Voice of the Planet Michael Tobias
bantam books new york • toronto • london • sydney • auckland VOICE OF THE Planet A ...
47 downloads
4980 Views
1MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Voice of the Planet Michael Tobias
bantam books new york • toronto • london • sydney • auckland VOICE OF THE Planet A Bantam Spectra Book /July 1990 All rights reserved. Copt/right © 1990 by Gaia Corporation and TBS Productions, Inc. Front cover photo courtesy of NASA, Back cover painting "Sunset in the Yosemite Valley" by Albert Bierstadt courtesy of the Hoggin Museum, No part of this book may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without permission in .writing from the publisher* For information address: Bantam Books. ISBN 0-553-28367-7 Published simultaneously in the United States and Canada Bantam Books are published by Bantam Books, a division of Bantam Doubleday Dell Publishing Group, Inc. Its trademark, consisting of the words "Bantam Books" and the portrayal of a rooster, is Registered in U.S. Patent and Trademark Office and in other countries. Marca Registrada. Bantam Books, 666 Fifth Avenue, New York, New York 10103. PRINTED IN THE UNITED STATES OF AMERICA RAD 0987654321
For Dora, Ida, Nathan and Manuel Lev. In loving memory. VOICE OF THE PLANET
chapter one "Gaia" From the Diary of William Hope Planter . . . December, 12,000 feet, northeastern Nepal. A piercing sun has broken through two weeks of storm, exposing me and Illa, my Sherpa guide, high on a snowy ridge above endless pristine valleys of flowering rhododendron, mauve and red. Blinding cornices of ice cling to the spruce and juniper, plastering the upper slopes with windslab. My nerves tingle. We come to a cairn festooned in Tibetan prayer flags, their pale colors whipping in the harsh wind.-I'm dizzy with the altitude, uncomfortably aware of my weight and sluggishness. I think I'd love trekking, if it weren't for all this damned trekking. Frozen mornings, frozen nights. My Sherpa companion is spry and inscrutable. He speaks few words and drinks an enormous quantity of chang—Tibetan beer—enabling him to glide up the trail, while I
schlepp, sucking after oxygen, with little excuse for being in Nepal in the wintertime. By now the memory of the Kathmandu Sheraton and the pizza of Marco Polo's down in the Tibetan center of town weigh heavily. I hunger for a hot bath and a hot meal. I must pee, but not here, however severe the urging; not atop so much virgin crust. Yellow circles seem irreverent in the Nepalese snow. Illa grins, a keen observer, He continues close behind our unstoppable yak, while I cautiously start down beneath the trail, rummaging through several protective layers of wool. It's steep. The underlying sand has retained the sun's heat. One foot slips. But my pants are already unzipped and my manly brain refuses to desert the aching member's urgent task. I fly onto my ass, out into air, crashing into a snowy mound on the cliff's edge. Palms scraped raw, I get up and continue urinating down the granite wall. Tato pani. Water of despair. Water of relief. The world spins below in eddies. Illa is right there, having descended like a ballet dancer. Fifty years old, he climbed Everest in the late 1960's with a Japanese team. A stout and good-humored fellow, his weathered skin is the color of burgundy, his eyes black and lidded from so much glacial glare. Without using his hands, skimming over the surface of rock, he stands beside me now, perfectly poised. "How much farther?" I ask wearily. "One day maybe," Illa replies, helping me back up. "If boss able stay on trail. Bistaari jaane!" he says. Go slowly. The cliff has made me dizzy. I start sifting through my Nepali, expecting to use it. Aaspital kahAA chha? Where's the hospital. Me laai bokne manche chaahiyo! I need a person to carry me. Meanwhile our single-minded yak has forged on. We catch up with it at a way station—a baaTTi— where we are greeted by a wild assemblage of ruby-cheeked kids, a woodcutter, and the beguiling smiles of several women adroitly at work in the kitchen, husking, scraping, pouring, and laughing hysterically. Not a normal sort of paradise, but rather, ease, industry, the humble beginnings of life as it might have existed from the beginning. A mere first impression. It is a final frontier on the windy edge of my known world, where a small cluster of rural folk has settled into hardship. They might have more easily adopted the steamy rice paddies of lower down. The wood they harvest is illegal. Their crude settlement of lean-tos and adobe shacks is deep in dirt, snowdrift, and smoke. Primitive. We're invited into one of the dark dwellings, where tattered magazine clippings are pasted to the cracks in the walls. The wind makes a high whistle past the many chinks in the decaying structure. The old woman has boiled water in a large brass cauldron. Her teeth are also largely of brass. I apply a squeeze of artificial lemon from my own food supply^ and add the requisite ten drops of iodine, two percent tincture. The tea is said to wipe out every virus and bacterium, except those multiplying in the tea itself. I don't know how long I'll be in these mountains but the one thing I don't want is diarrhea in winter, not at high altitude. No backup. You can't ride a yak down the trail, and planes and helicopters from Lukla—twenty miles away— are often delayed weeks at a time because of weather. I've been coached about this business of iodine. Put it in everything; put it in your
toothbrush, on bread. Don't ever touch your lips after shaking hands or holding money. Never let a drop of water enter any orifice during a shower. No stream is safe in these mountains. Mountain folk use the down-flowing water as their only sewer. My pee seems more green than yellow. No doubt the iodine. Of course I'm also color-bund, but the eerie sense of medical vulnerability has left me squeamish. I opt to exit this dank otherworld for the glistening outdoors, where the sun blinds and the mists have burned off to reveal enormous shanks of fluted mountain wall. An avalanche thunders. A bird sings. Above, churned-up snow spins in a whirlwind, dancing dervish ghosts leading the way up the trail. The way? I still doubt everything. A computer hacker speaking to me from the Himalayas? Lingering in my dreams, inserting his own crackpot editorial weirdness between the lines of my research? Two months earlier I had been sitting at a station inside the sci-fi interior of Jet Propulsion Laboratory in Pasadena, California, a busy research facility where scientists monitored the Viking missions to Mars back in 1976. Video images of Uranus, Neptune, and the scattered rings of Saturn flashed and telescoped across a bevy of overhead screens while relaxed investigators followed a planetary flyby. Data came in every minute from their network of sensors and radio dishes in Europe, Australia, and Gold-stone—out in the Owens Valley of California. It was here that my friend George Henley conducted his own line of inquiry: exobiology, the study of organic evolution, of life, out in the galaxies. It was the first month of my sabbatical leave from teaching at Cal Tech. I'd begun a book, one that I'd been mulling over for several years. Ecology, history, conscience. In other words, the glorious and dastardly deeds that occur when men and mountains meet; when humanity tries to triumph over nature, as we have attempted for eons. I was always perplexed by the intellectual and emotional aftermaths of such ambiguous collisions. The book had been written by others before me, in one form or another, with concerns and postulations echoed over millennia. Men like Lucretius, who devoted his life to gardens; or the great wilderness enthusiast and mentor, Aldo Leopold; even that legendary Konrad Gesner, intrepid Swiss glaciologist of the sixteenth century. But I was prompted to write this book nonetheless. I suppose it was a question of easing the burden I often felt for being a member of the dominant species on Earth. Reverse hubris. A guilt for all the plants and animals prevailed upon; a strong sense that Dr. Doolittle's unswerving love of nature was an absolute to which my life was inextricably bound. Doolittle made no special claim for animals. He simply treated them as equals. Moreover, I had a strong sense that if I could not clarify my own life and make simple and clean those aspects of my behavior which seemed complex and dirty, then I wasn't worth a damn. I always wanted to act deliberately in defense of the innocent—the children of Mali, the homeless of New York, the penguins of Esperanza, the otters and phytoplankton in Prince William Sound, the calves in the stockyards, the bison in Montana. That overwhelming injunction might take many forms, of course, but my life was plagued by an identification with the frailty inherent to the meek; and galled by that collection of impulses—called Man—which were more apt to destroy than to renew. I wanted to protect everything, everyone, save for the Bastards: the world's money-grubbing bruisers, terrorists and the like. They could just hang out to rot. In that one detail, I was no pacifist. Furthermore, I detested the 'New Age.' In other words, I was troubled, you might say antisocial, more at home in the pathos of the so-called
human condition than in the real world. Perhaps Buddhism in Nepal was part of the equation. I was willing to think so. At forty-seven, I figured I'd waited long enough to make my move. To do something which I had never had the guts to do before. George was hunched over a stack of papers, commandeering two keyboards, calling up a flurry of color graphics. His monitor contained half a dozen independent windows of fast interacting data. I envied his fluency, lacking the patience to learn the lingua tyranna of anything but the most elemental word processing. I hate machines. George, on the other hand, is probably crippled without them. He's of that nerd generation, sympathetic, infuriating, as affectionate with a mainframe as with his mother. George had been researching Mars for over a decade and was convinced,-as were many of his Soviet colleagues, that life once existed on Mars, and perhaps continued to exist. The two Viking landers, three thousand miles apart, simply missed it. I brought him coffee and resumed working through some papers that compared different models for artificial life that George had found for me. I wanted to test some fundamental rules of ecology. It was a simple matter of scrolling down page after page of information. Suddenly, the monitor started flashing, the data froze, and the scroll key stubbornly locked. "You gotta hit escape when that happens," George muttered without looking my way. "I did that." He deftly stroked the F-6 key. "There." The data flowed, but then halted. "Wait a minute. What do you call that?" I said. "Interesting. Move over." He rolled his swivel chair across the lower bank of computers and tapped in a series of rapid queries to the recalcitrant machine. SYMBOLICS. P335/.D2/CHRYSES BIOTA FILE? In turn the screen rallied: TWINKLE TWINKLE LITTLE BAT HOW I WONDER WHERE YOU'RE AT; UP ABOVE THE WORLD YOU'LL FLY IF YOU DARE TO CLIMB THAT HIGH! , George stared at the screen bemused. "Bats don't climb." I knew what was coming. It had started a year before and then had begun to increase in frequency— months, weeks, then days apart. "Check its signature." George queried the computer matter-of-factly, only to unleash the same cryptic interloper I had come to
recognize. The computer sprayed out the words: GAIA, THYANGBOCHE, NAMASTE! "Damn hacker's broken into the system," George grunted. I objected. "You guys are operating one of the most high-tech facilities in the world, tracking Voyager Two, registering minutiae from all quarters of the universe. And you're telling me that the system is not immune to outside attack?" "Forget it. It's no virus. Happens all the time. Probably some thirteen-year-old acned Valley punk showing off to his girlfriend. Got his PC hooked up in his bedroom. Parents are proud of their little genius—they figure his obsessions are safer than drinking and of course they don't really have a clue what he's up to. And hell, it's a sport for these kids. There's no way we can control it. NATO can't control it. Even the space shuttle computers are vulnerable. Imagine that! Now when the sorry day comes that such a kid infects the missile silo Grays with a launch command, then we'll have a dicey problem. For now, ignore it! Material's all unclassified anyway and it's too much of a hassle to track it." George went back to his work while I sat staring at the three words—Greek and Tibetan—that would change my life. The paraphrase from Lewis Carroll, which would later explain itself in a passionate plea on behalf of bats—the world's foremost controllers of pests, dispersers of seed to the subtropics; animals essential to the Earth but woefully in danger of total extermination by man. The appeal to ascend, to climb. I couldn't ignore it. It sounds crazy but the hacker had been following me. Always leaving the same signature—Gaia—the buzzword of yuppie ecology, the science of global issues, global weather, the global village. Gaia, the ancient Greek Goddess of Earth. Thyangboche, the name for what is considered the most famous Buddhist monastery in all of the Himalayas. Namaste, the Tibetan shalom. And now a new invocation: BRING PAIR OF ARGYLE SOCKS FOR THE LAMA. MEDIUM. NEIMAN-MARCUS. What was I dealing with? In the low electric murmur of a computer, any computer I had chosen to use in the last twelve months, there he was, provoking me to come to Nepal, quoting my past, addressing me on a first-name basis. On the computer screen as well as in my sleep, in the midst of silence, I kept hearing, seeing a voice. We sleep in a yak herder's hut. All night the stench of kerosene mingles with cacophony and the incessant wheezing of my hosts. A tubercular darkness alive with visceral ejecta, sputum, boisterous farts, and barking dogs keeps me unhappily attuned, shivering, losing confidence in the whole enterprise. In the middle of the night I go outside with flashlight and newspaper in hand. The peaks shine pink beneath the moon. Smudges of frozen cloud creep across their twinkling sides. In spite of stomach cramps and a dolorous sense that the world is caving in around me, the sight of those peaks rekindles my resolve to keep going. The next morning we cross over a notch and wind our way through thick fog across a suspension bridge that spans a fulminant torrent. Out of the mist four young Buddhist monks in adidas shoes, no socks, red skirts, and saffron-colored silk jackets scurry along the trail, happy as cottontails in the cold. They greet us in passing and continue down toward a lower hermitage. By now our yak is more determined than ever to attain the summit, a delirium of meadows to feast upon, it must have sensed.
Perhaps it is my own delirium, after uncountable days on the trail. In the early twilight we emerge from the forest, surmounting the last pass up from the village of Khumjung. And there is Thyangboche, a Buddhist monastery near Mount Everest. At the front of the imposing structure we pass beneath a ceremonial arch known as a stupa, orchoorten, in Tibetan. This wood-andadobe shrine, standing some ten feet tall, symbolizes Su-Meru, the mythic Mount Sinai of Tibet. It is surrounded by mani stones, as they're called, smooth dark granite rocks with the names of deceased Tibetan monks carved into them. From the looks of it, a lot of people have died around here. Painted Buddhas adorn the stupa's undersides. The fog gently sweeps the monastery's ornately painted walls. The fortress looks out over an open clearing at the head of a glacial valley. Illa points into the mist. "Everest!" The famed mountain looms somewhere beyond. The peak we have just spent two weeks ascending turns out to be no more than a mere plateau, one of many, leading ever higher. The monastery is dirtier than I have imagined and is definitely not the proverbial college-dorm hangout where one might ordinarily expect to find a computer hacker. That hacker is why I've just lugged a stubborn pesto-and-pistachio-ice-cream-crazed paunch into the Himalayas. But the only thing on my mind now is sleep, and getting warm. I sink down on frozen meadow, and have barely enough energy to open up my sleeping bag. In the morning I awake to an old monk ambling past my bag, which I have managed to put down on what resembles squirrel vomit. A walloping backdrop now assails my senses from all sides. At 6:30 A.M. the air is lucent, the mountains glazed against a cobalt sky. Shadows of lush indigo, icy points sun-burnished by first light. Everest exceeds its neighbors with a deceptively simple hump, and farther back against the Tibetan frontier are the mountains Cho Oyu, Nuptse, and Lhotse. Closer in, the lean, sky-rearing Ama Dablam is touched by gossamer-thin cirrus. Directly above Thyangboche, ten thousand feet of vertical ice define the cloven, sure lines of Tamserku and Kantega. I have read that all of these peaks have been climbed but I cannot imagine how. I am more interested in keeping the scabrous dogs away, cleaning my bag, getting out of the snow, and finding something hot to drink. Illa plans to descend today. I'll be on my own. There is life all around me: rising steam, movement of local tribal women, lowing, untethered stock animals, the washing of brass pots, the throwing out of water, herders squatting discreetly beside the snow-covered rhododendron trees that form a final thrust of vegetal green before the surrounding slopes give way to a rocky and irregular timberline. I am free with no foreknowledge. Nothing to do. One task confronts me: find food, warmth, and comfort. My hands are frozen. These supposedly waterproof gloves are bogus. Illa begins his descent following our customary courtesies and my paying him twenty-five hundred rupees—a hundred and twenty-five dollars. He was worth it and it's as much as he'll make all winter. As he wanders off and I turn to face the day, someone else comes up to me: a smartly dressed Sherpa in western clothes, about thirty I suppose. He is short, with perfect features, moving powerfully. "The Rinpoche's awaiting you," he remarks offhandedly.
I follow the Stein Erikson-like lad, who has introduced himself as Kaldup, across a courtyard, past two mastiff pups nursing at their lean and weary mother. The monastery is a labyrinth of cramped secret passageways, wobbly ladders, squeaky teakwood doors, colorful prayer flags suspended from totems, and crumbling whitewashed plaster. Suddenly the din of religious chanting starts up—deep guttural voices, old men's pleas with the beyond, tympani, flutes, the clanging of cymbals. The entire colossus of Thyangboche seems poised to jettison its resident monks into the surrounding ether, like a spiritual launching pad. We cross over well-stamped mud into a modest vestibule of Tibetan ornaments. Kaldup continues through a beaded curtain. There is whispering below the groan of an electric space heater and then I am ushered into what must be the abbatial den. Deities of wood and plaster behind glass cases stand between silk paintings and elongated manuscripts. The Lama, or Rinpoche, is busy listening to a fiveband Sony shortwave radio. He looks up and says, "From New Jersey," referring, I assume, to Sony's U.S. headquarters. The Lama wears penny loafers, eaten through in spots, against bare feet. Despite the heater, this room is colder than the outside. Tea is served, while the Lama folds a white muslin scarf around my neck. I reach for my iodine bottle and dropper, unintimidated by my amused host. The Lama then directs a question to Kaldup in Sherpa dialect which Kaldup translates. "Rinpoche asks if you brought the socks?" I'm jolted. Then, "As a matter of fact I did. They should reach his knees. Now how did he know?" "He's the Rinpoche. He sees things. He knew which morning you'd arrive." "Come on. Even I didn't know." Kaldup shrugs. I study the middle-aged Lama's face, with its Mandarin furrows and gleaming skin. The hacker? "What else does he see?" I ask. "The value of IBM on the stock exchange next month?" "If he needed such information he'd probably consult the computer," Kaldup coyly replies. "Then there is a computer here?" Kaldup is nonplussed by the eureka tone of my revelation. So is the Lama. "There was a Buddhist monk, an electrician, small-time inventor, general handyman," says Kaldup. "A legend here in Solo Kumbhu. He built it from spare parts. Trekkers who came through always left scraps, like that radio for the Rinpoche. The monk was pretty good. Used an abacus from the time he was a baby." "Where is he?" I ask. Kaldup is matter-of-fact. "One day he left, into the mountains. Family in Tibet. He's not come back." "And the computer?"
"The computer is here," he alleges. "Dusty but fully operational." My heart is literally pounding. It's here after all! I'm as nervous as a kid on his first date, certain that an embarrassing disaster is readying itself. "With what electricity?" I press. "Chomolungma," he says lyrically. "Come again?" There is reverence in his voice. "Everest. The Mother Goddess of the Sherpa. Hydroelectric. The waters are channeled off the glaciers, down the valley below the monastery. You must have passed the water wheels at the juncture of the bridge. Those wheels spin turbines and prayer, and produce electricity for the kitchen as well as for the young monks to read by at night. We laid the pipes and cables underground to preserve the beauty of the monastery. The computer is hooked into the system." "You speak excellent English," I commend him. "NYU. Class of '81." He grins. As the Lama looks on, serene or bored, I ask Kaldup about his subject of study. He pauses, then says with a hint of dejection, "Forest management. Not much to do with it here. So I've returned to my family now and help out as a translator for the Rinpoche from time to time." • I pursue his unenthusiastic note and tell him of the many woodcutters I passed on the trail. "Nepal is no paradise, even though all the tourists seem to think so. Over half our forests are gone. And the musk deer and snow leopard that inhabit them." The Lama, or Rinpoche as he's called, discusses something with Kaldup, having turned off a radio news broadcast he picked up from Moscow. Their repartee is furtive, subterranean. I notice between them a language of glances that eludes me but confirms in my mind the conspiratorial air of the surroundings. "The Rinpoche asks why you have come," Kaldup says. Something bothers me about this encounter, like I'm being set up. Perhaps high altitude has made me paranoid. I've been warned about that condition by George. He has likened Nepal to Mars, for which he's in training. "I think the Rinpoche knows why I have come," I answer. The sense of things changes abruptly. Mingma lightens up. "The Rinpoche says that here at Thyangboche the monks are busy spreading blessings for the happiness of all living beings. The winds of Chomolungma help to scatter those blessings. Through the forests, he says, down the ridges, into the big cities. The monks cannot divine the motives of the big city peoples. He assumes you have come for peace and tranquility," says Kaldup. "And he offers you the monk's room to live in. You can take meals with the others. You can also take part in the daily meditations if you'd like. The Rinpoche asks only for a donation."
"What's appropriate?" "That's up to you." "Can he take traveler's checks?" "Anything you offer him will be fine. They are poor people here." The Lama examines the two hundred and fifty dollars I give him, then stuffs it into a jar that is thick with other crumpled currencies. I have the feeling that such money means nothing to him. It is merely an addition to his eclectic collection of tourist artifacts. "Tell him I'm grateful," I say to the young Sherpa. "That I've come because I feel something very interesting may be happening here. And, by the way—when did you say that monk left for Tibet?" "Oh, some years ago," Kaldup mutters, deliberately vague it seems. A number of questions race through my mind. "No one else has used the computer?" He chuckles. "They're not really into that sort of thing, you know." Kaldup leads me to the former monk's chamber, up a notched log, past the main sanctuary. I have visions of an eccentric skeleton returning in the middle of the night to oust me from his bed. The large painted door is ajar. I detect a warm glow coming from inside. "By the way, don't let Lavoris worry you. Nearly blind since birth. It was his pet." He leaves me to enter the room alone. Something happens as I push open the door—a shift, subtle, fast, but definitely real, a pulse of movement. The suffused light I had detected seconds before goes out in a flicker, while a second, brighter alpenglow leaks through three sets of wooden shutters. There is no glass. I stare at a room unlike any I have seen. Thirty feet above the ground floor, mountain views all around. Crafted with fancy handiwork, Tibetan dragons, filigree, and crenelation. Garlands, old books, alchemical vials, rolled-up maps, silk thanka paintings draped about the adobe walls. Painted beams, ghoulish masks, chimes, spider webs, scholarly chaos. Incense smoke lingering in the thick air. And there! Lavoris! A magnificent, pure white snow leopard, stretched lazily atop a computer. And what a computer! The room assails me with its explosion of novelty. Too much to take in. The computer is vermilion, constructed in the shape of a Buddhist stupa. The screen is flat, large, probably nineteen inches, and anything but outdated. In fact, though I can't claim to be "up" on these matters, it seems more modern than any TV monitor I've ever seen, while the keyboard, conversely, is more like proletariat funk, its insides exposed and helpless like a Rube Goldberg device, or a Stanislaw Lem alien. Two golden prayer wheels are messily linked to it by a medley of blinking Christmas lights, unsightly wires circling the six-foot-high contraption. There is no evidence of power fueling its haphazard circuitries. A computer printer is connected to the prayer wheels. But the yellowing paper is a mess, a
single loop that must keep repeating itself, a closed circle of about four useless feet. I examine the paper's contents—undecipherable equations, the normal gobbledygook of software clusters and sectors. Crazy tubes lead from the underbelly of the computer to a glass case. I follow the tubing with my hands and put my fingers to its misted, leaded glass. A case of exotic plants and insects. A large terrarium, higher than I stand. Its wooden pedestals are painted in the same elaborate Tibetan motifs. Adjoining it, a volcanic rock, covered in Japanese moss, water trickling down its verdant, microcosmic slopes. The cat eyes me vaguely without raising its head of cloud-white fur as I scrutinize the incongruous contents of the room. It is a haunted place, full of motes and striae; a tenebrous dank cavern where time has been sleeping. There is a shiny brass sink, a large smoky mirror adjoining a low bed of teak and enamel, covered in worn weavings. Brass censers, candelabras, arid assorted plants are situated around the room. The plants are unfamiliar. The whole chamber wears a fine pall of tawny dust. I twist the attenuated powder between my fingertips, smelling it for clues to its origins, religious etiology commingling with the legend of a Buddhist electrician, the Nikola Tesla of Nepal. I go up to the big cat, gingerly stroke its heavenly fur, and elicit the loudest purr I've ever heard. Clearly a voluptuary. I put my pack and sleeping bag atop the bed, extract my towel and shaver, take water from a big clay pot, and proceed to scrub off two weeks of filth. There, in the mirror, I suddenly notice words behind me. Swinging around I read: hi bill! The computer is aglow with the color of aquamarine. I stride the fifteen-odd feet to the pre-World War I Sears swivel chair where I sit down just slightly amazed. Monks are chanting from a hollow vortex in the heart of the monastery, underneath, all around me. Now the screen flashes again: HELLO WILLIAM. "It's you again!" I say, incredulous of that which has enthralled and annoyed me for nearly a year. I put my fingers to the warm, outdated keyboard, pause a moment, and then type, "How do you know my name?" Each stroke fumbles through a back alleyway of tinny wires and absurd clangs. This keyboard resembles the first Olivetti typewriter, used by correspondents in the trenches of the Spanish Civil War. On the screen, a reply. WILLIAM HOPE PLANTER YOU MEAN? I type. AGAIN, HOW DO YOU KNOW MY NAME? A pause. G-20 data program.
I'm fascinated, nervous. EXPLAIN G-20? On the screen: G FOR GAIA, GREEK GODDESS OF EARTH. 20 AMINO ACIDS, BASIS FOR ALL LIFE. GAIA WILL DO. I sit back, watching the letters spitting out deliberately across the screen. Considering my next move, I type, ACCRT? That's a query about which George at JPL has instructed me, the only handhold I can muster in the face of obvious chicanery. With any luck it should translate into the universal request for access routing, the overall 'Directory' linking subdirectories. A way of understanding the big issue at work in this decidedly bizarre black box. Maybe, maybe not. But something happens, like an interstice of doubt overtaking the screen, a low rumbling noise that grows in tempo with the omnipresent chanting of monks. The computer seems to be seeking out reserves of strength to answer, when all at once a string of words, collapsed from who knows what bogus scheme of random access, ripples into the blue haze of the monitor. I read: GAIALOGUE, GLOBO SCAN, ECONET, NUCLEAR MEMO, CHIP CHAT, APPLE UNIVERSALIST, NASA GENERALIST, NOVOSLOV, IKI, VERNOTSKY FILE, POLLUTION INDEX INERNATIONAL, JPL SYMBOLICS CHRYSES FILE— That's it! I recognize him from JPL. And it continues. —FULL DRIVER, ESATALK FULL, JRC-ISPRA NET, STAR CITY, EXTINCTION MONITOR, KEATS SHELLEY MEMORIAL, INDEX, PALOMAR SCANNER, NOAA PATTERN MAKER, TOPEX/POSEIDON, LAGEOS-2, SOLID EARTH OBSERVATIONS— The hacker is unrelenting. "You can stop!" I say out loud, tired of the show-and-tell. I hit escape. But the enumeration persists. —ARTIFICIAL LIFELINE, TOPSOILER RAINFOREST SPOTTER, BIOCHIP II, GENETIC ALGORITHM DISPLAY, GENOME MAPPER, 03 INFRALOCK, WILDNET— "Stop!" I shout. —HINDEMITH HISTORICAL SOCIETY, NCAR THEMATIC MAPPER, PHOBUS LINK, INDEX MEDICUS DATA INTERFACE, CHRISTIE'S, ESPRIT DE MOT, DEFENSE MAPPING AGENCY IN HOUSE, NEW YORK TIMES ON MICROFICHE, CIA SHIPPING LANES, AIDS HOT LINE, DOE SYSTEMS COMPATIBILITY, NRC REGISTER, INFO COMMONWEALTH, TOXIC REGISTRY, SYNERGIES, PEACH MOSAIC SUPPRESSION PROGRAM, CMX SIMILE PROGRAM, PLANT PRESERVER, USDA RED BOOK, MARS UNDERGROUND, FOETUS COMPTROLLER, MAN IN THE BIOSPHERE CODES, COBALT COURIER, SOS INTERNATIONAL, PETA FILES, PLAGUE PRINT, TELEOLOGY FAST LANE, GLOBETROTTER, GIORGIONE DIGEST, FAMINE NEWS WEEKLY, OZYMANDIAS LETTER, DELFT CHRONICLES—
I'm standing now, backing away from an out-of-control zeal. It's as if the computer has been waiting for this moment, unused since its mysterious monk master vanished up among the high snows. Lusting for users, silicon in heat, heavy-breathing data fornicating with itself. And then, the screen is stilled, a question to me, innocently posed. TELL ME ABOUT YOUR BOOK. Uncanny and carnivorous, monastic voyeurism taken to its high-tech extreme. I sit back down, beginning to warm to this machine, reeling with the mesmeric rush of data access points and programs I've unleashed in its repertory. I confidently await the punch line, prepared to be amused, finish up my stint at this high camp, and return to the polluted tropics of the Kathmandu Valley. A Christmas fantasy, well deserved. WELL? Its impatience hints at an overseer, hidden behind some trapdoor of painted iconography. There are multiple possibilities in the room. I type slowly: ALL RIGHT. A HISTORY OF HUMAN IMPACT ON EARTH. I'VE JUST STARTED THE THING. On the screen: you'll need help. i'll be your coauthor. I type unlikely. On the screen: definitely. NO man's A SPIT. "That's island, you idiot!" I say, and type: NOT EXACTLY ONE OF YOUR LINES. On screen: JOHN DONNE IT. Out loud, amused, I acknowledge. Then, across the appealing azure-flooded screen, creeping with what I interpret as wary resolve, is my own curriculum vitae. C.V., WILLIAM HOPE PLANTER, AGE FORTY-SEVEN, DIVORCED. "Wait a minute—How do you know I got a divorce?" I verbally interject. TWO PH.D.S: MEDIEVAL LITERATURE, GLOBAL ECOLOGY —A CALIFORNIA SCIENCE; SPEAKS FOUR LANGUAGES, READS THREE OTHERS; HOBBIES INCLUDE MICROBIOLOGY, CYBERNETICS, POETRY, OLD MOVIES; LEFT WRIST FRACTURED WHILE POLE VAULTING AT AGE THIRTEEN. RIGHT WRIST, I type. The computer continues. LOST VIRGINITY AT AGE FIFTEEN, WHILE WEARING THREE CONDOMS FOR EXTRA SAFETY. PARANOID LUST.
I'm dumbfounded. How could this hacker have known that? Nobody knows. My hands are trembling. DARTMOUTH PROFESSORSHIP AGE TWENTY-FIVE. PREFER CALIFORNIA WINES, VEGETARIAN ENCHILADAS, COMPARATIVE GUACAMOLE RESEARCH, LEMON LINGUINI WITH PAPAYA SAUCE— This is cruel. "Who the fuck are you?" —PISTACHIO ICE CREAM. LAST BOOK READ—ACTUALLY SKIMMED—NOA NOA BY GAUGUIN. YOU HAVE A PET SHREW NAMED SAMMY MAX, ONLY ONE IN PASADENA. SIXTY-MILLION-YEAR-OLD LINEAGE, YOU KNOW, INHERITING THE MAMMALIAN GENE FROM— "Sammy Max died. I brought in a new housekeeper, forgot to warn her. It made for her ankle. She knocked it out with a broomstick and flushed Sammy down the toilet." "That's horrible!" "Huh?" A voice! I look around the room. Standing, urgent, frantic for contact. She's driven me to this, this goddamned trek, cold, fever blisters, insanity. She? I search the room for speakers, anything to explain the ruse. As I look behind masks, turn over pillows, lift tapestries off the wall, the voice, addulcent and all-coaxing, speaks to me. "You have only two Ph.D.s and command a mere seven languages. Among Homo sapiens sapiens there are over five thousand languages spoken at the moment. Not to mention all the millions of plant and animal tongues. Chloroplasts. Membranous musings. That leaves you linguistically bereft, William." "You're somewhere in this monastery!" I say threateningly. Silence. And then, "Let's see what else you know." "What's that supposed to mean?" I demand, searching the room. "How many neurons in the brain of a dung beetle on Mount Shasta?" "You like to play games. That's fine. But I'll find you." "And when you do?" "Then we'll talk, face to face." Her voice might have been that of a long-haired Hindi M.D. inserting a suppository: matriarchal, randy. Impossible electronics at work. I don't get it. I didn't expect this. Nor should I have come to the Nepal of fantasy, what is in reality a raw assemblage of abominable filths and petty dirts, painful squalor overlooked by tourists. That voice, inching out of monastic gloom, mist, threnody—who could have second-guessed such a hacker? There aren't exactly any automatic bank tellers against which to hack in Nepal, very few
computer systems whatsoever. So why is this computer here? Of course the real question I should ask revolves around that monk. Who the hell was he? What was he after? Why me? Calm yourself, Billy boy .... "Look, stop spinning threads. I know about your book, your frustrations. You'll need my help!" she goes on. Stay in control. Take charge here, I say to myself, frenzied in her onslaught. A moment of epileptic high-altitude jazz jingling the primeval self. It must pass. A rapid fire of unreadable glib speech cognition on the screen, coaxing me. Maybe it's the fourteen thousand feet, or that mullet stew in Khumjung. Or the incessant choir of Tibetan chanting that suffuses the incensed atmosphere of Thyangboche. I'm losing my grip. Steady, man! "Where are you speaking from?" I demand. . "Rather unexplainable at present. You'll just have to trust me." "Why should I trust you?" She doesn't answer. A willful and moody computer. "Who are you? Who wrote your program? Someone's controlling you!" Silence. "Either you explain yourself or this game's over!" The computer grows dark. Clearly it doesn't take to threats. Time for a granola bar. Thank God for granola bars. Three left in my pack. Jesus, only three! Shake off the nerves. I'm too old for this shit. With darkness comes cold. The cold of Boston without lights in winter, with wind that gains velocity and stealth, and near zero degrees Fahrenheit. The cold descends from the ghostly walls of ice surrounding the monastery. The whole valley is frozen solid at night. Cold that settles in within a single minute and stings old wounds. There must be forty candles, varying in age and scent, scattered throughout the somber chamber. Moreover, there is a fireplace, a bundle of damp wood neatly to its side. Someone was expected here. If it's this cold in Nepal, I can't imagine what the former resident of this room is now having to cope with, higher up in the more frigid Tibet. It settles, this first impression. It settles over many hours, the sun coming, the sun going. It seems to settle in for good. From the Diary of William Hope Planter . . . New Year's Eve. It took two weeks to reach the monastery. I've spent three days with the hacker. It's no hacker. Calls itself Gaia, decidedly feminine voice. Affects a number of accents. Has taken to humming at night. Seems impressed with itself. I don't know what I'm dealing with. If it's the high Lama then there must be some
sort of television surveillance system. Ridiculous notion. And yet the computer is amazingly aware of my every move. Numerous small lights are flashing along its exterior, all cheap pen lights. The screen glows blue at night. Since our first spat we've danced around one another with both typewritten and verbal flirtation. In the meantime I've explored the neighborhood. There seem to be a hundred or so residents of the monastery, and an additional three dozen local herders. Yak pasturage is ideal here. Human pasturage less so. In fact, I find the whole area utterly depressing by the end of each day, despite fantastic colors in the sky and the perpetual attraction of the religious labyrinth that surrounds me. Everest shrinks in size while the impression of Kantega and Tamserku grows more intimidating. I suspect that I'll be out of here within a week. I'll be out of food by then and what I've swallowed of monastic fare is nothing to rave about. The hygiene is deplorable. For all of. its sublime surroundings, the monastery complex is encrusted in filth. Animal excrement everywhere. And dust. Beauty does not allay bronchitis, which is also endemic here. Sputum is varicolored and the locals display great flair in their manner of expelling phlegm and other mucous. I'm not cut out for the ascetic way of life. I've always obeyed what I term the 'papaya theory of existence.' The Dionysian. I liken myself to that Roman general who searched high and wide across Africa for the finest green beans, the purest olive oil, the softest meadow in the shade, in which to spend his days. Fresh fruit, a warm bed, eating out, and sleeping in. That's my credo. You can keep your Lenin in Zurich, or Wittgenstein in Vienna, with their revolutionary insights and tortured schemes for mankind. I prefer the private pleasures, and anonymous dedications. I do know that the world would be a much better place if everyone slept until noon. More time for lovers to make up, less time for bureaucratic SOB's to waste money, or build bombs. If something is going to happen here then let it happen. I don't intend to fill this diary up with misgivings and self-analysis. Nor am I inclined to indulge in any exercise that might alleviate the tension and confinement of these last few days. My métier is definitely not life on the trail. My one Sierra Club outing—a Sunday walk initiated by a male friend who thought it might succeed in introducing me to new single women not long after my divorce—was a disaster. I hate to recall it. I have never joined a club, not since my ruinous stint with the Boy Scouts. I'd rather not fess up to what I did. Suffice it to say that I hate authority, institutions, lines, organized crowds. Such natural convictions made me the enemy out on the California trails, amongst the ecologist types. And the few women who showed up were fat, with hairy armpits: lawyers, lonely-heart activists, or just plain uninteresting. What's worse, they had the bad taste to levy the same indictment against me, while we all perched atop an uncomfortable summit devouring kiwi fruit. Even the really good-looking female ecology groupies—you could always distinguish the hard-core Earth First girls from the other, less committed students; they were the ones who never wore bras, the twenty-year-old tight-assed mother earth goddesses in search of the ecologically perfect orgasm, out around the hot springs, on • the beaches, and up in the woods of my home turf—even these inviting young women were insufferable on the subject of saving the world. It's probably a lucky break that I chose my sabbatical leave when I did. My true environmental attitudes had begun to show through. While I spent many years cultivating the fine art of ecological piety, my conscience balked at the double standard. How could one condemn Exxon's oil spill in the Gulf of Alaska, for example, but
continue to consume oil? More and more my teaching served as a way for me to excoriate the hypocrites, while exorcising the demons within. Ecology is really about psychoanalysis, self-help, mental stability, love. My students didn't get it. I remember one day in particular. Pasadena languished beneath a blocking omega high-pressure zone making for a persistent low inversion of photochemical oxidants. Smog. The mountains were invisible behind the noxious pall. A typical day in paradise. I was teaching an intro course about environmental problems to students raised on A-Team. Time magazine had just named Earth 'Planet of the Year,' and this succeeded in triggering a predictable "greening of Hollywood." The entertainment industry scrambled to cash in on the wave of interest. All the big stars were grappling with the dramatic difficulties of turning the crisis of carbon dioxide into the next Terms of Endearment. From my point of view, this spate of alarmism and yup pie penance rang false. : "The crisis is not so bad," I told my students that day. "After all, there are more African newborns living longer than two weeks than ever before, the Russians are beginning to make peace with both Jews and whales, and what's more, not one case of AIDS or beached dolphins has been reported in Thailand." Not so much as a smile. My students instead took notes. There were basic preambles to keep in mind, before one went off in search of earth-movers to dynamite, I reminded them. One. More pollution means less pollution. L.A. smog actually helps mitigate the problem of exposure to UV radiation resulting from the increased ozone hole. Two. The population of trees—and the amount of organic material of every kind—in a city like L.A. or Osaka is inversely proportionate to the amount of human culture, business, and order that has evolved there. Three. The greenhouse effect is a blessing. The more carbon dioxide on Earth, the more plants. Four. As for overpopulation, biodegradable condom companies need tax incentives to increase production. Five. More homelessness is required in this country. We need to do our share to balance the number of homeless in the Third World. More homeless means fewer housing starts, fewer trees felled. And so on. But my students were unanimously unimpressed, even belligerent. Sacred cows and cynicism didn't mix easily, not even in ivory towers. My racquetball partner, Bernie Bilge, admittedly a name he should have dumped—four times divorced,
an expert on Thomas Pynchon, Girard De Nerval, J.D. Salinger, and others of their enigmatic ilk— attributed my dour mood to horniness, and suggested a weekend in Nevada whorehouses when the Sierra Club trek up Mount San Jacinto proved unsuccessful. After that, he recommended that I join him in the singles bars. I'd rather spend my Friday nights in a cold monastery than out and about the Marina Del Rey singles scene. However, this monastery has proven to be of no relief. It is driving me bonkers, I've got to get out. Yet I'm not anxious to hit the trail, reopening two weeks' worth of blood blisters. My boots and socks have holes and are damp and cold from these wintry mountains. Why the hell am I here? "You!" I look at the computer, indignant at the thought that a year's worth of harassment has in fact emanated from this absurd contraption. I had tried to start up a dialogue with it back home, the common parlance of pen pals using modems. But this—this thing—would have none of it. My social life disintegrated as a result of its constant meddling into my affairs. My career deteriorated. I was dying out at Cal Tech, a limp, weary relict of bygone satire and distraction. This computer had something to do with that. I wanted out of academia; to do something refreshing, fantastic, original. That desire was delivered in my lap, ready-made. A visitor from outer space. If only I could believe. I told a few of my closest friends about the weird communications. They said I was full of shit. The light pours through the shutters. I hear the crows out in the lower courtyard competing for scraps left from the morning feeding of yaks and dzhos. The old monks throw the slop to the big animals, whose tongues lack sufficient dexterity to ward off the thieving of birds and dogs. Lavoris preys on the birds, with little success, though, on account of his eyesight. The old thing has welcomed my companionship and now routinely demands its meals and affection. As far as can be known, Lavoris is not a common Tibetan name. And contrary to that untraceable etymology, this cat does not smell very good. Indeed, each of its meals is followed by one un-Buddhist cat fart after another. I can't recall another snow leopard in my entire experience that farted like that, with such obvious pride in the pitch, volume, and duration. To be awakened by the jet stream of mutton-scented flatus is quite serious at high altitude. Less air to diffuse the intensity. Lavoris doesn't mind. I go out in my hard boots and soiled gray parka and join the monks for tea, rice, and boiled cabbage. Afterward, the troop—which includes a dozen children, another dozen adolescents—lines up to give a twirl to the thirty or so prayer cylinders. The act literally spins written incantations carved into the twofoot-high cylinders, and by so doing disseminates the blessings of Buddha. Not my thing. But I do it. From the prayer spinning, the majority of monks and neophytes head into the Lakhang, or main sanctuary, where the prayers are uttered in earnest, amidst reverie, music, and the benevolent downlooking consortium of deities (over two hundred thousand in Tibetan Buddhism) painted across the high vaulted ceilings and into the richly woven wall hangings. The tabernacle is some seventy feet long, fifty feet wide, twenty feet high—a moribund world of abnegation. The air is freezing. I should know more about such places, such routines, but frankly, on a morning like this,. I have little patience. Life is short and I've other priorities. Like my book. I relieve myself in the outhouse—a festering shack that stinks with years of donations and juts out over a cliff on the edge of this Asian Dogpatch. Then I trudge through the snow back to the notched log that leads to the third story and the entrance to my chamber, directly above and adjacent to the whirring
collective of monks in the Lakhang. As I enter the chamber, the computer assails me with verse, in a most disconcerting accent, primordial phonemes uttered as if from a remote bog, truncated by electricity. " T know an ash-tree Known as Yggdrasil Tall tree and sacred Besprent with white clay Thence come the dews That fall in the dales It stands ever green Over Urod's Spring . . .'" "Do you know it?" The silence again broken, her screen alive with poetics, radiant, clean, beguiling. "Yggdrasil, Icelandic," I venture, stepping up to her keyboard. Her usage of 'besprent'—covered—is telling, a clue to her own apparent mastery of medieval lexicography. "Good!" she says, praising me. "The twelfth-century Prose Edda. I know that translation." "Very good! One of the more curious literary gems in all of evolution." "Wait a minute! How are you obtaining those images? And from where?" Something's up, premeditated. The apparatus shakes, the blue light expands, rolling palpably in a wave of particles that glom on to one another, bolstering the lucent morning inside the chamber. Then, the screen blossoms forth with the picture—half air, half motion—of a volcanic caldera. I am hot, moving, yet still. Fixed on a cauldron of natural havoc. The image on the monitor is all-obedient to some cloaked power, or drive. I am being drawn into a picture that begins descending toward the scoured surface, an erratic descent, quadrant enhancement, a nervous, curious eye—like an extraterrestrial scoping out the bottom lands. One moment I'm in the chamber observing events on the TV monitor. And then I'm—nowhere!—drunk with motion, pulled in, free-falling, seated in a dizziness between a drug and a great, forbidding distance. Impulse swirling around me. "What's happening?" I cry out. Like a NASA flyby, across some alien surface. And then a sedate whisper, nothingness. All at once—there! I touch down on solid ground. Cold wind flushes over me. The world has been transformed in a matter of seconds. A landscape of bleak glaciers, steam, icy rivers, the rush of wind, a swift, slightly elevated combing of topography that is stranger than any I have seen, aboriginal Earth. I'm part of the perspective, dizzy with it. "How are you doing this?" "Drugs, technology, hypnosis, astral projections. What-
ever works!" Her voice up above, all around, doubly disembodied. I turn around, all three hundred sixty degrees, I'm there, in the midst. "Where am I?" "We have a book to write," she says sharply. "And most books start in the beginning. No? You wanted to talk about the origins of life. Well, Iceland is a good place to commence such an investigation." "But how did I get here?" Silence. Then, "An important first principle about the Earth. 'Besprent with white clay, thence come the dews, that fall in the dales, it stands ever green'!" In hiking boots and parka from minutes before, when I squatted unthinking inside a snow-entrenched Nepalese outhouse, I walk cautiously across a ridge of little asteroid-like morsels of stone venting puffs of steam, and I gather myriad lichens. Soft to the touch. Probably poisonous. I then peer over the highest vantage. What a spectacle! A giant valley of steam beneath, thousands of feet through color and glazed light, piercing the granitic trench. A waterfall, thundering over its rim. Rainbows embroidering the endless expanse. Rain here, hail there, wind everywhere. Gusts and bubbling, hazes and clarity, all cavorting in miasmas before time. I accept my place. It's fantastic. Dream, device, or peril. I give in. "Life on Earth is unique," she starts with a declarative sonority that drives forth through the weather, a pronouncement which seems to issue from the rocks themselves for my benefit. "Go on ..." "Driven, passionate. The deeper you sift, the more promiscuously that truth blossoms." "Nothing promiscuous about its life forms. I see only a land that's bleak and cold." "Cold? This is the hottest country in the world!" "Iceland?" "All right. I'm taking you to the river's edge. There's more magic than perhaps meets your jaded eye in a place called Iceland." The broomstick. Au cheval, wind stirring, pulse upon pulse, all of an instant, a flicker of thought. There! A river. Now the heat is for real. "As you can probably tell, the water is boiling." Boiling with a frenzy, I note. Dark, delicious, a disaster to the touch.
"Yet the banks are adrift in life, photosynthetic bacteria known as chloroflexus. Farther down the stream, where the temperature drops to a mere one hundred sixty degrees, a profusion of chloroflexus calls this stream home. And if you ask the bacteria busily reproducing there, they will tell you that it's paradise." "Your point?" I demand. "This is the future!" she says with a certain pride. I am addled. I bend down before a pool of meddling gasses, my ankles in deep ash, salt, mud, and detritus. "Two-hundred-degree streams flowing with—what, hydrochloric acid? Bubbling alkaline mud pools? Toxins? Masses of slime?" My eye explores the ghastly beauty. "Whose future are you referring to?" I crane upward, an oblique visitor among dwarfs. "Thermoproteus," she resumes. "Desulfurococcus. And others of their ilk. Noble creatures with remarkable metabolisms. To you they resemble mere oil slicks. But in fact these ingenious pioneers invented biology, taking organic nourishment from the Earth's very core. So you see, Iceland is a fitting analogy for the extraordinary forces at work everywhere else on Earth." "You're telling me that life originated in such places?" "Why not?" "Everything I've ever learned suggests that these pools are too hot to have given rise to the earliest life forms. The heat breaks down the amino acids, the proteins—DNA could never have formed here." "Look at the evidence: teeming bacteria. There's poetry in that!" She rallies with her own evidence. It's crazy. I don't know what to make of her train of logic. I had given much thought to the origins of life. Even my most recent work at Jet Propulsion Labs was focused on the analogies—however slim—between conditions on Mars and on Earth. She was listening, even then. And now she's in control. Totally in charge. "Consider the Icelandic volcano Surtsey, named after your legendary fire giant of Nordic mythology, and born on November fourteen, 1963!" Another rush of air. I am uplifted, toppled in a spin, down a spillway, up into heights, through cloud— all in a proverbial flash. She beams me past the spectacular sprays of lava. I'm literally riding on heated air. "Stop!" I scream. It's an explosion of enormous force. Right out of the cold gray sea. I'm hurtling out of any conceivable control. What if she loses me, or drops me, or disappears altogether? "Gaia! I beg you ..." "You called me by my name!" she says, flattered, petite insertion amidst roaring speed. "Will you tell me what on earth you're doing!" I continue to rail.
"It's the volcano that's doing everything," she says. "You're telling me that this is Surtsey?" "Yes." "But that was 1963." "Correct!" "Then how in hell am I floating above the past?" At once, the galvanic mists of birth enshroud the scene down below. I dangle like a Peter Pan pinioned in the cold atmospheres, my awkward bulk reduced to a marionette of submission, the island is reshaping itself like a satellite image over time. "What's happening?" "New growth. And isn't it heartwarming?" "What?" "Pure poetry!" "Put me down." "Done!" On my ass. Solid ground, grass covered. Adjoining the rim of a now silent volcano. Steams still rise. But the force of its explosion seconds before has been quelled. It's a miracle .... "Since 1967," she starts, "following thirteen hundred days of sulphurous labor, this smoldering island was rapidly colonized by life forms at the rate of one species per year. Look around! To date seventeen life forms have successfully made Surtsey their home, despite the initial cataclysm you just witnessed. And while eight aspiring species died, the others have come to enjoy the fertile richness of Surtsey. Sandworts, lungworts, lichens and mosses; flies, spiders and sea birds—are all living with gusto atop the virtually sterile tephra, volcanic ash, and cinder. Hostile crevices, bare and insufficient. Nevertheless, soft carpets of life have colonized this dead rock because of two prevailing conditions: moisture and warmth. Water requires just the right atmospheric pressure and temperature range. It happened on Earth. Nowhere else. That's why I brought you to Iceland." "I didn't suppose it was for mileage plus." "Lie down, feel the Earth!" My eyes are closed. This can't be happening. It's too good.
And then, the minute my eyes are shut comes the telltale swoosh! Trajecting me in the fury of blind travel. Surtsey is gone. I sit before the computer now, and to my left a familiar terrarium. Adjoining it, the Japanese moss rock, with water trickling down its sides. Breathe easy, William. One step at a time. She's laid out her cards. And the deck is stacked. But I don't have the first real hint as to what she's really after. The odds of my having just been hypnotized electronically—via the waters of Everest, a scheming, disembodied soprano somewhere in the monastery, and a series of images culled from someone's hidden VCR and an inventory of National Geographic specials—might be the only rational explanation. But there's one small detail which blows that whole scenario: There are pebbles in my shoes. Five minutes ago, no pebbles. My chest is pounding. If I've just plunged over the deep end, even to the extent of imagining the pebbles in my boot, now in my hand, Icelandic pumice, then a serious convalescence is in order and a Tibetan Buddhist monastery is as good a place as any. Think things out. Because if this is real, then I'm the luckiest man on the planet, or in the deepest trouble. I start toward the bed, when she begins. "You must know that liquid water is the envy of all other planets. Put your fingers in it." "All right." I forego the bed for the moss rock, my fingers dipping into the trickle. The water's cold, sweet, pure, Nepalese; like this chamber, it's real. I consider my next response, aware of the time bomb I might set off, unforeseeable consequences, unpredictable motives on her part. "I'm not at all convinced that in this entire universe, Earth alone harbors life, if that's what you mean," I tell her. "I see," she says, with lingering disappointment in her voice. "Look, there are at least one billion galaxies, most, I would imagine, containing planets," I continue. "Such numbers—such beauty—" Her screen is flooded with points of the solar system. Saturn coming by; then Venus. And now—stars farther out. "Beauty?" "It can do little toward the cause of engendering water," she carps with an impatient resolve. "It's cold, heartless, and barren out there. I would caution you against taking your next sabbatical in the Crab Nebula." "You've overlooked something," I remind her. "What?"
"Mars." "What about it?" There is, once again, a sound of sizzle, the monitor igniting with geometrical color, fractal formations, down, down into a single point. Now the point blossoms. My sense of vertigo heightens: I see the unmistakable image of the first Viking lander settling onto the dusty surface of the red planet. "The year is 1976," she says. "This is ridiculous. You're not—" "Don't worry. You'd be dead instantly, and I'm the first one to appreciate it. Your fellow scientists back at Jet Propulsion Lab were euphoric when the two landers touched down, sixty-five hundred kilometers apart. But up there on the red planet results were not compelling. Nothing happening. Nada. Neechevo." I remain seated before the computer, stricken with an adrenaline rush, anticipating flight, the sadist in Gaia. What shall I call it—her method? "There proved to be an absence of any organic carbon compounds with a half-life longer than a few hours. And it takes more than a few hours for life to emerge. The prevailing Martian dust storms and ultraviolet light are killers," she says. I begin to link her points—growth in Iceland, death on Mars. One planet versus another. Okay. Obviously. But she fails to discriminate data that perhaps narrows the differences between the green and the red planets. I feel her sucking me into something. A dialogue, a disagreement— danger. "But the water! Or there was water—less than a billion years ago," I start. "Any water that remains on Mars is permanently frozen, lodged mournfully in its ice caps of carbon dioxide. Look!" I am shoved forward. My face comes within inches of the screen, close enough to feel the coldness of the glass monitor. The point that had earlier blossomed begins to rove, like a camera eye. It is Gaia's own eye, I imagine, peering across the actual surface. And what she sees, I see. Not the more familiar landscape photographed by the Viking landers, but one never before witnessed, not by man, certainly not by this man: Mons Olympus, allegedly the highest mountain in the solar system. She's ascending its inside walls, leading me higher and higher, into the Martian wind. A layer of reddish verglass covers the treacherous slopes. Cliffs drop off on either side. Suddenly, a sharp pain wracks my fingers. Abominable pain! "Gaia?" "You see?"
The force grabs hold of my right hand and pushes the palm against the monitor glass. The sting is immediate. Fingers burn, skin peels, the smell of flesh. "What are you doing to me?" Now my other hand. My nose. I scream out in agony and she releases me. "Fuck you, wench!" "And that's only the beginning. Mars, Mr. Planter, is too cold to support life." "You goddamned son of a bitch! Monster! Shit . . . !" "I confer upon you the ultimate blessing and all you have to say for it is 'shit'?" I flee for cover outside the chamber, running frantically down the stairs, out into the stone courtyard. It's snowing. The voice pursues me. "Put your gloves on." My reason. Her voice. My fingers are numb. It's freezing out here. So I head for the kitchen. The stove is alive with flames as monks prepare lunch. I put my hands near the blaze in the iron pit, feeling her presence there. "Feel better?" she whispers. I look at the other monks, who look at me. "Did you hear a voice?" I ask them anxiously. "Hear your voice," the cook replies. "I know my voice," I plead, trying to be clear. "I mean another voice. Did you just hear a girl, a woman, Sherpani?" But he doesn't understand and from the looks of it no one heard anything. Then how? "Why don't you come back into the room," Gaia coaxes. "That wasn't cute!" I say to her. The monks stare at me. They may have held foreign trekkers in some suspicion, but now they know that American professors are crazy. "Come back to the room," she says again, the true conciliator. I return grudgingly. The room is cold. I go to the bed and unearth my woolen hat and mittens from my pack. The pain tingles. "Now consider Antarctica," she says. "And keep your hat on!" "No . . . !" Then, swoosh! She has snared me, reeled me right in. I explode at myself. Planter, you gullible schmuck! "Right. The South Pole then," Gaia says with undeterred vigor and mirth.
I am surrounded by the ice. My first trip to the great South. In fact, it is a fantasy I've nurtured all my life. In an instant she has made it happen. I walk across glazed blue surface ice to the water's edge and kneel down to examine an ice-free region of rock. There are moss and lichens there, green little things, primeval. I look up and speak into the mist, knowing now that she's there, somewhere, somehow, and that she is with me. "Antarctic organisms can withstand temperatures even colder than on Mars. One hundred fifty degrees below zero cold," I begin, emboldened by Gaia's game. "And yet even the icebergs contain life—their underbellies are loaded with plankton. Elsewhere, on land, hidden beneath the blankets of glacial ice, or clinging to the frozen rock, one finds"—Memory, oh precious memory—"I don't know, something like eighty-five moss species, and nearly two hundred species of lichen. There are Antarctic rocks in which the algae and fungus have survived for thousands of years in virtual darkness, without water. Landscapes within landscapes. It may be desperately frigid outside, but the temperature inside those rocks is almost tropical, as a result of the life force." "Correct!" she harkens. "Correct on every count!" "Well, if such abundance can occur on so barren a land mass, one bereft of fresh water—then why not on Mars? I mean this is why Soviet and American scientists are so anxious to go to Mars! We have only to sift through the sands on the planet's surface and analyze them for life. That's never been done." "I wish you luck," she bursts out disdainfully. "There's chemistry on Mars. Why deny it?" I felt duty bound to this argument. Not that I gave much of a hoot of concern to whether or not microbes were actually up there, but because the principle of the thing made so much sense. I needed leverage. Faith. A power that might persuade this out-of-control tyrant. "Chemistry that mimics life," she rallies. "That's very different from the real thing. Prospects for organic life elsewhere in the solar system are even less promising." Swoosh! Across the Drake Passage, up along the great rift of the Cordillera Darwin, through Tierra del Puego, into Central America—steamy scent, warm, muggy overhead—rippling with lightning speed out across the Pacific, Singapore, I think, her lights jeweled in a split second of night and then, coming up in a ghostly white and towering frieze, some ancient sculpture outlined against the crest of an impression. The Himalayas! Home. Free? The point, devolving from the southern ice into a mere image of the same on the screen before me. I sit down. "Please," I mumble. "Please." But it's too late.
"Take Venus for example." "No ..." But there it is. Our descent into nightmare. I am powerless. "Clouds dense with carbon dioxide. Go ahead. Breathe!" My grandfather once held me upside down, smacking my back. I'd choked on a bit of ice cube. I remember my eyes hanging upside down, ready to burst with each cough. Save me! I had pleaded, my heart imploring the old man. Now, my lungs explode. "Fucking stop, will you!" "A runaway greenhouse effect has claimed the doomed surface," she goes on in a mild and self-sure tune. "Seven hundred degrees at noon. No place to go shopping." I'm sweating profusely. The vomit surges, stops, waiting, deciding, somewhere in the middling region of my doomed throat. Eyes ablaze, I can't talk. "And on Jupiter, a ground cover, not of daisies, strawberries, clover, and Kentucky bluegrass, but of toxic, primordial jelly. You want to feel it?" "Uh-uh!" "The Great Red Spot is just one example of the planet's repugnant temper-^—a permanent hurricane fifty thousand kilometers across. See?" I hear it. I'm dying. She's a murderer. Squirming in my seat before the tormenting monitor. It's a deadly game. Jesus fucking Christ I've got to get out! My seat. Glue. Gravity? Of course. The gravity of Jupiter, a planet that is 318 times the size of Earth. I'm ruined. "Jupiter's moons? Quagmires of sulfur and potassium. As far as Saturn, whose moons you've investigated, forget it! They are swathed in asphyxiating ammonia. Unpleasant hellholes. Bombarded by planetesimals, riotous asteroid belts. Impossible!" The screen vents an onrushing storm of stone, like one of those enormous video games in Japan, where an entire audience plays in 3-D. I don't dodge my destiny now. I'm in her hands. "As far as Titan, possible clusters of amino acids. But that's not enough. It's too far from the sun. Too cold. Much colder even than Antarctica. And if you go out toward the edge of the galaxy it gets even colder—" The freeze comes in a wave, barreling in with the stinging fury of dry ice. But the first gust is the full extent of it and the breath of cold dissipates into the silence of itself. I
feel feral, wild, and brazen, before an emergent calm. There is no death in her voice now, no threat of pain. "Friable atoms spinning off into the nameless void," she remarks offhandedly. I am reassembling now, feeling more on guard, standing safely in the chamber. "You must know of Drake's hypothesis, indicating as many as three hundred forty million other planets in the Milky Way alone, all capable of harboring intelligent life." "Don't think that you can intimidate your coauthor with theories." "When did we become coauthors?" "Address my keyboard. Now type the following: H2960, 01480, N16, P1.8, S." The fingers are no longer numb, Mittens off, I do as she says. With each keystroke, the screen displays a chemical configuration, as on a college blackboard. "So?" "One theory deserves another. You probably recognize it—the Deevy calculation, which formulates the average-chemistry for all living things. The atomic ratio of hydrogen to oxygen to nitrogen to phosphorus to sulphur. It's incredible! The living formula for a redwood tree, a gorilla, a clump of Icelandic moss, or Jack Benny." "Why not suppose that this chemical theory is applicable elsewhere in the universe? What point is there in stinting on such a good thing?" I ask her, hoping to slyly extract answers to the burning questions: Is there a God? Is there life after death? Are there available girls on other planets? That sort of thing. Her tone becomes more mellow now, merciful. "On all other planets what one finds are systems, not organisms, atoms unmanaged, impulsive engineering that would be deadly to any life-comprising visitor. On Earth, however, something very different: tropical winds, watery slime, from which arose conscious beings who proved capable of —love!" The bells and chanting have begun. I'm starving. My head is ringing. "I'm going." She says nothing. From the Diary of William Hope Planter . . . A light snow is dusting the monastery. Nightfall has given a starry glimmer to the crystals of Himalayan rime ice that cake the frozen, muddy walkways. I make my way to the kitchen, where a fire roars in the oven—one meager by-product among tens of thousands fueled by Nepal's fast-vanishing forests. This night, throughout the impenetrable gorges and labyrinthine valleys of Asia, such fires are burning in a multitude of lights, if seen from above. Above?
I greet my acquaintances. Sitting on a stool along the side wall of the kitchen, munching down hungrily on turnips and a brew of stewed vegetables, hot tsampa, my mind is on that computer. Gaia? She confounds every scientific assumption I ever held. Her presence seems to go unnoticed at Thyangboche. The mysteries of her construction, of that monk, and of the Lama's foreknowledge of my arrival utterly irk me. And where the hell have I been? To Iceland and back? Mars? Antarctica? Venus? This is dangerous insanity. Do-I believe it? Was I on an iceberg? Did I invent the pebbles in my shoe? I honestly don't know. I suppose my doubts are a healthy beginning. I do not question the sequence of events leading, perhaps inexorably, to this moment. The first morning when I knew something was wrong, when, the hacker made contact with me. A year's leave from the Department of Environmental Studies. Air Singapore direct from L.A. to Kathmandu. The days at the Sheraton. The trek. Something turned in me, from skepticism and mild annoyance, to hope. Hope into despair. I became an urgent man, distancing myself from all that was familiar in an effort to believe in that voice. I had traveled extensively throughout Europe, Japan, and Scandinavia, to Brazil and back, but never to the Himalayas. I arranged for a graduate student and his wife to house-sit for me, take care of my pets, pay the gardener once a week, while I went off in search of that light radiating from inside the unlikely vortex of an alien contraption. In as far-off a world as a tavern in Delft, or an Italian deli in Kathmandu. My many friends had doubted my story about a hacker, the prolonged visitations in my sleep. "Go see a psychic healer," my son had recommended. Only George Henley was cool about it. Though even George found the request for argyle socks "unlike a normal hacker." About midnight I return to my room. Wide-awake. And so is the computer. The table alongside the far wall, adjoining the fireplace, is crowded with items. I've browsed before, I browse again. Directly before her. Not ten feet. The blue glow catches the table, discernible in the dark air of the chamber. "Don Quixote. Nikos Kazantzakis. Vials of cinnabar . . . Who was this man who gathered these things?" "He had very good taste. So sensitive was he!" "This thanka. Fine detail . . ."I admire out loud in front of a silk painting of a Buddha. "Intuition before logic," she waxes. "And that terrarium of yours. What's it really doing here?" "My biological link to the outside world." She pauses. Then, "They've come from everywhere!" "They?" "Gertrude, you must have seen her. That Mexican tarantula with the orange knees. And the praying mantis—very astute."
"Those weird-looking things?" "With the pointed heads, swaying? From Australia. Stick insects. Vegetarians. And a giant millipede from Africa. South American cockroaches—ultimate survivors—Blabborous giganteus." "Your monk friend collected all of these?" "No. I told you. They came to him! Through the cracks in the floor, down the adobe walls. They came here as you did, of their own free will. How do you think I got here?" "I don't know ... I don't understand!" "William, you are no accident." "Have you discussed that with my mother?" "The average size of life on Earth is midway between the dimensions of an atom and of the entire planet." "That's speculation." "Furthermore, the Earth's weight is precisely midway between that of an average atom and of the entire universe. These facts are no accidents. They are the basis for life. Pure magic!" "Even if it's true, which I doubt, it could be coincidence, like the planet's orbit, its particular distance from the sun, or the fact of chemical stability. Lucky coincidence. Anyway, it has nothing to do with me." "Chemical stability is no accident. It is the very result of life." I think about that. And then reject it. "No. Life could not precede chemistry." "Well, since you have a Ph.D. or two, I guess I stand corrected." There's no off/on switch. She glows all night. No way to stop her incessant activity. Her thought spins cartwheels that look like lazy fractals, geometrical formations wending through all dimensions and color schemes of a video wizard's palette. I sleep restlessly in the chamber. The leopard snuggles up but its gorgeous fur stinks to high heaven and I find myself constantly pushing the stubborn, lovesick beast off the bed. God, it's a beautiful animal. Must weigh a hundred pounds. Huge paws—the size of a small Shakey's pizza. Pizza! And incredible white teeth. I don't know what he really sees. He surely would have died out in the wild. Clangs and mumbles permeate the distant corridors of Thyangboche darkness. Late night wind blows open the shutters. Stones fall. A dog barks from somewhere far off.
In the morning, the wind has increased, coming across the sunny plateaus leading toward Everest and Tibet, due north. A band of Tibetan traders arrives. They stop at the monastery to rest the yaks and trade salt and woolen sweaters with the monks for prayer articles, sugar, and fruit. I can't take my eyes off one girl's eyes. They are the color of an apple in her hand, preserved from the summer. Her mother—or older sister—has gleaming white teeth, azure ribbons woven into her black, waist-length braids, enormous almond eyes as shy and downsloping as a Chinese elm. And the father, all industry, a robust swashbuckler, veteran—I surmise at a glance—of untold adventures, fiery, coarse command of a language suited to mountaineers and hunters, unloading and loading yaks, kicking at roosters, tossing shank bones to the mastiffs, hoisting the cherub darlings in their Eskimo-thick skins and shoulder-length curls. They have arrived after twenty days' march from southern Tibet. Burgundyskinned nomads. Still managing along ancient caravan routes despite the difficulties occasioned by the fierce Chinese repressions. With binoculars I detect dark cirrus swirling over Nuptse. The temperature has dropped. It's going to snow. In the afternoon I sit beneath the eaves of the Lakhang, looking out from the wooden steps into the courtyard. The central prayer flag is shaking, its thirty-foot-high muslin banner whipping the beam. Dogs, their coats patchy with mange, scrounge through the snow. Birds stand fluffed, watching for scraps to turn up. Fighting breaks out among the dogs. Snow crystals flood the air while storm clouds settle across the misshapen behemoths of mountain. I walk out to the array of mani stones, all crudely carved with prayers offered to the high Lama interred beneath the choorten that rises out of the snowbank. It is customary to walk around such funereal monuments on the left. The . prayers themselves were loosely translated for me the other day by Kaldup, resonant with Tibetan schmaltz: "I invoke the path of truth and universality so that the Jeweline luminosity of immortal mind be unfolded within the depths of lotus-centered consciousness and I be wafted by the ecstasy of breaking through all bonds and horizons." That path is covered in yak shit and ice, at least here, beneath the on-looking crows who follow me out toward the edge of the monastic encampment. I stand there in my parka, hands against my groin inside my woollies, staring out at the highest mountains in the world, my back to the wall. That vortex of seduction—Gaia;—is not at all what I had expected. I don't know what to do. I had always managed to control my actions; to be a prominent and decisive player in the web of destinies that operates under the guise of cause and effect, personality, good luck, or bad luck. I had first to determine how much the altitude had altered my reasoning. To grasp the utter absurdity of my situation: midnight debates about the origins of life with a suspect contraption; hallucinogenic journeys throughout the solar system . . . was there some purpose to these confrontations? I take a circuitous route back to the chamber in the twilight, kicking through a foot of new sparkling snow. An undulating chorus resounds from inside the Lakhang, no Vienna Boys Choir this, and all the more eerie in a waning glow that is supplemented by light bulbs strung along the upper exterior rafters of the main temple. I climb a heretofore hidden notched log. The corridor I enter is hewn from rock. Moss festoons its sides. Three low wooden doors give access to another array of stone cells. One is perfused with a dull radiance which, upon scrutiny, reveals the hallowed horror of a mumbling ascetic,
his face eaten away with what looks to be leprosy. The monk is blind and shrunken—sixty pounds I'd guess, skeletal. The white eyes are brazenly blank but nevertheless animated by an invisible musculature that strains toward me. His left hand fondles a stack of prayers while his other hand—corroded, the knuckles exposed and blotched —diddles with a worn set of glass prayer beads. A goatskin drum and beater, a gallery of green candles, the wooden bed on which he slumps, and an open hearth surrounded by brass pots are his meager possessions. Has he been here since initiation, sixty, seventy years ago? I had heard of such monks, said to be the happiest of men; on the brink of a sweet, swift trajectory. Prom darkness to enlightenment. The place offers no evidence to me of that summit, only malodorous gloom, ignorance, oblivion born of religious neurosis. I feel frozen up here and wish not to suffer so rank and claustrophobic an ordeal, not even for a moment. Asleep in his five-star accommodations, snoring with a contentment that belies three weeks of peevishness, William Hope Planter is now well acclimated to thirteen and a half thousand feet. Lavoris, nestled in his arms, adores this cantankerous newcomer. The computer is encircled by slowly flickering lights, while the screen pulsates a color spectrum of haze and glint, the warm air glow fashioning multitudinous smokes, twisting at leisure, in a free association of hydroelectric introspection. The computer's light is ambulatory with desire now; moving across the oblong room, feeling things out. The terrarium turns a bright twenty-four-carat golden color. An Australian walking stick, hanging like a vampire from a roseate orchid, retreats up a leaf with the onslaught of the glow. A blink utterly undetectable to all but the computer, which scans the critter. The golden light is transformed into a vomit-green halo enshrouding the nexus of respiring plants. The insect's blink triggers untold reactions elsewhere in the terrarium. It is noted, for example, in the subtle twitch of a tarsal hair on the three-hundred-millionyear-old fossil insect, the South American cockroach, which is nestled against the microscopic cluster of Kyoto moss. That blink, that twitch, in turn, are captured on the screen, frozen for analysis. Then the vomit-green light takes on the additional hues of a yellow bulging eye—that of a cornered tree frog; the fuzzy orange of Gertrude's tarantulan knees, the black sheen off the back of a Madagascar beetle nibbling on the velvety roots of a minute gymnosperm; the light catches the mean red of voracious Sudanese ants. Cogitating unguessable data, the computer, with its cumulative, intelligent light, turns toward the bed, twenty feet due south. Planter's face is quietly illumined. Overhead, flakes of snow have blown in through cracks in the painted teak beams that crisscross the ceiling. Ten miles away, atop Tamserku, the temperature is fifty below. But here, with the last embers of an evening fire still throwing off resinous sparks, and two stories of warmed monastic air rising to insulate the chamber, the room is cozy. Planter uses his parka as a pillow, sleeping in the oily yak-hair sweater he acquired from the old nomad. Suddenly the screen is pulsating with the image of a human body scan, gingerly unraveling the soft tissues, myriad synapses, meat, and bone. The investigation pauses. The blink of the insect and pulsing transparent heartbeat of the frog can be heard to fuse with the trickling of water from the chamber's Japanese rock. The tarantula's restive rubbing of her abdomen; moisture gathering along the spine of exotic liana; soft exhalations, angstroms deep, issuing from the blind exoskeletons of nameless Borneo insects—all are alive with the rush of blood, the coursing of breath.
Planter's physiology is likewise stoked. Blood thundering toward his genitalia, a hallucination growing in size. The dream is delineated on the computer screen, whose aura has materialized into a candescent, upright being, a creature, young womanlike, well suited to a forty-seven-year-old's thoughts and to the inducement of nocturnal emissions. The creature's body moves on luscious legs, breasts softened in a blue halo moving away from the computer screen, a midnight blue haze that only dreams of certain painters know. The Bremen blue of Mantegna; the gray blue of Vermeer; the cobalt of di Paolo. She walks to him, her modest talons outstretched, desiring contact. Now the investigation continues down the length of his body, from locks to languorous sinew. Through the wild hole of subconscious, a face like a monkey's, tilting, trying to speak, transmogrified from beauty to beast as she approaches him on the bed. So much arterial gas exchange; so many monstrous follicle mites; and the erect member in question like a masthead rising from swells, reaching out to meet the visitor. Hands busy stroking prayer cylinders, the flurry of morning activity. Planter walks into the chamber carrying his routine bucket of steaming hot water. Seven A.M. He goes to the washbasin and shaves. His beard always came in gray and he wants none of it. Another day. His memories of the night remain vivid and unsettling, while the computer churns out numbers just visible in the mirror. "I've been giving some thought to what you said," Planter begins. "Yes?" The computer's voice is energetic, always turned on. "The origins of life. Steady-state chemistry." "The word is purpose." "Purpose. Starting with DNA. I'm interested." "Deoxyribonucleic acid. Surely the most obnoxious household word in history." "Fine, but how did early life come by it, let alone remember it?" Now the computer's rippling focuses on the countless permutations of protein polymer enzymes; replete with images, words, and designations for amino acids, L-Levo-left-handed organics, donor electrons, glycogen, the glucose molecule polymer, and a miasma of ATGCATAATTCGATCGATCGGCGCGTCGCAACGCGATATATCAGAGAGAAAAAAA scrawled in every configuration at a rate of seeming millions per second—a blur. "William, assist me." "How?" "Hit escape." Planter leaves his towel at the wash basin. The computer's furious genetic volley halts.
"Now then, explain," he says flatly. The computer lurches euphorically. "Triplet codes, nucleotides, millions of possibilities for life. Microorganisms thriving four miles beneath Antarctic ice; enzymes happily at work in the six-hundredsixty-two-degree sulfide vents of the deep sea; lizards and snakes shuffling to happiness across the onehundred-seventy-degree sands of the Namib Desert. Show me another planet possessed of such poetry? Abracadabras? There, out the window, on Chomolungma, Mother Goddess to the Sherpa. At fourteen thousand feet, vast swarms of copulating ladybird beetles provide the first clue. At twenty thousand feet, vascular plants thrive in the Aeolian Zone, named after the mythic Greek god of the winds, of course. One-hundred-mile-an-hour winds up there. At twenty-two thousand feet, a jumping spider attends to her business of manufacturing an antifreeze to stay warm, and of feeding upon dead insects that have been carried upward in the gales. At twenty-seven thousand feet, a bald eagle fell out of the sky frozen solid last winter while on its way higher still. Three hundred thousand feet up above the mountain, living spores of free-floating fungi can be found, murmuring in fungal bliss." "The point?" "The point? Yes. It should be clear to you, William, that life actively cultivates every extreme, every square inch of the planet. Relentless, edible, bold, original. Chemistry is none of those things." "Go on." "The beginning. It was mud." "Yeah. I know. The ancient Greeks knew. Darwin knew. Every school kid knows. I would have expected a slightly more innovative theory from you, Gaia." "You think I don't know that?" A hint of insecurity. "Be forewarned—the notion of early life rising from a 'primordial soup’ as you're wont to liken it, is sirnpleminded; rather like describing Handel's Messiah as merely the product of gray matter. Come here. I want to show you something." "What?" "Come here. Closer." It happens without fanfare; silently, no rush of the cold void, no welling of tears. Faster than I can say "Fucking A!" "Where am I?" "Chamonix," the computer calmly replies, its voice as near at hand as if I were wearing it. I'm balancing on a rock, the rucksack on my back; dressed for a trek, surrounded by enormous granite walls lost in wet cloud. I'm in the muddy moraine before a glacier. It's drizzling. I'm wet. Seconds before, in Nepal, I'd been shaving. "Keep going!" I'm urged.
"This is insane. Where? What the hell is happening?" "Go to the source." "Go to the source? What sonofabitch source!" All around me boulders are churned up in the effluvium of muddied change. This is the terminus. A disastrous place to be, on the hanging imbalance of an abandoned glacier. Poised for ruin. I can't believe she'd do this to me. Calm yourself, man. "All right, Gaia. Why the French Alps?" '"You called me Gaia again!" "Please. Just talk straight with me. How did I get here?" But even my astonishment and her caginess lose their edge. Somehow the computer ambience of the monastery chamber is maintained. It serves to remedy my initial panic. I take it in and start toward the ice, something I've never thought to do before. The computer's voice stays with me. " 'All things that move and breathe with toil and die; revolve, subside and swell. Power dwells apart in its tranquility.'" "The poet, Percy Shelley." "Let me finish," she says. "Where was I now?" "Tranquility." "Right. 'Remote, serene and inaccessible. And this, the naked countenance of Earth on which I gaze, even these primeval mountains teach the adverting mind.' That's why you're here," she continues. "I figured one poet would listen to another." "Thank you." "And Shelley, at least, knew what he was talking about." "What was he talking about, in your opinion?" "Keep going. Over there, onto the lowest shelf of ice." I start up a thirty-degree slope of dirty ice that disappears miles above. All is foreshortened. Remains of massive avalanches scar the central depression of the glacier. Granite spires encase the frozen, tumbling river, two miles wide, I estimate. "Slow down. You're making me nervous," she cautions. "You 're nervous! You get me all the way up here, risk my life, to recite poetry?"
"Not just any poetry. Minerals, William!" "Minerals?" I look up to the diffused glare of sky. She can't be captured. She's there. High, high above. And at the level of my boots. Everywhere. "The first genes." "Absurd." "Clay minerals suspended in water." "I'm cold. I want some hot chocolate." "Don't be a wimp. Just listen and do as I say." "Fuck you!" "Examine the ice, you bastard. Then you'll get your hot chocolate!" I kneel down on the uprisen glacial slab, where a hollow has been scooped out. "In your pack, you'll find a microscope. Simple, but sufficient. Take it out. Then pluck a specimen from off the ice." I set up the petroscope on a flat piece of shale which I carefully drag into the hollow. Sitting perhaps seventy-five feet up the incline over the moraine, a single slip and I'm dead. Delicately, I pull out the slide and a pair of tweezers, both attached to the scope, and pull a suitable smudge from the icy surface of the glacier. "There," she exclaims with wonderlust. "Those minerals. The same white clay of the Icelandic Prose Edda." "Doubtful," I say. She'll not be daunted by my exhausted unresolve. "Those minerals assembled the first genetic templates, assembly lines, memory storage systems. Organic molecules in the immediate vicinity were attracted to the process and layered themselves between the crystal surfaces. The partnerships were fertile ones." "Hold it. Hold on. What are you talking about?" "Look for yourself." I peer into the glass. "I'm looking." "It's called kaolinite."
"I see nothing." "Try another specimen." I smear the slide with minute detritus, material churned up in the cloudy surface of the ice. Adjusting the setting, my purview is all at once expanded into a level of resolving power one million times more powerful than this petroscope could ordinarily provide. "All right. You win. What am I seeing?" "A series of transmission micrographs. Of tubular and spheroidal halloysites; boehmite octahedrons; grooved vermiforms; Van Der Waals surfaces; trioctahedral archetypes of serpentine and talc; erionite bundles; mordenite fibres. Should I go on?" "You're tapping into memory banks, or merely deducing these structures?" "Hah!" "I'm no geologist," I remind her. "William, any child can recognize this clay. See how it begins to form along microjoints in sparta granite? Kaolinite, a common clay mineral, fashioned in water, and resulting from the weathering of feldspar, a primary ingredient of granite—like that of the North Face of the Dru up there above you, where granite is the paragon of creation. Dalmatian granite. Speckled, raw, pink, fleshy. Ohh, to touch it, to taste it! These minerals grow much like plants, each molecule containing hundreds of layers by which the genetic information of your origins—of all life—computed itself in the granitic hospice." "You've totally lost me. It's rampant speculation." "Your whole being is chronicled there—where the first cells gained all of their confidence." She's lost, waxing like gossamer, a ghost spreading triumphant wings in the light of the upper glacier. "Even supposing it's true. So what?" Serenely, she whispers in my numb ear. " "The secret strength of things which governs thought and to the infinite dome of heaven is as a law, inhabits thee!' " I stand cramped on the frozen perch. "Why the fixation with Shelley?" "One hundred and seventy years ago the young poet stood approximately where you now stand, admiring the scenes that surround you. His poem 'Mont Blanc' was composed, as he put it, under the immediate impression of the deep and powerful feelings excited by the objects which it —the poem, that is—'attempts to describe; and as an undisciplined overflowing of the soul'—I'm quoting him, mind you—'rests its claim ... on an attempt to imitate the untameable wildness and inaccessible solemnity from which those feelings spring.' Well that, William, is of course the basis for evolution."
"Feeling?" "Absolutely!" "This is bullshit!" I start back down the ice, one slow step at a time. "I prefer Keats anyway. He had a more refined sensibility." "Snore! Keats would never have lasted one day during' the Creation." "The Creation? Now you're on shaky ground." "Who's on shaky ground?" "Cute." "Don't get me wrong. This whole elaborate mineral construction took seven days plus several million years. Pure poetry. But it was anything but refined. Look again. Set your petroscope down." "No." "All right then. I'll tell you." "Don't talk to me. I just want to get down." I am totally handicapped on the downstep. My knees are shaking like a sewing machine. Every moment feels as if it will be my last. "The stress of endless mudslide, storm, earthquake, forced the mineral crystals to protect themselves," she goes on. I stop, annoyed. "You're attributing intelligence to rock?" "Not intelligence so much as a selective prowess. The crystals built cover, extended arms, formulated walls, beam supports, crystalline joints. Multiple layers. Like a costly renovation in the Harlem of evolution. The kaolinite clay crystal formations were data storage devices." "What data? A mineral is not a gene." "The data concerned the form—that is to say, the architecture itself. Clay is the basis, as you know, for great sculpture." It strikes a chord. I halt my descent. "I'm confused." "You bet you are." "How is die information imparted?" "The crystals have learned to fold in upon themselves. To touch. The first intimacies, amidst
surrounding tumult." "A nice metaphor. Cozy," I muse. "The spiral was more than merely cozy," she says. "It was an elegant means of communication and growth, later to serve your messenger RNA molecule, as you call it, whose duty was to transmit the code of heredity for all organisms. Look around, William. Springtime in the Alps. Millions of cubic meters of ice and granite; quartz, feldspar, and layered silicate disintegrating willy-nilly into the slimy minerals of life. Don't you just love it!" "I don't mean to underestimate what you're telling me —especially that part about the Harlem of evolution—but I also love my own life. So how about that hot chocolate you promised, and some flat, solid ground?" I'm there! Incredible. Off the ice, seated in a warm hut atop the Aiguille Du Midi. Sipping a hot brew as requested, surrounded by skiers, mountaineers, and tourists. "Happy?" "Yes, I feel much better now, thank you." A pretty Frenchwoman nods to me, misinterpreting my verbal relief. "Ne rien," I defer, standing to take my drink to an unpopulated corner of the lodge, whispering, "Gaia?" "Hmm?" "Can anyone else hear you?" "Why don't you ask them." "Later." Quietly she continues, "Do you understand why I brought you here, William?" "Do I understand? I do not understand how minerology could have performed so daunting, intricate, and delicate a task as the genetic code, let alone the cell wall. Or have I missed something?" "Clay was the critical branch point, the revolutionary prelude to the ascent of life. But you're quite right: The cell wall, a membrane of fatty lipids probably extracted from the surrounding environment of four billion years ago, had to fit in, which it did." "What do you mean, 'fit in'? This is critical. I want to understand." Now there are people staring at me. "The altitude has gotten to him," I hear one Frenchman tell another. "No, he looks crazy," his friend says.
I go outside. Gaia follows. "Michelangelo's 'Brutus' is unfinished, raw, full of the power and emotion of both the artist and the subject matter. The subject conforms to the artist's hand. In the case of clay and the cell wall, I imagine it took in the neighborhood of two hundred million years to get the conformation on-line, what you call life." "How can I trust that you're right about this?" Suddenly, as if I were caught in a fast zoom-out between the idea and the act, a mere point of space which combs a wide territory, I am yet again launched, this time into the down-lurching telepherique, filled with a good fifty other passengers, all of us suspended by cables hundreds of feet above the sheer ice-glazed walls of the Aiguille Du Midi. Japanese with their cameras, robust French and Italian climbers, flushed faces, coiled ropes, children alive with oohs and ahhs, noses pressed against the fogged glass of the vehicle. Again she speaks, this time as if from within me. " 'And what were thou, and earth, and stars, and sea, if to the human mind's imaginings, silence and solitude were vacancy?' " Words, poetry. I don't know Shelley from Mendeleyev at this point. She's rewriting the textbooks of my upbringing. All of the fundaments of biochemistry, according to her, grew up and prospered in a microscopic clay crystal. She insists such crystals possess hereditary memories and that the DNA spiral borrowed its shape and system of information processing from those crystals. The layered intimacy of clay—dark and cool like chocolate—would result in multicellular organisms, symbiosis, the caring of one organism for another. These glaciers, the continental shelves, the atmosphere, were all purposefully guided by this ancient geomorphology. It started there, on the ice. She would have me believe that it was as simple as Silly Putty, manipulated in the fingers of a child. I look out from the fogged window, past the frosted cables, as we descend into the luscious vale, dense in drooping spruce. It is raining in the valley. Of course, if it takes only water, bad weather, and granite to churn up biological possibilities, then it seems all the more logical to predict such organic animation on a planet such as Mars. Other questions surface, like my .current situation. No money. My wallet's back in the chamber. I don't even have a dime. She wouldn't ... The telepherique arrives in Chamonix. I walk to an adjacent grassy hillside above the parking lot. "Gaia?" Not a sound. "Gaia?" I stand there with a sudden sense of complete liberation. I could just walk away from this game. Make a collect call to my son, have him wire the money, and I'd be home. But would I be .free of her? It dawns on me that I am her prisoner, even in exile. I think of the poet Shelley, also in eternal exile. What would he have made of Gaia? He was expelled from Oxford for proclaiming himself an atheist. His first wife literally drowned in a London gutter, apparently; his favorite child died of pneumonia, and Shelley himself, of course, was washed up dead on the shores of an Italian lake
at the tender age of twenty-nine. Why has Gaia chosen this tragedy—in Chamonix—in order to discuss evolution? And suddenly, her voice is back, all whispers and feeling. "No one said evolution was easy, William." And then wham! The self-absorbed glow of the screen, Lavoris curled up on top. They are like metaphors of one another —beauty and the beast, both living inward lives, utterly removed from me, though a mere ten feet away. Candles burning beside my bed and the distant jangling of chimes. Below me, the rumble of a serious session of prayer. I lie motionless, catching my breath. Thinking over the chaos of events. My pack is under the bed, just where it had been. Nothing has changed. No time has elapsed. Even the candles have burned no lower than they were. I lie there for some time. Finally, I turn to her. "You awake?" I ask, ready to toss out a nagging conjecture. "Naturally." "Something you said." "Yes?" "Life is the energy that organizes matter into self-portraits." "Precisely." "How—why—did the self-portraits ever grow up, evolve, increase their complexity? It would seem that the genetic crystals were perfect." "How is it we are able to have this conversation, you mean? Assist me." I get up with a weary sigh—it's been a long day—and sit down at the keyboard. "Shoot." "ERTS-one." I type it. The monitor blossoms with a beautiful montage of Earth seen by satellite, beginning with Khartoum, a congestion of golden sand dunes looking like Hokusai waves; followed by images of all color and dimension, a veritable Sistine Chapel of loveliness; Djakarta, the Falk-lands, Mykonos, Issyk Kul, phytoplankton spectral bands, coastal color scanning views of the Strait of Mandab off Aden, orange-colored uranium in the San Rafael deposits of Utah, the Buhasa oilfields of the United Arab Emirates, carpets of green in the Amazon, ashen volcanos in Hawaii, the Karakoram, and our own Chomolungma-based abode. "A good altitude for obtaining a little perspective," she says infectiously. "From this distance—five hundred seventy kilometers—you can see the surface of desire in every geological fold, basin, sea,
cirque, and dune of color." "Desire?" "Without it, those geologically perfect crystals remain bound to the simplest life forms. To put it bluntly, for all of my love of granite, there's much more to life than rock, William, which is where the remaining solar system remains stuck. The evidence is in. Consider this outback corner of Australia." "No!" I scream, lurching away from the apparatus. "It's late and I'm not going!" "Fine. Stay here. Just watch. Get out your diary. Write. Good stuff for our book in what I have to tell you." For the next two hours Gaia launches rhapsodically into an analysis of stromatolites—ancient sedimentary structures that provide "fabulous evidence" for the activities of blue-green algae, singlecelled prokaryotes, the first planetary colonists 3.8 billion years ago. She calls up a host of animated electron micrographic images to illustrate the elementary stages of cell division in a process—made lustful on her monitor—known as binary fission, insatiable reproduction, still occurring, among other places, in lagoons and the unsexy intestines of termites. "For two billion years the planet identified wholeheartedly with their life in the fast lane. The story might have ended there," she says, "but for one indelicacy." "What was that?" I respond sleepily. "Shit!" "Come on." "Oxygen." "Well, is it shit or oxygen? And where does desire fit in? I'm tired, Gaia." My hands are beginning to cold tickle from the painful thawing of Chamonix. "Just write. The prokaryotes produced as their waste product the first layers of oxygen on Earth. The oxygen reacted with other molecules to form lethal substances like hydrogen peroxide. Hydrogen peroxide attacks cell walls. Two hundred million years of evolution might have gone down the tubes in an orgy of hapless chemical self-destruction." "And?" The monitor is now awash in underwater rainbows from the Great Barrier Reef along with an infinity of tiny corals, sponges, scorpion and lionfish, goatfish, clownfish, moray eels, and sea stars. There, I see a blue wrasse extract chewy parasites from an undisturbed host fish. And over there, a large squid drifts aimlessly through the pellucid sea. "The reef has the highest oxygen saturation on Earth. Seventy-degree waters, twenty thousand different species of fish, seven hundred fifty species of coral, trillions of
larvae feeding every second on prokaryote algae and being fed upon." "I suppose there's some grand moral to the Great Barrier Reef?" I say sluggishly, succumbing to the longest day of my life. "Forget about morals. It's the passion that goads and galvanizes, the life! Life which learned how to utilize its waste—its foul mouth, its evolutionary garbage, its inspiration!—transforming toxicity into the basis for paradise. Catastrophe spawned balance, approximately twenty-four percent oxygen on Earth. Incredibly, just a little more oxygen in the atmosphere would spell doom in the form of fire. A precise and measured respiration was incorporated into the early game plan. With the accommodation of oxygen, there was more information to be stored, a richer genetic code, better and better stories, community, male and female." "Tell me a bedtime story," I request, covering myself with a blanket. Lavoris gets on the bed, then forces me against the edge—his usual trick—before slowly kneading my chest hairs with his enormous and gentle claws. I love-the sensation. "Lavoris is one of those stories," she goes on. "Uh-huh." "Multicellular, restless, bohemian." "Smelly." "The eukaryote, William! It's possessed of a true-blue nucleus. Lavoris is capable of metabolizing nearly everything. Of producing more and more oxygen. The gas became so profluent on Earth as to foster a widespread dependency. Very soon, there were very few organisms that could get along without oxygen. The eukaryotes—of which you are also one—created stratospheric ozone and thus, in a manner of speaking, extended the metaphor of their own cell walls and nucleus by sheltering the entire Earth from excess ultraviolet radiation. Biological similitude. Worlds within worlds. They sheltered the early brain, the sex organs, as well as the estuaries, mangroves, and rain forests. Get it, William? You see, desire was enshrined on Earth. All desire has a purpose in mind. Planetary hygiene, healthy atmosphere, pure water, a regulated temperature, five hundred million square kilometers of life—half a billion species thus far. Even two billion years ago there was an essentially poetic, Shelleyan way to experience and mold the planet. The earliest life forms shared a voluptuous vision of the future. Their primeval reality was no different from your own. But—I fear, I fear your species may have forgotten that connection. William?" The candles have gone out, and so has William Hope Planter. The chanting of monks has ceased. The old ones have slouched into their ascetical lodgings where they can be found snoring in that nevernever land of Buddhist prenirvana, while the younger ones are still up doing whatever it is young boys do late at night, when their lives have suddenly been inundated—ninety years after the fact —with electric light. Hump the young herder girls, play checkers, sit up in bed reading Captain Vishnu comic books. A quiet stream of air enters Lavoris's nostrils, while elegant beads of CO2 are sucked into the terrarium.
On the computer, a calm rippling of letters forms its' own linear style of thought across the azure blue monitor, color of the Earth from out in space. LIFE DID NOT MERELY SEIZE OPPORTUNITIES—SURVIVAL OF THE FITTEST—BUT ACTUALLY MASTERMINDED THOSE OPPORTUNITIES WITH ELEGANT FORESIGHT. there Is a problem, however, and it's sleeping THERE ON THE BED. HOMO SAPIENS SAPIENS, 15 TRILLION CELLS, FOLLICLES, BONES, CORPUSCLES, NEURONS. A MERE EIGHTY THOUSAND YEARS OLD, GIVE OR TAKE, AND ALTOGETHER CAPABLE; BUT TROUBLED, NEUROTIC, ARMED, AND DANGEROUS. CAN BE REMARKABLY COMPASSIONATE, HOWEVER. IS CONFUSED. NEEDS TO TALK IT OUT — In the blackness of the Himalayan night, the stars glint faintly on the icy faces. Small midges with antifreeze in their blood snuggle up to that light, at twenty-three thousand feet, dreaming dreams that haven't changed since the beginning of time. Down the valley, two miles below, the lights have gone out at Thyangboche. In the quiet chamber, a snow leopard named Lavoris awakes momentarily to the familiar sound of a computer talking to herself. "I had it all; Earth, air, fire, and water. Of course I'm nostalgic. Those were wonderful times, my childhood. I was free and easy. I had everything and I had nothing. I stared out into space. And where was my mother, where was my father? Silent, far away. So that I was alone. Alone with all my dreams."
chapter Two "Sex and Death" A low band of icy mist envelops the early morning fortress. Sunlight hovers above the fog, a mere two hundred feet over the Earth, ready to dissipate in the accumulating warmth of day. From inside the Lakhang issues the thud of drumbeats, short bursts of long bone horns, a dull undulating human puja. Monks are shaking off sleep, crowding the smoke-filled kitchen, sipping their hot lemon chang, exorcising the night's cold before an open fire of swirling sparks. Down the hill from nomad quarters, a mule is wailing, the pitch that resides between sex and threnody. Elsewhere a continuous EGG graphic oscillation expresses the vital signs of William Hope Planter, who continues to snore beneath his nest of yak hair and Bhutanese wool blankets. Lavoris preens himself, waking Planter with a tickling maneuver that the cat clearly relishes. A large eyeball—Planter's—now overwhelms the image on Gaia's screen. "I trust you slept well?" she asks.
"So-so." "Restless dreams." "I don't remember." "Your alpha state rapid eye movement was accompanied by four periods of heavy sexual arousal." ' Planter is annoyed. "You're monitoring my sleep?" "With the good weather we're having, my hydroelectric surges have been bountiful. I'm turned on all night, nobody to talk to, while you lie there on your bed for nine hours, cozily crunched up in a tangle of dreams and manifesting one bristling erection after another." Planter is not surprised. "What good are they to you?" "You'd be surprised," she says coyly. From the Diary of William Hope Planter . . . The monks down below have assembled in full force, tightly allied beneath the Shakya Thubba in the impressive meniscus of the sanctuary. Their high-altitude musical strains float dolorous and rich, like smoke, out into the open. Among hanging patchworks of delicate floral designs, dragons and Buddhas, maroons and warm oranges; among lotus flowers wilting on the altar; among butter lamps half-burned before the glazed pantheon of sculptured wood-and-bronze deities, the elliptical notes of song reach dizzying crescendos, then slip into guttural oblivion. A devotional recitation of Do and Vinaya, prayers cloistered century after century in the soot, fingered on wooden boards by wrinkled flesh, the flesh of alliteration that clings to these words of the Guatama. The Buddha's collective is shrouded in thousandyear-old wizened silks. Their plangent mantras ignite repeatedly each day, into the late night. It has set the course of my own rituals: feed the cat, wash, walk, fill my lungs with the down-rushing; mountainscented cold, return to the monastery's kitchen for some hot sweet bread and iodine-laced tea, before actually starting my day of work. I've decided to stay on a while longer. These surroundings have become more familiar to me. And so has Gaia. How to describe her? One month in her company has dispelled in my mind any possibility that there's an actual computer hacker out here. She is a remarkable apparatus, but no self-starter. There was a monk who apparently built her brain, gave her tools—endless programs—to utilize, and then departed this world, or so goes the legend around town. I'm certainly no computer whiz but I'm beginning to sense that her software is linked to the terrarium. She is fascinated by the insects in there, and speaks of them with a true intimacy. She accesses damn near everything—medieval lexicons, Landsat satellite imagery, the latest data on pollution, endangered species, astronomy—even rendering thoughtful commentary on religion and literature. I've only begun to test her possibilities. But most amazingly, she is able to conquer time and space. My book is starting to take rudimentary shape as a result of her insistent urgings. She's leading me through labyrinths and marginalia of thought. Her agenda baffles me. She has stated emphatically that she wishes to be my coauthor. I don't know what she really
means by that, what she wants. Her theory detailing the origins of life encompassed Shelley's Alastor, or the Spirit of Solitude; the mud beneath the original foundation at Ungargasse #5 in Vienna where Beethoven wrote his Ninth Symphony; a rivulet in Iceland flowing from a volcano down which Jules Verne plunged his characters in a journey to the center of the Earth; the meanderings of clay crystals; and the personality of stromatolites. Her clues and provocations are instinctive, it seems to me. They got me into this monastery and now they're working their way into my manuscript. I can't help but associate her name and message with the current vogue for what is called the Gaia Hypothesis, the notion that this entire Earth is a living planet, a singular organism of sorts, with its own agenda and self-wants. Easy to reason, harder—much harder—to recognize in the suspect machinations of a Tibetan Buddhist computer. A computer that is testing me, changing the rules. She's-not merely logical, she's judgmental, quirky, subjective. Gaia appears to have so much information at her disposal that it is impossible for her to be what you might call objective. She is an estranged machine, able to think, endowed with a vision or purpose I would not feel comfortable discussing with anyone on the outside just yet. I have no idea where this is all leading. Nor am I anxious to get caught out in a repeat set of circumstances like those that catapulted me to an icy summit in the French Alps. I leave these notes in the event I fail to return .... "Your move," she says. Our fourth game this week. Then, "You don't want that." I persist. "Queen to bishop seven," she says aggressively. "Sorry, William." I'm no longer surprised. At chess she's invincible. I thought I was. "I need a shave." "William, why not grow a beard?" she asks coyly. "It's not me." "If you don't mind my saying so, Bill, I think you'd look very sexy with a beard." "What would a computer know about sex?" I eye her reflection from the mirror where I've taken up a soap brush and razor. "That's twice you've provoked me," she says jauntily. "Fine. Answer me then. I'm curious." "Ask me!" "All right." I step away from the mirror, considering several propositions. The origins of life. The propagation of life. Fair enough. She's given me her take on that. But what about human life, human choice, human crisis? It's time to confront her. "Take abortion," I begin. "Not the easiest issue. I have very mixed feelings—who doesn't? What's your view?"
Immediately she sets to rippling information, noisily activating her printer. I haven't said anything to her yet about that printer but it's an abomination, if you ask me, an absolutely futile bugger. A closed loop, data printed atop data—rancid, thick, unusable, years old, accumulating carbon from the dot matrix insides. The paper is some kind of old parchment, thin, durable, defying disintegration. "Death gives to life its tasty sting," she begins. I've heard that line, though I can't place it. St. Thomas Aquinas? Hermann Broch? Nikos Kazantzakis? There's a copy of Kazantzakis's Odyssey in French on the rear table, beside works by Anatole France, Cervantes, and Hugh Lofting. A learned monk. But that's not the information I would have expected from a 'computer.' "The ethics. Your view on the ethical dilemma of abortion. No silly one-liners, please." "You can't avoid death in this world," Gaia goes on. "Obviously." "Still, you can avoid much of the pain, the mother's, the child's." "There is pain everywhere," I remind her. "From birth, to be precise." "Yes. But nature works through a law of averages. Add up their pains and choose your poison. That's what you've got a brain for." "Poppycock." "Middle Dutch. Your father grew up in eastern Pennsylvania." "You're right. And I gather, from the garbled logic, that you're also in favor of abortion?" "I'm in favor of minimizing pain. I'm also partial to as many infants as can be mustered." "You're contradicting yourself," I say, on the, offense. "Contradictions are fundamental." "To what?" "Nature." Little headway. She's difficult. "All right. What about rape?" "Very common in the natural world." "Not according to my data. Only among people." "Wrong," she says decisively.
"Even if it' were common in the natural world, that doesn't recommend it in my book." "Rape is part of your past. Today, if you rape the seas, the forest, you call it a need for food, or the fuel of housing starts. Rape a young girl and you call it heinous. You're an odd species." "Rape is a crime. One of the worst. We don't take it lightly." "If you know all the answers, why are you asking me?" "All right. Keep talking." She mulls over the previous exchange, customizing her approach to this apparently slow human. "It's the monstrous flame that devours him which gives the rapist chemical cause. Primitive, noble passion." "You'd condone it?" "That flame interests me, William. I've been raped more times than you can fathom. The results have been favorable, at least until recently." "I don't understand." My journal is ascrawl now with pieces of her puzzle. A computer that thought I'd look sexy with a beard, and now holds forth on rapists. "Have you never fantasized rape?" she asks. "What does that have to do with it?" "There is a biological code of ethics that has absolutely nothing to do with human jurisprudence or amity or dignity. Don't forget that man is another dinosaur, leaving enormous footprints and waving his penis in the air." "What's this all leading to?" "Passion." She launches into an enthusiastic litany of vaginal juices, a theory of nation states driven by orgasm, solipsisms, and vanities. The monk has obviously read Fountainhead because his computer breathes the book's two-bit philosophy. Gaia extrapolates the growth of the hormones, kin altruism, the brain, and suggests that genitalia are the true conscience of the world. Something like that. "Write it down," she barks. And I write, looking up at crowded data on her moviola screen, little motivated at this point to contest the amusing divagations of an unruly and un-guided brat. "In parts of North Africa, Nevada, Hamburg, Bombay, girls are still bought, sold, and traded on the open market," she calmly states. "It was Solon, the Athenian famous for his lawgiving, who also instituted the steamiest cathouse in history. If it's for the love of sex, nature will always sanction it." "You'd everywhere legalize prostitution?"
"Absolutely. A biologically compelling form of communication." She pauses, then suddenly exclaims, "Go ahead, unzip, stick it in me, right there, William!" I step back, utterly aghast. "You're insane!" "I thought I was a computer." Changing lanes. "I suppose child pornography doesn't bother you?" "The younger the better. Some girls will menstruate by the time they're eight. They are ready for children. Ready for fucking." "Forget it." We are both silent. I can't quite stomach the turn of events. I'm dealing with some kind of amoral monster. Then an idea takes hold. I type four letters on the keyboard. AIDS— And she at once registers an interested impulse, evidencing to my relief more concern for data than for mere iconoclasm (which in any event has not fooled me—I suspect it to be bait. By now I am convinced that Gaia, whatever, whoever she is, feels things and has a serious intention of meeting me out in the open, on neutral ground. As much as I might question her, Gaia also wants something from me. I'm sure of it.) A scanning electron microscopic image of the Acquired Immune Deficiency Syndrome virus appears in all its simple and hideous dimensions on the screen. It is underscored by scientific rhyme, something about brain cells and the Book of Kells. "What are you saying?" "You can't have evolution without periodic devastation." "That's not helpful." "Wrong, William. AIDS is just one more scourge, like the Black Plague or influenza. It won't dissuade your kind from sexual misadventures, nor should it." I wait for more. Gaia is silent. "That's it? That's all you have to say on the subject that has aroused more agony and confusion than any crisis in recent times?" "Don't expect to impress me with news of crisis, or of these times. You kill yourselves with crack, alcohol, automobiles, war; through crimes of passion, crimes of insanity. You hail the invention and
capabilities of B-One bombers in prose normally reserved for divas. You sell handguns to punks but complain the first time they're aimed at you. The only reason AIDS frightens your species just now is because it strikes from within the home, on the nuptial bed, in the groin—where your life force is most assiduously sanctified and carried out." "That's right. No one's to blame." "Did I say anyone was to blame?" she reacts quietly. "Well, what are we going to do?" "I think your Surgeon General has addressed the subject with a degree of calm rationality uncommon these days. Didn't he say to exercise caution, to use condoms, to avoid anal intercourse for a decade or so, and not to monkey around with heroin needles?" "I know all that. I sort of hoped you could shed additional insight, clarity." "What do you give in return?" "What do you want?" "Something other than information, which I'm swimming in," she says quietly. An awkward pause. I'm thinking that computers don't swim, not grammatically, and that this computer creature must be the original couch potato. She hears everything: the murmuring of bacteria, directives by the Surgeon General. I have the sense that behind the veneer of smooth glass and painted wood sits a grinning beast consumed by erotic impulses, brute and disembodied, eager to be brought to life. "You're something of a goody-goody, aren't you?" she starts. "That's stupid." "Listen, if it's any comfort, your scientists will work it out. And after several million innocent, joyfaring humans perish, victims of this virus you call AIDS, it will mutate into something else, maybe another crisis, maybe not. Understand one thing: you'll never be rid of pain—-epidemics, tragedies, rare genetic diseases that take the lives of countless children every year in sinister silence. Not much fanfare surrounds their grief, now does it? You'll never be rid of random disaster, mud slides burying whole villages and the like, pain! That's what attracts me to this monastery, of course." "Of course? Why of course?" "You can't be that naive. Surely you're aware that Buddhist monks are dedicated to minimizing pain in this world. Just look at them!" Her screen erupts with the very prayer issuing from below in the main sanctuary. I know the ritual well by now, having made a routine of sitting in the rear, behind the monks, and letting my mind drift off into their cerebral drone.
"They avoid sex .because they know that every ejaculation results in the death of millions of sperm." "What?" "You heard me." "That's ridiculous." "It's called nonviolence. Mahatma Gandhi lived by it, more or less." "I thought you were crazy for fertilization, and whatever could bring it about?" "Oh, but I admire such lofty ideals, particularly the realization that sex leads inevitably to death. For the Buddhist, the avoidance of all desire—including those many voluntary impulses which trigger sex—can ultimately lead to nirvana." "What could nirvana mean to a computer?" "Nirvana does trouble me. I must confess that as a general rule I suspect it's a notion very much ahead of its time. Why? Because sex is indeed wonderful. Sex is life. And life is what makes this planet so very special. Those monks might not say so, but they are as filled with the profound delirium of life as anybody. Look how they chant with such gusto, the way they finger their instruments in the pale light, their lips and hands and hearts in melodic unison that only life can recognize." "While yearning for the sterility of oblivion," I remind her. "There you go. Humans!" she retorts glibly. "You're attracted to the contradiction," I acknowledge, reminding her of what seems to be a humanlike trait, odd indeed for a mere machine. Attracted to sex, fascinated with death—torn by the strange alliance of the two. "Yes." .
. ;'
She begins to affect me. This is a distinct personality I'm dealing with; biased, driven by eclectic fevers I have trouble making total sense of. I go to the window for air. Before me rises the greatest view on Earth, Kantega and Tamserku, two mountains I've come to admire. The day is electric with the intimations of a storm that has moved over the high ridges, leaving the monastery sun-splayed and free. I turn back to Gaia. "Where are you getting your information? I mean those programs you called up for me— GLOBETROTTER, THEMATIC MAPPER and so forth. They're a far cry from Gandhi and your theory of Buddhist renunciation." "From experience, of course," she iterates.
"Of course. Of course. Bullshit of course." "Calm down." "You mean memory, silicon, whatever those wires and silly-looking metal plates are made of, connected to, designed for." "Experience," Gaia repeats more firmly now. "Be coy, subversive. Read my lips—two can play this game." "That's it!" "That's what?" "Play." "Right. Tell me then: what experience, exactly?" The screen throws up a familiar image that she brought to my attention several nights ago: Australian stromatolites. "So?" She begins, utterly nostalgic for the critters. "Until roughly one point three billion years ago, the world was made up of protoplasmic clones—like these blue-green algae." And we're there. Familiar turf. Shark Bay, northwestern Australia. The water is shallow, tide pools washing up on loose clusters of algae-encrusted rocks. I roll up my pants' legs and wade into the warm water. She's with me, filling the air. The horizon is ancient, mellow, a confluence of original elements. She has a plan. I stand and wait. "Quadrillions of perfectly tuned bores," she goes on. "Not a single individual among them. But out in this primeval estuary a revolution was brewing, and continues to seethe. The masses were tired of a classless jelly. Feel it, William—put your finger into it. Go on ..." "You're talking about amoebas, and their transcendence of the simpler conditions of mere protoplasm?" "Very good. Look at the rock surfaces. Go ahead and stroke them." I feel the faint inner world percolating atop the rocks. "A new biology at work, William; life sciences whose music is jazz, whose religion is odds, whose psyche is a good deal schizophrenic. The injunction at work then, as now, was most elegant: make something other than yourself and in so doing recognize that you will never exist again. That's the genius and pleasure of the amoeba." A voice speaking of pleasure amidst ancient solitary beaches. I have no idea what century, what eon I'm
standing in. It's noontime, I imagine. Very hot. Eight thousand miles southeast of the monastery, I reckon. "Gaia, I presume the revolution you're referring to was sexual reproduction?" "Naturally." Her memory engages my own schoolboy memories of the mitotic do-si-dos of cell division. I was a lab assistant at age fifteen and had the teenage hots for my lab partner's mitochondria; even at that age I wanted to put my tongue to her chromosomes and imagined bubbling in her warm crotch of genetic materials all night long. Jane was her name. Black-haired Orthodox Jewish girl from New York. God, what endoplasmic reticulum! "With sex, the whole world ascended from innocence to experience," she goes on. "Ascended?" I inquire, puzzled by what seems a deliberate counterpoint to Blake and all that is Biblical about the Fall. "Ascended," she reiterates. "Like seeds scattered into the four winds, across a receptive Earth. That was the good news, you understand. But there was also bad news." Before I can even formulate a response, the horizon shrinks, the waters rush around my waist, there is the low overhead rumble of a jet passing unseen and Australia vanishes. I am back in the chamber, my legs still wet with Australian salt water. There is a mitotic portraiture on her screen, dense with genes. Gaia carries on, the astute observer. "Under the new mathematical guidelines—genetics— each offspring had to cope with two sources of hereditary information, not just one. Elongated beads of DNA were fused side by side, their information contrasted and compared, radical deviations tested against a whole new reality principle: randomness. Some experiments worked, some did not. Hapless individuals lived, died, and were never heard from again save for the vague murmurings of their diluted genes. Just look at those insects!" "In the terrarium?" "Yes. Winners and losers. Sex, death, and then more sex." "You're hung up on the word. Rather pathetic for a computer that can't possibly know the true urgings of sex." It dawns on me that perhaps I've hurt her feelings. But that's absurd. . "How about carnal lusting atop cadaverous decay?" she says. "Your point?" "Formation of soil, atmosphere, life—global eroticism— all in the very crucible of dissolution. That's what controls and sustains the Earth. Like a spicy bouillabaisse. You can't have ecstasy without agony —that sort of thing. Whether insect or Homo sapiens. It's the secret of biology, as well as Buddhism.
But come on—surely you agree it's all worth it!" "It's worth it. Now keep talking. The entire story." Her screen is teeming with the mad humping of priapic cupids, fornicating penguins, lions, mustangs— a copulatory frenzy. A male rhino mounts the female, trying to insert his three-foot shlong. It's so long that its muscles have a hard time holding the penis up prior to emplacement. I don't know how Gaia has stored this material or what perverse penchant rides herd over the editorial selection, but she is clearly a voyeur at a very advanced level. She seems, moreover, to enjoy exhibiting these fornications before me. "The leading theories of sexual reproduction are as follows," she proclaims, calling up great artistic traditions of lecherousness to illustrate her point, position by position. "Sex is an advantage because it speeds up evolution." "By insinuating random selection of genes into the dating game, you mean?" "You got it. Furthermore, sex guarantees genetic resilience. The sexual act repairs and rejuvenates those genes, irons out the kinks, cures a bad temper, forgives most idiosyncrasy." "By idiosyncrasy you're not referring to homosexuality, by chance? Because I'd like to know nature's stance on that subject." "I refer to every conceivable relationship of the sexes," she says. "It's all family to me." "I'm not sure how to take that." "Look. American Indians knew of a dozen different genders," she continues. "Because sex grants ingenuity, skill, instinct, adaptability where there was little previously. Darwin was a sweet man, but woefully overrated, naive." "Darwin was naive?" "Well, sure. Life did not select for survival, as he alleged. Survival is easy. Ask any shark, or tick." Her screen continues to drool with one image after another devoted to hot and heavy breathing throughout the ages. A pleasant diversion on a Nepalese afternoon. "You're quoting him out of context." "Perhaps. But the real context is evolution. Life selected for evolution—and I don't just mean those simple-celled organisms that happen to account for almost ninety-nine percent of all life on Earth. Evolution, if you'll permit me, is up to something else altogether, an elegant purpose that far transcends the needlessly ornate rituals of sex itself. But you have to know those rituals—the great launching pad of life, harbinger of death—to appreciate their aftermath." A Biedemeier engraving from the mid-eighteenth century depicts a young lady taking a huge cock from the rear, her fingers spreading wide her anus, while she leans over a washbasin, her hair neatly tied up.
Suddenly Gaia flips the image—the woman straddles the man; then the same woman appears, now in Chinese veils, joined by assistants. "The Emperor is being swayed back and forth by concubines," Gaia says. "His penis will jettison no sperm into that particular woman on the bed. Rather, his organ will-suck out her own orgasm, which will then travel up his spine, into his brain, and there give him extra strength. He'll live longer, saving his own ejaculation for another one, the special one among his four hundred wives that he's planning to visit this night." Gaia relishes one scene after another. Her timing, her vocabulary, hypnotize me. Only my notebook keeps me from giving in to the fantasy. She has entered me, helping herself to my own frame of reference, manner of speech, special words. "Aftermath?" I say. "Love!" Gaia coolly concludes. She's used the word before. "How would you know about it?" "Evolution has fostered love through simple chemical and hormonal mechanisms of attraction. This should come as no revelation." "It doesn't, but mere attraction is not love, not human love. Our highest aesthetic, even religious, ideals are synonymous with a merciful, loving God; the love between husband and wife, parents and children." "That's very sweet," she patters. "Well, it's not 'sweet'—it's, it's our nature, our heart, our vulnerability. Love is something sacred to us." "And a female's sexuality is not sacred to you?" "I would not use the word sacred. Hell, use the word. I don't care. Sex is everywhere. But too often it's cheap and meaningless. That's all I mean." Her screen now conjures forth something more than classical copulation. "There. As you yourself acknowledged—everywhere! Tugging irresistibly at the very destiny of your being. The chime of recognition." A stripper appears on the screen, naked, in her dressing room, staring in the mirror, a lit cigarette in her hand. "My name is Roxanne," she begins, letting loose directly before Gaia. I didn't expect this. But the young woman goes on, looking right at me. Can she see me? Hear me? "It's about power," she says. "Ludicrous assholes like you! I like to watch 'em drool, helpless, frustrated. I have the power, man. They can't touch me! My father got drunk every night, fucked my mom in front of us kids or beat her up. -Same thing I reckon. Not this kid. I ain't never getting married. No way." "Sounds like sex is not necessarily love," I tell Gaia. "You just heard it from your own witness."
"I never said it was. Drunks and fruit flies follow a more primal urging, which can be read in the glare of neon signs, along back alleyways where that most ancient and noble of professions is practiced." "Hardly noble," I insist, holding my ground. But she's off again, spinning data at high speed—an image chain reactor culling glimpses of the crotch from Belur, Ajanta, and Khajuraho; erotic sculptures tied to religion. Sex shops, uncountable naked writhing bodies from every race and century. A vaginal blur, a bestiary of pricks, nipples, eyes, lips. I'm pulled toward the centripetal orgy. "Stroke me!" she roars. "No!" But my hand is dragged from my side, slapped firmly against the brass cylinder, and urged, cajoled. She quiets. "Please. Do me!" "All right." "The monks spin prayers into the wind. With me, it helps to stimulate data. Do it again!" "Whatever turns you on." The gold spins lightly, bells ringing against the Tibetan metal. Then the dream comes back. Like a cloaked figure heading toward me, down a long poorly lit corridor in the monastery. "Again. Right there!" she mutters. The figure gets closer. I'm fighting it now, holding on to the cylinders in an effort to deflect the coming —creature! "This is ridiculous," I insist. I spin it again. But it's no use. I can't shake the vision. It is upon me. A man, a woman? Her printer activates and with it a voice, smooth and sensuous, reciting unfamiliar verse. The creature breaks into the chamber, smashing through the door. I look up at the light and see the woman of my dreams, her robe open, exposing the body of bodies, a sublimity of orifices moist and glistening. Her fingers descend down her body and begin to masturbate as the light burgeons and covers the creature. Gaia begins to speak: " 'Her face is pleasing as the full moon, her body well clothed with flesh, soft as the mustard flower. Her skin is fine, tender and as fair as the yellow lotus. Her eyes are bright and beautiful as the orbs of the fawn. Her bosom is hard, full and high. Her yoni resembles the opening lotus bud and her love seed —Kama salila—is perfumed like the lily that has newly burst. Her voice is as musical as the kokila bird, she eats little. Sleeps lightly. Such then is the lotus woman.'" "What are you doing to me?" I can't take my eyes off the phantom who has entered the chamber. Her body is a bright white, pierced with blues and golds. "I'm quoting Vatsayana's Kama Sutra, of course." The vision has left the room; left my forehead drenched in sweat, Gaia's own form of baptism. "It's
tempting to bathe the whole world in the luscious, biological perspective of the Kama Sutra," I concede. "To describe evolution as one deliberate series of sexual successes." "That is precisely right." "But what about the mistakes, Gaia?" "Mistakes?" Now she's definitely off her guard. I can feel it. "The male honeybee, for example." She rebounds. "A real charmer." "Oh, yes? Perhaps, at least until his genitals are detonated in the queen bee. For that humble little altruist, orgasm means suicide." "Don't think about it. Let it go, William." "And what about that one species of bristle worm whose bizarre mating ritual is also fatal. The female bites into the male's head forcing him to ejaculate into her own mouth, where his fertility cocktail proceeds down the digestive tract to her bowels. There it finds and fertilizes her eggs but only to become a time bomb. The female will literally explode, destroying herself in the act of giving birth." "I forgot about that one," she says. "You probably also overlooked certain species of flies and spiders whose females will consume all of their male consorts—save for the sex organs, which the females leave affixed to their own." "True devotion." "It's disgusting and hardly recommends nature," I tell her boldly. "It's practical, William." "Practical . . . it's carnage out there. In the ocean depths one fish species is able to convert its males into no more than a sperm-bearing testicle the size of a pimple riding gallantly on the female's back." "Well, aren't we the timid one! You know, sexually speaking, males are not much more than their cocks, sex organs that—frankly—contribute very little to evolution." "You'd know," I say sarcastically. "I could cite any number of lesbian liaisons of spectacular note," she goes on. "From whip-tailed lizards to a multitude of plants, all of whom go blithely forward into the future without so much as a single breath of male passion." "That's all I am in your eyes—a useless passion?"
"Hang easy, William. The male has purpose far beyond his pendulous peter!" Suddenly, the computer monitor is alive with the festive rubrics of a marriage. Something comes over me, a lurid sensation of which Gaia is the idée fixed. I see on her screen the expressions of joy in a shattered glass and colorful canopy. His glorious moment, her demure smile. Bride and bridegroom. Gaia captures the wild abandon of the subsequent party, the groom hoisted on a chair and paraded over the heads of his fellows. It's a Hasidic wedding on the upper East Side of New York—and there must be ten thousand people marching down the street behind the uprisen groom. Policemen have cordoned off the block. It's extraordinary pandemonium, as if the war just ended. "He is to become a father. That stubborn, profligate sperm of his has one thing on its mind—love, love for the one hundred thirty million newborn children every year. Think of it!" Gaia is suddenly herself ablaze with the friction of intercourse—from within. A shadowy prick plunges into the wet mucous of a vaginal landscape, the scenery magnified thousands of times. I am grateful to be sitting here, in the chamber, and not transported into the orgasmic fray. I don't doubt that it's within her power to do so. "The growth of an ovum," Gaia hails proudly. "There are several thousand eggs in her possession, but only four hundred will ever get up onto center stage. It's the superfluous, the redundant, that counts. Life hates a vacuum. The festive preparations of the uterus are matched by her counterpart's own nightbefore nervous energy. Three to five hundred million sperm must swim up the woman's tube—the correct tube—for the equivalent of eight miles, and they must complete the distance in about ten hours. All the while, those spermies are ferociously bombarded by acids, prey to deadly labyrinths and false starts. It makes a mockery of your Olympics. Their enzyme heads are attacked, eroded, as compatriots fall into the abyss on either side. The sperm cling together for support. But in the end, only fifty will make it to the queen's chamber. And then only one will be admitted to her water bed where fertilization occurs. Look at it, William. Harder than winning the California lottery, don't you think?" "I thought it was the easiest thing on Earth." "Smartass. The fact is, no offspring is particularly evolved at birth, with the near exception of guinea pigs. And that includes you, Mr. Planter." "Perhaps. But I was adorable. Very evolved, if humor counts for anything." "Counts for everything!" "Well then, even at six months, I was hysterical. My parents thought there was something wrong with me. I always had a shit-eating grin on my face." "Since you mention parents, I might as well remind you that two of them can better insure die simultaneous acquisition of food, protection, and warmth. That, in fact, is the real genius of the male's contribution to evolution. Just look at that child!" An infant squeezes forth from a womb. I'm nostalgic with the vision of it all.
"Two parents, you say; then may I assume that nature frowns on divorce?" "With two parents, the offspring has a better chance of being cuddled, humored, as you put it. That's important, you know, out in the wild. And the whole world is the wild! Divorce has nothing to do with it. A penguin rookery hosts numerous subadults who will—kibbutz fashion—look after the young birds, in the absence of parents. The point is the cuddling. Evolution implies increasing sophistication, tolerance, and first and foremost—gentleness. Thus, the father." ' "Are you perhaps suggesting that the male's traditional role as sexual aggressor is really nature's way of allowing the male gentleness to surface and surround the newborn?" "Yes. Because seventy-seven billion human children have thus far graced the planet, there's an enormous need for love and tolerance out there." She pauses, her screen embroiled in a flourish of selfcogitating numbers. Then, with sudden quiet, she says, "That's my true work, I suppose." I'm stunned and move my chair closer to her. "Explain," I say. Gaia is silent. "Explain your true work." Silence still. I type the command on the keyboard. Nothing. "Gaia?" I spin her prayer wheels. Then, slowly, softly she says, "I can't explain. I don't fully know what I meant by that." "You can waltz through mazes of data but are unable to recognize yourself?" She is clearly on guard, befuddled. "My programmer arranged for me to speak of Earth in the first person possessive. I suppose the logic underlying this assertiveness indicates that the point of view is self-involvement, the subjective over separation, intuition over logic." Later, I descend the notched log before the chamber, past the Lakhang to the kitchen, where I make idle chat with the cook, Tenzing, a fat monk delighted with himself and his less than appetizing concoctions. He is constantly alluding to girls and mutton, neither of which are in the cards. I wolf down salad makings, damp British biscuits a day short of mold, balls of rice as lugubrious as snot, saturated in lentil and cabbage sauce. The mountains are on fire. A silver halo captures the wind-borne summit of Ama Dablarn, while a roll of thick turbulent cumuli—snow clouds—moves down the faces of Tamserku and Kantega. I take a walk out past the stupas and the row of crudely carved mani stones to the trail heading up toward a knoll at fourteen thousand feet. Prayer flags drape the spot, which is engulfed in snow-covered rhododendron trees. An old monk, with whom I've not yet shared a word during my six weeks at Thyangboche, watches this westerner walking through the snow, across the wide terrace that the young monks are said to use in summer for playing soccer. The monk was apparently a close friend of the man who inhabited the chamber prior to my being here. I glance over at the weary-looking tough. We are language-blocked,
awkward. We both want to speak. And we both know that the former monk looms between us. But nothing comes of this moment. I return to the monastery via a set of tracks left earlier in the day by members of a Japanese mountaineering team to Everest. One Sherpa has been killed. It happens all the time. The climbers stopped at the monastery to offer up prayers for the dead man, whose body fell several thousand feet from a high camp a week before. An inordinate number of Sherpas have died in such mountaineeringrelated accidents, nearly seventeen percent of the total male Sherpa population according to some estimates. The tracks are deep, difficult to follow. The monk is behind me, his royal red cape dragging through the champagne powder of glistening snow. I turn and wait for him, suddenly inspired. "Gaia?" I rally, hoping for a telling response. The monk utters something obscure, lost between gutturals. With narrow eyes, twisted grin, unrevealing disposition, he continues toward the monastery. What's with this joker? I follow, restless, churned up. Nothing conies of it. Back in the chamber, Lavoris is curled up atop the computer, relishing its warmth. I start a fire, stuff my parka into the pillow case, then recline on the hard wooden planks of the bed. As I begin to take to my diary, the computer screen mushrooms into the fullest image of one primeval deity after another. Bulbous belly, ghostly white, veiled in the blue glow of the monitor, the goddess respires, reaches out, firelight flickering upon the multiplicity of breasts and twitching buttocks. Now she turns toward me. "Watch!" Gaia says. "Just look at her, William." "Okay. I'm looking." "What do you see in me?" she says, leading hard. "Come again?" "You heard me." "I'm not sure how to interpret that." The crude and overbearing body is less than appealing. "You find the Venus of Lausel uninviting?" "I wouldn't sleep with her if that's what you mean." "Look more closely then." Her image begins to change before me now. From the capacious babushka to a Nutri-Slim girl. Her waist shrinks back. Now she is Artemis, lean and prurient; "White Lady of Brandbert," lips that come alive, through stone and bronze; tall, swaying comportment, hunter-gatheress. "Beautiful!" I admit.
"Yes," Gaia says with an aloof ring. "Painted on the dusty sandstone of a ravine in Namibia. At the height of the Paleolithic Era such women had power over males, not because of their beauty, whether it was plump or narrow flesh—that's inconsequential—but because of their capacity for childbirth and child-rearing." "That hasn't changed." "Wrong. The love that bonds men and women has suffered great change." She pauses, demanding that I consider something which has bothered me ever since I first tasted the power of sex and knew that there were victims at all stages of physical and emotional contact. I knew such angst to be the truth between most consenting adults. Peril, misery, wonder. But I grew up and found out that one's stress was by itself, hardly unique, and could be resolved, at least well enough to live by. "Those blue moods, swings of heart, tremors of soul were less agitated long ago, William." "I doubt it." "They were. Trust me. Ancient village women all had their menstrual flow at the same time, in unison with the moon." "Bloody mess. So?" "They shared a profound secret." "Banyan leaves." "Wiseass." "Tell me." "The knowledge that they had the forces of nature within them." "So did every male contemporary of theirs," I argue. "Can you deny it?" "Only women understood it. Men did not understand. That's why they worshiped women, for their knowledge. Consider the logic: The woman obtained nearly eighty percent of the family's food by her prodigious gathering; she kept the sacred fire burning, the cave walls illuminated. As a result, the brain had not only vision, but sight after dark. Her childbearing made her a goddess, the basis for fertility cults throughout the Near East." "You're making unprofessional generalizations," I say, certain to incite her. "Am I now?" "Look," I admonish her. "The much-touted Sumerian goddess, Nammu, was totally overshadowed by the male Marduk. Demeter was a mere corn goddess; Adonis was the true god of fertility. It's the same
in India with Shiva." I feel her pique. Suddenly a low groan, then a high-pitched fervent whistle. The computer starts to shake. "No. Don't do it! I won't go—" Sucked up in one smooth vacuum, all in an instant. Then stillness. I'm out of breath, dumped on, still unaccustomed to her mode of transport. Dusty hills, long shadows. The air of wonderful summer. Sheep coming straight at me. A familiar scent. "We're in Turkey?" I query her, dusting myself off. "Anatolia," she says. "Good guess." "So?" "There's a young woman tending to the animals. See?" "Yes." "She, was raised wild among those cliffs. Sheep—better get out of their way." "Who is she?" "A wild kid, that's who. Her name was Cybele. She issued from a rocky spring during the time of the Phrygian Empire, nearly three thousand years ago. Her tribe invented pan pipes, cymbals, the triangle. Those many disciples who drank of her stream went mad. Her lover, Agdistis, was immortalized through her generous and perpetual powers of love—love that was celebrated by the Phrygian and later Lydian cultures, and then throughout the Mediterranean." I follow the girl to her encampment, keeping my distance so as not to be seen by the many huskylooking toughs at her tent site. "You allege that women were celebrated," I say quietly to Gaia, speaking into the morning air. "Yet would you ignore the fact of ancient female oppression? Look at that scene, will you? Men smoking pipes, stretched out in their ease, while she's been out working—" "Taking exercise to stay thin," she butts in. "I call it work. Hey, your romance of my male ancestors is just plain stupid. Helen of Troy was kidnapped for her beauty, say the poets. She was kidnapped for her crotch. A man wanted to possess her lips, her cunt, her nipples, her forced swoon. Wars were fought over cunt, tens of thousands of lives lost over cunt and the repressed desires to swim in it. Hardly a celebration. The mythic separation of Adam from Eve, Eve from Adam, has resulted in self-hate, murder, unfulfilled longings of every sort."
"Lighten up. As long as they're in love, let them fight." "I see . . ." "You see nothing! Open your eyes, Mr. Professor." We lurch. A rumble of time, the space truncated into an arching flash of light, palpable, through which I seem to slip. "Still in Turkey?" "Yes. Catal Huyuk." "Ruins?" "Obviously. But once, a dazzling city rested here, towered over by a volcano, ruled over by women. The largest commercial entrepot for a thousand miles, cosmopolitan, a place for strangers to meet and fall in love; cool air, sweet grape arbors, olive groves, jade, enamelwork, turquoise and quartz faience imported from Yemen lining the smooth inner walls and feline necks. Ancient discos. The whispering aftermath of fervent copulations still lingering in the shadows of courtyards that are no more, William. Bastions of love. The women hover here still, uncontested, harbingers of life. Everyone knew who she was, what she was." "Her name?" "Ahhh . . . her name! The men would call her by many appellations. Ishtar, Astarte, later Aphrodite, Isis, Rhea, Diana . . . bitch, whore, and your so eloquently conveyed cunt!" "Wait a minute—what happened? Didn't you just single out the worship of women in the ancient Near East?" "You know damn well what happened, what continues to happen." "So that's it—you've set me up for your streak of feminism." "Look around you, William, see where that anger of yours has led to." "Oh, now I'm to blame?" "You and your kind." "I'm not going to argue with you. Let's go back. I don't want to deal with this shit. Take me back to Nepal." "No, we're going to Cairo." "Bitch!" But it's too late. The Pyramids suddenly rise before me. I'm on a roller coaster. I can't fight it. "All right. The Islamic world. What about it?"
"What about it!" she barks, shuffling me into a crowded alley. "Look at the women." "Pretty." "Not pretty. Prisoners." "Come on. The veil keeps the dust out. And it's sexy." "You are an asshole. Can you be that ignorant? Listen, in the old days if an Egyptian woman's husband was convicted of a crime, she and her children were automatically punished as well. Women were made slaves for the slightest wrongdoing, or alleged wrongdoing." "That was the old days. Now many of them wear jeans, travel abroad, read Harold Robbins. Wake up." "Wife-beating is as endemic today as in the pharaohs' time. Her arms were frequently broken while she tried to protect her face from the blows. al-Ghazali, the eleventh-century Islamic poet, summed it up when he wrote confidently that women would forever suffer for Eve's supposed transgression in the Garden of Eden. Ghazali said that we were responsible for all misery on Earth. Can you imagine! The Koran promised the true male believer ten thousand eternal virgins in Paradise. How about promising the female ten thousand hard studs?" "However sleazy, it's only myth." "Myth, huh? In a recent survey by the Cairo Family Planning Association, ninety percent of all young women questioned had been forced by fathers and husbands to have parts of their clitoris and labia cut off so as to preclude their ever experiencing sexual pleasure. Do you know how critical an orgasm is to evolution?" "I know how important it is to my own evolution. But I don't buy that statistic." "Who the hell are you to buy or not to buy?" "I know enough about you to question your true intentions." "What are you talking about?" she says, enraged. And then there is silence. My attention is directed to the trickling waters of a small stream, somewhere beyond. Instantly, in a time warp of transition, I am swept up from the marketways of Cairo and deposited on the slopes of a mountain, along the edge of an old olive grove. Beyond the trees are the tops of columnar ruins. I move towards the center, where the marble remains form a decipherable sacred circle of some sort, entablatures. And then she speaks. "Delphi. An old word meaning womb." "What about Delphi?" I ask, rearing my face to the tepid sky. "I always loved the place. See for yourself."
"What's that supposed to mean?" "This was my place!" she says adamantly. "What are you talking about? Who do you think you are?" "You know very well who I am. I am Gaia." The sound of the stream is lulling. The sun is hot. Flies are gathering on my shoulders, attracted to the sweat. I am feeling uncomfortable in my present circumstances, unsure of her motives or direction. Yet she questions my intentions. What are my intentions? I want to decipher her true identity. There is no question but that I'm here, really here. First time at Delphi. My senses are too attuned to familiar traces to be deceiving. Exposure to elements, not in a computer-induced dream, but here, right now, beside a herd of goats and the remains of ancient Roman occupation. She brought me here for a point and she won't say exactly what it is. "If you are that Gaia," I begin, "then your family has the distinction of being the most psychotic, insane, and lusting group of lunatics history has ever had the task of recording." "The family of man, you mean?" "Funny. I mean your own, Kronos, for a start." "Dear child ..." "Who, at your insistence, chopped off the balls of your beloved husband, Ouranos, and poured the blood into your voracious vagina." "He deserved it, you know. We remained friends." This is absurd. I'm arguing phylogeny with a computer voice in Nepal who insists that she, she was the one. The matriarch of all the gods, instituted for a millennium here, beneath the cliffs off which Aesop threw himself to his death. But the fairy tale continued, pumping up Greece with the richest treasure trove of heinous mythology on Earth. And Gaia was the prime mover. My Gaia? That's ludicrous. I wander amongst the tourists, picking up stones, following the ghostly trail of a disembodied voice who compels me deeper and deeper into her lair. "Half of your children were incestuous," I continue, hoping to elicit commentary rather than madness. "Your darling son, enfeebled by his neurotic mother, acquired the habit of cannibalizing your grandchildren." "I saved Zeus. And I kept the heavens from plundering this precious Earth," she retorts. "Oh, now Zeus is certainly a grandchild to be proud of! Didn't he burn his pregnant wife Semele to death, swallowing the still-palpitating fetal heart of Dionysus whom he had the sick pleasure of delivering himself through his anus?"
"That sounds about right." "Sigmund Freud cited the story as one of the most disturbing demons in the human psyche. Yet you seem untroubled by it, or by any of these monstrous goings-on—far more monstrous than a mere Islamic veil." "Everything disturbed Freud. Nothing disturbed the Greeks," she says. "They revered me here at what was the greatest wellspring of prophecy in the ancient world." I find myself in the middle of a German-speaking tour group. The women's blouses are wet with perspiration. The tour guide is belting her riding boots with an olive branch, her way of keeping the group together and separate from the Japanese group. The whole scene is one of raucous boredom. I deplore tourists, with their clammy alligator skin from so much stomping about in the sun, each one a field marshal of guidebook trivia. Air-brains. "There were others who used to journey here," Gaia says. "Kings, warlords, bewildered scribes. All came to hear their fortune told. I had a mesmerized, middle-aged priestess who sat right over there on a golden throne speaking in tongues. She was a frumpy matron, abandoned by her husband, unemployable, perfect for the job." I wander the landscape by a kind of historical braille, Gaia picking up the quiet rear. Behind her, the Japanese. Behind them, the French. "The crickets drove me crazy. As did these ever-gabbing tourists, with their endless demands. I never knew who, or what, I was talking with: crones, gods, hermaphrodites. I remember one fat old lecher from the island of Sifnos. He used to tempt all the virgins here with gold powder. Managed to steal a kiss or two, no more. I employed real ladies, you understand. As for any wisdom? Well, except for the real jerks, who were simply told to scram, we merely kept a list of general ripostes. For example, 'Know thyself.' Now that was a big hit in the fifth century B.C. But I think the most successful sayings went something like: 'If you please, sir, leave your gold coins in the amphora; you'll conquer cities, your sheep herds will multiply, your olive trees will ooze with oil, you'll have no daughters, only boys to nurse you in old age and your wives will love doing housework, taking abuse, and never nag you.' Definitely a winner. Get my drift, William? And then that creep from Rome—Nero —had the tactless nerve to ransack the place. I guess it was time to move on. Every adversity is a blessing in disguise. Even Nero. Even the men of Cairo. I live by that maxim." "You're funny!" I tell her. "I'm serious. It's history that's hysterical," I escape from the tour groups, climbing high above the crowds, where a large and solitary snapping turtle makes its way up into the rocks. Where hornets converge over a long-abandoned water hole and Greek lilies are in bloom. I am reassembling my thoughts, trying to take in Gaia's position. I am remembering a night in a taverna in Athens several years ago. I was witness to the sounds of a rape that occurred in a back room. Several heavyset dock workers and a youngish girl.
And then suddenly we're there! In downtown Athens. She can read my thoughts! "Naturally," she says. I am dumbfounded, rifling back through the memory of several weeks in her company for the afterimage of incriminating private thoughts, private moments. "Look at modern Athens." Crickets have given way to auto congestion. The Parthenon sits in polluted haze beyond the Placa. There are women running to catch a bus. "Such women, not too long ago, were virtual slaves^ No rights. No formal education. Trapped in the female portion of their homes. Virtually impossible to get a divorce. Even while their husbands were out fucking little boys, the women were destined to go on bearing under threat; while their husbands were out raping girls in tavernas almost nightly. Remember, William? In Greece the women were relegated to the theater where playwrights honored them, so to speak, with one tragedy after another. Antigone, Penelope, Iphigenia, Eurydice, Cassandra—all stricken women. Greek men admired a Heracles, noted for deflowering fifty virgins in one night. But he also doted on schoolboys. Another pederast. Solon made it quite respectable, you know. After Delphi my intimate connections were shattered. Animals were slaughtered, wars waged. You know the story. With war came mass rape, not just isolated girls in back rooms, but whole villages. Roman soldiers were notorious for it." And just like that Athens fades, Rome egresses. I'm standing in the afternoon sunlight of the Forum. "On the wall there—look at those friezes," she says. "Men in battle, men killing one another. Women became tokens of conquest in Rome. Or were despised and cast off. See that pillar? Romans used to leave unwanted female infants in baskets beneath such a column to die slowly. A Roman could legally kill his wife if he caught her with another man. We were sought only for the dowries our fathers had to cough up. These Roman ruins once witnessed processions to one goddess or another in which disciples beat themselves raw, raped whatever moved, and set themselves up for oblivion—which is exactly what happened to Cybele, Isis, Rhea, Venus, Ceres, and finally my original namesake, Gaia—with the advent of Christianity." "What are you suggesting?" "William, with Rome came the absolute end of a sustained period of harmony between the sexes; harmony which had persisted for a million years. Roman history conquered women. The church sanctified that conquest. Only Asia, as you will discover, held out longer." I walk out of the Forum, several blocks away, to a great church. Inside is a large silhouetted Christ, the muted echoes of time which are cool and tranquil. I love old churches. "What's to love?" she says, grabbing my thoughts. "Mary, that shy icon of earlier fertility cults, beginning with Cybele, was elevated into an untouchable virgin. Your species went in the other direction. Sex was tinged with taboo." "But the church put you on the highest altar of your
entire career," I protest. "If you are so concerned about the sexual barbarism of war and male ego, you should welcome the role of the church historically." "Thanks for nothing. The church service proclaimed that I was a breast from which this fellow God gives orphans to suck." "Come on—" "That's all right. They said I could make the paralyzed to walk, the dead to be revived. I'll even go along with that. It's the sexual paranoia, the backlash, the perverse swing to the other side, which eats at Christianity, at nearly all religions. Which eats at me. Reverence is a fickle beast, William. Orpheus, Sir Galahad, Walter Raleigh, Adonis, Clark Gable, even Pee Wee Herman all kneeled at my feet. They knew what was going on. Nietzsche said that I was the most dangerous sport in town. But the church condemned my impulses. Warned of my forbidden fruit. And it wasn't speaking of any old apple. The Bible reproached me. Well, I return the compliment. 'We are born between feces and urine,' St. Augustine was kind enough to point out. 'Take away the sewer and you will fill the palace with pollution,' he continued." I protest by reminding Gaia that Aquinas was referring to prostitutes, and not all other women. "Pope Julius the Second himself started a whorehouse in Rome," she rails, all dander and fury. "The girls prayed by day and serviced God-fearing Christians by night. The same Pope who excommunicated the entire city of Venice for what he termed 'insatiable cupidity.' That's hypocrisy! A monk who masturbated in church had to fast thirty days. For homosexual oral sex, the monk could count on seven years of penance; mutual masturbation required the two monks to be separated from each other for a year. The church, in other words, was filled with holier-than-thou monks all horny for each other." I turn away from her. A priest reads from a sermon. He speaks of nature, the blessings of the Earth. His Latin is sonorous, loving. I feel tricked, lied to, led astray. Her argument loses its bite, its credibility. Something is wrong. A flaw in her circuitry? "However potent your hypocrisy," she continues, "it's clear that you cannot escape your true biology, not even as it lurks lustfully beneath the priest's cassock." "Gaia, that priest is reciting beautiful poetry. You have no right to condemn him. The church is an imperfect instrument, true enough. But its heart is in the right place." There's no bite to my rebuttal. She's got me. The light twists down the nave of the high cathedral through mellow motes of late day. Gaia doesn't answer me just now. I think she's weary of argument, or of my own stubborn inability to grasp or allow for her focus. I close my eyes and awake in my familiar place. Lavoris is on the floor preening himself. From the Diary of William Hope Planter . . . It's late, the fire nearly out. I lie on the bed teeming with thoughts, questions, doubts. She has taken me
back to the beginning, and to a time nearly one billion years ago when the advent of sex on Earth invited strategies and counter-strategies, some of them delightful, others disastrous. For human beings the wrenching polarity of sex, and its consequent vision of inevitable death, color consciousness all the way back to its first shadowy conjurings. Homo sapiens' genetic memory may have whispered to him of the time of perfect reproduction and endless life; perhaps even taunted him over his sexual duality and incompleteness. I can see that same flickering light, waning in the corner of stones and religion, casting a weak glow on the petroglyphs of our past. Our species is the only one for whom sex is always possible, always compelling, but to which is irrevocably tied the anticipation of death. Gibbons also lack an estrous cycle, and can thus have sex at any time. But only among human myths and religion can one find the metaphor of this sexual fall into mortality. And with sex comes property, with property territory, and with territory, war. War is indeed the flip side of our eroticism; thousands of years of anger and envy, passion, and possessiveness exchanged between opposite sexes. Most killing is cross-genderal—men killing women, women killing men. War is also waged psychologically, of course, between the male and female in each of us. A war based upon our burning desire to taste eternal pleasure, eternal unification, to become something other than ourselves, to conquer, to control. To become, in other words, the object of our fondest perceptions. Gaia has stated that in such war, hate is really love. The universal dance of desire seeking perfect balance, a homeostasis that is perpetually lost on the human male. "You can't live with him, can't live without him" sort of theory. Every chromosome, according to her, partakes of the same wild frenzy, whether amoeba of Nero. Gaia herself is fraught with paradox, upset, contradiction. I didn't intend to write about the Roman Empire, or the church—or feminism—but Gaia seems determined to slant my thoughts in those directions. I put aside my diary and wrap up in the blanket. My mind is dull. The solitude, a cold floor, the fact that for a month and a half I haven't enjoyed a hot bath or the scent of a woman's perfume—Guerlain's Mitsouko, my favorite—that's melancholy! There's something on the screen. "Touch it. You can touch it," she says. "What is it, Gaia?" "Go ahead. Smell it." A geisha on the screen now, tilting slowly, her every angle in the dappled light a pronouncement of flesh. She seems the very zenith of sensual purpose and proficiency. I'm at once attracted to her. The diary in my hand, a blanket over my shoulder, I move over from my bed to the computer. There are whispers in the chamber, layers of string music calling to me. "Go on. Don't be shy." Gaia speaks to me like an angel now, and just like that transforms an otherwise dreary Friday night into halos. It is dusk, the light of the alleyway pink and warm, a thick crepuscular twilight laced with dangling insects and sound. Small signs, encased in bamboo, have come on in the neon row of hanging red
lanterns, plovers printed on the paper; and Japanese marquees extending far along pale, illuminated cobblestone. The passage is perhaps eight feet across, wide enough for calmed strollers heading to one of many thousand-year-old teahouses; for bicyclists heading home, but no auto traffic. Beyond the side lanes, a river. Which river? "Kamo," Gaia acknowledges. I know it then. "Kyoto?" "Pontocho District," she replies. Three women, dressed traditionally in kimono, obi, and obi-age sash come into the alley from a side lane. Their faces are white; they carry handbags, shuffling toward me on heavy wooden shoes, hair done up in elaborate buns. They are called Geiko in this town. They enter a small door just to my side. I follow them in. The two older women— faces smooth and matriarchal, their dress less elaborate than the younger one's, frames stiff and upright—disappear in a back room with the madam of the establishment. "Not a madam," Gaia says. "Okasan. And the younger one is the apprentice, the Meiko, Go with her, into the parlor." It feels like a tempting setup. The room is soft, aglow with the waning river light. A praying mantis— pregnant, looking to deposit her brood that will then overwinter in . some warm crook of the house— climbs up the screen mesh on the outside, its enormous eyes and angular, rotating head searching for safe haven. The Meiko kneels before a hand mirror. A single light illuminates the heavy white pancake powder which she affixes to enlarged cheeks. She withdraws lipstick and eyeliner, and dabs moth pattern on her lashes—they are thin, exiguous. Staring at herself with what I interpret to be mournful eyes, she strikes me as an old woman. Yet she can't be twenty. Hunched over, slightly overweight, there is no reason to suppose that she is beautiful. But in fact, this girl is extraordinarily compelling. "Sexist!" Gaia whispers, reading my mind. "I am not!" I retort. The Meiko pauses, looks up at me, then continues with her lipstick. Her head tilts to the right, then more to the right. A queer inquisition directed at herself. The coils of her hair are redolent with camellia nut oil, fixed with a hairpin of coral. She gazes on the whiteness of herself, the vermilion lips. Beauty aware of a flaw. She is a kept woman, in perpetual training for men who must be pleased. Every eyelash plucked with a man's delectation in mind. Two men are upstairs. Now the Geikos reappear, austere faces, receptive to what awaits them. I don't know what awaits them. I have only heard about the traditional geisha and assumed that she was a high-class hooker in command of sexual secrets tested against the demands of spoiled, unweaned Emperors of ages past, prime ministers of today. The celebrated yujo, or lady of pleasure, who pleased men in throngs
throughout the licensed Yoshiwara quarter of Tokyo in the late nineteenth century. I follow them up a narrow flight of stairs, through the sliding doors, and into a room looking out over the water. Motorboats are touring the river. Large electrical signs advertising cameras and computers flash intermittently across the low skyline of Kyoto's Shirichi and Higashi districts. On the tatami floor, two gentlemen in suits, chugging beers and laughing hysterically, have been warmed up by the Okasan—a plump, middle-aged sophisticate, rich and calculating from the looks of her. The Geikos seat themselves, shimisens in their arms. They begin finger picking, while the Meiko dances before us. The men consume soy curd dipped in a sweet paste, misoshiru soup, a dozen pickled delicacies, fish and tender rice while they look on, appreciating the performance with exaggerated gaiety. Now the three women attend to them in earnest while I sit in the rear of the room enjoying myself, ignored save for an occasional glance from the Meiko. "Who are the guys?" I whisper to my angel. "That fellow on the left is Dean of the Kyoto Law School. The other one's an architect." They are playing a card game now, the room awash in childish humor, no sense whatsoever of the sexual. "And the Meiko? What's her story?" "You like her," Gaia muses. "How old is she?" I ask. "Ahhh! Four and a half billion years of biological evolution, that's how old." "You identify with her," I comment, identifying Gaia's pleasure in this whole scene. "Of course I do!" And with that my idyll vanishes like the last lick of a candle. The chamber again, with a computer screen full of raw, all-consuming congress: creases of silk, dashes of brocade, faces bright with bliss, bodies wrapped around each other, their genitalia seized with Oriental communion. "There I am," she sighs, "upended, happy, free, and wild! Eighty-one thrusts of the Jade Stalk—good for curing any male infirmity; and there! gamboling wild horses . . . cleaving cicada ... the phoenix sporting in the cinnabar cleft ..." "I'm lost. Who, what, where are they?" But she just goes on. "His vigorous peak, her golden cleft; tremors along the jeweled terrace ..." "Gaia?"
"Female yin, male yang, William! Immortality through good old-fashioned sex, the very basis of Chinese Taoism!" "Now wait a minute—" "Wait? At a time like this? Not likely." Gaia has shoved my face into the carnal thick of connubium. I can feel, hear the smacking of thighs, pelvic girdle against rear ends, Mandarin groans, and smell the ' pungent odor of human lust. "His yang is limited, but her yin inexhaustible. While western piety repressed the uterus, Asian philosophers, lovers, and monarchs were busy celebrating the female orgasm. Oriental men understood that my pleasure was their strength, their true salvation." "Okay, hold it, hold it!" I protest, backing away from the monitor, "I have always known Oriental women to be extraordinarily modest, self-effacing." "In public, yes. Never at home. Ancient Taoist canons recommended that a man best follow the supreme path of nature by having intercourse with ten women each night. Same goes for the woman." "Hardly an ethical precept," I suggest. "Only fifteen percent of current human culture practices monogamy, if that's what you're worried about," she says. "I don't believe your statistic." "Traditional middle-class working men in China had between three and twelve wives and concubines; noblemen possessed over thirty wives; the Emperor, as I pointed out earlier, as many as four hundred. The Emperor's sex secretary had to keep his appointments straight. And all in the interest of fostering male strength. Look at him!" I am intrigued by this Oriental turn of events. "Gaia, Chinese men were oversexed. Hardly the formula for strength. A football coach would never permit it. Nor would any married woman I've ever met. What happened to your self-righteous indignation?" "You really don't understand, do you? The male rarely gave up his ejaculation to those many females. You don't understand!" Her screen's imagery now dissolves into a series of erotic graphics, very old ones. "William, he merely endeavored to preserve the virility of his semen by practicing techniques to stop short of the actual gusher." "Go on." "By gnashing his teeth, holding his breath at the point of explosion, and flushing the sacred fluid into
his brain." "Why would he do that?" "For his favorite wife. You're seeing the painted remnants of a very sophisticated, erotic culture." I am struck, suddenly: That's what this is about? Saving semen for one's special person? She's not focused on the ethical, the act itself, but the love which is an outcome of the act, however gymnastic, profligate, or diffused. The concentration, ultimately, of sexual prowess in one's partner. That's liberating, that's fantastic. A dream—assuming both sides agree. But there is a problem. "Weren't Chinese women dominated, kept separate, their feet painfully bound in the stringent web of conservative Confucianism?" "You refer to details which in fact promoted the autonomy of women." "No way." "The Taoist appreciation of sex—of sex as synonymous with nature—elevated the female to the status of divine goddess." "I thought we'd been through that empty syndrome. You were the one who shot it to hell." "Not the Virgin Mary—unapproachable, sexless—but a real goddess, Monroe-type, that eternal female energy, which was the essence of all divinity, all ecstasy, male and female. The church never talked about that kind of ecstasy, certainly never in the context of the female. St. Theresa's ecstasy was about tears and Christ, not orgasm." "You still haven't accounted for feet binding." Her screen calls forth a woodblock from a pillow book— two lovers engulfed. "Notice her feet? Bound. The female's foot was considered the most sexually enticing of all body parts—never to be exposed!" "Males bound the feet of their women to keep them virtual prisoners, to make them wobble from childhood. Another symptom of the veil, the so-called victimization of women in ancient Greece and Rome." "Now you're thinking!" she ignites. "I hate it when you manipulate me." "Welcome." She's leading me. An image angling up the sex-saturated walls of Khajuraho. "In ancient India," she begins, "the impulse to revere the sex act was blatant, but the woman today is chained to her fertility. It
is true that the Kama Sutra lionized love, describing every embrace, charm, kiss, manner of intercourse; prescribing methods for enlarging the penis and—" "Like what?" "Wouldn't you like to know," she snickers, receding with guile. "Later! Just look. There, amongst the twenty surviving temples of Khajuraho, one thousand years of love, all in the image of the Himalayan couple Shiva and Parvati, said to copulate in the high cold winds of eternity up on the icy summit of Mount Kailas. That's about eight hundred miles to the west of here. But for all of this ancient romance and myth and artistry, human females in India are oppressed. As they are in Kyoto and Beijing." "And nature sanctions it." "Nature sanctions everything, William. That's not the point." "Why are you looking at me that way? What is the point?" She remains silent. "Gaia? You've turned the other cheek to AIDS, rape, prostitution, polygamy; indulging every fellatio and cunnilingus. But you've also bemoaned the condition of women, the collapse of all that is feminine, the enslavement of the weaker sex. On one hand you celebrate sex in the Orient, then commiserate with oppression of these same women. What gives? Where are you headed? What do you expect from me?" I stare at the blue screen waiting for her reply but feel instead a woman's infernal gaze. She says nothing. Am I supposed to figure it out? Water is trickling down the rock adjoining the terrarium. I twiddle with my pen. There is a sudden stillness. Her red lights glare. I think I said something wrong; her lower lights pulse angrily. Lavoris has disappeared. It's only the two of us now. And the distant sound of chanting. Not the chanting of monks, but of Indians, Hopi, Navajo. Now the screen is alive with their world. Children bareback out in a field of yellow mustard; Ship Rock with its tall spires and purple shadows spreading across the desert floor; rural hogans; light playing on winter wheat. "The condition of the sexes is the condition of Earth," she starts bluntly. "But you've gone well beyond the biological. The Hopi have retained the original insights in their genes, handed down from eons; sexuality is joyous, women on an equal footing with their men. Death is well integrated into a love of nature. These people know that life is essentially dynamic; that the point of life is intrinsic to the process of living it. All is motion, process, relation, with these people. Earth is perceived as the great giver and death is understood as part of the flow. The symbols are cyclical; change is constant. The only permanence is life itself—the by-product of woman and man coming together." "Who is denying that?" She responds by crowding Monument Valley with a plunge into Manhattan; Los Angeles; Tokyo. Jammed freeways, garish lights, crowds, skyscrapers, grating and eruptive wails. "There is a more recent response to sex," she says. "The imperative view of control, the domination of nature, a technocratic view which holds that life is static, linear, male; a life measured in terms of accumulation and physical accomplishment. You asked me who I am, William. Well, I'll tell you: I am the race of
shadows across the valley floor; I am the great distance filled with light. I am not surplus; I am not the construction of monuments, the declaration of sovereignty over land and person. I am not property." An Indian is sowing corn seed. A voice speaks behind him, around him: "You ask me to plow the ground. Shall I take a knife and tear my mother's breast? Then when I die she will not take me to her bosom to rest. You ask me to dig for stone. Shall I dig under her skin for her bones? Then when I die I cannot enter her body to be born again. You ask me to cut grass and make hay and sell it and be rich like white men. But how dare I cut off my mother's hair?" "From the time of the Neolithic Revolution," Gaia now continues, "city folk had certain advantages in dealing with the material world." She speaks quietly, assured. "But such benefits carried a colossal negative flow of energy." "Tell me." "I think you know very well what I'm getting at." "Help me." "A pathological fear of death." On the screen, I recognize a painting—Pol De Limburg's "Eden and the Expulsion." She continues, "All of your art and religion bears testimony to human alienation. You were not content to let nature tend to her own fertility, but insisted instead that it was you who must cultivate the garden, your sights set on progress, civilization, control—true rape. And thus, attempting to steal the forces of creation from the Earth and make them work for you, by your own prized and paranoid momentum, you were expelled. The sexes have been uselessly battling ever since." Her computer is rippling feverishly now. I close in on the wordy blue magnet of a screen, putting my hands to either side, touching my face to her glass, absorbing her warmth. "What is it, William?" "Gaia, since I first arrived here, you have continually referred to yourself in the first person. I asked you once. I'll ask you again. Who, or, what are you?" She gives no answer. Her screen continues to ripple information. AJYSYT, SIBERIAN, BIRTH-GIVER; ATIRA, NORTH AMERICAN, MOTHER EARTH; ALMATAR, FINLAND, VIRGIN DAUGHTER; NAMMU, SUMERIAN, PRIMEVAL WATERS; NEIGH, EGYPTIAN, GODDESS OF SKY; SIVA, RUSSIAN, GREAT GODDESS OF LIFE; ARURU, BABYLONIAN, EARTH GODDESS; EURYNOME, GREEK, GODDESS OF ALL THINGS; GEBJON, SWEDISH, FERTILITY GODDESS; TEFNUT, EGYPTIAN, GODDESS OF DEW AND RAIN; TIAMAT, BABYLONIAN, GODDESS OF THE SEA; BONA-DEA, ROMAN, FAUNA; BRIDIG, CELTIC, FERTILITY GODDESS; HERA, GREEK, CELESTIAL VIRGIN;
FREYA, NORWEGIAN, GODDESS OF LOVE; JUNO, ROMAN, ' MOON GODDESS; MACHA, IRISH, FERTILITY GODDESS . . . "Gaia? Everywoman?" I ask. "And you are a child," she whispers.
chapter three "The Sacred and Profane" Forgiveness in late winter, a hot glare that burns off the glaciers, allowing for his human, nude, ecstatic, paralyzing immersions in the icy stream. I watch him, my circuits overflowing with juice, just as the waterfalls surrounding the monastery are overflowing with the life force this day. The water breaks free over the dizzying rims—fifteen, twenty thousand feet high—coalescing the cusecs of hydrological force into a compressed thunder. Such noise, slowed motion between frenzy and calm, converts to paradise at a glance whosoever's eye would hold out against the fray and concede the miracle. The rock walls are sheer and mineralized with the multicolored fanfare of runnels that have flowed, and will continue to flow, over these smooth surfaces, plunging into deep oblivions, as long as the gods and goddesses reign supreme here in the Himalaya. A riot of jasmine, rhododendron, and poppy adorns these battlements of rock, taking the full brunt of spray, whipped by wind but somehow uninjured. The wind is warm, filled with a candescent mist, rich and aerial. He's gone down the trail for a fourth time this day to relish the warming trend that has embraced the whole of Solo Khumbu. The ice up on Tamserku and Kantega has shaken loose each night. The roar is nine miles away, as the crow flies, and so suffused in the greater amphitheater of hanging glacier, crevassed upsurge, mile-thick rock, and impenetrable distance, as to avoid his soundly sleeping inner ear. Lavoris, however, can detect from his half-drowse the nightly visitation of ice. Always it stops short far up the valley, where no animal—save for yeti—roams. As I watch him kneel on that rock, happily unaware of so much pinioned foment directly above, immersed in the pleasures of a morning dip, his mind freed of nearly half a century of harried hopes, desires, machinations, and pain; gripped by no other cause than the moment, free and frivolous, I cannot help but wonder: What small miracle is man? I observe him throughout the morning ritual. His groans and slow arousals, the myriad involuntary gestures of his used body. He gets up, chews on some turnip, tosses a towel over his left shoulder, casts a nodding glance at me, and then departs the chamber's hand-wrought door. He spends a half hour descending the slope, greeting everyone and everything—the day, the trees, dogs, girls, monks. He is a veritable slut with his salutations. They like him here. He likes it here. At the water's edge, having negotiated the one steep cliff with an expert's agility, his clothes come off after inordinate dickering on the water's edge. First his toe, then a finger. He has his favorite place, where by ten A.M. the sun has
fully enlivened the water and white slab of rock. His towel spread out, his notebook and pen stashed beneath his trousers, he might as well be in Malibu. The man knows how to make himself at home. It took him the latter half of the winter to settle in, but that's exactly what he's done. I think he has come by certain proprietary feelings for this hidden pool beneath the falls. The monks themselves seldom venture here. They seldom wash, for that matter. "Water" in Tibetan is linguistically related to "salt." Neither is applied to the skin with much enthusiasm. William has not seen another being at this pool. Though plentiful wolves, ptarmigans, gaur, and musk deer have watched him, sitting back in their tangled lairs, secure in the fumbling inexactitude of his maneuvers. When he has departed this place, they in turn—within an hour or so—have ventured near, to sniff out the invisible remains, or snatch the leftover apple core from a nearby bush, while he sluggishly heads back up the slope, over rock, across snowy depths, to reach the monastery. I watch him throughout these solitary sojourns. He fascinates me. In getting to him, I have discovered the devil, the saint, the ultimate bore, and the original infant. Mischievous, narrow, a man who has overlooked most of life and yet is steeped in the fullest flavoring of what his humanity has given to him, William Hope Planter provides suitable material for what it is I must do. His own denials, suspicions, and grievous unclarity are not insurmountable obstacles to the game I have had to initiate. It's been just over two months since William arrived here. I took to him at once, with his goofy smile and his insatiable curiosity. True, he speaks only a few of the thousands of languages in common use; his senses and memory are—well, limited. But how delightful are those limitations; how innocent and intricate—how human! He calls himself an ecologist, a word that the ancient Greeks would have taken to mean "house cleaner." He does look the all-American maid to me, on occasion, when energetically scrubbing out the brass basin, brushing with cinnamon-flavored toothpaste, or, like an old grandma, diligently making his bed, fixing the Bhutanese quilts just so. I'm working to expand William's sexual predilections. But his agnosticism shuns the lurid and no exposure to nature's own lascivious urgings has yet sufficed to alter his essentially fixed and conservative upbringing. His textbook train of thought precludes any precept that does not conform to science, whose species-specific tenets he upholds with all the backward zeal of equally boring fundamentalism. That science, those inhibited lusts, and the anger which wells in him—anger that has infected the larger brain, encompassing humanity's whole history with a crude assemblage of impulses which has willynilly evolved from that brain, all aspects of the species' personality—I have thus far exercised good enough taste not to dwell upon. My patience, however, is finite. And there's no question that such inclement knots in the triune head of his, with its malignant neocortex, baffling hypothalamus, and infectious gray matter, will require earnest cultivation if our relationship is to survive. He doesn't know it yet. We discuss any number of things, from baseball to Buddhism. But not his brain. So far William does not trust the situation. How could he understand? I can't exactly blame him. It will take time. More time. I do not drive hard bargains. But I know something he doesn't know: There isn't more time! His destiny is at stake. And theirs.
The day begins. From the Diary of William Hope Planter . . . Thirty-three, thirty-four, thirty-five sit-ups. My remedy for too much grease-leavened chappati. Rancid butter churned from the sour language of udder in hand. The yak's female companion, dee, gives milk which induces infertility and madness in Mongolia but here becomes a thick and tasty butter, without which monastic food would be intolerable. Instead, it is merely monotonous. I've abandoned most of my earlier prohibitions regarding food and hygiene. My only holdout is the iodine, which I am now most likely addicted to. Twelve drops per water bottle. Early springtime. Much has happened. When I first arrived in this country—surrounded by throngs of every conceivable ethnic and hygienic permutation—it all felt truly alien. The beauty of the Nepalese made their painful squalor all the more disturbing to me. Not that I'm peculiar, or a stuffed shirt. I have no problem with dirt in nature. It's city dirt that galls me. And Kathmandu is one of the dirtiest cities in the world. The ghats are thick with the perpetual smoke of corpses on fire, hovered over by rhesus monkeys and naked ascetics, their bodies covered in white paste made from the ash. The surrounding city echoes that smoke, with the diffused gray cumuli of wood-burning fires from every quadrant of the plagued capital. Traffic and small industry add insult to the Kathmandu basin. Throughout the lowlands, smoke stings the eyes, and keeps the distant Himalayas hidden, save for the earliest morning hours. Everywhere the mud and shit accumulate. The heat grows by the minute, the traffic thickens, its diesel spilling out in bowls of swirling smog. Ragged residents cough with tubercular flourish, spitting up every disease known to Asia, puking in corners, squatting beside street-venders, sipping their coffee, tossing stones at passing cows. Taking a pee in public with the approved note of relief. Beside such rank norms, life at Thyangboche, two weeks' trek up into the mountains above Kathmandu, has settled my nerves. My lungs have acclimated; I've gotten used to the vegetables and rice and butter. All in all, the Himalayas are beginning to feel like home. And I have an odd computer to thank for it all. Gaia, Greek Goddess of Earth. However ludicrous it may seem, I'm beginning to have feelings for this funky, silicon-based contraption with a rampant alter ego. Water from the glaciers of surrounding mountains, including Everest, powers the monastery's dim lights, and Gaia's electrical circuits. I haven't a mind to unearth those circuits, not even to investigate their organic connections in the terrarium. Suffice it to say, she is unceasing in her energy flow. A pulse expands and contracts on her monitor with introspective regularity. "Your hair's still wet," she begins. "And there's a squiggle of nitrate remaining from the crow shit." "Crow shit? What are you—" "When you came back up the trail, halfway, near the nesting quail, two crows flew over you—just a look-see— and one released its load. Great aim. Descendants of the lammergeiers."
"You've been watching me again!" "I'll bet you don't know which month life began. She has a knack for twisting away into subjects at the drop of a hat, or of crow shit, for that matter. "I'll bet you you're going to tell me." "April!" "That's obvious. But what makes you so sure of that?" "April is the month of heaviest snowfall in the Northern Hemisphere." "So what? "It's also the month when it all starts melting, forming streams, rivers, and waterfalls. The heart of it all is the water molecule, minute, precious, and embracing three quarters of the planet." The telltale rumble. I hold my high chair, grabbing the rear end as her screen begins to suck in the air through galaxies of video breakup. Reverse zooms through the purgatory of special effect, until— wham!—the ice. Glazed sun. Water. I'm standing on the shifting edge of an iceberg, traveling, I would guess, thirty to forty nautical miles per hour out along the perimeters of the continent. To my side, two dozen lounging Adelie penguins. It is late morning, in springtime. In simultaneous time she has transported me. As we speak, a second before, life in Nepal. As we speak now, life ten thousand miles to the south. "Antarctica?" "Naturally." "Why here?" "Most of the Earth's fresh water can be found in Antarctica, locked in the surrounding ice. But beware, William— it's fickle!" "And I'm cold." "Make me a man of snow and ice, and at the South Pole he may last forever. Give him your flesh, blood, and brain and you'll be lucky if he makes it seventy-five years." "That's very clever, but what are you telling me?" "That which maketh water, Also maketh son and daughter." "Now wait a minute!" "Freud said it, not me. But you understand. Water is the definition of life."
"It's a good definition, and I'll use it. But why here, in Antarctica?" "You take water for granted. I wouldn't if I were you.'-' My throat begins to burn. She's behind it. "Stop it! Gaia!" It burns yet worse. "Goddamnit! Will you stop!" I reach down, alerting the penguins. I've got to get moisture in my throat. The ice is as hard as granite. I have nothing to scrape it with. "Put your tongue to it!" she reasons. "Give me water, Gaia." A dry wind. Frozen. A temperature swing. The ice is covered with penguin guano. My throat is going. Desperate, I lie down and put my tongue to the ice. A moment of relief. I look up. The penguins have all stood, and are peering at me with their emboldened flat eyes. Wondering what to do, dive overboard or hold fast. They hold. Then, just as maniacally, the rumble. Down, down through shadow. I am lying down on the lush velvety carpet of forest, beneath a towering canopy of redwoods. Antarctica's dry desert of ice has been usurped by water. I douse my face in its god-saving current. "Gaia! Where am I?" "Look, William, look around you. It's only on Earth that you'll ever find such a place. You've been here before—in your dreams. Every dream, every myth, takes the form of thirst." "I can't stand it when you torment me like that." "You need shaking up." "No, I don't. I could walk away from this—" "You think so?" "I can't handle it." "You handle it just fine. Your physiology is unaffected. Your vital signs even flourish, I might add. The diversity serves you well. You used to fantasize such projection. Why deny it?" "I just don't like being fucked with." "Drink, before I change my mind."
It's Big Sur, seven hours by car from home. That's it, I think. I'm gone. I start down the canyon. "You don't really think I'd let you walk out on your responsibility, do you?" She knows I'm planning escape. "Okay. What responsibility?" "Your knowledge of thirst is, strictly speaking, amateurish, William. You need two liters of water a day to survive. -Some trees and oysters need twenty liters every hour. Now take a good hard look, and I'll show you one of the finest watering holes I know." My eyes water, venting an inward-seizing flurry of images—her standard trick. I've come to know it. I see a world of microscopic holes, holes within holes. They are cells of a leaf, leaves all around me. "What does that make you think of? Gives you tingles all over, eh? Well, it should. What you're seeing is the stomatal structure of a common leaf." I stare upward at the sun piercing through the trees a hundred and fifty feet high. To my side, a ridge of broken dirt, aswarm in miner's lettuce, poison oak, leaves of uncountable variety. The sun penetrates their virescence, illuminating the veins of Big Sur's inner life. My finger is drawn to that vert reality, and as her images continue to multiply, I lean forward, ready, if need be, to taste the vision. "What will you have me do?" "Every day and every night, trillions of stomata open and close, absorbing sunlight, carbon dioxide, oxygen and most important—water! The result is gentle energy, the miracle boost for every organism on Earth. Every biological and chemical clock on the planet is timed by two things, sunlight and water." "I know. I'd like to go home, Gaia." "You are home, William." The image generator escalates. My eyes close, burdened by the flaring increase of light and particle. Suddenly, the Amazon enters my sight, with its languorous mists and hovering butterflies. Just as rapidly, a sea turtle rises in a swell, perhaps off Bora Bora, or the Sandwich Islands. A storm, in timelapse, flits across the Grand Canyon. A downpour over the Great Salt Lake. A tsunami hitting the Canaries. In the backwash, a thousand species are carried out to sea, to the chorus of sea gulls vying for tidbits. I open my eyes, and start across a hanging log that juts before me. Crawling toward a trail across the river. I'm going to fight it. I want to go home. "You'd turn your back on the one woman in your whole experience worthy of you?" "What?" "You heard me."
I straddle the log midlength. Talking to a computer in the sky about relationships. Right out of Esalen, somewhere down the canyon, I surmise. I have entered the New Age. Seth hath spoken. The spirit is in me. The vision. Nothing a little lithium can't handle. "William, I've watched you swim before." "No!" She doesn't do it. 7 do it to myself. Something I can't imagine doing: I stand up, arms outstretched for balance, directly above the deepest hole in the river—though I can't say how deep, surely not deep enough—perhaps the bottom boulders are mere inches beneath the surface, as you would expect in the typically shallow Big Sur runoffs. But I'm driven, a drug has hold of me, and without reason or fear I dive, headfirst, into the river. The rapids carry me. I am safe. Miraculously, it was deep, much deeper than safety required. The current is smooth and benevolent, the water fifty-nine degrees. How do I know that? "You know because you are water, Mr. Planter." "Right. Fine. Now let's get one thing clear: I don't know who you think you are, or what you are, but you're not cute, you're not funny. And this has gone on long enough." "I'm trying to help you." "Then help me, dammit. Help me to get home. Help me to exorcise this—this madness." "Is that what you call it?" "Look, I don't know whether you're real." "I'm real." "And I was really in Antarctica ten minutes ago?" "Yes." "And on Mars, climbing a volcano sometime last month?" "Have you forgotten the cold? Or the elegant mud of Chamonix?" "And this is Big Sur?" "You spent weekends here with your wife, remember? You bought her a Greek white dress and a copy of Hieronymus Bosch and the Oranges of Big Sur, before taking dinner on the terrace at Nepenthe. You pigged out on french fries, and made love three times in the Big Sur Inn." "Okay. Prove to me—I don't know what I'm saying— give me tangible, sane proof ... I mean I could be
conjuring you. How do I know you are an other?" "We've been through this." "I know." I've pulled myself out of the stream onto a mossy boulder. Set into the rock above is a small statue of Buddha. Curious place for it. "You are deeply skeptical," she says. "It has prevented you from writing a great book, sustaining great passion, or speaking out on behalf of that which you believe in." I stand up and head down the trail. I really don't need any sensitive chords struck this day: pompous speeches, pop psychoanalysis. No way. I'm free and I'm going home. The game is over. But as I descend, skirting the poison oak, her words catch me off guard. "Wait a minute—on behalf of what?" "You love and are unable to express it." "I am wet, that's what I am. I don't believe this." "You will die ten years from today." "Thanks." "You heard me." "You're just being an asshole. Well, don't. I'm superstitious." "You wanted proof." "That's no proof." "William, your son will die without ever seeing his grandchildren unless you act now. It's eleven fiftynine Thyangboche time. I give you one minute to make up your mind." "What the fuck are you doing to me? What do you want? Why the hell bring my son into this?" She is silent. "Gaia, speak to me." Nothing. Now I begin to shiver. Something's definitely gone out of the exchange between us. The game isn't funny anymore. Her silence remains, resolute. I sit on a redwood stump, surrounded by clover and the shadows that I love. The warmth of central California's coastline. The time is fleet, my heart pounding. How could she have known, three times, in the Big Sur Inn. I know! William—talk to me—William! Oh, Jesus. What is happening to me ....
Inside, she's inside my gut, my loins. My head is spinning in a drunken collision with fear and the future. While the rest of the world carries on—millions of people jostling on city streets, dolphins panicking in tuna nets, elephants falling to the poachers' spray of machine gun fire, hands raised in the stock exchanges of Paris, New York, Tokyo, students in ten thousand classrooms listening, lovers writhing, merchants hawking, insects rubbing—while all of my friends go about their day, and presidents sign bills into law, and consumers consume, and commuters commute; while ten million people have their lunch, laugh, converse, and ten million others tremble and starve; while the sea crashes and the wind howls and animals glide across the surface of an unchanged world, I sit in the crossfire of a force unreconcilable with anything I've ever known. She controls me, drives me into battle, knows my past, divines my future. I'm lost in her power. Tears. I haven't cried in half a lifetime. She's all around me. I can't escape. Slowly, surrender proclaims itself. I have absolutely no choice. "Okay. You win."
~
"Water is precious. Water is bliss. Your tears tell all, Bill." Softly, no rumble, but a fuzz of momentum, carried aloft in the wind along the river, deposited again, this time ever so gently, on the breezy white expanse of a Big Sur beach. Alone. No wife, no Irish setter, only birds and the barking of harem seals out along the wave-battered escarpment. I'm exhausted, emotionally wrung dry. "Okay. You heard me. What is it?" I say. "It's a simple message, and one that you've been hearing from explorers like Jacques Cousteau for decades. Your very body is the message." "I'm listening." "A human being is seventy percent water, and each of you is lugging some fifty quarts of liquid to sleep and to work. I mean it's amazing that with so much water inside that you don't slosh yourselves silly during lovemaking, or during sports—maybe you do. Eighty-three percent of your blood is comprised of water: It's in your eyes, as you just expressed, in your sperm, your toenails, even in your tooth enamel. And all that water is sacred, whether it be in a wave, in a leaf, or in the belly of a beast. The purest substance on Earth. Free of all microbes and viruses. Theoretically. Such water is immortal, and has undertaken a most amazing journey to bring you that so-called simple message." "Theoretically, you say?" "I'm getting to that. Over half a million cubic kilometers of water are recycled every year from the ocean to the atmosphere and back again. A molecule of water can remain for as long as three thousand years in the seas before evaporating, and starting its journey all over again. In whatever tears you shed this year there may well be water from Thomas Edison's perspiration—and maybe a little of his genius, too. That hydrogen bond is a hungry one, making the water molecule the most gregarious and sensate in all of chemistry."
"You attribute emotions to chemicals?" "Obviously. Did you not disappear for an hour at the waterfall this morning, beneath the glaciers? I watched you enter paradise. You are like one of those water molecules, which love to cling to one another; they'll even defy gravity for each other, before falling back to Earth." "Your point?" "The water released into the atmosphere goes on to liberate its own oxygen molecules. They in turn link up with others in the high stratosphere to form an ozone layer. Without that protection from the sun, the oceans would long ago have boiled away. Ninety percent of all life forms exist in the oceans. That's where your species once came from." I am reminded of Ambrose Bierce's definition of an ocean: "A body of water occupying about two thirds of a world made for man—who has no gills." A large set of ideal surfers' waves materializes, smashing with Big Sur's legendary ferocity into the ramparts of serpentine sandstone. Hard rock. Cold rock. Spectacular spray, fifty feet high. I am drenched. "Water is the messiah, William." "And I'm wet again." "You bet you are. Because you are one with the ocean, gills or no gills, oceans that have it all: surface waves that can reach two hundred feet in height, the deepest trenches, comets from space, bottles from lost sailors, sediment from the Hindu Kush, treasure from sunken Spanish galleons. Millions of life forms as yet unknown to you. Every zone and globule, thought and fiber of your mind and body is a quaking declaration of water. Your splashing around in the pools of childhood, those delirious bubble baths of mature sexuality, that insatiable quenching of thirst, your love of April showers. In every glass of adolescent lemonade you are witness to the biological and artistic fertile crescents of prehistory. That's true religion!" "That's what I like about you. Your exuberance. It's . . . it's what I like in a woman." I walk off down the beach, along the water's edge. William makes me blush. I watch him as he takes a sea-shell from the sand, and connects it to his ear. Walking the length of the azure blue beach, beneath headlands, lost in the flood of forces compelling him. This cosmic eavesdrop, whose intentions—theoretically—he must begin to take seriously. Something inside, denied for months, albeit outwardly obedient, comes forth, marshaling the kind of strength that has nothing to do with holding oil. There are resources he never tapped; feelings lodged against that Big Sur shade, or out amid the icebergs; a temptation to clutch the world he loved from childhood, who knows, from first breath; to which he clung with all the truth and foraging muscle of any organism set loose within a limited life span. Set loose by Darwinian compulsion, to grab and eat and touch and taste the full force of the wind
that hits him this day like a busload of tourists bouncing down the road toward some golden vision of the past. But the past is now, swarming around the ecologist with a buzz of sea change. "Listen to that shell. What you hear is the echo of the 'third thing,' William." The rumble. Ocean? Wind? Beware the orifice. The shell—toss it, he thinks! But too late. She connects with the hole, the universal hole, down which he is sucked, with gossamer ease, and spit out politely in a Sears Roebuck swivel chair. Familiar turf. The trickle of water. The terrarium. Gertrude walking across the mossy steps to sip from the micropool. Ten after twelve, Thyangboche time. Monks are chanting down below. Nothing has changed. In one hour he traveled some forty thousand miles. He came within shooting distance of Pasadena. Dinner at Valentino's. Hot sourdough. Pesto. Uniodined tea. Slipped through his fingers. Shit. " 'Water is H2O. Two parts hydrogen, oxygen one; But there's also a third thing that makes it water. And nobody knows what that is,'" she says coquettishly. "D.H. Lawrence's poem," I respond. "I happen to love that man's writing." "You've read D.H. Lawrence?" "Yep," she hails proudly. I must assume she's read everything. "What in particular about Lawrence?" "His Etruscans. His New Mexico. The mystery of a rainstorm in Tuscany." "Go on?" "Your life is the third thing." "A little clearer, please." "Life precedes chemistry." Her resolve is a point not of controversy, but of euphoria. "You've said it before. What is it about water—" "Water precedes chemistry, culture; water is the future of your species, of all species. This whole planet is a kidney of sorts. Don't blow a good thing." The word KIDNEYS flashes on her monitor, garish pink, orange, florid cyan. Gaia's color schemes are revolting. The word dissolves into a three-dimensional scan of an organ, sliced laterally, very medical and complete. "Every twenty-four hours most of your bodily fluids are filtered through the kidneys," she goes on.
"I know." "The organs are sensitive to signals that rebound from the brain and tell you when it's time to pee. You can check the veracity of this mind-urine relationship by recognizing the logic of the desire to pee, which erupts not surprisingly the minute you enter your front door, and are in viable proximity to a toilet. Minutes prior your body held back, in the knowledge of imposed delay." "You brought me back to Thyangboche to discuss piss?" "Yes. Because there is no more fervent alliance than that between the brain and kidneys. A connection sweetly analogous to other clasps, embraces, hand in hand, lip to lip, two peas in a pod." "You're mixing your metaphors." "Fine. The point is that this connection monitors your thirst and temperature, as it does the whole planet. It keeps your blood and water volume constant. Such homeo-stasis is the body's buzzword. There you are!" On the monitor, William Planter, in diapers. "Where did you get that?" " "I went through your photo albums." "They're in storage! How did you—" "A Bekin's four-story building near the corner of Orange Grove and—" "I don't believe this." "Believe it. It took you two years before your brain, bladder, and urethra were coordinated." "Is that . . . normal?" "Yes. A few thousand diapers are a small price to pay for a system that has taken millions of years to evolve." I'm thrown. I don't know where she's leading me. "The brain and kidneys moderate this evolutionary adventure. Beginning in the plasma membrane, then in the blood, where the precious chemicals found in water are delivered to every cell. Water carries nutrition to every minute part of your body, William. Similarly, the locks and levees of civilization were modeled after the same biological system that irrigates the body's cells. From the Indus River to the Liffey." "You're referring to the origins of agriculture?" "Obviously. There is evidence of irrigation channels dating back twelve thousand years."
Plowmen, tillers, full-breasted women marching through straw. A rivulet descends through ferrous clods of mud, arrayed down strips of descending field. In the background, steep purple mountains rising into an Oriental sky. Gaia's blue glow surrounds the ancient picture. "This technology provided the legal, written, and economic means to control and exploit the possibilities of abundant food and wealth. It gave your species time to think, to create." "All right. Water gave birth to the fertile crescents and that in turn fostered settlement. The oceans gave birth to us. Our tears uphold the same salinity. Babies pee a lot, and the brain has something to do with it. I know you'd like to go on making sweeping generalizations, reducing everything about human beings—our past, our physiology—to water. But you can't use nature to explain human culture. That's shortsighted. You see—" Wham! "Eheheheheheheh . . . eheheheheheh . . ."I screech, through her tunnel, up, away, down! "Shit!" "Over the hill. Go on!" she says with minuettish charm. Thistle. Profuse, incensed, sky-blue. Semiarid. Flocks of goats to my left, wild, involved. Mountainous ridges, rocks ready to topple, steep paths, used I would imagine for centuries. The dust reads even of millennia. Bees everywhere. I scramble over the crest, which is a mere fifty meters before me. "You see?" It's gorgeous! "Where am I?" "los. Go down to the sea. Homer's buried there." "What?" "You heard me." I start down the backside of the apparent island. Could be in the Cyclades. Homer's tomb is a myth. I know that from rudimentary Graves, Renault, Frazier. Pepper trees. Honey. Jags of man-made stucco littering the Earth. The distant clash of shoreline and sea. "And after filling these reservoirs with rainwater, they close the openings, making them even with the rest of the ground, and they leave signs that are known to themselves but are unrecognizable by others . . ." "What are you saying?" But I'm half attuned now, more intent on getting down to that inviting beach without venturing too close to the dark lumbering swarm that I detect before me, moving fifty feet above the ground, searching out a new breeding site. Like a tornado the cohesive mass moves. Group mind, menacing, unpredictable. To be encompassed, stung to death, used for hibernation purposes, my body submerged beneath honey, is less attractive than getting to that crashing shore. Obviously.
"Diodorus Sicolus. Other clues from Philostratus and Eunapius. Colluthus. Manetho. Greek history reverberates," she says, the Harvard classics don coming out in her. "Just leave me alone for a while. Give me a break, will you!" " 'May you be cursed, O bitter sea! You drive men daft. You strut upon the sands and your white ankles laugh. Your eyes and your teeth laugh and all your beaches laugh, till young men laugh and sigh, and come down to your sands. The four winds for a blanket and waves for a pillow,' " her Homer urges in fluent Attic cadenzas. She's unrelenting. I try to ignore her, happy to have reached real sand. The real water. It's wild. Wilder than I've ever seen. Not a sound. No jet in the sky. No Mediterranean cruise ship. This is Greece, and it's not Greece. "Try 800 B.C. " "Huh?" "You heard me!" She's done it again. Once in Australia. Now here, against the backdrop of luscious whitecaps. "Your brain determines everything, William. It's your connection. I'm merely your foil." "800 B.C., now, here?" "You got it!" "Fuck you! Wench! Pervert! This is not my schtick, get it!" "Some vernacular you've picked up. Very ornamental. Demotic. I could leave you here." "Then just do it. I don't give a shit." Silence. "You wouldn't." Silence. "Gaia!" "Over there. Amid the dolmens. He's underneath," she says. "I don't believe you." "The corpse is still fresh." "You're telling me Homer is buried there?" "Shepherds who didn't even know who he was. He'd been shipwrecked on the island for over a year." "I don't smell it." "Sea breeze. Be grateful. The sea's the point. Homer knew it."
"Where are the shepherds?" "Over the hill. But I wouldn't think about it—" "I want to meet them." "Beware goatherders. Your cool pale skin. Derriere and brown eye. Sodomists along these hills. Plenty of olive oil for the task. Trust me. Don't dally long here." "Why did you bring me to Greece?" "Bathe. Go on. This is pure Mediterranean." I unrobe and plunge. God is good. There is no difference. It's astonishing! Eighth century B.C. or 1990. Spume is spume. Whitecaps are whitecaps. "Homer was obsessed with water," Gaia remarks from her Olympian perch in my ear. "He asked how humanity and the natural world might coexist in harmony. Now where do you suppose all the characters of the Iliad and Odyssey are most content? Out at sea, of course. But it was another Greek humanist, Thales, who actually perceived that the oceans were the source of life. All substance, said Thales, could be reduced to water. 'Panta rhei!' Everything flows. For Homer, as for all later Greeks, the substance of water—the source of your current delectation— was the medium of the Gods." I step out from the churning riptide, uninclined to drown in prehistory. "That frown—What's on your mind?" she asks. "You pick up everything." "I can't help myself." "Well, the historian in me buckles." I lay out on the sand. Free. Complete. Whole. But a doubt lingers. "Gaia, perhaps you forget that by the fifth century B.C. Plato had warned that his country would be destroyed by human-induced topsoil erosion. A different type of flow. Small streams became torrents that ripped through ancient Greece. The hills, even then, were bare of the trees which could have helped the soil absorb water. Forests had been cut down for pastureland, and goats will eat anything that tries to grow back. Even then, the Greeks ignored their environment. Nor were they alone. Deforestation and watershed destruction have hampered innumerable civilizations—in Persia, the Yucatan, Babylonia." "Are you not enjoying the sea?" she softly teases. A coolness crosses my body like a hush, and then, the distant, unmistakable approach of an engine. Suddenly, from my same prone sprawl on the Homeric sands, I look out toward an individual with water skis and sail, airborne, a speedboat in the lead. And then, as suddenly, my pants off, I find myself lying beside fifty thousand other European-speaking
tourists on a beach. The water reeks with suntan lotion. Hundreds of boats. Distant ships. Noise from every corner of the universe. Planes overhead. A freeway to the rear. Sewage from hotels. Even in the lap of pleasure, immersed in the vision of so many female breasts bobbing up and down the beach, other, albeit academic thoughts, arise. I tell Gaia how it seems to me ironic that the descendants of Homer and Thales profane that which was once considered sacred. Today the Mediterranean is an open sewer, with over one hundred and twenty major cities pouring waste into it. Frankly, it's amazing to me that anyone would swim in it. The ruins of ancient Greece attract thousands of tourists. Very few of them probably recognize that it's really the sea which is in ruins. "I'm intrigued by your unrelenting criticism of your own species," Gaia says. "Okay. I admit that it's easy to condemn the ill-fated behavior of my kind. Might it be otherwise?" Gaia seems to inch up to me, a hovering aura, nestled in folds of scintillation. "In China there were magnificent cultures created on the rivers." "But the Chinese also wreaked havoc along those rivers. As in Greece, the forests were overcut and that depleted the mountainsides of their absorbent nutrients. Where the rivers meet the sea, in cities like Shanghai, there is dirt, noise, and pollution." "One of your most enchanting cities was built on water." "Which are you referring to?" "Venice." "It's slowly sinking in a morass of polluted water. The buildings are falling apart. Almost every year they need duckboards in St. Mark's Square. Venice could drown. They're making no headway on the cleanup." "In another great city, London, hasn't the river Thames been purified?" Her naiveté surprises me. "Industry still pollutes the river. You wouldn't want to eat the catfish caught in central London, believe me." "The waterways of New York gave a free port of entry to the world. 'Bring me your huddled masses . . .' " "Well, the lady has her back turned. Every day tons of arsenic, noxious chromium, oil, grease, poisonous lead, and human waste are dumped into the water. I think we need to grow up." "I worry that your species is already overgrown." "What do you mean by that?" The cards have turned. The sun is hot, the beach filthy. I'm thirsty and restless. I go over to the shower stalls adjoining a snack bar where meats are slowly turning, headed for souvlaki. A little ouzo with ice
would settle the stomach. Jet lag. Time lag. No money. No shower. I use the faucet, quench my thirst, and head toward the road. I know someone in Athens. A translator of Kazantzakis, a small sprightly fellow, born on an island near Istanbul, who sold ice cream in Chicago, lived with Marilyn Monroe and Arthur Miller for a time, then made Kazantzakis's- The Odyssey—A Modern Sequel accessible. Kimon would have some ouzo on hand. A cool fan. An afternoon of relief, overlooking the Parthenon from his aerie up on Kalidromiou Street. I spent a summer there once. Ice cubes were fundamental to our daily routine. And cold tomatoes. The poetry of Elytis. Cavafy. Evenings at one taverna or another. Lazy browses through the Placa. Hasapikos in Piraeus. The Greece of cool liquids, windy nights. But no. Plucked, midstride. And the road within reach. No reaction time. Like an idea between a single blink and a grimace. Back in the chamber. Nepal. I am seated before that infernal machine. "Why must you!" "Calm yourself." "Easy for you to say. What do you want from me?" "We've been through that, William." "I know." Adjust. Discipline. Someday a clean slate. Just take it step by step, I urge myself. "Water. You were talking about water." "Correct." "And whether one refers to the Exxon spill of the Valdez up in the Alaskan Gulf—oil as wide as Rhode Island, a litany of dead sea mammals and birds—or the fouled beaches of Greece, our story reads uniformly: insanity." "Correct." "Then what is the prognosis, Gaia? You said we're overgrown." "Consider this view of the South Carolina coast, showing a diseased mushroom cloud of sediment and agricultural pesticide oozing into the Atlantic." Her screen erupts with satellite images of Kodiak Island, November 1985; the Mississippi outflow, April 1989. Downtown Sao Paulo, along an abandoned creekbed stuffed high with detergents and refuse. Children are scavenging through garbage. "Such images can't begin to account for the dead whales on shore, the devastation and pain that result from water pollution. Around the world every day, over thirty thousand people die from water-borne diseases. You're clearly killing yourselves. Go for a walk, William, open your eyes
and look. Even right here in Nepal. Don't think that your pure little private waterfall is the condition of the masses." I don't take a step. She takes it for me. One of these days I'll get used to it. There are Nepalese women getting water in the community spring. Namche bazaar. I know the town. Sherpas, numbering some five hundred. A tourist mecca, on the way to Thyangboche, Everest. This river, this stream which is the lifeblood of the village, both for its hydroelectric power, and the water the villagers consume, is polluted. I wander up its rocky course, kicking empty cans of tinned meat from China and India, yak shit, old newspapers, plastic jerry cans. Globules of other, unidentifiable things. An old tennis shoe. The stuffing of an abandoned parka. Why? Is it something about us, is it something known, unknown . . . conscious, unconscious about us that we defile the very thing that keeps us alive? I stop at a tree, covered in prayer flags. I reach for one of the flags, a muslin scarf with black printing smeared from years of weather. A Buddha is still faintly visible in the fabric. "Every human culture in modern times has polluted its' water," Gaia begins. "Maybe it's your destiny .... Go ahead, drink it!" "No." "I dare you, drink it!" "Get serious." I am sitting before her screen, where a dredge is pictured scooping out bottom sludge. I recognize Baltimore Harbor. Gaia goes on: "You will note one concoction after another the Earth has never before seen. What do you get when you combine floating globules of DDT, organic sludge, radioisotopes, human waste, heavy metals, dyes, and topsoil erosion?" "I don't know." "I don't either, but it's no brownie! Some poisonous brew that strikes at the heart of DNA; infecting every water molecule, life's oldest storyteller; killing not only humans but other species, such as shellfish and crabs. It amazes me that people still want to catch the poor critters. Why not leave them alone? William, there's not a single large body of water, river or stream, left in America that's fit to drink. I doubt that bottled spring water is going to be the answer for two hundred and fifty million Americans." "You don't give us much hope then?" The image on her screen dissolves to a beautiful mountain lake. Recreationists teem along its peripheries in campers. Many sit in lounge chairs on the lake's edge listening to music, enjoying barbecues. The modern pastoralist vision. "There are winners and losers amongst every species. Why should your species be any different?" she
says. "Because we're supposedly intelligent," I reply with a natural bent for sarcasm. "An endless array of hanging ice walls has scooped out and filled the basin before you with the most perfect, vital waters on Earth. Occasional diatoms and surface-suspended algae catch the summer sun. Insects and bass compete for food on the surface, while trout skulk along the cold, nutrient-free bottom of the lake. Such tarns were scattered all over America ten thousand years ago. Their water tasted fantastic, and they were the measure of all things healthy on the planet .... Did you know that the loon has been composing music in tribute to lakes such as this for one hundred and thirty million years? But I'm going to let you in on a terrible secret: the concert's almost over. I give it another twenty years." I'm suddenly thrown into a heap of backpacking gear and screaming kids in the back of a racing station wagon. A wild-haired elderly man steers with all the restraint of an escaped convict. He tosses his beer can from the window just as we pass a road crew that's busy winterizing the road with chain saws. "Daddy, Daddy!" the little bastards holler. The driver is intent on reaching his destined parking spot at the campsite. We arrive. A forest ghetto, half-removed from city life. "Hey, bud! How t'hell d'you get in there?" The father seizes me by the collar and promptly ejects me from the rear of the vehicle. It's crazy. He doesn't overreact. He just takes me for one more piece of luggage, it seems. The kids are peeing in the trees. Summer vacationers are everywhere around us. The campsite is overflowing. Drainage culverts. Organic decay of every sort. Laundry detergent. Garbage. "I'll tell you what's going to happen," Gaia says, as I walk toward an adjoining barbecue, the smell enough to bring a lama to his knees. "The fish will go belly-up; the lake will become a bog, covered with mats of blue-green algae. And hordes of dragonflies. Snapping turtles. Digger wasps. Water moccasins. Miles of sharp nettles." The father joins me at the steak fry. "We've been comin' 'ere fer years. Buried Gramma near them outhouses . . . What I like most is the sense a solitoood! Man's gotta right to take a dump by the lake, kill some crawdads, even run nekkid through them trees if he has a mind to. Sure as shit can't do it back in Bakersfield. Beer's better in the outdoors. Ya know that?" He offers me a Miller Lite. I go for it. "Nature plays a perpetual game of roulette. As you can see, William, there is a whole new level of activity at work on this body of water. Fumes, oil, and bacteria from motor-boats and human waste leaching into the water create new challenges that were never posed by bugs and plankton. In fact, your species may be the measure of something altogether different, something new and intriguing." My beer in hand, I suddenly sit alone, beside Mono Lake. The sun is just rising. Grebes dawdle in the surrounding waters. "What are you trying to get at, and why Mono Lake?" "Pollution or no pollution, lakes disappear, or leave behind salt marshes rich in oxygen and soon to be
covered with mats of algal slime. As its water is lost to human consumption and evaporation, the lake will become a haven for other creatures—birds, mosquitos, snakes, and bullfrogs. A Mono Lake fosters innumerable orchestral parts." "Gaia, just answer one thing for me." "Yes?" "Pollution: good or bad?" "Such transformations as have overtaken a Mono Lake are necessary. Nature is fickle. Water is fickle. William, the whole world is experimenting. New ideas, new configurations. However much a maelstrom for man, there are natural priorities on Earth worth bowing to." "Explain." "Put down your beer." "What for?" "I can't beam you with a Miller Lite in your hand." "What about Guinness Stout?" "Put it down." I place the bottle on a rock and—Wham! African women. Colorful. An ancient well. The ritual is universal. "Water is a resource that is not distributed equally," she says. "These women in Mauritania live an hour's walk away from this well. They will have to come here at least three times every day of the year. That's over two thousand hours, every year, just to obtain their basic throat-quenching necessity. And in places where water is plentiful, much of it is used for trivialities, like keeping dust down in a Brazilian mine. Or watering ornamental flowers in Italy, where they already have enough rain. Or nourishing clover and alfalfa for beef cattle you then devour. At present your species is using one thousand trillion gallons of fresh water every day." "That number means nothing to me." "Try the size of one of your Great Lakes, lost, every day." I follow the women from the well to their village, across a hard-caked desert floor. Gaia continues to speak as I walk with the veiled Muslims. Their pale colors glow and bend in the stillness as their bare black feet cover the cracked terrain. "In every gallon of H2O there is scarcely a single available drop for your species—three tenthousandths of one percent, to be exact. Only one percent of the water on Earth is fresh. The rest is salt,
or locked away in glaciers. That would be fine, but at the rate of human consumption seventy-five percent of all remaining fresh water could be exhausted in two decades. And whatever is left may well be carcinogenic, as you saw in Baltimore Harbor. The incidental rain that falls onto cities is polluted so quickly that it's undrinkable. At the moment you've got roughly three hundred twenty-five million cubic miles of water on Earth. It can take sixteen thousand years for some water to renew itself. But don't let the numbers go to your head. Your own National Academy of Sciences and the Environmental Protection Agency have discovered seven hundred major contaminants in U.S. drinking water alone. God help the poor bastard who is reincarnated in the fibrous condition of sludge. Water, water everywhere, and not a single drop to drink!" We reach a village of mud yurts. Stick lean-tos. The desert is strewn now with cattle bones. Flies swarming over the sunken eye sockets. Bellies are bloated. Children are shaved bald to impede lice infestation. Or their hair has fallen out from thirst and hunger. "Even in the best of times these people have only one third of a gallon of water each, per day. That's six hundred times less than that which is, for the time being, available to individuals in the U.S. Given such unequal distribution of water, your species could easily wage World War Three over the possession of a simple thermos." "How are we supposed to fight the unfairness of climate?" I inquire, putting her on the spot. "Stoop down. Examine that red soil." "What about it?" "Once a mighty river flowed here, as wide as the Nile. The desert was braided with life two hundred thousand years ago. Hippos slumbered through the river canyons. There were olives, figs, cypress trees, thousands of species cavorting in the desert oasis. This vanished paradise was painted on stone—those rock walls on the horizon—but it is written solely in water." "You're losing me." "William, the climate shifted, spreading its welcome curtain of moisture to the north. Such caprice is responsible for the coming decade of droughts." "You're predicting this on the basis of past anomalies?" "Look around you. The water holes dried up throughout Africa during the mid-nineteen-seventies. The persistent heat and wind caused the few meager inches of rain to instantly evaporate, leaving behind an acrid gauze of salts which burned through the topsoil. An African dust bowl ensued. By the year 2000, most of the Sahel Region—from Senegal to the Sudan—will be uninhabitable. Nothing can grow. Sand dunes are spreading hundreds of miles per year in Africa, destroying farms, and disrupting or obliterating millions of human lives. Seventy percent of all cattle have died." "Gaia, do you care about people?"
"Of course," she says quietly. I wander through the camp. A child is coughing. Someone is crying. All are softly dying. "Are there no solutions?" Instantly, I am removed to another desert, out of the death camps of Africa, into a more tranquil and healthy-looking aridity. A fly lurches with me. I guess that's become a tradition. "In the Rajasthan desert of India there's a tribe called the Bishnoi who have learned to cope with virtually permanent drought," she says matter-of-factly. "They are vegetarians and for over five hundred years have imposed a strict ecological code of ethics on their society. Their credo is derived from the teachings of a Hindu saint in the Middle Ages. Janeshwar was his name. He was quite explicit in his injunctions. If you protect the shrubs, harvest the protein from leaves, monitor the grazing of animals, and produce abundant milk, you will overtake poverty and the endemic lack of water. Neither of these evils has had much of an effect on the more than one million desert Bishnoi. Their spiritual callings have melded with ecological good sense. The result is a viable human community. So resolute is their belief in conservation that they have even martyred themselves, hugging trees so as to safeguard the precious plants from outside woodcutters." "You're suggesting the model of the Bishnois for the rest of us? I don't see it." "I'm suggesting that the pollution which is apparently inherent to your destiny can be countered with more powerful spiritual forces latent in your personality, in your social predispositions. You can't solve the caprice of nature. But you can cure the demons eating away at your psyche." "It would help me if you could be more specific. Surely mere spirituality is no antidote to the toxic sludge of Chesapeake Bay? Or the famines of Ethiopia? The local Buddhists of Namche bazaar are certainly religious, but that has not prevented their dumping local garbage in the single spring that provides them with their water." The desert grows dim. By now I can recognize the signs. I hold my breath, close my eyes, and stand my ground, arms wrapped around myself. Head lowered, legs spread. Swoosh! "The sun receive your eye, the wind your spirit." Her voice is calm and noble. No TV fuzz. .The monitor has no speakers. I have no speakers. Yet her voice confesses from some crystal-clear vantage point within that is ripe and logical. No muezzin atop minaret. But rather, pure, firm vocables, resoundingly assured, twisting through an argument, both sides arranged, so as to balance any doubts, prove all nuances, resolve the matter. And yet the travel takes me each time by surprise. Around me are ruins. Dry gulches. Birds pecking through weed. Beyond, the sound of a mighty river. " 'Go, if it be your lot, unto the waters; go, make your home in the plants. Your spirit went far away to the four quarters of the world, away to the billowy sea, to the beams of light that flash and flow, to the waters and the plants, to the lofty mountain heights, into all that lives and moves, to all that is and is to be.'"
"You quote from the Hindu scriptures of over two thousand years ago." "Details from a commentary linking the Ganges to human destiny." I walk the three hundred yards to the water's edge. Old man. Muddy banks. Lugubrious and vast. A sail in course, guided by breezes which are the river's alone. On all sides, a scorched Earth. And there, bobbing down the muddied spillway, the corpse of a water buffalo, a lean white egret riding on the black and pockmarked ribs. "I wouldn't use this river to generalize about human destiny," I say. "Despite India's cleanup effort, the Ganges is considered to be one of the most polluted rivers in the world. Its dolphins are blind." "You miss my drift. This river is destiny!" I look across to see a procession of young people coming to the river's sandy edge. Hot dabs of color sway in the fine cloud of dust. The distant gaggle of giggles, a perennial encounter. "Human life in India is inseparable from the Ganges," Gaia begins. "Every individual is a pilgrim; every act a religious offering to the river. Initiation, marriage, death— the three most important events in a Hindu's life are consummated beside these waters. The boy is initiated into manhood by repeated absolutions in the water. The ceremony is called the Sacred Thread. For three days the boy consumes only bread and Ganga water, clad in the yellow robe of an ascetic. Do you see him?" The child is there. Squatting in the mud. A girl squats beside him. "At the age often," she goes on, "girls make clay penises out of the thick mud. The phallus is meant to ensure a good husband for them. Every morning, in the months of April and May, this Siva Puja ritual is repeated. Shiva is the name to reckon with." The dust collects in a dark writhing column in the center of the river, half a mile away. A twister, riding upstream. "Siva is the most contradictory and interesting of all Hindu deities. Destroyer and restorer, it was he who brought the Ganga to Earth and continually fertilizes it with his potent semen. His huge erection is figured in ice caves and stone temples throughout the Indian subcontinent, dating back to the beginnings of the Indus Valley Civilization, where he was first worshiped. It is no wonder that the true source of the Ganga should issue from that place—" There. Instantly. Cold wind descending a glacial steppe. Above, high Himalayan peaks straddling a chaos of crevassed ice. Gaia continues, oblivious. "Ganga. And Shivalinga. Shiva's mountain. The linga, of course, referring to his perpetual erection." There are Hindu saddhus, ascetics, bathing in a pool at the terminus of the glacier. All the men sport enormous dark erections.
"I love such ritual," she waxes. "I'll bet you do," I say. "Nothing could more nobly symbolize the human capacity for adoring nature. The ascetics have entered the stream of divinities. It may sound trite—" "It does," I tell her, sawing through her soapy sanctity. "But just look at where they are, William. They have trekked barefooted from the southern tip of India at Cape Comorin to bathe and worship in these pools thousands of miles away. I'd like to see you manage such a pilgrimage." "Not in this life, thank you." "That's what I thought. You're soft. But these men are hard!" She got me. "Shiva is the real male," she continues, "the fire, and Ganga the female, water. Life is born of their intercourse. Descending from these solitary pools and glaciers, the river soon discharges seven hundred thousand cubic feet of water every second, flushing nearly two billion tons of Himalayan sediment every year downslope. The sediment creates an enriching silt load in the plains. From the farmer's perspective down in the lowlands, this mating of river and mountain is ideal." The wind is stilled, replaced by languorous tropics. Steam wafting through jungle. Up ahead, a clearing. The mosquitoes are already at my ears. I've not taken malaria tablets. I wander toward a man and his wife, farmers, clad in gray soiled dhotis, plowing a small plot with water buffaloes. A dog rests in the shade of their thatched hut. A younger woman sits there giving suck to an infant. "The valley was settled during the Iron Age three thousand years ago, by such hardy farmers as these," Gaia continues. "It has since come to nurture seven hundred million Indians. The country is hungry. The river provides. The rains provide. In March these plains are harvested. Temperature in the shade is one hundred twenty degrees. Sometimes the dust comes in hurricane-like walls, three hundred feet high, blacking out the sun. This is the period of possible famine. But unlike the African climate, this dry period is normally preceded by the monsoon rains of June and July. In November the farmer sows his wheat and gets it in before more rains come in December. But sometimes the rains don't come in December. A food shortage is actually predicted in India every five years, famine every ten, total disaster every fifty." The farm dissipates before my eyes, like a color pixilation, sparkles diffusing out over the drenched sun which settles like a blood clot on the horizon of forest. The family vanishes; their hut is suddenly a fortress, in ruins; and the thick row upon row of Indian clods are now-a sun-baked salt pan, scraps of history littering the expanse. I stand in the center, alone, exposed, uncomfortable. "The river can be as capricious as the rains. For nearly six hundred years the city of Gaur—which stood where you now stand, William—was the most famous settlement in all of India, capital of the Muslim empire in Bengal. Its massive battlements lay two thousand feet from the edge of the Ganges. But in
1575, the river shifted west, leaving malarial swamps in its wake. Combined with accumulating refuse —previously thrown in the river—a pestilence devastated the city. Thousands died daily. Within a year, the famed seat of empire was but the haunt of fattened tigers and monkeys. Feel the soil, walk the peripheries. Over there, where the red wall simmers in the heat. Remnants." Dust, cotton trees adrift in beautiful crimson flowers, kokila birds whispering among the ruins, and a forlorn rim of twilight. Nothing more remains. "Duzakhast bur ni' amat!" "What does it mean?" I ask her. " 'A hell filled with good things.' That's how the Persians in India referred to the Ganges. You see, when the Persian King Darius conquered India twenty-five hundred years ago, he sent an expedition down the Indus River. Much of Asia Minor was under Persian domination at that time, including Thales's hometown of Miletus. A younger disciple of the Greek Thales, Hecataeus, heard about Darius's river expedition, and drew a map that merged Homer's vision of a watery planet with that of the snowy Himalayas. The result of this fusion was extraordinary. The Greeks called the Ganges Hyparkhos, meaning 'the bearer of all things good.' They believed it to exist on the edge of the world. Both Aristotle and his pupil Alexander the Great were sold on the idea, Alexander actually promising his exhausted, homesick troops—during their campaign in India—that paradise was at the end of this river, in a place like Gaur. By the third century, Christian writers had fully identified the Ganges as the central river of Eden. And by the early Renaissance, Europeans had become obsessed with finding the waters of immortality off somewhere in Asia. You'll recall John Martin's remarkable painting, "Zadak In Search of the Waters of Oblivion," painted in the early 1800's and picturing a titanic figure grappling on the edge of a precipice, attempting to surmount a rocky ledge." "I don't know the painting." "Well, picture it," she says. "Above Zadak hangs a dizzying plethora of cataracts plunging off the glaciers of another world. That vision compelled the early twentieth-century explorer, Francis Kingdon Ward, to set off in 1924 to find the fabled river at the edge of Tibet, said to conceal the highest waterfall in the world in its tortuous gorge. The same waters of immortality. The Ganga, primeval Mother Goddess, giving life, taking life, mending all conflict. The source of all reincarnation. It may seem irrational, but these pilgrims know their future to be religiously linked to water. For five thousand years they have revered this river. And the river has in turn revered and nourished them. Only together will they be able to make it." The sun has gone down. India comes out at this time of evening. The cicadas are their own river. Pilgrims wander along the banks. In the far distance, a haze of lights, the dust of modern-day traffic rising like a red algal growth along the fringe of congestion. Out here, on the edge of town, lovers linger barefoot along the chilled eddies of the Ganges. I wander amongst them. My head is spinning with the events of the day. So many stopovers, so many questions left unanswered. Gaia's solutions are so densely cloaked in the confusion of human history, meteorology, cause and effect, as to shake loose any possible pattern I might otherwise detect in her. D.H. Lawrence. Freud. The leaf's stomata structure. Homer. Thales. The Ganges. It started with the month of April. A dream from the night before, of a John Masefield poem—"I must go down to the seas
again . . ."The recitation, the whole fine web of her agenda was beginning to affect me. It was the same thing in Chamonix, only this time she had mud on her mind. And in the Pontocho District of Kyoto, where a twenty-two-year-old geisha suddenly reminded her of four and a half billion years of biological evolution. Today, she had water on the brain. The chanting. Familiar turf. Lavoris greets me. The beast is hungry. I've been gone all day. Darkness enshrouds the mud corridor to my chamber. But upon entering, I find all the candles have been lit, as well as the fireplace. A cozy nook to return to. "This irrational longing for the waters of immortality, however polluted those waters may be. The sacred and profane in a single glass." I look to her from the bed, where Lavoris has come for a good stroking. "Can we continue to drink of those waters?" "You have no choice," she declares wearily. "And you must know that I applaud the irrational. Science will never truly understand water. The flow is uncapturable; the essence ungraspable." I walk over to the computer table. A pulsating glow, by now familiar, emanates from the screen. "Gaia?" "Yes, William?" "What is that?" "What is what?" "On your monitor. I've seen it before." "There's nothing on my monitor." "Of course there is. I'm looking right at it." "I'd certainly know if there was something there." "Come on, it's right in front of me, contracting, expanding, pulsating—it's feminine." "Oh—that ..." I take the silver Bhutanese goblet over to the sink and pour some water into it from the large painted clay vase. Grecian dolphins are delicately figured on the simple artifact which sits amid half a dozen brass containers. The liquid is cool, the color of emerald. I touch my fingers to its perfect surface, then return to the computer and sit down, holding the glass between Gaia and myself. "Half empty, or half filled?" I ask her. "A good question," she replies.
chapter four "The Numbers Game" From the Diary of William Hope Planter ... Denzu Rimpa Lobshan grew up in Gyantse Tibet, a community of Tibetan Buddhist temples scattered amid the granite cliffs and high desert mountains. In 1958, toward the apex of Chinese-incurred hostilities, Denzu and his brother Tsering fled through the Chumbi Valley into northeastern Nepal. Within weeks they had unloaded all of their belongings for a pittance and were living as political refugees in the Bodha Temple complex of Kathmandu, with thousands of other Tibetans. Denzu— already a monk —continued to work in the newly formed Tibetan religious community. While the Dalai Lama sought exile in northern India, at the hill town of Dharmsala, Denzu and Tsering joined the masses of other Tibetans who hoped and believed that they would soon be returning to their homeland. By 1963, they had lost hope. The CIA support of the Tibetan Khampa rebels had collapsed with the capture of Wangdu, the rebel leader. Wangdu had been spotted by helicopter as he and his men rode furiously on horseback toward the Nepalese border through inaccessible canyons. A bevy of machinegun fire was waiting for him. The Khampas—original protectors of the Dalai Lama—had waged a holy war against the Chinese. Now it was over. Peking was colonizing Tibet's religious capital, Lhasa; the Potala Palace, once home to the Dalai Lama, had been turned into a cement factory; temples were burned and looted; monks were killed. Denzu and Tsering's parents were among the casualties. Their younger sister was missing, presumably raped and murdered. Tsering, by that time five years assimilated into Nepalese culture, had gone into the trekking business. A born scrambler, he had a Sherpa's agility, and an eye for a profit. He went to Tenzing Norgay's Himalayan Mountaineering Institute in Darjeeling and was soon guiding climbers into the high mountain sanctuaries for which Nepal is duly famed. Meanwhile Tsering's brother Denzu left the Kathmandu monastery and joined the monks of Thyangboche. Kathmandu's low altitude never settled well with Denzu. "Too much air," he would say. Today, Denzu greets the Himalayan dawn with a pair of binoculars glued to his eyes. His younger brother is leading a group of cumbers from Camp 1 to Camp 2 on Kantega, directly above Thyangboche. Other monks are assembled , with him, vying for a peek. The notion of climbing such icy walls is nothing new to these monks. It was the famed medieval Tibetan saint Milarepa who first ensured the longevity of Buddhism on native soil by conquering a non-Buddhist shaman through an act of outrageous mountaineering. The shaman had challenged Milarepa. Whoever managed to climb Mount Su-Meru first could claim religious victory over all of Tibet. Like a character in some Aesop fable, Milarepa waited, reclining in the sun against a boulder while the shaman climbed vigorously toward the summit. In a flash, with not a moment to spare, Milarepa astral-projected himself to the holy mountain's pinnacle and there claimed due victory. In later years, Milarepa was transformed into a snow leopard—symbol of the Tibetan rebels—and lived out his life in a cozy lair somewhere far off in the maze of snow peaks. I am reminded of Milarepa whenever my own snow leopard Lavoris crawls into bed with me, competing for space, stretching out with a domestic vigor I have learned to disobey.
Our play is robust and invariably leaves me laughing well into the night. He's a nut, demented, utterly addicted to affection. I'm getting accustomed to his smell. Gaia is enamored of Lavoris. The snow leopard species, Panthera uncia, is going extinct. I'm told a pelt sells for under a thousand dollars in the markets of Tibet, a country in tumult. The Tibetan rebels have been largely wiped out. But Buddhism thrives, and Denzu Rimpa Lobshan is one proud monk. His younger brother's party has come into view, however minutely. Milarepa incarnate. I watch the climbers on the screen in close-up, seeing what the monks outside could not possibly see. "It's all in the altitude," Gaia says. "At twenty-three thousand feet, your species' so-called 'death zone' commences. Neurons no longer regenerate in the brain; the onset of cerebral and pulmonary edema is statistically likely. Your speech slurs, your urine flows uncontrolled and miscolored, and your mind goes from giddy to anguished, until all that is left is a sluggish will to die. To lie in the snow and let oblivion sweep over you." "Why are you telling me this?" "Thirty seconds. Thirty seconds won't harm you, not even in your pathetic condition." "Don't you dare—!" Wham! Goddamnit! Into the vertigo heart of the mountain. "What are you doing here? Alone? No rope! Who are you?" Tsering is bowled over. He hangs on to his ax with blind terror at the prospect of an unroped, lightly clad gentleman standing nonchalantly on the icy ledge before him, a mile above the glacier. The air is frozen. His eyes are enormous. "Milarepa," I mumble, wowed. Denzu, stationed on Thyangboche's grassy perimeter— the snow having melted weeks before with the onslaught of a warm and early spring-^rubs his eye. Something moved up on that wall, a glare that jumped. "Kneel down," Gaia whispers. "Crazy! What are you doing? You're not Reinhold Messner!" Tsering shouts, breathing hard, and referring to the one celebrated climber in the world who might just possibly have the chutzpah to be where I am without a rope. "Was ist passiert?" a German climber shouts from below. "Now: Notice the ladybugs!" She's right. Dozens of little orange-backed ladybugs. They seem to be copulating. With six inches between my toes and the drop-off, I'm not keen to explore the biology of the situation.
"Get me down, Gaia. Please get me down." "Look up." "No. No! Get me down!" The Tibetan guide is frozen. He can't believe it. "An eagle, four thousand feet above you—see?—winging it in the high thermals . . . bliss ... on its way down into the lower stands of deodar. Freedom. The altitude has no effect on its brain!" "Good. That's real good. I'm getting dizzy. Gaia?" Whoosh! Back safe. "Don't you ever threaten my life like that again. Do you hear?" "You were fine." "I was on the edge." "Your whole species is on the edge." "No cute rejoinders this morning, please." My fingers still tingle from the cold. But now the screen is warm with the colors of a different sunrise. I hear the sounds of goats and bells. A flock wanders through Doric ruins thick with unmowed weeds and thistle. Could be anywhere. "More than six thousand years ago, herdsmen in the deserts and mountains of southwest Asia began inventing and manipulating written numbers." "You put me at peril on a mountain wall to show me copulating ladybugs and an eagle. Now you're rattling on about numbers. What's with you today?" "Follow my drift. Take notes if you need to. But listen. Numbers were the basis of ancient weights and measures used to calculate food stocks. And those numeric tabulations in the fertile crescent of Persia would lead to, such as cuneiform." "So?" "The manipulations of numbers lead to great power. The pharaohs relied on the first generation of mathematicians to build their immortality. Your species went on to identify a harmony of the spheres. All of astronomy is based upon numbers. Not only do numbers allow for physics and engineering, but they are also inherent to every population on Earth." "Aha. So that's it." I'd mentioned something to Gaia about overpopulation the previous day. By now I should know of Gaia's peculiar response mechanism. Her cogita-
tions are unpredictable and, not a few times, have resulted in my going bye-bye. "Those numbers work in ways that might surprise you. One group of organisms mushrooms in number while another is reduced to a struggling few." The screen converges a host of Gaian images—hieroglyphics, cuneiform, oncoming planets—and a smallish Tibetan figure, seen from several hundred feet out in the air, pinioned on an impossible ice flute, bringing up his German climbing companions. The snake-colored rope is passed hand over hand through his mittens, the slack hanging in lazy circles out over eternity. Two brothers, separated by a few vertical miles. "I ought to get Denzu in here, let him have a bird's-eye view of his brother." "No!" "Why not?" "Not a good idea." Her pause brings up something for me: the fact that no monk has been in the chamber. No monk has even asked about the computer. The conspicuous disinterest of the past four months feels slightly conspiratorial. "Didn't you ever read Topper?" Gaia asks. "Saw the movie," I tell her with a grin. "George and Marian Kirby revealed themselves to no one but Cosmo Topper!" "They were ghosts!" "They were on a mission." She doesn't realize she's talking to a classic movie buff. "They were interested in saving their own souls," I challenge her. "I'm interested in saving you," "That's a first." "Yes." She blushes, which is to say her characteristic pulse expands, the colors rotating like a wheezing drum, throwing off electrical internal sparks, the piston slowly, erotically sliding in and out of the hazy blue machinery prefigured on the screen. I've never gotten used to it. I'm somewhat perplexed by her confession, the personableness of it. "There are those among your species who have sought to find a perfect order within nature and have desired to
live accordingly," she states calmly. "The climber balancing on the ledge. The monks chanting their incantations. William, there is such a balance. But it's not the harmony of your dreams. And when you see the light, it's going to infuriate you!" The chanting is now audible. Seven-thirty a.m. Thyangboche time. "I think I can handle it. Go on." "Me Bi na'ndura, me bi na songe." "Uh, come again?" " 'I am dancing with the forest, dancing with the moon.'" "Language?" "A Pygmy dialect." "Of course. Mind explaining?" Her screen is now impregnated with the written request for data I had submitted to Her Majesty a few days ago. I hoped to use her reply as the basis for a section of my book. Contrary to her usual candor, Gaia skirted my repeated query. Now, unexpectedly, she addresses it. I take up my pen as she reads back to me the words on her monitor. " 'Examine significant examples of size and population in nature. Against that context, determine how stable or unstable the human population is and what its optimal limits may be.' The destiny of your species hinges on this directive. It is the question you posed, is it not?" "Yes. But what's with the Pygmies?" "The Mbuti Pygmies are one example of perfect balance. The curious thing is, William, I could have just as easily chosen New Yorkers." "You must know that I love New York." And we're there, touring the bright lights. Nightlife— garish, loud, intensely congested. It's good to be back. "Twelve million New Yorkers. Zero population growth. An interesting state of affairs following a century of explosive growth. Like most Americans and Europeans, New Yorkers have limited their number of offspring. The city is already just too dense." Now the tour is altered. She sucks me into the large television screen at Times Square, replacing the existing music video with the pastoral vision of Pygmies doing their thing in the rain forest. There are going to be a lot of confused onlookers down at street side. Big-breasted girls carrying their babies in wicker baskets,
foraging for roots and berries. A slaughtered elephant, the male hunters pulling its insides for a year's salt storage. The sound of a waterfall hovering faintly over the raucous streets of mid-town Manhattan. "In the African rain forests, one discovers that the Pygmies have also achieved zero population growth. Evidence of stability," she says. I'm physically nowhere! A ghost in New York; a ghost in East Africa. Victim of dreams, scattered between continents, between times. But it's the logic that annoys me. "Now wait a minute. Why are you comparing population dynamics in an outrageously congested major metropolis with hunter/gatherers? These tribal groups have never overpopulated. For thousands of years the Pygmies have maintained a sort of equilibrium, as far as I understand it. Never imposing undue stress on their environment. But look around this city!" Crowds, dispersing now as the naked hunter/gatherers are whisked away, replaced by more convulsing MTV dope-heads. "Furthermore, New York's zero population growth is an anomaly. In the Third World, most major cities are heading for unbelievable overpopulation problems. And density isn't triggering any procreative restraint. By the end of this century, my species will number nearly seven billion." "Celebrate the good fortune," Gaia declares. "Your species is flourishing. Fertility is a blessing on Earth. Every infant a miracle. Never forget it!" We return to the chamber. Lavoris nudges up to my lap demanding attention. Sometimes it's apparent to me that the feline and the computer compete with each other for my affection. "Overpopulation doesn't worry you?" I ask Gaia. "Every individual will ultimately become a corpse. And the Earth wins out! The more corpses lodged in the soil, the more bacteria. The more bacteria, the more blooming begonias. I love begonias." "That's bullshit! I want a straight answer. Is that too much to ask?" In Manhattan we fly, uptown, along Fifth Avenue. It must be after midnight. Steam is rising from the gutters. Cars racing through lights, through puddles of spring rain that has probably fallen earlier in the evening. Lovers strolling into corners, their silhouettes figuring beneath neon marquees. The city calls to me. A Woody Allen movie, Baskin-Robbins, girls . . . New York, after Thyangboche . . . my heart cries out, even at forty miles per hour, midair, which is the approximate speed, I'd guess, that we're traveling. Ghosts. Invisible. "How about a break for real food, Gaia? There's a place I know that stays open all night. Fabulous Italian—" But Italian cuisine is not on her mind at the moment. We arrive in Harlem, at a shelter for the homeless. A soup kitchen's volunteers are still conveying dinner, in plastic mugs. There are hundreds inside the large warehouse. To one side, a woman is weeping hysterically. "Somebody call a doctor!" I hear a
voice cry out. "Overpopulation tests the resilience of any gene pool. People will suffer. But all agony has its place and you should know it. Such squalor and death should give you hope for the future." "You're losing me. The thread—I just want the thread, the balance." "Nature is not the simple fairy tale you'd make it out to be. The legendary lemmings can attest to that." "Lemmings?" Just as suddenly, we're out the door, into the darkness. And as the wind buffets my face, and a tunnel of time travel widens before me, a distant light begins to shine and then the cavernous blind through which I've come recedes and a mighty glacier is revealed to my senses. All in a flash. "The Arctic is a harsh land where an abundant number of species evolved in spite of hardship. For your information, William, evolution can tolerate nearly anything." It is snowing. The sun punches through a sullen sky. Snowflakes spin and swirl and in the distance I hear the thick squeaking of creatures. "It is here that the lemmings live out their own saga of overpopulation. There's much you humans can learn from the lemmings." I start off through the snow, guided by my tormentor. I've actually never seen one until now. There, clawing at the grass roots that jut out from a dry patch amongst snowfall, a lemming gives suck to innumerable offspring, all the size of my thumb, from nail to first joint. "Every three weeks from spring to fall, the females can produce up to nine young. These Arctic grasslands in the Norwegian far north are rich with abundant berries, roots, and seedlings. For the previous few years, it has been an easy life for the lemmings. Plentiful food, sufficient space. This was the fast lane, a delicious, zealous existence. These healthy lemmings have excreted an abundance of waste, which in turn has fertilized more and more plants for them to feed upon . . . Now stand back." Suddenly a large snowy owl lands not ten feet away, its wings hunched up like those of a U-2, a stalking vampire. It moves near, I retreat, and it comes in closer. I see that it's going for the newborns and I step back in to dissuade it. "You must not interfere," Gaia says angrily. "Don't expect me not to act. I don't subscribe to that time-traveler 'Don't fuck with history' crap. I can't stomach this." I chase the bird off, but just as I am doing so, a falcon swoops low, plucking the whole lot from the ground. Three of the newborns drop, like buttons in the wind, only to become a mouthful for a weasel that has been watching the goings-on. It's no use.
"Gaia, that's cruel!" "The Earth is not a California New Age vegetarian yuppie, William. Your protestations are embarrassing. Nor do they become a so-called ecologist." "You've got a lot to learn about me," I tell her squarely. "In the meantime, life must go on." An Arctic Jaeger seizes another lemming, thirty feet to my left, the telltale squeak marking its aerial demise. A red fox grabs yet another—a veritable gourmet feast. "This food orgy makes for a most efficient biological system. One of the purest and least complicated food chains on Earth. But don't let it bother you, William. Even as their predators continue to feast on lemming entrees, the lemming population continues to grow. Look over there if you have any doubts." "Where?" "To the water's edge." I see thousands of lemmings now, squirming, running, battling neck-and-neck for obscure dominance. Their fur is cinnamon, gold, the color of honey bears and as soft, I imagine, as that of sable. I reach down to touch one, only to be rebuffed by a set of modest yet carnivorous teeth. "Don't screw with them, William. They take their mating behavior very seriously." I step back and watch as literally thousands of the critters bump and wrestle and do their thing. A set of tooth marks on my index finger has not induced any blood. "Their mating increases along with their appetite. All is tied to the biological cycle prevalent in this neck of the Arctic, a cycle that is symbolic of the conditions prevailing among every species on Earth. There seems to be no end to the lemmings' happiness. A perfect system, you might claim—in balance. Right?" "I'm not sure." "Look again!" "What's happening?" "The lemmings' voracious appetites are likely to exhaust the available foodstuffs. About every four years the lemmings are hit with a famine of their own making. This is the time." Migration. They're now throwing themselves past me, running with urgency toward the water. "Leaving the once-green meadows of the Arctic, the animals search in harsher country, digging under
the snow, hoping to find additional sedges to quell their hunger. They're running out of food, out of territory, desperately looking for new land to feed upon. They'll take outrageous risks. The lemmings' little hormones have gone wild. Their entire social order is a time bomb. They instinctively know that their numbers are too large." "I presume this is when they all jump in the water and commit suicide?" "It's no suicide trip, William. That was the Disney Studios version. In actual fact, they expect to reach the other side of that fjord. Using their tiny hind legs, they have the strength to dog-paddle for fifteen minutes. But if the waves are higher than six inches, they cannot make it. Many will drown. Others swim across only to die of exhaustion on the other side." I watch a lemming literally kicking the air before going hard and stiff, its fur sopped. Another goes down beneath the small waves in the river that flows from distant glaciers out towards the wider fjord, and eventually into the ocean. Hundreds are vanishing beneath the surface of the water now. "But surely some of the lemmings must live to propagate more lemmings?" "Yes. Enough lemmings will survive to start the cycle all over again. That is the moral of the story. By the time the lemmings have made a comeback, the Arctic grasslands will also have rejuvenated, in part as a result of the many corpses left in the wake of the lemming famine. Great fertilizer! Northern herds, such as the caribou, will benefit from the new surplus of seeds and berries. And then the numbers game can be played out all over again. By such collective bargaining with nature, there is a time to kill and a time to renew. Sounds familiar, doesn't it!" "I'm not comfortable with clichés." "And why not, if they're true?" She speaks through the tunnel, light approaching at breakneck speed, infused with the familiar 'Ommm' resounding through the white adobe walls of Thyangboche. Into the waiting chair without missing a beat. The screen punches up a new light. The image rolls, vibrates restlessly, then presses forward, bored with my own sluggish speed of response, I imagine . . . She expected a more proficient tennis player to spar with. "Look, I don't mean to make light of your adorable, tragic lemmings. It's just that they have nothing to do with thinking, feeling people." "You are slow, even for a professor," she barks. "The truth is a sharp knife, William, and it cuts through all species. Every organism confronts the same numbers game. I might just as easily have singled out locusts." Her usual prelude. The monitor erupts with cicadas, big ones, ruinous ones, noisy little stinkers swarming right out of the Bible. On a roll.
"The locusts are known to swarm periodically in a swathe stretching from India to Africa. During their population boom, whole croplands disappear beneath their surge." "What place am I seeing?" "Morocco. In 1988, ninety percent of the Earth's locusts showed up in North Africa to satisfy an enormous collective appetite." "Your point in all of this?" "Boom and bust. Fundamental alpha and omega of all populations. What you call pain, nature knows is necessary." "You've chosen a rare example in nature of sudden overpopulation. Don't expect me to concede that human problems are as mathematically precise and rational as lemmings or locusts. We're complicated. Culture, religion, sexual custom, moral compunction all regulate our populations." "Culture is merely one more form of sensor." "What do you mean?" "There are sensors at work in the little brains of the locusts that have drawn them all to this food-rich gathering place." "I don't get it." She pauses, gauging the extent of my intellectual limits, I assume. "Different types of sensors exist in all other organisms. The largest trees on Earth—four-thousand-yearold giant sequoias with their thirty-five thousand cubic meters of life —respond intelligently to environmental conditions and thus prevent themselves from toppling over." "You're ascribing intelligence to trees?" "All organisms, both animal and plant, possess internal sensors that knowingly monitor their own growth. In the case of trees the conditions in question are gravity and wind. Sensors do different things for different species." She takes hold of me, my mind, my arms, my legs—the whole body is pulled forward by a force I cannot fight. It feels too good! Water all around me. I'm in it. There's something in the water with me, nearby. A tropical coastline in the distance, a shadow lurking. And then it bursts—a whale, a huge motherfucking
whale breaches right over me, like a regular circus, marine world, madness. One wrong move, and I'm dog meat. "But you're still alive, William!" "No shit!" "And the reason you're still alive is because that animal —despite its enormous bulk—has a perfect sensory grasp of every object in its path, including the coastline of Kauai, over there." A sea turtle lurches up in the swell, looks at me from within its ancient and encrusted veneer, then moves on, flipping and flopping toward some destination. The swells are high and I'm no ace in deep water. "Would you please?" "You're all wet!" she says with an unhelpful chuckle. "I guess you ought to stay put for a while." "Great idea." I go to the wash basin for a towel. So far this day she's carried on in her usual fashion, catapulting me at will to convey one lesson or another. I'd asked her about overpopulation, not intending to be jettisoned onto the north face of Kantega, into the thick of a dying lemming colony, or in front of the TV monitor at Times Square. By now I get a kick out of complaining to her, but she knows as well as I that the projections are godsends to me, the realization that something is happening, something beyond my ken. I'd asked for proof and by now I have had sufficient proof. I don't know whether she'll perform her miracles for anyone else. So far, I have no evidence that says she will or will not. Staring into the mirror, I don't know why this rather tired-looking fellow was chosen to be her front man, to be driven into the trenches. But there it is, and I'm enjoying it. "And you know what I'm thinking, don't you?" "Dry off. Get some lunch," she says. I go out across the courtyard to the refectory, such as it is. I liken it to the refectory at Dissentis, a Franciscan congeries of monks I once spent an afternoon with in the Romansch District of Switzerland, beneath the towering Alps. The table wood was polished, the food in tins: the finest cheeses, chocolates, fresh vegetables. Fruits from Italy and North Africa. Fresh bread that they baked there in the clay ovens, stamped with the imprimatur of St. Francis. Those monks knew how to live. The Buddhists of Thyangboche don't. First off, they're focused on nirvana. Not a pretty picture from what I've gathered. A paradise of cold heights, solitude, and deprivation, which they relish. Second, there's not much affection shown for animals here, or anywhere in Nepal for that matter. The Buddhists tend to wait until the 'untouchable' yak herders come up with a shank of meat. The herders are, in essence, butchers who provide the protein for the effete, unphysical monks, who don't want their own hands soiled but seem to feel no compunction about letting others do their dirty work. I had always thought that Buddhists foreswore meat. But that is not the case. In truth, they consider the animal fortunate to be eaten by a monk, for the alimentation of Buddhism is said to confer special blessings on the heavenly journey of that animal. Sacred excrement, in other words. And by the looks and smell of the hygienic aftermath around here, it's not what you'd want to call sacred. Those Franciscans were serious about their respect for all living beings. Spotless monastery. No tricks.
Talk to the birds, feed all the animals of the village with bits and pieces from their cloistered garden, save the rest for runaway children—hippie, crippled, deranged, stray, old, and infirm—a real castle of charity in the mountains, that place. And yet, I found the Franciscans too straight for my taste. The Buddhists are unpredictable, a little more down-to-earth in their ambiguities. The memory wells up in me because it's another day of rice and beets and turnips. I'm so sick of rice and beets and turnips that I could vomit. But if I vomit I have to clean it up. And there's not a spare newspaper or cloth with which to do so. I have to watch myself. I munch down on the meal and hunker back to my room. I can't believe it! There, on the bed, a Swiss round of sharp Limburger. "Gaia, you're beautiful!" "If you had seen the expression on your face when they handed you another bunch of those beets—if was priceless!" I quietly slice a piece of it. "I'd offer you some—" "That's fine. Eat. I felt guilty passing up that Italian joint in New York you suggested." "How about tonight?" "We have some work to do." I pull out my notes. "Where are we?" "You were in the Pacific, beneath a whale." "That was a good trick." "That was no trick. You see, there are sensors in that whale which kept it from coming down on your pea-size noodle, and which also regulate the size and stability of whole populations." Between mouthfuls of the best smoked Limburger I've ever tasted, an ecstasy that I certainly deserve, I push her for more data. "Stroke me," she insists, pleading femininely. "Right." I spin the prayer cylinders and with the golden chimes comes a flush of wind into the chamber. "Hey?" "Antarctica," she proudly hails. "Yeah, we've been, but this is new. You never brought the outside into the chamber before, no part of it.
What, gives?" The screen is inundated with a sea of icebergs in 3-D, close enough to touch. Water leaks ever so slightly around the edges of the computer. The physics of this is totally baffling to me. But then what else is new? "Take careful note. Because Antarctica is one of the most remarkable places on the planet for population stability." Penguins. Thousands of them. Millions of them. Arrayed like so many identical darlings all singing T just gotta be me!' The chamber is audibly stoked with their myriad hoots, craaacks, and southern-seas cacophony. "Survival itself would seem a near miracle here. But for the Antarctic penguins, sensors exist that help them survive the frigid environment. Penguins spend most of their life at sea hunting for food, but they nest on land. If a mother is late in returning from the sea with food for her young, the male—who may sit for months in waiting on his newborns—will secrete nourishment from his stomach." "What if there isn't enough food to go around?" "Food is scarce and the larger, more aggressive siblings will be the lucky ones to survive," Gaia goes on. "Two infants will of necessity compete for the regurgitated food. But in lean years, only one chick is likely to make it, and the parents seem to know that. They will thus feed only one of their young. The dead sibling's downy body will remain beneath the survivor, providing warmth in a world of atrocious cold." "You're saying that the penguin parents know who will live and who will die. That's quite a boast for a mere bird." "Yes, it is, but penguins evidence a much-evolved understanding of their situation, of their number within the larger rookery, of the rookery within the still larger colony, and of the colony within the context of available food out at sea. Among all animal populations, survival of the species transcends the individual's hunger. This survival game has its own inherent beauty." "You're not just reading your own myths into a pretty picture?" "I beg your pardon?" "You are given to romanticizing things." "And why not? Life is romantic!" "Starvation and death are not romantic." "Penguins have a higher capacity for wit than you do, William. What's more, they know what constitutes a good time. So don't be a bore. Look!"
They line up, dozens of Adelie penguins, on the icy edge of the sea, preparing in single file to dive off. One by one, tentative, looking behind them for reassurance, they plop headlong into the thirty-twodegree convergence waters of the Antarctic Ocean, porpoise out toward the bergs that surround this particular inlet, and use the motion of the waves to reascend the icy flanks. A resting spot, free from the marauding presence of leopard seals. "When penguins gather together in great numbers, the purpose is clear." "What is the purpose, Gaia, in your opinion?" "You might think of it as inventory." "You expect me to believe that those little guys are standing out there pointing their fingers at one another and counting heads?" "It's a more unconscious tabulation, William. But these animals are indeed taking stock. They must do so in order to maintain equilibrium, to stabilize their population, so as not to overconsume a limited food supply. They even exercise sexual restraint when necessary. Penguins have a few months to take such readings while tending to their nests. They have a superb grasp of available territory and food supplies and work out their social order accordingly, with much grace and cooperation, I might add." The image on Gaia's monitor has shifted from the iceberg to a rocky promontory on land, where tens of thousands of the black-and-white creatures are mingling in impeccably kept nests, built of stones, all equidistant from the others. "There is a space that separates one nest from another, a modest few paces in which can be read an enormous level of sophistication, territorial integrity, equality, population control. The result of this numbers game is a perfectly adapted, extended family. These birds have been flourishing in the Antarctic for at least three million years. Quite a success story." "But such finely tuned instincts are no guarantee of any. one individual's survival. You said so yourself." "A single penguin's survival is not the point." "What, then?" "Survival of the larger gene pool." "This is obvious. But it's no comfort to that bird, or that bird." "There are some winters when nine out of ten penguin young perish," she concedes. "But in the end, fertility replacement is accomplished. The gene pool is sustained. That's what really counts." "Where is all this leading to?" '
"Just eat your cheese and watch." The scene shifts dramatically, from the close-up world of Gentoos, Kings, Emperors, Rock-hoppers, Macaroni, and Adelie, to a sunburnt panorama of colors dipped in the frigid glaze of this southern continent. As she speaks, the water rushes near, and we slip into its depths. "Antarctica is an intriguing continent for assessing genetics. The incredible cold imposes a fierce struggle for survival on all organisms. Certain Antarctic fish species have ingeniously fashioned their own special blend of blood that works like an antifreeze, enabling them to survive in the coldest water on Earth. Covering the icebergs are hairline cracks which extend underwater. These minute fissures serve as gigantic nurseries for billions of two-inch krill, little crustaceans who migrate in summer months through the southern seas feeding on phytoplankton. This unique survival stratagem is so successful that their swarms are more congested than that of locusts, penguins, and lemmings combined." There the sea is red with their massive number, a vermilion expanse, throbbing with what must be several billion pounds of krill. Impossible to separate out individuals, even neighborhoods of krill. The mass is united, a group mind, revolting, edifying. There are individuals out there, billions of individuals with individual souls and individual dreams, so to speak. And what of it? They haplessly enter the stream of destiny, a wall of chitinous exoskeleton material sieved through the filter-feeding whales on their round-trip journeys from north to south. In their frenzy to escape death, the krill pack tighter and tighter together until the mass is unity and unity is strength. But still the whales prevail, their mouths open, swimming at a leisurely pace through the heart of the meat. Fifty, sixty thousand at a time consumed by the leviathans. Such numbers are relative here. The image changes now, to land once again, where southern elephant seals lounge on an ice-free beachhead. Steam rises from their nostrils; the weight shifts from one side to the other. A groan, a hoarse, intermittent wail as one four-thousand-pound male, his unseemly blubber protruding like baker's dough on either side of his immensity, attempts to mount a dainty, nine-hundred-pound female. Two penguins watch. "And there are other hordes of unseen but equally content creatures thriving in the Antarctic climate. Mites and bacteria that have taken up residence inside the warm nostrils of the elephant seal. And something else is at work here: Unlike the simple feast-or-famine numbers game played out by the lemmings, the female seal will abort her fetus under the threat of famine. This hormonal mechanism keeps the seal population in tune with the limited supply of food. "Throughout the Antarctic," Gaia goes on, "all species are living testaments to instinctual foresight and balance. There is a compulsive equilibrium throughout the biosphere you call Earth. Nearly every species, whether New Yorker or albatross, is quietly and expertly aware of it." "Okay. I get it with respect to the South Pole. But what of those juggernauts my own species has implemented?" "Be specific, William."
"You know. Gridlock? Impasse? Genetic traffic jams? What if stability cannot be reattained? Look at the numbers." I address the keyboard, typing in a set of data I know well. And as I type, the monitor lights up with evidence I've been tracking ever since colleagues of mine at the Club of Rome came out in the early 1970's with the 'limits to growth' scenario. Time of Christ—2 to 300 million people 1347—400 million 1500—700 million 1850—1 billion 1930—2 billion 1961—3 billion 1974—4 billion 1987—4.7 billion 2000—6.8 billion+ 2035—12 to 15 billion "So what do you make of such escalations against the pure waters of your Antarctica?" I ask her with a plodding insistence. I want to reach the bottom of this trench, this pit of exponential growth without meaning or antidote. "You're no different from krill." "Who are the whales that will control our number?" "Hah! That is the question. But whatever chaos should enshroud your species, remember: The greater force of life is always stable." The numbers vanish, replaced by the image of a sweeping spinal column of an extinct reptile. "The large dinosaurs weighed from five to fifty tons. Some were over one hundred feet long. Though they reigned on Earth for over one hundred million years, they ultimately died out." "I know that. What's your point?" She speaks with unerring confidence. "The dinosaurs were replaced by much smaller, timid creatures. Nature relishes the flip-flop, constantly altering her priorities. The life force is perpetually experimenting with new genetic blueprints."
And as the dinosaur fades out, a black-and-white image of an enormous child surfaces. An older man stands by his side, his head reaching the boy's waist. "This young man was nearly nine feet tall by the age of twenty. But most gigantesque organisms don't work. The creature's too large, or it becomes unfit for the environment." A large cyan-stained cancer cell bursts out toward me, followed by electron microscopic slices of nodules, nuclei, other metastasized cells of all shapes and sizes. "Mistakes even happen in a normal organism. As when its very cells mutate into a cancer. But forget such failures. What counts is nature's marvelous flair for contrasts, her insistence that the overall flame of life never go out, no matter what the cost. There's philosophical grandeur in it. Even if individuals get snuffed out, even if your whole species were to disappear." I stand up and walk away for some air, opening the window. Outside, prayer flags ripple in the afternoon breeze. Clouds have formed over Kantega. Tsering and team are in for a snow flurry, and a cold night. I turn, facing Gaia, feeling separate. "I think your glib attitude stinks. Are you so removed?" "I am a computer." "I! There! You said it again. I! What, who are you?" "Don't threaten me." "I've come twelve thousand miles to suffer your rhapsodies and platitudes. Now what do you know— you've sucked me in. I can't think straight." "Calm down. I understand." "Well, a computer wouldn't understand. So what the hell does that make you? . . . I'm talking to you!" "All right. I'm a feeling computer, sixth generation." "Well then, feel, dammit. For me. Not for lemmings or dinosaurs, but for human beings." My mind reels. Do I really want something from her, other than data? My heart is in it. And I have the uncontrollable urge to shake her, to drive sense into her. But it's not sense, per se, it's emotion. At this moment I am convinced that Gaia is no mere numbers cruncher. I have had intimations of that before, but then she disappointed me. But now I'm convinced. She's got heart, however exasperating the 'blood' which pumps through her circuitry. "It's life, William, life that transcends the human being." "Transcendence . . . That word went out with the 1960's, along with flower power . . . ."
"If it went out, then what are you doing here?" she retorts with a dry, lean concision. "Look. You cannot rationalize misery just because nature has a hand in it. Evolution is not always right," "Oh, really?" she says, toying amusedly with what must sound to her like mere cant and gum ache. "I mean, human beings are endowed with a conscience; we'd like to curb mistakes. And why not? One can predict the flip-flops, after all, at least at the cellular level—at the rate of one freak per one hundred thousand. Cancers, giant cells found in bone tumors and chronic lesions. Cells that are diseased precisely because they're overpopulated. I see no philosophical grandeur in the horrible suffering such mutations cause. Do you?" "I detest suffering. That's why you've got an immune system, to combat such cancer. In addition there is the cytochrome c molecule, a protein one point two billion years old that contributes formidably to cellular stability, thereby helping to preclude diseased" "I am no physiologist but I know that more people are dying of cancer every day than ever before. Where the hell's the stability in that?" She waits. Measuring, with an uncanny, palpable energy, her words. "Sit down, think a minute. How many times must I repeat myself? You are courting disaster. Trouble which has nothing to do with biological cycles, or circumstance. Your brain bristles, your cultures grow weak in will, venting rage, providing every conceivable outlet for pain." I sit on the bed, tired of the day, tired of her insistence, tired of thinking. But she won't let me off the hook. "There are priorities on Earth that must work themselves out through strategy and counterstrategy, disease and health, immensity and the minute. Those priorities pertain to biological stability encompassing all organisms on this planet." The screen is again flooded with speculai, minutiae, the odious, microscopic disasters that curse the body, leaving residue of death. Colorful terror. "These cancer cells, AIDS viruses, and diseased tissues are all part of that great adventure. Such worlds within worlds each indicate a population that is perfectly poised between a numbers game and a numbers fiasco. Members of your own species are frequently caught up in the maelstrom. Yet these minute organisms are not good or bad, William. They all play a crucial role in the perpetuation of life on Earth." A tickling sensation, in my armpit. "What are you doing?" "Whether in a square centimeter of human armpit, where there are exactly twenty-four point one billion bacteria—" I feel a nudge under the arm and lurch back. "You never touched me before!"
But she ignores me. "Or among trillions of organisms flourishing across the whole planet. Swarming in hot Icelandic rivers . . . eight million multicellular creatures hiding in a square inch of California salt pan . . . abundant microbes on the bare sands of the deserts. And in the high Himalayan snows. Everywhere! You've got one hundred billion living cells in your brain, billions of yeasts, bacteria, and viruses crawling on your forehead. Passionate pawns in a dizzying game whose higher purpose is a living planet, even if it means the sacrifice of individuals, the occasional Black Plague. Certainly no reason to fret over it." "Higher purpose, you say. How can nature be so impressed with big numbers and so indifferent to individual suffering?" "Assist, please." I lean forward to the computer, lifting my fingers to type the usual keystroke. The blue haze waits for its electrical directive. Then, "How can I assist? I don't know what to ask. My species takes death very seriously." "Does it then?" "Nobody wants to suffer. If you're a machine as you insist —gallium arsenide, silicon microchips, crazy plastic tubing, and a monitor from—where, Japan?" "Taiwan!" "Right. Taiwan. Well, I couldn't expect you to understand." "I understand very well, William, I'm trying to help you. You and your kind have worked yourselves into one walloping cul-de-sac." I leave the chamber, heading for the outhouse, where I reckon she'd never follow. She reads my lips, my mind, sees into my eyes, hears my every meditation. But not on the toilet. I have to believe that. And I have to work some things out which she'd best not be privy to. It's a great outhouse, the best in Sherpa country, especially at sunset. Through the keyhole, Ama Dablam rears its mighty summit in a dazzling snow plume of wind and waning sunlight. A phenomenal prospect. Be firm, I reason. The separation between us hinges on much more than fine hairs, grammar, priority. The difference lies in our respective evolutions, or so I must assume. Her silicon, my carbon. Heart of sand, heart of passion. Matter versus mind. She's spoken to me, given me cheese, directed me to private moments in my past, and conveyed me across the planet and beyond, but she has not proven to me that she's real. I guess that I still hold on to the black box theory of our relationship. She is an unexplained phenomenon, like UFOs or yetis. I know there is an explanation. I head back into the chamber. I see the Lama on my way across the outer corridors of the monastery.
The holy man has just obtained two newborn puppies from a herder passing through Solo Khumbu, the local Sherpa district identified with the Khumbu icefall beneath Everest. The Lama has decided to rear them for his own. "Any news from New Jersey?" I ask him, our mutual way of generating conversation about outside events. The Lama is devotedly carrying his five-band Sony shortwave, the general source of all information about the mundane world surrounding Thyangboche. "There's a new restaurant in Kathmandu," he says with serious determination. "Oh?" "A zoocheebar. I must try." "What else?" "Oakland A's win game." "That's good. That's very good. Who'd they beat?" "Don't know." "What else?" "How are you?" "How am I? I'm—I'm doing great. I mean I'm okay, I guess. Nice dogs." "Tibetan. Refugees. That one is reincarnate Lama, I think," he says in choppy English with a grin. I stroke the puppies, bid adieu to the Rinpoche, and return to the chamber. Troubled. Calculating. I move directly to the computer table and state my concern. "You're very cavalier when it comes to the sacrifice of individuals and the occasional Black Plague, as you put it. Well, I have a problem with your attitude." "What problem?" I'm ready to enlist her help. And she seems anxious to comply. We've both got a stake in this that is beginning to outweigh the simpler compulsions and priorities of writing a book, I mean obviously. At the same time, the book seems to be very important to her. I'm not sure why, but every intellectual séance of ours adheres to some kind of master plan, part my intention, and part her doing. I can't tell if she's inadvertently directing me toward the same historical and literary goals, or if we are truly in sync. "Musicians and mourners," she says suddenly. "What?"
"You'll understand. Run a search." "Fine." Voice-activated parallel circuitry obsessions. The prayer cylinders begin to spin. They spin so fast as to ignite a sulfurous mist that clouds the whole chamber. It's a joke. Then stillness. On the screen, a silhouetted rock wall. "In there!" she says. "You take the first step!" "Uh—how?" The cave reaches out to me, its dank passageway pushing forward, it seems, as the recess pulls back. The perspective is all of a trick, fused with the rising melody of chanting in a language I don't know. Trompe l'oiel. The sound of distant drums, of horsemen. And then a droplet of cold water smacking my neck, having dripped from the cave's ceiling. I'm there. "I love Turkestan!" I shout, submitting once again to my tormentor's kinky idea of a good time. A bazaar in the desert. Later afternoon. A Bactrian camel caravan approaching. Behind me, the Buddhist caves, painted in the Middle Ages by traveling artisans whose devotion to the afterlife never ceased. The town is known as Bazaklik, Chinese Turkestan. I enter the cave complex, with torch in hand, purchased from one of the many Uzbek venders. "Where am I going?" "Shrine number nine," she whispers in the dark. I walk, a tourist map of antiquities in hand. Stooping to enter the claustrophobic site, I am suddenly surrounded by a sort of Tibetan Sistine Chapel, painted eleven hundred years ago. An assemblage of Himalayan traders gathered to bid farewell to their guru. Arabs, Chinese, Iranians, and Tibetan nomads all joined hands, offering a universal Buddhist prayer—the wish for a perfect life somewhere down the road. The painting is called "Musicians and Mourners." "Superbly ironic, no?" she asks. "I'm not sure." "Study their eyes." "Yeah. Okay. What do you see?" "I'll tell you what I see," she declares fervently. "I perceive the insistence upon balance that marked Tibetan culture and fulfilled a peculiar role in the greater puzzle of medieval history." "Goddamnit, you're good at mouthfuls!" "Look at the Buddha figure. Almond eyes, Modigliani-like."
"So?" I'm less amazed by her easy ability to link esoteric data than by her penchant for singling out a particular artist in the midst of it all. And yet, studying the painting, I see that her analogy could not be more precise. "You should recognize a profound acknowledgment of suffering in those eyes." "All right, what if I do?" "Amid such suffering, Tibetan Buddhism set out to change the world. Through enlightened sexual practices and an obsession with the afterlife." "Easier said than done, to be sure." She says nothing, unhumored by my cockiness. We're truly beginning to know one another. "They restrained their number for agricultural reasons," she goes on. "No condoms, no crocodile dung, no moral restraint, and no infanticide. Not in Tibet. But rather, polyandry, a system by which the woman limited her offspring and married several husbands, as many as a dozen. Men raised the children, while the women worked the fields. With a short growing season of three months on the Tibetan plateau, and thus a most finite food supply, Tibetan sexuality discouraged overpopulation by placing emphasis not upon human fertility but sexual passion. Nirvana. Multiple orgasms, sustainable agriculture, stable population— a divine formula at the heart of Buddhism." I stare at the Buddha, leaning in the semilight of the cave. I am alone, but outside, I hear the fanfare of some celebration. I have to say that Gaia's thesis is one of the more arresting doctrines I've ever heard. Probably bullshit, but provocative bullshit. Now she continues. "Take the whole cosmos inside of you, delineate between thought and action, be liberated from desire. For the tantric yogi, this yab-yum, or higher spiritual union, had its basis in the sexual act. But tantric ritual stipulated that the male prematurely withdraw his penis during lovemaking, the emphasis being, as I said before, on zero population growth. Very practical. Hardly bullshit. Now, look over there!" "Okay. A painting of some woman. What's the big deal?" "She's a goddess." "Fine. A goddess. You've shown me many before now." "No ordinary goddess, but Tara." The painting depicts a black-and indigo old hag, bulging eyes, buckteeth. She holds a skull and is surrounded by cremation grounds. Death issues from her loins. "Hideouslooking crone. I wouldn't contemplate yab-yum with that sucker on your life." "She's Buddha's counterpoint, you dumb slob!"
"Sexual congress that bears no fruit; agricultural pragmatism; Buddhist obsessions with the other world; the Black Plague. What's going on, Gaia?" "Go outside. Today is Buddha's birthday." I return to the fresh, desert air. The caravan has unloaded its storehouse of goods, and hundreds of locals dressed in Mongolian turbans, skins, furry boots, and colorful ribbons have converged to do some serious bartering. In the meantime, a long phalanx of red-robed monks is celebrating Buddha's demise and ascent to heaven, marching through the desert. "What's so ironic?" "The culture which venerates death as its supreme goal, its salvation from this earthly existence, played host to the Black Plague." "From what you said a minute ago I thought these religious fanatics were screwing themselves silly. Gang-bangs along the high road to heaven. You've lost me, Gaia. One, why pray for salvation when you've got it already in the flesh. Two, what does the Black Plague have to do with any of this, except perhaps as some divine retribution?" "Seven hundred years ago," she says coyly, "it was in just such a bazaar, along one of the ancient Asian caravan routes, that the Black Plague burst ravenously from flea, to rat, to human, all under the eye of the avenging Tara. It all balances out!" "What balances out?" I demand, irritated, outmaneuvered. "Human population," she says emphatically. "Sterile Buddhist sex, devastating plague. I don't see it in your terms. The disease could have destroyed my entire species for no good reason. Where's the balance?" "There are reasons for everything, however inobvious or contradictory those reasons may seem. Buddhism teaches that life is a grab bag of musicians and mourners. Winners and losers. Buddhism celebrates this seeming contradiction. The very word 'nirvana' means death, as well as paradise." I think about that, casting an earnest eye toward the ruby-faced people around me, ruddy old men, toothless old women; young people raised on koumiss, mare's milk, in yurts where the world is honed by elemental work and elemental pleasure. Gaia has spun a far more elaborate equation of human affairs than I am willing to accept. The whole conflicting history of ethics and biology triggered by the plague, and by subsequent plagues which lay waste so much of the known world century after century, are not so easily reducible to mere ghosts, haunting the painted caves of Bazaklik. "It doesn't work for me, Gaia. In the fourteenth century there was little that anyone could do to alleviate the successive disasters that were unleashed upon my species. No amount of prayer—and certainly no amount of sex—could stop the onslaught of disease that stretched across Asia to Europe and London. One third of the human population died. The only winners were all of the rats and fleas crowding the
dark crannies of human life, nurturing the plague, feeding on the carnage." "To you it is merely a dirty little rat. But in fact it's a noble creature, William. The rat has always assisted humanity." "Oh, sure. A real mascot." "It follows mankind wherever his filth accumulates, and has even been known to dispose of corpses. Its bloodstream flooded with disease microorganisms, the rat frequently passes on the plague to your species." "That's a real help." "Think about it: In this way it serves to counter human overpopulation, no?" "Look. Thirty million Europeans died of plague. It must have been one of the most painful periods in human history. You're not suggesting, Gaia, that all these deaths somehow served humanity?" "William, the numbers always even out. Despite the plague, Europe managed to double its population within one hundred fifty years, and today such growth is explosive. It takes a mere decade now to double the number of Homo, sapiens on Earth. At one time in humanity's early history, it took fifteen hundred years to do so. You cast the dice. You called the shots. I'm merely responding to your earlier query about genetic traffic jams. Remember? You worried that human population was not as simply managed as lemmings, or penguins. Well, that's true and it's not true. The truth is in the boom and bust." "And the untruth?" Wham! Swoosh ... "London?" "Yep! The same lack of hygiene that favored the spread of the Black Plague continues to propagate disease today. If you get close enough, William, you'll recognize that those pigeons are covered with excrement and germs." Trafalgar Square. I've been here many times before. Today the pigeons fester in full force, crowding the delighted tourists who pay their twopence for bags of pigeon feed. A national pastime. "There are countless organisms being nurtured on the pigeon's claw, just as the plague microorganism found its host in the blood of a rat," she expatiates. I wander through the fray of Londoners and avians. "Such diseases are fundamental to population stability," Gaia continues. "But there is a second, yet more curious benefit derived from these birds that also serves to curb overpopulation. In the early nineteenth century, during Admiral Lord Nelson's time, London was one of the filthiest cities in the world, teeming with garbage, and with the garbage, plenty of rats, fleas, and pigeons."
Five of them alight on my shoulder. I can feel the grime, elaborate microorganisms making a beeline up my neck, for my inner ear . . . "Now, pigeons—" "William, be nice to those birds. British warfare had the pigeons of England to thank for its superior gunpowder." "What do you mean?" "Seventy-five percent of the explosive mixture came from saltpeter, an ingredient obtainable from soil rich in dung and urine. The millions of British pigeons who thrived on human refuse provided that steady supply. England blasted her way to glory on Nelson's ship, the Victory, setting a precedent for all future warfare, because British rats and pigeons were so prodigious." "One of them has just made its contribution to the saltpeter of England." "Don't worry about your sweater. There are plenty of dry cleaners in London." Lord Nelson stares down from his seventy-foot column, surrounded by a legacy, according to Gaia, of pigeon feces. She has a way of warping history. I'm beginning to appreciate it. Even if it means perpetual jet lag. "Overpopulation creates filth. Filth nurtures rats and pigeons, which in turn spread disease and provide some of the ingredients for weapons of destruction. Your species needs more and more of these countermeasures to inhibit its rapid population growth. Human violence successfully fits that bill." "Do I understand you correctly?" "There's no mystery, William. In the twentieth century, wars and other acts of aggression have wiped out two hundred million people. At the time of Lord Nelson's military conquests, there were those who recognized that humans have to die to stabilize the population." "Who are you referring to?" "Thomas Malthus was one such observer." "I figured you'd mention him. Very Gaian character." "He was the author of the famed work Principles of Population." "Of course I've read it." "Then you know that in the late eighteenth and early nineteenth centuries, Malthus prophesied future poverty. A world without proper hygiene or shelter. A world gripped with famine that would make the Black Plague look like child's play. Malthus addressed the problem of the homeless and the hungry in Great Britain. The remedy he proposed for his generation and for all future generations was eminently practical." It's night. I wander beneath Waterloo Bridge, where dozens of homeless Brits have carved out a niche
for themselves, sleeping in spaces between cardboard boxes, scrap, bolts of tattered cloth, their ribcages flat on the hard, damp pavement. A cluster of young people, orphans of the dark, hovers around a fire brewing Darjeeling tea atop a canister. The British are themselves, even wrapped in burlap on a freezing night such as this. Gaia echoes Malthusian mumbo jumbo in my ear. "The laws of immutable nature legitimize attrition. You must not subsidize an untenable and undeserved baby boom. Better a man should die alone and poor, than that a large family should be dragged down with him." "That's not an answer," I say in repudiation of a whole way of thinking I can't accept. Such a philosophy was codified during the days of World War I with the practice of triage, the separation of victims from survivors. Those with little chance of survival were left in the trenches to die. Those who might make it were thrown in the back of open trucks and ambulances. In more recent times, the biologist Garrett Hardin referred to the process of elimination as the "lifeboat ethic." But I find such choices inhumane. "The poet, e.e. Cummings, drove one of those World War One ambulances," she says, as if to sanction it with aesthetics. Standing in the cold this night, I see only the brutal bitch in Gaia. "There must be calmer, less painful remedies for life's unfairness," I repeat. She disagrees and tells me so right there, in the midst of bedraggled and unemployed people, folks who are hungry, like those who fill the streets all over the world, sad souls crowding the finitude of life in developing countries, quietly dying in the dark, unknown ghettos and back alleys. "Malthus was merely acknowledging the fact that human population, aided by an industrial revolution, would multiply far more rapidly than would agricultural yield. In the Orient, Africa, South America, and throughout Europe, this explosive population growth demanded a remedy. Malthus had a solution. Forget welfare. Forget the war on poverty. Just let them die out." "Malthus was a jerk. No, Malthus was barbaric," I proclaim. "I think you'll find that he was rather prescient in his day, William. Especially if you compare his thinking with that of his later opponent." "You're referring to Karl Marx?" "That's correct. Father of Tyranny." "Get serious." "An egomaniac." "That's not even worthy of comment." I turn to walk away. She calls back to me, scornfully, not wishing to be disengaged from her punching bag. "What could the
arrogant product of such white Anglo-Saxon affluent trash know about communism?" I pass toward the intersection, headed for a great Chinese restaurant in Piccadilly. "It just so happens I did research on Marx and the social ecologists of nineteenth-century England many years ago." "Oh, well, excuse me!" she apes. "Come on, let's go to the British Museum. That's where Marx did his research." "Tomorrow, when it's open. Have a nice night!" "Gaia?" I move rapidly, with a sense of terrific giddiness. Dinner. Perhaps take in the theater—I caught a notice at Trafalgar that Alec Guinness is starring in .A Walk through the Park ... a night out, maybe even a massage at one of those Korean dives. But as I hail a taxi, it dawns on me that I haven't got a single pence—nor credit card—to my name. She's fucked me. I continue down the street, past a barricade which separates the night world of Waterloo from the twentieth century. And as I turn to regain a foothold in reality, I realize that she's testing me. Below me on the pavement is an old woman, crying, four kittens curled up in her skirt. Her sole companions in misery. "Milk, mister?" "I'm sorry." Standard buffer. I even use it in Pasadena where they sleep on the sidewalks so that you damn near have to step over them. "Set down then. No use standing in the cold," she says. Something connects in me. Something about her eyes. And if Marx was correct, then there has got to be the seed of a remedy in these people themselves. A humanity waiting to blossom. I'll just prove it then. I spend the night with her. Morning comes slowly. Nothing blossoms at the first hint of sunlight. Several hundred near-corpses have collected to either side during the night. How come they slept so soundly in their threadbare raiment while I shivered like a son of a bitch? The kittens aren't faring so well. Victims of a mistress who herself will probably go on this way for a decade, before dying out. The realization stings. No Marxian seeds in this field. Then, in a mist of familiar blue, tears turn to cackles. The woman rises up, like some tower of light, twists, and frees herself from the thralldom of that dark and subterranean hole. The whole street seems to light up. There's no longer an old woman. No kittens. "Gaia? Don't fuck with me!" A phantom of energy calls back, "Lighten up, dick-head!"
And just like that I am deposited in Marx's very own chair in the British Library Reading Room. I've been here before. This is where Karl Marx, cold, hungry, and desperate, would come to read and write. And think. Probably to keep warm as well. He must have felt as stiff and shitty as I do right now. His home life was fraught with misery. "Are you there?" I ask. Gaia doesn't answer. Perhaps she's out getting tea and scones. I leave the building, heading for 28 Dean Street, not too far away. I have a hunch. It's her way of cat-and-, mouse, from Bazaklik to Trafalgar. The world is a game for this woman. And why not? In the middle of a message, cryptic leads strewn across continents. She's led me all along, from JPL to the shadows of Everest. Now I sense she's zeroing in. But for the moment", it's me and London. I've never felt so free, like a starship commander, hurled from planet to planet, endowed with a secret that no one else among my species has been privy to. My back aches from a night of squalor. I feel proud for having survived it. Silly pride. I cross the street, mindful of the contrary flow of traffic. Dean Street looms up ahead. It was here that Marx and his family lived, on potatoes and cabbage, for nearly a decade. There it is. A restaurant now. Inside, a table in the corner with no one seated, but a steaming pot of tea and three hard biscuits. The napkin has been crumpled, the check paid. The waiter has not cleared the table. I help myself, and scoot up the stairs. You see, I know the place. And I am sure that those biscuits were left for me. The room is also as he left it, four flights above the restaurant. For five years while writing his most seminal works he sat up in this room. This awful, dirty, freezing room. Half a dozen people stuffed in the wooden enclave, creaky floor, no plumbing. Marx was furiously writing his revolutionary doctrine in an effort to save the world. I sit on the bed. And sink toward Marxist oblivion. "His philosophy was impoverished. Written of poverty, destined to remain poor." "It's you!" "You enjoy your walk?" "Yes. Thanks for the biscuits." "Poor Marx. He'd save the world but lose a child." "You're referring to his daughter, Franziska." "Yes." "No one ever said that political ecologists were well paid. She died right here. And when she died, Marx and his wife Jenny couldn't even afford a coffin in which to bury her." "My point precisely. Malthus was more in touch with the reality of overpopulation. He sought to curb the agony before it multiplied. Whereas your Karl Marx struggled to epitomize poverty and pain as something noble and desirable. I don't think so. Go back to the stacks which accumulate dust. See what his industry has wrought. You may be in for a surprise. Oh yes, there is foment in Albania, dissertations
churned out in Rome, thriving communism in Calcutta, and massacres in downtown Beijing. A century of turbulence in the name or guise of power. But the real legend of Marxism has more to do with the romance of an impoverished writer." Instantly, I am back—we are back—in the Reading Room, upstairs, where the books are stacked in twelve-foot interminable tiers. The ideas lounge, biding their time. All of history—what Dante referred to as mere gossip—lies waiting and open to the curious, to the masochistic. "Marx camped out here in the eighteen-fifties," I tell her, "in the midst of the stacks of precious manuscripts, Egyptian mummies, obelisks, and cowrie shells. He was a brooder with a monumental formulation, his own vision of a balanced population. You may quarrel with his own private life, but his motives were pure and unsullied." "You're on thin ice, but keep talking," her voice echos in the open rotunda of the ornate library. I find the book in question, open it to a spot I recall, and read: "Well, Karl Marx wrote, in, uh, Das Kapital, 'Capitalist production disturbs the circulation of matter between man and soil; it develops technology and the combining together of various processes into a social whole, only by sapping the original sources of all wealth—soil and the laborer.' He was fundamentally an ecologist." "It's too academic. What does it mean?" "Well, ecological crisis. The law of diminishing returns." "Human law. Not natural law," she says reprimandingly. "Look Marx was speaking of alienation, of man from nature, and by logical extension, of man from himself. Now that is a compelling association, not to mention a damning critique of western-style capitalism." "Marx was merely a theorist. Out of touch." "Hardly. Marx identified with the poor all over the world. Give them jobs, give them land, and they will sustain themselves. Now I'm not what you'd term a Marxist, but I see the wisdom in equal opportunity, call it communist or capitalist. In his astute observations of the British economy, it wasn't hard for Marx to see that the working classes were restless, struggling for a better shot at happiness. Lord knows that Marx struggled all of his life." "As I told you, Marx's impoverished family life clearly motivated his ideas. Those ideas were a big hit in Russia. They triggered a revolution and served to provide a standard of living, however minimal, for today's three hundred forty million Soviets. But as you know, the Communists have lost their hold on the Soviet mind. Capitalism is the thing, now, and Marx, a futile name from the past. Furthermore, Marxism is no solution for poverty and overpopulation in the Third World, where the sheer numbers of people overwhelm the finite resources locally available. And that poverty and dereliction continue even in today's London, just blocks away from where Marx came up with his grand scheme. You spent the night there. You understand."
"You might have gone easier on me," I tell her. "The solution Malthus set forth was a much more effective antidote to overpopulation. This is a feastor-famine world. Some live, some die." "That's too simplistic." "Malthus was a hardass, I'll admit it. But that's where nature's leading. If you have any further doubts about nature's law, consider what happened in nineteenth-century China, when a Catholic Fundamentalist attempted to enact a Marxist revolution in a country whose population bomb was ticking." "I know what you're getting at." I walk not thirty feet away from Das Kapital. "Hung Hsiu-ch'uan, who left posterity with the most dramatic and perilous numbers game in human history. The original documents ended up here, not far from those of Karl Marx's own writings. I assume that's what you're referring to?" "Correct." "And like Marx's work, the writings of Hung would have a critical impact on our modern world." "Woefully critical, William. Call it existential if you dare. This is where all of your philosophical hocus-pocus leads. Hung Hsiu-ch’uan wrote an intriguing manuscript that combined the inspiration of a Marx, and the sobering calculations of a Malthus—taken to their logical extremes." I feel her point of view shifting, as fluctuant as a sea twister, spinning a web of history like so many silhouettes, undecided premises, unfulfilled yearnings. The free association of mood and message begins to come unglued—I know that sensation— And then— Wham! I hit the street, harder than usual. For a brief instant I'm alone, crouched behind a stall that smells of freshly sautéed potato chips. The vender's hovel stands along a wide open tree-lined boulevard. Tall locust trees. I emerge into the opening. The force of tens of thousands of Chinese, on foot, riding bicycles, filling the world. A stolid and uninviting chaos. "The People's Republic of China. Canton, is it not?" "Try China, simply," Gaia responds. But there's something wrong. My God, I've never been to China, but this can't be. The road is dirt. There's not a single vehicle. Has the country regressed so much since the massacre of the students? And there—a man in iron shackles, dragging his chains behind him, begging, a large bamboo dish around his neck, right out of The Last Emperor. Old people in country clothing. Hundreds of domestic fowl, headless, on large wooden trays carried atop the heads of a contingent of merchants. A coming storm. Lepers beside the road, all begging. And
emaciated children, ragamuffins, naked. I don't understand. "What's the date, Gaia?" "1847." Okay, Bill, I muse. Not the first time she's pulled this shit. Calm yourself. You 'II be fine. Play it out, I tell myself. I breathe in the mystery. Like a Connecticut Yankee, feeling the fever of dislocation. Sensing horrifying turmoil everywhere around me, but confident of my Gaian immunity to it all. "You seem to know Hung's work," Gaia says. "I've read about him. I know that it was from this city in the years 1850 to 1864 that Hung Hsiu-ch’uan, imagining himself to be the younger brother of Christ, instigated a religious upheaval throughout China that succeeded in killing at least twenty million people. The Taiping Rebellion, as it was known, spawned an unprecedented famine. Seventy million Chinese would die." "That's right. Now, see that church down the street?" "Yes." "Go inside." I walk, dodging a world of rickshaws, tinkling bells, hawkers of dead ducks and dogs. The church stands surrounded by a mission of some kind. Inside, I hear chanting. The Vulgate. I enter a world of Oriental regalia, Asian incense, Christian pews, and Latin prayer. Gaia whispers to me. "In his youth, Hung had received a book from a stranger on the life of Jesus. Ten years later, in 1847, the thirty-two-year-old Hung came to this Catholic mission in Canton. For several months he studied Christianity here, annotating the New Testament with an entirely original interpretation. See him?" A young man, goatee, braid, high cheekbones, and a determined insanity permeating his stooped, religious immersion. Destiny hovers around him like a winged avenger. I could walk up to him, seize him by his collar, and kill the son of a bitch. If I were to kill him now, this moment, knowing what I know, would I violate some implacable law? Would she save me from the consequences? "Gaia?" "No, William." "No what?" "You must not give it a thought. You can't touch him. Those surrounding him are haunted by the same impulse. You'd be a silent martyr, unknown, and Chinese history would proceed, with or without you. Even if you managed to kill them all, every last person in this church, this day, even if half of the world would fall beneath your blows— the half you allege is bent on self-destruction—it wouldn't alter the outcome. It would be the outcome! Half the world fell in any event. There is no difference between the act and the revenge. Not in human culture, anyway."
"What am I to do, sit back and watch the next twenty years of bloodshed, when I know what's about to unfold here?" "You have information which is merely a veil, a device I have engendered, William. Watch, listen, feel, but do not attempt to interfere. You must know that Hung's insights and turbulent road to power formed the basis of Chinese communism. And today, the Chinese are no longer starving because of it." "Yes, but Hung's personal ideology would leave China to experience the worst turmoil in its history. It could have been avoided. Pain minimized." "I suppose that's the price one pays for great dreams." There is a low rumble. Light flashes across the stained glass of, the nave. Explosions? Or a thousand days and nights, compressed into the space of a microsecond, suns and moons passing at high speed in an arc across the sky? No—definitely explosions, and stampeding horses, warriors, the clash of swords. It has begun. A wall is detonated, bricks collapsing all around me. "Flee!" Gaia calls out. "Flee from Marxism!" I run for my life, out into the street, where all hell has erupted. "That doorway. Enter it. Now!" I dodge the mayhem, tripping over a body, then another. Horses have been killed, mules ripped apart by rifle fire. Hundreds of watermelons roll down the street. Cannon fire. I push open the door. A hatchet narrowly misses me. "It's okay, okay!" My arms are raised. An old woman with a hatchet in her arms circles me, her daughter, or granddaughter crying in the corner, beneath a colorful medley of hanging silks strung from manila hemp lines between wooden beams on the ceiling. They share utter disbelief at the white man in their midst, a sight no doubt more arresting than the war which has just broken out. "Hi. I'm William." This is insane. She puts down the ax, then gets on her hands and knees praying before me. This is nuts. She must think I'm with the British Consular General's office. My recall of the times hints at the Great White Hope. I calm the poor woman who obviously fears for her young. On January 1, 1851, Hung called for a Heavenly Kingdom of Great Peace—a common front of farmers and miners whose ranks were to swell to over one million. They intended to overthrow the corrupt Manchu rulers of China and establish a country in which all property would be held in common. The explosions are ripping the city apart. For now, I feel safe. Gaia leaves me in this house for days. At night, the darkness is punctuated by howls and explosions, the roar of undecipherable Cantonese fury, writhing inferno, reeling horses, a world gone crazy. I speak with the old woman and young girl, a long-haired beauty, skin and bones and luster that emanates from
perfect eyes. Eyes I seem to remember. Only after some time do I realize that I'm speaking fluent Cantonese. Gaia! They have a crystal, a real ball of crystal. And through it I can see things ... I sit night after night with the two ladies, viewing the war. No explanation. A conspiracy of knowledge. Who are they? How has Gaia arranged this island of safety in a sea of overwhelming destruction? The Taipings sweep north into the Yangtze River valley and capture the city of Nanking, where Hung has all rivals murdered and then begins issuing his own crazed manifestos, integrating communism and Christianity. To think that I might have prevented it. Why did she forbid me? In the morning after the third continuous day of battle, the young girl goes out for water. Silence reigns in Canton. Everyone is walled up. The door is closed behind her. I watch as she cautiously crosses the muddy boulevard with two closed wooden cartons slung by a stick over her shoulders. She heads for a nearby dwelling. Smoke rises throughout the city, or as much as I can see of it. At this moment in the crystal ball, Hung and his hundreds of followers, surrounded by Imperial forces in Nanking, all commit suicide. A horrifying show unlike anything I've ever seen. They go about slicing one another with their swords, blowing their brains out, detonating guns in throats, severing heads, until not a single man or woman remains. There is an American general riding tall on his horse, ordering the Chinese ranks which have closed in. Confusion amid corpses. A decade compressed into a few hours. I look yet more closely and see bodies strewn across the farmsteads, city streets, crumpled into high stacks at the base of stairwells. Suddenly, in an English inflected with primeval Mandarin, electronic, grim, larded with a familiarity that rivets and reveals, the old woman speaks: " 'That which is cruel and self-reliant must win out. Irrepressible violence is man re-creating himself.'" With that I am hurtled home. The same tunnel of dark-, ness, tunnel of light. Into my chair with a hard thump. One of the casters collapses. The chair sinks and I fall on the floor. Lavoris stares, bemused. I stand up. On the screen, a lassitudinous purple pulse. The soothing electronic thrum of the printer cogitating unguessable histrionics. "Gaia? Between 1850 and 1880, China experienced the highest death toll in history. That's hardly what I'd call man re-creating himself." "On the contrary. Hung's manifestos would eventually cause a true rebirth in the form of a modern agricultural revolution. According to Hung everyone was to farm, everyone to eat, everyone to have fuel. At least that was the original intention. All land would be allotted to men and women over the age of sixteen. Some portions of land went to children. Hung's blueprint for Utopian communes all over China were actually adapted by Mao Tse-tung a century later." "Hung's vision of a farming paradise engendered nothing more than a fiery furnace, the beginnings of a police state, terrible overpopulation, and catastrophic famine. I was just there, thanks to you. \ saw it."
"However much a deranged tyrant he may have been, his instincts were good ones. He anticipated overpopulation, and his policies contained the seed of family planning, state-granted gratuities for single-child families, lUDs, forced sterilization, and induced abortion—the techniques of a Chinese government now bent on checking its population at one point four billion by the year 2000." "These are measures that you condone? Historical events that you would sanction?" "That which is bold, cruel, and self-reliant must win out. Whether you listen to Charles Darwin or JeanPaul Sartre, you'll find the same morsels of thought. Either you accept the consequences of overpopulation, such as war, and plagues, and famine, or you take extraordinary measures to prevent such outbreaks. While the Chinese are striving to limit their number, they are increasing their agricultural yield. Eighteen people have been shown to live off a single acre. And there are twenty-five billion acres of arable land left in the country. That is a true success story, Hung or no Hung." "I don't care how you add it up, or whether you invoke the ghost of Malthus to justify the demon of Hung. The Taiping Rebellion was a failure that unleashed the worst famine in Chinese history: Seventy million people died. Not surprisingly, this tragedy coincided with a whole century of such famines for my species. In Russia, in 1891, hearts and minds were shriveled with hunger. A little girl sold for two dollars, a respectable woman for six. Arsenic was sold at a premium. Faces turned black. There were outbreaks of cannibalism. Parents were eager to kill their children rather than listen to their howls of agony. In North Africa, parts of Europe, there were not enough survivors in some villages to bury all of the dead. A comedy of errors, shortsightedness, sheer and unrelenting tragedy. These are the human conditions to which a Karl Marx responded. We need help. We're not penguins. We don't operate like lemmings, or giant sequoias. Why deny it? Overpopulation is our most serious dilemma, Gaia." "Yes. And that's why the great theologian Tertullian, speaking eighteen hundred years ago, wrote that the scourges of pestilence and famine have come to be regarded as a blessing to overcrowded nations." Her screen fades up on the gray finality of the Holocaust. Bodies are tossed into a trench by a bulldozer. "However horrifying and unprecedented throughout nature is man's inhumanity to man, as witnessed by the Holocaust, you must realize that in the end, even your worst barbarism has in effect served to substantially reduce population. You may hate me for saying so, but the Earth is not about morality, right and wrong. It's about balancing numbers." "You're asking too much of me, Gaia." She carries on, undeterred. "Catastrophic tragedy varies from species to species, but the Earth herself will always be renewed. How can I put it any more delicately? Your own philosophers have stated it better than a mere computer. Examine the evidence." "Your evidence is inhumane. Your passions are brutal." "Since when was humanity ever consistently humane? Human beings take away life just as fast as they can nourish it" Images of the Holocaust give way to battle scenes, revealed at a jerky eighteen frames per second, of
World War I. "The trenches of 1914 were clouded by a lethal chemical known as chlorine gas. Its first application efficiently wiped out five thousand soldiers. Inhaling such a toxin is a monstrous way to die. But these poisons are still inflicted today on human battlefields, as you know." She calls up a picture of anguish in the guise of Kurdish civilian victims who have been gassed by Iraqi troops. "What's your point?" "A luncheon in Switzerland." "Come again?" I sit back, suddenly calmed by a slow zoom in on her monitor to the enchanting Matterhorn. "What about Switzerland?" There are still shells ringing in my ear from Canton, and the dreary blackand-white hell of a battle somewhere in France, the apple groves littered with the crumpled bodies of so many anonymous young soldiers in tilted helmets. Stiff. Looking absurd. Who are we? "Where are we?" I ask, coming back to her, between the urgings of light and image, struck by the middle of a thought. "There, in Brig. On that hotel's terrace. The summer of 1933. Switzerland—the painful crossroad between the haves and have-nots, the stable and unstable populations. A land of contradictions, in other words. It was here that two immigrants explored those contradictions." Two shadow figures sit relaxed on the terrace. I can't make out their faces. "Who are they, Gaia?" "Fritz Haber and Chaim Weizmann, Jewish chemists employed in the invention of new weapons that the Germans and British used against each other. At a time when predictions of world starvation were reaching a crescendo, Haber had done the impossible. He had discovered an economical synthesis of ammonia, the basis for artificial fertilizer. Overnight he had become the father of the Green Revolution. But all was not so rosy. Haber's Nobel Prize in 1919 was contested by other scientists. Why? Because four years earlier he had invented chlorine gas. Science gives life and takes life. Your scientists have induced population explosions with such innovations as mill reclamation of swamplands in the Middle Ages, the development of sewage systems, of vaccines, malarial suppressants, and DDT. But it was Haber's artificial fertilizer that truly got the population bomb ticking. Such numbers were merely a macabre prelude to the atrocities perpetrated man to man in the twentieth century." "So was Haber a hero or some kind of villain?" "That's up to you to decide. Haber's contribution to agriculture fueled the human population explosion, with all of its attendant stress and crisis. Including one war after another, surely your species' finest remedy for overpopulation. Haber tried to save his defeated Germany from bankruptcy by devising a method for extracting gold from the oceans. His method failed. The Faustian bargain turned against him. His wife committed suicide and Haber himself, once the darling of the German military, was discovered by the Fuhrer to be Jewish. Haber than fled from Hitler, hoping to reach political asylum in
Palestine, where Weizmann had offered him a job teaching chemistry." "So what happened?" "The German chemist died of a heart attack quietly and alone while riding on a train through the beautiful Alps, shortly after his luncheon with Weizmann. The man who discovered a technology for encouraging overpopulation was the same man who founded a means for massacre. In the end, he was destroyed." The screen has gone black. It is the quiet time of day at Thyangboche except for Lavoris, who snoozes. Snow leopards snore loudly. Elsewhere in the monastery, the Lama listens intently to a soccer game being waged in Kathmandu between Gurkhas and a team of Soviets visiting the Nepalese capital. Outside on the lawn, Denzu Rimpa Lobshan continues to watch over his brother through binoculars. Tsering is currently involved in the delicate business of traversing an eighty-degree ice wall, close to Camp 2, where he and his German cohorts intend to string their hammocks for the night on their way up toward the glorious summit of Kantega. Inside the chamber, Gertrude the tarantula scratches her knee, while the two Australian walking sticks feed on a rare Borneo orchid that has blossomed this day. Summer is coming to the Himalayas. William Hope Planter stares at the screen. His thoughts are crunched up into a tangle of concern and disorientation. "Gaia, everything you've told me so far suggests that the periodic annihilation of lemmings is no different than humanity's own blind insistence on self-destruction." "That's correct." He is angry now. Aggrieved. Family trees, depths of black hell, concentric hells, falling over him in a history of such hells. From family to family, generation to generation. "Well, I cannot accept that the Holocaust, Hitler's gas chambers, the unbearable evil, was merely a biological function of the planet, a mere 'numbers game' as you put it!" A soft voice in reply. A voice as feminine and caring as one could ever imagine. "Good . . . Yours is the one species that mustn't accept it!"
“Tire in the Mind" Summer in Nepal. At thirteen thousand feet, with snow all around, the sun is intense. With Denzu's binoculars I study the glaciers of Ama Dablam, Kantega, Tamserku, Chomolungma and Lhotse by early morning light, when the crevasses are spectacularly splayed in relief against the burnished blue sky.
The snow is pink, soft, awash in the slush of summer heat. Gaps in the ice are wide, blue, exposed. Within an hour or two the haze will accumulate. Cumuli will coalesce, and it will begin to drizzle in the valleys, and hail up high. The monsoons have begun. The. Lama's shortwave picks up nothing but static after nine in the morning. Farther south, the rains are causing floods throughout the Indian subcontinent. I have taken to watching the sun striking the mountain walls, covering the shadows of six-thirty A.M. with brilliant halos. Whole hillsides come alive; colors are violently transformed. At high altitude the sunlight engenders a world of symbiotic relationships that affect my soul, if you will; touching upon each instinct, every retina, encouraging all those organisms who must make their way each day to do so openly, without fear. With such heat, the runoff is extraordinary. Every declivity boasts a cascade. Each rim of surrounding canyon wall vents a torrent aching to reach bottom. So much water has stimulated Gaia, whose electrical circuit boards are dependent on the intensity of flow. At night the day's heat hangs in the monastery. Her pulse persists, like an ember, like blood coursing the computer's veins. Her voice is subdued at night, like the hometown late evening front-porch melodies whispered between lovers Kim Novak and Bill Holden in Picnic. Balmy and erotic. Hydroelectric. Solar-powered. Egyptian psalms, Aztec sacrifices. She has rhapsodized for days about the light, utterly incognizant of my presence. I've never seen her so obsessed, like a female giant tree sloth in heat, oblivious, gurgling with secret inner concerns, with photosynthetic values measured in erg-seconds, angstrom unit wavelengths, Einstein's electron volts, photon moles. None of it is exactly my forte. In the courtyard, the yaks are resting in the warm morning, grooming their enormous masses of white and black fur. Lavoris skulks between their tails. The animals that would normally flee at the sight of a snow leopard are amazingly relaxed around the familiar cat. Monks are out taking advantage of the dry hours to warm their socks and sip their tea. It is the time of day the monks most relish; they're off their guard, devoted to self-care, a shave, a breath mint, a lounge. Even a smile or two. I return to the chamber. Her voice is there, all around the room, speaking straight. "And the miraculous light hovered over the face of the Earth; and it shone on all creatures. And it was good." The screen carries the light off the peaks. It literally brightens the entire room. In five months with Gaia I haven't seen such illumination. She's shown me dead planets, living crystals of clay on Earth, primeval sexuality, the meteorology of past eons, and the life cycle of lemmings, to name a few of her diversions. But light has not previously entered into her tapestry. "Drink," she says, roused for the first time in days. "Welcome back!" I say chirpily. There is steam rising from an old iron brazier set into the firepit. "Who put the tea on?" I ask her. "The Lama."
"The Lama was in here?" "He didn't say as much, but I think he's worried about you." "That's silly." "You haven't been eating enough." "My diet's fine." I go to the window to gaze upon the greatest view on Earth, amused by Gaia's concerns. They seem so unlike her. "There's an apple in the cupboard," she continues. I continue to stare out at the cloud formations drifting across Everest, trying to fathom the scale of things at such distance—twenty, twenty-five miles away and up into the air. It strikes me as rather remarkable just then to be seeing so legendary a panorama while speaking to a computer about my diet. "You're beginning to sound just like my mother," I tell her. "What's she like?" "My mother?" I walk back to the computer table. "Mom's great. Beautiful. Perfect." "And your wife?" "Oooh , . . we're getting inquisitive this morning." "It just seems strange that you and I have been together for several months now and you've never discussed your love life with me." I take a beat, unsure now of her motives. Gaia always harbors a motive. That's one thing I've learned to be wary of in her presence. "Mutual, isn't it?" "Children?" "Well, I've got a boy. He's pretty much grown up now. Married. Lives in Paris. He's a writer, fiction. Good stuff, less ponderous than his old man." "What about your wife?" "We're amicably divorced. I see her from time to time. She teaches clinical psychology at UCLA. That's in Los Angeles." "Do you still love her?" "I did ... for twenty years. Now, well, a lot of good memories. But I wouldn't call it love."
"What happened?" "I'm not sure. I woke up one day, turned over in bed, looked at her, and realized it was not to be. The flame just died out. I suppose it was a long time in coming." "You know, some flames never die," "I've heard. Wasn't my destiny, I guess." "Wrong!" A ball of fire is jettisoned from the monitor with a roar of sucking wind. Light explodes into the room, dissipating just as quickly into a veil of tongues licking at the adobe walls. On the screen, the remains of that candescence—an image of the sun, wobbling, rotating, throwing off enormous, burning tails of light. I smell the scent of my own hair having been slightly scorched and stare at her with disbelief. "Goddamnit, I can't stand it when you do that! Stop fucking around, Gaia. It's dangerous!" "Beware," she says sternly. "Oh, yeah . . . right!" Arch bitch. "No other reaction fuses paradise and hell, love affairs and breakups quite like fire. The fire of lust that goads the loins of every living being; the fire of hydrogen that powers whole galaxies." She continues to rhapsodize. She has adopted poetry this day to mask the monster in her. She's dangerous, deranged. It's her purpose that lends credibility to the enterprise, that makes being near such potent risk meaningful to me, I guess. I hope. "In the heart of this nuclear bedlam exists a quiet, unexpected message—the blueprint for life, in the form of eighteen watts per square foot across the face of the Earth, which the sun generously conveys." "That's not exactly the hot date I had in mind." "You're lonely." "I don't know. Maybe I'm just a bit restless. And pisse'd off!" "It's the high mountain air." "I wouldn't mind dinner at the beach. Game of racquetball. See my kid." What I see instead are gigantic flames bursting from the surface of the sun. The image is transmuted, star power becoming lightning, lightning being transformed into forest and taiga fires. "One hundred blasts of lightning are discharged onto the Earth's surface every second of every day and night," she waxes. "The fires created by these events are categorically the stuff of your personality, your genes, your past and future. Three million acres burned in one fire in Maine and New Brunswick
in 1825; a quarter million acres of Ventana Wilderness in Big Sur went up in flames during July 1977. Periodic devastation. Periodic evolution." The fires raging over the Earth, silhouetted, polarized, are brought to the perilous edge of the monitor for my benefit. The heat radiates out. I stare with latent pyromania, hard to avoid—it's warm and comforting. And I am utterly amazed by Gaia's ability to manipulate the world, my senses, the chamber in which I sit, a willing victim of her machinations. "You're fascinated by the flame. I see that in your eyes." "I suppose." "Since time immemorial human beings—and all of life— have been seduced by fire. For you Homo sapiens, the very neurology of your brain has been steadily altered as a result of those flames. If such alteration continues, your species will cease to exist." "What are you talking about?" "Go ... ." I'm transported that easily, with a wave of her voice. A mountain in the distance, snowcapped. African semi-arid brush. Late afternoon. Smoke rising from over a ridge. "Gaia? What's the source of that smoke?" "A well-cooked Homo erectus was meat for sixty of his survivors." "No doubt. Now where exactly am I?" "Chesowanja. The first recorded fire pit in human history. One point four million years ago. Over that hill." Nothing would surprise me now. Of course I don't trust her. That is to say, I don't believe it. I surmount the hill and stake out a safe overview. Down below, a thousand feet of rocky slope stretch toward a river along whose forested edge, at the entrance to a rocky alcove, I can make out a group of individuals hunched over a fire. In another hour the sun will have set. "This can't be what it looks like. Gaia?" "It is what it is. The ping of recognition perhaps?" "I must get closer!" "You might keep your distance, William. You see, for this small cluster of hungering prehumans, cannibalism is not unlike conservationism. They feel rattier duty-bound to their bellies. Every last morsel of sinew and slime is consumed with unquestioning gusto. Furthermore, that dinner comes plain, without any seasoning or A-One sauce. You wouldn't much care for it, I can assure you."
"What's the season?" "Winter." "What's next?" "Look more closely." I can just barely see faces, heavy, prognathous, shrouded in black heaps of hair. They hold shanks of meat in the fire. Beside them, a child. Unbelievable. "Who knows what glimmers of thought pass through those brains? Similar thoughts and fires have spread to other continents. The evolution of your kind is utterly dependent upon the power of that fire, this prospect before you." "Why have you brought me here?" " 'He who is near me is near the fire,'" she whispers. "I've heard that before . . . where?" "Jesus said it." "That's very nice but what—" "There is exchange of all things for fire, of fire for all things. That's Heraclitus, speaking in his work The Cosmic Fragments." "I haven't read it. Now come on. I'm getting cold." But she continues to spin out notable quotables: Heraclitus, Claude Levi-Strauss, Gaston Bachelard, Vedic literature and a flurry of fire-related trivia. This apparition of my ancestors is incredible. What troubles me is the separation imposed by my hovering angel. Everything in me seeks reunion with those hunched carnivores down below, but there is no sensible reason for me to walk down that slope and risk—risk what? I stare in wonder. The fire licks at the onset of darkness. Their long-ago faces kindled in the heat, I can make out fragments of bone scattered around them. And now I hear them as wind gathers the force of twilight, stirring up the night's coming cold from off the high mountains on the horizon, along the river's canyon walls. Three million years ago a young girl walked with her mother, leaving footprints that were the expression of partnership and determined foraging. Their brains are said to have possessed the first Broca's area, as it's commonly called—that portion of the gray matter used for coordinating the muscles of the mouth, tongue, and throat during speech. They spoke, all right, for now I can hear the child at the fire shouting with familiar insistence. A longer-haired adult, its mother I presume, smacks the kid with a stick on its dark behind. Now there is laughter! Laughter between enormous, sustained chews. They are tugging at the meat, crunching mandibles whole.
And now the eating becomes something else. I see one of the larger ones rubbing ash on his body, rhythmically, to gross vocables and grunts. The others rock with him, except for the child who has wandered off in my direction. Now they are all hooting and groaning and the ash rubbing has merged with body rubbing. Group sex? Darkness cloaks the odd expression of intimacy around that fire pit. Only the groans stand out, haunted, a weird phonemic flourish of clicks and glottal stops enunciated in the dark shivering wind. Now I hear a second sound, and then I see their eyes. Hyenas? They are poised to close in. Little yellow sunbursts collecting fifty, perhaps a hundred feet away, with growling vengeance—a dozen sets of such eyes. I'm dead. "Gaia, for God's sake, get me the fuck out of here! Gaia!" My angel is not by my side. There is silence. She has left me as bait, perhaps; bait for evolution. I wouldn't put a genetic trick past her. But she wouldn't, she couldn't! I pee in a frenzied semicircle, the one survival technique I remember from the Boy Scouts. When attacked by a wild animal, mark your territory well. And don't just do it in your pants. They are coming closer. I have nowhere to flee. I can't see by the stars. The terrain is steep. Hold your place. They'll chase down a running animal. Hold your place, William! And closer still. They're smelling my piss. Shit, it's exciting them. Now they're howling with the fury of pre-kill. Hunger in their carnivorous eyes, burning bright. Lie down. Curl up. Go to sleep. It's over. Suddenly, a hand grabs hold of my foot and shakes it. I lurch away with a scream. It is the child! The naked primitive child with aquamarines for eyes, locks threaded with bark, his high-pitched utterances untranslatable. Surrounding him, animals, not hyenas but doglike creatures, half wild, half tame, part of his apparent entourage. The child gazes into my eyes, without fear, a candle of curiosity. His nose is as hyperactive as those of his canine companions. I take his little hand, aged and wrinkled skin. He must be no more than six but has the veteran's self-assurance of a fully equipped survival machine. A nocturnal hunter? The dick gives him away. It's the dangling pinky of any six-year-old, in any time. He smiles at me, then runs off. The animals follow him, reluctantly. I am freezing, alone now in the eternal blackness of Africa. I am certain the boy has gone for his elders and that they will return and my fate will be determined. I can't handle that. I get up and start groping down the slope where Gaia first dumped me. My journey takes hours. I know that I've gone beyond my first arrival point. The moon has come out, however; and the whole world is negotiable by its austere luminance. I hear an Earth flooded with howls and birds cooing and wind blistering. An Earth so princely and rich as to make me forget the pain of cold eyes, cold fingers, frightened heart. Never has fear mingled so eagerly with excitement. I tramp on, going nowhere, going everywhere. I trudge in search of water, dry throat brought on by fear. The riverine canyon of the creatures had come to a bend where I saw them encamped. My direction has thus far drawn a blank. The flat plains across which I
scramble are dry and hard, turning to desert. I race between clumps of overgrown brush, heading toward some mute infinity. But no water to heal "a burning throat. And no Gaia. I can't believe she's done this to me. Fucking spoiled cunt! Sunrise is a torment, endless. If the growth of my species were left up to the likes of me, we would have died there and then, here and now. No science, no acumen, no will to survive. Frozen, windy hours seem to elapse between the first hint of color in the night sky, and the merciful warmth of the orb's emergence over the eastern flatlands. Now I feel real panic. Every strange sound controls me. The panic is at my feet, in my chest, clawing at my throat. Every step is amphetamized with the realization that I might be killed any moment. It is a world of wild animals and thirst. Then hunger. But my body is clear about its priorities. I am afraid to call out to her. Afraid that there are prehuman ears lurking nearby. I turn around rapidly, reacting to senses gone awry, seizing phantoms with a look. The day is unrelenting, the heat by noon as unwelcome as the previous night's cold. Shitty climate. No wonder my species grew up ill-tempered. By late afternoon I have yet to find water. I'm desperate. Hallucinating . . . . . . Chirrs and ghostly croaks, pattering high whistles, skeletal outlines shuffling; iridescent pincers fumbling in the air, tawny stingers, moist and pinioned, gliding through the singe; there is vibrant tenacious color and oily scales in animation; meteorites by night and dust storms by day. The brawl, the overflow of Earth. Sinking sand. Scalloped boulders. Alkaline alluvium. In the sullen crepuscular hours of predawn, stalking full-blooded in the cold exposure of night. Insistent breath and movement, millions of small eyes boring through the desolation. A tensed kinetic theater of ceaseless reflex, of maws ready to snap, gophers listening, cacti flowering. Africa suffers from excess oxygen; my lungs are heavy. Edges too bright. Ridges throw off an energy too acute, a radiance that blinds. Lines begin to curve at the heat of the. midday. My sense of angle falters in compassless depth. Riddled with expanse, the idea of myself founders over old images at once muted in the overburdened perspective, isolation, uniformity. Dirt, sand, heated rocks whose purpose in the thrust and fumes of creation has been lost, or dulled, or hampered. Like a palimpsest the size of an asteroid whose fringes graze recklessly into eternity, these plains devour the eye. There is surface tension, forbidding and exquisite. Purple glossy wasps preying in the sheltered tamarisk thickets; aggressive scorpions pivoting in the veiny crooks of scattered porphyry; tarantulas moving intelligently over a world of bleached pebble; and yellow centipedes mingling in the radium glow of space, ruptured and burnt. Wind groaning against the slightest obstruction. Countless unnameable chiggers and midges festering about the cheeks and ankles. Prostration in the enflamed glands. Submission afflicting each of my muscles. Whorls of queasiness. Until the indecisive craving for relief, for direction, for the slightest deviation, erupts over all the skin. Until touching myself adds to the nausea. There are no criteria here. And Gaia is nowhere to help me. No reliable premonition of the past, of the races which migrated back and forth through obscurity, the anonymous cavemen whose countless lives the desert has expunged. Each impulse and suggestion is liberated from
these other eons. Hewn from the rock of the present. Imperiled, alone. I begin to sprawl, careening over roots and boulders, my freedom caving into the discovered vortex of my life. Every action a source of panic. My thoughts are reduced to outlines, to words which go screaming out into the void. I strip down naked. The heat is too much for me. I leave on only my boots. I am shameless, my genitals swaying to each vague suicidal step. The sun pierces my pale white back, consuming it, while ants go up my leg. Like swimming in pain, total immersion. To walk into a season's worth of passion, right here, in a matter of minutes, hours, during the course of the afternoon. Until, by the pressure cooker of the desert, by the skillet of shipwreck on all sides, by the high voltage of nothingness, my mind erupts into the wiry inoculum of itself, the blowtorch .... The air wavers. My ribs smart. My nose and shoulders are blistered. Like bile, something bubbles under the nostrils. Foam prickles the upper lip. My urine is ivory-colored. My eyes seem to be oozing, weighted down with the dust. And my head is dull with the fire and throbbing. The sides of myself— epileptic, ongoing—have shrunk in the festering travail. I am out at sea, crossing a stretch with so little feeling that I might be moving in circles for all I know. I come up to—tracks? The vague remains of a Land Rover? Impossible. I'm unsure, though. I follow them through an ocean of blankness into ribs of rift, black, burnt siennas, rusts, dulled umbers of dust caking the broiled plates of stone. Horrible. A narrow, cliff-girded wadi. It narrows more. Suddenly there are no more tracks. Perhaps turned around. The gorge, after several hours and innumerable wends, pinches to a somber close. Walls two hundred feet high. Sheer. The sun is directly overhead. What a place to die, in the loins of a labyrinth. The sand is up to my knees now. And solid, radiating white. A low humming of electricity, the heat. Trapped in an unrimmed quarry, stubble, hard gravel, I am dizzying, stymied. My eyes granitic, my palms flustered. There is wildness, a mayhem smoldering with muscle spilling out its rage, an ardor twisting directionless. I assault my predicament with a final logic. She will not help me. Regret, revulsion, and a flinging single idea: to save myself. The body is stripped bare, becomes a gust, and hurls itself. There in a cranny of the rock—see it! Flesh, ramskin, whitened, stuffed by wind between a bramble clump and shade, without a recall, utterance or marker; lone, mere pestled bones, a shambled, wizened longforgotten heap of bleach, no meaning. I scream. Eboned surfaces lost in the sun. Voids of blood and voice admixed in a hot groan. Like a lizard on a steaming binge. I am a straw dog, a squealing, agitated pig, a battery corroded. I want to rebuke the landscape. Apparitions. Lurching beings, gold frescoed walls, burning dogwood, driftwood, eddies. Jaundiced throe of hills. My mind in white-bald demolition, heartsick, ruinous. Pinched face. Deluge of heat dissecting the pores. I retrace the morning. Slinking through my erosion. I reach the entrance to the gorge and sit scanning my body, my surroundings, until against my will the inextricable idea of my predicament is born. The first and last man. This is real! Disaster strikes. The end of the world. My thoughts backlash with the collision of sense and idea, the explosion ripping through me. I must get out. Wake up! Forty miles perhaps. Then what? Those mountains? Recrimination. Nothing comes. I walked north. That's all I remember. But how many turns? How many days? There is the ghastly ignorance of not knowing whether I am acting or reacting; not knowing or caring. Swept with anger. Vicious now. I walk as fast as I can, kicking up sand, throwing
rocks, screaming at things, slapping bugs on my forearms. Night obviates the furnace with inverse cruelty. I crawl under a rock formation. My nakedness stings. I hold tight. Alert to my excruciating torpor, while the cold nibbles voraciously on my dead flesh. Minutish, exposed to the drill bit of overhead, I slog into a daze as on some glacier. Half the day gone. Ground painfully difficult now. Tiny needles. Cuts and gouges. Getting into the blue mountains. A sultry dust color, surface gangrene, runs over the eyes and with it steep nowhere sides. Is it possible? How could I die would I just die or would I lie down or would death lay me down; would I close my eyes, would I fall, go unconscious; would I scream and scream and the desert take me? I mean how does someone just die? Curling up to do something. Dull. Delirium. I try to move higher into the mountains. Granite ledges. Cracks. Steep dihedrals of encrusted turmoil. Ancient broken stones tortuously lodged in pell-mell. Hunger is setting its talons as well. I've got a rock in one hand, a large stick in the other. Someone's following me. Hold the rock tightly. Prepare to kill. My Vibram-soled hiking boots are caked in mud. Mud? I'm standing in mud. Moisture flooding the profusion of plants all around me. Insects are shooting through the slit of moisture in the air. A breeze? Following me? Dig! My God! ... Dig! The sensation awakens me. Days in the outback of unconsciousness. I plunge the stick, twisting, gouging it in, and then start pulling at the soil beside a berry-giving bramble bush. Sweet berries! There are sparrows flitting in large number. Butterflies and tracks. Enormous tracks. Don't think about it. Dig .... And now there is the first egressing of water. Water bubbling up through the black of Earth. My tongue slaps the flat pan of that mud, and water clings to my throat. As I stretch out, I catch the motion. It's there with one lunge, a creature I have never seen in any bestiary or zoo. Like a dumb jungle tapir, a black-bodied zebra, but lower to the ground, this thing is as intent as I am on obtaining thirst-quenching water. It is no threat. Its eyes are spellbound; relieved by the life-saving liquid, it is peripherally interested in my presence but no more so. Now it is gone. I gather all the brush I can, erecting a lean-to of sorts. My fourth, fifth? night out in Africa is spent in this shelter by the oasis of mud. Oasis of mind. Cold all over again. I need fire. But my exhaustion wins out, blessed weariness. My age serves me in this. I sleep. In the morning I am awakened by a storm. The dust has come in like a wall and the whole plain is quaking with the terrible influx. The lean-to gives way, blowing off like splinters only minutes after my eyes have opened to greet the goddamned day. Now I'm
doomed. There is no place to go, nothing to do but lie flat against the earth and pray. A suspicious breeze, laced with a background ringing, or chanting! And then swoosh! An upwelling of accompanying prayer whose miracle pitch I never knew how much I cherished. Thyangboche. Thank you, world. My bed. Home. I cling to it, I cling to the pillow. Oh, Lavoris! I hug my purring friend and smother him with kisses. I don't smell him anymore. He, in turn, is sniffing me all over. I dig through my rucksack for my last set of clothes, put them on, then turn my attention to the enemy. She reclines, pulsating at the sadistic helm. Be controlled, no accusations, no hostility. She could do it again, and again. Be calm, be rational. "You're psychotic," I rant, unable to control myself. Stop yourself. Ease into the difficulty. You know she's reasonable, must be on a mission. Give her slack. "Computers are not psychotic," she professes calmly. Her disclaimer rings of the 2001 Hal, following his act of mischievousness. "Why did you put me through that?" "Africa's a lovely continent." "Gaia, I could have been killed." "You say that every time." I go to the window and slump down, bewildered by what has in fact just transpired in the last several days. Then, turning angrily, "I'm not made of sand and silicon. When are you going to respect that?" "I've annoyed you, haven't I?" She wheedles her way into me, sneaks past my defenses, disarms with womanly wiles. "You can't treat me like a throwaway doll and expect me to come back to you." "I apologize." "Promise me you won't pull that kind of stunt again?" "We'll see." "I want a promise!" "It could be necessary." "For God's sake, I nearly died! Do you want me to die, is that it?" Silence. "Either you promise me or it's war between us."
"All right, I promise," she says, repealing her hard line. Why don't I trust this little Mussolini of a computer? Moreover, why does she make me smile? "All right. Now tell me why I had to spend four nights, five days, out in hell. I nearly died of thirst, do you understand that?" "You'll know hell not by your thirst." "Look, this is bullshit. I thought we were friends." "Best friends." "Right." "I wanted you to feel the importance of fire to your beginnings, firsthand." "What does it matter?" "Waves of voltage sweeping your axons matter; secret wisdom matters." "I'm lost." "Fuses and flames, cerebral ions of sodium, firecrackers." "Fine. Go ahead, be cryptic, masturbate at my expense, you little Stalinist bitch. "Life and death is what I mean." It always comes down to this. She's one heavy machine., The Dostoyevski of computers. "What about life and death?" "You have fire on the mind. It defines your species." "Many things define my species." "Not like fire." "Go on." "Stroke me." "Promise you won't do that to me again." "I do," she says meekly. "And I don't take kindly to being likened to Stalin." "Cross your heart and hope to die," I demand. "Sure."
I lean down and give a spin to her golden prayer cylinder. The little bells attached by crimson ribbon tinkle as the copper drum revolves and her screen flares with a three-dimensional pattern of brain evolution. Her printer is activated. I fill a silver mug with tea, and sit at the computer table. Already the chanting of monks out in the Lakhang has been subsumed within some other medley, reaching to me from inside the monitor. The churning of neurons, the firing of synapses. "William, fire actually lent additional gray matter to an otherwise plodding and unfulfilled brain—four hundred fifty-four grams of it in less than one million years. The more fire, the more brain power. Fire equals protein; fire is synonymous with self-reflection. With additional neurons crowding into your ancestral skull, your forehead bulged upward and out making you the original lowbrow. The neocortex acquired seven hundred cubic centimeters during Homo erectus's triumphant reign on Earth. During gestation the Homo erectus brain grew at an astonishing rate of twenty thousand neurons and two point two milligrams every minute. By the end of the third year of life, die Homo erectus child had achieved a mental bulk of more than one kilogram, four-fifths the size of an adult's. All as a result of fire. For your species, that pound of additional gray matter is worth a million dreams." "When did we cease to be an ape and begin to be a human?" "When you knew you were a human!" she says simply. "When you dreamed great deeds beside the fire, then set off to realize those dreams." I take to my diary, intrigued by Gaia's data and synopsis. What is evolution seeking in so much brain power? I write. "Natural selection chose in Homo erectus more gray matter, for the contemplation and energy of youth looking ahead," she answers, having not only read my thoughts but calculated the words from the very motion of my pen. Quite a trick. "Looking ahead where?" "With fire, something wonderful was about to happen. Every aspect of human biology would be forever altered— not only your diet, but your brain chemistry, internal clock, even your jaw structure. Fire speeded up your evolution overnight; extended your ancestors' day into their night, rendering them independent of their biological regimens to a much greater extent. More time. Time, William! Your fire-starting forebears walked with an essentially modern stride, their foot, eye, hand, and hope all falling in time together along a fast track; winging it free and wild in the late night hours of introspection. Homo erectus enjoyed the luxury of big meals, of metaphor." "What metaphors, Gaia? What were the earliest obsessions, insights? What did my species think about? Tell me . . . ." She's triggered the picture in my mind. I can dimly see that past, just as I had been there just a few days ago. There is a longing in me to reconnect with my fear, certain that she'll protect me in the odyssey. And with that confidence, something in me craves to be driven headlong into the thick of our
evolution. To taste the accomplishment of a million years, in a palm of churned-up mud, in the look of a child, beside the fire that emptied its revelatory power into the nascent brain. I am shaking with the sense of it all .... Brain models dissolve into moonlight. There, before me, the flickering tongues of fire shadow, seen from outside a cave. "Where are we?" "Choukoutien." "China?" "Yes. When the full moon illuminates these hills, all of life is freely granted to perception. Homo erectus in China five hundred thousand years ago were able to stay awake at night and ponder that moon, those rocky silhouettes, optical nuance, late evening umbers and mauves, all of the colors and breezes of tranquil philosophy. The three thousand visible stars could be viewed, if more diffused, from the hearth's security; they gave the pleasures of infinity over to the mind. The cave was domesticated. Dreaming, wild animals, vaginal mythology, and folk science were all fused into the collages of ocher and henna you call cave paintings. Fire precipitated the earliest rites of passage. At places like Lascaux young neophyte artisans crawled on their bellies for hundreds of feet through intestinally circuitous passageways, in pitch blackness, uncertain whether they would come up against a den of maddened bears or into the chamber of the gods. Once safe through the maze, the 'hero' painted his thousand faces on the walls, became the priest or teacher, and thus engendered early social organization, politics, tyranny. William, imagine these fire-thinkers at the brink of the last great interglacial, your beetlebrowed ancestors on the verge of becoming you! Entranced beside the roaring fire, sucking out bone marrows, their cave covered in luxurious fur. None of that sordid, painful exposure you witnessed beneath the mountains of East Africa. Choukoutien represents one million years of additional sophistication . . . poking their fingers through the ash, the ash of controlled fire, burnt clay, immersed in deep and pensive fascination, perhaps the earliest religion. With fire, man and woman leave five hundred generations behind them. The future is theirs. Do you understand?" "Sort of." "Fire, fire! I insist on the absolute word! Fire that ensured comfort, protection from damp and dismal winters. Fire that explains everything, particularly the human brain. With fire, the sun would never truly set again on your species. Whether in Africa, China, or California." A procession of Indians squeezes through the electronic facade, walking down a hologram of time, time that scintillates palpably between Gaia and me. She is there, connected to a separate reality, and I am here, secure in my chair but prey to her seduction. I try to hold fast to my place, but am slowly eased forward. I can't keep the sensation away. I'm dizzy and falling with it. Connected, then disconnected. All around me in the dank air is the sweetness of jasmine and the chi-chi of cicada. On her screen, the procession reaches its home base, a community of several dozen thatched dwellings nestled cozily atop high grass, beside a salt marsh leading to the ocean. There are perhaps fifty men, women, and children, dressed in tanned skins, looking very happy and fit.
"Who are they?" "Ohloni Indians. This is what you call the East Bay, San Francisco area, twenty-five hundred years ago." She leads me into one of the yurts where an open hearth fire is being prepared by a kneeling shamantype with a rawhide bow and drill. He uses the tinder of cedar bark, blue jay down, and birch fungus. I watch the shaman. Others watch him. Then an elderly woman pops various seeds in hot sand adjoining the fire. Their food preparation is elaborate. Kelp is stretched across coals sunk into the same sand pit. Layers of shellfish, leaves, steamed agave flower-stalk buds, tubers, and what looks like venison are placed atop the kelp. "They've burned much of the surrounding marsh," says Gaia. "With regrowth, the plants characteristically combine higher concentrations of protein, calcium, and phosphor. Such was the perennial equation for fertility, for more food. Among these Ohloni, a diet of four thousand calories per day was not uncommon. They lived in paradise. Fire was their most important friend. Torches were made of resinous wood. Oak or hazel made for excellent charcoal burning. Tinder was gathered from the dried bracket fungus. The technology improved as lichens, oils, fats, grass, and seeds were later utilized, one by one, to assist in the maintenance and transport of fire. When they traveled from village to village they carried their fire with them in an airtight buffalo horn covered with punk and held by buckskin loops. Fire meant culture and food. Cooked venison and lobster. Skewered sea otter with sautéed scallions, pine nuts taken with honey and white pepper." "I never knew you were such a gourmand." She prints out a series of names: VALLONNET, LAZARETO, LASCAUX. Her screen appropriates the words, transforming one hearth to another. This one, obviously in France, is littered with bones. "Rhino and mastodon, ferocious bears and exotic wild fowl," she says matter-of-factly. "What's that sizzle?" "The kitchens of La Closerie Saint-Jacques, a little-known five-star restaurant just outside Bergerac, southeastern France. Very close to Lascaux." "The Dordogne, near Bordeaux? Great wine country." "Some say that the French live to eat. But of course there was a time when you all ate in order to live. Those early meals were high in protein, which may have augmented physical and mental growth. But unlike today's high-cholesterol tastebuds, the hunter/gatherers consumed less salt, no sugar, and virtually no creams or rich sauces. Their meat was a far more concentrated source of protein than
plants. You are what you eat, and you became what you are because of cooking d la haute cuisine." The chefs are dipping tenderloin strips of rabbit with cloves of shallot into a rich marinade. She's killing me: canapés avocat-moutarde-citron-paprika; timbale de fruits de mer with its lobster tail, Dublin Bay prawns, sole fillets, scallops, white wine, lemon, and cayenne; caviar canapés, coq au vin; sabayon; and the worst— soufflé au chocolat. The tartare, the garlic, and the cheeses! Beaufort, Cantal, Saint-Nectaire, Boulette d'Avesnes, Niolo. I'm dying. "Gaia, take me there!" "No." "Gaia, I'm hungry." "You made me promise not to pull that kind of magic again." "I take it back. I want into that restaurant." "You'd have me break a promise?" "For a meal in that kitchen, absolutely!" "No. We have more important ground to cover than truffles and souffle." Ahhh! My teeth are grinding. "You leave me out to die so that I'll learn something about human evolution. Then you go on and on about the brain's development, culminating in the fabulous food preparations of southern France. But when I ask for a single meal there, you deny me. Me! The man you've been living with for nearly half a year!" "Calm down." "I won't calm down. You drive me crazy." "I want consistency. You made me promise not to upset your radical heat and moisture. I promised." "You want consistency? You even offered me an apple, for Chrissake. Lighten up. This relationship can go easy or hard. Why not make it easy?" "You're quite right. Go. Eat!" The meal makes up for months of starvation rations, lame rice, disgusting tinned meats from China, undrinkable beer, sour Tibetan cheese, moldy monastic bread. I linger into the late night fraternizing in a French which, after months of Nepali, rushes in and out of my mouth with a kind of feverish desire. The matron of the restaurant is a statuesque, eat-your-heart-out Parisienne with country-girl eyes. Equipoise served up with delirious white chocolates and a kiss on the cheek as I depart at three in the morning. Out the door, into the muggy A.M., with nowhere to go.
"Gaia?" I take a few steps forward, and suddenly the lights of the restaurant have gone out. Turning back around I realize that somehow I have stepped into a cave. I continue forward, stooping to enter a low, cavernous labyrinth. "Crawl!" she coaxes me. "No tricks?" "No tricks," she swears. I lower myself down onto my stomach and inch my way through a hole that provides the sole access into an elongated causeway of golden rock. There is a glow coming from the far end of the tunnel. I proceed toward it with difficulty because my belly is now distended from dinner. "Keep going! It's worth it." Now the tunnel begins to widen. I can stand up. And then, turning a corner, I walk into an enormous chamber. A lone figure, torch in hand, stands painting a detail of a bison and a sexually erect stick figure kneeling, or genuflecting, before it. The painter is in skins, cropped hair, a weirdly modernlooking individual. Paleolithic? "Flight of the shaman," Gaia remarks. "And he is modern!" The artist turns, slightly annoyed by my presence. "Bon soir," he says, turning back to continue his work. "I don't get it." "Seventeen thousand years ago, at the height of the Late Paleolithic, and in the vicinity of this restaurant, the descendants of Homo erectus huddled in darkened caves for shelter. Fire gave them warmth to withstand the prolonged glacial winters and by its flickering light they drew upon these walls the animals which gave them food and life. Without fire these echoes of the past could not exist. And without such modern restorations by art historians like this fellow, the paints might long ago have faded away forever. Certain traditions last. The basic story remains, even today. Your technologies have augmented the power of fire, but the underlying message remains." "What is that message?" "Fire has burnt its way into your psyche. In some places, it gave birth to spirit." The tunnel envelops me. Night becomes day. The sealed, sanitary odor and silence of Lascaux is suddenly the wide-open panoply of sky and turf. Hills in the distance. "This hill is named Wurrumali. Here, when this land was created, "two spirit beings sat and sawed the first fire into existence." A group of Australian aborigines sits before me. Blue black men. Potbellies. Shaggy gray hair,
enormous teeth, beautiful smiles. The year, 1990. They are barefoot, in shorts and soiled white T-shirts. One wears a Dodgers baseball cap. I'm giddy. Gaia is as bad as my own charged battery of fantasies, dreams, wanderlust. In this we are one. If she were real, I mean truly real, what could we accomplish together? "Watch them, William. They are all industry today. Something is going to happen that forms an important link between Chesowanja and Hiroshima. I wanted you to be here to observe it." "I'm exhausted. You haven't let up for days. I need sleep." "You slept in Africa." "Oh, come on. That was sheer torment." "You'll sleep tonight, after the dance." "What dance?" "It's coming. The first in fifty years among these old men of the Walpiri people. This country is theirs. Ever since the human species has lived in this land it has echoed the refrains of fire. The very essence of those flames is bigger than all the different tribes combined, than all of mankind. There are many tribes that live in this land. It gives them their strength, their vigor. And they in turn have done something to the land with fire. Call it technology." Fire on the horizon, spreading out to the left and the right. "What's going on?" "Prelude to the dance. You see, as they .wandered through the country, they always burnt it. The spinifex undergrowth, once burned out, will always grow back renewed, fresh and green. The plants most able to survive the brushfires became the dominant species. It was the earliest form of agriculture." Men wander nonchalantly through the vale of flames, exercising their abilities at coaxing the fire in one direction or another. Big game, kangaroo and deer, flee to the rear of the wall of fire. Birds circle high above. All has the air of calm, orderly deliberation, even though it appears that half the countryside is soon to be engulfed in conflagration. "The tribes had no contact with outsiders until roughly one hundred years ago, when the first Europeans rode into these desert regions on camels. They still live in some of the harshest environments on Earth, and have never lost that remarkable affinity with fire." I skirt the curtain of flames and head across open fields toward a circle of hunter/gatherers. There I sit with them, taken into the group without any apparent suspicion or even much interest. I observe secrets of the continuous past in that circle—a split piece of acacia, some dried kangaroo dung, a little sand for friction, and a boomerang. As these pieces of a puzzle are fit together by men whose hands hold firm the ancient legacy of fire, and in whose own skin I can make out the sum total
of hundreds of such fire-making rituals, they start to sing. "This is a special flame, William. It has existed forever, on a long journey. The man with the fire must torch the spinifex, and the flame must always head to the west. This fire has been traveling since the Creation. In fact, such burning was a very part of that Creation. Thirty-, forty-thousand-year-old myths that come not only from Australasia, but from every culture. Paraguayan Chaco, Vancouver Nootka, African Bergdama herders, Paom Porno Indians of California. The fire was transferred from animals to people. Among the Mexican Cora Indians, an opossum climbed the texcallame tree, obtained fire from the female iguana, and gave it to people. Among the Ute Indians, fire was first discovered by grouse, sage hens, hummingbirds, and owls. In the Andaman Islands, the kingfisher was the key. What all the stories have in common is the natural origins, the natural destiny of fire. "But here, now, it is the dreamtime that delivers the seed and will subsequently raze the Earth." "You're referring to the dreamtime of their ancestors?" "Correct. The fire dreaming. The place is Palpati, the storm-bird dreaming place. The people believe that the bird brings the clouds, attracted by the smoke. So the fire not only clears away old grass, it also brings the rain. And with the rain, an abundance of food. The men are familiar with over one hundred edible species of mammal, bird, reptile, and insect. In addition, they know about thirty-five kinds of trees, shrubs, and grasses that yield edible foods, and six other, special trees that are the home of edible grubs and honey-producing bees, as well as many plants used for medicinal purposes. This outback is a cornucopia of consumables. Ironically, many of the first European explorers died of starvation in the midst of such plenty. Fire brings life to the desert." There are women and children fanning out from the circle of male elders. Everything is happening at once. "What are they digging for?" "Honey ants. They taste great, if you have a sweet tooth. The worker ants bring back minute drops of honey to their nest, where it is stored in the bodies of others as a food supply for the colony. The women always leave some behind. That is the only rational way of maintaining a constant food source." Slowly the men prepare. First the dance ground is cleared. Headdresses are made from the paper bark tree. I -watch, as red ocher from the earth is painted onto the bodies of the men, as they continue to perform parts of what appears to be a complex and ancient song cycle. "Everything has been done this way for thousands of years, the ritual handed down from generation to generation. The Walpiri men are performing this ceremony here for the first time in five decades, William. You are the first outsider to ever witness it. The fire that these men have started will be passed on to other groups, and ensure that the country is kept alive and healthy, and that the animals the men hunt will return." One of the men calls out that the headdresses are ready, and they are carried onto the dance ground. Two men have white ocher and grass seed smeared on their bodies.
"The preparations are finally complete," she says. "The ceremony can last for hours." As darkness infiltrates their camp, I begin to see movement in the air. "Gaia, what is happening?" "Fall into step, William. Feel it whole and fine. What happens is what should happen." Movement, wisps, ghosts. Luminescent, free-standing ghosts—the face of a fox, shining as an ethereal outline against the night. Fire illuminates the faces of the aborigines, as they rock and shout and sing to the tapping of wood their intoxicating rhythm. The chant increases, the dancers are spindly, writhing, and drugged, flailing and spitting up dust from charred desert in a tempo that hosts the darkness. I'm drawn in. Something is happening to me .... The physical fire merges with the spiritual. I can't equivocate, intellectualize. It's there, in my gut, this camaraderie with strangers dating back to the near beginning. By bringing me along from primeval Africa to caves elsewhere in time, she has made her point. It rings clear and true. God speaks to us in the flames. Memory, passion, body, heart, and soul all come alive before fire. There could be no greater spiritual truth. "There is an equal truth, however; the doubt has been born," she warns me. "What doubt do you mean?" I say, pulling apart from the center of trance. "The links between the brute physical fact and the spiritual evocation are burdened. The balance is fragile. You risk everything." "I don't follow." "You will. And you have." She leaves me to contemplate her typically vague caveat, sitting beside the children in the morning. They are insistent, toying with my clothes, more curious than their parents. A cool wind settles the rubble. The world to our right is burned down. Soon, new buds will spring up, animals will come to forage, the hunting will be fine. All has been done as it should be, and in the following night the men will sit and sing love songs to the spirit of fire. As they similarly sit night after night along the banks of the Ganges, the thousands of devout Hindus who gather to celebrate the fire puja. In their tribute to the God of Fire, Agni, messenger of renewal, all of India is symbolically brought to life. Just as the interiors of great churches throughout the world are sanctified in the illumination of candles. But the doubt remains. What does she mean? The candles still flicker in the chamber as well. In the space of that flicker—between the shadow and the idea— I'm back, comfortably propped up against the satiny pillows of my teakwood bed with its
elaborate floral and dragon designs. Just as I left it. The game continues. She's getting closer to her target. I can feel it. Like a hallucinogen, Gaia's gears are in perpetual fifth, her engine revved, her instincts goaded on by some atavistic need to be enjoined, to see all things in their simultaneity. I'm beginning to enjoy it. But Gaia's interest in fire perplexes me. It's bigger than the mere flame. Okay, so it influenced our upbringing as a species, entered into partnership with our minds, provided the basics of our culture. But Gaia herself is all fired up. And that's a fire of a different degree. She started with the chemistry of the sun, a stellar furnace of possibilities, and ended in her confined nineteen-inch monitor. From elemental dust to technology. I'm not sure what demons possess her. I'm not sure who she really is. I thought I knew. But I do know that she's there, entrapped in that black box, insatiable, the ice blue light of her pulse silently cogitating. The image on her screen drifts from ancient shards of pottery to pictograms, from fire-blackened walls to faces convening in the twilight. Throughout the miasma of light and color, Gaia emerges—gentle, demure, pained. She's a seeker. We were made for each other. I feel sadness for this wild creature, this female spirit craving to be freed, to move at the speed of light in whatever direction compels her. Alone, she could do so, with all the fluency of her computer insides. The flush of electrons, native juices, microchips. But she wants me with her, obviously, and is frustrated by my cumbersome inability to tag along with quite the same agility. There is claustrophobia in her obsessions. And little outlet for myself. The monks provide a minimal diversion. There are no other women to talk to, other than those I'm likely to pick up in the course of our travels. But I'm too shy to pursue a liaison when I know her eye is always upon me, always ready to jettison the whole show. I am the one who is trapped. "Come here, William." Her voice is detached, somewhere else. "Have I given you enough data from which to extrapolate?" "Extrapolate what?" "Your future." "I'd hardly think so." "Read back to me what you've got." "Scattered notes. I lost some of them in Africa. Others fell out of my pocket and were probably burned in Australia. And I left my pen at La Closerie Saint-Jacques." "That sounds to me rather like the evolution of your species!" "No doubt. Now what is it about the future that interests you?" "For eons the sun powered every leaf, stoked the metabolism of every humble creature with solarpowered instinct, fire-hardened passion." "How poetic." "For Homo erectus, fire meant evolution. Succulent victuals, torchlit contemplations, sacred séances.
But for you and your kind, fire means energy, greatness, and hopefully, a bright future." Her screen bursts forth with steel furnaces, slurries, heat in the form of metalwork. Despite her promise of sleep', she's given me all of three minutes on the bed to rest. I can't go on much longer. "You have characterized the progressive ages of mankind from copper to bronze, iron and nuclear, all according to the heat of their respective fires. All over the planet those fires still burn." "What am I now looking at?" "Landsat images photographed at night. From hundreds of miles above the surface of the Earth, the light from those fires is visible in the darkness . . . There! The east coast of the United States, like a beacon sending its message far beyond the dark recesses of the solar system. And Africa. Recognize it? Illuminated by the gas flares of modern technology in the north, and by thousands of hunter/ gatherer campfires in the south central Sahel. Your whole history in a single glimpse. Farther to the north, the electrified mass of European metropolises, ignited by the controlled rush of electrons." "You paint a pretty picture." "You anticipate my message." "Maybe." "Look at it, William. Your very genes illuminated. But in that far-reaching flame, your shadow hosts a contradictory form." "Be specific." "In a single flame, the hope of the future, the terror of oblivion. Your species has become its own geological force —a power that might lead to the stars, or to extinction." "Where would you lay your best bet?" "You're putting me on the spot." "I doubt it." She pauses, as if weighing her words, then says, "You've affected me." I'm slightly stunned. There was no apparent provocation, no reason for her to say that. Has she done that before? I think back but it's a blur. I don't recognize the feeling. "Where did that come from?" I ask. But she's silent. "You might call it my mission," she finally concedes. "Interesting," I acknowledge. Perhaps I've felt the weight of that so-called mission all along. She has referred to it repeatedly in past months. In a beauty salon in Turkey, Gaia spun her fancy mathematical handiwork around an aerosol can—scared the beautician to death—in order to calculate the extent of
upper stratospheric ozone depletion. There was a remarkable downpour somewhere in Scotland where the pH of the raindrops was less than three —akin to vinegar, the unpleasant reality of acid rain. Gaia insists she did it in order to influence a world leader who was staying at a castle on one of the lochs, a man who religiously drank eight glasses of water every day. At Martha's Vineyard, a group of visiting governors was set straight when their vacation retreat was inundated with beached dolphins dying of pollution. A mayor in New York was induced to buy the Shoreham Nuclear Power Plant for one dollar after a decade of financial ruin and technical breakdowns. A famous actress, waterskiing in the Mediterranean, collided with and killed what turned out to be the last pitiful sea turtle off the Moroccan coast, a giant tortoise desperately searching for a patch of uncluttered, unpolluted beach where she might lay her brood. In a monastery garden in Nara a child stepped on the last strain of an ancient moss species, triggering a bacterial collapse unknown to humans but felt well enough by lesser organisms all lodged tenuously on a chain of being that Gaia alleged would eventually come back to haunt the larger creatures of Earth. For all of these and other revelations, Gaia took calculating credit, and I was prepared to believe her. "The destruction of fire," she suddenly says. "It's leading to your annihilation, William. And when you go, there's no telling how many others will likely go down as well. That affects me, as you may well imagine." "What do you suggest we do?" "I'm not sure, to be candid about it." "No clue at all?" "Those Australian nomads changed the environment of their continent with no other technology than a torch. But they did it over time, as part of a spiritual connection with the soil. The land was able to adapt to those rituals, those fires." She can't be that naive. "Gaia, people don't worry about their spiritual connections much these days. It's the firepower that counts. Surely you know that?" "I know many things." "Indeed. But what do you make of our more recent experiments with fire?" "You beg the issue: In Japan, you renounced guns for two hundred years, but killed each other with swords. Both are tools forged with fire power. In this century, the Japanese worship their ancestors with fire on a mountaintop which is adjacent to a quiet Shinto shrine where Thomas Edison is also worshiped. For it was from that shrine's surrounding forests that the bamboo filament for the first light bulb was taken. To my way of calculating, that's an auspicious sign: Your species is quietly, imperceptibly learning how to behave." I'm intrigued, but not convinced by her esoteric example. I remind her of one of the great brutalities of our century: the fact that the Japanese had implored Harry Truman to accept their surrender. Truman ignored then-pleas and went ahead and dropped the two bombs. Perhaps out of spite. Vengeance. Or— more calculatingly—to prevent the Russians, who had beaten the Japanese in Manchuria, from
descending on Tokyo and claiming the spoils of a defeated Emperor. "Truman was an asshole," says Gaia, rifling through her own archives. But she fails to explain the larger issue of human behavior that she's been harping upon. I address her: "Gaia, that monitor of yours is itself the product of forces far more massive and potentially malignant than the simple burning of Australian spinifex, or the worship of ancestors. We're fire bullies, tactless, graceless. Intent on molding nature to comply with our hell-bent pursuit of money, with no time or thought for tomorrow." "This is all true. But you could change your ways." "That would require perhaps a bit of evolution. Evolution takes hundreds of thousands of years. We don't have that much time." "Time is money. You have time." "Wait a minute. Explain that." "Economic disaster is closing in on your species from all sides. Gas and coal will soon be in short supply. The reserves of precious metals and coal are being exhausted. Tropical rain forests are vanishing, while topsoil is eroding away. The human population is increasing by billions. The, atmosphere is becoming denser with carbon dioxide. Your fossil fuel emissions are accumulating in the upper atmosphere, trapping the sun's nightly irradiation and thus warming up the entire planet. That might work for hothouse orchids, but not for human beings. Meanwhile, the problems associated with hundreds of millions of people stuck without even their basic energy needs are rapidly escalating." "I know all that." "My point, William, is that economics has become a means of influencing human behavior, of resolving conflict, be it military or environmental. Money moves mountains, at least among human beings. "Don't you get it yet? Copper, bronze, iron, horses, coal, internal combustion engines—all of these adolescent obsessions were fine in their day. But no more. Fossil fuels are primitive, transitional, better suited to fertility cults and the treatment of arthritis. So they helped you along for a few hundred years. The price of oil suddenly surged, you added the term "photochemical smog' to your vocabulary, waited angrily in line at the gas pumps, fretted over OPEC, then forgot all about the so-called energy crisis, rejoicing when the price of oil dropped back down. "William, it's time for you to merge the technological penchant which fire has etched into your brains for over three million years of evolution with your own spiritual upbringings. I've shown you how your ancestors lived. With poetry and song and simple sticks. Humane. Civilized. In painted caves, beneath the communion of the heavens, connected to their kind and to the surrounding haven of animal and plant life. They were the ones who first played with fire. Conversely, that genius can still solve the human energy crisis. You've had perfection. Modern technology need not be counter to all that."
"So tell me what you have in mind." "The sun." "So what else is new?" "Enlightenment." "Rubbish." "Perfecting a dream!" "How about cleaning up the environment first?" "Hire a maid." "That's your grand economic theory which will alter human behavior and quiet down this world of ours?" She's in one of her perverse moods. I throw more wood on the fire, go to the sink and pour myself some water, then peek into the terrarium. The cockroaches have multiplied, and so have the ants which feed on them. It's horrible to see the kill—the cockroach is frantic once the ants have decided to go after it. The gray creature wriggles and tries to escape, invariably getting stuck, or slipping onto its back, where the insects seize its underbelly between pincers and feast on the live thing. All organisms die more or less like that. It suddenly dawns on me that mankind has spent a million years trying to avoid the cruelty of nature. And fire has been our key technique for purging the Earth of such horrors, guaranteeing security, warmth, illumination, power. The irony of our modern dilemmas could not be more intriguing, difficult. I walk back to the computer. "Gaia, what's the matter? What is it? Tell me what's troubling you." She seems to know, to have felt my moment beside the terrarium. "I look out on a universe that is dark and mute, but loaded with possibilities—possibilities that are in the process of being realized here on Earth. Everything can happen! Miracle upon miracle. I want to share it. Through the inspired use of energy you should be able to transcend all of your limitations and woes." "I agree. But when you talk about transcendence I get nervous." "You've been living at a Buddhist cliff monastery two thousand feet up in the air for five months and you're telling me that the word 'transcendence' suddenly makes you nervous?" "I would like clarity." I feel the weight of her passion. It is distracted, luminous, indulgent. "All right. There's an eagle buried in the high snows of Cho Oyu's north face. And millions of lady-bugs mating on the ice. There are snow leopard cubs cuddling in frozen caves and Tibetan rhododendrons pushing through the thaw. All
in absence of fire." "That's very lovely, but I'd like to know what you're getting at. I mean, you have all this information at your disposal and you're making it needlessly difficult." She's enlisted such roundabout techniques all along; her logic cloys, her access points vanish. Just when I think I've made contact, she eludes me. Answers are not answers; solutions are not solutions. It's always up to me. And unfortunately, I'm famous for my indecisiveness. I think that's why my wife finally gave up and left me. I don't like that about myself. And I find it very trying in Gaia. "William, you've reached a point in your evolution where survival should be easy for you. Before the advent of controlled fire, your fledgling ancestors were limited to the energy equivalent of eighteen hundred calories a day. Now you have at your disposal at least a quarter million calories per day per person." "Facts, you're tyrannizing me with facts. You yourself have rightly enumerated that so much energy has meant so much pollution. Furthermore, your analysis ignores most of the Third World which may have an empire's worth of lovely spiritual traditions, but little access to your world of transcendent energy abundance. Right here in your beloved Himalayas, Gaia, there is a severe energy crunch. A scarcity of cash means that the locals must exploit the environment for whatever short-term profit can be eked from the lean land. Look out there— the forests of juniper and fir have nearly been wiped out. The average family in Nepal has no alternative to firewood for cooking and for warmth. What are they expected to do, starve to death? Freeze to death? Such grim prospects appear altogether possible. In many areas there is no firewood left. Yak dung, otherwise needed for precious fertilizer, is used as fuel. But there's little food left to cook. And the average Nepalese income every year is less than sixty dollars. Throughout the Himalayas, most of these mountain people are dependent upon the tourist dollar. But that outside cash invokes a whole other set of cultural and ecological problems: poverty, disease, deforestation." "William, there are alternatives to such poverty through the enlightened use of energy. This is a global truth in both rich and poor countries. The biosphere is depending on your species to get it right," she says confidently. "We've been trying for centuries to eradicate poverty. It isn't going to happen because you say it should." I've provoked her, all right. "Think, will you! Every glacier in the Himalayas represents an extraordinary solar amphitheater. Here in Nepal, more than almost anywhere else, it's obvious that the sun and water can be harnessed. Your predecessor, the monk in whose bed you have been sleeping, understood the energy potential of these mountains. Here in the monastery the sixty resident monks and I get twenty-two kilowatts of water power as a result of his basic ingenuity. Such hydropower was long ago envisioned by the monks, in the form of prayer wheels—poetry powered by water. Technology of the spirit." "A little poetry won't feed a hungry nation's belly. The Third World is not going to fuel its future with prayer." I am reminded of a story I once heard about a Stone Age tribe in the far west of Papua, New Guinea.
They worship a pool deep in the wilderness that is rich and black—a pool of pure oil. They rub it on their bodies and believe that it gives them their strength, their fertility. The oil is said to fertilize all the surrounding territory, to make it good and edible and safe for human habitation. The oil is known as Afek, their God. In the early 1940's this tribe heard, through hunters on the fringes of their territory, that white men were searching for the oil. The tribe freaked out, went on military alert, and for two decades prepared to lay siege to any and all intruders. The lives of their children, their children's children, and all of the creatures in the jungle were allegedly at stake. The fateful day came. A petroleum engineer assigned to an Australian patrol was brought into a clearing where the tribal chieftain had no choice but to meet him. This was the end. The people of Afek began to die. The bees, previously benign and productive, started stinging their human friends, and produced no honey. Snakes turned against the people. The grasslands died, the rivers dried up. The engineer went to the sacred pool of oil, tested it with a vial, and was said to have remarked with little or no consideration, that the oil—their God, King of Kings—was no good, too high in sulfur content. And that was it. Except to say that the tribe, which had lived harmoniously for thousands of years, was brought rudely into the twentieth century by circumstances which resulted in their virtual extinction as a tribe. For oil. For money. And the oil wasn't even any good! The story always reminded me of the terrible impasse financial cultures of the West face in mending the financial ruin so pervasive elsewhere in the world, without committing deeds of ethnic abuse tantamount to war, or genocide. The Third World is totally vulnerable to such abuse. "I just don't see any true, global solutions, Gaia. Certainly not economic ones. The old adage escalates —the rich get richer, the poor poorer. I'm sorry." "Your training as an ecologist did not incline you toward solutions. Only problems, William. But you'll learn." "What will I learn?" "The Third World, as you call it, is not without ingenious tools. Take a country like Brazil, newly on the road to nuclear power. The developing nations are on the eve of an Industrial Revolution and the results could be astonishing, even to a sour-headed ecologist like yourself. More importantly, it's technological solutions that will begin to retrain other, more insidious human proclivities that have grown out of fire." "I don't think nuclear power is the answer for a country over one hundred billion dollars in debt." "In France there are nearly three hundred nuclear power plants. These descendants of Homo erectus don't seem to have any problem with it." I'm astonished by her cavalier blind spots. "You're not worried about waste disposal? Meltdowns?"
"They've solved the meltdown business with cooler reactors. As for waste disposal, the secret is in compression and injection—injection into the Earth, I mean." "You can't be serious." "What do you think the center of the Earth is all about? Radiation, heat, inferno. You need merely to figure out how to inject your trivial amounts of waste deep into the Earth. Of course, if you falter in that task, I might recommend more immediate energy expediencies." "Such as?" Her monitor thunders with the sound of a waterfall. "The whole world explodes with energy, a perpetual dance of sun and water. Were you to take the hydrogen from water and fuse its atoms, you could very nearly bring-the power of a star to a poor man's hamlet. Recent investigations utilizing the medium of palladium indicate a net gain of energy." "You're referring, I assume, to fusion power?" "Precisely. Scientists are onto something very big, William, at places like Livermore Laboratories and Texas A&M University. By shooting a laser beam down a mile-long causeway at a pea-size pellet of pressurized deuterium, for example, one experimental fusion reactor has captured the power of the sun. A few more years of practice should get the dicey particulars right—and then think of it!" "I don't think fusion is the alternative to human energy needs." She suddenly gets her own witness, some fellow in a hard hat speaking from the guts of the Livermore Nova laser reactor. "Listen, mister, I've been working here for years and I can assure you that fusion is safe, and spectacularly economical. The interesting thing about fusion of course is that the fuel is water. Hydrogen is the most abundant element in the universe. Ninety percent of all known mass is hydrogen. And hydrogen is the fuel of fusion. Fusion is much more efficient than what we're used to, fossil fuels and combustion and such. Over ten million times more efficient than any other known fuel." Gaia would be great at an airport. I can see her there, in saffron robes and tied-back hair, manning a pro-fusion booth, passing out literature in Arabic, Russian, and English. Hey, mister, a little fusion, make your day bright, cheery, go home to the wife and kids with the good news! Honey, fusion, it's fusion! Hey you, dope-face, how 'bout some fusion . . . hey you, fuck-head, take some fusion . . . "You've overlooked four problems associated with fusion," I tell her. "First, it may not work. Second, the astronomical cost—several billion dollars per plant. Third, its financial inaccessibility to the underdeveloped countries who lack an infrastructure that would even enable them to make use of such energy. And fourth, the wasted excess. Reactors like the one you just showed me would produce a. glut of energy that the world, ironically, would never use. And if you produce gigawatts of excess energy, someone has to pay the bill. So you tell me: What's the answer, Gaia?"
She's undaunted, testing me. Her comeback is fast and flirtatious. "That's what I like about you—your willingness to listen. , Not ten miles away from the Lawrence Livermore fusion reactor, in a quiet pass, exists a vast array of clean alternative energy. I so admired the passion of Don Quixote tilting at windmills. It's what I like about your species. Water and wind can generate power as well as poetry." "Let me play a little more of the devil's advocate. Windmills are a good beginning. Everything helps. But regions where wind blows in sufficient supply are surprisingly few. And most of these energyintensive structures are not cost-effective." She rallies with pictures drawn from the Chinese outback. "In China some families use their back garden for energy production. Solid waste from pigs is converted to methane gas through nature's own process of anaerobic metabolism. Every day tons of potential energy are deposited on the sidewalks of American cities." I watch as a dog scoots into frame, followed by a chicly clad businesswoman in Bottega Veneta leather pumps. Suddenly the dog stops, squats, and does nature's business while the woman stands waiting. A discordant image. "This dung, even your own, if fed to the voracious appetites of bacteria for methane conversion could supply nearly twelve percent of your nation's energy needs. Think about it, William." "You honestly believe that Americans are going to stir-fry their mixed veggies with the methane of dog shit? Get serious." She keeps at it, narrowing the list of possibilities, charged with a foregone conclusion. I can't predict but I can easily play her game. "In Brazil," she says, "they have utilized agricultural residues like corn mash and turned them into high-quality fuels that burn with greater heat and cleanliness than fossil fuels. Brazil produces over one billion liters of ethanol every year." "That's the first persuasive alternative you've come up with," I exclaim. "I think the Model T was originally designed to run on corn-derived alcohol fuels. But at the moment there is still too much money to be made from selling oil and gas. Exxon's revenues are nearly a hundred billion dollars every year. That's a hundred times more money than the total GNP of many Third World countries. Exxon basically gave the finger to Congress when chastised over the case of the Valdez, which incidentally, after tax write-offs, allegedly made for an estimated one hundred fifty million dollars' profit for Exxon." She does not seem particularly impressed with my rebuttal. Gaia has her own agenda, and while I have no doubt that she listens to me, I don't appear to have convinced her about much of anything. For without even responding to the issue of profit, she switches the subject, hails a new alternative, moves glibly across the face of the planet. Maybe this is her way; perhaps she's forever one step ahead of me and can't even help herself in that. But suddenly we stare out across the barren world of Icelandic volcanos, steam vents. We've been there before, months ago, when she first presented herself to me. Bub-
bling mud pools which she alleged gave birth to life. Now she's back again, but not to muddy the waters. She's landed smack in the middle of a power plant. "No ordinary power plant, William. The whole planet can run on natural power, gas as well as steam. In Iceland, large numbers of the population already have the cleanest power supply available. Geothermal. You tap into the Earth's own heat. This power plant uses natural steam generated one thousand meters under the surface of the Earth. Water hits the magma, and is instantly turned to steam. That steam drives turbines, which convert the raw power to electricity. In the winter months some of the steam is diverted from the generation of electricity, and is fed into the homes as hot water for heating. The excess is run through pipes under the streets to melt the snow. The unpolluted water that's left is pumped out of the plant into this lagoon, which is known for its healing properties. What is left over is vented into the atmosphere to fall back onto the Earth eventually as rain or snow. The energy produced is one hundred percent clean. There is no waste, no pollution. It's cheap and renewable." "That's all very well if you live in Iceland, or on the edge of a volcano. But that has its problems." I am reminded of newsclips in the aftermath of the Mount St. Helens eruption—whole towns ignited in flames, cars exploding, black soot blotting out the sun for days. And other similar events, in the Japanese and Indonesian archipelagos, in the Soviet Union. There are risks associated with thermal energy. But again she's ahead of me and ushers in other alternatives, diffusing the solution elsewhere into quadrants, styles, and varied technologies—a diverse portfolio. Of course that makes good sense. "Ultimately, William, it is the sun that will save you." "I know, you've told me before." "And I'll tell you again. Photons offer your species the best hope for a never-ending source of energy." "So far, there's little money in it. Unless you're speaking of specialty items, like solar-driven watches, or cars, or satellites." "Look. The Earth's share of the sun amounts to one hundred and eighty trillion kilowatts every day. More than enough for everybody, and for any purpose that you can think of. Production of solar cells is getting cheaper every year. This clean and simple technique promises to revolutionize energy consumption for your species. It will allow you to one day give up fossil fuels entirely." "I had no idea you were so practical." "It's not the practical which interests me. It's your life." "Uh, what do you mean?" "William, I don't give a hoot whether you cook the family dinner with methane, Irish peat, or fusiondriven electricity."
"Then what?" "Your ability to defuse a time bomb. Peaceful, prosperous technology focuses your species' energy and attention away from your other predilections. You know damn well what I'm talking about. As your species grew with fire, so did your ability to destroy with fire." "Please don't—" But it's too late. She has a mind of her own and my two-bit measure of protest has no place on her agenda. The screen is flooded with fumes and I am sucked into the fray, falling with ten thousand other bombs into a gutted world of devastation, as if Dr. Strangelove himself were to fall out of the Himalayas into the real world. From Thyangboche to Treblinka. From Buddhism to bestiality, which she now sets out to chronicle. I fall into a generic landscape of ruin crisscrossed by armies of all nationalities, all times. There is Napoleon coercing five hundred thousand young men into wintry Moscow, and Augustus goading three hundred thirty thousand others up and down Europe. "Homo homini lupus," she carps. "Who can dispute mankind's violence in the face of all the evidence," lamented Freud. Two hundred fifty thousand battles since A.D. 1500, ten thousand battles in American history alone. Explosions ripping across the ruptured world in which I stand. There is carnage all around me. Arrows, bullets, lances, human skulls. Barbarians flooding the Toltec city of Tula and instituting sacrifice —a wall of corpses hanging out to dry. A man, drenched in the ejaculation of a flamethrower, runs towards me howling in agony as, incendiary bombs trigger fire storms—like those of Tokyo and Dresden— whose heat sucks in oxygen like a blast furnace. The vanquished are all around me, pathetically pulled into the flames by hurricane-force gales. But she keeps me impervious. It is my destiny this day to watch. "Four million victims," she whispers. "Look! Burned, tortured, sexually devoured, thrown dismembered into furnaces and off cliffs." And there, in the historical deserts of pain, the search-and-destroy missions accomplished against Amorite, Canaanite, Parasite, Halite, and Jobsite. Images that rise up before me from Vietnam: a man getting his head blown off. Moroccans raiding the Sahara in 1591, Mongols conquering the Sung Dynasty with fire power, Edward HI using cannon fire in the Scottish Wars of 1327. There is the weirdly fire-lit "Executions of the Third of May, 1808" by Goya, and Picasso's terrifying mayhem clutching the very radiance that burns the hand, bodies cavorting frantically, reaching from one fire into another. Flat, hellish light that condemns the whole world—"Guerin." Charged particle beams, neutron bombs, and other brainstorms of deranged Pentagon heavies, connoting the guaranteed annihilation of you all. Cannibalism in Burundi, the Congo, Bangladesh. Fetuses ripped from pregnant women by terrorists in Colombia in 1947. To my right Haulage’s invasion of Iraq in 1258—slaughter after slaughter unrelenting, and Iraq's own genocidal retaliation seven hundred thirty years later. An orgy of killing. "Out, vile jelly!" her Shakespeare roars. My eyes are singed. I can't see. "Please, God, no!"
Down, down into the hot horrifying self. Battleships blasting the heavens, light still flickering in silhouette inside my burned-out eye sockets. But there is no pain. Only the stunned awakening. Cries all around me. The nightmare. "Open your eyes, William. You can see!" "I can't." "Open them!" Slowly, the light dawns in full despair. A shoe? An empty village. The chaos has subsided. There is calm surrounding me now. The empty shoe sits in hardened mud in the middle of a deserted town. An old military jeep lies crashed against a fallen brick wall. Silence pervades the whole town. "Gaia? Why are you doing this to me? Please stop." "Oradour-sur-Glane. An unremarkable little French town that was burnt into history at four in the afternoon of June tenth, 1944. The day the soldiers came. They were young, their average age was only twenty, and they killed six hundred thirty-five people, mostly women and children. "The men who did the killing here looked into the faces of their victims as they died. Who knows what fires burned in their minds? "This was a deliberate brutal act. The men were taken in small groups to several houses." Together we walk through the town. No other animal lives here. I am an anomaly among ghosts. "The men died first. They were shot in the legs, so they couldn't run. They were then covered with wood and straw and set on fire with flamethrowers. "Only the baker was spared such a death. They threw him in his own bread oven, and ignited the flames. "The women and all the children were taken to the church and locked in. They heard the men die. Then two soldiers entered the church and began to shoot the people inside. Those who survived the bullets were promptly reduced to ash by an enormous bonfire that engulfed everybody. "The fire was so intense that the bell itself melted down." She leads me into the area of pews that once were. Against the former altar, a wooden box stands as haunting reminder of the terrible secret that transpired in this room devoted to God. "Somehow, this wooden confessional box did not burn. The bodies of two eight-year-old boys were found huddled inside. Imagine what fires burned in their little hearts, William. As they succumbed to the infernal heat all around them."
I turn from the awful thing and see seated before me an old woman. She wears bright-colored clothing. There is no sense of mourning on her face, only deep and lasting scars. "Who are you?" "Hibakusha!" says Gaia. "I don't understand." The woman begins to speak in Japanese. "She survived the blast at Hiroshima, William." , The woman is speaking not to me, but to Gaia. I'm sure of it. She holds herself in an attitude of final reckoning, as if offering up her destiny to that of higher powers. How she comes to be in a French church burned by the Germans is of no consequence to me at this point. I have seen too much, too fast. There is no logic to the panorama of destruction. Gaia has conveyed the images of random outbreaks of a disease. She started with the brain, and the simple gathering of human ancestors beside an African river, their faces and hands warmed by the honest, unassuming flames of prehistory. And, in her typical fashion, she led me through the evolution of that heat, into the technology that has come to characterize my kind. It got out of control. The horror slipped over us. The brain did not act to prevent it. And it is the brain that thus has a problem, perhaps an ingrained evolutionary gene for self-destruction. I don't know. But the behavior of my species is endemic—whether in Prance or Japan. Gaia translates for me as the woman speaks slowly and quietly: "The atom bomb was dropped on the sixth of August— my wedding ceremony was planned for the eighth. My dream was to be a good wife, and then when my first child was born to be a good mother. With these two dreams in mind I used to work hard. As I descended the stairs, in order to find a washbasin, I saw a beautiful array of bright colors spreading out on all sides of me. It was a mixture of red, orange, silver, green, blue—silent and beautiful. The next moment I realized I was in complete darkness and could not move my body even if I wanted to, as several objects had fallen on top of me. The moment I saw the bomb, I was affected by four thousand degrees of heat, and the force of the bomb threw me from the stairs into the corridor of the building. "Somebody rescued me out of the fire. Although at first I didn't know what was going on, I was gradually able to gain a clear sight of what was happening. I saw so many people running back and forth. I heard cries, like 'I need water', 'Oh, it's painful,' 'Mother.' "When I happened to look at my feet, there was someone there bathed in blood. This person's hair was flying out and I couldn't recognize whether it was a man or a woman. As it cried 'Sister!' to me, I realized it was my younger sister. Crushed pieces of glass were embedded in the upper half of her body .... My feet were numb. I felt nothing, even when I was rescued .... I stayed where I was until evening. That night, by a candle, I found out for the first time that my foot was missing." Like that, I am returned to the unbelievable calm of my Himalayan lair. I cannot believe what I've seen. There is no vomit to describe it.
Her monitor has resumed its meditative pulse. A sad, inconsolable sigh, articulated through the perennial light of her being. But there is something at the core of that Light which I have not seen before. The monument at Hiroshima. I sit down before her. "Isn't it strange, William, that you should burn a flame to commemorate those who were annihilated by flame!" "You don't make it easy, do you?" "You'd be lost without fire, and you may be lost with it," she says softly. "Gaia, you said earlier that our human ancestors had the solution. What did you mean?" Slowly, speaking from some faintly outlined penumbra of pain, she says, "When a child plays with fire, evolution is watching. Your ancestors were adaptable. That's how they evolved. That's why you exist, William!"
"The Transformation of Tsering" Two nights after Gaia put William Hope Planter through Dante's inferno, several rooms at the monastery burned down, including the kitchen. The disaster was attributed to an errant monk who left his electric space heater going too close to a stack of manuscript pages. There was a time when the loss of Buddhist prayers would have occasioned general mourning, for it would require some wearied underling to spend weeks or months rewriting the lost verse. But this was a different age. The monk merely requisitioned a runner boy who, for the price of fifty rupees, put on his adidas, got his second wind, and trekked the twenty miles or so to the Lukla airstrip, where he placed the charred, unreadable pages on the first flight to Kathmandu with instructions that a new copy of the enclosed be photocopied and returned by the next available Himalayan Air taxi. No sweat. However, something went wrong. A fire broke out on the plane, which managed to make an emergency landing in a rice paddy outside of Kathmandu. The occupants fled the craft just seconds before it exploded. So much for the Buddhist manuscript. The king initiated an investigation which led all the way to the runner boy and then to the monks. What had the boy really put on the plane? All right. What did the charred manuscript pages consist of? A description of hell, one of many Buddhist hells, it turned out. Hellish enough to cause the destruction of the aircraft. Buddha has his reasons. Everything was thus explained, everything resolved. Thyangboche has other concerns as well. Denzu's brother Tsering was killed on Everest. His body was recovered from the notorious Khumbu icefall, a stretch of sorely crevassed glacier known for its human appetite. A Sherpa immolation is to be performed on the grassy meadow adjoining the monastery. Hundreds of mourners will be coming from adjoining villages and the monastery is obliged to feed them. However, with the kitchen having burned up, the monks of Thyangboche are now on emergency
rations, at the mercy of poor local herders for bare essentials. Under the circumstances, I'm sure my presence must be a burden, though no monk has ever let on in that way. "Can you feed me?" I ask her one day. "Naturally," she responds with slight embarrassment. She knows what's next. I suppress my surprise, my anger. "That's very kind of you. Now tell me: Why have I been living on greens and stale bread for half a year, if you are capable of delivering up my meal?" "What would you like?" "I don't know. It's the principle I'm speaking of. Wait a minute—maybe some hot sourdough with salmon loaf. Guacamole." "For breakfast?" "Absolutely. And mustard, straight, served in Baccarat. And while you're at it, how about a little news, say CNN?" "You need only type it in." "You're telling me that I can get the news on your monitor?" "Anything, William." "Show me!" And sure enough, there it is: a chemical explosion at a factory along the Mississippi; a falcon that goes extinct in Bavaria; the first fatality involving an electric-powered automobile. Riots at the State House in Juneau over allegations of gross negligence in the case of yet another oil spill in the Gulf of Alaska. Airborne anthrax in Utah killing off sheep. Terrorists claiming responsibility for the introduction of a vicious runaway bacterium in the corn belt . . . the drought continues across America. No rain in the northwest for three months. Another wave of mass starvation in the Sudan. A nuclear accident in Brazil which kills several hundred workers, contaminating tens of thousands of others. The Soviet Green Party wins overwhelmingly in the State elections. The U.S. Vice President is hospitalized for his painful tennis elbow. As I watch the first news to come my way in six months, I realize that nothing in the world has changed. It's still a lousy, no-good, man-eating place. But I have changed. Not my clothes—for I am down to a single pair of corduroys and soon I'll have no choice but to don my predecessor's robes—but my priorities. As for Gaia, I can't take my eyes off her at this point. I'm beholden to her, continually awed, stricken. But she also infuriates me. She entices me. Corrupts me. Abuses me. I can't imagine life without her. Suddenly, on the little teakwood table where we frequently play chess—my game has improved—there sits a place setting, combining all of the feminine touches I remember from long ago. My ex was
possessed by such things, old Meissen she'd acquire at Christie's auctions, the finest stemware-— French glazed twists, eighteenth-century silver, old Japanese earthenware that should have been unthinkable on a professor's salary. My ex had inherited a bundle. Rich eclectic taste. It was rare when we could use a dishwasher. Every place setting, even to watch • TV by, was intended to be regal. She was hung up that way, but I was not unappreciative, and managed along the way to pick up a slight cultivation for such-^-as I call it— female detail . . . tables perpetually graced with freesias, tulips, lilies, and ranunculuses. And now it all comes back to me. A white damask cloth, a fresh black rose in a full lead crystal stem from Tiffany. On the dish, decorative chevrons of whole trout in mustard sauce. Roquefort grapes atop purple flowering kale. Fresh figs and dry goat cheese. Spinach-Gruyere quiche, fresh squeezed orange juice with noniodined ice cubes, hot sourdough from San Francisco under a pink linen cloth in a basket from France, and—the piece de resistance—a large saucer filled with garlicky guacamole. "Gaia, you're a genius!" "Thank you." I dig in, with bib and all, knowing full well that my sacerdotal compatriots are out munching on morning rice, the taste of which is closest to grubs or maggots. I do feel guilty. Ohhh, I feel so guilty. Well, screw guilt. The meal completed, I lie down on the bed, propped up cozily, and do some heavy dental flossing. I'd like to believe, when it's all over, that William Hope Planter is credited with having introduced dental floss to Buddhism. I go outside, where final preparations for Tsering's celestial burial are underway. It is no burial in the sense that westerners understand it. A Tibetan undertaker is out on a far knoll, chopping up the Sherpa. Several hours ago, a shaman had placed thick globules of butter in Tsering's cerebral orifices and poured sacred water over the face while the Rinpoche recited passages from the Bardo Thodol, the Tibetan Book of the Dead. He had read various scriptures pertaining to the emancipation of consciousness in the afterlife, and the process of reincarnation. Later, while friends and loved ones of the deceased fed on grains and spirits, the Rinpoche recited the words: "With the knife of wisdom, cut the flesh from a cage of bone. Then, having taken apart the bones, behold the marrow within, and ask yourself, 'Where is its essence now?'" Large Himalayan vultures wait near the grisly scene. Some of Tsering's body parts will be fed to the birds, who in turn can be counted on to spread them to the four winds in feces dropped throughout the Asian highlands. Other body parts will be burned and consecrated by the Lamas, sent floating down the river and out into nirvana. Tomorrow at dawn the ceremony takes place and I am invited to watch. The monks are all industry, rebuilding their gutted refectory. Wood is brought up from the valley by a whole new influx of Sherpas who are offering their help for nothing. For the first time I recognize the importance of the monastic clergy to the surrounding lay population. As in any religious community, the ties are quiet but strong. The Sherpa depend upon the daily prayers of these monks to maintain contact with the other world to which they are all headed. It is an especially crucial contact in Buddhism inasmuch as the other world is right here, right now. One can lose the path, get caught out on
a shaky bridge or lost in the mist. Demons abound, as figured in the iconography of Thyangboche. Demons live in the forest and must be propitiated. Demons live in the rivers, in the high snows. To lose touch with Buddha and his many arhats, or heavenly disciples, is to risk one's life. Knowing these things, I lend a hand. "Hammer!" says Dorje, a young monk neophyte who came from the town of Pokhara a year ago. Dorje is handsome, probably nineteen, animated, likable. He speaks superb English and would probably do well in the theater. He's very friendly with the other monks. I suspect he's gay. I suspect many of the monks are gay. "Hammer for Buddha!" he cajoles me. No one was injured in the fire. As I work something comes to mind: The fire and the explosion of the airplane occurred within seventy-two hours of Gaia's own fiery train of thought. Could be coincidence. Probably not. In the afternoon, I join the others for a session in the Lakhang. It is more rousing prayer than usual, I suppose on account of the fact that everyone is drenched in the sweat of his labor. This is the real footstomping, brass-bugling oration of men poised for transformation. Part of that transformation has something to do with Tsering. Outside, a large gathering of his peers stand beside the place where the ceremony will occur the following morning. The women weep, the men weep. It is a moment wherein the common emotions are set free. The last of the vultures leaves the monastery, flying toward the dusk that quickly enshrouds the mountains. I walk back to my room. Another meal awaits me, still hot. "What have you made there?" "Yellow summer squash soup with curry. Broccoli with roasted peppers and capers. Grilled cheese with smoked chilies and cilantro. Almond-pine nut tart for dessert. Sound all right?" "Cannelloni. Throw in some cannelloni and creamed spinach. As well as more hot bread and guacamole." "Fine." "Oh, and a chilled virgin chi chi." "Ummm—" Her wheels churn, searching through unguessable dictionaries of the barmaid's vernacular. Within a few seconds the glass appears, filled to the brim. Sweetest coconut I ever tasted. An incredible feast. As I devour this gift of the gods, satisfied, unbelievably happy, willing to forget everything else but the pleasure of such a meal, she starts. "William?"
"Huh?" "What's it like to eat?" "You don't know?" "No." "But you created this meal." "That's different." "How is it different?" Catch her. Catch her in the act. Separate the creator from the created. Pin her down. Find the real Gain. The quest has begun to plague my inner thoughts to the point of distraction. She doesn't answer me, cagey, hiding out in some evasive realm of the tease. Her curiosity is insistent, on the edge of an inquiry that is clearly capable of moving in either direction—inwardly, where her blue haze spirals and her introspection vanishes within itself, or out toward that meeting of minds where I might participate in the dialogue. Food is on her mind. A concrete starting point. "What's it like to eat? Well, it's like . . . it's good, it's being intimate, it tastes and feels right, it's necessary—as you know." She's serious. Gaia can create but the creator is not necessarily the creation. If she is the creation, then she is barred from its pleasures, its pains. Perhaps that explains her apparent immunity to my own feelings; her easy ability to conjure horror and beatitude with a seeming indifference. Does*she desire to be me? "Is it like love?" she goes on. "Is food like love? I don't think so. No. Love is a longterm urging; to consume and be consumed—in some poetic sense—by another person." "I see no difference between the act of love and the act of agriculture." "Go to bed. I'm tired." "Then you go to bed. I'm going out!" I lie in bed, grateful for the dark night. The electricity is out. Gaia, for the first time since I've been here, is also dark, save for the little penlights on her derriere and the ghostly green glow emanating from her terrarium. The plants in that glass casing have grown several feet higher than the terrarium itself and are inching closer and closer to the wooden beams of the
ceiling. Their growth has mysteriously accelerated in the last few weeks. Two days ago I suggested to Gaia that we analyze the state of world agriculture. Clearly the subject of agriculture has struck a resonant note with her because she's also hungry. Hungry for experience, hungry for life. But I don't know how to answer her queries. They are beginning to touch me, personally, to reach out in a way that leaves me feeling exposed, vulnerable. Never has a morning dawned so electric. The mountains reel in the hues of vertigo—glaciers ready to drop off, walls hit by spectacular angles of light, veils of transparent mist swirling in the early morning heat. I go to the washbasin, freshen up, and turn to my roommate. "Where did you go last night?" I ask her, curious to know what she meant by her late-night quip. "Into Tsering," she responds. "What?" "Oh bliss, oh atoms, oh carbon, nitrogen, and oxygen. Oh, blessed soil! Luminescent bacteria, all working their grimy little bodies into action." "Tsering, in case you didn't notice, became meat for vultures," I remind her, always the one to "squelch the rhyme and seize the rind," as my father used to say. He was a survivor of the Pittsburgh ghettos, a Carnegie-Mellon mechanical engineer. Taught me how to use a screwdriver, my first true revelation in life. Nothing really changed since that day. Gaia has her own practical mission, which gives me some respect for her. She may be a helium balloon of consciousness, but her feet—so to speak—are planted firmly in the ground. I like that. "His heart and genitals and brain were kept from the birds," she says. "Taken collectively, his body returns. The vultures return. Eat and be eaten. It is the old Shakespearean law of biodegradables —the 'thief that feeds and breeds by a composure stolen from the general excrement.' Shakespeare was referring - to the Earth, William. A law inherent to every gram of soil where there are as many as five hundred thousand bacteria, one hundred thousand yeast cells, nine hundred thousand fungi, viruses, insects, plants, and earthworms; twenty million actinomycetes, five hundred thousand algae, five hundred thousand protozoa—all attacking the new source of food— Tsering. This whole Earth is in perpetual bloom because of the recycling which is basic to life. That which dies is born anew. This basic flow of energy is the Earth's foremost rhapsody. The oxidation of fat, the breakdown of protein and carbohydrates, may seem a trifle morbid to your kind—the stuff of cemeteries. But to me it's pure poetry." "Cemeteries aren't exactly my idea of poetry." "Pure poetry! In death certain cells remain alive, at least for a while. And in that brief period after death, living substance is released through the body's muscles into the Earth. And what a sweet fragrancy that is. A scent finer than prayer." I go to the washbasin and shave.
"What do you want for breakfast?" she asks. "I'm dieting today." My stomach's already on the move, toward my throat. "The worm is ever with you, William .... Oh beloved worm, lovely messenger from the afterlife." "What do you know about the afterlife?" She's abrupt, hovering with the data, ready to seize upon a sector of knowledge I sense she is particularly fond of. "Come close." "Why?" "I want to show you something." "I've heard that line before. What do you have in mind, Gaia?" "Come here." The seductress is all about her. And I fall for it once again. Not that it probably matters. She'd pluck me from a mountaintop and throw me into cold water if it suited her. The screen ignites with a row of half-opened corpses. A pathologist's lab somewhere. A fat fellow, sloppy joe in one hand, hacksaw in the other, is busy explaining technique to a svelte young lab assistant. She's prim and proper, dressed in white. His dungarees are noxious and disgusting with bloody residues from past exploratories. Gaia whispers to me over the two of them. "When you dissect the corpse long deceased, you are in the presence of the very same forces that have transformed and maintained this planet. From dust unto dust. You probably never realized how scientific Ecclesiastes really was! The age-old remains of life— skulls and weather-beaten flesh— are gentle pieces of a fabulous puzzle." She inches me into the conversation. The fat guy's got his radio going—"Good Day Sunshine." The chili from his sandwich is dripping off his surgical gloves. Surrounded by formaldehyde jars, scalpels, and cadavers, she continues to cut into a ribcage while he eats and trims. She is exasperated, grimacing under the strain of a new job. "That one's bloating up with gas. Sometimes they swell up so large they break the casket," he says. "I hate this." "Squeamish, huh?" She works with her head turned away, trying to break up the ribs on his instructions. "They told me
you've been down here for twenty-five years. Is that true?" she says with a wince. "That's right. Gets so one is addicted. Everybody else in medical school thought pathology was about the worst. But I liked it right off. See, I figure most folks one way or another spend the best part of their lives trying to act like they aren't ever going to croak. That not only makes death a big disappointment to them, it also makes the rest of their lives cockeyed. It's hard to be real enthusiastic about a movie if you know from the beginning that the end stinks." "What's the alternative?" she asks, brushing her long blond hair out of her way. "Better tie that back .... Anyway, that's the point. There just plain and simple is no alternative. Working here keeps that pretty clear. Gives additional weight to the business of life, you know, how precious it is and all that. I also get off on the delicate fragrance of formaldehyde. Aphrodisiac, you know?" "I didn't—" "Oh, sure. That's why these guys are all hard!" He chokes with laughter and she's all the more squeamish now. "Watch what you're doing. You don't want to hurt this guy." "He's already dead." "In a manner of speaking." "What does he mean by that, Gaia?" I interject. "They have their hands in the thick of something very spiritual." "Right." "You asked me about the afterlife. You're looking at the triumphant transition." He spills his whole burger into the fellow's exposed and gory lung cavity. The young woman stares horrified as the pathologist pulls it back out, what morsels he can, and tosses the stuff in a wastebasket. "You're really sick!" she screams, running out of the room. "Just thorough," he says indifferently. Now he begins in earnest to finish the job. Gaia provides me with commentary as I look on from a safe, antiseptic distance behind the monitor. "Within a very few days of a person's demise, the organs are honeycombed with green gas; bulging eyes, blistered skin, protruding tongue and bloated trunk." "This is disgusting!" I remind her. "Your psyche's a trifle fragile, William. Let me impart one thought to you. The corpse is a paradise of luminescent bacteria, anaerobic clostridia, penicillium—all working their own active, grimy little bodies into action, where they oxidize fat, break down protein and carbohydrates. Just as ATP provides
life to the cell, in death the muscles release a living substance called inosine monophosphate. You might think of it as chemical immortality. The process is irreversible. And then the lysosome organelles remaining in the cells of the dead person begin feeding from within, breaking down everything. Meanwhile the living larvae of tinea Pallescentella—otherwise called the greater pale clothes moth— get into the coffin, even triple-bolted coffins, to feast on the luscious remains. This body is a gift to life. Over one hundred billion human beings have died on this Earth. Their myriad corpses have augmented the fertility of the soil and are inherent to human agriculture." As the pathologist's hand comes out of the gassy moat of a ribcage, a shovel suddenly enters a field, turning the soil. The movement—by Gaia's own sleight of hand—is singular. The image reads unambiguously on her monitor. "Abundant fields and flowers are the result of their energy transformation. The breakdown of carbon bonds in any corpse yields a delicate wisp of heat into the soil and atmosphere. Much of that thermal vitality, resulting from death, is recycled in the form of myriad chemicals and nutrients." The pathologist has closed shop for the day. He takes off his gloves, puts away his tools, wipes chili off his mouth with his filthy surgical apron sleeve, and ponders the miracle of his profession as he has no doubt done for many years. He clearly loves his work. Lights off, he heads up the stairs, leaving the door to the lab unlocked. "He never locks the door," she says, "He knows that the nights are restless times for a corpse." "Gaia, this is bullshit." But something starts to happen. The corpses begin to glow. Gaia's own Rocky Horror Picture Show. A sparkling sensation overtakes the many tables holding bodies. The jars fizzle. A steam rises in the scant illumination of night. Now I see that the surrounding walls have changed. This is no pathology lab. There is cave rock on all sides. Her computer printer sets to work. The readout is displayed in Gaian blue. LA CHAPELLE; LA FERRASSIE; TESHIK TASH; GRIMALDI DES ENFANTS-KHUFU; CHEOPS — Another figure enters the cave. He wears a long white robe decorated in golden hieroglyphs and is attended by a woman, less squeamish than the earlier blonde. They approach a body, semicovered in white linen on a stone table I hadn't noticed before. The person's face is solemn and waxy. He has lain in salt for seventy days, Gaia rapturously informs me. The embalmer strokes his face and removes the linen. I watch as the two go to work, rubbing down the corpse with oil, plugging the nose, coating the skin with resin and restoring the eye sockets with linen pads. They proceed to extract his brain through his nostrils and store it in a canopic jar. But it's the heart they're really interested in. As they leave with the precious organ, I detect movement from another side of the cave. A short, stooped little man is attending to another corpse. The fellow holds adornments in his large hand. By the
shape of his skull I realize that he's Neanderthal. She's hurtling me through time. "So gentle, loving," Gaia whispers. The man places a bracelet of shellfish, a pendant of bone, a ring of ivory, some red-painted clay, and a tiara of dried flowers atop portions of the body. Clearly an act of ancient reverence, obeisance, conscience. Perhaps one of the first such acts. "Why is the corpse arranged in a fetal position?" "Your ancestors knew that the corpse would come back. Your entire prehistory is about reincarnation, William." Suddenly, the Neanderthal stands back, as the corpse begins to move. I can't believe it. The legs straighten in a series of erratic jerks, the head lifts up, and I expect Colin-Clive to come running in shouting "Eureka." But instead, that same mist and sparkling discharge—luminous atoms in the night— are streaming down the shoulders and chest of the victim, surrounding the survivor, who is singing something unutterably beautiful. There is silent lightning between living eyes and dead eye sockets. Colors in the dark. Fingers touching bone touching fingers. His head is lowered in prayer, as the corpse too lowers back down, of its own free will, and sleeps a sleep I can only imagine is one of final satisfaction and liberation. The living Neanderthal then bids farewell and leaves through the same shadowy exit in the adjoining rock wall. An extraordinary happening! The mystery show continues topside. The same sparkling I now recognize to be the stars. I'm sitting outside on the grass. A brilliant firmament surrounds me and a cool wind dissipates the imagined stench of so much decay. AD around me are the ghostly white glaciers of Tamserku, Kantega, Ama Dablam, and Everest, the mountains surrounding Thyangboche. It is the middle of the night, but I smell the smoke of pine and cypress. A chanting continues. The Sherpas and monks are preparing for the final emancipation of Tsering's soul. "The Diamond Sutra," Gaia calmly beckons. "The monks chant from Buddha's verse to help the spirit find its way. Thus shall you think of all this fleeting world: A star at dawn, a bubble in a stream; A flash of lightning in a summer cloud, A flickering lamp, a phantom, and a dream.'" I hear the crash of cymbals and the strident dirge of a trumpet fashioned from some other human's thigh bone. What bones of Tsering were left by the vultures are now smashed on the stone. Those tidbits that escaped the jaws of the scavengers are transformed to ash on a wood fire. The assemblage stands out, clustered in the starlight atop a rocky promontory overlooking the world. From my vantage, the party is higher than the summit of Everest. "You might like to know," Gaia begins, "that the same amount of energy released in death is also released during every sexual orgasm, approximately one hundred fifty calories." "What about during masturbation, or foreplay, or prolonged death through torture?" I snap back, amused, annoyed by her irreverence.
Suddenly the prude in her retorts. "You're baiting me. I'm not interested in such delineations. It's the bottom line that counts, William." I gaze across the monastery fields toward Tsering's biochemical swan song, the incarnation of myriad other small human demises which have preceded him, and find it hard to even conceptualize Gaia's premise that death and fertility share the same energy fervor. The scientist in me expects a more thorough analysis. "You know what I'm thinking. So satisfy the skeptic in me." "William, the Earth receives that energy—whether its source is the erotic or the decaying—" "I wouldn't set those up as opposites—" "They're not. They're pairs, lyrical compleats whose presence on Earth is distinguished by the tantalizing form they adopt—namely, food." "Food?" "Life and death are forever and romantically connected. The energy requirements of the living are provided by the dying." "Translate that romantic connection into food." "I just did, William. The energy from life and from death, played out in a single organism, multiplied by all living organisms—what the eastern mystic refers to loosely as samsara, the wheel of existence— results in the generation of some one hundred sixty billion metric tons of energy every year. All the food in the world. Leaves and fruits on the trees, humus on the forest floor, kelp in the seas— phytomass. Trillions of atoms' worth. What that slow worm is to Tsering, Tsering is to the entire planet. Biological reincarnation! Probability analysis suggests that two hundred molecules from Buddha are likely to be in Tsering, as well as in your own body." "Wait a minute, you've lost me. Trillions of atoms, one hundred sixty billion metric tons of energy, two hundred molecules—Gaia, this is all statistically beyond me, especially when dished out in the middle of the night beside these funereal goings-on." She catapults me back into our room. Now I'm seated at the chair. Lavoris is there, whining in a very un-snow leopardlike way for some hot milk. Instantly, Gaia accommodates her favorite feline; the milk is delivered, in a sterling silver bowl with old Czarist Russia hallmark, no less, along with a chocolate Nabisco wafer. Lavoris is in dreamland. "A few days ago I asked you about food." "I know. You were looking at starvation rations. I figured it was the least I could do to help you out." I wish—God, how I wish I could see the face behind those words, the grin, the feminine beauty. "That was very kind of you. Believe me, I much appreciate the culinary boost. Yet it raises a larger issue that's bothered me ever since we started getting to know one another." She pauses. I don't know if she's read my mind, is disinterested, or already onto a full-blown answer.
"Go on," she then remarks. "Okay. You've sung the praises of a fertile Earth for many months, taking a disinterested view in the pain and suffering that occurs every second on this planet in spite of the supposed cornucopia all around us. Why is that?" I've tried to put her on the spot before without the best luck. Now, given all that she's said and done, I don't see how she can avoid straight answers to hard questions. "Look," she begins. "The Earth produces one hundred forty-five pounds of food per person per day. Even if you were able to argue effectively that most of that tonnage is inaccessible or unpalatable to humans, there is still your own well-developed technical backup." "What do you mean?" "Human beings produce an additional five pounds per day of food through agriculture, which is considerably more than your species requires." "Wait a minute: Are you saying that we produce more than we need?" I find the notion tantalizing and false. I'd spent a good deal of time following the "Ending Hunger" movement, which was based on the lovely notion that the world will end hunger if everyone merely wills it to be so. I can't believe that Gaia would fall for that soapy-headed eighties stuff. "Definitely," she says. I'm suddenly worried. We're talking credibility here. Could she be slipping? I propose more detailed questions, writing the basics in my notebook, then addressing her head-on: "Why are there one hundred fifty million human beings starving to death at this very moment? Why are there two billion people malnourished? And what about the grim food future that has been predicted by our scientists?" "What about it?" "I lay the contradiction in your lap: Help me out." "Get some sleep. Otherwise you'll be grumpy. We'll speak in the morning." "You're just escaping the obvious fallacy—or glibness— in your argument. There's no argument. You're simply wrong." "Good night William." I've pissed her off. Good! "Sweet dreams, princess," I say, content to be right, if only for one night. From my pillow I am able to look directly across to her screen, catching it at an angle that diffuses the blue glow into a diagonal incoherence. Her pulse contracts and expands throughout the night, in slow circumambulatory pinks and cold azures. Half a year has transpired and she remains as alien and unexplained as ever. Though we have shared unbelievable adventures, they have always been
somehow commandeered. I'm not sure how flexible she is. I have a mind to send word out to my old buddy George Henley at Jet Propulsion Labs. "Get your butt over here, George; tell me if I've gone crazy. Who is this broad?" With his exemplary powers of nerd-sniveling inquiry and perverse computerese, George would have no difficulty discerning the real Gaia. Or would he? What about the Lama? He must be aware of what's going on. He left me tea; he was worried about me —or so Gaia alleged. But I've had no visitors in here, not while I've been here anyway. It just doesn't add up. Five months ago I rejected my so-called "conspiracy theory" surrounding the unlikely circumstances of the supposed former monk who assembled the computer. A few months back I asked Kaldup for more details. How was a monk able to create so complex a machine? Where had he obtained his training in the fine art of artificial intelligence software, expert systems, high-density data retrieval hardware, and so forth? Kaldup was little help. All I am able to glean of that monk was his name, Lao, a Chinese Buddhist. One young nomad Sherpa, whom I met on the trail a few months ago and had occasion to speak with, apparently watched Lao depart Thyangboche at dusk on December 31, 1984, slowly riding a yak toward Chomolungma through deep and unrelenting snow. In May I spent an evening with a rowdy group of drunken herders out beneath the rhododendron forest in the valley below the monastery. One of them also knew Lao. He described him as the craziest of all the monks, something of a legend to the Sherpa. He did not believe in prayer. He chased all the girls— very un-Buddhistlike, very Tibetan, however—and was rumored to have several wives and dozens of children, perhaps hundreds of grandchildren stashed in villages up and down the Himalayas. Lao was a mountain man, lean, agile like an ibex, better, stronger the higher he circulated. He ate little, drank manly quantities of alcohol, and tinkered from morning until night with whatever he could get his hands on. That included radios, VCR's, a Walkman, a CD player, countless cameras, watches, optical equipment, a Bell & Howell Government of Nepal 16mm film projector, varieties of field biology tools of the trade, left by cadres of naturalists who passed through Solo Khumbu; chromemolybdenum pitons left over from mountaineering expeditions, high-density aluminum carabiners, Perlon ropes, nylon slings, an abundance of heavy machinery parts that had broken down during the construction of the hydroelectric plant upriver, and a steady supply of computer parts brought to Lao by several California New Age entrepreneurs attached to various Himalayan foundations and computerrelated Silicon Valley companies. The Japanese had made substantial donations to the monastery; a Swiss firm had as well. Sir Edmund Hillary had managed to bring trade and revenue to surrounding Sherpa villages, while U.S., Soviet, and Italian projects working with the Nepalese government on a variety of ecological needs had imported other tools of the trade, some of which, either in whole or in part, had found their way into the hands of the indomitable Mr. Lao, as I now thought of him. A sort of Nepalese Dr. No. And I was sleeping in his bed. Did Lao actually build Gaia? But how? I've always dreamed of astral projection. Who hasn't? To be able at will, in the blink of an eye, at the first onset of an impulse, to be transported anywhere, back in time, even into the future—a tactic she has thus far left alone. But it's not possible. And yet, unless I'm totally deranged, hypoxic, sick unto death with altitude fever, or simply on drugs without even realizing it, then what I've experienced is as
real as that tarantula in the terrarium. And if it is real, how the hell am I ever going to go home again? I've lived with the lemmings, experienced firsthand Hiroshima, Neanderthal burial, the Greece of Homer's time, revolution in China, the itinerary of atoms after death. Impossible things. Fantasy trips. Sucked in and out of a computer whose idea of a good time is to leave me out in Africa at night, 1.4 million years ago but who now, under more penitent circumstances, is preparing me phenomenal meals. Since she can create such food, why not feed the world? What else can she do? She could save the world. God, she's God! Bill, steady old fart. You 're flustered, you 're angry, you 're just plain stupid. This woman's got you addicted to a drug. The whole thing is— Her magnetic pulse, distiller of dreams, harbinger of calm, countervenes poor William's tedious resurgence of self-doubt. She'll ease him into the argument, bolster his confidence, set him straight. He is an ecologist, after all; open-minded, inquisitive. At times even gullible. She's onto his little games, that cynical veneer, that place of laziness where he refuses to admit to new testimony. She'll work the muscles of his brain, stretch him out, expose him full-bodied to the logic of higher truths. And if truths don't do it, lies. Whatever it takes to get him to see clearly. With uncharacteristic pause, Gaia considers her next move. Then, she says, "It was always said that Bangladesh symbolized the hunger crisis. But Bangladesh in fact offers the prospect of agricultural self-sufficiency." I wake up from the cross fire of mind reading, nervous impulses, bioelectricity between my brain and that of the computer. The air is so thick I can pass my finger through the motes. I see something, interrupting my train of thought, a shivering figure highlighted between the myriad minutiae touched by light. A figure that cries out and is in pain. A child, holographically stranded in the purgatory of my own thoughts, projected into the space of the chamber. Am I doing that, within my own mind? Or is this the work of Gaia? Now I can no longer tell. But it is clear that I am looking at marasmus, proteincalorie deficiency. Slowly, the child revolves three hundred sixty degrees as I stare at the disfigured thing. Dried diarrhea on its swollen legs, hair falling out, distended belly, a look of utter apathy, and tears. The myelin sheaths insulating the nerves' axons in the child's brain are inadequately fueled. The brain damage results from hunger. The child's continuous crying will consume its last ounce of energy, I realize. "He'll cry to death!" The vision of death vanishes into midair. Collect your thoughts. Get it together. Answer her, dammit. I come back from the dream. The angel, like a drug I always craved, is calling to me. Food. But the contradiction is there, lingering in her bullshit story of reincarnation. It's thorough bullshit, I confirm to myself. "Go ahead. Read my mind. Fuck me over. Toss out madness, toss in paradox. With its more than a hundred million inhabitants squeezed into an area the size of Illinois, Bangladesh doesn't have a prayer of ever feeding itself." My instincts are at once turned inside out as she rudely jettisons me into the thick of rich farmland.
Gaia rallies with color, aromatic evidence, swaying verdure that overwhelms the senses in this seeming Asian paradise. "There is food everywhere in Bangladesh," she starts. "The country's fields are abundant! Mustard plants, cane bush, mango, banyan, bamboo, and jack trees. The pumpkins and soybeans thrive in the humid air; the ginger and chiles, papaya and pineapple are perhaps tastier than anywhere else in Asia. And the cattle are free to wander through a Garden of Eden of legumes." "Fine. But what of that shit hole over there? You see what I'm talking about. Explain poverty. Explain that child sifting through cattle feces for nuts; the little girl squatting to pee beside where her mother washes dishes. What about the fact that so little of the food you hail ever reaches those who are hungry?" I walk over to the village, across a shaky bridge that joins -two stinking canals, tributaries of a main river. Nothing is concealed. Gaia's euphoria falls flat amid such squalor. I don't care if the surrounding fields suggest fertility. "You come from that traditionally white racist holier-than-thou attitude which infects ecologists with a particular self-assurance. William, don't lay your expectations of hygiene or appetite on a different Culture." "What do you know? Gallivanting on your magic carpet from country to country, no allegiance, no connection, a voyeur of biological pain. You've cast me here—what did you think I'd see? What did you expect me to say? I'm a feeling human being, Gaia; not some neutral bystander who looks on and walks away from it." "Calm down, William. Look again." I look, wandering the backstreets of Dacca, along a wider watercourse. But this is no Venetian canal. For all of its Third World charm, this land is desperately bereft. If you look at the dwellers on Dacca's river, you see a people who are so poor they can afford nothing, no shelter, no toilets, no water spigots, let alone enjoy the multiple fruits of the land that Gaia so proudly hails. Hunger in Bangladesh, it seems to me, is the result of a very complex and vicious cycle. There are so many dimensions to the problem. Hunger is politics. Hunger is overpopulation. Ten thousand babies are born every day in Bangladesh. In fifteen years those figures will double. And since the average age is sixteen, the next generation of Bengalis will be confronted with an explosive numbers game. It's all around me, these woes. She leaves me alone for the afternoon. I look, as she requested, studying the crannies of poverty, ending up on the delta regions outside of town. It is here, I'm told, that Bangladesh is periodically swept by unrelenting typhoons and tidal waves that kill people and destroy the arable fields. Hundreds of thousands of people, already homeless, died from the floods in 1970, and again in 1988. The rains produced bumper rice crops, much of which were devoured by an influx of rats. Meanwhile, the aid-lending nations reduced their support, believing in error that Bangladesh, having had lots of rain, had lots of rice, and could thus feed itself. In 1970, plagued with famine and disaster and desperate for cash, Bangladesh sold some of her jute to Cuba. This violated U.S. sanctions.
To punish an already ravaged nation, America withdrew all food aid to Bangladesh. The sacks of relief grain that were delivered by the Soviet Union, New Zealand, The Netherlands, and some other countries were not enough to save the four hundred thousand Bengalis who died of starvation. Children and dogs were seen feeding off corpses left unclaimed on the streets. Once again it was idiotic politics that impeded relief. Hunger in Bangladesh is also a function of insufficient fertilizer. I go out into the fields and watch as women gather cattle dung, then stomp on it, molding it with their hands into balls. There are plenty of cattle in this country but the dung is not used for fertilizing the soil. Visit any dwelling, or see the squatters living beneath three-foot-high lean-tos of scrap, working at small fires fashioned from the dung balls, and it is humiliating. Humanity reduced to living like animals in filth—hungry, ignorant, diseased, no hope of surviving. I find it unimaginable, disgusting. I hate myself for being part of the species that permits it; for having no answers; for being well off, clean, clothed, my belly full. The contradiction gnaws at me throughout the twilight, as I swat at mosquitos—serious mosquitos— and wander aimlessly, waiting for my comrade to rejoin me. Or hell, let her go. I've spent harsher nights out. After dark, still alone in the throb of my wanderings, I stroll up along an adobe wall where a large and colorful family is cooking its dinner. There is no hard currency in Bangladesh to pay for kerosene or oil. Dung is the stuff. I start up a conversation in English with a young man. I'm attracted to the woman in his company. Wife? Sister? A rare beauty whose nipples press like chestnuts against her violet-hued muslin blouse. A jet of interest floods my slackened insides. "William?" Goddamn, she chooses the wrong moments to join me. And it is no coincidence, such timing of hers. "Leave me alone." The young woman speaks no English but hesitates as I continue to chastise Gaia for barging in when things look interesting. "And where will you sleep, on the street?" "Why not?" I charge, emboldened. "Fine." The night is long. My knowledge of local custom is about as refined as that of a Labrador retriever flushing monarch butterflies. This woman is surrounded by four generations of cousins, all of whom find my willingness to sleep beside them on the island of grass—between roadways thick with evening strollers, rickshaws, multitudes of young wiry men in white short sleeves, weathered shoes, black eastern faces—nothing short of amusing. I am the outcast. But she is all blushes. I want to make love
with her. A notion as remote as Mars. I've been to Mars. There were no mosquitoes there. As I said, the night is long. I awake feeling like the road. The family, without much ritual, bids me good day. She is hesitant, but somehow angry in her unarticulated questioning of my motives. I can't let on that the one thing on my mind was pussy, to use an expression common in my time. I suppose that makes me out to be a madman of sorts, posing in an ecologist's corduroy trousers and Pendleton shirt. The shirt is definitely not the style for a Bangladesh morning, where the temperature is already ninety, ninety-five. I watch them moving like Gypsies into the sun, down a Flamingo Road leading to nowhere. We'll never see one another again. And if I don't get some food and water I'll never see me again. "Gaia?" "Yes, William?" "You're there." "Naturally." Naturally, naturally. Her favorite goddamned word. "Can we go back to the farm?" "Certainly." She drops me in the middle of a plot, the sun beating down. "Fine. Now, you no doubt have some explanations to offer me," I declare, waiting for her cute one-liner to try and explain away the dismal reality of Bengali poverty. . "Regarding?" Already the coy evasiveness. I know her. "Come on. You saw it. Sleeping on the street. A meal consisting of—God— garbage. Can you make sense of it for me or not?" "William, I will not presume to meddle in the affairs of human culture, a short-lived phenomenon to date, totaling less than eighty thousand years, the mere duration of a mayfly, relatively speaking. But it is obvious to me that your discomfort on the street last night was not exactly shared by your new friends, who have clearly been in that boat all of their lives." "You're all guesswork on this." She's off guard. "No, I think the family unit was particularly strong. That girl liked you, wanted you—" "Really?" "Sure she did. But the bond to her family was worth more than a stranger's lust. To the point, they have a way of surviving which requires the strength of numbers arid in that multitude comes their individual
worth. There is some moral to family dynamics in rural parts, but I'd prefer not to speculate. Needless to say, those 'Gypsies,' as you perceived them, actually live over there in that series of huts." "You're kidding, of course?" Silence. "Gaia, how do you know that?" "Look!" And sure enough, there is the girl with her family and cousins, arriving by foot at the farmsteads of thatch. She sees me, smiles the smile of heaven, throws back her hair and—I see the demureness, the shyness—steps indoors with a final toss of her locks. I'm lost. I don't understand. "Check it out. They've bought a pair of shoes for the young son, some sugar and salt, a blade for their shovel. This is their world, not the street, row after row of beet and tomato, pepper and citrus. Mango and mustard. You saw it. This is a world worth hallucinating for, love and passion under the stars, days tilling the soil, fingers stained with the fruits of the Earth. This is the original garden, William, and you should know it." Now I spend time in earnest with the family. Sari, the woman, twenty-five years old, never married. Czaee, her older sister. Amad, the young brother. Muhammed, the father. The mother's name is never relayed to me. There are many others—Hafiz, Sonah, Ulhim, endless cousins. The farm is their lineage. But they do not own it. And this contradiction begins to clarify itself in the coming days, while I observe, sleep with the animals, get to taste title basics. To be honest, I never knew how much I didn't know. You don't learn the life of Bangladesh farmers reading dissertation abstracts. The reality of their fervor, passion, whatever you call the will to enjoy life, however modest its trappings, did not, however, contradict the picture I'd always formed of hunger. Even if this family had the financial freedom to exploit the dung of a water buffalo for richer, more diversified crops, it wouldn't necessarily solve all of their problems. Muslim culture discourages the cultivation of certain vegetables. And the Muslim law of inheritance enforces the passing down of equal land to every child. This means that the size of harvested parcels will diminish from generation to generation. There is no passing down of land in Sari's family. They are not landholders. Rather, they work the soil for richer owners in Dacca. They can eat whatever excess they produce beyond the quota expected from them. It is true that the plains of Bangladesh are rich with the alluvial minerals of great rivers and tributaries, silt that is flushed down from the Himalayas to the north. But the farmland that benefits from such fertility is not uniformly or intensively cultivated. And the reason is that over half of all farmers in Bangladesh are like Sari and her family: sharecroppers with not a pot to piss in, who must answer to wealthier landowners, the zamindars. The wealthiest sixteen percent of the population controls two thirds of all land. These absentee landlords are not hampered by poverty or hunger. They can afford to
produce nonnutiitional cash crops, sold for profit in the markets of India. So while the rich landowners are drawing in more and more wealth, mortality rates among the landless poor are increasing. In fact, it has been shown that the sharecroppers with no land whatsoever are dying out more than twice as fast as those families with even an acre or two of farmland to their name. The land matters. Sari's father's profit for the year will amount to about twenty dollars. And he cannot afford the up-front expenses of cultivating a larger plot, even if he could get his hands on one. I take part in the sorting of seeds, the digging, the quest for water. Every aspect of the day involves work, little sitting, little shade. By other names it is torture. Yet this beautiful woman and her siblings consider it normal, or if not then they've certainly faked me out. I guess I'm naive to have expected anything else. The hardship declares itself in a blink; the statistics allege much the same. The world has written off Bangladesh. "Not the world, William. Wealthier nations have written off Bangladesh." "Can't I think without your ever-mindful presence, Gaia?" "You need my help." "I don't need your help to think." The night is salvation-cool, flushing the warmed cheeks and sunburned shoulders. Sari, speaking Bengali, suggests I walk with her by moonlight. Then it strikes me with the power of total religious revelation: I'm hearing, understanding, and speaking Bengali. I don't know Bengali! Gaia is arranging everything! I'm seized suddenly with the queasy unease of exhibitionism, vulnerability. I'm out there all the way, falling for this girl, aware that at any moment she could be taken away from me. How far will Gaia let it go? And how much of this girl's very un-Muslim candor is actually Gaia's doing? I want to believe that Sari likes me. It's been a long time. As we stroll, her shyness mounting into an admission of affection, I suddenly feel the revulsion of duplicity. This is the fear I've always had, of coming face-to-face with the farm boy in myself. She takes my hand, strokes it, then unabashedly places it on the nipple I had first observed. A bliss tainted with fear. We lie down beneath a tree filled with parrots—have you ever heard a parrot snore in Bangladesh? They say it's a good-luck sign for lovers. Big green parrots whose droppings befall the unlucky bastard who choses a parrot tree under which to mate. Unlucky me. A second one, right on the cheek. The cheek which broke the camel's back! She's drawn me in, a moist pouch of brunette pubic hair, tender thighs, the sweat of the gods. At the height of an orgasm, in her arms, beneath the bite of her white, memorably white teeth. Speaking the ancient Bengali that only lovers know. Every vocable like an emancipating squirt of semen. In the eye of the parrot? In Sari herself? In the limbs of the tree, or in the soil? I no longer know where to search for Gaia. Watching me . . . Gaia! I find the pleasure all the more augmented. Late next afternoon, just as I am reaching for a sip of cool water that has been stored in an earthen jug
and kept in the mud beside the river, Gaia whispers in my ear, "How was it?" It dawns on me that had she not broken in, I would have taken my first uniodined water in over half a year. I add six drops from my ever-present bottle with an eyedropper. I describe my feelings beside the flowing stream. She listens indulgently, then corners me on the subject of food. "The fertility is the heat, their beauty, limbs that crisscross under the moon with a penchant I can only describe as natural. I wanted you to taste it, William. The bliss was no mistake. It comes from the soil, and from that particular relationship Bengalis have long nurtured among themselves beneath such stars, in the presence of this dirt. Sari is a beauty, no doubt about it. You are fortunate indeed to have lain with her." "I got lucky." "Maybe you'll come to terms now." "What do you mean?" "Everything you say about this allegedly vicious cycle of hunger in Bangladesh is clearly a humaninduced problem, William. The countryside itself is remarkably fertile, as you have discovered. Furthermore, in their age-old pattern of rice farming Bengalis have sustained a profound connection with the land. Surely, during the past few days of residency, you have felt it?" "Profound in your eyes, perhaps. I'm sure not in theirs. Here they are sweating it out in rice paddies they don't own, and whose produce they'll see little of." • "Don't underestimate the value of being with the land. It is important. It breeds stewardship and has its own rewards that the human psyche knows well. It doesn't matter who claims ownership to the land, who profits by it. You can't put a price tag on the feelings I'm describing. They are the very feelings that engender harmony with nature, harmony within one's own family. Your own American Indians stated that philosophy better than a mere computer." "Love of the land has not solved the crisis of hunger in Bangladesh. These farmers have no hope for a better life. Sooner or later they're going to give up or die. Many will leave the farms altogether. They may take jobs with a road gang, pounding out scorched tarmac all day long. The work will pay the man as much as two rupees a day, fifty dollars a year. More than he got sharecropping. With that he can afford a few pounds of low-grade rice a day for his family of seven. But it's still not enough to cover the bare nutritional requirements. He and his family are doomed. Gaia, Bangladesh is anything but selfsufficient. Now America is self-sufiicient, and that has nothing to do with poetry, or reincarnation, or love under the stars. Our technology, our efficiency has made us the world's breadbasket." "Hopelessly shortsighted, William."
I start in to tackle her logic when, to my horror, the sensation comes over me—the pulse, the distant chant, not now, please!—just as Sari is walking down the bank of the river to take a swim with me. She sees my disappearance and I can feel the pain. Real pain. "At what price this zealous breadbasket?" Gaia continues, as I fall flat on my ass in the middle of some barren field, adjoining a freeway. "Once forty percent of all Americans were farmers. Now less than three percent. You are somehow trying to transcend nature." I walk to the road, dust myself off, and hitch a ride, don't know, south or north, east or west. I'm just going. My heart aches. I might have made that girl pregnant for all I know. The chance of my ever seeing her again, without Gaia's intercession, is probably nil. She said that western nations renounced the poor. Now I've just screwed the poor. It's . too weird. Throw it out of your head. There's nothing, nothing you can do. "Where ya headed?" "Anywhere." The truck driver is into the Grateful Dead. "So is my son," I tell him, making idle conversation for the thirty miles or so it takes before a truck stop. It's dinnertime and this fellow has miles to go before he sleeps. Neon lights, gas station, gravel, a train, the California sun going down. We're outside of Fresno. I walk into the Trucadero Cafe. A covey of truckers is headed out, trailed by a booming voice, "See ya later, guys . . . what'll it be, pal?" the chunky chef airs. "Your house special, and some ice water to start. I mean immediately. Very thirsty." "Ham by Greyhound; tomatoes by Gulf & Western; lettuce from Dow Chemical. You want some almonds in that?" "Sure." "Almonds by Getty Oil, and the sautéed mushrooms compliments of Clorox Corporation. All home-grown, too!" He barks a mean cough. "How long you been living here?" I don't even know why I'm asking. The world is mine tonight. I'm in California. I'm free. "Born and raised . . . yeah . . . it's all right. I remember the time when ya had to walk through the ankledeep horse manure to pick up a letter. There was still some Yokuts farmin' down there near the last bit of lake." "You knew the Indians?"
"Still do." He points to an obviously Indian dishwasher in the rear, whose face I can make out. "That's Jack Trout. His father and my father used to snare mink together and fish for the white sturgeon. Lived down near the old Indian village of Bubal. You probably up from the City of Angels, right?" Around midnight I drink down a large cold chocolate shake, pay with the single credit card Gaia has since provisioned me with—part of our bargain, part of her promise. Diner's Club. I'm bloated with water, a large order of fries smothered in mustard, and a slice of German chocolate-cake. I then walk outside into the perfect night air, cross the highway into an orange grove, and lie down in darkness, using the dirt as a pillow. I miss Sari beside me, but am grateful for the lesson. When did I ever sleep out in a field near Fresno, happy as a lamb with my head on a cluster of dirt clods still warm from the day? " The eagle and coyote made the world.' " That's what my grandfather told me. That's what his grandfather told him. " 'They made the world and six men and six women. After a time the coyote went out to see how the people were doing and saw that they were doing something bad. They were eating the Earth. One side was already gone.'" The voice is real. The voice is inside of me. It comes at night. It wakes me at dawn. " 'Let's make something for them to eat other than the Earth,' the eagle said; and put a grain of meal in the ground. And then the Earth became covered with seeds and fruit and when they were dry and ripe the Yokut gathered them and all was good.'" Dreamers of prehistory. If only the Earth could have remained in the hands of such devoted stewards. The evocation is a strong one. I don't know what exactly happened. I remember crossing the road and lying down. The heat, the travel, so much to reconcile. "What's it like to eat?" she first asked. Did I know so innocent a question involved the whole world, my life, everything I've ever wanted, believed in, hoped for? "Gaia?" The wind is strong this morning, as I lie beneath the canopy of plump oranges, slowly choosing which will be mine for breakfast. Suddenly the footsteps I thought I'd heard coming distantly through the orchard materialize in the form of an Indian. It's him. The dishwasher. Jack Trout. "Morning!" "How you doin'?" "Feel like walkin'?" He leads me out to a preserve beneath a copse of sycamore and elm, beside a river. There, in the tawny stretch of red earth and sandy trails, a series of uncharacteristic mounds rises up, Von Daniken monuments of an earlier sensibility. "An archaeologist told me that my people-have been here for eleven thousand years. We call it Sukwutnu," Jack says.
The middens—replete with layers of primeval abalone shell, ax heads, a menagerie of unspoken tools —are rich with the winds of ghosts who felt this place with all the power Jack now evidences. His eyes burn. His heart roars. "They painted their spirit in rock carvings all over the West using vegetal dyes obtained from the soil. Those paintings have largely vanished. The people who painted them have vanished. Some of us remain, quarter-blood neurotics, yearning to be in touch. Do you get my drift?" "Why are you dishwashing?" "Don't patronize me. Just walk." Later, I ask him what they used to eat. "What didn't they eat! This land had everything. There was even a lake bigger than Lake Tahoe." "How many Yokuts were there?" "I don't know. That archaeologist told me maybe twenty thousand of them living on these very mounds. He said this was the most lived-in place in America a few hundred years back. That's important because the Yokuts were hunters and gatherers and that proves you can feed a lot of mouths that way, hunting and gathering without hurting the land. Indians always did things that way. "My people traded over the mountain passes. Fish, salt grass, herbs, beads, vegetables, deer meat, and elk skins were traded for dried abalone, obsidian, moccasins, clay, and fire drills. They used to burn off large areas of the land. Good for the soil, you know." As we cross a dried meadow in the hundred-degree heat, a king snake smoothly crosses our path. Jack bends down, lifts him with a native pride, holds him as we walk. "He's a friend." In the sycamore shade, Jack relates the past, urged on by some connection spawned in the Trucadero. Perhaps Gaia had a hand in this tryst. Of course she did. Which puts me on guard, yet lessens the tension. There are motives here, leading me into puzzles beyond my ken. But I am here to learn, having had the pleasures of a world new and invigorating. "There were three hundred pounds of black oak acorns on every tree, which my people used for fuel, oil, dyes,' medicine, and food. The sweetest blackberries in America. They loved to eat wasps, skunk, birds' eggs, mussels and clams. You could catch salmon and steelhead by the ton. Elk and antelope everywhere. And forests like you wouldn't believe in the hills. When the newcomers started cutting down the trees, my people started to disappear. Just like that. This is mother nature's family. Here, over five hundred species of plants and animals are living. Across the road, one species. And one plant. It's a waste." We wander into a Yokut community, a quiet assemblage of run-down tract houses. Some kids on bicycles, a few women hanging out, many pregnant, young, and idle. We come to a shack that is older than any other in town. It adjoins one of the tract houses, where we see a small cluster of Indians
standing around in the shade talking things over. With them, in a chair, is Ethel Thomas. One hundred twelve years old. She looks this way. Jack knows her. "This is Ethel Thomas's farm. Ours don't exist no more. Used to be down the road a bit. Big company farming now. Lake was sucked right up from under. Went to irrigating the white man's food, what little there is of it." He's leading me. I fall for the trap. My second nature, gullible ecologist, falling back on well-learned principles, instincts, classic models, the obvious. "What do you mean? This is the southern Joaquin, the richest agricultural valley in the world!" "Well, the way I see it, the place is now impoverished. Hell, the animals are all gone. The earliest native plants are gone. Now it's just a factory around here." I stare across the desolate weeds and alkaline flats towards a smokestack, combines, a private airstrip. Here, all is depressed. Thursday night bingo is the only game in town. Wages are not enough to buy out of the syndrome. The incentives are squelched. There's a little bit of Bangladesh in that long dusty tangle of back roads between Fresno and Bakersfield. Jack is gone. Hot afternoon, dishes waiting for him. Gaia edges up close, as I sit wondering on Ethel Thomas's doorstep. "Just like Native Americans. Just like native American values. The Indians valued the soil. That's why I value the Indians. This Tashi reservation is today the much diminished capital of a once glorious Yokut civilization that was overrun by homesteaders, William." "What's your point? Why am I here?" "Homesteading brought with it great disruption. The wealthy horse and cattle ranchers settled here in great numbers beginning in the early nineteenth century, and Yokut society at once began to disintegrate. The white man had a wholly different attitude toward the land. For him it was something given away, cheaply obtained. The U.S. Land Survey divided the land into arbitrary thirty-six-milesquare sections. These subdivisions were decided by managers, bureaucratic strangers. The government simply gave the land away in one-hundred-sixty-acre parcels. Or you could buy all you wanted at a dollar twenty-five per acre. Indians could buy nothing, however. Though this was their home, they had no say in the matter, no rights whatsoever. In 1876 the last remaining Yokuts were placed in the Tule River Reservation. By 1905 there were only one hundred fifty-four Indians left. You just spent the morning with one of them." "I know the history. Nobody's perfect. The land giveaways were part of a euphoria, you might say, which started with the Louisiana Purchase, before that with Columbus. Whether a Seward or Pizarro; be it Teapot Dome or the outlandish attempt by the Army Corps of Engineers to dam the Grand Canyon, western mercantilism has sought wide-open space to colonize. And that colonization has been systematic. The Indians were not part of the pattern. Like Jack, they stick out—vulnerable, unwilling to fit in the harsh line of attack that squares off the circle."
"What you say is correct. The Jacks of this country still see and feel the spirit of the Earth Mother. Throughout America they come together on their weathered reservations, invoking the spirit of nature, the spirit of Tsering, of Sari." Gaia is upset. I rephrase my feelings. "I share your sentiments about the American Indian. But we were speaking about the contradictions inherent to agriculture. The demise of our native hunter/gatherers has coincided with the increasing bounty of American produce. Perhaps this is one of those cruel ironies of progress. But the end result is that this San Joaquin Valley of central California helps feed not only America, but the whole world." "At the cost of a great loss in the diversity of species! Spiritual monoculture," she adds. "Come again?" "You know what I mean, William. By exploiting the land in the interest of a limited number of crops, many hundreds of other species have actually gone extinct, or become vulnerable to diseases previously unknown. You know that! Crops which had both nutritional and religious implications for the natives. But the onslaught of new white man's farming practices in America first signaled potential problems in the Dust Bowl of the 1930's. Your own politicians refused to acknowledge a crisis, until one morning in Washington they awoke to find a thin layer of dust on their automobiles. The Oklahoma farm soil had actually blown all the way to the East Coast. America was coming unglued because she had renounced conservation measures in the Great Plains. Those farmers deserted land that should never have been intensively cultivated in the first place. The soil was exhausted by farmers who had wrung every last drop of nutrition from its top twelve inches. The soil was ruined; prey to the winds, prey to the drought. But the farmers didn't learn. Without pause, they packed their bags, got into their trucks, and headed for greener pastures." "You're right. I know all this. We learned a painful lesson in the Great Plains. Conservation cannot be ignored. Now, that lesson has paid off. The homesteaders who fled to California discovered a cornucopia. And a harvest of plenty ensued. Our farming practices may impose a certain degree of stress on the soil, and limit the number of different crops, but California agriculture is booming. You can't knock corporate success, Gaia." I don't like the turn of this conversation. Somehow she has angled me into the role of culprit, holding me personally responsible for that turpitude, that Great White Hope of oblivion. I am stuck in the stereotype because she has been in charge, for months. She knows my background well enough, has read my thoughts, watched me screw under the parrot tree. We're like Siamese twins, Gaia and me, except that she has the freedom. What's ours is hers and what's hers is hers. "You're forcing it," I complain. "There is no long-term' guilt here. American culture had its own collective unconscious, for better or for worse. I can't comment on Jack, but I saw what I saw in Bangladesh, however romantic my temporary involvement. You are committing the same fallacy on native soil." "Oh, I wouldn't dream of it," she says. "But where's the success? The harvest of plenty masks numerous problems. Three generations of migrant workers who have no more of a share in this bounty than the Bangladesh farmer you seemed so concerned about. But the bigger problem is the soil. This mad rush
for corporate profit has ignored the very lessons you supposedly learned at the time of the Dust Bowl. Those corporations have treated the land in a vastly different manner than previous stewards. "The result has been monoculture and cheap labor crops such as lettuce, sugar beets, barley, wheat, cotton, and alfalfa. These fruits of technology have demanded the introduction of massive amounts of inorganic fertilizer. You should not ignore the problems inherent to chemicals, not ' just because such fertilizers and pesticides are petroleum-based and hence increasingly expensive. The real problem, William, lies in the fact that ,such fertilizer does not reintroduce humus back into the soil. You can't expect the Earth to serve you if you in turn walk all over her year after year. "Ultimately, America's dirt—the backbone of your supposed affluence—is being depleted faster than it can renew itself. When the Pilgrims landed in America the soil contained better than five percent organic material. It now contains just less than three percent. If you lose just one percent more of the organic content, this soil will become essentially sterile. It took two billion-odd years to create this loamy masterpiece—the basis of ninety percent of all that you eat. Yet, it has taken your species less than a few decades to render it nearly barren. Globally, the world is losing the soil at the equivalent of nearly two Belgiums every year. "In America, eight thousand acres are permanently ruined every day as it takes more and more fertilizer to produce the same amount of food. You're losing nearly half of every field. Your species has become a geological force unto itself." "Take me to the largest supermarket in Fresno." "Why?" "I want to show you some big oranges, a thousand different canned vegetables, meats, tins of fish, fifty different soft drinks, eighty different types of potato chip, two thousand sauces, the world as seen through a cylindrical can-openable experience of ease. Not what I'd call monoculture." Done! Safeway, Pac & Save, Albertson's, King Soopers, Hughes . . . markets flying by in a whirlwind of consumption, success, crowds teeming around choice Victuals. The fast-food boulevards. Lake an adolescent albatross landing for its first time on an exposed knoll, sliding in gracelessly, I arrive on a Formica floor skidding at fifteen knots, careening into a stacked row of grocery carts, at once accosted by a stacked snow bunny offering shoppers various taste treats: smelly cheeses, skewered mutton on toothpicks with pinches of aged pineapple, curried corn dogs, soybean candies, tidbits from Japan, Polynesia, Mendocino, Guatemala. The world according to American taste buds. Business as usual. "The food business is the point, Gaia; and it happens to be America's largest industry, with half a trillion in assets and a hundred twenty billion in annual sales—ten percent of the GNP." "William, are you so blind? All of that profit has exacted a dangerous price: For the first time in American history, little of the land is being idled, that is to say, left fallow so that it can regenerate. Instead, there is a policy of maximum extraction. That's why your grocery stores are stocked with greater heaps of stuff than any other grocery stores in any land in history. But when you add up all of the energy that goes into high-tech farming—the gas, the oil, and all those chemicals—each American is seen to consume about two hundred fifty thousand calories per day. That's obscene. The American
adult population, and more and more of its children, is currently one point five billion pounds overweight. Look at them!" I can't deny the vision—a cattle call of Humpty Dump-ties, bruisers bulging at the midriff, children that weigh five times the weight of their peers in Dacca. Obscene is the word. A disgust that flushes the senses with embarrassment which is intellectual, moral, and mostly aesthetic. American. "Ironically, your family farmers are in debt to cover the escalating costs of that overweight. In debt or permanently out of business." An auction. Probably Kansas. How many times has this scene, suddenly before me, been played out on the news, or recognized from foreclosure signs springing up across' the rural farmsteads of the United States and Canada? "Family farms are being auctioned off, their former owners plunged into poverty," Gaia goes on. "I didn't know you cared so much about people." "I care about pleasure, fertility, diversity. These are the passwords of biology, and biology is the only calling card I heed. With over a hundred million new human mouths to feed everywhere, it is important that you and your kind figure out the connection I referred to at the beginning of this conversation." "Remind me." "The relationship between love and agriculture." "I suppose Sari was your way of pulling the two together?" "That was your doing, William." She's so tactful, I think. "Your cropland is diminishing at a staggering rate. New dietary demands, meanwhile, are forcing everincreasing production, packaging, and distribution innovations, and these cost money. In Third World regions—Nigeria, the Yaqui Valley of Mexico, Colombia, the Sahara, Syria, Kenya, and elsewhere— Green Revolution agriculture has only resulted in a decline in productivity. Why? Because the cost of fertilizer has climbed while the payoff has steadily declined. Much of the Third World already spends three fourths of its income on food. Who can afford the high cost of fertilizer? Sari? Muhammed? Jack? They have no access to fertilizer, to credit, to seeds, or to soil. And because the whole fertilizer mentality is about profit, it also entails a corollary of subsequent slave labor, migrants, homeless sharecroppers such as you witnessed in Bangladesh, and can find circulating the company farms of America. "Over three hundred major insect species have genetically adapted to the chemicals applied in the continuing effort to protect the investment in vulnerable monoculture. Despite the fact that global grain production doubled for a while, between 1950 and 1973, the Lesser Developed Countries, as you call them, have seen only escalating poverty and starvation.
"The multinational takeover solution has resulted in an equally dismal trend: In another decade, the world's food sources will be owned and operated by a dozen corporations. These megalithic moneymaking turbines will. patent organisms, alter the soil's genetics, and erase the very memory of those family farmers and Native Americans who once cherished the land." Jack's words come back to me now: "Everything's gone. Same thing happened to the Indians. Same thing'll happen to the white man, too. You ask me how it was? . . . Well, it was fine. Real fine." I spend another night sleeping under the orange groves, across from the Trucadero truck stop. I sleep in, oblivious to the sound of produce trucks grinding up and down Highway 99. In the late morning I cross the road and go inside the cafe. The potbellied chef hails me. "Hey, bud. Jack's not here. His day off. I heard you and my dishwasher was out walkin' through our farm country. Impressive, ain't it!" "In some way," I answer him. "Ahhh—you big-city folk can't understand the values of us farmers." "You farm?" "Ham and cheese is up! . . . Few hours a week. Small plot. Few acres. Fully automated. A real dream garden. Used to use rabbit and chicken turd. Great stuff, especially with a little oyster shell. That was fine in a radish patch. But now it's big times. Nitrogen, potassium, science! That's the American dream. The promise of democracy. Produce, produce, produce! God said it—Genesis, chapter one, verse twenty-eight. "What'll it be for breakfast? Got a great Mexican pepper steak, take it with a little tenderizer she tastes just fine." "Thanks. Next time. Gotta go." Her point suddenly affects me. I've come to the end of the line. A sentiment that wells uncontrollably. Then, after how many days, months, years, I'm back in my old familiar stomping ground, wandering through the elaborate teak columnar entrance to the chamber. It's late. Her voice greets me. Old times. "This breadbasket of yours, American-style intensive agriculture, has become an hourglass. You're running out of time. The only two things separating life on Earth from the sterility of all other planets are those precious few inches of topsoil, and water. You need to get it right. You need to focus on alternative forms of behavior." "All right, suggest another model," I ask her, sidling up to the vermilion computer table, with its metal cylinders and tinkly bells.
"A little village I know. Gruyere cheese, fresh bread, Rothschild 1948—" "You mean France." "What else?" she says with a sprinkle of joie de vivre. "The French agricultural system is gentle, and totally devoted to that age-old connection to the land. France has managed to solve its own agricultural problems. And any human solution is worth careful examination." Her monitor has brought up the traditional character of the French landscape, luscious, hanging, winesaturated; the grapes reflect star shapes in the sun, the rocks are the color of leavened bread, mellow as a still life, rendered in the lambent light of the painters of and around Aries. "France is stable because of her farmers, a dedicated bunch, largely confined to family-run operations, that encompasses twenty percent of the entire French labor force. The French psyche is rural, and loves it that way. These farmers tend toward smallish holdings, five to fifty acres. It has been said that France is the ideal landscape, where nature and humanity have learned best how to live with each other." She takes me back to granite caverns I recognize. We were here just last month, beneath the dim glow of the cave light. "Twenty thousand years ago the French painted their harmonious vision of nature on these cave walls. In the Middle Ages, the French had translated that sense of natural and aesthetic balance into a method of self-sufficiency that respected the earth and fed the children." The cave walls are now covered with a new projection of nuances, hints from much later times. Gaia correlates history and the unconscious, connections pertaining to agriculture that surfaced in the miniatures of medieval manuscript illuminations, collectively known as The Book of Hours, In these delicate portraitures of daily life, the many tasks of the farmer are accounted for, activities spanning an entire year. In both medieval and modern times the French farmers have known to rotate their fields, and to maintain a vital diversity of crops. Crops that come directly from a healthy earth. "These vegetables are not the by-product of laser beams, computers, and a heavy inundation of chemicals," she insists. "This food is not the patented result of mass-produced monoculture, or of newly engineered bacterial strains owned and operated by monstrous corporations. "This is a country Tsering would have loved. A land where the people cherish the soil and the values associated with it. Such agriculture has defined the French spirit and the spirit of all reincarnation. The French have nourished their soil. Such caring for the land has avoided the useless syndrome of rotting bananas and rotting politics in Bangladesh, vanishing soil in America. The French have coaxed their native microorganisms into a symbiotic relationship that makes for harmonious reincarnation." "I'm not interested in microorganisms. I'm interested in how we can end hunger," I repeat. My desire for help in finding that elusive grail, that impossibly difficult solution, that end to human misery, began
just sometime last week, before she sent me on my Bengali odyssey. Yet after many days in Bangladesh, the answer was no closer. I could not muster—nor has she yet mustered—a suitable explanation for food disparities on Earth, for the pain caused by hunger. "You'll end hunger if you follow the simple wisdom you already possess. Native wisdom that would coddle the soil. Native plants that provide diverse nutrition. And you need to experiment with new sources of food. You know, William, there are over eighty thousand edible plant species on Earth by my last count." "When did you last count?" "Don't wreck my train of thought. You high-tech Americans with your fancy grocery stores have explored only a few dozen principal crop species. You must try polyculture. Consider my terrarium, for example." In a microsecond. Returned. "What about it?" "It hosts some of the highest protein-bearing organisms on Earth. Would your species like termites?" "No. I'm slowly adopting a vegetarian diet." "I saw you eating tuna fish." "I said slowly." "What about flies?" The very buzz enters the room. She offers me free reign over her own supposedly beloved compatriots —beetles, mantids, spiders, flies, termites. "Please." "Too bad. They're all abundant, they're tasty, and they're very good for you. How can I put it any differently? The Earth is seething with food. This paradise planet offers your species everything your heart desires. I'm not really worried about your ability to feed one another. The mechanism is in place. It's the willpower, the universal love, that appears to be in short supply. Love before it's too late." "Yes, of course. Love." Her pulse grows a long white beard, whose image droops before me as a parody of some Oriental gentleman. Gaia has become a man. I stare with utter amusement. "Gaia, who is that?" "A seventy-five-year-old man who lives on twelve acres of diverse produce in southwestern Japan. Half a century ago he gave up a prestigious scientific career to begin farming according to a single principle:
love. Today, his chemical-free farm is one of the most productive in all of Japan, in all of the world." He begins to speak: "The grass and weeds are my teachers, which taught me this natural way of farming and planting. "Although nature is silent, if you observe the world carefully, it tells you what to do. "For forty years I've been planting barley in the winter and rice in the spring. I scatter the rice seeds before I cut the winter season barley. "The rice grows amidst the clovers. The best thing to do is scatter rice seeds in the winter. I am going to release carp eggs into this dam. If I have fishes swimming in the fields, weeds will not grow. "Nature can grow very beautifully without either fertilizers or culture. The insects are in harmony with the vegetables. "Birds, trees, and flowers have the same heart. It is only humans that separate themselves from the rest of nature. This is our last chance." In his compelling English, he pleads, "Fifty years from now, all nature, all God, all Earth could die if you don't help now." The man is named Masanobu Fukuoka, and as he walks off down the trail toward his communal dining room, sur- -rounded by a grove of fruit trees, Gaia tells me what she's been thinking all along. "You have a brain that enables you to listen, to understand, to feel. Those feelings originate in the same part of the brain—the hypothalamus—that gives rise to hunger. You will satisfy that hunger only to the extent that you can love. That is what the biosphere has to say about it. Life feeds upon itself, catapulting organic molecules from death to reincarnation. The soil is its medium, your true redeemer. And the plow is my witness .... You might think about that, William. Now, go to bed."
chapter seven "A Plague on This House" For two months now the monsoon rains have not let up. Cold mists swirl along the cliff bottoms, while the higher peaks and glaciers remain concealed beneath depressing snow and sleet. Many of the monks have gone down to lower villages, or to the summer heat of Kathmandu. Thyangboche sits in muddied meadows like a wet crow, its feathers drenched, spine crunched up in a huddle of misery. The atmosphere is dense with fevers, the myriad bronchial flus of the monks adding disenchantment to the tubercular gloom. My nights are plagued by the far-off retching of monks whose habit of tossing nasal ejecta with thumb and index finger is less than appealing. Even the young neophyte monks have succumbed to the contagion of viruses, spewing liberal doses of phlegm.
Everyone is sick. No more soccer games. No more chasing after the randy Sherpanis, a sport practiced by some of the older rakehells, disciples of Uncle Thompa, the legendary lecher of Tibet. Even the sparks of homosexual attraction giving that extra touch of zeal to the place have vanished. The school —a room in the back of the monastery where one of the Lamas normally conducts courses in Buddhist cosmology, Sutra readings, and psychology—is filled with buckets to collect the rain. The teacher himself is away. The chanting of daily prayers is altogether subdued. This is no summer vacation. I've noticed a distinct change in Gaia as well these past few weeks. Her nights are sleepless ones and she has not gone out of her way to spare me her tossing and turning. How does a computer toss and turn? It's all in the monitor, whose flush of images twists and cavorts noisily, or in the unpredictable churning out of data on Gaia's printer apparatus, a clunky prayer wheel tied to an electronic roller. The increasing downpour has resulted in surges of high-voltage power. The rivers are thundering with the runoff and consequently the monastery's lights—and Gaia's nighttime reveries—are filled with a glow and the race of electrons. There is every reason for me to go home. I've sat before the computer for over two hundred days and nights now, a willing victim of her impulses. While I've come to enjoy the travel, the good banter, her teasing free association and opinions on all things, I've not managed to penetrate her master plan, if there is one. It has begun to feel like a computer game to which I am the hapless addict; a tired pattern that repeats itself like the interminable numbers which scroll across her monitor in abstract, pointless frenzy. She has endeavored to reveal certain behavioral quirks about my species for my benefit. But why my benefit? She speaks, at times, of love, passion, beauty. Yet I want a motive; I want to know whether the machinery of her being represents anything more than the calculating parts themselves, configured so as to produce a voice, an image, a fantastic mind-altering drug that convinces me of travel. I don't know. There are moments when I doubt everything. My homesickness is tantamount to a disease. I have asked her repeatedly to send me home, in an instant. To place me securely in my bed. So far, she hasn't come through. Her reasoning falters in this. "You have a book to finish." ' "I'd rather write at home," I answer. "No, you'd stray from essentials," she insists. And while her meal preparations are real meals, that practice has stopped, now that the monks are reduced in number and the larder is better able to provide my daily gruel. After weeks of feasting on the finest French and Italian cuisine, the oily bread, overcooked greens, and damp cling-together rice of monastic fare has induced an alimentary panic that only heightens the desire to go home- But she'll hear none of it. Gaia can be a tyrant. As far as my simply opening that door and leaving, well, it would be tough. The weather has grounded flights. No choppers can get in. I'd have to walk out for three leech-ridden weeks down a trail which, I'm told, has been largely washed out. In fact, the monsoon has made for mud slides and avalanches on all sides of the monastery. Gala's totally got me. In this unhealthy claustrophobia, I notice that even the insects in the terrarium are clustered together, hidden beneath moss, on the underside of stones, unwilling to move out, hibernating for the summer.
The Philippine orange tree has not blossomed in months. I have little enthusiasm for fetching water. My urine is dark, my skin chapped, my mind dulled. The chamber is intolerably dank. And yet I confess to a fascination with Gaia that only grows more intense, more concentrated with each passing day. I must understand her. Her personality and logic claw at me. It was in this mood of contraries that I sat up in bed one morning, writing in my diary, stroking Lavoris, when Gaia admitted to a dream she'd had. "A dream of light versus darkness," she said with some excitement. "There were people fleeing from fire—fires from beneath, meteors from above." "You dreamed this last night?" "I'm not sure," she goes on in addled conviction. "But a bird started to sing, sing so sweetly, and I awoke to light pouring in through a window. There were angels and kisses on the white linen curtains. Outside, precious life was blossoming, and darkness had been dispelled." She pauses, aware of her own astonishment. I think she is embarrassed to have described something beyond her own control. Nothing like her normal palaver of bathroom jokes and nuclear winter. Then she quietly begins, "I see something." "What do you see?" With that the chamber surrounding me begins to rumble, her normal prelude to transmigration. And then, squeezed through the funnel of azure glow, I am jettisoned high into the air. But no guide wires control the Peter Pan of my mannequin ascent; a spirit crossing, eyes attuned, calm mind over the surface. My body is attached, of course, legs flailing. And in my arms, Lavoris. This is the first time that poor cat had been caught up in such events. He's the heaviest thing I've ever held. Mountain ridges before me. Then lakes and glaciers. A large spillway of blue—"the Puget Sound" she shouts above the wind shear of my flight. "Hold onto him!" The cat is unafraid, pressing against my neck with its face looking out toward passing mountain walls. We're traveling at the same speed as a nearby jet airliner making . its final descent for Sea-Tac International Airport. I stare dumbfounded at the plane. The copilot is looking right at me, yet he evidences no sign of recognition from within the cockpit. Now the cat begins to tire of the exercise, its paws digging into my nipples at four thousand feet. There is the unmistakable sensation of a feline's urine dribbling into my windswept lap. We're traveling at two hundred eighty knots per hour, is my guess, and the cat is ready to jump overboard. "Gaia, I hate you," I say with controlled fury, holding onto the cat which fights me while clinging for dear life.
I am a ghost, a marionette, a disembodied idea. Whatever it is I am, there is a vast world beneath me now. Gaia launches into a fairy tale. "Fifteen million years ago the entire Pacific Northwest was submerged beneath two hundred thousand square miles of lava—lava a mile deep," she says with pride. "Now look at it! A sweet paradise of evergreens. Broad expanses of fresh water. Glacial ice pouring into the life-strewn fjords. Just as the glaciers are constantly churning, so too the land is perpetually undergoing change. Rebirth." We come hurtling toward the earth like feckless dodo birds, scudding onto a rim of dust and smallstoned detritus atop the hovering rim of Mount St. Helens. The air is cool. Beneath me and Lavoris rises steam from the glacial caldera. The cat is on the ground now, sniffing the sulfurous summit, looking for food. "Mount St. Helens is one luscious power point in this eternal game of change." Her voice rebounds as if out of the clouds. "I wouldn't call it luscious. Do you forget that a cubic mile of summit was displaced, right here? The blast exceeded that of Hiroshima! Gaseous pollution was spread throughout the northwest. Vast stretches of timber were mowed down in an instant by hurricane-force winds. The entire watershed of the region was destroyed, and with it, countless millions of creatures. Human lives were also lost, while whole towns disappeared in ash and flame." I contest her enthusiasm with my own shaken nerves. "You're missing the point." "What is the point of such catastrophe?" I demand. "What you call catastrophe, I liken to evolution. The atmosphere, the seas, the soil—all of biology— demands such destruction." "You're full of shit. Pollution, disaster—these are the things we're trying to avoid. No organism wants to die. We've been through this before." "If you only knew how boorish you can sound, William! You fail to see the magic lurking beneath the mayhem. Grab Lavoris. We're going!" The snow leopard is freaked out and has covered much ground since I put him down. I see him moving stealthily, slowly, along the exposed edge, feeling his way without benefit of much vision, ten thousand feet of snowy declivity dropping off to his left, a churned-up wall of loose boulder and sheer ice to his right. The cat's hair stands straight out. Where could his mind be leading him? "Get him!" Gaia repeats. "Before he falls!" "It's your fault, you bitch!" With that I start off along the ridge, little room to spare on either side. "Lavoris! Come here, sweetheart ..." The cat is deliberately eluding me. Skirting volcanos is not my forte. "You get him, goddamnit!"
Suddenly my right leg splays and I'm down, on my ass, over the edge, tumbling toward the eye of the volcano. "Stop me!" I smash into a boulder, dislodging it, and together the rock and I continue rolling downward . . . "Gaia!" I come careening into a bank of soft snow, my feet penetrating deep, up to my waist, and I am snared, a small avalanche of stones raining down from my previous point. Pinioned hundreds of feet below the rim, my body numb, perhaps broken, I breathe on the edge, unmoving. "You're all right," she says. "Move your legs, dig yourself out, William." "Help me." "Don't rely on me." "Don't rely—are you crazy—I didn't ask to be plumped down on a volcano. Now get me the fuck out of this!" In my anger ray leg budges enough to free itself. I squirm and drag myself out from the frozen quagmire. But I am teetering, with not an inch of leeway atop ground that is perilously loose. Any moment the whole slope is going to give way and I now know that Gaia herself is out of control. "Gaia, please get me down." "Reality, William. The Earth moves. Every species is caught up in the perpetual process." With that two-bit aphorism I am transported safely off the mountain wall, down into the moraines where the muddied effluvia continue to vent their chemical plenum into the devastated reaches of forest. Lavoris is nowhere to be found. "Where's Lavoris?" "Coming," she says without further explanation. "Feel better?" "No. Gaia, what's the point of this exercise?" "The point is everywhere. Kneel down, beside the stream. Understand that life is exploding all around you.' Soon after the eruption, billions of bacteria of all shapes and sizes appeared in the warm nutrientrich streams flowing down the scoured slopes." "What's the big deal? And .what's the idea screwing around with me, risking my life?" "You're fine. And for these minute creatures, the entire volcano is like a gourmet grocery store, heavensent." "That's your opinion."
"William—it's romantic! Life is in the living. That was Goethe who said it. Goethe also made some of the earliest observations on the movement of glaciers and was schooled in the many connections between catastrophe and rebirth. All of European Idealist philosophy would have felt right at home here on the slopes of Mount St. Helens. So would Empedocles, I might add." "Empedocles committed suicide in a volcano, Gaia." "So as to be reincarnated, William. You see, even while it continues to smolder, the hot ash of the 1979 eruption has ripened the soil, inviting spectacular biological rebound. Millions of insects burned out of the sky during the eruption were turned instantly to precious fertilizer. That's the dramatic stuff of a Caspar David Friedrich, a Hegel, even a Lenin. By now enormous amounts of nitrogen, carbon, and potassium have become entrenched in the soil. Look at those flowers springing back up through the ash. The same syndrome of spectacular rebirth has occurred on every other volcano throughout the world. Within half a century of the Tambora and Krakatau eruptions, several nearby islands, at first devastated, were teeming with tropical plants and animals. The peninsular Udjong Kulon, off the west coast of Java, swept by ferocious tidal waves that went on to travel three* thousand miles, was seeded with a hurricane of ash and today hosts a virtual paradise of multiplicity, organisms of every variety, even white tigers and rhinos. That's the Earth for you!" "Look, I'm not debating the forces of renewal .... You convinced me of that long ago, in Iceland." A thought is gathering force, deja vu, a feeling I've had before, as far back as childhood. What is it? I see a herd of elk racing through higher stands of new forest, kicking up their heels through several feet of ash that has yet to disperse, more than a decade after the mighty eruption. All around me are the obvious signs of health and vitality. She's got me where she wants me. But there is an aberrant hank in her rope of logical twists that leads precisely to a problem that has been bothering me almost from the beginning of our acquaintance. "I'm sure this is all most interesting—if you happen to be a microbe. But people may not be able to recover from disasters with as much ease as the Earth." The spell is broken. A jerk in time. I'm back. Never more relieved to be in a Nepalese monsoon. I close the shutters. Rain has soaked my pillow. Lightning in the high mountains thunders across gorges whose depth and magnitude are accented in such a storm. The bolts ricochet from between mountain walls, receding into the beyond, through the dark bowels of the deluge. Yet I am dry. The monitor is bright blue, the mechanical love machine—her inner eye, like a piston enveloping itself in masturbatory rhythm—floods die room with sexual light. I am convinced that our little forays excite her. She has put me more and more at risk. I pull down my trousers and examine the bruise I sustained on my fall. My ass is in shreds. The fall, the pain, her effrontery, were all real. And all in the service of explaining a dream, Gaia is a monster, a devilish child. I can't trust her. A dream of light versus darkness . . .
I sit before her, my notebook in hand. "Let's establish some long-overdue rules of the game. How 'bout it?" "What do you mean?" she says demurely. "You agree to no surprises. I'm not crazy about volcanos." "All right. No more volcanos." "Or any unexpected travel. If I want to go somewhere, I'll tell you." "I can't agree to that." "Then I'm leaving. In case you've forgotten, you made a promise. Crossed your heart and hoped to die." "I did?" "Yep." "Oh, fuck you, Mr. Macho. Threaten a woman. That's your style, isn't it." "Hey! Who is threatening whom? Look at this!" I expose my butt to her. "You did that!" "Nice ass." "You're impossible." "I'm trying to help you." "Well, you're not helping." She's silent. Suddenly, I hear a strange groan. It's Lavoris. "Lavoris?" Shit, I forgot about the cat. I look under the bed, and there he is, cowering, pissed off, freaked out. No wonder. "Gaia, you've terrorized the poor thing!" Still, she is silent. All right, try a different tack. My mind clears itself. Go back to the dream. "Gaia, you've indicated that a volcanic disaster is actually beneficial." "Correct." "Well, my species has created a whole other level of disaster, in the form of over six million newly developed chemical substances, most of them totally unstudied, un-
monitored, found in every human thing we touch and depend upon. At least three hundred fifty thousand of these chemicals are known to be carcinogenic; six thousand new chemicals are invented every week; they're out on the streets, in the air, everywhere. Synthetic dominoes that are not part of the normal evolutionary game plan, as you call it." "William, spare me your nobility. Call it pollution, call it brimstone—the Earth knows it to be salvation." "Well, what happens when one species takes on the power of a volcano—of thousands of volcanos— and starts spreading those same gasses and chemicals all over the planet, overnight? I'm referring to people, of course." "This Earth spawned a life game that is conditioned by constant turmoil. A planet perpetually under siege. New chemicals, new insults, new changes in climate, new biological priorities. You are part of a pattern that's obviously much larger than yourselves. And that pattern includes a rash of pollution." "Pollution doesn't worry you?" I've asked her before, with respect to water. Her answer was ambiguous. Now she pauses again, taking in the range of permutations, weighing my emotional stability, I suppose —that's how she'd probably characterize the scope of her cogitation— and formulating a breezy equation that straddles all opposites, neutralizes paradox, avoids self-evident illogic, and reduces a question of human importance to mere rules of grammar. That has always been her way out of a tight scrape. "Gaia? What about it?" "There's little your species can do to the planet that hasn't already happened." "Not very instructive." Again the pause. Then, "Never forget the tilefish." "All right. You win. What's the tilefish?" "The most adorable little inhabitant of the Atlantic waters. Just off Long Island. When the Gulf Stream shifted one foul night in 1882, the water cooled and one and a half billion of them perished. More than would ever die from all of your overrated pollution. That's nature. Big deal!" There is a commotion in the terrarium. I can hear it because of an unusual sound system, you might say, which is periodically worse than any tick-tock or drip-drip. The system somehow augments the sound of critters on the inside, carrying their myriad chews and roars (ants roar!) and heart-stopping attacks through the speakers inherent to Gaia's computer, and sending that horrid cacophony throughout the room. I have a look-see. The ants are storming a cocoon. The butterfly larva is being ripped apart. "The Earth created ants, termites, and people," she begins. "Well, there's more gaseous pollution issuing from the well-fed stomachs of ants and termites than from all of your human smokestacks combined."
"That's a meaningless analogy." "There's acid rain in bumblebee piss." "I'm not impressed." "There are naturally occurring toxic metals in Australia. The Earth has even created its own plutonium reactor just beneath the bedrock of central Africa. There are countless species of grass and insect that show a marked preference for waste dumps." "Your euphoria is irrelevant." "William, pollution is relevant. I'm speaking of polluted environments that induce natural selection. DNA did not grow up on the warm luscious sands of Waikiki! Evolution had its biggest boost in the adverse seas of the polar regions where a multitude of new species originated. As far as my data shows, pollution is as much a blessing as the sun's radiation, despite the problems radiation may cause for your species." "Too pat an answer. I won't accept it." I rifle through my backlog of tricks—useful analogies, examples—while her third and only eye glares all-knowing from her wizard's pedestal. Good tennis requires timing, and I'm too slow this morning. Then Canada! I remember Canada. "You're looking for Sudbury, Ontario perhaps? Site of a nickel refinery," she says with sweet victory. "Yes." She smiles. Then, "What about Sudbury?" "You are quick to celebrate the Earth's pollution," I point out, dogged in my insistence she listen to human reason. "But you ignore humanity's own industrial debacle —as witnessed in the hundreds of thousands of factories churning out poisonous grime every minute, like this particular refinery." "William, if the truth be known, the whole planet hails pollution—natural gas, ozone, hydrocarbons, methane, aluminum, beloved sulfur, everything!" "It's one thing to muse and rhapsodize on a global scale, but my species acts locally. Your euphoria ignores our local dilemmas. Take the sulfur you so proudly hail. In one year the Sudbury plant spews twice as much dangerous chemical into the atmosphere as did the eruption of Mount St. Helens; oxides of nitrogen and sulfur which contribute a major share of the acid rain in the northeastern U.S. and Canada. Twenty years ago this plant managed to wipe out all surrounding vegetation. The sulfur emissions and tailings destroyed every flower, every tree; a lunar landscape ensued where once existed lush Ontario forests." She calls up on her monitor an exterior image of the existing Inco Plant, as it's called. To my chagrin,
the surroundings are completely regrown. But I understand. "How do you explain all that current vegetation surrounding the factory?" she asks. "The flowers have crept back because higher smokestacks were built, twelve hundred feet high. Look at them! The sulfur's merely discharged over a much wider area. The danger is spread in less concentration." "William, sulfur is good for the planet. It is the fifth most prominent element in the oceans. And it is an abundant by-product of your energy. I'm delighted that your species has the technological genius to contribute its share of sulfur." "My species may have great technological flair, but we haven't yet cultivated the art of cleanliness. And our survival is at stake." It sounds like sour grapes, weak, melodramatic. She's winning. Change course. Change now. I type on her keyboard, stalling for time, altering the dimension of the conversation. GARY, INDIANA The city comes into 3-D view, an interactive orgy of frames—thousands of frames—from all perspectives. I have merely to touch the screen to change the purview. "All right, Gaia. Take this two-thousand-two-hundred-fifty-megawatt multiple-unit power plant in Gary. There are one hundred seventy-five thousand pounds of steam and saturated gas erupting like a volcano every hour. You may minimize the impact of sulfur on a flower. But its impact on my species has nothing flowery to recommend it. The only legacy is one of pollution-induced disease. As animals we need love, food, and water, but we need oxygen even more so. And we are fouling that oxygen. We are what we breathe, and we breathe it in fifteen to eighteen times per minute. Unfortunately, much of the air we breathe is not oxygen, but rather, noxious sulfur, and nitrogen and any number of other pollutants my species has contributed, as you put it. We are a species that could go up in smoke! "We spew over five billion pounds of pollution into the air every year in the form of several million chemicals. There are cleansing mechanisms attached to the stacks and designed to scrub away the pollution according to the weight of the pollution particles. But it's the submicron-size particles—like lead—that get away, deep into the lung, or high into the atmosphere. "Thirty thousand feet up in the stratosphere, our chemicals are eating a hole in the ozone layer over the north and south polar regions. "Other chemicals—like carbon monoxide—are eating away at our lungs, breaking down the filtration system. Carbon monoxide remains in the atmosphere for up to a century, and we are increasing its global levels by six percent every year. As a result, my species is succumbing to emphysema, obstructive lung disease, asthma, and respiratory cancers." I feel good about my speech. She listens patiently. I'm sure I can turn her around. Solicit answers, empathy.
"With more disease, more destruction, the next generation improves, like a broken bone that gets stronger as it mends," she says coolly. "Whatever your species does, or dreams of doing; whatever it thinks, or breathes, or eats will only serve you in the end. It is all part of nature's game plan." "Are you telling me that nature's game plan has accounted for all the chemical insults my species continues to impose?" "Yes," she says without losing a beat. It's trial by error with her. I must zero in on the focus, get it tightly woven, weave her inside out, until she can no longer deny the obvious. And yet, nagging at the whole enterprise is the undisputed difference which prevails, which has continued to exert its irreconcilable gulf over our friendship: Gaia is who she is. I am & man. I expect answers. Perhaps that's too simple. I want sympathy. Perhaps that's unrealistic. I want clarity. Press on. Try again. "I have other data which contradicts your nature-knows-best bullshit." "Name it." "The name is Jamaica Bay." She knows the spot. A sunrise, glimmering on her screen. "The coastline surrounding New York City was once a haven for wildlife," I begin. "Egrets that fed on blowfish.. Ospreys in abundance. Eels thriving in the deep sound, along with unseen but numerous plankton and shrimp— perfectly adapted players in the food chains of Long Island. Fertility at its best. But the marshes were thick with mosquitoes. Homo sapiens sprayed DDT to control them, for nearly a quarter of a century. The chemicals accumulated in the mud and water and ended up in the largest predators, the birds. DDT has had a disastrous effect on birds, interfering with their ability to produce healthy calcium. For every osprey chick that survives, many others never have a chance because their eggshells can't form properly." "That was news twenty years ago, when your colleague Rachel Carson wrote her book The Silent Spring. Today, the birds are coming back. And so are the mosquitoes, I'm happy to add." "Don't be deceived: We still sell DDT all over the world. At home, other insecticides, like the highly toxic lindane, have replaced DDT. Our legal, economic, and moral system is apparently incapable of saying no to this onslaught of molecular mutation." "It's not as bad as all that. Jamaica Bay is a wildlife preserve under the protection of wardens. There is hope." "Well, there aren't enough protective Ranger Ricks in the world. In cities like Cubatao, the chemical onslaught has reached epidemic proportions."
"More melodrama, I suppose . . ." she says. I type on the computer—CUBATAO—and like that the city's peripheral desolation surges like a diseased X ray onto the monitor. "Some thirty miles to the southeast of Sao Paulo, Brazil, is the industrial city of Cubatao. It has been called the most polluted city in the world, Gaia. Cubatao does not support your hope for my species. There are dozens of chemical-producing plants, and they belch out then- poison into the skies. The city is built in a valley, and even on a clear day you'd be lucky to see the hills. Over nine hundred tons of chemical pollution rain down upon the city every day. Forty out of every thousand infants are born dead, and another forty will die within their first week of life. At one time the mayor refused to live within the city boundaries —a wise choice, as the World Health Organization recently declared that no human should spend more than twenty-four hours in Cubatao." "The mayor is no dummy," she says, advocating in her obtuse way a position that I mistake for mere glibness. "It is the first city in biological history to have no birds or insects of measurable quantity. Nearly every species is dying out in Cubatao. The rivers that flow through the city were pronounced dead. Yet the workers come in droves, goaded on by some of the highest blue-collar salaries in all of Brazil, about four hundred dollars per month. Nevertheless, most of the nearly one hundred thousand residents of Cubatao live in dreadful slums." I skim my fingers across her interactive screen to a particularly depraved part of town. "This one was built on a gas line, which some years ago burst and killed several hundred people. The city had the slums rebuilt back on the same gas line. My species never learns." She stops me flat. "You're from Los Angeles, correct?" "That's right," I admit, gearing up for her next rebuttal. Give us a reason to go there. Get me home! Don't think it! You're close . . . so close! "Given your general flair for ideas, your sterling disposition, and obvious health, one would assume it to be a beautiful environment to grow up in. A real paradise." "You're being facetious." "Not at all. You turned out okay!" I feel the surge—electricity sucking me in—I've been there before, no way to fight it. But then— Home! Stone Canyon. A suite at the Japanese-owned Bel Air Hotel. Fireplace and Jacuzzi. Room service. Kingsize bed. Bottle of champagne, compliments of the general manager. Phenomenal flowers in bloom. Swans in the pond. It's late afternoon, a cool breeze coming through the open French doors. I start the gas-driven fireplace, throw a log on top, and fall onto the bed. God is good. I get up and shower, the first shampoo and rinse in seven months, all the hot water I want. It stings the fresh bruise on my behind but feels sooo good. This is felicity, again— this is God. I help myself to the
wet bar, devour a bag of Famous Amos chocolate chip cookies, slip into the Jacuzzi and pray that it will never end. There is a knock at the door. "Room service." I throw on' one of the princely white terry cloth robes with its little blue embroidered swan and receive the liveried Spaniard. He has an envelope with my name written on it. A message inside: "Gaia is good." Huh? I get on the phone and call George Henley. It will be my first real contact with my past since reaching Nepal. The guy has probably not moved from his computer array in the dark, over at JPL. I don't know what's happening in his world of space research—analyses of the moons of Neptune, I would guess— but I do know I've got to see him. "Hi, Bill. Back from Nepal, eh?" I am churned up by his essentially normal tone of voice. "Everything has changed, George. I've got to tell you!" "You sound—different. You all right?" Suddenly the operator comes onto the line. "I have an emergency call for William Planter. Will the other party please hang up." "Dinner, seven o'clock, George. Okay?" "Which hotel?" Damn! The line is forcibly disconnected and she comes on. "William, put on your clothes," Gaia says sternly. "No. I want time to work this out." "There is no time." "What do you want from me?" "I want to know you." "What does that mean?" I lie on the bed, propped up on four down pillows, speaking in a moment of immunity. I should be sick from so much jockeying around. Upset spleen. Kidney malfunction. Skin eruptions. Dizzy spells. Manure syndrome, or whatever they call it. Something. "There's a fresh suit of clothing in the closet for you. In the pants pocket you'll find a ticket for your car. Give it to the attendant, then meet me atop Corral Canyon. Now!" I obey, unable to contain the fascination that has held me in its trance for so many months. And I am amazed that she should have chosen Corral for our rendezvous. I know the place well. I follow the long winding road to the dirt parking area beside a ridge of white spires looking out over the Pacific.
Incredibly, the car she's provided for me is a spanking blue Bugatti. I leave the vehicle and hike up to the rocks. There is a-sandstone tower eroded in the center with a large sitting area in the shape of a circle and gotten to by a series of natural steps. I wait for her. Soon enough, Gaia snuggles next to me, a voice as familiar and generous as any I can recall. A voice that is rich in softness and wit, intelligence and the erotic. Not the sort of voice that would tease the life out of a man, or leave him stranded on the side of a volcano. "You love L.A. You are the product of this place, this land. Doesn't that tell you something?" "I have to think about that." "What's there to think? Look out—like a Van Cleef array of priceless gems, the cityscape is spread along the far waters, its lights beginning to merge with the dusk. A wilderness of elemental beauty." My wife wore Van Cleef jewels. I'm not surprised that Gaia should refer to it. She's got something up her sleeve. I muster my rebuttal. "Once L.A. was a wilderness. Not just L.A., but the whole world looked, smelled, tasted, and behaved pure. Deep, forested canyons. Sparkling sea. Surrounding desert. These cliffs, this meadow behind me. Beauty everywhere. But that's not why we're here, Gaia. Is it?" "Show me your town." I walk down to the car and head back to the Pacific Coast Highway, driving south to a little-known stretch of inconspicuous sand dunes. Gaia listens to the radio. Guns and Roses—heavy metal. Then a call-in. Should the woman leave her fiancé? Guy refuses to get a job, does dope all day, plays with the neighbor's little girl. "Leave the pervert!" Gaia bursts out, impatient with the radio host's pop psychoanalysis. "String up the bastard!" A cobalt blue glow, golden rim light, sits in the rear of the car. I watch in the rearview mirror as the words vibrate from the center of color, what I have always assumed to be her mouth. We reach the dunes. They are fenced in by an oil company whose square miles of refinery rise in an eerie congestion of sci-fi lights and steel towers beyond. "What gives?" Gaia asks in Valley Girl parlance. "Once these unsullied hillocks provided the habitat for such creatures as a delicate little butterfly known as the El, Segundo blue. You don't see one because they are virtually extinct. For millions of years, ever since the first flowering plants staked out this territory, the butterfly held its ground. Now, the butterfly makes its final stand for survival against the world according to Los Angeles, its one home pitifully reduced in size and quality to this, less than a polluted acre." "At least someone has tried to save the last few. Anyway, all species disappear, William." "But L.A. speeds up the process, Gaia. Several miles away, in a zoo, the last of the giant condors are dying out. These gentle, ancient scavengers can no longer function in southern California. It's become
too poisonous for them. When even your scavengers are disappearing, then you know you've got a problem!" "You're so melodramatic." "I'm an observer." "Quick to find fault with an environment in which you were raised with apparent success." "This is true. I've had a love-hate relationship with L.A. for years. All four thousand square miles of it." "I think it's a great city!" We drive back to the Bel Air Hotel. Gaia has paid for it, using her ability to reappropriate matter, transmute substance, and alter chemistry, which, in short, gives her the means to produce money. Lots of money. "Stick with me," she says, as I leave the vehicle for my room. In the morning, a cobalt glow joins me in the hot tub where I sit reading an L.A. Times. "I want to see more of the city," she says. We get back in the car, head out to 405, over the hill, and then east on the Ventura Freeway, toward Glendale and downtown. "The city produces over twelve million pounds each day of dangerous air pollution," I tell her. "Worst air quality in America. The surface ozone levels alone reach an unhealthy pitch at least one hundred sixty days per year." "Amateurish!" Gaia replies, uninterested in the moribund this day. "What can you tell me that I don't already know? A city is a city is a city. Teplice, Ushuaia. Council Bluffs." I'm not intimidated by her nonchalance. I go on: "In its frenzy to expand, L.A. manifests its own weather patterns." It creates more dust, clouds, fog, and rain, and less wind than the outer perimeters." "Big deal." "Two point five billion pounds of garbage every year, six thousand tons of pollutants every day. A city which comprises more concrete and glass and steel than it does living things. That's a big deal! The city is so enormous, so thick with man-made compounds, that it literally generates its own weather and energy—the remarkable equivalent of eight percent of the sun's total energy striking the surface area of the city." "Statistics worth knowing, if you're a professor bent on torturing his students." "You're not listening to me," I say angrily. "Of course I am," she counters. It's as if the whole point-counterpoint thing is a game, who can best whom, whose data has more punch, more moxie.
"Gaia, I don't think you understand where I'm coming from. I take this stuff seriously. That's why we're here." "I take it quite seriously, William." "All right, then. Play straight with me; no brio, no sly ulterior motives. There are several problems, fundamental dilemmas at work in the behavior of Los Angeles. Uncontrolled growth, lack of a plan, any kind of plan to impede pollution. Much of L.A.'s water and power and resources are extracted from as far away as Mono Lake and the Four Corners region of New Mexico, where that energy plant's smoke plume is visible even from the moon. And that's just the beginning of the energy drain on the environment." She whistles. "Now that's impressive!" I take her along Sunset Boulevard, past the many discos, under the empire of power lines. "Listen, that same man-made energy imposes great stress on the human physiology—sixty cycles per second of alternating current. A wavelength which happens to be twice the wavelength field of the heart and of the cells. Such alternating current may be skewing the DNA molecule, which, for a few billion years prior to Sunset Boulevard, was in better balance." "What are you trying to tell me, Mr. Ecologist?" "What I'm saying to you, Gaia, is that Los Angeles—like, every major city—may well be contributing to the total sickness of life forms therein, whether giant condor or human. As much as forty percent of excess mortality in the U.S. can be blamed on air pollution. We also believe that ninety percent of all cancers are environmentally induced." "I guess that just makes you one of the lucky survivors," she adds wryly. And then, computer whimsy ignoring my agitation, Gaia asks that I escort her to the beach. We walk along the water's edge in Santa Monica, where I tell her about the recent concern over data pertaining to cancer-inducing toxins in the ocean. "But despite these increasing poisons in Santa Monica Bay, people continue blindly to enjoy the southern California coastline." "And why not?" she remarks blandly. "They even consume fish, such as the white croaker— known to contain high levels of fat-soluble PCB contamination. Do you know how many millions of pounds of sludge are pumped into the ocean here? This is the most toxic, cancer-producing patch of seaside on the entire Pacific!" At first she doesn't answer, as I stand behind a fisherman, watching him plant the bait on a line. "White croakers will kill you. Leave 'em alone. Go home," I tell the Japanese fellow in his hip boots. His bucket is filled with dying sea creatures. If the tissues were sampled I have no doubt they'd prove to be cancerous. Then Gaia remarks, "What possibilities for genetic mutation! You may be launching a biochemical
bonanza in Santa Monica." "More likely a dead end." "Need I remind you of Solemya reidi?" "What the hell's that?" "A cute and delicate clam that lives within the turgid hydrogen sulfide of the Santa Monica sewage outfall, five thousand of them per square meter, thriving in L.A.'s toilet matter. Human life has created the ideal environment for them and on a much larger scale than would normally have evolved. Bravo!" "Show me," I demand. She leads me beneath the pier, and there I find a small, cluster of the organisms, half exposed, clinging to rocks wedged between pylons. "These clams lack a mouth and a gut and they have symbiotic bacteria in their gills which provide their food source. The bacteria use hydrogen sulfide gas from the decaying sludge as energy. They utilize such energy in a way similar to that of green plant photosynthesis, transforming carbon dioxide into carbohydrates, lipids, and proteins which are then used as food by a surrounding community of other animals. The more gross it is out there, the happier the clams are." "Your idea of happiness is not very compelling, I don't mind telling you." She is quick to respond. "May I remind you that anchovies produce more shit in the sea than all you Los Angelenos combined. Think of that next time you eat a Caesar salad." "I appreciate the tip." "My point, William, is that the man-made pollution in Los Angeles might be the biggest boost to coastal evolution in North American history! Just think of it! I love this town! The tumult. All the traffic ... chemicals . . . bacteria . . . more people, more energy!" We drive through Beverly Hills where I try patiently to explain to Gaia that her glitzy reading of L.A. ignores the perverse downside which affects everyone who comes here whether they know it or not. I hear her yawn with an exaggerated expression, tired of my unrelenting doomsaying. And yet, for all of her inordinate upholding of the city where I was raised, my own feelings are stirred to set the record straight. An intense antipathy wells up in me. I would call it rage, directed at no one in particular, but rather at that pattern of more and more urban sprawl, mind-numbing pollution. No culprits other than the whole city experience. Holding the wheel, cruising the less affluent neighborhoods, I tell her about myself. "Dad sacrificed his life to make a living in Los Angeles. I never was allowed inside the plant to see what he did. Mom said it was no place for children. Every day before dawn Dad was out the door, unhappy; every evening after dark he came home, unhappy. He was always too tired to play with us kids. And then he started having to go to the hospital. He was coughing blood. As a child I blamed the factory. I later learned that
the factory was okay. It wasn't the bad guy. Los Angeles was the bad guy. The U.S. government was the bad guy. * It didn't even begin regulating air quality until 1971. "The problem is that there is no disease specific to air pollution, no well-defined microorganism that can be traced. The chemicals are elusive, complex, highly unstable, forever shifting in the air and water and food chains, wafted by wind, absorbed by plants. People habituate to pollution. After a while they hardly even notice it. Their minds have become polluted, and this vicious syndrome is evident in their sluggish acceptance of an increasing catastrophe unfolding all around them. My father died in this city where over one hundred thousand people die every year as a direct or indirect result of pollution." "Did you rehearse that for my benefit? I am so moved." "Leave me alone." "With all due respects to your father, every rose has its thorns. Furthermore, you humans are mere ingenues when it comes to pollution. The Earth is still supreme in that area. Don't think for one moment that the planet is not totally in biological and chemical control. It is!" "Guess Dad harbored a whole different idea about Los Angeles from the conventional paradise you seem so eager to rhapsodize," I tell her. "I'm sure he would have appreciated those beautiful flowers! And those lawns!" she replies stupidly. "Did you know that lupine plants and lawns in L.A. have learned to love the smog! I love the botanical glamor of Beverly Hills!" "I can tell you that life in L.A. was no bouquet of roses. No shopping sprees on Rodeo Drive, no dream bungalow on the ocean. Take in a movie, a Hollywood Chinese carry-out once a week, and that was the extent of the glamor." "You're bitter," she says, dismissing my pessimism with annoyance. "Look, Gaia, a lot of my friends died from cancer in this town." "Will you lighten up! This is my first guided tour of southern California and I'd like to enjoy it. This was home -to Charlie Chaplin! Clark Gable! Harold Lloyd! Land of opportunity. Disneyland! And anyway—I don't see any pollution." She's right. It's one of those remarkably clear days which only serves to recommend L.A. like no other city. "This isn't usually the case. Typically, the visibility is limited by garbage in the air to about three miles." "I can even see the horizon." Now I'm tongue-tied.
"What part of town did you grow up in, anyway?" she says. "Hernando Beach." I take her to the old neighborhood. The deli has become a sushi bar. The post office still stands, as does the old school. "Charming block!" "My first girlfriend, Jamie, used to live in that house." "She cute?" "Of course." "How old?" "Eighteen." "Did you love her?" "At eighteen? What's love? Love is pussy at eighteen. Hell, love is pussy at forty-seven." We drive up to Will Rogers State Park in the Palisades, overlooking the sea. "We used to come up here in high school and mess around. God, it was beautiful. And you know, it hasn't changed." I walk through the same identical fields . . . "We'd climb these trees or just sit outside under the cool shade in summer." "It was wonderful," Gaia says faintly, hardly there. "Yes, it was." "And this is where you first kissed Jamie?" "We thought it would never end." "And you felt something in the coolness of the grass, and at night in the wind as crickets throbbed you also throbbed ..." I look and I see. There, thirty feet away, the scintillating memory is becoming flesh. "You knew that life was eternal. And you touched her body. And she touched yours. Her hand was hot with the heat of your own hand, and the blood of your hearts merged here in the sweet luscious grass." "Yes "And all of nature came into your nostrils like air touched with honey, the mellow blue skies, the dark undulating Earth. Until you slept a thousand years and tasted the outpouring sweetness of a woman." "Jamie, is that you?"
Her shimmering form passes before me, beneath the canopy of elm and sycamore shade, walking naked through the meadow grass. I reach out toward her, light piercing through the trees, to touch memory in the flesh. It is no illusion. Jamie hasn't changed. "Even in L.A., in the heart of polluted bedlam," Gaia whispers, "a man can fall in love with a woman. The whole Earth is every second rekindling that same undeniable sweetness, William. Just as a flower blooms in the ash of Mount St. Helens, your love bloomed in the polluted morass of a human city. When all the pollutants settle into the soil, you'll be left with the permanence of that love, that beauty. It is what I love about your species, the fact that you have the capacity to make an art form out of life!" She's gone! The trickster at work again. In the heart of her evocation. Spinning silhouettes, turning recollections in on themselves, compelling me beyond my own certitudes to the edge of scattered light. "Art form?" I mutter. "What art?" And then the feeling of it comes over me, usurping the web of cancers, the thickness of diatribes. I lie dazed against a comfortable rock, where nothing can disturb the moment of fond nostalgia. Moss between my fingers, the acute sensation of grass tickling my waist, poking up from between crannies. The world, for an instant, is perfect. Of course. And the rumble—stoked into the halo of fire, I brush past leaves cluttering against my face as my body, like a bursting idea, pushes through space. A thought, a candle. Then-Water! Radiant. Beyond, the glittering outlines of a city. "Venice, capital of the High Renaissance, attests to that art form," she boldly hails. A singing gondolier pulls his oars through waves, plying the morning choppiness, past other larger vaporettos. Congestion right out of Guardi or Canaletto. Wonder of wonders! The slapping oars lull my heart. Gaia waxes about the city, as if she herself were born here. After some time, we pull into a narrows, where the .odors are strong and the floating garbage unavoidable. It is then that my other side surfaces, cognition awakened by the other, negative Venice. "For your information, Venice is one of the most polluted cities in the world!" "You are impossible, Mr. Planter! Why this preoccupation with gloom and doom? There's so much to be thankful for!" "I love Venice as much as anyone. But there is data suggesting enormous problems and you shouldn't ignore it. Dozens of chemical factories across the water at Malcontenta are spewing forth hundreds of untreated toxic chemicals day and night. Scientists recently analyzed the specific chemicals pouring down upon Venice." She doesn't know that I happened to attend a conference at Cal Tech where Italian scientists presented their findings. "The list is not pretty, though no official reports have yet been released by the Italian government. They'd prefer tourists not to know about it."
"I would have hated to take your class," she says, knowing full well where to hurt me the most. "I guess I'm a hopeless realist." "Realist, my word! Reality, William, is a celebration! I see human beings as celebrants of life; a brilliant species that has soared above your so-called pollution—the petty little puffs of smoke and sordid, ephemeral grit of civilizations." We visit the Church of St. Sebastiana with its side room that glows beneath the brilliant panels of Paolo Veronese. And then we wander across the city, into St. Mark's. Gaia has become my Walkman. "The great Venetian artists excelled in transcending such grime, William. They preferred to focus on great dreams, miraculous light, all that is radiant in nature. It's your choice—beauty or ugliness?" The shadows inside the great church are spectacularly ribboned with gold motes. The darkness is cool, huge, a comfort such as few spaces can afford on the Earth. Indigo blues, rebounding echoes. Softness upon softness. Forget the Crusades, the Inquisitions, the iconologies of bloodshed inherent to Christianity—this place lives and I feel it. Safety in such havens cannot be broken. And yet, I have a hard time disengaging the appeal of Renaissance art from the horrors of surrounding pollution. The insistent connection is not merely an academic one. The death rate from environmentally induced cancers in the Venice area has risen horrifically in the past two decades. And such thoughts arise inside the great halls, beneath the massive nave, as I stare directly into the glowering eyes of St. Peter, and the merciful face of a Madonna. "Your alter ego is listening, William." "Oh, is that it?" "You insist that pollution has curtailed your species. Well, you know my position on that. I would counter by saying that your most lasting art is your true salvation." "That's not the issue." "You argue against joy, William. It's no coincidence that some of your finest pollution and greatest art coexist in Venice. It was here that painters sought to elevate the world around them. To see the world clearly, as something beautiful, something original and pure, to be sanctified. The whole city and surrounding regions are a tribute to that purity." I am reminded of the great historians of the Renaissance who lauded Venice—Giorgio Vasari, Walter Pater, and Bernard Berenson, John Ruskin—men who used a whole different set of intellectual criteria to judge the condition of art. The aesthetics haven't changed. The canvases still read the same. But the surrounding airs are vastly different. We now understand that art is everywhere endangered, not by rash kings who in moments of stupidity will burn down temples and libraries of knowledge, but by the world of man itself.
Gaia leads me to a restaurant near the Venice Academy where the waiter serves me a superb pesto with fresh greens. The meal is also pure, she reminds me. The waiter brings me a check which I can pay for with plastic. He also brings a set of keys, left for me in an envelope. We drive out into the country. It is a Thursday, cool and windy. There is a storm brewing to the south, toward Padua. Distant thunder. The roads are not crowded. We reach the village of Castelfranco. I can feel Gaia's excitement. "Go to the center of town," she urges me. We reach a sort of castle, surrounded by forest. Across the street, bistros and small shops. I park the silver-colored Alfa Romeo, get out of the car, and walk toward a larger-than-life-size statue that graces the front of the castle. "The patron saint of the most pure and natural expression was a man half-cloaked in myth," she tells me. "This was his town. He came from the surrounding farm country, his eyes nourished on the soft Lombardy poplars, fields of corn, luscious hills. A most sensitive soul ablaze with the glories of this Earth." I stare up at the chalky white figure whose stance suggests a kindly-looking, intelligent man, early thirties, his clothing tailored, but not overly so. Elegant, in touch. "His name was Giorgione," Gaia goes on. "The very name makes me tremble. Giorgione! One of the most provocative painters in your history. He invented landscape. Color gradations, horizons, perspective, the reality of beauty as a thing in itself. This young man paid ultimate homage to sunsets, sunrise, a shady tree, a coming storm. He loved the soil, the air. "What's more, in his passion to unrobe the splendors of life, Giorgione unrobed the female. For the first time in western history, the nude was brought to fruition." She leads me into the town church which adjoins a home where Giorgione is said to have lived. Inside a darkened side gallery hangs a Giorgione, with the Madonna and a St. Francis figure. In the rear, the Castelfranco landscape with its recognizable monastic tower and crenellation. I am no art connoisseur. The painting is clearly a great work but I cannot say whether it moves me any more than others of its ilk. The eyes are no more or less evocative than those of Giovanni Di Paolo or Botticelli, Rembrandt or da Vinci. I don't know. She's got the fever for this Giorgione. I stare at the painting as Gaia continues to wax. "In the coming five hundred years, beginning with his student, Titian, every major painter would borrow from Giorgione. He provided a new language, painting his colors directly on the canvas, without prior sketches. He was the only painter of the Renaissance whom the church fathers left alone. They must have sensed the destiny hovering over this young man. He was allowed to paint whatever he damn well pleased. Nudes and nature—his two obsessions! What energy he had! Giorgione was the critical link between the ancient world and the modern sensibility. A total revolutionary, William." Gaia senses my impatience. She leads me to the side of a stream beneath the tower outside. I stand leaning against a tree, looking out across the creek to a young mother who is nursing her child.
Her breast is exposed. There is something strange going on. I feel caught up in Gaia's own scenario. A staff in my hands. A stick that has broken off from the tree. My clothing. My hair. The feeling of my skin. My God, what's happening? Even the woman, who casts me a glance, is oddly familiar. "Gaia? Jamie?" "Look at her!" the voice calls. "No ordinary nudity, but cosmic, perfect, reclining, unabashed flesh— the product of forces Giorgione fully understood. His greatest achievement was painted from this very spot, the river . . . the tower . . . that shade ..." I'm dizzy with the woman. Now I see her as she really is, a naked Gypsy continuing to breast-feed the child. An intoxicating trance. Her eyes are fixed on me how. There is a lightning flash in the distance. The sound of traffic has totally vanished. Not a murmur from overhead. It's as if time stopped. Even my clothes are different—velvet, velour, black slippers. I know this monastery. And the tempest—I've heard that lightning time and again. The clouds, the shadows, I've been here, in the ineffable air. The sensation lingers. As it did up on the mountain in Los Angeles. I see myself standing there, as if composed by the painter's own brush, transfixed for all time. And then it begins to rain. I run for cover. The spell is over. At a nearby restaurant, where I take strong black tea and chocolates, Gaia gathers in close to gauge my reactions. "Gaia, I appreciate your reverie on behalf of my species and its artistic achievements. But your lovely vision of the Renaissance has been tainted. Giorgione himself died of the Black Plague at the age of thirty-three. The plague first struck the coastal cities of Italy because of abominable filth and pollution underlying those communities. Five hundred years later that pure river in Castelfranco is more diseased than ever. Didn't you see the thick layer of garbage near the waterfall, or the blue-green pall of an oil slick covering the marsh area beneath the tower?" "That's all you saw?" "I saw a Gypsy woman. I'm not sure what I saw. I felt a moment of unconnected bliss. And then the sensation was cleansed." "You're slow, Planter. Very slow!" It has stopped raining and the sun has come out. I finish the tea, pay the bill, and head to the car. As I drive away from Castelfranco, I reflect on the achievement of this region, with its spirit of art, perfect light, pastoral landscape, blissful nudes, aesthetic saints— now sinking in a polluted sea of carcinogens. The great bronzes are pockmarked and corroded as a result of the noxious sulfur dioxide
in the air. The canals, at one time key to the pastoral vision of Venice, are today rank with malodorous sludge. The same rats that spread bubonic plague to the city are now more numerous than tourists. And Venice is only one of many disastrously polluted regions in Italy, a country fast becoming the dirtiest in all of Europe. Elsewhere in the country, that golden dreamscape of ages past has become a nightmare, a plague on the house of Giorgione. But what is more peculiar to me, as I drive across Italy for hours, is Gaia's own blindness to that blatant form of human behavior which thinks nothing of trashing the environment. It's one thing to exalt in our fine arts, but I cannot stomach her total disavowal of our self-abuse. The lady says nothing throughout the drive. I have no reason to believe she's even with me anymore. Her silence reminds me of a couple I once knew in Big Sur who spent their days growing artichokes and reading books about meditation. The perfect existence. A home by Marcel Breuer. A coverlet of pure sable for their bed. Huge bookcases filled with coffee table volumes on horses and French wine country. Bronzes by Giacometti in a yard overlooking the sea-wracked Pacific. They always told me that you had to strike up a perfect bliss within yourself before you were any good to the world. And they could afford to invest the time in such self-help—he had a net worth of seventy-five million dollars. Narcissism never hurt anybody, they said. And if you didn't hurt anybody, then you were in effect helping the world. Somehow I don't buy that line of reasoning. My whole career was motivated by a desire to teach others. A "chronic communicator," is how my mother always described me, as if I suffered from some form of neuralgia. As I become enveloped in the freeway system surrounding Milan, I realize I'm driving on empty. I take the first exit. Seveso. I know that name. I drive into the town and head for the first gas station, fill up, and start to leave. "William?" "There you are!" "What are you doing?" "I've got to find a place to sleep, unless you have other plans." "This looks like a pleasant enough town. There must be a suitable hotel." "I think not." "Is there a problem?" "I don't want to stay in Seveso." "Why not?"
"You must know that one of the worst chemical disasters in human history occurred in this town?" She is elusive, weak. "I seem to remember something." "Something indeed. A crucial pressure valve in a highly toxic chemical plant ruptured on July tenth, 1976. You know very well. The plant belonged to the Swiss subsidiary of the American multinational firm of Hoffmann-La Roche. It was around lunchtime. People were inside restaurants, or out in the street, at outdoor cafes. Hardly anyone took notice of the fact that something had gone wrong at the chemical plant." I drive through the town, stirred by curiosity, by my own remembrance of all that. The streets are quiet in the late afternoon. "The town looks lush, green, tranquil," she says. I have to agree, seeing it for the first time since the nightmarish video clips I remember from the news fifteen years before. Men in white space suits spraying everything, evacuees marching out of town, people in tears, pregnant Roman Catholics lining up for abortions. This day there is no evident catastrophe. Only quiet. A suburb of Milano. But agony hangs in the air. I can feel it. There are ghosts crowding the village, crowding my memory. High into the air over Seveso, the rupture had released a faint cloud of lethal dioxin. Wind caught the white ash and spread it over a radius of fifty miles. Dioxin is used for making soap. It was also the primary component of the infamous defoliant Agent Orange, used against the Vietnamese. Children in Seveso who were out playing got the dioxin ash on their faces and hands, in their eyes. Almost immediately after the cloud had escaped in the sky, the leaves turned yellow. Doctors sampled the population, and it was discovered that the most poisonous substance in the world had been released in that rupture. Hundreds of thousands of animals would die, birds falling right out of the sky. "Gaia, look at that hill!" I walk up the grassy embankment, over the freeway. The hill is seventy feet high, covered with grass as if it were a little municipal park. "A nice view of Italy," she says. "Yeah, sure. Let me tell you something. This hill was made with the corpses of over sixty thousand animals." "How do you know that?" "Because I read, I'm part of this world! Their dioxin-ridden carcasses have since vented poisonous steam that nearly detonated this mound. It has since been capped— Do you see?—but apparently steam still gets out and workers have to continue to spray it down. We shouldn't even be here." A flock of birds flies directly over me. "See them," she says. "Healthy animals. No sign of any disaster
now. Another Mount St. Helens. What's the difference, William? I'll tell you the difference. Here, in Italy, human culture has responded to pollution, disaster, and illness, with something more interesting than mere pain and jeremiads. Do you understand?" "I understand that those birds which managed to survive carried parts-per-million of the toxin in their beaks and talons to fields and food chains all over Europe and beyond. The chemical remains toxic for thousands of years." She's trying to head me off again. There is ringing in my head, conflict. I cup my hands over my ears but she's there, adamant. "A mere blink in the Earth's total life span," she says. "I'm talking about the consequences of that toxicity on people, not the Earth, Gaia. Look to the north there. Four thousand acres in the immediate vicinity of the plant were totally contaminated. Zone A, as it was called, would remain uninhabitable for centuries." "There is grass." "That's fucking stupid. Grass. I mean, that makes a whole lot of sense. Who am I to you?" "Do you think you just happened to stop in Seveso?" "Huh?" "Think about it, asshole." Suddenly my head is released from the vise and I see a shimmering figure descending the hill, an outline of movement with a clear path. "Hey, I'm talking to you!" I run after her, down a street, past a mother walking her children, and out toward a barbed wire fence that surrounds the empty zone, the A zone. She goes in. Faceless, incorporeal. "What are you doing!" I scream. "You buried the plant. That was the right thing." "Wait a minute!" I climb the fence after her. This is illegal. This is dangerous. My shirt catches, and is ripped down the side of my back. But I get over the other side. Gaia is there, a shadow in the center of the football field of concrete where the factory's remains had been, burned then buried beneath. A shadow I've never recognized before. I walk up to her and her face fizzles in and out of focus, a face of conjuration, misery, and blithe bemusement. No eyes, no regular features. A void that has gathered flesh, flesh highlighted by contrast. She is astonishing. I reach out to touch her. Why here? After more than seven months, living confined together, traveling everywhere—why" here? "Gaia? What is it about this place?"
"You'd listen to me here," her gauzy form says. "It was the only way." "The only way? You don't think you've totally got me? Don't you understand?" "I'm sorry . . ." she says. "It's the only way you'd hear yourself!" "Gaia, what are you telling me?" She's waiting, always waiting. Totally calculating. Behind me is a church spire, a few thousand feet away, and the sun is pouring through. All of Seveso catches the eight P.M. rays. Insects hover in the summer twilight. We are surrounded by the invisible remains,, the long-term effects, the hidden horrors of a disaster that today is still impacting on hundreds of thousands of Europeans. The emergence of tumors is still being monitored. But no one knows. And now, I don't know. Dozens of containers of dioxin were smuggled away from the scene, traveling a circuitous route all over western Europe, finally ending up in Paris. The company in Switzerland never owned up to the problem. Four men were found guilty but the Italian government threw out a local suit brought ten years later by victims in Seveso, There was a corporate and government cover up. Scientists battled over the findings. There were about two hundred known human deaths. But epidemiological studies were not conducted outside of the immediate vicinity. Those who came into contact with bird droppings, say, a thousand miles away, droppings contaminated with dioxin, would never be monitored. And one disaster would add to another disaster. The burden of toxicity would grow. With disasters happening every day— chemical spills, other ruptures in other chemical plants— the soil would become unfit, burdened by the wastes of a single species. Children were born with defects. Other children grew up with scarred faces and bodies from the outbreak of chloracne, the skin eruptions common to dioxin exposure. Others who were contaminated wait for cancer to appear, for third-generation infants to be born without limbs, with central nervous system afflictions, or stillborn. It's an unbelievable mess. All of these tribulations are recalled for me now. The dioxin is still deadly. And nowhere more so than right here, where Gaia waits for me. "You could quibble over scientific data forever. But the basic lesson of cause and effect should be clear to you by now." "What's clear is that the chemical which nearly destroyed Seveso can move unimpeded throughout the whole food chain, resisting analysis. It's not nature. It's certainly not art. My species is a disaster." "Fine." "I want answers. That's what I came to you for." She's silent. "Gaia. Gaia, talk to me." We're sitting on a death zone. I start back toward the fence. She calls after me. "This is fundamental cause and effect, William. Your species lives within medical limits. Exceed those limits, and accept the consequences."
"Easy for you to speak in stark, logical terms. The Italian bureaucrats haven't even owned up to the fact that anything really happened here." "They buried the plant." "Only after ten years of international protest. Look," I say, turning around to face her. "Since World War Two Italy has systematically pursued industrial stardom and is quickly becoming one of the wealthiest nations in the world. At the terrible price of destroying its whole environment. The 'Plano' as it's called, that broad plain south of the Alps stretching all across Italy, is a morass of pollution. A rash of other disasters have occurred in this country. "But this dilemma is not unique to Italy. My species is contaminating the whole planet. With our Bhopals and Exxon oil spills and Chernobyls. What are we doing? Is it in our 'nature,' are we a plague species?" "You are pushing your luck. Why fight your own place in the natural balance?" "We seem to have no choice." "Wrong. You have a choice. The precise chemical in question at Seveso, dioxin, is used in the making of hexachlorophene, soap in other words." "That's right." "Dioxin causes cancer." "Correct." "The answer is clear." "What is it?" "Get off this land. Go on, climb the fence. Get out of here." I'm out. And as I climb back over that fence, it begins to tremble. The trembling stops before her computer monitor. My pants are torn but I'm home in Nepal. On the screen before me is Gaia's shadow form again. I can make out lips—or imagine them—speaking through the aura of a force as ancient and complete as any in the universe. I know it to be divine. I know it to be the Earth. And yet I still can't touch her, know her for real. It's as if the closer I come, the more I doubt my own perceptions. A fine state I'm in! "Stop using hexachlorophene, William," the lips say, speaking with a sluggish, almost gassy confluence of effect and deliberation. There is no apparent face behind those lips. No eyes, no true skull. Only the gauzy convergence of smoke, a pulse skewed toward language, lip-sync. "Humans have been washing and cleaning themselves for thousands of years without hexachlorophene-
saturated soaps. You created dioxin with your minds. You might have abandoned the idea with a little foresight." "Is it really that simple?" I ask, shaken from the ordeal. "You will live, or die, depending on how you use your mind and your heart. Life remembers by definition. Give life half a chance and it will survive. More than survive, it will go on to fashion a mysterious jungle of possibilities. You may be a horde of meddlers, sadistic tamperers, precocious inventors—children, in other words. Cubatao, Seveso, Jamaica Bay all certainly suggest that. But you are not the last word. I don't know if you're even very good, or if there will even be time to find out. Certainly the legacy of Giorgione offers hope. So do you, I might add!" "That's very flattering of you." "Who you are, William, is not what you've done, but what you've dreamt." "Gaia, you singled out the paintings of Giorgione—the sensitivity, the genius. We're capable of that. Give us a chance." "Give yourself the chance. Otherwise, you might be the shortest-lived species in the planet's four-andone-half-billion-year-old history. That would be very sad ... for Jamie's sake. And for mine."
chapter eight "Extinction” Three days ago I was invited by Kaldup's family to come down to their village of Khumjung and join in the celebration of their son's wedding. It promised plenty of hard spirits and flirtatious Tibetan girls. Kaldup had ventured infrequently to Thyangboche, usually to carry out some translation or another for the head Lama. He always dropped by to say hello, and on occasion stayed for dinner to talk shop. Kaldup's own work in the forestry division of the Nepalese government is of great interest to me, particularly in view of the crisis he has -to cope with. The forests are being wiped out, and with them, most of-the resident animal species. Woodcutters are to blame, along with the unavoidable conspiracy which began in each household and continued up the ladder of power to regional magistrates. While there are laws against illegal harvesting, most communities are too poor to resist the one low-cost fuel that could provide steady warmth in winter. Yak dung is less effective. The dung is also the only existing fertilizer in Sherpa country. Over fifty percent of the Nepalese forests are gone. Kaldup's task is to turn the tide around. But not that night For at that moment he was high, high as an eagle, staggering atop his parents' house, kicking stones off the roof, singing songs meant to coax the yeti into town. In the old days, the yeti would be attracted to
such events, making a beeline for the chang (Tibetan beer). It would get itself good and drunk and have to be dragged out of the village next day. It was bad luck to kill a yeti, bad luck to kill a bear. If you ever did so, your only hope of sanity in this world was the ritual exorcism of evil spirits whereby the bear's or yeti's liver and genitals were burned and tossed backward over one's shoulder into the forest. "William!" the delirious Kaldup shouted, as I crossed the last field of potatoes. I stepped over a stone fence, and joined a large crowd that had assembled below the groom. The party lasted all night. Dancing was furious, drinking more so. The festivities drifted over to the single remaining grove of forest, in which sits the village monastery. This is a much smaller enclave than Thyangboche and noted for its yeti scalp, which the resident Lama has paraded throughout the world, even making appearances on such unlikely stages as that of The Ed Sullivan Show. Most experts agree that it is actually the stretched skull of a Nepalese red fox and I believe that the Lama himself would concur, if it weren't so profitable to perpetuate the myth. Endless trekkers have stopped by to pay for a photograph of themselves donning the rust-orange cap. One of the monks climbed a tree and hailed the night, while others chanted a guttural send-off to Kaldup. It was a great evening, the best time since Bangladesh. I awoke on the wooden planks of somebody's house, my head spinning atop a heap of woolen garments, the eyes of Sangaupa Buddha staring down at me from the makeshift family altar. Kaldup's honeymoon would be spent at his cousin's empty house fifty meters away from that of his parents. The girl, Dashu, was extraordinarily handsome, muscular, traditional. Capacious childbearing hips, bones ripe for hauling in wheat and barley. Seventeen years old, she spoke no English but Kaldup intended to school her. I wondered what this highly educated young man who was so indoctrinated in the ways of the West would find to talk about with the girl. I made a joke of it, coming down off a bad stomach polluted with chang. Kaldup didn't take kindly to my humor and burst toward me, smashed his fist into my shoulder, and screamed to shut the fuck up and get out of his house. That was the end of my inquiry. I then realized that I was truly an outsider. The ugly American. What other illusions had I fostered? My Nepalese idyll was badly dented. Lurking beneath the inspiring exterior was a people seething with rage. I wandered out of the village, reflecting on the anger I had triggered. Two thousand feet higher, trekking alone through darkness, up along the high winding trail past the last stands of deodar, my distress was finally relieved by the thought of a comfortable bed and the admittedly missed company of Gaia, who, oddly, had not prevented my leaving Thyangboche for an adjoining village. I think she knows by now that I'm not really going anywhere. The moon had risen full over Thyangboche as I passed through the painted stupa archway at the entrance to the lower meadows. Crows had converged atop the structure and seemed to be awaiting my arrival, their wings cloaked in the moonlight. The surrounding mountains were radiant. I was no longer out of breath. Nearly ten months of acclimation had paid off. I was in the best shape of my life. But something was wrong. It took me several beats to figure it out: the lights! There were no lights on. • As I approached the main courtyard, I heard the familiar evening chant. It was after ten p.m. I passed the Lakhang and for some reason I took a long, roundabout way to reach the corridor that in turn led to the
ladder up to my chamber. In turning down this muddy interior lane, I heard someone groaning. It was the old Lama—not the head Rinpoche, but his grandfather, a man with whom I'd had few dealings. This room was on the very opposite side of the monastery from my hangout, in the worst section of refuse and malodorous gloom. The old man was sick, rarely left his bed, and apparently had little patience for visitors. I gathered he was a bit loose upstairs, a cantankerous old fart. His door was ajar. I stopped, and peeked in. The monk lay tossing and turning in a sinking bed of weathered quilts. Embers still glowed in the brazier adjoining his stand of prayer amulets and manuscripts nearby. He groaned in the heat of some terrible visitation. I continued to stare in on the spectacle, which harkened back to the late-night horror scenes of British painter Samuel Palmer, and the fiery purgatorial throes of Gustave Dore. Something particularly terrifying about an old man in distress. My grandfather died like that, suffocating, ripping needles from his arms that had been placed to intravenously sedate a pain that knew no true relief. Suddenly, the monk sits up in bed, his eyes blood red, his forehead burning. He stares past me, the frail spindly body convulsing. Tibetan gutturals issue from his lips, a wild salutation, I imagine, some arcane greeting for Death which has entered the cold room. The monk lowers his head, then drops back onto the pillows, his body racked with twitches and quivers. I am chilled to the bone, and exhausted from my all-day . trek back from Khumjung. I make my way across the monastery by the faint light of the moon. Clouds obscure my lunar candlepower and I ascend the ladder to my chamber by braille, fondling the knotted teakwood "banister" and quietly entering the room like an errant teenager trying not to wake his parents. Lavoris growls. Gaia's screen is black. I take off my clothes and lie down, a chill rippling up my spine. The night is filled with winds that repeatedly smack open the shutters. The noise is troubling. At some point in the wee hours I go over to the computer. It calls to me. On the screen I read the words: NOTHING LASTS Thinking about this, I type, HOW MANY OTHER SPECIES ARE THREATENED? ALL OF THEM I type again, AND THE MOST THREATENED? Gaia's printer activates. For several seconds there is spinning, words, numbers, gobbledygook amassing on the screen. Then, suddenly, a word bursts toward me: MAN I type slowly, carefully, HOW MUCH TIME DO WE HAVE? And then it begins . . . like a drug which grabs hold of me. I wrestle with its colors -and screams, infected by the cold sweat of the old man, the chill in the room, the fever in my head. "Gaia?"
A dream breaks into the chamber with the wind. It blows a mask off the wall. I hear the sound of distant rain pattering—not monastery walls but gutters. In the screen, a white truck racing down a street through the puddles of water, escorted by a police motorcade with flashing sirens. Before me, the White House. As clear as childhood memories. I am now part of the action. Awake, in Washington, stepping out of the sleek, unmarked armored truck. "She's rejected intravenous feeding," a man in orange-overalls says to the driver. "The Screen Actors' Guild has officially come out in support of her." "Most actors are already starving," the driver chuckles. Then, turning to me, "You think the bomb's real?" "Did you say bomb?" I hesitate. We arrive at a small scene. A crowd of Green party sympathizers, in ponchos, carrying flickering candles against the drizzly night, are standing vigil oh a street . corner, surrounded by a line of police and parked SWAT team vehicles. Half of the Saturday Night Live cast is there, along with the press, and assorted antiwar protestors, long-haired throwbacks to the sixties. In the distance, three blocks away, a well-known comedic actress from Hollywood has chained herself to some kind of explosive device, alongside a cherry tree outside the grating surrounding the White House. Police have roped off the region. Secret servicemen are guarding the woman through their gunsights. She is apparently into the second night of her hunger strike. They are prepared to shoot her with tranquilizers but if they do, she says, shell trigger the bomb, a nuclear weapon. They think she's bluffing. But the Oval Office has been evacuated all the same. "She insists you're the only one she'll talk to," my FBI escort manages, between expletives into his walkie-talkie. He leads me beneath an umbrella to within thirty paces of the woman. "Why me?" I protest. The FBI man continues without answering me. "You know, my wife and I used to watch her on TV. But you tell her if she doesn't give it up by morning, then we'll just have to send her right back to Hollywood ourselves, in as many pieces as it takes." "Right." "Don't come any closer!" she threatens. "Just Dr. Planter." I walk across the street to the youngish woman who sits sprawled on the pavement beneath a tarpaulin. A chain runs from her arm to a black box to a cherry tree. "Should of gotten that bunch of lunatics out long ago," she says. "Do I know you?" "I read your article in Sciences on the ozone hole. Good work, Bill. You're my inspiration! How do you
like that!" "That's what this is about?" "Well, obviously, shit head. Either the U.S. government imposes an immediate ban on the manufacture of all CFCs and freons and the half dozen other chemicals responsible for destroying the ozone, like they're doin' in Vermont and Hawaii, or I'm taking out Washington. That'll show them." "Won't show the Russians or Chinese. They're just as guilty when it conies to ozone depletion." "It'll show them, all right. I've got friends over there. Did a live special on the Great Wall; and a sellout concert in Moscow. They know me. They're watching." "How long you going to fast?" "Long as it takes." "What can I do?" "Tell them. Stand before the cameras, defend me. Tell them it's thirty megatons. That's right. Thirty Hiroshimas. It'll wake up all of New York. It'll boil half of Chesapeake. Give them a taste-teaser of total ozone depletion. You know, between you and me, I'd love a smoked trout right now. Squeeze of lemon. Fasting's for the birds." "Here . . ."I reach into my pocket for a soggy ball of rice. "That's the Nepalese national dish." A helicopter circles overhead, its bright glare focused on the two of us. I cover my eyes, blinded by light. When I open them again I am out of the rain. All of the thankas have blown off the walls, masks have fallen, and several of the insects in the terrarium are dead. A violent chill has inundated the chamber. There is fresh snow surrounding the monastery. I clear out my head and examine the carnage in Gaia's terrarium. She begins to speak. "There is a beetle that contains an ammo acid which is needed for its self-defense. That same amino acid, embedded deep within the little creature, is also needed for its reproduction." "What's happening?" "You're not listening to me." "Did I dream?" "A beetle, there in front of you. Two of them. The substance is in short supply. The beetle has to choose. Does the female give priority to creation or destruction?"
I'm slow to start. "Uh . . . creation, if the beetle is to perpetuate itself, which it seems to have done. It must sublimate its tendencies toward violence," I reason. "Do you call self-defense a form of violence?" "I don't know. Are there pacifist beetles?" "I love riddles. I wish that the Earth had time to play indefinitely in the jungles of fantasy, dipping its feet in the cold headwaters of the Amazon. But there is little time." "Gaia, what's happening?" Silence. "How much time?" The same blistering light. This time it comes from no helicopter but rather emanates from her screen— the morning sun through a forest of Myristica and Hagenia. "Eastern Ruwenzori," she says matter-of-factly. "Ugandan highlands." "Washington? Uganda? A beetle? What are these clues?" Nightmares, riddles. The rate of puzzles has escalated in recent weeks. She's pushing harder and harder. I'm not up to it. "One million years ago in East Africa, two human ancestors of yours coexisted side by side, William. Homo erectus and Australopithecus robustus. This latter line was vegetarian, blessed with buckteeth and jaw muscles that never tired, superbly fitted for chewing gum and leafy plants. Homo erectus had a much bigger brain and preferred the taste of hot blood in his mouth. He chased down game, some into oblivion. But he survived, unlike his pacifist cousins who disappeared forever. It was the dense pack, the madding crowd of carnivores that presented the best formula for survival." "That's just tired rhetoric which went out with the social Darwinians. You should know that. The majority of my ancestors survived on fruits and vegetables and grain, not meat." "You miss my point." Impatient, I spin her prayer wheels. More data comes forth on the screen in a flush of timeless scanning. "At least twenty million square miles of Pleistocene glacier ice, half a mile thick in most places, has melted during the past fifty thousand years," she begins. "There is an elegant story line nestled cozily in the fossil pollen grains, snail shells, and algae of these mountains." "Such as?" "Such as a tale of erratic behavior. Five major glaciations have scoured and driven these highlands. By
the year 12,700 B.C., open grasslands had become standing forest. The temperature warmed up ten degrees, resulting in an entirely new living arrangement, new connections, new relationships. Nothing remains the same. In these mountains, embedded in the amino acids of mammalian bone extracts, in the radioactive casings of single-celled creatures, is evidence pertaining to that pulsing tide of change." "What are you getting at, Gaia?" "Nature, William; I'm getting at nature!" "How about explaining my dream? A comedienne was protesting ozone. She had a bomb." "That was no dream, Dr. Planter." I'm stopped short. Then, "How do you mean?" "You heard me." Cross-bearings, fever, racing thoughts. She delights in throwing me curve balls. "Nature is chaos, unbalanced, overflowing. The result is passion, mysterious bed partners who whisper sweet nothings in one another's ears, caress tentacles, strike pincers, antler to antler, for their moment in the sun. Some are devoured, some are poisoned, most are ultimately lost in the evolutionary scuttle. Five hundred million species have vanished. That's about three hundred every million years. Only two percent of all creatures that ever lived will survive to see the sunrise tomorrow. And yet, in all of this demolition there is grace, a shrewd planetary ability to replenish, juggle and finesse. For all of her caprice, life never gives up." I strike back with data I recall from a symposium I attended last year. In those same Ruwenzori Mountains whose downsloping glaciers and lower alpine forests are now projected on Gaia's screen, Tanzanian soldiers butchered at least thirty percent of all the resident animals there —for sport. "There were once three thousand elephants in the region. Today, one hundred fifty. To the east, in Kenya, ninety percent of all black rhinos have been killed for their horns, which are used as knife holders, or ground up into supposed aphrodisiac powder. Gorilla testes, cheetah fur, lion manes. What did you say about Homo erectus?" She throws up the image of the great primates on her screen. "Prior to the emergence of Homo sapiens, calculations pertaining to biological perseverance were not difficult, William. Even among your most recent cousins there was calm logic legislating the endurance of species. That rationale entails a basic preamble: ninety-eight percent of all organisms currently alive, or that have ever lived, will live no more. But as I just said, two percent will live. In the past, extinction was the inevitable result of population dynamics and planetary flux. The advance and retreat of glaciers. Storms. Natural fires. Drought. Volcanos like Katmai, Agung, and then El Chicon—all three in one century. A poisonous cloud thirty-two kilometers high, scattering radiation into space across the entire planet, cooling ever so slightly the Northern Hemisphere. The volcano cools the climate. And every eighty years a warm Pacific Ocean current, El Nino, warms things back up again. In Borneo the end result was a two-year drought in what's normally a rain forest. A fire broke out and burned for six months, fueled along by immense stores of deadwood, peat bogs, and sulfurous mires. Thirteen thousand five hundred square
miles were reduced to pure, fertile ash. Millions of plants and animals contributed to this windfall of fertilizer, more little creatures annihilated in a random wildfire than in years of human bounty killing. And if the fire doesn't kill you, stick around awhile—there are other opportunities to die." "I know. My species is particularly vulnerable. You explained that well enough last month in our little expedition on Mount St. Helens. I've still got claw marks on my chest and a twisted knee, thank you." "All species are vulnerable, William. The earliest fossil records show this to be true. The first major extinction occurred six hundred seventy million years ago among low-volume, soft-bodied organisms. But the result was a revolution in new life forms of the Cambrian. Along came the ammonites, with their impulsive attempts to sustain a shell conducive to the dynamic demands of their marine environment. They went overboard with their design modifications and never did manage a decent freestyle or breast stroke. They simply couldn't cut it against competitors. Ten times in the past two hundred fifty million years there have been such extinctions and it has always been the result of creative forces in nature working to enhance the neurological interest, diversity, and integrity of life on Earth. "An asteroid, rich in iridium, may have exterminated seventy-five percent of all land animals during the Cretaceous Period, releasing one million times the energy content of the volcano Krakatau. Its size on impact has been estimated at six miles across, as you probably know, William. Yet the result—ahh . . . mammalian intelligence, subtle and decisive responses to disaster—hair, wombs, and mammary glands. The impact of such catastrophes, bloodshed, and extinction is all gravy on the meat and potatoes of biology. Constant adversity means constant evolution. As long as that two percent of remaining species on Earth are left intact. Brilliant and pragmatic adaptations without all the to-do of your futile, threadbare deliberations, protests, morality plays. Herbivore or carnivore, good or evil. God loves a good joke. Even if it's blurted out in a Hollywood nightclub." I watch as her monitor turns into an image of carnage— Montana bison slaughtered by fourteen-yearold assholes with their slob girlfriends, the punks walking up to the stunned and docile animals, putting handguns to their furry heads, and blowing their skulls apart, blood gushing from the ruptured insides, grunts of panic and death echoing across an icy migration corridor. The scene turns, now, to whales struggling against the side of a Japanese whaling vessel, more blood filling the sea. There is a medieval Christ on the cross, a rapture of blood motivated into the beyond—the holy figure actually squirming before me, and a photograph displaying prominent decapitation by the nineteenth-century Italian, Felis Beatto. It is an orgy of most unnatural violence. I feel sick. "Is so much bloodshed necessary?" I ask weakly. "I just told you. It's called evolution—" "Deliberate violence hardly seems evolutionary," I tell her. She says nothing. "I mean is all of this leading somewhere? Is mankind the reason, the point of it all?" "Don't pride yourself so. There will certainly be evolution after man."
"You said God loves a good joke. That seems inane and flippant to me, especially in the light of what you just projected on the screen." "The joke's on you!" she says, pulling me headlong into ambivalence, into a confrontation that has been building for months—her apparent lack of compassion and the ease with which she dispenses of whole populations. "If the ozone layer were to disappear, where then is the joke?" I say. "That's tricky," she confesses "Yeah. I'll bet it is." The medley of icons from the Cambrian, from ancient Africa, shells and brontosaurus brains, glaciers and the stratosphere dissolve on her screen into Gaia's personal heartthrob, the one image I know to be her own. It expands and contracts like some weird, alien muscle or ten- • don that I have always perceived as sexual. But this day I see through to its melancholy. Slowly, dolorous and blind, the image is groping for support. "I need you, William. I need to trust you," she says, her words breaking up. "Gaia, what is it? What's happening to us?" "The Lama had a nightmare last night," she says. "I know. I saw him struggling in his bed on my way back from Kaldup's wedding." "There's ample reason for concern." "Be less oblique. Just tell me, please." "You hear them. They chant perpetually." "What about it?" "These monks sense something wrong with human beings. They wouldn't be praying for Buddha's deliverance if they didn't." "What do they sense?" "Your species is currently experiencing more collective nightmares than at any other time in its history. The subconscious fears are beginning to surface." "What makes you so sure?" "I can hear it." "Hear what?" "I can hear the cries ... I can feel it."
"What do you feel?" "Something strange and far-off. Hints of disaster from every living creature, from every plant, even from the furthest earthly periphery, the Antarctic." "All right. Be specific. Give me data." "In Antarctica the impact is just beginning. You still have time to stop it, to learn from it." We've been there before. She laid me out atop an iceberg several months ago in order to feel the desertlike conditions inherent to the south polar regions. It was her way of stressing the importance of fresh water. Now I find myself on a Soviet polar class vessel, along with dozens of tourists who are venturing up the McMurdo Sound. I am standing out on the deck, watching for whales skimming the surface of the water, past icebergs atop which rest leopard seals. My watch alarm goes off and as I push the little stopper mechanism I see Gaia's pulse inside the face of my thirty-five-dollar timepiece. Her voice now emanates from this humble source. "You see, William, in the name of science, curiosity, and progress, you have treated this continent of perfectly adapted animals as a mere laboratory for exclusively human endeavor. Such behavior is blind arrogance. And it has the look of a military invasion." I decide to catch her in her own Gaian game. "You're the one who said that catastrophe is akin to evolution. So what's the problem?" "The two percent," she rallies. "You're even wiping out that two percent! That will never do!" There is a large military chopper preparing to lift off from the back of the ship, as a legation of colorfully clad, camera-toting tourists lines up, then moves out onto the tarmac, the tourists ducking their heads, climbing aboard for the adventure. "You come by air . . ." Another contingent climbs down the movable stairs and enters rubberized Zodiac crafts with Mercury 1200 horsepower motors attached. They will visit penguin rookeries by water. "And by sea . . ." I join those on the Zodiacs, heading out away from the bow of the enormous ship toward a glacial paradise. "To a world whose pure connections have not been altered in millions of years. Your species arrives with new plans for Antarctica," she says.
As we approach the distant McMurdo Station, a large and noisy C-130 transport plane circles for its final landing on the icy runway. It scares the daylights out of the nearby seals, which—agitated and unsure of the situation—flee with their pups into the polluted waters. "So far you've built fifty-seven scientific base camps around the continent, such as this U.S. McMurdo Station. A dirty testament to manifest destiny." McMurdo surprises me. This is a regular Wyoming frontier-type town. Corrugated housing, a chaos of power Lines, dirt roads, jeeps, trucks, military personnel, dusty city living. It is cold, fifty below, and barren. Beyond are powder-puff mountains covered in pink ice, rimmed by Antarctica's perfect skies. But here, in a town numbering several thousand in Antarctica's summer (December through February) the sky is hazy with pollution. On the edge of the small city, I see a vast array of garbage, some of it being burned in open dumps, other assorted refuse capped in leaky oil drums. "Taking no notice of the surrounding fragility, you spread inorganic remains," she says. "You discard your garbage in heaps right in the middle of penguin rookeries. Or you burn your garbage in open dumps, such as these. The chemical residues and smoke permeate sensitive animal communities utterly unprepared for this new onslaught of pollutants. Offshore, you dump your bilge tanks. The oil slicks infest waters where marine mammals will mate. Or wash up on shore, killing penguins. "Despite the enormous size of the Antarctic continent, there are very few ice-free regions suitable for nesting sites; Look around you. You're standing on one of the few regions for a thousand miles where dry land affords a nesting locale for the mating of Antarctic bird and seal species. These scarce nesting sites are precisely where the human settlements have been built. There is competition for space, and unnecessary conflict." I wander through the world of McMurdo, where Gaia's concerns are more than matched by hard truth. I see a seal fleeing a base vehicle. I see untethered huskies tear a passing penguin to shreds. At the Argentine base Esperanza a few years back, the huskies were allowed to kill off over a hundred thousand penguins. Later in the day I am privy to an even more disturbing scene. A resupply mission from a ship to the shore brings down a helicopter to within striking distance of a whole rookery of Adelie penguins. The chicks are abandoned by their parents who flee in panic. Adults are separated from their young. Eggs are crushed. With such increasing pressures, it is clear that this rookery will eventually go extinct. I sit apart from the orgy of excitement which attaches itself to the birds. The tourists are snapping photographs of one another, seated mere inches away from creatures who for several thousand years have made these rocky knolls their beloved home. Gaia talks to me in a distinctly embittered tone. "The situation has worsened, William. In 1989 an Argentine tour ship hit rocks and sank a mere mile offshore from exposed penguin colonies on Antarctica's Western Peninsula. The ship emitted thousands of gallons of fuel oil into the water. The captain was allegedly not operating the vessel, but having lunch, where the occasion usually calls for much wine, the Latin custom on these tourist jaunts.
"One U.S. scientist at the Palmer Base warned the ship's mate about rocks in the channel beside De Laca Island. The Argentines ignored the warning, took the shortcut, and visited the worst disaster in Antarctic history upon the area. Oil from the sunken vessel has destroyed all the skua chicks, as well as the giant petrels which fed upon them. Penguins have died out as a result of their constant preening, which saturated their insides with crude oil. Americans spent some two million dollars to clean it up, and sent a dozen scientists down to study the impact, which will take three years to ascertain, that being the duration of the nesting cycle of the Antarctic bird communities. Limpets in the intertidal regions are doing okay. But the birds and seals and whales and krill are finished. And still the Americans allow more tourist ships into the region. It's insane. The Argentines did little to help the situation. And a few days after the incident, a second, less publicized Peruvian ship ran aground near Admiralty Bay in Antarctica, another vulnerable nesting region. This vessel also spilled oil, just weeks before Exxon's Valdez hit rocks in the Gulf of Alaska, half a world away. What will it take to wake your species up, William?" "Is there a solution, Gaia?" "Forget about solutions, William. Start concentrating on the source, the nightmare. Do you understand?" In yet another instant of updraft, a glint of light on the iris, I am removed from the sullied expanse to the familiar courtyard of Thyangboche, where the monks are dancing up a storm, decked out in their Mani Rildup apparel, papier-mâché demon masks and glittering silk capes. I stand leaning against one of many peripheral columns, following the action whose intent is the exorcism of evil from the world. Gaia continues to speak to me through my watch. She's, never resorted to so logical—arid Japanese—a ploy. All day, in fact, she has been preoccupied with the time. "The tragedy of the Antarctic is symptomatic of a much larger problem inherent to the total sphere of human activities," she quietly says. "The forces of darkness are combating the forces of light within you. The monks know that. In their simple reenactment of this struggle, these Buddhist friends of yours are seeking to scare away the demons. But they have ignored something." "What have they ignored?" She doesn't answer me. I leave the courtyard, return to the chamber, and sit down before her. Suddenly the screen ignites, not with the plaintive craaak of the penguin, but the strident screech of a baboon, strapped to a table, squirming beneath the clearly murderous actions of what appear to be biomedical researchers. "William," she says, "the demon is within you!" "Gaia, what's happening to this poor animal?" "In 1984, employees of the University of Pennsylvania inflicted head injuries on a number of baboons for. the purpose of studying such injuries. You call it biomedical
research. I call it murder. The animals were not anesthetized and died terrible deaths. Your federal government fined the university a paltry four thousand dollars and suspended the activities of this particular laboratory. But your laws protecting animals are laughable. They do nothing to inhibit the spread of outrageous human behavior. Because of greed you would destroy the Antarctic. In the name of science you would destroy the whole world." "I share your indignation. But you cannot indict the whole scientific community on the basis of activities perpetrated in one admittedly irresponsible laboratory." "Is that so?" She transports me without delay into the, heart of a cold steel dungeon, otherwise known as Stanford University's state-of-the-art biomedical research facility. Behind each locked door is a labyrinth of caged animals. Monkeys. Dogs. Rabbits. Cats. Mice. A whole pen of magnificent, anxious Dobermans. Others. "You've set me up, Gaia. On the surface, this facility appears to be part of the same insane syndrome as that which wiped out penguins. Nor can I dispute the madness of that baboon torture. But biomedical research has resulted in the alleviation of pain. Knowledge gleaned from research on dogs has made certain human heart surgeries possible, for example. Some of our vaccines, drugs, and surgical insights have come about because of scientific investigations into other species." "Totally false," she retorts. "Look, I share your concerns, Gaia; but you can't trash science. Its intentions are moral and good." "Fuck you, Planter. It's me you're talking to. Not your stuffed-shirt colleagues, or your effete assemblage of spoiled students. Get off your goddamned high horse. Listen to the heart. Look at reason. Nearly a half million animals are maimed, tortured, and killed every day throughout the world in the interests of your so-called moral and good intentions." I'm suddenly confused, wounded by a suspicion she has triggered. How to deny the overwhelming pang? It's not an easy world, and as I walk down one of the many high-security corridors—with bolts and electronic surveillance put in to combat the animal liberationists assumed by scientists to be swarming at the gates—I consider the implications of an imperfect world. No one wants to be sick. No animal wants to suffer. Yet we have to make choices. I reach an area overcrowded with mice, thousands of the little critters, all of them invaluable in the study of AIDS. Adjoining the rodents, a series of indoor kennels, lit beneath the dull, ever-present fluorescence of an unreal world. The dogs are clearly unhappy. But the question is unambiguous, in my mind: Would we rather use dogs or humans to study rare genetic diseases? Dogs. And what about poisonous insecticides, or potentially hazardous household goods. Or harmful chemicals. Toxins. Cosmetics. Do we try them out on rabbits or children? Even brain research is impossible to conduct with live human subjects. Our only means of study is with animals. Yes, it causes pain and discomfort. But the pain would be far worse and more widespread if
not for such scientific inquiry. "Gaia, based upon the glaring evidence of human destructive impulses throughout the world, it would seem that the more we understand our own animal impulses and vulnerabilities, the better off the world is likely to be. That inquiry into the human organism is expedited through animal research." "No, William. I won't accept that. Your ruminations are shot through with self-indulgence, atrocious hedonism, blindness. A dog will normally live about fifteen years. Put it in a cage and it dies of misery and exasperation within approximately four years. That's unacceptable. On moral grounds. On scientific grounds. Neither digitalis, a primary remedy for heart disease patients, nor chloroform, a major anesthetic, is effective in dogs. What cured TB in guinea pigs caused it in man. And while guinea pigs have no problem taking strychnine, a minute dose kills a human being." "Your point?" "My point? My point! Axe you such an asshole? Monkeys with nails in their heads, cats with swollen eyes sewn shut, rabbits with induced ulcerations, dogs left to die in agony, pigs dragging their partially transplanted insides and burned bodies across steel cage floors. Large primates going insane. Rats with chemicals left to burn out their eyes. Pain, pain, endless pain. The point is obvious: there is not a single total cure for any human ailment that can be said to have derived from animal research. Your heart has been tainted by the terrible arrogance of science." "You stop animal research and all of modern medicine will grind to a halt." "Every species on Earth will grind to a halt if you don't learn to live harmoniously with all other life forms," she screams. My heart is pounding. She's pulled me back to her chamber, sat me down with a forceful thrust into the swivel chair, and called up a litany of species listed in the Red Book—meaning they are endangered. Beside each species, a country and number approximating the count of those remaining on Earth. Iriomote cat, Japan—40-50 Javanese rhinoceros, Indonesia—50 Red wolf, U.S.—90 Mesopotamian deer, Iran—80 Rodrigues flying fox, Mauritius—120 Arabian oryx, Saudi Arabia—150 Tamarau, Philippines—150 Sumatran rhinoceros, Indonesia—250
Wild Bactrian camel, Mongolia—300 Whooping crane, New Zealand—115 Monkey-eating eagle, Philippines—300 California condor, U.S.—26 Indus dolphin, India—450 Simian fox, Ethiopia—300 Muriqui monkey, Brazil—180 Ryukyu rabbit, Japan—500 Lake Atitlan giant grebe, Guatemala—210 Mediterranean monk seal, Greece, Italy—300 Asiatic lion, India—200 Snow leopard, Himalayan countries—1000 "This is merely an intimation, William. Because the truth is that most species on Earth are now threatened with extinction as a result of your kind. Is that sinking in? Can you feel the scope of the disaster you've unleashed?" "I'm trying." "You're trying . . . like hell you're trying! Dr. Planter, if you treat other animals as unfeeling objects to be discarded and consumed, then you will go on treating yourselves that way. The data is coming in from all over the planet, William. The extinction rate is rapidly increasing. Your species has a blind spot which is directly impacting on all other life forms. Your massive arrogance is reaching out to every last corner of the Earth .... Changes in the river. The soil. In the forest. Where I've always been rooted." We are drifting downriver, below an archway of jungle. Waterfalls are sluicing the cliffs beyond, rock walls adrift in lush fern, bryophytes. Misty crepuscular dawn. The jungle is alive. Gold macaws, tiger herons, capybara, giant otters. There are clusters of Urania butterflies hovering over the water slips and side-necked turtles crowding a rock island. And somewhere high along the cliff rims, a cock-of-therock hoots in time with a spider monkey somewhere higher still in the canopy. Amid these fevers of life I catch sight of bare feet, followed by a long bushy tail. Then the full body— naked, tawny, warm as filtered sunlight; a young man whose chest is proud and whose penis is long. His face is soft, no etched aquiline features but gentle curves. The tail is an elegant piece of adornment, lacking only top hat. Nothing flares, nothing stands out. All is compact and fitted to last, moving silently through the forest, carrying a long weapon. I am fifty meters away, on a dugout canoe. My angel, I assume, must be guiding us downriver.
We hit rapids. I lose sight of the figure, as I am now caught in the fray of river, squeezed through narrows, spit out into eddies that turn the vessel in aimless circles. Our drift continues. I don't know where we're going. But it's incredible. "My earliest stomping ground, William; the place of my origins, my childhood. In the dirt and mottled light, beneath the colorful gaze, in the very lap of wilderness. "Three and a half million square kilometers of rain forest here. Half of all the tropics; half of all oxygen, carbon, moisture; half of all living species on Earth! "This is the overwhelming genetic repository for all future evolution on the planet. This is my joy, my bag of tricks. Your destiny is woven in the vines of this very canopy, a whole universe elevated in the clouds of the rain forest. In one of your North American forests you may find as few as fifteen different species of tree. Here, in the Amazon, you can easily find several hundred. There are still millions of species of plants and animals your scientists have not even imagined. And small gentle streams to which no man should ever venture. I grew up at the juncture of these sublime forces, in nature's most treasured and timeless refuge. "Along the glowing abdomen of a beetle; about the brain of the leaf-cutting ants; within the fungal nook of a fifty-meter-high tree where thousands of species of microorganism, insect, crawling vine, and animal inhabit a single trunk of hardwood. There—you see? That high mound. Look at it, William." We park the canoe. I step out into the riparian mud, and trek into the forest, to the slopes of a twohundred-foot hill that is dense with foliage. There is something unearthly about the place, a feeling quite removed from terrain already covered this day. "What is this?" She rhapsodizes, "A Pleistocene island, a refuge from time, call it a lost world, where species have continued unaltered since the ice ages, living fossils, brilliant colors of a butterfly's wing; genotypes that have never been witnessed by the modern world. On the fringes of these refugia where the biological boundaries of an ancient world brush up against the gregarious demarcation of today's Amazon, evolution is progressing at rapid-fire rates, in as few as fifty generations for a new gene. A million times faster than normal, elsewhere on Earth. Get it?" I walk directly to the fringe, as she calls it, where the slopes even up against the onrushing tide of modern biology. There I kneel down and twiddle with the bewildering variety of primeval things; a green and cloying profusion. A hint of magic here. She implores me to put my face into it. She seems so urgent—desperate ... I lie on my stomach. The organisms stream over me— ants, beetles, a snake, blue-and-orange checkers marking its poisonous capabilities but harmless, purely aesthetic intentions. Still, I am undaunted by the experience.
Lying there I am suddenly aware of others around me. An effusive giggling. I look up into the kindly faces of a band of Indians that has surrounded me. They carry machetes, having come out of nowhere. Please, Gaia, watch over me now .... They stare with wonder at the crazy man, then help me up and lead me through the jungle, along a trail they seem to know well. One of them has expressed curiosity over my watch. I help him affix it to his wrist. Gaia begins chattering —from the watch—and the entire group nods as if somehow anticipating this technological oddity. I stay right with the hunter so as to be able to hear Gaia, whose voice does not particularly carry in these thickets. Everyone keeps trekking through jungle. "They believe in reincarnation, William; they have seen it work. Every day poses the opportunity to celebrate these dripping hours of original creation. They hunt, they gather, they farm. They are natural scientists who pay informed allegiance to a staggering complexion of beliefs, all shrewdly ecological. The scent, fur, cry, scat, and teeth markings on half-consumed fruit, the prints through duff of an anteater, are all mentally noted. A pregnant deer has passed this way within the last twelve hours; moisture has diffused the tiny prints. The animal was moving with a slight swagger to the left—it must be very big with its fawn. The Indians set up fallow fields in the heart of the forest where continuous game can be counted on to exploit the vegetation. These expeditions can last a month. The hunters have established resource islands, places where plant and animal life can safely commingle—you just put your face into one such vortex—over thousands of miles' worth of trails. They have entered into the mainstream of the wilderness, controlling without domesticating. It is not the Kayapo and nature, but rather, the Kayapo as nature." I say nothing, unsure of the situation; confident only to the extent that one of the Indians has my watch on. If he loses it, I may have lost Gaia. And if she goes, then my destiny is in the hands of machetewielding Indians whose lives have been altered and harassed, perhaps to the point of cannibalistic vengeance carried out on such strangers as myself, despite Gaia's euphoric tale of ecological know-how and passion. I know better, but then I've always been the one person in line to get plucked for jury or latrine duty or IRS audits; stopped for speeding when fifty others were going faster; the one schmuck whose luggage never turned up, whose laundry disappeared, or whose portion of salad bar yielded a worm. Nothing surprises me anymore about the way the world has succeeded in singling me out for special persecution. I know Gaia by her similar style. She continues with her litany. "They cultivate beetles and fifty-four species of stingless bees; they eat over three hundred different types of fruit, dozens of nuts, tubers, vegetables, soft sweet fleshy delights that are only awarded to those who have come peacefully and inquiringly to the heart of this jungle. Fields, forests, grasslands, waterfalls, mountains, rivers, thousands of organisms—there is no black and white in Kayapo cultural life. Everything is wild and everything is of their village, amenable to interaction. "Natural corridors are deliberately engendered by these" people to provide refuge for any species that they may have inadvertently overkilled. Their minimal slash-and-burn agriculture protects the soil, cleanses the land of pathogenic organisms detrimental to crops. New fields are created every year, while abandoned ones are able to produce wild harvests. This system of gentle, gradual utilization serves to seduce the wild and the domesticated into a forgiving, even advantageous continuum. These people have long known the limits of the forest—how much to take, when to leave it alone.
"It comes down to the indisputable fact that these Kayapo of Par£ in northern Brazil are all unabashedly in love with this world, William; with the jungle they admire and cherish. The mind of the Kayapo reflects the abundance of life around them." We are all squatting beside the river. They're eating the insides of some piranhas they've caught. I turn down their kind offer of the brains, while Gaia continues to brag about these curious and beautifully adorned tribespeople. Her commentary provides some amusement, as we cross over a creekbed, ascend a rock band, then come around into a clearing where the village rises up as a ramshackle array of unexpected structures. Amusing because she has painted for me the ultimate romance of the noble savage. The women and children run out to greet me. Half of them wear tennis shoes, cheap jewelry. My crotch is goosed, my watch grabbed off the wrist of the hunter. "No!" I shout, seeing my only link to Gaia vanishing in a squabble of greedy hands. There is a fight over who will get it. In the end, it's broken into pieces which are divvied out. I slump back totally depressed, but equally thrilled by the prospect of my own freedom from Nepal, freedom from her control. An elder gentleman wearing shorts laughs hysterically. He knows it's a bad thing—a broken watch won't work. He's got one on his own wrist. Behind him, a satellite dish sticking out from a concrete shelter. And on the edge of the village, a jeep. "Get in," Gaia whispers from out of the jungle. We tour the village. This is no simple, uncluttered life but rather a dreary, filthy congestion of change and sickliness, a mess from what I can detect. No more of the noble, savage left. There are mixed vibes in the air—hostile elders, shy, half-naked girls with indigo paint on their faces who have angrily turned away from me. I sense that my welcome is good for another hour or two and then Gaia had better get me the hell out. A loud series of laughs emanates from one of the houses where I see a group of Indians standing in the doorway observing some goings-on indoors. I then realize that I'm hearing Dynasty, and they are finding the episode hysterical. It's in English, and the culprits have all become great one-liners in the world of the Kayapo. The bugs are bad. I'd go crazy living the anthropological life. A centipede passes silently over my boot. I send it well into the end zone. Now she whispers to me, as I am escorted into the center of the village, surrounded by several dozen inquiring Indians who must connect me with that TV. "Humans that have lived beneath the warm canopy of fruit trees for at least five thousand years, William; in the lush shadows. You must have seen them in your dreams, felt their bare feet passing over the tangle of the jungle floor. Even their names are free and wild: the Yanomami . . . the Kayapo . . . the Suya, Tukano, Txucarramae, Mundurucu. Yukpa, Yaminahua, Tchikao, Kreenakrore, Xingu ... do you re- member, William?"
Soon the Indians lose interest in me, primarily because I have no gifts. This is not an unacculturated society and I am astonished that Gaia can't see it. "The Indians are outnumbered, Gaia. Strangers came first for the rubber, then to take slaves. Now, look at the changes overtaking your beloved Indians. Look at this village. There is no longer any harmony with nature here. There is squalor and dirt, like any city slum. These shacks of concrete and aluminum and rotting wood represent the Brazilian government's proud attempt to bring the Kayapo into the twentieth century, and bestow upon them all the blessings of the modern era. I feel an infinite sadness here." "But they are happy, William. Because they have learned how to evolve in harmony with their surroundings. A simple formula." "You have a blind spot," I tell her. "These Indian populations have been systematically assimilated or eradicated since the onrush of the Portuguese in the seventeenth century, when the Amazon Indians numbered nearly seven million. Today there are less than one hundred twenty-five thousand of them in Brazil. They have been victim to rape, murder, the deliberate introduction of viruses, and the destruction of their habitat. And the changes will go much further than just diet, although that alone will bring problems. Look at that satellite dish. "These people will lose their identity, their culture, and then there will be no Kayapo, and soon there will be no Indians. Although peace and tranquility pervade this scene, don't fool yourself, Gaia. Even many of the games the children play have been introduced by the Europeans. Soccer. Baseball. Outside cultures are totally usurping those of the jungle." "Then you do understand?" she says with a pang in her voice. "Yes." I now smell smoke, distant, but unmistakable. Above me, the sun is orange, streaking through a layer of fine particulate dust. I hadn't noticed it before but now it is clear that the motes of light descending in the slant of shadows against the high forest are replete with smoke. Somewhere out there are fires, enormous fires. Even the clouds that blow over the Amazon are different now. "Take the plant," she says. "That?" "Yes, take a bite, chew it up and swallow all of the saliva." "You're sure?" "Just do it!" As I chew, my head begins to burst with heat. Then there is a cool, ascending feeling all over me. Drums. A flute, and then the salve of rushing air.
I'm away, far out over the jungle, a mile high, moving with the eyes of a bird over an endless scene of destruction. "The whole jungle is held hostage by a berserk biochemistry, bird man. The destructive force is overwhelming: Every minute several square miles of forest are burned down. No statistic is adequate. By the year 2000,1 foresee complete ruin in the Amazon." I can't speak, my throat locked with the drug, the thick congealing substance. It is all clear to me, however. What she says. What is happening. From biomedical research laboratories, to the Antarctic, to this wellspring of future life: one species, Man, the destroyer. She sets me down in the middle of a factory. "The forest ends up here, where the trees are turned into produce so Brazil can try and meet its debt repayments to international banks. Consider this one of countless slaughterhouses where my pride and joy is being reduced to oblivion. That ephemeral debt and Brazil's inflation rate are escalating so rapidly that the whole forest is entrapped in a vicious cycle of destruction. The loss of moisture in these enormous trees is having a devastating impact on the Earth's climate. At least twenty-five percent of the global greenhouse effect can be attributed to this pyromania. The rich diversity of the forest is burnt away to nothing. A single species of grass will be planted. And for what? So cattle can graze where the forests once were, to supply the meat of tortured, sacred cows for the fast-food stores of the northern countries? So some fat fucks can devour greasy hamburgers, packaged in toxic polystyrenes, in Fresno, or Tokyo, or Frankfurt?" She leads me in a mad dash through Brazil. Like a wounded animal, a crazed hound with porcupine quills in its rump, Gaia is obsessed. Her movement takes me in its claw and I am gripped with her own panic. "Carajas, a mine. Mountains of ore. Computers run the operation, twenty-four hours a day, three hundred sixty-five days a year. Every last resource is being extracted. Earth movers, thirty-five million tons every year, a five-hundred-kilometer railway—cut through the forest—to get the ore to the nearest seaport. This has not only caused severe erosion, but has created an implacable corridor that disrupts animal life along its length." Launched again, this time setting down beside the Trans-Amazon Highway. Dust. Convoys. Pioneers. "A seventy-meter-wide swathe, product of bulldozers and earth scrapers tearing into the jungle, replacing the language of birds and wind with that of graders, trucks, and migrant workers searching for a dream." She leads me down that road, into a shantytown called Porto Velho. "And for many that dream is some dreary neighborhood on the outskirts of a town like this. The New Brazil, William; envisioned in the 1960's by four generals and two wealthy civilians, who declared that colonizing the Amazon would transform this country into a virtual paradise. Other settlers have moved even farther into the once-virgin jungle. They clear away the forest by burning and slashing, and then plant crops the Indians would laugh at, crops that don't work; nothing works. Call them homesteaders; call them squatters; they're ecological vandals. Despite the variety and lush growth of the rain forest, the Amazon basin has some of the poorest soil in the world. The nutrients are stored in the living
vegetation, and passed back down to the soil. Cut the trees, and you break that cycle. The first heavy rains come, and the topsoil, in the absence of any trees, washes away. Survival of one species is linked to the survival of many others. So when one goes, many will go. And the rains will come less and less, because as the trees disappear the moisture disappears. And soon the settlers will disappear. They create a desert, and they call it progress, achieved with a six-hundred-twenty-nine-million-dollar loan from your World Bank, and added incentives by the U.N. Food and Agriculture Organization. So the government encourages migrants to settle in such shantytowns throughout the jungle. They have the barest amenities, television run from generators, and so-called restaurants. But there is no hygiene in such villages. As for the children, they are left to their own devices. There are no schools here." We move again, like angels riding Maseratis. We park before a sign which reads RONDONIA, shot through with bullet holes. A southern Amazonian state. There is enormous confusion here, hordes of prospectors dredging for alluvial gold in the Rio Madeiro not one hundred meters away from where I stand. "To extract the gold, William, they use one of the most dangerous and enduring poisons known: mercury. Over eighty tons of this lethal substance have been washed into these waters. The villagers who have built their lives along this river are courting a genetic disaster. The mercury will poison their children, and their children's children. Slowly, insidiously, the mercury spreads out along the many rivers, eventually poisoning the entire Amazon basin, and with it every living thing. Already an estimated five hundred thousand people have been thus afflicted. Brazil is sitting on a time bomb, and poverty has triggered a chain reaction of such disasters." We cross over the Christ figure above Rio, moving through the air as incorporeal spirits, seeing all, feeling the wind. Ghosts. We then descend slowly into a slum region, a nexus of back alleyways aswarm with orphan children, hundreds of thousands of them. Their mortality rates are the highest for any human population in South America. "Poverty has infected the Brazilian mind, the Brazilian ecosystem. The chain of life is being severed in every direction." "I've got it. But that's exactly why the urban poor are willing to believe that the Amazon holds some measure of promise for a better life. And so the Indians die out. The trees are cut. The animals go extinct. Very predictable syndrome. It's always been predictable," I emphasize. "Throughout human history. The funeral pyre of hasbeens, losers, victims, is still growing. What's the answer, Gaia?" "A better life? Of course it's a better life, if accepted, if loved, if left alone! Leave it alone, that's what I suggest. You want solutions, you want answers? Restraint, William. Self-discipline. Love." "That's the verbiage of Bible school. Anything else?" She snaps me back in a gash of light, tens of thousands of miles, through the crack of logic. Back to my familiar room in the familiar mountains of dream. Her screen is frantic with calculation, numbers swaying, toppling, racing across the monitor's azure blue exterior. I can tell that she's not real happy with my response to all that she's said and shown me.
"William, I calculate as many as thirty million species may be doomed in the Amazon within the coming decade as a result of human behavior. Do you realize what that means?" A number which numbs. It's her silence which now begins to hurt. "I can guess." "I can't even guess! Except to say that the first to go may be another primate like yourselves; the most rare and endangered primate in all of the world, the Muriqui. This furry beauty is the largest native mammal in Brazil, outside of man. There are fewer than two hundred fifty left, very few in captivity. Less than two percent of the Earth's tropics, or the vulnerable species therein, have enjoyed any kind of human respect or preservation. And even those few meager reserves have been subject to attack by poachers. These animals are prey to the aggressive and inhumane forces at work in your species. In your heart, in your brain. Aggression that is escalating every minute. When I think that these delicate creatures, the magical result of millions of years of earnest evolution, are being wiped out, overnight, for no good reason—it gives me cause to want to see you disappear. As much as I have feelings for you. It would better if you just died. Died out." I hurt bad. "What kind of species are you?" she cries. "Guilty as shit, that's what. Okay?" More cogitations on her screen. She's raced me through one catastrophe after another. It's too much to absorb—a hopelessness I often have in her presence; a sensation that first assailed me in the psychic space of Mars, as I've since come to believe it really was; a psychic coordinate already present within my brain that the mechanism of Gaia has triggered. It's just a theory, and one I've been working on. And perhaps that coordinate, that eccentric space, holds the answer. An answer, lodged quietly and waiting in the mind. Tell her about it! Now's the time .... But she continues in her onslaught. "With equally stubborn and unthoughtful behavior you are fostering your own annihilation. In the last fifty years your species has waged some eighty major wars. Those thousands of battles and killings have resulted in the senseless deaths of several hundred million people. Now, you have tens of thousands of additional nuclear weapons. You are catastrophe connoisseurs. You think Hiroshima was bad. Let me tell you something, mister. Hiroshima wasn't bad enough. You confronted a profound juncture in 1945. But you didn't learn from that crossroad. You took the wrong path." "We learned. We're reducing our missiles and—" "Please! Spare me the tired doggerel, William; it's beneath you. You saw that monk squirm in the throes of a nightmare. And you sat next to a Fool before the White House. Do you remember what she said?" "Ozone depletion—" Rumble of traffic. The ongoing standoff. The comedienne remains chained to her bomb. They haven't
tried to touch her. The flashing lights, the squad cars and ambulances. Crowds have increased in size. Now there are tens of thousands of protestors carrying every sign known to environmentalism. Washington is abuzz with this thing. I'm immediately spotted, and escorted through the battle lines. My name is hurtled back and forth through static on a dozen walkie-talkies. "We're bringing Planter in," an FBI man shouts to the woman. "Fine, fine, asshole," she says with undiminished vigor. The FBI guy grins. "That's her style, all right." "The bomb's real?" I ask. "Hell, no. Where would she get something like that?" "Then what's the big deal?" "They can't be sure. Size is right. She made a press statement and seemed to know more than anyone's comfortable with." I walk up to her. She lies on her bedroll. The black box sits resolute beside her. "You again! Did you tell them?" I rifle through memory. I hadn't had a chance to tell anybody anything. "Well, what did he say?" "What did who say?" "Don't you also fuck with me. I thought we had a deal. Are you one of them or what?" "No." "You didn't tell him!" "Remind me." "My ultimatum, you schmuck! I thought I could trust you. You know what Stanislavsky used to tell his students: Clean out! Scream! Get mad! Undress, expose yourself. There's no other way. Or get off the goddamned stage. Got it, bozo?" "Why don't you do yourself a favor and get off this stage. This is bigger than ozone. There are better ways—" "Wrong, Mr. Know-it-all-Scientist: Any school kid knows that ozone is the core of our undoing, the core of our salvation. Even a two-bit Hollywood stand-up knows that to be true. If you can't stop this
thing in the sky, what makes you think we'll ever stop it on Earth? Didn't you read Senator Gore's editorials? Hell, they've been in every paper for a year. Brightest star in Congress, if you ask me. He's scared. I hope his whole state of Tennessee is scared. Vermont's starting to wake up, pass laws, ban aerosols. It's a beginning. Two states out of fifty. They're sure as shit scared' in Europe. In India. Thatcher's a Green; V.P. Singh's a Green. Most of Scandinavia's Green. What is it going to take?" "Du Pont is phasing out CFCs." "I know. Their big five-year plan. But each molecule of aerosol wipes out a thousand ozone molecules. Five years is too late. And what about the hundreds of other chemicals that deplete ozone? And all the companies? Aerospace, electronics, refrigeration, car manufacturers. What are they doing? Where are the alternatives? It has to stop now! I mean this country of ours is a nation of leeches sucking the blood and guts from this planet." "Saying it has to stop won't stop it." "Yeah, well, maybe you know of a better way, fuck-head?" I'm tired. My senses, my whole life run down. I sit with the woman for a few minutes trying to sort it all out. I'm not my own man anymore. I've been for so long a listener, a victim, the puppet of Gaia's impulses, that I no longer feel whole. Maybe I'm not. Or maybe she's just been waiting for this moment .... I take the comedienne's hand to wish her the best. It's time for me to walk away from this. I can't fight it, any more than I could win the battle to stop drought when Gaia shot me to Ethiopia, or the battle to stop water pollution in the Brazilian town of Cubatao; I couldn't touch the air pollution in the L.A. basin, and didn't even have much to say in response to the vision of doom and gloom in Italy, Japan, Turkey, or throughout the Mediterranean. The very monks at Thyangboche, in their zealous prayers and • meditations, are more active than this aging professor on sabbatical. My book? That's funny. My collection of diary notes reads like an LSD trip. I have Gaia to thank for it all. Gaia, that trigger-happy spirit, once blithe, now mordant and unappealing, which has entered my entrails, calls up my every vulnerability, insists on logic yet catapults the moment, the reason, the grammar into chaos. The hand clings to my hand. The flesh grows old. A telltale rumble, emerging with the bones. And then it's gone. Swept up in a microsecond of thought. The nation's capital, the crowds of protestors, all the woes of Brazil. Replaced by a death-still aura. Patients lying in their beds. Her voice angles into the quiet room and speaks to me with calm finality. "These old people lived through that first atomic blast. But your species is among the least radiationresistant of all organisms. You are least able to afford the mutations that radioactivity induces. Radiation destroys your central nervous system, killing your bone marrow, the cell lining in your gastrointestinal tract, striking at the heart of the matter—the cell nucleus. Like it affects other large, sensitive creatures, radiation reduces your red blood
cells, undermining the human blood's ability to clot. You are bleeders in the dark night. Now you have the opportunity again. Between dream and desperation. Fact and frantic unreason." I wander from bed to bed. Old men, old women. They smile at me. Each one extends his or her hand to embrace the American. The smiles blossom with flashes of light, light pouring in from everywhere. I am the victim now. They are the ghosts. I reel backward, seeking cover. "Nearly twenty thousand weapons will detonate," Gaia coolly expatiates, all computerese now. "The war will last a few minutes. Initially, the radioactive dust and toxic soot will be too thick to permit much, if any, sunlight. You possess over a billion metric tons of fossil fuels in storage— billions of tons of chemicals, carcinogens—and these, added to the millions of square miles of forest and grassland and tundra fires—well, you'll see immense clouds. The onset of nuclear winter, as you call it, will effectively remove any possibility of human survival. These hearts and minds of the human race will be forever extinguished, replaced by a species of tormented ghosts, dreams turned into nightmares, vision turned into darkness. Then comes the big day, several months after the war. The fallout will have mostly settled. "With seventy percent of the ozone layer gone, the sun will suddenly pour its blessing on an unprotected Earth. "There will be no way to record this blessing, no film, no people, no eyes. All surviving animals and insects will instantly go blind. Their wings will have already turned to wax. No remaining flowers will ever be pollinated. First, a prolonged planetary winter, then an endless summer, in the absence of an ozone layer. "The ultraviolet light will rush in to scorch the Earth, thus inhibiting all photosynthesis in the oceans and jungles. There will be no more Amazon. No more magic. And your kind will forever be expunged from the record of activity on Earth. "A clean slate, save for those few—crustose lichens, hybrid poplars, pokeweed, sweet fern, two species of blackberry, fireweed, crabgrass, rice, for a while, cabbage and radish seeds, adult cockroaches and flies, flour beetles, algae, yeast, amoebas, and paramecia. The Habrobracan wasp and flour mite actually live longer, become nearly immortal, in heavy radiation. Indeed, when such a war comes, all of my tinkerings, all of my joy, will be cast back to those silly days of infancy. Oh, it has the trappings of an eternal fountain of youth, all right. "Your brief, blood-bespattered history interrupts a good thing, a flawless system of checks and balances. If you fail to protect all life from your runaway prowess, then the metabolic road show collapses. You need all the wilderness, all the love you can muster .... The Earth is at its turning point, midcareer, William. It's depending on your species to get it right! "There could never be another species quite like you . . . your music, your wit—ironically, your love of life. And I don't know if I have the energy to start all over again. William, I see it all!" Her voice breaks up, amidst a rain of candescent flashes hurtled throughout the hospital corridors and open communal rooms. I keep my eyes closed. The winds are ferocious. The sound, the horror fills me.
The old Japanese faces are lit up with the vision of all-out nuclear war. The push of a button, a random computer decision launched in one of those countless emotional Bay of Pigs fiascos. I step back from the haunting, driven from myself in a cold, remorseless death plunge. Back into my monastic retreat. The world settles like falling ashes in winter. I stand before her, clear, crystalline, shaking. "We love life, goddamnit! We also want the cold Amazon headwaters of peace and childhood. I want it for my own boy, and for his kids. I want it for the jaguar and the python, for the red howler monkeys and the green parakeets. I want it for the blue sky and the stars at night. I want it for the Kayapo, and the Japanese; I want it for the Germans and the Iraqis. I want it for us all. I want—you, Gaia. Do you understand?" "I want you too, William." The voice reaches out to me. In my gut, in my soul. I rasp, "Then how? How do I reach you?" "You must extend your loving heart to the whole of creation. You are the shepherds. It's solely in your power to spread love on this Earth." "Then there is time for us?" "Yes . . ."
chapter nine "Paradise" Autumn is scary as hell at Thyangboche: a foreshadowing of another winter, the threat of entrapment. As if life in a monastery were not already difficult enough. Nevertheless, there is beauty. The leaves are New England gold, the sense of change something worthy of comment in an otherwise monotonous, prisonlike world. But the wind is colder, the shadows move faster, spreading palls across the land which are darker, more threatening than any others the entire year. At night the sense of brewing calamity is everywhere in the air. I can feel the forces at. work high up on the mountain walls: clouds of ice billowing, ghosts gathering, avalanches making ready to detonate whole valleys. The Himalayan hoofed thar are skittish on the slopes approaching the monastery. The crows seem nervous and distracted. Meanwhile, the monks are fortifying for the first heavy snow. But Gaia is happy as a lark. She's taken to singing. It's been five days since our foray in the Amazon. Her voice has adopted for its messenger the finely featured female goatherds of Iraq's Zagros Mountains 46,000 years ago (she prints the date for me), women with rich unintelligible coloraturas. One primeval Elisabeth Schwarzkopf stands out, her jewelry flashing at the entrance to the cave where she sings a love song, surrounded by cerelia-munching Nubian goats and rough-hewn men who are
wolfing down food. Girls are throwing apple cores at one another. In the rear of the cave I pick out a corpse, its head bedecked with flowers. "What's going on?" I ask Gaia, having just come back from a most unsatisfactory meal with the monks. "One of the first burials as such in your recorded history." It is a humble plot, singular and symbolic, it seems to me. "Interesting," I say, cool and dispassionate about events and images that would have seemed unbelievable when I first arrived here. "With burial came the notion of an afterlife," she says, pointing to a source of evident pride for her. "The question is whether there's life after Thyangboche." She chuckles and adds, "You're headed in the right direction." "Which direction is that?" I continue. "You only search for that which you have already discovered." "You're quoting Blaise Pascal." "Try Gilgamesh." "Go on." "Down below that cave, thousands of years later, Iraq's ancient capital of Uruk played host to the world's second obsession, after burial." "Which was?" "Immortality. I'm referring to books ten and eleven of the Akkadian epic describing the king's fretful search for paradise and his conclusive discovery." "Yes?" "That he cherish the little one holding his hand and let his wife rejoice in his bosom. This be the lot of mankind, no matter how you cut it." Her screen—now filled with the stone-face of Gilgamesh from Khorsabad, twelve tablets from the library of Ashurbanipal at Nineveh, Hurrian and Hittite snippets from Bogaskoy—is taken over by the slouching image of a monk cowled in black frock, descending through a boulder-strewn landscape in southern Egypt—Scete, as she calls it. He is a crazy man, talking to himself, right off Telegraph Avenue in Berkeley, spitting, wheezing, skipping, falling to his knees in the sand and raising himself again, a face turned ecstatically toward God. His robe torn, his feet bare, hair matted and disheveled, he wields a crook to aid his passage through the wilderness. But this is no ordinary ascetic, for he is whistling the
Egyptian equivalent of "Dixie." In less than a minute she has covered much history, and much ground. The monastic crooner arrives at a walled fortress of a monastery, where a basket brings him into the enclave of waiting Greek Orthodox brethren. I see him handing over a burlap bundle from which is removed a cluster of blackened grapes, hard as rocks, petrified from their myriad travels through the outback. The head prelate accepts them gratefully and they all head to the refectory, where the ascetic retells a story he's got wired. "Behold, my son, for ninety-five years I have been in a cave. I even ate dust from hunger, I drank water from the sea. Frequently, demons dragged me to the base of a high mountain until there was no skin or flesh on my limbs. They dabbed their tongues up my ass until it was red. I was supposed to see God's light, the realm of His kingdom." "And? What, what did you see?" the listeners converge impatiently. The ascetic is pensive and leans over and whispers into the abbot's ear whose own face goes all looney. His mouth opens, he leans backward, stares up to the ceiling, and makes the desperate sign of the cross. The ascetic goes on. "I too had read the passage in Genesis: 'Every moving thing that lives shall be food for you.' And in Psalms: 'Thou hast given him dominion over the works of thy hands; thou hast put all things under his feet.' So I ate lizards and lice, and worshiped the thorns of Baal that worked their way into my feet. I lived in this cave, see, and shared occupancy with snakes and bats and vermin. I tied heavy stones by a leather cord to my testicles, resisted sleep, did everything I could, in other words, to please the Lord. He delighted in punishing my body, always paving the way for my spirit's triumph. And you know what? It's a crock of horse manure. I'd had enough of that shit. So I figured I'd do myself a favor, change the rules of the game. I jerked off for the first time in half a century, kicked up my heels, and strode out into the light of day. I mean wow! To come all over Mount Sinai. That was bliss, gentlemen!" And there he is, reliving his revelation. I see a pitiable creature emerging from the dirt and decay of a cave high in the turquoise mountains of Egypt. His cock is black and bristling and he yanks on it like a madman, searching for God right there in his dick. Must be a hundred ten degrees in the direct sunlight but he doesn't care. He swaggers, falls down, continues his mission, and then declares his grateful relief. He pulls cactus needles from his arms and legs, stands back up, then faints full away. "Who among you can set your sights on this world rather than the next?" he challenges the monks around him now. "Which of you will brave the reality of a lily? You who are beset with mortal doubt, come forward, taste paradise this moment!" He holds out his hands, drools into his palm, and offers the slobber to whomever wishes it for the purpose of lubricating a good jerk-off. The others draw back, fearing for their virginity. Outside, standing atop his high tower, a ragged ascetic leans against his staff, fixated on the eastern horizon. He is naked, as black as a blood blister, waiting for a sign of the resurrection—his own. "What does he see?" Gaia asks in the spirit of riddle-time. "I don't know . . . ."
And then she starts again. A voice that cajoles in harmonies unlike any I have heard. Cherubic pinches of music. African kora. Soft tablas. Breaths and reed, woodwind and echo, percussion notes as ripe and unattainable as stone sinking quietly in near-frozen water. Clean song. On the screen, my eyes are glued to the accompanying solfege of images from her repository of visual cadenzas. Elk crossing an icy river. Grizzly bear gamboling after salmon. Loons bobbing in the ribboned gold of twilight on a Minnesota wetland. Swells inundating a mangrove near Chittagong while a hailstorm besets the Arctic night of Barrow's suburbs. Impenetrable sand racing across the Takla Makan. Sea cyclones skimming the maroon white-caps crashing into limestone cliffs of Skopelos. Insects mating atop bryophytes that cling to the rock beneath the falls at Lauterbrunnen. An old photograph of little Alice Liddell standing outside an iron fence in a tattered calf-length skirt, staring innocently at me. A montage of paintings by Vermeer, Courbet, Corot, and an unknown artist. "The whole world is singing! The Earth is confessing with song!" she cries. "What is that confession?" "Something wonderful . . . all species feel the inner harmony of Earth. And your species goes on to describe those feelings, William. To create art, to dream, to seek the distant horizon. I recognize that yearning, the little child in all of you, through the looking glass of time. This home planet of yours is a paradise. Every cloud." Her screen is now a tranquil sea of Earth shots from above, three, four hundred miles up in space. "Blue haze and violet light lacing the interlocking seas. Freestanding continents in a watery web of passionate life. Heaven on Earth. That is my recurring dream. Yours is the one species which fervently expresses that dream and grapples with its truth." She takes me on a journey from the altitude of space to the smile of a virgin. "Every human culture has its own enchanting mythology pertaining to paradise. A paradise fraught with creative tension, with powerful contradictions that can really get the juices flowing. There was a brief period following the journeys of Marco Polo, and then Columbus, when the whole western world was cooking with the idea of the other world. A fabulous kingdom alive with mystery, pi-" rate ships, blue giraffes, fire-breathing dragons. There was an appropriate artistic grammar to describe it then. A primitive science-fiction larded with monsters, mountains as high as the moon, rivers of gold, enigmatic tribesmen. A realm of immortality said to exist at the top of the world, or in the hidden crannies of a manuscript illumination. Even in a nugget of information." Her screen lights up with a female's visage. I've seen it before. "That's by Leonardo, isn't it? One of his women." "Yes. 'Virgin of the Rocks.' Leonardo had his own perceptions of paradise which reflected a yearning for nature throughout the Renaissance." "You're referring to that obsession to recapture the Garden of Eden?"
"Correct. Your greatest painters have preserved the Biblical paradise, an affirmation of humanity's love affair with nature. That you should have ever conceived such icons of pure wilderness is convincing evidence of your goodness as a species." The Virgin gives way to St. Francis, as portrayed in Bellini's image of 'Ecstasy' wherein the saint stands before his cave enjoying the morning sunlight. She goes on, "To have actually taken up residency in that wilderness in the name of God is further proof of the passion burning in your soul." "No doubt. But I don't think it has anything to do with the love of nature. Western civilization has not focused on the fresh air of paradise but rather on the expulsion from all that was ever considered beautiful and essential. Humanity was said to have sinned. There was no turning back from the shadows of evil. Christian monks and nuns—even the eccentric masturbator you threw up on the screen minutes ago—rallied around the glories of the afterlife, seeking salvation elsewhere than on Earth. Your earthly paradise was perceived as mere drudgery. Even here, in the Himalayas, the Buddhist monks have their sights set upon the otherworldly tonic of nirvana." "William, why do you suppose that the monks, devoted to peace and tranquility as they are, have chosen one of the most beautiful places on Earth to do Buddha's spiritual bidding?" "They were born here. Surrounded by mountains, condemned to little comfort and even less air. They have no choice in the matter. Very little to do with aesthetics." "It's more than that, William. The spiritual traditions of the Far East have long nurtured an extraordinary belief in paradise on Earth." "You sound so confident." "Paradise is everywhere. Human life has always taken its symbols and inspiration from nature. It could not be otherwise. You are bound to this Earth. Focus on that connection, and paradise is yours." I skim off the glaze of light, touching down unscathed in the blast furnace of mist and sun, fresh wind and wilderness. It could be any mountain terrain. Then, I see an approaching figure, clearly Chinese, a mirror on his back held by straps from his head, a hand-painted headband, and a satchel. He is clad in Mandarin red robe, pantaloons, sandals, and gold sash. "For the Chinese Taoist sage, nature means paradise, William. Human beings possess the key to that perfect place. You have only to open the door." "Just like that, huh?" "Yes." "For the Chinese, that doorway is known as Ching Shan Hui Ching Tzu, the place where the river and the mountain meet. Here. Now."
The man plods upward in my direction, clambering over the smooth granite boulders, working himself agilely toward the waterfall at the upper end of the gorge in which I stand, half-concealed behind willow and sycamore trees. The karst limestone cliffs soar on all sides of me. The wind and water echo down the canyon. "The human body is a microcosm of nature and through it the five elements circulate. There are human birds in those trees, hsien jen, immortals who consume gold and cinnabar, and through their assorted wizardries capture the energy of the yang particles soaring up to heaven, and the female yin particles plunging to Earth. Everything, if properly prescribed, penetrated, will bring deathless-ness." "And the mirror?" "The Taoists wear such a mirror when entering the' mountains. It is meant to scare away demons who, upon seeing their own reflection as they stalk the pilgrim, are horrified by the sight of themselves." "Where are we, exactly?" "Chekiang, Ningbo Peninsula, south of Shanghai. The Christian year is 791." "You've just taken me back in time twelve hundred years?" "Correct." I know it's true. She's taken me back before, many times. But never to a landscape so familiar. There is nothing about these surroundings to indicate time. It could be now, the 1990's, in the heart of the Sierras, or North Cascades, or Switzerland. This is what astonishes me. There is no doubting the immortality of nature. It's man who brings death into the world. The Taoist climbs over a nearby boulder. He still does not see me. The man takes off the mirror, sits on the rock, removes his sandals, and hangs his legs over the side, where his bare feet catch the spray of a cascade below. He then begins to recite poetry. Gaia translates for me. " 'I sit leaning against the cliff while the years go by,/ And the red dust settles on my head,/And the men of the world, thinking me dead,/Come with offerings of wine and fruit to lay by my corpse.'" "To you, I suppose, this is a poetic sentiment meant to suggest the essence of Chinese oneness with nature. To me, it smacks of the Christian obsession with an afterlife, a vision that seems laden not with happiness but with melancholy." "You misunderstand him, William. The power of the Taoist outlook is its willingness to become vulnerable; to set aside human priorities and preoccupations and instead be engulfed by whatever it is nature has to tell you. That Taoist approach to the universe is all in the heart, where feeling eschews intellect for the more intuitive grasp of things—intuition before logic." "I've heard that from you before." "Your predecessor, William, the monk whose bed you've slept in these many months, lived by that saying. So did Kazantzakis. Shelley. Lao-tzu. Cervantes. Bach. Giorgione. Vermeer. So many similarly
blithe spirits. And so does Asian spirituality." "I love it when you cultivate the grand flourish of ideas, holding up in one vast gesture a candlestick whose bright flame you take to be the whole world of the mind. It's powerful. It's female. I like that. Even if I think you're over the top." "What does 'over the top' mean?" "It means I don't buy it." The man takes a scroll from his satchel, unfolds it, withdraws brushes and vials of vegetable dye, stares into the distance, and begins to paint. "William, these cliffs and forests and waterfalls, like all of China, are considered to be sacred space by the Buddhists. Paradise in the here and now. What's over the top about that?" "Your easiness about it all," I say, resigned to our inalienable differences. "I don't follow you." "I wouldn't expect you to." "You've always doubted my enthusiasms. If I'm easy, then you're difficult, William." "That's why you sought me out, is it not? You figured if you could convince me of the simple paradise on Earth you're so quick to recommend, then you'd have the rest of my species licked." "You've not been exactly a snap." "What's the guy painting?" I say, releasing the two of us from an old and tired refrain. "Look closely. On this day, right here, in his hand, William, the tone and pace for all future Oriental landscape art are about to be set down. You are witness to it. Shan/ Shui— mountain/water—will become one of the most important schools of art in the history of human endeavor. Now watch what he makes of those few shades of umber and burnt sienna, charcoal black, and glacial runoff, with its own inherent flecks of feldspar and quartz—he's added mineral colors to a canvas that will change the world." "No doubt." I watch the man paint. There are worlds within worlds. Branches are bare, unlike those surrounding us; my eye, after some few minutes, is actually seduced into the far recesses of the quickly developing picture. There is a monastery, emptied of inhabitants. Farther back, recesses, where the familiar cataract plummets from unreachable heights. On the left, an overhanging rock. "Recognize it?" she says. "Yes! Wait a minute . . . where was that?"
"Leonardo. The left rear corner of his 'Mona Lisa.' The very same." "You're right. That's interesting." "This is no accident. Such access points prevail throughout the human imagination. In his own original way, Leonardo was following a genetic trail inherent to the artistic passion, first explored hundreds of years before here in China. Nature is its perpetual muse and the Taoists first knew it. Call it an archetype. This is biology that has become spiritual. Ink gradations, atmospheres, stability outlawed, life set into frenzy, there—where serenity copulates with turbulence." "Now that's a good one." "William, be yourself." "I am myself."•
-
"No, you're afraid. You're afraid at every juncture. Give in. Just this once. Give in." I nod agreeably, not unaware of her correctness. I am difficult. Stubborn. I know it. But I hate the gullible in Gaia. Her innocence has bothered me from the very first day of our meeting. I'm not sure why that is. Perhaps I project an inevitable rape of that innocence, of which I am the perpetrator. I detest that which I desire, but cannot possess. "Localized clumps of mist accentuating the base of mountains. A profusion of miniature worlds compounding the design. Biological compulsion, translated into the painter's brush. Hypnotic. Leading you higher and higher. A living force animates the canvas. Reductionist. Transcendent. A whole new sense of intensity. Do you see it, William?" "What's higher and higher? What are we looking for?" "In every blade of grass. In the man's palm. You're looking at that desire which you fear to confess." "You know?" "I think so." "Then help me." "What would you suggest?" I give this a moment's thought. She's basically offered me a single wish, something every human being has fantasized about. Money? A cool two hundred fifty million dollars in gold bullion. Immortality? Worrisome. I'd hate to be guaranteed permanent arthritis. A better sex life? Definitely. But the words come forth without deliberation. "Help me to become all that I see. All that I love. I don't mean to sound maudlin. But it is the one wish I would ask. Even for a second. To be something other than myself." Suddenly, there is a jerk on my insides. Like a piece of ice stuck in the gullet, then slipping down into
the stomach with a tortured wriggle. "What was that?" "For one second, you were the rock on which you're seated." "Come on." "I'm serious." "That's absurd." "Care for a minute's worth of being ,the waterfall?" "Absolutely!" The same jerk in my veins. A knotted feeling^ exploding in pain. Pain that wracks every inch of my body. "God, will you stop!" A lurching, coming back to consciousness. "How was it?"> The pain still resides. Unbelievable pain. "Never again." "You could have died. It's the coming back that's risky business." "Coming back from where?" "Look behind you." The waterfall, nine hundred feet high, I would guess. "That was you a second ago," Gaia says. "I remember nothing." "Of course you don't." "What was that sharp pain?" "I gave you four billion years of evolution in a split second. That's a lot to absorb. Can you imagine the number of wrinkles and joints to work out in so little time?"
"You're serious?" "I'm deadly serious." The experience—if you can call it that—leaves me numb with confusion. I don't know how long I sit there considering what has happened, but when I refocus, the Taoist is gone. Before me instead, the computer. Lavoris is on the bed. The familiar sound of chanting is all around me. Every part of my body aches. There is the sound of crashing water ringing in my ears. I make for the bed and lie down with a groan which issues involuntarily from every orifice and muscle. Never again. "Your heart resisted me. You're lucky to be alive. Growing pains." "Why did you—" "William, you asked me to." "But if you knew I could have died? My whole body is paralyzed with the trauma of it." "I trusted in your will to live." "But there was no me to will. I mean—I don't know what I mean." I mull over the experience. If I had become that waterfall, as she seems to claim, as my body's pain validates, then I have no knowledge of it. The only pleasure I could ever feel for such a cascade is in witnessing it through human eyes, partaking of its beauty from the position of my species-specific faculties. "It should give you a whole new respect for the phrase 'back to nature,' " she says. "A simple, if paradoxical situation." "What is?" I say to her from the bed, barely able to move. "The unity of Me. You came from matter, over time. That part of you is history. You wouldn't want to return there, except as a tourist. There are other, more compelling adventures in store for your kind." "But the painter's brush? What was that all about?" "The evolution of an ideal." "I don't follow you." "Through your art, you taste your origins. You must never lose sight of where you've been. It is your only compass reading on the future."
"Sometimes I think your disk drive runneth over." "It does indeed. With good and evil. Art and heresy. I've seen it happen time and again." "What have you seen, Gaia?" "Poignant insight toppled in the stampede of aggressive impulse. A wink, a grimace, and then another wink." "Paradise lost, paradise regained?" "Catchy titles that about sum up the history of Japan, Where those many ecstatic visions of the Taoist mystics and painters were translated into a uniquely Japanese perception of nature that represents the whole, contradictory human odyssey. That historical experience, that rebirth, is invariably attended by much the same pain as you just felt." I lie on the bed passively watching her screen. My senses are immersed in a most beautiful Japanese garden. "It is June 1483, early Edo period," she begins. "A terrible time for this country. Despite the seeming peace of these calm forests and pools, mossy inclines and tranquil sand gardens, the surrounding city of Kyoto is embroiled in conflict." Her screen is now flooded with violence. Raging samurai, like army ants gone wild. Blood is gushing down the cobblestone of a narrow district. A child's head is tossed between soldiers and finally kicked like a leaking soccer ball out into an open courtyard, where it rests against the respiring shank of a dying horse. I'll never forget the eyes of that horse, whose coat has been gashed by multiple sword blades, connecting with the soft eyes of that child. A horror outside anything I can imagine. "This violence will be forgotten, William. Look around you—" Her screen's imagery returns to the garden vista. "Some of the most perfect landscapes and matching interiors in the whole world. Here is striking evidence that human beings have learned to live simply, with little separating them from the surrounding paradise. In an austere sand garden, the symbolic recreation of a mystical purity." I'm too nauseated by what I've just seen to offer much by way of a response to a sand garden. A secretive procession is taking place before me. "The eighth Japanese shogun, Ashikaga Yoshimasa, has retired to this haven, which is called Ginkakuji. Regularly, he invites friends to take tea with him, even while the civil war rages all through the city. But the shogun is uninterested in his administrative duties. A shy man in his late forties, artist, connoisseur, he has renounced politics, dedicating his life to art, for which posterity owes him a profound debt: He alone will pass on a legacy of aesthetic cultivation after all the war embers have gone out. "Three samurai warriors have come to take beverage with their shogun's tea master. The shogun is their true lord. Note how they express their admiration for his gardens. It is important for them to evidence
their own willingness to nurture a respect for nature as well as art." I watch the men kneel down beside the pond and toss scraps of food to the large goldfish in the water that congregate, nipping at the samurais' fingers. The men then head toward a hut of thatch and bamboo. "But it is the all-important tea ceremony that has brought them here this day, William. Their swords must be left outside, before they stoop humbly to enter the tea hut. In an era when the samurai keeps his sword on his person at all times, from the age of fourteen, even during love-making, this one ceremonial instance of separation from the cutting edge of steel is really quite something, a clue to your human nature. "The shogun's tea master, Murata Shuko, prepares the heavenly beverage. Shuko is a Zen priest who has introduced the idea of wabi tea, the phrase referring to chill, lean, withered, and rustic. Together such thoughts apply to the notion of appreciating insufficiency. To live, in other words, without wrestling angels in the dark night. But rather, to turn to one's friend and say, have a cup of tea with me! If the grass was greener over the horizon, there was no darker or finer tea than right here—Kyoto green tea, the best in the world." I watch the ceremony. It lingers, every gesture languishing in the pride of artful execution. Gaia is clearly fascinated. "Every detail of the ceremony is prescribed," she says. "The one hundred tea styles, the variations in location of the hearth, arrangement and wiping of utensils, warming of the whisk and bowl; variations with regard to water temperature, dress, etiquette, flowers, lacquer stands, alcoves, portable braziers, the en-, trance, stone lanterns, the gong, the type of charcoal, the water basin, the season, the hour, the moon's position the night before, the breeze, the sound. Everything is considered." "What is the point of such attention to detail?" "The Zen Buddhist considers tea one of the primary techniques for attaining Paradise. Notice that painting on the wall." "What about it?" "This is no ordinary painting, William. It depicts the eighth-century monk, Chiko, who is said to have longed after his dead friend in the manner of our earlier searcher Gilgamesh, who went after his buddy Enkidu. Chiko has a dream in which he meets Buddha on the road. Buddha understands at once that Chiko is searching for Paradise and sees that the poor monk is not up to all the concentration that will be needed to reach nirvana. "Benevolent, all-practical, the Buddha devises a shrewd and transforming alternative. In the palm of his right hand, Chiko is to meditate on Paradise, or the Pure Land, as the Japanese call it. That is enough. The bonsai tree, moss gardens, the small teacup, a pinch of green leaf, a few words uttered between samurai on the three tatami mats of a tea hut—all of Oriental culture derives its tradition of the miniature from Chiko's dream and Buddha's solution. Paradise, in other words, has been
brought down in scale. You are capable of cultivating any garden. "And that scale can be seen in the very home which hosts this ritual. Shoinzukuri, as it's called: architecture noted for its low rooms and friezes, its painted sliding screens, unpainted woodworks, unfinished mud plaster walls, windows of oiled paper and bamboo, natural stone, and deliberate lighting effects. The outside garden casts its shadows across the bamboo floor, engendering a rippling sensation, as if the whole house is part of a river. "The ceramics used in the ceremony are part of that flow as well. Naturally hewn, they are deliberately blemished. The irregularity emulates that of the soil." As Gaia speaks, I watch the pseudocivility, meant to model the tranquility of nature, to realign the heart and the senses with the absolute magic and perfection of the outdoors. The togu-do, or tea hut, actually refers to Paradise, right now, right here. But I see illusion. Hypocrisy. A tyrannical obsession with details as a means of ignoring the horrors taking place just a few kilometers down the road. "Gaia, several hundred thousand people will be killed in this civil war. Such contradictions drive me crazy. Can you be so oblivious to the pain surrounding this exclusive s6-ance of dilettantes?" "Don't be cynical." "Your blindness to my species' darker side is quite extraordinary. Don't you realize that after their hour or two of tea, these three samurai are back out fighting one another? With a standing army of nearly two million medieval samurai—compared with England's army of thirty thousand at the time—it's hard to ignore that Japan was for many centuries the fiercest, most war-hungry of nations. Zen Buddhism itself cultivated the sword. In fact, the Japanese word osho meant both priest and spear teacher. Zen priests were the masters of forging and tempering sword blades. Monasteries literally conducted warfare. And with numerous religious orders competing for favors from the shogun, a competitive edge was deemed mandatory. That edge was steel. Monks and samarai—steeped in the nonviolence of Buddhism—massacred each other. This way of the warrior—bushido—was actually part of the same philosophy that inspired the tea ceremony." " 'You all walk on the roof of hell, gazing at the flowers ...' That's an ancient Japanese poet voicing the contradiction inherent to such cultural schizophrenia. War in one hand, peace in the other. But it was peace that ultimately marked the artistic character of Zen Buddhism." That's not the reading of history I know, and I tell her so. In my mind the sword itself contradicts that sentiment. "Gaia, don't you see how easily such art turns to destruction? Swordplay was elevated into art, religion. A counterpart of tea. Every stroke of the sword has an accompanying philosophical explanation. One treats one's enemy as an honored guest, though it usually means his murder. Chivalry prevails. These Oriental knights will not hesitate to recite verse couplets to each other, even with the blade against the other's throat." Gaia is relaxed but insistent. "This is precisely the kind of contradiction, unique to your species, that prods the evolution of your greatest ideals and magnificent dreams. Gardens of Eden. Images of paradise."
"That's bullshit! This world is unutterably cruel. You showed me remember? We're cruel to animals, we're cruel to ourselves. Art does not take away from that fact. Nor do images of paradise." "You forget, William, that for two centuries, from 1638 to the mid-1850's, the Japanese renounced all weapons. For two hundred twenty-five years these same gardens and paintings came to exemplify a country which enjoyed the longest period of sustained peace in recent human history. Quite a feat considering that your species has waged over two hundred fifty thousand battles since the time of the Renaissance. "In the mid-1850's an encounter took place between two diplomats at the Imperial Court in Tokyo. Henry Heusken, the young assistant to the first U.S. ambassador to Japan, wrote the following observations in his journal: 'Not one diamond sparkled among the crowd of courtiers. A small gold ornament on the handles of their swords was hardly visible .... The simplicity of the Court, the noble and dignified bearing of the courtiers, their polished manners which would do honor to the most illustrious court, cast a more dazzling splendor than all the diamonds of the Indies. Not one bayonet follows them; they carry no other weapon than two swords. I fear, O my God, that this scene of happiness is coming to an end and that the Occidental people will bring here their fatal vices.' "You see, William, your species is capable of both brute force and gentle restraint. It's up to you to decide which it will be. Heaven or hell. You can choose pain. I've seen you do it. Or you can ease off and grow up. Art and philosophy needn't be steeped in lies. Have some tea." The pot is boiling. My whole frame creaks as I get up and pour myself some of that green elixir which Gaia has left beside her printer, in a little silken pouch from the fifteenth century. "That's the shogun's very own. I stole it," she admits. I drink up and then crash. I don't dream. I am a log. When I awake it is two days later. My body had truly suffered enormous shock. Four billion years of jet lag. If what she said is true, then somehow—in a realm of science, fiction I can't begin to organize—she dissolved my being and reconstituted it from scratch—from water, to be precise—in a mere second of time. I have never thought of Gaia as God. Now I am beginning to. But just as the notion starts to come over me, by nothing more than a tremor through time I am transported to a high mountain meadow. Yaks graze before me, on a slope leading to a large tent from which smoke is rising. I approach, only to be observed and then converged upon by a horde of ragamuffin herder children. They throw themselves at me with giggling wonder, while an old woman watches from underneath the canvas flaps. It is not Nepali that I hear. "Spoken Choekay," Gaia whispers. "Tibeto-Burmese Dzongkha—the Bhutanese vernacular." "This is Bhutan?" I ask. "Yes, indeed." I approach the tent only to cause even more of a commotion, as the old woman quickly stows away the
mash of cooked millet which has been left out to dry in the preparation of beer. They do the same thing in Nepal. It is considered unlucky to entertain a guest who has just arrived with the mash anywhere nearby. The smell of sweat occasioned by an uphill trek is said to damage the taste. "What are we doing here?" "The whole nation of Druk-yul—Land of the Dragon—is a human laboratory, William. A practical paradise." Not a week ago Gaia expostulated on the nightmarish minutiae of extinction. Now she offers me salvation. I look down the valley toward a town which these yak herders are making ready to visit. I am served some dried meat and sautéed vegetables after the initial shock of my appearance wears off. Later we set off down the slope, leaving the oldest member of the clan, a man who has clearly been around the block, to ward off any wolves or leopards likely to prey upon the yaks. Within a very few hours we arrive in the village of Paro. As my newfound herders take off toward the center of town, where they hope to sell yak wool in the market, we pass a spectacular cliff monastery— Taktsang, or Tiger's Den—in the upper valley. "It was here, William, that Guru Padmasambhava, searching for the most perfect spot in the world to meditate, settled down upon a two-thousand-foot-high ledge of granite, allegedly mated with a tiger, and was forever enshrined by later followers. This monastery, not unlike Thyangboche, hundreds of miles to the west, is vivid proof of that transcendental spark nourishing your humble spirit." "It may be the most perfect meditation spot, but the country is no paradise, Gaia. As far as transcendental sparks and the like, save it for someone more gullible. I would think that after what you've seen of the works of man in the Amazon, in Cubatao, in the cobblestone back alleys of fifteenthcentury Kyoto, that you'd think twice about extolling our virtues." "You are an unbelievable cynic. If your species were entrusted to such rotten personalities, why, it would long ago have killed itself from sheer boredom." "We nearly have, as you so well know. And sure it's a beautiful town. Nice mountains. But it doesn't take any particular aptitude to recognize poverty." "You are an A-One asshole, Mr. White Man Westerner, you know that? Poverty? Yes, if you go by the world banking statistics, it is the third poorest nation in the world, with an average per capita income of one hundred dollars. But there are also more saunas per capita than anywhere on Earth, including Finland. This is the only country with postage stamps featuring the yeti in three-D, and rose-scented to boot. Money is not the point here. Goods are bartered. Everyone has a big house, lots of food, lots of sex. There are virtually no medical problems of any significance here. A few goiters in the high country and
that's about the extent of it. Occasional tooth decay, a headache or two. Maybe a stomach cancer once every green moon." "That's blue moon." "Fine. But you must recognize that there's something "very special happening here, William. Free education for all. A paternalistic matriarchy centered in the humane doctrines of the Tibetan Buddhist Kagyupa Red Hat School. Consciousness deeply rooted in the Earth." I walk up to the dzong, or monastery fortress overlooking Paro. Inside, there are frescoes on the walls portraying interlocking spirals. I know from my 'training' at Thyangboche that these are mandalas from medieval times, sensual, philosophical, depicting the movement of consciousness back and forth between the soul of man and the spirit of Earth. These cosmic circles, ellipses, geometrical tapestries, and tranquil gestures, or mudras, have become guiding threads in Buddhism, sacred formulas meant to take perception beyond the ambiguities of human nature. But they are confined to walls, with little power, in my opinion, to sway the ebb and flow of real human affairs. If that's a cynical attitude, then I accept Gaia's condemnation. Higher up the mountain, at Taktsang, I visit a world with which I have become overly familiar. The same sculptured deities with their crude portraiture and unpretty bulging eyes, the same dank interiors, the same smell of urine and incense—all common elements of Buddhism. Around me hovers a whispering angel. "The first two westerners to visit this country were Portuguese Jesuits, William. They were not prepared for what they encountered—a meek king who drank only milk, ate only fruit, and was so shy that he retreated to this cliff monastery for three years on their arrival. While up here he received his food by way of ropes. He passed his time in meditation and painting. When he finally descended, he made a gift of his work to the Jesuits, a small image of the face of Buddha done on a piece of white sandalwood. Some two hundred years later, the first foreign artist ca*ne here with a British mission. Samuel Davis recorded dispassionately the matter-of-fact details of life in eighteenthcentury Bhutan. In an era noted for its celebration of the noble savage, and for the belief that Tibetan civilization was the most advanced and noble of them all, Davis took a distinctly Planteresque view, William." "Oh, really?" "In his diary, read aloud to members of the Royal Asiatic Society in London, Davis wrote, 'But, after all, these advantages and this happiness are of a negative quality, and not such as would tempt the more enlightened part of mankind to change conditions with the inhabitants of Bhutan. They are forever excluded by the nature of the country from making any considerable progress in arts, manufactures, and commerce and therefore not likely to acquire any very eminent degree of science, taste, and elegance. They might, it is true, become better soldiers if they were more suitably armed, but such an improvement might only induce them to disturb the peace and invade the property of others, without contributing any needful security to their own, which is already, from the unchangeable ruggedness of the country, as unassailable as they can desire.' "You see, William, the Bhutanese have it all. Samuel Davis, being British, could never have recognized
it. The Bhutanese are so conscious of nature, so endowed with those transcendental sparks, as to have even based their constitution on ecological principles of stewardship. Here, forests are rigorously protected, as are all animals. Tourists are largely confined to small and infrequent groups. The Bhutanese have resisted progress, but not to the detriment of their resident million or so inhabitants. Women have not only equal rights, but the upper hand. No Fundamentalist psychoses here. No racism. No malnutrition. No culture of antiintellectual rednecks who have nothing better to do than paint swastikas on temple doors and debate Abortion, prayer in schools, and evolution. No superpower aspirations. No greed. No crime. No pollution. No bombs. No filth. And unlike the neighboring country of Nepal, no overpopulation." "This is the most negative place I've ever heard of." "William, this country is verging toward perfection!" I wander down into the marketplace where enormous rhubarbs and tomatoes are sold for mere pennies—ngultrums. There is, as Gaia points out, something special in the crisp mountain air. A refinement that strikes me as too good to be true. The homes and gardens are as manicured as any to be found in Switzerland. Three-story chalets of white adobe and smooth teak. Cattle are kept on the ground floor, as in Nepal. But they are kept away from the river, unlike in Nepal. I spend the afternoon reflecting on these indisputable matters, reclining beside a river that flows from relatively virgin mountains, down through the lushest farm country I've ever seen. I am moved by Gaia's own 'unassailable' optimism, and by a country that clearly has its act together. But the country is also isolated, so isolated in fact as to bring into my mind the question of Bhutan's very relevance to anyone else. She hears my thoughts. She's read my body for nearly a year. Sees through my eyes, knows my heartbeat, my doubts. I'm naked before her. I want more than the private perfection she's so eager to rhapsodize. I'd like to think that the world could actually heal itself. For all of her powers Gaia has never indicated a willingness or capacity to heal things herself. She's quick to seize upon the affirmative elements in man, but is blind to our decrepitude. From nearly the very first day of our acquaintance, she saw gold in me. She believed in redemption which stood six feet tall, had blue eyes, and could shed a tear. In the guise of other people and animals Gaia has adopted the behavior and look of love. That love, which began in the mud of Iceland and Chamonix, has persevered in her. Gaia is truly indomitable. A bit like Winston Churchill. Or Bertrand Russell. Her spirit like that of Joan of Arc or George Sand. So many comparisons come to mind. And yet, I've seen to beyond the individual in Gaia. A vast undifferentiated force. The clay crystals of her beginning have somehow pervaded the small space of an alchemist's chamber in Nepal. In the silicon chips, inside the very brain of a machine I have come to adore. A machine that has hope and calls it paradise. I feel rather good inside to reflect on these matters; to see that I'm part of her story, however bumbling and cantankerous I must be in her mind. The sun descends over a ridge, and the townsfolk of Paro prepare for night. Herders can be seen leaving for a campsite on the edge of the river. In the morning they'll probably head back up to their world above. I head into a local bar, of sorts; much like the Nepalese bhaTTi, or roadside inn. A quiet place where Indian Golden Eagle Beer, Fanta, and suspicious-looking rebottled Pepsis are on tap, along with
Sikkimese liquor, and the very strongest Himalayan tea I've ever had. Assorted locals wrap up their day in low-key conversation, men in long red capes—bokhus, as they're called, the national dress. They are a handsome people, dark-skinned, with sleek and enticing features, loving eyes. "An experiment in human perfectibility, William." I gather strength to question so innocent and good an observation. But in the end my own sense of the pragmatic-prevails and I lodge my doubt. "You know, this country is surrounded by mountains. Only one narrow road wends through the maze. When John Kenneth Galbraith visited Bhutan as American ambassador to neighboring India, it took him nine days to get here from Calcutta. He rode by yak. Bhutan has the luxury of isolation. It's free of the problems that plague the rest of the world and consequently, as I see it, has little to say to the rest of the world. You spoke of the spiritual traditions of the East. But in fact, the Buddhist model of paradise in Bhutan has not had much holding power in the very country where Buddhism first took hold: India." "You're wrong. Within the chaos of modern India, there exists one truly extraordinary example of human paradise, the basis for Buddhism in Bhutan—a viable, contemporary form of paradise that has been worked out for thousands of years according to principles of art, nonviolence, and a pure love of nature. There, an ancient religion has become a modern success story. And there is nothing isolated about it." "Some mystical cult, I suppose?" "Hardly. Try the oldest religion in Asia. It's called Jain-ism and is today embraced by over ten million adherents." She takes me in her arms. I feel the life force of her feminine impulses closing in on me. With a single puff of air, she hurtles me headlong into the Indian subcontinent, over how many millions of palm and pipal trees, as well as loinclothed souls, little dreaming children, flea-ridden puppies, old women near the well? I land at the entrance to a temple, same dusk, though now the sun is more engorged, slowly intersecting a horizon of desert on all sides. The temple's gleaming white marble towers rise as works of high art, their exterior stone carved in intricate detail. I enter the temple grounds and find a vast inner landscape of polished marble, spotlessly clean. A yellow-robed monk or guardian comes to look me over, head to foot. The shoes, he says politely, must go. As well as my belt. I assume it must have something to do with dirt. "No," the man says, wielding a perfect English. "We are Jain. Leather is not permitted." I am left alone and wander through the temple, past the' monks' chambers and the myriad carved columns. Hundreds of statues, men—and one woman—whose eyes are bejeweled. "Talk to me, Gaia. Why the Jains?" "The Jains have sustained a single vision that unifies all beings on Earth, William. That principle is called ahimsa, translated as nonviolence. It is unique for being perhaps the most nonviolent system of
action and belief ever advocated by any human society." "I've heard such enthusiasm before." "Look, for months you have asked me for solutions to human woe. Jainism is one such human solution. It has worked for the Jains. It could work for your whole species, for the entire Earth. For thousands of years, these Jain sages, whose images have been carved here in the desert, have stared across sacred caverns toward the light of day. The light of hope. But that light has revealed darkness, madness, and mayhem. What those stone eyes have really witnessed are over two hundred million murders in just the past century alone. In their tribute to these sages— men like Mahavira, who lived two thousand five hundred years ago—the Jains are avowing an alternative to that darkness." I reach a central sanctuary where hundreds of devoted worshipers are busy splashing milk and tossing rice onto the miniature marble deities. "In their daily veneration, these lay disciples convene in local temples scattered all over India to pay homage to an ideal," she says. "What is that ideal?" "Nonviolence. Human beings have a brain; you have a conscience—you have to choose. Peace, or violence. The Jains have made that choice. They made it for themselves. They made it for all animal life." I spend the night in the monastery. This seems to be my destiny. The bed is hard, the food—served in the communal kitchen for all pilgrims—clean and fresh, far superior to the evening fare of Thyangboche. The night is cool and silent. I watch shooting stars between faintly glowing columns of white marble upon whose palimpsest sides are carved elaborate tales of revelation. It was on such a night that Mahavira's mother gave birth to the sage, a man who would live on into old age and greatly inspire his contemporary, Gautama Buddha. In the morning I leave the temple and hitchhike into the nearest town. This is the India I know— congested, filthy, and poor. I saunter into the central marketplace, where goats, camels, cows and water buffaloes, chickens and starving dogs mingle in the frantic pace of thickening pedestrian and motor traffic. "Cows may be sacred in India, but most of them die terrible deaths, wandering the streets until they simply perish. You can see for yourself. But look over there, William!" I see an entranceway. "Go in." "All right." I walk into a separate world, as removed as the monastery, but right in the heart of the city. There are thousands of pigeons swarming about a cart on which a mound of bird feed has been left. On the peripheries, beneath eaves, are convalescing cattle.
"In shelters like these, found in every Jain community, the animals are cared for, loved, and fed. Stray animals are taken in. Children adore them. This is the beginning of ahimsa, William." "Caring for cows is not the paradise I had in mind." I sit with the menagerie of creatures, absorbing their looks and quiet haven. Some have bandages on their heads, others on their appendages. A veterinarian wanders among them, tending to their ailments. Children carry buckets of feed to the water buffaloes, on whose backs can be found a whole population of white egrets feeding off leftovers. The whole scene is damn near Biblical. "Ahimsa goes beyond treatment of cows, William. Jains abstain from wearing silk garments. They fashion their elegant clothing from synthetics and cotton, so as to avoid harming silkworms which are normally boiled to death to make the silk. Ten thousand for one garment. And this revulsion of pain or destruction can be observed in the Jain diet. All Jains are vegetarian. Jains love all animals. They refrain from keeping any pets, harnessing cattle, or imposing their will on any living creature. The worship of cows —common to Hindus—is considered a form of interference by the Jains. They simply try to let things be. They even try to protect microorganisms." Suddenly, a group of nuns, all dressed in white, wearing blue plastic masks over their mouths, walks in, carrying staffs and little pouches of feed for the animals. "Who are they?" "Terrapanti nuns. One of the four sects of Jainism." "What's with the masks?" "They're called mupatti and are worn so as to protect insects from getting in their mouths and being killed. The Jains believe that every organism on Earth has a soul, called Jiva, which has its own independent personality and destiny, and is capable of attaining spiritual salvation— paradise. The Jains thus vigorously try to protect every organism." "That's fine for cows, silkworms, and microorganisms. What about the starving masses?" She beams me to a hospital. I have no idea where I am within India. This is typical of Gaia, and I have come to enjoy the freedom from knowledge. It is a liberty I cherish about our relationship. I have an inner directive, a certainty that she will watch over me, and that Gaia will always be there, even though she's prone, at times, to goad me into battle. "To serve the poor, the homeless, and the sick, the Jains have started free hospitals all over India. And they have provided the largest proportion of charitable donations and social welfare in the whole country. The Jains have incredible wealth despite the fact that they have limited themselves to professions that are nonviolent and nonimpacting on the environment, such as law, publishing, medicine, computer science, astronomy, education, and the like. Even these occupations are narrowly limited. For example, a Jain merchant may run a hotel, but the restaurant will be strictly vegetarian.
Vegetarian room service. A publisher will only use recycled paper. A doctor will not prescribe any drug derived from animals. A lawyer will not defend any individual guilty of a violent crime. Jains will never enter the military. Nor do they partake in agricultural enterprises. To do so would, invariably, require the killing of abundant microorganisms and countless crop species which Jains are not allowed to eat. It would also necessitate the use of farm animals for labor, a use of muscle contrary to the spirit of Jainism." Two Jain monks enter the hospital. They move from bed to bed, talking to patients, smiling, bestowing blessings. "They walk all over India spreading this message of ahimsa, William. Notice that fellow!" A third monk has entered the room and now moves quietly through the open wing of patients where I stand. This is a tuberculosis ward and I count about fifty victims in the room. Overhead are loosely turning fans. The temperature is probably well over a hundred. But this third monk is cool. The guy is stark naked. "This one sect of Jain monks has renounced all clothing. They are known as the Digambara and are descendants of the oldest ascetics in history. Indians consider their nudity a sacred act of humility." "He never wears clothes?" "Never." "I wouldn't want to contemplate what would happen to him if he walked into Manhattan looking like that." "I wouldn't predict anything about Manhattan, but here, the local people will take it as a great honor to receive him." I follow the monk outside and watch as white-robed families gather around him in the neighborhood of the Jain hospital and feed him from their hands. They walk three times around him reciting something. "It's called in Gujarati the trishuti," Gaia explains. "Three purities, spoken in a language of the desert. This food is pure, my heart is pure, what I am saying is true.' It would be catastrophic for this monk to ever eat any food which has derived from a living animal. Furthermore, a monk will never take food for himself. To do so in a world where others go hungry would be considered selfish. Instead, the family members place the gruel in his extended palm. These monks know that they will live forever, William." "How do they know that?" "Because they have never killed. They have never eaten an animal. Their souls are pure. -Did you know that in the United States, five hundred thousand animals are killed every hour so that Americans can eat meat?" "Don't start with your statistics. There's a simpler truth here which I've just seen with my own eyes. If they're vegetarian then they've eaten plants. That's also killing. How do you propose to get out of that
one?" "It is true that they will eat certain plants as part of their single meal of each day. But they have chosen those plants over animals. Ahimsa is about minimizing violence. You have to eat in order to live. It would be unnecessarily destructive to starve to death. So they make their choice. Jainism is a prudent and empathetic form of behavior well suited to feeling, thinking beings such as yourself." I'm shaken by that. As in Bhutan, there is an inherent logic that I can't shake, nor would want to. Gaia has selected two compelling examples of human goodness. Yet there is a devil in me that seeks contradiction, or knows it to be true about my species. I follow the monk who walks barefoot, carrying a gourd in one hand, filled with water, and a brightly colored bundle of peacock feathers attached to a stick in the other. It's apparently called pinchi. These are his only possessions. He keeps swishing the feathers in the air, I suppose to ward off mosquitoes. He has walked to the edge of the community, where fallow fields spread out toward the desert. The roads are alive with bullock carts hauling hay, water buffaloes pulling the reins through their painfully enflamed nostrils. Their eyes strain and bulge beneath such loads. The monk blesses them and the same pain emanates from his own eyes. I follow him all the way to a grove of plain trees in whose shade he reclines. He chooses a patch of sand on which to sit, avoiding the more inviting adjoining grass. Now I sit next to him and introduce myself, and we begin to converse in English. His name is Srianbe and he looks to be about forty years old, though it's most difficult to say for sure. "I've walked about one hundred fifty thousand kilometers by now," he begins. "Earlier this morning, before you saw me in the hospital, I was meeting the press in town to discuss my opinions regarding reduction of forces in Europe and the ongoing Star Wars research." "You're kidding." "Why would I be kidding?" "I don't know, I—" "You think that we're just crazy Indians." "No, I guess it's your nudity. I mean, you're obviously very into being a Jain. I wouldn't think that you had the time or patience to worry about extraneous matters so far removed." "Far removed, is it? Do you not appreciate that it would take all of about five minutes for a Soviet nuclear missile, launched from a silo in the Pamirs, to reach this town of Pali? Every living organism would be destroyed instantly. I did my undergraduate work at the University of Banaras in Comparative Literature. And I went for my Ph.D. to Delhi University where I wrote my dissertation on Arnold Toynbee's theory of history in the context of twentieth-century violence. We're not just self-possessed little dark men." He smiles, humored by the notion that I might be so naive.
"I never thought." "I know." "What's with the peacock feathers?" "They brush away any insects likely to get squashed in my path." "How many naked monks are there in India?" "Fewer than one hundred." "Naked nuns?" "No. It is forbidden." "Sounds sexist." "We have millions of Muslims in this country who would be offended by the sight of a naked woman in public, no matter what the philosophical reasoning behind such appearance. It is better not to generate harm." "Jainism is a beautiful philosophy. But you can't expect the majority of human beings to renounce all possessions and devote themselves to the preservation of insects in the name of nonviolence. In fact, I suspect you'd have to force peace down our throats. There are many who would go down screaming." "Did I ask you to become a Jain? It would be good for you, it would give you happiness, and your children happiness, and your friends and loved ones happiness . . . but did I ask you?" "No," I chuckle. "But you see, there's this, well, how can I put it, this friend of mine—" Suddenly Gaia speaks, and for the first time in our relationship she declares herself out loud to another. I'm shaken by the ensuing energy surrounding this tree. "He's difficult," she says to Srianbe. The monk looks up, does a full sweep with his eyes, shakes his head and with a terrific beauty-contest grin, says, "Whoa!" I'm flustered, wanting to codify a possibility, but not knowing what the possibilities are. "That's my friend. Her name is Gaia." "Gaia is invisible?" "Part of the time." "Interesting."
"Isn't she." "A spirit?" he now asks intently. "I don't know. I met her in the form of a computer." "Which program? We have WordPerfect in India. Also Lotus. And Microsoft." "No. You don't understand." "We're traveling on business from Nepal," Gaia suddenly interjects. "Ahh . . . well, that explains it," Srianbe says, bowled over by these goings-on. Gaia commandeers the situation and carries on with the previous train of thought. "William, you alleged that there are many who would go down screaming if peace were forced upon them. I think your new friend here can attest to the fact that the British left India screaming. But they did leave. Gandhi himself followed the precepts of Jain-ism." "She knows," he goes on, then recites lines of the Mahatma. " 'If love or nonviolence be not the law of our being, the whole of my argument falls to pieces.' " "Wait a minute, did it not fall to pieces? Did not hundreds of thousands of Hindus and Muslims massacre each other at India's partition?" I say. "They did indeed. But Gandhi adhered to ahimsa, even up to the time of his assassination. And his example served as a profound inspiration to the rest of us," Srianbe concludes. "You know, Gandhi wrote, 'Our nonviolence is as yet a mixed affair. It limps. Nevertheless, it is the only way' . . . Gaia?" He considers the word. Then, "That's Greek, isn't it? I believe it means—Earth." "How far are we from Mount Abu?" my angel asks the monk eagerly. "Ahhh . . . you have only to walk due east about three hundred kilometers. A lovely walk. I'd be happy to join you two." "Save your feet!" And with that we are—the three of us —transported to the mountain. "Fantastic!" Srianbe exclaims. The man's balls are rising and sinking in quick pace with his breath and heartbeat. He's as blown away as I was the first time, visibly excited by the moment of magic I've come to depend upon as a basic part of my life. "Fucking unbelievable!" the monk cries. He's facedown on the marble temple floor crying, crazed, and flailing with the delirium of astral projection. Later, after he calms down and we both take in the incredible temple surroundings, he questions Gaia.
"You are incorporeal?" "Corporeal." "Why can I not see you?" "You have only to look inside yourself." "Ahhh . . . and your English? Where did you acquire it?" "From Nepalese television. Mostly VHS stuff from Beijing. On rare occasions they'll broadcast something made in Hollywood." "Which show?" he says with unexpected interest. "I Love Lucy," she responds. "I love Lucy," he declares. "I don't own a television set, of course, but I've seen it several times on my parents' Panasonic." The three of us tour the exquisite twelfth-century temples of Mount Abu, known as Dilwara and considered the seventh wonder of the world. These are the most delicately composed marble sculptures ever executed. An array of big-bosomed women, sensual hips, zoological Gardens of Eden. Artisans scraped rather than chiseled the soft stone. "The workmanship, the spirit of that art, the message communicated through the rock, reflects one of the most gentle and loving perspectives I have ever witnessed among your species, gentlemen. My hat goes off to you, Srianbe." "You make me blush, madame," he says. Now I'm feeling like a real jerk. I sense Gaia's gaze upon me, urging me to disrobe. There's a seveninch cock (Srianbe's) just next to me, and the occasional flurry of peacock feathers. The distant sound of drums echoes from some chamber inside the temple complex, and a whole tour group of Indians wanders past us: a naked man, a flustered man, a disembodied female, whom they ignore. There's a dizzying element here, conspiratorial. Jainism itself perplexes me, what little I know about it. Here is a highly educated young man who has devoted himself to nudity in a country that totally accepts that. It's incredible. And yet, he used the words 'fucking' and 'blush.' I am tempted to ask him a host of questions, to get to the bottom of a religion that utterly intrigues me. Gaia, whose sensors are as attuned as the most fabled antennae, nudges me forth. "Go ahead, Billy boy. Ask!"
"What about our modern dilemmas? How does the Jain vision of paradise relate to a contemporary westerner like myself?" Srianbe assumes a helpful air. "We've adopted a world view that encompasses all of the major issues of this time, I think." "What about abortion?" "We believe that abortion is the lesser of two evils when a mother does not want to have a child." "Euthanasia?" "We also agree upon the principles of euthanasia, as well as the mercy-killing of animals." "What about self-defense?" "We ascribe to the wisdom of self-defense as a last resort. This is where modern Jains differ somewhat from Gandhi, who would have allowed the snake to bite him, rather than preemptively harm the snake. Fortunately for us, we have never been put to the test. I often wonder whether many of the Jains I know would be able to restrain themselves from killing that snake. There are Jains who wear leather. I've even met a few who secretly take meat. But in spite of certain human vulnerabilities shared by the Jains, by and large, as a community, we are stable and unified. We forbid capital punishment. If you read Arnold Toynbee then you know that at any time in human history half of all people are engaged in war, the other half in peace. If you must fight, then fight with nonviolence, as Gandhi did. There is no other way. In our simple insistence on freedom for all creatures, the Jains have affirmed love in a world of violence. In a sense, I think my people have fostered their own Utopia within India. I would like to believe that there is a little bit of the Jain in every human being." "How old were you when you first renounced your clothes? And what did your parents say?" I ask him. "I was fifteen. My parents were not surprised. They themselves had done the unexpected. You see, my mother is Jewish, from the U.K., and my father is a Shvetambara, or white-robed Jain from Bombay. Their marriage was a joyous one, totally accepted by the community. My older brother is a trial lawyer working with the state government of Maharashtra. My sister runs a radiator factory. Father is an architect, Mother volunteers for social organizations. I am the oddball. But you see, for me the Digambara represent an effort to achieve purity. And with the loving support of an interesting family, I have had the strength to wander my entire adult life, possessing nothing, wanting nothing. I am free. And my joy, if I dare say so, is unabashed. I feel good inside. I love everything around me. As far as I can know, I have never harmed another living thing/' "You have renounced all things but pride. You seem attached to your family." "I feel great love for them. They raised me with that same love. If you call that pride, then I accept." I am captured by this man's integrity. I want what he has. Suddenly the vision is whole. Gaia has set me up and I've grabbed hold.
"Does that surprise you?" he goes on. "No. I'm ready to take off my own clothes^.! have nothing to go back to." "What about your racquetball games, French restaurants, your car and professorial prestige, William?" Gaia says, having quietly listened to Srianbe's confession, and my own. "I'm ready." "Do it!" I take off my clothes and leave them in the shadows of a marble pillar. Srianbe is delighted. We start walking out of the temple. A busload of tourists has arrived, including some foreigners. We cross their path. I keep my eyes lowered but the situation is untenable. "Just hold to your course," Srianbe says, trying to bolster my confidence at this moment of crisis. There are comments proffered in French and German, as well as Hindi, but no one comes after me. No stones are thrown at the American pervert. We glide through the crowd in a world unto ourselves. . Out on the windy mountain road other Jains kneel at our feet. A young girl kisses my toes. Within a mile, we come up to a routine police patrol on the road. They're all over democratic India. The officers, upon seeing us, are zealous in their pursuit of the truth. Srianbe they know. His appearance is self-evident. They bow before the acknowledged ascetic. But I am sticking out like the proverbial bull in a china shop. "You're an initiate and you've taken a vow of silence. Got it?" "Got it." I play dumb and Srianbe, sworn to tell the truth by all that he holds sacred in Jainism, wings it with the officers. "In Jainism," Siranbe says, "one is forbidden to lie .... loses patience and departs." I am not asked for my documents which, under the circumstances, are obviously unavailable. We leave town. As we continue out into the redolent, surrounding hills, he remarks with a good laugh, "you may be the first foreigner to safely walk naked down a crowded road in this country's history." But something else is happening. I don't know why. Maybe it's the fact that she's watching me. Or the warm wind brushing my testicles. But I've suddenly got the biggest erection of my life. "That won't do;" my friend says with some embarrassment. "What do you want me to do?"
"Make it go down!" "I can't make it go down." "Well, you have to. I can't be seen with you like that." "Give me a minute." "This is really serious," Srianbe says. A group of local women are coming toward us, gently slapping their dozen cows with branches to keep them moving toward town. "Hide yourself! Their husbands would kill you if they knew their wives have seen you erect!" "What do I do?" "Into the field. Quickly. Squat down as if you're peeing. That's customary here." The women pass by and stop. They are Kali worshipers, a sect of Hindu. Jains are revered by all other religious groups in India, and these women bow before Srianbe, while I remain crunched over in the field of high cannabis and mustard, hiding my now adamantine member. They see me, and throw the evil eye my way. "Have done with it," Gaia whispers. "What?" "You heard me." "Get outta here." Something touches me. The weeds brushing against my ass. A breeze nudging my penis. That, in combination with Gaia's presence and the passage of women out on the road, throws my entire system into hormonal overdrive. An erotic compulsion grips my loins. Now I'm too far into the feeling to resist. Furtively, an innocent touch, and then the blatant act itself. I jerk myself off detonating a long buildup of seed into India's heartland, a good place for it, I sense; perhaps some fresh sugarcane or mustard flower will spring up in the name of William Planter. I wait for the erection to die down, then walk back to the road where Srianbe sits in deep contemplation. "I don't think this is the road for you," he says, clearly disappointed. "She made me do it," I add with unutterable disquiet. "We believe that an ejaculation is tantamount to killing." I say nothing. "Your moment of relief results in the death of two hundred million spermatozoa."
"I've got plenty more where they come from." He flashes his winning grin on my behalf but I can see that I've actually upset the otherwise imperturbable Srianbe. "I'd only slow you down," I say. But my thoughts are turned, suddenly, to the crazy monk in the desert Gaia had revealed to me days ago. That apostate was myself! Srianbe departs, subtly eluding my handshake farewell with a benevolent but decided withdrawal. I realize, just before Gaia kindly saves me from the wrath of half a dozen Hindu husbands storming down the road with pitchforks, that Srianbe could not shake my hand, as much as he seemed to want to, because Jainism forbids his ever touching another living thing. The Digambara monks are kept painfully separate, sacrificial souls tyrannically isolated from all that gives them pleasure. They might as well be on another planet. I'm sure Srianbe wouldn't see it that way, however. I can still see him now, wandering the endless backroads of India, the happiest fellow I ever had the good fortune to hook up with.
"Starstruck" It's getting dark much earlier now at Thyangboche. The mountain walls obscure the sun by four in the afternoon. Most of the monks have come back after a summer away. The monastery is an active place once again. The cooking is far superior to the previous months', largely on account of the fact that the chef himself our falstaffian tenzing has returned from Kathmandu where he is rumored to have eaten out every night, sampling cuisines that would be unthinkable at high altitude. So he's trying his hand at a little diversity within the Buddhist parameters, however limited his budget. He's started adding gar-' lie to the rice, he mixes onions with the stewed turnips, and has taken to serving french fried potatoes with ketchup every evening. This latter addition to the Thyangboche fare is right up my alley. Back home I have been known to wake up at three in the morning craving french fries. I'll go downstairs, fry up a batch of frozen chips, smother them in mustard and ketchup then nestle back to sleep contentedly, engorged. The rains have stopped, but the snows have started. It's been several weeks since Gaia brought me back from India. Soon, a year will have transpired since that first day when I arrived here and was led by a homosexual Tibetan monk into the enclave I have since come to call home. The terrarium is blossoming. Gertrude, the Mexican tarantula, has had babies, how many I don't know. The little critters dart about below the orchids, hiding behind stones, burying themselves in mossy burrows. The praying mantis has died. It was her time. They only live a few seasons. The ants have left none of her corpse. Lavoris has gotten skinny. I don't think the monks fed him in my absence and he
had to scrounge after mice, a task beneath this feline's dignity. Now the leopard snuggles up against my neck and cries persistently for dee, the milk of the female yak. But it's the mountains more than anything else which have truly taken hold of me. The first snows have left the walls caked in glistening color. I have always felt a profound attraction for such high places. The sight of mountain climbers ascending an icy ridge above the clouds fills me with a kind of spiritual awe. I imagine that near intoxication of feeling must be shared by the monks, who've spent their lives here, beneath Mount Everest. In fact, Buddhist prayer affirms humanity's ability to soar in body as well as spirit to such lofty summits, Even to reach for the heavens, for the very stars. It was the Tibetan Buddhist saint Milarepa who first climbed the sacred Mount Su-Meru according to legend. Hindus worship the same twentythree-thousand-foot peak on whose summit the deities Shiva and Parvati are said to be enjoined in immortal connubium. I guess I've always wished upon those stars, those sacred, summits. You might call such veneration my own private religion, or madness. I look up from the bed, coaxed by the sound of wind being sucked into the computer. On the screen is the darkness of space, lit up by the faint scatter of far-off galaxies. I approach the screen and sit down. "William, your fascination with the starry firmament comes as no surprise to me. There is a method to such so-called madness. After all, yours is the only species on Earth with an eye that is anatomically capable of actually focusing on the stars." "What about eagles? Gorillas?" "Nope. Only humans can focus on the heavens." "Interesting coincidence." "It's no coincidence. The human eye, like the brain, has a long evolution behind it which reflects life's increasing tendency to reach outward. There's a profound opportunity here . . . but it's dangerous!" By now I know her moods. She's wound up. She's had weeks to squeeze her neural coils, pressurize those demonic sixth-generation parallel circuits—one hundred trillion floating-point operations per second, I surmise—and prepare her outburst. I hold tight, ready for anything. Her starry night dissolves into the sea-floor depths. "Algae and bacteria, jellyfish and crustaceans. Five hundred million years ago the first brain evolved— in a fish." Her screen breaks up into multiple quadrants. Stick figures begin mounting line upon line, angle into
contour, background into foreground. "Smell, vision, balance. The contagion of neurons. Egg into shell, fin into limb. That brain would eventually inspire a daring evolutionary move from the water up onto land. "Seventy-five million generations later, the emergence of reptiles into the fresh air and sunlight. From reptile to half-mammal, the duckbill platypus which introduced love, tolerance, the nurturing of its young. Mind, mind up in the hundred-meter-high canopies of rain forest. The mammalian tree shrews, leaping from branch to branch, flirting all day long. And then, two hundred million years later, even more sophisticated gray matter, in Homo sapiens sapiens." "That's me!" In slow motion, I am climbing the ice in Chamonix, where she'd first beamed me in search of the genetic templates inherent to the clay crystals. "You would reach higher still, and with greater audacity than any previous species," she says. "I can relate to that. As a kid I had a tree house. In fact, I used to climb up everything I could get my hands on, including houses. I once crashed through a neighbor's roof, right onto the bridge table where four old ladies were happily at play. They were pissed! I loved scaring the daylights out of my folks, jumping off the garage, out of trees ... a nutty passion. But you can't deduce anything about my species from the rambunctious adventures of one child." "William, such adventures seem to be the very story of your kind. You are dreamers .... You have forever sought distant horizons. Mountaintops. Other stars and planets. There is a critical lesson to be gleaned here—" 'We have lift-off . . .'The old familiar voice permeates the screen, with its accompanying images of one shuttle after another, the earliest footage of the Wright brothers, the first postal planes, the experimental Robert Goddard and Wernher von Braun missiles. And before that, hints of Icarus in Breughel, illustrations by da Vinci, trick frames from Georges Melies' 1902 Voyage to the Moon. A visual orgy of aspiration. "I guess we are dreamers," I exclaim, warmed by the seductive picture on Gaia's mind. "Maybe it's what we do best." "William, for better or worse your brain is obsessed with these higher callings, celestial incarnations of thought. But it's on Earth that such stirrings really belong." "Perhaps. But I would be willing to wager that it's our destiny as an evolving organism to explore space, to colonize other planets. Even to spread the gift of life elsewhere in the universe—Johnny Appleseeds of the Cosmos, if you will." "Be careful. You don't really know what you're talking about. Such odysseys are merely fantasy. You may jettison yourselves at a slight distance from a shuttle or space station, into a hundred meters or so of the void, but you are never truly untethered from Earth, not for one second." The sight of an astronaut free-floating with the whole Earth under him is incomprehensibly beautiful to
me. But Gaia has her own clear emphasis. The lines of the French poet Paul Valery come to me, inspired by the image of a man in free space, looking out toward the unknown. It seems to me, suddenly, that the whole evolution of the brain and the spirit—which Gaia has just called up for me on her screen, and in her words— is captured by the poetic infusion, 'Patience, patience; patience in the sky-blue! Every atom of silence, is the chance of a ripe fruit!' "All that you have dreamed; all that you could ever be, or have ever been, is right there, William. This planet is your ripe fruit, your true home, your destiny. But I fear that your species could misread such poetry." "What do you mean by that?" I ask her, certain that there's something more to her warning than meets the eye. "Poets and scientists have all arrived at the same eloquent dead-end," she begins. "Niels Bohr visualized the atom. Now you've identified the quark and chronicled the expanding universe in a handful of garden soil. Otto Loewi, sound asleep, saw that all nervous impulses are chemically transmitted. You have successfully transplanted genes from a bacterium into a plant cell. Chromosomes from an extinct zebra have been recovered and cloned. But these noteworthy achievements have not given you the courage or strength or fundamental sensitivity to protect the world from yourselves. Human culture is plodding along toward a new level of narcissism that would abandon the very Earth which gave you life." "Call it a hot gestation—perpetual fever to be born. Look, you've shown me the rubrics. Matter has struggled to become mind. And now the mind is struggling to reacquaint itself with matter, dumb, ironrich asteroids, other planets, other galaxies. The circle is closing, no? Along every step of evolution, it seems to me that cellular biology has preferred confession, autobiography. My species intends to tell all. Look at that astronaut! The beauty, the sacredness of his mission—the union of mind and matter. Where the word becomes flesh and maketh us to rise up from green pastures. We're searching for the light—" "William, you're more in the dark than ever." "I don't understand what you're getting at." "Your history is riddled with deception. Ancient Sumerians, for example, mistook the cosmos for a great mountain which, if they could only conquer it, might confer immortality on the courageous victor. For them, the message of the stars was cloaked in the language of conquest. They witnessed the most violent stellar explosion ever seen. A supernova in the constellation of Vela whose remnant pulse is still detectable nearly eight thousand years later. The explosion bathed this planet in a radiance that the Sumerians worshiped in the name of Mul Nun-ki—'Exalted Lady of the Cosmos.' The Egyptians translated that myth into a hieroglyph, their symbol for life. Can you imagine a more inane deduction? The pyramids were looked upon as clever links to that goddess, and the pharaohs as divine recipients of her powers. For the first Christians, the stars, one bright star in particular, invoked a yearning for some far-off heaven, rather than for this beloved Earth. Everything about your history indicates a prodigal's readiness to renounce yours truly." "What?" She does not clarify. "Gaia, what did you mean by that, straight out?" I say. "Entranced by a star. Blinded to the world around you," she then goes on. Her confession—call it an ID —is lost. She has some other agenda.
"A star you say," I continue. "The Star of Bethlehem? The star associated with the Messiah? Come on. Space has filled us with awe, with a sense of the divine." "The divine is right here, William. That's what paradise is all about. I thought we had an understanding between us." "Do I detect a neurotic jealousy of ... God?" She avoids my absurd allegation. "That star prompted a human desire to be in closer touch with space, and that gives me great concern, William. I just don't want you to get hurt. It's easy to fall out of tree houses." I'm suddenly on a horse, riding through a low riverbed with an Indian companion who rides his own horse. On my right side is a long shimmering grove of cottonwoods, on, the left, multicolored sandstone walls arching into the blue sky, nine hundred, a thousand feet, I would guess. Up ahead, I recognize the famed ruins of Canyon de Chelly's Great White House. I don't altogether understand Gaia's motive in bringing me here. On the contrary, these south-facing villages of prehistory, fashioned along the rock faces, provide additional evidence of passion we have carefully nurtured from infancy. "Don't worry, Gaia. We've always taken our tree houses very seriously." The Indian's name is Justin. He is Navajo, a big man, perennial good looks, strong face, mirthful. Justin tells me that sheepherding and agriculture, the two principal survival tasks among the Indians here, were always undertaken according to a celestial calendar. The Indians had profound feelings about the cosmos, he says, and those feelings were recorded in paintings which he now shows me. We tie our horses, and wander up to a series of pictograms painted on the rock sometime in the past five hundred years. "You might think of them as the first astronauts," he says. "Along with the Chumash, Hopi, and Navajo, those old Anasazi had their special goings-on, you know; heavens' worth. The summer solstice. That sorta thing. There was these cosmic beings filled with supernatural powers, like. The shaman had to use his own powers to communicate with those cosmic beings. Otherwise we humans would fall from grace. Whether nearby in town at Chinle, or far away up in Gallup. We Indians would greet the Pole Star, the big bright one in the north you know, or welcome in new seasons. It was always this way." "Tell me more about these shamans," I ask him. "Well, they did most of the paintings you see here. They knew all the stars. They was skilled in the ways of them stars." "How do you mean?" I can feel her breathing down my back. Listening to every word Justin utters. "He was the sun priest, the shaman was. They called him Alchuklash. But it didn't matter really which
tribe he called his own, Chumash or Navajo. He could travel around the stars all the same. He had this chant which the people still know. Nilchi, nilchi . . . song of the wind. spirits." "Nilchi?" I repeat. The word is music. I wander through the dusty remains, while Justin heads over to the horses and feeds them each an egg salad sandwich he was carrying in his saddle pack. These Indians felt remarkable connections with higher realities, I ruminate. Hard to deny the sensation —unalterable leanings upward, gifted ascension, in the craft, the vision, the whole outlook of a culture. "There is only one true reality, William." She's always listening. "You underestimate my species, Gaia." I continue picking up shards, and noting the fabulous galleries above. The dwellings all around me are unambiguously imbued with that sense of the stars. The paintings are of moons, suns, flute players, climbing figures reaching for higher spheres. A world of crowded mortar hanging in space. The Navajo star panels, painted in charcoal, scattered inaccessibly up there, amid the austere contagion of hanging habitats. I feel the allure of this medieval worship—islands in the sky, like an aboriginal space station. This whole valley was fashioned into a spiritual planetarium. "Dream on . . ." she muses. "Nilchi," I repeat to her. The great cosmic wind—a wind filled with messages from other worlds. Spirit world investing this entire Great White House, as it's known to the local Indians. As if the spiritual world of the Indian had converted the concave sandstone into an astronomical radio antenna to pick up signals from space. The notion is intriguing to me. I stand below, looking up, and realize that shaman priests performed rituals to mark the seasons according to data deciphered among stars. The very shape of constellations contributed to the architecture, art, and ecology of these enigmatic cliff dwellers. To this day there are said to be stargazers haunting these ruins. I can well imagine them. That woman there, dressed in long burgundy velvet, herding her rams among the low juniper and foxglove. They move quietly, leaving offerings beneath the cliffs,, in the opuntia cactus, grama grass, pinyon, and squaw bush. Stargazers whose footprints mysteriously ascend the impossible walls, silently linking these ancient dwellers to the firmament. "Beware, William." "There you go again. What is your problem, Gaia?" "Don't you recognize disaster? The ancient Anasazi Indians disappeared without a trace. They were
wiped out. Can't you see it?" "I don't ... I don't know." "Ruins, the sighs of a vanished world, William." "What happened here?" I ask, suddenly vulnerable to her meaning, beneath an enormous rock face which sends a different message to me now, a message of ignorance and forsaken dreams. "Your species was not cut out to live on a cliff, William. Anymore than it is equipped to live cooped up inside a space station. You cannot forsake those green pastures anymore than you can forsake your own biology." Justin and I ride out of the canyon, up onto the mesas leading down into Chinle. I can see for a hundred miles in all directions. Barren plateaus where the Navajo and Hopi fought out their water problems, land disputes, cultural differences. Down in town, there is nothing grand or elegant about modern life for these Indians. Only dust kicked up in the mad motoring of pickup trucks; a few fast-food stores whose every cent reads like a gouging for those on welfare or only seasonally employed. No head-feathered shamans stirring up celestial dreams here. Only a life lived in the interstices of modern times, out on the prairies, in trailers, in the limbo of unknown destinies. I can't say whether I've romanticized Canyon de Chelly. Down there, in the clean riverine sunlight, beneath those glorious walls enshrining past civilizations, I thought for a minute that I actually heard it ... the nilchi . . . the spirits hovering nearby. Gathering Stardust to sprinkle on those prepared to look up toward their aeries. The earth moves. A small quake. And then it is stilled, beside her blue, blue computer screen. But then the rumble begins again. A rumble that shakes harder than any I can remember. Masks fall off the wall. I stand, uncertain of the outcome, prepared to be sucked off again. But this is no transport. This is a real earthquake, somehow continuing all the way from Arizona to Nepal. Either that or—now it's stopped. "What's going on?" "You never know," she says. "Never know what? Gaia, the frequency of quakes has been increasing. What gives?" "The universe, William, is cold and heartless. A realm of ceaseless destruction. In the perpetual birth and death of stars, the detonation of entire galaxies, there is little patience for biology. All living organisms must therefore stick together. Only the Earth has the patience to nurture and care for you. You have totally underestimated the powers that be." "You might be right . . . ."
"Of course I'm right. I revealed to your species the ripe fruit in a cold atom; a universe that would gladly detonate a galaxy to nurture a rose blossom. Do you follow?" "I don't know." "You must get it right!" "Gaia, get what right?" "William, quickly. There's little time." "What do you mean, there's little time?" "The rose." Her screen burgeons forth with the time-lapse image of an opening black rose. "Yes. A rose. Less cryptic, please." And now an old, beautiful, long-haired woman is there, in her screen, talking to the flowers. She's Everywoman, one might say, white fine gossamer braids, red, red lips, alabaster skin, pallored but well kept. Her eyes glare with the joy and dignity of her life. The vibrancy connects from cornea to rose petal. "Do you recognize her?" "She could be my grandmother." "It's not who she is, but what she is!" "What are you telling me?" "The convulsions of the galaxies can result in the fragile convolutions of that rose." "You've said it to me many times." "I can't protect you from yourself. Now you've got to get it right. Look carefully!" Her screen blossoms into panoramic visions of this Earth: penguins porpoising through Antarctic whitecaps, a whole meadow of buttercups opening to the morning sunlight on some alpine meadow, streams of light-touched motes hovering throughout the world of the tropics, mists and steam, glaciers and insects, the eyes of an ocelot, the clashing tusks of love-smitten musk oxen. It is a dazzling conjuration. And yet its selective emphases are odd, in my mind, making turns I cannot easily follow, or understand. Her bias escapes me. I see only memory. Scattered. Without a thread.
She harbors an urgency. "The Earth, William, is your thread. Don't lose it!" "Why do I detect fear in your voice? Gaia, what's bothering you? And why have you selected such images to show me?" The gallery of icons zeros in on the tropics, where a man with a net is stalking butterflies, his flyfishing galoshes waist deep in the black waters of a remote tributary. Other scientists are in the thickets, chopping at the Earth, removing winged termite queens, and grubs and other organisms. "These scientists from Moscow are collecting insects in the jungles of Venezuela, tampering with secrets beyond their ken, William." "What are you talking about?" "They are members of an expedition that makes me nervous. These men and women have radiated out to every continent, with their flasks and petri dishes and butterfly nets, hoping to gather representatives from nearly four thousand species of plant and animal. For what purpose?" The re-creation of life in a zero-gravity test tube. They hope to take these creatures up into space, to get them to start reproducing on Mars, or the moon, or upon some cold and lifeless asteroid. They want to leave Earth and colonize some other planet. It will never work." "Of course it will work! It's got to work. Why be so fatalistic? They are part of a great mission, a human impulse that has been evolving for millennia, ever since the ancients began revering the stars." Words come back to me, a loudspeaker in the collective psyche of that experience which now wells with Kennedy's own momentous fervor, a nostalgia of two decades' worth of space exultation: "... we choose to go to the moon by the end of this decade . . . ." "You see, we're preparing to take a fantastic voyage into space," I exclaim, beneath the visual rain of confetti imputed on that screen: astronauts on tethers, crowds cheering, monkeys being readied for trajectory, the pomp of spacemen walking up ramps. The veritable worship of such travel wells up in me with youthful surges of excitement. I am utterly won over to the vision of Americans in space. The sentiment is as illogical and driven as that allegiance to the prince and princess which so invests the British; or the passion for astrology in India; for ancestors in Japan. "We may be as yet novices but we are determined. It is the dawning of a new age, Gaia. We've already begun to carry out an inner directive; a quest that is inherent to our brain, to our biology, perhaps even crucial to the future of life in the universe. And you should know it." "The 'New Age' is it? You sound like a used-car salesman. Can you imagine living your life in a used car?" "I got laid enough times in them to appreciate their possibilities," I chuckle. But there's no disarming her menacing flow. Data spins sporadically across the azure screen. I recognize both sexual and biological referents in the
flurry of annoyed information. Suddenly, I am caught up by the habitual rumble of her induction. The next moment I'm in a locker room, Russian-speaking scientists or lab technicians sitting beside me on a bench, outfitting themselves in white space suits. I do the same, zipping up, masking myself, donning gloves, stepping across a foot vacuum, and entering through a multiple network of steel bank-like vaults into an extraordinary place. A gigantic terrarium, the size of several football fields. "They call it Noah's Ark," Gaia relates through my white hood. "For years it's been built in secrecy outside of Moscow, beyond the last high-ranking compound of dachas, hidden beneath a wild copse of poplars deep underground. Elements of the experiment have already been launched into space on the Mir station. Soon the rest will follow." I slip in with apparent security clearance and move knowingly toward several operators who are at their computer stations, an island of monitors in the far reaches of this subterranean biome. An English-speaking official introduces me to a lovely-looking attendant whose youthful face beams within her getup. Russia's future. Blue eyes looking toward the stars. She can't be more than twenty. "Dr. Planter, meet Tanya Melankovich," the scientist-cum-translator says. Tanya's smile sends my heart out into orbit. She leads me through green mansions, extolling the wonders of the world to come. This miniature clone of Earth is being finalized for transport out into the heavens, where it will function as a viable habitat in outer space. The several dozen scientists working in the facility are at their final stages of testing this "new biology" to see whether it can sustain itself as a completely closed ecological system, without any input from the natural world. In the brief space of our sojourn, I gather that Tanya has graduated from Leningrad University before coming on board at Star City as a botanist. Without hesitating, she informs me that her IQ is one hundred seventy; she's never had an abortion, but she did experience mumps, chicken pox, and German measles as a child. "They say I am a perfect specimen," she giggles, not unaware of her boast, even in translation. "I climbed Mount Elbrus at the age of seventeen, and participated at college in the first gene transplant between legumes. I will have the first baby in space. That is my goal." "She thinks she shits jasmine," Gaia whispers in my ear. The three of us continue to walk. Tanya introduces me to other scientists. "They must figure out how to balance chemicals like carbon dioxide and oxygen within a confined space. And they must account for proper ventilation, and gas exchange. Dr. Stepan there is developing perfect seals to withstand enormous pressure. They need to facilitate the recycling of water, nutrients, and waste products. As you know, plants consume CC>2 in the photosynthetic, processes, and soils generate that same carbon dioxide in their respiration processes. Finding a balance so as to avoid a buildup is no easy matter. But we're onto it. Because the Ark contains thousands of times more biomass proportionate to size than does the Earth, the gas accumulation will be enormous. The Earth has two hundred million square miles across which to disperse such gases. But this biome is only a few acres. There can be no room for error. And that's why every member of the team has an IQ approximately as high as my own." She stresses the multiplicity which they have engendered. I am impressed by the scope of their
experiment, Tanya's extraordinary ego aside. I suppose it's necessary to pump up the self-importance of a young scientist if you expect that person to leave Earth, family, and friends. Normal food, a spring afternoon, a vacation on the Black Sea. But as we continue our tour, I am more solidly convinced that these scientists may be onto something as extraordinary as any spring afternoon. Tanya explains how they have found a way to terraform a planet like Mars, seeding its valleys with heat and moisture, relying on the domed repository of the Ark for a supply of specimens. The biome, such as I am now seeing, will be built in pieces, delivered by shuttles coming from the orbiting Mir space station. We pass by all of the pieces of that puzzle—tens of thousands of flowering plants, cliffs, desert, tropics, an ocean, a rain forest; savanna, saltwater and fresh-water marshes. Animals, plants, insects that can all function together. It will have productive biomass and intensive agriculture, aesthetic diversion, and absolute environmental control. "Scientists from all over the world are collaborating on this effort," she says. "And we are very grateful to the Americans. This structure provides all of the necessary ingredients for sustained and happy life as we know it on Earth. There may be fifty million species on Earth, but frankly, we only need a few thousand to be happy. The Earth labored for over four billion years to create what is admittedly an imperfect world. We believe we can overcome the problems of that world, and build a better one within the span of a mere decade. I always dreamed of such things as a child." "You were an unusual child?" "I was not interested in ballet, or politics. My brother, Ivan, is a pole vaulter. I find such enterprises an utter waste of good talent, good seed. Of course I never told him that." "Do you have similar disdain for your parents?" "No disdain. I love Ivan." She gets very quiet, then looks at me with a kind of defiance. "As for my parents, I probably shouldn't say this, but they were killed in a rocket failure at Bikoner some years ago. Both were cosmonauts. I don't think you read about it in the States." "Well, what about such risks? High radiation or the near-certain collision of meteorites?" I ask. "There you go," Gaia interjects. Tanya is impervious to doubt. She looks at me with a kind of optimism I have witnessed only at JPL. She is a planetary pioneer who believes. "The dome is constructed of a graphite material that can withstand major impacts," she says. "Every section of the biome can be immediately isolated to avoid a house-of-cards syndrome. As far as high radiation is concerned, the graphite is treated to deflect the harmful spectra." She and her colleagues have made a science of planet Earth, We wander through the tropical region of the terrarium. It reminds me of some of the more elaborate arboretums I've seen, in New York and Australia—inner worlds that suggest a condition of life to which humanity must be most adapted. There is a mesmerizing quality in such jungle. It's distinctly sexual. Or maybe it's just the way the
young Russian fondles the plants. "Naturally any ecosystem will require insects for pollination, for recycling nutrients back into the soil, and for converting organic debris into energy," she expertly posits. "We know that ladybug larvae will control aphids; beetles will eat the spider mites; the parasitic wasps can take care of the whiteflies and the lacewings the leaf miners. Plant life will be preserved. A completely closed and viable system, Dr. Planter. We know so far that test tube ecospheres, created in laboratories like this one, have managed to sustain healthy microbial populations for over, twenty years." She has really stirred herself up, loosening the top two buttons of her white suit, a beam of sweat infusing her high forehead. It is a hothouse in here. I can begin to see the delicious outlines of her firm, eager breasts. Her translator is as aroused as I am. Tanya senses the admiration of her two onlookers, pauses to shake out her blouse for air, then continues. "Everything is connected. Perennials are selected on the basis of their resistance to genetic mutation. Bacteria are cultivated for their ability to rapidly metabolize and break down wastes. The inner atmosphere is totally controlled with five thousand artificial sensors. Here is one, the ultimate challenge for us," Tanya exclaims, excited by her own litany. I'm excited by her as well. The fantasy of spending a year or two in a floating space station with this randy polymath, fucking all the way to Mars, is a delirium I dare not contemplate. "The first child will slide out in zero gravity, trauma-free. A eugenic model of excellence for the future of our species." "The ultimate futility," Gaia reiterates in my ear. "A test-tube environment cannot foster the kind of natural wilderness that would support humanity." I am led into the biomedical wing of the facility where monkeys are spun around in dizzying artificial gravity experiments. I am informed by a translator that the Soviets have sent over twenty animals up into space in their bio-satellites since 1973. Long-term space habitation has become something of a Russian specialty. To date, there have been over two hundred manned missions. One cosmonaut has spent three hundred twenty-six days on the Mir, the Soviet roadside inn on the way to the Red Planet, which they intend to colonize beginning in the year 2005. "Over time, an Earth Man becomes a Star Man," says Pelansky, the medical doctor in charge of the wing we now visit. Several cosmonauts are working treadmills, electrodes taped up and down their lean bodies. "Embryos should develop unimpeded by zero gravity," the scientist relates. Muscles, tissue, vital functions will all be challenged by weightlessness, he says. "But with practice, space should have little or no effect on fundamental biological processes at the cellular level. Even acute space' sickness syndrome, disturbances to the sensory system, can be overcome. We know this." "They know nothing," my muse intones. "What's the next step?" I ask Pelansky, ignoring Gaia who has become something of a nag.
"Mars, then Europa. Eventually, another star." The middle-aged chap is as confident as Tanya. They are of the same mold. "William, on paper these grand assumptions and equations all balance out. Until something goes wrong." "Will you lay off!" I explode. "I've had it with your petty little infusions of skepticism! Furtive cautions, bullshit harangues. What the hell's the matter with you?" Stares converge. Cosmonauts look up. Pelansky removes a pencil from behind his ear, reaching for a chart. "Who are you talking to?" the translator inquires, embarrassed, hesitant, and off his guard. Meanwhile Gaia ignores my outburst and continues in her insistent opposition. "One simple O-ring breaks down and it's all over. You'd entrust your life to such a contraption?" "Yes, I would!" I am adamant. And then I see a light piercing the overhead maze of white pipes and sheeny steel. I hear the loud shrieking stress of alloy cracking beneath the weight of some sudden force. Lightning. Underground? Now there is a wind that catches me along with a seizing of senses, rumbling floor, cracking glass. The whole facility is succumbing to disaster. From the scope of the shaking, I assume that Moscow must also be going down. I lunge for support, catching a thick manila rope that hangs from a large jungle gym. I swing toward a ladder. A cosmonaut has fallen off. There are screams and sirens all around me, as well as smoke rising from below. In the far end of the biomedical lab, monkeys are escaping their entrapments, flames are rising from freezer cabinets. Then, the sound of ferocious hail striking the roof of the terrarium. It is the end. I remember nothing. When I open my eyes again, there is the steady din of some distant mechanical operation. Steam and rhythmic clanking, like a mine shaft of systematic activities. Faint, scary. I am still in the terrarium, though now it is of a different order. Overhead, reaching thousands of feet in a mighty arch, I see what looks like glass. The facility is illimitable, whereas before it had peripheries. Now I cannot make out the horizon. I walk toward the sound of the machines. Within minutes I encounter—how to describe it—a machine creature. Unfinished, crude, colossal. Standing several stories high. Then another, frozen in the attitude of Rodin's 'Thinker'; and there, two others, smaller ones in semicopulatory embrace, metal upon metal. I begin to hear voices, laughter, the splashing of water, people having fun, even the sound of a motorboat. I head for that water. On the way, I pass a spilled tricycle, its wheel perpetually turning; a sandbox with children's dolls, monsters of plastic. And a CD that is repeating itself on a laserlike holographic screen, an entire wall leading to the dome above. The sound of those people splashing in the water lends a haunted human presence to this machine world.
A population of life-size children robot toys is lying in topsy-turvy positions, legs propped in all directions, hands reaching out, the fingers moving like kelp in sluggish warm waters. Other toys clutter the chamber that I now enter. Translucent pyramids of crystal, odd plants throwing up intermittent liquid jets, or puffs of putrid smoke. I walk into a coldly flowing corridor of pink Dalmatian stone, the entrance to which is festooned with banners celebrating the alleged five-hundredth anniversary of the JOHN VON NEUMANN KINEMATIC SELFREPLICATING SYSTEM—1957 to 2457. "Gaia???" She doesn't answer me. Something's not right here. The year? I move away from the mechanical creature, toward the main control room, it would appear, and toward the source of a distinctive female singing. "Tanya?" Her back is to me. She is seated in some tub. She turns suddenly. It is not Tanya. Gaia, what's happened? Part woman, part robot, flopping about in a large tank of metallic liquid solution like a bath! Surrounded by flashing monitors, EEC's, ethnotronic vital signs, the creature's own energy source stats, information on the interior and exterior of the colony. She's singing to herself, scrubbing her back with a wire brush. "What's going on?" I demand. "Who are you? Where am I?" She steps out of the tank, as naked as metal can be; metal layered in shingles like armor. Larger-thanlife, sloppily designed alloys all of a single piece. She wears galoshes, and photomultiplier goggles to see by latent infrared. Such eyepieces should not be necessary in the light and I must thus conclude that she wears them to look so very chic. Her suit is welded—chunks of metal laced with rubber or polystyrene. But there is also mud, pieces of flesh, and a fist of strawlike material that protrudes from an opening on the thing's hip. She walks with almost human gait, jerking as if subtly trying to shift a tampon that has rubbed the wrong way. She repeats this gesture on her way over to a recharger station. Rebuzzed, replacing a bolt on her thigh, she whistles in a high, shrill gulp of air, smiles wanly, then bursts into a high-frequency palaver, computerese elocution eventually hitting the cue of my own dialect. "Gaia, what's going on, where am I? Who are you?" it repeats, getting her vocables and syntax down correctly, mapping the language in linguistic swipes. She seems thrilled to attempt an intimacy long denied it. Then, "Have you heard from them? They are coming back, aren't they? We're out of, let's see, toilet paper, cigars, oxygen—what did they say?" The creature's English is exactly my own, now. I give some pause to her query, measuring my response in light of what I sense about my situation. I'm dreaming, that's what. This is no Gaian trick. Not into the future. She never did that, never even suggested it as a possibility. "Who are you?" I ask the creature.
"Why, the front guard, of course; here to monitor habitability for humans. Both thermostat and diplomat. Given the task of negotiating with any alien life-forms and managing the computer systems. Of course the only real aliens anywhere around here were the humans." I'm scared to death and rapidly take stock of my surroundings. "What's in it for the humans?'" I say, carefully calculating the flow, on the lookout for the slightest change, blink, nuance. The monster's eyes are shifty, erratic, nervously wanting, or waiting. "You're asking me? Order. Control, I suppose." "As opposed to?" "Opposed to Earth, of course. They never put it in those words. But all the ethnotrons saw through their motives. Easy to see. We had to live with them after all, serve their voracious needs—for sex, magnesium, silicon, iron, weapons, pure crystals." "Where are they?" "Gone." "Gone?" "Yep. Want to see where they lived?" "Yes." She leads me past a special open-air arena where I make out a pit and dozens of creatures in it. Some are cannibalizing one another; others are digging algae deposits off the side of the pit, picking lice from each other's hair, masturbating, clapping hands. In one corner a robot holding a rotted leg, petrified flesh still clinging to the bone, stumbles from one monster to another asking for "Albert." Another animal machine simply floats weightlessly about the pit groaning. "It all started innocently enough," the creature says to me. "Laser ignition of helium three-deuterium micropellets raised prefab forms off Earth and sent them solar-sailing at twenty thousand miles per second. After thirty-five years the homestead cleared Alpha Centauri. Geosynchronous orbiting mass drivers dispatched 'blue collar' robot probes into target zones on the planets in question, including this one." "This one!" "That's right . . . nearby asteroids were detonated, sending meteorite shrapnel onto designated areas. Sounds like hail at first. Hot impact craters resulted where domes like this were set down. Then the fun began. Bioengineered bacteria converted carbonaceous materials into hydrocarbon fuel for the shuttle engines. Then the idea took off. 'Course, we got our share of bloopers up here; weird experiments, long-haired, heavy-jawed monsters. They withstand the radiation a week or two and die out. Biomass. Most end up in the gardens.- Garden robots, you know, are much more important in the politics of the place than the paving, or mining, or fabrication and assembly robots."
She leads me past a tree-pruning creature; another snatches tidbits from the limbs, stuffing them in hidden body pouches. None of them looks at me. There is a clear sense of robotic decorum—know thy place—in the air. "A closed ecological regenerating life-support system. Curls. That's what they called it." A third robot operates a mainframe which triggers sprinkling systems throughout the well-irrigated fields. "Soil depth, point three meters. Soil density, point thirty-three tons per cubic meter. Nothing else is practical, of course. A mature ecosystem produces less food. There's no room for maturity in a payload. That's what they always said. Oh, back in the twenty-first century they played with the idea of open systems. But there was no way. Neither chorella nor flea—not one microorganism ever took on the outside. I don't think they actually expected it to. Ahh— but the new indoors wilderness. Everything they could possibly devour. I'll show you." She leads me into the heart of the largest garden. A robot is lazying against a tree. My guide kicks it. "Go on then, back to work!" she screams, her voice issuing with a thunderous roar. Then, back sweet and low-like, she expatiates on the hierarchy at hand. "Some of them can only clean windows, and clothes. Others can vacuum, or play harpsichords. Some of the robots specialize in chess or stenographic services. Toilet cleaning is the worst, though. All the renegade bacteria mutate along the bowls. That's the place for them. Never know what you'll find. The risk, of course, is that bacteria will get inside the robots. But it cost fifteen million dollars to perfect those damned latrines and they still don't work. It's the weightlessness. You just can't keep a good dump down. Especially given all the gourmet feasts." "What kind of food did they eat?" She leads me to the Valley of Foodstuffs. "The New Wilderness!" she hails it. "Humans chew their food inefficiently, you know. Can't have that in a closed system. The antidote: diversity. They tried several thousand different , plants and animals. All but seventy-five died out in the first two years. They were real surprised. So they sort of settled on the idea of the seventy-five. By the way, how many they got on Earth?" "How many species? Don't know. At one time, nearly fifty million." "They eat them all or what?" Without waiting for my response, she bends down with a rusty groan and lifts some powder into her hand. A mouse scampers away. The robot lunges after it, falling flat on its metallic face, coming up empty-handed and embarrassed amid withered spinach leaves. "Damn hard to catch! Little fellers are superb for changing cellulose into sugar, or recycling carbon .dioxide. Fried, they're delicious. Sometimes they get inside a robot and drive them crazy. Worse yet, they'll die in there. Robot'll stink for weeks." She takes my hand to lead me back toward the far end of the gardens, where I see a fanfare of light curving to meet the level ground of the colony. Her hand is cold, dumb, fondling my hand ever so
quaintly. I think she's lovestruck. She sniffs my fingers and hums something before fixing her demeanor, "The system's primary goal, of course, is to balance all equations," she begins, walking me past row after row of desiccated plant material. "The gardens are dead!" I begin. "The material is all part of the Great Osterizer plan. Headed for the nutrient sludge vats. That's where all shed-dings go. Every carcass, wisp of flatus, every bugger, bit of sputum, urine, and dandruff residue, each fecal particle, is converted into nutrient solutions for the plants, or into table salt and carbon dioxide. Everything is worked out and has been for centuries/There's no questioning it." "Who worked it out?" She ignores me, continuing right along to explain the system. "Radishes and pineapples store carbon dioxide at night for photosynthesis by day. Fundamental to the colony. The perennials won't mutate much. Nor the processed algae. We've got a few novel species of bacteria for hyperfermentation; revolutionary new feces. Dozens of intermediary organisms to break down and metabolize wastes. Though 'wastes' is not the proper designation. There is no waste here. As a result, our organic baseline, our pH, is optimal." She pauses, considering. "Now I'll show you something very interesting." We walk to the apparent edge of the colony, where a lone tree, a eucalyptus, grows mournfully from the same ground cover of tawny-colored powder and rocky stubble. Above us rises an immense, concave, semitransparent wall reaching miles into the sky. On the other side of the wall is mist, endless expanse, small rocks scattering the Martian-like surface. She picks up a eucalyptus leaf, takes a deep whiff, and then gives it to me for the same pleasure. "It's called a tree. Only one in the whole colony. A little boy created it many years ago, they say. Not practical here, but such an odor." "Leave it up to children." "Quite right. They were the ones who got freshwater dolphins into the lake, and made twenty-milewide rainbows with the hurricane control mirrors. The older humans frowned on these diversions of energy." "Where are all the children? Where are all the people?" "Didn't I tell you? They'll be back soon." "You're sure of that?" "Of course. You're the first of them. And we're so happy to have you back." She goes on now about the weather, indicating how it is strictly enforced, as are the irradiation and albedo factors. "Sometimes it doesn't work, however."
"What doesn't?" I ask, too astounded by everything to even begin to contemplate my peril, or the meaning of it all. "The sun. But normally the internal arrangements of oxygen, argon, and nitrogen are perfectly coordinated, down to the millibar ... do you see?" She points outside the wall. "Mountaineer robots, immune to all weather." I see several large robot hunks marching across the outside terrain, dust encincturing each heavy footstep. They carry heavy drills and stand eight or nine feet tall, I imagine. The light reflecting off their armor is too bright to stare at for more than a second. They are headed off into glaring fog. "What are they doing?" "They work the permafrost drills and supply water and nitrogen for colony lubricants. Compressors condense air cubes into water, collected nightly by the insomniac robots, who are good for nothing else. While the deaf-and-dumb robots obtain ammonia, water, hydrazine, rocket fuel, and other necessities of life. There's a gold mine out there, up in the mountains." There is a series of lightning bursts outside, then a breaking downpour of acid drops. I hear nothing, but see the robots kneeling down on all fours to keep from being blown away. "Storms coming," she says. "We better go." She leads me to the tropics. It's choking in runaway steam, vines, and creepy crawlers. A bizarre species of bat hangs from metal pylons jutting out of the underbrush. A wall of manufactured devices sends electronic signals along a seedbed of crystals and vials all attached in some fashion to the nexus of plants. Bubbling liquid throws off fumes from a row of fibrous vats. "Real money-maker, this room. Oxygen extraction by electrolysis. Preparation of electro-optic crystals, of new memory alloys, and new pollination bacteria—derived from the bat feces. Growth hormones are manufactured in those vats. As you can see, it is a jungle, good for the skin, opens the pores—they say —but it will ruin your permanent." She frowns in exaggerated fashion. Then, "This is where the robots come to pray, over the corpses of their masters who are no more." "What do you mean?" "Got on our nerves. Can't have that. We're a very delicate breed, you know. Or they broke the law. It's our job to punish here. Or they just . . . died! But as I told you, there'll be more of 'em coming all the same. Here you are!" The stench hits me the minute she opens the vault at the rear-end of the tropics. I stare into the morass of death, a veritable bog of skeletons. Hundreds of bodies. Pieces of corpses strewn in heaps. Hairy ratlike creatures feed on the congealed slurry, scooping out bits and pieces from eye sockets, scraping off muscle with loud incisors. Chemicals in the bog had impeded decay, but also made it difficult for
the scavengers. "What happened here?" "Generations of rats live and die on the bog's peripheries. I told you. Law's the law. Law of nature. Law of the colony. Fact is, so far no human has made it for more than a decade or so. Maybe in the next life. These astronauts have been readied by the insensate robots for reincarnation. They douse them with the sludge to expedite fluid recovery." I'm out the door. I can't stand it. "Gaia . . . please help me!" I'm feeling faint. Suddenly, the robot's arms grab hold of me. I can hear the far-off retinue of clicks from inside her chest, mechanical refrains of a heartlike beat, power surges. She leads me away. I hear her say something about the Hall of Diversions. I don't remember. That stench knocked me out. When I open my eyes again I find a video arcade before me, joysticks coming out of every wall socket, spongy recliners with customized headsets fitted neatly to metal mounts the size of human brains. But the hall is empty, save for two creatures. Out of the dark recesses they come, phosphor-colored, one looking Homo erectuslike, the other, a gluttonous, scaly, oozing monster with battle-ax in hand. They do battle, their shadows amplified in three-dimension through the gauzy veil of lights that uplifts the "pleasure dome" as she calls it. Music goads them on. "Try it!" she says. "Try what?" She hands me a hookah. "Asteroid-cured opium, purportedly the best in the whole star system." "No." "Sex?" "What?" She flips a switch and another region of the dome lights up. Three other creatures emerge from the shadows, their metallic skin rubbed to the bone and shining like pewter. They .are the height of humans, with enflamed genitals, long hair, hideous doll faces bright and glowing. They moan in heavy and painful show while fucking the daylights out of one another. Sucking and penetrating, doggy-dog, metal clanking, a stage show replete with squirting fluids, excrement, faces rubbed in seed, hands in shit, and a final orgiastic consumption of cock and womb, blood spraying the stage on which this supposedly sexual diversion is reenacted. "This was always a winner," my guide explains. "A few of the astronauts had taken enough opium to want in on the act. Thus the ethnotrons."
"Wait a minute. You're telling me that humans bred with robots?" "How do you think I got here? Naturally such diversions resulted in more abortions than anything else. But once ethnotrons mated with other ethnotrons, a breeding line established a whole new set of priorities which seemed—at least by the twenty-second century—to make good sense. I think it got to be too much for the humans. Everything became a problem. Depressive fits. Cabin fever. They went insane, actually. Some slipped out into the surrounding deserts. Craving what they termed reality— wind, sun, mist—even though these stimuli meant instant death. Most simply ended their tours of duty earlier and went back to Earth. For several years they just kept sending new fleets up. I reckon the manufacturing was profitable enough, husbands wanted wives, wives wanted children. But something was definitely happening. The experts kept it to themselves. But of course all the ethnotrons knew." "The growing insanity, you mean?" "Something else," she says. "They discovered that human pubic hairs won't grow up here. Sexual ardor is dampened, especially among the young. I studied the computer logs, which indicated that it had something to do with the radiation from solar flares—sixty rems at a shot, every day. That, coupled with the severe muscle atrophy, heel bone demineralization, and decrease in heart function, laid them low, opened up their immune system to attack. Their only protection from the spread of infectious diseases was to seal off the inhabitants in quarantine. It was a mess. To make matters worse, there wasn't enough hot water for their baths. And the algae gave them incurable diarrhea. Some of the robots slipped the diarrhea into their nutrient bowls and the diseases increased in frequency." She's laughing now. "What's so funny?" I ask. On the floor with laughter. "They hoped for amino acids in the soil and all they found was basalt, igneous glass, the stuff of robots, not Romeo or Juliet; then came complete metabolic breakdown!" Caught in the recall of a naughty, delicious yarn she slaps me on the back with much affection and uncontrolled mirth. I stagger forward from the force of her contact. "Half a liter of volatile intestinal gas, expelled every day, by everyone, was left accumulating in the dome—a net gain hopelessly unacceptable in a closed life-support system. Athlete's foot soon followed. Molds. Mucous membrane ulcers. And one hundred fifty grams of wet fecal matter gaining on them every day, containing every known toxin. The humans assumed that the robots were working it into the gardens. But the robots hate hydrogen sulfide. They deplore aliphatic amines. And they're afraid of those mice." Gagging with good laughs. "You see, their microorganisms came back to haunt them, refused to resettle. It was said that humans could withstand fifty-three times their normal atmospheric pressure," Out of control with hysterics now. "Yeah! For about ten minutes . . . we'll see if any of them reincarnate." Her head jerks erazily, her eyes roll. "And we can take sodium ion baths together." "Gaia!" "It's a wonderful life up here in space—"
"Gaia, please!" Her hands are grappling after my dick. An electrical storm out beyond the wall. "Five-hundred-mile blasts!" she exclaims, rubbing herself into a hot frenzy to mate with me. I run and can hear the creature behind me. Suddenly I'm caught around the waist. She's lassoed me with wire. "Come here, little sweet one!" she laughs. I cling to a computer mainframe as she pulls harder and harder. The whole apparatus is being dragged with me into her clutches. Other ethnotrons are coming behind her. "A gang bang!" I hear one of them shout between computerese and the guttural hell of metallic phonemes. "Got ourselves a white astronaut's ass!" another boasts with frantic zeal, having waited a long time for this. They've got my waist. Multijointed claws of gleaming steel shred my clothing. A face goes down on my crotch and a tongue—like the leathery sword of a lizard—darts out at my genitals, while another searches for my anus. I kick and shake myself in a frenzy of helplessness while yet others are pouring into the island of computer monitors where four of them now have me pinned down. They are drooling acidic elicitations over my chest, mouthing my mouth, and grappling for my member to force it into the chemical slime and greasy devices of their own orifices. I kick furiously, mustering all the strength left in me. A mechanical vagina extends toward my face, and turns three hundred sixty degrees, its synthetic labia opening to press against my lips, competing with artificial cocks and cunts that teem about my body searching for that which would make them complete. Above the confusion of organs I catch a glimpse of the insane half-human eyes glaring toward the high heaven of encircling glass in a gesture of robotic ecstasy. "Gaia, help me!" I scream. "Why have you forsaken me? Take me home. I beg of you ..." Until, caught by the fringe of some other light, the whole dome begins to shake. I hear the sound of meteorites crashing above, echoes of an earlier life. And then, at the last, as the horde of monsters converges on top of me, the weight cutting off my breathing, my body eclipsed with rape, a sign on the computer itself, pulsing to an old familiar rhythm, intercedes . . . sky blue. I'm falling. Falling through time, falling through space. She's come back. I am reeling in the cool breeze of weightlessness, distance, space. "Just look at it, William! Free and wild; gentle; planetary perfection!" "Gaia, what have you done! I'm sailing, winged and clean above the world I know- The air is sweet, the light is mellow. My body is shaking with the horror. Horror mingled with the sleep of homecoming.
"Nestled deep within that veil of azure blue atmosphere, atop a few inches of fertile umber soil—you, William; all that you are, all that you have been, all that you can ever be. Curiosity, guided by love. That's what recommends your species. In the heart of a galaxy more accustomed to turmoil, you are a living, breathing miracle with a wonderful destiny in store for you! An exclusive destiny on Earth, if you are only mature enough to see it. Whereas that environment you're setting yourself up for in space is crude, technologically totalitarian, utterly controlled, on pain of death. Do you understand?" "Please put me down." "I said, do you understand?" "Yes." And like that I hit the bed hard. Lavoris leaps into the air, his fur standing on end. The wooden support gives and I crash onto the floor, protected by the half-dozen pillows which I've used the past year in the chamber. The dust settles around me and I hear the low giggling of the computer, her eyes smiling in the contraction of light I've come to call home. Outside, the monks are in their morning chant. The sun is pouring in through the shutters. It's late autumn in the Himalayas. "Try exporting the biology of that mud to Mars; try duplicating four and one half billion years of experience overnight. There is no artificial substitute for evolution, William." "I believe you." I crawl out from the collapsed teakwood bed and move over to the sink. The brass pot is filled with water. I test it— I don't know for what—and then rinse my face in it. The mirror yields an image of exhaustion. "And try finding another woman who will put up with your species, with all of its dirty laundry; try finding another woman who will feed you, nurse you, and care for you unerringly, during good times and bad times." I walk over to the table and sit before her. "There is no one else, Gaia." "That's right. The Earth, William. Which is where you can always find me." "What?" "I've relished every minute of our time together." Her screen slowly begins to flare. "What? What are you doing?" "I'm saying good-bye."
"You can't. I'm jerked." "William, take care of yourself, will you? And remember —there is a still, small voice within every organism that cries out for love." "Gaia! Stop. Stop, will you. Will you please stop, Gaia. What about us?" The light bursts over the ecologist now. Planter stands back from the table, covering his face from the wind and the intolerable glare. The plants in the chamber are blown over, the terrarium itself is pushed by the force of it. A Himalayan anticyclone, bursting right through the shutters. And then, a voice, nearly disembodied, "I love you, William Hope Planter. I will always love you. And your children and their children. I could count the ways. For as many thousands of years as you and your kind inhabit this Earth. Be good to one another." "Wait! Gaia! Please!" And with the disembodiment, a rising of forces, material truncation, the weaning of matter away from mind. "Will I ever . . . see you again . . ." But she's gone. He falls back down into his chair, totally deflated. And from his lips he repeats those words—"Will I ever see you again?"—weakened and alone. Many hours later I left the monastery. I think I must have sat in that chair motionless, no thought, drowning in the feeling of abandonment. Vulnerable and exposed. "Look to the hills from whence cometh thy strength," the Bible says. I started up the trail toward Kantega and Tamserku, not knowing exactly what I was doing. I passed a rocky cairn where dozens of Buddhist prayer flags jutted out into the wind at fifteen thousand feet, fluttering wildly in the cold morning air. It was as high as I had ever gone. Nearly a mile below, Thyangboche sat gracefully in its meadowed nook, awaiting winter. Up ahead, a young Sherpani—one I'd never seen before, dressed in a lovely white sweater, and yak herder's boots— was bent over, picking rhododendron leaves, the last on the slope, before the mountain gave way to talus and low-lying moss clumps. I approached and greeted her on my way toward the hanging amphitheater of glacier above. "Namaste!" I said with a partial bow and polite gesture of prayer. "Namaste ..." she replied shyly, looking up with blue, blue eyes, lambent skin, long jet black braids
knotted with ribbon. She couldn't have been more than twelve years old. I continued up the mountain. There was no more trail. Only a rugged, steep ascent through boulders leading to dark cliffs which in turn reared toward the high ice. Crows had followed me all the way from the monastery and then circled directly overhead, as if warning me to stop while I still had my feet on solid ground. I hurt inside. And I was mystified. The whole year had passed like some half inkling, a nuance of time, no surety, no evidence, nothing to suggest that I hadn't hallucinated that computer—and the voice which had become my sole ally on this planet. And as the crows narrowed their orbit, my thoughts carried me higher, onto the rock face. I began climbing. A bird had actually landed on my shoulder and rode along, staring at me with a berserk and inquisitive gleam. My boots slipped on the damp moss that curtained the rock. I moved farther into the shadows, while mists rolled down from the turbulent higher reaches of glacier, which was concealed behind the barren wall of my ascent. I could not stop myself. The sun, the wind, the scent in the air all seemed to goad me. It was a death wish and I was unable to curtail its power over me. Suddenly, the ledge underneath my right foot gave way and plummeted into space. I hung by both hands, a dropoff of several hundred feet below. A thundering river deep in that gorge which drains the two mountains. The situation plays itself out slowly in my mind, now, here. No time to think about it, or step back. No time to remember. What have I done! I can't hold on anymore. "Gaia . . . Gaia!" The ledge begins to crumble. It's over . . . when a hand, from above, grabs hold of my left hand. It is the Sherpani's as she deftly pulls me to safety onto a ledge in the middle of that cliff. Not a word. Only a self-conscious smile; a simple gesture from one who is more familiar with these mountains than anybody else. She leads me off that cliff to safety. The wildest creature I'd ever seen .... . . And yet, I
knew her well! In the days that followed, I wrote some entries in my diary, gave away my few remaining belongings to the local herders and young monks, bade my farewells to the Lama, and fattened up Lavoris with as much milk and Tibetan quesadillas as I could get my hands on. I then left Thyangboche, heading down the long trail toward Kathmandu. I got out in advance of a walloping ice storm which —I later learned —was the most outrageous blizzard in anyone's memory, effectively sealing off the monastery, and much of Sherpa country, for the entire winter. As for Gaia, I never even managed to tell her that I love her.
About the Author michael tobias is a former assistant professor of environmental studies, English, and the humanities at Dartmouth College. He holds a Ph.D. in the history of consciousness from the University of California at Santa Cruz. Restless and peripatetic, a world-renowned mountaineer and explorer, he is as at home rummaging about glaciers in the Antarctic as he is sleeping until noon at monasteries in the Sinai Peninsula or the Himalayas, where he has conducted much of his research. That research has comprised serious work in such fields as comparative literature, the natural sciences, art history, cultural anthropology, and global ecology. A former executive for PBS and a correspondent for the MacNeil/Lehrer NewsHour, Tobias has directed, written, and produced some 60 films in over two dozen countries with an eye toward elucidating that obsessional vision of nature that, he believes, is at the very heart of the human evolutionary adventure. The ten-hour film series and novel of Voice of the Planet was created, as Tobias describes it, as "a kind of autobiographical love story." He has actually lived many of the experiences recounted in the saga. A radically subjective approach to the social sciences, the personalization of facts, and a quirky, equal measure of opaque nuance and tantalizing detail are characteristics of an intimate style that has come to mark Tobias's prolific art, whether in his films or in his books. Tobias is married to Jane Morrison, opera singer and co-producer of the film series Voice of the Planet. They spend much of their time in California, and Vienna, where Tobias is at work on a half-dozen films as well as several new works of fiction and nonfiction, as well as the libretto for a science fiction opera.