YAC Protocols

CHAPTER 1 Generation of Large Insert YAC Libraries Zoia Larin, Anthony P. Monaco, and Hans Lehrach 1. Introduction Th...

Author: David Markie

12 downloads 2145 Views 27MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

CHAPTER 1

Generation of Large Insert YAC Libraries Zoia

Larin, Anthony P. Monaco, and Hans Lehrach

1. Introduction The introduction of yeast artificial chromosomes (YACs) as cloning vectors in 1987 has significantly advanced the analysis of complex genomes (I). The capability of cloning large DNA (1004000 kb) as YACs has accelerated the construction of physical maps and contig building (a contiguous set of overlapping clones). YAC contigs now cover entire human chromosomes (i.e., Y and 21) (2,3) and small genomes (i.e., Schizosaccharomyces pombe) (4), and large YAC contigs cover much of the human genome (5). The main advantages of YACs over prokaryotic-based cloning systems are their large insert capacity and ability to maintain sequences that are unstable or not well represented in bacteriophage or cosmid genomic libraries (6). Therefore, YACs complement existing cloning vectors (cosmids, bacteriophage) and new cloning vectors (Pl bacteriophage [Pl], bacterial artificial chromosomes [BACs], and Pl-derived artificial chromosomes [PACs]; for review, see ref. 7) in mapping and chromosome walking projects (6,8). Several laboratories have generated YAC libraries from different eukaryotic genomes including arabidopsis (9), S. pombe (4), mouse (IO, II), and human DNA (10,12,13). Libraries usually have been constructed in the Saccharomyces cerevisiae strain AB 1380, but other strains are available with additional genetic markers that may be useful for selection of products following homologous recombination of YACs From Methods II) Molecular B/o/ogy, Vol. 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

1

2

Larin, Monaco, and Lehrach

(14). In addition, recombination deficient yeast strains (radl or r&52) have also been used to reduce the problem of chrmerism owing to recombination in YACs (15), and these strains stabilize some sequencescloned in YACs (16). Analysis of YACs maintained in rud52 and radl yeast strains compared to standard strains indicate that the frequency of chimerism is lower (27). Different YAC vectors with centric and acentric arms have been constructed that allow rescue of end fragments in yeast for chromosome walking projects, and a bacteriophage T7 promoter for generation of riboprobes from the rescued end fragments (14). Other YAC vectors incorporate a conditional centromere that allows for amplification of YAC DNA under appropriate conditions (18). YAC libraries have been constructed by preparing and size fractionatmg high molecular weight DNA in solution using sucrose gradients (1,12), or in agarose by pulsed field gel electrophoresis (PFGE; IO, 13,I9). When DNA is prepared in agarose, YAC insert sizes are larger on average because shear forces seen with DNA in solution are minimized. However, partial degradation of DNA occurs when melting agarose containing high molecular weight DNA, perhaps due to metal ion contamination or denaturation (10). The presence of polyamines (10) or high concentrations of NaCl (100 mM) (20), protects DNA in agarose from degradation at the melting step. The authors constructed mouse, human, and S. pombe YAC hbrarres with average insert sizes of 700, 620, and 500 kb, respectively, by incorporating polyamines in the cloning procedure (10). This chapter describes in detail the protocols the authors used to construct large insert YAC libraries. This includes preparation of pYAC4 vector partial digestion of genomic DNA in agarose blocks, size fractionation by PFGE both before and after ligation to vector, and transformation of the yeast host AB 1380. 2. Materials 1.

Preparationof vector: All library construction protocols in this chapter are basedon the pYAC4 vector (I), avarlablefrom the American Type Culture Collection.

Vector DNA is prepared by large scale plasmid

extractions and

purification by CsCl gradientcentrifugation (22). 2. Restriction

enzyme digest buffers: For most restriction

digests, buffers rec-

ommendedby the manufacturerare adequate.The authorsrecommendT4

Large Insert YAC Libraries

3

polymerase buffer (21) when digesting vector DNA because it works with almost all restriction enzymesand calf intestinal alkaline phosphatase (CIP; Boehringer, Mannheim, Germany, 1 U/pL), thus eliminating precipitation of DNA and buffer changes between enzyme reactions. 1OX T4 polymerase buffer: 0.33M Tris-acetate, pH 7.9,0.66M potassium acetate, 0.1 OMmagnesium acetate, 0.005M dithiothrettol (DTT), 1 mg/mL bovine serum albumin (BSA). Store frozen at -20°C m small abquots. 3. Preparation and lysis of cells in agarose blocks: High molecular weight DNA from fibroblast or lymphoblastoid cell lines, whole blood, or fresh mouse spleen tissue IS prepared in low melting point agarose blocks (‘221, with 2-5 x lo6 cells/block (approx 1.5-40 pg DNA). 4. EcoRI partial digestion reaction buffer: 1 agarose block with DNA 80100 uL, 50 pL (5 mg/mL) BSA, 50 pL 10X EcoRI methylase buffer, 13 pL (O.lM) spermidine, 1 U EcoRI, 50-200 U EcoRI methylase (NEB), distilled water to 500 pL final volume. 5. 10X EcoRI methlyase buffer: 800 pM S-adenosyl-methionine (SAM, NEB), 0.02M MgCl,, 1.OM NaCl, OSM Tris-HCl, pH 7.5, O.OlM DTT. Store frozen at -20°C in small aliquots. 6. 100X Polyamines: 0.075M spermidine-(HCl),, 0.03OM spermine-(HC1)4 Store frozen at -20°C m small aliquots. 7. 10X Ligase buffer: 0.5M Tris-HCl, pH 7.5, O.lM MgC12, 0.03M NaCI, 1OX polyamines. 8. YPD medium: see Chapter 29. 9. Regeneration plates (23): 1.OM sorbitol (Sigma, St. Louis, MO), 2% dextrose, 0.67% yeast nitrogen base without amino acids (Difco, Detroit, MI; add as filter sterile after autoclaving of agar), 1X ammo acid supplements (without uracil), 2% agar. 10. 1OX Amino acid supplements (23) : 200 pg/mL adenme, 200 pg/mL arginine, 200 ug/mL isoleucine, 200 pg/mL histidine, 600 pg/mL leucine, 200 pg/mL lysine, 200 pg/mL methionine, 500 pg/mL phenylalanine, 200 yg/mL tryptophan (light sensitive, filter sterilize and store at 4OC), 1.5 mg/mL valine, 300 pg/mL tyrosine, 200 yglmL uracil (omit in regeneration and selective plates). 11. SCE: I.OM sorbitol, O.lMsodmm citrate, pH 5.8, O.OlMEDTA, pH 7.5, 0.03M 2-mercaptoethanol or O.OlM DTT (add fresh). 12. STC: 1.OM sorbnol, O.OlM Tris-HCl, pH 7.5, O.OlM CaCl,. 13. PEG: 20% Polyethylene glycol6000 (PEG, Serva, Heidelberg, Germany), O.OlMTris-HCl, pH 7.5, O.OlMCaCl,. Make fresh and filter sterilize. 14. SOS: 1.OM sorbitol, 25% YPD, O.O065MCaCl,, 10 ug/mL tryptophan, 1 pg/mL uracil. Make fresh and filter sterilize.

4

Larin, Monaco, and Lehrach

15. YAC selective media and plates: 2% dextrose, 0.67% yeast nitrogen base without amino acids (add filter sterile), 1X amino acid supplements (without uracil and tryptophan), 2% agar for plates. 16. Contour-clamped homogeneous electric field (CHEF) apparatus. The authors recommend the BioRad (Richmond, CA) system. 17. Small horizontal gel electrophoresis apparatus: Use to check restriction enzyme digests of vector and test ligations of vector and genomic DNA. 18. Electrophoresis buffer: For both CHEF and horizontal gels, the authors recommend TBE. 10X TBE: 0.89M Tris-borate, 0.89M boric acid, 0.016M EDTA. 19. Agarose: The authors recommend regular (SeaKern) and low melting point (LMP) (Seaplaque GTG) agarose from FMC. Most gels will be 1% (w/v) (aqueous). 20. Yeast and/or lambda concatamer size markers (BioRad). 21. Agarase (Sigma) dissolved in 50% (v/v) glycerol in water and store at 10 U/uL at -2OOC or P-agarase (NEB, Beverly, MA). 22. T4 DNA ligase (NEB) at 400,000 U/mL. 23. T4 polynucleotide kinase (NEB) at 10 U&L. 24. 1X TE: O.OlMTris-HCl, pH 7.5, O.OOlMEDTA, pH 7.5. 25. Proteinase K (Boehringer-Mannheim): Dissolve in water at 10 mg/mL and store in small aliquots at -2OOC. Alternatively, use pronase (BoehringerMannhelm). Add directly at 2 mg/mL. 26. Phenylmethylsulfonylflouride (PMSF, Sigma): Prepare at 40 mg/mL m ethanol or isopropanol and heat several minutes at 68°C to dissolve. Caution: Use gloves. It is toxic. 27. 0.5M EDTA, pH 8.0. 28. Lyticase (Sigma): Weigh out fresh prior to spheroplast formation (500 U/ 20 mL of yeast cells in SCE) and dissolve in SCE or water. Lyticase is difficult to get in solution and will need extensive vortexing. 29. 2-Mercaptoethanol (BDH, London, UK): Open m hood and use gloves, 30. For the yeast transformation, a spectrophotometer, a student microscope (lox, 25x, and 40x objectives and phase contrast), and a hemocytometer cell counter are needed. 3 1. Phenol equilibrated with O.lM Tris-HCl, pH 8.0. Caution: Wear gloves because phenol burns. 32. Chloroform. 33. 100% Ethanol. 34. Trinitriloacetic acid (BDH): Dissolve in water at O.lSMand store frozen in small aliquots at -20°C. Used to inactivate CIP.

Large Insert YAC Libraries

5

3. Methods 3.1. Preparation of pYAC

4 Vector 1. Before preparing pYAC4 arms for ligation to genomic DNA, test plasmid preps for deletions of telomere sequences during propagation in Escherichia coli. Digest 0.5 pg of the pYAC4 plasmid with Hind111 and check on a 1% agarose gel. Four bands should be visualized: a 3.5, 3.0, 1.9, and 1.4 kb doublet. 2. If there is an additional smaller fragment below the 1.4 kb doublet, then telomere sequenceshave been deleted from the plasmid and another preparation should be attempted. 3. For preparattve vector arms, digest 100-200 ug of pYAC4 with EcoRI and BamHI to completion m 500 pL 1X T4 polymerase buffer and check on a 1% agarose gel. Three bands should be visualized: 6.0, 3.7, and 1.7 kb. 4. Heat kill the EcoRI and BamHI at 68OCfor 10 min. 5. Add directly 0.03-0.06 U/ug vector of CIP and incubate at 37°C for 30 min. 6. Inactivate the CIP with trinitriloacetic acid to 0.015Mat 68OC for 15 min. 7. Extract twice with phenol, once with chloroform, and precipitate with ethanol. 8. Resuspend the vector arms at a concentration of 1 ug/uL in O.OlM TrisHCl, pH 7.5, and O.OOlMEDTA (1X TE). 9. Check the efficiency of dephosphorylation of vector ends and the ability of these ends to ligate after phosphorylation. Set up two 20-uL ligation reactions (2 pL 10X ligase buffer without polyamines, 0.5 ug of digested and CIP-treated pYAC4 vector, 1 U T4 DNA ligase), one with and one without 1 U of T4 polynucleotide kinase. 10. Check hgations on a I % agarose gel: a. Without kinase: 3 bands should be visualized as after digestton; and b. With kinase. The 1.7 kb BamHI fragment can ligate to itself and form several supercoiled forms below 1.7 kb. The upper arms (6.0 and 3.7 kb) should ligate together by their EcoRI and BarnHI sitesand form several larger fragments. 3.2. Partial Digestion of Genomic DNA 1. Partial digestion reactions: Prior to enzyme digestion, wash the blocks containing genomtc DNA in 1X TE with 40 pg/mL PMSF at 50°C to inactivate the proteinase K and twice in 1X TE to remove the PMSF. Blocks incubated in pronase instead of proteinase K need only be washed extensively in 1X TE. 2. Perform partial EcoRI digestions by incubating blocks with a combination of EcoRI and EcoRI methylase. To determine the best mixture of the two

6

Larin, Monaco, and Lehrach

3. 4. 5. 6. 7

enzymes, set up analytical reactions of 1 U of EcoRI with 0, 20, 40, 80, 160,320, and 640 U of EcoRI methylase. Place mdividual blocks in EcoRI partial digestion buffer (see Section 2., item 4) with the various combmations of EcoRI and EcoRI methylase and incubate on ice for 1 h. Transfer the reactions to 37°C for 4 h. Add EDTA and protemase K to 0.02M and 0.5 mg/mL, respectively, to terminate the reactions, and incubate at 37°C for 30 min. Check partial digests on a 1% agarose gel m a CHEF apparatus with yeast chromosomes as stzemarkers to see which combination of enzymes gives most DNA in the range of 200-2000 kb. Then digest many (6-l 2) blocks preparatively for the library construction usmg several of the best enzyme combmations (usually 1 U EcoRI and 50-200 U EcoRI methylase).

3.3. First Size Fractionation

by PFGE

1. Pool blocks containmg partially digested DNA in a 50-mL Falcon tube and wash once m 0.0 1M Tris-HCl, pH 7.5, and 0.05M EDTA. 2. Place blocks adjacent to each other in a trough m a 1% LMP agarose gel in 0.5X TBE, and preset for 1 h at 4°C. Place a genomic DNA block in the adjacent gel slot on either side of the trough and place yeast chromosome size markers in the outside gel slots. 3. Overlay the gel slots and trough wtth 1% LMP agarose. Subject the gel to electrophoresis at 160 V (4.7 V/cm), using a switch time of 30 s (which selects fragments 2400 kb) for 18 h at 15OCin a CHEF apparatus. 4. Remove the gel from the CHEF apparatus. Cut away only the outside lanes, including one lane each of partially digested genomic DNA and yeast chromosome size markers, and stain with ethidmm bromide (1 ug/mL) for 45 min. Keep the central portion of the preparative gel in 0.5X TBE plus 0.02M EDTA at 4°C. 5. Under UV light, notch the marker lanes at the edges of the limiting mobility (>400 kb) and take a photograph. Place adjacent to the central portion of the preparative gel, cut out the limiting mobility using the notches m the outside lanes as a guide, and place m a 50-mL Falcon tube. Stain all of the remaining preparative gel with ethidium bromide and take a photograph.

3.4. Ligation

to Vector

1. Equilibrate the gel slice (l-2 mL) containing the limiting mobility of size-selected DNA four times (30 min each) in 1X ligase buffer (see Section 2., item 7).

Large Insert YAC Libraries 2. Place the gel slice equilibrated m 1X ligase buffer in an Eppendorf tube (cl mL agarose/tube) and melt at 68°C for 10 min together with digested and CIP-treated pYAC4 vector (see Section 3.1.) m a ratio of 1: 1by weight of genomic DNA 3. Stir the vector and genomic DNA in molten agarose slowly with a pipet tip and mcubate at 37°C for l-2 h. 4. Add T4 DNA hgase to 4 U/uL, ATP, pH 7.5 and DTT to O.OOlMeach m 1X hgase buffer by slow stirring at 37°C. Incubate the reaction at 37°C for an additional 0.5-l h and then overnight at room temperature. For ligation efficiency controls, see Note 2. 5. Termmate the reaction by adding EDTA pH 8.0 to 0.02A4.

3.5. Second Size Fractionation

by PFGE

1. Melt the ligation reaction at 68°C for 10 mm and cool to 37°C. 2. Carefully pipet the molten agarose with a tip of bore diameter >4 mm mto a trough m a 1% LMP agarose gel m 0.5X TBE, and preset for 1 h at 4°C. Place some molten agarose ligation mix in the gel slots adjacent to the trough on each side and place yeast chromosome size markers in the outside gel slots. Overlay the gel slots and trough with 1% LMP agarose. 3. Subject the gel to electrophoresis in a CHEF apparatus using the same conditions as described in Section 3.3. for the first size fractionation. 4. Excise the limiting mobility as described m Section 3.3., step 5. If any degradation of DNA is seen at this step, see Note 1. 5. Equilibrate the gel slice (approx 2-3 mL), containing the limiting mobility from the second size fractionation, four times (30 min each) in 0.0 IMTrisHCI, pH 7.5,0.03M NaCl, O.OOlM EDTA, and 1X polyamines. 6. Score the equilibrated gel slice with a sterile scalpel and place lessthan 1mL of agarose into individual eppendorf tubes. Melt at 68°C for 10 min, cool to 37°C and add agarase(Sigma 15&200 U/mL of molten agarose or P-agarase 20 U/mL of molten agarose).Incubate at 37°C for 2-6 h prior to transformation.

3.6. Transformation Transformation is carried out as described (24) using lyticase (Sigma) to spheroplast yeast cells. The yeast strain S. cerevisiae AB1380 has largely been used (I), but libraries have been prepared in recombination deficient strains (1.5). 1. Streak a fresh YPD plate with the appropriate strain from a frozen glycerol stock. Grow at 30°C for 2-3 d. Inoculate a single colony into 10 mL of YPD. Let sit overnight at 30°C.

8

Larin, Monaco, and Lehrach

2. The next evening, inoculate 200 mL of YPD m a 1-L flask with 200 uL of the 10-mL overnight culture. Use a larger inoculum (1/lo0 or l/500) if it is a recombination deficient strain, because these cells tend to grow more slowly. Shake at 30°C overnight for 16-l 8 h. 3. When the ODboO,,,,,of a l/l 0 dilution of the ABl380 culture IS between 0 12 and 0.15, spht the culture mto 50-mL Falcon tubes. Check some of the culture under the mtcroscope for bacterial contamination. 4. Spm the tubes at 400-6OOg (3000 rpm on tabletop centrtfuge) for 510 mm at 20°C. Decant media and resuspend pellets m 20 mL of distilled, sterile water for each tube. 5. Spm 400-6OOg for 5-10 min at 20°C. Decant water and resuspend pellets m 20 mL of 1.OM sorbitol. 6. Spm 400-6OOg for 5-10 min at 20°C. Decant sorbrtol and resuspend pellets in 20 mL SCE. 7. Add 46 uL of 2-mercaptoethanol and take 300 j.tL from one tube for aprelyticase control. Add 500 U lyticase (Sigma), mix gently, and incubate at 3O’C. 8. At 5, 10, 15, and 20 min, test the extent of spheroplast formation of one tube by two independent methods: a. Using a spectrophotometer, measure OD6a0nmof a l/l0 dilution in distilled water. When the value is l/10 of the prelyticase value, spheroplast formation is 90% complete. b. Mix 10 yL of cells with 10 uL 2% SDS and check under the microscope using phase contrast. When cells are dark (“ghosts”) they are spheroplasted. 9. Take the spheroplastformation to 80-90%. This should take 1O-20 min. Then spin cells at 200-300g (1100 rpm on tabletop centrifuge) for 5 min at 20°C. 10. Decant SCE and resuspend pellets gently in 20 mL of l.OM sorbitol. Spm 200-300g for 5 min at 20°C. Decant sorbitol and resuspend pellets in 20 mL STC. 11. Take a cell count of one tube by making a l/l 0 to l/50 dilution in STC and count on a hemocytometer. 12. Spin cells at 200-300g for 5 min at 20°C and then resuspend m a volume of STC calculated for a final concentration of 4-O-6.0 x 10scells/ml when added to genomic DNA. 13. Add approx 0.5-l .Oug of DNA in digested agarose solution (50-75 uL) to 150 uL of spheroplasts in 15-mL conical polystyrene Falcon tubes. For transformation controls, use: a. No DNA; b. 10 ng supercoiled YCp50 (25); and c. 100 ng restricted and CIP-treated pYAC4. Let DNA and spheroplasts sit for 10 min at 20°C.

Large Insert YAC Libraries 14. Add 1.5 mL PEG and mix gently by Inverting tubes. Let sit for 10 mm at 20°C. Spin at 200-300g for 8 min at 20°C. 15. Carefully pipet off PEG solution and do not disturb pellets. Gently resuspend pellets in 225 pL of SOS. Place at 30°C for 30 mm. 16. Keep molten top regeneration agar at 48°C. If usmg small plates, add 5 mL of regeneration top agar (without uracil) to each 225 pL of SOS and cells. If you are using large (22 x 22 cm) plates, pool 10 tubes of 225 uL of SOS and cells to a 50-mL Falcon tube, and add 50 mL of regeneration top agar (without uracil). Mix gently by inverting the tube and pour quickly onto the surface of a prewarmed regeneration plate (without uracil) and let sit. Incubate plates upside down at 30°C for 34 d. 17. YAC analysis and replication of transformants. Good transformation efficiencies are between 2-8 x lo5 clones/ug YCp50 and 100-l 000 clones/pg genomic DNA. For low transformation efficiencies, see Note 3. Ptck YAC clones individually onto selective plates (without uracil and trypophan, see Section 2., item 14) to test for both vector arms. When usmg mmlmal adenine, visualize red color in YAC colonies containmg mserts Grow YAC clones in selective media and make agarose blocks contammg chromosomes to check the size of YAC clones by PFGE. To replicate clones for library screening, pick YAC clones individually into mtcrotiter dishes for screening of pools by polymerase chain reaction (PCR) amplification (26) or by colony hybridization after spotting onto filters using manual devices. A multipm transfer device, containmg 40,000 closely spaced pins, has been used to efficiently replicate YAC clones from the supportive agar matrix of regeneration plates to the surface of selective plates, for colony hybridization and picking into microtiter dishes (10).

4. Notes 1. Degradation of DNA: If anywhere m the cloning procedure you encounter complete or partial degradation of high molecular weight DNA, use yeast chromosomes in a series of control reactions to pinpoint the problem. Because yeast chromosomes can be visualized as distinct bands on PFGE, degradation can be detected much easier than in partial digests of genomic DNA. Test all buffers and enzymes (EcoRI methylase, T4 DNA hgase, proteinase K, agarase) for nuclease activity in mock cloning experiments using yeast chromosomes. Also, melt agarose blocks containing yeast chromosomes in buffers with and without 1X polyamines to test for partial degradation. 2. Ligation controls for vector and genomic DNA: Test the efficiency of hgation of vector arms to partially digested genomic DNA by incubating a small sample of the ligation reaction with and without 1 U T4 polynucle-

Larin, Monaco, and Lehrach

10

ottde kmase. Melt the samples and load them on a small 1% agarose gel to check for no change of vector arms without kmase and disappearance of vector arms to larger sized fragments when incubated with kmase. 3 Transformation efficiency: If your transformation efficiencies are routinely lower than expected, check the followmg: a. Always streak the yeast strain onto a fresh YPD plate before settmg up cultures. Cultures grown from old plates (>2 wk) seem to transform less well although they will appear to spheroplast normally. b. Try different concentrations of lyticase and percent spheroplast formation for optimum efficiency. c. Try various batches of sorbitol and PEG to see if there is any difference in transformatton efficiency. d. Always use distilled, deionized water to guard against heavy metal ion contammation that can degrade DNA or decrease transformation efficiency. e. Check the temperature of room. Transformation is best at 20-22°C and decreases dramatically at temperatures around 30°C. References 1 Burke, D T , Carle, G F , and Olson, M V. (1987) Cloning of large DNA segments of exogenous DNA mto yeast by means of artificial chromosome vectors Science 236,806-8 12. 2 Foote, S , Vollrath, D , Hilton, A., and Page, D. C (1992) The human Y chromosome overlappmg DNA clones spanning the euchromatic region Sczence 258,60-66 3 Chumakov, I , Rigault, P , Gmllou, S , Ougen, P , Billaut, A , Guascom, G , et al (1992) Continuum of overlappmg clones spanning the entire human chromosome 21q. Nature 359,38&387. 4. Maier, E., Howeisel, J , McCarthy, L., Mott, R , Grigortev, A. P., Monaco, A. P., Larm, Z., and Lehrach, H (1992) Complete coverage of the Schzzosaccharomyces pombe genome m yeast artificial chromosomes. Nature Genet 1,273-297. 5. Cohen, D., Chumakov, I., and Werssenbach, J. (1993) A first-generation physical map of the human genome. Nature 366,698-70 1, 6 Coulson, A., Waterston, R , Klff, J., Sulston, J , and Kohara, Y. (1988) Genome lmkmg with yeast artificial chromosomes Nature 335, 184-I 86 7. Monaco, A. P and Larm, Z. (1994) YACs, BACs, PACs and MACs artificial chromosomes as research tools Trends BzotechnoZ 12,280-286. 8. Garza, D , Ajioka, J W , Burke, D T., and Hart& D. L (1989) Mapping the Drosophtla genome with yeast artitictal chromosomes. Sczence 246,641&646. 9. Guzman, P. and Ecker, J (1988) Development of large DNA methods for plants, molecular clonmg of large segments of Arabtdopsts and carrot DNA mto yeast, Nuclezc Aczds Res 16, 11,091-l 1,105. 10 Larm, Z., Monaco, A P , and Lehrach, H. (1991) Yeast artificial chromosome libraries contammg large inserts from mouse and human DNA. Proc Natl Acad

Scz USA 88,4123-4127.

Large Insert YAC Libraries

11

11. Burke, D T , ROSSI,J M , Leung, J., Koos, D S , and Tilghman, S. M. (1991) A mouse genomtc library of yeast artttictal chromosome clones Mammal Genome 1,65. 12. Anand, R., Villasante, A , and Tyler-Smith, C (1989) Construction of yeast arttficial chromosome libraries wtth large inserts usmg fractronatton by pulsed-field gel electrophoresis. Nuclezc Acids Res. 17, 3425-3433. 13. Albertsen, H M , Abderrahim, H., Cann, H. C , Dausset, J , Le Pasher, D , and Cohen, D (1990) Construction and characterization of a yeast artifictal chromosome library containing seven haploid human genome equrvalents Proc Nat1 Acad Scl USA 87,5109-5113. 14 Reeves, R. H., Pavan, W. J , and Hieter, P (1992) Yeast artificial chromosome modificatron and manipulation, in Methods in Enzymology, vol. 2 16 (Wu, R , ed.), Humana, Totowa, NJ, pp. 584-603 15. Chartter, F. L., Keer, J T., Sutchffe, M. J., Henrtques, D A , Mileham, P , and Brown, S. D. M. (1992) Construction of a mouse yeast artificial chromosome library m a recombmant-deficient strain. Nature Genet 1, 132-136 16. Neil, D. L., Vtllasante, A., Fisher, R. B , Vetrie, D., Cox, B., and Tyler-Smtth, C (1990) Complete coverage of the Schizosaccharomyces pombe genome m yeast artificial chromosomes. Nuclezc Acids Res l&421428 17 Ling, L. L , Ma, N S -F , Smith, D. R., Miller, D D , and Molt-, D T (1993) Reduced occurrence of chtmeric YACs m recombinant deficient hosts. Nucleic Acids Res 21,6045,6046. 18. Smith, D. R., Smyth, A. P., and Motr, D T (1992) Copy number amplification of yeast arttfictal chromosomes, in Methods zn Enzymology, vol 216 (Wu, R , ed ), Humana, Totowa, NJ, pp 603-6 14. 19. McCormick, M. K., Shero, J H , Cheung, M. C., Kan, Y. W., Hteter, P A., and Antonarakis, S. E. (1989) Construction of human chromosome 2 1-specific yeast artificial chromosomes Proc Nat1 Acad Sci USA 86,9991-9995 20 Lee, J T , Murgia, A., Sosnoski, D M., Ohvos, I. M., and Nussbaum, R L (1992) Construction and characterisation of a yeast artrfictal chromosome library for Xpter-Xq27. 3: a systemattc determination of coclonmg rate and X-chromosome representation. Genomzcs 12, 526-533. 2 1. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Clonzng A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY. 22. Herrmann, B. G., Barlow, D. P., and Lehrach, H. (1987) An inverted duplication of more than 650 Kbp m mouse chromosome 17 medtates unequal but homologous recombination between chromosomes heterozygous for a large inversion. Cell 48,8 13-825. 23. Rothstein, R. (1985) Cloning in yeast, in DNA Clonzng Volume II (Glover, D. M., ed ), IRL Press, Oxford, UK, pp. 45-65. 24. Burgers, P. M. J. and Percival, K. J. (1987) Transformation of yeast spheroplasts without cell fusion. Anal Biochem 163,391-397. 25. Hieter, P , Mann, C., Snyder, M., and Davis, R W (1985) Mitottc stabihty of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40,38 1-392 26. Green, E. D. and Olson, M. V. (1990) Systematic screening of yeast artificial chromosome ltbrarres by use of the polymerase cham reaction Proc Nat1 Acad Scl USA 87,1213-1217

CHAPTER2

YAC Library

Storage

and Transport

John E. Collins, Sheila Hassock, and Ian Dunham 1. Introduction The large size of mammalian genomes necessitates the use of cloning vectors that will accommodate genomic DNA inserts of at least several hundred kilobases. The development of the yeast artificial chromosome (YAC) cloning system (1) in the mid- 1980s and the construction of YAC libraries with large numbers of genome equivalents for both the human (2-5) and mouse genomes (5,6) provided a major impetus to mammalian genome mapping. These technical advances enabled the mapping of megabase-sized chromosomal regions (7,8), culminating in the first complete clone maps of single mammalian chromosomes (9,10). In 1994, it is fair to say that the success of any long range mapping and cloning project depends on access to YAC resources. In the human genome project, the distribution of YAC libraries to multiple laboratories and institutes has greatly facilitated progress by improving the availability of the libraries for screening. In our experience, direct access to YAC libraries is crucial for any ambitious mapping project, but dealing with large YAC resources has required the development of a series of appropriate tools and protocols. The authors describe a set of protocols to enable the easy manipulation of large numbers of YACs such as contained in a library made from the DNA of a complex genome. Traditionally, genomic DNA libraries in lambda or cosmid vectors, which may consist of more than a million recombinants, have been From Methods m Molecular Biology, Vol. 54 YAC Protocols Edited by D. Markle Humana Press Inc , Totowa, NJ

13

14

Collins, Hassock, and Dunham

screened by random replica plating and hybridization. The increase of insert size made possible by the YAC cloning system reduced the number of clones required to give high genome coverage, and this has allowed a change in approach so that single recombinant clones are stored separately in an ordered array. YAC libraries are stored with single YAC clones in separatewells of 96- (or 384-)well microtiter plate arrays at-70°C. Thus each YAC clone has a unique address within the library, consisting of the microtiter plate number and the well coordinate, A-H, on the vertical axis, and 1-12 on the horizontal axis. This address acts as a permanent reference for the YAC that can be stored in a database with associated information and commumcated along with the library. Clones from different libraries are distinguished by referring to the library from which they were derived. Hence, the authors could refer to YAC clone 639611 from the CEPH YAC library. It is essential that these reference numbers are used by all workers who use a widespread library so that data is kept compatible. YAC libraries may be received by one of the methods described in Section 3.5. Initially, the library will need to be replicated into three copies for storage. The first is an archive copy that should remain frozen. The second is a backup copy that is periodically duplicated to remake the third, working copy. The backup plates are also used to replace single working plates that may be lost through contamination or by being dropped. Libraries are replicated using a 96-pin tool (Fig. 1). Each microtiter plate is stamped onto YAC selective media and the colonies grown. An inoculum may then be taken from the agar plate into multiple microtiter plates filled with liquid media. Once a layer of cells has grown to cover the bottom of each well, the plate may be frozen in 15-20% glycerol. The authors store plates in sets of 16 in a purpose made aluminum racking system that IS convenient for our library screening protocols (II, see Chapters 3 and 4). Future manipulation of the library for replacement of plates or replication to send a copy elsewhere uses the same protocols. 2. Materials 1. 96-Pm tool (Fig. 1): This is made using 96-inoculation pins (Denley [Billmg Hurst, Surrey, UK] WR080/02), 2X 96 place heads (Denley WR080/01), a top plate (the authors make their own) all held together with eight spacers, four screws, and four nuts.

YAC Library

Storage

and Transport

Fig. 1.96-Pin hand held replicating tool (or hedgehog) (see Section 2., item 1). Note the two 96-place heads stabilize the pins to minimize horizontal movement and the spacers allow each pin 10 mm of vertical movement. Once sterilized, the tool can be held by the end pieces of the 96-place heads. 2. Wellfill 3 (Denley WF043) or multichannel pipetman for filling microtiter plates. 3. YPD medium: see Chapter 29. 4. AHC medium: see Chapter 29. 5. 80% Glycerol, autoclaved. 6. Flat-bottomed microtiter plates (Falcon 3072, Becton Dickinson, Lincoln Park, NJ). Round-bottomed plates are not recommended for YAC libraries as the cells will settle into a small area in the center and it may prove difficult to replicate from these plates. 7. Microtiter plate sealers (Dynatech [Chantilly, VA], cat. no. 00 1-O1O-5701). 8. IO-cm Rubber roller, available from all good art materials shops. 3. Methods

All the sterilization procedures and manipulations of YACs should be carried out in a class II microbiological safety cabinet in accordance with local regulations. This is also necessary to minimize contamination problems.

16

1. 2. 3. 4.

1.

2. 3. 4. 5. 6. 7. 8. 9.

Collins,

Hassock, and Dunham

3.1. Initial Sterilization of 96-Pin Tool Invert tool in flowhood (pins up). Spray wtth absolute ethanol from a wash bottle. Light a Bunsen burner and ignite ethanol covering the 96-pin tool. Ensure that the lit Bunsen IS kept well away from the ethanol bottle! Leave 96-pin tool to cool for at least 10 min. 3.2. Cyclic Sterilization Procedure When Using 96-Pin Tool Take 3-microtiter plate size dishes (use either a 1%cm diameter Petri dish or the sterile microtiter plate packaging). Fill one with water (not sterile), one with absolute ethanol, and the third sterile dish with YPD broth ensurmg that each tray 1s filled at least as deep as the depth of media m the microtiter plate. Take the sterile 96-pin tool (see Section 3.1.) and perform the desired YAC manipulation (see Sectton 3.3.). Rmse the end of the pins m the water to remove any agar or media and stamp them dry on a pad of dry &sues or towels. Place the pins into the absolute ethanol for a few seconds and then invert the tool m the flowhood. Ignite with the ethanol on the tool with the Bunsen flame, briefly wavmg the flame over each pm head (take care that the dish of ethanol is at the other end of the flowhood). Try not to make the tool hot by excessive flaming. Cool the pin heads by placing in the sterile YPD. (It IS posstble to avotd this step if you have two 96-pm tools and use them m rotatton allowing them to cool in the air flow after step 5.) Shake the tool to remove excess YPD. Perform the next YAC manipulation and repeat steps 3-6 after every YAC manipulation. At the end of each session, sonicate the tool in water in a sonicating water bath for 10 min to remove colony debris.

3.3. YAC Manipulation 3.3.1. Transfer of YACs from YPD Broth to Agar-Filled Microtiter Plate or Agar Plate 1, Place the 96 pins of the sterilized tool into athawed microtiter plate of YACs. 2. Gently scrape the tool on the bottom of the plate avoidmg splashes between wells. 3. Transfer the tool to an AHC agar dish and “stamp” the YACs onto the plate surface checking that all the pms are touching the agar. Do not allow

YAC Library

4. 5. 6. 7.

Storage and Transport

17

the full weight of the tool to rest on the agar as it will sink mto the plate, especially if it is still sightly warm. Place the AHC dish at the back of the hood for 5 min until the liquid has dried. Sterilize tool (see Section 3.2.). Incubate agar plate at 30°C for 2 d. If growth is patchy or nonexistent, see Notes 1 and 2; if contamination is a problem see Notes 3-7. Repeat manipulation as necessary.

3.3.2. Transfer of YACs from AHC Agar to Single or Multiple Copies of YPD Broth Microtiter Plates 1. Check each AHC agar plate for contaminants such as fungal growth or bacteria. At this stage contaminants may be cut out from the agar with a sterile scalpel, leaving an empty space in the library. The YAC can be added back to the library when it has been recovered usually by streaking separately on selective media (AHC). 2. Fill the required number of microtiter plates with 150 pL YPD broth per well using either a multichannel pipetman or an automatic well filler. 3. Place the 96 pins of the sterile tool over the colonies on the AHC agar dish, checking that all the pins are touching the colonies. 4. Transfer the tool to a prefilled YPD broth microtiter plate. Mix the tool in the broth to remove the cells. 5. If required, return the tool to the same AHC plate to collect more YAC colony and inoculate further copies of the plate as necessary. 6. Sterilize tool (see Section 3.2.). 7. Repeat manipulation as necessary. 8. Incubate microtiter plates at 30°C for 2 d.

3.4. Freezing

YACs in Microtiter

Plates

1. Look at the microtiter plate from beneath to check that the YACs have grown to cover the bottom of the microtiter plate. Occasionally, the YACs grow in clumps that will need to be dispersed using the sterile 96-pin tool before freezing. 2. Mix equal volumes of 80% glycerol and YPD broth to make 0.5X YPD broth containing 40% glycerol. This dilution makes the glycerol less viscous and easier to manipulate. 3. Add 100 uL of this 40% glycerol mix to each well to give an approximate final glycerol concentration of between 15 and 20% depending on how much of the original YPD broth has evaporated during incubation. It is as

18

Collins,

Hassock, and Dunham

well to check how much volume is lost through evaporation under your own condrttons. If a Wellfill is used, the delivery switch needs to be set at approx 150 uL, which wtll then add 100 uL to each well because of the vtscosity of the glycerol. The amount of glycerol delivered can be measured using an empty microtiter plate and a pipetman before proceeding to add the glycerol to the library plates. 4. Usmg the sterile tool, gently mix the glycerol with the YACs (see step 1 in Section 3.3.1.). This also disperses any clumps of YACs to form an even coverage of the well bottom. 5. Archive plates should be sealed with plate sealers 6. Freeze the microtiter trays at -70°C stacked and wrapped in suitable plastic bags to prevent frost. It is prudent to test that the type of bag you are using will survive freezing at -70°C beforehand. 3.5. Transport of YAC Libraries YAC libraries can be transported in a number of ways. The best method to suit the exporter and importer may be selected from the following: 1. Each microtiter plate is stamped onto a 15-cm selective media plate. This is the stmplest method as the exporter only needs to stamp the YACs from their backup stocks, and the importer has a plate ready to make microtiter plate copies. However, the plates are fragile and bulky, usually requiring careful transport by car. 2. Each microttter plate IS stamped into another microttter plate filled with 150 uL of YPD agar media. This is the most convenient method for international transport. It is compact and less susceptible to damage during rough handling. However, as the YACs do not tend to grow evenly m such a plate, it is difficult to use this plate for further copies. Thus the importer should recover the YACs m a YPD broth mtcrotiter plate and then make a further selective agar plate that IS used to expand the library. 3. YACs may be transported frozen in their microtiter plates. The obvious problem is keeping the large number of plates frozen. The authors have transported several YAC libraries m large expanded polystyrene boxes filled with dry ice. The importer has the advantage of being able to use the YACs immediately, for example for griddmg (see Chapter 3), although further copies may need to be produced. 4. Notes I, If the YACs do not grow, check that the media was made correctly with all the appropriate nutrients (e.g., glucose and adenine). Test a batch of media prior to starting on replication of a library.

YAC Library

Storage and Transport

19

2. If the YACs give a patchy growth pattern there are a number of possibihties: a. The tool is not cooled enough after sterilization. b. The pins are not touching either the agar or the bottom of the microtiter plate. It is possible that the pin heads are sticking to the back plate. This can be solved by cleamng the tool by sonication m water in a deeply filled water bath for 10 min. Tap the tool sharply before taking the colony lifts and visually check that all the pms are level. c. The AHC agar plates are poured too thin. A 15cm diameter Petri dish needs at least 50 mL of agar. d. The tool was not scraped enough on the bottom of the microtiter plate (see Section 3.3.1.). 3. In general, YACs are grown at each stage for 1 or 2 d. This is to minimize the chance of yeast and bacterial contamination competmg with the YAC colony. Where fast growing yeast contaminants have been a problem, the authors have added extra ademne to the media, allowing the YACs to grow more rapidly. It is worth noting that the further away from the original YAC library a plate has become, the more likely it is that contamination has occurred with other YACs or another organism. It is therefore important when duplicating and, especially, exporting libraries to try to use the closest possible copy to the original library without unnecessarily dtsturbing the archive plates. 4. Bacterial contamination may be controlled by adding 50 pg/mL ampicillin, 5 ug/mL tetracycline, or 30 pg/mL kanamycin, or a combination of these to the AHC agar before pouring the plates. 5. Spread of fast growing yeast contaminants may be limited by adding 100 ug/mL adenine to both broth and agar allowing the YACs to grow more quickly. YACs will grow sufficiently in high adenine media overnight, but will not turn red. However, the best policy is to remove the contaminants completely. This may be achieved by streaking the contents of the well onto AHC plates and after 2 d growth retrieving the red YAC from the contaminant. Unless there is obvious contamination at this point, the plate can be left for another few days at 4°C to allow the red color of the YACs to show fully. The recovered YAC can then be grown up in a microtiter plate and added back to the main library m the correct well. Contammated wells are cleaned by removing the contents and soaking in 95% ethanol for 10 mm. In some cases, two rounds of streaking may be necessary. 6. Most of the wtdely available YAC libraries do not necessarily contam a single YAC clone in each well, partly because the density of the YACs m the agar origmal transformation plates from which the YACs were picked

20

Collins, Hassock, and Dunham was high enough that a picking of a single transformant could not be guaranteed, and partly because mampulation of the mlcrotiter plates mvarlably leads to some cross contamination between wells. The amount of work required to streak out each clone to a single colony IS so great that this has not generally been done. Although this fact confounds screening strategies that rely on single well locations for each YAC, it does mean that the archive copies of the YAC libraries have been grown very little and so any YAC that is prone to deletion has had less chance to delete. However, contamination of YACs between the wells of microtlter plates IS a con-

tinual problem. The only way to obtain a pure clone from a microtiter plate well 1s to streak it onto an AHC agar plate and test the single colonies for STS or probe content (see Chapter 4). 7. Fungal contamination of agar plates may be removed by cutting out the affected area with a sterile scalpel. YAC colonies lost this way will need to

be recovered and added back to the library.

References 1. Burke, D. T., Carel, G. F., and Olson, M. V. (1987) Clonmg of large segments of exogenous DNA into yeast by means of artiticlal chromosome vectors. Science 236,806-812. 2. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T , Korsmeyer, S J., Schlessinger, D., and Olson, M. V. (1989) Isolation of single-copy human genes from a library of yeast artificial chromosome clones. Science 244, 1348-l 35 1. 3. Anand, R. A., Riley, J. H., Butler, R., Smith, J. C., and Markham, A. F. (1990) A 3.5 genome equivalent multiaccess YAC library, construction, characterisation, screening and storage. Nucleic Aczds Res. 18, 195 l-l 956. 4. Albertsen, H. M., Abderrahlm, H., Cann, H. M., Dausset, J., Le Paslier, D., and Cohen, D. (1990) Construction and characterisation of a yeast artificial chromosome library containing seven haploid human genome equivalents, Proc. Natl Acad. Scl USA 87,4256-4260. 5. Larin, Z., Monaco, A. P., and Lehrach, M. (1991) Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc Natl Acad. Sci USA 88,41234127. 6. Chartier, F. L., Keer, J T., Sutcliffe, M. J., Hennques, D. A., Mileham, P , and Brown, S. D. M. (1992) Construction of a mouse yeast artificial chromosome library in a recombmatlon-deficient strain of yeast. Nature Genet 1, 132-136 7. Green, E. D. and Olson, M. V. (1990) Chromosomal region of the cystic fibrosis gene m yeast artificial chromosomes: a model for human genome mapping Scrence 250,94-98 8. Vetrie, D., Vorechovsky, I., Sideras, P., Holland, J., Davies, A., Flinter, F., et al. (1993) The gene involved in X-linked agammaglobulinaemia 1s a member of the src family of protein-tyrosme kinases. Nature 361,226-233.

YAC Library

Storage and Transport

21

9. Chumakov, I., Riault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G , et al. (1992) Contmuum of overlapping clones spanning the entire human chromosome 21q. Nature (Lond.) 359,380-387. 10. Foote, S., Vollrath, D., Hilton, A., and Page, D. C. (1992) The human Y chromosome. overlappmg DNA clones spanning the euchromatic regions Sczence 258, 60-66. Il. Bently, D. R., Todd, C., Collins, J., Holland, J., Dunham, I., Hassock, S., et al. ( 1992) The development and application of automated griddmg for efficient screening of yeast and bacterial ordered libraries. Genomzcs 12,534-641.

CHAPTER3

YAC Library Preparation

Screening

of Hybridization

Charlotte

I

Filters and PCR Pools

G. Cole, John E. Collins, and Ian Dunham 1. Introduction

The storage of yeast artrficial chromosome (YAC) libraries in ordered microtiter plates required a new approach to screening for clones containing specific DNA sequences. Screening libraries of some 60,000 clones by hybridization to filters prepared from individual 96-well microtiter plates was not a feasible option, prompting development of the polymerase chain reaction (PCR)-based screening approach of Green and Olson (I). Here (and in all subsequently developed PCR-based strategies), YAC libraries are screened by performing the PCR on a series of pools of DNA derived from specific mixtures of yeast clones. Amplification of target DNA sequencefrom an individual pool indicates the presence of the required YAC within the parent microtiter plates. Further rounds of testing on subsidiary pools are used to reveal the exact location of the YAC. Thus, a library of approx 36,000 clones may be prepared as 24 individual pools of 1536 YACs each for the first round of the PCR, each pool containing yeast DNA from 16 microtiter plates. Screening by the PCR therefore requires the preparation of pools of total yeast DNA derived from several thousand different YAC clones in equal amounts (2-4). Pools contaimng fewer YACs may also be required for subsequent stages of PCR screening.

From Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

23

24

Cole, Collins,

and Dunham

Although screening by the PCR has proved successful even for large projects ($5) it is also desirable to have the option of screeningwhole libraries by hybridization, thus circumventing the need to develop large numbers of suitable primer pairs (sequenced tagged sites [STSs]). Efficient screening of YAC clones by hybridization requires, first, that the DNA derived from many different individual clones is present at high densities on hybridization filters and, second, that these filters can be prepared rapidly and precisely. This has been achieved through the use of robots that automatically grid clones from microtiter plates onto hybridization filters in high density ordered arrays of clones (2,6-+). Thus, the system used in the authors’ laboratory grids 1536 YACs onto a single 8 x 12 cm filter (2,8; see Fig. 1 in Chapter 4). To enable subsequent identification of individual colomes following autoradiography, it is essential to preserve the ordered array precisely. Hence, the clones are gridded and grown on a nylon filter, the resulting colonies spheroplasted and lysed in situ, and the DNA denatured and fixed to the filter. Described herein are methods for the preparation of PCR pools from yeast DNA isolated in agarose plugs (see Note 1) and of filters for hybridization. The pools described are based on a relatively simple pooling system (see Fig. 2 in Chapter 4) and preparation of pools based on l/2 filters or rows and columns are not described. However, the method is applicable to any array of YACs grown on nylon filters. For the preparation of high-density Iilters for hybridization, the authors strongly advise the use of an automatic gridding system. The method given assumes access to a customized robot of the type described by Bentley et al. (2) or McKeown et al. (8; G. McKeown and A. Watson [Sanger Centre, Cambridge, UK], personal communication). However, nylon filters gridded in different arrays may be treated identically (see Note 2). Filters generated from YACs spotted onto filters manually using individual “pins” or a hand-held 96-pin replicating “hedgehog” (Chapter 2) may also be grown and treated in much the same way, with a few caveats, as detailed in Section 3. (see also Note 3). 2. Materials 2.1. Hybridization Filters 1. Sterile 80 x 120 mm nylon filters (Hybond N, Amersham, Arlington Heights, IL; available precut to size cat. no. RPN 119N) (seeNote 2).

YAC Library

Screening I

25

2. Sterile rectangular 8 cm x 12 cm Petri dishes with hds (Hybaid “colony picker plates with lids,” available from Hybaid [Teddington, Middlesex, UK] on request). For gridding of yeast colonies, these dishes are poured to uniform thickness (50 ml/dish) with YPD agar (see Chapter 29) contaming 50 pg/mL ampictllm, 5 pg/mL tetracycline (see Note 4). Plates can be reused by scraping out the media with a spatula and washing with detergent followed by sterilization with 70% tsopropanol and drying m a laminar flowhood. 3. Plastic trays with lids (30 x 40 x 2 cm trays from Jencons [Leighton Buzzard, Bedfordshire, UK], cat.no. 682-008; 390 x 290 mm lid from Marathon [London, UK], cat. no. TT2171132). 4. Yeast spheroplastmg solutron: 1M sorbrtol, 20 mM EDTA, 10 mM TrisHCl, pH 7.4, containing freshly added 0.1 mg/mL zymolyase 20T (ICN, High Wycombe, UK) and 14 mM P-mercaptoethanol (see Notes 5 and 6). 5. Denaturation solution: 0.5M NaOH, 1.5M NaCl. 6. Neutralization solution: 0.5M Tris-HCl, pH 7.4, 1.5MNaCl. 7. Protease solution: l/l0 dilution of neutralization solution containing 250 pg/mL protemase K. Sigma (St. Louts, MO) XI-S Protease 1sof suffictent quality. Store aliquots of stock proteinase K at 25 mg/mL, -20°C and make protease solution up freshly each time. 8. 50 mM Trrs-HCl, pH 7.4. 1. 2. 3. 4. 5. 6. 7. 8. 9.

2.2. PCR Pools Sterrle 80 x 120 mm nylon filters Hybond N, Amersham; avatlable precut to size, cat. no. RPN. 119N). See Section 2.1.) item 2 for high-density pools generated using robot Petri dishes, and for single plate pools, see Section 2.1.) item 2, or sterile 15-cm circular Petri dishes poured as noted wtth or without tetracycline. 50 mM EDTA, pH 8.0. Basic yeast spheroplastmg solutron: 1M sorbitol, 20 mM EDTA, 10 mM Tris-HCl, pH 7 4. Yeast spheroplasting solution containing 0.1 mg/mL zymolyase 1OOT (ICN), 14 mM P-mercaptoethanol, Low-gelling temperature (LGT) agarose (SeaPlaque agarose, FMC, Rockland, ME). 1 mL Disposable (flexible) plastic bulb style pipets, tube diameter approx 2-3 mm. Filter stertlized or autoclaved yeast lysis solution (YLS): 1% lithium dodecyl sulfate, 100 mM EDTA, 10 mA4 Tris-HCl, pH 8.0 (see Note 7). T,,tE: 10 mMTris-HCl, pH 8, 0.1 mA4EDTA.

Cole, Collins, and Dunham

26

3. Methods

I. 2.

3.

4.

3.1. Preparation of Nylon Filters for Hybridization 3.1.1. Growth of YACs on Nylon Filters Thaw working stocks of YACs stored m 15-20% glycerol (see Note 8). Label the nylon filters m the top left-hand comer corresponding to position Al of a microtiter plate with a suitable pen (e.g., Edding 1800) and lay onto the YPD agar plates (see Note 4). Carefully lift the filter and re-lay to remove air bubbles rf necessary Grid the YACs robottcally onto the filters following the manufacturers instructions (see also, ref. 2). Alternatively, stamp the YACs manually onto filters using the 96-pin “hedgehog” as described m Chapter 2, or spot the YACs onto filters using 0.6-2 mm pins (available from Cambridge Repetition Engineers, Cambridge, UK). Grow YACs for approx 27 h at 30°C (or until even growth is observed) (see Note 3).

3.1.2. Spheroplasting

and Lysis of YACs on Filters

1. Soak single layers of 3MM Whatman (Mardstone, UK) paper in spheroplastmg solutton, using approx 50 mL/780 cm2 of Whatman paper (26 x 35 cm sheets tf using the recommended trays). Pour off excess liquid (approx 5-10 mL) until the paper still “shines” but no pools of liquid remain. Avoid evaporation from Whatman paper prior to step 2 2 Remove the nylon filters from the agar plates taking care not to carry over lumps of agar and carefully lay the filters colony side up onto the freshly soaked Whatman paper. Check carefully to ensure no air bubbles are trapped under the filter (see Note 9). Place a lid over the tray, seal m a plasttc/autoclave bag, and incubate overnight at 37°C. 3. Remove filters from the spheroplasting tray and lay colony side up onto a fresh sheet of 3MM Whatman soaked in denaturation solution. Ensure no air bubbles are trapped under the Whatman paper or the filter. Leave at room temperature for at least 10 mm but no more than 20 mm. Check constantly for air bubbles. These are observed by the appearance of colonies that fall to lose their red color and may be alleviated by carefully lifting and relaying the filter. 4. Dry the filters for 10 min by laying colony side up onto a fresh piece of 3MM Whatman paper. 5. Carefully submerge each filter colony side up in neutralization solution. Use excess liquid (500 mL m a medium-sized sandwich box). Leave for approx 5 mm.

YAC Library

Screening

27

I

6. Carefully pour off the solution and replace with a l/l0 dilution of neutralization solution for 5 min at room temperature. 7. Incubate the filters colony side up in a sealed box containing protease solution at 37OC for 30-60 min. One hundred milliliters are sufficient for up to 40 filters in a suitable sized (small) sandwich box, but ensure that all filters are covered. 8. Wash the filters by submerging in an excessof l/l0 dilution of neutralization for 5 min, with very gentle shaking. Do not wipe the filters. 9. Wash the filters twice m an excess of 50 mMTris-HCl, pH 7.4 with very gentle shaking. 10. Following the final rinse, use a pair of tweezers to drag the back of the filter along the edge of the sandwich box to remove excess liquid and any debris stuck on the back of the filter. Lay flat on a fresh piece of 3MM Whatman paper. 11. An dry for at least 15 mm. When nearly dry, place another sheet of 3MM Whatman on top to prevent the filters from rolling up (see Note 10). 12. Place fully dried filters flat, colony side down, onto a UV transilluminator and irradiate for 2 min at 312 nm (see Notes 1l-13).

3.2. Preparation 1.

2.

1. 2. 3. 4. 5.

of Pools of YAC DNA for PCR

3.2.1. Growth of YACs Grid or stamp the YACs onto nylon filters as described in Section 3.1.1. For pools prepared from YACs gridded at high density, prepare two identical filters for each pool. The authors prepare high-density pools from 16 microtiter plates gridded in a 4 x 4 array (see Fig. 1 in Chapter 4). For pools prepared from single microtiter plates, stamp each plate onto a single filter using a 96-pin “hedgehog,” as described in Chapter 2. Grow the YACs for two nights at 3OOC. 3.2.2. Spheroplasting and Lysis of YACs in Agarose Plugs Lift the filters from the agarplatesusing tweezers,taking care not to remove any agar with the filter. Roll up loosely, colony side inward, and place in a 50-mL Falcon (Becton Dickinson) centrifuge tube containing 25 mL 50 rnA4EDTA. Screw the cap tightly and shake to wash off all the colonies. Remove the washed filter and discard. Pellet the yeast cells by spinning at 3000g for 5 min. Discard the supernatant and wash the pellet once more with 25 mL 50 mM EDTA, pelleting as in step 3. Determine the wet weight of cells (take an average of each pellet assuming approximately even growth and weight of cells) (see Note 14).

28

Cole, Collins, and Dunham

6. Prepare 2% molten LGT agarose in basic yeast spheroplasting solution, cool, and mamtam at 45°C. You will need approx 2 mLNAC filter. 7. Resuspend the cells in 2 vol of prewarmed (37OC) spheroplastmg solutton containing 0.1 mg/mL 1OOTzymolyase and 14 mM P-mercaptoethanol (e.g., 2 mL/g of cells). Maintain at 37°C. 8. Add 2 mL of molten LGT agarose per gram of cells to the cell suspension, mix well, and draw up the slurry mto the barrel of one or more dtsposable 1-mL plastic pipets (do not suck agarose into the bulb). Stand the pipet upright m the Falcon tube until set (place at 4°C if necessary for speed). 9. Once set,cut the tapered part of pipet away and extrude the agarose “worm” into a new 50-mL Falcon tube. 10. Cover with approx 10 mL of spheroplasting solution containing 0.1 mg/ mL zymolyase lOOT, 14 mM P-mercaptoethanol. Incubate overnight at 37°C with gentle shaking. 11. Replace the solution with 1O-l 5 mL of YLS (see Note 7). Incubate at 37°C for 30-60 min. 12, Replace with fresh YLS and incubate at 37°C overnight with gentle shaking. 13. Continue replacing with fresh YLS until there is no color left in the agarose (normally once or twice more). 14. The agarose “worms” can now be stored at room temperature m YLS or 0.5M EDTA (see Note 15). 3.2.3. Rinsing and Dilution of Agarose Plugs 1. Cut off up to 2.5 cm of agarose “worm” and place in a clean 50-mL Falcon tube. 2. Add 25 mL T,, 1E and incubate 50°C for 30 min. 3. Pour off To ,E, and repeat step 2 twice more. 4. Pour off To ,E and add 25 mL fresh T, lE. Wash at room temperature for 30 min with gentle shaking 5. Pour off To ,E and repeat step 4 twice more. 6. Place the agarose “worm” m a 1.5-mL Eppendorf tube and remove any liquid carried over. 7. Melt the agarose fully at 65°C for approx 15 mm. 8, Prewarm 700 yL To rE in a 1.5-mL Eppendorf tube to 65’C. Add 100 pL of the molten agarose, vortex briefly to mix, and incubate for an additional 5-10 min at 65°C. Vortex once more. 9. The diluted agarose pool is now ready for use. Store both the diluted PCR pool and the remaining neat melted agarose pool stock at 4°C. For rapid screening of libraries with large numbers of STSs, the pools may be aliquoted into 96-well microtrter plates, thus maximizing the use of multichannel pipets (see Note 16).

YAC Library

Screening I

4. Notes 1. Total yeast DNA can be prepared in solution. However, the authors have found that the agarose plug-based method is simpler to perform, gives a more consistent yield of DNA, and the resulting pools give more reliable PCR results when compared to solution DNA preparations. 2. The authors have found that the spheroplasting step was not effective on Hybond N+ positively charged membranes. 3. It is essential not to overgrow the yeast colonies, because the centers of larger colonies are not penetrated by the subsequent spheroplastmg and lysis solutions. This results in poor or halo-shaped hybridization signals around the edges of colonies only. Filters made from YACs stamped manually using a 96-pin replicating tool of the type described in Chapter 2 are particularly susceptible. 4. Plates can be poured and the filters layed on up to 3 d in advance. 5. Zymolyase does not go mto solution easily. Mix the powder vigorously m a small volume of spheroplasting solution for 2-3 mm prior to addition to the ml1 volume Mix again if allowed to stand prior to preparation of the spheroplasting trays. 6. To avoid excessive inhalation of P-mercaptoethenol, all relevant steps should be performed m a fume hood where practically possible. 7. YLS is toxic. Handle with care. 8. For robotically replicated YACs, the authors have observed that a more even growth occurs if gridding is postponed for at least one night following mixing of newly grown YACs with glycerol. This probably results from cells settling out to form an even layer of yeast on the bottom of the dish, rather than from the effects of freeze thawing. 9. Small an bubbles under individual colonies may not be immediately visible. Each filter should be checked again very carefully after several minutes by holding up to eye level. YACs over bubbles will not spheroplast and will be visible as darker colonies the following day. 10. Damp colonies will stick permanently to the second sheet of Whatman paper If layed on too soon. 11. Do not crosslink filters while wet/damp. 12. Some filters curl up during drying. Rubbing the surface of a Saran wrap (Dow Chemical Co., Uxbridge, Middlesex, UK)-covered UV-transtlluminator hard with a tissue creates static, thus holding the filters down. Cover with Saran wrap and a piece of cardboard to keep flat during crosslinking. 13. Titrate conditions of crosshnkmg. In the authors’ experience, crosslmking YAC filters usmg a standard UV transilluminator is more suitable and gives superior results compared to more specialized devices.

30

Cole, Collins,

and Dunham

14. The average wet weight of cells from a single-stamped filter or two htghdensity grtdded filters are approx 0.7 and 1 g, respectively. 15. To prevent precipitation of lithium dodecyl sulfate, all YLS must be rinsed out fully before storage of agarose plugs at 4°C (a mmimum of three 30-min washes m To ,E at 50°C as described m Section 3.2.3., steps 2 and 3) 16. The use of multichannel pipets vastly increases the rate of PCR screening. Pools are ahquoted mto 96-well microtiter plates as described below. Multichannel pipets are used both to set up the PCR reactions directly from the microtiter plate into a 96-well PCR plate, and to load the agarose gels. Round bottomed microtiter plates for pool storage are available from Falcon. PCR plates (96-well) are available from Hybaid or Costar (Cambridge, MA). To increase the efficiency of gel loading, combs are designed to form lanes at twice the frequency of mtcrotiter plate wells, hence, pools are arranged m the microtiter plate with odd numbers in the first column (pool 1 in Al, pool 3 m Bl, pool 5 in Cl, etc.) and even numbers m the second column (pool 2 m A2, pool 4 m B2, pool 6 m C2, etc.). Aliquot a maximum of 200 pL/well. Repeat this format until the plate 1s full. To prevent evaporation of the pools during storage, overlay each well with two drops of mineral oil and seal the plates with microtiter plate sealers (see Chapter 2, Materials and Methods). Followmg PCR, use the multichannel pipet to load column 1 mto wells 1,3,5,7,9, 11, 13, and 15. Load PCR reactions in the second column mto wells 2, 4, 6, 8, 10, 12, 14, and 16. In this way, the linear order 1, 2, 3, 4, and so on, is re-created on the gel Pools representmg several libraries may be aliquoted mto a single microtiter plate. Single plate (secondary) pools may also be aliquoted into microtiter plates.

References 1. Green, E. D. and Olson, M. V (1990) Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reaction Proc Natl. Acad Scr USA 87, 1213-1217. 2. Bentley, D R , Todd, C., Collins, J., Holland, J , Dunham, I., Hassock, S., et al. (1992) The development and application of automated gndding for efficient screening of yeast and bacterial ordered libraries. Genomxs 12,534-541 3 Amemlya, C T , Alegria-Hartman, M J., Aslanidis, C., Chen, C., Nikohc, J , Grmgnch, J. C , and De Jong, P J. (1992) A two-dimensional YAC pooling strategy for library screening via STS and Alu-PCR methods. Nuclezc Acids Res 20, 255%2563. 4. Chumakov, I., Rigault, P., Gmllou, S., Ougen, P , Billaut, A , Guascom, G., et al

(1992) Continuum of overlapping clones spanning the entire human chromosome 21q. Nature (Lond) 359,380-387

YAC Library

Screening I

31

5. Foote, S., Vollrath, D , Hilton, A , and Page, D. C (1992) The human Y chromosome: overlapping DNA clones spanning the euchromatic regtons. Sczence 258,6&66. 6. Ntzettc, D. N., Zehetner, G., Monaco, A. P., Gellen, L., Young, B D., and Lehrach, H. (199 1) Constructron, arraying and high density screening of large insert libraries of the human chromosomes X and 2 1. their potential use as reference libraries. Proc. Nat1 Acad Scr USA 88,3233-3231 7. Copeland, A and Lennon, G (1994) Rapid arrayed filter productton using the “ORCA” robot. Nature (Lond) 369,42 1,422 (product review). 8. McKeown, G., Watson, A., Karunaratne, K., and Bentley D (1993) High throughput filter preparation robot. Genome Science and Technology (spectal first issue), Program and Abstracts Genome Sequencing and Analysis Conference V, October 23-27, 1993, p 56 (abstract C 21).

CHAPTER4

YAC Library Hybridization

John

Screening

II

and PCR-Based Screening Protocols

Charlotte E. Collins,

G. Cole, and Ian Dunham

1. Introduction Yeast artificial chromosome (YAC) libraries stored in microtiter plates are available for screening as either complex PCR pools or hybridization filters generated from YACs gridded at high densities (see Chapter 3). Different libraries may be available as either PCR pools, hybridization filters, or both. Consequently, screening strategies have been designed that rely solely on either technique, or use a combined approach. Clearly, access to the YAC library microtiter plates and an automatic gridding system allows the user greater flexibility and is an advantage in large mapping projects. Hybridization filters containing YACs gridded at high density locate each positive YAC to an individual microtiter plate well coordinate in one experiment. The precise arrangement and number of YACs on a filter will vary depending on the robot employed, and different centers will grid the same library in quite different arrays. For the purposes of this chapter, hybridization of nylon filters generated using the customized robot employed in the authors’ laboratory are described (Fig. 1, refs. 1,2, G. McKeown and A. Watson [Sanger Centre, Cambridge, UK], personal communication). A number of different PCR-screening strategies have been described (1,3-S). The more complex PCR pools based on high density row and From Methods In Molecular Biology, Vol 54. YAC Protocols Edlted by. D Markle Humana Press Inc., Totowa, NJ

33

Cole, Collins,

34

and Dunham

High Density YAC Filters

B

1

2

3

4

5

6

7

8

9

10

11

12

1

2

3

4

5

6

7

8

9

10

11

12

72mm

~-108

mm-*

Fig. 1. High-density YAC filters. (A) Representation of a hybridization result showing the 4 x 4 array of 1536 clones gridded from 16 microtiter plates onto a single 8 x 12 cm filter. Autoradiographs and filters are labeled in the top lefthand corner, corresponding to position Al of the microtiter plate. Within each square of 16 YACs the 16 microtiter platesare gridded as follows: row 1, plates

YAC Library

Screening II

column pools or combinatrons of l/2 plates may be able to locate a positive PCR signal to a single microtiter plate well using relatively few PCR pools. However, these may also give increased background noise. For the purposes of this chapter, use of a relatively simple pooling strategy is described (see Fig. 2). Here, each primary PCR pool contains total yeast DNA isolated from sixteen 96-well microtiter plates, or 1536 yeast colonies. The secondary PCR pools contain the DNA derived from each of the appropriate 16 plates individually. Once a YAC has been located to a single microtiter plate pools representing the 8 rows and 12 columns of the 96-well mrcrotiter plate can be prepared and screened, thus locating

the positive YAC to a single well (Fig. 3). Alternatively, a hybridization filter may be prepared and screened using the labeled sequence tagged

site (STS) as a probe (see Note 1). 2. Materials 2.1. Hybridization

1. YAC hybridization filters prepared as described m Chapter 3. 2. 20X SSC: 31MNaC1,0.3M Trr-sodium citrate, pH 7.0. 3. 100X Denhardts: 20 mg/mL Ficoll400-DL, 20 mg/mL polyvmylpyrrolidone 40, 20 mg/mL BSA pentax fraction V. 4. Hybridization buffer: 6X SSC, 1% sarkosyl, 10X Denhardt’s solution, 50 m&I Trrs-HCl, pH 7.4, 10% dextran sulfate. 5. 10-20 ng DNA probe. 6. Total yeast DNA: 40 ng at approx 10 ng/pL (see Note 2). 7. A-Minus nucleotrde mix: 1 mL 1.25MTris-HCl/O. 125M MgC12, 18 pL P-mercaptoethanol, 5 pL 100 mM dCTP, 5 pL 100 miI4 dTTP, and 5 pL 100 mMdGTP. 8. a-35S-(thio)clATP (600 Ci/mmol). 9. Sheared human placental DNA (10 mg/mL, e.g., Sigma [St. Louis, MO] D-3287) (see Note 3). l-4; row 2, plates 5-8; row 3, plates 9-12; row 4, plates 13-16. Filter 3 from a library is shown, therefore this filter contams YACs from microtiter plates 33-48 (see Fig. 2). The black crossesare drawn on to the autoradrograph to enable accurate interpretation of results wrth the help of the template shown in (B). (B) Scale drawing of the templatesused to aid interpretation of high-density YAC filter autoradiographs, Templates are prepared on overhead projector acetate sheetsusing fine, pale-colored pens. A positive signal is seen in (A) as follows: filter 3, C5, posttion 10. This signal therefore ongmates from mtcrottter plate 42, position C5.

Cole, Collins,

36 YAC Library

Plates

I-16

PCR Pooling

17-32

33-48

Scheme

n-(n+15)

..a . . . . .

........ AN

~

Primary Pools -

and Dunham

1

123.....

NC

PCR Products

~~~ Secondary Pools -

33

35 34

37 36

39 38

41 40

43 42

45 44

47 46

48

Fig. 2. YAC library pooling scheme. Total yeast DNA from 16 microtiter plates of YAC clones have been combined in each primary PCR pool to give primary pools 1 to N. The PCR is performed on each pool of DNA. Following gel electrophoresis of the PCR products, pool 3 is identified as containing at least one positive YAC with the help of the genomic positive control (lane marked C) and a DNA marker (i.e., 1-kb ladder, not shown). The PCR is performed on the 16 secondary PCR pools (pools 33-48) that correspond to primary pool 3. Gel electrophoresis would be performed to identify a positive secondary pool, thus identifying an individual positive YAC library microtiter plate.

YAC Library

Screening

37

II

Rows and Columns A

Strategy

Pooling Columns 1

2

3

B Rows and columns Columns

4

5

6

7

8

9

10

11 12

PCR Rows

Fig. 3. Row and column strategy. (A) Representation of a 96-well microtiter plate containing colony dilutions in TO,,E stamped from a single YAC library plate. An aliquot of YAC colony from each of the 12 columns and 8 rows are combined to generate rows and columns pools. For instance, the eight colony dilutions combined to generate PCR pool “column 5” are highlighted with the vertical block. The 12 colony dilutions combined to generate PCR pool “row C” are highlighted with the horizontal block. (B) Representation of results of gel electrophoresis of the 12 column and 8 row PCR pools, showing positive signals from column 5, row C, and a genomic positive control (+). Thus, a positive PCR result detected in the secondary PCR pool representing this plate has been localized to plate position C5.

Cole, Collins,

38

and Dunham

10. Wash solutions: a 2X SSC. b 0.5X SSC, 1% sarkosyl c 0.2X SSC, 1% sarkosyl. d. 0.2x ssc.

11. Autoradrography film (e.g., DuPont [Boston, MA] Cronex 4, cat. no. 6603478) and cassetteswith intensifying screens. 12. Luminescent sticker (e.g., glo-gos, Stratagene, La Jolla, CA). 2.2. PCR Screening 1. PCR pools prepared as described m Chapter 3. 2. Genomic DNA (15 ng/pL) derived from the speciesin question (i.e., human, mouse, etc.) containing the target sequence for use as a positive control. 3. 10X PCR buffer: 670 mM Tris-HCl, pH 8.8, 166 mM enzyme grade (NH4)$S04, 67 mill MgCl* (see Note 4). 4. 1OX Nucleotide mix: 5 mA4 each dNTP. 5. 1OX Primer mix: 13 pA4 each primer. 6. 5 mg/mL BSA (Sigma A-4628). 7. 700 mM /3-mercaptoethanol: 1 m 20 dilution of 14A4P-mercaptoethanol m sterile water 8. Tuq polymerase. 9. PCR grade mineral oil (e.g., Sigma 8042-47-5). 10. T0 ,E: 10 mMTris-HCl, 0.1 mMEDTA, pH 8. 11. 2.5% Agarose, 1X TBE mmigels containmg 0.2 pg/mL ethidium bromide in the gel and the running buffer (see Note 5). 12. 15-cm Circular YPD-agar plates (see Chapters 2 and 29; Note 6). 13. 96-Well microtiter plates. 14. 96-Pm replicating tool (see Chapter 2). 15 Access to YAC library microtiter plates. 3. Methods 3.1. Hybridization-Based Screening 3.1.1. Preparation of Labeled Probe 1. Prepare labeled probe using standard techniques (0.25-l x 1Ogcpm/pg of probe; see Note 7). 2. Separate labeled probe from unincorporated label if desired (see Note 8). 3. Add To ,E to give a final volume of 125 pL (see Note 9). 4. If competrtton 1s required, add 125 pL sheared placental DNA, 125 pL Tc ,E, and 125 pL 20X SSC. Mix well (see Note 10). 5. Boil for 5 min, snap chill on water/ice mix. If labeled yeast background is used (see Section 3.1.2.) this can be added to the probe mix before boilmg.

YAC Library

Screening II

3.1.2. Preparation of Labeled Yeast Background (Optional) 1. Prepare 35S-labeled yeast background. Use 40 ng of total yeast DNA in a routme random prime hexamer labeling, but substitute 5 pL [a-35S]dATP in place of [a-32P]dCTP and use A-minus nucleotide mix (see Note 11). 2. Following labelmg, add 100 pL T, 1E/25 pL labeled yeast background (do not separate unincorporated label). Store at -20 or -70°C. 3. Allow approx 0.5 pWl0 mL of hybridization buffer. Either add directly to the probe before boiling or boil for 5 mm, snap chtll on water/ice mix, and add to the hybridization mix separately. 3.1.3. Pretreatment and Hybridization

of Nylon Filters 1. Ensure the hybridization filters have been UV crosslmked (see Chapter 3, Section 3.1.2, step 12). 2. Prehybridize for 1 h at 65’C, preferably leave for 2-3 h. a. For library screens of up to 25 filters (see Note 12) the authors use empty rectangular 8 x 12 cm gridding plates (Chapter 3, Section 2.1.) item 2). Use approx 40 mL hybrtdization buffer for 25 filters, adding the filters individually to the hybridization buffer. Cover with a sheet of plastic (e.g., as used for hybridization bags) and the plate lid. Seal m a sandwich box containmg a moist tissue to prevent drying. b. For hybridization of one to three filters, the authors use a 15-mL roundbottomed plastic tube. Fill the tube with hybridization buffer, roll up the filter (colony side Inward), and use tweezers to slide the filter down to the bottom of the tube where it will unwind. Hybridtze upright m an orbital shaker. 3. Add the boiled probe to the filters. a. If using filters layered in a box, remove filters from the box draining excess hybridizatton buffer back mto the box. Add the probe to the buffer and mix well. Add filters back into the box one at a time (colony side down), covering each filter with hybridization buffer. Cover with plastic and seal as described in step 2a. b. If hybridizing filters in 15-mL tubes, add the probe into the center of the tube, re-cap, and invert gently at least 6-10 times to mix. 4. Hybridize with gentle shaking or 18-48 h, 65°C

3.1.4. Washing and Autoradiography

of Filters 1. Pour off hybridization buffer and wash filters m an excess of wash solutions (use at least 500 mL/25 filters). a. Wash twice in wash solution 1 for 5 min at room temperature with gentle shaking. b. Wash for 30 mm in wash solution 2 at 65OC with gentle shaking

40

2. 3.

4. 5. 6. 7. 8. 9.

10.

11.

1. 2. 3. 4.

Cole, Collins,

and Dunham

c. Wash for 30 mm in wash solution 3 at 65OC with gentle shakmg (see Note 13). d. Wash twice in wash solution 4 for 5 min at room temperature with gentle shaking. Smooth a sheet of Saran wrap (Dow, Uxbridge, Mtddlesex, UK) Just larger than the cassette onto a flat surface. Briefly touch the back of the filter onto a sheet of 3MM Whatman (Maidstone, UK) to drain excess hquid and lay the filters colony side down onto the smoothed out Saran wrap (see Note 14). Do not touch the colony side onto the Whatman paper and avoid hftmg the filter from the Saran wrap since colony debris and associated probe may stick to the Saran wrap. Cover with a second sheet of Saran wrap. Do not rub smooth the colony side of the Saran wrap, particularly after freezing, as the colony debris and associated probe will smear over the filter. Stick a glo-go on to a clear area of Saran wrap. Preflash the film and autoradiograph for 5 h to 7 d as necessary(see Note 15). Lay the autoradiography film over the wrapped up filters and mark the position of the corners of the filter and the position of each filter name. Filters may be rewashed if necessary (see Note 14). Carefully peel the filters off the Saran wrap (see Note 16) and wash as required, including a final room temperature wash without sarkosyl. Re-expose as described. Identify positive clones using a reference template if necessary. Prepare the template by using a pale (e.g., not black) fine marker pen to draw a grid on an overhead acetate sheet. If available use an autoradiograph with good yeast background signal as a model (see Fig 1). Mark small crosses on the autoradiograph at the mtersecttons of several 4 x 4 squares of clones (see Fig. 1; Note 17). Line up the crosses on the film with the intersections on the grid, making sure to keep the orientation of the labeled film and template correct. (The authors label filters m the A 1 position.) Each box on the template surrounds the clones grtdded in a 4 x 4 array from a specific well position in 16 microtiter plates. If background is not uniformly visible, the position within a square on the template 1sused to determine the source of the positive signal. 3.1.5. Rescreening of Positive Colonies Thaw the relevant working copies of the library plate. Streak to single colonies on AHC agar plates (see Chapter 29). Grow for two nights at 30°C. Fill 96-well microtiter plates with 150 pL YPD broth (see Chapter 29)

YAC Library

Screening II

41

5. If purificatton to single colonies is required, pick four to six colonies mto individual wells of the microtiter dish (see Note 18). Pick a mixture of colonies into a final well. Incubate at 30°C for 2 nights. If single colonies are not desired, pick a mixture of colonies into a single well of the microtiter dish. Grow for 2 nights at 30°C. 6. Duplicate and freeze the microtiter plates as described m Chapter 2, Section 3.4. 7. Using one of the copies only, stamp or grid the rescreen plates and prepare hybridization filters as described in Chapter 3. Hybridize the filters as described. 8. Use the second plate for archiving the appropriate clones (see Note 19).

3.2. PCR-Based Screening 3.2.1. Primary Pool PCR This method is based on the use of 0.5~mL microcentrifuge tubes. For rapid throughput of STSs, pools are stored in 96-well microtiter plates enabling the use of multichannel pipets to set up the reactions in PCR microtiter plates and to load the agarose gels (see Note 16, Chapter 3). 1. Prepare a PCR premix as follows (allow approx one spare tube worth for every 10 yeast primary pools, plus 2 tubes worth for controls): For each reaction tube, mix 1.5 uL 10X PCR buffer, 1.5 uL 10X dNTPs, 1.5 l.tL 10X primer mix, 0.49 JJL 5 mg/mL BSA, 0.21 pL 700 mM P-mercaptoethanol, 0.1 uL Taq polymerase (0.5 U), 6.7 yL To lE. Vortex to mix. 2. Place a 3-l.tL droplet of each yeast primary pool onto the side of a 0.5~uL Eppendorf tube approx 5 mm below the lip of the tube. 3. Place a 3 uL droplet of T,, ,E and 3 uL 25 ng/uL genomtc DNA onto the edge of the negative and positive control tubes. 4. Add 12 PL of PCR premix into each tube above the DNA (it will mix with the DNA by gravity). You do not need to change the pipet tip between aliquots of premix unless you have touched the DNA. 5. Add a drop of paraffin oil to each tube above the DNA/premix. The DNA/ premix should mix and drop to the bottom of the tube below the oil without centrifugation. 6. Perform 35 cycles of PCR (see Note 20). 7. Test 5 ltL of each PCR product on a 2.5% agarose mimgel prepared as described in Section 2. Include a suitable size marker at the end of each lane (see Note 21). Electrophorese until the bromophenol blue (if used in loading buffer) has migrated approx 3-5 cm. 8. Photograph gel under UV. 9. Identify all positive pools (see Notes 20,22, and 23).

Cole, Collins,

42 3.2.2. Secondary

and Dunham

Pool PCR

1. For each positive primary pool, identify the relevant secondary pools. The simple pooling system described in Fig. 2 identifies 16 secondary pools for each primary pool. 2. Prepare a PCR premix suffictent for each set of 16 secondary pools, plus the positive primary pool and a genomic and To iE control. Perform the PCR as described m detail m Section 3.2.1. 3. Identify the positive secondary pools. Each pool represents the contents of a single mrcrotiter plate in the poolmg systemjust described (see Note 24). 3.2.3. Preparation

of “Rows and Columns”

PCR

Preparation of rows and columns PCR pools can be avoided by the use of hybridization to nylon filters (see Note 1). 1. Thaw YAC library (working) mtcrotiter plate correspondmg to each positive secondary pool. 2. Stamp the contents of each mtcrotiter plate onto circular YPD agar plates usmg the 96-pin hedgehog as described m Chapter 2. Be sure to mark the appropriate position on the plate with “A 1,” corresponding to position A 1 m the microtiter plate. 3. Incubate the plates at 30°C for 2 mghts. 4. For each stamped plate, fill each well of two 96-well mtcrotiter dishes wtth 100 uL PCR-grade To ]E using a multrchannel pipet if available. 5. Using the 96-pin “hedgehog” stamp the YACs from each agar plate mto the two filled microtrter dishes (see Chapter 2). Be sure to preserve the Al posmon of the stamped agar plate and the microtrter dish (see Note 25). Label one plate “rows A-H” and the second plate “columns l-l 2.” 6. Store the agar plate at 4°C for future use. 7. Take the microtiter plate labeled “rows.” Mix using a pipet and transfer 10 pL of colony suspension from each of the 12 wells m row A (A 1-A 12) to the single well in position Al of a fresh microtrter dish (Fig. 3). You do not need to change pipet tips between each of the 12 wells. If you have access to a multichannel pipeter, steps 7, 8, and 9 can be performed simultaneously. 8. Repeat step 7, but transfer 10 uL of colony suspension from each of the 12 wells in row B (Bl-B12) to posmon Bl of the new mtcrotrter dish. 9. Repeat steps 7 and 8 for each of the remaining rows C to H until Al-H 1 of the new microtiter dish have been tilled with YAC pools representing rows A to H of the YAC library microtiter plate. Using a ptpet mix each of the wells to form a uniform colony suspension of all the YACs present.

YAC Library

Screening

II

43

10. Take the plate labeled “columns.” Mix using a pipet and transfer 10 pL of colony suspension from each of the 8 wells m column 1 (Al-Hl) to the single well in position Al of a second fresh microtiter dish. You do not need to change pipet tips between each of the 8 wells. If you have access to a multichannel pipeter, steps 10, 11, and 12 can be performed simultaneously. 11. Transfer 10 pL of colony suspension from each of the 8 wells m column 2 (A2-H2) to the single well in posttion A2 of the new microtiter dish as described in step 9. 12. Repeat steps 10 and 11 for each of the remainmg columns 3 to 12 until Al-Al2 of the new microtiter dish have been filled with YAC pools representmg columns 1 to 12 of the YAC library microtiter plate. Using a pipet mix each of the wells to form a uniform colony suspension of all the YACs present. 13. The microtiter dishes containing the colony suspensions can be stored at 4°C for several months or more. It is advisable to seal the wells to prevent evaporation. The authors use microtiter plate sealers (Dynatech [Chantilly, VA], cat. no. 001-010-5701). 1. 2. 3. 4. 5. 6. 7.

3.2.4. Rows and Columns PCR Set up a PCR premix sufficient for each set of 20 rows and columns PCR reactions (8 rows and 12 columns), plus the positive secondary pool, a genomic and a To ,E control as described m Section 3.2.1.) step 1(see Note 4). Aliquot 12 pL of PCR premix mto each of, for example, 23 tubes (for a single rows and columns PCR). Mix the colony pools well using a pipet and add 3 pL of colony suspension, 3 PL of genomic DNA, or 3 pL of To ,E into the PCR premixes as appropriate. Add a drop of mineral oil to each tube. Perform the PCR using appropriate conditions for 35 cycles (see Note 26). Test 5 pL of PCR product on a 2.5% agarose minigel as described in Section 2. and Section 3.2.1.) step 7. Photograph under UV and identify the positive pools. You expect one of the 8 rows (A-H) and 1 of the 12 columns (1-12) to be positive. Positive signals of the expected size in, for example, row pool C and column pool 5 determines that the positive YAC is expected to reside in position C5 of the original YAC library plate (Fig. 3, see Notes 27-29). 3.2.5. Confirmation

by Colony PCR The results of a rows and columns pool result must be confirmed by colony PCR on the single “positive” YAC identified (see Notes 4 and 26).

44

Cole, Collins, and Dunham

1. Set up a PCR premix sufficient for each colony to be confirmed, plus a genomic and a To ,E control as described in Section 3.2.1.) step 1 and ahquot 12 yL into each 0.5-mL PCR tube. 2. Use the stamped agar plate representing the relevant YAC library plate (stored at 4°C Section 3.2.3., step 6) to add the deduced positive YAC to the PCR premix: a. Either: Use a toothpick or yellow tip to suspend a small “blob” of colony in 100 pL of T0 ,E and add 3 pL of the resultmg colony suspension to the PCR, b. Or: Touch a yellow tip just onto the colony and stardn-ectlymto the PCR. In this caseadd 3 yL of T, ,E to the PCR tube to make up the volume to 15pL. 3. Perform the PCR as appropriate for 30-35 cycles and test on a 2.5% agarose mmtgel as described m Section 3.2.1.) step 7 (see Note 30). 4. Spreading of YACs between mtcrotiter plate wells during manipulation of the library can result m mixed colonies wtthm a single well. To confirm absolutely the presence of two STSs within a single YAC, streak the YAC to single colomes on AHC agar plates, pick individual colonies into 100 I.~LTo ,E for use m PCR testing as described. Use the same toothpick to patch the colony onto YPD agar plates for growth and future archivmg. Use the colony suspension to test mdtvtdual colonies with each STS (see Notes 19 and 20).

4. Notes 1. Generation of numerous row and column pools can be avoided by the preparation of a high density hybridization filter containing all the microtiter plates to be tested with one or more STSs. This is the authors’ method of choice when high throughput STS testing is required. Alternatively, a hybridization filter containing a single microtiter plate may be prepared manually. See Chapter 3 for preparation of hybridization filters. STSs are labeled by PCR-labeling (see ref. I, Note 7). 2. Items 6-8 in Section 2.1 are optional for labelmg yeast background if required. 3. Item 9 in Section 2.1. is optional for prereassoclation of hybridization probes where required. 4. Many different PCR buffers are available. Some may work better than others for parttcular STSs. However, the authors have found the buffer/PCR conditions given to be most reliable, particularly when used m a yeast colony-PCR. 5. We use 7.5-cm gels with two 23-well combs placed at 1.5 and 4.5 cm, respectively (Flowgen [Slttmgbourne, Kent, UK] mimgel apparatus, 23well combs available from Flowgen on request).

YAC Library

Screening II

6. Items 12-15, Section 2.2. are for preparation of single plate rows and columns if required. 7. Labeling may be performed using standard random primed hexamer labeling techniques or by PCR labeling (I). PCR labeling is particularly effective for labeling STS for use m library screens or secondary screens followmg primary and/or secondary PCR. Use 3-5 PL [a-32P]dCTP (3000 ci/mmol) for a full library screen m up to 40 mL hybridization buffer. Use 0.5-l PL (1 pL for PCR labeling) of [a-32P]dCTP for hybridization of l-3 filters m 15 mL buffer. 8. Separation of labeled probe from unmcorporated nucleotides 1snot necessary in order to achieve strong, clean signals and is only required to check labeling efficiency. The authors routinely use labeled probes directly. 9. If PCR labeling is used, add a small amount of a 0.5 % phenol red/dextran blue dye mix to help visualize separation of probe from mineral oil. 10. Contrary to conventional advice, the authors have found it is possible to add the boiled probe/human DNA mix directly to the hybridization filters without prior incubation. This includes labeled Mu-PCR probes derived from YACs for use m 2- or 3-filter hybridtzations. 11. Labeled yeast DNA background is not always necessary. Its inclusion depends on the type of probe used and the washing stringency. Some probes, e.g., small single copy STSs, may give no background hybrtdization signals on negative yeast colonies. In contrast, Mu-PCR probes and cosmids generally give adequate background when used alone. 12. Before using a newly prepared probe on a large number of filters it is advisable to hybridize and wash a single filter first using an aliquot of labeled probe. Freeze the remaining probe until the filter has been checked for unacceptably high (and potentially irreversible) background hybridization signals. 13. Although these conditions routinely work well, the stringency of washing conditions required will vary dependmg on the probe employed. 14. Do not dry excessively, since this compromises the effectiveness of rewashing. 15. Unless the filters sound very hot (>20 cpm), the authors routinely test after approx 16 h and take a second exposure as required. 16. It is normal to observe some(radioactive) colony debris stuckto the Saranwrap. 17. If the background ts faint these may be difficult to see at first. Look hard, holding the film up to the light at different angles or take a longer exposure. 18. It is advisable to use mixed isolates rather than mdividual colonies in subsequent tests owing to the possibility of part of the YAC insert m specific colonies deleting during growth. In regions prone to deletions isolation to individual single colonies may never be advisable.

46

Cole, Collins,

and Dunham

19. Once a colony result has been confirmed, the relevant yeast clone should be grown up for archiving and future testing. The authors pass all clones through selectton on an AHC agar plate and pick a mixture of colonies mto several microtiter plates. These are grown as described m Chapter 2 and transferred to sets of microtiter plates containing our entire collection of isolated YACs. The authors recommend preparing a master plate (which is rarely used, and never employed for robotic griddmg, etc.), a working master (remade when necessary from the master), and several working plates (remade from the workmg master). 20 Yeast pools (especially complex primary pools) may give PCR background, whereas human and rodent samples do not. Raising the annealing temperature and lowering the extension time can eliminate this problem. However, persistent yeast-specific fragments may be ignored if they do not interfere with the human-specific band. Yeast-specific fragments cannot be ignored if they overlap in size or they amplify stgmticantly more efficiently and may dominate amplification m a particular PCR tube. 2 1. To ensure correct sizing of PCR fragments, the authors recommend loadmg the products of amplification of human DNA at both ends of each comb. 22. Check immediately that the expected size has been amphfied. 23. Amplification of significantly more positives than expected from the library complexity indicates a potential problem because these signals are unlikely to result from amplification of a single copy human DNA sequence. It is more likely that they represent either human repeat sequences or intermittent yeast background. 24. The number of positive secondary pools per positive primary pool will depend on the library complexity and the arrangement of pools. The pooling scheme described in Chapter 3 normally yields one (occasionally two) positive secondary pools per primary pool for a <6-hit library. 25. Take care not to transfer agar to the microttter dish and check yeast colony has transferred to each well. 26. Colony suspensionsdo not appear to amplify consistently m PCR machines that use heated top plates m place of mineral oil (e.g., Cetus 9600; Eric Green, personal communication). In this case heat the colony suspension (98OC, 10 min), spin, and geneclean (Bto 101) the suspension before use, or add mineral oil to the PCR. 27. If more than one positive in either the 8-row or 12-column PCRs are observed, the position indicated by the strongest row and column PCR is probably correct. Other signals may result from contamination during preparation of the rows and columns pools. Alternatively, one clone may be present twice on the same microtiter plate following spreading during mampulation of the library. However, two strong signals in each row and

YAC Library

Screening

II

47

column set could indicate the presence of different YACs positive for the same STS in a single plate. Test all combinations of rows/columns by colony PCR (see Section 3.2.5.) to identify the correct microtiter plate position(s). 28. Weak PCR signals in hand-prepared rows and columns pools are not uncommon. Test all possible positive colonies by colony PCR (see Section 3.2.5.). 29. If either the row or columns do not give a positive signal, test all 12 or 8 colonies in the relevant positive row or column, respectively, by colony PCR (see Section 3.2.5.). 30. If the expected colony is not positive, the orientation of the row or column pools may have been reversed during then preparation. Test possible alternatives.

References 1. Bentley, D R.. Todd, C , Collins J., Holland, J., Dunham, I , Hassock,S , et al (1992) The developmentandapphcationof automatedgridding for efficient screening of yeastand bacterial ordered libraries. Genomics 12,534-541. 2 McKeown, G , Watson, A., Karunaratne, K , and Bentley D (1993) Hugh throughput filter preparation robot. Genome Sci Technol (special first issue), Program and Abstracts Genome Sequencing and Analysrs Conference V, October 23-27, 1993, p. 56 (abstract C 21). 3. Green, E. D. and Olson, M V. (1990) Systematrc screening of yeast artrficralchromosome hbrarres using the polymerase chain reaction. Proc Nat1 Acad Scz. USA 87,1213-1217 4. Amemrya, C. T., Alegria-Hartman, M. J., Aslamdrs, C., Chen, C., Nikolic, J., Gringrich, J. C , and De Jong, P. J. (1992) A two-dimensional YAC pooling strategy for library screening via STS and Alu-PCR methods. NucEex Acids Res 20,

2559-2563 5. Chumakov, I., Rigault, P., Guillou, S , Ougen, P , Billaut, A., Guascom,G., et al. (1992) Contmuum of overlapping clones spanning the entire human chromosome 21q. Nature (Land.) 359, 380-387.

CHAPTER5

Cloning of Human in Saccharomyces Gillian

Telomeres cerevisiae

Bates

1. Introduction 1.1. Telomeres Telomeres are specialized structures that form the ends of eukaryotic chromosomes and that are required to fulfill a number of varied functions, see Biessman and Mason for recent review (I). First, they must protect the chromosome ends from degradation and from fusion and recombination with other chromosome ends or internal DNA. They must also provide a solution to the problem of chromosome end replication, because all known polymerases require a primer and synthesize DNA from 5’-3’, therefore, the 3’ ends of linear DNA pose a problem to the normal replication machinery. They can influence gene expression by position effect variagation and finally, telomeres may play a role in establishing the architecture of the interphase and/or the meiotic prophase nucleus. Isolation of telomeric sequences is therefore of interest with respect to unraveling telomere structure and the mechanisms underlying telomeric function. In addition, the isolation and characterization of all human telomeres is a necessary part of the human genome project in order to generate genetic and physical markers at the ends of chromosomes thereby providing the boundaries of genetic and physical maps. The structure of eukaryotic telomeres is highly conserved and characterized by a tandem array of G-rich telomeric repeats. This G-rich sequence has been determined for a number of species to be as follows (2): T4G4(&y&ha), (TG)im3TGZm3 (Saccharomyces),T1-‘LACAc-iCO-IG14 From Methods m Molecular &ology, Vol 54, YAC Protocols E&ted by D Markle Humana Press Inc , Totowa, NJ

49

(Schizosaccharomyces), AGt-s (Dictyostelium), T2G4 (Tetrahymena), T2AG3 (Trypanosoma and vertebrate) (3). Genetic studies m S. cerevisiae

have shown that the tandem array of this G-rich sequence is both necessary and sufficient for telomere function (4). The original yeast artificial chromosome (YAC) cloning vector described by Burke et al. (5) uses telomere sequencesfrom Tetrahymena which act as functional telomeres in S. cerevisiae. The isolation of the human telomere repeat (6) revealed that its sequence is identical to that in trypanosomes and differs by only a single base from that in Tetrahymena, making it extremely likely that a human telomere would also be functional in yeast. 1.2. Telomere

Cloning

Approaches

Strategies were developed by a number of groups to clone human telomeres by complementation in yeast (7-1 I). In general, the approach was the same in all cases and a telomere cloning vector (or half YAC vector) was used that contains a yeast centromere, yeast replicating sequence, selectable marker, and a single cassette of the Tetrahymena telomere repeat. Linearization of such a vector produces a molecule with a cloning site at one end and a Tetrahymena telomere at the other. Ligation to genomic DNA that has been restricted with the appropriate endonuclease will then provide the means to identify the subset of molecules that terminate in a human telomere. Several approaches were developed in order to enrich for telomeric sequences prior to the construction of these libraries. Cross et al. (10) took advantage of the low frequency of Sau3A sites close to telomeres, thereby enriching telomere sequencesby isolating the large fraction from a Sau3A complete genomic digest. Cheng et al. (9) used a complete EcoRI digest of genomic DNA and circularized chromosome-internal EcoRI fragments using dilute ligation conditions and Brown (8) used a complete BamHI digest and isopycnic centrifugation on a Cs2S04 gradient in the presence of silver ions to enrich for (TTAGGG), sequences. All of these methods were based on the digestion of genomic DNA with frequent cutter enzymes and generated comparatively small clones. Bates et al. (7) and Riethman et al. (II) did not attempt to enrich for telomeric fragments but aimed to take advantageof the large clone size that could be achieved by using YAC vectors in S. cerevisiae, thereby increasing the likelihood of obtaining single copy DNA in the clones and simplifying the identification of their map location. The approach described here was

Cloning of Telomeres designed to specifically clone the telomere of chromosome 4p (7). Subsequent analysis of this telomere clone showed that the terminal 60 kbp of chromosomes 4p, 13p, 15p, 2 lp, and 22p are identical (12), indicating that large clones would be necessary to unequivocally map these telomeres. 1.3. The YACt2 Vector and CZoning Strategy The YACt2 telomere cloning vector (7) (Fig. 1) was constructed by ligating a single copy of the Z’etruhymena telomere cassette from the pYAC4 vector (5) into the yeast centromere vector YCp50 (13), which contains the centromere CEN4, the ARSl replicating sequence, and the URA3 selectable marker. The addition of a rare cutter polylinker generated a telomere cloning vector with cloning sites for NotI, &XII, S&I, MEUI, &I, and SnaB 1. This vector can be used with a comprehensive range of rare cutter restriction enzymes as it will also accept DNA digested with BssHII, NaeI, NarI, SmaI, and 301, because of ligation compatibility with sites in the polylinker; there is also an EcoRI site for use with fragments generated by partial digestion. In addition, a number of unique sites in the vector backbone, namely XhoI, PvuI, KpnI, and BglII, are available for plasmid rescue of the internal end of the clone. The experiment in which the telomere of chromosome 4p was isolated is outlined in Fig. 1. The pulsed field restriction map at the end of 4p had been established in detail and the position of the telomere could be predicted with some degree of certainty. This experiment was therefore designed to isolate the terminal 115 kbp BssHII fragment which could be identified with a specific probe. Section 3. describes in detail the steps that were carried out in this specific experiment and discussion of possible modifications and/or optimizations appears in the Notes section. 2. Materials 2.1. Enzymes 1. Restrictionenzymes(NEB, Beverly,MA). Performreactionsasrecommended. 2. CIP (calf intesmal phosphatase)(Boehringer Mannhelm, Mannhelm, Germany). 3. T4 DNA ligase (NEB) 400 U/uL. 4. T4 polynucleotide kinase (NEB) 10 U/uL. 5. ProteinaseK (BDH, Leicestershire,UK). Dissolve in water to 10mg/mL, freeze on dry ice, and storein aliquots at -2OOC. 6. Agarase (Cambiochem, San Diego CA; Sigma, St. Louis, MO). Dissolve at 20 U/uL in 50% sterile glycerol and storeat -20°C.

Bates

52

High

molecular

weight

DNA

Y

Digest wth BssHll

I

Digest wth BamHl and Mlul Phosphatase

I

Ligate Remove non recombinant vector Transform Into ura- host

Identify

telomere

of interest

from background

clones

Fig. 1 Strategy for the isolation of the 4p telomere. Genomic DNA was digested to completion with BssHII generating a subset of molecules with a BssHII site at one end and a telomere at the other. The YACt2 vector was digested with MluI (compatible with BssHII on ligation) and BarnHI, phosphatased and ligated to the genomic DNA. After removing some of the nonrecombmant vector on an agarose gel, the ligation mix was transformed into the Ura- yeast strain AB 1380. The 4p telomere was identified from the background of vector and nontelomeric clones by hybridtzation with a 4p specific probe. 7. Novozym 234 (Novobiolabs, Denmark), Zymolyase 20T (ICN Biochemicals, High Wycombe, UK). 8. Lyticase (Sigma). Dissolve to 1000 U/pL in SCE and store at 4°C.

Cloning of Telomeres

53

2.2. Strains and Media 1. Host yeast strain: AB1380 (MATa, ade2-2, canl-200, ly.s2-1, trpl, ura.3, his5, Thr-, [psi-t-]) (5). 2. YPD (see Chapter 29). 3. Regeneration plates: 0.9Msorbitol (Sigma), 3% dextrose, amino acid, and base supplements at 20 mg/mL (without uracil), 2% agar. After autoclaving, add a filter sterilized solution of 6.7% yeast nitrogen base without amino acids (Difco, Detroit, MI) to a final concentration of 0.67%. 4. Regeneration top agar: Same as for the regeneration plates, but with 1M sorbitol and 2.5% Bacto agar. 5. Amino acid and base supplements (Sigma) (stock solutions): 5 mg/mL adenme sulfate, 20 mg/mL L-arginine monohydrochloride, 20 mg/mL L-histidme monohydrochloride, 20 mg/mL L-isoleucine, 20 mg/mL L-leutine, 20 mg/mL L-lysine monohydrochloride, 20 mg/mL L-methionme, 20 mg/mL L-phenylalanme, 20 mg/mL L-tryptophan (light sensitive store at 4OC), 10 mg/mL L-tyrosme, 3 mg/mL uracil, 20 mg/mL L-valine (See Chapter 29 for more details.) 6. Omtssion media: 2% dextrose, required nutrients (without uracil) at 20 mg/mL. After autoclavmg, add a filter sterilized solution of 6.7% yeast nitrogen base without ammo acids (Difco) to a final concentration of 0.67%. Add Bacto agar to 2% for plates. 2.3. Solutions and Buffers 1. TE: O.OlMTris-HCl, pH 8.0, 1 mMEDTA. 2. Nitrilotriacetic acid (NTA; Sigma): Prepare at 0.15M and store frozen in aliquots. 3. 10X ligase buffer: 0.4M Tris-HCl, pH 7.6,O.lM MgC12, O.OlM DTT. 4. 1000X PMSF (phenylmethylsulfonyl fluoride) (Sigma). Prepare fresh by dissolving in isopropanol at 40 mg/mL. Heat to 68°C in order to dissolve. 5. SCEM: 1.OM sorbitol, O.lM sodium citrate, pH 5.8,O.Ol M EDTA, pH 7.5. Filter sterilize and store at room temperature. Immediately before use, add P-mercaptoethanol to 0.03M. 6. STC: l.OM sorbitol, O.OlM Tris-HCl, pH 7.5, O.OlM CaC12.Autoclave or filter sterihze and store at room temperature. 7. PEG: 20% polyethylene glycol6000 (PEG, Serva, Heidelberg, Germany), O.OlM Tris-HCl, pH 7.5, O.OlMCaCl, (prepare fresh and filter sterilize) 8. SOS: 1.OM sorbitol, 25% YPD, 0.0065M CaC&, 1 pg/mL uracil. 9. Hybridization solution: 50% formamide, 4 x SSC, 0.05M sodium phosphate, pH 7.2, 8% dextran sulfate, 10X Denhardts, 1 mM EDTA, 25 pg/ mL sheared denatured salmon sperm DNA, 1% SDS.

10. 11, 12. 13.

PCI: phenol, chloroform, isoamyl alcohol (volume ratios: 25:24: 1). CI: chloroform, lsoamyl alcohol (volume ratios: 24: 1). Phosphate buffered salme (PBS). If unspecified, prepare solutions as described (14).

2.4. Other Materials 1. High gelling temperature agarose (SeaKern) and low melting point (LMP) agarose (Seaplaque), FMC Bioproducts (Rockland, ME). 2. Prepare yeast chromosomes for size markers as described (see ref. 15 and Chapter 7). 3. Lambda concatamer stze markers (FMC Bioproducts). 4. Carrier DNA for spheroplast transformation: Dilute sheared herring sperm DNA (Promega, Madison, WI) to 5 mg/mL m 1M sorbitol. 5. Colony replicator (ICRT, IMTECH, London). 6. Nylon membranes (Hybond N+), Amersham (Arlington Heights, IL).

3. Methods 3.1. Preparation of YACt2 Vector 1. Prepare YACt2 vector DNA by appropriate large scale method (14). 2. Digest a few hundred micrograms YACt2 vector DNA to completion (do not overdrgest) with the enzyme requtred to generate the clonmg site (see Note 1) and check the digest on an agarose gel. Precipitate DNA and digest to completion with BumHI to expose the telomere sequences. 3. Precipitate vector DNA and resuspend m CIP buffer and dephosphorylate with CIP as recommended by the manufacturer (Boehrmger Mannhelm). Inactivate the CIP by the addition of NTA to 0.015M and place at 68°C 10 mm. Extract twice with PCI, once with CI, precipitate, and resuspend in TE at a concentration of 1 pg/pL. 4. Prepare test hgations to ensure that the vector is completely dephosphorylated. Prepare two reactions m parallel each containing 500 ng vector DNA, 1X ligase buffer, 0.2 mM ATP, 0.5 pL (200 U) T4 DNA ligase m 10 PL. To one, add 0 5 pL T4 polynucleotide kinase. Ligate overnight at 15°C. Fractionate on an agarose gel alongside cut and phosphatased vector. The ligase control should appear as linear vector indicating complete dephosphorylation. The kmase control will show both supercoil and concatamer DNA molecules, indicating that the vector ends are ligatable.

3.2. Preparation

of Genomic

DNA

1. Prepare high molecular weight genomic DNA m agarose blocks from lymphoblastoid cell lines or whole blood as described (16). Mix 20 mL whole blood with 2.2 mL 3.8% trisodrum citrate m a 50-mL Falcon tube.

Cloning of Telomeres

55

Divide between two tubes and add 30 mL lysis buffer (0.155Mammonium chloride, O.OlMammonium bicarbonate 0. lMEDTA, pH 8.0) to each, mix by gentle shaking, and leave on ice for 5 min. Pellet cells at 600g for 5 min, resuspend in 10 mL lysis buffer, and stand on ice for 5 mm. Pellet cells at 600g for 5 mm, resuspend m 25 mL PBS, pool, count cells, pellet again, and resuspend at an appropriate concentration m PBS. Lymphoblastoid cell lines are washed twice in PBS, resuspended in 50 mL PBS and counted, pelleted again, and resuspended in an appropriate volume of PBS. Embed cells in 0.6% low melting point (LMP) agarose at a concentration of 3 x IO6 cells/block (approx 20 pg DNA in 80 pL). 2. Digest the genomic DNA m LMP agarose blocks to completron with the rare cutter enzyme of choice (see Note 1). Drgest five blocks (100 pg DNA) in 1X restriction buffer, 0.5 mg/mL BSA with 250 U restriction enzyme in a volume of 1 mL for 4 h. Scale the reaction up or down as requrred but it is worth starting with plenty of DNA. 3. Inactivate the restriction enzyme by the addition of proteinase K to 250 ug/mL and EDTA, pH 8.0 to 0.05M and incubating at 37°C for 30 mtn. Then inactivate the proteinase K by washing the blocks in 50 mL of 40 pg/ mL PMSF in TE twice for 30 mm at 50°C. Store the blocks m 0.5MEDTA while the quality of the digest is assessed. 4. Load one-quarter to one-third of a block onto a pulsed field gel and fractionate the DNA at a pulse time designed to separate fragments up to 1.O1.5 Mb (the size chosen ~111depend on the enzyme used) m order to check the extent of digestion and to ensure that the DNA has not degraded.

3.3. Ligation

to YACt2 Vector

The ligation reaction contains an excess of vector termini in order to lower the chance of obtaining clones with coligated genomic fragments. In the construction of the BssHII telomere library, 20 mg genomic DNA and 60 mg vector DNA were used in each ligation reaction. The size of the YACt2 vector is approx 8 kb, and assuming that the mean size of a BssHII fragment is approx 200 kb, in this reaction there was a 3540fold excess of vector over insert compatible ends. I. Equilibrate the digested blocks with TE + 0.125MNaCl by washmg 3 x 30 min in 50 mL at room temperature. This will give a final NaCl concentration of 0.05M in the ligation reaction. 2. Ligate each block separately in a reaction containing 200 uL. Melt the equilibrated blocks with 20 pL 10X ligase buffer, vector DNA, and the required volume of water at 68°C for 5 min. Allow to cool to 37°C. Add ATP to 0,OOlMand 2000 U T4 DNA hgase and mix gently by stirring.

Bates

56

3. Remove two aliquots of 2 uL from the ligation reactions for ligation controls. Dilute to 5 uL with 1X ligase buffer and add 5 U (0.5 uL) T4 polynucleotide kinase to one of the control reactions. 4. Incubate the library and control hgations at 15OCovernight. 5 Melt the control ligations at 68°C for 5 min and fractionate alongside cut and phosphatased vector on an agarose gel. In the control without kmase, a linear vector band will be visible and there may be a band m the gel limitmg mobility correspondmg to high molecular weight genomic DNA. In the control containing kinase, the vector will have ligated to form concatamers and will mostly appear m the limitmg mob&y of the gel.

3.4. Removal

of Nonligated

Vector

As the telomere cloning vector is a single vector arm, by necessity it contains a selectable marker and an ARSl sequence. In both this experiment and those reported by Brown (8’ and Riethman et al. (II), the vector 1s capable of producing a significant clone background probably owing to m vivo ligation and circularization. In the preparation of the BssHII telomere library, steps were taken in order to remove some of the nonligated vector from the ligations in order to lower the vector background in the library. The steps used are described in the following, however, the vector background was still very high. Because the 4p telomere was isolated from this experiment, this step was not optimized (see Note 2). 1. Melt the ligation at 68OCfor 5 min, carefully add 100 PL 3% LMP agarose m TE, mix by stirring gently and transfer 3 x 100 pL into block formers using a yellow tip from which the very tip has been removed so as to guard against DNA shearing. 2. Load the blocks onto a conventional agarose gel prepared in TAE buffer without ethidium bromide. Ensure that the lanes containing the ligation are flanked by at least two lanes contaming hHzndII1 markers on each side. Mark the level of the buffer and electrophorese the DNA at approx 1.5 V/cm for 2 h. Slice away and stain the outer 3LHz:ndIIImarkers (the 600 bp fragment should travel about 5 cm). The cross-section of the gel containing the 23-kb Hind111marker and below is removed from under the preparative lanes. 3. Recast the remaining gel fragment inside a new gel, place back into the electrophoresis tank, top up the buffer to the previous level, reverse the field, and electrophorese the gel at 1.5 V/cm for another 2 h. Remove the outer hHindII1 lanes, stain, and check that the AHind marker had been successfully electrophoresed back into the slot.

Cloning of Telomeres 4. Remove the blocks from the wells and place m 50 mL O.OlMTris-HCl, pH 7.5,0.02MEDTA, 0.05MNaCl. Stain the remammg gel to reveal any DNA that has been lost from the blocks. This varies from one block to another; the loss of 25% of the DNA at this stage is likely to be an overestrmate. 5. Equilibrate the blocks m O.OlM Tris-HCl, pH 7.5, 0.02M EDTA, 0.05M NaCl by washing twice m 50 mL for 30 mm. 6. Melt the blocks together at 68OCfor 5 mm (three blocks per initial ligation reaction containing a total of 15 ug genomic DNA) and place at 37°C for 10 mm. Add 5 pL 20 U/mL agarase, mix by gentle stirring, and incubate at 37OCfor 4 h (see Note 3). Allow to stand at room temperature for 30 min to check that the reactions do not set and dilute 1: 1with 2Msorbitol (approx 250 mL/ligation reaction) and mix carefully by stirring (see Note 4). At this stage the reactions can be frozen on dry ice and stored at -70°C (see Note 5).

3.5. Transformation into AB1380 Preparation of yeast spheroplasts and transformation was essentially carried out by the method of Burgers and Percival (17). Optimizations of the transformation procedure and notes on troubleshooting are discussed in Chapter 1. 3.5.1. Preparation of Spheroplasts 1. Streak a YPD plate from a frozen stock of AB1380 and grow at 30°C for 2-3 d. Inoculate a 10-mL culture of YPD with a single colony of Al3 1380 and either grow as a standing culture overnight at 30°C or with gentle shaking. 2. Inoculate 200 mL YPD in a 1-L conical flask with 200 pL from the overnight culture and incubate for 16-18 h at 30°C with shaking. 3. Once the OD6e0,,,,,of a 1:lO dilution (in water) of the culture is 0.15-0.2 (see Note 6), divide the culture into 50-mL Falcon tubes. 4. Pellet yeast at 400-6OOg for 5 min at 20°C. Pour off media and resuspend the cells in each tube in 20 mL sterile distilled water. Pool samples to give 2 x 40 mL. 5. Pellet yeast at 400-6OOg for 5 min at 20°C. Pour off the water and resuspend in 40 mL 1.OM sorbitol. 6. Pellet yeast at 400-6OOg for 5 min at 20°C. Pour off sorbitol and resuspend in 40 mL SCEM. Remove 100 uL as a prelyticase control. Begin spheroplasting by the addition of 2000 U Lyticase, mix gently, and incubate at 30°C. 7. Remove a 100~JJLsample from one of the Falcon tubes after 10 min and then at 5-min intervals and monitor the extent of spheroplast formation by two independent methods:

58

Bates

a. Dilution of the spheroplasts (m SCEM) with water creates an osmotic shock, causing them to lyse and hence changmg the optical density of the solutron. Measure the ODhoO,,,,,of a 1:100 dilution in distilled water of the spheroplastmg yeast cells agamst 1% SCEM. The extent of spheroplast formation 1ssufficient when the reading has reached 10% of the prelyttcase value. b. The addition of SDS to an ahquot of the spheroplasting reaction is sufficient to cause the spheroplasts to lyse. These can be observed under phase contrast microscopy as phase dark “ghosts” as opposed to phase bright healthy yeast cells. Mix 5 PL of the cells with 5 l.tL of 2% SDS and observe the extent of ghostrng using a 40X phase contrast oblectrve. Allow spheroplasting to proceed until 95% of the yeast cells have ghosted. 8. Once spheroplast formation has proceeded to 80-90% (after 10-20 mm), pellet cells at 200-300g for 4 mm at 4°C. Resuspend gently m 40 mL 1M sorbitol. 9. Pellet cells at 200-300g for 4 mm at 4°C and resuspend m 40 mL STC. With the use of a hemocytometer, count a 1: 10 dilution of the cells. One hundred millihters of cells, grown to an ODhoO“,,.,of 0.2, should produce approx 5-6 x lo9 spheroplasts. 10. Pellet cells at 200-300g for 4 min at 4°C and resuspend at a concentration of 0.5 x 108/mL in STC. The spheroplasts can be kept on ice for a few hours. 3.5.2. Transformation of Spheroplasts In addition to transformation of the ligations, control transformations should include: 10 ng YACt2 supercoil DNA, 10 ng YACt2 prepared vector, 100 ng YACt2 prepared vector, carrier DNA (see Note 7), and STC. Transform the ligation in 25 separate reactions (see Note 8). The reactions are then pooled into 5 sets of 5 for plating onto 22 x 22 Peti dishes. 1. Prewarm plates at 37”C, melt top agar (5 mL for 90-mm Petri dishes and 50 mL for 22 x 22-cm Petri dishes) and place in a water bath at 48OC. 2. Prepare 15-mL Falcon tubes contammg 16 PL of a hgatron (ahquot usmg a yellow tip that has had the tip removed) and 4 uL carrier DNA, and add 200 l.tL spheroplasts. Mix by sturing. For the vector controls, the vector DNA and carrier should be in a volume of 10 uL or less, to which add 100 uL spheroplasts. Incubate the reactions at room temperature (2% 22OC) for 10 mm. 3. Add 2 mL PEG to each ligation transformation and 1 mL PEG to each control transformation, mix by gentle inversion, and incubate at room temperature (20-22OC) for another 10 mm.

Cloning of Telomeres 4. Pellet cells at 200-300g for 8 min at 20°C and remove PEG with a pipet carefully without disturbing the pellet. 5. Resuspend in 300 pL SOS to for each ligation transformation and 150 pL to each control tube, and place at 30°C for 20-40 min. 6. Pool the five ligation transformations into a 50-mL Falcon (see Note 7). Add 50 mL top agar, mix by mversion, and quickly pour over a prewarmed 22 x 22-cm Petri dish. Add 5 mL top agar to the control transformations and pour quickly over a go-mm Petri dish. 7. Allow yeast to grow for 34 d at 30°C (see Note 8).

3.6. Replication

of Clones Out of Top Agar

One of the major technical difficulties posed by the construction of YAC libraries for the purpose of isolating a single or few clones of interest, is the identification of these specific clones from the library or clone background, without first picking all of the clones out of the top agar into microtiter plates. This obstacle was circumvented by use of a colony replicator (22 x 22-cm aluminum plate containing 40,000 machined pins) (see Note 9). 1. The regeneration plates containing the clones to be replicated must be dry. Leave at room temperature for 1 or 2 d and do not stack the plates or those at the bottom of the stack will not dry as much as those at the top. 2. Sterilize the replicator by flaming in ethanol and place inverted on a support so that the pins are pointing upward. 3. Press one of the regeneration plates face down onto the pins. Press the plate firmly onto the pms at points all over the back of the plate. If the plates are too wet, the agar will behave like a squeezed sponge and the colonies will cross contaminate. 4. Remove the regeneration plate. Place an omission plate face down over the pins and apply a light even pressure over the back of the plate. Do not press too hard as the pms will dig into the agar. Prepare a second plate by removing the first omission plate and replacing it with a second, again applying light even pressure to the back of the plate. For screenmg, two duplicate plates from each library regeneration plate are required although at least six copies of each library plate can be prepared. Allow the omission plates to grow at 30°C for 2-3 d until l-2 mm in diameter.

3.7. Filter

Lifzs, Processing,

and Hybridization

An alternative filter processing protocol is described in Chapter 3. 1. Place a sterile dry nylon filter over the colonies avoiding air bubbles. Orient the filter by piercmg the filter and agar with a sterile needle.

Bates 2. Remove the filter and place colony side up on Whatman (Maidstone, UK) 3MM paper soaked m SCEM contammg 4 mg/mL Novozym 234 or 1 mgl mL zymolyase (20T) (in a container that has a lid and can be sealed with parafilm), and incubate at 37°C for 4 h. 3. Remove filter and place colony side up on 3MM Whatman paper soaked in denaturing solutton (1.5M NaCl; 0.5M NaOH) for 10 min at room temperature. 4. Remove excess denaturmg solutton by resting the filter on dry Whatman 3MM paper. 5. Float the filter on neutrahzmg solutton (1.5MNaCl; lMTrrs-HCl, pH 7.4, approx 1.5 cm depth) for 2 min. 6. Incubate the filter on Whatman 3MM paper soaked in 0.1X neutralizing solution containing 200 mg/mL proteinase K for 2&30 mm at 37°C. 7. Wipe cell debris from the filter using tissues soaked m 0.1 X neutralizing solution using several changes of tissue paper and rinse the filter thoroughly with 0.1X neutralizing solutton to wash away remaining debris and fragments of tissue paper. 8. Float the filter on 2X SSC for 2 mm, and UV crosslink DNA to filter. 9. Prehybrrdtze filters for at least 2 h in hybridizatton solution at 42°C. Hybridize at 42OC with a probe concentration of 1O6counts/ml. 10. Store plates at 4OC. 11. Align duplicate positives on X-ray film with position of clones on plate. Streak positive clone onto omission plates for single colonies and repeat screening. 4. Notes 1. The choice of cloning enzyme will largely depend on whether there 1sany pulsed field restriction map information about the DNA adjacent to the telomere of interest. If so, it is convenient to choose a cloning enzyme that would generate a telomeric fragment of approx 100-200 kb as this size fragment is preferentially cloned in yeast in the absence of size selection. If this informatton IS not readily available, it could be generated by hybrtdizmg a human specific subtelomeric repeat (9,18,19) to a pulsed field filter of DNA from a somatic cell hybrid containing only the chromosome/ telomere of interest that has been digested with a range of rare cutter restriction enzymes. Thts repeat can then be used as a probe to isolate the subclass of telomeres to which rt maps from the library. Alternatively, a telomere library that is potentially representative of all telomeres could be constructed by the use of large DNA molecules that have been generated by EcoRI partial digestion. For this approach, follow the methods in Larm et al. (20) and m Chapter 1 for partial digestion by methylation and size fractronation of the DNA both before and after ligation.

Cloning of Telomeres 2. If the library is to be screened by hybridization for specific telomere clones, and the means to handle large numbers of clones at this step is available (e.g., a colony replicator), it may not be worth trying to remove the nonligated vector. However, if it is desirable to reduce the clone background, the gel approach described in this chapter could be optimized. It was not easy to reset the ligation into blocks and a considerable amount of genomic DNA was lost in trying to electrophorese the DNA back into the blocks. It may be worth melting the ligation and loading it directly into the wells of a LMP gel and isolating the ligated genomic DNA as the gel limiting mob&y. It would be relatively easy to carry out a number of cycles of this by placing the limiting mobility gel slice into the wells of a second gel without risk of DNA damage. On the final cycle, the hmitmg mobility would used to proceed from step 4 m Section 3.4. 3. Test transformations of hgations that had been melted and not treated with agarase indicated that the agarase step may be unnecessary. 4. Dilution with 2M sorbitol was carried out m order to increase the transformation efficiency by reducing any osmotic shock to the spheroplasts. This is probably unnecessary. 5. Tests were not performed to investigate a potential size limit to the DNA that could be frozen without shearing. It would be worth checking this using yeast chromosomes as a control before freezing very large DNA molecules. 6. The yeast cell culture can be used for spheroplasting once it has reached an OD 600,,,,,of 0.05-O 2. However, the higher the OD, the more spheroplasts will be recovered. 7. A more even distribution of clones across the library plates was achieved if the ligated genomic DNA was transformed in small quantities and the transformations were subsequently pooled for plating (20). 8. Transformation efficiencies of the order of 105/l.tg supercoil vector DNA should be expected. In the BssHII telomere cloning experiment, approx 5000 clones grew on each of the five library plates. Of the 25,000 clones, 10% were later found, by hybridization, to contain Alu repeat sequences, indicating that 90% of the clones were vector background. Therefore, 2500 clones contamed human DNA, suggesting a substantial background of nontelomeric clones with ends terminating in BssHII sites that had healed into telomeres by an unknown mechanism. A similar background was also noted by Riethman et al. (22). Although the representation of telomeres in this library can only be estimated, the 4p telomere was present twice suggesting that the library may have contained a oneor twofold representation of telomeric BssHII fragments that fall within the 80-200-kb size range.

62

Bates

9. Smith et al. (21) described a method whereby the clones were plated in 3 mL 2% LMP agarose (per 90 cm plate). After a few days, the top agarose

layer had dried to a thin film so that most of the colonies were growing on the surface and filter lifts could be taken directly.

References 1 Blessmann, H. and Mason, J M. (1992) Genetics and molecular biology of telomeres. Adv. Genet 30, 185-249. 2. Zakian, V. A. (1989) Structure and function of telomeres Annu. Rev. Genet 23, 579-604. 3. Meyne, J., Ratchffe, R. L., and Moyzis, R. K (1989) Conservation of the human

telomere sequence (TTAGGG)n

among vertebrates Proc Natl. Acad Scz USA

86,7049-7053.

4. Szostak, J. W. and Blackburn, E. H. (1982) Cloning yeast telomeres on a lmear plasmid. Cell 29, 245-255 5 Burke, D. T., Carle, G F , and Olson, M. V (1987) Clonmg of large DNA segments of exogenous DNA into yeast by means of artificial chromosome vectors Science 236,806-g 12. 6. Moyzis, R. K., Buckingham, J. M., Cram, L. S., Dam, M , Deaven, L L , Jones, M. D , et al (1988) A highly conserved repetitive DNA sequence, (TTAGGG),, present at the telomeres of human chromosomes Proc Nat1 Acad Set USA 85,6622-6626 7. Bates, G. P., MacDonald, M E , Baxendale, S., Sedlacek, Z., Youngman, S , Romano, D., et al. (1990) A yeast artificial chromosome telomere clone spannmg a possible location of the Huntington disease gene Am J. Hum. Genet 46,762-775 8 Brown, W. R. A. (1989) Molecular cloning of human telomeres in yeast Nature 338,774-776.

9. Cheng, J.-F., Smith, C L , and Cantor, C. R. (1989) Isolation and characterisation of a human telomere Nucleic Acids Res 17, 6 109-6127 10 Cross, S. H., Allshire, R. C., McKay, S. J., McGill, N. I., and Cooke, H. J (1989) Cloning of human telomeres by complementation m yeast. Nature 338, 77 l-774. 11. Riethman, H. C., Moyzis, R. K , Meyne, J., Burke, D. T., and Olsen, M. V. (1989) Cloning human telomeric DNA fragments into Saccharomyces cerevzszae using a yeast-artificial-chromosome vector Proc. Natl. Acad Sci USA 86,6240-6244. 12 Youngman, S., Bates, G P , Williams, S., McClatchey, A I , Baxendale, S., Sedlacek, Z., et al (1992) The telomeric 60 kb of chromosome arm 4p is homologous to telomeric regions on 13p, 15p, 21p, and 22~. Genomics 14,350-356 13. Hieter, P., Mann, C , Snyder, M., and Davis, R. W. (1985) Mitotic stability of yeast chromosomes: a colony color assay that measures nondisJunction and chromosome loss. Cell 40,38 l-392 14 Sambrook, J., Fritsch, E. F., and Mamatis, T. (1989) Molecular Cloning* A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Sprmg Harbor, NY, 15. Herrmann, B. G., Barlow, D P , and Lehrach, H. (1987) An inverted duplication of more than 650 Kbp m mouse chromosome 17 mediates unequal but homologous recombmation between chromosomes heterozygous for a large inversion Cell 48,8 1M25.

Cloning of Telomeres

63

16. Herrmann, B. G. and Frrschauf, A.-M. (1987) Zsolatzon ofgenomzc DNA, Academic, New York. 17. Burgers, P. M. J. and Perctval, K. J (1987) Transformation of yeast spheroplasts without cell fusion. Anal Biochem. 163,391-397. 18 Brown, W. R. A , MacKmnon, P J., Villasante, A , Spurr, N , Buckle, V J , and Dobson, M J. (1990) Structure and polymorphism of human telomere-associated DNA Cell 63, 119-132 19 de Lange, T , Shme, L , Myers, R. M , Cox, D. R , Naylor, S. L., Killer-y, A M., and Varmus, H. E. (1990) Structure and variability of human chromosome ends. A401 Cell Blol 10,5 18-527. 20. Larm, Z , Monaco, A P., and Lehrach, H. (1991) Yeast artificial chromosome hbrartes containing large inserts from mouse and human DNA Proc Nat1 Acad Sci USA 88,4123-4127. 21. Smith, D. R., Smyth, A. P., and Motr, D. T. (1990) Ampllficatton of large arttfictal chromosomes. Proc Natl, Acad SCL USA 87,8242-8246.

CHAPTER6

Purification of YAC-Containing Total Yeast DNA Gary A. Silverman 1. Introduction There are many methods describing the preparation of DNA from Succharomyces cerevisiae. The method described in this chapter is a moditication of those described by Olson et al. (1) and Philippsen et al. (2). Although simpler techniques are available (3), this methodroutmely provides relatively high molecular weight DNA (50-250 kb range) that is suitable for restriction endonuclease digestion; plasmid, phage, or cosmid subcloning; end-fragment isolation; PCR; and random labeling.

2. Materials 1. Adenine sulfate: Add 200 mg adenine sulfate to 100 mL of distilled water, autoclave, and store at room temperature. 2. AHC or YPD medium (see Chapter 29). 3. SCE: l.OM sorbitol, O.lM sodium citrate, 0.06M EDTA. Adjust to pH 7 with HCl, sterile filter, and store at room temperature. 4. SCEM (see Note 1): SCE with 0.05M P-mercaptoethanol. Make fresh as required by adding 25 uL of a 14.2M P-mercaptoethanol stock to 7 mL of SCE. 5. Lysis buffer (see Note 2): 0.W Tris-HCl, pH 9, 3% N-lauroylsarcosme, 0.2M EDTA, 0.5 mg/mL protemase K (add fresh). 6. Lyticase: Sigma (St. Louis, MO), resuspend at 10 U/pL in a solution containing 0.05Mpotassium phosphate pH 7.5 and 50% glycerol. Store at -20°C. Use at a final concentration of 20-50 U/mL of SCEM. 7. PCI: Buffered phenol/chloroform/isoamyl alcohol m volume ratios of 25:24: 1, respectively. From Methods m Molecular Bology, Vol 54. YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

65

66

Silverman

8. 5M Potassium acetate:29.4 g potassium acetate, 11.5 mL glacial acetic acid made up to 100 mL with water. Stenle filter and store at room temperature. 9. RNase-DNase free: 0.5 ug/pL, Boehrmger-Mannheim (Indianapolis, IN) 10. TE: 10 mMTris-HCl, pH 7.4, 1 mM EDTA, pH 8. 11. Zymolyase: 100,000 U/g, ICN Biochemicals (Costa Mesa, CA); use 10 mg/ 7 mL SCEM.

3. Method 1. Inoculate 5 mL of YPD or AHC with a single yeast colony. Incubate the culture overnight m a 30°C environmental shaker. 2. Transfer the overnight culture into a 2-L flask containing 500 mL of YPD or AHC (see Note 3). Incubate the culture in a 30°C envu-onmental shaker until its growth reaches late-log or stationary phase (-lo* cells/ml). This will require l-2 d for cultures in YPD and 2-3 d for AHC. 3. Pour the cultures into 500-mL polypropylene centrifuge bottles. Collect the yeast by centrifugatton (3000g for 15 min). Carefully aspirate and discard the supernatant. 4. Add 50 mL of distilled water to the bottle. Resuspend the yeast pellet by swirling. Transfer the yeast suspension to a 50 mL, polypropylene, conical centrifugation tube. 5. Collect the yeast by centrifugatton (3000g for 15 min). Aspirate and discard the supernatant. 6. Wash the pellet in 50 mL of 50 mMEDTA, pH 7.5. Collect the pellet by centrtmgation (3000g for 15 mm). Aspirate and discard the supernatant 7. Weigh the centrifuge tube to obtain an approximate wet weight of the yeast pellet. A 500-mL culture should yield a wet weight of -3-4 g. The yeast pellet can be stored at -20°C. 8. The subsequent steps are based on a yeast wet weight of 3-4 g. The volume of solutions can be scaled proportionately for different size pellets. 9. This spheroplastmg step is critical to obtaining complete lysts and a high yield of DNA. The author follows this process spectrophotometrically. Resuspend the cells in 7.0 mL SCEM. Transfer a 100-pL ahquot to a cuvet containing 900 pL of SCE or water. This sample services as a no-lysis control. Add 10 mg zymolyase or 35 pL of lyticase to the yeast/SCEM suspension. Incubate at 37°C with occasional shaking. Every 30 min, remove a 100-PL aliquot of the suspension and transfer to a cuvet contaming 900 pL of water. Mix the sample. Compare the ODb6aof this sample with the no-lysts control. (Remember to resuspend the yeast m the no-lysts control cuvet prior to reading the OD,,,.) When the ODhbOsample/OD660 no-lysis control = 0.1, the reaction IScomplete. This may take 30-l 20 mm, depending on the lot and amount of zymolyase or lyticase added to the original suspension (see Note 4).

Purification

of DNA

67

10. Add 14 mL of lysis buffer and mix thoroughly by inversion. At this point, the reaction mixture should be very viscous. Incubate the mixture at 50°C for 2-4 h, but preferably overnight (yields will increase). 11. Transfer the mixture to a 65°C water bath and incubate for 30 min. Some clearing of the sample should occur. 12. Add 5.7 mL of 5M potassium acetate and mix by inversion. 13. Place the sample on ice for at least 1 h. 14. Remove the precipitated proteins, salts, and SLS by centrimgation (3500g for 15 min). 15. Transfer the supernatant to a clean 50 mL, polypropylene, conical centrifuge tube. Discard the pellet. 16. Add 30 mL of ethanol (at room temperature) and mix thoroughly by mversion. Although the final concentration of ethanol is only -6O%, this is sufficient to precipitate the high concentration of nucleic acids present m the solution. Alternatively, a volume of isopropyl alcohol equal to that of the sample (-20 mL) can be added. 17. Collect the precipitate by centrifugation (5000g for 15 min). 18. After centrifugation, the DNA will appear as a pink or white disc on top of a pink, gelatinous pellet. Carefully pour the supernatant into a clean beaker. By rotating the tube between your fingers, allow the gelatinous pellet to slide out from beneath the DNA and to drain into the beaker (see Note 5). Using a cotton-tipped swab, remove residual gelatinous material from the tube. Do not touch the DNA pellet. 19. Pour the sticky DNA pellet into a clean 50-mL polypropylene centrifuge tube. Resuspend the pellet in 10 mL of TE by gently flicking the tube. 20. Add 50-100 pL (25-50 pg) DNase free RNaseA and incubate at 37°C for 1 h. 2 1. Extract the sample with an equal volume (10 mL) of buffered phenol, and separate the phasesby centrifugation (5000g for 15 min). Transfer the aqueous phase to a new tube. Repeat the procedure with an equal volume of PC1 (until the interface is clean) and, finally, with an equal volume of chloroform. 22. After the last extraction, transfer the aqueous phase to a clean 50-mL centrifuge tube. Add an equal volume of isopropyl alcohol (at room temperature) to the aqueous phase. Mix thoroughly by inversion. Spool-out the DNA fibers with a flame-bent Pasteur pipet (see Note 6). 23. Wash the DNA pellet by dipping it into a dish containing 50% isopropyl alcohol. Blot the excessalcohol by dabbing the DNA pellet onto parafilm. 24. Transfer the Pasteur pipet with the sticky DNA pellet mto a tube containmg l-2 mL of TE. Allow the DNA to dissolve and then discard the pipet. It may take over 24 h before the DNA goes into solution. 25. Quantitate the amount of DNA by diluting 5 pL mto 995 uL of water and measuring the ODzhO.Typical yields are l-4 mg DNA/4 g of yeast.

Silverman

68 4. Notes

1. DTT at a final concentration of 0.02M can be substituted for P-ME. For 7 mL of SCE, add fresh 80 PL of a 2M stock 2. Lysis buffer can be prepared m large volumes and stored at room temperature. Protemase K should be added to an aliquot of lysis buffer Just prior to mlxmg with the yeast spheroplasts. 3. Frequently, the author supplementsthe AHC broth with 10 mL of a 2 mg/mL adenine sulfate stock The high concentratton of adenme sulfate (40 mg/L of AHC) enhances growth and suppresses pigment formation. 4. Alternatively, the spheroplastmg reaction can be followed mlcroscoplcally. Remove 1 PL of the spheroplast solutton and mix with 9 pL of 1% SLS or HZ0 that was deposited on a glass slide. Add a coverslip and examme under 240--400x magmficatlon using either a phase contrast or a conventional light microscope. Yeast appear as oval, refractile cells, whereas the spheroplasts lyse and appear as empty cellular membranes or ghosts. When the majority of cells appear as ghosts, the reaction is complete. 5. Use a clean beaker for each sample. This will permit retrieval of the DNA if it inadvertently slides out of the centrifuge tube. 6. If DNA fibers do not form, centrifuge the sample at 6000g for 15 mm Pour off the supernatant and add 4.0 mL HZ0 to dissolve the DNA. Reprecipitate the DNA by adding 0.2 mL 3M sodium acetate and 8.0 mL isopropyl alcohol. Mix and spool-out fibers.

Acknowledgments This work was supported by grants from the National Institutes of Health (HD28475), the Hearst Fund, the March of Dimes, and the Elsa Pardee Foundation. The author thanks Kelly Ames for preparing the manuscript.

References 1 Olson, M V., Loughney, K , and Hall, B. D. (1979) Identification of the yeast DNA sequencesthat correspondto specltictyrosme-msertmgnonsensesuppressor loci J Mol Blol 132,387-410 2. Phlhppsen,P., Stotz,A , andScherf, C. (1991) DNA of Saccharomycescerevlslae Methods Enzymol 194, 169-l 82

3. Rose, M. D , Winston, F., and Hleter, P (1990) Methods zn Yeast Genetlcs A Laboratory CourseManual, Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY, p. 198.

CHAPTER7 Restriction Jiannis

Analysis

of YACs

Ragoussis

1. Introduction Restriction enzyme analysis of yeast artificial chromosome (YAC)cloned DNA allows direct comparison to genomic DNA, particularly in regions were pulsed-field gel electrophoresis (PFGE) maps are available, or to DNA cloned in other vectors (1,2). Furthermore, it allows the comparison of overlapping YACs and the detection of deletions or possible chime&m. The CpG methylation sensitive endonucleasesare widely used for long range mapping because most of these positions are methylated in the human genome. The rare cutting enzymes can be divided into those that recognize CpG islands (clusters of unmethylated CpGs) with high frequency (i.e., NotI, BssHII and EagI) and to those that do so with low frequency (i.e., MuI, NruI and PvuI) (3,4). A combination of the two classes is ideal for generating restriction maps that also give information about the position of CpG islands and thus potentially associated genes (5). Although the YAC-cloned DNA is unmethylated and these enzymes will cut more frequently than in uncloned DNA, the generated fragments are reasonably large, whereas the sites which are unmethylated in cloned and uncloned DNA, should be identical. The presented methods are modified versions of those described in the literature (6,7). Three steps are necessary: 1, The preparationof the YAC DNA in agaroseplugs; 2. The sizing of the YAC by PFGE; and 3. Performing the restriction enzyme digests. From Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

69

70

Ragoussis

Partial digests allow the ordering of restriction sites with respect to the ends of a YAC clone. The DNA is digested in various degrees and fragments containing the ends of the YAC detected by hybridization using specific probes.

2. Materials 1, SD + C broth and agar growth medium with appropriate supplements (see Chapter 29). 2. 2-Mercaptoethanol (Sigma, St. Louis, MO). 3. SE: 1M sorbitol, 20 mM EDTA. Sterilize by autoclaving. 4. SEM: Prepare fresh as required by making SE to 14 mM with 2-mercaptoethanol (add 1 pL 2-mercaptoethanol/mL SE). 5. Low-gelling temperature (LGT) agarose (Seaplaque GTG, FMC, Rockland, ME). 6. Standard agarose for PFGE. 7. SET: 1M sorbitol, 20 mM EDTA, 10 mMTris-HCl, pH 7.5. 8. Plug molds (Pharmacia [Uppsala, Sweden] or BioRad [Richmond, CA]). 9. Lyticase (Sigma) or Zymolyase 1OOT(ICN Biomedicals, High Wycombe, UK). Make a stock of 50 U/pL in SE by resuspending the lyophilized enzyme into the appropriate volume of sterile SE. 10. Yeast lysis solution (YLS): 1% (w/v) lithium dodecyl sulfate, 100 mM EDTA, 10 mMTris-HCl, pH 8. Filter sterilize and store at room temperature. Caution: YLS is toxic, take care. 11. TE: 10 mA4Tris-HCl, 0.1 mM EDTA, pH 8. 12. TBE electrophoresis buffer (1 OX): Dissolve 108 g Tris base and 58 g boric acid in water, add 40 mL 500 mM EDTA, and make up to 1000 mL. 13. To lE: 10 mMTris-HCl, 0.1 mMEDTA, pH 8. 14. 0.25M HCl. 15. 0.4MNaOH. 16. Contour-clamped homogeneous electric field (CHEF) apparatus (BioRad). 17. PFGE markers: h Concatemers (48.5-1000 kb) and yeast chromosomes (220 kb-2.5 Mb) are available from Pharmacia, BioRad, New England Biolabs (Beverly, MA) and other companies. Also recommended are the low range PFGE markers (15 to approx 400 kb) available from New England Biolabs. 18. Ethidmm bromide stock solution 10 mg/mL (Sigma). 19. Vacuum blotting apparatus (BioRad, Pharmacia, or other). 20. Filter membrane (Hybond-N+, Amersham, Arlington Hetghts, IL). 2 1. Restriction enzyme buffers: Follow manufacturer’s recommendations. Appropriate buffers are often supplied with enzymes. 22. Restriction enzymes NotI, MluI and BssHII are a minimal set (New England Biolabs and various other suppliers).

Restriction 23. 24. 25. 26. 27.

Analysis

of YACs

71

0.5M EDTA, pH 8. Human cot1 DNA (BRL). Water bath. Shaking incubator (New Brunswick Scientific, Hatfield, UK). Medium range centrifuge (Beckman [Fullerton, CA] J6-B).

3.1. Preparation

3. Methods of Yeast DNA in Agarose

Plugs

1. Streak out the clone on an SD + C agar plate with appropriate supplements, grow for 2-3 d at 30°C, and inoculate a single colony into 20 mL supplemented SD + C broth. (You will obtain approx l-2 plugs or l-2 pg of DNA/mL of saturated culture.) Grow for 24 h at 30°C with shaking. 2. Pellet cells at IOOOgfor 5 mm and wash once in 50 mA4EDTA. 3. Prepare LGT-agarose to a concentration of 2% (w/v) in SE, melt, and place in a 45OCwater bath and check that the gel has cooled down. Add 2-mercaptoethanol to 14 mM (add 1 PL 2-mercaptoethanol/mL) and shake gently. 4. Prepare 6 mL of SEM and make it to 100 p,g/mL zymolyase 1OOT(ICN Biomedicals) or 20 U/mL lyticase (Sigma). 5. Prepare the plug molds by briefly rinsing in ethanol, drying, and taping one side. 6. Resuspend the yeast cells in 400 pL SEM with zymolyase/lyttcase and add 400 pL of the molten agarose, mix well, and dispense mto the slots of the plug mold, takmg care that there are no bubbles. Allow to set on ice for 20 min. 7. Remove the tape and expel the plugs by placing a Pasteur pipet bulb over the bottom of the plug in the mold and squeezefirmly while holdmg over a 30- or 50-mL plastic tube containing 5 mL SEM with zymolyase or lyticase. Incubate at 37°C for 2 h. 8. Decant solution (see Note 1) and replace with 5 mL YLS. Incubate at 37°C for 30 min. 9. Pour off solution and add another 5 mL YLS. Incubate overnight at 37°C. 10. Store plugs in YLS at room temperature or rinse with TE and store m 500 mM EDTA at 4°C.

3.2. Separation

of YAC DNA by PFGE

1. Wash plugs thoroughly with TE, three times for 30 min at 50°C and three times for 30 min in To ,E at room temperature. 2. Prepare a 1% (w/v) agarose gel in 0.5X TBE. 3. Load plugs (see Note 2) and separate under the following PFGE conditions: 40-90 s pulse time, 6 V/cm, 12°C 24 h. For guidelines on conditions to provide better resolution of YACs in specific size ranges, see Note 3.

72

Ragoussis

4. Stam the gel for 30 mm with ethrdmm bromide at a final concentratton of 0.5 I@nI., in 0.5X TBE, and photograph with a ruler at the side for reference. 5. Prepare Southern blot by using condmons recommended by the membrane manufacturer. For Amersham Hybond N+ and related membranes suitable for alkaline blottmg, proceed as follows: a. Acid treat the gel with 0.25M HCl for 20 mm b, Prepare a standard capillary blot with 0.4M NaOH as buffer and transfer for 4-5 h or use a blottmg apparatus (1-2 h). c. Neutrahze the membrane by washing for 2 mm m 5X SSC. 6. The YACs can be detected as bands either by hybridtzation with a specific probe or with labeled human cot1 DNA (see Note 4). For probe labelmg and hybridization protocols, see Chapter 16.

3.3. Restriction Enzyme Digestion of DNA Prepared in Agarose Plugs 1 2. 3.

4. 1. 2. 3.

1. 2.

3.3.1. Single Digests Wash the LGT agaroseplugs three times with TE (up to five plugs for 50 mL of TE) for 1 h each at room temperature, and then leave overnight in TE Equilibrate each plug m 1 mL of restriction enzyme buffer for 1 h on ice Place mto a fresh tube containing 300 uL of restriction enzyme buffer plus enzyme for each plug and incubate for 6-l 6 h at the appropriate temperature. The recommended units of enzyme for the individual digests are as follows (see Note 5): 2 U BssHII, 20 U ClaI, 10 U EagI, 10 U MuI, 10 U NotI, 25 U PvuI, 20 U SalI, 25 U XhoI. Stop the reactions by adding 50 uL of 0.5M EDTA. 3.3.2. Double Digests Digest one plug as described for the single digest and cut in half. Store one half m TE at 4°C Use the other half for the second digest. If the same restriction enzyme buffer is suitable for both enzymes,stmply incubate the half plug in 250 uL fresh buffer-containing enzyme. If a different buffer is optimal for the second enzyme equihbrate the half block first m buffer without enzyme and proceed as described for the single dtgest (Section 3.3.1.). 3.3.3. Partial Digests Equihbrate each plug m 1 mL of restriction enzyme buffer for 1 h on ice. Place into a fresh tube containing 300 PL of restriction enzyme buffer plus enzyme for one plug. At least three different amounts of enzyme are recommended, plus one undigested and one complete digest control. For BssHII partial digests use 0.1,0.4, and 1 U partial digest reactions, and for A4ZuIuse 1, 5, and 10 U partial digest reactions (see Note 6).

Restriction

Analysis

of YACs

73

3. Equilibrate for 1 h on ice and then incubate for 15 min at 37°C for MuI, or 50°C for&HI1 digests. Stop the reactrons by adding 50 uL of 0.5MEDTA pH 8 and placing on ice. 4. Run PFGE gel and blot (see Note 7). 5. Prepare end probes by digestmg pBR322 DNA with PvuII and BarnHI. This results in a 2.67-kb fragment specific for the “left” end (containing the TRPZ gene and centromere) and a 1.69-kb fragment specific for the “right” end (contammg the U&43 gene) (see Note 8). 6 Hybridrze the blot with one labeled end probe and measure the lengths of the detected fragments. Starting from the result of the complete digestion, the position of the restriction sites can be determined by simply adding the extra length of the partial digestion products. By determmmg the fragment lengths from left and right ends, a complete map can be constructed. For probe labeling and hybridization protocols, see Chapter 16.

4. Notes 1. Special sieve-screw cups for 50-mL Falcon tubes are available from BioRad. 2. A convenient method for loading is to place the plugs onto the teeth of a horizontally positioned comb, remove any excesshquid, and let sit for 10min. Carefully place the comb into the gel frame and pour the agarose (65°C) around. After the gel solidifies, simply remove the comb. Alternatively, make a trough m the gel and carefully place the plugs in it. Fill the gaps with molten agarose. 3. If the YAC is longer than 900 kb, the following condmons can be applied in order to separateit: 60-120-s pulse time, 6 V/cm, 24-26 h. For more accurate sizing of YACs smaller than 450 kb: 10-40-s pulse time, 6 V/cm, 24 h. 4. The hybridization with human cot1 DNA is a necessary step for the identification of additional YACs in the same clone. 5. The enzyme units provided are based on experience with enzymes supplied by New England Biolabs. Slight adjustments may be necessary for enzymes from different suppliers. 6. BssHII is very active at 50°C. The activity of a particular enzyme will depend on the buffer system used. Test 0.2, 1, and 5 U in order to obtain an indication about activity. 7. Running conditions will depend on the sizeof the YAC and whether a particular sizerange needs resolving. For YACs up to 500 kb use 0.3-30-s pulse time, 6 V/cm, 20 h. For up to 1000 kb use 10-60-s pulse time, 6 V/cm, 24 h. 8. Alternatively, end specific probes can be derived by PCR using pYAC4 DNA (8). A 330-bp left arm specific probe is made by amplification with the following primer pair: YACLRl : 5’ GTGTGGTCGCCATGATCGCG 3’ and YACLP: 5’ ATGCGGTAGTTTATCACAGTTAA 3’. The 265-bp long

74

Ragoussis right arm probe is amplified with the following 5’ GATCATCGTCGCGCTCCAAGCGAAAGC 5’ CTCGCCACTTCGGGCTCA 3’.

primer pax: YACRP. 3’ and YACRR3:

PCR IS can-led out for 30 cycles using standard reaction buffers contammg 1.5 mA4 MgC12 and an annealing temperature of 55°C (primers and conditions are as suggested by the author).

References 1 Coffey, A , Roberts, R , Green, E , Cole, C , Butler, R., Anand, R., et al. (1992) Constructton of a 2.6Mb contig in yeast artificial chromosomes spanmng the human dystrophin gene using an STS-based approach. Genomlcs 12,474-484. 2. Ragoussts, J., Monaco, A., Mockridge, I., Kendall, E., Campbell, R. D., and Trowsdale, J (199 1) Clonmg of the HLA class II regton m yeast arttfictal chromosomes Proc Nat1 Acad Scr USA 88,3753-3757. 3 Bud, A (1989) Two classes of observed frequency for rare-cutter sttes m CpG islands. Nucleic Aczds Res 17, 9485 4 Lindsay, S and Bud, A. (1987) Use of restriction enzymes to detect potential gene sequences m mammahan DNA Nature 327,335-338 5. Bird, A. (1987) CpG islands as gene markers in the vertebrate genome. Trends Genet 3,342-347

6. Anand, R., Ogtlvie, D J., Butler, R., Rtley, J. H., Fmnear, R S , Powell, S. J , et al (199 1) A yeast artificial chromosome contrg encompassmg the cystic fibrosts locus Genomlcs 9, 124-130 7 Larin, Z , Monaco, A , and Lehrach, H. (199 I) Yeast arttficral chromosome hbraries containing large inserts from mouse and human DNA Proc Nat1 Acad Scl USA 88,4123-4127

8 Hurst, M. C., Rack, K., Nakahon, Y , Roche, A., Bell, M. V., Flynn, G , et al. ( 199 1) A YAC contig across the fragile X site defines the regton of fragihty Nuclezc Aczds Res 19,3283-3288.

CHAPTER8

RARE-Cleavage

Analysis

of YACs

Shawn P. Iadonato and Andreas Gnirke 1. Introduction The ordering of yeast artificial chromosome (YAC) clones by sequencetagged site (STS)-content mapping has proven an effective means of constructing large, contiguously cloned arrays of DNA, some of which span almost entire human chromosomes (I). This method requires that each YAC clone be tested for the presence or absence of each STS in a simple binary fashion and ultimately results in a content map where each clone is identified and positioned relative to others based on its complement of STSs (2,3). The application of this technique to the long-range physical mapping of the genomes of more complex organisms, although powerful, is complicated by the fact that precise distance and positional information cannot be derived directly from the STS content of each clone. The authors describe the method of RecA-Assisted Restriction Endonuclease (RARE) cleavage (4,5), which allows selective cleavage at individual restriction sites as specified by their surrounding sequences. The specificity relies on the ability of the RecA protein to form a triplex with an oligodeoxynucleotide and homologous duplex DNA sequences. The formation of this complex can be used to obscure a specific restriction endonuclease recognition site from the action of its corresponding methylase. Although all other sites become modified, this single site remains susceptible to cleavage with restriction enzyme, subsequent to removal of the RecA-oligodeoxynucleotide complex. The reaction steps are illustrated in Fig. 1. From Methods m Molecular Bology, Vol 54 YAC Protocols Edlted by D Markie Humana Press Inc , Totowa, NJ

75

76

Iadonato

and Gnirke

RecA protein oligonucleotide ATPyS

M --A--.,,5,,

M

I

EcoRi

I

SDS

Ic

E

methylase

M E

EcoRl

restriction

M <\\\..EL endonuclease

Fig. 1. Illustration of the reaction steps of RARE cleavage. A hypothetical DNA molecule containing 5 EcoRI sites (E), each surrounded by unique sequence, is incubated in the presence of RecA protein (shaded oval), an oligodeoxynucleotide specific for the sequence around one of the EcoRI sites, and ATPyS, a noncleavable analog of ATP. The oligodeoxynucleotideRecA complex binds to its homologous sequence within the DNA molecule, thereby protecting the internal EcoRI site from methylation (M) by the EcoRI methylase. The oligodeoxynucleotide does not necessarily have to cross the targeted restriction site to protect this site from methylation. Provided that all other EcoRI sites are methylated, only the targeted EcoRI site is susceptible to cleavage by EcoRI restriction enzyme after removal of the nucleo-protein complex.

RARE-Cleavage

Analysis

of YACs

77

This protocol is designed for use with the EcoRI restriction-modification system. Although this experiment can be performed successfully with other enzyme combinations, the authors’ experience has been that this presently is the most robust restriction enzyme/methylation system commercially available and applicable to this protocol (see Note 1). The authors have successfully used this method to localize STSs and cloneend sequences by virtue of an internal or nearby EcoRI restriction site (Fig. 2). Distances between these sites and clone-ends are determined by targeted cleavage within YACs, with the size of the resulting fragments measured by pulsed-field gel electrophoresis. This method involves the synthesis and purification of an oligodeoxynucleotide 35-55 bases in length, preparation of high-molecular-mass DNA in agarose beads or plugs from YAC-containing strains of yeast, binding of the RecA protein+ligodeoxynucleotide complex to an homologous site in this DNA preparation, methylation of all other sites with EcoRI methylase, and cleavage of the targeted site following . removal of the RecA-oligodeoxynucleotide complex. The authors describe in detail the application of this protocol to the localization of a given EcoRI site within a single YAC clone.

2. Materials 1. AHC (see Chapter 29): For optimal growth of YAC clones m lrqurd culture, the authors recommend an increase m the adenine hemrsulfate concentration to 80 mg/L. 2. Light paraffin oil: Supplied by EM Science (Cherry Hill, NJ; cat no. PXOO47-1). 3. InCert agarose:Supplied by FMC Bioproducts (Rockland, ME) (catno. 50 121). 4. 1M Sorbitol: Dissolve 182.2 g sorbrtol in 1 L H,O and filter-sterilrze. Store at room temperature. 5. Spheroplasting solutron: lMsorbltol,20 mMEDTA, 10 mMTris-HCl, pH 7.5. Add fresh on the day of use 1 uL 2-mercaptoethanol and 1 mg (70 U) yeast lytic enzyme (ICN [High Wycombe, UK] cat no. 152270) per milliliter of solutron to a total final concentration of 14 rnA4 and 70 U/mL, respectively. 6. NDS solution: 0.5M EDTA, 10 mA4Tris base, 1% sarkosyl, pH adjusted to 9.5 with NaOH. Filter sterilize and store at room temperature. 7. LDS: 1% lithium dodecyl sulfate, 100 mA4 EDTA, 10 mM Trrs-HCl, pH 8.0. Filter sterilize and store at room temperature. 8. TE8: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0.

Iadonato

Duso (da

-----++++

&CA M.&oRl I~~ ECORI

-

5

5

3.6

2.5 1.3

-+-++++++

w--e.++++ I

--+++++++

RlBCtiOO

10

I

2

3

415

6

7

8

IMill

-

5

I -+-++++++ --+++++++ 1

5

3.6

2.5

and Gnirke

1.3

I 2

3

415

I 6

7

R

Lb

Chromosome

678

-

581

-

xl yGART2,

V, VIII

4a5IX RARE-L 111

3aa291

-

VI

194

-

itARE-R

97-

IA

678

-

581

-

YAC-vector

probe

Right YAC-vector

probe

- yGART2

.

4&T-

c 3lc3291

-

RARE-L

-

RARE-R

-

Fig. 2. RARE-cleavage mapping of an EcoRI site within a YAC. DNA in agarose beads from a yeast strain containing the YAC yGART2 (6) was subjected to RARE cleavage at the EcoRI site defining the left YAC-vector insertjunction of an overlapping YAC, yGART1. The bead samples were split in half and run in duplicate lanes on a pulsed-field gel. The natural yeast chromosomes,

RARE-Cleavage

Analysis

of YACs

79

9. 10X RecA buffer: 250 mMTris-acetate pH 7.9,40 rnA4magnesmm acetate, 10 mMdithiothreitol,5 mMspermidine free base(Sigma [St.Louis, MO] catno. S-2626), 5 mg/mL acetylated bovine serum albumin (BSA; Gibco BRL [Gaithersburg,MD] catno. 15561-020).Filter sterihze,aliquot, andstoreat-20°C. 10. ATPyS: A stabihzed 100 Wstock solution of the lithmm salt (Boehrmger Mannheim [Mannheim, Germany] cat no. 1162-306). Ahquot and store at -20°C. 11. Oligodeoxynucleotide: Designed 35-55 bases m length with sequences homologous to the targeted site and its associated EcoRI restriction endonuclease recognition sequence. Each oligonucleotide is purified on reversed-phase OPEC columns and stored at -20°C (see Notes 2 and 3). 12. S-Adenosyl methtonine: Supplied with each methylase as a stabilized 32 mM stocksolution (New England Biolabs,Beverly, MA). Aliquot and storeat -2OOC. 13. RecA protein: Supplied as a l-5 mg/mL stock solution (US Biochemical [Cleveland, OH] cat no. 70028). Short-term storage at -2OOC is adequate. For longer periods, store at -70°C. Once thawed, the protein is stable and can be stored at 4°C for several months. Avoid repeated thawing and freezing cycles. RecA protein from Pharmacia (Uppsala, Sweden) has also been tested and found to function adequately in RARE-cleavage experiments. 14. EcoRI methylase: Supplied as a 40,000 U/mL solution (New England Biolabs cat no. 211). Store at -20°C. 15. 10X EcoRI restriction endonuclease buffer: 500 mM HEPES-NaOH, pH 7.0, 100mA4MgClZ, l.SMNaCl, 10mMDlT. Aliquot and storeat -20°C. BSA may be added at a final concentration of 0.5 mg/mL to the restriction digest. 16. EcoRI restriction endonuclease (various suppliers): Store at -20°C. 17. Gel-loading buffer: 0.25% Bromophenol blue, 0.25% xylene cyanol, and 15% ficoll. 18. OPEC cartridges: Supplied by Clontech (Palo Alto, CA; cat no. K1078- 1). yGART2, the RARE-cleavage products (RARE-L and RARE-R), and the h-concatemere size markers (M) were visualized by staining with ethidium bromide. The two RARE-cleavage fragments can easily be discriminated by hybridization with YAC-vector-arm specific probes. Reactions O-4 are controls for the extent of EcoRI methylation and digestion. Reactions 5-8 are complete RARE-cleavage reactions with various amounts of oligodeoxynucleotide (indicated as nanomoles of nucleotide). The ratio of nucleotide to RecA-protein monomer (approx 38 kDa) in this titration experiment ranges from 5-l .3. The degradation of yeast chromosomes at low oligodeoxynucleotide concentrations is probably owing to the nonspecific inhibition of methylation by the binding of excess RecA protein to yeast DNA.

80

Iadonato

and Gnirke

3. Methods 3.1. Preparation

Embedded

in Agarose

of Yeast DNA Beads (see Note 4)

1, Inoculate a 5-mL culture of AHC medium (containing 80 mg/L adenine hemrsulfate) with a single yeast colony from an AHC plate and shake for about 24 h at 30°C. Start a lOO-mL AHC culture from 1 mL of this overnight culture and shake overnight at 30°C. Determine the cell concentration using a hemocytometer. The cell count should be approx 1 x IO8 cells/ml for a saturated overmght culture. 2. Harvest the cells by spinning 5 min at 13OOg. Wash the cells twice m 50 mM EDTA, each time centrifugmg 5 mm at 13OOg. 3. Resuspend the cell pellet m 50 m/U EDTA to a final concentration of 2 x log cells/ml and warm the cell suspension for 5 mm in a 45°C water bath. Add an equal volume of 1% InCert agarose m 50 nnJ4 EDTA, prewarmed to 45°C. Mix well by pipeting up and down and transfer to a 200-mL Erlenmeyer flask, prewarmed to 45°C. Add 20 mL of paraffin oil, also prewarmed to 45°C. 4. Mix vtgorously by swulmg for 5-10 s to form an emulsron and pour quickly mto a 400-mL beaker containing 100 mL of ice cold 50 mMEDTA that is being vigorously stirred m an ice bath with a magnetic bar Contmue stirring at the highest setting on ice for another 5 mm. 5. Dispense the bead slurry mto three 50-mL conical tubes, shake well to disperse the beads, and spin for 10 min at 13OOgat room temperature. Remove most of the oil phase, shake the remammg solution to disperse the beads, and centrifuge again asjust mentioned. Decant the supernatant and wash the bead pellet once with 50 mL of 50 mA4 EDTA, centrifuging as just described. After removing the supernatant a second ttme, wipe all remaining oil from the inside of the tube with a Kimwipe tissue. 6. Resuspend the beads m 40 mL freshly prepared spheroplastmg solution and incubate for 2 h at 37°C with gentle agitation. 7. Pellet the beads by a 15-mm centrifugation at 2400g at room temperature. Remove the supernatant by aspiration, and resuspend the beads to a total of 45 mL in LDS solutton. Incubate for 30 min at 37°C and centrifuge for 15 min at 24OOg. Replace the supernatant with fresh LDS solutton and incubate overnight at 37°C with gentle agitation. 8. Pellet the beads as in step 7. Resuspend the bead pellet m a total of 45 mL of 0.2X NDS solution, wash for 30 mm at room temperature with agitation, and centrifuge as m step 7. Repeat step 8 two additional times.

RARE-Cleavage

Analysis

of YACs

9. Wash the beads five times for 30 min in 45 mL of TE8, each time pelleting them for 10 min at 13OOg.The beads are then stored at 4°C under TES. Bead preparations are usually stable for up to 3 mo, at which time the beads in some preparations may start to dismtegrate. 10. An ahquot for analysis on a pulsed-field gel is taken as follows. Pellet the beads by centrifugatlon at 13OOg,remove the supernatant by aspiration, and transfer 50 PL of the packed bead pellet to a 1.5-mL mlcrocentrlfuge tube using a cut-off plpet tip Add 5 FL of gel-loading buffer, mix well, and centrifuge briefly in a mlcrocentrifuge. Slowly draw the sample into a cut-off pipet tip taking care not to introduce any av bubbles and plpet into the well of a submarine agarose gel. The remaining beads are stored at 4°C under TE8.

3.2. RARE CZeavage of YAC DNA in Agarose Beads 1. Transfer to a 15-mL conical tube enough bead suspension to yield 150 pL of packed bead volume per RARE reaction and centrifuge for 10 min at 13OOg.Remove the supernatant by aspiration. Add Hz0 and 1 mL 10X RecA buffer to a final volume of 10 mL, mix well, and let sit at room temperature for 15 mm. Pellet the beads asJust described, resuspend them in 10 mL 1X RecA buffer, and let sit overnight at 4°C. Prior to setting up the RARE reactions, wash the beads an additional time with 10 mL 1X RecA buffer for 15 mm, spm, and remove the supernatant. 2. Set up each RARE reaction m a 1.5-mL mlcrocentrlfuge tube with a total preincubation volume of 189 pL. Each reaction should include 10 pL 1OX RecA buffer, 3000 pmol nucleotide of an oligodeoxynucleotlde (see Notes 2 and 3), 2 pL of 100 mA4 ATP@, 40 pg of RecA protein, and 100 pL of beads previously equilibrated m 1X RecA buffer. Add the components in the followmg order: H20, 10X RecA buffer, ATPyS, oligodeoxynucleotide, RecA protein, and beads. The 10X RecA buffer, ATPyS, and Hz0 can be made up ahead of time as a premix on the day of the experiment and stored on ice. Mix by vortexing, centrifuge briefly in a microcentrifuge, stir each reaction with a clean pipet tip to dislodge the bead pellet, and premcubate for 20 mm at 37°C. 3. Add 1 PL of 32 mM S-adenosyl methlonine to a final concentration of 16 p&Yand 10 pL of 40 U/pL EcoRI methylase. Vortex, centrifuge, and stir. Incubate for 90 min at 37’C. 4. Stop the reaction by adding 200 PL of 2% SDS. Mix well and incubate for 30 mm at 37°C.

82

Iadonato

and Gnirke

5. Add 1 mL of TE8 to each sample, mtx briefly by vortexmg, and let sit at room temperature for 5 mm. Pellet the beads by a brief spin in a microcentrifuge and remove most of the supematant by aspiration through a pipet tip. Take care not to disturb any of the bead pellet. Repeat this step four additional times. 6. Wash the beads twice m 500 pL of 1X EcoRI restriction buffer containing 500 yg/mL BSA, centrifuge and aspirate as described. 7. Add 10 U of EcoRI restriction endonuclease in 300 pL of 1X EcoRI restriction buffer containing 500 pg/mL BSA. Vortex, centrifuge, and stir as described. Incubate ovemrght at 37°C (see Note 5). 8. Collect the beads by a 1-min centrifugation m a microcentrifuge. Remove most of the supematant, spin again, and aspirate as much of the remaming supematant as possible. Add 10 pL gel-loadmg buffer, and load each sample onto a gel using a cut-off pipet tip as described.

3.3. Preparation of Yeast DNA Embedded in Agarose Plugs 1. Inoculate a 5-mL culture in AHC medium (containing 80 mg/L adenine hemisulfate) with a single colony from a YAC-containing strain of yeast. Grow overnight at 30°C until saturated. The following day, use 1 mL of this starter culture to inoculate an additional 100 mL of AHC medium. Grow overnight at 30°C until saturated. Determine the number of yeast cells/ml using a hemocytometer. The cell count should be roughly 1 x 1OS cells/ml for a saturated culture. 2. Harvest the cells by centrifugation at 1300g for 5 min. Wash the cell pellet twice with 50 mA4 EDTA, spinning 5 min at 1300g. 3. Resuspend the cells in 50 mM EDTA to a final concentratton of 2 x lo9 cells/ml and warm the cell suspension at 45°C for 5 min. Add an equal volume of 1% InCert agarosein 50 m&f EDTA, also prewarmed to 45’C. Mix the suspenston thoroughly by vortexmg and pipet 500~PL aliquots mto each plug mold to harden (see Note 6). A lOO-mL culture should yield approx 20 plugs. Plugs may be allowed to set at room temperature or placed at 4°C. 4. Extrude each plug from the plug mold into a six-well dish, up to three plugs per well. To each well add 6 mL of freshly prepared spheroplasting solutton. Incubate at 37°C for 2-4 h with gentle shaking. Longer incubation times are preferred. 5. Aspirate off the spheroplast solution from each well and add 6 mL of LDS solution. Incubate with gentle shaking at 37°C for 1 h. Remove and add fresh LDS solution. Incubate with gentle shaking at 37°C overnight. 6. Wash the plugs three times for 30 min with 6 mL of 0 2X NDS solutron with gentle shaking at room temperature.

RARE-Cleavage

Analysis

of YACs

83

7. Wash the plugs five times for 30 min with 6 mL of TE, pH 8.0 with gentle shaking at room temperature. Plugs may be stored at 4°C in stx-well dishes with TE, pH 8.0, covered with Saran wrap to prevent excessive evaporation, High-molecular-mass DNA will usually remain undegraded for longer than 6 mo.

3.4. RARE CZeavage of YAC DNA in Agarose Plugs 1. In a 15-mL conical tube, rmse two or three plugs with 10 mL of 1X RecA buffer. Each plug will be enough DNA for eight reactions. Wash the plugs a second time with 10 mL fresh 1X RecA buffer overnight at 4OC with very gentle shaking. The next morning, prior to setting up each RARE reaction, wash the plugs an additional time with 10 mL 1X RecA buffer for 1 h. 2. Cut each equilibrated plug into 50-pL sections by placing the plug horizontally on a clean piece of parafilm and using a razor blade sterilized with ethanol and flame. 3. Using 1.5-mL microcentrifuge tubes, set up each RARE reaction on ice with a total volume of 189 pL. Each reaction should include 15 PL 10X RecA buffer, 2 pL of 100 mJ4 ATPyS, 3000 pmol nucleotide of an oligodeoxynucleotide (see Notes 2 and 3), 40 pg of RecA protein, and 50 PL of plug volume. Add the reagents to each reaction m the following order: H20, 1OX RecA buffer, ATPyS, oligodeoxynucleotide, RecA protein, and the 50-pL plug. The 10X RecA buffer, ATPyS, and HZ0 can be made up ahead of time as a premix on the day of the experiment and stored on ice. Mix by tapping the tube lightly and premcubate each reaction for 2 h at 4°C. 4. Raise the temperature of each reaction to 37OC and incubate for an additional hour. 5. Add 1 p.L of 32 mA4 S-adenosyl methionine to a final concentration of 16 p,M and 10 pL of 40 U/pL EcoRI methylase. Incubate each reaction for an additional 2 h at 37°C. 6. At the end of this time, add 200 PL of 2% SDS and incubate at 37°C for 30 min to stop the reaction. 7. Remove each plug to one well of a six-well dish. Wash each plug twice for 1 h by gently shaking with 6 mL of TE, pH 8.0. Transfer each plug to one well of a 24-well dish. Wash each plug two additional times for 1 h each time with 2 mL of 1X EcoRI restriction endonuclease buffer containing 500 pg/mL BSA, again with gentle shaking. 8. Transfer each plug to a 1.5-mL microcentrtfuge tube and digest with 30 U of EcoRI restriction endonuclease in >300 l.tL 1X EcoRI restriction buffer containing 500 pg/mL BSA overnight at 37°C (see Note 5).

84

Iadonato

and Gnirke

9. If plugs are stored prior to electrophoresls, add EDTA to a final concentration of 50 mM. For electrophoresls of high-molecular-mass DNA, load each plug into a single well of a pulsed-field gel. 1.

2.

3.

4.

4. Notes Modlficatlon/restnctlon systemsother than M. EcoRIIEcoRI have been successfully used for RARE cleavage (e g., M HhaIIIHznff [.5], M. HhaIIHhaI [7/). However, some commercial methylase preparations are contammated with nuclease, resulting m the nonspecific degradation of yeast DNA. Ollgodeoxynucleotldes can be designed with the EcoRI site at the center, 3’-, or 5’-end of the molecule. In most cases,the best data will result from ohgodeoxynucleotldes with the EcoRI site near the center of the molecule. When, however, sequence 1savailable from only one side of the EcoRI site (e.g., when mapping a site at the vector-Insert Junction of a clone), design the oligodeoxynucleotide with the restriction site at the 3’-end of the molecule. This will ensure that even nonfull-length products of the ohgodeoxynucleotide synthesis contain the targeted restriction site. The authors recommend that ohgodeoxynucleotldes be synthesized on a solrd-phase-phosphoramldlte-chemistry based synthesizer with the 5’-tntyl group still attached. This allows subsequent purification of the full-length products by reversed-phase chromatography using either HPLC or OPEC cartridges. The authors routinely use OPEC columns for the purification of tntyl-on ohgodeoxynucleotides according to the manufacturer’s standard protocols with the following modlflcations: As longer ohgodeoxynucleotldes appear to elute less efficiently, the authors recommend that the final elution step be carried out with 40% acetonitrile rather than the manufacturer-recommended 20%; followmg elutlon from OPEC columns, the entire sample is generally lyophihzed with heat, resuspended in 300 pL of TE, pH 8.0, ethanol-precipitated, and resuspended in a final volume that results m 500 pmol of nucleotide/pL. The choice between performing RARE-cleavage m beads or in plugs 1s largely a matter of personal preference. Most researchers with previous YAC experience will be more familiar with working m plugs. Handling of beads requires observance of certain rules so as to better control their sometimes idiosyncratic behavior. The sedimentation of beads greatly depends on their size, whtch, m turn, depends on the way the oll/agarose emulsion 1sformed and cooled during bead preparation. It IS Important to form small agarose droplets by vigorous swn-lmg and to cool the “oll-and-vmegar”like emuslon as quickly as possible. Even with “perfect” beads, it 1shard to avoid losing about half of the initial agarose volume. Beads are usually trapped m the 011phase and tend to disappear during the numerous cen-

RARE-Cleavage

Analysis

of YACs

85

trifugation steps. Sticking to plasticware may also be problematic. The affinity of beads for plastic depends on factors such as the concentration of detergent or presence of proteins, and can dramatically change during the course of an experiment, For example, beads that pelleted well after stoppmg the methylase reactlon with SDS will start to stick to the side wall of the microcentrlfuge tube after about four washes with TE8 and not pellet properly until BSA-contaimng buffer 1sadded. 5. Before attempting a RARE-cleavage experiment It is advisable to perform a methylatlon assay, i.e., resistance of methylated DNA to EcoRI digestion. Degradation of yeast chromosomes in this assay can be due to either poor methylation with the EcoRI methylase or to cleavage at noncanonical EcoRI sites by the star activity of the EcoRI endonuclease. The latter can usually be avoided by use of a high-salt restrlctlon buffer at neutral pH, and a large reaction volume. 6. The authors believe the thickness of plugs affects the quality of the data that result from RARE-cleavage experiments. Very thin plugs are difficult to handle, although overly thick plugs have a lower surface-to-volume ratio that may adversely affect the experiment’s success.Plug molds used in our lab contain about 450 PL of volume and measure approx 2 x 26 x 8 mm.

Acknowledgments This chapteris basedon experiments that were carried out in the laboratory of Maynard Olson, whom the authors thank for many helpful discussions. References 1. Foote,S.,Vollrath, D., Hilton, A , and Page, D. C. (1992) The human Y chromosome. overlapping DNA clones spanningthe euchromaticregion. Science 258,6&66 2 Green, E. D. and Green, P. (1991) Sequence-tagged site (STS) content mapping of human chromosomes: theoretical considerations and early experiences. PCR Methods Appl 1,77-90

3. Green, E. D. and Olson, M V. (1990) Chromosomal region of the cystic fibrosis gene m yeast artificial chromosomes a model for human genome mapping. Scrence 250,94-98. 4. Ferrm, L. J. and Camermr-Otero, R. D. (199 1) Selective cleavage of human DNA: RecA-assisted restnctlon endonuclease (RARE) cleavage. Sczence 254, 1494-1497 5. Koob, M., Burklewicz, A , Kur, J., and Szybalskl, W. (1992) RecA-AC single-site cleavage of plasmlds and chromosomes at any predetermined restriction site. Nucleic Acids Res. 20,583 l-5836. 6. Gnirke, A., Barnes,T. S.,Patterson,D., Schild,D., Featherstone,T., andOlson, M. V (199 1) Cloning and in vlvo expresslon of the human GART gene using yeast artificial chromosomes EMBO J, 10, 1629-1634. 7. Gnirke, A , Iadonato, S. P , Kwok, P. Y., and Olson, M. V (1994) Physical calibration of yeastartificial chromosomecontig mapsby RecA-asasted restriction endonuclease (RARE) cleavage. Genomzcs 24, 199-2 10.

CHAPTER9

YAC Localization by Fluorescence In Situ Hybridization Gabriele

Senger

1. Introduction Fluorescence in situ hybridization (FISH) is a rapid procedure for mapping YACs on metaphase chromosomes and for identifying chimeric YACs that contain cocloned DNA fragmentsfrom different genomic regions. A variety of chromosome banding methods are currently used in combination with FISH, which allows hybridization signals and the banding pattern to be visualized simultaneously (1-3). A replication banding method is described herein, in which bromodeoxyuridine (BrdU) is incorporated into late-replicating DNA sequences before harvesting the cells. After FISH these late-replicating DNA regions are detectedwith an FITC-conjugated anti-BrdU antibody resulting in an excellent G-banding pattern. Both the chromosome banding pattern fluorescing in green and a red probe signal are visible at the sametime when using a dual band pass filter set (4,5). Yeast artificial chromosome (YAC) DNA isolated from low melting point agarose plugs by agarasetreatment, and phenol/chloroform extraction (see Chapter 7) is suitable for FISH without separation from the total yeast DNA. However, as the probe-specific DNA represents only a small portion of the total yeast DNA, it is essentialto use large amounts of labeled DNA for each FISH experiment. Alternatively, YAC DNA, which is PCRamplified with certain&-specific primers, canbe used asprobe DNA (67). One advantage of PCR-amplified YAC DNA is that it contains only negligible amounts of total yeastDNA and therefore a smaller amount is required. The main steps of the FISH protocol described in detail are listed in Fig. 1. From: Methods m Molecular Biology, Vol. 54 YAC Protocols E&ted by D Markle Humana Press Inc , Totowa, NJ

87

Senger PREPARATION OF CHROMOSOMES AFTER LABELLING OF LATE !EPLICATING DNA WITH BrdI J

I-

I DENATURATION OF YAC DNA AND PRE-HYBRIDISATION OF REPETITIVE SEQUENCES

I I

POST-HYBRIDISATION WASHES, PROBE DETECTION (with avidmTexas Red) AND CHROMOSOME BANDING (wuh FITC conjugated am-BrdU) I 1 MICROSCOPIC

ANALYSIS

1

Fig. 1 Flowchart illustrating the individual steps for mapping YACs on replication G-banded chromosomes by fluorescence in situ hybridizatton.

2. Materials 2.1. Preparation of Metaphase

Spreads

1. RPM1 1640 medium containing 10% (v/v) fetal calf serum, 2.4 mJ4 L-glutamme, 60 pg/mL pemcillm, and 100 ug/mL streptomycm. 2. Phytohaemagglutmin (Wellcome, Dartford, UK): Reconstitute one ampule (45 mg) m 5 mL double-distilled sterile water. 3. Heparinized whole blood (0.5 mL for each 10 mL culture). 4. Incubator with 5% CO2 atmosphere. 5. 0.05 mM5-fluorodeoxyundine (FdU, Sigma [St.Louis, MO], cat.no. F 0503). 6. 0.12 mg/mL Uridme (Sigma cat. no. U 3750). 7. 20 mg/mL BrdU (Sigma cat. no. B 5002) (see Note 1). 8. Hypotonic solution. 0.075M KCl. 9. Fixative: Mix methanol and glacial acetic acid m the ratio 3: 1. 10. Microscope slides thoroughly cleaned m ethanol and then washed m sterile double-distilled water,

YAC Localization

89

2.2, Labeling 1. 2. 3. 4. 5. 6. 7. 8. 1. 2. 3. 4. 5. 6. 7.

of YAC-DNA

with

Biotin

BioNick kit (BRL [Gaithersburg, MD] cat. no. 18247-015). 1 ug Highly purified YAC-DNA. 1X TE: 10 mA4 Tris-HCI, 1 mMNa2EDTA, pH 8. Sephadex G50 (Pharmacia [Uppsala, Sweden], cat. no. 17-0043-02) in TE buffer. 10mg/mL Salmon testesDNA somcatedto a fragment length of approx 500 bp. 10 mg/mL Escherichia coli tRNA (Boehringer [Mannhelm, Germany], cat. no. 109 541). 3M Sodium acetate, pH 5.6. Ethanol. 2.3. In Situ Hybridization Cot-l DNA (BRL, cat. no. 15279-011). Hybridization solution: 50% deiomzed formamide, 2X SSC (300 mM NaCl, 30 n&f sodium citrate), 10% (w/v) dextran sulfate, 1% Tween-20, pH 7.0. Store frozen m individual aliquots. 70% Formamide, 2X SSC pH 7.0. Deiomzation of this formamide is not necessary. The pH can be adjusted with 1M HCI. 70% Ethanol (ice cold) and 95 and 100% ethanol. 22 x 22 mm Coverslips. Rubber cement. Moist chamber: Made from a plastic sandwich box containing a layer of paper towel soaked m water.

2.4. Probe Detection 1. Buffers for posthybridization washes: Buffer 1: 50% formamide, 2X SSC (0.3M NaCl, 0.03M sodium citrate), pH 7.0 can be adjusted with 1M HCl without deionization of formamide. Buffer 2: 2X SSC pH 7.0. Both buffers are prewarmed to 42’C. 2. Washing buffer between detection steps(SSCT): 4X SSC, 0.05% Tween-20, pH 7.0. 3. Blocking buffer (SSCTM): SSCT with 5% (w/v) dried milk (Marvel, 99% fat-free [Premier beverages, Stafford, UK]). Nondissolved particles are removed by centrifugation for 5 min at 1500 t-pm. 4. All detection reagents (Texas red conjugated avidin, biotmylated antiavidin and FITC-conjugated anti-BrdU) are diluted in SSCTM m the ratios: 1:500 for Texas red-conjugated avidin (Vector Laboratories [Burlingame, CA], cat. no. A2016), 1: 100 for biotinylated anti-avidin (Vector Laboratories, cat. no. BA0300), and 1: 10 for FITC-conjugated anti-BrdU (Boehrmger, cat. no. 1202 693).

Senger

90

5. PBS: 130 mMNaC1,7 mMNa2HP0,, 3 mMNaH2P04. 6. Glass coverslips (22 x 50 mm). 7. Mounting medium: Citifluor AFl (Citifluor Ltd., London) with 0.2 pg/mL DAPI 2.5. Microscopic

Analysis

1. High quality fluorescence microscope (e.g., Zeiss Axioskop) equipped with filter sets specific for DAPI (Zeiss, 02), for FITC (Zeiss, 09), and Texas red (Zeiss, 15). Additionally, a dual band pass filter set (Chroma Technology, Omega or Zeiss) for simultaneous visualization of FITC and Texas red is advantageous for precise mappmg. If a dual band pass filter set is not available, the filter sets for FITC and Texas red must be aligned (“wedge free”). This eltmmates any shift that might result from the two superimposed images obtained by a double exposure photograph. 2. Microscope camera (e.g., Zeiss MClOO) for documentation of the results. 3. Fujicolor 400 ASA film for color prints or Scotch 3M 640 T film for color slides.

3.1. Preparation

3. Methods of Metaphase

Spreads

1. Mix, under sterile conditions in a 20-50-mL plastic tube, 0.5 mL peripheral human blood (contaming 50 U/mL sodium heparm) with 9.5 mL RPM1 1640 medium (supplemented with 10% fetal calf serum and 2.4 mM L-glutamine) and 0.1 mL phytohaemagglutmin (9 mg/mL). Incubate the cell culture (with loosely attached lid) for 72 h at 37°C m an incubator with 5% CO*. 2. Synchronize the cells withm the S-phase by adding 100 pL of 0.05 mA4 5-fluorodeoxyuridine (FdU; final cont. = 5 x 1OW7wand 100 pL 0.12 mg/mL uridine (final cont. = 1.2 pg/mL). Incubate overnight (16-20 h) at 37°C 5% coz. 3. Release the S-phase block by adding 15 pL of 20 mg/mL BrdU (endconc. = 30 pg/mL) and incubate for 5 h 30 min. 4. Pellet the cells at 1500 rpm for 5 min. Remove and discard the supernatant. 5. Resuspend the pellet in 10 mL 0.075M KC1 (prewarmed to 37OC). Incubate the cells in thts hypotonic solution for 10 min at room temperature. 6. Centrifuge at 1500 rpm for 5 min.

YAC Localization

91

7. Remove the supernatant and resuspend the cells in the remaimng drop of hypotonic solution. Take the cell suspension up into the pipet, till the tube with 10 mL ice cold fixative (methanol/glacial acetic acid [3: l]), and squirt the cells mto the fixative. 8. Keep on tee for 20-30 mm. 9. Wash the cells twice in fixative. 10. After the last centrifugation resuspend the cell pellet in 1 mL fixative and prepare metaphase spreads by dropping the suspension onto several clean, wet slides. Air-dry and pass the slides through a series of 70,95, and 100% ethanol in order to remove traces of fixative (see Note 2). 11. Air-dried slides can then be stored desiccated at -20°C for several months.

3.2. Labeling

ofYAC-DNA

with Biotin

(see Note 3)

1. Mix 1 pg probe DNA (total yeast DNA or PCR products) with water to a total volume of 40 pL. Add 5 pL 10X dNTP mixture and 5 pL enzyme mixture (included in the BRL BioNick kit) and incubate for 60 min at 15°C (see Note 4). 2. Add 5 pL stop-buffer (BioNick kit). 3. Prepare a Sephadex G-50 column in a 145~mm Pasteur pipet plugged with sterile glass wool and rinse with 2 mL TE buffer, pH 8.0. 4. Apply the DNA mixture (55 pL) onto the column and add 545 pL TE buffer. Discard the eluate. Add another 600 pL and collect the eluate, which contains the labeled DNA. 5. Mix the eluate with 5 pL of 10 mg/mL salmon testes DNA, 5 PL E. colz tRNA and 60 pL 3M sodium acetate pH 5.6. 6. Divide the solution in half and precipitate the DNA in each tube with 2 vol of ethanol. Freeze for 10 min on dry ice and centrifuge the precipitate m a microcentrifuge for 15 min at 10,000 rpm and 4°C. 7. Dry the pellet and resuspend the DNA in each tube m 10 pL TE buffer pH 8.0. The amount of labeled DNA is calculated without considering DNA loss that occurs during the purification steps (i.e., 500 ng m each tube).

3.3. In Situ Hybridization 1. Bake the slide at 65°C for 2-3 h. Slides should be at least 1 wk old. If fresher slides need to be used, prolong the time of baking. 2. Mix 500 ng btotinylated total yeast DNA (or 100 ng if Alu-PCR amplified DNA is used) with 4 pg of Cot-l and add 2 vol of ethanol (see Note 5). 3. Lyophilize the DNA. 4. Dissolve the DNA in 12 l.tL hybridization buffer (50% formamide, 2X SSC, 10% dextran sulfate, 1% Tween-20, pH 7.0) (see Note 6).

92

Senger

5 Denature the probe DNA at 75OCfor 3 min, chill on ice, and quickly spin the solution to the bottom of the tube. 6. Incubate at 37°C for 30 mm in order to prehybndize repetmve sequences within the probe. 7. Denature the chromosomal target DNA by incubating the slide for 3 mm in a coplm jar with 70% formamrde, 2X SSC pH 7.0 prewarmed to 73-75°C Pass the slide through a series of 70 (ice cold), 95, and 100% ethanol for 3 min each. Air dry the slide (see Note 7). 8. Place the prehybrtdized probe on the slide, cover wtth a 22 x 22-mm coverslip and seal with rubber cement. 9. Place the slide m a morst chamber and incubate overnight at 37°C. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

3.4. Probe Detection Remove the rubber solution and carefully hft off the coverslip. Wash the slide three times for 5 mm m 50% formamtde, 2X SSC pH 7.0 at 42°C and three times for 5 mm m 2X SSC pH 7.0 at 42°C followed by a short wash m SSCT at room temperature. Incubate the slide with 100 uL blocking buffer (SSCTM) covered with a 22 x 50-mm coverslip m a moist chamber at 37°C for 15 mtn. Wash briefly m SSCT. Apply 100 uL Texas red conjugated avidm (diluted 1:500 m SSCTM), cover with a 22 x 50-mm covershp, and incubate at 37°C in a moist chamber for 30 min. Wash three times for 3 min m SSCT at room temperature on a shaking platform. Incubate the slide with 100 pL blotinylated anti-avidin (diluted 1:lOO in SSCTM) at 37°C m a moist chamber for 30 mm. Wash three times for 3 mm in SSCT at room temperature with agitation. Repeat steps 5 and 6 in order to amplify the signal with a second layer of Texas red-conjugated avidin (see Note 8). Apply 50 PL of FITC-conjugated anti-BrdU (diluted 1:10 m SSCTM), cover with a 22 x 50-mm coverslip, and incubate for 30 min in a moist chamber at 37°C (see Note 9). Wash once for 5 min in SSCT and then twice for 5 min each m PBS. Pass the slides through a series of 70, 95, and 100% ethanol. Air dry and mount the slide with Citifluor that contains DAPI as counterstam.

3.5. Microscopic Analysis (see Note 10) 1. Screen several metaphases and locahze specific signals (see Note 11). 2. Take photographs on a color print film (Fujicolor 400 ASA) or on a color slide film (Scotch 3M 640 T) using the dual band pass filter set.

YAC Localization

93

Fig. 2.1 d/lapping of YAC DNA on metaphase chromosomes. (A) Simultaneous visualization of the probe signals (art-owed, detected with Texas red) and replication G-banding pattern (detected with FITC) allows the localization of this YAC on band 6~2 1.3. The biotinylated probe was detected with two layers of Texas red-conjugated avidin. (B) DAPI staining of the same metaphase shown in (A) facilitates chromosome identification. Digitized images of both pictures were captured with a cooled CCD camera and merged using software developed by T. Rand and D. C. Ward (Yale University, New Haven, CT). Exposure times between 50 and 100 s are usually sufficient (see Notes 12 and 13 and Fig. 2).

94

Senger 4. Notes

1. The BrdU stock-solution, BrdU-treated cell cultures, and resultant metaphase spreads need to be protected from light because BrdU is light sensitive. 2. To achieve good hybridization results and optimal chromosome banding, it is important to prepare cytoplasm-free metaphase spreads. Slide preparation in a humid atmosphere may help to improve the quality of the chromosome spreads (8). Washing with 3:1 methanol:acetic acid prior to complete evaporation of the fixative may also help to remove cytoplasm. 3. The availability of fluorochrome-conjugated nucleotides allows direct labeling of DNA-probes with fluorochromes (9). Thus the hybridized YAC DNA can be visualized immediately after the posthybridization washes without further detection reactions. This is especially advantageous for YACs that give bright signals but also high background. Most laboratories, however, still prefer indirect labeling with biotm, which allows signal amplification if necessary. 4. Highly purified DNA is essential for obtaining adequate labeling by nick translation. A major cause of failed FISH experiments is poor quality of DNA. Positive results with other DNA probes usually exclude any problem with the reagents used. 5. The amount of Cot- 1 DNA may be increased up to 1O-fold if high background is obtained with particular YACs. This is especially advisable for Alu-PCR generated DNA. 6. The use of htgh qualrty formamide in the hybridizatton solution 1sessential for obtaining good FISH results. It may be necessary to check different brands of formamide. 7. If several slides are denatured successively, the temperature must not drop below 70°C in order to ensure appropriate denaturation of the target DNA. Temperatures higher than 75°C can lead to poor chromosome morphology. 8. If bright signals are obtained with most YACs, it is possible to skip steps 7-9. It is still possible to amplify the signals after microscopic analysis of the slide. This can be done by removing the mounting medium with methanol. The air-dried slide is then briefly washed in SSCT followed by steps 3-4,7-8,5, and 1I-13, as described in the detection protocol (see Section 3.4.). However, more than one round of amplification is usually not advantageous because of increased background signals. 9. The anti-BrdU-FITC stock-solution deteriorates withm a few days when stored at 4°C resulting in a notably paler banding pattern. Therefore, it IS best to store this antibody frozen m individual ahquots.

YAC Localization

95

10. Although a digital imaging systemis not required for mapping YACs on chromosomes, the advantages of digitized images obtained with a cooled CCD camera may be considered when setting up the FISH method in a laboratory: a. Weak signals, which might not be visible on photographs can easily be detected with a CCD camera. b. Documented results are available immediately. c. Color photography can be circumvented by using a color printer. 11. Weak probe signals, or signals localized on a positive G-band, may be difficult to seewith the dual band pass filter set. Therefore it 1sadvisable to view a number of metaphases with separate filter sets for Texas red and FITC in order to ensure that no specific signals were overlooked. 12. Fading of Texas red occurs rapidly and it 1snecessary to limit the light exposure of metaphases to a minimum in order to obtain photographs with sufficiently bright signals and banding. 13. The replication banding pattern obtained with the BrdU anttbody technique does not show the positton of centromeres. Hence, a second picture of the same metaphase showing the DAPI counterstaining (exposure time 5-10 s) is beneficial for the identification of chromosomes (see Fig. 2).

References 1. Cherif, D., Julier, C., Delattre, O., Deffe, J., Lathrop, G. M., and Berger, R. (1990) Simultaneous localization of cosmids and chromosome R-banding by fluorescence microscopy: apphcation to regional mapping of human chromosome 11 Proc Natl. Acad. SCI. USA 87,6639-6643. 2. Fan, Y.-S., Davis, L. M., and Shows, T. B. (1990) Mapping small DNA sequences by fluorescence zn situ hybridization directly on banded metaphase chromosomes. Proc. Natl. Acad. SCI. USA 87,6223-6227 3. Baldini, A. and Ward, D. C. ( 199 1) In situ hybridization of human chromosomes with Alu-PCR products. a simultaneous karyotype for gene mapping studies Genomics 9,770-774. 4. Lawrence, J. B. (1990) A fluorescence in situ hybridization approach for gene mapping and the study of nuclear organization, m Genome Analysis, vol. 1. Genetrc and Physical Mapping (Davies, K. and Tilghman, S., eds.), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. l-38. 5. Senger, G., Ragoussis, J., Trowsdale, J., and Sheer, D. (1993) Fine mapping of the MHC class II region within 6~21 and evaluation of probe ordering usmg mterphase fluorescence m situ hybridization. Cytogenet. Cell Genet. 64,49-53. 6. Baldini, A., Ross, M., Nizetic, D., Vatcheva, R., Lindsay, E. A., Lehrach, H., and Siniscalco, M. (1992) Chromosomal assignment of human YAC clones by fluorescence zn situ hybridization: use of single-yeast-colony PCR and multiple labeling. Genomzcs 14,18 l-l 84.

Senger 7. Lengauer, C , Green, E D., and Cremer, T (1993) Fluorescence zn sztu hybridization of YAC clones after Alu-PCR amplificatron Genomzcs 13, 826428. 8. Lawce, H. J. and Brown, M. G. (1991) Harvestmg, slide-makmg, and chromosome elongation techniques, m The ACT Cytogenetlcs Laboratory Manual (Barth, M. J., ed ), Raven, New York, pp. 3 l-105 9. Wlegant, J , Wtesmerjer, C. C., Hoovers, J. M. N., Schuuring, E , d’Azzo, A , Vrolijk, J., et al. (1993) Multiple and sensrtrve fluorescence zn sztu hybrtdrzatlon with rhodamine-, fluorescem-, and coumarm-labeled DNAs. Cytogenet Cell Genet. 63,73-76.

CHAPTER10

Ah-PCR

Fingerprinting of YACs

AZison Cofiey, Simon Gregory, and Charlotte G. Cole 1. Introduction Random fingerprinting strategies have been applied to a number of genome projects using unorderedcollections ofphage or cosmid clones, e.g., Escherichia coli (l), Saccharomyces cerevisiae (2), and Caenorhabditis elegans (3), Overlaps were identified between either phage or cosmid clones using a fingerprinting method based on restriction endonuclease digestion. In each case the success of the method depended on the ability to generate and resolve sufficient numbers of bands in each fingerprint to detect as many as possible of the potential overlaps. Yeast artificial chromosomes (YACs) are not amenable to the same methods because of the presence of the yeast genome DNA in equimolar or higher amounts and because it is not possible to purify the artificial chromosome as it has no physical properties to distinguish it from the host DNA. The presence of large numbers of interspersed repetitive sequences in mammalian species can be exploited to selectively analyze the DNA derived from the insert of the YAC. This provides an opportunity to use equivalent methods to those described for phage or cosmid fingerprinting. The first such method applied to YACs in the human genome project was based on the separation of digests of yeast DNA on agarose gels followed by hybridization with probes recognizing the human repeat sequencesAlu or Ll (45). This method, however, is limited by the resolution of the gel system used. From. Methods m Molecular B/o/ogy, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

97

98

Coffey, Gregory, and Cole

This chapter describes a fingerprinting strategy utilizing the same high resolution gel system as in the C. elegans project (3). The method uses Alu-element-mediated polymerase chain reaction (PCR) (AluPCR) (6) to selectively amplify the human insert only from the YAC clone. Selection of suitable Ah primers is essential to generate the maximum numbers of fragments across any given region. The primers used here are ALE1 and ALE3 that recognize the most conserved regions of the human Ah element and direct amplification outward from the left and right ends of the Alu-repeat, respectively (7). As the Alu repeat itself can be orientated in either direction within the genome with respect to adjacent repeat units, use of both a left-hand and righthand primer in a combined reaction generates at least four times as many products as the use of either single primer in isolation. As a result of the uneven distribution of repeats in the genome, in common with all methods based on repeat sequences, some YACs will produce large numbers of bands, whereas some will produce none. Under the conditions described, in a pilot project of 1050 clones the primers chosen generated an average of 32 bands per YAC clone with only 9 YACs having no products (8). This number of fragments gives a fingerprint with at least the equivalent information content to that used in the C. elegans project. The fingerprinting method is based on Alu-PCR performed directly on yeast colonies (Fig. 1) (9). The method has been developed as a rapid, informative, and convenient technique that does not require a high level of automation. A primary PCR is performed using a colony suspension as the target material. Following a workup step to help with the quality of fingerprints produced, a dilution of the primary PCR is used as template in a secondary PCR in the presence of 5’-end labeled primers. These products are subject to a further workup and then electrophoresed on a high resolution denaturing polyacrylamide gel. 35S-labeled Sau3AI digested lambda DNA markers are run every seventh lane to allow for effective gel-to-gel comparisons. The gels are fixed, dried, and exposed to autoradiograph film. Overlaps between clones are shown by the correspondence of multiple bands in each clone that have not only the same size but also have a reproducible appearance. It is also possible to use the fingerprint data to detect chimeric clones in a contig of sufficient depth.

Alu-PCR

Fingerprinting Ah-PCR

based

fingernrinting

of YAC clones,

Colony suspension

Primary Alu-PCR 30 cycles wo;k-up check samples

2.5% agarise minlgel

I

/

Secondary Alu-PCR 5’ end-labelled primers 10 cycles

load on high-resolution denaturing polyacrylamide gel, electrophorese, dry down and autoradiograph Scan J ANALYSIS ACEDB

Fig. 1. Schematic of the Alu-PCR fingerprinting method. See Section 1. for explanation.

100

Coffey, Gregory,

and Cole

2. Materials 2.1. Primer Labeling 1. [y-32P]dATP (3000 Ci/mmol, 10 mCt/mL, Amersham [Arlington Heights, IL], PB10168). 2. 10X Kmase buffer: 500 mM Trts-HCl, pH 7.6, 100 mM MgCl,, 100 mM DTT (see Note I). 3 10X Primer dilution (ALE1 : 100 ng/pL, ALE3: 80 ng/pL). Primer sequences* a. ALE1 : GCCTCCCAAAGTGCTGGGATTACAG. b. ALE3: CCA(C/T)TGCACTCCAGCCTGGG (Note: The sequence previously published m ref. 9 is mcorrect.) 4. 10 U/pL T4 Polynucleotide kmase (Boehrmger Mannhelm [Mannhelm, Germany] cat. no. 633 542). 5. T, ,E: 10 mA4 Tris-HCl, 0.1 r&f EDTA, pH 8.0.

2.2. Primary

PCR

2.2.1. PCR Use separate,

clean, sterile

solutions

throughout

(see Note 2).

1. Sterile toothpicks. Optional 96-pm replicating tool and titer plates. 2. Microtiter plate sealers (Dynatech [Chantilly, VA], cat. no. 3. 10X PCR buffer: 670 mA4 Tris-HCl, pH 8.8, 166 mM (NHJ2S04, 67 mA4 MgCl, (see Note 3). 4. 1OX Nucleotide mix (5 mM each dNTP diluted in T, ,E). 5. 1OX Primer dilution (ALE1 : 100 ng/pL, ALE3: 80 ng/pL), for sequences. 6. 5 mg/mL BSA (Sigma [St. Louis, MO] A-4628) (see Note 7. 700 m/r4 P-mercaptoethanol (see Note 5). 8. Amplitaq (Cetus Inc., Foster City, CA) (see Note 6). 9. T, ,E (see Section 2.1.). 10. PCR grade mineral oil (e.g., Sigma 8042-47-5).

2.2.2. Analysis

of the Primary

96-well

micro-

00 1-O 1O-570 1). enzyme grade

see Section 2.1. 4).

PCR Products

1. 2.5% Agarose, 1X TBE (see Section 2.5. for 10X TBE) mimgels 0.4 pg/pL ethidium bromide in the gel and running buffer, 2. 6X Glycerol loading dyes (Bromophenol blue only): 30% glycerol, Bromophenol blue, 5 mM EDTA, pH 7.5. 3. 1-kb Ladder markers (BRL [Richmond, CA], cat no. 5279SA).

with 0.1%

Ah-PCR

1. 2. 3. 4. 1. 2. 3. 4. 5. 6. 7.

1.

2. 3. 4. 5. 6. 7. 8. 9. 10.

Fingerprinting

101

2.3. Secondary PCR PCR reagents as in Section 2.2.1.) items 3-10. Radtolabeled primers (see Section 3.1.). EDTA/SDS/F-dyes mix: 300 uL 10% SDS, 300 pL 0.5M EDTA, 25 mL 6X formamide dyes, 14.4 mL H20. Store at room temperature, wrapped in foil. See Note 7 for recommendations on the handling of radioactrve samples. 2.4. Preparation of Lambda Markers 40 U/FL Suu3Al (Amersham cat, no. E1082ZH). 10X M Buffer: 100 mMTrrs-HCl, pH 7.5, 100 mA4MgCl,, 500 mMNaC1, 10 tidithioerythritol (DTE) (Boehringer Mannheim, cat no. 1417983). Lambda DNA (500 ng/pL). 10 mMdGTP. 10 mM ddTTP. [a-35S](thro)dATP (600 Ci/mmol) Amersham SJ264. AMV reverse transcrtptase: Northumbrtan Btologtcals Ltd. (Cramlmgton Northumberland, UK, cat. no. 020604). Store at -70” C. 2.5. Polyacrylamide Gel Electrophoresis Apparatus: There are many different types of gel running apparatus avatlable. For the primer labeling gels the authors use a system from Cambridge Electrophoresrs Ltd. (Cambridge, UK, EV400). Samples are loaded using 1.5-cm wide wells. For the fingerprintmg gels the authors use a gel system from BRL (vertical sequencmg tank, model S2, cat. no. 580-l 105 SC). Samples are loaded using 5 x 3 mm wells (50 wells/gel). Acrylamide: Scotlab (Shelton, CT), Easigel cat. no. 5L-9223. 6X Formamrde dyes: 80% deiomzed formamrde, 50 mM Tris-borate, pH 8.3, 1 miI4 EDTA, 0.1% xylene cyanol, 0.1% Bromophenol blue. 10X TBE: 890 miI4 Tris base, 890 mIt4 borate, 20 nnI4 EDTA, pH 8.0. Urea. Silane mix: 3 mL ethanol, 50 pL 10% acettc acid, 5 p.L methacryloxypropyltrimethoxysilane. Silicomzing solution: Dimethyldichlorosilane. APS: 10% Ammonium persulfate. Make up 10 mL at a time; keep at 4°C for up to 1 mo. TEMED: iV,iV,N:N’-Tetramethylethylenedramine. Autoradiography film (e.g., DuPont [Wilmington, DE] Cronex 4, cat. no. 6603478) and cassetteswith and without intensifying screens.

102

Coffey, Gregory, and Cole 3. Methods 3.1. Primer Labeling

1. 2. 3. 4. 5. 6. 7. 8. 1. 2. 3. 4.

5.

3.1.1. Preparation of the Primer Labeling Thaw label (see Note 7). Make up 10X kmase buffer. Aliquot 4 pL ALE1 (100 ng/pL stock) and 4 l.tL ALE3 (80 ng/pL stock) mto separate OS-mL Eppendorf tubes (see Notes 8 and 9). Prepare premix: 24 pL To iE, 4 pL 10X kinase buffer, 4 pL [y-32P]ATP. Remove 1 pL and add to 19 pL To iE for the control sample. Keep in a perspex box. Add 2 pL polynucleotide kmase to the rest of the premix. Mix well and add 16 pL premix to each primer aliquot. Incubate at 37°C m a water bath for 30 mm with suitable shieldmg (see Note 10). Store frozen (-20°C) m a protective container and use as required. 3.1.2. Primer Labeling Testing Aliquot 19 pL T0 tE into each of two new 0.5-mL Eppendorf tubes. Remove 1 uL from each primer labeling reactton and add to the T, ,E (see Section 2.1.) item 5). In separate tubes mix 4 pL of each diluted labeled primer and the control sample from step 5 in Section 3.1.1. with 2 pL formamide dyes. Boil for 3 min and snap chill on ice/water. Load 2.5 pL on an 8% polyacrylamide, 7Murea 1X TBE gel (see Section 3 4.2.). Electrophorese until the Bromophenol blue (Dark blue/Fast blue) has run 20 cm from the wells. On our 40-cm gel system 45 min at 30 mA is sufficient. Autoradiograph for approx 2 h at -70°C with preflashed film (Fig. 2). See figure legend for analysts of results.

3.2. Primary

PCR

3.2.1. Preparation of the Primary PCR 1. Use a sterile toothpick to remove a colony from the surface of a nylon filter and resuspend the cells by stirring the toothpick in 100 pL T0 ,E in 0.5-mL Eppendorf tubes (see Notes 11, 12, and 13). Alternatively, for YACs that are stored m microtiter plates, stamp the plates onto filters placed on YPD using a sterile 96-pin transfer tool (“hedgehog”). Grow for 2 d. Use the “hedgehog” to stamp the colonies into a microtiter plate filled with 100 uL To iE/well. To prevent evapora-

Ah-PCR

Fingerprinting

103

Fig. 2. Primer labeling. Autoradiograph of a 2-h exposure of a primer labeling gel. The two primers are shown in lanes 2 and 3. A faint ladder is seen underneath the labeled full-length product. This represents smaller products as a result of incomplete synthesis. These do not appear to affect the fingerprinting. The control sample is seen in lane 1. Note the disappearance of the major band seen in lane 1 in the labeled primers. The bottom band in lane 3 is always stronger in ALE3 than ALEl. This does not affect the final fingerprint result (see also Notes 8 and 9). tion of the samples on storage, the authors seal the plates with microtiter plate sealers (for more details on the use of “hedgehogs,” see Chapter 2). Store at 4°C until required. 2. Prepare premix using the following quantities per sample (allow at least one spare tube per 20 samples plus 1 tube worth for a negative control): 2.5 PL 10X PCR buffer, 2.5 PL 10X dNTPs, 2.5 PL 10X each unlabeled primer, 0.825 yL 5 mg/mL BSA, 0.35 PL 700 mM /3-mercaptoethanol, 0.3 pL Taq polymerase, 8.525 uL T,,E. Vortex well to mix. Aliquot 20 PL of PCR premix per tube into a 0.5-mL Eppendorf tube.

104

Coffey, Gregory, M

1 2

3 4 5

6

and Cole

7 6 9 10 11 12 13 1415

1000 bp 500 bp

299 bp

200 bp Fig. 3. Primary PCR results. Five microliters of primary PCR products from 15 YAC clones chosen at random run on a 2.5% agarose minigel. The markers are I -kb ladder with approximate sizesas marked. 3. Use a pipet tip to gently resuspend the cells in the colony suspension and add 5 pL of the diluted colony to each of the sample tubes containing premix. Add the suspension into the premix and again mix using a pipet. Add 5 pL of T,,,E to the negative control tube. 4. Add one drop of mineral oil to each tube and cap firmly. 5. Perform PCR. PCR cycling conditions for the Perkin-Elmer Cetus (Norwalk, CT) thermocycler are as follows: 94W5 min followed by 30 cycles of 93Wl min, 65Wl min, 72W5 min, then 72W5 min (see Note 14). These conditions are also suitable for use on the Hybaid Omnigene PCR machine with both tube and microtiter plate PCR (see Note 26 in Chapter 4). 3.2.2. Analysis of the Primary PCR Products 1. Prepare 2.5% 1X TBE agarose minigels (see Note 15). Include 2 uL of 10 mg/mL ethidium bromide per 50 mL in both the gel and the buffer. 2. Remove a 5-pL aliquot of primary PCR (see Note 16) and mix with 1 uL glycerol loading dyes that contain Bromophenol blue only. Load and run the gels until the Bromophenol blue dye reaches the bottom of the gel (approx 7.5 cm). Load an aliquot of 1kb ladder as size markers on each gel (Fig. 3). 3. The remainder of the primary PCR product is stored at -2O’C until required.

Alu-PCR

105

Fingerprinting

3.3. Secondary

PCR

3.3.1. Workup of the Primary PCR Product 1. Add 28 pL To iE to the primary PCR products (see Note 17). Spin in a microfuge for 5 mm. Transfer the supernatant to a new 0.5-mL Eppendorf tube avoiding the pellet. The primary PCR product can be stored at this stage at -2OOC until required. 2. Aliquot 47.5 pL Ta iE into 0.5-mL Eppendorf tubes. Add 2.5 pL of sample from Section 3.3.1.) step 1 and mix well. This dilution is the template for the secondary PCR and can also be stored at -2OOC. (The authors have used dilutions that have been stored for at least 6 mo.) 3.3.2. Preparation of the Secondary PCR 1. Prepare premix using the following quantities per sample (allow at least one spare tube per 10 samples,): 1 uL 10X PCR buffer, 1 uL 10X dNTPs, 0.29 pL each labeled primer, 0.3 uL 5 mg/mL BSA, 0.13 pL 700 mM P-mercaptoethanol, 0.07 pL Tuq polymerase, 4.92 pL To ,E. (see Note 7 for radioactive sample handling recommendations). Mix well. 2. Ahquot 8 pL per sample into 0.5-mL Eppendorf tubes. 3. Add 2 pL of each diluted primary PCR product to premix. 4. Add 1 drop of mineral oil to each tube and cap firmly. 5. Perform PCR. PCR conditions for Perkin-Elmer Cetus thermocycler: 94W 5 min followed by 10 cycles of 93”CYl min, 65OC/l mm, 72”C/5 mm, then 72”C/5min. 6. After the PCR, carefully add 40 pL EDTA/SDS/F-dyes, tap to mix, and spin m a microfuge for 5 min (spin all radioactive samples in a fume hood). 7. Transfer 6 pL (avoiding the pellet and paraffin) to a 1.5~mL Eppendorftube. 8. Boil for 3 min with tubes uncapped in a fume hood and load 2-pL sample on a 4% polyacrylamide 7M urea gel (see Section 3.4. and Note 7). Load Sau3AI-digested [35S]-labeled lambda DNA markers every seventh lane (see Section 3.4.1.). Electrophorese at 30 mA until the xylene cyan01 dye is approx 13 cm from the bottom of the gel plate (the authors use a 40-cm gel plate). It is very important that gels that are to be compared with each other are run to exactly the same distance.

3.4. Polyacrylamide

Gel Electrophoresis

3.4.1. Preparation of Ls5S]-Labeled Sau3Al Digested Lambda DNA Markers 1. MIX together 342 uL To ,E, 50 pL 10X M buffer, 33 pL lambda DNA, 10 pL Suu3Al (40 U/pL). Incubate at 37°C for 1 h (for convenience the authors make a 10X digest mix and use an aliquot to label as in step 2).

106

Coffey, Gregory,

and Cole

2. Take 43.5 uL of the digest from step 1 and add 2 I.~L 10 mA4dGTP, 2.5 pL 10 mM ddTTP, 4 uL [a-35S]dATP, 1 uL AMV RT (10 U). Incubate at 37°C for 30 min. 3. Add 53 pL formamide dye and store at -2OOC. Load l-2.0 pL per marker lane of a successful labeling (see Note 18). Thts should be visible after 36 h exposure at room temperature with no flash or intensifying screens (see Note 19) 3.4.2. Preparation of the Polyacrylamide Gels There are many different apparatus available. The general principles apply to all gel systems (e.g., cleanliness of plates, siliconizing of plates, etc.). The details of the following description of how to pour a gel are directly applicable to the system from Cambridge Electrophoresis. Check manufacturer’s instructions for the apparatus of choice. 1. Clean the glass plates very thoroughly with detergent and water. Use a soft tissue to wtpe them with ethanol and check that they are completely free of dirt or grease. 2. Front plate (either the notched or smaller plate depending on the system used): Make the silane mix (20). Fold a tissue into a small square and pour the silane mix onto this. Wipe over the plate. Do this m a fume hood and dtspose of the tissue carefully. Allow the plates to dry for a few seconds, then clean with ethanol. Back plate (either the flat or larger plate): Wipe over with ethanol. Pour siliconizing solution liberally onto the plate and spread over with a tissue. Leave to dry in a fume hood for a few minutes. Wipe over with ethanol again to clean. 3. Clean the gel spacers and comb wtth water and then ethanol. Positton the spacers on the edge of the back plate. Put the front plate on top without dislodging the spacers. Use yellow Scotch tape to tape the sides and bottom of the gel plates together. Fold carefully at the corners to ensure no leaks. 4. Prepare the gel mix: 10 mL 1OX TBE, 10 mL acrylamide, 42 g urea. Make up to 100 mL with double distilled water. Stir on a hot plate on a low heat to help the urea dissolve. 5. Add 800 uL 10% APS and 80 uL TEMED, swtrl to mix, then take up the gel mtx in a 50-mL syringe (without a needle). Hold the plates tilted at 45” angle away from you. Start to add the gel mix m between the plates adjacent to one of the spacers. Take care not to get any atr bubbles. If any air bubbles do appear then immediately tap on the glass

Ah-PCR

Fingerprinting

107

to dislodge them and allow them to rise to the surface of the liquid. As the plates become full, lower them down and rest the top end on, for example, a lo-mL pipet. Put the comb carefully in between the gel plates and clip a l-m. bulldog clip either side of the combs to squeeze the plates together and help with good well formation. Posttton two additional clips m place about halfway down the gel plates. Allow to set for at least 30 min and preferably about 1 h. Any remaining acrylamide in the syringe should be squirted into a beaker and used as an indication of when the gel has set. 6. Once set, remove the tape from the bottom of the gel and clamp it in place on the apparatus with the backplate facing outward. If suggested by the manufacturers of the system being used, clamp a metal plate to the gel to allow even dtstribution of the heat generated during the gel run. 7. Fill the upper and lower chambers with 1X TBE running buffer. Carefully remove the comb. Flush out any nonpolymerized acrylamide and urea from the wells as soon as the comb is removed and prior to loading using a needle and syringe. Do this two or three times carefully during loading to help ensure tight bands.

3.5. Gel Processing 3.5.1. Primer Labeling Gels 1. Separate the gel plates. Cover the gel with Saran wrap taking care to avoid any wrinkles. 2. Autoradiograph with flashed film and mtensifymg screen at -7OOC for 2 h (Fig. 2). 3.5.2. Fingerprint Gels 1. Separate the gel plates. Immerse the gel in 1 L 10% acetic acid for 15 min (do this in the fume hood if possible). 2. Pour off the acetic acid solution. Immerse the gel in 1 L of water for 25 mm, change at least once. Alternatively, rinse under continuous flow of water taking care not to allow the water to flow directly onto the gel. 3. Dry in a dry oven at 80°C for approx 30 min or by placing directly on a gel dryer at 80 “C (gel side up with no cover) for approx 30 min. Do not rewet the gel as it will rehydrate and stick to the film. Leave to cool. 4. Autoradiograph at -7OOC using flashed film and an intensifying screen overnight. 5. Defrost the cassette fully. Develop the film and re-expose the gel at room temperature, without flashing the film and without an intensifying screen for approx 3-7 d (Fig. 4) (see Notes 19 and 20).

108

Coffey, Gregory,

and Cole

Alu-PCR Fingerprinting

109

3.6. Analysis of Results If the pattern produced by the Ah PCR is not very complex and within the resolution of the minigel then in some cases it may be possible to detect overlaps between clones on the agarose minigel (9) after the primary PCR. The overlapping relationship between YAC clones can otherwise be detected by visual inspection of the autoradiograph following analysis of the secondary PCR products. Overlaps are shown by the correspondence of multiple bands in each clone that not only have the same size but also a reproducible, distinctive appearance thus adding to the information content of the fingerprint. Figure 5 shows a fingerprint gel of selected clones from a contig in Xq26 (II). The clones are numbered l-l 9 along the top of the autoradiograph and correspondto the clones l-l 9 in the contig drawn below. It is possible to detect overlaps between adjacent clones in all but two regions of the contig (between Y6 and Y8; between YlO and Y 12, 13, or 14). These overlaps may either be very short or in Alu-poor regions. The probability of two clones overlapping is related to the number and proportion of bands in common. It is an advantage of the Alu-PCR based fingerprinting system that it is possible within a set of overlapping clones to assign the fingerprint bands to particular intervals across the contig. Individual bands can then be excised from a preparative polyacrylamide gel, reamplified, and purified. These can be radiolabeled and used as hybridization probes to confirm contigs and generate new landmarks within contigs (9). It is quite easy to analyze YACs on one or two gels for overlaps but large numbers of clones on different gels need a precise and controlled system for data analysis. For larger scale projects, the autoradiographs are digitized using an Amersham scanner controlled by the Amersham Filmreader. The scannedautoradiograph can then be displayed graphically using the newly developed IMAGE program (Wobus et al., unpublished) which is also used to digitize each fingerprint. The initial program process Fig. 4. (‘revzouspuge) SecondaryPCR results.Autoradiographshowing the Alu-PCR fingerprint of 24 randomly chosenYAC clones. The first 15 are the sameclonesshown on the minigel in Fig. 3. The Sau3AI-digested,[35S]-labeled lambda DNA markers areshown every seventhlanemarked M. Someapproxlmate sizes are shown on the left hand side of the autoradiograph.

Coffey, Gregory, and Cole

110

1

, :::::::::::::::::::::::::.:..::::::/::::,::::::..:.:::::::~ j:::::,:

Ah-PCR

111

Fingerprinting

enables us to locate manually the position of each band in our known standard (the marker lanes), and hence derive a precise location for each of the bands in the sample clones. The second processgives us the option to maximize the accuracy of the newly generatedidealized data by allowing us to edit the band numbers and locations of each clone. The data file generated for each gel or clone set is then enteredinto a database.An analysis program identifies potential matches between clones that possess bands occurring in the same location on the gel. All the aforementioned analysis programs are publicly available. Further information is available from Xmosaic. 4. Notes 1. DTT: Make a 1M stock and store m small aliquots. Thaw and use each aliquot once only. 2. It is easy to get human DNA contammatton in the primary PCR that is seen in the negative control as a smear on the minigel. In order to minimize the chance of contamination it is recommended that all solutions used in the primary PCR set up are kept for primary PCR set up only and kept physically separated from any primary PCR products and solutions used m the secondary PCR. It is also recommended to keep a separate set of pipets, which are cleaned at regular intervals, for use m setting up the primary PCR. Should contammation occur, throw away all solutions used, clean areas used for PCR set up, clean the pipets used, and try a test PCR using fresh ahquots of solutions. 3. The authors have found the PCR buffer and conditions given consistently produce more Alu-PCR bands per YAC than other buffers. The average number of bands produced per YAC clone is 32. This buffer is also found to be the most reliable when used with colony PCR in general. 4. Make a 1: 10 dilution of the stock BSA (Sigma A-4628) and store at 4°C. BSA will precipitate if kept frozen and continually freeze-thawed. Addition to the premix when setting reactions up fresh each time makes a dif-

ference. The authors have found this BSA to give significantly better results than others tested. 5. A fresh dilution from a stock of 14.4M P-mercaptoethanol is made each

time as the reactionsarebemg set up. The stock is storedat 4°C in a fridge designatedfor toxic chemicals. Fig. 5. (previous page) Alu-PCR fingerprint of a YAC contig in Xq26. Fingerprint of 18 YACs from a contig m Xq26 (contig drawn below). The arrowed bands in clone 8 are probably contributed by a chimeric portion of that clone (see Note 18).

112

Coffey, Gregory,

and Cole

6. The cloned Taq polymerase sold by Cetus (Amphtaq) has been found to amplify more reliably than other Taq polymerases tested parttcularly when used m complex reactions mvolvmg large numbers of different stzeproducts. 7. Because this procedure involves the use of radtoactive material, use suttable shielding throughout and obey local radioacttve safety gutdelmes. For handling large numbers of tubes contammg radioactive samples, the authors strongly recommend the use of a perspex box wtth perspex Eppendorf racks available from Scotlab or Amersham International. Pipet guards are also available from Scotlab and Amersham Internattonal to fit most prpeting devices. These greatly reduce the exposure to fingers when handling large numbers of tubes. The use of plugged tips when handling radtoacttve samples will reduce the rusk of contammating any ptpeting devtce. The authors would also recommend working within a perspex workstatton such as the betaCAB available from Scotlab. All centrimgation of radtoacttve samples should be done m a fume hood. 8. Primers ALE1 and ALE3 are labeled separately using a single premix. These primers will not label well tf mixed prtor to labeling. Do not use label more than l-2 d after the activity date for the labelmg reaction, because this has also been found to affect the efficiency of the labeling. 9 ALE3 always appears to label slightly lessefficiently than ALE 1 asJudged by less mcorporation of nucleottde on the primer labeling gel. A small difference does not appear to affect the fingerprmt. However, do not use a primer that was labeled 50% or less compared with the second primer It 1s advisable to check that each primer has been labeled adequately before continuing with the protocol because unsatisfactory labelmg will result in smeared or famt fingerprints. 10. Incubating the kmase reaction in a dry 37°C oven (even for 1 h as 1ssometimes recommended) does not result in as efficient labeling as incubatmg in a water bath. 11. Growth of YACs on filters removes the chance of touching the agar when toothptcking (constituents of the agar are known to inhibit PCR) and has the advantage that YACs grow wtth a “less red” appearance. The red pigment (a polymerized intermediate m the ademne biosynthesis pathway) ts also thought to inhibit PCR. Altemattvely add extra ademne to the growth medium to suppress the first step m the ademne biosynthesis pathway and prevent accumulation of this intermedtate--see discusston m Chapter 29. 12 Colony dilutions have been stored for at least 1 yr (some even longer) and successfully reused in a PCR. 13 Alu-PCR performed on YAC or cosmtd colomes has been found to be more reproductble and to generate longer products than when performed on enher yeast solutton DNA preps or agarose plug preps.

Ah-PCR

Fingerprinting

113

14. For some regions it may be worth trying a 7-min extension time as this may produce some longer products in regions that otherwtse appear to produce few products. The authors have also found that where few products are amplified the inclusion of Taq Extender (Stratagene [La Jolla, CA] cat. no. 600148) produces longer products and increases the yield of large weaker products. 15. The authors use the 7.5-cm mmigel apparatus from Flowgen (Stttingbourne, Kent, UK) with 16 well (3 x 1 x 6 mm) combs. 16. Keep a separate set of Gtlson (Paris) pipetors for handling the PCR products. 17. Prior to the secondary PCR tt 1s necessary to dilute the primary PCR products and remove some of the material accumulated during the primary PCR to prevent smeared fingerprints. A two stage workup 1s performed. 18. The [35S]-labeled Sau3Al -digested lambda DNA markers can be stored at -20°C for up to 2 wk It may be necessary to load more marker for an equivalent exposure as the marker gets older. 19. The [32P]-labeled fingerprmts will be much darker on the overnight exposure at -70°C with flashed film and intensifymg screens than the [35S]labeled lambda markers, This discrepancy will be less with the room temperature exposure. 20. The overall signal intensity of a [32P]-labeled fingerprint overnight at -70°C with flashed film and mtensifymg screens will be the same as a 3-d exposure at room temperature with unflashed film and no intensifying screens, although the bands will be much sharper on the room temperature exposure. 2 1. The fingerprint of clone 8 in Fig. 5 illustrates the use of the flngerprmt data to atd m the detection of chimertc clones m a contig of sufficient depth. Clone 8 is contained entirely within clones 7 and 9. However, there are at least five novel bands marked with arrows in clone 8. It is most likely that these arose from a chtmertc portion of clone 8.

References 1. Kohara, Y., Akiyaina, K., and Isono, K. (1987) The physical map of the whole E coli chromosome: application of a new strategy for rapid analysts and sortmg of a large genomic library. Cell 50,495-508. 2. Olson , M V , Dutchik, J E , Graham, M Y , Brodeur, G. M , Helms, C., Frank, M , et al (1986) Random-clone strategy for genomic restriction mapping in yeast Proc Nat1 Acad SCI USA 83,78264’830

3. Coulson, A , Sulston, J , Brenner, S., and Karn, J. (1986) Towards a physical map of the genome of the nematode Caenorhabdltu elegans Proc Nat1 Acad Scl USA 83,7821-7825

114

Coffey, Gregory,

and Cole

4 Wada, M., Little, R. D , Abtdt, F , Porta, G , Labella, T , Cooper, T , et al (1990) Human Xq24-Xq28. Approaches to mapping with yeast arttficial chromosomes. Am J Hum Genet 46,95-106 5. Zucchi, I. and Schlessinger, D. (1992) Distrtbutton of moderately repetitive sequences pTR5 and LFl in Xq24-q28 human DNA and their use m assemblmg YAC conttgs. Genomlcs 12,264-275 6. Nelson, D. L , Ledbetter, S A., Corbo, L , Victoria, M F., Ramirez-Solis, R., Webster, T. D , et al (1989) Alu polymerase cham reaction. a method for rapid tsolatton of human-specific sequences from complex DNA sources Proc Nat1 Acad Scl USA 86,668&6690. 7 Cole, C G , Goodfellow, P N , Bobrow, M., and Bentley, D R (1991) Generatton of novel sequence tagged sites (STSs) from discrete chromosomal regions usmg Alu-PCR. Genomzcs 10,816-826. 8 Coffey et al (1995) manuscript in preparation. 9. Coffey, A. J., Roberts, R. G., Green, E. D., Cole, C G., Butler, R., Anand, R., et al. (1992) Constructton of a 2 6 Mb conttg m yeast arttfictal chromosomes spannmg the human dystrophm gene using an STS-based approach. Genomlcs 12,474-484 10. Garoff, H. and Ansorge, W. (198 1) Improvements of DNA sequencing gels Anal Bzochem 115,45&457 11 Cole, C. G., Dunham, I., Coffey, A. J., Ross, M. T., Meier-Ewert, S., Bobrow, M , and Bentley, D. R. (1992) A random STS strategy for constructton of YAC conttgs spannmg defined chromosomal regions. Genomlcs 14,256-262

CHAPTER11 Detection Sandro

of Chimerism Banfi

and

in YAC Clones Huda

I? Zoghbi

1. Introduction Chimerism, the presenceof noncontiguous DNA fragments in the same clone, is one of the most common problems encountered when working with yeast artificial chromosomes (YACs). Its frequency can vary among the different libraries, but on average, 40-60% of YAC clones among the most used libraries are chimeric (I). To determine if a given YAC clone is chimer+, the most obvious approach is to isolate both ends of the insert and map them to assessif they have the same chromosomal origin, However, this approach could be time consuming, especially when an investigator deals with many YACs isolated from the same genomic locus and wants to identify very quickly the clones to be characterized. An alternative approach involves the fluorescent in situ hybridization (FISH) of Alu polymerase chain reaction (Alu-PCR) products, from YAC DNA to human metaphase chromosomes. This method, although very powerful, has the disadvantages of requiring expertise in preparing metaphase chromosomal spreads, and the need for specialized equipment. In this chapter, the authors describe an alternative and rapid method to identify chimeric human YAC clones. It is based on the hybridization of the Alu-PCR product from YACs to a dot blot containing the Alu-PCR products from monochromosomal or highly reduced hybrids representing each of the 24 different human chromosomes. This method allows one to identify chimeric human YAC clones without any previous characterization and identifies the chromosomal origin of the noncontiguous segments (Fig. 1). This procedure can also be used to detect chimerism From Methods m Molecular Ecology, Vol 54 YAC Protocols E&ted by D Markle Humana Press Inc , Totowa, NJ

115

A

B

Fig. 1. Example of an AIu-dot-blot charactenzatron of two YAC clones (A) The hybridrzatron of a nonchimerrc clone with a positive signal to the chromosome 6 hybrid. (B) The &u-dot-blot hybndtzation of a chimerrc YAC clone wrth a positive signal to the chromosome 1and to the chromosome 6 hybrids. M = mouse, H = hamster (from ref 6 with permission from Oxford University Press).

Detection of Chimerism

in YAC Clones

117

in YACs from other species utilizing the appropriate reagents (repetitive sequences and monochromosomal somatic cell hybrids specific to the species examined). 2. Materials 2.1. Ah-PCR A monochromosomal hybrid panel of the 24 human chromosomes has been developed and characterized (2). Hybrid DNAs can be obtained from the NIH Human Genetic Mutant Cell Repository catalog. 1. Monochromosomalhybrid DNA: 1 pg. 2. YAC DNA: 20 ng (for preparationof YAC DNA, see Chapters 6 and 7). 3. 10X PCR buffer: 100 IIS Tris-HCl, pH 8.3, 500 mM KCl, 12.5 mM MgC12, 0.01 % (w/v) gelatin,

4. 1OX dNTPs mix: 2.5 mM eachdNTP. 5. AZu primer pDJ34 10 w, the sequence of the primer IS as follows (see also

ref. 3): 5’TGAGC(C/T)(G/A)(A/T)GAT(C/T)(G/A)(C~)(G/A)TGAGCCA3’. 6. Thermus aquaticuspolymerase(Tag polymerase). 7. TE buffer pH 7.5: 10 mM Tris-HCl, pH 7.5, 1 nGI4EDTA. 8. 2M Ammonium acetate.

2.2. Preparation

of Dot Blots

1. Nylon membranes. 2. Denaturatron solution: 0.4N NaOH. 3. Neutralization solution: 0.2M Trrs-HCl, pH 7.5, 2X SSC (see the following for formulation of 30X SSC).

2.3. Hybridization 1. 2. 3. 4.

of Dot Btots

Hybridization solution: lMNaC1, 1% SDS, 10% (w/v) dextran sulfate. Sheared human placental DNA: 20 mg/mL. Sodium dodecyl sulfate (SDS): 20% in H20. SSC 30X: 4.5MNaC1,450 mMNaCitrate, pH 7.

3. Methods 3.1. Production of Ah-PCR Products 3.1.1. Alu-PCR on Hybrids 1. Perform PCR m a total volume of 100 pL using 1 pg of hybrid DNA and 0.1 pM of& primer pDJ34 in 1X PCR buffer, 1X dNTPs mrx, and 2.5 U Taq polymerase.

2. Carry out PCR with an initial denaturationstep at 95°C for 5 min and 30 cycles of 94°C denaturation (1 min), 55°C annealing (1 mm), and 72OC extension (4 min).

Banfi and Zoghbi 3. Test the efficiency of the PCR reaction by runnmg 15 pL of PCR products on a 1.2% agarose gel. A smear ranging from 4000-400 bp IS seen when optimum amplification occurs. 4. In a 1.5-mL microfuge tube, mix 80 pL of PCR products with 160 pL of 2M ammonmm acetate and 240 PL of 100% ethanol; leave at room temperature for 5 mm, then centrifuge at high speed for 10 min, wash the pellet in 70% ethanol, and resuspend m 20 uL of H20.

3.1.2. Alu-PCR on YACs 1. Carry out Alu-PCR on 20 ng of yeast DNA containing the YAC of interest in the same manner described for the hybrids (see also Notes 1 and 2). The Alu-PCR on yeast DNA can be performed using as template either DNA in solution (see Chapter 6) or yeast DNA in agarose plugs (see Chapter 7). In the latter case, equilibrate a small ptece of an agarose plug in TE pH 7.5 m a 1.5-mL microfuge tube for 15 min; discard the TE buffer and repeat thts step three more times. After the last wash, melt the plug at 67°C for 5 min and use 4 uL of the melted plug for the PCR reaction. 2. Test the efficiency of the PCR reaction by running 10 uL of the product on a 1.2% agarose gel (a discrete band pattern in the range 4OOWOO bp is expected). 3. Precipitate the rest of the PCR products as described above.

3.2. Preparation

of Dot Blots

1. Draw a grid of 24 1 x 1 cm squares on nylon membrane and number each square. 2. Spot 1 uL of the precipitated Alu-PCR products onto the filter and au dry for 15 min. 3. Soak the filter m denaturation solutton for 5 min and then in neutralization solution for 5 min. The denaturation and neutralization steps can be carried out on blotting paper soaked with the respective solutions. Air dry the filter for 30 min and bake it at 80°C for 2 h m a vacuum oven.

3.3. Hybridization

of the Dot Blots

1. Label 3 uL of precipitated Mu-PCR products from a YAC with [o~-~~P] dCTP by the random primer method (4). 2. Prehybridize the filter using the hybridization solution and 100 pg/mL of sheared human placental DNA for at least 2 h at 67°C. 3. Preassociate the labeled probe, at a concentration of lo6 cpm/mL of hybridization solution with 500 ug/mL of human placental DNA at 67°C for 40-60 min (see Note 3). 4. Add the preassociated probe to the hybridization solution and hybridize at 67OC for 12-16 h; wash in 2X SSC/O.1% SDS, 1X SSC/O.1% SDS, and

Detection of Chimerism

in YAC Clones

II9

0.1X SSWO.1 % SDS for 30 min each at 67OC. Expose the filter to X-ray film with an intensifying screen for 45-60 mm. 5. A typical autoradiograph of an Alu-PCR dot-blot analysis is shown in Fig. 1: The panel on the left (A) shows the hybridization of the dot blot with a nonchimeric YAC from chromosome 6, whereas the panel on the right (B) shows the result of a hybridization with a chimetrc YAC clone containing a segment from chromosome 6 and another segment from chromosome 1 (see Notes 4 and 5). This method can be useful also for detecting chimerism within the same chromosome; dot blots prepared from various radiation hybrids retaining different portions from the same chromosome can be used for the hybridization (5,6). 4. Notes

4.1. Ah-PCR 1. It is important to carry out Alu-PCR on hybrtds and YACs using the same Ah primer. In our experience, primer pDJ34 has proven to be the most effective, because it generates a large number of inter-&u fragments and does not amplify hamster DNA. Other Ah primers can be used as long as they do not amplify hamster DNA (7). 2. Concentration of MgC12 in the PCR reaction is very important. The 1.25 mA4 concentration can be increased up to 2.5-3 mM in order to amplify more and larger fragments. However, the authors recommend the mclusion of hamster and yeast genomic DNAs as controls to ensure the specificity of amplifying human sequencesat MgClz concentration of > 1.5 nnI4. The presence of amplification products in hamster or yeast DNA will interfere with the hybridization and analysis.

4.2. Dot-Blot

Hybridization

3. Preassociation of both the filter and the probe with human placental DNA to block repetitive sequences is a critical factor for obtaining clean and specific hybridization patterns. Failure of effective blocking of repetitive sequences will result in high background and preclude the identification of specific signal. If high background is detected even after an adequate preassociation, it may be useful to reduce the amount of probe in the hybridization solution down to a concentration of 0.1 x lo6 cprn/mL. In such instances, the problem may be caused by the presence m the YAC probe of low copy repeats that are not effectively blocked. 4. In our experience, it is possible to use the same dot blot at least 10 times, after which the efficiency of the hybridization decreasesand identification of specific hybridization signals becomes more and more difficult. The membranes that have been used to develop this protocol are Sureblot membranes (Oncor, Gaithersburg, MD).

Banfi and Zoghbi

120

Table 1 Comparisonof YAC Chimerism Detection Using &u-Dot Blot Hybridization and YAC EndsMapping Approaches YAC ends mapping Alu-dot blot Chimetic Nonchimeric hybridization YACs YACs Total Chtmerrc YACs

Nonchimenc YACs

19 3

0 19

19 22

5. The authors have tested the sensitivrty and reliabrlity of this technique by comparing it with the traditional YAC ends mapping approach. Table 1 summarizes the results of such comparison performed on more than 40 YAC clones. This analysis shows that for three clones &-dot-blot hybridization technique did not detect chimerism that was present based on YAC ends mapping. The presence of three false negatives among the YACs tested by&u-dot-blot hybridization suggest that the chimeric segment may be small and hence does not contain enough A/u-repeats in the correct orientation to permtt amplificatton of interdlu sequences.This limitation on detection of chimerism by relying on interdlu amphfication is also inherent to mapping by FISH analysis using Alu-PCR products. Nevertheless, the high reliability m detecting chimertc clones (19/l 9 in Table 1) and the ease of this approach make it a very useful tool for the initial characterization of a large number of YAC clones.

References 1. Green, E. D., Riethman, H. C., Dutchrk, J. E., and Olson, M. V. (1991) Detectron and characterizationof chimeric yeastartificial-chromosomeclones.Genomrcs11, 658-669. 2. Ledbetter, S. A., Garcia-Heras,J., and Ledbetter, D. H (1990) “PCR-karyotype” of human chromosomes m somatic cell hybrids. Genomics 8,614-622. 3. Breukel, C , Wtjnen, J., Tops, C., Klift, H., Dauwerse, H., and Khan, P. M. (1990) Vector-Alu PCR: a rapid step in mapping cosmids and YACs. Nucleic Acids Res 18,3097 4

Feinberg, A. P. and Vogelstein, B. ( 1984) A technique for radiolabeling DNA restrictton endonuclease fragments to high specific activity Anal. Btochem

137,

266,267.

5. Zoghbt, H. Y. and Chinault, A. C. (1993) Generation of YAC contigs by walking, in YACs* A User Guzde (Nelson, D L. and Brownstein, B. H., eds.), Freeman, New York, pp. 93-112

Detection of Chimerism

in YAC Clones

121

6. Bar& S , Ledbetter, S. A , Chmault, A. C., and Zoghbr, H. Y. (1992) An easy and rapid method for the detection of chimeric yeast artificial chromosomes clones. Nucleic Acids Res 20, 18 14 7. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Sobs, R., Webster, T D., et al. (1989) Alu polymerase chain reaction* a method for rapid isolatron of human-specific sequences from complex DNA sources Proc Natl Acad Sci. USA 88,6157-6161.

CHAPTER12

Amplification

with Arbitrary

Primers

Anna Di Rienxo, Amy C. Peterson, and Nelson B. Freimer 1. Introduction Several methods have been published that rely on the use of short oligonucleotide primers with arbitrary sequences to amplify discrete DNA fragments by the polymerase chain reaction (PCR) (1,2). Typically, a single arbitrary primer is used in each reaction and amplification is achieved when the same sequence is present in inverted orientation at two sites separated by less than a few kilobases. These methods have several advantages: 1. They canbe usedto producequickly large numbersof discrete DNA fragmentswithout prior sequenceinformation; 2. Owing to the random nature of the process,the amplified fragments are likely to be evenly distributed acrossa genomic region; 3. Because they do not rely on the presenceof species-specific repetitive sequences(e.g., Ah repeats[3]), they can be used to analyze the genome of any species. The most common application of arbitrary primers is to amplify polymorphic DNA fragments that can be used to construct genetic maps. Such arbitrary PCR assays are supposed to detect single base variation in genomic DNA so that a given fragment is amplified depending on the presence of a sequencecomplementary to that of the arbitrary primer used. However, it is possible that mechanisms other than single point mutations may be at the basis of the variation detected by arbitrary amplification. From Methods m Molecular &o/ogy, Vol 54 YAC Protocols Edlted by Cl Markle Humana Press Inc , Totowa, NJ

123

124

Di Rienzo, Peterson,

and Freimer

Here the authors present a modification of the aforementioned methods that is not aimed at the identification of variation for genetic mapping purposes, but relies on the ability to amplify discrete DNA fragments from a yeast artificial chromosome (YAC) template (4). The authors expect that the present method will be employed mainly in physical mapping efforts. Arbitrary primers are utilized to generate large numbers of discrete PCR fragments from YAC templates. In addition, m order to produce PCR fragments near the YAC ends, the authors used the arbitrary primers in combination with primers designed to anneal specifically to vector end sequences. Once specific PCR fragments are identified, they can be used for a variety of applications. Owing to their likely even distribution across a genomic region, such fragments can be used to construct maps with fewer gaps. They can be used as probes for Southern blots or genomic denaturing gradient gel electrophoresis (gDGGE) (5). Also, they may be cloned and sequenced to generate sequence tag sites (STS) (6). In addition, the identification of candidate YAC ends by PCR with arbitrary and vectorspecific primers may provide preliminary information on the overlap between YACs whose order 1s unknown. Once the specificity of the potential YAC end fragments is confirmed by hybridization, the suggested order can be confirmed further by PCR with arbitrary primers only. The method relies on the use of YAC template DNA separated by pulse field gel electrophoresis and eluted from the agarose band. The YAC DNA is used as a template for PCR either with a single random 10-mer only or with a random lo-mer and a vector specific primer to obtain random fragments from the YAC insert or YAC ends, respectively. The PCR products are separatedon agarosegel electrophoresis and candidate bands are eluted from the agarose. Candidate band DNA is used to probe Southern blots containing the YAC DNA as well as control DNAs including genomic, somatic cell hybrid, and YAC vector DNAs. The results of the Southern hybridization will confirm the specificity of the PCR bands isolated on the agarose gel. 2. Materials

1. 10X PCR buffer: O.lM Tris-HCl pH 8.3, OSM KCI, 0.02M MgC12, 0.0 1% gelatin. 2. 1 mMdNTPs.

Amplification

with Arbitrary

Primers

125

3. Amplitaq polymerase (Perkin-Elmer Cents, Norwalk, CT). 4. 5 PMArbitrary prtmer solution m H20. (Ten-mers with arbitrary sequence can be purchased from Operon Technologies, Inc.) 5. 5 pA4 Vector primer solution in H20. The authors designed the following 16-mers: a. 93.16 S-TGAACCATCTTGGAG-3’ for the left arm; and b. 94.16 5’-AAGTCTGGAAGTGAA-3’ for the right arm. 6. Low melting point (LMP) agarose (Gibco BRL, Gaithersburg, MD). 7. Geneclean II kit (Biol 01). 8. 5X TB electrophoresis buffer: 54 g Trrs base, 27.5 g boric acid for 1 L. 9. 20X SSC: 175.3 g NaCI, 88.2 g sodium citrate, pH 7.0 (adjust wtth 1OM NaOH) for 1 L. 10. 10 mg/mL ethidium bromide. 11. 10% SDS. 12. 50X Denhardt’s solution: 5 g Ficoll (Type 400, Pharmacra, Uppsala, Sweden), 5 g polyvinylpyrrolidone, 5 g bovme serum albumin (Fraction V, Sigma, St. Louis, MO) for 500 mL. Filter sterilize and store at -20°C. 13. 25% Dextran sulfate. 14. IMNaOH. 15. 3MNaCl. 16. 1M Trrs-HCl pH 7.4. 17. 0.5M NaOH, 1.5M NaCI. 18. 0.5M Tris-HCl pH 7.4, 1.5MNaCl. 19. Hybridization solution: 6X SSC, 10X Denhardt’s solution, 1% SDS. 20. 0.1X SSC, 1% SDS.

3. Methods 3.1. Preparation of YAC Templates The first step consists in the preparation of YAC DNA as a template for PCR. Yeast cells are grown and agarose blocks are prepared as described in Chapter 7 so that approx 3 x 1O8cells are loaded in each gel lane. The electrophoresis conditions to separate YAC DNA from the yeast chromosomes vary depending on the size of the YACs examined. The authors were successful in determining appropriate electrophoresis conditions by means of the autoalgorithm provided with a CHEF mapper (BioRad, Richmond, CA) apparatus in 1% LMP agarose gel run m 0.5 x TB at 14°C. (EDTA was omitted from the electrophoresis buffer so that the template DNA would not contain any EDTA that might alter the efficiency of primer annealing during PCR.)

126

Di Rienzo, Peterson, and Freimer

I. Stam the agarose gel m a tray containing a 0.5 pg/mL ethtdium bromide solution for 15 mm. 2. Transfer the gel onto a clean sheet of Saran wrap on a UV transilluminator. 3. Usmg a sterile razor blade, excise the band containing the YAC DNA and transfer mto a sterile 1.5-mL Eppendorf tube. Use different razor blades for different YACs. 4. Add 200 p.L H20, heat to 65°C for 2 min, and vortex. The YAC DNA 1s now ready for PCR (see Note 1).

3.2. Arbitrary

PCR

The DNA from each YAC is subjected to PCR with a single arbitrary

lo-mer. A no-template control and a control containing YAC vector DNA are performed each time to check for contaminations or amplifica-

tion of yeast fragments. 1. For each reaction use: 2.5 pL 10X PCR buffer, 2.5 pL 1 WdNTPs, 1 ltL 5 pA4arbitrary lo-mer, 0.2 uL Amplitaq, 14 pL H,O, 5 pL template DNA. Make a master mix scaled up for the number of YAC templates and controls used. Ahquot 20 PL of master mix mto each tube and add 5 yL YAC template and 5 pL HZ0 for the negative control. Overlay with 60 pL mineral oil. 2. Amplificatton 1s carried out m a Perkin-Elmer Cetus thermal cycler (see Note 2) in 0.5-mL Eppendorf tubes usmg the followmg cyclmg profile: Imtial denaturatton at 94°C for 3 mm: a. 5 cycles of: 94°C for 1 min, 36°C for 5 min, 72’C for 2 min. b. 40 cycles of 94°C for 1 mm, 36’C for 1 mm, 72°C for 2 min. 3. Load 15 pL of each reaction on a 1.2% LMP agarosegel (approx 11 x 14 cm) contammg 0.5 pg/mL ethtdium bromide. Run at 33 V overmght. 4. Transfer the gel onto a UV transilluminator and excise the selected PCR bands. Transfer each band mto a 1.5-mL Eppendorf tube (see Note 3). 5. Add 209 pL HzO, heat to 65°C for 2 min, and vortex. The DNA 1snow ready to be labeled.

3.3. PCR with Arbitrary and Vector End Primers Each YAC template is amplified using an arbitrary primer and a vector specific primer with the aim of isolating PCR fragments at the ends of the YAC insert. For each YAWprimer combination, it is necessary to perform a PCR with the arbitrary primer only and a PCR with the vector primer only in order to check whether fragments obtained with the arbitrary and vector primer combination are the result of priming with either primer only. The other controls, i.e., no template and YAC vector, should also be performed every time.

Amplification

with Arbitrary

Primers

227

1. For each arbitrary/vector primer combination use: 2.5 pL 1OX PCR buffer, 2.5 pL 1 miJ4 dNTPs, 1 p.L 5 fl arbitrary IO-met-, 1 pL 5 @4 vector primer, 0.2 pL Amphtaq, 13 pL HzO, 5 pL template DNA. The control PCR wtth a single primer (either the arbitrary or the vector primer) are performed as described earlier for the arbitrary PCR except for the PCR profile. Make a master mix for all the YAC templates and the controls and aliquot 20 pL into 1.5-n& Eppendorftubes. Add 5-pL templates or 5 PL Hz0 for the no template control. Overlay with 60 PL mineral oil. 2. Amplificatton is carried out in a Perkin-Elmer Cetus thermal cycler in 0.5mL Eppendorf tubes using the following cycling profile: Initial denaturation at 94°C for 3 min: a. 5 cycles of: 94°C for 1 min, 44OC for 5 mm, 72°C for 2 mm. b. 40 cycles of: 94°C for 1 min, 44OC for 1 mm, 72°C for 2 min. 3. Load 15 PL of each reaction on a 1.2% LMP agarose gel containing 0.5 pg/mL ethidmm bromide. Run at 33 V overnight. 4. Transfer the gel onto a UV transillummator and excise the selected PCR bands. Transfer each band into a 1.5-mL Eppendorf tube (see Note 4). 5. Add 200 pL H20, heat to 65°C for 2 min, and vortex. The DNA is now ready to be labeled.

3.4. Southern

Hybridization

Analysis

In order to test the specificity of the PCR fragments obtained in the preceedmg two steps, they are used to hybridize Southern blots containing: 1. Genomic DNA; 2. Somattc cell hybrid DNA containing the genormc region cloned tn the YACs; 3. Mouse or hamster genomtc DNA, depending on which cells were used to make the somatic cell hybrids; 4. YAC(s) DNA prepared from yeast cell suspension, i.e., containing yeast as well as YAC DNA; and 5. YAC vector DNA. The use of the preceeding DNAs allows one to test whether a given fragment is specifically amplified from the genomic region contained in the YAC(s) and whether it contains areas of overlap between the different YACs examined on the same Southern blot (see Note 5). 1. Digest DNA with EcoRI or any other enzyme used in constructing the YAC library. Typically, 10 pg DNA are used to detect single copy sequences in mammahan genomes. Owing to the smaller size of the yeast genome, the use of 0.1 pg DNA IS preferable. This ensures that bands of similar intensity are produced in both the genomic and YAC lanes.

128

Di Rienzo, Peterson, and Freimer

2. Digested DNA is run on a 0.8% agarose at 60 V overnight; denatured m O.SNNaOH, l.SMNaCl; neutralized m 0.5MTns-HCl, pH 7.4, 1.SMNaCl; and transferred and covalently bound to nylon membrane. 3. Five microliters DNA from the PCR bands excised from the agarose gel are labeled with [32P] by random priming (7) to a specific activity of 1OScpmpg. 4. Prehybrtdize nylon membrane m hybridtzatton oven at 65°C overnight m 5-l 0 mL hybridization solutton. 5. Denature and dilute probe to approx lo6 cpm/mL in hybridization solution. Use 5-l 0 ml/hybridization tube. Hybridize overmght at 65°C. 6. Wash filters m 0.1X SSC, 1% SDS at 65°C. 7. Expose filters to Kodak XAR film in autoradiography cassettewith mtensifymg screens at -80°C for 24-48 h.

4. Notes 1. An alternative procedure to purify the YAC DNA from the excised band uses the Geneclean II kit according to the manufacturer’s recommendations. The DNA from a single YAC band should be diluted to a 300~pL final volume. 2. The authors found that a PCR protocol could not be reproducibly transferred to different PCR machines. In particular, the authors found that the pattern obtained with a given primer/template combination on a PerkinElmer thermal cycler could not be reproduced on a Perkin-Elmer 9600 PCR machine. However, the pattern obtained wtth a given primer/template combmation could be reproduced from one amphfication to another on any grven machme. 3. Selection of bands after PCR with arbitrary primers: Varying numbers of PCR products are usually obtained depending on the primer used and the size of the YAC. Also, the intensity of the bands varies withm the same amplification, In general, intense bands are preferred because they are more likely to represent specific PCR products. In addition to band mtensity, the criteria for selection depend on whether the order of the YACs is known and on the specific apphcatton of the method. In general, bands of the same size present in more than one YAC are interpreted as areas of overlap between YACs, whereas bands unique to a given YAC are mterpreted as nonoverlapping areas. If the order of the YACs 1sknown, unique bands are expected from nonoverlapping YACs and shared bands are expected only in overlapping YACs. If the order IS unknown, shared bands can provide prehminary information on overlap to be confirmed by Southem blot hybridrzation.

Amplification

with Arbitrary

Primers

129

4. Selection of bands after PCR with arbitrary and vector primers. Bands are considered candidate YAC ends if they are present only m the gel lane containing the PCR products from the combination of primers. Bands that are present also in any of the lanes containing the PCR products from single primers are the result of amplification with the same primer. The candidate YAC ends identified in the agarose gel are then used as probes for Southern blots. 5. The PCR bands used for hybridization of Southern blots may contam repetitive sequences. In the authors’ experience it is often possible to ldentify specific bands on the Southern blot even against a high background. However, m case the repetitive DNA background is too high to detect unique bands, the hybridization protocol can be modified to include 250 pg/mL genomic DNA in the prehybridization and the hybridization mixes. However, the authors have noticed that the addition of genomlc DNA sometimes prevents detection of specific bands. Therefore, the authors recommend performing the hybridization without genomlc DNA first and resort to it only if a very high background 1spresent.

References 1. Williams, J. G K., Kubelik, A. R., Livak, K. J., Rafalski, J A , and Tingey, S V. (1990) DNA polymorphisms amplified by arbitrary primers are useful genetic markers. Nucleic Acids Res 18,653 l-6535 2 Welsh, J and McClelland, M (1990) Fingerprintmg genomes using PCR with arbitrary primers Nuclerc Aczds Res l&72 13-72 18 3. Nelson, D. L , Ledbetter, S A., Corbo, L , Victoria, M F , Ramirez-Sohs, R , Webster, T., et al. (1989) Alu polymerase chain reaction: a method for rapid lsolanon of human-specific sequencesfrom complex DNA sources.Proc. Nat1 Acad. Set. USA 86,6686-6690 4. Di Rienzo, A,, Peterson, A., Das, S , and Frelmer, N B. (1993) Genome mapping by arbitrary amplification of yeast artificial chromosomes Mammahan Genome 4, 359-363. 5. Burmelster, M., diSiblo, G., Cox, D. R., and Myers, R. M. (1991) Identlficatlon of polymorphisms by genomic denaturing gradient gel electrophoresis: application to the proximal region of human chromosome 2 1 Nuclezc Acids Res. 19, 1475-148 1. 6. Olson, M., Hood, L , Cantor, C , and Botstein, D (1989) A common language for physical mapping of the human genome. Science 245,1434-1435. 7. Femberg, A. P. and Vogelstein, B. (1984) Addendum. a technique for radlolabeling DNA restriction endonuclease fragments to high specific activity Anal. Biochem. 137,266,267

CHAPTER13

End Rescue from YACs Using the Vectorette Donald J. Ogilvie and Louise A. James 1. Introduction 1.1. The Vectorette Principle The vectorette unit (1) consists of a pair of annealed oligonucleotides that contain two regions of complementary nucleotide sequenceflanking a 29-bp noncomplementary segment (Fig, 1). The 5’ terminus of one of these complementary regions is phosphorylated and displays a restriction enzyme-specific sticky (or blunt) end that permits ligation of vectorette units to both ends of a restriction fragment. A nested pair of polymerase chain reaction (PCR) primers, VP 1 and VP2, directed toward the phosphorylated end have most of their sequence, including their 3’ termini, in the noncomplementary region of the vectorette. These oligonucleotides cannot function as PCR primers on vectorette units without synthesis of a complementary strand from a primer located in the ligated DNA. Thus, although vectorette units will ligate to themselves and to all restriction fragments with matching ends, only DNA flanked by a specific primer (from known sequence)and a vectorette will be amplified in PCR. Because PCR only works effectively for pairs of primers separated by a few kilobases, it is necessary, in the absence of restriction map information, to construct a set of vectorette “libraries,” covering a range of restriction enzyme specificities, in order to maximize the chanceof obtaining a product. The number and choice of restriction enzyme specificities depends on the source of DNA and the size of products required. From: Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

131

Ogilvie and James

132 A Vectorette unit and Primers GCTGTCTGTCGAAGGTAAGGAACGGACGA 9 (NNNN)XAAGGAGAGGAC 3 ‘I’ TKCTCTC

GAGAAGGGAGAG 3’ CTCll CCC TCTC 5’

CTG TCGCTAAGAGCATGCTECCAATGCTAAG

3’ CATGC-ITGCCAATGCTAAGCTCTKCCTCT Vectorette Pnmer 1 (VPl) 3’ TCGCTAAGAGCATGClTGCCAATGCTAAGC Vectorette Pnmer 2 (VP2)

5’

5

3 TTCCTCTCCTGTCGC 5’ Sequencmg Primer (SV)

B YAC vector (pYAC4) primers Rl

5’ ATAGGCGCCAGCAACCGCACCTGTGGCG

3’

R2

5’ C-ITGCAAGTCTGGGAAGTGAATGGAGAC

3

SR

5’ GTCGAACGCCCGATCTCAAG

Ll

5’ GTGl7ATGTAGTATACTCTTTCI-KAAC

L2

5’ C-IXAACAA-ITAAATACTCTCGGTAGCC

SL

5’ GITGGI-ITAAGGCGCAAG

3’

3’ 3’

3’

Fig. 1. Oligonucleotides used m vectorette end rescue from YACs: (A) The vectorette unit and associated PCR and sequencing primers. In the bluntended vectorette residue X = 5’ Phospho-T; Y = A. In the GATC sticky-ended vectorette (NNNN)X = 5’ Phospho-GATCG; Y = C. (B) PCR and sequencing primers for the r(tght) and l(eft) arms of the YAC vector pYAC4 (based on sequence in ref. 3).

With complex DNA sources (e.g., human or yeast genome), it is often necessary to carry out two rounds of PCR, with nested primers, to obtain sufficient specific product for other manipulations such as cloning, sequencing, and hybridization. 1.2. Application of Vectorette to End Rescue from YACs For efficient genome walking with yeast artificial chromosomes (YACs), it is desirable to isolate both the insert-terminal segments (2).

End Rescue from YACs

133 EcoRl (cloning S&J)

pYAC4

RIGHT

ARM

X I IDigest with X-specific ECORI

pYAC4

X J

1

restriction

enzyme

X I

RIGHTARM

Ligate Vectoreite pYAC4

RIGHT

ARM

VECTORElTE

PCR (2 rounds)

1 I EcoRl

Fig. 2. Amphfication of insert-terminal segment from a YAC using the vectorette. X = site(s) for restrtctron enzyme(s) used to construct the vectorette libraries. Rl, R2 = pYAC4 right arm (containing UK43 gene) vector PCR prtmers (Ll, L2 used for left arm [containing TRPZ gene]). VPl, VP2 = vectorette PCR primers. SRand Sv are sequencing primers. These can be specifically amplified in PCR with YAC clone vectorette “libraries” using primers specifying each YAC vector (pYAC4) arm (right and left) in conjunction with the vectorette primers (3) (Figs. 1

and 2) (see Note 1). For YAC insert-terminal segment isolation it is necessary to make vectorette libraries for each YAC clone. Unless multiple YACs are present, whole yeast (YAC clone) DNA is used as substrate for library construction (see Notes 2 and 3). The authors routinely construct vectorette libraries using a single blunt-ended vectorette with digests of YAC clone DNA with four blunt-cutter enzymes (AZuI, EeoRV, PvuII, and RsaI). This yields satisfactory products from both ends of -95% of YACs. As an alternative the authors have also used a GATC sticky-ended vectorette with the four restriction enzymes BarnHI, BgZII, BcZI, and MboI. Starting with YAC DNA in agarose plugs, insert-terminal segments from both ends of four YACs can be isolated in 3 d.

134

Ogilvie and James 2. Materials

1. YAC DNA in agarose plugs (-3 pg DNA m 100 pL agarose plug). (See Chapter 7 for preparation.) 2. Vectorette units and other oligonucleotides (Fig. 1). Vectorette units and reagents are available from Genosys Btotechnology Inc. (Woodlands, TX). 3. Enzymes:Tagpolymerase, T4 DNA ligase, and selectedrestriction enzymes. 4. Restrictton/ltgation buffer (RLB): 10X RLB is 100 mM Trts acetate, 100 mM magnesium acetate, 500 mM potassium acetate, pH 7.5. 5. TE: 10 mA4Trts-HCl pH 8.0, 1 mA4Na2EDTA. 6. 2MNaCl. 7. 100 mA4ATP. 8. 10X PCR buffer: 100 mMTris-HCl, pH 8.3,500 mMKC1, 10 mA4MgC12, 1% gelatin.

3. Methods 3.1. Construction of Vectorette Libraries from YAC DNA 3.1.1. Digestion of DNA 1. Dialyze one agarose plug from each YAC clone against 2 x 5 mL TE (for >2 h/change) in a 6-mL polystyrene bottle on a roller at 4°C. 2. Cut the plug into four equal portions using a clean scalpel blade. Equilibrate one portion with 0.5 mL of each of the followmg buffers for 60 mm on ice m 1.5-mL tubes: for AZuI, RsaI: 1X RLB; for EcoRV: 2X RLB; for PvuII: 1X RLB + 12.5 p.L 2MNaCl (per 0.5 mL RLB). 3. Remove the equilibration buffer and replace with 50 pL of fresh buffer containing 20-25 U of the appropriate restrictton enzyme. Equilibrate on ice for 30 min before transferring to a 37°C water bath for overnight incubation.

3.1.2. Ligation of Vectorette Units 1. Add 75 pL 1X RLB to each digest and incubate at 65°C for 10 mm to melt the agarose. Mix gently and transfer 40 pL to a clean 1.5-mL tube. Keep at 37°C. 2. Mix the following (adjustpro rata, depending on the number of YACs): 2 pL Blunt vectorette (2 pmol), 2 pL 100 mM ATP, 6 pL containing 20 U T4 DNA ligase, 40 pL 1X RLB. 3. Add 10 pL of this vectorette ligation mtx to each 40 pL of digested DNA. Incubate at 37OC for 2 h. 4. Add 200 pL sterile Hz0 and mix to yield vectorette “library.” Such hbrartes have been stored at -20°C for at least 2 yr without loss of activity.

End Rescue j?om YACs

135

3.2. Amplification

of YAC Insert-Terminal Fragments 3.2.1. First Round PCR 1. Mix the following m a OS-mL tube (1 for each restriction enzyme specrticity): 2 pL (-1-2 ng) vectorette library DNA, 10 nmol of each dNTP, 30 pmol each of VP1 and Rl (or Ll) primers, in 1X PCR buffer and 48 pL total volume. 2. Denature 96”C/lO mm. Add 1 U Tag polymerase in 2 pL 1X PCR buffer, then 92”C/2min, 60°C/2 min, 72”W min, and 39 cycles in thermal cycler. Although some YAC insert-terminal products are detectable by agarose electrophoresis after one round of PCR (3), better products in terms of specificity, yield, and size are obtained after a second round of PCR with nested primers.

3.2.2. Second Round PCR 1. Mix the following in a 0.5-mL tube: 2 pL diluted (1 in 200) first round PCR product, 10 nmol of each dNTP, 100 pmol each of VP2 and R2 (or L2) primers, m 1X PCR buffer and 98 pL total volume. 2. Denature 96OC/lO min. Add 2 U Tuq polymerase in 2 pL 1X PCR buffer, then 92OC/2min, 60°C/2 min, 72OC/3min, and 36 cycles in thermal cycler. 3.3. Characterization of YAC Insert-Terminal Fragments 3.3.1. Verification of Integrity of PCR Products 1. Examine 10-pL sample of second round PCR reaction by electrophoresis in 2% agarose. Store remainder of reaction at -20°C. 2. Select the best products (size, purity, and quantity) and digest 10-20 pL with 10 U EcoRI at 37°C overnight. This excises the amplified YAC vector sequences (left or right) from any insert-terminal vectorette products (Fig. 2). (EcoRI will also cleave any EcoRI sites within the amplified insert-terminal segment, see Fig. 3.) 3. Compare the EcoRI-digested products against 10 pL undigested sample of second-round PCR reaction by electrophoresis in 2% agarose. Genuine insert-terminal vectorette products will be cleaved at least once by EcoRI to yield a YAC vector-derived fragment of characteristic size (Figs. 3 and 4) (see Notes 5,6, and 7).

3.3.2. Preparation for Use in DNA Hybridization 1. Insert-terminal vectorette products with YAC vector sequences removed by EcoRI digestion can be excised from the test gel (see Section 3.3.1.).

136

Ogilvie

and James

kb 1.6

-

0.5

0.1

R

5

5R

6

6R

L

Fig. 3. Agarose gel electrophoresis of vectorette products from the right end of YAC 27ED3. Key to vectorette libraries used: 1 (RsaI); 2 (PvuII); 3 (Hinfl); 4 (EcoRV); 5 (BgZII); 6 (AZuI). Lanes marked R contain EcoRI digests of vectorette products: the common 90-bp band in each digest indicates cleavage of the pYAC4 (right arm) fragment. The Hi@ product is not cleaved because the Hinjl site to which the vectorette is ligated lies within the vector arm (see Fig. 4). Note the additional (0.42 kb) band in the EcoRI digest of the product from the BgZII library (lane 5R); this indicates the presence of an EcoRI site within the insert-terminal region amplified from this library. L = I-kb ladder marker (Gibco-BRL, Gaithersburg, MD). 2. Test gel slices containing these DNA bands are inserted into the wells of a 0.8% low gelling temperature (LGT) agarose gel and electrophoresed until the DNA has migrated about 1 cm. 3. DNA in LGT agarose is then excised and used for labeling and hybridization by standard methods. The vectorette component does not hybridize to human or yeast DNA. 3.3.3. Preparation for Use in Direct Sequencing 1. Purify undigested insert-terminal vectorette products by electrophoresis in LGT agarose. Excise the “verified” band, identified in the test gel (see

137

End Rescue from YACs Eco RI (RI) YAC insert uYAC4

R arm

Primer R2

$

Hinf

I (Hf)

+

Ah

I (Al)

,-a

Eco RV (RV)

-m

Pvu II (Pv)

-

Rsa I (Rs)

-

+

= Vectorette

n

= Vectorette

a

&I 11(W

map Restriction

product

, HfRl ,,

0

FR,s

0.4

,

,

0.8

1.2

“I’,

16kb

Fig. 4. Schematic representation of insert-terminal vectorette products from the right end of YAC 27ED3 with a predicted restrtction map. Section 3.3.1.), and purify the DNA (e.g., by using a Geneclean ktt). 2. Direct sequence the purified DNA using a standard protocol for PCR products (4) with vector (S, and S,) and vectorette (Sv) sequencing primers (Fig. 1).

4. Notes 1. Vectorette libraries can be used to isolate segments adjacent to any known sequencesfrom the YAC insert (not just thoseadjacent to the vector sequence). 2. If a YAC clone contains more than one YAC, insert-terminal vectorette products need to be carefully characterized (e.g., by hybridization of vector-free fragments to PFGE blots) m order to determine the YAC of ortgm. 3. The genomic origin of Insert-termmal fragments 1sof course subject to the possibility of noncontiguous ligation and other artifacts intrmsic to the YAC library. YAC walking strategies should include screens (e.g., somattc cell hybrids) for the evaluation of new markers 4. A new generation of vectorette units contammg a variety of restrlctton sites to facilitate cloning are also available from Genosys Btotechnology. It should be noted that these vectorettes are not compatible with the prrmers described m this chapter.

138

Ogilvie and James

5. Partial digestion of YAC clone DNA can lead to skipping of sites or generation of multiple vectorette products from the same library. Products have also been observed from cleavage of DNA by abnormal (e.g., “star”) restriction enzyme actlvlty. Such sites will not be present in the genomic sequence. 6. Ligation of vectorette usually results in “mactivation” of the restriction site for the enzyme used to create the fragment. 7. Calculations regardmg the size of vectorette products and then amplified segments should take account of contributions from the vectorette (-50 bp) and pYAC4 vector components (right arm = -90 bp; left arm = -70 bp). This is particularly important when selecting products for sequencmg or hybridization.

References 1. Markham, A F., Smith, J., and Anwar, R. (1990) A Methodfor the Ampltficatton of Nucleotzde Sequences UK patent GB-222 1909 B 2. Butler, R., Ogllvle, D J., Elvin, P., Riley, J H., Fmmear, R. S., Slynn, G., et al. (1992) Walking, cloning, and mapping with yeast artlticlal chromosomes: a contig encompassing D21S13 and D21S16 Genomzcs 12,42-51. 3. Riley, J. H., Butler, R , Ogilvie, D. J., Finniear, R., Jenner, D., Anand, R , et al. (1990) A novel, rapid method for the lsoiatlon of terminal sequences from yeast artificial chromosome (YAC) clones Nuclezc Acids Res 18,2887-2890. 4 Green, P M. and Giannelli, F. (1991) Direct sequencing of PCR-amplified DNA, in Methods in Molecular Biology, vol. 9, Protocols in Human Molecular Genetics (Mathew, C., ed.), Humana, Cl&on, NJ.

CHAPTER14

Isolation of YAC Ends by Plasmid Rescue Gillian

Bates

1. Introduction In the construction and characterization of yeast artificial chromosome (YAC) contigs, it is necessary to be able to isolate and map the ends of the genomic inserts. This is important with respect to both extending contigs, and identifying chimerism. A number of techniques have now been described and successfully applied to this purpose, and the majority of these methods are PCR-based, including Alu-vector PCR (I), vectorette libraries (2), and inverse PCR (3) (see ref. 4 for review). Although the possibility of isolating vector-insert junctions by plasmid rescue was identified in the initial article describing the pYAC vectors (‘J, these vectors were not designed with plasmid end rescue in mind. The most widely used YAC libraries are constructed in the pYAC4 vector, i.e., the Washington University (6), CEPH (7), ICRF (8), and ICI (9) libraries, and consequently, modifications to the vector arms need to be made in order to comprehensively use the plasmid rescue approach. The left arm (LA) of pYAC4 contains a Co/El bacterial replication origin and an ampicillin resistance gene in addition to the yeast elements: CEN#, TRPl, ARSl. In contrast, the right arm (RA) contains only a UM3 yeast selectable marker. Plasmid rescue can therefore only be directly applied to the LA vector-insert junction. YAC DNA is digested with a restriction enzyme that cuts within the LA distal to the C&El sequenceand amp genes.This enzyme will also cut at unknown locations within the genomic insert. After circularization, the fragment containing From Methods m Molecular B/ology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

139

140

Bates

the vector-insert junction is isolated as a plasmid by transformation of Escherichia coli and selection for ampicillin. Only XhoI and NdeI have a recognition site at an appropriate position in the LA, therefore limitmg the choice of restriction enzymes that can be used for end rescue to Nu’eI, X501, and Sal1 (compatible with XhoI on ligation). In order to extend the use of plasmid rescue to both pYAC4 vector arms and increase the number of restriction enzymes that can be used for this purpose, integrating plasmids pICL and PLUS have been developed that can be used to retrofit the pYAC4 vector arms (IO) (see Chapter 17 for a more complete descnptlon). Although the RA of pYAC4 contains neither a bacterial origin of replication nor an antibiotic resistance gene, the vector-insert junctions can be rescued indirectly. The YAC DNA 1s digested with an enzyme that yields vector insert fragment that contams the URA3 gene and is subcloned into a plasmid vector. The appropriate vector-insert fragment can be identified by URA3 complementation of E. coli containing the pyrF mutation (4, II). Plasmid rescue is a useful addition to the repertoire of techniques that are available for isolating vector-insert junctions from YAC clones. Although the PCR approaches are comparatively rapid, they do not always generate useful hybridization probes. Plasmid rescue allows the isolation of larger fragments thereby increasing the chance of obtaining single copy sequences. In addition, the use of the restriction enzymes 301 and Sal1 with this technique can generate plasmids of 20 kbp or greater which can be used directly as FISH probes providing an additional mapping option.

2. Materials 2.1. Preparation of YAC DNA Prepare yeast chromosomes in LMP agarose blocks as described in ref. 12 and Chapter 7.

2.2. Enzymes 1. Restriction enzymes(NEB, Beverly, MA). Perform reactions asrecommended. 2. 400 U/pL T4 DNA ligase (NEB). 3. Proteinase K (BDH, Leicestershire, UK) Dissolve m water to 10 mg/mL, freeze on dry ice, and store m ahquots at -20°C 4. Agarase (Camblochem, San Diego, CA, or Sigma, St. Louis, MO). Dlssolve at 20 U/pL m 50% sterile glycerol and store at -20°C.

Isolation

141

of YAC Ends 2.3. Solutions

and Buffers

1. TE: O.OlMTris-HCl, pH 7.6, 1 mA4EDTA. 2. 10X Ligase buffer: 0.4M Tris-HCl, pH 7.6,O. 1M MgC12, O.OlM DTT. 3. 1000X PMSF (phenylmethylsulfonyl fluoride) (Sigma): Prepare fresh by dissolving in tsopropanol at 40 mg/mL. Heat to 68°C m order to dissolve. 4. Hybrtdization solution: OSM sodium phosphate, pH 7.2, 7% SDS, 2 mM EDTA (13). 5. PCI: phenol, chloroform, isoamyl alcohol (volume ratios 25:24: 1). 6. CI: chloroform, isoamyl alcohol (volume ratios 24: 1). 7. LB medium: see Chapter 29 8. If unspecified, solutions were prepared as described (14).

2.4. Materials 1. High gellmg temperature agarose (SeaKern) and low melting point (LMP) agarose (Seaplaque) were from FMC Bioproducts (Rockland, ME). 2. Gene Pulser electroporation apparatus and 0.2-cm electroporation cuvet (Biorad, Rxhond, CA). 3. Nylon membranes (Hybond N+), Amersham (Arlmgton Heights, IL). 4. XLlblue E. colz (Stratagene Inc., La Jolla, CA). 3. Methods

3.1. Digestion

of YAC DNA

1. Digest the yeast genomic and YAC DNA m LMP agarose blocks (5 x 1O7 yeast cells is equivalent to 1 yg DNA in 80 uL) to completton wtth the required restriction enzyme (see Note 1). Digest two blocks with 50 U restriction enzyme m a volume of 400 pL. Mix all of the components thoroughly includmg the restriction enzyme, add the YAC block, and digest for 4 h. 2. Inactivate the restriction enzyme by the addition of proteinase K to 250 ug/mL and EDTA to 0.05Mand incubating at 37°C for 30 min. Then mactivate the proteinase K by washing the blocks m 15 mL of 40 ug/mL PMSF in TE twtce for 30 mm. 3. Load one block onto a 0.7% agarose gel (see Note 2) and after electrophoresis, transfer the DNA to a nylon membrane by Southern blotting and hybridize with the PvuIIIEcoRI fragment of pBR322 that is specific to the CEN4 containing vector arm of pYAC4. This both ensures that the digestion is complete and indicates the size of the fragment to be recovered.

142

Bates 3.2 Ligation

It is important to use ligation conditions that favor intramolecular rather than intermolecular ligation events and therefore a comparatively low DNA concentration must be used. A 400 uL ligation reaction contains approx 2.5 ng DNA/pL (see Note 3). 1. Equilibrate the digested block (80 pL) with TE + 0.25MNaCl by washing twice for 30 mm m 15 mL at room temperature. This will give a final NaCl concentration of 0.05Min a volume of 400 pL. Melt the equilibrated block with 40 uL 10X ligase buffer and the required volume of water at 68°C for 5 mm. Mix thoroughly and allow to cool to 37OC.Add ATP to 200 @4 and 4 I-J/uL T4 DNA hgase mix and incubate at 15°C overnight. 2. Add EDTA to 0.02M melt at 68°C for 5 mm. Place at 37°C for 10 mm. Add 4 yL agarase (see Note 4) and incubate at 37°C for 4 h or overnight. Extract once with PCI, once with CI, precipitate with ethanol, and resuspend in 4 uL TE. 3.3. EZectroporation Transformation of electrocompetent E. coli cells is performed using a

BioRad Gene Pulser electroporation apparatus. Electrocompetent cells, prepared as recommended (BioRad), routinely transform the bluescript plasmid (Stratagene Inc.) at transformation efficiencies of the order of 109/yg DNA. 1. Add 2 ltL DNA to 50 uL electrocompetent XL-blue cells, place on ice for 1 mm, and pulse in a 0.2~cm electroporation cuvet at 2.5 kV, 200 R, and 25 PF. Immediately add 1 mL LB to the cells and incubate at 37°C for 1 h with shaking. 2. Pellet cells, resuspend m 100 uL LB, and plate on an LB plate contammg 50 ug/mL ampicillin. For plasmids of up to 25 kb, between 20 and 500 colonies can be expected from the transformation and plating of half of the ligation reaction.

4. Notes 1. YAC DNA m the form of yeast chromosomes in LMP agarose blocks was used for these experiments as YAC DNA was already available in thts form. YAC mimprep DNA would also be suitable (ZO). 2. Digestion of genomic DNA with SalI or XhoI can be expected to generate large restriction fragments, a gel containing a higher percentage of agarose could be used with other restriction enzymes.

Isolation

of YAC Ends

3. A solution containing a 20 kb DNA molecule at a concentration of 2.5 ng DNA/pL would contain a j/i ratio of >5 where j is the effective concentration of one end of a DNA molecule in the neighborhood of the other end of the same molecule and i is a measure of all complementary termini in the solution (14). 4. Gelase (FMC) is a suitable alternative to agarase.

References 1. Nelson, D. L., Ballabto, A., Victoria, M. F , Pterettt, M., Bies, R. D., Gibbs, R. A., et al. (1991) A/u-primed polymerase chain reaction for regional assignment of 110 yeast arttficial chromosome clones from the human X chromosome: identification of clones associated with a disease locus. Proc Natl. Acad Sci. USA S&6157-6161 2. Riley, J , Butler, R., Ogrlvte, D., Finniear, R., Jenner, D., Powell, S., et al. (1990) A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nuclerc Aczds Res l&2887-2890. 3. Silverman, G. A., Ye, R. D., Pollock, K. M , Sadler, J. E., and Korsmeyer, S. J. (1989) Use of yeast artificial chromosome clones for mapping and walking within human chromosome segment lXq21 3. Proc Natl. Acad Sci USA 86,7485-7489 4. Silverman, G A. (1993) Isolating vector-insert junctions from yeast artificial chromosomes. PCR Methods Appi. 3, 141-150. 5. Burke, D T., Carle, G. F., and Olson, M. V. (1987) Cloning of large DNA segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236,806-8 12 6. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Korsmeyer, S. J., Schlessmger, D., and Olson, M V (1989) Isolation of single-copy human genes from a library of yeast arttticial chromosome clones. Science 244, 1348-1351. 7. Albertson, H. M , Abderrahim, H., Cann, H. M., Dausset, J., Paslier, D L , and Cohen, D. (1990) Construction and characterlsatton of a yeast artifictal chromosome library containing seven haplord human genome equivalents. Proc Natl. Acad. Scl USA 87,4256-4260. 8 Larin, Z., Monaco, A. P., and Lehrach, H. (1991) Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc Natl. Acad Sci. USA 88,4123-4127 9 Anand, R., Riley, J. H., Butler, R., Smtth, J. C., and Markham, A. F. (1990) A 3.5 genome equivalent multi access YAC library: construction, characterisation, screening and storage. Nuclex Acids Res. 18, 1951-1956. 10. Hermanson, G. G., Hoekstra, M. F., McElligot, D. L., and Evans, G. A. (1991) Rescue of end fragments of yeast arttficial chromosomes by homologous recombination m yeast. Nuclex Acids Res. 19,49434948. 11. Rose, M., Grisafi, P., and Botstem, D. (1984) Structure and function of the yeast URA3 gene: expression m Escherichia ~011.Gene 29, 113-l 24.

144

Bates

12 Herrmann, B. G., Barlow, D. P., and Lehrach, H (1987) An inverted duphcatton of more than 650 Kbp m mouse chromosome 17 medrates unequal but homologous recombmatron between chromosomes heterozygous for a large mversron Cell 48, 813-825. 13 Church, G M., and Gilbert, W. (1984) Genomx sequencing Proc Natl. Acad Scz USA 81,1991-1995 14 Sambrook, J , Fntsch, E F , and Maniatis, T (1989) Molecular CZonzng A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

CHAPTER 15

End-Rescue of YAC Clone Inserts by Inverse PCR Gary A. Silverman 1. Introduction The termini of yeast artificial chromosome (YAC) inserts can serve as probes or sequence tagged sites (STSs) that are useful in genomic analysis. For example, these elements can be used to: 1. 2. 3. 4.

Build physical maps and YAC contigs; Characterize and orlent YAC clones; Assess chromosomal origin and YAC chimerism; and Construct conventional and rare-cutting restriction maps.

Although many techniques have been developed, polymerase chain reaction (PCR)-based methods have proven to be a most efficient way to isolate large numbers of end-fragments (reviewed in ref. 2). To achieve logarithmic amplification, however, these techniques require that unique primer template sequencesflank both sidesof the end-fragment.Inverse PCR accomplishes this task by encircling the desired DNA fragment with known vector sequencesprior to the amplification step (Fig. 1) (26). First, sets of oligonucleotide primers in head-to-head, or inverse, orientation are synthesized for both the left and right YAC vector arms (Fig. 2). For reference, the left vector arm (LA) is that portion of the YAC vector that contains the TRPl, ARSl, and CEM sequences;whereas the right vector arm (R4) contains the UR43 gene. Second, YAC DNA is digested with one of a series of restriction enzymes that cleave at known locations within vector arm sequencesand at unknown locations within the genomic insert. From Methods m Molecular Bology, Vol 54 YAC Protocols Edited by D Markie Humana Press inc , Totowa, NJ

145

146 IA

Silverman LEFI’ ARM

INSERT

I

lef1 arm Izx

product

RIGHT ARM

digestion

right

arm

cp

Fig. 1. (A) Inverse PCR YAC DNA is digested with a restriction enzyme that cleaves at a known location in the vector arm and at an unknown location in the genomic insert (0). Templates for vector primers are oriented inversely and direct DNA synthesis in opposite directions (arrows). (B) Restriction fragments are self-ligated to form monomer circles. (C) Circularization of vector-insert junctions reorients primer templates and permits amplification of the intervening genomic insert (from ref. I with permission). Enzymes that cleave between the oligonucleotide template sequences and the EcoRI cloning site of the pYAC4 vector are avoided. The use of

several different restriction enzymes increases the likelihood of generating a vector-insert junction fragment that can be amplified efficiently by the PCR. Third, the DNA is diluted to a concentration of 0.2-2.0 pg/mL and self-ligated using T4 DNA ligase. This results in the formation of monomer circles in which known vector arm sequences now flank the genomic insert (Fig. 1). Circularization also reorients the vector arm templates so that the vector arm primers can anneal in the appropriate orientation. Finally, sets of LA or RA vector arm primers are used to amplify the desired LA or RA vector-insert junction fragments, respectively.

End-Rescue

of YAC Clone Inserts

Nhlll

GACTACGCGA?CATGGCGACCACACC Y13

Fig. 2. DNA sequence flanking the pYAC4 EcoRI cloning site. The location of various left arm (LA) and right arm (RA) vector primers used for inverse PCR (see Section 2.) are depicted by arrows. The vertical lme demarcates LA from RA. Insertions and point mutations not predicted by the composite sequence in Genbank (i.e., pBR322 and SUM) are underlined (from ref. I with permission).

Inverse PCR was used to construct megabase-size YAC contigs that encompass the BCL2 (6), Huntington’s disease (7), and MC genes (8, 9). A single restriction enzyme and inverse PCR was also used to isolate 12 of 14 end-fragments from a modified pYAC vector containing Arabidopsis thaliana DNA (I 0). The average sizes of inverse PCR fragments in our laboratory is 600 bp (range 26-1250 bp). The overall success rate of inverse PCR (>90%) is comparable to vectorette and other forms of ligation-mediated PCR. The use of gel-purified YAC DNA and a large panel of restriction enzymes that are available for both LA and RA rescue may account for the high success rate that have been experienced using this technique.

Silverman

148

2. Materials 2.1. pYAC4 Primers The DNA sequence of that segment of pYAC4 vector that encompasses the SUP4 gene and the EcoRI cloning site are depicted in Fig. 2. This sequence was determined by standard dideoxy chain termination methods and has been confirmed using several different YAC DNAs. The primers selected for LA and RA inverse PCR reactions have been derived empirically and work best with DNAs digested with different restriction endonucleases (see Section 3.4.). 1. LA prtmers: a. Sense #8: S-GTAGCCAAGTTGGTTTAAGG-3’; b. Antisense #15: 5’-ATACAATTGAAAAAGAGATTCC-3’; c. Antisense #13 S-GGACGGGTGTGGTCGCCATGATCGCG-3’.

and

2 RA primers. a. Antisense #3: 5’-AGTCGAACGCCCGATCTCAA-3’; b. Sense #2* 5’-GACTTGCAAGTTGAAATATTTCTTTCAAGC-3’; c. Sense #l 1: 5’-AAGAGTCGCATAAGGGAGAG-3’.

and

Primers are synthesized using standard phosphoramidite reagents, deprotected by ammonialysis, dried, resuspended m water at a concentration of 50 pA& and used without further purification. 2.2. Enzymes 1. Agarase:Epicentre Technologies(Madison, WI). 2. Restriction endonucleases: AccI, EcoRV, NZuIII, NZaIV, RsaI, SalI, S’hI, TaqI.

HaeIII,

HhaI,

HincII,

MboI,

3. T4 DNA hgase:400 U/pL, New England BioLabs (Beverly, MA). 4. Thermus aquaticus (Tuq) DNA polymerase: 5 UIyL, Perkm-Elmer (Norwalk,

CT).

2.3. Buffers

and PCR Reagents

1. 1OX Lrgase buffer: O.SMTris-HCl, pH 7.4,O. 1MMgC12, 0.2MDTT, 10 rnJ4 ATP, 50 ug/mL BSA. 2. 1OX PCR buffer: 500 mJt4 KCl, 100 mMTrrs-HCl, pH 8.3, 15 mA4 MgC12. 3. dNTP stock: A mixture of dATP, dGTP, dTTP, and dCTP each at 1.25 w. 4. YAC storage buffer: 30 mMNaC1, 10 mMTris-HCl, pH 8.0, 1 mMEDTA, pH 8, 0.75 mM spermidine trihydrochloride, and 0.3 mM spermine tetrahydrochloride.

End-Rescue

of YAC Clone Inserts

149

-450 -360 -280 -240

kb

Fig. 3. Gel purification of YACs. High-molecular-weight DNAs from three different YAC clones (above lanes) were separated by pulsed-field gel electrophoresis. Electrophoresis conditions (CHEF apparatus, 6V/cm field strength, 20-40 s ramped switching interval, 24-h run) were selected to enhance separation of natural yeast chromosomes I (-240 kb), VI (-280 kb), III (-360 kb), and IX (-450 kb). Arrows indicate the positions where YACs were excised from the ethidium bromide stained gel (from G. Silverman, unpublished data, with permission). 3. Methods 3.1. DNA Preparation 3.1.1. Total Yeast DNA Total yeast DNA can be prepared from a broth culture by one of several techniques (see Chapter 6; ref. II). 3.1.2. Optional: Gel-Purified YAC DNA (see Note 1) 1. Prepare high-molecular weight yeast DNA in low melting point (LMP) agarose blocks or beads as described (see Chapter 7; ref. 6). 2. Place agarose plugs in a 1% LMP agarose gel that is prepared with 0.5X TBE buffer. Place the gel in a pulsed field gel electrophoresis chamber. Set voltages and switch intervals that optimize separation of the YAC from the natural yeast chromosomes (Fig. 3). 3. After electrophoresis, soak the gel for 30-60 min in a dilute solution of ethidium bromide (0.5 ug/mL). Visualize the YAC by UV illumination. Excise the band with a clean razor blade (Fig. 3) and place the gel slice in a microfuge tube.

Silverman

150

4. Place the tube on a rotating platform. Remove TBE buffer from the sample by washmg the gel slice for a minimum of 3 h in several changes of 1.5 mL of YAC storage buffer. The gel slice can be stored at 4°C m storage buffer or digested with agarase (see step 5). 5. Aspirate the YAC storage buffer. Melt the LMP agarose gel slice by mcubating the tube at 65°C for 10-15 mm. Place the tube in a 3740°C water bath and allow for temperature equilibration (-5 mm). Add l-2 U of agarase per 100 uL of molten agarose. Incubate for at least 1 h. The DNA/ agarose solution can be stored at 4’C.

3.2. Restriction

Endonuclease

Digestion

1. If the sample has been treated with agarase (see Section 3.1.) step 5), transfer 4 uL of the DNA/agarose solution to a new tube. If the gel slice containing the gel-purified YAC DNA has not been treated with agarase, remove the YAC storage buffer and incubate the sample m a 65°C water bath for 10 min. After the LMP agarose has melted, remove 4 pL and place in a new microfuge tube. Immediately place this tube in a 37°C water bath. Total yeast DNA, in the amount of 0.0 1-O. 1 ug, can be substttuted for the gel-purified material. However, the total volume of the subsequent reaction should remain at 10 pL. 2. To the tube contammg the 4 pL YAC DNA/agarose solution, add: 4 uL H20, 1 pL of appropriate 10X restriction enzyme buffer, and 1 uL of restriction endonuclease (5-l 0 U) (see Note 2). Incubate the mixture at the appropriate temperature for l-2 h or overmght. 3. Optzonal: Heat inactivate the restriction endonuclease by incubating the mixture at 65°C for 15-30 min. Samples can be stored at 4°C.

3.3. LigationlCircuZarization 1. If the restriction mix has solidified, heat the sample to 65°C for 10 min and then place at 37°C. 2. To the 10 pL restriction mixture, add: 34 pL H20, 5 uL 1OX ligation buffer, and 1 uL T4 DNA ligase. 3. Incubate overnight at 14OC. 4. The ligation mixture can be stored at 4°C.

3.4. PCR Amplification 1. If the ligation mrxture has solidified, heat the sample to 65°C for 10 min and then place at 37°C. 2. To a PCR tube, add: l-5 pL ligation mixture, 5 pL 10X PCR buffer, 8 pL dNTP stock, 1 pL sense primer (see Note 3), 1 p.L antisense primer (see Note 3), and 33-29 uL HZ0 (total reaction volume = 50 p,L),

End-Rescue

of YAC Clone Inserts

151

1.3. 06 0.3kb

Fig. 4. RA inverse PCR products. Gel purified YAC DNA from different clones (top of lanes) was digested with HueIII, ligated with T4 DNA ligase,and amplified with primers #2 and #3. PCR fragments were visualized after agarose gel electrophoresis and ethidium bromide staining. DNA sequence analyses of the PCR fragments in the yB 125A3, y36IB 10, y39BH5, and y 13HEl lanes confirmed the presence of insert-YAC vector junction fragments (from G.

Silverman, unpublisheddata,with permission). 3. Overlay the reaction mixture with 50 pL of mineral oil and “hot start” the PCR reaction by incubating the sample at 96°C for 10 min. 4. After the 10-min hot start, deliver 1 pL (1.25 U) of Thermus aquaticus DNA polymerase to the reaction by plunging the pipet tip through the mineral oil overlay. 5. Complete 3-O thermocycles by denaturing at 94OCfor 1 min, annealing at 55-6O”C for 1 min and elongating at 72°C for 1 min. To ensure all products are double stranded, the final elongation step can be increased to 4-5 min. 3.5. Analysis of PCR Products 3.5.1, Agarose Gel Electrophoresis and DNA Hybridization

Ten microliters of the reaction mix is aspirated from beneath the mineral oil, mixed with loading buffer, and electrophoresed through a 1% agarose gel. The appearance of PCR products can be confirmed by UV illumination of an ethidium bromide stained gel (Figs. 4 and 5). To confirm the presence of appropriate PCR products, the gel can be blotted and hybridized to an end-labeled oligonucleotide probe that hybridizes to a portion of the vector arm that is internal to the primer template (Fig. 6). To confirm that human DNA has been amplified, the PCR fragments can be labeled and hybridized to Southern blots of human genomic DNA (Fig. 6).

152

Silverman

1358603310194-

Fig. 5. LA inverse PCR products. Gel-purified YAC DNAs from clonesyA27D8 and yA24E4 were digested with different restriction enzymes, ligated with T4 DNA ligase, and amplified with primers #8 and #13. PCR products were visualized after agarose gel electrophoresis and ethidium bromide staining. PCR controls included AB1380 chromosomeVI (chromosomeVI is -280 kb and copurified with yA27D8), oligonucleotide primers alone, and a 500-bp product derived from a control template and primers (3LDNA) (from ref. 5 with permission).

of PCR Products Amplification products in the remaining sample (-40 pL) can be purified by gel electrophoresis (see Note 4). Purified PCR products are subcloned into appropriate plasmid vectors for subsequentDNA sequencing. Alternatively, PCR products can be sequenceddirectly using nested primers in either a modified T7 DNA polymerase (Sequenase, United States Biochemical, Cleveland, OH) or a cycle sequencing reaction (Cyclist ExoPfu DNA sequencing kit, Stratagene,La Jolla, CA). DNA sequenceanalysis confmns the presence of a rescued terminal fragment by identification of vector arm sequencesthat flank a novel segment of DNA (Fig. 7). 3.5.2. DNA Sequencing

End-Rescue

of YAC Clone Inserts

153

Barn HI

SUP4

oligonucleotide*

A27 A24 L* L*

Fig. 6. Characterization of inverse PCR products. (Left) The DNA in the agarose gel (see Fig. 5) was blotted to reinforced nitrocellulose. The specificity of LA PCR products was confirmed by hybridizing the blot to a [32P]end-labeled oligonucleotide probe specific for the amplified segment of the SUP4 gene (sequence shown in Fig. 7). (Right) Examination of inverse PCR products for human DNA sequences.Southern blot ofBamHI-digested human DNA hybridized with [32P]-labeled PCR product from the LA of yA27D8 (A27L*) or yA24E4 (A24L*) (from ref. 5 with permission).

4. Notes 1. This purification step reduces the incidence of spurious PCR products. Moreover, this step ensures that the correct products will be isolated in the event that the yeast contain more than one YAC. 2. MboI, NZuIII, TugI, NlaIV, HaeIII, EcoRV, and RsaI restriction endonucleases can be used to obtain LA products; whereas NlaIV, ElaeIII, NlaIII, HhaI, SphI, AccI, WI, and HincII can be used to obtain RA products (Fig. 2). A separate reaction is required for each enzyme selected. 3. A single set of PCR primers can be used for each vector arm. However, it has been determined empirically that combinations of certain vector arm

154

Silverman ECORI

SUP4 Region Sense Primer internal Probe Cloning Slh 6’-WI’ ~Q~AGCCAAQTTGGTTTAAG~GCAAGACTTTAATT~TCAC~C~AATT~ATGACT~A~AGTGTTCTGAGGCTG

CTCTGGACATGCAATCTTGCATGCTTTTGTCATGACAGGTCTTAAGAAGTTTATCAGCTTTCTCAAATAGCTG

AATGACAGAACACTGGATTTTTGTTCAGATAGCCTATCAACTTGGCATCTGTGTTGCGGTTGTCACTTGGTAA

CAAGATAAGTACTTACTA~QCQATCATQGCQACCACACCCQTCCT] 3’4

YIP5 Region Anttsense

Primer

5

Fig. 7. DNA sequence of the A24L inverse PCR product. Sequence of the product obtained after TuqI dtgestton, ctrculartzation, and LA amplification of yA24E4. In this case, the correct DNA sequence of the inverse PCR product should read through the senseprimer #8, a portion of the SUP4 locus, the EcoRJ cloning site, an unknown element (the end-fragment), and the reverse-complement of primer # 13. Location of the mternal oligonucleotide probe used m Fig. 6 is between the SUP4 senseprimer #8 and the EcoRI cloning site (from ref. 5 with permission). primers and enzymatlcally digested DNA are more successful m yielding mverse PCR fragments. To obtain LA products, primer combmations #5 and #8 are used with MboI- and NZaIII-digested DNA, whereas primers #I3 and #8 are used with TaqI-, NlaIV-, HaeIII-, and EcoRV-digested DNA. To obtain RA products, primers #2 and #3 are used with NZaIV-, H&II-, NZuIII-, H/x&, and S’hI-digested DNA, whereas primers #11 and #3 are used with AccI- and HzncII-digested DNA. 4. Unused primers also can be removed by collecting the sample in a microconcentrator cup (e.g., Microcon-30, Amicon, Inc., Beverly) that excludes higher molecular weight DNA.

Acknowledgments This work was supported by grants from the National Institutes of Health (HD28475), the Hearst Fund, the March of Dimes, and the Elsa Pardee Foundation. The author thanks Kelly Ames for the preparation of the manuscript.

End-Rescue of YAC Clone Inserts

155

References 1. Silverman, G. A. (1993) Isolating vector-insert junctions from yeast artificial chromosomes. PCR Methods Appl 3, 141-150. 2 Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provitus J Vwol. 63, 1924-1928. (Published erratum appears in J, Vwol. 1990,64[6], 3 150.) 3 Trtglia, T., Peterson, M. G., and Kemp, D. J (1988) A procedure for in vitro amphfication of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res. 16,8 186. 4. Ochman, H., Gerber, A. S., and Hartl, D L. (1988) Genetic apphcattons of an inverse polymerase chain reaction. Genetics 120,621-623. 5. Silverman, G. A., Ye, R. D., Pollock, K. M., Sadler, J E., and Korsmeyer, S J. (1989) Use of yeast arttfictal chromosome clones for mapping and walking within human chromosome segment 18q21.3. Proc Nat1 Acad. SCL USA 86,7485-7489. 6. Silverman, G. A., Jockel, J. I., Domer, P H., Mohr, R M., Taillon, M. P , and Korsmeyer, S. J. (1991) Yeast artificial chromosome clonmg of a two-megabasesize contig within chromosomal band 18q2 1 establishes physical linkage between BCL2 and plasminogen activator inhibitor type-2. Genomzcs 9,219228. 7. Zuo, J., Robbins, C., Talllon, M. P., Cox, D R., and Myers, R. M. (1992) Clomng of the Huntington disease region in yeast artificial chromosomes. Hum. Mol. Genet 1,149159.

8. Groden, J., Thlivens, A , Samowuz, W., Carlson, M., Gelbert, L., Albertsen, H , et al. (1991) Identttication and characterization of the familial adenomatous polyposts coli gene Cell 66,589-600 9. Joslyn, G., Carlson, M., Thliveris, A., Albertsen, H., Gelbert, L., Samowitz, W., et al. (1991) Identification of deletion mutations and three new genes at the familial polyposts locus. Cell 66,601--613. 10. Grill, E. and Somervtlle, C. (1991) Construction and characterization of a yeast artificial chromosome library of Arabzdopszs which IS suitable for chromosome walking. Mol. Gen. Genet. 226,484-490. 11. Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in Yeast Gene&s* A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p 198

CHAPTER16

Covering YAC-Cloned DNA with Phages and Cosmids Jiannis Ragoussis and Anthony P. Monaco 1. Introduction The detailed analysis of the DNA cloned in yeast artificial chromosomes (YACs) is performed by subcloning into vectors such as phages or cosmids, which allow a simpler purification of insert DNA in addition to allowing high resolution mapping. Cosmids or phages are still a preferred DNA source for the isolation of new polymorphic markers or coding sequences. For example, the techniques used to isolate genes involve screening of cDNA libraries with whole cosmids or applying cDNA selection on immobilized cosmid DNA (1). Exon amplification is most effective when applied to cosmids (2). The combination of these resources has been instrumental in identifying disease genes like Huntington’s and Spinocerebellar Ataxia 1 (3,4). In order to generate cosmids or phages covering the YAC insert, two main strategies can be adopted: 1. The screeningof gridded chromosome-specificcosmid libraries with isolated, labeled YAC DNA (5,6) or Alu-PCR products. 2. The construction of a library using whole YAC DNA (7). This method is useful in order to generateadditional resourcesto the onejust describedor in caseswhere an orderedchromosomespecific library is not available. Also, it can be usedto fill in gaps in contigs formed in chromosomespecific cosmid libraries. From Methods in Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

157

Ragoussis and Monaco

158 2. Materials 2.1. Screening

of Gridded

Cosmid

Libraries

1. Yeast agarose plugs prepared as described m Chapter 7. 2. Pulsed-field gel electrophoresis (PFGE) apparatus, The contour-clamped homogeneous electric field (CHEF) apparatus is very suitable (e.g., CHEF DR-II, BioRad, Richmond, CA) or rotating field apparatus (e.g., Rotaphor, Biometra, Germany). 3. TBE electrophorests buffer (10X): 0.89M Tris base, 0.89M boric acid, 0.016MEDTA. 4. Low melting point (LMP) agarose (Seaplaque GTG) from FMC bioproducts (Rockland, ME). For regular agarose any electrophoresis grade ~111do. We recommend Seakem (FMC), Type V (Sigma, St. Louis, MO) or Ultrapure (BRL, Lite Technologies, Paisley, Scotland). 5. P-Agarase I (New England Biolabs, Beverly, MA). 6. Glassmilk DNA purification kit. We recommend Geneclean II from BIO 101 (La Jolla, CA). 7. Mini horizontal gel apparatus and power supply. 8. Heated blocks or water bath. 9. Thermal cycler (from Perkin Elmer-Cetus [Norwalk, CT], Techne [Cambridge, UK], or equivalent). 10. Oligo labeling buffer (OLB): Make up Solutions 0, A, B, and C as follows: a. Solution 0: 1.25M Tris-HCl, pH 8, 0.125M MgCl,. b. Solution A: Mix together 1 mL solution 0, 18 p.L P-mercaptoethanol, 5 pL 100 mM dATP, 5 pL 100 mA4 dGTP, 5 pL 100 mA4 dTTP. c. Solution B: 2M HEPES, pH 6.6. d. Solution C: 0.33 mg/mL hexanucleotides (Pharmacia, Uppsala, Sweden). Mix solutions A, B, and C in ratio 100:250: 150. 11. 10 mg/mL Bovine serum albumin (BSA) (New England Biolabs, BRL). 12. [a-32P]dCTP, 10 pCi/pL, 3000 Ci/rnmol (Amersham, Arlington Heights, IL). 13. Klenow enzyme (Escherichia coli DNA polymerase I large fragment). 14. SSC buffer (20X): 0.3MNa-citrate pH 7.4, 3MNaCl. 15. 20% SDS: 200 g/L sodium dodecyl sulfate. 16. 50X Denhardt’s solution: 1% BSA, 1% ficoll400, 1% polyvinylpyrrolidone. 17. Hybridization buffer: 6X SSC, 1OX Denhardt’s solution, 50 mMTris-HCl, pH 7.4, 1% sarkosyl (BDH), 10% dextran sulfate (Pharmacia). 18. Sonicated human placental DNA (Sigma) 10 mg/mL. 19. Alu-PCR prtmers: a. ALEl: 5’ GCCTCCCAAAGTGCTGGGATTACAG 3’. b. ALE3: 5’ CCAT/cTGCACTCCAGCCTGGG 3’.

Couering YAC-Cloned DNA 20. Amplitaq DNA Polymerase (Cetus, Roche Medical Systems, Branchburg, NJ). 2 1. PCR buffer (10X): 670 mMTris-HCl, pH 8.8, 166 mM(NH&S04 (enzyme grade), 67 mM MgClz. 22. Shaking water bath or rotating hybridization oven (available from Appligene [Illkirch, France], Hybaid or Techne [Teddington, Middlesex, UK]). 23. Plastic bags or boxes for hybridization, or special bottles if the oven is used. 24. Gridded cosmid library filters. High density library filters can be produced using a robotic device (81 or available from Gunther Zehetner, ICRF Laboratories (London). 2.2. Construction

of Cosmid

and Phage Libraries from Whole YAC DNA 1. Preparation of vector: For the cosmid library construction, the authors recommend SuperCos 1 (Stratagene, La Jolla, CA) and for the phage library construction EMBL3 or X-DASH (Stratagene). 2. Restriction enzyme buffers: The buffers recommended or supplied by the manufacturers are the best to use. For preparing the vector DNA, the authors use T4 polymerase buffer, because it IS suitable for most enzyme digests as well as calf intestinal phosphatase (CIP). 3. T4 Polymerase salts (1OX): 0.33MTris-acetate, pH 7.9, 0.66M K-acetate, 0.1OM Mg-acetate. 4. Dithiothreltol (DTT) solution at 50 mM. Store frozen. 5. BSA solution at 10 mg/mL. Store frozen. 6. Ligase buffer (10X): 0.5M Tns-HCl, pH 7.5,O. 1M MgC12, 0.3MNaCl. 7. T4 DNA hgase (New England Biolabs) at 400,000 U/mL. 8. T4 Polynucleotide kmase (New England Biolabs) at 10 U/uL. 9. TE: 10 mMTris-HCl, pH 7.5, 1 mA4EDTA. 10. 0.5MEDTA pH 8. 11. Phenol equilibrated with 0. 1M Tris-HCl, pH 8. 12. Chloroform/isoamyl alcohol 24: I. 13. Ethanol 100%. 14. CIP from Boehringer-Mannheim (Mannheim, Germany) at 1 U/uL. 15. 0.15M Trinitriloacetic acid (BDH) stored at -20°C in small aliquots. It is used to inactivate CIP. 16. Dextran T40 solution at 10 mg/mL. 17. ATP solution at 10 miI4. Store frozen. 18. In vrtro packaging extracts. The authors recommend Gigapack XL (Stratagene) for the cosmid library and Gigapack Gold (Stratagene) for the phage library.

160

Ragoussis and Monaco

19. Bacteria strains: XLI-BLUE MRA (P2 and non-P2 lysogen) for the phage library and XLI-BLUE MRA for the cosmtd library available from Stratagene. 20. NZCYM, TB, and LB media (see Chapter 29). 21 SM buffer. 10 mMNaC1,8.3 mMMgS04, 50mMTris-HCI, pH 7.5,0.01% gelatin. Autoclave to sterthze. 22. 3MM Filter paper (Whatman, Matdstone, UK) and Nylon membranes (the authors recommend Hybond-N, Amersham). 23. Denaturant solution: 1.5M NaCl, 0.5M NaOH. 24. Neutralization solutton: 1M Trts-HCl, pH 7.4, 1.5M NaCl. 25. X-ray film, cassettes,and intensifying screens.

3. Methods

1. 2. 3.

4. 5. 6.

7.

3.1 Screening of a Chromosome-Specific Cosmid Library Prepare agarose plugs and separate the YAC from the other yeast chromosomes by PFGE, as described in Chapter 7. Cut out the gel sltce contammg the YAC and purify the DNA with glassmilk by using Geneclean II kit or other equivalent product (for an alternative YAC DNA purification method, see Note 1). To radiolabel the DNA, take approx 20-50 ng of purified YAC DNA m solution (as Judged by comparison to known quantities of marker DNA on an agarose mimgel) and make up to 33 PL with water. Place in a bothng water bath for 5 mm then chill on ice. Add 10 PL OLB, 2 PL of 100 mg/mL BSA, 5U Klenow enzyme, and 3 uL [a-32P]dCTP. Incubate at 37°C for 4 h or overnight. Alternatively, labeled Alzl-PCR products from the YAC can be used as a probe (see Notes 2 and 3). Compete the human repetitive sequences prior to hybridization by making the labeled probe up to a volume of 125 PL wtth water, then addmg 250 pL of 10 mg/mL sonicated human placental DNA and 125 l.tL 20X SSC. Boll for 5 min, place on ice for 1mm, then incubate at 65°C for 30-60 mm and add to hybridization mix. Hybridize the filters overnight at 65°C and wash once in 2X SSC, 0.1% SDS at room temperature for 20 min, once m 2X SSC, 0.1% SDS at 65°C for 20 min, and twice in 0.1X SSC, 0.1% SDS at 65°C for 10 mm. The last wash can be increased to 68°C for further reduction of background signal tf required. Expose washed filters to X-ray film with intensifying screens at -70°C for 2 h to overnight.

Figure 1 shows an autoradiograph obtained from a high density cosmid grid hybridized with labeled probe from a YAC.

Covering

YAC-Cloned

DNA

161

Fig. 1. High density cosmid grid (6) hybridized with Alu-PCR products from an 800-kb long YAC. One hundred fifty individual clones have been picked. Filter kindly provided by Dean Nizetic (ICRF Laboratories, London).

1. 2. 3. 4. 5. 6. 7.

3.2. Construction of a Cosmid or Phage Library Using Whole YAC DNA (see Note 4) 3.2.1. Purtial MboI Digests of Yeast DNA in Agarose Blocks Make agarose plugs as described (Chapter 7) and wash thoroughly in TE. Set up four reactions each with one block (one block contains l-2 pg of DNA in approx 100 pL), 20 pL 10X T4 polymerase salts and 40 pL sterile water. Melt at 68°C for 10 min, then bring to 37°C. Add 20 pL BSA solution (10 mg/mL), 20 pL DTT solution (50 mM), and 0.1 UMboI. Incubate at 37OC,tube 1 for 2 min, tube 2 for 5 min, tube 3 for 10 min, and tube 4 for 15 min. Heat kill Mb01 at 68OC for 20 min and bring to 37°C. Add 3 uL P-agarase I and incubate for 2-3 h.

162

Ragoussis and Monaco

8. Add 0.1 U CIP in 40 pL 1X T4 polymerase buffer to each tube and incubate at 37OCfor 30 min. 9. Add trmimloacetic acid, pH 8.0 to 0.015Mand incubate at 68°C for 20 min. 10. Bring to room temperature and add 5 PL Dextran T40 (10 mg/mL) as carrier, Extract twice with an equal volume of phenol, once with an equal volume of chloroform, and precipitate by adding 5 PL more Dextran T40, making to 0. IA4 NaCl and adding two volumes of ethanol.

3.2.2. Ligation to EMBL3 Vector ArmslSuperCos 1 (see Note 5) 1. Resuspend the DNA pellet m IO PL TE. 2. Set up the following test ligations for each Mb01 partial digest: a. I pL DNA solution in 10 uL 1X ligase buffer, no ligase. b. 1 PL DNA solution in 10 mL 1X ligase buffer with 0.5 PL ligase. c. 1 uL DNA solution in 10 pL 1X ligase buffer with 0.5 pL ligase and 0.5 pL polynucleotide kinase. 3. Incubate at 37OC for 60 min then load on 0.3% agarose gel for analysis with lambda Hi&III and lambda SacI digests as size markers. From this gel, decide which is the best digest for phage and/or cosmid libraries. The digests with the bulk of DNA migrating between 45 and 35 kb are the most suitable. For best results use at least two different partial digest conditions. 4. Ligate partially digested DNA to vector arms: a. For phage library construction with vector arms in a 5-PL reaction: i. 0.5 PL 10X ligase buffer; ii. 0.5-l .O PL (OS-1 .O p,g) EMBL3 arms cut with BumHI and EcoRI (1: 1 ratio with insert); iii. 0.5 ltL ligase (400 U/mL); iv. 3-O-3.5 pL YAC DNA (Mb01 partial digest). b. For cosmid library construction with SuperCos 1 in a 20-PL reaction: i. 2.5 p,g YAC DNA (Mb01 partial digest); ii. 1.0 pL SuperCos 1 (1 pg/pL); iii. 2.0 uL 10X ligase buffer; iv. 2.0 p.L 10 mMATP; v. 1.OuL ligase (400 U/pL); vi. Sterile water to 20 pL. 5. Incubate at 16OCovernight or 4OCfor 2 d.

3.2.3. In Vitro Packaging of Phage Library (Stratagene) 1. Package cells and plate according to the detailed protocol provided by the manufacturer. Plate out three dilutions of the packaged material, 1 pL, 10-l pL, and 10” pL on 37-mm plates. Incubate at 37°C overnight.

Covering YAC-Cloned

DNA

163

2. Count the plaques on the 10-t plate and compare the lysogen and the nonP2 lysogen plaques. If they are comparable in numbers, then most of your plaques are recombinants. Calculate the titer of your original stock.

3.2.4. In Vitro Packaging of Cosmid Library (Stratagene Gigapack XL) 1. Package cells according to the detailed protocol provided by the manufacturer. 2. Make a 1: 10 and a 1:50 dilution in SM buffer of the packaged DNA. 3. Mix 25 PL of each dilution with 25 pL of prepared XLI-BLUE MRA cells (according to the Stratagene protocol) m a tube and let sit at room temperature for 30 min. 4. Add 200 pL of LB broth to each sample and incubate for 1 h at 37°C shaking gently every 15 min. 5. Spin tube for 30 s and resuspend the pellet in 50 PL fresh LB broth. 6. Plate the cells on Hybond filters placed on LB plates containing 50 pg/mL ampicillin and incubate overnight at 37°C. The titer should be between 1 x lo5 and 1 x lo6 transformants per mg DNA (see Note 6).

3.2.5. Filter Lifts from Phage Plaques 1. Dry the plate in a laminar flow hood for 30 min and place in the cold room for 30 min. 2. Place a dry Hybond N circle onto the plate. Pierce the membrane and agar with a 19-g needle asymmetrically several times for orientation markers. 3. After 30 s, lift the membrane and place onto 3MM paper soaked in denaturant solution for 2 min with plaque side up, 4. Repeat steps 2 and 3 with a fresh filter to generate a duplicate. 5. Move the filters to 3MM Whatman paper soaked in neutralization solution for 3 min. Do this again, then move to 2X SSC and wash, 6. Air dry, then bake and UV crosslink.

3.2.6. Preparation of Bacterial Colony Filters 1, Cool the bacteria plates for 30 min and place a nylon filter membrane on each plate. Allow to soak for 2 min. 2, Pierce the membrane and agar with a 19-g needle asymmetrically several times for orientation markers. Lift filters from plates and place onto 3MM paper soaked m denaturant solution for 5 mm (bacteria side up). 3. Place on 3MM Whatman paper soaked in neutralization solution for 5 min. Repeat on fresh Whatman and then wash in 2X SSC. Dry filters and bake/ UV crosslink.

164

Ragoussis and Monaco

Fig. 2. A phage library constructed using a 350-kb YAC clone. Five thousand clones were plated out in a 24 x 24-cm plate and screened with total human DNA. One hundred sixty clones are visible as distinct colonies, giving a theoretical lo-fold coverage of the YAC. The 11 black dots used for orientation on the film are present. The phage and cosmid filters can be used for hybridization with total

human DNA, specific repeated sequence,or single copy probes using the methods described in Section 3.1. Figure 2 shows an autoradiograph obtained from a phage library constructed from a YAC and probed with total human DNA. 4. Notes 1. The following is an alternative for the purification of YAC DNA for use as a hybridization probe. Separate the DNA in a 1% LMP agarose pulsed

field gel. Cut out the slice containing the YAC, equilibrate in TE, andmelt

Covering YAC-Cloned

2. 3.

4. 5.

6.

DNA

at 65°C. Add j3-agaraseI buffer, equilibrate to 40°C, then add 10 U/100 pL P-agarase I and incubate at 40°C for l-2 h. Phenol extract and ethanol precipitate the DNA, adding Dextran T40 or Glycogen to a final concentration of 0.1 pg/mL as carrier. Labeling ofAlu-PCR products: simply take 1 pL out of the PCR reaction (primary reaction, see Section 3.2.1. of Chapter 10) and label using the random priming method as described. Choice of probe for library screen, labeled en&e YAC DNA or Alu-PCR products? There are advantages in both. Whole YAC DNA gives a better coverage with a htgher number of positive clones. False positives will be included because of signals from rDNA sequences present in various degrees in particular chromosomes. Alu-PCR products give less positives leadmg to potential gaps, but the more limited number of clones makes the management and handlmg easier. The method described can be used for the construction of a cosmid library from any source. Chotce of vector to use for cosmid library constructton. The authors prefer SuperCos 1 because it is efficient with small amounts of DNA and the insert can be treated with CIP. In contrast to other systems, the insert can be excised with Not1 or EcoRI digests thus enabling easy mapping, subcloning, and further use for tdentttication of expressed sequences. In addition, it allows the generation of labeled RNA probes from each end for contig construction using hybridtzation approaches. How many cosmtds/phages should be plated? Not all YACs are present in storchiometrrc proportton to the other yeast chromosomes. We expect an average YAC of 650 kb to represent approx l/20 of the total DNA. One hundred sixty cosmtds would gave a theoretical 1OX coverage (average insert size 40 kb), and therefore plating out 3250 clones should be sufficient. For a 24 x 24-cm plate this number of clones should give individual colomes, provided they are evenly spread, which are easy to identify and pick.

References 1. Wei, H., Fan, W -F., Xu, H , Parimoo, S., Shukla, H., Chaplin, D., and Weissman, S. M. (1993) Genes m one megabase of the HLA class I region. Proc N&Z. Acad Sci USA 90, 11,870-l 1,874. 2. Church, D., Stotler, C., Rutter, J., Murrell, J., Trofatter, J., and Buckler, A. (1994) Isolation of genes from complex sources of mammahan genomrc DNA usmg exon amphflcation. Nature Genet. $98-105 3. Huntmgton’s Consortium (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes Cell 72,97 l-983

166

Ragoussis and Monaco

4. Orr, H., Chung, M.-Y., Banfi, S., Kwiatkowskr, T., Jr., Servadio, A., Beaudet, A., et al. (1993) Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. Nature Genet. 4,22 l-226 5. Baxendale, S , MacDonald, M., Mott, R., Francis, F., Lm, C., Kirby, S., et al. (1993) A cosmid contig and high resolution restriction map of the 2 megabase region contaimng the Huntmgton’s disease gene Nature Genet. 4, 18 l-1 86. 6. Nizetic, D., Geilen, L , Hamvas, R., Mott, R., Grigoriev, A., Vatcheva, R., et al (1994) An integrated YAC-overlap and “cosmid-pocket” map of the human chromosome 21 Hum Mol. Genet. 3,759-770. 7. Banfi, S., Chung, M.-Y., Kwiatkowskt, T., Ranum, L., McCall, A., Chmault, A , et al. (1993) Mapping and cloning of the crtttcal region for spinocerebellar ataxra type 1 (SCA 1) in a yeast artrfictal chromosome conttg spamnng 1 2 Mb Genomzcs l&627-635.

CHAPTER17 Fragmentation and Integrative Modification of YACs Jennifer W. McKee- Johnson and Roger H. Reeves 1. Introduction The very large cloning capacity of yeast artificial chromosomes (YACs) has facilitated the analysis of complex genomes by bridging physical and genetic maps. The large size of YAC inserts also creates some unique problems, including identification of novel genes on large stretches of uncharacterized DNA, creating physical maps of large genomic inserts in YACs, and localizing defined sequences within the YAC. The well-characterized and highly efficient system of homologous recombination in Saccharowlyces cerevisiae (1,) can be used to introduce additional markers (e.g., neoR cassette, polylinkers, bacterial markers) and modifications to YACs that allow these problems to be addressed. This chapter covers fragmentation and integration, two recombination-based techniques for modifying the insert DNA and vector arm sequences of YACs. Specialized vectors containing cloned repetitive elements or sequences specific to YAC vector arms can recombine with homologous sequences in the YAC (2). Repetitive sequences are ideal for recombination-based modification because they are present at a high copy number and sufficiently widespread in the genome that most YACs will contain multiple representatives of these families. From. Methods m Molecular Biology, Vol 54’ YAC Protocols Edlted by D Markie Humana Press Inc., Totowa, NJ

167

168

McKee- Johnson and Reeves 1.1. Fragmentation

Chromosome fragmentation vectors (CFVs) were designed to facilitate the generation of physical maps of yeast chromosomes (3). CFVs contain a minimal yeast telomere, a yeast selectable marker, and a mammalian targeting sequence.Pavan et al. (4) designed vectors that use human repetitive elements to target recombination to homologous sequences in the inserts of human-derived YACs. These CFVs are linearized between the telomere and targeting sequence.When introduced into yeast, one end of the vector is quickly healed into a stable telomere, while the free end is highly recombrnogenic (Fig. IA). Recombination between the targeting sequencein the vector and homologous sequenceson the YAC introduces a telomere at that site and results in loss of sequencesdistal to the site of recombmation, including the original vector arm and selectable marker (Fig. 1B). (CFVs that include a centromere will delete sequencesproximal to the site of recombination.) The result is a set of nested deletions along the YAC that can be used to orient and localize genes, eliminate chimerrc segments, generate new markers, map exons by using a cDNA to target homologous recombination, and develop restriction maps. New subclones and sequencetagged sites (STSs) of the YAC can be generated by recovery of end plasmids from deletion derivatives (see Chapter 14). The products of fragmentation are selected based on the presence of the yeast selectable marker in the CFV and screened for loss of the original YAC vector arm marker. CFVs may be centric or acentric permitting fragmentation from both ends of the YAC. Fragmentation by an acentric CFV in an orientation that deletes the centric arm of the YAC will result in acentric recombinants that will be lost because of mitotic instability. Dicentric products generated usmg a centromere-containing fragmentation vector will also be unstable. Many of the available YAC libraries have been constructed using the pYAC4 cloning vector in the yeast strain, AB 1380. AB 1380 contains several selectable markers in addition to the URA3 and TRpl auxotrophies utilized by the YAC. All of these are point mutations that revert at some frequency or, more frequently, can be corrected by gene conversion with the correspondmg selectable marker on the CFV. Where the targeting sequence in the CFV and the target on the YAC share a long stretch of homology, this background presents no problem. However, in conditions where homologous recombination is suboptimal, for example, where the

Modification

of YACs

169

polylinker

Fig. 1. Fragmentation. (A) “Generic” CFV, pBPlO3, includes a telomere, the HIS3 yeast selectable marker, bacterial ampand orz’sequences,and a polylinker for introduction of a targeting sequence (5). (B) Fragmentation of a YAC at repetitive elements using CFVs with target sequences in opposite orientations will produce a nested deletion series. target is small (e.g., when an exon in genomic sequence is targeted by a cDNA) or diverges significantly from the target sequence (e.g., many repetitive element families), it is desirable to have a nonreverting marker with no homology to the CFV. A variety of yeast strains deleted for several markers have been constructed for use in this circumstance (Table 1). The

Table 1 Used in YAC Clonmg

Yeast Straw Strain

2

Genotype

ATCC#

AB1380”

MATa

ura3-5

trpl

ade2- I

canl-I 00

lys2-I

his.5

~PH857~

MA Ta

ura3-52

trpl-A63

ade2-101

cyh2R

lys2-801

hu3-A200

leu2-Al

16628

CGY2516

MA Ta

ura3-52

trpl-A63

Iys2&02

hls3-A200

leu2-Al

74013

yPH274

MATa MATa

ura3-52 ura3-52

trpl-A63 trpl-A63

hzs3-A200 hu3-A200

leu2-Al leu2-Al

76622

ade2-101 ade2-201

%oleucme and threomne should also be included m selectwe media for growth byPH925 is yPH857 with the addlhonal mutation m SARI, see Chapter 22

20843

Modification

of YACs

171

pBP series of CFVs employ the HIS3 gene as the selectable marker for fragmentation products. To use these vectors, YACs harbored in AB 1380 are first transferred to a his3 background, such as yPH925. This can be accomplished readily using the KAR-mediated transfer protocol (8,) described in Chapter 22. The his3A200 background is advantageous because the 3-kb deletion in the HIS3 gene cannot revert or be corrected by gene conversion and therefore background is reduced. Where less stringent conditions for homologous recombination are acceptable, several CFVs are available that complement the ly.s2-801 point mutation in AB 1380 (Table 2). Fragmented YACs, selected on the basis of the CFV marker and screened for the loss of the marker on the deleted YAC arm, are separated by pulsed field gel electrophoresis (PFGE) and analyzed with probes specific for the CFV and the retained vector arm (Fig. 2A). By comparing the sizes of multiple deletion derivatives, a map of recombination sites can be assembled. Unique sequence probes can be localized on the map by typing the set of fragmented YACs for the presence or absence of hybridization. Finer scale mapping of the parental YAC is achieved through restriction mapping of the deletion derivatives. For a given restriction fragment in an acentric fragmentation series, if recombination occurs distal to the fragment, its size will be unchanged. Recombination within the restriction fragment will reduce its size, and recombination proximal to the restriction fragment will eliminate it (4). Additional inforrnation can be gained by hybridizing conventional Southern blots of fragmentation derivatives with repetitive elements (Fig. 2B). Members of the human Alu element family are present on average every 4-5 kb in the genome; therefore, a human-derived YAC insert will nearly always contain a number of Alu elements. Each YAC and its derivatives will have a “repeat sequence profile.” As the size of the deletion derivatives decreases, a greater subset of the repetitive elements will be lost. 1.2. Integration Integrating vectors (IVs) can be used to isolate YACs containing specific inserts from a library (9), to create internal deletions in a YAC by targeting recombination to noncontiguous segments of the insert DNA (10, I I), to introduce site-specific mutations by a two-step gene replacement (12), and to insert new markers into the YAC (e.g., mammalian

Table 2 Chromosome Fragmentatton Vectors Name

Vector type

Target sequence

Selectable marker

Enzymesa

Refs.

ATCC#

5

77087

5

77088 77089

Rothstem, submitted

n/a

pBP1133~

Fragmentation

(Polylinker for insertmg any targeting sequence)

HIS3

~BPl08~, pBPlOsd

Fragment&on

300 bp Human Ah element

HIS3

San

pWJ522, pWJ528

Fragmentatton

130 bp Mouse B 1 element

HIS3

SaNXiioI

pBCL

Fragmentation

300 bp Human Ah element

LYS2

SalI

6

pBlF, pBlR

Fragmentation

130 bp Mouse B 1 element

LYS2

San

Edmonson et al., submitted.

pRS3 13

Transformanon control

HIS3

7

77142

pRS317

Transformation control for LYS2 CFV

LYS2

7

77157

%&cated restriction enzyme yields hnear molecules sunable for transformation bReplaces pBP62 (4) ‘Replaces pBP63a (4) dReplaces pBP63b (4).

n/a

Modification

A

of YACs

B 23kl

45Okb 360kb 310kb

4kb

15Okb

Fig. 2. Analysis of fragmented YACs. (A) PFGE analysis of fragmentation derivatives of 450 kb YAC, 4B4, hybridized with the centric YAC arm probe (Table 3). The parental yeast strain, yPH925, contains no YAC and gives no signal with this probe. (B) EcoRI digest of successively smaller fragmentation derivatives of 4B4 hybridized with a repetitive DNA element. selectable markers) (4,1.?). In each case, an IV is linearized to expose two ends of a linear molecule with homology to sequences on the YAC. Recombination introduces a yeast selectable marker. In the specific examples used here, an IV containing a HIS3 selectable marker is targeted to repetitive elements in the YAC insert or to the YAC vector arm, depending on the enzymes used to expose the appropriate targeting sequences. Products of this recombination are selected for the presence of yeast selectable markers from both YAC arms and the IV. The result is a duplication of the target sequence with the IV selectable marker between the recombination sites (see Fig. 3 on page 176). Selected YACs are further analyzed by PFGE and generation of an “Ah profile” to confirm proper targeting and integrity of the YAC. Note that the use of different IVs for different purposes will require corresponding changes in selective medium, restriction enzymes used for analysis, and so on (Table 3). The following examples pertain specifically to pBP47 (Fig. 3A) targeted to Ah sequences or to the YAC vector arm as indicated.

Table 3 Integration Vectors Name pICL

Target sequence AmpR on centric pYAC4 arm,

Enzymea

Selection

Refs

ATCC#

ScaI

LYS2

14

77408

adds polylinker PLUS

Residual tetR on acentw pYAC4 arm, adds ampR and bacterial on

SalI

LYS2

14

n/a

pCGS990

CEN on centric pYAC4 arm,

SaZI

LYS2

15

n/a

EcoRIb

HIS3

9

77082

HIS3

28

87028

replaces entire arm and adds amplifiable CEN pBP47

AmpR on centrtc pYAC4 arm,

adds neoR cassette pDC47

PVUIC

As for pBP47 but uses a polI1 promoter for neoR

SmaIb

pLNA

300 bp human Ah element, adds neoR

NorIb ScaIC

LYS2

16

n/a

pLUNA

URA3 on acentric pYAC4 arm, adds neoR, ampR, and bacterial on

ApaI

LYS2

16

nla

PRAN4

pBR322 sequence on acentrtc pYAC4 arm, adds neoR, ampR, and bacterial on

BamHI

ADE2

17

77481

TICLU2

URA3 on acentric pYAC4 arm, adds thymldme kinase (TK) gene

HzndIII

uRA3

18

n/a

pRVl

URA3 on acentrtc pYAC4 arm, adds neoR

HzndIII

LYS2

19

n/a

PVUIC

pRV2

Human L 1 repetitive element, adds neoR

EcoRI + BumHI

LYS2

19

nfa

pLNA1

Am9 on centric pYAC4 arm, adds neoR

AatII

LYS2

20

n/a

pLNT2

Residual tetR sequence on acentric pYAC4 arm, adds neoR, ampR, and bacterial OYZ

EcolU

LYS2

20

n/a

pLNE3 1

Human Ah element, adds neoR

EcoRI

LYS2

20

n/a

a Indtcated enzyme yields lmear molecules swtable for tmnsformatlon. b Lmeanzation with tks enzyme targets human Ah sequences. c Lmeanzatlonwith this enzymetargetsam$ sequences m the centric YAC arm

176

McKee- Johnson

BUliHl

and Reeves

HIS3

B

Fig. 3. Integration. (A) The IV plasmid, pBP47, is used to insert the neoR mammalian selectable marker into YACs. This vector targets insertion to Ah sequences when linearized with EcoRI, or to the acentric pYAC4 vector arm when linearized with PvuI. (B) Integrative modification targeted to repetitive elements in the YAC insert.

2. Materials 2.1. Lithium

Acetate

(LiOAc)

Transformation

1 O.lM LiOAc: 5.01 g LiOAc in 500 mL sterile, distilled H20. Filter sterilize and store at room temperature. 2. 40% Polyethylene glycol (PEG): Bring 40 g PEG, average mol wt 3350

Modification

of YACs

177

Table 4 Probes Commonly Used for Analysis of Modified YACs Name HIS3 LYS2 uRA3 TRPI

Acentric YAC arm probe Centric YAC arm probe NeoR

(Sigma,

3.

4. 5. 6. 7. 8. 9. 10.

Plasmld

Enzvme BamHI EcuRV

Size

Refs.

ATCC#

1.7 kb

2.5 7 25

77157

25 26

77306 31344

pJJ2 17 pRS317 pJJ244 pJJ280 pBR322

PvuIIISa A

1.1 kb 0.9 kb 1.4 kb

pBR322

PvuIVEcoRl

2 3 kb

26

31344

pHIS3pol2neo

BaZIEcoRI

0.8 kb

27

n/a

4.0 kb

SmaI

EcoRI

St. LOUIS, MO) to a volume

of 100 mL in 10 mh4 Tris-HCl,

77304 77305

pH

7.5. Adjust pH to 7.5, filter sterilize (do not autoclave), and store in 10-mL aliquots at -20°C. Frozen altquots are stable for several months. Replicator and sterile velvets: A replicator can be purchased from Owl Scientific Products, Inc. (Cambridge, MA). Purchase velvet by the yard from a fabric store and cut into 13 x 13 cm squares. A dark color of velvet is preferable for seeing the yeast. Used velvets should be soaked in diluted Lysol(25 mL/L) nnmediately after each use, washed using hot water and no soap, dried, and autoclaved m alummum foil. PCI: phenol, chloroform, isoamyl alcohol (volume ratios of 25:24: 1). CI: chloroform, isoamyl alcohol (volume ratios of 24: 1) RestrictIon enzymes, various suppliers. 3MNaOAc pH 6.0 (adjusted with acetic acid). 95% Ethanol. TE: 10 mMTris-HCl, 1 WEDTA, pH 8.0. AHC and SD medium: See Chapter 29.

2.2. Analysis

of Modified

Refer to Table 4 for information mented YACs.

YACs

on probes used in analysis of frag-

3. Methods 3.1. Preparation of Vector DNA for Transformation Any type of plasmid isolation protocol that provides clean, concentrated DNA is acceptable for vector preparation.

178

McKee- Johnson and Reeves 3.1.1. CFV and IV Preparation

1. Digest 50 pg of plasmid to completion with the appropriate restriction enzyme(s) (see Table 1). Linearized vector can be stored frozen so large digests can be prepared. 2. Heat inactivate restriction enzymeper the manufacturer’s recommendations. 3. Remove a small alrquot for electrophorests to check completeness of digest. If there is any circular DNA remaining, repeat the digest. Any remaining circular DNA will transform at a high efficiency, resulting m a high background. 4. Extract digested DNA with an equal volume of PCI. 5. Extract once with an equal volume of CI. 6. Add l/10 volume 3M NaOAc and 2 volumes cold 95% ethanol. 7. Chill at least 30 min at -20°C. 8. Collect precipitate by centrifugation at htgh speed for 15 mm m a 4°C microcentrifuge. 9. Pour off supernatant and an dry pellet. 10. Resuspend m 50 pL of TE to give a concentration of approx 1 pg/pL. 11. Store at -20°C until use. 3.2. Lithium Acetate Transformation of Yeast A variety of methods are available for transformation of yeast including electroporation (21,22), spheroplast transformation (231, and lithium acetate. The lithium acetate protocol presented here is an adaptation of the protocol described by Ito et al. (24) and is technically simple, reproducible, and requires no special equipment. Transformation efficiencies are on average lO-lo3 colonies per microgram of yCP test plasmid (Table 1). 1. Inoculate 5 mL of selective media (AHC or SD + supplements) with a “matchhead” of yeast from a fresh plate. Incubate overnight at 30°C with vigorous shaking. 2. Add the 5-mL overnight culture to 45 mL of fresh selective media. Incubate 2-6 h at 30°C with shakmg. 3. Check the ODboOusing a spectrophotometer. The ideal range for this protocol is OD,,a 1-2; however, cultures with ODs as low as 0.4 can be used with a slight decrease m efficiency. 4. Transfer the culture to a 50-mL screwtop tube and collect cells by centrifugation at 2000g for 5 min at 4°C. 5. Decant the supernatant. Resuspend cells in 10 mL of 0.M LiOAc by pipetmg or gentle vortexmg.

Modification

of YACs

179

6. Collect cells by centrifugatlon at 2000g for 5 mm at 4°C. 7. Decant the supernatant and resuspend cells in 10 mL 0. IM LiOAc. Incubate at 30°C for 1 h without shaking. Alternatively, cells can be stored at 4°C overnight with no effect on transformation efficiency. 8. Collect cells by centrifugation at 600g for 5 min at 4°C. 9. Decant the supernatant and resuspend cells in 0. 1M LiOAc using a pipet. 10. Aliquot 50 pL of cells into Eppendorf tubes. 11. Add prepared vector DNA and carrier DNA as needed. Use 0.5-2.0 pg of circular test plasmid DNA (Table 1) as a transformation control. Vector concentrations should be titrated (see Note 1). 12. Incubate 10 min at room temperature. 13. Add 0.5 mL of 40% PEG, pH 7.5 that has been warmed to room temperature. Always use a fresh aliquot of PEG; pH is cntical. 14. Mix by vortexing or repeated inversion. 15. Incubate 1 h at 30°C. 16. Heat shock in a 42’C water bath for 5 min. This step 1sessential(see Note 2). 17. Top off tube with sterile, distilled H,O. Mix by inversion. 18. Collect cells by centnfugation at high speed for 5 s in a microfuge. 19. Decant supematant and resuspend cells in 1.OmL sterile, distilled H20. 20. Collect cells by centrifugation at high speed for 5 s in a mlcrofuge. 21. Decant supematant. Resuspend cells m 0.1 mL sterile, distilled HzO. 22. Spread each 100 PL of cells on a 100-mm selective plate (e.g., when using a pBP 100-series CFV, use an appropriately supplemented SD plate lacking histidine). At this step, select only for the CFV or IV marker, not the YAC markers. Incubate inverted at 30°C. Colonies should be visible in 2-5 d (see Notes 2 and 3). 3.3. Identification of Fragmented YACs 3.3.1. Auxotrophic Analysis 1. Using sterile toothpicks or an inoculating loop, pick colonies onto a plate that selects for the presence of the CFV marker and the retained YAC vector arm marker (U&I3 or TWI). 2. Incubate overnight at 30°C. 3. Use a replicator to plate colonies onto a plate that selects for the lost vector arm marker. This step is essential as up to 30% of colonies may possessall three markers. 4. Incubate overnight at 3O’C. 5. Select for expansion and further analysis those colonies showing the appropriate auxotrophies/prototrophies (see Note 4).

180

McKee-Johnson

and Reeves

3.4. Analysis of Fragmented YACs Fragmented YACs are analyzed by PFGE to determine the sizes of deletion derivatives and to assurethat each strain contains only one YAC, and by probing conventional Southern blots with repetitive elements (human Alu or mouse B 1 elements) to confirm that each fragmented YAC is a member of a nested deletion series. 3.4.1. PFGE Analysis

Refer to Chapter 7 for information on making high mol wt DNA plugs and performing PFGE. Select PFGE conditions that will yield the greatest separation of fragments smaller than the parental YAC. Some fragmentation derivatives may be visible under UV light after ethidium bromide staining; however, others may be obscured by comigrating yeast chromosomes. Transfer of the large DNA fragments to filters is facilitated by treatment of the gel with 0. 1N HCl for 20 min prior to denaturation. PFGE blots of CFV derivatives should include the unfragmented YAC and parental yeast strain without a YAC, and are analyzed using the following probes (Table 4) in the order listed (see Note 5). 1 Probe 1: Selectable marker from the retained YAC vector arm. Thus probe will hybridize to the mutant endogenous gene as well as the fragmented YACs. Hybridtzatton to the parental (unfragmented) YAC permits better comparison of size changes and determination of the number of YACs. 2. Probe 2: CFV marker (e.g., the HIS3 gene for the pBP-100 series vectors). This probe should colocahze with the vector arm marker indicating proper targeting of the CFV to the YAC. 3. Probe 3: Deleted YAC vector arm marker. This probe should only hybridize to the parental YAC and, depending on the probe and strain, to the endogenous yeast gene. 4. Probe 4: Sequences specttic to the YAC insert (unique or repetitive elements). The presence or absence of hybridization of these probes to a panel of fragmentation dertvattves can be used to localize and orient unrque sequences on the YAC, whereas repetitive sequences should identify all but the shortest dertvattves. 3.4.2. Repeat Sequence Profile by Conventional Southern Blotting

Refer to Chapter 7 for information on restriction digestion of high mol wt DNA prepared in agarose plugs (see Note 6).

Modification

of YACs

181

1. Digest DNA from CFV products to completton (2-16 h) with a 6-base cutter restriction enzyme. Include DNA from the parental YAC and the background yeast strain without a YAC as controls. 2. Separate the restrictton fragments on a 1% agarose gel. 3. Denature, neutralize, and transfer to nylon or nitrocellulose membrane. 4. Probe with repetitive elements. 3.5. Integrative

Transformation

Vectors are prepared as described in Section 3.1. using appropriate restriction endonucleases (Table 3). Lithium acetate transformation is accomplished as described in Section 3.2. At step 11, use 2-5 pg of pBP47 linearized with EC&I (to target integration to AZu elements) or PvuI (to target integration to plasmid sequences in the centric arm of pYAC4). 1. 2. 3. 4. 5.

3.5.1. Auxotrophic Analysis Using a sterile toothpick or inoculating loop, pick colonies onto a plate that selects for the presence of the IV marker and the U&t3 gene from the YAC vector arm. Grow overnight at 30°C. Replicate colonies onto appropriately supplemented SD plates lacking htstidine, tryptophan, and uracil. Grow overnight at 30°C. Colonies that exhibit all three prototrophies should be selected for further expansion and analysis. 3.5.2. PFGE

Protocols for making high mol wt DNA plugs and PFGE are provided in Chapter 7. PFGE conditions should be selected to expand the region of the electrophoretic karyogram including the YAC. The gel should be blotted and analyzed with the following probes (Table 4) (see Note 7). 1. Probe 1: U.3 or TRPl. These probes will hybridize to the parental as well as modified YACs; the sizes should all be approxrmately the same. 2. Probe 2: IV marker. This can be the yeast or mammalian selectable marker. This probe will hybridize only to targeted YACs and the signal should colocalize to the same position as the UK43 and TRPl probes. 3.5.3. Conventional Southern Analysis

Refer to Chapter 7 for restriction endonuclease digestion of high mol wt DNA plugs. IVs can be targeted to repetitive elements within the YAC

McKee- Johnson and Reeves

182

insert or to sequences in the YAC vector arm. Both cases will be considered here using pBP47 as an example. 1. Digest the high mol wt plug DNA with BamHI, with CZaI, and with a third enzyme that provides a good Alu profile of the YAC. Controls include DNA from the background yeast strain and cells containing the parental Y AC. 2. Separate restriction fragments on a 1% agarose gel. 3. Denature, neutralize, and transfer to nylon or nitrocellulose. 4. Hybridize with the following probes (Table 4): a. Probe 1: TRPI. This probe is mformative for the CM digest of YACs with pBP47 targeted to the YAC vector arm. A YAC made m pYAC4, digested with &I, and hybridized with TRPl, will give a 5.9-kb band. Integration of pBP47 mto the TRPI arm of pYAC4 will cause this band to shift to 12 kb, mdicating proper targeting of the IV. If a band shift occurs for this probe when targeting pBP47 to repetitive elements improper integration has occurred. b. Probe 2: IV specific probe. For pBP47, this can be either the yeast (‘15’31 or mammalian selectable marker (neoR). BumHI digests of strains from pBP47 targeted to repetitive elements will yield a 6.1-kb band representing most of the IV when integration is targeted to an Ah sequence (or sequences). c. Probe 3: Ah (repetitive) element. Alterations to the AZu profile should be minimal. If the IV is targeted to repetitive elements, restriction enzymes that cut in the IV should yield two new Alu-containing fragments because integration reduplicates the target sequence but changes the restriction sites around both. (Note that these can be the same size as one of the original Ah profile bands and thus may not be obvious.) An enzyme that does not cut IV or Ah sequences will give an AZu profile with a size change in only one Ah element. If pBP47 IS targeted to the vector arm, there will usually be no change in the repetitive element profile beyond the addition of the Alu element in the IV. Loss of several bands from the Ah profile suggeststhat each end of the ltnearized vector targeted a different Alu element, deleting the intervening sequence. These YACs should be discarded (see Note 8) 4. Notes 4.1. Lithium Acetate Transformation 1. Titration of vector: The optimal amount of linearized CFV or IV used in

eachtransformation serieswill vary between strains and transformations. A range of concentrations including 0.5, 1, 2, and 5 pg per reaction is

Modification

of

YACs

183

recommended. For smaller amounts of vector (<3 pg), 1 uL of 10 mg/mL sheared salmon sperm DNA should be included as a carrier. 2. No colonies: If no colonies are obtained on the positive control plate, there are several possible explanations. First, check the pH of the 40% PEG. PEG that has a pH too far above or below the ideal pH of 7.5 can affect transformation efficiency. This may be owing to changes m the interaction between the PEG and lithium acetate at less than optimal pH. Omitting the 5-min incubation at 42°C will also give low to nonexistent transformation efficiencies. Additionally, check the control DNA to make sure it is intact and at an appropriate concentration. The optimal range for control circular DNA is 0.5-2.0 pg; too much DNA appears to lower efficiencies. 3. Colonies on negative control plates: A small number of colonies on negative control plates is acceptable, especially if using a selection paradigm based on a point mutation. If the number of colonies is substantial, the experiment should be discarded, and sources of contamination should be examined.

4.2. Analysis

of Transformants

4. Auxotrophic screens: Some colonies may screen positive for the “lost” marker in addition to the retained vector arm marker and fragmentation vector marker. This may be the result of transformation of circular DNA stemming from mcomplete digestion of the vector or recircularization of vector on entering the cell. Another possibility is a gene conversion event between the vector sequences and homologous sequences in the yeast genome, This is a special concern when the target sequence is small and divergent from the insert DNA. Finally, the parental YAC may be reduplicated after fragmentation (described herein). 5. PFGE analysis: Small deletion derivatives (~100 kb) are likely to be underrepresented for two reasons. First, very small YACs are frequently unstable. Second, recombination events mvolvmg mtegration of the acentric CFV close to the centric end of the YAC (or vice versa) sometimes result in generation of a small deletion derivative with reduplication of the parental YAC (phenotype: Ura+Trp+His+). Cells with this phenotype are discarded in the original auxotrophy screen because most will contain an intact YAC plus a recircularized CFV. Small deletion derivatives can sometimes be found by screening this class of transformants. Alternatively, fragmentation with a centric CFV will provide appropriate products for mapping deletion derivatives that are nested from the other end of the YAC. 6. Analysis of repetitive element profiles: In some cases, the number of repetitive elements may appear too numerous for a small YAC. This may

184

McKee- Johnson and Reeves be the result of the repetitive element content of a larger YAC masking the content of a smaller YAC. The strain grvmg such a result should be evaluated for the presence of two YACs by PFGE.

4.3. Analysis

of Transformants

Afier

Integration

7. PFGE: In some casesthe IV marker may not comigrate with the YAC as determined by probing with YAC vector arm markers. If the IV marker is absent, the strain may have reverted at the yeast genomic copy of the IV marker. This is more likely using one of the selection paradigms based on a pomt mutation. Strains lacking the IV marker or possessing a marker that does not comigrate with the YAC should be disregarded. Integration of multiple copies of the IV may be distinguishable as increased stze of the YAC by PFGE, depending on the size of the YAC, the number of copies Inserted, and the electrophoresrs conditrons. 8. Southern analysis: Expected alterations to restriction fragments in the vector are descrrbed m the precedmg. Occasionally, multiple head-to-tail concatamers of the IV may be present in the YAC (18). Each instance must be assessedto determme whether this occurrence will be deleterious to the planned experiments. Repetitive element profiles of IV-modified YACs should resemble the parental YAC pattern with only small changes (described m Section 3.) resulting from the integration events. Radical changes in patterns (mtssmg bands, drastic size changes) may reflect rearrangements of the YAC and should be discarded. References 1. Orr-Weaver, T., Szostak,J., andRothstem,R. (1983) Geneticapplicationsof yeast transformation with linear andgappedplasmids.Methods Enzymol. 101,228-245 2. Reeves,R. H., Pavan,W. J , and Hieter, P. (1990) Modification and manipulation of mammalianDNA cloned asyeastartificial chromosomes.Genet Anal Tech& Appl 7, 107-l 13. 3. Vollrath, D. M., Davis, R W., Connelly, C., and Hieter, P. (1993) Physicalmapping of large DNA by chromosomefragmentation.Proc. Natl. Acad. Set. USA 85, 6027-603 1. 4. Pavan, W. J., Hieter, P., and Reeves,R. H (1990) Generationof deletion derivatives by targeted transformation of human-derived yeastartrficial chromosomes. Proc Nat1 Acad, SCI. USA 87,1300-1304

5. Pavan, W. J., Hieter, P., Sears,D., Burl&off, A , and Reeves,R. H. (1991) High efficiency yeastartificial chromosomefragmentation vectors. Gene106, 125-127. 6. Lewis, B. C., Shah,N P.,Braun, B S.,andDenny, C T. (1992) Creatronof a yeast artificial chromosomefragmentation vector basedon lysine-2. GATA 9, 86-93. 7. Sikorski R S. and Hieter, P. (1989) A systemof shuttle vectors and yeast host strainsdesigned for efficient manipulation of DNA in Saccharomyces cerevwae Genetics 122, 19-27.

Modification

of YACs

8. Spencer, F., Hugerat, Y., Simchen, G., Hurko, O., Connelly, C., and Hieter, P. (1994) Yeast karl mutants provide an efficient method for YAC transfer between strains. Genomtcs 22, 118-126. 9. Pavan, W. J. and Reeves, R H (199 1) Integrative selection of human chromosomespecific yeast arttfictal chromosomes. Proc Natl. Acad Sci USA S&7788-7791 10. Pavan, W. J., Hieter, P., and Reeves, R. H. (1990) Modification and transfer mto an embryonal carcinoma cell line of a 360 kb human-derived yeast artrficial chromosome. Mol. Cell Biol 10,4163-4169. 11 Das Gupta, R., Morrow, B , Marondel, I., Parimoo, S., Goei, V., Gruen, J., et al (1993) An integrated approach for rdentifymg and mapping human genes. Proc. Natl. Acad Sci. USA 90,4364-4368. 12. Winston, F., Chumley, F., and Fink, G. R. (1983) Evtctrons and transplacement of mutant genes m yeast. Methods Enzymol. 101,21 l-228. 13. Pachnis, V., Pevny, L , Rothstein, R., and Constantim, F. (1990) Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevisiae into mammalian cells Proc Nati Acad. Scz USA 87, 5 109-5 113 14. Hermanson, G G., Hoekstra, M. F , McElligott, D C., and Evans, G A (1991) Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res 19,4943-4948. 15. Smith, D. R., Smyth, S. P , Strauss, W. M., and Moir, D. T. (1993) Incorporation of copy number control elements into yeast artificial chromosomes by targeted homologous recombination. Mammal. Gen 4, 141-147. 16. Davies, N. P., Rosewell, I. R , and Bruggemann, M. (1992) Targeted alterations in yeast artificial chromosomes for inter-species gene transfer. Nuclezc Acids Res 20, 2693-2698.

17. Markie, D., Ragoussis, J , Senger, G., Rowan, A , Sansom, D., Trowsdale, J , et al (1993) New vector for transfer of yeast artificial chromosomes to mammahan cells. Somatic Cell Mol Gen 19, 161-169. 18. Eliceiri, B., Labella, T , Hagino, Y., Srivastava, A K , Schlessinger, D , Ptlia, G., et al. (199 1) Stable integration and expression in mouse cells of yeast artificial chromosmes harboring human genes Proc. Natl. Acac Set USA 88, 2179-2183. 19. Srtvastava, A. K. and Schlessinger, D. (199 1) Vectors for insertmg selectable markers m vector arms and human DNA inserts of yeast artificial chromosomes (YACs). Gene 103,53-59. 20. Riley, J. H. , Mot-ten, J. E. N., and Anand, R. (1992). Targeted mtegration of neomycin into yeast artificial chromosomes (YACs) for transfection mto mammalian cells. Nucleic Aczds Res. 20,297 l-2976. 2 1. Karube, I., Tamiya, E., and Matsuoka, H (1985) Transformation of Saccharomyces cerevtsiae spheroplasts by high electric pulse. FEBS Lett 182, 90-94. 22. Simon, J. and McEntee, K. (1989) A rapid and efficient procedure for transformation of intact Saccharomyces cerevisiae by electroporation. Biochem. Btophys Res Commun. 164,1157-l 164. 23. Hinnen, A., Hicks, J., and Fink, G. (1978) Transformation of yeast. Proc Natl. Acad Sci. USA 75, 1929-1933.

186

McKee- Johnson and Reeves

24 Ito, H., Fukuda, Y , Murata, K., and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cattons. J Bacterzol 153, 163-168 25. Jones, J. and Prakash, L (1990) Yeast Saccharomyces cerevzszae selectable markers in pUC 18 polylmkers Yeast 6,363-366 26. Burke, D T , Carle, G. F, and Olson, M. V. (1987) Cloning large segments of DNA mto yeast by means of artifictal chromosomes. Science 236,906912. 27 Lamb, B. T., Sisodia, S S , Lawler, A. M., Slunt, H H., Kitt, C. A., Keams, W. G., et al. (1993) Introduction and expression of the 400 kilobase amylotd precursor protein gene m transgemc mace. Nat Gen. 5,22-30. 28. Cabm, D E , Hawkins, A., Griffin, C , and Reeves, R H. (1995) YAC transgemc mace in the study of the genetic basts of Down Syndrome. Progr. Clzn Bzol Res (in press)

CHAPTER

18

Targeting Mutations to YACs by Homologous Recombination Karen

Dufand

CZare Huxley

1. Introduction There are innumerable instances when one wants to manipulate cloned DNA: point mutagenesis for analysis of protein function and transcription factor binding sites, introduction of insertions to produce fusion proteins or to introduce reporter genes or motifs, and creation of deletions to define functional regions of proteins. One of the advantages of cloning in yeast artificial chromosomes (YACs) is that the DNA is maintained in the yeast host where one can carry out sophisticated and subtle mutagenesis with ease. Simple manipulations, such as the insertion of a mammalian selectable marker into the arm of the YAC, can be carried out by a single step integration or replacement as described in Chapter 17. However, two rounds of recombination can be used to make more subtle mutations such as point mutations. The combination of bemg able to create transgenic mice with YAC DNA and to manipulate the YAC DNA before transfer opens up a power&l new angle on transgenic mouse research. The large size of YAC inserts means that very often they contain intact mammalian genes with all the flanking DNA and introns needed for full levels of expression wherever the DNA integrates into the genome. This fidelity of expression has now been demonstrated for several YACs carrying large mammalian genes or gene clusters, including the human P-globin cluster where several of the mice produced expressed high levels of the human From Methods m Molecular B/ology, Vo/ 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

187

Duff and Huxley genes and the transgenes were correctly controlled in a developmental and tissue specific manner (1). The combination of the ability to make transgenic mice carrying YAC DNA with the ability to manipulate the YAC before transfer means that mice expressing mutated genes in a fully controlled fashion can be produced. The methods for manipulating DNA in the yeast host are well established and have been widely used in yeast genetics. In this chapter the authors describe pop-in/pop-out as applied specifically to YACs. A more thorough coverage of the methods as applied to yeast in general can be found elsewhere (2,3). There are not many reports of such manipulations of YACs (4-6) largely because the methods for reintroduction into cells in tissue culture and into mice have not been available. These methods are now well established (Chapters 24-26) and the ability to introduce fine mutations into YACs is likely to become widely used. Barton et al. described introduction of an insertion of 17 bp into the PA-globin gene on a cosmid-size YAC carrying the chicken P-globin genes (4). Duff et al. described the introduction of a specific pathogenic point mutation found in families affected by early onset Alzheimer disease into the amyloid precursor protein (APP) gene on a YAC (5). In both of these cases the URA3 gene was used for the positive and negative selection steps of pop-in/pop-out recombination. Ketner et al. first cloned the entire functional adenovirus genome as a YAC and then used pop-in/ pop-out to delete part of the E3 gene to form an adenovirus expression vector (6). In each case, the functional unit of DNA was too large to be conveniently manipulated in vitro; the chicken P-globin cluster spans 38 kb, the APP gene spans 400 kb, and the adenovirus genome is 36 kb in size. 1.1. Pop-InlPop-out

In this chapter the authors describe the procedure called pop-in/popout, which allows one to introduce insertions, deletions, or point mutations into the YAC. The procedure was first used by Scherer and Davis to introduce both a 150-bp deletion and a 2.55kb insertion into the HIS3 gene in yeast (7). The procedure is outlined in Fig. 1, where v indicates a very small mutation in the region of homology that will be introduced into the YAC. Variations are shown in Fig. 2 that indicate how one would make an insertion or deletion by the same method.

Targeting Mutations

to YACs

189

URA3

3 YAC POP-IN

YAC

P

OP.OUT

URAJ

f&--J

1 b

-w 3

2 4 4

YAC

Fig. 1. Overview of pop-in/pop-out strategy. At the top is shown the pop-in plasmid carrying the U&43 gene and a region of homology including the mutation (v). After linearization at the unique cut site, this plasmid is transformed into the YAC containing yeast strain and can integrate into the YAC (pop-in). The reverse recombination event (pop-out) occurs at relatively high frequency. Depending on the position of the recombination event, the mutation is either left in the YAC (a) or is lost from the YAC (b).

As indicated in Fig. 1, a plasmid is constructed that carries the VRA3 selectable marker and a region of homology to the YAC that carries the mutation to be introduced onto the YAC. The plasmid is linearized within the region of homology (cut), transformed into the YAC-containing yeast

Duff

190

and Huxley

URA3

A

1

X

2 YAC POP-IN/POP-OUT

YAC

URA3

B

1&

deletion

2 YAC

POP-IN/POP-OUT

YAC

Fig. 2. Use of pop-in/pop-out to introduce (A) an insertion or (B) a deletion in a YAC. The sequence of events is the same as in Fig. I, but large insertions or deletions are made depending on the arrangement of DNA fragments in the original plasmid.

Targeting Mutations

to YACs

strain, and the U&43 gene on the plasmid is selected. As the plasmid does not contain an autonomously replicating sequence (ARS) it is maintained in the yeast by integration. High frequency integration into the region of homology is directed by the cut ends of the DNA. Transformants that are shown to have the mutation correctly integrated into the YAC are then plated out onto plates containing 5fluoroorotic acid (5-FOA) that selects against the URA3 gene. Colonies that grow on the 5-FOA plates include those where the URA3 gene has been excised (pop-out) by homologous recombination between the repeated regions of homology flanking the URA3 gene. Depending on which side of the mutation the pop-out recombination event occurs, the mutation will either be left in the YAC or will be removed with the URA3 gene, leaving the YAC as it was originally. 1.2. Positive

and Negative

Selection

in Yeast

The introduction of subtle mutations requires positive selection to introduce the mutation and negative selection to remove the positive selectable marker. This can be carried out using the UK43 gene that is the most commonly used marker and the one described here. In ura3 mutant strains, such as AB1380 the most common host for YACs, the UK43 gene can be positively selected for by growth on plates lacking uracil; the gene encodes orotidine-5’-phosphate decarboxylase which is an essential enzyme in uracil biosynthesis. The UK43 gene can also be selected against by growth on 5-FOA, which is converted to a toxic product by the URA3 decarboxylase. Other markers that can be selected against in yeast are LYS2, CANI, and CYHl and the use of these markers is described in full in ref. 3. In summary, LYS2 can be selected for with -1~sdrop-out media and against with a-aminoadipate as the nitrogen source. In can1 strains (e.g., AB1380) the CANI gene can be selected against using canavanine in the absence of arginine. However, one generally needs a separate positive selectable marker to introduce the CAM gene that can only be selected for directly in Arg- strains. This can be achieved using a dual cassette,such as the CAN1 gene linked to the LEU2 gene (3), but this would require the transfer of the YAC into a leu2 strain. In cyhd mutant strains (not AB 1380) one can select against the wild-type CYH2 gene with cycloheximide but again a positive marker is needed to introduce the CYH2 gene in the first place.

Duff and Huxley 1.3. Knocking Out the URA3 Gene on the YAC Most YAC libraries have been constructed with the URA3 gene as the selectable marker on one of the arms of the YAC. In order to use URA3 as the selectable marker for the pop-in/pop-out, it is necessary to knock out the gene on the YAC, One can select directly for YACs that have mutated the URA3 gene without the rest of the YAC being affected (8), one can retrofit the YAC using the vector pRV1 (9) or pRAN4 (IO), or one can make a new retrofitting vector that will specifically inactivate the U&43 gene. To get YACs that no longer carry a functional URA3 gene, a culture of yeast containing the YAC is grown overmght in -trp media that selects for the YAC (if TRPI is located on the left arm) while allowing loss of the URA3 gene. One hundred microliters of this culture and of dilutions are spread on -trp plates containing 5-FOA (see Section 2.). Yeast colonies which grow do not have a functional URA3 gene, though this should be checked by transferring colonies to a -ura plate where they should not grow. It is then absolutely necessary to screen about six colonies for ones that have not been otherwise rearranged. The YAC should still be the same size as the original YAC by pulsed field gel electrophoresis (PFGE), and should have the same long range restriction map. Although about half of the colonies obtained will contain apparently unrearranged YACs, it is hard to be sure that the YAC has not undergone other mutations and this is the major drawback of this method. The vector pRV1 replaces some of the URA3 gene on the right arm of the YAC with the yeast selectable marker LYS2 and at the same time inserts the neomycin resistance gene (~9~) under the control of the mouse metallothionem promoter. pRV1 is linearized with Hind111 and transformed into the yeast containing the YAC (see Chapter 17). The transformation mix is plated out on -1~splates to select for transformants which have integrated pRV1. Transformants are subsequently replica plated onto -trp, and -ura plates (separately); those that contain the YAC grow on -trp plates and those that have undergone the required recombination do not grow on -ura plates. Approximately six of the phenotypitally correct transformants should be checked by PFGE to determine that the YAC is of the right size and carries the neo’gene on the YAC (see Note 1). Although retrofitting with pRV1 works effectively for the purpose of knocking out the URA3 gene, it introduces a LYS2 gene onto

Targeting Mutations

to YACs

193

the YAC and LYSZ cannot then be subsequently used for retrofitting the YAC. This is not a problem if the neo’gene on pRV1 is good for the anticipated experiments, however if transfer into ES cells is required then the promoter on pRV1 is not as good as the PGK or TK promoters used on other retrofitting plasmids. Other commonly used retrofitting plasmids such as pLUNA (11) that integrate into the URA3 gene leave a functional MA3 gene on the YAC and hence cannot be used in this context. pRAN4 replaces the right arm of the YAC (including the UM3 gene) with the yeast selectable marker ADE2 and the neo’ marker driven by the SV40 promoter. Yeast transformed with pRAN4 are selected on -ade plates and then replica plated to -trp and -ura plates. The correctly retrofitted YAC strains should be Ura-, Trp+, and Ade+ (white) (see Note 2). As pRAN4 uses the ADE2 selectable marker, this leaves the strain Lysand retrofitting vectors, such as pLUNA, can be used subsequently to retrofit with a neo’ gene suitable for use in ES cells. One phenomena that has been observed in two instances (10,11) is that yeast strains occasionally stably contain two copies of the same YAC. In this case, transformants will be positive for the introduced marker but will not be Ura-, as the strain will contain two YACs, one Ura- and the other Ura+. Usually it will be possible to isolate Ura- colonies from such strains simply by screening a hundred or so colonies, but it may be necessary to separate the YACs by sporulation (12), kar transfer (13,14), or retransformation (IS). 1.4. Making

the Pop-In

Construct

The starting plasmid for pop-in/pop-out is a yeast integration plasmid carrying URA3 or one of the other positive and negative selectable markers mentioned earlier. A convenient plasmid is pRS406 (Stratagene [La Jolla, CA] catalog number 217406), which is based on bluescript and has a large polylinker for cloning into (16). A region of DNA containing the mutation, insertion, or deletion of interest is cloned into the polylinker of pRS406. For a small mutation, the cloned region should span the mutation and also contain a unique restriction site so that the final plasmid can be linearized before introduction into the yeast. The region of homology should be large enough so that there are a few hundred basepairs on either side of the cut site. The restriction site should be more than about 50 bp from

Duff and Huxley the mutation, as a smaller space leads to a higher frequency of the mutation not being incorporated into the YAC but rather being lost by gene conversion during the pop-in step. The ratio of pop-out events that leave the mutation in the YAC to events where the mutation is lost is largely determined by the relative sizes of the regions of homology on either side of the mutation. For insertions and deletions, two regions of homology, either flanking the insertion as shown m Fig. 2A or bringing together the two sides of the region to be deleted as shown in Fig. 2B are cloned into pRS406. One region of homology should contain a unique restriction site for linearization before introduction into the yeast and the site should be at least a couple of hundred basepairs from either end of the region of homology. The second region of homology should be at least as large as the one with the restriction site to get a high frequency of pop-out events that leave the insertion/deletion in the YAC. If the mutation to be introduced into the YAC is a naturally occurring mutation and DNA from a patient is available, one can conveniently amplify and clone the region using PCR. Restriction enzyme &es present in the primers of the PCR can be used to clone directly into the polylinker. For mutations that are not naturally available it 1s necessary to engineer the desired fragment possibly by in vitro mutagenesis or PCR using internal primers that carry the mutation. The frequency of homologous recombination is increased with larger regions of homology. For point mutations the regions can be Just a couple of hundred basepairs, but for deletions or inSertions of several kilobasepair larger regions should be used and a considerable amount of screening may be necessary to get the desired recombinant.

2. Materials 1. Drop-out media: See Chapter 29 for the fortnulatlon of SC and drop-out media. Bio 101 (La Jolla, CA) sell supplement mixtures, for example, their -1~smix, is cat. no. 10434-10. 2. 5-FOA drop-out plates: Take the ingredients necessary for 100 mL of the appropriate drop-out medium excluding agar (see Chapter 29) and make up to Just 50 mL with water. Add 0.1 g S-FOA (5-fluoroorotic acid, Sigma [St. LOUIS,MO] cat. no. F5013 or the Genetics Society of America), stir well until dissolved, and filter sterilize. Autoclave 2 g agar m 50 mL water, brmg both solutions to 5O”C, mix, and pour plates. This makes about three plates and is economical m the use of 5-FOA, which is very expensive.

Targeting

Mutations

to YACs

195

3. Methods 3.1. Colony PCR of Yeast Strains The quickest way to determine whether a specific DNA sequence is present in a YAC strain is to do PCR directly on yeast. A PCR reaction mix (1 O-50 pL) is set up without any template and yeasts are added by touching a pointed toothpick to the surface of a yeast colony and then twiddling it in the reaction mix.

3.2. Pop-In The following procedures are described for a YAC carrying the LYS2 marker and lacking a functional URA3 gene, as would be obtained if pRV1 were used to knock out the URA3 gene on the YAC. In other cases, the YAC may carry other markers and selection for the YAC should be maintained accordingly. 1. Transform the YAC-containing yeast strain with lmearized plasmid. Plate out onto SC (-ura) plates and grow for 3 d at 30°C (see Note 3). 2. Pick colonies onto a SC (-1~s) plate that selects for the YAC and that will be a master plate for analysis of the different colonies. In many colonies, the insertion plasmid will have integrated correctly into the YAC but it is necessary to screen individually to determine that the mutation has been integrated onto the YAC and that the YAC is still intact (see Note 4). 3. Carry out colony PCR on individual colonies to determine whether the mutation has been incorporated as expected mto the YAC DNA. This could be done with primers 1 and 2, as shown in Fig. I, where primer 1 is specific for the mutation or the PCR product could span the mutation that can then be detected by SSCP or sequence analysis. Alternatively diagnostic restriction digestion of DNA followed by Southern blotting can be used to determine whether the mutation has been inserted correctly. 4. Prepare plugs of two or more positive YAC strains and compare on a pulsed field gel (see Chapter 7) with the original YAC to determine that no change in size has occurred (see Note 5).

3.3. Pop-Out 1. Inoculate 5 mL of SC (-1~s) media with a colony of pop-m yeast and grow overnight at 30°C with shaking. The culture should then be saturated. The media will select for maintenance of the YAC, whereas recombination will occur m some of the yeasts during growth without selection for W&43.

Duff and Huxley 2. Spread 100 pL of the culture and 100 pL of 1 m 10 and 1 m 100 dilutions of the overnight culture on to SC (-1~s) plates supplemented with 1 mg/mL 5-FOA. The lack of lysme selects for the presence of the YAC, whereas the 5-FOA selects for those cells where the URA3 gene has been lost (see Note 6). 3. Incubate at 30°C for 3 d or until the colonies have grown up. 4. Pick about 20 colonies onto a SC (-1~s) plate and grow at 30°C. This is a master plate to which you can return once the correct colonies have been identified. It is necessary to determine at this point whether the mutation is present on the YAC, whether the pop-out has actually occurred, and whether the YAC is otherwise unrearranged. 5. Carry out colony PCR to detect the presence of the mutation (primers 1 and 2) and to determine that it is surrounded by the correct YAC sequence on both sides (primers 3 and 4). This can also be done by diagnostic restriction digestion and Southern blotting (see Note 7). 6. Make plugs from single colonies and separate the chromosomes on a pulsed field gel to determine whether the YAC is still the same size as the original. Also, carry out diagnostic digestions to check that no other mutations have occurred to the modified YAC. 4.

Notes

1. A proportion of transformants obtained with pRV1 are Trp+, Lys+, Ura+, and have not undergone the expected recombmation. This is not owing to integration mto the chromosomal ura3-52 allele (unpublished data). However, the majority of Trp+, Lys+, and Ura- transformants have undergone the wanted recombination. 2. The use of pRAN4 relies on the host yeast being ade2 mutant. Thts is generally true for AB 1380, but revertants do arise, especially if the yeast is grown in media containing limiting (10 mg/L) amounts of adenine. Mutant ade2 strains are red in limiting adenine unless they are petites that we find quite frequently in YAC libraries. If adenine is added to 40 mg/L, the yeast do not go dark red, grow to higher densities, and there is less selection for revertants. 3. It does not matter what method is used to transform the yeast strain, LiAc transformation as described in Chapter 17, and spheroplast transformation as described m Chapter 1 are both commonly used. The amount of DNA used in the transformation and the number of colonies obtained will be determined by the transformation method used. 4. If there is any ARS activity on the plasmid, for instance, present in an insertion that is to be introduced onto the YAC, then there will be a large

Targeting

Mutations

to YACs

197

background of colonies in which the UX43 gene is maintained on an extrachromosomal plasmid. There will also be colonies formed by integration of the plasmid into the chromosomal ura3 allele. Most YACs have been made in the host strain AB 1380 that carries the ~~~3-52 allele that 1scaused by an integration of a TY 1 element. This mutation almost never reverts and also prevents replacement events into the ~~~3-52 allele (ref. 17 and unpublished results), however it does not prevent insertion events. Although the mutation is generally integrated with the URA3 gene, it can be lost by gene conversion. 5. Out of five colonies analyzed, the authors found one that had the mutation correctly integrated and in which the YAC was unrearranged (5). 6. The frequency of pop-out events will largely depend on the size of the duplicated region. If the frequency of pop-out events is low, there will be a high background of other events where the URA3 gene 1smutated. 7. Out of five colonies the authors found two that had deleted the whole region of the YAC containing the UR43 gene, two that had reverted to the original, and one that contained the mutation (5).

References 1 Peterson, K. R., Clegg, C. H., Huxley, C , Josephson,B. M., Haugen, H. S., Furnkawa, T , and Stamatoyannopoulos,G. (1993) Transgemcmice contaimng a 24%kb yeast art&la1 chromosomecarrying the human P-globin locus display proper developmentalcontrol of humanglobin genes.Proc. Nati. Acad SCL USA 90,7593-7597

Rothstein,R. (1991) Targeting, disruption, replacement,andallele rescue:mtegrative DNA transformation m yeast,in Guide to Yeast Genetics and Molecular &ok ogy (Guthrie, C. and Fink, G. R., eds.),Academic,San Dlego, CA, pp. 281-301. 3 Sikorskl, R. S. and Boeke, J. D. (1991) In vitro mutagenesisand plasmid shuffling: from cloned geneto mutant yeast,in Gurde to yeast genetzcs and molecular bzologV (Guthrie, C. and Fink, G. R., eds.), Academic, San Diego, CA, pp, 2

302-318. 4.

Barton, M. C., Hoekstra,M. F., andEmerson,B. M. (1990) Site-dlrected,recombination-mediated mutagenesisof a complex gene locus Nucleic Aczds Res 18, 7349-7355.

Duff, K., McGuigan, A , Huxley, C., Schulz,F., and Hardy, J. (1994) Insertion of a pathogenic mutation into a yeastartificial chromosomecontaining the human amylold precursor protein gene.Gene Ther 1,70-75. 6. Ketner, G., Spencer,F , Tugendrelch, S , Connelly, C , and Hieter, P. (1994) Efficlent manipulation of the human adenovirns genomeas an mfectlous yeastartificial chromosomeclone.Proc Natl. Acad SCI USA 91,6186--6190. 7. Scherer, S. and Davis, R. W. (1979) Replacement of chromosome segments with altered DNA sequencesconstructed in vitro Proc Nat1 Acad SCL USA

5.

76,4951-4955.

Duff and Huxley 8 Cook, J. R., Emanuel, S. L , and Pestka, S. (1993) Yeast artificial chromosome fragmentation vectors that utilize URA3 selection Genet Anal. Tech AppE 10, 109-I 12. 9 Srivastava, A. K., and Schlessmger, D. (1991) Vectors for insertmg selectable markers in vector arms and human DNA inserts of yeast artificial chromosomes (YACs). Gene 103,53-59 10. Markie, D., Ragoussis, J , Senger, G., Rowan, A., Sansom, D , Trowsdale, J , Sheer, D , and Bodmer, W. F (1993) New vector for transfer of yeast artificial chromosomes to mammalian cells. Somat Cell Mel Genet 19, 161-169 11. Davies, N. P , Rosewell, I R., and Bruggemann, M (1992) Targeted alterations m yeast artifictal chromosomes for inter-species gene transfer. Nucleic Aczds Res 20, 2693-2698. 12 Green, E. D. and Olson, M. V. (1990) Chromosomal region of the cystic fibrosis gene m yeast artificial chromosomes* a model for human genome mapping. Science 250,94--98 13. Hugerat, Y , Spencer, F., Zenvirth, D., and Simchen, G (1994) A versatile method for efficient YAC transfer between any two strains. Genomlcs 22, 108-l 17 14. Spencer, F , Hugerat, Y , Simchen, G., Hurko, O., Connelly, C., and Hieter, P (1994) Yeast kurl mutants provide an effective method for YAC transfer to new hosts. Genomics 22, 118-126. 15 Connelly, C., McCormick, M., Shero, J , and Hieter, P (1991) Polyamines eliminate an extreme size bias against transformation of large yeast artificial chromosome DNA. Genomics 10, 10-16. 16. Sikorski, R. S. and Hieter, P (1989) A system of shuttle vectors and yeast host strains designed for eftictent manipulation of DNA in Succharoyces cereviszae. Genetics 122, 19-27. 17. Rose, M. and Winston, F. (1984) Identification of a Ty msertion within the coding sequence of the S cerevwae URA3 gene. Mol. Gen Genet. 193,557-560.

CHAPTER

19

Reconstruction of Large Genomic Segments of DNA by Meiotic Recombination Between YACs Gary

A. Silverman

1. Introduction The cloning of megabase-size DNA fragments in yeast artificial chromosomes (YACs) creates new opportunities to study, for example, remote c&acting elements, higher order chromatin structure, and chromosomal folding in coordinating the transcriptional regulation of large genes. Prior to initiating these types of studies, however, it is necessary to develop reliable and reproducible methods that permit the experimental manipulation (reconstructions, deletions, insertions, point mutations) of the large DNA molecules cloned into YACs. Sheer forces limit the ability to alter these large DNA molecules in vitro. Fortunately, the high frequency and fidelity of homologous recombination in Saccharomyces cerevisiae allows these types of modifications to be accomplished in vivo. The purpose of this chapter is to describe a simple method that utilizes meiotic recombination between overlapping YACs to reconstruct a single clone containing an intact gene. The widely available Washington University, CEPH, ICRF, and ICI human genomic YAC libraries were constructed using the vector, pYAC4 and the haploid yeast strain, AB 1380. The meiotic recombination scheme outlined herein entails the use of these clones but is applicable to those derived from other YAC vector cloning systems. From Methods m Mo/ecu/ar Biology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

199

200

Silverman

Meiotic recombination between YACs requires that the clones 1. Reside in yeast of the oppositemating type; 2. Sharesomedegreeof overlap; and 3. Have the sameinsert-vector orientation or polarity (Fig. 1). AB1380 is a haploid strain of the a mating type (MATa). In their vegetative state, these yeast propagate by mitosis. Exposure to mating pheromones from a strain of the opposite mating type (MATa) results in cell cycle arrest in Gl. In preparation for conjugation, the cells increase in size and form pear- or shmoo-shaped projections. At the point of contact, cells of the opposite mating type dissolve a portion of their cell wall and fuse their plasma membranes, Subsequent fusion of the haploid nuclei results in a diploid, dumbbell-shaped zygote. The zygote reproduces vegetatively until it is nitrogen deprived (starved). This induces meiosis and sporulation. The products of meiosis are four haploid spores, a tetrad, that are packaged in a sac-like structure, the ascus. Because the products of meiosis are contained within a single ascus, homologous recombination between overlapping YAC clones can be detected by molecular analysis of the individual spores (tetrad analysis). The frequency of meiotic recombination between homologous YACs (<2-7.7 kb/cM) is comparable to that observed for natural yeast chromosomes (0.5-12.5 kb/cM) (I). In part, the frequency of recombination between YACs depends on the degree of overlap. YACs overlapping by as little as 60 kb of DNA have recombined. Although the minimal length of DNA necessary for homologous recombination between YACs has not been defined (2), yeast integrating vectors can recombine with homologous DNA segments that are only several hundred basepairs in length (reviewed in ref. 3). Finally, it is important for the recombining YACs to have the same polarity. This refers to the orientation of the insert relative to the left (TRPI, ARS4, CEN4) and right (URA3) YAC vector arms. Recombination between YACs in different vector orientations will yield dicentric or acentric recombinants that are mitotically unstable. If candidate clones in the same polarity are unavailable, a three-way cross, elegantly described by Den Dunnen et al. (4), may be employed. In this strategy, mating and sporulation yields a haploid cell that contains two nonoverlapping YACs with the same polarity. This cell is mated with another yeast, which contains a

Reconstruction

haploid

201

of DNA Segments

hIATustrain

haploid MATa strain

Single crossover

4 -

event

meiosis I

L

co +

meiosis II

Fig. 1. Generation of a recombinant YAC from two overlapping clones. The area of overlap between YACs is stippled. The products of meiosis are four spores (tetrad) packaged in an ascus.

Silverman

202

Fig 2 Microneedles. Glass fibers (-40 p in diameter), cut with a cover&p, are exammed under low power using a dissecting mlcroscope. Only the flat needle on the right is suitable for dissectmg tetrads. YAC that overlaps both clones but is in the opposite vector onentatlon. Meiotic recombination among all three clones yields a stable, acrocentric YAC containing the desired genomic sequence.

2. Materials 2.1. Microneedles There are several methods for preparing microneedles. The simplest is to purchase fiber optic glass with a diameter of 10-100 ~1.Cut -2-cm length fibers with a coverslip held at a 45” angle. Inspect the ends of the fibers under a microscope and select those pieces that have a flat end (Fig. 2). Orient a fiber to the mounting rod at a right angle. Affix with an acrylic adhesive. 2.2. Micromanipulators Several types of mlcromanipulators with single-lever controls are available commercially from distributors such as Technical Products International (St. Louis, MO), Lawrence Precision Machine (Hayward,

Reconstruction

of DNA Segments

203

Table I Partial Genotypes of Saccharomyces cerevwae Strain

Mating type

AB1380 AB1610 YS58 YM2062 YPH252

MATa MATa MA Ta MATa MA Ta

Strains

Partial genotype

Refs.

trpl ura3-52 ade2-I hu5 lys2-I canIv/‘(seeNote 9) trp5-2 ura3-52 ade2-I lys2-I canI-IOOmet4-I EeuI-I2 trpl-789 ura3-52 his4-519 leu2-3, I I2 ura3-52 ade2- IO I his3- A200 1~~2-801 trDI-AI hu3-A200 ade2-IOI leu2-AI IvsZ-8OI

(5) (6)

(4) (7) (8)

CA), Singer Instrument Co. Ltd. (Watchet, Somerset, UK), C. H. Stoelting Co. (Chicago, IL), Carl Zeiss Instruments (Thornwood, NY), Wild Leitz (Rockleigh, NJ), Narishige USA Inc. (Greenvale, NY), and Research Instruments Limited (Cornwall, UK).

2.3. Enzymes 1. Agarase Eplcentre Technologies (Madison, WI). 2. Glusulase: NEN Research Products (Wilmington, DE) dilute 1:4 to 1: 100 m distilled water 3. Thermus aquatzcus DNA polymerase. 4. Zymolyase:

100,000 U/g, ICN Biomedicals

(Costa Mesa, CA). Prepare

fresh by dissolvmg 0.5 mg/mL in 1M sorbltol.

2.4. Media 5. 6. 7. 8. 9.

Acid hydrolyzed casem (AHC) medium (see Chapter 29). Dissection medium: Prepare YPD with 10% noble agar. Sporulation (SPO) medium (see Chapter 29). Synthetic complete (SC) and drop-out media (see Chapter 29). Yeast, peptone, dextrose (YPD) medrum (see Chapter 29).

2.5. Yeast Strains The genotypes of the S. cerevisiae strains useful in crosses with AB 1380 are depicted in Table 1.

2.6. Mating

Type PCR Primers

1. Universal MAT: S-AGTCACATCAAGATCGTTTATGG-3’. 2. MATa

specific: 5’-GCACGGAATATGGGACTACTTCG-3’.

3. MATa

specific: 5’-ACTCCACTTCAAGTAAGAGTTTG-3’.

204

Silverman A B

A 0 X I A85R

F M

~A8566

(200kb)

M x

N MS xx I BCI-2 EXIlIl

I ----------I MD I h-15

FM +&...ip

H n Q Cl 4 D

lOkb probes intron 5’13’ flank right vector arm left vector arm

I F L S X

yB206A6

M

1; AdL i X I’

U L (F) M SSXF

M ’

I 8206R

(O(M)

(700kb)

I I I - - - - - --se

I -’

I EICI-2 EXIIIMSR

S B

’ i

’ ‘/i+‘*p

MCI3

B206L

Fig. 3. Rare-cutting restriction maps of yA85B6 and yB206A6. Boxed area indicates the region of overlap between the clones. Dotted lines represent the fragments in yB206A6 that were derived from chromosome 7 (B206R) or 1 (B206L). Abbreviations: A, NaeI; B, BssHII; F, @I; L, SalI; M, SmaI; N, N&I; S, SacII; U, MM; X, 33~01(from ref. 2 with permission).

3. Methods 3.1. Characterization of YACs The degree of overlap, polarity, and size of the YAC clones can be determined by mapping with rare-cutting restriction endonucleases and pulsed field gel electrophoresis (PFGE). Methods describing high

molecular weight DNA preparation, enzyme digestion, and PFGE conditions are outlined in Chapter 7. By comparing the rare-cutting restriction map of the overlapping clones, one can predict the size and frequency of the desired recombinant. In the example depicted in Fig. 3, PFGE mapping reveals that two clones, spanning the entire BCL2 proto-oncogene, are in the same 5’ + 3’ vector orientation and overlap by 60 kb (2). This predicts that a single crossover event will yield the desired 800-kb and

the reciprocal 90-kb recombinant clones in -&30% of the meiosis. 3.2. Obtaining YACs in a Yeast Strain of the Opposite Mating Type

Prior to mating the yeast that contain overlapping YACs, one of the clones must be in a yeast strain of the opposite mating type. Three methods can achieve this task:

Reconstruction

of DNA Segments

205

1. Genetic outcrossmg to a strain of the opposite mating type (see Section 3.2. I .); 2. Yeast transformation with gel-purified YAC DNA (see Section 3.2.2.); and 3. Mating type switch by transformation wtth an HO-containing plasmrd (see Note 1).

3.2.1. Method 1: Outcrossing to a Strain of the Opposite Mating Type 1. Selection of a yeast strain. The genotypes of AB 1380 (MA 7’a) and several MATo strains are depicted in Table 1 (4-8). Selection of the appropriate MA To strain for outcrossing with AB 1380 depends on future needs. If the goal is to obtain a YAC in a cell of the opposite mating type, then any MA Ta strain that permits positive selection for the YAC may be suitable. However, if subsequent manipulations of the YAC are anticipated, then the genotypes of certain MA Ta strains may be more desirable (see Note 2). 2. Yeast mating: Prepare a fresh culture of a YAC-containing yeast and a strain of the opposite mating type (e.g., AB1610) by streaking onto AHC and YPD plates, respectively. After several days of growth at 30°C, spread a loopful of cells from each culture onto the same area (~1 cm2) of a fresh YPD plate, Use the loop to mix the cells. 3. After incubating the plate at 3O”C, diploids are selected by one of three methods: a. Selection of dtplotds by genetic selection: After overnight incubation, remove an ahquot of the cell mixture and streak for a single colony on SD medium prepared with the approprtate drop-out powder (see Chapter 29). In this example, ABl380 x AB1610 diploids are phenotypitally His+, Ura+, and Trp+. Synthetic medium lacking histidine, uracil, and tryptophan (SD -his -ura -trp) will select for diploids wtth these prototrophies. Haploid cells from the parental strains are auxotrophic for at least one of these nutrients and wrll not survive on this medium. b. Selection of diplords by morphologic selection: The genotypes of some haploid strains are not complementary in regard to then auxotrophies. In these cases,diploids can not be selected on the basis of different growth requirements. However, zygotes can be vtsuahzed microscoprcally by their characteristtc dumbbell shape. Six to eight hours after mating, mrx a loopful of cells with -20 uL of Hz0 and streak the suspension down the middle of an AHC plate. Using the dissecting microscope and micromanipulator (see Section 3.4., step 3), examine the field for dumbbell-shaped zygotes,and transfer single cells to a peripheral portion of the plate. After several days of growth, confirm the presenceof a diploid cell by sporulation, lack of mating to tester strains, or absenceof pheromone production (9).

206

Silverman 1 2

3 4

5

6 7 8

9 10 11 12 13 14

1353-

603-

-MATa

-MATa@

(544

bp) bp)

Fig. 4. Mating type PCR. Primers that distinguish between MATa and MATa were used in the same PCR assay with whole yeast. PCR products were separated by 1% agarose gel electrophoresis and visualized by ethidium bromide staining. Lanes: 1, haploid strain AB1380 (MATa); 2, haploid strain ABl610 (MATcx), 3-l 1, single colonies obtained after mating of AB 1380 x AB16 10. Nine of the colonies are diploid (from G. Silverman, unpublished data, with permission). c. Selection of diploids by mating type PCR: The presence of a diploid cell can be determined by PCR. Huxley et al. developed a set of three PCR primers (see Section 2.6.) that can determine whether a copy of HMLa or HMRcx is present at the MAT locus (20). Inclusion of these primers in an amplification reaction with whole yeast yields both a 404bp MATcl and a 544-bp MATa fragment if the cells are diploid (Fig. 4). Haploid cells will yield either a MATa or MATcx product. Dispense 5 pL of a solution containing 10 n-& Tris-HCl, pH 8.3,50 mMKCL2.5 mMMgC12, 200 pJVeach dNTP, 1.0 weach oligonucleotide primer and 0.25 U T. aquaticus DNA polymerase into a PCR tube. Touch the tip of a round toothpick to a yeast colony and transfer the cells to the bottom of the PCR tube and discard the toothpick (see Note 3). Overlay the reaction mixture with 20 uL of mineral oil, heat to 96°C for 5 min, and then perform 30-35 thermocycles by incubating at 94OC for 1 min, 58°C for 1 min, and 72°C for 1 min. Amplification products are separated by electrophoresis through 8% polyacrylamide or 1% agarose gels and visualized by ethidium bromide straining (Fig. 4). 4. Sporulation of diploids and selection of YAC-containing haploid cells (see Note 4): Streak the appropriate diploid clone onto a YPD plate and incubate at 30°C overnight. Transfer a loopful of cells onto SPO medium (see Chapter 29) as described in Section 3.4., step 1. After approx 5 d, process the tetrads as described in Section 3.4., steps 2 and 3). After the spores have germinated, select for the presence of the YAC by replica plating them to AHC medium. Determine the mating type of the YAC-containing haploid cells by mating type PCR (Section 3.2.1.) step 3c) or by crosses to

Reconstruction

207

of DNA Segments

a and a tester strains (9). If needed, the genotype of the YAC-containing, MATa spores can be determined by complementation with appropriate MATa strains (see Note 5). 3.2.2. Method 2: Transformation of S. cerevisiae with Gel-Purified YAC DNA 1. YACs can be transferred into haploid cells of the opposite mating type by DNA transformation. Prepare high molecular weight DNA in agarose blocks and separate the chromosomes by PFGE as described m Chapter 7. 2. Excise the band, and wash the gel slice in several changes of a solution containing 30 mA4 NaCI, 10 mM Tris-HCl, pH 8, 1 mM EDTA, pH 8, 0.75 mM spermidine trihydrochloride, and 0.25 mM spermme tetrahydrochloride. 3. Remove the solution and melt the agarose block by incubating at 65°C for 10-l 5 min. Transfer the tube containmg the molten agarose to a 3740°C water bath and allow for equilibration (S-10 mm). 4. Add l-2 U of agarase/lOO pL of agarose. Carefully mix the agarase with the agarose by gently swirling the pipet tip. Incubate at 37OCfor at least 1 h. The sample can be stored at 4“C. 5. Use several microliters of the DNA containing agarose solution to transform a MATct yeast strain by the spheroplast method of Burgers and Percival (11) (see Chapter 1). Transformants are selected by growth m AHC medium. that

3.3. Mating Between Contain Overlapping

Yeast YAC Clones

YACs present in haploid yeast strains of the opposite mating type can be introduced into a single cell by mating. This procedure is similar to that described in Section 3.2.1.) step 2. 1. Mix a loopful of the two freshly grown clones of the opposite mating type onto the same -1 cm2 area of a YPD plate. Incubate overnight at 30°C. 2. Select for dtploids by streaking a loopml of cells onto the appropriate SD medium. If diploid cells can not be selected for, streak onto an SD-ura-trp or an AHC plate. 3. Determine ploidy of the individual colonies by using the matmg type PCR assay (Fig. 4, see Section 3.2.1.) step 3c) (see Note 6). 4. Patch individual zygotes to a YPD plate and incubate overnight at 30°C. Overnight mcubation on YPD plates enhances sporulation.

208

Silverman

3.4. Sporulation and Dissection of Asci 1. Remove a loopful of diploid cells from an overnight culture. Streak these cells onto SPO medium and incubate at 30°C for 2 d and then at room temperature for 2-3 d. Some dlploids may take longer to sporulate. 2 Prior to dissectton of tetrads, the asci are digested with either zymolyase (12) or glusulase (13). Resuspend a loopful of cells in a tube containing 50 pL of zymolyase. Incubate at 30°C for 10 min. Slowly, add 0.8 mL of sterile distilled water and place the suspension on ice until plating. Alternatively, resuspend a loopml of cells in 200 PL of diluted glusulase. Incubate from 5-l 5 min at room temperature and then place on ice until plating. Do not vortex or shake the tube once the asct have been incubated with either enzyme (see Note 7). 3. Gently remove a loopful of the enzyme-treated suspension and pass a single streak across the diameter of a 100-mm Petri plate (Fig. 5). To aid in vtsuahzation of the tetrads, the agar plate is prepared using 10% noble agar dtssolved in YPD. Position the culture dish on the stage of a light microscope outfitted with a micromanipulator (Fig. 6) and a glass microneedle (Fig. 2). A detailed description of micromanipulators, mrcroscopes, and microneedles are provided by Sherman and Hicks (23). Set the magnificatton at -20&400x by using the 10--15x objectives and the 20-25x eye pieces (13). Maneuver the microneedle such that its shadow 1s next to a tetrad. Move the needle toward the plate until a memscus forms between the surface of the agar and the needle. This will appear as a halo around the needle’s shadow. In a single motion, sweep the needle toward the tetrad while withdrawing the needle from the surface of the plate. The tetrad will disappear from view if it has been picked up by the microneedle. Using the graduations on the mechamcal stage, deposit the tetrad onto the agar surface 5 mm from the central streak. Note the position. Disrupt the tetrad by tapping the benchtop while the needle is next to the cluster. Pick up three of the spores and deposit them 5 mm from the previous spot. Repeat this process until all four spores are 5-n-m apart in a line perpendicular to the central streak (Fig. 5). Spores from approx 20 tetrads can be deposited on each plate (10 on each side of the streak). After 2-3 d of growth at 3O*C, spores can be replica plated to appropriate selection medium (e.g., SD-uratrp or AHC medium) for tetrad analysis (see Note 8).

4. Notes 1. S cerevislae can switch their mating type with successive rounds of cell divrsion. This interconversion is assisted by a site-specific endonuclease, HO, that forms a double-strand break at the MAT locus. The DNA repair process installs a new copy of a mating type cassettefrom either the Hula

Reconstruction

of DNA Segments

209

microneedle

0

0

0

0

0

0

0

0

0

0

0

0

0

random spore

Fig. 5. Tetrad dissection. Diploid cells, induced to sporulate, are treated with glusulase and streaked down the center of an agar Petri plate. Tetrads are picked using a microneedle and deposited toward the periphery of the plate. or the HMRa locus. In the majority of cases,a copy of the opposite mating type is installed at the MAT locus. As a consequence, colonies will contain a mixture of diploid cells and haploid cells of both mating types. Yeast strains that can interconvert their mating type are termed homothallic. However, many laboratory strains (e.g., AB 1380) are heterothallic, as they are unable to interconvert their mating types. Frequently, this is owing to a mutation in the HO gene. The ability to undergo a mating type switch can be restored by transformation with a yeast expression plasmid (YEP) that contains the HO gene (14). After transformation, cells are grown on enriched media to enhance replication and allow for plasmid loss. Indi-

Silverman

Fig. 6. Micromanipuator and microscope for dissecting tetrads (courtesy of h-v Toplin, Carl Zeiss Inc., Thornwood, NY). vidual colonies can be assayed for a, a, or ala cells by mating type PCR (see Section 3.2.1.) step 3c) or mating factor production assays(9). 2. Pavan et al. constructed a series of yeast-integrating plasmids (25) and chromosome fragmentation vectors (16) that generate insertions, interstitial deletions, and terminal deletions within YAC clones. Because these vectors lack autonomously replicating sequences, transformation occurs via recombination between homologous plasmid and YAC sequences.The presence of a functional JU5’3 gene within the plasmid permits selection of the modified YACs providing the background yeast genotype has been changed from his5 HIS3 (AB1380) to HIS5 his3 (e.g., 2062, YPH252).

Reconstruction

of DNA Segments

211

3. Only a scant amount of yeast 1snecessary for the PCR assay. Avoid transferring agar as this may inhibit the amplification reaction. 4. After a diplotd cell has been identified, the presence of the original YAC can be assessedby sizing the clone on a pulsed field gel. Alternatively, the clone can be identified by using yeast colonies m a PCR assay wtth YAC-clone specific primers. 5. Prtor to further matmgs (see Section 3.3.), it is prudent to assessthe integrity of the YAC within its new host. Stzing of the YAC by PFGE is a reasonable method to screen for overt deletions or rearrangements. Alternatively, PCR analysis with multiple sets of YAC-specific prtmers can be used to screen for clone mtegrtty. 6. As a third alternative, diploid cells (zygotes) can be isolated using a light microscope fitted with a micromanipulator and a mtcroneedle (see Section 3.2.1.) step 3b). 7. The adequacy of digestion can be assessedby exammmg an aliquot of the spore suspension under a phase contrast microscope at 400x magniflcation Four, well-circumscribed spores can be visualized in appropriately digested specimens. Asci containing indistinct spores m tightly packed tetrahedral or diamond-shaped configurations are not adequately digested. Overdigestion results in premature rupture of the asci and spillage of spores into the surroundmg solution. 8. In part, the meiotic behavior of two different YACs during meiosis will depend on then degree of homology. If the YACs are stgmticantly dtsparate, they may behave as nonhomologous chromosomes. This may result m nondisjunction or precoctous sister chromatid separation during meiosis I (2). Although meiotic recombmation may occur between nonhomologous chromosomes, this event is extremely rare (I). Should this occur, some of these spores will not contain a YAC. These tetrads can be identified and eliminated from further analysis by culturing on SD -ura -trp or AHC medium. YACs that behave as homologous chromosomes undergo non-, single-, or double-crossover events during meiosis I. This yields tetrads that contam spores of two (dttypes) or four (tetratypes) different genotypes. Analysis of these tetrads for the desired recombmant can be achieved by preparing high molecular weight DNA from each spore and sizing their YAC inserts by PFGE (Fig. 7) (see Chapter 7). The size of the recombinant clone can be predicted by previous analyses of the parental clones. PCR fingerprinting with markers that are present on both parental YACs can be used for tetrad analysis. For example, a single crossover between two overlapping YACs will yield a tetratype with a predictable

Silverman

212

1

-800 -700 Kb

-200 - 90 total human

DNA*

Fig. 7. Sizing of the YACs contained within spores derived from the yA85B6 x yB206A6 mating (Fig. 2). Yeast chromosomes were separated by CHEF electrophoresis (45-90 s, linearly ramped switch interval), blotted, and hybridized to [32P]-labeled total human DNA. AB1380 is the nontransformed host. yA85B6 and yB206A6 are the parental clones and the tetratype is the same as described in Fig. 8 (from ref. 2 with permission). PCR fingerprint (Fig. 8) (2). Two of the spores will score for a set of markers specific for each parental type. The other spores will score for a series of markers specific for each recombinant. PCR analysis is rapid and can be performed on whole yeast cells. However, PFGE and restriction mapping should be used to ensure that candidate clones are of the appropriate size and genomic configuration. Meiotic recombination between overlapping YACs has provided intact copies of the cystic fibrosis transmembrane conductance regulator (17), BCL2 (2), dystrophin (4), and the type I neurofibromatosis (18) genes. Expression studies are needed ultimately to determine whether homologous recombination has yielded an intact gene. The detection of human BCL2 mRNA (Fig. 9) and protein in mouse cells transfected with the human BCL2containing (recombinant) YAC suggests that genes reconstructed by meiotic recombination in yeast will yield functional, intact genes (19).

Reconstruction

of DNA Segments

213

A

yBPOBA6

yB20BAB parental (700kb)

yA85lWO6 (800kb)

(MAT@

Ret

B ~ABCDEFG

~ABcDEFG

~ABCDEFG

d’A

B C D E FG

1356 603:/g: Spore

I

spore

I1

spore

III

Spore

xx

Fig. 8. PCR fingerprint analysis of spores derived from the yA85B6 x yB206A6 mating. (A) Schematic representation of the mating, crossover, and desired tetratype that would yield a spore containing a single YAC with the entire BCL2 gene. (B) Ethidium bromide-stained 1% agarose gels of PCR-amplified products of DNA isolated from the indicated spores and primers that amplify regions depicted in (A). Sizes of the amplified products for A-G in basepairs are 149 (A85R), 275 (BCLZ ExHI), 660 (B206R), 420 (A85L), 225 (BCLZ ExIII), 550 (MCR), and 410 (B206L). (Upper) Analysis of four spores derived from a single tetrad. (Lower) As controls, amplified products derived from parental strains. $, HueIII-digested $X174 phage DNA (size standards) (from ref. 2 with permission).

Silverman

214

603 -

- Bcl2 (human)

194-

-P*M (mouse)

Fig. 9. BCL2 expression from a recombined YAC. YACs containing the human BCL2 gene were transfected into a mouse tumor line (MMT) via protoplast fusion. Human BCL2 RNA was detected by an Sl nuclease protection assay. Total RNA was obtained from REH (human pre-B lymphoma line that has a deregulated BCL2 gene), the parental MMT cell line, and a series of MT clones that contained an integrated BCLZ-containing YAC. MT 8.2 has integrated a nonrecombinant YAC clone containing the entire human BCL2 gene. MT 10.18 and 11.3 1 have integrated the recombinant YAC (clone depicted by spore III in Figs. 7 and 8) containing the entire human BCL2 gene (from ref. 19 with permission). 9. Several laboratories have determined that AB1380 is Thr-. This growth requirement can be satisfied by adding either threonine or isoleucine to SD medium or by using AHC medium.

Acknowledgments This work was supported by grants from the National Institutes of Health (HD28475), the Hearst Fund, the March of Dimes, and the Elsa Pardee Foundation. The author thanks Kelly Ames for the preparation of the manuscript.

Reconstruction

of DNA Segments

215

References 1. Sears, D. D., Hegemann, J. H , and Hieter, P. (1992) Melotic recombmation and segregation of human-derived artificial chromosomes in Saccharomyces cerevisiae Proc Natl Acad Scl USA 89,5296-5300 2. Silverman, G A, Green, E. D., Young, R L , Jockel, J I, Domer, P H., and Korsmeyer, S. J. (1990) Meiotic recombmatron between yeast artificial chromosomes yields a single clone containmg the entire BCL2 protooncogene. Proc Natl. Acad. Sci USA 87,99 13-99 17 3. Rothstem, R. (1991) Targetmg, disruption, replacement, and allele rescue: mtegratlve DNA transformation m yeast, in Guide to Yeast Genetics and Molecular Biology (Guthrie, C. and Fink, G. R., eds.), Academic, San Diego, CA, pp. 281-301 4. Den Dunnen, J. T., Grootscholten, P. M , Dauwerse, J. G., Walker, A P , Monaco, A. P., Butler, R., et al. (1992) Reconstruction of the 2.4 Mb human DMD-gene by homologous YAC recombination. Hum. Mol Genet 1, 19-28. 5. Burke, D. T., Carle, G. F , and Olson, M. V. (1987) Clonmg of large segments of exogenous DNA into yeast by means of artificial chromosome vectors Science 236,806-8 12. 6 Riles, L and Olson, M. V (1988) Nonsense mutations in essential genes of Saccharomyces cerevlsiae. Genetics 11,601-607. 7. Flick, J. S. and Johnston, M. (1990) Two systems of glucose represston of the GAL1 promoter in Saccharomyces cerevisrae Mel Cell Blol. 10,4757-4769 8. Sikorski, R. S. and Hleter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient mampulatton of DNA in Saccharomyces cerevlstae Genetu 122, 19-27 9. Sprague, G F., Jr (199 1) Assay of yeast mating reaction, m Guide to Yeast GenetES and Molecular Biology (Guthrie, C. and Fink, G R , eds.), Academic, San Diego, CA, pp 77-93 10. Huxley, C , Green, E D., and Dunham, I. (1990) Rapid assessment of S cerevzszae mating type by PCR. Trends Genet 6,236 11. Burgers, P. M. J. and Percival, IS. J. (1987) Transformation of yeast spheroplasts without cell fusion. Anal. Blochem. 163,391-397 12. Rose, M D , Winston, F., and Hieter, P. (1990) Methods zn Yeast Genetzcs A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. 198. 13. Sherman, F. and Hicks, J. (1991) Micromanipulation and dissection of asci, m Guide to Yeast Genetics andMolecular Biology (Guthrie, C. and Fink, G. R., eds.) Academic, San Diego, CA, pp. 2 l-37. 14. Russell, D. W., Jensen, R., Zoller, M J., Burke, J., Errede, B., Smith, M , and Herskowitz, I. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysts of Its upstream regulatory region. Mol Cell. Biol. 6,428 l-4294. 15. Pavan, W. J., Hieter, P., and Reeves, R. H. (1990) Modification and transfer mto an embryonal carcinoma cell line of a 360-kilobase human-derived yeast artificial chromosome. Mol Cell Bzol 10,4163-4169

Silverman

216

16. Pavan, W. J., Hreter, P., Sears, D., Burkhoff, A., and Reeves, R. H. (1991) Hughefficiency yeast artificial chromosome fragmentation vectors Gene 106, 125-127. 17. Green, E. D. and Olson, M. V. (1990) Chromosomal regron of the cystic fibrosis gene in yeast artificial chromosomes: a model for human genome mappmg Science 250,94-98. 18 Marchuk, D A, Tavakkol, R , Wallace, M R , Brownstem, B. H , Taillon-Mrller, P , Fong, C. T,, et al. (1992) A yeast artrfictal chromosome contig encompassing the type 1 neurofibromatosis gene Genomics 13,672-680. 19. Silverman, G A , Yang, E., Profftt, J H , Zutter, M , and Korsmeyer, S. J (1993) Genetrc transfer and expression of reconstructed yeast artificial chromosomes contammg normal and translocated BCL2 proto-oncogenes. Mel Cell Blol 13, 5469-5478.

CHAPTER20 Genomic Reconstruction by Mitotic Recombination of YACs David

ilfarkie

and

Jiannis

Ragoussis

1. Introduction 1.1. Mitotic Crossing Over Mitotic crossing over was first observed in the somatic tissues of genetically marked strains of fruitfly (I), but has proved most valuable as a mapping tool in asexual fungi (2,3). Although the yeast Saccharomyces cerevisiae has a sexual cycle, and is therefore more amenable to genetic analysis by classical meiotic approaches, mitotic crossing over within a region of homology shared between two artificial chromosomes in this host has some interesting consequences, and can be used to physically reconstruct the genomic structure of an extended region in a single molecule (4). 1.2. Application to YACs and Limitations Yeast artificial chromosome (YAC) libraries provide a valuable resource for cloning genomic DNA, with individual clones usually ranging from around 200 kb to 1 Mb. The relatively large size of YAC clones compared to other cloning systems expedites the construction of maps containing large contiguous stretches of complex genomes made up of overlapping clones (contig maps). However, when genomic DNA is to be used in a functional application, the size of individual YAC clones within a contig may still be limiting, and the high degree of chimerism in most YAC libraries (seeChapter 11) effectively further reducesthe average contiguous insert size. Some genes (e.g., the human dystrophin gene) are From. Methods m Molecular Biology, Vol 54. YAC Protocols Echted by. D Markle Humana Press Inc , Totowa, NJ

217

218

Markie and Ragoussis

too large to be cloned in individual YACs from currently available libraries, and it may also be desirable to preserve the integrity of fi-mctlonally related gene clusters (e.g., the human MHC region) or regulatory sequencesat some distance from the gene of interest (e.g., the human globin genes). The identification of occasional clones ranging up to 2 Mb m some YAC libraries, and reconstruction experiments that have produced a YAC of 2.3 Mb in length (5), strongly suggests that the carrying capacity of the yeast host is not the critlcal factor determining clone size, but rather that the technical difficulty of transforming very large DNA molecules into yeast during library construction limits the average insert size of YACs. Reconstruction of genomic regions contained in overlapping YAC clones is therefore a useful approach to overcoming the difficulties of YAC size, and can provide valuable reagents for functional studies. It also has some utility in eliminating chimeric segments within contigs, and can provide reagents for producing extended restriction and fragmentation maps (see Chapters 7 and 17). The two available approaches to reconstruction of large genomic regions in YACs rely on meiotic and mitotlc crossing over, respectively, and each has advantages and disadvantages. Both require YACs containing a region of overlap that is cloned in the same orientation with respect to the left (centric) and right (acentric) vector arms. It is therefore useful to have a good depth of coverage within contigs to improve the likelihood of identifying suitable YACs with the same cloning polarity. Melotic recombination (see Chapter 19) requires the transfer of one YAC to a yeast strain of the opposite mating type, followed by mating, sporulatlon, and analysis of individual spores. Although these are standard techniques in laboratories practicing yeast genetics, this approach requires specialist equipment and expertise. The mitotic approach described here is undertaken entirely within the common YAC host AB1380, and requires no specialist equipment apart from an ultraviolet lamp. It is, however, effectively limited to the recombination of two overlapping YACs, as the ploidy is doubled during the procedure with no simple method for reduction to allow further cycles, This limitation does not apply to meiotic reconstruction that allows for serial reconstruction of extended contigs. However, the simplicity of the mitotic approach may outweigh this disadvantage when the desired genomic region is contained within two clones.

Genomic

Reconstruction

219

1.3. Outline of Procedure For ease of understanding the procedure can be conveniently divided into four stages. 1.3.1. Retrofitting

with pRAN4

In this procedure, one of the YACs is modified by replacing the UL43 gene on the right arm with theADE2 gene contained in the vector pRAN4 (6). This changes the phenotype of the strain, which previously required adenine for growth (among other requirements), but now requires uracil instead. Testing for a uracil requirement is used as a simple test to identify correctly targeted clones following transformatton with pRAN4. The difference in growth requirements between a modified and an unmodified YAC strain produces the selection required for forcing diploid formation at the next stage. Furthermore, mutants at the ADE2 locus, as well as having an absolute requirement for adenine, produce red-pigmented colonies when grown on limiting adenine concentrations. Hence standard YAC strains (constructed with pYAC4 in AB 1380) appear red on low adenine media, whereas those correctly retrofitted with pRAN4 appear white owing to the presence of the functional ADE2 gene on the YAC. Colony color can then be used to follow the segregation of the YAC modified with pRAN4, and is the basis for identifying recombination and chromosome loss events later in this protocol. The choice of YAC to retrofit from an overlapping pair is determined by considering the consequences of recombination and segregation (see Fig. 1). It is most convenient to modify the YAC in which the right (acentric) arm will ultimately be lost, to leave a long recombinant YAC containing pYAC4 vector arms suitable for future retrofitting as desired. The transformation protocol described here for retrofitting with pRAN4 is modified from the original lithium acetate method (7). Although other protocols (e.g., protoplast transformation) are suitable, this simple and robust method yields ample transformants for identifying clones correctly targeted with pRAN4. For a fuller description of retrofitting procedures, see Chapter 17. 1.3.2. Diploid Formation by Protoplast Fusion Diploids in S. cerevisiae are normally formed by mating two haploid

strains of opposite mating type (a and a). To avoid the necessity to transfer one YAC to a strain of opposite mating type, it is possible to enzy-

Markie

and Ragoussis

Recombination evident as “twin spot”

crose-over Segregation alternatives

Colony formation

Recombination not evident

Fig. 1. Schematic diagram of YAC mitotic crossing-over and its consequences. The YACs are shown initially in the upper left corner prior to recombination, with their regions of overlap aligned. The duplicated chromatids (vertical lines) are connected at their centromeres (circles). The pRAN4 retrofitted YAC is shown with an open box representing the right vector arm, the unmodified YAC has its right arm shown as a shaded box. Following crossover (lower left), the chromatids will segregate either to produce two “homozygous” clones with respect to the ADI32 and UK43 markers (segregation alternative 1) or two “heterozygous” cells (segregation alternative 2). These two alternatives will occur with equal frequency, but only alternative 1 will produce a visible twin spot. matically remove the cell walls from two strains of yeast, and then treat with polyethylene glycol (PEG) to promote fusion of the resulting protoplasts. The selective markers required to force fusion of the two strains have been provided in this protocol by modifying one with pRAN4 in the previous step (neither can grow in the absence of both uracil and

Genomic Reconstruction

221

adenine, but growth of the rare diploids formed is independent of these two supplements). 1.3.3. Production and Analysis of Twin Spots Following mitotic crossing over between a modified and an unmodified YAC within a diploid host, appropriate segregation of recombinant chromosomes will produce two daughter cells that require adenine and uracil, respectively (segregation alternative 1 in Fig. 1). If the crossingover event occurs at or soon after plating, the two cells will be adjacent to each other on the surface of the plate, and when grown will form approximate halves of the resulting colony. On suitable media, the adenine requiring half will be red, and the uracil requiring half will be white, which allows these events to be detected as so-called “twin spots” on a background of mainly nonrecombinant white colonies. The alternative segregation event (segregation alternative 2 in Fig. I), will occur at the same frequency but will not be visible on this background. Not all apparent twin spot colonies will be due to crossover events. Red sectored colonies (and completely red colonies) can arise by other mechanisms, most commonly loss of the pRAN4 modified YAC during colony growth. Therefore, it is worthwhile testing the white half of an apparent twin spot for nutritional requirements before proceeding. Only those in which the white sector requires uracil are further analyzed for YAC size to confirm recombination, Spontaneous mitotic crossing over is a relatively rare event in S. cerevisiae, and although it is possible to carry out this procedure without the use of recombinogenic agents, it is often convenient to expose the yeast cells to a sublethal dose of ultraviolet light. This increases the frequency of crossing over, and ensures that the majority of such events occur soon after plating, thereby leading to twin spot development. An alternative approachto select for mitotic crossing over events, which utilizes neither UV light nor twin spot detection, has been reported (8). 1.3.4. Separation of Two YACs Within a Clone Following crossover and segregation, the resulting strain is a diploid containing the desired long recombinant and one of the parental chromosomes (see Fig. 1). In some applications it would be desirable to lose the nonrecombinant chromosome. To do this the vector pRAN4 can be used once again to retrofit one of the YACs in the diploid strain. (Note that

222

Markie and Ragoussis

when two YACs arepresent in a single strain, pR4N4 targeting to one YAC will not produce a uracil requirement as one functional copy of the URA3 gene remains on the nonmodified YAC.) Modified clones are isolated and then plated on low adenine media, revealing occasional red colonies that have spontaneously lost the modified YAC. Several independent modified clones are processed in parallel to ensure that in at least one it is the nonrecombinant YAC that IS retrofitted and subsequently lost. A single red colony from each can then be analyzed by pulsed-field gel electrophoresis (PFGE) to identify those that retain the desired YAC. This is a generally useful approach m any situation where an identified strain contains two YACs and it is desirable to segregate them. Such clones are not uncommon m YAC libraries, and can arise either by cotransformation of two independent YACs during library construction or through reduplication of a single YAC during yeast growth. A similar approach utilizing an alternative selective system has been described (9). 2. Materials 1. SD + C medium. All media used in this protocol are based on SD + C (see Chapter 29), and where specified this is supplemented with tryptophan (see Note l), uracil, or adenme. Supplements are made up as concentrated stocksolutions (seethe following), andthe appropriate amount addedto SD + C broth prior to use, or to molten SD + C agar just prior to pouring plates. 2. Adenme stock solutton: Adenme hemlsulfate (Sigma [St. LOUIS,MO] A-9 126) in water at 5 mg/mL. Sterilize by autoclaving and store at room temperature. Adenine is used m media at two concentrations,denoted low (20 pg/mL) and high (50 pg/mL), respectively (see Note 2). 3. Tryptophan stock solution: L-Tryptophan (Sigma T-0254) at 10 mg/mL. Filter sterilize and store at 4°C protected from light. Use in media at a final concentration of 20 pg/mL. 4. Uracil stock solution: Uracil (Sigma U-0750) at 2 mg/mL. Sterilize by autoclaving and store at room temperature. Use m media at a final concentration of 20 pg/mL. 5. LiOAc solutton: 100 mM lithium acetate (Sigma L-6883), 10 n%WTrisHCl, pH 7.5, 1 mA4 EDTA. Filter sterilize and store at room temperature. 6. pRAN4 vector: pRAN4 is available from the American Type Culture Collection. Prior to use it should be digested withBamH1 in the manufacturer’s

recommendedbuffer at a concentrationof approx 0.1 pg/uL. Check an ahquot for complete digestion and heat treat the remainder at 68°C for 10min. Store frozen until required for transformation, and use this solution directly.

223

Genomic Reconstruction

7. Carrier DNA: Sonicated salmon or herring sperm DNA at a concentration of 10 mg/mL (e.g., Promega [Madison, WI] cat. no. D 1811). Denature in a boiling water bath Just prior to use. 8. LiOAc/PEG solutton: 40% (v/v) PEG (average mol wt 1500, BDH Laboratory Supplies [London, UK] product no. 29575) m LiOAc solution. Ftlter sterilize and store at room temperature. 9. TE: 10 mM Tris-HCl, pH 8.0, 1 mA4 EDTA. Sterilize by autoclavmg and store at room temperature. 10. Sterile toothptcks. 11, Spheroplasting solution: 1M sorbitol, 20 mM EDTA, 10 mM Tris-HCl, pH 7.4. Sterilize by autoclaving and store at room temperature. 12. 2% SDS: Sodium dodecyl sulfate in water at 2 g/100 mL, sterilization not required. 13. 14.4M j3-mercaptoethanol(2-mercaptoethanol) (Sigma M-7522). 14. Lyttcase solutton: Lyticase (Sigma L-8137) dissolved in 50 mM Tris-HCl, pH 7.5, 1 mA4 EDTA, 50% (v/v) glycerol. Filter sterilize and store at 4°C. There is little change in activity under these conditions over 2-3 mo. 15. STC solution: 1M Sorbttol, 10 mA4 Tris-HCl, pH 7.5, 10 mM CaCl*. Sterilize by autoclaving and store at room temperature. 16. 20% PEG 1500: 20% (v/v) PEG (average mol wt 1500, BDH product no. 29575) in 10 mMTris-HCl, pH 7.5, 10 mMCaC12. Filter sterilize and store at room temperature. Other preparations of PEG with an average mol wt up to 6000 are also suitable. 17. SOS solution: 1M sorbitol, 25% (v/v) YPD (see Chapter 29), 6.5 mM CaC12.Filter sterilize or make up from sterile components as required. 18. Regeneration agar SD + C agar containing 1M sorbitol (added prtor to autoclavmg) and supplemented with tryptophan. 19. Hemocytometer. 20. Ultraviolet light source with a wavelength of 254 nm (see Notes 3 and 4).

3. Methods 3.1. Modification with pRAiV4 1. Inoculate 4 mL of SD + C broth (supplemented with high adenine and tryptophan) in a sterile 50-mL Falcon tube with the desired yeast strain. Grow overnight, with shaking, at 30°C. 2. Make the culture volume up to 20 mL with the same medium, and grow under the same conditions for an additional 4-5 h. 3. Harvest cells by centrifugation at 1OOOgfor 5 min, discard the supematant, and resuspend in 20 mL sterile water.

224

Markie

and Ragoussis

4. Pellet again at 1OOOgfor 5 min, discard the supernatant, and resuspend m 1 mL LiOAc solution. Transfer the yeast cell suspension to a sterile 1.5mL Eppendorf tube. Pellet by pulsing for about 5 s in a microcentrifuge, discard the supernatant, and resuspend m 400 pL LiOAc solution. 5. Aliquot 50 pL volumes of yeast suspension mto each of two sterile 1.5-mL Eppendorf tubes. To one add 5 PL of carrier DNA (at 10 mg/mL), followed by 0.1-0.5 pg of BarnHI-lmearized pRAN4 (m a maximum volume of 5 pL), and to the other add only the carrier DNA. This second sample will act as the nontransformation control. 6. Add 300 pL LiOAc/PEG solution to each and mix well. Incubate at room temperature for 30 mm. 7. Heat shock at 42°C for 15 mm, then pellet cells by pulsing m a microcentrifuge. 8. Remove the supernatant and resuspend m I mL SD + C broth (supplemented with high adenine and tryptophan), and incubate at 30°C for 30 mm. 9. Pellet by pulsing rn a microcentrifuge, discard the supernatant, and resuspend in 1 mL TE. Spread lOO+t.L ahquots of each suspension onto plates of SD + C agar (supplemented with uracil and tryptophan). 10. Once the suspension has dried into the surface of the agar media, mvert the plates and incubate at 30°C. 11. After 3 d growth there should be two types of colony apparent on the transformation plates, small pink colonies (see Note 5) and larger white colonies. There should be few or no colonies present on the nontransformed control plates (see Note 6). 12. Using sterile toothpicks, pick around 20 of the white colonies in a similar array pattern on to a plate of test media (SD + C agar supplemented with tryptophan) and a plate of complete media (SD + C agar supplemented with uracil and tryptophan). Incubate at 30°C. 13. After 2 d compare the growth of individual clones on the test and complete media. Correctly targeted clones will fail to grow on the test media, and should comprise between 50 and 90% of those tested (see Note 7). 14. Select one or more clones that have failed to grow on the test media and recover them from the plate of complete media. Analyze by PFGE (see Chapter 7) to confirm that YACs have not sustained coincidental deletions during the retrofitting procedure (see Note 8). 3.2. Protoplast Fusion 1. Inoculate the unmodified YAC strain into 4 mL SD + C broth (supplemented with high adenine and tryptophan) m a sterile 50-mL Falcon tube, and semilarly inoculate the pRAN4 modified strain into 4 mL SD + C broth (supplemented with uracil and tryptophan). Grow overmght, with shaking, at 30°C.

Genomic Reconstruction

225

2. Make each culture volume up to 20 mL with the appropriate media and grow for an additional 4-5 h under the same condttions. 3. Harvest cells by centrtfugation at 1OOOgfor 5 min, discard the supernatant, and wash by resuspending m 20 mL sterile water (see Note 9). 4. Pellet cells by centrifugatton as before and wash once more with 1M sorbrtol. 5. Resuspend each cell pellet m 5 mL spheroplasting solution. 6. Take a 1OO+,L aliquot of each cell suspension, dilute m 900 pL 2% SDS, and record the optical density at 600 nm (see Note 10). 7. To each 5-mL cell suspension add 10 pL P-mercaptoethanol (final concentration approx 30 mA4) and 25 pL of lyticase solution (250 U). Incubate at room temperature, with occasional gentle mixing. 8. At approx 15-min intervals take 100~pL aliquots of cell suspension, dilute, and record the OD,,, as described previously. When this value has fallen to around l/10 of the original for both samples (usually 30-45 mm), pellet by centrifugation at 3508 for 10 min (see Note 11). 9. Discard the supernatant and resuspend in 5 mL STC. Pellet at 350g for 10 min and resuspend in 200 pL STC. 10. Place 100 pL of each suspension m a sterile tube with a conical base (e.g., 15-mL Falcon tube) and gently mix. In two additional tubes, separately place 100 pL of each suspension (these will act as the nonfusion control samples). 11. Add 1.5 mL of 20% PEG 1500 to each tube and mix gently by inversion. Incubate for 20 mm at room temperature. 12. Centrtfuge at 350g for 10 min and carefully remove the supernatant without disrupting the cell pellet. 13. Gently resuspend the pellets m 225 pL SOS and incubate at 30°C without shaking for 30 min. 14. Add 5 mL of molten regeneration agar (equilibrated to Just below 50°C) to each tube, mix by gentle inversion, and quickly pour each as an overlay onto the surface of individual prewarmed (37OC) regeneration plates. Allow to set, invert, and incubate at 30°C. 15. After 4-5 d pick mdividual colonies from the fusion plate for PFGE analysis (see Chapter 7) to check for the presence of both YACs wrthin the same strain (see Note 8). If colonies appear on the nonfusion control plates, see Note 12.

3.3. Induction

of Mitotic Crossing with W Light

Over

1. Select a diploid strain containing both YACs of interest and grow to saturation in 10 mL SD + C broth with tryptophan by shaking at 30°C for 2-3 d. 2. Count cells using a hemocytometer, and spread a series of aliquots containing 500 cells on each of 10 plates of SD + C agar supplemented with

226

3.

4.

5

6.

7.

Markie and Ragoussis tryptophan, uracil, and low adenine. Prepare an additional series of 10 plates with ahquots containing 1000 cells (see Note 13). Once the cells have dried on to the plates, put one from each series aside and expose the rest to a UV light source to give a total dose of around 30 J/m2 at a wavelength of 254 nm. Ensure that the lids are removed from the plates durmg exposure (see Notes 3 and 4). Incubate the plates at 30°C for 4-5 d, at which point occasional red colonies, and red sectored colonies, should be apparent. Identify and mark around 20 colonies that contam both red and white sectors, preferentially choosing colonies where these each make up approx half the colony. Using sterile toothpicks, pick the red sector from each twin spot onto a plate of SD + C agar supplemented with tryptophan and low adenme. Pick the white half of each twm spot sequentially onto a plate of test medium (SD + C agar with tryptophan) and then onto a plate of complete medium (SD + C agar with tryptophan and uractl). Ensure that the array pattern used on all three plates is identical such that each half of the twin spots can be matched after growth. Incubate at 30°C for 2 d. Examine the two plates onto which the white half of each twm spot was streaked and compare growth. Those that fail to grow on the test media require uracil, and this confirms that the red sectored colony tested was a true twin spot. Not all colonies tested will produce this result, and those showing growth on both the test and complete media are owing to events other than mitottc crossing over. For confirmed twin spots, recover the white (uracil reqmrmg) stram and the red (adenine requiring) strain from the appropriate positions on then respective plates, and prepare blocks for PFGE (see Chapter 7). Run in adjacent wells m a pulsed field gel and confirm the presence of recombinant YACs (see Notes 8 and 14). An example of a PFGE gel analysis of several twm spots is shown m Fig. 2.

3.4. Reduction

in YAC Number

1. Select a red clone containing the desired long recombinant from a twm spot, and retrofit with pRAN4 as described m Section 3.1. However, note that all transformed clones will now grow m the absence of uracil, as two YACs are present in each cell. If the desired long recombinant is present within white clones derived from twin spots, see Note 15. 2. Select five transformed clones, streak onto SD + C agar with tryptophan, and grow for 2 d at 30°C. 3. Using a sterile yellow pipet tip, scrape up a barely visible quantity of yeast cells from each clone, and individually resuspend in 1-mL aliquots of sterile water.

Genomic

227

Reconstruction

,.;:..; i ., ..,... :’.,,. : ‘: ..,,.:...i’...,:,:. ,.,. .,.‘i ./..Y:., ;.,,.._:..,. :.;..:.:.:.;,~,.‘.:.:‘: .+,: ,;.:.:; ..;::‘.;& ..,...,_: ‘3 y %~ ~-b f $2 kb

650 --c 550 -e 450 a 350 J,

.-

____I__

.-_

RING4

Fig. 2. PFGE analysis of twin spots. The filter has been hybridized with a marker contained within the overlapping region so that all YAC derivatives are revealed. The original diploid containing both YACs is contained in the lefthand lane, and respective red (r) and white (w) sectors from twin spots are run in adjacent lanes. In most cases,the red sector contains the long recombinant (650 kb) and the 450 kb parent YAC, and the white sector contains the short recombinant (350 kb) and the 550 kb parent YAC. The r7 sector shows an aberrant result. In addition to the two parent YACs in the lane containing the original diploid, faint bands representing the short and long recombinants can also be seen in this relatively overexposed autoradiograph, demonstrating spontaneous recombination events occurring during culture of this strain. Reproduced from ref. 4 with permission from the Oxford University Press. 4. Plate 10 pL of each suspension onto individual plates of SD + C agar with tryptophan and low adenine. Grow for 3 d at 30°C. 5. Examine the plates for the presence of occasional red colonies. Select one colony from each plate for PFGE analysis (see Chapter 7 and Note 8). Approximately half of clones analyzed should contain the desired YAC.

4. Notes 1. Although tryptophan is not strictly essential for the growth of AB1380 strains containing YACs, the TRPI gene carried on the left arm of pYAC4 is poorly functional, and this results in slow growth in the absence of tryp-

228

2.

3.

4. 5.

6.

Markie and Ragoussis tophan. Tryptophan supplementation is therefore added to all media described here, as there 1sno requirement for maintaining selection for this marker during the procedure. Low adenine supplementation (final concentration of 20 ug/mL) is used m plates for the development of red pigmentation in ade2 mutants. High adenine supplementation (final concentration of 50 ug/mL) 1sused in broth cultures for expansion of ade2 mutants. The authors have used an Amplirad PCR decontammatron chamber (Genetic Research Instrumentation Ltd., Felsted, Essex,UK) for UV exposure. This apparatus contains a 1.8 W germtcidal lamp (Coastwave GST5) and the surface of the plates is approx 14 cm from the light source m this apparatus. In this architecture a 3-s exposure produces a total dose of around 30 J/m* Other UV sources of the same wavelength should also perform well, and it may be preferable to choose a system with a lower power output, or where the exposed surface is further from the light source so that exposure times are not so short and difficult to reproduce accurately. If a meter for measuring UV dose is not available, it is possible to determine the required dose by examining the effect of various dose times on cell survtval. A dose that produces a survival of 90% (as determined by colony formation) when compared to an unexposed control plate should produce an adequate level of crossing over. Ultraviolet light is a serious hazard and precautions should be taken to prevent exposure. Wear eye, face, and hand protection if the source is not completely enclosed at all times. The production of slower growing pink colonies was an unexpected but consistent phenomenon observed following transformation with pRAN4. It is owing to the ability of this plasmid to replicate as a circular episome in yeast (with the ARS actrvtty most probably located within the short segment derived from SV40). However, in the absence of a centromere sequence it does not segregate with high fidelity, giving rise to cells with multiple copies (adenme independent, white), and those with no copies (adenine requiring, red). This mixed population produces the slow growing pink appearance of these colonies. The ratio of pink colonies (episomal transformants) to white (integrative transformants) varies according to the efficiency of digestion with BamHI, and if insufficient white colonies are produced with an excess of pink colonies the vector should be prepared again and digestion confirmed prior to transformation. Significant numbers of colonies on the nontransformed control plates suggests a high proportion of ADE2 revertant or suppressor mutations in the culture used for transformation. If this occurs, it is advisable to return to the earliest available source of the clone to be retrofitted and to streak thts

Genomic Reconstruction

229

for single colonies on media contammg limitmg ademne (SD + C agar supplemented with low ademne and tryptophan). After 3 d growth, single red colonies should be selected and confirmed to contain the desired YAC. To avoid a growth advantage for revertant/suppressor mutants that may spontaneously arise when this clone is expanded m broth culture prior to retrofitting, ensure that the adenine concentration during this growth is not limiting (use SD + C broth with high adenine and tryptophan). 7. Some YAC clones fail to produce any clones that require uracil following transformation with pRAN4. These will invariably contam two YACs, either owing to cotransformation (often apparent on PFGE analysis) or YAC duplication (not apparent on PFGE analysis). Before proceeding further, they must first be subjected to the procedure described m Section 3.4. for loss of one of the chromosomes. 8. Southern blotting and hybridization with a suitable probe may be necessary to reveal the presence of YACs obscured by yeast chromosomes. 9. All centrifugation steps should be at room temperature. 10. Yeast cells that have had their cell walls removed are osmotically unstable in hypotonic solutions and cell lysis (as measured by a reductron in ODbOc after dilution in 2% SDS) is a convenient indicator of the progress of the protoplasting reaction. 11. All centrifugation, pipeting and mixmg steps should be undertaken with care following the addition of lyticase, as protoplasts are fragile and may lose viability if mistreated. 12. If there are significant numbers of colonies on one or both of the two nonfusion control plates, this suggestsreversion occurring during clone expansion prior to fusion. Check the phenotype of strains prior to expansion and grow under conditions that do not favor revertant clones (see Note 6). 13. Two series of plates are used to ensure that at least one series will provide colonies at the right density, such that there are adequate numbers of twin spots evident, but where the colonies are not too close together to interfere with colony pickmg. Once experience is gamed in cell counting, plating, and UV exposure, it may be possible to predict cell counts that will reproducibly give adequate colony densities under the conditions used. 14. If the choice of retrofitted YAC was made according to the suggestion m Section 1.3.1., then the red clone will contain one parental YAC and the desired long recombinant, and the white clone will contain the other parental YAC and the short recombinant. If chimerism is present in one or both YACs, then the length of recombinant YACs may be unpredictable (but consistent between twin spots). In this case it would be advisable to examine marker content to confirm the desired recombinant.

230

Markie and Ragoussis

15. If the long recombinant appears within the white clones derived from twm spots, then it is not possible to retrofit with pRAN4 as adenme selection is no longer available. However, it should still be possible to use the right arm of pYAC4 as a retrofitting vector m this case. Isolate the 5-kb fragment from a gel after digesting pYAC4 with EcoRI and BarnHI. Use 0.1-0.5 pg to transform the desired clone (as described m Section 3.1.) and plate on SD + C agar with tryptophan. Contmue the procedure from step 2 of Section 3.4.

References 1. Stem,C. (1936) Somaticcrossingover andsegregationin Drosophzla melanogaster. Genetics 21, 625-730 2. Pontecorvo, G. andKafer, E (1958) Geneticanalysisbasedon mitotic recombrnation. Adv Genet. 9,7 l-104 3 Poulter, R., Hanrahan, V., Jeffery, K , Markze, D , Shepherd, M G , and Sullivan, P. A (1982) Recombination analysis of naturally diploid Candzda albzcans J Bacterzol 152,969-975 4. Ragoussis, J., Trowsdale, J., and Markze, D. (1992) Mitotic recombmatzon of yeast artificial chromosomes Nuclezc Aczds Res 20, 3 135-3 138. 5 Den Dunnen, J. T., Grootscholten, P M., Dauwerse, J G., Walker, A. P , Monaco, A. P , Butler, R., et al. (1992) Reconstructton of the 2.4 Mb human DMD-gene by homologous YAC recombination. Hum Mol Gen. 1, 19-28. 6. Markie, D., Ragoussts, J., Senger, G., Rowan, A , Sansom, D , Trowsdale, J., et al (1993) New vector for transfer of yeast artzficzal chromosomes to mammalzan cells Sam. Cell Mol. Genet 19, 161-169 7. Ito, H., Fukuda, Y., Murata, K., and Ktmura, A. (1983) Transformation of intact yeast cells treated with alkali cations J Bacterial 153, 163-l 68. 8. Rotomondo, F. and Carle, G. F. (1994) Genettc selection of metotic and mitotzc recombinant yeast artzficzal chromosomes Nuciezc Aczds Res 22, 1208-1214 9. Hezkoop, J. C., Steensma, Y , van Ommen, G.-J. B , and Den Dunnen, J T. (1994) A simple and rapid method for separating co-cloned YACs. Trends Genet lo,40

CHAPTER21 Amplification Lucy

of the Copy Number of YACs

L. Ling, Douglas R. Smith, and Donald T. Moir

1. Introduction The ability to propagate long fragments of DNA cloned in Saccharomyces cerevisiae as yeast artificial chromosomes (YACs) represents a significant advance in cloning technology. Its introduction m 1987 (1) demonstrated the cloning of human DNA with the pYAC series of vectors in the yeast host AB1380. Subsequently, many other libraries have been generated from different DNA sources, with varying average insert sizes and using different combinations of YAC vectors and yeast hosts (2-5). Because DNA replication initiates only once/cell cycle in yeast cells at each chromosomal origin of replication (6) with equal segregation of replication products (7-g), these clones consist of only one YAW haploid cell. This limits the sensitivity and convenience of using YACs. In 1990, cloning vectors were introduced that allowed selection of cells carrying amplified numbers of YAC copies (IO). In S.cerevisiae, centromere function can be inactivated by transcription toward the centromere (II13). Disruption of centromere mnction can lead to unequal segregation (I I, 12). There are several types of selective markers available that confer a growth advantage to cells containing multiple copies of the marker with concomitant loss of cells lacking copies of the marker from the population (13-I 6). Amplification of copy number results when unequal segregation is coupled with a strong selective growth advantage for cells containing multiple copies of a vector marker (11,12,17) and thus multiple copies of From Methods m Molecular Bology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

231

232

Ling, Smith, and Moir

the YAC. This is the basic principle used in the amplification vectors currently available, exemplified by the first such vector, pCGS966. A map of pCGS966 with all the essential elements is shown in Fig. 1. In addition to the usual markers, such as URA3 and TRPl, to permit screening for the presence of YACs after transformation, these vectors also have the necessary elements for amplification: a centromere, made conditional by virtue of its location downstream from an inducible GAL1 promoter, and a selectable marker, the thymidine kinase gene. The centromere is functional in glucose supplemented medium that represses transcription from the GAL1 promoter. However, growth m galactosesupplemented medium, in the absence of glucose, results in transcription from the GALJ promoter toward the centromere, thus dtsrupting the function of the centromere. This results in unequal segregation of the artificial chromosome containing this centromere. The thymidine kinase marker is used in amplification vectors because it is responsive to a wide concentration range of selective agents (IO, 14). Also, yeast cells do not possess an endogenous thymidine kinase gene (14,18). The expression of thymidine kinase can be selected for by growth in thymidine, methotrexate (amethopterin), and sulfanilamide. Methotrexate and sulfanilamide are folate antagonists that inhibit the enzymes involved in the recycling and de ylovo synthesis of folate cofactors required for the synthesis of deoxythymidine monophosphate (19). DNA synthesis in the presence of these two compounds is possible only for cells that can take up exogenous thymidine as well as express a thymidine kinase gene. The presence of multiple copies of YACs and the resulting multiple copies of the thymidine kinase gene confers a growth advantage. Thus, a combination of galactose-induced disruption of a conditional centromere concomitant with strong selection for multiple copies of the thymidine kinase gene results in cells with amplified numbers of YAC copies. The extent of amplification appears to be related to the number of cell divisions. A minimum of about seven generations is required for significant amplification (20). Although amplification tends to be maximal for small YACs, 20-25 copies have been observed for YACs >600 kb (10,20). Most YAC libraries are based on the original system, a pYAC type of vector in the yeast host AB1380. Vectors are now available to convert these single-copy pYAC-derived clones to amplifiable ones ($21). These conversion vectors come with different markers to select for successful exchange of YAC arms. However, the amplification scheme works on

Amplification

of the Copy Number

- 19.5

of YACs

233

kb

TEL \ BaDm

Fig. 1. Map of pCGS966. The essential elements for amplification are the GAL1 promoter, the conditional centromere (CEN4), and the thymidine kinase gene (TK). TEL, telomere; on’, origin.

the same principle as the amplification vectors, and the design of these conversion vectors is basically the same as the TRPI arm of pCGS966. Of all currently available conversion vectors for amplification, pCGS990 appears to have the highest success rate of conversion. (For more information on conversion/retrofitting of YACs, see Chapter 17.) Unfortunately, AB1380 does not grow well on galactose and the capacity to use galactose as a carbon source is important for maximal copy number amplification. The amplification observed in successfully converted pYAC-derived chromosomes in AB 1380 is usually less than in host strains that grow well on galactose. For maximal copy number amplifications, converted pYAC-derived chromosomes can be reintroduced into strains that grow well on galactose. Several yeast host strains such as CGY2557 and CGY2570 have been developed that retain the transformation potential of AB 1380, carry useful genetic markers, and grow well on galactose, thus showing a maximal amplification of copy number (5).

234

Ling,

Smith,

and Moir

2. Materials 1. Amplifiable YAC: A pYAC4-derived YAC which has been converted for amplificatton (see Chapter 17 for conversion/retrofitting of YACs), or a YAC from an amplifiable YAC library (22). 2. Amplification vectors: pCGS966 (ATCC6837 1) has an EcoRI cloning site. pCGS970 (s&l cloning site), pCGS969, pCGS988, and pCGS999 (all Not1 cloning site) are designed for use with partial fill-in or nonself-complementary ohgonucleottde adapter cloning schemes (available on request from Genome Therapeutics, Waltham, MA). 3. Yeast host strains (with genotype) (available on request from Genome Therapeutics): a CGY2557 MATcl ura3-52 trpllys2-I ade2-I canl-100 hm5 leu2-3 w+. b. CGY2570 (ATCC90435) MATa ura3-52 trpl-A63 lys2-A202 hzs3A200 ade2-I

leu2-Al

y’+,

4. Sulfamlamide (200X): 200 mg/mL m N,N’-dimethyl-formamide. No sterilization required. Store at -20°C. 5. Methotrexate (amethopterm) (100X): 10 mg/mL in 50 mMNaOH. No sterilization required. Store at -20°C. 6. Thymidine (50X): 40 mg/mL in water. Filter sterilized. Store at -20°C 7. Galactose (10X): 20 g/100 mL in water. Sterilize. Store at room temperature. 8. AHC medium: (see Chapter 29): Can be made wtthout a carbon source to be supplemented with either 2% glucose or 2% galactose as required. May be supplemented with 2% agar to make plates. 9. Amplification medium: AHC medmm with 2% galactose substituted for glucose, and containing 1 mg/mL sulfanilamide, 10 pg/mL methotrexate (amethopterin), and 0.8 mg/mL thymtdine. IO. YPD medium (see Chapter 29).

3. Method 1. Obtam YACs wtth features requtred for copy number amphficatton. Build YACs m pCGS966, retrofit from pYAC4, or isolate from libraries of YACs built m amplifiable vectors. 2. Streak out the clone of choice on a selective AHC plate containing 2% glucose as the carbon source, selecting for the presence of both vector arms. Be sure that the YAC contams all the necessary elements for amplrfication (see Note 1). 3. Grow at 30°C for 2 d or until sizable (l/16 in. or larger) colonies are seen. 4. Use a large colony to inoculate 5 mL AHC medium with 2% galactose as the carbon source m place of glucose (see Note 2). 5. Grow with aeration (loose caps) until saturation to OD,,, > 2.0. It may take 2 d to overcome the growth lag caused by transfer from glucose to

Amplification

of the Copy Number of YACs

235

galactose as a carbon source. The rate of growth also depends on the yeast host strain and its ability to use galactose as a carbon source. Saturation is reached at a lower cell density than is observed durmg growth m glucosesupplemented media. 6. Subculture at l/100 dilution, transferring 50 pL of the culture directly into 5-mL amplification medium. If using only one round of growth in methotrexate and sulfamlamtde, subculture at l/200. Use 2X concentration of sulfanilamtde, methotrexate, and thymidme for inefficient galactose users such as AB 1380 (see Notes 3-5). 7. Grow with aeration at 30°C until saturation (ODeoO> 2.0). This usually takes longer than 2 d, especially for inefficient galactose users because the amplification medium strongly mhibits growth. Growth m the amplification medium also changes the morphology of the cells that form large clusters and chains. 8. Subculture at l/10 dilution, transferring 0.5 mL mto 5 mL fresh amplification medium. This second subculture increases the copy number in yeast host strains that grow well in galactose. It may be omitted, depending on the amount of amplification desired and the host strain. 9. Grow cells until saturated to ODboO> 2.0. This usually takes another 2 d (see Note 6). 10. Subculture at l/100 dilutton, transferring 50 FL mto 5 mL of YPD or AHC medium (see Note 7). 11. Grow until saturated. This usually only takes a day because the cells grow faster and revert to a nearly normal morphology m this nonselective growth medium. This step increases the efficiency of cell wall digestion by lytic enzyme with minimal loss of ampltficatton. Cells that have gone through thts subculture in YPD should not be regrown m amplification medium because this can cause instability and deletions in YACs. 12. Harvest cells by centrifugation. Prepare the yeast genomic DNA in agarose plugs (see Chapter 7). 13. Measure the amount of copy number amplification by pulsed field gel electrophoresis of amplified and unamplified samples followed by ethidium bromide staining. 14. Expect an amplification of 10-25 copies for most YACs, with those in AB 1380 falling at the lower end of the range (see Note 8).

4. Notes 1. The selective plates can be made with 2% galactose substituted for glucose, for clones that grow well on galactose. 2. Yeast cells grow better at a fairly heavy initial inoculum.

Ling, Smith, and Moir 3. For amplification in strams that grow poorly on galactose, such as AB 1380, it ts most convenient to subculture only once at l/100 dilution m amplification medium supplemented with twice the concentration of sulfanilamide, methotrexate, and thymidine. Let the culture grow to saturation as described in Section 3., step 7, skip steps 8 and 9, and proceed to step 10. 4. For amplification of copy number in microtiter plates, grow cells overnight in AHC medium with 2% galactose as the carbon source in place of glucose, subculture at l/l 00 dilution into amplification medium, and grow until the bottom of the wells are covered with cells. 5. For amplification on agar plates, patch or replica plate the clones onto amplification medium supplemented with twice the concentration of sulfamlamide, methotrexate, and thymidine in 2% agar. Let the cells grow for 4-7 d until sizable colonies are seen. The colonies or patches will have a yellowish color. Replica plate to YPD plates and grow overnight before use. 6. The cells in amplification medium can be harvested by centrifugation and stored frozen in 15% glycerol at -70°C for later regrowth in YPD. 7. The cells reach a higher density with growth in YPD than in AHC medium without any significant loss of amphtication. 8. Low amplification may be owing to insufficient growth m the amplification medium. To boost amplification, cells from the first or second subculture m amplification medium can be further grown in amplification medium with a higher concentration of sulfamlamide, methotrexate, and thymidine. References 1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segmentsof exogenousDNA into yeastby means of artificial chromosomevectors. Science 236,806-8 12 2. Coulson, A., Waterston,R., Kiff, J., Sulston,J., and Kohara, Y (1988) Genome linking with yeastartificial chromosomesNature 335, 184-I 86. 3 Guzman,P. andEcker,J. R (1988) Development of large DNA methodsfor plants. molecular cloning of large segmentsof Arubidopsis and carrot DNA into yeast. Nuclezc Acids Res. 16, 11,09l-l 1,105 4. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Korsmeyer, S. J., Schlessmger,D., and Olson, M. V. (1989) Isolation of single-copy human genes from a library of yeastartificial chromosomeclones.Scrence 244, 1348-1351. 5 Smith, D. R. (1994) Vectorsand host strainsfor cloning and modification of yeast artificial chromosomes,in YAC Libraries A User’s Guide (Nelson, D L. and Brownstem, B. H , eds.),Freeman,New York, pp. 1-31. 6. Fangman,W. L., Hice, R. H., and Chiebowicz-Steclziewska, E. (1983) ARS replication during the yeastS phase.Cell 32,83 l-838.

Amplification

of the Copy Number of YACs

7. Clarke, L. and Carbon, J. A. (1980) Isolation of a yeast centromere and construction of functional small crrcular chromosomes. Nature 287,504-509. 8. Murray, A. W., Schultes, N. P., and Szostack, J. W (1986) Chromosome length controls mitotic chromosome segregation in yeast. Cell 45,529-536. 9. Hieter, P., Mann, C., Synder, M., and Davis, R. (1985) Mitotrc stability of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40,38 l-392 10. Smith, D. R., Smyth, A. P., and Moir, D. T. (1990) Amplification of large artificial chromosomes. Proc Natl. Acad. Sci. USA 87,8242X3246. Il. Chlebowicz-Sledziewska, E. and Sledziewski, A. Z. (1985) Construction of multicopy yeast plasmids with regulated centromere function. Gene 39,25-3 1. 12 Hill, A. and Bloom, K. (1987) Genetic manipulation of centromere function. Mol. Cell. Blol. 7,2397-2405.

13. Beggs, J. D. (1978) Transformation of yeast by a replicating hybrid plasmid. Nature 275, 104-109. 14. McNeil, J. B. and Friesen, J. D. (1981) Expression of the herpes simplex virus thymidme kinase gene in Saccharomyces cerevulae. MOE Gen Genet 184,386-393. 15. Zealy, G. R., Goodey, A. R., Piggot, J. R., Watson, M. E., Cafferkey, R. C., Doel, S. M., et al. (1988) Amplification of plasmid copy number by thymidme kmase expression in Saccharomyces cereviszae. Mol Gen. Genet 211, 155-159. 16. Zhu, J., Contreras, R., Gheysen, D., Ernst, J., and Fiers, W. (1985) A system for dominant transformation and plasmid amplification m Saccharomyces cerevuiae. Bzo/Technology 3,45 l- 456. 17. Murray, A. W. and Szostack, J. W. (1987) Pedigree analysis of plasmid segregation in yeast. Cell 34,96 l-970. 18. Grivell, A. R. and Jackson, J F. (1968) Thymidine kinase: evidence for its absence from Neurospora crassa and some other microorgamsms, and the relevance of this to the specific labellmg of deoxyribonucletc acid J. Gen Mcroblol 54,307-3 17. 19. Goodey, A. R., Doel, S. M., Piggot, J. R., Watson, M. E. E., Zealy, G. R., Cafferkey, R., and Carter, B. L A. (1986) The selection of promoters for the expression of heterologous genes in the yeast Saccharomyces cerevwae. Mol Gen Genet. 204, 505-511. 20. Smith, D. R., Smyth, A P , and Moir, D. T. (1992) Copy number amplification of yeast artificial chromosomes Methods Enzymol. 216,603-614. 21. Smith, D. R., Smyth, A. P., Strauss, W. M., and Moir, D. T. (1993) Incorporation of copy-number control elements into yeast artificial chromosomes by targeted homologous recombination. Mammal. Gen. 4, 141-147. 22. Moir, D. T., Dorman, T. E., Smyth, A. P., and Smith, D. R. (1993) A human genome YAC library in a selectable high-copy-number vector. Gene 125,229-232.

CHAPTER22

Transfer of YAC Clones to New Yeast Hosts Forrest

Spencer

and

Giora

Simchen

1. Introduction

Yeast artificial chromosome (YAC) clones are propagated in yeast, a host organism with a variety of established techniques for altering DNA sequences by homologous recombination in vivo. The modification of existing YAC clones allows the removal of undesired insert DNA (e.g., neighboring coding sequences or chimeric segments), the introduction of new selectable markers, or the replacement of wild-type DNA with defined mutant alleles. To use existing vector systems for YAC manipulation by homologous recombination, transfer to other yeast hosts is often necessary. The development of alternative host strains has been motivated in part by the paucity of nonreverting genetic markers in the genotype of the common library host AB1380 (1). In addition, clones with unstable inserts may be more faithfully propagated in recombinationdeficient yeast strains (see, e.g., 2-4). At this time, three different methods for transfer of YACs to new hosts have been described. Two commonly used methods are transfer by traditional genetic cross (spore colony analysis after mating and meiosis) and yeast transformation with chromosome-sized DNA molecules. These techniques work well, but present significant technical barriers to use by laboratories not routinely applying them. The manipulations involved in these two methods are described in detail in Chapters 1 and 19 and in brief descriptions presented at the end of the Methods section. For most purposes, a newer method, transfer by Karl- mating, will be more efficient. This method From Methods m Molecular Bology, Vol 54 YAC Protocols Edited by D Markle Humana Press inc , Totowa, NJ

239

240

Spencer and Simchen

employs simple microbiological techniques (yeast culture and the use of selective media) and is described in detail herein. After transfer by any method, the presenceof a YAC clone of expected structure should be veritied by analysis of the electrophoretic karyotype of the recipient yeast strain. In examples described herein, AB 1380 serves as the YAC donor, and YPH857 (or related strain YPH925) as the new host. For YAC modification, the most useful new genetic markers in these strains are his3A200, leuddl, and cyh2R. his3A200 is a nonreverting complete gene deletion that will support the efficient recovery of relatively rare recombination events, e.g., those that must occur through sequences with imperfect homology, such as human Alu repeats (5). Using this marker, false-positive background transformants (owing to reversion or gene conversion from the introduced HIS3 gene copy) are not observed. The pair of markers leu2Al and cyh2R can be used to provide the sequential positive and negative selections employed in a two-step replacement paradigm (6,7) for the introduction of defined DNA sequence modifications. YPH925 is YPH857 after introduction of the mutation karl Al 5. 1.1. Transfer by Karl- Mating In this method, a YAC is transferred between nonfused nuclei in a defective mating (from donor to recipient), and cells of the recipient genotype with the newly introduced YAC are identified as viable colonies on selective medium. Laboratory yeast can be cultured in either haploid or diploid phases of the life cycle (8). When yeast cells from haploid strains of opposite mating type encounter one another, they will fuse to form diploid cells. The processes involved in cell fusion include directed cell growth resulting in “schmoo” formation, cell/cell adhesion and the degradation of cell walls at the schmoo tips, plasma membrane and cytoplasmic fusion to form a heterokaryon, and nuclear fusion (karyogamy) mediated by a spindle-like microtubule-based structure. The yeast KARl gene was first identified in a mating defective mutant that formed heterokaryons, but failed in nuclear fusion (9). Subsequent studies have shown that the IURI gene encodes a polypeptide that is essential for viability and is associated with the yeast microtubule organizing center (IQll). A subset of karl mutants, however, are fully viable and exhibit only the defect in nuclear fusion during mating, as observed for cells carrying the original mutant allele.

Transfer of YAC Clones to New Yeast Hosts YAC transfer by Karl- mating is illustrated in Fig. 1. To initiate the process, donor strain cells are mixed with recipient cells in approximately equal numbers and allowed to mate. In a Karl- mating, cellular fusion produces heterokaryons with normal frequency, but processes required for nuclear fusion are highly defective. Therefore, true diploids form rarely (from -1% of heterokaryons), whereas -99% of heterokaryons generate daughter cells that inherit a nucleus of one (either) parental genotype. This is indicated in Fig. 1 by the heavy arrow in the nonfusion pathway. Most daughters from a nonfusion heterokaryon will exhibit a nuclear genotype identical to either parent in a mixed cytoplasmic environment (9). These are referred to as “cytoductants.” At a low frequency, cytoductants are produced that have inherited a chromosome from the opposite parent: approx 0.1% of cytoductants exhibit acquisition of a given transferred chromosome. These have been referred to as “chromoductants” (12). YACs can also be transferred (13) and cytoductants that have acquired a YAC have been called “YACductants” (1#,15). The molecular events that result in chromosome transfer in Kar l- matings are not well understood. For YAC transfer by Karl- mating, the donor and recipient strains must have several properties. They must be haploid yeast strains of opposite mating type, and at least one of the two must be Karl-. The recipient strain must contain a recessive drug resistance marker, such as canlR (resistance to the poisonous arginine analog, canavanine) or cyJ~2~ (resistance to cycloheximide). The yeast CANI gene encodes argmine permease (Id), and cad mutations provide recessive drug resistance because a single wild-type allele will allow lethal canavanine uptake. The yeast CYH2 gene encodes the ribosomal protein L29, which can mutate to cycloheximide resistance (17). cyJ~2~mutants are recessive, presumably because the presence of cycloheximide sensitive ribosomes on polysomes prevents the resistant ribosomes from completing translation. This recessive resistance conferred by either of these markers provides a means of selection for the recipient strain genotype in haploid state. The recipient must also contain an auxotrophic marker (e.g., ura3) that can be complemented by a prototrophic allele present on the YAC to be transferred (e.g., URA3). Thus, among products generated in a Karlmating, YACductants are identified as cells that simultaneously exhibit drug resistance (unlike true diploids, or the parental donor strain), and YAC marker prototrophy (unlike the parental recipient strain).

242

Spencer and Simchen

DONOR --DRUGSENSITIVE(DOMINANT) --YACMARKERPROTOTROPHY

RECIPIENT &a+

Cvh s ii;’

--DRUGRESlSTANT(RECESSIVE) --YACMARKERAUXOTROPHY

CyhR Ura‘Trp‘

HETEROKARYON

HAPLOIDPRODUCTS

Cytoductants

Normal Diploid --DRUGSENSITWE Cyhs --YACMARKERPROTOTROPHY

Iho+ Trp+

-- DRUGRESISTANT CyhR --YACMARKERAUXOTROPHY OR --DRUGSENSITIVE Cyhs --YACMARKERPROTOTROPHY

Ura-Tq-

Um+Ttp+

YACductant -_DRUGRESISTANT CykR --YACMARKERPROTOTRPHY

Ura+ Trp+

Transfer of YAC Clones to New Yeast Hosts

243

In practice, a variable but significant fraction (range 3080%) of colonies resulting from this double selection are found to be bona fide YACductants on analysis of their electrophoretic karyotype (‘#,15). The remainder are principally derived from diploid cells that have become drug resistant owing to loss of the dominant sensitivity allele. (This may have occurred by loss of the chromosome with the sensitive allele, segregation after mitotic recombination to produce homozygous drug resistance alleles, gene conversion of the sensitive to the resistant allele, or new mutation of the sensitive allele to a resistant form.) It is therefore often desirable to employ an additional criterion to positively identify a transfer product. Of the several possibilities, the use of a replica plate test is described. This test determines the status of a recessive auxotrophic marker from the recipient parental genotype, which would be complemented in a diploid. After this screening, candidates are subjected to electrophoretic karyotype analysis. Virtually all are found to be YACductants. 1.2. Versatile Application of Transfer by Karl- Matings In the example given in this Chapter, a YAC is transferred from AB1380 to YPH925, its recipient and new host, in a single transfer step. However, YAC transfer in Karl- matings can be applied with considerable versatility using either of the following

two strategies.

1. Two properties of Karl- chromosome transfer allow further flexlbrhty. the Karl- defect is unilateral (a single mutant parent specifies the mating defect) and chromosome transfer is bidirectional (the karZAl5 parent may be either the YAC recipient or donor). Moreover, YAC transfer can also be accomplished in matings between two karZAl5 strains. These properties have lead to the suggestion that a YAC can be moved between vntually any pair of hosts in Karl- matings using a series of two or three transfer steps (IS). For example, a YAC transferred from AB1380 into YPH925 can now be transferred to a MA Ta canZR recipient that will allow selection of one or both YAC markers (URA3 and TRPI). Thus second step wrll Fig. 1. (previous page) YAC transfer. Phenotypic characteristics that distmguish the yeast strains established by each colony type are described. At least one of the parental strains must be a karl mutant. The phenotypesgiven in italics represent the cross described in the example: AB1380 + YAC (donor) by YPH925 (recipient).

244

Spencer and Simchen

provide immediate access to yeast hosts with new genetic markers useful in YAC modification. It may also be useful m facilitating the transfer of unstable clones into a recombmation deficient host. The recipient m the second step need not contain the karlAl mutation since the donor does, although both donor and recipient may be mutant (15). The basic requirements for recipient strains in secondary (or tertiary) transfer steps are: the appropriate mating type; a selectable recessive drug resistance marker that is not present in the immediate YAC donor; and auxotrophy for a marker carried on the YAC. The number of transfer iterations required to construct the desired strain using this method will be dictated by the mating type of the final recipient. In addition to YPH925, three other strains useful as mtermediaries for series transfer protocols are available through the American Type Culture Collection (ATCC). The four related strains and their genotypes are: a. YPH925: MATa ura3-52 1~~2-801ade2-101 his3A200 trplA63 leu2Al cyh2R karl Al 5 (ATCC accession #90834); b. 2477: MATa ura3-52 iys2-801 ade2-101 hts3A200 trpldl leu2Al canlR karlAl (ATCC accession #90835); c. 2479: MATa ura3-52 lys2-801 ade2-101 hts3A200 trpldl leu2Al canlR karlAl (ATCC accession #90836); and d. 2480: MATa ura3-52 lys2-801 ade2-101 his3A200 trplA63 leu2Al cyh2R karlAl (ATCC accession #90837). 2. New recipient strains with desired genetic properties can be constructed by introducing the cloned karlAl allele using two-step gene replacement methods (18; and Chapter 18). LYS2- and UZL43-based integrating plasmids suitable for this purpose have been generated (E. Vallen and M. Rose, unpublished; 14).

2. Materials 1. Yeast strains: a. AB1380 + YAC: MATa ura3 lys2-lot ade2-lot his5am trpl canl1000~ Ile- Thr- + YAC (URA3 TRPZ); b. YPH925 (see Note 1): MATa ura3-52 lys2-801 ade2-102 his3A200 trplA63 leu2Al cyh2R karlAl5. 2. Media: See Chapter 29 for medta formulations. For YAC transfer, liquid media required are YPD and SD + lys + ade + his

+ leu + ile + thr. Platesrequiredare SD + trp + lys + ade + his + leu with cycloheximide, SD + lys + ade + his + leu + cycloheximide, and SD + lys + ade + his + cycloheximide.

Transfer of YAC Clones to New Yeast Hosts

245

For analysis of electrophoretic karyotypes, liquid media required are SD + lys + ade + his + leu (for colony-purified candidate YACductants), SD + lys + ade + his + ile + thr (for AB1380 + YAC), and YPD (for AB1380 and YPH925). Add supplements at these final concentrations: 20 mg/L uracil, 30 mg/L L-lysine, 20 mg/L adenine sulfate, 20 mg/L L-hi&dine, 20 mg/L L-tryptophan, 30 mg/L L-leucine, 30 mg/L L-isoleucine, 200 mg/L L-threonine. Supplements may be conveniently prepared as filter-sterilized 1OO-fold concentrated stocks and added after the other ingredients are autoclaved. Where appropriate, cycloheximide is added to media just prior to pouring at a final concentration of 3 mg/L. A filter-sterilized stock solution of 10 mg/mL cyclohextmide in HZ0 may be stored at 4°C.

3. Methods 3.1. Transfer by Karl-

Mating

1. Grow overnight cultures of YPH925 in 5 mL YPD liquid medium, and AB1380 + YAC in 5 mL SD + lys + ade + his + ile + thr liquid medium (which maintains selection for the presence of the YAC). 2. Determine the culture density by measuring absorbance at 600 nm m a spectrophotometer and converting to cells per milliliter. (An absorbance at 600 nm of 0.1 indicates -lo6 cells/ml. The overnight cultures wtll probably have to be diluted between lo- and 1OO-fold to measure within instrument range.) 3. Pellet lo7 cells each of YPH925 and AB 1380 + YAC in 1.5-mL Eppendorf centrifuge tubes by spinmng about I5 s in a microcentrifuge. 4. Resuspend YPH925 and AB1380 + YAC cells together in a total of 1 mL fresh YPD liquid, and transfer the mixture to a sterile culture tube. 5. Culture together at 30°C for 4-6 h with good aeration (e.g., on a tilted rotatmg drum) (see Note 2). 6. Plate the cells onto SD + lys + ade + his + trp + leu with cycloheximide (see Note 3) in a dilution series on three plates: 50 pL, 300 pL, and remainder (see Note 4). 7. Incubate plates at 30°C for 4-6 d. Large colonies should appear over a heavy lawn of plated cells. (A good mating should yield 2200 Cyh2R Ura+ Trp+ colonies.) 8. Replica plate to SD + lys + ade + his + leu + cycloheximide, and culture for l-2 d at 30°C. This will remove much of the heavy lawn, as well as provide selection for the other YAC marker. 9. Replica plate again to SD + lys + ade + his + leu + cycloheximide, as well as SD + lys + ade + his + cycloheximide (no leucine). This step distin-

246

10. 11. 12. 13.

14.

Spencer and Simchen guishes YACductants from the undesirable Cyh2R diploid false-positive colonies: CyhR YACductants will be unable to grow without leucine (leu2Al), whereas the diploids will be leucine prototrophs (LEU2/ZeuZAl) (see Note 5). Incubate plates at 30°C for l-2 d. From the SD + lys + ade + hts + leu + cycloheximtde plate, choose SIXlarge well-spaced colonies that are unable to grow on the plate without leucine. Streak each of the six for single colonies on SD + lys + ade + his + leu + cycloheximrde, and choose a single colony from each to estabhsh strain stocks. For each candidate YACductant strain, prepare high molecular weight DNA from yeast m agarose, and separate the chromosomes on a pulsed field gel (see Chapter 7) Include AB 1380 (no YAC), AB 1380 + YAC, and YPH925 as useful controls. Examine the electrophoretic karyotype of each(see Note 6). A YACductant will have yeast chromosomes correspondmg to the recipient, wrth the addition of a YAC band (see Figs. 2 and 3). In additton, cotransfer of natural yeast chromosomes will occur m approx 20% of YACductants (14,25). These are visualized as extra bands within the YPH925 karyotype (with migration of AB 1380 chromosomes), or increases in band intensity. Although these cotransferred chromosomes will seldom be of any importance m subsequent manipulations of the transferred YAC, YACductants containing them can be avoided by careful analysts of the karyotypes.

3.2. Transfer by DNA-Mediated Transformation In this method, the YAC clone is prepared from the donor as deproteinated high molecular weight DNA in low-melting point agarose blocks (described in detail in Chapter 7), and introduced into the recipient by transformation of very high efficiency yeast spheroplasts, described in detail in Chapter 1). For example, a pYAC4 clone can be transferred from AB1380 to YPH857 with the following manipulations. Chromosome-sized DNA is prepared from YAC-containing yeast cells suspended in low-meltingpoint agarose.Approximately 200 ng of high molecular weight total yeast DNA in 10 pL molten agarose are used to transform recipient yeast cells made competent by spheroplasting. YPH857 cells in logarithmic phase (3 x lo7 cells/ml) are spheroplasted by controlled treatment with an enzyme preparation that degrades the yeast cell wall (i.e., Zymolyase or Lyticase). The spheroplasts are then exposed to the transforming total yeast DNA in the presence of polyamines (0.3 rnA4 spermine, 0.75 n.M

Transfer of YAC Clones to New Yeast Hosts

247

Yeast Chromosomes

XI VIII, v IX III VI I

Fig. 2. Electrophoretic karyotypes of AB1380 and YPH925. A photograph of a CHEF gel stained with ethidium bromide shows the chromosome length polymorphisms observed in comparison of the karyotypes of ABl380 and YPH925. Electrophoresis was in 1% low EEO agarose in 0.5X TBE at 200 V. Field direction was switched every 60 s for 16 h, and then every 90 s for 16 h. As shown, theseconditions separateDNA molecules in the yeastkaryotype (21), with an effective range from chromosome I (2 10kb) through chromosome IV ( 1400 kb).

spermidine), polyethylene glycol, carrier DNA, and calcium chloride. They are then subjected to a mild heat shock, allowed a short period of recovery in rich media-containing sorbitol for osmotic balance, and plated in a top agar layer on sorbitol-containing plates that select for the growth of transformants exhibiting YAC marker acquisition (UE43 and TRPI). The identity of transformants as YPH857 containing an intact, newly introduced YAC clone should be confirmed by electrophoretic karyotype analysis. Successful use of this method requires the production of yeast spheroplasts with very high transformation competence, i.e., that yield approx 500 transformants per nanogram of a test circular plasmid such as pYAC4 (19). (The control circular minichomosome should be introduced in a

Spencer and Simchen

248

-

F

- YAC

Fig. 3. YACductant identification by electrophoretic karyotype. A CHEF gel illustrating YAC transfer by Karl- mating is shown. Electrophoresis conditions chosen (1% agarose, 0.5X TBE, 2OOV, with gradually increasing pulse times from 5-35 s) display the length polymorphisms between the small yeast chromosome bands of the donor and recipient, as well as presence of the YAC band. The YACductant on the left shows cotransfer of AB1380 chromosome IX (note the band 4 doublet). h, 50-kb ladder of unit length lambda phage and concatemers.

parallel tube of competent yeast cells without polyamines: Treatment with these will dramatically decreasethe efficiency of transformation by small quantities of circular DNA.) In general, this protocol can be expected to yield a few to dozens of YAC transformants. 3.3. Transfer

by Traditional

Genetic

Cross

By this method, desired genetic markers for the new host background are introduced by forming heterozygous diploids, and analyzing meiotic products to identify YAC-containing spore colonies of preferred genetic composition. The resulting strain will contain the specifically selected markers, and will be otherwise a mixture of the two parental laboratory strain backgrounds. Access to a tetrad dissection microscope is required.

Transfer of YAC Clones to New Yeast Hosts Briefly, cells of opposite mating type are cultured together, and subjected to genetic selection for diploids (e.g., using complementing auxatrophic markers) or physically manipulated to isolate zygotes from the mating population. The resulting diploid colonies will contain the YAC, and desired markers in heterozygous state. Diploid yeast are induced to undergo meiosis (sporulation) by culturing on low nitrogen media, generally for 3-5 d. The product of meiosis is an ascus containing four spores derived from a single diploid cell. Spores from individual tetrads can be physically manipulated for analysis using a microscope equipped with a glass microneedle. These spore products will germinate on return to rich media, and, if they have been separated from one another, can be analyzed for segregation of genetic markers by replica plating to various selective media. The number of tetrads that must be analyzed will depend on the number of independently segregating markers desired in the preferred strain. Protocols for mating, diploid selection, sporulation, and tetrad dissection are presented in detail in Chapter 19. For example, a YAC clone in AB1380 can be introduced into a strain with the genetic markers from the alternative host YPH857 by the following method. If the haploid strains AB 1380 + YAC (which is MATa) and YPH857 (which is MATa) are allowed to mate, diploid products containing the YAC are of the genotype: M4Ta LEU2 yra3-52 MATa leu2Al uru3-52 + YAC (lJRA3 TRFI)

&2-801 lys2-801

pde2-lot ade2-101

hisjam HIS5

m hu3A200

g& trplA63

canl-10s CAhUs

Q@ cyh2

Selection for cells that are simultaneously Leu+ His+ Ura+ Trp+ will allow YAC-containing diploids to grow, and will prevent growth of haploid parental yeast (or diploid cells without a YAC). After colony purification of two such diploids, they should be sporulated on low nitrogen medium, and tetrads dissected. With the exception of the His- auxotrophs (which may indicate the presence of hisjam, his3A200, or both mutations), the spore phenotypes from this cross provide an unambigous indication of the genotype. Each true tetrad will show 2+:2- segregation for leucine prototrophy (LEU2 vs leu2Al), canavanine resistance (canl-IO@ vs CANIs), cycloheximide resistance (CYH2s vs ~yh2~), and will contain 2 MATa and 2 M.4Ta spores. Because the YAC was present in one copy, most tetrads should also show 2:2 segregation for the YAC (half of the spores will contain

250

Spencer and Simchen

the markers URA3 and TRPI). The hrstidine genotype can be determined by complementatron tests using available tester strains (22): e.g., MATa his3A200 (YPH389), MATa his3A200 (YPH390), MATa his5 (YPH391), and MATa his5 (YPH392). The YPH857 markers his3A200, leuddl, cyh2R are useful for YAC modification. A desired spore genotype of HIS5 his3A200 + YAC should appear with the frequency (l/2)3, and therefore 6 tetrads will provide 3 desired spores, on average. Similarly, a spore genotype HIS5 his3A200, Zeu2A1, cyh2R + YAC should appear with frequency (l/2)5, requiring on average 24 tetrads for 3 such spores. The presence of a YAC clone with expected structure should be confirmed by analysis of the electrophoretic karyotype of the final strain.

4. Notes 1. The karlAZ.5 mutation is a nonreverting 70 amino acid deletion allele that can be conveniently confirmed by Southern blot. Its presence does not adversely affect the structural integrity or mitottc stability of YACs (14,25), and it IS as karyogamy deficient as the original missense karl-Z allele. 2. In an alternative procedure, the cells can be incubated together on a sterile Whatman filter paper disk laid on a YPD plate. To accomplish this, resuspend the donor and recipient cell mixture m a small volume of YPD (30-50 pL), and carefully spot them onto the sterile filter paper disk. Incubate the plate at 30°C for 4-6 h, move the disk (with sterile forceps) into a sterile test tube containing 1 mL YPD, and shake the cells off the disk. Plate the cells as described in step 6. 3. This plate is designed to selecttvely allow the growth of YACductant colonies, which will be Ura+ Cyh R. The AB1380 parent will fall to grow because of the lack of isoleucine and threonine, and the presence of cycloheximide. The YPH925 parent will fail to grow because of the lack of uracil. A false posttive background of CyhR cells derived from Ura+ diploids does appear, but will be dealt with in steps %l 1. 4. Within the dilution platmg scheme suggested, the expected lo-fold difference in CyhR colonies is generally not observed. This presumably reflects a negative effect of high cell densities on the recovery of YACductants. Thus, the authors recommend plating at variable densities to ensure recovery of a convenient number of well-spaced colonies. 5. At this point, there are several alternative strategies. For example, candidate YACductants for further analysis can be identified by determmmg the mating type locus composition using PCR (20), as described in Chapter

Transfer of YAC Clones to New Yeast Hosts 19. The desired colonies will be MATa, whereas the false-posmve background will be largely MATaIMATa heterozygotes. Or, for small scale applications of this transfer technique (e.g., transfer of a single YAC), steps 9-l 1can be skipped altogether, and a larger number of candidates screened directly by pulsed field gel analysis. 6. There are several chromosome length polymorphisms that distinguish the YPH925 genetic background from AB 1380. The number of chromosome length polymorphtsms vtsible on a given pulsed field gel depends on the runnmg condrtrons during electrophoresis, and sharpness of the chromosomal bands. Several readily apparent polymorphisms are tllustrated in Fig. 2.

Acknowledgments The authors would like to acknowledge stimulating discussions and valuable contributions of C. Connelly, E. Green, P. Hieter, Y. Hugerat, 0. Hurko, S. Klein, and D. Zenvirth. References 1. Burke, D., Carle, G., and Olson, M (1987) Cloning of large segments of DNA into yeast by means of artificial chromosome vectors. Science 236,806-g 12. 2. Lmg, L., Ma, N., Smith, D., Miller, D., and Mou, D. (1993) Reduced occurrence of chrmerrc YACs m recombmatron-deficient hosts Nuclezc Acids Res. 21,6045,6046. 3. Chartier, F., Keer, J., Sutcliffe, M., Hennques, D., Mrleham, P , and Brown, S (1992) Construction of a mouse yeast artificial chromosome library m a recombrnation-deficient strain of yeast. Nature Genet. 1, 132-136 4. Nell, D., Villasante, R., Vetrre, D., Cox, B., and Tyler-Smith, C. (1990) Structural mstabihty of tandemly repeated DNA sequences cloned in yeast artificial chromosome vectors. Nuclezc Acids Rex 18, 1421-1428 5. Pavan, W., Hieter, P., and Reeves, R. (1990) Generation of deletion derlvatlves by targeted transformation of human-derived yeast artificral chromosomes Proc. NutE Acad Scl USA 87, 130%1304. 6. Spencer, F., Ketner, G., Connelly, C , and Hreter, P. (1993) Targeted recombmation-based clomng and mampulatron of large DNA segments in yeast Methods 5, 161-175. 7. Ketner, G., Spencer, F , Tugendreich, S , Connelly, C., and Hieter, P. (1994) Efticrent manipulation of the human adenovuus genome as an infectious DNA clone. Proc Natl. Acad Sci USA 91,6186-6190. 8. Botstem, D. and G Fink (1988) Yeast: an experimental organism for modern biology. Science 249,1439-1443. 9. Conde, J. and Fink, G. (1976) A mutant of Saccharomyces cerevisiae defective for nuclear fusion. Proc Natl. Acad Sci. USA 73, 3651-3655 10. Rose, M. and Fink, G. (1987) KARI, a gene required for function of both intranuclear and extranuclear microtubules in yeast Cell 48, 1047-1060.

252

Spencer and Simchen

Il. Vallen, E , Htller, M., Scherson, T., and Rose, M. (1992) Separate domains of KARI mediate distmct functions in mitosis and nuclear fusion J Cell Blol 117, 1277-1287. 12. Jt, H., Moore, D , Blomberg, M., Bratterman, L , Voytas, D., Natsoulis, G , and Boeke, J (1993) Hotspots for unselected Ty 1 transposmon events on yeast chromosome III are near tRNA genes and LTR sequences. Cell 73, 1007-1018. 13. Hugerat, Y. and Srmchen, G (1993) Mrxed segregation and recombination of chromosomes and YACs during single-dtviston meiosis in spol3 strains of S cerevwae. Genetics 135,297-308 14. Spencer, F., Hugerat, Y., Stmchen, G , Hurko, 0 , Connelly, C , and Hteter, P (1994) Yeast karl mutants provtde an effective method for YAC transfer to new hosts. Genomics 22, 118-126. 15. Hugerat, Y., Spencer, F., Zenvirth, D., and Stmchen, G. (1994) A versatile method for efficient YAC transfer between any two strams. Genomlcs 22, 108-l 17. 16. Hoffmann, W. (1985) Molecular characterization of the CAN2 locus of 5’. cerevwae. J Blol Chem 260, 11,83 l-l 1,837 17. Kaufer, N., Fried, H., Schwindinger, W., Jasm, M., and Warner, J. (1983) Cyclohextmrde resistance m yeast: the gene and its protein. Nucleic Acids Res. 11, 3123-3133. 18. Rothstem, R. (199 1) Targeting, disruptton, replacement, and allele rescue: integrative DNA transformation m yeast. Methods Enzymol. 194,28 l-30 1. 19. Connelly, C., McCormtck, M., Shero, J., and Hieter, P. (1991) Polyammes eliminate an extreme size bias against transformation of large yeast artttictal chromosome DNA. Genomlcs lO, lO-16 20 Huxley, C., Green, E., and Dunham, I. (1990) Rapid assessment of S. cerevtstae mating type by PCR. Trends Genet. 6,236. 2 1. Carle, G. and Olson, M. (1984) Separation of chromosomal DNA molecules from yeast by orthogonal-field-alternation gel electrophoresis. Nucleic Acids Res 12, 5647-5664.

CHAPTER23

Use of ACEDB as a Database for YAC Library Data Management Ian

Dunham

and

Gareth

Ll. Maslen

1. Jntroduction Increasingly, the libraries that are the basic genomic DNA resources of physical mapping projects are stored in ordered arrays in the wells of 96- or 384-well microtiter plates (see Chapters 2-4). Localization of individual genomic clones to single wells of 96-well microtiter plates rather than the traditional random plating has meant that screening of these libraries is no longer done “in isolation.” The results of all library screens may be accumulated over time and positive signals ascribed to the individual clones. In this way potential links between markers are more quickly identified and any worker who has access to the library can obtain a clone that has been previously identified positive with a particular marker. Thus the resources available to the mapping community have become less parochial and more highly organized. The distribution of yeast artificial chromosome (YAC) and other libraries by their constructors to many centers around the world, ensures that, at least in principle, an investigator has access to the sum of all data generated in that library, and the power of the ordered genomic resource strategy is further enhanced. However, this change in the way genomic DNA libraries are used has brought with it the need to store efficiently and display the screening data for libraries consisting of hundreds of thousands of clones. The very fact that a YAC library carries with it a burgeoning history of screening that is communicable presents the problem of how to store, display, and communicate these data. From Methods m Molecular Biology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

253

254

Dunham

and Maslen

There have been a number of different database solutions used for YAC library data, each of which has its own pros and cons (see Note 1). We describe how we have made use of the functionalities present in the freely available ACEDB database program to store and display the data obtained in our effort to make a physical map of human chromosome 22. We believe that this approach is both flexible and efficient, and in addition is fully compatible with the protocols outlined in Chapters 2-4. The ACEDB program was originally developed by Richard Durbin and Jean Thierry-Mieg for the nematode genome mapping and sequencing project (I). It is an object-oriented database management system that also provides tools that allow genetic and other biological data to be displayed in a natural way through the use of a series of graphical displays. Versions of the ACEDB system have been used not only for the nematode genome project, but also for Arabidopsis data (AATDB), for human genome mapping data for chromosomes 2 1, 22, and X; Drosophila; and many other plant and animal genome proJects. The software is continually developing with regular releases of updated versions, and an everincreasing and active group of users (see Section 4.). A detailed step-by-step description of all the intricacies of ACEDB is beyond the scope of this chapter, and such descriptions are available elsewhere (I-4). We can only hope to illustrate how useful the system has been to us, and point you in the right direction by outlinmg where to go to find more information and begin to set up the system. Therefore, in this chapter, we deviate from the format of the rest of this volume, and present first a description of how we have used ACEDB for storage and display data from extensive screening of YAC and other genomic libraries. Then we outline the basic resourcesyou would need to use ACEDB in a similar way. Finally, we present a brief introduction to how to get hold of and setup the program, how to customize it to suit your purposes,and how to obtain information on the program and follow future developments. 2. ACEDB

for Genomic

Clone Libraries

2.1. Introduction

Our approach to organization and screening of YAC libraries is outlined in Chapters 2-4. To facilitate storage, display, and analysis of data generated using these procedures we have utilized the program ACEDB. In particular, we have made extensive use of an interface that is an integral part of the program and that allows the user to display ordered arrays

Use of ACEDB for Data Management

255

M123Gl Length Orlgm Reference

320 RPgth

CEPH

Construction and characterlsation of a yeast artlflclal chromosome library containing seven haplold human genome equivalents

Fig. 1. The tree representationof single YAC clone object in ACEDB. The tree for the clone M 123G1 is shown, containing dataon its size as measuredby PFGE,the information that it is a YAC clone from the CEPH YAC library, and the referenceto that library. Each item of text in bold is a pointer to another object that can be displayed by picking with the left mousebutton. of clones in a graphic called the Clone-Grid display. Hybridization or STS content data for the clones in the gridded array can be entered through this display via a point and click procedure. It is this aspect of the program on which we focus. In order to fully appreciate the speed and utility of using the program, we strongly recommend that this chapter should be read with a live and functioning version of the program available to explore. Therefore a detailed reading is best accompanied by the human chromosome 22 implementation of ACEDB as used in the examples, and that can be obtained as described in Section 4.2. 2.2. ACEDB

Basics

All the information in ACEDB is stored as objects, which each belong to one of a number of classes. Each object has a unique name in the class to which it belongs. The classes are standard units such as clones, loci, papers, and so on, which may be displayed in class-specific ways. What may be stored in the objects in each class is governed by a model that describes the makeup of the class. Each object may also contain pointers to related data that are stored in objects of other classes. The data in an individual object are stored in the form of a tree with tags pointing to the information at the end of the tree (Fig. 1). In general, all objects in either a text or graphical display can be picked using the mouse opening up another window with information about the picked object. When you start ACEDB you will see a pair of windows (Fig. 2). In the main window (uppermost in Fig. 2) is a list of all the visible classes of objects within the database.Any class can be picked by clicking with the left mouse button and a second click will reveal a list of all the objects in the class in the second (lower) window, the “selection list.” In Fig. 2, the

Template: Classes: Map Locus Paper Laboratory Pool Datasheet Keyword KI-probe Probe

ICI-grid Polygrid

+j

[H&p/ f

7

,.

Journal Sequence Restriction Contlg KeySet STS AluPCR-probe YAC-Probe ICRF-grid Framework

,<

I-lone Gene-Class Hybrid Method OMIM Model CQ -reoeat VectoAte Cosmid-grid Fosmld-grid

“

Use of ACEDB for Data Management class containing the 24 Clone-Grids representing the 24 high-density grids of the CEPH YAC library has been picked and a list of these grids is shown (described in detail herein). Each of the Clone-Grid objects can be picked by double clicking to reveal the graphical display of the grid (Fig. 3). 2.3. Organization of a YAC Library Within ACEDB YAC libraries are organized in the wells of a series of microtiter plates so that each clone has a unique address within the library consisting of the microtiter plate number and the grid position within the plate consisting of a single letter from A-H and an integer from 1-12. Thus the clone in position Gl of plate 123 of the CEPH YAC library is clone 123Gl. In order to represent this clone in the ACEDB database, it must have a unique name, and the unique library address is the obvious choice. However, because every different library stored in microtiter plates will have clone addresses of the same form, we need to have a way to distinguish clone 123Gl of the CEPH YAC library from clone 123Gl of the Washington University YAC library and so on. A simple solution is to ascribe a prefix that indicates from which library the clone comes. We have adopted a single letter code for this purpose, and so in our database clone, M 123Gl is from the CEPH YAC library, whereas A123Gl is from the Washington University YAC library. Having settled on this solution, each clone from each library can become a single unique object m the database. Thus, in an ACEDB databaseeach clone may be displayed as a single object (or record) in its own text window (Fig. 1). A typical genomic DNA YAC library will consist of several hundred microtiter plates and some tens of thousands of clones. Chapters 2-4 describe how YAC libraries are organized around the central unit of the 4 x 4 high-density grid. This organization can be mirrored within ACEDB with each high-density grid represented by a single Clone-Grid object. This consists of a set of square boxes representing the clones arrayed in the same pattern as the clones on the high density gridded filter (Fig. 3). The names of individual clones in the array can be displayed in the “Gridded Clone:” text box by single clicking on the clone square. In Fig. 2. (previous page) The main window and selection list of the human chromosome22 version of ACEDB. Figures 2-5 are Images captured as screen dumps from the human chromosome for explanation.

22 version of ACEDB

See Section 2.2.

Fig. 3. The Clone-Grid display of the 4 x 4 high density gridded array of the first 16 microtiter plates of the CEPH “megaYAC” library. See Sections 2.3. and 2.4. for details.

Use of ACEDB for Data Management addition, each clone can be picked by double clicking on the box representing the clone to display the text tree containing information about the clone. To seethe names of all clones within the grid, it is possible to toggle to a name display mode using the drag-down menu found on the right mouse button within the window. In fact, it is possible to make Clone-Grid objects with various geometries, such as 3 x 3 or 2 x 2 or even with a staggered array as for the C. elegans genome project. 2.4. Storage of YAC Library Screening Results Through the Clone-Grid System The hybridization pattern of a probe to a high-density grid may be displayed by typing the name of the probe into the probe text entry box, and then pressing return. Note that we use the term hybridization to describe both genuine probe hybridizations and STS-based PCR data that we store and display in the same way. The hybridization pattern is displayed with positive hybridization signals being representedby a blue fill to the clone box. Weak hybridization signals are represented by a light blue fill. It is also possible to represent the hybridization pattern for a pool of probes, which may be either a piece of experimental data, such as the hybridization of pooled Mu-PCR products (51, or a virtual pool that is the union of the hybridization patterns for all of the probes and subpools that comprise the pool. Figure 4 shows an example of the results of all hybridizations to the first high-density grid of the CEPH megaYAC library displayed through a pool (sp or “superpool”) that is the sum of all probes or pools that have ever been used on this filter. Each clone that has ever had a positive signal is indicated by the blue filled boxes. This kind of approach is very useful for keeping track of YAC library screening results. In addition, it is possible to compare the representations of hybridization signals from different probes. This becomes very useful when you are working within a set of clones starting to build up probe or STS content information for construction of contigs. Having displayed a hybridization pattern for a probe as described earlier, you can place this pattern in the background by selecting “Center-surround” from the right mouse button drag-down menu. The current hybridization pattern is placed as a surround around the clone boxes. A second hybridization pattern can then be called up in the usual way and compared with the first. Where both probes hybridize to the sarneclone this is shown by the green surround signal coinciding with the central blue fill. An example of this is shown in Fig. 5, where the

0000 0000 fi UUULI 0000 0000 B

c

0

E

f

G

0000 0000 Llouo 0000 0000 0000 0000 on.0 oooo 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 q ollo 0000 0000 nnno nOllloooo q ooo oooo nllno 00010000 0000 0000 0000 0000 0000 0000 rlooo 0000 0000 OOLIO 0000 OOIIO 0000 q ULIO 0000 0000 0 0000 0 0000

1000 0000 uoou 0000 0000 0000 oooo 0000 0000 0000 0000 0000 0000 0000 0000 DO00 moo0 oooo 0000 0000 0000 0000 0000 0000 OOOII Llooo 0000 0000

0000 0000 LlUUl 0000 0000 0000 oooo 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 oooo q onn ooou 0000 0000 0000 0000 0000 oooo 0000 0000 0000

0000 0000 ouon 0000 Llooo 0000 q OCIO q ono 0000 0000 0000 0000 0000 0000 0000 0000 0000 0100 oooo 0000 0000 0000 0000 0000 Llooo Llooo oooo q lloo 0000 0000

0000 0000 q OOIJ 0000 0000 0000 q ooo 0000 0000 0000 0000 0000 0000 q ono 0000 00000000 0000 0000 q ooo 0000 0000 0000 0000 000170000 0000 0000 q ooo OOIJO 0000 0000

0000 0000 0000 0000 0000 0000 oooo 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 q ooo 0000 0000 0000 0000 0000 0000 q IIOO OOLlO 0000 0000

0000 0000 ouon 0000 0000 0000 oooo 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 q i300 oooo 0000 0000 .ooo 0000 0D00 0000 0000 q OOII q IJOO 0000 0000 00 00

0000 0000 0000 0000 0000 0000 q ooo 0000 0000 q oocl 0000 0000 0000 0000 0000 0000 0000 0000 oooo onclL! Cl.00 0000 0000 0000 0000 0000 CILIOO q lloo orloo 0000 0000 0000

0000 0000 0000 0000 0000 0000 oooo oono 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 q ooo 0000 0000 0000 no00 0000 0000 0000 oooo 0000 0000 0000 0000 0000

11 0000 0000 q uoo 0000 0000 0000 oooo ocon q OOIJ 0000 0000 0000 q ool3 0000 0000 0000 0000 0D00 oooo nclno 0000 0000 0000 q lloo 0000 q ooo OOOII q OOLl 0000 0000 0000 0000

ii 0000 0000 uuu. 0000 0000 0000 LICI~CI OOOLl 0000 0000 0000 0000 0000 0000 0000 0000 0000 00170 q ooo IJnnn 000” 00.0 q *oo 0”“” q oou 0000 q ouo 0000 q oon 0000 0000 0000

Fig. 4. A pool probe hybridization pattern displayed through the Clone-Grid. In this case, the hybridization pattern for the pool of all hybridizations to these clones (sp) is shown. The filled in boxes indicate hybridization to the clone represented by the box.

Fig. 5. Use of the “Center<->Surround” facility to compare the hybridization patterns of two STS probes. See Section 2.4. for complete explanation.

262

Dunham

and Ma&en

hybridization signal for an STS at the 3’ end of the break point cluster region gene (stBCR) to a collection of YACs derived from human chromosome 22 has been placed in the surround, and compared with the hybridization signal of an STS from the gene for a guanine nucleotide binding protein on chromosome 22 shown by the center fills. The patterns coincide by hits on the YACs at positions B5 plate 4 and H2 plate 4, showing that these two YACs provide a genomic link between the target sequences for the two STSs. Given that you have write access to the database (see the following) entry of YAC library screening data through the Clone-Grid system is done via a simple point and click mechanism. The name of the probe or STS for which data is going to be entered is typed into the text entry box and then a single click on the “Edit mode” button of the Clone-Grid display will toggle into the editing mode. You can then ascribe positive hybridization to any clone on that grid by a single mouse click on the clone, which will fill the clone box blue. Weak hybridization signals can also be represented by a second click on the box that gives a light blue fill. A final third click completes the cycle returning the clone box to the unfilled/nil hybridization state. When the hybridization pattern has been entered, the pattern is saved by choosing “save data with probe” from the drag-down menu on the right button. If you then display the probe tree using the same drag-down menu, the hybridization pattern will have been entered into the tree (Fig. 6). In this way it 1s possible to store a large amount of hybridization data. For instance, in our current chromosome 22 ACEDB database,there are over 1400 probes and pools of probes with a total of greater than 9500 hybridization hits to YAC and cosmid clones, all of which have been entered as described earlier. Using the databasefacilities, query, and table functions of ACEDB these data can readily be dumped to text files or tables, and hence transferred to other programs. In addition, data from outside sources using the same YAC libraries can be converted readily into ACEDB format and stored in your own database. 3. Resources Required for Use of ACEDB 3.1. Computer Literacy You do not need to be a programmer to work with ACEDB. In fact, a motivated biologist can pick up the essentialswith Me previous computer experience. All that is required is a little perseverance and an open mind.

Use of ACEDB

for Data Management

Positive-locus PosItIon

GNAZ Filter-number Hybridizes-to

STS

’ gpt-; STgjkngth

C$jinntor Fingerprint

SP

M22.226 M22.1253 M22.1585 wa5i

30992 28294 28294 8Q4 B49E12 M673F7 R14QFlO IWED 1 Y23F5 K6OB5 K451 H4 K514C6 K518H12 K865E9

CTAQAQAQQCCCAATCCAQQ AAQAQACCTCQACA-I-I-ITAQ 194 Colllns JE Probe-id

1495

Fig. 6. The tree representation of the clone object for the STS for GNAZ. The tree shows how the hybrrdrzation pattern for the clone is stored as the list of clones at the right of the Clone-Grid name and the tag “Hybridizes-to.” Again, each of the text items in bold is a pointer toward another object that can be displayed by picking with the left mouse button. You may even find yourself learning more than is necessary and becoming distracted from the job in hand. However, you will need to know: 1. A basic set of UNIX commands. You will need to know how to move between directories, how to create and delete files, and learn how to use the UNIX manual pages that describe the usage and syntax of commands. It would be wise to attend a basic introductory course to UNIX computing systems or to read at least the first few Chapters of a UNIX manual. After that rapid progress can be made at the keyboard. 2. How to use a text editor. You will need to be able to create simple text files for many purposes. We recommend use of the commonly available editor Emacs. However, it is even possible to get away with using the word processor on your PC and then transferring the ASCII file. 3. How to gain access to the internet and obtain information over the internet via email, bulletin boards, FTP (file transfer protocol), and the World Wide Web. In fact, we do give you some help on this m Sections 4. and 5.

264

Dunham

and Maslen

4. For more extensive work with data from other databases, you ~111need to learn a little of a programming language for manipulating text in files, such as Awk (6) or Per1 (7).

In fact only the curator of the database needs to have this knowledge and it is quite possible to have a multiuser group with little computer experience looking at and even adding data to the database. We have used ACEDB m this way in the chromosome 22 mapping group at the Sanger Centre, with each individual in the group able to add his or her own YAC library data while a single curator deals with all the customization and setup, plus obtaining data from outside sources. However, in this kind of situation, it is essential that each user follows a basic set of rules regarding nomenclature. 3.2. Hardware and Software Requirements 1. In order to make best possible use of ACEDB, you will need either direct access to a UNIX workstation such as a SUN, DEC, or SGI runnmg X wmdows software, or accessthrough a terminal capable of using X wmdows (e.g., an X termmal or a PC wtth X windows emulation software) over a local area network (LAN) 2. Access to the outside world through a wide area network 1srequired, e.g., in the UK through the Joint Academic Network (JANET). You will probably want to use software such as Xmosaic for accessto World Wide Web servers. Details of some useful biology and ACEDB mformation server are given m Note 2. 3. The current version of the ACEDB software 1sneeded. See Section 4.1. for mformation on how to obtain this. 4. You will need at least 50 Mb of free disk space. You may be able to get away with less than this, but tf you intend to establish a large ACEDB database you will probably require more. 5. Network accessto a prmter capable of prmtrng PostScript files is necessary.

It is as well to discuss these requirements with your system manager before you start in case any problems arise. In general it is prudent to develop a good relationship with the system manager, as he or she will be able to advise you on the best course of action and help with problems. 4. Obtaining, Installing, and Customizing ACEDB In this Section we describe via a series of actual examples how to obtain and install an ACEDB database,and how to begin setting up your

Use of ACEDB for Data Management own database. A full description of customizing and curating your own database is beyond the scope of this chapter, so we will merely indicate how to obtain further information, both in the form of publications and over the network. In the examples, we use an i tal i cized Cow-i er f on t to indicate text taken directly from the computer terminal, while the keyboard input within the text is indicated in bold. 4.1. Obtaining

ACEDB by FTP (File Transfer Protocol) To get and install ACEDB, it is simplest to first get the C. elegans version of the program with its accompanying data, so that you gain experience of setting up the program and also look at the nematode data. You can obtain a copy of ACEDB for C. elegans by FTP (the Internet Protocol file transfer program) from the following anonymous FTP server locations on the internet: 1. crrm.cnm.fr (192.54.15 1.100) m France, directory pub/acedb;

2. celemrc-lmb.cam.ac.uk (13 1.11.84.1) in England, in pub/acedb; 3. ncbi.nlm.nih.gov (130.14.20.1) in the US, in repository/acedb; and 4. bioinformatics.welzmann.ac.il (132.76.55.12) in pub/databases/acedb.

You start an FTP session from your command line by typing “FTP ‘sitename’ ” where “sitename” is the FTP site from which you want to pick up the program. In general, it is usual to FTP to the site that is physically closest to you, as this will minimize the network traffic created by your actions. It is possible that at some times of the day accessto these sites over the network may be slow and transfer of big files might be quicker out of office hours. Log in as user “anonymous” and give your email address as password. Then change directory to the appropriate directory (e.g., pub/ acedb) and set to binary transfer mode by typing “binary.” Initially, get the two short text files README and NOTES. Read these files at your own terminal. After you have read them get the installation script INSTALL and the relevant binary executable,or the sourcecode.A typical sessionwould be: pabayfidll:

73:> FTP ncbi.nlm.nih.gov

Connected to ncbi.nlm.nih.gov. 220-Welcome to the NCBI FTP Server fncbi.nlm.nih.gov) 220 220 ncbi FTP server (Version wu-2.4(2/ Mon Apr 18 13:33:40 ready.

EDT 1994)

266

Dunham

Name (ncbi.nlm.nih.gov:idl) : anonymous 331 Guest login ok, send your complete e-mail address Password: 230 Guest login ok, access restrictions apply. FTP> cd repository/acedb 250 CWD command successful. FTP> 1s 200 PORT command successful. 150 Opening ASCII mode data connection for file list.

and Maslen as password.

ace3 xv ace2

c.elegans human. c21 . cache

code.3.3. tar.Z README.3 - 3 226 Transfer complete. 74 bytes received in 0.0074 s (9.8 Kbytes/s) FTP> cd c.elegans 250 CWD command successful. FTP> binary 200 Type set to I. FTP> get README

200 PORT command successful. 150 Opening ASCII mode data connection 226 Transfer complete. local:

README remote:

3165 bytes received FTP> quit 221 Goodbye. pabay fi dll : 74 :

for README (3086 bytes).

README

in 0.17 seconds

You could now read the README

(19 Kbytes/s)

file as follows:

pabayfidll : 74 : more README README file for acedb database repository _______________________ _____________________ This

directory

database

for

contains

the

the nematode

public

release

Caenorhabditis

of

elegans.

ACEDB,

It

the

also

the source code for the ACEDB genomic database manager. Get and read the file NOTES to get further general information.

Files

are:

INSTALL

installation

NOTES

read this this file

README

shell

next

script

genomic

contains

Use of ACEDB for Data Management README.LINUX angistute.sit.hqxMacintosh angistute.ps.2 bin.sparc.Z-0. tar.Z 4.1.3 bin.solaris.2-0. tar.Z bin.solaris.2-OA. tar.Z bin.iris.2-0. tar.Z

bin.alpha.2-0.

tar.Z

cor2asc. for

doc.2-0.

tar.Z

letter.2-8 letter.2-9

letter.2-10 macace2.0. Bin

pmapace. Z proteins.2-8. tar.Z source. 2-O. tar. 2 update.2-1. tar.Z ... update.2-10. tar.Z

information

about LINUX version Word 171 version of Australian

postscript

file

of Australian

executables,

run

time files

executables, executables, executables, executables,

run time files run time files run time files

update

up to current

for

PCs tutorial

tutorial Sun Spare SunOS

Sun Spare Solaris Solaris alternate SGI MIPS Irix run time files Dee Alpha OSFl for transfer of VAX CONTIG9 data various documentation release letter for 2-8 (first version 2 release) release letter for 2-9 release letter for 2-10 MacBinary file of macace-see letter for transfer of VAX CONTIG9 data proteins for mu1tiple alignment display source, run time files, and dot

files

You need all the updates from 2-1 up to the latest one and either bin.etc or source.etc, but not both. Werecommend the bin versions if possible because you need various freely available, but nonstandard, things to recompile (gee and MIT X libraries). You also need the most up- to-date proteins. *. tar.Z to see the protein alignments to predicted genes. Sun SPARCstation 1, It,

2, IPC, IPX running SunOS 4.1.3: bin.sparc... Sun Spare running Solaris, especially Classic, LX, Sparcstation 10 bin.solaris.. , DEC DECstation3100, 5100 etc. bin.mips... DEC alpha/OSF-1 bin.alpha... Silicon Graphics Iris series, compiled on R4000 Indigo bin.iris.. . PC 486 with Linux free Unix bin.linux... Other Unix: There exist, or have existed, ports onto Alliant, BP, IBM R6000, Next, Convex. To use these versions you must make

268

Dunham

and Maslen

the executable from the source or contact us. Please let Jean Thierry-Mieg know if you need help, or have a new port, Sunview: We no longer support Sunview.Please contact us if you need it badly,but part of the graphic code would need modifications. Macintosh: There is now a running macintosh version. Anonymous FTP to genome.lbl .gov, and look in directory pub/macace. To make a database FTP the appropriate script INSTALL,

from scratch or just install the latest release, tar.Z files to an ACEDB home directory and run the

When you first run the program it makes an empty database file. next time you run it you should select the “Add Update” option the main menu to add all the updates. Please

let

us know either

Richard Durbin Jean Thierry-Mieg

if

you have problems

[email protected] [email protected]

installing

Richard Durbin Jean Thierry-Mleg pabaylidll : 75:

please

the system.

[email protected]

If you want the nematode data you must mget update*. After you run the INSTALL script you will have a directory containing further documentation. If you have further questions, addresses that follow.

The from

send mail

to one of

called

wdoc

us at the

rd@mrc - lmba . cam, ac. uk mieg@crbml. cnusc. fr

If you follow these instructions, getting the update files and the binary appropriate to your machine you should be able to set up a functional copy of the nematode ACEDB database. 4.2. Obtaining

the Human Chromosome 22 Version of ACEDB You can get hold of the human chromosome 22 version of ACEDB that was used in the examples in this chapter by FTP from ftp.sanger.ac.uk. A typical session will proceed as follows, again with your typed commands in bold:

Use of ACEDB for Data Management

269

pabay[idlI :131:ftp ftp.sanger.ac.uk Connected to ftp.sanger.ac.uk. 220 islay FTP server (SunOS 4.11 ready. Name fftp.sanger.ac.uk:idlj: anonymous 331 Guest login ok, send ident as password. Password: 230 Guest login ok, access restrictions apply. FTP> cd pub/human/chr22/humana 250 CWD command successful. FTP> 1s 200 PORT command successful. 150 ASCII data connection for /bin/is (193.60.84.123,40382) (0 bytes). acedb.22. tar.Z 226 ASCII Transfer complete. 87 bytes received in 0.062 s (1.4 Kbytes/s) FTP> binary 200 Type set to I. FTP> get acedb.22. tar.Z 200 PORT command successful. 150 Binary data connection for acedb.22. tar.Z /193.60.84.123,40384) 110900639 bytes). 226 Binary Transfer complete. local: acedb.22. tar.Z remote: acedb.22. tar.Z 1024000 bytes received in 7 s (1.4et02 Kbytes/sJ

FTP> quit 221 Goodbye. pabayfidll:132:

To install this database, move the file acedb.22.tar.Z into an appropriate directory, for instance, your home directory. Make sure that you have 50 Mb of free space. Then uncompress and untar the file to produce a series of subdirectories that form the database structure. This is done as follows. First list the files in the directory: pabay[idl1:133:ls acedb.22. tar.Z pabay[idll:134:

Uncompress the tar.Z file and list the files: pabay[idl1:134:uncompress pabayCidl1:135:ls

acedb.22.

tar.Z

Dunham

270

and Maslen

acedb.22. tar pabaylidlI:136:

Extract the tar file to create the directory structure: pabay[idlI :136: tar -xf acedb.22. pabay[idlI :137:ls acedb.22 acedb. 22. tar pabay[idll:138:cd acedb.22/ pabay[idll:138:ls externalFiles bin database in-situ

tar.

pictures

rawda ta

wdoc wquery

wspec

pabay[idlI:139:

In the bin directory there are executables for SunOS 4.1.3 (bin/ xace.SUN) and Solaris (bin/xace.SOL) operating systems for Sun sparcstations. If you are running on a different machine you will need to get the appropriate executable as described in Section 4.1. and put it in the acedb.22/bin directory. Rename the executable you need to be xace, e.g., for the Solaris executable: pabay [id1 I : 139 :mv bin/xace. pabay[idll:140:

SOL bin/xace

You should now be able to run the database as follows. First you set the ACEDB environment variable to the directory that contains the database directory structure. Then run the executable to start the database: pabaylidll :ldO:setenv ACEDB $HOME/acedb.22 pabay Lid1 I : 141: $ACEDB/bin/xace & pabayfidlI:142:

The two starting windows of the database should now appear as in Fig. 2, and you will be able to explore the database. If you experience any problems with getting this database to run, please contact Ian Dunham by email (id1 @sanger.ac.uk). 4.3. Setting Up Your Own Database for YAC Library Data If you have looked at either the C. elegans or human chromosome 22 versions of ACEDB, then you are already halfway to setting up your own database. You can use the same database structures and executable for your own version. It is also worth bearing in mind that you can also transfer the data present in any ACEDB database to your own database

271

Use of ACEDB for Data Management

by dumping the data from the first database, in the form of a text file in so-called .ace format, and then reading that data into your own database, providing the databases have models that are compatible. Thus data are readily transferable in a simple text form that can be edited if necessary using a text editor. Before experimenting with setting up your own database, read all the documentation that is available (see the following). If you wish to take advantage of the data structures we have set in place for handling YAC library data generated as described in Chapters 2-4, it is best to start with the chromosome 22 database as your template, as this provides the appropriate data models. The first thing to do is to copy the database structure to a new set of directories where you will establish your new database. pabay[idll:85:cp pabay[idlI:86:cd pabayCidll:87:

-r $HOME/acedb.22/ newdatabase

$HOME/newdatabase

In order to add or remove data from the database you will need to have write access to the database. To allow yourself write access register your userid in the file $ACEDB/wspec/passwd.wrm according to the instructions in the file. Then initialize the database.You do this by first deleting the file database/ACEDB.wrm: pabay[idlI:87:ls bin externalFiles database in-situ pabay[idlI :88:cd database/ pabay[idll:89:ls ACEDB . wrm blocks . wrm pabay[idll:90:m ACEDB.wrm rm: remove ACEDB. wrm (y/n)? y pabay[idlI:91:

pictures rawda ta

wdoc wquery

lock. wrm

log.wrm

wspec

and then start the new database as you did in Section 4.2., except grant yourself ACEDB superuser status by setting the environment variable ACEDB-SU. pabayfidll:92:setenv ACEDB-SIT pabay[idll:93:setenv ACEDB $HOME/newdatabase pabaylidlI:94:$ACEDB/bin/xace & pabay[idll:95:

272

Dunham

and Maslen

The program will then ask if you want to initialize the system, and you click the yes button to confirm. The database will now initialize, which will take some time. At the end you will see the two starting windows of ACEDB as before, except that the databasewill be empty. In order to add data to the new database, get write access from the drag-down menu on the right button in the main menu. You can then enter data by one of two means. First there is an interactive data entry mode that allows you to enter data within the databaseone piece at a time while seeing where you are making changes. The second method involves parsing data into the database from an external text file, known as .ace file, which must conform to a simple syntax. Both these methods are described in the documentation and also m ref. 2. For simphcity’s sake, we briefly describe the latter method for an example file. We have left three .ace files (cephgrids.ace, icigrids.ace, and icrfgrids.ace) that construct the Clone-Grid displays we use for our database in the FTP site at ftp.sanger.ac.uk in the directory pub/human/acedb/acefiles. Get these files by anonymous FTP or dump them from the chromosome 22 ACEDB version. Place them into your $ACEDB/rawdata directory. From your database, with write access, you can now select the “read .ace files” option from the right button menu in the main window. A window will appear, and you should click the “open file” button that will spawn a file chooser window. Select the cephgrids.ace files from the file list and press the button to read in the file. When the file has been read in, you can quit the “read .ace files” window and choose the Clone-Grid class. You should see all 24 of the Clone-Grids representing the CEPH megaYAC library in 4 x 4 high-density grid array. You can then save this edit session from the main window to incorporate these grids permanently mto the database. It is worth taking a look at the structure of these .ace files to see how the grid structure was formed and entered. In these *grids.ace files the clones in the Clone-Grid are entered via their positions within the high density array. It is also possible to enter Clone-Grid arrays mto the database as the individual microtiter plates of 96 clones and then to assemble each high density Clone-Grid from the individual microtiter plates. This approach is called the virtual grid and has the advantage of giving much greater flexibility in the make up of nonstandard grids of clones. In addition, if a clone is added or removed from one of the parent microtiter plates in the database, the change will be valid on all the virtual

Use of ACEDB

for Data Management

273

grids that use that plate, rather as in the real world. However, for clone library grids that are unlikely to change in their content, it is better to use the setup specified m the *grids.ace files, as these take less time to draw and redraw than a virtual grid. The specifics of making virtual grids are dealt with in Note 3. The structure of your database in terms of how the data is displayed, and what kind of data can be stored, is determined by the tiles in the wspec directory. Each of these files has a description of its structure and function as a set of comments within the tile, and the files can be edited according to those instructions. Of primary importance in terms of what kind of data can be stored is the models file, $ACEDB/models.wrm. This file determines the structure of the data within the database. If you have used the human chromosome 22 version of ACEDB as the basis for your new database,then the models file is the form that we have used extensively for YAC library data. Using these models, we store all the data that we require to keep track of our library screening. A number of examples of the type of data stored are shown in Fig. 7. In addition it is possible to add new data structures to the model files so that the model can be further customized to your needs. Details of how to do this are really beyond the scope of this description and can be found in the documentation. 4.4. Obtaining and Further

Documentation Information

There are a number of sources of information that will be invaluable if you wish to set up and maintain your own ACEDB database. Here we provide details of the major current sources at the time of writing. 4.4.1. ACEDB

Documentation

Provided

with the Program

While in an ACEDB database, an on-line help is available that covers the practicalities of moving around the database and the details of the functions available within the specialized displays. The on-line help is obtained either by clicking a help button in many windows or by dragging down to the help option in the menu available on the right button in all windows. You can move around the help window by picking on topics or using the buttons and menu provided. For information on using ACEDB installation and configuration, program documentation is provided with the program release. If you have got ACEDB via FTP, then in the directory $ACEDB/wdoc there should be files for a user’s guide, an installation guide, and a configu-

Dunham

274

A

An example of data structure

and Maslen

for an STS.

stD22S277 Positive-locus D22S277 Posttion Hybridizes-to 22~01~1

A216Bll M882G4 17B4 69C6

STS

AFM-Num AFM 168xa 1 Oligo-1 TTCTTGTGTGGTAGTCTGGG Oligo-2 TACCNACTCCCCAAACTATG STS-length 140 170 CA-repeat Orrgmator Weissenbach J Reference A second-generation linkage map of the human genome B

An example of data structure

for a YAC clone.

M697C3 Type AluPCRqrobe prM697C3 Posttion Posmveqrobe stD22S451 prR12IE2 prR7HGl prR31DDlO prM937A12 prM697C3 st234zh4 Negattvegrobe stD22S314E stwr-405 stD22S292E stD22S286E 1250 Length Gel-length Origin YAC CEPH Grldded CEPH6 22polyl Added-togrid-by ID Added-to_grid CGC 17.4.94 C

An example of data structure

for a vectorette probe.

prM882G4R Type Vectorette-from_YAC M882G4 Position Falter-number M22.553 14.6.93 Hybridizes-to 22~01~1 A5lD4 69C6 M843H2 M882G4

weak

Use of ACEDB for Data Management

275

ration guide. These guides are also available from the same FTP site as the C. eEeguns version of the program in the file doc.2-O.tar.Z (see Section 4.1.). 4.4.2. Email Announcements

List

New releases of software are announced on the ACEDB electronic mailing list. To get on to the ACEDB announcements mailing list, send mail to [email protected] or [email protected]. 4.4.3. ACEDB

Network

News and FAQ List

There is a BIOSCI newsgroup that provides a forum for questions and discussion of the ACEDB system. If you have access to a Network News server, you can choose to subscribe to the group bionet.software.acedb, where you can read articles on the system and even post any questions you may have. If you do not have access to the BIOSCI conferences via a newsreader (e.g., rn, trn) you can participate in the conference by electronic mail. To subscribe to the email version of the conference send email to [email protected] (UK and European readers use [email protected] or biosci.daresbury.ac.uk) with no subject line and only the message: subscribe ACEDB-SOFT in the body. To unsubscribe send the message unsubscribe ACEDB-SOFT to the same address. This is an automated service. Your email address will be taken from the header of the message that you send. If you then send mail to [email protected], the mail will be distributed to all subscribers and to the electronic conference. In addition, a list of questions and answers known as a FAQ (frequently asked questions) list is posted monthly to the group (3). This list intended to be used as an index to ACEDB databases and for information about the software. The latest text version of the list can also be obtained via Fig. 7. (previouspage) Examples of datastructuresfor objects in the human chromosome22 version of ACEDB. Examplesare shownfor (A) an STSobject, (B) a YAC clone, and (C) a vectorette-probederived from one end of a YAC. In each case, the text items in bold are pointers toward other objects that can be displayed by picking with the left mousebutton.

276

Dunham

and Maslen

anonymous FTP at machine net.bio.net as file: publBIOSCI/ACEDBl ACEDB.FAQ or at rtfm.mit.edu as pub/usenet/news.answers/acedb-faq. World Wide Web users may access the FAQ using the Uniform Resource Locator (URL): hltp://probe.nalusda.gov:8OOO/acedocs/acedbtoq.html. If you only have electronic mail, the FAQ can be retrieved from [email protected]. 4.4.4. Other ACEDB Resources Available on the Network 1 The ACEDB Documentation Server IS listed on the home page for the Agr~cultural Genome World Wide Web Server at http://probe.nalusda gov:8000. 2. The Australian Natronal Genomic Information Service has prepared documentation of the C elegans version of ACEDB m the files Angrsturte.ps and angistute.hqx available by anonymous FTP at ncbi nih.gov m repositorylacedblace2. 3. The text for refs. 2 and 4 is available through FTP or gopher from weeds.mgh.harvard.edu. 4. An ACEDB developer’s archive has been set up and is available by anonymous FTP from weeds.mgh.harvard.edu m the acedb-dev directory. 5. The Genome Computing Group, Lawrence Berkeley Laboratory, has an anonymous FTP service at machme genome.lbl.gov (13 1.243.224.80) that includes a repository of contributed software for data conversions. In addition, a number of useful FTP and WWW sttes are given in Note 2. 4.4.5. ACEDB Developers’ Workshop An ACEDB workshop is held annually. Information about past and future workshops can be obtained from the sources in Sections 4.1.2.4.1.4. 5. Notes 1. A number of the labs that have been involved in large scale library screenmg have developed then own databasesfor storage of YAC library screenmg data. Many of these programs are either based on commercially available relational database systems, such as Sybase, or are not publicly available at this time. Information about these database systems may be found by browsing the network sites given m Note 2. One example is the Reference Library Database (RLDB) system used at the ICRF in London for storage of screenmg information for their m-house libraries. Information about the RLDB system can be obtained by email from [email protected] or [email protected]. 2. Some other useful WWW sites: These server sites can be reached over the World Wide Web using a client program such as X mosaic (see Table 1).

Use of ACEDB for Data Management

277

Table 1 World Wide Web Server Sites Server URL

Organization or mformation

htp.Jfwww.sanger ac.uk http://moulon.mra.fr/acedb/acedb.html gopher:lfweeds mgh harvard.edul77l.mdexf Caenorhabditis-elegans_Genome http://probe.nalusda.gov*8OOOlacedocs/ mdex.html http:lprobe.nalusda gov 8000lacedocsf acedbfaq.html http:llwww.hgmp mrc uk http.//www.genethon frlgenethon-enhtml http llgdbwww gdb.org http NWWW.CHLC.org http./www-genome.wi

mit edu

http:flwww bto cam ac.uk http.//www.hgp,med.umtch.edu/#btomfo http.//gea.lif

tenet uk

http*//www-hgc.lbl.gov

held

Sanger Centre (Hmxton, Cambridgeshire, UK) (mcludes ACEDB documentation as Mosaic documents) ACEDB (Moulon, France) ACEDB via gopher (Harvard, MA) ACEDB documentation server (National Agrtcultural Library, Beltsville, MD) ACEDB FAQ (National Agricultural Library) Human Genome Mapping Project (Hinxton, Cambridgeshire, UK) Genethon (Paris, France) Genome Database (Baltimore, MD) Cooperattve Human Linkage Center (Iowa City, IA) WI/MIT Center for Genome Research (Cambridge, MA) Umversity of Cambridge, Department of Biochemistry (Cambrtdgeshire, UK) Michigan Human Genome Center (Ann Arbor, MI) Reference Library Database, Imperial Cancer Research Fund (London, UK) Lawrence Berkeley Laboratory Human Genome Center (Berkeley, CA)

grid defimtrons m ACEDB. Each grid IS composed of 16 microtiter plates gridded m a 4 x 4 pattern. This pattern IS repeated for each position of a 8 x 12 microtiter plate. This layout yields a grldded array of (4 x 4) x (8 x 12) = 1536 clones. Clones are located according to then position within the 4 x 4 array at each row and column junction of the polygrid. This array of clones can be represented wtthm the ACEDB database as a single text file containing the names of all 1536 clones, or as a vntual grid defined in terms of the component microtiter plates. The principal advantage of the virtual grid is that tt IS a highly flexible method of creating new grads, or altering pre-exrsting grids. Microtiter plates may be added to, or deleted from, the gnd definition file m a single step, ehmmatmg the need for large scale editing of individual clones in a grid defimtron Alterations made to

3. Virtual

Dunham

278

and Maslen

the contents of any indivtdual microtiter plate are propagated throughout all the grids contaimng that plate. Grids are thus updated with the mmrmum of human intervention, reducing the possibthty of outdated informatron remaining in the database,and easing the load of maintaimng the database. The virtual grid is defined in terms of the component microtiter plates. Each microtiter plate can be defined as an array of clones in an ASCII text file in .ace format. For instance, the following .ace file specifies a microtiter plate called Xp 1.1 of YAC clones. N Xp 1.1microtiter.ace Clone-Grid : “Xp 1.1” Title “Xpl. 1” Lines-at 1 1 No-stagger Al-labelmg ~~~ 1“lA1” “lA2” “lA3” “lA4” “1Arj” “lA6” “lA7” “l,,# “lA9” “lAl0” “IA1 1” “lA12” ~~~ 2 “1~1” “1~2” “1~3” “lB4” “1~5” “1B6” “1~7” “lB8” “lB9” “lBlO”\ “1Bll” “lB12” Row 3 “lCl”“lC2” “lC3” “l(l/> “1(-y “lC6” “1(-y “l(yy “l(y “l(-go” “lC11” “lC12” Row 4 “lD1” “lD2” “lD3” “lD4” “lD5” “lD6” “lD7” “lD8” “lD9” “lDl0” “ID1 1” “lD12” Row 5 “lE1” “lE2” “lE3” “lE4” “lE5” “lE6” “lE7” “lE8” “lE9” “lEl(y\ “lEl1” “lE12” ~~~ 6 “1~1” “1~2” “1~3” “lF4” “1~5” “lF6” “lF7” “lF8” “lF9” “lFl0”\ “1Fll” “lF12” Row 7 “lG1” “lG2” “l@” “lG4” “l@” “1,-&V “lG7” “lG8” “lG9” “lGl0” “1Gll” “lG12” Row 8 “lH1” “lH2” “lH3” “lH4” “lH5” “lH6” “lH7” “lH8” “lH9”

InMd In&d

“lHlO”\“lHl “Xpoly-1” “XpolyQ”

\

\ \

\

l”“lH12”

Clone-Grid is the name of the microtiter plate. Title is the title displayed for the clone grid by ACEDB. Lines-at, No-stagger, and Al-labeling are ACEDB comments that affect the manner in which the Clone-Grid information is visually displayed. The In_grid tag indicates that the microtiter plate is part of the Xpoly-1 and Xpoly-2 high-density grids. Each microtiter plate is linked to a high-density Clone-Grid object.

Use of ACEDB for Data Management

279

Following is shown the .ace file text description of the composition of a high-density Clone-Grid which contains the microtiter plate Xpl . 1. Each position in the 4 x 4 array of clones present on the grid is defined by the microtiter plate present at that position. Clone-Grid : Xpo1y.J Title Xpoly-1 Layout Lines-at No-stagger A l-labeling Virtual-row 1 Virtual-row 2 Virtual-row 3 Virtual-row 4

4

4

xp1.1 xp1.2 xp1.3 xp1.4 Xp1.5 Xp1.6 Xp1.7 Xp1.8 xp1.9 xp1.10 xp1.11 xp1.12 Xp1.13 Xp1.14 Xp1.15 Xp1.16

As with the microtiter plate Clone-Grid objects, the Title, Layout, No-stagger, and Al-labeling tags affect the display of the grid. The Virtual-row tags define which microtiter plates occur at each position in the 4 x 4 clone array present on the grid. Thus, the Xp 1.1 microtiter plate always occurs at position 1 in the 4 x 4 array. The virtual grid is thus generated from the clones present in each microtiter plate. This arrangement allows the grid to be edited at a macroscopic level of whole microtiter plates, or at the level of a single clone present on a microtiter plate. This flexibility makes the virtual clone grid a powerful tool for manipulating and editing arrays of clones within ACEDB. 4. Since the time this chapterwas written a new version of the ACEDB databasehas beendeveloped(ACEDB4). This databaseis also available from the same sitesas the ACEDB2 databasedescribed in this chapter. ACEDB4 is a more advanced version of the database, and differs from the previous ACEDBZ and ACEDB3 versions in a number of important respects, which are detailed in the release notes. Most of these alterations will have little, or no effect, with regard to the operation of the database as described in this chapter, however a number of alterations which do impinge on the material discussed in this chapter are mentioned: a. The class Clone-Grid has been replaced by class Grid. b. The clone class has been subdlvided into several new classesrelated to the vector used for cloning (i.e., classesBAC, PAC, YAC, cosmid, etc.). Each object in the class has a prefix to indicate the type of cloning vector used (e.g., y for YAC clones). This scheme allows clones from

280

Dunham

and Maslen

different ordered libraries to be differentiated from each other and so ease database adnnmstratlon. c. The classes Probe and STS contam the hybrtdtzatton and screening mformatton for the libraries. The tag Hybrtdtzes-to has been replaced by the tag Positive-?Class, where ?Class refers to the vector used for clonmg.

Acknowledgments The authors thank Richard Durbin for his invaluable help with ACEDB and for the modifications to the Clone-Grid displays that were essential for our use of the system. They would also like to thank Charlotte Cole for her comments on the development of the manuscript and Ian Dunham thanks the members of the Sanger Centre chromosome 22 mapping group for use of their combined data.

References 1. Durbm, R and Thierry-Mteg J (1991) A C elegans Database, Documentatzon, Code and Data Available from anonymous FTP servers at lit-mm lirmm fr, cele mrc-lmb cam ac uk and ncbi nlm mh gov 2 Dunham, I , Durbm, R , Thierry-Mteg J , and Bentley, D R (1994) Physical mappmg proJects and ACEDB, m Guide to Human Genome Computmg (Bishop, M J , ed ), Academic, London, pp 11 l-l 58 3 Sherman, B K (1994) ACEDB Genome Database FAQ Usenet news.answers Available via Universal Resource Locators ftp //rtfm mit.edu/pub/usenet/ news answerslacedb-faq-and-http-l/probe nalusda.gov:8000/acedocs/ acedbfaq.html 4. Cherry, J. M. and Cartmh, S. W. (1993) ACEDB, a tool for biological mformation, m Automated DNA Sequenczng and Analysts (Adams, M , Fields, C , and Venter, C , eds ), Academic, San Diego, CA, m press 5 Cole, C G , Patel, K , Shipley, J , Sheer, D, Bobrow, M., Bentley, D R , and Dunham, I. (1992) Identification of region-specific YACs using pools ofAlu-PCR probes labelled via linear-amplification Genomics 14,93 l-938 6. Aho, A. V , Kemighan, B W , and Weinberger, P. J. (1988) The A WK Programmmg Language, Addison-Wesley, Reading, MA 7. Wall, L. and Schwartz, R. L. (1991) Progrummzng Perl O’Reilly & Associates, Inc., Sebastopol, CA.

CHAPTER24

YAC Transfer into Mammalian Cells by Cell Fusion Nicholas

I? Davies

and

Glare

Huxley

1. Introduction The large regions of DNA that can be cloned in yeast artificial chromosomes (YACs) are ideal for expression studies of the complex genes and gene clusters found in the mammalian genome. Such studies require that the YAC of interest be transferred into a suitable expression system, such as mammalian cells in tissue culture or transgenic animals. Recent experiments indicate that large genes cloned on YACs may be transferred

intact and are often expressed at a level comparable to the endogenous genes and in a fully controlled fashion owing to the large amount of flanking DNA containing long range controlling elements (reviewed in ref. I). This chapter describes the use of fusion with yeast spheroplasts to introduce YAC DNA into mammalian cells, a procedure that can be used with rodent cell lines in tissue culture, including ES cells prior to generation of chimeric mice (2-4). An alternative method for the introduction of YAC DNA into mammalian cells in tissue culture, including ES cells,

is lipofection as described in Chapter 26. Microinjection, as described in Chapter 25, can also be used to introduce YAC DNA into adherent cells in tissue culture or into transgenic mice by pronuclear injection. The lack of any physical handling of the DNA makes fusion ideal for the intact transfer of YAC DNA hundreds of kilobases in size because there is no step where the large DNA would be subjected to shearing forces. This is in contrast to lipofection or microinjection, both of which require gel purification of intact YAC DNA that becomes increasingly difficult with From Methods m Molecular Bology, Vo/ 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

281

282

Davies and Huxley

YAC DNA over about 600 kb in size. A striking demonstration of the transfer of extremely large DNA intact comes from an experiment in which a whole Schizosaccharomycespombe yeast chromosome, 3.5 Mb in size, was transferred into a mouse cell line (C 127) by fusion with yeast spheroplasts (5). 1.1. YAC Transfer by Cell Fusion The demonstration that polyethylene glycol (PEG)-mediated fusion of plasmid-containing yeast spheroplasts and mammalian cells resulted in the stable transfer of the plasmid to the mammalian cells (6) provides an attractive means by which to transfect DNA without the limitations of mechanical extraction. Fusion of yeast spheroplasts with mammalian cells has now been used to transfer YAC DNA to a variety of rodent cell lines (2-4,7-20). Where the integrity of the introduced YAC DNA has been investigated, the general observation is that the majority of the transformed cell lines contain essentially intact YAC DNA at low or single copy number, which has integrated mto a mammalian chromosome. YACs of around 600 kb have been transferred by several investigators and no limit to the size of YAC that can be transferred has yet been reached. One feature of fusion is that the entire yeast genome is initially introduced into the mammalian cell along with the YAC of interest. This leads to the integration of a variable amount of yeast DNA into the mammalian genome. The amount of yeast DNA integrated is variable between different cell lines as shown in Fig. 1. This figure shows Southern blot analysis of cell lines derived by fusion of mouse L A-9 cells with yeast carrying the 660 kb YAC yHPRT (yHPRTlO1, 103, 105, and 106) and of ES cells with yeast carrying the 320 kb YAC Iglc (3B2, 3B3, 3B4). As can be seen, the cell lines yHPRT105, 3B3, and 3B4 appear to contain no yeast DNA as detected with the yeast repetitive element Tyl that is present in about 30 copies scattered throughout the yeast genome (see lane containing yeast DNA). This means that it is easy to screen for cell lines with very little yeast genomic DNA. In addition, it has been shown that the yeast DNA does not interfere with germline transmission of ES cells (3,4). In most cell lines that have been investigated by in situ hybridization to metaphase spreads, the YAC DNA and any yeast genomic DNA are observed integrated at a single position in a host chromosome as shown

YAC Transfer into Cells

283

432 -.

TY~

Fig. 1. Yeast genomic DNA present in cell lines made by fusion of mouse cells with yeast spheroplasts. Each lane contains DNA from the cell line indicated above the lane, or size markers (M), or DNA from yeast (yeast). The DNA was cut with EcoRI, separated on an agarose gel, blotted onto Hybond N, and hybridized with the yeast repetitive element Ty 1. Sizesare indicated on the left of the gel. There is cross-hybridization of the probe to some of the DNA in the size marker lane. Figure courtesy of Amanda McGuigan. in Fig. 2A. In a minority of instances the YAC DNA has been observed to integrate as amplified arrays (Fig. 2B) or to be maintained as extrachromosomal elements (Fig. 2C) rather than integrated into a host chromosome (15-17). These phenomena have only been observed in transformed rodent cell lines that are known to be able to support high levels of gene amplification. The cell lines containing extrachromosomal elements are also rather unstable and would be missed if only the most healthy and

284

Davies and Huxley

.

Fig. 2. In situ hybridization of metaphase spreads from different cell lines derived by fusion of mouse L A-9 cells with yeast containing the YAC yHPRT. (A) A metaphase spread from a cell lme with a single mtegratlon of YAC and yeast DNA: stained with DAPI (left), the FITC signal of the purified YAC probe (center), and the rhodamine signal of the yeast genomlc DNA probe (right). (B) A metaphase spread from a cell line with a large amplified region of YAC and yeast DNA: stamed with DAPI (left), the FITC signal of the yeast genomic DNA probe (center), and the rhodamme signal of the purified YAC DNA probe (right). (C) A metaphase spread from a cell line with extrachromosomal elements: stained with DAPI (left), the FITC signal of the purified YAC DNA probe (center), and the rhodamine signal of the yeast genomic DNA probe (right). The images have been reversed so that the fluorescent signal is black. Figure reproduced from ref. 1.5with permission.

YAC Transfer

into Cells

fast growing cell lines are picked. Amplification and extrachromosomal elements have not been observed in ES cell lines. Although fusion has been reported with a variety of rodent cell lines, including ES cells, it has become clear that certain mammalian cell lines do not give rise to cell lines after fusion with yeast spheroplasts (21; several unpublished observations). Fusion with human cells, after initial difficulties, has now been described (22) and it seems that persistence and careful choice of an appropriate selectable marker cassette wrll yield success with most cell lines (see Note 6). 1.2. Overview of Fusion of Yeast Spheroplasts and Mammalian Cells The protocols used by the many different investigators who have used fusion to introduce YACs into mammalian cells are basically the same. There are slight modifications as to the order of pelleting the yeast and mammalian cells, the composition of the PEG solution, and the exact way the pellet is resuspended. Yeast cells have a relatively thick cell wall surrounding their membrane. Before fusion of yeast and mammalian cells can take place, this cell wall must be removed in order for transfer of the yeast DNA into the mammalian cells to occur. This procedure, known as spheroplasting, involves the use of an enzyme (yeast lytic enzyme, lyticase, or zymolyase), which breaks down components of the yeast cell wall. The fusion process is then mediated by PEG, which stimulates the sticking together of the membrane of the yeast spheroplasts and the mammalian cells. The cells are then plated out to regenerate as colonies derived from single cells. The cells are allowed to recover for 48 h before the addition of selection to allow time for expression of the resistance gene on the YAC. 1.3. Retrofitting the YAC Introduction of YAC DNA into mammalian cells by fusion with yeast spheroplasts requires that one can select for those cells that have taken up the YAC DNA. This is often done by introducing a dominant selectable marker, such as a gene for G418 resistance or an HPRT minigene, onto the YAC by homologous recombination in the yeast host. The introduction of a selectable marker onto a YAC is often referred to as “retrofitting” and is described in Chapter 17.

Davies and Huxley The promoter used for the expression of the selectable marker and the copy number of the resistance gene have been found to be very important to success. There are a number of retrofitting plasmids available that carry the gene for G4 18 resistance (neo) driven by a range of different promoters, such as the mouse metalothionine, TK, or PGK promoters. The authors have observed a large difference in the number of colonies obtained with YACs retrofitted using different vectors and it is probably advisable to assay a variety of vectors for their ability to form G4 18 resistant colonies in the cell line of interest. Furthermore, multiple copies of the resistance gene in the YAC arm probably give higher levels of expression of the protein and consequently more colonies (2). Indeed, Lamb et al. (23) observed up to a 1O-fold increase in the number of colonies obtained when transferring a YAC containing multiple wo copies into ES cells, as compared to one containing a single ~160gene. Suitable restriction digestion and the increase in size of the YAC can be used to determine how many copies of the selectable marker have been introduced onto the YAC. 2. Materials 1. lMTris-HCI, pH 7.5. Filter sterlhze or autoclave. 2. 1M CaCl*. Filter sterilize or autoclave.

3. 1M Sorbltol. Filter sterilize or autoclave. 4. SCE: IMSorbitol, O.lMsodium citrate pH 5.8, 10 WEDTA, sterilize.

pH 8.0. Filter

5. SCEM: Add 43 pL of P-mercaptoethanolto 20 mL of SCE. P-mercaptoethanol should be used in a tie

hood.

6. STC: lMSorbito1, 10 mMTris-HCl, pH 7.5, 10 miVCaC1,. Filter sterilize or autoclave.

7. PEG solution: 50% PEG 1500,10mMCaC12, 10%DMSO. Make up fresh by mixing the followmg: 4 mL of 50% (v/v) PEG 1500 (Boehringer Mannheim [Mannhelm, Germany] cat. no. 783 641, ready to use solution m 75 mM HEPES buffer), 40 pL of 1M CaC12,400 PL of DMSO (tissue

culture grade).Brmg to 37OC. 8. Enzyme solution: Dissolve yeast lytic enzyme (ICN cat. no. 152270) in SCE at 2.6 mg/lOO pL. Make fresh. 9. L A-9 cell medium: DMEM with Glutamax-1 (Gibco-BRL [Gaithersburg, MD] cat. no. 61965-026) supplemented with 10% fetal calf serum (FCS, Globepharm, Surrey). 10. PBS: Sterile 10X solution (Sigma [St. Louis, MO] cat. no. D.1480). 11. Trypsm-EDTA: Sterile 1X solution (Gibco-BRL cat. no. 45300-019).

YAC Transfer into Cells

287

3. Methods 3.1. Yeast Culture and Preparation of Yeast Spheroplasts

The protocol for making yeast spheroplasts is basically as described by Burgers and Percival (24). Yeast are generally grown in media that select for maintenance of the YAC. In the case of YACs retrofitted with a selectable marker, these are often dropout media lacking lysine or, if both the URA3 and TRPl genes on the YAC are intact, AHC (see Chapter 29) made with 40 mg of adenine/L. It is good practice to culture yeast from a frozen stock (15% glycerol at -70°C) rather than serially transferring strains on agar plates as YACs delete at a significant frequency. Colonies take about 3 d to grow up on agar plates. Prepare the yeast spheroplasts before trypsinizing the mammalian cells and carry out the fusion within l-2 h of preparing the spheroplasts. 1. Inoculate 5 mL of selective yeast media with a large colony of yeast and grow overnight at 30°C with shaking. At this point the culture should be saturated (see Note 1). This overnight culture can be kept at 4°C for up to 1 wk or used immediately. 2. In the afternoon, inoculate 3X 100 mL of selective media with 20,100, and 500 pL of the overmght culture. Grow overnight at 30°C with shakmg. 3. Take 100~pL samples of the cultures and dilute fivefold. Count the yeast with a hemocytometer and use the culture that is 23 x lo7 cells/ml. 4. Transfer a total of 150 x 10’ cells to 50-mL comcal polypropylene tubes. Spin down for 5 min at 6OOgat room temperature and discard the supematant. 5. Resuspend yeast m 20 mL H20, spin down as described, and discard the supernatant. 6. Resuspend yeast in 20 mL of 1M sorbitol, spm down as described, and discard the supernatant. 7. Resuspend cells in 20 mL of SCEM and add 60 pL of enzyme solution. 8. Place in a 30°C water bath about 15 mm until 90% spheroplasted.

To determine the degree of spheroplasting, take 20 PL of cells and add to 80 pL of water, put 20 PL onto a microscope slide and cover with a coverslip, and observe under 32x with phase contrast. The intact yeast are bright under phase contrast, whereas the spheroplasts lyse in water leaving dark remains and clear cases so that the percentage of

spheroplasting can be determined (see Note 2). From this point on treat the spheroplasts gently as they lyse easily. Use a lo-mL pipet to resuspend the spheroplasts, as this reduces shearing.

Davies and Huxley

288

9. Pellet the yeast spheroplasts at 240g for 5 mm at room temperature and dtscard the supernatant. 10. Resuspendyeast m 2 mL of STC by swirling and ptpetmg gently, then make up to 20 mL with STC. Spin down as described and discard supernatant. 11. Repeat wash in step 10. 12. Resuspend cells m 2 mL of STC. 13. Make a 1 m 100 dilution of the yeast spheroplasts m STC and count the spheroplasts with a hemocytometer. 14. Place 10 pL of the yeast spheroplasts on a microscope slide with a coverslip. Under phase contrast, all the spheroplasts should be intact and bright. When water is placed at the side, so that it spreads under the cover slip, all the spheroplasts should lyse. The yeasts are now ready for use and are stable for at least 1 h.

3.2. Yeast Spheroplast-Rodent

Cell Fusion

1. Harvest exponentially growing cells by trypsimzation and neutralize with media contaming FCS (see Note 3) 2. Pellet the cells at 15Ogfor 5 min and discard the supernatant. 3. Resuspend the cells m DMEM without FCS and repeat step 2. 4. Repeat the wash in step 3 twice more. 5. Count the cells with a hemocytometer and brmg to 2 x 106/mL m DMEM without FCS. 6. Place 1 x lo8 yeast spheroplasts into a 15-mL conical tube, centrifuge at 240g for 5 min, and remove supernatant completely while takmg care not to disturb the pellet. 7. Carefully layer 1 mL of cells (2 x 106) onto the yeast pellet usmg a blue pipet tip, taking care not to dislodge the yeast. 8. Pellet the cells at 240g for 5 mm and remove the supernatant with a blue pipet tip. 9. Add 0.5 mL of PEG solution prewarmed to 37OC and gently resuspend the cells by mixing and pipeting with a blue tip. Let sit for l-2 min at room temperature. 10. Now dilute the cells slowly (over approx 2 min) with gentle stirrmg, with 5 mL DMEM without FCS. Carefully invert the tube a couple of times to mix (see Note 4). Il. Pellet the mixture at 240g for 5 mm, remove supernatant, and resuspend in full media containing FCS, penicillm, and streptomycm. 12. Plate out cells m normal cell medium at a suitable density for selection. For rapidly growing rodent cell lines, plate the entire fuston mixture onto four 1O-cm dishes. It is important that the cells should not be touching each other before the selection is added.

YAC Transfer into Cells 13. The day after fusion remove any dead cells and yeast by washing with 1X PBS followed by the addition of fresh cell media (see Note 5). 14. Apply G4 18 or other selection at 48 h post fusion and thereafter (see Note 6). 15. Colonies will normally be observed within 2 wk and can be picked from separate plates for expansion as independent cell lines.

4. Notes 1. Slow growmg yeast: Some strams of yeast,notably minutes that arise spontaneously and lack mitochondria, grow slowly and only reach confluency after 2 or 3 d. Minutes fuse efficiently with mammalian cells but culture times should be Increased to give the desired number of yeast cells. Minutes can be distinguished from other AB1380 derived strains by bemg white rather than pink. 2. Making good yeast spheroplasts: If it is found that the yeasts do not form spheroplasts m about 20-25 min, or a different brand of yeast lytic enzyme is used, it is necessary to carry out an optimization experiment to determine how much enzyme is needed to give spheroplasting in the appropriate length of time. The spheroplasts should be kept until the end of the fusion procedure and then rechecked with a phase contrast microscope to ensure that the spheroplasts are still intact. If it is found that the spheroplasts have lysed during preparation or by the end of the experiment one should suspect either that they have been handled too roughly or that some detergent is present. If detergent is suspected, rinse all glassware thoroughly before making any of the solutions to be used to make the spheroplasts and, if possible, use plasticware instead of glassware. 3. Other cell lines: Minor variants of this protocol have been used to mtroduce YACs mto a variety of rodent cell lines in tissue culture including ES cells that can then be transmitted through the germline (3). If other cells are used, the same methods for preparation of the yeast spheroplasts and fusion with the cells should be used. However, the media used for the growth of the mammalian cells, the density of cell plating, and the concentration of G418 or other selection should be modified appropriately. As described in the Introduction, many cell lines seem to be resistant to fusion with yeast spheroplasts. 4. Fusion with PEG: Care must be taken when mixing the media into the PEG solution. Rapid mixing causes swift osmotic changes that can damage the mammalian cells. 5. Washing off yeast cells: The host yeast strain used for most YAC libraries (AB1380) will not generally grow in DMEM with 10% FCS, and simple washing with PBS will remove the bulk of the yeast. In some other media, such as Earls with 15% FCS, some yeast growth is observed and the yeast

Davies and Huxley

290

should be washed off more thoroughly. Fusion with cells that grow m suspension has not been described, but some other method for removal of the yeast would probably be necessary. 6. Selectable marker: The selectable marker must be highly expressed m the cell line being used and tt IS advantageous to have multiple copies of the marker on the YAC that may give increased levels of expression. As different promoter and resistance gene combmatrons function differently in different cell lines, tt is best to collect a variety of retrofitting vectors and determine which one gives the highest number of colonies when transfected into the mammalian cell lme of interest. Resistance to G4 18 IS the most commonly used marker that IS retrofitted onto YACs, but the Herpes simplex TK gene has been used m TK negative mouse L cells (25), and an HPRT mmlgene has been used successfully in HPRT negative ES cells (4). Other markers, such as resistance to hygromycm or histidmol, are also very effective in mammalian cells.

Acknowledgments N. P. Davies is grateful to the Cancer Research Campaign and AFRC for financial support of this work. The authors thank M. Briiggemann for DNA from ES cell lines 3B2,3, and 4. References 1, Huxley, C. (1994) Transfer of YACs to mammalian cells and transgemc mice, m Genetic Engweermg (Setlow, J. K , ed.), Plenum, New York, pp. 65-91 2. Davies, N. P., Rosewell, I. R., Richardson, J. C., Cook, G. P , Neuberger, M. S., Brownstem, B. H., et al (1993) Creation of mice expressing human antibody light chains by mtroduction of a yeast artificial chromosome containing the core region of the human mnnunoglobulin K locus BioTechnology 11,911-914. 3. Jakobovits, A., Moore, A. L , Green, L. L., Vergara, G J., Maynard-Currie, C. E , Austin, H. A , and Klapholz, S. (1993) Germ-lme transmission and expression of a human-derived yeast artificial chromosome. Nature 362,255-258. 4 Green, L L., Hardy, M. C., Maynard-Currie, C E , Tsuda, H , Lome, D M , Mendez, M. J , et al. (1994) Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nature Genet. 7,13-21 5. Allshire, R. C., Cranston, G., Gosden, J R., Maule, J. C., Hastie, N. D , and Fantes, P. A. (1987) A fission yeast chromosome can replicate autonomously in mouse cells. Cell SO,39 l-403.

6. Ward, M., Scott,R. J., Davey, M. R., Clothier, R. H., Cocking, E. C., and Balls, M. (1986) Transfer of antibiotic resistance genes between yeast and mammahan cells under conditions favoring cell fusion. Somat Cell Mol. Genet 12, 10 l-l 09.

YAC Transfer into Cells

291

7. Traver, C. N., Klapholz, S., Hyman, R. W., and Davis, R. W. (1989) Rapid screening of a human genomic library m yeast artificial chromosomes for single-copy sequences. Proc. Natl. Acad. Sci. USA 86,5898--5902. 8. Pachnis, V., Pevny, L , Rothstein, R., and Costantim, F. (1990) Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevzszae into mammalian cells. Proc Nat1 Acad Scz USA 87,5 109-5 113 9. Pavan, W. J., Hteter, P., and Reeves, R. H. (1990) Modificatton and transfer mto an embryonal carcmoma cell lme of a 360-kilobase human-derived yeast artificial chromosome. Mel CeZl Bzol 10,4163-4169. 10. Gnirke, A., Barnes, T. S., Patterson, D., Schtld, D., Featherstone, T., and Olson, M V. (1991) Clomng and in vivo expression of the human GART gene using yeast artificial chromosomes. EMBOJ. 10, 1629-1634 11. Huxley, C., Hagino, Y., Schlessinger, D., and Olson, M. V. (1991) The human HPRT gene on a yeast artificial chromosome is functional when transferred to mouse cells by cell fusion. Genomzcs 9,742-750. 12 Davies, N. P., Rosewell, I R., and Bruggemann, M (1992) Targeted alterations m yeast artifictal chromosomes for inter-species gene transfer. Nuclezc Aczds Res 20, 2693-2698

13 Riley, J H , Morten, J. E N., and Anand, R (1992) Targeted integration of neomycin into yeast artificial chromosomes (YACs) for transfection into mammalian cells. Nuclezc Acids Res. 20,297 l-2976. 14. Demmer, L. A. and Chaplin, D. D. (1993) Simultaneous transfer of four functtonal genes from the HLA class II region into mammalian cells by fusion with yeast spheroplasts carrying an artificial chromosome. J. Immun 150,5371-5378 15. Featherstone, T. and Huxley, C. (1993) Extrachromosomal maintenance and amphfication of yeast artificial chromosome DNA in mouse cells Genomzcs 17,267-278 16. Markie, D., Ragoussis, J., Senger, G., Rowan, A., Sansom, D , Trowsdale, J., et al. (1993) New vector for transfer of yeast artificial chromosomes to mammalian cells. Somat Cell Mol Genet 19,161-169. 17. Nonet, G. H. and Wahl, G. M. (1993) Introduction of YACs containing a putattve mammalian replication origin into mammahan cells can generate structures that replicate autonomously. Somat Cell Mol. Genet. 19, 17 l-l 92 18. Silverman, G. A., Yang, E., Profftt, J. H., Zutter, M., and Korsmeyer, S. J. (1993) Genetic transfer and expression of reconstructed yeast artificial chromosomes containing normal and translocated BCL2 proto-oncogenes. Mel Cell Biol. 13,5469-5478.

19. Soh, J., Donnelly, R. J., Mariano, T. M., Cook, J. R., Schwartz, B., and Pestka, S. (1993) Identification of a yeast artificial chromosome clone encoding an accessory factor for the human interferon y receptor: evidence for multiple accessory factors, Proc. Natl. Acad. Scz USA 90,8737-8741.

20. Cook, J. R., Emanuel, S. L., Donnelly, R. J., Soh, J , Martano, T. M., Schwartz, B., et al. (1994) Sublocahzation of the human interferon-y receptor accessory factor gene and characterization of accessory factor activity by yeast artificial chromosomal fragmentation. J Bzol Chem. 269,7013-70 18.

292

Davies

and Huxley

21 Huxley, C. and Gnirke, A (1991) Transfer of yeast arttfictal chromosomes from yeast to mammalian cells B~oEssuys 13,545-549 22 Wada, M., Ihara, Y., Tatsuka, M., Mttsut, H , Kohno, K., Kuwano, M., and Schlessmger, D (1994) HPRT yeast arttficial chromosome transfer mto human cells by four methods and an mvolvement of homologous recombmation Blochem Bzophys Res Commun 200,1693-1700

23 Lamb, B. T., Stsodta, S. S., Lawler, A. M , Slum, H. H., Km, C. A , Keams, W. G., et al. (1993) Introductton and expresston of the 400 ktlobase precursor amylotd protein gene m transgemc mice. Nature Genet 5,22-30 24. Burgers, P. M. J and Percival, K. J (1987) Transformation of yeast spheroplasts wtthout cell fusion Anal Blochem 163,391-397 25 Elicent, B., Labella, T., Hagmo, Y , Snvastava, A , Schlessmger, D., Ptha, G , et al (1991) Stable integration and expression in mouse cells of yeast artifictal chromosomes harboring human genes. Proc Nat1 Acad Scz USA 88,2 179-2 183

CHAPTER25

YAC Transfer Andreas

by Microinjection

SchedZ, and LZuis

Brenda MontoZiu

Grimes,

1. Introduction Soon after the first report of how yeast artificial chromosomes (YACs) could be used as cloning vectors for large DNA fragments, the transfer of YACs into mammalian cells came into focus of interest, Following mammalian cell transfer, the YAC Integrates into the host genome. Because of the large size of YACs, genes contained within the construct should be regulated and expressed at levels comparable to their endogenous counterparts. This method should, therefore, allow the identification of genes by complementation and can also be used to study gene function and regulation in vivo. YACs ranging in size from 35-650 kb have been transferred to mammalian cells. Possibly the most straightforward approach to generate transgenic cell lines is to transfer YACs by spheroblast fusion, a technique described in Chapter 24. This method, however, normally leads to integration of the entire yeast genome in addition to the YAC, which might interfere with the interpretation of the results of some experiments. It is now possible to purify YAC DNA from a gel and use it for microinjection into the nucleus of a recipient cell. In this chapter, the authors describe a method for the isolation of purified and concentrated YAC DNA. Protocols for microinjection into immortalized somatic cells in culture and fertilized mouse oocytes are discussed. Purification of YAC DNA for microinjection faces two problems: isolation of sufficiently concentrated DNA and DNA shearing or degradation. From Methods m Molecular Btology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

293

294

Schedl, Grimes, and Montoliu

In contrast to plasmid DNA, YACs are normally maintained as a single-copy molecule per yeast cell. An important advance in YAC technology came from the development of retrofitting vectors, which introduce an amplification system into normal YACs (I; Chapter 21). The retrofitting vector is used to replace the normal YAC centromeric arm by homologous recombination. Under selective conditions, YAC copy number increases 10-100 fold, which dramatically increases the amount of YAC DNA for isolation. Although it is possible to isolate enough YAC DNA for microinjection purposes without an amplification step, the authors would highly recommend YAC modification with a retrofitting vector, if it will be used for more than one experiment.* The purity of the sample is increased significantly, especially for YACs comigrating with one of the endogenous yeast chromosomes. Purification of YAC DNA from the endogenous yeast chromosomes is achieved by preparative pulsed-field gel electrophoresis (PFGE) of yeast DNA embedded in agarose plugs. Because of the low amount of YAC DNA within the gel, it is often necessary to further concentrate the DNA. In our hands, best results are achieved with a method employing a second gel run. For this purpose, the excised PFGE gel slices (1% agarose) containing the YAC DNA are embedded into 4% low melting point (LMP) agarose and gel electrophoresis is performed at a 90” angle to the PFGE run (see Fig. 1). Because DNA migrates faster in low percentage agarose, it will be concentrated at the border to the high percentage gel. After the second gel run the DNA can be excised in an agarose slice of a much smaller volume (usually l/5 of the original slice) and purified by agarase digestion. The advantage of this method over others is that the YAC DNA is protected within the agarose gel slice and can be stored at 4°C until needed. Agarase treatment involves an incubation step at 68°C to melt the LMP agarose. These high temperatures can lead to breakage of large DNA molecules when incubated in buffers of low ionic strength. It is, there*Note added in proofs. The thymrdme kmase gene (TIC), presentm amphficattonvectorsto apply strongselectivepressure,contamsa crypttc promoterin its codingsequence, which leads to expressionin the testes.Recentresultshave shownthat this can confer male sterrhty m transgemcmace(2). Estabhshment of transgemchnesfrom YAC constructscarrying amplification vectorsmight, therefore,be drfficult.

YAC Transfer by Microinjection fore, essential to equilibrate gel slices prior to agarasedigestion in a high salt buffer, which have proven very effective in stabilizing DNA during isolation procedures. Passage of large DNA through the microinjection needle is likely to cause shearing of DNA molecules >150 kb in size. Gnirke et al. (3) microinjected a 590 kb YAC into mouse cells in culture. The largest contiguous fragment transferred was about 500 kb. The authors suggest that there is a limitation on the size of a DNA molecule that can be microinjected as an intact molecule because of the constraint imposed by the small diameter of the injection needle. High molecular weight DNA can also be protected from shearing by using polyamines, such as spermine and spermidine. Polyamines protect DNA by forming inter- as well as intro-molecular bridges owing to ionic interactions (4,5). However, under low salt conditions this leads to precipitation of DNA making it unsuitable for microinjection. In electronmicroscopic studies, the authors have shown recently that low concentrations of spermine and spermidine in combination with high salt leads to compaction of DNA by the formation of globular structures (6). YAC DNA prepared in the presence of 100 n-M NaCl and polyamines can be centrifuged for periods as long as 15 min without precipitation. Although there are not enough data at present, it is quite likely that YAC DNA prepared with high salt and polyamines is more resistant to shearing during microinjection than YAC DNA prepared in high salt alone. The authors therefore suggest to include spermine and spermidine when working with YACs larger than 200 kb. An important factor to consider is the DNA concentration to be used for microinjection. Plasmid DNA is normally at a concentration between 1 and 2 ng/pL when used for microinjection into mouse pronuclei. Assuming an injection volume of l-2 pL, approx 500 copies of a standard, plasmid-derived construct (3-5 kb) are being transferred per injection. In contrast, only two to five copies are injected when working with a 500 kb YAC at similar concentrations. It is therefore recommended to use slightly higher DNA concentrations in YAC microinjection experiments. However, it should be kept in mind that DNA concentrations higher than 10 ng/pL lead to a reduction in survival of the injected embryos (7). We are now routinely microinjecting a 470 kb YAC at a concentration of 5 ng/pL. Survival rates of injected and transferred embryos are as high as 20-30%.

296

Schedl, Grimes, and Montoliu

2. Materials Heavy metal ions present in buffers even in traces will lead to degradation of YAC DNA during agarasetreatment. Make sure to use water of highest quality (e.g., Milli-Q, Millipore, Bedford, MA) for the preparation of buffers and gels. 1. SE: IM sorbitol, 20 mM EDTA, pH 8.0. 2. TENPA: 10 mA4 Tris-HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, 30 pM spermme, 70 pA4 spermidine. 3. MlcromJection buffer IB. 10 mM Tris-HCl, pH 7.5, 0 1 mM EDTA, 100 mA4NaCl, 30 fl spermme, 70 l&! spernndine. 4. LIDS: 1% hthium-dodecylsulfate, 100 mM EDTA, pH 8.0. 5. Zymolyase-1OOT (store at 4°C) (ICN Btomedrcals Inc., Costa Mesa, CA). 6. Nusieve GTG LMP agarose (FMC, Rockland, ME). 7. Seaplaque GTG LMP agarose (FMC). 8. P-Mercaptoethanol(l4M stock). 9. P-Agarase (store at -20°C) (New England BioLabs, Beverly, MA). 10. Dialysis Filters, filter type VM, 0.05 pm pore size, cat. no: VMWP 02500. 11. Petri dishes for tissue culture (NUNC, Naperville, IL). 12. Automatic InJectton System (Zeiss, Germany). 13. Femptotips, Eppendorf (Brmkmann Instruments Inc , Westbury, NY). 14. Insert molds (plug formers) (Pharmacia, Uppsala, Sweden). 15. CHEF-DR II, PFGE system (Bio-Rad Labs, Richmond, CA). 16. SD medium: See Chapter 29. For growth of pYAC4 clones m the host AB 1380 this should be supplemented with 10 mg/L ademne, 20 mg/L histidine, 50 mg/L lysme, 50 mg/L isoleucme, and 50 mg/L tryptophan (maintaining selection for the URA3 gene). For other YAC vectors, hosts, or retrofitted YACs, supplements will have to be altered accordmgly. 17. 1X TAE: 40 mMTris-acetate, 1 mMEDTA, pH 8.5.

3. Methods 3.1. Preparation of High-Density for Preparative PFGE

Plugs

1. Inoculate 500 mL of SD medium (with appropriate supplements, see Section 2.) with the yeast strain containing the YAC and grow the culture in a 2-L flask to late log phase (2-3 d, at 3O”C, 250 r-pm). 2. Prepare a solution of 1% Seaplaque GTG LMP agarose m SE buffer containing 14 mM P-mercaptoethanol and keep at 42°C until use. 3. Spm down cells at 2000g for 5 mm and resuspend the pellet m 50 mL SE buffer. Transfer the cell suspension mto a 50-mL Falcon tube.

YAC Transfer by Microinjection 4. Seal the bottom of Pharmacia plug formers (insert molds) with strips of tape and place them on ice. 5. Wash cells twice with SE (2OOOg,5 mm.). 6. After the last washmg step, discard the supernatant, and carefully remove all liquid by cleanmg the inside of the tube with a paper towel. The cell pellet should be approx 1-l .5 mL. 7. Add 200 mL of SE buffer. With a cut off yellow tip, try to resuspend the pellet. The suspension will be very thick and difficult to pipet. 8. Transfer OS-mL aliquots of the cell suspension mto 2-mL Eppendorf tubes and keep at 37OC. 9. Just before use, dissolve 10 mg Zymolyase-1OOT in 2.5 mL of the LMP agarose solution (see Note 1). 10. Transfer 0.5 mL of this solution to the yeast cell suspension and mix thoroughly the agarose with the cells by pipeting up and down using a blue cutoff tip (see Note 2). Keep the solution at 42°C at all times to avoid setting of the agarose. 11. Using a cutoff yellow tip, pipet 80-mL aliquots of the mixture mto plug formers kept on ice. Leave for 10 min to allow the agarose to set. 12. Transfer the plugs into SE buffer containing 14 mM P-mercaptoethanol and 1 mg/mL zymolyase. Incubate at 37°C for 4-6 h. 13. Replace the buffer with LrDS buffer using at least 0.5 ml/plug and mcubate at 37°C with gentle rocking. After 1 h refresh the LrDS buffer and continue incubation overnight. 14. Wash plugs extensively m TE pH 8.0 until no more bubbles (from LiDS solution) can be seen.Store plugs in O.SMEDTA at 4OCuntil use (seeNote 3). 3.2, Isolation

2. 3. 4. 5.

YAC DNA

Microinjection Cast a gel using 0.25X TAE, 1% agarose. Tape up several teeth of the comb to obtain a preparative lane of approx 5 cm (see Note 4). If the DNA wtll be concentrated by a second gel, standard agarose can be used. Otherwise use 1% LMP agarose (Seaplaque GTG). Wash the high-density yeast plugs for 4 x 15 mm in 0.25X TAE with gentle shaking on a rocking platform. Load the plugs next to one another into the preparative lane (see Note 5) and seal the slot with 1% LMP agarose (0.25X TAE). Run the PFGE in a cooled buffer (0.25X TAE) using conditions optimized to separate the YAC from the endogenous chromosomes (see Note 6). After the gel run, cut off marker lanes on either side of the preparative lane (including approx 0.5 cm of the preparative lane; see Fig. 1) and stam them for

1.

of Intact

298

6.

7. 8.

9. 10. 11. 12. 13. 14. 15. 16. 17.

Schedl, Grimes,

and Montoliu

on a rocking platform in 0.25X TAE buffer containing 0.5 pg/mL ethidium bromide. Mark the positton of the YAC band under UV hght usmg a sterile scalpel blade. Reassemble the gel and excise the part of the preparative lane contammg the YAC DNA. Excise also two slices containing endogenous yeast chromosomes (one greater and one smaller than the YAC, if possible) to serve as marker lanes for the second gel run. Position the gel slices on a minigel tray with the YAC slice m the mtddle and casta 4% Nusteve GTG LMP agarosegel 0.25X TAE around them (seeFig. 1). Run the gel at a 90” angle to the PFGE run (see Fig. 1) for approx 6-8 h at 4 V/cm m 0.25X TAE (circulating buffer). The running time depends on the size of the gel slice as well as on the agarose (percentage and brand) used for the PFGE run. Cut off and stain the two marker lanes (see Fig. 1) to localize the DNA (see Note 7). Excise the concentrated DNA from the corresponding position of the YAC DNA lane. Equilibrate the gel slice on a rocking platform m 20 mL of TENPA buffer for at least 1.5 h. Transfer the gel slice into a 1.5-mL Eppendorf tube and remove all additional buffer using a tine tipped (e.g., yellow tip) pipet. Melt the agarose for 3 min at 68OC,centrifuge for 10 s to bring down all of the molten agarose to the bottom of the tube, and incubate for an additional 5 mm at 68°C. Transfer the tube to 42°C for 5 mm. Add 2 U of agarase (New England BtoLabs) per 0.1 mL of molten gel slice (see Note 8). Incubate for an addttiona13 h at 42°C. Dialyze the resulting DNA solution for 1 h on a floating dialysis membrane (Mtllipore, pore size 0.05 pm) against microinjectton buffer (IB). To determine the DNA concentration, check l-2 yL on a thm 0.8% agarose gel with small slots, using h DNA of known concentratton as a standard (see Note 9). The integrity of the DNA can be checked by running 10-20 uL of the preparation on a PFGE gel (use a comb with small slots). After loading the DNA solution fill the slot with 1% LMP agarose to prevent loss of your sample when placing the gel into the running buffer.

3.3. Injection

into Cultured

Cells

The Zeiss Automatic Injection System (AIS) can be used for rapid injection of large numbers of cells growing on cell culture dishes, A digital camera attached to a microsope transmits an image of the cell mono-

YAC Transfer

299

by Microinjection

A

Excise: Marker

slice

YAC slice Marker slice

!T; -2’ . .

+! ._

I

stain

C

B

Excise YAC DNA I-- I

cut

/-

F cut

Fig. 1. Schematic drawing of the two-step gel isolation procedure. (A) After preparative-PFGE both sides of the gel are cutoff, stained in ethidium bromide (hatched areas), and the position of the YAC DNA is marked under UV-light using a scalpel blade. The gel is reassembled and the region of the gel containing the YAC in the preparative lane (hatched box), as well as two marker slices containing yeast chromosomes (black boxes) are excised. (B) Gel slices are positioned on a gel chamber, embedded in 4% LMP agarose, and standard gel electrophoresis is performed at a 90” angle to the PFGE run. (C) Marker lanes are stained to localize the concentrated DNA and the area corresponding to the YAC is excised from the center lane (see text for details).

300

Schedl, Grimes, and Montoliu

layer to the computer screen. An interactive computer program is then used to position the microinJection needle at the surface of a “reference cell.” The position of the needle tip is stored by the computer and serves as a reference point for the rest of the injections. Nuclei of other cells visible on the screen can now be marked for injection by pressing on the computer mouse. Injections are performed automatically by the computer. The amount of DNA injected can be regulated by altering the length of time taken to carry out the injection as well as the pressure delivered during the injection. High pressures result in higher efflux of the DNA containing solution. The pressure to be set depends on the viscosity of the DNA solution and the size of the needle opening (because each supplied needle is not identical, it has to be adjusted individually in each experiment). The pressure in a standard experiment will vary between 70 and 150 hPa. Almost confluent dishes are best to inject. A too low cell density allows only a few cells to be injected per frame, whereas cells on confluent plates do not grow in one plane making it impossible to set the needle to inject all cells in the frame. The efficiency of micromjectlon will depend greatly on the cell type. Best results are achieved using cells with big and easily visible nuclei. 1. Grow cells on a 60 x 15 mm circular Petri dish (NUNC)

to 80% confluency

m the medrum required by the cell type. 2. Immediately before injection replace 5 mL of fresh medium over the cells. Then add 5-10 mL of liquid

paraffin

over the medium,

which acts as a

barrier to prevent contammation from aerial microbes as well as preventing evaporation of the medmm during mjectlons. 3. Switch on computer, microscope, monitor, Eppendorf mIcroinJector, and pump. Wait for the stage to reset, then place the culture dish on the stage, and bring cells into focus at the lowest magnification (5x). They should now be visible on the monitor screen. 4. Adjust pump to Pl > 3000 hPa (see Note 10). 5. Use the yellow button on the mouse to call up the menu. Choose the command MOVE STAGE from the mam menu to select a region of the dish that is almost confluent and the cells look as if they are growing in one plane. The stage can be moved by clicking (always use the top/yellow button) onto the crossed double arrows. The direction of the arrow mdicates the direction m which the stage ~111 move. The distance from the center of the cross determines the speed with which the stage moves,

YAC Transfer by Microinjection

301

6. Return to the main menu (click twice on mouse) and select MARK/ INJECT. A new menu will appear that allows you to choose from the following options: a. NEW FILE: Allows generation of a file in which the positions of the injected cells will be stored. To use this option the bottom of the dish has to be marked to give the machine left and right hand references (scratch crosses at either side). Find the marks after the plate has been placed on the stage and click cursor on the appropriate box to record the references. If you generate a file you must enter an operator and a sample name. If you do not want to record positions of inJected cells choose NO, and leave the operator and sample as 00. b. APPEND: Allows you to go back to a previous file to find the cells that have been microinjected. c. COPY: Copies settings from an existing file. d. NO: This option does not record the cells that are injected and is sufficient for most applications. e. ANGLE, Z-SPEED, OBJECTIVE, OPTOVAR are used as default, as they appear on screen. 7. Select the number of frames you want to inject by filling in numbers of 10 or less for X and Y values. A frame is the wmdow visible on the screen and, therefore, represents the field in which cells can be marked and injected at a time. Each frame has specific X and Y coordinates. The computer moves along the X-axis first. An array of 5 x 10 frames will allow you to inject more than 1000 cells depending on the confluency of the plate. The maximum number of frames is 10 x 10. 8. Click on DATA OK. 9. Load 1.5 pL of DNA solution mto an Eppendorf microloader and insert it into an Eppendorf Femptotip (microinjection needle) placing it carefully at the very bottom of the tip. Slowly release the DNA solution trying to avoid the introduction of air bubbles, which can block the needle. 10. Twist the needle carefully to remove it from its cover and load the needle by screwing it into the injection needle holder at the microscope. 11. Choose the option ADJUST from the menu. Use the mouse control (yellow button) to lower the needle by clicking onto the arrow in the center of the screen. Hold the mouse button pressed during needle movement. The distance from the center determines the speed of the movement. Start with high speed and slow down when you approach the paraffin layer. Once the needle touches the paraffin find it in low power magnification of the microscope. Use the micrometer screws on the needle holder to center

302

Schedl, Grimes, and Montoliu

the needle in the frame. The needle appears as a dark spot that “ripples” out from the center. Change the lens to higher magnification. Focus on a plane intermediate between the cells and the needle and bring the needle down into focus using the mouse control. Repeat this procedure gradually moving up through 10x, 20x, 32x, and 40x lenses. Care should be taken to move the needle very slowly at highest magnification (i.e., short, 1-s clicks at the slowest speed) as the needle is very prone to being broken. Once the needle is pressing on the chosen cell, a small halo becomes visible. If the needle presses too hard on the cell, it will be punctured and a hole will be visible. If this happens, immediately raise the needle and focus on tt to check it has not broken. Once the needle is touching the cell, click on MARK TIP (2x). This option allows you to use the cursor to mark the tip of the needle so the computer can tdentify its position. 12. The following options are available to adJust the postnon of the needle. a. STEP DOWN: Lowers the needle in the smallest possible increment. b. MARK TIP: Allows to set the reference point for the computer software. To adjust, click on the very tip of the injection needle. This can be repeated during the course of injections. c. INJECTION TIME: Determines the time the needle remains within the cell and is, therefore, one parameter for the volume delivered to the nucleus. This time has to be varied depending on DNA viscosrty, pressure and needle diameter. A time of 0 2 s is a good value to start with. d. MOVE STAGE: Allows you to move the stage directed with the mouse. e. RESTART: Takes you back to the mam menu and you can reset any of the parameters. f. HOME: Takes the needle back to the original posmon. g. POSITION OK: Click on this when you are ready to start imecting. 13. To perform the mjectrons click on MARK NEXT. This will allow you to direct the computer to the nuclei of cells to be injected. Click on MARK and subsequently onto the nuclei. To start the inJections click on INJECT. The computer will perform the injections into the marked cells. If you wish to stop the injection at any point, press on the yellow mouse button firmly and make adJustments. Successfully injected cells can be identified by a temporary dramatic swelling of the nucleus. If no change of cells can be observed after a number of injections, check the following possibilities: a. The injection needle 1sblocked: Use the high pressure button (Pl) at the injection machine control panel to release DNA, which can be monitored down the microscope. If this does not help the needle has to be replaced.

YAC Transfer by Microinjection

303

b. The computer is injecting in the wrong plane: Stop the injections by pressing the yellow button and try lowering or lifting the needle in single step increments. Be careful not to break the needle on the surface of the dish by lowering it too much.

c. Too low pressure:Increasethe pressurefor P3 (usually in the rangeof 70-I 50). Beawarethattoo high pressurewill resultin burstingof the cells. Pressthe mousebutton at any time during injections to adjust the needle height or remark the tip of the needle (see Note 11). To inject the whole frame

againpressRESTART. Alternatively you can carry on with CONTINUE. 14. To finish the injections press RESTART, MARK/INJECT, DATA OK, RESTART, HOME, EXIT. 15. Remove paraffin layer in cell culture hood and add fresh medium. Traces

of paraffin will not be harmful to the cells. 16. Leave in 37°C tissue culture incubator overnight to recover. 17. The following day trypsinize cells and split 1:4 into 100 x 15 mm Petri dishes (NUNC) (see Note 12). Add selection for DNA uptake. After lO-14 d colonies of cells are visible, which have taken up the mammalian selectable marker present on the YAC. Typically one clonal population of cells can be established per 1000 cells inJected with YAC DNA. Sev-

eral thousand cells can be injected in 3-4 h. 3.4. Pronuclear Injections into Fertilized Mouse Oocytes

The procedure for generating transgenic mice involves isolation of fertilized oocytes from superovulated females, microinjection of DNA into pronuclei and the transfer of injected oocytes into pseudopregnant foster mothers. A detailed description of these steps would be far beyond the scope of this book and we are therefore referring to other literature dealing extensively with this method (see refs. 8 and 9). In the following section we concentrate on differences of the YAC approach to the standard procedure. Preparation of DNA constructs for injection normally involves a filtration step in which the DNA is passed through a membrane with a 0.2~ym pore size. This step is recommended to avoid blocking of the injection needle by dust particles in the DNA solution. YAC DNA preparations should not be subjected to filtration because of shearing forces occurring during this step. We have found that blockage of the needle is a relatively infrequent event if the agarose digestion was successful. In some cases it might be necessary to centrifuge the DNA for 5 min (12,000 rpm Eppendorf centrifuge) to remove undigested gel pieces.

304

Schedl, Grimes, and Montoliu

However, because small particles of agarose can trap DNA, we would strongly recommend to determine the DNA concentration after the centrifugation step. Some DNA preparations are very sticky, which is probably owing to incomplete agarose digestion. In these cases a higher proportion of injected oocytes will be found to lyse and the injection needle has to be exchanged more frequently. Prepare a new batch of DNA for the next injection day and take care to digest all agarose. Flush the pipet once or twice before each injection to make sure the needle has not been blocked. The percentage of lysed oocytes should not be markedly higher, when compared with normal constructs. When using an automatic injection machine, injections can be carried out using the balance pressure only. This is the lowest pressure applied permanently to counteract the capillary force of the needle. Setting the balance pressure at a slightly higher value than normal leads to a continuous flowthrough of DNA. Injections can be controlled by the length of time the needle is allowed to remain in the pronucleus. This “slow” injection probably reduces the shearing forces occurring m experiments with high injection pressures. Injected oocytes can be either transferred on the same day to the oviduct of pseudopregnant foster mothers or incubated overnight at 37°C in Ml6 buffer. Normal survival rates (20-30%) of transferred embryos even at DNA concentrations as high as 5 ng/pL should be obtained. Transgenic animals can be identified by PCR or Southern blot analysis with DNA isolated from tail tips. With 250 kb constructs, approx 1O-20% of the offspring should have YAC DNA integrated. Preliminary data suggest the efficiency with bigger constructs (500 kb) to be slightly lower (5-l 0%). Once a transgenic line has been established it is important to confirm the integrity of the integrated construct. This can be achieved by conventional PFGE mapping and Southern analysis using several probes from different regions of the YAC. However, this requires a detailed knowledge of the restriction map of the construct. Alternatively, the elegant RecA approach can be used to release the entire YAC from the mouse genome (3,lO; and Chapter 8). Constructs of 250 kb and smaller should in most cases integrate as intact YACs and without rearrangements (12). The fate of larger YACs followmg pronuclear mjection is not yet known.

YAC Transfer by Microinjection

305

4. Notes 1. Zymolyase-IOOT does not completely dtssolve at this concentratton. Weigh the required amount and work with a protein suspension. 2. Only a completely homogeneous mixture will yield high-quality plugs with even distribution of yeast cells, and therefore DNA. 3. DNA plugs prepared this way can be storedwithout degradation for at least 1yr. 4. To ensure even migration of DNA through the gel, it 1srecommended to run the preparative lane m the center of the gel. DNA in preparative lanes bigger than 5 cm, may migrate anomalously, thereby producing “smilmg” effects Uneven DNA migration leads to imprecise excision of the YAC and, as a result, DNA at a lower final concentration. 5. Best results are achieved using rectangular plugs (such as produced in Pharmacia plug formers), which can be loaded next to one another without intervening spaces. Use 90 mL of the 1% gel for a small BioRad casting chamber (14 x 12.7 cm). The plugs should occupy the entire height of the gel. Therefore, when casting the gel, make sure that the comb is touching the bottom of the casting chamber. Make sure that the castmg chamber as well as the PFGE chamber are absolutely leveled (use a spirit level) to avotd any loss of DNA during the gel run. 6. Good separatton from endogenous yeast chromosomes is achieved using a single pulse time instead of a time ramp for the entire run. It is worthwhile to test out several conditions before starting the isolation procedure. 7. If the DNA has not yet completely run mto the Nusteve LMP gel, continue the electrophoresis. Because it is impossible to digest normal agarose with the enzyme agarase, tt is important to excise only LMP maternal. 8. Do not add agarase directly from the -2OOC freezer, which can lead to setting of part of the LMP agarose. Load the enzyme into the tip and allow to warm up for a few seconds by placing mto the molten agarose. Carefully release the enzyme while stirring slowly with the tip. Mixmg can be achieved by releasing air bubbles into the solution. 9. It is useful to prepare a 2 ng/pL stock solution of 3LDNA. Loading of 2, 5, 10, and 20 ng of thts standard should allow a relatively accurate determtnation of the YAC DNA concentratton. 10. The Pl readmg must be >3000 hPa for the apparatus to work. Use the black knob on the pump to adjust the vacuum if there is no pressure m the system. 11. It has been observed that the needle has to be raised (or lowered) slightly as it travels along the X-axis. At frame numbers 11,2 I,3 1,41, etc. the needle often has to be lowered (or raised) again to ensure the nuclei are injected. 12. We use Petri dishes rather than flasks, which makes it easier to work with clomng rings once colonies have grown.

306

Schedl, Grimes, and Montoliu References

1. Smtth, D R., Smyth, A. P., Strauss, W. M., and Motr, D T. (1993) Incorporation of copy-number control elements mto yeast artificial chromosomes by targeted homologous recombinatton. Mammahan Genome 4, 141-147. 2. Al-Shawi, R., Burke, J., Wallace, H , Jones, C., Harrison, S., Buxton, D., Maley, S , Chandley, A , and Bishop, J 0 (1991) The herpes simplex virus type 1 thymtdine kmase is expressed m the testes of transgemc mace under the control of a cryptic promoter Mol Cell Blol 11,4207-42 16 3. Gmrke, A., Huxley, C., Peterson, K., and Olson, M V (1993) Mtcromjection of intact 200- to 500-kb fragments of YAC DNA into mammalian cells Genomzcs 15,659-667

4 Gosule, L C and Schellman. J. A (1978) DNA condensatton with polyamines. I. Spectroscopic studies. J MOE Biol 121,3 1l-326 5. ChattoraJ, D. K., Gosule, L. C., and Schellman, J. A. (1978) DNA condensatton with polyammes. II. Electron macroscopic studies. J Mol. Bzol 121, 327-337 6 Montoliu, L., Schedl, A., Kelsey, G., Zentgraf, H , Ltchter, P., and Schutz, G. (1994) Germ line transmission of yeast artificial chromosomes in transgemc mice Reprod Fertll Dev ,6,577-584 7 Brmster, R. L., Chen, H. Y , Trumbauer, M. E., Yagle, M. K., and Palmiter, R. D. (1985) Factors affecting the efficiency of introducing foreign DNA into mice by mtcroinjecting eggs. Proc Natl. Acad. SCL USA 82,4438-4442. 8. Hogan, B., Constantini, F., and Lacy, E. (1986). Manipulatzng the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 9. Murphy, D. and Carter, D A. (1993) Transgenests m the mouse, m Methods rn Molecular Biology, Vol. 18, Transgenests Techmques (Murphy, D and Carter, D. A , eds ), Humana, Totowa, NJ, pp. 109-l 76. 10. Ferrin, L J and Camerim-Otero, R. D. (199 1) Selecttve cleavage of human DNA RecA-assisted restriction endonuclease (RARE) cleavage. Science 254, 1494-1497. 11 Schedl, A , Montoliu, L., Kelsey, G , and Schittz, G (1993) A yeast artificial chromosome covering the tyrosmase gene confers copy number-dependent expression in transgenic mice. Nature 362,258-260

CHAPTER26

Transfection of Mammalian via Lipofection William

Cells

M. Strauss

1. Introduction The use of baker’s yeast, Succharomyces cerevisiae, for the cloning of extremely large genomic intervals (exceeding 1 Mb) was made possible with the development of yeast artificial chromosomes (YACs) (I). YACs are linear molecules containing all the control elements necessary for stable replication and segregation during the yeast life cycle. This cloning strategy was used to develop a technology for shuttling large genomic intervals back and forth between mammals and yeast. The purpose of this chapter is to provide the investigator with the techniques necessary for transfecting YACs into mammalian cells. This chapter contains four components: 1. 2. 3. 4.

Preparation of YAC DNA; Gel purification of YAC DNA; Introduction of YAC DNA into mammalian cells; and Analysis of transfectants.

Each component includes an overview (with background, critical parameters, and anticipated results), special materials, and protocol(s). 1.1. Preparation of YAC DNA Large amounts of purified YAC DNA are required for transfections and these preparations are expensive and time consuming. A preparation costs the laboratory at least $100 in consumable supplies. To recover enough useful total yeast DNA for gel purification attention must be From. Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

307

308

Strauss

paid to the growth and embedding conditions. In this section techniques for growth and handling of large amounts of healthy yeast culture are discussed. A fresh moculum of cells is prepared to start a large 24-h culture. After harvesting this large volume of culture, the cellular DNA is processed into intact chromosomal DNA. To maintain its structure the chromosomal DNA is embedded at high density in low melt agarose. This section contains the most important and technically difficult step in this chapter. For preparation of DNA, there are two important qualities of a yeast culture: the number and age of the growing yeast. The growth conditions must ensure that a sufficient quantity of yeast cells from the early stationary phase are available. Older cells, which have entered the late stationary phase, are not suitable, as they have undergone maturation of their cell wall. After maturation of the cell wall, the cells become difficult to spheroplast and the chromosomal DNA preparation is of inferior quality. In chromosomal plug preparations made from cultures with a large fraction of old cells, many of the embedded cells will not be lysed or will be incompletely lysed. Sometimes plugs made from older cultures are also unstable as they may be contaminated by DNA degrading activities. To be practical, quantitative recovery of transfection quality gel-purified DNA also requires that batch to batch variation be eliminated. Every chromosomal DNA prep should have identical quantities of total yeast chromosomes. Final spheroplasted cell concentration must be calculated for each preparation. One must determine experimentally the number of yeast cells recovered, and then project what the final embedding volume (plug volume) should be. This is accomplished by determining the ratio of initial cell volume to final plug volume. This ensures that the loading capacity of the pulsed field gel apparatus is not exceeded. The culture growth preparation as outlined is designed to yield a large amount of relatively synchronized yeast culture at the appropriate stage of maturity. A 2-L preparation of most yeast strains should yield 20 mL of packed cells. This will supply W-120 pg intact YAC DNA. In a given transfection, the typical experiment requires approx 40 pg of a 500-kb YAC. 1.2. Gel Purification of YAC DNA The separation of the yeast genome from YAC DNA is necessary for purification. Currently, only one method is available that ensures reasonable purity and physical integrity. This method is called pulsed field gel

Transfection

of Mammalian

Cells

309

electrophoresis (PFGE) (2,3) and involves the fractionation of the yeast/ YAC DNA in a low melt agarose gel. The region of the gel containing the YAC is excised and then used for subsequent experiments. The PFGE technique only allows a small window of optimal resolution for the separation of DNA species. The desired size range of DNA molecules must first be determined prior to the commencement of the DNA isolation. The PFGE electrophoretic environment can favor the isolation of a single molecular species, The environment can also exclude a certain size class while concentrating the remaining molecular species into a focused band. PFGE-purified DNA has been used as a source for YAC library construction, for FISH probes, and in transfection of mammalian cells (4-6). The critical parameters can be grouped into two categories: DNA preparation (previous section) and PFGE-run conditions. The success of the whole protocol is absolutely determined on the quality of the input DNA. If the DNA is degraded or if the density is too high there will be significant contamination and poor resolution. Time is well spent preparing the highest quality DNA possible. Applied electric field angle proves to be a critical determinant of resolution at high DNA loading concentrations (see Fig. 1). Field angles of 120” are sufficient for low concentrations of chromosomal DNA. However, at cell loading concentrations >0.28 (see Notes 1 and 2), the field angle must be lowered. If one does not lower the field angle the resolution between bands often will be compromised and result in a smeared gel. The optimal applied electric field angle can vary a bit but ranges between 104” and 110”. Routinely, we work with field angles of 105” 107”. One additional benefit of a decreased electric field angle is that the length time for a PFGE run can be reduced. At high DNA loading concentrations the PFGE gel-agarose concentration has a marginal effect on overall resolution. It does prove to have a major effect on overall DNA mobility. For a given DNA concentration, the variation of PFGE gel-agarose concentration over a threefold range can result in a 25% change in mobility. The relative separation of each chromosomal band will not change accordingly. Furthermore, high PFGE-agarose gel concentrations can play a complicating role in recovering the YAC DNA for transfection, whereas very low agarose concentrations can produce a gel that is very fragile (see Notes 2, 3, and 4). Thus, the author routinely works within a range of agarose concentra-

Struuss

kb

Fig. 1. Effect of PFGE field angle on resolution. Identical preparations of yeast chromosomes were loaded on 1% agarose gels and fractionated under either 120” applied field angle or 106’, for similar switching times and run duration. From left, the first seven lanes are the same high concentration plug preparation (0.32; see Note l), the eighth lane is a control of low concentration. Notice the improved separation in the gel run at 106”.

tions from 0.7-l .O%. The author has worked successfully with concentrations as low as OS%, and as high as 1.2%. For most purposes, a concentration of 0.8% is satisfactory. The PFGE switching routine is very important to isolate effectively the particular classes of DNA molecules for further experimentation. PFGE gels can be either run with fixed switching times or with ramped switching times. The main difference between these two types of routines for preparative purposes is that fixed switching routines tend to exclude certain molecular size ranges and focus others. Ramped routines tend to spread resolution over a greater size range with a loss in ideal

Transfection

of Mammalian

Cells

311

resolution for a particular class of sizes. Ideally, if one is trying to concentrate all molecules over a certain size range, and exclude all molecules that are smaller, then a fixed switching routine is perfect. If, however, one is trying to isolate a particular class of molecules, for example, chromosome V from 5‘. cerevisiae, then a ramped routine is preferred, as both molecules smaller and larger can be spread out over a larger portion of the gel. This protocol can produce quantities of DNA in the microgram range per milliter of PFGE gel slice. The degree of contaminating DNA from other size species depends on the quality of the DNA and the amount of DNA loaded on the gel. The more dilute the DNA the lower the contamination owing to comigration of different molecular species. Sample DNA can take various periods of time to prepare; the actual PFGE run time varies from as short as 12 h to as long as 40 h. Runs longer than this can be achieved if one is working with very large molecules (>5 Mb) but the time required to isolate DNA for further experimentation can become prohibitive. 1.3. Introduction of YAC DNA into Mammalian Cells

Efficient transfection of mammalian cells using DNA conjugated to cationic lipids was reported using DOTMA and the process was termed lipofection (7) to distinguish this method from other transfection procedures. With conventionally sized DNA molecules and a variety of currently available cationic lipids, a wide range of efficiencies have been reported. Differing cellular targets respond to a particular lipofection protocol with significantly divergent results, thus no single protocol can guarantee universally optimized success. The scientist must try a variety of lipids, in combination with cells, and DNA. Classification of cells morphologically into two groups can assist in determining the best approach to transfection. Cells in culture either grow in suspension or adhere to a substrate. Cells that grow in suspension grow with a minimal surface exposed to the environment. Adherent cells can either spread out to expose a maximal surface area or they can round up to expose a minimal surface to the environment. This difference in cellular topology is determinant in the choice of a lipofection protocol. The first protocol described herein is designed to work with adherent cells

312

Strauss

that spread out on a substrate. The second protocol is for cells grown in suspension or are adherent but expose the mmimal surface. Ideally, DNA concentration can be varied to optimize the lipid to DNA ratio in the transfection complex. With conventionally sized DNA molecules this is easily accomplished. However, with ultrahigh molecular weight DNA in the form of YACs, the DNA concentration is much less easily manipulated. Purified YAC DNA was first introduced into mammalian cells (5,6,, simply by excising a portion of a low melt PFG gel and mixing the agarased slurry with lipid and applying to adherent cells. Thus, the DNA concentration is limited to the loading capacity of the PFGE system employed. Methods have been described (8) that provide some limited concentration but never provide material better than a fivefold concentration. These concentration procedures can also impair the quality of the input DNA, consequently the investigator must weigh the effort of preparation against the possible results. The protocols described herein assume that the DNA is not concentrated further after gel purification. Transfection of gel purified YAC DNA represents a flexible approach to functional testing of large cloned genomic intervals. Lipofection’s flexibility is the result of three features: 1. Owing to the wide array of commercially available cattonic liplds, many cell types from differing species can be transfected with success. For Instance, cells derived from human sources are known to be dtfticult to transfect via fusion protocols, these cells can be successfully transfected with DNA-hpid mlcelles. 2. Llpofection operates opttmally at low DNA concentrations; thts is the srtuation encounteredwith YAC transfections.Because of the loading capacity of PFGE gels, after puriticatton of YAC DNA, the quantities available range from l-5 pg/2 mL of gel slice. 3. Finally, the technology required to establish hpofection in a laboratory is very modest. Assummg the expertise and facilities to work wtth ultrahigh molecular weight DNA, all that IS requtred IS access to a standard tissue culture facility.

The most important parameters can be divided into those that relate to the DNA-lipid transfection complex, and those that relate to the cells. Transfection of intact YACs relies on the gentle handling of the DNA before and after liquefaction of the agarose. During the dialysis of the

Transfection

of Mammalian

Cells

313

agarose bound DNA, attention must be directed to the quality of the water used to make buffers, it should from a sterile deionized source, double glass/quartz distilled is adequate. Condensing agents must be used with ultrahigh molecular weight DNA to prevent shearing. In general a polyvalent cation will coordinate DNA and compact it. The coordination occurs through the negatively charged PO4 backbone of DNA and a positively charged repeating unit on the condensing agent. The most commonly used condensing agents are the polyamines spermidine and spermine. Spermidine has a coordination number of +3 and spermine +4. Mixtures of spermidine/spermine have been utilized by several investigators in the production of YAC libraries. Spermine has about a 1O-fold greater capacity for condensation than does spermidine (9), thus in the protocols that the author has developed, the use of spermidine has been omitted during dialysis. Also, no additional benefit was observed with concentrations of spermine >500 pM, and the concentration of spermine was reduced to a minimum. The spermine should always be from a fresh source to ensure that it is not oxidized. A second condensing agent, with a very high coordination number (> 1000), poly L-lysine is used during the digestion of agarose. Although the binding of spermine is reversible under the conditions of high salt or electric field strengths of 5-10 V/cm, the binding of poly L-lysme is essentially irreversible. It is very important to use poly L-lysine very sparingly, because over titration will result in the precipitation of DNA into a large stringy mass. The small volume of poly L-lysine is pipeted on to the agarose slice, prior to heating to 6568°C. Never agitate the sample while melting the agarose, as this will shear the DNA. After cooling the melted gel slice to 4O”C, agarase is added. In this cooled state very gentle tapping of the mix can be performed and is sufficient to disperse the enzyme. Never vortex. Similarly, when adding lipid, gentle tapping of the tube is sufficient to disperse the lipid. A polystyrene tube is recommended, as the lipid and DNA will not adhere to the side of the tube. Finally, always use wide bore pipets when transferring the condensed DNA or DNA-lipid complex. There is much lore concerning the transfectability of mammalian cells. Adherent cells occasionally show toxicity with certain lipids, for instance, DOTMA has a very steep toxicity curve owing to the fact that

314

Strauss

the formulation may be difficult for cells to metabolize. This toxic effect is ameliorated by transfecting a confluent monolayer. Confluent monolayers are not ideal for transfection. Transfections should be performed on cells that are growing rapidly, thus it is desirable for adherent cells to be used at a subconfluent stage. As a compromise and as a general rule the cells should have reached near confluence (g&95%) just prior to addition of transfection complex. Suspension cells should not reach saturation prior to transfection. In most saturated cultures, many of the cells can actually be dead or sick, consequently one should use a large volume of recently split cells. Transfection efficiency is cell-type dependent. Even if the protocol is optimized the range of efficiencies can vary over several orders of magnitude. Utilizing murine fibroblastic cell lines and the adherent-cell transfection protocol transfection efficiency can range from 10e5-10” drug resistant clones. Using some embryonic carcinoma cell lines with the suspension cell protocol, similar results can be obtained. With ES cells, the range varies from 1@-10-7drug resistant clones. From this population of drug resistant clones, a portion will contain intact YACs and some YAC fragments. With attention paid to condensing the YAC DNA, prior to transfection, this ratio can be invariant as a function of YAC size. For YAC clones >lOO kb, after transfection, 10% of drug resistant cell clones should contain intact YACs. 1.4. Analysis of Trans fectan ts To determine whether a transfected cell line contains a YAC requires screening many cell lines. This determination can present a significant technical problem. Several approaches exist: 1. Drug selection; 2. Restriction mapping; and 3. In situ hybridization. A complete discussion of these topics is outside the context of this chapter (see Chapters 7-10 in this volume). Some general comments are presented as well as a useful protocol. 1.4.1. Drug Selection of Transfectants In order to differentiate the cells that have taken up YAC DNA from those that have not, drug selection must be used. The YAC can contain a

Transfection

of Mammalian

Cells

315

cis-encoded drug resistance gene or the marker can be cotransfected ($6, IO). Most YACs are from libraries where no drug marker was fashioned into the vector and must be retrofitted with a resistance marker. Many conversion cassettes have been constructed (see Chapters 17 and 21). The important consideration is to use the marker system that will suit the experimental need best. A few general points are worth considering. If two different markers are used, one on each arm, then after transfection each arm of the YAC can be selected. Only those clones with both arms of the YAC would therefore be further characterized. Some marker cassettes also contain rare restriction sites, these sites can be very useful in subsequent characterization. Finally, the location of the drug marker can be chosen with great precision and different locations provide very different advantages. The investigator should carefully consider where to place the selectable marker(s). Because of the nature of the DNA-lipid micelles formed during lipofection, cotransfections are possible. To achieve cotransfection it is necessary to mix a drug marker cassette in a limiting molar quantity with YAC DNA. The DNA-lipid micelle is then formed of two DNA species. The transfection complex is mixed with the target cell. Application of the drug to the media would then proceed as usual. As the marker DNA is present in limiting quantity compared to YAC DNA, the chances for both DNA species to coexist in the same cell line is improved. Despite the limiting amount of selectable marker DNA in the transfection complex, most of the drug resistant colonies will not contain YAC DNA. Thus the central disadvantage of the cotransfection approach is that selection must be followed by a screening step for YAC DNA. This translates into more work for the researcher. When using cotransfection with drug selection one must screen 102-lo3 clones instead of 107-lo* cells in the whole culture. Certainly this is labor saving but it represents 10 times more work than using a colinear selectable marker, The advantage of the cotransfection approach is that the YAC does not have to be modified. For some experiments this is a major advantage. For instance, YACs can be quite unstable. If this situation occurs, then modification by homologous recombination may be prohibited. By cotransfection, one can successfully transfect the gel-purified material despite the inability to modify the clone.

316

Strauss 1.4.2. DNA Isolation

from Transfected

Lines

In order to determine whether transfected cell lines contain YAC DNA, genomic DNA must be isolated from many cell lines. The following protocol was designed to facilitate the isolation of small amounts of DNA for initial screening of hundreds of cell lines. Most conventional methods for isolating genomic DNA utilize a proteinase K step followed by phenol/CHCl, extraction to remove protein. The DNA produced by this type of method is very pure and stable in storage. Unfortunately, the organic extractions require multiple pipeting steps and transfer of aqueous DNA solution to several different tubes. When dealing with many samples, this represents a prohibitive amount of work. The protocol described here does not involve any organic extractions or tube changes (11). In fact, the cellular tissue is lysed right in the growth vessel, a 24-well dish. This protocol enables a single investigator to produce restriction enzyme digestible genomic DNA from hundreds of cell lines with a marginal commitment of effort. Proteinase K is a very robust and stable enzyme. This protocol utilizes the minimal amount that still allows for isolation of high quality DNA. If the investigator exceeds the amounts specified, proteinase K activity will still be found in the processedDNA. This carryover of proteinase K activity will prevent the digestion of the DNA with restriction enzymes and the DNA will be useless for analysis by Southern blotting and hybridization. During the overnight digestion of the DNA with proteinase K, the samples must be mixed. The consistent gentle agitation of the tissue culture plate ensures that the cells are completely dispersed and digested. If the plate is not rocked, there will be incomplete processing and the DNA will fail to digest well. The 24-well dish can contain varying numbers of cells depending on the nature of the cell line. It is important to ensure that each well has grown up to confluence, or near confluence. It is also important that there is little well to well variation. When consistent numbers of cells are available then the recovery of DNA will be similar from well to well. After the cells are grown up in the 24-well dishes, it is expected that high grade DNA will be available in less than 2 d. The difference between working with one 24-well tray and 10 trays is minimal. Furthermore the yield of DNA does not vary with the scaling of the experiment. In general one can expect 100-200 pg of DNA recovered from each well, this is enough for about 10 restriction digests or 10 lanes on a gel.

Transfection

of Mammalian

317

Cells

1.4.3. Determination

of YAC Xntegrity

The central issue in transfections of YACs is the integrity of DNA after manipulation. DNA integrity can be impaired in the yeast host, during gel purification or during the transfection itself. Given the very large size of YAC clones, the determination of YAC integrity represents a formidable problem. There are three approaches to determination of YAC integrity (see Chapters 7-10 in this volume). The first approach utilizes a single probe which hybridizes in very many locations to YAC DNA. One such probe would be a LINE sequence probe. This probe can be used in combination with a restriction enzyme that recognizes a six-base sequence to generate a YAC fingerprint. The fingerprint of the YAC before transfection is compared to the transfected YAC fingerprint. If there is significant similarity between the two fingerprints then there is a good chance that the YAC is intact. The second approach to determination of YAC integrity relies on the availability of many unique sequence probes. These unique probes are derived specifically from different regions of the YAC. Hybridization of these probes to cell line Southern blots indicates the presence (or absence) of particular regions, the YAC. This hybridization can be accomplished individually or in pools. A pooling strategy can significantly reduce the amount of work, and the resulting data will look much like the fingerprint generated with a repeat probe. Both of the two preceding approaches can yield important information using infrequent or frequently cutting restriction enzymes. The choice of enzyme is largely dictated by the method of DNA preparation. If the high throughput DNA isolation protocol (see Section 3.4.) is used then a frequent cutting enzyme must be used with a standard electrophoretic environment. If the YAC DNA can be differentiated from host DNA by restriction fragment length polymorphisms (RFLPs), then probes from the YAC vector or from the cloned insert can be used for structural analysis (see Fig. 2). For instance, if a human YAC clone is transfected into a murine cell line then either of the foregoing two approachesto restriction mapping could be used. On the other hand if the degree of polymorphism between the YAC and host genome is not great, only the second approach may be useful. One example is the use of A4us spretus YAC clones to transfect MUS musculus cell lines. In this case there is little repeat sequencedivergence, so a repeat sequence fingerprint cannot be generated. There is sufficient sequence

318

Strauss

divergence, however, to differentiate a spretus YAC from a musculus genome with unique sequenceprobes and informative restriction enzymes. The appropriate choice of enzyme will differentiate the YAC sequences from the host sequences(see Fig. 2). In either case, the vector probe will allow the investigator to determine the copy number of each arm in the transfected cell line. For instance, no BamHI sites exist in the pYAC4 vector, thus using this enzyme and a probe from one arm will show a single hybridizing band if the YAC is present in single copy number (see Fig. 2). The arm specific probes easily can be generated by the digestion of pBR322 with PvuII and BamHI. The two fragments generated will each correspond to one arm. A variant of restriction mapping for the purpose of determining the integrity of transfected YAC DNA depends on engineering the YAC before transfection. If rare cutting sites are constructed into either side of the YAC vector, then an even stronger demonstration of integrity after transfection can be made. If these rare cutting sites are not found in the cloned insert, after restriction digestion, fractionation, and hybridization a unique restriction fragment the approximate size of the original YAC will be revealed only if the transfectant contains an intact YAC. Rearranged transfected YACs should exhibit a band of different mobility. The third approach to determination of transfected YAC integrity requires fluorescent in situ hybridization technology (FISH). Mitotic and interphase chromosomes of transfected cell lines can be analyzed by this technique. One can determine which YAC fragments are present in the cell line, which fragments are colinear, and where in the genome the YAC transgene is located. YAC specific probes can be screened rapidly by this procedure with a point to point resolution of ~10 kb when using the interphase chromosome. 2. Materials of Large Volume Yeast Cultures Density Chromosomal DNA

2.1. Preparation and High 1. Digestion buffer: 250 mA4 EDTA, 20 mM Tris-HCl, pH 7.6, 2% n-lauryl sarcosine, 0.5 mg/mL proteinase K. Add the ProtemaseK fresh prior to use. 2. Phenylmethylsulfonylfluoride (PMSF) 100X stock: 100 mM PMSF in 100% isopropanol, made up fresh prior to use.

3. Storagebuffer: O.lM EDTA, 0.02M Tris-HCl, pH 8.0.

DmIn --~-

Pm

Wllll

12341234

I2 +

BAMIII

34

1234

P3-n 1234

wull I2

3

BUlm 4

Pm

I2341234

wuw I

g

34

l i-

-9-4 ‘e -4.3

i 1 -M i -24 4 1

Lt

Rt

Fig. 2. RFLP analysis of ES cells transfected with a YAC. The ES cells were propagated without feeders on gelatincoated tissue culture plates in the presence of lo3 U/mL of leukocyte inhibitory factor (LIF). DNA was prepared in plugs, digested with’BamH1, MI, or PvuII, separated by.electrophoresis on a 1% gel and transferred to a Zetabind filter (Cuno). DNA was successively hybridized to a collagen cDNA probe, a left arm (Lt) YAC probe or a right arm (Rt) YAC probe. Lanes 1 and 2 contain DNA from transfected ES cells, lane 3 contains M. muscuhs DNA and lane 4 contains M. spretus DNA. The figure clearly shows the power of RFLP analysis for the demonstration of successful transfection of YAC DNA.

320

Strauss

4 5. 6. 7.

5% SeaPlaque-GTG agarose m 100 mM EDTA, pH 8.0 Zymolyase 1OOT(Seigaku America Inc., Rockville, MD). 1M Sorbitol, 20 mM Tris-HCl, pH 7.0. Drop out mix powder (lacking uracil and tryptophan for selection of conventional YACs): Mix together well 2 g (except where noted) of each of the following dry constituents:adenine, alanine,p-ammobenzotc acid (0.2 g), arginine, asparagme, aspartic acid, cysteme, glutamic acid, glutamme, glycine, histidine, rnositol (0.1 g), isoleucine, leucme (4 g), lysine, methtonine, phenylalanme, prolme, serine, threonme, tyrosme, valme. Store at room temperature. 8. Rich drop out media: Add 2 g of the appropriate drop out mix to flask 1, then add 1.45 g yeast nitrogen base without ammo acids and ammonium sulfate (Difco, Detroit, MI), 5 g ammomum sulfate (Difco), and 500 mL of dH20. In flask 2 suspend 20 g agar m 450 mL dH,O, autoclave each separately and then mix, and add 50 mL of 40% glucose. Pour plates and allow to set for 24 h prior to use. Liquid media is prepared in a similar fashion except that the agar is omitted. 9. @Mercaptoethanol (Sigma, St. Louis, MO). 10. PFGE plug molds. 1 2 3. 4. 5. 1. 2. 3. 4. 5.

2.2. Gel Purification 1OX TBE (Tns-borate-EDTA) electrophoresis buffer: 242 g Tris base, 123 g Boric acid, 5.2 g EDTA-Na,, dissolve m 4 L of dHzO. Dilute 1:20 prior to use m a PFGE apparatus, 1:10 for other electrophoretic applications. Low melt agarose: SeaPlaque GTG agarose (FMC, Rockland, ME). PFGE apparatus (BioRad [Richmond, CA] CHEF DRIII). Ethidtum bromide (10 mg/mL stock solution). Dialysis buffer: 20 mMTris-HCl, pH 7.6, 1 mMEDTA, 100 l..uJ4spermme. 2.3. Lipofection Dulbecco’s Modified Eagle media (DMEM) (Gibco-BRL, Gaithersburg, MD). 10X DMEM (Gibco-BRL). OptiMEM (Gibco-BRL). Evans-Kaufman (EK) media: 500 mL high glucose DMEM, 75 mL fetal bovine serum, 5 mL nonessential amino acids, 5 mL pemctllin/streptomycin, 4 pL P-mercaptoethanol (all available from Gibco-BRL). Commercially available lipids (see Note 5): a. Gibco-BRL. Lipofectin (DOTMA and DOPE), lipofectamine (DOSPA and DOPE). b. Boehringer Mannheim (Mannheim, Germany): DOTAP. c. Promega (Madison, WI): DOGS.

Transfection

of Mammalian

Cells

321

6. Condensing agents: spermine (Fluka, Buchs, Switzerland), poly+-lysine low molecular weight (Sigma, PO879). 7 Plasticware: 100-n-u-ncell culture dishes, T75 and T175 cell culture flasks. 8. P-Agarase: For transfections, it is important to use a very high quahty agarase, two preparations (NEB and Gelase) are recommended.

2.4. Genomic

DNA Isolation

1. Lysis buffer: 100 mMTris-HCl, pH 8.5,5 rnMEDTA, 0.2% SDS, 200 mM NaCl. On day of procedure add proteinase K stock to produce 100 pg/mL. 2. Proteinase K stock solution (1000X): 100 mg/mL m 20 mM Tris-HCI, 1 rnMEDTA, pH 8.0. 3. T,,E: 20 mMTris-HCl, pH 7.6-8.0, 1 MEDTA. 4. Plasticware: 24-well cell culture dishes. 3. Methods

3.1. Preparation and High

of Large Volume Yeast Cultures Density Chromosomal DNA

1. Inoculate 50 mL of rich drop out media with a 1:100 dilution of a stationary culture. 2. Grow the culture overnight at 30°C in a roller drum to saturation. 3. Inoculate 2 L of the same drop out media with the fresh overnight culture at an inoculation of 1:100. 4. Shake cultures at 260 rpm at 30°C. (Grow up for a duration not to exceed 24 h. It is important not to overgrow the culture.) 5. Transfer the cells and broth to Beckman 1-L canister bottles and spin in J6 at 800-l OOOgfor 10 mm to pellet cells. 6. Resuspend cells in distilled deionized water and repeat the pelletmg. 7. Resuspend cells in 1M sorbitol and repeat the pelleting. 8. Resuspend cells in 10 mL of 1M sorbitol and transfer to a 50-mL plastic conical, rinse out the 1-L canister to recover all of the cells, and add to the 50-mL tube. 9. Spin down the cells m 56 at SOCrlOOOgfor 5 min and gently remove the clear supematant; the sorbitol will contrtbute 10 mL of volume, the total volume should be 30 mL so there should be approx 20 mL of cells (see Note 1). 10. Add 17 mL of 1M sorbitol and 1 mL of /3-mercaptoethanol to bring final volume to 48 mL, then add 60 mg of zymolyase 100-T. After mixing, split the reaction between 3 x 50 mL conical tubes (16 ml/tube) and mcubate at 37°C for 45-70 min till spheroplasted (check microscopically, see Note 6). 11. Add 5 mL of 5% SeaPlaque GTG low melt agarose in 100 mA4 EDTA (equilibrated to 54°C) and immediately cast m plug molds.

322

Strauss

12. Eject plugs into two fresh 50-mL plastic conicals, using an air line. 13. Add digestion buffer (with fresh proteinase K) and digest overnight at 5055OCwith very gentle agitation. 14. Treat with 1 mMPMSF by simply adding a 1: 100 volume of stock solution to the tube and letting sit for 60 min at room temperature. 15. Decant inactivated digestion buffer and add storage buffer.

3.2. Gel Purification

of YAC DNA

1. Prepare source DNA in agarose plugs, and dialyze in 0.5X TBE. 2. Pour a 0.5-l .2% low melt agarose gel in 0.5X TBE using a glass casting plate with velcro strips. Use a single slot trough with small wells at either end for lane markers (see Fig. 3; Note 4) 3, Equilibrate the DNA plugs against runnmg buffer (0.5X TBE) and load them into the slot trough lengthwise. Make sure that the plugs are as close to each other as possible without placing them under significant compression. The plugs can be sealed in the trough with a little warm agarose. (Use the same mixture as you used to pour the gel.) 4. Into the outer lanes, load sizemarkers to ensure accurate sizing of the DNA fragments. (If one is fractionating whole yeast chromosomes this step is unnecessary.) 5. Place the whole glass plate (with the gel firmly attached to It) mto a prechilled PFGE apparatus. Let the gel equilibrate in the chamber for lO15 min, then commence the PFGE run. 6. After the PFGE run is complete, slice off the left and right edges of the gel contaming the size markers and a small portion of the sample DNA. Carefully slide these samples into a staining bath containing running buffer with 100 mg/L ethidium bromide. Let the gel slice slices stain for 30-60 min, and destain with buffer alone for 30-60 min (see Notes 7 and 8). 7. Place these slices side by side with a ruler atop a UV transilluminator (short or medium wave UV is suitable) and photograph. (It 1simportant to examme both sides of the gel as PFGE gels often run with a little deformation from edge to edge.) 8. Going back to the remaining unstained gel, place two rulers on either side of the gel. Line up a third ruler along the width of the gel using the photograph as a reference. Use a clean scalpel to slice a strip of the desired section of the gel. 9. Transfer this slice to a 50-mL conical centrifuge tube and dialyze against the dialyses buffer listed in Materials. (At least three changes are required over a course of 12 h.) The DNA is usually stable for several days to a week, but it should be used as soon as possible.

Transfection

of Mammalian

Cells

323

I

‘\ velcro teeth

\

g ass

20 cm

_I

1

b

20 cm

Fig. 3. A schematic for the construction of a large format gel support. Velcro teeth are glued to a standard glass plate with silicone adhesive. The gel is then cast by wrapping tape around the edges of the plate, inserting the slot comb onto the plate, and pouring melted agarose onto the plate. IO. In order to accessthe gel-bound DNA, subdivide the gel slice in to OS- to 2.0~mL sections and transfer into capped and sterile 15-mL round bottom polystyrene tubes (Falcon, Lincoln Park, NJ).

3.3. Lipofection

Procedures

3.3.1. Lipofection of Adherent Cells 1. A few days (depends on growth rate of cells) prior to the transfection, plate out cells onto 100-mm dishes. The plating should ensure that the day of the transfection the cells will be 95% confluent (see Note 9).

324

Strauss

2. On the day of transfection add to the gel slice poly L-lysme to a final concentration of 4 pg/mL. Warm the tube to 65-68”C until the gel slice 1s melted and equilibrate at 40°C for 5 mm. 3. Add 10 U of P-agarase, gently mix, and allow to digest for 60-120 mm. 4. Add the appropriate amount of catiomc hpid (for DOTAP 5-30 pg) and allow the mixture to complex at room temperature for 30 min. 5. Equilibrate the transfection complex sample with 1:10 volume of 10X DMEM, 1 mL of OptiMEM can be added. The final volume should be between 2 and 5 mL. 6. Wash the monolayer of cells free of standard medium with OptiMEM and then apply the transfection complex (see Note 10). 7. Stop the transfection at 4 h or continue overnight depending on the viability of the cells. Stop the transfectton by changing to fresh media. Culture for 24-48 h and apply selection. 3.3.2. Lipofection of Cells in Suspension Some cells grow in suspension, and some cells that grow adherently

are better transfected in suspension. In particular this protocol was developed for use with murine embryonic stem cells (ES cells). I. Thaw a vial of ES cells and expand on a feeder layer in a T25 flask for 3 d. Split the flask 1:6 on to 3 x T75 flasks and culture for 3 d. Dependmg on the size of the experiment these three flasks can again be split 10X T175 (approx 1:8 spht by surface area). It IS important to use the cells on d 3. 2. On d 3, trypsimze the cells and remove the feeder cells from the culture by preplatmg on fresh plastic plates for 30 min at 37°C. Wash the nonadherent cells and count. 3. Add 5 x 106-1 x 1O7cells to each 15-mL polystyrene tube (Falcon) containing the prepared transfection complex (see Section 3.3. I.), loosely recap, and place m an mcubator at 37OCfor 4 h with occasional (once an hour) gentle mixing to resuspend the settled cells. 4. Subsequently plate the cells from each tube mto a single lo-cm trssue culture dish over a monolayer of uradiated feeder cells in Evans-Kaufman (EK) media. 5. Change the media 24-48 h later and place the cells under selection. This is called d 0. 6. By d 2 there should be massive cell death, and few colonies should remam. By d 6 real resrstant colomes should be discernible from background and colonies can be picked on d 8-10 (see Note 11).

Transfection

of Mammalian

3.4. High

Throughput

325

Cells Genomic

DNA Isolation

1. Into each well of a 24-well tray containing growing cells, pipet 500 PL of lysis solution. 2. Incubate overnight at 55°C on a gently rocking or rotatmg rack. 3. Add 500 PL of isopropanol. 4. Rock the samples back and forth to mix. After the samples are well mixed the DNA should precipitate and form a lacy pellet. 5. With a fresh yellow tip pick the pellet out of the tube and transfer to a fresh tube, the samples can be washed (optional) with 95% ethanol. 6. When all tubes are complete add 100 PL of TzoEto the samples and allow to resolubilize. Use 10 PL for each genomic digest destined for Southern blot.

4. Notes 1. All the proportions of sorbrtol and agarose are calculated to achieve a certain concentration of cells, expressed as a ratio of initial cell volume to final agarose plus cell plus sorbitol volume. The desired ratio of cell volume to final plug volume is between 0.32 and 0.35. For example, if one has 20 mL of cells and wants a final ratio of 0.32 then the final amount of agarose embedded cells would be 63 mL (20/63 = 0.32). 2. Do not overload the gels, DNA density in the plugs makes a significant difference in final resolution on PFGE. Routine concentrations of 6 x 1OS to 1 x 1Ogyeast cells per milliliter are never a problem, very high concentrations of yeast can be used with care. 3. It takes quite a while for the low percentage agarose gels to solidify, one trick is to cast the gel m a 4OCcold room. 4. The gel setsinto the velcro and thus the casting plate grips and supports the delicate gel during handling and electrophoresis. This item is easily homemade utilizing velcro strips (only the teeth portion) silicon glue and a standard 20 x 20 glass plate. 5. Transfection lipids: a. DOTMA: N-[ l-(2,3-diioleyloxy)propyl]-N,N,N-trimethylammonium chloride. b. DOSPA: N-[2-( (2,5-bis(3-aminopropyl)amino]- 1-oxypentyl} amino) ethyl]-N-,N-dimethyl-2,3,bis(9-octadecenyloxy)1-propanaminium trifluoroacetate). c. DOTAP: N-[ 1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethyla~oniummethylsulfate. d. DOGS: Dioctadecylamidoglycyl spermidine. e. DOPE: dioleoyl phosphatidylethanolamine.

326

Strauss

6. Microscopic determination of spheroplasting is best achieved m the following manner: Prepare a 1% SDS and 1M sorbrtol solution. On a microscope slide place a 10-pL drop of the SDS and 10-nL drop of the sorbitol m a separate location. To each drop add 2.5 nL of the treated yeast culture. Mix and cover the drops with a coverslip. Examme the cells under a phase microscope at 200x magnification. The sorbitol-treated cells should look unchanged from untreated cells, the SDS-treated cells should appear blown apart, pale, and ghost-like if successful spheroplasting has been achieved. 7. It facilitates further transfer of these staining samples to place the strips on top of a plastic or glass sheet prior to and during staining. 8. This step improves the signal to noise ratio by reducing the background. 9. It has been observed that there is less toxicity with confluent monolayers. 10. It is important to transfer the transfectlon complex as gently as possible to ensure that the DNA is not sheared. The use of wide bore pipets is recommended. 11. Some cells grow m a nonadherent manner, for selection of nonadherent cell lines different strategies must be employed. Obviously, if one IS working with a cell line that grows m suspension the latter half of this protocol is inappropriate. After the transfection step the cells can be selected in bulk and then cloned in microtiter wells after a significant period of drug selection. The disadvantage of this approach is the faster growing clones. Clones that grow faster will tend to predominate and bias recovery of other clones. An alternative IS cloning or simple fractionatron of the transfected cells prior to the commencement of selection.

References 1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segments of exogenous DNA into yeast using artificial-chromosome vectors. Science 236, 806-812. 2. Schwartz, D. C. and Cantor, C. R. (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37,67-75. 3. Chu, G., Vollrath, D., and Davis, R. (1986) Separation of large DNA molecules by contour-clamped homogeneous electric fields Scrence 234, 1582-l 585 4. Strauss, W. M., Jaenisch, E , and Jaemsch, R. (1992) A strategy for rapid production and screening of yeast artificial chromosome libraries. Mammaltan Genome 2, 150-157. 5. Strauss, W. M and Jaenisch, R (1992) Molecular complementation of a collagen mutation in mammalian cells using yeast artificial chromosomes. EMBO J 11, 417-422 6. Strauss, W. M., Dausman, J., Beard, C., Johnson, C., Lawrence, J. B., and Jaemsch, R. (1993) Germ line transmission of a yeast artificial chromosome spanning the murine alpha 1(I) collagen locus. Sczence 259, 1904-l 907.

Transfection

of Mammalian

Cells

327

7. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W , Wenz, M., et al (1987) Lipofection, a highly efficient, lipid-mediated DNA-transfectton procedure. Proc Nat1 Acad. Sci. USA 84,74 13-74 17 8. Lamb, B. T., Sisodia, S. S., Lawler, A. M., Slunt, H. H , Kttt, C. A., Kearns, W. G., et al. (1993) Introduction and expression of the 400 kb precursor amyloid protem gene in transgenic mice. Nature Genet 5,22-30 9. Gosule, L. C. and Schellman, J. A. (1978) DNA condensation with polyamines. J Mel Biol 121,3 1l-326 10. Chow, T. K., Hollenbach, P. W., Pearson, B. E , Ueda, R. M., Weddell, G N , Kurahara, C. G., et al. (1993) Transgenic mice containing a human heavy chain immunoglobulm gene fragment cloned in a yeast artificial chromosome. Nature Genet 4, 117-123. 11. Laird, P W., Zyderveld, A., Linders, K., Rudmcki, M. A., Jaenisch, R., and Berns, A. (199 1) Simplified mammalian DNA tsolatlon procedure. Nucleic Acids Res 19,4293.

CHAPTER27

The Isolation of cDNAs by Hybridization of YACs to cDNA Libraries Russell

G. Snell

1. Introduction The isolation of genes from large candidate regions is one of the major problems for the molecular biologist. With the advent of yeast artificial chromosomes (YACs), the problem of cloning these regions is now largely solved; however, screening these large genomic regions for expressed sequences is still a very time-consuming task. The scale of this task will become even greater as the emphasis shifts to the identification of the genes involved in polygenic disorders. There are a number of methods for identifying expressed sequences, all of which have their merits and difficulties. It is likely that more than one method will be necessary to isolate all the genes coded for in a genomic region. The hybridization of radioactively labeled YACs to filter lifts of cDNA libraries is described in this chapter. This is a relatively straightforward method for isolating at least some of the genes from within a candidate region (1,2). It has been used successfully to identify specific genes, including the neuroflbromatosis type 1 gene and the human alpha adducin gene, demonstrating the potential power of this technique (3,4). The main advantage of this technique over others is its simplicity. 1.1. Overview of the YAC Hybridization Method There are two problems in using YACs as hybridization probes. First, YACs are lO&lOOO times longer than the DNA generally used as a From Methods m Molecular Biology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

329

330

Snell

probe. The molar concentration for an equivalent mass of a YAC IS 1OOto lOOO-fold less. Consequently, as the signal from a hybridization is directly related to the net activity per copy, the activity per kilobase has to be increased for anywhere near equivalent results. Second, the large numbers of repeat sequences in a YAC that will be labeled as part of the probe must be stopped from hybridizing to prevent spurious clone detection. In the method described here, the first difficulty is overcome by simply using lo- to 20-fold more isotope in the YAC labeling reaction over a conventional reaction for an equivalent mass of DNA. Longer autoradiographic exposure times also “enhance” the signal. The second difficulty is avoided by preannealing the repeat sequences in the probe and on the plaque lift filters with competitor DNA. This effectively removes these sequences from the hybridization. In order to reduce the complexity of the probe, and thereby increase the hybridization signal, the YAC is first separated by size from the majority, or ideally all, of the host’s chromosomes. This is accomplished using preparative pulsed field gel electrophoresis (PFGE) (5,6). The YAC DNA is then retrieved by cutting it out of the gel. This is then used as a probe after radioactively labeling to a high specific activity and prehybridizing with added cold DNA. In some cases, when YACs cannot be separated from comigrating yeast chromosomes, these have to be included in the probe. This increases the complexity of the probe so more isotope may have to be added to the labeling reaction. The cDNA library to be screened obviously should be made from the tissue that is likely to contain the transcripts of the gene of interest. The library is plated at a relatively low density, as large plaques are easier to detect. Filter lifts are taken from the plates and prehybridized in denatured blocking DNA. This step again results in the preferential annealing of repeat sequences and blocks nonspecific sites on the filter. The preannealed probe is then added to the preannealed filters and allowed to hybridize. Following the hybridization, the excess probe is washed off at various stringencies aiming for a low background without removing the specific hybridization. Positively hybridizing plaques are then replated and screenedagain in the sameway. Clones that come through this procedure are localized by hybridization back to the YAC (and, if possible, somatic cell hybrid DNA), which also serves as a check for the presenceof repetitive sequencesin the clone.

The Isolation

of cDNAs

The three most important parameters in this method are the choice of library to screen, the activity of the probe, and the stringency of the posthybridization washes. Even with all these precautions however it is unlikely that the procedure can be optimized so that only true localizing clones are isolated. This results in part because low level repeats are not effectively blocked from the probe and also the true signal to background ratio is low. 2. Materials 1. Yeast synthetic drop out media (seeChapter29). 2. SE: 75 mMNaC1,25 mA4 EDTA, pH 8.0. Sterilize by autoclaving. 3. Low melting point (LMP) agarose. 4. 0.5M Dithiothreitol (DTT). This is prepared m SE, filter sterilized, and stored at -2OOC. 5. 10 mg/ mL Lyticase (1000 U/mg, Sigma [St. LOWS,MO] cat. no. L8012), prepared in SE and used the same day. 6. OSM EDTA, pH 9.5. 7. Sodium lauryl sarcosyl (SLS). 8. Proteinase K (20 mg for each YAC clone grown). 9. 5X TBE: For 1 L 54 g Tris, 27.5 g boric acid, 20 mL 0.5MEDTA, pH 8.0. 10. 10 mg/mL Ethidium bromide. Powder is dissolved in water and stored at room temperature m a light proof vial. 11. [a-32P]dCTP (3000 Ci/mmol, Amersham, Arlington Heights, IL). Partlcular care should be taken when handling the radioactive isotope as a considerable amount is used in this procedure. 12. Sheared human placental DNA (Type III Sigma). 13. Sheared denatured salmon sperm DNA (Type III, Sigma). 14. YAC vector DNA. 15. 20X SSC: For 1 L 175.3 g NaCl, 88.2 g sodium citrate. Adjust pH to 7.0 with NaOH. 16. 50X Denhardt’s reagent: For 500 mL, 5 g Ficol (type 400 Pharmacia,

Uppsala, Sweden), 5 g polyvinylpyrrolidone, 5 g bovine serum albumin (BSA) (fraction V, Sigma). Filter sterilize and store at -20°C. 17. 18. 19. 20. 2 1.

Sodium dodecyl sulfate (SDS). PEG 8000. Phage cDNA library. Hybond N (Amersham, Amersham, UK). 1OX Klenow polymerase buffer: 0.5M Tris-HCl, pH 7.5, 0. 1M MgCl*, 10 WDTT, 0.5 mg/mL BSA.

22. Escherichra coli DNA polymerase 1, Klenow fragment.

332

Snell

23. 3dNTP mix, each 0.5 mA4 (minus dCTP). 24. Random hexanucleotides (Pharmacta). 25. Block molds, 100 each 100 pL in volume and shaped to produce wellshaped blocks.

3. Methods 3.1. Growth ofYeast Containing YACs and Preparation of DNA in Blocks This method produces 100 blocks of 100 yL in volume, each containing approx 3 l.tg of DNA. 1. Inoculate 200 mL of appropriately supplemented mmimal medial (see Chapter 29) with a few mtcroliters of a glycerol stock. Grow for 2 d shaking at 30°C. 2. Make up fresh 5 mL of 2% LMP agarose in SE containing 1mg /mL (1000 U/ mL ) lyticase and 50 mM DTT/200 mL of initial culture. Melt the agarose in the SE and cool to 42OCbefore adding the lyticase and DTT. Keep at 42°C for use. 3. Harvest the yeast by centrifugation at SOOgfor 5 min and wash by resuspending the pellet in 50 mL of SE and recentrifuge. Repeat this step. 4. Resuspend the washed pellet in 5 mL of SE, incubate at 42°C for a few minutes. 5. Mix the cells m SE with the LMP agarose, DTT, lyticase by pipeting up and down a few times, then pour mto the molds, and allow to set. 7. Place the agarose blocks containing the cells in 5 mL of SE with 25 mM DTT and 0.5 mg/mL lyticase (500 U/mL), for 4 h at 37°C. 8. Pour off the solution and add 9 mL 0.5M EDTA, pH 9.5, 1 mL of 10% SLS, and 20 mg of proteinase K. Incubate at 50°C for 48 h. The DNA containing agarose blocks can then be stored m this solution indefinitely at 4°C (see Note 1).

3.2. Purification

of Probe DNA by PFGE

1. Precool the running buffer (0.5X TBE) to the desired temperature m the electrophoresis tank. 2. Make a 1% LMP agarose gel without ethidium bromide. 3. Load samples into the wells of the gel, making sure that the top of the sample is below the surface of the gel. It is not necessary to wash the blocks before electrophorests. To prevent samplesfrom floating out of the gel, some warm LMP agarose can be added to the sample in the well. 4. Place the gel m the tank making sure that the gel will remain flat on the bottom of the tank or tray during the run.

The Isolation

of cDNAs

5. Electrophoresis conditions will vary according to the apparatus used and the size of the YAC to be separated. Using CHEF apparatus from BioRad (Richmond, CA) ramped pulse times from I O-200 s over 42 h at 160 V are good starting conditions for YACs >3OOkb.For YACs smaller than this, a ramp of 5-80 s over 22 h at 200 V and 14°C gives good resolution. More generally, lengthening the average pulse times increases the difference m mobtlity of larger YACs. 6. After electrophoresis the DNA is stained by soaking the gel m the runnmg buffer containing 5 pg/mL of ethidium bromide for 30 min. 7. An estimation of relative level of fluorescence is made of the YAC band to determine the amount of DNA and it is cut out of the gel (see Note 2). 3.3. cDNA Library PZating (see Note 3) There are many well written protocols for plating phage libraries that vary slightly depending on the vector-host cell combination (7,s). The only variation from these protocols recommended is to reduce the density of the plaques to approx 2000/g-cm plate and grow them to confluence. The larger plaque size enables easier clone identification. Plaque lifts are taken on Hybond N (Amersham) according to the manufacturer’s instructions. It may be that if an alternative membrane is used, the hybridization protocol, in particular the filter blocking, may have to be changed. 3.4. Probe Labeling, Filter Prehybridization, and Hybridization A considerable amount of isotope is used in this procedure. Care should be taken to minimize exposure. The labeling method is random primer extension (9). 1. Estimate the concentration of DNA in the agarose containing the YAC band by comparing the amount of DNA (as estimated by relative fluorescence) with the mass of the agarose. 2. Melt the band by heating to 65°C and take a volume equivalent to approx 100 ng of DNA. Calculate the volume of water needed to increase the final reaction volume to 300 yL (inclusive of the other components in the labeling reaction) and add to the agarose. Boil this for 5 min. 3. At 37°C (while the DNA in agarose is still molten) add 30 pL of the 3 dNTP mix, 30 uL of the 10X Klenow fragment buffer, 0.5 pg of the random hexanucleotides, the appropriate volume of [a-32P]dCTP (see Note 4), and 20 U of Klenow fragment. Incubate from 4-16 h at 37°C. Alternatively, a commercial labeling kit can be used.

334

Snell

4. To ethanol prectpitate the probe and separate it from the majority of the unincorporated nucleotides, heat the labeling reaction to 65°C to melt the agarose and quickly add 150 pL of 7SMammonium acetate and 900 pL of ethanol. Mix by pipeting carefully and place on ice for 30 min. 5. Centrifuge at full speedin a microfuge for 10 min and discard the supematant. The pellet consists of agarose and DNA as well as some unincorporated nucleotides that do not present any problems. 6. Estimate the volume of the pellet and add to it 1 mg of sheared human placental DNA (100 pL of 10 mg/mL), 20 pg of YAC vector DNA, and water to a final volume of 300 pL. Boil for 5 mm making sure the probe is fully resuspended. Determine the activity of the probe in dpm. 7. Add 100 pL of 20X SSC (final concentration 5X SSC) and place at 65°C for 4-6 h. This step is designed to preanneal the repeat sequences m the probe. 8. Make up the filter prehybridization/hybridization solution consisting of 5X SSC, 5X Denhardt’s, 6% PEG 8000, 1% SDS 100 p.g/mL sheared denatured salmon sperm DNA, and 100 pg/mL sheared denatured human placental DNA (or DNA from the speciesthe YAC DNA originated from). Denature the DNA by boiling for 10 min then add to the rest of the solution Approximately 100 mL is sufficient for 40 or more g-cm filters. 9. Prehybridize the filters for 4-6 h at 65°C in a box with gentle agitation at the same time that the probe is preannealing. 10. After the preannealmg of the probe and the prehybridization of the filters pour off some of the prehybridization solution and add the probe to this (see Note 5). Mix and add back to the filters. Hybridize for 24 h at 65°C. 11. After hybridization pour off the probe and commence washing the filters m 4X SSC 0.1% SDS at 65°C for 20 min. The stringency is then increased step wise (2X SSC, 1X SSC, 0.5X SSC, 0.2X SSC, all with 0.1% SDS at 65°C) until the activity measured within 1 cm of a single filter with a Gelger counter (Mm1 Instruments series 900 mini monitor) is approx 4 cps. The final wash stringency may be 0.5X SSC or 0.2X SSC, depending on the activity remainmg on the filters (see Note 6). 12 Autoradiography should be carried out at -7OOC or colder usmg an intensifying screen for l-3 d. 13. Plaques corresponding to a range of hybridization mtensities should be picked for purification by hybridization using the same method as the primary screen. They should be plated at a lower density so single plaques are well spaced.

Some of the purified clones will be false positive, either because they contain sequences that are either low level repeats, yeast, or just spuri-

The Isolation

of cDNAs

335

ous. It is necessary to test each cDNA by hybridization to PFGE Southern blots of a selection of YACs that are expected to be positively and negatively hybridizing. Repeats are apparent after only 2-3 h autoradiography. Further localization by hybridization to Southern blots of separated digested YAC DNA, genomic DNA, and somatic cell hybrids, if available, should also be done.

4. Notes 1. Yeast chromosome degradation in blocks: This seems to be mostly dependent on the batch of lyticase used. If the chromosomes are degraded, try another batch of lyticase. 2. No apparent YAC band: Sometimes rt is not obvious which is the YAC band, either due to low DNA concentration or comigration of the YAC with one of the yeast chromosomes. It may be necessary therefore to identify the location of the YAC band by Southern blotting and hybridization. 3. Choice of a cDNA library: Do not use a library that has been made using yeast carrier RNA at any stage. 4. The amount of radioisotope needed is dependent both on the size of the YAC to be labeled and whether there are comigrating yeast chromosomes that will be labeled as part of the probe. As a guide, 150 pCi IS sufficient isotope for single YACs of up to about 300 kb. For larger YACs or YACs copurified with yeast chromosomes, the net activity per 100 ng of DNA does not increase much when more than 330 PCi is added. 5. Activity of the probe: I have used probe ranging m activity from 1.7-4.8 x lo6 dpm/mL. It may be that even higher activity will result in background problems. 6. The washing of the filters is probably the most critical step. Because of the high complexity of the probe the relative difference between background signal and true plaque detection is not high. Therefore, all the background activity should not be washed off the filters, at least initially.

References 1. Elvin, P., Slynn, G , Black, D., Graham, A., Butler, R , Riley, J , Anand, R., and Markham, A. F. (1990) Isolation of cDNA clones using yeast artificial chromosomeprobes.Nucleic Acids Res. 18,39 13-39 17 2. Snell, R. G., Doucette-Stamm,L. A., Gillespie, K M., Taylor, S. A. M., Rlba, L , Bates,G. P., et al. (1993) The isolation of cDNAs within the Huntington disease region by hybridisation Mel

Genet

of yeast artificial chromosomes to a cDNA library Hum.

2,305-309.

3. Wallace, M. R., Marchuk, D. A., Anderson, L. B., Letcher, R., Odeh, H. M., Saulino, A. M., et al. (1990) Type 1 neurofibromatosls gene: identification of a large transcript disrupted m three NFl patients.Science 249, 18 l-l 86.

4 Taylor, S A. M , Snell, R. G., Buckler, A., Ambrose, C., Duyao, M , Church, D , et al. (1992) Clonmg of the a-adducm gene from the Huntington’s disease candidate region of chromosome 4 by exon amphfication. Nature Genet 2,223-227 5 Schwartz, D C. and Cantor, C. R (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresrs. Cell 37,67-75. 6 Chu, G , Vollrath, D , and Davts, R W. (1986) Separation of large DNA molecules by contour-clamped homogeneous electrtc fields Science 234, 1582-1585 7. Sambrook, J. Frttsch, E F., and Mamatis, T. (1989) MoZecular BzoZogy--A Laboratory ManuaE 2nd ed , Cold Sprmg Harbor Laboratory, Cold Spring Harbor, NY. 8 Ausubel, F M., Brent, R., Kingston, R. E., Moore, D. D., Serdman, J. G , Smrth, J. A , and Struhl, K. (1993) Current Protocols zn Molecular Brology, Greene Pubhshmg and Wiley, New York 9. Feinberg, A. P and Vogelstem, B. (1983) A techmque for radiolabelling DNA restrtctron fragments to a high specific activity Anal Blochem 132, 6-13

CHAPTER 28

cDNA Selection Satish

with YACs

Parimoo

1. Introduction One of the major efforts in the field of positional cloning and the human genome project is to identify coding sequences or transcription units in large genomic regions such as yeast artificial chromosomes (YACs).The task proves to be challenging because only a small percent of the total DNA of the genome codes for mRNA, whereas the remainder consists of introns, intergenic sequences, and various repetitive sequences, Gene discovery by large scale genome sequencing with the available sequencing technology is not a practical approach, at least for the present. Several approaches for identifying expressed sequenceshave been described (1-9). So far, however, experience with these methods at the megabase level remains limited. A simple and efficient polymerase chain reaction (PCR) (10) based approach of direct cDNA selection (11) is described in detail here to permit rapid identification of cDNA fragments encoded by large genomic DNAs, such as YACs. This approach has been used successfully to identify several new genes in one megabase region of the HLA-A region (12,13). It has also been tested, although to a limited extent, with total yeast genomic DNA containing YACs that could further simplify the process (14). The general approach of cDNA selection consists of immobilizing the target genomic DNA fragments (YAC DNA restriction enzyme digests) on a small piece of nylon paper. Total cDNA library fragments are amplified by PCR from cloned short-fragment (sf) random primed cDNA libraries using flanking vector primer sequences.This cDNA is annealed From Methods m Molecular Bology, Vol 54 YAC Protocols E&ted by D Markle Humana Press Inc , Totowa, NJ

337

Purim00

338 lmmoblllse heat denatured DNA on a

Block repeats & rlbosomal RNA sequences

Second cycle 01 hybrld- selection with a new preblocked nylon piece. PCR smellflcatlon with prlher pair ‘A’

h( -7 i‘&=-

~9 d$

Wash

off nonspeclflcally

Elute

& PCR amplify

-z

bound cDNA

Digest

cDNA

with EcoRI,

&

PCR ampllfled cDNA library Inserts wlth Xgtitl flenklng sequences (prlmer palr ‘C)

molecules.

-

4

Sonlcated, blunt-ended denatured quenching DNA molecules

molecules Analyze

PCR products (optional)

8 make

a llbrary

-

Size select

r

on Southerns

molecules

clone

In ligtl0

I Analyze

Analyze

+

plaques non-encoded

for repeats, sequences.

rlbosomal Discard

RNA (1. any them.

other plaques for unknown and any known encoded In the target genomlc DNA.

cDNAs

Fig. 1. Schematic representation of cDNA selection. The primer sets ‘C’ and ‘A’ are identical to the primer sets I and II respectively (Section 2.3.).

to the immobilized target DNA (YAC) on the nylon paper discs in the presence of an excess of quenching/blocking reagents to block repeats and GC-rich sequences such as ribosomal sequences. The nylon paper discs containing immobilized DNA are washed to remove nonspecific material, and the cDNAs are recovered by thermal elution, PCR amplification, and cloning. Multiple cycles of selection can be performed as depicted schematically in Fig 1. It is possible to carry out the selection process with very small amounts of target DNA and relatively small

cDNA Selection with YACs amounts of cDNA because of the high sensitivity of PCR. The selection can be carried out with either a single cDNA library in order to get tissue specific cDNAs or with a mixture of cDNAs to get a more comprehensive coverage of cDNAs. The advantage of using a short-fragment random primed library is that it is least affected by any bias introduced by PCR as a result of the size of cDNAs or GC-rich regions of a particular cDNA.

2. Materials 2.1. YAC DNA and cDNA Libraries 1. YAC DNA: YAC DNA is purified by pulsed field gel electrophoresls and electroeluted after restrlctlon digestion of the DNA in agarose plugs. For preparation, see Section 2.5.2. 2. cDNA library: Short-fragment random primer primed cDNA libraries. For preparation, see Section 2.5.3.

2.2. Blocking

Reagents

(see Note 1)

1. Ribosomal RNA clones: a. pR7.3 and pR5.8: Human ribosomal RNA 4% precursor coding region

EcoRI fragments(7.3 and 5.8 kb) cloned in the plasmid pBR 322 (IS). (These were kindly provided by David Ward at the Yale Medical School.) b. Yeast ribosomal RNA clones: RibH 15 and RibH 7 clones contain the entire yeast ribosomal RNA precursor sequence as 7.3 and 2.5 kb Hind111fragments, respectively in pBR322 (16,17). (These were kindly provided by R. Kucherlapati at the Albert Einstein College of Medicine, New York.) These may be necessary for selection with very large YACs (l-2 Mb) corn&rating with large yeast chromosomes, known to harbor severalcopiesof ribosomal RNA genes.They arealso necessary when the target DNA is yeast total DNA rather than pure YAC. 2. Repeat library (RL) DNA: a. RL-I: A genomic repetitive sequence library prepared from the human partial digest genomic library by pooling and subcloning 500 plaques that hybridized to a [32P]probe prepared from total genomic DNA (e.g., XRL-1 m ref. 22). This serves as a source of high copy repeats, and may be replaced by commercially available C&l DNA (BRL, Gaithersburg, MD) supplied as sonicated DNA. b. RL-2: A particular human chromosome specific genomic library subcloned in a high copy plasmld vector such as Bluescript (Stratagene, La Jolla, CA). This library supplements the other repeat library RL-I and may be able to quench some medium or rare abundance repeats. The chromosome library to be usedfor this purposeshould be derived

340

Purim00

from a chromosome dtfferent from the one from which the YAC is derived (e.g., p15 for chromosome 6 YAC selection, ref. 12). It is important to bear in mind, while choosing a particular chromosome specific library, that they are usually contaminated with a small percentage of other chromosomes. 3. Poly d1. dC: From Pharmacia (Uppsala, Sweden) (cat. no. 27-7875); it is dissolved m water and used as such without any further treatment. 4. Yeast DNA: DNA from yeast host alone (without any YAC) such as Succharomyces cerevisiae strain AB 1380.

2.3. PCR Primers 1. Set I (outer primer set of the vector hgtl0): a. 5’ CCACCTTTTGAGCAAGTTCAG 3’. b. 5’ GAGGTGGCTTATGAGTATTTC 3’. 2. Set II (inner set of the vector hgtl0, closest to the EcoRI site): c. 5’ AGCCTGGTTAAGTCCAAGCTG 3’. d. 5’ CTTCCAGGGTAAAAAGCAAAAG 3’.

2.4. Other Reagents

(see Note 2)

1, Restriction enzymes (New England Biolabs, Beverly, MA): EcoRI, HindIII, BamHI. 2. Enzymes: Amplitaq DNA polymerase (Perkin Elmer-Cetus, Norwalk, CT), Mung Bean nuclease (New England Biolabs), RQl DNase and RNasin (Promega, Madison, WI), and T4 DNA ligase (New England Biolabs). 3. Commercial kits: cDNA synthesis kit (BRL, cat. no. 18267-013); Gigapack plus cDNA packaging kit (Stratagene); PCR ds-DNA cycle sequencing system (BRL cat no. 18196-O14). 4. Lambda gt 10 arms: Commercially available EcoRI digested and dephosphorylated hgtl0 arms (Stratagene). 5. Synthetic olrgonucleotides: random hexamers (Pharmacia). EcoRI adaptors (Promega, cat. no. C1291). 6. Ohgo-dT cellulose Type 3 (Collaborative Research, Bedford, MA). 7. Chemicals (Sigma, St. Louis, MO): Tris base (cat. no. T8524), ethylene diamine tetraacetic acid (EDTA), sodium chloride, sodium acetate, ammomum acetate, sodium hydroxide, sodium dodecyl sulfate (SDS), sodium citrate, sodium phosphate (monobasic), calcium chloride. 8. Wash solutions: a. Wash solution I: 2X SSC, 0.1% SDS. b. Wash solution II: 1X SSC, 0.1% SDS. c. Wash solution III: 0.2X SSC, 0.1% SDS. d. Wash solution IV: 0.1X SSC, 0.1% SDS. e. Wash Solution V: 0.1X SSC.

cDNA Selection

with YACs

9. 10. 11. 12.

Ethidium bromide solution, 10 mg/mL (Sigma). Glycogen, 20 mg/mL (Boehringer-Mannheim, Mannheim, Germany). 20X SSC: 3M sodium chloride, 0.3M sodium citrate, pH 7.0. 20X SSPE: 3M sodium chloride, 0.2Msodium phosphate (monobasic), 20 rmI4 EDTA, pH 7.4. 13. 5X SSPE: 0.75M sodium chloride, 0.05M sodium phosphate (monobasic), 5 nuI4 EDTA, pH 7.4. 14. Ammomum acetate: 7.5M, pH 7. 15. Sodium acetate: 3A4,pH 7. 16. SM: 50 mMTrts-HCl, pH 7.5,0.2% MgS04 7 H20, O.lMsodium chloride, 0.0 1% gelatin. 17. Denaturing solution: 0.5M sodium hydroxide, 1.5M sodium chloride. 18. Neutrahzation solutron: 0.5M Tris-HCl, pH 8, 1.5M sodium chloride. 19. ATP, 100 mM (Pharmacra). 20. Deoxynucleotide trtphosphates, 100 rnA4, pH 7.5, stock solutions (Pharmacra). 2 1. MgCl,: 20 nuI4 stock (Perkin Elmer-Cetus). 22. Ligatronbuffer(lX): 50mMTris-HCl,pH7.8, lOmMMgCl,,5mMDTT (Boehringer-Mannheim), 1 n~I4 ATP. 23. TE: 10 mM Tris-HCl, pH 8, 1 rnA4EDTA. 24. TLE: 10 mA4 Tris-HCl, pH 8, 0.1 mM EDTA. 25. 0.5X TBE: 45 nnI4 Tris-base, 45 mA4 boric acid, 0.1 mM EDTA, pH 8.3. 26. DNase incubatron buffer (1X): 50 mM Trrs-HCl, pH 7.9, 10 mMNaCl,6.0 mA4 MgCl*, 0.1 nnI4 CaCl,. 27. PCR buffer: 10X without MgC12 (Perkin Elmer-Cents). 28. Somcatron buffer: 10 mA4 Tris-HCl, 10 mM EDTA. 29. Phenol (Boehringer-Mannheim): Equilibrated to pH 7.5 wrth 10 rnA4 Tris-HCl (18). 30. Chloroform (T. J. Baker, Phillipsburg, NJ). 3 1. Phenol-chloroform: 1:1 mixture of phenol and chloroform. 32. Dialysis tubing (Spectra/Phor 2, Spectrum): Flat width 25 mm. 33. Centricon- (Amtcon, Danvers, MA).

2.5. Preparation

of the Reagents

2.5.1. Yeast Genomic DNA Preparation Yeast genomic DNA is isolated by standard methods (see Chapter 6). 2.5.2. Preparation of YAC DNA (see Note 3) 1. Preparation of yeast DNA in agarose plugs is described in Chapter 7. 2. Size fractionate the yeast chromosomes from the agarose plugs in 1% SeaKem GTG agarose m 0.5X TBE on a BioRad CHEF electrophoresis

342

3.

4. 5.

6. 7. 8.

9.

Purim00 apparatus or a similar apparatus in order to achieve separation of the YAC of interest. Refer to Chapter 7 for details. Identify the YAC DNA band by ethtdmm bromide staining of the gel. If a YAC comigrates with a native yeast chromosome and is indistinguishable on the gel, it is identified by hybrtdization of Southern blot (from a single lane of the gel) to pBR 322 or a related plasmid probe. During blottmg, the remainder of the gel is wrapped in Saran wrap and stored at 4OC. After identification of the YAC, excise the DNA band of mterest (from 10 slots or more) and store it in a capped 15mL Falcon tube at 4°C until further use. Soak agarose piece containing YAC DNA in TE for 1 h and then equilibrate in an approprtate restrtction enzyme buffer for 2 h at 4°C with a change of buffer in between, Immerse an 8-cm long agarose slice containing the YAC DNA in 4-5 mL of the restriction enzyme buffer with 0.25-0.5 U of enzyme/pL such as Hind111 or BamHI in a 15-mL Falcon tube and incubate at 37OC for at least 6-8 h with gentle rotation. Add EDTA, pH 8, to a final concentration of 20 mM to stop the reaction. After 30 min, replace the solution with 0.5X TBE and incubate for another 30 mm. It may be a good practice, in general, to make two preparations of YAC DNAs digested with two dtfferent enzymes separately, and then pool them after electroelution and phenol extraction for cDNA selection. Cut a dialysis tubing of appropriate length in order to fit the agarose slice, and boil and wash it as described (181. Fill the dialysis tubing with 7-8 mL of 0.5X TBE and the agarose gel piece containing DNA. Place in a horizontal agarose gel electrophorests tank (23 x 35 cm) and electroelute DNA at least overnight in 0.5X TBE at 90 V. Several dialysis tubmgs can be fitted in this size gel box. For a single sample use a smaller gel box. Keep dialysis bags in such a way so that the agarose slice is parallel to the electrodes. Pour enough buffer so that the bags arelust submerged under the buffer. After completion of electroelution, the polarity is reversed for 1 min before removal of the dialysis tubings. Check for complete electroelution of the DNA by ethidium bromide staining of the agarose slice. Concentrate the electroeluted sample m a Centricon- (Amicon) to -250 pL. Ethanol precipitate the DNA after phenol-chloroform extractton in the presence of 0.3M sodium acetate and 2 pg glycogen as carrier, and dissolve the YAC DNA m 10 yL TE.

cDNA Selection

with YACs

10. Determine the concentratron by ethidium bromide spot detection (IS). For this purpose, mix equal volumes (2.5 uL) of each DNA sample and ethidium bromide (2.5 uL of 1 pg/mL solution) and spot them on a sheet of Saran wrap. Spot various concentrations (l-10 ng) of standard DNA such as restriction enzyme digest of genomic DNA of known concentration and ethidium bromide in similar volumes as the test samples. Place the Saran wrap on a transilluminator and take one or more pictures with different exposures. Estimate the concentration of test samples by comparison with the standard DNA sample fluorescence. The YAC DNA is adjusted to a concentration of 40-60 ng/uL. 2.53. Short-Fragment cDNA (sf-cDNA) Libraries (Average Size: 400-1500 bp) 1. Prepare total RNA from the tissue or cell line of interest by standard methods, such as a combination of guanidine thiocyanate/phenol extraction (19) and selective precipitation of RNA by lithium chloride (20). Remove any traces of DNA by treating the total RNA with 10 U of RQ 1 DNase/mg of RNA in the presence of RNasin in the DNase incubation buffer at 37OCfor 15-30 min. Ethanol precipitate RNA after phenol-chloroform extraction by adding l/10 vol 3M sodium acetate and 2.5 vol ethanol. 2. Isolate poly A+ RNA from the total RNA by oligo-dT cellulose columns as described (18). 3. Prepare double-stranded cDNA in a 40-uL reaction from 5 ug of poly A+ RNA by the method of Gubler and Hoffman (21) using one of the commercial cDNA synthesis kits (see Materials). 4. Use random hexanucleotide [p(dN),] instead of oligo(dT)i2-,s as the primer for the first-strand cDNA synthesis in order to generate random sf-cDNAs. Use 6.75 ug of p(dN&/40 uL of first-strand cDNA synthesis mixture so as to generate cDNAs of the size up to 1500 baselengths, as judged by alkaline agarose gel electrophoresis (18). All the other steps of cDNA synthesis are as described in the protocol provided by the manufacturer. 5. Make cDNA blunt ended by treatment with 1 U of mung bean nuclease/ug cDNA at 29°C for 30 mm (18). After addition of EDTA to 10 mM, inactivate nuclease by phenol, phenol-chloroform, and chloroform extraction. Precipitate cDNA by addition of a half volume of ammonium acetate and 2.5 vol of ethanol. 6. Ligate EcoRI adapters to the double-stranded cDNA by standard procedures (18). 7. Size fractionate cDNA in a 1% low melting point (LMP) agarose gel and purify cDNA of the size range of 40&1500 bp by excising the gel piece,

344

Parimoo

melting the agarose, extractmg cDNA with phenol, phenol-chloroform, chloroform, and ethanol precipitation after the addition of half volume of ammonium acetate (18). 8. Ligate the gel-purified cDNA to the hgt 10 arms according to the vendor’s protocol. 9. Amplify three million or more plaques (for a deeper library) by plating 75,000-100,000/150-mm Petri dish. Harvest phage with 15 mL SM/plate. Pool all the phage lysate and purify phage DNA by standard methods (18). 1. 2

3.

4.

2.5.4. Preparation of Blocking Reagents (see Note 4 ) The DNA samples (plasmid or yeast DNA) are prepared by standard methods (IS) (see Chapter 6). Digest the blocking reagent DNA samples with EcoRI and ethanol precipitate the DNA. Somcate the DNA in sonication buffer to generate DNA of -0.2-0.8 kb m size. Ethanol precipitate the DNA after phenol-chloroform extraction. Treat all the DNA samples, after somcation, with mung bean nuclease at 1 U/pg DNA for 30 mm at room temperature, and then extract with phenol, phenol-chloroform, and chloroform. Ethanol precipitate the DNA in the presence of 0.3M sodium acetate. Dissolve the DNAs (from step 3) m a small quantity of TE for storage. After estimation of concentration at 260 nm, 20X stocks of each are made in water and stored m aliquots at -20°C. The 20X stock concentration of each of the quenching reagents is: RL-I (e.g., XRLI or Cot1 DNA) = 0.5 pg/pL; RL-II (e.g., ~15) = 1 p.glp.L; pR 7.3 and pR 5.8 (I:08 ratio) mixture = 0.8 p.g/p.L;yeast host (ABl380) DNA = 0.5 pg/pL, poly dI.dC = 0.4 pg/pL, Rib H15 = 4 pg/pL and Rib H7 = 2 pg/pL.

3.1. Amplification

3. Methods of cDNA

Inserts

by PCR

1. Amplify the cDNA inserts from the sf-cDNA library by PCR using primer set I. Start PCR reactions in at least 10 Eppendorf tubes m order to have enough material after processmg. (See Table 1 and Note 5 for details.) 2. Freeze the amplified samples at -20°C if not used or processed the same day. Combme the amplified products, extract with chloroform and isoamyl alcohol mixture (24.1 [v/v]) once and precipitate the cDNA with ethanol. Fractionate this cDNA by electrophoresis m a 1% LMP agarose gel (load four or more slots) and isolate the cDNA between 400 and 1500 bp stze after phenol-chloroform extraction and ethanol precipitation as described earlier (see Section 2.5.3.).

345

cDNA Selection with YACs Table 1 Hot-Start PCR Amplification of sf-cDNA Library” Component

Volume, pL

Final concentration

2

10 ng

2

0644

2

0.6 pA4

cDNA library, 5 ng phage DNA/pL m TE Primer # 1, 30 p&f stock Pnmer #2, 30 Cul/istock 1OX PCR buffer, without MgC 12 20 mA4 MgClz AmphTaq polymerase, 5 U/pL (Cetus enzyme) Sterile water

63.5

Total volume

90.0

10

1x

10

2mM 25u

05

%over the samples with mineral 011 and place the tubes In the PCR machme Denature the samples at 94’C for 2 min and then Incubate at 80°C At this stage pause the machine, and without removing the tubes, add 10 JJL of 2 0 r&4 dNTP mixture (each 2 mM) by dlppmg the plpetman tip almost to the bottom of the tube and releasmg the solution with proper care (final dNTP m PCR IS 0 2 mM) Contmue PCR cycles as follows 94°C for 45 s/50°C for 45 s/72’C for 2 mm for 30 cycles for Perkm Elmer PCR 9600 machme and 94°C for 70 s/5O”C for 70 s/7O”C for 2 mm for 30 cycles for Perkm Elmer PCR 100 machme. A final extension of 5 mm at 72°C at the end of 30 cycles IS carried out m either machme

3.2. Immobilization of Target Genomic DNA onto Nylon Discs (see Notes 6 and 7) 1, Cut Hybond-N nylon (Amersham, Arlington Heights, IL) into 2.5 x 2.5 mm squares. 2. Mark the discs for different samples with a pencil by gently marking dots at the comers on the side that is not used for spotting DNA (the blank side). 3. In an Eppendorf tube, mix 2.5 pL of restriction enzyme digested YAC DNA (40-60 ng/pL) with 2.5 pL H&II digested bacteriophage $X174 DNA as carrier DNA (200 ng/pL in water). 4. Denature the DNA from step 3 at 95-98°C for 3 min, and chill the tube on ice immediately. Spin briefly. 5. Add an equal volume (5 pL) of 20X SSC to the denatured DNA and mix. Spot the DNA in 0.5~pL aliquots on 2.5 x 2.5 pieces of Hybond on the sides not marked with pencil marks to immobilize 10-l 5 ng of YAC DNA/ disc. Dry under a lamp.

346

Purim00

6. Place the discs on a small sheet of Whatman (Matdstone, UK) 3 MM paper and transfer onto several sheets of Whatman 3 MM soaked with denaturmg solution. Transfer the sheetof paper after 5 min to a dry paper to remove excess alkali and place it on sheets of Whatman paper soaked with the neutralization solutron for 1 min; then transfer onto fresh Whatman paper soaked with fresh neutralizing solutton for another 2-3 min, and finally to 1OX SSC for 2 mm. 7. Transfer the discs onto a dry Whatman filter, and UV crosslink in a Stratalinker (Stratagene) at the autocrosslmk mode for 1 min while they are damp. Transfer the discs into 0.5-mL Eppendorf tubes and bake at 80°C with lids open in a vacuum oven for 0.5 h. Store dry in Eppendorf tubes with lids closed at 4°C until used. Baking for 2 h at 80°C alone is also successful. Prepare two discs for each YAC sample so as to suffice for two cycles of cDNA selectton

3.3. First Cycle of Selection 3.3.1. Prehybridization /Quenching (see Note 8) 1. Prepare blocking/quenchmg mtx, and set up prehybrrdtzation of the DNA discs in 0.5-mL Eppendorf tubes, as shown in Table 2. The 20X stock concentrations are given in Section 2.5.4. 2. After completion of prehybridtzation, remove the oil phase and wash the nylon discs twice briefly with 5X SSPE containing 0.1% SDS at room temperature. Keep the discs m this solutron at room temperature until ready for hybridization.

3.3.2. Hybridization

(see Notes 9-l 1)

1. After prehybridization, transfer the discs with the help of pipetman tips into the fresh tubes contammg the hybridization mrx without letting dtscs dry. Care IS taken not to let the DNA-munobilized side of disc come in contact with the walls of the tube to prevent oil smudging. 2. Hybridrzation mix (40-50 pL) is aliquoted quickly into fresh 0.5-mL Eppendorf tubes, and the nylon discs are transferred into these tubes individually from 5X SSPE solution. Only a few samples are handled at a time m order to mmimrze reannealing of the cDNA and other reagents. The tubes are covered with mineral oil and incubated at 65°C for 36-40 h with gentle rocking. See Table 3 for setting up hybridization.

3.3.3. Washing Discs (see Note 12) 1. Remove the top oil phase from the tubes. Using vacuum suction, take out most of the solutron, leaving behind Just enough to cover the discs. The last traces are removed with a pipetman tip without letting discs dry at any stage during these washes.

347

cDNA Selection with YACs Table 2 Prehybndlzation Conditions for Nylon Discs Bearing Immobilized YAC DNA0 Volume/tube

Stock Blocking reagents, 20X

Fmal concentration

2.5 PL of each, total = x pL YPL 30 PL

1x

Water X+Y The tube 1s placed in boiling water for 5 mm and then chdled m ice. The following components are then added sequentially: 20X SSPE (18) 50X Denhardt’s (28)

12.5 /JL 5X SSPE 5X Denhardt’s 5 PL The tube IS placed m a 65°C water bath briefly Just to warm the solution and then SDS IS added. 10% SDS

2.5 PL

Final volume

50 PL

0.5% SDS

“The above volumes are given for one tube, and the prehybrldizatlon mix 1s prepared in bulk for three to four tubes at a time. Then 50 pL 1squickly aliquoted into the tubes contammg nylon discs with unmobllized target DNA The tubes are covered with mmeral 011and Incubated at 65°C for 24 h with gentle rockmg 2. Immediately

3.

4.

5. 6. 7. 8.

add 300 PL of wash solution

I at room temperature.

Vortex

for 5 s and remove the solution as earlier. Repeat two more times. Transfer discs to fresh 1.5-mL Eppendorf tubes, each containing 600 PL of solution I. The wet discs are transferred by dragging the discs along the wall of the Eppendorf tube with the DNA side in contact with the plpetman tip; the blank side (without DNA) is in contact with the surface of the Eppendorf tube. Avoid scratching the nylon discs. Wash the discs next with 600 PL of solution I at 65°C for 20 min each three times, removing the wash solution m between as earlier. Keep wash solution I at 66-67”C in between the washes. Vortex each time before addition and removal of each solution. Transfer discs to fresh tubes again as earlier. Wash with 600 PL of solution II at 65°C once for 20 min. Wash with solution III once at 65OCfor 15 min. Transfer the tubes to fresh tubes as earlier and wash with 600 PL of solution IV twice at 65’C for 20 min each. Next rinse the discs with solution V twice at room temperature, and transfer to 0.5-mL siliconized Eppendorf tubes containing 40 PL of autoclaved

348

Purim00 Table 3 cDNA Hybridization Conditions for Nylon Discs Bearing Immobilized YAC DNAa Stock

Volume/tube

Blocking reagents, 20X except poly dI.dC Amplified cDNA Sterile water x+y+z=

2 uL of each, total = x pL YPL z PL 24 PL

Final concentration 1x n

The tubes are put m boiling water for 5 minutes, chilled quickly, and briefly spun, then to each tube mdrvidually the followmg components are added: 20X SSPE 50X Denhardt’s

10 j.lL 5X SSPE 5X Denhardt’s 4 PL The tubes are warmed briefly at 65°C and then SDS is added: 10% SDS

2 PL

Fmal volume

40 pL

0 5% SDS

‘For the first cycle of selection, a final concentration of 10 pg/mL cDNA IS present m the hybrtdtzatton solutton when a single cDNA hbrary ISused, a final concentratton of 5 pg/mL of each cDNA ISpresent when a combmatton of several cDNA hbrarres IS used for the first cycle of selectton For the second cycle of selection, the final concentratron of hybrtdtzmg cDNA dertved from the first cyde of selectton wtth a smgle library or a mrxture IS 0.250 5 pg/mL and 0 51 0 pg/mL, respectrvely. The hybridrzatron is at 65°C for 36-40 h water. Care is taken not to carry over salt solution from the previous tube. Also, never let nylon discs dry during transfers. The tubes can be stored overnight at 4°C or processed immediately for PCR ampltficatron.

9. Heat the tubes containing the discs m 40 PL of water m the PCR machme at 98°C for 5 min, briefly spm the tubes, and chill. Transfer 20 PL from each tube to fresh PCR tubes for PCR amplification, and store the rest as backup sample at -20°C.

3.3.4. First Round ofPCR (see Note 13) Carry out hot-start PCR with 20 pL eluate from Section 3.3.3., step 9 in a 50-pL volume using primer set I for 30 cycles with the same cycling conditions as described in Table 1. The concentration of primers is 0.3 pM in the final PCR reaction mixture.

cDNA Selection

with YACs

349

3.3.5. Second Round of PCR 1. Take out 3 p-L from the first round of PCR for re-PCR in a 100-PL volume with a 0.6 IuU final concentration of primer set I, as described earlier. 2. Analyze an ahquot of 5 ltL of the final product on a 1% agarose gel. A smear of an average size of -0.3 kb should be visible on ethidmm bromide staining. 3. Extract the remainder of the PCR product with phenol-chloroform mtxture and ethanol precipitate the cDNA after addition of EDTA to a final concentration of 5 mM, l/10 vol of 3M sodium acetate and 2 pg glycogen. 3.3.6. Size Selection of cDNA. 1. Size fractionate once-selected cDNA after second round of PCR (see Section 3.3.5., step 3) on 1% LMP agarose gel. The agarose piece containing DNA >0.35 kb is cut out and processed for DNA extraction and ethanol precipitated as before. If the volume of the solution before ethanol precipitation is -600-700 ,uL, then concentrate it to -200-300 PL by speed-o-vat; in case of larger volumes, use the Centncon-30 or Centricon100 (Amicon) before ethanol precipitation. 2. After ethanol precipttatton, dissolve the DNA in 50 pL TE and take 20 pL for spectrophotometric estimation m a 0.1 -mL or 0.5-mL cuvet. 3.4. Second Cycle of Selection 3.4.1. Prehybridization I Quenching

Carry out the same steps as before (see Section 3.3.1.) steps l-2) using YAC DNA immobilized on new nylon discs. Quenching materials and conditions are the same. 3.4.2. Hybridization

Follow the same steps as before in the first cycle (see Section 3.3.2., steps l-2), except that a lower concentration of cDNA is used in this second cycle of the selection. The concentration of once-selected cDNA (from Section 3.3.6.) in the final 40 pL of hybridization mixture is 0.250.5 pg/mL if only a single cDNA library was used in the first cycle of selection. This concentration can be increased to 0.5-l .Opg/mL if a mixture of cDNA libraries were used in the first cycle of selection. 3.4.3. Washing Discs

Same as in first cycle (see Section 3.3.3., steps l-9).

350

Purim00

3.4.4. First Round of PCR Amplification This step is identical to the one described in the first cycle (Section 3.3.4.), except that primer set II is used (0.3 m in a 50-p,L final volume). 3.4.5. Second Round of PCR Amplification 1. Identical to the second round of PCR of the first cycle of selection (Section 3.3.5., step l), except that primer set II is used (0.6 win a 100~PL volume). 2. Analyze an aliquot of 5-pL on an analytical agarose gel. To the rest of the PCR material add EDTA to a final concentration of 5 mM. The cDNA 1s extracted with phenol, phenol-chloroform, chloroform alone, and then ethanol precipitated after the addition of l/2 vol of ammonium acetate solution and 2 pg glycogen. 3. Dissolve the DNA in 10 PL of TE.

3.5. Cloning

and Analysis

of the Selected Library 3.5.1. Analysis of PCR-Amplified and Selected cDNA This step is optional. Take 0.5 PL of cDNA from the PCR mix of first and second selection and run a Southern blot along with the total PCRamplified cDNA from the cDNA library. Analyze the blots with various specific probes (single copy sequences encoded by the YAC) if known, and nonspecific probes such as total genomic DNA (for repeats) and ribosomal RNA probes (see Notes 14 and 15). As an example, see Fig. 2 Southern blot, showing enrichment of class I genes and an anonymous sequence B 30.7-a rare single copy sequence encoded by the YAC B30H3. The signal from repeats and ribosomal probes is either invisible or very faint in the selected samples in contrast to the total cDNA sample.

Fig. 2. (opposite page) Selection with the 300 kb YAC B30H3 from the human MHC region. Southern blots of selected cDNAs after one or two cycles of selection (as indicated) from 5 ng purified YAC DNA immobilized on nylon (lanes 14) or from a nylon strip from a CHEF Southern blot containing the YAC B30 H3 (lane 5). Probes: YAC encoded (specific) probes: (A) HLA-A; (B) anonymous clone B30.7; (C) YAC nonencoded (nonspecific) probes: MHC class II; (D) human P-globin; and (E) ribosomal RNA probe. The concentration of total cDNA in the hybridization mixture for selection was 10 pg/mL during the first cycle of selection and 0.25 pg/mL during the second cycle of selection. All the lanes m the blot are identical.

cDNA Selection with YACs

Twice Once Selected Selected --

Probes

MHC class I

A

B 30.7

B

MHC

class II

C

Human b-globin

D

Ribosomal RNA

E

351

352

Parimoo 3.5.2. Cloning

of the Selected DNA

1. Digest the twice-selected cDNA wtth 40-80 U of EcoRI m a 50-uL vol for 1 h at 37OC. 2. Extract the cDNA with phenol and chloroform and ethanol precipitate after the addition of EDTA to 10 mM and 2 ug glycogen. 3. Size fractionate the EcoRI digested cDNA on 1% agarose, and cut out the agarose with DNA >0.3 kb in size. The DNA 1s extracted with phenol, phenol-chloroform, and chloroform before ethanol precipitatton in the presence of ammonium acetate and glycogen as described earlier. 4. Dissolve the DNA m 10 FL of TLE. Estimate the concentration either spectrophotometrically or by ethidium spot detection as described m Section 2.5.2., step 10. 5. Ligate 0.5 ng size-selected cDNA with 0.5 ug of hgtl0 arms in a 5-p.L final volume containing ligation buffer and 200 U of T4 DNA hgase at 14°C for overnight. 6. In vitro package 4 PL of the ligation mix (from step 5) with the cDNA packaging kit (see Materials) as per the manufacturer’s instructions. The packaged DNA can be stored at 4°C and should be used preferably within 1 wk for amplifying the library in Escherichla coli c600hfl according to the protocol of the vendor. 3.5.3. Amplification

and Analysis

of the Selected Library

1. Make one confluent plate of plaques from the selected and packaged material (from step 6), and harvest phage lysate with 15 mL SM (18). This represents a high titer selected hbrary stock (titer -lOlO). Store at 4°C. 2. Plate a part of the selected and amplified-selected library at a low density to pick up random individual plaques. About 1O-20 plaques are randomly picked and resuspended in 100 uL of SM. 3. Add a drop of chloroform to the phage suspension and mix briefly. Store at 4OC for at least 6-8 h. 4. Determine the percentage of plaques with inserts and their size distribution after PCR amphlication of l-2 uL of phage suspension from individual plaques (step 3) in a 100~uL PCR reaction mixture. For this purpose, it is not necessaryto perform hot-start PCR; all the components of PCR, including dNTPs and enzyme, can be mixed, and the tubes should be put into the machine when the temperature is at least 70°C. Dtstmct single bands ranging from 200-600 bp or more in size should be visible (see Note 16).

cDNA Selection

1. 2. 3.

4.

with YACs

353

3.5.4. Screening of the Selected cDNA Library for Novel (Unknown) Clones (see Notes 17-20) Pick at random at least 50 plaques for every 100 kb of YAC, and resuspend in 100 pL of SM. Amplify the individual cDNA inserts by taking 1 pL of phage suspension in a 50 PL PCR, as described earlier. Make a dot blot from these individual PCR reactions by spotting about 1 pL of the PCR product in an array of 96 dots. Make multiple blots dependmg on the number of the probes to be used. Store rest of the PCR products at -2OOC. Probe the blots with ribosomal RNA probes, total genomic DNA for repeats, and any other probes known to be encoded by the YAC. At this stage one can make pools of the PCR products from rows and columns m the form of 96 grid plates and use them also as probes to identify the overlapping clones. After eliminating undesirable and/or overlappmg clones, sequence at least 150-200 bp of the PCR products rapidly using ds-PCR cycle sequence kit. For sequencing individual PCR products, take 2-3 pL out of 50 FL of the PCR-amplified

product (amplified

with primer

set I) and

SubJeCt

it

to the

PCR-based cycling sequencing without any intermediate purification, using one of the mner primers of set II as [32P] end-labeled sequencing oligonudeotide and the vendors’s instructions. 5. Analyze these sequences for any sequence matches in the GENEMBL databank. 6. Confirm unique sequencesthat are encoded m a particular YAC by Southern blots using total genomic DNA, YAC DNA, and DNA (if available) from a somatic hybrid cell line known to harbor a chromosome region corresponding to the YAC of interest. 7. Screen a full-length cDNA library by using these short fragment selected clones as probe.

4. Notes 1. Blocking reagents either can be prepared by individual investigators or procured from different laboratories. 2. All the reagents should be stored properly. Storage of deoxynucleotide triphosphate solutions in several small abquots at -70°C is recommended highly. Most of the reagents are available commercially. 3. The immobilized target DNA (e.g., YAC DNA) should be free of yeast RNA or any oligonucleotides. 4. It is important that all the plasmids and DNA samples, comprismg the blocking reagents, should be completely digested with EcoRI enzyme and sonicated and treated with mung bean nuclease,as described in Section 25.4.

354

Parimoo

5. Contammation of PCR reagents or improper storage of deoxynucleotide trtphosphates can create problems m PCR amplifications. Hence, proper precautions should be taken to avoid these problems. All PCR reactions should be set up using aerosol resistant tips for the pipetman. Wherever possible, the solutions and the plasticware should be autoclaved for at least 30 min. It is desirable to use commercrally available silicomzed Eppendorf tubes when ethanol precipitation of small amounts of cDNA is mvolved. Hot-start PCR is a must. (See Table 1 footnote for the details.) 6. Some batches of nylon paper may occasionally give higher background. Those batches that give clean results with usual dot blots or Southern blots should be kept separately and used within 1 or 2 yr. 7. Improper mnnobilization of target DNA and subsequent leaching may causefortuitous PCR amplifications. DNA to be immobilized should be spotted m minimal volume, and W and/or baking should be carried out properly. 8. If a YAC comigrates with a yeast chromosome in the l-2 megabase region, include sonicated and blunt-ended yeast ribosomal RNA clones as additional blocking reagents during prehybridization and hybridization as described in Section 3. 9. During hybridrzation of the nylon discs with the sf-cDNA (Table 3), poly [(dI) (dC)] is excluded from the hybridizatron mix. The concentration of Rib H15 and Rib H7 DNA (for total yeast DNA experiments or mega YACs selections) is reduced by half that used in the prehybrtdization step. 10. The heat-denatured blocking agents and the cDNA should be chilled on ice and added to the discs as quickly as possible to avoid reannealing problems. 11. One can use either a single cDNA library for selection tf the goal is to get tissue specific cDNAs, or a mixture of cDNA librartes if a more comprehensive identificatton is warranted. 12. Under the circumstances, where GC-rich regions pose a problem, one can use a more stringent wash with 2.4A4 tetraethylammonium chloride (Et4 NCl) in the final stages of washmg the discs (22), and, finally, wash the discs with 0.1X SSC several times before using them for PCR. However, this wash has not been used as a matter of routine for several YACs that were tested. 13. Too many cycles of PCR should be avoided, as tt generates high molecular wetght products after nucleotide triphosphates are exhausted. 14. Presence of a high number of clones of repeats or ribosomal RNA could reflect either a YAC that is deficient in genes or improper preparation of the blocking reagents. 15. Some YACs may contain region-specific low level repeats that are not competed out by the quenching cocktail. In such cases,a significant number of cDNAs with homologies to such repeats may be selected. One way

cDNA Selection with YACs of overcoming this problem 1sto hybridize the selected library plaques to such repeats and to remove them physically. Alternatively, one can make an additional blocking reagent derived from several plaques that hybridize to such repeats. The DNA from this quenching reagent can be readily prepared by PCR amplification of the plaques, followed by EcoRI digestion and mung bean nuclease treatment. 16. A high percentage (>30%) of small insert cDNA clones (<200 bp) m the final selected library could result either from overloading of cDNA in size fractionating agarose gel or from not letting the gel run enough distance. Usually, bromophenol should migrate at least 1O-12 cm from the gel slots. 17. The method described here has worked for cosmid DNA and YAC DNA (II). It worked much better with lysed bacterial colonies harboring cosmids than with lysed yeast colonies harboring YACs after one round of selection (data not shown). Experiments with a few samples containing total yeast DNA bearing YACs have been very encouraging (14). However, detailed comparisons of a large number of the selected clones derived from selection with the purified YACs vs total yeast DNA contammg the same YAC have not been carried out. As a model experiment and approximation to a hybrid cell line in our previous experiments (11), various amounts of cosmid DNA (1 O-200 pg) were mixed with either 1 or 5 pg of hamster DNA for cDNA selection. The data indicated that the yield of specific product was reduced when large amounts of hamster DNA were included with the cosmid DNA m comparison to cosmids alone. This reduction in yield could be owing to competition between the large number of selected cDNAs during PCR amplification. A low level of ribosomal sequences in comparison to MHC class I was also observed after one cycle of selection. 18. The data with immobilized cosmid DNA indicate that increasing target concentration had very little or no effect on coselection of nonspecific cDNAs, whereas high concentrations of cDNA in the hybridization mix did cause coselection of a small proportion of contaminating cDNA after one cycle of selection (‘II). The data also indicated that as little as 1 pg of cosmid DNA was able to select its homologous cDNAs (II). By extrapolation, 10-20 pg of a 300 kb YAC DNA should be sufficient to select cDNAs encoded by a particular YAC. This sensitivity becomes partlcularly important if one wants to use the method for total yeast DNA containing a YAC or to adapt the method to a chromosome specific library or to a hybrid cell line. However, in order to generate enough cDNA material for cloning from selection experiments, 5-l 0 ng of a putlfied YAC (300400 kb) DNA immobilized on a nylon disc is more than enough for generating cDNA libraries.

356

Purim00 I

III,

I

III

I I I I II

’

’

’ ’ ’ nss”,,

Al 9OC8 630H3

2: 56 58 55 A7 59

60 6162

64 66 63 65 67 I II "

70 63 68

71

I,

72

I

74 76 7 A',' 777060

82 63

‘8:”

79 -

NW genes (CATS)

A

E 30

92 I

Cantromete

1OOkb

70

598021 I

II/

16

90

I Telomers

Clars I genes b Pseudo genes

Fig. 3. Map of the newly isolated genes in the human l-Mb MHC class I region. New genes are designated as CAT 53-CAT 83. The YACs used for the cDNA selection are. A 23 lG12, B30H3, and A190C8. Adapted from We1 et al. (13). It has been possible to select a cDNA whose abundance m the original library is one m a million (13). In fact, some of the short fragment clones could not pick up a clone in a oligo-dt primed cDNA library, even though they were positive on the Northern blots, showing again that they were probably rare clones (13). 19. When cDNA selection was carried out with three overlapping YACs in the human MHC class I region covering one megabase region and a mixture of several libraries (12, I3), at least 3 1 new non-HLA genes were identified by this approach (Fig. 3.). If one includes HLA genes and other pseudogenes identified m this region, the average gene density comes to around one gene every 20 kb, which 1s comparable to that of class II and III regions. In addition, this approach identified a new repeat element that is also present outside the MHC region. Detailed analysis of a large number of randomly picked clones from several YAC selected libraries showed that more than 85% of the clones after two rounds of selection do hybrtdize to the YAC; the number of background clones with ribosomal RNA sequencesand/or repetitive sequences(abundant type) was less than 7% (2 I), 20. Different members of a multigene family showing partial sequence homology may be missed by the screening strategy described earlier (see Section 3.5.4.). One of the ways to overcome this problem is by rescreenmg a common pool of a presumptive multigene family clones m a selected library by specific ohgonucleotide hybridizations. The sequence of specific ohgonucleotrde can be searched after sequencing a few clones.

cDNA Selection with YACs

357

Acknowledgments This work was carried out in the laboratory of Sherman M. Weissman at the Yale Medical School. The author wishes to thank Dr. Weissman for the discussions and the facilities provided during the course of the study. The author also gratefully acknowledges a fellowship award from the Cancer Research Institute, New York. References 1. Monaco, A. P., Neve, R L., Colletti-Feener, C., Bertelson, C. J., Kurmt, D M , and Kunkel, L. M (1986) Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature 323,646-650 2. Rommens, J M , Ianuzzi, M C., Kerem, B -S., Drumm, M L., Melmer, G., Dean, M., et al. (1989) Identification of the cystic tibrosrs gene, chromosome walking andJumping. Science 245,1059-1065. 3. Bud, A P. (1986) CpG-rich islands and the function of DNA methylatton. Nature 321,209-213.

4 Hanson, I. M., Poustka, A., and Trowsdale, J (1991) New genes in the class II region of the human maJor hrstocompatrbrlrty complex. Genomzcs 10,417424. 5. Elvin, P., Slynn, G., Black, D., Graham, A., Butler, R., Riley, J , et al. (1990) Isolation of cDNA clones using yeast artificial chromosome probes Nucleic Aczds Res l&3913-3917 6. Dyuk, G M., Kim, S , Myers, R. M., and Cox, D R. (1990) Exon trapping: a genetic screen to identify candidate transcribed sequences m cloned mammalian genomlc DNA. Proc Nat1 Acad Sci USA 87,8995-8999. 7. Buckler, A. F., Chang, D. D , Graw, S. L., Brook, J. D., Haber, D A., Sharp, P A , and Housman, D. E. (199 1) Exon amplification. a strategy to isolate mammalian genes based on RNA splicing Proc Nat1 Acad Scl USA 88,4005-4009 8. Corbo, L., Maley, J. A., Nelson, D. L., and Caskey, C. T. (1990) Direct cloning of human transcripts with HnRNA from Hybrid cell lines. Science 249, 652-655. 9. Lm, P., Legerski, R., and Sicrhano, M. J (1989) Isolation of human transcribed sequences from human-rodent somatic cell hybrids. Sczence 246, 8 13-8 15. 10. Erlich, H., Gelfand, D., and Sinsky, J. J. (199 1) Recent advances m the polymerase chain reaction. Science 252, 1643-l 650 11. Parimoo, S , PatanJah, S R , Shukla, H , Chaplin, D , and Weissman, S M (199 1) cDNA selection: efficient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments. Proc Natl. Acad Scz USA 88,9623-9627. 12. Fan, W.-F , Wel, X., Shukla, H., Parimoo, S., Xu, H., PatanJah, S., Zhen, L., and Weissman, S. M (1993) Applications of cDNA selections techniques to the regions of the human MHC Genomzcs 17,575-58 1 13. Wei, H , Fan, W -F , Xu, H., Parimoo, S., Shukla, H , Chaplin, D , and Weissman, S. M. (1993) Genes m one megabase of the HLA class I region. Proc Natl Acad Sci USA 90, 11,870-l 1,874 14 Parimoo, S., Kollurr, R., and Weissman, S. M. (1993) cDNA selection from total yeast DNA containing YACs. Nucleic Acids Res. l&4422,4423

358

Purim00

15. Erickson, J. M., Rushford, C. L., Dorney, D. J., Wilson, G. N., and Schmickel, R. D. (198 1) Structure and variation of human ribosomal DNA: molecular analysis of cloned fragments. Gene 16, l-9 16. Howard, F. (1970) Unpublished doctoral thesis, Albert Emstein College of Medtcme, New York 17 Philippsen, P., Thomas, M., Kramer, R. A., and Davis, R. W (1978) Umque arrangement of coding sequences for 5 S, 5.8 S, 18 S and 25 S ribosomal RNA m Saccharomyces cerevisiae as determined by R-loop and hybridization analysis J A401 Blol 123,387-404. 18. Sambrook, J , Fritsch, E. F., and Maniatis, T. (1990) Molecular Cloning. A Luborutory Manual. Cold Sprmg Harbor Laboratory Press, Cold Spring Harbor, NY. 19. Chomczynski, P and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Blochem. 162, 156-159 20 Cathala, G , Sayouret, J -F , Mendez, B , West, B L , Karin, M., Marctial, J. A , and Baxter, J. D. (1983) A method for isolation of intact, translationally active nbonucleic acid. DNA 2, 329-339. 2 1 Gubler, U. and Hoffman, B J. (1983) A simple and very efficient method for generating cDNA libraries. Gene 25,263-269. 22 Wood, W I., Gitschier, J., Lasky, L. A., and Lawn, R. M (1985) Base composition-independent hybridization in tetramethylammonium chloride a method for oligonucleotide screening of highly complex gene libraries. Proc. Nut1 Acud Scz USA 82,1585-1588.

CHAPTER29

Markers,

Selection, and Media in YAC Cloning David

Markie

1. Introduction The genetic markers used in yeast, and in yeast artificial chromosome (YAC) cloning, are largely defined by the manipulation of growth media. This chapter, apart from providing recipes for media formulation, also contains a brief introduction to genetic markers in yeast that are relevant to YAC cloning. It is hoped that this will provide an adequate understanding of the media that are used for particular applications, and allow adaptation of media for individual requirements. 1 .l. Auxotrophtic

Markers

In contrast to bacterial cloning systems, where the use of dominant antibiotic resistance determinants is common, selective markers used in YAC manipulation are based mainly on complementation of biosynthetic mutations. Such mutations, producing a growth requirement in the yeast strain that can be satisfied by the addition of a nutritional supplement to the media, are termed auxotrophies, whereas the wild-type state is the absence of that requirement (prototrophy). When using biosynthetic genes as selectable markers, choice is therefore limited to those genes that are mutant in the proposed host, and for which there is a source of a functional copy of the gene. The genotypes of some commonly used YAC host strains can be found in Table 2 in Chapter 17. To apply selection for a functional gene that complements an auxotrophic mutation in the host, the appropriate supplement is omitted from the media. However, From Methods m Molecular Biology, Vol. 54 YAC Protocols Edlted by D Markte Humana Press Inc , Totowa, NJ

359

Markie

360

most YAC hosts have complex genotypes, and may have nutritional requirements other than those being considered in a particular selection experiment. These “nonrelevant” requirements must not be forgotten when designing media. For example, to maintain selection for a YAC in the pYAC4/AB1380 vector/host system, with functional URA3 and TRPZ genes on the YAC and corresponding ura3 and trpl mutant alleles in the host (see Note 1 for guidance on yeast genetic nomenclature), it is essential to ensure that the growth medium contains no uracil, but provides a source of histidme, lysine, isoleucine/threonine (see Note 2), and adenine to cover the remaining nutritional requirements of this strain. The presence or absence of tryptophan is optional (see Note 3). Furthermore, most biosynthetic pathways are comprised of several distinct genes, each encoding a unique enzymatic function but capable of producing the same phenotype when mutant. The appropriate gene is required for complementation of a specific mutant locus (e.g., the functronal HIS3 gene in the pBP series of fragmentation vectors does not complement the his5 mutation present in AB1380 and these plasmids can not be used in this host, but they are very effective in yPH857 containing the his3-A200 allele). 1.2. Color

Markers

Wild strains of Succharomyces, and many laboratory strains, form white colonies when grown on standard media. However, mutations that produce colored colonies are of particular value as they allow visual screening for the segregation of marked genetic elements. There are two genes in the adenine biosynthetic pathway of yeast (ADEI and ADE2) that, apart from producing an absolute requirement for adenine when mutant, also produce a change in colony color. This is owing to accumulation of intermediates in the adenine biosynthetic pathway prior to the enzymatic steps encoded by the ADEZ and ADE2 genes (see ref. I for analysis of purine biosynthesis in Neurospora crassa). However, red coloration is conditional and can be manipulated by altering the concentration of adenine available in the media, thereby affecting feedback control of the adenine biosynthetic pathway. High concentrations of adenine repress the pathway, no accumulation of intermediates occurs, and the colonies remain white. If the concentration of adenine is adequate but limiting for growth, then the adenine biosynthetic pathway is derepressed, pathway intermediates accumulate prior to the

YAC Cloning enzymatic block, and red pigment is formed. Mutant ade2 alleles are present in several common YAC hosts (see Chapter 17), and the ADE2 gene can be used as a selectable marker for YAC modification (see Chapter 20). For guidelines on the appropriate use of high and low adenine media see Note 4. 1.3. Suppressor

Mutations

In yeast, as in other organisms, protein translation may be terminated by any one of three stop codons UAG (amber), UAA (ochre), and UGA (opal), owing to the absence of tRNA molecules capable of recognizing them. Accordingly, nonsense mutations will produce truncated (and usually nonfunctional) gene products. However, secondary point mutations in the anticodons of some tRNA genes may allow recognition of stop codons and subsequent readthrough of nonsense mutations with “suppression” of the original phenotype. There are three ochre mutations that are potentially suppressible in the common YAC host AB 1380 (ade2-1, lys2-I, and canl-100) (2). Ochre suppression in this strain will simultaneously produce prototrophy for adenine and lysine, the clones will appear white when grown on limiting adenine (see Section 1.2.), and will be sensitive to canavanine (see Section 1.4.). Insertional inactivation of an ochre suppressor gene (SUW) in the vector pYAC4 has been used as a cloning indicator during library construction in this host (2). The white, canavanine-sensitive colonies produced by transformation with the pYAC4 vector alone (SUP4 gene intact) can be readily differentiated from the red, canavanine-resistant colonies (SUP4 gene disrupted) that contain an insert. Ochre suppressor mutations may also arise spontaneously during growth of AB 1380 clones, producing a white, Ade+, Lys+, Cans phenotype. This poses a difficulty for later modification using the ADE2 or LYS2 genes as selectable markers. To minimize the risk of ochre suppression developing, always expand clones m media containing high concentrations of adenine (see Note 4). 1.4. Resistance

Markers

A number of chemicals are used to reveal resistance markers in yeast. Mostly these are metabolite analogs that are toxic, and resistance is mediated by mutations that abolish uptake or metabolism of these compounds. As a consequence, such mutant resistance alleles are usually recessive (one functional allele is adequate for normal processing of the

Markie

toxic metabolite even in the presence of a nonfunctioning mutant copy), in contrast to the dominant antibiotic resistance markers used in bacteria. For example, wild-type yeast are sensitive to the arginine analog L-canavanine, whereas mutations in the CAN2 gene (such as in AB 1380) produce resistance owing to the absence of a functional arginine permease (3). Although selection can be exerted for the presence of a functional CAN1 gene product on particular strain backgrounds (4), in the common YAC host strains it can only be applied for its absence. Note that when canavanine selection IS applied the media should contain no arginine, as competition for uptake reduces the efficacy. Two further selective agents, a-amino adipate and 5-fluoro-erotic acid (5-FOA), have potential relevance to YAC manipulation because they interact with markers carried by the common host strain AB 1380.5-FOA is metabolized via the uracil biosynthetic pathway, ultimately producing growth inhibition. Mutations at the URA3 locus (and to a certain extent at URAS) produce resistance (5), although also producing a requirement for uracil. This provides a mechanism for both forward and reverse selection-absence of uracil in the media can be used to select for the presence of a functional URA3 gene and, when required, 5-FOA can be used to select for its loss. The value of this strategy is well illustrated by procedures for introducing desired mutations into YACs (see Chapter 18) and for reducing the number of YACs within a clone (6). The chemical a-amino adipate, an intermediate in lysine biosynthesis, can be used in a similar fashion to select against the functional LYS2 gene, although this has not yet been widely exploited in YAC manipulation. Wild-type strains are unable to grow when a-amino adipate is provided as the only source of nitrogen, whereas l’s2 strains (and to some extent ~JLVS strains also) are able to utilize It for growth (7). Resistance to cycloheximide (an inhibitor of protein synthesis) can be produced in yeast by mutations affecting its interaction with ribosomal proteins. The use of cycloheximide to select against the sensitive donor strain m Karl--mediated YAC transfer is described in Chapter 22. A selection system more closely resembling bacterial antibiotic resistance markers using an exogenous thymidine kinase gene has been developed to provide selection for increasing YAC copy number (8) and this system is described in Chapter 2 1.

YAC Cloning 1.5. Miscellaneous Markers Current knowledge of yeast biology derives largely from the enthusiastic use of mutagens by generations of yeast geneticists, and as a result mutations affecting many physiological functions have been described. Although most are of little relevance to YAC cloning, a minority may affect some YAC manipulations. Wild yeast strains are often capable of utilizing galactose (Gal+), whereas many laboratory strains (including AB 1380) are relatively slow growing when galactose is provided as their sole carbon source (Gal-). This is probably owing to a defective galactose permease (encoded by the GAL2 gene) reducing galactose uptake and subsequent induction of galactose catabolic pathways. The system described for YAC copy number amplification is dependent on galactose-mediated induction of transcription from the GAL1 promoter, and consequently, although this system is of value in AB 1380, it may not be as effective as when applied in a Gal+ host (see Chapter 2 1). Mutations in DNA recombination and repair systems also have relevance to YAC cloning. The high rate of chimerism in many currently available YAC libraries probably results from in vivo recombination between repetitive sequence elements during library construction (9). Internal deletions observed in “unstable” YAC clones during culture may similarly be mediated by recombination between tandemly repeated sequence elements (ZO). One approach to overcoming these difficulties has been the use of recombination deficient strains as hosts, and rad52 mutants have met with some success (12). However, the absence of recombination in these hosts may be something of a double-edged sword, as it precludes the later manipulation of YACs through yeast recombination systems. Transfer of YACs to alternative host strains may overcome this limitation. One further marker that has been elegantly exploited for YAC transfer between strains is a mutation in the KARI gene, affecting karyogamy without preventing mating (see Chapter 22). Examples such as this should stimulate further investigation into aspects of yeast physiology and genetics that may have a bearing on the propagation and manipulation of YACs. The enormous investment in yeast genetics over many decades has provided a wealth of literature, and the application of this knowledge to YACs should be limited only by the ingenuity of those wishing to exploit it.

Markie Table 1 Common Stock Solutions Used for Supplementation of Media (SD and SD + C) During YAC Selection and Mantpulattona

Supplement Adenine hemtsulfate L-Arginine.HCl L-Histidine.HCl L-Isoleucine L-Leucine L-Lysine HCI L-Threonin& L-Tryptophan Uractl

Stgma catalog number A-9126 A-5131 H-8125 I-2752 L-8000 L-5626 T-8625 T-0254 u-0750

Fmal medra concentratron, UmL 20b 20 20 30 30 30 200 20 20

Stock solution and strength, mg/mL 5 2 2 3 3 3 2

(250X) (100X)

(100X) (100X) (100X)

(100X) (10X) 10 (500X) 2 (100X)

%oncentrated stock solutions are stenhzed by autoclavmg and stored at room temperature, with the exceptton of tryptophan, whtch should be filter sterilized and stored at 4”C, protected from hght Brown drscoloratlonof tryptophansolutronsindtcatesdecomposltlon.The appropnate volumeof mdrvrdualsolutionsis addedto stertleSD mediumasrequired Final concentrationsat which someof the supplements are used may vary according to lndlvldual preferences

bSeeNote 4. Tee Note 2.

2. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17.

Yeast extract (Difco [Detroit, MI] 0127-01-7). Peptone (Difco 0118-01-8). D-Glucose (dextrose) (Dtfco 0155-17-4) (see Note 5). o-Galactose (Sigma [St. Louis, MO] G-0750). Yeast nitrogen base wrthout amino acids (see Notes 6 and 7) (Dtfco 0919-15-3). Agar (Difco 0140-01-l). Casein hydrolysate, acid (Stgma C-9386) (see Note 8). Stock solutions for nutrrtional supplementation of SD medium (see Table 1). 1OX Supplement mix for SC and drop-out media (see Table 2). Sorbitol (Sigma S-602 1). Potassium acetate. Tryptone (Difco 0123-01-I). NaCl. Casein hydrolysate, enzymatic (Sigma C-0626). MgS04 .7H,O. Glycerol, 0.17MKH2P04, 0.72M KZHP04, sterilize by autoclaving.

YAC Cloning Compositlon

Supplement

365 Table 2 of I OX Supplement Mix for SC Mediuma Sigma catalog number

Final media concentration, f-dmL

A-9126 A-5131 H-8125 I-2752 L-8000 L-5626 M-9625 P-2126 T-8625 T-0254 T-3754 u-0750 v-0500

506 20 20 30 60 30 20 50 200 20 30 20 150

Adenine hemisulfate L-Arginine.HCl L-Histidine.HCl L-Isoleucine I--Leucine I,-Lysine.HCl I,-Methlonrne I,-Phenylalanine 1.-Threonine r.-Tryptophan r,-Tyrosine Uracil L-Valine

Concentration in 1OX supplement mix, g/L 0.5 0.2 0.2 0.3 06 0.3 0.2 0.5 2 0.2 0.3 0.2 1.5

“The stock solution is filter stenhzed and when tryptophan IS Included should be stored at 4”C, protected from light. Some workers regularly omit some nonrelevant ammo acrds from thetr supplement mix, for example threomne can be omltted wlthout adversely affectmg the growth of most current YAC hosts (see Note 2) and reduces preparation costs For the constructlon of specific drop-out media, individual 10X supplement mixes should be prepared lacking the appropriate nutrient(s), for example, SC (-1~s) would be made with a 10X supplement mix lackmg lysine As an alternatlve to aqueous mixes, some workers prepare well mixed dry powder preparations of supplement mix (and drop-out mixes), and the appropriate amount IS then welghed and added to media prior to sterdization. bSeeNote 4.

3. Methods Growth media are produced as broth, or made solid by the addition of agar at 20 g/L prior to autoclaving. Most media can be sterilized by autoclaving, although where noted some components are filter sterilized separately. The media recipes in this section are each for 1 L unless otherwise stated, but volumes can be scaled up or down as required. We find it most convenient to autoclave media in 500-mL bottles (to allow subsequent remelting in a microwave), with storage at room temperature to allow easy identification of inadvertent contamination. 3.1. Complete

Undefined

Yeast Media

(yeast extract, peptone,dextrose) medium: 10 g yeast extract, 20 g peptone,20 g o-glucose.Add 20 g agarfor solid medium. This is an unde-

1. YPD

Markie fined medium that will support the growth of most yeast strams, u-respective of their auxotrophic requirements. The adenine concentration is limiting for adel and ade2 mutant strains, and these will demonstrate red pigmentation when grown on this medium (see Note 4). 2. YPAD (yeast extract, peptone, adenme, dextrose) medium: 10 g yeast extract, 20 g peptone, 20 g o-glucose, 50 mg ademne hemrsulfate. Add 20 g agar for solid medium. The adenine concentration of this medium IS increased to provide faster growth, higher saturation densities, and absence of red pigmentation with adel and ade2 mutant strains (see Note 4). 3.2. Defined and Semidefined for Selection in Yeast

Media

There are two general approaches taken to providing the required nutrients in selective media. The first requires knowledge and consideration of all auxotrophic markers present in the host, and appropriate individual supplements are added as required to minimal medium (SD). In the alternative approach, individual components are omitted as required from a defined complete medium (SC) to produce drop-out media, and only the markers for which selection is being applied need to be considered. The most convenient approach for a particular application depends largely on personal habit, but may also be affected by how much is known about the genotype of the host, and the number of auxotrophic requirements present. I. SD (synthetic dextrose) medium: 6.7 g yeast nitrogen base without amino acids, 20 g o-glucose. Add 20 g agar for solid medium. Adjust pH to 5.8 prior to autoclaving. SD is a defined minimal medium that will support the growth of wild type yeast. Any auxotrophic requu-ements of mutant yeast strains must be considered and appropriate supplements added. For example, for the growth of the host strain ABl380 carrying a YAC constructed with the pYAC4 vector, SD medium would at minimum be sup-

plemented with lysme, adentne, htsttdine, and isoleucme (see Note 2). This medium IS denoted SD (+lys, +ade, +his, +ile). Supplementation of SD media is most conveniently carried out by adding individual supplements from sterile concentrated stock solutions just prior to pourmg molten soled media, or just prior to use of broth media. See Table 1 for details of individual stock solutions required, and Sections 1.1. and 1.2. for the design of selective media. 2. SC (synthetic complete) and drop-out media: 6.7 g yeast nitrogen base wtthout amino actds, 20 g n-glucose, 100 mL 10X supplement mrx (add

YAC Cloning after autoclavmg). Add 20 g agar for sohd medium. Adjust pH to 5.8 prior to autoclavmg. This is a defined medium containing a complex mixture of supplements suitable for the growth of most laboratory yeast strains carrying auxotrophic mutations. Selective (drop-out) media are made by omitting tndividual requirements from the supplement mix (see Table 2). For example, omitting uracil and tryptophan from the supplement mix provides selection for a YAC containing UK43 and TRPI genes in the host AB1380. This double drop-out medium would be denoted SC (-ura, -trp). 3. AHC (actd hydrolyzed casein) medium: 6.7 g yeast nitrogen base without amino acids, 14 g casein acid hydrolysate, 20 g n-glucose, 20 mg adenine hemisulfate. Add 20 g agar for solid medium. Adjust pH to 5.8 prior to autoclaving. This medium provides selection for uracll and tryptophan prototrophy and is a convenient medium for the growth and maintenance of standard YAC strains. The adenine concentration may be Increased as desired (see Note 4) and the addition of tryptophan will also improve the growth rate of standard YAC strains (see Note 3) while still maintaining the uracil selection necessary for YAC retention. Some versions of AHC routinely include uracil and tryptophan as well as adenine in the formulation. 4. SD + C (synthetic dextrose + casamino acids) medium: 6.7 g yeast nitrogen base without ammo acids, 14 g casein acid hydrolysate, 20 g n-glucose. Add 20 g agar for solid medium. Adjust pH to 5.8 prior to autoclavmg. This medium is used in a similar fashion to SD medium, but allows the manipulation of only three supplements (adenine, tryptophan, and uracil). Although similar to AHC in formulation, it is here named SD + C to clearly reflect its content and avoid confusion with the various definitions of AHC in common usage.

3.3. Special

Yeast Media

1. Regeneration medium: 6.7 g yeast nitrogen base without amino acids, 20 g b-glucose, 182.2 g sorbitol, appropriate nutritional supplements. Add 20 g agar for solid medium. Adjust pH to 5.8 prior to autoclaving. This is a solid medium used for recovery followmg cell wall removal (for protoplast transformation or protoplast fusion experiments). As well as providing appropriate selectton for the particular experiment, it also contams sorbitol for osmotic protection of spheroplasts. The sorbitol is added prior to autoclaving the medium. Yeast are poured in a molten overlay (agar concentration may vary according to individual preferences) on to solid medium in plates. It is important that both the plate medium and the overlay contain sorbitol. Variations of regeneration media and their use are described in Chapters 1, 5, and 20.

Markie 2. SPO (sporulatton) medium: 20 g potassium acetate, 2.5 g yeast extract, 1 g n-glucose, 20 g agar. Adjust pH to 7.0 with KOH prior to autoclavmg. Supplement at 75 pg/mL with required nutrients. This medium is used to induce sporulation m diploid strains. Its use IS described in Chapter 19. 3. Media for 5-FOA (5-fluoro-orottc acid) selectton: Selection with 5-FOA is usually undertaken in defined solid medium (SD with appropriate supplements, or the desired drop-out medium based on SC). The concentration of 5-FOA necessary for effective selection may vary between strains but IS generally m the range of 0.5-l mg/mL. An alternative medium destgned to lower the concentration of 5-FOA for efficient selection has been reported to be useful m some strains (12), although from personal experience thts does not seem effective with AB 1380. Owing to the expense of 5-FOA, the high concentratton at which rt is used, and its relatively poor solubtlity, the media are prepared somewhat differently to standard media. In general, the desired media is prepared m small amounts at 2X concentration, the appropriate amount of 5-FOA added (vrgorous vortexmg and heating to 65°C may be necessary for complete dissolution), and then filter stertlrzed. This medium IS then mixed with an equal volume of sterile molten agar (at 40 g/L) before pouring. For a fuller description of the preparation and use of 5-FOA medium, see Chapter 18. 4. Copy number amplification medium: The media used for copy number amphficatton substrtute galactose for glucose as a carbon source, and specific selective agents are added from concentrated stock solutions. For a description of this media see Chapter 2 1.

3.4. Bacterial

Media

1. LB (Lurra-Bertani) medium: 10 g tryptone, 5 g yeast extract, 10 g NaCl. Add 20 g agar for solid media. Adjust pH to 7.0 with NaOH. 2. NZCYM medium: 10 g casein hydrolyzate, enzymatrc, 5 g NaCl, 5 g yeast extract, 1 g casein hydrolysate, acid, 2 g MgS04 . 7H@. Add 20 g agar for solid media. Adjust pH to 7.0 prior to autoclaving. 3. TB (terrific broth): 12 g tryptone, 24 g yeast extract, 4 mL glycerol. Make up to 900 mL and autoclave, then when cool add 100 mL stertle 0.17M KH,PO,, 0.72M K2HP04. 4. Notes 1. Yeast genetic nomenclature: Yeast genes are generally designated by a three-letter acronym (usually an abbreviation of the phenotype produced by mutants at that locus) and a number (to drstingursh between independent genes that can give rise to the same phenotype). Dominant alleles of a gene (m yeast these are usually, but not always, wild-type functional alle-

YAC Cloning les) are denoted m upper case italics (for example ADE2) and recessive alleles (usually nonfunctional mutant alleles) in lower case italics (a&2). In some cases, specific alleles are further defined by the addition of an allele number (ade2-100) that distinguishes them from other mutations at that locus. This information can be very useful as mdlvldual mutant alleles may have specific characters, such as low or high reversion rates, suppressibility (see Section 1.3.), intragenic complementatlon, and so on. Occasionally, additional symbols are used to convey further mformatlon about specific alleles, for example, A, signifying a deletion mutant. Phenotyplc descriptions of yeast generally use the same three-letter code (with no gene number required), and to differentiate them from gene descrlptlons they are not ltaliclzed. The symbols + and - are used in superscript to signify functional and defective states,respectively (for example Thf indicates that a strain is defective in threonine biosynthesis, and Gal+ indicates that a strarn is capable of utilizing galactose as a carbon source), R and s are used to specify resistance and sensitivity respectively. 2. In addition to the original description of the AB 1380 genotype (2), this yeast strain seemsto have a mutation tn threonine biosynthesis. The resulting growth requirement can be satisfied by the addition of either threonine or tsoleucine to the medium. 3. For most purposes, tt 1snecessary to maintain selection for only one marker on the YAC rather than both. In addition, the copy of the TRPl gene used in the construction of pYAC4 1spoorly functional and, although pYAC4/ AB1380 clones can be grown in the absence of tryptophan, they will have suboptimal growth rates. It is common practice to supplement media with tryptophan and maintain selection for the UK43 gene only. 4. Adenine is used at different concentrations depending on the application. When ade2 mutant clones are being expanded (such as durtng library growth and duplication, growth for transformation, and for agarose block preparation) the development of red coloration 1sof no utility, and adenine can be used at a high concentration (50 pg/mL or higher). In these high adenine media, growth rates are improved, cells protoplast more easily, and the selective advantage for spontaneous mutants causing reversion (or suppression) of the ade.2 mutation is removed. If such mutants do arise wlthm a clone they will quickly predominate under limiting adenine conditions, as is already the case for a minority of clones in currently available YAC libraries. However, when plating on solid media for single clones from an ade2 strain, low adenme medium (approx 20 pg/mL) is used as the red colony color provides confirmation that a selected clone is not a contammatmg yeast, or a revertant/suppressor clone that has arisen in the culture. As a

Markie

5.

6.

7.

8.

general rule when using standard YAC strains (pYAC4 m AB 1380), broth medium should always contain high ademne concentrations, and plate culture should usually contain low concentrations. Autoclaving media containmg glucose produces a brown discoloration, which may vary from batch to batch, depending on the extent of caramelization. Although this does not seem to adversely affect yeast growth, some workers prefer to filter sterilize solutions of glucose at 20 or 40% w/v, and add these as required to autoclaved media. Yeast nitrogen base is a complex, but completely defined mixture of mdividual components providing everything necessary for the growth of wildtype yeast, with the exceptton of a carbon source. However, standard yeast nitrogen base also contains some nonessential ammo acids, prohtbitmg the use of certain selectable markers. For this reason a variant formulation, yeast nitrogen base without amino acids, is also available to allow complete manipulation of the ammo actd content of media, and it is this product that is most useful in the production of defined media for YAC cloning and mampulation. It IS generally used at a concentration of 6.7 g/L, of which 5 g is ammonium sulfate. A further variatron is also available, yeast mtrogen base without amino acids and ammonium sulfate, which contams no source of nitrogen. It is used at 1.7 g/L, and a nitrogen source is also required, usually 5 g/L ammonium sulfate, It is essential to be clear about which formulation ts being used, as this determines the amount added to the media and the need for addition of a nitrogen source. Some workers prefer to filter sterihze a 1OX concentration of yeast rntrogen base (without amino acids) and add this to autoclaved media as necessary. However, media containing yeast nitrogen base (without amino acids) can be sterilized by autoclaving without any apparent ill effects on yeast growth. Casein acid hydrolysate (or casamino acids) 1sacid hydrolyzed milk protein, and is a convenient supplement providing adequate concentrations of amino acids (with the exception of tryptophan) for the propagation of yeast with multiple auxotrophic requirements. Clearly, it cannot be used when selection is exerted for an ammo acid prototrophy (with the exception of tryptophan). It contains no adenme or uracil.

References 1. Bernstein,H. (1961) Imidazolecompoundsaccumulatedby purmemutantsof Neurospora crassa 3 Gen Microbloi

25,4146.

2. Burke, D T., Carle, G. F , and Olson, M. V. (1987) Cloning of large segmentsof exogenousDNA into yeastby meansof artificial chromosomevectors, Scrence 236,806-8

12

YAC Cloning

371

3. Grenson, M., Mousset, M., Wiame, J. M., and Bechet, J (1966) Multiplicrty of the ammo acid permeases m Saccharomyces cerevulae, I. Evidence for a specific arginine-transporting system. Biochim Bzophys Acta 127,325-338. 4. Whelan, W. L., Gocke, E., and Manney, T. R. (1979) The CAN1 locus of Saccharomyces cerevislae: fine structure analysis and forward mutation rates Genetics 91,35-51. 5. Boeke, J. D., LaCroute, F., and Fink, G. R. (1984) A positive selection for mutants

lacking orotidineJ’-phosphate decarboxylase activity in yeast: 5-fluoro-orottc actd resistance. Mol. Gen Genet. 197,345,346. 6. Heikoop, J. C., Steensma, Y., van Ommen, G.-J. B., and den Dunnen, J. T. (1994) A simple and rapid method for separating co-cloned YACs Trends Genet 10,40. 7. Chattoo, B. B., Sherman, F., Azubalis, D. A., Fjellstedt, T. A., Mehnert, D., and Ogur, M. (1979) Selectron of lys2 mutants of the yeast Saccharomyces cerewsiae by the utilization of a-amino adipate. Genetics 93, 5 l-65. 8. Smith, D. R., Smyth, A. P., and Moir, D. T. (1990) Amplrfication of large artificial chromosomes. Proc Natl. Acad. SCL USA 87,8242-8246 9. Larionov, V., Kouprma, N., Nikolaishvili, N., and Resnick, M. A. (1994) Recombination during transformation as a source of chimertc mammalian artificial chromosomes in yeast (YACs). Nucleic Acids Res 22,4 154-4162 10 Kouprina, N., Eldarov, M., Moyzis, R., Resnick, M., and Larronov, V (1994) A model system to assess the integrity of mammalian YACs during transformation and propagation in yeast. Genomics 21,7-l 7 11. Haldi, M., Per-rot, V., Saumrer, M., Desai, T., Cohen, D., Cherrf, D., Ward, D., and Lander, E. S. (1994) Large human YACs constructed m a rad52 strain show a reduced rate of chime&m. Genomtcs 24,47%-484. 12. McCusker, J H. and Davis, R. W. (1991) The use of proline as a nitrogen source causes hypersensrtivtty to, and allows more economtcal use of SFOA in Saccharomyces cerevwiae. Yeast 7,607,608.