The Nramp Family

MOLECULAR BIOLOGY INTELLIGENCE UNIT

Mathieu Cellier and Philippe Gros CELLIER • GROS MBIU

The Nramp Family

The Nramp Family

MOLECULAR BIOLOGY INTELLIGENCE UNIT

The Nramp Family Mathieu Cellier, Ph.D. Institut National de la Recherche Scientifique INRS-Institut Armand-Frappier Laval, Québec, Canada

Philippe Gros, Ph.D. Department of Biochemistry McGill University Montréal, Québec, Canada

LANDES BIOSCIENCE / EUREKAH.COM GEORGETOWN, TEXAS U.S.A.

KLUWER ACADEMIC / PLENUM PUBLISHERS NEW YORK, NEW YORK U.S.A.

To Mireille and Catherine

CONTENTS Preface ................................................................................................ xiii 1. Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1): A Key Player in Host Innate Immunity against Infections .................................................................. 1 Nada Jabado, Steven Lam-Yuk-Tseung, John R. Forbes and Philippe Gros Why Mouse Models? ............................................................................. 2 Nramp1: A Mouse Host Resistance Locus ............................................. 2 Pathogens Under Nramp1 Control ....................................................... 3 Nramp1 Gene and Protein Expression in Macrophages ......................... 4 The Nramp Gene Family ...................................................................... 4 Divalent Cation Transport by Nramp Proteins ..................................... 5 Nramp1 Dependent Divalent Cations Transport at the Phagosomal Membrane ........................................................... 6 Structure/Function Studies by Site Directed Mutagenesis ..................... 7 Divalent Cation Transport and Resistance to Infections ........................ 8 Nramp1 and Phagosomal Maturation ................................................... 9 2. Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals ..................................................... 16 Judith Caron, Danielle Malo, Christopher Schutta, Joe W. Templeton and L. Garry Adams Comparative Genomics ....................................................................... 17 Nramp1 .............................................................................................. 17 Chicken Genomics, Salmonella Infection and NRAMP1 ..................... 18 Bovine Genomics, Brucella abortus Infection and NRAMP1 ................ 21 3. The NRAMP Genes and Human Susceptibility to Common Diseases............................................................................ 29 Audrey Poon and Erwin Schurr NRAMP1 Gene Location and Structure .............................................. 30 NRAMP1 Polymorphisms ................................................................... 30 NRAMP1 Function ............................................................................. 32 NRAMP1 and Infectious Diseases Susceptibility .................................. 32 NRAMP1 and Autoimmune Diseases Susceptibility ............................ 36 NRAMP2 Location and Genomic Structure ........................................ 38 NRAMP2 Functions ............................................................................ 38 NRAMP2 Polymorphisms ................................................................... 38 NRAMP2 Polymorphisms and Human Diseases Susceptibility ............ 39

4. Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions .................................................................... 44 Luis F. Barrera and Martin Olivier Resistance to Three Pathogens Controlled by One Gene ..................... 45 Bcg/Lsh/Ity Gene Expression in Macrophage ........................................ 45 Bcg/Lsh/Ity Gene Pleiotropic Effects on Macrophage Functions ........... 45 Nramp, a Candidate Gene for Bcg/Lsh/Ity Gene ................................... 47 Impact of Nramp Gene Expression on Macrophage Signaling Activity and Functions Regulation ................................... 48 5. Role of Nramp Family in Pro-Inflammatory Diseases .......................... 53 Jenefer M. Blackwell, Hui-Rong Jiang and Jacqueline K. White Genetic Associations with Pro-Inflammatory Autoimmune Disease in Man ................................................................................ 54 Evidence for Gene x Environment Interactions? .................................. 54 Searching for the Functional Polymorphisms in SLC11A1 .................. 56 Relating Disease Phenotypes to Pleiotropic Effects of SLC11A1 .......... 57 A Direct Role for Iron in SLC11A1 Regulated Autoimmune Disease Phenotypes? ........................................................................ 58 Mouse Models to Study Slc11a1 Regulation of Pro-Inflammatory Diseases .......................................................... 59 6. Role of Nramp2 (DMT1) in Iron Homeostasis .................................... 65 Nancy C. Andrews Mammalian Iron Metabolism .............................................................. 65 Roles of Nramp2 (DMT1) in Iron Homeostasis .................................. 66 Nramp2 (DMT1) in Iron Disorders .................................................... 68 7. Molecular Physiology of the H+-Coupled Iron Transporter DMT1 .............................................................................. 73 Bryan Mackenzie and Matthias A. Hediger Molecular Mechanisms of DMT1 ....................................................... 73 Substrate Profile .................................................................................. 75 Structure-Function Analysis of DMT1 ................................................ 76 The Role of DMT1 in the Biology of Iron Transport .......................... 77 Multiple Splice Forms Reveal Discrete Expression Control Mechanisms ....................................................................... 77 DMT1 and Its Association with Human Disease ................................. 79 8. Cellular and Tissue Expression of Rat DMT1 / Nramp 2 .................... 82 Evan H. Morgan Gastrointestinal Tract .......................................................................... 84 Liver .................................................................................................... 86 Erythroid Tissue .................................................................................. 88 Brain ................................................................................................... 91 Kidney ................................................................................................ 92 Placenta ............................................................................................... 93

9. Tissue Distribution and Subcellular Localization of Nramp Proteins ............................................................................... 96 François Canonne-Hergaux and Philippe Gros NRAMP1: Discovery of The Nramp1 Gene ....................................... 96 Tissue and Cellular Expression of Mouse and Human Nramp1 mRNA .......................................................... 97 Cellular and Subcellular Expression of the Nramp1 Protein in Macrophages and in Neutrophils ................................................. 97 NRAMP2: Nramp2/DMT1 Gene, RNA and Protein Isoforms ........... 99 Topology Model of Nramp2/DMT1 Protein .................................... 100 Nramp2/DMT1: Ubiquitous and Cell Specific Expression ............... 101 Nramp2/DMT1 in Epithelial Cells ................................................... 104 Nramp2/DMT1 in Peripheral Tissues ............................................... 106 Nramp2/DMT1 Studies: Rich but Controversial Literature .............. 109 10. Plant Metal Transporters with Homology to Proteins of the NRAMP Family ....................................................................... 113 Sebastien Thomine and Julian I. Schroeder Genomic Analysis of the NRAMP Family in Plant Species ................ 114 Functional Characterization of NRAMP Metal Transport Properties in Heterologous Expression Systems ............................. 115 NRAMP Gene Expression Pattern and Regulation in Plants ............. 118 Analysis of NRAMP Functions in Plants ........................................... 119 Conclusions and Perspectives for the Analysis of Plant NRAMP Functions ....................................................................... 121 11. The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis ........................................................................ 124 Edward Luk, Laran Jensen and Valeria Culotta Historical Perspective: Why the Name SMF? .................................... 125 The Function of S. cerevisiae Smf1p .................................................. 125 Smf2p as a Manganese Transporter ................................................... 127 Smf3p as an Iron Transporter ............................................................ 127 Using Yeast as a Model to Study Nramp Metal Transport from Diverse Species ..................................................................... 129 Post-Translation Regulation of SMFs by Manganese ......................... 129 Transcriptional Regulation of SMF3 by Fe ........................................ 131 12. Metal-Ion Transporters: From Yeast to Human Diseases ................... 135 Adiel Cohen, Hannah Nelson and Nathan Nelson Discovery of the Yeast Smf1p as a Metal-Ion Transporter Revealed that Metal Ions Function through NRAMP in Resistance and Sensitivity to Bacterial Infection ........................ 136 A Glimpse into the Mechanism of Metal-Ion Uptake ........................ 139 Expression of Heterologous Metal-Ion Transporters in Yeast Cells ................................................................................. 141 The Involvement of NRAMP in Diseases .......................................... 142

13. Regulation of Bacterial MntH Genes ................................................. 146 John D. Helmann Mycobacterium tuberculosis ................................................................. 147 Bacillus subtilis ................................................................................... 147 Staphylococcus aureus .......................................................................... 148 Escherichia coli and Salmonella enterica serovar Typhimurium ........... 150 14. Manganese and Iron Transport by Prokaryotic Nramp Family Transporters ....................................... 154 Krisztina M. Papp, David G. Kehres and Michael E. Maguire Nramp Proteins in Prokaryotes ......................................................... 155 Physiological Cation Transport ......................................................... 161 Transport Mechanism ....................................................................... 162 Regulation of MntH ......................................................................... 163 Other Mn2+ Transporters ................................................................... 163 Mn2+ in Pathogenesis ......................................................................... 165 15. Role of the Nramp Orthologue, MntH, in the Virulence of Mycobacterium tuberculosis ............................................................ 172 Pilar Domenech and Stewart T. Cole M. tuberculosis Is an Intracellular Pathogen ........................................ 172 Murine Nramp1 and the M. tuberculosis Phagosome ......................... 173 M. tuberculosis MntH Is Constitutively Expressed ............................. 173 M. tuberculosis MntH Protein As a Cation Transporter ..................... 174 Role of the M. tuberculosis MntH Protein in Virulence ...................... 174 16. Molecular Evolutionary Analysis of the Nramp Family ...................... 178 Etienne Richer, Pascal Courville and Mathieu Cellier Early Gene Duplication in Eukaryotes Gave the Outparologs ‘Prototype’ and ‘Archetype’ Nramp ..................... 179 Characterization of Bacterial Nramp Orthologs: MntH A and B .............................................................................. 182 Study of MntH Xenologs: MntH Cα, Cβ, Cγ .................................. 183 Proposed Evolutionary Pathway of Bacterial Nramp Genes ............... 189 Significance and Implications in the Context of Bacterial Infection ..................................................................... 191 Index .................................................................................................. 195

EDITORS Mathieu Cellier, Ph.D. Institut National de la Recherche Scientifique INRS-Institut Armand-Frappier Laval, Québec, Canada Chapter 16

Philippe Gros, Ph.D. Department of Biochemistry McGill University Montréal, Québec, Canada Chapter 1, 9

CONTRIBUTORS L. Garry Adams Department of Veterinary Pathobiology College of Veterinary Medicine Texas A&M University College Station, Texas, U.S.A. [email protected]

François Canonne-Hergaux Faculté de Médecine Xavier Bichat INSERM, Genetic and Molecular Pathology of Hematopoiesis Paris, Cedex, France [email protected]

Chapter 2

Chapter 9

Nancy C. Andrews Division of Hematology and Oncology Children’s Hospital Boston Boston, Massachusetts, U.S.A. [email protected]

Judith Caron Department of Human Genetics McGill University Health Center Center for the Study of Host Resistance Montréal General Hospital Montréal, Québec, Canada

Chapter 6

Chapter 2

Luis F. Barrera Facultad de Medicina Universidad de Antioquia Medellin, Colombia Chapter 4

Jenefer M. Blackwell Cambridge Institute for Medical Research University of Cambridge Cambridge, U.K. [email protected] Chapter 5

Adiel Cohen Department of Biochemistry George S. Wise Faculty of Life Sciences Tel Aviv University Tel Aviv, Israel Chapter 12

Stewart T. Cole UGMB Institut Pasteur Paris, Cedex, France [email protected] Chapter 15

Pascal Courville INRS-Institut Armand-Frappier Laval, Québec, Canada Chapter 16

Nada Jabado Department of Pediatrics Montreal Children’s Hospital McGill University Montréal, Québec, Canada

Valeria Culotta Departments of Environmental Health Sciences, Biochemistry and Molecular Biology Division of Toxicological Sciences Bloomberg School of Public Health Johns Hopkins University Baltimore, Maryland, U.S.A. [email protected]

Chapter 1

Chapter 11

Chapter 11

Pilar Domenech TBRS, LIG, NIAID Rockville, Maryland, U.S.A. [email protected]

Hui-Rong Jiang Cambridge Institute for Medical Research University of Cambridge Cambridge, U.K.

Chapter 15

Laran Jensen Departments of Environmental Health Sciences, Biochemistry and Molecular Biology Bloomberg School of Public Health Johns Hopkins University Baltimore, Maryland, U.S.A.

Chapter 5

John R. Forbes Department of Biochemistry McGill University Montréal, Québec, Canada Chapter 1

Matthias A. Hediger Membrane Biology Program and Renal Division Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts, U.S.A. [email protected]

David G. Kehres Department of Pharmacology School of Medicine Case Western Reserve University Cleveland, Ohio, U.S.A. Chapter 14

Steven Lam-Yuk-Tseung Department of Biochemistry McGill University Montréal, Québec, Canada Chapter 1

Chapter 7

John D. Helmann Department of Microbiology Cornell University Ithaca, New York, U.S.A. [email protected] Chapter 13

Edward Luk Departments of Environmental Health Sciences, Biochemistry and Molecular Biology Bloomberg School of Public Health Johns Hopkins University Baltimore, Maryland, U.S.A. Chapter 11

Bryan Mackenzie Membrane Biology Program and Renal Division Brigham and Women’s Hospital Harvard Medical School Boston, Massachusetts, U.S.A. Chapter 7

Michael E. Maguire Department of Pharmacology School of Medicine Case Western Reserve University Cleveland, Ohio, U.S.A. Chapter 14

Danielle Malo Department of Human Genetics and Medicine McGill University Health Center Center for the Study of Host Resistance Montréal General Hospital Montréal, Québec, Canada [email protected]

Martin Olivier Departments of Medicine, Microbiology and Immunology McGill University Health Centre Research Institute Centre for the Study of Host Resistance Montréal, Québec, Canada [email protected] Chapter 4

Krisztina M. Papp Department of Pharmacology School of Medicine Case Western Reserve University Cleveland, Ohio, U.S.A. [email protected] Chapter 14

Audrey Poon McGill University Health Centre Research Institute Montréal General Hospital Montréal, Québec, Canada

Chapter 2

Chapter 3

Evan H. Morgan Department of Physiology School of Biomedical and Chemical Sciences University of Western Australia Crawley, Western Australia, Australia [email protected]

Etienne Richer INRS-Institut Armand-Frappier Laval, Québec, Canada [email protected]

Chapter 8

Hannah Nelson Department of Biochemistry George S. Wise Faculty of Life Sciences Tel Aviv University Tel Aviv, Israel

Chapter 16

Julian I. Schroeder Cell and Developmental Biology Section Division of Biology Center for Molecular Genetics University of California, San Diego La Jolla, California, U.S.A. [email protected] Chapter 10

Chapter 12

Nathan Nelson Department of Biochemistry George S. Wise Faculty of Life Sciences Tel Aviv University Tel Aviv, Israel [email protected] Chapter 12

Erwin Schurr McGill University Health Centre Research Institute Montréal General Hospital Montréal, Québec, Canada [email protected] Chapter 3

Christopher Schutta Department of Veterinary Pathobiology College of Veterinary Medicine Texas A&M University College Station, Texas, U.S.A.

Sebastien Thomine Institut des Sciences du Vegetal Gif-sur-Yvette, Cedex, France [email protected] Chapter 10

Chapter 2

Joe W. Templeton Department of Veterinary Pathobiology College of Veterinary Medicine Texas A&M University College Station, Texas, U.S.A. Chapter 2

Jacqueline K. White Cambridge Institute for Medical Research University of Cambridge Cambridge, U.K. Chapter 5

PREFACE A genetic component for susceptibility to typhoid first came to light in mice following the development of inbred mouse strains. The pioneering work of Webster, Schott, and others in the 1920s and 1930s identified important differences in the survival of inbred strains to a lethal challenge with Salmonella. This laid the groundwork for subsequent genetic analyses that demonstrated that susceptibility to S. typhimurium was indeed under simple genetic control in mice. In the early 1980s, a major locus controlling S. typhimurium replication in vivo was mapped to the proximal portion of mouse chromosome 1 and was designated Ity. Ity appeared not only to control bacterial replication in target tissues and survival in the context of an acute infection, but also appeared to affect the ability of mice to mount a protective immune response following vaccination with avirulent isolates. Independently, it was discovered that Lsh, a locus responsible for controlling the replication of Leishmania donovani in liver, also maps to the vicinity of Ity and studies in recombinant inbred mouse strains suggested that they were indeed the same locus. Finally, while studying the genetic control of replication of small inoculum of avirulent Mycobacteria (M. bovis, BCG) in spleen of inbred strains, we mapped a locus (Bcg) to the same region of chromosome 1. Similarities in phenotypic expression of resistance/susceptibility in the three infection models together with common map locations suggested that Ity, Lsh and Bcg were most likely the same gene affecting the replication of unrelated intracellular infectious agents. Studies in vivo and studies in explanted cell populations ex vivo showed that the macrophage was the cell type affected by Ity/Lsh/Bcg, and it was proposed that the locus probably regulates an important bacteriostatic or bactericidal function of these cells towards antigenically and taxonomically unrelated intracellular pathogens. In the early 1990s, the locus was isolated by positional cloning. The gene was identified on the basis of its genetic and physical location, the specific expression of its mRNA in macrophages and the presence of sequence polymorphism associated with susceptibility to infection in inbred strains. The gene was designated Nramp1 for “Natural Resistance Associated Macrophage Protein 1”and was found to encode a predicted hydrophobic peptide possibly corresponding to an integral membrane protein. This book picks up the story from there. It summarizes recent work by several laboratories on the characterization of the Nramp1 protein (recently re-named Slc11a1) and of the role it plays in resistance to infection and in macrophage function, including its biochemical mechanism of action. It also explores the function of the close mammalian homolog Nramp2 (also named Divalent Metal Transporter1, DMT1 and Slc11A2) and the critical role it performs in iron metabolism. This book further contains a series of chapters that illustrate the astonishing degree of conservation of this protein family throughout evolution and that analyze the role of these proteins in divalent metals metabolism not only in mammals but also in plants, fungi and bacteria.

The mouse Nramp1 protein is expressed at the membrane of lysosomes and late endosomes of macrophages and is targeted to the membrane of phagosomes soon after phagocytosis. The proposed functions of Nramp1 at the phagosomal membrane are reviewed along with the substrates and proposed mechanisms of transport at that site. The effect of Nramp1 transport on the ability of internalized bacteria to influence their intracellular fate in mouse macrophages is also addressed (Chapter 1). Comparative genomic approaches have led to the characterization of the NRAMP1 orthologs in farm animals and have provided evidence that these genes contribute to host resistance to bacterial infections (Chapter 2). In humans, polymorphic variants within or near the human NRAMP1 ortholog have been identified and have been found associated with susceptibility to infections such as tuberculosis and leprosy both in regions of endemic disease and in the outbreak situation (Chapter 3). Likewise, certain NRAMP1 polymorphisms have been associated with certain inflammatory conditions, related to the pleitotropic effects of Nramp1 on macrophage functions (Chapter 4), and to pro-inflammatory responses typical of human pathologies (Chapter 5). Vertebrates also possess a closely related homolog Nramp2 gene that was initially identified by cross hybridization. Nramp2 turned out to be a key protein in iron metabolism that has been extensively studied. Much of what we now understand about Nramp1 is derived in part from parallel studies of Nramp2. Nramp2 protein mediates transferrin-independent iron uptake at the intestinal brush border but is also responsible for transport of transferrin-iron across the membrane of acidified endosomes in peripheral tissues. A mutation in Nramp2 (Dmt1) was shown to be responsible for microcytic anemia in the mk mouse and in the Belgrade rat which were identified in the 1960s as animals with natural and radiation-induced erythroid defects (Chapter 6). Based on differential expression in the proximal intestine in response to iron deprivation, Nramp2 mRNA was functionally cloned and characterized in Xenopus oocytes as a pH-dependent iron uptake system (Chapter 7). Much work has been done to characterize the organ, cellular and sub-cellular distribution of Nramp2 mRNA transcripts and proteins, along with their regulation by iron in normal and mutant animals (Chapter 8). The transport function of Nramp2 in iron metabolism and its role in the iron regulatory networks of the body will also be reviewed with special emphasis on the tissue, cellular and subcellular localization of Nramp 2 protein compared to Nramp1 (Chapter 9). A great diversity of organisms express conserved Nramp homologs. In all the species where they have been studied, Nramp homologs were shown to function as pH-dependent divalent metal transporters, indicating that the remarkable sequence conservation throughout evolution reflects both Nramp substrate ubiquity and similar transport function. Green plants in-

cluding Arabidopsis thaliana possess several Nramp homologs. Plant Nramps are involved in metal uptake from soil, distribution to other tissues and subcellular metabolism; their number provided the opportunity to compare substrate specificities and regulation of expression by different environmental metal conditions (Chapter 10). There exist three homologs in the yeast Saccharomyces cerevisiae (named SMF1, 2 and 3) that have complementary roles in manganese and iron homeostasis, based on the elucidation of their subcellular localization and metal-dependent regulation of expression (Chapter 11). The first hints of Nramp protein family function came from the study of yeast Smf genes. Initially identified as high-copy suppressors of the mitochondrial import factor mif mutants (smf ), the SMF1 and 2 proteins were shown to mediate uptake of divalent metals in yeast cells and have been studied by electrophysiology in Xenopus oocytes (Chapter 12). The functional conservation in the Nramp family is illustrated in eukaryotes by the fact that mammalian and plant Nramp proteins can complement yeast smf mutants. Last but not least, increasing numbers of Nramp-related genes (encoding proton-dependent manganese transporters, MntH) have been identified in a substantial fraction of genomes of Bacteria (vs. Archaea) which sequence have recently become available. The bacterial sequences belong to three phylogenetic groups; MntH homologs from groups A and C have been functionally characterized in their respective hosts. Their mechanisms of regulation by metal availability will be reviewed (Chapter 13); transport properties of MntH A proteins and their possible impact in virulence for a mammalian host have been analyzed in selected Gram negative (Chapter 14) and Gram positive bacteria (Chapter 15). MntH groups differ in both their taxonomic and phylogenetic patterns, including intriguing examples of horizontal transmission and resemblance to eukaryotic Nramp. These studies suggest an evolutionary pathway for the emergence of eukaryotic Nramp in possible relation to host defense (Chapter 16). Mathieu Cellier Philippe Gros

CHAPTER 1

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1): A Key Player in Host Innate Immunity against Infections Nada Jabado, Steven Lam-Yuk-Tseung, John R. Forbes and Philippe Gros

Abstract

N

ramp1 is one of the few host resistance genes that have been well characterized at the molecular and functional level. This protein is an integral transmembrane protein expressed in the lysosomal compartment of phagocytic cells and is recruited to the phagosomal membrane where it affects pathogen replication. Nramp1 is part of a large gene family conserved through evolution that codes for divalent cation transporters. In this chapter, we will summarize studies carried out on this gene in the mouse model, and will review recent work on the protein and its mechanism of action at the membrane of phagosomes formed in phagocytes. We propose that Nramp1 is a pH-dependent divalent cation efflux pump at the phagosomal membrane. It affects microbial replication by modulating divalent cation content in the phagosomal space.

Introduction Infectious diseases remain a major health problem worldwide, accounting for 33% of world mortality. The spreading of Human Immunodeficiency Virus (HIV) made tuberculosis and other mycobacterial infections undergo a dramatic comeback in many western as well as in third world countries and it is estimated that one-third of the world’s population is infected with Mycobacterium tuberculosis. The widespread emergence of multi-drug resistance in these mycobacterial infections, as in almost all infectious diseases, has increased the severity of this health problem and has prompted the search for alternative strategies for intervention. It is widely recognized that genetic factors are important in the response to infectious diseases and that, in the majority of infections, only a proportion of individuals exposed to the same pathogen will develop a clinically active disease. For example, in tuberculosis only around 10% of individuals who become infected will in fact develop clinical disease. These individual differences in susceptibility are influenced both by environmental factors, in particular those affecting exposure and virulence status of the bacterium, but also host-derived such as genetic predisposition, and type, and efficiency of immune response. On the pathogen side, microbes have developed sophisticated virulence mechanisms to either block or subvert normal host cellular processes contributing to increased pathogenicity. Identification of genes/proteins involved in host defense mechanisms or in increased microbial pathogenicity will likely improve our understanding of infectious diseases and may provide much needed novel targets for pharmacological intervention. Nramp1 is one of at least 11 genes/loci identified to date and affecting host susceptibility/resistance to mycobacterial infections.1 This gene plays a pivotal role in macrophage function, and the mechanism of action of the encoded protein is now fairly The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

The Nramp Family

2

well understood. Here, we will summarize studies carried out on this gene in the mouse model, and will review recent work on the protein and its mechanism of action at the membrane of phagosomes formed in phagocytes.

Why Mouse Models? Although a genetic component for susceptibility to infectious diseases such as tuberculosis and leprosy has been well-established in humans,2 the study of individual genes involved is difficult due to the multifactorial nature of disease susceptibility, the complexity of the genetic control, the intrinsic heterogeneity of human populations, and the difficulty of obtaining repeated biological samples for in vitro analysis.3 In addition, variations in pathogen-specific virulence determinants that ultimately reveal host susceptibility, further complicate genetic analyses in humans. Such complex interactions can be teased out (including the identification of relevant genes) in appropriate animal models of infections where the basic pathophysiology of the human disease is respected in the animal host. The laboratory mouse is the experimental model of choice for this type of genetic analysis for the following reasons: 1. Large numbers of well characterized and carefully maintained inbred, recombinant inbred and mutant stocks are available to study disease genes. 2. Mouse is the best genetically characterized mammal with high-density coverage of informative markers for linkage studies. 3. Informative segregating animals can be generated easily and quickly in big numbers. 4. A complete transcript map and genome assembly are available. 5. Candidate genes can be targeted for inactivation in the germ line by homologous recombination, and gain-of-function alleles can be created by reintroducing normal variants on mutated background either as single genes or as group of genes clustered on BAC clones (functional complementation in vivo).

Nramp1: A Mouse Host Resistance Locus In the early 70’s, the first reports describing a mouse locus possibly controlling intracellular replication of taxonomically different pathogens appeared in the literature. A survey of inbred mouse strains showed that they segregated into 2 groups, being either resistant (i.e., with an LD100>104-105 bacteria) or susceptible (i.e., with an LD100<100 bacteria) to Salmonella typhimurium infection, and that this trait was controlled by a single locus termed Ity.4 Parallel experiments showed that Ity was either allelic or tightly linked to Lsh, a locus that similarly controls replication of Leishmania donovani in mouse tissues.5 Finally, another locus Bcg which controls replication of several mycobacteria in vivo was also mapped to the same region.5-8 Resistance behaved in all cases as a dominant trait encoded by a single gene, Bcg/Ity/Lsh, mapping to proximal mouse chromosome 1. It was subsequently demonstrated that the genetic advantage of resistant strains was phenotypically expressed as the ability to restrict intracellular replication of these infectious agents in mature tissue macrophages. Positional cloning was used to isolate the Bcg/Lsh/Ity locus.6 The minimal genetic and physical intervals for the gene were defined and transcription units were isolated from the interval by exon amplification. Among six genes identified, one encoded an mRNA expressed exclusively in the spleen and in the liver and enriched in macrophage populations extracted from these organs. This mRNA was predicted to encode a highly hydrophobic integral trans-membrane protein with a structure reminiscent of a transporter or an ion channel. This gene was named Nramp1 (OMIM No 600266; now classified as Slc11a1, but further referred to here as Nramp1). Subsequent data unambiguously established Nramp1 as the Bcg/Lsh/Ity gene involved in host resistance to infections: Sequence analysis of Nramp1 from 27 inbred mouse strains revealed that susceptibility to infections is associated with a single Gly169Asp substitution in predicted trans-membrane (TM) 4 (Fig. 1) of the protein.6,7 Likewise, a null mutation at Nramp1 introduced by homologous recombination in embryonic stem cells abrogates the resistance of normally resistant 129sv mouse strain.8 Conversely, introduction of Nramp1Gly169 genomic DNA into mice of an Nramp1Asp169 genetic background restores resistance to infections.9

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

3

Figure 1. Predicted structural features of Nramp1.

Importantly, an Nramp1 homologue was cloned in humans10 and was subsequently shown to be associated with resistance to infections with a variety of intracellular pathogens (see related chapter in this book) confirming the importance of this gene in host immune defenses.

Pathogens Under Nramp1 Control Nramp1 (Bcg) was identified as the gene affecting splenic replication of the Bacillus Calmette-Guerin (BCG) vaccine strain of Mycobacterium bovis.11 Bcg was also shown to control intracellular replication of Mycobacterium lepraemurium12 in vivo, and Mycobacterium intracellulare13 and Mycobacterium avium14 in macrophages ex vivo. Surprisingly, Nramp1 inactivation does not seem to affect resistance of mice to in vivo infection with H37rv Mycobacterium tuberculosis the causative agent of pulmonary tuberculosis in humans.15-17 These studies are in apparent contrast to the human situation where polymorphic variants at NRAMP1 show a protective role in tuberculosis. This apparent paradox may be linked to differences between the experimental model of tuberculosis in the mouse (low or high doses, i.v), and the natural human situation (low doses, aerosol). Finally, additional studies have shown that Ity/Lsh/Bcg affects replication of not only S. typhimurium, L. donovani, and several Mycobacteria, but also of a variety of ovine18 and avian19 strains of Salmonella, as well as Brucella abortus,20 Pasteurella

4

The Nramp Family

pneumotropica,21 and Candida albicans (reviewed in 22). Interestingly, Ity/Lsh/Bcg alleles also seem to affect susceptibility to infection with Toxoplasma gondii,23,24 and Francisella tularensis,25,26 although in these cases, the susceptibility allele at Ity/Lsh/Bcg is associated with increased resistance. Finally, in vivo or in vitro replication of other pathogens such as Chlamydia, Legionella, Listeria, Pseudomonas, Bacillus subtilis, and Staphylococcus aureus is not affected by Ity/Lsh/Bcg alleles.21,27-29

Nramp1 Gene and Protein Expression in Macrophages The Nramp1 gene has 15 exons and spans 11.5 kb, with 8 of the 12 TM domains of the protein being encoded by individual exons.30 A consensus transport motif is encoded by exon 11, and the extracellular domain containing the 2 predicted Asn-linked glycosylation signals is encoded by exon 10. The gene has several transcription initiation sites (-90 and –140nt), and shows several consensus sites for binding of transcription factors associated with constitutive and inducible gene expression in macrophages30 (see other chapter in this book). In mice, Nramp1 mRNA is expressed in primary macrophages and in granulocytes, and its expression can be further induced by lipopolysaccharide (LPS) and interferon γ (INFγ).31 Human NRAMP1is strongly expressed in polymorphonuclear leukocytes; Monocytes express NRAMP1 at a lower level, and migration of immature macrophages to tissue is associated with an increase in NRAMP1 expression.32 Parallel studies in the promyelocytic leukemia HL-60 shows that differentiation into either monocytes/macrophages or granulocytes is associated with strong induction of NRAMP1 mRNA.32 Nramp1 encodes a 90- to 100-kDa integral membrane protein (Fig. 1) which is extensively glycosylated (up to 50% of its mass) and phosphorylated in macrophages.7 It contains 12 hydrophobic trans-membrane regions, a heavily glycosylated extracellular loop, several phosphorylation sites including 3 putative protein kinase C phosphorylation sites, a Src homology 3 (SH3) binding region, and a consensus transport signature.33,34 Immunolocalization studies show that Nramp1 is restricted to the Lamp1-positive late endosomal/lysosomal compartment of macrophages.35 It is rapidly recruited after phagocytosis to the phagosomal membrane of phagosomes containing inert particles such as latex beads or zymosan35,36 or live bacteria such as Salmonella, Yersinia, Leishmania or Mycobacterium avium.37,38 Kinetics of Nramp1 recruitment to the phagosomal membrane are similar to those of Lamp1 but are clearly distinct from those of the early endosomal marker Rab 5.35 In human neutrophils, subcellular fractionation studies show that Nramp1 is present in the tertiary, gelatinase-positive, granules suggesting that it can not only be targeted to the phagosomal membrane but can also be present at the plasma membrane upon degranulation.39 These findings suggest that Nramp1 acts by altering microbicidial properties of the phagosome.

The Nramp Gene Family Nramp1 defines a family of proteins highly conserved throughout evolution and the study of such homologs has provided important clues on the mechanism of action of the mammalian protein(s) (see other chapters in this book). In humans and rodents, a second Nramp gene was cloned.39 Nramp2 (OMIM No 600523, formerly designated as DMT1 or DCT1, now designated as Slc11a2 but referred to in this work as Nramp2) encodes a protein that is highly homologous (Fig. 1) to Nramp1 (78% identity)(see below).33,40 Highly conserved Nramp homologs have been identified in Zebrafish (73% identity),41 Drosophila melanogaster (70% identity), Caenorhaditis elegans (68% identity), Saccharomyces cerevisiae (SMF 1,2 and 3, 40-45% identity), Escherichia coli, Mycobacterium leprae and tuberculosis (MntH, 37% identity), plants (OsNramp family, 50-60% identity) and other organisms (reviewed in 42,43). The degree of similarity is remarkable and suggests a common mechanism of action preserved through evolution. Extensive computer assisted analysis of sequences from the Nramp family identified key secondary structural features conserved in these proteins.33,44 The most obvious feature is the presence of a highly conserved hydrophobic core. The core encodes 10 TM segments and contains several invariant charged residues in a thermodynamically unfavorable setting

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

5

Table 1. Some Nramp homologs* % Identity to mNramp1 Substrate(s)†

Organism

Protein

Mouse

Nramp1 Nramp2

100 78

Human

NRAMP1

79

NRAMP2

79

Nramp1

87

Dog

Mutant Phenotype

Mn2+, Fe2+ Susceptibility to infection6 Fe2+, Mn2+, Zn2+, Co2+ Microcytic Anemia Cu2+, Cd2+, Ni, Pb ND Susceptibility to infection/ autoimmune diseases2,18,70 Fe2+, Mn2+, Zn2+, Co2+ Unknown Cu2+, Cd2+, Ni, Pb ND Susceptibility to leishmania5

M. tuberculosis Mramp

30

Mn2+, Co2+, Cu2+, Cd2+ No growth on EGTA/ AlkalinepH43 Mn2+, Co2+, Cu2+, Cd2+ No growth on EGTA/ AlkalinepH ND Fe2+, Mn2+ Mn2+, Fe2+, Zn2+, No growth on metal chelators56 Cd2+, Ni2+ Mn2+, Fe2+, Zn2+, Cu2+ ND57

Zebrafish cdy/Nramp2 Drosophilia malvolio melanogaster Arabidopsis At-Nramp 1,2,3,4,5,6 Thaliana EIN2-Nramp

73 70

Fe2+ Fe2+, Mn2+

28

Fe2+, Cd2+, Mn2+

Chardonnay (iron deficiency)41 Malvolio, behavioral54 taste defect ND42

21

Unknown

Triple response to ethylene

S. cerevisiae Smf1 (Baker's yeast) Smf2

E. colio

Smf3 MntH

42 43 45 37

*This table shows only Nramp homologs for which there is published data on potential transport substrate or a mutant phenotype. †Substrate in bold appears to be preferred substrate for transport. oSee other chapter in this book for complete review of bacterial transporters.

(Fig. 1). A striking helical periodicity of sequence conservation is also noted in TM segments, suggesting a conserved (hydrophilic/polar) and nonconserved (hydrophobic/neutral) face of several amphipatic TM helices. Interestingly the G169D mutation associated with susceptibility to infection in mice, introduces a charge in a predicted lipid accessible face of TM4. Finally, a consensus transport signature (known as BPDTSIMCS) is present on the cytosolic side of the membrane between TM8 and TM9. This motif resembles a highly conserved region important for the formation of permeation pathways in animal voltage-gated K+ channels.45 These unique features (transport motif and charged residues) strongly suggest that the Nramp gene family is a family of membrane transporters.

Divalent Cation Transport by Nramp Proteins The mechanism of transport and substrate of Nramp proteins has been established for several members of the family (see other chapters in this book). In mammals, Nramp2 was the first to yield its secret. The tissue, cellular and subcellar localization of Nramp2 at the plasma membrane and in recycling endosomes37-39,46,47 is reviewed in details elsewhere in this book. In Xenopus laevis oocytes, Nramp2 was shown to mediate electrogenic (H+ cotransport) of Fe2+, Mn2+, Zn2+ and other divalent cations excluding Ca2+ and Mg2+ (Table 1)48,49(see other chapters in this book). This transport was pH-dependent and maximum at pH5.5. In cultured

6

The Nramp Family

mammalian cells, including CHO cells overexpressing cMyc-tagged Nramp2, similar transport properties were observed.49 A mutation (G185R) at Nramp2 causes microcytic anemia and iron deficiency in the mk mouse and the Belgrade (b) rat,50,51 a pathology associated with decreased iron uptake in the duodenum, and impaired iron metabolism in peripheral tissues.52 Nramp2 is believed to function as the major transferrin-independent iron uptake system at the intestinal brush border, and also transports transferrin iron across the membrane of acidified endosomes. In yeast, Nramp homologs SMF1 and SMF2 have been shown to transport Mn2+ but also Cd2+, Cu2+ and Co2+ while SMF3 transport mostly Fe2+43. Mammalian Nramp2 but not Nramp1 expression in a double SMF1/2 mutant restores the ability of this mutant to grow on a medium containing either metal chelators (EGTA) or alkaline pH.53 The fruit fly Nramp homologue, malvolio, is expressed primarily in the brain, and mutations at this locus cause a sensory-neuron defect in taste discrimination. Mutant phenotype can be corrected by dietary Fe2+ or Mn2+ and by expressing mammalian Nramp1 in malvolio transgenic flies.54 Finally, a number of bacterial homologs have been identified and functionally characterized as pH-dependent metal transporters42,55-57 (see other chapters in this book). Together these studies demonstrate both structural and functional conservation in this family of a pH-dependent, divalent cations transport function.

Nramp1 Dependent Divalent Cations Transport at the Phagosomal Membrane The above mentioned studies suggested that Nramp1 transports divalent cations at the phagosomal membrane, this activity influencing microbial survival and/or replication at that site. However, the mechanism, substrate specificity and direction of transport of Nramp1 at the phagosomal membrane with respect to protein topology and polarity of pH gradient still remain the subject of controversy (reviewed in 58). Dietary iron loading of Bcgr (for resistant) mice was found to increase Mycobacterium avium replication in vitro.59 This observation was interpreted as excess iron overcoming the advantage provided by Nramp1 in these mice, indirectly suggesting that Nramp1 mediated iron transport is important for efficient anti-mycobacterial host defenses. Conversely, Zwilling et al reported that addition of extracellular iron over a very narrow concentration range (0.005-0.05 µM) inhibited intracellular M. avium replication in Bcgr macrophages whereas it stimulated growth in Bcgs macrophages.60 The addition of iron at concentrations >0.05µM resulted in stimulation of mycobacterial growth in both resistant and susceptible macrophages. These authors concluded that under certain conditions iron can stimulate the anti-mycobacterial defenses of macrophages. Transport studies with radioisotopic 55Fe2+, performed by the same group, using intact cells or isolated phagosomes containing either Latex beads or live M. avium have suggested that Nramp1 may transport iron into phagosomes.61,62 Nramp1 activity was dependent on acidic lysosomal pH, and was inhibited by an antiserum directed against the proposed glycosylated loop of Nramp1 defined by the TM5 to TM6 interval.62 In these studies, RAW cells transfected with Nramp1G169 also showed increased production of hydroxyl radicals prompting the authors to propose a model in which Nramp1 would transport iron into the phagosome to increase hydroxyl radical production via the Haber-Weiss/Fenton reaction. Recent electrophysiology studies detected small, concentration, and voltage-dependent Zn2+-induced inward currents (at pH 7.5) in Nramp1 vs. water-injected Xenopus oocytes.63 Experiments with isotopic Zn2+ detected Nramp1-stimulated metal uptake at pH 9.0 but not at pH 7.5, while at pH 5.5 Nramp1-injected oocytes accumulated less radioisotopic Zn2+ than water controls. The authors suggested a model by which Nramp1 would function by a pH-dependent antiport mechanism, transporting cytoplasmic divalent-metals into the phagosome against a proton gradient. Interestingly, the Zn2+-dependent current detected in Nramp1-oocytes by electrophysiology were only seen at pH 7.5, a pH at which no Nramp1-dependent radioisotopic Zn2+ transport could be detected.63 Although mechanistically appealing, both studies raise some important issues. First, Nramp1

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

7

transport would have to be in the opposite direction to that of Nramp2 with respect to the topological orientation of the two proteins in the membrane and with respect to the pH gradient, with Nramp1 acting as a metal/proton antiporter as opposed to a metal/proton cotransporter. Although possible, the close structural similarity between Nramp1 and Nramp2 would argue against drastically distinct mechanisms of action of the 2 proteins. Also, in these studies phagosomal iron association was clearly increased however, authors did not distinguish between binding and active transport of ligand. In addition, iron is an essential element for mycobacterial growth in vitro and in vivo, enhancing growth of the pathogen in infected mice and promoting development of active tuberculosis and other intracellular pathogens in humans.59,64 Therefore, an anti-microbial effect based on iron delivery to the phagosome appears somewhat counter-intuitive. Two other methods were used by another group to monitor divalent cation fluxes by Nramp1; conclusions from these studies were that Nramp1 acts as a divalent cation efflux pump at the phagosomal membrane. The first study monitored metal transport in and out of individual phagosomes in live primary macrophages in situ and analyzed in real time.36 Fura-FF6-triethylester (fura-FF6) fluorescence is fairly pH-insensitive but can be efficiently quenched by divalent metals including Mn2+. Fura-FF6 was chemically coupled to porous, water-filled, zymosan particles which were phagocytozed by Nramp1-positive and Nramp1-negative macrophages, and the effect of extracellularly added Mn2+ ions on fluorescence quenching of intracellular phagosomes was monitored in real time. It was observed that Nramp1-positive phagosomes accumulated less Mn2+ than Nramp1-negative ones. Parallel experiments with Fura-FF6 zymosan particles prequenched with Mn2+ ions suggested that Nramp1-positive phagosomes could efflux Mn2+ ions more efficiently than their Nramp1-negative counterparts. Elimination of the pH gradient across the phagosomal membrane by treatment with the vacuolar H+-ATPase inhibitor bafilomycin abrogated both of these activities. This study suggested that Nramp1 may function as a pH-dependent divalent cation efflux pump at the phagosomal membrane by a mechanism similar to that of Nramp2-mediated iron transport across the membrane of acidified endosomes, and which is impaired in reticulocytes from mk mice.39 In a more recent study, an Nramp1 protein modified by insertion of a haemagglutinin epitope (HA) into the predicted TM7/8 loop was expressed at the plasma membrane of CHO cells as demonstrated by immunofluorescence and surface biotinylation.80 Experiments in Nramp1HA transfectants using the metal-sensitive fluorophors Calcein and Fura2 showed that Nramp1HA expression at the plasma membrane could stimulate uptake of Co2+, Mn2+, and Fe2+. Nramp1HA transport was time, temperature, pH-dependent, and occurred down a proton gradient. Similar results were obtained in transport studies using radioisotopic 55Fe2+ and 54Mn2+. Both studies clarify the mechanism by which Nramp1 contributes to phagocyte defenses against infections and clearly indicate pH-dependent divalent cation extrusion from phagosomal space.

Structure/Function Studies by Site Directed Mutagenesis

In one study,65 structure-function relationships in the Nramp super family were studied by mutagenesis, followed by functional characterization in yeast and in mammalian cells. Multiple sequence alignments were used to identify highly conserved residues in the Nramp-superfamily TM domains possibly involved in substrate transport and pH regulation. Three negatively charged and highly conserved residues in transmembrane domains (TM) 1, 4, and 7 were identified as essential for cation transport by Nramp-superfamily members including Nramp2. These residues were mutated in the backbone of Nramp2 and corresponding mutants were tested in yeast and mammalian cells. The introduction of a charged residue (G185R) in TM4 found in the naturally-occurring microcytic anemia mk (mouse) and Belgrade (rat) mutants was shown to cause a partial or complete loss of function in mammalian and yeast cells, respectively. A pair of mutation-sensitive and highly conserved histidines (H267, H272) was identified in TM6. Surprisingly, inactive H267 and H272 mutants could be rescued by lowering the pH of the transport assay. This indicated that H267/H272 are not di-

8

The Nramp Family

rectly involved in metal binding but rather they play an important role in pH regulation of metal transport by Nramp proteins. Other studies by our group (S. Lam-Yuk-Tseung and P.Gros, personnal communication) and others66 show that Nramp2 mediated transport in transfected cells is sensitive to the action of the histidine-specific reagent diethyl pyrocarbonate (DEPC) further confirming the importance of these residues in metal transport. Mammalian Nramp show specific subcellular localization despite extensive protein homology. Distinct targetting signals present in the cytosolic C- and N-termini of both Nramp1 and Nramp2 (see corresponding chapter for Nramp2) may account for this specific sub-cellular distribution. Nramp1 has a YXXφ (φ: hydrophobic bulky amino-acids) motif in its N-terminal cytosolic domain, which has been shown to be important in clathrin mediated endosomal sorting,67 and a YXLXX motif in its C-terminal cytosolic domain, which has been recently implicated for endosomal targeting in Nramp2.68

Divalent Cation Transport and Resistance to Infections A large body of published data indicates that iron is a key determinant in onset, progression and ultimate outcome of a number of infections (reviewed in ref. 69). A delicate balance in body iron must be maintained for resistance to infections. On the one hand, insufficient iron levels may impair specific anti-microbial defenses expressed by macrophages and neutrophils, including phagocytosis, cytokine production, respiratory burst, myeloperoxidase activity, and generation of oxygen radicals through the iron dependent Haber-Weiss or Fenton reactions. On the other hand, excess iron (iron overload) may have a detrimental effect on host defenses, either through increased availability of nutritional iron to microbes or through direct impairment of phagocyte functions.69 Studies in mouse models of infection have shown that induction of iron overload causes increased susceptibility to a lethal challenge with Salmonella.70 On the other hand, deprivation of nutritional iron in mice is associated with prolonged survival and decreased mortality from acute Salmonella infection.71 Divalent cations are essential cofactors for bacterially-encoded superoxide dismutase and catalase, enzymes that neutralize some of the antimicrobial actions of the phagolysosome and may thus enhance intramicrobial survival.72 These observations have suggested that an adequate supply of these metals is important for intracellular replication of certain pathogens in macrophages in particular.64,73 Indeed, Mycobacteria expresses several transcriptional iron dependent regulators such as fur and ideR and, Salmonella expresses under different conditions a surprising number of high or low affinity, ATP-dependent or proton coupled (tonB dependent) iron acquisition systems (Fe2+, Fe3+) such as fepBCDG, sitAD, FeoABC, CorAD, and the Nramp homolog MntH.55,64 Single mutations at feoB and sitA-D reduce virulence in vivo, and double mutations at MntH, sitA-D, or feoB completely abrogate virulence in Nramp1-/- mutant 129sv mice.55 Nonsiderophore metal chelators inhibit cell free growth of Salmonella in vitro, and dipyridyl, an iron chelator, can significantly reduce the intracellular replication of both wild type Salmonella and particularly Salmonella mutants partly impaired in iron acquisition, when studied in Nramp1 defective RAW264.7 macrophages.55 Thus, iron acquisition is key to intracellular survival and active replication in permissive mammalian cells. Nramp1-mediated depletion of divalent metals from the phagosomal space may thus create a stressful and growth-limiting environment that is actively sensed by the bacteria within it. This has been shown in recent experiments with Salmonella carrying a number of transcriptional LacZ fusions that were used to infect Nramp1 positive and Nramp1 negative mice in vivo, and corresponding macrophages ex vivo. These studies showed that intracellular Salmonella respond to the presence of Nramp1 by induction of a number of “virulence” genes that map within Salmonella pathogenicity island 2 (SPI2) including ssrA and sseJ.74 The Nramp1 effect on SPI2 gene induction in vivo can also be reproduced in vitro in cell-free conditions, upon addition of iron chelators (such as dipyridyl) to Salmonella culture medium.74

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

9

Figure 2. Maturation of phagosomes containing Bacillus subtilis, Salmonella typhimurium and Mycobacterium avium/bovis in permissive (Nramp1 deficient) macrophages. Phagosomes containing B. subtilis mature rapidly by fusion to early then late endosomes, and to lysosomes. This leads to the formation of a fully mature and acidified phagolysosome and to the destruction of the internalized bacilli. Phagosomes containing virulent S. typhimurium show a maturation block; although they acidify and acquire certain late endosomal markers (e.g., Lamp1), they remain negative for M6PR and do not fuse with recycling endosomes. Phagosomes containing M. bovis or M. avium show reduced acquisition of vacuolar H+/ATPase and do not acidify fully; they remain negative for late endosomal Lamp1 and for some lysosomal markers, and do not contain mature active lysosomal proteases. Moreover, they remain positive for early endosomal markers inluding Rab5 and TfR. In the case of Salmonella and Mycobacterium, recruitment of functional Nramp1 to the phagosomal membrane help overcome the maturation block leading to increased bactericidal activity.

Nramp1 and Phagosomal Maturation Phagosomes formed in macrophages are initially plasma membrane-derived and poorly bacteriostatic/bactericidal. They acquire such properties through a maturation process which involves sequential fusion to different classes of endomembrane compartments (endosomes, lysosomes) ultimately leading to the formation of fully mature phagolysosomes75 (Fig. 2). The intracellular survival strategy of certain pathogens involves blocking or delaying this maturation process, with possible seclusion in “replication-competent” vacuoles showing different characteristics (reviewed in ref. 76). Recent studies have shown that Nramp1 recruitment to the phagosomal membrane affects the ability of pathogens contained within it to express individual survival strategies, including arresting phagosome maturation at different stages (summarized in Table 2). Mycobacteria including M. tuberculosis, M. bovis and M. avium survive intracellularly by prematurely arresting phagosomal maturation. Mycobacterial phagosomes formed in permissive cells show a maturation block characterized by reduced acidification, reduced fusion to lysosomes, and increased retention of endosomal markers.77 Using primary macrophages and Nramp1-transfected macrophage cell lines, we have observed that M. bovis-containing

The Nramp Family

10

Table 2. Effect of Nramp1 recruitment on fusogenic properties of Salmonella- and Mycobacterium-containing phagosomes Absence of Nramp1 Mycobacterium Rab5 spp TfR low Lamp1 No Rab7 No V-ATPase Salmonella typhimurium

Rab7 Lamp1 V-ATPase low M6PR low cathepsin L

Presence of Nramp1 Block in acidification

Rab7

Block in maturation at the early endosome interactions Limited fusion with late endosomes/lysosomes Limited interaction with endocytic pathway Poor acquisition of M6PR

V-ATPase Lamp1 No Rab5 No TfR

No block in acidification Fusion events with late endosomes/lysosomes

Rab7 Competent for fusion Lamp1 with endocytic V-ATPase pathway M6PR Increased acquisition Cathepsin L? of M6PR

phagosomes formed in Nramp1-positive cells acidify more fully (pH 5.5), and show increased recruitment of Lamp2 compared to control cells. Nramp1-negative phagosomes containing either dead M. bovis or inert latex particles acidify fully, further suggesting that Nramp1 antagonizes an active process encoded by live bacilli.77 Recent electron microscopy studies of M. avium-containing phagosomes formed in Nramp1-positive and Nramp1-negative primary bone marrow macrophages linked Nramp1 to (a) reduced intracellular bacterial replication, (b) increased morphological damage of internalized bacteria, (c) increased lysosomal fusion, (d) decreased fusion of endocytic markers.78 Salmonella containing vacuoles (SCVs) interact with early endosomes and then acquire a subset of lysosomal markers by interacting with intermediate vesicles but not with “terminal” lysosomes (reviewed in 76). Studies on SCVs formed in cultured macrophages indicate that recruitment of Nramp1 to SCVs affects neither acidification nor fusion to dextran-rhodamine labeled, Lamp-1 positive lysosomes.79 However, Nramp1-positive SCVs show increased recruitment of mannose-6-phosphate receptor (M6PR) (Fig. 3), and increased delivery of fluid phase markers (Rhodamine dextran) from early endosomes,79 both of which are known to be actively suppressed by Salmonella in permissive, Nramp1-negative cells. Is the effect of Nramp1 on the fusogenic properties of pathogen containing phagosomes linked to intraphagosomal divalent cation deprivation? This question was addressed in recent studies from our group monitoring the effect of membrane permeant iron chelators on maturation of SCVs.81 Pretreatment of either primary macrophages from Nramp1 mutant mice, or of RAW264.7 macrophages (from BALB/c mice bearing a Nramp1D169 deficient allele) with either desferrioxamine or salicylaldehyde isocotinoyl hydrazone, two membrane permeant iron chelators, restored recruitment of M6PR and delivery of the fluid phase marker Rhodamine dextran to SCVs to levels similar to those seen in macrophages expressing wild type Nramp1. The effect was specific, dose-dependent and could be abrogated by preincubation with excess iron. These data suggested that Nramp1-mediated deprivation of iron and possibly of other divalent metals in macrophages antagonizes the ability of Salmonella to alter phagosome maturation.

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

11

Figure 3. M6PR recruitment to Salmonella typhimurium containing vacuoles formed in peritoneal macrophages from Nramp1-positive (129sv, WT) or Nramp1-mutant (K/O) mice. Mannose 6 Phosphate Receptor is stained by Cy3 fluorophore (M6PR, red) , GFP-S represents a Salmonella typhimurium strain expressing a Green Fluorescent Protein (green); overlay is shown in the right panel, yellow indicates colocalization. Note the extent of recruitment of M6PR to Salmonella containing vacuoles in macrophages from WT mice as opposed to macrophages from K/O mice. Cells were cropped from different fields from the same experiment.

Thus, the active process by which Salmonella or Mycobacterium arrest phagosome maturation may rely at least in part on Mn2+ and/or Fe2+-dependent enzymatic activities, which may be directly antagonized by Nramp1 transport at the phagosomal membrane. Alternatively, the Nramp1 effect could be more general and secondary to deprivation of nutritional metals required for normal metabolic activity of the pathogen. Finally, Mn2+ and Fe2+ are key cofactors required for activity of pathogen-encoded antioxidant defenses such as catalase, peroxidase and superoxide dismutase. Nramp1-mediated deprivation of cations from the phagosomal space would impair such protective enzymatic activity, causing a net enhancement of the bactericidal activity of the phagocyte (Fig. 4).

Conclusions and Perspectives Studies of Nramp1 protein function have provided new insights into our understanding of interactions between the mammalian host and pathogens such as Salmonella and Mycobacterium. The important role of this gene has been validated in association and genetic linkage studies in humans from areas of endemic disease. Several questions remain unanswered and should be the focus of future investigations. One of the most critical issue will be to understand how removal of divalent metals affects so drastically intracellular survival of certain pathogens, and what are the adaptive mechanisms developed by others to overcome this effect.

The Nramp Family

12

Figure 4. Proposed model for Nramp1 function at the phagosomal membrane in phagocytic cells. Nramp1 is shown as mediating efflux of divalent cations including Fe2+ and Mn2+ from inside the phagosome and into the cytoplasm. Acidification of the phagosomal space by vacuolar H+/ATPase would provide the pH gradient essential for Nramp1-mediated transport. Deprivation of Mn2+ and Fe 2+ could deplete bacterium of nutritional metals, prevent expression of individual survival strategies (virulence factors)and/ or disable bacterially encoded detoxifying enzymes (SOD, catalase…). Bacterial Nramp homologs function by a similar mechanism to acquire metals from their environment, and may possibly compete with their mammalian counterpart for the same substrate(s).

Acknowledgments This work was supported in part by the National Institutes of Health grant 1R01 A135237-06 to P. Gros. N. Jabado is the recipient of a Human Frontier Science Program fellowship. P. Gros is a Distinguished Scientist of the Canadian Institutes for Health Research.

References 1. Marquet S, Sanchez FO, Arias M et al. Variants of the human NRAMP1 gene and altered human immunodeficiency virus infection susceptibility. J Infect Dis 1999; 180(5):1521-1525. 2. Bellamy R. Susceptibility to mycobacterial infections: The importance of host genetics. Genes Immun 2003; 4(1):4-11. 3. Skamene E, Schurr E, Gros P. Infection genomics: Nramp1 as a major determinant of natural resistance to intracellular infections. Annu Rev Med 1998; 49:275-287. 4. Plant J, Glynn A. Genetics to resistance to infection with Salmonella typhimurium in mice. J Infect Dis 1976; 133:72-78. 5. Bradley D. Genetic control of resistance to Leishmania donovani. Nature 1974; 250:353-354. 6. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73(3):469-485. 7. Vidal SM, Pinner E, Lepage P et al. Natural resistance to intracellular infections: Nramp1 encodes a membrane phosphoglycoprotein absent in macrophages from susceptible (Nramp1 D169) mouse strains. J Immunol 1996; 157(8):3559-3568.

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

13

8. Vidal S, Tremblay ML, Govoni G et al. The Ity/Lsh/Bcg locus: Natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J Exp Med 1995; 182(3):655-666. 9. Govoni G, Vidal S, Gauthier S et al. The Bcg/Ity/Lsh locus: Genetic transfer of resistance to infections in C57BL/6J mice transgenic for the Nramp1 Gly169 allele. Infect Immun 1996; 64(8):2923-2929. 10. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 1994; 180(5):1741-1752. 11. Skamene E, Gros P, Forget A et al. Genetic regulation of resistance to intracellular pathogens. Nature 1982; 297:506-509. 12. Skamene E, Gros P, Forget A et al. Regulation of resistance to leprosy by chromosome 1 locus in the mouse. Immunogenetics 1984; 19:117-120. 13. Goto Y, Buschman E, Skamene E. Regulation of host resistance to Mycobacterium intracellulare in vivo and in vitro by the Bcg gene. Immunogenetics 1989; 30:218-221. 14. Goto Y, Iwakiri A, Shinjo T. [Pathogenicities of Mycobacterium intracellulare and M. avium strains to the mice which were isolated from nontuberculous mycobactriosis patients]. Kansenshogaku Zasshi 2002; 76(6):425-431. 15. Medina E, Rogerson BJ, North RJ. The Nramp1 antimicrobial resistance gene segregates independently of resistance to virulent Mycobacterium tuberculosis. Immunology 1996; 88(4):479-481. 16. Medina E, North RJ. Evidence inconsistent with a role for the Bcg gene (Nramp1) in resistance of mice to infection with virulent Mycobacterium tuberculosis. J Exp Med 1996; 183(3):1045-1051. 17. North RJ, LaCourse R, Ryan L et al. Consequence of Nramp1 deletion to Mycobacterium tuberculosis infection in mice. Infect Immun 1999; 67(11):5811-5814. 18. Gautier AV, Lantier I, Lantier F. Mouse susceptibility to infection by the Salmonella abortusovis vaccine strain Rv6 is controlled by the Ity/Nramp 1 gene and influences the antibody but not the complement responses. Microb Pathog 1998; 24(1):47-55. 19. Hu J, Bumstead N, Burke D et al. Genetic and physical mapping of the natural resistance-associated macrophage protein 1 (NRAMP1) in chicken. Mamm Genome 1995; 6(11):809-815. 20. Barthel R, Feng J, Piedrahita JA et al. Stable transfection of the bovine NRAMP1 gene into murine RAW264.7 cells: Effect on Brucella abortus survival. Infect Immun 2001; 69(5):3110-3119. 21. Chapes SK, Mosier DA, Wright AD et al. MHCII, Tlr4 and Nramp1 genes control host pulmonary resistance against the opportunistic bacterium Pasteurella pneumotropica. J Leukoc Biol 2001; 69(3):381-386. 22. Blackwell JM, Goswami T, Evans CA et al. SLC11A1 (formerly NRAMP1) and disease resistance. Cell Microbiol 2001; 3(12):773-784. 23. McLeod R, Buschman E, Arbuckle LD et al. Immunogenetics in the analysis of resistance to intracellular pathogens. Curr Opin Immunol 1995; 7(4):539-552. 24. Blackwell JM, Roberts CW, Roach TI et al. Influence of macrophage resistance gene Lsh/Ity/Bcg (candidate Nramp) on Toxoplasma gondii infection in mice. Clin Exp Immunol 1994; 97(1):107-112. 25. Kovarova H, Halada P, Man P et al. Proteome study of Francisella tularensis live vaccine strain-containing phagosome in Bcg/Nramp1 congenic macrophages: Resistant allele contributes to permissive environment and susceptibility to infection. Proteomics 2002; 2(1):85-93. 26. Kovarova H, Hernychova L, Hajduch M et al. Influence of the bcg locus on natural resistance to primary infection with the facultative intracellular bacterium Francisella tularensis in mice. Infect Immun 2000; 68(3):1480-1484. 27. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189(5):831-841. 28. Pal S, Peterson EM, de La Maza LM. Role of Nramp1 deletion in Chlamydia infection in mice. Infect Immun 2000; 68(8):4831-4833. 29. De Chastellier C, Frehel C, Offredo C et al. Implication of phagosome-lysosome fusion in restriction of Mycobacterium avium growth in bone marrow macrophages from genetically resistant mice. Infect Immun 1993; 61:3775-3784. 30. Govoni G, Vidal S, Cellier M et al. Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics 1995; 27(1):9-19. 31. Govoni G, Gauthier S, Billia F et al. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J Leukoc Biol 1997; 62(2):277-286.

14

The Nramp Family

32. Cellier M, Shustik C, Dalton W et al. Expression of the human NRAMP1 gene in professional primary phagocytes: Studies in blood cells and in HL-60 promyelocytic leukemia. J Leukoc Biol 1997; 61(1):96-105. 33. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92(22):10089-10093. 34. Barton CH, White JK, Roach TI et al. NH2-terminal sequence of macrophage-expressed natural resistance-associated macrophage protein (Nramp) encodes a proline/serine-rich putative Src homology 3-binding domain. J Exp Med 1994; 179(5):1683-1687. 35. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: The Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185(4):717-730. 36. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: Natural resistance-associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192(9):1237-1248. 37. Govoni G, Canonne-Hergaux F, Pfeifer CG et al. Functional expression of Nramp1 in vitro in the murine macrophage line RAW264.7. Infect Immun 1999; 67(5):2225-2232. 38. Searle S, Bright NA, Roach TI et al. Localisation of Nramp1 in macrophages: Modulation with activation and infection. J Cell Sci 1998; 111 ( Pt 19):2855-2866. 39. Canonne-Hergaux F, Levy JE, Fleming MD et al. Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders. Blood 2001; 97(4):1138-1140. 40. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25(2):514-525. 41. Donovan A, Brownlie A, Dorschner M et al. The zebrafish mutant gene chardonnay (cdy) encodes divalent metal transporter 1 (DMT1). Blood 2002; 100(13):4655-4659. 42. Cellier MF, Bergevin I, Boyer E et al. Polyphyletic origins of bacterial Nramp transporters. Trends Genet 2001; 17(7):365-370. 43. Portnoy ME, Jensen LT, Culotta VC. The distinct methods by which manganese and iron regulate the Nramp transporters in yeast. Biochem J 2002; 362(Pt1):119-124. 44. Cellier M, Belouchi A, Gros P. Resistance to intracellular infections: Comparative genomic analysis of Nramp. Trends Genet 1996; 12(6):201-204. 45. Kerppola RE, Ames GFL. Topology of the hydrophobic membrane-bound components of the histidine periplasmic permease. Comparison with other members of the family. J Biol Chem 1992; 267:2329-2336. 46. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93(12):4406-4417. 47. Canonne-Hergaux F, Gros P. Expression of the iron transporter DMT1 in kidney from normal and anemic mk mice. Kidney Int 2002; 62(1):147-156. 48. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388(6641):482-488. 49. Picard V, Govoni G, Jabado N et al. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem 2000; 275(46):35738-35745. 50. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95(3):1148-1153. 51. Fleming MD, Trenor CC 3rd, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16(4):383-386. 52. Chua A, Morgan E. Manganese metabolism is impaired in the belgrade rat. J Comp Physiol 1997; 167:361-369. 53. Pinner E, Gruenheid S, Raymond M et al. Functional complementation of the yeast divalent cation transporter family SMF by NRAMP2, a member of the mammalian natural resistance-associated macrophage protein family. J Biol Chem 1997; 272(46):28933-28938. 54. D’Souza J, Cheah PY, Gros P et al. Functional complementation of the malvolio mutation in the taste pathway of Drosophila melanogaster by the human natural resistance-associated macrophage protein 1 (Nramp-1). J Exp Biol 1999; 202 (Pt14):1909-1915. 55. Boyer E, Bergevin I, Malo D et al. Acquisition of Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2002; 70(11):6032-6042.

Mouse Natural Resistance Associated Macrophage Protein 1 (Nramp1)

15

56. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-1078. 57. Agranoff D, Monahan IM, Mangan JA et al. Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J Exp Med 1999; 190(5):717-724. 58. Forbes JR, Gros P. Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions. Trends Microbiol 2001; 9(8):397-403. 59. Gomes MS, Appelberg R. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology 1998; 95(2):165-168. 60. Zwilling BS, Kuhn DE, Wikoff L et al. Role of iron in Nramp1-mediated inhibition of mycobacterial growth. Infect Immun 1999; 67(3):1386-1392. 61. Kuhn DE, Baker BD, Lafuse WP et al. Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J Leukoc Biol 1999; 66(1):113-119. 62. Kuhn DE, Lafuse WP, Zwilling BS. Iron transport into mycobacterium avium-containing phagosomes from an Nramp1(Gly169)-transfected RAW264.7 macrophage cell line. J Leukoc Biol 2001; 69(1):43-49. 63. Goswami T, Bhattacharjee A, Babal P et al. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J 2001; 354(Pt3):511-519. 64. De Voss J. Iron acquisition and metabolism by mycobacteria. J Bacteriol 1999; 181:4443-4451. 65. Lam-Yuk-Tseung S, Govoni G, Forbes J et al. Iron transport by NRAMP2/DMT1: pH regulation of transport by two histidines in transmembrane domain 6. Blood 2003; 101:3699-3707. 66. Worthington M, Browne L, Battle E et al. Functional properties of transfected human DMT1 iron transporter. Am J Physiol Gastrointest Liver Physiol 2000; 279:G1265-1273. 67. Ohno H, Stewart J, Fournier M et al. Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 1995; 269:1872-1875. 68. Tabuchi M, Tanaka N, Nishida-Kitayama J et al. Alternative splicing regulates the sub-cellular localization of divalent Metal transporter 1 isoforms. Mol Biol Cell 2002; 13:4371-4387. 69. Patruta S, WL H. Kidney Int 1999; 55:S125-S130. 70. John S, Marlow A, Hajeer A et al. Linkage and association studies of the natural resistance associated macrophage protein 1 (NRAMP1) locus in rheumatoid arthritis. J Rheumatol 1997; 24(3):452-457. 71. Puschmann M, Ganzoni A. Infect Immun 1977; 17:663-664. 72. Weinberg E. Acquisition of iron and other nutrients in vivo. In virulence Mechanisms of Bacterial Pathogens. In: Roth JA, Washington DC, eds. American Society for Microbiology. 1995:79-183. 73. Ratledge C, Dover LG. Iron metabolism in pathogenic bacteria. Annu Rev Microbiol 2000; 54:881-941. 74. Zaharik ML, Vallance BA, Puente JL et al. Host-pathogen interactions: Host resistance factor Nramp1 up-regulates the expression of Salmonella pathogenicity island-2 virulence genes. Proc Natl Acad Sci USA 2002; 99(24):15705-15710. 75. Duclos S, Desjardins M. Subversion of a young phagosome: The survival strategies of intracellular pathogens. Cell Microbiol 2000; 2:365-377. 76. Knodler L, Celli J, Finlay B. Pathogen trickery: Deception of host cell processes. Nat Rev Mol Cell Biol 2001; 2:578-588. 77. Hackam DJ, Rotstein OD, Zhang W et al. Host resistance to intracellular infection: Mutation of natural resistance-associated macrophage protein 1 (Nramp1) impairs phagosomal acidification. J Exp Med 1998; 188(2):351-364. 78. Frehel C, Canonne-Hergaux F, Gros P et al. Effect of Nramp1 on bacterial replication and on maturation of Mycobacterium avium-containing phagosomes in bone marrow-derived mouse macrophages. Cell Microbiol; 4(8):541-556. 79. Cuellar-Mata P, Jabado N, Liu J et al. Nramp1 modifies the fusion of Salmonella typhimurium-containing vacuoles with cellular endomembranes in macrophages. J Biol Chem 2002; 277(3):2258-2265. 80. Forbes J, Gros P. Iron, manganese, and cobalt transport by Nramp1 (Slc11a1) and Nramp2 (Slc11a2) expressed at the plasma membrane. Blood 2003; 102(5):1884-92. 81. Jabado N, Cuellar-Mata P, Grinstein S et al. Iron chelators modulate the fusogenic properties of Salmonella-containing phagosomes. Proc Natl Acad Sci USA 2003; 100(10):6127-32.

16

The Nramp Family

CHAPTER 2

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals Judith Caron, Danielle Malo, Christopher Schutta, Joe W. Templeton and L. Garry Adams

Abstract

C

omparative genomics is playing a pivotal role in the genetic dissection of complex traits such as infectious diseases resistance. Using mouse models of infection, natural resistance associated macrophage protein 1 (Nramp1) was shown to have a critical role in innate resistance to infection with unrelated intracellular pathogens including Mycobacterium bovis, Leishmania donovani and Salmonella typhimurium. Nramp1 is a member of an ancient family of genes having orthologs among mammals, birds, invertebrates and plants. A role for NRAMP1 in host defense against microbial infection was demonstrated in two major zoonotic diseases of livestock: salmonellosis in chicken and brucellosis in cattle. In both cases disease susceptibility is inherited as a complex trait and polymorphisms within NRAMP1 contribute clearly to the risk and the progression of infection.

Introduction Under natural conditions, the host response to infection in farm animals is multifactorial and involves the complex interaction between two genomes (the host and the pathogen) and the environment. It had been long observed that diseases rarely occur in all members of animal populations exposed to pathogens: studies of resistance to Salmonella pullorum in poultry and Brucella suis in swine confirmed a major role of the host genetic background in the expression of the disease.1,2 Natural disease resistance refers to the inherent capacity of an animal to resist disease when exposed to pathogens, without prior exposure or immunization.3 Although some of the observed variation in natural resistance to infection is related to environmental factors, a significant component of variation appears to be heritable and, therefore, stably passed from parent to offspring. The understanding of the complex host response to infection in domestic animals and other mammalian species has advanced considerably through the use of mouse models of infection. The laboratory mouse is well known to have a broad range of host susceptibility to human pathogens (reviewed in ref. 4). The development of genome resources and technologies combined with classical genetics contributed to the successful identification of several host resistance genes in laboratory mice including the gene encoding for Nramp1 (natural resistance associated macrophage protein 1).5 One powerful approach to unravel the genetic determinants involved in host resistance to infection in agriculturally important animal species is the use of comparative genomics. Despite traditional disease control measures, losses attributable to infectious diseases continue to impede the livestock industries. An alternative approach to enhancing animal health manageThe Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

17

ment systems is to increase the overall level of genetic resistance at herd and population levels by using selective breeding programs. Comparative genomics involves initially the mapping and the identification of genes for resistance to infectious disease in model organisms such as the mouse. Candidate chromosomal regions and/or orthologous genes are then tested for association to susceptibility to related infections in other animal species.6

Comparative Genomics Comparative mapping was based for the past 20 years on genetic maps created through the integration of data obtained from visible phenotypes and traditional mapping techniques, such as restriction fragment length polymorphisms (RFLPs), fluorescence in situ hybridization (FISH), genetic studies of somatic cells, and pedigree analysis of interspecific crosses (reviewed in ref. 7). More recently, information obtained from additional types of markers that amplify coding sequences and genes, microsatellite markers and single nucleotide polymorphisms (SNPs), has increased the density of these maps.8 The first indication that genes reside in similar region of the genome in different mammalian species was provided with the observation that the albino and pink-eye dilution mutations are closely linked in the mouse, rat and rabbit genomes7. In 1984, Nadeau and Taylor9 compared the chromosomal locations of orthologous genes (83 loci) in mouse and human using mouse linkage and human cytogenetic data. They predicted about 180 syntenic regions (defined as regions in which a series of loci occur in the same order on a single chromosome in both species), a number that was confirmed in a more recent study using more than 3600 orthologous loci to define about 200 regions of conserved synteny.10 A more comprehensive analysis of conserved synteny was reported using the draft sequences of the human and mouse genomes.11 The comparison of the entire mouse and human genome sequences was not based only on human-mouse gene pairs but also on a large set of orthologous landmarks (558,000 orthologous landmarks). Each genome could be parsed into 342 conserved syntenic segments.11 Comparative mapping offers many possibilities, such as the identification of candidate disease genes and modulators of disease susceptibility, the characterization of the genetic basis of complex disorders, the identification of novel genes, transcription factors, and regulatory elements. For years, agriculturally important animal populations have been genetically improved through selective breeding.12 Most of this selection was based on visible phenotypes without knowing the molecular basis of the trait in question.12 The human and mouse genome projects have paved the way for the development of genome resources and technologies in farm animals. Dense genetic maps and large-insert libraries (YAC and BAC) have been generated for all main farm animals.13,14 Radiation hybrid panels and collection of expressed sequence tags (ESTs) are available for pig, cow and chicken.13,14 However the number of genes mapped in farm animals is still small compared to humans and mice. Comparative mapping is currently an important component of farm animal genome programs and as more farm animal genomes are sequenced, comparative genomics will be exploited fully towards the identification of genes that control key economical and/or biological important traits.

Nramp1 Numerous success stories have emerged using comparative genomics between human and mice.8 The success of comparative genomics in studying host resistance to infection in animal species other than mice and humans has been well illustrated with the gene Nramp1.15,16 Nramp1 was positionaly cloned a decade ago as the gene underlying the Bcg/Lsh/Ity locus located on mouse chromosome 1.5 The Bcg/Lsh/Ity locus was known to control the exponential growth rate in the early phase of infection of unrelated intracellular pathogens such as different Mycobacterium species (including the Bacille Calmette-Guérin, BCG), Leishmania donovani as well as Salmonella typhimurium.17-19 A polymorphism within Nramp1 abolished the protein’s function and consists in a glycine replacement by an aspartic acid residue at position 169 of the protein.20 Mice homozygous for the wild type allele, Nramp1G169, are highly resistant to BCG,

18

The Nramp Family

Leishmania donovani and Salmonella typhimurium, whereas mice with the mutated allele, NrampD169, are highly susceptible.5 Further proof that Nramp1 was the gene underlying the Bcg/Lsh/Ity locus came when the functional Nramp1 gene was disrupted by homologous recombination in resistant mice which then became very susceptible to infection with BCG, Leishmania donovani and Salmonella typhimurium.21 Additionally, susceptible mice were rendered resistant to BCG and Salmonella typhimurium by transfer of the resistance allele, further confirming the identity of Nramp1 with the phenotypic resistance to Salmonella typhimurium.22 Nramp1 codes for a phosphoglycoprotein that is recruited to the phagosomal membrane early during an infection.23,24 Nramp1 functions as a pH-dependent manganese transporter and has pleiotropic effects on various effectors of the immune system to facilitate bacterial killing.24 The identification of Nramp1 and its function opened a whole new field in the area of host resistance to intracellular pathogens. Because of the critical role of Nramp1 in the mouse model of mycobacterial, Leishmania and Salmonella infections, several homologues of the mouse Nramp1 were investigated with respect to resistance to various intracellular pathogens causing major diseases in important agricultural species.

Chicken Genomics, Salmonella Infection and NRAMP1 The chicken has been an important animal model in immunology and has led to several fundamental discoveries.14 During the past decade, there has been a concerted international effort to produce a molecular map of the chicken genome.25-31 The consensus map comprises 39 pairs of chromosomes that are subdivided into eight pairs of cytologically distinct macrochromosomes, 2 sex chromosomes and 30 pairs of cytologically indistinguishable microchromosomes. The resulting map contains 1889 loci and spans ~3800 cM.30 Although the physical size of the chicken genome is roughly 3 times smaller (~1200Mb) than mammalian genomes, the recombination genetic map is comparable to that of most mammals. Comparative maps between chicken, man and mouse show a considerable amount of chromosomal conservation.30,32,33 With the development of genomic technologies, the chicken is becoming an excellent model for the study of host resistance to infection. Salmonella are ubiquitous Gram-negative, facultative intracellular bacteria that replicate in macrophages and neutrophils of the reticuloendothelial systems of numerous animal species, including humans, laboratory and domestic animals, livestock and birds. Several Salmonella serotypes including Salmonella typhimurium and Salmonella enteritidis infect a broad spectrum of hosts. Other serotypes such as Salmonella typhi and Salmonella paratyphi in humans, Salmonella dublin in cattle and Salmonella gallinarum in birds are host specific. In humans, Salmonella cause two major types of infection, a systemic disease (typhoid fever) caused by Salmonella typhi, and a gastrointestinal disease (salmonellosis) caused by Salmonella enteritidis or Salmonella typhimurium. Typhoid fever is still a major disease in endemic areas of the world where access to clean water is limited. There are over 21 million cases of typhoid fever reported annually worldwide and 200 000 deaths associated with untreated infection.34 Salmonellosis caused by the ingestion of Salmonella-contaminated poultry products is one of the most common causes of food poisoning in humans.35 There has been a resurgence of salmonellosis in North America and Europe with an estimated number of salmonellosis of 1.4 million per year in the United States alone.34 In chickens, host specific Salmonella such as Salmonella gallinarum and Salmonella pullorum cause a systemic disease with high mortality rates in birds of all ages.36 Salmonella enteritidis and Salmonella typhimurium infections in young chickens cause also a major disease characterized by severe clinical signs of diarrhea and dehydration with high mortality rates. In adult chickens, Salmonella typhimurium and Salmonella enteritidis infections do not cause significant disease or mortality and birds can carry the bacteria for several weeks without presenting any clinical signs, which constitutes an insidious risk for public health.37 Chickens have been studied for more than 50 years for their resistance and susceptibility to Salmonella infection because of their central importance in the poultry industry worldwide.37

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

19

Many factors are known to affect the susceptibility of chickens to Salmonella infection, including age, Salmonella strains, sanitary conditions at the farms, as well as the genetic background of the animals. Host genetic factors clearly influence the epidemiology of Salmonella infection in chickens. Genetic regulation of chicken resistance to Salmonella infection was reported initially by Bumstead and Barrow.38 A survey of inbred and partially inbred lines of chicken showed significant differences in mortality following both oral and intramuscular challenge of newly hatched chicks with Salmonella typhimurium.38 Lines W1, 61 and N were highly resistant to Salmonella typhimurium with more than 70% survival during the course of infection, whereas lines C, 72 and 15I were highly susceptible with 70% to 100% mortality rates. Resistance to infection extended to other Salmonella serotypes in these chicken lines: lines resistant to Salmonella typhimurium were also resistant to infection with Salmonella gallinarum, Salmonella pullorum and Salmonella enteritidis, and chicken lines susceptible to Salmonella typhimurium were also susceptible to the other Salmonella serotypes. In susceptible chickens, mortality occurred early during the course of infection (within 7 days post-inoculation) and host differences in susceptibility to Salmonella infection in chicken have been shown to correlate with the bacterial load in the reticuloendothelial organs.36,39 Significantly higher numbers of Salmonellae were isolated from the spleen and liver of susceptible chickens compared to the resistant chickens, suggesting that resistance to salmonellosis in chicken is related to a greater ability of the reticuloendothelial system to control bacterial proliferation during the early stage of infection, resembling the phenotype described in mouse Nramp1 mutant. Segregation analysis using resistant W1 and susceptible C chickens showed that resistance to infection is dominant and inherited as a complex trait, not associated with the major histocompatibility complex or maternal factors.38 An effect of the genetic background in host resistance to infection with Salmonella was also seen in adult chickens.40 In this case, susceptible birds survived the infection but produced fewer eggs and presented higher degree of egg contamination. Chicken NRAMP1 clones were identified from chicken genomic DNA and cDNA libraries using a mouse Nramp1 partial cDNA as hybridization probe.41 Chicken NRAMP1 encodes a polypeptide of 555 amino acid residues that shows a strong homology with mammalian Nramp1 including mouse and humans (83% and 81% similarity respectively). The overall structure and particularly the position and sequence of the 12 putative transmembrane domains, the two N-linked glycosylation sites and the consensus transport motif are highly conserved, suggesting the functional importance of these regions among phylogenetically distinct species. Chicken NRAMP1 was mapped using linkage analysis and fluorescence in situ hybridization to chromosome 7q13 within a syntenic linkage group including three known genes (the mitochondrial NADH-coenzyme Q reductase gene, NDUFS1; the T cell surface antigen, CD28 and the elongation factor 1, EF1B) that have been conserved in the mouse (chromosome 1) and human (chromosome 2) genomes.41,42 Analysis of NRAMP1 expression in a variety of chicken tissues has demonstrated that the highest expression of chicken NRAMP1 is in spleen and thymus with much lower expression in liver and lung.43 Fractionation of spleen cells into adherent (macrophage-enriched) and non-adherent (lymphocyte enriched) subpopulations show that the expression of NRAMP1 is enhanced in the adherent cell compartment as previously demonstrated in mice.5 A search for regulatory sequences in the chicken NRAMP1 promoter revealed a number of consensus motifs associated with binding of trans-acting nuclear factors implicated in myeloid differentiation corresponding to elements known to bind constitutively expressed transcription factors.43 Additional sequence motifs associated with inflammatory response or lymphokine-inducible gene expression was detected in the promoter region. The presence of PU.1 and PEA binding sites is in agreement with the restricted expression of chicken, mouse and human NRAMP1 mRNA in haematopoietic cells (macrophages and granulocytes). The overall sequence homology between the promoter region of the chicken and mouse NRAMP1 genes is 41% and is 36% between chicken and human NRAMP1. More interestingly, several of the consensus elements (PU box; interferon γ responsive element and binding sites for NF-IL6 and NF-kB)

20

The Nramp Family

are present in chicken, mouse and human NRAMP1 promoters.16,43,44 The conservation of genomic organization of mammalian and avian NRAMP1 proteins is striking. The chicken NRAMP1 gene spans about 5 kb and contains 15 exons. Except for a smaller range of intron lengths, the overall structure of the chicken gene proved to be very similar (number of exons, exon sizes and splicing junctions) to those of mouse and human Nramp1. The high degree of sequence and structure conservation between chicken and mouse NRAMP1, the presence of similar regulatory elements within the promoter regions of the two homologous genes, and similar tissue expression supports the concept that the NRAMP1 protein exerts similar roles in vivo both in mice and birds. Nucleotide sequence analyses of the coding portion of NRAMP1 in susceptible (72, 15I and C) and resistant (W1, 61 and N) chicken lines revealed eleven sequence variants within NRAMP1 cDNA.16 Almost all of these sequence variants (10 out of 11) resulted in silent mutations or conservative changes that were detected both in resistant and susceptible chicken lines. Only one sequence variant corresponding to a G→A transition at position 696, resulting in a non-conservative Arg223→Gln223 within the predicted TM5-6 interval was specific to the susceptible line C. A positively charged Arg residue was found at the equivalent position in most mammalian NRAMP1 proteins (human, sheep, horse, pig, dog, rat and rabbit) with the exception of the mouse (His) and cow (Gln).16,23,45 The role of NRAMP1 in resistance of chickens to Salmonella infection was tested by linkage analysis using a backcross chicken panel that consisted in 425 progeny, derived from resistant line W1 and susceptible line C. One day old progeny were infected with 103 CFUs Salmonella typhimurium intramuscularly and mortality rate was recorded for a period of 15 days.16 In this model, W1 chickens were highly resistant to infection (3% mortality was observed 15 days post inoculation) whereas C chickens were highly susceptible (89% mortality for the same time period). The overall mortality rate in the 425 (W1 X C)F1 X C backcross progeny was intermediate (35%) between those of resistant W1 and susceptible C lines.16 Mortality rate in line C occurred in two phases: an early phase (day 1-7) where most animals died from infection (about 80% of the deaths occurred during this period) and a late phase (day 8-15) where the mortality rate was much lower. The major effect of NRAMP1 was seen early after infection (7 days) when the mortality rate of homozygous CC chickens (27%) was twice the one observed in CW1 heterozygote progeny (13%). Using linkage analysis, NRAMP1 and the adjacent chromosomal region was linked to resistance to infection with Salmonella typhimurium in chickens (Likelihood ratio test of 9.44, p = 0.00213) using the Cox proportional hazards model for the period covering the first 7 days post-infection. A second region of the chicken genome located on microchromosome E41W17 and harboring the host resistance gene Toll-like receptor 4 (TLR4) was shown to be linked to disease susceptibility in the same model of infection.16,46 The impact of TLR4 on resistance to infection during the first 7 days post infection is similar to that observed with NRAMP1 (Likelihood ratio test of 10.2, p = 0.00138). The interaction between NRAMP1 and TLR4 was examined by dividing the backcross progeny into four two-locus genotypes at NRAMP1 and TLR4.46 The group NRAMP1CW1-TLR4CW1 presented the highest survival rate at day 7 post-infection (93%) compared to the progeny carrying NRAMP1CC-TLR4CC genotypes (58%). The two other groups (NRAMP1CC-TLR4CW1 and NRAMP1CW1-TLR4CC) presented intermediate survival rates (69% and 73% respectively). These data were consistent with the previous observation in mice that mutation within Nramp1 affects susceptibility to infection with Salmonella typhimurium one or two days earlier than mutation within Tlr4.47,48 Individually, NRAMP1CW1 accounted for 17% of the early differential resistance to infection and TLR4CW1 was found to account for 21% of the phenotype in the chickens tested. A genome scan performed on the same animal panel clearly showed that the chromosomal regions surrounding NRAMP1 and TLR4 had a major impact on susceptibility of chickens to Salmonella typhimurium infection (unpublished data). In experimental Salmonella enteritidis infection in mice, Nramp1 was shown to exert an effect not only during the innate phase of the host response but also in controlling bacterial

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

21

clearance during the late phase of infection.49 In young chickens, NRAMP1 was also associated with the early host response to infection with Salmonella enteritidis as measured by bacterial load in the spleen within a week post infection.50,51 In adult chickens, NRAMP1 was shown to have a dramatic impact on the risk of spleen contamination four weeks post infection suggesting an additional role for NRAMP1 in the control of resistance to Salmonella carrier state in chickens.52 The mechanism by which NRAMP1 affects bacterial clearance in chickens is not clearly elucidated however studies performed in mice have shown that in addition to its specific role as a cation transporter,24 Nramp1 has been associated with regulation of macrophage activation as measured by production of nitric oxide, IL-1, INF-γ and MHC class II expression and Th1/Th2 differentiation.53,54

Bovine Genomics, Brucella abortus Infection and NRAMP1 Recent developments in the construction and comparison of mammalian genome maps combined with efficient tools such as whole genome radiation hybrids (RH) and large fragment clone libraries (BACs) have advanced considerably the progress made on the identification and characterization of disease candidate genes in cattle.55,56 Several evidences will be reviewed here supporting the concept that the bovine homologue of mouse Nramp1 is a major gene controlling natural resistance to infection with Brucella abortus in cattle.57 Brucella abortus, an ubiquitous facultative intracellular Gram-negative bacteria, causes a severe disease in cattle known as brucellosis. The disease is characterised by abortions, birth of weak or nonviable offspring, and infertility in both males and females. Brucella abortus infection caused an estimated annual loss of US$35 million to the livestock industries until it was brought under control and virtually eliminated in the late 1990’s in the USA. The disease adversely affects the export trade of livestock by imposing quarantine on infected herds, requesting vigorous testing and restricting trade from high risk geographical areas. In the USA, the federal brucellosis eradication program has been in effect since 1934. This program, based on vaccination and elimination of domestic reservoirs, has cost over US$2 billion from 1951 to present. In USA and Canada, brucellosis is a notifiable disease and reportable to the local health authority. According to the Food and Agriculture Organization (FAO), the World Health Organization (WHO) and the Office International des Epizooties (OIE), brucellosis is still a serious economical problem for livestock and a major public health hazard for humans in several countries. A recent survey directed by these organisms reported that out of 174 countries evaluated for brucellosis occurrence, 19 had never encountered the disease, 15 had completely eradicated the disease and 140 countries still had infected livestock and human populations. In humans, the three closely related species Brucella melitensis, Brucella abortus and Brucella suis are the etiologic agents of brucellosis. One important source of transmission in humans is the ingestion of contaminated milk and dairy products. The clinical disease is often difficult to diagnose because of non-specific clinical signs and an insidious onset: patients infected with Brucella spp. may present an acute fever, or a chronic or localized infection. Antibiotics (usually doxycycline and rifampin for 6 weeks) have proven to be generally effective, but recurrence of the disease is not uncommon, and foci of infection have been documented to persist for decades in some patients. Public health strategies to protect humans from brucellosis have virtually always relied on the elimination of diseased animals. Using bovine brucellosis as a prototype intracellular disease model, studies aimed at defining the genetic basis for resistance to Brucella abortus in cattle began in the late 1970’s.58 Although resistance to infection was associated in some studies with a simple mode of inheritance, it was most frequently associated with a model supporting the effect of several genes. This apparent discrepancy may be explained by the fact that studies aimed at demonstrating a genetic basis for natural disease resistance in domestic animals are highly dependent on methodology, including the nature of the exposure to the pathogen, the method used to assess resistance, and the type of genetic analysis used. In classical breeding studies, natural resistance to Brucella was demonstrated to be improved by simple mass selection in one generation of selec-

The Nramp Family

22

Table 1. Characteristics of macrophages, T cells and antibody responses in cattle naturally resistant or susceptible to Brucella abortus Biological Activity

Resistant

Susceptible

In vitro intracellular growth of B. abortus, M. bovis, S. dublin

Restrictive

Permissive

Phago-lysosomal fusion

Increased

Reduced

Production of Reactive Oxygen Intermediates

High

Low

LPS + IFNγ induced Nitric Oxide production

High

Low

B. abortus binding to macrophages

RGDS tetrapeptide, B. abortus LPS & Mab anti-LFA-1 inhibit 90% binding

Minimal inhibition

Antibody response to B. abortus LPS

Minimal, short duration

Massive, long duration

IgG2a A1 and A2 allotypic response to B. abortus LPS at 6 wks.

≈ 50:50

95% A1

Oligoclonal T cell response

Only B. abortus stimulates

B. abortus, B. suis, B. melitensis and B. canis stimulates

tive breeding.58 The frequency of natural resistance to brucellosis in challenged unvaccinated cattle was 20% (30/150). Breeding a naturally resistant bull to naturally resistant cows increased the frequency of natural resistance in their progeny to 58.6% (17/29). The genetic analysis of these crosses was consistent with a model of resistance to infection involving two or more genes. The host response to brucellosis was analysed experimentally in a recent study using a standardized dose of Brucella abortus to maximize differences observed between resistant and susceptible animals, while approximating a natural exposure. Unvaccinated and previously unexposed sexually mature bulls or heifers at mid-term gestation (150±30 days) were challenged with the standardized discriminating challenge inoculum of 106 CFUs of Brucella abortus strain S2308, scored for the outcome of parturition, and quantitative cultures were collected from tissues and secretions 3-5 months post inoculation. Resistant cows did not abort, and no Brucella organisms were cultured from the cow or calf. Resistant bulls were similarly culture negative for Brucella in semen and at slaughter. In this system, natural resistance to Brucella infection in the cow was shown to correlate with macrophage, function, T-cell response and specific immunoglobulin allotypes (Table 1). The expression of anti-LPS immunoglobulin IgG2a allotypes in resistant cattle was significantly different from the IgG2a A1 allotype predominating (p <0.05) in Brucella abortus susceptible cattle59,60 while previous studies have disputed the role if any that antibodies play in natural resistance to Brucella abortus in cattle.61,62 No association of resistance with BoLA class I alleles was demonstrated; however, mammary and monocyte-derived macrophages from re-

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

23

Table 2. Association of bovine NRAMP1 SSCA polymorphism with bovine brucellosis resistant and susceptible phenotypes

NRAMP1 SSCA Type Resistant SSCA Susceptible SSCA Total

In Vivo Resistant Phenotype

In Vivo Susceptible Phenotype

9* 2 11

2 9 11

* Significant association-p = 0.0089 (Fisher’s Exact Test)

sistant cows and bulls were significantly more active than macrophages obtained from susceptible cows and bulls in terms of (1) respiratory burst activity in response to opsonized Brucella abortus;63 and (2) ability to control replication of Brucella abortus.64-66 The differential response between macrophages from resistant and susceptible cattle was similar to that observed in mice strains carrying Nramp1G169 or Nramp1D169 in response to infection with BCG, Leishmania donovani, Mycobacterium paratuberculosis, and Salmonella typhimurium.67-69 In addition to their capacity to restrict the intracellular replication of Brucella abortus, macrophages isolated from resistant cattle were able to restrict the growth of BCG and Salmonella dublin significantly better than macrophages obtained from susceptible cattle.66 The brucellacidal capacity of macrophages in vitro predicted with >80% accuracy disease susceptibility in vivo. These striking similarities between bovine macrophage function in resistance to brucellosis and murine macrophage function in resistance to Salmonella, Mycobacterium and Leishmania supported the hypothesis that a bovine homolog of the murine Nramp1 gene is a major player in determining resistance to brucellosis. Consequently, the bovine homolog of mouse Nramp1, designated bovine NRAMP1 was cloned and the cDNA sequenced.57 The DNA sequences of the murine Nramp1, human NRAMP1 and bovine NRAMP1 show a remarkable degree of conservation. The predicted amino acid similarity between mouse Nramp1 and bovine NRAMP1 is 87% and 89% between human NRAMP1 and bovine NRAMP1.44,57 Bovine NRAMP1 encodes for a 60 KDa protein predominantly expressed in macrophages of the reticuloendothelial system. Specific characteristics of the mouse Nramp1 and human NRAMP1 proteins including N terminus SH3 motif, four PKC phosphorylation sites, and a ‘binding protein dependent transport system inner membrane component signature’ are also present in the bovine NRAMP1 protein.5,57,70 Additionally, binding motifs for regulation of specific tissue expression of bovine NRAMP1 are conserved in the 5′ untranslated region from position -257 to -80, 5′ to start the codon. These include protein binding sites for IRE, NF-IL6, PU.1, PEA-3, W element and NF-κB. In cattle, NRAMP1 was mapped to bovine chromosome 2 within the linkage group on mouse chromosome 1 and human chromosome 2q harbouring Nramp1/NRAMP1.71-75 Cattle and several other animal species including humans, rats, chickens, bovine, bison, water buffalo, sheep, red deer, and moose possess a glycine residue at position 169 of the Nramp1 protein arguing in favour of the importance of this amino acid in protein function. Two sequence variants within bovine NRAMP1 have been identified and associated with disease resistance. These sequence variants are located within the 3' untranslated portion of bovine NRAMP1 and show a complex mutation pattern consisting of a T to G substitution at position 1782 and a variation in the number of GT dinucleotide repeats in a (GT)n microsatellite at position 1907.76,77 The variation in microsatellite length ranged from (GT)13 to (GT)16 and showed significant association with resistance to bovine brucellosis in SSCA analyses (Table 2). A (GT)n microsatellite was also detected in the 3′ UTR of NRAMP1 isolated from bison,

24

The Nramp Family

water buffalo, goat, sheep, red deer, white-tailed deer, fallow deer and moose, however the T to G substitution at position 1782 was present only in cattle76,78 (J.W.T. unpublished data). The two alleles observed for the T to G substitution in cattle were designated 1782T(GT)11 and 1782 G(GT)10 and shown to segregate with resistance to brucellosis in 10 unrelated animals as well as within one family studied (J.W.T., unpublished data). The impact of the (GT)n sequence variant at position 1907 on NRAMP1 function was studied using an experimental system in which bovine NRAMP1 under the regulatory control of its own promoter was transfected into murine RAW264.7 macrophage cell (Nramp1D169).79 The polymorphism within the microsatellite in the 3' untranslated region critically affects the expression of bovine NRAMP1 and the control of in vitro replication of Brucella abortus but not Salmonella dublin. A role for microsatellites in the regulation of gene expression has previously been proposed and is thought to be mediated through changes in the α-helical phasing between transcription factor binding domains.80-82 These binding domains flank the sequence repeat and are found in a specific phase along the α-helix that allows their transcription factor ligands to bind the DNA in a cooperative fashion. Any alteration in the length of the repeat sequence may affect the cooperative binding of the transcription factors needed for optimal expression of the gene. These observations suggest that resistance to Brucella abortus infection in cattle may be attributable to the transcriptional regulation of NRAMP1 mediated through the length of the 3′ UTR poly (GT) repeat sequence. Although the bovine NRAMP1 gene is one of the major candidate gene controlling natural resistance to brucellosis, it does not determine resistance and susceptibility to infection with Mycobacterium bovis in cattle.83 This finding is in agreement with recent studies in the mouse that have failed to establish a role for Nramp1 in protection against virulent Mycobacterium tuberculosis.84,85 However, in humans, genetic variants at NRAMP1 contribute clearly to the risk and the progression of mycobacterial infections in humans, although it accounts for only a modest proportion of the overall genetic component of natural resistance to tuberculosis.86-88

Conclusions Infectious diseases remain among the most important burdens on human and animal health notwithstanding antibiotic therapy and immunization that have contributed substantially to the their control. One fundamental aspect of infectious disease pathogenesis is the identification of host genes that play a critical role in determining the outcome of host-pathogen interactions. Studies in important agricultural animals have demonstrated the role of such heritable factors in governing the susceptibility to infectious diseases. Identification of the molecular basis of host resistance to pathogens offers the possibility to improve disease resistance of breeding stock through marker-assisted selection.12,13 It is clear that any form of resistance to disease is relative rather than absolute due to the complex nature of the host pathogen interaction. Application of marker-assisted selection will be limited to genes of moderate to large effect until the host response to a specific infection is fully dissected.12 Thus, breeding animals to increase their level of natural resistance is not expected to completely prevent infectious diseases. However, the increased level of natural resistance conferred by selective breeding would be expected to reduce morbidity and economic losses caused by infectious diseases. The emerging genomic resources for farm animals coupled with new technologies for gene transfer will eventually facilitated the genetic improvement of agricultural important animals.14,73,89-93

Acknowledgments Judith Caron is the recipient of a Canadian Institutes for Health Research (CIHR) fellowship. Garry Adams is supported by the Texas Agricultural Experiment Station Projects No. 6194 and 8409, USDA NRICGP Project No. 2002-35204-11624, and DHHS/PHS/NIH-1 RO1 A144170-01A1. Danielle Malo is a member of the federal Networks of Centres of Excellence- the Canadian Bacterial Diseases Network (CBDN) and a scholar of CIHR and an International Research Scholar of the Howard Hughes Medical Institute (HHMI).

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

25

References 1. Cameron HS, Hughes EH, Gregory PW. Genetic resistance to brucellosis in swine. J Anim Sci 1942; 1:106-110. 2. Roberts E, Card LE. The inheritance of resistance to bacillary white diarrhea. Poult Sci 1926; 6:18-23. 3. Hutt FB. Genetic Resistance to Disease in Domestic Animals. Ithaca, NY: Comstock Publishing Associates; 1958. 4. Buer J, Balling R. Mice, microbes and models of infection. Nat Rev Genet 2003; 4(3):195-205. 5. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 1993; 73(3):469-485. 6. Wei L, Liu Y, Dubchak I et al. Comparative genomics approaches to study organism similarities and differences. J Biomed Inform 2002; 35(2):142-150. 7. Shakarad M, Prasad NG, Rajamani M et al. Evolution of faster development does not lead to greater fluctuating asymmetry of sternopleural bristle number in Drosophila. J Genet 2001; 80(1):1-7. 8. O’Brien SJ, Menotti-Raymond M, Murphy WJ et al. The promise of comparative genomics in mammals. Science 1999; 286(5439):458-462, 479-481. 9. Nadeau JH, Taylor BA. Lengths of chromosomal segments conserved since divergence of man and mouse. Proc Natl Acad Sci USA 1984; 81(3):814-818. 10. Hudson TJ, Church DM, Greenaway S et al. A radiation hybrid map of mouse genes. Nat Genet 2001; 29(2):201-205. 11. Waterston RH, Lindblad-Toh K, Birney E et al. Initial sequencing and comparative analysis of the mouse genome. Nature 2002; 420(6915):520-562. 12. Dekkers JC, Hospital F. The use of molecular genetics in the improvement of agricultural populations. Nat Rev Genet 2002; 3(1):22-32. 13. Andersson L. Genetic dissection of phenotypic diversity in farm animals. Nat Rev Genet 2001; 2(2):130-138. 14. Brown WR, Hubbard SJ, Tickle C et al. The chicken as a model for large-scale analysis of vertebrate gene function. Nat Rev Genet. 2003; 4(2):87-98. 15. Adams LG, Barthel R, Gutiérrez JA et al. Bovine natural disease resistance macrophage protein 1 (NRAMP1) gene. Arch Tierz 1999; 42:42-55. 16. Hu J, Bumstead N, Barrow P et al. Resistance to salmonellosis in the chicken is linked to NRAMP1 and TNC. Genome Res 1997; 7(7):693-704. 17. Bradley DJ. Regulation of Leishmania populations within the host. II. genetic control of acute susceptibility of mice to Leishmania donovani infection. Clin Exp Immunol 1977; 30(1):130-140. 18. Plant J, Glynn AA. Genetics of resistance to infection with Salmonella typhimurium in mice. J Infect Dis 1976; 133(1):72-78. 19. Skamene E, Gros P, Forget A et al. Genetic regulation of resistance to intracellular pathogens. Nature 1982; 297(5866):506-509. 20. Malo D, Vogan K, Vidal S et al. Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics 1994; 23(1):51-61. 21. Vidal S, Tremblay ML, Govoni G et al. The Ity/Lsh/Bcg locus: Natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J Exp Med 1995; 182(3):655-666. 22. Govoni G, Vidal S, Gauthier S et al. The Bcg/Ity/Lsh locus: Genetic transfer of resistance to infections in C57BL/6J mice transgenic for the Nramp1 Gly169 allele. Infect Immun 1996; 64(8):2923-2929. 23. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185(4):717-730. 24. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: natural resistance- associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192(9):1237-1248. 25. Bumstead N, Palyga J. A preliminary linkage map of the chicken genome. Genomics 1992; 13(3):690-697. 26. Cheng HH. Mapping the chicken genome. Poult Sci 1997; 76(8):1101-1107. 27. Cheng HH, Levin I, Vallejo RL et al. Development of a genetic map of the chicken with markers of high utility. Poult Sci 1995; 74(11):1855-1874. 28. Crooijmans RP, Dijkhof RJ, van der Poel JJ et al. New microsatellite markers in chicken optimized for automated fluorescent genotyping. Anim Genet 1997; 28(6):427-437.

26

The Nramp Family

29. Dodgson JB, Cheng HH, Okimoto R. DNA marker technology: a revolution in animal genetics. Poult Sci 1997; 76(8):1108-1114. 30. Groenen MA, Cheng HH, Bumstead N et al. A consensus linkage map of the chicken genome. Genome Res 2000; 10(1):137-147. 31. Levin I, Santangelo L, Cheng H et al. An autosomal genetic linkage map of the chicken. J Hered 1994; 85(2):79-85. 32. Burt DW, Bruley C, Dunn IC et al. The dynamics of chromosome evolution in birds and mammals. Nature 1999; 402(6760):411-413. 33. Nanda I, Shan Z, Schartl M et al. 300 million years of conserved synteny between chicken Z and human chromosome 9. Nat Genet 1999; 21(3):258-259. 34. Surveillance of bacterial and mycotic diseases. CDC Surveill Summ. 2002. 35. Scott E. Foodborne disease and other hygiene issues in the home. J Appl Bacteriol 1996; 80(1):5-9. 36. Barrow PA, Huggins MB, Lovell MA. Host specificity of Salmonella infection in chickens and mice is expressed in vivo primarily at the level of the reticuloendothelial system. Infect Immun 1994; 62(10):4602-4610. 37. Wigley P, Hulme SD, Bumstead N et al. In vivo and in vitro studies of genetic resistance to systemic salmonellosis in the chicken encoded by the SAL1 locus. Microbes Infect 2002; 4(11):1111-1120. 38. Bumstead N, Barrow PA. Genetics of resistance to Salmonella typhimurium in newly hatched chicks. Br Poult Sci 1988; 29(3):521-529. 39. Bumstead N, Reece RL, Cook JK. Genetic differences in susceptibility of chicken lines to infection with infectious bursal disease virus. Poult Sci 1993; 72(3):403-410. 40. Protais J, Colin P, Beaumont C et al. Line differences in resistance to Salmonella enteritidis PT4 infection. Br Poult Sci 1996; 37(2):329-339. 41. Hu J, Bumstead N, Burke D et al. Genetic and physical mapping of the natural resistance-associated macrophage protein 1 (NRAMP1) in chicken. Mamm Genome 1995; 6(11):809-815. 42. Girard-Santosuosso O, Bumstead N, Lantier I et al. Partial conservation of the mammalian NRAMP1 syntenic group on chicken chromosome 7. Mamm Genome 1997; 8(8):614-616. 43. Hu J, Bumstead N, Skamene E et al. Structural organization, sequence, and expression of the chicken NRAMP1 gene encoding the natural resistance-associated macrophage protein 1. DNA Cell Biol 1996; 15(2):113-123. 44. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 1994; 180(5):1741-1752. 45. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92(22):10089-10093. 46. Leveque G, Forgetta V, Morroll S et al. Allelic Variation in TLR4 Is Linked to Susceptibility to Salmonella enterica Serovar Typhimurium Infection in Chickens. Infect Immun 2003; 71(3):1116-1124. 47. Qureshi ST, Lariviere L, Sebastiani G et al. A high-resolution map in the chromosomal region surrounding the Lps locus. Genomics 1996; 31(3):283-294. 48. Sebastiani G, Olien L, Gauthier S et al. Mapping of genetic modulators of natural resistance to infection with Salmonella typhimurium in wild-derived mice. Genomics 1998; 47(2):180-186. 49. Caron J, Loredo-Osti JC, Laroche L et al. Identification of genetic loci controlling bacterial clearance in experimental Salmonella enteritidis infection: an unexpected role of Nramp1 (Slc11a1) in the persistence of infection in mice. Genes Immun 2002; 3(4):196-204. 50. Girard-Santosuosso O, Lantier F, Lantier I et al. Heritability of susceptibility to Salmonella enteritidis infection in fowls and test of the role of the chromosome carrying the NRAMP1 gene. Genet Sel Evol 2002; 34(2):211-219. 51. Lamont SJ, Kaiser MG, Liu W. Candidate genes for resistance to Salmonella enteritidis colonization in chickens as detected in a novel genetic cross. Vet Immunol Immunopathol 2002; 87(3-4):423-428. 52. Beaumont C, Protais J, Pitel F et al. Effect of two candidate genes on Salmonella carrier-state in fowl. Poult Sci 2003; 82(5):721-6. 53. Blackwell JM, Black GF, Sharples C et al. Roles of Nramp1, HLA, and a gene(s) in allelic association with IL-4, in determining T helper subset differentiation. Microbes Infect 1999; 1(1):95-102. 54. Wojciechowski W, DeSanctis J, Skamene E et al. Attenuation of MHC class II expression in macrophages infected with Mycobacterium bovis bacillus Calmette-Guerin involves class II transactivator and depends on the Nramp1 gene. J Immunol 1999; 163(5):2688-2696. 55. Adams LG, Templeton JW. Genetic resistance to bacterial diseases of animals. Rev Sci Tech Apr 1998; 17(1):200-219.

Genetic Susceptibility to Infectious Diseases Linked to NRAMP1 Gene in Farm Animals

27

56. Horin P. Biological principles of heredity of and resistance to disease. Rev Sci Tech 1998; 17:302-314. 57. Feng J, Li Y, Hashad M et al. Bovine natural resistance associated macrophage protein 1 (Nramp1) gene. Genome Res Oct 1996; 6(10):956-964. 58. Templeton JW, Adams LG. Natural resistance to bovine brucellosis. In: Adams LG, ed. Advances in Brucellosis Research: An International Symposium. College Station: Texas A&M University Press, 1990:144-150. 59. Adams LG, Templeton JW. Identifying candidate genes for natural resistance to brucellosis. Proc Annu Meet US Anim Health Assoc 1995:111-115. 60. Estes DM, Templeton JW, Hunter DM et al. Production and use of murine monoclonal antibodies reactive with bovine IgM isotype and IgG subisotypes (IgG1, IgG2a, and IgG2b) in assessing immunoglobulin levels in serum of cattle. Vet Immunol Immunopathol 1990; 25:61-72. 61. Gwakisa PS, Minga UM. Humoral factors of natural resistance of Bos indicus cattle selected for antibody titre to Brucella abortus. Scand J Immunol 1992; 36(Suppl)11:99-102. 62. Thimm B. Zum Problem einer erhöhten engeborenen Resistenz der ostafrikanischen KurzhornZeburasse (Bos indicus) gegenüber Brucellose. Zentralbl Veterinarmed ‘B. 1973; 20:490-494. 63. Harmon BG, Adams LG, Templeton JW et al. Macrophage function in mammary glands of Brucella abortus-infected cows and cows that resisted infection after inoculation of Brucella abortus. Am J Vet Res Apr 1989; 50(4):459-465. 64. Campbell GA, Adams LG. The long-term culture of bovine monocyte-derived macrophages and their use in the study of intracellular proliferation of Brucella abortus. Vet Immunol Immunopathol 1992; 34:291-305. 65. Price RE, Templeton JW, Smith R et al. Ability of mononuclear phagocytes from cattle naturally resistant or susceptible to brucellosis to control in vitro intracellular survival of Brucella abortus. Infect Immun 1990; 58:879-886. 66. Qureshi T, Templeton JW, Adams LG. Intracellular survival of Brucella abortus, Mycobacterium bovis (BCG), Salmonella dublin and Salmonella typhimurium in macrophages from cattle genetically resistant to Brucella abortus. Vet Immunol Immunopathol 1996; 50:55-66. 67. de Chastellier C, Frehel C, Offredo C et al. Implication of phagosome-lysosome fusion in restriction of Mycobacterium avium growth in bone marrow macrophages from genetically resistant mice. Infect Immun 1993; 61(9):3775-3784. 68. Radzioch D, Hudson T, Boule M et al. Genetic resistance/susceptibility to mycobacteria: phenotypic expression in bone marrow derived macrophage lines. J Leukoc Biol 1991; 50:263-272. 69. Radzioch D, Kramnik I, Skamene E. Molecular mechanisms of natural resistance to mycobacterial infections. Circulatory Shock 1995; 44:115-120. 70. Blackwell JM. Structure and function of the natural-resistance-associated macrophage protein (Nramp1), a candidate protein for infectious and autoimmune disease susceptibility. Molecular Medicine 1996; 2:205-211. 71. Barendze W, Armitage SM, Kossarek LM et al. A genetic linkage map of the bovine genome. Nature Genetics 1994; 6:223-235. 72. Bishop MD, Kappes SM, Keele JW et al. A genetic linkage map for cattle. Genetics 1994; 136:619-639. 73. Fries R, Eggen A, Womack JE. The bovine genome map. Mammalian Genetics 1993; 4:405-428. 74. Malo D, Vidal S, Lieman JH et al. Physical delineation of the minimal chromosomal segment encompassing the murine host resistance locusBcg. Genomics. 1993; 17:667-675. 75. Womack JE, Moll YD. Gene map of the cow: conservation of linkage with mouse and man. J Hered 1986; 77:2-7. 76. Horin P, Rychlik I, Templeton JW et al. A complex pattern of microsatellite polymorphism within the bovine NRAMP1 gene. Eur J Immunogenet. Aug 1999; 26(4):311-313. 77. Sarkar G, Cassady J, Bottema CDK et al. Characterization of polymerase chain reaction amplification of specific alleles. Anal Biochem 1990; 186:64-68. 78. Matthews GD, Crawford AM. Cloning, sequencing and linkage mapping of the NRAMP1 gene of sheep and deer. Anim Genet Feb 1998; 29(1):1-6. 79. Barthel R, Feng J, Piedrahita JA et al. Stable transfection of the bovine NRAMP1 gene into murine RAW264.7 cells: effect on Brucella abortus survival. Infect Immun May 2001; 69(5):3110-3119. 80. Becker JC, Nikroo A, Brabletz T et al. DNA loops induced by cooperative binding of transcriptional activator proteins and preinitiation complexes. Proc Natl Acad Sci USA Oct 10 1995; 92(21):9727-9731. 81. Griffith J, Hochschild A, Ptashne M. DNA loops induced by cooperative binding of lambda repressor. Nature Aug 21-27 1986; 322(6081):750-752.

28

The Nramp Family

82. Hochschild A, Ptashne M. Cooperative binding of lambda repressors to sites separated by integral turns of the DNA helix. Cell Mar 14 1986; 44(5):681-687. 83. Barthel R, Piedrahita JA, McMurray DN et al. Pathologic findings and association of Mycobacterium bovis infection with the bovine NRAMP1 gene in cattle from herds with naturally occurring tuberculosis. Am J Vet Res Sep 2000; 61(9):1140-1144. 84. Medina E, North RJ. The Bcg gene (Nramp1) does not determine resistance of mice to virulent Mycobacterium tuberculosis. Ann N Y Acad Sci Oct 25 1996; 797:257-259. 85. Medina E, North RJ. Genetically susceptible mice remain proportionally more susceptible to tuberculosis after vaccination. Immunology Jan 1999; 96(1):16-21. 86. Bellamy R, Beyers N, McAdam KP et al. Genetic susceptibility to tuberculosis in Africans: a genome-wide scan. Proc Natl Acad Sci USA Jul 5 2000; 97(14):8005-8009. 87. Bellamy R, Ruwende C, Corrah T et al. Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N Engl J Med 1998; 338:640-644. 88. Greenwood CM, Fujiwara TM, Boothroyd LJ et al. Linkage of tuberculosis to chromosome 2q35 loci, including NRAMP1, in a large aboriginal Canadian family. Am J Hum Genet 2000; 67(2):405-416. 89. Muller M, Brem G. Transgenic strategies to increase disease resistance in livestock. Reprod Fertil Dev 1994; 6(5):605-613. 90. Muller M, Brem G. Intracellular, genetic or congenital immunisation-transgenic approaches to increase disease resistance of farm animals. J Biotechnol Jan 26 1996; 44(1-3):233-242. 91. Pursel VG, Rexroad CE Jr. Recent progress in the transgenic modification of swine and sheep. Mol Reprod Dev Oct 1993; 36(2):251-254. 92. Riggs PK, Owens KE, Rexroad CE et al. Development and initial characterization of a Bos taurus x B. gaurus interspecific hybrid backcross panel. J Hered Sep-Oct 1997; 88(5):373-379. 93. Womack JE, Kata SR. Bovine genome mapping: Evolutionary inference and the power of comparative genetics. Current Opinion in Genetics & Development 1995; 5:725-733.

CHAPTER 3

The NRAMP Genes and Human Susceptibility to Common Diseases Audrey Poon and Erwin Schurr

Abstract

R

esults obtained in murine models have raised the hope that human NRAMP genes could be important determinants of susceptibility for common human diseases. There is good agreement among studies conducted in racially vastly different populations that NRAMP1 alleles are risk factors for tuberculosis. However, the extent of the NRAMP1 mediated risk may vary according to the specific epidemiologic setting. There is also good evidence that NRAMP1 is involved in susceptibility to autoimmune diseases, such as rheumatoid arthritis, especially for patients who present early onset of disease. A large number of additional diseases with either known or suspected infectious etiology have also been investigated for a possible contribution of NRAMP1 to risk of disease. In most examples, replication studies are needed before firm conclusions can be reached. In contrast to NRAMP1, no disease associations have been identified for NRAMP2.

Introduction It is becoming increasingly evident that human genetic variability is an important modulator for the risk of acquiring common human diseases. Unfortunately, the identity of genetic variants that impact on risk of disease is largely unknown. A major hurdle in identifying genetic risk factors in human infectious disease is the complex genetic control of such phenotypes, and susceptibility to infectious diseases is frequently referred to as a “complex trait.” Complex traits are characterized by incomplete penetrance, polygenic contribution to trait expression and genetic heterogeneity.1 To identify susceptibility genes, geneticists are employing linkage and/or association studies.2 If the correct genetic model is known, parametric linkage studies are the most powerful means of identifying disease variants. However, the mode of inheritance, the penetrance of predisposing alleles, the frequency of disease alleles and other pertinent parameters are usually not known for susceptibility to infectious diseases and non-parametric linkage methods are employed. These methods, especially if used for genome wide searches, have limited sensitivity to detect genes impacting on disease susceptibility and usually only allow the identification of genes that exert strong effects on susceptibility. To identify genes that exert moderate genetic effects on susceptibility to disease candidate genes are employed. Candidate genes are selected based on their known or proposed function in humans or animal models. Specifically, animal models can provide useful candidates to be tested in human populations. For example, the mouse model of susceptibility to early resistance/susceptibility to infection with Mycobacterium bovis (BCG) led to the identification of the human NRAMP1 gene as a risk factor in susceptibility to mycobacterial disease.3-6 Most commonly candidate genes are employed in association studies. By comparing the frequencies The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

30

The Nramp Family

of candidate gene alleles in affected and non-affected individuals, or by analysing the number of transmissions of such alleles from parents to affected children, association of the studied allele with susceptibility to disease can be established. Association between allele(s) and susceptibility to infectious disease may imply that either the allele is the disease causing variant or that it is in physical proximity to the allele causally involved in disease development.1,7 Presently much of the research aimed at deciphering the genetic component of infectious disease susceptibility is employing association studies. It is noteworthy that association studies while providing a powerful means of analysis also present distinct disadvantages. Specifically, small numbers of individuals enrolled, undetected population substructures, allelic heterogeneity, failure to correct for multiple testings or for not reported testings as well as publication bias have led to the publication of false positive and false negative studies. Hence, replication of association findings (or the absence of such associations) is critical for a full appreciation of the role of studied genetic variants as risk or protective factors for infectious diseases.

NRAMP1 Gene Location and Structure The official nomenclature for the human natural resistance-associated macrophage protein 1 (NRAMP1) gene is solute carrier family 11 (protein-coupled divalent metal ion transporter) member 1 (SLC11A1) gene. The rationale for renaming commonly known genes with essentially meaningless and highly obscure complex gene family designations has been questioned in the past and the discussion of the pros and cons is outside the scope of this review.8 In this review, we will adhere to the originally assigned gene designation NRAMP1. NRAMP1 was cloned and mapped to chromosomal region 2q35, in close proximity to the interleukin 8 receptor gene (IL8R), the villin gene (VIL) and the recently identified Nuclear LIM Interactor-Interacting Factor gene (NLI-IF).4,6,9-12 Interestingly, the NRAMP1 gene is located in a genomic region with extreme density of Alu- and other genomic repeat clusters.12,13 The NRAMP1 gene consists of 15 exons and spans 13kb.4,10 An alternative splice site exists within intron 4. The regular spliced gene is predicted to encode a 550 amino acid protein, with 12 putative transmembrane domains, 2 N-linked glycosylation sites and 1 evolutionary conserved consensus transport motif. The alternatively spliced gene is predicted to encode a truncated protein due to a premature stop codon in alternatively spliced exon 5.4,10 This truncated protein is assumed to be nonfunctional. The transcription start site has been mapped at 148 bp or 175 bp 5’of the translation codon.10,14 Regulatory motifs within the NRAMP1 promoter include 1 TATA box element, 6 IFNγ response elements, 3 W-elements, 3 NFκB binding sites, 1 AP-1 site, 1 Z-DNA forming enhancer element and 9 purine-rich GGAA core motifs for the myeloid-specific PU.1 transcription factor.4,10,11 The presence of these consensus and binding motifs for transcriptional activation is consistent with the effects of known immune modulators of NRAMP1.

NRAMP1 Polymorphisms

A total of 11 polymorphisms have been identified and verified in the NRAMP1 gene.6,10,15,16 One repeat polymorphism and one single nucleotide polymorphism (SNP) are located in the promoter region, (designated as 5’(CA)n and –236C/T, respectively), while nine biallelic polymorphisms are found in the remainder of the gene. Four of the eight biallelic polymorphisms occur in the coding region of which two introduce an amino acid change (A318V in exon 9 and D543N in exon 15); three polymorphisms occur in intronic regions (469+14G/C in intron 4; 577-18G/A in intron 5 and 1465-85G/A in intron 13); two insertion/deletion polymorphisms are found in the 3’UTR of NRAMP1 (1729+55delTGTG and 276insCAAA280; Fig. 1). Specifically, the 5’ (CA)n polymorphism has been the focus of intensive study in efforts to link select gene polymorphisms to altered NRAMP1 functional activity. The 5’(CA)n polymorphism has been proposed to function as an enhancer element due to its predicted Z-DNA

The NRAMP Genes and Human Susceptibility to Common Diseases

31

A

B

Figure 1. Schematic presentation of the intron-exon organization of the two human NRAMP genes. A) Location of polymorphisms in the NRAMP1 gene. Adapted from references 4 and 6. B) Location of polymorphisms in the NRAMP2 gene. Adapted from references 72 and 82.

forming properties.5 DNA segments in a “Z” secondary structure interact with a distinct class of binding proteins to regulate transcriptional activity. Four alleles of the 5’(CA)n polymorphism have been observed in 36 Brazilian multicase families of leprosy, tuberculosis (TB) and visceral leishmaniasis. The four alleles are T(GT)5AC(GT)5AC(GT)nG, n = 11 (allele 1), 10 (allele 2), 9 (allele 3) and 4 (allele 4).10 Four additional alleles have been observed in different populations; n=8 was observed in a Texas TB study 17, alleles 5 (T(GT)4AC(GT)5AC(GT)10G and 6 (T(GT)5AC(GT)5AC(GT)4AT(GT)4GGCAGA(G)7) were observed in a primary biliary cirrhosis case control study, and allele 7 (T(GT)5AC(GT)5AT(GT)11GGCAGA(G)6 ) was observed in a Japanese study investigating

32

The Nramp Family

NRAMP1 polymorphisms in inflammatory bowel disease (IBD).17-19 In all populations studied, allele 3 (n=9) is the most frequent representing 75% to 80% of all chromosomes followed by allele 2 (n=10) which is found in approximately 20% to 25% of all chromosomes. The remaining promoter alleles are rare variants. The four promoter repeat alleles identified in the Brazilian study were shown to drive differential expression of a luciferase reporter construct following transfection into myeloid U937 cells.5 In the absence of exogeneous stimuli, alleles 1, 2 and 4 were poor promoters; while allele 3 drove high luciferase expression. In the presence of interferon γ (IFNγ), all four alleles showed enhanced gene expression. Such enhancement after stimulation with IFN-γ implies that multiple γ-IREs flanking the Z-DNA forming polymorphic repeats are important in enhancing gene expression across all 4 alleles. Addition of bacterial antigen lipopolysaccharide (LPS) in the presence of IFN-γ had no effect on alleles 1 and 4 expression while it caused significant expression reduction driven by allele 2 and enhanced expression driven by allele 3.5 These results supported the view that NRAMP1 protein would be synthesized by cells belonging to the monocyte-macrophage lineage in response to microbial assault and that certain individuals, depending on their promoter NRAMP1 alleles, would be able to mount a more vigorous production of NRAMP1 protein resulting in increased disease resistance. If and to what extent this expectation will hold true is presently unknown.

NRAMP1 Function In humans, NRAMP1 mRNA is expressed in spleen, lung, liver, and most abundantly in peripheral blood leukocytes.4,20 The function of human NRAMP1 is not known. Consequently, it is presently unclear if known NRAMP1 polymorphisms impact on the function of NRAMP1 protein, and this is clearly a question that requires further study. It appears likely that NRAMP1 protein has a function that is closely related to the one of its mouse ortholog Nramp1. The mouse protein is targeted to the phagosomal membrane where it controls pathogen replication by transporting divalent cations across the phagosomal membrane.3,21 The direction of transport is still controversial but most likely proceeds from the vesicular lumen into the cytoplasm. Absence of Nramp1 in the phagosomal membrane results in altered cation fluxes that in turn trigger substantial changes in intracellular vesicle trafficking.

NRAMP1 and Infectious Diseases Susceptibility The World Health Organization (WHO) reported that in the year 2000, one third of total global deaths were caused by infectious diseases. Epidemiologic and genetic studies suggest that susceptibility to and progression of infectious diseases are determined by the genetic makeup of the host, pathogen factors and the interplay between environment, host and pathogen. Infectious diseases caused by mycobacteria are one of the most challenging global health problems. Consequently, enormous efforts have been directed to the investigation of susceptibility to TB and leprosy, the two most prevalent human mycobacterial diseases. TB is an infectious disease caused by Mycobacterium tuberculosis. M. tuberculosis transmission occurs via aerosols and the main site of infection and disease manifestation are the lungs. Other sites that may show pathological changes in response to M. tuberculosis infection include the larynx, lymph nodes, pleura, brain, kidneys or bones and joints (often summarily referred to as extrapulmonary TB). The mycobacteria can also enter the bloodstream and spread to all parts of the body (miliary TB). If an infected individual develops TB within approximately one year of infection, the disease is often categorized as primary TB. If disease develops years after infection, it is categorized as reactivation TB. Leprosy, caused by Mycobacterium leprae, exhibits a spectrum of clinical phenotypes, ranging from localized, paucibacillary forms (tuberculoid leprosy) to disseminated, multibacillary forms (lepromatous leprosy). M. leprae induced pathological changes occur mainly in the skin and peripheral nerves, but can also involve other areas such as the eyes, nose, or testicles.22 It is important to realize that severe neurological damage frequently occurs in patients that have

The NRAMP Genes and Human Susceptibility to Common Diseases

33

been microbiologically cured of the disease. Following cure, in particular multibacillary patients may suffer from vigorous, neuro-destructive auto-inflammatory reactions, so called reversal reaction, and hence require lengthy follow-up after antibiotic treatment.

NRAMP1 and Susceptibility to Tuberculosis Linkage studies aimed at providing evidence for NRAMP1 as a susceptibility gene in TB have been done in human populations of varying racial and ethnic backgrounds and epidemiological settings. Generally speaking, linkage studies have provided inconsistent evidence for a role of NRAMP1 in TB susceptibility. For example, a genome scan in South African and Gambian sibpairs did not detect any significant evidence for linkage between the NRAMP1 region and TB.23 Interestingly, an earlier study in a large number of Brazilian TB families provided evidence for linkage of two markers tightly linked to NRAMP1, but not for NRAMP1 itself.24,25 In striking contrast to the above linkage studies, a genetic analysis of a TB outbreak in an aboriginal Canadian community provided strong evidence for linkage between NRAMP1 and TB susceptibility.26 Differences in markers employed, patient recruitment schemes, population histories and/or analytical methodologies may have contributed to the different results in the above linkage studies. For example, the Canadian study investigated the role of NRAMP1 in rapid progression of infection to disease by recruiting cases who developed TB shortly after infection. In contrast, the other studies investigated the role of NRAMP1 in TB infection susceptibility by recruiting patients who represented an unknown mix of rapid and slow progression from infection to TB. Likewise, the Canadian study considered the exposure history of patients to model gene-environment interactions while other studies solely considered the impact of NRAMP1, or closely linked genetic markers, on TB. Interestingly, by neglecting exposure histories evidence for linkage of NRAMP1 with TB dissipated even in the Canadian study. Lastly, human populations are evolving under different environmental pressures, and genetic variability among races may result in genetically heterogeneous control of TB susceptibility. In addition to linkage studies, many association studies have been conducted to investigate the role of NRAMP1 in TB susceptibility. In a large population based association study done in The Gambia, four polymorphisms (5’(CA)n, 469+14G/C, D543N and 1729+55del4) displayed association with tuberculosis.27 For each of these polymorphisms, the rare alleles increased the risk of developing TB, with odd ratios of 1.5-1.9. Further analyses on Gambian TB patients showed that promoter alleles 1 and 2 conferred risk to TB while allele 3 offered protection.28 The two 5’ polymorphisms (5’(CA)n and 469+14G/C) are in strong linkage disequilibrium, as are the two 3’ polymorphisms (D543N and 1729+55del4). However, there is only limited linkage disequilibrium between the 5’ and 3’ ends of NRAMP1, and 5’and 3’ NRAMP1 polymorphisms were independently associated with TB susceptibility. As a consequence, the risk to develop TB increased dramatically for individuals who were heterozygous for both the 5’and 3’polymorphism (OR=4.07; 95% CI 1.86-9.12). Following the Gambian study, NRAMP1 polymorphisms have been investigated by various groups in other populations. Confirmations and contradictions exist. Associations of 5’ polymorphisms with TB have been confirmed in Japanese TB patients but not in a Cambodian population.29,30 In addition, a family based association study done in Guinea-Conakry confirmed the association of the 469+14G/C polymorphism with TB.31 The Japanese study confirmed increased risk of TB associated with alleles 1 and 2 and a protective effect associated with allele 3 of the 5’(CA)n polymorphism. A study conducted among Caucasian TB patients in Denmark failed to detect an association of NRAMP1 polymorphisms with TB.32 However, in this study, among patients of divers racial backgrounds, an association with the 469 + 14G/ C polymorphism was observed in patients with microscopy-positive TB as compared to microscopy-negative cases. It is not clear if this finding was confounded by the unbalanced distribution of patients belonging to different racial groups among microscopy-positive and -negative TB cases. The 3’ NRAMP1 polymorphism associations with TB have been confirmed

34

The Nramp Family

in Korean and Japanese TB populations, however, studies conducted in Guinea-Conakry, Denmark and Taiwan did not detect any 3’polymorphism association with TB.31-33 The study in Cambodian patients detected a protective effect of the rare allele of the D543N polymorphism, contrary to the findings in the Gambian, Japanese and Korean populations.27,29,30,34 Additional contrasting findings came from a study of Caucasian TB patients in Houston that, in contrast to the Danish study, observed an excess of promoter allele 3 in non TB controls compared to pulmonary TB, extrapulmonary TB and HIV-positive TB patients (p=0.004).17 Within the different clinical forms of TB, the Houston study observed a significant increase of allele 2 in extrapulmonary as compared to pulmonary cases. This observation raised the enticing possibility that an effect of NRAMP1 on TB susceptibility may be more pronounced among extrapulmonary cases of TB. The notion that NRAMP1 variants are genetic risk factor in TB susceptibility is mostly agreed upon. It is difficult to envision that NRAMP1 polymorphisms are in linkage disequilibrium across racial boundaries with unknown disease causing polymorphisms in a gene other than NRAMP1. The only gene that one could suspect of being in linkage disequilibrium with NRAMP1 is NLI-IF and a contribution of this gene to TB susceptibility has been ruled out.35 Hence, the repeated reports in different ethnic populations of NRAMP1 polymorphisms being associated with TB are strong evidence to implicate NRAMP1 in TB susceptibility. What is not clear is the causal relationship between these NRAMP1 risk factors and TB disease, and the question if NRAMP1 measured risk of disease is more pronounced for specific forms of TB. For example, the finding that NRAMP1 variants are associated with microscopy-positive TB and extrapulmonary TB suggests that NRAMP1 is involved in control of bacillary growth and possibly dissemination rather than susceptibility to TB per se or susceptibility to infection with M. tuberculosis.17,32

NRAMP1 and Susceptibility to Leprosy In addition to classifying forms of leprosy according to number of skin lesions and counts of bacilli in skin smears, the disease can be classified more accurately according to motor and sensory changes and biopsy findings. These findings can classify the disease, as indeterminate, tuberculoid, borderline tuberculoid, mid-borderline, borderline lepromatous, and lepromatous leprosy.22 The role of NRAMP1 in susceptibility to leprosy has been investigated. A linkage study done on French Polynesian leprosy families failed to detect linkage between NRAMP1 and susceptibility to leprosy.36,37 By contrast, a linkage study performed on 20 Vietnamese multiplex leprosy families revealed significant linkage between an NRAMP1 haplotype and leprosy per se, i.e., leprosy regardless of the clinical leprosy manifestation.38 The reason for the differences in NRAMP1 linkage to leprosy in Vietnam and French Polynesia could be indicative of genetic heterogeneity of leprosy susceptibility. However, it is noteworthy to realize that the French Polynesia families did not provide the power to detect modest genetic effects on leprosy susceptibility. Considering that in a recent large scale genetic study of leprosy susceptibility in Vietnam the NRAMP1 region had only a modest impact on susceptibility (Lod score = 1.0; p < 0.02), it is clear that such a moderate genetic effect of NRAMP1 in the French Polynesian families could not have been detected.39 In addition to linkage studies, association studies have been carried out to investigate the role of NRAMP1 in leprosy susceptibility. A study in Mali did not detect any association between the tested polymorphisms and leprosy susceptibility per se.40 However, when substructured according to leprosy type, the leprosy population had an excess of heterozygotes for the NRAMP1 1729+55del4 polymorphism in the multibacillary group compared to the paucibacillary group; i.e., the risk of developing multibacillary leprosy is greater than paucibacillary leprosy if an individual carries at least one copy of the deletion allele (OR=5.79).40 Questions remain about the validity of stratifying patient populations in the absence of an overall effect. An association study done in an Indian population failed to detect associations

The NRAMP Genes and Human Susceptibility to Common Diseases

35

between the NRAMP1 5’polymorphisms and leprosy, keeping in mind that the polymorphisms tested were not very polymorphic in this Indian population.41 In contrast to the tuberculin skin test that is being used to establish infection by M. tuberculosis and measured at 48 hrs to 72 hrs after injection, the Mitsuda reaction, measures the granulomatous specific immune response against intradermally injected heat-killed M. leprae bacilli (lepromin) at 28 days post infection. The Mitsuda reaction has a reasonably good prognostic value for susceptibility to lepromatous forms of leprosy. Complex segregation analysis done in a Brazilian population suggested major gene control of Mitsuda reactivity.42 A linkage study of 20 nuclear Vietnamese families detected strong linkage of NRAMP1 with extent of Mitsuda reactivity; suggesting that NRAMP1 alleles influence the acquired anti-mycobacterial immune response.43 Interestingly, the linkage of NRAMP1 to Mitsuda reactivity appeared to be independent of the clinical phenotype of tested persons. Since granulomatous responses are indicative of a TH1-type immune response it is possible that NRAMP1 alleles impact on the TH1/TH2 balance of anti-mycobacterial immunity. This suggestion would be consistent with the observed association of NRAMP1 polymorphisms with leprosy type in the Mali study.40 Although a follow up study of the Brazilian population failed to detect linkage between NRAMP1 polymorphisms and Mitsuda reactivity, the very small sample size and failure to identify alleles by identity-by-state vs identity-by-descent may have contributed to the negative result.44

NRAMP1 and Susceptibility to Other Infectious Diseases Positive evidence supporting the role of NRAMP1 in susceptibility to TB and leprosy prompted its candidacy as susceptibility gene in other infectious diseases. For example, the possible role of NRAMP1 polymorphisms in HIV susceptibility has been investigated in a Columbian population.45 The results of this study indicated allele 3 of the 5’ (CA)n polymorphism to be a protective factor for HIV infection (RR=0.35 95%CI 0.14-0.91), along with the two linked SNPs (274C/T and 469+14G/C), while the 823C/T polymorphism is a risk factor (RR=2.29, 95%CI 1.06-4.92). The reason why the high expressing NRAMP1 promoter allele is associated with HIV infection susceptibility is not known but likely is a consequence of the pleiotropic effects of the NRAMP1 gene on macrophage physiology. Specifically, the recent finding that promoter allele 3 homozygotes drive increased TNFA production could offer a functional explanation since TNFA is known to drive high levels of HIV transcription and production of infectious particles.46 A Taiwanese study which investigated the role of NRAMP1 polymorphisms and susceptibility of TB in HIV seropositive patients did not detect any association with TB susceptibility; yet the 5’(CA)n polymorphism was not tested.33 In a similar study of HIV/TB co-infection in Caucasian subjects, it was observed that homozygotes and heterozygotes for promoter allele 3 were at increased risk for coinfection of HIV and TB (OR=6.86 95%CI 1.55-30.21).17 Hence, it appears that allele 3 of the 5’(CA)n repeat is a protective factor for TB in the absence of HIV infection, but becomes a risk factor for HIV/TB co-infection. Recently a Japanese study showed an association between the 5’promoter (CA)n repeat of NRAMP1 and Kawasaki disease in Japanese children.47 Although the causative agent of Kawasaki disease has not been identified, epidemiology and clinical features of the disease suggest an infectious etiology. The study detected allele 1 of the polymorphism to be a risk factor for Kawasaki disease in Japanese children. The results of the study are unusual since this is the only report associating allele 1 with disease susceptibility. Due to an increased frequency of allele 1 among Asians (3%-4%) as compared to non-Asians (<2%), a risk modulating effect of this allele may be easier to detect in Asian populations. Finally, evidence is now emerging that links NRAMP1 with susceptibility to visceral leishmaniasis.48 Earlier studies had failed to detect a link between visceral leishmaniasis and cutaneous leishmaniasis in Brazilian and Ethiopian patients, respectively.49,50 The possible role of NRAMP1 polymorphisms in Mycobacterium avium-intracellular complex (MAC) disease was investigated in two studies.51,52 Both studies failed to detect significant evidence for NRAMP1-mediated susceptibility. However, the sample sizes employed

36

The Nramp Family

would have only allowed to detect Mendelian effects of NRAMP1, a situation that is unlikely to occur. Other studies which investigated the role of NRAMP1 in infectious diseases and failed to detect associations include a South Indian study of Wuchereria bancrofti infection, a study of Vietnamese typhoid fever patients, and a study among Peruvian patients suffering from Trypanosoma cruzi infection.53-55

NRAMP1 and Autoimmune Diseases Susceptibility The finding of differential NRAMP1 expression driven by promoter alleles 2 and 3, respectively, is consistent with the hypothesis that alleles that are detrimental in relation to autoimmune disease susceptibility may be maintained in the population because they improve the survival following infectious challenges. The pleiotropic effects of NRAMP1, such as macrophage activation and inflammation regulation, and its likely function as an iron transporter further support the hypothesis of NRAMP1 alleles as risk modifiers of both autoimmune and infectious diseases. Many autoimmune diseases are characterized by chronic inflammation in specific organs. Rheumatoid arthritis (RA) is characterized by increased iron deposits in the synovial membrane and the presence of a chronic inflammatory response. A British study has investigated the linkage and association between NRAMP1 polymorphisms and RA susceptibility.56 Linkage and association were not detected with the 5’(CA)n polymorphism due to its low information content in the study population. However, D2S1471, a marker located an estimated 200 kbp from NRAMP1, was weakly linked to RA in a human lymphocyte antigen (HLA) discordant subgroup (p=0.05). Another UK study detected linkage (LOD=1.01, p=0.024) for a gene in the NRAMP1 area and a trend in nonrandom transmission of promoter allele 3 in RA affected offspring (χ2 = 3.9, p=0.048).57 By contrast, NRAMP1 promoter allele 3 was identified as a protective factor in Spanish RA patients who did not possess any HLA risk factor for RA.58 In addition to being a risk factor for RA susceptibility (OR=3.74; CI=1.31-10.72), allele 2 increases the risk of developing severe form of RA (OR=5.45). Association of the 5’(CA)n polymorphism with RA could not be found in Korean and Canadian patients.59,60 The Korean study, however, detected genotypic and allelic association between the NRAMP1 823C/T, D543N and 1729+55del4 polymorphisms with RA. The rare alleles of these polymorphisms were found more frequently in patients than in controls (allelic, p=0.006, genotypic, p<0.05). The Canadian study found the 543N allele and the deletion allele of 1729+55del4 polymorphisms to confer some protection against RA (p=0.014 for both polymorphisms), regardless of the HLA-DRB1 genotypes. Finally, a study in Latvia investigated the role of NRAMP1 in juvenile rheumatoid arthritis (JRA).61 This Latvian study observed allele 3 of the 5’(CA)n polymorphism to be a risk factor (OR=2.26), and allele 2 to be a protective factor for JRA (OR=0.44). Similar to RA, inflammatory bowel disease (Crohn’s disease (CD) and ulcerative colitis (UC)) is characterized by a chronic inflammatory response. CD is a particularly interesting phenotype to investigate for association with NRAMP1 because of cases of colonic TB that had been misdiagnosed as CD.62 The similarity in clinical presentation between CD and colonic TB may suggest a similar genetic influence on pathogenesis. Two microsatellites markers, D2S434 and D2S1323, which localize to the NRAMP1 gene region on human chromosome 2q35, were found to be associated with CD.63 These results are unlikely to implicate NRAMP1 in CD susceptibility since there is presently no data supporting the assumption that the two microsatellite markers are in linkage disequilibrium with NRAMP1. The 5’(CA)n polymorphism was investigated for its role in CD and UC in a Japanese case control study.19 A novel promoter repeat allele, allele 7, was found to be a risk factor for CD and UC when compared to two separate control groups. (OR=2.67, 2.25 (p=0.015, 0.023) for CD, OR=2.7, 2.28 (p=0.018, 0.027) for UC) A Dutch population-based case-control study did not detect association with the two markers tested (274C/T and 823C/T).64 To some extent the Dutch

The NRAMP Genes and Human Susceptibility to Common Diseases

37

results are not consistent with the Japanese findings since at least NRAMP1 274C/T is known to be in strong linkage disequilibrium with the promoter polymorphisms. Also clinically similar to TB is sarcoidosis. It is characterized by a hypersensitivity response to unknown antigens. A population based case control study was carried out in an African American population to investigate the role of NRAMP1 in sarcoidosis.65 Compared to the common promoter allele 3, all other alleles of 5’(CA)n decreased the risk of sarcoidosis (OR=0.48, 95%CI 0.28-0.81, p=0.014). When tested in high risk homozygotes for allele 3, the N allele of the D543N morphism confers protection when present with two copies (OR=0.33, CI95% 0.13-0.83, p=0.003). Although clinically and histologically similar to TB, sarcoidosis seems to differ from TB in the genetic control of susceptibility since promoter allele 3 is a protective factor for TB but a risk factor for sarcoidosis. In a Japanese case control study that investigated early onset of type 1 diabetes, allele 1 and 3 increased the risk of the disease (OR=1.8, CI95% 1.1-2.9).66 In a UK family based case control study, allele 3 was nonrandomly transmitted to the affected offspring (p=0.04) who had a first or second-degree relative with RA.67 These data provide some evidence that allele 3 could be a weak risk factor for type I diabetes in defined clinico-epidemiologic settings. However, given the weak effect of tested alleles these results need to be replicated. When chronic inflammation occurs in the central nervous system, multiple sclerosis (MS) may be diagnosed. A case control study was carried out in South Africans subjects of European ancestry.68 Three groups of controls were included in this study: general, parental nontransmitted alleles and elderly. The study observed the allelic distribution of the 5’(CA)n polymorphism to be different between the MS patients and the control groups, both individually and as one group (p<0.05). The very rare promoter allele 5 described by Graham et al, 18 was found more frequently in patients than in controls (χ2 = 35.2, 2 df, p<0.01). Interestingly, when compared to the younger control group, in the elderly control group NRAMP1 promoter alleles 3 and 5 are overrepresented (χ2 = 16.6, 2 df, p<0.01). The latter finding gave rise to the interesting speculation that alleles considered detrimental in relation to autoimmune diseases may prove to be beneficial for longevity via protection against infection, iron overload and oxidative processes that result in cellular aging. Primary biliary cirrhosis (PBC) is a chronic slowly progressive cholestatic liver disease involving the formation of granulomas and tissue damage. Autoimmune mechanisms are believed to be the culprit, however, an infectious origin cannot be excluded. A population based case control study was carried out to investigate the role of the 5’(CA) polymorphism of NRAMP1 in PBC susceptibility.18 A novel allele 5 was found more frequently in the PBC patients when compared to normal controls (p<0.024), to alcoholic liver disease patients (p<0.012), or to hepatitis C patients (p<0.012). Importantly, this study pointed out the technical possibility of mistaking allele 5 for allele 3, possibly confounding the findings from previous studies. The heart lesions and tissue damage of Chagas’ disease are thought to be the result of autoimmune processes. Infection with Trypanosoma cruzi has been identified to be the trigger. A Peruvian study investigated the role of NRAMP1 polymorphisms in the susceptibility of T. cruzi and development of Chagasic cardiac disease.55 The study did not find any of the tested polymorphisms to be associated with T. cruzi infection susceptibility. However, the study observed with borderline statistical significance more cardiomyopathic patients being homozygous for allele 3 of the 5’(CA)n polymorphism than asymptomatic patients (χ2 = 3.30, p=0.07). The latter finding strengthens two hypotheses: chronic hyperactivation of macrophages associated with allele 3 is functionally linked to autoimmune disease, and heart damage in chronic Chagas’disease is due to an autoimmune process. Atopy is characterized by elevated serum IgE levels upon trigger by common environmental allergens. To study a possible contribution of NRAMP1 alleles to atopy, a Swedish study investigated the role of the 5’ (CA)n promoter repeat polymorphism in atopy of BCG vaccinated and non-vaccinated children.69 The study did not find an association between atopy,

38

The Nramp Family

BCG vaccination and NRAMP1 promoter alleles. However, when investigating association of D2S1471 alleles with atopy a borderline association (p=0.07) was detected. The risk of atopy for D2S1471 allele 5 carriers appeared more significant for vaccinated children (OR=2.6, 95% CI 1.3-5.5, p=0.01). Amazingly, the same allele provided protection against food allergy (OR=0.49, 95%CI 0.27-0.91, p=0.03) in BCG non-vaccinated children but increased the risk of positive IgE responses against air borne allergy in vaccinated children (OR= 4.3, CI 95% 1.7-10.7, p=0.002). The interpretation of these results is difficult since the D2S1471 alleles were found not to be in linkage disequilibrium with the NRAMP1 promoter alleles. Possible linkage disequilibrium of D2S1471 with 3’ NRAMP1 alleles was speculated but not shown. It also must be considered that the overall evidence for an association in the vaccinated group was weak and absent in the non-vaccinated group. This raises the common problem of interpreting stratification in the absence of an overall effect.

NRAMP2 Location and Genomic Structure There are two members of the human NRAMP gene family, NRAMP1 and NRAMP2. The cDNA clone corresponding to the second member of the NRAMP gene family, NRAMP2 (now also called SLC11A2), was mapped onto chromosomal region 12q13.70 The NRAMP2 coding nucleotide sequence is 64% identical to NRAMP1.71 However, the NRAMP2 gene contains one additional 5’exon, and one additional alternative spliced 3’ exon.72 Indeed, alternative splicing appears unusually extensive for NRAMP2.73 The 5’regulatory region contains five potential metal response elements (MRE’s), three potential SP1 binding sites and a single γ-interferon responsive element.72 Tissue expression specificity of NRAMP2 mRNA has not been firmly established,70,74 although its expression in the duodenum has been shown.75,76 In non-intestinal cells, NRAMP2 is found to co-localize with LAMP2 to the membranes of the late endosome/lysosome compartment.77 Analysis of the NRAMP2 cDNA clones identified two splice forms differing at the 3’end.72 The two forms are designated as NRAMP2- (iron responsive element) IRE and NRAMP2 non-IRE. The IRE form contains an AT rich 3’UTR with one classical iron responsive element. The non-IRE form substituted 18 amino acids at the carboxyl terminal with novel 25 amino acids, and a different 3’UTR lacking a classical IRE.72 To what extent iron regulates mRNA stability of the non-IRE form remains to be investigated.

NRAMP2 Functions In vitro studies using Xenopus oocytes injected with rat DCT1 (divalent cation transporter 1) demonstrated DCT1 to be a pH-coupled divalent cations transporter. Northern blotting indicated that DCT1 mRNA was upregulated in most tissues when challenged with iron deficiency.78 Comparative sequence analysis revealed 92% identity between rat DCT1 and human NRAMP2 genes. Independently, it was shown that two single mutations at the homologous position in rat and mouse Nramp2 give rise to microcytic anemia in mk/mk mice and underlie the defect in iron transport in the Belgrade b rat.79,80 Together with extensive transport studies in mammalian cells these findings clearly establish that Nramp2 proteins are capable to transport a broad range of divalent cations including iron.81 Specifically, it has been shown that Nramp2 is a pH-dependent iron/proton symporter. It is likely that human NRAMP2 will have a similar function consistent with its localization in the membranes of acidified vesicles.77

NRAMP2 Polymorphisms Amongst the large number of genetic variants detected in the NRAMP2 gene, 7 polymorphisms have been investigated for their roles in human diseases susceptibility. Two of the 5 SNPs are in the coding regions (c.1254T/C and c.1303 C/A), with the latter SNP resulting in an amino acid change of leucine to isoleucine. The remaining four SNPs are intronic (IVS2+11A/ G, IVS4+44C/A, IVS6+538G/Gdel and IVS15Ex16-16C/G). 72,82 A microsatellite

The NRAMP Genes and Human Susceptibility to Common Diseases

39

TATATCTATATATC(TA)6-7(CA)10-11CCCCCTATA(TATC)3(TCTG)5TCCG(TCTA)6 was detected in intron 3 and 4 alleles have been identified in a Japanese study population (allele 1: 247bp, allele 2: 245bp, allele 3: 243bp and allele 4: 239bp).83

NRAMP2 Polymorphisms and Human Diseases Susceptibility Mouse and rat models indicated hypochromic anemia to be associated with mutation in Nramp2.79,80 A G/A mutation resulting in an glycine to arginine substitution at codon 185 in both mouse and rat is associated with failure of iron transport out of endosomes within the transferrin cycle, leading to abnormal reticulocyte iron uptake and gastrointestinal iron absorption. In humans, a disease intimately connected to disturbed iron transport pathways is hereditary haemochromatosis. It is an autosomal recessive disorder characterized by excessively high iron accumulation in tissues caused by excessive intestinal iron absorption. The phenotype was found to be associated with mutations in the haemochromatosis gene (HFE).84,85 However, mutations in the HFE gene only accounted for roughly 85% of the cases suggesting the involvement of additional genes in the control of haemochromatosis.84,85 The fact that iron uptake is also disturbed in mk/mk mice and b rats, albeit these animals are characterized by deficient rather than excess iron uptake, prompted investigations for a role of NRAMP2 in haemochromatosis. To investigate the role of NRAMP2 polymorphisms in haemochromatosis susceptibility, a case control study was carried out on Caucasian haemochromatosis subjects.86 The study did not find a significant difference in 1254G/C and IVS6+538G/Gdel allelic distributions between the patients and the controls, whether analyzed separately or combined. Likewise, stratification by HFE genotypes did not produce significant differences in allelic or haplotypic distributions. Another study investigated the coding region of the NRAMP2 gene in haemochromatosis probands who did not carry any HFE mutations on both chromosomes.73 Surprisingly, a total of 17 splice mRNA variants were found; 5 due to exon skipping and 12 due to cryptic splicing sites. Eight of these cryptic splicing site activations were between exons 3 and 4 and observed in a majority of haemochromatosis probands and control subjects, implying splicing instability in the region. The study did not find any evidence for NRAMP2 involvement in hereditary haemochromatosis.73 In a functional case control study, expression of NRAMP2 in haemochromatosis patients was compared to controls.75 The patients were all homozygous “G” at the HFE C282Y mutation and carried no H53D mutation; all controls were negative for the C282Y and H63D mutations. The study found duodenal NRAMP2 mRNA expression was a magnitude higher in haemochromatosis patients than in controls, indicated by both Northern blotting and competitive PCR (p<0.001). In addition, NRAMP2 cDNA and serum ferritin concentration were inversely correlated in controls (r=-0.94, p=0.001) but not in patients. No mutation in the NRAMP2 coding region of seven hemochromatosis patients was observed. The findings in this study support the proposed mechanism of an initial duodenal iron depletion due to the HFE mutation, resulting in iron-regulatory proteins (IRP) mediated increased NRAMP2 mRNA stability and heightened NRAMP2 transport activity that increases iron absorption. In humans, iron balance is regulated at the level of intestinal absorption. Since two genome-wide scans located an IBD susceptibility locus on the long arm of chromosome 12 approximately 10 cM proximal of NRAMP2 and due to the known role of NRAMP2 in intestinal iron metabolism, NRAMP2 is suspected to play a role in IBD susceptibility.87,88 A Dutch study investigated the possible role of NRAMP2 polymorphisms in IBD susceptibility and identified a novel SNP in intron 15 (IVS15Ex16-16C/G) that was neither linked nor associated with IBD.82 Only homozygotes for the “G” allele of IVS2+11A/G showed a weak increase in the risk of Crohns disease (OR=2.2, CI95% 1.3-3.9, χ2 =8.4, p=0.013). By contrast, allele sharing methods did not provide evidence for linkage of NRAMP2 to IBD or any of its clinical entities. The disagreement between the association and linkage studies suggests that the phenotype is under complex genetic control with NRAMP2 providing at best a small contribution to overall expression of the phenotype.

40

The Nramp Family

Conclusion As has been outlined in this chapter, a contribution of NRAMP genes has been studied for a sizeable number of human diseases. The most encouraging results have been derived from a large number of studies in different ethnic groups implicating variants of the NRAMP1 gene in increased susceptibility to TB. Together, these studies provide very strong evidence for NRAMP1 being a TB susceptibility locus even in the absence of a clearly identified disease mechanism. The major challenge for the study of NRAMP1 in human TB will now be to provide the mechanistic link between risk alleles and biological function. This won’t be easy considering the difficulties encountered by establishing Nramp1 function in the mouse even though knockout strains had been available to accomplish the task. Perhaps the best strategy will be to apply what is known about Nramp1 function in the mouse to genetically characterized human populations. As for many of the other disease associations, it is likely that some of the reported associations are due to chance while possibly some of the negative findings are a result of under-powered studies. Only carefully designed replication studies will be able to give conclusive answers.

References 1. Lander ES, Schork NJ. Genetic dissection of complex traits. Science 1994; 265:2037-48. 2. Risch NJ. Searching for genetic determinants in the new millennium. Nature 2000; 405:847-56. 3. Skamene E, Schurr E, Gros P. Infection genomics: Nramp1 as a major determinant of natural resistance to intracellular infections. Annu Rev Med 1998; 49:275-87. 4. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 1994; 180:1741-52. 5. Searle S, Blackwell JM. Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility. J Med Genet 1999; 36:295-9. 6. Liu J, Fujiwara TM, Buu NT et al. Identification of polymorphisms and sequence variants in the human homologue of the mouse natural resistance-associated macrophage protein gene. Am J Hum Genet 1995; 56:845-53. 7. Schulze TG, McMahon FJ. Genetic association mapping at the crossroads: which test and why? Overview and practical guidelines. Am J Med Genet 2002; 114:1-11. 8. Morton NE. Genetics without frontiers. Nat Genet 1998; 20:329-31. 9. White JK, Shaw MA, Barton CH et al. Genetic and physical mapping of 2q35 in the region of the NRAMP and IL8R genes: identification of a polymorphic repeat in exon 2 of NRAMP. Genomics 1994; 24:295-302. 10. Blackwell JM, Barton CH, White JK et al. Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism. Mol Med 1995; 1:194-205. 11. Kishi F, Tanizawa Y, Nobumoto M. Structural analysis of human natural resistance-associated macrophage protein 1 promoter. Mol Immunol 1996; 33:265-8. 12. Marquet S, Lepage P, Hudson TJ et al. Complete nucleotide sequence and genomic structure of the human NRAMP1 gene region on chromosome region 2q35. Mamm Genome 2000; 11:755-62. 13. Roger M, Sanchez FO, Schurr E. Comparative study of the genomic organization of DNA repeats within the 5'-flanking region of the natural resistance-associated macrophage protein gene (NRAMP1) between humans and great apes. Mamm Genome 1998; 9:435-9. 14. Kishi F. Isolation and characterization of human Nramp cDNA. Biochem Biophys Res Commun 1994; 204:1074-80. 15. Lewis LA, Victor TC, Helden EG et al. Identification of C to T mutation at position -236 bp in the human NRAMP1 gene promoter. Immunogenetics 1996; 44:309-11. 16. Buu NT, Cellier M, Gros P et al. Identification of a highly polymorphic length variant in the 3’UTR of NRAMP1. Immunogenetics 1995; 42:428-9. 17. Ma X, Dou S, Wright JA et al. 5' dinucleotide repeat polymorphism of NRAMP1 and susceptibility to tuberculosis among Caucasian patients in Houston, Texas. Int J Tuberc Lung Dis 2002; 6:818-23. 18. Graham AM, Dollinger MM, Howie SE et al. Identification of novel alleles at a polymorphic microsatellite repeat region in the human NRAMP1 gene promoter: analysis of allele frequencies in primary biliary cirrhosis. J Med Genet 2000; 37:150-2.

The NRAMP Genes and Human Susceptibility to Common Diseases

41

19. Kojima Y, Kinouchi Y, Takahashi S et al. Inflammatory bowel disease is associated with a novel promoter polymorphism of natural resistance-associated macrophage protein 1 (NRAMP1) gene. Tissue Antigens 2001; 58:379-84. 20. Cellier M, Shustik C, Dalton W et al. Expression of the human NRAMP1 gene in professional primary phagocytes: studies in blood cells and in HL-60 promyelocytic leukemia. J Leukoc Biol 1997; 61:96-105. 21. Forbes JR, Gros P. Divalent-metal transport by NRAMP proteins at the interface of host- pathogen interactions. Trends Microbiol 2001; 9:397-403. 22. Jacobson RR, Krahenbuhl JL. Leprosy. Lancet 1999; 353:655-60. 23. Bellamy R. Identifying genetic susceptibility factors for tuberculosis in Africans: a combined approach using a candidate gene study and a genome- wide screen. Clin Sci (Lond) 2000; 98:245-50. 24. Shaw MA, Collins A, Peacock CS et al. Evidence that genetic susceptibility to Mycobacterium tuberculosis in a Brazilian population is under oligogenic control: linkage study of the candidate genes NRAMP1 and TNFA. Tuber Lung Dis 1997; 78:35-45. 25. Blackwell JM. Genetics of host resistance and susceptibility to intramacrophage pathogens: a study of multicase families of tuberculosis, leprosy and leishmaniasis in north-eastern Brazil. Int J Parasitol 1998; 28:21-8. 26. Greenwood CM, Fujiwara TM, Boothroyd LJ et al. Linkage of tuberculosis to chromosome 2q35 loci, including NRAMP1, in a large aboriginal Canadian family. Am J Hum Genet 2000; 67:405-16. 27. Bellamy R, Ruwende C, Corrah T et al. Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N Engl J Med 1998; 338:640-4. 28. Awomoyi AA, Marchant A, Howson JM et al. Interleukin-10, Polymorphism in SLC11A1 (formerly NRAMP1), and Susceptibility to Tuberculosis. J Infect Dis 2002; 186:1808-14. 29. Gao PS, Fujishima S, Mao XQ et al. Genetic variants of NRAMP1 and active tuberculosis in Japanese populations. International Tuberculosis Genetics Team. Clin Genet 2000; 58:74-6. 30. Delgado JC, Baena A, Thim S et al. Ethnic-specific genetic associations with pulmonary tuberculosis. J Infect Dis 2002; 186:1463-8. 31. Cervino AC, Lakiss S, Sow O et al. Allelic association between the NRAMP1 gene and susceptibility to tuberculosis in Guinea-Conakry. Ann Hum Genet 2000; 64:507-12. 32. Soborg C, Andersen AB, Madsen HO et al. Natural resistance-associated macrophage protein 1 polymorphisms are associated with microscopy-positive tuberculosis. J Infect Dis 2002; 186:517-21. 33. Liaw YS, Tsai-Wu JJ, Wu CH et al. Variations in the NRAMP1 gene and susceptibility of tuberculosis in Taiwanese. Int J Tuberc Lung Dis 2002; 6:454-60. 34. Ryu S, Park YK, Bai GH et al. 3’UTR polymorphisms in the NRAMP1 gene are associated with susceptibility to tuberculosis in Koreans. Int J Tuberc Lung Dis 2000; 4:577-80. 35. Ma X, Wright J, Dou S et al. Ethnic divergence and linkage disequilibrium of novel SNPs in the human NLI-IF gene: evidence of human origin and lack of association with tuberculosis susceptibility. J Hum Genet 2002; 47:140-5. 36. Roger M, Levee G, Chanteau S et al. No evidence for linkage between leprosy susceptibility and the human natural resistance-associated macrophage protein 1 (NRAMP1) gene in French Polynesia. Int J Lepr Other Mycobact Dis 1997; 65:197-202. 37. Levee G, Liu J, Gicquel B et al. Genetic control of susceptibility to leprosy in French Polynesia; no evidence for linkage with markers on telomeric human chromosome 2. Int J Lepr Other Mycobact Dis 1994; 62:499-511. 38. Abel L, Sanchez FO, Oberti J et al. Susceptibility to leprosy is linked to the human NRAMP1 gene. J Infect Dis 1998; 177:133-45. 39. Mira MT, Alcais A, Di Pietrantonio T et al. Segregation of HLA/TNF region is linked to leprosy clinical spectrum in families displaying mixed leprosy subtypes. Genes Immun 2003; 4:67-73. 40. Meisner SJ, Mucklow S, Warner G et al. Association of NRAMP1 polymorphism with leprosy type but not susceptibility to leprosy per se in west Africans. Am J Trop Med Hyg 2001; 65:733-5. 41. Roy S, Frodsham A, Saha B et al. Association of vitamin D receptor genotype with leprosy type. J Infect Dis 1999; 179:187-91. 42. Feitosa M, Krieger H, Borecki I et al. Genetic epidemiology of the Mitsuda reaction in leprosy. Hum Hered 1996; 46:32-5. 43. Alcais A, Sanchez FO, Thuc NV et al. Granulomatous reaction to intradermal injection of lepromin (Mitsuda reaction) is linked to the human NRAMP1 gene in Vietnamese leprosy sibships. J Infect Dis 2000; 181:302-8. 44. Hatagima A, Opromolla DV, Ura S et al. No evidence of linkage between Mitsuda reaction and the NRAMP1 locus. Int J Lepr Other Mycobact Dis 2001; 69:99-103. 45. Marquet S, Sanchez FO, Arias M et al. Variants of the human NRAMP1 gene and altered human immunodeficiency virus infection susceptibility. J Infect Dis 1999; 180:1521-5.

42

The Nramp Family

46. Blackwell JM, Goswami T, Evans CA et al. SLC11A1 (formerly NRAMP1) and disease resistance. Cell Microbiol 2001; 3:773-84. 47. Ouchi K, Suzuki Y, Shirakawa T et al. Polymorphism of SLC11A1 (formerly NRAMP1) gene confers susceptibility to Kawasaki disease. J Infect Dis 2003; 187:326-9. 48. Bucheton B, Abel L, Kheir MM et al. Genetic control of visceral leishmaniasis in a Sudanese population: candidate gene testing indicates a linkage to the NRAMP1 region. Genes Immun 2003; 4:104-9. 49. Blackwell JM, Black GF, Peacock CS et al. Immunogenetics of leishmanial and mycobacterial infections: the Belem Family Study. Philos Trans R Soc Lond B Biol Sci 1997; 352:1331-45. 50. Maasho K, Sanchez F, Schurr E et al. Indications of the protective role of natural killer cells in human cutaneous leishmaniasis in an area of endemicity. Infect Immun 1998; 66:2698-704. 51. Tanaka E, Kimoto T, Matsumoto H et al. Familial pulmonary Mycobacterium avium complex disease. Am J Respir Crit Care Med 2000; 161:1643-7. 52. Huang JH, Oefner PJ, Adi V et al. Analyses of the NRAMP1 and IFN-gammaR1 genes in women with Mycobacterium avium-intracellulare pulmonary disease. Am J Respir Crit Care Med 1998; 157:377-81. 53. Dunstan SJ, Ho VA, Duc CM et al. Typhoid fever and genetic polymorphisms at the natural resistance- associated macrophage protein 1. J Infect Dis 2001; 183:1156-60. 54. Choi EH, Zimmerman PA, Foster CB et al. Genetic polymorphisms in molecules of innate immunity and susceptibility to infection with Wuchereria bancrofti in South India. Genes Immun 2001; 2:248-53. 55. Calzada JE, Nieto A, Lopez-Nevot MA et al. Lack of association between NRAMP1 gene polymorphisms and Trypanosoma cruzi infection. Tissue Antigens 2001; 57:353-7. 56. John S, Marlow A, Hajeer A, Ollier W, Silman A, Worthington J: Linkage and association studies of the natural resistance associated macrophage protein 1 (NRAMP1) locus in rheumatoid arthritis. J Rheumatol 1997; 24:452-7. 57. Shaw MA, Clayton D, Blackwell JM. Analysis of the candidate gene NRAMP1 in the first 61 ARC National Repository families for rheumatoid arthritis. J Rheumatol 1997; 24:212-4. 58. Rodriguez MR, Gonzalez-Escribano MF, Aguilar F et al. Association of NRAMP1 promoter gene polymorphism with the susceptibility and radiological severity of rheumatoid arthritis. Tissue Antigens 2002; 59:311-5. 59. Yang YS, Kim SJ, Kim JW et al. NRAMP1 gene polymorphisms in patients with rheumatoid arthritis in Koreans. J Korean Med Sci 2000; 15:83-7. 60. Singal DP, Li J, Zhu Y et al. NRAMP1 gene polymorphisms in patients with rheumatoid arthritis. Tissue Antigens 2000; 55:44-7. 61. Sanjeevi CB, Miller EN, Dabadghao P et al. Polymorphism at NRAMP1 and D2S1471 loci associated with juvenile rheumatoid arthritis. Arthritis Rheum 2000; 43:1397-404. 62. Lau CF, Wong AM, Yee KS et al. A case of colonic tuberculosis mimicking Crohn’s disease. Hong Kong Med J 1998; 4:63-66. 63. Hofmeister A, Neibergs HL, Pokorny RM et al. The natural resistance-associated macrophage protein gene is associated with Crohn’s disease. Surgery 1997; 122:173-8; discussion 178-9. 64. Stokkers PC, de Heer K, Leegwater AC et al. Inflammatory bowel disease and the genes for the natural resistance- associated macrophage protein-1 and the interferon-gamma receptor 1. Int J Colorectal Dis 1999; 14:13-7. 65. Maliarik MJ, Chen KM, Sheffer RG et al. The natural resistance-associated macrophage protein gene in African Americans with sarcoidosis. Am J Respir Cell Mol Biol 2000; 22:672-5. 66. Bassuny WM, Ihara K, Matsuura N et al. Association study of the NRAMP1 gene promoter polymorphism and early- onset type 1 diabetes. Immunogenetics 2002; 54:282-5. 67. Esposito L, Hill NJ, Pritchard LE et al. Genetic analysis of chromosome 2 in type 1 diabetes: analysis of putative loci IDDM7, IDDM12, and IDDM13 and candidate genes NRAMP1 and IA-2 and the interleukin-1 gene cluster. IMDIAB Group. Diabetes 1998; 47:1797-9. 68. Kotze MJ, de Villiers JN, Rooney RN et al. Analysis of the NRAMP1 gene implicated in iron transport: association with multiple sclerosis and age effects. Blood Cells Mol Dis 2001; 27:44-53. 69. Alm JS, Sanjeevi CB, Miller EN et al. Atopy in children in relation to BCG vaccination and genetic polymorphisms at SLC11A1 (formerly NRAMP1) and D2S1471. Genes Immun 2002; 3:71-7. 70. Vidal S, Belouchi AM, Cellier M et al. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 1995; 6:224-30. 71. Kishi F, Tabuchi M. Complete nucleotide sequence of human NRAMP2 cDNA. Mol Immunol 1997; 34:839-42. 72. Lee PL, Gelbart T, West C et al. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998; 24:199-215.

The NRAMP Genes and Human Susceptibility to Common Diseases

43

73. Le Gac G, Mura C, Raguenes O et al. Nramp2 analysis in hemochromatosis probands. Blood Cells Mol Dis 2000; 26:312-9. 74. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25:514-25. 75. Zoller H, Pietrangelo A, Vogel W et al. Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients with hereditary haemochromatosis. Lancet 1999; 353:2120-3. 76. Kishi F, Tabuchi M. Human natural resistance-associated macrophage protein 2: gene cloning and protein identification. Biochem Biophys Res Commun 1998; 251:775-83. 77. Tabuchi M, Yoshimori T, Yamaguchi K et al. Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 2000; 275:22220-8. 78. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-8. 79. Fleming MD, Trenor CC 3rd, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16:383-6. 80. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95:1148-53. 81. Picard V, Govoni G, Jabado N et al. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem 2000; 275:35738-45. 82. Stokkers PC, Huibregtse K Jr, Leegwater AC et al. Analysis of a positional candidate gene for inflammatory bowel disease: NRAMP2. Inflamm Bowel Dis 2000; 6:92-8. 83. Kishi F, Fujishima S, Tabuchi M. Dinucleotide repeat polymorphism in the third intron of the NRAMP2/DMT1 gene. J Hum Genet 1999; 44:425-7. 84. Feder JN, Gnirke A, Thomas W et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996; 13:399-408. 85. Mura C, Raguenes O, Ferec C. HFE mutations analysis in 711 hemochromatosis probands: evidence for S65C implication in mild form of hemochromatosis. Blood 1999; 93:2502-5. 86. Lee PL, Gelbart T, West C et al. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998; 24:199-215. 87. Satsangi J, Parkes M, Louis E et al. Two stage genome-wide search in inflammatory bowel disease provides evidence for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet 1996; 14:199-202. 88. Duerr RH, Barmada MM, Zhang L et al. Linkage and association between inflammatory bowel disease and a locus on chromosome 12. Am J Hum Genet 1998; 63:95-100.

44

The Nramp Family

CHAPTER 4

Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions Luis F. Barrera and Martin Olivier

Abstract

E

xpression of Nramp1 gene in phagocytes has been correlated with resistance toward infections, restricting growth of various intracellular microbes within the phagolysosome environment. This gene codes for a transmembrane protein that transport divalent cations (Fe2+, Mn2+, Zn2+) outside the phagolysosome rendering this internal milieu inappropriate for pathogens that necessitate metal for their growth. Of interest, it has been reported that phagocytes expressing Nramp1 were more prone to become activated once stimulated with various cytokines, such as interferon gamma (IFN-γ). Macrophage activation may also contribute to some extent to the phenotypic character conducting to resistance or susceptibility toward intracellular pathogens. As these macrophage functions are regulated by different signaling pathways it is possible that mobilization of metallic divalent cations may contribute to control their levels of activation or inactivation, therefore explaining in part why Nramp expressing cells are functionally more responding to stimulation

Introduction Inherited factors contributing to the susceptibility to mycobacterial infections have been postulated for decades. Studies concerning racial differences in resistance and susceptibility to tuberculosis indicate that Black-Americans are more susceptible to initial invasion by Mycobacterium tuberculosis, while Ashkenazi Jews seem to be resistant to tuberculosis.1 Genes linked and unlinked to major histocompatibility class II antigens have been associated with resistance and susceptibility to mycobacterial infection and proliferation inside the host.2-5 In vitro studies on monocyte-derived macrophages of human origin have shown that macrophages from Caucasians permit less rapid replication of M. tuberculosis than those from blacks.6 McPeek and collaborators7 have found that monocytes show a pattern of HLA-DR expression consistent with relative resistance to M. tuberculosis in 70% of whites but in only 30% of American blacks. So far, no single human gene was unequivally shown to be associated with direct resistance or susceptibility to mycobacterial infections. The phenomenon of inherited natural resistance and susceptibility to mycobacteria intracellular replication was observed in rabbits early in this century.8,9 Resistance trait to tuberculosis was shown by Mendelian analysis to be dominant, multiple, and additive over that of susceptibility.9 The studies in other animal models (such as the “Biozzi” mice) have also pointed to a genetic regulation of resistance and susceptibility to mycobacterial infections. In this particular model, mice bred for low antibody (L) responsiveness to sheep erythrocytes were able to control proliferation of Mycobacterium bovis BCG in the spleens more efficiently than mice bred for high (H) antibody responsiveness.10

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions

45

Resistance to Three Pathogens Controlled by One Gene

Genetic resistance and susceptibility to intravenous injection of low doses (103 to 105 colony forming unit, CFU) of M. bovis BCG was observed among different inbred mouse strains.11 The mouse strains could be separated into two distinct groups. Genetic control of the susceptibility or resistance in non-overlapping groups of mice with respect to the growth of bacteria in the spleen in animals infected with low doses of BCG was not linked to the MHC H-2 locus.11,12 Using classical genetic analysis, Gros et al12 hypothesized that resistance to BCG was controlled by a single, dominant, autosomal gene, that was designated the Bcg gene. The product of the Bcg gene was found to influence the early phase of the in vivo response to infection with BCG.12 The Bcg gene was mapped on mouse chromosome 1, in exactly the same locus previously found to confer resistance and susceptibility to Salmonella typhimurium (Ity gene)13 and Leishmania donovani (Lsh gene).14 A full concordance of the strain distribution pattern (SDP) of resistant and susceptible alleles of Bcg, Ity, and Lsh among recombinant inbred strains of mice gave additional support to the conclusion that the genetic control of resistance to M. bovis BCG, S. typhimurium, and L. donovani was exerted by a single gene with pleiotropic effects.15 Additional studies indicated that the growth of BCG substrains and atypical mycobacteria such as M. kansasii and M. fortuitum,16 M. intracellulare,16,17 M. lepraemurium,18,19 and M. smegmatis20 were also under the control of the Bcg gene.

Bcg/Lsh/Ity Gene Expression in Macrophage Immunological studies demonstrated that mice genetically resistant to BCG infection were able to prevent bacterial multiplication without the need for an acquired immune response. This conclusion was based on the evidence that DTH against mycobacterial antigens (PPD), granuloma formation in spleen and liver, and resistance to challenge with homologous (BCG) and heterologous (Listeria monocytogenes) bacteria, were greatly inferior in animals carrying the Bcgr allele.21 The kinetic studies of BCG infection in congenitally athymic mice that carried the “nude” mutation on Bcgr (AKR/J) or Bcgs (BALB/c) background showed that the functional absence of T lymphocytes did not influence the expression of the Bcg gene.22 Furthermore, in vivo depletion of T cells or B cells2 did not affect the resistant phenotype in BCG-infected mice. On the other hand, treatment of BCG-resistant mice with silica, a chemical agent preferentially taken up by macrophages, was able to reverse the resistant phenotype.22 Experiments conducted by O’Brien et al1 using Ityr mice infected with S. typhimurium, led to similar conclusions. Since M. bovis, L. donovani, and S. typhimurium are intracellular parasites it is possible that the Bcg gene controls the efficiency of macrophages to fight infection.15 Additional evidence pointing to the macrophage as the cell type involved in the phenotypic expression of the Bcg/Lsh/Ity gene was obtained from in vitro experiments. Stach and colleagues23 used resident peritoneal macrophages explanted from inbred and congenic mouse strains to demonstrate that the multiplication of M. bovis, (assessed by the bacterial 3H-uracil uptake), was faster in Bcgs macrophages compared to Bcgr macrophages. Splenic and peritoneal macrophages of resistant mice infected with S. typhimurium,24 and Kupffer cells infected with L. donovani25-29 were also shown to control the growth of these intracellular pathogens more efficiently than macrophages derived from susceptible mice.

Bcg/Lsh/Ity Gene Pleiotropic Effects on Macrophage Functions One of the critical questions concerning the ability of macrophages expressing the Bcg/Lsh/ Ity gene is the mode of action of this gene. Studies aimed at comparing functional and phenotypic parameters of activation in Bcgr and Bcgs macrophages detected various examples of differentially regulated metabolic pathways, which are thought to represent pleiotropic expression of the resistance locus. Macrophages from resistant strains (Bcgr) were superior producers of hydrogen peroxide (H2O2) and superoxide anion (O2-) compared to macrophages from susceptible strains (Bcgs), following either infection with BCG or treatment with interferon gamma

46

The Nramp Family

(IFN-γ).26,30 Denis et al31 showed that splenic macrophages isolated from uninfected BALB/ c.Bcgr congenic mice contained a higher percentage of Ia-positive cells than splenic macrophage populations obtained from BALB/c mice. Differences in Ia expression have also been reported.32,33 Another example of plasma membrane bound molecules that are regulated differentially by Bcgr and Bcgs macrophages is the AcM.1 marker of macrophage activation.34 Macrophages from resistant mice infected with BCG, or activated with IFN-γ and lipopolysaccharide (LPS) significantly upregulated the expression of AcM.1 while macrophages from Bcgs mice could not be stimulated to display changes in their level of AcM.1 expression under the same conditions.35 Some other pleiotropic effects of the Bcg/Lsh/Ity gene have also been reported. When bone marrow-derived macrophages from Lshr and Lshs congenic strains were activated with IFN-γ and LPS, a dose-dependent difference in the amount of tumor necrosis factor (TNF-α) released over 24h was observed. The magnitude of this response was enhanced in macrophages preinfected with L. donovani amastigotes, suggesting that the parasite itself may act as a trigger for the production and/or release of TNF-α.26 In other study, it has been reported that macrophages from Lshr mice were producing greater amount of TNF-α as compared to Lshs macrophages when they were cultured in matrixes of extracellular matrix proteins, such as fibrinogen and fibronectin.36 The addition of IFN-γ to the cultured macrophages, or infection with L. donovani, increased the production of TNF-α even further. The fact that differences in TNF-α release could be measured at the protein level within 4h of addition of priming/activating signals suggested that differences in the expression of early response genes, such as c-fos, c-myc, JE and KC, might also play an important role.37 Clear differences in the mRNA expression for KC were indeed observed in resident peritoneal macrophages stimulated with LPS or IFN-γ plus LPS. Lshr macrophages expressed more KC mRNA than Lshs macrophages. Similar differences in KC mRNA expression, but not in JE mRNA expression, in response to lipoarabinomannan from avirulent M. tuberculosis (araLAM) were also reported.38 The possibility that TNF-α may play an important role in genetically-determined resistance and susceptibility to intracellular infections controlled by the Bcg/Lsh/Ity gene was stressed by the results reported by Mastroeni et al.39 The authors tested effect of the late administration of anti-TNF-α antibodies on the course of virulent Salmonella typhimurium infection. Administration of anti-TNF-α antiserum to resistant mice prevented the suppression of exponential bacterial growth in the MPS. These data indicate that TNF-α is essential for the control of virulent Salmonella in mice.39 Similar observations, stressing the role of TNF-α and control of growth of S. typhimurium in vivo have also been reported.40,41 Roach and colleagues29 showed the difference in nitric oxide (NO) production in response to IFN-γ and LPS by bone marrow-derived macrophages derived from Lshr and Lshs congenic mice. In this study, NO production by Lshr macrophages was significantly higher than the production in Lshs macrophages. In addition, it seemed to be correlated with leishmanicidal activity and TNF-α production by the macrophages. More recently, we showed that both B10R (Bcgr) macrophage cell line and peritoneal macrophage from Nramp+/+ mice infected by M. tuberculosis H37Rv were more prone to produce TNF-α whereas B10S (Bcgs) and Nramp-/- cells were greater producer of IL-10.42 Of interest, the use of monoclonal antibodies to block either TNF-α or IL-10, inversely modified NO production and loss of cell viability, as well as other key molecular events related to programmed cell death such as, caspase 1 activation and Bcl-2 and p53 expression. Our study was suggestive that a tight balance between TNF-α and IL-10 is potentially influenced by Nramp1, and that this balance may in part permit to understand some of the phenotypical differences between macrophages from resistant and susceptible background, such as nitric oxide generation43 and modulation of apoptosis.44 Additional pleiotropic effects have been reported in the S. typhimurium model. Investigators45 examined the initial inflammatory response following Salmonella infection in both Ityr and Itys mice and studied the kinetics of production of several cytokines, including IFN-γ in

Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions

47

explanted cells. Only splenocytes from Ityr were able to produce IFN-γ upon stimulation with Salmonella antigens. Ramarathinam et al46 reported similar results when using splenocytes from Ityr and Itys inbred and congenic mouse strains. Finally, differences involving differential responsiveness to granulocyte-macrophage colony stimulating factor (GM-CSF),47 myelopoietic responsiveness,48 membrane-associated interleukin 1 (maIL-1),45 interleukin 1β (IL-1β) mRNA,37 and phagosome-lysosome fusion49 have also been reported to differ between Bcg/Lsh/Ity resistant and susceptible animals or cells derived from them. Taken together, these experiments suggest that the pleiotropic effects induced by the Bcg/Lsh/Ity gene in murine macrophages may be closely associated with the genetic regulation of macrophage priming for activation.4

Nramp, a Candidate Gene for Bcg/Lsh/Ity Gene

Ten years ago a candidate gene for the Bcg/Lsh/Ity gene was cloned50,51 and its product called Natural Resistance Associated Macrophage Protein (Nramp). Northern blotting analysis initially indicated that Nramp1 is expressed in reticuloendothelial organs such as the spleen and liver, splenic macrophages and macrophage cell lines but not in other tissues or cell lineages.50 The Nramp gene is member of a new protein family conserved throughout evolution being encountered in living organisms from bacteria to human. It is now named Nramp1, as a second Nramp gene (Nramp2) has been found in murine system52 as well as in human53 and being expressed at low level in overall tissues. It is now well established that Nramp1 is mainly expressed in macrophages and polymorphonuclear cells as a membrane protein of 100 kD extensively glycosylated and phosphorylated.54 Initial studies revealed that Nramp1 encodes a polypeptide with no apparent sequence similarity to any previously identified protein. Hydropathy analysis of the predicted amino acid sequence identifies 10-12 strongly hydrophobic domains that are similar to the membrane-spanning regions of polytopic membrane proteins. The Nramp1 gene product also contains two potential N-linked glycosylation sites as well as two potential sites for protein kinase C phosphorylation.50 Subsequently, Barton et al51 described an additional exon of Nramp1, located 5' of the sequence published by Vidal et al.50 This newly described domain is rich in proline, serine, and basic amino acids, includes three protein kinase C phosphorylation sites and a putative Src homology 3 binding domain. Nucleotide sequence analysis of the Nramp cDNA showed that in 27 inbred mouse strains of either Bcgr and Bcgs phenotypes, the susceptibility trait was associated with a nonconservative glycine to aspartic acid amino acid substitution within predicted transmembrane domain 4 of the protein.50 The Nramp protein contains a conserved sequence motif known as the “binding-protein-dependent transport system inner membrane component signature”, identified in prokaryotic and eukaryotic transport proteins. This motif is present in the permease for the nitrate uptake encoded by the crnA gene of the eukaryote Aspergillus nidulans.50 A syntenic region of the mouse chromosome 1 containing the Bcg gene has been mapped on the human chromosome 2q35.55 In the early nineties, Cellier and colleagues cloned the human homologue of the mouse Nramp gene. Mouse and human Nramp display a 93% overall sequence homology. Sequence analysis indicates that human Nramp encodes a polypeptide with 10-12 transmembrane domains, two N-linked glycosylation sites and an evolutionary conserved consensus transporter motif. Northern blot analysis indicated that human Nramp mRNA was highly expressed in peripheral blood leukocytes, and in the lung and spleen. Macrophages were identified as cells expressing human Nramp mRNA.56 The mechanism by which Nramp1 contributes to the antimicrobial activity of macrophages is now better characterized. Study of the functions of the various proteins of the Nramp family has permitted to postulate the possible Nramp1 functions. Nramp2 has 78% of identity with the hybrophobic region of Nramp1, being expressed in the plasma membrane, as well as early and late endosomes of various cellular types.52-54,57 Nramp2 is present in the duodenum and its expression is regulated by iron contained in the diet.58 Functional analysis in Xenopus

48

The Nramp Family

oocytes demonstrated that Nramp2 functions as a pH-dependent divalent cations transporter.59 Using various animal models, Fleming et al60,61 showed that the mutation of Nramp2 leads to abnormal iron intestinal absorption and severe microcytic anemia. Furthermore, the transfer of Nramp2 was shown to complement Smf1/Smf2 yeast mutants.62 Finally, Nramp homologues identified in MTB63 and E. coli,64 were also characterized as divalent cation transporters (see other chapters in this book). These evidences indicate that iron, which is of paramount importance for mycobacteria growth, is under the control of Nramp1. Of utmost interest, prior evidences suggested that Nramp1 acts as an iron transporter, as animals bearing the susceptibility alleles Nramp1s/s lost their capacity to exclude iron from their phagosome and to control M. avium growth.65 Recent experiments have permitted to firmly conclude that Nramp1 transports divalent cations in the same direction as the proton transport, forcing the cations to exit the phagosomes.66 Other investigations revealed that overexpression of Nramp1 in Cos-7 cells, Raw 264.7 macrophages and study of iron regulatory protein 1 and 2, two endogenous iron sensors, coincided with enhancement of iron flux conducting to exclusion from its cytoplasm.67-69 Additionally, iron per se has been shown to play an important role in Nramp1 regulation, as iron chelation with deferoxamine was reported to negatively modulate Nramp1 expression.70

Impact of Nramp Gene Expression on Macrophage Signaling Activity and Functions Regulation As discussed above, although several cellular functions are attributed to Nramp1 expression in phagocytic cells, and that some of them are associated with inflammatory and microbicidal activities of macrophages such as phagocytosis,27 nitric oxide,71,72 respiratory burst, chemokines and cytokines production (reviewed in ref. 69), and mRNA stabilization of IFNγ-inducible genes such as MHC class II molecules,73 it is however, still not clear how Nramp1 expression can influence these macrophage functions. From various studies, mRNA stabilization of genes69,73,74 has been proposed to be a mechanism whereby expression of Nramp may influence phagocytes functions rendering the cells more prone to respond to infection or extracellular stimulation. Knowing that mRNA stability is strongly influenced by signaling molecules, such as kinases, to control the phosphorylation status of proteins involved in this cellular event,75 it is thus suggestive that Nramp may influence the activity of these regulatory molecules. In fact, different kinase activities will not only influence mRNA stability of genes, but will also contribute to differentially regulate protein conformation and activation post-transcriptionally. Brown et al74 were the first to obtain some indication that the Ser/Thr kinase PKC was in part responsible for persistent I-A expression induced in macrophage isolated from Bcgr mice. Thereafter, using B10R (Bcgr) and B10S (Bcgs) macrophage cell lines, we have firmly established that cytoplasmic and membrane PKC activity in these cells, subjected or not to Mycobacterium bovis BCG infection or phorbol myristate acetate stimulation (PMA), were dramatically different.76 Of utmost interest, these differences in PKC activity were not due to a different PKC expression level of the various members of this kinase family, but to a greater innate PKC activity in B10R cells where Nramp expression seems to influence, in some ways, the level of sensitivity and phosphorylation of PKC, rendering this latter more prone to become fully activated upon stimulation.76 Whereas PKC has been reported to influence Nramp1 stability,69 a recent study suggests that PKC-dependent regulation of oxidant generation by Nramp1 transport activates MAP kinase-signaling cascades that result in Nramp1 mRNA stabilization.77 This last piece of data bring about new information on the potential of Nramp1 expression in the regulation of signaling events that could influence as well other cellular events leading to macrophage activation. Whereas Nramp1 expression seems to influence signaling activity of macrophages, the mechanisms whereby this occurs are still unraveled. As Nramp1 was shown to transport divalent cations (Fe2+, Mn2+, Zn2+) by a proton gradient dependent mechanism,78 it is possible that in

Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions

49

non-infectious context, cells being stimulated by cytokines or various other agonists, modify the cellular homeostasis for these divalent cations influencing their distribution within the cells and contribute to their interaction as co-factors to augment or diminish signaling cascade activities. For instance, it has been recently reported79 that iron (Fe2+) plays an important role in NF-κB activation in Kupffer cells by directly inducing inhibitor kappaB kinase (IKK) which end-point result in the activation of TNF-α promoter and secretion of TNF-α protein. Additionally, various metals (copper or zinc) have been reported to strongly influence the ethylene-signaling pathways studied in Arabidopsis thaliana, involving EIN2, a central signal transducer of this pathway, having shown some homology to Nramp.80 As regulation of cellular functions depends upon a fine-tuned balance between kinases and phosphatases, it is possible that availability of divalent cations may also influence the activity of various phosphatases favoring kinases activation. For instance, metal-induced signaling in human airway epithelial cells was shown to result from inhibition of phosphotyrosine phosphatases (PTP) activity by zinc and vanadium.81 Using PTP inhibitors peroxovanadium, having vanadate as metallic core, we have demonstrated their powerful modulatory effect on macrophage functions conducting to NO generation and control over Leishmania infection in vitro and in vivo.82,83 Furthermore, Fe2+, Mn2+ and Zn2+ have been reported to play an important role in the activation of the Ser/Thr phosphatase PP2A,84,85 a key phosphatase regulating Ser/Thr kinases such as PKC. Finally, and of utmost interest, a tartrate-resistant acid phosphatase (TRAP) with unknown role has been recently identified and shown to be under the regulation of Fe2+,86 and to be a lysosomal enzyme found in various tissues including dendritic cells, osteoclasts and macrophages.87 Whereas this phosphatase may represent a major player in the context of Nramp regulated resistance or susceptibility toward intracellular pathogens remains to be investigated. Collectively, these various studies indicate that modulation of second messengers involved in cell signaling is influenced by divalent cations. Suggesting that Nramp expression may influence the distribution of these latter, and their availability for different type of kinases and phosphatases that necessitate iron or manganese, for instance, to be finely regulated and thus explaining in part the pleiotropic impact that Nramp has on the induction of macrophage functions in response to cytokines and infectious agents.

References 1. O’Brien AD, Scher I, Formal SB. Effect of silica on the innate resistance of inbred mice to Salmonella typhimurium infection. Infect Immun 1979; 25:513-520. 2. Skamene E. Genetic control of susceptibility to mycobacterial infections. Rev Infect Dis 1989; 11:s394-399. 3. De Vries RRP. Regulation of T cell responsiveness against mycobacterial antigens by HLA class II immune response genes. Rev Infect Dis 1989; 11:s400-405. 4. Schurr E, Radzioch D, Malo D et al. 1991. Molecular genetics of inherited susceptibility to intracellular parasites. Behring Inst Mitt 1991; 88:1-12. 5. Stead WW. Genetics and resistance to tuberculosis. Could resistance be enhanced by genetic engineering? Ann Intern Med 1992; 116:937-941. 6. Crowle AJ, Elkins N. Relative permisiveness of macrophages from black and white people for virulent tubercle bacilli. Infect Immun 1990; 58:632-638. 7. McPeek M, Salkowitz J, Laufman H et al. The expression of HLA-DR by black and white donor monocytes: different requirements for protein synthesis. Clin Exp Immunol 1992; 87:163-168. 8. Lurie MB, Dannenberg AM Jr. Macrophage function in infectious disease with inbred rabbits. Bacteriol Rev 1965; 29:466. 9. Lurie MB, Zappasodi P, Dannenberg AM et al. On the mechanism of genetic resistance to tuberculosis and its mode of inheritance. Am J Hum Gen 1952; 4:302. 10. Gheorghiou M, Mouton D, Lecoeur H et al. Resistance of high and low antibody responder lines of mice to the growth of avirulent (BCG) and virulent (H37Rv) strains of mycobacteria. Clin Exp Immunol 1985; 59:177-184. 11. Forget A, Skamene E, Gros P et al. Differences in response among inbred mouse strains to infection with small doses of Mycobacterium bovis BCG. Infect Immun 1981; 32:42-47. 12. Gros P, Skamene E, Forget A. Genetic control of natural resistance to Mycobacterium bovis (BCG) in mice. J Immunol 1981; 127:2417-2421.

50

The Nramp Family

13. Plant J, Glynn AA. Locating Salmonella resistance gene on mouse chromosome 1. Clin Exp Immunol 1979; 37:1-6. 14. Bradley DJ, Taylor BA, Blackwell J et al. Regulation of Leishmania populations within the host. III. Mapping of the locus controlling susceptibility to the visceral leishmaniasis in the mouse. Clin Exp Immunol 1979; 37:7-14. 15. Skamene E, Gros P, Forget A et al. Genetic regulation of resistance to intracellular pathogens. Nature 1982; 297:506-509. 16. Denis M, Forget A, Pelletier M et al. Control of the Bcg gene of early resistance in mice infections with BCG substrains and atypical mycobacteria. Clin Exp Immunol 1986; 63:517-525. 17. Goto Y, Buschman E, Skamene E. Regulation of host resistance to Mycobacterium intracellulare in vivo and in vitro by the Bcg gene. Immunogenetics 1989; 30:218-225. 18. Brown IN, Glynn AA, Plant J. Inbred mouse strain resistance to Mycobacterium lepraemurium follows the Ity/Lsh pattern. Immunology 1982; 47:149-156. 19. Skamene E, Gros P, Forget A et al. Regulation of resistance to leprosy by a chromosome 1 locus in the mouse. Immunogenetics 1984; 19:117-124. 20. Denis M, Forget A, Pelletier M et al. Killing of Mycobacterium smegmatis by macrophages from genetically susceptible and resistant mice. J Leuk Biol 1990; 47:25-30. 21. Pelletier M, Forget A, Bourassa D et al. Immunopathology of BCG infection in genetically resistant and susceptible mouse strains. J Immunol 1982; 129:2179-2185. 22. Gros P, Skamene E, Forget A. Cellular mechanisms of genetically controlled host resistance to Mycobacterium bovis BCG. J Immunol 1983; 131:1966-1972. 23. Stach, JL, Gros P, Forget A et al. Phenotypic expression of genetically controlled natural resistance by Mycobacterium bovis (BCG). J Immunol 1984; 132:888-892. 24. Lissner CR, Swanson RN, O’Brien DA. Genetic control of innate resistance of mice to Salmonella typhimurium: Expression of the Ity gene in peritoneal and splenic macrophages isolated in vitro. J Immunol 1983; 131:3006-3013. 25. Crocker PR, Blackwell JM, Bradley DJ. Expression of the natural resistance gene Lsh in resident liver macrophages. Infect Immun 1984; 43:1033-422. 26. Blackwell JM, Toole S, King M et al. Analysis of the Lsh gene expression in congenic B10.L-Lshr mice. Curr Top Microbiol Immunol 1988; 137:301-309. 27. Olivier M, Tanner CE. Susceptibilities of macrophage populations to infection in vitro by Leishmania donovani. Infect Immun 1987; 55:467-471. 28. Olivier M, Bertrand S, Tanner CE. Killing of Leishmania donovani by activated liver macrophages from resistant and susceptible strains of mice. Int J Parasitol 1989; 19:377-383. 29. Roach TIA, Kiderlen AF, Blackwell J. Role of inorganic nitrogen oxides and tumor necrosis alpha in killing Leishmania donovani amastigotes in gamma-lipopolysaccharide-activated macrophages from Lshs and Lshr congenic mouse strains. Infect Immun 1991; 59:3935-3944. 30. Denis M, Forget A, Pelletier M et al. Respiratory burst in congenic Bcgr and Bcgs macrophages. Clin Exp Immunol 1988; 73:370-375. 31. Denis M, Forget A, Pelletier M et al. Pleiotropic effects of the Bcg gene. I. Antigen presentation in genetically susceptible and resistant congenic mouse strains. J Immunol 1988; 140:2395-2400. 32. Kaye PM, Patel NK, Blackwell JM. Acquisition of cell-mediated immunity to Leishmania. II. LSH gene regulation of accessory cell function. Immunology 1988; 65:17-22. 33. Johnson SC, Zwilling BS. Continous expression of I-A antigen by peritoneal macrophages from mice resistant to Mycobacterium bovis. J Leuk Biol 1985; 38:635-647. 34. Taniyama T, Tokunaga T. Monoclonal antibodies directed against mouse macrophages in different stages of activation for tumor cytotoxicity. J Immunol 1983; 131:1032-1037. 35. Buschman E, Taniyama T, Nakamura R et al. Functional expression of the Bcg gene in macrophages. Res Immunol 1989; 140:793-797. 36. Formica S, Roach TIA, Blackwell JM. Interaction with extracellular matrix proteins influences Lsh/ Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-α and nitrite release. Immunology 1994; 82:42-50. 37. Blackwell JM, Roach TIA, Atkinson SE et al. Genetic regulation of macrophage priming/activation: the Lsh gene story. Immunology Letters 1991; 30:241-248. 38. Roach TIA, Chatterjee D, Blackwell JM. Induction of early-response genes KC and JE by mycobacterial lipoarabinomannans: Regulation of KC expression in murine macrophages by Lsh/Ity/Bcg (candidate Nramp). Infect Immun 1994; 62:1176-1184. 39. Mastroeni P, Villareal-Ramos B, Hormaeche CE. Effect of late administration of anti-TNFa antibodies on a Salmonella infection in the mouse model. Microbial Pathogenesis 1993; 14:473-480. 40. Tite JP, Dougan G, Chatfield SN. The involvement of tumor necrosis factor in immunity to Salmonella infection. J Immunol 1991; 147:3161-3164.

Pleiotropic Effects of Nramp (Bcg/Lsh/Ity) Gene Expression on Macrophage Functions

51

41. Nauciel C, Espinasse-Maes F. Role of gamma interferon and tumor necrosis factor alpha in resistance to Salmonella typhimurium infection. Infect Immun 1992; 60:450-454. 42. Rojas M,Olivier M, Gros P et al. TNF-α and IL-10 modulate the induction of apoptosis by virulent Mycobacterium tuberculosis in murine macrophages. J Immunol 1999; 162:6122-6131. 43. Arias M, Rojas M, Zabaleta J et al. Inhibition of virulent Mycobacterium tuberculosis by Bcgr and Bcgs macrophages correlates with nitric oxide production. J Inf Dis 1997; 176:1552-1558. 44. Rojas M, Barrera LF, Puzo G et al. Differential induction of apoptosis by virulent Mycobacterium tuberculosis in resistant and susceptible murine macrophage: role of nitric oxide and mycobacterial products. J Immunol 1997; 159:1352-1361. 45. Kita E, Emoto M, Oku D et al. Contribution of interferon γ and membrane-associated interleukin 1 to the resistance to murine typhoid of Ityr mice. J Leuk Biol 1992; 51:244-250. 46. Ramarathinam L, Niesel DW, Klimpel GR. Ity influences the production of IFN-γ by murine splenocytes stimulated in vitro with Salmonella typhimurium. J Immunol 1993; 150:3965-3972. 47. Morrissey PJ, Charrier K. GM-CSF administration augments the survival of Ity-resistant A/J mice, but not Ity-susceptible C57BL/6 mice, to a lethal challenge with Salmonella typhimurium. J Immunol 1990; 144:557-561. 48. Peterson VM, Madonna GS, Vogel SN. Differential myelopoietic responsiveness of Balb/c (Itys) and C.D2 (Ityr) mice to lipopolysaccharide administration and Salmonella typhimurium infection. Infect Immun 1992; 60:1375-1384. 49. De Chastellier C, Frehel C, Offredo C et al. Implication of phagosome-lysosome fusion in restriction of Mycobacterium avium growth in bone marrow macrophages from genetically resistant mice. Infect Immun 1993; 61:3775-3784. 50. Vidal S, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73:469-485. 51. Barton H, White JK, Roach TIA et al. NH2-terminal sequence of macrophage-expressed natural resistance-associated macrophage protein (Nramp) encodes a proline/serine-rich putative Src homology 3-binding domain. J Exp Med 1994; 179:1683-1687. 52. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25:514-525. 53. Vidal S, Gros P, Skamene E. Natural resistance to infection with intracellular parasites: molecular genetics identifies Nramp1 as the Bcg/Ity/Lsh locus. J Leukoc Biol 1995; 58:382-390. 54. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185:717-730. 55. Schurr E, Skamene E, Morgan K et al. Mapping of Co13a1 and Co16a3 to proximal murine chromosome 1 identifies conserved linkage of structural protein genes between murine chromosome 1 and human chromosome 2q. Genomics 1990; 8:477-486. 56. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization and tissue-specific expression. J Exp Med 1994; 180:1741-1752. 57. Govoni G, Canonne-Hergaux F, Pfeifer CG et al. Functional expression of Nramp1 in vitro in the murine macrophage line RAW264.7. Infect Immun 1999; 67:2225-2232. 58. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93:4406-4417. 59. Wood RJ, Han O. Recently identified molecular aspects of intestinal iron absorption. J Nutr 1998; 128:1841-1844. 60. Fleming MD, Trenor 3rd CC, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16:383-386. 61. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95:1148-1153. 62. West AH, Clark DJ, Martin J et al. Two related genes encoding extremely hydrophobic proteins suppress a lethal mutation in the yeast mitochondrial processing enhancing protein. J Biol Chem 1992; 267:24625-24633. 63. Agranoff D, Monahan IM, Mangan JA et al. Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J Exp Med 1999; 190:717-724. 64. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35:1065-1078. 65. Gomes MS, Appelberg R. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology 1998; 95:165-168.

52

The Nramp Family

66. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: natural resistance-associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192:1237-1248. 67. Atkinson PG, Barton CH. Ectopic expression of Nramp1 in COS-1 cells modulates iron accumulation. FEBS Letter 1998; 425:239-242. 68. Atkinson PG, Barton CH. High level expression of Nramp1G169 in RAW264.7 cell transfectants: analysis of intracellular iron transport. Immunology 1999; 96:656-662. 69. Barton CH, Biggs TE, Baker ST et al. Nramp1: a link between intracellular iron transport and innate resistance to intracellular pathogens. J Leuko Biol 1999; 66:757-762. 70. Atkinson PG, Blackwell JM, Barton CH. Nramp1 locus encodes a 65 kDa interferon-gamma-inducible protein in murine macrophages. Biochem J 1997; 325:779-786. 71. Barrera LF, Kramnik I, Skamene E et al. Nitrite production by macrophages derived from BCG-resistant and -susceptible congenic mouse strains in response to IFN-gamma and infection with BCG. Immunology 1994; 82:457-464. 72. Formica S, Roach TI, Blackwell JM. Interaction with extracellular matrix proteins influences Lsh/ Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release. Immunology 1994; 82:42-50. 73. Barrera LF, Kramnik I, Skamene E et al. I-A beta gene expression regulation in macrophages derived from mice susceptible or resistant to infection with M. bovis BCG. Mol Immunol 1997; 34:343-355. 74. Brown D, Faris M, Hilburger M et al. The induction of persistence of I-A expression by macrophages from Bcgr mice occurs via a protein kinase C-dependent pathway. J Immunol 1994; 152:1323-1331. 75. Jaramillo M, Olivier M. Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signal-regulated kinase- and cyclic adnosine 5’-monophosphate (camp)-dependent pathways: involvement of NF-kappa B, activator protein 1, and c-AMP response element binding protein. J Immunol 2002; 169:7026-7038. 76. Olivier M, Cook P, DeSanctis Z et al. Phenotypic difference between Bcgr and Bcgs macrophages is related to differences in protein-kinase-C-dependent signalling. Eur J Biochem 1998; 251:734-743. 77. Lafuse WP, Alvarez GR, Zwilling BS. Role of MAP kinase activation in Nramp1 mRNA stability in RAW264.7 macrophages expressing Nramp1(Gly169). Cell Immunol 2002; 215:195-206. 78. Forbes JR, Gros P. Divalent-metal transport by Nramp protein at the interface of host-pathogen interactions. Trends Microbiol 2001; 9:397-403. 79. She H, Xiong S, Lin M et al. Iron activates NF-kappaB in Kupffer cells. Am J Physiol Gastrointest Liver Physiol 2002; 283:G719-26. 80. Hirayama T, Alonso JM. Ethylene captures a metal! Metal ions are involved in ethylene perception and signal transduction. Plant Cell Physiol 2000; 41:548-555. 81. Samet JM, Silbajoris R, Wu W et al. Tyrosine phosphatases as targets in metal-induced signaling in human airway epithelial cells. Am J Respir Cell Mol Biol 1999; 21:357-364. 82. Olivier M, Romero-Gallo BJ, Matte C et al. Modulation of interferon-γ-induced macrophage activation by phosphhotyrosine phosphatases inhibition. Effect on murine leishmaniasis progression. J Biol Chem 1998; 273:13944-13949. 83. Matte C, Marquis JF, Blanchette J et al. Peroxovanadiummediated protectionn against murine leishmaniasis: role of the modulation of nitric oxide. Eur J Immunol 2000; 30:2555-2564. 84. Cai LW, Chu YF, Wilson SE et al. A metal-dependent form of protein phosphatase 2A. Biochem Biophys Res Comm 1995; 208:274-279. 85. Nishito Y, Usui H, Tanabe O et al. Interconversion of Mn2+-dependent and -independent protein phosphatase 2A from human erythrocytes: Role of Zn2+ and Fe2+ in protein phosphatase 2A. J Biochem 1999; 126:632-638. 86. Lamp EC, Drexler HG. Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma 2000; 39:477-484. 87. Hayman AR, Bune AJ, Bradley JR et al. Osteoclastic tartrate-resistant acid phosphatase (Acp 5): Its localization to dendritic cells and diverse murine tissues. J Histochem Cytochem 2000; 48:219-227.

CHAPTER 5

Role of Nramp Family in Pro-Inflammatory Diseases Jenefer M. Blackwell, Hui-Rong Jiang and Jacqueline K. White

Abstract

E

arly observations on the multiple pleiotropic effects of murine Slc11a1 (formerly Nramp1) on macrophage activation and pro-inflammatory responses prompted us to look for human SLC11A1 association with autoimmune diseases (rheumatoid arthritis (RA)). Since then, multiple studies have replicated and extended the linkage and/or association data to include: rheumatoid arthritis in UK, Canada, Korea and Spain; juvenile rheumatoid arthritis in Latvia; type 1 diabetes in the sibs of RA patients in the UK; early onset type 1 diabetes in Japan; inflammatory bowel disease, including Crohn’s disease in USA and Crohn’s disease and ulcerative colitis in Japan and Colored South Africans; primary biliary cirrhosis in the UK; sarcoidosis in African Americans; and multiple sclerosis in Caucasian South Africans. This growing number of reports attests to the potential global importance that polymorphism at SLC11A1 has in determining susceptibility to autoimmune diseases. The association is interesting in relation to the primary role of SLC11A1 in regulating infectious disease susceptibility, in particular to the frequently proposed infectious (especially mycobacterial) etiology or trigger for autoimmune diseases. A role for anti-mycobacterial immunity has also been proposed in modulating susceptibility to atopic disorder, such that in Sweden polymorphism at SLC11A1 influences susceptibility to atopy following BCG vaccination, but not in unvaccinated children. The common association between exposure to mycobacteria and susceptibility to pro-inflammatory autoimmune diseases and atopic disorders suggests that this group of pathogenic organisms has had a major impact in shaping the human immune system. Frequencies of polymorphic variants at SLC11A1 likely provide a genetic signature for the selective forces imposed by exposure to mycobacteria. To date the only functional polymorphism identified at the SLC11A1 locus is a GTn repeat in the promoter, which is further modulated in function by a variant C→T allele at position -237bp. No studies in man have yet determined whether association with autoimmune disease and atopic disorder is related to the direct action of SLC11A1 protein as a divalent cation transporter in late endosomes/lysosomes of macrophage, or is due to one or more of the multiple pleiotropic effects of SLC11A1 on the pro-inflammatory response of macrophages and subsequent development of antigen-specific type 1 versus type 2 T cell responses. Development of murine models to study related autoimmune and atopic disease phenotypes, in particular the development of new congenic mouse strains that carry gene disruptions for proteins pleiotropically regulated by Slc11a1, should prove more tractable in determining the underlying mechanisms of disease.

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

54

The Nramp Family

Introduction Solute carrier family 11 member a1 (Slc11a1) is a proton/divalent cation transporter that is more familiar by its former designation Nramp1/NRAMP1. Nramp1 stands for “natural resistance associated macrophage protein 1”, and is the positionally cloned Ity/Lsh/Bcg gene,1 originally described for its roles in regulating resistance and susceptibility to Salmonella typhimurium, Leishmania donovani, and Mycobacterium bovis BCG in mice (reviewed in refs. 2,3). Early observations on the multiple pleiotropic effects of murine Slc11a1 on macrophage activation prompted us to look for human SLC11A1 association with autoimmune as well as infectious diseases. Here we review the progress of research that looks at SLC11A1 as a regulator of pro-inflammatory responses and susceptibility to autoimmune and other pro-inflammatory diseases in humans and mice.

Genetic Associations with Pro-Inflammatory Autoimmune Disease in Man Using the UK Arthritis and Rheumatism Council’s National Repository of affected sib-pair rheumatoid arthritis (RA) families,4 our laboratory was the first to demonstrate an association between polymorphism at SLC11A1 and susceptibility to autoimmune disease.5 Follow-up analysis showed that all of the effect of SLC11A1 was contributed by the HLA-discordant affected sib pairs.6 These initial observations have been replicated and extended in multiple studies of autoimmune disease world-wide (Table 1). Hence, linkage or association between SLC11A1 and autoimmune diseases now include: RA in UK,5 Canada,7 Korea8 and Spain,9 juvenile rheumatoid arthritis (JRA) in Latvia,10 type 1 diabetes in the sibs of RA patients in the UK,11 early onset type 1 diabetes in Japan,12 inflammatory bowel disease (IBD), including Crohn’s disease in USA13 and Crohn’s disease and ulcerative colitis in Japan14 and coloured South Africans,15 primary biliary cirrhosis in the UK,16 sarcoidosis in African Americans,17 and multiple sclerosis in Caucasian South Africans.18 This growing number of reports attests to the potential global importance that polymorphism at SLC11A1 has in determining susceptibility to autoimmune diseases. Accurate statistical evaluation of its role relative to other genes in the complex inheritance of susceptibility to autoimmune and infectious (see Schurr et al this volume) diseases will be of interest as larger and well-characterized multi-national repositories are developed.

Evidence for Gene x Environment Interactions? The association between SLC11A1 and autoimmune diseases is interesting in relation to its primary role in regulating infectious disease susceptibility (reviewed Schurr et al this volume). Somewhere in the literature relating to almost all autoimmune diseases an infectious etiology has been proposed, frequently related to exposure to mycobacteria. For example, the demonstration of DR4-restricted T cells from synovial fluid of RA patients that respond to mycobacterial-specific epitopes of heat shock proteins provided supporting evidence for a role for mycobacteria in triggering autoimmunity.19 Recent studies20 using specific antibodies and confocal scanning laser microscopy to directly demonstrate M. avium subsp paratuberculosis in microvilli on full thickness tissue of patients with Crohn’s disease (but not in controls) has added to a long literature relating this disease to the presence of atypical mycobacteria in the gut. A role for anti-mycobacterial immunity has also been proposed in modulating susceptibility to atopic disorder.21 Atopy is characterized by immediate immunoglobulin E (IgE)-mediated hypersensitivity to agents such as house dust mites and pollen, and it underlies the increasingly prevalent disorders of asthma, hay fever and eczema. Atopy can be recognized by allergen-specific IgE in serum or by immediate-type hypersensitivity reactions to allergens after intradermal injection. Shirakawa and colleagues21 showed that, amongst Japanese school children, there was a strong inverse association between delayed hypersensitivity to tuberculin prepared from M. tuberculosis and atopy. Positive skin-test responses to tuberculin predicted a lower incidence of asthma, lower serum IgE levels, and cytokine profiles biased toward T helper 1 type. The

Role of Nramp Family in Pro-Inflammatory Diseases

55

Table 1. Summary of autoimmune and immune response phenotypes showing positive linkage or allelic assocation with SLC11A1. Modified and updated from Blackwell et al 2003.31 Phenotype/Disease1 Autoimmune disease: RA RA RA RA in HLA shared epitope -ve patients Juvenile RA Type 1 diabetes in sibs of RA patients Early onset type 1 diabetes IBD Crohn’s Disease IBD Crohn’s disease and ulcerative colitis IBD Crohn’s diseae and ulcerative colitis Primary biliary cirrhosis Sarcoidosis Multiple sclerosis

Immune response: Granulomatous Mitsuda Reaction to Lepromin IL10 responses to mycobacterial PPDs IL10 responses to LPS and LPS + IFNγ Airborne allergen IgE and atopy in BCG vaccinated children

Population

GTn Allele2 Associated

Reference

UK Canada Korea Spain

Allele 3 GTn not associated GTn not associated Allele 2

Shaw et al, 19965 Singal et al, 20007 Yang et al, 2000 8 Rodriguez et al, 20029

Latvia UK

Allele 3 Allele 3

Sanjeevi et al, 200010 Esposito et al, 199811

Japan USA Japan

(Allele 2 lower in patients) Bassuny et al, 200212 not done Hofmeister et al, 199713 Allele 7 Kojima et al, 200114

Colored South Africans UK African Americans Caucasian South Africans

Allele 3 with -237bp C allele Allele 5 Allele 3 Allele 5 200118

Vietnam

not done

Alcais et al, 200043

Malawi

GTn not associated

The Gambia

Allele 2

Blackwell et al, unpublished data Awomoyi et al, 200226

Sweden

GTn not associated

Alm et al, 200223

Zaahl et al, 200315 Graham et al, 200016 Maliarik et al, 200017 Kotze et al,

1RA= rheumatoid arthritis; IBD= inflammatory bowel disease. 2Associations with the major alleles (see Table 2) at the functional GT promoter region polymorphism. n

Not done indicates that this particular polymorphism was not examined, but associations with other polymorphisms across the locus were demonstrated.

authors concluded that exposure and response to BCG vaccination or M. tuberculosis may, by modification of immune profiles, inhibit atopic disorder. The common association between exposure to mycobacteria and susceptibility to pro-inflammatory autoimmune diseases and atopic disorders suggests that this group of pathogenic organisms has had a major impact in shaping the human immune system. Frequencies of polymorphic variants at SLC11A1 likely provide a genetic signature for the selective forces imposed by exposure to mycobacteria. Following on from the Japanese study, Alm and colleagues22 compared rates of atopy in Swedish children who had received BCG vaccination at age < 6 months with those who had no BCG vaccination. Initially they concluded that there was no association between BCG vaccination and rates of atopic disease before school age. In a more recent study23 we reexamined

56

The Nramp Family

this population to determine whether an effect of BCG could be uncovered if we looked for an association between SLC11A1 and atopy after stratifying according to BCG vaccination status. Our hypothesis was that, if ability to mount a type 1 immune response to BCG was under genetic control of SLC11A1, we might only see a relationship between atopy and SLC11A1 in the group that had been BCG vaccinated. For these studies, atopy was defined as positive serological test and/or skin-prick test to any of the selected allergens (cf. below), and a physician assessed clinical symptoms or history congruent with atopic disease. Atopy was assessed by analysis of allergen specific IgE antibodies in sera (Pharmacia Diagnostics AB, Uppsala, Sweden) using 6 common food allergens (fx5) and 11 airborne allergens (Phadiatop®) and with skin prick tests (ALK, Copenhagen, Denmark) against 13 common allergens. Children with a positive serological test and/or at least one positive skin-prick test (≥ 3 mm in diameter and ≥ the histamine-induced weal after 15 min) to any of the selected allergens were considered to be atopic. As predicted, an SLC11A1 association with atopy was only observed in the BCG vaccinated group, and only in those children having atopic responses to airborne and not food borne allergens. This suggests not only a genes x environment interaction, i.e., the influence of SLC11A1 on atopy was only apparent if the children had first made an SLC11A1-regulated response to their BCG vaccination, but also suggested that route of presentation of antigen to the immune system was important. These data raise the interesting possibility that an association between SLC11A1 and pro-inflammatory diseases could provide a signature for an infectious etiology or trigger. This is interesting in relation to the recent demonstration of an association between SLC11A1 and Kawasaki disease in Japan.24 Kawasaki disease is an acute multi-system vasculitis that occurs in infants and children. Diagnostic criteria include fever, inflammatory changes of the lips and tongue, redness and swelling of the peripheral extremities, rash, and cervical lymphadenopathy. Although an infectious etiology has long been suspected based on epidemiological and clinical features, none has been identified to date. Association with SLC11A1 suggests that one may yet be found.

Searching for the Functional Polymorphisms in SLC11A1 Having demonstrated linkage and allelic associations between SLC11A1 and diseases in man, it is clearly important to identify the functional variants responsible for disease. In our laboratory we have sequenced 30-35 genetically independent affected individuals,25 (J.M. Blackwell and others, unpublished data) from each of multiple studies.10,11,25,26 where linkage and association to disease has been observed. To date we have failed to identify new putative functional polymorphisms in the coding region, intron 1, intron/exon boundaries, intron4/ exon4a, or in the 3’UTR. In one population, one novel promoter polymorphism (–86bp G→A) was identified25 within a putative nuclear factor kappa B binding site that could be functional, but it did not occur at sufficiently high frequency to be solely responsible for disease susceptibility in that population. This leaves the GTn repeat identified in the promoter of SLC11A127,28 as the only polymorphism studied to date that has a functional role in regulating SLC11A1 expression.29 In that study,29 reporter gene constructs carried allelic variants 1 to 4 (Table 2) of the GTn repeat on constructs that incorporated 571 to 587 bp of promoter sequence 5' of the ATG initiation codon. Of the four variants tested, allele 3 drove high endogenous and interferon-γ (IFNγ)/ lipopolysaccharide (LPS)-stimulated expression of the luciferase reporter gene, whereas alleles 1, 2 and 4 drove low expression. Recent luciferase reporter gene experiments15 confirm allele 3 as the only allele driving high expression (compared to alleles 2, 5, 8 and 9; see Table 2), and demonstrate further that the variant T allele at the -237bp C→T (formerly -236bp30) promoter polymorphism reverses allele 3-driven expression, bringing it down to the level observed for other alleles. In our earlier studies we had predicted5 that the high expressing allele 3 would be associated with autoimmune disease, and this hypothesis has held up in multiple studies in which the GTn polymorphism has been genotyped (Table 1). As might therefore be predicted, the variant -237bp T allele, which reverses the high level of expression driven by the GTn allele 3, is

Role of Nramp Family in Pro-Inflammatory Diseases

57

Table 2. Summary of GTn alleles in the promoter of SLC11A1 Allele

Sequence at GTn repeat motif

References

1 2 3 4* 5 6 7 8 9

t(gt)5ac(gt)5ac(gt)11ggcaga(g)6 t(gt)5ac(gt)5ac(gt)10ggcaga(g)6 t(gt)5ac(gt)5ac(gt)9ggcaga(g)6 t(gt)5ac(gt)10ggcaga(g)6 t(gt)4ac(gt)5ac(gt)10ggcaga(g)6 t(gt)5ac(gt)5ac(gt)4at(gt)4ggcaga(g)7 t(gt)5ac(gt)5at(gt)11ggcaga(g)6 t(gt)5ac(gt)5ac(gt)6ggcaga(g)6 t(gt)5ac(gt)5ac(gt)8ggcaga(g)6

Blackwell et al, 1995;27 Searle et al, 199929 Blackwell et al, 1995;27 Searle et al, 199929 Blackwell et al, 1995;27 Searle et al, 199929 Blackwell et al, 1995;27 Searle et al, 199929 Graham et al, 200016 Graham et al, 200016 Kojima et al, 200114 Zaahl et al, 200315 Zaahl et al, 200315

* We recently resequenced this allele for Brazil and The Sudan and found it to have 10 not 9 centrally located GT repeats as reported earlier.

protective for IBD.15 The corollary to this was our prediction5 that the low expressing allele 2, which is the most frequent low expresser allele in all populations studied, would be associated with susceptibility to infectious disease. Although this has proved true for tuberculosis in multiple studies in which the GTn promoter polymorphism has been genotyped (reviewed 31), there are studies of infectious diseases (HIV32; visceral leishmaniasis,25 and meningococcal meningitis, M. Hibbard, M. Levin and J.M. Blackwell, unpublished data) where association has been with allele 3. In this situation it could be that the acute pro-inflammatory responses driven by high expression of SLC11A1 mediate pathology, and allele 3 is therefore deleterious. This is consistent with our observation that individuals homozygous for SLC11A1 promoter allele 3 produce higher levels of TNFα and are at significantly higher risk of severe clinical meningococcal disease (M. Hibbard, M. Levin and J.M. Blackwell, unpublished data). Similarly, allele 3 is on a 5' haplotype significantly associated with visceral leishmaniasis in Sudan,25 consistent with SLC11A1-regulated pro-inflammatory responses (e.g., high TNFα;33) associated with this disease. The -237bp C→T variant was not observed in either of these populations, although the novel -86bp G→A variant could modulate promoter activity of the GTn in Sudan. In many studies (e.g., refs. 34,35) evidence has also been found for polymorphisms on 3' haplotypes contributing separately to disease susceptibility, suggesting that there are other functional mutations (e.g., insertion/deletion mutations in the 3’UTR) in man. A functional role for these has yet to be demonstrated. In the meantime we conclude that the 5' GTn promoter region polymorphism plays an important role in shaping autoimmune and infectious disease profiles. Further analysis of 5' promoter region variants that modulate this function will be of great interest as we continue to understand how SLC11A1 shapes human susceptibility to pro-inflammatory diseases world-wide.

Relating Disease Phenotypes to Pleiotropic Effects of SLC11A1 As we have seen, a large number of studies now provide compelling evidence that polymorphism at SLC11A1 is globally important in determining pro-inflammatory responses and autoimmune/atopic disease susceptibility in man, but few studies have attempted to relate this to the mechanism of action of the protein. This is made complex by the multiple pleiotropic effects that we know murine Slc11a1 has on macrophage function (reviewed in refs. 2,3). Does autoimmune disease susceptibility relate to the primary function of SLC11A1 as a divalent cation transporter36 localized to late endosomes/lysosomes,37,38 or is it more likely to relate to one or more of the many pleiotropic effects of SLC11A1 has on macrophage function? Indeed, its influence on different diseases might each be related to a different pleiotropic effect of

58

The Nramp Family

SLC11A1 on the pro-inflammatory/anti-inflammatory response. For most autoimmune diseases, a case could equally be made for susceptibility to be related to any one of the multiple pro-inflammatory chemokines or cytokines differentially regulated by SLC11A1, or to differentially regulated expression of MHC Class II, inducible nitric oxide synthase, respiratory burst activity, antigen processing, or apoptosis (reviewed in refs. 2,3). For example, high levels of TNFα and IL1β are variably elevated in JRA disease subtypes,39 as are other parameters of macrophage activation. The corollary of this is that we might expect anti-inflammatory responses to be associated with susceptibility to infectious disease, especially where the pro-inflammatory cytokines are essential for granuloma formation. This is consistent with recent studies26 demonstrating that allele 2 at the GTn promoter polymorphism for SLC11A1 is not only associated with susceptibility to tuberculosis in The Gambia, but also with high ex vivo IL10 responses in peripheral blood stimulated with IFNγ/LPS in vitro. One argument in favour of a pleiotropic, rather than a direct, effect for SLC11A1 in determining autoimmune/atopic disease susceptibility is the potential link to immune memory. Studies in mice have demonstrated40-42 that Slc11a1 not only influences the immediate pro-inflammatory macrophage activation response, but has long term effects in determining T helper 1 versus T helper 2 bias in antigen-specific T cell-mediated immune responses. In man, Alcais and coworkers43 have demonstrated that ability to mount a delayed granulomatous Mitsuda reaction to mycobacterial antigens from M. leprae is also linked to SLC11A1 (Table 1). In the atopy study in Sweden,23 it was only in the children who had received BCG vaccination at <6 months old that an SLC11A1 association with preschool-age atopy was observed, implying that SLC11A1-regulated memory generated at the time of vaccination impacted on later bias in T helper 1 versus T helper 2 responses on exposure to allergens.

A Direct Role for Iron in SLC11A1 Regulated Autoimmune Disease Phenotypes? Despite the obvious case that can be made for a role for SLC11A1 in regulating macrophage pro-inflammatory responses and susceptibility to autoimmune disease, we also know that patients suffering from RA, for example, show a statistically significant increase in iron deposits in the synovial membrane compared to osteoarthritis patients,44 with an inverse correlation between the haemaglobin concentration and erythrocytes in the serum and the amount of iron in the synovial membrane. Similarly, iron deposition and iron-catalyzed oxidative damage are proposed45,46 as the underlying pathological basis to the development of cortical and subcortical gray matter hypointensities on T2-weighted magnetic resonance images in the brains of multiple sclerosis patients. These observations prompt more interesting speculation that regulation of iron by SLC11A1 contributes directly to the disease phenotype in autoimmune disease. To gain a better understanding of how iron accumulates in RA, Telfer and Brock47 recently analysed expression of ferritin, transferrin receptor, SLC11A1 and SLC11A2 in human rheumatoid synovium. They found that, while SLC11A2 could be detected by PCR in both isolated synovial macrophages and fibroblasts, SLC11A1 was detected by PCR and immunocytochemistry in macrophage and neutrophils in the lining and subintimal zone, and in inflammatory infiltrates, but was absent from fibroblasts. In separate studies Mulero and colleagues48 showed that iron delivered as insoluble Fe59-labelled transferrin-anti-transferrin accumulates in macrophages transfected with mutant Slc11a1, but is efficiently recycled to the medium in wild-type transfectants. This did not occur when iron was delivered as Fe59-transferrin, consistent with delivery to late endosomes/lysosomes as necessary for iron recycling by Slc11a1, possibly through lysomal iron exocytosis. This suggests that SLC11A1-mediated iron recycling from erythrocytes through macrophages could contribute to local deposition of iron in the synovial joints. Alternatively, that failure to recycle iron through macrophages could lead to iron deposition. Addition of ferric citrate to cultures of synovial cells from RA patients significantly enhances cell proliferation, and is additive with effects induced by IL1β, IL7, TNFα or

Role of Nramp Family in Pro-Inflammatory Diseases

59

interferon-γ.49 The mechanistic role played by iron in oxidative damage or nitric oxide production may also contribute to the local inflammatory responses. Hence, we can hypothesize that iron regulation associated with SLC11A1 expression may contribute to disease at the inflammatory site, but we don’t yet know exactly how this works mechanistically.

Mouse Models to Study Slc11a1 Regulation of Pro-Inflammatory Diseases Studies undertaken in humans can, at best, provide correlations. What is needed are model systems in which Slc11a1 function, and the multiple pro-inflammatory mediators it influences, can be regulated more precisely. For this purpose we have recently returned to the mouse to study autoimmune disease phenotypes. Murine models of autoimmune diseases should prove more tractable to analysis of underlying molecular mechanisms, particularly because they allow us to breed gene disruptions for genes that encode each of the molecules that come under pleiotropic regulation of the Slc11a1 gene onto congenic Slc11a1 wild-type and mutant backgrounds. The initial problem has been to choose appropriate models of human autoimmune disease that would provide a Slc11a1-regulated phenotype on the genetic backgrounds (B10, B6 and BALB) upon which congenic lines or gene disruptions for Slc11a1 have already been bred. Recently we have made some progress in defining Slc11a1-regulated phenotypes for dextran sulphate-induced colitis, collagen-induced arthritis, and myelin oligodendrocyte glycoprotein (MOG35-55)-induced experimental autoimmune encephalomyelitis (EAE) which is a model for multiple sclerosis.

Colitis

In initial experiments using a published50,51 protocol that required administration of 5% dextran-sulphate sodium salt (DSS) in the drinking water we observed a 25-30% weight loss over 5-7 days in both Slc11a1 wild-type and mutant B10 congenic strains, with 80-100% mice dying between day 5 and day 7. In subsequent experiments we reduced the dose to 2% DSS in the drinking water, resulting in 8-14% body weight loss in one experiment and 15-25% body weight loss in a second (Fig. 1), and reduced mortality in both (<20%). In both cases we observed a statistically significant difference between congenic Slc11a1 wild-type and mutant mice, providing us with a phenotypic window in which we can now study the associated pathology and immunological mechanisms, including analysis of the Nos2A and phox91 gene disrupted Slc11a1 congenic mouse strains that we have bred in our laboratory. Reduced mortality and recovery after cycle one of DSS treatment, the innate or macrophage controlled phase of disease, means that we will now be able to proceed to a second cycle of DSS at reduced dosage to study the influence of these genes on the acquired T cell phase of the disease.

Collagen-Induced Arthritis (CIA)

To induce arthritis we used the published52 protocol: 100µg/50µl chicken type II collagen in complete Freund’s adjuvant (CFA; 250µg/50µl), intradermally on day 0; followed by 100µg/ 50µl chicken type II collagen, intraperitoneally on day 21. Although a higher mean clinical score was observed (Fig. 2) in N20 (= congenic Slc11a1 wild-type) compared to B10 (= Slc11a1 mutant) mice, the overall clinical phenotype was mild. Higher doses of collagen are being employed to determine whether we can improve the phenotypic window in which to study Slc11a1-regulated immune mechanisms.

Experimental Autoimmune Encephalomyelitis (EAE)

To induce EAE, we used the published52 protocol: 50µg/50µl of myelin oligodendrocyte glycoprotein (MOG35-55) peptide in CFA (100 µg/50µl), subcutaneous on day 0; Pertussis toxin, 100ng/200µl, intravenous on day 0 and day 2. For this disease, a significantly higher mean clinical score was observed (Fig. 3) in B10 (= Slc11a1 mutant) compared to N20 (= congenic Slc11a1 wild-type) mice. Although the maximum clinical score of 4 was observed in

60

The Nramp Family

Figure 1. Dextran-sulphate sodium salt (DSS)-induced colitis in congenic Slc11a1 wild-type (N20) and mutant (B10) mice.

Figure 2. Collagen-induced arthritis (CIA) in congenic Slc11a1 wild-type (N20) and mutant (B10) mice.

Role of Nramp Family in Pro-Inflammatory Diseases

61

Figure 3. Myelin oligodendrocyte glycoprotein (MOG)-induced experimental autoimmune encephalomyelitis (EAE) in congenic Slc11a1 wild-type (N20) and mutant (B10) mice.

100% of B10 mice, which is consistent with published data for C57BL6 mice,52 the effect is transient and all mice survive. The model provides us with a phenotypic window between B10 Slc11a1 congenic strains in which to study immune mechanisms. In establishing these models to study autoimmune disease phenotypes in Slc11a1 congenic mice, it was of interest that, whilst the colitis and CIA models follow the hypothesis that hyper-activation of macrophages and pro-inflammatory responses in Slc11a1 wild-type mice will lead to more severe disease compared to Slc11a1 mutant mice, EAE follows the opposite pattern in which more severe disease is associated with the functionally null Slc11a1 mutant protein. This poses the interesting possibility that inability to recycle iron through macrophages may be associated with iron deposition in the brain. Studies in mice provide the opportunity to look directly at the effect of modulation of iron using ferritin or desferroxamine, as well as the ability to modulate iron catalyzed oxidative damage by removing the machinery (e.g., phox91 and Nos2A knock-outs) that provide the substrates for iron-mediated radical generation. Once we have determined whether or not reactive oxygen (phox91) or nitric oxide (Nos2A) responses play a role in these different Slc11a1-regulated autoimmune disease phenotypes, we can continue to use the backcrossing/intercrossing strategy to breed in gene disruptions of other chemokine/cytokine genes that we know come under the pleiotropic regulation of Slc11a1. In this way we should be able to define the different pathways that are important, and we will know whether the same or different pleiotropic effects are important in the different autoimmune diseases. Mouse models also provide an opportunity to study the role of Slc11a1 in diabetes.53 In this case, Idd5 congenic mice carrying the B10 Slc11a1 mutant allele show reduced incidence of diabetes compared to those carrying a NOD Slc11a1 wild-type allele. Interestingly, previous studies in NOD mice have shown that prior administration of M. bovis BCG protects against the development of diabetes,54 and that this protection is IFNγ-dependent.55 Moreover, NOD mice protected from diabetes by BCG administration develop an autoimmune rheumatic dis-

The Nramp Family

62

ease similar to systemic lupus erythematosus.54 Further work is required using congenic lines to determine what influence polymorphism at Slc11a1 has in determining these BCG-mediated effects. Mouse models have also been used to study the influence of Slc11a1 on the induction of allergic asthma in the mouse.56 Congenic wild-type and mutant mice were sensitized with ovalbumin/alum and later challenged with ovalbumin aerosols. Comparable levels of airway hyper-reactivity and eosinophilia, as well as serum ovalbumin-specific IgG1 and IgG2a, were observed. However, significantly lower serum total and ovalbumin-specific IgE, and significantly lower mast cell degranulation, was observed in wild-type compared to mutant mice. Ovalbumin challenge also led to significantly less release of type 2 cytokines into the airways in wild-type mice. These results suggest that Slc11a1 can affect the development of allergy, but not the development of airway hyper-responsiveness, in the mouse. Again, exposure to mycobacterial antigens modulates these allergic responses in mice,57,58 but a role of Slc11a1 in modulating the BCG effect has yet to be evaluated.

Future Directions Studies reviewed here demonstrate that polymorphism at SLC11A1 contributes to susceptibility to a wide range of autoimmune diseases and to atopic disease. A hypothesis worth pursuing is that this association relates to man’s exposure to infection and, in particular, that current frequencies of polymorphic variants at SLC11A1 provide a genetic signature for the selective forces imposed by exposure to mycobacteria. At present we are unable to define whether SLC11A1 influences disease susceptibility because of its direct action as a divalent cation transporter in the late endosomes/lysosomes of macrophages, or is due to the multiple pleiotropic effects that the protein has on macrophage activation, pro-inflammatory responses, and type 1/ type 2 cytokine bias. However, some progress has been made in the development of mouse models in which Slc11a1-regulated phenotypes can be studied. The challenge for the future is to decipher the important pathways involved in Slc11a1-regulated disease phenotypes, and to apply this information to our further understanding of genetically-regulated pro-inflammatory diseases in man.

Acknowledgements Work in our laboratory on Slc11a1/SLC11A1 is supported by The Wellcome Trust.

References 1. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73:469-485. 2. Blackwell JM, Goswami T, Evans CAW et al. SLC11A1 (formerly NRAMP1) and disease. Cellular Microbiol 2001; 3:773-784. 3. Buschman E, Skamene E. From Bcg/Lsh/Ity to Nramp1: Three decades of search and research. Drug Metab Dispos 2001; 29:471-473. 4. Hay EM, Ollier WER, Silman AJ. The Arthritis and Rheumatism Council’s national family material repository. Brit J Rheumatol 1993; 32:443-444. 5. Shaw M-A, Clayton D, Atkinson SE et al. Linkage of rheumatoid arthritis to the candidate gene NRAMP1 on 2q35. J Med Genet 1996; 33:672-677. 6. John S, Marlow A, Hajeer A et al. Linkage and association studies of the natural resistance associated macrophage protein (NRAMP1) in rheumatoid arthritis. J Rheumatol 1997; 24:452-457. 7. Singal DP, Li J, Zhu Y et al. NRAMP1 gene polymorphisms in patients with rheumatoid arthritis. Tissue Antigens 2000; 55:44-47. 8. Yang YS, Kim SJ, Kim JW et al. NRAMP1 gene polymorphisms in patients with rheumatoid arthritis in Koreans. J Korean Med Sci 2000; 15:83-87. 9. Rodriguez MR, Gonzalez-Escribano MF, Aguilar F et al. Association of NRAMP1 promoter gene polymorphism with the susceptibility and radiological severity of rheumatoid arthritis. Tissue Antigens 2002; 59:311-315. 10. Sanjeevi CB, Miller EN, Dabadghao P et al. Polymorphism at NRAMP1 and D2S1471 loci associated with juvenile rheumatoid arthritis. Arthritis Rheum 2000; 43:1397-1404.

Role of Nramp Family in Pro-Inflammatory Diseases

63

11. Esposito L, Hill NJ, Pritchard LE et al. Genetic analysis of chromosome 2 in type 1 diabetes: Analysis of putative loci IDDM7, IDDM12, and IDDM13 and candidate genes NRAMP1 and IA-2 and the interleukin-1 gene cluster. IMDIAB Group. Diabetes 1998; 47:1797-1799. 12. Bassuny WM, Ihara K, Matsuura N et al. Association study of the NRAMP1 gene promoter polymorphism and early-onset type 1 diabetes. Immunogenetics 2002; 54:282-285. 13. Hofmeister A, Neibergs HL, Pokorny RM et al. The natural resistance-associated macrophage protein gene is associated with Crohn’s disease. Surgery 1997; 122:173-179. 14. Kojima Y, Kinouchi Y, Takahashi S et al. Inflammatory bowel disease is associated with a novel promoter polymorphism of natural resistance-associated macrophage protein 1 (NRAMP1) gene. Tissue Antigens 2001; 58:379-384. 15. Zaahl MG, Winter T, Warnich L et al. Analysis of the SLC11A1 5'-(GT)n repeat polymorphism in patients with inflammatory bowel disease: In vivo and in vitro evidence for a protective allelic effect in the presence of the -237C/T polymorphism. Hum Mol Genet 2003; in press. 16. Graham AM, Dollinger MM, Howie SE et al. Identification of novel alleles at a polymorphic microsatellite repeat region in the human NRAMP1 gene promoter: Analysis of allele frequencies in primary biliary cirrhosis. J Med Genet 2000; 37:150-152. 17. Maliarik MJ, Chen KM, Sheffer RG et al. The natural resistance-associated macrophage protein gene in African Americans with sarcoidosis. Am J Respir Cell Mol Biol 2000; 22:672-675. 18. Kotze MJ, de Villiers JN, Rooney RN et al. Analysis of the NRAMP1 gene implicated in iron transport: Association with multiple sclerosis and age effects. Blood Cells Mol Dis 2001; 27:44-53. 19. Rook G, McCulloch J. HLA-DR4, mycobacteria, heat-shock proteins, and rheumatoid arthritis. Arth Rheum 1992; 35:1409-1412. 20. Naser SA, Shafran I, Schwartz D et al. In situ identification of mycobacteria in Crohn’s disease patient tissue using confocal scanning laser microscopy. Mol Cell Probes 2002; 16:41-48. 21. Shirakawa T, Enomoto T, Shimazu S-i et al. The inverse association between tuberculin responses and atopic disorder. Science 1997; 275:77-79. 22. Alm JS, Lilja G, Pershagen G et al. Early BCG vaccination and development of atopy. Lancet 1997; 350:400-403. 23. Alm JS, Sanjeevi CB, Miller EN et al. Atopy in children in relation to BCG vaccination and genetic polymorphisms at SLC11A1 (formerly NRAMP1) and D2S1471. Genes Immun 2002; 3:71-77. 24. Ouchi K, Suzuki Y, Shirakawa T et al. Polymorphism of SLC11A1 (formerly NRAMP1) gene confers susceptibility to Kawasaki disease. J Infect Dis 2003; 187:326-329. 25. Mohamed HS, Ibrahim ME, Miller EN et al. SLC11A1 (formerly NRAMP1) and susceptibility to visceral leishmaniasis in The Sudan. Eur J Hum Genet 2004; 12(1):66-74. 26. Awomoyi AA, Marchant A, Howson JM et al. Interleukin-10, polymorphism in SLC11A1 (formerly NRAMP1), and susceptibility to tuberculosis. J Infect Dis 2002; 186:1804-1814. 27. Blackwell JM, Barton CH, White JK et al. Genomic organization and sequence of the human NRAMP gene: Identification and mapping of a promoter region polymorphism. Mol Med 1995; 1:194-205. 28. Liu J, Fujiwara TM, Buu NT et al. Identification of polymorphisms and sequence variants in human homologue of the mouse natural resistance-associated macrophage protein gene. Am J Hum Genet 1995; 56:845-853. 29. Searle S, Blackwell JM. Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility. J Med Genet 1999; 36:295-299. 30. Lewis L-A, Victor T, Hoal-van Helden E et al. Identification of a C to T mutation at position -236bp in the human NRAMP1 promoter. Immunogenetics 1996; 44:309-311. 31. Blackwell JM, Searle S, Mohamed H et al. Divalent cation transport and susceptibility to infectious and autoimmune disease: Continuation of the Ity/Lsh/Bcg/Nramp1/Slc11a1 gene story. Immunol Lett 2003; 85:197-203. 32. Marquet S, Sanchez FO, Arias M et al. Variants of the human NRAMP1 gene and altered human immunodeficiency virus infection susceptibility. J Infect Dis 1999; 180:1521-1525. 33. Barral-Netto M, Badaro R, Barral A et al. Tumor necrosis factor (cachectin) in human visceral leishmaniasis. J Infect Dis 1991; 163:853-857. 34. Bellamy R, Ruwende C, Corrah T et al. Variation in the NRAMP1 gene is associated with susceptibility to tuberculosis in West Africans. N Engl J Med 1998; 338:640-644. 35. Cervino AC, Lakiss S, Sow O et al. Allelic association between the NRAMP1 gene and susceptibility to tuberculosis in Guinea-Conakry. Ann Hum Genet 2000; 64:507-512. 36. Goswami T, Bhattacharjee A, Babal P et al. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J 2001; 354:511-519.

64

The Nramp Family

37. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infections with intracellular pathogens: The Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185:717-730. 38. Searle S, Bright NA, Roach TIA et al. Localisation of Nramp1 in macrophages: Modulation with activation and infection. J Cell Sci 1998; 111:2855-2866. 39. Mangge H, Kenzian H, Gallistl S et al. Serum cytokines in juvenile rheumatoid arthritis. Correlation with conventional inflammation parameters and clinical subtypes. Arthritis Rheum 1995; 38:211-220. 40. Kaye PM, Blackwell JM. Lsh, antigen presentation and the development of CMI. Res Immunol 1989; 140:810-815. 41. Kramnik I, Radzioch D, Skamene E. T-helper 1-like subset selection in Mycobacterium bovis bacillus Calmette-Gurin-infected resistant and susceptible mice. Immunology 1994; 81:618-625. 42. Soo S-S, Villarreal Ramos B, Khan CM et al. Genetic control of immune response to recombinant antigens carried by an attenuated Salmonella typhmurium vaccine strain: Nramp1 influences T-helper subset responses and protection against leishmanial challenge. Infect Immun 1998; 66:1910-1917. 43. Alcais A, Sanchez FO, Thuc NV et al. Granulomatous reaction to intradermal injection of lepromin (Mitsuda reaction) is linked to the human NRAMP1 gene in Vietnamese leprosy sibships. J Infect Dis 2000; 181:302-308. 44. Fritz P, Saal JG, Wicherek C et al. Quantitative photometrical assessment of iron deposits in synovial membranes in different joint diseases. Rheumatol Int 1996; 15:211-216. 45. Bakshi R, Dmochowski J, Shaikh ZA et al. Gray matter T2 hypointensity is related to plaques and atrophy in the brains of multiple sclerosis patients. J Neurol Sci 2001; 185:19-26. 46. Bakshi R, Benedict RH, Bermel RA et al. T2 hypointensity in the deep gray matter of patients with multiple sclerosis: A quantitative magnetic resonance imaging study. Arch Neurol 2002; 59:62-68. 47. Telfer JF, Brock JH. Expression of ferritin, transferrin receptor, and nonspecific resistance associated macrophage proteins 1 and 2 (Nramp1 and Nramp2) in the human rheumatoid synovium. Ann Rheum Dis 2002; 61:741-744. 48. Mulero V, Searle S, Blackwell JM et al. Solute carrier 11a1 (Slc11a1; formerly Nramp1) regulates metabolism and release of iron acquired by phagocytic, but not by transferrin-receptor-mediated, iron uptake. Biochem J 2002; 363:89-94. 49. Nishiya K. Stimulation of human synovial cell DNA synthesis by iron. J Rheumatol 1994; 21:1802-1807. 50. Dieleman LA, Palmen MJ, Akol H et al. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Exp Immunol 1998; 114:385-391. 51. Krieglstein CF, Cerwinka WH, Laroux FS et al. Regulation of murine intestinal inflammation by reactive metabolites of oxygen and nitrogen: Divergent roles of superoxide and nitric oxide. J Exp Med 2001; 194:1207-1218. 52. Hoek RM, Ruuls SR, Murphy CA et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 2000; 290:1768-1771. 53. Hill NJ, Lyons PA, Armitage N et al. NOD Idd5 locus controls insulitis and diabetes and overlaps the orthologous CTLA4/IDDM12 and NRAMP1 loci in humans. Diabetes 2000; 49:1744-1747. 54. Silveira PA, Baxter AG. The NOD mouse as a model of SLE. Autoimmunity 2001; 34:53-64. 55. Serreze DV, Chapman HD, Post CM et al. Th1 to Th2 cytokine shifts in nonobese diabetic mice: Sometimes an outcome, rather than the cause, of diabetes resistance elicited by immunostimulation. J Immunol 2001; 166:1352-1359. 56. Smit JJ, Van Loveren H, Hoekstra MO et al. Influence of the macrophage bacterial resistance gene Nramp1 (Slc11a1) on the induction of allergic asthma in the mouse. Faseb J 2003; 17(8):958-60. 57. Hopfenspirger MT, Parr SK, Hopp RJ et al. Mycobacterial antigens attenuate late phase response, airway hyperresponsiveness, and bronchoalveolar lavage eosinophilia in a mouse model of bronchial asthma. Int Immunopharmacol 2001; 1:1743-1751. 58. Hopfenspirger MT, Agrawal DK. Airway hyperresponsiveness, late allergic response, and eosinophilia are reversed with mycobacterial antigens in ovalbumin-presensitized mice. J Immunol 2002; 168:2516-2522.

CHAPTER 6

Role of Nramp2 (DMT1) in Iron Homeostasis Nancy C. Andrews

Abstract Nramp2 (DMT1) plays several important roles in iron metabolism. Investigations of animals carrying mutations in the Nramp2 (DMT1) gene have shown that the protein is critically important for absorption of dietary nonheme iron in the intestine and assimilation of transferrin-bound iron by erythroid precursors. It is likely, but not yet demonstrated, that Nramp2 (DMT1) also functions as an iron transporter in other sites, particularly the kidney and the brain.

Mammalian Iron Metabolism Iron is an essential component of hemoglobin, cytochromes and a variety of enzymes. However, free iron is toxic, and excessive accumulation of the metal promotes oxygen radical formation and consequent cell damage. The toxicity of iron is attenuated by incorporation into proteins, and tight regulation of the overall amount of body iron. Because there is no excretion mechanism for iron through the liver or kidneys, most control of body iron balance is exerted at the level of intestinal absorption. Dietary iron is absorbed in the proximal duodenum, close to the gastric outlet. It passes through the barrier of absorptive epithelial cells with the aid of transmembrane transporter molecules located on the apical and basolateral plasma membranes (reviewed in ref. 1). Iron entering the portal vasculature is taken up by transferrin, an abundant plasma protein capable of binding two iron atoms per molecule with very high affinity. Transferrin prevents iron from catalyzing free radical formation, and it delivers iron to cells bearing surface transferrin receptors. After binding to its receptor, diferric transferrin enters the cell through receptor-mediated endocytosis (also reviewed in ref. 1). Specialized iron-containing endosomes are acidified, resulting in dissociation of iron from transferrin. Iron is subsequently carried across the membrane of the endosome to enter the cytoplasm. Transferrin and transferrin receptor return to the cell surface for further rounds of iron delivery. This iterative uptake process, termed the “transferrin cycle,” has been shown to be essential for normal erythropoiesis. However, nonerythroid cells have alternative mechanisms of iron uptake, which are only partially understood. Hepatocytes are particularly well equipped for iron uptake, apparently taking advantage of both the transferrin cycle and at least one other pathway for direct transmembrane transport of nontransferrin bound iron. Macrophages of the reticuloendothelial system play a unique role in iron homeostasis. Because intestinal absorption normally supplies only 0.5 to 2 mg of iron each day, and erythropoiesis requires approximately 25 mg, most iron dedicated to erythropoiesis must come from an iron supply already present in the body. The bulk of this iron is derived from breakdown of senescent red blood cells, degradation of hemoglobin and recovery of heme iron. This is acThe Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

66

The Nramp Family

complished by specialized macrophages resident in the liver, spleen and bone marrow. They recognize and phagocytose aged and damaged erythrocytes, and recycle the iron to transferrin. This process appears to involve heme oxygenase to liberate the iron from heme, but otherwise it is not well understood.

Roles of Nramp2 (DMT1) in Iron Homeostasis Nramp2 (also known as divalent metal transporter 1, DMT1; divalent cation transporter 1, DCT1) was first shown to function as a divalent metal ion transporter by exogenous expression of the protein in Xenopus oocytes.2 Concurrently, its importance in iron transport was revealed through studies of animals carrying spontaneous loss-of-function mutations in its gene.3 We now know that Nramp2 (DMT1) functions as a transmembrane iron importer in at least two important sites – in the duodenum and in erythroid transferrin cycle endosomes. It is widely expressed, and may have roles in other tissues as well. Microcytic anemia (mk) mice and Belgrade (b) rats carry the same missense mutation in the Nramp2 (DMT1) gene, converting amino acid 185 from glycine to arginine (G185R). The G185R mutation introduces a bulky, basic residue into the fourth predicted transmembrane domain of the protein. Remarkably, the mutation has occurred on at least three independent occasions, twice in mice and once in rats.4 This recurrence is even more striking when considered in the context of the Nramp protein family, because the mutation in Nramp1 associated with increased susceptibility to intracellular pathogens occurred in an adjacent glycine residue, at codon 169 in Nramp1, corresponding to codon 184 in Nramp2 (DMT1).5 That mutation is discussed elsewhere in this volume. The G185R Nramp2 (DMT1) protein has been shown both to have impaired function4 and abnormal intracellular localization,6 but the reason why the mutation has occurred repeatedly is not known. Detailed analyses of the phenotypes of mk mice and b rats have given important insights into the multiple roles of Nramp2 (DMT1). Homozygous mk mice are runted, severely anemic and poorly viable.7 Studies of isolated gut loop segments and of animals that have undergone bone marrow transplantation have shown that mk mice have impaired iron transport at the apical brush border membrane of the gut epithelium.8,9 Similarly, b rats also have a defect in absorption of dietary iron.10,11 Recognizing that both animals have the G185R mutation in Nramp2 (DMT1)3,12 and combined with more recent studies of the subcellular localization of Nramp2 (DMT1) in the intestine,13,14 we can conclude that Nramp2 (DMT1) plays a major role in apical intestinal transport of nonheme iron. Basolateral transport of iron, completing the transfer of iron across the gut epithelium, does not require Nramp2 (DMT) and is probably accomplished by a structurally unrelated iron transporter, known as ferroportin (also Ireg1, MTP1).15-17 Both Nramp2 (DMT1) and ferroportin appear to work in concert with an enzyme that changes the oxidation state of iron. At the apical membrane, this is probably Dcytb, a duodenal-specific cytochrome b – like ferrireductase (see below).18 Basolateral transport appears to require hephaestin, a ferroxidase that may be localized to that membrane.19 All of these proteins, and their putative roles in nonheme iron transport, are illustrated in Figure 1. Intestinal Nramp2 (DMT1) probably also plays a role in absorption of other metals. It carries a broad range of divalent metal ions, including Mn2+, Co2+, Zn2+, Cu2+ and Pb2+ in addition to Fe2+.2 It may be particularly important for manganese uptake; b rats have been shown to have tissue manganese deficiency in addition to iron deficiency.20 Its capacity for lead transport may have relevance in human plumbism (lead poisoning) but this has yet to be established experimentally. In addition, the same bone marrow transplant experiments and additional red blood cell iron uptake experiments using tissues from mk mice indicated that they also have a defect in assimilation of iron by erythroid precursors.9,21 The site of the defect was clarified by studies of b rats, which showed that iron entered erythroid precursors through the transferrin cycle, but was not retained within cells.22-25 This information, along with the knowledge that these animals carry the G185R mutation in Nramp2 (DMT1)3,12 suggested that DMT1 mediates

Role of Nramp2 (DMT1) in Iron Homeostasis

67

Figure 1. Proteins involved in nonheme iron transport. The diagram shows Nramp2 (DMT1) in the context of an absorptive enterocyte. It is localized on the apical brush border membrane (top), where it transports ferrous (Fe2+) ions. Dietary iron is probably reduced by the brush border ferrireductase Dcytb. Iron is thought to exit the cell across the basolateral membrane through ferroportin, which probably also transports Fe2+ ions. Hephaestin, a putative ferroxidase, has some role in basolateral iron transfer, but its site of action has not been established. It may be involved in reducing Fe2+ ions to Fe3+ ions to bind to apotransferrin in the plasma.

transmembrane transfer of iron out of transferrin cycle endosomes into the cytoplasm. Indeed, several subcellular localization studies have confirmed that Nramp2 (DMT1) may be found in transferrin cycle endosomes.4,26 Though it is not selective for iron,2 Nramp2 (DMT1) only serves as a carrier for divalent metals. Dietary nonheme iron and transferrin-bound iron arrive at the membrane in the trivalent (Fe3+) state. At the duodenal brush border, Fe3+ ions are converted to Fe2+ ions through the action of a ferrireductase, which is most likely Dcytb (see Fig. 1).18 The evidence supporting that conclusion is that Dcytb is strongly induced by iron deficiency, and localized to the apical surface of absorptive enterocytes. However, Dcytb is not found in erythroid precursor cells (our unpublished data), and therefore cannot perform the ferrireductase function needed within transferrin cycle endosomes. The identity of the erythroid ferrireductase has not yet been established. It is not yet clear whether Nramp2 (DMT1) also serves important iron transport functions in other cell types. Studies of b rats support the idea that there is a generalized defect in cellular

68

The Nramp Family

iron uptake.10 Nramp2 (DMT1) mRNA is widely expressed, particularly in the brain and the kidney in addition to the tissues already discussed.2 The protein is present on the brush border of renal proximal tubular cells27 and it has been suggested that Nramp2 (DMT1) may play a role in resorption of iron from the renal filtrate to prevent excretion of the metal in the urine.28,29 However, there is some disagreement about where in the kidney it might be acting. Nramp2 (DMT1) mRNA is abundantly expressed in several structures of the central nervous system, including the cerebellum and the hippocampus.2 In addition, Nramp2 (DMT1) has been found in subcellular vesicles in both macrophages and Sertoli cells,30 but its roles in those tissues are not known. As mentioned earlier, the liver has at least two mechanisms for taking up iron. While it is possible that Nramp2 (DMT1) is involved in hepatocellular iron uptake, we have found that mk mice avidly accumulate iron in hepatocytes after they are given intravenous iron dextran (H. Gunshin and N.C. Andrews, unpublished data). This result makes it unlikely that DMT1 is the only transmembrane iron transporter functioning in the liver. There are at least four isoforms of Nramp2 (DMT1) mRNA detected in mammalian cells. These result from alternative splicing events that assemble different combinations of two alternative 5' exons and two alternative 3' exons, resulting in mRNAs that have different coding sequences at both ends.31 The alternative 5' exons, denoted 1A and 1B, are transcribed from different promoters, and exon 1A adds approximately 30 amino terminal amino acids to the protein. The alternative 3' exons not only encode different carboxyl termini for the protein, but also mediate differential translational regulation. One 3' exon contains an RNA hairpin structure in the 3' untranslated region that bears strong similarity to iron regulatory elements (IREs) known to effect post-transcriptional control of mRNA translation in response to varying cellular iron levels (reviewed in ref. 32). The other 3' exon does not include an IRE. The level of Nramp2 (DMT1) mRNA increases dramatically in intestinal samples from iron-deficient animals. This increase is probably due to both induction of transcription and post-transcriptional stabilization of the IRE-containing form of Nramp2 (DMT1) mRNA. It has been observed that the abundance of the mRNA containing both exon 1A and the 3' IRE is most markedly increased by iron deficiency.31 Mice and rats are not the only species in which Nramp2 (DMT1) mutations have been identified. A Drosophila screen for mutants with gustatory defects identified a mutation in malvolio,33 the only Nramp protein in that species, and a protein more closely related to mammalian Nramp2 (DMT1) than to Nramp1. Fruit flies do not produce hemoglobin, and therefore would not be anemic if iron transport was defective. Interestingly, however, the gustatory defect in malvolio mutants bears a striking similarity to the human disorder pica. Pica is a bizarre behavior observed in patients with iron deficiency, characterized by the compulsive consumption of nonnutritive substances. Perhaps not surprisingly, it has been shown that the gustatory defect in malvolio flies can be reversed by feeding the flies iron.34 Recently, a mutation was described in the zebrafish ortholog of Nramp2 (DMT1).35 In this case, truncation of the protein by substitution of a nonsense codon in the middle of the coding sequence resulted in total loss of protein function and a consequent microcytic, hypochromic anemia similar to that seen in mk mice and b rats. However, the mutant fish are viable, and not as severely affected as mutant rodents, suggesting that fish are less dependent on Nramp2 (DMT1) for iron transport. Table 1 lists the known animal mutations in Nramp2 (DMT1).

Nramp2 (DMT1) in Iron Disorders The identification of Nramp2 (DMT1) mutations in several species underscores the importance of the protein in iron metabolism, and begs the question of whether abnormalities of Nramp2 (DMT1) are also associated with human diseases. It has been noted that human patients with familial iron-refractory, iron-deficiency anemia36-38 bear phenotypic similarity to mk mice.39 However, although several groups (including our own) have analyzed the DNA

Role of Nramp2 (DMT1) in Iron Homeostasis

69

Table 1. Mutations in Nramp2 (DMT1) proteins in animals. Species

Mutation

Phenotype

M. musculus

G185R

R. rattus

G185R

D. rerio

Nonsense mutation

D. melanogaster

Insertion mutations

Defective iron uptake at the apical surface of absorptive enterocytes and in erythroid precursor cells, leading to iron deficiency with hypochromic, microcytic anemia Defective iron uptake at the apical surface of absorptive enterocytes and in erythroid precursor cells, leading to iron deficiency with hypochromic, microcytic anemia Hypochromic, microcytic anemia probably due to defective erythroid iron uptake Abnormal taste behavior, which corrects when flies are given extra iron

Reference 3

12

35

33

sequence of the Nramp2 (DMT1) gene in some of these patients, no mutations have been found.40 A more careful analysis of the phenotype in one case report showed that there were differences between the abnormalities found in mk mice and those seen in children with inherited iron deficiency anemia that was not responsive to oral iron therapy.38 Nonetheless, Nramp2 (DMT1) probably does have an important role in human iron disorders. At present, it is the only known portal of entry into the intestine for dietary nonheme iron. Investigation of compound mutants produced by mating mice lacking the murine ortholog of the human hemochromatosis gene (Hfe) with mk mice demonstrated that loss of Nramp2 (DMT1) was protective in murine (and presumably also in human) hemochromatosis.41 While animals with the Hfe-/- genotype developed iron overload, animals with the Hfe-/-;Nramp2mk/ mk genotype were iron deficient, similar to mk/mk mice with normal Hfe protein. This conclusively showed that iron loading in hemochromatosis results from increased entry of iron through Nramp2 (DMT1) rather than through activation of an alternative iron uptake system. This suggests that Nramp2 (DMT1) could be a good target for pharmaceutical agents aimed at decreasing dietary iron loading in hemochromatosis. Could iron loading simply result from increased expression of Nramp2 (DMT1) protein in hemochromatosis? Probably not. While there are reports of increased Nramp2 (DMT1) expression in intestinal samples from Hfe-/- mice of mixed genetic background42 and human hemochromatosis patients treated in various ways,42,43 other groups studying Hfe-/- mice on a pure genetic background have found no increase in expression44 or increased expression only on certain strains.45 The studies of human patients were confounded by the fact that the patients had undergone phlebotomy treatment for their disease, which in itself is likely to alter expression of Nramp2 (DMT1). Taken together, these results suggest that iron loading in hemochromatosis is not simply a consequence of upregulation of Nramp2 (DMT1) expression, but must involve other abnormalities. In contrast, there is definitive data from animal experiments that indicates that Nramp2 (DMT1) expression is increased when erythropoiesis is iron-restricted.2,6,13,44 It likely responds to the “erythroid regulator,”46,47 a stimulus to increase intestinal iron absorption to meet the erythropoietic needs of an iron-deficient bone marrow.

70

The Nramp Family

Future Directions Although our understanding of the role of Nramp2 (DMT1) in iron transport has advanced rapidly over the past few years, there are still many important questions that remain to be answered. First, although the phenotype of mk mice and b rats suggests that Nramp2 (DMT1) is the major nonheme iron transporter in the duodenum, it may not be the only nonheme iron transporter. It has been proposed that there is an alternative transport mechanism for Fe3+ ions,48 but there is little experimental evidence to support that contention. It is not yet known how heme iron is taken up by intestinal absorptive cells, or whether Nramp2 (DMT1) also plays a role in that transport mechanism. Similarly, it is not known whether there are redundant iron transporters aiding in the release of iron from transferrin cycle endosomes. Targeted disruption of the Nramp2 (DMT1) gene in selected mouse tissues may help to answer these questions, and will allow comparison of mk mutant animals to animals lacking Nramp2 (DMT1) altogether. Macrophages are, arguably, the most important iron-handling cell, because of their central role in iron recycling. There is currently very little information about the role, if any, of Nramp2 (DMT1) in these cells. The fact that Nramp1, the only known mammalian homolog of Nramp2 (DMT1), is exclusively expressed in tissue macrophages49 suggests that Nramp1 may play a role in iron recycling. But it is yet to be determined whether either or both of these Nramp proteins are involved in that process. Similarly, placental iron transfer is very important, but poorly understood. Nramp2 (DMT1) is expressed in the placenta but its role in that tissue is unknown. It is likely that the high levels of Nramp2 (DMT1) mRNA in the kidney and central nervous system signify important roles for the protein in those tissues. Information about those roles may be accessible through studies of mice that have selectively inactivated the Nramp2 (DMT1) gene through tissue-specific expression of Cre recombinase to excise critical elements of the gene in “conditional” knockout mice carrying floxed Nramp2 (DMT1) alleles.

References 1. Andrews NC. Animal Models of Iron Transport and Storage Disorders. In: Templeton DM, ed. Molecular and Cellular Iron Transport. New York, NY: Marcel Dekker Inc., 2001:679-697. 2. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-488. 3. Fleming MD, Trenor CC, Su MA et al. Microcytic anemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16:383-386. 4. Su MA, Trenor CC, Fleming JC et al. The G185R mutation disrupts function of iron transporter Nramp2. Blood 1998; 92:2157-2163. 5. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73:469-485. 6. Canonne-Hergaux F, Fleming MD, Levy JE et al. The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000; 96(12):3964-3970. 7. Russell ES, McFarland EC, Kent EL. Low viability, skin lesions, and reduced fertility associated with microcytic anemia in the mouse. Transplant Proc 1970; 2:144-151. 8. Bannerman RM, Edwards JA, Kreimer-Birnbaum M et al. Hereditary microcytic anaemia in the mouse; studies in iron distribution and metabolism. Br J Haematol 1972; 23(2):235-245. 9. Harrison DE. Marrow transplantation and iron therapy in mouse hereditary microcytic anemia. Blood 1972; 40:893-901. 10. Farcich EA, Morgan EH. Diminished iron acquisition by cells and tissues of Belgrade laboratory rats. Am J Physiol 1992; 262(2 Pt 2):R220-224. 11. Oates PS, Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol May 1996; 270(5 Pt 1):G826-832. 12. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95:1148-1153.

Role of Nramp2 (DMT1) in Iron Homeostasis

71

13. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93(12):4406-4417. 14. Trinder D, Oates PS, Thomas C et al. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000; 46(2):270-276. 15. Donovan A, Brownlie A, Zhou Y et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000; 403(6771):776-781. 16. McKie AT, Marciani P, Rolfs A et al. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000; 5:299-309. 17. Abboud S, Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 2000; 275:19906-19912. 18. McKie AT, Barrow D, Latunde-Dada GO et al. An iron-regulated ferric reductase associated with the absorption of dietary iron. Science 2001; 291:1755-1759. 19. Vulpe CD, Kuo YM, Murphy TL et al. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 1999; 21:195-199. 20. Chua AC, Morgan EH. Manganese metabolism is impaired in the Belgrade laboratory rat. J Comp Physiol [B] 1997; 167(5):361-369. 21. Edwards CQ, Deiss A, Cole BC et al. Hematologic changes in chronic arthritis of mice induced by Mycoplasma arthritidis. Proc Soc Exp Biol Med 1975; 150(3):664-668. 22. Edwards JA, Garrick LM, Hoke JE. Defective iron uptake and globin synthesis by erythroid cells in the anemia of the Belgrade laboratory rat. Blood 1978; 51(2):347-357. 23. Edwards JA, Sullivan AL, Hoke JE. Defective delivery of iron to the developing red cell of the Belgrade laboratory rat. Blood 1980; 55(4):645-648. 24. Farcich EA, Morgan EH. Uptake of transferrin-bound and nontransferrin-bound iron by reticulocytes from the Belgrade laboratory rat: Comparison with Wistar rat transferrin and reticulocytes. Am J Hematol 1992; 39(1):9-14. 25. Garrick MD, Gniecko K, Liu Y et al. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J Biol Chem 1993; 20:14867-14874. 26. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189:831-841. 27. Canonne-Hergaux F, Gros P. Expression of the iron transporter DMT1 in kidney from normal and anemic mk mice. Kidney Int 2002; 62(1):147-156. 28. Ferguson CJ, Wareing M, Ward DT et al. Cellular localization of divalent metal transporter DMT-1 in rat kidney. Am J Physiol Renal Physiol 2001; 280(5):F803-814. 29. Wareing M, Ferguson CJ, Green R et al. In vivo characterization of renal iron transport in the anaesthetized rat. J Physiol 2000; 524 (Pt 2):581-586. 30. Jabado N, Canonne-Hergaux F, Gruenheid S et al. Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes in macrophages and Sertoli cells. Blood 2002; 100(7):2617-2622. 31. Hubert N, Hentze MW. Previously uncharacterized isoforms of divalent metal transporter (DMT)-1: Implications for regulation and cellular function. Proc Natl Acad Sci USA 2002; 99(19):12345-12350. 32. Eisenstein RS, Blemings KP. Iron regulatory proteins, iron responsive elements and iron homeostasis. J Nutr 1998; 128(12):2295-2298. 33. Rodrigues V, Cheah PY, Ray K et al. malvolio, the Drosophila homologue of mouse NRAMP-1 (Bcg), is expressed in macrophages and in the nervous system and is required for normal taste behaviour. Embo J 1995; 14(13):3007-3020. 34. Orgad S, Nelson H, Segal D et al. Metal ions suppress the abnormal taste behavior of the Drosophila mutant malvolio. J Exp Biol 1998; 201(Pt 1):115-120. 35. Donovan A, Brownlie A, Dorschner MO et al. The zebrafish mutant gene chardonnay encodes Divalent Metal Transporter1 (DMT1). Blood 2002; 100(13):4655-9. 36. Buchanan GR, Sheehan RG. Malabsorption and defective utilization of iron in three siblings. J Pediatr 1981; 98:723-728. 37. Hartman KR, Barker JA. Microcytic anemia with iron malabsorption: An inherited disorder of iron metabolism. Am J Hematol 1996; 51:269-275. 38. Pearson HA, Lukens JN. Ferrokinetics in the syndrome of familial hypoferremic microcytic anemia with iron malabsorption. J Pediatr Hematol Oncol 1999; 21(5):412-417. 39. Bannerman RM. Of mice and men and microcytes. J Pediatr 1981; 98:760-762.

72

The Nramp Family

40. Galanello R, Cau M, Melis MA et al. Studies of NRAMP2, transferrin receptor and transferrin genes as candidate genes for human herditary microcytic anemia due to defective iron absorption and utilization (Abstract). Blood 1998; 92S:669a. 41. Levy JE, Montross LK, Andrews NC. Genes that modify the hemochromatosis phenotype in mice. J Clin Invest 2000; 105(9):1209-1216. 42. Fleming RE, Migas MC, Zhou X et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: Increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 1999; 96:3143-3148. 43. Zoller H, Pietrangelo A, Vogel W et al. Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients with hereditary haemochromatosis. Lancet 1999; 353(9170):2120-2123. 44. Canonne-Hergaux F, Levy JE, Fleming MD et al. Expression of the DMT1 (NRAMP2) iron transporter in mice with genetic iron overload disorders. Blood 2001; 97:1138-1140. 45. Dupic F, Fruchon S, Bensaid M et al. Inactivation of the hemochromatosis gene differentially regulates duodenal expression of iron-related mRNAs between mouse strains. Gastroenterology 2002; 122(3):745-751. 46. Finch C. Regulators of iron balance in humans. Blood 1994; 84:1697-1702. 47. Andrews NC. Medical Progress: Disorders of iron metabolism. N Engl J Med 1999; 341(26):1986-1995. 48. Conrad ME, Umbreit JN, Moore EG. Iron absorption and transport. Am J Med Sci 1999; 318(4):213-229. 49. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization and tissue-specific expression. J Exp Med 1994; 180:1741-1752.

CHAPTER 7

Molecular Physiology of the H+-Coupled Iron Transporter DMT1 Bryan Mackenzie and Matthias A. Hediger

Abstract

T

he mammalian DMT1 is a widely-expressed divalent metal-ion transporter that is energized by the H+ electrochemical gradient. Among the broad range of transition metal ions accepted as substrates, Fe2+ is transported with high affinity (K0.5 2 µM). DMT1 accounts both for the intestinal absorption of free Fe2+ and for transferrin-associated endosomal Fe2+ uptake in erythroid precursors and many peripheral cell types. The identification of multiple splice forms with differing expression patterns point to discrete targeting and control mechanisms, and may explain how DMT1 is dramatically upregulated in the intestine by dietary iron restriction whereas its expression in many other tissues is less dependent upon iron status. Knowledge of the molecular mechanisms and regulation of DMT1 will help us better understand the role of DMT1 in human health and in disorders such as hereditary hemochromatosis.

Introduction DMT1 was cloned in our laboratory in 1997 by identifying a rat cDNA that induced iron uptake activity in Xenopus laevis oocytes.1 Around the same time, Andrews’ group used a positional cloning strategy to identify the defective gene (Nramp2) in an inbred mouse strain with microcytic anemia (mk).2 Although Nramp2 had been identified previously, its cellular role remained unknown.3 Our functional characterization of DMT1 (the rat orthologue of Nramp2) as a divalent metal-ion transporter1 provided an explanation for the mk mouse phenotype and fueled speculation1,4 as to the mechanisms by which Nramp1, a macrophage-specific homologue of Nramp2, could confer resistance to mycobacterial infection.5 The product of the SLC11A2 gene, DMT1 is a membrane glycoprotein with 12 predicted transmembrane domains (TM) (Fig. 1).1,3,6-8 We review here aspects of DMT1 that are the focus of work in our laboratory, exploring both the molecular mechanisms of the transporter and the role it plays in iron absorption and cellular iron uptake in human health and disease.

Molecular Mechanisms of DMT1 We examined the functional characteristics of DMT1-expressing oocytes using the voltage clamp and measurement of intracellular pH (pHi).1 We found that iron transport was rheogenic, with Fe2+ evoking currents of up to -1,000 nA at low extracellular pH (pHo). DMT1 displayed high affinity for Fe2+ (the half-maximal Fe2+ concentration, KFe0.5, was 2 µM at pHo 5.5, -50 mV).1 The Fe2+-evoked currents were voltage-dependent and activated by low pHo (KH0.5 of 1-2 µM at -50 mV). This latter effect was not simply due to the increased solubility of the iron at low pHo and its reduction by L-ascorbic acid included in the experimental media. Rather, The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

74

The Nramp Family

Figure 1. Proposed topological model of rat DMT1 with 12 transmembrane (TM) regions, indicating the site of the G185R mutation (in TM4) associated with microcytic anemia in the Belgrade rat (the mk mouse also harbors this mutation). His-267 and His-272 (in TM6), the targets of site-directed mutagenesis studies described in this chapter, are also indicated.

DMT1-mediated Fe2+ transport is driven by the coupled flux of H+ down its electrochemical potential gradient, as was demonstrated by the combination of these microelectrode techniques. First, in the absence of metal ion, step-changes in membrane potential (Vm) generated rapidly-decaying transient currents that were sensitive to changes in pHo — our first indication that H+ was a ligand of DMT1, since H+ could alter the conformation of the DMT1 protein within the membrane. Second, simultaneous measurement of pHi revealed that the Fe2+-evoked current was associated with a rapid intracellular acidification (Fig. 2).1 Intracellular acidification was also demonstrated in association with Fe2+ transport activity in Caco2 cells.9 Caco2 cells are known to express DMT1 (Refs. 9,10), and the characteristics of Fe2+ uptake in these cells, in terms of pH-dependence and KFe0.5 ≈ 3 µM,10 were consistent with our studies in oocytes. A small inward current, associated with a modest intracellular acidification, was also observed in oocytes after switching from pHo 7.5 to 5.5 in the absence of metal ion (Fig. 2). This ‘leak’ current was increased 10-fold in oocytes expressing a DMT1 mutant, H272A.11 The reversal potential (V ) of the H272A-DMT1 leak currents varied with pHo according to the rev Nernst equation (∆V = -53 mV per pHo unit) confirming that the DMT1 leak current is an rev + uncoupled H conductance.11 The H+ leak is represented by step 2 to 5 in our oversimplified model for DMT1 in which transport is viewed as a series of ligand-induced conformational changes (Fig. 3). Whereas this six-state model accounts reasonably well for the observed activity of DMT1, it will need to be revised as more kinetic and structure-function data becomes available. Uncoupled conductance(s) were also suggested by the observation that the magnitude of the Fe2+-evoked currents exceeded that expected for stoichiometric transport of H+ with Fe2+ (ref. 12). Members of the yeast SMF transporter family4 (which bear ≈ 30% identity to rat DMT1) also appear capable of transporting Fe2+ (ref. 12) and may exhibit features that help us understand the molecular mechanisms of DMT1. Expression of SMF1, but not DMT1,

Molecular Physiology of the H+-Coupled Iron Transporter DMT1

75

Figure 2. H+-coupling of Fe2+ transport mediated by DMT1. Simultaneous measurement of current and intracellular pH (pHi) revealed that the Fe2+-evoked current was associated with an influx of H+. The oocyte was voltage-clamped at -90 mV and superfused for the periods indicated by the boxes in the top panel, with pH 7.5 medium (blank), then with pH 5.5 medium (diagonal hatch). Fe2+ was added at 50 µM for the period shown by the solid bar. Redrawn from Ref. 1 with permission of Nature Publishing Group.

in oocytes was associated with a La3+-sensitive Na+ conductance with properties of a channel, and SMF1-mediated 55Fe2+ uptake was inhibited in the presence of Na+.12 DMT1 did not mediate a 22Na+ flux11 and there is no evidence for a Na+ leak. The physiological significance of leak currents is not understood, except that they place a penalty on the cell energetics.

Substrate Profile DMT1 displays a remarkable promiscuity towards a range of divalent transition metal ions (Me2+). That Cd2+, Co2+, Cu2+, Mn2+, and Zn2+ are ligands was demonstrated by their ability to evoke currents of a similar magnitude to the Fe2+-evoked currents in oocytes expressing DMT1 (Ref. 1). Ni2+ and Pb2+ also evoked currents, but these were smaller than the Fe2+-evoked currents. Nevertheless, direct measurement (such as radiotracer assay) will be required to confirm that each of these Me2+ ligands are actually transported, as for 60Co2+ and 54Mn2+ which are transported in DMT1-expressing oocytes.13 DMT1 exhibits lower affinity for certain metal ions compared with Fe2+. For example, the KNi0.5 of 6 µM (at pHo 5.5, -50 mV, B. Mackenzie, and M. A. Hediger, unpublished) makes it doubtful that DMT1 would account for significant nickel absorption when iron is abundant in the diet. Ca2+ (but not Mg2+) exhibited properties

76

The Nramp Family

Figure 3. Oversimplified model of H+-coupled Fe2+ transport in DMT1. The operation of DMT1 is viewed as a series of voltage-dependent or ligand-induced conformational changes. Available data suggest that the empty transporter bears a movable net negative charge, that H+ binds before Fe2+, and that both substrates are translocated simultaneously. A H+ ‘leak’ (uniport) pathway is indicated by the dotted arrow between states 2 and 5.

of a weak blocker, but the very low apparent affinity (KCai ≈ 10 mM) indicated that Ca2+ is unlikely to interfere with iron transport under physiological conditions.1 We urge that data from mammalian cell lines and tissues be interpreted cautiously, both with regard to (1) the multiplicity of transport routes for Me2+ and (2) the understanding that inhibition of Fe2+ transport by Me2+ is not final evidence of Me2+ transport. One of the more compelling studies of late comprised DMT1 knockdown in Caco2 cells. DMT1 knockdown significantly inhibited 55Fe2+ and 109Cd2+ uptake without effect on uptake of lead.10 Therefore, DMT1 may also account for absorption of the toxic metal cadmium, but not lead.

Structure-Function Analysis of DMT1 As the first step in structure-function analysis, we and others are determining the impact of mutating specific amino acid residues in the DMT1 protein (Fig. 1). Two histidyl residues that reside in TM6 appear critical to normal function.8 A pair of histidyl residues can form a Me2+-binding site, as can a Cys-residue pair. However, since mutating both His residues to Cys abolished transport activity, it is not clear whether His-267 and His-272 serve a role in Me2+ binding. Instead, His-267 and His-272 seem to be involved in pH regulation of Me2+ transport,8 and our work indicates that the H272A mutation uncouples Fe2+ transport from the H+ flux.11 An identical glycine-to-arginine missense mutation at residue 185 in TM4 in the rat and mouse DMT1 underlies the microcytic anemia that is characteristic of the Belgrade (b) rat and mk mouse. Fe2+ transport activity was reduced more than 90% in mammalian cells transfected

Molecular Physiology of the H+-Coupled Iron Transporter DMT1

77

with the b and mk mutants compared with wild-type DMT1 (Refs. 8,14,15), an effect that was not fully explained by a decrease in the amount of protein that reaches the cell surface.15 Future kinetic and molecular analysis of the impact of the G185R mutation (such as in the oocyte system) may help in interpreting the complex phenotype of the b and mk animals and, in turn, help us better understand the role of DMT1 in the biology of iron transport.

The Role of DMT1 in the Biology of Iron Transport

DMT1 mRNA was present in at least some cell types in every tissue tested.1 DMT1 mRNA and protein is expressed throughout the small intestine, most strongly in the proximal duodenum where its expression is tightly regulated by body iron status.1,16 In the small intestine, DMT1 is absent from crypt cells,16 the iron-sensing cells of the intestine. DMT1 mRNA is found along the crypt-to-villus axis, whereas expression of the protein is highest in cells that have migrated to the villus tip (Fig. 4).1,16,17 There, the sequential actions of the Na+/K+-ATPase and the Na+/H+ exchanger generate an acidic microclimate at the brush border, providing a H+ electrochemical gradient sufficient to drive uptake of Fe2+ into the enterocytes (Fig. 4). Notably the microclimate pHo of ≈ 6.0 measured in vivo18 closely corresponds with the observed KH0.5 (1-2 µM) in DMT1-expressing oocytes.1 That DMT1 is an obligatory requirement for adequate intestinal absorption of nonheme iron is demonstrated by the mk mouse and b rat phenotypes in which intestinal iron absorption is impaired.14 Upregulation of DMT1 in the duodenum (the G185R mutant retains 3-10% wild-type activity in transfected mammalian cells in vitro8,14,15) may account for how these animals can even survive. However, targeting of DMT1 to the intestinal brush border is also disrupted in the mk mouse.19 Classic studies of the mk mouse and b rat phenotypes described severe microcytic anemia and defective erythroid cell iron utilization (reviewed in Ref. 20). Whereas the transferrin cycle per se appeared normal in these animals, transfer of iron from the endosomal lumen to the cytosol was disrupted. DMT1 has been colocalized with the transferrin receptor in recycling endosomes of reticulocytes and transfected cells in vitro,15,21-24 and likely accounts for export of Fe2+ (after dissociation from transferrin) to the cytoplasm. Acidification of these intracellular compartments by the V-ATPase25 may provide the H+ gradient to energize DMT1-mediated Fe2+ transport (Fig. 4). This process may account for Fe2+ uptake in many other peripheral cell types too. An analogous—but transferrin-independent—process accounts for recovery of Fe2+ from phagosomes of macrophages and Sertoli cells (Fig. 4).26 Localization of DMT1 to the plasma membrane of CHO cells27 and the renal brush border28 reminds us that the expression of DMT1 at the plasma membrane is not limited to the intestine.

Multiple Splice Forms Reveal Discrete Expression Control Mechanisms DMT1 mRNA levels in rat and human intestine were markedly increased in response to iron deprivation, and a consensus iron-responsive element (IRE) in the 3'-untranslated DMT1 mRNA (just downstream of its coding sequence) was assumed to underlie this regulatory control.1,17 We proposed that DMT1 expression could be regulated at the level of mRNA stability by the iron-dependent binding of an IRE-binding protein (IRP1) to the DMT1 IRE, in analogy to the iron-responsive regulation of the transferrin receptor mRNA expression.29,30 Consistent with this view, a second human DMT1 splice variant31 that lacks the IRE is not subject to iron-dependent regulation.17,32 The carboxy termini differ slightly between the IRE-containing and nonIRE DMT1 variants so their expression can be detected both at the protein level and mRNA level. The IRE-containing and nonIRE forms are discretely regulated in rodents: the IRE-containing DMT1 is upregulated in the small intestine of iron-deficienct animals, whereas expression of the nonIRE DMT1 in spleen and liver is independent of iron status.16,33

78

The Nramp Family

Figure 4. Models of DMT1-mediated H+-coupled Fe2+ transport. A, B) Intestinal iron absorption. The association of HFE and the transferrin receptor (TfR) in crypt cells may be the basis of an iron sensing mechanism that controls expression of DMT1 in maturing enterocytes as they migrate towards the villus tip (A). Fe2Tf, diferric transferrin. The acidic microclimate at the brush border provides a H+ electrochemical gradient that drives DMT1-mediated Fe2+ uptake into the enterocyte (B). Basolateral export of Fe2+ may be mediated by Ireg1 in association with hephaestin. C) Iron transport in erythroid precursors comprises endocytosis of transferrin and DMT1-mediated Fe2+ export from acidified endosomes into the cytosol. D) Recovery of Fe2+ from phagosomes in macrophages, driven by the H+ gradient generated by the V-ATPase.

More recent work has also revealed alternative splicing at the 5'-end in human, rat and mouse DMT1 (ref. 33). The novel 5' exon (exon 1A) is located upstream of the first exon (“1B”) of the previously-characterized DMT1 and introduces an additional 29-31 amino acids to the DMT1 sequence. Notably, both the 1A exon and the 3' IRE contributed to regulation by iron status in the duodenum and in Caco2 cells.33 These alternative splicing arrangements give rise to four mRNA transcripts (1A-IRE, 1A-nonIRE, 1B-IRE, and 1B-nonIRE) that differ in their expression patterns. Whereas the 1B isoform was ubiquitous, the 1A isoform was tissue-specific, found predominantly in the duodenum and kidney.33 Meanwhile, another recent study showed that the IRE form was expressed predominantly by epithelial cell lines, whereas the nonIRE form was expressed by blood cell lines.34 However, it is not clear from the emerging data how the four transcripts differ in tissue distribution since it has not been possible to discriminate between all four simultaneously. Differences in the amino acid sequences of the four splice forms might be expected to contribute to their discrete targeting within cells, e.g., targeting to endosomes in tissues in which iron uptake depends upon transferrin-mediated

Molecular Physiology of the H+-Coupled Iron Transporter DMT1

79

endocytosis. Site-directed mutagenesis revealed that the cytoplasmic tail of the nonIRE DMT1 contains a signal sequence (Y555XLXX) required for targeting to early endosomes.34 Meanwhile, the IRE-containing form was localized to the apical plasma membrane, late endosomes and lysosomes of polarized cells, and its insertion into the apical membrane—but not endosomes—appeared to require N-glycosylation of DMT1 (Ref. 34).

DMT1 and Its Association with Human Disease Possible disease-related mutations of SLC11A2 within the human population have not yet been fully explored. Nevertheless, it is interesting to note that at least two human pedigrees display an autosomal, recessively-inherited disorder characterized by severe microcytic anemia and intestinal malabsorption of iron.35,36 The disorders in iron metabolism were only partially corrected by parenteral iron administration in these patients, reminiscent of the b rat and mk mouse phenotypes. Strong evidence exists for the involvement of DMT1 in the etiology of hereditary hemochromatosis (HHC), the most common hereditary disease in Caucasians, but DMT1 is not itself mutated in the disease.31 Most cases of this autosomal recessive disorder result from missense mutations in an MHC class I-like protein called HFE.37-39 HHC is characterized by the increased absorption of iron in the small intestine, leading to the toxic deposition of iron in the liver, heart and other organs. HFE, which is expressed in intestinal crypt cells in association with the transferrin receptor (Fig. 4),40 is not directly involved in iron absorption — a function of villus cells. Instead, as in animal models of the disease,41 the expression level of DMT1 is elevated in the disease compared to controls.17,32 Work in our laboratory revealed that the intestinal DMT1 IRE splice form is not appropriately downregulated with increasing serum iron levels in HHC, whereas its expression is subject to iron-dependent regulation in control subjects.17 The precise link between the HFE defect and DMT1 regulation however is not yet clearly understood.

References 1. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a proton-coupled mammalian metal-ion transporter. Nature 1997; 388:482-488. 2. Fleming MD, Trenor CC, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16:383-386. 3. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25:514-525. 4. Supek F, Supekova L, Nelson H et al. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93:5105-5110. 5. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73:469-485. 6. Kishi F, Tabuchi M. Human natural resistance-associated macrophage protein 2: Gene cloning and protein identification. Biochem Biophys Res Commun 1998; 251:775-783. 7. Cellier M, Privé G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92:10089-10093. 8. Lam-Yuk-Tseung S, Govoni G, Gros P. Iron transport by NRAMP2/DMT1: pH regulation of transport by two histidines in transmembrane domain 6. Blood 2003; 101(9):3699-707. 9. Tandy S, Williams M, Leggett A et al. Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco2 cells. J Biol Chem 2000; 275:1023-1029. 10. Bannon DI, Abounader R, Lees PS et al. Effect of DMT1 knockdown on iron, cadmium, and lead uptake in Caco2 cells. Am J Physiol Cell Physiol 2003; 284:C44-C50. 11. Mackenzie B, Ujwal ML, Chang M-H et al. Resolving the mechanisms of the iron transporter DCT1 from its kinetic properties and the impact of mutating two critical histidyl residues within transmembrane regions. FASEB J 2003; 17:A911 (Abstract). 12. Chen X-Z, Peng J-B, Cohen A et al. Yeast SMF1 mediates H+-coupled iron uptake with concomitant uncoupled cation currents. J Biol Chem 1999; 274:35089-35094.

80

The Nramp Family

13. Sacher A, Cohen A, Nelson N. Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J Exp Biol 2001; 204:1053-1061. 14. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95:1148-1153. 15. Su MA, Trenor CC, Fleming JC et al. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 1998; 92:2157-2163. 16. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93:4406-4417. 17. Rolfs A, Bonkovsky HL, Kohlroser JG et al. Intestinal expression of genes involved in iron absorption in humans. Am J Physiol Gastrointest Liver Physiol 2002; 282:G598-G607. 18. McEwan GTA, Daniel H, Fett C et al. The effect of Escherichia coli STa enterotoxin and other secretagogues on mucosal surface pH of rat small intestine in vivo. Proc R Soc Lond B 1988; 234:219-237. 19. Canonne-Hergaux F, Fleming MD, Levy JE et al. The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000; 96:3964-3970. 20. Andrews NC. Animal models of iron transport and storage disorders. In: Templeton DM, ed. Molecular and Cellular Iron Transport. New York: Marcel-Dekker, 2002:679-697. 21. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189:831-841. 22. Canonne-Hergaux F, Zhang AS, Ponka P et al. Characterization of the iron transporter DMT1 (NRAMP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood 2001; 98:3823-3830. 23. Garrick LM, Dolan KG, Romano MA et al. Nontransferrin-bound iron uptake in Belgrade and normal rat erythroid cells. J Cell Physiol 1999; 178:349-358. 24. Tabuchi M, Yoshimori T, Yamaguchi K et al. Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 2000; 275:22220-22228. 25. Nelson N, Harvey WR. Vacuolar and plasma membrane proton-adenosinetriphosphatases. Physiol Rev 1999; 79:361-385. 26. Jabado N, Canonne-Hergaux F, Gruenheid S et al. Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes in macrophages and Sertoli cells. Blood 2002; 100:2617-2622. 27. Picard V, Govoni G, Jabado N et al. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem 2000; 275:35738-35745. 28. Canonne-Hergaux F, Gros P. Expression of the iron transporter DMT1 in kidney from normal and anemic mk mice. Kidney Int 2002; 62:147-156. 29. Casey JL, Hentze MW, Koeller DM et al. Iron-responsive elements: Regulatory RNA sequences that control mRNA levels and translation. Science 1988; 240:924-928. 30. Hentze MW, Kühn LC. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl Acad Sci USA 1996; 93:8175-8182. 31. Lee PL, Gelbart T, West C et al. The human Nramp2 gene: Characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998; 24:199-215. 32. Zoller H, Koch RO, Theurl I et al. Expression of the duodenal iron transporters divalent-metal transporter 1 and ferroportin 1 in iron deficiency and iron overload. Gastroenterology 2001; 120:1412-1419. 33. Hubert N, Hentze MW. Previously uncharacterized isoforms of divalent metal transporter (DMT)-1: Implications for regulation and cellular function. Proc Natl Acad Sci USA 2002; 99:12345-12350. 34. Tabuchi M, Tanaka N, Nishida-Kitayama J et al. Alternative splicing regulates the subcellular localization of divalent metal transporter 1 isoforms. Mol Biol Cell 2002; 13:4371-4387. 35. Buchanan GR, Sheehan RG. Malabsorption and defective utilization of iron in three siblings. J Pediatr 1981; 98:723-728. 36. Hartman KR, Barker JA. Microcytic anemia with iron malabsorption: An inherited disorder of iron metabolism. Am J Hematol 1996; 51:269-275. 37. Feder JN, Gnirke A, Thomas W et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996; 13:399-408.

Molecular Physiology of the H+-Coupled Iron Transporter DMT1

81

38. Pietrangelo A. Physiology of iron transport and the hemochromatosis gene. Am J Physiol Gastrointest Liver Physiol 2002; 282:G403-G414. 39. Harrison SA, Bacon BR. Hereditary hemochromatosis: Update for 2003. J Hepatol 2003; 38(Suppl 1):S14-S23. 40. Waheed A, Parkkila S, Saarnio J et al. Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum. Proc Natl Acad Sci USA 1999; 96:1579-1584. 41. Fleming RE, Migas MC, Zhou X et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: Increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 1999; 96:3143-3148.

82

The Nramp Family

CHAPTER 8

Cellular and Tissue Expression of Rat DMT1 / Nramp 2 Evan H. Morgan

Abstract

E

vidence that rat DMT1 functions as a membrane transporter of iron was established by expression cloning in Xenopus laevis oocytes and by investigations in the Belgrade rat in which iron metabolism is impaired due to a missence mutation of the protein. DMT1 can transport several divalent metal ions as well as iron. It is expressed in most types of cells and is particularly important for iron absorption in the proximal part of the small intestine and for iron uptake by erythropoietic cells for hemoglobin synthesis. As a consequence, homozygous Belgrade rats have greatly impaired iron absorption from the intestine and severe microcytic hypochromic anemia. In the proximal small intestine DMT1 is expressed in the cytoplasm and brush border membrane of villus enterocytes, localization to the membrane increasing in iron deficiency in keeping with augmentation of iron absorption. Duodenal expression of both mRNA and protein are reduced in iron overload, as is iron absorption, and increased in iron deficiency. In developing erythroid cells DMT1 is required for transport of iron out of endosomes, where it is released from transferrin, to the mitochondria for use in heme synthesis. Expression of DMT1 has also been investigated in the rat liver, brain, kidney and placenta. In none of these organs with exception of the placenta is there any evidence that expression increases in iron deficiency. Indeed, in the liver, where it was found on the sinusoidal membrane of hepatocytes, expression increased in iron overload and decreased in iron deficiency. On the basis of investigations on these organs it appears likely that DMT1 functions in iron uptake by hepatocytes, iron transport across the blood brain barrier and its utilisation by neurons and glial cells, iron reasorption from renal tubular fluid and iron transport to the fetus.

Introduction

DMT1 (Nramp 2) was initially cloned from human1 and murine2 sources and was shown to be expressed in many tissues including intestine, kidney, liver, brain, spleen, lung, heart and muscle. Its function as a transporter of ferrous iron, Fe(II), and other divalent metals was clearly demonstrated by expression cloning of rat DMT1 in Xenopus laevis oocytes.3 These studies illustrated several of the properties of the transposter. Fe(II) transport was shown to be dependent on membrane potential and to be coupled with protein transport, probably in a molar ratio of 1 Fe2+: 1H+. Thus, Fe (II) transport into oocytes expressing DMT1 was greater at pH 5.5 than at pH7.5. Several metals in addition to iron (Zn, Cd, Mn, Cu, Co, Ni and Pb) could also be transported. The name divalent-cation transporter 1 (DCT1) was proposed. Subsequently the term divalent metal transporter 1 (DMT1) has come to be more widely used. Two alternatively sliced variants of DMT1 are recognized.4,5 The mRNA of one isoform carries

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

83

a putative iron responsive element (IRE) in the 3' untranslated region, while the other lacks it.5 These forms of DMT1 will be referred to as IRE+ and IRE- forms. More recently two further isoforms of DMT1 have been described due to the presence or absence of an upstream 5' exon of the gene.6 It’s presence results in a 30 amino acid extension of rat DMT1 and confers a means of regulation by iron levels in addition to that resulting from the IRE. The isoforms (IRE+ and IRE-) with the 5' extension were found to be expressed only in the duodenum and kidney while the isoforms without the extension were detected in all tissues examined. Further strong evidence for the function of DMT1 as an iron transporter was provided by the observations of a common missence mutation of DMT1 (G185R) in microcytic anemia mice (mk)7 and Belgrade rats (b).4 The anemia is inherited as an autosomal recessive trait. In homozygous microcytic anemia mice (mk/mk) and Belgrade rats (b/b) there is a defect in intestinal absorption of non-heme iron 8-10 and uptake of transferrin – bound iron by developing red blood cells.11-14 In the intestine the defect is due to impaired uptake of iron from the lumen by duodenal enterocytes8,10 and in erythroid cells to impaired transport across the endosomal membrane for utilisation in heme synthesis by the mitochondria after release from transferrin within the endosomes.15,16 Defective iron uptake from transferrin has also been demonstrated in brain, liver, placenta, bone marrow and fibroblasts of b/b rats.9 On the basis of these studies it may be concluded that DMT1 functions as a carrier for iron in the brush border membrane of intestinal absorptive cells and in the membranes of recycling endosomes in many different tissues. Subsequent investigations have supported this with regard to intestinal absorption but are less conclusive with endosomes. Nearly all cells of the body are bathed in extracellular fluid which contains the plasma iron-transport protein transferrin. Like other plasma proteins transferrin can pass through capillary walls everywhere in the body except in the brain where the walls are highly impermeable to proteins and constitute part of the “blood-brain barrier” (BBB). However, transferrin can be synthesized in the brain and is present in brain interstitial fluid.17 Transferrin has a very high affinity for iron and is usually only 30-40% saturated with the metal. Hence, under normal circumstances there is virtually no protein-free iron in blood plasma or other extracellular fluid18. Only when the degree of iron saturation of transferrin is high as in conditions with iron overload does non-protein-bound iron exist in the general extracellular fluid. Free iron may exist momentarily after passage out of intestinal enterocytes following its absorption19 but it is then rapidly bound by plasma transferrin. As a consequence nearly all types of cells acquire the iron needed for cellular processes from transferrin. This occurs by receptor-mediated endocytosis of the iron-transferrin complex followed by acidification of the endosome, release of iron from transferrin and its reduction to Fe(II), transport of the metal through the endosomal membrane and recycling of the iron-free transferrin (apotransferrin) to the extracellular fluid.18 The acidic environment within endosomes, as well as facilitating iron release from transferrin, provides the conditions necessary for efficient iron transport across the endosomal membrane by DMT1. The widespread distribution of this process across most types of cells probably explains why DMT1 is expressed in most, if not all, tissues. Few types of cells in the animal body are normally exposed to extracellular iron which is not bound to transferrin or other proteins. One is the mucosal cells of the gastrointestinal tract, a major site of DMT1 expression. Others are renal tubule cells, exposed to iron in tubular fluid, and hepatocytes under conditions of very rapid intestinal iron absorption or of iron overload when absorbed iron may not have bound to portal blood transferrin by the time it reaches the hepatic sinusoids. This review will summarise research on the expression (function, mRNA, protein) of DMT1. It will be concerned primarily with investigations in the rat but will utilise information from other species when required to make the overall picture comprehensible. Emphasis will be placed on those organs for which most information is available (gastrointestinal tract, erythropoietic tissue) but other organs (liver, brain, kidney, placenta) will also be considered.

84

The Nramp Family

Figure 1. Iron absorption by b/b and +/b rats fed a control diet and by Wistar (+/+) rats fed a control or low iron (depl) diet. Absorption was measured by whole body counting daily for 10 days after administration of a 60 µg dose of radiolabeled Fe(III) by gastric gavage.9 Each value is the mean +SEM of 4 rats.

Gastrointestinal Tract Function The role of DMT1 in iron absorption was clearly demonstrated in the Belgrade rat. Absorption was studied in homozygous (b/b), heterozygous (+/b) and Wistar (+/+) rats by whole body counting for 10 days after administration of a dose of 59Fe-labelled Fe(III) by gastric gavage 9,10 and by use of radiolabeled Fe(II) and Fe(III) in closed in situ duodenal loops.10 The absorption was grossly impaired in b/b rats and did not increase when animals were fed a low iron diet prior to testing whereas it did increase in +/+ rats (Fig. 1).9 The defect in the b/b rats was shown to lie in the uptake phase of absorption by which iron is taken up from the lumen by enterocytes of the intestinal villi, implicating DMT1 in this step.10 Feeding a low iron diet led to a marked increase in iron uptake by the mucosa and iron absorption in +/b and +/+ rats and, compared with these animal, the values for b/b rats were less than 10% of those for the other types of rats. This indicates that nearly all non-heme iron absorption by the duodenum occurs via DMT1 and that the mutation present in b/b rats deprives the protein of most if not all of its transport function. No difference was found between the absorption of Fe(II) and Fe(III),10 probably because Fe(III) is reduced to Fe(II) by a membrane ferrireductase, Dcytb.20

mRNA and Protein Both the IRE+ and IRE- isoforms of DMT1 mRNA are expressed in the rat intestine with the IRE+ form being dominant,21 as in the mouse. 22,23 Expression is greatest in the duodenum and proximal part of the jejunum, with much lower levels in the stomach, distal small intestine and colon. 3 The proximal – distal changes along the intestine are more marked for the IRE+ form than the IRE- form and expression of the IRE+ form increases greatly in the proximal small intestine of rats fed a low iron diet. 3,21 It also increases in mucosal cells of the duodenum as they migrate from the crypts of Lieberkühn to the villus 24,25 DMT1 mRNA has not been detected in the cells of the deeper part of the crypts, but appears abruptly at the crypt-villus junction. The level of expression then increases up the villus to maximal levels in the mid-villus region, decreasing towards the tips of the villi. It varies inversely with iron status, greatest in iron deficient rats and least in iron loaded ones.24,25

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

85

Figure 2. Immunochemical staining of DMT1 protein using a polyclonal antibody in duodenal villus enterocytes of a Wistar rat fed an iron deficient diet (A) and a b/b rat fed a control diet (B). Note the localisation of the protein to the brush border membrane in both types of rats, higher in concentration in the Wistar, and the presence of some staining in the supranuclear region of the cells of the b/b rat. For methods see reference 24.

Expression of DMT1 protein in the intestine corresponds well with that of its mRNA.24,26 It was detected by immunohistochemistry in villus enterocytes of duodenum and, with a lower level of staining intensity, in the colon. No protein was observed in the crypts, detectable protein expression commencing at the crypt-villus junction and increasing to reach highest levels in the upper part of the villi. Goblet cells of the mucosa and macrophages of the lamina propria did not stain for the protein. The intensity of staining increased in iron deficiency and diminished with iron loading. The intracellular distribution of the protein in enterocytes also varied with iron status. In control rats DMT1 was present mainly intracellularly, with an even distribution throughout the cytoplasm. There was only a low level of margination to the brush border membrane of the cells. In iron deficiency, however, most of the DMT1 was located on this membrane (Fig. 2). No DMT1 was detected in enterocytes of iron loaded rats and none was observed on the basolateral membrane in any animals. The effects of iron status on DMT1 expression in duodenal villi is probably due at least in part to the post-translational regulation of the IRE+ isoforms of its mRNA. In mice it has been shown that only this form of the protein is upregulated by iron deficiency.23,27 In addition, expression of the isoform containing the 5' extension which is regulated by iron independently of the IRE probably contributes to the high level of DMT1 found in the duodenum in iron deficient conditions. It may also be responsible for localization to the brush border membrane.6 The concentration of iron in villus enterocytes of b/b rats fed a normal diet is low, similar to that of Wistar rats on an iron deficient diet,25 presumably due to impaired function of DMT1. Corresponding to this, expression of DMT1 mRNA and protein are elevated when compared with Wistar or +/b rats fed a normal diet.25,28 Indeed, the duodenal mRNA level as assessed by in situ hybridization was found to be higher in b/b rats fed a normal diet than in iron deficient Wistar rats.25 By contrast, expression of the protein was lower in the b/b rats (Fig. 2). The change in expression along the crypt—villus axis was the same as described above for Wistar rats. In villus enterocytes much of the DMT1 was localized to the brush border membrane but there was some in the cytoplasm, mainly in the supranuclear region (Fig.2B). The level of

86

The Nramp Family

DMT1 protein expression was lower in b/b rats than expected from the mRNA level when compared with Wistar rats. Possibly these results are due to impaired release from the site of synthesis or accelerated catabolism of the protein. The staining observed in the supranuclear region of the cells could reflect either of these possibilities. A lower level of surface membrane expression was observed in human embryonic kidney cells transfected with the G185R mutation than with wild type DMT1, an effect believed to be due to lower stability of the mutant protein.29 The localization of DMT1 in duodenal enterocytes of b/b rats differs from that reported for mk/mk mice.22 In the latter very little DMT1 was observed on the brush border membrane even though the concentration in the cytoplasm was high. It was concluded that targeting of the protein to this membrane was impaired in these mice. The effect of iron status on the intracellular distribution of DMT1 in duodenal enterocytes raises the question whether the protein can exchange between intracellular sites and the brush border membrane. This was investigated in rats which had been fed an iron deficient diet for 14 days. The rats were then given a 25 µmol dose of iron by gastric gavage followed 1, 3 and 7 hours later by measurement of iron absorption, mRNA levels and DMT1 distribution in duodenal enterocytes.30 Iron absorption and mRNA levels fell rapidly to reach levels by 7 hours which were approximately 25% of those present at zero time. The decrease in absorption was due entirely to a fall in the uptake step of the absorptive process. No change in the step of iron transfer from the mucosa to the blood was observed. The intensity of staining of DMT1 on the brush border membrane also decreased so that by 7 hours it was lower than in rats fed a control diet. There was no increase in staining intensity in the cytoplasm; that is, no evidence of redistribution of DMT1 from the brush border to the cytoplasm was obtained. It was concluded that DMT1 is turned over rapidly and that the level of protein in the cell is dependent on its rate of synthesis, which is proportional to the level of mRNA. These results are compatible with another investigation which showed a rapid decline in iron absorption and the levels of iron responsive proteins (IRP) 1 and 2 in the duodenal mucosa of iron deficient rats after gavage feeding 20 or 60 µmol iron.31 The results also demonstrate that DMT1 expression in villus enterocytes is affected very quickly by the amount of iron taken up from the lumen, a negative feed-back effect which would help to regulate the amount of iron absorbed from the diet. However, different observations were made using b/b and +/b rats.28 The animals used in this investigation were raised on a diet of normal iron content. After feeding a bolus of food containing iron (90 µmol/100g body weight) there was a decline in duodenal mucosal DMT1 mRNA and IRP levels over the next 6 hours, but DMT1 protein increased for 1.5 to 3 hours before returning to the initial levels. Also, by immunofluorescence, some of the DMT1 was shown to relocate from the brush border membrane to intracellular vesicles in the apical cytoplasm of the cells. The reasons for the different results obtained in the two studies concerned with the intracellular distribution of DMT1 after iron feeding is uncertain but differences in the strains of animal used, prior levels of dietary iron, dose and form of iron administered and method used to observe intracellular distribution of DMT1 must be considered. Further work is required to resolve the problem.

Liver Function

Homozygous Belgrade rats have low levels of stainable iron32 and chemically determined non-heme iron in the liver, associated with a much higher plasma iron concentration than in +/ b or Wistar rats (Fig. 3). This suggests that iron uptake from plasma transferrin by liver cells is impaired, as was found following intravenous injection of radiolabeled transferrin-bound iron (Table 1).9 The elevated plasma iron concentration despite poor iron absorption from the intestine indicates impaired iron uptake by many tissues as well as the liver, particularly erythropoietic tissue which is the main site of iron utilisation in the body (see below).

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

87

Figure 3. Plasma iron and tissue non-heme iron concentrations in b/b and +/b rats. Each value is the mean + SEM of 12 rats. In all cases the difference between the values for b/b and +/b rats were statistically significant (P<0.05).

mRNA and Protein The expression of DMT1 mRNA and protein in the liver was studied in control, iron deficient and iron loaded rats.24 In control animals the mRNA detected by in situ hybridisation was present at relatively low concentration in hepatocytes. No changes were observed with variation in iron status even though the non-heme iron concentration varied greatly, from 0.7 to 5.4 and 120 µmol/g in iron deficient, control and iron loaded animals, respectively. In control animals DMT1 protein staining was observed along the lining membrane of the sinusoids and, by isolation of the cells, was shown to be on the membrane of hepatocytes. No

Table 1. Iron absorption from the intestine and iron uptake by the fetuses and other organs from plasma transferrin in b/b and +/b rats Iron uptake (% dose) Organ

b/b

+/b

Intestinal absorption Fetuses Liver Brain Kidneys Femurs

2.2 ± 0.1 24 ± 1.6 7.2 ± 0.18 0.0165 ± 0.0012 0.34 ± 0.01 1.54 ± 0.02

19 ± 1.0 62 ± 1.8 11.1 ± 0.65 0.0474 ± 0.007 0.43 ± 0.005 4.18 ± 0.61

The results are the % of dose of 59Fe injected into the stomach by gavage tube as FeCl3 (absorption) or intravenously as transferrin-bound iron which was retained in the whole body after 10 days (absorption) or in the fetuses and organs 2h after injection. Fetal uptake was measured on the 21st day of pregnancy. The other values are from non-pregnant animals. Each value is the mean ±SEM of 4-6 animals. In all cases there was a significant difference between the values for b/b and +/b rats. Data from reference 9.

88

The Nramp Family

staining of Kupffer cells was observed. No DMT1 was detected in livers from iron deficient rats while in iron loaded ones the level of iron staining was greater than in controls but with similar distribution in the cells. These results show that the effects of iron status on DMT1 expression in the liver are different from that in the duodenum. Possibly the IRE- isoform of DMT1 is the major one expressed in the liver. Also, the 5' regulatory region of DMT1 mRNA contains 5 potential iron regulatory elements5 which may provide a mechanism for increased expression with iron loading of the liver. Further work, with quantitative measurements of both isoforms of the mRNA and protein, is required to answer these questions. Whatever the mechanism, increased expression of DMT1 in the liver in association with iron overload may explain why the liver is the major site of iron deposition under these conditions. High iron stores are usually accompanied by a high degree of saturation of plasma transferrin with iron. As a result some of the iron absorbed from the intestine may not bind to portal blood transferrin. This protein-free iron would be cleared from the plasma as it circulates through the liver by the activity of DMT1 on hepatocyte microvillus membranes. By contrast, in iron deficiency down regulation of DMT1 in the liver and a low degree of saturation of plasma transferrin with iron means that absorbed iron can bind to transferrin and, little being cleared by the liver, can pass to tissues with high iron requirements and levels of expression of transferrin receptors such as erythropoietic tissue.

Erythroid Tissue Function As noted above, b/b rats and mk/mk mice have severe microcytic anemia due to impaired uptake of iron by developing erythroid cells. The mechanisms of iron transport across the membranes of immature erythroid cells has been studied in some detail by using rat and rabbit reticulocytes and non-transferrin-bound iron.33-39 The mechanisms of uptake were the same with cells from both species. Two distinct processes were identified.37 One is a high affinity process with a Km value for Fe(II) of 0.1-0.2 mmol/L and the other with a much lower affinity for Fe(II), approximately 20 mmol /L.33,37-39 High affinity Fe(II) transport is impaired in b/b rats to the same degree as is iron uptake from transferrin (Fig. 4), indicating that it is mediated by DMT1.40 Low affinity transport is not impaired in these animals.37, 38 Investigation of the mechanism of high affinity Fe(II) transport in reticulocytes has elucidated many properties of DMT1-mediated transport of iron. The rate of transport was found to be maximal at pH 6.5 33 and to be influenced by membrane potential.36 This is in keeping with evidence obtained in Xenopus levis oocytes injected with DMT1 of proton-coupled transport of Fe(II).3 Other features of the transport process in reticulocytes are that it is inhibited by metabolic inhibitors,34 disappears as the cells mature into erythrocytes35 and that it can transport several other divalent cations as well as Fe (II).38 The connection between cell metabolism and Fe (II) transport may be due to a requirement to maintain membrane potential and/or the activity of the endosomal ATP-dependent proton pump. If the latter suggestion is correct it indicates a closer link between protons derived from the pump and Fe (II) transport than with protons in the bulk medium, as has also been suggested for iron absorption into renal tubule cells (see below). In DMT1-injected oocytes iron transport was found to be active at pH 5.5, lower than the optimal pH of reticulocytes. Possibly lowering the extracellular pH of reticulocytes below 6.5 has deleterious effects on the cells which indirectly affect the transport process. When reticulocytes mature in vivo or in vitro the rate of high affinity Fe(II) transport declines at the same rate as the number of transferrin receptors, as determined by the uptake of diferric transferrin (Fig. 5).35 This suggests that DMT1 and transferrin receptor are closely associated in the membranes of reticulocytes and are lost simultaneously as the cells mature. This may occur by exocytosis of multivesicular bodies, leading to the loss of membrane-bound vesicles or “exosomes” 41,42 which contain both DMT1 and the receptor. Several divalent metals as well as Fe (II) (Mn, Co, Zn, Cd, Ni) can be transported into reticulocytes by the high affinity mecha-

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

89

Figure 4. Rate of iron uptake of transferrin-bound iron (Tf-Fe) and of Fe(II)by the high affinity mechanism by reticulocytes from +/b and b/b rats. Each value is the mean + SEM of 6 measurements.

nism (Fig.6) and can act as competitive inhibitors of Fe (II) transport.38 The transport of all these metals is much lower in b/b than +/b reticulocytes.38 These observation are in agreement with results obtained using DMT1-injected oocytes3 and a protein extracted from the brush border membrane of rabbit proximal small intestine.43 They provide at least one explanation

Figure 5. Changes in the maximum rate of Fe(II) uptake by the high affinity mechanism (Vmax) and the maximum amount of receptor-mediated uptake of transferrin (Bmax) by reticulocytes during incubation in vitro for up to 50 hours.35 The Fe(II) Vmax is a measure of DMT1 activity and the transferrin Bmax a measure of the number of transferrin receptors.

90

The Nramp Family

Figure 6. Michaelis-Menten constants (Km) and maximum rate of uptake of divalent metals by the high affinity Fe(II) transport mechanism (Vmax) in rabbit reticulocytes.38 Each value is the mean + SEM of 4 measurements. *Significant difference from the values for Fe.

for the large number of reports in the literature of interactions between the metabolism of iron and other divalent metals. Of particular interest is the very high affinity of the transport mechanism in reticulocytes for Cd which explains why Cd poisoning produces severe iron deficiency and anemia which can be prevented by feeding an iron-loaded diet.44 The rate of iron uptake by b/b reticulocytes is approximately 30% of that by normal cells (Fig. 4). Thus, some iron transport into developing erythroid cells persists in the presence of the G185R mutation and is probably the reason why the animals can survive. This is surprising since this mutation was found to cause almost complete loss of iron transport function in transfected human embryonic kidney cells even though the mutant protein localized to transferrin-containing endosomes.29 Hence, it is possible that another iron transporter as well as DMT1 is present in endosomes. Similar observations and conclusions were made in relation to iron transport into reticulocytes from mk/mk mice45 and by cells of the crypts of Lieberkühn in rats.25 The studies with cells from b/b rats also help to identify the site of DMT1 localization in reticulocytes. It was shown that iron released from transferrin within endosomes was not transported into the cytosol but remained in organelles which could be accessed by transferrin taken up from the incubation medium.15 This localizes the defect in b/b reticulocytes and, therefore, DMT1 to the membrane of endosomes which also contains transferrin receptors.

mRNA and Protein In contrast to the number of functional studies there have been few investigations of DMT1 mRNA and protein expression in erythroid cells. DMT1 protein is strongly expressed in rat bone marrow erythropoietic cells.26 More detailed studies with splenic tissue and blood cells from mk/mk, +/mk and wild-type mice showed that the IRE- isoform of DMT1 was the major one expressed in erythroid cells, that it partially colocalizes with the transferrin receptor in an endosomal compartment and that very little DMT1 protein could be detected in mk/mk reticulocytes.45 The latter observation suggested that the G185R mutation affects the stability and/ or normal targeting of the protein within the cell, as was also concluded with respect to duodenal cells of mk/mk mice.22 No information has been published on the regulation of DMT1 expression in rat erythroid cells. However, in human bone marrow stem cells and in erythroid

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

91

cell lines DMT1 mRNA levels were found to be unchanged or diminished on exposure to erythropoietin or induction of hemoglobinization with dimethyl sulphoxide.46,47

Brain Function Most cells of the body acquire the iron required for metabolic processes from plasma transferrin. This depends on direct interaction between the transferrin which has passed into the interstitial space and cell membrane receptors. In the brain the presence of the BBB prevents this from happening. However, brain capillary endothelial cells express transferrin receptors on their luminal membrane. According to the two hypothesis for iron transport into the brain these receptors mediate either transcytosis of the transferrin-iron complex across the endothelial cells into brain interstitial fluid or iron release from transferrin within the endothelial cells, with transport of the iron into the brain and recycling of apotransferrin to the blood.17 Current evidence, derived from the relative rates of transfer of iron and transferrin into the brain, favour the latter mechanism but do not rule out the possibility of some transcytosis of transferrin-iron.17 It is also supported by studies in Belgrade rats.9,48 The concentration of non-heme iron (Fig. 3) and stainable iron 48 in the brain of b/b rats are lower than in +/b ones, and the transfer of iron from blood to brain is also impaired (Table 1).9 Impaired iron transport into the brain, especially in the presence of a high concentration of plasma transferrin – bound iron (Fig. 3), would not be expected if iron was transported into the brain by transcytosis of transferrin-iron.

mRNA and Protein In the original study by Gunshin et al the rat brain was shown to contain a high level of DMT1 and mRNA, mainy localised to neurons and choroid plexus epithelial cells.3 It was not detected in glial cells or ependymal cells. The level of expression varied considerably between neurons in different parts of the brain. A subsequent study confirmed the presence of the mRNA in neurons and reported its presence in cultured rat astrocytes.49 Both the IRE+ and IRE- isoforms of DMT1 are expressed in the brain.21,23 Whether mRNA expression changes with iron status is unknown. The reported distribution of DMT1 protein in rat brain differs somewhat from that of the mRNA. The protein was detected in neurons (again with varying intensity of staining in cells from different areas), astrocytes (mainly in the end-feet adjacent to capillaries), vascular cells and ependymal cells of the third ventride.50 Evidence for co-localization of DMT1 with transferrin receptors in microvessels isolated from the brain was presented. Homozygous Belgrade and +/b rats fed low or high iron diets for 2 weeks were included in this study. No consistent differences in the level or distribution of DMT1 were observed in these animals compared with normal ones. The antibody used in this investigation recognises both the IRE+ and IRE- forms of the protein. Hence, the failure to detect a change in DMT1 expression as a consequence of manipulation of dietary iron levels may be due to the fact that the IRE- form predominates in the brain, as suggested by the authors. However, dietary manipulation for only 2 weeks is unlikely to produce physiologically significant changes in brain iron levels due to the very low rate of iron transport across the BBB in adult rats and the very limited capacity of the brain to eliminate iron.17 Thus the dietary studies probably provide no information on the effects of brain iron levels on DMT1 expression. The observations with b/b rats may be of more significance in this respect since brain iron levels are low in these animals. Hence, it is likely that DMT1 expression in the brain is not responsive to iron level. The two IRE isoforms of DMT1 protein were detected in cultured rat sympathetic ganglion neurons but with different distributions within the cells.51 The IRE+ form was present in the cell body and on the cell membrane, with no staining of the nuclei. By contrast, the IREform was observed within the nucleus and on the cell membranes, with only weak staining of the cell body. There was only partial co-localisation of the transferrin receptor and IRE+ form, and virtually no co-localisation with the IRE- form. These results, and similar ones in rat PC12

92

The Nramp Family

cells, a neuronal-like cell line, led to the conclusion that the two forms of DMT1 may have different functions in neuronal cells

Kidney Function Little is known about renal iron metabolism. However, it is likely that renal cells can acquire iron from two sources, plasma transferrin and tubular fluid. The first of these sources probably provides the iron required for cellular proliferation and growth and replacement of catabolized iron-containing proteins. The lower iron concentration in the kidney of b/b than of +/b rats (Fig. 3) indicates that DMT1 is involved in renal iron metabolism. Presumably iron is taken up by receptor-mediated endocytosis of transferrin as in other organs and requires the function of endosomal DMT1. Absorption of iron from renal tubular fluid would help to conserve the iron content of the body by reducing loss in the urine. In microperfused rat renal tubules injected with 59FeCl3 absorption was found to occur in the loop of Henle and collecting ducts.52 Little or no absorption occurred in the proximal tubules. Whether or not this experimental model is a valid physiological one is uncertain. Under normal circumstances, due to the extremely high affinity of transferrin for iron, it is unlikely that any protein-free iron enters the glomerular filtrate. However, plasma proteins including transferrin are filtered at low rates and are reabsorbed in the proximal convoluted tubule and catabolized in lysosomes. 53 Transferrin-bound iron could enter the cells by this route. Alternatively, if tubular pH is sufficiently low iron could be released from transferrin in the tubular lumen and then absorbed in the loop of Henle and collecting ducts, as was found with Fe Cl3. Hence it is likely that iron reabsorption from renal tubular fluid can occur in proximal convoluted tubules in protein-bound form and further along the nephron in protein-free form. DMT1 could be involved in the reabsorptive process at both sites.

mRNA and Protein

DMT1 mRNA of both isoforms is highly expressed in the kidney.3,6,21,23,54 In Northern blots the mRNA was found at similar levels in renal cortex, outer medulla and inner medulla.3,54 By in situ hybridisation the mRNA was shown to occur in the proximal convoluted tubules and collecting ducts.3 DMT1 protein was observed in highest concentration in the cortex and outer part of the medulla of the rat kidney, with only low levels in the inner medulla.54 Protein staining was high in proximal and distal convoluted tubules, thick ascending limb of the loop of Henle and collecting ducts. It was not detected in the glomeruli, thin ascending limb of the loop of Henle or in blood vessels. In the proximal tubules immunoreactivity was present intracellularly and did not localise to the brush border membrane or co-localise with H+ ATPase on that membrane. In the thick ascending limb, distal tubules and collecting ducts it was detected both in the cytoplasm and brush border membrane where it did co-localise with H+ ATPase. The results were considered to be consistent with the observations that iron reabsorption occurs in the loop of Henle and collecting ducts. It was suggested that activity of the H+ ATPase on the brush border membrane may provide an acidic microenvironment which aids Fe(II) transport by DMT1. DMT1 in the cytosol could be involved in iron uptake from transferrin. In the proximal convoluted tubules it may also function in the intracellular transport of iron released during the catabolism of proteins taken up from the tubular lumen. No DMT1 was detected in the basolateral membranes of any renal cells, so it is unlikely to play a role in the exit of iron from the cells.

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

93

Placenta Function Iron transfer from maternal to fetal blood occurs via the chorioallantoic placenta in those species of animals with a hemochorial type of placenta, e.g.,: rats, humans.18 It involves receptor-mediated uptake of transferrin-iron from maternal blood by trophoblast cells, release of iron from the transferrin in endosomes, transport of the iron into fetal blood and recycling of the apotransferrin to maternal blood. The transfer process is unidirectional, from maternal to fetal blood. Placental trophoblast cells are highly endowed with transferrin receptors, enabling the uptake and transfer of large amounts of transferrin-bound iron. The rate of transfer of iron keeps pace with fetal growth, rising to maximal values near term. In the rat this is extremely high and accounts for approximately 60% of the plasma iron turnover (Table 1).55 On the basis of information obtained from other types of cells it would appear likely that the iron released from transferrin in endosomes of trophoblast cells is transported into the cytosol by DMT1. This is yet to be proven. However, there is good evidence that DMT1 is involved in at some stage of the transfer process since placental transfer of iron is low in b/b rats (Table 1)9 and both b/b rats and mk/mk mice are iron deficient at birth.

mRNA and Protein Expression of DMT1 mRNA and protein in near-term rat placentas has been examined by Northern and Western blots.56 both were detected and found to increase when the pregnant rats were fed an iron deficient diet. Transferrin receptor expression also increased. The increase in DMT1 as a result of iron depletion was accounted for entirely by increased expression of the IRE+ form of the mRNA. The intracellular localisation of DMT1 in the rat placenta has not been reported. However, in the human placenta it was detected immunohistochemically in the cytoplasm and at the junction of basal membrane of trophoblast cells and fetal capillaries.57 It did not co-localise with transferrin receptors which were found mainly on the maternal side of the cells. Hence, DMT1 may function at a site between transferrin-containing endosomes and where iron is transported out of the trophoblast cells. It is possible that DMT1 is located in transport endosomes (late endosomes), rather than in the early endosomes which are involved in transferrin endocytosis and recycling, and that iron is transported across the cytoplasm of trophoblast cells by a vesicular mechanism. The localization of DMT1 in late endosomes which do not contain transferrin receptors has been reported for Hep-2 and CaCo-2 cells in culture.58,59 However this is not the case with all types of cells as noted above for reticulocytes.

References 1. Vidal S, Belouchi AM, Cellier M et al. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 1995; 6:224-230. 2. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25:514-52. 3. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-48. 4. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence for a role for Nramp2 in endosmal iron transport. Proc Nat Acad Sci USA 1998; 95:1148-1153. 5. Lee PL, Gelbart T, West C et al. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cell Mol Dis 1998; 24:199-215. 6. Hubert N, Hentze M W. Previously uncharacterized isoforms of divalent metal transporter (DMT)-1: Implications for regulation and cellular function. Proc Nat Acad Sci USA 2002; 99:12345-12350. 7. Fleming MD, Trenor CC, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nature Genet 1997; 16:383-386.

94

The Nramp Family

8. Edwards JA, Hoke JE. Defect of intestinal mucosal iron uptake in mice with hereditary microcytic anemia. Proc Soc Exp Biol Med 1972; 141:81-84. 9. Farcich EA, Morgan EH. Diminished iron acquisition by cells and tissues of Belgrade laboratory rats. Am J Physiol 1992; 262:R220-R224. 10. Oates PS, Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol 1996; 270:G826-G832. 11. Edwards JA, Hoke JE. Red cell iron uptake in hereditary microcytic anemia. Blood 1975; 46:381-388. 12. Edwards JA, Garrick LM, Hoke JE. Defective iron uptake and globin synthesis by erythroid cells in the anemia of the Belgrade rat. Blood 1978; 51:347-357. 13. Edwards JA, Sullivan AL, Hoke JE. Defective delivery of iron to the developing red cell of the Belgrade laboratory rat. Blood 1980; 55:645-648. 14. Edwards JA, Huebers H, Kunzler C et al. Iron metabolism in the Belgrade rat. Blood 1986; 67:623-628. 15. Bowen BJ, Morgan EH. Anemia of the Belgrade rat: Evidence for defective membrane transport of iron. Blood 1987; 70:38-44. 16. Garrick MD, Gnieckot K, Liu Y et al. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J Biol Chem 1993; 268:14867-14874. 17. Moos T, Morgan EH. Transferrin and transferrin receptor function in brain barrier systems. Cell Molec Neurobiol 2000; 20:77-95. 18. Morgan EH. Iron metabolism and transport. In: Zakin D, Boyer TD, eds. Hepatology, A Textbook of Liver Disease. 3rd Ed. Philadelphia, PA: Saunders; 1996:526-554. 19. Morgan EH. The role of plasma transferrin in iron absorption in the rat. Quart J Exp Physiol 1980; 65:239-252. 20. McKie AT, Barrow D, Latunde-Dada GO et al. An iron-regulated ferric reductase associated with the absorption of dietary iron. Science 2001; 291:1755-1759. 21. Frazer DM, Volpe CD, McKie AT et al. Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins. Am J Physiol 2001; 281:G931-G939. 22. Canonne-Hergaux F, Fleming MD, Levy JE et al. The Nramp2 / DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000; 96:3964-3970. 23. Tchernitchko D, Boureois M, Martin M-E et al. Expression of the two mRNA isoforms of the iron transporter Nramp2 / DMT1 in mice and function of the iron responsive element. Biochem J 2002; 363:449-455. 24. Trinder D, Oates PS, Thomas C et al. Localisation of the divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000; 46:270-276. 25. Oates PS, Thomas C, Freitas E et al. Gene expression of divalent metal transporter 1 and transferrin receptor in duodenum of Belgrade rats. Am J Physiol 2000; 278:G730-G936. 26. Trinder D, Oates PS, Thomas C et al. The expression and distribution of rat Nramp2. Available at http://www.mcmaster.ca/inabis 98. 27. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localisation of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93-4406-4417. 28. Yeh K-Y, Yeh M, Watkins JA et al. Dietary iron induces rapid changes in rat intestinal divalent metal transporter expression. Am J Physiol 2000; 279:G1070-G1079. 29. Su MA, Trenor CC, Fleming JC et al. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 1998; 92:2157-2163. 30. Oates PS, Trinder D, Morgan EH. Gastrointestinal function, divalent metal transporter-1 expression and intestinal iron absorption. Pflüg Arch Eur J Physiol 2000; 440:496-502. 31. Schümann K, Moret R, Künzle H et al. Iron regulatory protein as an endogenous sensor of iron in rat intestinal mucosa. Possible implications for the regulation of iron absorption. Eur J Biochem 1999; 260:362-372. 32. Sladic-Simic D, Martinovitch N, Zivkovic N et al. A thalassemia-like disorder in Belgrade laboratory rats. Ann NY Acad Sci 1969; 165:93-99. 33. Morgan EH. Membrane transport of non-transferrin-bound iron by reticulocytes. Biochim Biophys Acta 1988; 943:428-439. 34. Qian ZM, Morgan EH. Effect of metabolic inhibitors on uptake of non-transferrin-bound iron by reticulocytes. Biochim Biophys Acta 1991; 1073:456-462.

Cellular and Tissue Expression of Rat DMT1 / Nramp 2

95

35. Qian ZM, Morgan EH. Changes in the uptake of transferrin-free and transferrin-bound iron during reticulocyte maturation in vivo and in vitro. Biochim Biophys Acta 1992; 1135:35-43. 36. Quail EA, Morgan EH. Role of membrane surface potential and other factors in the uptake of non-transferrin-bound iron by reticulocytes. J Cell Physiol 1994; 159:238-244. 37. Hodgson LL, Quail EA, Morgan EH. Iron transport mechanisms in reticulocytes and mature erythrocytes. J Cell Physiol 1995; 162:181-190. 38. Savigni DL, Morgan EH. Transport mechanisms for iron and other transition metals in rat and rabbit erythroid cells. J Physiol 1998; 508:837-850. 39. Morgan EH. Mechanisms of iron transport into rat erythroid cells. J Cell Physiol 2001; 186:193-200. 40. Farcich EA, Morgan EH. Uptake of transferrin-bound and nontransferrin-bound iron by reticulocytes from the Belgrade laboratory rat: comparison with Wistar rat transferrin and reticulocytes. Am J Hematol 1992; 39:9-14. 41. Harding C, Heuser J, Stahl P. Endocytosis and intracellular processing of transferrin and colloidal gold-transferrin in rat reticulocytes: demonstration of a pathway for receptor shedding. Eur J Cell Biol 1984; 35:256-263. 42. Pan BT, Teng K, Wu C et al. Electron microscope evidence for externalisation of the transferrin receptor in vesicular form in sheep reticulocytes. J Cell Biol 1985;101:942-94. 43. Knöpfel M, Schulthess G, Funk F et al. Characterization of an integral protein of the brush border membrane mediating the transport of divalent metal ions. Biophys J 2000; 79:874-884. 44. Crowe A, Morgan EH. Effect of dietary cadmium on iron metabolism in growing rats. Toxicol Appl Pharmacol 1997; 145:136-146. 45. Canonne-Hergaux F, Zhang A-S, Ponka P et al. Characterization of the iron transporter DMT1 (NRAMP2/DCTI) in red blood cells of normal and anemic mk/mk mice. Blood 2001; 98:3823-3830. 46. Zoller H, Decristoforo C, Weiss G. Erythroid 5-aminolevulinate synthase, ferrochelatase and DMT1 expression in erythroid progenitors: differential pathways for erythropoietin and iron-dependent regulation. Br J Hematol 2002; 118:619-626. 47. Becker EM, Greer JM, Ponka P et al. Erythroid differentiation and protoporphyrin IX down-regulate frataxin expression in Friend cells: characterization of frataxin expression compared to molecules involved in iron metabolism and hemoglobinization. Blood 2002; 99:3813-3822. 48. Burdo JR, Martin J, Menzies SL et al. Cellular distribution of iron in the brain of the Belgrade rat. Neurosci 1999; 93:1189-1196. 49. Williams K, Wilson MA, Bressler J. Regulation and developmental expression of the divalent metal-ion transporter in rat brain. Cell Mol Biol 2000; 46:563-571. 50. Burdo JR, Menzies SL, Simpson IA et al. Distribution of divalent metal transporter 1 and metal transport protein 1 in the normal and Belgrade rat. J Neurosci Res 2001; 66:1198-1207. 51. Roth JA, Horbinski C, Feng L et al. Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells. J Neurosci 2000; 20:7595-7601. 52. Wareing M, Ferguson CJ, Green R et al. In vivo characterization of renal iron transport in the anaesthetized rat. J Physiol 2000; 524:581-586. 53. Maunsbach AB, Christensen EI. Functional ultrastructure of the proximal tubule. In: Windhager EE, ed. Handbook of Physiology. Section 8: Renal Physiology. Oxford: Oxford Univ Press 1992; 41-107. 54. Ferguson CJ, Wareing M, Ward DT et al. Cellular localization of divalent metal transporter DMT-I in rat kidney. Am J Physiol 2001; 280:F803-F814. 55. McArdle HJ, Morgan EH. Transferrin and iron movements in the rat conceptus during gestation. J Reprod Fert 1982; 66:529-536. 56. Gambling L, Danzeisen R, Gair S et al. Effect of iron deficiency on placental transfer of iron and expression of iron transport proteins in vivo and in vitro. Biochem J 2001; 356:883-889. 57. Georgieff MK, Wobken JK, Welle J et al. Identification and localization of divalent metal transporter-1 (DMT-I) in term human placenta. Placenta 2000; 21:799-804. 58. Tabuchi M, Yoshimori T, Yamaguchi K et al. Human NRAMP2 / DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in Hep-2 cells. J Biol Chem 2000; 275:22220-22228. 59. Griffiths WJH, Kelly AL, Smith SJ et al. Localization of iron transport and regulatory proteins in human cells. Q J Med 2000; 93:575-587.

96

The Nramp Family

CHAPTER 9

Tissue Distribution and Subcellular Localization of Nramp Proteins François Canonne-Hergaux and Philippe Gros

Abstract

T

he NRAMP family regroups divalent metal transporters highly conserved throughout evolution. In mammals, these membrane carriers play key roles in resistance to intracellular pathogens and in iron homeostasis. Nramp1 (Slc11a1) is expressed in professional phagocytes and functions as a divalent-metal efflux pump at the phagosomal membrane to restrict proliferation of intracellular pathogens. On the other hand, Nramp2 (Slc11a2; DMT1) is responsible for intestinal iron absorption and for iron acquisition in peripheral tissues, and cells such as erythroid cell precursors. At least four Nramp2/DMT1 protein isoforms encoded by mRNAs generated by alternate splicing or alternate use of transcription initiation sites are predicted to exist in mammalian cells. Here, we will review current literature addressing the tissue expression and the cellular and subcellular localization of Nramp1 (Part I) and Nramp2/DMT1 (Part II) proteins. We also catalog the numerous Nramp protein species that have been detected by different authors in different tissues and using different antibodies.

NRAMP1: Discovery of The Nramp1 Gene The Nramp1 gene was discovered 10 years ago as a positional candidate for the mouse chromosome 1 «host resistance» locus Ity/Lsh/Bcg (reviewed by refs. 1, 2; see additional chapters in this book). Ity/Lsh/Bcg had been known for many years to control innate susceptibility of inbred mouse strains to infection with Mycobacterium, Salmonella, and Leishmania; Studies ex vivo with explanted macrophages had demonstrated that Ity/Lsh/Bcg affect the ability of these cells to regulate intracellular replication of these pathogens. A positional cloning approach 3 led to the identification of Nramp1 (Natural resistance associated macrophage protein 1), also recently designated Slc11a1 in the genome annotation. At the time of its discovery, Nramp1 mRNA was shown to be expressed at high levels in spleen, and was enriched in splenic macrophages and in the macrophage cell line J774,3 in agreement with a proposed role in host defenses. In addition, analysis of the primary amino acid sequence of Nramp1 identified a highly hydrophobic membrane protein composed of 12 putative trans-membrane (TM) domains, suggesting a possible sub-cellular site of expression for the protein. Sequence analyses indicated that susceptibility to infection in inbred Bcgs strains was associated with a mutation in predicted TM4 (Gly to Asp substitution at position 169) of the protein.4 Allelism between Nramp1 and Bcg/Ity/Lsh was formally demonstrated by the creation of a loss-of-function allele at Nramp1, shown to abrogate natural resistance to infection with M. bovis, S. typhimurium, and L. donovani.5 [Macrophages derived from such animals also proved to be extremely useful The Nramp Family, edited by Mattieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Tissue Distribution and Subcellular Localization of Nramp Proteins

97

for studies of the cellular and subcellular localization of the Nramp1 protein in target cells by immunofluorescence and imunocytochemistry (see below)]. Finally, transgenic transfer of a wild type allele of Nramp1(Gly169) onto the mutant Nramp1Asp169 background of C57BL/6J was shown to restore resistance to infections,6 while overexpression of Nramp1Gly169 in RAW macrophages (Nramp1Asp169) eliminates the permissiveness of these cells to replication of S. typhimurium.7 Together, these results established that Nramp1 is indeed Bcg/Ity/Lsh.

Tissue and Cellular Expression of Mouse and Human Nramp1 mRNA The exon/intron organization and sequence of the mouse Nramp1 gene was elucidated, and primer extension and S1 nuclease protection were used to map one major and several minor transcription start sites in the gene.8 Sequence analysis of the upstream region revealed a TATA-less promotor, with consensus SP1 binding sites and initiator (INR) sequences associated with initiation of transcription by RNA polymerase II. Consensus sequences for binding of the transcription factor PU.1 and GM-CSF response elements (associated with gene expression in macrophages and lymphoid cells), together with sequences associated with response to interferon-γ (IFN-γ) and binding of NF-IL6 (LPS responsiveness), were also identified in the proximal promotor region of Nramp1. In addition, RNA expression studies in various hemopoietic cell lines revealed that Nramp1 expression is restricted to macrophage cell lines J774A and RAW264.7, and is dramatically increased by combined treatment with IFN-γ and LPS. Additional studies in differentiated cell cultures from mouse bone marrow showed Nramp1 mRNA expression in both granulocytes and macrophages.9 In RAW macrophages in vitro, a robust time- and dose-dependent induction of Nramp1 expression by LPS is detected while IFN-γ can also induce Nramp1, although at lower levels. Finally, inflammatory stimuli in vivo such as LPS and thioglycholate can also induce Nramp1 mRNA expression in resident macrophages. Together, these results indicate that Nramp1 is expressed constitutively in professional phagocytes, and can be further up-regulated by infectious or inflammatory stimuli.9 In humans, polymorphonuclear leukocytes (PMN) were found to be the major site of NRAMP1 expression in blood, followed to a lesser degree by monocytes (MN).10,11 Both migration of MN to tissues (alveolar macrophages) and maturation in vitro were associated with increased NRAMP1 expression compared to blood MN. Northern analyses of RNA from model cultured cells showed absence of NRAMP1 expression in transformed cell lines from either erythroid or lymphoid T or B lineage, as well as progenitors of the monocyte/macrophage pathway (KG1, U937, THP1) and the HL-60 promyelocytic leukemia cell line. Experimental induction of differentiation of HL-60 cells towards either the monocyte/macrophage or the granulocyte pathway was concomitant with strong induction of NRAMP1 expression. Analysis of two mammalian and one avian NRAMP1 promoter region identified conserved binding sites for transcription factors SP1, AP-2, and the myeloid-specific factor PU.1/Spi-1, suggesting that these proteins may regulate NRAMP1 expression. These results indicate that human NRAMP1 expression is specific to the myeloid lineage and is acquired during the maturation of PMN and MN.11

Cellular and Subcellular Expression of the Nramp1 Protein in Macrophages and in Neutrophils (Fig. 1) Two glutathione-S-transferase fusion proteins containing either the first 54 or the last 35 residues of Nramp1 were used as immunogens to raise specific anti-Nramp1 antibodies in rabbits. The Nramp1-specific portion of the antisera were further purified by affinity using immunoblotting against dihydrofolate reductase fusions containing the corresponding portions of Nramp1; we have found this last step to be absolutely key to the production of high affinity and high specificity reagents against Nramp proteins to be used for immunofluorescence and immunohistochemistry. In addition, a peptide epitope from the c-Myc protein was introduced in-frame at the C-terminus of the protein to follow its expression in transfected

98

The Nramp Family

Figure 1. Nramp1 in macrophages and neutrophils. Intracellular pathogens are phagocytosed by macrophages or neutrophils and are initially enclosed in a phagosome. A) Nramp1 positive late endosomes/lysosomes in macrophages and tertiary granules in neutrophils are recruited to the pathogen-containing phagosome to form mature acidified and fully bactericidal/bateriostatic phagolysosomes. We have proposed that Nramp1 may act as a divalent metal efflux pump at the phagosomal membrane to create a metal-limiting intra-phagosomal environment. B) In Nramp1 deficient phagocytes, divalent metals are available for pathogen growth and/or expression of survival mechanisms including active inhibition of phagosome maturation. Therefore, in the absence of Nramp1, intracellular pathogens can survive and replicate in immature and poorly bactericidal phagosomes.

cells. Various Nramp1 expression constructs were generated and used to express recombinant proteins in yeast and in mammalian cells.12 The anti-Nramp1 antisera and an anti-c-Myc antibody specifically recognized the tagged Nramp1 protein in membrane fractions from yeast cells, verifying that Nramp1 is indeed an integral membrane protein (resistant to urea extraction).12 Through immunoprecipitation studies using resident Bcgr (Nramp1G169) macrophages, one of the sera identified a protein of 95 Kd which could be metabolically labelled with [32P]orthophosphate and that was sensitive to glycosydase treatment, verifying that Nramp1 is an integral membrane phosphoglycoprotein. Analysis of macrophage extracts from Bcgs mouse strains (Nramp1D169) failed to detect any trace of this protein, suggesting that the G169D mutation at Nramp1 prevents proper maturation or membrane integration of the protein, resulting in its rapid degradation.12 Parallel studies using immunofluorescence and confocal microscopy on normal 129sv and Nramp1-/- mutant macrophages showed that Nramp1 was expressed exclusively in a subcellular membranous compartment, but was absent from the plasma membrane. Double immunofluorescence studies with markers for Golgi, endoplasmic reticulum, early endosome, late endosome, and lysosome co-localized Nramp1 with the late endosome/early lysosomal marker Lamp-1.13 Immunofluorescence and biochemical purification of latex beads containing phagosomes showed that Nramp1 was recruited to the membrane of the maturing phagosome, with kinetics similar to Lamp-1 but distinct from those of the early endosome marker Rab-5. These results suggest that after phagocytosis and during phagosome maturation, Nramp1 becomes intimately associated with the phagosome.13 Using similar techniques, Nramp1 protein association with phagosomes containing Leishmania parasites was also demonstrated.14 Studies in RAW macrophage cell line (defective Nramp1D169 allele) transfected with the functional

Tissue Distribution and Subcellular Localization of Nramp Proteins

99

Nramp1 cDNA (Nramp1G169) fused to a c-Myc epitope tag showed that Nramp1-cMyc is also recruited to the membrane of phagosomes containing either Salmonella typhimurium or Yersinia enterocolitica.7,15 These results clearly established that Nramp1 is rapidly recruited from the late endosomal/lysosomal compartment to the membrane of phagosomes containing either inert particles or live bacteria. In human blood, polymorphonuclear leukocytes (PMNs) are the most abundant site of NRAMP1 mRNA expression, suggesting that NRAMP1 may play an important role in the activity of these cells. By northern blot analysis, NRAMP1 mRNA was only detected in the most mature neutrophils fraction from bone marrow suspensions (band and segmented cells). A high affinity polyclonal rabbit anti-human NRAMP1 antibody directed against the amino terminus of the protein was produced, and used to study cellular and sub-cellular localization of the protein in primary human neutrophils.16 Sub-cellular fractionation of granule populations together with immunoblotting studies with granule-specific markers indicate that NRAMP1 expression is primarily in tertiary granules. This granule fraction is positive for the matrix enzyme gelatinase and for the membrane subunit of the vacuolar H+/ATPase, and can be recruited for exocytosis by treatment of neutrophils with phorbol myristate acetate. Immunogold studies by cryo-electron microscopy with primary neutrophils show that a) NRAMP1 reactivity is seen at the membrane of certain granules, b) confirm that a majority of NRAMP1-positive granules (75%) are also positive for gelatinase, and c) suggest further heterogeneity in this granule population (detection of NRAMP1 positive but gelatinase negative granules). Presence of NRAMP1 in tertiary granules is in agreement with the late stage appearance of NRAMP1 mRNA during neutrophil maturation in bone marrow. Finally, immunoflorescence studies of Candida albicans-containing phagosomes formed in neutrophils indicates that NRAMP1 is recruited from tertiary granules to the phagosomal membrane upon phagocytosis, supporting a role for NRAMP1 in the anti-microbial defenses of human neutrophils.16 Thus, the Nramp1 protein is found in close association with pathogens phagocytosed by both macrophages and neutrophils (Fig. 1). The functional role of the Nramp1 protein at phagosomal membrane is discussed at length in other chapters of this book. Likewise, the possible significance of Nramp1 protein function in infection with intracellular parasites in humans is also reviewed elsewhere in this book.

NRAMP2: Nramp2/DMT1 Gene, RNA and Protein Isoforms (Fig. 2)

Nramp2 was originally cloned by cross-hybridization to Nramp1.17,18 Two groups working on the genetic characterization of rodent models of iron deficiency19 and using expression cloning strategies in Xenopus oocytes,20 concomitantly identified the function of Nramp2. Rat Nramp2 (DCT1, for Divalent Cation Transporter 1) was shown to function as a proton coupled metal–ion transporter with high affinity for iron.20 This transporter was shown to be involved in intestinal absorption of non-heme iron, as well as in iron acquisition in peripheral tissues including erythrocyte precursors.19,21 Nramp2/DCT1 has also been given the appelation DMT1 for Divalent Metal Transporter 1, and more recently was assigned to a new gene family and given the named SLC11A2 (solute carrier family 11 member 2). In this chapter, the Nramp2/ DMT1 nomenclature is used. Sequence analyses indicate that Nramp2/DMT1 can generate through alternative splicing and 3’end processing, 2 different RNA variants that differ with regards to the 3’terminal coding sequences and 3’UTR (Fig. 2).17-19 Interestingly, one of the 2 variants shows a Iron Response Element (IRE) in its 3’UTR, whereas the other does not (Fig. 2). IREs are known to play a regulatory role in cellular iron metabolism through interactions with iron regulatory proteins (IRPs). IREs are found either in the 3’ or in the 5’ UTR of mRNAs encoding proteins that play key roles in iron metabolism. When cellular iron concentration is low, IRPs bind to IRE in 3’UTR sequences, stabilizing and increasing half-lives of target mRNAs acting to mimmick enhanced gene expression.22 The IRE- and non-IRE-containing Nramp2 mRNAs

100

The Nramp Family

Figure 2. Nramp2/DMT1 RNA messengers and protein isoforms. Sequencing of cDNA and genomic clones for Nramp2/DMT1 showed alternative splicing of the 3’ terminal exon of the gene, which generates 2 different mRNAs ).17-19 One mRNA contains the Iron Response Element (IRE) in the 3’UTR (isoform I; IRE form). The second mRNA has a distinct 3’ UTR which lacks the IRE (isoform II; non-IRE form). Isoforms I and II proteins have distinct carboxy terminal peptide sequences. The use of alternate transcription initiation sites has been reported, and generates further diversity at the 5’ end of the message, including the presence of exon 1a 23 encoding distinct amino terminal sequences (variants “a” and “b”). Therefore , four distinct Nramp2/DMT1 mRNAs and proteins may be expressed in mammalian cells [Isoform I (a), Isoform I (b), Isoform II (a), and Isoform II (b)].

encode distinct proteins designated isoform I and II, respectively. Recently, a novel 5’ upstream exon (Ia) generated by use of alternate transcription initiation sites, was identified in the human, mouse and rat Nramp2/DMT1 gene.23 Thus, a possibility of 4 Nramp2/DMT1 mRNAs and proteins (isoforms Ia, Ib, IIa and IIb; Fig. 2) can be theoretically produced by the gene. Herein, the distribution and localization data of Nramp2/DMT1 isoform(s)I and II will be reviewed without discrimination between isoform Ia and Ib or isoform IIa and IIb.

Topology Model of Nramp2/DMT1 Protein (Fig. 3) As described in Table 1, numerous antibodies have been generated against Nramp2/DMT1 peptide sequences. The choice of peptide segments used as immunogens for the production of such antibodies has been based on a topological model largely (but not completely) inferred from hydropathy profiling.24 Figure 3 shows an accepted model for the predicted membrane topology of Nramp2/DMT1 protein, highlighted by the presence of 12 transmembrane (TM) domains and intra-cytoplasmic amino (NT) and carboxy termini (CT). Sequence signatures, previously associated with protein trafficking, such as NPXY (exon 1a) and di-leucine motifs, are present in the NT and CT of Nramp2/DMT1, respectively. The biological relevance/significance of such motifs for Nramp2/DMT1 subcellular localization and function has recently been studied in transfected polarized epithelial cells.25 The fourth extracytoplasmic loop shows two possible sites of Asparagine-linked glycosylation (N-X-S/T); the extracellular localization of this loop and the intracytoplasmic location of NT 26 have been demonstrated by epitope mapping experiment, in support of the proposed topological model. Nramp2/DMT1 proteins

Tissue Distribution and Subcellular Localization of Nramp Proteins

101

Figure 3. Model of Nramp2/DMT1 protein structure in cellular membranes (adapted from ref. 24). Nramp2/DMT1 proteins encodes 12 predicted transmembrane (TM) domains delineating six (I to VI) extracytoplasmic loops and five intracytoplasmic (I to V) loops. The extracytoplasmic loop IV contains two predicted sites for Asn-linked (NXS, NXT) glycosylation, while the fourth intracytoplasmic loop shows a highly conserved sequence signature (conserved transport motif, CTM) of unknown function. The G185R mutation in TM4 of Nramp2/DMT1 that causes microcytic anemia in both the mk mouse and the belgrade rat is indicated by a star. The amino acid position of individual domains is indicated.

contain 561 (isoform I) to 568 amino acids (isoform II). Other DMT1 protein isoforms (Ia and IIa) with proposed NT extensions (29-31 amino acids) have not yet been verified experimentally. According to these amino acid sequences, the calculated molecular mass of Nramp2/ DMT1 (s) should be between 61000 and 66000 Daltons. Identical missense mutations (Glycine to Arginine at position 185; G185R) in predicted TM4 are associated with severe iron deficiency anemia in the mk mouse and the belgrade rat.19,21 This mutation strongly impairs Nramp2/DMT1 transport function 27 but also its normal trafficking properties 28 and its stability (see below). Several anti-Nramp2/DMT1 polyclonal antibodies were raised against peptide sequences from the NT (exon 1b), CT (isoform I and II) and extraloops III and IV. They were used to analyze organ, cell and subcellular localization of the protein(s). Published reports show a variety of seemingly different immunoreactive protein species, with distinct molecular mass and distribution. This information is summarized in Tables 1 and 2.

Nramp2/DMT1: Ubiquitous and Cell Specific Expression RNA detection by RT-PCR and northern blot analysis indicated that Nramp2/DMT1 is expressed at low levels in most mammalian tissues.17,18,20,29 However, Nramp2/DMT1 mRNAs are also expressed at high levels in certain tissues and cell types involved in iron metabolism (Fig. 4).20,23,29,30

The Nramp Family

102

Table 1. Detection of Nramp2/DMT1 in human mouse and rat tissues

Tissues

Phenotype Species or Treatment

Intestine30 Mouse

Wild-type Iron deficient

Intestine32 Rat

Intestine28 Intestine33 Intestine34 Intestine63 Intestine41

Intestine35 Kidney49

Methods IHC IF WB IHC

Wild-type Iron deficient Iron loaded Mouse Microcytic IHC anemia (mk) WB Human IHC WB Rat Wild-type IHC Belgrade b rat WB Mouse HFE IHC WB Mouse HypotransIHC ferrinemic WB (Hpx) Human HFE IHC WB Rat Wild-type IHC IF WB

Kidney48

Mouse

Wild-type mk mice

IHC WB

Liver32

Rat

IHC

Brain60

Rat

Iron deficient Iron loaded Wild-type b rat

IHC WB

Placenta62 Human -

IHC WB

Placenta64 Mouse Blood Mouse Spleen54

WB IF WB

Wild-type mk mice

Mol. Mass and Tissue Cellular Subcellular Isoform Distribution Localization Localization Detected Duodenum

Enterocytes

Duodenum Jejunum

Enterocytes

Duodenum

Enterocytes

Duodenum

Enterocyte

Duodenum Jejunum Duodenum

Enterocytes

Duodenum

Enterocyte

Duodenum

Enterocytes

Enterocytes

BB Apical cytoplasm BB Apical cytoplasm Apical cytoplasm BB BB Cytoplasm BB

(97 kD not shown) IsoformI 90-100 kD 60kD 43kD 60kD

BB 90-100kD Apical cytoplasm BB 60 kD

Cortex Proximal Cytoplasm Outer Tubule cells medulla Collecting Apical mb ducts Henle’s loop Distal tubule cells Cortex Proximal BB Tubules Cytoplasm cells Hepatocyte Cell surface Striatum Neurons Cerebellum- Ependymal Thalamus cells Vascular cells SyncytioCytoplasm trophoblasticBasal mb cells Fetal vessels Erythroid cell Plasma mb precursors Recycling endosomes

IsoformI 90-100 kD

70 kD

IsoformI 70-75 kD 95 kD 62kD 60 kD 85 kD

50kD IsoformII 70kD

IHC= Immunohistochemistry; IF= Immunofluoresence; WB= Western Blot; mb= membrane

Tissue Distribution and Subcellular Localization of Nramp Proteins

103

Table 2. Study of Nramp2/DMT1 in cell lines

Cell lines

Types

Caco233

Human intestinal cells Human intestinal cells Human intestinal cells Human intestinal cells

Caco2T738 Caco237 Caco2 (HTB 37)36

Nature of the Protein Detected Endogenous Endogenous Endogenous Endogenous

Methods IHC WB IF WB WB WB IF

Raw, J774, Mouse Endogenous MEL, macrophages, TM431 erythroid precursors and sertoli cells Raw cells56 Mouse Overexpressed macrophages cMyc tagged isoformII

IF WB IP

TM4 and 15-P-156

Mouse sertoli cells

Endogenous

IF WB

HEp-265

Human hepatocyte

Endogenous

IF WB

COS7 Human Hek293T66 embryonic kidney cells CHO26 Chinese hamster ovary cells HEK293T27 Human embryonic kidney cells BEAS-2B67 Human Bronchial epithelial cells PC12 Neuronal cells Neurones61

IF WB

Overexpressed IF cMyc-tagged WB Monkey isoforms Overexpressed WB HA Tagged Nramp2 (isoform II) Overexpressed WB Flag tagged-Nramp2 IF isoform II Endogenous IHC WB Endogenous

IF WB

Cellular Localization

Mol. Mass and Isoform Detected

BB

60 kD

BB

66 kD 66 kD

BB Recycling endosomes Recycling endosomes

43 kD

IsoformII* 70-90 kD (≈50 kD after glycosidase treatment) Recycling IsoformII* endosomes 80 kD Late endosomes Phagosomes Recycling IsoformII* endosomes 80 kD Late endosomes Phagosomes Late 90-116 kD endosomes (≈50 kD after Lysosomes glycosidase treatment) Plasma mb 65kD Intracellular vesicles Plasma mb 90-100 kD Intracellular (+60 kd vesicles precursor?) Recycling 60 kD endosome Cell surface 94 kD

Nucleus, IsoformII cellular, 65-67kD Neurite Cell body, IsoformI intracellular 65 and 90kD vesicles

* personal observation; IHC= Immunohistochemistry; IF= Immunofluoresence; WB= Western Blot; mb= membrane

104

The Nramp Family

Figure 4. Tissue distribution of Nramp2/DMT1 protein isoform I and II in relation to iron metabolism. Dietary inorganic iron is absorbed by Nramp2/DMT1 isoform I and transported across the duodenal mucosa. After intestinal absorption, iron is transported by transferrin and distributed to peripheral tissues and cells for utilisation and storage. In certain parenchymal cells, Nramp2/DMT1 is likely to participate in iron uptake for storage. A large proportion of transferrin iron is supplied to erythroid precursors present in the bone marrow for the synthesis of heme, a major constituent of hemoglobin. In immature erythrocytes, where iron is acquired via a transferrin-transferrin receptor mediated endocytosis, Nramp2/DMT1 isoform II is highly expressed and transports iron across the membrane of acidified endosomes and into the cytoplasm. At the end of their life span, senescent erythrocytes are phagocytosed by macrophages from spleen, bone marrow and liver (Kupffer cells). In these cells, heme iron is processed and iron is then exported in the blood circulation to reconstitute the transferrin iron pool. Some recent investigations indicate the possible role of Nramp2/DMT1 in this process. Nramp2/DMT1 isoform I is also highly expressed in kidney but its role in this tissue needs to be clarified.

Nramp2/DMT1 in Epithelial Cells Nramp2/DMT1 in the Intestine (Fig. 5) Nramp2/DMT1 expression and localization was studied in human, rat and mouse intestine (Table 1) and in intestinal cell lines (Caco2, Table 2). These studies showed that isoform I is the major Nramp2/DMT1 variant expressed in the intestine. However, there is significant discrepancy in the reported molecular mass of the mature protein present in intestinal cells, varying in size between 43 and 90-100 kD depending on the report and on the antibody used for detection (Table 1). In transfected CHO cells, Nramp2/DMT1 is highly glycosylated with as much as 40% of molecular mass contributed by carbohydrates.31 Such modification of Nramp2/ DMT1 may provide protection against degradation by the intestinal content or may be important for the proper maturation and targeting of the protein to its site of action. Immunostaining studies of tissues sections show that Nramp2/DMT1 protein expression is limited to the villi and is absent in the crypts.30,32-35 Nramp2/DMT1 staining is strongest in the apical two-third of the villi where it is limited to the columnar absorptive epithelium of the mucosa, the enterocytes. In these cells, Nramp2/DMT1 localizes primarily to the brush border (apical plasma membrane) with some additional weaker cytoplasmic staining at the apical pole of the cells. This staining pattern was also observed in the human intestinal cell line Caco2.33,36-38 In mk/ mk enterocytes, the G185R mutation impairs metal transport by Nramp2/DMT127 but also

Tissue Distribution and Subcellular Localization of Nramp Proteins

105

Figure 5. Detection, localization and role of Nramp2/DMT1 in epithelial tissues. A) Nramp2/DMT1 in mouse intestine. 1) Nramp2/DMT1 is expressed in the proximal part of the duodenum. 2) In the duodenum of iron deficient mice, Nramp2/DMT1 is highly expressed at the apical membrane (brush border) of duodenal cells. Some apical intracellular staining can be also seen in these cells. No staining is seen in crypt cells.3) In enterocytes, Nramp2/DMT1 mediates acquisition of reduced inorganic iron into the cells. This transport likely occurs either directly at the apical membrane or possibly via vesicular shuttling. After absorption, iron may be found in the intracellular labile iron pool (LIP) or may incorporate into ferritin or may be transported into the circulation by Ferroportin upon oxidation of iron by hephaestin. B) Nramp2/ DMT1 in the mouse kidney. 1) Nramp2/DMT1 expression is limited to the cortex portion of the kidney. 2) Subcellular localization studies indicate strong Nramp2/DMT1 staining in the proximal circumvoluted tubules (PCT) whereas glomeruli and distal circumvoluted tubules (DCT) remain negative. In PCT, Nramp2/DMT1 is expressed in the apical surface (brush border) and cytoplasm. In rat kidney, Nramp2/ DMT1 was also detected in intravesicular structures in PCT and at the apical membrane of DCT and ascending loop of Henle. 3) Nramp2/DMT1 may act as a divalent metal re-uptake system in the kidney. Some recent investigation suggest that holotransferrin may be a source of iron in this tissue.

appears to affect apical membrane targeting with little protein found at the brush border.28 In the proximal intestine (duodenum), expression of Nramp2/DMT1 isoform I is up-regulated in response to deprivation of dietary iron20,30,39,32 and seems repressed under iron overload conditions.32,40 This upregulation was also observed for the mutant DMT1 G185R isoform expressed in the duodenum of anemic mk mice. The fact that Nramp2/DMT1 IRE-containing mRNA and protein isoform I levels respond to dietary iron is consistent with a functional role of the IRE present in its 3’ UTR of mRNA. Interestingly, expression of the novel Nramp2/ DMT1 5’ mRNA variant seems to be tissue specific and abundant in the duodenum and kidney.23 Moreover, the new 5’ promoter/exon1a region in association with the IRE-containing terminal exon has been shown to participate in iron regulation of Nramp2/DMT1 mRNA expression.23 Other studies indicate that hypoxia and erythropoiesis are also associated with enhanced intestinal expression of Nramp2/DMT1, suggesting that Nramp2/DMT1 levels also respond to the erythroid regulator.41 It has been proposed that in hereditary hemochromatosis (HH), a prevalent human iron overload disease caused by mutations at the HFE locus,

106

The Nramp Family

upregulation of Nramp2/DMT1 may increase duodenal absorption and lead to iron overload.42,43 However, these findings have been debated (see other chapters in this book) and are not supported by parallel studies of mouse mutants lacking the hfe gene.41 In the intestine, Nramp2/DMT1 likely transports reduced iron directly across the apical membrane into the cytoplasm of the enterocytes. However, recent studies in Caco2 intestinal cells suggest that a vesicular process could also be implicated in the intestinal iron uptake.34,37 After apical Nramp2/ DMT1-mediated uptake, iron can be stored into cellular ferritin, or exported by Ferroportin,44-46 and hephaestin47 before entering the circulation and distribution to peripheral tissues via the transferrin-transferrin receptor system.

Nramp2/DMT1 in the Kidney (Fig. 5)

In situ hybridization20 and immunoblotting experiments48,49 have identified strong Nramp2/ DMT1 mRNA and protein expression in the kidney. In this tissue, the IRE containing -isoform I appears to be the predominant form expressed, and is detected as a 70-75KDa species.48,50 The protein is expressed mostly in the cortex and perhaps in the outer medulla.20,48,49 There is some discrepancy between the subcellular site of Nramp2/DMT1 expression in mouse and rat kidney. In mouse (Fig. 5B), Nramp2/DMT1 was reported at the brush border of proximal convoluted tubules,48 while in rat it has been found in intracellular vesicles of proximal tubular cells of S3 segment, and at the apical membrane of distal convoluted tubules, thick ascending limbs of Henle’s loop and collecting ducts.49 In contrast to the intestine, Nramp2/DMT1 mRNA and protein expression appears largely unaffected by dietary iron deprivation,23,48 and are not affected by stimulation of erythropoiesis.29,48 The different behaviour of the IRE-containing isoform I in kidney and intestinal brush border in response to iron levels, suggest different regulatory networks in the two tissues.23,51 In kidney from mk48 and belgrade mutants,50 the G185R defective protein is present at very low levels compared to wild type controls, suggesting possible instability of G185R in kidney. This is in sharp contrast to the intestine, where the G185R variant is overexpressed in mk and b mutants, but where the protein appears to be inappropriately targeted to the brush border.28 Expression of Nramp2/DMT1 protein in kidney suggests a previously unsuspected role in homeostasis of iron and/or of other divalent metals, possibly through re-absorption from glomerular filtrate. One possible physiological source of iron in the urine is the holotransferrin (iron containing transferrin) known to be filtered through the glomerulus and reabsorbed in proximal tubules.52 Interestingly, holotransferrin was also associated to iron-induced toxicity in kidney observed in nephrotic syndrome in which iron accumulates in the proximal tubule.53 The localization and the characteristic of Nramp2/DMT1 transport indeed suggests that Nramp2/ DMT1 may participate in this process. However, the possible mechanism of Nramp2/DMT1 action on holotransferin iron in the proximal tubule is speculative but could be related to the Nramp2/DMT1-mediated transport of transferrin iron across the membrane of acidified recycling endosomes (see below).

Nramp2/DMT1 in Peripheral Tissues (Figs. 6, 7 and 8) Nramp2/DMT1 in Erythroid Cells (Fig. 6) Studies in primary cells and in transfected cells lines (Table 2) have shown that Nramp2/ DMT1 is not only expressed at the plasma membrane but is also present in transferrin receptor positive recycling endosomes.27,31 In mice, reticulocytes are the major physiological site of expression of the non IRE-containing isoform II of Nramp2/DMT1,54 which is detected as a 70 kDa protein in these cells. Nramp2/DMT1 isoform II is coexpressed and colocalizes with transferrin receptor (TfR) in erythroid cell precursors (Fig. 6, ref. 54). Nramp2/DMT1 expression in reticulocytes does not seem to be regulated by iron status (F.C.H and P.G., personal observation). However, treatment with phenylhydrazine or erythropoietin induces production of Nramp2/DMT1-positive reticulocytes.53 As opposed to wild type cells, mk reticulocytes (like mk kidney cells) express no detectable Nramp2/DMT1 protein, despite a robust expres-

Tissue Distribution and Subcellular Localization of Nramp Proteins

107

Figure 6. Nramp2/DMT1 is the endosomal iron transporter in erythroid cell precursors. In immature red cells, iron uptake is through transferrin receptor (TfR) mediated endocytosis. This process leads to the internalisation of transferrin-bound iron (TBI) in recycling endosomes. Endosomal acidification via vacuolar H+/ATPase favors realease from transferrin and reduction of iron. Ferrous iron is then transported by Nramp2/DMT1 into the cytosol and used for hemoglobin synthesis in mitochondria. The Tf-TfR complex is then recycled to the cell surface where Apo-Tf is released from TfR.

sion of TfR in these cells, suggesting a possible effect of the mutation on stability and targeting of Nramp2/DMT1 in reticulocytes. During erythropoeisis, immature red cells are avid consumers of iron for heme biosynthesis, and production of hemoglobin. High level expression of TfR and of Nramp2/DMT1 in these cells would permit coordinate iron uptake in these cells at the plama membrane and transfer across the membrane of recycling endosomes.

Nramp2/DMT1 in Liver (Fig. 7) Nramp2/DMT1 is expressed in liver, an organ that fulfils a key storage function for iron. In human iron overload disorders such as atransferrinemia and hereditary hemochromatosis, iron accumulates in hepatocytes leading to irreversible cell and organ damage. Nramp2/DMT1 mRNA is expressed in hepatocytes with the protein detected in cells lining the sinusoids.32 Nramp2/ DMT1 staining at the plasma membrane of hepatocytes seems to increase and decrease in response to iron overload or iron deficiency, respectively.32 It has been suggested that in iron overload with high plasma Tf saturation, the non-transferrin-bound iron (NTBI) increases and is absorbed by the liver. Nramp2/DMT1 has been proposed to serve as a NTBI membrane transport.55 Trinder et al suggest that upregulation of such transporter in the liver during iron overload could reduce the risk of unregulated iron intake and cell damage elsewhere in the body.32

Nramp2/DMT1 in Macrophages (Fig. 8) Nramp2/DMT1 is expressed in macrophages as a 50kDa precursor modified by N-linked glycosylation to a 70-90 kDa mature species.31 The non-IRE containing isoform II Nramp2/ DMT1 is the isoform expressed in these cells (F.C-H. and P.G., unpublished observations). Macrophages play a key role in iron metabolism through phagocytosis of senescent red cells, and recycling of heme iron. Therefore an iron transporter is suspected to be present at the phagosomal membrane in order to transport the phagosomal iron into the cytoplasm after hemoglobin degradation. Immunoflurescence analysis suggests that the Nramp2/DMT1 could

108

The Nramp Family

Figure 7. Role of Nramp2/DMT1 in TBI and NTBI uptake in parenchymal cells. In hepatocytes, Tf- bound iron (TBI) is acquired through a TfR mediated endocytosis and transported across the endosomal membrane by Nramp2/DMT1 (see Fig. 6). NTBI also can be absorbed at the plasma membrane via Nramp2/ DMT1. Intracellularly, iron may transit through the labile iron labile pool (LIP) and can be stored in ferritin or transported into mitochondria for utilisation (the latter transport mechanism remains unknown). Iron can be also secreted into the circulation likely through the combined action of an iron exporter (ferroportin1) and a plasma ferroxydase (ceruloplasmin).

be associated with phagosomal membranes during phagocytosis.31 Recently, in two murine Sertoli cell lines of the testis (TM4 and 15P-1) and in Nramp2/DMT1-transfected Raw macrophages, Nramp2/DMT1 was localised primarily to early endosome compartment with some overlapping staining in Lamp1-positive late endosomes.56 In this study, Nramp2/DMT1 was also found associated with erythrocyte-containing phagosomes.56 All together these studies suggest that Nramp2/DMT1 may carry out active transport at the phagosomal membrane in phagocytic cells.57,58 Some studies indicate that Nramp1 may also regulate macrophage iron handling after erythrophagocytosis.57-59 Nramp1 function at this site would have to be redundant of an other transporter, since Nramp1-/- deficient mice show no sign of anemia or other impairment of erythrocyte iron homeostasis.

Nramp2/DMT1 in Other Tissues The mechanism underlying iron accumulation in the brain in certain neurodegenerative diseases is poorly understood. Nramp2/DMT1 mRNA was detected by in situ hybridization in numerous structures of the rat brain.20 Nramp2/DMT1 protein staining was observed in neurons in striatum, cerebellum, thalamus and in the ependymal and vascular cells throughout the brain.60 One study suggested that in cells of neuronal origins and in the cell line PC12, both isoforms I and II are present; while isoform I was detected in intracellular vesicles, isoform II was detected in the nucleus.61

Tissue Distribution and Subcellular Localization of Nramp Proteins

109

Figure 8. Heme iron recycling in macrophages. Macrophages from bone marrow, liver (Kuppfer cells) and spleen, play an important role in iron homeostasis by recycling heme iron (derived from effete erythrocytes). Effete erythrocytes phagocytosed by macrophages are present in phagosomes that mature to phagolysosome through vesicular fusion events with late endosomes and lysosomes. During this process hemoglobin is degraded and iron is extracted from heme via the activity of the heme oxygenase1 (HO-1). Nramp proteins could then transport iron into the cytosol for a subsequent storage in ferritin. In relation to the iron needs of the organism, iron could be exported by ferroportin1 and oxidized by ceruloplasmin in the plasma for tissue distribution (via Tf/TfR).

Nramp2/DMT1 protein was also detected in placenta, both in the cytoplasm and at the junction of the fetal (basal) membrane and fetal vessels.62 It was proposed that it may transport endosomal ferrous iron into the cytoplasm of the human syncytiotrophoblast to supply the fetus.

Nramp2/DMT1 Studies: Rich but Controversial Literature There has been considerable heterogeneity in the reported molecular mass of DMT1 protein(s) detected by different groups by immunoblotting, even when analysed in the same tissue (see Tables 1 and 2). Although it is difficult to reconcile all these differences and it is almost certain that some of the detected species represent artefacts, several factors may have contributed to this reported diversity. First, there exists at least 4 possible Nramp2/DMT1 protein isoforms (Fig. 2) that may be differentially expressed in different tissues and/or cell types. Individual isoforms may be further modified post-translationally by glycosylation and phosphorylation in a cell-specific fashion. In addition, analysis of tissue samples from different species (human, mouse or rat) may also have contributed to heterogeneity. Also, the choice of peptide immunogens for the production of anti-Nramp2 antibodies may have also influenced the protein species detected. For example, antibodies directed against the extracellular loop may preferentially recognize the non-glycosylated precursor form of the protein as opposed to

110

The Nramp Family

the fully mature glycosylated peptide (i.e., 60kDa vs. 90-100kDa species), while antibodies directed against the carboxy or the amino termini would recognize both.40,62 Finally, procedural differences in tissue collection, sample preparation, fixation and analysis may have also contributed to differences in the reported subcellular localization of the protein.

Conclusion Cellular and subcellular localization studies with isoform specific antibodies have provided important insight and have helped to better understand the normal physiological role of Nramp1 and Nramp2/DMT1. Nramp2/DMT1 proteins are distributed in different subcellular localization (plasma membrane, recycling vesicles, late endosomes or phagosomes). The dual localization of Nramp2/DMT1 at the plasma membrane and in recycling endosomes supports the notion that this protein can mediate both a) transferrin-independent acquisition of nutritional iron at the intestinal brush border, and b) cellular import of transferrin iron from the lumen of acidified endosomes to the cytoplasm. Recent studies have uncovered differential splicing events at the 3’ end of the gene, and alternative use of 5’ transcription initiation sites which together increase the structural and possibly functional diversity of the Nramp2/DMT1 family at the cellular level. Localization studies of Nramp1 indicate that this protein carries out divalent metal transport at the phagosomal membrane of macrophages. Thus, Nramp1 appears to have a specialized and cell specific function. However, metal transport by both proteins would be by a pH-dependent mechanism, down a proton gradient. For Nramp1 and Nramp2/DMT1, the vacuolar H+-ATPase would play a critical role in creating the pH gradient required for substrate transport.

References 1. Blackwell JM, Goswami T, Evans CA et al. SLC11A1 (formerly NRAMP1) and disease resistance. Cell Microbiol 2001; 3:773-84. 2. Skamene E, Schurr E, Gros P. Infection genomics: Nramp1 as a major determinant of natural resistance to intracellular infections. Annu Rev Med 1998; 49:275-87. 3. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 1993; 73:469-85. 4. Malo D, Vogan K, Vidal S et al. Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics 1994; 23:51-61. 5. Vidal S, Tremblay ML, Govoni G et al. The Ity/Lsh/Bcg locus: Natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J Exp Med 1995; 182:655-66. 6. Govoni G, Vidal S, Gauthier S et al. The Bcg/Ity/Lsh locus: genetic transfer of resistance to infections in C57BL/6J mice transgenic for the Nramp1 Gly169 allele. Infect Immun 1996; 64:2923-9. 7. Govoni G, Canonne-Hergaux F, Pfeifer CG et al. Functional expression of Nramp1 in vitro in the murine macrophage line RAW264.7. Infect Immun 1999; 67:2225-32. 8. Govoni G, Vidal S, Cellier M et al. Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics 1995; 27:9-19. 9. Govoni G, Gauthier S, Billia F et al. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J Leukoc Biol 1997; 62:277-86. 10. Cellier M, Govoni G, Vidal S et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 1994; 180:1741-52. 11. Cellier M, Shustik C, Dalton W et al. Expression of the human NRAMP1 gene in professional primary phagocytes: studies in blood cells and in HL-60 promyelocytic leukemia. J Leukoc Biol 1997; 61:96-105. 12. Vidal SM, Pinner E, Lepage P et al. Natural resistance to intracellular infections: Nramp1 encodes a membrane phosphoglycoprotein absent in macrophages from susceptible (Nramp1 D169) mouse strains. J Immunol 1996; 157:3559-68. 13. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185:717-30. 14. Searle S, Bright NA, Roach TI et al. Localisation of Nramp1 in macrophages: modulation with activation and infection. J Cell Sci 1998; 111:2855-66.

Tissue Distribution and Subcellular Localization of Nramp Proteins

111

15. Cuellar-Mata P, Jabado N, Liu J et al. Nramp1 modifies the fusion of Salmonella typhimuriumcontaining vacuoles with cellular endomembranes in macrophages. J Biol Chem 2002; 277:2258-65. 16. Canonne-Hergaux F, Calafat J, Richer E et al. Expression and subcellular localization of NRAMP1 in human neutrophil granules. Blood 2002; 100:268-75. 17. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25:514-25. 18. Lee PL, Gelbart T, West C, Halloran C et al. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998; 24:199-215. 19. Fleming MD, Trenor CC 3rd, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16:383-6. 20. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-8. 21. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95:1148-53. 22. Eisenstein RS. Iron regulatory proteins and the molecular control of mammalian iron metabolism. Annu Rev Nutr 2000; 20:627-62. 23. Hubert N, Hentze MW. Previously uncharacterized isoforms of divalent metal transporter (DMT)-1: implications for regulation and cellular function. Proc Natl Acad Sci USA 2002; 99:12345-50. 24. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92:10089-93. 25. Tabuchi M, Tanaka N, Nishida-Kitayama J et al. Alternative splicing regulates the subcellular localization of divalent metal transporter 1 isoforms. Mol Biol Cell 2002; 13:4371-87. 26. Picard V, Govoni G, Jabado N et al. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem 2000; 275:35738-45. 27. Su MA, Trenor CC, Fleming JC et al. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 1998; 92:2157-63. 28. Canonne-Hergaux F, Fleming MD, Levy JE et al. The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000; 96:3964-70. 29. Tchernitchko D, Bourgeois M, Martin ME et al. Expression of the two mRNA isoforms of the iron transporter Nrmap2/DMTI in mice and function of the iron responsive element. Biochem J 2002; 363:449-55. 30. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93:4406-17. 31. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189:831-41. 32. Trinder D, Oates PS, Thomas C et al. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000; 46:270-6. 33. Griffiths WJ, Kelly AL, Smith SJ et al. Localization of iron transport and regulatory proteins in human cells. Qjm 2000; 93:575-87. 34. Yeh KY, Yeh M, Watkins JA et al. Dietary iron induces rapid changes in rat intestinal divalent metal transporter expression. Am J Physiol Gastrointest Liver Physiol 2000; 279:G1070-9. 35. Zoller H, Koch RO, Theurl I et al. Expression of the duodenal iron transporters divalent-metal transporter 1 and ferroportin 1 in iron deficiency and iron overload. Gastroenterology 2001; 120:1412-9. 36. Ma Y, Specian RD, Yeh KY et al. The transcytosis of divalent metal transporter 1 and apo-transferrin during iron uptake in intestinal epithelium. Am J Physiol Gastrointest Liver Physiol 2002; 283:G965-74. 37. Sharp P, Tandy S, Yamaji S et al. Rapid regulation of divalent metal transporter (DMT1) protein but not mRNA expression by non-haem iron in human intestinal Caco-2 cells. FEBS Lett 2002; 510:71-6. 38. Tandy S, Williams M, Leggett A et al. Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells. J Biol Chem 2000; 275:1023-9. 39. Fleming RE, Migas MC, Zhou X et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 1999; 96:3143-8.

112

The Nramp Family

40. Oates PS, Thomas C, Freitas E et al. Gene expression of divalent metal transporter 1 and transferrin receptor in duodenum of Belgrade rats. Am J Physiol Gastrointest Liver Physiol 2000; 278:G930-6. 41. Canonne-Hergaux F, Levy JE, Fleming MD et al. Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders. Blood 2001; 97:1138-40. 42. Zoller H, Theurl I, Koch R et al. Mechanisms of iron mediated regulation of the duodenal iron transporters divalent metal transporter 1 and ferroportin 1. Blood Cells Mol Dis 2002; 29:488-97. 43. Fleming RE, Sly WS. Mechanisms of iron accumulation in hereditary hemochromatosis. Annu Rev Physiol 2002; 64:663-80. 44. McKie AT, Marciani P, Rolfs A et al. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000; 5:299-309. 45. Donovan A, Brownlie A, Zhou Y et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000; 403:776-81. 46. Abboud S, Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 2000; 275:19906-12. 47. Vulpe CD, Kuo YM, Murphy TL et al. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 1999; 21:195-9. 48. Canonne-Hergaux F, Gros P. Expression of the iron transporter DMT1 in kidney from normal and anemic mk mice. Kidney Int 2002; 62:147-56. 49. Ferguson CJ, Wareing M, Ward DT et al. Cellular localization of divalent metal transporter DMT-1 in rat kidney. Am J Physiol Renal Physiol 2001; 280:F803-14. 50. Wareing M, Delannoy M, Ferguson CJ et al. Iron Handling by the Belgrade rat. BIOIRON 2001-World Congress on Iron Metabolism. Cairns, Australia; 2001. 51. Gunshin H, Allerson CR, Polycarpou-Schwarz M et al. Iron-dependent regulation of the divalent metal ion transporter. FEBS Lett 2001; 509:309-16. 52. Kozyraki R, Fyfe J, Verroust PJ et al. Megalin-dependent cubilin-mediated endocytosis is a major pathway for the apical uptake of transferrin in polarized epithelia. Proc Natl Acad Sci USA 2001; 98:12491-6. 53. Chen L, Boadle RA, Harris DC. Toxicity of holotransferrin but not albumin in proximal tubule cells in primary culture. J Am Soc Nephrol 1998; 9:77-84. 54. Canonne-Hergaux F, Zhang AS, Ponka P et al. Characterization of the iron transporter DMT1 (NRAMP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood 2001; 98:3823-30. 55. Garrick LM, Dolan KG, Romano MA et al. Non-transferrin-bound iron uptake in Belgrade and normal rat erythroid cells. J Cell Physiol 1999; 178:349-58. 56. Jabado N, Canonne-Hergaux F, Gruenheid S et al. Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes in macrophages and Sertoli cells. Blood 2002; 100:2617-22. 57. Wyllie S, Seu P, Goss JA. The natural resistance-associated macrophage protein 1 Slc11a1 (formerly Nramp1) and iron metabolism in macrophages. Microbes Infect 2002; 4:351-9. 58. Mulero V, Searle S, Blackwell JM et al. Solute carrier 11a1 (Slc11a1; formerly Nramp1) regulates metabolism and release of iron acquired by phagocytic, but not transferrin-receptor-mediated, iron uptake. Biochem J 2002; 363:89-94. 59. Biggs TE, Baker ST, Botham MS et al. Nramp1 modulates iron homoeostasis in vivo and in vitro: Evidence for a role in cellular iron release involving de-acidification of intracellular vesicles. Eur J Immunol 2001; 31:2060-70. 60. Burdo JR, Menzies SL, Simpson IA et al. Distribution of divalent metal transporter 1 and metal transport protein 1 in the normal and Belgrade rat. J Neurosci Res 2001; 66:1198-207. 61. Roth JA, Horbinski C, Feng L et al. Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells. J Neurosci 2000; 20:7595-601. 62. Georgieff MK, Wobken JK, Welle J et al. Identification and localization of divalent metal transporter-1 (DMT-1) in term human placenta. Placenta 2000; 21:799-804. 63. Griffiths WJ, Sly WS, Cox TM. Intestinal iron uptake determined by divalent metal transporter is enhanced in HFE-deficient mice with hemochromatosis. Gastroenterology 2001; 120:1420-9. 64. Gambling L, Danzeisen R, Gair S et al. Effect of iron deficiency on placental transfer of iron and expression of iron transport proteins in vivo and in vitro. Biochem J 2001; 356:883-9. 65. Tabuchi M, Yoshimori T, Yamaguchi K et al. Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 2000; 275:22220-8. 66. Zhang L, Lee T, Wang Y et al. Heterologous expression, functional characterization and localization of two isoforms of the monkey iron transporter Nramp2. Biochem J 2000; 349:289-97. 67. Wang X, Ghio AJ, Yang F et al. Iron uptake and Nramp2/DMT1/DCT1 in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol 2002; 282:L987-95.

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

113

CHAPTER 10

Plant Metal Transporters with Homology to Proteins of the NRAMP Family Sebastien Thomine and Julian I. Schroeder

Abstract

P

lants need metal transporters to fulfill many essential functions ranging from metal absorption to metal sequestration and storage. In some cases, plants also have to deal with toxic heavy metals such as cadmium, lead and mercury or toxic excess of essential metals. This chapter focuses on our knowledge of the properties and functions of plant metal transporters with homology to the Natural Resistance Associated Macrophage Protein 1 (NRAMP1). The plant NRAMP family is now well documented in both plant genomic and plant EST databases, demonstrating that genes from this family are present in virtually all plants studied at the molecular level. Plant NRAMP genes complement yeast mutants deficient in the uptake of several metals, including iron, manganese and zinc, demonstrating their conserved function as metal transporters among all kingdoms. The elucidation of the function of NRAMP genes in plant cells is an emerging field supported by reverse genetic studies on NRAMP knock-out plants and systematic tissue and subcellular localization using promoter reporter gene fusion and transporter-green fluorescent protein fusion. In plants, several NRAMP genes are up-regulated under Fe starvation, indicating a function in Fe nutrition. NRAMP proteins likely localize on intracellular membranes such as the plastid envelope and the vacuolar membrane. Over-expression or disruption of NRAMP genes in Arabidopsis leads to changes in Fe or Cd sensitivity. The plant NRAMP family raises the question of the importance of dynamic metal compartmentalization in plant cells.

Introduction Plants need metal transporters to fulfill many essential functions ranging from metal absorption to metal sequestration and storage.1 Plant roots represent the main site for the primary uptake of metals from soils to the food chain. Therefore the uptake and trafficking of beneficial as well as toxic heavy metals by plants determines to a large extent the quality of food. Because the abundance and the bioavailability of micronutrient metals can be very limiting in some soils, plants have developed efficient absorption strategies. These strategies have been best studied in the case of iron (Fe). To take up iron, plants use two distinct strategies, the first one that is used by all plants except grasses is based on the reduction of iron from ferric chelates at the root surface and subsequent uptake by a ferrous iron uptake transporter.2 This strategy is analogous to the mechanism of iron uptake in yeast.3 The second one is based on the release of Fe chelating molecules called phytosiderophores in the soil solution surrounding the root.4 Then, specific transporters catalyze the uptake of ferric iron phytosiderophore complexes into the root cells.5 This strategy is analogous to the iron uptake strategy by many soil and pathogen bacteria.6,7

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

114

The Nramp Family

In addition to metal absorption, plants also need to be able to transport transition metals to the growing organs and to the cell compartments where they are necessary. A fine control of metal concentrations is required in chloroplasts in photosynthetic tissues, where metals play essential roles in photosynthesis but can cause serious oxidative damage. In some cases, plants also have to deal with toxic heavy metals such as cadmium, lead and mercury or toxic excess of essential metals. In this case, transporters can function either in excluding metals at the root or sequestering metals in some cell compartments such as the vacuole. Thus, it is not surprising that the analysis of the Arabidopsis genome has uncovered the existence of several large families of metal transporter genes. These families include zinc and iron transporters ZRT1-IRT1 like proteins (ZIP, 15 members in Arabidopsis genome), Cu and Cd transporting ATPases (7 members), Zn and Cd transporting Cation Diffusion Facilitator (CDF, 8 members), copper transporters (CTR, 6 members), and NRAMP homologues8-10 (http://www.cbs.umn.edu/arabidopsis/). In addition, members of the vacuolar cation proton exchanger (CAX) and of the ABC transporter family are involved in metal homeostasis in plant cells.11,12 Individual metal transporters from several of the above families have been implicated in a variety of functions at the cellular and plant levels. IRT1, a member of the ZIP family was shown to encode the primary uptake transporter for Fe, Mn, Zn and Co uptake from the soil through the plasma membrane of root epidermal cells.13,14 RAN1, a member of the CuATPase family in Arabidopsis with homology to the Menkes and Wilson diseases genes,15 is important for the loading of copper on Cu containing proteins such as the ethylene receptor.16,17 ZAT1, a member of the CDF family was shown to increase Zn tolerance when over-expressed in plants.18 This tolerance is likely the result of an increased sequestration in the vacuolar compartment. This chapter focuses on our knowledge of the properties and functions of plant homologues of the Natural Resistance Associated Macrophage Protein 1 (NRAMP1). After NRAMP1 was characterized as a resistance gene to intracellular pathogens in mouse,19 homologues of NRAMP1 were characterized in plants. Belouchi and collaborators have detected the presence of several genes of the NRAMP family among rice ESTs and cloned corresponding cDNAs.20,21 However, the understanding of NRAMP functions in plants remained limited. The plant NRAMP family is now well documented in both plant genomic and plant EST databases, demonstrating that genes from this family are present in virtually all plants studied at the molecular level. Plant NRAMP genes complement yeast mutants deficient in the uptake of several metals demonstrating their conserved function as metal transporters among all kingdoms.22,23 In addition, Arabidopsis harbor EIN2, which contains a NRAMP homologous domain fused to a soluble domain and was initially identified by genetic studies as a gene required for Arabidopsis sensitivity to the plant hormone ethylene.24,25 The elucidation of the function of NRAMP genes in plant cells is an emerging field supported by reverse genetic studies on NRAMP knock-out plants and the systematic tissue and subcellular localization of plant membrane proteins using promoter reporter gene fusion and transporter-green fluorescent protein fusion. This study is complex because of the rather high number of NRAMP genes present in plant genomes, which may cause functional redundancy within the family.

Genomic Analysis of the NRAMP Family in Plant Species A database search for NRAMP homologous genes in plant species identifies a large number of genes. Overall the plant NRAMP proteins show high amino acid sequence conservation with NRAMP from other kingdoms. For instance, Arabidopsis NRAMP proteins share between 40 and 50% amino acid sequence identity with mouse NRAMP1 and about 30% identity with the yeast NRAMP SMF1. Even higher sequence conservation is found in the predicted transmembrane domains (TMs) and the bacterial Consensus Transport Sequence found between TM8 and TM9.26 Interestingly NRAMP genes are distributed among all plant families. They are present both in grasses and nongraminaceous species. These two groups of plants use different strategies to

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

115

take up iron (Fe) from the soil solution.2 The occurrence of NRAMP genes in these two groups of plants suggests a general function in metal homeostasis distinct from the initial steps of metal uptake from the soil solution. Another feature of plant NRAMP genes is the relatively high number of homologues per species. The Arabidopsis genome encodes six NRAMP homologues, in addition to EIN2, whereas yeast and mouse genomes encode only three and two NRAMP genes, respectively. A similar situation is found in rice: the complete genome sequence of rice also contains at least seven distinct genes encoding NRAMP homologous proteins27 (http://www.cbs.umn.edu/rice/). In addition, we have identified several ESTs with homology to NRAMP in species as diverse as Medicago truncatula, soybean, cotton, tomato, pine tree, maize and barley. However, it is not possible at the moment to determine how many NRAMP genes the genomes of these plant species contain. Examination of the phylogenetic tree of plant NRAMP proteins reveals the existence of two distinct subfamilies independent from the clusters formed by animal, bacterial and yeast NRAMP sequences: the group I contains among others AtNRAMP1 (Arabidopsis), LeNRAMP1 (tomato) and OsNRAMP1 (rice) and the group II contains AtNRAMP2 and OsNRAMP2 (Fig. 1). Whereas AtNRAMP2, 3, 4 and 5 from the group II share between 67 and 75% identity, they share only 33 to 37% identity with AtNRAMP1 and 6 from group II. In addition to the divergence in the primary amino acid sequence between genes from group I and II, they display striking differences in the gene organization: genes from the group I such as AtNRAMP1 and AtNRAMP6 are highly fragmented with as many as 12 introns, whereas genes from the group II such as AtNRAMP2, 3, 4 and 5 have only 2 to 3 introns located at conserved positions (Fig. 2). This sequence divergence suggests early evolutionary separation between the two groups of plant NRAMPs. Although both groups are nuclear encoded one group could derive from the eucaryotic branch whereas the other would originate from endosymbiotic organites such as mitochondria or plastids. Group II appears to be more closely related to known animal NRAMP homologues than group I. Phylogenetic analyses of the translated EST sequences from Medicago truncatula, Glycine max, cotton and tomato reveal that all these species harbor NRAMP genes from group I and group II. This suggests that both group I and group II are required for proper metal homeostasis in plants. In addition to the NRAMP genes, the Arabidopsis genome encodes the EIN2 protein that contains an amino-terminal domain with clear homology to NRAMP proteins. However the NRAMP domain of EIN2 is divergent from any other known NRAMP sequence and shares only 17 to 20% identity with other Arabidopsis NRAMP homologs. This domain is fused to a “signaling” domain, which does not bear any significant homology with any protein identified so far. The analysis of ein2 mutants has shown that EIN2 functions in multiple signaling pathways regulating the transduction the plant gaseous hormone ethylene, the sensitivity to jasmonate, and resistance to pathogens.25

Functional Characterization of NRAMP Metal Transport Properties in Heterologous Expression Systems Starting with SMF1, NRAMP proteins have been shown to function as metal transporters. SMF1 was first identified as a component of the Mn uptake system in yeast.28 Following, DCT1/ DMT1/NRAMP2 was identified as the main Fe uptake transporter in mammalian duodenum and shown to transport a range of heavy metals.29 An emerging concept is that NRAMP genes encode transition metal transporters with broad specificity. The metal transport function of plant NRAMP proteins has been demonstrated by complementation of yeast mutants impaired in metal uptake. OsNRAMP1, AtNRAMP1, 3, 4 and 5 can complement Fe uptake in the yeast double knockout strain fet3fet4.30,31which is defective in both high and low affinity iron uptake systems (Table 1).22,23,32 In contrast, OsNRAMP2 and AtNRAMP2 fail to complement this strain.22 The ability of some plant NRAMP homologues to transport other metals has also been tested. AtNRAMP1, 3, 4 and 5 complement the phenotype of smf1,28 which is defective in manganese

116

The Nramp Family

Figure 1. Phylogenetic tree of NRAMP genes. Nramp homologous genes: EIN2, AtNRAMP1 (AF 165125), AtNRAMP2 (AF 141204), AtNRAMP3 (AF202539), AtNRAMP4 (AF202540), AtNRAMP5 (At4g18790) and AtNRAMP6 (At1g15960) from Arabidopsis; OsNRAMP1 (L41217), OsNRAMP2 (L81152), OsNRAMP3 (U60767), OsNRAMP4 (2677.m00154), OsNRAMP5 (2125.m00086), OsNRAMP6 (2025.m00169) and OsNRAMP7 (2485.m 00126) from rice (Oryza sativa); LeNRAMP1 and LeNRAMP3 from tomato (lycopersicon esculentum) (Bereczki and Bauer personal communication). Note that for EIN2, only the sequence of the NRAMP homologous domain of the protein was taken into account to construct the tree. SMF1 (U15929) SMF2 (U00062) and SMF3 (S0004024) from yeast (Saccharomyces cerevisiae). MmNRAMP1 (L13732) and MmNRAMP2 (L33415) from mouse (Mus musculus). DCT1 is the rat homologue of MmNRAMP2. DmMVL1 stands for Mavolio 1 (U23948) from Drosophila melanogaster. DrMntH (AE002012), EcMntH (AF161318), PaMntH1 (AF161319), PaMntH2 (AF161320) and StMntH (AF161317) from bacteria (Deinococcus radiodurans, Escherichia coli, Pseudomonas aeruginosa and Salmonella typhimurium). The phylogenetic tree of NRAMP sequences was drawn using Treeview software after comparison of the deduced protein sequences with ClustalX software. One thousand bootstrap replicates were performed and the numbers on the nodes indicate the percentage of trees obtained with the node in the represented position on the tree.

uptake.23,32 (Table 1). In addition, AtNRAMP4, but not AtNRAMP1 or 3 complements the growth of zrt1zrt2 yeast.33,34 in which low and high affinity Zn transporters have been disrupted (Table 1, S. Thomine unpublished). The complementation of the yeast plasma membrane uptake systems for Fe, Mn and Zn requires strong constitutive expression of the plant NRAMP genes, suggesting that yeast cells express plant NRAMP proteins at the plasma membrane with low efficiency. Furthermore, expression of plant AtNRAMP1, 3 and 4 genes in wild type yeast increase their sensitivity to the toxic metal cadmium.23 This supports the idea that in addition to essential metals, plant NRAMP transporters can also transport toxic metals. Altogether, these results show that plant NRAMP encode metal transporters able to transport several different transition metals.

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

117

Figure 2. Genomic organization of Arabidopsis NRAMP genes. Alignment between the coding sequence and the genomic sequence of Arabidopsis NRAMP genes was performed to determine the position of introns (black box). The grey box indicate a predicted intron that was found in several independent AtNRAMP6 cDNAs. These improperly spliced AtNRAMP6 cDNAs cannot be translated into a full length NRAMP protein because the intron contains a stop codon and introduces a frameshift.

Interestingly, the different NRAMP transporters tested do not transport the same range of metals. For example, although AtNRAMP1, 3 and 4 all induce the same level of Cd hypersensitivity, AtNRAMP3 and 4 complement fet3fet4 with a greater efficiency than AtNRAMP1 and, AtNRAMP4 is the only one among the NRAMP genes we tested which is able to complement zrt1zrt2 growth on low zinc level.23 The transport selectivity of plant NRAMP protein seems independent of whether they belong to group I or to group II in the phylogenetic tree (Table 1, Fig. 1). Although other plant NRAMP genes have been shown to encode metal transporters, no metal transport function could be demonstrated for EIN2. It has been proposed that EIN2 could function as a metal sensor in plant cells.35 In the future it will be interesting to determine the complete substrate range for each NRAMP transporter and to identify the structural features underlying the differences in selectivity. The transport mechanism that plant NRAMP use also remains to be determined. Based on the strong pH sensitivity of the complementation of fet3fet4 phenotype by AtNRAMP3 and 4,23 it has been hypothesized that the metals might

Table 1. Complementation of yeast metal uptake mutants by plant NRAMP genes Yeast Strain/ Gene

Mn (smf1)

Fe (fet3fet4)

Zn (zrt1zrt2)

Cd (wild type)

AtNRAMP1 AtNRAMP2 AtNRAMP3 AtNRAMP4 AtNRAMP5 AtNRAMP6 EIN2 OsNRAMP1 OsNRAMP2

+ + + + ND ND ND

+ + + + ND + -

+ + ND ND ND

+ ND + + ND ND ND ND

References 22,23 22 23 23 32 23,25 22 22

The Nramp Family

118

Table 2. Expression pattern and regulation of plant NRAMP genes Gene AtNRAMP1 AtNRAMP2 AtNRAMP3 AtNRAMP4 AtNRAMP5 AtNRAMP6 LeNRAMP1 LeNRAMP3 OsNRAMP1 OsNRAMP2 OsNRAMP3

Organ

Tissue

Fe Starvation

Reference

roots>>shoots roots>shoots roots<shoots roots<shoots flowers leaves and stems roots roots>shoots roots>leaves leaves>>roots leaves>roots

ND ND conductive tissues conductive tissues pollen ND ND ND ND ND ND

up-regulated no up-regulated up-regulated ND ND up-regulated no ND ND ND

22,23 22 23,47 23 32 32 37 37 20 21 21

be cotransported with protons, as demonstrated for mammalian NRAMP2/DCT1/DMT1 and yeast SMF1.29,36 Attempts to express AtNRAMP3 and 4 in Xenopus oocytes to analyze the transport mechanism in more detail did not allow to record any significant metal currents (S. Thomine and J. Schoeder, unpublished).

NRAMP Gene Expression Pattern and Regulation in Plants The expression of plant NRAMP genes has been studied by Northern blot and promoter-reporter gene fusions. In contrast to the metal transporter genes from the ZIP family, IRT1 and IRT2, which are strictly root specific, several plant NRAMP genes are expressed both in roots and shoots (Table 2). Some members of the family are preferentially expressed in the roots (AtNRAMP1 and 2, LeNRAMP1 and 3 and OsNRAMP1) and others in the shoots (AtNRAMP3 and 4, OsNRAMP2 and 3). The preferential expression of plant NRAMP genes in the roots or shoots is independent of whether they belong to group I or to group II of the phylogenetic tree. For instance, OsNRAMP3 and AtNRAMP1 and LeNRAMP1 all belong to group I. OsNRAMP3 expression is stronger in the shoots whereas AtNRAMP1and LeNRAMP1 expressions are stronger in the roots21,22,37 (Table 2, Fig. 1). The expression of AtNRAMP5 is restricted to the reproductive organs in Arabidopsis.32 Consistent with its expression pattern restricted to root epidermal cells, IRT1 encodes the primary metal uptake transporter driving influx of iron from the soil into the root cells.14 In contrast the expression of NRAMP genes in both roots and shoots suggests that they participate in metal homeostasis in all plant organs. NRAMP2/DMT1/DCT1 plays an important role in iron uptake and recycling in mammalian cells. The expression of some NRAMP genes from Arabidopsis and rice can rescue the growth on low iron medium of the yeast mutant fet3fet4, which is defective in iron uptake (Table 1). To investigate the possible function of NRAMP in iron homeostasis in plants, several studies have tested the regulation of NRAMP expression under iron starvation conditions. In Arabidopsis, several NRAMP homologues are up-regulated in iron deficient plants. AtNRAMP1, AtNRAMP3 and AtNRAMP4 that can complement the Fe uptake mutant in yeast are up-regulated in the root system under iron starvation.22,23 This is a good indication that they function in iron homeostasis in plants. LeNRAMP1, the tomato homologue of AtNRAMP1 is also up-regulated under iron starvation.37 However, the expression of LeNRAMP3, the closest homologue of AtNRAMP3 in tomato, is insensitive to the iron nutrition status of the tomato (Fig. 1, Table 2).37 Interestingly, LeNRAMP1 activation under iron starvation is controlled by the fer gene.37 The tomato fer mutant fails to activate iron uptake responses under Fe starvation. The fer gene was recently cloned and encodes a transcription factor with a basic Helix Loop Helix (bHLH)

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

119

DNA binding domain.38 Transcription of LeNRAMP1 could well be one of the direct targets of fer action. In addition, LeNRAMP1 is up-regulated in the tomato mutant chloronerva, which behaves as constitutively iron starved plants.37,39 It will be interesting to analyze further the pathways that regulate NRAMP genes under Fe starvation. This can be done by monitoring NRAMP gene expression in known iron-response mutants or by selecting new Arabidopsis mutants defective in NRAMP induction under Fe starvation. It is also possible that some plant NRAMP genes are regulated by excess or starvation of other transition metal cations such as Zn, Mn or Cu. Our studies using transcriptional fusions between AtNRAMP promoters and the β-glucuronidase (GUS) gene have shown that AtNRAMP3 and AtNRAMP4 are expressed in the vascular tissues of roots and shoots.47 This suggests that they could be involved in the translocation of metals between different organs of the plant. Interestingly, these studies also revealed that the up-regulation of AtNRAMP gene expression under iron starvation occurs at the transcriptional level. Indeed the GUS reporter gene under the control of either AtNRAMP3 or AtNRAMP4 promoter is activated upon Fe starvation. This is in contrast with the control of iron regulated genes in mammals, which occurs at the post-transcriptional level and involves stabilization of mRNA mediated by IRE sequences (Iron Regulatory Elements).40,41 However, AtNRAMP regulation is in agreement with the regulation of other iron responsive genes such as IRT1, IRT2 and ferritin which have been shown to be regulated at the transcriptional level in response to iron starvation.14,42,43 Finally, AtNRAMP6 cDNA with the 6th intron unspliced have been isolated in three independent laboratories (L.E. Williams personal communication, S. Thomine unpublished, http:/ /www.rtc.riken.go.jp/). The presence of this intron introduces a premature stop codon in the protein and no functional AtNRAMP6 transporter can be translated from this cDNA. It is an attractive hypothesis that the production of AtNRAMP6 metal transporter could be regulated by differential splicing, depending on metal availability or other environmental conditions.

Analysis of NRAMP Functions in Plants The function of metal transporters of plant NRAMP homologs has been demonstrated by expression in Saccharomyces cerevisiae, however their roles in metal homeostasis in planta have not been fully elucidated yet. The function of AtNRAMP1 and 3 has been investigated by the analysis of plants in which NRAMP genes have been disrupted or overexpressed. Curie and collaborators have constructed Arabidopsis lines that overexpress AtNRAMP1 by transforming plants with a construct containing AtNRAMP1 cDNA under the control of the strong constitutive promoter CaMV35S from the Cauliflower Mosaic Virus (35SAtNRAMP1). These plants do not display any obvious phenotype when they are grown with sufficient iron (50 µM). However, when they are grown on high toxic concentrations of iron (0.3-0.8 mM), they appear to be significantly more resistant to iron toxicity than control plants.22 The same authors have also isolated plants carrying an insertion of the T-DNA from Agrobacterium tumefaciens in the AtNRAMP1 gene. In agreement with the phenotype of the CaMV35S-AtNRAMP1 Arabidopsis, the mutant plants homozygous for the disrupted AtNRAMP1 allele are hypersensitive to toxic iron concentrations.22 Taken together, these results point to a function of AtNRAMP1 in iron homeostasis in Arabidopsis. This function is likely mediated by the iron transport function of AtNRAMP1 demonstrated by complementation of the yeast iron uptake mutant, fet3fet4. However, these results do not support a role of AtNRAMP1 for iron uptake in plant cells. In this case, AtNRAMP1 overexpression would be predicted to lead to hypersensitivity rather than resistance to toxic iron concentrations. Computer predictions based on the proteomic analysis of the plastid envelope give a very high probability for the AtNRAMP1 protein to be located in plastids.44,45 This prediction needs to be supported by experimental determination of AtNRAMP1 subcellular localization. Together with the expression AtNRAMP1 gene in roots, its plastidial localization would raise the exciting hypothesis that plastids, which contain the iron storage protein phytoferritin,46

120

The Nramp Family

Figure 3. Models for AtNRAMP1 and AtNRAMP3 function. Predicted or experimentally determined membrane localizations of AtNRAMP proteins indicate a function in intracellular metal homeostasis.

participate in Fe homeostasis in plant roots (Fig. 3A). It will be interesting to investigate the metal content and distribution in plants overexpressing AtNRAMP1 or carrying a T-DNA insertion in this gene. We have used a parallel approach to analyze the function of AtNRAMP3 and AtNRAMP4 genes. Plants overexpressing AtNRAMP3 under the control of the 35SCaMV promoter did not display any obvious developmental phenotype when grown on complete plant medium. However, when they were grown on medium supplemented with cadmium, their root growth was hypersensitive to this toxic cation.23 Plants overexpressing AtNRAMP4 also displayed cadmium hypersensitivity (S. Thomine, unpublished results). In agreement with this result, an Arabidopsis mutant carrying a T-DNA insertion in AtNRAMP3 displayed a moderate but reproducible resistance to cadmium. These results show that AtNRAMP3 and AtNRAMP4 can modulate cadmium sensitivity in planta. This is in agreement with the results obtained by expressing this gene in yeast in which AtNRAMP3 increases cadmium sensitivity and cadmium content.23 These results suggest that AtNRAMP3 could be involved in cadmium uptake into plant cells or in mobilization of cadmium from a plant cell compartment where it is sequestered. However, measurement of metal content of AtNRAMP3 over-expressing or AtNRAMP3 mutant Arabidopsis did not show any detectable difference in their cadmium content when compared with control plants. Recently, we determined the subcellular localization of AtNRAMP3 by transient expression of AtNRAMP3-GFP fusion proteins. AtNRAMP3-GFP clearly localized to the vacuolar membrane.47 Our current working hypothesis is that AtNRAMP3 could modu-

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

121

late cadmium sensitivity with no modification of plant cadmium content by transporting cadmium from the vacuolar compartment, where it is sequestered, to the cytosol, where it is highly toxic (Fig. 3B).

Conclusions and Perspectives for the Analysis of Plant NRAMP Functions As their animal and yeast counterparts, plant NRAMP genes encode transition metal transporters with a broad selectivity. In the future, it will be important to determine whether they actually transport several transition metals in vivo or if physiological conditions or cofactors present in plant cells determine a narrower selectivity. Indeed, even though bacterial NRAMPs can transport Mn and Fe, their physiological function is restricted to Mn uptake.48 It is also remarkable that the different plant NRAMP transporters differ in their selectivity. For example, whereas AtNRAMP3 and 4 share 75% identity at the amino acid level, when expressed in yeast AtNRAMP4 can transport Zn but not AtNRAMP3. It will be interesting to identify the protein domains that confer transition metal selectivity. A significant objective would be for example to dissociate transport of toxic metals such as cadmium from transport of essential micronutrients metals such as Fe, Mn and Zn to engineer crop that do not accumulate toxic metals.1 Another important goal will be to determine whether the NRAMP homologous moiety of EIN2 is a functional metal transporter and to analyze its transport properties and regulation. Our current knowledge suggests that plant NRAMP encode intracellular metal transporters with putative subcellular localization as diverse as the plastid envelope or the vacuolar membrane. In the future, it will be important to determine systematically the subcellular localization of all plant NRAMP proteins. With such localizations, plant NRAMP proteins are expected to play important functions in intracellular metal homeostasis. However, the phenotypes of plants over-expressing AtNRAMPs or carrying disrupted alleles of AtNRAMP genes are rather subtle and can only be revealed upon treatment with the toxic metal cadmium or toxic concentrations of Fe. Given the high number of metal transporter families present in Arabidopsis, it is possible that compensation achieved by transporters from other families accounts for the lack of strong phenotypes in AtNRAMP knockout plants. Another attractive hypothesis is that there is redundancy within the NRAMP family and that knocking out more than one member of the family will be necessary to uncover the important physiological functions of plant NRAMPs. This hypothesis seems even more plausible when one considers the high number of NRAMP genes in plant genomes in comparison with yeast or mammalian genomes. It will be important to construct multiple knockout plant for several NRAMP genes to determine if severe phenotypes related to imbalances in metal homeostasis are revealed under these conditions. Compensation or redundancy can account for the lack of strong phenotypes in the NRAMP knockout mutants but they do not account for the subtle phenotypes of plant that strongly and ectopically overexpress NRAMP genes. It is important to note that the overexpression has only been checked at the mRNA level. It is possible that strong regulation of NRAMP proteins occurs at the protein level. Such regulation has been demonstrated for yeast and plant members of the ZIP family of metal transporters and also in the case of the yeast NRAMP homolog SMF1. Future studies should thus investigate the regulation of plant NRAMP protein synthesis and degradation. Finally, a combination of structure function analyses in heterologous expression systems, molecular genetic investigation in plants, cell biological and biochemical investigation of NRAMP protein stability and localization will provide a clearer image of NRAMP functions in plants and of their relationship with other transporters and chelators involved in metal homeostasis. The plant NRAMP family raises the question of the importance of dynamic metal compartmentalization in plant cells. The fine study of their cellular functions will require the development of new tools such as fluorescent dyes to monitor independently metal concentrations in different cell compartments.

122

The Nramp Family

Acknowledgments Research in the author’s laboratories was supported by CNRS and Génoplante funding to S. Thomine and NIEHS grant 1P42ES10337 to J.I. Schroeder.

References 1. Guerinot ML, Salt DE. Fortified foods and phytoremediation. Two sides of the same coin. Plant Physiol 2001; 125:164-167. 2. Marschner H, Romheld V. Strategies of Plants For Acquisition of Iron. Plant Soil 1994; 165:261-274. 3. Eide DJ. The molecular biology of metal ion transport in Saccharomyces cerevisiae. Ann Rev Nutr 1998; 18:441-69. 4. Mori S. Iron acquisition by plants. Curr Opin Plant Biol 1999; 2:250-253. 5. Curie C, Panaviene Z, Loulergue C et al. Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 2001; 409:346-349. 6. Brown J, Holden D. Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect 2002; 4:1149. 7. Expert D. Withholding and exchanging iron: Interactions Between Erwinia spp. and Their Plant Hosts. Ann Rev Phytopathol 1999; 37:307-334. 8. Williams LE, Pittman JK, Hall JL. Emerging mechanisms for heavy metal transport in plants. Biochim Biophys Acta 2000; 1465:104-126. 9. Mäser P, Thomine S, Schroeder JI et al. Phylogenetic relationships within cation transporter families of Arabidopsis. Plant Physiol 2001; 126:1646-1667. 10. Guerinot ML. The ZIP family of metal transporters. Biochim Biophys Acta-Biomemb 2000; 1465:190-198. 11. Hirschi KD, Korenkov VD, Wilganowski NL et al. Expression of arabidopsis CAX2 in tobacco. Altered metal accumulation and increased manganese tolerance. Plant Physiol 2000; 124:125-33. 12. Kushnir S, Babiychuk E, Storozhenko S et al. A Mutation of the Mitochondrial ABC Transporter Sta1 Leads to Dwarfism and Chlorosis in the Arabidopsis Mutant starik Plant Cell 2001; 13:89-100. 13. Eide D, Broderius M, Fett J et al. A novel iron-regulated metal transporter from plants identified by functional expression in yeast. Proc Natl Acad Sci USA 1996; 93:5624-5628. 14. Vert G, Grotz N, Dedaldechamp F et al. IRT1, an Arabidopsis Transporter Essential for Iron Uptake from the Soil and Plant Growth. Plant Cell 2002; 14:1223-1233. 15. Vulpe C, Levinson B, Whitney S et al. Isolation of a Candidate Gene For Menkes Disease and Evidence That It Encodes a Copper-Transporting ATPase. Nat Genet 1993; 3:273-273. 16. Hirayama T, Kieber JJ, Hirayama N et al. Responsive-to-antagonist1, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis. Cell 1999; 97:383-393. 17. Woeste KE, Kieber JJ. A strong loss-of-function mutation in RAN1 results in constitutive activation of the ethylene response pathway as well as a rosette-lethal phenotype. Plant Cell 2000; 12:443-455. 18. van der Zaal BJ, Neuteboom LW, Pinas JE et al. Overexpression of a novel Arabidopsis gene related to putative zinc-transporter genes from animals can lead to enhanced zinc resistance and accumulation. Plant Physiol 1999; 119:1047-1055. 19. Vidal SM, Malo D, Vogan K et al. Natural Resistance to Infection With Intracellular Parasites Isolation of a Candidate For Bcg. Cell 1993; 73:469-485. 20. Belouchi A, Cellier M, Kwan T et al. The Macrophage-Specific Membrane Protein Nramp Controlling Natural Resistance to Infections in Mice Has Homologues Expressed in the Root System of Plants. Plant Mol Biol 1995; 29:1181-1196. 21. Belouchi A, Kwan T, Gros P. Cloning and characterization of the OsNramp family from Oryza sativa, a new family of membrane proteins possibly implicated in the transport of metal ions. Plant Mol Biol 1997; 33:1085-1092. 22. Curie C, Alonso JM, Le Jean M et al. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem J 2000; 347:749-755. 23. Thomine S, Wang R, Ward JM et al. Cadmium and iron transport by members of a plant transporter gene family in Arabidopsis with homology to NRAMP genes. Proc Natl Acad Sci USA 2000; 97:4991-4996.

Plant Metal Transporters with Homology to Proteins of the NRAMP Family

123

24. Guzman P, Ecker JR. Exploiting the Triple Response of Arabidopsis to Identify Ethylene-Related Mutants. Plant Cell 1990; 2:513-523. 25. Alonso JM, Hirayama T, Roman G et al. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 1999; 284:2148-2152. 26. Kerppola RE, Ames GF. Topology of the hydrophobic membrane-bound components of the histidine periplasmic permease. Comparison with other members of the family. J Biol Chem 1992; 267:2329-36. 27. Bennetzen J. The rice genome. Opening the door to comparative plant biology. Science 2002; 296:60-3. 28. Supek F, Supekova L, Nelson H et al. yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93:5105-10. 29. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-8. 30. Dix DR, Bridgham JT, Broderius MA et al. The Fet4 Gene Encodes the Low Affinity Fe(Ii) Transport Protein of Saccharomyces Cerevisiae. J Biol Chem 1994; 269:26092-26099. 31. Desilva DM, Askwith CC, Eide D et al. The Fet3 Gene Product Required For High Affinity Iron Transport in Yeast Is a Cell Surface Ferroxidase. J Biol Chem 1995; 270:1098-1101. 32. Vaughan RJ, Logan-Smith MJ, Pittman J et al. AtNRAMP5 and AtNRAMP6, two putative transition metal transporters in Arabidopsis. The 12th International Workshop on Plant Membrane Biology Madison, Wisconsin; 2001; 232. 33. Zhao H, Eide D. The ZRT2 gene encodes the low affinity zinc transporter in Saccharomyces cerevisiae. J Biol Chem 1996; 271:23203-10. 34. Zhao H, Eide D. The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. PProc Natl Acad Sci USA 1996; 93:2454-8. 35. Hirayama T, Alonso JM. Ethylene captures a metal! Metal ions are involved in ethylene perception and signal transduction. Plant Cell Physiol 2000; 41:548-55. 36. Chen XZ, Peng JB, Cohen A et al. Yeast SMF1 mediates H+-coupled iron uptake with concomitant uncoupled cation currents. J Biol Chem 1999; 274:35089-35094. 37. Bereczky Z, Wang H-Y, Schubert V et al. Differential regulation of nramp and irt metal transporter genes in wild type and iron uptake mutants of tomato. J Biol Chem 2003; 278:24697-704. 38. Ling HQ, Bauer P, Bereczky Z et al. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc Natl Acad Sci USA 2002; 99:13938-43. 39. Ling HQ, Koch G, Baumlein H et al. Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotianamine synthase. Proc Natl Acad Sci USA 1999; 96:7098-103. 40. Casey JL, Hentze MW, Koeller DM et al. Iron-responsive elements: Regulatory RNA sequences that control mRNA levels and translation. Science 1988; 240:924-8. 41. Klausner RD, Rouault TA, Harford JB. Regulating the fate of mRNA: The control of cellular iron metabolism. Cell 1993; 72:19-28. 42. Petit JM, van Wuytswinkel O, Briat JF et al. Characterization of an iron-dependent regulatory sequence involved in the transcriptional control of AtFer1 and ZmFer1 plant ferritin genes by iron. J Biol Chem 2001; 276:5584-5590. 43. Vert G, Briat JF, Curie C. Arabidopsis IRT2 gene encodes a root-periphery iron transporter. Plant J 2001; 26:181-189. 44. Koo AJ, Ohlrogge JB. The predicted candidates of Arabidopsis plastid inner envelope membrane proteins and their expression profiles. Plant Physiol 2002; 130:823-36. 45. Ferro M, Salvi D, RiviereRolland H et al. Integral membrane proteins of the chloroplast envelope: Identification and subcellular localization of new transporters. Proc Natl Acad Sci USA 2002; 99:11487-92. 46. Briat JF. Roles of Ferritin in Plants. J Plant Nutr 1996; 19:1331-1342. 47. Thomine S, Lelièvre F, Debarbieux E et al. AtNRAMP3, a multispecific vacuolar metal transporter involved in plant responses to iron deficiency. Plant J 2003; 34:685-95. 48. Kehres DG, Zaharik ML, Finlay BB et al. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol Microbiol 2000; 36:1085-100.

124

The Nramp Family

CHAPTER 11

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis Edward Luk, Laran Jensen and Valeria Culotta

Abstract

T

he bakers yeast S. cerevisiae expresses three distinct Nramp metal transporters, namely Smf1p, Smf2p and Smf3p. Smf1p and Smf2p primarily function in manganese homeostasis, however these transporters are not redundant. Smf1p operates at the cell surface in the uptake of manganese. Smf2p resides in intracellular vesicles that play a critical role in supplying manganese to various compartments of the cell including the mitochondria and Golgi. Consistent with their role in manganese homeostasis, Smf1p and Smf2p are specifically induced under manganese starvation conditions. This induction involves changes in protein localization and protein stability. When manganese is plentiful, a regulatory protein in the endoplasmic reticulum (namely, Bsd2p) helps traffic Smf1p and Smf2p to the vacuole lumen where the transporters are degraded by vacuolar proteases. However, when cells are starved for manganese, Smf1p and Smf2p escape detection by Bsd2p and instead arrive at their proper destinations (Smf1p at the cell surface and Smf2p in the secretory pathway). This regulation by Bsd2p and manganese is a rapid method for adapting to changes in manganese ion availability. Unlike Smf1p and Smf2p, the third Nramp transporter of S. cerevisiae, Smf3p, plays no role in manganese homeostasis and is not regulated by manganese. This transporter instead functions in iron metabolism. Specifically, Smf3p is localized at the vacuolar membrane where it helps mobilize vacuolar stores of iron for cell utilization. Accordingly, Smf3p is induced by iron starvation and this induction involves changes in SMF3 mRNA levels and iron regulatory elements in the promoter region of the SMF3 gene. SMF3 is also regulated by oxygen at the mRNA level and this dual regulation by oxygen and iron helps to minimize iron toxicity which can be exasperated by oxidative stress. Overall, the S. cerevisiae Nramp metal transporters provide an excellent example for how three seemingly similar molecules can evolve with quite disparate functions.

Overview The bakers yeast S. cerevisiae has become an ideal organism in which to examine the function of Nramp metal transporters in the uptake and intracellular trafficking of metals. This yeast expresses three functionally distinct forms of the transporters that have been named Smf1p, Smf2p and Smf3p. In spite of their close homology to one another, these three molecules operate in distinct cellular compartments to differentially affect the transport and intracellular trafficking of iron and manganese ions, and to a lesser extent, cobalt and copper. The goals of this particular review are three-fold: (i) to provide a historical perspective on how the three different Nramp transporters of yeast were identified (ii) to elaborate on the distinct function and cellular localization of Smf1p, Smf2p and Smf3p, and (iii) to describe how these

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis

125

transporters are differentially regulated in response to metal ions. In general, the S. cerevisiae Nramp transporters provide a clear example of how structurally similar molecules can evolve to function in divergent pathways.

Historical Perspective: Why the Name SMF? With S. cerevisiae, new genes or new protein functions are often identified in a serendipitous manner, i.e., by sheer accident. Such is the case for the Nramp transporters of bakers yeast. In 1992, A. Horwich and colleagues at Yale University were searching for S. cerevisiae genes that function in import of proteins into mitochondria.1 Their genetic screen employed a “mif1-1” yeast mutant which expresses a mutant form of the mitochondrial peptidase needed for protein import into mitochondria. Horwich and colleagues identified two genes, which when expressed to very high levels in yeast, suppressed the protein processing defect associated with the mif1 mutant. These genes were reported to encode hydrophobic proteins that are highly homologous to one another. Dr. Horwich named these two proteins Smf1p and Smf2p for suppressor of mif1. It was hypothesized that these factors function in protein translocation into mitochondria.1 These same two proteins were later noted by M. Cellier and P. Gros to represent members of a very large family of membrane proteins that are well conserved throughout evolution, but with function unknown at the time.1 The first evidence that Smf1p and Smf2p were actually metal transporters emerged from elegant studies in the laboratory of N. Nelson. His colleague F. Supek discovered that smf1∆ mutants of yeast were very sensitive to the metal chelator EGTA and that this sensitivity could be suppressed by supplementing the growth medium with high concentrations of manganese.2 Moreover, the Smf1 polypeptide was localized to the plasma membrane and when expressed to high levels in yeast, increased the high affinity uptake of manganese from the growth medium. Supek and Nelson defined Smf1p as the high affinity manganese transporter for yeast, and were the first to propose that Nramp proteins from various organisms actually function in metal ion transport.2 If Smf1p is indeed a manganese transporter, then what is the connection to mitochondrial protein import? Supek and Nelson noted that the defect of mif1-1 mutants could also be rescued by supplementing high manganese to the growth medium and proposed that manganese serves as the co-factor for the mutant peptidase encoded by mif1-1.2 Hence, over-expression of SMF1 and SMF2 bypasses the mitochondrial import defect by increasing manganese availability to the metal requiring peptidase.3 Smf1p and Smf2p are not the only Nramp transporters of yeast and the first reports of a third Nramp homologue (Smf3p) appeared in 2000 by N. Nelson4 and by our group.5 In both cases, the protein was identified on the basis of its strong homology (almost 50% identity) to Smf1p and Smf2p. As described below, Smf3p functions divergently from Smf1p and Smf2p in the homeostasis of iron atoms, not manganese.

The Function of S. cerevisiae Smf1p Many of the original studies conducted with Smf1p metal transport employed conditions where the protein is over-expressed. In their initial manganese transport studies, Nelson and colleagues observed a 5-10 fold increase in cell surface uptake of manganese when SMF1 was over-expressed.2 However, a deletion in the single chromosomal copy of SMF1 has only a marginal effect on manganese accumulation2,6 suggesting that Smf1p is not the sole source for manganese uptake under normal growth conditions. Smf1p is capable of transporting other metals as well. Yeast cells expressing high levels of Smf1p accumulate elevated manganese, cadmium and copper.7 Moreover, in a Xenopus oocyte expression system, Nelson and colleagues demonstrated that Smf1p can transport iron and zinc.8,9 These studies in oocytes were critical in elucidating a metal-proton co-transport activity for Smf1p.8,9 Hence, as is the case with Nramp transporters from other organisms (e.g., mammalian DMT1/DCT1/Nramp210), S. cerevisiae Smf1p is a proton coupled metal transporter capable of translocating a wide array of divalent heavy metals.

126

The Nramp Family

Figure 1. Smf1p and Smf2p in Manganese Trafficking. Shown is a model for the functioning of Smf1p and Smf2p at the cell surface and intracellular vesicles, respectively. The two molecules both transport manganese in the direction of the cytosol. The Smf2p-vesicles act as a central branching point in manganese trafficking. Under both physiological (left) and manganese starvation conditions (right), Smf2p is essential for trafficking manganese to downstream targets such as SOD2 in the mitochondria (Mito) and sugar transferases (STases) in the Golgi. By comparison, Smf1p is not required under physiological conditions, as other unknown, presumably low affinity, transporter(s) indicated by “?” also contribute to manganese uptake (left side). However, under manganese starvation conditions, Smf1p becomes essential for high affinity uptake of manganese (right side). Black spheres represent membrane transporters for manganese. Solid arrows indicate the trafficking of manganese.

If Smf1p can transport such diverse metals, then what is its physiological substrate in yeast? As one suggestion, Smf1p was proposed to function in copper and iron uptake.4 However, we found that deletions in SMF1 do not perturb copper accumulation or intracellular copper trafficking even when the high affinity copper uptake systems were absent.11 We also failed to notice any symptoms of iron deficiency in strains lacking SMF1 5. Mutants of smf1 do however exhibit a striking sensitivity towards the metal chelator EGTA2,4,9 particularly under oxidative stress conditions,12,13 and this phenotype is efficiently rescued by manganese supplements. Intracellular manganese complexes can act as anti-oxidants14-16 and as such, cells become very prone to oxidative stress when manganese is depleted through the combination of smf1 mutations and metal chelator treatment. We therefore propose that the physiological function of Smf1p is to contribute to manganese uptake when cells are starved for this metal, e.g., by depleting manganese with EGTA. Consistent with this role in manganese transport, Smf1 protein levels are strongly induced by starving cells for manganese, but not other metals5,7,13,17 (see below). Although Smf1p may be critical for manganese uptake when the metal is limiting, under physiological conditions where manganese is in surplus, Smf1p is not the limiting transporter of cellular manganese and other transporters must be at play (Fig. 1).

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis

127

Smf2p as a Manganese Transporter There are many parallels that can be drawn between S. cerevisiae Smf1p and Smf2p. First, over-expression of SMF2 leads to high manganese accumulation4 and can suppress the mitochondrial peptidase defect of mif1 mutants.1 As with Smf1p, Smf2 protein levels are strongly regulated by manganese ions5 (see below). Smf2p can also act in the transport of other metals such as iron and cobalt.4,7,9 However, unlike smf1 mutations, a deletion of SMF2 in yeast leads to a profound defect in manganese ion accumulation and trafficking under all growth conditions tested. Even when manganese is plentiful in the growth medium, yeast cells absolutely rely on Smf2p for proper homeostasis of manganese.6 There are two manganese dependent processes in eukaryotic cells that we have exploited to examine the requirement for Smf2p in manganese accumulation and trafficking. First, a superoxide dismutase enzyme (SOD2) that resides in the mitochondria requires manganese for activity; hence SOD2 activity provides a read-out for mitochondrial manganese. Secondly, sugar transferases in the Golgi require manganese and the glycosylation of secreted enzymes such as invertase serves as an excellent marker for Golgi manganese.18 Using these two assays, we found that cells lacking Smf2p are defective in the delivery of manganese to both SOD2 in the mitochondria and to the sugar transferases in the secretory pathway.6 In fact, smf2 mutants accumulate very low levels of total cellular manganese, explaining the lack of manganese availability to both the mitochondria and Golgi.6 These manganese related-defects were specific to smf2 mutants and not seen with cells containing mutations in either SMF1 or SMF3. Moreover, smf2 mutants exhibited defects in manganese accumulation and manganese-requiring enzymes even when cells were grown in enriched medium containing ample manganese.6 Therefore, S. cerevisiae Smf2p appears to be a limiting source for cellular manganese. Since smf2 mutants accumulate low levels of manganese, one would expect this transporter to reside at the cell surface and act in the direct uptake of manganese from the growth medium. However, under no conditions were we able to demonstrate a cell surface localization for Smf2p. Instead Smf2p appears to localize to intracellular vesicular structures, reminiscent of yeast Golgi.5 This localization did not change in yeast mutants blocked for endocytosis,6 excluding a transient residence for Smf2p at the cell surface. Although the identity of the Smf2p-containing vesicles has not been established, these structures are presumably acidic in nature due to the known proton requirement for Smfp metal transport.8,9 Furthermore, since Smf2p helps deliver manganese to both the mitochondria and Golgi, these vesicles may be a central branch point in manganese trafficking, transiently holding the metal prior to its subsequent trafficking to downstream targets (Figs. 1, 2). In this regard, the Smf2p-vesicles may function analogously to the DMT1-containing endosomes of mammals.19,20

Smf3p as an Iron Transporter The third Nramp transporter is quite distinct from Smf1p and Smf2p in that it plays no obvious role in manganese trafficking in yeast and is not regulated by manganese ions.5 Instead, this transporter functions in the metabolism of iron atoms. A smf3 null mutant strain exhibits symptoms of iron starvation.5 Specifically, the Aft-transcriptional regulon that is known to be induced by iron starvation21 is up-regulated in strains containing smf3 mutations.5 Even so, total iron levels are not greatly affected in this strain, suggesting that iron availability rather than total iron is reduced in the smf3 mutant. We find that Smf3p localizes to the vacuolar membrane of yeast.5 Based on topology predictions and topology mapping experiments with an epitope tagged version of Smf3p, the transporter is predicted to transport the metal out of the vacuole and into the cytosol.5 Since the vacuole of yeast is quite acidic, this direction of metal transport is completely consistent with the proton coupled transport activity of Nramp transporters. Taking these findings together, we have proposed a model in which Smf3p helps to mobilize vacuolar stores of iron for utilization by the cell. The targets for Smf3p transported iron are not all understood, but the Aft transcription factors are presumably in this list, since their activity is greatly affected by smf3 mutations5 (Fig. 2).

128

The Nramp Family

Figure 2. Yeast Nramp transporters in manganese and iron homeostasis. An overview of how the three SMF homologues operate at distinct cellular sites to differentially regulate intracellular trafficking of manganese and iron. Smf1p functions at the cell surface and is an important player in manganese uptake especially under manganese starvation conditions. Smf2p functions downstream of Smf1p at intracellular compartments and is indispensable for transporting manganese to the mitochondria and the Golgi where the metal activates mitochondrial SOD2 and sugar transferases (STase) in the Golgi. Smf3p regulates iron homeostasis. This Nramp transporter localizes to the vacuolar membrane and helps mobilize stores of irons in the vacuole. Inactivation of Smf3p induces the iron transcriptional regulon, presumably by loss of iron binding to the Aft1 and Aft2 transcription factors in the nucleus. Solid arrows indicate the trafficking of metal ions.

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis

129

Using Yeast as a Model to Study Nramp Metal Transport from Diverse Species The ease by which yeast can be manipulated biochemically and genetically and the efficiency of heterologous gene expression in this organism has made S. cerevisiae an attractive organism for analyzing Nramp transporters from diverse eukarytoes. For example, E. Pinner in the laboratory of P. Gros was able to complement the EGTA sensitivity of a smf1 smf2 double mutant by expression of human Nramp2 (also known as DMT1/DCT1), but not Nramp1.12 Based on this, the authors concluded that Nramp2 can function in manganese transport, at least when expressed in yeast. In a separate study, complementation of the smf1-EGTA sensitivity was achieved by expression of cDNAs encoding three distinct Nramp transporters of the plant Arabidopsis.22 Thus the plant Nramp transporters can also function in manganese transport based on this analysis. In addition to eukaryotic Nramp transporters, John Voss and co-workers have very recently succeeded in complementing a smf1 smf2 smf3 yeast mutant by expression of Nramp from pathogenic M. leprae, exemplifying the strong conserved nature of Nramp transporters from bacteria to eukaryotes.23 The bakers yeast has additionally been used as a model system to examine the iron uptake capacity of heterologous Nramp transporters. In this case, yeast mutants defective in high affinity iron uptake were utilized rather than the mutants of smf. The iron deficiency of such iron uptake mutants was efficiently rescued by expression of Nramp transporters from the plants Arabidopsis thaliana and Oriza sativa 22,24 and by human DMT1 (Nramp2).25

Post-Translation Regulation of SMFs by Manganese As mentioned above, S. cerevisiae Smf1p and Smf2p are strongly induced under manganese starvation conditions. This regulation is not transcriptional, but rather occurs at the post-translational level through changes in protein localization and protein turnover. This novel method of gene regulation by manganese was uncovered in a serendipitous manner as follows: In 1992, we initiated a genetic search for new anti-oxidant pathways and isolated gene mutations that suppress oxidative damage in yeast cells lacking superoxide dismutase.26 One such gene cloned was S. cerevisiae BSD2 (for bypass superoxide dismutase defect)27 and we noted that inactivation of BSD2 rescued oxidative damage through a mechanism involving manganese ions. As mentioned above, complexes of manganese have anti-oxidant properties and bsd2 mutants accumulated high levels of manganese, as well as other metals.7 This accumulation of divalent metals was found to occur through up-regulation of Smf1p and Smf2p.7 Bsd2p normally down regulates Smf1p and Smf2p in response to manganese, and in bsd2 mutant strains, the uptake of divalent metals via Smf1p and Smf2p becomes very high.7 In essence, our search for new-antioxidant pathways surprisingly revealed a novel pathway for metal regulated gene expression. How do Bsd2p and manganese ions negatively regulate Smf1p and Smf2p? Bsd2p resides in the endoplasmic reticulum7 where it works to modulate the trafficking of Smf1p and Smf2p through the secretory pathway.5,17 When intracellular manganese is high, Bsd2p helps direct much of Smf1p and Smf2p to the yeast vacuole where these transporters are degraded by vacuolar proteases. (Fig. 3) However, when cells are starved for manganese, Smf1p and Smf2p are not recognized by Bsd2p and are not degraded in the vacuole; instead the transporters move to either the cell surface (in the case of Smf1p) or to intracellular vesicles (Smf2p) where they function in metal ion transport.5,17 (Fig. 3) Such shifts in protein localization require a transport-competent molecule. Mutants of the Smf1 polypeptide that cannot transport manganese are not trafficked to the vacuole by Bsd2p and are also not directed to the cell surface in response to manganese starvation.13 Apparently only the transport-competent form of Smf1p can adopt the necessary conformations that enable control by Bsd2p and manganese.

130

The Nramp Family

Figure 3. Post-translational regulation of Smf1p and Smf2p by Bsd2p. Shown are models for the differential trafficking of Smf1p and Smf2p through the secretory pathway. Under high manganese concentrations (left), Smf1p and Smf2p adopt conformations that are detected by Bsd2p in the endoplasmic reticulum (ER); recognition by Bsd2p results in the movement of Smf1p and Smf2p to the vacuole for degradation. When manganese becomes limited (right), Smf1p and Smf2p adopt an alternative conformation that is not recognized by Bsd2p. The transport proteins are instead targeted to the cell surface and intracellular vesicles, respectively. Hedged arrows indicate the movements of Smf1p and Smf2p through the secretory pathways.

It would appear that Bsd2p has evolved to specifically control the trafficking of fungal Nramp transporters. S. pombe expresses a Bsd2p homologue (accession number NP_594209), but there are no known homologues in mammals. In S. cerevisiae, the only non-Smf target for Bsd2p is a mutant form of the cell surface proton ATPase, encoded by pma1-7. The wild type ATPase resides at the plasma membrane, but mutant Pma1-7p is targeted to the vacuole in a Bsd2p-dependent manner.28 Apparently, the mutant protein adopts a conformation that is recognized by Bsd2p in a manner similar to Smf1p and Smf2p. Overall, the control of yeast Smf1p and Smf2p by manganese and Bsd2p is a clever method for regulating metal transport in response to metal ion availability. Since the Nramp transporters can act on toxic metals as well, it seems imperative to keep Smf expression levels low to minimize metal toxicity. Indeed, bsd2 mutants that express high levels of Smf1p and Smf2p are exquisitely sensitive to toxicity from cadmium and copper.7,27 The post-translational repression by Bsd2p also allows for rapid adaptation to changes in metal conditions. When cells are starved for manganese, they quickly up-regulate manganese transport through changes in Smf protein localization. (Fig. 3) It is quite an efficient design. Lastly, post-translational regulation appears to be the preferred method of manganese regulation in yeast. Unlike, zinc, iron and copper, which can modulate gene expression at the level of transcription,29-37 our preliminary microarray studies have failed to yield an obvious transcriptional regulon for manganese (unpublished information, Luk and Culotta). Although the basis is not yet clear, the post-translational regulation by manganese may reflect cellular compartmentalization of the metal. In eukaryotes, a significant fraction of the cellular manganese is directed to the secretory pathway where it is needed to activate sugar transferase enzymes.38-42 Perhaps this preferential targeting of manganese to the secretory pathway facilitates Bsd2p control of Smf1p and Smf2p at the level of protein trafficking.

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis

131

Transcriptional Regulation of SMF3 by Fe The third Nramp transporter of yeast, Smf3p, fails to show any regulation by Bsd2p and manganese ions. Smf3p is a transporter of the vacuolar membrane and its localization does not change with metal starvation or in bsd2 mutants.5 Although SMF3 is not regulated by manganese, the polypeptide levels are induced under iron starvation conditions, and this regulation occurs through changes in mRNA. Smf3p is -50% identical in amino acid sequence to Smf1p and Smf2p; thus it is not obvious why this Nramp transporter would escape regulation by Bsd2p. Smf3p however is missing an N-terminal extension present in Smf1p and Smf2p.5,43 Nelson and co-workers have shown that deletion of this N-terminus in Smf1p enhances manganese uptake,4 suggestive of a regulatory role. However, we find that this N-terminal region is not sufficient to confer regulation by Bsd2p and manganese43 and therefore, other regions of the Smf1 and Smf2 polypeptides must be involved. As described above, the iron regulation of SMF3 occurs at the level of gene transcription. We have identified two distinct regions of the SMF3 gene promoter that are necessary for this regulation: sequences ≈-435 to-350 that contain dual consensus binding sites for the Aft1 iron regulatory factor; and sequences -348 to –247 that do not contain obvious Aft1 binding sites.43 Aft1p and Aft2p are iron sensing transcription factors in yeast that induce a wide array of iron homeostasis genes in response to iron starvation.21,36,44 SMF3 is a member of this “Aft iron regulon”,36 but in addition, an Aft-independent pathway for iron control of SMF3 exists.43 The basis for this second pathway is unknown. Besides its regulation by iron, SMF3 is also induced under anaerobic conditions45,46 and this regulation by oxygen involves an oxygen-sensing repressor in yeast known as Rox1p.47,48 Smf3p is not the only iron transporter that is negatively regulated by both iron and oxygen, and the S. cerevisiae Fet4p low affinity iron transporter is also regulated by Rox1p and iron starvation.45 This dual control of iron transport by iron and oxygen helps to minimize the bioavailability of toxic iron atoms that are particularly detrimental to cells under oxidative stress conditions.45

Overview The Nramp transporters of S. cerevisiae provide an excellent example for how three very similar transport molecules have evolved to function differentially. Smf1p and Smf2p both function in manganese transport, but these two transporters are not redundant. Smf1p operates at the cell surface to facilitate manganese uptake whereas Smf2p resides in intracellular vesicles to control manganese trafficking. Smf1p is not the only port of entry for the metal and other as of yet elusive, transporters also contribute to cell surface uptake of manganese. (Fig. 1) By comparison, Smf2p plays an essential role in manganese trafficking to various cellular sites including the Golgi and mitochondria, and there appears to be little, if any back-up system for Smf2p. In essence, Smf2p appears to be a “gate keeper” for manganese. The third Nramp transporter, Smf3p, exhibits no obvious role in manganese transport but rather functions in iron homeostasis. Smf3p is one of the critical transporters for mobilizing vacuolar stores of iron (Fig. 2). Like Nramps from other organisms, fungal Smf transporters have the capacity to transport a broad range of heavy metals including copper, cobalt, cadmium and zinc.7-9 Why then, do we only observe physiological roles in manganese and iron trafficking? Specifically, smf gene deletions only perturb homeostasis of manganese and iron, not other metals. We propose that the functional specificity is in part, afforded at the level of metal regulation: Smf1p and Smf2p are only appreciably produced under conditions of manganese starvation and Smf3p is induced by iron depravation. Once intracellular levels of manganese and iron are raised, levels of the Smf polypeptides are reduced to minimize transport of unwanted toxic metals. It is also possible that the yeast Nramp transporters act on available copper and zinc, however with the presence of other high affinity transport systems for these ions,49-51 the Smfs may contribute very little to copper and zinc physiology.

132

The Nramp Family

As a remaining question: how do three seemingly similar polypeptides function at three distinct locations in the cell and are differentially regulated by metals? The answer certainly lies in subtle differences in the corresponding polypeptide sequences. Future structure-function analyses should unravel the underlying diversity of S. cerevisiae Nramps.

Acknowledgements The work described in this review was in part supported by the JHU NIEHS center and by NIH grant ES 08996.

References 1. West AH, Clark DJ, Martin J et al. Two related genes encoding extremely hydrophobic proteins suppress a lethal mutation in the yeast mitochondrial processing enhancing protein. J Biol Chem 1992; 267:24625-24633. 2. Supek F, Supekova L, Nelson H et al. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93:5105-5110. 3. Supek F, Supekova L, Nelson H et al. Function of metal-ion homeostasis in the cell division cycle, mitochondrial protein processing, sensitivity to mycobacterial infection and brain function. J Exp Biol 1997; 200:321-330. 4. Cohen A, Nelson H, Nelson N. The family of SMF metal ion transporters in yeast cells. J Biol Chem 2000; 275:33388-94. 5. Portnoy ME, Liu XF, Culotta VC. Saccharomyces cerevisiae expresses three functionally distinct homologues of the Nramp family of metal transporters. Mol Cell Biol 2000; 20:7893-7902. 6. Luk E, Culotta VC. Manganese superoxide dismutase in S. cerevisiae acquires its metal co-factor through a pathway involving the Nramp metal transporter, Smf2p. J Biol Chem 2001; 276:47556-47562. 7. Liu XF, Supek F, Nelson N et al. Negative control of heavy metal uptake by the Saccharomyces cerevisiae BSD2 gene. J Biol Chem 1997; 272:11763-11769. 8. Sacher A, Cohen A, Nelson N. Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J Exper Biol 2001; 204:1053-1061. 9. Chen XZ, Peng JB, Cohen A et al. Yeast SMF1 mediates H(+)-coupled iron uptake with concomitant uncoupled cation currents. J Biol Chem 1999; 274:35089-35094. 10. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-488. 11. Portnoy ME, Schmidt PJ, Rogers RS et al. Metal transporters that contribute copper to metallochaperones in Saccharomyces cerevisiae. Mol Gen Genet 2001; 265:873-882. 12. Pinner E, Gruenheid S, Raymond M et al. Functional complementation of the yeast divalent cation transporter family SMF1by NRAMP2, a member of the mammalian natural resistance- associated macrophage protein family. J Biol Chem 1997; 272:28933-28938. 13. Liu XF, Culotta VC. Mutational analysis of Saccharomyces cerevisiae Smf1p, a member of the Nramp family of metal transporters. J Mol Biol 1999; 289:885-891. 14. Archibald FS, Fridovich I. The scavenging of superoxide radical by manganous complexes in vitro. Arch. Biochem Biophys 1982; 214:452-463. 15. Archibald FS, Fridovich IJ. Manganese and defenses against oxygen toxicity in Lactobacillus plantarum. J Bacteriol 1981; 145:422-451. 16. Chang EC, Kosman DJ. Intracellular Mn(II)-associated superoxide scavenging activity protects Cu,Zn superoxide dismutase-deficient Saccharomyces cerevisiae against dioxygen stress. J Biol Chem 1989; 264:12172-12178. 17. Liu XF, Culotta VC. Post-translational control of Nramp metal transport in yeast: role of metal ions and the BSD2 gene. J Biol Chem 1999; 274:4863-4868. 18. Rudolph HK, Antebi A, Fink GR et al. The yeast secretory pathway is perturbed by mutations in PMR1, a member of a Ca+2-ATPase family. Cell 1989; 58:133-145. 19. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189:831-41. 20. Tabuchi M, Yoshimori T, Yamaguchi K et al. Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 2000; 275:22220-22228.

The Role of Yeast Nramp Metal Transporters in Manganese and Iron Homeostasis

133

21. Yamaguchi-Iwai Y, Dancis A, Klausner R. AFT1: a mediator of iron regulated transcriptional control in Saccharomyces cerevisiae. EMBO J 1995; 14:1231-1239. 22. Thomine S, Wang R, Ward JM et al. Cadmium and iron transport by members of a plant metal transporter family in arabidopsis with homology to nramp genes. Proc Natl Acad Sci USA 2000; 97:4991-6. 23. Reeve I, Hummell D, Nelson N et al. Overexpression, prification and sitedirected spin labeling of the Nramp metal transporter from Mycobacterium leprae. Proc Natl Acad Sci USA 2002; 99:8608-8613. 24. Curie C, Alonso JM, Jean ML et al. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem J 2000; 347:749-55. 25. Bannon DI, Portnoy ME, Lees PSJ et al. Uptake of lead and iron by divalent metal transporter 1 in yeast and mammalian cells. Biochem Biophys Res Commun 2002; 295:978-984. 26. Liu XF, Elashvili I, Gralla EB et al. Yeast lacking superoxide dismutase: isolation of genetic suppressors. J Biol Chem 1992; 267:18298-18302. 27. Liu XF, Culotta VC. The requirement for yeast superoxide dismutase is bypassed through mutations in BSD2, a novel metal homeostasis gene. Mol Cell Biol 1994; 14:7037-7045. 28. Chang A, Fink GR. Targeting of the yeast plasma membrane [H+] ATPase: a novel gene AST1 prevents mislocalization of mutant ATPase to the vacuole. J Cell Biol 1995; 128:39-49. 29. Lyons TJ, Gasch AP, Gaither LA et al. Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc. Natl Acad Sci USA 2000; 97:7957-7962. 30. Zhao H, Eide D. Zap1p, a metalloregulatory protein involved in zinc-responsive transcriptional regulation in Saccharomyces cerevisiae. Mol Cell Biol 1997; 17:5044-5052. 31. Furst P, Hu S, Hackett R et al. Copper activates metallothionein gene transcription by altering conformation of a specific DNA binding protein. Cell 1988; 55:705-717. 32. Thiele D. Ace1 regulates expression of the Saccharomyces cerevisiae metallothionein gene. Mol Cell Biol 1988; 8:2745-2752. 33. Gross C, Kelleher M, Iyer VR et al. Identification of the copper regulon in Saccharomyces cerevisiae by DNA microarrays. J Biol Chem 2000; 275:32310-32316. 34. Jungmann J, Reins H, Lee J et al. MAC1, a nuclear regulatory protein related to Cu-dependent transcription factors is involved in Cu/Fe utilization and stress resistance in yeast. EMBO J 1993; 13:5051-5056. 35. Blaiseau P, Lesuisse E, Camadro J. Aft2p, a novel iron-regulated transcription activator that modulates, with Aft1p, intracellular iron use and resistance to oxidative stress in yeast. J Biol Chem 2001; 276:34221-34226. 36. Rutherford J, Ray E, Brown PO et al. A second iron-regulatory system in yeast independent of Aft1. Proc Natl Acad Sci USA 2001; 98:14322-14327. 37. Yamaguchi-Iwai Y, Stearman R, Dancis A et al. Iron-regulated DNA binding by the AFT1 protein controls the iron regulon in yeast. EMBO J 1996; 15:3377-3384. 38. Kuhn NJ, Ward S, Leong WS. Submicromolar manganese dependence of Golgi vesicular galactosyltransferase. Eur J Biochem 1991; 195:243-250. 39. Ram BP, Munjal DD. Galactosyltransferases: physical, chemical and biological aspects. CRC Crit Rev Biochem 1985; 17:257-311. 40. Rayner JC, Munro S. Identification of the MNN2 and MNN5 mannosyltransferases required for forming and extending the mannose branches of the outer chain mannans of Saccharomyces cerevisiae. J Biol Chem 1998; 273:26836-43. 41. Durr G, Strayle J, Plemper R et al. The medial-Golgi ion pump Pmr1 supplies the yeast secretory pathway with Ca 2+ and Mn 2+ required for glycosylation, sorting, and endoplasmic reticulum-associated protein degradation. Molec Biol Cell 1998; 9:1149-1162. 42. Ton VK, Mandal D, Vahadji C, Rao R. Functional expression in yeast of the human secretory pathway Ca 2+ , Mn 2+ -ATPase defective in Hailey-Hailey disease. J Biol Chem 2002; 277(8):6422-6427. 43. Portnoy ME, Jensen LT, Culotta VC. The distinct methods by which manganese and iron regulate the Nramp transporters in yeast. Biochem J 2002; 362:119-124. 44. Casas C, Aldea M, Espinet C et al. The AFT1 transcriptional factor is differentially required for expression of high-affinity iron uptake genes in Saccharomyces cerevisiae. Yeast 1997; 13:621-37. 45. Jensen LT, Culotta VC. Regulation of S. cerevisiae FET4 gene expression by iron and oxygen. J Mol Biol 2002; 318:251. 46. Linde JJM, Liang H, Davis RW et al. Genome-wide transcriptional analysis of aerobic and anaerobic chemostat cultures of Saccharomyces cerevisiae. J Bacteriol 1999; 181:7409-7413. 47. Kastaniotis AJ, Zitomer RS. Rox1 mediated repression. Oxygen dependent repression in yeast. Adv Exp Med Biol 2000; 475:185-195.

134

The Nramp Family

48. Balasubramanian B, Lowry CV, Zitomer RS. The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif. Mol Cell Biol 1993; 13:6071-6078. 49. Dancis A, Yuan S, Haile D et al. Molecular characterization of a copper transport protein in S. cerevisiae; an unexpected role for copper in iron transport. Cell 1994; 76:393-402. 50. Knight S, Labbe S, Kwon LF et al. A widespread transposable element masks expression of a yeast copper transport gene. Genes and Develop 1996; 10:1917-1929. 51. Zhao H, Eide D. The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. Proc Natl Acad Sci USA 1996; 93:2454-2458.

Metal-Ion Transporters: From Yeast to Human Diseases

135

CHAPTER 12

Metal-Ion Transporters: From Yeast to Human Diseases Adiel Cohen, Hannah Nelson and Nathan Nelson

Abstract

T

ransition metal ions such as copper, iron, manganese and zinc serve as essential cofac tors for a variety of biological processes including cell energetics, gene regulation and control of free radicals. However, these essential nutrients, are toxic at elevated levels. Therefore metal ion transporters play a crucial role in maintaining the vital metal-ions’ homeostasis. The yeast (Saccharomyces cerevisiae) metal transporters SMFs and their homologues in other organisms (NRAMP-related transporters) play a central role in the accumulation of metal ions in different tissues and distinct cellular organelles. The use of yeast as an eukaryotic model system facilitated the study of these metal ion transporters and served also as a heterologous expression system through complementation of various yeast null mutants with related genes. For this end, we generated mutant yeast strains with null mutations in each individual SMF gene as well as in all combinations of the three genes. The triple null mutant smf1,2,3∆ can not grow on medium with reduced divalent metal ions concentration (containing EGTA) or medium buffered at pH 7.5. The yeast Smf1p and the mammalian transporter DCT1 suppress the above phenotype and allow growth in the presence of EGTA or at pH 7.5. The Mycobacterium leprae transporter NRMIT suppresses the EGTA sensitivity of the mutant smf3∆. Both yeast and mammalian transporters were expressed in Xenopus oocytes and the uptake activity as well as the electrophysiological properties of Smf1p and DCT1 were studied. A novel clutch mechanism of slippage that operates via continuously variable stoichiometry between the driving force pathway (H+) and the transport pathway (divalent metal ions) was proposed. The possible physiological advantage of proton slip through DCT1 and sodium slip through Smf1p is discussed. The mechanism of metal ion transport of those transporters is essential for understanding of certain human diseases.

Introduction Factors controlling metal ion transport across cellular membranes, intracellular homeostasis and regulatory responses of cells to changing environmental supply of divalent metal ions, have been subjects to many studies in recent years (ref. 1 for reviews). Of particular interest were divalent trace metals like Cu2+, Mn2+, Fe2+, Zn2+ because of their important role in cell metabolism, especially as cofactors of many enzymes. Usually their intracellular concentration is kept at a low, rather constant physiological level by a number of transporters, sensor systems, storage proteins and chaperones. These physiological levels can be disturbed in several ways, which frequently lead to severe disease phenotypes. Genetic disorders as well as malnutrition can be the cause for suboptimal concentrations and, sometimes, for accumulation of these essential ions in cells.

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

136

The Nramp Family

Toxic metals like Cd2+, Co2+ and Ni2+ can be a major threat to the health of mammals and could suppress plants growth, mostly because they interfere in various ways with transport, homeostasis or function of the essential metals. To minimize their deteriorating effects cells have developed various strategies, among which transport or sequestration into organelles and binding by thiols are most prominent.1-4 A specific set of transporters functions in each cellular compartment to provide a delicate balance of transport activities across their membranes.5,6 Because metal-ions are vital for several life processes, and their action also inflicts damage on DNA and proteins, their proper distribution is vital and a slight alteration in their activity could cause severe disease. For example, abnormal iron uptake has been implicated in the most common hereditary disease hemochromatosis, as well as in neurological diseases such as Parkinson’s disease, Friedreich ataxia and Pica.6-10 Apparently any aberration in the cellular metal-ion concentrations may cause a shortage of a vital metabolic element or inflict damage that may lead to cell death. Only in recent years has research focused on genes encoding metal ion transporters in eukaryotes and on the genetic disorders associated with them.6-8 As a result, a large number of candidate genes were discovered and some of the transporters have been described in detail, particularly those for Ca2+, Cu2+, Fe2+. Yet, several observations indicate that many more proteins, involved in transport and homeostasis of metal ions, await their identification. The use of the yeast Saccharomyces cerevisiae as a model system for the identification and isolation of these proteins is particularly attractive. Yeast is an Eukaryote which has a haploid and diploid form, a known, relatively small genome with few introns, excellent rate of homologous recombination, and easy methods for genetic screens. Yeast is also an easy organism to grow under metal ion stress. Transporters identified in this model organism frequently proved to be rather well conserved among eukaroytes. Indeed the attributed function of the NRAMP family as divalent metal ion transporters was discovered through the function of homologous genes in yeast.11 Mammalian or plant homologues of yeast genes could be recognized either by screening sequences in the database or by complementation of yeast mutants with higher organisms’ cDNA libraries.

Discovery of the Yeast Smf1p as a Metal-Ion Transporter Revealed that Metal Ions Function through NRAMP in Resistance and Sensitivity to Bacterial Infection It has long been recognized that the pathogenicity of a broad range of intracellular parasites is dependent on the availability of transition metal ions (Ref. 12, 13 for reviews). The discovery of a macrophage protein known to confer resistance to intracellular parasites Nramp1 (Natural Resistance Associated Macrophage Protein) and its recognition as a metal ion transporter substantiated it.11,14,15 Nramp1 is identical to the Ity and the Lsh gene conferring resistance to infections by Salmonella typhimurium and Leishmania donovani, respectively.16 However the enigma was what does it transport. The discovery that the yeast homologue, Smf1p is a metal-ion transporter11, paved the way for the advancement of our knowledge about the substrate of the mammalian NRAMP. Its function as a scavenger of metal-ions from the bacteria-containing phagosomes was then suggested with the discovery of Smf1p as the yeast Nramp homologue.11 SMF1 has originally been cloned as a high copy number suppressor of a temperature-sensitive mif1-1 mutant.17 MIF1 (MAS1) and MAS2 (MIF2) encode the processing enhancing protein and the matrix processing peptidase, respectively. The two proteins function as a heterodimer to form the active holoenzyme of mitochondrial processing peptidase, which is vital for cell growth.18-20 The activity of the purified peptidase is inhibited by chelators such as EDTA or orthophenantroline and is stimulated by Mn2+, Zn2+, or Co2+.21 We picked up the SMF1 gene as a suppressor of a csp2 (cdc1-1 ) mutant, that was sensitive to the presence of EGTA in the medium.11 The Chelator Sensitive Phenotype (Csp-) of the csp2 mutant was caused by a mutation in the CDC1 gene, in which Gly149 was substituted by

Metal-Ion Transporters: From Yeast to Human Diseases

137

arginine. The cdc1-1 mutant exhibited a very similar complementation characteristics to the mas1 (or mif1-1) mutant with the exception of their growth inhibiting conditions (which are EGTA and 37oC, respectively). We re-examined the mif1-1 mutant and found that its temperature-sensitivity could be alleviated by the addition of 1 mM Mn2+ to the medium or by overexpression of Smf1p.11 Thus the temperature sensitivity of mif1-1 mutant may result from reduced stability of the mutated processing peptidase which needed higher manganese concentrations for its function in higher temperature. In both cases, the mif1-1 and the cdc1-1, the mutation could be relieved by supplementing the media with Mn2+ or overexpressing Smf1p that stimulates the Mn2+ transport from the medium and elevates its concentration in the cytoplasm.11,22 Cdc1p may be a Mn2+-dependent cell division cycle protein that is vital for cell growth23,24 but the G149R mutation rendered it less stable and the cell sensitive to low Mn2+ concentration in the medium. Further studies indicated the Smf1p is a general metal-ion transporter and can transport not only Mn2+ but also Cu2+, Fe2+, Cd2+, Ni2+ and Co2+.11,22,25,26 Yeast cells contain two additional genes of this family, SMF2 and SMF3, and indirect evidence indicates that they also exhibit broad range metal-ion specificity, which differs from Smf1p.27 It is remarkable, that prior to these studies, manganese was not considered to be an essential element for yeast growth. Only by discovering that mutations in Cdc1p and Mas1p can be complemented by the addition of Mn2+ did it become apparent that this metal-ion is vital for yeast.11,23,24 We proposed that the role of Nramp1 in macrophage defense against microbial invasion is to reduce the metal-ion concentrations inside the bacteria containing phagosomes11,25 (Fig. 1). Consequently it limits the production and function of the engulfed bacterial metallo-enzymes required for their defense against reactive oxygen and/or nitrogen toxic intermediates that are poured upon them by the phagocytes.28,29 It was proposed that Nramp1, like its yeast homologue, transports metal-ions from the phagosomal lumen into the cytoplasm. Thus the metal-ion depletion of the phagosomal lumen becomes a rate-limiting step in metalloenzymes function of the engulfed bacteria. This restricts the mycobacterial ability to produce and activate enzymes such as SOD and prevents the propagation of the ingested microorganisms (Fig. 1). Conversely, an increased concentration of metal-ions in the phagosome caused by a defective Nramp1 transporter (Bcgs ) may promote the growth of the mycobacteria and render the invaded organism sensitive to the pathogen. The discovery of Nramp -related genes (NRMIT) in several bacteria suggests that the pathogens use the same strategy in competition for the limited amounts of metal-ions inside the phagosome.11,15,30,31 The above hypothesis was addressed by several studies proving that the transporter indeed transports divalent metal ions. However, in respect to the directionality of the metal-ion pumping by Nramp1 in macrophages, the researchers differ. One group proposes Nramp1 pumps metal ions into the macrophage phagosomes and facilitates accumulation of metal ions in their lumen. Addition of Fe2+ to Nramp1 expressing macrophages in tissue culture was shown to further inhibit the growth of Mycobacterium avium and that this effect could be reversed by the addition of hydroxyl radicals scavengers.32 Moreover, Nramp1 expressing macrophages grown with 55Fe accumulated four times more Fe2+ in their phagosomes than the cells lacking Nramp1 same was true for import into isolated phagosomes. There was a burst of hydroxyl radicals after infection in the Nramp1 expressing cells but not in the nonexpressing cells.33 The iron uptake was shown to be dependent on pH gradient and with its disruption by lysomotropic agents like chloroquine and ammonium chloride, the amount of iron import to isolated Nramp1 expressing phagosomes decreased. This iron uptake could be also inhibited by treatment of the phagosomes with antibody against the putative outer fourth loop.34 Another group expressed Nramp1 in Xenopus oocytes and demonstrated that it could transport Fe2+, Zn2+ and Mn2+ in exchange with H+.35 Although large metal-ion induced currents were recorded, the metal ion transport was extremely low. The activity of Nramp1 mRNA injected oocytes was only up to 2 fold in comparison with water-injected oocytes whereas with Nramp2 (DCT1) injected oocytes rates that are more then 1000 fold the background are frequently obtained.36 This makes

138

The Nramp Family

Figure 1. A proposed role of Nramp1 in macrophage-pathogen interaction. Nramp1 is proposed to function in divalent metal ion exclusion from the macrophage phagosome. The Me2+-metal ion transport is driven by an H+ gradient generated by V-ATPase. The engulfed bacteria compete on the metal-ions by their Nramp homologue NRMIT. The directionality of driving force (protons), and divalent metal-ion transport is indicated by arrows.

one wonder what is the source of the large metal-ion induced currents (see below). These groups believe Nramp1 functions as a pH dependent antiporter, importing divalent cations into the bacteria containing phagosome. The accumulated cations in the phagosome generate highly reactive hydroxyl radicals by Haber-Weiss reaction, which contribute to the bacteriostatic effect of the macrophage on the engulfed bacteria.32-35 The other group proposes that the transporter pumps out the metal ions from the phagosome into the cytoplasm. They showed that in Nramp1 expressing macrophage 28% of the iron was bound to ferritin and 60% was in a soluble fraction namely, in the cytoplasm.37 Upon induction of the macrophage, the iron in the cytoplasm was increased to 82% on the expense of iron bound to ferritin that was less then 5%. This suggests that Nramp1 is required for releasing iron from phagosomes and transporting it into the cytoplasm.37 Using calcein as a marker, it was demonstrated that Nramp1 could transport iron from vesicles to the cytoplasm in relaxed macrophage.38 Using zymosan-FF6 as a phagocytosed indicator, it was shown that phagosomes from wild type mice transported Mn2+ out of the phagosome significantly faster as compared to knock-out mice. This transport was dependent on the pH gradient generated by V-ATPase.39 In analogy, Nramp2 (DCT1) was found to associate with erythrocyte containing phagosomes suggesting a role in recycling of iron from dying erythrocytes, which are the main source of iron in our body. Nramp2 was also found in sperm containing phagosomes of Sertoli cells suggesting a role in iron recycling from degenerating spermatozoids.40 This too suggests

Metal-Ion Transporters: From Yeast to Human Diseases

139

that the transporter works by exporting metal ions from the phagosome into the cytoplasm. These groups argue that the transport of divalent cations out of the microenvironment of the bacteria (phagosome) by Nramp1, results in an enhanced bacteriostatic activity. Regardless of the directionality of the transport, there is no dispute about the necessity of transport of divalent cations by this transporter for the defense against bacterial infection. However, as mentioned above, we favor the metal ion depletion hypothesis, where the reduction in metal ion concentration in the phagosomal lumen becomes a rate-limiting step in metalloenzymes production by the engulfed bacteria (Fig. 1). This will restrict mycobacterial ability to produce active enzymes such as SOD and prevent the propagation of the ingested microorganisms. Conversely, an increased concentration of metal-ions in the phagosome caused by a defective Nramp1 transporter (Bcgs) may result in higher metal-ion concentration, promote the growth of the mycobacteria and render the organism sensitive to the pathogen. The discovery of Nramp homologous genes (NRMIT) in several bacteria suggests that the pathogens use the same strategy in competition for the limited amounts of metal-ions inside the phagosome.15,31

A Glimpse into the Mechanism of Metal-Ion Uptake Characterization of Metal-Ion Transporters Expressed in Xenopus Oocytes The mechanism of metal-ion transport by eukaryotic cells is largely obscure. The large number of transporters occupying the plasma membrane of a typical eukaryotic cell makes the study into the mechanism of a single transporter, very difficult. Therefore most of the information about those transporters has come from electrophysiological studies on DCT1 (Nramp2) and Smf1p that were expressed in Xenopus oocytes.26,36,41 One of the main advantages of oocytes as heterologous expression system, is their being self sufficient in terms of nutrition and therefore providing a system with very low background for foreign transporters expressed in their plasma membrane. DCT1 transports a wide range of divalent metal-ions, which is H+ driven. Uptake of radioactive cations such as Mn2+ and Co2+ into the oocyte is up to 1,000 fold above the background of water injected oocyte.36 By two-electrode recordings, presteady-state and steady-state currents induced by expressed electrogenic transporters can be measured (ref. 42, 43 for reviews). As in other transporters, in the absence of metal ions in the medium, oocytes expressing DCT1 exhibit large presteady-state currents but only at positive potentials. In the presence of those metal-ions a steady state current is induced mainly in negative potentials, which is also dependent on chloride or other permeable anions.41 Since it seems surprising that the transport of a divalent cation such as Fe2+ will be driven solely by additional cation H+, we further investigated the influence of anions on the currents generated by DCT1.4,36 Substitution of chloride anions by gluconate drastically reduced the 55Fe2+ uptake into the oocytes and rendered it sensitive to membrane potential.4 It remains unknown, whether Cl- is cotransported with the metal ion and whether the steady-state current results solely from the transport of positive charges of H+, or is a sum of proton and metal ion transported charges. The stoichiometry between the H+ and the transported metal ion varied under different experimental conditions and an analogy of clutch mechanism between the metal ion transport and gear-shift cars was drown36 (Fig. 2).

The Slip Phenomenon

It was demonstrated that DCT1 cotransports Fe2+ together with H+ with a stoichiometry of 1:1.41 The metal ion transport is therefore dependent on proton concentration in the external side of the membrane, as protons are cotransported with iron,44 but the nature of the driving force for transport is not apparent. At physiological membrane potentials of -90 to -30 mV, the apparent affinity constant for H+ was about 1 µM, suggesting that at neutral pH, proton binding is the rate-limiting step in the transport process. At low pH, DCT1 expressed in Xenopus oocytes exhibited a metal-ion induced uncoupled proton current into the oocyte and under certain conditions the transporter operates as an H+ uniporter.41 This phenomenon we

140

The Nramp Family

Figure 2. Schematic representation of a slip (variable uncoupled current) by a clutch mechanism. The mechanistic clutch regulates a variable stoichiometry between the ion-motive pathway (force pathway) and the substrate-transport pathway. High concentration of H+ for Nramp2 or of Na+ for Smf1p result in slippage through the driving-force pathway and loose coupling with the divalent metal-ion transport pathway. M+2 - metal ion.

defined as a mechanistic slip that is an integral part of the transporter’s mechanism of action.45 The proton slip is influenced by the membrane potential, it increases as the imposed potentials become more negative and is absolutely dependent on the presence of metal ions in the medium.36,41 The involvement of Zn2+ in the transport process and proton slippage, deviates from all the other metal ions that were tested. Zn2+ was found to be an inhibitor of iron transport by DCT1 and manganese transport by Smf1p,11,41 therefore it is likely to bind to the same site as the other metal ions. However, Zn2+ is almost not transported by DCT1, yet induces the proton slip as much as the other metal ions and therefore under these conditions DCT1 acts as an H+ uniporter.4 The mechanism of metal ion transport by Smf1p is closely related to that of the mammalian DCT1 and exhibits similar affinities toward the various metal ions.27,36 Although in both H+ is the driving force, the most striking difference between DCT1 and Smf1p is in the uncoupled slip that was shown to be H+ in DCT1 and Na+ in Smf1p.26,45 The sodium slip in Smf1p is not dependent on the presence of metal ions and increases with elevation of the pH. Sodium is unlikely to be bound to the metal-ion transport site, because metal ions do not compete with sodium on the slip current and elevation of the metal concentration did not affect the inhibition of their transport by sodium.36 Therefore, sodium is likely to compete with protons on the

Metal-Ion Transporters: From Yeast to Human Diseases

141

proton-binding site and to generate a sodium slippage through the proton transport pathway.45 The evolutionary and physiological significance of this phenomenon could be explained in terms of a protection mechanism against overloading the cell with metal ions. Apparently the evolution of the system could not provide an alternative driving force for the proton electrochemical gradient. Considering that excess metal-ions is toxic, a protection mechanism against too much transport of these elements had to be developed in DCT1 as well as in Smf1p. Several kinds of food products are highly enriched in iron and eating too much of them can also cause heartburn. The excess acid may reach the duodenum together with high iron concentrations and this combination of very high driving force and substrate abundance may be deleterious. Uncoupling by a built-in proton slip could protect the organism from too much metal-ions intake. It was suggested that a similar protection might function in the sodium slip through the yeast Smf1p.26 In this case the yeast cells may be protected against excessive influxes of toxic metal ions by evolving a sodium slippage that competes with the metal ion uptake under conditions of increasing salt concentrations in the medium.

Expression of Heterologous Metal-Ion Transporters in Yeast Cells The expression systems of Xenopus oocyte and mammalian cells, currently used to express metal-ion transporters, provided invaluable data necessary for understanding the mode of action of the transporters. However, those systems are not adequate for studies of other features like suppressor mutants, for instance, for which bacteria or yeast provide an ideal experimental system. We utilized the SMF triple mutant (smf1,2,3∆) generated in our laboratory that fails to grow on buffered YPD at pH 7.5 or on EGTA, to complement the growth deficiency by the different SMF family members from yeast mammals and other sources.27 The work of Pinner et al.,46 demonstrated that Nramp2 can complement the lack of growth of the double knockout yeast mutant (smf1,2∆) in the presence of EGTA. This showed that yeast null mutants lacking the SMF metal ion transporters could be used not only for studying yeast transporters but also their mammalian homologues. All the expressed transporters we tagged by appropriate amino acid sequences to enable immunological detection.27 Using this property, the assembly of the transporters into the plasma membrane could be followed. Each gene that successfully complemented one of the triple mutant deficiencies, was subjected to site directed mutagenesis. The cDNAs of those that yielded an inactive transporter that reached the plasma membrane, were subjected to random mutagenesis to obtain suppressor mutants as previously described.47 The suppressor mutants were expressed in Xenopus oocytes, where their transport mechanism was studied. That way we identified that the first outer loop is connected to the substrate and proton binding sites of DCT1 and were able to change the metal-ion specificity of the transporter.48 Studies with yeast mutants expressing bacterial metal ion transporters (NRMIT) may provide an amenable system for discovering new drugs targeted specifically against the bacterial transporters. If indeed Nramp1 and the bacterial NRMIT compete on the metal ions inside the macrophage phagosomes a screen for drugs that inhibit NRMIT but not Nramp1 using their functional expression in yeast as an assay, could be developed. We expressed the gene encoding metal-ion transporter (NRMIT) from mycobacterium leprae in the yeast mutant smf3∆.49 The expressed bacterial gene complemented the EGTA sensitivity of the mutant and enabled its growth in the presence of the chelating agent. Attempts to express NRMIT (MntH) from Mycobacterium tuberculosis did not yield complementation of any of the yeast SMF disruptant mutants. Next we expressed Nramp1 in smf1,2,3∆ mutant, and were able to grow the transformed yeast on YPD pH 7.5 (Fig. 3). Thus the system was ready for drug screen that might have yielded substances that specifically inhibit the bacterial MIT but not the mammalian transporter. As many good intentions this was doomed by a single good experiment that showed that null mutant in NRMIT of M. tuberculosis infected mammalian cells and propagated as usual.50,51 May be we barked on the wrong bush. There must be an additional back-up trans-

142

The Nramp Family

Figure 3: Nramp1 and Nramp2 complement yeast SMF null mutants. Growth of smf3∆ and smf1,2,3∆ mutant expressing Nramp1 or Nramp2 on YPD pH 6 with or without EGTA or on YPD buffered to pH 7.5. As can be seen Nramp2 could complement both the EGTA and the pH 7.5 sensitivity of the smf1,2,3∆ whereas Nramp1 could only suppress the pH 7.5 sensitivity of smf1,2,3∆. Under these conditions the smf3∆ mutant grows like wild type cells.

porter in the bacteria, that has the same function as NRMIT. Indeed in Salmonella enterica Serovar Typhimurium, where recently Mn+2 was shown to be important to the virulence of the above mentioned Salmonella in Nramp1 (-) mice, the major factor for the uptake of Mn+2 into the bacteria was shown to be the Mn+2/Fe+2 ABC transporter sitABCD.52 The double mutant sitABCD/MntH (the bacterial Nramp1 homologue) showed minimal Mn+2 uptake and was sensitive to H2O2 and to the divalent metal chelator 2,2- dipyridyl and defective in proliferation in the macrophage. MntH was found to transport Mn+2 rather then Fe+2 and over expression of MntH on the background of the double mutant sitABCD/MntH suppressed the H2O2 sensitivity and improved the survival in the Nramp1 (-) macrophage. Once again Mn+2 appears to be very important player in the sensitivity or resistance to infections.

The Involvement of NRAMP in Diseases The subject of the involvement of the Nramp family of genes in diseases was pioneered by Philippe Gros and his colleagues,14 and it will be extensively reviewed in other chapters. However, by serendipity, we have made some contribution to this area as well, that might shed light on the understanding of a disease called Pica. 53 While introducing the concept of NRAMP-related proteins as metal-ion transporters, we came across a paper showing that a null mutant in MALVOLIO (NRAMP-related protein from Drosophila melanogaster) had a behavioral effect that stemmed from the loss of taste to sugar.54 This observation connected the

Metal-Ion Transporters: From Yeast to Human Diseases

143

Drosophila’s metal-ion transporter to neuronal responses, which brought us to the idea to complement the mutant with a dietary supplement of manganese that indeed complemented the taste behavior.55 As we published the results, Nancy Andrews pointed out to us the relevance of those findings to the Pica disease, where the patients are relieved from their unexplained compulsory symptoms by addition of iron to their diet.

References 1. Radisky D, Kaplan J. Regulation of transition metal transport across the yeast plasma membrane. J Biol Chem 1999; 274(8):4481-4484. 2. Hediger MA. Membrane permeability. The diversity of transmembrane transport processes. Curr Opin Cell Biol 1997; 9(4):543-546. 3. Eide DJ. The molecular biology of metal ion transport in Saccharomyces cerevisiae. Annu Rev Nutr 1998; 18:441-469. 4. Nelson N. Metal ion transporters and homeostasis. EMBO J 1999; 18(16):4361-4371. 5. Eide D. Molecular biology of iron and zinc uptake in eukaryotes. Curr Opin Cell Biol 1997; 9(4):573-577. 6. Askwith C, Kaplan J. Iron and copper transport in yeast and its relevance to human disease. Trends Biochem Sci 1998; 23(4):135-138. 7. Babcock M, de Silva D, Oaks R et al. Regulation of mitochondrial iron accumulation by Yfh1p, a putative homolog of frataxin. Science 1997; 276(5319):1709-1712. 8. Andrews NC, Levy JE. Iron is hot: An update on the pathophysiology of hemochromatosis. Blood 1998; 92(6):1845-1851. 9. Fleming MD, Trenor III CC, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16(4):383-386. 10. Fleming RE, Migas MC, Zhou X et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 1999; 96(6):3143-3148. 11. Supek F, Supekova L, Nelson H et al. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93(10):5105-5110. 12. Bullen JJ. The significance of iron in infection. Rev Infect Dis 1981; 3(6):1127-1138. 13. Payne SM. Iron acquisition in microbial pathogenesis. Trends Microbiol 1993; 1(2):66-69. 14. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73(3):469-485. 15. Agranoff DD, Krishna S. Metal ion homeostasis and intracellular parasitism. Mol Microbiol 1998; 28(3):403-412. 16. Plant JE, Blackwell JM, O’Brien AD et al. Are the Lsh and Ity disease resistance genes at one locus on mouse chromosome 1? Nature 1982; 297(5866):510-511. 17. West AH, Clark DJ, Martin J et al. Two related genes encoding extremely hydrophobic proteins suppress a lethal mutation in the yeast mitochondrial processing enhancing protein. J Biol Chem 1992; 267(34):24625-24633. 18. Pollock RA, Hartl FU, Cheng MY et al. The processing peptidase of yeast mitochondria: The two cooperating components MPP and PEP are structurally related. EMBO J 1988; 7(11):3493-3500. 19. Yang M, Jensen RE, Yaffe MP et al. Import of proteins into yeast mitochondria: The purified matrix processing protease contains two subunits which are encoded by the nuclear MAS1 and MAS2 genes. EMBO J 1988; 7(12):3857-3862. 20. Witte C, Jensen RE, Yaffe Mp et al. MAS1, a gene essential for yeast mitochondrial assembly, encodes a subunit of the mitochondrial processing protease. EMBO J 1988; 7(5):1439-1447. 21. Hawlitschek G, Schneider H, Schmidt B et al. Mitochondrial protein import: identification of processing peptidase and of PEP, a processing enhancing protein. Cell 1988; 53(5):795-806. 22. Liu XF, Supek F, Nelson N et al. Negative control of heavy metal uptake by the Saccharomyces cerevisiae BSD2 gene. J Biol Chem 1997; 272(18):11763-11769. 23. Paidhungat M, Garrett S. Cdc1 is required for growth and Mn2+ regulation in Saccharomyces cerevisiae. Genetics 1998; 148(4):1777-1786. 24. Paidhungat M, Garrett S. Cdc1 and the vacuole coordinately regulate Mn2+ homeostasis in the yeast Saccharomyces cerevisiae. Genetics 1998; 148(4):1787-1798. 25. Supek F, Supekova L, Nelson H et al. Function of metal-ion homeostasis in the cell division cycle, mitochondrial protein processing, sensitivity to mycobacterial infection and brain function. J Exp Biol 1997; 200(Pt 2):321-330.

144

The Nramp Family

26. Chen XZ, Peng JB, Cohen A et al. Yeast SMF1 mediates H(+)-coupled iron uptake with concomitant uncoupled cation currents. J Biol Chem 1999; 274(49):35089-35094. 27. Cohen A, Nelson H, Nelson N. The family of SMF metal ion transporters in yeast cells. J Biol Chem 2000; 275(43):33388-33394. 28. Segal AW, Abo A. The biochemical basis of the NADPH oxidase of phagocytes. Trends Biochem Sci 1993; 18(2):43-47. 29. Chan J, Xing Y, Magliozzo RS et al. Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. J Exp Med 1992; 175(4):1111-1122. 30. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92(22):10089-10093. 31. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-1078. 32. Zwilling BS, Kuhn DE, Wikoff L et al. Role of iron in Nramp1-mediated inhibition of mycobacterial growth. Infect Immun 1999; 67(3):1386-1392. 33. Kuhn DE, Baker BD, Lafuse WP et al. Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J Leukoc Biol 1999; 66(1):113-119. 34. Kuhn DE, Lafuse WP, Zwilling BS. Iron transport into mycobacterium avium-containing phagosomes from an Nramp1(Gly169)-transfected RAW264.7 macrophage cell line. J Leukoc Biol 2001; 69(1):43-49. 35. Goswami T, Bhattacharjee A, Babal P et al. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J 2001; 354(Pt 3):511-519. 36. Sacher A, Cohen A, Nelson N. Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J Exp Biol 2001; 204(Pt 6):1053-1061. 37. Mulero V, Searle S, Blackwell JM et al. Solute carrier 11a1 (Slc11a1; formerly Nramp1) regulates metabolism and release of iron acquired by phagocytic, but not transferrin-receptor-mediated, iron uptake. Biochem J 2002; 363(Pt 1):89-94. 38. Atkinson PG, Barton CH. High level expression of Nramp1G169 in RAW264.7 cell transfectants: Analysis of intracellular iron transport. Immunology 1999; 96(4):656-662. 39. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: Natural resistance-associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192(9):1237-1248. 40. Jabado N, Canonne-Hergaux F, Gruenheid S et al. Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes in macrophages and Sertoli cells. Blood 2002; 100(7):2617-2622. 41. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388(6641):482-488. 42. Wright EM, Loo DD, Panayotova-Heiermann M et al. ‘Active’ sugar transport in eukaryotes. J Exp Biol 1994; 196:197-212. 43. Loo DD, Hirayama BA, Gallardo EM et al. Conformational changes couple Na+ and glucose transport. Proc Natl Acad Sci USA 1998; 95(13):7789-7794. 44. Tandy S, Williams M, Leggett A et al. Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco2 cells. J Biol Chem 2000; 275(2):1023-1029. 45. Nelson N, Sacher A, Nelson H. The significance of molecular slips in transport systems. Nat Rev Mol Cell Biol 2002; 3(11):876-881. 46. Pinner E, Gruenheid S, Raymond M et al. Functional complementation of the yeast divalent cation transporter family SMF by NRAMP2, a member of the mammalian natural resistance-associated macrophage protein family. J Biol Chem 1997; 272(46):28933-28938. 47. Supek F, Supekova L, Nelson N. Features of vacuolar H(+)-ATPase revealed by yeast suppressor mutants. J Biol Chem 1994; 269(42):26479-26485. 48. Cohen A, Nevo Y, Nelson N. The first external loop of the metal-ion transporter DCT1 is involved in metal-ion binding and specificity. Proc Natl Acad Sci USA 2003; 100:10694-10699. 49. Reeve I, Hummel D, Nelson N et al. Overexpression, purification, and site-directed spin labeling of the Nramp metal transporter from Mycobacterium leprae. Proc Natl Acad Sci USA 2002; 99(13):8608-8613. 50. Domenech P, Pym AS, Cellier M et al. Inactivation of the Mycobacterium tuberculosis Nramp orthologue (mntH) does not affect virulence in a mouse model of tuberculosis. FEMS Microbiol Lett 2002; 207(1):81-86.

Metal-Ion Transporters: From Yeast to Human Diseases

145

51. Boechat N, Lagier-Roger B, Petit S et al. Disruption of the gene homologous to mammalian Nramp1 in Mycobacterium tuberculosis does not affect virulence in mice. Infect Immun 2002; 70(8):4124-4131. 52. Boyer E, Bergevin I, Malo D et al. Acquisition of Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2002; 70(11):6032-6042. 53. Moore Jr DF, Sears DA. Pica, iron deficiency, and the medical history. Am J Med 1994; 97(4):390-393. 54. Rodrigues V, Cheah PY, Ray K et al. Malvolio, the Drosophila homologue of mouse NRAMP-1 (Bcg), is expressed in macrophages and in the nervous system and is required for normal taste behaviour. EMBO J 1995; 14(13):3007-3020. 55. Orgad S, Nelson H, Segal D et al. Metal ions suppress the abnormal taste behavior of the Drosophila mutant malvolio. J Exp Biol 1998; 201(Pt 1):115-120.

146

The Nramp Family

CHAPTER 13

Regulation of Bacterial MntH Genes John D. Helmann

Abstract

B

acterial NRAMP-like transporters, generically referred to as MntH proteins, appear to function primarily as Mn(II) uptake systems induced under conditions of manganese limitation. Regulation of mntH gene expression usually involves a Mn(II)-sensing regulatory protein, MntR. In the enteric bacteria, regulation additionally involves the iron-sensing Fur regulatory protein and the peroxide-sensing OxyR activator. This complex regulation is indicative of the fact that Mn(II) is important not only for its role as an enzyme cofactor, but also for its ability to help detoxify reactive oxygen species.

Introduction All organisms require numerous metal ions for growth. Metal ion influx and efflux are mediated by a combination of ATP- and proton-dependent mechanisms.1,2 The metal ion transporters found in eukaryotic cells are often closely related to their prokaryotic orthologs. For example, the copper transporters implicated in both Menkes’ and Wilson’s diseases bear striking similarity to ATP-dependent efflux pumps important for copper resistance in Bacteria.3,4 The Natural Resistance-Associated Macrophage Protein (NRAMP) family of eukaryotic transporters was identified based on the effect of these proteins on the multiplication of intracellular pathogens.5 Bacterial genes encoding members of the NRAMP family of transporters were initially identified based on sequence similarity with their eukaryotic counterparts.6,7 Where the functional role of these NRAMP-type transporters has been documented (in Mycobacterium tuberculosis, Bacillus subtilis, Escherichia coli, and Salmonella enterica) the weight of the available evidence suggests a primary role in the uptake of Mn(II) ion.8-10 The name MntH (Manganese transport, H+-dependent) was therefore adopted for this bacterial protein family. However, a role in the transport of other metal ions in these or other bacteria cannot be rigorously excluded. Additional uncharacterized homologs are present in most sequenced bacterial genomes. In this chapter we will focus specifically on the regulatory pathways governing the expression of NRAMP-like (MntH) transporters in bacterial systems. Despite the similarities between bacterial and eukaryotic transport machinery, the regulatory pathways that control the expression of metal ion homeostasis systems are completely distinct.1,2,11 In eukaryotic cells, metal ion uptake functions are often controlled by metal-sensing transcription activators such as the yeast iron sensor AFT1,12 the zinc sensor ZAP1,13 or the MRE-binding protein in human cells.14,15 In the case of iron homeostasis genes, translational control mediated by IRE-binding proteins plays a prominent role.16 In bacterial systems, metal homeostasis is most frequently controlled by metal-sensing repressors such as Fur (ferric uptake repressor), Zur (zinc uptake repressor), or MntR (manganese transport regulator).17 Efflux systems may be controlled by either metal-sensitive repressors, such as the zinc sensor SmtB, or by transcription activators of the MerR family.18,19 Regulation of mntH genes in response to Mn(II) is mediated primarily by MntR. In the enteric bacteria, additional regulation involves the Fe(II)-sensing Fur protein and the peroxide-sensing OxyR factor. The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Regulation of Bacterial MntH Genes

147

Mycobacterium tuberculosis One of the first bacterial NRAMP homologs to attract attention was the M. tuberculosis homolog, for which the designation MRAMP was proposed.20 The function of this hypothetical transporter was investigated by microinjection of the corresponding mRNA into Xenopus oocytes. In this context, the MRAMP transporter mediates uptake of divalent zinc and iron, with competitive inhibition noted for both manganese and copper.20 The authors conclude that this transporter interacts with a range of divalent cations. The regulation of MRAMP was investigated in M. tuberculosis using RT-PCR. The results indicate that MRAMP is up-regulated when cells are grown in the presence of high concentrations of Fe(II) or Cu(II).20 Since transporters that function to import metal ions are usually repressed rather than induced by their substrates, this result is surprising. It should be noted, however, that the levels of Fe(II) and Cu(II) used in this study were sufficient to inhibit bacterial growth. It is therefore plausible that these ions act as competitive inhibitors of the transport of another essential ion, perhaps Mn(II), mediated by the MRAMP protein. Recent results indicate that MntH is not a virulence determinant for M. tuberculosis.21,22 The lack of a significant role for MntH in growth, either in vitro or in the mammalian host, is likely indicative of a redundancy of transport systems for metal ion acquisition.

Bacillus subtilis One of the first clues to suggest a major role for bacterial NRAMPs in Mn(II) uptake emerged from genetic analysis of metal-regulated gene expression in B. subtilis.10 This Gram positive bacterium encodes a homolog of the well characterized diphtheria toxin repressor (DtxR) protein of Corynebacterium diphtheriae. In C. diphtheriae, DtxR senses Fe(II) and regulates the expression of both diphtheria toxin and iron homeostasis genes.23 Unlike DtxR, which senses Fe(II), the B. subtilis DtxR homolog is a Mn(II)-specific regulator designated MntR.10 Wild-type B. subtilis requires low levels (usually nanomolar) of manganese for growth and can tolerate up to 1 mM. When an mntR null mutant was constructed the resulting cells were extremely sensitive to Mn(II), presumably because of an inability of the cells to shut-off the expression of transporters.10 The mntR mutant strain can not grow at concentrations of Mn(II) above 5 µM. The sensitivity of the mntR mutant to several other tested metal ions was unaffected. These results led us to speculate that the function of MntR was to regulate one or more transporters that act to import Mn(II). The extreme Mn(II) sensitivity of the B. subtilis mntR mutant strain provides a powerful genetic selection for suppressor mutations. A major class of transposon-generated suppressor mutations were insertions in a gene encoding an NRAMP homolog, subsequently designated MntH (Manganese transport, H+-dependent). Using reporter fusions it was demonstrated that mntH transcription is induced by growth under Mn(II) limiting conditions. Expression can be repressed by Mn(II), but by none of the other divalent metal ions tested.10 These results are consistent with the idea that uptake of Mn(II) is the major physiological function of MntH. To identify other genes that are controlled by MntR, the operator sites required for regulation of MntH were characterized. MntR binds to at least three sites in the mntH promoter region as judged by electrophoretic mobility shift assays and DNase I footprinting. The core region required for binding has similarity to other operator elements regulating known or putative Mn(II) uptake systems in other bacteria (Table 1). When the mntH operator was used to search the B. subtilis genome for related elements, the closest match was to a region just upstream of the ytgABCD operon (renamed mntABCD) encoding a putative Mn(II)-selective ABC transporter. Both the MntH (proton-dependent) and MntABCD (ATP-dependent) transporters are repressed by Mn(II) with comparable sensitivity: repression is complete when the medium contains >1 µM Mn(II).10 The regulation of these operons by Mn(II) clearly requires MntR, but the mechanistic details have only recently become clear. Based on initial studies, using reporter fusions, we proposed that MntR was a dual function regulator: MntR acted to induce expression of the mntABCD operon under Mn(II)-limiting

The Nramp Family

148

Table 1. Recognition sites for the manganese transport regulator, MntR Organism

Protein

Metals

Target Gene

Sequencea

Ref.

B. subtilis

MntR

S. aureus

MntR

E. coli

MntR

Mn Mn Mn ? Mn,(Fe)

mntH mntA mntA mntH mntH

ATAATTTGCCTTAAGGAAACTC TAATTTTGCATGAGGGAAACTT TTAATTAGGTTAGCCTAAACTT AAATTTAGGTTGGCCTAAACAT AAACATAGCCTTTGCTATGTTT --------> <--------

10 10 26 26 25,30

a. The E. coli MntR-binding site is an inverted repeat as shown by the inverted arrows.

conditions and to repress mntH when Mn(II) is in excess.10 However, this model has been revised in light of recent RNA-based measurements (including DNA microarrays and slot blot analyses) that indicate that both operons are targets of MntR-mediated repression (our unpublished data). This discrepancy resulted from our analysis of mntA transcription using a transcriptional fusion of the mntA promoter region. This PmntA-lacZ operon fusion is not expressed in mntR mutant strains.10 However, this is due to instability of this particular mRNA in this genetic background. This experience serves as a reminder that it is important to verify effects detected using reporter fusions with direct, RNA-based measurements. Our current model for MntR regulation states that MntR represses both mntH and mntABCD in response to Mn(II), but not to other metal ions (Fig. 1A). Of particular interest, neither mntH nor mntABCD were identified as part of the Fur regulon, and neither is repressed in response to iron.24 This contrasts with recent findings in the enteric bacteria.25 The Mn(II) selectivity of transcriptional control is in agreement with measurements of metal ion transport in wild-type and various mutant strains of B. subtilis which establish that MntH has a primary role in the uptake of Mn(II) (M. Cellier, personal communication).

Staphylococcus aureus Recent results demonstrate that the manganese homeostasis circuitry in S. aureus is mediated by transporters similar to those described in B. subtilis.26,27 In both organisms, MntR acts as a manganese-dependent regulator of Mn(II) uptake systems, but the role of MntR in regulation of S. aureus mntH appears complex. The MntABC system is critical for achieving high cell densities in media containing sub-micromolar levels of Mn(II), suggesting that this is the higher affinity transport system.26 Repression of the mntABC operon is highly selective for Mn(II) and is unaffected by other tested metal ions. This repression requires MntR. Thus, at this promoter, MntR behaves as a Mn(II) dependent repressor, just as it does for both mntABCD and mntH in B. subtilis. In contrast, expression of mntH is reduced about 2- to 4-fold in an mntR mutant and does not appear to be regulated by Mn(II).26 This is a surprising result, but seems to suggest that MntR might act as a positive regulator of mntH (Fig. 1B). This is similar to our original (but erroneous) suggestion that MntR functioned as a positive regulator of mntABCD in B. subtilis. The lack of regulation of S. aureus mntH by Mn(II) is unexpected, and raises the possibility that this protein may in fact transport another metal ion or transport Mn(II) in response to a physiological stimulus distinct from metal ion starvation. It is interesting to note, for example, that B. subtilis contains a Zn(II) uptake system that is not regulated by Zn(II), but is induced under conditions of peroxide stress to import Zn(II) as an antioxidant.28 It is possible that in S. aureus MntH may be regulated by signals other than metal ion starvation, such as oxidative stress. Alternatively, the lack of Mn(II) regulation may be related to the fact that S. aureus mntH is phylogenetically distinct from the B. subtilis ortholog,

Regulation of Bacterial MntH Genes

149

Figure 1. Regulation of bacterial NRAMP (MntH) genes. A) The B. subtilis mntH gene is repressed by MntR binding to an extended operator region (dashed line; from approximately –15 to +53 relative to the transcription start site) overlapping the promoter (P). The primary binding site is indicated by the inverted arrow.10 Repression (as indicated by the ⊥ ) is highly selective for Mn(II) and requires MntR. B) The S. aureus mntH gene also appears to have an “MntR box” overlapping the –35 region of the promoter element. However, Northern blot analyses demonstrate that this gene is not significantly regulated by Mn(II), and expression is slightly decreased in an mntR mutant.26 This suggests that MntR may play a positive role in activation of mntH. See ref. 27 for a more complete description of the interacting Mn(II), Fe(II), and oxidative stress circuitry in S. aureus. C) Salmonella enterica serovar Typhimurium mntH regulation involves the coordinated action of OxyR, Fur, and MntR which bind to their corresponding operator sites (OxyR, dashed line; MntR, inverted repeat).25 Although not illustrated here, there is evidence that Fur can also mediate some repression in response to Mn(II), and MntR may also respond to Fe(II) (see text). The E. coli mntH gene is regulated similarly, although there is no evidence yet for cross-talk among these regulatory systems.30

150

The Nramp Family

belonging instead to a sub-family of bacterial mntH genes that may have been acquired by lateral gene transfer from eukaryotes.29

Escherichia coli and Salmonella enterica serovar Typhimurium The MntH orthologs in the enterobacteria were described by both the Cellier and Maguire laboratories as proton-dependent transporters with a primary role in the uptake of Mn(II).8,9 The mntH locus is subject to complex regulation in response to manganese, iron, and reactive oxygen species (Fig. 1C). In an initial characterization of mntH regulation in S. enterica serovar Typhimurium using an mntH::lacZYA reporter system, Kehres et al reported a strong transcriptional induction after treatment with EDTA or hydrogen peroxide, but little if any induction by the superoxide generator, paraquat.8 Analysis of the promoter and regulatory regions of mntH from S. enterica serovar Typhimurium led these authors to speculate that mntH was under the control of the metal-sensing Fur and peroxide-sensing OxyR proteins. Since Fur protein can respond to either Fe(II) or Mn(II), at least at some promoter sites, the authors speculated that Fur might mediate both types of regulation: a model refined in subsequent studies. Patzer and Hantke reported the first detailed analysis of mntH regulation in E. coli.30 Their results demonstrate that mntH is regulated by an MntR repressor similar to that found in B. subtilis, as well as by Fur. They initially identified a mntH::Mud-lac insertion in a random screen for genes repressed by iron and induced by the iron chelator, 2,2'-dipyridyl: the hallmarks of Fur-regulated genes.30 Significantly, they found that either iron or manganese could elicit repression with an additional weaker effect noted for cobalt. The ability of iron to elicit repression was abolished in a fur mutant strain, but manganese repression was Fur-independent. Therefore, they used random mutagenesis to identify mutants derepressed for mntH expression on plates containing Mn(II). The resulting derepressed mutants were complemented by plasmids encoding MntR, an ortholog of the Mn(II)-sensing repressor from B. subtilis. Thus, Patzer and Hantke concluded that mntH is under the dual control of Fur, mediating iron repression, and MntR, mediating manganese repression.30 This model of regulation has been refined by Kehres et al based on studies of mntH regulation in S. enterica serovar Typhimurium.25 These authors demonstrate that the mntH regulatory region in S. enterica serovar Typhimurium (and by homology, that in other enterobacteria) contains a σ70 promoter element with three closely linked regulator binding sites (Fig. 1C). Just upstream of the –35 promoter element is an OxyR binding site required for peroxide-induction. A Fur box motif required for iron-mediated repression overlaps the –35 element while the MntR-binding motif identified by Patzer and Hantke overlaps the transcription start site. In agreement with previous results,30 Kehres et al find that mntH expression is repressed by either Mn(II) or Fe(II) at 10 µM with a slight effect of Co(II) noted at 10-fold higher levels.25 To dissect the roles of the various regulatory proteins in mediating repression, Kehres et al introduced mutations in the regulators, in the regulator-binding sites (cis-acting elements), or both.25 The results were unexpectedly complex. The data indicate that mntH repression by iron is only partially eliminated by mutation of either the fur protein, the Fur box motif, or both. (In contrast, the effects of cobalt were entirely Fur-dependent). The residual iron-regulation was lost in double mutant strains in which both the Fur- and MntR-regulatory systems are disrupted. Thus, E. coli MntR, unlike the B. subtilis ortholog, can apparently respond to micromolar levels of iron. It should be noted that the ability of MntR to respond to iron in the fur mutant strain is not necessarily physiological, since fur mutants are derepressed for iron uptake and therefore have elevated intracellular iron levels. However, this objection is obviated by experiments in which the Fur regulatory system is intact, and thus iron homeostasis is expected to be normal, and only the Fur box element is mutated. In this strain there is still significant, MntR-dependent, repression of mntH by iron.25

Regulation of Bacterial MntH Genes

151

Analysis of the manganese effects on mntH transcription was equally complex. Transcription of mntH is sensitive to sub-micromolar levels of Mn(II) added to the medium, and this repression is unaffected by mutation of either fur or the Fur box motif. However, significant manganese repression was still observed in an mntR mutant strain. This residual manganese regulation was eliminated in the fur mntR double mutant.25 Thus, Fur can sense Mn(II) to regulate this promoter, at least in an mntR mutant background in which Mn(II) uptake is derepressed. Since elimination of the mntR-binding motif by itself abolished manganese-dependent regulation, it was not possible to investigate the ability of Fur to sense Mn(II) in an otherwise wild-type background. Moreover, this result suggests that the ability of manganese-liganded Fur to repress mntH requires DNA sequences overlapping the MntR-binding motif. In contrast, the iron-liganded Fur protein requires a classical Fur box to repress transcription. The complexity of regulation of mntH seen in S. enterica illustrates that many metalloregulators can respond to more than one metal ion in vivo. Indeed, Fur is known to respond to Mn(II) at other sites.31 It has been argued that the ability of high concentrations of Mn(II) to repress iron uptake functions may be one of the mechanisms leading to Mn(II) toxicity: selection for Mn(II) resistant bacteria frequently leads to the isolation of fur mutants.32 Similarly, the ability of S. enterica MntR to respond to Fe(II) in addition to Mn(II) is reminiscent of SirR, an MntR-like regulator of Staphylococcus epidermidis that responds to both metal ions.33 The final aspect of mntH regulation is the peroxide-induction mediated by OxyR. Transcription of mntH can be strongly induced by hydrogen peroxide and this induction can overcome the iron- or manganese-mediated inhibition noted above.25 The significance of mntH induction by hydrogen peroxide is unclear, but it is likely related to the observation that mntH mutants have an increased susceptibility to peroxide-mediated killing in S. enterica. It is reasonable to suggest that increased Mn(II) uptake under oxidative stress conditions serves a protective role in the cell. Mn(II) is known to play a major role in protecting bacteria against superoxide stress.34-38 While mntH expression is not peroxide-inducible in B. subtilis, this organism has another dedicated metal uptake system that responds to peroxide stress: the ZosA protein is a Zn(II) uptake P-type ATPase that is specifically induced by hydrogen peroxide as part of the PerR regulon.28 ZosA is postulated to protect cells against peroxide-stress by displacing iron, copper, and other redox active metal ions from adventitious binding sites in the cell where Fenton chemistry can lead to cell damage. In the Enterobacteriaceae, manganese uptake may play a similar role.27,35 In summary, these studies establish that mntH regulation in S. enterica involves a complex interplay between at least three regulatory circuits. The presence of similar regulatory sites in the corresponding DNA sequences from S. enterica ssp. typhi and Yersinia pestis suggests that other members of the Enterobacteriaceae may have similarly complex mntH regulation. In contrast, regulation in B. subtilis seems quite simple, with MntR being the only regulator so far documented as directly affecting mntH transcription. Further studies will be necessary to clarify the regulators that affect mntH expression in S. aureus, M. tuberculosis, and the many other bacteria that clearly harbor orthologues.

Acknowledgements Work in our laboratory on MntR and metalloregulation is supported by the National Institutes of Health (GM59323).

References 1. Eide DJ. Metal ion transport in eukaryotic microorganisms: Insights from Saccharomyces cerevisiae. Adv Microb Physiol 2000; 43:1-38. 2. Van Ho A, Ward DM, Kaplan J. Transition metal transport in yeast. Annu Rev Microbiol 2002; 56:237-61. 3. Mercer JF. The molecular basis of copper-transport diseases. Trends Mol Med 2001; 7(2):64-9. 4. Andrews NC. Metal transporters and disease. Curr Opin Chem Biol 2002; 6(2):181-6.

152

The Nramp Family

5. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73(3):469-85. 6. Cellier M, Belouchi A, Gros P. Resistance to intracellular infections: Comparative genomic analysis of Nramp. Trends Genet 1996; 12(6):201-4. 7. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92(22):10089-93. 8. Kehres DG, Zaharik ML, Finlay BB et al. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol Microbiol 2000; 36(5):1085-100. 9. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-78. 10. Que Q, Helmann JD. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol Microbiol 2000; 35(6):1454-68. 11. O’Halloran TV. Transition Metals in Control of Gene Expression. Science 1993; 261:715-25. 12. Yamaguchi-Iwai Y, Dancis A, Klausner RD. AFT1: A mediator of iron regulated transcriptional control in Saccharomyces cerevisiae. Embo J 1995; 14(6):1231-9. 13. Zhao H, Eide DJ. Zap1p, a metalloregulatory protein involved in zinc-responsive transcriptional regulation in Saccharomyces cerevisiae. Mol Cell Biol 1997; 17(9):5044-52. 14. Giedroc DP, Chen X, Apuy JL. Metal response element (MRE)-binding transcription factor-1 (MTF-1): Structure, function, and regulation. Antioxid Redox Signal 2001; 3(4):577-96. 15. Samson SL, Gedamu L. Molecular analyses of metallothionein gene regulation. Prog Nucleic Acid Res Mol Biol 1998; 59:257-88. 16. Eisenstein RS. Iron regulatory proteins and the molecular control of mammalian iron metabolism. Annu Rev Nutr 2000; 20:627-62. 17. Hantke K. Iron and metal regulation in bacteria. Curr Opin Microbiol 2001; 4(2):172-7. 18. Outten FW, Outten CE, O’Halloran TV. Metalloregulatory Systems at the Interface between Bacterial Metal Homeostasis and Resistance. In: Storz G, Hengge-Aronis R, eds. Bacterial Stress Responses. Washington, D.C.: ASM Press, 2000:145-57. 19. Helmann JD. Metal cation regulation in Gram-positive bacteria. In: Silver S, Walden W, eds. Metal Ions in Gene Regulation. New York, NY: Chapman & Hall, 1997:45-76. 20. Agranoff D, Monahan IM, Mangan JA et al. Mycobacterium tuberculosis Expresses a Novel pH-dependent Divalent Cation Transporter Belonging to the Nramp Family. J Exp Med 1999; 190(5):717-24. 21. Boechat N, Lagier-Roger B, Petit S et al. Disruption of the gene homologous to mammalian Nramp1 in Mycobacterium tuberculosis does not affect virulence in mice. Infect Immun 2002; 70(8):4124-31. 22. Domenech P, Pym AS, Cellier M et al. Inactivation of the Mycobacterium tuberculosis Nramp orthologue (mntH) does not affect virulence in a mouse model of tuberculosis. FEMS Microbiol Lett 2002; 207(1):81-6. 23. Holmes RK. Biology and molecular epidemiology of diphtheria toxin and the tox gene. J Infect Dis 2000; 181 Suppl 1:S156-67. 24. Baichoo N, Wang T, Ye R et al. Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Mol Microbiol 2002; 45(6):1613-29. 25. Kehres DG, Janakiraman A, Slauch JM et al. Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H(2)O(2), Fe(2+), and Mn(2+). J Bacteriol 2002; 184(12):3151-8. 26. Horsburgh MJ, Wharton SJ, Cox AG et al. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Mol Microbiol 2002; 44(5):1269-86. 27. Horsburgh MJ, Wharton SJ, Karavolos M et al. Manganese: Elemental defence for a life with oxygen. Trends Microbiol 2002; 10(11):496-501. 28. Gaballa A, Helmann JD. A peroxide-induced zinc uptake system plays an important role in protection against oxidative stress in Bacillus subtilis. Mol Microbiol 2002; 45(4):997-1005. 29. Cellier MF, Bergevin I, Boyer E et al. Polyphyletic origins of bacterial Nramp transporters. Trends Genet 2001; 17(7):365-70. 30. Patzer SI, Hantke K. Dual repression by Fe(2+)-Fur and Mn(2+)-MntR of the mntH gene, encoding an NRAMP-like Mn(2+) transporter in Escherichia coli. J Bacteriol 2001; 183(16):4806-13. 31. Privalle CT, Fridovich I. Iron-specificity of the Fur-dependent regulation of the biosynthesis of the manganese-containing superoxide dismutase in Escherichia coli. J Biol Chem 1993; 268:5178-81. 32. Hantke K. Selection procedure for deregulated iron transport mutants (fur) in Escherichia coli K 12: Fur not only affects iron metabolism. Mol Gen Genet 1987; 210(1):135-9.

Regulation of Bacterial MntH Genes

153

33. Hill PJ, Cockayne A, Landers P et al. SirR, a novel iron-dependent repressor in Staphylococcus epidermidis. Infect Immun 1998; 66(9):4123-9. 34. Inaoka T, Matsumura Y, Tsuchido T. SodA and manganese are essential for resistance to oxidative stress in growing and sporulating cells of Bacillus subtilis. J Bacteriol 1999; 181(6):1939-43. 35. Jakubovics NS, Jenkinson HF. Out of the iron age: New insights into the critical role of manganese homeostasis in bacteria. Microbiology 2001; 147(Pt 7):1709-18. 36. Jakubovics NS, Smith AW, Jenkinson HF. Oxidative stress tolerance is manganese (Mn(2+)) regulated in Streptococcus gordonii. Microbiology 2002; 148(Pt 10):3255-63. 37. Tseng HJ, McEwan AG, Paton JC et al. Virulence of Streptococcus pneumoniae: PsaA mutants are hypersensitive to oxidative stress. Infect Immun 2002; 70(3):1635-9. 38. Tseng HJ, Srikhanta Y, McEwan AG et al. Accumulation of manganese in Neisseria gonorrhoeae correlates with resistance to oxidative killing by superoxide anion and is independent of superoxide dismutase activity. Mol Microbiol 2001; 40(5):1175-86.

154

The Nramp Family

CHAPTER 14

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters Krisztina M. Papp, David G. Kehres and Michael E. Maguire

Abstract

I

nitially identified in the mouse, the Nramp class of transport proteins is present in the majority of Eukaryota and Bacteria thus far investigated. In contrast very few Archaea appear to possess Nramps. Mammalian Nramps were initially characterized as divalent cation/proton symporters, with the presumed physiological cation being Fe2+. However, initial Enterobacterial Nramp genes (named mntH) characterized express a transporter with a very high selectivity for Mn2+, the Ka being on the order of 100 nM. In contrast, while these Bacterial Nramps can transport Fe2+, affinity is poor (>10 µM) and well above the physiologically relevant free Fe2+ concentration. Mn2+ has subsequently been implicated as a physiologically relevant substrate for mammalian Nramp1. Bacterial mntH loci appear to be regulated by Mn2+ through MntR, a Mn2+-dependent repressor belonging to the DtxR class of repressors. Fe2+ can also regulate mntH expression through Fur while OxyR alters expression in response to peroxide challenge. Mutation of mntH does not confer any strong growth or other Mn2+-dependent phenotype, suggesting that alternative routes for Mn2+ uptake exist. In Salmonella enterica serovar Typhimurium, this function is fulfilled by SitABCD, an ABC-class ATPase transporter. SitABCD transport has Mn2+ transport and cation selectivity properties very similar to MntH with the major exception being Zn2+ which is a much more potent inhibitor of SitABCD than MntH. Mutation of mntH does not affect the ability of S. Typhimurium to invade macrophages, nor survive within them. Upon invasion mntH expression is markedly induced. Oral inoculation of mntH S. Typhimurium in a Nramp1-/- BALB/c mouse shows no attenuation. In contrast, tail vein injection in Nramp1+/+ 129/SvJ mice showed marked attenuation for sitABCD but not mntH mutants; however complete attenuation was seen with mntH sitABCD double mutants. Oral inoculation in the Nramp1+/+ C3H strain showed marked attenuation in a mntH mutant strain. These results suggest strongly that there is an interaction between a homologous Bacterial and host gene during infection and demonstrate than Mn2+ acquisition, although for currently unknown reasons, is important for Bacterial virulence.

Introduction

More than 25 years ago, Plant and Glynn1-3 made the initial discovery that a host gene can convey resistance to a bacterial pathogen. The presence of the wild type locus referred to as ity renders the mouse less susceptible to infection from Salmonella enterica serovar Typhimurium (S. Typhimurium). The locus was eventually mapped to mouse chromosome one. Succeeding studies generated further links confirming that this locus influences host susceptibility to other infections, including Leishmania donovani (lsh) and Mycobacterium bovis (bcg). The ity, lsh, and bcg loci were all independently mapped to mouse chromosome one strongly indicating The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

155

that the same gene was involved in the host resistance to pathogens. Interestingly, this same locus is also associated with increased resistance to Toxoplasma gondii infection.4 In 1993, using exon trapping, Vidal et al5 identified six potential candidate genes for bcg. RNA expression studies indicated one of the genes, now referred to as Nramp1 (Natural Resistance Associated Macrophage Protein 1), was primarily expressed in macrophages in the spleen and liver. Nramp1 is predicted to encode an integral membrane protein of 12 putative transmembrane domains with homology to both prokaryotic and eukaryotic transport systems.5 Further work confirmed that bcg, ity, and lsh were identical to Nramp1. A single amino acid difference, Gly to Asp at residue 169 within transmembrane domain 4 of Nramp1, was found in susceptible mice compared to resistant mice. When infected with bacteria, mice carrying the wild type isoform had fewer bacteria in their spleen and liver than those with the Asp169 allele. Macrophages that express the wild type G169 Nramp1 respond to interferon-γ or lipopolysaccharide stimulation with a substantial respiratory burst, increased formation of reactive oxygen species, and increased acidification of the phagosome, all of which would greatly assist host efforts to kill invading bacterial pathogens.6 In 1995, a second Nramp class gene, Nramp 2, mapping to chromosome 15, was discovered using a cross-hybridization approach.7-10 Unlike Nramp1, Nramp2 is expressed in multiple tissues with levels highest in the duodenum and kidney.11 The Nramp2 locus is regulated by dietary iron levels, is a crucial mediator of intestinal iron absorption, and is involved in transfer and storage of iron in the endosome.12,13 Strains of mice and rats carrying a Gly to Arg mutation in the Nramp2 residue equivalent to Gly169 of Nramp1 have been isolated. The mutation leads to microcytic anemia in both species due to iron deficiency.10,12-20 This same mutation generates symptoms of Mn2+ deficiency as well.21,22 These observations of links to cation homeostasis coupled with the protein’s localization in the membrane obviously suggested that Nramp proteins transported cations. In 1997, this was confirmed for Nramp2. Initially referred to in the rat as DCT1, Nramp2 was shown to be a highly electrogenic proton and divalent cation cotransporter with a broad substrate range that included Fe2+, Mn2+, Zn2+, Co2+, Cd2+, Cu2+, Ni2+, and Pb2+.23 Subsequent studies in mammalian systems have focused almost exclusively on iron as the physiologically relevant cation.10,12,13,15,18,24-34 More recently however, stimulated largely by work in several labs on prokaryotic Nramp homologs, Mn2+ has been implicated as a physiologically relevant substrate for Nramp1. Characterization of Nramp homologs in the Bacteria will be the focus of this review.

Nramp Proteins in Prokaryotes Initially identified in mice, Nramp homologs have been found in a wide range of organisms, including Homo sapiens, Drosophila melanogaster, Saccharomyces cerevisiae, Caenorhabditis elegans, and plants (Oryza sativa).35 Similarly, Nramp homologs are widespread in the Bacteria. A representative phylogenetic tree for Bacterial Nramps (Table 1 and Fig. 1) is strikingly congruent with that of the Bacteria as a whole, suggesting that this structural class of proteins is of ancient origin. Interestingly, there are few Nramp homologs in the Archaea based on current genomic sequence data.

Phylogenetics There are no other proteins convincingly related to Nramps in Bacterial genomes. BLAST analysis indicates that the closest prokaryotic relatives of Nramps are two small and weakly related families of hydrophobic proteins of unknown function (Table 1 and Fig. 1). One is a family of four proteins with single members in two Proteobacteria that lack Nramps and two Firmicutes that possess Nramps (labeled “Type II” in Figure 1. The other is a family of seven proteins with two isoforms in an α-Proteobacterium that thus far lacks Nramps, and one or two isoforms in three Firmicutes that possess Nramps (labeled “Type III” in Figure 1. Weaker homology with the most similar proteins of known function —branched-chain amino acid carriers in the sodium-substrate symporter family— is not sufficiently convincing to suggest analogous structures or transport mechanisms. Thus, while widespread, Bacterial Nramps have

156

Table 1. Representative Nramp proteins and putative homologs

Protein1

Species or Common Name

% Identity to Human Nramp14

MTGDKGPQRL…EEDQKGETSG MISDKSPPRL…EEQGGVQGSG MSGDTGPPKQ…EDQEKGRTSG MSGDTGPPKQ…EDQEKGRTSG MSGDTGPSKQ…EDQEKGRTSG MSGDTGTPNQ…EDQEEGRTSG MPGDMGPPKQ…EDQENGRTSG MTGDTDPPKQ…HQHFLYGLLE MSGSGPAMAS…ADVPGLAGPH MVLGPEQKMS…TEEATRGYVK MVLDPKEKMP…SEDTSGGNIK MVLDPEEKIP…TVDAVSLVSR AFTGPGFLMS…VCAINMYFVV FPANNETLEV…SVIVYVTDLN

34 33 33 33 33 33 34 32 32 30 31 31 33 27

100 88 90 90 89 89 90 87 68 64 64 64 71 65

gi|746574 gi|746573 AA445891 SWAMCA1730SK gi|1346609|sp|P49283 ACC:AF047331 PID:g2921865

MASSNNDGPI…SAVHDNAGYQ MSIAYLDPGN…ETFVVNDVYF SGFSFRKLWA…IYLVLEAGFL MSSNEAYHEP…AIMGEFVNGL MALNEGYHNK…CADCNSDVLP

30 29 36 33 33

47 51 61 59 60

gi|2642450 AL035526 NID:g4539378 PID:g5231117 GI:5231117

MPQLENNEPL…PWPFKAESSH MTGSTVSRQE…MSERVVSTET MENDVKENLE…LPKRVSVSNS

33 31 32

43 45 45

First 10 and Last 10 Amino Acids of Sequence3

gi|1352521|sp|P49279 gi|730193|sp|P41251 gi|2499218|sp|Q27981 gi|3024227|sp|Q95102 gi|3024223|sp|Q2794 gi|2232291 gi|2232289 gi|3258616 gi|1709350|sp|P51027 ACC:BAA24933 PID:g2911112 gi|2921274 gi|2921272 gb|AF048761|AF048761 gb|AI588597.1|fb97b06.y1

Table contined on next page

The Nramp Family

VERTEBRATA: >HS1 (Nramp1) Human >MM1 (Nramp1) Mouse >BT1 (Nramp1) Bovine >BB1 (Nramp1) Bison >BA1 (Nramp1) Water buffalo >OA1 (Nramp1) Sheep >CL1 (Nramp1) Red deer >SS1 (Nramp1) Pig >GG1 (Nramp1) Chicken >HS2 (Nramp2) Human >MM2 (Nramp2) Mouse >RN2 (Nramp2) Rat >OM1 Rainbow trout >DA15 Zebrafish METAZOA: >CE1 C. elegans >CE2 C. elegans >BM15 Brugia malayi >DM1 D. melanogaster >DH1 D. heteroneura PLANTS: (all MAGNOLIOPHYTA) >AT1 A. thaliana >AT2 A. thaliana >AT3 A. thaliana

% Identity to S. Typhimurium MntH4

Accession or Contig Number2

Protein1

Species or Common Name

% Identity to Human Nramp14

MEAEIVNVRP…KNVTAYGSLG VLQSVQIPFA…LVIVINGYLL MGVTKAEAVA…ADEDSKEPPV MRPAFSWRKL…RLRSAMTKST IPGPGFLISI…NGAAHKFKTR

(23) (37) 34 33 32

18 35 34 50 38

ACC#:Z74864 Y13140 ACC#:U00062 U00093 ACC#:Z73206 Y13138 C.albicans_Con4-2733 C.albicans_Con4-3075 C.albicans_Con4-3072 ACC#:Z69368 GI:1182037

MVNVGPSHAA…QLGMSHGDIS MTSQEYEPIQ…GFTTGKEVHL MRSYMQILQK…SYLLGADIHF MENKVSEISE…QMAVSGVTGS* MGFLTNFTNF…SMLLGYDVPL* MNQQQQQPLL…IIAFANGADI MSSQSYYMND…IVWLGMGVSF

29 31 31 30 31 31 32

26 27 28 26 27 25 26

gi|5670176|AF161317_1 gnl|Sanger_601|S.tContig367 gi|5670178|AF161318_1 gnl|Sanger_632|Y.p_Contg669 gi|5670180|AF161319_1 gi|5670182|AF161320_1 gi|5670184|AF161321_1 RRC02893 A1_32844_33512

MTDNRVENSS…LLVGTVMGLS MTDXRVENSS…LLVGTVMGLS MTNYRVESSS…WLLVGTALGL LMGPAFIAAI…ILGKLVVLIV MDPGNWATAI…NLTLLYFWFG MSAKDTPAPQ…LQLLADFAFG WATDIQAGSQ…LALGIVGATI MIHENSMSGR…IIGATVMPHA

100 95 93 80 46 40 40 49

33 31 33 34 34 37 40 35

gi|3025117|sp|P96593 MMNKDITAQS…NVFLIVDTFR* gnl|TIGR_1280_2|S.a_2653+3345 AQLAIIATDI…ILNVYLIVQT

50 34

32 33

First 10 and Last 10 Amino Acids of Sequence3

AF141203 GI:5231114 gb|AI441171 sa52b11.y1 gi|2231132|gb|AAB62273.1 gi|2231149|gb|AAB61961.1 gi|1698582|gb|AAC49720.1

Table contined on next page

157

>ATEIN2A5 A. thaliana >GM15 Soybean >OS1 Oryza sativa >OS2 Oryza sativa >OS3 Oryza sativa FUNGI: (all ASCOMYCOTA) >SC1 S. cerevesiae >SC2 S. cerevesiae >SC3 S. cerevesiae >CB1 C. albicans >CB2 C. albicans >CB3 C. albicans >SP1 S. pombe BACTERIA:6 Proteobacteria: >ST1 S. Typhimurium >SI1 S. typhi >EC1 E. coli >YP1 Y. pestis >PA1 P. aeruginosa >PA2 P. aeruginosa >BC15 B. cepacia >RC1 R. capsulata Firmicutes: >BS1 B. subtilis >SA1 S. aureus

% Identity to S. Typhimurium MntH4

Accession or Contig Number2

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

Table 1. Continued

158

Table 1. Continued

Protein1

Species or Common Name

% Identity to Human Nramp14

MDKLSIREDN…LLYLTFTGQT* MRKINIFKGK…LNIALLVSYF* MSFWKTLFAY…AMEQQVEEVK* LAQRTQGSLK…MVLIWLTVTG LAQDTRTSLK…VMLIYLTVTG* MSHPFRLGFW…VVLIYLTVTS*

44 28 32 43 44 41

29 26 29 30 29 26

gnl|TIGR_1097|C.t_gct_3

MAVSFSKLIQ…LLSTTVTGDS*

37

30

gnl|TIGR_1299|D.r_8793

MDSRSPSLPD…GYLLWELLGG*

51

32

gb|L42023|L42023 gnl|Sanger_65699|N.m_NM.seq gi|2632707|embl|Z99106.1 gnl|TIGR_1280_2|S.a_2229

RNAVLGAAFL…FVVIIMAILS RNALIGAAFL…IVVGLMAVLS LMGAAFLMAT…ALVVIVMAVM ILLSIIIDIG…DAVLVTILTG

17 17 15 14

15 15 14 15

gnl|TIGR_920|t_f_218 gnl|TIGR_920|t_f_199 gnl|TIGR_1764|M.avium_5456 gnl|TIGR_1764|M.avium_5540 emb|AL035300|MLCB1886 gnl|GTC_1488|C.a_AE001437 gnl|GTC_1488|C.a_AE001437

MSVIPELHGA…YGYTVVFPSA* MSAAPAARNI…YGGLNSIPGW* ITGPGLIVMV…WCLVLLSLAL LAIVGPGIIV…YERADTVLGA MTYISTDAIS…PVRRIGLLML LGIIGPGLIT…IIILSLILFV SIVGPGLITA…IILTILAFAG

21 21 20 20 18 18 19

17 19 16 18 16 20 20

First 10 and Last 10 Amino Acids of Sequence3

gi|4027858|AE001438 gnl|GTC_1488|C.a_AE001437 gnl|TIGR_1351|gef_6353 gnl|TIGR_1764|M.avium_5712 gi|3097212|embl|-AJ005699.1 gb|U15184|MLU15184

Table contined on next page

The Nramp Family

>CA1 C. acetobutylicum >CA2 C. acetobutylicum >EF1 E. faecalis >MA1 M. avium >MB17 M. bovis BCG >ML1 M. leprae Green sulfur bacteria: >CT1 C. tepidum Thermus/Deinococcus group: >DR1 D. radiodurans Type II Homologs: >HIH21 H. influenzae >NMH21 N. meningiditis >BSH21 B. subtilis >SAH21 S. aureus Type III Homologs: >TFH31 T. ferrooxidans >TFH32 T. ferrooxidans >MAH31 M. avium >MAH32 M. avium >MLH31 M. leprae >CAH31 C. acetobutylicum >CAH32 C. acetobutylicum

% Identity to S. Typhimurium MntH4

Accession or Contig Number2

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

159

Table 1. Legend 1Protein abbreviations correspond to those used in Figure 1. 2For proteins with DNA or amino acid

sequence in GenBank, accession numbers are indicated. For proteins derived from incomplete genome projects, the most recent sequence or contig number at the time or writing is indicated. 3As sequence identifiers in incomplete genome projects may change between releases, the first and last 10 amino acids of each sequence in this table are indicated to facilitate retrieval. 4Percent identities are based on a CLUSTALW alignment of all 63 sequences in this Table. 5Nramp sequences of these organisms are incomplete. Percent identities are given for common regions. For ATEIN2A from Arabidopsis, percent identity reflects only the N-terminal portion of the protein that is homologous to Nramps. 6The following Bacterial species have complete or nearly complete genomic sequences and lack an Nramp homolog: Aquificales: Aquifex aeolicus; Chlamydiales: Chlamydia trachomatis; Cyanobacteria: Synechocystis ssp. PCC6803; Cytophagales: Porphyromonas gingivalis; Firmicutes: Streptococcus sp., Mycoplasma sp.; α-Proteobacteria: Rickettsia prowezekii; β-Proteobacteria: Bordetella sp., Neisseria sp.; γ-Proteobacteria: Haemophilus influenzae, Vibrio cholerae, A. actinomycetemcomitans; ε-Proteobacteria: Campylobacter jejuni, Helicobacter pylori; Spirochaetales: Borrelia burgdorferi, Treponema pallidum; Thermotogales: Thermotoga maritima; 7The amino acid sequence of M. tuberculosis Nramp is identical to that of M. bovis BCG 40.

not undergone large scale amplification and divergence comparable to that of the ABC and P-type ATPase transporter families. Bacterial Nramps are as similar to Eukaryotic Nramps as the latter are collectively to one other. Nramps are found in every major branch of the crown group Eukaryotes for which there is representative sequence, i.e., vertebrates, worms, insects, plants and fungi. As with Bacteria, individual Eukaryotes appear to have relatively few Nramp genes (one to three per genome), and phylogenetic relationships among them mirror those of their respective organisms. Identity among Nramps from divergent multicellular Eukaryotes ranges from 25% to 60%, identity of these to the fungal Nramps is 25% to 30%. Identity between any Eukaryotic and Bacterial Nramp is comparable to the identity between Bacterial subclasses themselves, about 30%-40% (Table 1). As within the prokaryotes, there are no other proteins within the Eukarya with similarity to the Nramps with the exception of the EIN2 protein of Arabidopsis thaliana, involved in the ethylene signaling pathway.36 Only the N-terminus of this protein shows similarity to Nramps, and the significance of this relationship is unknown.

Membrane Topology Topology predictions suggest that all Nramps, Bacterial and Eukaryotic, share a conserved core extending at least from the first transmembrane segment through the hydrophilic region following the eighth transmembrane segment, and in most cases extending through the eleventh transmembrane segment. Eukaryotic Nramps however appear to have an additional twelfth transmembrane segment that is absent in all Bacterial Nramps.

Transport Functionality of the Bacterial homologs for cation transport has been demonstrated in Mycobacterium tuberculosis, Mycobacterium leprae, Escherichia coli, S. Typhimurium, and Bacillus subtilis. In the Enterobacteriaciae, Nramp genes have been identified though not yet characterized in Salmonella paratyphi, Yersinia pestis and Klebsiella pneumoniae among others.11,35,37,38 Excepting K. pneumoniae, the Enterobacteriaciae share a gene arrangement in which Nramp and nupC (a nucleoside permease) are transcribed divergently with about 300 base pairs between the open reading frames.37 Currently, the transport function of the presumed Nramp transporters has been characterized in depth only in E. coli, S. Typhimurium,37-39 and Mycobacterium tuberculosis.40

160

The Nramp Family

Figure 1. Phylogenetic tree of bacterial NRAMPs and related proteins. Phylogenetic tree of bacterial Nramps and related proteins. A CLUSTALW alignment was performed using two human Nramps, three S. cerevisiae Nramps, 18 Bacterial Nramps and 11 Type II and Type III putative bacterial Nramp homologs indexed in (Table 1), along with an outlier group composed of 6 Bacterial branched chain amino acid transporters. Accession numbers for these latter sequences are: ECB1 (E. coli) = PID:g1786601, PAB1 (P. aeruginosa) = gi|115118|sp|P19072, SAB1 (S. aureus) = gnl|TIGR_1280|S.aureus_4348, SNB1 (S. pneumoniae) = gnl|TIGR_1313|S.pneumoniae_sp_21 , EFB1 (E. faecalis) = gnl|TIGR_1351|gef_6271 , and CP1 (C. perfringens) = gi|1220104|gnl|PID|d1009231. The CLUSTALW multiple alignment program74 was used to align Nramp sequences, to derive an unrooted phylogenetic tree using the PHYLIP neighbor-joining program75 and to assign confidence level estimates to individual tree branches using a multiple random resampling (bootstrap) program76 with 1000 resamplings as described previously.77 The results were converted to a dendrogram using a Windows 95® version of NJPlot (http://pbil.univ-lyon1.fr/software/ njplot.html). Branches shown are the most probable in all cases; the numbers on each branch of the dendrogram are the number of times in 1000 resamplings that the corresponding node occurred. Numbers above 200 are generally considered to be significant indication of a valid branching.

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

161

As will be detailed below, proton-stimulated divalent cation transport has been demonstrated for two bacterial Nramp proteins, distinctively Mn2+ transport, which is H+-stimulated. Consequently, Bacterial Nramp homologs have been named mntH. Makui et al38 determined that the yfeP gene (renamed mntH) of the E. coli K-12 genome was an Nramp family member and showed uptake of Fe2+ and Mn2+. Concomitantly, Kehres et al37 cloned Nramp homologs from S. Typhimurium, Pseudomonas aeruginosa, and Burkholderia cepacia, in addition to that of E. coli K-12. E. coli and S. Typhimurium each have a single Nramp homolog, and each was shown to transport divalent cations. Interestingly, P. aeruginosa and B. cepacia have two and three Nramp homologs respectively.

Mutant Phenotypes Disruption of mntH in E. coli and S. Typhimurium does not affect bacterial growth under aerobic conditions in minimal or rich medium, implying that MntH is not crucial for growth in normal laboratory conditions.37,38 The lack of a strong growth phenotype suggests either that Mn2+ is not critical for growth or that other transporters in the bacteria can compensate for the loss of MntH-mediated uptake. Phenotypes other than growth however were described by both laboratories. Of most direct relevance to the cation transport function of MntH, Makui et al38 demonstrated that overexpression of mntH from a plasmid would restore growth to the temperature sensitive hflB1 mutant, which requires high intracellular metal ion concentrations to grow at nonpermissive temperatures.41 This result suggests that transport of metal ions by MntH enables the mutant to grow at nonpermissive temperatures. In addition, when MntH was overexpressed, Mn2+, Cd2+, Co2+, Fe2+, Zn2+, Ni2+, and Cu2+ (in decreasing order) were cytotoxic to cells. Since Mn2+ was the most cytotoxic, MntH was suggested to have a higher affinity for Mn2+.38 Likewise, Kehres et al. confirmed that overexpression of mntH renders both E. coli and S. Typhimurium more sensitive to growth inhibition by Mn2+ and Cd2+, and in addition showed that the loss of mntH rendered S. Typhimurium and E. coli more sensitive to hydrogen peroxide but not superoxide.37

Physiological Cation Transport Studies in eukaryotes have shown that Nramp homologs transport a variety of divalent metals with some apparent selectivity for Fe2+ and Mn2+.12,23,42 Unfortunately, no investigators have comprehensively determined affinities of eukaryotic Nramps for potential substrate or inhibitory cations, especially Fe2+ versus Mn2+. The only values extant in the literature appear to be a demonstration of a 2 µM affinity of Fe2+ for rat Nramp2 (DCT1)43 and a Zn2+ affinity of 0.6 µM for mouse and human Nramp1.24 It is not possible without further data to determine whether mammalian Nramp1 and Nramp2 are general divalent cation transporters or are more or less selective for Fe2+, Mn2+, Zn2+ or another metal. In prokaryotes however, more information is available. Makui et al38 indicated, on the basis of a 10-fold difference in total cation uptake, that E. coli MntH preferred Mn2+ over Fe2+ at the concentrations tested. Kehres et al. directly determined cation affinities for the S. Typhimurium and E. coli MntH transporters37 either by direct kinetic analysis or by inhibition of54 Mn2+ uptake with other cations. Mg2+ and Ca2+ do not inhibit54 Mn2+ uptake in either species. E. coli MntH exhibits an affinity (Ka) of 1 µM for Mn2+ while S. Typhimurium exhibits a Ka of 0.1 µM (Fig. 2). Both affinities are independent of pH; however, for both species, the transport rate (Vmax) increases with decreasing pH, suggesting proton dependence of transport. In contrast, the Ki for inhibition by other cations, with the exception of Fe3+, is pH dependent with acid pH increasing affinities three to ten-fold. In S. Typhimurium, Ni2+, Cu2+ and Zn2+ inhibit uptake via MntH with Ki’s greater than 100 µM while Co2+ inhibits with a Ki of 20 µM. Fe3+ and Pb2+ also inhibit weakly, exhibiting Ki’s of 100 µM or greater. Cd2+ is the most potent inhibitor with a Ki of 1 µM. Fe2+ inhibition of Mn2+ uptake is pH dependent with a Ki of 10 µM at pH 5.5, rising to 100 µM at pH 7.5 (Fig. 2). The E. coli MntH had a similar inhibition profile, except that Ki’s were three- to ten-fold higher for all cations. The pattern of affinities suggests that, at least for E. coli and S. Typhimurium, the physiologically relevant

162

The Nramp Family

Figure 2. Cation inhibition of MntH transport. A S. Typhimurium strain carrying mntH on a high copy number plasmid was incubated with 0.1 µM54Mn2+ containing different concentrations of potential competitors. Uptake at different inhibitor concentrations was normalized to uptake in the absence of inhibitor. Details of this transport assay and additional cation inhibition data have been published.37 τ= Mn2+; υ= Cd2+; ν= Fe2+; σ= Fe3+; λ= Zn2+

cation transported by MntH is Mn2+. While MntH is capable of transporting Fe2+, the Ka for Fe2+ is too high to be physiological since free Fe2+ concentrations in biological systems are at least two orders of magnitude lower than the apparent Ka. In contrast, the Ka for Mn2+ is on the same order as the concentrations found in biological systems.37,39

Transport Mechanism Initial studies in eukaryotes showed that divalent metal transport through Nramp was proton-coupled (Gunshin et al, 1997)23 involving cotransport of H+ and divalent cation with a 1:1 stoichiometry. Most unusually for a transporter, subsequent work has reported that the stoichiometry can apparently be variable.34,44-46 Strikingly, while mammalian Nramp2 clearly cotransports proton and cation, murine and human Nramp1 can function as a H+ and divalent cation antiporter.24 Mechanistic studies in prokaryotes are not nearly as advanced although what data there is suggests, like eukaryotic Nramp2, cotransport of proton and divalent cation. Treatment of E.

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

163

coli with a protonophore markedly inhibited MntH transport while depletion of ATP did not38 suggesting proton coupling. As already noted, the Vmax for both E. coli and S. Typhimurium Mn2+ influx is pH sensitive while the Km is independent of pH, consistent with proton coupling.37 While these experiments are not conclusive, the mechanism of MntH transport appears similar to mammalian Nramp transport.23

Regulation of MntH Initial observations indicated that expression of a mntH::lacZ reporter construct could be regulated by reactive oxygen species, as well as divalent cations including Mn2+ and Fe2+. Inspection of the promoters of E. coli and S. Typhimurium mntH suggested at least three possible regulatory sites, one for Fur, one for OxyR, and a novel inverted repeat encompassing 22 bp.37 In Gram-negative and Gram-positive bacteria with low GC content, proteins involved in iron uptake are repressed by Fur (ferric uptake regulator) in the presence of adequate iron.47-49 Since MntH transports iron, it would appear at first glance logical for the locus to be regulated by Fur. Likewise, both Mn2+ and Fe2+ are involved in defense against reactive oxygen and nitrogen species, making regulation by OxyR reasonable since this repressor controls numerous genes important for response to reactive oxygen.50,51 Both of these suppositions are correct; Fur (Fig. 3) and OxyR repress mntH in the presence of Fe2+ and peroxide, respectively.37,52 Mn2+ clearly regulates mntH expression but does not mediate that repression via Fur although Mn2+ is known to bind to Fur to regulate some genes.52 Additional Fe2+ and Mn2+ regulated repressors have been identified, one of which is the diphtheria toxin repressor, DtxR, which regulates toxin production in an iron-dependent manner.53 DtxR homologs have since been found in many Gram-positive bacteria. However, DtxR homologs have a much broader role. DtxR homologs are preferentially regulated by Mn2+ rather than Fe2+ in Treponema pallidum,54 Streptococcus gordoni, 55 B. subtilis,56 and Staphylococcus aureus.57 These repressors have generally been named MntR. DtxR homologs also have been shown to bind to an inverted repeat promoter sequence.58,59 Consequently, when the genomic sequence of E. coli and S. Typhimurium indicated a weak DtxR/MntR homolog in both species (15-20% identity), it was hypothesized that it encoded a Mn2+ dependent repressor that bound to the inverted repeat in the mntH promoter. Patzer and Hantke in E. coli and this laboratory in S. Typhimurium confirmed this hypothesis (Fig. 3).60,52 In E. coli Patzer and Hantke also directly demonstrated Mn2+-dependent repressor binding to the inverted repeat sequence using DNA footprinting.60 In both species, MntR regulates expression of mntH in response to Mn2+. In S. Typhimurium at least, MntR can also repress mntH expression when bound with iron albeit at a concentration higher than iron’s affinity for Fur.52 Fur and MntR have been shown to account for all cation regulatory effects at the mntH locus.52,60 Since mntH is regulated (in part) by OxyR and since Mn2+ is an obligate cofactor for sodA, encoding a cytosolic Mn2+ superoxide dismutase, a relationship between Mn2+ and toxicity from reactive oxygen species might be expected. E. coli K-12 and S. Typhimurium LT2 have been tested for reactive oxygen sensitivity.37 Mutation of mntH rendered both species significantly more sensitive to killing by peroxide than wild type cells. Overexpression of mntH did not alter resistance to peroxide or superoxide. Interestingly, although Mn2+ is a cofactor for one of the organism’s superoxide dismutases, an mntH mutation did not alter sensitivity to superoxide.37 Further, since S. Typhimurium LT2 is rpoS- and E. coli is rpoS+, identical responses in both species to reactive oxygen suggests that RpoS, a sigma factor active in stress responses, is not involved in regulation of mntH. Thus, one role for MntH may be to provide Mn2+ as one component of the cell’s defenses against reactive oxygen, whether in the general environment or specifically within the host cell during an infection.

Other Mn2+ Transporters

Since loss of MntH does not result in a significant Mn2+-dependent phenotype and elicits no obvious growth deficiency attributable to Mn2+, the cell presumably must have other Mn2+ transporters that can compensate for its loss. Sequence analysis of the S. Typhimurium genome

164

The Nramp Family

Figure 3. Control of iron and manganese repression by Fur and MntR. Cultures of wild type or S. Typhimurium or S. Typhimurium strains carrying various mutations were grown overnight with no added metal, with 10 µM MnSO4 or with 10 µM FeSO4. For each strain the β-galactosidase activity of metal-challenged cultures was normalized to that of the same strain grown in the absence of added metal. Panel A shows the effect of mutation of fur or the Fur motif of the mntH promoter on repression by Mn2+ and Fe2+. Panel B shows the effect of mutation of mntR or the MntR motif of the mntH promoter on repression by Mn2+ and Fe2+. The data indicate that both Fe2+ and Mn2+ can mediate repression through MntR, but that under the conditions of this assay, only Fe2+ can mediate repression through Fur. Additional data extending these results has been published.52

determined that sitABCD, an ABC cassette-ATPase type transporter previously considered to be a ferrous iron transporter,61 is the only other gene in the S. Typhimurium genome that possesses the palindromic sequence bound by MntR.39 Subsequent analysis of SitABCD’s transport properties and regulation indicated that SitABCD is not a physiologically relevant Fe2+ transporter but like MntH is highly selective for Mn2+. Its Mn2+ affinity of 100 nM is equivalent to that of MntH (Fig. 4). Also similar to MntH, SitABCD’s affinity for Mn2+ is not dependent on pH while the Ki for inhibitory cations is pH dependent. As with MntH, Co2+, Cu2+, Ni2+, Fe2+, and Fe3+ all inhibited Mn2+ uptake via SitABCD. The Ki of Fe2+ for SitABCD

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

165

Figure 4. Cation inhibition of SitABCD transport. A S. Typhimurium strain carrying sitABCD on a high copy number plasmid was incubated with 0.1 µM54Mn2+ containing different concentrations of potential competitors. Uptake at different inhibitor concentrations was normalized to uptake in the absence of inhibitor. Details of this transport assay and additional cation inhibition data have been published.39 τ= Mn2+; υ= Zn2+; n= Fe2+; σ= Fe3+.

is slightly better than that for MntH but still above physiological free Fe2+ concentrations. Unlike MntH, Zn2+ inhibited SitABCD with a significantly better affinity than MntH and was not sensitive to pH (Fig. 4). Interestingly, SitABCD transport, while pH dependent like MntH, is maximal at alkaline pH rather than the acid pH preferred by MntH. Thus uptake through SitABCD increases with increasing pH, whereas uptake through MntH decreases with increasing pH implying that the organism may use MntH and SitABCD under different growth conditions.

Mn2+ in Pathogenesis S. typhimurium is an intracellular pathogen. Upon phagocytosis by a macrophage, bacteria reside in a subcellular compartment in the mammalian cell referred to as Salmonella-containing vacuole (SCV).62,63 Residence within the SCV has at least two consequences relevant to Mn2+. First, essential ions and nutrients needed for bacterial growth and survival are low in the SCV.64 Second, invasion by a bacterium elicits multiple responses from the host cell, among which generation of reactive oxygen and nitrogen species are vital. Thus Mn2+ could be necessary to the bacterium for both nutrient and defense purposes. The invasion of S. Typhimurium carrying a mutation in mntH has been studied using a murine macrophage-like cell line, RAW264.7 cells. Upon bacterial invasion of the cells, ex-

166

The Nramp Family

Figure 5. Induction of mntH transcription after invasion of RAW264.7 macrophages. S. Typhimurium strain 14028s was transformed with the single copy mntH::lacZYA operon fusion plasmid pMLZ10437 and used to infect RAW264.7 cell lines with or without a functional Nramp1 allele65 β-Galactosidase activity was measured using a chemiluminescent assay.

pression of mntH increased significantly, reaching a maximum level three hours after infection (Fig. 5). However, neither invasion efficiency nor survival of the bacteria was affected by mutation of mntH.37 Similar results have been obtained after S. Typhimurium invasion of epithelial cells (M.L. Zaharik and B.B. Finlay, personal communication). Although mntH induction occurred in the macrophage cells (Fig. 5), the degree was modest, usually three- to four-fold.37 However, RAW264.7 cells do not express Nramp1 as they carry a gene with the inactivating Gly169Asp mutation. An Nramp1 expressing cell can be generated however by stable transfection of RAW264.7 cells.65 When this Nramp1+/+ line is infected with S. Typhimurium, expression of mntH is markedly induced thirty-fold or more (Fig. 5), an order of magnitude greater than in Nramp1-/- cells. This remarkable result shows that expression of a bacterial gene is influenced by the presence or absence of its ortholog in the host cell. Such results suggest that MntH and Mn2+ might be important in the pathogenic process. Currently available literature does not provide extensive information on the regulation of sitABCD expression. The operon contains both a Fur and MntR site, but unlike mntH it has no OxyR site. Thus its expression is controlled primarily by Mn2+ and Fe2+ (A. Janakiraman and J.M. Slauch, personal communication). As with mntH, expression of sitABCD is induced upon invasion of the macrophage-like RAW264.7 cell line, and the degree of expression is greater in cells carrying a functional Nramp1 (M.L. Zaharik, D.G. Kehres, M.E. Maguire and B.B. Finlay, manuscript in preparation).

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

167

The experiments described above are suggestive of a role for mntH and Mn2+ in pathogenesis but do not directly assess involvement. More direct evidence has recently been provided in an elegant series of experiments by Jabado et al66 showing that the eukaryotic Nramp1 transporters actively modify Mn2+ content of the SCV. These authors used a Mn2+-binding dye coupled to a porous particle to assess Mn2+ movement within the macrophage during phagocytosis. Particles with coupled dye were ingested by macrophages, and fluorescence quenching of the dye was followed by digital fluorescence imaging. Nramp1 is known to be recruited to the phagosome after particle ingestion or bacterial invasion.67-70 The results indicated that Nramp1+/+ macrophages appear to extrude Mn2+ from the phagosome much faster than Nramp1-/- macrophages. Extrusion was dependent on acidification of the phagosome, consistent with H+-dependent Mn2+ transport by Nramp1. Thus, Mn2+ transport by Nramp1 appears to be directly involved in phagocytosis. Dyes or other methodologies to detect movement of other transition metal divalent cations are not available however. Therefore, whether this effect of Nramp1 is completely Mn2+ selective will have to await the detailed characterization of cation affinities for Nramp1 transport. Nonetheless, these experiments give strong support to the hypothesis that Mn2+ is important for pathogenesis. These results with Nramp1 imply that Mn2+ transport would be important for the bacterium also. Previous work37 suggested that mutation of mntH alone had minimal effect upon oral infection of BALB/c mice in that mortality was not reduced but only delayed by about two days. However, BALB/c mice are Nramp1-/-. As mice congenic except for the Nramp1 locus were not available to us, we chose to test C3H mice which are Nramp1+/+. As shown in Figure 6, the effect of mutation in mntH is significant in C3H mice. The dose used is about two logs above the S. Typhimurium LD50 for an Nramp1+/+ mouse, so the attenuation is marked. The double mutant is extremely attenuated. These data are suggestive of an interaction between orthologous genes in host and pathogen. Nonetheless, the experiment in Figure 6 is compromised, because the C3H and BALB/c mice are not congenic thus making it possible that another mouse locus contributes to the observed phenotype. Significantly more convincing evidence that mntH and sitABCD and thus Mn2+ are important for pathogenicity has recently been published by Boyer and colleagues.71 These authors used strains of S. Typhimurium with combinations of mutations in mntH, sitABCD and feoB (ferrous iron transporter).72,73 Transport of Mn2+ by SitABCD was shown in agreement with our results.39 Using tail vein injection of S. Typhimurium as a model of typhoid disease, these authors reported that the Nramp1+/+ 129/SvJ strain of mice could clear both wild type bacteria and all combinations of mutant strains without mortality. This contrasts with our results that mntH mutants are attenuated in C3H Nramp1+/+ mice. In the Nramp-/- 129/SvJ mice, Boyer at al. reported that mutation of mntH alone had no effect on virulence, consistent with the results of Kehres et al. using oral inoculation of Nramp1-/- BALB/c mice.37 However, mutation of sitABCD alone significantly attenuated virulence, increasing mean time to initial morbidity and ultimately reducing overall mortality. The mntH sitABCD double mutant was completely avirulent. A mutation in feoB also resulted in decreased mortality though less so than with a sitABCD mutation. Although mntH mutation alone did not diminish virulence, its combination with a feoB mutation also led to complete attenuation. (Strains deficient in feoB and sitABCD were also avirulent as was the triple mutant strain.71) These data clearly show that acquisition of both Mn2+ and iron by the pathogen is important for virulence. It is of interest to note also the differences (as far as they can be compared) between these results and our unpublished data in the Nramp1+/+ C3H mice. In the Nramp1+/+ 129/SvJ strain, bacteria injected into the tail vein are readily cleared whether or not mutations in mntH or sitABCD are present. In contrast, in the Nramp1+/+ C3H strain, attenuation of a mntH mutant is clearly seen after oral inoculation. Whether this is a difference in mouse strains used, a difference in route of inoculation or both will have to be sorted out by further experiments. Either answer would be of interest however. If the difference is due primarily to a strain difference, it implies interaction with another locus in addition to Nramp1. If the difference is due to route of inoculation, this clearly has implications for where and why Mn2+ is important. For

168

The Nramp Family

Figure 6. Effect of mutation of mntH on virulence in BALB/c and C3H mice. Mice were orally inoculated with 3-5 108 bacteria of the indicated strain and monitored twice daily for morbidity and mortality. No difference in induced morbid symptoms was observed with wild type versus mntH strains.

example, it may be that Mn2+ acquisition is important while S. Typhimurium is within the macrophage SCV and being distributed throughout the host organism. However, once within the circulation, Mn2+ acquisition is not crucial to pathogen survival.

Conclusions The MntH proteins, the Bacterial Nramp homologs, like their mammalian counterparts are transition metal divalent cation transporters. To date, the Enterobacterial MntH transporters are quite selective for Mn2+ although they can transport Fe2+ and probably Cd2+. Their transport of Fe2+ does not appear physiologically relevant for the bacterium. Nonetheless, it is important to remember that the selectivity observed in E. coli and S. Typhimurium for Mn2+ may not be present in MntH orthologs from other Bacteria. Indeed, it is hard to understand why organisms like P. aeruginosa express two and B. cepacia three transporters unless the cation selectivity and thus physiological relevance of each transporter differs in some manner. It will be important to thoroughly investigate factors such as cation selectivity in each new system to ensure that data are interpreted with regard to the physiologically relevant cation. Just as Fe2+ cannot be assumed to be the physiologically relevant ligand for a transporter solely on the basis of homology or growth phenotype, homology and phenotype cannot define a Mn2+ transporter in the absence of actual transport data. Iron has long been thought to be the primary divalent transition metal cation important for virulence. Characterization of Nramp transport in eukaryotes has led to investigation of Nramp function in the Bacterial and the demonstration in some Enterobacterial species that Mn2+ transport via an Nramp class transporter is important for bacterial pathogenicity. The role of Mn2+ in prokaryotic metabolism and bacterial pathogenesis will clearly be a very active field of investigation for some time to come.

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

169

References 1. Plant J, Glynn AA. Natural resistance to Salmonella infection, delayed hypersensitivity and Ir genes in different strains of mice. Nature 1974; 248(446):345-347. 2. Plant J, Glynn AA. Genetics of resistance to infection with Salmonella typhimurium in mice. J Infect Dis 1976; 133(1):72-78. 3. Glynn AA, Bradley DJ, Blackwell JM et al. Genetics of resistance to infection. Lancet 1982; 2(8290):151. 4. Blackwell JM, Roberts CW, Roach TI et al. Influence of macrophage resistance gene Lsh/Ity/Bcg (candidate Nramp) on Toxoplasma gondii infection in mice. Clin Exp Immunol 1994; 97(1):107-112. 5. Vidal SM, Malo D, Vogan K et al. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993; 73(3):469-485. 6. Barton CH, Whitehead SH, Blackwell JM. Nramp transfection transfers Ity/Lsh/Bcg-related pleiotropic effects on macrophage activation: Influence on oxidative burst and nitric oxide pathways. Mol Med 1995; 1(3):267-279. 7. Gruenheid S, Cellier M, Vidal S et al. Identification and characterization of a second mouse Nramp gene. Genomics 1995; 25(2):514-525. 8. Vidal S, Belouchi AM, Cellier M et al. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 1995; 6(4):224-230. 9. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci USA 1995; 92(22):10089-10093. 10. Canonne-Hergaux F, Gruenheid S, Ponka P et al. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999; 93(12):4406-4417. 11. Forbes JR, Gros P. Divalent-metal transport by NRAMP proteins at the interface of host- pathogen interactions. Trends Microbiol 2001; 9(8):397-403. 12. Fleming MD, Romano MA, Su MA et al. Nramp2 is mutated in the anemic Belgrade (b ) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 1998; 95(3):1148-1153. 13. Fleming MD, Trenor CC, Su MA et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16(4):383-386. 14. Oates PS, Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol 1996; 270(5 Pt 1):G826-G832. 15. Garrick MD, Scott D, Kulju D et al. Evidence for and consequences of chronic heme deficiency in Belgrade rat reticulocytes. Biochim Biophys Acta 1999; 1449(2):125-136. 16. Pallarés I, Lisbona F, Lopez Aliaga I et al. Effect of iron deficiency on the digestive utilization of iron, phosphorus, calcium and magnesium in rats. Br J Nutr 1993; 70:609-620. 17. Al Younes HM, Rudel T, Brinkmann V et al. Low iron availability modulates the course of Chlamydia pneumoniae infection. Cell Microbiol 2001; 3(6):427-437. 18. Su MA, Trenor CC, Fleming JC et al. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 1998; 92(6):2157-2163. 19. Fleming MD, Andrews NC. Mammalian iron transport: An unexpected link between metal homeostasis and host defense. J Lab Clin Med 1998; 132(6):464-468. 20. Sheth S, Brittenham GM. Genetic disorders affecting proteins of iron metabolism: Clinical implications. Annu Rev Med 2000; 51:443-64.443-464. 21. Chua AC, Morgan EH. Manganese metabolism is impaired in the Belgrade laboratory rat. J Comp Physiol [B] 1997; 167(5):361-369. 22. Chua AC, Morgan EH. Effects of iron deficiency and iron overload on manganese uptake and deposition in the brain and other organs of the rat. Biol Trace Elem Res 1996; 55(1-2):39-54. 23. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388(6641):482-488. 24. Goswami T, Bhattacharjee A, Babal P et al. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J 2001; 354(Pt 3):511-519. 25. Kuhn DE, Baker BD, Lafuse WP et al. Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J Leukoc Biol 1999; 66(1):113-119. 26. Zoller H, Pietrangelo A, Vogel W et al. Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients with hereditary haemochromatosis. Lancet 1999; 353(9170):2120-2123. 27. Atkinson PG, Barton CH. High level expression of Nramp1G169 in RAW264.7 cell transfectants: Analysis of intracellular iron transport. Immunology 1999; 96(4):656-662.

170

The Nramp Family

28. Fleming RE, Migas MC, Zhou X et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: Increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 1999; 96(6):3143-3148. 29. Gruenheid S, Canonne-Hergaux F, Gauthier S et al. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J Exp Med 1999; 189(5):831-841. 30. Zhong W, Lafuse WP, Zwilling BS. Infection with Mycobacterium avium differentially regulates the expression of iron transport protein mRNA in murine peritoneal macrophages. Infect Immun 2001; 69(11):6618-6624. 31. Picard V, Govoni G, Jabado N et al. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem 2000; 275(46):35738-35745. 32. Gomes MS, Appelberg R. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology 1998; 95(2):165-168. 33. Thomine S, Wang R, Ward JM et al. Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc Natl Acad Sci USA 2000; 97(9):4991-4996. 34. Sacher A, Cohen A, Nelson N. Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J Exp Biol 2001; 204(Pt 6):1053-1061. 35. Cellier MF, Bergevin I, Boyer E et al. Polyphyletic origins of bacterial Nramp transporters. Trends Genet 2001; 17(7):365-370. 36. Alonso JM, Hirayama T, Roman G et al. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 1999; 284(5423):2148-2152. 37. Kehres DG, Zaharik ML, Finlay BB et al. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Molec Microbiol 2000; 36:1085-1100. 38. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 NRAMP orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-1078. 39. Kehres DG, Janakiraman A, Slauch JM et al. SitABCD Is the Alkaline Mn2+ Transporter of Salmonella enterica Serovar Typhimurium. J Bacteriol 2002; 184(12):3159-3166. 40. Agranoff D, Monahan IM, Mangan JA et al. Mycobacterium tuberculosis Expresses a Novel pH-dependent Divalent Cation Transporter Belonging to the Nramp Family. J Exp Med 1999; 190(5):717-724. 41. Herman C, Lecat S, D’Ari R et al. Regulation of the heat-shock response depends on divalent metal ions in an hflB mutant of Escherichia coli. Mol Microbiol 1995; 18(2):247-255. 42. Pinner E, Gruenheid S, Raymond M et al. Functional complementation of the yeast divalent cation transporter family SMF by NRAMP2, a member of the mammalian natural resistance- associated macrophage protein family. J Biol Chem 1997; 272(46):28933-28938. 43. Supek F, Supekova L, Nelson H et al. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93(10):5105-5110. 44. Reeve I, Hummell D, Nelson N et al. Overexpression, purification, and site-directed spin labeling of the Nramp metal transporter from Mycobacterium leprae. Proc Natl Acad Sci USA 2002; 99(13):8608-8613. 45. Chen XZ, Peng JB, Cohen A et al. Yeast SMF1 mediates H(+)-coupled iron uptake with concomitant uncoupled cation currents. J Biol Chem 1999; 274(49):35089-35094. 46. Nelson N. Metal ion transporters and homeostasis. EMBO J 1999; 18(16):4361-4371. 47. Ratledge C, Dover LG. Iron metabolism in pathogenic bacteria. Annu Rev Microbiol 2000; 54:881-941.881-941. 48. Braun V, Killmann H. Bacterial solutions to the iron-supply problem. Trends Biochem Sci 1999; 24(3):104-109. 49. Hantke K. Iron and metal regulation in bacteria. Curr Opin Microbiol 2001; 4(2):172-177. 50. Storz G, Imlay JA. Oxidative stress. Curr Opin Microbiol 1999; 2(2):188-194. 51. Storz G, Tartaglia LA, Ames BN. The OxyR regulon. Antonie Van Leeuwenhoek 1990; 58:157-161. 52. Kehres DG, Janakiraman A, Slauch JM et al. Regulation of Salmonella enterica Serovar Typhimurium mntH Transcription by H2O2, Fe2+, and Mn2+. J Bacteriol 2002; 184(12):3151-3158. 53. Boyd J, Oza MN, Murphy JR. Molecular cloning and DNA sequence analysis of a diphtheria toxin iron-dependent regulatory element (dtxR) from Corynebacterium. Proc Natl Acad Sci USA 1990; 87(15):5968-5972.

Manganese and Iron Transport by Prokaryotic Nramp Family Transporters

171

54. Posey JE, Hardham JM, Norris SJ et al. Characterization of a manganese-dependent regulatory protein, TroR, from Treponema pallidum. Proc Natl Acad Sci USA 1999; 96(19):10887-10892. 55. Jakubovics NS, Smith AW, Jenkinson HF. Expression of the virulence-related Sca (Mn2+) permease in Streptococcus gordonii is regulated by a diphtheria toxin metallorepressor-like protein ScaR. Mol Microbiol 2000; 38(1):140-153. 56. Que Q, Helmann JD. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol Microbiol 2000; 35(6):1454-1468. 57. Horsburgh MJ, Wharton SJ, Cox AG et al. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Mol Microbiol 2002; 44(5):1269-1286. 58. Tao X, Boyd J, Murphy JR. Specific binding of the diphtheria tox regulatory element DtxR to the tox operator requires divalent heavy metal ions and a 9-base-pair interrupted palindromic sequence. Proc Natl Acad Sci USA 1992; 89(13):5897-5901. 59. Tao X, Murphy JR. Determination of the minimal essential nucleotide sequence for diphtheria tox repressor binding by in vitro affinity selection. Proc Natl Acad Sci USA 1994; 91(20):9646-9650. 60. Patzer SI, Hantke K. Dual repression by Fe2+-Fur and Mn2+-MntR of the mntH gene, encoding an NRAMP-like Mn2+ transporter in Escherichia coli. J Bacteriol 2001; 183(16):4806-4813. 61. Zhou D, Hardt WD, Galan JE. Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect Immun 1999; 67(4):1974-1981. 62. Knodler LA, Celli J, Finlay BB. Pathogenic trickery: Deception of host cell processes. Nat Rev Mol Cell Biol 2001; 2(8):578-588. 63. Brumell JH, Tang P, Mills SD et al. Characterization of Salmonella-induced filaments (Sifs) reveals a delayed interaction between Salmonella-containing vacuoles and late endocytic compartments. Traffic 2001; 2(9):643-653. 64. Garcia-del Portillo F, Foster JW, Maguire ME et al. Characterization of the micro-environment of Salmonella typhimurium-containing vacuoles within MDCK epithelial cells. Mol Microbiol 1992; 6:3289-3297. 65. Govoni G, Canonne-Hergaux F, Pfeifer CG et al. Functional expression of Nramp1 in vitro in the murine macrophage line RAW264.7. Infect Immun 1999; 67(5):2225-2232. 66. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: Natural resistance-associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192(9):1237-1248. 67. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: The Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185(4):717-730. 68. Hackam DJ, Rotstein OD, Zhang W et al. Host resistance to intracellular infection: Mutation of natural resistance-associated macrophage protein 1 (Nramp1) impairs phagosomal acidification. J Exp Med 1998; 188(2):351-364. 69. Jabado N, Canonne-Hergaux F, Gruenheid S et al. Iron transporter Nramp2/DMT-1 is associated with the membrane of phagosomes in macrophages and Sertoli cells. Blood 2002; 100(7):2617-2622. 70. Searle S, Bright NA, Roach TI et al. Localisation of Nramp1 in macrophages: Modulation with activation and infection. J Cell Sci 1998; 111(Pt 19):2855-2866. 71. Boyer E, Bergevin I, Malo D et al. Acquisition of Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2002; 70(11):6032-6042. 72. Velayudhan J, Hughes NJ, McColm AA et al. Iron acquisition and virulence in Helicobacter pylori: A major role for FeoB, a high-affinity ferrous iron transporter. Mol Microbiol 2000; 37(2):274-286. 73. Hantke K. Ferrous iron transport mutants in Escherichia coli K-12. FEMS Microbiol Lett 1987; 44:53-57. 74. Higgins DG, Thompson JD, Gibson TJ. Using CLUSTAL for multiple sequence alignments. Methods Enzymol 1996; 266:383-402. 75. Felsenstein J. Inferring phylogenies from protein sequences by parsimony, distance, and likelihood methods. Methods Enzymol 1996; 266:418-427. 76. Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985; 39:783-791. 77. Kehres DG, Lawyer CH, Maguire ME. The CorA magnesium transporter gene family. Microbial & Comparative Genomics 1998; 43:151-169.

172

The Nramp Family

CHAPTER 15

Role of the Nramp Orthologue, MntH, in the Virulence of Mycobacterium tuberculosis Pilar Domenech and Stewart T. Cole

Abstract

M

ycobacterium tuberculosis is the causative agent of tuberculosis. The natural habitat of this pathogen is the alveolar macrophage where it modulates the maturation of the phagosome, inhibiting the fusion of the phago-lysosome. Eukaryotic Nramp1 is localized in late endosomal and lysosomal compartments. Mycobacterium tuberculosis also possesses a Nramp1 orthologue (MntH), suggesting a model in which both Nramp proteins compete for the same kind of cations; inactivation of this transporter may disadvantage the corresponding cell. A M. tuberculosis MntH knock-out strain created by allelic interchange did not show any impairment in intracellular growth irrespective of the host Nramp1 background. Nor was attenuation observed in mice that have the Asp169 mutation inactivating Nramp1. This indicates, that in the model used, M. tuberculosis MntH does not play a detectable role in determining the outcome of infection. Tuberculosis has plagued mankind since prehistoric times and is still an important source of morbidity and mortality.1 The causative agents of this disease are the bacteria comprising the Mycobacterium tuberculosis complex, namely M. tuberculosis. M. africanum, M. canettii, M. bovis, M. microti and the attenuated vaccine strain M. bovis BCG. These are all slow growing mycobacteria, with a replication time of approximately 20 hours. This slow growth complicates microbial diagnostics and contributes to the necessarily long-term drug treatment. Although tuberculosis can manifest in any tissue, the lung represents the main port of entry and the most important site of disease manifestation.

M. tuberculosis Is an Intracellular Pathogen The natural habitat of M. tuberculosis is the alveolar macrophage. After phagocytosis by the macrophage, M. tuberculosis is maintained in vacuoles that fail to fuse with lysosomes and this “non-fusogenic phenotype” correlates with the viability of the infecting organism.2,3 The mycobacterial factors involved in this process have not been identified so far. Acidification of the phagosome is a characteristic of maturation along the endosomallysosomal network. Early endosomes are acidified to pH=6 and late endosomes and lysosomes are acidified to pH=5.5. This process results from delivery of the vacuole proton pump to early and late endosomes and removal of the Na+/K+ -ATPase from the late endosome.4 Mycobacteria-containing phagosomes are less acidic than lysosomes5 with a pH=6.3-6.5.6 This failure to acidify normally is, at least in part, due to the exclusion of the vacuolar proton The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Role of the Nramp Orthologue, MntH, in the Virulence of Mycobacterium tuberculosis

173

pump ATPase.6 Another factor that might affect the lack of acidification could be the presence of the Na+/K+ -ATPase in the mycobacteria containing phagosome, but inhibition of this ATPase with ouabain did not affect the pH of M.bovis BCG-containing phagosomes. 7 Immunoelectron microscopy of murine bone marrow macrophages infected with M. avium or M. tuberculosis indicates that the vacuolar membrane surrounding the bacilli possesses the late endosoma/lysosomal marker, Lamp1 but lacks the vesicular proton-ATPase. 8 The Mycobacterium-containing phagosome is a dynamic structure that retains the ability to fuse with and is accessible to glycosphingolipids from the host cell plasmalemma.9 The presence of MHC class II molecules and the transferrin receptor indicates persistent interaction of the M. tuberculosis phagosome with early endosomes.2 The presence of the Rab5 GTPase, another early endosome marker, but not Rab7 (a late endosome marker) has been detected in M. bovis BCG-containing vacuoles, indicating that interruption of the maturation of mycobacterial phagosome occurs between these two stages.10 Accessibility to exogenously administered transferrin indicates that the Mycobacterium-containing vacuole is arrested within the transferrin recycling pathway of the host cell.11 M. avium containing phagosomes acquire the hydrolase cathepsin D not from the lysosome but from the biosynthetic pathway of the macrophage12,13 This result provides an explanation for the anomalous distribution of lysosomal proteins in Mycobacterium-containing phagosomes which are positive for Lamp1, cathepsin D and transferrin receptor but show low levels of acquisition of the vesicular proton ATPase.

Murine Nramp1 and the M. tuberculosis Phagosome

Eukaryotic Nramp1 is expressed exclusively in professional phagocytes.14 Murine Nramp1 is localized in late endosomal and lysosomal compartments colocalizing with Lamp1 and cathepsins D and L. Double immunofluoresence studies and direct purification of latex bead-containing phagosomes demonstrated that upon phagocytosis, Nramp1 is recruited to the membrane of the phagosome and remains associated during the maturation of the phagolysosome.14,15 Nramp1 functions as a pH dependent transporter that modulates the phagosomal space by extruding Mn2+. These divalent cations are essential for microbial function, either as nutrients or as cofactors of enzymatic ativities, and therefore Nramp1 contributes to defense against infections.16 Comparison of the properties of M. bovis BCG infected macrophages from either Nramp1 positive mice or from Nramp1 null mutant mice indicates that Nramp1 plays a role in the events that lead to phagosomal acidification. The pH of phagosomes containing live M. bovis BCG more acidic in nramp1 +/+ cells than in nramp1 -/-. This acidification is associated with an enhanced ability of phagosomes to fuse with vacuolar-type ATPase-containing late endosomes and/or lysosomes.7 It remains unknown if the Nramp1 protein plays the same role in M. tuberculosis-containing phagosomes. Resolution answering this question might provide valuable insight into the differences between the pathogen M. tuberculosis and the vaccine strain M. bovis BCG. The role of eukaryotic Nramp1 in resistance to M. tuberculosis infection in mice is controversial. While some authors report that Nramp1 is involved in resistance to infections initiated with very small intravenous inocula.17 Others consider that the eukaryotic Nramp1 is of limited importance in resistance to M. tuberculosis infection.18 It has been shown that mouse strains homozygous for the nramp1 resistant allele are equally or even less resistant to M. tuberculosis infections than strains homozygous for the susceptible allele.19-21

M. tuberculosis MntH Is Constitutively Expressed Analysis of the sequence of the M. tuberculosis genome reveals the presence of an extensive group of genes encoding cation transporters such as 11 P-type ATPases and a member of the Nramp family of proteins (mntH).22,23 Nramp orthologues are also present in the genome sequences of other members of the M. tuberculosis complex (M. bovis and M. bovis BCG) and in other pathogenic (M. avium) and saprophytic (M. smegmatis) mycobacteria. The MntH

174

The Nramp Family

protein is predicted to have 428 amino acids and a molecular mass of 44.9 kD. It contains 11 putative transmembrane domains and shows an identity of 38% with the MntH protein of Escherichia coli and 39% with that of Salmonella typhimurium. MntH mRNA was detected in cultures of M. bovis BCG grown in the macrophage-like cell line THP1 indicating that this gene is constitutively expressed when the bacteria grow intracellularly. In vitro MntH mRNA expression is stimulated (~ 50 fold) in the presence of Fe2+at concentrations between 1 and 48 µM, while addition of Cu2+ in the same range to the culture media results in a 10-fold increase of MntH expression that is maximal at 5 µM.24

M. tuberculosis MntH Protein As a Cation Transporter Some experimental evidence suggesting that the M. tuberculosis MntH protein functions as a cation transporter was provided by Agranoff and coworkers.24 These investigators showed a 20 fold increase in 65Zn2+ and 55Fe2+uptake in Xenopus laevis oocytes that were injected with mRNA encoding the M. tuberculosis MntH protein. This transport was dependent on acidic extracellular pH and was maximal between pH 5.5 and 6.5. They also showed that this transport was abolished when excess Mn2+ and Cu2+was present, suggesting a possible interaction of the M. tuberculosis MntH protein with a broad range of divalent cations. The MntH proteins of E. coli and S. typhimurium act as divalent cation transporters (Fe2+, Mn2+) in a proton-dependent manner, showing the highest affinity for Mn2+.25,26 However, no data have been reported so far regarding the affinities of the M. tuberculosis MntH protein for divalent cations. In B. subtilis, mntH expression is regulated by the MntR protein, a transcriptional regulator related to the Diphteria toxin repressor family of proteins (DtxR) that regulates the expression of mntH and an ABC transporter in a Mn2+-dependent manner.27 By contrast, in E. coli, mntH shows dual repression by Fe2+ via Fur and by Mn2+ via MntR.28 The M. tuberculosis genome sequence revealed more than 100 putative transcriptional regulators,22 reflecting the diversity of environments that this organism faces. Among these transcriptional regulators two (furA and furB) belong to the Fur (Ferric Uptake Regulator) family, whilst IdeR and SirR are metal-dependent regulators of the DtxR family. FurA is involved in the regulation of the catalase-peroxidase gene KatG, and hence is involved in isoniazid sensitivity and virulence.29 The IdeR protein of M. tuberculosis has been found to be a pleiotropic regulator that represses the expression of the genes involved in the synthesis of the salicylate-derived mycobactin siderophores of M. tuberculosis, constituting the main Fe3+-acquisition system in this organism. IdeR also activates expression of the iron storage protein bacterioferritin in an iron-dependent way.30,31 No function has been described for the M. tuberculosis SirR although the predicted protein shows 50 % identity with the Mn2+-dependent transcriptional regulator of Corynebacterium glutamicum. SirR was first identified in Staphylococcus epidermis as a metal-dependent (Mn2+ and Fe2+) regulator of the sitABC operon, an ABC transporter that appears to be involved in iron uptake in Staphylococcus epidermis.32,33 It remains to be seen whether Fur, SirR or IdeR play a role in regulating mntH transcription.

Role of the M. tuberculosis MntH Protein in Virulence The presence of the MntH protein, able to act as a divalent cation transporter, in intracellular pathogens like M. tuberculosis and M. leprae suggests a model in which the mammalian (Nramp1) and the bacterial (MntH) proteins could compete for the same cations present in the phagosome. These cations are essential nutrients for the bacteria and could also play an important role in the defense of the bacteria against the adverse conditions of the macrophage. For example, these cations are cofactors of many enzymatic activities like the SOD (superoxide dismutase), a metalloenzyme that catalyzes the conversion of superoxide anion to hydrogen peroxide and confers resistance in the bacteria to the oxidative stress produced by the macrophage. It has been reported that a SOD-deficient M. tuberculosis H37Rv mutant was attenuated in the mouse model.34

Role of the Nramp Orthologue, MntH, in the Virulence of Mycobacterium tuberculosis

175

The role of the MntH protein in the intracellular survival of M. tuberculosis and thereby its virulence has been studied by two different groups of investigators.35,36 In both cases, a M. tuberculosis mntH knock-out strain was generated by allelic exchange mutagenesis. Disruption of the gene did not affect extracellular growth under standard conditions although under iron-deficient conditions, the M. tuberculosis mntH knock-out mutant showed impaired growth. This result indicates that the MntH protein confers an advantage to the wild-type strain over the mutant, for growth under low iron conditions, suggesting a role as divalent cation transporter for the M. tuberculosis MntH protein.36 However, some experiments still need to be done in order to elucidate the physiological role of the M. tuberculosis MntH protein. 65Zn2+, 55 2+ Fe , Mn 2+ and Fe 2+ in vitro uptake experiments with the mntH knock-out mutant and the wild-type strains will reveal whether the absence of MntH is compensated by any of the 11 P-ATPases present in M. tuberculosis. To study the effect of this transporter on intracellular growth, the M. tuberculosis wild-type and the mntH knock-out mutant strains were assayed in different kinds of macrophages. Bone marrow-derived macrophages from mice with intact nramp1 gene (strain 129SV) and mice that have the Asp169 mutation inactivating Nramp1 (strains BALB/c and C57BL/6) were used in these studies 35,36 together with macrophage lines derived from the bone marrow of 129SV mice expressing the wild-type nramp1 gene and from an isogenic mice strain that bears a homozygous null allele at the nramp1 locus.36 There was no impairment in the intracellular growth of the M. tuberculosis mntH knock-out compared to the wild-type in any eukaryotic Nramp1 background tested. These results suggest that, at least in vitro, MntH is dispensable for intracellular growth of M. tuberculosis independently of the presence of a functional eukaryotic Nramp1. The role of the M. tuberculosis MntH protein in virulence was studied by intravenous infection of BALB/c mice with the M. tuberculosis wild-type and the mntH knock-out mutant. Growth kinetics of these strains were followed for periods of more than three months in lung and spleen. In both studies the results were consistent and no significant difference was observed in the growth of both strains either in the initial pre-immune phase of the infection, in which there is an exponential increase in the number of bacilli in both organs, or after acquired immunity had developed and the mice controlled the intracellular multiplication of the bacteria.35,36 Nor were differences observed in the survival of the mice infected with both M. tuberculosis strains, wild-type and mntH knock-out mutant.36 Taken together, these results indicate that the MntH protein of M. tuberculosis is not essential for the bacteria to establish a chronic infection, therefore ruling out the role of the M. tuberculosis MntH protein in virulence in the model used. The mice employed in both of the virulence studies mentioned above harbor the Asp169 mutation that inactivates Nramp1. Boechat and coworkers36 reported no differences in intracellular growth between the mntH knock-out mutant and the wild-type M. tuberculosis strains in resting macrophages of mice with an intact nramp1. Murine Nramp1 expression is upregulated by LPS and IFN-γ administration both in primary macrophages and in macrophages cell lines37,38 in a time and dose-dependent fashion.39 It still remains unknown if the absence of MntH in the M. tuberculosis KO mutant determines the outcome of the infection in the Nramp1 positive mouse model. MntH is not specific to intracellular parasites and is present in saprophytic bacteria, so alternatively, MntH may contribute to the extracellular life of the bacteria. Extracellular growth of the bacteria occurs in the last stage of pulmonary tuberculosis. At that stage, the solid caseous center of the granuloma liquefies. Macrophages do not survive in this liquefied caseum and bacteria grow extracellularly for the first time in the course of the disease. They can reach such large numbers that the cell-mediated immunity, developed in a resistant host, becomes overwhelmed. Cavitation of the bronchial tree is produced by discharging the content of the liquefied lesions and spread of the bacteria to other parts of the lung occurs and to the nearby

176

The Nramp Family

environment. Cavitary tuberculosis is therefore, highly contagious.40,41 No tissue damage, liquefaction or cavitation is produced in the mouse model of tuberculosis contrasting with the necrotic pulmonary lesions and cavitation present in rabbits, guinea pigs and humans.42 It is possible that in this liquefied caseous environment the bacteria need highly controlled metal uptake that allows their survival. This could be provided by cation transporters such as the 11 P-type P-ATPases and MntH. In such a scenario, a M. tuberculosis mntH knock-out mutant could be impaired in the development of disease at that last stage. Testing this hypothesis will require a different experimental model of tuberculosis.

References 1. http://www.who.int/gtb/ GTPWHO. 2. Clemens DL, Horwitz MA. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 1995; 181(1):257-270. 3. Frehel C, de Chastellier C, Lang T et al. Evidence for inhibition of fusion of lysosomal and prelysosomal compartments with phagosomes in macrophages infected with pathogenic Mycobacterium avium. Infect Immun 1986; 52(1):252-262. 4. Clemens DL. Characterization of the Mycobacterium tuberculosis phagosome. Trends Microbiol 1996; 4(3):113-118. 5. Crowle AJ, Dahl R, Ross E et al. Evidence that vesicles containing living, virulent Mycobacterium tuberculosis or Mycobacterium avium in cultured human macrophages are not acidic. Infect Immun 1991; 59(5):1823-1831. 6. Sturgill-Koszycki S, Schlesinger PH, Chakraborty P et al. Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 1994; 263(5147):678-681. 7. Hackam DJ, Rotstein OD, Zhang W et al. Host resistance to intracellular infection: mutation of natural resistance-associated macrophage protein 1 (Nramp1) impairs phagosomal acidification. J Exp Med 1998; 188(2):351-364. 8. Xu S, Cooper A, Sturgill-Koszycki S et al. Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol 1994; 153(6):2568-2578. 9. Russell DG, Dant J, Sturgill-Koszycki S. Mycobacterium avium- and Mycobacterium tuberculosiscontaining vacuoles are dynamic, fusion-competent vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J Immunol 1996; 156(12):4764-4773. 10. Via LE, Deretic D, Ulmer RJ et al. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J Biol Chem 1997; 272(20):13326-13331. 11. Clemens DL, Horwitz MA. The Mycobacterium tuberculosis phagosome interacts with early endosomes and is accessible to exogenously administered transferrin. J Exp Med 1996; 184(4):1349-1355. 12. Sturgill-Koszycki S, Schaible UE, Russell DG. Mycobacterium-containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. Embo J 1996; 15(24):6960-6968. 13. Ullrich HJ, Beatty WL, Russell DG. Direct delivery of procathepsin D to phagosomes: implications for phagosome biogenesis and parasitism by Mycobacterium. Eur J Cell Biol 1999; 78(10):739-748. 14. Gruenheid S, Pinner E, Desjardins M et al. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med 1997; 185(4):717-730. 15. Searle S, Bright NA, Roach TI et al. Localisation of Nramp1 in macrophages: modulation with activation and infection. J Cell Sci 1998; 111(Pt 19):2855-2866. 16. Jabado N, Jankowski A, Dougaparsad S et al. Natural resistance to intracellular infections: natural resistance-associated macrophage protein 1 (Nramp1) functions as a pH-dependent manganese transporter at the phagosomal membrane. J Exp Med 2000; 192(9):1237-1248. 17. Brown DH, Miles BA, Zwilling BS. Growth of Mycobacterium tuberculosis in BCG-resistant and -susceptible mice: establishment of latency and reactivation. Infect Immun 1995; 63(6):2243-2247. 18. North RJ, Ryan L, LaCource R et al. Growth rate of mycobacteria in mice as an unreliable indicator of mycobacterial virulence. Infect Immun 1999; 67(10):5483-5485. 19. Medina E, North RJ. Evidence inconsistent with a role for the Bcg gene (Nramp1) in resistance of mice to infection with virulent Mycobacterium tuberculosis. J Exp Med 1996; 183(3):1045-1051.

Role of the Nramp Orthologue, MntH, in the Virulence of Mycobacterium tuberculosis

177

20. Medina E, North RJ. Resistance ranking of some common inbred mouse strains to Mycobacterium tuberculosis and relationship to major histocompatibility complex haplotype and Nramp1 genotype. Immunology 1998; 93(2):270-274. 21. Medina E, Rogerson BJ, North RJ. The Nramp1 antimicrobial resistance gene segregates independently of resistance to virulent Mycobacterium tuberculosis. Immunology 1996; 88(4):479-481. 22. Cole ST, Brosch R, Parkhill J et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998; 393(6685):537-544. 23. Tekaia F, Gordon SV, Garnier T et al. Analysis of the proteome of Mycobacterium tuberculosis in silico. Tuber Lung Dis 1999; 79(6):329-342. 24. Agranoff D, Monahan IM, Mangan JA et al. Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J Exp Med 1999; 190(5):717-724. 25. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-1078. 26. Kehres DG, Zaharik ML, Finlay BB et al. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol Microbiol 2000; 36(5):1085-1100. 27. Que Q, Helmann JD. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol Microbiol 2000; 35(6):1454-1468. 28. Patzer SI, Hantke K. Dual repression by Fe(2+)-Fur and Mn(2+)-MntR of the mntH gene, encoding an NRAMP-like Mn(2+) transporter in Escherichia coli. J Bacteriol 2001; 183(16):4806-4813. 29. Pym AS, Domenech P, Honore N et al. Regulation of catalase-peroxidase (KatG) expression, isoniazid sensitivity and virulence by furA of Mycobacterium tuberculosis. Mol Microbiol 2001; 40(4):879-889. 30. Gold B, Rodriguez GM, Marras SA et al. The Mycobacterium tuberculosis IdeR is a dual functional regulator that controls transcription of genes involved in iron acquisition, iron storage and survival in macrophages. Mol Microbiol 2001; 42(3):851-865. 31. Rodriguez GM, Voskuil MI, Gold B et al. ideR, An essential gene in Mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infect Immun 2002; 70(7):3371-3381. 32. Hill PJ, Cockayne A, Landers P et al. SirR, a novel iron-dependent repressor in Staphylococcus epidermidis. Infect Immun 1998; 66(9):4123-4129. 33. Cockayne A, Hill PJ, Powell NB et al. Molecular cloning of a 32-kilodalton lipoprotein component of a novel iron-regulated Staphylococcus epidermidis ABC transporter. Infect Immun 1998; 66(8):3767-3774. 34. Edwards KM, Cynamon MH, Voladri RK et al. Iron-cofactored superoxide dismutase inhibits host responses to Mycobacterium tuberculosis. Am J Respir Crit Care Med 2001; 164(12):2213-2219. 35. Domenech P, Pym AS, Cellier M et al. Inactivation of the Mycobacterium tuberculosis Nramp orthologue (mntH) does not affect virulence in a mouse model of tuberculosis. FEMS Microbiol Lett 2002; 207(1):81-86. 36. Boechat N, Lagier-Roger B, Petit S et al. Disruption of the gene homologous to mammalian Nramp1 in Mycobacterium tuberculosis does not affect virulence in mice. Infect Immun 2002; 70(8):4124-4131. 37. Govoni G, Vidal S, Cellier M et al. Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics 1995; 27(1):9-19. 38. Atkinson PG, Blackwell JM, Barton CH. Nramp1 locus encodes a 65 kDa interferon-gammainducible protein in murine macrophages. Biochem J 1997; 325(Pt 3):779-786. 39. Govoni G, Gauthier S, Billia F et al. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J Leukoc Biol 1997; 62(2):277-286. 40. McMurray DN, Collins FM, Dannenberg AM et al. Pathogenesis of experimental tuberculosis in animal models. Curr Top Microbiol Immunol 1996; 215:157-179. 41. Dannenberg AM, Collins FM. Progressive pulmonary tuberculosis is not due to increasing numbers of viable bacilli in rabbits, mice and guinea pigs, but is due to a continuous host response to mycobacterial products. Tuberculosis (Edinb) 2001; 81(3):229-242. 42. Rhoades ER, Frank AA, Orme IM. Progression of chronic pulmonary tuberculosis in mice aerogenically infected with virulent Mycobacterium tuberculosis. Tuber Lung Dis 1997; 78(1):57-66.

178

The Nramp Family

CHAPTER 16

Molecular Evolutionary Analysis of the Nramp Family Etienne Richer, Pascal Courville and Mathieu Cellier

Abstract

T

he natural resistance-associated macrophage protein (Nramp) belongs to a family of ion permeases highly conserved in eukaryotes that originated in prokaryotes. Three phylogenetic groups of homologs were identified in Bacteria based on functional genomic approaches. Proteins of group A were characterized as H+-dependent MaNganese Transporter (MntH A) representing functional homologs of eukaryotic Nramp. Heterologous expression in E. coli of MntH B and C proteins modulated bacterial sensitivity to cobalt and cadmium, suggesting conserved function among MntH groups. Genome sequencing of model eukaryotes revealed two groups of eukaryotic Nramp. Conservation in invertebrates of a ‘prototype’ suggests early duplication of an ancestral Nramp gene. Family trees inferred from phylogenetic analyses using various approaches indicate successive divergence of MntH B, MntH A, eukaryotic Nramp and MntH C. MntH C shows high level sequence identity with ‘prototype’ Nramp, heterogeneous variation of a.a. replacement rate among sites, and predicted divergence from ‘archetype’ Nramp. The data suggest a relatively recent origin for MntH C, derived from an eukaryote ‘prototype’ Nramp gene. This proposition is discussed in the context of bacterial infection.

Overview Structural Nramp homologs were characterized in both eukaryotic and prokaryotic species and perform similar metal ion transport function. Amino acid sequence conservation between Nramp homologs corresponds to the preservation of a hydrophobic core of ten predicted transmembrane domains (TMD) and a consensus transmembrane topology prediction with the N-terminus cytoplasmic followed by 11 to 12 predicted transmembrane α-helices. Many of the first ten TMDs display amphiphilic character, as they contain conserved negative charges embedded within the membrane, and may be involved in key structures including proton motive force and divalent cation transport pathways. Phylogenomic studies indicate Nramp family and function originated in Bacteria life domain and highlight the complex evolution of bacterial Nramp homologs. These studies include compiled phylogenetic data using various approaches (distance matrix, maximum parsimony and likelihood, and statistical bootstrapping) and either full-length sequences or a set of conserved, informative positions to infer an extensive Nramp family tree with distance estimates, and verify congruency with the species phylogeny (based on 16S RNA). Additional statistical analyses of a.a. replacement rate variations were done for each group. Comparative studies of sequenced genomic loci were carried out to document vertical or horizontal ancestry. Functional studies were executed by expression in E. coli mntH A strains.

The Nramp Family, edited by Mathieu Cellier and Philippe Gros. ©2004 Eurekah.com and Kluwer Academic / Plenum Publishers.

Molecular Evolutionary Analysis of Nramp Family

179

Nramp family is subdivided in several branches, most of them congruent with the phylogeny of corresponding organisms, suggesting they represent groups of orthologs that diverged with speciation. Parologs resulting from ‘prototype’ Nramp gene duplication early in eukaryote evolution were found (outparologs); various evidences demonstrate bacterial MntH xenologs, resulting from horizontal gene transfer. The bacterial clade the most distant from eukaryotic Nramp, MntH B, is a monophyletic group of sequences showing moderately tight grouping that were found in distant anaerobic bacteria. MntH A group is closer to eukaryotic Nramp and includes members from both high- and low-GC Gram positive Bacteria and Gram negative Bacteria. MntH A possibly contained the precursor of eukaryotic Nramp. MntH C is subdivided in three subgroups (Cα, Cβ, Cγ) in which horizontal gene transfer is prevalent. MntH Cα sequences belong to distant species but are closely related and remarkably similar to ‘prototype’ Nramp suggesting gene transfer from Protist to Bacteria.

Early Gene Duplication in Eukaryotes Gave the Outparologs ‘Prototype’ and ‘Archetype’ Nramp Nramp protein family was defined using highly similar sequences from mammal, invertebrate, plant and yeast which also demonstrated remarkable conservation in hydrophobicity and predicted amphiphilic helical structures susceptible to form a hydrophilic transmembrane ion transport pathway.1 Similar transport functions were demonstrated using Nramp proteins from distant eukaryotic species and inter-specific genetic complementation.2-6 These data indicate that the role of eukaryotic Nramp proteins is to facilitate cellular chemiosmotic uptake of divalent metal ions (detailed in Chapter 1, Jabado et al, Chapter 7, Mackenzie & Hediger, and Chapter 12, Cohen et al). Recently, genome sequencing and detailed phylogenetic analyses showed eukaryotic Nramp protein sequences segregate in two clusters : ‘prototype’ Nramp, including yeast SMF 1-3, and ‘archetype’ Nramp found mostly in multicellular organisms (including the social amoeba7). Data from the model species Dictyostelium discoideum (Mycetozoa, DdNR1, 2, (Fig. 1) and Anopheles gambiae (Arthropoda, Insecta, AgNR1, 2) -which diverged from the eukaryotic root before the separation of plants and vertebrates, respectively- revealed the coexistence of two divergent types of eukaryotic Nramp genes: ‘prototype’ Nramp encode proteins that are close to each other and to microbial homologs; ‘archetype’ Nramp code for proteins more similar to animal Nramp. The phylogenetic distance between these parologous ‘proto-’ and ‘archetype’ Nramp sequences implies strong divergence after gene duplication (Fig. 1). The divergence of ‘archetype’ Nramp was accompanied by the insertion of at least one spliceosomal intron marking the beginning of Nramp hydrophobic core, before predicted TMD 1. The position of this intron is conserved in Dictyostelium, Drosophila and human genes, including canonical intron boundaries (5'-GT…3'-AG; Fig. 2B). These data raise the possibility that ‘prototype’ and ‘archetype’ Nramp are outparologs that resulted from a gene duplication prior to the separation of Myceotozoa and animal phyla. Yeast SMF proteins are closer to ‘prototype’ Nramp and contain 11 predicted TMD like most other microbial sequences. Yeast genes are intronless and were duplicated twice before the divergence of Saccharomyces cerevisiae and Candida albicans (Fig. 1); S. cerevisiae SMF proteins differ both in cellular location and metallo-regulation (detailed in Chapter 11, Luk et al.). Another recent duplication of SMF1 gene occurred in the pathogen C. albicans ; whether it affects its virulence is not known. A putative SMF1 homolog was found in the distant fungus, Neurospora crassa (Pezizomycotina, Sordariaceae), suggesting SMF1 may be close to yeast ancestral sequence. Aside from the ancestral gene duplication yielding the outparologs ‘prototype’ and ‘archetype’ Nramp, several phyla-specific gene duplications also occurred (inparologs), notably in plants (presented in Chapter 10, Thomine & Schroeder), and worm, fish, and mammals, presumably due to species-specific adaptations.

180

The Nramp Family

Figure 1. Phylogenetic analysis of the Nramp / MntH super-family. An unrooted tree obtained by Maximum Likelihood phylogenetic analysis using 292 parsimonious positions and the model of a.a. substitution BLOSUM 62 is presented. Statistical confidence is indicated in percent at the right of each node. The scale of 0.1 a.a. replacement per site is indicated. Systematic names for proteins are composed of the initial of genus name in capital, two to four letters from the species names followed by NR for eukaryotic Nramp proteins or A, B, or Cα, Cβ, and Cγ for prokaryotic MntH proteins; numbers have been added in multigenic organisms. The taxonomic distribution of the species possessing Bacterial MntH and corresponding phylogenetic grouping is presented in Table1. Eukarya: Ag= Anopheles gambiae; At= Arabidopsis thaliana; Bt= Bos taurus; Ca= Candida albicans; Ce= Caenorhabditis elegans; Cre= Chlamydomonas reinhardtii; Dd= Dictyostelium discoideum; Dm= Drosophila melanogaster; Gg= Gallus gallus; Hs= Homo sapiens; Ncr= Neurospora crassa; Om= Oncorhynchus mykiss; Os= Oryza sativa; Mm= Mus musculus; Sc= Saccharomyces cerevisiae.

Molecular Evolutionary Analysis of Nramp Family

181

Figure 2. Duplication of Nramp gene in eukaryote yielded ‘prototype’ and ‘archetype’ Nramp. A) Condensed tree obtained by the minimal evolution method, using distance-based calculation and the least square method to infer the phylogenetic tree; 3000 replica of statistical bootstraping were performed to evaluate the significance of each node (here, above 50%); branch length is not proportional to sequence relationship. B) Nramp protein sequence alignment and corresponding gene sequences showing conservation of the position of the first intron found in the ‘archetype’ Nramp genes of Dictyostelium discoideum, Drosophila melanogaster and Homo sapiens.

Two distinct types of Nramp are found in plants (plant Nramp I and II, (Fig. 1, 2A). Plant I appears intermediate between ‘prototype’ and ‘archetype’ Nramp clusters, and Plant II group is part of ‘archetype’ Nramp. Plant I and II divergence predated the speciation of eudicot (A. thaliana) and monocot (O. sativa). In the protochordate C. intestinalis and all vertebrates, only ‘archetype’ Nramp was conserved (animal Nramp). The gene duplication that produced mammalian Nramp1 and 2 probably occurred in vertebrates (Fig. 2B), which would be consistent with their different tissue and cell specific expression (presented in details in Chapter 8, EH Morgan, and Chapter 9, Canonne-Hergaux & Gros). Whereas Nramp2 is expressed in many tissues and cell types and is required for iron homeostasis, Nramp1 gene is expressed in mature professional phagocytes contributing mainly to innate immunity (e.g., see ref. 8).

182

The Nramp Family

Current data obtained with yeast and animal Nramp suggest ‘prototype’ and ‘archetype’ Nramp are functionally conserved but distinct (see Chapter 12, Cohen et al). Study of Dictyostelium ‘archetype’ and ‘prototype’ Nramp cellular function and location will enable to compare the properties of Nramp outparologs in a model organism. D. discoideum feeds on bacteria that are ingested and degraded within a phagosome ; it will be of interest to determine –if and- which Dictyostelium Nramp is involved in antimicrobial defence.

Characterization of Bacterial Nramp Orthologs: MntH A and B The existence of bacterial Nramp homologs -denominated MntH- suggests this family existed prior to the emergence of eukaryotes. The polyphyletic origins of mntH genes question the ancestry of eukaryotic Nramp and hypothetical role of mntH genes in bacterial virulence.

MntH A and Bacterial Virulence

Several MntH A proteins were studied once the role of yeast SMF1 protein in Mn2+ uptake2 and the existence of a M. leprae Nramp candidate homolog were established.1 One aim was to determine whether bacterial MntH could perform a similar transport function and would compete with host Nramp1 for metal acquisition within the phagosome during intracellular infection. Enteric E. coli MntH A was characterized by gene knockout and add-back experiments as a proton-dependent Mn2+ transporter facilitating the uptake of other divalent metal ions, in whole cell transport assays, and by complementation of a E. coli metal-dependent mutant.9 As E. coli does not normally survive in macrophages, targeted mutations were also generated in Mycobacteria and Salmonella to address the possible role of mntH A homologs in virulence. Salmonella enterica serovar Typhimurium (S. typhimurium) has two Mn2+ transporters : a pH-dependent Mn2+ permease MntH A and an ABC-type transporter SitABCD (‘Salmonella iron transporter’10-13). The mntH A gene is carried by a chromosome fragment conserved in E. coli (~120 kb) and Yersinia spp. (~ 22 kb), whereas sitABCD is encoded by Salmonella pathogenicity island 1,14 and also found close to mobile DNA in E. coli CFT 073 and Y. pestis pathogens. Salmonella MntH A is required for resistance to hydrogen peroxide (H2O2) and regulated transcriptionally by the metallo-repressors Fur and MntR and the H2O2 responsive activator OxyR (detailed in Chapter 13, Helmann JD, and in Chapter 14, and Papp et al.). SitABCD mediates both Mn2+ and Fe2+ uptake at alkaline pH. It is a virulence factor in the systemic phase of the murine typhoid that is expressed intracellularly and in response to iron privation,15 suggesting regulatory mechanisms similar to mntH A gene. The role of S. typhimurium mntH A in virulence was tested, compared to the role of sitABCD and feoB, encoding the GTP-dependent ferrous iron transporter, by gene knockout experiments and systemic infections in Nramp1+ or Nramp1-/- mice.10 The mortality and morbidity induced by infection demonstrated that both sitABCD and feoB were required for full virulence in Nramp1-/- animals, whereas all Nramp1+ animals survived the intravenous challenge (103 bacteria). In vitro, Nramp1 expression by Raw macrophages inhibited the growth of all Salmonella strains tested; the double mutant mntH A sitABCD, lacking Mn2+ uptake, was most affected. Infection of Nramp1-/- macrophages required the addition of a cell permeant Fe2+ chelator to observe diminished intracellular growth of S. typhimurium mutants; sitABCD mutant was also affected. The results are consistent with the observation that Salmonella do not experience iron shortage during in vitro infection of Nramp1-/- macrophages.16 In vivo, the acquisition of divalent metals is important for Salmonella virulence in Nramp1-/- animals and the primary transporters of Mn2+ and Fe2+ are more important than MntH A. High dose infections will be required to study Salmonella survival in presence of Nramp1 and to address the possible competition between host and bacterial Nramp homologs. MntH A proteins were also studied in both low- and high-GC Gram positive species (Table 1). B. subtilis mntH A expression was found MntR- and Mn-dependent, and required for growth in Mn-limited medium.17 The role of M. tuberculosis mntH A in virulence in mice was

Molecular Evolutionary Analysis of Nramp Family

183

tested using mntH A knockout mutant and both high- and low-dose intravenous infections. The results presented in Chapter 15 (Domenech and Cole) appear consistent with the Salmonella study, indicating that although mntH A may contribute to resistance to metal starvation and/or oxidative stress, primary transporters of divalent metals (feo, sit) may be more important during the systemic phase of infection.

Identification of MntH B in Anaerobes Group B sequences were revealed by genome sequencing of anaerobe species ; phylogenetic analyses showed they represent a separate group.18 Heterologous expression of C. tepidum and Clst. acetobutylicum MntH B in E. coli conferred increased sensitivity to divalent cations,7 modulating the Fe-dependent temperature sensitive growth of E. coli hflB1 Ts mutant. The results suggest that divalent metals including Fe2+ are substrates for MntH B proteins, implying conserved function with MntH A despite relatively low sequence similarity. Group B sequences show relatively low level identity and loose phylogenetic grouping (Fig. 3), consistent with sizeable phylogenetic distances between the corresponding species (based on 16S RNA, Green sulfur bacteria, Cytophaga-Flexibacter-Bacteroides group, and low-GC Gram positive Clostridiaceae and lactic Bacteria). A high value of the shape parameter alpha (1.3) was obtained with relatively few MntH B protein sequences, indicating a uniform gamma distribution of the a. a. replacement rate among sites in this group. The data seem consistent with an early origin of the ancestor of MntH B group.7 MntH B site-specific a.a. substitution rate (coefficient theta) was found more similar to the value obtained for MntH A than for any other group, suggesting limited functional (type 1) divergence between MntH A and B. However, MntH A group also showed low level site-to-site difference in a.a. replacement (alpha shape parameter, 1.22), due partly to the phylogenetic distance between species composing MntH A group and to the number of sequences which increases diversity. The significance of predicted functional divergence from MntH B was increased after considering less diverse MntH A subsets, notably low- vs. high-GC Gram positive Bacteria, but not in the case of the subgroup MntH A* that comprises proteins from α- and β-Proteobacteria possessing additional mntH Cγ genes. Two low-GC Gram positive Clostridiaceae spp. possess both one mntH A and one mntH B gene. Clostridiaceae MntH A sequences form a sister clade of Bacillaceae MntH A, presumably due to the presence of the additional mntH B gene in their genomes (Fig. 1). The potential type I functional divergence predicted between clostridial MntH B and A proteins might suggest mntH A and B genes diverged after an ancestral gene duplication.7

α, Cβ β, Cγγ Study of MntH Xenologs: MntH Cα A third group of bacterial Nramp homologs was found (MntH C) that displayed higher similarity to ‘prototype’ Nramp than to MntH A and B groups, being phylogenetically closer to eukaryotic homologs. mntH C genes are present in distant phyla including α, β- and γ-Proteobacteriaceae, low-GC Gram positive Bacteria and Cyanobacteria, due to prevalent horizontal transmission.

MntH Cα This clade shows the shortest distances between members despite they derive from distant Bacteria (based on 16S RNA phylogeny, Table 1). MntH Cα also contains the closest sequences to the protist Chlamydomonas sequence and to other ‘prototype’ Nramp (Fig. 1). Site-to-site a.a. replacement rate in MntH Cα group follows a nonuniform gamma distribution that indicates preservation of a pattern of a.a. conservation/variability. This result contrasts with those obtained for MntH A and B, and may be explained by a more recent origin of MntH Cα. Consistently, the gamma distributions calculated for pairwise combinations of MntH Cα, Cβ or Cγ subgroups remained heterogeneous, indicating conservation of the a. a. substitution pattern across these subgroups and suggesting they derive from a common ancestor.7

184

The Nramp Family

Figure 3. Horizontal gene transfer of mntH Cβ1 in group B Streptococcus (GBS). The sequence of mntH loci was compared using the complete genomes of three strains of S. agalactiae serotypes Ia (A909), III (NEM316) and V (2603 V/R) and one strain of S. mutans. Strains A909 and NEM316 were similar in gene content and order and possess only one mntH Cβ2 gene, conserved in sequence and genomic context with S. mutans mntH Cβ2 gene (A). The strain 2603 V/R was unique, exhibiting an additional mntH Cβ1 gene within a presumably mobile DNA element (B).

Prediction of potential divergence of function for MntH Cα was significant with ‘archetype’ Nramp, MntH A and B, but minimal between MntH Cα, Cβ and Cγ. Preferential divergence from ‘archetype’ Nramp was also observed for MntH Cβ, MntH Cγ and yeast Nramp, suggesting it may reflect in part the divergence between ‘prototype’ and ‘archetype’ Nramp. This would support the proposition that MntH C ancestor belonged to the ‘prototype’ Nramp group. Several α-Proteobacteria possess a mntH Cα gene. This phylum also includes the genus Rickettsia that is the closest known to the ancestor of mitochondria, raising the possibility that

Molecular Evolutionary Analysis of Nramp Family

Table 1. Taxonomic distribution of bacterial homologs of MntH groups B, A, A*, Cα, Cβ, Cγ Taxonomic Group

Species

Abbreviation

Phylogenetic MntH Group

Archaea Euryarchaeota

Halobacteriales

Natromonas pharaonis

CFB/Green Sulfur Bacteria

Cytophagales/ Flavobacteria/ Bacteroidetes

Bacteroides fragilis B. thetaiotaomicron

Green sulfur bacteria

Chlorobium tepidum

Ctepi

B

Low GC Gram positive

Clostridiales

Clostridium acetobutylicum Carboxydothermus hydrogenoformans

Cacet Chydr

B

A A

Thermoanaerobiales Bacillales

Thermoanaerobacter tengcongensis Bacillus subtilis B. cereus B. anthracis Listeria hydrogenoformans L. inocua Staphylococcus aureus S. epidermidis

Tteng Bsubt Bcere Banth Lmono Lino Saur Sepi

B

A A A A

Enterococcus faecalis E. faecium Lactobacillus brevis L. plantarum Oenococcus oeni Leuconostoc mesenteroides Streptococcaceae agalactiae S. cricetus S. gordonii S. mitis S. mutans Lactococcus lactis

Efa Efcm Lbre Lpl Ooe Lmes Sag Scri Sgor Smit Smut Llact

Nphar

Outgroup

Bfrag Btheta

B B

Bacteria

Lactobacillales

Cα Cα Cβ Cβ

185

B^

Cβ1,2 Cβ Cβ Cβ1,2,3 Cβ1,2 Cβ Cβ1+,2 Cβ# Cβ Cβ1,2 Cβ Cβ continued on next page

186

Table 1. Continued Taxonomic Group

Species

Abbreviation

Phylogenetic MntH Group

Bacteria High GC Gram positive

Actinomycetales

Mycobacterium tuberculosis M. leprae M. avium M. marinum M. smegmatis Clavivacter michiganensis Corynebacterium diphteriae

Mtube Mlpr Maviu Mmari Msmeg Cmich Cdiph

A A A A A A A#

Bifidobacteriales

Bifidobacterium longum

Blong

A A

Thermus/Deinococcus

Deinococcales

Deinococcus radiodurans

Dradi

Cyanobacteria

Nostocales

Nostoc sp. PCC 7120 N. punctiforme

Nost Npun

Cα Cα

Rhizobiales

Rhodopseudomonas palustris Bradyrhizobium japonicum Brucella suis Mesorhizobium loti Agrobacterium tumefaciens Rhizobium leguminosarum

Rpal Bjap Bsui Mlot Atum Rleg

Cα Cα Cα Cα Cα Cα

Proteobacteria

Alpha Subdivision

Rhodobacter capsulatus

Rcap

Magnetospirillum magnetotacticum

Mmag

Burkholderiales

Burkholderia mallei B. pseudomallei B. cepacia B. fungorum Ralstonia solanacearums

Bma Bps Bce Bfu Rsol

A*1 Cα A*2 A*2 A*1,2

Cγ1^,2 Cγ1 Cγ2 Cγ1,2 Cγ2

continued on next page

The Nramp Family

Beta Subdivision

Rhodobacterales Rhodospirillales

Molecular Evolutionary Analysis of Nramp Family

Table 1. Continued Taxonomic Group

Species

Abbreviation

Phylogenetic MntH Group

Bacteria Gamma Subdivision

Enterobacteriales

Wigglesworthia brevipalpis Klebsiella pneumoniae Escherichia coli Shigella dysenteriae Sh. flexeneri Salmonella typhi S. typhimurium S. bongori Yersinia pestis Y. enterocolitica Erwinia chrysanthemi E. carotovora

Wbre Kpne Ecoli Sdys Sflex Styph Stypm Sbong Ypest Yente Echry Ecaro

Pseudomonadales

Pseudomonas aeruginosa P. syringae P. fluorescens

Pae Psyr Pflu

Cα

Xanthomonadales

Xanthomonas axonopodis X. campestris Xylella fastidiosa

Xaxo Xcam Xfas

Cα Cα Cα

Cβ A A A A A A A A A A A Cγ2 Cγ2 Cγ2

^= pseudogene; += strain polymorphism; #= small plasmid

187

188

The Nramp Family

closeness between α-Proteobacterial MntH Cα and ‘prototype’ Nramp reflects horizontal gene transfer (HGT) from prokaryote to the eukaryotic nucleus. However, mntH genes in α-Proteobacteria are diverse, including one mntH A* in R. capsulatus, and two types of mntH Cα. One comprises sequences from closely related α-Proteobacteria (Rleg Cα, Atum Cα, Rpal Cα, Bsui Cα) ; the other type includes sequences from α- and γ-Proteobacteria (Mlot Cα, Mmag Cα, Xcam Cα, Xaxo Cα, Xfas Cα) that are encoded by a conserved divergent operon formed by mntR and mntH genes.7 It was localised in a region of Xanthomonas genome rich in transposable elements and strain specific genes, likely involved in host colonization and pathogenesis.19 Together these data indicate a recent origin for MntH Cα and raise the possibility that recent HGT in Bacteria resulted from an initial transfer from eukaryote to prokaryote.

MntH Cβ mntH Cβ genes are mainly restricted to lactic Bacteria and other low-GC Gram positive spp. such as Staphylococcaceae. Many species possess two mntH Cβ genes and several examples of likely recent HGT were documented. Most intriguing is the horizontal transfer of a mntH Cβ gene from a low-GC Gram positive spp. to the γ-Proteobacterium Wigglesworthia brevipalpis. Wigglesworthia is a primary endosymbiont of the tsetse fly possessing one of the smallest known bacterial genome with the lowest known GC content.20 Wbre Cβ is the single Wigglesworthia protein clearly more related to Staphylococcus or Streptococcus than to Enterics homologs. Wbre Cβ mntH gene is linked to an Asn-tRNA gene, which may facilitate recombination and gene transfer (e.g., Yersinia high pathogenicity island7). It will be of interest to establish whether mntH Cβ gene transfer occurred prior to or after establishment of endosymbiosis and how it contributes to Wigglesworthia fitness in the mutualistic interaction with its host. In Streptococacceae, several examples of mntH Cβ genes linked to potentially mobile insertion sequences (IS) also suggested horizontal transfer of mntH Cβ genes.7 An example of recent HGT was revealed by the genomic sequencing of several serotypes of the group B Streptococcus (GBS) S. agalactiae, a commensal of the human gastrointestinal and urogenital tracts that can cause life-threatening infections sepsis and meningitis in neonates and infants.21,22 Strains of GBS serotypes Ia (A909), III (NEM316) and V (2603 V/R) share together with S. mutans, another commensal but cariogenic species, a genomic DNA fragment carrying genes encoding (5' to 3' orientation) the peptidase U32, MntH Cβ2, and the lysyl-t-RNA synthetase. Connecting DNA segments at both extremities of mntH Cβ2 are different between S. mutans and S. agalactiae species, compatible with species-specific genetic plasticity (Fig. 3A). The GBS strain 2603 V/R possesses an additional gene (Fig. 3B), encoding a MntH Cβ1 protein highly similar to those of Enterococcus faecalis, Oenococcus oenii, Lactococcus lactis and Lactobacillus plantarum (Fig. 1, Table 1). S. agalactiae gene is localized at the 3' end of a DNA element presumed mobile, as its presence does not correlate with capsular serotypes; it is related to S. thermophilus integrative and conjugative element (ICESt1) that is suspected to facilitate HGT between lactic Bacteria spp. It is not known at present if and how this additional MntH Cβ1 protein increases GBS fitness. MntH Cβ1 proteins display 12 predicted transmembrane domains (TMD), a number normally found in eukaryotic Nramp proteins (except yeast proteins). Both proteins EfaCβ1 (12 TMD) and EfaCβ2 (11 TMD) were functionally expressed in E. coli, conferring increased sensitivity to Co and Cd.7

MntHCγ The subgroup Cγ is peculiar, displaying a relatively homogeneous gamma distribution of a.a. replacement rate among sites (alpha=1.1) despite fewer sequences. The subset MntH Cγ2 shows less uniform gamma distribution (alpha=0.65) and high sequence relationship to MntH Cα, whereas MntH Cγ1 is more related to MntH A* -a subgroup comprising species with both mntH A and Cγ genes. The low level of functional divergence predicted between MntH Cγ or Cγ2 groups and MntH A* vs. other MntH A subsets (e.g., Enterics, Gram positive Bacteria), argues against the suggestion that mntH A* and Cγ genes diverged after gene duplication in a

Molecular Evolutionary Analysis of Nramp Family

189

single species. In addition, the limited sequence divergence of MntH A* and Cγ2 from other groups, ‘archetype’ Nramp in particular, may be interpreted as an indication of their recent origin. One possibility is that species possessing both mntH A* and Cγ genes already had a mntH A gene before acquiring a novel mntH C gene by HGT, subsequently maintaining both functions. Consequently, both MntH Cγ and MntH A* sequences would appear specifically different. If eukaryotic ‘prototype’ Nramp genes were ancestors of mntH C genes, the presence of three subgroups Cα, Cβ and Cγ would suggest repeated opportunities for gene transfer. Each subgroup contains species living intracellularly, indicating that close association with eukaryotic host may have favoured HGT of a ‘prototype’ Nramp gene.7

Proposed Evolutionary Pathway of Bacterial Nramp Genes Several possible steps in the evolution of Nramp family are proposed (Fig. 4): (i) early origin in Bacteria, probably an anaerobe fermenting species, of MntH B -a proton-dependent divalent metal cations symporter (ferrous iron?); (ii) emergence of MntH A, before the divergence of Gram positive and negative clusters and Deinococcus group, with a preference for Mn2+; (iii) horizontal transfer of a mntH A gene to the eukaryotic nucleus after an endosymbiotic event giving rise to ‘prototype’ Nramp; (iv) gene duplication in eukaryotes, predating the separation of Mycetozoa, animals and plants enabling divergence of ‘archetype’ Nramp; (v) horizontal transfer of eukaryotic ‘prototype’ Nramp gene to Bacteria, creating MntH C and further spread by horizontal transfer. MntH B deep branching in Nramp tree implies early emergence (Fig. 1). Bacteroides / Chlorobia group diverged early in the evolution of Bacteria24-26 and C. tepidum performs anoxygenic photosynthesis using an iron-based reaction center (RC I), a likely precursor of cyanobacterial Mn-dependent RC II required for oxygenic photosynthesis.27,28 Thermoanaerobacter spp. fermentate sugars using thiosulfate and sulphur, but not sulfate or sulfite, as electron acceptor.29 These anaerobic Bacteria have thus growth requirements compatible with early earth atmosphere (anaerobiosis, reduced sulfur, soluble ferrous iron, high temperature, light) i.e., prior to the onset of aerobiosis (ca 2.4 gyrs, estimated by iron oxidation and sulfur isotope variation records.28,30 MntH A is an evolutionary intermediate between MntH B and C. Similarly to MntH B, but contrary to MntH C, MntH A sequence relationships (except MntH A*) appear congruent with the phylogeny and gene content of corresponding species, and are supported by analyses of a.a. replacement rate variations. These properties indicate a likely origin of MntH A prior to the separation of Gram positive and negative clusters, and Deinococcus group. The demonstration of MntH A-dependent high affinity Mn2+ uptake in D. radiodurans, whose thermo-resistance and DNA repair capacity is affected by Mn31 would support this proposition. It is a possibility that MntH A diverged from MntH B after gene duplication; also, the sequence of another low-GC Gram positive species, Carboxydothermus hydrogenoformans, was found either branching between MntH B and A groups or diverging before MntH B. On the other hand, the closer relationship of MntH A (vs. MntH B) with eukaryotic Nramp suggests a mntH A gene as likely endosymbiotic ancestor of eukaryotic Nramp. Together these observations support an early emergence of MntH B prior to MntH A.18 That eukaryotic ‘prototype’ Nramp derived from prokaryotic MntH implies adaptation to novel cellular compartments, membrane composition and mechanisms of regulation for efficient divalent metal uptake (possibly in competition with MntH expressing Bacteria). Mycetozoa and Arthropoda share the closely related ‘prototype’ homologs (DdNR1 and AgNR1, Fig. 1), indicating a common eukaryotic ancestry rather than separate horizontal acquisitions of bacterial MntH, given the actual MntH diversity (Fig. 1). After the gene duplication that yielded ‘archetype’ Nramp, some protists and invertebrates maintained ‘prototype’ Nramp, whereas others and the vertebrates lost it. Fungi possess several ‘prototype’ but no ‘archetype’ Nramp ; this suggests fungi either diverged before the ancestral

190

The Nramp Family

Figure 4. Hypothetical evolutionary time scale of Nramp evolution (in billions years ago, bya). A) Estimated molecular time for the divergence of Archaea and Bacteria (~ 3.5 bya), origin of Eukarya (~ 2.7 bya), apparition of Cyanobacteria (~ 2.6 bya), the rise of atmospheric O2 from below 1% to above 15% (~2.3 bya), origin of mitochondria (~2.0 bya), the divergence between animals, plants and fungi (~1.6 bya), and between invertebrates and vertebrates (~ 1.0 bya), the divergence of birds (~0.3 bya) and between Eudicot and Monocot plants as well as the radiation of mammals (~0.1 bya) are from Ref.26,28,43-45 B) Prokaryotic MntH B could date back to the apparition of anoxygenic photosynthetic organisms which may have been able to colonize meso-thermophile habitats (e.g., shallow water setting); MntH A may have evolved in more oxygenic conditions and could have been selected in aerobic organisms. Eukaryotic Nramp likely derive from a mntH A gene transferred to the eukaryotic nucleus after an endosymbiotic event (between 2.7 and 2.0 bya) and was duplicated in protist (before 1.6 bya) yielding the proto- and archetype Nramp outparologs. MntH C probably appeared afterward following horizontal transfer of a eukaryotic prototype Nramp gene.

Nramp gene duplication or selectively retained ‘prototype’ and lost ‘archetype’ Nramp. As fungi are generally viewed close to metazoans, and given the presence of ‘archetype’ Nramp in protozoans, believed to have diverged early in eukaryotic evolution (e.g., Plasmodia), selective maintenance of ‘prototype’ Nramp in fungi may seem more likely. MntH C possibly results from the transfer of a eukaryotic ‘prototype’ Nramp gene to a Bacterium and further propagation by HGT. MntH C grouping may reflect shared ecological niches by the respective species, e.g., gastro-intestinal tract for MntH Cβ or intracellular milieu for MntH Cα, aiding to create (contact or gain-of–function) opportunities for mntH gene transfers. Minimal functional divergence was predicted between MntH Cα and Cβ suggesting their main differences could be the type of gene that was acquired, e.g., ‘prototype’ Nramp or mntH C, and presence or absence of other mntH genes in the recipient Bacteria. Common MntH C properties would include deriving from a ‘prototype’ Nramp ancestor and improving bacterial divalent metals acquisition at the interface with eukaryotic cells.

Molecular Evolutionary Analysis of Nramp Family

191

Significance and Implications in the Context of Bacterial Infection Presence and Diversity of MntH in Bacteria No sequence was yet demonstrated to encode an Archaeal homolog. Biological membranes are more permeable to proton at high temperatures and hyperthermophilic Bacteria and Archaea use the less permeable ion sodium to maintain a motive force;32 they also use preferably ATPor GTP- driven systems for carbon and energy sources uptake (e.g., MntA or FeoB homologs, respectively33). In addition, Archaea have fewer transporters than most Bacteria.32 Hence biology and lifestyle may explain the absence of proteins similar to MntH in Archaea. In absence of Archaeal homolog, eukaryotic Nramp likely derived from a Bacterial ancestor. MntH A group sequence properties support an origin predating eukaryotic Nramp; MntH B group appeared even more ancient whereas MntH C clearly had a more recent origin. Sequence differences between MntH groups B and A may thus reflect their antiquity, relating to divalent metals uptake by Bacteria using the proton-motive force. In contrast, MntH C sequence diversity would relate to prevalent HGT and eukaryotic ‘prototype’ Nramp origin of mntH C genes.

MntH C and Bacterial Fitness A logical correlate to the horizontal transfer of mntH C genes is a gain of function for recipient Bacteria, as acquisition of genomic islands or islets is a common evolutionary mechanism used by Bacteria to adapt to their environment.34 HGT concerns genes subjected to positive selection for increasing bacterial fitness in various conditions (ecological, saprophytic, symbiotic or pathogenic fitness). A single function, e.g., iron uptake, may favour the growth of related Bacteria either pathogen (Yersinia), saprophyte (Escherichia) or environmental (Klebsiella 34). Considering MntH membrane transport a simple operational function, it is expected to find examples of mntH HGT. However, the high prevalence of HGT in MntH C group suggests distinctive properties, useful in different conditions given the diversity in bacterial species in this group. Novel membrane transport properties could have resulted from the adaptation of ‘prototype’ Nramp in eukaryotic cells and might explain subsequent spreading of mntH C xenologs among various Bacteria spp. This could be tested by comparing the role of MntH C and A in bacterial infection of eukaryotic hosts. One possibility is that MntH C proteins could confer increased resistance to metal starvation and oxidative stress conditions encountered during host infection, or to other conditions unfavourable for microbial growth (e.g., food preservation). Intracellular accumulation of Mn can increase bacterial growth and fitness, providing elemental protection against reactive oxygen species.35 Several virulent bacteria use this strategy during infection whereas host defences aim at depleting microbial environment of metal ions.36,37 Bacterial pathogens, including Enterics, rely primarily on ABC-type transporters related to SitABCD to maintain full virulence in vivo.15,38 However, inactivation of both mntH Cβ and mntABC was required to observe reduced growth of Staphylococcus aureus in a murine abscess model.39 Future studies will aim at establishing how MntH C vs. MntH A-dependent transport can increase bacterial fitness and if it is important for infection. Mn improves resistance to various stresses as it is a cofactor of many detoxifying enzymes.37 For example, Mn- and O2-dependent decarboxylases create a “proton-motive metabolic cycle’’ used to take solute up for intracellular decarboxylation and efflux of the product, in turn producing ATP and protecting cells against acidification.40 The lactic bacterium O. oeni uses the malolactic fermentation cycle to cope with external pH ~ 3.5 in the presence of ethanol, which increases proton membrane permeability, and is used to balance wine.41 Similar Mn-dependent activity may be required to resist hoop bitter compound in beer; identification of Lactobacillus brevis mntH Cβ -the closest known relative of O. oeni mntH Cβ2- as a putative genetic marker of strains growing in beer, could indicate a role of MntH Cβ proteins in bacterial stress resistance.42 MntH C proteins could thus increase resistance to harsh environmental conditions,

192

The Nramp Family

including metal starvation, acid and oxidative stresses, and favour bacterial growth in an infectious setting.

Outlook The Nramp family of divalent metal transporters originated early in the evolution of Bacteria before the divergence of Gram positive and negative clusters; MntH B homologs found in few Bacteria could represent the closest relatives to the ancestor of the family. Despite relatively low sequence identity, MntH B share with MntH A several characteristics (sequence length, hydrophobicity, and relative site-specific divergence rates) suggesting that sequence difference resulted from successive times of emergence and/or adaptation to changing environmental conditions (e.g., aerobiosis). The closer relationship between MntH A and Nramp suggests the endosymbiotic transfer of a prokaryotic mntH A gene towards eukaryotic nucleus. Two types of eukaryotic Nramp, ‘proto-’ and ‘archetype’, are believed to result from an ancient gene duplication in the common ancestor of plant, animal and fungi, followed by extensive sequence divergence. The functional and/or structural correlates of Nramp diversification are presently not known. ‘Archetype’ Nramp are expressed in vertebrates at host/microbe interface (e.g., epithelia and phagocytes) and required for metal homeostasis and resistance to infection. It will be interesting to study the role of these ‘prototype’ and ‘archetype’ Nramp proteins in host resistance to infection in eukaryotic species possessing both types. The close sequence relationship between ‘prototype’ Nramp and prokaryotic MntH C, subjected to prevalent horizontal gene transfer, strongly suggests the possibility of transfer between domains (Eukarya, Bacteria). The importance of horizontal gene transfer in adaptive processes of Bacteria is widely recognised. The potential role of MntH C in bacterial infection deserves further attention given the importance of eukaryotic Nramp for host resistance and the existence of endo-symbiotic or parasitic Bacteria that express MntH C. The use of a phylogenetic model will help understanding the evolution of Nramp mechanism of transport of divalent metals and its role in metal homeostasis.

Acknowledgments This work was supported by a research grant from the Canadian Institutes of Health Research (CIHR). E. R. is supported by the CIHR and Dr. Cellier is a scholar from the Fonds pour la Recherche en Santé du Québec.

References 1. Cellier M, Prive G, Belouchi A et al. Nramp defines a family of membrane proteins. Proc Natl Acad Sci 1995; 92:10089-10093. 2. Supek F, Supekova L, Nelson H et al. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci USA 1996; 93(10):5105-5110. 3. Perzov N, Spekova L, Supek F et al. Organellar H(+)-ATPase—site directed mutagenesis and suppressor mutants. Acta Physiol Scand Suppl 1998; 643:185-194. 4. D’Souza J, Cheah PY, Gros P et al. Functional complementation of the malvolio mutation in the taste pathway of Drosophila melanogaster by the human natural resistance- associated macrophage protein 1 (Nramp-1). J Exp Biol 1999; 202(Pt 14):1909-1915. 5. Gunshin H, Mackenzie B, Berger UV et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997; 388:482-488. 6. Pinner E, Gruenheid S, Raymond M et al. Functional complementation of the yeast divalent cation transporter family SMF by NRAMP2, a member of the mammalian natural resistance- associated macrophage protein family. J Biol Chem 1997; 272(46):28933-28938. 7. Richer E, Courville P, Bergevin I et al. Horizontal gene transfer of "prototype" Nramp in bacteria. J Mol Evol 2003; 57(4):363-376. 8. Roig EA, Richer E, Canonne-Hergaux F et al. Regulation of NRAMP1 gene expression by 1alpha,25-dihydroxy-vitamin D(3) in HL-60 phagocytes. J Leukoc Biol 2002; 71(5):890-904. 9. Makui H, Roig E, Cole ST et al. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 2000; 35(5):1065-1078.

Molecular Evolutionary Analysis of Nramp Family

193

10. Boyer E, Bergevin I, Malo D et al. Acquisition of Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2002; 70(11):6032-6042. 11. Kehres DG, Zaharik ML, Finlay BB et al. ME. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol Microbiol 2000; 36(5):1085-1100. 12. Kehres DG, Janakiraman A, Slauch JM et al. Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H(2)O(2), Fe(2+), and Mn(2+). 13. Kehres DG, Janakiraman A, Slauch JM et al. SitABCD is the alkaline Mn(2+) transporter of Salmonella enterica serovar Typhimurium. J Bacteriol 2002; 184(12):3159-3166. 14. Zhou D, Hardt WD, Galan JE. Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect Immun 1999; 67(4):1974-1981. 15. Janakiraman A, Slauch JM. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol Microbiol 2000; 35(5):1146-1155. 16. Eriksson S, Lucchini S, Thompson A et al. Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol Microbiol 2003; 47(1):103-118. 17. Que Q, Helmann JD. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol Microbiol 2000; 35(6):1454-1468. 18. Cellier MF, Bergevin I, Boyer E et al. Polyphyletic origins of bacterial Nramp transporters. Trends Genet 2001; 17(7):365-370. 19. da Silva FR, Vettore AL, Kemper EL et al. Fastidian gum: The Xylella fastidiosa exopolysaccharide possibly involved in bacterial pathogenicity. FEMS Microbiol Lett 2001; 203(2):165-171. 20. Akman L, Yamashita A, Watanabe H et al. Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia. Nat Genet 2002; 32(3):402-407. 21. Tettelin H, Masignani V, Cieslewicz MJ et al. Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc Natl Acad Sci 2002; 99(19):12391-12396. 22. Glaser P, Rusniok C, Buchrieser C et al. Genome sequence of Streptococcus agalactiae, a pathogen causing invasive neonatal disease. Mol Microbiol 2002; 45(6):1499-1513. 23. Burrus V, Pavlovic G, Decaris B et al. The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid 2002; 48(2):77-97. 24. Brochier C, Philippe H. Phylogeny: A nonhyperthermophilic ancestor for bacteria. Nature 2002; 417(6886):244. 25. Brochier C, Bapteste E, Moreira D et al. Eubacterial phylogeny based on translational apparatus proteins. Trends Genet 2002; 18(1):1-5. 26. Hedges SB. The origin and evolution of model organisms. Nat Rev Genet 2002; 3(11):838-849. 27. Baymann F, Brugna M, Muhlenhoff U et al. Daddy, where did (PS)I come from? Biochim Biophys Acta 2001; 1507(1-3):291-310. 28. Nisbet EG, Sleep NH. The habitat and nature of early life. Nature 2001; 409(6823):1083-1091. 29. Zhou XJ, Vaziri ND, Pandian D et al. Urinary concentrating defect in experimental hemochromatosis. J Am Soc Nephrol 1996; 7(1):128-134. 30. Wiechert UH. Geology. Earth’s early atmosphere. Science 2002; 298(5602):2341-2342. 31. Levin-Zaidman S, Englander J, Shimoni E et al. Ringlike structure of the Deinococcus radiodurans genome: A key to radioresistance? Science 2003; (5604):254-256. 32. Konings WN, Albers SV, Koning S et al. The cell membrane plays a crucial role in survival of bacteria and archaea in extreme environments. Antonie Van Leeuwenhoek 2002; 81(1-4):61-72. 33. Koning SM, Albers SV, Konings WN et al. Sugar transport in (hyper)thermophilic archaea. Res Microbiol 2002; 153(2):61-67. 34. Hacker J, Carniel E. Ecological fitness, genomic islands and bacterial pathogenicity. A Darwinian view of the evolution of microbes. EMBO Rep 2001; 2(5):376-381. 35. Horsburgh MJ, Wharton SJ, Karavolos M et al. Manganese: Elemental defence for a life with oxygen. Trends Microbiol 2002; 10(11):496-501. 36. Posey JE, Gherardini FC. Lack of a role for iron in the Lyme disease pathogen. Science 2000; 288(5471):1651-1653. 37. Jakubovics NS, Jenkinson HF. Out of the iron age: New insights into the critical role of manganese homeostasis in bacteria. Microbiology 2001; 147(Pt 7):1709-1718. 38. Claverys JP. A new family of high-affinity ABC manganese and zinc permeases. Res Microbiol 2001; 152(3-4):231-243.

194

The Nramp Family

39. Horsburgh MJ, Wharton SJ, Cox AG et al. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Mol Microbiol 2002; 44(5):1269-1286. 40. Foster JW, Moreno M. Inducible acid tolerance mechanisms in enteric bacteria. Novartis Found Symp 1999; 221:55-69. 41. Graca da Silveira M, Vitoria San Romao M, Loureiro-Dias MC et al. Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells. Appl Environ Microbiol 2002; 68(12):6087-6093. 42. Hayashi N, Ito M, Horiike S et al. Molecular cloning of a putative divalent-cation transporter gene as a new genetic marker for the identification of Lactobacillus brevis strains capable of growing in beer. Appl Microbiol Biotechnol 2001; 55(5):596-603. 43. Kasting JF. Earth history. The rise of atmospheric oxygen. Science 2001; 293(5531):819-820. 44. Archibald JM, Keeling PJ. Recycled plastids: A ‘green movement’ in eukaryotic evolution. Trends Genet 2002; 18(11):577-584. 45. Hedges SB, Kumar S. Genomic clocks and evolutionary timescales. Trends Genet 2003; 19(4):200-206.

INDEX

A

C

Anemia 5-7, 38, 39, 48, 66, 68, 69, 73, 74, 76, 77, 79, 82, 83, 88, 90, 100, 101, 103, 108, 155 Arabidopsis 5, 49, 113-121, 129, 158, 159, 181 Aspergillus nidulans 47 Association studies 29, 30, 33, 34 Atopy 37, 38, 53-58, 62 Autoimmune disease 5, 29, 36, 37, 53-59, 61, 62

Cadmium 76, 113, 114, 116, 120, 121, 125, 130, 131, 178 Caenorhaditis elegans 4, 157 Candida albicans 4, 99, 156, 179, 181 Ceruloplasmin 108, 109 Chagas’ disease 37 Chelator 6, 8, 10, 121, 125, 126, 136, 142, 150, 182 Chicken 16-21, 23, 59 Chlamydia 4, 158 Collagen-induced arthritis (CIA) 59-61 Comparative genomics 16, 17 Complementation of yeast 115, 116, 119, 135, 136, 141 CorAD 8 crnA 47 Crohn’s Disease (CD) 36, 53-55

B Bacillus Calmette-Guerin (BCG) 3, 17, 18, 23, 29, 37, 38, 44-46, 48, 53-56, 58, 61, 62, 158, 159, 172-174 Bacillus subtilis 4, 9, 146-151, 156, 159, 163, 174, 182, 184 Bacteria 2, 4, 8, 10, 18, 21, 45, 47, 99, 113, 117, 129, 136-139, 141, 142, 146-148, 151, 154-156, 159, 161, 163, 165-169, 172, 174-176, 178, 179, 182-184, 186-192 Belgrade rat 74, 82-84, 86, 91, 100, 101 Blood-brain barrier (BBB) 83, 91 Bovine 21, 23, 24, 157 Brain 6, 32, 61, 65, 68, 82, 83, 87, 91, 108 Breeding 17, 21, 22, 24 Brucella abortus 3, 21-24 Brucella suis 16, 21, 22, 187 Brucellosis 16, 21-24 BSD2 129 Bsd2 129-131

D Diabetes 37, 53-55, 61 Disease resistance 16, 21, 23, 24, 32 Divalent cation 1, 5-8, 10, 12, 32, 38, 44, 48, 49, 53, 54, 57, 62, 66, 88, 99, 138, 139, 147, 154, 155, 161-163, 167, 168, 173-175, 178, 183 Divalent metal 7, 8, 10, 11, 30, 66, 67, 73, 82, 88, 90, 96, 99, 104, 106, 110, 129, 135-137, 139, 141, 142, 147, 161, 162, 179, 182, 183, 189, 190-192 Divalent metal transporter 66, 82, 96, 99, 192 Divalent metal transporter 1 (DMT1) 4, 65-70, 73-79, 82-93, 96, 99-110, 115, 118, 125, 127, 129 Drosophila melanogaster 4, 69, 117, 142, 155, 157, 180, 181

The Nramp Family

196

E

G

EIN2 5, 49, 114-117, 121, 159 ein2 115 Endosymbiosis 188 Enterocytes 67, 69, 77, 78, 82-86, 103, 104, 106 Erythroid cell 77, 82, 83, 88, 90, 96, 103, 106 Erythroid tissue 88 Erythropoiesis 65, 69, 105, 106 Erythropoietic cells 82, 90 Escherichia coli 4, 5, 48, 117, 146, 148-150, 156, 159, 161-163, 168, 174, 178, 182, 183, 186, 188 Eukaryotic Nramp1 167, 172, 173, 175 Experimental autoimmune encephalomyelitis (EAE) 59, 61 Expressed sequence tag (EST) 17, 113-115

Gastrointestinal tract 83, 84 Gene duplication 179, 181, 183, 188-190, 192 Gene expression 4, 19, 24, 32, 45, 48, 97, 99, 118, 119, 129, 130, 146, 147 Glial cells 82, 91 Golgi 98, 124, 127, 129, 131 Granulocyte-macrophage colony stimulating factor (GM-CSF) 47, 97

F Fe2+ 5-8, 11, 12, 44, 48, 49, 66, 67, 73-78, 82, 135-137, 139, 154, 155, 161-166, 168, 174, 182, 183 feoABC 8 feoB 8, 167, 182, 191 fepBCDG 8 Ferric uptake repressor (Fur) 8, 146, 148, 150, 151, 154, 163, 165, 166, 174, 182 Ferritin 39, 58, 61, 104, 106, 108, 109, 119, 138, 174 Fibrinogen 46 Fibroblasts 58, 83 Fibronectin 46 Fluorescence in situ hybridization (FISH) 17, 19 Francisella tularensis 4

H Heme iron 65-67, 69, 70, 77, 83, 84, 86, 87, 91, 99, 105, 107, 108 Hemochromatosis 39, 69, 73, 79, 105, 107, 136 Hepatocytes 65, 68, 82, 83, 87, 88, 102, 103, 107, 109 Hereditary hemochromatosis (HHC) 39, 73, 79, 105, 107 Heterologous expression 115, 121, 135, 139, 178, 183 HLA-DR 44 Horizontal gene transfer 179, 185, 188, 192 Host resistance 1, 2, 16-20, 24, 96, 155, 192 Human immunodeficiency virus (HIV) 1, 34, 35

I Immunoglobulin E (IgE) 37, 38, 54-56, 62 Infection 1-5, 7, 8, 16-24, 29, 32-37, 44-46, 48, 49, 62, 73, 96, 97, 99, 136, 137, 139, 142, 154, 155, 163, 166, 167, 172, 173, 175, 178, 182, 183, 188, 191, 192 Inflammatory bowel disease (IBD) 32, 36, 39, 53-55, 57

Index

Interferon γ (INFγ) 4, 19, 21, 32, 44, 45 Interleukin 1β (IL-1β) 47 Intestinal absorption 39, 48, 65, 73, 77, 83, 87, 99, 105 Intestinal iron absorption 39, 69, 77, 78, 83, 96, 155 Intestine 65, 66, 69, 73, 77, 79, 82-89, 104-106 Intracellular pathogen 3, 7, 16-18, 44, 45, 49, 66, 96, 99, 114, 146, 165, 172, 174 IRE-binding protein 77 Iron 5-8, 10, 36-39, 47-49, 58, 59, 61, 65, 66-70, 73, 75-79, 82-93, 96, 99, 101, 103-110, 113-115, 118, 119, 124-127, 129-131, 135-138, 140, 141, 143, 146-148, 150, 151, 155, 163-165, 167, 168, 174, 175, 181, 182, 189, 191 Iron deficiency 5, 6, 66-69, 82, 85, 88, 90, 99, 101, 107, 126, 129, 155 Iron metabolism 6, 39, 65, 68, 79, 82, 92, 99, 101, 105, 107, 124 Iron regulatory protein (IRP) 39, 48, 86, 99 Iron transport 6, 7, 38, 39, 48, 65-68, 70, 73, 76-78, 82, 83, 88, 90, 91, 106, 107, 114, 119, 127, 131, 140, 164, 167, 182 Iron-deficiency anemia 68 Iron-responsive element (IRE) 23, 32, 38, 68, 77-79, 83-85, 88, 90, 91, 93, 99, 101, 105-107, 119, 146 IRP1 77 Ity/Lsh/Bcg 3, 4, 54, 96

K Kawasaki disease 35, 56 Kidney 65, 68, 70, 78, 82, 83, 86, 90, 92, 102, 104-106, 155 Kinase 4, 47-49

197

L Legionella 4 Leishmania 2, 4, 5, 16-18, 23, 31, 35, 45, 49, 54, 57, 96, 98, 136, 154 Leishmania donovani 2, 3, 16-18, 23, 45, 46, 54, 96, 136, 154 Leprosy 2, 31, 32, 34, 35 Linkage studies 2, 11, 29, 33-35, 39 Lipopolysaccharide (LPS) 4, 22, 32, 46, 55, 56, 58, 97, 155, 175 Listeria 4, 45, 184 Liver 2, 19, 32, 37, 45, 47, 65, 66, 68, 77, 79, 82, 83, 86-88, 105, 107, 108, 155

M Macrophage 1-4, 6-11, 16, 18, 19, 21-24, 30, 32, 35-37, 44-49, 53, 54, 57-59, 61, 62, 65, 66, 68, 70, 73, 77, 78, 85, 96-99, 102, 105, 107, 108, 110, 113, 114, 136-139, 141, 142, 146, 154, 155, 165-168, 172-175, 178, 182 Major histocompatibility class II 44 Manganese 18, 49, 66, 113, 115, 124-126, 127, 129-131, 135, 137, 140, 143, 146-151, 165, 178 Manganese transport regulator 146, 149 Membrane protein 1, 2, 4, 44, 47, 96, 98, 114, 125, 155 Membrane transport 5, 65, 82, 107, 127, 191 Membrane-associated interleukin 1 (MaIL-1) 47 Menkes’ disease 114, 146 Metal homeostasis 114, 115, 118, 119, 121, 146, 192 Metal-ion 73, 135-143 Metal-ion transport 139-141 Mitochondria 82, 83, 106, 109, 115, 124, 125, 127, 129, 131, 184, 191 Mn2+ 5-7, 11, 44, 48, 49, 66, 75, 135-139, 154, 155, 161-168, 173, 174, 182, 189

The Nramp Family

198

MntH 4, 5, 8, 141, 142, 146-148, 150, 154, 161-166, 168, 172-176, 178, 179, 181-184, 186-192 MntR 146-151, 154, 163-166, 174, 182, 188 Monocyte 4, 22, 32, 44, 97 Multiple sclerosis (MS) 37, 53-55, 58, 59 Mycobacteria 1-3, 6-9, 18, 24, 29, 32, 35, 44, 45, 48, 53-55, 58, 62, 73, 137, 139, 172, 173, 182 Mycobacterium avium 3, 4, 6, 9, 10, 35, 48, 54, 137, 159, 173, 187 Mycobacterium bovis 3, 9, 10, 22, 29, 44, 48, 54, 61, 96, 154, 158, 159, 172-174 Mycobacterium intracellulare 3, 45 Mycobacterium lepraemurium 3, 45 Mycobacterium tuberculosis 1, 3, 5, 9, 24, 32, 34, 44, 46, 54, 55, 141, 146, 147, 151, 158, 159, 172-176, 182, 187

N Neutrophils 4, 8, 18, 58, 97, 99 Nitric oxide (NO) 21, 22, 46, 48, 49, 58, 59, 61 Nramp (NRAMP) 4-8, 12, 29, 31, 38, 40, 44, 46-49, 66, 68, 70, 82, 96, 97, 108, 113-119, 121, 124, 125, 127, 129-131, 135-137, 139, 142, 146-148, 154, 155, 157-159, 161-163, 167, 168, 172, 173, 178-184, 188-192 Nramp1 (NRAMP1) 1-12, 16-21, 23, 24, 29-38, 32, 40, 44, 46-48, 53, 54, 66, 68, 70, 73, 96-99, 108, 110, 113, 114, 129, 136-139, 141-143, 154, 155, 157, 161, 162, 166, 167, 172-175, 181, 182 NRAMP2 5, 29, 31, 38, 39, 99, 115, 118 NRMIT 135, 137, 139, 141, 142

O Oxidative stress 124, 126, 131, 148, 151, 174, 183, 191, 192 OxyR 146, 148, 150, 151, 154, 163, 166, 182

P Pasteurella pneumotropica 3 Pathogenesis 24, 36, 165, 167, 168, 188 PerR 151 pH 1, 5-8, 10, 12, 18, 38, 48, 73-76, 82, 88, 92, 110, 117, 135, 137-141, 143, 161, 163-165, 172-174, 182, 191 Phagocytic cells 1, 12, 48, 108 Phagolysosome 8, 9, 44, 99, 108, 173 Phagosome 1, 2, 4, 6, 7, 9, 10, 12, 47, 48, 77, 78, 98, 99, 102, 108, 110, 136-139, 141, 155, 167, 172-174, 182 Phosphatases 49 Phylogenetic analysis 181 Phylogeny 178, 179, 183, 189 Placenta 70, 82, 83, 93, 109 Placental transfer 93 Plant 113-121, 129, 136, 154, 179, 181, 192 Primary biliary cirrhosis (PBC) 31, 37, 53-55 Pro-inflammatory response 53, 54, 57, 58, 61, 62 Protein kinase C (PKC) 4, 23, 47-49 Pseudomonas 4, 117, 161, 186

R Reactive oxygen species 146, 150, 155, 163, 191 Regulation 7, 8, 19, 21, 23, 24, 36, 44, 47-49, 58, 59, 61, 65, 68, 69, 73, 76-79, 83, 85, 88, 90, 105-107, 118, 119, 121, 124, 129-131, 135, 146-148, 150, 151, 163, 164, 166, 174, 179, 189

Index

199

Restriction fragment length polymorphisms (RFLP) 17 Reticulocyte 7, 39, 77, 88-90, 93, 106, 107 Rheumatoid arthritis (RA) 29, 36, 37, 53-55, 58 Rice 114, 115, 117, 118

SOD2 127, 129 Staphylococcus aureus 4, 148, 149, 151, 156, 159, 161, 163, 184, 191 Superoxide dismutase 8, 11, 127, 129, 163, 174

S

TNF-α 46, 49, 57, 58 Toxoplasma gondii 4, 155 Transferrin 6, 39, 58, 65-67, 70, 73, 77-79, 82, 83, 86-93, 105-107, 110, 173 Transferrin cycle 39, 65-67, 70, 77 Transferrin receptor 58, 65, 77-79, 88-91, 93, 105, 106, 173 Transport 4-8, 11, 12, 19, 23, 30, 32, 38, 39, 44, 47, 48, 65-68, 70, 73-78, 82-84, 88-93, 100, 101, 104, 106-110, 114-119, 121, 124-126, 127, 129-131, 135-142, 146-149, 154, 155, 159, 161-165, 167, 168, 174, 178, 179, 182, 191, 192 Transporter 1, 2, 5, 18, 21, 30, 36, 38, 47, 48, 53, 54, 62, 65, 66, 68, 70, 73, 74, 76, 82, 83, 90, 96, 99, 106-108, 113-119, 121, 124-127, 129-131, 135-139, 141-143, 146-148, 150, 154, 159, 161-164, 167, 168, 172-176, 178, 182, 183, 191, 192 Trypanosoma cruzi 36, 37 Tuberculosis 1-5, 7, 9, 23, 24, 29, 31-35, 44, 46, 54, 55, 57, 58, 141, 146, 147, 151, 158, 159, 172-176, 182, 187

Saccharomyces cerevisiae 4, 5, 117, 119, 124, 125, 127, 129-132, 135, 136, 155, 161, 179, 181 Salmonella 2-4, 8-11, 16-21, 23, 24, 45-47, 54, 96, 99, 117, 136, 142, 146, 148, 150, 154, 159, 165, 174, 182, 183, 186 Salmonella containing vacuoles (SCV) 10, 11, 165, 167, 168 Salmonella enteritidis 18-21 Salmonella gallinarum 18, 19 Salmonella pathogenicity island 2 (SPI2) 8 Salmonella pullorum 16, 18, 19 Salmonellosis 16, 18, 19 Signaling 44, 48, 49, 115, 159 Single nucleotide polymorphism (SNP) 17, 30, 35, 38, 39 sitA-D 8 SLC11A1 30, 53-59, 62 SLC11A2 38, 58, 73, 79, 99 Slip 135, 139-141 Slip phenomenon 139 SMF1 6, 74, 75, 114, 115, 117, 118, 121, 125-127, 136, 179, 182 smf1 5, 48, 115, 116, 125-127, 129, 131, 135, 141, 143 Smf1p 124-127, 129-131, 135-137, 139-141 SMF2 6, 117, 125, 127, 137 smf2 5, 48, 127, 129, 131 Smf2p 124, 125, 127, 129-131 SMF3 6, 117, 124, 127, 131, 137 smf3 5, 127, 129 Smf3p 124, 125, 127, 129, 131

T

U Ulcerative colitis (UC) 36, 53-55 Uptake 6, 7, 39, 45, 47, 65, 66, 68, 69, 73-78, 82-84, 86-90, 92, 93, 104-107, 109, 113-116, 118-121, 124-127, 129, 131, 135-137, 139,

The Nramp Family

200

141, 142, 146-148, 150, 151, 154, 161, 163-165, 174-176, 179, 182, 189, 191

V Vacuole 9-11, 114, 124, 127, 129-131, 165, 172, 173 Vesicle trafficking 32 Virulence 1, 2, 8, 12, 142, 147, 154, 167-169, 174, 175, 179, 182, 191

W Wilson’s disease 114, 146

Y Yeast 5-7, 48, 74, 98, 113-121, 124-127, 129-131, 135-137, 141, 143, 146, 179, 182, 184, 188 Yeast mutants 48, 113-115, 118, 125, 127, 129, 136, 141

Z Zinc 49, 113, 114, 117, 125, 130, 131, 135, 146, 147 Zinc uptake repressor (Zur) 146 Zn2+ 5, 6, 44, 48, 49, 66, 75, 135-137, 140, 154, 155, 161, 163-165

MOLECULAR BIOLOGY INTELLIGENCE UNIT

INTELLIGENCE UNITS Biotechnology Intelligence Unit Medical Intelligence Unit Molecular Biology Intelligence Unit Neuroscience Intelligence Unit Tissue Engineering Intelligence Unit

CELLIER • GROS

Landes Bioscience, a bioscience publisher, is making a transition to the internet as Eurekah.com.

MBIU

The chapters in this book, as well as the chapters of all of the five Intelligence Unit series, are available at our website.

The Nramp Family

9 780306 478413