Human Papillomaviruses: Methods and Protocols (Methods in Molecular Biology)

M E T H O D S I N M O L E C U L A R M E D I C I N E TM Human Papillomaviruses Methods and Protocols Edited by Clare Da...

Author: Clare Davy | John Doorbar

148 downloads 1256 Views 7MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

M E T H O D S I N M O L E C U L A R M E D I C I N E TM

Human Papillomaviruses Methods and Protocols Edited by

Clare Davy John Doorbar

Human Papillomaviruses

M E T H O D S I N M O L E C U L A R M E D I C I N E™

John M. Walker, SERIES EDITOR 124. Magnetic Resonance Imaging: Methods and Biological Applications, edited by Pottumarthi V. Prasadi, 2006 123. Marijuana and Cannabinoid Research: Methods and Protocols, edited by Emmanuel S. Onaivi, 2006 122. Placenta Research Methods and Protocols: Volume 2, edited by Michael J. Soares and Joan S. Hunt, 2006 121. Placenta Research Methods and Protocols: Volume 1, edited by Michael J. Soares and Joan S. Hunt, 2006 120. Breast Cancer Research Protocols, edited by Susan A. Brooks and Adrian Harris, 2005 119. Human Papillomaviruses: Methods and Protocols, edited by Clare Davy and John Doorbar, 2005 118. Antifungal Agents: Methods and Protocols, edited by Erika J. Ernst and P. David Rogers, 2005 117. Fibrosis Research: Methods and Protocols, edited by John Varga, David A. Brenner, and Sem H. Phan, 2005 116. Inteferon Methods and Protocols, edited by Daniel J. J. Carr, 2005 115. Lymphoma: Methods and Protocols, edited by Timothy Illidge and Peter W. M. Johnson, 2005 114. Microarrays in Clinical Diagnostics, edited by Thomas O. Joos and Paolo Fortina, 2005 113. Multiple Myeloma: Methods and Protocols, edited by Ross D. Brown and P. Joy Ho, 2005 112. Molecular Cardiology: Methods and Protocols, edited by Zhongjie Sun, 2005 111. Chemosensitivity: Volume 2, In Vivo Models, Imaging, and Molecular Regulators, edited by Rosalyn D. Blumethal, 2005 110. Chemosensitivity: Volume 1, In Vitro Assays, edited by Rosalyn D. Blumethal, 2005 109. Adoptive Immunotherapy: Methods and Protocols, edited by Burkhard Ludewig and Matthias W. Hoffman, 2005 108. Hypertension: Methods and Protocols, edited by Jérôme P. Fennell and Andrew H. Baker, 2005 107. Human Cell Culture Protocols, Second Edition, edited by Joanna Picot, 2005 106. Antisense Therapeutics, Second Edition, edited by M. Ian Phillips, 2005 105. Developmental Hematopoiesis: Methods and Protocols, edited by Margaret H. Baron, 2005 104. Stroke Genomics: Methods and Reviews, edited by Simon J. Read and David Virley, 2004

103. Pancreatic Cancer: Methods and Protocols, edited by Gloria H. Su, 2004 102. Autoimmunity: Methods and Protocols, edited by Andras Perl, 2004 101. Cartilage and Osteoarthritis: Volume 2, Structure and In Vivo Analysis, edited by Frédéric De Ceuninck, Massimo Sabatini, and Philippe Pastoureau, 2004 100. Cartilage and Osteoarthritis: Volume 1, Cellular and Molecular Tools, edited by Massimo Sabatini, Philippe Pastoureau, and Frédéric De Ceuninck, 2004 99. Pain Research: Methods and Protocols, edited by David Z. Luo, 2004 98. Tumor Necrosis Factor: Methods and Protocols, edited by Angelo Corti and Pietro Ghezzi, 2004 97. Molecular Diagnosis of Cancer: Methods and Protocols, Second Edition, edited by Joseph E. Roulston and John M. S. Bartlett, 2004 96. Hepatitis B and D Protocols: Volume 2, Immunology, Model Systems, and Clinical Studies, edited by Robert K. Hamatake and Johnson Y. N. Lau, 2004 95. Hepatitis B and D Protocols: Volume 1, Detection, Genotypes, and Characterization, edited by Robert K. Hamatake and Johnson Y. N. Lau, 2004 94. Molecular Diagnosis of Infectious Diseases, Second Edition, edited by Jochen Decker and Udo Reischl, 2004 93. Anticoagulants, Antiplatelets, and Thrombolytics, edited by Shaker A. Mousa, 2004 92. Molecular Diagnosis of Genetic Diseases, Second Edition, edited by Rob Elles and Roger Mountford, 2004 91. Pediatric Hematology: Methods and Protocols, edited by Nicholas J. Goulden and Colin G. Steward, 2003 90. Suicide Gene Therapy: Methods and Reviews, edited by Caroline J. Springer, 2004 89. The Blood–Brain Barrier: Biology and Research Protocols, edited by Sukriti Nag, 2003 88. Cancer Cell Culture: Methods and Protocols, edited by Simon P. Langdon, 2003 87. Vaccine Protocols, Second Edition, edited by Andrew Robinson, Michael J. Hudson, and Martin P. Cranage, 2003 86. Renal Disease: Techniques and Protocols, edited by Michael S. Goligorsky, 2003 85. Novel Anticancer Drug Protocols, edited by John K. Buolamwini and Alex A. Adjei, 2003

M E T H O D S I N M O L E C U L A R M E D I C I N E™

Human Papillomaviruses Methods and Protocols

Edited by

Clare Davy John Doorbar Division of Virology, The National Institute for Medical Research Mill Hill, London, UK

© 2005 Humana Press Inc. 999 Riverview Drive, Suite 208 Totowa, New Jersey 07512 www.humanapress.com All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher. Methods in Molecular Medicine™ is a trademark of The Humana Press Inc. All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not necessarily reflect the views of the publisher. This publication is printed on acid-free paper. ∞ ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials. Production Editor: Tracy Catanese Cover design by Patricia F. Cleary Cover illustration: The image shows a section through a papilloma (wart) caused by Human Papillomavirus Type 1 stained to reveal the viral E4 protein (green) and the cellular protein CyclinB (red), which regulates proper entry into mitosis. Cyclin B is readily detected in cells expressing E4. In HPV1 warts, E4 expression begins as soon as the infected cell leaves the basal layer. Nuclei are counter-stained with DAPI (blue), revealing the location of the basal cells surrounding the papillae. Artwork provided by John Doorbar. Photocopy Authorization Policy: Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, is granted by Humana Press Inc., provided that the base fee of US $30.00 per copy is paid directly to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923. For those organizations that have been granted a photocopy license from the CCC, a separate system of payment has been arranged and is acceptable to Humana Press Inc. The fee code for users of the Transactional Reporting Service is: [1-58829373-4/05 $30.00]. Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1 e-ISBN 1-59259-982-6 ISSN 1543-1894 Library of Congress Cataloging in Publication Data Human papillomaviruses : methods and protocols / Edited by Clare Davy, John Doorbar. p. ; cm. -- (Methods in molecular medicine ; 119) Includes bibliographical references and index. ISBN 1-58829-373-4 (alk. paper) 1. Papillomavirus diseases--Laboratory manuals. 2. Papilloma-viruses--Laboratory manuals. Clare. II. Doorbar, John. III. Series. [DNLM: 1. Papillomavirus, Human--genetics--Laboratory Manuals. 2. Papillomavirus, Human--pathogenicity--Laboratory Manuals. 3. Cervix Neoplasms--virology--Laboratory Manuals. W1 ME9616JM v.119QW 25 / H918 2005] QR201.P26H86 2005 616.9'11--dc22

I. Davy,

2005006265

Preface Papillomaviruses attract the attention of virologists and doctors alike, perhaps most importantly because human papillomaviruses (HPV) are the etiological agent of cervical cancer, the second most commonly found female cancer worldwide. Historically, research into HPVs has been hampered by the fact that, unlike many other viruses, HPVs show both species and tissue specificity. To overcome this problem, specialized techniques, such as the use of organotypic “raft” cultures to study the HPV lifecycle in human tissue, have been developed. This approach complements the traditional method of histochemistry used on clinical samples and the multitude of molecular methods available for analyzing individual viral protein functions. Despite recent progress on vaccine development, it seems likely that, for the foreseeable future, HPV will remain an important human pathogen. Indeed, fundamental questions regarding both the virus lifecycle and cancer progression remain. It is our hope that Human Papillomaviruses will be a useful tool in helping to find the answers. We have aimed to provide a collection of protocols that will be a useful resource for both basic scientists and clinicians working in the field of papillomavirus research. Although it is impossible to cover all aspects of papillomavirus research, Human Papillomaviruses aims to incorporate a broad range of protocols. Some protocols are already well established, whereas others have been developed only in the last few years. The major themes of this book include: the detection and typing of papillomavirus infections, the study of the papillomavirus life cycle, and the production and functional analysis of papillomavirus proteins. This is achieved using a wide variety of techniques, from PCR to propagation of HPV in vitro. Each chapter has been compiled by experts in the field who are well aware of the pitfalls of their experiments. With this in mind, emphasis has been placed on providing methods that go beyond the details provided in typical journal articles. The protocols are intended to be immediately understandable to a novice in the field, and potential problems are highlighted before they can occur. Of course books like Human Papillomaviruses require input from a large number of people and we are indebted to all the authors for giving up their time to produce such excellent contributions. We would like to thank them for their tolerance of our editorial interventions and our persistent pestering for corrections and signatures. Valuable assistance in proofreading was provided by

v

vi

Preface

Mahmood Ayub and other members of the Doorbar lab. We are also very grateful to John Walker at the University of Hertfordshire, and the editorial staff at Humana Press, for all the advice and assistance they have provided. Clare Davy John Doorbar

Contents Preface .............................................................................................................. v Contributors .....................................................................................................xi 1 Identification of New Papillomavirus Types Ethel-Michele de Villiers, Corinna Whitley, and Karin Gunst ............. 1 2 Identification of HPV Variants John Cason, Jon Bible, and Christine Mant ........................................ 15 3 Histochemical Analysis of Cutaneous HPV-Associated Lesions Kiyofumi Egawa ................................................................................... 27 4 Histological Analysis of Cervical Intraepithelial Neoplasia Michael Babawale, Rashmi Seth, Adam Christian, Wessam Al-Utayem, Ragini Narula, and David Jenkins ................. 41 5 Detection of Papillomavirus Proteins and DNA in Paraffin-Embedded Tissue Sections Woei Ling Peh and John Doorbar ....................................................... 49 6 Detection and Quantitation of HPV Gene Expression Using Real-Time PCR Rashmi Seth, John Rippin, Li Guo, and David Jenkins ....................... 61 7 Analysis of p16INK4a and Integrated HPV Genomes as Progression Markers Svetlana Vinokurova, Nicolas Wentzensen, and Magnus von Knebel Doeberitz ................................................ 73 8 Use of Biomarkers in the Evaluation of CIN Grade and Progression of Early CIN Jan P. A. Baak and Arnold-Jan Kruse .................................................. 85 9 HPV DNA Detection and Typing in Cervical Scrapes Peter J. F. Snijders, Adriaan J. C. van den Brule, Marcel V. Jacobs, René P. Pol, and Chris J. L. M. Meijer .......................................... 101 10 HPV DNA Detection and Typing in Inapparent Cutaneous Infections and Premalignant Lesions Maurits de Koning, Linda Struijk, Mariet Feltkamp, and Jan ter Schegget ..................................................................... 115 11 Establishing HPV-Containing Keratinocyte Cell Lines From Tissue Biopsies Margaret Anne Stanley ..................................................................... 129

vii

viii

Contents

12 Using an Immortalized Cell Line to Study the HPV Life Cycle in Organotypic “Raft” Cultures Paul F. Lambert, Michelle A. Ozbun, Asha Collins, Sigrid Holmgren, Denis Lee, and Tomomi Nakahara ................... 13 Differentiation of HPV-Containing Cells Using Organotypic “Raft” Culture or Methylcellulose Regina Wilson and Laimonis A. Laimins ........................................... 14 Propagation of Infectious, High-Risk HPV in Organotypic “Raft” Culture Margaret E. McLaughlin-Drubin and Craig Meyers.......................... 15 Retrovirus-Mediated Gene Transfer to Analyze HPV Gene Regulation and Protein Functions in Organotypic “Raft” Cultures N. Sanjib Banerjee, Louise T. Chow, and Thomas R. Broker ........... 16 The HPV Xenograft Severe Combined Immunodeficiency Mouse Model William Bonnez ................................................................................ 17 The Cottontail Rabbit Papillomavirus Model of High-Risk HPV-Induced Disease Janet L. Brandsma ............................................................................. 18 Studying the HPV Life Cycle in 3A Trophoblasts and Resulting Pathophysiology Yong Liu, Hong You, and Paul L. Hermonat .................................... 19 Replication and Encapsidation of Papillomaviruses in Saccharomyces cerevisiae Peter C. Angeletti .............................................................................. 20 Analysis of the Regulation of Viral Transcription Bernd Gloss, Mina Kalantari, and Hans-Ulrich Bernard .................. 21 Analysis of HPV Transcription by RPA Jason M. Bodily and Craig Meyers .................................................... 22 Analysis of Regulatory Motifs Within HPV Transcripts Sarah A. Cumming and Sheila V. Graham ........................................ 23 Detection of HPV Transcripts by Nested RT-PCR Christine Mant, Barbara Kell, and John Cason ................................. 24 Analysis of HPV DNA Replication Using Transient Transfection and Cell-Free Assays Biing Yuan Lin, Thomas R. Broker, and Louise T. Chow ..................

141

157

171

187

203

217

237

247 261 279 291 317

331

Contents

ix

25 Detection and Quantitation of HPV DNA Replication by Southern Blotting and Real-Time PCR Iain M. Morgan and Ewan R. Taylor ................................................. 26 Analysis of E7/Rb Associations Sandra Caldeira, Wen Dong, and Massimo Tommasino .................. 27 Transformation Assays for HPV Oncoproteins Paola Massimi and Lawrence Banks ................................................. 28 Analysis of Adeno-Associated Virus and HPV Interaction Paul L. Hermonat, Hong You, C. Maurizio Chiriva-Internati, and Yong Liu ................................................................................. 29 In Vitro Assays of Substrate Degradation Induced by High-Risk HPV E6 Oncoproteins Miranda Thomas and Lawrence Banks ............................................. 30 Measuring the Induction or Inhibition of Apoptosis by HPV Proteins Anna M. Kowalczyk, Geraldine E. Roeder, Katie Green, David J. Stephens, and Kevin Gaston ........................................... 31 Codon Optimization of Papillomavirus Genes Martin Müller .................................................................................... 32 Generation of HPV Pseudovirions Using Transfection and Their Use in Neutralization Assays Christopher B. Buck, Diana V. Pastrana, Douglas R. Lowy, and John T. Schiller ...................................................................... 33 Generation and Application of HPV Pseudovirions Using Vaccinia Virus Martin Sapp and Hans-Christoph Selinka ......................................... Index ............................................................................................................

ix

349 363 381

397

411

419 433

445

463 483

Contributors WESSAM AL-UTAYEM, MD, MS • Division of Histopathology, University of Nottingham Medical School, Queens Medical Centre, Nottingham, UK PETER C. ANGELETTI, PhD • Nebraska Center for Virology, School of Biological Sciences, University of Nebraska-Lincoln, Lincoln, NE JAN P. A. BAAK, MD, PhD, FRCPath, FIAC (HON), Dr. HC (ANTWERP) • Department of Pathology, Stavanger University Hospital, Stavanger, and The Gade Institute, University of Bergen, Bergen, Norway, and Free University, Amsterdam, The Netherlands MICHAEL BABAWALE, MD, PhD • Division of Histopathology, University of Nottingham Medical School, Queens Medical Centre, Nottingham, UK N. SANJIB BANERJEE, PhD • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL LAWRENCE BANKS, PhD • Tumour Virology, International Centre for Genetic Engineering and Biotechnology, Trieste, Italy HANS-ULRICH BERNARD, PhD • Department of Molecular Biology and Biochemistry, University of California, Irvine, CA JON BIBLE • Department of Immunobiology, Guy's, King's College and St. Thomas' Hospitals School of Medicine, King's College London, Guy's Campus JASON M. BODILY, MS • The Department of Microbiology and Immunology, The Pennsylvania State University College of Medicine, Hershey, PA WILLIAM BONNEZ, MD • Infectious Diseases Unit, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY JANET L. BRANDSMA, PhD • Department of Comparative Medicine, Yale University School of Medicine, New Haven, CT THOMAS R. BROKER, PhD • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL CHRISTOPHER B. BUCK, PhD • Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, Bethesda, MD SANDRA CALDEIRA, PhD • Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisbon, Portugal JOHN CASON, PhD • The Department of Infectious Diseases, Guy’s, King’s College and St Thomas’ Medical and Dental Schools, King’s College, London, UK

xi

xii

Contributors

C. MAURIZIO CHIRIVA-INTERNATI, PhD • Department of Microbiology and Immunology, Texas Tech University, Lubbock, TX LOUISE T. CHOW, PhD • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL ADAM CHRISTIAN, BSc, MBBS • Division of Histopathology, University of Nottingham Medical School, Queens Medical Centre, Nottingham, UK ASHA COLLINS • McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, WI SARAH A. CUMMING, PhD • Institute of Biomedical and Life Sciences, Division of Virology, University of Glasgow, Glasgow Scotland, UK MAURITS DE KONING, MSc • Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands and Delft Diagnostic Laboratory, Delft, The Netherlands ETHEL-MICHELE DE VILLIERS, PhD • Division for the Characterization of Tumourviruses, Deutsches Krebsforschungszentrum, Heidelberg, Germany WEN DONG, BSc • International Agency for Research on Cancer, World Health Organization, Lyon, France JOHN DOORBAR, PhD • Division of Virology, The National Institute for Medical Research, Mill Hill, London, UK KIYOFUMI EGAWA, MD, PhD • Department of Dermatology, Kumamoto University School of Medicine, Kumamoto, Japan MARIET FELTKAMP, MD, PhD • Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands KEVIN GASTON, PhD • Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol, UK BERND GLOSS, PhD • Neurotransgenic Laboratory, Duke University Medical Center, Durham, NC SHEILA V. GRAHAM, PhD • Institute of Biomedical and Life Sciences, Division of Virology, University of Glasgow, Glasgow, Scotland, UK KATIE GREEN, BSc • Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol, UK KARIN GUNST • Division for the Characterization of Tumourviruses, Deutsches Krebsforschungszentrum, Heidelberg, Germany LI GUO • Department of Histopathology, Division of Molecular Medicine, Queens Medical Centre, University Hospital, University of Nottingham, UK PAUL L. HERMONAT, PhD • Departments of Internal Medicine and Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, AR

Contributors

xiii

SIGRID HOLMGREN • McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, WI MARCEL V. JACOBS, PhD • Section of Molecular Pathology, Department of Pathology, VU University Medical Center, The Netherlands DAVID JENKINS, MD, FRCPath • Department of Histopathology, Division of Molecular Medicine, Queens Medical Centre, University Hospital, University of Nottingham, UK MINA KALANTARI, PhD • Department of Molecular Biology and Biochemistry, University of California, Irvine, CA BARBARA KELL, PhD • The Department of Infectious Diseases, Guy’s, King’s College and St Thomas’ Medical and Dental Schools, King’s College, London, UK ANNA M. KOWALCZYK, BSc • Department of Biochemistry, School of Medical Sciences,University of Bristol, Bristol, UK ARNOLD-JAN KRUSE, MD, PhD • Department of Pathology, Stavanger University Hospital, Stavanger, Norway LAIMONIS A. LAIMINS, PhD • Department of Microbiology-Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL PAUL F. LAMBERT, PhD • McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, WI DENIS LEE • McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, WI BIING YUAN LIN, MS • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL YONG LIU, MD, PhD • Departments of Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, AR DOUGLAS R. LOWY, MD • Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, Bethesda, MD CHRISTINE MANT, PhD • The Department of Infectious Diseases, Guy’s, King’s College and St Thomas’ Medical and Dental Schools, King’s College, London, UK PAOLA MASSIMI, PhD • International Centre for Genetic Engineering and Biotechnology, Trieste, Italy MARGARET E. MCLAUGHLIN-DRUBIN, PhD • The Department of Microbiology and Immunology, The Pennsylvania State University College of Medicine, Hershey, PA CHRIS J.L.M. MEIJER, MD, PhD • VSection Molecular Pathology, Department of Pathology, VU University Medical Center, The Netherlands CRAIG MEYERS, PhD • The Department of Microbiology and Immunology, The Pennsylvania State University College of Medicine, Hershey, PA

xiv

Contributors

IAIN M. MORGAN, PhD • Institute of Comparative Medicine (Pathology), University of Glasgow, Glasgow, Scotland MARTIN MÜLLER, PhD • Programme Infection and Cancer, German Cancer Research Center, Heidelberg, Germany TOMOMI NAKAHARA, PhD • McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, WI RAGINI NARULA, BSc, MBBS • Division of Histopathology, University of Nottingham Medical School, Queens Medical Centre Nottingham, UK MICHELLE A. OZBUN, PhD • Department of Molecular Genetics and Microbiology, University of New Mexico School of Medicine, Albuquerque, New Mexico DIANA V. PASTRANA, PhD • Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, Bethesda, MD WOEI LING PEH, PhD • Division of Virology, The National Institute for Medical Research, Mill Hill, London, UK RENÉ P. POL, BSc • Section Molecular Pathology, Department of Pathology, VU University Medical Center, The Netherlands JOHN RIPPIN • Department of Histopathology, Division of Molecular Medicine, Queens Medical Centre, University Hospital, University of Nottingham, UK GERALDINE E. ROEDER, LLB, PhD • Department of Biochemistry, School of Medical Sciences,University of Bristol, Bristol, UK MARTIN SAPP, PhD • Institute for Medical Microbiology and Hygiene, University of Mainz, Mainz, Germany JAN TER SCHEGGET, MD, PhD • Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, Leiden, and Delft Diagnostic Laboratory, Delft, The Netherlands JOHN T. SCHILLER, PhD • Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, Bethesda, MD HANS-CHRISTOPH SELINKA, PhD • Institute for Medical Microbiology and Hygiene, University of Mainz, Mainz, Germany RASHMI SETH, PhD • Department of Histopathology, Division of Molecular Medicine, Queens Medical Centre, University Hospital, University of Nottingham, UK PETER J.F. SNIJDERS, PhD • Section Molecular Pathology, Department of Pathology, VU University Medical Center, The Netherlands MARGARET ANNE STANLEY, MB, PhD • Department of Pathology, University of Cambridge, Cambridge, UK DAVID J. STEPHENS, BSc, PhD • Department of Biochemistry, School of Medical Sciences,University of Bristol, Bristol, UK

Contributors

xv

LINDA STRUIJK, PhD • Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands EWAN R. TAYLOR, PhD • Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA MIRANDA THOMAS, PhD • Tumour Virology, International Centre for Genetic Engineering and Biotechnology, Trieste, Italy MASSIMO TOMMASINO, PhD • International Agency for Research on Cancer, World Health Organization, Lyon, France ADRIAAN J. C. VAN DEN BRULE, PhD • Laboratory for Pathology, PAMM Institute, Eindhoven, The Netherlands SVETLANA VINOKUROVA, PhD • Institute of Molecular Pathology, University of Heidelberg, Heidelberg, Germany MAGNUS VON KNEBEL DOEBERITZ, MD, PhD • Institute of Molecular Pathology, University of Heidelberg, Heidelberg, Germany NICOLAS WENTZENSEN, MD • Institute of Molecular Pathology, University of Heidelberg, Heidelberg, Germany HONG YOU, MD, PhD • Departments of Internal Medicine and Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, AR CORINNA WHITLEY • Division for the Characterization of Tumourviruses, Deutsches Krebsforschungszentrum, Heidelberg, Germany REGINA WILSON, BS • Department of Microbiology-Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL

Identification of New Papillomavirus Types

1

1 Identification of New Papillomavirus Types Ethel-Michele de Villiers, Corinna Whitley, and Karin Gunst Summary The identification of papillomavirus DNA sequences in tissue samples using polymerase chain reaction (PCR) amplification, has led to the association of these infections to a multiplicity of clinical manifestations. The cloning and sequencing of PCR-amplified products has, to date, resulted in the identification of more than 300 putative “new” papillomavirus types. The methods used to identify these unknown papillomavirus sequences are described here. The CP, FAP, and GP primers are used for PCR amplification, followed by cloning and sequencing of the amplicons. Sequence comparisons and the interpretation of DNA sequence identities are discussed. Details of defining a new papillomavirus type and of the recently approved taxonomic classification system for the Papillomaviridae are given.

1. Introduction The identification and isolation of new papillomavirus types have been an ongoing process spanning almost three decades. The lack of cell-culture systems for the in vitro propagation of these viruses hampered investigations considerably. The first human papillomavirus (HPV) DNA was isolated in the late 1970s, at a time when the use of restriction enzymes, cloning, and sequencing was a novelty. Initially, papillomaviruses were purified by caesium-chloride gradient centrifugation of minced warts, followed subsequently by DNA extraction from the fractions containing viral particles. The application of the Southern blot hybridization technique enabled the identification of closely related papillomavirus types. Restriction enzyme-digested DNA samples from various tumors were separated by gel electrophoresis and transferred onto nitrocellulose membranes. A radiolabeled DNA probe of a known papillomavirus type was hybridized to the membrane at a given temperature below the DNA melting point. Identical or related sequences were detected by varying these From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

1

2

de Villiers, Whitley, and Gunst

hybridization conditions. In addition, comparative analyses of restriction fragment lengths induced by individual or combinations of restriction enzymes allowed for the identification of differences in the genomes of the respective isolates. The small group of scientists involved in papillomavirus research at that stage agreed to accept an isolate as a papillomavirus only if the complete genome had been cloned and made available. The full-length viral genomes were isolated from tissues either by ethidiumbromide density gradient centrifugation from tissues containing many copies of papillomavirus particles, or by plaque hybridization of bacteriophage libraries constructed from digested total cellular DNA. Gradient-purified viral DNA was cloned directly into a bacterial plasmid, whereas virus DNA integrated into the bacteriophage genome was subsequently subcloned into a plasmid. The degree of DNA homology between the full-length genomes of related papillomavirus types was determined by liquid hybridization and, in some instances, by analyzing the heteroduplex formation of the genomes by electron microscopy. A new papillomavirus type was then defined as sharing less than 50% homology in liquid hybridization to the closest related known papillomavirus type. The advent of the sequencing technology facilitated the classification of papillomaviruses. Individual genes within the viral genome were identified, and the genome organization characteristic for all papillomaviruses was determined. The sequence homology between individual genes from a number of papillomavirus types could now be compared, and conserved regions within the genome identified. This development led to a modification of the definition of a new papillomavirus type. The members of the papillomavirus research community this time agreed on defining a new papillomavirus type as follows: a complete papillomavirus genome sharing less than 90% DNA homology in each of the E6, E7, and L1 open reading frames (ORF) to the respective ORFs of the closest related papillomavirus type. The L1 gene is the most conserved ORF, and its protein is the main viral capsid protein. The choice of E6 and E7 was based on their functional importance. During the beginning of the 1990s, the majority of papillomavirus genomes were sequenced by Hajo Delius (1). With all the sequence data available, it became evident that the decision to include the E6 and E7 sequences could not be upheld. The HPV 77 E7 shares 97% DNA sequence homology to the HPV 29 E7 (2). It was therefore decided to revert to comparing only the L1 ORF when defining a new papillomavirus type. This has remained the definition of a papillomavirus type to the present time (reviewed in ref. 3). The possibility of detecting papillomavirus DNA sequences in tissue by polymerase chain reaction (PCR) amplification has led to a very rapid increase in the number of putative new papillomavirus types being identified. The enormous interest in the papillomavirus types associated with genital lesions and

Identification of New Papillomavirus Types

3

the potential use for diagnostic purposes, led to the development of the MY09/ MY11 primers (4) amplifying a region of the L1 ORF of a broad spectrum of the types belonging to the genus α-papillomavirus. A large number of putative new HPV types were also identified by sequencing the amplicons (5,6). The GP5+/GP6+ primers amplify a shorter region within the same region of the L1 ORF (7). Several other PCR primer systems amplifying regions of the E6, E7, E1, or L1 ORFs were reported, but used only in single laboratories. The detection of papillomavirus sequences in cutaneous lesions requires the use of PCR primers that amplify a broader spectrum of papillomavirus types. HPV types in the genera β-papillomavirus, γ-papillomavirus, µ-papillomavirus, as well as a number of HPV types in the genus α-papillomavirus were originally isolated from cutaneous lesions. Emerging data on the detection of papillomavirus sequences in tumor and normal tissue from a variety of organs indicate the existence of an extremely large group of papillomavirus types. Unfortunately, very little information is available on the pathogenic mechanisms of the majority of individual papillomavirus types. Earlier notions failed to modify the definition of a type in order to combine types sharing high DNA sequence homology, due to the divergence in their biological behavior. An example can be found in certain cutaneous HPV types, which each react completely differently upon ultraviolet irradiation despite their genomes sharing a very high DNA homology (8). There is a clear need to continue the process of identifying unknown papillomaviruses. Phylogenetic analysis (3) is suggestive of the possible existence of larger numbers of papillomavirus types in certain genera, which, to date, have not been studied extensively. On the other hand, histological data of certain types of tumors are indicative of the possible involvement of an infection with papillomavirus. Combining these data, as well as extending ongoing studies, may lead us to the identification of additional factors in the etiology of disease. The following describes a useful approach to identify unknown papillomaviruses, independent of the organ origin of the cellular DNA. (Read notes carefully prior to preparing for or starting with any experiments.) 2. Materials 2.1. DNA Extraction 1. Phenol (pH stabilized with 10 mM Tris, 1 mM ethylenediamine tetraacetic acid [EDTA], pH 8.0). 2. Proteinase K (20 mg/mL). 3. PK buffer (2X): 0.2 M Tris-HCl (pH 7.5), 25 mM EDTA, 0.3 M NaCl, 2% sodium dodecyl sulfate (SDS). Do not autoclave this solution, but sterilize through filtration. 4. Chloroform:isoamylalcohol (CIA) at 24:1.

4

de Villiers, Whitley, and Gunst 5. 6. 7. 8. 9.

Ethanol, absolute, 70%, 80%, and 90%. Xylol. 1X TE : 10 mM Tris-HCl,1 mM EDTA (pH 7.4). 3 M Na acetate (pH 5.4). Orbital mixer.

2.2. Polymerase Chain Reaction 1. dNTP set: mixture containing 10 mM each dNTP. Aliquot and store at –20°C until use. 2. Primers: aliquot at a dilution of 10 pmol/µL and store at –20°C until use. For GP amplification (7)—modified: L1 ORF: amplicon size 140–150 bp GP 5+: 5'–ttggatccT TTG TTA CTG TGG TAG ATA CTA C–3' GP 6+: 5'–ttggatccG AAA AAT AAA CTG TAA ATC ATA TTC–3' For CP amplification (9)—modified: L1 ORF: amplicon size 480–500 bp, and for the nested reaction, 370–390 bp CP 65: 5'–ttggatccC ARG GTC AYA AYA ATG GYA T–3' CP 70: 5'–ttggatccA AYT TTC GTC CYA RAG RAW ATT GRT C–3' CP 66: 5'–ttggatccA ATC ARM TGT TTR TTA CWG T–3' CP 69: 5'–ttggatccG WTA GAT CWA CAT YCC ARA A–3' For FAP amplification (10)—modified: L1 ORF: amplicon size approx 480 nucleotides FAP59 (forward): 5'–ttg ga tccT AAC WGT IGG ICA YCC WTA TT–3' FAP64 (backward): 5'–ttg gat ccC CWA TAT CWV HCA TIT CIC CAT C–3' The BamHI restriction site (ggatcc) and the tt overhang were incorporated into all primers to facilitate cloning. Y: C or T; R: A or G; W: A or T; M: A or C; 3. Taq polymerase (Ampli Taq Gold; Perkin Elmer). The PCR buffer (10X) and MgCl2 (25 mM) solution are included. Aliquot these and store at –20°C until use. MgCl2 (25 mM) is added to a final concentration of 2 mM for the CP and GP primers and 3.5 mM for the FAP primers. 4. Sample DNA (50–100 ng in a total volume of 10 µL). 5. Size marker: DNA ladder mix (100–10,000 bp) 6. Loading buffer (xylene cyanol: 0.5% xylene cyanol, 50% glycerol). 7. EP buffer: 40 mM Tris-HCl, 5 mM Na acetate, 1 mM EDTA (pH 7.8). 8. Agarose gels (1.5% and 2%) in 1X EP buffer. 9. Ethidium bromide (concentration 0.1%). 10. PCR thermocycler: Multicycler PTC200 (Biozym Diagnostik).

2.3. Cloning of the Amplicons 1. High Pure PCR Product Purification Kit, Roche (Cat. No. 1732676). 2. Gel extraction kit, e.g., JETQUICK (Genomed Cat. No. 420050). 3. TA Cloning Kit complete with TOP10F' competent cells (Invitrogen).

Identification of New Papillomavirus Types

5

4. Luria-Bertani (LB) broth (4 g tryptone, 4 g NaCl, 2 g yeast extract) containing ampicillin (end concentration 100 µg/mL). 5. LB agar plates (LB broth and 6 g Bacto-agar) containing 100 µg/mL ampicillin, 40 mg/mL isopropyl-β-D-thiogalactopyranoside (IPTG) and 40 µg/mL X-gal (5-bromo-4-chloro-3-indolyl-β-galactoside). Ampicillin, IPTG, and X-gal should be added to the solutions after sterilization. Take care to cool solutions partially prior to addition. 6. Plasmid miniprep kit, e.g., JETQUICK (Genomed). 7. Restriction enzyme BamH1.

2.4. Sequencing and Sequence Analysis 1. Automated sequencer. 2. Sequence analysis package software.

3. Methods 3.1. DNA Extraction (see Notes 1–3) If fresh biopsies are used, DNA is extracted either directly or after storage at –70°C until use. 1. Cut tissue into very small pieces and place into 1.5-mL tube. 2. Add absolute ethanol and leave overnight at room temperature. 3. Remove ethanol and lyophilize pellet (cover open tube with parafilm and pierce several times with needle). 4. Add 250 µL PK buffer, 250 µL double-distilled water, and 10 µL proteinase K (20 mg/mL) to tissue. 5. Close tube, seal with parafilm, and rotate the tube for at least 5 h or overnight on an orbital mixer at 37°C. 6. Add 500 µL phenol (saturated and stabilized at pH8 with 1X TE) and mix well by rotation for at least 10 min. 7. Centrifuge for 10 min at 13,000g. 8. Aspirate supernatant into a new 2-mL tube and add 250 µL phenol and 250 µL CIA. 9. Repeat rotation and centrifugation. 10. Repeat step 8 and transfer supernatant to a new 2-mL tube containing 500 µL CIA. 11. Repeat step 9. 12. Aspirate supernatant into new 1.5-mL tube after rotation and centrifugation— take great care not to aspirate CIA when removing supernatant. 13. Add 1/10 volume Na acetate (pH 5.4) and 2 volumes absolute ethanol. 14. Cool at –20°C for at least 1 h (preferably overnight). 15. Centrifuge tube in pre-cooled centrifuge for 30 min at 13,000g. 16. Discard supernatant and add 70% ice-cold ethanol to wash pellet by centrifugation for 15 min at 13,000g. 17. Remove supernatant carefully and lyophylize pellet. 18. Dissolve pellet according to size in 1X TE (pH 8.0). 19. Measure the DNA concentration.

6

de Villiers, Whitley, and Gunst

3.2. Removal of Paraffin Prior to Extracting the DNA in the Case of Paraffin Embedded Tissue (see Notes 2–5) Paraffin is removed as follows, depending on the number of sections and the thickness of single sections. For three to four sections of 3–5 µm thickness in 1.5-mL tube: 1. 2. 3. 4. 5. 6. 7. 8. 9.

Add 200 µL xylol mix thoroughly by rotation on a mixer for at least 10 min. Remove supernatant after centrifugation for 10 min at 13,000g. Repeat steps 1 and 2 twice. Add 200 µL absolute ethanol and repeat mixing, centrifugation, and aspiration of supernatant as above. Repeat as above, except for replacing the supernatant with 90%, 80%, and 70% ethanol in successive steps. Close tube with parafilm and pierce with needle. Lyophilize. Store tightly closed at 4°C until further use, or Proceed to steps 4–19 as described under Subheading 3.1.

For three sections of 25–30 µm thickness: 1. 2. 3. 4. 5. 6. 7.

Add 1 mL xylol in 1.5-mL tube. Rotate overnight on orbital mixer. Centrifuge for 10 min at 13,000g. Aspirate and discard supernatant. Add 1 mL absolute ethanol. Repeat steps 2–4. Repeat steps 1–9 as above, except that a volume of 1 mL of the respective solutions is added.

3.3. PCR Amplification (see Notes 1, 2, and 6) 3.3.1. Amplification Using the CP primers 1. The first round of PCR is done using the CP65 and CP70 primers. Prepare the following master mix for the PCR amplification according to the number of samples to be tested: 5 µL 10X PCR buffer, 1 µL of 4 × 10 mM dNTPs, 5 µL each of 10 pmol/µL CP65 and CP70, 0.25 µL 5 U/mL Taq polymerase, and 5 µL 25 mM MgCl 2 in a total volume of 40.25 µL. 2. Add the sample DNA to the tube containing an aliquot of the master mix. Denature at 94°C for 9 min and amplify through 40 cycles of 60 s at 94°C, annealing for 60 s at 50°C, and elongation for 1 min at 72°C. Add a final elongation step of 5 min at 72°C. 3. Run 10 µL per amplified product with 2 µL loading buffer on a 1.5% agarose gel and visualize bands by staining with ethidium bromide (expected amplicon size CP65/CP70 is 452–467 bp) (see Notes 7–9).

Identification of New Papillomavirus Types

7

4. Aspirate 3 µL of the first amplified product for the subsequent nested PCR using the primers CP66 and CP69. The same PCR conditions are used as for CP65/CP70. 5. Repeat step 3 for visualization of the amplicons (expected size CP66/CP69 is 374–389 bp) (see Note 9). 6. If a single band is visible after EtBr staining, purify the total amplification product using the High Pure PCR Product Purification Kit. 7. If more than one band is visible, precipitate the sample (refer to steps 14–16 under Subheading 3.1.). Dissolve the pellet in 10 µL 1X TE (pH 8.0), add loading buffer, and separate on a 1.5% agarose gel; stain and cut each band from gel with a sterile scalpel (see Note 10). 8. Purify the amplicons excised from the agarose gel using the JETQUICK Gel Extraction Kit. 9. The total volume after elution will be 50 µL. Measure the DNA concentration. 10. Ligate the DNA fragment into one of the mentioned vectors (e.g., pCR2.1) using TA Cloning Kit, at ratio of five insert molecules to one vector molecule (follow instructions as described in the kit) with overnight ligation at 14°C. 11. Transform TOP10F' competent Escherichia coli with the ligated DNA. 12. Plate bacteria on LB agar plates containing ampicillin, IPTG, and X-gal, and incubate overnight at 37°C. 13. Cool agar plates at 4°C for 1 h in order to increase the contrasting of blue and white colonies. 14. Select white colonies: pick individual colonies each with a sterile toothpick and transfer the latter into a tube containing 5 mL LB broth with ampicillin (see Notes 11 and 12). 15. Shake bacterial cultures by rotation (180 to 220 rpm) at 37°C overnight. 16. Purify the plasmid DNA from the bacteria using a miniprep kit according to the manufacturer’s instructions, eluting in a final volume of 75 µL. 17. Digest 2 µL of each purified DNA sample with the restriction enzyme BamH1. 18. Separate digested fragments on a 1.5% agarose gel. 19. Visualize the DNA bands by EtBr staining and ultraviolet (UV) light. 20. Select the clones with inserts of the expected size (see Note 13). 21. Sequence an aliquot of at least 6–10 clones per amplification product.

3.3.2. Amplification Using the GP5+/GP6+ Primers 1. Amplify the sample DNA using the GP5+/GP6+ primers in the following reaction: 5 µL 10X PCR buffer, 1 µL of 4 × 10 mM dNTPs, 5 µL each of 10 pmol/µL GP5+ and GP6+, 0.25 µL 5 U/mL Taq polymerase, and 5 µL 25 mM MgCl2 in a total volume of 40.25 µL. 2. Denature at 94°C for 9 min and amplify through 40 cycles of 40 s at 94°C, annealing of 90 s at 40°C, and elongation for 90 s at 72°C. Add a final elongation step of 5 min at 72°C. 3. Repeat step 3 under Subheading 3.3.1. The expected amplicon size is 140 bp to 150 bp. 4. Repeat steps 5–21 under Subheading 3.3.1.

8

de Villiers, Whitley, and Gunst

3.3.3. Amplification Using the FAP Primers 1. Amplify the sample DNA using the FAP primers and the following master mix: 5 µL 10X PCR buffer, 1 µL of 4 × 10 mM dNTPs, 5 µL each of 10 pmol/µL FAP59 and FAP64, 0.25 µL 5 U/mL Taq polymerase, and 7 µL 25 mM MgCl2 in a total volume of 40.25 µL. 2. Denature at 94°C for 8 min and amplify through 45 cycles of 90 s at 94°C, annealing for 90 s at 50°C, and elongation for 90 s at 72°C. Add a final elongation step of 5 min at 72°C. 3. Repeat step 3 under Subheading 3.3.1. The expected amplicon size is 480 nucleotides (see Note 14). 4. Repeat steps 5–21 under Subheading 3.3.1.

3.3.4. Amplification of DNA From Paraffin-Embedded Tissue to Determine Fragment Size Range If DNA from paraffin-embedded tissue is used for amplification by PCR, the integrity of the cellular DNA has to be determined by PCR amplification of a household gene, e.g., β-actin (11), prior to amplification with papillomavirusspecific primers. The average fragment size of the cellular DNA is determined by using different combinations of the primers described. If the maximum length amplified does not exceed, for example, 100 bp, it is unlikely that the PCR amplification using the CP or FAP primers will succeed (see Note 5).

3.4. Sequence Comparisons With Databanks 1. The software chosen for the analyses of sequences obtained from the cloned amplicon compared to the sequences available in the databanks, depends on what is available in the specific laboratory. The HUSAR Package (12) is very useful (see Note 15). 2. Sequences are initially compared to the viral databanks. If sequence identity to any other virus type is listed first, the query sequence probably represents a cellular sequence and not a papillomavirus sequence. 3. If the identity between the query sequence and a papillomavirus sequence in the databank is 90% or above—and covers almost all of the sequence length (see Note 16)—the query sequence is that papillomavirus type or partial putative papillomavirus type (see Note 17). 4. If the identity between the query sequence and the closest related papillomavirus sequence in the databank is below 90%, but above 80%, the query sequence is defined as related to the next closest papillomavirus type, and therefore probably defines a putative new papillomavirus type. To verify this finding, sequencing of both strands of the clone is necessary to exclude sequencing errors and to determine the exact full-length sequence. 5. If the identity between the query sequence and the closest related papillomavirus sequence is lower than 80%, a comparison to all databanks is necessary to determine whether the query sequence may be of cellular origin. If the same result is

Identification of New Papillomavirus Types

9

obtained as against the viral databank, the translation of the query sequence (across all six reading frames) is necessary to determine whether the query sequence harbors the amino acids conserved among papillomaviruses within the amplified region. If the latter applies, the sequence probably represents a putative new papillomavirus distantly related to the closest related papillomavirus type. If it does not apply, the query sequence does not represent a papillomavirus sequence. 6. In all cases where putative new papillomavirus sequences are identified, subsequent attempts should be made to clone the full-length papillomavirus genome (see Note 18).

4. Notes 1. Probably the most important aspect of applying the polymerase chain reaction is taking precautionary measures to avoid DNA contamination. This applies not only in the laboratory where the testing is being performed, but starts at the point where tissue samples are collected. In all instances, fresh gloves, scalpels, and containers must be used. Freezing multiple samples (tubes) in large liquid-nitrogen containers could lead to crosscontamination, because the tube lids, in most cases, allow for the penetration of the liquid nitrogen into and out of the closed tube. Precautions in the laboratory include repeated cleaning of surfaces, changing of gloves, and separation of handling procedures and instruments into different rooms. An example is to change the laboratory clothing prior to entering the room where the solutions (e.g., master mix in the absence of DNA) are prepared, vs a room where the addition of the sample DNA and amplification steps are performed. Tubes should preferably be centrifuged prior to opening in order to minimize the formation of an aerosol when opening the lid. Even then, the opening should be performed cautiously. Contamination on the outside wall of the tube and lid must be avoided, as well as the contamination of all laboratory instruments. Plugged disposable pipet tips must be used at all times. 2. It is not advisable to handle or amplify more than 5–10 samples at one time. If contamination does occur, it can easily be localized to a specific sample or experiment. In this case, repetition of the experiment starting with the extracted sample DNA is advisable. If this leads to the same result as initially obtained, additional DNA should be extracted again from the original sample and the experiments repeated using new aliquots of all solutions, and so on. 3. Care should be taken when dissolving a lyophilized DNA pellet. Forced pipetting will lead to fragmentation of the DNA sample. It is advisable to leave the buffer on the pellet for some time in order to soften the pellet prior to pipetting. It is advisable to keep the sample DNA in a more concentrated form and to prepare dilutions of aliquots when needed. 4. The sectioning of fixed samples requires the use of a new blade for each individual sample, in combination with an extensive cleaning of the microtome between samples.

10

de Villiers, Whitley, and Gunst

5. DNA extracted from fixed tissue is often degraded (as a result of inappropriate fixing methods/times). The quality of the extracted DNA should be tested by the amplification of a house-keeping gene (e.g., β-actin [11]) in order to determine the average fragment size of the DNA. In some instances (e.g., lesions producing a high copy number of papillomavirus particles) amplification of larger papillomavirus sequences may be obtained from tissue samples of which the average DNA fragment size is below 200 bp. Apparently intact virus particles are resistant to degradation, and viral genome may be extracted following the described methods. 6. Aliquot all solutions in volumes adequate for one experiment. This requires additional time, but in the end saves more time and effort in instances when contamination does occur. 7. Include negative as well as positive controls with each amplification. Negative control means one sample containing only the master mix without any DNA, as well a sample containing any “neutral” cellular DNA (e.g., placenta DNA). Positive controls will include an HPV type at specific concentration. The following HPV types are suggested as controls: HPV 3 when using GP+ primers, HPV 8 when using CP and FAP primers. Each of these is included at dilutions of 10 and 100 viral copies against a placenta DNA background. If any of the HPV types used as control appears to be present in one of the samples tested, the experiments are repeated using different HPV types as controls. This is done to exclude the possibility of cross-contamination. In this case, HPV 18 is used with the GP+ primers, HPV 23 with the CP primers, and HPV 32 with the FAP primers. 8. Run DNA size markers on both sides of the samples during gel electrophoresis. This allows for a more accurate fragment size determination. 9. When using the CP primers CP65/CP70 for amplification, two nonspecific bands (approx sizes 500 bp and 250 bp) are often seen. The viral DNA fragment size is generally approx 450 bp. If the viral DNA was amplified sufficiently, only one band will be present. In all other cases, or in case of uncertainty, it is advisable to perform the nested PCR reaction using the CP65/CP69 primers. The amplicons generated here are usually of viral origin, but weak bands may indicate low viral copy numbers mixed with cellular sequences. Therefore, cloning and sequencing are necessary steps to verify the origin of the sequences. 10. Do not run more than one sample per gel when running preparative gels. The huge amount of DNA present could easily cross-contaminate in the buffer as well as during handling of the gel. Removal (cutting with a sterile scalpel) of the required DNA band from the agarose gel should be performed under long-wave UV visualization in the shortest period of time possible. Short-wave UV may damage the DNA molecules extensively, leading to fractioning. Place a clean plastic sheet between the UV filter and the gel to avoid contamination of subsequent samples. 11. Initially, 12 bacterial colonies are picked for DNA extraction. If all plasmid preparations contain inserts of the expected size, 6–10 inserts will be sequenced. If less than 6 preparations contain inserts of the expected size, additional bacte-

Identification of New Papillomavirus Types

12.

13.

14.

15.

16.

17.

18.

11

rial colonies will be examined. The possibility of identifying infections with multiple HPV types and/or putative new HPV types (both when either present at low copy numbers or distantly related to known types) increases with the analysis of increasing numbers of colonies/inserts. Aliquots of all bacterial culture suspensions should be preserved for further use or conservation. The same applies for ligation reactions and DNA from plasmid preparations. Larger fragment sizes, expected when using the initial primers, may be obtained after the nested amplification. This results from additional amplification in the second reaction of the initial amplicon by the carrying over of initial primers, and so on, in the sample taken from the first amplification round to initiate the nested reaction. When using the FAP primers, the expected amplicon size is approx 480 bp. Offsized amplicons of approx 200 bp are sometimes observed. Cloning and sequencing of these amplicons indicated the presence of additional binding site(s) for the FAP primers within this stretch of the L1 ORF of certain HPV types. It is therefore necessary to examine such products by cloning and sequencing in order to capture any unidentified (new) HPV sequences. The sequencing reaction is initiated by using the primers located adjacent to the multiple cloning site of the vector. Make sure to delete adjacent vector sequences from the sequence in question prior to comparing insert sequences to other sequences in the databanks. Vector sequences are often included in many of the submitted sequences and may cause confusion in interpreting the results. It is very important that the sequence identity should encompass almost the full length of the cloned DNA. Identity over short stretches could imply the coverage of only the primer sequences, with the rest not being papillomavirus sequences. The PCR amplicon constitutes a partial HPV sequence and may be indicative of a putative new HPV type. The complete genome has to be cloned and sequenced (characterized) in order to be referred to as an HPV type. The complete genomes are then integrated into the taxonomic classification of the Papillomaviridae, which was recently agreed upon by the International Committee on the Taxonomy of Viruses (ICTV) (reviewed in ref. 3). The following definitions for the Papillomaviridae may be used as guide for the interpretation of the cloned sequences: • Genera share less than 60% nucleotide sequence identity in the L1 ORF. • Species share between 60% and 70% nucleotide identity. • Types within species share between 71% and 89% identity. • Nucleotide identity of the L1 ORF of 90% to 98% and more constitutes a subtype, and higher than 98% a variant of a known papillomavirus type. The isolation and cloning of full-length papillomavirus genomes may be tedious if small amounts of sample DNA are available, if low copy numbers are present in the sample, or if multiple types are present within one sample. The direct cloning of the complete genome into vector systems capable of harboring larger fragments is preferable (Bacteriophage lambda, Expand Cloning Kit; Roche, Cat. No. 1940392).

12

de Villiers, Whitley, and Gunst Alternative ways are being used, but these do pose problems. Amplification by long PCR (a number of different kits are available) using outward primers, designed on the initial PCR fragment, may lead to sequence modifications (even though proofreading enzymes are used). It was therefore decided to label HPV types generated by this method as HPVcand . . . (cand = candidate). This method may even lead to the amplification of “hybrid” HPV genomes if more than one HPV type is present in the same sample and these types are closely related types or amplification conditions allow for the nonstringent annealing of the primers. Another method being applied with success is the multiply primed rolling circle amplification using the Phi29 DNA polymerase and random hexamer primers (13). Kits (Amersham, GenomiPhi Cat. No. 25-660-01, and TempliPhi Cat. No. 25-6400-10) are available. Conditions have to be optimized for the amplification of papillomavirus genomes (14). The initial amplification of the cellular DNA using this method will facilitate amplification using the long PCR amplification method (Gunst and de Villiers, unpublished results). The complete genomes generated this way have, to date, not been verified on sequence identity to the papillomavirus sequence present in the original tissue sample.

References 1. Delius, H. and Hofmann, B. (1994) Primer-directed sequencing of human papillomavirus types. Curr. Top. Microbiol. Immunol. 186, 13–31. 2. Delius, H., Saegling, B., Bergmann, K., Shamanin, V., and de Villiers, E-M. (1998) The genomes of three of four novel HPV types, defined by differences of their L1 genes, show high conservation of the E7 gene and the URR. Virology 240, 359–365. 3. de Villiers, E-M., Fauquet, C., Broker, T., Bernard, H-U., and zur Hausen, H. (2004) Classification of papillomaviruses. Virology 324, 17–27. 4. Bauer, H. M., Greer, C. E., Chambers, J. C., et al. (1991) Genital human papillomavirus infection in female university students as determined by a PCRbased method. JAMA 265, 472–477. 5. Bernard, H-U., Chan, S. Y., Manos, M. M., et al. (1994) Identification and assessment of known and novel human papillomaviruses by polymerase chain reaction amplification, restriction fragment length polymorphisms, nucleotide sequence, and phylogenetic algorithms. J. Infect. Dis. 170, 1077–1085. 6. Manos, M. M., Waldman, J., Zhang, T. Y., et al. (1994) Epidemiology and partial nucleotide sequence of four novel genital human papillomaviruses. J. Infect. Dis. 170, 1096–1099. 7. De Rhoda-Husman, A. M., Walboomers, J. M., van den Brule, A. J., Meijer, C. J., and Snijders, P. J. (1995) The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J. Gen. Virol. 76, 1057–1062. 8. de Villiers, E-M., Ruhland, A., and Sekaric, P. (1999) Human papillomaviruses in non-melanoma skin cancer. Semin. Cancer Biol. 9, 413–422.

Identification of New Papillomavirus Types

13

9. Berkhout, R. J. M., Tieben, L. M., Smits, H. L., Bouwes Bavinck, J. N., Vermeer, B. J., and ter Schegget, J. (1995) Nested PCR approach for detection and typing of Epidermodysplasia Verruciformis-associated human papillomavirus types in cutaneous cancers from renal transplant recipients. J. Clin. Microbiol. 33, 690–695. 10. Forslund, O., Antonsson, A., Nordin, P., Stenquist, B., and Hansson, B. G. (1999) A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J. Gen. Virol. 80, 2437–2443. 11. Greer, C. E., Peterson, S. L., Kiviat, N. B., and Manos, M. M. (1991) PCR amplification from paraffin-embedded tissues. Effects of fixative and fixation time. Am. J. Clin. Pathol. 95, 117–124. 12. Senger, M. T., Flores, K-H., Glatting, P., Hotz-Wagenblatt, A., and Suhau, S. (1998) W2H: WWW interface to the GCG sequence analysis package. Bioinformatics 14, 452–457. 13. Dean, F. B., Nelson, J. R., Giesler, T. L., and Lasken, R. S. (2001) Rapid amplification of plasmid and phage DNA using phi29 DNA polymerase and multiplyprimed rolling circle amplification. Genome Res. 11, 1095–1099. 14. Rector, A., Tachezy, R., and van Ranst, M. (2004) A sequence-independent strategy for detection and cloning of circular DNA virus genomes by using multiply primed rolling-circle amplification. J. Virol. 78, 4993–4998.

Identification of HPV Variants

15

2 Identification of HPV Variants John Cason, Jon Bible, and Christine Mant Summary The vast majority of anogenital carcinomas are caused by high-risk human papillomaviruses (HPVs), and among Western nations HPV-16 is usually the most predominant cancer-associated type. As a DNA virus, HPV type 16 has a relatively stable genome that is believed to have co-evolved with its host over the millennia. Nevertheless, among the “wild” populations of HPV-16 that are circulating, a large number of variants have been identified, and these may have considerably different pathogenic potentials. In this chapter, methods for screening and characterizing HPV-16 sequence variants are described. In particular, we describe methods for the identification of variation within the HPV-16 E5 open reading frame and for the detection of the nt 131 A→G mutation of the E6 ORF, using restriction fragment length polymorphism assays . In addition, we describe approaches for DNA sequencing and analysis. Such methods are likely to be of particular interest to those involved in epidemiological investigations of virus transmission and pathogenicity studies.

1. Introduction Cervical cancer is a major cause of female cancer deaths, with some 450,000 incident cases worldwide (1). It is now clearly established that a subgroup of human papillomaviruses (HPVs) are causally associated with this malignancy and are termed high-risk (HR) HPVs (2). In the United Kingdom—and in most Western countries—HPV types 16 and 18 are most frequently detected HRHPVs in cervical malignancies: in our inner-city location, HR-HPV DNA occurs in about 95% of cervical cancers, and 62% are positive for HPV-16 DNA (3). Because the vast majority of HR-HPV infections do not result in carcinoma (4,5), other factors must be involved in malignant progression. Although co-factors for cervical cancer have been sought, no single convincing co-factor has been identified, and the greatest risk for developing cervical cancer remains persistent infection with a HR-HPV and a high viral load. From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

15

16

Cason, Bible, and Mant

For a long time, there has been interest in the phylogeny of HPV-16 variants (6), and some studies have sought an association between HPV-16 variants and cervical neoplasia (7–11). However, these reports are largely based on crosssectional studies of small patient numbers and a limited clinical spectrum of neoplastic lesions, and rarely include infected women with normal cytology. Additional, more detailed longitudinal studies of the association between HPV-16 variants and disease are required. The identification of HPV-16 variants may also be suited for use in studies of virus transmission for epidemiological purposes and in litigation cases of alleged sexual abuse. In this chapter we describe two restriction fragment length polymorphism (RFLP) assays that can be used to rapidly identify the presence of variations within the E5 and E6 open reading frames (ORFs) of HPV-16 variants in large population studies, and a DNA sequencing strategy to rapidly identify and analyze HPV-16 variants. 2. Materials 2.1. Reference Materials and Clinical Sample Preparation 1. Positive controls: reference isolates of HPV-16 such as pAt-16 (12,13), available from Dr. E. M. DeVilliers, DKFZ, Heidelberg, Germany), and DNA from CaSki or SiHa cells (both are HPV-16 DNA positive; obtainable from the American Type Culture Collection [ATCC] Ltd., Rockwell, MD). 2. Negative controls: an HPV-16 DNA negative cell line (e.g., A431, available from ATCC). 3. Cervical brush smears: typical samples for analysis would include cervical brush smears collected with an Axibrush™ (Colgate Medical Ltd.) from women attending local well-woman centers and gynecological outpatient clinics. 4. Dulbecco’s phosphate-buffered saline (PBS). 5. Proteinase K (PK) solution: 0.45% v/v NP-40, 0.45% v/v Tween-20, 60 g/L PK (Roche Ltd., UK).

2.2. Setting Up PCR Reactions 1. 2. 3. 4. 5.

DNA polymerase (5 U/µL; Promega). 10X polymerase chain reaction (PCR) buffer (Promega). 25 mM MgCl2 (Promega). E5 PCR primers (see Table 1 for sequences and conditions). E6 PCR primers and cycling conditions: The first E6 PCR uses the primers E61A (GAGAACTGCAATGTTTCAGG) and E62A (TGATTA CAGCTGGGTTTCTC: 3) which amplifies a 469-bp fragment of the E6 gene (Fig. 1A). The second primer set consists of E61B (CCAAAAGAGAACTGCAATGT) and E62B (AATTTTAGAATAAAACTTTAAACATT) (Fig. 1B). 6. Molecular biology-grade (MBG) DNase-free water. 7. Premixed dNTPs (Cambio, Ltd.).

Identification of HPV Variants

17

Table 1 Example of the E5 Polymerase Chain Reaction Conditions Reaction buffer (10X stock) 20 µL

MgCl2 (25 mM)

dNTPs (2.5 mM each stock)

Amount of each primer (2.5 mM)

DNA polymerase (5 U/mL)

dH2O

Sample

20 µL

16 µL

2 µL

1 µL

119 µL

20 µL

Upstream Primer TACAGGATCC TTATGTAATTA AAAAGCGTGC AT

Downstream Primer ATTTAGATC TATATGACA AATCTTGAT ACTGC

Cycling (×40)

(×1) 94°C/15 s

94°C/5min 55°C/15 s 72°C/10 s

(×1) 72°C/ 5min

Size of in product basepairs 273

A = Adenine C = Cytosine G = Guanine T = Thymidine

Fig. 1. Restriction fragment length polymorphisms to detect the E6 nt 130 A to G variant.

18

Cason, Bible, and Mant

8. Aerosol-resistant tips. 9. DNase-free plastics (Elkay Laboratory Plastics, Ltd., UK).

2.3. RFLP 1. 2. 3. 4.

Phenol:chloroform:isoamylalcohol (50%:48%:2% v/v). Absolute ethanol, and 70% v/v aqueous ethanol. Restriction endonucleases and buffers: Xcm1, Ssp1, Nsp1, Nsi1, and Msp1. Bovine serum albumin (Sigma).

2.4. Agarose Gel Electrophoresis 1. 10X Orange G loading buffer: 30% (w/v) Ficoll (Sigma), 250 mM ethylenediamine tetraacetic acid (EDTA; disodium salt), 0.25% (w/v) Orange G (BDH, Ltd.). 2. Agarose, UltraPure, electrophoresis grade (Invitrogen). 3. Tris-borate EDTA (TBE) buffer: 0.9 M Tris, 0.9 M boric acid, 2 mM EDTA. 4. Ethidium bromide: 10 mg/mL stock solution. 5. Molecular-weight size marker (e.g., 1 kb Ladder).

2.5. DNA Sequencing 1. 2. 3. 4.

Qiagen™ columns for purifying amplicons. pGem (Promega). Escherichia coli JM109 cells (Promega). Commercially obtainable T7 and SP6 primers (Sequenase™ kit, Pharmacia, Ltd.).

3. Methods 3.1. Preparation of Clinical Samples for PCR 1. Use PBS to resuspend cells from cell-lines or cervical brush smears in four 1-mL aliquots for PCR. 2. Centrifuge a 1-mL sample at 10,000g, resuspend the cell pellet in 200 µL PK solution, and incubate overnight at 55°C. 3. Inactivate the PK (by heating the sample to 90°C for 10 min), then store at –70°C.

3.2. Polymerase Chain Reactions 3.2.1. General PCR Considerations 1. Stringent precautions must be taken to prevent false-positives as a result of contamination, as described in Chapter 23, Subheading 3.1.

3.2.2. E5 PCR 1. Use a 20-µL aliquot of the PK-treated cell suspension directly in a 200-µL volume PCR using a proofreading DNA polymerase to amplify nt 3866 to 4077 of the HPV-16 genome (see Note 1, refs. 14,15, and Fig. 2). 2. For each batch of 20 clinical samples, two negative controls (molecular biology– grade water and A431 cells) and two positive controls (either pAt-16 plus CaSki

Identification of HPV Variants

19

Fig. 2. Restriction polymorphism fragment analysis of human papillomavirus (HPV) type 16 E5. or pAt-16 plus SiHa DNA) should be included. The PCR is performed using the conditions shown as a guideline (Table 1); if problems are encountered, re-optimize conditions (see Note 2). 3. After PCR amplification, add 100 µL of MBG dH2O and then extract the DNA using phenol:chloroform. Precipitate the DNA with 1 mL of absolute ethanol, wash with 70% v/v aqueous ethanol, and then dry under vacuum for 10 min. Finally, resupsend the pellets in 20 µL of sterile MBG dH2O and store at –20°C prior to restriction digests.

3.2.3. E5 RFLP The E5 PCR amplifies HPV-16 E5 wild-type gene between nucleotides (nt) 3866 to 4077 and has been used previously to identify particular variants most commonly associated with cervical disease (16). For the reference HPV-16 sequence, this region contains over 45 restriction endonuclease (RE) cleavage sites, at least three of which (Xcm I [3872CCANN NNN↓NNNNTGG3886: where N = any nt]; Ssp I [nt 3978AAT↓ATT3983]; and, Nsp I [4077ACATG↓C4082]) are disrupted in different reported HPV-16 variants (6) (Fig. 2). These RE can therefore be used in an RFLP assay to identify eight HPV-16 variants (see Table 2 and Note 3).

20

Cason, Bible, and Mant Table 2 Designation of E5 Restriction Fragment Length Polymorphism Patterns Variant 1 2 3 4 5 6 7 8

XcmI

SspI

NspI

+ + – + – + – –

+ – + + – – + –

+ + + – + – – –

1. Resuspend DNA pellets in 50 µL of MBG water. 2. Prepare four 5-µL aliquots for each sample, three of which are subjected to an overnight digestion at 37°C with 5 U of one RE (SspI, XcmI, or NspI). 3. Separate the products by agarose gel electrophoresis (Subheading 3.2.4.). 4. Spiking experiments indicate that mixed infections can be identified in the RFLP assay only when the least frequent variant exceeds 10% (w/w) of the total HPV16 E5 DNA present (Fig. 3). In our experience, all eight possible RFLP patterns have been detected among samples from patients, with RFLP patterns 1 (28%), 2 (32%), and 9 (36%) being most common among cytologically normal women infected with HPV 16 (16). In HPV-16-positive women with cervical neoplasia, pattern 2 was present in 63% of cases and pattern 1 in 21%.

3.2.4. Agarose Gel Electrophoresis of PCR Products/RFLP Digests 1. Prepare a 2% (w/v) agarose gel using TBE buffer and 5 µL ethidium bromide solution per 100 mL agarose gel. 2. Mix PCR amplicons or RFLP digests with 10X Orange G loading buffer and electrophorese at 125 V for approx 1 h. Ensure molecular-weight standards are run in parallel with the molecular-weight markers analyzed on the gel to assess the size of PCR products. 3. Visualize bands on a ultraviolet transilluminator and compare amplicon size against molecular-weight marker. Photographic records should be obtained.

3.3. RFLP Detection of A→G Variation at Position 131 Within the E6 Open Reading Frame In this section we describe two RFLP assays to detect the E6 variant (A→G at position 131) described by Ellis et al. (17), which may be highly associated with women with high-grade CIN and with human leukocyte antigen B7 gene.

Identification of HPV Variants

21

Fig. 3. Sensitivity of the human papillomavirus (HPV) type 16 restriction fragment length polymorphism to mixtures of variants. For this spiking experiment, each group of four lanes corresponds to (left to right) undigested amplicon, SspI, digest, XcmI digest, and NspI digest. A1: prototypic HPV16 pAt-16. A2-C10: mixtures of prototypic and HPV16 variants in different ratios from 90% prototypic/10% variant (A2) through to 10% prototypic/90% variant (C10). C11: 100% variant. M: molecular weight marker (sizes in bp).

3.3.1. E6 PCRs The first E6 PCR uses the primers E61A and E62A (18); this amplifies a 469-bp fragment of the E6 gene (Fig. 1A). The second primer set consists of E61B and E62B, which amplifies a 234-bp fragment of E6 (Fig. 1B).

3.3.2. E6 RFLP 1. Following PCR amplification with primer set A, digest 5 µL of product with 10 U NsiI (see Note 3) in a final dilution of 20 µL of buffer at 37°C overnight. 2. Further digest 10 µL of this reaction with Msp-I under the same conditions except for the addition of bovine serum albumin at 0.2 g/L. 3. PCR products produced using primer set B are digested with MspI alone. 4. Separate products on a 1.5% agarose gel containing ethidium bromide, and then visualize by trans-illumination with ultraviolet light.

22

Cason, Bible, and Mant

5. Variants can be identified by the presence of the unique MspI site. Thus, in the case of the PCR using primer set A, the 469-bp product is digested with NsiI to produce fragments of 163 and 306 bp. These products are then digested with MspI, which cuts the 306-bp fragment into 245- and 61-bp products and cuts the 163-bp fragment into 127 and 36 bp only when the variant is present. The variant can be seen after electrophoresis, where the 163-bp fragment of the prototypic sequence is replaced by a 127-bp fragment, which indicates the variant is present. In the case of amplicons produced using primer set B, MspI digestion results in a band of 234 bp when the prototypic sequence is present, or a band of 192 bp when the nt 131 E6 variant is present.

3.3.3. DNA Sequencing There are two main approaches for DNA sequencing analysis. First, one can perform direct/bulk sequencing of PCR amplicons, which will provide a consensus of any HPV-16 sequences present; second, a more accurate approach is to clone the PCR products into a plasmid and then sequence >20 clones. 1. Purify E5 PCR amplicons using Qiagen columns and blunt end clone into pGem. 2. Add transformed plasmids into E. coli JM109 cells and grow overnight at 37°C on agar plates. 3. Select white colonies, grow midi-cultures, and purify plasmid DNA using Qiagen columns. 4. Sequence the inserts in both orientations (with T7 and SP6 primers that recognize sequences in pGem which flank the inserted E5 DNA) using Sequenase kit. 5. Analyze resulting E5 products representing HPV-16 E5 DNA sequence between nucleotides 3866 and 4077 on a DNA sequencer.

3.3.4. DNA Sequence Analyses A variety of free-to-use software is available on the net for DNA sequence analyses (Table 3). DNA sequence data can be easily arranged into a FASTA format: >DNA sequence title (hard return) ACCGGGGGGGGTGCTCAG . . . (but containing no “hard returns”)

This file can be saved as a normal text “.doc” file and manipulated for sequence editing (e.g., use the “Find” option in the “Edit” function of Microsoft Word to rapidly identify the primer sites, and the “Replace” function to remove hard returns). Such FASTA files can then be cut and pasted into an alignment program such as CLUSTAL-W (http://www.ebi.ac.uk/ clustalw/index.html or, http://clustalw.genome.ad.jp/). These programs will also permit “gap stripping” so that only like sequences of DNA are compared, the production of homology measurements, bootstrap analyses (which indicate how many times a given

Identification of HPV Variants

23

Table 3 Useful Web Sites for DNA Analyses http://cti.itc.virginia.edu/~cmg/Demo/wheel/wheelApp.html http://www.ncbi.nlm.nih.gov/BLAST/ http://searchlauncher.bcm.tmc.edu/multi-align/multi-align.html http://ca.expasy.org/ http://www.ddbj.nig.ac.jp/E-mail/clustalw-e.html http://www.ualberta.ca/%7Estothard/javascript/rev_comp.html http://pbil.univ-lyon1.fr/alignment.html http://www.cbs.dtu.dk/databases/PhosphoBase/predict/predict.html http://www.ch.embnet.org/software/TCoffee.html http://www.ebi.ac.uk/clustalw/index.html http://www.ebi.ac.uk/services/ http://clustalw.genome.ad.jp/

branch occurs when trees are produced with a random input of the sequence files), and the drawing of phylogenetic trees. The trees can then be pasted into TreeView (http://taxonomy.zoology.gla.ac.uk/rod/treeview.html) in order to obtain phylogenetic trees that will indicate the amount of variation. 4. Notes 1. Phenol/chloroform extraction of target DNA often results in significant loss of target material. For this reason, we habitually do not use this method and just treat samples with proteinase K. To check that no significant carry-over of potential PCR inhibitors has occurred, all samples should also be tested by PCR for a “housekeeping” gene such as β-globin. 2. For all PCRs, it is recommended that “checkerboard” analyses (titrations of differing concentrations of different PCR components) be performed to optimize the PCRs by checking the optimal concentrations of primers, dNTPs, and magnesium ions. 3. There can be considerable variation in the efficacy of purportedly the same enzymes obtained from different suppliers; however, in our experience NEB, Ltd., produces highly active RE. Prior to any RFLP analyses of clinical samples, the activities of any RE should be determined by digesting a known section of DNA containing the appropriate RE cut sites.

References 1. zur Hausen, H. (2002) Papillomaviruses and cancer: from basic studies to clinical application. Nat. Rev. Cancer 2, 342–350. 2. zur Hausen, H. (2001) Oncogenic DNA viruses. Oncogene 20, 7820–7823. 3. Cavuslu, S., Goodlad, J., Connor, A., et al. (1997) Relationship between human papillomavirus infection and overexpression of p53 protein in cervical carcinomas and lymph node metastases. J. Med. Virol. 53, 111–117.

24

Cason, Bible, and Mant

4. IARC (1995) Epidemiology of infection. In, IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, Human Papillomaviruses, Lyon: International Agency for Research on Cancer, World Health Organisation, pp. 60–65. 5. Conrad-Stoppler, M., Ching, K., Stoppler, H., Clancy, K., Schlegel, R., and Icenogle, J. (1996) Natural variants of the human papillomavirus type 16 E6 protein differ in their abilities to alter keratinocyte differentiation and to induce p53 degradation. J. Virol. 70, 6987–6993. 6. Chan S-Y., Ho, L., Ong, C-K., et al. (1992) Molecular variants of human papillomavirus type 16 from four continents suggest ancient pandemic spread of the virus and its coevolution with mankind. J. Virol. 66, 2057–2066. 7. Fujinaga, Y., Okazawa, K., Nishikawa, A., et al. (1994) Sequence variation of human papillomavirus type 16 E7 in preinvasive and invasive cervical neoplasias. Virus Genes 9, 85–92. 8. Hecht, J. L., Kadish, A. S., Jiang, G., and Burk, R. D. (1995) Genetic characterization of the human papillomavirus (HPV) 18 E2 in clinical specimens suggests the presence of a subtype with decreased oncogenic potential. Int. J. Cancer 60, 369–376. 9. Londesborough, P., Ho, L., Terry, G., Cuzick, J., Wheeler, C., and Singer, A. (1996) Human papillomavirus genotype as a predictor of persistence and development of high-grade lesions in women with minor cervical abnormalities. Int. J. Cancer 69, 364–368. 10. Xi, L-F., Koutsky, L. A., Galloway, D. A., et al. (1997) Genomic variation of human papillomavirus type 16 and risk for high grade cervical intraepithelial neoplasia. J. Natl. Cancer Inst. 89, 796–802. 11. Zehbe, I., Wilander, E., Delius, H., and Tommasino, M. (1998) Human papillomavirus 16 E6 variants are more prevalent in cervical carcinoma than the prototype. Cancer Res. 58, 829–833. 12. Seedorf, K., Kraemmer, G., Duerst, M., Suhai, S., and Rowekamp, W. G. (1985) Human papillomavirus type 16 DNA sequence. Virology 145, 181–185. 13. Halbert, C. L. and Galloway, D. A. (1998) Identification of the E5 open reading frame of human papillomavirus type 16. J. Virol. 62, 1071–1075. 14. Cavuslu, S., Starkey, W. G., Kaye, J. N., et al. (1996) Detection of human papillomavirus type-16 (HPV-16) DNA utilising microtitre-plate based amplification reactions and a solid-phase enzyme-immunoassay detection system. J. Virol. Methods 58, 59–69. 15. Mant, C., Kell, B., Best, J. M., and Cason, J. (1997) Polymerase chain reaction protocols for the detection of DNA from mucosal human papillomavirus types 6,-11, -16, -18, -31 & -33. J. Virol. Methods 66, 169–178. 16. Bible, J. M., Mant, C., Best, J. M., et al. (2000) Cervical lesions are associated with human papillomavirus type 16 intratypic variants that have high transcriptional activity and increased usage of common mammalian codons. J Gen. Virol. 81, 1517–1527.

Identification of HPV Variants

25

17. Ellis, J. R. M., Keating, P. J., Baird, J., et al. (1995) The association of an HPV 16 oncogene variant with HLA B7 has implications for vaccine design in cervical cancer. Nat. Med. 1, 464–470. 18. Luxton, J., Mant, C., Greenwood, B., et al. (2000) HPV16 E6 oncogene variants in women with cervical intraepithelial neoplasia. J. Med. Virol. 60, 337–341.

Analysis of Cutaneous HPV-Associated Lesions

27

3 Histochemical Analysis of Cutaneous HPV-Associated Lesions Kiyofumi Egawa Summary Hematoxylin and eosin (H&E) staining of cutaneous warts is presented to illustrate the practical methods utilized for histochemical analysis of cutaneous human papillomavirus-associated lesions. Every step of the staining procedure, from sampling of the specimens to microscopic examination of the stained sections, is detailed with reference to the recent achievements in this field.

1. Introduction Histochemistry is a biological approach that permits a precise interpretation of the chemistry of cells and tissues in relation to structural organization. Hematoxylin and eosin (H&E) stain is the most widely used method in histochemical analysis (1–4) of cutaneous human papillomavirus (HPV)-associated lesions. Several important aspects of HPV cell biology and virology have been disclosed utilizing this method either alone or in combination with the other methods of immunohistochemistry, cell kinetics, or molecular cell biology. Two important aspects of the nature of this group of heterogeneous viruses are the way in which specific HPV genotypes are associated with distinct clinical and histological morphologies and the way specific HPV genotypes affect distinct anatomical sites. The former is best evidenced by the HPV-type specific cytopathic or cytopathogenic effect (CPE) (5–13), whereas the latter is suggested by the marked preference of each HPV genotype for specific tissues and sites (5–8). Recent studies have also suggested that specific HPV genotypes may target epithelial stem cells at specific anatomical sites (14–17). In this chapter, I illustrate the practical methods of H&E staining. These include the sampling of specimens, and their fixation, embedding, sectioning, From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

27

28

Egawa

staining, and microscopic examination. I have included references to recent achievements in HPV-associated cutaneous pathology to illustrate the methods. 2. Materials 1. 2. 3. 4.

5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.

16. 17. 18. 19. 20. 21.

Local anesthetics. Scalpel. Plastic containers of various sizes (Fig. 1A). Fixative solution: 10% neutral buffered formalin (pH 7.0), concentrated (40%) formaldehyde solution (100 mL), distilled water (900 mL), acid sodium phosphate (monohydrate) (4 g), anhydrous disodium phosphate (6.5 g). Xylene (100%). Ethanol (70%, 80%, 90%, 95%, 100%). Paraffin wax—e.g., Histosec (Merck Co.). Cassettes or molds of various sizes—e.g., Tissue-Tek Processing/Embedding Cassette (Sakura Finetek Co.) (Fig. 1A,B). Microtome. Glass microscope slides. Water bath. Hot plate. Staining basket—e.g., Matsunami Glass Ind. (Fig. 2). Staining vat—e.g., Matsunami Glass Ind. (Fig. 2). Carazzi hematoxylin (modified): hematoxylin crystals (1.5 g) in 10% alcohol (10 mL), aluminium potassium sulfate 12-hydrate (50 g) in distilled water (800 mL), sodium iodide (0.3 g), glycerol (200 mL), acetic acid (15 mL). 0.25% aqueous solution of hydrochloric acid. Alcoholic eosin solution: water-soluble eosin Y (5.0 g), distilled water (500 mL), 80% ethanol (1500 mL). Mounting medium—e.g., Malinol (Muto Pure Chemical Co.). Glass coverslips. Light microscope. Automatic processor—e.g., Vacuum Infiltration Processor (Sakura Finetek Co.) (optional).

3. Methods The methods described below outline (1) sampling of the specimens, (2) fixation, (3) embedding and sectioning, (4) hematoxylin and eosin stain, and (5) histopathological examination. Fig. 1. (opposite page) (A) Plastic containers (Co), cassettes (C) and molds (M), of different sizes. (B) A tissue specimen placed into a mold (M) holding the melted paraffin. Inset: A paraffin block mounted on a plastic cassette. (C) A cut paraffin section is floated on water and scooped up using a glass microscope slide. The section is allowed to stretch by placing it in warm water and is then mounted up again by being scooped up onto a glass microscope slide.

Analysis of Cutaneous HPV-Associated Lesions

29

30

Egawa

Fig. 2. Deparaffinization, rehydration, and staining. B: staining basket; V: staining vat containing xylene or graded ethanol; S: glass microscope slide; M: mounting medium in a glass bottle; C: glass cover slip.

3.1. Sampling of the Specimens In most instances, an incisional or excisional biopsy is taken from a welldeveloped typical lesion by scalpel or punch under local anesthesia. However, in research, consideration should be given to the selection of the lesions to obtain the specimens which are most appropriate for the aim of each study. In the presented case, a biopsy is taken from a very early lesion of a plantar wart to evaluate the histological localization of the initial changes of HPV infection in terms of its association with epidermal stem cells (16–19) (see Note 1). Tissues submitted for histology must not be more than 5 mm thick and not larger than the dimensions of the cassette used; otherwise, they will not be adequately fixed or infiltrated by paraffin.

3.2. Fixation 1. Following removal, place the biopsy specimen immediately into a container containing at least 10 volumes of fixative solution, ensuring that it completely surrounds the specimen on all sides (Fig. 1A). 2. Allow adequate time for fixation: the minimum period for a specimen 4 mm thick is 8 h (4). We usually carry out the fixation overnight at room temperature (see Note 2).

Analysis of Cutaneous HPV-Associated Lesions

31

3.3. Embedding and Sectioning 3.3.1. Dehydration, Clearing, and Infiltration 1. Remove the water from the tissue (dehydration) by immersing the formalin-fixed specimens into graded ethanol from 70% to absolute at room temperature: 70% (12 h), 80% (12 h), 90% (12 h), 95% (12 h), and 100% (12 h, three times). This is necessary because the water contained in the tissue is not miscible with paraffin. 2. Pass the tissue through two or three changes of xylene until all the alcohol is replaced by xylene (clearing): 100% (60 min, three times). 3. Place the tissue in melted paraffin at 60°C until all the xylene has been replaced by paraffin (infiltration).

These steps can be carried out by an automatic processor.

3.3.2. Embedding The current dermatopathology has been established on the morphologic descriptions of skin sections cut perpendicular to the skin surface (1–4) (Fig. 3 faces A,B). Place the tissue into a mold (Fig. 1A), holding the melted paraffin (Fig. 1B) in such a manner that the tissue will be cut perpendicular to the skin surface when it is mounted on a microtome (embedding) (see Note 3). In the case presented here, further attention is paid to the precise orientation for embedding; to allow examination of the initial histological changes associated with HPV infection in the shallow or deep epidermal ridges (16–19) (see Note 1 and Fig. 3, face A), the specimen is placed so that the cut will be perpendicular to the epidermal ridges. When the specimen is cut in parallel with ridges (Fig. 3, face B), it is impossible to evaluate such association (see Note 3).

3.3.3. Sectioning 1. After cooling for several minutes to an hour at room temperature (depending on the size), the hardened paraffin blocks are mounted onto a cassette (Fig. 1B) and placed into the microtome in such a manner that the edge of the knife does not hit the horny layer first (see Note 4). 2. Cut the tissue into 4-µm thick slices using a microtome (sectioning). 3. Float the cut paraffin sections on water at room temperature. Scoop it up onto a glass microscope slide, ensuring the section is smooth against the slide (Fig. 1C). Move the slide into warm water (approx 48°C); the section will float off; leave for a few seconds to stretch out and remove any creases. To mount up the section, scoop it up again onto the glass slide (Fig. 1C), and dry on a hotplate (approx 42°C) for 10 min or more to allow the section to adhere to the glass slide.

3.4. Hematoxylin and Eosin Stain In H&E staining, a specific chemical-identifying reaction is achieved utilizing hematoxylin as a basic dye and eosin as an acidic dye, to identify the chemi-

32

Egawa

Fig. 3. Nonlabeled: Drawing of the plantar skin tissue showing different faces to be cut corresponding to the aim of each examination: “A” represents the face cut perpendicular not only to the skin surface but also to the surface ridges and sulci; “B” represents the face cut perpendicular to the skin surface but in parallel with surface ridges; and “C” represents the face cut in parallel with the skin surface (horizontal section). (A–C): H&E-stained sections obtained from a minimal wart. A corresponds to Face A; B corresponds to Face B; and C corresponds to Face C of the drawing. Sections obtained from a central portion of the minimal wart, clearly demonstrate that the initial human papilloma virus-associated histological changes are restricted to the deep epidermal ridge in association with an eccrine duct (arrow) in A and C, whereas it is impossible to evaluate the initial histological changes in terms of its association with such epidermal architecture in B. R, surface ridges; S, sulci; W, a minimal wart; DR, deep ridges; SR, shallow ridges; ED, eccrine ducts; arrows, eccrine ducts.

cal substances contained in the cells or tissues. Hence, a cellular or tissue component that binds hematoxylin is described as being basophilc; conversely, a component that binds eosin is acidophilic or eosinophilic. After the nucleus is stained blue to purple with hematoxylin, as a result of its nucleic acid content, the cytoplasm is counterstained pink to red with eosin, mainly as a result of its structural proteins (1–4).

Analysis of Cutaneous HPV-Associated Lesions

33

3.4.1. Deparaffinization and Rehydration Before the sections can be stained, the paraffin permeating them has to be removed and replaced by water (Fig. 2). 1. Dip the sections adhering to glass slides first into xylene (10 min, two changes) to remove the paraffin and then into absolute ethanol to remove the xylene (5 min, two changes). 2. Then pass the sections through ethanol of decreasing strength and finally distilled water: 90% ethanol (five dips), 80% ethanol (five dips), 70% ethanol (five dips), and distilled water (a few minutes).

3.4.2. Staining Procedure 1. Stain with Carazzi hematoxylin (15 min); rinse in tap water (5 to 10 min). 2. Differentiate in 0.25% aqueous solution of hydrochloric acid (two to three dips); wash in running tap water (5 min). 3. Stain with eosin (15 s to 2 min, depending on the age of the eosin and the depth of counterstain desired). 4. Dehydrate: 70% alcohol (one dip), 80% alcohol (one dip), 90% alcohol (five dips), and absolute alcohol (five dips, three changes). 5. Clear in xylene (five dips, two changes, then until mounting), mount in medium, and cover with a cover slip.

3.5. Histopathological Examination The final and most important step of this method is the histopathological examination by light microscopy. In the examination, it is important to be familiar with not only the morphological and cell biological aspects of the normal human skin (3,4,19) but also HPV type-specific CPE (5–13) (Subheading 3.5.1.), on which every HPV-associated histopathological change should be analyzed.

3.5.1. HPV Type-Specific CPE HPV type-specific CPE is the central schema when we analyze and understand the cutaneous HPV-associated histopathology. The concept was first suggested by the characterization of distinct HPVs from different types of cutaneous warts (5–8,20,21): HPV 1 from deep plantar warts (myrmecia or inclusion warts), HPV 2 from common warts, and HPV 3 from flat warts. A characteristic histological feature of HPV 1 infection is intracytoplasmic inclusion bodies (ICB) appearing as eosinophilic granules (granular type of inclusion body: Gr-ICB) in most of the cells of the epidermis (Fig. 4A). The cells infected with HPV 2 are described as often vacuolated, containing condensed heterogeneous keratohyaline granules (Fig. 4B). Highly characteristic of HPV 3-induced warts is perinuclear clarification around small basophilic,

34

Egawa

Fig. 4. Cytopathic effects of human papilloma virus (HPV) 1 (A), HPV 2 (B), and HPV 3 (C). Arrows: granular inclusion bodies (A), vacuolated cells (B), and bird’seye cells (C); arrow + K: condensed keratohyaline granules (B).

sometimes pyknotic (pyknosis: shrinking of nuclei), usually centrally located nuclei and well-defined borders of the cells (so-called bird’s eye cells) (Fig. 4C). The CPE results from the derangement of terminal differentiation of keratinocytes infected by HPV (5,6). The importance of characterization of CPE is best evidenced in a group of novel inclusion warts (5–13).

3.5.2. Inclusion Warts For some time, the term inclusion wart has been used synonymously with myrmecia or HPV 1-induced warts (5–10,20,21). This is because the myrmecia was the first established clinical entity in which specific Gr-ICBs were identified (22) (Fig. 4A), and further characterized as HPV 1-induced inclusion bodies (5–10,20,21). However, careful clinicopathological examinations reveal that two novel types of inclusion warts exist (9,10)—punctate warts containing a heavily stained intracytoplasmic tonofibril-like substance within which there are filamentous structures (filamentous type of ICB: Fl-ICB) (9,10) (Fig. 5A) and pigmented warts containing an eosinophilic, homogeneous substance in each cell (homogeneous type of ICB: Hg-ICB) (9,10,13) (Fig. 5B,C,D). Similar Hg-ICBs are also identified in two other new types of skin lesions—i.e., the cystic papilloma (11) and the ridged wart (12). Cystic papilloma (or wart) is a new clinical entity, which includes HPV-associated epidermoid cysts (6,8,11) (see Note 5). These unusual CPEs, which have not previously been described, lead to the conclusion that the warts could be induced by novel types of HPV (9–11). Indeed three new types, HPV 60, 63, and 65, have been cloned from such

Analysis of Cutaneous HPV-Associated Lesions

35

Fig. 5. Filamentous type inclusion bodies (Fl-ICB) associated with human papillomavirus (HPV) 63 (A) and homogeneous type ICBs (Hg-ICBs) associated with HPV 4 (B), HPV 60 (C), and HPV 65 (D). Arrows: intracytoplasmic inclusion bodies.

lesions (9,23). The direct associations are currently observed among myrmecia, Gr-ICB, and HPV 1; among punctate warts, Fl-ICB and HPV 63; and among pigmented warts, Hg-ICB and the related types of HPV—HPV 4, 60, and 65 (6–10,13) (see Note 6). HPV 60 was originally identified in (11) and cloned (23) from HPV-associated epidermoid cysts with the Hg-ICB. One does not always get what one expects when staining (and often not what is already documented in the literature). For example, a punctate wart

36

Egawa

with Fl-ICBs may be expected to contain HPV 63 DNAs, considering the HPV-type specific CPE. However, in such a lesion, it may be found following molecular analysis that each single cell contains HPV 1 as well as HPV 63 (24) (see Note 7). In the case presented here, an eccrine-centered distribution of the initial CPE in the deep epidermal rete ridge was suggested from serial sections obtained from the entire biopsy specimen (16,17) (see Fig. 3). It has also been suggested from recent histopathological analyses using serial sections that the HPV-associated epidermoid cysts may develop from an eccrine duct by HPV infection (25,26). To produce reliable histopathological information, we recommend that histochemical analysis be utilized in combination with other methods such as immunohistochemistry, cell kinetics (27), or molecular cell biology, and that as many serial sections as possible be taken from each specimen (1,16,17,25,26,28). 4. Notes 1. Evidence has suggested that the epidermal stem cells exist in the bulge region of the hair follicle in hair-bearing skin, while they exist in the basal layer at the deepest point of the deep rete ridges in non-hair-bearing palmoplantar skin (16–19). Schmitt et al. (14) and Boxman et al. (15) propose the idea that HPVs may primarily target the epidermal stem cells in hair follicles in hair-bearing skin. In non-hairy palmoplantar skin, alternating ridges and sulci are present on the surface, with ridges and sulci corresponding histologically to the deep and shallow epidermal ridges, respectively. To address the question as to whether HPVs also target epidermal stem cells in the palmoplantar skin, a very early lesion is required whose size is small enough to estimate the correlation between the wart and ridges (16,17) (Fig. 3). 2. Tissues should not be frozen once they have been placed in the fixative solution, or a peculiar ice crystal distortion will result. In textbooks of histopathology, it is recommended that, during winter or in countries with cold weather, either 95% ethanol, 10% by volume, be added to the formalin solution or the specimen be allowed to stand in the formalin solution at room temperature for at least 6 h to prevent such artifacts (1–4). However, one should be aware that some CPEs might be lost from cells in fixatives that contain alcohol, resulting in figures of vacuolated cell-like, koilocytic, or signet ring cell-like appearance (Fig. 6). 3. This is not always the case in research. Although proper identification and orientation of the specimen is always important for the adequate histopathological evaluation of the lesion, specimens may also be cut with other deviations corresponding to the aim of each particular study. In addition, sometimes the histological sections deviate from the ordinary face A to B or C, even though this was not what was intended. 4. This opinion is the opposite of a current recommendation that specimens should be placed in such a manner that the edge of the knife hits the epidermis first. However, in wart specimens, it is actually quite common that an extremely

Analysis of Cutaneous HPV-Associated Lesions

37

Fig. 6. Hematoxylin and eosin (H&E)-stained sections obtained from human papillomavirus (HPV) 1-induced myrmecia show marked cell vacuolization-like artifacts instead of granular type inclusion bodies (Gr-ICB), when specimens are fixed in 80% ethanol. hypertrophied hard horny layer disturbs our smooth sectioning when the specimens are placed in such a manner. 5. We propose to call the HPV-associated epidermoid cysts “cystic papilloma” in humans (11). This is because we follow the suggestion of Rous and Beard, who gave the name cystic papilloma to the epidermoid cysts produced in rabbits by the Shope papillomavirus (29). We assume that the cystic papilloma of rabbits corresponds to the HPV-associated epidermoid cyst in humans (11). 6. The Gr-ICB is mainly composed of HPV 1 E4 proteins (30). The Hg-ICB is also associated with HPV 4 or HPV 65 E4 proteins (5,13). Although the exact role of the E4 proteins has not yet been determined, interference with normal intermedi-

38

Egawa

ate filament assembly has been proposed as a function (30). Indeed, HPV 16 E4 protein is involved in causing the collapse of the keratin cytoskeleton (31). The heterogeneity of ICBs, and their association with specific (or the related) types of HPV, will provide a useful model system for studying the interaction between keratinocytes and HPVs, especially in the functional aspect of E4 gene expression (9,10,13,24). In this aspect, it is interesting that the related types of HPV, HPV 4, HPV 60, and HPV 65 induce a very distinct CPE—i.e., Hg-ICB. 7. The double infection with HPV 1 and HPV 63 within a single cell is of special interest, because of its HPV 1-type CPE (6,8,24). This poses the very important problem of a possible interference between the viruses or a role of one virus in transactivation of the other viruses (6,8,24). We would emphasize that CPE is not a mere diagnostic marker for recognizing HPV type, but an important natural representation of the tight association between the genotype and phenotype. Any deviations from the basic association should suggest the underlying virus- or hostrelated factors that could influence CPE.

Acknowledgments I acknowledge Drs. Yumi Honda, Ethel-Michele de Villiers, Hidero Kitasato, John Doorbar, Tomas Iftner, and Harald zur Hausen for the excellent collaborations and fruitful discussions; Mrs. Chiemi Shiotsu for technical assistance; Dr. Clare Davy for helping in preparation of the manuscript; and Mrs. Motoe Egawa for encouragement. References 1. Ham, A. W. and Cormack, D. H. (1979) Histology, its place in the biological and medical sciences, and how it is studied. In: Histology, 8th ed, Ham, A. W. and Cormack, D. H. (eds.), J. B. Lippincott Company, Philadelphia, pp. 3–32. 2. Rosai, J. (1996) Gross techniques in surgical pathology. In: Ackerman’s Surgical Pathology 8th ed., vol. 1, Rosai, J. (ed.), Mosby–Year Book, Inc., St. Louis, MO, pp. 13–28. 3. Mehregan, A., Hashimoto, K., Mehregan, D., and Mehregan, D. (1995) Technical data, including pitfalls and artifacts. In: Pinkus’ Guide to Dermatopathology, 6th Ed., Mehregan, A., Hashimoto, K., Mehregan, D., Mehregan, D. (eds.), Appleton and Lange, East Norwalk, CT, pp. 49–68. 4. Lever, W. F. and Schaumburg-Lever, G. (1990) Laboratory methods. In: Histopathology of the Skin, 7th ed, Lever WF, Schaumburg-Lever G (eds.), J. B. Lippincott Company, Philaderphia, pp. 44–54. 5. Croissant, O., Breitburd, F., and Orth, G. (1985) Specificity of cytopathic effect of cutaneous human papillomaviruses. Clin. Dermatol. 3, 43–55. 6. Gross, G. E. and Jablonska, S. (1997) Skin warts: gross morphology and histology. In: Human Papillomavirus Infections in Dermatovenereology, Gross, G. E. and von Krogh, G. (eds.), CRC Press, Boca Raton, FL, pp. 243–258.

Analysis of Cutaneous HPV-Associated Lesions

39

7. Gross, G. E., Jablonska, S., and Huegel, H. (1997) Skin: diagnosis. In: Human Papilloma Virus Infection: A Clinical Atlas, Gross, G. E. and Barrasso, R. (eds.), Ullstein Mosby, Berlin, pp. 63–123. 8. Syrjaenen, K. and Syrjaenen, S. (2000) HPV infections of the skin. In: Papillomavirus Infections in Human Pathology, Syrjaenen, K. J. and Syrjaenen, S. M. (eds), John Wiley & Sons, Ltd., Chichester, UK, pp. 315–340. 9. Egawa, K., Delius, H., Matsukura, T., Kawashima, M., and de Villiers, E-M. (1993) Two novel types of human papillomavirus, HPV 63 and HPV 65: comparison of their clinical and histological features and DNA sequences to other HPV types. Virology 194, 789–799. 10. Egawa, K. (1994) New types of human papillomaviruses and intracytoplasmic inclusion bodies: a classification of inclusion warts according to clinical features, histology and associated HPV types. Br. J. Dermatol. 130, 158–166. 11. Egawa, K., Inaba, Y., Ono, T., and Arao, T. (1990) “Cystic papilloma” in humans?—demonstration of human papillomavirus in plantar epidermoid cysts. Arch. Dermatol. 126, 599–1603. 12. Honda, A., Iwasaki, T., Sata, T., Kawashima, M., Morishima, T., and Matsukura, T. (1994) Human papillomavirus type 60-associated plantar wart: ridged wart. Arch. Dermatol. 130, 1413–1417. 13. Egawa, K., Honda, Y., Inaba, Y., and Ono, T. (1998) Pigmented viral warts: a clinical and histopathological study including human papillomavirus typing. Br. J. Dermatol. 138, 381–389. 14. Schmitt, A., Rochat, A., Zeltner, R., et al. (1996) The primary target cells of the high-risk cottontail rabbit papillomavirus colocalize with hair follicle stem cells. J. Virol. 70, 1912–1922. 15. Boxman, I. L. A., Berkhout, R. J. M., Mulder, L. H. C., et al. (1997) Detection of human papillomavirus DNA in plucked hairs from renal transplant recipients and healthy volunteers. J. Invest. Dermatol. 108, 712–715. 16. Egawa, K. (2003) Do human papillomaviruses target epidermal stem cells? Dermatology 207, 251–254. 17. Egawa, K. (2005) Eccrine-centered distribution of HPV 63 infection in the epidermis of the plantar skin. Br. J. Dermatol. in press. 18. Lavker, R. M. and Sun, T.-T. (2000) Epidermal stem cells: properties, markers, and location. Proc. Natl. Acad. Sci. USA 97, 13,473–13,475. 19. Holbrook, K. A. and Wolff, K. (2001) The structure and development of skin. In: Dermatology in General Medicine, 5th ed., Fitzpatrick, T. B., Eisen, A. Z., Wolff, K., Freedberg, I. M., and Austen, K. F. (eds.), McGraw-Hill, Inc., New York, pp. 70–141. 20. Gross, G., Pfister, H., Hagedorn, M., and Gismann, L. (1982) Correlation between human papillomavirus (HPV) type and histology of warts. J Invest. Dermatol. 78, 160–164. 21. Jablonska, S., Orth, G., Obalek, S., and Croissant, O. (1985) Cutaneous warts. Clinical, histologic, and virologic correlations. Clin. Dermatol. 3, 71–82.

40

Egawa

22. Lyell, A. and Miles, J. A. R. (1951) The myrmecia. A study of inclusion bodies in warts. Br. Med. J. 28, 912–915. 23. Matsukura, T., Iwasaki, T., and Kawashima, M. (1992) Molecular cloning of a novel human papillomavirus (type 60) from a plantar epidermoid cyst with characteristic pathological changes. Virology 190, 561–564. 24. Egawa, K., Shibasaki, Y., and de Villiers, E.-M. (1993) Double infection with human papillomavirus 1 and human papillomavirus 63 in a single cell of a lesion displaying only an human papillomavirus 63-induced cytopathogenic effect. Lab. Invest. 69, 583–588. 25. Egawa, K., Honda, Y., Inaba, Y., Ono, T., and de Villiers, E.-M. (1995) Detection of human papillomaviruses and eccrine ducts in palmoplantar epidermoid cysts. Br. J. Dermatol. 132, 533–542. 26. Egawa, K., Egawa, N., and Honda, Y. (2005) Human papillomavirus-associated plantar epidermoid cyst resulting from an epidermoid metaplasia of eccrine duct epithelium: a combined histological, immunohistochemical, DNA-DNA in situ hybridization, and three-dimensional reconstruction analysis. Br. J. Dermatol. in press. 27. Egawa, K., Iftner, A., Doorbar, J., Honda, Y., and Iftner, T. (2000) Synthesis of viral DNA and late capsid protein L1 in parabasal spinous layers of naturally occurring benign warts infected with human papillomavirus type 1. Virology 268, 281–293. 28. Honda, Y., Egawa, K., Baba, Y., and Ono, T. (1996) Sweat duct milia–immunohistological analysis of structure and three-dimensional reconstruction. Arch. Dermatol. Res. 288, 133–139. 29. Rous, P. and Beard, J. W. (1935): The progression to carcinoma of virus-induced rabbit papillomas (Shope). J. Exp. Med. 62, 523–548. 30. Doorbar, J., Cambell, D., Grand, R. J. A., and Gallimore, P. H. (1986) Identification of the human papillomavirus-1a E4 gene products. EMBO J. 5, 355–362. 31. Doorbar, J., Ely, S., Sterling, J., Mclean, C., and Crawford, L. (1991) Specific interaction between HPV 16 E1-E4 and cytokeratins results in collapse of the epithelial cell intermediate filament network. Nature 352, 824–827.

Cervical Intraepithelial Neoplasia

41

4 Histological Analysis of Cervical Intraepithelial Neoplasia Michael Babawale, Rashmi Seth, Adam Christian, Wessam Al-Utayem, Ragini Narula, and David Jenkins Summary A wide interobserver variation is seen even among competent histopathologists in the routine diagnosis of cervical intraepithelial neoplasia (CIN). As a result, early detection of lowgrade CIN (CIN 1) lesions, in particular, remains a major challenge both in routine diagnosis and in cervical screening. In this chapter, the salient diagnostic features of human papillomavirus infection and CIN lesions are demonstrated.

1. Introduction Human papillomavirus (HPV) infection is now universally accepted as the most important risk factor for carcinoma of the cervix in women (1). There is poor reproducibility and variable diagnostic accuracy among histopathologists, largely because of failure to adhere to accepted diagnostic guidelines (2). These limitations have led to the search for more sensitive and specific biomarkers, such as p16INK4a, with the hope of improving the diagnostic accuracy of cervical intraepithelial neoplasia (CIN) lesions (3). However, routine hematoxylin and eosin (H&E) remains the gold standard of diagnosing HPV and CIN lesions in women. Hematoxylin is extracted from the tree Haematoxylin campechianum, now mainly cultivated in the West Indies. Hematoxylin itself is not a stain; it is its oxidation product, hematin, that is the natural dye. Hematin is usually combined with a mordant such as aluminum salts (cation) to improve its binding affinity to anionic tissue sites such as nuclear chromatin. Eosin is a xanthene dye with the ability to distinguish between the cytoplasm of different types of cells and connective tissue fibers. Eosin combines extremely well with hematoxylin and hence, it has become a universally acceptable stain in demonstrating the general histological architecture of tissue (4). From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

41

42

Babawale et al.

CIN is a widely accepted term describing a range of dysplastic changes occurring in the cervical epithelium. CIN1 corresponds to mild dysplasia, CIN2 to moderate dysplasia, and CIN3 to severe dysplasia or carcinoma in situ. The Bethesda classification, commonly used in the United States, groups cervical epithelial lesions into two categories. The first includes HPV lesions and CIN1, and is called low-grade squamous intraepithelial lesions (LGSIL). The second category, high-grade squamous intraepithelial lesions (HGSIL), includes CIN2 and CIN3. For high-risk HPV (HR-HPV), general consensus primers (GP5+/6+) are used to amplify the viral DNA from the biopsies. DNA is normally extracted and purified from tissue sections and amplified. The polymerase chain reaction (PCR) products can then be analyzed using enzyme-linked immunosorbent assay (ELISA) and a cocktail of HR-HPV probes as previously described (5). For HPV 16 genotyping, type-specific primers designed in the HPV 16 E7 region are used in conjunction with real-time PCR to obtain viral-load measurements. In this chapter, we demonstrate a method of using H&E staining in different grades of CIN compared to normal tissue, and then correlate the results with the presence of HR-HPV and HPV 16 E7 gene viral loads in the biopsy material using real-time quantitative PCR assay. 2. Materials 1. Harris’s hematoxylin, composed of 2.5 g hematoxylin, 25 mL absolute alcohol, 50 g potassium alum, and 1.25 g mercuric oxide in 500 mL distilled water. The hematoxylin is dissolved in the absolute alcohol and is then added to the alum that has previously been dissolved in the warm distilled water in a 2-L flask. The mixture is rapidly brought to the boil, and the mercuric oxide is then slowly and carefully added. The stain is rapidly cooled by plunging the flask into cold water or a container of ice blocks. 2. Eosin. 3. 1% acid alcohol (1 mL concentrated HCl + 700 mL ethanol + 300 mL deionized H2O). 4. Graded alcohol: 70%, 95%, and absolute (99.5%). 5. Xylene. 6. DPX (NUSTAIN, Nottingham, UK). 7. Glass slides. 8. Cover slips. 9. An optical microscope (Zeiss, W. Germany). 10. Real-time PCR instrument (Mx4000, Stratagene, UK). 11. GP5+ forward primer: 5' TTTGTTACTGTGGTAGATACTAC 3'. 12. GP5+ reverse primer: 5' GAAAAATAAACTGTAAATCATT 3'. 13. HPV 16E7 gene forward primer: 5' GATGAAATAGATGGTCCAGC 3'. 14. HPV 16E7 reverse primer: 5' GCTTCGGTTGTGCGTACAAAGC 3'.

Cervical Intraepithelial Neoplasia 15. 16. 17. 18. 19.

43

Betaglobin forward primer: 5' ACACAACTGTTCACTAGC 3'. Betaglobin reverse primer: 5' GAACCCAAGAGTCTTCTTCTCTCT 3'. DNA kit (DNA Easy Kit, Qiagen, UK). Standard HPV 16 DNA (Advanced Biotechnologies, Inc., UK). QuantiTect SYBR® Green PCR master mix kit (Qiagen).

3. Methods The methods described below outline (1) H&E staining techniques, (2) realtime quantitative PCR using consensus and HPV 16 type-specific primers, and (3) how to interpret the data obtained from the clinical biopsy specimen.

3.1. Hematoxylin and Eosin Staining (4) 1. Cut the tissue sections (5 µm) on glass slides, fix by keeping them on the hotplate for 15–20 min, and then dip in two consecutive changes of xylene to remove paraffin (see Note 1). 2. Rehydrate the tissue sections through downgraded alcohol to water prior to staining. First place in absolute (99.5%) ethanol (ethyl alcohol), second into 90% ethanol (and 10% water), and finally into 70% ethanol (and 30% water). 3. Dip the sections in Harris’s hematoxylin for 5–10 min. 4. Wash in running water for 5 min to remove the excess hematoxylin stain. 5. Differentiate in 1% acid alcohol for 5–10 s (see Note 2). 6. Wash again in running water for 2 min. 7. Counter-stain in 1% eosin for 5–10 min (see Note 3). 8. Wash in running water for 2 min to remove the excess eosin (see Note 4). 9. Dehydrate through upgraded alcohol and then xylene. Dip slides through ascending grades of ethanol, first in 70% ethanol (and 30% water), followed by 90% ethanol (and 10% water), then absolute (99.5%) ethanol, and finally xylene (see Note 5). 10. Clear in two changes of xylene. 11. Mount using DPX (see Note 6). 12. View and interpret the slides.

The above steps could be carried out manually or by automated staining machines.

3.2. HPV Detection and Typing Before the PCR can be set up, DNA extraction from the tissue sections needs to be performed using a Qiagen DNA extraction kit following the manufacturer’s instructions. 1. Suspend 30 µm sections after de-waxing (see Note 7) in 200 µL of ATL digestion buffer (from the DNA extraction kit). 2. Incubate the samples overnight at 56°C in the presence of proteinase K; vortex occasionally until the tissue is completely lysed. 3. Extract DNA using the mini-columns (all buffers and columns provided in the kit); pure DNA is eluted in AE buffer (provided in the kit).

44

Babawale et al.

Table 1 Summary of Representative 16/40 of Biopsies Used N

Number of cases

Histological grade

HR-HPV positivity

HPV -16E7 positivity

1

3

Normal

3/3

2/3

2

2

CIN1

2/2

1/2

3

4

CIN2

4/4

3/4

4

4

CIN3

4/4

2/4

5

3

Invasive Cancer

3/3

3/3

Viral load Very low (<10 pg) Low (10–50 pg) Medium (100–500 pg) High (1–10 ng) Very high (1–>10 ng)

HR-HPV, high-risk human papillomavirus; CIN, cervical intraepithelial neoplasia.

4. Set up PCR for housekeeping gene (betaglobin) to test for the presence of amplifiable DNA. PCR conditions are standard, using SYBR green master mix, and primers are added at 10 pmol per 25 µL reaction. Start PCR using 40 cycles of 58°C for 1 min and then 72°C for 30 s. 5. Samples positive for betaglobin (generating a 205-bp fragment when run on agarose gel) are then subjected to HPV PCR using consensus primers to obtain overall HR-HPV positivity. HPV 16 type-specific PCR is carried out using HPV 16 E7 type-specific primers (see Chapter 6). 6. All of the samples positive for HR-HPV (giving a 108-bp product) are then subjected to HPV 16 type-specific PCR using real-time quantitative PCR technique (see Note 8) and SYBR Green dye (see Note 9). 7. Positive controls are set up with increasing dilutions of standard HPV 16 DNA to give a calibration graph. Negative controls are always set up by substituting deionized water for the template. The HPV 16 E7 assay is sensitive (0.0001 ng/ tube) and specific for HPV 16 only, and there is no cross-reaction with any other HPV types when tested. Samples that are positive will also have viral load measurements (in ng/tube). 8. Interpret the H&E staining with grade of CIN and viral load measurements. Our results have shown that there is a significant positive correlation between CIN grade and HPV viral load (see Table 1).

3.3. Interpretation of Results Hematoxylin binds to anionic tissue sites such as nuclear chromatin and stains the nucleus blue-black. Eosin, on the other hand, stains the cell cytoplasm and connective tissues different shades of red and pink.

Cervical Intraepithelial Neoplasia

45

Fig. 1. (A) Hematoxylin and eosin staining showings normal ectocervical epithelium. Arrow shows the normal basket-weave pattern of keratinocytes in the surface epithelium. The keratinocytes have regularly shaped nuclei and show maturation from the basal layer up to the epithelial surface. Note that there is no nuclear pleomorphism in the basal layer of the epithelium, which is usually one or two cells thick . (B) Cervical intraepithelial neoplasia (CIN) 1 with human papillomarvirus (HPV) changes. The short arrow shows a multinucleated keratinocyte and the long arrow indicates a koilocyte, both of which are pathognomonic of HPV infection. Koilocytes are characterized by enlarged and hyperchromatic nuclei, which are wrinkled in outline with perinuclear halo. Nuclear pleomorphism is apparent in the basal third of the epithelium.

3.3.1. Normal Ectocervix The epithelium of the transformation zone of the cervix consists of stratified squamous epithelium with a single basal cell layer with small, darkly stained cuboidal cells. The keratinocytes have regular-shaped nuclei and show maturation from the basal layer up to the epithelial surface, where the cells become progressively flattened until they are shed from the surface (Fig. 1A).

3.3.2. HPV-Associated Changes Koilocytes are virus-infected epithelial cells with enlarged irregular nuclei surrounded by clear cytoplasm and are indicative of productive HPV infection. Koliocytic cells have enlarged, wrinkled nuclei surrounded by perinuclear halo (Fig. 1B). However, HPV infection can be present in the ectocervical epithelium in the absence of koilocytes. Multinucleated epithelial cells in association with parakeratosis are termed HPV-like features.

46

Babawale et al.

Fig. 2. (A) Cervical intraepithelial neoplasia (CIN) 2. Note that there is nuclear abnormality in the full whole thickness of the epithelium, which is more pronounced in the lower two-thirds of the epithelium (arrow). (B) Cervical intraepithelial neoplasia (CIN) 3. Note lack of maturation of the keratinocytes throughout the full thickness of the epithelium. Arrow points to an abnormal mitotic figure high up in the epithelium. Both nuclear and cytological atypia of the keratinocytes up to the surface of the epithelium are seen.

3.3.3. CIN 1 (LGSIL) The cells in the lower third of the epithelium are hyperchromatic, showing a mild degree of pleomorphism and increased mitotic activity. Keratinocyte maturation is still seen in the upper two-thirds of the epithelium, and HPVassociated changes may be present (Fig. 1B).

3.3.4. CIN 2 (HGSIL) When basal cell proliferation extends up to two-thirds of the epithelial thickness, CIN2 is diagnosed. Moderate pleomorphism and abnormal mitoses are seen up to the middle third of the epithelial thickness, while keratinocyte maturation is still seen in the upper third (Fig. 2A).

3.3.5. CIN 3 and Carcinoma In Situ (HGSIL) Atypical cells extend into the upper third of the epithelium. Mitotic figures are common and are seen throughout the epithelium. Little cytoplasmic maturation may be still seen in the upper third of the epithelium in CIN3. However, no cytoplasmic maturation is seen in carcinoma in situ cases (Fig. 2B).

3.3.6. Invasive Cancer When irregular clumps of squamous cells are seen invading the stroma of the cervix, the case is then diagnosed as invasive cervical squamous cell carcinoma (SCC). The cells also show some atypical features, such as nuclear pleo-

Cervical Intraepithelial Neoplasia

47

Fig. 3. Invasive cervical squamous cell carcinoma. Arrow indicates a squamoid nest that has invaded the cervical stroma.

morphism, hyperchromasia, increased nuclear-cytoplasmic ratio, and frequent abnormal mitoses (Fig. 3).

3.3.7. HPV Typing Result Typical results of an HPV typing experiment are shown in Table 1. The analysis of 40 samples showed that nearly all the cases were PCR positive for HR-HPV and for HR-HPV16/E7 gene (see Table 1, showing representative 16/40 samples). Both HR-HPV viral load and HR-HPV16 E7 gene proportionally increased with increasing grade of cervical pre-cancer, and a highly significant association (p = 0.000) was found between the two. 4. Notes 1. Tissue sections are embedded in paraffin wax, which has to be removed prior to an experimental procedure by dipping the sections in xylene. Tissue sections are then clipped in ethanol to remove the traces of xylene and also to allow gradual rehydration of the tissue sections. 2. Differentiation is performed by dipping slides in 1% acid alcohol followed by “blueing” in water to ensure optimal staining. 3. Eosin Y (eosin yellowish, eosin water soluble) C.I. No 45380 (C.I. Acid Red 87) is the most widely used eosin. As a cytoplasmic stain, it is usually used as a 0.5 or 1.0% solution in distilled water, with a crystal of thymol added to inhibit fugal growth.

48

Babawale et al.

4. Differentiation of the eosin, by dipping slides in water and by dehydrating slides through ascending grades of ethanol, ensures that adequate intensity of the stain is maintained. 5. Dehydration through ascending grades of ethanol, followed by xylene, ensures that all traces of water are removed from the tissue sections. 6. Mounting of slides is carried out using distyrene (a polysterene), a plasticizer (tricresyl phosphate), and xylene. This mixture is known as DPX and is used as a mounting medium by placing a drop of DPX on cover slip and inverting the stained slide over the cover slip. 7. During DNA extraction from fixed tissues, xylene is added to a 30-µm section to remove paraffin wax. Ethanol is then added to remove the traces of xylene. 8. QuantiTect SYBR Green PCR master mix kit (purchased from Qiagen). This kit contains all the components for a successful real-time PCR. It contains optimized amounts of Taq DNA polymerase, a reference dye called ROX, a reporter dye SYBR Green I, nucleotides (dNTPs), and buffer. Qiagen HotStar DNA polymerase (included in the kit) prevents the production of nonspecific products at room temperature. 9. SYBR Green I detects all double-stranded DNA, and it is critical to determine whether there are any primer-dimers or nonspecific products being generated in the PCR. These appear as small peaks around low temperature (about 60–70°C). Using dissociation curve analysis for these sets of primers, no primer-dimers were detected.

Acknowledgments The authors wish to thank Ms. Anne Kane for excellent photo-imaging assistance. References 1. Zur Hausen, H. (1996) Papillomavirus infections-a major cause of human cancers. Biochem. Biophys. Acta 1288, F55–F78. 2. Jenkins, D. (2001) Diagnosing human papillomaviruses: recent advances. Curr. Opin. Infect. Dis. 14, 53–62. 3. Klaes, R., Friedrich, T., Spitkovsky, R., et al. (2001) Overexpression of p16 as a specific marker for dysplastic and neoplastic epithelial cells of the cervix uteri. Int. J. Cancer 92, 276–284. 4. Bancroft, J. D. and Stevens, A. (1996) Theory and Practice of Histological Techniques, 4th ed, Churchill Livingston, London, 99–110. 5. Jacobs, M., Sniders, P. J. F., van den Brule, A. J. C., Helmerhorst, T., Meijers, C. J. M., and Walboomers, J. M. M. (1997) A general primer GP5+/GP6+ mediated PCR-enzyme immunoassay method for rapid detection of 14 high-risk and 6 lowrisk human papillomavirus genotypes in cervical scrapings. J. Clin. Microbiol. 35, 791–795.

Detection of Papillomavirus Proteins and DNA

49

5 Detection of Papillomavirus Proteins and DNA in Paraffin-Embedded Tissue Sections Woei Ling Peh and John Doorbar Summary The key events during the papillomavirus life cycle can be mapped in infected tissue samples by antibody detection and in situ hybridization. The ease of immuno-detection varies for different proteins and is dependent on antigen availability. Epitope exposure is sometimes necessary, because the antigen may become masked after formalin fixation and paraffin embedding of the infected tissue. Visualization of both nucleic acid and protein targets can be done simultaneously by combining in situ hybridization and immuno-detection methods.

1. Introduction The most direct way to visualize the life-cycle events of papillomaviruses in an infected tissue biopsy is by immunodetection and in situ hybridization. In order to detect target proteins and viral DNA in cells, specific antibodies and DNA probes must first be made. Immunodetection of viral proteins using specific antibodies allows mapping of the protein expression patterns and sequence of events as they occur during an infection. Although a good antibody is critical for immunodetection experiments, the preparation and fixation of the tissue sample are also important to get successful staining results. Recent improvements to immunodetection techniques and reagents have facilitated high-resolution studies of proteins in vivo in formalin-fixed tissues. Even some proteins that in the past were difficult to detect using antibodies, can now be detected following antigen-retrieval treatments and signal amplification. This chapter describes some of the techniques and reagents that are commonly used for immunodetection studies on formalin-fixed, paraffin-embedded tissue sections. In addition, detection of viral DNA by in situ hybridization, and an outline for doing double staining experiments (protein–protein or protein–DNA), are also described. From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

49

50

Peh and Doorbar

2. Materials 2.1. Immunodetection of Proteins 1. Xylene (BDH Laboratories Supplies). 2. Absolute ethanol. 3. Phosphate-buffered saline (PBS): 142 mM NaCl, 2.7 mM KCl, 4 mM Na2HPO4, 1.8 mM KH2PO4. Adjust pH to 7.2 with HCl. 4. Hydrogen peroxide: 3% hydrogen peroxide made up in PBS. 5. Antigen-retrieval buffer (10 mM citrate buffer, pH 6.0): approx 43 mL of 0.1 M sodium citrate solution, 7 mL of 0.1 M citric acid solution in 500 mL buffer. 6. Trypsin solution: 0.1% (w/v) trypsin, 0.1% (w/v) calcium chloride, 20 mM TrisHCl solution (pH 7.8). 7. Blocking solution: 10% (v/v) normal goat serum made up in PBS. 8. Wash buffer: 0.05% (v/v) Tween-20™ (Sigma-Aldrich Company, Ltd.) in PBS. 9. Tris-buffered saline (TBS): 142 mM NaCl, 2.7 mM KCl, 25 mM Tris-HCl. Adjust pH to 8 with HCl. 10. Specific antibodies against target proteins (see Note 1). 11. Fluorophore-labeled or enzyme-linked species-specific secondary antibodies. 12. 3',3'-Diaminobezidine tetrahydrochloride tablet (DAB; Sigma-Aldrich Company, Ltd.). 13. Sigma Fast™ Fast Red TR/Naphthol AS-MX Tablet Sets (Sigma-Aldrich Company, Ltd.). 14. Nuclei counterstains: 4', 6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich Company, Ltd.), used at 0.5 µg/mL, which gives a blue signal. Propidium iodide (Sigma-Aldrich Company, Ltd.) used at 0.5 µg/mL, which gives a red signal. 15. Cellular counterstain: Harris’s hematoxylin (BDH Laboratories Supplies), 0.5% glacial acetic acid/99.5% ethanol. 16. Mounting media: Citifluor (Agar Scientific, UK), DPX (BDH Laboratories Supplies). 17. Coverslips (BDH Laboratories Supplies). 18. Wilson jar or slide troughs and holders (Fisher Scientific). 19. Microwave. 20. Pressure cooker. 21. Humidified box. 22. ImmEdge pen (Vector Laboratories Incorporated, Burlingame, CA). 23. Microscope equipment, imaging instruments, and software for viewing and acquiring fluorescent images. 24. Light microscope.

2.2. Additional Materials for DNA Fluorescent In Situ Hybridization (FISH) 1. Proteinase K solution: 50 µg/mL proteinase K in PBS. 2. 20X SSC: 88.2 g tri-sodium citrate, 175.3 g NaCl per liter. Adjust pH to 7.8 with sodium hydroxide (see Note 2).

Detection of Papillomavirus Proteins and DNA

51

3. Hybridization buffer: 50% (v/v) deionized formamide, 1X Denhardt’s solution (Sigma-Aldrich Company, Ltd.), 5% (w/v) dextran sulphate, 200 µg/mL salmon sperm DNA, 4X SSC. 4. DIG-labeled DNA probes: Digoxigenin (DIG)-labeling kit (Roche Diagnostics), DNA template. 5. Anti-DIG horseradish peroxidase (HRP)-conjugated antibodies (Roche Diagnostics). 6. Formamide wash buffer: 50% (v/v) formamide, 2X SSC, 0.05% (v/v) Tween-20. 7. TE buffer: 10 mM Tris-HCl (pH 8.0), 1 mM ethylenediamine tetraacetic acid (EDTA). 8. Hot block.

2.3. Signal-Amplification Systems 1. ABC amplification: ABC Reagents (DAKO, Ltd.) and biotin-labeled speciesspecific secondary antibodies. 2. TSA™ (tyramide signal amplification) fluorescence systems (NEN Life Science Products, Inc.).

3. Methods This section describes the methods by which (1) viral proteins can be detected using specific antibodies, (2) viral DNA can be detected using DIGlabeled DNA probes by in situ hybridization, and (3) protein–protein or protein–DNA double stains can be carried out on the same tissue section. In addition, the use of signal-amplification systems to improve staining results is discussed.

3.1. Detection of Proteins in Paraffin-Embedded Tissue Sections The use of specific antibodies for the detection of papillomavirus proteins in infected tissue sections has been shown for E2, E4, E7, L1, and L2 proteins (1–5). However, the ability to detect and visualize these proteins in vivo varies considerably. In general, E4, L1, and L2 proteins can be readily detected using specific antibodies, whereas the detection of E2 and E7 requires additional antigen-retrieval steps and/or signal-amplification steps.

3.1.1. Preparation of Tissue Sections for Immunostaining 1. Prepare tissue sections (5 µm thickness; see Note 3) from paraffin-embedded tissue blocks (see Chapter 3) onto precoated microscope slides (see Note 4). 2. Deparaffinize and rehydrate the tissue sections: soak the slides twice in xylene (1 × 10 min, 1 × 5 min), twice in 100% ethanol (2 min each), followed by a series of graded ethanols (80%, 50%, 30%) for 2 min each, and finally distilled water (at least 5 min).

52

Peh and Doorbar

3.1.2. Antigen-Retrieval Treatments The two major ways in which epitopes may be retrieved are by (a) heat denaturation (microwave or pressure cooking) and (b) proteolytic treatment (see Note 5). 3.1.2.1. MICROWAVE TREATMENT 1. Place slides in a glass slide holder and presoak for 5 min in 500 mL of antigenretrieval buffer (see Note 6) in a 1-L plastic beaker (see Note 7). 2. Cook (at 650 W) for 12–15 min (3 × 5 min, with 1 min intervals), then cool for 15–20 min. 3. Wash in PBS for 5 min.

3.1.2.2. PRESSURE COOKING 1. Make up enough citrate buffer to fill one-quarter of the pressure cooker (the buffer level must be able to completely cover the slides in a slide holder). 2. Bring the buffer to a boil in the pressure cooker and carefully place the presoaked slides (5 min in antigen-retrieval buffer) into the boiling buffer. 3. Cook the slides at full pressure for 2–10 min (length of treatment should be optimized for each antigen). 4. Cool the cooker in a basin of cold tap water. (At this point, it is very important to wait until the pressure is completely released from the cooker before it is safe to open the lid.) 5. Leave the slides to cool for 20 min before washing in PBS for 5 min.

3.1.2.3. PROTEOLYTIC TREATMENT 1. Digest tissue sections with pre-warmed (37°C) trypsin solution for 30 s to 20 min (depending on the antigen and tissue) in a humidified box (see Note 8). 2. Wash the slides for 2 × 5 min in PBS.

3.1.3. Immunodetection 1. Circle the perimeter of the tissue section using an ImmEdge pen. 2. Block with 10% normal goat serum/PBS (see Note 9) at room temperature for 1 h in a humidified box. 3. Dilute the antigen-specific primary antibody in 5% normal goat serum/PBS, add the antibody onto the section, and incubate at room temperature for at least 1 h in a humidified box (see Note 10). 4. Wash the section for 3 × 5 min in wash buffer at room temperature with shaking. 5. Dilute the fluorophore-labeled species-specific secondary antibodies (see Note 11) in either PBS or in 5% normal goat serum/PBS. Add a nuclear counterstain to show the organization of the epidermis. 6. Incubate the tissue section with the secondary antibody and nuclear counterstain mix at room temperature for 30–60 min in a dark humidified box. 7. Wash the section for 3 × 5 min in wash buffer at room temperature with shaking.

Detection of Papillomavirus Proteins and DNA

53

Alternatively, enzyme-linked HRP or alkaline phosphatase [AP]) speciesspecific secondary antibodies (see Note 12) can be used in step 5. 1. For HRP antibodies, incubate the tissue section with 3% hydrogen peroxide at room temperature for 15 min to quench endogenous peroxidase activity. 2. Dilute the enzyme-linked species-specific secondary antibodies in either PBS or in 5% normal goat serum/PBS (see Note 13 for AP-linked antibodies). For fluorescence studies, add an appropriate nuclear counterstain at this step. 3. Incubate at room temperature for 30–60 min in a dark, humidified box. 4. Wash the section for 3 × 5 min in wash buffer at room temperature with shaking.

3.1.4. Visualization 3.1.4.1. IMMUNOFLUORESCENCE 1. Wash the section briefly in PBS and mount with Citifluor. 2. View results by fluorescent microscopy.

3.1.4.2. ENZYME-SUBSTRATE DETECTION 1. Prepare substrate solutions according to the manufacturer’s instructions. Substrates for HRP activity: tyramide-fluorophore (fluorescent) and DAB (nonfluorescent). Substrate for AP activity: Fast Red (see Note 13). 2. Add the substrate solution onto the section. 3. For tyramide-fluorophore substrates, incubate for 8–10 min, then wash in PBS for 5 min. Mount onto slides with citifluor. 4. For DAB and Fast Red substrates, monitor color development on the tissue section under a light microscope to prevent the accumulation of background staining. Stop the reaction by washing 2 × 5 min in distilled water. 5. Counterstain for nonfluorescent staining. Add a few drops of Harris’s hematoxylin to the section for approx 5 min. Wash gently in distilled water. Dip in glacial acetic acid/ethanol for 10 s. Wash in distilled water. Air-dry and mount with DPX.

3.2. Detection of Viral DNA Using DIG-Labeled DNA Probes This protocol is optimized for FISH, with the use of random-primed, DIGlabeled DNA probe, and visualized with a tyramide-fluorophore substrate.

3.2.1. Synthesis of DIG-Labeled Probes 1. Linearize the viral genome DNA by enzyme digestion, gel purify, and use this as template for making the DIG-labeled DNA probe. 2. Prepare the labeling reaction using the DIG-labeling kit according to the manufacturer’s instructions. 3. Incubate the reaction in a 37°C water bath overnight. 4. Purify the DIG-labeled probe according to the manufacturer’s instructions and store it at –20°C. (Optional: labeling efficiency may be tested by dot-blotting.)

54

Peh and Doorbar

3.2.2. In Situ Hybridization 1. Deparaffinize and rehydrate the tissue sections as described under Subheading 3.1.1. 2. Incubate the tissue section in 3% hydrogen peroxide for 15 min at room temperature (see Subheading 3.1.3.). 3. Wash the section for 5 min in PBS. 4. Digest the section with a freshly made-up proteinase K (50 µg/mL) solution for 20 min at 37°C in a humidified box. 5. Wash the section for 2 × 5 min in PBS, then allow to air-dry. 6. Dilute the DIG-labeled DNA probe (1:25) in hybridization buffer. 7. Add 10–50 µL of the diluted probe mix (depending on the size of the tissue section) to the tissue section. 8. Carefully lower a coverslip onto the tissue section, and ensure that no air bubbles are trapped under the coverslip, and the entire tissue section is covered with the probe mix. 9. Heat the section on a hot block at 95°C for 5 min, then cool on ice for at least 1 min. 10. Incubate the section overnight at 37°C in a humidified box.

3.2.3. Detection and Visualization 1. Loosen the coverslip by shaking the slide in 0.5X SSC. 2. Wash the section with prewarmed (42°C) solutions—formamide wash buffer for 2 × 5 min, then 2X SSC for 2 × 5 min. 3. Block with 10% normal goat serum/PBS for 1 h at room temperature in a humidified box. 4. Prepare HRP-conjugated anti-DIG antibodies and a nuclear counterstain in 5% normal goat serum/PBS. Incubate for 1 h at room temperature in a dark humidified box. 5. Wash the section for 3 × 5 min in wash buffer. 6. Prepare and use the tyramide-fluorophore substrate solution (see Subheading 3.1.4.) for the detection of HRP activity.

3.3. Protein–Protein or Protein–DNA Double Detection in a Tissue Section To perform co-localization studies (protein–protein or protein–DNA) on the same tissue section by immuno-fluorescence techniques, several factors have to be considered beforehand (see Note 14).

3.3.1. Immunodetection of Different Proteins 1. Prepare tissue section for immunodetection as described under Subheadings 3.1.1. and 3.1.2. 2. Block the section with 10% normal goat serum/PBS at room temperature for 1 h in a humidified box. 3. Dilute the two primary antibodies in 5% normal goat serum/PBS and add this onto the section for at least 1 h in a humidified box (see Note 10).

Detection of Papillomavirus Proteins and DNA

55

4. Wash the section for 3 × 5 min in wash buffer at room temperature with shaking. 5. Dilute fluorophore-labeled species-specific secondary antibodies in either PBS or in 5% normal goat serum/PBS. Add a nuclear counterstain to show the organization of the epidermis. 6. Incubate the section with the secondary antibody and nuclear counterstain mix at room temperature for 30–60 min in a dark humidified box. 7. Wash the section for 3 × 5 min in wash buffer at room temperature with shaking.

3.3.2. Combining FISH and Immunodetection 1. Prepare the tissue section for immunodetection as described under Subheadings 3.1.1. and 3.1.2. (see Note 15). 2. Process the section for ISH and hybridize at 37°C overnight as described under Subheading 3.2.2. 3. Loosen the coverslip by shaking the slide in 0.5X SSC. 4. Wash the section with prewarmed (42°C) solutions—formamide wash buffer (2 × 5 min), then 2X SSC (2 × 5min). 5. Block the section in 10% normal goat serum/PBS with blocking buffer for 1 h at room temperature in a humidified box. 6. Add the primary antibody mix onto the section for protein detection as described under Subheading 3.1.3. 7. Wash the section for 3 × 5 min in wash buffer. 8. Prepare a mixture containing the HRP-conjugated anti-DIG antibodies, a fluorophore-labeled, species-specific antibody (which recognizes the primary target antibody), and a nuclear counterstain in 5% normal goat serum/PBS. Add onto the section and incubate for 1 h at room temperature in a dark humidified box. 9. Wash the section for 3 × 5 min in wash buffer. 10. Prepare and use the tyramide-fluorophore substrate solution (see Subheading 3.1.4.) for the detection of HRP activity.

3.4. Signal-Amplification Systems Signal-amplification systems can significantly improve immunostaining results that are weak or difficult to obtain as a result of low antibody affinity or low protein expression levels (see Note 16).

3.4.1. ABC Reagents 1. Following primary antibody binding, detect the primary antibody with a biotinlinked, species-specific secondary antibody. Incubate the section with the biotinylated antibody at room temperature for 30–60 min in a humidified box. 2. Prepare the StreptABComplex/enzyme mixture according to the manufacturer’s instructions. 3. Wash the section for 3 × 5 min in wash buffer (see Note 10). 4. Add the StreptABComplex mixture onto the tissue section and incubate for 30 min at room temperature.

56

Peh and Doorbar

5. Wash the section for 3 × 5 min in wash buffer. 6. Prepare the appropriate substrate solutions for the detection of HRP or AP activities.

3.4.2. TSA Fluorescence Systems 1. Prepare the substrate according to the manufacturer’s instructions. 2. Add the substrate onto the tissue section and incubate for 8–10 min in a dark, humidified box. 3. Wash the section in PBS for 5 min. 4. Mount with citifluor.

4. Notes 1. Primary antibody binding affinity and specificity to the target antigen should be tested on Western blots and enzyme-linked immunosorbent assay (ELISA) prior to use on tissue sections. For some antibodies, antigen recognition on Western blots and ELISA does not guarantee antigen detection on tissue sections. Optimal dilutions for each antibody must be individually tested. This is particularly important for polyclonal antisera generated in animals, as some antibodies may be best used at 1:40 while others give clean staining only when used at 1:6000. A good working dilution to start with for polyclonal antibody is 1:250. Monoclonal antibody is usually used at a more dilute concentration (for example, 1:1000), while hybridoma supernatant is used at a higher concentration (for example, 1:100 or less). 2. A stock solution of 20X SSC can be made up, autoclaved, and stored at room temperature. Once made up, the hybridization buffer may be stored at –20°C for at least 3 mo. 3. When preparing tissue sections onto slides, it is useful to label each section in a serial order as they are being cut. If different staining experiments are carried out on sequentially cut tissue sections, the expression pattern of viral/host proteins (detected by immunostaining) in a particular region of interest (for instance an area where the late stage of the papillomavirus life cycle is supported) may be compared. Although comparison of different staining patterns can be done on adjacent sections, this method cannot be used for co-localization studies of different proteins. 4. Different kinds of coated microscope slides for the preparation of tissue sections are commercially available today. We have found that charge-coated slides (BDH Laboratories Supplies) are superior to poly-lysine-coated slides in withstanding harsh antigen exposure treatments. It is also useful to incubate the tissue sections at 37°C overnight prior to immunodetection, as this seems to reduce the chance of tissue detachment during staining experiments. 5. This step is optional and can be performed to expose antigen epitopes that may be masked by formalin fixation (6,7). Antigen retrieval before antibody detection is necessary for some proteins, but not for others. Combination of heat denaturation and proteolytic treatment is also used for some proteins, such as HPV-11 E1^E4

Detection of Papillomavirus Proteins and DNA

6.

7.

8. 9.

10.

11.

12.

57

(8,9). Heat denaturation is usually carried out first, followed by proteolytic digestion (10). The antigen-retrieval buffer may be modified for different antigens. Other buffers frequently used in our laboratory include 10 mM citric acid buffer (4) and 10 mM citrate buffer containing 1 mM EDTA (pH 8.0) (9). Antigen-retrieval buffers of higher pH (8.0–9.9), are recommended by some researchers and claimed to improve staining of some proteins (10,11). The beaker should be covered with paper towels to prevent excessive buffer loss during the microwave process. Paper towels should be secured with tape and perforated to allow gaseous escape. It is also useful to note the level of buffer in the beaker before the microwave treatment, as the buffer level is topped up during the cooling step. In our hands, trypsin digestion of approx 1–2 min is usually sufficient. It is crucial not to over-digest the section to prevent tissue damage and/or loss of epitope. 10% fetal bovine serum (not fetal calf serum, as this contains higher amounts of immunoglobulin [Ig]G), 3% bovine serum albumin, and 10% nonfat dry milk are also commonly used as blocking solutions for tissue staining (12). The optimal length and temperature of antibody binding may vary for different antibodies. Lower temperatures (such as 4°C) are preferred in some cases, as high temperatures may cause the loss of some epitopes (11). However, we have observed that some antibodies produced much cleaner staining results when used at 37°C instead of room temperature or 4°C. Sensitivity of detection may be increased with longer or overnight incubations. Fluorophore-labeled secondary antibodies are useful for doing high-resolution studies, but the main disadvantage is signal fading with increasing excitation radiation exposure (photo-bleaching), as well as with increasing time. The most commonly used fluorophores are fluorescein, fluorescein isothiocyanate (FITC), rhodamine, and Texas red. Antibodies labeled with these fluorophores are widely available commercially. However, we have found that the Alexa fluor dye series (Molecular Probes, Inc.) are superior to these traditional fluorophores. As the manufacturer has claimed, we find that the Alexa fluor dyes are more photostable and produce a more intense fluorescence signal. When working with fluorophores, it is advisable to perform antibody incubations in the dark and reduce the excitation radiation exposure time to minimize photo-bleaching. Fluorescent stained and mounted sections may be stored at 4°C for several months. Enzyme-based detection methods are versatile for protein localization studies in cells, since different fluorescent and non-fluorescent substrates are now widely available for the enzymes. Colored fluorophores have been developed for HRP activity, and we have found the tyramide-based fluorophores (see Subheading 3.4.2.) are reliable in producing relatively clean staining results. On the other hand, non-fluorescent substrates such as DAB (for HRP activity) and Fast Red (for AP activity) are also commonly used for immuno-histochemistry. Nonfluorescent substrates are cheap, and ideal for producing permanent results that can be stored for record keeping. In addition, special microscope equipment

58

13.

14.

15. 16.

Peh and Doorbar and imaging instruments and software are not required for viewing nonfluorescent staining. It should be noted that all phosphate-based buffers (for antibody dilution and washing) should be replaced with Tris-based buffers (TBS) when using AP. Fast Red can be used as a fluorescent substrate for AP, and can be viewed under a fluorescent microscope using a Texas Red (or equivalent) microscope filter. However, it is not advisable to use Fast Red as a fluorescent substrate in double immuno-staining experiments, as it is an opaque substrate and can cause masking of other fluorophores in co-localization studies. Antibody selection. When performing double immunostaining experiments, it is important to ensure that the origins of both primary antibodies are derived from distantly related animal species—for example, rabbit and mouse. The use of primary antibodies from closely related animal species, such as rat and mouse, is not recommended for co-localization studies, although this is not impossible. In this case, staining of the individual proteins can be done on adjacent tissue sections so that the separate staining patterns within a specific region of the tissue may be compared and used to verify the double immunostain results. This will help to rule out the possibility of cross-reactivity of the secondary antibodies that may contribute to false-positive staining results in double immunostained sections. Alternatively, the use of direct fluorophore-conjugated primary antibodies eliminates the possibility of secondary antibody cross-reactivity. Otherwise, biotin- or DIG-labeled primary antibodies may also be useful in multiple protein immunostain experiments. Instead of species-specific antibodies, streptavidin conjugates or anti-DIG antibodies may be used. Microscopy. Fluorescent microscopy is an area where potential false-positive results may arise. False-positive results may be obtained when bleed-through from the microscope color filters occurs. For example, red fluorescence may be seen through a green filter at the green fluorescence wavelength setting, even though the red fluorescence should not be excited at that specific wavelength. Color filter bleed-through can be avoided by using a color filter with a narrow spectrum range that is optimally designed for your choice of fluorophore. Another common contributor to color bleed-through in multiple-color fluorescence studies is any particular fluorescent color being too bright (signal saturation). This can be prevented by optimizing the concentration of the primary and secondary antibodies. We have found that antigen retrieval is sometimes not necessary for certain antigens when the tissue section is prepared for ISH. Signal amplification systems: The ABC reagents work by amplifying the signal of one biotin-labeled secondary antibody into a large multimeric enzyme complex (StreptABComplex/enzyme) that can be detected by appropriate enzyme substrates. The TSA fluorescence systems are available in five different tyramidefluorophore substrates (fluorescein, tetramethyl-rhodamine, coumarin, cyanine 3, and cyanine 5) for the detection of HRP activity in tissue sections or cells. The tyramide-fluorophore substrates can be used in indirect immunodetection of pro-

Detection of Papillomavirus Proteins and DNA

59

teins (see Subheading 3.1.3.), or in conjunction with ABC reagents (see Subheading 3.4.1.). We have found that tyramide fluorophores are particularly valuable in enhancing fluorescent signals with minimal loss in resolution.

References 1. Maitland, N. J., Conway, S., Wilkinson, N. S., et al. (1998) Expression patterns of the human papillomavirus type 16 transcription factor E2 in low- and high-grade cervical intraepithelial neoplasia. J. Pathol. 186(3), 275–280. 2. Penrose, K. J. and McBride, A. A. (2000) Proteasome-mediated degradation of the papillomavirus E2-TA protein is regulated by phosphorylation and can modulate viral genome copy number. J. Virol. 74(13), 6031–6038. 3. Du, J., Chen, G. G., Vlantis, A. C., et al. (2003) The nuclear localization of NFkappaB and p53 is positively correlated with HPV16 E7 level in laryngeal squamous cell carcinoma. J. Histochem. Cytochem. 51(4), 533–539. 4. Middleton, K., Peh, W., Southern, S., et al. (2003) Organization of human papillomavirus productive cycle during neoplastic progression provides a basis for selection of diagnostic markers. J. Virol. 77(19), 10,186–10,201. 5. Doorbar, J., Foo, C., Coleman, N., et al. (1997) Characterization of events during the late stages of HPV16 infection in vivo using high-affinity synthetic Fabs to E4. Virology 238(1), 40–52. 6. Shi, S. R., Key, M. E., and Kalra, K. L. (1991) Antigen retrieval in formalinfixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J. Histochem. Cytochem. 39(6), 741–748. 7. Cattoretti, G., Becker, M. H., Key, G., et al. (1993) Antigen unmasking on formalin-fixed, paraffin-embedded tissue sections. J. Pathol. 171(2), 83–98. 8. Bryan, J. T. and Brown, D. R. (2000) Association of the human papillomavirus type 11 E1()E4 protein with cornified cell envelopes derived from infected genital epithelium. Virology 277(2), 262–269. 9. Peh, W. L., Middleton, K., Christensen, N., et al. (2002) Life cycle heterogeneity in animal models of human papillomavirus-associated disease. J. Virol. 76(20), 10,401–10,416. 10. Grafisk, K. (1997) A Guide to Demasking of Antigen on Formalin-Fixed, Paraffin-Embedded Tissue 2nd ed. DAKO, Copenhagen, Denmark. 11. Harlow, E. and Lane, D. (1999) Using Antibodies, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 12. Harlow, E. and Lane, D. (1998) Antibodies, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

HPV Gene Expression Using Real-Time PCR

61

6 Detection and Quantitation of HPV Gene Expression Using Real-Time PCR Rashmi Seth, John Rippin, Li Guo, and David Jenkins Summary Human papillomaviruses (HPVs) are known to be etiological agents of cervical cancer and have been found in 99.7% of women with high-grade (HG) cervical intraepithelial neoplasia (CIN) precancer. Testing of high-risk HPV (HR-HPV) has been proposed as a way of improving cervical screening, especially for women with low-grade (LG) Papanicolaou (Pap) smears. In this chapter, real-time quantitative polymerase chain reaction (PCR) methods that can be used to investigate the expression of HPV 16 early genes in HG or LG precancer are demonstrated. Detecting the expression of early HPV genes in conjunction with the Pap smear may improve the specificity of identifying LG precancers that are associated with high risk of progression.

1. Introduction High-risk human papillomaviruses (HPVs) are associated with cervical intraepithelial neoplasia (CIN) and cervical carcinoma, and HPV DNA has been found to be present in more than 99.7% of these cancers (1). The highrisk group so far includes HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 54, 56, 58, 59, 66, 68, 70, and 72. The infecting HPV type, the viral load, and the integration state of the HPV genome are known to have profound implications for patient prognosis (2–4). In countries such as the United Kingdom and the United States, national cervical screening programs have reduced the incidence of cervical cancer (5). However, 50% of invasive cervical cancers arise in women screened with existing cytological methodologies (6). HPV detection and typing techniques have been proposed as an adjunct to, or a replacement for, the current cytological screening regime, and the success of such strategies will depend on the development of rapid, sensitive, and specific HPV detection methods applicable in the clinical setting. From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

61

62

Seth et al.

Many approaches to the detection and typing of HPV are available, all of which have advantages and disadvantages, and have been reviewed elsewhere (7). Various polymerase chain reaction (PCR)-based tests have been developed to detect HPV DNA using primers that amplify a region of the major viral capsid L1 gene that is highly conserved. They include the consensus primers MY09/MY11 (8), PGMY09/11 (9), and GP5+/GP6+ (10). All assays require post-PCR processing to identify positivity and individual genotypes. For individual genotyping, a pool of type-specific primers for use in PCR have been developed, followed by reverse line blot techniques or Southern blotting (11–13). With the availability of quantitative real-time PCR instruments and different chemistries, new assays for HPV have already been reported. Swan and others used Taqman probes to detect and quantitate HPV genotypes (14). Others include using self-probing amplicons known as Scorpions (15). Molecular beacon-labeled primers (16) have also been developed and used by Jordens and others (17) to detect and genotype HPV. The main disadvantages of these techniques are the cost of synthesis of dye-labeled primers and probes, and unavailability of a continuous and reliable supply. The “gold standard” for HPV genotyping is sequencing, in which HPV DNA is amplified and the product is sequenced. Although this technique gives the most conclusive genotype information, it is also the most labor-intensive and costly. There is a need for a rapid, cost-effective test that can distinguish between the different HPV genotypes on the basis of their nucleotide sequences, and two such methods have been reported using real-time PCR technique (18,19). This approach combines PCR amplification with post-PCR amplicon meltcurve analysis, and it involves using the fluorogenic dye SYBR® Green I. Viral load in each sample can be quantified and the HPV genotype interrogated by a post-PCR melt-curve analysis. Our studies as well as those of others have shown that HPV 16 is the most frequently detected genotype. In this chapter we demonstrate a method for the detection and analysis of the HPV 16 early genes E2, E4, and E6 in RNA swabs from clinical specimens using quantitative real-time PCR and SYBR Green I dye. 2. Materials 1. 2. 3. 4.

Real-time PCR instrument (Mx4000, Stratagene, UK). Primers synthesized by UK-OSWEL, UK. cDNA from clinical specimens. QuantiTect SYBR Green Master Mix (Qiagen, UK). The kit contains a vial of master mix, which is a premixed solution containing HotStarTaq DNA polymerase, PCR buffer, dNTPs, SYBR Green I dye, a reference dye ROX, and a vial of PCR-grade water.

HPV Gene Expression Using Real-Time PCR

63

Table 1 Summary of Primer Sequences for Human Papillomavirus (HIV) 16 E-Genes and Corresponding PCR Product Size PCR type

Sequence

Site in HPV genome

Product

HPV16 E2

Forward 5'-gccaacactggctgtatcaa-3' Reverse 5'-catcctgttggtgcagttaaa-3' Forward 5'-tccaatgccatgtagacgac-3' Reverse 5'-gctcacacaaaggacggatt-3' Forward 5'-gcataaatcccgaaaagcaa-3' Reverse 5'-agcgacccagaaagttacca-3'

2932–2951 3061–3081 3700–3719 3573–3592 287–306 123–142

149 bp

HPV16 E4 HPV16 E6

146 bp 134 bp

5. Standard HPV 16 viral DNA control, 50 ng/µL (purchased from Advanced Biotechnologies Inc. UK). This DNA is purified from CaSki cells, which are reported to contain approx 600 copies of integrated HPV-16 DNA per cell.

3. Methods The methods described below outline (1) primer pair design for HPV 16 genes E2, E4, and E6, (2) optimization of primers for use in real-time PCRs, and (3) how to interpret the data obtained from clinical specimens.

3.1. Designs and Development of Primers Primers can be designed in-house, using the Web-based primer design program Primer 3, available on the Internet. (http://www-genome.wi.mit.edu/cgibin/primer/primer3_www.cgi). The software allows the lengths of the primers and annealing temperatures for the PCR to be customized and also gives the size of the target PCR product. Primer sequences once identified can then be synthesized commercially (see Note 1). In Table 1, the nucleotide sequences are listed, together with the expected product size and the position in the HPV 16 genome.

3.2. HPV 16 E-Gene Real-Time PCRs Before commencing any real-time PCRs using SYBR Green I, it is vital to optimize the primer concentrations and thermal cycling conditions to eliminate nonspecific product formation. Once these have been determined, the assays can be validated in terms of analytical specificity and sensitivity before applying them.

3.2.1. Optimization of Primers We use a kit (QuantiTect SYBR Green PCR master mix) for real time PCRs (see Notes 2 and 3). Each PCR uses a single set of primers in a single reaction

64

Seth et al.

Fig. 1. An example of a thermal profile for human papillomavirus (HPV) 16 E4 gene polymerase chain reaction.

mixture. A checkerboard experiment (not shown) is set up with varying forward primer dilutions across the horizontal axis and the reverse primer dilutions along the vertical axis (varying from 0.1 pmol to 500 pmol/tube in 1 µL volume). The following protocol is used. 1. 12.5 µL of master mix (provided in the kit) is added to each tube. 2. Add 1 µL of each primer at varying dilutions. 3. DNA template (2 µL HPV16 DNA, 2 ng/tube) is added next to all the tubes except those that are to be kept as negative controls. 4. Finally, 8.5 µL of RNAse-free, PCR-grade water (provided in the kit) is added to obtain a final volume of 25 µL in each tube. 5. Perform forty cycles of PCR amplification using a general thermal profile shown in Fig. 1. 6. Interpretation of results (see Note 4).

Ct (cycle threshold) values for each dilution are computed from the amplification plots using the built-in software, and are shown in Table 2. The final primer dilutions for E2 gene PCR were determined as 35 pmol for both forward and reverse primer. For the E4 and E6 gene PCRs, the primer dilutions were set at 25 pmol for both forward and reverse primers.

Table Gene 2 HPV Expression Using Real-Time PCR Cycle Threshold (Ct) Values for Each Primer Combination for E2, E4, and E6 HPV 16 Assays Primers

65

Forward primer concentration

Reverse primer concentration

䉴

100 pmol, 100 pmol E2 Ct = 15.86 E4 Ct = 13.60 E6 Ct = 13.52

100 pmol 35 pmol E2 Ct = 16.22 E4 Ct = 13.39 E6 Ct = 13.55

100 pmol, 25 pmol E2 Ct = 17.39 E4 Ct = 13.68 E6 Ct = 14.17

35 pmol, 100 pmol E2 Ct = 16.40 E4 Ct = 14.21 E6 Ct = 13.38

35 pmol, 35 pmol E2 Ct = 16.70 E4 Ct = 13.77 E6 Ct = 14.02

35 pmol, 25 pmol E2 Ct = 17.51 E4 Ct = 14.15 E6 Ct = 14.63

25 pmol, 100 pmol E2 Ct = 17.31 E4 Ct = 14.18 E6 Ct = 13.61

25 pmol, 35 pmol E2 Ct = 18.01 E4 Ct = 14.20 E6 Ct = 14.51

25 pmol, 25 pmol E2 Ct = 19.51 E4 Ct = 14.40 E6 Ct = 15.26

3.2.2. Optimizing Annealing Temperature (Thermal Profiles) The best annealing temperatures for real-time PCRs should be investigated (see Note 5). The following protocol can be used to optimize the annealing temperature for any real-time PCR. 1. Set up master mixes for each PCR as previously, but using the optimized primer concentrations (for E2 gene, 35 pmol; for E4 and E6, 25 pmol) and HPV16 DNA standard (2 ng/tube). 2. Set up tubes containing cloned HPV types (HPV 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 56, 58, 59, 66, and 68) at approx 100 pg/tube to identify the effect of each temperature on primer binding specificity. 3. Different annealing temperatures (61, 59, 54, and 52°C) must be tested (see Note 5). For HPV16 E2, the best annealing temperature was found to be 54°C, whereas for HPV E4 and E6 it was 59°C.

3.2.3. Specificity (Cross-Reactivity) Analysis Once the optimal thermal profile has been identified, the specificity of each gene assay must be investigated by setting up cross-reactivity studies. We use DNA of known HPV types (6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 66, and 68) (see Note 6) at concentrations of 100 pg/tube. 1. Set the PCRs up as before in a final volume of 25 µL per tube, which contains 12.5 µL of the QuantiTect master mix, 1 µL of the forward primer, 1 µL of the reverse primer, 2 µL of the template, and 8.5 µL of PCR-grade water.

66

Seth et al.

Table 3 Effect of Assay Sensitivity and Cross-Reactivity When the Annealing Temperature Is Altered Temperature 52°C Annealing temperature

55°C annealing temperature

59°C annealing temperature

62°C annealing temperature

HPV E2

HPV E4

HPV E6

Cross reacts with 18, 31, 35, 39, 45, 51, 66, 6, 11

Cross reacts with 18, 31, 33, 35, 39, 45, 51, 56, 58, 59, 66, 6, 11 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 31, 33, 35, 39, 45, 51, 59, 66, 6, 11 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 31, 33, 66, 6 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 31, 66, 6 HPV 16 sensitivity = 0.02 ng

Cross reacts with 18, 31, 33, 35, 39, 45, 51, 56, 58, 59, 66, 6, 11 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 31, 33, 35, 39, 45, 51, 59, 66, 6, 11 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 31, 33, 39 HPV 16 sensitivity = 0.0002 ng Cross reacts with 18, 33, 39 HPV 16 sensitivity = 0.02 ng

HPV 16 Sensitivity = 0.0002 ng Cross reacts with 18, 31, 33

HPV 16 sensitivity = 0.0002 ng Cross reacts with 18 HPV 16 sensitivity = 0.02 ng Cross reacts with 6 HPV 16 sensitivity = 0.2 ng

2. Carry out the PCR using the optimal thermal profile identified in the previous experiment.

In Table 3, the types of results that can be expected are shown. HPV 18, 31, and 33 cross-react with HPV 16 E2 gene; HPV 18, 31, 33, 66, and 6 cross-react with HPV16 E4 gene; and HPV 18, 31, 33, and 39 cross-react with HPV 16 E6 gene at a low rate of 0.2%. This is because the nucleotide sequences in the HPV 16 E-genes are very similar to those of HPV18, 31, 33, and 39 E-genes.

3.2.4. Reproducibility of the HPV PCRS To test for intra- and inter-assay variations, the following method can be used: 1. Dilute HPV 16 DNA standard in PCR water to a concentration of 0.25 ng/µL in a volume of 200 µL. 2. Using the optimized PCR reaction mixtures and thermal profiles for E2, E4, and E6 PCRs, set the PCR assays as before. 3. Test the sample (0.5 ng/tube, 2 µL) 20 times in a single run (to obtain intra-assay variation) and 10 times in consecutive runs (to obtain inter-assay variation).

HPV Gene Expression Using Real-Time PCR

67

4. Calculate the mean Ct values, the standard deviations, and the percentage coefficient of variation (see Note 7).

3.2.5. Standard (Calibration) Graphs to Analyze Assay Sensitivity Analytical sensitivity of a PCR assay is defined as the least amount of specific PCR product that can be detected with confidence. To determine sensitivity of the E-gene PCRs, the following procedure can be followed: 1. Make a 10-fold serial dilution using HPV16 DNA standard to cover the range from 2 ng/tube to 0.00002 ng/tube in PCR-grade water. 2. Use 96-well format to set up the PCRs. 3. Pipet standards (2 µL) in duplicate into the tubes. 4. Also, set up 10 wells as negative controls (no template controls, NTC) to monitor contamination. 5. Perform PCR reactions as before in 25µL final volume using thermal profiles for HPV 16 E2, E4, E6 followed by dissociation curve analysis.

Fluorescence data collected during the PCR is fed into the software, which constructs a standard curve on the bases of the Ct value of each well. Quantity of the PCR product for each of the PCR reactions is then calculated from this information. A text report is obtained, which tabulates the quantity of the PCR product in ng/tube. Two major factors are considered when assessing sensitivity of the PCR. They are (1) the analytical efficiency and specificity of the reaction, preventing potential primer-dimer product formation and (2) maximum discrimination between negative controls and the least detectable specific product (see Note 8). In our hands, the assay sensitivity was found to be 0.0002 ng/tube for the early genes E2, E4, and E6.

3.3. Clinical Application of HPV PCRs To analyze gene expression, total RNA (cDNA) is needed from clinical specimen. Total RNA used in our study was obtained during the TOMBOLA clinical trial—a trial of management of borderline and other low-grade cervical abnormalities. DNA and RNA swabs were available from these women that were no longer in the trial.

3.3.1. RNA From Cervical Swabs Total RNA from cervical samples can be extracted by employing the Qiagen RNeasy kit for total RNA following the manufacturer’s instructions. Total RNA must then be transcribed into complementary DNA (cDNA) using standard protocols before PCR amplification (20). During RNA extraction, no genomic DNA carry-over must take place. The way this is controlled is by including a DNA digestion step that removes all the genomic DNA. The total

68

Seth et al.

Fig. 2. An example of a standard calibration graph obtained for human papillomavirus (HPV) 16 E6 gene assay.

RNA is then divided into two parts—one for a reverse transcription step with reverse transcriptase enzyme, and one without any enzyme so that it acts as an internal control for the reverse transcription step. Both the cDNAs are then amplified for a housekeeping gene such as GAPDH. The cDNA without any enzyme present (known as the RT-negative control) should not show any amplification at all.

3.4. Analysis of Clinical Samples The following procedure can be carried out when analyzing the clinical samples: 1. Construct standard curves using HPV16 DNA in a 10-fold serial dilution to cover the range from 2 ng/tube to 0.0002 ng/tube as before, using a 96-well format. 2. Apply standards in duplicate in all the assays. 3. In each assay, also include negative controls (no template) to monitor any contamination. 4. Use 2 µL of cDNA from clinical samples as template in a 25-µL final volume. 5. Use individual thermal profiles for HPV 16 E2, E4, and E6, followed by dissociation curve analysis after 35–40 cycles of amplification.

On the Mx4000, the fluorescence data collected are fed into the software, which constructs a standard curve on the basis of the Ct value of each well (see Fig. 2) and a dissociation curve (melt curve) for each PCR product (see Fig. 3). Quantity of the PCR product for each of the PCR reactions is then calculated. A text report is obtained, which tabulates the quantity of the PCR product in

HPV Gene Expression Using Real-Time PCR

69

Fig. 3. Dissociation curve analysis for human papillomavirus (HPV) 16 E2, E4, and E6 gene assays, showing the three specific products amplified during the polymerase chain reaction.

ng/tube. Gene expression is expressed as a ratio of the amount of product of that particular gene divided by the amount of product for a housekeeping gene (see Note 9). The most prevalent high-risk infections are HPV16, so identification of the early gene expression will add valuable information to the clinical state of the patients with abnormal smears. The melting-curve profiles are clearly separate and distinct from each PCR, indicating that early genes can be identified and distinguished from each other using these real-time PCR techniques, avoiding any further laboratory analysis. 4. Notes 1. We order our primers from Eurogentec. The primers should be of high quality and HPLC purified. 2. QuantiTect SYBR Green PCR master mix (Qiagen UK) contains all the components for successful real-time PCRs and requires only that the concentration of the primers and the thermal cycling conditions be optimized. It contains optimized amounts of Taq DNA polymerase, a reference dye called ROX, a reporter dye (SYBR Green I), nucleotides (dNTPs), and buffer. Hotstar DNA polymerase is included in the kit; this prevents the production of nonspecific products at room temperature.

70

Seth et al.

3. SYBR Green I detects all double-stranded DNA, and it is critical to determine whether there are any primer-dimer or nonspecific products being generated in the PCR. These appear as small peaks around low temperature (approx 60–70°C). Using dissociation curve analysis for these sets of primers, no primer-dimers were detected. 4. From the information on Ct values (see Table 2) the E4 and E6gene PCRs done with 100-pmol primer dilutions produce DNA amplification between 13.52 and 15.26 cycles, whereas the E2 assay was less sensitive and had a range from 15.86 to 19.51 cycles. In the E2, E4, and E6 PCRs, the 100 pmol primer dilutions also produced small-molecular-weight byproducts (primer-dimer). 5. If the annealing temperature is too low, then the primers will bind in a nonspecific manner to other HPV types or other non-HPV sequences. Alternatively, if the annealing temperature is too high, the primers will not be able to anneal. Temperatures to be tested are 5 degrees above and below the melting temperatures (that is, the average Tm of the primers). The other components of the thermal profiles can be identical to Fig. 1. 6. Known HPV DNA types are used at a concentration of 100 pg/µL. The HPV genotype can be confirmed by sequencing. 7. Values expected are 20% for inter-assay and 10% for intra-assay. In our assays, the inter-assay variation was found to be 15%, whereas the intra-assay variation was less than 9%. 8. Analytical efficiency and specificity are determined by analysis of the standard curves and the melting-curve profiles (see Fig. 2 for an example of a standard curve and Fig. 3 for the melting-curve analysis). The gradient of the HPV 16 standard curve was between –3.330 and –3.43, which translates to an equivalent of a PCR reaction of 95–99.7% efficiency. 9. In our laboratory, GAPDH PCR product (obtained by carrying out quantitative real-time PCRs for GAPDH) is used as a housekeeping gene to normalize the results obtained for the early genes E2, E4, and E6. Another housekeeping gene that is measured regularly is betaglobin.

Acknowledgments The authors would like to acknowledge the women who took part in the TOMBOLA Trial (funded by MRC and NHS in England and the NHS in Scotland), the grant holders, and the trial staff in Grampian, Tayside, and Nottingham for the use of clinical specimens collected in this study. We also acknowledge Miss Anne Kane (Department of Histopathology, QMC, Nottingham) for her help with the diagrams. References 1. Walboomers, J. M., Jacobs, M. V., Manos, M. M., et al. (1999) Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J. Pathol. 189, 12–19.

HPV Gene Expression Using Real-Time PCR

71

2. Josefsson, A. M., Magnusson, P. E., Ylitalo, N., et al. (2000) Viral load of human papillomavirus 16 as a determinant for development of cervical carcinoma in situ: a nested case-control study. Lancet 355, 2189–2193. 3. Swan, D. C., Tucker, R, A., Tortolero-Luna, G., et al. (1999) Human papillomavirus (HPV) DNA copy number is dependent on grade of cervical disease and HPV type. J. Clin. Microbiol. 37, 1030–1034. 4. Ylitalo, N., Sorensen, P., Josefsson, A.M., Magnusson, P., Anderson, P., Ponten, J., Adami, H. O., Gyllensten, U. B., and Melbye, M. (2000) Consistent high viral load of human papillomavirus 16 and risk of cervical carcinoma in situ: a nested case-control study. Lancet 355, 2194–2198. 5. Sasieni, P., Cuzick, J., and Farmery, E. (1995) Accelerated decline in cervical cancer mortality in England and Wales. Lancet 346, 1566–1567. 6. Cuzick, J. (1998) HPV testing in cervical screening. Sexually Transmitted Infections 74, 300–301. 7. Jenkins D. (2001) Human papillomaviruses in cervical screening. Current Diagnostic Pathology 7, 96–112. 8. Manos, M. M., Ting, Y., Wright, D. K., Lewis, A. J., Broker, T., and Wolinski, S. M. (1989) Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7, 209–214. 9. Gravitt, P. E., Peyton, C. L., Apple, R. J., and Wheeler, C. M. (1998) Genotyping of 27 human papillomavirus types by using L1 consensus PCR products by a single-hybridization, reverse line blot detection method. J. Clin. Microbiol. 36, 3020–3027. 10. Jacobs, M., Sniders, P. J. F., van den Brule, A. J. C., Helmerhorst, T., Meijers, C. J. M., and Walboomers, J. M. M. (1997) A general primer GP5+/GP6+ mediated PCR-enzyme immunoassay method for rapid detection of 14 high-risk and 6 lowrisk human papillomavirus genotypes in cervical scrapings. J. Clin. Microbiol. 35, 791–795. 11. Evander M. and Goran, W. (1991) A general primer pair for amplification and detection of genital human papillomavirus types. J. Virol. Methods 31, 239–250. 12. Kleter, B., van Doom, L. J., ter Schegget, J., et al. (1998) A novel short-fragment PCR assay for highly sensitive broad-spectrum detection of ano-genital papillomaviruses. Am. J. Pathol. 153, 1731–1739. 13. Gravitt, P. E., Peyton, C. L., Alessi, Q., et al. (2000) Improved amplification of genital human papillomaviruses. J. Clin. Microbiol. 38, 357–361. 14. Swan, D. C., Tucker, R. A., Holloway, B. P., and Icenogle, J. P. (1997) A sensitive, type-specific fluorogenic probe assay for detection of human papillomavirus DNA. J. Clin. Microbiol. 34, 886–891. 15. Whitcombe, D., Theaker, J., Guy, S. P., Brown, T.,and Little, S. (1999) Detection of PCR products using self-probing amplicons and fluorescence. Nat. Biotech. 17, 804–807. 16. Nazarenko, I. A., Bhatnagar, S. K., and Hohman, R. J. (1997) A closed tube format for amplification and detection of DNA based on energy transfer. Nucleic Acids Res. 25, 2516–2521.

72

Seth et al.

17. Jordens, J., Lanham, S., Pickett, M. A., Amarasekara, S., Abeywickrema, I., and Watt, P. J. (2000) Amplification with molecular beacon primers and reverse line blotting for the detection and typing of human papillomaviruses. J. Virol. Methods 89, 29–37. 18. Cubie, H. A., Seagar, A. L., McGoogan, E., et al. (2001) Rapid real-time PCR to distinguish between high-risk human papillomavirus types 16 and 18. J. Clin. Pathol. 54, 24–29. 19. Seth, R., Nolan, T., Rippin J, and Jenkins, D. (2004) Simultaneous detection and genotyping of HPV by quantitative real-time PCR and Sybr Green. In: A–Z of Quantitative PCR, Bustin, S. (ed.) La Jolla, CA: International University Line. 20. McLaughlan, J., Seth, R., Vautier, G., et al. (1997). Interleukin-8 and inducible nitric oxide synthase mRNA levels in inflammatory bowel disease at first presentation. J. Pathol. 181, 87–92.

p16INK4a and Integrated Genomes as Progression Markers

73

7 Analysis of p16INK4a and Integrated HPV Genomes as Progression Markers Svetlana Vinokurova, Nicolas Wentzensen, and Magnus von Knebel Doeberitz Summary Most cervical cancers are preventable when the precursor lesions are detected in time. Human papilloma viruses (HPVs) are the main risk factors for cervical cancer development, but there is a high percentage of healthy women infected with HPV that never develop a lesion. Only a small percentage of low-grade dysplasias finally grow out to invasive cancer. Several biomarkers can be used to identify lesions at risk for malignant progression. Overexpression of p16INK4a is induced by the viral oncoprotein E7 and distinguishes dysplastic lesions from benign changes. Integration of human papillomavirus DNA into the host genome is mainly found in high-grade dysplastic lesions and invasive cancers, and points to an increased progression potential.

1. Introduction The principal carcinogenic factors of high-risk human papillomaviruses (HR-HPV) are the viral oncogenes E6 and E7, which code for proteins interfering substantially with apoptosis and cell-cycle regulation. Expression of these viral genes is required to induce and maintain cervical carcinogenesis. Most of the acute HR-HPV infections regress spontaneously within a couple of months (1). However, in a few cases (3 to 10%), such acute HR-HPV infections might persist for a longer period of time. This induces incompatible biochemical signals that regulate replication of the host cell and the viral genome, and rapidly leads to chromosomal instability (2). The most important interactions of E6 and E7 are with p53 and pRB, both cellular tumor-suppressor genes (3). E6 binds to p53 and leads to its degradation. When p53 function is lost, chromosomal damage accumulates in the cells and can lead to malignant transformation. pRB is an inhibitor of G1-S transition. When E7 is bound From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

73

74

Vinokurova et al.

Fig. 1. Mechanism of p16INK4a overexpression. (A) E2F is bound by Rb, no expression of cell-cycle promoting genes. (B) Phosphorylation of cyclin-dependent kinases (CDK) leads to the release of E2F and to the activation of cell-cycle promoting genes. p16INK4 down-regulates CDK action to maintain strict cell-cycle regulation. (C) HR-HPV E7 is binding to Rb independent of the phosphorylation state; activation of p16INK4a has no effect on the E2F release.

to pRB, E2F is released and leads to the activation of several cell-cycle promoting factors (4). Another independent effect of E6 and E7 expression is the major disturbance of the mitotic spindle apparatus, leading to abnormal mitoses with multipolar mitotic figures, which results in severe numeric and chromosomal aberrations (2). The interaction of E7 with the pRB gene product results in release of E2F from the active pRB-E2F complex and premature degradation of the pRB-E7 complex (4). Because pRB-E2F inhibits transcription of the p16INK4a gene, expression of HR-HPV E7 results in excessive and deregulated transcription and translation of the p16INK4a (p16) gene (5) (Fig. 1). Importantly, this overexpression of p16INK4a due to the expression of the HR-HPV E7 gene product is not observed when the E7 protein is normally expressed at low levels during an acute HR-HPV infection (6). Because p16INK4a is not expressed in normal cervical squamous epithelia, screening for p16INK4a overexpressing cells allows specific identification of dysplastic lesions in histological sections and in cervical smears (7–11).

p16INK4a and Integrated Genomes as Progression Markers

75

Only a minority of patients that have developed a cervical dysplasia have lesions that finally progress to invasive cancer. Identification of molecular markers that reliably predict the progression risk of cervical lesions might contribute to disease management of cervical dysplasia. It was observed that a fraction of high-grade dysplastic lesions as well as the majority of cervical cancers harbor HPV DNA integrated into the host genome (15). It was shown that integration of HR-HPV genomes in cervical lesions results in enhanced expression of the viral oncogenes E6 and E7, and thus confers a strong promoting factor in the progression of dysplastic cervical lesions (12,13). It was shown that chromosomal instability and aneuploidization of the host cell genome precedes integration of the viral genome, suggesting that integration reflects the severe chromosomal damage that occurs during the progression of the dysplastic lesion (14). HPV DNA is integrated into the host genome in over 80% of the cervical carcinomas (15). There is no specific integration hot spot—every HPV integration happens at unique sites distributed over the whole human genome (15,16). However, so-called fragile sites within the human genome appear to facilitate the integration of HR-HPV genomes. As a result of the uniqueness of every integration site, integration detection can be used as a highly specific and individual tumor marker. The precise recombination sites of viral and cellular sequences represents a molecular fingerprint that is applied to delineate the clonality of a lesion, to monitor patients after treatment for local recurrences, or to monitor distant metastases and lymph nodes using highly sensitive and specific polymerase chain reaction (PCR) methods. Integration of HR-HPV genomes in cervical carcinoma cells usually results both in disruption of the E1 or E2 open reading frames and in disruption or deletion of the viral early-region polyadenylation signal from the viral oncogene-encoding sequences. Consequently, transcripts derived from the integrated E6 and E7 oncogenes commonly encompass viral sequences at their 5'-ends and flanking cellular sequences at their 3'-ends. These structural differences of integrated or episomal viral oncogene transcripts are detectable by the amplification of papillomavirus oncogene transcripts (APOT) assay. Using an oligo(dT)17-primer coupled to a linker sequence ([dT]17-p3), the reverse transcription (RT) of all of the mRNAs is initiated by binding to their poly(A) tail. Subsequently, both episome- and integrate-derived HPV oncogene transcripts are amplified by nested PCR reactions using E7-specific forward primers in combination with primers p3 and (dT)17-p3, respectively (Fig. 2). Integrate-derived transcripts can now be differentiated from the abundant episome-derived transcript (1050 bp) because of their different sizes. Furthermore, the obtained PCR fragments can be verified by Southern blot hybridization analysis using HPV E7- and E4-specific oligonucleotides (Fig. 3, h1 and h2).

76

Vinokurova et al.

Fig. 2. APOT diagram. Arrows: Primer binding sites. P1, P2: HPV-specific forward primers for first and second PCR. dT: Oligo dT primer. P3: Adaptor primer. H1: E7 probe. H2: E4 probe.

p16INK4a and Integrated Genomes as Progression Markers

77

The two methods described in this chapter were developed to detect different stages in the progression of HR-HPV-induced lesions. p16INK4a staining marks those persistently HR-HPV-infected cells that display deregulated expression of the viral oncogenes. This starts in early dysplastic lesions and helps to distinguish dysplastic cells in equivocal cytological or histological slides or samples from benign, inflammatory, and metaplastic lesions. However, only a fraction of these p16ink4a-positive lesions will grow out to invasive carcinomas. Detection of integrated viral genomes or their transcription, in contrast, points to more advanced lesions (CIN3 and carcinoma) with a very high potential of further malignant progression. 2. Materials 2.1. p16 Staining 1. Ethanol: 95%, 70%, 50%. 2. Xylene. 3. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4) + 0.1% Tween-20 (PBS + T). 4. Slides (e.g., SuperFrost Plus, poly-L-lysine-coated slides). 5. Immunohistochemistry Marking Pen (e.g., DAKO Pen, DakoCytomation, Glostrup, Denmark). 6. Primary antibody (e.g., E6H4 by MTM Laboratories) or appropriate p16 staining kit (CINTec histology/cytology kits, Dakocytomation, Glostrup, Denmark). 7. Appropriate biotin-coupled secondary antibody (anti-mouse, e.g., Vectastain, Vector Laboratories, Burlingame, CA). 8. Appropriate AB complex and substrate amino-ethylcarbazol (AEC) or diaminobenzidine (DAB) (e.g., Vectastain kits, Vector Laboratories, Burlingame, CA). 9. Counterstain: hematoxylin, (e.g., Mayer’s hematoxylin, DakoCytomation, Glostrup, Denmark). 10. Coverslips. 11. Humid chamber. 12. Water bath with lid (for epitope retrieval at 95–99°C). 13. Light microscope. 14. Mounting medium (e.g., aqueous Aquatex, Merck, or glycerol gelatin). 15. Positive and negative specimens to use as process controls.

Fig. 3. (opposite page) Amplification and hybridization results (human papillomavirus [HPV] 16). Upper row: agarose gel electrophoresis after amplification of papillomavirus oncogene transcripts (APOT) reverse-transcription polymerase chain reaction. Middle and lower rows: Southern blot hybridization with HPV E7/E4-specific probes. 1–3 = normal; 4–6 = CIN1; 7–9 = CIN2; 10–12 = CIN3; 13–15 = carcinomas. * Integrate detection by differential hybridization.

78

Vinokurova et al.

2.2. Amplification of Papillomavirus Oncogene Transcripts 1. RNeasy (Qiagen). 2. RNAlater (Ambion, Woodward, TX). 3. Enzymes and buffers: SuperScript™ II, RNase H- Reverse Transcriptase (Invitrogen). 4. Oligonucleotide primers: (dT)17-P3: GACTCGAGTCGACATCGA TTTTTTTTTTTTTTTTT P3: GAC TCG AGT CGA CAT CG HPV16-P1: CGG ACA GAG CCC ATT ACA AT HPV18-P1: TAG AAA GCT CAG CAG ACG ACC HPV16-P2: CCT TTT GTT GCA AGT GTG ACT CTA CG HPV18-P2: ACG ACC TTC GAG CAT TCC AGC AG 5. Whatman filter paper. 6. Nylon membranes (e.g., Hybond N+, Amersham Life Science). 7. Gel Extraction Kit (Qiagen). 8. Agarose and DNA sequencing gel equipment. 9. ECL oligolabeling and detection kit (Amersham). 10. Hybridization probes H1-16: TCGTACTTTGGAAGACCTGTTAATG H1-18: GTTTCTGAACACCCTGTCCTTTGTG H2-16: GAAGAAACACAGACGACTATCCAG H2-18: CAGCTACACCTACAGGCAACAACAA 11. TA cloning kit (Invitrogen).

3. Methods 3.1 p16INK4a Histology (see Note 1)

3.1.1. Tissue Preparation Tissues fixed with neutral buffered formalin and embedded in paraffin can be used for p16 staining. 1. Cut paraffin-embedded tissues into 1–2-µm slices and place on glass slides. 2. To dry, incubate slides overnight at 37°C. 3. For proper staining, paraffin has to be removed completely by washing in xylene twice for 5 min, 95% ethanol twice for 3 min, 70% ethanol three times for 3 min, and finally distilled water once for >30 s. (see Note 2). 4. For antigen retrieval, incubate slides in Tris-ethylenediamine tetraacetic acid (EDTA) (pH 9.0) at 95°C (water bath) for 10 min. Cool down to room temperature for 20 min. Apply marking pen to confine staining solutions (see Note 3). 5. To block, incubate sections with 1% peroxidase for 5 min. 6. Wash in PBS + T for 5 min.

p16INK4a and Integrated Genomes as Progression Markers

79

3.1.2. Staining and Mounting 1. Incubate sections with primary antibody (for E6H4 use a concentration of 0.6 µg/mL) in the appropriate blocking solution (for E6H4 use 2% horse serum in PBS + T) at room temperature for 30 min. 2. Wash in PBS + T twice for 5 min. 3. Incubate with biotinylated secondary antibody (e.g., horse-anti-mouse immunoglobulin [Ig]G, 1:200) in the appropriate blocking solution (e.g., 2% horse serum in PBS + T) at room temperature for 30 min. 4. Wash in PBS + T twice for 5 min. 5. Dilute equal amounts of avidin- and biotin-coupled horseradish peroxidase solution 1:50 in PBS + T and incubate sections at room temperature for 30 min. 6. Wash in PBS + T twice for 5 min. 7. Use either AEC or DAB substrates for color reaction according to the manufacturer’s protocol. 8. Wash in water at room temperature for 5 min. 9. Counterstain nuclei with hematoxylin. According to the strength of the hematoxylin solution, incubate slides for 1–5 min. 10. Blue sections in tap water for 5–10 min. 11. Mount sections in the appropriate mounting medium: for DAB substrates, use aqueous mounting medium, for AEC use glycerol gelatin (see Notes 4 and 5).

3.2. p16INK4a Cytology 3.2.1. Cytology Slide Preparation Different thin-layer cytology systems can be used for the procedure, e.g., Cytyc, SEROA, Autocyte, and so on. The slides should be ethanol (100%) fixed after preparation. Follow the steps outlined under Subheading 3.1.1., beginning with antigen retrieval.

3.3. Amplification of Papillomavirus Oncogene Transcripts 3.3.1. RNA Isolation and Quality RNA integrity is very important for good performance of the APOT assay. When RNA integrity is assured, APOT can be performed from very small amounts of clinical material, such as cervical swabs or small biopsies. It is very important to stabilize RNA immediately after sample extraction; for optimal results, samples should be frozen in liquid nitrogen (see Note 6). All RNA isolation methods show sufficient results with APOT amplification when good RNA was used as starting material (see Note 7).

80

Vinokurova et al.

3.3.2. DNAse Digest If problems with DNA contamination occur, a DNAse digest can be performed prior to reverse transcription. However, a general application of DNAse does not seem to be necessary (see Note 8).

3.3.3. Reverse Transcription Use total RNA (1 ng to 1 µg) for reverse transcription with an oligo(dT) 17-primer coupled to a linker sequence (dT)17-p3 (see Note 9). 1. Prepare a master mix (1) containing per reaction: 4 µL (1 ng to 1 µg) of total RNA template, 7 µL water, 1 µL 25 µM (dT)17-p3. 2. Prepare a master mix (2) containing per reaction: 4 µL 5X RT buffer, 2 µL 0.1 M dithiothreitol (DTT), 1 µL 10 mM dNTP, 0.1–0.2 µL (20–40 U) MMLV RT SuperScript. 3. Heat-denature master mix 1 at 70°C for 10 min and quickly chill on ice. 4. Add master mix 2 and incubate at 42°C for 60 min. 5. Inactivate for 5 min at 90°C.

3.3.4. PCR Amplification 1. Prepare a first PCR reaction containing the following: 1X PCR buffer; 0.2 mM dNTPs; 1.5 mM MgCl2; 0.25 µM primer HPV16-P1 (for HPV16) or primer HPV18-P1 (for HPV18), and 0.25 µM P3; 5 U Taq polymerase; and 4 µL template; in a total of 50 µL. 2. Cycle according to the following conditions: Initial denaturation for 3 min at 94°C, then 30 cycles of denaturation for 40 s at 94°C; annealing for 30 s at 59°C (for HPV16) or 61°C (HPV18); extension for 4 min at 72°C. The reactions finish with a final extension of 7 min at 72°C. 3. Prepare a second PCR reaction containing the following: 1X PCR buffer; 0.2 mM dNTPs; 1.5 mM MgCl2; 0.25 µM primer HPV16-P2 (for HPV16) or primer HPV18-P2 (for HPV18), and 0.25 µM primer d(T)17-P3; 5 U Taq polymerase; and 4 µL of the first PCR product; in a total volume of 50 µL. 4. Cycle according to the following conditions: Initial denaturation for 3 min at 94°C, then 30 cycles of denaturation for 40 s at 94°C; annealing for 30 s at 67°C (for HPV16) or 70°C (for HPV18); extension for 4 min at 72°C. The reactions finish with a final extension of 7 min at 72°C.

3.3.5. Hybridization 1. Electrophorese the PCR products in 1.2% agarose gels and transfer onto nylon membranes. 2. Hybridize with an E7-specific probe (H1) at 50°C. Hybridize a second parallel filter with an E4-specific probe (H2) at 50°C to highlight amplimeres that encompass E4 sequences.

p16INK4a and Integrated Genomes as Progression Markers

81

3. Use ECL oligolabeling and detection kit for labeling and detection of the probes according to the manufacturer’s instructions. Alternatively, other ECL detection systems can be used according to your personal preferences.

3.3.6. Interpretation of Results All specific amplimers show hybridization signals with the E7 probe. Amplimeres that do not hybridize with the E4-specific probe or that display a different size than the major E7-E1^E4 episomal transcript (approx 1050 bp in length for HPV16 and 1000 bp for HPV18) are suspected to be derived from integrated HPV genomes (see Note 10).

3.3.7. Sequencing Excise PCR products of interest from the gel and extract using Gel Extraction Kit. PCR products can be cloned, for example into pCR2.1 vector using the TA cloning Kit (Invitrogen), or directly sequenced using P2 primers. 4. Notes 1. The authors are experienced users of the p16INK4a mouse monoclonal antibody E6H4 (MTM laboratories, Heidelberg). DAKO is offering staining kits for p16INK4a histology and cytology using modified and shortened protocols compared to the general staining protocols described in this chapter. Other antibodies may be used, but staining procedures have to be adjusted accordingly. 2. Change solutions after 30–40 slides. 3. Touching tissue and cells with the marking pen might result in staining artifacts. Leave enough space between tissue/cells and marking pen. 4. A good nuclear counterstain is necessary for the assessment of nuclei to discern rare p16-positive metaplastic cells from dysplastic cells showing nuclear atypias. 5. It is of utmost importance that the slides do not dry out during the staining procedure. As with all immunohistochemistry procedures, staining in the border areas of slides is not considered to be specific. In every staining procedure, positive controls should be included, either confirmed p16-positive tissue samples or p16expressing cell lines (e.g., HeLa cells). To avoid contamination of cytological slides with detached cells from the positive-control slide, these samples should be washed in different containers. 6. RNA stabilization solutions can be used as a substitute for liquid nitrogen. Good APOT amplification results can be obtained when samples are immediately transferred to RNAlater (Ambion) and stored up to 1 wk at 25°C and up to 1 mo at 4°C. Long-term storage is possible in RNAlater solution at –20°C or –80°C. The quality of the isolated RNA should be determined by amplification of housekeeping gene mRNAs like GAPDH or beta-actin. 7. Various RNA preparation methods can be used, including modified phenol/chloroform assays, Trizol protocols, or column-based methods, like RNeasy (Qiagen).

82

Vinokurova et al.

8. If RNA is extracted using the RNeasy kit, DNA can also be isolated from the first wash flow-throughs. The isolated DNA can be used for HPV typing or genomebased integration detection. DNAse digestion of the isolated RNA is generally not performed. 9. SuperScript II RNase H- Reverse Transcriptase (Invitrogen) can be used to synthesize first-strand cDNA and will generally give higher yields of cDNA and more full-length product than other reverse transcriptases. 10. When high amounts of episomal transcripts are present, mispriming of the oligo(dT) primer to A-rich regions can lead to amplification episomal fragment that have a different length from the standard episomal transcript (1050 bp for HPV16 and 1000 bp for HPV18).

References 1. Ho, G. Y., Bierman, R., Beardsley, L., Chang, C. J., and Burk, R. D. (1998) Natural history of cervicovaginal papillomavirus infection in young women. N. Engl. J. Med. 338, 423–428. 2. Duensing, S. and Munger, K. (2004) Mechanisms of genomic instability in human cancer: insights from studies with human papillomavirus oncoproteins. Int. J. Cancer 109, 157–162. 3. Mantovani, F. and Banks, L. (2001) The human papillomavirus E6 protein and its contribution to malignant progression. Oncogene 20, 7874–7887. 4. Munger, K., Basile, J. R., Duensing, S., et al. (2001) Biological activities and molecular targets of the human papillomavirus E7 oncoprotein. Oncogene 20, 7888–7898. 5. Khleif, S. N., DeGregori, J., Yee, C. L., et al. (1996) Inhibition of cyclin D-CDK4/ CDK6 activity is associated with an E2F-mediated induction of cyclin kinase inhibitor activity. Proc. Natl. Acad. Sci. USA 93, 4350–4354. 6. Von Knebel Doeberitz, M. (2002) New markers for cervical dysplasia to visualise the genomic chaos created by aberrant oncogenic papillomavirus infections. Eur. J. Cancer 38, 2229–2242. 7. Klaes, R., Woerner, S. M., Ridder, R., et al. (1999) Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. Cancer Res. 59, 6132–6136. 8. Klaes, R., Friedrich, T., Spitkovsky, D., et al. (2001) Overexpression of p16(INK4A) as a specific marker for dysplastic and neoplastic epithelial cells of the cervix uteri. Int. J. Cancer 92, 276–284. 9. Sahebali, S., Depuydt, C. E., Segers, K., et al. (2004) p16INK4a as an adjunct marker in liquid-based cervical cytology. Int. J. Cancer 108, 871–876. 10. Trunk, M. J., Dallenbach-Hellweg, G.., Ridder, R., et al. Morphological characteristics of p16ink4a positive cells in cervical cytology samples. Acta Cytologica 48, 771–782. 11. Klaes, R., Benner, A., Friedrich, T., et al. (2002) p16INK4a immunohistochemistry improves interobserver agreement in the diagnosis of cervical intraepithelial neoplasia. Am. J. Surg. Pathol. 26, 1389–1399. 12. Jeon, S., Allen-Hoffmann, B. L., and Lambert, P. F. (1995) Integration of human

p16INK4a and Integrated Genomes as Progression Markers

13.

14.

15.

16.

83

papillomavirus type 16 into the human genome correlates with a selective growth advantage of cells. J. Virol. 69, 2989–2997. Jeon, S. and Lambert, P. F. (1995) Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carcinogenesis. Proc. Natl. Acad. Sci. USA 92, 1654–1658. Melsheimer, P., Vinokurova, S., Wentzensen, N., Bastert, G., and von Knebel Doeberitz, M. (2004) DNA aneuploidy and integration of HPV-16 E6/E7 oncogenes in intraepithelial neoplasia and invasive squamous cell carcinoma of the cervix uteri. Clin. Cancer Res. 10,3059–3063. Wentzensen, N., Vinokurova, S., and von Knebel Doeberitz, M. (2004) Systematic review of genomic integration sites of human papillomavirus genomes in epithelial dysplasia and invasive cancer of the female lower genital tract. Cancer Res. 64, 3878–3884. Ziegert, C., Wentzensen, N., Vinokurova, S., et al. (2003) A comprehensive analysis of HPV integration loci in anogenital lesions combining transcript and genomebased amplification techniques. Oncogene 22, 3977–3984.

Use of Biomarkers in the Evaluation of CIN

85

8 Use of Biomarkers in the Evaluation of CIN Grade and Progression of Early CIN Jan P. A. Baak and Arnold-Jan Kruse Summary The treatment of cervical intraepithelial neoplasia (CIN) depends on the evaluation of CIN grade. The grading of CIN is however problematic, as intra- and interobserver reproducibility of CIN-grade evaluation among pathologists is not perfect. There are also difficulties in reliably distinguishing CIN from nonneoplastic lesions, and over- or undertreatment can be the result. These points suggest a need for adjuvant methods that can distinguish CIN from nonneoplastic lesions, and can distinguish different CIN grades and predict the risk of progression of early CIN1 and -2 lesions. This chapter describes the use of biomarker-related methods for the diagnosis and prognostic evaluation of patients with CIN1 and CIN2. As CIN involves the progressive dysfunction of proliferation and differentiation activities in cervical epithelial cells, we have concentrated in this chapter on demonstrating the utility of proliferation- and differentiation-related biomarkers.

1. Introduction Treatment of cervical intraepithelial neoplasia (CIN) depends on the accurate assessment of CIN grade. However, CIN grade assessment is problematic (1), as intra- and interobserver reproducibility among pathologists is not perfect (2–7). There are also difficulties in reliably distinguishing CIN from nonneoplastic lesions (6–9), and over- or undertreatment can be the result. These points indicate a need in surgical pathology and gynecology practices for adjuvant methods that can differentiate between CIN grades and distinguish CIN from non-neoplastic lesions. Such methods should also predict the risk of finding high-grade CIN3, whether in the same diagnostic biopsy, in the cervical mucosa left in situ adjacent to the biopsy, or in the follow-up of early CIN1 and -2 lesions (“early CIN”). This chapter describes the application of adjuvant methods developed for this purpose. For too long, such methods have been mostly morphological in nature and have not, in any adequate way, incorpoFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

85

86

Baak and Kruse

rated knowledge of the underlying biological mechanisms leading to or explaining the disease. As CIN involves progressive dysfunction of the proliferation and differentiation activity of cervical epithelial cells, we have concentrated on studying proliferation- and differentiation-related biomarkers. There is considerable variation in the literature regarding the value of biomarkers, although certain trends are now generally accepted. The reasons for these discrepancies are manifold. First, most biochemical sampling methods carry the risk of mixing lesions with normal tissue. Depending on how much of each is mixed, the results can vary considerably. Immunohistochemical (IHC) methods can avoid this disadvantage, but the results may vary as a result of staining differences and interpretation differences. We use a strict staining procedure to limit such variations (10). To avoid interpretational errors, quantitative objective methods can be used in order to improve the reproducibility of assessments. In addition to the objective assessment of certain features, the detection of differences that escape subjective judgment is also possible with quantitative microscopy (11). Finally, assessment of the different features can be performed in the deep, middle, and superficial layers of the epithelium. As images of the cervical epithelium are a snapshot of a highly dynamic process, this can be done as follows. Immature cells (large nuclei, little cytoplasm) are “born” in the deep epithelium and, while moving to the surface, mature into highly differentiated cells (small pyknotic nuclei, much cytoplasm). This process may take 7–14 d, at the end of which the cells are desquamated. Biomarkers reflect these maturation processes, and it can therefore be expected that they will vary greatly in the different layers of the epithelium. Figure 1A illustrates that for the Ki67 nuclear proliferation-associated antigen, this is indeed the case. Consequently, their analysis in the epithelium as a whole is like mixing apples and oranges. An average epithelial value therefore is of little significance, and geographyspecific interpretation is essential to catch the biology of the CIN lesion. In order to obtain an adequate impression of the biomarker dynamics in normal and neoplastic epithelium, the biomarkers must be quantified separately in the different layers of the epithelium (see Fig. 1B). This chapter gives a summarized description of each method. 2. Materials 2.1. Staining Procedures 1. 2. 3. 4. 5.

Silanized slides (Dako, Glostrup, Denmark). Xylene. Graded series of alcohol solutions. 10 mM Tris-HCl, 1 mM ethylenediamine tetraacetic acid (EDTA) (pH 9.0). Autostainer (DAKO, Glostrup, Denmark).

Use of Biomarkers in the Evaluation of CIN

87

Fig. 1. (A) Example of a human papillomavirus (HPV)-positive but morphologically normal epithelium. Left: hematoxylin and eosin (H&E); inset: normal basal and parabasal nuclei. Right: Ki67 (note the parabasal location and low number of positive nuclei, arrows). (B) Diagram illustrating the different epithelial layers in which the measurements were performed. 6. 7. 8. 9.

TBS (S1968), 0.05%. Tween-20 (pH 7.6). Peroxidase blocking reagent S2001 (DAKO, Glostrup, Denmark). Monoclonal antibodies. Table 1 gives an overview of the clones, dilutions, and manufacturers of each of the monoclonal antibodies used. 10. DAKO antibody diluent S0809.

88

Baak and Kruse

Table 1 Clones, Dilutions, and Manufacturers of the Monoclonal Antibodies Used Monoclonal antibody CK-13 CK-14 cyclin D1 cyclin E hTERT p16 p21 pRb cyclin A p27 p53 Ki67

Clone KS-1A3 LL002 P2D11F11 13A3 44F12 6H12 4D10 13A10 CYA06 SX53G8 DO-7 MIB-1

Dilution 1:200 1:40 1:25 1:40 1:100 1:25 1:25 1:25 1:40 1:100 1:200 1:100

Manufacturer Novocastra, Newcastle upon Tyne, UK Novocastra Novocastra Novocastra Novocastra Novocastra Novocastra Novocastra Neomarkers, Fremont, USA DAKO, Glostrup, Denmark DAKO DAKO

11. Peroxidase/diaminobenzidine (DAB) (K 5007) (ChemMate Envision Kit, DAKO, Glostrup, Denmark. 12. Envision/HRP, rabbit/mouse (Envision = ENV). 13. DAB + chromogen. 14. Hematoxylin.

2.2. Immunoquantitation and Syntactic Structure Analysis Interactive image analysis system (QPRODIT). 3. Methods 3.1. Staining Procedures 1. Mount paraffin sections of 4-µm thickness adjacent to the hematoxylin and eosin (H&E) sections used for the CIN grade assessment, onto silanized slides. 2. Dry overnight at 37°C followed by 1 h at 60°C. 3. Deparaffinize the sections in xylene and rehydrate in a graded series of alcohol solutions. 4. Perform antigen retrieval by pressure cooking in 10 mM Tris, 1 mM EDTA (pH 9.0) for 2 min at full pressure followed by cooling for 15 min. 5. Use an autostainer for the immunostaining. 6. Add TBS (S1968) at 0.05% and Tween-20 (pH 7.6) as the rinse buffer. 7. Block endogenous peroxidase activity by incubating for 10 min in peroxidaseblocking agent. 8. Incubate with monoclonal antibodies at the dilutions shown in Table 1. 9. Visualize the immune complex by peroxidase/DAB with incubation of Envision/ HRP, rabbit mouse (ENV) for 30 min, and DAB + chromogen for 10 min. 10. Counterstain the section with hematoxylin.

Use of Biomarkers in the Evaluation of CIN

89

11. To ensure the presence of the same CIN lesion in all test sections, cut the section adjacent to the sections used for immunostaining and stain with H&E.

3.2. Ki67 Immunoquantitation Using MIB-1 Antibody 1. Mark in each case the area with the subjectively highest CIN grade. 2. Avoid technically unsatisfactorily cases for quantitative Ki67 analysis (see Note 1). 3. Demarcate with the cursor of the interactive image analysis system, the lumen and basal membrane of the most severely dysplastic epithelium (making sure that the length of any one epithelial strip is at least 30 µm). 4. At a final monitor magnification of ×1400, mark the center of each Ki67-positive nucleus using the cursor of the system. Figure 2 illustrates this method. 5. The system automatically calculates multiple quantitative features (including various descriptive statistics for each feature) in each case. These include the distance between the nucleus and basement membrane (=DBM), epithelial thickness (=T) at the location of the nucleus indicated, distance between the nucleus and the lumen (=DL), stratification index (Si) (=DBM/T, which is the distance between the nucleus and basal membrane, divided by the epithelial thickness), total number of Ki67-positive nuclei per 100 µm basement membrane, and percentage Ki67-positive nuclei in the deep third, the middle third, and the upper third of the epithelium. 6. The QPRODIT system also calculates a large number of descriptive statistics for each quantitative variable, such as mean, median, 5th, 10th, . . . 90th, 95th percentiles.

3.3. Evaluation of MIB-1-Positive Cell Cluster Criterion 1. Assess the presence of a MIB-1 (Ki67) positive cell cluster in cervical squamous epithelium. The MIB-1 positive cell cluster criterion is defined as positive when a cluster of at least two strongly stained adjacent epithelial nuclei are present in the upper two-thirds of the epithelial thickness anywhere within the lesion (12). Figure 1A shows a human papillomavirus (HPV)-positive but morphologically normal epithelium. Figure 3 shows an HPV-positive MIB-1-cell-cluster positive CIN lesion. It is important to exclude inflammatory cells and tangentially cut parabasal epithelium (see Note 2).

3.4. Evaluation of Immunopositivity 1. Regard cells as either negative or positive and assess the percentage of positive cells in the basal cell layer, the lower half (excluding the basal cells), and the upper half of the epithelium by two independent observers. 2. In case of interobserver disagreement, obtain consensus through discussion.

3.5. Syntactic Structure Analysis 1. Select the most severely dysplastic part of the epithelium in the H&E section. 2. Mark in this area the upper border, the basal membrane, and the borders between the two deepest layers of the epithelium (the deepest layer excluding the basal cell layer).

90

Baak and Kruse

Fig. 2. Illustration of the Windows-based image analysis method. The microscopic image of the epithelium is shown on the monitor of the image-analysis system. Using the mouse the operator demarcates a diagnostic epithelium strip, carefully avoiding tangentially cut areas. The demarcation lines are shown as white lines (surface, basal membrane, left, right). The operator then clicks the mouse on all Ki67-positive nuclei within the demarcated strip. After each click, the system automatically draws a perpendicular line from that point to the basal membrane and over the full thickness of the epithelium (these thin dotted lines are barely visible for all nuclei) and calculates several quantitative features, such as thickness (=T) of the epithelium at that point, distance (=D) of the point to the basal membrane and stratification index (SI = D/T). These quantitative features are shown in the left panel after each click and are stored automatically. In the figure, lines D (dotted lines) and T (continuous lines) are emphasized for three nuclei at A-A', B-B', and C-C'. The SIs are 0.90, 0.45, and 0.19 respectively. The image analysis program automatically calculates per sample many quantitative features, of which SI90 and MIDTHIRD are the most important. The SI90 is the 90th percentile of the stratification index. The MIDTHIRD is the percentage of all MIB-1-positive nuclei in the whole thickness of the middle third of the epithelium. 3. Mark on a video screen, by setting a point with the cursor of the interactive image analysis system, the centers of gravity of all nuclei in the lower deep half of the epithelium in five fields of vision chosen randomly. Figure 4 illustrates this image-analysis method.

Use of Biomarkers in the Evaluation of CIN

91

Fig. 3. Example of a cervical intraepithelial neoplasia (CIN) 1 lesion (left: hematoxylin and eosin [H&E]) with (right) MIB-1-positive cell clusters (arrows).

The computer program composes the Voronoi diagram (VD) and the minimum spanning tree (MST) using this set of points. The Voronoi tessellation splits the image plane into polygons, each containing one nuclear center of gravity in its center, and in such a way that each point in the polygon is closer to this center nucleus than to any other point in the plane. The MST interconnects a set of nuclei in such a way that the total length of the lines was minimal and no loops were formed. Figure 4 illustrates this image-analysis method.

3.6. Use of Biomarkers in Daily Routine On the basis of the above-mentioned methods, we recommend the following strategy for the handling of a cervical biopsy in a surgical pathology laboratory, in the realm of CIN analysis: 1. Analyze the diagnostic H&E-stained section for routine evaluation. 2. Scan the serial section after staining for p16 (see Chapter 7) in order to identify diffusely positive squamous areas. Based on recent studies in the literature and our own routine use of p16 (unpublished results), these are nearly always dysplastic (false-positive staining for p16 is very rare and easily recognized) (11). The underlying cause of diffuse p16 positivity is usually hrHPV positivity of the p16-positive squamous cells.

92

Baak and Kruse

Fig. 4. Illustration of the syntactic structure analysis (SSA). In each case, the most severely dysplastic part of the epithelium in the hematoxylin and eosin (H&E) section used for the routinely assessed diagnosis was selected. In this area, the upper border, the basal membrane, and the borders between the two deepest layers of the epithelium were marked (the deepest layer excluding the basal cell layer). SSA was performed in fields of vision chosen randomly in the already demarcated area by constructing a Voronoi diagram (VD) and a minimum spanning tree (MST) per field. Briefly, with a ×40 objective (final magnification ×1200) the centers of gravity of all nuclei in the lower deep half of the epithelium per field of vision were interactively marked on a video screen by setting a point with the cursor of the system. Using this set of points, the computer program composed the VD and the MST. The Voronoi tessellation splits the image plane into polygons, each containing one nuclear center of gravity in its center and in such a way that each point in the polygon was closer to this center nucleus than to any other point in the plane. The MST interconnected a set of nuclei in such a way that the total length of the lines was minimal and no loops were formed. The system automatically calculates multiple quantitative features (including various descriptive statistics for each feature) in each case derived from the VD. These include (1) total points clicked on with the cursor, (2) the sum of all polygon surfaces, (3) average surface of the polygons, (4) minimum surface of the polygons, (5) maximum surface of the polygons, (6) standard deviation of the polygons, (7) average of all roundness factors, (8) standard deviation of all roundness factors, (9) area disorder, (10) the number and percentage of selected points from which the surrounding surface

Use of Biomarkers in the Evaluation of CIN

93

3. Evaluate further with Ki67 in the next serial section. Ki67-positive cell clusters further indicate CIN (12,13). 4. Perform quantitative Ki67 analysis for objective grading support (Fig. 5A) and progression risk indication (Fig. 5B,C), in the case of CIN1 and CIN2 (see Fig. 2 for a detailed description of the method and the most important features used). If Ki67 Si90 exceeds 0.57 and/or MIDTHIRD exceeds 30%, the likelihood of CIN3 in the follow-up is high (30%) (see Note 3 and Fig. 5B,C). Figure 5B,C shows the Ki67-only models used at our laboratory to grade and predict the progression risk of CIN lesions (14–18). 5. Then, in the subsequent section, which is stained for retinoblastoma protein (Rb), analyze the Rb positivity of nuclei in the lower half of the epithelium. The retinoblastoma (Rb) gene was the first suppressor gene discovered. pRb, the protein product of Rb, is a nuclear phosphoprotein that plays a key role in regulating the cell cycle. In its active state, pRb serves as a brake on the advancement of cells from the G1 to the S phase of the cell cycle. It is thus understandable that a decrease of pRb in the lower cell layers of the cervical epithelium will lead to an increased (uncontrolled) proliferation. This then may be reflected as an increase in Ki-67-positive nuclei in the middle and upper cell layers. If the combination of Ki67-Si90 > 0.57 occurs together with Rb < 40% (which means that in the lower half of the epithelium the percentage of pRb-positive nuclei is less than 40%), progression risk in CIN1 and CIN2 is very high (approx 50%). Figure 5D illustrates this graphically (19). 6. Finally, analyze CK13 and CK14. These features have prognostic value, but only in the high-risk subgroup of Ki67 Si90 > 0.57 with Rb < 40%. Combined CK13 < 80% and CK14 <50% identifies patients with an excessively high progression risk (see flow chart in Fig. 5E and Note 4) (19).

Figure 6 shows the typical immunohistochemical images of the different biomarkers as described above in normal cervical epithelium, a nonprogressive lesion, and a progressive early CIN lesion. 4. Notes 1. Approximately 30% of routine cases are technically unsatisfactorily for quantitative Ki67 analysis. Technically inadequate is defined as tangential cutting of the Fig. 4. (continued from opposite page) has n edges, (11) the sum of all distances between points clicked on with the cursor, (12) average, minimum, maximum, and standard deviation of all distances, and (13) density of selected points per 10,000 µm2. From the MST, the following features are calculated by the system: (1) number of points, (2) total, average, minimum, and maximum MST line length, (3) number and percentages of points with one neighbor, two neighbors, three neighbors, four neighbors, and five neighbors composed in each field. The values per case result from measurements in the five fields taken together, and for each of the features, the mean and standard deviation (SD) are calculated.

94

Baak and Kruse

Fig. 5. (A) Cervical intraepithelial neoplasias. Model used at our laboratory to grade cervical intraepithelial neoplasia (CIN) lesions. This is the 90th percentile of the stratification index and the number of Ki67-positive nuclei per 100 µm basal membrane, which is the best-discriminating set of Ki67-only features to distinguish the three CIN grades at the same time. (B) Survival curves of patients with different combinations of the Ki-67 SI90 and MIDTHIRD. This is used as the progression model for the Ki67-only features. Log rank is the test statistic used for Kaplan-Meier survival analysis. P = probability of no significant difference between the two subgroups epithelium, the basal membrane not parallel with the luminal surface (as a result of epithelial budding), a very small area of CIN (typically less than 30 µm), no orientation possible, or badly damaged epithelium (as a result of diathermic or mechanical biopsy distortion). 2. When using the MIB-1-positive cell cluster criterion to distinguish histologically low-grade CIN lesions from normal and reactive cervical lesions, MIB-1-positive tangentially cut parabasal nuclei and inflammatory cells have to be carefully

Use of Biomarkers in the Evaluation of CIN

95

Fig. 5. (continued from opposite page) analyzed. (C) Two-dimensional prognostic classification model of Ki-67-only features for early CIN lesions, to predict progression-or-not to CIN3. (D) Scatter plot of the 90th percentile of the stratification index of the Ki67-positive nuclei and the % Rb-positive nuclei in the deep half layer of the epithelium. (E) Decision diagram of the different Ki67 features, retinoblastoma protein, and cytokeratins -14 and -13, to predict the likelihood of cervical epithelium to progress or not to high CIN grade, after a histological early CIN lesion diagnosis in that patient. excluded. Inflammatory cells can be recognized by their typical (small) lobulated or ellipsoid nuclei. Tangentially cut parabasal epithelium is characterized by intraepithelial stroma with or without capillaries, and/or remarkably concentric parabasal cells in the upper parts of the epithelium. In such cases, MIB-1 positivity below the level of these intraepithelial basal cell nests, which could be falsely interpreted as middle- or upper-layer positivity, has to be ignored. Figure 7A shows a tangentially cut epithelium with many MIB-1-positive cell clusters in

96

Baak and Kruse

Fig. 6. Typical immunohistochemical images of the different features in normal cervical epithelium, a nonprogressive and a progressive early cervical intraepithelial neoplasia (CIN) lesion. the upper two-thirds of the epithelium, which is clearly a false-positive result. In this case, tangential cutting is evident by the features mentioned above. Figure 7B shows a reactive epithelium with one MIB-1-positive cell “cluster,” which were inflammatory cells. Only one of the 48 non-CIN cases, an immature squamous metaplasia (ISM), was positive for the MIB-1-positive cell cluster. This single false-positive case showed a special, easily recognizable MIB-1 pattern, which differed from CIN, as the MIB-1 staining in the nuclei is not diffuse (as in CIN), but clumped. Moreover, positive nuclei are somewhat less densely packed than in CIN (Fig. 7C).

Use of Biomarkers in the Evaluation of CIN

97

Fig. 7. <(A) Tangentially cut epithelium, left = hematoxylin and eosin (H&E), right = MIB-1, with many MIB-1-positive cell clusters in the “upper two-thirds” of the epithelium. This is clearly a false-positive result. Tangential cutting is evident in such a case by intraepithelial stroma with or without capillaries, and/or remarkable concentric parabasal cells in the higher parts of the epithelium. (B) Reactive epithelium with one MIB-1-positive cell cluster (broad arrow), which were inflammatory cells. These can be recognized by their typical (small) lobulated or ellipsoid nuclei. The other more mature granulocytes (triangles) were negative. Note the much larger MIB-1positive parabasal nuclei (thin arrows). (C). Immature squamous metaplasia can be MIB-1 cluster positive. This false-positive case showed a special, easily recognizable MIB-1 staining pattern, different from cervical intraepithelial neoplasia (CIN), as the MIB-1 staining in the nuclei is not diffuse (as in CIN) but clumped (see inset, nucleus at higher magnification). Moreover, positive nuclei (arrows) are somewhat less densely packed than in CIN. 3. Multivariate survival analysis (Cox proportional hazards model) was performed. The MIDTHIRD and the Si90 was the best combination of (Ki67-only) features to distinguish cases with and without progression (Ki67 and pRb features are the best bivariate combination of different molecular markers).

98

Baak and Kruse

4. Early CIN lesions are small, and occasionally on re-cuts the lesion can no longer be detected in small biopsies. We have therefore started to routinely provide the surgical pathologists in our laboratory with both a hematoxylin-eosin- and Ki67stained serial section. Oriented embedding, adequate fixation, and serial sectioning of the biopsies will largely solve the other problems.

References 1. Heatly, M. K. (2002) How should we grade CIN? Histopathology 40, 377–390. 2. Keenan, S. J., Diamond, J., McCluggage, W. G., et al. (2000) An automated machine vision system for the histological grading cervical intraepithelial neoplasia (CIN). J. Pathol. 192, 351–362. 3. McCluggage, W. G., Bharucha, H., Caughley, L. M., et al. (1996) Interobserver variation in the reporting of cervical colposcopic biopsy specimens: comparison of grading systems. J. Clin. Pathol. 49, 833–835. 4. Ismail, S. M., Colclough, A. B., Dinnen, J. S., et al. (1990) Reporting cervical intra-epithelial neoplasia (CIN): intra and inter-pathologist variation and factors associated with disagreement. Histopathology 16, 371–376. 5. Ismail, S. M., Colclough, A. B., Dinnen, J. S., et al. (1989) Observer variation in histopathological diagnosis and grading of cervical intraepithelial neoplasia. BMJ 298, 707–710. 6. Robertson, A. J., Anderson, J. M., Swanson Beck, J., et al. (1989) Observer variability in histopathological reporting of cervical biopsy specimens. J. Clin. Pathol. 42, 231–238. 7. Stoler, M. H. and Schiffman, M. (2001) Atypical squamous cells of undetermined significance—Low-Grade Squamous Intraepithelial Lesion Triage Study (ALTS) group. Interobserver reproducibility of cervical cytologic and histologic interpretations: realistic estimates from the ASCUS-LSIL Triage Study. JAMA 285, 1500–1505. 8. Nafussi, A. I. and Colquhoun, M. K. (1990) Mild cervical intraepithelial neoplasia (CIN1)—a histological overdiagnosis. Histopathology 17, 557–561. 9. Creagh, T., Bridger, J. E., Kupek, E., et al. (1995) Pathologist variation in reporting cervical borderline epithelial abnormalities and cervical intraepithelial neoplasia. J. Clin. Pathol. 48, 59–60. 10. Baak, J. P. (1991) Manual of Quantitative Pathology in Cancer Diagnosis and Prognosis. Springer-Verlag, Heidelberg, Germany, pp. 7–18. 11. Klaes, R., Benner, A., Friedrich, T., et al. (2002) p16INK4a immunohistochemistry improves interobserver agreement in the diagnosis of cervical intrapithelial neoplasia. Am. J. Surg. Pathol. 26, 1389–1399. 12. Pirog, E. C., Baergen, R. N., Soslow, R. A., et al. (2002) Diagnostic accuracy of cervical low-grade squamous intraepithelial lesions is improved with MIB-1 immunostaining. Am. J. Surg. Pathol. 26, 70–75. 13. Kruse, A. J., Baak, J. P., Helliesen, T., et al. (2002) Evaluation of MIB-1-positive cell clusters as a diagnostic marker for cervical intraepithelial neoplasia. Am. J. Surg. Pathol. 26, 1501–1507.

Use of Biomarkers in the Evaluation of CIN

99

14. Kruse, A. J., Baak, J. P. A., de Bruin, P. C., et al. (2001) Ki67 immunoquantitation in cervical intraepithelial neoplasia (CIN): a sensitive marker for grading. J. Pathol. 193, 48–54. 15. Kruse, A. J., Baak, J. P. A., de Bruin, P. C., et al. (2001) Relationship between the presence of oncogenic HPV DNA assessed by polymerase chain reaction and Ki67 immunoquantitative features in cervical intraepithelial neoplasia. J. Pathol. 195, 557–562. 16. Kruse, A. J., Baak, J. P. A., Janssen, E. A., et al. (2003) Low and high risk CIN1 and 2 lesions: prospective value of grade, HPV and Ki67 immunoquantitative variables. J. Pathol. 199, 462–470. 17. Kruse, A. J., Baak, J. P. A., Janssen, E. A., et al. (2004) Ki67 predicts progression in early CIN: Validation of a multivariate progression-resk model. Cell Oncol. 26, 13–20. 18. Kruse, A. J., Gudlaugsson, E., Helliesen, T., et al. (2004) Evaluation of prospective routine application of Ki67 immunoquantitation in early CIN for short-term progression risk assessment. Anal. Quant. Cytol. Histol. 26, 134–140. 19. Kruse, A. J., Skaland, I., Janssen, E. A., et al. (2004) Quantitative molecular parameters to identify low and high risk early CIN lesions: role of markers of proliferative activity and differentiation and Rb availability. Int. J. Gynecol. Pathol. 23, 100–109.

HPV DNA Detection and Typing

101

9 HPV DNA Detection and Typing in Cervical Scrapes Peter J. F. Snijders, Adriaan J. C. van den Brule, Marcel V. Jacobs, René P. Pol, and Chris J. L. M. Meijer Summary Polymerase chain reaction (PCR)-based assays that use consensus primers to detect DNA of a broad spectrum of human papillomavirus (HPV) types in a single assay belong to the most frequently used methods to detect HPV in clinical specimens. Here, we describe in detail one of these assays, the so-called GP5+/6+ PCR method, which can be used to detect and type HPV DNA in crude extracts of cervical scrapes and biopsy specimens. Following PCR with GP5+ and GP6+ primers, the latter of which is biotinylated at its 5' end, the presence of DNA of any of the high-risk genotypes can easily be determined by an enzyme immunoassay (EIA). In this assay, PCR products are captured in streptavidin-coated wells of a microtiter plate, denatured by alkaline treatment, and hybridized to cocktails of digoxigenin-labeled oligonucleotides specific for high-risk or low-risk HPV types. The resulting hybrids can then be detected by alkaline phosphatase conjugated anti-digoxigenin polyclonal antibodies and substrate followed by optical density reading. Subsequently, EIA-positive PCR products can be typed by a reverse line blot genotyping procedure that, using a miniblotter device, enables typing of up to 39 samples with specific oligonucleotide probes for 37 different HPV (sub)types in a single assay.

1. Introduction Given the fact that infection with high-risk human papillomaviruses (HPVs) has been recognized as the key causative event for cervical cancer (1,2), establishing a place for high-risk HPV testing in cervical screening programs and clinical practice is the aim of many ongoing studies (3). The HPV tests that are currently most widely applied rely on detection of DNA of a broad spectrum of HPV types in a single assay, either with or without a subsequent typing step. These include the commercially available, US Food and Drug Administration (FDA)-approved Hybrid Capture 2 method, and consensus primer (i.e., primers that recognize the DNA of multiple HPV genotypes) polymerase chain

From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

101

102

Snijders et al.

reaction (PCR) assays (reviewed in ref. 3). The so-called PGMY, SPF10, and GP5+/6+ primer pairs, which all target sequences of the viral L1 open reading frame, are nowadays most frequently used. Among these, the GP5+/6+ PCR procedure has been clinically validated in several studies (4–8), has been used in many International Agency for Research on Cancer (IARC) case–control and prevalence survey studies (2,9,10), and formed the basis of an epidemiological classification of HPV types associated with cervical cancer worldwide (2). With the aid of the GP5+/6+ PCR method, the presence or absence of highrisk vs low-risk HPV types can be determined using an enzyme immunoassay (EIA) format. For this EIA procedure, the GP6+ primer is biotinylated at its 5' end, which upon incorporation allows amplified DNA to bind to streptavidincoated wells in a microtiter plate (11,12). Subsequently, captured PCR products are denatured by alkaline treatment and hybridized to cocktails of digoxigenin-labeled oligonucleotides specific for high-risk or low-risk HPV types. The resulting hybrids can be detected by alkaline phosphatase conjugated anti-digoxigenin polyclonal antibodies and pNPP (p-nitrophenyl phosphate) substrate followed by optical density reading. Further typing of EIA-positive PCR products can be easily performed by reverse line blot (RLB) genotyping. This method enables the non-radioactive hybridization of the GP5+/6+ PCR products of up to 39 samples with specific oligonucleotide probes for 37 different HPV (sub)types in a single assay (12). Hereto, the oligonucleotide probes are covalently attached to a membrane in parallel lines using a miniblotter. After binding of the oligos, the membrane is removed from the miniblotter and rotated 90°. The slots of the miniblotter, which now are perpendicular to the oligo lines, are filled with the biotinylated PCR products. Hybridization takes place in the miniblotter, and if a particular HPV type is present in a sample, hybridization will occur on the crossing point of the sample slit with the respective HPV probe line. Hybrids are then visualized using peroxidase-labeled streptavidin, which interacts with the biotin of the PCR product, followed by enhanced chemiluminescent (ECL) detection. This chapter describes the use of the GP5+/6+ PCR method followed by EIA and RLB to detect and type HPV DNA in cervical scrapes. 2. Materials (see Note 1) 2.1. Preparation of Crude Cell Extracts of Cervical Scrapes 1. Cervex (Rovers) or cytobrushes for taking cervical scrapes. 2. Phosphate-buffered saline (PBS): 0.82 % (w/v) NaCl, 0.19 % (w/v) Na2HPO4· 2H2O, 0.03% (w/v) NaH2PO4·2H2O, adjusted with HCl to pH 7.4. 3. Merthiolate (to be used as anti-fungal agent). 4. 10 mM Tris HCl, pH 7.4. 5. Laminar flow hood.

HPV DNA Detection and Typing

103

6. 7. 8. 9. 10. 11. 12.

Bleaching liquor. Vortex. 1.5-mL reaction tubes with screw caps. Water bath. Centrifuge. Forceps. Two negative sample preparation controls consisting of 10 mM Tris-HCl, pH 7.4, incorporated during each sample-preparation step. 13. 70% Ethanol.

2.2. β-Globin PCR 1. 2. 3. 4. 5. 6. 7.

8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.

25 mM MgCl2 (Perkin-Elmer). 10X PCR buffer: 100 mM Tris-HCl, pH 8.3 (Perkin-Elmer). 10X dNTP solution: 2 mM dATP/dCTP/dGTP/dTTP (Perkin-Elmer). Thermostable DNA polymerase (AmpliTaq; Perkin-Elmer). 25 pmol/µL BGPCO3 oligonucleotide primer (5'-ACACAACTGTGTTCACTAGC3') in distilled water. 25 pmol/µL BGPCO5 oligonucleotide primer (5'-GAAACCCAAGAGTCTTCTCT3') in distilled water. β-globin PCR mix (for a 50-µL reaction volume): 1X dNTP solution, 1X PCR buffer, 1.5 mM MgCl2, 25 pmol of each BGPCO3 and BGPCO5 primer, 1 unit AmpliTaq DNA polymerase, deionized water to a total volume of 40 µL. 0.2-mL thin-wall PCR tubes. PCR thermocycler. PCR cabinet for processing of samples with built-in ultraviolet (UV) sterilizer (Labcaire). Dilutions (10 ng, 1 ng, and 100 pg) HP- (human placental) DNA (Sigma), to be used as β-globin PCR positive controls. Two PCR negative controls consisting of PCR mixture with distilled water instead of target DNA, included in each PCR assay. Multipurpose agarose (Roche). 10X Tris-borate/ethylene diamine tetraacetic acid (EDTA) (TBE), pH 8.3 (BioWhittaker). 2 mg/mL ethidium bromide. Loading buffer: 15% (v/v) ficoll, 0.6% (w/v) sodium dodecyl sulfate (SDS), 0.03%(w/v) EDTA, 0.05% (w/v) bromophenol blue. Electrophoresis apparatus, including gel trays and combs. DNA size marker (e.g., plasmid DNA digested with restriction enzyme[s]) with fragments within the range of 100 to 500 basepairs (bp).

2.3. HPV GP5+/6+ PCR 1. Reagents 1 to 4, 8 to 10, and 12, as listed under Subheading 2.2. 2. 25 pmol/µL GP5+ oligonucleotide primer (5'-TTTGTTACTGTGGTAGATACTAC-3') in distilled water.

104

Snijders et al.

Fig. (A) Human papillomavirus (HPV) type specific oligoprobes used for enzyme immunoassay (EIA) detection of GP5+/6+ polymerase chain reaction (PCR) products (indicated in 5' to 3' direction). All oligonucleotides have to be digoxigenin-11-ddUTP labeled. 3. 25 pmol/µL 5'-end biotin-labeled GP6+ oligonucleotide primer (5'-GAAAAATAAACTGTAAATCATATTC-3') in distilled water. 4. GP5+/6+ PCR mix (for a 50-µL reaction volume): 1X dNTP solution, 1X PCR buffer, 3.5 mM MgCl 2, 25 pmol of each GP5+ and biotinylated GP6+ primer, 1 unit AmpliTaq DNA polymerase, deionized water to a total volume of 40 µL. 5. Serial dilutions (10 ng, 1 ng, and 100 pg) of DNA of the cervical cancer cell line SiHa (containing 1 to 2 HPV-16 copies per cell; American Type Culture Collection) in 100 ng HP-DNA, to be used as HPV PCR positive controls and referred to as SiHa-10 ng, SiHa-1 ng, and SiHa-100 pg.

HPV DNA Detection and Typing

105

(B) HPV type specific oligoprobes used for RLB typing of GP5+/6+ PCR products (indicated in 5' to 3' direction). All oligonucleotides have to be labeled with a 5' terminal amino group.

2.4. Enzyme Immunoassay (EIA) Detection Using Digoxigenin-Labeled Oligonucleotide Probes 1. High-capacity streptavidin-coated microtiter plates (Roche). 2. Digoxigenin 11 ddUTP-labeled oligonucleotide probes. For probe sequences, see Fig. 1A. 3. Denaturation reagent: freshly made 0.2 N NaOH. 4. 20X SSC: 3 M NaCl , 0.3 M sodium citrate, adjusted with NaOH to pH 7.0 (Cambrex). 5. Hybridization and wash buffer: freshly made 1X SSC, 0.5% Tween-20.

106

Snijders et al.

6. 7. 8. 9.

Anti-digoxigenin (Fab fragments) conjugated alkaline phosphatase (Roche). Substrate: pNPP and Tris-HCl tablets (Sigma). Temperature incubator. Enzyme-linked immunosorbet assay (ELISA) reader with 405-nm and 630-nm filters. 10. Automated plate washer. 11. Biotinylated PCR products derived from pHPV 6 (for low-risk HPV cocktail probe) and pHPV-16 DNA (for high-risk HPV cocktail probe) plasmids, generating an OD405 value of approx 0.6 ± 0.2 after overnight substrate incubation in the EIA procedure. These EIA-positive controls provide information about possible failure of the capturing, denaturation, hybridization, and staining steps used in EIA procedures.

2.5. Reverse Line Blot Analysis 1. 2. 3. 4. 5. 6. 6. 8. 9. 10. 11. 12. 13.

Miniblotter MN45 (Immunetics). Foam cushions (Immunetics). Biodyne C Membrane (Pall Biosupport). Oligonucleotide probes with 5' terminal amino group. For probe sequences, see Fig. 1B. Hyperfilm ECL (Amersham Bioscience). Streptavidin-POD conjugate (Roche) ECL detection reagents (Amersham Bioscience) 20X SSPE: 3 M NaCl, 200 mM NaH2PO4, 20 mM EDTA (Invitrogen). SDS (BDH). 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDAC; Sigma). 10 M NaOH. 0.5 M NaHCO3, pH 8.4. 20 mM EDTA, pH 8.0.

3. Methods The methods described below outline (1) preparation of crude extracts of cervical scrapes, (2) β-globin PCR as a quality control of target DNA, (3) HPV GP5+/6+ PCR, (4) EIA detection of high-risk or low-risk HPV-specific GP5+/ 6+ PCR products, and (5) reverse line blot hybridization of GP5+/6+ PCR products for HPV typing (see Note 2). Background information about these methods is provided elsewhere (8,11,12).

3.1. Preparation of Crude Cell Extracts of Cervical Scrapes by Consecutive Freeze–Thaw and Boiling Steps 1. After a classic cervical smear has been made on a slide, cervical scrapes are collected by placing the brush in 5 mL sterile PBS, 0.005% merthiolate. 2. Vortex the scrape suspension vigorously and remove the brush with sterile forceps (intermittently heated and put in 70% ethanol).

HPV DNA Detection and Typing

107

3. Pellet the cells by centrifugation at 3000g for 10 min, and decant the supernatant into a container with bleaching liquor. 4. Add 1 mL of 10 mM Tris-HCl (pH 7.4) to the cell pellet using a disposable pipet. 5. Homogenize the cell suspension by gently vortexing, and transfer to a 1.5-mL screw-cap reaction tube. 6. Pipet 100 µL of the cell suspension into a new 1.5-mL screw-cap tube. 7. Freeze the 100-µL cell suspension at –80°C for at least 1 h. The remaining 0.9-mL suspension can be stored at –80°C for later use. 8. Thaw the 100-µL suspension, boil at 100°C for 10 min in a water bath, and cool at room temperature. 9. Centrifuge the 100-µL suspension for 1 min at 3000g, vortex, and take 10-µL aliquots for PCR purposes (see Note 3).

3.2. β-Globin PCR Procedure 1. In a laminar flow hood, add on ice 10 µL of crude cell lysate to a PCR tube using a pipet with a sterile aerosol-resistant tip. 2. Add using a repeat pipet with a sterile tip in a PCR Prep Station, 40 µL β-globin PCR mix to the PCR tubes containing the crude cell lysates. 3. Centrifuge for 15 s at maximum speed in a microcentrifuge, and transfer the PCR tubes to the PCR thermocycler, located in a physically separated laboratory. 4. Run 40 cycles of betaglobin PCR amplification after an initial 4-min denaturation step at 94°C. Each cycle should include a denaturation step at 94°C for 60 s, an annealing step at 58°C for 120 s, and an elongation step at 72°C for 90 s. The final elongation step is prolonged for a further 4 min. 5. Include in each PCR round the two negative sample preparation controls, two PCR negative controls, and the dilutions of HP DNA. 6. Prepare a 1.5% agarose gel containing 0.05 µg/mL ethidium bromide. 7. Mix 3 µL loading buffer with 10 µL PCR product and electrophorese against a size marker for 1 h at 200 mA. 8. Visualize the specific betaglobin PCR products of 209 bp by exposing the gel to UV light.

The 10 ng, 1 ng, and 100 pg HP DNA samples, serving as positive controls, should always generate a specific signal of 209 bp after gel electrophoresis. The negative controls should not generate any signal. Samples showing a specific 209-bp betaglobin PCR signal are considered qualitatively adequate to be subjected to HPV PCR. Samples without a 209-bp signal are considered inadequate for HPV PCR.

3.3. HPV GP5+/GP6+ PCR Procedure 1. In a laminar flow hood, add on ice 10 µL of crude cell lysate to a PCR tube using a pipet with a sterile aerosol-resistant tip. 2. Add in a PCR cabinet 40 µL GP5+/6+ PCR mix to the PCR tube containing the crude cell lysate, using a repeat pipet with a sterile tip.

108

Table 1 Snijders et al. Polymerase Chain Reaction Cycling Conditions for GP5+/6+ PCR Using PTC225* Thermocyclers (Ramping Schedules Are Indicated in bold) PTC225 (Biozym)

PE9700 (Perkin Elmer)

Start: 4 min at 94°C Cycles (n = 40): 20 s at 94°C (denaturation) in 24 s to 90°C in 66 s to 48°C in 30 s to 38°C 30 s at 38 °C (annealing) in 18 s to 42°C in 42 s to 66°C in 18 s to 71°C 80 s at 71°C (elongation) in 24 s to 69°C in 90 s to 94°C

Start: 4 min at 94°C Cycles (n = 40): 20 s at 94°C (denaturation) in 32 s to 38°C

Final step: 4 min at 71°C

Final step: 4 min at 71°C

30 s at 38°C (annealing) in 17 s to 71°C

80 s at 71°C (elongation) in 8 s to 94°C

*Ramp speed: 9600.

3. Centrifuge for 15 s at maximum speed in a microcentrifuge and transfer the PCR tubes to the PCR thermocycler, located in a physically separated laboratory. 4. Run 40 cycles of GP5+/bioGP6+ PCR amplification after a 4-min denaturation step of 94°C. Each cycle should include a denaturation step at 94°C for 20 s, an annealing step at 38°C for 30 s, and an elongation step at 71°C for 80 s, using ramping times as specified in Table 1 for the different thermocyclers. The final elongation step is prolonged for a further 4 min (see Note 4). 5. Include in each PCR run the two negative sample preparation controls, two PCR negative controls, and the SiHa-10 ng, SiHa-1 ng, and SiHa-100 pg positive controls.

3.4. Enzyme Immunoassay for Detection of GP5+/6+ PCR Products The enzyme immunoassay (EIA) involves a capturing step, a denaturation step, a hybridization step, and a detection step, as described under Subheadings 3.4.1.–3.4.4. how cut-off values should be calculated and how EIA results should be interpreted is described under Subheading 3.4.5.

3.4.1. Capturing of Biotinylated DNA 1. Pipet 5 µL of biotinylated PCR product into a micro-well of a streptavidin-coated micro-titer plate using a multichannel pipettor with clean tip (see Note 5).

HPV DNA Detection and Typing

109

2. Add 50 µL freshly made 1X SSC, 0.5% Tween-20 solution into the same microwell using a repeat pipettor with a clean tip. 3. Cover plate with plate sealer and incubate micro-wells for 60 min at 37°C.

3.4.2. DNA Denaturation 1. Wash micro-wells three times with freshly made 1X SSC, 0.5% Tween-20, using an automated plate washer (see Note 6). 2. Tap excess liquid out of the inverted plate onto clean absorbent paper and add 100 µL freshly made 0.2 N NaOH to each well using a repeat pipettor with a clean tip (see Note 6). 3. Cover plate with plate sealer and incubate for 15 min at room temperature.

3.4.3. Probe Hybridization According to the recently described epidemiological classification of HPV types associated with cervical cancer, the HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 73, and 82 (IS39 and W13B/MM4 subtypes) can be considered as high-risk, or probably high-risk (2). Consequently, a highrisk HPV cocktail probe can be prepared of a panel of digoxigenin-11-ddUTPlabeled oligonucleotides specific for these 18 HPV types. Likewise, a low-risk HPV cocktail probe can be prepared by mixing digoxigenin-11-ddUTP-labeled oligonucleotides specific for HPV 6, 11, 34, 40, 42, 43, 44, 54, 55, 57, 61, 70, 71, 72, 81, 83, 84, and CP6108. For EIA probe sequences, see Fig. 1A. A total of 0.5 pmol of each individual probe is used per micro-well. For 100 tests, add 50 pmol of each individual HPV type-specific oligoprobe to 5 mL (final volume) 1X SSC, 0.5% Tween-20 and vortex gently. The cocktail probes can be stored at –20°C for periods up to 1 yr until use. 1. Wash micro-wells three times with freshly made 1X SSC, 0.5% Tween-20 using an automated plate washer. 2. Tap excess liquid out of the inverted plate onto clean absorbent paper. 3. Add 50 µL probe mixture (containing 10 pmol of each digoxigenin-11-ddUTPlabeled oligonucleotide probe per mL 1X SSC, 0.5% Tween-20) into each well using a repeat pipet with a clean tip. 4. Cover plate with plate sealer and seal the plate in a plastic bag or plastic wrap to prevent dehydration during the hybridization step. Hybridize for 60 min at 55°C.

3.4.4. Detection of Hybrids 1. Wash micro-wells three times with freshly made 1X SSC, 0.5% Tween-20, using an automated plate washer. 2. Tap excess liquid out of the inverted plate onto clean absorbent paper. 3. Add 50 µL of the diluted (1:10,000) conjugate using a repeat pipet with clean tip. 4. Cover plate with plate sealer and incubate for 60 min at 37°C.

110

Snijders et al.

5. Wash micro-wells five times with freshly made 1X SSC, 0.5% Tween-20, using an automated plate washer (see Note 7). 6. Tap excess liquid out of the inverted plate onto clean absorbent paper. 7. Add 100 µL freshly made substrate solution into each well using a repeat pipet with a clean tip. 8. Cover plate with plate sealer and seal the plate in a plastic bag or Plastic wrap. 9. Incubate overnight (equivalent to approx 16 h) at 37°C. 10. Read absorbance with an EIA reader at 405 nm using a reference filter at 630 nm.

3.4.5. Interpretation of EIA Results and Cut-Off Calculation A GP5+/6+ PCR EIA run should be considered valid when (a) all negative controls give OD405nm values <0.1, (b) the lowest concentration of positive PCR controls (i.e., SiHa-100 pg) gives an OD405nm value near or higher than the cut-off value and the SiHa-1 ng control a value that is clearly higher than the cut-off when using the high-risk HPV cocktail probe, and (c) the EIA positive controls give an OD405nm value of >0.5. If (c) is invalid, all PCR products should be subjected to an additional EIA round with new reagents. If (c) is valid but (a) and/or (b) not, the whole PCR procedure should be repeated with new PCR reagents. The following equation should be used to determine the cut-off value: Cut-off = 3 × mean OD405nm value of the four negative controls. A sample should be considered positive in case its OD405nm > cut-off, and negative when the OD405nm cut-off.

3.5. HPV Typing by Reverse Line Blot Hybridization GP5+/6+ PCR products that reveal a positive signal in the EIA can subsequently be typed using the RLB hybridization format specified as follows. The RLB procedure consists of three steps: (1) covalent coupling of oligonucleotide probes to the membrane, (2) hybridization with PCR product and detection, and (C) stripping of membranes for re-use.

3.5.1. Covalent Coupling of Oligonucleotide Probes to the Membrane All oligonucleotide probes are synthesized with a 5'-terminal C6 amino group in order to covalently link the oligos to an activated negatively charged Biodyne C membrane. Sequences of all the HPV-specific oligonucleotide probes are shown in Fig. 1B (see Note 8). 1. Dilute the oligonucleotides to a concentration of 200 pmol in 150 µL 500 mM NaHCO3, pH 8.4. 2. Activate the Biodyne C membrane by 10-min incubation in 10 mL freshly prepared 16% (w/v) EDAC in deionized water, in a rolling bottle at room temperature.

HPV DNA Detection and Typing

111

3. Rinse the membrane with water and place it on a support cushion in a clean miniblotter system. Turn the screws hand tight. Remove residual water from the slots by aspiration. 4. Fill the slots of the miniblotter with 150 µL of the diluted oligonucleotide solutions but do not fill the first and the last slot with oligos. 5. The first and the last slot are used to mark the edges of the membrane by filling these slots with drawing-pen ink diluted 1:100 in water. 6. After all samples are added, incubate for at least 1 min at room temperature. 7. Remove the oligonucleotide solutions by aspiration in the order in which they were applied. 8. Remove the membrane from the miniblotter using forceps and incubate the blot in 100 mM NaOH for 10 min (at maximum) to inactivate the membrane (see Note 9). 9. Rinse the membrane at room temperature for 1 min in distilled water. 10. Wash the membrane in a plastic container under gentle shaking in 100 mL 2X SSPE, 0.1% SDS for 5 min at 60°C (see Note 10). 11. The membrane is now ready for use. 12. If the membrane is to be stored at this point, wash the membrane in a plastic container under gentle shaking in 100 mL 20 mM EDTA (pH 8) for 1 min at room temperature, seal it in plastic or plastic wrap to avoid dehydration, and store the membrane at 4°C until use.

3.5.2. Hybridization With PCR Product and Detection Prepare the following buffers from concentrated stocks, using deionized or double-distilled water for dilution (quantities for one membrane): a. b. c. d.

100 mL 2X SSPE, 0.1% SDS, room temperature. 200 mL 2X SSPE, 0.5%SDS, 42°C (hybridization temperature). 200 mL 2X SSPE, 0.5%SDS, 51°C (posthybridization wash temperature). 200 mL 2X SSPE, room temperature.

All buffers should be prewarmed before use. Diluted buffers should not be stored longer than 2 d. The buffers can be prewarmed overnight for use on the next day. 1. Add 10 µL of the PCR product to 150 µL 2X SSPE, 0.1% SDS. 2. Heat-denature the diluted PCR product for 10 min at 96°C (in the PCR thermocycler) and cool on ice immediately. 3. Incubate the membrane for 5 min at room temperature in 100 mL 2X SSPE, 0.1% SDS. 4. Place the membrane on a support cushion into the miniblotter, in such a way that the slots are perpendicular to the line pattern of the applied oligonucleotides. Channels must be between the two ink lines. 5. Remove residual fluid from the slots of the miniblotter by aspiration.

112

Snijders et al.

6. Fill the slots with the diluted PCR product (avoid air bubbles!). Empty slots adjacent to filled slots should be filled with 2X SSPE, 0.1% SDS, to prevent crossflow. Hybridize for a maximum of 60 min at 42°C on a horizontal surface. Avoid cross-flow to the neighboring slots (no rocking or shaking!). 7. Remove the samples from the miniblotter by aspiration and take the membrane from the miniblotter using forceps. 8. Wash the membrane twice in 100 mL 2X SSPE, 0.5% SDS for 10 min at 51°C. 9. 1:4000 diluted peroxidase-labeled streptavidin conjugate in 2X SSPE, 0.5% SDS, for 30–60 min at 42°C in a rolling bottle. 10. Wash the membrane twice in 100 mL of 2X SSPE, 0.5% SDS for 10 min at 42°C. 11. Rinse the membrane twice with 100 mL of 2X SSPE for 5 min at room temperature. 12. For chemiluminescent detection of hybridizing DNA, incubate the membrane for 1–2 min in 20 mL ECL detection liquid. Use a special box dedicated for this step. 13. Cover the membrane with an overhead sheet or with plastic wrap and expose a Hyperfilm ECL to the membrane for 1–10 min. 14. If necessary, the membrane can be directly used again to expose another film for a shorter or longer period.

3.5.3. Stripping of Membranes for Reuse 1. Wash the membrane twice in 1% SDS at 80°C for 30 min. 2. Wash the membrane in 20 mM EDTA, pH 8.0, for 15 min at room temperature. 3. Seal the membrane in plastic or plastic wrap to avoid dehydration and store the membrane at 4°C until use (see Note 11).

4. Notes 1. Make all buffers using distilled or deionized water. 2. The main drawback of PCR is its high sensitivity. Therefore, reliable execution requires strong laboratory discipline and specialized containment conditions to prevent contamination of samples by PCR products or sample-to-sample carryover. Physically separated rooms for sample processing, PCR preparation, PCR amplification, and PCR product analysis are necessary. During the whole procedure sterile disposable tubes, aerosol-resistant pipet tips, and gloves must be used. Never transfer any kind of material (including pencils, paper, books) from the PCR amplification/post-PCR analysis laboratory to the specimen/PCR mixture preparation place. Specimens for PCR should be prepared in a laminar-flow hood equipped with UV light. Use separate pipet sets (with aerosol-resistant tips) for sample preparation and PCR mixture preparation. 3. Cervical scrapes that are collected in preservation media used for liquid-based cytology cannot be subjected to the procedure described under Subheading 3.1., but instead require complete DNA extraction using columns or standard phenol/ chloroform procedures before PCR can be carried out. On the other hand, a series of 3 to 12 tissue sections of 5 µm (in total, approx 1 cm2 of tissue) of both formalin-fixed and frozen biopsies can be used to prepare crude samples for PCR. In

HPV DNA Detection and Typing

4.

5.

6.

7.

8.

9.

10.

11.

113

that case, we advise adding 250 µL of lysis mix (10 mM Tris-HCl, pH 7.5, 0.45% Tween-20, 500 µg of proteinase K) to the sections and incubating overnight at 37°C. Subsequently, the sample can be boiled and centrifuged for 1 min in a standard tabletop centrifuge (8000g). After cooling, 10 µL of the sample can be used for PCR. The PCR cycling conditions are rather crucial for a successful performance of this assay. The use of a different PCR thermocycler may require slightly different cycling conditions, which should be tested first on a SiHa dilution series before being used for clinical samples. When pipetting the PCR products into the wells of a microtiter plate, cover the empty wells that will be filled with products of subsequent samples to avoid possible contamination by biotinylated PCR products. Take care that during the washing steps each well is filled with wash buffer. Inadequate washing will result in increased background signals. The use of freshly prepared reagents (NaOH and 1X SSC, 0.5% Tween-20) is also important for an optimal signal-to-background ratio. Care should be taken to prevent contamination with extraneous alkaline phosphatase during the EIA procedure. Covering the plates after washing steps is especially important, since exogenous alkaline phosphatase may react with the colorimetric substrate used in the EIA protocol and give rise to false-positive results. Unless stated otherwise, all incubations should take place in a plastic container under gentle shaking. Use dedicated plastic containers for the washing steps. Chemicals that are absorbed (and released) by the plastic may interfere with the assay. Inactivation of the membrane by NaOH incubation for longer than 10 min will result in weak hybridization signals. Thoroughly clean the miniblotter with neutral pH soap and a dedicated brush before and after use. The choice of SDS is of critical importance for the success of the reverse line blot assay. Some brands of SDS may result in a loss of signal, while others result in high background. Do not use a different brand of SDS until it is proven to be suited for this purpose. Preferably, the membrane should be stripped as soon as possible, but this can also be done a few days after the hybridization. However, it is important to prevent dehydration of the blot at this point. Dehydration of blots may result in intense background staining and irreversible binding of PCR products.

References 1. Bosch, F. X., Lorincz, A., Munoz, N., Meijer, C. J., and Shah, K. V. (2002) The causal relation between human papillomavirus and cervical cancer. J. Clin. Pathol. 55, 244–265. 2. Munoz, N., Bosch, F. X., de Sanjose, S., et al. (2003) Epidemiologic classification of human papillomavirus types associated with cervical cancer. N. Engl. J. Med. 348, 518–527.

114

Snijders et al.

3. Snijders, P. J., van den Brule, A. J, and Meijer, C. J. (2002) The clinical relevance of human papillomavirus testing: relationship between analytical and clinical sensitivity. J. Pathol. 201, 1–6. 4. Nobbenhuis, M. A., Walboomers, J. M., Helmerhorst, T. J., et al. (1999) Relation of human papillomavirus status to cervical lesions and consequences for cervicalcancer screening: a prospective study. Lancet 354, 20–25. 5. Nobbenhuis, M. A., Meijer, C. J., van den Brule, A. J., et al. (2001) Addition of high-risk HPV testing improves the current guidelines on follow-up after treatment for cervical intraepithelial neoplasia. Br. J. Cancer 84, 796–801. 6. Rozendaal, L., Walboomers, J. M., van der Linden, J. C., et al. (1996) PCR-based high-risk HPV test in cervical cancer screening gives objective risk assessment of women with cytomorphologically normal cervical smears. Int. J. Cancer 68, 766–769. 7. Rozendaal, L., Westerga, J., van der Linden, J. C., et al. (2000) PCR based high risk HPV testing is superior to neural network based screening for predicting incident CIN III in women with normal cytology and borderline changes. J. Clin. Pathol. 53, 606–611. 8. Jacobs, M. V., Snijders, P. J. F., Voorhorst, F. J., et al. (1999) Reliable high risk HPV DNA testing by polymerase chain reaction: an intermethod and intramethod comparison. J. Clin. Pathol. 52, 498–503. 9. Anh, P. T., Hieu, N. T., Herrero, R., et al. (2003) Human papillomavirus infection among women in South and North Vietnam. Int. J. Cancer 104, 213–220. 10. Sukvirach, S., Smith, J. S., Tunsakul, S., et al. (2003) Population-based human papillomavirus prevalence in Lampang and Songkla, Thailand. J. Infect. Dis. 187, 1246–1256 11. Jacobs, M. V., Snijders, P. J., van den Brule, A. J., Helmerhorst, T. J., Meijer, C. J., and Walboomers, J. M. (1997) A general primer GP5+/GP6(+)-mediated PCRenzyme immunoassay method for rapid detection of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical scrapings. J. Clin. Microbiol. 35, 791–795. 12. van den Brule, A. J., Pol, R., Fransen-Daalmeijer, N., Schouls, L. M., Meijer, C. J., and Snijders, P. J. (2002) GP5+/6+ PCR followed by reverse line blot analysis enables rapid and high-throughput identification of human papillomavirus genotypes. J. Clin. Microbiol. 40, 779–787.

HPV Typing: Premalignant Lesions

115

10 HPV DNA Detection and Typing in Inapparent Cutaneous Infections and Premalignant Lesions Maurits de Koning, Linda Struijk, Mariet Feltkamp, and Jan ter Schegget Summary Epidemiological studies, which address the role of human papillomavirus (HPV) in the pathogenesis of (pre)malignant cutaneous lesions, focus on the HPV B1 subgroup comprising the so-called epidermodysplasia verruciformis (EV)-associated HPV types. To detect and type HPV DNA in human materials, Polymerase Chain Reaction (PCR)-based assays are used. In this chapter, a nested, broad-spectrum PCR method using a mixture of primers and a typespecific PCR using specific primers are described. The broad-spectrum PCR detects the B1 subgroup of HPV types. HPV typing is performed by sequence analysis of the PCR product. The type-specific PCR detects and types HPV 5a, 8, 15, 17, 20, 24, 36, and 38. These HPV types are representative of the B1 subgroup, because they are evenly distributed over the phylogenetic tree of the B1 subgroup.

1. Introduction Current studies investigating the role of human papillomavirus (HPV) in (pre)malignant cutaneous lesions mainly focus on the epidermodysplasia verruciformis (EV) associated HPV types. These EV-HPV types were originally found in skin lesions from patients with EV. Recently, these types have been found to be associated with premalignant skin lesions such as actinic keratoses and with nonmelanoma skin cancers in (sero)-epidemiological studies (1–6). Phylogenetically, EV-HPV types belong to the HPV B1 subgroup. In the last two decades, several polymerase chain reaction (PCR)-primer sets have been developed to detect EV-HPV types in skin biopsies, plucked hairs, and skin swabs (7–16). These PCRs can be divided into broad-spectrum HPV PCRs, using a mixture of primers, and HPV type-specific PCRs, using HPV type-specific primers. A broad-spectrum PCR is employed for the simulFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

115

116

de Koning, et al.

taneous detection of a subgroup of HPV types. Additionally, it provides information about the presence of novel HPV types, when typing is performed by sequence analysis of the PCR products. Its sensitivity varies for the individual HPV types among the subgroup. The HPV type-specific PCR will give more reliable information about the prevalence or predominance of individual EV-HPV types. In this chapter, we describe a broad-spectrum nested EV-HPV PCR, utilizing a mixture of primers, which we term the general EV-HPV PCR (12), and EV-HPV type-specific PCRs using specific primers for a number of EV-HPV types (4). 2. Materials 2.1. DNA Isolation From Plucked Hairs and Skin Biopsies 1. 0.5% sodium hypochlorite solution. 2. Lysis buffer (L6). Prepare this buffer exactly as originally described by Boom et al. (17): 120 g guanidine thiocyanate (Fluka Chemie AG, Buchs, Switzerland) and 2.6 g Triton X-100 dissolved in 100 mL of 0.1 M Tris-HCl (pH 6.4), and 22 mL of 0.2 M ethylenediamine tetraacetic acid (EDTA) (pH 8.0) at 65°C (see Note 1). Caution: upon contact with acids, guanidine thiocyanate can produce a very toxic gas (HCN). As a precaution, guanidine thiocyanate-containing buffers have to be prepared in a fume hood, and guanidine thiocyanate-containing waste has to be collected in a strong alkaline solution (2 M NaOH, in such an amount that the final concentration could not drop below 0.3 M). 3. Human genomic DNA (50 µg/mL; Promega). 4. Celite suspension: 10 g Celite (Acros Organics, Geel, Belgium) in 49.5 mL of H2O and 500 µL of 35% HCl (see Note 2). 5. Wash buffer (L2): 120 g guanidine thiocyanate dissolved in 100 mL of 0.1 M Tris-HCl (pH 6.4) at 65°C (see Note 1). 6. 70% Ethanol. 7. Acetone. 8. 2 M NaOH. 9. TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 10. Proteinase K buffer: 20 mM CaCl2, 10 mM Tris-HCl, pH 7.5. 11. Proteinase K solution (20 mg/mL): 1 mL proteinase K buffer, 1 mL glycerol, 40 mg fungal proteinase K (Gibco BRL). 12. Sodium dodecyl sulfate (SDS)/proteinase K buffer: 5.85 mL 50mM Tris-HCl/ 50 mM EDTA, 100 µL proteinase K solution (20 mg/mL), 50 µL 20% SDS.

2.2. PCR Analysis 2.2.1. General EV-HPV PCR 1. Bovine serum albumin (BSA) (1 mg/mL). 2. 10 mM deoxynucleoside triphosphates (dATP, dCTP, dGTP, dTTP). 3. Ampli-Taq DNA polymerase (5 U/µL) (Applied Biosystems).

HPV Typing: Premalignant Lesions

117

Table 1 Primers Used in the General EV-HPV and A-Myb Polymerase Chain Reaction Primer pair Ma

Ha

A-Myb

Name CP62 (forward) CP70a (reverse) CP65 (forward) CP69a (reverse) A-Myb1 (forward) A-Myb2 (reverse)

Position relative to HPV8

Sequence 5'-3' GTW AAT GAA AYT TGY AAA TAT CC

6520-6542

AAY TTT CKA CCY ARA GRA TAY TGA TC

7298-7273

CAR GGT CAY AAY AAT GGY AT

6832-6851

TCW GTY ATR TCT ACA TYC CA

7253-7234

Product size

779 base pairs

422 base pairs

CAT GGA ATG CCA ATT TAA CG CAT CCC TAA GTT CGC TGC C

185 base pairs

aThe abbreviations to represent ambiguity are: R (A or G), W (A or T), Y (C or T) and K (G or T). HPV, human papillomavirus.

4. 5. 6. 7.

1 M KCl. 1 M Tris-HCl, pH 8.8. 25 mM MgCl2. Reverse phase high-performance liquid chromatography (RP-HPLC) purified oligonucleotide primers (Table 1). 8. Agarose. 9. Sterile MilliQ water. 10. PCR apparatus with preheated lid and preferably for 48 or 96 tubes.

2.2.2. HPV Type-Specific PCR 1. 10 mM dNTPs. 2. Ampli-Taq Gold DNA polymerase (5 U/µL) and 10X buffer (Applied Biosystems). 3. 25 mM MgCl2. 4. RP-HPLC purified oligonucleotide primers (Table 2). 5. Agarose. 6. Sterile MilliQ water. 7. PCR apparatus with preheated lid and preferably for 48 or 96 tubes.

2.3. DNA Cloning and DNA Sequence Analysis 2.3.1. DNA Cloning 1. TOPO TA Cloning Kit (Invitrogen). 2. 42°C water bath. 3. Luria-Bertani (LB) plates containing 50 µg/mL ampicillin.

118

de Koning, et al.

Table 2 Primers Used in the Human Papillomavirus (HPV) Type-Specific Polymerase Chain Reactions Primer pair HPV5a HPV8 HPV15 HPV17 HPV20 HPV24 HPV36 HPV38

4. 5. 6. 7.

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Sequence 5'-3'

Position

Product size

CCT GAC AAC GAA AGG ATC TC GCA CAG GAG CTG CAG ATC TC GCT AGA CAT CGA AAG AAC TG GAA GCT GTA GGT CTC TGA AC GGA GGA GCC ACG ATT TAT TC ACA CCA ACT TAA CTT CTT CC GGA GGA GCC TCG TCG TAT AC CAC CAA CTG TAC TTC ACC TA GAG CCT CAG ATT GAA AGA GC AGC TCG TCA ATC AGC AAT TG GTG GAG CCT GAA AGA AGA GC AAA TGA CCA CCT CTT CTA GC GCT TGA CAC CGA AAG AAT CG TGC AGG TCA CCG GTC AGC AA GGC TAA AAC TAT ACG TGT GG ATC GTC CGC CAT TGC GAA TG

648 794 647 789 641 792 641 791 645 781 642 789 647 784 714 835

147 base pairs 143 base pairs 142 base pairs 151 base pairs 137 base pairs 148 base pairs 138 base pairs 122 base pairs

40 mg/mL X-gal in dimethylformamide (DMF). 37°C shaking and nonshaking incubator. SOC or LB medium. Chemically competent Escherichia coli (TOP10F').

2.3.2. Colony PCR 1. 2. 3. 4. 5. 6. 7. 8.

LB medium containing 50 µg/mL ampicillin. 1 mg/mL BSA. 10 mM dNTPs. Ampli-Taq DNA polymerase (5 U/µL) (Applied Biosystems). 1 M KCl. 1 M Tris-HCl, pH 8.8. 25 mM MgCl2. RP-HPLC purified oligonucleotide T7 primer and M13 reverse primer (Table 3).

2.3.3. DNA Sequence Analysis 1. BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). 2. Terminator Ready Reaction (TRR) Mix (Applied Biosystems). 3. Sequencing dilution buffer: 200 mM Tris-HCl (pH 9.0) and 5 mM MgCl2.

HPV Typing: Premalignant Lesions

119

Table 3 Primers Used for the Colony and DNA Sequence Polymerase Chain Reaction

Primer M13 Reverse Primer T7 Primer

Sequence 5'-3' CAGGAAACAGCTATGAC TAATACGACTCACTATAGGG

Priming site Bases 205-221 Bases

Vector pCR®2.1-TOPO® pCR®2.1-TOPO®

Product size without insert

179 base pairs

364-383

4. RP-HPLC purified oligonucleotide T7 primer and M13 reverse primer (Table 3). 5. 75% isopropanol. 6. Template suppression reagent (TSR; Applied Biosystems).

3. Methods The methods described below outline (1) the sampling of the hairs, (2) DNA isolation from hairs, (3) DNA isolation from biopsies, (4) PCR analysis, (5) EV-HPV typing, and (6) prevention and detection of contamination.

3.1. Hair Sampling In a recent study (7), EV-HPV DNA was detected in plucked hairs from healthy and immunosuppressed individuals, facilitating epidemiological studies. Usually eyebrow hairs are collected for this purpose. To ensure isolation of sufficient DNA, 8 to 10 eyebrow hairs are needed. Take the hairs using each time a sterile pair of tweezers, and put them in a 1.5-mL tube with an external screw top. Collect only the hairs containing hair bulbs (see Note 3). For DNA isolation, store the samples at –20°C (see Note 4).

3.2. DNA Isolation From Plucked Hairs For the DNA isolation, the guanidine thiocyanate–diatom method described by Boom et al. (17) is used. 1. Centrifuge the tubes at 15,000g to get the hairs at the bottom of the tube, and swab the tubes with 0.5% sodium hypochlorite solution. 2. Add 400 µL of L6 lysis buffer to the samples, vortex thoroughly, and re-centrifuge 3. Subsequently, incubate for 1 h at room temperature in the dark. The hair bulb cells will lyse in the L6 lysis buffer. 4. Transfer 140 µL from this L6 solution to a new tube and store the remainder at –20°C (see Note 4) (additionally, use parafilm to seal the tubes). Include in this

120

5. 6. 7.

8.

9. 10. 11. 12.

de Koning, et al. step the negative controls between each set of seven samples—by turns, 140 µL of L6 or 140 µL of L6 + 5 µL of human genomic DNA (50 µg/mL). Add 20 µL of Celite suspension to the 140 µL of L6 solution. The Celite suspension has to be vortexed before pipetting it with a cut sterile filter tip (see Note 5). Vortex this solution and incubate at room temperature with shaking for 45 min to 1 h in the dark. Centrifuge for 10 to 15 s at 15,000g. Discard the supernatant, using a new tip every time for this and also in the following wash steps. N.B.: for safety reasons, put 25 mL of 2 M NaOH in the waste flask before suction to prevent the production of HCN. Wash the pellet twice with 400 µL of L2 wash buffer, twice with 400 µL 70% ethanol, and once with 400 µL acetone (vortex, spin 15 s at 15,000g, and discard the supernatant by suction). Be careful, the pellet is loose. Open the tubes and dry the pellet for approx 10 min in a heat block at 56°C until it turns white (see Note 6). Add 100 µL of TE. Close the tubes, vortex, and incubate for 10 min with shaking at 56°C. Vortex again thoroughly and re-centrifuge for 4 min at 15,000g. Transfer the supernatant to a new sterile tube and store at –20°C.

3.3. DNA Isolation From Tissue Material (Punch Biopsies) The DNA isolation procedure on tissue material is similar to the procedure on hair samples, except that tissue material has to be treated by SDS/proteinase K to digest the tissue and to obtain an efficient DNA extraction. 1. Collect the tissue material in 1.5-mL tubes with an external screw top, and store them at –80°C. 2. Centrifuge the tubes at 15,000g to get the tissue material at the bottom of the tube, and swab the tubes with 0.5% sodium hypochlorite solution. 3. Add 300 µL of SDS/proteinase K buffer (see Note 7) to the tissue material, vortex thoroughly, and incubate overnight in a shaking heat block at 60°C. 4. Inactivate the proteinase K by heating for 10 min at 95°C. 5. Mix 150 µL of this SDS/proteinase K-treated tissue material with 800 µL of L6 lysis buffer and 30 µL of Celite suspension. Vortex and shake for 1 h at room temperature in the dark. Store the remainder of the SDS/proteinase K-treated tissue material at –20°C (additionally, use parafilm to seal the tubes). Include in this step the negative controls between each set of seven samples—by turns, 800 µL of L6 lysis buffer or 800 µL of L6 lysis buffer plus 5 µL of human genomic DNA (50 µg/mL). 6. Process the samples as in steps 6–12 of Subheading 3.2., but use double the volume of each reagent.

HPV Typing: Premalignant Lesions

121

3.4. PCR Analysis 3.4.1. General EV-HPV PCR 3.4.1.1. A-MYB PCR

First, determine the quality of each sample by PCR amplification of a 184-bp fragment of the A-myb gene (see Note 8). 1. Perform this PCR with 50 mM KCl, 10 mM Tris-HCl (pH 8.8), 2.0 mM MgCl2, 0.1 mg/mL BSA, 0.2 mM of each dNTP, 0.3 U of Ampli-Taq DNA polymerase, and 0.2 µM of each primer (Table 1). 2. Add 5 µL of purified DNA to the mixture and bring the final volume to 25 µL with distilled water. 3. The conditions for the A-myb PCR are as follows: 5 min at 95°C, followed by 40 cycles of 1 min at 95°C, 1 min at 55°C, and 2 min at 72°C, then a final elongation step of 10 min at 72°C (see Note 9) and a cooling down of 10 min at 16°C. 4. Analyze 10 µL of the PCR products on a 1.5% agarose gel. After running the agarose gel, visualize positive PCR products by ultraviolet (UV) illumination after staining with ethidium bromide (20 ng/mL). If no A-Myb PCR amplimer is generated, the sample is not further analyzed.

3.4.1.2. EV-HPV PCR

For the general EV-HPV PCR, a nested PCR is performed with a mixture of primers (Table 1), which are located in the L1 open reading frame and designed to detect the B1 subgroup of known EV-HPV types. In the first step of the PCR using primer set Ma (consisting of the forward primer CP62 and the reverse primer CP70a), a 779-bp product is generated (see Note 10). The second (nested) PCR step using primer set Ha (consisting of the forward primer CP65 and the reverse primer CP69a) generates a product of 422 bp (Fig. 1). 1. Perform both steps of this PCR with 50 mM KCl, 10 mM Tris-HCl (pH 8.8), 3.6 mM MgCl2, 0.1 mg of BSA per mL, 0.2 mM of each dNTP, 0.3 U of Ampli-Taq DNA polymerase, and 0.2 µM of each primer. 2. Add 5 µL of purified DNA to the first-step PCR and bring the final volume to 25 µL with distilled water. Set the PCR conditions as for the A-myb reaction in Subheading 3.4.1.1., step 3. 3. Add 3 µL from the first-step PCR to the second-step PCR using distilled water to bring the final volume of the mixture to 25 µL. 4. Again set the PCR conditions as for the A-myb reaction in Subheading 3.4.1.1., step 3. 5. Analyze 10 µL of the second-step PCR on a 1.2% agarose gel and visualize as under Subheading 3.4.1.1.

122

de Koning, et al.

Fig. 1. Detection of the nested EV-HPV PCR products on a 1.2% agarose gel. In lanes 1, 2, 4, 5, 7, 8, 10, and 11 tissue samples are analyzed. In lanes, 3, 6, 9, and 12 negative controls are analyzed. Lane 13 contains the PCR product of 5 fg of HPV15 plasmid DNA (approx 500 copies) as a positive control. M: 100 bp marker.

3.4.2. EV-HPV Type-Specific PCR First determine the quality of each sample by PCR amplification of a 184-bp fragment of the A-myb gene (see Note 8). 1. Perform the PCR with 1X PCR Gold Buffer, 3.4 mM MgCl2, 0.2 mM of each dNTP, 0.8 U of Ampli-Taq Gold DNA polymerase, and 0.2 µM of each primer (Table 1). 2. Add 5 µL of purified DNA and enough distilled water to bring the final volume of the mixture to 25 µL. 3. Set the conditions for the A-myb PCR as follows: 9 min at 95°C, followed by 40 cycles of 1 min at 94°C and 1 min at 65°C, then a final elongation step of 10 min at 65°C (see Note 9) and a cooling down of 10 min at 16°C. 4. Analyze 10 µL of the PCR products on a 1.5% agarose gel and visualize as under Subheading 3.4.1.1. If no Myb PCR amplimer is generated, the sample is not further analyzed.

For the HPV type-specific PCR, primers have been designed for the EV-HPV types 5a, 8, 15, 17, 20, 24, 36, and 38 (Table 2). These EV-HPV types are evenly distributed over the cutaneous B1 group of the phylogenetic tree of papillomaviruses. The primers are located in the E7 open reading frame and generate PCR products between 122 and 151 bp (Table 2 and Fig. 2). 1. Perform the PCRs with 1X PCR Gold Buffer, 3.5 mM (for HPV5a and 8) or 3.8 mM (for HPV15, 17, 20, 24, 36, and 38) MgCl2, 0.2 mM of each dNTP, 0.8 U of Ampli-Taq Gold DNA polymerase, and 0.2 µM of the specific forward and reverse primer.

HPV Typing: Premalignant Lesions

123

Fig. 2. An example of products of the HPV15 type-specific polymerase chain reaction (PCR) analyzed on a 1.5% agarose gel. Lanes 1, 2, 4, 5, and 6 show hair samples, whereas lane 3 shows the negative control. Lane 7 contains the PCR product of: 5 fg of HPV15 plasmid DNA (approx 500 copies). M: 100 bp marker. 2. Add 5 µL of purified DNA and enough distilled water to bring the final volume of the mixture to 25 µL. 3. Set the conditions for all HPV type-specific PCRs as follows: 9 min at 95°C, followed by 40 cycles of 1 min at 94°C and 1 min at 65°C, then a final elongation step of 10 min at 65°C (see Note 9) and a cooling down to 16°C. Analyze 10 µL of the PCR products on a 1.5% agarose gel and visualize as under Subheading 3.4.1.1.

3.5. EV-HPV Typing HPV typing after the general EV-HPV PCR is performed by DNA sequence analysis (8) of the molecularly cloned second-step PCR products. Direct sequence analysis of the amplified HPV DNA fragment is generally not possible due to the presence of multiple HPV types in the analyzed materials (see Note 11). Further sequence analysis of the PCR products of the HPV type-specific PCR is not required to confirm the presence of the detected HPV type (4).

3.5.1. DNA Cloning Molecular cloning of the amplimers prior to DNA sequence analysis is performed using the TOPO TA Cloning Kit. Next, identify HPV DNA-positive colonies with the colony PCR (see Subheading 3.5.2.). Process the DNA cloning according to the protocol provided with the kit.

124

de Koning, et al.

3.5.2. Colony PCR Test at least six independent colonies per cloned PCR product to ensure the detection of multiple HPV genotypes present in one sample. 1. Inoculate a white colony in 25 µL of LB medium containing ampicillin (see Note 12). 2. Mix by pipetting. 3. Take 3 µL of this suspension as input for the PCR reaction. 4. Use the following reaction mixture for the colony PCR: 50 mM KCl, 10 mM Tris-HCl (pH 8.8), 3.6 mM MgCl2, 0.1 mg of BSA per mL, 0.2 mM of each dNTP, 0.3 U of Ampli-Taq DNA polymerase, 0.2 µM of each of the appropriate primers (Table 3), an input of 3 µL of the bacterial suspension, and enough distilled water to bring the final volume of the mixture to 25 µL. 5. The PCR conditions are as follows: 5 min at 95°C, followed by 40 cycles of 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C. The reaction ends with a final elongation step of 10 min at 72°C (see Note 9) and a cooling down to 16°C.

3.5.3. DNA Sequence Analysis Perform the DNA sequence analysis according to the manual of the Big Dye Terminator Cycle Sequencing kit using the ABI310 sequencer (see Note 13). Sequence the cloned HPV DNA fragment entirely utilizing either the M13 Reverse Primer or the T7 primer (Table 3). 1. Dilute the TRR Mix eight times in sequencing dilution buffer. 2. The DNA-sequence PCR reaction mix consists of 8 µL of diluted TRR Mix, 8 µL of template (see Note 14), 0.2 µM of either the forward or reverse primer (Table 3), and enough distilled water to obtain a final volume of 20 µL. 3. The PCR conditions are as follows: 25 cycles of 10 s at 96°C followed by 5 s at 50°C, then 4 min at 60°C and a cooling down to 16°C.

Precipitate the PCR-products before DNA sequence analysis (see Note 15). 1. 2. 3. 4. 5. 6. 7. 8. 9.

Add 80 µL of 75% isopropanol to the sample to precipitate the DNA. Transfer the mixture to a 1.5-mL tube and incubate for 15 min at room temperature. Centrifuge for 15 min at 15,000g. Carefully remove the supernatant and directly add 250 µL of 75% isopropanol. Centrifuge for 5 min at 15,000g and carefully remove the supernatant. Dry the pellet for 2 min in a heating block set at 96°C. Dissolve the DNA in 12 µL of template suppression reagent (TSR) buffer. Denature the sample for 2 min at 96°C and immediately cool it on ice. Subject the sample to automatic DNA sequence analysis using the ABI310 sequencer.

Compare the sequence subsequently to all known HPV types present in the NCBI database, utilizing nucleotide-nucleotide BLAST (blastn). This tool can be found on the NCBI website: http://www.ncbi.nlm.nih.gov/BLAST/ (see

HPV Typing: Premalignant Lesions

125

Note 16). A distance of less than 10% at the nucleotide level with a specific reference HPV type identifies the cloned HPV DNA as that specific HPV type. Sequences with dissimilarities of 2 to 10% from the reference HPV type are identified as subtypes. Dissimilarities of 2% identify HPV type variants.

3.6. Prevention and Detection of Contamination A successful use of PCR technology is dependent on strict guidelines adapted from Kwok et al. (18), which have to be applied to prevent contamination. This contamination occurs when strongly positive DNA originating from PCR products from earlier PCR reactions, cultured pathogens, or highly positive clinical samples is introduced in the procedure. Therefore, be aware while working with positive controls and spikes, because they are notorious sources for contamination, as are highly positive patient samples. In a typical PCR, 100 copies of recombinant HPV DNA can serve as a good positive control. When a much higher concentration of DNA is used, the risk of contamination rises. Another very important guideline is that the different steps of the HPV DNA detection procedure—reagent and PCR mix preparation (see Note 17), DNA isolation, and amplimer analysis—be carried out in different laboratories. This also includes an obligatory routing with no return possibilities between the different rooms. Be careful with tubes containing DNA, as opening of the tubes can lead to carryover of DNA. Therefore, it is best to spin the tubes briefly before opening them. Furthermore, equipment (pipets, racks, tubes, tips (see Note 18), solutions, and so on), and lab coats (see Note 19) must be dedicated to a single lab. Finally, it is very important to include several negative controls. One of these is the “no DNA” reagent control, consisting of the PCR mixture without DNA. This type of negative control is used to check for the presence of target DNA in the PCR reagents. The other is the control that contains only human genomic DNA and has gone through all the sample preparation steps. In this manner, contamination occurring during sample preparation can be detected. 4. Notes 1. Store the buffer at room temperature in a bottle covered in foil. If the buffer is crystallized, heat at 37°C before use. 2. Vortex thoroughly before dividing the lot into volumes of 1 mL. These can be kept in a dark environment at room temperature. 3. The DNA is isolated from the hair bulb, not from the hair shaft. The hair bulb of the plucked hair is visible with the naked eye as a small bulge at the end of the hair shaft. 4. If RNA analysis is performed, hairs must be stored at –70°C. 5. The end of the filter tip has to be cut with a sterile scalpel; otherwise, the Celite suspension cannot be pipetted properly.

126

de Koning, et al.

6. Do not dry the pellet much longer than 10 min, otherwise less DNA will be eluted from the pellet. 7. The SDS/proteinase K buffer has to be made fresh. 8. Two different A-myb PCR conditions are described in this chapter (see Subheadings 3.4.1. and 3.4.2.). Both are equally suited for the quality determination of the samples. 9. The prolonged elongation ensures that incomplete products are no longer present. 10. Generally, no clear band is visible upon agarose gel electrophoresis after this first PCR step. Agarose gel electrophoresis is therefore carried out after the nested PCR. 11. Direct sequencing can be carried out, but only if the intensity of the PCR product is high enough. The PCR product must have a concentration of at least 10 ng/µL. Direct sequencing will lead to inconclusive results if multiple HPV types are present in the sample. 12. This is one of the methods used to select clones containing an insert. While the colonies from bacteria without an insert are blue, the colonies from bacteria containing the insert are white. In a successful cloning, the PCR product is inserted in the lacZ gene, thereby stopping its expression. 13. Other methods of sequencing are also possible. 14. If the cloning PCR renders an intense product, it should be diluted eight times. 15. In this procedure, salts that would interfere with the sequence analysis are washed away. 16. Extra information and a tutorial about BLAST can be found at: http://www. ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html. 17. The only DNA material allowed in the reagent and PCR mix laboratory are PCR primers. 18. The use of filter-tipped pipet tips is absolutely necessary to avoid contamination. 19. It is best to label the lab coats in such a manner that it is obvious to which lab they are designated.

References 1. Feltkamp, M. C. W., Broer, R., di Summa, F. M., et al. (2003) Seroreactivity to epidermodysplasia verruciformis-related human papillomavirus types is associated with nonmelanoma skin cancer. Cancer Res. 63, 2695–2700. 2. Pfister, H., Fuchs, P. G., Majewski, S., Jablonska, S., Pniewska, I., and Malejczyk, M. (2003) High prevalence of epidermodysplasia verruciformis-associated human papillomavirus DNA in actinic keratoses of the immunocompetent population. Arch. Derm. Res. 295, 273–279. 3. Pfister, H. (2003) Human Papillomavirus and Skin Cancer. J. Nat. Cancer Inst. Monogr. 31, 52–56. 4. Struijk, L., Bouwes Bavinck, J. N., Wanningen, P., et al. (2003) Presence of human papillomavirus DNA in plucked eyebrow hairs is associated with a history of cutaneous squamous cell carcinoma. J. Invest. Dermatol. 121, 1531–1535. 5. Pfister, H. and Ter Schegget, J. (1997) Role of HPV in cutaneous premalignant and malignant tumors. Clin. Dermatol. 15, 335–347.

HPV Typing: Premalignant Lesions

127

6. Harwood, C. A. and Proby, C. M. (2002) Human papillomaviruses and non-melanoma skin cancer. Curr. Opin. Infect. Dis. 15, 101–114. 7. Boxman, I. L., Berkhout, R. J., Mulder, L. H., et al. (1997) Detection of human papillomavirus DNA in plucked hairs from renal transplant recipients and healthy volunteers. J. Invest. Dermatol. 108, 712–715. 8. Berkhout, R. J., Bouwes Bavinck, J. N., and Ter Schegget, J. 2000. Persistence of human papillomavirus DNA in benign and (pre)malignant skin lesions from renal transplant recipients. J. Clin. Microbiol. 38, 2087–2096. 9. Berkhout, R. J., Tieben, L. M., Smits, H. L., Bouwes Bavinck, J. N., Vermeer, B. J., and Ter Schegget, J. (1995) Nested PCR approach for detection and typing of epidermodysplasia verruciformis-associated human papillomavirus types in cutaneous cancers from renal transplant recipients. J. Clin. Microbiol. 33, 690–695. 10. De Jong-Tieben, L. M., Berkhout, R. J., Ter Schegget, J., et al. (2000) The prevalence of human papillomavirus DNA in benign keratotic skin lesions of renal transplant recipients with and without a history of skin cancer is equally high: a clinical study to assess risk factors for keratotic skin lesions and skin cancer. Transplantation 69, 44–49. 11. De Jong-Tieben, L. M., Berkhout, R. J., Smits, H. L., et al. (1995) High frequency of detection of epidermodysplasia verruciformis- associated human papillomavirus DNA in biopsies from malignant and premalignant skin lesions from renal transplant recipients. J. Invest. Dermatol. 105, 367–371. 12. Boxman, I. L., Russell, A., Mulder, L. H., Bouwes Bavinck, J. N., Ter Schegget, J., and Green, A. (2000) Case-control study in a subtropical Australian population to assess the relation between non-melanoma skin cancer and epidermodysplasia verruciformis human papillomavirus DNA in plucked eyebrow hairs. The Nambour Skin Cancer Prevention Study Group. Int. J. Cancer 86, 118–121. 13. Shamanin, V., zur Hausen, H., Lavergne, D., et al. (1996) Human papillomavirus infections in nonmelanoma skin cancers from renal transplant recipients and nonimmunosuppressed patients. J. Natl. Cancer Inst. 88, 802–811. 14. Antonsson, A., Forslund, O., Ekberg, H., Sterner, G., and Hansson, B. G. (2000) The ubiquity and impressive genomic diversity of human skin papillomaviruses suggest a commensalic nature of these viruses. J. Virol. 74, 11,636–11,641. 15. de Villiers, E. M., Lavergne, D., McLaren, K., and Benton, E. C. (1997) Prevailing papillomavirus types in non-melanoma carcinomas of the skin in renal allograft recipients. Int. J. Cancer 73, 356–361. 16. Harwood, C. A., Spink, P. J., Surentheran, T., et al. (1998) Detection of human papillomavirus DNA in PUVA-associated non-melanoma skin cancers. J. Invest. Dermatol. 111, 123–127. 17. Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M., and van der Noordaa, J. (1990) Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495–503. 18. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature 339, 237–238.

HPV-Containing Cell Lines From Tissue Biopsies

129

11 Establishing HPV-Containing Keratinocyte Cell Lines From Tissue Biopsies Margaret Anne Stanley Summary The generation of cell strains and established cell lines from human papillomavirus (HPV)infected cervical biopsies and ano-genital warts is best achieved by the application of conventional protocols for keratinocyte cell culture. The optimal protocol that permits growth at clonal density and serial cultivation involves the use of an inactivated 3T3 fibroblast feeder layer and medium supplemented with hydrocortisone and fetal bovine serum. Modifications in terms of additives and serum concentration are required for optimal culture of neoplastic and malignant HPV-containing keratinocytes.

1. Introduction 1.1. Papillomaviruses Papillomaviruses exhibit both species and tissue specificity. The tissue specificity is such that in vivo a complete infectious cycle can be undergone only in the keratinocytes of a fully differentiating squamous epithelium (1). Thus, in vitro systems seeking to support the papillomavirus infectious cycle in the keratinocyte must reproduce the differentiation program of the keratinocyte. The human papillomaviruses (HPVs) form a huge family of more than 130 known types, with evidence for the existence of at least a further 50 HPV types (2). The viruses can be classified into two major groups—those that infect the skin preferentially and those with a predilection for internal squamous surfaces, such as the respiratory and ano-genital tracts. Within these groups, the viruses again separate into those inducing benign epithelial proliferations or warts (low-risk HPVs) and those that cause lesions at risk for progression to malignancy (high-risk HPVs). The E6 and E7 genes of the high-risk HPVs that infect the genital tract are oncogenes, the gene products of which From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

129

130

Stanley

deregulate key cell-cycle controls, resulting in cell transformation and immortalization in vitro, a phenomenon associated with integration of viral DNA sequences into host chromosomes (3). These phenomena have implications for efforts to establish HPV-containing cell lines in vitro from tissue biopsies of warts or neoplastic lesions. First, cellculture techniques specific for the different epithelia must be employed. The in vitro requirements of epidermal keratinocytes (4–6) differ subtly from those of oral and laryngeal (7) or cervical keratinocytes (8). Second, if the objective is to reproduce a complete infectious cycle, then in vitro culture systems that support this are mandatory. Third, it must be remembered that a cell line by definition can be passaged multiple times and is usually considered to be immortal. Cell lines therefore are likely to be established only from biopsies containing HPVs encoding both the transforming E6 and E7 genes.

1.2. Keratinocyte Culture In 1975, Rheinwald and Green (9) published a seminal study that demonstrated serial cultivation of neonatal foreskin keratinocytes. Prior to this, cultures were initiated by explantation of epithelial fragments (reviewed in ref. 10). Sheets of epithelial cells were regularly obtained, but serial cultivation was rarely successful, passaged primary keratinocytes attached poorly and senesced rapidly in secondary culture, and the cultures rapidly became dominated by fibroblasts. The lack of success in serial culture of normal epithelium was paralleled by attempts to grow neoplastic keratinocytes from either squamous intra-epithelial precursor lesions (SIL) or carcinomas. The same technical problems encountered in the culture of normal epithelial keratinocytes were found with neoplastic keratinocytes, plus the added complication of cellular heterogeneity in the biopsy from which the line originated. Central to the Rheinwald and Green technology was provision of connective tissue factors by an irradiated mouse feeder-cell layer. In later work, the requirement for epidermal growth factor (4) and cholera toxin (5) in deferring differentiation and enhancing colony plating efficiency was described, and a rational basis for keratinocyte culture was achieved. Through this approach, it was shown that ectocervical keratinocytes could be serially cultivated (8) and that the growth requirements for these cells were similar but not identical to those of epidermal keratinocytes (11). Ham and co-workers used an alternative approach to keratinocyte culture that concentrated on the development of keratinocyte-specific defined media (12–14). This culminated in the development of MCDB-153 (14), a low-calcium defined medium supplemented with bovine-specific pituitary extract that supported the initiation of primary cultures and serial passage of human fore-

HPV-Containing Cell Lines From Tissue Biopsies

131

Table 1 Comparison of Different Culture Methods Method

Advantages

Explant culture

Easy

Low Ca2+ (0.15 mM)

Long in vitro life Low contamination with other cell types Serum free Differentiation can be manipulated Long in vitro life Sub-culture easy Large expansion of cell numbers Low contamination with other cell types. Differentiation easily manipulated. Clonal

Serum free medium

3T3 feeder layer

Disadvantages Short in vitro life Serial cultivation not possible without feeders. Not clonal Expansion of numbers small

Risk of 3T3 escape

skin keratinocytes in the absence of serum and feeder cells. The advantages and disadvantages of these various techniques are listed in Table 1. Keratinocytes grown as monolayers do not undergo complete differentiation in vitro, although limited stratification is achieved using the feeder technique. Fusenig and his collaborators (15) described a technique whereby enhanced tissue organization of stratified squamous epithelium was achieved when keratinocytes were cultivated on collagenous substrates and grown at the air–liquid interface. This technology was developed and refined by several investigators (16–19) (see also Chapters 12–15). Growth of primary genital and oral keratinocytes using the techniques detailed below is now routine in many laboratories, and short-term cultures of HPV-containing keratinocytes from cutaneous, ano-genital, and laryngeal warts can be established with comparative ease. It remains difficult, however, to establish cell lines containing episomal HPV genomes from clinical biopsies, and few successes have been reported. The W12 cell line containing episomal HPV 16 was established from a CIN 1 lesion (20) using the 3T3 feeder support technique. Transplantation of these cells into immunosuppressed mice

132

Stanley

using a technique that recapitulates skin reformation results in keratinocyte differentiation with permissive viral growth and the generation of infectious virus (21). The virus DNA is maintained as an episome in monolayer cultures of these cells for 10–20 passages before integration (22). The CIN 612 line containing HPV 31 as an episome was established from a CIN 1 using serumfree keratinocyte growth medium (23). Exposure of these cells to phorbol esters and growth in organotypic culture results in the generation of infectious virus in vitro (24). The UT-DEC-1 line containing HPV 33 was established from a vaginal intra-epithelial lesion grade 1 (VAIN 1) using standard 10% serumsupplemented media without feeder support (25,26). These cells contain HPV 33 as the episome at early passage, but integration of viral sequences occurs with progressive passage (26). The KG line was established from a vulval intraepithelial lesion and contains HPV 16 as the episome (27). 2. Materials 2.1. Media, Sera, and Cells 1. Fetal bovine serum (FBS). 2. Transport medium: Dulbecco’s modified Eagle’s medium (DMEM), 10% FBS, 100 µg/mL gentamicin sulphate, 10 µg/mL amphotericin B. 3. Keratinocyte culture medium (complete medium): DMEM, 10% FBS, 0.5 µg/mL hydrocortisone, 8.4 ng/mL cholera toxin. 4. 3T3 culture medium: DMEM, 10% newborn calf serum (NCS). Store at 4°C for up to 3 wk. 5. Serum-free keratinocyte growth medium (KGM), MCDB 153 (see supplier’s instructions for preparation and storage). 6. EGF medium: complete medium, 10 ng/mL epidermal growth factor (EGF). 7. Mitomycin C, 400 µg/mL. 8. DMEM supplemented with 2% FBS and 0.5 µg/mL hydrocortisone but without cholera toxin or EGF 9. 3T3 J2 cells (established by J. G. Rheinwald [9]) from an authenticated distribution stock.

2.2. Salt Solutions and Disaggregating Agents 1. Phosphate-buffered saline A (PBSA): 0.2 mg/mL KCl, 0.2 mg/mL KH2PO4, 8 mg/mL NaCl, 2.16 mg/mL Na2HPO4·7H20; aliquot in 200-mL lots and sterilize by autoclaving. 2. PBSA, gentamicin sulfate, 50 µg/mL, and amphotericin, 5 µg/mL. 3. 10X ethylenediamine tetraacetic acid (EDTA)-disodium salt (Versene): 3.4 mM stock (0.1% w/v) in PBSA; filter sterilize and aliquot in 2-mL lots. Dilute in PBSA before use. 4. 10X trypsin: 2.5% (25 mg/mL) in PBSA (pH 7.0); filter-sterilize and aliquot in 2-mL lots. Store at –20°C. 5. Trypsin-EDTA: PBSA, 0.25% (w/v) trypsin, 0.3 mM EDTA (pH 7.4).

HPV-Containing Cell Lines From Tissue Biopsies

133

2.3. Equipment 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

Petri dishes, plastic, bacteriological grade, 9 cm. 75 cm3 Tissue-culture flasks. Universal bottles. Forceps, fine. Scissors, curved iris. Scalpel, no. 22 blade. Muslin or steel tea strainer, 0.5- to 1-mm mesh. Magnetic stirrer and sterile, plastic-coated magnetic flea to fit a universal bottle. 37°C, 5% CO2 incubator. 50-mL Centrifuge tubes. 10-mL Glass pipet. Rubber pipet bulb. Inverted phase-contrast microscope. Irradiation source, γ- or X-ray.

3. Methods 3.1. Preparation of 3T3 Feeder Layers

3.1.1. Cell Culture of 3T3 Cells 1. Prepare a large master stock of 3T3 cells (see Note 1) and freeze down in individual ampoules, each containing 1 × 106 cells. 2. If 3T3 cells are to remain effective feeders, the cells should not be used after passage 20. When the current stock culture reaches passage 18, thaw a new ampoule of cells from frozen stocks and re-establish new feeder-stock culture. 3. Grow cells in DMEM supplemented with 10% newborn calf serum in 75-cm2 flasks. 3T3 cells grow poorly in roller bottles. 4. Seed cells at 1.5 × 104 cells/cm2 growth area and passage just before confluence. In practice, this results in weekly passage.

3.1.2. Inactivation of 3T3 Cells With Radiation 1. To generate feeder cells, irradiate flask cultures with 60 Gy either from an X-ray or 60Co source. 2. Irradiated cells, if kept at 4°C, retain their capacity to act as feeders for 4–5 d.

3.1.3. Inactivation of 3T3 Cells With Mitomycin C If an X-ray or mitomycin C.

60Co

source is not available, cells can be inactivated with

1. Resuspend 3T3 cells at a concentration of 1 × 107/mL. 2. Add 50 µL mitomycin C per mL of cell suspension to give 20 µg/mL final concentration. 3. Resuspend carefully to ensure effective mixing of the mitomycin C. 4. Leave at 37°C for 1 h. 5. Spin at 80g, remove the supernatant, and wash four times with 10 mL medium. 6. Seed cells for feeder layers as described below.

134

Stanley

3.2. Culturing Cervical Epithelial Cells 3.2.1. Harvesting Cervical Epithelial Cells From Biopsy Material 1. After excision in the clinic or operating room, the biopsy for culture should be transferred immediately to transport medium (see Note 2). 2. Remove the biopsy from the transport medium with sterile forceps and place in a 9-cm plastic Petri dish. 3. Wash the biopsy with five applications of 5 mL sterile PBSA containing 50 µg/mL gentamicin sulfate and 5 µg/mL amphotericin. 4. Orient the biopsy with the epithelial surface down on the culture dish. Using a disposable scalpel fitted with a number 22 blade, cut and scrape away (with a cutting direction away from the operator) as much of the stroma and muscle as possible. A thin, opaque white epithelial strip should be left after this procedure. 5. Take this strip and mince finely with curved iris scissors. It is important that the fragments be small; the operator’s wrists usually ache if this procedure is properly carried out! 6. Add 10 mL of trypsin-EDTA preheated to 37°C to this minsate, and transfer to a glass universal containing a sterile, plastic-coated, magnetic flea. Rinse the Petri dish with a further 10 mL of trypsin-EDTA and add to the suspension in the universal. 7. Place the universal on a magnetic stirrer in an incubator or hot room at 37°C and stir slowly for 30–40 min. 8. Allow the suspension to stand at room temperature for 2–3 min to allow the fragments to settle to the bottom of the universal. 9. Using a 10-mL pipet, remove the supernatant containing single cells and filter through muslin or a stainless-steel tea strainer (0.5–1 mm) into a sterile 50-mL centrifuge tube. Add 10 mL complete medium to this. 10. Add a further 10–15 mL of warm trypsin-EDTA to the fragments in the universal and repeat the above procedures, combining the trypsin supernatants in one centrifuge tube. 11. Take the combined trypsin suspensions and spin at 80g for 5 min. 12. Remove the supernatant and add 10 mL of complete medium to the pellet. Prepare a single-cell suspension by resuspending this pellet vigorously with a 10-mL glass (see Note 3) pipet to which is attached a large rubber pipet bulb. 13. Count the cells, using a counting chamber; only count small, circular, refractile cells and ignore large squames and red blood cells. Cell viability can be assessed at this stage by trypan blue exclusion.

3.2.2. Culture of Cervical Keratinocytes on Fibroblast Feeders 1. Dilute the cervical cell suspension with complete medium to achieve an appropriate dilution, and plate the cells out at a density of 2 × 104 cells/cm2 (105 cells/ 5-cm Petri, 4 × 105 cells/9-cm Petri) onto preformed feeder layer, or add with feeder cells (see Note 4).

HPV-Containing Cell Lines From Tissue Biopsies

135

2. Incubate cultures at 37°C in 5% CO2 in air. 3. Examine the cultures by phase-contrast inverted microscopy at 72 h after the initial plating to determine that the feeder layer is satisfactorily dispersed. 4. Change the culture medium and replace with complete medium supplemented with EGF at 10 ng/mL. Further feeder cells should be added if required (i.e., if degeneration or depletion of the feeder layer is observed). 5. The medium should be changed twice weekly and EGF should be present in the medium, except when cells are initially plated. 6. At 12–16 d after the initiation of the primary culture, keratinocyte colonies should be easily visible to the naked eye and should contain about 1000 cells and have a diameter of 1–3 mm. Colonies should be subcultured at this time.

3.2.3. Subculture of Cervical Keratinocytes on Fibroblast Feeder Layers 1. Aspirate the medium from the cultures. 2. Remove the remaining feeder cells by vigorously squirting 1–2 mL of 0.3 mM EDTA over the entire surface of the dish. This maneuver should not last longer than 30 s. 3. Rinse the culture surface twice with PBSA. 4. Add 2 mL of prewarmed 0.1% trypsin in 0.3 mM EDTA in PBSA to each 5-cm Petri dish. 5. Leave at 37°C until the keratinocytes have detached; this should be checked microscopically. The total time in trypsin must not exceed 20 min. 6. Remove the cell suspension from the plate and transfer to a sterile centrifuge tube. 7. Rinse the culture surface with 5.0 mL of complete medium and add to the cell suspension. 8. Mix gently using a 10-mL pipet. 9. Spin at 80g for 5 min. 10. Remove the supernatant and resuspend the cell pellet in 10 mL of complete medium to produce a single-cell suspension. 11. Count the cells in a counting chamber. The suspension may be replated, frozen down, or subjected to chemical analysis as required by the investigator. 12. Cells to be re-plated should be inoculated at 5 × 103/cm2 or 1 × 104/ cm2, together with lethally irradiated feeder cells at 1 × 105/cm2, and grown as described for primary cultures (see Note 5).

3.3. Selective Conditions for Preferential Cultivation of Keratinocytes From Neoplastic Epithelium Biopsies are obtained either as punch biopsies taken under colposcopic direction or as epithelial strips removed from cone biopsies under the dissecting microscope. The biopsies are usually very small (2–3 mm3), and disaggregation to single cells with trypsin is an inefficient procedure. The following protocol has been found to be the most effective.

136

Stanley

3.3.1. Culture of Cervical Intraepithelial Neoplasia (CIN) 1. Rinse the biopsy twice with 2–3 mL PBSA. 2. Mince finely with curved iris scissors. 3. Add 0.5–1.0 mL FBS to the minsate and transfer with a Pasteur pipet to the growth surface (lower surface) of a 25-cm2 tissue-culture flask. 4. Spread the minced fragments evenly across the growth surface of the flask. 5. Carefully turn the flask over so that the growth surface with the fragments is uppermost. 6. Add 4.5 mL DMEM supplemented with 2% FBS and 0.5 µg/mL hydrocortisone (but without cholera toxin or epidermal growth factor) to the surface of the flask opposite that carrying the fragments. The medium must not cover the fragments. 7. Leave the flask and contents in this inverted position in the incubator for 2–3 h at 37°C, then carefully turn the flask to the correct position so that the medium covers the explanted fragments, and leave for 72–96 h without touching or moving. 8. Examine the cultures, using inverted-phase microscopy to assess growth. Usually, epithelial cells migrate quickly from the explants and can be passaged at 7–10 days onto feeder layers.

3.3.2. Culture of Cervical Carcinoma Cervical carcinoma lines have been established using almost every variation of culture technique, including the feeder support system (28), after transplantation in nude mice (29), in low (30) and high serum (31). In general, success rates are low and a cell line can be generated from about 1 in 10 biopsies. There are two major problems encountered in the culture of cervical carcinomas— microbial contamination and fibroblast contamination. Microbial contamination is caused predominantly by Gram-negative bacterial species and fungal (usually Candida) species. Thus, the growth medium for carcinomas must be supplemented initially with a broad-spectrum antibiotic (50 µg/mL gentamicin sulfate and 5 µg/mL amphotericin). The following protocol is the most satisfactory: 1. Carcinoma biopsies are taken in the operating room at the initial staging examination under anesthetic (EUA). 2. Transport biopsies to the laboratory in transport medium. 3. Malignant cervical cells are protease sensitive, and dissociation into single cells with trypsin is not recommended; explantation is the most satisfactory initiation technique. 4. Rinse the biopsies with PBSA containing 5 µg/mL amphotericin and 50 µg/mL gentamicin. 5. Mince finely with curved iris scissors. 6. Explant the minced fragments in serum as described above for CIN. 7. Subsequent passage and subcultivation procedures are as described for CIN (see Note 6).

HPV-Containing Cell Lines From Tissue Biopsies

137

4. Notes 1. The J2 clone (established by J. G. Rheinwald [9]) of the 3T3 cell line provides the best feeder-cell support for cervical keratinocytes. 2. Biopsies exceeding 2 cm in diameter will remain viable in this medium for up to 3 d at 4°C. Small biopsies must be processed on the same day. 3. A glass pipet is essential; plastic does not work nearly so well. 4. The feeder layers consist of lethally irradiated 3T3 cells at a density of 1 × 105 cells/cm2 (5 × 105 cells/5-cm dish, 2 × 106 cells/9-cm dish) in complete medium. The feeder layers can be prepared previously and the keratinocytes added to these layers, or feeder cells and keratinocytes can be inoculated together. In either case, it is important that the feeder cells form a continuous, even layer across the dish and that there be no regions of high and low density. 5. The genital tract is susceptible to mycoplasma infection, so all cultures should be screened for mycoplasma at the time of first passage. 6. Fibroblast contamination is the most significant problem in the culture of cervical carcinomas. In our hands, this has been effectively controlled only by the combination of low-serum growth medium, physical removal of fibroblasts from the cultures with a rubber cell scraper, and dense 3T3 feeder layers. Confirmation that the cultures are carcinoma cells can be obtained by subcutaneous injection into nude or SCID mice.

References 1. Stanley, M. A. (2001) Pathobiology of human papillomaviruses. In Viruses, Cell Transformation and Cancer (Grand, R. A., ed.), Elsevier, Amsterdam: pp. 129–144. 2. De Villiers, E. M. (1994) Human pathogenic papillomavirus types: an update. Curr. Top. Microbiol. Immunol. 186, 1–12. 3. zur Hausen, H. (1999) Immortalization of human cells and their malignant conversion by high risk human papillomavirus genotypes. Semin. Cancer Biol. 9, 405–411. 4. Rheinwald, J. G. and Green, H. (1977) Epidermal growth factor and the multiplication of cultured human keratinocytes. Nature 265, 421–424. 5. Green, H. (1978) Cyclic AMP in relation to the epidermal cell: a new view. Cell 15, 801–811. 6. Green, H., Kehinde, O., and Thomas, J. (1979) Growth of cultured human epidermal cells into multiple epithelia suitable for grafting. Proc. Natl. Acad. Sci. USA 76, 5665–5668. 7. Taichmann, L., Reilly, S., and Garant, P. R. (1979) In vitro cultivation of human oral keratinocytes. Arch. Oral Biol. 24, 258–268. 8. Stanley, M. A. and Parkinson, E. K. (1979) Growth requirements of human cervical epithelial cells in culture. Int. J. Cancer 24, 407–414. 9. Rheinwald, J. G. and Green, H. (1975) Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell 6, 331–344.

138

Stanley

10. Wilbanks, G. D. and Fink, C. G. (1976) Tissue and organ culture of cervical epithelium. In The Cervix (Jordan, J. A. and Singer, A., eds.), W.B. Saunders & Co., London, pp. 429–441. 11. Stanley, M. A. and Dahlenburg, K. (1984) Factors controlling the growth of human cervical epithelium in culture. In Vitro 20, 144–151. 12. Peehl, D. M. and Ham, R. G. (1980) Growth and differentiation of human keratinocytes without a feeder layer or conditioned medium. In Vitro 16, 516–525. 13. Tsao, M. C., Walthall, B. J., and Ham, R. G. (1982) Clonal growth of normal human epidermal keratinocytes in a defined medium. J. Cell Physiol. 110, 219–229. 14. Boyce, S. T. and Ham, R. G. (1986) Normal human epidermal keratinocytes. In In Vitro Models for Cancer Research (Webber, M. M. and Sekely, L. I., eds.), CRC Press, Boca Raton, FL, pp. 211–232. 15. Fusenig, N. E., Amer, S. M., Boukamp, P., and Worst, P. K. (1978) Characteristics of chemically transformed mouse epidermal cells in vitro and in vivo. Bull. Cancer 65, 271–279. 16. Lillie, J. H., MacCallum, D. K., and Jepsen, A. (1980) Fine structure of subcultivated stratified squamous epithelium grown on collagen rafts. Exp. Cell Res. 125, 153–165. 17. Kopan, R., Traska, G., and Fuchs, E. (1987) Retinoids as important regulators of terminal differentiation: examining keratin expression in individual epidermal cells at various stages of keratinization. J. Cell Biol. 105, 427–439. 18. Asselineau, D., Bernard, B. A., Bailly, C., Darmon, M., and Prunieras, M. (1986) Human epidermis reconstructed by culture: is it “normal”? J. Invest. Dermatol. 86, 181–186. 19. Meyers, C. and Laimins, L. A. (1994) In vitro systems for the study and propagation of human papillomaviruses. Curr. Top. Microbiol. Immunol. 186, 199–215. 20. Stanley, M. A., Browne, H. M., Appleby, M., and Minson, A. C. (1989) Properties of a non tumorigenic human cervical keratinocyte cell line . Int. J. Cancer 43, 672–676. 21. Sterling, J., Stanley, M., Gatward, G., and Minson, T. (1990) Production of human papillomavirus type 16 virions in a keratinocyte cell line. J. Virol. 64, 6305–6307. 22. Alazawi, W., Pett, M., Arch, B., et al. (2002) Changes in cervical keratinocyte gene expression associated with integration of human papillomavirus 16. Cancer Res. 62, 6959–6965. 23. Bedell, M. A., Hudson, J. B., Golub, T. R., et al. (1991) Amplification of human papillomavirus genomes in vitro is dependent on epithelial differentiation. J. Virol. 65, 2254–2260. 24. Meyers, C., Frattini, M. G., Hudson, J. B., and Laimins, L. A. (1992) Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. 25. Hietanen, S., Auvinen, E., Grenman, S., et al. (1992) Isolation of two keratinocyte cell lines derived from HPV positive dysplastic vaginal lesions. Int. J. Cancer 52, 391–398.

HPV-Containing Cell Lines From Tissue Biopsies

139

26. Peitsaro, P., Hietanen, S., Johansson, B., Lakkala, T., and Syrjanen, S. (2002) Single copy heterozygote integration of HPV 33 in chromosomal band 5p14 is found in an epithelial cell clone with selective growth advantage. Carcinogenesis 23, 1057–1064. 27. Grassmann, K., Rapp, B., Maschek, H., Petry, K. U., and Iftner, T. (1996) Identification of a differentiation inducible promoter in the E7 open reading frame of human papillomavirus type 16 (HPV-16) in raft cultures of a new cell line containing high copy numbers of episomal HPV-16 DNA. J. Virol. 70, 2339–2349. 28. Kelland, L. R., Burgess, L., and Steel, G. G. (1987) Characterization of four new cell lines derived from human squamous carcinomas of the uterine cervix. Cancer Res. 47, 4947–4952. 29. Pal, A. K., Pratap, M., and Mitra, A. B. (1992) Cervix tumour cell line established from tumour after long term passages as heterotransplant in nude mice. Indian J. Exp. Biol. 30, 655–656. 30. Waggoner, S. E. and Wang, X. (1994) Effect of nicotine on proliferation of normal, malignant, and human papillomavirus transformed human cervical cells. Gynecol. Oncol. 55, 91–95. 31. Ho, T. H., Chew, E. C., Tam, J. S., et al. (1993) Biological characteristics of a newly established human cervical carcinoma cell line. Anticancer Res. 13, 967–971.

HPV Life Cycle in Organotypic “Raft” Cultures

141

12 Using an Immortalized Cell Line to Study the HPV Life Cycle in Organotypic “Raft” Cultures Paul F. Lambert, Michelle A. Ozbun, Asha Collins, Sigrid Holmgren, Denis Lee, and Tomomi Nakahara Summary The papillomavirus life cycle is tied to the differentiation of the stratified squamous epithelium that this virus infects. The ability to study the papillomavirus life cycle is facilitated by organotypic culturing techniques that allow one to closely recapitulate this terminal differentiation process in the laboratory. Current techniques allow for the establishment of recombinant wild-type or mutant human papillomavirus (HPV) genomes in transfected early-passage human foreskin keratinocytes (HFKs). These cells can then be used in organotypic culture to investigate the role of individual viral genes in different aspects of the viral life cycle. When using early-passage HFKs, there is a need for the transfected HPV genome to extend the life span of the cells in order to have sufficient cell generations in which to carry out organotypic culturing. The recent isolation of a spontaneously immortalized HFK cell line that supports the complete HPV life cycle has further allowed investigators to study wild-type or mutant papillomaviral genomes that do not confer immortalization. In this chapter, we describe the methodologies that permit the study of the HPV life cycle in this HFK cell line.

1. Introduction The application of organotypic culture methodology to the study of papillomaviruses has made it possible to recapitulate the full viral life cycle in relevant host cell types. In this chapter, we describe the methodologies for recapitulating the papillomaviral life cycle in an immortalized keratinocyte cell line called NIKS. This cell line affords the researcher a renewable source of human foreskin keratinocytes (HFKs) in which to carry out life-cycle studies. NIKS are a spontaneously immortalized line of human foreskin keratinocytes that arose in the laboratory of Dr. Lynn Allen-Hoffmann and were found by that lab to be genetically stable, near-diploid cells that display normal differentiation properties when placed in organotypic culture (1). We determined that From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

141

142

Lambert et al.

NIKS cells (originally referred to as BC1-Ep/SL cells) support the life cycle of HPV16 (2). To date, we have used these cells to assess the role of the E5 and E7 oncogenes in the viral life cycle (3,4) as well as other viral genes (unpublished data). Because NIKS cells are already immortalized, they afford the opportunity to study human papillomaviruses (HPVs) that are unable to immortalize HFKs (i.e., HPVs other than high-risk anogenital genotypes) or that are mutated so as to be defective in oncogenes that contribute to immortalization. In the absence of immortalization potential, studies using early-passage HFKs are limited to the lifespan of these cells, which often prevents one from performing a complete analysis of the viral life cycle prior to senescence. Consistent with their stable genetic characteristics, NIKS are wild-type for p53 and pRb. However, one must remain cognizant of the fact that NIKS are spontaneously immortalized cells, and therefore there remains a question as to what cellular processes have been disrupted in these immortalized cells. In this chapter, we describe methodologies using these NIKS cells largely in the context of our own studies on HPV16. The methods and the NIKS cell line have proven useful for studying the life cycle of other HPVs (types 18 and 31) that we have tested to date (S.H. and P.F.L., unpublished observations). (See also chapters 13 and 14 for additional rafting methods.) 2. Materials 2.1. Standard Culturing Methodology for Propagating NIKS 1. 2. 3. 4. 5. 6. 7. 8. 9.

10. 11.

NIKS (Bc1-Ep/SL) cell line (available from ATCC, see Note 1). M1 3T3 feeders (available from [email protected]). Pen/Strep (Mediatech/Cellgro; Herndon, VA). 1X phosphate-buffered saline (PBS) (Invitrogen/GIBCO). 1X trypsin-ethylenediamine tetraacetic acid (EDTA) solution; 0.05% trypsin (Mediatech/Cellgro; Herndon, VA). 0.02% EDTA solution: 0.2 g EDTA (tetra-sodium salt, Sigma) in 1 L 1X PBS. Dispense into 100-mL bottles and autoclave. F12 Nutrient Mix (Invitrogen/GIBCO). Dulbecco’s modified Eagle’s medium (DMEM) with high glucose (Invitrogen/ GIBCO). Earles salts: For 2 L, add 128 g NaCl, 8 g KCl, 74 g NaHCO3, 2.5 g NaH2PO4· H2O, 4 g MgSO4·6H2O, 0.002 g FeNO39H2O, 0.1 g phenol red. Bring to 2 L with sterile water. Filter sterilize and store tightly capped at room temperature. HEPES-buffered Earles salts (HBES): combine 25 mL 1 M HEPES buffer and 100 mL Earles salts. Bring to 1 L with sterile water and filter sterilize. 50X mitomycin C (Sigma). Be sure to wear gloves! Add 2 mL HBES to a vial containing 2 mg mitomycin C (MMC). Transfer to 15-mL conical tube and bring to 10 mL with HBES. Filter sterilize and store at –20°C in 1-mL aliquots. Can be kept at 4°C for 2 wk or at –20°C for 2 mo.

HPV Life Cycle in Organotypic “Raft” Cultures

143

12. 100X hydrocortisone (Calbiochem): dissolve 25 mg in 5 mL cold 100% ethanol to make a 5 mg/mL solution. Add 0.8 mL of 5 mg/mL solution to 100 mL HBES containing 5% fetal bovine serum (FBS). Filter sterilize and store at –20°C in 10-mL aliquots. 13. 100X cholera toxin (ICN): add 1.2 mL of sterile water to 1-mg vial, making 10 µM solution. Dilute 50 µL of 10 µM solution into 50 mL HBES containing 0.1% bovine serum albumin. Filter sterilize and store at 4°C in 10-mL aliquots. 14. 100X insulin (Sigma): prepare immediately before use and never freeze! Dissolve 12.5 mg insulin in 25 mL of 0.005 M HCL. Filter sterilize with a syringe filter pre-wet with FBS. 15. 100X adenine (Sigma): dissolve 121 mg adenine in 50 mL of 0.05 M HCl by stirring for 1 h. Filter sterilize and store at –20°C in 10-mL aliquots. 16. 100X epidermal growth factor (EGF; R&D Systems): dissolve 100 µg in 10 mL sterile water. Add 90 mL HBES containing 0.1% bovine serum albumin. Filter sterilize and store at –20°C in 10-mL aliquots. 17. Tissue-culture dishes (Falcon/Becton Dickinson; Franklin Lakes, NJ). 18. 3T3 cell medium: 500 mL DMEM with high glucose, 50 mL bovine calf serum, 5 mL Pen/Strep. 19. F medium (incomplete): 375 mL F12 medium, 125 mL DMEM with high glucose, 25 mL FBS, 5 mL 100X hydrocortisone, 5 mL 100X insulin, 5 mL 100X cholera toxin, 5 mL 100X adenine, 5 mL, Pen/Strep. 20. F medium (complete): 500 mL F medium (incomplete), 5 mL 100X EGF.

2.2. Transfection/Selection 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Ligase and ligase buffer (New England Biolab). Miniprep Spin Columns, Buffer PB, Buffer PE, Buffer EB (Qiagen). 10-mL Syringe. HPV16 DNA, e.g., pEF399 (2), available from Dr. P. F. Lambert). pEGFPN1 (Clontech, Palo Alto, CA). BamH I restriction enzyme. Vacuum manifold. Polystyrene tubes (Falcon; San Jose, CA). Superfect Transfection Reagent (Qiagen). Geneticin sulfate (G418; Invitrogen/GIBCO). Chelex-treated FBS: dissolve 50 g of Chelex-100 resin in 100 mL of sterile water to make a 50% slurry. Adjust pH to 7.0. Centrifuge to sediment resin. Combine one volume settle resin and two volumes FBS and stir for 1 h at 4°C. Centrifuge to sediment resin. Decant serum and filter sterilize. 12. 10X DME salts: For 1 L, add 4 g KCl, 1.25 g NaH2PO4, 0.001 g Fe(NO3)3·9H2O, 64 g NaCl, 45 g dextrose, 0.15 g phenol red. Bring to 1 L with sterile water and filter sterilize. 13. 10X glycine-serine: For 1 L, add 0.3 g glycine, 0.42 g serine. Bring to 1 L with sterile water and filter sterilize.

144

Lambert et al.

14. 50X glutamine: For 100 mL, add 100 mL sterile water, 2.92 g glutamine. Filter sterilize and store at –20°C in 10-mL aliquots. 15. Calcium-free DMEM: For 500 mL, add 50 mL 10X DME salts, 50 mL 10X glycine/serine, 10 mL 50X BME amino acids (Gibco Cat. No. 11130-051), 5 mL 100X MEM vitamin solution (Gibco Cat. No. 11120-052), 5 mL 100X nonessential amino acids (Gibco Cat. No. 11140-050), 330 mL sterile water, 725 µL 1 M MgSO4, 1.88 g sodium bicarbonate. Mix thoroughly and adjust pH to 7.2 with HCl. Bring to 500 mL with sterile water and filter sterilize. Add 10 mL 50X glutamine before use. 16. Ca2+-free F12: Make according to manufacturer’s instructions (Gibco Cat. No. 21700-075). 17. Low-calcium F medium (incomplete): three parts Ca2+-free DMEM, 1 part Ca2+free F12, Chelex-treated fetal bovine serum to 5%, 1X hydrocortisone, insulin, adenine, cholera toxin, and Pen/Strep. 18. Low-calcium F medium (complete): low-calcium F medium (incomplete), 1X EGF. 19. 1% Agarose gel.

2.3. Organotypic (Raft) Culturing Technique for Inducing Terminal Differentiation of NIKS 1. Cotton pads (Schleicher & Schuell BioScience Inc., Cat. No. 740-E, 8 × 10 in.). Cut into 2.5 × 2.5 cm squares and autoclave in a jar. 2. Transwell Inserts (Costar, Cat. No. 3450). 3. Deep-Well Plates (Becton Dickinson Labware, BIOCOAT). 4. Tissue-Tek cassettes (SAKURA Finetek, Inc.). 5. Rat Tail Collagen Type 1 (Upstate Biotechnology Inc. Cat. No. 08-115). 6. 1,2-dioctanoyl-sn-glycerol (C8:0; Sigma Cat. No. D1912). 7. 5-bromo-2'-deoxyuridine (BrdU). 8. 10% Buffered formalin phosphate (Fisher Cat. No. SF100-4). 9. Bacto™ agar (Difco, Becton Dickinson, Cat. No. 0140-01). 10. F12 medium powder (GIBCO, Invitrogen Corp. Cat. No. 21700-075). 11. Human fibroblast medium: to F12 medium add FBS to 10% v/v. Add Pen/Strep. 12. Collagen premix (25 mL, sufficient for six rafts): 2.5 mL 10X F12 medium, 6 µL 10 N NaOH, 250 µL 100X Pen/Strep, 2.5 mL FBS, 20 mL collagen solution. Mix solutions just before use by carefully pipetting into 50-mL conical tubes on ice and avoid making bubbles. 13. Keratinocytes plating medium: make up F medium (incomplete) containing 0.5% FBS. Add 610 µL 1 M CaCl2 to 500 mL of the medium (Ca2+ final concentration, 1.88 mM). 14. Cornification medium no. 1: make up F medium (incomplete) containing 5% FBS. Add 610 µL 1 M CaCl2 to 500 mL of the medium (Ca2+ final concentration, 1.88 mM). Add C8:0 before use to a final concentration of 10 µM. 15. Cornification medium no. 2: Make up F medium (incomplete) containing 2.5% FBS. Add 610 µL 1 M CaCl2 to 500 mL of the medium (Ca2+ final concentration, 1.88 mM). Add C8:0 before use to a final concentration of 10 µM.

HPV Life Cycle in Organotypic “Raft” Cultures

145

16. 1,2-dioctanoyl-sn-glycerol (C8:0, 10 mM stock concentration): dissolve 50 mg in 14.3 mL of sterile 1X PBS. Filter sterilize and store at –20°C. Use at final concentration of 10 µM. 17. 5-bromo-2'-deoxyuridine (BrdU, 10 mM stock concentration): Dissolve 46 mg in 15 mL of sterile 1X PBS. Filter sterilize and store at –20°C. Use at final concentration of 10 µM. 18. Fixation solution (2% agar, 1% formalin): Make this up fresh just prior to harvesting rafts. Dissolve 2 g of Bacto agar in 90 mL of ddH2O and boil in a microwave. Cool at room temperature with stirring. Note: Don’t cool it down below 50°C, because it will gel. Add 10 mL of 10% buffered formalin. Keep warm in a 60°C water bath until use.

2.4. Harvesting Virus From Organotypic Raft Cultures 1. Virucidal agent such as Vesphene or CiDecon. 2. Hepamark face mask (3M 8233-N100). 3. BeadBeater (BioSpec Products 1107900). The BeadBeater chamber can be filled with 70% EtOH before use (let sit for 10 min) and then rinsed with sterile water. 4. 1-mm glass beads (BioSpec Products 11079110). 5. “15 mL” BeadBeater chambers (one for each set of tissues harboring a different HPV genotype) (BioSpec Products 110803-2X15-BB). 6. Homogenization buffer: 1 M NaCl, 50 mM Na-phosphate buffer (pH 8.0). Filter sterilize and cool to 4°C. 7. Resuspension buffer: 50 mM NaCl/100 mM EDTA/50 mM Na-phosphate buffer (pH 7.4). Filter sterilize. (See Note 2.) 8. 38-mL Steriled screw-top polypropylene centrifuge tubes. 9. Sorvall RC5B refrigerated centrifuge/SS34 rotor. 10. 38-mL Ultra-Clear ultracentrifuge tubes (for SW 28 rotor, Beckman 344058). These should be sterilized with ethanol, then rinsed with sterile water. 11. 50-mL Conical tubes. 12. SW 28 rotor. 13. Ultracentrifuge. 14. 1-mL Dounce homogenizers (one set for each sample). 15. Large pestle from a Dounce homogenizer (one for each sample). 16. Siliconized 1.5-mL tubes (Fisher). Siliconized plasticware increases virus yield by reducing the amount of virus annealing to plasticware. 17. Siliconized pipet tips (Fisher).

3. Methods (see Note 3) 3.1. Standard Culturing Methodology for Propagating NIKS

3.1.1. Culturing Feeder Cells 1. Grow 3T3 cells in 3T3 cell medium. When confluent, passage at 1:10 or 1:50 dilution. 2. Change medium on cells twice per week.

146

Lambert et al.

3.1.2. Preparing Feeder Layer for Keratinocytes Cells are prepared by treating them with mitomycin C (MMC). This treatment irreversibly damages DNA, so that feeder cells arrest their cell cycle. Cells remain alive for approx 8–9 d. 1. Aspirate medium from confluent 10-cm or 15-cm plate. 2. For 10-cm dish, add 5 mL 3T3 cell medium and 100 µL MMC; for 15-cm dish, add 10 mL 3T3 cell medium and 200 µL MMC. 3. Incubate 2 h at 37°C, 5% CO2. 4. Aspirate medium containing MMC from dish and wash twice with 1X PBS. 5. Add 3 mL trypsin/EDTA to dish and re-suspend cells in either 3T3 cells medium or F medium (incomplete). One confluent 10-cm dish will make four 10-cm dishes or nine 6-cm dishes. One confluent 15-cm dish will make 4 15-cm dishes or 12 10-cm dishes. If feeders are to be used within 24 h, re-suspend in F medium (incomplete); otherwise, re-suspend in 3T3 cell medium. Feeders must be used within 48 h after MMC treatment. Incubate feeders at least 2 h in F medium (incomplete) prior to subculture of keratinocytes.

3.1.3. Passaging Keratinocytes (see Note 4) 1. Aspirate medium from sub-confluent dishes. 2. Add 5 mL 0.02% EDTA solution to cells, wait 1 min, and pipet up and down to remove feeder cells. One can see loose feeder cells with the naked eye, but make sure of complete removal under the microscope. 3. Aspirate 0.02% EDTA solution and wash with 1X PBS. 4. Add 3 mL trypsin/EDTA and incubate for at least 5 min at 37°C, 5% CO2. Check cells under the microscope every 5 min. Don’t overtrypsinize! It usually takes 10–15 min. 5. Re-suspend cells in F medium (incomplete) by pipetting up and down to obtain a single-cell suspension. 6. Count cells and plate 2 × 105 cells on 10-cm feeder dish, or 5 × 105 cells on 15-cm feeder dish (prepared as above). 7. Feed cells with F medium (complete) 24 h after plating: 5 mL for 6-cm dish, 10 mL for 10-cm dish, 20 mL for 15-cm dish. Feed cells every other day. 8. Check cells for confluency. Pass cells when sub-confluent, before individual colonies touch each other, approx 6–7 d.

3.2. Transfection/Selection 3.2.1. Preparation of DNA for Transfection Recombinant papillomaviral genomes are first released from the bacterial plasmid vector in which they were originally cloned, and then the viral genome is recircularized. 1. Restriction enzyme digest 5 µg recombinant HPV16 plasmid DNA (e.g., pEF399) in 50 µL for 2 h at 37°C.

HPV Life Cycle in Organotypic “Raft” Cultures

147

2. Heat-inactivate BamHI at 80°C for 20 min. 3. Dilute DNA solution to 2 mL with 1X ligase buffer. These dilute ligation conditions select for single, self-ligated genomes. 4. Add 20 µL ligase and incubate overnight at 16°C. 5. Attach a 10-mL syringe to a Miniprep Spin Column and place syringe-column on a vacuum manifold. 6. Add 10 mL PB buffer to DNA solution and transfer DNA solution into syringe. 7. Using vacuum, allow solution to pass through column. 8. Wash column with 1 mL PE buffer, then spin column dry for 10 min at 10,000g. 9. Transfer column to a clean 1.5-mL tube. 10. Elute DNA from column twice with 30 µL EB buffer using standard procedure. 11. To check the integrity and size of relegated DNA, run 5 µL of DNA on 1% agarose gel.

3.2.2. Transfection (see Note 5) 1. One day prior to transfection, plate NIKS at 2 × 105 cells per 6-cm dish in lowCa2+ F medium (incomplete) without feeders. The transfection is done in the absence of feeders to increase the number of keratinocytes transfected. In order to prevent differentiation of keratinocytes during the 2 d without feeders, the cells must be maintained in medium with low levels of calcium. 2. Dilute 1.2 µg pEGFPN1 (plasmid containing neomycin-resistance gene; other neo-marker plasmids may be used) religated HPV16 DNA into 50 µL TE (pH 7.4) in a 4-mL polystyrene tube. Do not use polypropylene tubes, as the lipid-DNA complex will stick to the tube. 3. Into the 4-mL tube add 100 µL of low-Ca2+ F medium (no serum, no antibiotics) and mix well. 4. Add 15 µL of SuperFect reagent to DNA mixture and mix by pipetting up and down. 5. Incubate samples at room temperature for at least 30 min to allow liposomeDNA complexes to form. 6. Wash cells twice with 1X PBS and aspirate. 7. Add 1 mL of low-Ca2+ F medium containing 5% Chelex-treated FBS, EGF, and penicillin/streptomycin to liposome-DNA complex. Mix by pipetting up and down. 8. Add the contents of the tube to appropriate dish of cells and place in 37°C incubator for 3–4 h. 9. Remove medium from cells by aspiration and wash cells three times with 1X PBS. 10. Add 5 mL of low-Ca2+ F medium containing 5% Chelex-treated FBS, EGF, and penicillin/streptomycin.

3.2.3. Selection of G418-Resistant Colonies (see Note 6) 1. Eighteen hours after the beginning of transfection, trypsinize cells and place onto a 10-cm dish containing MMC-treated 3T3 feeder cells and F medium (incomplete). 2. Twenty-four hours after passaging cells, begin drug selection by changing medium to F medium (complete) containing 100 µg/mL geneticin sulfate (G418). G418 selection is done for 4 d in a stepwise fashion. This first day of selection, cells are put into 100 µg/mL G418. On the second day of selection, fresh mito-

148

Lambert et al.

mycin C-treated feeders are added. On day 3 of selection, medium is changed to F medium (complete) containing 50 µg/mL G418. The following day, once again, fresh mitomycin C-treated feeders are added; this is selection day 4. On day 5, medium is changed to F medium (complete) containing no G418. The following day, fresh mitomycin C feeders are added again. 3. From this point on, cells are maintained in F medium (complete). Medium is changed every other day.

3.3. Organotypic (Raft) Culturing Technique for Inducing Terminal Differentiation of NIKS In this section, a detailed methodology for producing stratified squamous epithelia using an organotypic culturing approach is described. This is commonly referred to as “raft” culture because one “floats” the keratinocyte cell culture at the air:liquid interface. By culturing HPV-harboring keratinocytes on raft cultures, one can recapitulate all stages of the viral life cycle. Raft culturing is extremely cumbersome and requires a great degree of devotion to details.

3.3.1. Preparation of the Dermal Equivalent (see Note 7) 1. Culture early-passage human foreskin fibroblasts in human fibroblast medium. 2. Harvest fibroblasts by trypsinization and prepare a suspension of fibroblasts at a concentration of 7.5 × 105 cells/mL in fibroblast medium. 3. Using sterile forceps in the biosafety hood, place transwell inserts into each well of deep-well plates. 4. Prepare collagen premix (25 mL, sufficient for six rafts). 5. Plate 1 mL of premix (step 4) in each transwell insert (step 3). Tilt to coat bottoms of transwells. Allow to gel for 5 min in the hood at room temperature. 6. Add 600 µL of 7.5 × 105 cells/mL of fibroblasts (4.5 × 105 cells) to remaining collagen mixture. Mix thoroughly by pipetting on ice and avoid making bubbles. 7. Layer 2.6 mL of step 6 over each 1-mL gel in a transwell. Allow to gel for 30 min at 37°C, 5% CO2. 8. Add 18 mL of human fibroblast medium to outer well (or enough to float transwells) and incubate at 37°C, 5% CO2. 9. Gels will contract to appropriate shape within 4–7 d. During this incubation, medium does not have to be changed.

3.3.2. Culturing Rafts DAY 0: PLATING KERATINOCYTES ONTO DERMAL EQUIVALENTS 1. Trypsinize keratinocytes as detailed under Subheading 3.1.3. Prepare a keratinocytes solution at 1.4 × 10 6 cells/mL in F medium (incomplete). 2. Aspirate human fibroblast medium from outer well and carefully aspirate medium from inner transwells of dermal equivalents. 3. Plate 100 µL of keratinocytes solution from step 1 onto dermal equivalents.

HPV Life Cycle in Organotypic “Raft” Cultures

149

Fig. 1. Lifting organotypic raft cultures (see Subheading 3.3.2.). Four cotton pads are placed under a transwell insert in which keratinocytes are cultured on a dermal equivalent. To maintain keratinocytes exposed to air/liquid interface, the amount of cornification medium no. 1 has to be carefully determined. Dots indicate top of the medium. We usually add 12 mL of the medium at day 4 and 9 mL after day 6. 4. Incubate for 2 h in an incubator to allow keratinocytes to attach. Carefully add 18 mL of keratinocyte plating medium to outer well (or enough to float transwells) and incubate at 37°C, 5% CO2.

DAY 2: CHANGING CULTURING MEDIUM 1. Aspirate the medium from outer well and carefully remove medium from inner transwells of raft cultures. 2. Carefully add 18 mL of fresh keratinocyte plating medium to outer well.

DAY 4: LIFTING RAFTS 1. Aspirate the medium from outer well and carefully remove medium from inner transwells of raft cultures. 2. Using sterile forceps, take transwell inserts out of plates. 3. Place four sterile cotton pads into each well using the forceps. 4. Using the forceps, place transwell from step 2 back onto cotton pads. 5. Add 12 mL of cornification medium no. 1 (or enough to submerge cotton pads). Keratinocytes should be exposed to air from now on and fed only from the bottom through cotton pads (see Fig. 1). 6. Incubate them at 37°C, 5% CO2.

DAY 6: REDUCE THE MEDIUM 1. Aspirate the medium from outer well and carefully remove any medium from inner transwells of raft cultures. 2. Add 9 mL of cornification medium no. 1 into outer well (see Note 8).

DAYS 8, 10, 12, 14: CHANGING THE MEDIUM 1. Aspirate the medium from outer well and carefully remove medium from inner transwells of raft cultures. 2. Add 9 mL of cornification medium no. 1 into outer well (see Note 9).

150

Lambert et al.

Fig. 2. Harvesting rafts for histology (see Subheading 3.3.3.). After taking a transwell insert out of a deep-well plate, remove an upper part of a transwell insert (A; step 3). Carefully lift a raft off of the transwell membrane (B), then place a raft on top of fixation solution prepared in step 4 (C; step 5). Add fixation solution on top of a raft to be embedded (D; step 6), then keep it overnight at 4°C.

DAY 15: INCUBATION WITH BRDU (OPTIONAL) 1. Aspirate the medium from outer well and carefully remove the medium from inner transwells of raft cultures. 2. Add 9 mL of cornification medium no. 1 containing 10 µM BrdU into outer well. 3. Incubate for 8 h at 37°C, 5% CO2.

3.3.3. Harvesting Rafts for Histology (see Fig. 2) 1. Prepare fixation solution and keep it warm (60°C) in a water bath. 2. Aspirate the medium from outer well and carefully remove the medium from inner transwells of raft cultures 3. Take transwells out of deep-well plates and cut transwell membranes in bottom along side with a scalpel; carefully remove upper part of transwells (Fig. 2A). 4. Plate a portion of fixation solution (3–4 mL/raft) on a clean glass plate. 5. Carefully lift rafts off of transwell membrane and place them onto the fixation solution (Fig. 2B,C). 6. Add fixation solution on top of the rafts to embed them (Fig. 2D). 7. Wrap glass plates with foil or saran wrap to avoid drying up. 8. Keep at 4°C overnight. 9. Cut fixation solution-embedded rafts out with a scalpel and place into TissueTek cassettes. 10. Soak rafts in the Tissue-Tek cassettes in 4% formalin/PBS and keep them at 4°C overnight. 11. Now rafts are ready for paraffin embedding.

HPV Life Cycle in Organotypic “Raft” Cultures

151

Fig. 3. Harvesting rafts for virus preparation (see Subheading 3.4.1.). Using one set of forceps to grip keratinocyte layer and the other to hold down the underlying dermal equivalent, gently peel apart the layers (step 2), reserving the keratinocyte layer for obtaining virus (steps 3 and 4).

3.4. Harvesting Virus From Organotypic Raft Cultures (see Note 10) This procedure is based upon a protocol developed by one of us (M.A.O.) for isolation of HPVs from rafts generated with a variety of HPV-positive cell lines. Much of the protocol (i.e., buffers, centrifugation, and so on) was adapted from previous methods (5).

3.4.1. Harvesting Organotypic Raft Cultures for Virus Preparation 1. Using forceps, remove raft culture from transwell and place on a disposable, clean surface, such as the lid to the outer well plate. 2. Using two pairs of forceps, peel keratinocyte layer away from the dermal equivalent (see Fig. 3). 3. Place keratinocyte layers in 15-mL conical tube. These tissues will probably cling to the inside of the tube. Dermal equivalent can be discarded. 4. Proceed directly to harvesting virus, or freeze tissue at –80°C, and later thaw on ice before harvesting virus.

3.4.2. Harvesting Virions If the raft cultures have differentiated well, 10 raft cultures (with 2.5-cm diameters) should yield between 1 and 4 µg of L1 protein. 1. For each sample, fill a BeadBeater inner chamber one-third to one-half full with glass beads. 2. Resuspend rafts in 15 mL of cold homogenization buffer and pour into BeadBeater chamber. Make sure that all tissue is transferred. Fill inner chamber the rest of the way full with beads and screw closed. 3. Fill outer chamber with ice, insert inner chamber, then screw closed with outer ring (see Fig. 4). Grinding creates a lot of friction, which will heat up the homo-

152

Lambert et al.

Fig. 4. Homogenizing rafts set-up for virion preparation using a BeadBeater (see Subheading 3.4.2.). BeadBeater inner chamber contains tissue, beads and buffer (steps 1 and 2). Outer chamber encloses system, and holds ice that keeps homogenate cool. Inner and outer chambers are screwed together with outer ring (step 3). Inner/ outer chamber setup is held to BeadBeater by a spring-loaded chain.

4. 5. 6.

7. 8. 9.

10. 11. 12.

genate. Temperatures above 50°C should be avoided, to preserve viruses in an intact conformation. The ice maintains a cool temperature. Grind tissue in BeadBeater for 2–3 min. Remove inner chamber and cool on ice while grinding any other samples. Grind each sample 2 min longer, or until tissue pieces are no longer visible. Pour homogenate into 38-mL screw-top centrifuge tubes. Because opening to inner chamber is rather wide, it is easier to pour homogenate into 50-mL conical tube first, and then transfer it to the 38-mL centrifuge tube. Set aside inner chamber for re-extraction in step 9. Centrifuge at 8000g for 10 min at 4°C. This pellets beads, unbroken cells, and large cellular debris. Immediately pour off supernatant containing virus into a clean 50-mL conical tube. Reserve on ice. Re-extract pellet by pipetting 15 mL of homogenization buffer into centrifuge tube containing the pellet. Resuspend pellet and pour into corresponding BeadBeater chamber. Grind as before for 2 min. Pour the resulting homogenate into the same 38-mL centrifuge tube as before. Centrifuge again at 8000g for 10 min at 4°C. Pool supernatants. At this step, an optional third centrifugation at 8000g for 10 min can be performed in a clean 38-mL centrifuge tube to pellet any debris that was transferred.

HPV Life Cycle in Organotypic “Raft” Cultures

153

13. Transfer supernatant into ultracentrifuge tubes. Balance to <0.1 g with homogenization buffer. 14. Centrifuge in SW28 rotor, 130,000g for 1 h, 4°C. This g force is upon a sedimentation coefficient of 296S–300S for “full” viral DNA-containing particles. 15. Carefully remove buckets from rotor. Using tweezers, carefully remove tubes from buckets. The resulting yellow-tan pellet contains virus, and is usually approx 0.5 cm in diameter. The pellet may also contain black flecks that come from inert carbon found on the glass beads. Carefully decant and discard the supernatant. Allow excess fluid to drip out by taping the centrifuge tube upside-down in a 50-mL conical tube. 16. Resuspend the pellet by pipetting 500 µL of resuspension buffer on the pellet. Use the large Dounce homogenizer pestle to break up the pellet. Then pipet the buffer and chunks of pellet into the small, 2-mL Dounce homogenizer. Homogenize 12–15 times. 17. Transfer homogenate to a small, siliconized 1.5-mL tube. Centrifuge at 8000g, 10 min at 4°C. Remove virus-containing supernatant to a new siliconized 1.5-mL tube, and reserve on ice. 18. Re-extract pellet with 500 µL resuspension buffer, by homogenizing resuspended pellet with 2-mL Dounce homogenizer and then centrifuging again at 8000g, for 10 min at 4°C. 19. Pool the supernatants. This is the crude preparation of virus particles. Store preps short-term at 4°C, long-term at –80°C.

4. Notes 1. NIKS are cited in US Patent No. 5,989,837, issued 11/23/99. The ATCC accession number is ATCC CRL-12191. ATCC Patent Depository released these cells for general distribution on January 10, 2000. 2. Different resuspension buffers can be used depending on what will be done with the virus. For example, the EDTA will inhibit many subsequent enzymatic reactions, and may be omitted. 3. There are some general precautions to consider in working with cultures that have the potential to generate HPVs. Because these are human pathogens that are associated with human cancer, care should be taken in working with cultures. All work must be carried out under biosafety level 2 conditions, using a suitable biosafety cabinet. Gloves are always used when handling cultures, and all surfaces are disinfected with ethanol following use. We employ additional levels of safety when harvesting virus (see Note 10). 4. For NIKS to be cultured successfully, one must adhere to the methodology described in this section. Deviation from this methodology will lead to changes in NIKS, as evidenced by altered karyotype. Specifically, one must maintain NIKS on feeders and the feeders must be maintained at relatively low passage. One must use the media as described, and not use semi-defined keratinocyte growth media such as KGM (the latter is believed to lead to selection for mutations in p16/Rb pathway). The F medium differs from E medium, another com-

154

5.

6.

7. 8. 9.

10.

Lambert et al. mon medium used when growing keratinocytes on fibroblast feeders. Specifically, the F medium is three parts F12 to one part DMEM. E medium has the opposite ratio. The liposome-mediated transfection technique was chosen as it gives reasonable transfection efficiency (approx 10–20% based on flow-cytometric analysis of % green fluorescent protein [GFP]-positive cells at 48 h posttransfection) with tolerable toxicity. The selection process using short-term exposure to G418 (geneticin) has been optimized for the selective growth of transfectants harboring episomal forms of papillomaviral genomes. Note that longer-term exposure to drug will lead to death of transfectants. We strongly encourage that if not working with episomal replicons such as papillomaviruses, one use retroviruses for introducing genes (see Chapter 15), as the selection scheme described here likely will not select for stable integrants of nonreplicating recombinant plasmid DNA (i.e., drug selection cannot be maintained long enough to select for stable integrants). Dermal equivalents should be used within 4–7 d after preparation. This step is necessary to keep keratinocytes exposed to air, because dermal equivalents will be thinner than day 4. The best differentiation will be seen at day 15. If further incubation is needed, change the medium to cornification medium no. 2 after day 15, and change the medium every other day until harvesting. However, we do not recommend further incubation of rafts, because we observed that all layers of tissue, except the basal and parabasal layers, become squamous in nature by 21 d. There are additional levels of safety taken when harvesting papillomavirus from rafts. Beyond standard biosafety level 2 safety precautions, we do the following: always wear two layers of disposable gloves, discarding one layer whenever exiting the hood. Wearing a disposable lab coat is recommended, because it can simply be thrown into a biohazard bag in case of a spill. Any disposable items that come in contact with samples should be discarded in a biohazard bag (also contained in hood) and later autoclaved. Any items that must be reused and that have come into contact with the samples should be immersed in a virucidal agent, such as CiDecon or Vesphene, for 10 min before being washed. Items that have not come into contact with samples should be sprayed with 70% ethanol as a precaution before being taken out of the hood. During the homogenization of tissues, there is the potential for aerosol formation. Because HPVs can infect the oral cavity and can cause head-and-neck cancers, it is especially important during this step to wear a hepamark face mask that will filter out any aerosols. We recommend having the face mask tested yearly for fit and functionality by your environmental safety office.

Acknowledgments The authors were supported by grants from the NIH, including CA22443, CA098428, CA85747, and AI52049.

HPV Life Cycle in Organotypic “Raft” Cultures

155

References 1. Allen-Hoffmann, B. L., Schlosser, S. J., Ivarie, C. A., Sattler, C. A., Meissner, L. F., and O’Connor, S. L. (2000) Normal growth and differentiation in a spontaneously immortalized near-diploid keratinocyte cell line, NIKS. J. Investig. Dermatol. 114, 444–455. 2. Flores, E., Allen-Hoffmann, B. L., Lee, D., Sattler, C. A., and Lambert, P. F. (1999) Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line. Virology 262, 344–354. 3. Flores, E., Allen-Hoffmann, B. L., Lee, D., and Lambert, P. F. (2000) The human papillomavirus type 16 E7 oncogene is required for the productive stage of the viral life cycle. J. Virol. 74, 6622–6631. 4. Genther, S. M., Sterling, S., Duensing, S., Münger, K., Sattler, C., and Lambert, P. F. (2003) Quantitative role of the human papillomavirus type 16 E5 gene during the productive stage of the viral life cycle. J. Virol. 77, 2832–2842. 5. Favre, M., Breitburd, F., Croissant, O., and Orth, G. (1975) Structural polypeptides of rabbit, bovine, and human papillomaviruses. J. Virol. 15, 1239–1247.

Differentiation of HPV-Containing Cells

157

13 Differentiation of HPV-Containing Cells Using Organotypic “Raft” Culture or Methylcellulose Regina Wilson and Laimonis A. Laimins Summary The study of human papillomaviruses (HPVs) has been challenging due to the differentiation-dependent aspects of their productive life cycles. The use of HPV virions, isolated from tissues, to study viral pathogenesis has been complicated due to the low numbers of HPV virions synthesized and inefficient infection of cells in tissue culture. As an alternative approach, genetic methods have been developed to study the papillomavirus life cycle in its natural host, human keratinocytes. Techniques have been developed to transfect keratinocytes with cloned HPV DNA and to isolate cell lines that maintain viral DNA as extra-chromosomal elements. Since the productive phase of the HPV life cycle is dependent on differentiation, in vitro tissueculture models have also been used to recapitulate epithelial differentiation. Differentiation in organotypic raft cultures as well as upon suspension in semi-solid media have been used to study both early and late stages of the viral life cycle.

1. Introduction Human papillomaviruses (HPVs) are small DNA viruses that infect epithelia and induce a range of host responses. HPV virions infect epithelia through micro-lesions that expose basal cells to viral entry. Following infection, virions migrate to the nucleus and establish viral genomes as nuclear episomes at approx 50–100 copies per cell (1). In these infected basal cells, episomal HPV DNA is coordinately replicated with cellular DNA and, following cell division, is distributed equally to each daughter cell. This process allows for the persistence of viral genomes in the basal layer. Following cell division, one infected daughter cell detaches from the basement membrane, migrates toward the suprabasal layers, and begins to differentiate. Upon differentiation, viral DNA amplification occurs, which results in the increase of viral genomes to several thousand copies per cell. HPV late-gene expression occurs coincident From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

157

158

Wilson and Laimins

with viral DNA amplification, resulting in the assembly and subsequent release of progeny virions (2,3). One of the challenges in studying the productive life cycle of human papillomaviruses has been the difficulty in generating large numbers of HPV virions to allow for infection of cells in culture. As an alternative approach to studying the viral life cycle, methods have been developed for transfection of cloned HPV genomes into keratinocytes and for the isolation of cells that mimic undifferentiated basal cells (2,4,5). In this method, cloned viral genomes are released from bacterial vectors through restriction digestion, re-ligated, and co-transfected into normal human keratinocytes (NHKs) along with drugselectable marker plasmids. Following selection, cell lines are isolated that maintain HPV genomes as episomes and exhibit extended life spans (6). The productive phase of the life cycle of human papillomaviruses is dependent on epithelial differentiation, and methods have been developed that faithfully recapitulate this process. These include growth in organotypic raft cultures (4,7,8) and suspension of keratinocytes in semisolid medium (9). Applications of these in vitro methods to the study the HPV life cycle has allowed for the analysis of the mechanisms regulating viral DNA amplification as well as lategene transcription (2–4,10). Furthermore, these methods allow for a genetic analysis of viral protein function during the productive life cycle. In the following section, we provide a detailed description of these methods (see also Chapters 12 and 14 for additional rafting methods). 2. Materials 1. Neonatal foreskin. 2. Transport medium for neonatal foreskin: for each foreskin, add 355.2 mL Hanks balanced salt solution (HBSS) with phenol red, without Mg2+ and Ca2+ (Cat. No. 14170-112, Hyclone; Logan, UT), 40 mL fetal bovine serum (Cat. No. SH30070.03, Hyclone), 4 mL penicillin/streptomycin (Cat. No. 15140-122, Gibco Invitrogen), 0.8 mL fungizone (Cat. No. 15295-017, Gibco Invitrogen); aliquot 7 mL in 15-mL falcon tube and store at 4°C. 3. 70% ethanol. 4. 100 mm × 20 mm treated polystyrene, nonpyrogenic, sterile tissue-culture plates (Cat. No. 430167, VWR; Bristol, CT). 5. 60 mm × 15 mm treated polystyrene, nonpyrogenic, sterile tissue-culture plates (Cat. No. 430166, VWR). 6. Dispase II (Cat. No. 295 825, Roche). 7. 0.25% trypsin/1 mM ethylenediamine tetraacetic acid (EDTA) (Cat. No. 25200056, Gibco Invitrogen). 8. Keratinocyte growth medium (KGM, Cat. No. CC-3001, Clonetics BioWhittaker). 9. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4).

Differentiation of HPV-Containing Cells 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28.

29. 30. 31. 32. 33. 34. 35.

159

Dimethyl sulfoxide (DMSO). 0.05% Trypsin/0.53 mM EDTA (Cat. No. 25300-054, Gibco Invitrogen). HPV genome-containing plasmids (e.g., pBR322-HPV31). DNA ligase and buffer. Isopropanol. NaCl. TE medium: 10mM Tris-HCl (pH 7.5), 1 mM EDTA. Fugene 6 Transfection Reagent (Roche). Mitomycin C (Cat. No. 107 409, Roche). Versene: 1 mL 0.5 M sterile EDTA (pH 8.0) in 1 L of PBS. RNase A. Proteinase K. Eighteen-gage needles. Phenol:chloroform:isoamylalcohol (25:24:1). 3 M Sodium acetate. Dulbecco’s modified Eagle’s medium (DMEM, Cat. No. 11956-092; Gibco Invitrogen). Calf serum. Bovine serum albumin (BSA, Cat. No. 12657, Calbiochem-Novabiochem Corp). HEPES (Cat. No. 391338, Calbiochem-Novabiochem Corp.): make a 1 M stock solution by dissolving 71.5 g into 250 mL deionized double-distilled water (ddH2O). Use 10 N NaOH to adjust the pH to 7.0. Bring the volume to 300 mL and filter sterilize. G418 (Neomycin). Trizol (Gibco-BRL Cat. No. 15596-026). Rat Tail Collagen type I (Cat. No. 354236, BD Biosciences). DMEM without NaHCO3 (Cat. No. 12100-061: Gibco Invitrogen). Filter sterilize (to prevent the formation of precipitate), aliquot, and store at –20°C. Stainless-steel metal grids (Cat. No. CR-03063-040-100-S, Williams and Mettle Co., Houston, TX). 10X reconstitution buffer: Dissolve 2.2 g NaHCO3 and 4.8 g HEPES in 100 mL 0.05 M NaOH. Filter sterilize and aliquot, and store at –20°C. E medium: a. 180 mM adenine (Cat. No. A-2786, Sigma): 4.9 g is added to 150 mL deionized ddH2O. Add (while stirring) approx 6 mL of 10N HCl slowly, until all powder is dissolved. Do not add any more HCl. Make up to 200 mL with deionized ddH2O. b. 5 mg/mL insulin (Cat. No. I-6634, Sigma): 1 g is dissolved in 200 mL of 0.1 N HCl. c. 20 nM 3.3'.5-triiodo-L-thyronine (T3; Cat. No. T-6397, Sigma): dissolve 13.6 mg of T3 in 100 mL 0.02 N NaOH (0.2 mM T3). Take 0.1 mL of 0.2 mM T3 and add 9.9 mL sterile PBS (2 µM T3). Take 2 mL of 2 µM T3 and add 198 mL sterile PBS. d. 5 mg/mL transferrin (Cat. No. T-1147, Sigma): 1 g is dissolved in 200 mL sterile PBS. e. E medium supplements: 100X cocktail: combine 200 mL 180 mM adenine, 200 mL 5 mg/mL insulin, 200 mL 5 mg/mL transferrin, 200 mL 20 nM T3,

160

Wilson and Laimins

f.

g.

h. i. j. k. l. m. n. o.

p.

q.

and 1200 mL sterile PBS, mix well, and filter sterilize. Store in 400-mL aliquots at –20°C. 1000X cholera enterotoxin: A 1 mg vial cholera enterotoxin (Cat. No. 190329 MP Biomedical, Irvine, CA) is reconstituted with 1 mL deionized ddH2O to make 0.1 mM stock solution. Further dilute with 99 mL deionized ddH2O. Store at 4°C in the dark. 1000X hydrocortisone: 100 g hydrocortisone (Cat. No. H-0888, Sigma) is dissolved in 20 mL 100% ethanol to make a 5 mg/mL stock. Take 19.2 mL of the stock and add 220.8 mL HEPES buffer. Make six 40-mL aliquots (0.4 µg/mL) and store at –20°C. Defined fetal bovine serum (FBS, Cat. No. SH30070.03, Hyclone; Logan, UT). DMEM (Cat. No. 1200-061, Gibco Invitrogen). Hams F-12 (Cat. No. 21700-075, Gibco Invitrogen). HCl. 0.2 µm Mediumkap Hollow Fiber Medium Filter (Cat. No. F348-10, MG Scientific, Pleasant Prairie, WI). Tissue-culture grade NaHCO3. Penicillin-streptomycin (Invitrogen). E medium. For a 40-L preparation, combine the following in a 40-L carboy: 30 L deionized ddH 2 O, 3 (10 L) packets of DMEM powder, dissolved in 3 L deionized ddH2O, 10 (1 L) packets of Hams F-12 powder, dissolved in 1 L deionized ddH2O, 122.7 g tissue-culture-grade NaHCO3, dissolved in 1 L deionized ddH2O, 400 mL 100X cocktail E medium supplements, 400 mL penicillin-streptomycin, 40 mL 1000X hydrocortisone, 40 mL 1000X cholera toxin. Shake briefly to mix. Add 12.5 mL concentrated HCl (dilute in deionized ddH2O first), shake, and remove a small quantity to check that pH is approx 7.1. For 5% FBS, add 2 L of FBS. Make up to 40 L with deionized ddH2O and shake. Filter sterilize using a low-protein-binding 0.2-µm filter and aliquot aseptically. Store at 4°C in the dark. 1 µg/mL mouse epidermal growth factor (EGF; Cat. No. 354010, Collaborative Research/Biomedical, Bedford, MA): 100 µg EGF and 10 mg BSA, each dissolved in 10 mL deionized ddH2O, is combined and brought up to 100 mL with deionized ddH2O. Filter-sterilize, aliquot, and store at –20°C. E medium is supplemented with 5 ng/mL (1:200 dilution of 1 µg/mL) EGF immediately before use. E medium containing 1.5% methylcellulose: Autoclave dry methylcellulose (viscosity 400 centipoises, Cat. No. M-0512, Sigma) and a stir bar in a bottle. Add half the final volume of E medium without EGF to autoclaved methylcellulose and heat in a 60°C water bath for 20 min. Do not stir, because stirring causes clumps in methylcellulose. Add the remaining one-half volume of E medium, minus 5% of the final volume to account for FBS that will be added later. Stir at 4°C for 3 h or longer, until solution becomes clear. Add 5% FBS and mix. Store at 4°C.

3. Methods The methods described below will focus on (1) isolation of NHKs from neonatal foreskin, (2) maintenance of monolayer NHKs, (3) preparation of

Differentiation of HPV-Containing Cells

161

HPV genomes for transfection of NHKs, (4) maintenance of HPV-positive NHKs in monolayer cultures, (5) isolation of DNA and (6) RNA from NHKs, (7) methods in keratinocyte differentiation using organotypic raft cultures, as well as (8) differentiation induced by suspension in methylcellulose.

3.1. Isolation of Normal Human Keratinocytes From Neonatal Foreskin Day 1 1. Place fresh isolated foreskin in a tube containing transport medium. Store at 4°C. Use within 24–72 h after collection. 2. For isolation of proliferating basal cells, rinse foreskin twice with PBS (1–5 mL). 3. Using sterile forceps, transfer foreskin to a 100-mm tissue-culture dish containing 10 mL of PBS. 4. Soak forceps and scissors in 70% ethanol and flame before using to trim off fat and vessels from the dermal side (fat will inhibit dispase). Cut tissue into a few pieces (3–4). Soak forceps and scissors in 70% ethanol and flame before each subsequent use. 5. Place 4 mL dispase solution into a 60-mm dish. Add the foreskin pieces, epidermal side up. Incubate for 16 h at 4°C.

Day 2 1 Using two sterile forceps, peel off the epidermis from each piece and transfer the remaining tissue to a 100-mm culture dish containing 0.25% trypsin/1mM EDTA (4 mL). Incubate 10–15 min at 37°C (dispase is inactivated by EDTA). 2. To neutralize trypsin, add 0.5 mL bovine serum to the dish and inactivate for several minutes. 3. With sterile forceps, grasp each piece of tissue and vigorously shake or rub against bottom of dish, 10 to 30 s per piece. Examine under microscope (cells in suspension and scratch marks on dish should be visible). 4. Using a pipet, transfer the cell suspension and pipettable debris to a 15-mL centrifuge tube. Rinse dish once with PBS (5 mL) and add to tube. 5. Centrifuge suspension at 200g for 5 min at room temperature. 6. Discard supernatant. Resuspend cell pellet in KGM (10 mL) and plate on a 100mm tissue-culture dish. Maintain cells in a 37°C, 5% CO2 humidified incubator. 7. After 2 to 24 h, aspirate the medium containing debris and nonadherent cells. Rinse once with PBS if necessary. Replace with fresh KGM. 8. Change KGM medium every 2 d.

3.2. Maintenance of Monolayer Normal Human Keratinocytes (NHKs) 1. Maintain monolayer NHKs on tissue-culture dishes and change medium every 2 d. Passage cells at an 80% confluency. 2. To passage cells, first aspirate medium and then wash once with PBS (10 mL). 3. Aspirate PBS and add 2 mL of 0.05% trypsin/0.53 mM EDTA per 100-mm dish. After addition of the 0.05% trypsin/0.53 mM EDTA, place plate in a 37°C incubator for 3–10 min (incubation time varies among NHK cell lines) to release NHKs from tissue-culture dish.

162

Wilson and Laimins

4. Check cells periodically under a microscope during incubation to monitor release of NHKs. To help facilitate release of cells, tap sides of dishes gently. 5. When cells are in suspension, inactivate trypsin by adding an equal amount of a serum-containing medium. Transfer inactivated trypsin and medium mixture to a 15-mL conical tube. Rinse tissue-culture dish once with a serum-containing medium and add to the conical tube as well. 6. Centrifuge cell suspension at 200g for 5 min at room temperature. 7. Aspirate supernatant, resuspend cell pellet in 10 mL of KGM, and place in a 100-mm tissue-culture dish. Maintain cells in a 37°C, 5% CO2 humidified incubator. When cells become 80% confluent, split cells at a ratio of 1:5.

3.2.1. Removal of Fibroblasts Contaminating NHK Isolates 1. To remove fibroblasts that were carried over in isolation of NHKs from foreskins, a brief treatment with trypsin is needed. The fibroblasts are more sensitive to trypsin than NHKs; therefore, a brief trypsin treatment will selectively remove the fibroblasts while keeping the NHKs adherent. 2. Remove medium by aspiration and wash once with PBS (10 mL). 3. After wash, add 2 mL of 0.05% trypsin/0.53 mM EDTA per 100-mm dish and place in a 37°C incubator for approx 1 min. 4. Remove fibroblasts by aspirating off the trypsin. Inactivate remaining trypsin immediately by adding 10 mL of any serum-containing medium to the dish. 5. After addition of medium, remove trypsin/medium mixture, wash plate twice with 10 mL PBS, and add 10 mL of fresh KGM.

3.2.2. Freezing Normal Human Keratinocytes 1. To freeze NHKs for long-term storage in liquid nitrogen, first prepare freezing medium. Mix 80 mL of KGM with 10 mL FBS and 10 mL of sterile DMSO, for a total of 100 mL. Filter sterilize and store at 4°C for 4–6 wk. 2. To prepare NHKs for freezing, first trypsinize the cells at a confluency of approx 80%. Inactivate trypsin using a serum-containing medium and spin cells down at 200g for 5 min. Resuspend cells in ice-chilled freezing medium and place in freezing tubes. Place freezing tubes in a slow-cool freezing chamber containing isopropanol. Put freezing chamber in a –80°C freezer overnight before transferring to liquid nitrogen. 3. To thaw frozen cells, warm cryo-vials containing cells in a 37°C water bath. Remove cryo-vials from water bath when cells are almost totally thawed. Pipet cells up and down in cryo-vial to complete thawing and transfer to a 100-mm dish containing 15–20 mL of fresh KGM. Mix cells in dish carefully by swirling and place in a 37°C incubator. The following day, change medium by adding 10 mL of fresh KGM.

3.3. Transfection of Normal Human Keratinocytes With HPV Genomes 3.3.1. Maintenance of 3T3 J2 Fibroblasts 1. To maintain stocks of 3T3 J2 fibroblasts (14), cells are grown as monolayers in DMEM, supplemented with 10% calf serum (not fetal calf serum) in a 100-mm

Differentiation of HPV-Containing Cells

2. 3. 4. 5.

6. 7.

8.

163

tissue-culture dishes. Cells are then placed in a 37°C, 5% CO2 humidified incubator and passaged at a confluency no greater than 80%. J2 fibroblasts are typically used up to passages of 20–25 following thawing of an early passage isolate, or until spontaneously transformed foci appear. Passaging of cells should be performed by first trypsinizing cells by addition of 1 mL of 0.05% trypsin/0.53 mM EDTA per 100-mm tissue-culture dish. Incubate cells at room temperature for 1–2 min. Tap dishes on sides to release cells. Inactivate trypsin by adding an equal amount of a serum-containing medium. J2 3T3 fibroblasts are usually split at 1:5 or 1:10 but can be split up to 1:20 if needed. Treat J2 3T3 fibroblasts with mitomycin C prior to use as feeders for HPV-containing keratinocytes. To treat cells, add 100 µL of 0.4 mg/mL mitomycin C solution to 5 mL medium on a sub-confluent plate of fibroblasts, swirl gently, and incubate treated cells for 2–4 h at 37°C in a 5% CO2-humidified incubator. Aspirate off medium containing mitomycin C and wash three times with PBS. If cells are to be used right away, trypsinize fibroblasts to remove them from dish and add to keratinocytes. One sub-confluent plate of J2 fibroblasts can be used for two to four 100-mm dishes of keratinocytes. Mitomycin C-treated fibroblasts can be maintained for up to 48 h in DMEM with 10% calf serum at 37°C in 5% CO2 prior to addition to keratinocytes.

3.3.2. Freezing of 3T3 J2 Fibroblasts 1. To prepare 100 mL of freezing medium for J2 fibroblasts, mix 80 mL of DMEM containing 10% calf serum, 10 mL of DMSO, and 10 mL of calf serum. Filter sterilize and store at 4°C for 4–6 wk. 2. Trypsinize J2 fibroblasts at an 80% confluency. Inactivate trypsin by adding an equal amount of serum-containing medium and spin cells down. 3. Resuspend cells in ice-cold freezing medium and aliquot into cryovials. 4. Place cryovials into an isopropanol-containing freezing chamber for a slow cool and place in an –80°C freezer overnight before storing in liquid nitrogen.

3.2.3. Preparation of HPV Genomes for Transfection of NHKs 1. Incubate HPV genome-containing plasmids (e.g., 10 µg pBR322-HPV31 DNA) with restriction enzymes to release the HPV genome from the bacterial vector in total reaction volume of 52.5 µL. 2. To check for complete digestion of plasmids, take 2.5 µL of reaction mixture and analyze by agarose gel electrophoresis. 3. After confirming that the digestion is complete, heat-inactivate the restriction enzyme(s) by incubation at 65°C for 10 min or according to manufacturer’s suggestions. 4. Re-ligate HPV genomes by adding the remaining reaction volume (50 µL) to 180 µL 5X ligation buffer, 1 µL T4 DNA ligase (400U), and 669 µL dH2O. Incubate at 16°C overnight. 5. After overnight ligation, precipitate DNA (900 µL ligation mix) using 600 µL isopropanol and 180 µL of 5 M NaCl (do not use acetate because the salt can change pH, which can affect lipid formation during transfection). Incubate overnight at –20°C.

164

Wilson and Laimins

6. After overnight incubation, spin for 30 min (15,800g at 4°C) to isolate precipitated DNA. 7. Wash once with 70% ethanol and resuspend pellet in 15 µL TE. 8. Check 1 µL of ligation using an agarose gel electrophoresis to ensure that a majority of re-ligated genomes have formed.

3.3.4. Transfection and Selection of NHKs Using Fugene 6 (see Note 1) 1. Plate an early passage of NHKs onto 60-mm tissue-culture dishes and let cells grow to a confluency of approx 50–60%. 2. For each transfection, add 6 µL of Fugene 6 to 94 µL KGM. Make sure that Fugene is added to the KGM and not vice versa. If undiluted Fugene comes into contact with plastic surface other than pipet tip, transfection efficiency will be decreased. 3. Add to each KGM/Fugene 6 mixture 1 µg HPV DNA and 1 µg of neomycinresistant marker plasmid, pSV2Neo. Tap tube to mix but do not vortex. 4. Incubate at room temperature for 20–45 min. 5. Add 4 mL of fresh KGM into the 6-cm plates containing NHKs. 6. Add 100 µL of the Fugene/DNA mixture to each dish containing NHKs and swirl plates gently.

3.3.5. Selection of Transfected NHKs With G418 1. Day 1: the day following transfection, trypsinize transfected cells and plate onto 100-mm tissue-culture dishes in the presence of mitomycin C-treated J2 fibroblasts and E medium containing 5 ng EGF/mL. 2. Days 2 and 4: change media by adding fresh E medium (with EGF) containing 100 µg/mL G418 to transfectants. 3. Days 3, 5, 7, and 9: add fresh mitomycin-treated J2 fibroblasts to tranfectants. 4. Days 6 and 8: change media by adding fresh E medium (with EGF) containing 200 µg/mL G418 to transfectants to select for neomycin resistance. 5. On average, it takes approx 5 d to see the effects of G418 selection (see Note 2). 6. To determine transfection efficiency, use a plate of untransfected NHKs to check for successful selection. In addition, NHKs transfected with a green fluorescent protein (GFP) plasmid can be used as a positive control to check for transfection efficiency.

3.4. Maintenance of NHKs Containing Episomal Copies of HPV 3.4.1. Passaging of HPV Containing NHKs 1. To passage a 100-mm tissue-culture dish of HPV-containing NHKs, first remove medium and wash plate once with 10 mL of PBS; add 2 mL 0.05% trysin/0.53 EDTA. Place plate in a 37°C, 5% CO2, humidified incubator for 3–10 min (time varies, depending on NHK cell isolate). 2. After incubation, gently tap plate to loosen adherent cells and add at least an equal amount of a serum-containing medium to inactivate trypsin.

Differentiation of HPV-Containing Cells

165

3. Split keratinocytes at ratios of 1:4 to1:10 and add appropriate amounts to mitomycin-treated fibroblasts in E medium. 4. Add fresh medium to cells every 3 d.

3.4.2. Versene Treatment of HPV-Containing NHKs To isolate DNA, RNA, and proteins from HPV-transfected NHKs, a short Versene treatment is first necessary to remove J2 fibroblast feeders while leaving keratinocytes adherent to tissue-culture plates. Aspirate E medium from each plate and wash once with 10 mL of PBS. 1. After wash, add 10 mL of Versene/100-mm dish and incubate at room temperature for approx 2 min. Vigorously rinse plates with Versene several times using a Pipetman. 2. Monitor loosening of fibroblasts by visual observation through a microscope. Repeat Versene treatment if necessary. Before isolation of DNA, RNA, or protein, wash plates twice with PBS to remove any residual fibroblasts.

3.4.3. Freezing HPV-Containing NHKs 1. To prepare 100 mL of freezing medium for HPV-positive keratinocytes, add 70 mL of E medium, 10 mL FBS, and 20 mL glycerol. Mix thoroughly and filter sterilize. Store freezing medium at 4°C for 4–6 wk. 2. Trypsinize HPV-positive keratinocytes when they are approx 80% confluent. Inactivate trypsinize with a serum-containing medium and spin down. After spin, resuspend cells in ice-cold freezing medium and aliquot into cryo-vials. 3. Place cryo-vials into an isopropanol-containing freezing chamber for a slow cool and place in a –80°C freezer overnight before storing in liquid nitrogen.

3.5. Isolation of Viral DNA From Normal Human Keratinocytes 1. Prepare lysis buffer containing 400 mM NaCl, 10 mM Tris-HCl, and 10 mM EDTA at a final pH of 7.4. 2. Harvest NHKs when they are approx 80% confluent by first removing J2 fibroblasts with Versene as described under Subheading 3.4.2. After Versene treatment, trypsinize keratinocytes to detach them from tissue-culture dishes and inactivate trypsin with a serum-containing medium. Spin cells at 200g for 5 min and wash once with 10 mL of PBS. 3. Resuspend cell pellets from one 100-mm tissue-culture dish in 3 mL lysis buffer (see Note 3). 4. Add RNase A to a final concentration of 50 µg/mL, vortex, and incubate at room temperature for 15 min. 5. After incubation, add proteinase K to a final concentration of 50 µg/mL in a solution of 0.2% sodium dodecyl sulfate (SDS), and vortex. Incubate lysis mixture at 37°C overnight. 6. After overnight incubation, shear cellular DNA by passing the mixture through an 18-gauge needle approx 10 times.

166

Wilson and Laimins

7. Perform a phenol-chloroform extraction by adding 6 mL of phenol/ chloroform/ isoamylethanol (25:24:1) and spin at 3077g for 5 min. Repeat extraction two additional times. 8. Extract supernatant twice with 6 mL chloroform/isoamylethanol (24:1). 9. Ethanol precipitate overnight by adding two times the volume of ethanol and one-tenth volume 3 M sodium acetate (pH 5.2) and place at –20°C. 10. Wash twice with 70% ethanol and resuspend in 100 µL TE. Incubate DNA in TE for 30 min at 37°C or 15 min at 60°C to resuspend DNA before storing.

3.6. Isolation of RNA From Normal Human Keratinocytes 1. Harvest RNA from monolayer cultures that are approx 80% confluent by first removing J2 fibroblast feeders by Versene treatment. 2. After Versene treatment, add 7.2 mL of Trizol to each 100-mm plate and incubate at room temperature for 1 min. Pipet the Trizol/lysate mixture up and down using a Pipetman to ensure complete lysis and then place mixture in a 15-mL Falcon tube (see Note 4). 3. Let mixture stand at room temperature for approx 5 min. Following incubation, add 1.4 mL chloroform per 15-mL Falcon tube and shake tubes vigorously for 15 s. Incubate tubes for an additional 2–3 min at room temperature and spin at 1730g for 15 min at 4°C. Transfer the aqueous phase to a fresh tube (see Note 5). 4. Precipitate the RNA by adding 3.6 mL of isopropyl alcohol. Mix samples by inverting tubes gently, and incubate samples at room temperature for 10 min. 5. After incubation, spin down samples at 1730g for 10 min. Precipitated RNA will form at the bottom of the tube as a gel-like pellet. 6. Remove supernatant, wash once with 7.2 mL of 75% ethanol, and mix by vortexing. 7. Spin down RNA at 200g for 5 min at 4°C. 8. Briefly air-dry pellet and resuspend in 50 µL TE. Incubate RNA in TE at 55–60°C for 10 min to resuspend RNA before storing.

3.7. Keratinocyte Differentiation Using Organotypic Raft Cultures 3.7.1. Organotypic Rafts: Preparation 1. First, treat stainless-steel metal grids with chromic/sulfuric acid to remove any residue on the metal grids that could interfere with the differentiation process. To remove residue, treat grids with chromic/sulfuric acid for 1 h, then rinse overnight with tap water. After overnight rinse, grids are rinsed an additional 3–5 h with ddH2O. 2. Prepare treated sterile stainless-steel metal grid by bending down three sides of grid equidistant from one another, by bending edges approx 0.5 cm. These edges will provide the support for the rafts. Autoclave metal grids before use. 3. Determine the number of rafts you will need for your experiment. For each raft. you will need one collagen gel. For each collagen gel, you will need 3 mL of collagen mix, consisting of: 2.4 mL rat-tail collagen type I, 0.3 mL 10X reconsti-

Differentiation of HPV-Containing Cells

4.

5.

6.

7.

8.

9.

10.

11.

167

tution buffer, 0.3 mL 10X DMEM without NaHCO3, and 1–2 × 106 J2 fibroblasts. Create a master mix by first calculating the amount of collagen mix needed. Owing to the viscosity of the collagen mix, include in the calculation enough collagen mix for the preparation of three to four additional collagen gels. To prepare collagen gel, first trypsinize J2 3T3 fibroblasts by adding 1 mL of 0.05% trypsin/0.53 mM EDTA to each 100-mm tissue-culture dish. Add 2 mL of E medium to each dish to inactivate the trypsin and add all J2 fibroblasts from tissue-culture dishes in E medium to a 50-mL conical tube. Count the number of cells with a hemocytometer and spin cells down for 5 min at 250g. After centrifugation, aspirate medium and resuspend pellet in the appropriate amount of 10X reconstitution buffer, 10X DMEM without NaHCO3, and collagen. Add collagen last to prevent gel from solidifying prematurely. If the color of the mix is yellow, add a couple of drops of filtered, sterilized 1 N NaOH and mix to obtain a reddish-orange color, which is indicative of the correct pH. Quickly add 3 mL of the collagen mix to each well of a six-well cell-culture dish using a pipet by touching the pipet to the edge of the plate and letting the collagen mix fall gradually into the well. Allow the collagen mix to solidify in a 37°C incubator for 30 min. After 30 min, add 3 mL of E medium with EGF on top of solidified collagen and return to incubator. Keep at 37°C for at least 1 d and use within 4 d. Optimal results occur after 2 d of incubation. To prepare NHKs for differentiation, place 1–2 × 106 Versene-treated and trypsinized NHKs onto the top of each collagen gel and allow the cells to grow to confluency. Replace medium daily. When medium changes to yellow the day after medium change, the culture is confluent. This usually takes 2–4 d. If medium does not turn yellow, proceed into differentiation at day 4. Using sterile forceps, place an autoclaved metal grid in a 100-mm dish. Remove medium from collagen gel. Use a sterile spatula to cut the perimeter of the gel to release it from sides of plate. To remove collagen gel, tilt plate slightly and lift by sliding a spatula underneath. Lay collagen gel on the metal grid without generating bubbles between the grid and gel. To reduce the number of plates containing metal grids, you can add two collagen gels/grid. To create an air-liquid interface, add E medium without EGF to the bottom of the dish so that the medium is touching the metal grid but the collagen is not. Avoid generating bubbles to ensure that the bottom of metal grid comes into contact with E medium to achieve uniform differentiation. Incubate rafts at 37°C and change medium every other day. Harvest rafts after 13 d.

3.8. Keratinocyte Differentiation Using Semisolid Medium 3.8.1. Suspension of NHKs in 1.5% Methylcellulose 1. Harvest NHKs at a confluency of approx 80% by first removing J2 fibroblasts with Versene treatment as described under Subheading 3.4.2. (see Note 6).

168

Wilson and Laimins

2. Trypsinize NHKs and inactivate trypsin using a serum-containing medium. Place mixture in a 15-mL conical tube. Rinse any excess cells from the plate by adding additional medium, and transfer these to the same 15-mL conical tube. 3. Spin down cells at 250g for 5 min. 4. Remove supernatant and resuspend pellet in 1 mL of E medium. Add the cell suspension dropwise to a 100-mm Petri dish containing 25 mL of 1.5% methylcellulose. To create a homogenous mixture, use a pipet to mix cells. Incubate the suspended cells for 24–48 h at 37°C.

3.8.2. Harvesting Keratinocytes From 1.5% Methylcellulose 1. At each time point following suspension in methylcellulose, collect cells by centrifugation. For each 100-mm Petri dish containing 1.5% methylcellulose, use four 50-mL conical tubes to collect cells. Scrape cells into tubes using a rubber policeman and distribute cells equally to each 50-mL conical tube. Rinse rubber policeman with 10 mL of ice-cold PBS and add this to the tubes. 2. Fill the 50-mL conical tubes with ice-cold PBS, mix, and spin cells at 250g for 10 min at 4°C. 3. After centrifugation, aspirate off supernatant up to 10-mL mark for each tube. Add 10 mL of fresh PBS to each tube, resuspend cells, and combine the mixture into two tubes. 4. Fill the two conical tubes with ice-cold PBS. Spin again. 5. Aspirate supernatant and resuspend cells with ice-cold PBS. Combine volumes into one conical tube. Fill tube with PBS and spin. 6. Aspirate supernatant, resuspend cells in ice-cold PBS, and add suspension to a 15-mL conical tube. Spin and aspirate supernatant. 7. Cells are now ready for DNA, RNA, and protein isolation.

4. Notes 1. Transfection of cell lines with HPV genomes can also be performed using LipofectAce (2,11) and LipofectAmine (12,13) as described by the manufacturer. 2. The effect of G418 might not be evident until several days after initial selection. If cells under selection grow too confluent, split cells at a 1:2 or 1:3 ratio onto mitomycin J2 fibroblasts in the presence of E medium containing EGF. Omit selection on days of passing and resume the following day. 3. During isolation of DNA, more than 100 µg of total DNA can be isolated from one 100-mm tissue-culture dish containing NHKs at a confluency of approx 80%. 4. Cell lysates in Trizol can be stored at –80°C until ready to continue the protocol. 5. After centrifugation during Trizol extraction, there should be three different phases: a lower red phenol-chloroform phase, an interphase, and a colorless upper aqueous phase. 6. For suspension in 1.5% methylcellulose, one 100-mm tissue-culture dish of 80% confluent keratinocytes is treated in one 100-mm Petri dish containing methylcellulose. It is essential that cells be harvested during exponential growth and not

Differentiation of HPV-Containing Cells

169

past a confluency of approx 80%. Inadequate differentiation could occur if cells are too confluent.

References 1. Howley, P. M. (1996) Papillomaviridae: the viruses and their replication. In Fundamental Virology, third ed. (Fields, B. N., Knipe, D. M., and Howley, P. M. (eds), Lippincott-Raven, Philadelphia, PA: pp. 947–978. 2. Frattini, M. G., Lim, H. B., and Laimins, L. A. (1996) In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiationdependent late expression. Proc. Natl. Acad. Sci. USA 93, 3062–3067. 3. Hummel, M., Hudson, J. B., and Laimins, L. A. (1992) Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes. J. Virol. 66, 6070–6080. 4. Frattini, M. G., Lim, H. B., Doorbar, J., and Laimins, L. A. (1997) Induction of human papillomavirus type 18 late gene expression and genomic amplification in organotypic cultures from transfected DNA templates. J. Virol. 71, 7068–7072. 5. Meyers, C., Mayer, T. J., and Ozbun, M. A. (1997) Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA. J. Virol. 71, 7381–7386. 6. Meyers, C., Frattini, M. G., Hudson, J. B., and Laimins, L. A. (1992) Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. 7. Meyers, C. and Laimins, L. A. (1994) In vitro systems for the study and propagation of human papillomaviruses. Curr. Top. Microbiol. Immunol. 186, 199–215. 8. Pray, T. R. and Laimins, L. A. (1995) Differentiation-dependent expression of E1—E4 proteins in cell lines maintaining episomes of human papillomavirus type 31b. Virology 206, 679–685. 9. Ruesch, M. N., Stubenrauch, F., and Laimins, L. A. (1998) Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin-10. J. Virol. 72, 5016–5024. 10. Fehrmann, F., Klumpp, D. J., and Laimins, L. A. (2003) Human papillomavirus type 31 E5 protein supports cell cycle progression and activates late viral functions upon epithelial differentiation. J. Virol. 77, 2819–2831. 11. Thomas, J. T., Oh, S. T., Terhune, S. S., and Laimins, L. A. (2001) Cellular changes induced by low-risk human papillomavirus type 11 in keratinocytes that stably maintain viral episomes. J. Virol. 75, 7564–7571. 12. Hubert, W. G., Kanaya, T., and Laimins, L. A. (1999) DNA replication of human papillomavirus type 31 is modulated by elements of the upstream regulatory region that lie 5' of the minimal origin. J. Virol. 73, 1835–1845. 13. Terhune, S. S., Hubert, W. G., Thomas, J. T., and Laimins, L. A. (2001) Early polyadenylation signals of human papillomavirus type 31 negatively regulate capsid gene expression. J. Virol. 75, 8147–8157.

Propagation of High-Risk HPV in “Raft” Culture

171

14 Propagation of Infectious, High-Risk HPV in Organotypic “Raft” Culture Margaret E. McLaughlin-Drubin and Craig Meyers Summary The organotypic (raft) culture system has been used to develop an in vitro system that is capable of reproducing the entire human papillomavirus (HPV) life cycle, including virion morphogenesis. This system utilizes HPV-containing cell lines that are either derived from biopsies or created by the transfection of keratinocytes with HPV genomic DNA. When grown as raft cultures, these lines allow for a detailed study of all stages of the viral life cycle. In this chapter, we describe in detail how to (1) culture keratinocytes, (2) electroporate primary keratinocytes with HPV DNA, (3) detect episomal HPV genomes by Southern (DNA) blotting, (4) grow organotypic raft cultures, (5) isolate HPV, and (6) perform in vitro infectivity testing.

1. Introduction The life cycle of human papillomaviruses (HPVs) is tightly linked to the differentiation of the host tissue, the squamous epithelium. After infection of stratified squamous epithelium, the HPV genome is established as an episome in the basal cells, where it is stably maintained at 50–200 copies per cell. The latter stages of the life cycle, including vegetative replication and virion morphogenesis, occur only in the differentiated cells of the epithelium. Historically, this link to differentiation hindered study of the HPV life cycle. The organotypic (raft) epithelial culture system has been used to develop an in vitro system that mimics important morphological and physiological features of the epithelium as seen in vivo, and is ultimately capable of reproducing the complete HPV life cycle (1–5). The use of this system for the study of the HPV life cycle involves HPV-containing cell lines that are either derived from biopsies or created by the transfection of keratinocytes with HPV genomic DNA. When grown as raft cultures, these lines allow for a detailed study of all stages of the viral life cycle, including episomal maintenance of the viral genome, amplifiFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

171

172

McLaughlin-Drubin and Meyers

cation of the viral genome, differentiation-dependent viral gene expression, and virion morphogenesis (see also Chapters 12 and 13 for additional rafting methods). 2. Materials 2.1. Growth of Keratinocytes

2.1.1. Tissue-Culture Cells and Media 1. Primary human keratinocytes (obtained from clinics). 2. J2 3T3 mouse fibroblast cells, established by Rheinwald and Green (6). 3. Primary keratinocyte growth medium: 154 Medium (Cascade Biologics, Portland, OR 97219, Cat. No. M-154-500) supplemented with Human Keratinocyte Growth Supplement Kit (Cascade Biologics, Cat. No. S-001-5) and PSA: 100 U/mL penicillin G, 100 µg/mL streptomycin sulfate, 0.25 µg/mL amphotericin B (Cascade Biologics, Cat. No. R0004-PSA). 4. J2 growth medium: liquid Dulbecco’s modified Eagle’s medium (DMEM), 4500 mg/L D-glucose and L-glutamine, no sodium pyruvate, supplemented with 10% heat inactivated newborn calf serum and 25 µg/mL gentamicin. 5. HaCaT growth medium: liquid DMEM, 4500 mg/L D-glucose and L-glutamine, no sodium pyruvate, supplemented with 10% heat-inactivated fetal bovine serum, 1 mM sodium pyruvate, and 25 µg/mL gentamicin. 6. Keratinocyte growth medium (E medium): a. Dissolve 200.55 g powdered DMEM with 4500 mg/L D-glucose and L-glutamine, no sodium pyruvate or sodium bicarbonate, in 1 L of distilled and deionized water. Dissolve 53.13 g powdered F-12 Nutrient Mixture (Ham), with L-glutamine, no sodium bicarbonate, in 1 L of distilled and deionized water. When the powders are completely dissolved, add to a 20-L carboy containing 16.25 L of distilled and deionized water. b. Add 61.37 g of tissue-culture-grade sodium bicarbonate. c. Add 20 mL of 1.8 × 10–1 M adenine, prepared earlier by dissolving 486 mg of adenine in 15 mL of sterile distilled water. Add approx 10 drops of concentrated HCl until the adenine is dissolved, and bring the volume of the stock to 20 mL. The stock solutions can be stored at –20°C for up to 1 yr. Heat the adenine stock at 55°C for 5 min prior to use to ensure that the precipitate goes back into solution. d. Add 20 mL of 5 mg/mL insulin, prepared earlier by dissolving 100 mg of insulin in 20 mL of 0.1 N HCl. The stock solutions can be stored at –20°C for up to 1 yr. e. Add 20 mL of 5 mg/mL transferrin, prepared earlier by dissolving 100 mg of transferrin in 20 mL sterile PBS. The stock solutions can be stored at –20°C for up to 1 yr. PBS is made by dissolving 8 g NaCl, 0.2 g KH2PO4, 1.15 g of Na2HPO4, and 0.2 g KCl in 700 mL of distilled, deionized water and bringing the volume to 1 L. Store at room temperature.

Propagation of High-Risk HPV in “Raft” Culture

173

f. Add 20 mL of 2 × 10–8 M T3, prepared earlier by dissolving 13.6 mg of T3 in 100 mL of 0.02 N NaOH, then adding 0.1 mL of this solution to 9.9 mL of sterile PBS, and further diluting 1.0 mL of this solution in 99 mL of sterile PBS. The stock solutions can be stored at –20°C for up to 1 yr. g. Add 200 mL of penicillin-streptomycin solution (10,000 U/mL and 10,000 µg/mL, respectively). h. Add 20 mL of 0.4 mg/mL hydrocortisone, prepared earlier by dissolving 25 mg of hydrocortisone in 5 mL of 100% ethanol and diluting 4.8 mL of this solution in 55.2 mL of 1 M HEPES buffer, pH 7.0. The stock solutions can be stored at –20°C for up to 1 yr. i. Add 20 mL of 0.01 mg/mL cholera enterotoxin, prepared earlier by dissolving 1 mg cholera enterotoxin in 100 mL sterile distilled water. The stock solution can be stored in the dark at –20°C for up to 1 yr. j. Add 6.25 mL concentrated HCl. k. Mix the solution in the carboy and bring the volume to 20 L. Check the pH and adjust, if necessary, to pH 7.1. Mix well and filter sterilize 950 mL into sterile 1-L bottles using a low-protein-binding 0.2-µm filter. Store in the dark at 4°C for up to 6 mo. Add 50 mL of heat-inactivated fetal bovine serum (5%) and 10 mL nystatin (final concentration 100 U/mL) to each bottle prior to use. The media can be stored for up to 6 mo at 4°C after the addition of serum.

2.1.2. Passaging of Keratinocytes and J2 3T3 Cell Lines 1. Trypsin-EDTA: 0.5% trypsin, 0.53 mM ethylenediamine tetraacetic acid (EDTA)·4Na. 2. 100-mm tissue-culture dishes. 3. Mitomycin C: Dissolve 2 mg of mitomycin C in 5 mL sterile PBS (final concentration, 0.4 mg/mL) and filter sterilize. Store at 4°C in the dark. The stock will remain good for 2–3 wk or until a heavy precipitate forms.

2.2. Electroporation 1. 2. 3. 4.

Plasmid DNA containing cloned HPV genomes. Restriction endonucleases. Denatured salmon sperm DNA (10 mg/mL). 200X epidermal growth factor (EGF): 100 µg EGF dissolved in 10 mL dH2O, 100 mg bovine serum albumin (BSA) dissolved in 10 mL dH2O, and 80 mL dH2O. Filter sterilize, aliquot, and store at –20°C. 5. 1X TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 7.4. 6. 5 mM N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES), pH 7.2. 7. Gene Pulser II (BioRad).

2.3. Detection of Episomal HPV Genomes by Southern (DNA) Blotting 1. 1X TE buffer (see Subheading 2.2.). 2. 50X TAE buffer: 242 g Tris base, 57.1 mL glacial acetic acid, 37.2 g Na2EDTA·2H2O, H2O to 1 L.

174

McLaughlin-Drubin and Meyers

3. 10 mg/mL RNase A: 100 mg RNase A, 100 µL 1 M Tris-HCl (pH 7.5), 150 µL 1 M NaCl, and 9.75 mL H2O. Heat the solution to 100°C for 15 min and cool slowly to room temperature. Aliquot and store at –20°C for up to 1 yr. 4. 10% sodium dodecyl sulfate (SDS). 5. 20 mg/mL Proteinase K in H2O. Aliquot and store at –20°C for up to 1 yr. 6. 18-Gage needles. 7. 5-mL Syringes. 8. Extraction buffer: 400 mM NaCl; 10 mM Tris-HCl (pH 7.4); 10 mM EDTA. Store at room temperature. 9. Phenol:chloroform:isoamyl alcohol (25:24:1). 10. Chloroform. 11. 3 M Sodium acetate. 12. Ethanol. 13. Agarose. 14. Polaroid film. 15. HCl. 16. NaOH. 17. GeneScreen Plus Membrane (PerkinElmer Life Sciences, Inc.). 18. 3MW Gel Blot paper. 19. Plastic wrap. 20. 20X SSC: 175.3 g NaCl and 88.2 g sodium citrate in 800 mL H2O. Adjust pH to 7.0 with NaOH and bring volume to 1 L with H2O. 21. Prehybridization solution: 15 mL formamide, 6 mL 20X SSPE, 1.5 mL 100X Denhardts, 1.5 mL 20% SDS, 1.5 mL 10 mg/mL denatured salmon sperm DNA, and 4.5 mL dH2O. Store at –20°C for up to 1 yr. 22. Hybridization solution: 15 mL formamide, 6 mL 20X SSPE, 1.5 mL 100X Denhardts, 20% SDS, 3 g dextran sulfate, 1.5 mL denatured salmon sperm DNA, and 1.5 mL dH2O. Store at –20°C for up to 1 yr. 23. Formamide. 24. 20X SSPE: 173.5 g NaCl, 27.6 g NaH2PO4·H2O, 7.4 g EDTA in 800 mL H2O. Adjust the pH to 7.4 with NaOH and bring the volume to 1 L with H2O. 25. 100X Denhardts reagent: 10 g ficoll, 10 g polyvinylpyrrolidone, and 10 g bovine serum albumin. Bring to 500 mL with H2O. 26. 32P-dCTP. 27. Random Primed Labeling Kit (Roche). 28. Quick Spin Column (Roche). 29. Autoradiography film.

2.4. Organotypic (Raft) Cultures 1. NaOH. 2. Rat-tail type I collagen (BD Bioscience Discovery, Cat. No. 356236). 3. 10X reconstitution buffer: 2.2 g sodium bicarbonate, 4.7 g HEPES, and 75 mL of 0.062 N NaOH. Dissolve completely and bring the final volume to 100 mL with

Propagation of High-Risk HPV in “Raft” Culture

4.

5. 6. 7.

175

0.062 N NaOH. Adjust pH to 8.2. Filter-sterilized aliquots are stored at –20°C for up to 1 yr. 10X DMEM: 133.7 powdered DMEM in 1 L sterile dH2O. The powder will not completely dissolve; however, warming the solution in a water bath will help. Filter-sterilized aliquots can be stored at –20°C. Before use, take care that the solution is as homogeneous as possible, as the precipitate will persist. The precipitate will dissolve when all components of the dermal equivalent are mixed together. Dichromic acid. Six-well tissue-culture cluster dishes. Three one-sixteenth-inch 40-mesh 010 SS wire cloth circles (Williams and Mettle Co., Houston, TX, 77041, Cat. No. 20368). Bend the circle at the edge at three points equidistant from each other. The bends are to form legs that will raise the mesh approx 2 mm from the bottom of the tissue-culture dish. Soak the circles in dichromic acid cleaning solution for 1–2 h. Rinse the wire-cloth circles for 48 h in a beaker with distilled water. Place the wire-cloth circles in a beaker, cover with foil, and autoclave.

2.5. Virus Isolation 1. 2. 3. 4. 5. 6. 7. 8.

Scalpel. Forceps. Sea sand (Fisher). NaCl. Mortar and pestle. Virus isolation buffer 1: 1 M NaCl, 0.05 M Na2HPO4 (pH 8.0). Virus isolation buffer 2: 0.05 M NaCl, 0.1 M EDTA, 0.05 M Na2HPO4 (pH 7.4). PBS: see Subheading 2.1.1.

2.6. In Vitro Infectivity Assay 1. Aerosol-resistant pipet tips. 2. HaCat cells (kindly provided by Norbert Fusenig, German Cancer Research Center, Division for Differentiation and Carcinogenesis, Im Neurenheimer Feld 280, D-69120 Heidelberg, Germany). 3. HaCaT growth medium: see Subheading 2.1.1. 4. 24-Well tissue-culture cluster dishes. 5. Sonicator with cup horn. 6. DEPC: add 100 µL DEPC to 100 mL dH2O. Incubate at 37°C for 12 h and autoclave to sterilize. 7. mRNA Capture Kit (Roche). 8. Reverse transcription-polymerase chain reaction (RT-PCR), First Strand cDNA Kit (Roche). 9. Taq polymerase. 10. 10 mM dNTP mix.

176

McLaughlin-Drubin and Meyers

11. PBS: see Subheading 2.1.1. 12. Gel loading buffer. 13. HPV primers: see Table 1.

3. Methods The methods described below outline (1) the culture of keratinocytes, (2) the electroporation of primary keratinocytes with HPV DNA, (3) the detection of episomal HPV genomes by Southern (DNA) blotting, (4) the growth of organotypic (raft) cultures, (5) the isolation of HPV, and (6) the detection of infectious HPV.

3.1. Growth of Keratinocytes 3.1.1. Passaging of Keratinocyte and J2 3T3 Cell Lines 3.1.1.1. PRIMARY HUMAN FORESKIN KERATINOCYTES

Primary human foreskin keratinocytes are maintained as monolayers in 100-mm tissue-culture dishes in 12 mL of primary keratinocyte growth medium. The cells are grown in a 37°C 5% CO2 humidified incubator and fed every 2 d. Upon 80–90% confluence, the cells should be passaged using standard tissue-culture techniques (see Note 1). Primary human foreskin keratinocytes should usually be passaged 1:3 to 1:6. 3.1.1.2. HPV-CONTAINING KERATINOCYTES

Keratinocyte cell lines containing HPV genomes are maintained as monolayers in 100-mm tissue-culture dishes in 10 mL of E medium in the presence of mitomycin C-treated J2 3T3 fibroblast feeder cells. The cells are grown in a 37°C 5% CO 2 humidified incubator and fed every 2 d. Upon 80–90% confluence, the cells should be passaged 1:5 or 1:10 onto mitomycin C-treated feeder cells using standard tissue-culture techniques (see Note 2). 3.1.1.3. J2 3T3 FEEDER CELLS

J2 3T3 cell lines are maintained as monolayers in 100-mm tissue-culture dishes in 10 mL of J2 3T3 maintenance medium. The cells are grown in a 37°C 5% CO2 humidified incubator and fed every 3 d. Upon 80–90% confluence, the cells should be passaged 1:5 to 1:10 (see Note 3). 3.1.1.4. MITOMYCIN C TREATMENT OF J2 3T3 CELLS (SEE NOTE 4) 1. Add the 0.4 mg/mL stock solution of mitomycin C to a final concentration of 8 µg/mL to a dish of J2 3T3 cells prior to use as feeders for keratinocyte growth (200 µL mitomycin C per 10 mL E medium) and incubate the treated dish at 37°C for at least 2 h but no more than 4 h.

Species

Nested band size

Outer 5'

Outer 3'

Nested 5'

Nested 3'

N/A

429 bp

HPV16

880-3358

226 bp

HPV18

929-3434

269 bp

HPV31

877-3295

229 bp

HPV33

894-3351

380 bp

HPV39

943-3418

323 bp

HPV45

929-3392

302 bp

5'GATGACC CAGATCA TGTTTG3' (nt. 778-98) 5'TGGAAGAC CTGTTAATG GGCACAC3' (nt. 797-820) 5'GTTGTGTA TGTGTTGTA AGTGTGA3' (nt. 772-795) 5'GTGTGTAC AGAGCAC ACAAGT3' (nt. 760-780) 5'CGAACCAT ACAGCAA CTACTTAT3' (nt. 801-823) 5'CTGGTAGT AGAAGCCT CACGG3' (nt. 820-840) 5'GAGCTTA CGTAGAGA GCTCG3' (nt. 806-826)

5'GGAGCAA TGATCTT GATCTTC3' (nt. 3665-3684) 5'GTTACTAT TACAGTTAA TCCGTCC3' (nt. 3584-3607) 5'GTCCACAA TGCTGCTT CTCCG3' (nt. 3580-3600) 5'TTGGTTTG TGCATG CAGCTGC3' (nt. 3521-3541) 5'CTTTATAA GGTTTTAAT CTGTATC3' (nt. 3617-3640) 5'TACCACAA CTGAGGTAC CGTCT3' (nt. 3641-3662) 5'TGTTACCAC TACACACTT TCCTTC3' (nt. 3613-3636)

5'AACACCC CAGCCAT GTACGTTG3' (nt. 808-828) 5'GGAATTGT GTGCCCCAT CTGTTC3' (nt. 823-845) 5'GAATTGGC TAGTAGTAG AAAGCT3' (nt. 801-824) 5'CGCATATT GCAAGA GCTGTTA3' (nt. 788-808) 5'GTGTCAACA GTACAG CAAGTG3' (nt. 775-795) 5'GATACTCT GCGACAACT ACAGC3' (nt. 841-862) 5'GCAGAGG ACCTTAGAA CACTA3' (nt. 827-847)

5'ACTCCAT GCCCAGG AAGGAAGG3' (nt. 3559-3578) 5'GCAACAACT TAGTGGTG TGGC3' (nt. 3507-3527) 5'TCCCACGT GTCCAGGT CGTGT3' (nt. 3555-3575) 5'AGTTGACA CTGTCCA CGGAGT3' (nt. 3486-3506) 5'ACATTTTA AACTATTTGA TTCACC3' (nt. 3589-3612) 5'GTGTTGTG GCCTGTACTG TTAC3' (nt. 3618-3939) 5'GAACACAG GAGCGGGTT GTGC3' (nt. 3572-3592)

177

E1^E4 Splice

Actin

177

Propagation of High-Risk HPV in “Raft” Culture

Table 1 PCR Primers Used in HPV Infections Titer Assay

178

McLaughlin-Drubin and Meyers

2. Remove the medium and wash the dish three times with 3 to 5 mL of sterile PBS. 3. If the cells are to be used immediately, mitomycin C-treated J2 3T3 cells can be split 1:2 to 1:3. If the cells are to be stored for later use, add 10 mL E medium and incubate for up to 1 wk with re-feedings every 2–3 d.

3.2. Electroporation (see Note 5) 1. Digest the HPV plasmid DNA with a restriction endonuclease that linearizes the viral DNA and separates it from vector sequences. Verify that digestion is complete by visualization with ultraviolet (UV) by ethidium-bromide staining. 2. Phenol/chloroform/isoamyl alcohol extract the digested DNA twice, then chloroform extract and ethanol precipitate. Resuspend the DNA in 1X TE buffer at a concentration of approx 7.5 µg/10 µL. The DNA can be stored in aliquots at –20°C until used. 3. Mix 10 µL of the digested DNA with 4.25 µL of sonicated and denatured salmon sperm DNA (10 µg/µL) in a 1.5-mL microcentrifuge tube. 4. Trypsinize human foreskin keratinocytes using standard tissue-culture techniques and count the cells. Centrifuge the cells at 16g, remove the medium and resuspend the cells in E medium containing 10% fetal bovine serum (FBS) with 5 mM N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES) (pH 7.2) to a final concentration of 20 × 106 cells/mL. 5. Add 250 µL of the cell mixture (5 × 106 cells) to the microcentrifuge tube containing the DNA and incubate for 10 min at room temperature. 6. Transfer the DNA and keratinocyte solution to an electroporation cuvette, electroporate using a Gene Pulser set at 210 V/960 µF (time constant approx 40), then incubate at room temperature for 10 min. 7. Layer the electroporated cell solution onto 10 mL of E medium containing 10% FBS and centrifuge at 16g for 10 min. 8. Remove the medium and resuspend the cell pellets in E medium containing 10% FBS and 100 U/mL nystatin. Plate the electroporated cells onto 100-mm tissueculture dishes containing mitomycin C-treated J2 3T3 feeder cells. 9. The following day, add EGF to a final concentration of 5 ng/mL. 10. Feed the cultures every other day for 7 d with E medium containing 10% FBS, 5 ng/mL EGF, and 100 units/mL nystatin. After the 7-d period, feed the cells with E medium containing 5% FBS, 5 ng/mL EGF, and 100 U/mL nystatin until the keratinocytes grow to confluence, at which time the EGF is omitted from the medium. 11. Continue to grow the cells until the presence of the HPV genome has been confirmed (see Notes 6 and 7).

3.3. Detection of Episomal HPV Genomes by Southern (DNA) Blotting 3.3.1. Total DNA Extraction 1. Remove approx 80% confluent cells from dish by trypsinization and pellet the cells in a 15-mL conical tube following standard tissue-culture techniques.

Propagation of High-Risk HPV in “Raft” Culture

179

2. Aspirate the medium from the pellet. At this point, the cell pellet can be stored at –20°C until used. 3. Add 3 mL of extraction buffer, RNase A to a final concentration of 50 µg/mL, and SDS to a final concentration of 0.2% to the pellet, and incubate at 37°C overnight on a rotating tube shaker. 4. Add proteinase K to a final concentration of 50 µg/mL and incubate at 37°C for 1–4 h on a rotating tube shaker. 5. Shear the DNA by passing it approx 10 times through an 18-gage needle (use a 5-mL syringe). 6. Phenol/chloroform/isoamyl alcohol extract the digested DNA twice, then chloroform extract and ethanol precipitate. 7. Resuspend the pellet in 100 µL of 1X TE buffer, incubate overnight at 4°C, and then incubate at 37°C for 15 min to ensure resuspension. 8. Determine the concentration of the DNA samples by spectrophotometry at A260 nm. The DNA can be stored at 4°C until used.

3.3.2. Southern (DNA) Blot Hybridization 1. Run 5 µg of the sample DNA on a 0.8% 1X TAE ethidium-bromide agarose gel. The sample should be either digested with a restriction enzyme that does not digest the HPV genome (allowing for the visualization of supercoiled and relaxed circle DNA) or a restriction enzyme that linearizes the HPV genome. 2. Measure the distances of the molecular-weight markers and photograph the gel. 3. Gently shake the gel at room temperature in two volumes of 0.25 M HCl for 15 min, then distilled water for 5 min, and finally 0.4 N NaOH for 30 min. 4. While the gel is soaking in the NaOH, prewet a nylon membrane (cut to the same size as the gel) in water and soak it in 0.4 M NaOH for at least 20 min at room temperature. 5. Wet three long sheets of 3MW gel blot paper in 0.4 N NaOH and lay over a glass plate in a pyrex container containing 0.4 N NaOH to serve as wicks. Smooth the wicks with a pipet. 6. Transfer the gel onto the wicks and smooth the gel with a pipet. Cover the wicks with plastic wrap, leaving only the surface of the gel exposed. Exposed wick surfaces will result in the loss of the NaOH from the reservoir, causing the transfer of the DNA to be incomplete. 7. Place the nylon membrane atop the gel and gently smooth the membrane with a pipet to remove any air bubbles (air bubbles will prevent the transfer of DNA). 8. Place one sheet of 0.4 N NaOH-soaked 3MW gel blot paper approximately the size of the gel, on top of the gel. Place ten sheets of dry 3MW gel blot paper on top of the wet gel blot paper. 9. Stack 15–20 cm of paper towels on top of the blot paper. Place a weight (such as a heavy book) on top of the paper towels and allow the DNA to transfer overnight. 10. The next day, remove the weight, paper towels, and blot paper, and mark the positions of the wells on the membrane with a pencil.

180

McLaughlin-Drubin and Meyers

Fig. 1. Southern (DNA) blot hybridization of episomal HPV45 genomes. The sample in lane 0X was digested with a non-cutter of the HPV45 genome and the sample in lane 1X was digested with a single cutter of the HPV45 genome. HPV45 100, 10, and 1 copy number standards are shown. Arrows indicate Form II DNA (nicked), Form III DNA (linear), and Form I DNA (supercoiled). 11. Rinse the membrane in 2X SSC to remove any remaining gel fragments and dry the membrane on a piece of 3MW gel blot paper for 30 min. 12. Bake the membrane in an envelope constructed from 3MW gel blot paper in a vacuum oven at 80°C for 2 h. The membrane can then be stored at room temperature until hybridization. 13. Wet the membrane in 2X SSC just prior to prehybridization. 14. Prehybridize the blot for at least 1 h at 42°C (with shaking) in prehybridization solution (minimum 50 µL/cm2 blot) in a sealed plastic bag. 15. Remove the prehybridization solution and add hybridization solution (minimum 50 µL/cm2 blot). 16. Add a 32P-dCTP random primed labeled HPV genomic probe (see Subheading 3.3.2.1.) to the hybridization solution and hybridize at 42°C (with shaking) for 12–16 h. 17. Rinse the blot in 2X SSC, 0.1% SDS. 18. Wash the blot (with shaking) for 15 min at room temperature in 2X SSC, 0.1% SDS, followed by 15 min at room temperature in 0.5X SSC, 0.1%SDS, followed by 15 min at room temperature in 0.1X SSC, 0.1% SDS, followed by 30 min at 50°C in 0.1X SSC, 1% SDS. 19. Expose to autoradiography film. 20. Utilize cell lines maintaining episomal genomes for further studies. Examples of episomal genomes can be seen in Fig. 1 and refs. 2–5.

3.3.2.1. 32P-DCTP RANDOM PRIMED LABELED HPV GENOMIC PROBE 1. Digest the appropriate HPV plasmid DNA with a restriction endonuclease that separates the genomic DNA from vector sequences. Gel purify the genomic band

Propagation of High-Risk HPV in “Raft” Culture

2.

3. 4.

5. 6. 7. 8.

181

from a 1X TAE, ethidium-bromide gel and resuspend the DNA in 1X TE buffer at a final concentration of 10 ng/µL. This DNA will serve as the template for the Southern probe and can be stored at –20°C until use. Add the following to a 1.5-mL microcentrifuge tube: 5 µL denatured DNA template (50 ng), 5 µL dH2O, 3 µL dA,G,TTP Mix (Random Primed Kit), 4 µL 32P-dCTP, 2 µL solution 6 (Random Primed Kit), and 1 µL Klenow (Random Primed Kit). Incubate at 37°C for 30 min. Add 2 µL 500 mM EDTA, adjust the volume to 100 µL with dH2O, and spin for 5 min in a Quick Spin column at 2250g (spin the column for 2 min to dry prior to sample spin). Add 100 µL of 10 mg/mL denatured salmon sperm DNA to the probe. Add an equal volume of formamide and denature the probe at 95–100°C for 5 min. Cool the probe on ice for 15 min. Count an aliquot of the probe using a scintillation counter. 106 cpm of probe/mL hybridization solution should be used.

3.4. Organotypic (Raft) Culture 3.4.1. Dermal Equivalent (Collagen Matrix) 1. Prior to the preparation of the dermal equivalent, calculate the number of raft tissue cultures that are needed, being sure to calculate for an additional raft to make up for any adherence of the collagen in the pipet. Based on this number, calculate the final volume of collagen-fibroblast mixture needed. As each raft culture requires a total of 2.5 mL of collagen-fibroblast mixture, simply multiply the number of rafts needed (plus one) by 2.5. The collagen-fibroblast mixture consists of one-tenth the final volume of reconstitution buffer, one-tenth the final volume of 10X DMEM, 8/10 the final volume of rat-tail type I collagen, 2.5 × 105 J2 3T3 cells per mL of collagen mixture, and 2.4 µL of 10 N NaOH per mL of the final volume. (Note: the J2 3T3 cells used for the dermal equivalent are not mitomycin C treated.) 2. Trypsinize the J2 3T3 cells using standard tissue-culture techniques. Count the cells, pellet the trypsinized J2 3T3 cells by centrifugation in a 50-mL conical tube, and aspirate off the trypsin solution. Resuspend the cell pellet in the necessary amount of reconstitution buffer. Mix this with the predetermined amount of 10X DMEM. At this point, the mixture can be aliquoted into additional 50-mL conical tubes, ensuring that the final volume of the collagen-fibroblast mixture does not exceed 30–45 mL per tube. From this point on, keep the tubes on ice to ensure that the collagen does not solidify. 3. Add the predetermined amount of rat-tail type I collagen to each tube. As rat-tail collagen is very viscous, the use of the same pipet to dispense collagen to all of the tubes will prevent excess loss of collagen adhering to the pipet. 4. Add the predetermined amount of NaOH to each tube (2.4 µL × final volume of collagen-fibroblast mixture).

182

McLaughlin-Drubin and Meyers

5. Cap the tubes tightly and gently invert the tubes approximately five times until the solution is mixed. Take care not to introduce many bubbles. 6. Aliquot 2.5 mL of the collagen-fibroblast mixture into the wells of a six-well cluster dish using one 10-mL pipet. Again, avoid the introduction of bubbles, if possible. 7. Place the six-well cluster dishes containing the dermal equivalents in a 37°C incubator until solidification occurs, usually 1 h. The dermal equivalents can remain in the incubator overnight before the next step of the protocol is started. 8. After solidification, add 2–3 mL of E medium to the top of the dermal equivalent. Take care not to use excessive force, which can damage the dermal equivalent. The dermal equivalent can be left in the incubator for up to 1 wk with medium changes every 2 d.

3.4.2. Seeding the Keratinocytes and Lifting the Collagen Matrix/ Keratinocytes to the Air-Liquid Interface 1. Remove the medium from the collagen matrix and place 0.5 × 106 – 1 × 106 keratinocytes on top in 3–4 mL of E medium. 2. Allow the cells to attach by incubating for 1 d at 37°C. 3. Remove the medium. Use a sterile lab spoon to carefully separate the collagen matrix from the sides of the six-well cluster dish. 4. Tilt the six-well cluster dish and slip the lab spoon under the lower side of the collagen matrix until it can be lifted and placed onto the wire-cloth circles in the 100-mm tissue-culture dish. Quickly move the lab spoon between the collagen matrix and the wire-cloth circle to smooth out the matrix as much as possible. One to three collagen matrices can be placed on a single wire-cloth circle. 5. Feed the cultures every other day from underneath the wire grid for 10 d with E medium containing 5% FBS, 100 U/mL nystatin, and 10 µM C8. The addition of C8 promotes a more complete differentiation of the tissue. Do not allow the top of the cultures to become wet from the medium. 6. After 10 d of growth, the raft culture tissues can be harvested and used for histology, immunohistochemistry, electron microscopy, and biochemical and molecular biological studies. The entire raft culture tissue is harvested for histology and immunohistochemistry. Only the epithelial layer is harvested for viral preparations and biochemical and molecular biological studies. To harvest the epithelial layer, peel the raft culture epithelium off of the collagen with a scalpel and forceps. Make a cut in the tissue with the scalpel and scrape the tissue away from the collagen. Lift the tissue off the collagen with the forceps. 7. At this point, Southern blot analyses can be performed on total DNA isolated from the raft tissue to detect the presence of amplified HPV genomes (see Note 8).

3.5. Virus Isolation While amplification of the viral genome is thought to be a necessary step in the viral life cycle, we have found that it does not necessarily correlate with infectious virus production (see Note 9). Thus, it is necessary to test putative

Propagation of High-Risk HPV in “Raft” Culture

183

viral stocks for infectivity whether or not the genome appears to amplify upon differentiation of the tissue. 1. Peel the raft culture epithelium off of the collagen with a scalpel and forceps (a minimum of 10 and a maximum of 25 raft tissues are used to make each putative viral stock). 2. Grind the tissue in a mortar with sea sand (use just enough sea sand to cover). Add 3 mL 0.15 M NaCl and grind some more. 3. Resuspend the ground tissue in a total volume of 11 mL of virus isolation buffer 1 and centrifuge at 4°C for 10 min at 8000g. Collect the supernatant and store on ice while proceeding to step 5. 4. Re-extract the pellet with 11 mL of buffer 1 and centrifuge at 4°C for 10 min at 8000g. 5. Pool the supernatants from both centrifugations and centrifuge at 4°C for 1 h at 130,000g. 6. After the centrifugation, resuspend the pellet in 12 mL of virus isolation buffer 2 and centrifuge at 4°C for 10 min at 8000g. Collect the supernatant and store on ice while proceeding to step 8. 7. Re-extract the pellet with 12 mL of buffer 2 and centrifuge at 4°C for 10 min at 8000g. 8. Pool the supernatants from the last two centrifugations and centrifuge at 4°C for 1 h at 130,000g. 9. Resuspend the pellet in 2.5 mL of PBS and store aliquots at –20°C. At this point, electron microscopy and titering of the stock can be performed.

3.6. In Vitro Infectivity Assay The infectivity assay is based on an in vitro system described by Smith et al. (7). HaCaT cells, an immortalized human keratinocyte cell line, are grown to confluence in HaCaT growth medium. 1. Plate 5 × 104 HaCaT cells in 0.5 mL medium per well of a 24-well cluster dish. Incubate the cells at 37°C for 2–3 d until the cells are almost 100% confluent. 2. Thaw virus stocks on ice. 3. Sonicate the virus stocks for 30 s on ice and prepare serial dilutions of the stock in HaCaT medium. 1:100 and 1:1000 dilutions are convenient when initially titering a virus stock. Once the infectivity of a stock is established, further dilutions may be desired. 4. Aspirate the medium from the HaCaT cells and add 0.5 mL of each dilution per well. As a control, add 0.5 mL of medium without virus to one well on each dish. Incubate the cultures overnight at 37°C. 5. Add an additional 0.5 mL medium and incubate overnight at 37°C. At this time RNA can be isolated for viral titering.

3.6.1. RNA Isolation, cDNA Synthesis and PCR Amplification 1. Rinse the cells twice with 0.5 mL cold PBS and then add 0.25 mL cold lysis buffer (provided in the mRNA Capture Kit), taking care not to cross-contaminate samples. Wait 1–2 min.

184

McLaughlin-Drubin and Meyers

2. Using a 1000-µL pipet set to 500 to 700 µL, remove the lysis buffer by mechanically scraping the bottom of each well with the tip and aspirating the contents. Take care not to let any of the stringy genetic material touch your gloves, pipet, or other wells. Add the lysis buffer to a labeled 1.5-mL RNase- and DNase-free tube and place on ice. At this point, the lysates can be stored at –70°C until further use. 3. Vortex the lysates briefly and sonicate on ice, twice for 1 min on continuous mode with the power setting between 5 and 6. After sonication, check the viscosity of the samples. If the lysates are still viscous, sonicate an additional minute. 4. Vortex the lysates for 10 to 15 s. 5. Dilute the biotinylated oligo-dTs (provided in the mRNA Capture Kit) 1:4 in sterile water and add 1 µL per lysate for HPV31, 39, and 45; 1:20 and add 4 µL per lysate for HPV11 and HPV16; and 1:4 and add 2 µL per lysate for HPV18. 6. Place the lysates at 42°C for 10 min and then place on ice. 7. Remove 50 µL of each lysate and place in a streptavidin-coated capture tube (provided in the mRNA Capture Kit). Incubate the capture tubes for 3 min at 37°C and then place on ice. 8. Remove 50 µL of lysate from each tube and discard into 50% bleach. Wash the tubes three times with 200 µL of wash buffer (mRNA Capture Kit). At this point, the samples can be kept at –70°C until cDNA synthesis. 9. The cDNA synthesized will be used for nested PCR to test for the presence of actin (to check the integrity of the sample) and the E1^E4 spliced product (to determine whether the viral stock is infectious). Add the following to each capture tube (reagents provided in the RT-PCR First Strand Synthesis Kit): 25 µL DEPC H2O, 5 µL 10X reaction buffer, 10 µL 25 mM MgCl2, 5 µL 10 mM dNTP, 1 µL gelatin, 2 µL RNase inhibitor, and 2 µL AMV RT. 10. Incubate the tubes for 2 h at 42°C and then place on ice. 11. Remove 50 µL of the cDNA master mix from each tube. Wash the tubes once with 200 µL of wash buffer (provided with the mRNA Capture Kit). 12. In a PCR tube, mix: 1X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 125 ng HPV outer 5' primer, 125 ng HPV outer 3' primer, 12.5 ng actin outer 5' primer, 12.5 ng actin outer 3' primer, 0.5 µL Taq polymerase, DEPC H2O to 50 µL (PCR no. 1 reaction). 13. PCR conditions are as follows: For HPV11, 31, 39, and 45, 2 min at 95°C followed by 40 cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C. Then a final elongation step of 10 min at 72°C, followed by 4°C. For HPV16 and 18, 5 min at 95°C followed by 40 cycles of 30 s at 95°C, 30 s at 60°C, and 1 min at 72°C. Then a final elongation step of 10 min at 72°C, followed by 4°C. 14. In a 0.65-mL PCR tube, mix: 1X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 125 ng HPV nested 5' primer, 125 ng HPV nested 3' primer, 125 ng actin nested 5' primer, 125 ng actin nested 3' primer, 1 µL Taq polymerase, DEPC H2O to 45 µL, 5 µL PCR no. 1 reaction. 15. Perform PCR as above except for HPV16 and 18, elongate for 30 s rather than 1 min at 72°C. 16. Add gel loading buffer to each sample and run 10 µL on a 2% agarose gel.

Propagation of High-Risk HPV in “Raft” Culture

185

4. Notes 1. Higher confluency of the cells induces greater differentiation, thus decreasing the pool of proliferating cells. 2. Do not allow HPV-containing keratinocyte cell lines to reach 100% confluence, and ensure that feeder cells are present at all times. The lack of feeder cells could result in integration of the HPV genome. 3. Do not grow the cells for more than 20 passages or to confluence, as rodent fibroblast lines have a tendency to spontaneously transform and lose their ability to induce differentiation of human keratinocytes in organotypic (raft) culture. 4. Mitomycin C prevents DNA replication and is used to treat J2 3T3 cells prior to their use as feeder cells. 5. The versatility of the organotypic (raft) culture-based system lies in the fact that virtually any high-risk HPV genome, wild-type or mutant, can be introduced into primary keratinocytes for the study of its life cycle. While a number of methods exist to introduce HPV DNA into primary keratinocytes, we find that the introduction of linear genomes by electroporation yields the most favorable results, as it reproducibly yields cell lines containing episomal genomes. The presence of integrated genomes in our hands is rarely, if ever, observed. We have used this technique to successfully introduce HPV16, 18, 31a, 33, 39, 45, and an 18/16 chimera into primary keratinocytes. 6. The freezing of cells just prior to crisis may result in difficulties when thawing the cells for further study. For this reason, it is advised that multiple passages of cell lines be frozen. To avoid thawing difficulties, we recommend freezing the cells at the first five passages. 7. We have found that a variable lag period exists between the introduction of the HPV DNA into primary human foreskin keratinocytes and its subsequent re-circularization and detectable replication. For example, HPV18 is detectable at approx 1–2 wk before HPV31, 39, or 45 (Meyers, unpublished data). Thus, electroporated cultures should be kept growing until the presence of the HPV genome is verified by Southern blot. 8. A necessary step in the complete viral life cycle of HPVs is the amplification of the viral genome upon differentiation of the epithelium. Thus, it is of interest to determine whether the electroporated cultures that contained episomal genomes in monolayer have amplified their genomes upon differentiation in raft culture. In order to determine whether the genomes have amplified, Southern blots must be performed on DNA extracted from the raft cultures and from monolayer control cultures. A comparison of the amount of DNA in the two cultures will indicate whether the genome had indeed amplified. The protocols described under Subheadings 3.3.1–3.3.3. can be used for raft-culture DNA also. 9. The amplification of the viral genome upon differentiation in raft culture does not necessarily correlate with the production of infectious virus. Moreover, the lack of obvious amplification also does not correlate with the lack of infectious virus production. Possible explanations for this are that the number of cells containing amplified genomes may be diluted by the overall number of cells in the

186

McLaughlin-Drubin and Meyers raft, or that only a few cells may contain amplified genomes but still could be producing large amounts of virus. For this reason, it is advised that all cell lines that maintain the viral genome be tested for infectious virus production.

References 1. Meyers, C., Frattini, M. G., Hudson, J. B., and Laimins, L. A. (1992) Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. 2. Meyers, C., Mayer, T.J., and Ozbun, M. A. (1997) Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA. J. Virol. 71, 7381–7386. 3. Meyers, C., Zhang, J., Kaupas, M. E., Bryan, J. T., Lowe, R. S., and Jansen, K. U. (2002) Infectious virions produced from a human papillomavirus type 18/16 genomic DNA chimera. J. Virol., 76, 4723–4733. 4. McLaughlin-Drubin, M. E., Wilson, S., Mullikin, B., Suzich, J., and Meyers, C. (2003) Human papillomavirus type 45 propagation, infection, and neutralization. Virology 312, 1–7. 5. McLaughlin-Drubin, M. E., Christensen, N.D., and Meyers, C. (2004) Propagation, infection, and neutralization of authentic HPV16 virus. Virology 322, 213–219. 6. Rheinwald, J. G. and Green, H. (1975) Serial cultivation of strains of human epidermal keratinocytes: formation of keratinizing colonies from single cells. Cell 6, 331–343. 7. Smith, L. H., Foster, C., Hitchcock, M. E., et al. (1995) Titration of HPV-11 infectivity and antibody neutralization can be measured in vitro. J. Invest. Dermatol. 105, 438–444.

HPV Gene Regulation in “Raft” Cultures

187

15 Retrovirus-Mediated Gene Transfer to Analyze HPV Gene Regulation and Protein Functions in Organotypic “Raft” Cultures N. Sanjib Banerjee, Louise T. Chow, and Thomas R. Broker Summary The productive phase of human papillomavirus (HPV) infection is dependent on squamous differentiation of epithelial keratinocytes. Organotypic culture systems of primary human keratinocytes (PHKs) or immortalized keratinocytes that contain HPV genomes were developed to recapitulate this permissive environment. A complementary approach to determine the functions of individual HPV genes and to examine the virus–host interactions is to introduce the gene, alone or in combination, into keratinocytes that are then grown in organotypic cultures. The success of the latter approach depends on the methodology of retrovirus-mediated gene transfer, which can transduce the viral gene or genes into an entire population of PHKs. In this chapter, we describe the strategies and methods of retrovirus-mediated gene transfer into keratinocytes grown into organotypic cultures.

1. Introduction The productive phase of human papillomavirus (HPV) infection is dependent on squamous differentiation of epithelial keratinocytes (1–4). Organotypic culture systems of primary human keratinocytes (PHKs) or immortalized keratinocytes that contain HPV genomes were developed to recapitulate this permissive environment (5–7) (see Chapters 12–14). In these systems, the keratinocytes are cultured at the medium–air interface, supported on a dermal equivalent, which consists of collagen with embedded fibroblast feeder cells. Shortly after being elevated into contact with the air, the keratinocytes begin to stratify and, by 9 d, have differentiated into a full-thickness squamous epithelium, similar to the original tissue from which the particular keratinocytes were derived (6,8). Moreover, organotypic cultures of HPV-immortalized keratinocytes resemble different grades of dysplasias (9–11). Since the origiFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

187

188

Banerjee, Chow, and Broker

nal description of the systems for HPV reproduction, many important advances have been made. Recircularized HPV genomes excised from bacterial plasmid have been transfected into PHKs and, upon differentiation in the organotypic cultures, virions are produced (12). The productive phase of several high-risk HPV types that can extend the lifespan of PHKs (a requirement to obtain sufficient PHKs for organotypic cultures), have been reproduced this way. Using the raft culture methods, the transcriptional profile of these HPVs has been analyzed in genetic detail. Mutational analyses of HPV genomes have also been conducted by many laboratories. A spontaneously immortalized human keratinocyte cell line was shown to support the productive phase of the HPV life cycle in organotypic cultures as well (see Chapter 12). The introduction of this cell line has allowed the analysis of HPV mutants that no longer prolong the lifespan of PHKs (13,14). A complementary approach to determine the functions of individual HPV genes and to examine the virus–host interactions is to introduce the gene, alone or in combination, into keratinocytes that are then grown in organotypic cultures (15–24). The success of the latter approach depends on the methodology of retrovirus-mediated gene transfer that can transduce the viral gene or genes into an entire population of PHKs. Primary or immortalized human keratinocytes are difficult to transfect with high efficiency. DNA–calcium phosphate precipitation can trigger terminal differentiation, and a large fraction of the keratinocytes are killed by electroporation. Lipid- or nonlipid-based trasfection has yielded the best results, but the majority of the cells are not transfected. Furthermore, the transfected plasmid is invariably lost during the long process of preparing raft cultures. In contrast, transgenes transduced via retrovirus or lentivirus are stably integrated as a part of the provirus, preserving the integrity of the transgenes. High titers of recombinant viruses can easily be generated. When a selectable marker is also included in the virus, nontransduced cells are completely eliminated by a relatively short exposure to the appropriate antibiotics. Even though each transduction event results in the provirus integrated into a unique chromosomal location, when the entire transduced population is analyzed, a consistent and representative consequence of the transgene is apparent and unambiguous, and in each case the results are consistent with the observations made with patient specimens. Retrovirus-mediated gene transfer has also been applied to the investigation of the HPV cis elements located in the upstream regulatory region. On the basis of the reporter gene activities, a number of critical positive and negative trans factors contributing to the differentiation-dependent P1 promoter are identified (25–28). In this chapter, we describe the strategies and methods of retrovirus-mediated gene transfer into keratinocytes grown into organotypic cultures.

HPV Gene Regulation in “Raft” Cultures

189

2. Materials 2.1. General Purposes 1. Escherichia coli strains DH5α and Stbl2 (Invitrogen) for preparation of DNA plasmids. 2. Culture media for bacteria (Luria-Bertani [LB] broth). 3. Appropriate antibiotics for selection of the bacterial vectors. 4. Gene Pulser II with Capacitance Extender Plus for electroporation into mammalian cells and cuvettes (Biorad). 5. Ultraviolet (UV) sterilizer (Biorad GS GeneLinker™, Biorad or equivalent). 6. CO2 incubator for mammalian cells. 7. Laminar-flow hood. 8. Standard equipment and supplies for DNA cloning and recombinant DNA analyses.

2.2. Primary Human Keratinocytes (PHKs) and Feeder Cells 1. Cells: epithelial cells for organotypic cultures are PHKs or epithelial cell lines. 2. Serum-free medium (SFM) with supplements (GIBCO, Invitrogen Corp., Cat. No. 17005 042) for propagation of PHKs. 3. 0.25% trypsin/0.53 mM Na-ethylenediamine tetraacetic acid (EDTA) (Invitrogen, Cat. No. 25200-072) for use with PHKs. 4. 0.05% trypsin in 0.53 mM Na-EDTA for use with feeder fibroblasts. 5. Antibiotic and antimycotic mixture (GIBCO, Invitrogen, Cat. No. 15240-062, 100X) for recovery of PHKs from squamous epithelial tissues. 6. Feeder cells are murine NIH-3T3 fibroblasts (available from American Type Culture Collection) treated with mitomycin C (4 µg/mL) for the initial recovery and expansion of PHKs from neonatal foreskins. Untreated NIH-3T3 J2 fibroblasts are used for preparing the dermal equivalent for organotypic cultures of PHKs. 7. Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Cat. No. 12800-082) supplemented with 10% bovine calf serum for culturing feeder cells. 8. Penicillin-streptomycin (Invitrogen, Cat. No. 15140-122, 100X.) for feeder cells. 9. Mitomycin C (50X stock, 200 µg/mL solution; Sigma, Cat. No. M 4287). Dissolve 2 mg in 10 mL of 25 mM HEPES buffered Earle’s salts or DMEM and filter sterilize. Store aliquots frozen in foil, since mitomycin C is light sensitive. Thawed working solution remains stable for 2 wk in the dark.

2.3. Organotypic Cultures 1. DMEM: the same as Subheading 2.2., item 6. 2. 1X Ham’s F12: F12 powder mix (1 L package, GIBCO, Invitrogen, Cat. No. 21700-075). Follow the directions on the package and add 1.176 g sodium bicarbonate; adjust pH to 7.0–7.1 with hydrochloric acid before filtration. This gives a straw-colored solution. Filter-sterilize with a 0.2 µm cellulose acetate bottle-top filter into four 250-mL bottles. It is important to use reasonably fresh F12, as the pH will drift over time and the color turns deep pink.

190

Banerjee, Chow, and Broker

3. Cholera toxin (MW = 87,000) (Sigma, Cat. No. 3012). Add 2 mL sterile ultrapure water to 1 mg cholera toxin in bottle (0.5 mg/mL storage stock). To prepare a working 10,000X (1 mM) stock solution, dilute 174 µL of storage stock with 826 µL sterile pure water. Both solutions are stored at 4°C in aliquots. Never freeze! 4. Insulin (1000X stock). Dissolve 100 mg (Sigma, Cat. No. I-1882) in 20 mL sterile ultra-pure water. Store overnight at 4°C and then in 1.6-mL aliquots in cryo-vials at –20°C. 5. Apo-transferrin (1000X stock). Dissolve 100 mg (Sigma, Cat. No. T-1147) in 20 mL sterile pure water, and store aliquots in cryo-vials at –20°C. 6. Hydrocortisone-21-hemisuccinate (Sigma, Cat. No. H-4881) (100 or 500 mg). Dissolve 100 mg in 25 mL 100% ethanol to make 10,000X stock, aliquot and store at –20°C. 7. Human epidermal growth factor (10,000X stock) (GIBCO, Invitrogen, Cat. No. 1324-051) . Dilute 100 µL into 20 mL sterile pure water, aliquot, and store frozen at –20°C. 8. Organotypic (raft) culture medium. 400 mL of culture medium is prepared by mixing the following components: 270 mL DMEM, 90 mL 1X Ham’s F12 medium (3:1 DMEM to F12), 40 mL of fetal bovine serum (FBS), 40 µL of 10,000X hydrocortisone stock (0.4 µg/mL), 40 µL 10,000X human epithelial growth factor (hEGF) stock (to 0.5 ng/mL), 40 µL 10,000X cholera toxin stock (to 0.1 nM), 400 µL 1000X apo transferrin stock (to 5 µg/mL), and 400 µL 1000X insulin stock (to 5 µg/mL). Recipes for stock solutions are given above (see Note 1). 9. Type I Rat Tail Collagen (BD Biosciences, Cat. No. 354236). 10. 10X reconstitution buffer for the collagen dermal equivalent: 2.2 g sodium bicarbonate, 0.2 g sodium hydroxide, and 4.76 g HEPES (free acid; Sigma, Cat. No. H 3375) per 100 mL. Store in 10-mL aliquots in –20°C. 11. 10X F12: one 1-L package of Ham’s F12 medium (Invitrogen, Cat. No. 21700075) is dissolved in 100 mL dH2O. The pH is not adjusted and sodium bicarbonate is not added. Filter sterilize into small snap-cap tubes and store at –20°C. 12. 10X phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 1.8 mM Na2HPO4 (pH 7.2). 13. Fine mesh stainless-steel screen (from a hardware store). The screen is cut into approx 2.5-cm squares. Bend the four corners by about 80 degrees to function as feet.

2.4. Retroviral Vectors and Supplies for Retrovirus Production and Transduction 1. Retroviral Vectors: pLNSX, pLXSN, pLJ or pLC, pBabe Puro, and pBabe Neo (pBabe Bleo and pBabe Hygro are also available). All vectors are based on the Moloney murine leukemia virus (MoMLV). pLJd is derived from pLJ or DOL– vector (29) by deleting the Dra I restriction fragment that contains much of the polyomavirus T antigen gene (located outside the two long terminal repeats

HPV Gene Regulation in “Raft” Cultures

2. 3. 4. 5. 6. 7.

8. 9.

10.

11.

191

[LTRs]) and re-ligating the backbone (17). This replication-incompetent retroviral vector contains a 5' LTR, packaging signal, cloning sites and SV40driven neomycin marker, and the 3' LTR. This particular version of neomycinresistance gene also allows selection in E. coli, and the plasmid is selected with kanamycin in transformed E. coli. pLC is a derivative of pLJd in which the bacterial origin of replication is substituted with that from pBluescript SK+ for improved plasmid yields in E. coli (20). pLNSX and LXSN include the neomycin-resistance gene and express the transgene (X) from either the SV40 early promoter or 5' LTR, respectively (30). Retroviral vectors from the pBabe series contain the SV40 early promoter-driven neomycin (pBabe Neo), puromycin (pBabe Puro), bleomycin (pBabe Bleo), or hygromycin (pBabe-Hygro) resistance genes (31). pLNSX, pLXSN and the pBabe vectors use ampicillin selection in E. coli. Each of the vectors has one or more cloning sites. Ecotropic Bosc-23 cells (32) (American Culture Collection [ATCC] CRL 11270) package recombinant retrovirus that can infect murine cells. Amphotropic GP+envAM-12 cells (33) (ATCC CRL-9641) produce recombinant retrovirus that infects cells from many mammalian species, including human. DMEM supplemented with 100 U/mL streptomycin and 10% calf serum or fetal calf serum. Geneticin (G418) (50 mg/mL stock; GIBCO, Invitrogen, Cat. No. 10131-035); store at 4°C. Puromycin (1 mg/mL stock; Sigma, Cat. No. P 8833); filter sterilize and store frozen. Sheared salmon sperm or calf thymus DNA. Dissolve at 20 mg/mL in 10 mM Tris-HCl, 1 mM EDTA (pH 8.0) by heating to 65°C for a few minutes. Sonicate twice on ice for 20 s. Confirm on an agarose gel that the DNA size is approx 500 bp and repeat sonication if necessary. Extract twice in phenol-chloroform and once in chloroform, precipitate in ethanol, wash twice with 70% ethanol, air/ vacuum dry and dissolve in autoclaved ultra-pure water. Adjust to 10 mg/mL and store frozen at –20°C in 500-µL aliquots. 10X (500 mM, pH 7.2) N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid (BES) (Sigma, Cat. No. B-6266). Filter sterilize, aliquot, and freeze. Polybrene® (hexadimethrine bromide, Aldrich, Cat. No. 10,768-9): 3 mg/mL in PBS. Filter sterilize through a 0.2-µm polysulfone syringe filter (Acrodisc® HT Tuffryn® filter membrane, Pall Corporation, Cat. No. 4192) and store at 4°C or –20°C. 0.45-µm low-protein-binding polysulfone syringe filter (Acrodisc® HT Tuffryn, Pall Corporation, Cat. No. PN 4184) or the equivalent, to remove cell debris from virus-containing culture media. Trypsin solution: 0.05% trypsin in 0.53 mM Na-EDTA.

2.5. Fixation of Organotypic Cultures 1. 10% buffered formalin (Fisher, Cat. No. SF 100-20). 2. Lens paper (Fisher Scientific, Cat. No. 11-995) and hinged multi-cassettes (Surgipath Medical Industries, Cat. No. 02275-BX).

192

Banerjee, Chow, and Broker

3. Embedding and sectioning (4-µm thickness). Consult your local surgical pathology laboratory. 4. Superfrost®/Plus microscopic glass slides (1 in × 3 in, Fisher Scientific, Cat. No.12-550-15) for collecting tissue sections.

3. Methods The methods described below outline (1) the cloning of transgenes in MoMLV retroviral vectors, (2) generating recombinant retroviruses, (3) recovery and culturing of PHKs, (4) retrovirus-mediated gene transduction into PHKs or cell lines, and (5) establishment of organotypic epithelial cultures.

3.1. Cloning Strategy of Retroviral Vectors The gene of interest can be driven by the 5' LTR by placing it in the sense orientation. From the integrated provirus, transcripts initiated from the 5' LTR are polyadenylated using the polyA signal and RNA cleavage site in the 3' LTR. Alternatively, one can express a gene from a promoter of interest, such as the HPV upstream regulatory region containing the E6 (P1) promoter. The expression cassette is cloned in either orientation to take advantage of the polyA in the 3' LTR. If cloned in the anti-sense orientation, a dedicated polyA signal and cleavage site will be needed downstream of the cassette to derive a functional mRNA. Cloning in the antisense orientation is necessary only if the inserted sequence has alternative mRNA splicing—for instance, the entire early region of the HPV genome. Should the early region be cloned into the vector in the sense orientation, individual retroviruses generated in the packaging cell line could become alternatively spliced, rather than preserving the intact early region. Moreover, if intron sequences are important in regulating the expression of the transgene, cloning in the antisense orientation is essential to prevent premature splicing while generating the recombinant (34). In theory, one should avoid any strong polyA signal and cleavage site in the inserted sequence in the sense orientation, as they could prevent the generation of high-titer virus due to premature cleavage of the recombinant retroviral RNA prior to reaching the polyadenylation site in the 3' LTR. Interestingly, the presence of the upstream regulatory region containing the late polyA signal and cleavage site has not prevented the production of high-titer virus in our hands (refs. 17,21,22 and references therein).

3.2. Production of Recombinant Retroviruses The recombinant plasmids used to generate recombinant retroviruses are purified by CsCl ethidium bromide equilibrium density gradient centrifugation (see Note 2). The amphotropic retroviruses are generated through a two-stage process. First, the purified retroviral vector plasmid is electroporated into an ecotropic packaging cell line, which transiently generates recombinant

HPV Gene Regulation in “Raft” Cultures

193

retroviruses capable of infecting mouse cells. We regularly use Bosc-23 cells, a 293T-cell derivative expressing MLV gag, pol, and env genes (32). This cell line has a high transfection efficiency and can produce high-titer (>106 infectious units/mL), helper-free infectious retrovirus. The viruses present in the culture medium of Bosc-23 cells are used to infect GP+envAm-12 cells, an amphotropic packaging cell line. Stably infected GP+envAM-12 cells are selected in appropriate antibiotic-containing medium. In these producer cells, the retrovirus is integrated as provirus, from which amphotropic recombinant viruses are packaged and released into the medium. The amphotropic producer cells can be frozen in liquid nitrogen for future use. Frozen producer cells are thawed and re-selected for 2–7 d before use to eliminate any cells in which the transcription from the provirus might have been silenced, if the frozen cells have previously been passaged several times. To increase virus titer, one can ping-pong the viruses between Bosc-23 cells and GP+envAM-12 cells (35). Briefly, virus from GP+envAm-12 cells could be used to infect fresh Bosc-23 cells. The virus from the latter is used to infect fresh GP+envAm-12 cells. The infected producer cells are then selected as above. Similarly, recombinant lentiviruses have also been used to transduce genes into PHKs (34,36). These viruses are generated by using a one-step, third-generation Tat-free packaging system. 293T cells are cotransfected with a lentiviral vector, a plasmid that expresses HIV gag pol, and a plasmid that expresses the envelope gene of the vesicular stomatitis virus for pseudotyping the recombinant virus. The pseudotyped viruses are more stable than lentiviruses with the HIV envelope, and can be concentrated by sedimentation onto a sucrose cushion (see refs. 37–42 and references therein). The advantage of the lentiviral vector is its large packaging size (43). The one-step virus production can generate high-titer recombinant viruses faster than the two-stage production of retrovirus. The disadvantage is that one does not generate a stable producer cell line for future use.

3.2.1. Transient Production of Ecotropic Virus in the Packaging Cell Line Bosc 23 1. Growth of Bosc 23: Typically, Bosc 23 must be maintained in DMEM supplemented with 10% bovine fetal serum with gpt selection (32) for consistent production of high-titer virus. However, very good virus yields have been obtained by growing the producer cells in medium without selection. These cells attach loosely to the plate, requiring very gentle handling (see Note 3). The cells are propagated at no more than 80–90% confluence and are split at 1:5 for passage. 2. Production of ecotropic virus in Bosc-23 cells: start a fresh culture of Bosc-23 cells. At 80–90% confluence, trypsinize and resuspend the cells in 5 mL growth medium, and count them with a hemocytometer under an inverted light micro-

194

Banerjee, Chow, and Broker

scope. Pellet the remaining cells and resuspend at 2 × 107 cells/mL growth medium. Use 250 µL of these cells (5 × 106 cells) per electroporation. 3. Sterilize the electroporation cuvettes in a UV sterilizer/cross-linker according to the manufacturer’s instructions. Pipet the following into the cuvette in the exact order: 5 × 10 6 Bosc-23 cells in 250 µL growth medium, 2.5 µL of 500 mM BES (pH 7.2), 4.5 µL (45 µg) sheared calf thymus or herring sperm carrier DNA (freshly denatured by boiling for 5 min and snap chilling on ice), and up to 10 µL (10 µg) of retroviral vector plasmid. Gently tap the cuvette with a finger to mix the contents, but avoid frothing. Electroporation is carried out at capacitance of 975 µF and 170 V in the BioRad Gene Pulser II linked to Capacitance Extender Plus, according to the manufacturer’s instructions. 4. After the electric discharge, leave the cuvette in the hood at room temperature for 15 min. The appearance of clumps of lysed cells is normal. Transfer the cells gently using a Pasteur pipet to 10 mL growth medium in a 100-mm tissue-culture plate. After distributing the cells by tilting the plate, culture the cells overnight at 37°C and 5% CO2. The cells should recover and undergo at least one division within 24 h, reaching confluence. 5. Replace the medium in the confluent Bosc-23 plate with 5 mL of fresh medium and culture the cells for 16 h at 37°C and 5% CO2. The medium contains the ecotropic recombinant retrovirus released from the transfected Bosc-23 cells (see Note 4).

3.2.2. Production of Stable Amphotropic Producer Cells in Packaging Helper Line GP+envAm 12 1. Cell growth and storage: GP-envAm12 is grown in DMEM and 10% calf serum. 2. Infection with ecotropic recombinant retrovirus: on day 1, start a fresh culture of GP+envAm-12 in a 100-mm plate. On day 2, split the cells to 20–25% confluence and culture overnight at 37°C and 5% CO2. On day 3, collect the medium from the overnight culture of transfected Bosc-23 cells (see Subheading 3.2.1.) and pass it through a 0.45-µm disposable sterile syringe filter (polysulfone). Remove the medium from the GP+evnAm-12 cells and replace it with the filtered, viruscontaining culture medium. Add sterile polybrene to a final concentration of 12.5 µg/mL. Mix well and incubate at 37°C and 5% CO2. After 4–5 h, add 5 mL fresh growth medium and culture the cells overnight. 3. Selection of infected packaging cells: on day 4, split the infected GP+envAm-12 cells and plate at 25% confluence in the morning; after 8 h, re-feed the cells with medium containing appropriate selection antibiotics. Typically, geneticin is added to a final concentration of 600 µg/mL for 7 d. Puromycin is added to a final concentration of 1 µg/mL for 3–4 d (see Note 5). Change the antibiotic-containing media every other day. Surviving cells form visible colonies. If the titer of the ecotropic virus is very high, most cells survive the selection and the culture becomes confluent without discernable colonies. 4. At the end of selection, pool the colonies by trypsinization and replating the cells in two to three tissue-culture dishes containing antibiotic-free medium for 2 d.

HPV Gene Regulation in “Raft” Cultures

195

These are the stable producer cells, and aliquots can be frozen for future use. The cells are regularly used for up to 10 passages without significant loss of virus titers.

3.3. Retrovirus Infection of Primary Human Keratinocytes PHKs and GP+envAm-12 producer cells are grown separately in their respective media to 90% confluence. It is desirable to use PHKs from very early passage (P0, P1, or P2) to ensure proper differentiation in organotypic cultures. Always prepare organotypic cultures of uninfected PHKs or PHKs infected with vector-only control retrovirus as quality control of the culture conditions and as reference points to which the effects of transgenes are compared. 1. On day 1, split 2 × 105 PHKs onto 60-mm plates without feeder cells such that they attain 25–30% confluence on day 2. Replace the medium of the 90%confluent amphotropic producer cells with 5 mL of normal growth medium (without selection antibiotics) (see Note 6). Culture both overnight to 24 h at 37°C and 5% CO2. 2. On day 2, replace the medium of the PHKs with that from the amphotropic virus producer cell plate. The latter is collected in a sterile disposable 5-mL syringe and filtered through a 0.45-µm, low-protein-binding filter (polysulfone) directly onto the plates of keratinocytes at 2.5 mL per plate. Add sterile polybrene at 12.5 µg/mL and mix well. After 1 h at 37°C and 5% CO2, add 2.5 mL fresh SFM and return the plates to the CO2 incubator. After another 4 h, replace the medium with fresh SFM (see Note 7). 3. On day 3, examine and determine whether the infected PHKs have divided and increased in confluence. If so, change the medium with fresh SFM containing the appropriate antibiotic (250–300 µg/mL of geneticin or 1.5 µg/mL of puromycin, depending on the marker gene on the retrovirus vector) (see Note 8). Culture the cells for 2 d to select for transduced cells. 4. On day 5, feed the PHKs with antibiotic-free SFM and culture for another day or two (see Note 9). Infection with high-titer virus should yield more than 80% confluent plate after selection, ready for establishing raft cultures.

3.4. Organotypic Raft Cultures 3.4.1. Isolation of Primary Human Keratinocytes From Neonatal Foreskins 1. Sterilize fresh (not more than 1 d old) neonatal foreskins (ideally three or four) by dipping 10 times in 70% ethanol (or 3% bleach) and rinse them briefly in 10 mL DMEM with 10% bovine calf serum or PBS with 10% bovine calf serum. Transfer the tissue to a 100-mm sterile plate containing 5 mL PBS. 2. Remove dermal and fat tissues using surgical scissors and forceps. Mince the epidermis into very fine pieces by using the same tools. Keep the minced tissues moist in PBS to prevent the tissues from drying out during processing. 3. Transfer the minced tissues into a 125-mL sterile conical flask with a stir bar. Add 5–10 mL 0.25% trypsin/EDTA for each foreskin. Digestion is performed at

196

Banerjee, Chow, and Broker

37°C for 45 min with gentle mixing on a magnetic stirrer. Add an equal volume of PBS/10% bovine calf serum to quench the trypsin. Mix well and filter through a sterile stainless screen to remove the debris (see Note 10). 4. Pellet the PHKs by centrifugation at 160g in Jouan C3-12 low speed centrifuge (or equivalent) for 10 min. Resuspend the cells in 10 mL SFM for each one or two foreskins and plate this volume onto a 100-mm plate containing NIH-3T3 feeder fibroblasts. The feeder cells have been treated the day before with mitomycin C (4 µg/mL) for 2–4 h. Mitomycin-treated cultures can be kept up to 2–3 d prior to splitting as feeder layers. The treated fibroblasts are washed with PBS, trypsinized, and plated at 20–25% confluence (106 cells/100-mm plate or 3–4 × 105 cells/60-mm plate) on a fresh plate without mitomycin C. They should not be disturbed for at least 2 h after plating. Prepare the plates with mitomycin C-treated feeders the day before seeding PHKs. This schedule gives time to the feeder cells to secrete extra cellular matrix materials, which help the growth of PHKs. Remove the medium from the feeder cells and wash with PBS before plating PHKs. 5. Add antibiotic and antimycotic mixture to 2X final concentration. After 2 d, replace the medium with SFM containing 1X concentration of antibiotic-antimycotic mixture and culture the PHKs for two more days. Then culture the cells in SFM without antibiotic or antimycotic mixture for 4–5 d. Change the media on alternate days. PHKs are harvested at 70–80% confluence (P0) and can be expanded once (P1) or twice (P2) for use in raft cultures. We usually freeze PHKs at P0 (2 cryovials/2–3 foreskins) for future use.

3.4.2. Making the Collagen Dermal Equivalent 1. The 3T3-J2 feeder cells are cultured in DMEM and 10% calf serum. Alternatively, human fibroblasts have also been used (10). These cells are split at no higher than 50% confluence (see Note 11). 2. Estimate the required amounts of collagen, media, and feeder cells for each set of experiments. Typically, we use 1 × 105 feeder cells and 0.75 mL of collagen mixture for each well of a 24-well plate. To make 10 raft cultures, one will need 7.5 mL total collagen mix. Because the collagen tends to shrink the volume of the mixture, prepare 8 mL final volume. 3. Treat the feeder cells with 1 mL trypsin solution (0.05%) per plate and quench with 3 mL of growth medium containing 10% serum. Count the cells with a hemocytometer. Pellet the cells and resuspend in FBS at 2 × 106 cells/400 µL. 4. To make collagen dermal equivalent for 10 raft cultures, mix the following components on ice (see Note 12) in a 15-mL sterile polypropylene (Falcon) conical tube in the exact order: 0.8 mL 10X Ham’s F12 medium, 0.8 mL 10X reconstitution buffer, 100% type 1A rat-tail type I collagen to 8 mL (see Note 13), according to the graduation marker on side of the tube, and then 0.4 mL resuspended 3T3-J2 cells (see Note 14). The contents are mixed by quickly inverting the tube a few times. Avoid introducing air bubbles. Dispense 0.75 mL collagen mix into each well. Incubate the plate for up to 1 h at 37°C and 5% CO2, during which the

HPV Gene Regulation in “Raft” Cultures

197

dermal equivalent solidifies. Add 1 mL raft culture medium per well. After incubating approx 4 h, examine the plate under a phase-contrast microscope to make sure that the fibroblasts have survived and spread out. If they have, then the collagen-fibroblast matrix can be seeded with keratinocytes.

3.4.3. Seeding the Dermal Equivalent With PHKs 1. Trypsinize and count PHKs, retrovirus-transduced PHKs, or epithelial cell lines (such as keratinocytes immortalized in vitro by HPV, or cervical carcinoma cell lines). 2. Pellet and resuspend in SFM (for PHKs or immortalized PHKs) at 4 × 105 cells/mL (2 × 105cells/well). 3. Remove the medium from the collagen matrix. 4. Seed 0.5 mL of resuspended keratinocytes onto each collagen matrix and add 0.5 mL raft culture medium. 5. Rock the plate gently to spread the cells, and cultivate overnight at 37°C under a 5% CO2 atmosphere.

3.4.4. Lifting the PHK–Dermal Equivalent Assembly onto the Stainless-Steel Stand 1. Remove the medium carefully. The collagen bed is gently detached from the side of the well by sliding a sterile spatula around the side while pulling slightly inwards. Add 1 mL fresh raft culture medium to each well. The PHK-collagen assembly should become completely loose and float freely in the medium. Incubate for a minimum of 5 h at 37°C and 5% CO2 to allow shrinkage of the collagen (see Note 15). 2. Sterilize one stainless-steel platform for each raft by autoclaving. Place the stand into a 60-mm plate. Transfer the PHK-collagen assembly onto the platform with a sterile spatula. Fill the bottom of the plate with raft culture medium to just below the top of the platform. Remove air bubbles trapped beneath the stand with a Pasteur pipet attached to a vacuum. It is important that no medium get on top of the assembly of the PHK-dermal equivalent, as it will severely inhibit proper differentiation. 3. Typically, after lifting to the medium–air interface, raft cultures are incubated for 9–10 d at 37°C and 5% CO2. Change the medium every other day. 4. The cultures can be exposed to BrdU or inhibitors to metabolic pathways prior to harvesting (see citations in this chapter).

3.4.5. Harvesting the Raft Culture 3.4.5.1. IN SITU ANALYSES

The medium from the raft-culture plate is aspirated off and the culture is rinsed with PBS. Then the entire assembly is submerged in 10% buffered formalin for at least 1–2 h in the same plate. We prefer buffered formalin because DNA, RNA, and proteins are all preserved. The tissue is gently detached from

198

Banerjee, Chow, and Broker

the steel grid by using a scalpel blade. Care must be taken to prevent pulling apart and distorting the epithelium. Using a spatula, wrap the culture with a small square of lens paper (prewet in PBS) and transfer it to a labeled tissue cassette for embedding. The assembled cassettes are placed in 70% ethanol in a specimen cup. At this stage, the cassette can be store at 4°C overnight before paraffin embedding and sectioning. Tissue sections should be collected on Superfrost®/Plus microscopic glass slides rather than regular slides for better tissue adherence for in situ analyses. After deparaffinization, stain one tissue section with hematoxylin and eosin to examine the histology. Additional sections can be used to analyze cellular DNA replication or for various cellular or viral proteins by using immunohistochemical or immunofluorescence detection methods. In situ hybridization techniques for viral or host DNA or RNA have also been described. 3.4.5.2. PROTEIN AND NUCLEIC ACID EXTRACTION

The raft cultures are rinsed in sterile PBS and the epithelium is gently peeled off from the dermal equivalent underneath. The detached epithelium is then transferred into a precooled and labeled tube, snap-frozen in a dry ice–ethanol bath, and stored at –80°C until required. 4. Notes 1. Because of the fairly rapid breakdown of EGF, each batch of raft-culture medium is used for no more than 5 d. 2. We recommend that the recombinant plasmids be purified by CsCl–ethidium bromide density gradient centrifugation to obtain the supercoiled form of the plasmid. This is critical for efficient tranfection. 3. Liquid should be added on the side of the plate to avoid dislodging the cells. 4. The transfected Bosc-23 cells are not subject to selection with antibiotics and are discarded after the virus-containing medium has been collected. This is because the transfected plasmid DNA does not persist. Although a few colonies may emerge after selection, plasmid DNA integration into the cellular chromosomes is not mediated by the retroviral integrase. Consequently, these cells are unlikely to produce recombinant retrovirus. 5. GP+envAm-12 cells must be at no more than 30–40% confluence when the antibiotic selection is initiated. Otherwise, the cells could become overconfluent and selection ineffective. 6. The amphotropic producer cells should be grown to over-confluence to ensure high-titer virus in the medium. The medium can be harvested every 24 h for 2–4 d. 7. The producer cells are grown in a medium containing calf serum and high calcium. Long exposure to such media induces differentiation in PHKs and hence must be avoided. It is necessary to add an equal volume of SFM after 1 h of infection and refresh with SFM after 4 h.

HPV Gene Regulation in “Raft” Cultures

199

8. If cells do not appear to have undergone at least one cell division, antibiotic selection is delayed until the next day. 9. It is advisable to culture PHKs for 1–2 d after cessation of antibiotic selection. Uninfected cells continue to die during this time. For proper selection, PHKs should be infected at no more than 25% confluence. Immortalized human keratinocytes and tumor cells are also successfully infected with retroviral vectors by following the same procedure. 10. Transfer the trypsin-digested foreskin tissues with plastic disposable pipets, as these tissues stick to glass pipets. 11. 3T3 J2 cells should be split at 50% confluence. If the cells are grown to a higher confluence, they can be split for raft cultures, but do not passage and store them for future use. Continued passage at higher confluence may select for more transformed cells that no longer support proper squamous differentiation of PHKs. Under the conditions described in this chapter, organotypic cultures prepared with early passages of primary human fibroblasts in the dermal equivalent sometimes have few or fewer granulocytes, indicative of somewhat incomplete squamous differentiation. 12. Keep the collagen and the collagen-fibroblast mixture on ice until the dermal equivalent is ready for the CO2 incubator, as warming leads it to gel and solidify. 13. Collagen sticks to glass. Transfer or dispense it with a disposable plastic pipet. 14. Add resuspended feeder cells to the reconstituted collagen mixture last. Otherwise, the cells will die from the acidic pH of the collagen preparation. We have used collagen beds even after 3–4 d without any ill effect on differentiation. 15. The collagen does not shrink if the feeders are highly transformed. Moreover, the feeders should remain scattered in the collagen rather than migrating to the top of the collagen. If either failure to promote shrinkage or excessive motility becomes a problem, it is time to switch to less transformed fibroblasts.

Acknowledgments The research was supported USPHS grant CA36200. We thank our students, post-doctoral fellows, staff members, and collaborators for their many contributions through the years. References 1. Stoler, M. H. and Broker, T. R. (1986) In situ hybridization detection of human papillomavirus DNAs and messenger RNAs in genital condylomas and a cervical carcinoma. Human Pathol. 17, 1250–1258. 2. Stoler, M. H., Wolinsky, S. M., Whitbeck, A., Broker, T. R., and Chow, L. T. (1989) Differentiation-linked human papillomavirus types 6 and 11 transcription in genital condylomata revealed by in situ hybridization with message-specific RNA probes. Virology 172, 331–340. 3. Stoler., M. H., Whitbeck, A., Wolinsky, S. M., et al. (1990) Infectious cycle of human papillomavirus type 11 in human foreskin xenografts in nude mice. J. Virol. 64, 3310–3318.

200

Banerjee, Chow, and Broker

4. Stoler, M. H, Rhodes, C. R., Whitbeck, A., et al. (1992) Human papillomavirus type 16 and 18 gene expression in cervical neoplasias. Human Pathol. 23, 117–128. 5. Dollard, S. C., Wilson, J. L., Demeter, L. M., et al. (1992) Production of human papillomavirus and modulation of the infectious program in epithelial raft cultures. Genes Dev. 6, 1131–1142. 6. Wilson, J. L., Dollard, S. C., Chow, L. T., and Broker, T. R. (1992) Epithelialspecific gene expression during differentiation of stratified primary human keratinocyte cultures. Cell Growth Diff. 3, 471–483. 7. Meyers, C., Frattini, M. G., Hudson, J. B., and Laimins, L. A. (1992) Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. 8. Chow, L. T. and Broker, T. R. (1997) In vitro experimental systems for HPV: epithelial raft cultures for investigations of viral reproduction and pathogenesis and for genetic analyses of viral proteins and regulatory sequences. Clin. Dermatol. 15, 217–227. 9. Hurlin, P. J., Kaur, P., Smith, P. P., Perez-Reyes, N., Blanton, R. A., and McDougall J. K. (1991) Progression of human papillomavirus type 18-immortalized human keratinocytes to a malignant phenotype. Proc. Natl. Acad. Sci. USA 88, 570–574. 10. Blanton, R. A., Perez-Reyes, N., Merrick, D. T., and McDougall J. K. (1991) Epithellial cells immortalized by human papillomaviruses have premalignant characteristics in organotypic raft culture. Am. J. Pathol. 138, 673–685. 11. Steenbergen, R. D. M., Parker, J. N., Isern, S., et al. (1998) Viral E6-E7 transcription in the basal layer of organotypic cultures without apparent p21cip1 protein precedes immortalization of human papillomavirus type 16- and 18-transfected human keratinocytes. J. Virol. 72, 749–757. 12. Frattini, M. G., Lim, H. B., and Laimins, L. A. (1996) In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiationdependent late expression. Proc. Natl. Acad. Sci. USA 93, 3062–3067. 13. Flores, E. R., Allen-Hoffmann, B. L., Lee, D., Sattler, C. A., and Lambert, P. F. (1999) Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line. Virology 30, 262, 344–354. 14. Flores, E. R., Allen-Hoffmann, B. L., Lee, D., and Lambert, P. F. (2000) The human papillomavirus type 16 E7 oncogene is required for the productive stage of the viral life cycle. J. Virol. 74, 6622–6631. 15. Blanton, R. A., Coltrera, M. D., Gown, A. M., Halbert, C. L., and McDougall J. K. (1992) Expression of the HPV 16 E7 gene generates proliferation in stratified squamous cell cultures which is independent of endogenous p53 levels. Cell Growth Diff. 3, 791–802. 16. Halbert, C. L., Demers, G. W., and Galloway D. A. (1992) The E6 and E7 genes of human papillomavirus type 6 have weak immortalizing activity in human epithelial cells. J. Virol. 66, 2125–2134. 17. Cheng, S., Schmidt-Grimminger, D., Murant, T., Broker, T. R., and Chow L. T. (1995) Differentiation dependent up-regulation of the human papillomavirus E7

HPV Gene Regulation in “Raft” Cultures

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

201

gene reactivates cellular DNA replication in suprabasal differentiated keratinocytes. Genes Dev. 9, 2335–2349. Jian, Y., Schmidt-Grimminger, D.-C., Wu, X., Broker, T. R., and Chow, L. T. (1998) Post-transcriptional induction of p21cip1 protein by HPV E7 in differentiated epithelial cells inhibits reactivated unscheduled DNA synthesis. Oncogene 17, 2027–2038. Jian, Y., Van Tine, B. A., Chien, W.-M., Shaw, G. M., Broker, T. R., and Chow, L. T. (1999) Concordant induction of cyclin E and p21cip1 in differentiated keratinocytes by the HPV E7 protein inhibits cellular and viral DNA synthesis. Cell Growth Diff. 10, 101–111. Chien, W-M., Parker, J. N., Schmidt-Grimminger, D.-C., Broker T. R., and Chow L. T. (2000) Casein kinase II phosphorylation of the human papillomavirus-18 E7 protein is critical for promoting S-phase entry. Cell Growth Diff. 11, 425–435. Chien, W-M., Noya, F., Benedict-Hamilton, H. M., Broker, T. R., and Chow, L. T. (2002) Alternative fates of keratinocytes transduced by human papillomavirus type 18 E7 during squamous differentiation. J. Virol. 76, 2964–2972. Noya, F., Chien, W-M., Broker, T. R., and Chow L. T. (2001) p21cip1 degradation in differentiated keratinocytes is abrogated by costabilization with cyclin E induced by human papillomavirus E7. J. Virol. 75, 6121–6134. Garner-Hamrick, P. A., Fostel, J. M., Chien, W.-M., et al. (2004) Global effects of human papillomavirus 18 (HPV-18) E6/E7 in an organotypic culture system. J. Virol. 78, 9041–9050. Boccardo, E., Noya, F., Broker, T. R., Chow, L. T., and Villa, L. L. (2004) Resistance to TNF-α mediated cell proliferation arrest and DNA synthesis inhibition by HPV-18 oncoproteins in organotypic cultures of primary human keratinocytes. Virology 328, 233–244. Parker, J. N., Zhao, W., Askins, K. J., Broker, T. R., and Chow, L. T. (1997) Mutational analyses of differentiation dependent human papillomavirus type 18 enhancer elements in epithelial raft cultures of neonatal foreskin keratinocytes. Cell Growth Diff. 8, 751–762. Zhao, W., Broker, T. R., and Chow, L. T. (1997) Transcriptional activities of human papillomavirus type-11 promoter-proximal elements in raft and submerged cultures of foreskin keratinocytes. J. Virol. 71, 8832–8840. Zhao, W., Chow, L. T., and Broker T. R. (1999) A distal element in the HPV-11 upstream regulatory region contributes to promoter repression in basal keratinocytes in squamous epithelium. Virology 253, 219–29. Zhao, W., Noya, F., Chen, W. Y., Townes, T. M., Chow, L. T., and Broker, T. R. (1999) Trichostatin A up-regulates human papillomavirus type 11 upstream regulatory region-E6 promoter activity in undifferentiated primary human keratinocytes. J. Virol. 73, 5026–5033. Korman, A. J., Frantz, F. D., Strominger, J., and Mulligan, R. (1987) Expression of human class II major histocompatibility complex antigens using retrovirus vectors. Proc. Natl. Acad. Sci. USA 84, 2150–2154. Miller, A. D. and Rosman, G. J. (1989) Improved retroviral vectors for gene transfer and expression. Biotechniques 7, 980–990.

202

Banerjee, Chow, and Broker

31. Morganstern, J. P. and Land, H. (1990) Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucl. Acid Res. 18, 3587–3596. 32. Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993) Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl, Acad. Sci. USA 90, 8392–8396. 33. Markowitz, D., Goff, S., and Bank, A. (1988) Construction and use of a safe and efficient amphotropic packaging cell line. Virology 167, 400–406. 34. Noya, F., Chien, W-M., Wu, X., et al. (2002) The promoter of the human proliferating cell nuclear antigen gene is not sufficient for cell cycle-dependent regulation in organotypic raft cultures of keratinocytes. J. Biol. Chem. 277, 17,271–17,280. 35. Kozak, S. L. and Kabat, D. (1990) Ping-pong amplification of a retroviral vector achieves high-level gene expression: human growth hormone production. J. Virol. 64, 3500–3508. 36. Van Tine, B. A, Kappes, J.C., Banerjee, N.S., et al. (2004) Clonal selection for transcriptionally active viral oncogenes during progression to cancer by DNA methylation-mediated silencing. J. Virol. 78, 11,172–11,186. 37. Yu, S. F., von Ruden, T., Kantoff, P. W., et al.(1986) Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells. Proc.Natl. Acad. Sci. USA 83, 3194–3198. 38. Naldini, L., Blömer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93, 11,382–11,388. 39. Dull, T., Zufferey, R., Kelly, M., et al. (1998) A third-generation lentivirus vector with a conditional packaging system. J. Virol. 72, 8463–8471. 40. Zufferey, R., Dull, T., Mandel, R.J., et al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delievery. J. Virol. 72, 9873–9880. 41. Wu, X., Wakefield, J. K., Liu, H., et al. (2000) Development of a novel translentiviral vector that affords predictable safety. Mol. Ther. 2, 47–55. 42. Pfeifer, A., Kessler, T., Silletti, S., Cheresh, D. A., and Verma, I. M. (2000) Suppression of angiogenesis by lentiviral delivery of PEX, a noncatalytic fragment of matrix metalloproteinase 2. Proc. Natl. Acad. Sci. USA 97, 12,227–12,232. 43. Kumar, K., Keller, B., Makalou, N., and Sutton, R. E. (2001) Systematic determination of the packaging limit of lentivral vectors. Human Gene Ther. 12, 1893–1905.

HPV Xenograft SCID Mouse Model

203

16 The HPV Xenograft Severe Combined Immunodeficiency Mouse Model William Bonnez Summary The permissive propagation of papillomaviruses outside their natural hosts has not been possible, which is an important restriction to the study of human papillomavirus (HPV) infections and associated diseases. Since the mid-1980s, several models have been described that rely on the growth of HPV in susceptible human xenografts implanted in immunodeficient mice. The severe combined immunodeficiency (SCID) mouse has been particularly suited to this approach, and to reproduce reliably the macroscopic, microscopic, and molecular features of naturally occurring lesions. We describe two common methods that permit growth and propagation of HPV in subcutaneous (heterotopic) or cutaneous (orthotopic) human skin grafts implanted in the SCID mouse.

1. Introduction Papillomaviruses are widely disseminated throughout vertebrates, but they maintain a narrow species specificity. Therefore, even if the propagation of animal papillomaviruses in their respective natural hosts under experimental conditions is readily feasible, for obvious ethical reasons the same cannot be done in humans. The absence for a long time of permissive human papillomavirus (HPV) in vitro models of infection made this a significant limitation for the study of HPV infections. This obstacle was overcome in 1985, with the description by Kreider et al. (1) of the HPV-infected human xenograft model in the nude (athymic) mouse. The idea was to infect human susceptible epithelial tissues with HPV in vitro and graft them in an immunodeficient animal. This was made possible by a succession of developments in laboratory-animal medicine and experimental pathology (reviewed in ref. 2), starting in the early 1960s with the discovery of the spontaneous “nude” mutation in mice, which rendered these animals not From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

203

204

Bonnez

only hairless, but also immunodeficient as a result of an absence of thymus and thymus-dependent immune functions. The ability to graft nude mice with grafts from other mice (allografts) or other species (xenografts), either in their proper anatomic location (orthotopic grafting) or in a different location (heterotopic grafting), was fully established, while the problems of husbandry and housing of immunodeficient animals were resolved. The renal capsule became the preferred implantation site for xenografts because of its relatively high efficiency. This allowed several investigators to show that different viruses (Epstein-Barr virus, infectious bovine rhinotracheitis virus, Moloney sarcoma virus, and bovine leukemia virus), some of them fastidious growers, could be grown or rescued in tissues that were either naturally or experimentally infected and implanted in the nude mouse. The nude phenotype is caused by a homozygous autosomal mutation on chromosome 11 of the nu locus. This causes a qualitative and quantitative T-cell deficit, which diminishes with age. Antibody levels are diminished, but an antibody response can be elicited to T-independent antigens, and the natural killer (NK) cell and macrophage activities are increased. A novel immunodeficient mouse, the severe combined immunodeficiency (SCID) mouse, which results from an autosomal mutation on chromosome 16 of the C.B-17 strain (an IgH congenic partner of the BALB/c strain), was recognized in 1980 (3). SCID mice are more profoundly immunodeficient than nude mice because they lack both T- and B-cells, which renders them hypogammaglobulinemic and lymphopenic. The phenotype tends to become “leaky” with age as the mice begin producing immunoglobulins (4,5). SCID mice retain normal antigenpresenting capacity, myeloid cells, and normal NK cell activity. The severity of the immune defect in SCID mice is associated with a growth of xenografts equal or superior to that in nude mice (6–8). This has allowed the reconstitution of the defective immune system of the animal with human cells provided by grafting or intravenous injection of human fetal thymus, liver, lymph node, or spleen tissues or cells (SCID-hu mouse model) (9), or by intraperitoneal injection of human peripheral blood leukocytes (hu-PBL-SCID mouse model) (10) or bone marrow (11). As applied to papillomaviruses, the SCID mouse has also shown apparent advantages over the nude mouse. The papillomavirusinfected xenograft nude mouse model has been difficult to use. Grafts often fail to grow, and the isolation and growth of new strains of HPVs in addition to the original HPV-11 strain (1) has been slow-paced (2). In addition, sites other than the renal capsule, which unfortunately is technically demanding to graft, are inefficient and thus impractical for the growth of grafts. In a parallel comparison of the two mouse strains, we found the SCID mouse to be more efficient in supporting the growth of HPV-infected grafts (12). This and other

HPV Xenograft SCID Mouse Model

205

studies showed that the SCID mouse was more versatile, permitting successful implantation not only under the renal capsule, but also in the peritoneum, under the flank or ear skin, or in the vagina (13–17). Although the xenograft immunodeficient model has been used to study animal papillomaviruses (18–24), most of its appeal is for the study of human papillomaviruses. To date, this is the only model that allows the experimental reproduction of HPV-induced lesions caused by oncogenic or non-oncogenic HPV types. The tumors grown not only have the macroscopic characteristics of the natural lesions, but also possess their microscopic and molecular features. The only significant difference so far recognized is the absence in the model of an immunologic component. The HPV-xenograft immunodeficient mouse model is also the only model that allows the sustained reproduction of the full permissive viral cycle and viral propagation. Although the model remains cumbersome to develop, mostly because of the restrictions imposed by working with immunodeficient mice and the cost, it offers unique advantages for pathogenesis and antiviral studies that are yet to be fully exploited. The methods described in this chapter concern the SCID mouse and HPV, and are those familiar to the author, but, as already mentioned, variants have been described and could be easily adapted. 2. Materials 1. Fox Chase C.B-17 SCID (C.B-17/Icr Tac-scidfDF) male, 5- to 7-wk-old mice (Taconic, Germantown, NY, www.taconic.com). 2. Human neonatal foreskins (from a local hospital nursery). 3. Turbo A-5 Clipper, Oster, one-speed (Cat. No. 442-35; PBS Animal Health, Massillon, OH). 4. Tissue stapler (Cat. No. 01-804; Fisher Scientific). 5. Surgical clips (Cat. No. 01-804-5; Fisher Scientific). 6. 3M™ SR-3 Scissor Staple Remover (Cat. No. MMM SR3; www.mohawkmedicalmall.com). 7. Povidone iodine swabs (Cat. No. MDS 093901; Medline Industries Inc., Mundelein, IL). 8. Toothed forceps no. 5 (Cat. No. 15666-212; VWR International). 9. Straight scissors (Cat. No. 25601-084; VWR International). 10. Mortar and pestle (Cat. No. 50420-223 & 50420-427; VWR International). 11. Disposable skin biopsy punches, 4 mm (Cat. No. 9033504; Premier Medical Products, Plymouth Meeting, PA). 12. Disposable scalpels (Cat. No. 139090; Tyco HealthCare, Mansfield, PA). 13. Circular self-adhesive bandages (BandAid™) (Cat. No. 6403; Tyco HealthCare). 14. Xeroform™ dressing (Cat. No. 431605; Tyco HealthCare). 15. Gauze sponges, 4 in × 4 in. (Cat. No. 2556; Tyco HealthCare). 16. Dulbecco’s phosphate-buffered saline (Cat. No. 14190-144; Invitrogen Corp.). 17. Dulbecco’s modified Eagle’s medium (Cat. No. 11960-044; Invitrogen Corp.).

206

Bonnez

18. Penicillin-streptomycin (Cat. No. 15140-122; Invitrogen Corp.). 19. Sterile sand (Cat. No. 9887 Sigma Aldrich Corp.). 20. 2% chlorhexidine gluconate in 4% isopropyl alcohol (Chlorostat™) (Jones Medical Industries, Inc., St. Louis, MO). 21. Avertin (2,2,2-tribromoethanol) (20 mg/mL working solution in tert-amyl alcohol, obtained from local pharmacy). 22. Isopropyl alcohol, 70% (obtained from local pharmacy).

3. Methods In this section, we detail the different steps involved in the papillomavirus human xenograft, subcutaneous (heterotopic) and cutaneous (orthotopic) SCID mouse models, summarized in Fig. 1.

3.1. Mice Strains and Handling We use Fox Chase C.B-17 SCID (C.B-17/Icr Tac-scidfDF) male mice. This is an inbred strain directly derived from the original mice described by Bosma and colleagues (3). Male mice are more readily available and cheaper than female animals, which are also used for breeding. Male SCID mice are only slightly larger than females, and this is not a significant advantage. Typically, the animals are grafted when they are 6 to 8 wk old, which corresponds to adolescence. This ensures that the animal is of sufficient size to make the grafting procedures easy, and has sufficient remaining lifespan free of “leakiness.” The leakiness refers to the development of a limited number of B- and T-cells in 2–23% of C.B-17 SCID when they are between 3 and 9 mo old (4,25). By the time they reach the very old age of 12 mo, all C.B-17 SCID mice have B- and T-cells. This is an oligoclonal phenomenon that is probably unlikely to affect the fate of the xenograft. Approximately 15% of SCID mice are found to have thymic lymphoma at autopsy between the ages of 4 amd 12 mo (26). These lymphomas are significant, as they are the main cause of spontaneous mortality of the animals. The Fox Chase ICR SCID (Tac:Icr:Ha(ICR)-scidfDF) is also homozygous for the scid gene, but it is outbred instead of being inbred. These mice have the same degree of immunodeficiency as the C.B-57 SCID mice, but have the advantage of growing faster and bigger. The scid mutation has also been introduced in other genetic murine strains (C3H) by backcrossing. All these animals are less frequently and significantly leaky (5). In our experience, these mice do not appear to sustain the growth of HPV-infected human orthotopic xenografts as well as the inbred strain. Many more immunodeficient mouse strains are available to the researcher, and their number is growing (5,27). Two strains in addition to the nude and SCID mice have been used for xenografting in a manner relevant to

HPV Xenograft SCID Mouse Model

207

Fig. 1. Diagram of the different steps involved, or possible, in the HPV xenograft, subcutaneous (A) and cutaneous (B) SCID mouse model.

papillomavirus research. The first one, the RAG mouse, has been an excellent model for the study of the cottontail rabbit papillomavirus (Shope papillomavirus) in rabbit skin (24). The second one, the SCID-NOD strain, can be reconstituted with human peripheral blood mononuclear cells, and yields a

208

Bonnez

sustained invasion with human lymphocytes of intravaginal human xenografts, thus potentially offering an elaborate model for the study of mucosal HPV infections (17).

3.1.1. Mouse Housing The immunodeficient nature of the mice imposes strict conditions for their housing to eliminate any pathogens other than those in the defined microbial flora they harbor. This can be best achieved with a dedicated facility. At the University of Rochester, our xenograft facility consists of a central vestibule with an airlock anteroom, pass-through autoclave and sterile storage room, two animal housing rooms, and two laboratories. Construction materials were selected to facilitate cleaning. There are no windows, and the air-handling system provides 15 air changes per hour of nonrecirculating fresh air that is HEPA filtered. Air pressures are positive relative to outside the facility. Temperature in the animal-housing rooms is maintained at 25.5 ± 1°C, and the relative humidity is controlled at 68 ± 10%. Rigorous techniques of sterilization and disinfection are in place. The personnel and operators are to go through a surgical scrubbing. After washing their hands with a germicidal soap (e.g., 2% chlorhexidine gluconate in 4% isopropyl alcohol), they have to put on scrub suits, surgical gowns, caps, masks, and shoe covers. Mice are supplied in filtered, germ-free containers, and are kept in sterilized Sedlacek cages with a filter top. The cage contains hardwood bedding with sterile feed (Purina, autoclavable rodent chow) and water (pH 2.5–2.8) provided once weekly. Mice are checked daily. Each batch of SCID mice (or other immunodeficient mice) is accompanied in a separate cage by a sentinel heterozygote BALB/c mouse. Every month the sentinel mouse is bled for murine hepatitis virus serology. Every 6 mo, the sentinel mouse serum is tested for the following serologies: pneumonia virus of mice, Sendai virus, murine hepatitis virus, minute virus of mice, Theiler mouse encephalomyelitis virus, reovirus type 3, polyoma virus, ectromelia virus, K virus, mouse adenovirus, epizootic diarrhea of infant mice virus, murine cytomegalovirus, lymphochoriomeningitis virus, parvovirus, Mycoplasma pomona, and cilia-associated respiratory (CAR) bacillus. Once the last SCID mouse of the batch is sacrificed, the sentinel mouse is killed and submitted to a complete necropsy. Other methods of housing immunodeficient mice exist. The animals can be kept in laminar-flow rack housing, individually ventilated isolator housing, or flexible-film isolator housing. The choice among protocols and specific standard operating procedures for handling and housing immunocompromised mice should be discussed with the laboratory-animal medicine staff at the investigator’s institution (28).

HPV Xenograft SCID Mouse Model

209

3.1.2. Animal Comfort and Euthanasia Animals will experience the discomfort of isofluorane anesthesia, or the pain associated with intraperitoneal injection of avertin, as well as that of any other added procedures. Expected adverse effects of subcutaneous or cutaneous grafting surgery include local wound pain. Blood loss is insignificant. Unexpected adverse effects include death during or immediately after surgery, hematomas, and wound dehiscence. These should be exceptional. Local and systemic infections are possible, but are rare complications of all surgical procedures. Euthanasia rules have to be established and may vary slightly from institution to institution, but in the United States they have to be in compliance with the American Association for Accreditation of Laboratory Animal Care (www.aaalac.org), as well as state and federal laws. The rules we follow to sacrifice the animal before the end of an experiment are as follows: (a) greater than 10% weight loss; (b) bleeding or bruising; (c) inability to maintain righting reflex; (d) inability to move about; (e) inability to eat or drink; (f) a tumor greater than 20% of body weight. Because we use young mice that are still growing during our experiments, we cannot rely on the animal weight increase to measure tumor weight. Graft size should be used as a surrogate marker. Animals are euthanized with a lethal dose of avertin (2,2,2,-tribromoethanol), 480 mg/kg, intra-peritoneally. The euthanasia is completed by cervical dislocation. The animal is immobilized by holding a flat ruler behind its occiput using one hand, while the other hand grabs the tail. The tail is pulled in a sudden jerk to cause the cervical dislocation. It is crucial to let newly acquired animals adapt to their environment, and not start grafting for at least 48 h if one wants to avoid stress-related postsurgical mortality (29). We typically wait 1 wk.

3.2. Skin Collection and Preparation We collect neonatal foreskins obtained from routine circumcision as a skin source. Although investigators should contact their local institutional review board, as long as no identifiers are collected on the donor, informed consent should not be necessary because these foreskins would otherwise be discarded. 1. Store the resected foreskin in transport medium (DMEM, penicillin 100 U/mL, streptomycin 100 µg/mL), and keep at 4°C until use (see Note 1). 2. Using a toothed forceps no. 5, place the foreskin in a sterile Petri dish; use a scalpel with a no. 10 blade to remove the occluded side of the foreskin (the side that was in contact with the penile glans) (see Note 2). 3. Cut thin (1- to 2-mm-wide) bands of tissue out of the foreskin, cut each band into 1- to 2-mm-long squares or rectangles. Alternatively, use a biopsy punch (3–4 mm) to cut discs of tissue out of the foreskin (see Note 3).

210

Bonnez

3.3. Virus Preparation Viral stocks used for the infection of the foreskin implants can be prepared from HPV-infected xenografts retrieved from the mice (see Note 4). Xenografts grown under the skin are best suited for that purpose because they grow as cysts that retain at their center a stratum corneum rich in viral particles that would otherwise desquamate. 1. Fresh or thawed HPV-infected xenografts are placed in a sterile mortar. 2. A little bit of sterile sand and sterile Dulbecco’s phosphate-buffered saline (pH 7.4) are added (approx 0.3 mL per mg of tissue). 3. Using a pestle, the specimens are ground for about 10–15 min. 4. The suspension is transferred to centrifuge tubes and spun for 10 min at 1000g, at 4°C. 5. The supernatant is collected. It can be stored in bulk at –80 °C, with a few 250- to 500-µL aliquots that will be titrated in the mouse model, or assayed for the copy number of HPV DNA molecules, to determine what should be the final dilution of the viral stock when it is aliquoted for use (see Note 5).

The above preparation is simple, but presupposes the availability of an established HPV strain. In order to prepare one’s strain(s) of HPV, one should start with clinical samples (genital warts, intraepithelial neoplasia, and so on), preferably shown to contain the HPV genotype of interest. Although pooling samples from different donors is not strictly necessary and increases the chances of isolating mixed HPV strains, it enhances the chance of a successful isolation. We feel that the key to success is to highly purify the virus and use different foreskin donors (kept separate or mixed) to grow the virus in the xenograft model. The purification of the virus begins as in the previous paragraph, but step 4 is followed by further processing. 1. The clarified supernatant is centrifuged at 100,000g for 1 h, at 4°C. 2. The pellet, which should appear as very pale gray, is resuspended in approx onetwentieth to one-thirtieth of its original volume in Dulbecco’s PBS. This is done using a 1-cc tuberculin syringe with a 27-gage needle and vigorous to-and-fro action to put the viral particles in suspension. 3. A second high-speed centrifugation may be done if the pellet appears heavily contaminated—i.e., of a darker color.

3.4. Graft Infection Graft infection is done immediately prior to grafting. It is achieved by placing the foreskin fragments in a vial containing an aliquot of the viral suspension, vortexing it briefly to disperse the fragments. Incubation is carried out for 1 h at 37°C (see Note 6).

HPV Xenograft SCID Mouse Model

211

Fig. 2. Subcutaneous model. (A) Placement of the flank incision. (B) Positioning of the graft under the skin, in the pocket created cephalad to the incision, by blunt dissection.

3.5. Graft Placement 3.5.1. Anesthesia For all grafting procedures, the mouse is anesthetized in an anesthesia chamber with 5% isofluorane to 2 L of oxygen, until no corneal or pedal reflexes can be elicited. The animal is removed from the chamber, and the isofluorane is adjusted to 2% to 1 L of oxygen for continued administration via nose cone for the duration of the surgical procedure. Alternatively, if an anesthesia chamber is not available, animals can be anesthetized with avertin (2,2,2-tribromoethanol), 240 mg/kg, administered intraperitoneally. Attainment of a surgical plane is assessed by failure to elicit a toe pinch reflex. Breathing is monitored visually for signs of either elevated or depressed rate. Surgical procedures are not started until no corneal or pedal reflexes can be elicited. If indicated, the animal is tagged by ear notching while anesthetized (see Note 7).

3.5.2. Subcutaneous Grafting 1. Shave the animal’s fur with electric shears. 2. Disinfect the skin with isopropyl alcohol and then a povidone-iodine swab. 3. With scissors, make a 1-cm, mid-flank skin incision perpendicular to the spine, below the costophrenic angle (Fig. 2A).

212

Bonnez

Fig. 3. Cutaneous model. (A) Placement of tongue blade depressor and fingers of the hand holding the mouse by the back skin. The biopsy skin punch is used to cut through the skin fold. (B) Two symmetrical, circular skin defects have been created by the skin biopsy punch, exposing the musculo-fascial plane (panniculus carnosus) of the animal. (C) The left skin defect is filled with one graft, while a graft is positioned into the right grafting site. (D) The left graft site is covered with a circular, selfadhesive bandage, secured to the skin with two surgical clips. The right grafting site is covered with the Xeroform dressing. 4. Dissect the subcutis bluntly through the incision, using the closed scissors, in order to create a pocket that will accept a graft. The pocket can be created cephalad, caudal, or both, relative to the incision, depending on the number of grafts one wishes to implant. 5. Place the graft in the subcutaneous pocket. We try to position the graft with the dermis in contact with the musculo-fascial plane (panniculus carnosus) of the mouse (Fig. 2B). 6. Close the incision with a surgical clip. 7. The procedure is repeated on the other flank, if necessary, and the mouse is placed back in its cage to recover from the anesthesia and surgery. 8. Remove the surgical clips between 1 and 2 wk after their placement. No anesthesia is necessary then.

3.5.3. Cutaneous Grafting 1. Shave the animal’s fur with electric shears. 2. Disinfect the skin with isopropyl alcohol and then a povidone-iodine swab. 3. Pinch the back skin with the thumb against a wooden tongue blade supported by the lateral aspect of the curled index finger of the same hand (Fig. 3A). 4. Using a skin punch biopsy instrument of the same size used to cut out the foreskin fragments, the folded skin is perforated, until the punch bites the wood of the backing tongue blade (Fig. 3A). This creates two circular skin defects (Fig. 3B). 5. Fill each skin defect with one foreskin graft, its dermis in contact with the panniculus carnosus and its epidermis exposed to the air (Fig. 3C).

HPV Xenograft SCID Mouse Model

213

6. Cover each graft with a small Xeroform petrolatum dressing, maintain it in place with a round adhesive bandage (e.g., BandAid™), and secure it to the mouse skin with metal clips (Fig. 3D). 7. Place the mouse back in its cage. 8. Remove the surgical clips and the bandages between 1 and 2 wk after their placement. No anesthesia is necessary then.

3.6. Graft Growth and Endpoints Graft growth is continuous once the infection is successful, and it can be monitored easily by visual inspection if the graft has been placed on the skin. When placed under the skin, the graft can be measured accurately only by making under anesthesia a small flank incision, and exposing the graft. Otherwise, measurements have to be taken after euthanasia. The graft can be measured precisely in all three dimensions, and the volume of the parallelepiped enclosing it can be obtained by multiplying the three dimensions. Its cubic root gives the geometric mean diameter or side length of the equivalent cube, a measure that for purposes of statistical analysis more closely follows a normal distribution (see Note 8). Subcutaneous grafts tend to grow larger than cutaneous grafts, because they form an epidermal cyst that retains the desquamated stratum corneum in its center, which further stretches the cyst. In contrast, the growth of the cutaneous grafts is mostly restricted to height because the HPV infection does not extend into the surrounding mouse epithelium. Typically, more than 90% of the implanted infected grafts remain in place and grow. However, this “take” rate varies considerably, depending on the foreskin donor; some of them appear to be completely resistant to HPV infection. Uninfected grafts are much less persistent, and often involute due to a foreignbody reaction of the host. It takes approx 3 mo to obtain a substantial increase in graft size, a point in time when mean volumes are approx 20 mm3 for subcutaneous grafts, and 5.5 mm3 for cutaneous grafts. 4. Notes 1. Although it is preferable to use the foreskins within 12 h to avoid microbial overgrowth and preserve the best chance of grafting, foreskins can still be used within 48 h, and possibly longer (30). 2. The purpose of removing the mucosal epithelium is to expose the dermis. The remaining skin is thus prepared as a split-thickness graft. 3. When grafting subcutaneously, the grafts may not need to be of identical size. However, if the endpoints of the experiment include graft size, or if the grafts are implanted on the mouse skin (orthotopic grafting), it is important to precisely control the size of the graft and use a biopsy punch. Prior to cutting out the fore-

214

4. 5.

6. 7.

8.

Bonnez skin, one may puncture it evenly multiple times with the tip of a scalpel to create many small wounds that could be portals of infection to the basal epithelium. However, this manipulation is not essential, as it appears to offer only a marginal benefit (31). The handling of HPV in the laboratory requires biosafety level (BSL) 2 precautions (www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4toc.htm). We recommend preparing aliquots of 250–500 µL. Smaller aliquots, which might be necessary when isolating a new strain, do not appear to bathe the foreskin fragments sufficiently during incubation, and in our experience have resulted in lower infection rates of the grafts. If precipitates are noted, a brief sonication may help dissociate the viral particles. The animal can be tagged by a variety of methods, including the subcutaneous implantation of electronic chips or the tattooing of the ears. But a simple method consists of notching the external ears with scissors. For example, one notch on the right ear is for mouse A, one notch on the left ear for mouse B, and a notch on each ear for mouse C. Up to eight mice per cage can be identified by using a system that includes up to two notches per ear (excluding no notches). A more elaborate approach consists of calculating the volume (V) of the ovoid based on length (L), width (W), and height (H) (V = L × W × H × π/6), or the radius (r), or diameter, of the equivalent sphere [r = (3V/4π)1/3].

Acknowledgments The author thanks Caroline DaRin, Colleen Leonard, and Victoria Simpson for their help in preparing the manuscript. This work has been supported by NIH-NIAID contracts NO1-AI-35159, NO1-AI-85336, and NOl AI-1543. References 1. Kreider, J. W., Howett, M. K., Wolfe, S. A., et al. (1985) Morphological transformation in vivo of human uterine cervix with papillomavirus from condylomata acuminata. Nature 317, 639–641. 2. Bonnez, W. (1998) Murine models of human papillomavirus–infected human xenografts. Papillomavirus Report 9, 27–38. 3. Bosma, G. C., Custer, R. C., and Bosma, M. J. (1983) A severe combined immunodeficiency mutation in the mouse. Nature 301, 527–530. 4. Bosma, G. C., Fried, M., Custer, R. P., Carroll, A., Gibson, D. M., and Bosma, M. J. (1988) Evidence of functional lymphocytes in some (leaky) scid mice. J. Exp. Med. 167, 1016–1033. 5. Hendrickson, E. A. (1993) The SCID mouse: relevance as an animal model system for studying human disease. Am. J. Pathol. 143, 1511–1522. 6. Phillips, R. A., Jewett, M. A. S., and Gallie, B. L. (1989) Growth of human tumors in immune-deficient scid mice and nude mice. Curr. Top. Microbiol. Immunol. 152, 259–263. 7. Mueller, B. M. and Reisfeld, R. A. (1991) Potential of the scid mouse as a host for human tumors. Cancer Metastasis Rev. 10, 193–200.

HPV Xenograft SCID Mouse Model

215

8. Xie, X., Brünner, N., Jensen, G., Albrectsen, J., Gotthardsen, B., and Rygaard, J. (1992) Comparative studies between nude and scid mice on the growth and metastatic behavior of xenografted human tumors. Clin. Exp. Metastasis 10, 201–210. 9. McCune, J., Kaneshima, H., Krowka, J., et al. (1991) The SCID-hu mouse: a small animal model for HIV infection and pathogenesis. Ann. Rev. Immunol. 9, 399–429. 10. Mosier, D. E. (1996) Human immunodeficiency virus infection of human cells transplanted to severe combined immunodeficient mice. Adv. Immunol. 63, 79–125. 11. Dick, J. E., Lapidot, T., and Pflumio, F. (1991) Transplantation of normal and leukemic human bone marrow into immune-deficient mice: development of animal models for human hematopoiesis. Immunol. Rev. 124, 25–43. 12. Bonnez, W., Rose, R. C., Da Rin, C., Borkhuis, C., de Mesy Jensen, K. L., and Reichman, R. C. (1993) Propagation of human papillomavirus type 11 in human xenografts using the severe combined immunodeficiency (SCID) mouse and comparison to the nude mouse model. Virology 197, 455–458. 13. Bonnez, W., DaRin, C., Borkhuis, C., de Mesy Jensen, K., Reichman, R. C., and Rose, R. C. (1998) Isolation and propagation of human papillomavirus type 16 in human xenografts implanted in the severe combined immunodeficiency mouse. J. Virol. 72, 5256–5261. 14. Bonnez, W., Borkhuis, C., DaRin, C., de Mesy Jensen, K., and Rose, R. (1994) Production of cutaneous human condyloma acuminatum (CA) in the severe combined immunodeficiency (SCID) mouse. 13th International Papillomavirus Conference. Amsterdam, The Netherlands. October 8–12. 15. Bonnez, W., DaRin, C., Reichman, R. C., and de Mesy Jensen, K. (1997) Growth and propagation of two new HPV-11 strains in the human xenograft severe combined immunodeficiency (SCID) mouse model. 16th International Papillomavirus Conference. Siena, Italy. September 5–11. 16. Bonnez, W., Borkhuis, C., DaRin, C., Greer, C. E., Ralston, R., and Rose, R. C. (1995) Evaluation of neutralization of HPV-11 infection in the SCID mouse model using an anti-HPV-6 virus-like particle antibody. 14th International Papillomavirus Conference. Québec City, Canada. July 23–28. 17. Kish, T. M., Budgeon, L. R., Welsh, P. A., and Howett, M. K. (2001) Immunological characterization of human vaginal xenografts in immunocompromised mice: development of a small animal model for the study of human immunodeficiency virus-1 infection. Am. J. Pathol. 159, 2331–2345. 18. Gaukroger, J., Bradley, A., O’Neil, B., Smith, K., Campo, S., and Jarrett, W. (1989) Induction of virus-producing tumours in athymic nude mice by bovine papillomavirus type 4. Vet. Rec. 125, 391–392. 19. Gaukroger, J., Chandrachud, L., Jarrett, W. F. H., et al. (1991) Malignant transformation of a papilloma induced by bovine papillomavirus type 4 in the nude mouse renal capsule. J. Gen. Virol. 72, 1165–1168. 20. Christensen, N. D. and Kreider, J. W. (1990) Antibody-mediated neutralization in vivo of infectious papillomavirus. J. Virol. 64, 3151–3156. 21. Höpfl, R. M., Christensen, N. D., Angell, M. G., and Kreider, J. W. (1993) Skin test to assess immunity against cottontail rabbit papillomavirus antigens in rabbits

216

22.

23. 24. 25. 26. 27. 28.

29. 30. 31.

Bonnez

with progressing papillomas or after papilloma regression. J. Invest. Dermatol. 101, 227–231. Higgins, G. D., Karlis, J., Kuiper, L., Meischke, R. H., Baird, P. J., and Burrell, C. J. (1995) Ovine papillomavirus infection of ovine mammary skin xenografts in SCID mice. 14th International Papillomavirus Conference. Québec City, Canada. July 23–28. Christensen, N. D., Cladel, N. M., Reed, C. A., et al. (1996) Laboratory production of infectious stocks of rabbit oral papillomavirus. J. Gen. Virol. 77, 1793–1798. Lobe, D. C., Kreider, J. W., and Phelps, W. C. (1998) Therapeutic evaluation of compounds in the SCID-RA papillomavirus model. Antiviral Res. 40, 57–71. Bosma, M. J. (1992) B and T cell leakiness in the scid mouse mutant. Immunodeficiency Rev. 3, 261–276. Bosma, M. J. and Carroll, A. M. (1991) The scid mouse mutant. Definition, characterization, and potential uses. Ann. Rev. Immunol. 9, 323–350. Shultz, L. D. (1991) Immunological mutants of the mouse. Am. J. Anat. 191, 303–311. Donovan, J. T. and Brown, P. (1995) Care and handling of laboratory animals. In Current Protocols in Immunology Vol. 1 (Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M., and Strober, W., eds), Greene Publishing Associates, New York, NY, pp. 1.0.1–1.11.4. Landi, M. S., Kreider, J. W., Lang, C. M., and Bullock, L. P. (1982) Effects of shipping on the immune function in mice. Am. J. Vet. Res. 43, 1654–1657. Cubie, H. A. (1976) Failure to produce warts on human skin grafts on ’nude’ mice. Brit. J. Dermatol. 94, 659–665. Bonnez, W., Borkhuis, C., Rose, R. C., and DaRin, C. (1996) Effect of graft puncture and coverslipping of grafting site on growth of HPV-11 infected grafts in the subcutaneous xenograft-severe combined immunodeficiency (SCID) mouse model. 15th International Papillomavirus Workshop. Gold Coast, Queensland, Australia. December 1–5, 1996.

Cottontail Rabbit Papillomavirus Model

217

17 The Cottontail Rabbit Papillomavirus Model of High-Risk HPV-Induced Disease Janet L. Brandsma Summary Animal models are essential to study the pathogenesis of papillomavirus infection and develop strategies for treatment and prevention. This review details use of the cottontail rabbit papillomavirus (CRPV)-laboratory rabbit model. The protocols describe how to infect rabbits with CRPV DNA or CRPV virus to induce papillomas. They also describe the design and analysis of genetic pathogenesis experiments, prophylactic and therapeutic intervention experiments, and malignant progression experiments.

1. Introduction Animal models are essential to study the pathogenesis of papillomavirus infection and develop strategies for treatment and prevention. Because human papillomaviruses (HPVs) do not directly infect animals and there is no known papillomavirus for laboratory rodents, the only tractable animal model that enables study of papillomavirus infection and disease, including malignant progression, is the cottontail rabbit papillomavirus (CRPV)–laboratory rabbit model (reviewed in refs. 1 and 2). The protocols described in this chapter have been successfully used in our laboratory to analyze various aspects of CRPV infection in rabbits. The CRPV and high-risk HPV genomes have the same organization, are expressed in similar differentiation-specific patterns in lesions, and encode proteins with conserved sequence and function (3–7). Many aspects of CRPVinduced carcinogenesis in rabbits reflect HPV-associated carcinogenesis in humans: lesions are initiated by infection with a papillomavirus; infection is confined to stratified squamous epithelium; papillomas are polyclonal (because multiple cells are infected); papillomas persist for long periods of time in relaFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

217

218

Brandsma

tive harmony with the host despite an intact immune system; and carcinogenesis occurs spontaneously through the acquisition of cellular mutations. CRPV infection of rabbit skin follows a highly predictable course. Papillomas appear 3–5 wk after infection. Each site forms multiple tiny papillomas in close proximity that grow to confluence within a couple of weeks. Initially, papillomas grow at exponential rates, but growth gradually slows, presumably due to a shortage of supportive factors in the microenvironment. The papillomas are cutaneous and can be examined or biopsied easily, providing multiple data sets with minimal animal use. Further, small biopsies do not induce regression. Because papilloma formation is virtually complete by 8 wk, experiments that use papilloma formation as an endpoint are relatively brief. Metastatic squamous cell carcinomas develop in up to 75% of CRPVinfected laboratory rabbits, when held 10 to 18 mo (see refs. 8,9 and unpublished data). Malignant progression appears to occur randomly within a population of papilloma cells. However its frequency and rapidity of onset are augmented when larger areas of skin and higher doses of virus are used (see ref. 10 and unpublished results). It is also possible to accelerate malignant progression using chemical carcinogens (11), although chemically induced progression may not have the same natural history as spontaneous progression. Highly predictable disease can be induced with CRPV virus or with molecular clones of the CRPV genome using an efficient DNA delivery method, which we introduced (12,13). The use of CRPV DNA is advantageous because the virus is not commercially available. Furthermore, the CRPV genome can be mutated in vitro and tested for biological activity in vivo. We and others have used this approach to evaluate several CRPV mutants (6,12,14–20). Currently, the CRPV-rabbit model is the only in vivo model that permits genetic evaluation of papillomavirus-induced pathogenesis. Site-directed mutations that cripple the papilloma-inducing activity of CRPV are particularly informative. Such mutants require complementary studies to demonstrate stability of the mutant protein, to confirm defective protein function in vitro (if possible), and to rule out inadvertent mutations outside the sitedirected mutation. Site-directed mutations that result in lesions require evaluation of the lesions to rule out the possibility of contamination or genetic reversion as the reason for activity. Minimal contamination with the wild-type CRPV genome may induce a papilloma, since infected cells are exponentially amplified in vivo. Similarly, in vivo reversion of a disabling mutation would give the reverted CRPV genome a selective growth advantage. The CRPV-rabbit model is useful for developing protective vaccines as well as therapeutic intervention strategies, assuming low rates of spontaneous regression. We have rarely observed spontaneous papilloma regression, although others have reported relatively high rates (21). This discrepancy

Cottontail Rabbit Papillomavirus Model

219

appears due to differences among rabbits, which are genetically diverse. Intervention experiments can test the efficacy of a treatment under various conditions of stringency, by choosing the number of sites infected and the amount of CRPV in the inoculum. It is important not to use too little virus or too few inoculation sites, because the control rabbits may form few papillomas and/or show papilloma regression. It is equally important not to use too much CRPV or too many sites, because the induction of efficacy may be masked. We advocate infecting rabbits at multiple sites and analyzing a combination of clinical outcomes. Quantitative outcomes associated with protection are fewer sites that form papillomas, prolonged times to papilloma onset, and/or slower rates of papilloma growth. Outcomes associated with therapeutic efficacy are increased numbers of papillomas that regress, increased volumes of papillomas that regress and decreased times from papilloma formation to regression. Prophylactic and therapeutic protocols that affect a clinical outcome at the high dose of virus normally show the same effect at lower doses of virus. When intervention results in regression, it is important to determine whether CRPV infection has cleared or remains latent, which can be determined by polymerase chain reaction (PCR). When intervention reduces papilloma volumes without regression, the question is whether the treatment may have also reduced the number of viral copies per cell. This is of interest because reduced CRPV copy numbers may render a lesion more susceptible to standard treatments and especially to antipapillomavirus drugs that may be developed in the future. Copy number quantitation is best achieved by real-time PCR using primer sets for CRPV and a single-copy rabbit gene (manuscript in preparation). An advantage of the CRPV-rabbit model for immunotherapeutic studies is the ability to evaluate cell-mediated antitumor immunity in vivo, an important aspect of immunotherapy, by rechallenge with CRPV DNA. CRPV DNAinduced papilloma formation can be inhibited only by cell-mediated immunity, because infection bypasses any effect of neutralizing antibodies (induced by primary infection). It is useful to mention that unvaccinated rabbits sometimes resist CRPV DNA rechallenge (unpublished data). CRPV DNA-resistant, papilloma-bearing rabbits reflect the delicate balance between natural immunity and antigenic load. Natural immunity is sufficient to suppress the formation of new papillomas in such rabbits—but insufficient to clear established lesions. Finally, papillomas in laboratory rabbits (Oryctolagus cuniculus) generally do not show vegetative CRPV DNA replication or virion production, analogous to high-risk HPV-positive genital lesions in humans. Therefore, the complete CRPV life cycle must be studied in cottontail rabbits (Sylvilagus floridanus) (13). Such studies are beyond the scope of this review. The lack of CRPV replication in laboratory rabbits is, however, a significant benefit from an experimental point of view, because the unpredictable natural spread of

220

Brandsma

infection is not a confounding variable. This feature also enables the co-housing of CRPV-infected and other laboratory rabbits in an animal room. 2. Materials 2.1. Rabbit Infection With CRPV DNA 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.

CRPV-pLAII (American Type Culture Collection ATCC, No. 45072). Plasmid expressing β-gal, e.g., pCMV-β-gal. Analytical balance. Gene delivery device (commercially available as Helios Gene Gun System from Bio-Rad Laboratories, Inc.). Sonicator—Branson 1200. Microfuge. Vortex mixer. Tube turner. Nitrogen gas tank. Helium gas tank. Gas pressure regulators. 1–3-µm-Diameter gold (Sigma-Aldrich Co.). Tefzel® tubing (McMaster-Carr Supply Co.). Peristaltic pump. Spermidine. CaCl2. Veterinary tranquilizer (e.g., Acepromazine). 23-Gage needles. Syringes. Marker pen. Clipper. 100% Ethanol. Eppendorf tubes. P200 Eppendorf pipetor. Rabbits—2–3-kg New Zealand white rabbits. Depilatory (e.g., Nair®, Division of Carter-Wallace Inc.). Paper towels. Salve or antibacterial cream. Ear protectors.

2.2. Rabbit Infection With CRPV Virus 1. CRPV virus (small amounts available for infection from J. Brandsma). 2. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4). 3. Glycerol. 4. Tubes, pipetor, tips. 5. Rabbits.

Cottontail Rabbit Papillomavirus Model 6. 7. 8. 9. 10. 11. 12. 13. 14.

221

Veterinary sedative—e.g., Acepromazine. Needles. Syringes. Marker pen or tattoo. Clipper. Razor blade. Elizabethan collars (veterinary suppliers). Vortex. VetBond™ tissue adhesive (3M).

2.3. Special Care of Rabbits With Persistent Papillomas 1. 2. 3. 4. 5.

Betadine® surgical scrub (Purdue Pharma, L.P.). Salve or antibacterial cream. Bandage. Elizabethan collar (veterinary suppliers). Booties (veterinary suppliers).

2.4. DNA Extraction and Analysis 1. 2. 3. 4. 5. 6. 7.

PCR oligonucleotide primers. PCR polymerase. PCR buffer. Tubes. PCR machine. Electrophoresis equipment for agarose and/or polyacrylamide gels. Scanner (if using for SybrGreen for SSCP analysis).

3. Methods This section details use of the CRPV-rabbit model. The protocols describe how to infect rabbits with CRPV DNA or CRPV virus, perform and analyze genetic pathogenesis experiments, perform and analyze prophylactic and therapeutic intervention experiments, and evaluate malignant progression. They are based on 15 yr of experience with the model.

3.1. Rabbit Infection With CRPV DNA The highest efficiency of papilloma formation is obtained using a heliumdriven delivery device for CRPV DNA inoculation (see Note 1). Our device is a prototype of the Helios gun (Biorad) and was generously provided by Powderject Vaccines (Madison, WI). Because the commercially available device differs slightly from ours, we strongly recommend a preliminary experiment to optimize the helium pressure (see Note 2). The amount of protein expression induced by optimal inoculation of a reporter gene (β-galactosidase) is illustrated in Fig. 1.

222

Brandsma

Fig. 1. DNA-encoded β-galactosidase expression in rabbit skin. Shown is a cutaneous site on a rabbit that was inoculated 24 h before with 1 µg pCMV-β DNA (Clontech). The site was removed at euthanasia, glued by its edges to a Petri dish, and stained with x-gal. The arrow marks the pCMV-β DNA-inoculated area, showing intense β-galactosidase expression.

The protocols described below generate material to inoculate 40 skin sites with 1 µg DNA per site. They involve (1) precipitation of DNA onto gold particles, (2) preparation of DNA-coated gold particles for inoculation, and (3) DNA inoculation of rabbit skin.

3.1.1. Precipitation of CRPV DNA onto Gold Particles 1. Weigh 21 mg gold into an Eppendorf tube. 2. Prepare fresh 0.1 M spermidine and add 100 µL to the gold. Sonicate briefly. 3. Add 42 µg supercoiled CRPV-pLAII (Fig. 2A) (see Note 3) and vortex vigorously. Add 200 µL 2.5 M CaCl2 dropwise while constantly vortexing over about 15 s. Incubate for 10 min, while vortexing briefly three to four times to keep the DNA and gold suspended. 4. Spin at full speed in a microfuge for 1 min. 5. Remove and discard the supernatant, using a 23-gage needle attached to a vacuum. Be careful not to touch the DNA/gold pellet. 6. Vortex the tube to loosen the pellet.

Cottontail Rabbit Papillomavirus Model

223

Fig. 2. Cottontail rabbit papillomavirus (CRPV) DNA-induced papilloma formation. Panel A shows the structure of plasmid CRPV-pLAII with disruption of the L2 gene. B shows the appearance of five CRPV DNA inoculation sites immediately after inoculation. C shows papillomas that formed at five adjacent inoculation sites 6 wk after CRPV-pLAII inoculation. 7. Add 1 mL of 100% ethanol and vortex 3 to 10 s to resuspend the pellet. 8. Spin briefly to reform the pellet and clarify the supernatant. Remove and discard the supernatant as described in step 6. 9. Wash the pellet three times with 100% ethanol. 10. Resuspend the pellet in 3 mL 100% ethanol for a final concentration of 7 µg DNA/mL. Disperse the pellet by back-and-forth pipeting. 11. Transfer the suspension into the bottom of a 15-mL conical screw-cap tube and close completely. Sonicate the DNA/gold particles by three passes through the sonication bath. Be aware that over-sonication will shear the DNA.

3.1.2. Preparation of DNA-Coated Gold Particles for Inoculation 1. Cut a 50-cm length of Tefzel tubing to prepare 40 inocula. If more inocula are required, cut multiple 50-cm lengths. 2. Fit one end of the tubing with a 10-mL syringe and place the other end into the DNA/gold suspension. 3. Vortex the DNA/gold suspension and leave no bubbles. Immediately draw the suspension through the full length of tubing by slow aspiration with the syringe. 4. Remove the syringe and quickly slide the loaded tubing into the tube turner. 5. Turn the tube turner on and rotate slowly for about 1 min to allow the DNAcoated gold particles to coat the inner walls as evenly as possible. 6. Turn the tube turner off and allow the particles to settle for 5 min. Otherwise, some DNA/gold with remain in suspension and be drawn off in the next step. 7. Attach one end of the tubing to a peristaltic pump. At low speed, begin to withdraw the ethanol, leaving the DNA/gold particles behind. The speed can be gradu-

224

8. 9. 10.

11.

12.

13.

Brandsma ally increased as more ethanol is withdrawn. Alternatively, the ethanol can be withdrawn manually, by steady slow aspiration with a syringe over a 2- to 3-min period. Rotate the tubing containing the DNA/gold particles and residual ethanol at approx 10–15 rpm to re-coat the inner walls of the tubing. While continuing to rotate, attach one end of the tubing to a nitrogen gas tank fitted with a pressure regulator. Open the nitrogen gas tank slowly to 0.1 PSI and gradually increase the pressure to 0.5 PSI (1 PSI equals approx 7 kPa). After about 30 s, the particles will be absolutely dry and their color will change from dark gold to pale yellow. Remove the tubing from the turner and cut it into 1.2-cm sections, each containing 1 µg DNA/0.5 mg gold. Alternatively, if a smaller inoculum is desired, the tubing can be cut into 0.6-cm lengths, each containing 0.5 µg DNA/0.25 mg gold. The gold does not have to be perfectly uniform in each section, so long as each section contains approximately the same amount of gold. To verify proper release of the particles, load a few sections into the cartridge of the DNA-delivery device. Set the helium pressure to the optimal value determined in the preliminary experiment (see Note 2). Hold the front of the device against a sheet of white paper and discharge the helium. The paper should have a round gold shadow, with the highest concentration of gold at the center. Look at the piece of tubing to see if it is empty. If any gold remains, discharge a second time; the remainder of the gold should be removed. To verify that the sections contain approx 1 µg DNA each, elute the DNA-gold particles from individual sections to run on an ethidium bromide-stained agarose gel. For elution, cut the end from a yellow pipet tip to increase its diameter to just fit into the section. Use 20 to 40 µL of 10 mM Tris-HCl (pH 8.5) to wash out the particles by back-and-forth pipetting. The gold does not interfere with electrophoresis and does not need to be removed. Include DNA concentration standards on the gel.

3.1.3. Intracutaneous Inoculation of CRPV DNA 1. Sedate four to six rabbits at a time, by intramuscular inoculation of Acepromazine (2 to 3 mg/kg) (see Note 4). It takes about 15 min for the sedative to take full effect. 2. Number each rabbit on the outer ear with a permanent marker pen or by tattoo. If using a marker pen, remark the number every 3–4 wk. 3. Clip the fur from an area of about 100 cm2 on one flank of the rabbit. 4. Remove the residual hair and superficial keratin because they impede penetration of the gold particles. Apply a thin coat of Nair or other depilatory to the clipped area and wait about 5 min. Wipe a small part of the treated area to determine whether the hair is gone. If not, wait another 2–3 min and repeat. 5. Gently wipe the entire depilated area several times with wet paper towels. The depilatory must be totally removed or irritation will occur. In case of irritation,

Cottontail Rabbit Papillomavirus Model

6. 7.

8.

9. 10.

225

treat the skin with a salve or antibacterial cream; it will not affect papilloma formation. Blot the skin and allow it to dry completely before proceeding. This is because liquid impedes the penetration of DNA-coated gold particles into skin. Load each of the 12 positions in the cartridge of the delivery device with one section of loaded tubing, and attach the delivery device to the helium tank. Set the pressure gauge to the optimal pressure determined in the preliminary experiment. Hold the front of the device against the depilated skin and pull the trigger to release the helium. If some gold remains in the tubing after one release of the trigger, repeat. Do not try to compensate by increasing the helium pressure. Wear ear protectors to dampen the noise. The noise does not bother sedated rabbits. Inoculation produces redness that resolves in about a week. Gold shadows may persist longer (Fig. 2B). Repeat step 8 until all inoculations have been performed. Each inoculation site will form multiple scattered papillomas (Fig. 2C).

3.2. Rabbit Infection With CRPV Virus (see Note 5) 1. We recommend infecting each rabbit with three doses of virus at three sites each, i.e., nine sites per rabbit, to provide good statistical power for analysis of experimental data. 2. Serially dilute the CRPV virus stock in PBS:glycerol (1:1) to produce high, moderate, and low doses of virus. Dilutions may range from 2-fold to 10-fold, depending on the papilloma-inducing activity of the high dose. The glycerol helps prevent the inoculum from rolling off the skin in step 7. 3. Determine the area of each infection site. We have infected sites as large as 2 cm2 and as small as 5 mm2. 4. Determine the volume of virus to be used at each site. We have used 30 µL per 2-cm2 site and 10 µL per 5-mm2 site. To calculate the volume of each dose of virus required for the experiment, multiply: (volume of virus/site) × (number of sites/rabbit) × (number of rabbits). Prepare about 10% extra. 5. Sedate the rabbits, number the outer ear, and clip an area on the flank, as described under Subheading 3.1.3. 6. Mark nine sites in a 3 × 3 pattern on the clipped flank with a marker pen. Leave 2 cm between each site and the next one. 7. Drop the virus inoculum onto one site, using a micropipetor. Start with a lowdose site on the rabbit that was sedated first. 8. Spread the virus over the predetermined area by gentle stroking with a micropipet tip. The site will become pinkish red in color. 9. Repeat step 7 for the remainder of the low-dose sites, the moderate-dose sites, and finally the high-dose sites on the first rabbit. 10. Scarify each site by cross-hatching it with seven strokes of a razor blade, in each of four directions. Start with the low-dose sites and use one razor blade per rabbit.

226

Brandsma

Fig. 3. Papilloma growth. Papilloma formation and growth are shown 4 (A) and 7 (B) wk after infection at three sites, with low, moderate, and high doses of cottontail rabbit papillomavirus (left, middle, and right of each photograph, respectively). 11. Lightly puncture each site with a tattoo needle 5 times or more, depending on the area of the site. 12. After four rabbits have been infected, sedate another four to six rabbits and continue. Repeat until all rabbits have been infected. If the rabbits lick the infected sites before they dry, temporarily fit them with an Elizabethan collar. 13. Papilloma formation in response to infection with three doses of CRPV is illustrated in Fig. 3.

3.3. Analysis of the Clinical Effects of CRPV Infection The clinical response to CRPV infection depends on the CRPV genome (mutant vs wild-type) (see Subheading 3.4.) and/or an effective prophylactic or therapeutic intervention (see Subheading 3.5.). The CRPV-rabbit model provides quantitative data regarding papilloma frequency, time to papilloma onset, and papilloma growth.

3.3.1. Data Collection Examine each rabbit beginning approx 18 d after CRPV infection and approximately weekly thereafter. If rabbits are followed for a prolonged period, bi-weekly examinations are usually sufficient after 2 mo of infection. At each examination, record whether each site is papilloma-positive or not and measure each papilloma at each site using a caliper. We measure the length, width, and also height of each papilloma, because their heights vary considerably. Early papillomas are hairless, slightly raised, harder than normal skin, and pink in color. They can be palpated with a fingertip. Tiny papillomas are highly vascular and release a faint streak of blood if stroked with a fingernail. The earliest papillomas are too small to measure; we estimate them to be 0.5 mm ×

Cottontail Rabbit Papillomavirus Model

227

Fig. 4. Quantification of clinical outcomes. Rabbits were infected with three doses of cottontail rabbit papillomavirus. In A, C, and D, the markers represent high (filled squares), moderate (open circles), and low (filled triangles) doses. The two graphs at the bottom of the figure show the papilloma volumes plotted either as actual means (C) or as the natural logarithm of the actual means (D).

0.5 mm × 0.5 mm (length, width, and height); within 1 wk such papillomas in untreated rabbits will be large enough to measure.

3.3.2. Clinical Outcomes and Statistical Analyses The clinical responses of rabbits to CRPV infection depend on the CRPV genome (mutant vs wild-type) (see Subheading 3.4.) and any prophylactic or therapeutic intervention (see Subheading 3.5.). Data from a typical experiment are shown in Fig. 4. Statistical methods have been reported previously (22,23).

228

Brandsma

Fig. 5. Papilloma regression. Shown are regressing papillomas at 20 (A) and 24 wk (B) after cottontail rabbit papillomavirus infection. 1. Papilloma frequency is the proportion of papilloma-positive sites, divided by the total number of infected sites, at any time point. Analyze differences using ChiSquare or logistic regression (Fig. 4A). 2. Time to papilloma onset is the number of days between CRPV infection and the time point when a papilloma is first recorded. Analyze differences using survival methods with interval censoring (Fig. 4B). 3. Papilloma volume is calculated using the formula for a geode as: π × length/2 × width/2 × height/2. To obtain the papilloma volume for each site, sum the volumes of individual papillomas at that site. If papilloma volumes are calculated separately from papilloma frequency, use only the papilloma-positive sites and ignore the papilloma-negative sites in the volume calculations. Papilloma growth at early times is exponential and can be plotted as mean volumes (Fig. 4C) or as the natural logarithm of mean volumes (Fig. 4D). Analyze differences in growth rates using the slopes of the lines representing papilloma growth, by means of analysis of variance (ANOVA). 4. If CRPV virus is used for infection, stratify the data for each outcome according to the dose prior to statistical analysis. 5. If regression occurs, evaluate: (1) regression frequency—the number of sites where papillomas regress/the number of sites where papillomas form, (2) time to regression—the number of days between maximum papilloma volume (or papilloma onset) and papilloma regression, and (3) rate of growth reversal. Regressing papillomas are illustrated in Fig. 5.

3.4. Genetic Pathogenesis Experiments 3.4.1. Construction of CRPV Mutant Genomes Introduce site-specific mutations into the CRPV genome in CRPV-pLAII using standard recombinant methods. Because CRPV-pLAII has few unique restriction sites, it is often necessary first to subclone the region of interest.

Cottontail Rabbit Papillomavirus Model

229

Introduce mutations into the subclone, and then replace the corresponding region of CRPV-pLAII with the mutated CRPV fragment. Before performing a rabbit experiment, verify that the recombinant sequence is correct.

3.4.2. CRPV DNA Inoculation of Adjacent Skin Sites Papillomas induced by CRPV DNA form at scattered locations over an area wider than the obvious gold deposit, when using a helium-driven DNA delivery device (Fig. 2C). If an experiment requires subsequent identification of individual sites, e.g., after papillomas form, it is essential to shield all but one site at the time of inoculation. Site identification is particularly important when delivering different CRPV DNAs to adjacent sites.

3.4.3. Considerations for CRPV Mutants That Induce Lesions Mutant CRPV genomes with defective activity can be rescued to confirm that inadvertent mutations elsewhere in the genome are not responsible for the phenotype (16). Obtain a tissue sample at euthanasia or by biopsy. A thin biopsy can be shaved from the surface of a lesion with a razor blade. It will yield sufficient DNA for PCR analysis. If the lesion is highly keratinized, the biopsied site will not bleed. If slight bleeding occurs, apply a drop of VetBond™ tissue adhesive to stop it. However, in biopsies that are too deep or too large, bleeding will occur. In case of clearly regressing lesions, obtain a punch biopsy before regression is complete. In our experience, punch biopsies do not cause regression. Use standard methods to extract the DNA and amplify the CRPV region containing the mutation by PCR. A single set of primers can be used to amplify wild-type or mutant sequences, and the products can be distinguished by: restriction endonuclease patterns (in some cases), direct sequencing, if the product is pure, single-strand conformational polymorphism (SSCP), and hybridization of dot blots to specific oligonucleotide probes (17); in some cases, different sets of primers can be designed to specifically amplify either the wild-type or a mutant sequence.

3.4.4. Considerations for CRPV Mutants That Do Not Induce Lesions The most informative CRPV mutants have defective biological activity. To ensure that a defect is not due to instability of the mutant protein, in vitro studies must be performed, e.g., transfection of the mutant gene followed by Western blotting. If the protein is stable, the biological defect may be due to host immunity or abnormal protein function. To address the possibility of immunity, co-inoculate experimental rabbits with mutant and wild-type CRPV (at different sites); inoculate control rabbits with wild-type CRPV. If wild-type CRPV is defective in the co-inoculated rabbits but not in the controls, the mu-

230

Brandsma

tant protein is probably immunostimulatory, either directly, through interaction with antigen-presenting cells, or indirectly, through activation of immunomodulatory molecules such as cytokines. If wild-type CRPV instead retains wild-type activity in the co-inoculated rabbits, the mutant protein probably functions abnormally (e.g., ref. 16). If the function in question can be assayed in vitro, positive findings (dysfunction) strongly support defective protein function. Marker rescue experiments also can be performed to rule out the possibility of an unintended, detrimental mutation outside the site of interest. To rescue a mutant CRPV genome, replace a subfragment containing the mutation with the corresponding wild-type fragment and then assess the genome’s activity in vivo.

3.4.5. Analysis of CRPV Latency Clinically normal infection sites may be CRPV-negative or latently infected. These include sites where papillomas do not form and sites where papillomas regress. To evaluate the possibility of latency, obtain a tissue sample at euthanasia or by punch biopsy. It is advisable to wait at least 2 wk after regression to obtain the sample, because viral clearance may take longer to occur. It is important, however, to mark the last area of regression as soon as a lesion disappears. Otherwise it will be impossible to locate at a later time (regression sites leave no sign of prior infection). Extract DNA from the sample and evaluate CRPV status as described under Subheading 3.3.2.

3.5. Intervention Experiments 3.5.1. Experimental Stringency The severity of disease and hence the stringency of an intervention experiment is determined by the number of sites infected with CRPV and the amounts of CRPV in the inocula. Experimental stringency also is determined by the timing of the intervention. Prophylactic protocols can be initiated days, weeks, or months prior to CRPV infection. Therapeutic protocols can be initiated prior to papilloma formation (during the subclinical incubation period), subsequent to papilloma formation, or subsequent to malignant progression. The greater the numbers and volumes of papillomas (or carcinomas) at the time of intervention, the greater the stringency of the experiment.

3.5.2. Systemic vs Local Effects To evaluate vaccines or drugs with systemic effects, administer each vaccine/drug to a different group of rabbits. To evaluate interventions that induce only local effects, administer multiple drugs/formulations/doses to each rabbit. For example, six topical drug formulations plus a control can be administered

Cottontail Rabbit Papillomavirus Model

231

to 5 sites each, using rabbits with 35 papilloma sites. This design provides internal controls for the genetic heterogeneity of rabbits, and it reduces the number of rabbits required for an experiment.

3.5.3. In Vivo Evaluation of Cell-Mediated Immunity CRPV DNA rechallenge can be used to evaluate the presence and persistence of cell-mediated immunity in CRPV-infected, vaccinated rabbits. For rechallenge, inoculate CRPV DNA at skin sites not previously infected with CRPV. See Subheading 3.1. for CRPV DNA inoculation methods. This assay requires CRPV DNA and cannot be performed with CRPV virus.

3.5.4. In Vivo Neutralization Assay Protective vaccines aim to induce neutralizing antibody. The presence and titer of neutralizing antibody can be determined in vivo. This assay requires CRPV virus and cannot be performed with CRPV DNA. Make serial 10-fold dilutions of preimmune and immune sera in PBS containing 1% bovine serum albumin. Mix 25 µL of diluted serum with 25 µL CRPV virus and incubate on ice for 2–3 h. Inoculate naïve rabbit skin with 15–20 µL of each mixture at duplicate or triplicate sites, using the protocol in Subheading 3.2. Infect additional sites on each rabbit with the same amount of virus without serum as positive controls.

3.5.5. Special Care of Rabbits With Persistent Papillomas Because of the natural history of CRPV-induced disease, some rabbits with persistent papillomas may require special care. Papillomas may crack spontaneously, or a rabbit may chew or scratch the lesions, inducing bleeding. The care of such rabbits may involve thorough cleaning of the lesions, e.g., with Betadine, followed by application of a salve or antibacterial cream. An Elizabethan collar can be placed around the neck to prevent chewing, and booties can be tied to the hind feet to prevent scratching. In more problematic cases, a rabbit can be wrapped around the trunk with a bandage.

3.6. Malignant Progression Experiments When the goal of an experiment is to evaluate malignant progression, results will be obtained most rapidly by infecting large areas of skin with large doses of virus (see ref. 24 and unpublished data). It also is possible to accelerate malignant progression using chemical carcinogens (11), although chemically induced progression may not have the same natural history as spontaneous progression. Cancers always arise within an area of papilloma, as shown histologically in Fig. 6A. Early clinical signs include a fleshy, convex base and/or a

232

Brandsma

Fig. 6. Malignant progression. A shows the histopathology of a carcinoma arising within a papilloma. B and C show the development of a carcinoma, 34 and 40 wk after cottontail rabbit papillomavirus (CRPV) infection, respectively. D and E show metastases of the lesion to lymph node (arrow) and lung, respectively, 10 mo after CRPV infection.

marked depression in the papilloma (Fig. 6B). Later, the tumor becomes ulcerated (Fig. 6C) and ultimately metastasizes, usually to lymph nodes and lung (Fig. 6D,E). To determine whether a suspicious lesion is carcinoma, obtain a biopsy for histopathologic evaluation. In our experience, significant weight loss, inappetence, and malaise occur only after the lesion has become invasive or metastatic. Rabbits with carcinoma may be followed to determine whether additional carcinomas will develop at other sites, if the primary tumor is surgically excised before it metastasizes. Rabbits with metastatic disease should be euthanized for humane reasons. 4. Notes 1. We have compared four methods to induce papilloma formation in rabbits using CRPV DNA delivery: intradermal inoculation and puncture, scarification, jet injection, and a helium-driven gene delivery device (12,13). Helium-driven gene delivery is by far the most effective, reproducible, and humane.

Cottontail Rabbit Papillomavirus Model

233

2. Preliminary experiments for optimization of helium pressure use a reporter gene such as β-galactosidase. Rabbits are inoculated, for example, at two sites per day using different pressures, e.g., 250, 300, 350, and 400 PSI (1 PSI equals approx 7 kPa), for 2 d and euthanized on day 3. The eight inoculated sites plus normal skin sites as negative controls are then evaluated for reporter-gene expression. The helium pressure that produces the strongest reporter-gene expression is chosen for subsequent experiments. 3. Papilloma formation was not affected by the type of DNA preparation, and we now use supercoiled CRPV-pLAII regularly (unpublished data). 4. Rabbits may be anesthetized with xylazine and/or ketamine instead of sedated with Acepromazine. However, anesthetized rabbits lie down, and if they lie on the CRPV virus-infected flank, they develop fewer/smaller papillomas, indicating that some virus was inadvertently removed after infection. 5. The reproducibility of infection using CRPV virus depends on several factors. To achieve maximal reproducibility, we strongly recommend having a single investigator inoculate all sites in all rabbits. We also recommend keeping the infection sites small, which also facilitates the collection of clinical data because papilloma confluence is reached more rapidly (and papillomas can then be measured as one).

References 1. Brandsma, J. L. (1994) Animal models of human-papillomavirus-associated oncogenesis. Intervirology 37, 189–200. 2. Kreider, J. W. and Bartlett, G. L. (1981) The Shope papilloma-carcinoma complex of rabbits: a model system of neoplastic progression and spontaneous regression. Adv. Cancer Res. 35, 81–110. 3. Giri, I., Danos, O., and Yaniv, M. (1985) Genomic structure of the cottontail rabbit (Shope) papillomavirus. PNAS (USA) 82, 1580–1584. 4. Giri, I. and Yaniv, M. (1988) Study of the E2 gene product of the cottontail rabbit papillomavirus reveals a common mechanism of transactivation among papillomaviruses. J. Virol. 62, 1573–1581. 5. Haskell, K. M., Vuocolo, G. A., Defeo-Jones, D., Jones, R. E., and Ivey-Hoyle, M. (1993) Comparison of the binding of the human papillomavirus type 16 and cottontail rabbit papillomavirus E7 proteins to the retinoblastoma gene product. J. Gen. Virol. 74, 115–119. 6. Peh, W.L., Brandsma, J. L., Christensen, N. D., Cladel, N. M., Wu, X., and Doorbar, J. (2004) The viral E4 protein is required for the completion of the cottontail rabbit papillomavirus productive cycle in vivo. J. Virol. 78, 2142–2151. 7. Zeltner, R., Borenstein, L. A., Wettstein, F. O., and Iftner, T. (1994) Changes in RNA expression pattern during the malignant progression of cottontail rabbit papillomavirus-induced tumors in rabbits. J. Virol. 68, 3620–3630. 8. Rous, P. and Beard, J. W. (1935) The progression to carcinoma of virus-induced rabbit papillomas (Shope). J. Exp. Med. 62, 523–548. 9. Syverton, J. T. (1952) The pathogenesis of the rabbit papilloma-to-carcinoma sequence. Ann. N.Y. Acad. Sci. 54, 1126–1140.

234

Brandsma

10. Rous, P., Kidd, J. G., and Beard, J. W. (1936) Observations on the relation of the virus causing rabbit papillomas to the cancers deriving therefrom. I. The influence of the host species and of the pathogenic activity and concentration of the virus. J. Exp. Med. 64, 385–400. 11. Rogers, S. and Rous, P. (1951) Joint action of a chemical carcinogen and a neoplastic virus to induce cancer in rabbits. J. Exp. Med. 93, 459–488. 12. Brandsma, J. L., Yang, Z. H., Barthold, S. W., and Johnson, E. A. (1991) Use of a rapid, efficient inoculation method to induce papillomas by cottontail rabbit papillomavirus DNA shows that the E7 gene is required. PNAS (USA) 88, 4816–4820. 13. Xiao, W. and Brandsma, J. L. (1996) High efficiency, long-term clinical expression of cottontail rabbit papillomavirus (CRPV) DNA in rabbit skin following particle-mediated DNA transfer. Nucleic Acids Res. 24, 2620–2622. 14. Brandsma, J. L., Yang, Z. H., DiMaio, D., Barthold, S. W., Johnson, E., and Xiao, W. (1992) The putative E5 open reading frame of cottontail rabbit papillomavirus is dispensable for papilloma formation in domestic rabbits. J. Virol. 66, 6204–6207. 15. Meyers, C., Harry, J., Lin, Y. L., and Wettstein, F. O. (1992) Identification of three transforming proteins encoded by cottontail rabbit papillomavirus. J. Virol. 66, 1655–1664. 16. Wu, X., Xiao, W., and Brandsma, J. L. (1994) Papilloma formation by cottontail rabbit papillomavirus requires E1 and E2 regulatory genes in addition to E6 and E7 transforming genes. J. Virol. 68, 6097–6102. 17. Defeo-Jones, D., Vuocolo, G. A., Haskell, K. M., et al. (1993) Papillomavirus E7 protein binding to the retinoblastoma protein is not required for viral induction of warts. J. Virol. 67, 716–725. 18. Jeckel, S., Huber, E., Stubenrauch, F., and Iftner, T. (2002) A transactivator function of cottontail rabbit papillomavirus e2 is essential for tumor induction in rabbits. J. Virol. 76, 11,209–11,215. 19. Hu, J., Cladel, N. M., Pickel, M. D., and Christensen, N. D. (2002) Amino acid residues in the carboxy-terminal region of cottontail rabbit papillomavirus E6 influence spontaneous regression of cutaneous papillomas. J. Virol. 76, 11,801–11,808. 20. von Knebel Doeberitz, M. (2002) New markers for cervical dysplasia to visualise the genomic chaos created by aberrant oncogenic papillomavirus infections. Eur. J. Cancer 38, 2229–2242. 21. Han, R., Breitburd, F., Marche, P. N., and Orth, G. (1992) Linkage of regression and malignant conversion of rabbit viral papillomas to MHC class II genes. [see comment]. Nature 356, 66–68. 22. Leachman, S. A., Tigelaar, R. E., Shlyankevich, M., et al. (2000) Granulocytemacrophage colony-stimulating factor priming plus papillomavirus E6 DNA vaccination: effects on papilloma formation and regression in the cottontail rabbit papillomavirus—rabbit model. J. Virol. 74, 8700–8708.

Cottontail Rabbit Papillomavirus Model

235

23. Leachman, S. A., Shylankevich, M., Slade, M. D., et al. (2002) Ubiquitin-fused and/or multiple early genes from cottontail rabbit papillomavirus as DNA vaccines. J. Virol. 76, 7616–7624. 24. Rous, P., Kidd, J. G., and Beard, J. W. (1936) Observations on the relation of the virus causing rabbit papillomas to the cancers deriving therefrom. J. Exp. Med. 64, 385–400.

HPV Life Cycle in 3A Trophoblasts

237

18 Studying the HPV Life Cycle in 3A Trophoblasts and Resulting Pathophysiology Yong Liu, Hong You, and Paul L. Hermonat Summary Human papillomavirus (HPV) productive infection has been long considered to be restricted to the squamous epithelium. However, we have demonstrated that both HPV type 16 (HPV-16) and type 31b (HPV-31b) productively replicate in a trophoblast cell line, 3A. Trophoblasts are an important cell type, as these are the cells of the placenta that directly contact maternal tissues. There are a number of studies that suggest that HPV infection may be found commonly in placental material and might be linked with spontaneous abortions. This chapter describes the preparation and transfection of HPV genomes into 3A cells, suggests ways to analyze viral replication and transcription, and describes how to assay the effect of HPV infection on the ability of the trophoblasts to bind endometrial cells.

1. Introduction Human papillomavirus (HPV) productive infection has long been considered to be restricted to the squamous epithelium. However, we have demonstrated that both HPV type 16 (HPV-16) and type 31b (HPV-31b) productively replicate in a trophoblast cell line, 3A (1,2). 3A cells are mortal and have normal trophoblast traits (e.g., synthesize human chorionic gonadotropin and alkaline phosphatase) at 40°C. These cells have been altered with SV40 ts30, a temperature-sensitive large T antigen (3). Trophoblasts are an important cell type, as these are the cells of the placenta that directly contact maternal tissues. They both anchor the placenta to the maternal tissues and regulate nutrient and waste exchange. Thus, disruption of the trophoblastic layer, by HPV or any other infectious or chemical agent, could be very dangerous for the gestation and promote expulsion (4). There are a number of studies that suggest that HPV infection may be found commonly in placental material and might be linked with spontaneous abortions (5–13). From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

237

238

Liu, You, and Hermonat

2. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24.

25.

26.

27. 28. 29. 30. 31. 32.

Plasmid pAT/HPV-16 containing full-length HPV-16 genome (14). BamHI (10 U/µL; Promega). 1% Agarose gel with 0.5 µg/mL ethidium bromide. TAE electrophoresis buffer: 0.04 M Tris-acetate, 0.002 M ethylenediamine tetraacetic acid (EDTA) (pH 8.0). GeneClean III kit (BIO101, Vista, CA). T4 DNA ligase (1 U/µL; Promega). Tris buffer saturated phenol (pH 8.0 ± 0.2, Fisher Scientific). 100% and 75% ethanol. 3A trophoblasts, CRL 1583 (American Type Culture Collection, ATCC). Six-well tissue-culture plates. 10-cm Tissue-culture dishes. Dulbecco’s modified Eagle’s medium (DMEM) with 4.5 mg/mL glucose and L-glutamine (Cellgro, Herndon, VA). Premium fetal bovine serum (FBS; Atlanta Biologicals, Norcross, GA). FuGENE 6 transfection reagent (Roche Applied Science). Phosphate-buffered saline (PBS): 0.83 mM KH2PO4, 0.15 M NaCl, 5.6 mM Na2HPO4 (pH 7.4). Trypsin-EDTA solution: 0.05% trypsin, 0.53 mM EDTA in HBSS (Cellgro, Herndon, VA). 20X SSC: 3.0 M NaCl, 0.3 M sodium citrate (pH 7.0). Denaturation buffer: 0.5 M NaOH, 1.5 M NaCl. Neutralization buffer: 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.0). Thick chromatography paper (Fisher Scientific). Zeta-Probe blotting membrane (nylon membrane; Bio-Rad). 1225 Sampling Manifold (Millipore). UVGL-58 Mineralight Lamp (multiband UV-254/366 nm; San Gabriel, CA). HPV-16 spliced transcript E1^E4 primer set (15). Upstream: 5'-TGGAGAACCTGTTAGGGCACAC-3' (nt 797 to 820). Downstream: 5'- TATAGACATAAATCCAGTAATGACAC-3' (nt 3826 to 3849). HPV-16 spliced transcript E6^E7 primer set (16). Upstream: 5'-ACAGTTATGCACAGAGCTGC-3' (nt 142 to 161). Downstream: 5'-CTCCTC CTCTGAGCTGTCAT-3' (nt 647 to 666). HPV antibodies: H16.V5 (HPV-16 neutralizing antibody), H16.J4 (HPV-16 nonneutralizing antibody), HPV-18.J4 (HPV-18 neutralizing antibody), and H11.H3 (HPV-11 neutralizing antibody). HPV-31b virus stock (2). Oligotex Direct mRNA Micro kit (Qiagen). RNase-free DNase I (1 U/µL; Promega). Oligo (dT)15 primer (0.5 µg/µL; Promega). RNasin ribonuclease inhibitor (40 U/µL; Promega). M-MLV reverse transcriptase (200 U/µL; Promega).

HPV Life Cycle in 3A Trophoblasts 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43.

239

Polymerase chain reaction (PCR) nucleotide mix (10 mM dNTPs; Promega). Taq DNA polymerase (5 U/µL) and buffer (Qiagen). PTC-100 programmable thermal controller (MJ Research, Watertown, MA). Primary epidermal keratinocytes (Cambrex Bio Science Whittaker, Walkersville, MD). J2 fibroblasts (ATCC). Endometrial carcinoma cell line: HEC (HTB-112, ATCC), RL95 cells (CRL110, ATCC). Keratinocyte-SFM medium (Invitrogen). 24-Well culture. 0.22-µm Syringe-driven filters (Millipore). β-mercaptoethanol (β-ME; Sigma). Chromium-51 radionuclide (51Cr; 5 mCi/mL; PerkinElmer Life Sciences, Boston, MA).

To demonstrate HPV productive replication in 3A trophoblasts, a series of experiments are carried out. Southern blot, Western blot, production and purification of HPV-31b virus stock, in situ immunocytochemistry, and others are performed by the standard methods and are not described here in detail because of space limitations. 3. Methods The full-length HPV-16 DNA is cut from the original plasmid and recircularized, and then transfected into 3A trophoblasts cells. The HPV life cycle can be analyzed using a variety of methods.

3.1. Preparation of Recircularized HPV-16 DNA 1. Digest plasmid pAT/HPV-16 with BamH I (5–10 U/µg DNA) at 37°C for 4 h. 2. Make >10 cm long, 1.0% agarose gel containing 0.5 µg/mL ethidium bromide in TAE buffer. 3. Load digestion solution and DNA markers onto gel and electrophorese for 2–4 h (6 V/cm). 4. Gel extract the BamH I-digested DNA fragment containing the complete HPV-16 genomic DNA (approx 7.9 kb) using GeneClean III kit. 5. Recircularize the DNA using T4 DNA ligase (1 U/µg DNA) at 15°C overnight. 6. Phenol extract and ethanol precipitate the DNA.

3.2. Transfection of HPV-16 DNA (see Note 1) 1. Culture 3A trophoblasts to 80% confluence in six-well tissue-culture plates at 40°C in a CO2 incubator using 3.0 mL of DMEM containing 7.0% FBS per well. 2. Renew the medium every 2 d. 3. Add in order FBS-free DMEM (200 µL), FuGENE 6 (9 µL), and the recircularized HPV-16 DNA (3.0 µg) into a sterile glass or polystyrene tube. Mix gently and incubate the mixture at room temperature for approx 30 min.

240

Liu, You, and Hermonat

4. Remove the medium from the 3A cells and replace with 1 mL of FBS-free DMEM. Add the FuGENE 6/DNA mixture to this. 5. After 8 h, replace the medium with 3 mL/well of DMEM containing 7% FBS.

3.3. Infectious Center Assay for HPV Type 16 Replication 1. Cell preparation: At predetermined times (e.g., 3, 6, 9, 12, 15, 18, 21 d) 3A cells are trypsinized with 1.0 mL of trypsin-EDTA solution per well at 37°C for 5 min, harvested and washed with PBS buffer by centrifugation at 150g for 10 min, and resuspended with PBS buffer (5 × 103 cells/mL). 2. Membrane preparation: Cut pieces of Zeta-Probe blotting membrane and chromatography paper (2.5-cm diameter) to the size of the 1225 Sampling Manifold. Wet in 6X SSC for 1 min. 3. Place the wet chromatography papers in the manifold, lay the wet membranes on top of them, and then assemble the manifold. 4. Switch on the suction to the manifold device, apply 3.0 mL of 6X SSC to each well, and allow to filter through, leaving the suction on. 5. Add 1 × 104 cells into each well under continuous suction, and then turn the suction off. 6. Add 2.0 mL of denaturation buffer into each well, switch on the suction to allow the solution to filter through, and then turn suction off. Repeat this step again. 7. Add 2.0 mL of neutralization buffer into each well as described above. 8. Wash the membrane with 2X SSC for 1 min, and then fix DNA to the membrane with ultraviolet (UV) light (254 nm, UVGL-58 Mineralight Lamp) for 1 min. 9. Probe the membrane with 32P-labeled HPV-16 DNA according to standard hybridization conditions (see Fig. 1).

3.4. Analysis of HPV-16 Spliced Transcripts (see Note 2) 1. Isolate polyA RNA (mRNA) from the HPV-treated 3A cells using Oligotex Direct mRNA Mini kit at predetermined times (eg., 3, 6, 9, 12, 15, 18, 21 d). 2. Digest the total mRNA with RNase-free DNase I (4 U/µg RNA) at 37°C for 30 min. 3. Perform first-strand cDNA synthesis at 37°C for 1 h, in a final volume of 25 µL, using 0.1–0.5 µg mRNA, 0.5 µg Oligo(dT)15, 40 U RNasin, 200 U M-MLV reverse transcriptase, 1X buffer and 0.5 mM each of the four dNTPs. 4. Mix the following PCR reactions in a total volume of 50 µL: 5–15 µL cDNA solution, 1X Taq buffer without MgCl2, 2 mM MgCl2, 0.4 mM dNTPs, 1.25 U Taq polymerase, 1 µM each upstream and downstream primers. 5. Use the following PCR condition: 5 min at 95°C, followed by 34 cycles of 50 s at 94°C, 55 s at 58–60°C, 50 s at 72°C. A final elongation of 8 min at 72°C should be included. 6. Electrophorese as previously described. The expected lengths of the E1^E4 and E6^E7 reverse transcriptase (RT)-PCR products are 510 and 525 base pairs, respectively.

HPV Life Cycle in 3A Trophoblasts

241

Fig. 1. Analysis of human papillomavirus (HPV)-16 DNA replication in 3A trophoblasts by infectious center assay. CaSki cells (1 × 103) were used as positive controls; each cell contains approx 600 copies of HPV-16. At the indicated times, the cells were applied to membranes and analyzed by hybridization for HPV-16 sequences. Note positive signals at days 9–24.

3.5. Analysis of Infectious Virion Production The generation of infectious HPV-16 virions in the HPV-16 treated trophoblasts is measured by the ability of lysates from these trophoblasts to infect and replicate in a secondary culture of primary epidermal keratinocytes grown as stratified squamous epithelium. 1. Culture the HPV-transfected 3A trophoblasts to 100% confluence in 10-cm dishes with 6 mL of DMEM containing 7% FBS as previously described. 2. Freeze (–20°C or –80°C) and thaw (room temperature) the cells two times to lyse the cells at the indicated times. 3. Vortex the lysates for at least 60 s and centrifuge them at 3220g, 4°C, for 15 min. 4. Treat supernatants with RNase-free DNase I (10 U/mL) at 37°C for 30 min, and then filter (0.22-µm syringe-drive filter). 5. Add 3.0 mL of each supernatant into a 10-cm tissue-culture dish containing 90% of confluent primary epidermal keratinocytes (1.0 mL of keratinocyte-SFM medium). 6. Culture for 4 h in CO2 incubator. 7. Trypsinize the cells as previously described.

242

Liu, You, and Hermonat

Fig. 2. Specific antibody neutralization of human papillomavirus (HPV)-16 virions produced in trophoblasts. HPV-16 virus stocks, derived from HPV-16 DNA-transfected 3A cells, were pretreated with the indicated antibodies before being used to infect the keratinocytes. In addition, H16.V5 was also treated with β-ME. Note that only untreated H16.V5, known to neutralize HPV-16, was able to prevent the infection of the raft tissue. 8. Seed the keratinocytes onto collagen rafts containing J2 fibroblasts to generate an organotypic epithelial raft culture system using standard methodologies (17) (see Chapters 13 and 14). 9. Isolate cellular DNA, mRNA, and proteins from the rafts at day 12, and then analyze HPV replication and expression with Southern blot, RT-PCR, and Western blot using standard methodologies (see Chapter 14).

3.6. Antibody-Neutralizing Analysis This experiment is to further verify that HPV 16 can generate infectious virions in 3A trophoblasts. It is similar to that described above, except that the HPV-16 virus stocks are pretreated with HPV-16 neutralizing, nonneutralizing, β-mercaptoethanol (β-ME)-treated neutralizing antibodies, and antibodies of other HPV types, respectively, before infection of the secondary keratinocyte culture (18,19). The infectious virions are neutralized only by the HPV-16 neutralizing antibody and cannot infect the keratinocytes if there are virions in the lysed 3A trophoblast supernatant. However, the other antibodies cannot block the infectious ability of HPV-16 virus because they cannot neutralize the infectious virions. 1. Mix the HPV-16 virus stocks/lysed 3A trophoblast supernatant with a series of HPV antibodies including H16.V5, H16.J4, HPV-18.J4, and H11.H3, respectively (diluted 1/1000). 2. In addition, treat H16.V5 with 0.2 M β-ME to destroy this immunoglobulin (Ig)G antibody before it is mixed with the lysates (see Fig. 2).

HPV Life Cycle in 3A Trophoblasts

243

3.7. Trophoblast-Endometrial Cell-Binding Assay A central characteristic and function of trophoblasts is to bind endometrial cells. This is needed for both implantation and placental maintenance. To analyze whether this central characteristic is changed in HPV-infected trophoblasts, a heterologous cell–cell adhesion assay is used, which involves the binding of 51Cr-labeled, single-cell trophoblasts in suspension to confluent adherent-monolayer HEC or RL95 endometrial cells. The analysis of HPV-31b productive viral replication is very similar to the above, with the exception of the method of HPV introduction. HPV-31b infection is used to introduce the HPV genome (see Chapter 28 for preparation of the HPV-31b virus stock). 1. Culture HEC or RL95 cells in DMEM containing 7% FBS to 100% confluence in 24-well plates. 2. Label the suspensions of HPV infected 3A cells, uninfected or other control cells (2 × 105 cells/mL) by adding 50 µCi of 51Cr and incubate for 1 h at 37°C. 3. Trypsinize and wash the labeled cells three times with PBS by centrifuge at 150g for 10 min. 4. Add the 51Cr-labeled cells to the medium covering the confluent monolayer of HEC or RL95 endometrial cells, and incubate for 1 h or 3 h at 37°C. 5. Remove the medium and nonadherent cells. 6. Gently wash the monolayer cells three times with PBS. 7. Extract the labeled 3A trophoblasts that remain bound to HEC or RL95 cells by the addition of 0.5 M NaOH and 1% SDS. 8. Measure the retained radioactivity by liquid scintillation counting. The binding radioactivity counts reflect the degree of trophoblast-endometrial binding because the trophoblasts are labeled with 51Cr.

4. Notes 1. To avoid appearance of a white precipitate, the liposomal-DNA mixture must be mixed very carefully and gently. 2. We suggest, at first, that total RNA be isolated from the cells using TRIzol reagent (Invitrogen), and then the total mRNA separated using Oligotex mRNA Kit (Qiagen). To confirm that HPV DNA does not contribute to the RT-PCR results, direct PCR (no RT step) should also be undertaken using 5–10 µL of the total mRNA solution as the PCR template.

Acknowledgments The authors thank Drs. Richard Schlegel for the plasmid pAT-HPV-16 and Neil Christensen for the antibodies. Work in our lab is supported by a grant from the March of Dimes.

244

Liu, You, and Hermonat

References 1. Liu, Y., You, H., Chiriva-Internati, M., et al. (2001) Display of complete life cycle of human papillomavirus type 16 in cultured placental trophoblasts. Virology 290, 99–105. 2. You, H., Liu, Y., Agrawal, N., et al. (2003) Infection, replication, and cytopathology of human papillomavirus type 31 in trophoblasts. Virology 316(2), 281–289. 3. Chou, J. Y. (1978) Human placental cells transformed by tsA mutants of simian virus 40: a model system for the study of placental functions. Proc. Natl. Acad. Sci. USA 75, 1409–1413. 4. Clark, D. A., Banwatt, D., and Croy, B. A. (1993) Murine trophoblast failure and spontaneous abortion. Amer. J. Reprod. Imm. 29, 199–205. 5. Armbruster-Moraes, E., Ishimoto, I. M., Leao, E., and Zugaib, M. (1994) Presence of human papillomavirus DNA in amniotic fluids of pregnant women with cervical lesions. Gyn. Oncol. 54, 152–158. 6. Favre, M., Majewski, S., De Jesus, N., Malejczyk, M., Orth, G., and Jablonska, S. (1998) A possible vertical transmission of human papillomavirus genotypes associated with epidermodysplasia verruciformis. J. Invest. Derm. 111, 333–336. 7. Hermonat, P. L., Han, L., Wendel, P., et al. (1997) Human papillomavirus DNA is more prevalent in first trimester spontaneously aborted products of conception compared to elective specimens. Virus Genes 14, 13–17. 8. Hermonat, P. L., Kechelava, S., Lowery, C. L., and Korourian, S. (1998) Trophoblasts are the preferential target for human papillomavirus infection in spontaneously aborted products of conception. Human Pathol. 29,170–174. 9. Malhomme, O., Dutheil, N., Rabreau, M., Armbruster-Moraes, E., Schlehofer, J. R., and Dupressoir, T. (1997) Human genital tissues containing DNA of adenoassociated virus lack DNA sequences of the helper viruses adenovirus, herpes simplex virus or cytomegalovirus but frequently contain human papillomavirus DNA. J. Gen. Virol. 78, 1957–1962. 10. Manavi, M., Czerwenka, K. F., Schurz, B., Knogler, W., Kubista, E., and Reinold, E. (1992) Latent cervical virus infection as a possible cause of early abortion. Gynakologisch-Geburtshilfliche Rundschau. 32, 84–87. 11. Pao, Q., Hor, J. J., Wu, C. J., Shi, Y. F., Xie, X., and Lu, S. M. (1995) Human papillomavirus DNA in gestational trophoblastic tissues and choriocarcinoma. Internatl. J. Cancer 63, 505–509. 12. Rabreau, M. and Saurel, J. (1997) Presence of human papilloma viruses in the deciduous membranes of early abortion products (letter). Presse Medicale 26, 1724. 13. Sikstrom, B., Hellberg, D., Nilsson, S., Brihmer, C., and Mardh, P. A. (1995) Contraceptive use and reproductive history in women with cervical human papillomavirus infection. Advances in Contraception 11, 273–284. 14. Bubb, V., McCance, D. J., and Schlegel, R. (1988) DNA sequence of the HPV-16 E5 ORF and the structural conservation of its encoded protein. Virology 163, 243–246. 15. White, W. I., Wilson, S. D., Bonnez, W., Rose, R. C., Koenig, S., and Suzichi, J. A. (1998) In vitro infection and type-restricted antibody-mediated neutralization of authentic human papillomavirus type. J. Virol. 72, 959–964.

HPV Life Cycle in 3A Trophoblasts

245

16. Sotlar, K., Selinka, H.-C., Menton, M., Kandolf, R., and Bultmann, B. (1998) Detection of human papillomavirus type 16 E6/E7 oncogene transcripts in dysplastoc and nondysplastic cervical scrapes by nested RT-PCR. Gyn. Oncol. 69, 114–121. 17. Meyers, C. (1996) Organotypic (raft) epithelial tissue culture system for the differentiation-dependent replication of papillomavirus. Methods Sci. 18, 201–210. 18. Roden, R. B., Armstrong, A., Haderer, P., et al. (1997) Characterization of a human papillomavirus type 16 variant-dependent neutralizing epitope. J. Virol. 71, 6247–6252. 19. Christensen, N. D., Reed, C. A., Cladel, N. M., Hall, K., and Leiserowitz, G. S. (1996) Monoclonal antibodies to HPV-6 L1 virus-like particles identify conformational and linear neutralizing epitopes on HPV-11 in addition to type-specific epitopes on HPV-6. Virology 224, 477–486.

Papillomaviruses in S. cerevisiae

247

19 Replication and Encapsidation of Papillomaviruses in Saccharomyces cerevisiae Peter C. Angeletti Summary Improvements in methodologies to recapitulate and study particular biological functions of the papillomavirus life cycle have led to great advances in our knowledge of these viruses. Described in this chapter are techniques that allow low-copy and high-copy replication of fulllength human papillomavirus (HPV) genomes, as well as assembly of virus-like particles, in Saccharomyces cerevisiae (yeast). This system has several distinct advantages that make it an attractive complement to the well-established raft-culturing system. First, yeast are inexpensive, rapid, and simple to culture in the lab. Second, they provide an ever-widening array of genetic tools to analyze HPV functions—most recently notable, the yeast open reading frame (ORF)-deletion library. Third, yeast provide a potentially high-efficiency means to produce large quantities of infectious virus in a short time frame. Fourth, assembly of HPV virus in yeast allows encapsidation of mutant genomes, since previous studies have shown that no viral ORF is required for replication of full-length HPV in yeast.

1. Introduction The advance represented by keratinocyte raft culture greatly improved our ability to study the molecular details of the human papillomavirus (HPV) life cycle. This technology has permitted analysis of replication of wild-type or mutant genomes within the appropriate biological context of a differentiating epithelium (1,2 and see Chapters 12–14). In further studies, Michelle Ozbun’s lab has succeeded in utilizing raft culturing as a means to produce significant quantities of infectious virus (3). However, impediments still remain in understanding certain aspects of the viral life cycle. In particular, the precise cis and trans packaging requirements of HPVs, the mechanistic details of virion attachment, uncoating, assembly, and egress are less well characterized in HPVs than in other viral systems. We also lack efficient technologies for encapsidating mutant genomes for use in infection studies, something that can From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

247

248

Angeletti

be achieved with a number of other viral systems. Previous studies have established that HPVs can replicate in yeast (4–6). Further developed methodologies are described here, which allow not only replication, but also the amplification and encapsidation of target HPV genomes in yeast. Previous work has established that L1-L2 pseudoviruses can be readily formed in yeast and that these are capable of encapsidating partial HPV genome constructs (7). These particles are capable of transduction of epithelial cells. The methods described here allow packaging of actively replicating, full-length HPV genomes, and the resultant pseudovirus particles are of authentic morphology. 2. Materials 2.1. DNA Cloning 1. Competent DH5α Escherichia coli (Invitrogen). 2. Plasmids containing full-length HPV (described in refs. 1 and 4). 3. Plasmids containing a yeast selectable marker and promoter, such as Ura3, Trp1, Leu2, or His3 (American Type Culture Collection [ATCC]). 4. Primers to amplify the yeast selectable markers and promoter and viral open reading frames (ORFs). 5. Taq polymerase and T4 DNA ligase for DNA manipulations (Promega). 6. Calf-intestine alkaline phosphatase (CIAP; Promega). 7. Restriction enzymes (New England Biolabs). 8. Luria-Bertani (LB) broth (Becton, Dickinson Co.). 9. Ampicillin. 10. Qiaquick kit (Qiagen). 11. Bacterial plasmid miniprep kit (Qiagen). 12. Agarose. 13. Plasmids for selective expression of viral ORFs, i.e., containing a galactoseinducible promoter (BD Biosciences or Invitrogen). 14. YPH500 or any yeast strain with suitable selectable markers (ATCC).

2.2. Transformation of Plasmids Into Yeast 1. Yeast selective and nonselective media (Becton, Dickinson Co.). 2. Frozen-EZ transformation kit (Zymo Research, Orange, CA).

2.3. DNA Isolation From Yeast 1. Yeast DNA isolation buffer: 10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 2% Triton X-100, and 1% sodium dodecyl sulfate (SDS). 2. Acid-washed glass beads (400 nm; Sigma). 3. Yeast miniprep kit (Zymo Research, Orange, CA). 4. Speed-vac (Savant).

Papillomaviruses in S. cerevisiae

249

2.4. DNA Replication Assays of Plasmids Recovered From Yeast 1. 2. 3. 4.

DpnI (New England Biolabs). Southern blot reagents (see Note 1). Rediprime DNA labeling kit (Amersham). Phosphorimager (Molecular Dynamics).

2.5. RNA Isolation From Yeast 1. 2. 3. 4.

DNase (RNase free; Promega). Buffer A: 50 mM sodium acetate (pH5.2), 10 mM EDTA, 1% SDS. Northern blot reagents. RNA markers, 0.28–6.58 kb (Promega).

2.6. HPV Pseudovirion Isolation From Yeast 1. Virion isolation solution 1: 1 M NaCl, 50 mM NaPO3 (pH 8.0). 2. Virion isolation solution 2: 50 mM NaCl, 50 mM NaPO3 (pH 7.4) (see Note 2). 3. Phenylmethylsulphonyl fluoride (PMSF) or protease inhibitor cocktail (Sigma)

2.7. Analysis of Encapsidation by DNase Treatment 1. DNase I (Promega). 2. DNase buffer: 100 mM NaCl, 10 mM MgCl2, 10 mM Tris-HCl (pH 7.9). 3. DNase stop buffer: 100 mM NaCl, 100 mM EDTA, 1% SDS, 20 mM Tris-HCl (pH 7.9).

3. Methods The methods described here outline (1) the construction of HPV genome vectors that are competent for replication in yeast, and vectors for expression of HPV ORFs, (2) analysis of episomal replication and trans-acting effects of E2 in yeast, and (3) assembly and isolation of HPV pseudoviruses from yeast.

3.1. HPV-Genome Constructs The construction of HPV-genome vectors for yeast is outlined below. The general approach is to insert a yeast nutritional marker, such as Ura3, Trp1, Leu2, or His3, into a location within the genome sequence, such that functions to be studied are not affected. In the example described here, Ura3 gene was placed between the L1 ORF and the LCR of HPV 16 or HPV 31 to create pPA103 and pPA106, respectively (Fig. 1A).

3.1.1. Cloning Methods Standard cloning methods are used to subclone a yeast nutritional marker into the HPV genome. They are described in outline here.

250

Angeletti

Fig. 1. Human papillomavirus (HPV)/yeast plasmid constructs and HPV ORF expression vectors. Each HPV genome construct contains a Ura3 nutritional marker placed in a convenient location in the genome. (A) The pPA103 vector, containing the HPV-16 genome, has the Ura3 cassette inserted into nt 7266 of the genome, between the L1 ORF and the LCR. The puc18 backbone can be excised by a BamHI digest. The pPA106 vector, which contains the HPV-31 genome, has the Ura3 cassette inserted into an SpeI site at nt 7559 of the genome, at the 5' end of the LCR. The pBR322 backbone can be excised by an EcoRI digest. (B) The pPD2-16E2 construct contains a Leu2 selectable marker. The pho5 promoter drives expression of HPV-16 E2 at moderate levels when uninduced. The pL1L2 plasmid contains a bidirectional galactoseinducible promoter, which drives expression of HPV-16 L1 and L2. 1. Locate a suitable cloning site within the HPV genome (see Note 3). 2. Design primers to amplify the chosen nutritional marker along with its constitutive promoter. Engineer appropriate restriction sites into the primers for the purpose of cloning the marker into the chosen restriction site in the HPV genome. 3. Polymerase chain reaction (PCR)-amplify the marker gene, ethanol-precipitate the DNA, and digest both the PCR product and the HPV DNA with the chosen restriction enzyme. 4. Phosphatase the vector DNA using CIAP for 30 min at 37°C in the provided buffer. 5. Gel-purify both DNAs using the Qiaquick kit.

Papillomaviruses in S. cerevisiae

251

6. Ligate DNAs in a molar ratio of 3:1, insert to vector for 2 h at room temperature, and transform into E. coli DH5α. 7. Screen colonies for clones that contain inserts by digestion of miniprep DNAs with the chosen restriction enzyme.

3.2. HPV-ORF Expression Vectors The pPD2-16E2 vector, diagramed in Fig. 1B, achieves E2 expression via a phosphate-dependent promoter (pho5). The pho5 promoter yields a low to moderate level of E2 expression in unmodified selective media, which is the desired level, since over-expression of E2 is known to lead to G2/M arrest in yeast (Schizosaccharomyces pombe) (8). The pPD2-16E2 plasmid also contains a yeast 2-µ origin, the Leu2 biosynthetic gene, a coli 1 origin, and an ampicillin marker. A complete description of the construction of this plasmid is given in (9). For expression of HPV-16 L1 and L2, a bidirectional galactoseinducible promoter was used; the vector is referred to here as pL1L2 (Fig. 1B). The L1 ORF was generated by PCR amplification from pEF399, which contains HPV 16 (W12E) (10). The L2 ORF was amplified from a codon-optimized version created by Leder et al. (11). 3.3. Yeast Strains A haploid yeast strain such as YPH500 (12) (MAT-α Ura3-52 lys2-801 ade2-101 trp1-63 his3-200 leu2-1) can be used. We have witnessed identical results of HPV replication with different yeast strains, such as HF7 (MAT-a, Ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3, 112, gal4-542, gal80538, LYS2::GAL-HIS3, URA3::(GAL4 17-mers)3-CYC1-lacZ; Clontech). Therefore, the choice of yeast strain is limited only by the availability of nutritional markers (see Note 4). 3.4. Transformation of Plasmids into Yeast Approximately 200 ng of plasmid DNA is used to transform YPH500 yeast. The method of greatest simplicity utilizes the Frozen-EZ transformation kit, and instructions are provided with the kit (see Note 5). Yeast transformations are plated on selective media and analyzed for colony formation after 3 d. An example of transformation results is shown in Fig. 2A. Note that colonies are formed only when the HPV-16 genome is present, and that Ura3 (puc18 Ura) itself is insufficient to allow colony formation. In most cases, sequential transformation is an effective method to create yeast strains containing multiple plasmids (see Notes 4 and 6). 3.5. DNA Isolation From Yeast 1. Inoculate yeast harboring HPV plasmids from an individual colony into a 5-mL liquid culture of nutritionally selective medium and grow at 30°C with vigorous shaking.

252

Angeletti

Fig. 2. Example of colony formation and episomal replication of HPVs in yeast. (A) Two-hundred ng of plasmid DNA, either a control plasmid (pPA104; puc18-Ura) or pPA103 (HPV16-Ura), was transformed into haploid YPH500 yeast. Yeast were plated on minimal media lacking uracil. Plates were incubated at 30°C for 3 d prior to analysis and quantification of colony formation. (B) Colonies that were capable of growth in the absence of uracil were grown in 5 mL liquid culture overnight, and DNA was isolated. Approximately 1 × 108 cell equivalents of DNA was loaded on to a 1% agarose gel and analyzed by Southern blot. Examples of episomal replication of pPA103 (HPV 16) and pPA106 (HPV 31) are shown on the left and right panels, respectively. The controls on the left of each blot represent the number of DNA copies per cell. OC = open-circular, SC = super-coiled. 2. Use the entire 5-mL culture to inoculate a 25-mL culture and grow to yield an OD600 over 1.0. Typically, 2–5 × 108 cells are harvested per 25-mL culture. 3. Pellet the cells by centrifugation in a table-top centrifuge at 2000g and resuspend them in 600 µL of yeast DNA lysis buffer. 4. Add 300 µL of 400-nm acid-washed glass beads. Add 600 µL of phenol and vortex the mixture for 1–2 min.

Papillomaviruses in S. cerevisiae

253

5. Recover the supernatant by brief centrifugation in a microfuge and transfer the supernatant to a new tube. Precipitate the DNA by addition of 2.5 vol of 100% ethanol and incubating at –20°C for at least 10 min. 6. Recover the DNA by centrifugation at 14,000g for 10 min at 4°C in a microfuge. 7. Wash the pellet with ice-cold 70% ethanol and dry it in a Speed-vac. Resuspend the DNA samples in ddH 2O at a concentration of 1–5 × 107 cell equivalents per µL (see Note 7). In yeast, HPV DNA is replicated at 1–5 copies per cell in the absence of E2 and 50 copies per cell in the presence of E2.

3.6. DNA Replication Assay of Plasmids Recovered From Yeast In order to determine whether HPV target genomes are replicating episomally, a Southern analysis should be performed. In many cases, it is desirable to demonstrate that the HPV plasmids have undergone complete replication in yeast. In order to achieve this, the DpnI resistance assay is utilized (1,13). In this assay, bacterially methylated DNA is digested by DpnI and thus is discernable from DNA replicated in eukaryotic cells, which is unmethylated at DpnI sites and therefore resistant to digestion (see Note 8).

3.6.1. Dpn I Resistance Assay 1. DpnI digest approx 1 × 108 cell equivalents of DNA isolated from yeast for 24 h at 37°C. Include 2 ng of a control bacterially synthesized DNA as a means to monitor the completeness of DpnI digestion. 2. Electrophorese DNAs on a 1% agarose gel along with copy number controls of the target plasmid, diluted to an appropriate concentration. 3. Transfer the DNAs to nitrocellulose using standard Southern blotting techniques (14). 4. Radiolabel the HPV DNA probe by use of a Rediprime kit, according to the manufacturer’s instructions. 5. Probe the blot with the appropriate radiolabeled HPV DNA and wash the blot according to standard Southern techniques (14). 6. Visualize and quantify the DNA by use of a PhosphorImager.

The example demonstrated in Fig. 2B shows evidence that each of the plasmids (pPA103 and pPA106) is capable of low-copy episomal replication in yeast, as indicated by the presence of supercoiled and open-circle DNA forms.

3.7. Modeling of HPV Trans-Acting Functions in Yeast For many reasons, efficient expression of viral ORFs in yeast in trans to the replicating genomes becomes desirable. The example given in this chapter is of the effects of E2 expression on replication and transcription of full-length HPV-16 genomes in yeast. In keratinocytes, E2 functions in replication, maintenance, and transcription of the viral genome (15,16). In yeast, moderate E2 expression causes a 10-fold induction of genome copy number and a concomitant induction of viral E6-E7 mRNA expression (Fig. 3, left and right panels),

254

Angeletti

Fig. 3. Trans-effects of E2 expression on the full-length HPV 16 in yeast; genome amplification and transcription from the viral genome. Yeast containing full-length HPV 16 (pPA103), either expressing HPV 16 E2 (pPD2-16E2) or not (pPD2), were subjected to Southern and Northern analysis to assay for E2-dependent DNA amplification and E6-E7 mRNA production, respectively. p∆Yac is included as a negative control in these experiments. Probes for each of the blots are indicated below. The markers to the right of the Northern blot (right panel) represent the nucleotide lengths of RNA markers.

which demonstrates the utility of this system. It is important to note that use of a relatively low expression-level promoter may be important to achieve the most biologically meaningful results (see Notes 9 and 10).

3.7.1. mRNA Isolation From Yeast Assessment of E2-dependent transcriptional effects necessitates use of a quantitative Northern analysis. A convenient method for isolation of total RNA from yeast is outlined as follows: 1. 2. 3. 4. 5.

Resuspend pelleted yeast (from a 5-mL overnight culture) in 300 µL of buffer A. Add 300 µL of phenol. Mix thoroughly and incubate at 65°C for 5 min. Vortex briefly. Centrifuge the mixture for 2 min at 14,000g in a microfuge.

Papillomaviruses in S. cerevisiae

255

6. Recover supernatant and extract with chloroform/isoamyl alcohol (24:1). 7. Centrifuge the mixture for 2 min at 14,000g in a microfuge. 8. Precipitate the RNA by addition of 0.1 volume sodium acetate and 2.5 volumes of ethanol, followed by incubation at –20°C for 10 min. 9. To pellet the RNA, microfuge the tube at 14,000g for 10 min at 4°C. 10. Dry the pellet in a Speed-vac, resuspend the pellet in RNase-free water, and treat with RNase-free DNase I.

After isolation, approx 1 × 108 cell-equivalents of RNA should be analyzed by standard Northern techniques as prescribed in the Current Protocols in Molecular Biology manual (14). The described procedure for analysis of viral mRNAs is simple; thus, expressions of multiple transcripts are easily tested simultaneously.

3.8. HPV Pseudovirion Isolation From Yeast The rationale for creation of the HPV/yeast system was to potentially use it as a means to create significant quantities of virus. Historically, papillomaviruses have proved difficult to propagate. The efficiency and rapidity of yeast culture methods allow recovery of approx 2.5 × 1010 yeast cells from a 250-mL culture grown in 24 h, which argues that production of infectious HPV in yeast could be made extremely efficient by use of this system. The virion isolation protocol was created by modification of the procedure described by M. Ozbun (3), with changes specific for isolation of virus from yeast.

3.8.1. Pseudovirion Isolation Procedure 1. Grow the yeast strain harboring the HPV genome, E2, and the Gal-inducible L1 and L2 expression plasmids on a plate under nutritional selection in the presence of dextrose at 30°C for 2 d, so that an individual colony can be easily picked. 2. Inoculate a 5-mL culture from a single colony with selective medium in the presence of dextrose and grow overnight at 30°C with vigorous shaking. 3. Centrifuge the overnight culture at approx 2000g for 5 min. Wash the pellet in selective medium with galactose. Inoculate the washed cell pellet into a 25-mL culture with selective medium and galactose and allow it to grow at 30°C with vigorous shaking for 2 d. The cells should be above an OD600 of 1.4 (see Note 11). 4. Centrifuge the yeast pellet in 50-mL Falcon tubes by low-speed centrifugation (2000g). 5. Resuspend the pellet in 1 to 2 mL of solution 1, transfer to a 2-mL tube, wash, and re-pellet the yeast. 6. Resuspend the yeast in 1.5 mL of solution 1. Add 200 µL of 400-nm glass beads and vortex for 2 min, then chill on ice for 1 min. Repeat vortexing and chilling four times (see Note 12). 7. Centrifuge the mixture at 8000g in a microfuge for 10 min at 4°C. Transfer the supernatant to an SW41 centrifuge tube and fill the remaining volume of the tube up completely with solution 1.

256

Angeletti

8. Centrifuge the supernatants at 130,000g for 1 h in an SW41 rotor in an ultracentrifuge. 9. Pour off the supernatant (discard as biohazard) and resuspend the pellet in 50 µL of solution 2; scrape the bottom of the tube thoroughly and transfer to a microfuge tube. 10. Mix the material thoroughly and centrifuge at 8000g in a microfuge for 10 min at 4°C. Transfer the supernatant to a new tube. This is the clarified virus extract (see Notes 2 and 13–15).

3.8.2. Analysis of Encapsidation by DNase Treatment In order to determine the efficiency of HPV encapsidation, pseudovirus produced in yeast is subjected to DNase I sensitivity analysis. Pseudoviruses that are complete should protect internalized DNAs from DNase I digestion. The protocol is as follows: 1. Incubate pseudovirus with 1 unit of DNase I in DNase buffer for 30 min at 37°C (1 unit of DNase I will digest 1 µg of DNA in 10 min at 37°C) in a convenient volume. Adjustment of the DNase I concentration may be necessary. 2. Add an equal volume of DNase stop buffer. 3. Phenol/chloroform extract and precipitate the DNA. 4. Analyze DNase-treated and non-DNase-treated virion samples by Southern analysis and quantify the number of DNase-resistant DNA-containing units by comparison of DNA amounts with control DNAs (see Note 16).

An example of electron micrographs of HPV pseudovirions produced from yeast is shown in Fig. 4. In this example, L1 and L2 were induced in the presence or absence of full-length HPV 16 (pPA103). Note that only in the presence of full-length HPV 16 is the negative stain excluded from the centers of pseudovirions and obvious projections on the surface. These properties suggest that pseudovirions produced by the described yeast method may be identical to authentic virions (see Notes 9 and 10). 4. Notes 1. In general, the techniques for Southern analysis of yeast DNA are the same as with any other source of DNA. One exception is that DNA preparations from yeast often have a pink, insoluble pigment that can affect gel loading and the electrophoretic migration of DNAs. This material reduces the clarity of the resulting Southern blots. A simple solution to this problem is to microfuge the DNA preparations at 14,000g for 5 min, recover the clarified supernatants, and use these to load onto a gel. 2. After isolation of pseudovirions, they can be analyzed immediately by Southern or Western blots or stored at 4°C. If the pseudovirions are to be stored, it is a good practice to include 1 mM PMSF or a protease-inhibitor cocktail to protect the pseudovirions from degradation.

Papillomaviruses in S. cerevisiae

257

Fig. 4. Virion assembly in yeast. Yeast containing pL1L2 and pPD2-16E2 or pL1L2 and pPD2-16E2 and pPA103 (lacking the puc18 vector) were induced to express L1 and L2 open reading frame an d allowed to grow for 1–2 d. Yeast were disrupted by vortex treatment with glass beads, and virus was recovered by differential centrifugation. Virus extracts were analyzed here by electron microscopy using the phosphotungstenate staining method. Each bar represents 100 nm. 3. An important consideration when designing the HPV/yeast vector is where to clone the nutritional marker. This depends upon the type of studies to be done. For the examples given in this chapter (pPA103 and pPA106; Fig. 1), cloning sites were chosen that did not disrupt any viral ORF, thus allowing the potential for appropriate gene expression to occur. Removal of the vector sequence prior to transformation into yeast leaves a minimum of foreign sequence (the marker) and allows the replication-competent genomes to be of packageable size. 4. It is also possible to mate yeast containing different plasmids, and this is often a very convenient and efficient method to create the desired strain. For this purpose, one needs only to choose a strain of the opposite mating type but genotypically identical in terms of the auxotrophic mutations. For example, YPH499 is Mat-a and YPH500 is Mat-α (12), but they are otherwise genotypically identical, and are therefore good candidates for mating (see Subheading 3.3. for genotype information). In the lab, we have found that diploid strains containing the multiple HPV plasmids described here appear to have even better stability characteristics than haploid strains. Details regarding standard yeast mating techniques can be found in the Current Protocols in Molecular Biology manual (14). 5. An alternate technique for transformation of plasmids into yeast is by means of the standard LiAc and PEG 8000 method, as described by Schiestl et al. (17). An important tip here is to use yeast that are actively dividing in mid-log phase for optimal transformation efficiency. 6. Previous results in our lab have demonstrated that HPV genomes replicate very stably in yeast (4), even in the presence of additional plasmids, such as those containing E2 (pPD2 16E2) and L1 and L2 ORFs (pL1L2). However, it is still advisable to create glycerol stocks of each yeast strain and begin each experi-

258

7.

8.

9.

10.

11. 12.

Angeletti ment with fresh, actively growing yeast directly from these glycerol stocks. This minimizes the chances of unwanted recombination, mutations, or changes in plasmid copy number from occurring. An alternative to the yeast DNA miniprep method described in Subheading 3.5. is to use the Zymoprep yeast miniprep kit made by Zymo Research (Orange, CA). Simple instructions are provided with this kit, and we found it to be efficient for DNA recovery. When performing viral DNA replication experiments, as shown in Fig. 2B, particular attention should be paid to whether episomal forms of circular plasmids are observable. By comparing samples to appropriate control plasmids, supercoiled and open-circle forms of plasmids can be identified. An important analysis here is to digest the genomes with a convenient single-cutting enzyme to generate a linear fragment. If an appropriate-sized linear form is not observed, then there is a high likelihood that integration of the plasmid into the yeast chromosomes has occurred. As discussed in the methods section, a useful proof of DNA replication is given by resistance to digest of the DNA by DpnI. Alternatively, MboI enzyme can be used in place of DpnI. MboI digestion occurs only on DNA unmethylated at MboI sites, as is the case with DNA replicated in bacteria. MboI sites are protected when methylated during DNA replication in mammalian cells. Use of a galactose-inducible promoter to express L1 and L2 allows better control of protein stoichiometry during the virus assembly experiments. Our experience in the lab indicates that over-expression of certain trans-factors such as E1, and to a far lesser extent E2, can lead to recombination of plasmids, and therefore should be carefully controlled. It is also important to note here that large differences in copy number between expression and target HPV plasmids can lead to recombination between the plasmids, although it may not always occur. Careful control of protein expression and plasmid copy number is important to the overall stability of the system. Furthermore, inducible control of L1 and L2 helps to mitigate some of the potential safety issues with HPV psuedovirion production in yeast. The addition of E2 in the virion encapsidation strain is likely to be important for at least two reasons. First, E2 expression induces a copy number increase up to approx 50 copies per cell, which is likely to increase the efficiency of encapsidation. Second, E2 may enhance packaging according to bovine papillomavirus (BPV) studies (18) and is known to interact with L2, the minor capsid protein (19). An OD600 reading at the point of harvest can be used to calculate the number of yeast cells (where OD600 of 1 is equal to approx 107 cells). Isolation of pseudovirions by means of vortexing yeast with glass beads is an efficient method. We noticed that it is important to take note of, and adhere to, vortexing conditions that yield the highest quality pseudovirion preparations. By electromagnetic analysis of different pseudovirus preparations, we noticed that there can be variability in the preparations in terms of the number of complete

Papillomaviruses in S. cerevisiae

13.

14.

15. 16.

259

and broken pseudoviruses. An alternative to using a vortex for harvesting pseudovirus is to use a Beadbeater (Biospec, Bartlesville, OK). Again, optimization of the treatment should be performed to define the best conditions. Further physical-chemical analysis of HPV pseudovirions is important and can be achieved by performing a CsCl gradient (7) on the virus extract. This approach allows a determination of pseudovirus density shift because of the presence of encapsidated HPV DNA genomes. The efficiency of recovery of packaged genomes is approx 3 × 107 DNase-resistant DNA-containing units (DCUs) isolated from approx 2 × 108 cells in a 25-mL culture (from yeast containing 50 copies per cell of the HPV genome). This results in approx 1 DCU per seven yeast cells. A step to allow maturation of virions isolated from yeast can be included by simply incubating the virions in buffer 2 at 37°C for 24 h. DNase-resistant DNAs from HPV capsids can be recovered and the relative number of colony-forming units can be measured by transforming them into DH5α. The encapsidated plasmids can then be identified by gel analysis.

Acknowledgments I would like to thank: Paul F. Lambert (UW-Madison) for his support, important discussions, and contributions, which made the HPV/yeast system possible; Kitai Kim, who created and analyzed several HPV/yeast constructs; Valery Grdzelishvili, who created the pL1L2 expression vector. I wish to acknowledge support received through the Nebraska Center for Virology COBRE grant (5P20RR015635) from NCRR. Part of the development of the HPV/yeast was also supported by the Howard Temin career award (5K01CA100736) to P. C. A. References 1. Flores, E. R., Allen-Hoffmann, B. L., Lee, D., Sattler, C. A., and Lambert, P. F. (1999) Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line. Virology 262, 344–354. 2. McCance, D. J., Kopan, R., Fuchs, E., and Laimins, L. A. (1988) Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc. Natl. Acad. Sci. USA 85, 7169–7173. 3. Ozbun, M. A. (2002) Infectious human papillomavirus type 31b: purification and infection of an immortalized human keratinocyte cell line. J. Gen. Virol. 83, 2753–2763. 4. Angeletti, P. C., Kim, K., Fernandes, F. J., and Lambert, P. F. (2002) Stable replication of papillomavirus genomes in Saccharomyces cerevisiae. J. Virol. 76, 3350–3358. 5. Kim, K., Angeletti, P. C., Hassebroek, E. C., and Lambert, P. F. (2004) Identification of Cis-acting elements that mediate the replication and maintenance of human papillomavirus type 16 genomes in Saccharomyces cerevisiae. J. Virol., submitted.

260

Angeletti

6. Zhao, K. N. and Frazer, I. H. (2002) Replication of bovine papillomavirus type 1 (BPV-1) DNA in Saccharomyces cerevisiae following infection with BPV-1 virions. J. Virol. 76, 3359–3364. 7. Rossi, J. L., Gissmann, L., Jansen, K., and Muller, M. (2000) Assembly of human papillomavirus type 16 pseudovirions in Saccharomyces cerevisiae. Hum. Gene Ther. 11, 1165–1176. 8. Fournier, N., Raj, K., Saudan, P., et al. (1999) Expression of human papillomavirus 16 E2 protein in Schizosaccharomyces pombe delays the initiation of mitosis. Oncogene 18, 4015–4021. 9. Lambert, P. F., Dostatni, N., McBride, A. A., Yaniv, M., Howley, P. M., and Arcangioli, B. (1989) Functional analysis of the papilloma virus E2 trans-activator in Saccharomyces cerevisiae. Genes Dev. 3, 38–48. 10. Flores, E. R. and Lambert, P. F. (1997) Evidence for a switch in the mode of human papillomavirus type 16 DNA replication during the viral life cycle. J. Virol. 71, 7167–7179. 11. Leder, C., Kleinschmidt, J. A., Wiethe, C., and Muller, M. (2001) Enhancement of capsid gene expression: preparing the human papillomavirus type 16 major structural gene L1 for DNA vaccination purposes. J. Virol. 75, 9201–9209. 12. Sikorski, R. S. and Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27. 13. Krysan, P. J., Haase, S. B., and Calos, M. P. (1989) Isolation of human sequences that replicate autonomously in human cells. Mol. Cell Biol. 9, 1026–1033. 14. Ausubell, F. M., Brent, R., Kingston, R. E., et al. (1995) Current Protocols in Molecular Biology, John Wiley and Sons Inc., New York, NY. 15. Piirsoo, M., Ustav, E., Mandel, T., Stenlund, A., and Ustav, M. (1996) Cis and trans requirements for stable episomal maintenance of the BPV-1 replicator. EMBO J. 15, 1–11. 16. Skiadopoulos, M. H. and McBride, A. A. (1998) Bovine papillomavirus type 1 genomes and the E2 transactivator protein are closely associated with mitotic chromatin. J. Virol. 72, 2079–2088. 17. Schiestl, R. H., Dominska, M., and Petes, T. D. (1993) Transformation of Saccharomyces cerevisiae with nonhomologous DNA: illegitimate integration of transforming DNA into yeast chromosomes and in vivo ligation of transforming DNA to mitochondrial DNA sequences. Mol. Cell Biol. 13, 2697–2705. 18. Zhao, K. N., Hengst, K., Liu, W. J., et al. (2000) BPV1 E2 protein enhances packaging of full-length plasmid DNA in BPV1 pseudovirions. Virology 272, 382–393. 19. Heino, P., Zhou, J., and Lambert, P. F. (2000) Interaction of the papillomavirus transcription/replication factor, E2, and the viral capsid protein, L2. Virology 276, 304–314.

Regulation of Viral Transcription

261

20 Analysis of the Regulation of Viral Transcription Bernd Gloss, Mina Kalantari, and Hans-Ulrich Bernard Summary Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection (“footprinting”) for location of transcription-factor binding sites, electrophoretic mobility shifts (“gelshifts”) for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

1. Introduction Human papillomavirus (HPV) genomes have double-stranded DNA. As in all organisms and DNA viruses, the two mechanisms of transcription and translation lead to expression of HPV genes into proteins, which regulate the viral life cycle and the pathogenic consequences of HPV infections. Transcription and translation are modulated in complicated ways to bring about the idiosyncrasies of HPV biology. Among these two processes, most regulatory events occur at the level of transcription. The study of HPV transcription led to the finding of many fascinating features of HPV biology, some of which are incompletely understood. These mechanisms include epithelial specificity of transcription (the reason for the viral epithelial tropism), regulation of transcription during the differentiation of the stratified epithelium, negative feedback loops, and epigenetic regulation by chromatin and DNA methylation (1). The study of the regulation of transcription is a very large field of research, and the discussion of all relevant experimental protocols would fill a whole book on its own. Also, nearly all techniques useful to study HPV transcription From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

261

262

Gloss, Kalantari, and Bernard

have been developed in the study of cellular genes or genes of other viruses, and were subsequently adapted to the study of HPV genes. For these two reasons it would be inappropriate to deal with each of these techniques here in detail. Instead of doing this, we will discuss strategic considerations that are specific for the study of HPV transcription, and we will provide a list of techniques that have been used successfully in HPV transcription research and cite important references from within and outside the HPV field for reference. We describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of HPV transcription, namely, DNAse I protection (“footprinting”) for location of transcription factor binding sites, electrophoretic mobility shifts (“gelshifts”) for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

1.1. Strategies: General Considerations Transcriptional research amounts to the study of cis-responsive elements on the HPV DNA and cellular and viral proteins binding them, that together determine how frequently and efficiently a viral gene is expressed. Cis-responsive elements occur throughout the HPV genome, but are concentrated in the long control region (LCR, also called upstream regulatory region, URR), a genomic segment without genes, positioned between L1 and E6, covering roughly 10% of the viral genome (1). Proteins that act on HPV DNA include viral proteins, in particular E2, numerous different activating and repressing cellular transcription factors, the histones that comprise nucleosomes, and the proteins that alter nucleosome conformation. The following is a discussion on how to choose the right methods and protocols to dissect these multifaceted phenomena.

1.2. HPV Transcription in Its Natural Cellular Environment The objective of all HPV transcription research is to measure—or make inferences about—HPV transcription during natural infections. The techniques to adhere to this objective are limited for the following reason: specific HPV types, for example, HPV 16, create lesions restricted to certain anatomic sites. In the case of HPV 16, these are cervical intraepithelial neoplasia and cancer of the cervix, which are derived from cell populations of the transformation zone between the columnar epithelium of the endocervix and the squamous epithelium of the ectocervix. The fact that HPV-16 lesions most frequently occur at this site does not necessarily mean that these host cells are typical of cells where HPV 16 undergoes a normal life cycle. For example, it is known that this virus infects stratified mucosal epithelia of the vagina and stratified cutaneous epithelia of the penis. At these two sites, HPV 16 most often does not induce lesions, but nevertheless creates infected cell populations that generate

Regulation of Viral Transcription

263

and spread viral particles. As a consequence, typical HPV-16 transcriptional biology may take place in cells that are pathologically of little relevance and rarely studied as HPV-16 host cells. Two approaches have been used to overcome part of this problem in HPV transcription research: (1) some cell lines, like CIN 612E, were derived from cervical lesions with HPV genomes and can be grown in raft culture, where they exhibit stratification and differential gene expression as they do in a mucosal epithelium of the ectocervix (2); and (2) primary keratinocytes from foreskin can be transfected with HPV DNA and subsequently grown in raft culture (see Chapters 12–14), where they also stratify into a cell population resembling a natural HPV transcription environment similar to the cellular context in male patients (3). As an additional source of information on HPV transcription, qualitative data have been generated by in situ hybridization with natural HPV-infected tissues (4).

1.3. HPV Transcription in Transfected Cell Cultures Elements with transcription regulation function can be detected and mapped after transfection of whole HPV genomes or chimeric clones composed of segments of HPV genomes and reporter genes. These investigations based on transfection experiments have most often been done in cell lines that were either transformed in vitro or derived from cervical cancers. HaCat cells, derived from a cutaneous epithelium, are typical representatives of the first group, while SiHa, CaSki, and HeLa belong to the second group (5). The latter three cell lines contain endogenous, chromosomally recombined HPV-16 (SiHa, Caski) or HPV-18 (HeLa) genomes, and express the E6 and E7 oncoproteins, but not the HPV E2 transcription factor. There have been warnings that these cell lines should be used with caution, as the HPV gene products may alter the expression of transfected HPV reporter constructs, but no data have ever been published to substantiate this assumption. Published data have shown that there are very divergent experimental outcomes of transcription studies, both among these four cell lines and between these cells and raft cultures, likely resulting from different levels of activating and repressing transcription factors (5). Because of this, the inter-laboratory comparison of data obtained with different host cells is often inappropriate. In addition, since HPV transcription is specific for epithelial cells, experiments with many commonly used nonepithelial cell lines, such as fibroblasts, have to be avoided completely.

1.4. Promoter Identification An initial goal of transcription research is to detect the object of transcriptional regulation, the start site of mRNAs. The three methods of choice to detect

264

Gloss, Kalantari, and Bernard

5' ends of transcripts are primer extension, RNAase protection (6), and determination of the 5' ends of clones in cDNA libraries (7). DNA sequences surrounding such transcription start points normally have promoter function and have to be tested for this function by transfection experiments or by in vitro transcription. The most frequently investigated promoter of genital HPVs is the E6 promoter, p97 in HPV 16, which has well-studied homologs in HPV 6, 11, 18, and 31 (7). E6 promoters have characteristic elements, namely one Sp1 and two E2 binding sites, and a TATA box (8). Another promoter in E7 is a likely late promoter (7,9), and yet another promoter within E6 is specific for HPV 6 and 11 (10), and is required for E7 expression.

1.5. HPV Cis-Responsive Elements in Reporter Vectors In order to identify regulatory elements on HPV genomes that are part of promoters or that act on promoters, an essential strategy is to dissect the LCR (or other parts of the HPV genome) into short segments, typically with sizes of 50–800 bp. The functions of these segments can be investigated in vectors with reporter genes that allow measurement of the effects of promoters, enhancers, or silencers in transfected cell cultures. Such a study of cis-responsive elements of HPVs strongly depends on the precise location of the genomic segment, and even slight changes can lead to contradictory data. The present literature suggests that the E6 promoter of genital HPVs, transfected in appropriate recipient cell lines like HeLa, has strength comparable to that of the early promoter of SV40. Just as the SV40 promoter is stimulated by the SV40 enhancer, the activity of the HPV E6 promoter is increased by factors ranging from 10- to 1000-fold, when cloned together with epithelial specific enhancer of HPVs, a 400-bp segment centered 350 bp 5' of the transcription start site. The combined system approaches strengths similar to those of the frequently used SV40 enhancer-promoter or the cytomegalovirus enhancerpromoter systems (5). The study of the exact function of HPV enhancer-promoter elements has been confounded by at least three properties: (1) a “silencer,” regulated by the repressors CDP and YY1, is located between the enhancer and the promoter, and as a consequence, contiguous viral genomic segments are much less active than chimeric enhancer-promoter clones, particularly in cells that contain a high concentration of the repressors CDP and YY1 (5,11); (2) regulatory elements exist outside the enhancer-silencer-promoter segment, e.g., in the 5' part of the LCR (12), and further modify transcriptional responses; and (3) deletion mutants have been created in search of the decisive epithelial-specific elements, and this research led to the concept of a “core enhancer” (13). Most likely,

Regulation of Viral Transcription

265

epithelial specificity is divided among many factors and many cis-responsive elements, and the concept of a “core enhancer” is probably not useful.

1.6. Binding Sites for Transcription Factors Once the general position of functional elements on HPV genomes has been determined by subcloning and transfection experiments, a detailed transcription factor binding map can be obtained by the DNAase footprinting technique (see ref. 14 and Subheading 3.1.). The exact nucleotide sequence recognition properties of transcription factors are identified by electrophoretic mobility shift assays (EMSAs, “gelshifts”) with wild-type and mutant oligonucleotides that represent the HPV sequences covered by footprints. The gelshifts that are obtained can be compared with those of oligonucleotides representing sequence elements bound by factors in other well-characterized cellular and viral genes, and seem to be similar to elements found in HPV genomes. The sequence specificity of transcription factors giving rise to gelshifts is further confirmed by EMSA competition experiments, which aim to measure whether an HPV-specific gelshift is maintained or eliminated under the influence of oligonucleotides representing known sites. Yet another technique, the analysis of “supershifts,” tests the recognition of a transcription factor by a specific antibody, by measuring the reduced migration of a gelshift in the presence of the antibody.

1.7. Epigenetic Regulation In the last few years, it has become clear that HPV transcription is not only regulated by cis-responsive elements and sequence-specific transcription factors, but also by the chromatin, i.e., the nucleosomes, that form on HPV DNA. Nucleosomes can become specifically positioned across HPV enhancers and promoters, as determined by methods such as the analysis of DNAse-hypersensitive sites and nucleosomal footprinting (15). Nucleosomes can have conformations permitting or antagonizing transcription, mediated by histone acetylation and deacetylation, as tested by the response to trichostatin A. Histone deacetylation is also under the influence of DNA methylation, which is commonly found on HPV genomes. DNA methylation can be measured with certain restriction enzymes and by bisulfite sequencing (16), and functional consequences can be monitored by response to azacytidine.

1.8. Regulatory Mechanisms Beyond Transcription Initiation The availability of HPV mRNAs for translation into proteins can be regulated, in addition to the frequency of transcription initiation, by regulation of

266

Gloss, Kalantari, and Bernard

transcription termination, differential splicing of the primary transcript, and mRNA stability.

1.9. Selected Approaches to Study HPV Transcription It was the goal of this introduction to explain the rationale for how about 20 different methods and protocols can be combined to analyze HPV transcription. In the following, we will concentrate on three selected techniques— footprinting, EMSA, and bisulfite sequencing, which are particularly powerful and frequently used in these studies (see also Chapter 21 for related methods to analyze HPV transcription using the ribonuclease protection assay). 2. Materials 2.1. DNase I Footprinting 1. Plasmids containing a promoter region of interest (see Note 1) purified by commercially available Maxi- or Midiprep Kits. 2. 10X Klenow-polymerase reaction buffer: 70 mM Tris-HCl (pH 7.5), 70 mM MgCl2, 1 mM ethylenediamine tetraacetic acid (EDTA), 50 mM β-mercaptoethanol. 3. 10X T4 polynucleotide kinase reaction buffer: 500 mM Tris-HCl (pH 7.4), 100 mM MgCl2, 50 mM dithiothreitol (DTT), 1 mM spermidine, 1 mM EDTA. 4. [α-32P]dATP or [α-32P] dCTP (3000 Ci/mmol) or [γ-32P] ATP (8000 Ci/mmol). 5. Deoxyribonucleotides: dATP, dCTP, dGTP, and dTTP, each at 20 mM. 6. T4 polynucleotide kinase or Klenow fragment of DNA polymerase I. 7. SMK mix: 12 mM spermidine, 12 mM MgCl2, 120 mM KCl. 8. Nonspecific competitor DNA: 50 mg/mL poly[dI-dC] in 1X TE (10 mM TrisHCl (pH 7.5), 1 mM EDTA). 9. Buffer D: 20 mM HEPES-KOH (pH 7.9), 2% glycerol, 20 mM KCl, 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT. 10. 1X TE (10 mM Tris-HCl [pH 7.5], 1 mM EDTA). 11. Nuclear extracts: Either commercially bought or prepared from HeLa cells according to the procedure described by Dignam et al. (17) and modified by Wildeman et al. (18). 11. DNase I mix (see Note 2): 17.14 mM MgCl2, 238 µg/mL calf thymus DNA, 70,290 µg/mL DNase I. 12. DNase I stop mix: 400 mM sodium acetate, 30mM EDTA, 270 µg/mL t-RNA (Sigma). 13. 2% Formic acid. 14. Piperidine. 15. Sequencing gel-loading buffer: 96% deionized formamide, 0.05% xylene cyanol, 0.05% bromophenol blue, 10 mM EDTA, 5 mM NaOH. 16. Tris-acetate buffer: 40 mM Tris-base, 5 mM sodium acetate, 1 mM EDTA. The pH is adjusted with glacial acetic acid to 7.8.

Regulation of Viral Transcription 17. 18. 19. 20. 21.

267

Chloroform/phenol: 50/50 (v/v) mixture. Ethanol (100%). Sodium acetate: 3 M solution. Liquid nitrogen. Speedvac system for drying samples under mild centrifugation and vacuum.

2.2. Electrophoretic Mobility Shift Assay (EMSA) 1. Complementary oligonucleotides: Mostly spanning the nucleotide sequence of a footprint region (see Note 3). 2. Klenow, T4-Kinase, deoxyribonucleotides, SMK-Mix, TE, buffer D, and nuclear extracts are the same as described in the footprint materials. 3. Nonspecific competitor DNA: 500 mg/mL poly[dI-dC] in 1X TE (10 mM Tris HCl [pH 7.5], 1 mM EDTA). 4. 30% Acrylamide/bis-acrylamide mixture 60:1 in water, deionized and filtered. 5. 5X Tris-glycine buffer: 50 mM Tris-base, 380 mM glycine, 2 mM EDTA. 6. 6X Loading buffer: 0.25% bromophenol blue, 0.25% xylene-cyanol, 15% Ficoll type 400 (Sigma) in water. 7. 10% Ammonium persulfate in water (see Note 4). 8. N,N,N',N'-tetramethyl-ethylenediamine (TEMED). 9. 50 mM NaCl. 10. [α-32P] dCTP (3000 Ci/mmol). 11. [γ-32P] ATP (8000 Ci/mmol). 12. 0.5 µg/mL Ethidium bromide. 13. poly[dI-dC] (0.5 mg/mL).

2.3. Bisulfite Sequencing 1. 3 M NaOH: add water to 0.6 g NaOH pellets to a final volume of 5 mL (freshly prepared). 2. 4.8 M Sodium bisulfite: add water to 2.5 g sodium bisulfite to a final volume of 5 mL (vortex and heat at 65°C to dissolve) and 400 µL of 3 M NaOH to adjust to pH 5.0 (freshly prepared). 3. 100 mM Hydroquinone: add 1 mL water to 0.01 g hydroquinine (freshly prepared). 4. QIAquick polymerase chain reaction (PCR) purification kit (Qiagen). 5. 2% LMP (low melting point) agarose: 1 g SeaPlaque GTG agarose (Cambrex Bioscience, Rockland, ME) suspended in 50 mL water (heat in microwave oven to dissolve). 6. Mineral oil: store a 50-mL aliquot covered in foil to protect from light, at 4°C. 7. TE: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA. 8. Sodium acetate: 3 M, pH 5.0. 9. Highly purified (i.e., protein-free) genomic DNA. 10. Restriction enzyme that cuts close to but outside the region of interest. 11. 100% Ethanol.

268

Gloss, Kalantari, and Bernard

3. Methods 3.1. DNase I Footprinting

3.1.1. Asymmetric Labeling of a DNA Fragment All handling and manipulation of the 32P reagents should be performed behind a protective shield that blocks all β particles. The DNA fragment can be labeled using either Klenow or T4 kinase. Klenow will label the lower, noncoding strand, whereas T4 Kinase will label the upper, coding strand. 1. In a total volume of 40 µL, digest 5 µg of a plasmid containing a region that is to be analyzed by DNase I footprinting. A restriction enzyme should be selected that cuts a unique restriction site either 5' or 3' of the fragment and leaves 5'-overhanging single-stranded ends after the restriction cut. For example, EcoRI, HindIII, BamHI, or SalI are suitable enzymes. Depending on the restriction buffer compatibility with the reaction conditions for the Klenow polymerase or T4 kinase, the labeling reaction can be carried out directly with a quarter of this reaction. Otherwise, the DNA should be precipitated after the addition of 2.5 volumes of ethanol and a final concentration of 300 mM sodium acetate. 2. After spinning, washing, and air-drying, dissolve the pelleted DNA in 40 µL water. 3. The Klenow labeling reaction should contain 10 µL of a solution of the DNA fragment, 2 µL of 10X Klenow-polymerase reaction buffer, 2 µL of a mixture of dATP, dTTP, dGTP at 2 mM each, 5 µL of [α-32P]dCTP (3000 Ci/mmol), and 1 µL of Klenow DNA polymerase (5 U). 4. The kinase labeling reaction should contain 10 µL of DNA fragment, 2 µL 10X T4 polynucleotide kinase reaction buffer, 5 µL [γ-32P]ATP (8000 Ci/mmol), 1 µL T4 polynucleotide kinase (5 U), and 2 µL water. 5. Incubate either labeling reaction at 37°C for 20 min, and in the case of the Klenow reaction, add 1 µL of a mixture of all four dNTPs at 2 mM each and continue the incubation for 10 min (see Note 5). 6. Add 80 µL 1X TE and 100 µL phenol-chloroform. After mixing carefully and spinning at 12,000g in a microcentrifuge for 5 min, transfer the aqueous phase to a new tube and precipitate the DNA by adding 0.1 vol of 3 M sodium acetate and 2.5 vol ethanol. Incubation at –20°C for 30 min is sufficient to precipitate the labeled DNA. 7. Collect the precipitate by centrifugation at 12,000g for 15 min at 4°C and wash by dissolving, re-precipitating, and centrifuging at 12,000g for 5 min at room temperature. 8. After briefly drying at room temperature, dissolve the pellet in 89 µL water, and add 10 µL 10X restriction enzyme buffer. Then add 1 µL of a restriction enzyme that cuts at a distance of 200 to 1000 bp from the radiolabeled end of the fragment (see Note 6). Incubate this restriction digest for 1 h at 37°C and treat as described above (labeling reaction) with phenol-chloroform and precipitation. 9. Dissolve the washed, dried pellet in 20 µL water and add 4 µL 6X loading buffer. Load this sample on a 1% agarose gel in Tris-acetate buffer containing

Regulation of Viral Transcription

269

0.5 µg/mL ethidium bromide. After the labeled fragment has electrophoretically separated from the vector and any unlabeled fragments, excise it from the gel under long wave (312 nm) ultraviolet (UV) illumination, mince the material into small pieces, and apply on top of an aerosol pipet tip that has been cut off at the bottom to yield a beveled tip and to fit into a 1.5-mL tube. Spin this assembly at 4000g for 5 min. 10. The eluate from the gel contains the asymmetrically labeled DNA fragment, which is then precipitated by addition of 0.1 volumes of 3 M sodium acetate and 2.5 vol of ethanol. 11. The dried pellet can be counted in a beta scintillation counter (Cerenkov counting) followed by the addition of 1X TE so that a specific activity of 5000–8000 counts per minute (cpm) per microliter is achieved.

3.1.2. DNase I Footprinting Reaction 1. Fill 1.5-mL tubes with 2 µL poly[dI-dC] (0.5 mg/mL), 3 µL SMK mix, and 5 µL nuclear protein extracts or buffer D. Leave on ice for 15 min. Add 3 µL labeled fragment (samples without protein) or 1 µL to tubes containing nuclear protein. Leave on ice for 15 min. 2. Place into a 25°C heat block and add 2 µL appropriate DNase I mix for 1–2 min (see Note 2). Stop reaction with 75 µL DNase I stop mix, vortex, and snap freeze in liquid nitrogen. 3. After thawing of the samples on ice, add 100 µL phenol-chloroform, mix well, spin for 10 min at 12,000g at 4°C, and transfer aqueous phase into a new 1.5-mL tube. 4. Add 40 µL 1X TE to the phenol-chloroform phases and vortex again, then spin at room temperature for 3 min at 12,000g; remove aqueous phase and combine with the previous aqueous phase that was kept on ice. 5. Precipitate the DNA fragments by addition of 200 µL ethanol and incubation at –20°C for 30 min. Spin at 4°C for 15 min at 12,000g, remove supernatant carefully, and add 180 µL of 80% ethanol to wash the pellet by spinning for 2 min at 12,000g at room temperature. 6. Count dry pellet in β counter (Cerenkov counting). 7. Dissolve pellet in sequencing gel-loading buffer so that all samples have the same Cerenkov cpm/µL. Three milliliters is the minimum volume to use (for the sample with the lowest counts). Vortex thoroughly, spin down, and incubate at 95°C for 3 min. 8. Chill the samples in ice-water and load immediately 3 µL of each sample on a 6% or 8% standard sequencing gel together with 3 µL marker A+G sample (see Subheading 3.1.3.) either preceding or following the footprint samples. 9. After running the gel until the bromophenol blue dye runs off the gel, transfer gel to Whatman 3MM paper, cover with plastic wrap, and dry on a heated vacuum gel-dryer. Expose the dry gel on the Whatman 3MM paper to X-ray film overnight at –80°C.

A schematic drawing shown in Fig. 1 illustrates the origin of the various bands that can be seen by autoradiography. Figure 2 shows an actual X-ray

270

Gloss, Kalantari, and Bernard

Fig. 1. Schematic drawing of a DNase I footprinting result. The upper part of the figure shows an asymmetrically labeled DNA fragment (indicated by the two adenosines in bold lettering) that is occupied by two proteins, labeled AP-1 and NF-1. Partial, random cleavage by DNase I is outlined below with the arrows indicating cuts of the lower and upper DNA strand. Vertical lines without arrow indicate DNase I cuts on naked DNA. The radiolabeled fragments that occur after denaturation with occupied DNA (thick lines) and unoccupied DNA (fine and thick lines) are listed. On the right side of the figure a cartoon of an autoradiography of a footprint gel shows the appearance and origin of the various bands after partial DNase I digestion of occupied (here indicated with nuclear extracts from HeLa cells) and unoccupied (-) DNA. A+G indicates a lane with fragments from a partial cleavage with piperidine at adenine and guanine residues after formic acid treatment. This lane serves as a sequence marker lane.

Regulation of Viral Transcription

271

Fig. 2. Autoradiography of a DNase I footprinting gel. The bands in lanes 1–4 originate from a radiolabeled fragment that contained human papillomavirus (HPV)16 enhancer sequences from position 7661 to position 7723 and thymidine kinase (TK) promoter sequences. A+G indicates a partial cleavage of this fragment at adenine and guanine residues (lane 1). Lane 2—designated “-”—shows a partial DNase I digestion of the unoccupied DNA fragment, and lanes 3, 4—designated with “+”—show partial DNase I digestion of the DNA fragment occupied by proteins from HeLa cell nuclear extracts. The region bracketed and indicated fp5e is a low-affinity interaction binding site for the nuclear factor 1 (NF-1) containing the core motif “TTGGC.” The region designated fp6e appears to be a high-affinity interaction site for NF-1, also containing the core motif “TTGGC.” Other “DNase I footprints” can be detected in the region of the TK promoter. Note that the regions between protein interaction sites are often hypersensitive to DNase I cleavage in the occupied DNA fragment. This is an unpublished gel generated during the research that led to reference (14).

272

Gloss, Kalantari, and Bernard

film exposure of a sequencing gel loaded with footprinting samples from a fragment of the LCR of HPV 16.

3.1.3. Marker A+G Sample Preparation (Maxam and Gilbert Method) 1. Dispense the equivalent of approx 50,000 cpm asymmetrically labeled DNA fragment into a 1.5-mL tube, add 1 µg of calf-thymus DNA, and dry in a SpeedVac. 2. Add 4 µL of 2% formic acid to the dried nucleic acids, vortex briefly, spin 2 s, and transfer the sample to a 37°C water bath for 5 min. 3. Transfer the sample to a SpeedVac and evaporate for at least 2 h. 4. Add 90 µL of water, vortex thoroughly, and add 10 µL of piperidine. Seal lid of the 1.5-mL tube with a clip and incubate the sample at 95°C for 30 min. 5. Transfer to a SpeedVac and evaporate until completely dry. 6. Add 100 µL 1X TE, vortex to dissolve dried materials, and transfer to a new 1.5-mL tube (see Note 7). Add 10 µL of 3 M sodium acetate and 250 µL of ethanol. Incubate for 30 min at –20°C and spin at 12,000g for 15 min at 4°C. 7. Wash the pellet with 80% ethanol and spin for 2 min at 12,000g at room temperature. 8. Count the dried pellet (Cerenkov counts) and dissolve in sequencing gel loading buffer at a specific activity of 1000 cpm/µL.

3.2. Electrophoretic Mobility Shift Assay (EMSA) 3.2.1. Labeling of the Annealed Double-Stranded Oligonucleotide 1. Anneal 10 µg of each oligonucleotide in 200 µL 1X TE, 50 mM NaCl by heating to 95°C in a beaker containing 1 L of water, then allowing it to cool to room temperature overnight. 2. The Klenow labeling reaction: 5 µL of annealed oligo, 2 µL of 10X Klenowpolymerase reaction buffer, 2 µL of a mixture of dATP, dTTP, dGTP at 2 mM each, 5 µL of [α-32P] dCTP (3000 Ci/mmol), 1 µL of Klenow DNA polymerase (5 U), and 5 µL of water. 3. The kinase labeling reaction: 5 µL of annealed oligo, 2 µL of 10X T4 polynucleotide kinase reaction buffer, 5 µL of [γ-32P] ATP (8,000 Ci/mmol), 1 µL of T4 polynucleotide kinase (5 U), and 7 µL of water. 4. Incubate the labeling reactions at 37°C for 30 min. 5. Add 4 µL 6X loading buffer and load the samples on a 2% agarose gel in Trisacetate buffer containing 0.5 µg/mL ethidium bromide. After electrophoresis, the labeled oligonucleotide can be visualized by long-wave UV (312 nm) and excised from the gel and recovered as described above for the labeled footprint DNA fragment.

3.2.2. Protein/DNA Complex Assembly and Separation on an Acrylamide Gel 1. Add to 1.5-mL tubes 2 µL poly[dI-dC] (0.5mg/mL) (see Note 8), 3 µL SMK mix, 1 µL nuclear protein extracts, and 4 µL buffer D. Leave on ice for 15 min.

Regulation of Viral Transcription

273

2. Add 2 µL labeled oligo (5000 cpm). Leave on ice for another 15 min. 3. Add 2 µL 6X loading buffer and load the samples on a 5% polyacrylamide gel (60:1 acrylamide/bisacrylamide) in 1X Tris-glycine buffer. The gel should be pre-run for approx 1 h at 140 V or until the current has dropped to 12 mA at 140 V (gel dimensions are 15 × 16 × 0.015 cm). Run the samples on the gel at room temperature until the bromophenol blue dye has reached the middle of the gel. 4. Separate the glass plates and soak the glass plate with the gel for 5 min in 10% acetic acid, 5% methanol. 5. Transfer the gel to Whatman 3MM paper, cover it with plastic wrap, dry on a heated vacuum gel-dryer, and expose to X-ray film overnight at –80°C.

3.3. Bisulfite Sequencing for Identifying Methylated Cytosine Residues The expression bisulfite sequencing stands for bisulfite-dependent conversion of cytosine residues into uracil, followed by PCR amplification and either direct sequencing of the amplification product or sequencing of plasmid clones of the amplicon. The method was developed by Frommer et al. (19), technically refined by Clark and colleagues (20), and has been employed for HPV research (16,21). DNA methylation is an indicator of likely chromatin changes, which reduce the efficiency of transcription. Bisulfite sequencing allows the precise mapping of methyl cytosines, as, in the resulting sequencing output, methylated cytosines score as cytosines, while unmethylated cytosines score as thymine residues. This method requires a smaller amount of genomic DNA compared to techniques involving restriction enzyme digestion, and is therefore useful for the analysis of clinical samples, where the amount contained in a sample is often limited.

3.3.1. Primer Design Primer design is critical in bisulfite-based methylation analysis, because (1) the complexity of DNA is reduced, (2) most cytosines outside of CpG dinucleotides, but also some in CpGs, have been converted to Ts, and (3) the two strands of the DNA have lost their complementarity. DNA becomes degraded during bisulfite modification, and 90–99% of the target DNA may be lost. To compensate for that, one should attempt to analyze only small (maximally 300 bp) amplicons.

3.3.2. Liquid Bisulfite Modification 1. Use only highly purified (i.e., protein-free) genomic DNA, typically isolated by protocols involving proteinase K or guanidinium. 2. Digest DNA (50–1000 ng) with any restriction enzyme that does not cut the region of interest, but results in short fragments. 3. Stop the reaction by boiling for 5 min. 4. In a 0.5-mL tube, bring 50–1000 ng of digested or undigested DNA to a volume of 18 µL in water. (Optional: add 1 µg salmon DNA if starting DNA is less than 1 µg.)

274 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

Gloss, Kalantari, and Bernard Add 2 µL of freshly made 3 M NaOH. Incubate at 37°C for 15 min. Add 278 µL of 4.8 M sodium bisulfite. Mix by inversion and incubate in a thermal cycler for 17–20 cycles at 55°C for 15 min and 95°C for 30 s. Proceed with QIAquick PCR purification kit and protocol, and elute in 50 µL. Add 5.5 µL of 3 M NaOH to eluate. (Optional: Add 5 µg mussel glycogen if starting DNA is less than 1 µg.) Incubate at 37°C for 15 min. Add 5.6 µL of sodium acetate and 150 µL of 100% ethanol. Mix by inversion. Incubate at –80°C for 1 h. Spin 20 min at 13,000g. Discard supernatant and wash the pellet with 150 µL 70% ethanol. Spin 10 min at 13,000g. Discard supernatant and remove remaining liquid with pipet. Air-dry for approx 10 min. Dissolve pellet in 30–50 µL of water. Modified DNA can be used for PCR directly or stored at –20°C for up to 2 mo. Use 2–5 µL of recovered DNA for PCR.

Alternatively, there are several commercial bisulfite modification kits available (EZ DNA Methylation kit from Zymo Research and CpGenome DNA Modification kit from Intergen).

3.3.3. Agarose-Embedded Bisulfite Modification In our hands, this protocol was powerful enough to analyze the HPV-16 methylation pattern with as little as 1 ng genomic DNA of the cell line SiHa, corresponding to 333 genomes of HPV 16. 1. Optional: the literature is ambiguous whether digestion of genomic DNA with a restriction enzyme cutting outside the genomic region of interest is helpful to achieve better modification. 2. Adjust volume of DNA solution to 9 µL. Note that the final amount of DNA will be one-third of the input, as a sample forms three beads. For example, if starting with 3 ng of DNA in 9 µL, one ends up with three beads containing 1 ng each. 3. Add 2 µL 3 M NaOH. 4. Incubate 15 min at 37°C. In the meantime, pipet 0.5 mL cold mineral oil into each of three 1.5-mL tubes for each sample, and keep these tubes on ice. Prepare another set of 1.5-mL tubes with 556 µL of 4.8 M sodium bisulfite and 4 µL of 100 mM hydroquinone in each tube. 5. Add 20 µL 2% LMP agarose. To reach an amount of 20 µL per tube, one may need to pipet a larger amount, e.g., 23 µL, as agarose sticks to the pipet tips. Mix by repeated pipetting. Quickly pipet 10 µL into the tube with cold mineral oil, which will form beads. Avoid bubble formation while underlaying the mineral oil with your sample. Work with one sample at a time and leave other samples at 37°C until you are ready to add the agarose.

Regulation of Viral Transcription

275

6. When the beads are sufficiently dense, they will sink to the bottom of the tube. Carefully transfer the beads with a pipet into the tubes containing sodium bisulfite and hydroquinone. Avoid transferring mineral oil by wiping it off with sterile tissue. 7. Incubate 4 h at 50°C in the dark, by covering the top of the water baths with a piece of dark cloth or aluminum foil under the lid, followed by placing the tubes on ice. Remove the bisulfite/hydroquinone mixture with a pipet. 8. Wash 3 × 15 min in TE, then 2 × 10 min in 0.2 M NaOH (dilute from the fresh 3 M NaOH) and finally 3 × 10 min with water. (“Washing” means adding the fluid, waiting briefly, then pipetting out the liquid.) Keep the TE, 0.2 M NaOH, and water on ice, but washing can be done at room temperature. 9. Drop one bead (the equivalent of approx 5–10 µL) into the PCR reaction.

It is not the objective of this chapter to describe PCR conditions. Typical PCR amplification conditions as used in the context of bisulfite-modified HPV DNA and considerations for troubleshooting have been described (16,20). There are no optimal standard conditions to amplify bisulfite-treated DNA, and the appropriate conditions have to be adjusted empirically. 4. Notes 1. The plasmid vector containing the fragment of interest can be a standard cloning vector, like pBluescriptSK (Stratagene), that offers a choice of unique restriction sites both 5' and 3' of the insert. Be aware that the usual standard sequencing gels can resolve not more than 200–300 nucleotides from the labeled end of the DNA strand. It therefore may be necessary to subclone fragments of overlapping 300- to 400-bp fragments into a suitable vector to cover a larger region of a promoter/enhancer by footprint analysis. 2. The DNase I mix has a range of concentration of DNase I. The amount of DNase I has to be determined empirically so that approx 20% of the input labeled fragment is randomly digested and approx 80% remains undigested. This can be further fine tuned by various digestion times (usually between 1 and 2 min). The samples where no nuclear extracts were added, or in which a purified protein was added instead of nuclear extract, are much easier to digest by DNase I than the samples with nuclear extract. Depending on the concentration and purity of the nuclear extracts, an optimal DNase I concentration and digestion time has to be determined to match the digestion pattern with the samples that had no protein added. 3. Complementary oligonucleotides for EMSA can be designed by using the region of the promoter/enhancer that is protected from DNase I digestion as a “core” sequence that is usually extended by three to five nucleotides at the 5' and 3' end because these flanking sequences may be important (although not protected from DNase I digestion) for the protein/DNA interaction. In addition, the oligonucleotides are designed so that after annealing, there is a 5' protruding sequence on either end of the double-stranded oligonucleotide that can be filled in by Klenow polymerase and radiolabeled deoxynucleotides for labeling purposes.

276

Gloss, Kalantari, and Bernard

4. Although most protocols recommend making a fresh solution of 10% ammonium persulfate, we found that the solution could be kept at 4°C for up to 1 yr. It is important, however, that the dry, powdered substance be kept well desiccated and that it not contain any clumps, to avoid the frustrating experience of a sequencing or EMSA gel that never polymerizes. 5. The addition of “cold” (unlabeled) nucleotides at the end of the labeling reaction is recommended, because fragments that were not completely filled in during the labeling reaction (sometimes caused by a limited amount of the labeled nucleotide) will produce an inconsistent digestion pattern. This is because a cleavage of DNase I at the same position in incompletely filled-in DNA fragments will lead to various lengths of the labeled cleavage products (see Fig. 1 for an illustration of the possible DNase I cleavage products). 6. The re-cut at the other end of the radiolabeled fragment produces the asymmetry of the labeled fragment, in the sense that after re-cutting, only one of the two DNA strands is radiolabeled. The distance of the re-cut relative to the labeled end can vary, because the sizes of the DNase I cleavage products are determined by the position of DNase I cleavage and the labeled end (see Fig. 1). Longer DNase I fragments will remain unresolved at the top of the gel. Therefore, it is recommended to use 200- to 400-bp-long fragments for footprinting analysis. 7. The transfer of the piperidine-treated DNA to a new tube is essential, because the heating of the 1.5-mL tube with piperidine seems to lead to contaminants of the sample that can be separated by precipitation in a new tube and that otherwise lead to “fuzzy” or “smeary” resolution of the bands on the sequencing gel. 8. The amount of the nonspecific competitor DNA (poly-[dI-dC]) has to be determined empirically and is dependent on the concentration and purity of the nuclear extract. When purified proteins are used for EMSA, the amount of nonspecific competitor DNA has to be reduced about 100-fold in comparison with nuclear extracts.

Acknowledgments This work was supported by a fellowship from the Cancer Research Institute of the University of California Irvine to M. K., and by funds of the same institute and NIH grant ROI-CA 91964 to H. U. B. References 1. Bernard, H. U. (2002) Gene expression of genital human papillomaviruses and potential antiviral approaches. Antiviral Therapy 7, 219–237. 2. Hummel, M., Hudson, J. B., and Laimins, L. A. (1992) Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes. J. Virol. 66, 6070–6080. 3. Meyers, C., Mayer, T. J., and Ozbun, M. A. (1997) Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA. J. Virol. 71, 7381–7386.

Regulation of Viral Transcription

277

4. Stoler, M. and Broker, T. H. (1986) In situ hybridization detection of human papillomavirus DNAs and messenger RNAs in genital condylomas and cervical carcinoma. Human Pathol. 17, 1250–1258. 5. Sailaja, G., Watts, R. M., and Bernard, H. U. (1999) Many different papillomaviruses have low transcriptional activity in spite of strong epithelial specific enhancers. J. Gen. Virol. 80, 1715–1724. 6. Chan, W. K., Chong, T., Bernard, H. U., and Klock, G. (1990) Two AP1 sites in the long control region of human papillomavirus type 16 lead to phorbolester stimulation of the viral E6/E7 promoter. Nucleic Acids Res. 18, 763–769. 7. Ozbun, M. A. and Meyers, C. (1997) Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 71, 5161–5172. 8. Tan, S. H., Leong, L. E. C., Walker, P. A., and Bernard, H. U. (1994) The human papillomavirus type 16 transcription factor E2 binds with low cooperativity to two flanking binding sites and represses the E6 promoter through displacement of Sp1 and TFIID. J. Virol. 68, 6411–6420. 9. Ai, W., Narahari, J., and Roman, A. (2000) Ying yang 1 negatively regulates the differentiation-specific E1 promoter of human papillomavirus 6. J. Virol. 74, 5198–5205. 10. Ai, W., Toussaint, E., and Roman, A. (1999) CCAAT displacement protein binds to and negatively regulates human papillomavirus type 6 E6, E7, and E1 promoters. J. Virol. 73, 4220–4229. 11. O’Connor, M. J., Stünkel, W., Koh, C. H., Zimmermann, H., and Bernard, H. U. (2000) The differentiation-specific factor CDP/Cut represses transcription and replication of human papillomaviruses. J. Virol. 74, 401–410. 12. Stünkel, W., Huang, Z., Tan, S. H., O’Connor, M, and Bernard, H. U. (2000) Nuclear matrix attachment regions of human papillomavirus-16 repress or activate the E6 promoter depending on the physical state of the viral DNA. J. Virol. 74, 2489–2501. 13. Chong, T., Apt, D., Gloss, B., Isa, M., and Bernard, H. U. (1991) The enhancer of human papillomavirus-16: Binding sites for the ubiquitous transcription factors oct-1, NFA, TEF-2, NFI and AP1 participate in the epithelial specific transcription. J.Virol. 65, 5933–5943. 14. Gloss, B., Chong, T., and Bernard, H. U. (1989) Numerous nuclear proteins bind the long control region of human papillomavirus type 16: A subset of 6 of 23 DNAseI-protected segments coincides with the location of the cell-type-specific enhancer. J.Virol. 63, 1142–1152. 15. Stünkel, W. and Bernard, H. U. (1999) The chromatin structure of the long control region of human papillomavirus type 16 represses viral oncoprotein expression. J. Virol. 73, 1918–1930. 16. Badal, V., Chuang, L. S. H., Badal, S., et al. (2003) CpG methylation of human papillomavirus-16 DNA in cervical cancer cell lines and in clinical specimens: genomic hypomethylation correlates with carcinogenic progression. J. Virol. 77, 6227–6234.

278

Gloss, Kalantari, and Bernard

17. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489. 18. Wildeman, A. G., Sassone-Corsi, P., Grundstrom, T., Zenke, M., and Chambon, P. (1984) Stimulation of in vitro transcription from the SV40 early promoter by the enhancer involves a specific trans-acting factor. EMBO J. 3, 3129–3133. 19. Frommer, M., McDonald, L. E., Millar, D. S., et al. (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA 89, 1827–1831. 20. Millar, D. S., Warnecke, P. M., Melki, J. R., and Clark, S. J. (2002) Methylation sequencing from limiting DNA: embryonic, fixed, and microdissected cells. Methods 27, 108–113. 21. Kim, K., Garner-Hamrick, P. A., Fisher, C., Lee, D., and Lambert, P. F. (2003) Methylation patterns of papillomavirus DNA, its influence on E2 function, and implications in viral infection. J. Virol. 77, 12,450–12,459.

Analysis of HPV Transcription by RPA

279

21 Analysis of HPV Transcription by RPA Jason M. Bodily and Craig Meyers Summary Human papillomavirus (HPV) transcription is a complex process using multiple promoters, splices, and polyadenylation sites to create polycistronic transcripts capable of encoding the known and putative viral genes at the correct time and place throughout the differentiationdependent life cycle. The ribonuclease protection assay (RPA) provides a flexible and convenient tool to study the behavior of HPV transcripts under a variety of cellular conditions and treatments, or in response to genetic mutations. Using a known cloned DNA as a template, an antisense RNA probe is generated and hybridized to the sample RNA. After digestion with ribonucleases (RNases), the fragments of the probe protected by the sample are examined by gel electrophoresis. With the proper design of the probe template, information about promoter usage, splicing, transcript levels, and other parameters can be accurately, simply, and quantitatively measured throughout the HPV life cycle.

1. Introduction Expression of human papillomavirus (HPV) genes is a complex process, often involving the production of polycistronic transcripts that can be differentially spliced and/or polyadenylated, which arise from multiple promoters and respond to various cellular conditions, including especially cellular differentiation (1–4). HPVs are exquisitely adapted parasites of differentiating squamous epithelia, and their patterns of transcription reflect this dependence. Consequently, in order to perform meaningful analyses of HPV transcripts throughout the viral life cycle, the source of RNAs for study is of primary methodological importance. At least three parameters should be considered when generating RNAs for study. First, because HPV genomes in a normal productive infection are episomal, cell lines or other material from which RNAs are obtained should maintain the HPV genome episomally. Even without considering the loss of genetic material from the viral genome due to integration, transcriptional properties of episomal and integrated HPV differ (5,6). Second, From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

279

280

Bodily and Meyers

HPVs have a strong tropism for keratinocytes, and their transcriptional properties are best studied in these cells. In some cases, we have found that even different keratinocyte cell lines (especially C33A, for example) support different patterns of transcription when compared with other, more “normal” keratinocyte lines (7,8; and unpublished data), so one should take this into account in experimental design. Third, because cellular differentiation is a crucial parameter affecting HPV transcription, monolayer culture by itself presents an incomplete picture of HPV infection. A number of methods of inducing differentiation have been reported (e.g., refs. 1,9,10), but only the organotypic (or raft) cultures have been shown to support the complete HPV life cycle in vitro (see Chapters 12–14). Using the raft culture system, we have found that transcription patterns from HPV promoters closely follow the differentiation of the raft tissue (4), meaning that rafts harvested at various times can be used as sources of HPV transcripts at each stage of differentiation to consider each part of the viral life cycle in sequence. Methylcellulose culture can also support late transcript production (9), although not the entire virus life cycle, and is a quick and inexpensive method for inducing keratinocyte differentiation (see Chapter 13). In summary, an important prerequisite for studying HPV transcripts is to choose an experimental system in which the relevant lifecycle stage is properly supported. Understanding the processes governing HPV transcription throughout the viral life cycle requires precise analysis of RNAs from HPV-infected cells, including mapping and quantitation under a variety of cellular conditions. The ribonuclease protection assay (RPA) is a flexible and useful method for quantifying and mapping RNA molecules. In this assay (Fig. 1), a uniformly radiolabeled riboprobe antisense to the RNA of interest is generated in vitro by transcription from a linearized template and allowed to hybridize to a sample containing the RNA of interest. The annealed RNA sample is then treated with ribonucleases (RNases), which digest away portions of the probe that remain single stranded, leaving undigested (or protected) those parts of the probe that were hybridized to the target RNA. The sample is subjected to electrophoresis, and information about the target RNA can be obtained from the sizes of probe fragments that remain undigested. If the probe was present in the reaction in excess, the intensity of the band will be directly proportional to the amount of the target RNA present in the sample. RPA can be used for a number of applications, including quantitation of messenger RNAs, mapping the 5'-ends of transcripts, and locating splice sites (see Note 1). The protocol described below is a general method for performing RPAs, including, where appropriate, considerations for its application to studies of HPV transcripts. The protocol described here centers on the MAXIscript™ and RPA III™ kits sold by Ambion. We have obtained good results using these

Analysis of HPV Transcription by RPA

281

Fig. 1. The steps of the ribonuclease protection assay.

products, but have not extensively tested kits sold by other manufacturers. The general strategy of the RPA should not vary enormously between manufacturers of different components, although details of protocols may vary. We will discuss the design and preparation of the probe, hybridization of the probe to the sample RNA, treatment with RNase, and analysis of the protected fragments by electrophoresis. 2. Materials 1. RNA sample (see Note 2). 2. Plasmid DNA to be used as a riboprobe template. 3. RNase-free microcentrifuge tubes (see Note 3), 1.5 mL. Newly opened bags are reliably RNase free, and can remain so if tubes are poured out and the bag carefully closed after each use. 4. RNase-free, aerosol barrier pipet tips.

282

Bodily and Meyers

5. RNase-free TE buffer: 10 mM Tris (pH 7.4), 1 mM ethylenediamine tetraacetic acid (EDTA). 6. 20 mg/mL Proteinase K. 7. Phenol:chloroform:isoamyl alcohol (25:24:1; PCI). 8. 3.0 M Sodium acetate. 9. MAXIscript in vitro transcription kit (Ambion, see Note 4) includes nucleasefree water, 10X transcription buffer (keep at room temperature after thawing for use), 10 mM each of ATP, UTP, and GTP. Thaw, mix in 1:1:1 ratio, and store at –20°C in small aliquots; this is the AUG mix. 15-30 U/µL RNA polymerase (SP6, T3, T7), 2 U/µL RNase-free DNase I. 10. 0.5 M Nuclease-free EDTA, pH 8.0. 11. [α32P] CTP (10 mCi/mL, 400-800 Ci/mmol). 12. Urea. 13. 40% Acrylamide: N,N'-methylene-bis-acrylamide (38:2). Note: acrylamide is a neurotoxin. Use care in handling solutions. 14. 10X Tris-borate-EDTA: 890 mM Tris, 890 mM boric acid, 20 mM EDTA; if precipitate forms, discard. 15. Nalgene disposable filtration unit, 0.45 µm. 16. N,N,N',N'-Tetramethylethylenediamine (TEMED). 17. 10% Ammonium persulfate (see Note 5). 18. Plastic wrap. 19. X-Omat AR Scientific Imaging film (Kodak). 20. Razor blades. 21. RPA III kit (Ambion; available alone or in combination with MAXIscript kit), includes probe elution buffer, 5 mg/mL torulla yeast RNA, 5 M ammonium acetate, hybridization buffer, RNase digestion buffer, RNase mix (250 U/mL RNase A; 10,000 U/mL RNase T1), RNase precipitation/inactivation solution, gel loading buffer. 22. Filter paper.

3. Methods 3.1. Preparation of the Probe

3.1.1. Preparation of the Probe Template (see Note 6) 1. Locate a restriction enzyme site at the 5' end of the region of interest in the template DNA, possibly in the polylinker into which the DNA has been cloned (see Note 7). This will serve as the 3' end of the riboprobe when transcribed in an antisense orientation. The enzyme chosen must not digest the plasmid between this site and the phage promoter from which transcription will be initiated. 2. Digest 10 µg of the plasmid with the enzyme. Bring the volume up to 100 µL with RNase-free TE and analyze 2 µL (200 ng) by agarose gel electrophoresis to ensure digestion. 3. Add 0.75 µL 20 mg/mL proteinase K and digest 30 min at 50°C.

Analysis of HPV Transcription by RPA

283

4. Add an equal volume of PCI, vortex well, and centrifuge at 1600g for 5 min. Remove the aqueous (upper) phase to another tube and repeat once again with PCI and once with chloroform. 5. Add 10 µL 3 M sodium acetate, 250 µL 100% ethanol, and place at –20°C for more than 30 min. 6. Centrifuge at at least 10,000g, 15 min at 4°C. 7. Redissolve 20 µL (500 ng/µL) in RNase-free TE buffer. Store at –20°C.

3.1.2. Generate the Probe 1. Mix in an autoclaved 1.5-mL centrifuge tube at room temperature (see Note 8): 6 µL RNase-free dH2O, 2 µL 10X transcription buffer, 3 µL AUG mix, 2 µL 500 ng/µL DNA template, 5 µL 12.5 µM [α32P]CTP, 1 µL 10 U/µL phage RNA polymerase. 2. Incubate at least 10 min at 37°C. The exact incubation time is not critical. 3. Add 1 µL of 2 U/µL RNase-free DNase I; incubate 15 min, 37°C. This destroys the template DNA, preventing protection of the target RNA by the template DNA. 4. Add 1 µL 0.5 M EDTA to prevent hydrolysis of the RNA by Mg2+ upon heating.

3.1.3. Gel-Purify the Probe 1. Add an equal volume of gel loading buffer and heat the sample for 3–5 min at 95°C. 2. Load the sample onto a 0.75-mm thick 5% acrylamide/8 M urea/1X TBE gel and run for approx 20–60 min at 100–300 V until bromphenol blue (faster running, purple dye) reaches the bottom of the gel. 3. Carefully disassemble the gel apparatus, blot away excess buffer, and remove one plate from the gel sandwich. Wrap the gel and the remaining plate in plastic wrap so that the gel surface is covered with a smooth sheet of plastic. Caution: the gel and buffer will be very radioactive and should be handled with care. 4. In a darkroom, expose X-ray film to the wrapped gel for approx 30 s. It is convenient to place the film on a table or counter and place the gel on top of the film. The exact time of exposure is not crucial, but if after developing the film, 30 s proves insufficient for easy visualization of the probe band, the reaction was probably unsuccessful. During the exposure time, hold the gel in place and carefully mark the edges of the plate with a pencil (not a pen). The pencil marks will survive through the film-developing process and will be useful in the next step. 5. Once the film is developed, unwrap the gel/plate, daub any residual buffer from the back of the plate, and place the film underneath. By aligning the corners of the plate with the pencil marks on the film, the exposed part of the film will be aligned with the part of the gel containing the probe. 6. Excise the full-length probe from the gel with a fresh razor blade and transfer the gel fragment to a microcentrifuge tube containing 350 µL of elution buffer. 7. Incubate at 37°C overnight to elute approx 95% of the probe (see Note 9). Remove gel fragment and determine cpm of probe using a scintillation counter. Store at –20°C. 8. Prepare a 0.75-mm denaturing 5% acrylamide/8 M urea/1X TBE gel (see Note 10).

284

Bodily and Meyers

3.2. Hybridization of Probe and Sample RNA 1. For each sample, mix 32P-labeled probe (2–8 × 104 cpm/10 µg RNA) with sample RNA (5–20 µg) in a 1.5-mL microcentrifuge tube (see Note 11). 2. Set up two control tubes for each probe by mixing 2 µL (10 µg) of yeast RNA with the probe. Yeast RNA is assumed not to contain transcripts that will specifically protect the probe. One tube will be left undigested by RNases to show whether the probe is degraded in the absence of RNase treatment. The other yeast control will be digested along with the experimental samples to distinguish fragments that are nonspecific remnants of digestion from fragments specifically protected by the target RNA. 3. Adjust the NH4OAc concentration to 0.5 M (by adding 0.1 volume of 5 M), add 2.5 vol of 100% ethanol, and mix. Place at –20°C, >15 min. 4. Centrifuge the samples at at least 10,000g for 15 min, 4°C. Remove ethanol, taking care not to dislodge the pellets. Pellet again and carefully remove the last traces of ethanol. Dry 5 min at room temperature. 5. Resuspend the pellets in 10 µL of hybridization buffer. Vortex each for 5–10 s, then centrifuge briefly to collect droplets to the bottom of the tube. 6. Incubate at approx 90°C (±5°C) for 3–4 min to denature RNA and aid in solubilization, then revortex and pellet briefly. 7. Incubate tubes for 2–18 h, preferably in a 42–45°C cabinet-type incubator, or in a 45°C water bath or heat block (see Note 12).

3.3. RNase Digestion of Hybridized Probe and Sample RNA 1. Thaw RNase digestion buffer and make RNase solution (150 µL × number of samples) at 1:100 dilution of RNase. 2. Spin samples briefly. To one yeast RNA control, add 150 µL of RNase digestion buffer. To the other yeast control and the experimental samples, add 150 µL of the RNase solution. 3. Vortex, spin to collect, then incubate at 37°C for 30 min to digest unprotected RNA. 4. Add 225 µL inactivation/precipitation solution to each tube. Vortex and spin briefly. Precipitation of small fragments (100–150 nt) can be improved by adding 75 µL of ethanol, or 150 µL of ethanol for fragments 50–100 nt. Because for a typical 300-nt probe, many fragments may be less than 100 nt, we add 150 µL ethanol routinely. 5. Incubate at –20°C for 15 min. It is not necessary to add carrier RNA at this step.

3.4. Separation and Detection of Protected Fragments 1. Centrifuge the RNase-digested samples 15 min, at at least 10,000g, 4°C. 2. Carefully remove the supernatant from the tube, being careful not to dislodge the pellets. Spin again briefly and aspirate remainder of supernatant. A blue residue may be apparent at the bottom of the tube. This is a co-precipitant included in the RPA III kit that makes it easier to locate the pellet. This residue may not dissolve completely in the loading buffer.

Analysis of HPV Transcription by RPA

285

3. Resuspend pellets in 8 µL of gel loading buffer. 4. Heat the tubes to approx 90°C (±5°C) for 3–4 min to denature RNA and aid in solubilization, then revortex and pellet briefly. Also heat the size markers before loading onto the gel (see Note 13). 5. Load each sample on the gel and run at 150–300 V. Use only approx 1 µL of the undigested probe controls, as they are much more radioactive. 6. Transfer the gel to filter paper, cover with plastic wrap, and expose to film at –70°C with an intensifying screen. The length of exposure time will depend on the intensity of the signal, but overnight is a good starting place. Repeated exposures are possible, but once the gel has frozen, care should taken to prevent the gel from thawing while a new film is applied.

4. Notes 1. RPA analysis can be used to map promoter start sites or to measure the amount of mRNA originating from a particular start site (11). Because extraneous bands can appear in RPA analyses, initial characterization of promoters requires primer extension or S1/ExoVII analysis in addition to RPA to confirm that transcription initiates at a given location. Once the exact initiation sites are mapped with confidence, however, RPA can provide a convenient, simple, and sensitive way to measure transcription from a known promoter under different conditions. RPA analysis can also be used to measure expression of particular genes. One commonly performed RPA in our laboratory is to measure the level of L1 transcripts in raft cultures of HPV-infected keratinocytes as a step in determining whether a particular wild-type or mutant HPV can support late gene expression. Using this strategy, we can determine quantitatively the effect that, for example, a mutation in a transcriptional regulatory region has on expression of L1 late in the viral life cycle. A similar strategy can be used to study the expression of any of the other viral genes. If the probe is designed to overlap a spliced region, changes in splicing patterns and/or splice site usage under different conditions can be detected (3). RPA is one of a number of techniques for mapping and analyzing RNAs. Others include S1 and ExoVII nuclease mapping, primer extension, QRT-polymerase chain reaction (PCR), and Northern analysis. The specific information desired from the experiment will dictate which assay should be used in a particular case. S1/ExoVII mapping is similar in concept to RPA in that a single-stranded probe is hybridized to the sample, treated with nucleases, and analyzed by electrophoresis. The major conceptual difference with RPA is that S1/ExoVII probes are labeled at one end rather than uniformly throughout the length of the probe. This has several consequences. First, only fragments that include the labeled end of the probe will appear on the autoradiograph. This means that S1/ExoVII measures the distance between the labeled end and the first point of noncomplementarity with the target RNA. In contrast, fragments protected by any segment of the probe in an RPA can be used to obtain information about the target. Second, the signal intensity per mole of labeled probe is lower for S1/ ExoVII than for RPA. This results in a lower sensitivity of the assay. Third,

286

Bodily and Meyers

because only fragments containing the labeled end appear on the gel, the background is lower for S1/ExoVII assays than for RPA, in which extraneous bands can sometimes be present. The major advantage of S1/ExoVII analysis is that it is capable of unambiguously determining the distance between the end of the probe and the 5' end of an RNA molecule with low background. Primer extension analysis is capable of mapping the 5' ends of RNA molecules despite discontinuities, which can be both an advantage and a disadvantage. It is a disadvantage in that features such as splice sites that result in a shorter RNA cannot be unambiguously distinguished from an alternative transcriptional initiation site. In contrast, using RPA one can obtain information about the behavior of the target RNA at any point along the length of the probe. The advantage of primer extension is precision of mapping RNA ends. By performing a dideoxy sequencing reaction using the same primer and running the reaction products of the same gel, one can determine the precise nucleotide to which the 5' end maps. The mapping resolution of an RPA is limited by the accuracy of size comparison between the protected RNA fragments and size markers. Quantitative real-time (QRT)-PCR analysis allows the investigator to determine the absolute number of transcripts present in a sample, and therefore may be preferable to RPA for transcript quantitation in some situations. A significant difference between RPA and QRT-PCR is that, like primer extension, QRT-PCR is insensitive to sequence features, such as splice sites, that create discontinuities in the region to be analyzed, while RPA can detect such features. Whether this difference represents an advantage or disadvantage depends on the experimental situation. Northern blot analysis is useful for determining the size and quantity of RNA molecules containing the particular sequence complementary to a probe. In the context of HPV transcription, the multitude of transcriptional initiation sites, splices, and differentially polyadenylated transcripts can make interpretation of a Northern blot problematic. RPA can coalesce all of the species containing a particular sequence into a single signal, or alternatively, can distinguish features of different species, depending on the design of the probe. 2. A number of RNA isolation reagents are on the market. RNA from methylcellulose cultures can be extracted using protocols specified by the manufacturers for monolayer cultures after washing the suspended cells in phosphate-buffered saline (PBS) several times to eliminate the methylcellulose. Using TRIzol reagent (Invitrogen) to extract RNA from methylcellulose cultures, we have encountered the formation of aggregate material upon addition of TRIzol. This is lessened by the addition of a small amount of TRIzol to the cell pellet first, mixing well, and then adding more TRIzol gradually. RNA from raft cultures can be extracted using protocols for extraction from tissue samples, using, for example, glassTeflon® or power homogenizers to disrupt the tissue. Whatever the RNA isolation method, the RNA should be treated with RNase-free DNase to eliminate contaminating DNA from the preparation. This step is important to ensure that signals in the RPA result from protection of the probe by RNA and not by DNA

Analysis of HPV Transcription by RPA

3.

4.

5.

6.

287

contaminants. The integrity of the RNAs should be confirmed by agarose gel electrophoresis and staining with ethidium bromide to observe the two prominent rRNA bands. Because the RNA and probe will be precipitated as part of the hybridization procedure, the concentration of RNA needed is not crucial: the precipitation can be adjusted to accommodate a wide range of volumes. We find 0.5–2 µg/µL total RNA to be a convenient range for a working concentration, and that 10–15 µg of RNA from HPV-infected cells in each assay reaction is enough to generate a robust signal from most HPV transcripts. Up to 50 µg of RNA can be used in the assay, but the sample may migrate aberrantly in the gel if too much RNA is present. Poly(A)-selected mRNA may also be used; 0.6–2 µg per reaction is a good starting place. One of the most persistent problems in working with RNA is avoiding contamination by ribonucleases. RNases are very stable and difficult to eliminate from a contaminated sample. Several helpful precautions are listed as follows. a. To avoid contamination by RNases from the hands, always wear gloves when working with RNA samples or with materials or reagents to be used in RNA work. Change gloves frequently. b. New, sterile, disposable plasticware, such as microcentrifuge tubes in a freshly opened bag, can be relied upon to be RNase free so long as they are handled so that RNases from the hands or other sources are not introduced. Glassware can be treated by baking at 180°C for 8 h or more. It is helpful to set aside materials and supplies to be used for RNA work and store them in a designated place so as not to mix them with other laboratory materials. c. Equipment such as pipetmen should be wiped down with RNase-inactivating solutions such as RNase Zap (Sigma). d. Solutions should be made using baked glassware or fresh plasticware, baked spatulas, and chemicals that are reserved for RNA work. Solutions can be treated with diethyl pyrocarbonate (DEPC) to eliminate RNase activity by adding DEPC to the solution to 0.1%, incubating for 12 h at 37°C, and autoclaving for 15 min at 15 lb/sq. in. (approx 1 bar or 100 kPa). Autoclaving inactivates the DEPC, so DEPC-treated solutions can subsequently become contaminated with RNases. Because DEPC reacts with amine groups, solutions containing Tris cannot be DEPC treated. Nuclease-free stock solutions of Tris can be obtained commercially and used to make working solutions. e. When manipulating solutions containing RNA, use aerosol barrier pipet tips. Several versions of the MAXIscript kit exist containing different combinations of phage polymerases. The polymerase needed to generate the riboprobe will dictate which kit to purchase (see Note 6). Make 10% APS fresh the day you use it. We keep 50-mg aliquots of powder to which we can add 500 µL of water to make a 10% solution, thereby having a fresh solution quickly without much waste. The riboprobe template consists of cloned DNA corresponding to the target RNA. This DNA may consist of genomic DNA or cDNA. Probe template design is

288

Bodily and Meyers

critical for extracting the most information from the RPA, and will depend on the needs of the particular experiment. The flexibility of the RPA permits a great deal of ingenuity in probe design. Probes can be made to overlap a splice junction (differentiating between spliced and unspliced populations of transcripts) or overlapping the 5' end of a transcript (permitting mapping of transcriptional start sites or differentiating between closely spaced promoters). One probe we have made includes sequences from a reporter cloned downstream of an HPV promoter. If the assay is performed on HPV-infected cells transfected with the reporter, RNA derived from the transfected reporter will protect a longer segment of the probe, thus permitting us to distinguish endogenous from transfection-derived transcripts. Using a probe template made from a spliced cDNA, one can probe specifically for a particular spliced product. If more than one protected fragment is expected from the digest, such as would be the case for two closely spaced promoters or perhaps spliced vs unspliced transcripts, the probe should be designed so that the resulting fragments are sufficiently different in size to be resolved on the gel. This is also true if more than one probe is used in the assay, such as when an internal control is included for quantitation. We have found high-fidelity PCR with primers flanking the region of interest followed by cloning of the fragment into a vector (such as pGEM) containing phage promoters on either side of the multiple cloning site to be a simple way to create any probe we desire. Whatever the probe design, there must be a phage promoter (such as T7, T3, or SP6) at the 3' end of the region of interest, oriented to initiate transcription into the region of interest. The distance between the phage promoter and the digested end of the linearized template will be the length of the undigested probe. Although probes of 1000 nt are possible, we have found that 200–450 nt is a convenient size of probe to work with, and the expected fragments protected by a probe this size are easily resolved by electrophoresis. The protected region of the probe should be sufficiently different in size from the full-length undigested probe to distinguish the two species. 7. There has been a report that transcription can occur from the opposite strand if the template is linearized with an enzyme that leaves a 3' overhang (12). The linearizing enzyme should therefore leave a blunt end or a 5' overhang. Alternatively, a 3' overhang can be filled in. 8. The reaction is assembled at room temperature to prevent the precipitation of spermidine present in the transcription buffer. The reaction volumes here are recommended as a starting place. The amount of probe needed will depend on the number of samples to be tested and the amount of probe to be added to each, and can be adjusted by adjusting the volumes of each component proportionally. We have found that a half reaction generates more than enough probe for a standard RPA of 12–20 samples. 9. Shorter elution times are possible with a corresponding decrease in recovery. Larger probes elute more slowly. We have found an overnight elution to be logistically convenient. Because of the isotopic label along its length, the probe will rapidly degrade by radiolysis, resulting in many extraneous bands, so probes

Analysis of HPV Transcription by RPA

10.

11.

12.

13.

289

should be used within a few days of being made. We have obtained good results by setting up the hybridization the day after the probe was made (i.e., following the overnight elution step). Dissolving urea is facilitated by heating to 37°C and rocking the tube occasionally. Urea often contains particulate impurities that can cause blurring of bands when the gel is run, and boric acid in TBE buffers often precipitates. It is therefore helpful to filter the gel solution using a disposable filtration unit after the urea is dissolved, but before the addition of APS or TEMED. Leaving the vacuum on for a few min after the solution has passed through the unit also de-gasses the solution. We have also found it helpful after pouring the gel solution to place the comb only partway into the gel so that the well is shallow; the sample can become diffuse as it sinks to the bottom of a very deep well, resulting in fuzzy bands. Allow the gel to “cure” overnight at room temperature. Placing damp paper towels over the top of the gel and wrapping it in plastic wrap can prevent drying of the wells and precipitation of urea. When the RPA is used to quantitate the level of the target RNA, it is helpful to include a probe against an internal control transcript that is expressed at a constant level to provide a reference point against which the level of target RNA can be compared. It also provides a standard for normalization of RNA levels between samples. Although a number of “housekeeping” transcripts have been used in the literature as internal controls, the cyclophilin mRNA is most consistent over the course of keratinocyte differentiation (13). A template for making a probe against cyclophilin is available from Ambion. If an internal control is to be included, the probe against the control is made using the same protocol as the probe against the target RNA, and the control probe is added to each hybridization reaction along with the experimental probe. It is possible to add several experimental probes to the reaction to detect the levels of multiple transcripts at the same time, as is the strategy behind several commercially available systems for detecting multiple cytokine transcripts. It is important that the sizes of the protected fragments from each probe be sufficiently different to distinguish them on the gel. For example, we often measure the levels of HPV-31 L1 transcripts from cells grown in raft culture using a cyclophilin internal control. The protected fragment of the HPV31 L1 probe is 216 nt, while the cyclophilin fragment is 103 nt, sizes that are easy to tell apart using a 5% polyacrylamide gel. We usually hybridize overnight for convenience, so that the actual ribonuclease treatment and electrophoresis are performed 2 d after the probe was made. When we have tried shorter hybridization times, the results were not significantly altered. We use the RNA Century™ Markers from Ambion. The template for these markers consists of a mixture of linearized plasmid templates that generate a series of labeled in vitro transcripts using essentially the same protocol as described above for making the riboprobe. There is no need to gel-purify the markers. With freshly made markers, 1–2 µL of a 1:50 dilution is more than sufficient for a strong signal. We make dilutions directly in gel loading buffer and store them pre-diluted

290

Bodily and Meyers at –20°C. By using a greater volume or a lesser dilution, one marker reaction can be used for several months, until the signal intensity diminishes by radiolytic decay.

References 1. Meyers, C., Frattini, M. G., Hudson, J. B., and Laimins, L. A. (1992) Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. 2. Ozbun, M. A. and Meyers, C. (1997) Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 71, 5161–5172. 3. Ozbun, M. A. and Meyers, C. (1998) Human papillomavirus type 31b E1 and E2 transcript expression correlates with vegetative viral genome amplification. Virology 248, 218–230. 4. Ozbun, M. A. and Meyers, C. (1998) Temporal usage of multiple promoters during the life cycle of human papillomavirus type 31b. J Virol 72, 2715–2722. 5. Bechtold, V., Beard, P. and Raj, K. (2003) Human papillomavirus type 16 E2 protein has no effect on transcription from episomal viral DNA. J. Virol. 77, 2021–2028. 6. Frattini, M. G., Lim, H. B., and Laimins, L. A. (1996) In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiationdependent late expression. Proc. Natl. Acad. Sci. USA 93, 3062–3067. 7. Sen, E., Bromberg-White, J. L., and Meyers, C. (2002) Genetic analysis of cis regulatory elements within the 5' region of the human papillomavirus type 31 upstream regulatory region during different stages of the viral life cycle. J. Virol. 76, 4798–4809. 8. Bromberg-White, J. L. and Meyers, C. (2003) Comparison of the basal and glucocorticoid-inducible activities of the upstream regulatory regions of HPV18 and HPV31 in multiple epithelial cell lines. Virology 306, 197–202. 9. Ruesch, M., Stubenrauch, F., and Laimins, L. (1998) Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin 10. J. Virol. 72, 5016–5024. 10. DiLorenzo, T. P. and Steinberg, B. M. (1995) Differential regulation of human papillomavirus type 6 and 11 early promoters in cultured cells derived from laryngeal papillomas. J. Virol. 69, 6865–6872. 11. del Mar Pena, L. M. and Laimins, L. A. (2001) Differentiation-dependent chromatin rearrangement coincides with activation of human papillomavirus type 31 late gene expression. J. Virol. 75, 10,005–10,013. 12. Schenborn, E. T. and Mierendorf, R. C., Jr. (1985) A novel transcription property of SP6 and T7 RNA polymerases: dependence on template structure. Nucleic Acids Res. 13, 6223–6236. 13. Steele, B. K., Meyers, C., and Ozbun, M. A. (2002) Variable expression of some “housekeeping” genes during human keratinocyte differentiation. Anal. Biochem. 307, 341–347.

Regulatory Motifs Within HPV Transcripts

291

22 Analysis of Regulatory Motifs Within HPV Transcripts Sarah A. Cumming and Sheila V. Graham Summary Papillomavirus late gene expression is highly dependent on host epithelial cell differentiation, such that capsid proteins are produced only in differentiating cells. Several papillomaviruses contain negative regulatory elements (NREs), that is, short regions of late transcripts that interact with host cellular RNA processing factors to prevent capsid protein synthesis in undifferentiated cells. In this chapter, the human papillomavirus (HPV)-16 NRE will be used as an example to show how cis-acting RNA regulatory elements can be identified and mapped using transient transfection of reporter gene constructs. The use of reporter gene assays is also readily applicable to the identification and characterization of novel promoters and other regulatory sequences in HPV DNA. In vitro RNA–protein binding techniques, including ultraviolet crosslinking, electrophoretic mobility shift assay, and affinity purification of RNA binding proteins, will also be described, again using the HPV-16 NRE as an example. These techniques may be used to identify cellular proteins that bind the NRE, allowing its mode of action to be deduced. They may also be used to study interactions between host cellular proteins and other protein-binding motifs on HPV mRNA. These interactions are important for the regulation of HPV gene expression, and have key roles in splicing, polyadenylation, mRNA export, stability, and translation.

1. Introduction Papillomavirus late gene expression is confined to the differentiated cells in the outer layers of an infected epithelium. In undifferentiated cells, although late mRNAs are present, capsid protein production may be prevented by negative regulatory elements (NREs). These are short RNA elements that have been identified in the open reading frames of the L1 and L2 late genes (1–4) or late 3' untranslated regions (UTRs) (5–8) of several papillomaviruses. NREs interact with host RNA processing factors and inhibit late gene expression by a variety of posttranscriptional mechanisms, including reduction of RNA stability (9), retention of transcripts in the nucleus (1,7), and reduction of polyadenylation efficiency (10). An NRE may be identified in papillomavirus From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

291

292

Cumming and Graham

DNA by cloning selected viral sequences into a mammalian reporter vector and assaying for reporter gene expression following transient transfection in basal epithelial cells. If expression is low compared to the control that lacks the viral sequences, an NRE is present. Once the limits of the element have been established by deletion analysis, NRE RNA may be made by in vitro transcription and incubated with epithelial cell extracts to identify NRE-binding proteins. If the RNA is radioactively labeled, the sizes of the proteins binding directly to the RNA may be determined by ultraviolet (UV) crosslinking the proteins to the RNA, sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and exposing the dried gel to X-ray film (11). Alternatively, the radiolabeled NRE RNA may be incubated with cellular proteins, then electrophoresed through a nondenaturing acrylamide gel in an electrophoretic mobility shift assay (EMSA) (12). Bound protein retards the migration of the probe through the gel, and incubation with antibodies against bound proteins can retard it still further, generating a supershift. It is also possible to purify NRE-binding proteins by chemically crosslinking unlabeled RNA to agarose beads, incubating with cellular extracts, and washing the beads with a high-salt buffer to remove proteins that are bound nonspecifically. The bound proteins are eluted in protein gel loading buffer and Western blotted to determine whether specific proteins are part of the complex that forms on the NRE. These techniques will be illustrated using the human papillomavirus (HPV)16 NRE as an example, but they may be more widely applied to the study of papillomavirus gene transcription (see Chapters 20 and 28), and of RNA processing events such as polyadenylation and alternative splicing. This chapter describes (1) selection of a reporter gene and plasmid design for experiments to identify and map an NRE; (2) transient transfection of reporter gene constructs into basal epithelial cells; (3) chloramphenicol acetyltransferase (CAT) reporter gene assays; (4) β-galactosidase reporter gene assays; (5) use of deletion constructs to map an NRE; (6) design, labeling, and purification of suitable probes to identify NRE-binding proteins; (7) UV crosslinking of NRE probes to proteins present in cellular extracts or purified expressed proteins; (8) EMSA using cellular extracts or purified proteins; (9) antibody supershift EMSA experiments; and (10) affinity purification and Western blotting of NRE-binding proteins present in cellular extracts. 2. Materials 2.1. Identification of an NRE 1. A suitable mammalian expression vector containing a strong promoter (e.g., the cytomegalovirus [CMV] immediate early [IE] gene promoter) and a reporter gene (e.g., CAT, lac Z, luciferase), either lacking polyadenylation signals, e.g., pLW1

Regulatory Motifs Within HPV Transcripts

2. 3. 4. 5.

293

(13), or from which polyadenylation signals may be readily removed and replaced if required, e.g., pGL3 or pCAT3 vectors (Promega). It may be advisable to use an intron-containing plasmid, e.g., pCI (Promega), to allow for possible interactions between splicing and polyadenylation factors across the terminal exon. Restriction endonucleases and 10X buffers as supplied by the manufacturer. Bacteria competent to receive plasmid DNA (stored at –70°C in small aliquots). T4 DNA ligase and reaction buffer as supplied by the manufacturer. Materials for polymerase chain reaction (PCR) amplification (see Subheading 2.11.).

2.2. Transient Transfection of Undifferentiated Epithelial Cells 1. 2. 3. 4.

Mammalian epithelial cells suitable for transient transfection, e.g., HeLa cells. Commercial transfection reagent (LipofectAmine from Invitrogen works well). 2 M CaCl2. Filter-sterilize and store at 4°C for up to 6 mo. 10X HEPES-buffered saline (HBS): 8.18% NaCl, 5.92% HEPES, 0.2% Na2HPO4 (pH 7.15). Filter-sterilize and store at 4°C for up to 6 mo.

2.3. CAT Reporter Gene Assay 1. CAT assay resuspension buffer: 110 mM Tris-HCl (pH 7.8), 1 mM ethylenediamine tetraacetic acid (EDTA), 1 mM dithiothreitol (DTT). Store at 4°C for up to 3 mo. 2. Xylene extraction buffer: 1 mM Tris-HCl (pH 7.5), 1 mM EDTA. 3. Chloramphenicol [ring-3, 5-3H] (NEN NET928) (see Note 1). 4. n-butyryl coenzyme A (C4:0) lithium salt (Sigma B1508). Store 25 mM stock in dH2O in small aliquots at –70°C for up to 3 mo. 5. 0.5 mM chloramphenicol. Make 50 mM stock in 100% ethanol, and then dilute 10 µL into 1 mL dH2O immediately before use. Store 50 mM stock at 4°C for no more than 2 d. 6. CAT enzyme from Escherichia coli 50,000–100,000 units per mg protein (Sigma C2900). Store the stock solution (0.1 ng/µL in dH2O) in small aliquots at –20°C for up to 3 mo. 7. Xylenes, mixed. ACS reagent ≥ 98.5% isomers plus ethylbenzene (highly flammable) (Sigma X2377). 8. Petroleum ether (highly flammable). 9. Liquid scintillation counter and scintillation fluid.

2.4. β-Galactosidase (ONPG) Assay 1. o-nitrophenyl-β-D-galactopyranoside (ONPG) substrate for β-galactosidase (Sigma N1127): 4 mg/mL in 0.1 M sodium phosphate (pH 7.5). Make fresh immediately before use. 2. 100X Mg solution: 0.1 M MgCl2, 4.5 M β-mercaptoethanol. 3. 0.1 M sodium phosphate buffer (pH 7.5). Store at room temperature. 4. 1 M Na2CO3. Store at room temperature.

294

Cumming and Graham

5. E. coli β-galactosidase enzyme purified from E. coli or recombinant: 3000 U/mL in 0.1 M sodium phosphate (pH 7.5). Store in small aliquots at –20°C.

2.5. Mapping an NRE 1. Materials for cloning (see Subheading 2.1.). 2. Materials for transient transfections (see Subheading 2.2.). 3. Materials for CAT reporter gene assays (see Subheading 2.3.) and β-galactosidase reporter gene assays (see Subheading 2.4.). 4. Materials for PCR (see Subheading 2.11.).

2.6. Probe Preparation 1. A plasmid containing a multiple cloning site (MCS) flanked by T3, T7, or Sp6 bacteriophage RNA polymerase promoter sequences, e.g., pBluescript (Stratagene), pGEM-T (Promega). 2. Materials for cloning (see Subheading 2.2.). 3. Materials for PCR (see Subheading 2.11.). 4. Diethylpyrocarbonate (DEPC, Sigma) (see Note 2). 5. [α-32P]-rUTP or -rCTP (800 mCi/mmol) and a safe environment for the use of radiochemicals. 6. T3, T7, or Sp6 RNA polymerase, dilution buffer, and 5X or 10X transcription buffer as supplied by the manufacturer. 7. Ribonucleotide triphosphate (NTP) set (100 mM). 8. DNase I enzyme that is free of RNase activity, e.g., RQ1 (Promega). 9. Sephadex G50 columns, e.g., Mini Quick spin RNA columns (Roche). 10. Equipment and reagents for denaturing PAGE (see Subheading 2.13.). 11. 0.5% SDS in TE buffer. 12. 3 M Sodium acetate (pH 5.2) treated with DEPC. 13. Phenol saturated with 0.1 M citrate buffer (pH 4.3) (e.g., Sigma P4682). Store at 4°C. 14. Chloroform (flammable). Store protected from light at room temperature. 15. 75% Ethanol, prepared using DEPC-treated dH2O. 16. Liquid scintillation counter and scintillation fluid.

2.7. UV Crosslinking 1. Equipment and reagents for SDS-PAGE (see Subheading 2.12.). 2. Diethylpyrocarbonate (DEPC, Sigma) (see Note 2). 3. HeLa cell nuclear extracts purchased from 4C Biotech (Seneffe, Belgium) or prepared according to Dignam (14). May be stored at –70°C for several months in single-use aliquots, which should be thawed on ice immediately before use. 4. Purified proteins expressed in bacteria, if available. 5. tRNA from E. coli strain W (Sigma R1753) or tRNA type X-SA from Bakers yeast (Sigma R8759). Prepare 10 mg/mL stock in RNase-free water (see Note 2) and store for 1 yr at –20°C.

Regulatory Motifs Within HPV Transcripts

295

6. 1X UV crosslinking binding buffer: 60 mM KCl, 20 mM HEPES-KOH (pH7.6), 1 mM MgCl2, 10% glycerol. Make 2X or 5X stock and store at room temperature for up to 3 mo. 7. Ribonuclease A (RNase A) type 1-A from bovine pancreas, 5X crystallized, salt fractionated, and chromatographically purified (Sigma R4875). Prepare 10 mg/mL stock in dH2O and store in small aliquots at –20°C for up to 1 yr. 8. 96-Well flat-bottomed plates. 9. Stratalinker® (Stratagene) or other suitable source of UV radiation at 254 nm. 10. Chromatography paper. 11. Gel dryer. 12. X-ray processor or chemicals, X-ray film, and a light-tight autoradiography cassette.

2.8. Electrophoretic Mobility Shift Assay 1. Equipment and reagents for nondenaturing polyacrylamide gel electrophoresis (see Subheading 2.13.). 2. Diethylpyrocarbonate (DEPC) (Sigma D5758) (see Note 2). 3. 1X EMSA binding buffer: 60 mM KCl, 10 mM HEPES-KOH (pH 7.6), 3 mM MgCl2, 5% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (PMSF). Make 5X stock (without PMSF or DTT) and store at room temperature for up to 3 mo. 4. Heparin: sodium salt grade 1-A, from porcine intestinal mucosa (Sigma H3393). Prepare 50 mg/mL stock in RNase-free water and store for up to 1 yr at –20°C. 5. DTT (dithiothreitol) molecular biology reagent (Sigma D9779). Prepare 1 M stock in 10 mM sodium acetate (pH 4.8) and store at –20°C for up to 1 yr. 6. HeLa cell nuclear extracts (see Subheading 2.7.3.). 7. Purified proteins expressed in bacteria, if available. 8. tRNA (see Subheading 2.7.5.). 9. RNase inhibitors (e.g., Promega RNasin®, N2111 or N2511) and protease inhibitors (e.g., PMSF, Sigma P7626. 0.2 M stock in isopropanol, store at –20°C, or Roche mini complete EDTA-free protease inhibitor cocktail 1836170). 10. Chromatography paper. 11. Gel dryer. 12. X-ray processor or chemicals, X-ray film, and a light-tight autoradiography cassette.

2.9. Antibody Supershifts 1. Reagents for EMSA (see Subheading 2.8.). 2. Antibodies against putative NRE-binding proteins.

2.10. Affinity Purification of RNA-Binding Proteins 1. Diethylpyrocarbonate (DEPC, Sigma) (see Note 2). 2. Templates and reagents for RNA in vitro transcription (see Subheading 2.6.). 3. Adipic acid dihydrazide agarose beads (Sigma).

296

Cumming and Graham

4. 14-mL Round bottomed polypropylene centrifuge tubes (Greiner). 5. 1 M Sodium acetate, pH 5.0. 6. Sodium m-periodate (Sigma). Store 50 mM stock at room temperature (protected from the light) for up to 3 mo. 7. Polyuridylic acid agarose (Sigma). Immediately before use, add 100 mg beads to 1 mL 2 M NaCl and leave on ice to swell for 1 h. 8. 2 M NaCl prepared using DEPC-treated dH2O. 9. HeLa cell nuclear extracts (see Subheading 2.7.3.). 10. High-salt buffer D: 20 mM HEPES-KOH (pH 7.6), 5% glycerol, 300 mM KCl, 0.2 mM EDTA, 0.5 mM DTT (prepare fresh or store without DTT at room temperature for up to 3 mo). 11. Low-salt buffer D: 20 mM HEPES-KOH (pH 7.6), 5% glycerol, 100 mM KCl, 0.2 mM EDTA, 4 mM MgCl2, 0.5 mM DTT (prepare fresh or store at room temperature without DTT for up to 3 mo). 12. Equipment and reagents for SDS-PAGE (see Subheading 2.12.). 13. Equipment (electroblotting cell) and membrane (e.g., Hybond P, Amersham Pharmacia Biotech) for Western blotting. 14. Chromatography paper. 15. Western blotting transfer buffer: 25 mM Tris (pH 8.3), 192 mM glycine, 20% methanol. 16. Primary antibodies against RNA binding proteins. 17. Horseradish peroxidase (HRP)-conjugated secondary antibodies. 18. Dried skimmed-milk powder. 13. PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, adjust pH to 7.4 using HCl, store at room temperature). 14. Polyoxyethylene-sorbitan monolaurate (Tween-20, Sigma P7949). 15. PBS-T (PBS + 0.05% [v/v] Tween-20). 16. Western blot detection reagent, e.g., ECL (Amersham Pharmacia Biotech). 17. X-ray processor or chemicals, X-ray film, and a light-tight autoradiography cassette. 18. Western blot stripping buffer: 100 mM β-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl (pH 6.8). Prepare immediately before use, adding the mercaptoethanol in the fume hood.

2.11. Reagents for PCR Amplification 1. 2. 3. 4. 5.

Thermal cycler. dNTP mix (10 mM each, store at –20°C). Taq polymerase and 10X PCR buffer supplied by the manufacturer. 25 mM MgCl2. Custom oligonucleotide primers, resuspended in sterile dH2O at 100 pmol/µL and stored at –20°C (10X stock).

Regulatory Motifs Within HPV Transcripts

297

2.12. Materials for SDS-PAGE 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Small gel electrophoresis kit for SDS-PAGE, e.g., BioRad mini Protean system. Long round tips for loading gels, e.g., Sorenson Multiflex (13790). 30% Acrylamide solution (acryl/bis 37.5:1) (store at 4°C). TEMED (store at 4°C). 10% Ammonium persulphate (APS), store at 4°C for up to 1 mo. 1.5 M Tris-HCl (pH 8.8). 1 M Tris-HCl (pH 6.8). 10% SDS. Protein gel electrophoresis buffer: 0.25 M glycine, 0.025 M Tris, 0.5% SDS. 2X protein loading buffer: 100 mM Tris-HCl (pH 6.8), 4% SDS, 20% glycerol, 0.2% bromophenol blue, 200 mM DTT. Store at room temperature, adding DTT immediately before use. 11. DTT molecular biology reagent (Sigma). Prepare 1 M stock in 10 mM sodium acetate (pH 4.8) and store at –20°C for up to 1 yr.

2.13. Materials for Denaturing and Nondenaturing PAGE 1. 2. 3. 4. 5. 6. 7. 8.

Equipment for large polyacrylamide gel, e.g., BioRad Protean gel system. Long round tips for loading gels, e.g., Sorenson Multiflex (13790). 40% Acrylamide solution (acryl/bis 19:1) (for denaturing gel—store at 4°C). Urea (for denaturing gel). 30% Acrylamide solution (acryl/bis 37.5:1) (store at 4°C). TEMED (store at 4°C). 10% Ammonium persulphate (APS); store at 4°C for up to 1 mo. RNA loading buffer: 15% Ficoll, 1 mM EDTA, 0.25% bromophenol blue, 10 mM sodium phosphate (pH 7.0). Store at room temperature in small batches. 9. 10X TBE buffer: 0.9 M Tris, 0.9 M borate, 25 mM EDTA.

3. Methods 3.1. Identification of an NRE Functional assays should be carried out to show that the putative NRE sequence inhibits gene expression in undifferentiated epithelial cells, and to identify specific sequences within the NRE that are required for inhibition. Before starting these experiments, a reporter gene system must first be selected. Suitable choices include the E. coli CAT gene, the E. coli β-galactosidase gene, or firefly luciferase genes. CAT expression is relatively stable in transiently transfected cells and simple to assay using a phase-extraction method (15). It requires the use of some expensive reagents—e.g., tritiated chloramphenicol and butyryl coenzyme A. Access to a liquid scintillation counter is also a requirement. The β-galactosidase assay is inexpensive and

298

Cumming and Graham

simple to carry out, though in certain cell lines endogenous enzymes may give high background. It is conveniently used as a transfection control in combination with CAT assays using a portion of the same cell lysates, and requires only a spectrophotometer to measure samples. CAT and β-galactosidase assays will be described under Subheadings 3.3. and 3.4., respectively. The luciferase system is much more sensitive than the CAT reporter (16), inexpensive, and quick and simple to use, although it requires the use of a luminometer, which may not be readily available. Renilla (sea pansy) and Photinus (firefly) luciferase genes may be assayed from the same samples, providing an internal transfection control. A good range of plasmid vectors, reagents, and kits for assaying luciferase, CAT, and β-galactosidase is available from Promega. If the sequence of interest forms part of the 3' UTR of the virus (1,6,8,17), clone it downstream of a reporter gene in a mammalian expression vector that contains a strong promoter. If possible, select a plasmid that has an intron upstream of the reporter gene, since interactions between proteins bound to the NRE and to upstream splice sites may occur. The plasmid must include polyadenylation signals, i.e., a GU/U-rich CstF-64 binding site (18–20) downstream of a poly(A) hexanucleotide signal (AAUAAA). These may be the endogenous viral sequences, or the heterologous sequences present in the reporter plasmid. It may be necessary to test both, as the NRE may bind proteins that interact with specific downstream polyadenylation signals. If the sequence of interest is part of the coding region, e.g., the HPV-16 L1 and L2 gene inhibitory elements, the whole open reading frame may be cloned between the reporter gene and the polyadenylation signals, and the inhibitory elements mapped by deletion analysis (1,2). A second possibility is to generate an in-frame fusion between the putative inhibitory element and heterogeneous sequences that can be assayed at RNA or protein level (21), e.g., the CAT reporter gene. Alternatively, putative inhibitory elements may be analyzed in their natural position within the gene by introducing mutations that disrupt the nucleotide sequence while maintaining the amino acid sequence of the protein, allowing the protein produced to be quantified by Western blotting (21). The latter two approaches are preferable, since the position of the inhibitory element within the RNA might affect its function.

3.2. Transfection of Undifferentiated Epithelial Cells 1. Transient transfection experiments should be performed using undifferentiated epithelial cells, e.g., HeLa (which may be considered a convenient model for basal epithelial cells). Controls for the experiment should include mock-transfected cells, a plasmid known to express the reporter gene, and a plasmid that lacks the reporter gene. The cells should be co-transfected with a second plasmid expressing β-galactosidase (e.g., pSVβgal, Promega), to correct for any variations in transfection efficiency.

Regulatory Motifs Within HPV Transcripts

299

2. Plate the cells at 1 × 105 per 35-mm dish 16–24 h before transfection. 3. In a sterile tube, pipet 187 µL filter-sterilized 2X HBS, pH 7.15. The pH of this reagent is critically important. 4. In a second sterile tube, mix 150 µL sterile dH2O, 23 µL 2 M CaCl2, 3 µg test plasmid DNA, and 3 µg pSVβgal DNA. Note: This quantity is sufficient for three 35-mm dishes so the transfection may be performed in triplicate. 5. Slowly mix the contents of the two tubes, which should now look only very slightly cloudy. Incubate at room temperature for 30 min. If a coarse precipitate forms, check the pH of your HBS. 6. Pipet the transfection mixture slowly into the cell-culture medium. Change the medium after 16 h. Alternatively, transfect the cells using a commercial reagent (e.g., LipofectAmine, Invitrogen) in accordance with the manufacturer’s instructions.

3.3. CAT Reporter Gene Assay 1. After a further 24 h, scrape cells and medium into a centrifuge tube. 2. Centrifuge at 60g in a tabletop centrifuge for 5 min at 4°C. Decant the supernatant (medium). 3. Resuspend the cells in 1 mL ice-cold PBS, and transfer to a 1.5-mL microcentrifuge tube. 4. Centrifuge at full speed in a microcentrifuge for 1 min at 4°C, then carefully pipet off and discard the supernatant. 5. Resuspend the cells in 200 µL ice-cold resuspension buffer. 6. Transfer the samples to an ethanol/dry-ice bath for 2 min to freeze, then a 37°C water bath for 2 min to thaw. Repeat the freeze–thaw twice more. 7. Add 1 µL (0.1 ng) CAT enzyme to a sample of mock-transfected cells. Repeat the freeze-thaw once more. 8. Chill the samples on ice, and then centrifuge for 3 min at full speed at 4°C in a refrigerated microcentrifuge. 9. Transfer the supernatants to fresh tubes. Remove 30 µL from each and retain on ice for the β-galactosidase assay. 10. Heat the samples to 65°C for 6 min. This inactivates cellular enzymes that can use coenzyme A derivatives as substrates. It is vital to remove the lysate for the β-galactosidase assay before heating, because β-galactosidase is also inactivated at this temperature. 11. Chill the samples on ice. Add to each sample 20 µL 0.5 mM chloramphenicol, 2 µL [3H]-chloramphenicol, and 2 µL 25 mM butyryl coenzyme A. Incubate the reactions at 37°C for 2 h. The CAT enzyme transfers the butyryl groups from butyryl coenzyme A to chloramphenicol. Butyrylated chloramphenicol is soluble in xylene, allowing it to be separated from unmodified chloramphenicol (15). 12. Working in a fume hood, add 400 µL xylene, vortex thoroughly, and centrifuge at top speed for 2 min in a microcentrifuge. 13. In a fume hood, transfer the top (xylene) layer to a clean tube. 14. Add 200 µL xylene extraction buffer, vortex, centrifuge at top speed for 2 min, and then transfer the top layer to a clean tube. Repeat twice more.

300

Cumming and Graham

15. Add 30 µL from the purified sample to 2 mL scintillation fluid and count using a liquid scintillation counter (see Note 3).

3.4. β-Galactosidase (ONPG) Assay 1. For each sample, mix together 3 µL 100X Mg solution, 66 µL ONPG, 30 µL cell lysate, and 201 µL 0.1 M NaPO4 (pH 7.5). Also include a sample containing lysate from mock-transfected cells to estimate endogenous enzyme. For the positive control for the assay, add 1 µL of a 1 in 60 dilution of β-galactosidase enzyme to mock-transfected cells. Incubate the reactions at 37°C for 30 min or until a yellow color develops. ONPG is catalyzed by β-galactosidase in the presence of ATP to form the yellow compound o-nitrophenyl (22). 2. Measure the optical density of the samples at 420 nm (OD420) using a spectrophotometer. The readings obtained from the transfected cell lysates should all be very similar, if the transfection efficiency is consistent between samples. 3. Calculate the mean of the OD420 readings. Divide each OD420 by the mean, and multiply by 1 to obtain a series of values normalized to the mean of the data (e.g., 1.05, 1.10, 1.12, and so on). Correct the CAT assay scintillation counts for variation in transfection efficiency by dividing each by its corresponding normalized β-galactosidase value. If the plasmid containing the viral DNA sequences has low expression of the CAT reporter gene compared to the positive control, despite containing an adequate polyadenylation signal, the existence of an NRE can be deduced.

3.5. Mapping an NRE 1. The inhibitory element may be mapped within the 3' UTR or coding sequences by using PCR to amplify fragments that may contain the NRE. The PCR primers should each be designed to include as a 5' extension, restriction sites that will allow cloning of the PCR product into the reporter plasmid. Fig. 1A shows some of the plasmid constructs that were used to map the HPV-16 negative regulatory element. Progressive deletions were made from the 5' end of the late gene 3' UTR, until the loss of inhibitory sequences caused an increase in CAT reporter gene activity (Fig. 1B), allowing the precise location of the 5' end of the inhibitory element to be deduced (5). The 3' end of the element was subsequently identified using a complementary series of deletions from the 3' end of the late 3' UTR (23). 2. The position of the NRE should be confirmed by precise deletion, in order to locate the 5' and 3' ends of the element. For the HPV-16 NRE, removal of the 79-nt element leaving the surrounding sequence intact gave high gene expression comparable to that obtained using ∆G in Fig. 1B (24). The position of the NRE was further confirmed by using plasmid constructs that contain deletions within the NRE (Fig. 1C). Deletion of each region of the NRE tested led to an increase in CAT reporter gene activity, though gene expression was still significantly inhibited, showing that the whole 79-nt element is required for the most efficient inhibition of gene expression (24) (Fig. 1D). Deletions of portions of the NRE were generated using PCR (see Note 4, Fig. 2).

Regulatory Motifs Within HPV Transcripts

301

Fig. 1. Identification of an NRE in the HPV-16 late 3' untranslated region (UTR) using chloramphenicol acetyltransferase (CAT) reporter gene assays. (A) Diagram of plasmid constructs containing 5' end deletions that were used to map the HPV-16 late gene NRE. The positive control is a plasmid, pTer5, which contains the HSV-2 IE gene 5 mRNA 3'-end processing signals downstream of the CAT reporter gene (13). ∆A-∆G are plasmids that contain progressive 5'-end deletions of the late 3' UTR downstream of the CAT reporter. (B) Bar chart showing CAT activity assayed in the presence of [3H] chloramphenicol of HeLa cells transiently transfected with the CAT reporter plasmid constructs ∆A-∆G. (C) Diagram of plasmid constructs containing internal deletions of the NRE. The sizes of the wild-type and mutant NREs are: wt (79 nt); mut 1 (49 nt); mut 2 (30 nt); mut 3 (63 nt); and mut 4 (46 nt). (D) Bar chart showing CAT activity assayed in the presence of [3H]-chloramphenicol of HeLa cells transiently transfected with CAT reporter plasmid constructs containing deletions within the NRE. The positive control in this experiment, plasmid ∆G, lacks the NRE and upstream sequences and is shown in A. pBS (Stratagene) contains no CAT reporter gene. Arrow, HSV-2 immediate early (IE) gene -4/-5 promoter; open box, CAT reporter gene; stippled box, NRE; arrowhead, poly(A) site. 3. The NRE sequence should be examined to identify binding sites for RNA processing factors or other proteins, which might mediate the inhibitory activity of the element. Possible sequences of interest include 5' splice sites, which are found

302

Cumming and Graham

Fig. 2. Diagram showing how polymerase chain reaction (PCR) can be used to introduce site-specific mutations (see Note 4). (A) Template DNA showing the positions of PCR primers and restriction sites. (B) PCR amplification of two half molecules. (C) Products from the first round of PCR. (D) Annealing and PCR amplification of the two half molecules. (E) PCR product containing the desired mutation. Arrows, PCR primers; asterisk, mismatch generating desired mutation. in the bovine papillomavirus (BPV)-1 and HPV-16 NREs and bind U1 snRNP (24,25); AU-rich elements (AREs), e.g., in the HPV-1 NRE, which bind HuR (9); and GU-rich regions of the HPV-16 and -31 NREs, which bind CstF-64 (8,23). These may be identified by comparison with consensus splicing sequences (26) or GU-rich downstream sequence elements (18–20), or by consulting the AU-rich element website (http://rc.kfshrc.edu.sa/ared/). These may then be mutated by PCR (27) to determine what contribution such short sequences make to the inhibitory capacity of the element. In some cases, mutations affecting specific motifs will reduce the efficacy of the NRE while simultaneously reducing binding of specific proteins or complexes (9,10,24,28). This may suggest the mechanism by which the NRE inhibits gene expression in undifferentiated cells.

Regulatory Motifs Within HPV Transcripts

303

3.6. Probe Preparation The NREs that have been described to date bind splicing, polyadenylation, and RNA export and stability factors. Individual RNA–protein interactions may be demonstrated by preparing in vitro transcribed sense-strand RNA probes, which may be used in protein-binding experiments. 1. Clone the NRE into a vector containing a bacteriophage T3, T7, or Sp6 RNA polymerase promoter. If the sequence exceeds 200 bp, clone it in shorter portions to improve probe labeling and resolution of RNA–protein complexes. Linearize cesium chloride-purified plasmid DNA (22) downstream of the NRE sequence, then phenol/chloroform extract and ethanol precipitate. Enzymes that generate 3' overhangs must be avoided, because back transcription may occur, producing a mix of sense and antisense molecules. Preferably, since we have found that proteins present in cellular extracts may bind to certain plasmid polylinker sequences, prepare probe template by PCR amplification using a 5' primer that contains at its 5' terminus the T3 promoter sequence (5' 6 random nucleotides + AATTAACCCTCACTAAAGGG + 18–20 specific nucleotides) together with a conventional reverse primer. Gel purify the PCR product and resuspend it at 0.5–1 mg/mL in TE buffer. 2. All solutions for probe labeling, UV crosslinking, EMSA, and affinity chromatography must be RNase free (see Note 2). 3. Label the probe using [α-32P] rUTP or rCTP, depending on which occurs more frequently in the sequence of interest. rUTP is preferable, since rCTP may be modified to dCTP when incubated with cellular extracts. 4. Add to a microcentrifuge tube 0.5–1 µg template DNA; 2 µL NTP mix (2.5 mM each GTP, CTP, and ATP for UTP probes); 2 µL 5X buffer (supplied with the enzyme); 1 µL 100 µM DTT; 1.2 µL 100 µM UTP, 5 U T3, T7, or Sp6 polymerase; 20 U RNase inhibitor (optional); and 2.5 µL [α-32P] UTP. Dilute the polymerases immediately before use in the dilution buffer supplied with the enzyme, since these enzymes are highly thermolabile. The dilution buffer must be stored at –20°C and transferred from the freezer to an ice block only immediately before use to prevent it from warming up. Incubate the transcription reaction at 37°C for 1 h. 5. To remove the template, add 1 U DNase I enzyme and the supplied reaction buffer to 1X final concentration; incubate at 37°C for 1 h. 6. For UV crosslinking, a low level of transcripts that are not full length may be tolerated, though it is advisable to check a portion of the transcription reaction on a gel as described under Subheading 3.6.7. If the transcription reaction is satisfactory unincorporated, nucleotides may be removed using a Sephadex G50 spin column. If short transcripts are common, it is preferable to gel purify UV crosslinking probes (see Subheading 3.6.7. and Note 5), resuspending the probe RNA at 5 × 105 cpm/µL in DEPC-treated dH2O. 7. For EMSA, even a small proportion of transcripts that are not full length cannot be tolerated, since each may bind proteins and be retarded to a different extent.

304

Cumming and Graham Purify full-length transcripts from a 20-cm denaturing acrylamide gel (4% acrylamide, 50% w/v urea, 1X TBE; add APS to 0.001% and TEMED to 0.001% to polymerize). Add 3 µL RNA loading dye to the in vitro transcription reaction prepared as described under Subheading 3.6.4. Rinse the wells thoroughly before loading the samples. Electrophorese the samples in 1X TBE buffer at 10 V/cm for 2 h. Excise full-length transcripts from the gel (see Note 5), then elute the RNA from the gel slice at 37°C overnight in 0.5% SDS in TE buffer. Remove and discard the gel slice, then purify the RNA by phenol/chloroform extraction (using phenol buffered with citrate buffer, pH 4.3) and ethanol precipitation. Recover the RNA by centrifugation, wash the pellet with 75% ethanol, and then resuspend it in 50 µL DEPC-treated dH2O. Count using a scintillation counter, and dilute further if necessary to 5 × 104 cpm/µL.

3.7. UV Crosslinking This technique is used to determine the approximate sizes of proteins that can bind an NRE. A radiolabeled probe is incubated with nuclear or whole-cell extracts, or purified proteins. Proteins in direct contact with the RNA are covalently linked using UV irradiation. Unbound probe is digested using RNase enzyme, and then the radiolabeled bound proteins are separated by SDS-PAGE. Once approximate sizes have been determined, potential binding proteins of these sizes may be tested using EMSA supershift experiments (Subheadings 3.8. and 3.9.) or affinity purification and Western blotting (Subheading 3.10.). For example, the HPV-16 NRE binds proteins of approx 65 kDa that include the splicing factor U2AF65, and the polyadenylation factor CstF-64. It also binds HuR, a protein involved in RNA transport and stability. Binding was shown by UV crosslinking of purified protein and EMSA antibody supershift experiments (29). Fig. 3 shows HeLa cell nuclear extracts and glutathione S-transferase (GST)-tagged HuR protein UV crosslinked to the HPV-16 NRE. 1. Prepare a 12% SDS-PAGE minigel. Separating gel: 12% acrylamide, 0.375 M Tris (pH 8.8), 0.001% SDS; add APS to 0.001% and TEMED to 0.001% to polymerize. Stacking gel: 5% acrylamide, 125 mM Tris (pH 6.8), 0.001% SDS; add APS to 0.001% and TEMED to 0.001% to polymerize. 2. In a 96-well plate, mix together at room temperature in 1X UV crosslinking binding buffer, probe (5 × 105–1 × 106 cpm), 20 µg E. coli tRNA, and 20 µg nuclear extract or 0.5 µg purified expressed protein. The total reaction volume should be 20 µL. Controls for UV crosslinking experiments include antisense probes, probe with no nuclear extract (to ensure complete RNase digestion of the probe, since undigested probe fragments can easily be mistaken for small bound proteins), and, when GST-tagged purified proteins are used, GST alone. 3. Incubate the reactions at room temperature for 15 min. 4. UV crosslink on ice (first removing the lid) at 250 mJ using a Stratalinker.

Regulatory Motifs Within HPV Transcripts

305

Fig. 3. Ultraviolet crosslinking of human papillomavirus (HPV)-16 negative regulatory element (NRE) probes to HeLa cell nuclear extracts and glutathione S-transferase (GST)-tagged HuR protein. HPV-16 NRE and control probes were [32P]-labeled and crosslinked to 20 µg HeLa cell nuclear extracts (NE) (lanes 1–3), 0.5 µg GSTtagged HuR protein (lanes 5 and 6), or 0.5 µg GST protein. Lane 1, NRE (79 nt) + NE; lane 2, antisense NRE (79 nt) + NE; lane 3, in vitro transcribed pBS polylinker RNA (65 nt) + NE; lane 4, NRE probe only; lane 5, NRE + GST-HuR; lane 6, antisense NRE + GST-HuR; lane 7, NRE + GST protein. 5. Add 20 µg RNase A per reaction, place the 96-well plate in a Perspex box, and incubate at 37°C for 30 min. RNase-free tips and solutions are not required from this point. 6. Add 20 µL 2X protein loading buffer (containing 100 mM DTT) and transfer the samples to screw-capped tubes. 7. Denature the samples at 90°C for 10 min; load half the sample (20 µL) and separate by SDS-PAGE using 1X protein gel electrophoresis buffer. It is advisable to ensure all the bromophenol blue is run off the bottom of a UV crosslinking gel, since this will ensure the digested excess probe is also lost from the gel. 8. Dry the gel and expose it to X-ray film overnight (see Note 6).

306

Cumming and Graham

Fig. 4. Electrophoretic mobility shift assay (EMSA) competition and salt titration assays using a human papillomavirus (HPV)-16 negative regulatory element (NRE) probe. (A) A [32P]-labeled NRE probe (1.5 pmol) was incubated with HeLa cell nuclear extracts in the presence of specific competitor RNA. Lane 1, no extract; lane 2, no competitor; lanes 3–8, 1- to 16-fold molar excess of specific competitor, i.e., 1.5–24 pmol in vitro transcribed unlabeled NRE RNA. Arrows, RNA–protein complexes. NE, HeLa cell nuclear extracts. (B) A [32P]-labeled NRE probe (1.5 pmol) was incubated with HeLa cell nuclear extracts in the presence of varying concentrations of KCl. Lane 1, no extract; lane 2, 60 mM KCl; lane 3, 120 mM KCl; lane 4, 250 mM KCl; lane 5, 500 mM KCl. Arrows, RNA–protein complexes. NE, HeLa cell nuclear extracts.

3.8. Electrophoretic Mobility Shift Assay (EMSA) This method also involves binding radiolabeled NRE RNA probes to proteins present in cellular extracts, but the reactions are separated using a nondenaturing polyacrylamide gel, such that protein–protein as well as RNA– protein interactions are maintained. Complexes that form upon the RNA may contain several different proteins, and cause the RNA probe to migrate more slowly through the gel. Experiments using competitor RNAs may be used to demonstrate that the RNA–protein interactions are specific (see Notes 7 and 24). Figure 4A shows a competition experiment using unlabeled NRE RNA, which competes with an NRE probe to bind proteins present in HeLa cell nuclear extracts. Figure 4B shows the effect of increasing salt concentration on the binding of proteins in HeLa cell nuclear extracts to an NRE probe.

Regulatory Motifs Within HPV Transcripts

307

1. Prepare a 5% polyacrylamide gel, using 0.5-mm spacers and comb and 20-cm plates (5% acrylamide, 0.5X TBE, add APS to 0.01% and TEMED to 0.001% to polymerize). After polymerization, pre-run the gel at 200 V (10 V/cm) at 4°C in 0.5X TBE. 2. Assemble in microcentrifuge tubes on ice, a reaction containing 1X EMSA binding buffer, 5 × 104 cpm probe, 1 µg E. coli tRNA, and 20 µg nuclear extract or 0.5 µg purified protein in a total volume of 20 µL. It is important to keep the volume of the protein to less than 2 µL to maintain the salt concentration in the reaction. For each probe, include as a control one reaction that contains no proteins. 3. Incubate the reactions on ice for 15 min. 4. Add 1 µg heparin to each tube to stabilize the complexes. 5. Incubate on ice for 15 min. 6. Using long tips, load the samples without adding loading dye (see Note 8). 7. For a probe of around 100 nt, run the gel for 2–3 h at 200 V (10 V/cm). For longer probes, use a lower-percentage gel and a longer run time (e.g., 4% acrylamide in 0.5X TBE for 3.5 h for a 300-nt probe). Dry the gel and expose to film.

3.9. Antibody Supershifts To show that a known protein is part of an RNA–protein complex, an antibody against this protein may be added to the binding reaction. If the protein is present, the mobility of the complex is further reduced, generating a supershift (see Note 9). Alternatively, if binding of the antibody to its epitope interferes with RNA binding, the intensity of the complex may be reduced. Figure 5A, lane 2 shows that GST-tagged HuR protein can directly bind the HPV-16 NRE, and that addition of the anti-HuR monoclonal antibody 19F12 further reduces the mobility of the complexes, producing a supershift (lane 3). 1. Prepare and pre-run the gel as described under Subheading 3.8.1. 2. In a microcentrifuge tube on ice, mix together 20 µg nuclear extract, 1 µL (1 µg) antibody, and 1 µg E. coli tRNA in 1X binding buffer (see Note 10) in a (20-x) µL reaction, where x is the volume of probe required to give 5 × 104 cpm. Do not add the probe yet. 3. Incubate the samples on ice for 15 min. Add the probe. 4. Continue from Subheading 4.4.3. onwards.

3.10. Affinity Purification of NRE Binding Proteins In vitro transcribed RNA may be chemically linked to agarose beads, then incubated with cellular extracts to purify RNA-binding proteins (30). NREbinding proteins are eluted from the agarose beads and Western blotted. This technique was used to show that the U1 snRNP components U1A and Sm proteins bind to the HPV-16 NRE (24). Fig. 6 shows that HuR protein binds to the NRE and to poly(U) RNA, but not to agarose beads alone.

308

Cumming and Graham

Fig. 5. Electrophoretic mobility shift assay (EMSA) antibody supershift experiment using a human papillomavirus (HPV)-16 negative regulatory element (NRE) probe. EMSA experiment showing binding of [32P]-labeled NRE probes to 0.5 µg glutathione S-transferase (GST)-tagged HuR protein, and supershift of the RNA–protein complexes using 200 ng of the anti-HuR monoclonal antibody 19F12 (Molecular Probes). Lane 1, NRE probe; lane 2, NRE probe + GST-HuR; lane 3, NRE probe + GST-HuR + 19F12. Arrows, GST-HuR bound to NRE RNA; arrowheads, supershifted RNA–protein complexes.

Fig. 6. Western blot of proteins affinity purified on negative regulatory element (NRE) RNAs linked to agarose beads. Proteins were purified from HeLa cell nuclear extracts using RNA chemically crosslinked to adipic acid dihydrazide agarose beads and Western blotted using the anti-HuR monoclonal antibody 19F12 (Molecular Probes). Lane 1, NRE RNA linked to beads incubated with HeLa cell nuclear extracts (NE); lane 2, poly(U) RNA linked to beads incubated with NE; lane 3, beads incubated with NE; lane 4, NE only.

Regulatory Motifs Within HPV Transcripts

309

1. Prepare NRE RNA by in vitro transcription essentially as described under Subheading 3.6.4., substituting an NTP mix containing all four NTPs at 2.5 mM each, and omitting the unlabeled and radiolabeled UTP. Make the reaction volume up to 10 µL with DEPC-treated dH2O. Incubate the reaction at 37°C for 1 h, then DNase I digest the reaction as described under Subheading 3.6.5. Recover the RNA by phenol/chloroform extraction and ethanol precipitation. After recovering the RNA by centrifugation, wash with 75% ethanol and resuspend it in 30 µL DEPC-treated dH2O. Determine the concentration of the RNA using a spectrophotometer (1 OD260 unit = 40 µg/mL RNA) and check the integrity of the transcripts by gel electrophoresis. 2. Oxidize 500 pmol RNA in a 500 µL reaction containing 5 mM sodium m-periodate and 0.1 M sodium acetate (pH 5.0) at room temperature for 1 h in the dark (e.g., in a lead pot). Ethanol precipitate the RNA and resuspend it in 500 µL 0.1 M sodium acetate (pH 5.0). 3. Prepare adipic acid dyhydrazide agarose beads. Prepare beads also for a no RNA control. Add 10 mL 0.1 M sodium acetate to 400 µL beads in a 14-mL roundbottomed centrifuge tube. Spin the beads at 20–30g in a tabletop centrifuge for 3 min at 4°C. Carefully pipet off and discard the supernatant. Wash the beads three more times with 10 mL 0.1 M sodium acetate and resuspend them in 300 µL 0.1 M sodium acetate. 4. Add the beads to the oxidized RNA in a microcentrifuge tube and incubate the samples at 4°C overnight on a rotating wheel. 5. If appropriate, poly(U) agarose (polyuridylic acid agarose) beads may be used as a positive control for protein binding; e.g., poly(U) binds RNA-processing factors such as U2AF65, HuR, that also bind the 3' end of the HPV-16 NRE. Prepare the beads 1 h before use as described under Subheading 2., then wash the beads as described under Subheading 3.10.6., before incubation with cellular proteins. 6. Spin the beads at 20–30g at 4°C for 3 min. Pipet off and discard the supernatant. Gently resuspend the beads in 1 mL ice-cold 2 M NaCl and spin again. Wash the beads twice more with 1 mL 2 M NaCl. Add 1 mL high-salt buffer D to the beads and centrifuge at 20–30g for 3 min at 4°C. Discard the supernatant and wash three times more with 1 mL high-salt buffer D. 7. Resuspend the beads in 400 µL high-salt buffer D. Add 250 µL nuclear, cytoplasmic, or cellular protein extracts (250 µg) (see Note 11). Incubate at 30°C for 20 min, gently mixing occasionally. 8. Centrifuge the sample at 20–30g for 3 min at 4°C. Resuspend the beads in 1 mL low-salt buffer D and transfer to a 14-mL centrifuge tube. Add a further 10 mL of low-salt buffer D, mix gently, and centrifuge in a tabletop centrifuge as before. Wash twice more with 10 mL low-salt buffer D. Resuspend the beads in 1 mL low-salt buffer D, transfer to a microcentrifuge tube, and centrifuge at 20–30g to recover the beads. 9. Add 60 µL protein loading buffer to the beads. Incubate the samples at 90°C for 5 min to elute the bound proteins. Electrophorese 20 µL of each sample on a 12% SDS-PAGE gel, including 10 µg protein extracts as a positive control.

310

Cumming and Graham

10. Electroblot the gel onto nitrocellulose or PVDF membrane at 200 mA for 2 h or at 100 mA overnight at 4°C. Stir the buffer and use an ice block to prevent overheating. 11. Rinse the membrane briefly in PBS-T. 12. Block the membrane for at least 1 h on an orbital shaker at 4°C in PBS-T + 5% dried-milk powder. 13. Wash the membrane on an orbital shaker for 3 × 5 min with PBS-T. 14. Dilute the primary antibody in PBS-T + dried-milk powder (see Note 12). Prepare at least 1 mL of antibody solution per 10 cm2 of membrane. 15. Seal the membrane and antibody solution in a plastic bag, taking care to avoid leaks or air bubbles. Tape the bag to the platform of an orbital shaker. 16. Shake the membrane at high speed for 1 h at room temperature. 17. Remove the membrane from the bag and wash it for 6 × 5 min in PBS-T on an orbital shaker (see Note 13). 18. Dilute the secondary antibody as required in PBS-T + 5% dried-milk powder. Use an HRP-conjugated anti-mouse antibody, HRP-conjugated anti-rabbit antibody, or HRP-conjugated protein A, depending on the species in which the primary antibody was generated. Prepare at least 1 mL of secondary antibody solution per 10 cm2 of membrane. 19. Seal the membrane in a plastic bag, and incubate it on an orbital shaker for 1 h at room temperature. 20. Wash the membrane for 6 × 5 min in PBS-T. 21. Detect the signal with ECL reagent, blot the excess liquid from the membrane and seal it in plastic. Expose the membrane to X-ray film for 1 min. Repeat the exposure for a longer or shorter time if necessary (see Note 14).

4. Notes 1. Tritiated chloramphenicol is supplied in ethanol. Before use, take 1 µL and add to 2 mL scintillation fluid. Transfer the remainder to a 1.5-mL microcentrifuge tube, chill on dry ice for 5 min, and then evaporate the ethanol by drying under vacuum. Resuspend the tritiated chloramphenicol in 500 µL TE buffer. Working in a fume hood, add 500 µL xylene, vortex to mix thoroughly, and then centrifuge the sample for 2 min at full speed in a microcentrifuge. Remove and discard the upper layer; retain the lower aqueous layer. Extract once more with xylene, again retaining the lower layer. Add 500 µL petroleum ether, mix by vortexing, and then centrifuge for 2 min at full speed in a microcentrifuge. Retain the lower layer. Allow the excess ether to evaporate in the fume hood for 20 min, then add 1 µL of the sample to 2 mL scintillation fluid. Count the two samples on a liquid scintillation counter to estimate recovery, bearing in mind that the postpurification sample is approximately half the volume. Store the tritiated chloramphenicol at –20°C in small-volume aliquots to avoid repeated freezethawing. We have also used [14C]-chloramphenicol (NEN NEC408A) in these CAT assays. The counts obtained are lower, reducing the sensitivity of the assay. However, the reagent is supplied in aqueous solution and may be stored at 4°C, making it more convenient to use.

Regulatory Motifs Within HPV Transcripts

311

2. Solutions for these RNA–protein binding experiments should be maintained RNase free. Solutions (with the exception of Tris buffers) may be treated with 0.1% DEPC. In a fume hood, add two drops DEPC per 100 mL of solution and leave at room temperature overnight, then autoclave it. DEPC degrades to CO2 and H2O. RNase-free microcentrifuge tubes and pipet tips may be purchased, or may be prepared by soaking overnight in DEPC-treated water, and then autoclaved and baked dry. Solutions and plasticware for RNA experiments should always be kept separate from those used for other experiments. 3. It is important to be sure that your reporter assay results lie on the linear range for the assay, and that none of your reagents has become depleted. If all counts obtained seem very high and there is no clear difference between samples with and without putative NRE sequences, repeat the assay diluting the cell lysate. If all counts are very low, first confirm that the transfection has worked by assaying the samples for β-galactosidase. If the problem appears to lie with the CAT assay, first try preparing fresh chloramphenicol, since the stock solution may be unstable. If the assay still works very poorly, a new batch of butyryl coenzyme A may be required. 4. In order to make mutations by PCR, use conventional forward and reverse (outer) primers that will amplify the whole region of interest, including the NRE. For convenience, the fragment may be cloned into a plasmid such as pBluescript (Stratagene), providing convenient restriction sites and allowing outer T3 and T7 primers to be used. In order to introduce one or a small number of base changes into the element, design a pair of complementary inner primers containing a mismatch towards the center that will introduce the desired sequence (see Fig. 2). Alternatively, to make a deletion of <100 bp, design a pair of inner primers that have 15–20 bp of homolgy 5' of the desired deletion and 15–20 bp of homology 3' of the deletion. For the PCR reaction, first prepare template DNA by restriction digestion, selecting sites that lie between the outer (T3 and T7) primers and the region to be amplified (Fig. 2A). In the first round of PCR, amplify the sequence in two portions, using the combinations of primers and template DNA as shown in Fig. 2B. Gel-purify and anneal these two PCR products (mix equal amounts of DNA, heat to 65°C and allow to cool to room temperature) and use them as a template for a second round of PCR using the outer pair of primers. Gel purify the product, clone it into a suitable plasmid, and sequence it to confirm the presence of the desired mutation. 5. Full-length transcripts may be excised from the gel as follows. Behind a Perspex screen, carefully separate the plates, keeping the gel attached to one plate. Cover the gel with plastic wrap, then transfer plate and gel to an X-ray cassette. Expose to film for 5 min, carefully aligning one corner of the plate with the film for orientation. After developing the film, use a scalpel to cut out and discard the region of the film that corresponds to the full-length RNA transcripts, i.e., the largest band obtained. Behind the screen, lay the film over the gel, again carefully aligning the corners of the glass plate and the film. Using the window you have cut in the film as a guide, mark the position of the desired band on the plastic wrap with a fine marker pen. Excise this portion of the gel, monitoring

312

6.

7.

8.

9.

10.

Cumming and Graham with a Geiger counter to ensure you have cut out the correct area, and transfer the gel slice to a tube containing elution buffer. The subsequent purification of the RNA (see Subheading 3.6.7.) must be very thorough to remove all traces of SDS, which will inhibit RNA–protein interactions. If your EMSA RNA–protein complexes appear weak or indistinct, repurify the probe by repeating the phenol/ chloroform extraction and ethanol precipitation. If desired, the UV crosslinking gel may be Western blotted, in which case nuclear extracts without probe should be run alongside the UV crosslinked samples. Blot the gel as described under Subheading 3.10., step 10. After blotting, seal the membrane in plastic and expose it to X-ray film, being careful to mark the exact position of the membrane after developing the film. Then probe the membrane using antibodies against potential NRE-binding proteins, and compare the sizes of bands in the UV crosslinking reaction with those on the Western blot. This cannot definitively show that a particular protein directly binds the NRE, but can provide a good indication. Alternatively, UV crosslinking reactions may be immunoprecipitated with antibodies against possible NRE-binding proteins; the precipitate is electrophoresed by SDS-PAGE and exposed to film to detect the proteins. Only if the protein of interest binds directly to the NRE will the immunoprecipitation reactions be visible on the X-ray film, since they will be “marked” with radioactively labeled NRE RNA. It is important to show that the RNA–protein complexes in an EMSA are specific. This may be achieved by titrating the complexes with a molar excess of NRE RNA (Fig. 4A), or with an equivalent quantity of an unrelated RNA of similar size and complexity. In vitro transcribe the RNA as described under Subheading 3.10., step 1. It is also possible to use E. coli tRNA as a nonspecific competitor (24). It is essential not to add loading dye to EMSA reactions, since components of the dye may cause the complexes to dissociate. Instead, add some dye to a spare lane, and mark and number the wells to be loaded using a marker pen. The glycerol in the binding buffer will enable the samples to sink quickly. Load the gel as quickly as possible to produce a clear gel with sharp bands. Not all antibodies will generate a supershift, even though the protein may be part of the complex. The particular epitope recognized by the antibody may not be accessible, either because it is close to the RNA binding domain, or because it is masked by an interaction with another protein. Alternatively, the quality or concentration of a particular preparation of antibody may not be sufficiently high. If a particular antibody does not cause a supershift, try using another clone that recognizes a different epitope. Even if no supershift is obtained, the antibody may still detect the protein in the complexes affinity purified on NRE RNA. In antibody supershift experiments, preparations of antibody contaminated with RNase and/or protease enzymes may cause degradation of the probe or complexes. It is therefore advisable to add RNase inhibitors to each reaction, and to include additional protease inhibitors, e.g., by substituting a protease inhibitor cocktail solution for the DEPC-treated dH2O when preparing the binding buffer.

Regulatory Motifs Within HPV Transcripts

313

11. As for all RNA–protein binding experiments, the salt concentration for the binding reaction in this experiment is critically important. The composition of highsalt buffer D given here assumes the nuclear extracts contain 100 mM KCl. If the extracts contain a different concentration of salts (NaCl and/or KCl), it is important to alter buffer composition accordingly. Similarly, if the extracts need to be diluted before adding to the beads, dilute them in the buffer they are stored in, to avoid altering the salt concentration. 12. It is possible to dilute the antibody in PBS-T + 5% dried-milk powder that also contains 1 M NaCl, in order to reduce the background. This is usually necessary only when using polyclonal antibodies that produce a high background due to nonspecific binding of the antibody to the membrane, so the whole area of the membrane appears dark on the X-ray film, or to unrelated proteins, producing extra bands. 13. Diluted primary antibodies may be stored at –20°C and used two or three times more. This is particularly useful for noncommercial antibodies that are available in limited quantity. 14. The membrane may be stripped and reused, though sensitivity may be reduced. Incubate the membrane in a box with a tightly fitting lid in a shaking water bath with an excess volume of stripping buffer for 30 min at 50°C. Discard the buffer in a sink inside a fume hood and then wash the membrane 3 × 10 min on an orbital shaker in PBS-T in the fume hood. Block and reprobe the membrane as described under Subheading 3.10., step 12 onwards.

Acknowledgments This work was funded by the Wellcome Trust and the UK Biotechnology and Biological Sciences Research Council. We would like to thank Maria McPhillips, who carried out the affinity purification experiment shown in Fig. 6, for kindly permitting us to reproduce her data. References 1. Tan, W., Felber, B. K., Zolotukhin, A. S., Pavlakis, G. N., and Schwartz, S. (1995) Efficient expression of the human papillomavirus type 16 L1 protein in epithelial cells by using Rev and the Rev-responsive element of human immunodeficiency virus or the cis-acting transactivation element of simian retrovirus type 1. J. Virol. 69, 5607–5620. 2. Sokolowski, M., Tan, W., Jellne, M., and Schwartz, S. (1998) mRNA instability elements in the human papillomavirus type 16 L2 coding region. J. Virol. 72, 1504–1515. 3. Collier, B., Goobar-Larsson, L., Sokolowski, M., and Schwartz, S. (1998) Translational inhibition of human papillomavirus type 16 L2 mRNA mediated through interaction with heterogeneous ribonucleoprotein K and poly(rC) binding proteins 1 and 2. J. Biol. Chem. 273, 22,648–22,656. 4. Terhune, S. S., Hubert, W. G., Thomas, J. T., and Laimins, L. A. (2001) Early polyadenylation signals of human papillomavirus type 31 negatively regulate capsid gene expression. J. Virol. 75, 8147–8157.

314

Cumming and Graham

5. Kennedy, I. M., Haddow, J. K., and Clements, J. B. (1990) Analysis of human papillomavirus type 16 late mRNA 3' processing signals in vitro and in vivo. J. Virol. 64, 1825–1829. 6. Furth, P. A. and Baker, C. C. (1991) An element in the bovine papillomavirus late 3' untranslated region reduces polyadenylated cytoplasmic RNA levels. J. Virol. 65, 5806–5812. 7. Tan, W. and Schwartz, S. (1995) The Rev protein of human immunodeficiency virus type 1 counteracts the effect of an AU-rich negative element in the human papillomavirus type 1 late 3' untranslated region. J. Virol. 69, 2932–2945. 8. Cumming, S. A., Repellin, C. E., McPhillips, M., Radford, J. C., Clements, J. B., and Graham, S. V. (2002) The HPV-31 late 3' UTR contains a complex bi-partite negative regulatory element. J. Virol. 76, 5993–6003. 9. Sokolowski, M., Zhao, C., Tan, W., and Schwartz, S. (1997) AU-rich instability elements on human papillomavirus type 1 late mRNAs and c-fos mRNAs interact with the same cellular factors. Oncogene 15, 2303–2319. 10. Gunderson, S. I., Polycarpou-Schwartz, M., and Mattaj, I. W. (1998) U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase. Mol. Cell 1, 255–264. 11. Moore, M. J. and Query, C. C. (1998) Use of site-specifically modified RNAs constructed by RNA ligation. In RNA-Protein Interactions: A Practical Approach (Smith, C. W. J., ed), Oxford University Press, Oxford, UK: pp. 75–108. 12. Black, D. J., Chan, R., Min, H., Wang, J., and Bell, L. (1998) The electrophoretic mobility shift assay for RNA binding proteins. . In RNA-Protein Interactions: A Practical Approach (Smith, C. W. J., ed), Oxford University Press. Oxford, UK: pp. 109–136. 13. Gaffney, D., Whitton, J. L., Lynch, M., McLauchlan, J., and Clements, J. B. (1985) A modular system for the assay of transcriptional regulatory signals: the sequence TAATGARAT is required for herpes simplex virus immediate early gene activation. Nucleic Acids Res. 13, 7847–7863. 14. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489. 15. Seed, B. and Sheen, S.-Y. (1988) A simple phase-extraction assay for chloramphenicol acetyltransferase activity. Gene 67, 271–277. 16. Alam, J. and Cook, J. L. (1990) Reporter genes-application to the study of mammalian gene-transcription. Anal. Biochem. 188, 245–254. 17. Kennedy, I. M., Haddow, J. K., and Clements, J. B. (1991) A negative regulatory element in the human papillomavirus type 16 genome acts at the level of late mRNA stability. J. Virol. 65, 2093–2097. 18. McLauchlan, J., Gaffney, D., Whitton, J. L., and Clements, J. B. (1985) The consensus sequence YGTGTTYY located downstream from the AAUAAA signal is required for efficient formation of mRNA 3' termini. Nucleic Acids Res. 13, 1347–1368.

Regulatory Motifs Within HPV Transcripts

315

19. Beyer, K., Dandekar, T., and Keller, W. (1997) RNA ligands selected by cleavage stimulation factor contain distinct sequence motifs that function as downstream elements in 3'-end processing of pre-mRNA. J. Biol. Chem. 272, 26,769–26,779. 20. Takagaki, Y. and Manley, J. L. (1997) RNA recognition by the human polyadenylation factor CstF. Mol. Cell. Biol. 17, 3907–3914. 21. Collier,B., Öberg, D., Zhao, X., and Schwartz, S. (2002) Specific inactivation of inhibitory sequences in the 5' end of the human papillomavirus type 16 L1 open reading frame results in production of high levels of L1 protein in human epithelial cells. J. Virol. 76, 2739–2752. 22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, New York. 23. Dietrich-Goetz, W., Kennedy, I. M., Levins, B., Stanley, M. A., and Clements, J. B. (1997) A cellular 65-kDa protein recognizes the negative regulatory element of human papillomavirus late mRNA. Proc. Natl. Acad. Sci. USA 94, 163–168. 24. Cumming, S. A., McPhillips, M. G., Veerapraditsin, T., Milligan, S. G., and Graham, S. V. (2003) Activity of the human papillomavirus type 16 late negative regulatory element is partly due to four weak consensus 5' splice sites that bind a U1 snRNP-like complex. J. Virol. 77, 5167–5177. 25. Furth, P. A., Choe, W.-T., Rex, J. H., Byrne, J. C., and Baker, C. C. (1994) Sequences homologous to 5' splice sites are required for the inhibitory activity of papillomavirus late 3' untranslated regions. Mol. Cell. Biol. 14, 5278–5289. 26. Senapathy, P., Shapiro, M. B., and Harris, N. L. (1990) Splice site junctions, branch point sites and exons-sequence statistics, identification and applications to genome project. Method Enzymol. 183, 252–278. 27. Matthews, K. R., Tschudi, C., and Ullu, E. (1994) A common pyrimidine-rich motif governs trans-splicing and polyadenylation of tubulin polycistronic premRNA in trypanosomes. Genes Dev. 8, 491–501. 28. Sokolowski, M., Furneaux, H., and Schwartz, S. (1999) The inhibitory activity of the AU-rich RNA element in the human papillomavirus type 1 late 3' untranslated region correlates with its affinity for the elav-like HuR protein. J. Virol. 73, 1080–1091. 29. Koffa, M. D., Graham, S. V., Takagaki, Y., Manley, J. L., and Clements, J. B. (2000) The human papillomavirus type 16 negative regulatory element interacts with three proteins that act at different posttranscriptional levels. Proc. Natl. Acad. Sci. USA 97, 4677–4682. 30. Caputi, M., Mayeda, A., Krainer, A. R., and Zahler, A. M. (1999) HnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing. EMBO J. 18, 4060–4067.

Detection of HPV Transcripts by Nested RT-PCR

317

23 Detection of HPV Transcripts by Nested RT-PCR Christine Mant, Barbara Kell, and John Cason Summary Human papillomaviruses (HPVs) are etiologic for the development of cervical cancer and its precursor lesions, cervical intraepithelial neoplasia (CIN). Nearly all cervical carcinomas (CaCx) harbor HPV DNA, but the presence of HPV alone is not indicative of the future development of neoplasia. While both normal and abnormal smears may harbor HPV DNA, the detection of HPV mRNA is associated, although not exclusively, with abnormal cytology. Recent observations suggest women with a high HPV viral load are at a significantly greater risk for CIN development—particularly those infected with high-risk (HR) HPV types, such as HPV type 16 (HPV 16). Thus, assays capable of detecting HPV transcripts may have useful prognostic value and could be utilized to identify biological markers for progression to highgrade cervical disease. This chapter describes the nested reverse transcriptase (nRT)-polymerase chain reaction (PCR) methods developed in our laboratory for the detection of the majority of all early region HPV-16 transcripts.

1. Introduction Broadly, mucosal genital human papillomaviruses (HPVs) may be divided into low-risk (LR) and high-risk (HR) types, depending on their association with malignancy. Although HPV DNA is the most significant risk factor for cervical disease in all grades of lesion (1), the presence of HR HPVs, compared with LR HPVs, has been shown to confer a 13-fold greater risk for the development of cervical intraepithelial neoplasia (CIN) (2); infection with HPV 16 confers a risk of over 100-fold (3). While both normal and abnormal smears may harbor HPV DNA, the detection of HPV mRNA is associated, although not exclusively, with abnormal cytology (4). Reverse transcriptase (RT)-polymerase chain reaction (PCR)-based methods have been used to detect HPV-specific transcripts in cervical cell lines and clinical samples, such as CaCx and suspected CIN lesions. Traditionally, the study of transcription in clinical samples was hindered by the inherent diffiFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

317

318

Mant, Kell, and Cason

culty of isolating sufficient RNA from small lesions. RT-PCR was originally performed in conjunction with Southern blotting and subsequent hybridization of blotted gels with specific labeled internal oligonucleotide probes (5–7). However, despite improved levels of sensitivity when compared with RT-PCR alone, this methodology is time-consuming and laborious. Development of nested RT-PCR (nRT-PCR) methods, where an additional round of PCR amplification using internal specific primers replaces the Southern blotting and hybridization procedures, has greatly improved the detection of viral transcripts. Moreover, such protocols have been adopted in several studies and the viability of assessing transcriptionally active infections in this manner has been investigated (1,4,8,9). The application of nRT-PCR methods for the detection of HPV transcripts may be a useful prognostic marker of progressive disease, particularly as it is now well acknowledged that a high viral load is a significant risk factor for the development and progression of CIN lesions (10,11). This chapter describes the method developed in our laboratory to detect HPV-16 early region mRNA (E-mRNA), and centers on the E5 open reading frame (ORF), which plays a role in the transformation of cells at an early stage of cervical neoplasia (12–16). While other methods have targeted transcription patterns of the major oncogenes E6 and E7, these ORFs are expressed at high levels only in high-grade CIN lesions and CaCx following the integration of viral DNA into the host cell genome (17,18). Targeting the E5 ORF for assessment of HPV-16 early gene transcription allows the identification of active infections earlier in the life cycle of the virus, the E5 ORF being common to most transcribed E-mRNAs (19–21). The method described herein focuses on cervical smears, but is equally suitable for HPV-infected cells or biopsy material. 2. Materials 2.1. Collection and Preparation of Samples by RNAzol Lysis 1. Axibrushes (Colgate Medical Ltd). 2. Sterile phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4). 3. Solution for the isolation of RNA, i.e., RNAzol™ B, Trizol (see Note 1). 4. 70% (v/v) aqueous ethanol. 5. Sterile 1X Tris-EDTA (TE) buffer: 10 mM Tris-HCl (pH 8.0), 1 mM ethylenediamine tetraacetic acid (EDTA). 6. Deoxyribonuclease I (DNAse I; 5–10 U/µL). 7. 100 mM MgCl2 containing 10 mM dithiothreitol (DTT). 8. RNAse inhibitor. 9. TE-buffered ultrapure phenol (pH 4.5).

Detection of HPV Transcripts by Nested RT-PCR 10. 11. 12. 13. 14. 15.

319

Chloroform/isoamyl alcohol (24:1). Linear acrylamide 10 µg/µL (22). Absolute ethanol. Molecular biology-grade (MBG) DNAse/RNAse-free water. Isopropanol. Sterile DNAse/RNAse-free filter tips.

2.2. Reverse Transcription: Preparation of cDNA 1. Primer(s) for cDNA synthesis (see Note 2). These can be random hexamers, oligo d(T), or a first round gene–specific downstream PCR primer. The choice of primer depends on many factors and is best made on the basis of experimentation. Our early-region nRT PCR is primed with 25- to 30-mer oligo d(T), the E5 region being adjacent to the poly (A)+ tail. Random hexamers contain a random distribution of hexameric oligonucleotides containing all possible combinations of the nucleotides A, C, G, and T. 2. Moloney murine leukemia virus (MMLV) reverse transcriptase. (see Note 3). 3. Deoxynucleoside triphosphates (dNTPs; premixed, 2.5 mM of each). 4. 5X first-strand MMLV buffer: 250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2 (see Note 3). 5. MBG DNAse/RNAse-free water. 6. Sterile DNAse/RNAse-free filter tips. 7. Positive and negative controls (see Note 4). 8. Thermocycler.

2.3. PCR 2.3.1. Preparation of PCR Reactions 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Taq polymerase (5 U/µL) (see Note 5). 10X PCR buffer: 500 mM KCl, 100 mM Tris-HCl (pH 9.0), 1% Triton X-100. 25 mM MgCl2. Forward and reverse first-round PCR primers (50 µM of each) (see Table 1 and Note 6). Forward and reverse nested PCR primers (Table 1, 50 µM of each). MBG DNAse/RNAse-free water. Premixed dNTPs (2.5 mM of each). Wax pellets. Positive and negative controls (see Note 4). Sterile DNAse/RNAse-free filter tips. Programmable thermocycler and/or heating block.

2.3.2. Agarose Gel Electrophoresis 1. 10X Orange G loading buffer: 30% (w/v) Ficoll, 250 mM EDTA, 0.25% (w/v) Orange G. 2. Agarose, UltraPure, electrophoresis grade.

320

Mant, Kell, and Cason

Table 1 PCR Primers Primer

Nucleotide Sequence (5' to 3')

Nucleotide localization

Product size

P1 P2 P3 P4

ATTTAGATCTATATGACAAATCTTGATACTGC TTTTTTTTTTTTTTTTTTTTTTTTTTAAGT GTGCTTTTGTGTGTCTGCCTATTAATAC TACAGCATCCTTATGTAATTAAAAAGCGTGCAT

3837-3868 4227-4330 3910-3936 4078-4110

421 202

P1 and P2 primers are used in first-round polymerase chain reaction (PCR); P3 and P4 are used in nested PCR. Nucleotide location refers to location within HPV-16 genome. Product sizes are given in base pairs.

3. 4. 5. 6. 7. 8.

1X Tris-borate EDTA (TBE) buffer: 0.9 M Tris, 0.9 M boric acid, 2 mM EDTA. Ethidium bromide (10 mg/mL stock solution). Molecular-weight size marker (e.g., 1 kb ladder). Flatbed electrophoresis apparatus. Ultraviolet (UV) transilluminator Photography equipment, i.e., a video copy processor for capturing images.

3. Methods 3.1. General Considerations Stringent precautions must be taken to prevent false-positives as a result of contamination. These include the use of: 1. Geographically remote rooms for the preparation of PCR reagents, extraction of RNA from clinical samples, amplification, and detection of PCR products. 2. Dedicated micropipets in conjunction with sterile, disposable, aerosol-resistant tips. It is also vital to use DNAse/RNAse-free plastics throughout the preparation of samples, to avoid degradation of isolated RNA. 3. Aseptic technique, including the wearing of gowns and the use of powder-free gloves for all manipulations. 4. Strict laboratory discipline, such that workers do not collect or handle samples, or re-enter cleanrooms, on the same day that they have been exposed to PCR amplicons. 5. Inclusion of suitable negative controls, i.e., on extraction, negative distilled-water controls should be processed in parallel with cervical samples, one for every five test samples (see Note 4). Additionally, for each RT-PCR reaction a paired negative control containing all reagents except reverse transcriptase should be included. The second negative control is imperative when amplifying transcripts without splice sites, such as HPV-16 E5, as without it, a positive nRT-PCR result could be interpreted as amplification of DNA.

Detection of HPV Transcripts by Nested RT-PCR

321

3.2. Designing Oligonucleotide Primers On designing primers to be used in the RT and PCR amplifications of HPV, transcript maps, such as those described by Doorbar et al. (19) and Sherman et al. (20) must be consulted, in order to take into consideration the position of splice sites between exons. 1. Primer design software packages such as Oligo® (Molecular Biology Insights, Inc., Cascade, CO) should be used to aid design and position of primers (see Note 2). 2. Table 1 shows the primer pairs used in HPV-16 E-mRNA first-round and nested PCRs. First-round downstream primer (P2) consists of a 26-mer (dT) plus 4 bases, AAGT, complementary to the last 4 bases of untranslated mRNA found adjacent to the poly A tail of HPV-16 E5 (23). This is paired with an upstream E5-terminal specific primer (P1), giving an amplicon of 421 base pairs (bp). Nested PCR primers (P3 and P4) comprise internal E5-specific sequences and amplify a product of 202 bp.

3.3. Collection and Preparation of Samples by RNAzol Lysis 1. Collect cervical brush smears with Axibrushes from patients of interest, suspending collected cells in 5 mL of sterile PBS. 2. Pellet cells from a 1-mL aliquot of each clinical sample in a microcentrifuge at 4000g for 10 min. 3. Remove 900 µL supernatant and add 400 µL of RNAzol™ to the remaining cell pellet. Centrifuge briefly before the addition of 80 µL of chloroform, and vortex to mix. Once RNAzol™ has been added to samples, they may be stored at –70°C until required. 4. Leave to stand on ice for 5 min, prior to centrifugation at 10,000g for 15 min. 5. Transfer upper aqueous phase to a clean 1.5-mL tube and add 400 µL of isopropanol. Mix well and incubate overnight at –20°C to precipitate RNA. 6. Centrifuge at 10,000g for 15 min, remove supernatant, and add 1 mL of 70% (v/v) aqueous ethanol to wash resulting pellet. Vortex and centrifuge for a further 15 min. Remove supernatant and air-dry pellet. Resuspend in 50 µL of TE buffer. 7. To each sample add 5U of DNAse I, 10 µL 100 mM MgCl2/10 mM dithiothreitol (DTT) and RNAse inhibitor (e.g., 1 U/µL final concentration Prime RNAse Inhibitor). Incubate at 37°C overnight. 8. Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), vortex, and centrifuge for 5 min at 10,000g. 9. Transfer upper aqueous phase to a clean Eppendorf tube containing three volumes of absolute ethanol, adding 75 µg of linear acrylamide as a carrier. Mix well and incubate at –20°C for at least 1 h. 10. Centrifuge at 10,000g for 15 min, remove supernatant, and add 1 mL of 70% (v/v) aqueous ethanol to wash resulting pellet. Vortex and centrifuge for a further 15 min. Remove supernatant, air-dry pellet, and resuspend in 20 µL of MBG DNAse/RNAse-free water prior to RT.

322

Mant, Kell, and Cason

Table 2 Reverse Transcription Reactions Volume (µL) Reverse transcriptase (RT) reagent

With RT

Without RT

4 2.3 8 0.7 1 1 17

4 3.3 8 0.7 0 1 17

5X RT first strand buffer dH2O dNTPs (10 mM stock) Prime RNAse Inhibitor 30 U/µL) MMLV RT (200 U/µL) Primer of choice (50 µM) 3'Oligo dT Subtotal

Volumes stated are for each sample to be tested. RT reactions should be set up using master mixes (see Note 7).

3.4. Reverse Transcription: Preparation of cDNA 1. For each sample, set up RT reactions in two separate small, thin-walled PCR tubes as described in Table 2 (see Notes 3 and 7). 2. Add 3 µL of RNA sample to each tube and spin briefly. 3. Incubate reaction tubes at 37°C for 90 min. 4. Add 20 µL of MgCl2 mix. Final concentration in 100 µL solution volume should be determined by titration, as described in Table 3. 5. Add two wax pellets, spin briefly, and incubate at 99°C for 5 min to inactivate the RT. 6. Allow wax to solidify at room temperature.

3.5. PCR 3.5.1. Setting Up First-Round PCR Reactions and Cycling Conditions 1. Add 60 µL PCR mix (Table 4) to each sample from the RT reactions after wax has hardened. Spin briefly, prior to amplification in a programmable heating block. 2. Amplify DNA by subjecting tubes to a series of PCR cycles comprised of template denaturation, primer annealing, and polymerase extension steps (see Notes 8 and 9) using the following conditions: 94°C for 5 min, 49°C for 15 s, 72°C for 1 min, followed by 29 cycles of 94°C for 30 s, 49°C for 15 s, 72°C for 1 min, then a final elongation step of 72°C for 5 min.

3.5.2. Preparation of Nested PCR Reactions 1. For each first-round sample to be tested, prepare “lower” and “upper” reaction mixes (see Table 5 and Note 7).

Detection of HPV Transcripts by Nested RT-PCR

323

Table 3 Magnesium Titration Experiment MgCl2 Concentration

Volume of 25 mM MgCl2 (µL)

1.0 1.25 1.5 1.75 2.0 2.25 2.5 2.75 3.0 3.25 3.5 3.75 4.0

4 5 6 7 8 9 10 11 12 13 14 15 16

The final concentration of MgCl2 in 50-µL solution volume should be determined by performing a titration experiment, varying the Mg2+ concentration from 1 to 4 mM in 0.25 mM increments (this equates to a titration volume from 2 to 8 µL in 0.5 µL increments). The volume of water is adjusted accordingly to maintain a total “lower” buffer volume of 17.5 µL.

Table 4 First-Round Human Papillomavirus (HPV)-16 E-mRNA Reverse Transcriptase (RT)-Polymerase Chain Reaction (PCR) PCR Mix dH2O 10X PCR buffer Upstream primer P1 (50 µM) Downstream primer P2 (50 µM) Taq polymerase (5 U/µL) Total

µL 49.5 8 1 1 0.5 60

Volumes stated are for each sample to be tested. RT reactions should be set up using master mixes (see Note 7).

324

Mant, Kell, and Cason

Table 5 Nested Human Papillomavirus (HPV)-16 Reverse Transcriptase (RT)-Polymerase Chain Reaction (PCR) Lower

µL

Upper

µL

10X PCR buffer 25 mM MgCl2 2.5 mM dNTPs Upstream primer P3 (50 µM) Downstream primer P4 (50 µM) dH2O Total

2.5 2–8 4 0.5 0.5 2–8 17.5

10X PCR buffer Taq Polymerase dH2O

2.5 0.25 19.75

Total

22.5

Volumes stated are for each sample to be tested. RT reactions should be set up using master mixes (see Note 7).

2. Add 17 µL of “lower” mix to each 0.65-mL thin-walled PCR tube. 3. Add two wax pellets and spin briefly. Incubate at 70°C in a water bath for 3 min to melt the wax. Allow wax to solidify at room temperature for 3 min. 4. Add 22.5 µL of “upper” solution to each PCR tube, followed by 10 µL of the first-round HPV-16 E-mRNA PCR product. 5. Spin briefly prior to PCR amplification in a programmable heating block. 6. Amplify DNA by subjecting tubes to a series of PCR cycles comprised of denaturation, annealing, and extension (see Notes 8 and 9) using the following conditions: 94°C for 5 min, followed by 25 cycles of 94°C for 15 s, 50°C for 15 s, and 70°C for 10 s, then a final elongation step of 72°C for 5 min.

3.6. Agarose Gel Electrophoresis of PCR Products 1. After amplification, remove 18 µL of PCR reaction to a clean 1.5-mL tube and add 2 µL of 10X Orange G loading buffer. 2. Prepare a 2% (w/v) agarose gel using 1X TBE buffer, dissolving agarose powder by heating in a microwave for approx 90 s. 3. Allow cooling to approx 50°C before the addition of 5 µL ethidium bromide per 100 mL agarose gel. 4. Pour gel into electrophoresis casting tray and allow to solidify for approx 30 min. 5. Mix PCR amplicons with 10X Orange G loading buffer and pipet products into wells of the gel. Electrophorese at 125 V for approx 1 h, ensuring that molecularweight standards are run in parallel with the samples to assess the size of PCR products. 6. Visualize bands on a UV transilluminator and compare amplicon size against molecular-weight marker. Photographic records should be obtained (Fig. 1) using a video copy processor.

Detection of HPV Transcripts by Nested RT-PCR

325

Fig. 1. Negative image of ethidium bromide-stained 2% agarose gel showing representative results for human papillomavirus (HPV)-16 E5 nested reverse transcriptasepolymerase chain reaction products. MW: molecular-weight marker (kb ladder). +/–: reverse transcriptase positive or negative reaction, respectively. Lanes 1 and 2: HPV16 DNA containing positive control cell line CaSki. Lanes 3 and 4: negative control RNAzol-processed water. Lanes 5–12: clinical samples.

4. Notes 1. Other procedures for the isolation of RNA may be substituted for the RNAzol method described here. This includes the use of TRIzol® reagent (Invitrogen™ Life Technologies, UK), which may be used in a similar manner to RNAzol. Alternatively, commercially available kits, such as RNeasy RNA isolation kits (QIAgen) may be used. Nonetheless, whichever procedure is chosen, care must be taken to avoid contamination, including the use of DNAse/RNAse-free Eppendorfs, ART tips, gloves, sterile water, and good laboratory practice. It may also be desirable to perform a keratin RT-PCR (24) to ensure that samples contain sufficient RNA for RT-PCR, and to exclude the presence of PCR inhibitors. 2. General considerations when designing primers: • Usually PCR primers are 18–25 nucleotides in length. • GC content should be 40–60%, and more than three G or C nucleotides at the 3' end of the primer should be avoided to minimize nonspecific priming. • Primers should not be self-complementary or complementary to the other primer in the amplification pair. This will help avoid primer-dimers and minimize hairpin formation. • The melting temperature of flanking primers should not differ by more than 5°C. • Estimation of melting and annealing temperature can be calculated approximately as follows, although optimization should still be conducted: (a) If the primer is shorter than 20 nucleotides, the melting temperature (Tm) can be calculated using the formula: Tm = 4(G + C) + 2(A + T); where G, C, A, T

326

Mant, Kell, and Cason

relates to the number of respective nucleotides in the primer. Annealing temperature can be approximated to 5°C lower than Tm. (b) If the primer is longer than 20 nucleotides, it is recommended to calculate Tm using specialized computer programs (e.g., Oligo) where the interactions of adjacent bases and the influences of salt concentration are evaluated. 3. The use of MMLV RT may be substituted for an alternative RT enzyme, such as SuperScript™ (Invitrogen) or Sensiscript (Qiagen Ltd). The choice of RT depends upon the length of transcript, as well as the amount of RNA used per reaction. The buffers included with these enzymes will vary in their concentration, and hence the quantity of the components of each RT reaction will need to be adjusted to reflect this. 4. Controls: HPV-16 positive cell lines derived from cervical epidermoid cancers should be used to evaluate the E5 nRT-PCR, i.e., CaSki (American Type Culture Collection [ATCC] CRL 1550), SiHa (ATCC HTB35), and XH1 (25). We also used the human keratinocyte cell line K1/16 as a positive control for our E5-based E-mRNA nRT-PCR. This cell line is transfected with full-length HPV 16 and is known to express E5 (26). The HPV-18 positive cell line HeLa (ATCC CCL2), derived from a cervical epidermoid cancer, and A431 (ATCC CRL 1555), an HPV-negative cell line derived from an epidermoid cancer of vulval origin, should also be used as negative controls, as well as water samples processed in parallel with clinical samples. The use of the HPV-18 cell line ensures the type specificity of the HPV-16 PCR. Amplification reactions containing all reagents, but where the DNA target sample is replaced by water, should also be included to monitor possible contamination during the preparation of the PCR. 5. The choice of DNA polymerase used for PCR may be altered, in a similar way to the RT enzyme. This will depend on several factors, including the length of product, the end use of the amplicon, and the initial choice of RT. Additionally, the user may have a personal preference. If a different polymerase is used, the buffer concentration will also be different. PCR conditions and cycling parameters will have to be re-optimized, including Mg2+ titration, annealing temperature, and extension time. 6. The concentration of primer used can be altered. The protocols described here use 50 µM, but in other PCR and RT-PCR experiments conducted recently in our laboratory, this has been significantly reduced to 2.5 µM. However, the necessary concentration of primer should be determined by optimization by the user and will depend upon the nature of the PCR reaction and the components in the reaction mix. 7. When master mixes are made, the necessary volumes should be calculated such that, for every seven samples tested, three extra reactions are set up. This will account for the wetting of plastics during preparation and provide a reaction mix for the samples plus a negative or positive control. Thus, in theory, for every ten volumes set up, enough PCR mix should be obtained for nine reactions, depending upon the skill of the researcher and the accuracy of the pipets. 8. Complete denaturation of the DNA template at the start of a PCR reaction is of utmost importance and is generally recommended over an interval of 1–5 min.

Detection of HPV Transcripts by Nested RT-PCR

327

The length of this denaturation is increased with an increased GC content, and can also depend upon the nature of the target DNA. For example, DNA with a high degree of secondary structure may require longer denaturation times. Following initial denaturation, the PCR is subjected to a series of steps that form a cycle. Each cycle includes further denaturation, primer annealing, and finally template extension. Optimal annealing temperature is generally estimated at 5°C lower than the melting temperature of primer-template DNA duplex, and can be determined from primer design software packages such as Oligo. 9. Temperature titrations must be performed to ensure optimal amplification with little or preferably no false priming. The extension step is performed at 72°C for Taq polymerase, and an extension time of 1 min is sufficient for the synthesis of PCR fragments up to 2 kb. However, these two parameters depend upon the DNA polymerase chosen for amplification, and thus should be adjusted accordingly. The recent introduction of gradient thermocyclers (i.e., DNA Engine DYAD™, MJ Research, Inc., Reno, NV) allows a convenient way to optimize all PCR parameters (i.e., primer concentration, Mg2+) simultaneously, over a range of temperatures, and in a 96-well format if desired.

References 1. Kruger-Kjaer, S., van den Brule, A. J., Svare, E. I., et al. (1998) Different risk factor patterns for high-grade and low-grade intraepithelial lesions on the cervix among HPV-positive and HPV-negative young women. Int. J. Cancer 76(5), 613–619. 2. Ho, G. Y. F., Kadish, A. S., Burk, R. D., et al. (1998) HPV 16 and cigarette smoking as risk factors for high-grade cervical intra-epithelial neoplasia. Int. J. Cancer 78, 281–285. 3. van der Graaf, Y., Molijn, A., Doornewaard, H., Quint, W., van Doorn, L. J., and van den Tweel, J. (2002) Human papillomavirus and the long-term risk of cervical neoplasia. Am. J. Epidemiol. 156(2), 158–164. 4. Biswas, C., Kell, B., Mant, C., et al. (1997) Detection of human papillomavirus type 16 early-gene transcription by reverse transcription-PCR is associated with abnormal cervical cytology. J. Clin. Microbiol. 35, 1560–1564. 5. Cornelissen, M. T. E., Smits, H. L., Briet, M. A., et al. (1990) Uniformity of the splicing pattern of the E6/E7 transcripts in human papillomavirus type 16-transformed human fibroblasts, human cervical premalignant lesions and carcinomas. J. Gen. Virol. 71, 1243–1246. 6. Johnson, M. A., Blomfield P. I., Bevan, I. S., Woodman, C. B. J., and Young, L. S. (1990) Analysis of human papillomavirus type 16 E6-E7 transcription in cervical carcinomas and normal cervical epithelium using the polymerase chain reaction. J. Gen. Virol. 71, 1473–1479. 7. Falcinelli, C., Claas, E., Kleter, B., and Quint, W. G. V. (1992) Detection of the human papillomavirus type 16 mRNA-transcripts in cytological abnormal scrapings. J. Med. Virol. 37, 93–98. 8. Selinka, H-C., Sotlar, K., Klingel, K., Sauter, M., Kandolf, R., and Bültmann, B. (1998) Detection of human papillomavirus 16 transcriptional activity in cervical intraepithelial neoplasia grade III lesions and cervical carcinomas by nested

328

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

19. 20.

21.

Mant, Kell, and Cason

reverse transcription-polymeras chain reaction and in situ hybridisation. Lab. Invest. 78, 9–18. Sotlar, K., Selinka, H-C., Menton, M., Kandolf, R., and Bültmann, B. (1998) Detection of human papillomavirus type 16 E6/E7 oncogene transcripts in dysplastic and nondysplastic cervical scrapes by nested RT-PCR. Gynaecol. Oncol. 69, 114–121. van Duin, M., Snijders, P. J., Schrijnemakers, H. F., et al. (2002) Human papillomavirus 16 load in normal and abnormal cervical scrapes: an indicator of CIN II/III and viral clearance. Int. J. Cancer 98(4); 590–595. Hart, K. W., Williams, O. M., Thelwell, N., et al. (2001) Novel method for detection, typing, and quantification of human papillomaviruses in clinical samples. J. Clin. Microbiol. 39(9), 3204–3212. Leechanachai, P., Banks, L., Moreau, F., and Matlashewski, G. (1992) The E5 gene from human papillomavirus type 16 is an oncogene which enhances growth factor-mediated signal transduction to the nucleus. Oncogene 7, 19–25. Leptak, C., Cajal, S. R., Kulke, R., et al. (1991) Tumorigenic transformation of murine keratinocytes by the E5 genes of bovine papillomavirus type 1 and human papillomavirus type 16. J. Virol. 65, 7078–7083. Pim, D., Collins, M., and Banks, L. (1992) Human papillomavirus type 16 E5 gene stimulates the transforming activity of the epidermal growth factor receptor. Oncogene 7, 27–32. Schwartz, E., Freese, U. K., Gissman, L., et al. (1985) Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature 314, 111–114. Straight, S., Hinkle, P. M., Jewers, R. J., and McCance, D. J. (1993) The E5 oncoprotein of human papillomavirus type 16 transforms fibroblasts and effects the down regulation of the epidermal growth factor receptor in keratinocytes. J. Virol. 67, 4521–4532. Fuchs, P. G. and Pfister, H. (1994) Transcription of papillomavirus genomes. Intervirology 37, 159–167. Jeon, S. and Lambert, P. F. (1995) Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carginogenesis. Proc. Natl. Acad. Sci. USA 92, 1654–1658. Doorbar, J., Parton, A., Hartley, K., et al. (1990) Detection of novel splicing patterns in a HPV-16 containing keratinocyte cell line. Virology 178, 254–262. Sherman, I., Alloul, N., Golan, I., Durst, M., and Baran, A. (1992) Expression and splicing patterns of human papillomavirus type 16 mRNAs in pre-cancerous lesions and carcinomas of the cervix, in human keratinocytes immortalized by HPV–16, and in cell lines established from cervical cancers. Int. J. Cancer 50, 356–364. Smits, H., Cornelissen, M., Jebbink, M., van den Tweel, J., Struyk, A., and Briet, M. (1991) Human papillomavirus type 16 transcripts expressed from viral-cellular junctions and full-length viral copies in CaSki cells and a cervical carcinoma. Virology 182, 870–873.

Detection of HPV Transcripts by Nested RT-PCR

329

22. Gaillard, C. and Strauss, F. (1990) Ethanol precipitation of DNA with linear polyacrylamide as carrier. Nucleic Acids Res. 18, 378. 23. Taniguchi, A. and Yatumoto, S. (1990) A major transcript of human papillomavirus type 16 in transformed NIH 3T3 cells contains polycistrionic mRNA encoding E7, E5 and E1/E4 fusion gene. Virus Genes 3, 221–233. 24. Bosma, T., Corbett, K. M., O’Shea, S., Banatvala, J. E., and Best, J. M. (1995) PCR for the detection of rubella virus RNA in clinical samples. J. Clin. Microbiol. 33, 1075–1079. 25. Han, X., Lyle, R., Eustace, D. L. S., et al. (1991) XH1—a new cervical carcinoma cell line and xenograft model of tumour invasion, “metastasis” and regression. Br. J. Cancer 64, 645–654. 26. McCance, D., Kopan, R., Fuchs, E., and Laimins, L. A. (1988) Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc. Natl. Acad. Sci. USA 85, 7169–7173.

Transient Transfection and Cell-Free Assays

331

24 Analysis of HPV DNA Replication Using Transient Transfection and Cell-Free Assays Biing Yuan Lin, Thomas R. Broker, and Louise T. Chow Summary The genomes of human and animal papillomaviruses amplify in keratinocytes undergoing terminal squamous differentiation. Two approaches have been developed to facilitate the investigation into the requirement for viral DNA replication and its regulation outside the context of the host tissues. Under these conditions, the investigation can be conducted independently of viral genes required to re-establish the S-phase milieu in the differentiated keratinocytes to support viral DNA replication. The first method is transient replication in cell lines after transfection of a plasmid containing the viral origin of replication together with expression vectors of the necessary viral proteins that direct specific initiation from the origin. The second is cell-free replication in which purified viral replication proteins are complemented by cell extracts to initiate origin-specific replication. The two methods have identified the origin, the viral E1 and E2 proteins necessary for initiation, their functions, and the host factors that are required to support and regulate the viral DNA replication. These two methods are complementary in providing answers and insights that either one alone may not be able to achieve. This chapter provides a practical guide to these two replication assays.

1. Introduction In the past decade, we and others have established the transient and cell-free replication systems for studying the mechanism of papillomaviral origin (ori) replication. These two complementary assays help elucidate the interactions among viral origin sequence, viral proteins, and cellular proteins that are critical for the assembly and initiation of viral DNA replication. In brief, viral DNA replication depends on the viral encoded E1 and E2 proteins and the host DNA replication machinery, including DNA polymerase α/primase, DNA polymerase δ, RPA, PCNA, RFC, topoisomerases, and cyclin E/cdk2 (1–8). E2 is the origin recognition protein, which helps recruit E1 to the origin (ori), whereas E1 is the replicative helicase, which recruits the cellular DNA polyFrom: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

331

332

Lin, Broker, and Chow

merase α and RPA to initiate replication (9–13). In this chapter, we describe the principles of, and provide general guidance and specific protocols for, transient and cell-free replication assays, based on the HPV-11 replication system. These protocols can be extended to other papillomaviruses (see Chapter 25 for similar methods relating to human papillomavirus (HPV) 16). The ori is located in the viral upstream regulatory region (URR) or long control region (LCR), overlapping the viral E6 promoter. It consists of an E1 binding site (BS) flanked by multiple E2 BS. A mutated DNA containing no E2 BS does not function as an ori for mucosotropic HPVs (14). Both viral proteins are essential to initiate efficient transient replication from an ori in transfected cells. In contrast, as a replicative helicase, E1 also associates with DNA without E1 BS. Thus, in cell-free replication, high concentrations of E1 protein alone can initiate replication, even from a non-ori plasmid. Nonetheless, the presence of E2 greatly enhances replication initiation from the ori and, conversely, suppresses initiation from non-ori plasmids. Upon initiation, E2 is no longer present in the replication complex. In contrast, E1 is required throughout initiation and elongation (15). For transient replication in transfected cells, there are two critical requirements. One is to have appropriate mammalian expression vectors for the E1 and E2 proteins. In our experience, the CMV promoter, although good for expressing bovine papillomavirus (BPV)-1 replication proteins (2), is not adequate for the native HPV-11 protein expression (our unpublished results) (see Note 1). For HPV 11 and HPV 18 (3,5), proteins were expressed from the pMT2 vector, which has the adenovirus major late promoter and tripartite adenovirus late mRNA leader (16). The second requirement is to have a cell line with a transfection efficiency of at least 10% (17). When both conditions are met, the HPV ori plasmid will replicate in many cell lines of different animal species, including 293 and C33A cells (human), CV-1 or COS cells (monkey), NIH 3T3 cells (mouse), and CHO cells (hamster) (3). For cell-free replication, it is critical to have concentrated mammalian cell extracts prepared from log-phase cells and highly purified, native HPV E1 and E2 proteins. We routinely use human 293 cells to prepare extracts (see Note 2). Viral protein can be expressed in and purified from either bacteria or from insect cells. To facilitate E1 and E2 protein purification, the viral proteins are tagged at the amino-terminus. We use a glu-rich epitope from the polyoma T antigen to tag the HPV-11 E1 protein, and an epitope from pp65 of CMV to tag the HPV-11 E2 (4,7). Other tags also work. For instance, we have functional His-tagged HPV-18 E1 and GST-fused HPV-18 E2 proteins. They can be purified using commercially available Ni-NTA and glutathione-sepharose affinity columns, respectively (5) (see Note 3).

Transient Transfection and Cell-Free Assays

333

2. Materials 2.1. General Purposes 1. Escherichia coli strains DH5α for DNA preparation and BL21(DE3) and BL21(DE3)pLyS (Invitrogen) for protein expression. 2. Culture media for bacteria (Luria-Bertain [LB] broth), mammalian cells (Dulbecco’s modified Eagle’s medium [DMEM]; fetal bovine serum [FBS]), and hybridomas (protein-free hybridoma medium). 3. Appropriate antibiotics for selection of the bacterial vectors. Penicillin-streptomycin (Invitrogen) for mammalian cell cultures. 4. Electrophoretic equipment for agarose gels and for sodium dodecyl sulfate (SDS)polyacrylamide gel electrophoresis (PAGE). 5. Spectrophotometer to measure DNA and protein concentrations. 6. PhosphorImager System (Molecular Dynamics, Amersham Biosciences). 7. ImageQuant® software (Molecular Dynamics, Amersham Biosciences). 8. Nucleic acid-modifying enzymes for specific protocols under Subheadings 3.1. and 3.2. 9. Water bath incubators (50°C and 37°C). 10. 1X TAE buffer: 40 mM Tris-acetate, 1 mM Na-ethylenediamine tetraacetic acid (EDTA). 11. 6X DNA gel-loading buffer: 60 mM Tris-HCl (pH 8.0), 6 mM Na-EDTA, 0.25% bromophenol blue, and 30% glycerol in water. 12. Phosphate-buffered saline (PBS) (pH 7.2): 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4. 13. Proteinase K (10 mg/mL). Store at –20°C. 14. Phenol/chloroform/isoamyl alcohol (25:24:1). Store at 4°C. 15. 100% Ethanol. 16. TE buffer: 10 mM Tris-HCl, 1 mM EDTA (pH 8.0).

2.2. Transient Replication 1. 293 Cells (available from ATCC), or other cell lines with good transfection efficiency, as described above. 2. Purified mammalian expression vectors for HPV E1 and E2 proteins (see Note 4). 3. Ori plasmid(s) (see Note 5). 4. Salmon sperm DNA (10 mg/mL), stored at –20°C and boiled for 5 min before used. 5. N, N'-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid (BES) buffer, 0.5 M (pH 7.2). 6. Trypsin/EDTA buffer: 0.5% (w/v) trypsin and 0.2% (w/v) Na-EDTA. 7. Gene Pulser® II System and cuvettes (Bio-Rad) (see Note 6). 8. Solution I: 50 mM glucose, 25 mM Tris-HCl (pH 8.0), 10 mM Na-EDTA (pH 8.0). 9. Solution II: 0.2 N NaOH, 1% SDS. 10. Solution III: 10 M ammonium acetate. 11. DNA resuspension buffer: 20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM Na-EDTA, 0.2% SDS, 200 µg/mL proteinase K. 12. Isopropanol.

334

Lin, Broker, and Chow

13. Savant SpeedVac® Concentrator (Telechem International, Inc., Sunnyvale, CA). 14. TE/RNase A buffer: 10 mM Tris-HCl, 1 mM Na-EDTA, 20 µg/mL RNase A. 15. Nytran® SuperCharge transfer membrane (Cat. No. 10416296, Schleicher & Schuell). 16. Megaprime DNA Labeling System (Amersham Biosciences). 17. TurboBlotter™ system (Schleicher & Schuell). 18. Hybridization buffer: 2X SSPE (sodium chloride–sodium phosphate–EDTA. 2X concentration contains 0.36 M NaCl, 20 mM NaH2PO4, 20 mM EDTA (pH 7.4), 1% SDS. 19. Hybridization wash buffer I: 2X SSPE, 0.1% SDS. 20. Hybridization wash buffer II: 0.5X SSPE, 1% SDS. 21. Hybridization oven and tubes. (This equipment is for convenience. A sealed bag immersed in a water bath will do.) 22. Ultraviolet (UV) Stratalinker (Stratagene).

2.3. Cell-Free Replication 1. Bacterial or insect-cell expression vectors for E1 and E2 proteins (4,7). 2. Origin plasmid as used for transient replication. 3. 293 suspension cell line (available from ECACC) grown in Joklik’s medium with 5% calf serum. 4. Spodoptera frugiperda (Sf9) insect cells (American Type Culture Collection) grown in TNM-FH medium with 10% FBS, or High Five™ cells in EX-Cell 405 medium (JRH Biosciences, Lenexa, KS). 5. Branson SONIFIER450 Cell Disruptor (Branson, Danbury, CT). 6. Isopropyl-β-D-1-thiogalactopyranoside (IPTG). 7. Buffer A: 10 mM HEPES-K+ (pH 7.5), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol (DTT). 8. Buffer B: 20 mM HEPES-K+ (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 25 % glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 2 µg/mL leupeptin. 9. Bacterial lysis buffer: 20 mM Tris-HCl (pH7.0), 150 mM NaCl, 1 mM DTT. 10. Insect cell lysis buffer: 20 mM Tris-HCl (pH 7.5), 10 mM DTT, 2 mM MgCl2, 50 mM KCl, 1% Triton X-100, 1 mM PMSF, 50 µg/mL aprotinin. 11. Q-Sepharose (Bio-Rad). 12. Buffer Q: 20 mM Tris-HCl (pH 7.0), 15 mM 2-mercaptoethanol. 13. Protein A Sepharose CL-4B (Amersham Biosciences). 14. Buffer C: 20 mM Tris-HCl (pH 7.5), 800 mM NaCl. 15. Buffer D: 20 mM Tris-HCl (pH 7.5), 1 M NaCl. 16. 10 mM Phosphate buffer (pH 6.8). 17. 100 mM Triethylamine (freshly prepared before use). 18. Storage buffer: 10 mM Tris-HCl (pH 7.0), 50 mM NaCl, 10% glycerol. 19. Millipore® Centricon 100. 21. Hybridoma cell lines to obtain monoclonal antibodies (see Note 7). 23. Biologic LP chromatography system (Bio-Rad) (see Note 8).

Transient Transfection and Cell-Free Assays

335

24. Protein A-Sepharose CL-4B immunoaffinity column (Pharmacia Amersham). 23. Econo-Pac® High Q and High S ion exchange cartridges (Bio-Rad). 24. Hypotonic buffer: 20 mM HEPES-K+ (pH 7.5), 5 mM KCl, 1.5 mM MgCl2 and 1 mM DTT; stored at 4°C. 25. Dounce homogenizer with B-type pestle. 26. 5X cell-free replication reaction buffer: 150 mM HEPES-K+ (pH 7.5), 35 mM MgCl2, 2.5 mM DTT, 125 µM dCTP, 500 µM dATP, 500 µM dGTP, 500 µM dTTP, 20 mM ATP, 1 mM UTP, 1 mM CTP, 1 mM GTP, and 200 mM phosphocreatine. 27. Creatine phosphokinase (CPK) (Sigma) stored at –20°C. 28. Replication mixture (for ten 25-µL reactions): 100 µL of 293 cellular extract (approx 1 mg), 50 µL 5X cell-free replication buffer, 10 µL 2.5 mg/mL CPK, and 10 µL HPV origin DNA (40 ng/µL). 29. 32P-α-dCTP labeling mixture (for ten 25-µL reactions): combine 8 µL H2O and 2 µL 32P α dCTP (10 mCi/mL; 3000 Ci/mmol; Amersham Biosciences). 30. Stop solution (for ten 25-µL reactions): 40 µL 1 M Tris-HCl (pH7.5), 40 µL 0.5 M EDTA, 20 µL 10% SDS, 40 µL proteinase K (10 mg/mL), and 1.9 mL H2O.

3. Methods The methods described below outline transient replication and cell-free replication.

3.1. Transient Replication This assay is based on two principles: Firstly, the ori-containing plasmid replicates transiently in transfected cells when the cells express from co-transfected expression vector or vectors sufficient amounts of viral proteins necessary for initiation (3,14,17–19). Secondly, the restriction enzyme Dpn I can distinguish plasmid DNA that has replicated in mammalian cells from plasmid DNA prepared from E. coli that did not replicate. By comparing the pattern of DNA restriction enzyme fragments generated with or without Dpn 1 digestion, replicated DNA can be revealed after Southern blot hybridization (see Note 9). Briefly, Dpn I cleaves DNA when its recognition site (5'-GATC-3') is methylated at the A residue. Unmethylated DNA is resistant to Dpn I, whereas hemimethylated DNA is sensitive to high concentrations of Dpn I (15) (see Note 10). DNA replicated in mammalian cells is hemimethylated (one round of replication) or unmethylated (two or more rounds of replication) at this residue. DNA purified from E. coli contains methylated Dpn I sites and is cut into small fragments. Thus, DNA replicated in mammalian cells can be distinguished from the transfected DNA on the basis of its resistance to Dpn I digestion. Specifically, two digestions are conducted on the low-molecular-weight DNA harvested from transfected cells. One-half of the DNA preparation is cut with an enzyme that linearizes the origin DNA. The other half is digested with

336

Lin, Broker, and Chow

both the single-cut enzyme and Dpn I. The input unreplicated ori DNA and the E1 and E2 expression vectors will be digested into small fragments. After Southern blot hybridization, only replicated ori DNA remains as linearized DNA in the absence or presence of Dpn I. The loss of the large fragments from the E1 and E2 expression vectors upon Dpn I digestion serves as an internal control for the completeness of the Dpn I digestion. In their place, small fragments are observed that migrate ahead of the ori plasmids. When establishing the assay or replication system, it is advisable to set up negative controls by leaving out the expression vector of E1, E2, or both. Figure 1 shows a schematic autoradiogram of the results of a replicated ori plasmid and negative controls.

3.1.1. Preparation of Mammalian Cells Transient replication can be conducted in many mammalian cell lines, including human kidney epithelial 293 cells, cervical carcinoma C33A cells, monkey CV-1 cells, CHO (Chinese hamster ovary), and even rodent cells, as each of the host replication systems is compatible with the HPV replication proteins (3). These cells can be grown in DMEM medium with 10% FBS. We prefer 293 cells because they are human cells, have good transfection efficiency, and extracts of these cells are also used in cell-free replication. Cells must be kept healthy to avoid significant cell death upon transfection (20). Avoid using COS cells if the E1 and E2 expression vector has the SV40 origin. Cervical carcinoma cell lines that contain integrated HPV DNA, including HeLa, CaSki, and SiHa cells, are not recommended. These cells support HPV ori replication very poorly (3). One of the reasons is thought to be a deficiency in free cyclin E, which is critical for HPV replication (7,8), even though the total amount of cyclin E is comparable to that in 293 cells when determined by Western blot (Jen-Sing Liu, Shu-Ru Kuo, Thomas Broker, and Louise Chow, unpublished results). The integrated HPV DNA in these cells retains the amino-terminal portion of the HPV-18 or HPV-16 E1 gene. The encoded E1 peptide spans the cyclin binding motif and is thought to sequester any free cyclin E, making it unavailable to support HPV replication in transient and cell-free replication assays (7,8).

3.1.2. DNA Transfection by Electroporation For most mammalian cell lines, we use pulsed electrical fields to introduce DNA into the cells (21) for consistency among different experiments and among different investigators (see Note 11). 1. To each electroporation cuvette, add 5 µg each of mammalian cell expression vectors for the E1 and E2 proteins. For most purposes, this amount of expression vector works. But one may wish to conduct a titration experiment, depending on the results or purpose. 0.5 µg of HPV-origin DNA, 50 µg of carrier DNA

Transient Transfection and Cell-Free Assays

337

Fig. 1. A Photoshop rendition of a Southern blot hybridization of a transient replication assay with a human papillomavirus (HPV) origin-containing plasmid. Plasmid origin DNA has been co-transfected with expression plasmids of E1 and E2 (lanes 1 and 2), E1 only (lanes 3 and 4), or E2 only (lanes 5 and 6). Lanes 1, 3, and 5 show the patterns of hybridization with a probe that detects all three plasmids after the lowmolecular-weight ori DNA is linearized with a single-cut enzyme without Dpn I digestion. Lanes 2, 4, and 6 show the pattern of double digestions. Replication of ori plasmid to Dpn I resistance occurs when E1 and E2 are both present (lane 2). The nonreplicated plasmid DNAs are digested (lanes 2 and 4) into small fragments that migrate ahead of the linear ori plasmid (not shown).

2.

3. 4. 5.

(sonicated salmon sperm DNA), 293 cells, and BES buffer to 5 mM. Gently mix by tapping the cuvette with finger. Set the parameters on the Gene Pulser®II system. Typical capacitance value is 975 µF. Voltages range from 170 to 230 V, depending on the cell line (discussed later), to achieve both high cell survival and transfection efficiency. Under these conditions, the transfection efficiency can be up to 50%, depending on the cell lines (see Note 12). One may need to alter the voltage to obtain the best results for one’s particular cell line. We recommend 170 V for 293 cells; 180 V for COS-7, C-33A, and SiHa cells; 200 V for NIH3T3 and HeLa cells; 210 V for C127 and PHK cells; and 230 V for CHO cells. Leave the cells in the cuvette in the laminar-flow hood at room temperature for 10 min. Transfer the cells to a 50-mL conical tube with 10 mL of DMEM plus 10% FBS. Pellet the cells at 160g for 5 min. Resuspend the cells in 20 mL of DMEM and 10% FBS medium. Plate the cell suspension in two 100-mm plates. Culture the cells at 37°C and 5% CO2 for 2 d.

3.1.3. Purification of Low-Molecular-Weight DNA 3.1.3.1. CELL HARVEST

Harvest the cells at the desired time point. We usually choose 48 h after the transfection.

338

Lin, Broker, and Chow

1. Remove the medium, and wash the cells with PBS. 2. Recover the cells by adding trypsin/EDTA in phosphate-buffered saline. 3. Spin down the cells gently (approx 1000 rpm for 10 min), resuspend in 200 µL precooled solution I, and transfer into a 1.8-mL tube.

3.1.3.2. PURIFICATION OF LOW-MOLECULAR-WEIGHT DNA

Low-molecular-weight DNA is purified by the modified Hirt DNA extraction method (2,22). 1. Lyse the cells by adding 400 µL of freshly prepared solution II. Invert the tube gently four to six times to mix. 2. Add 300 µL of ice-cold solution III and mix gently but thoroughly. Keep the lysate on ice for 10 min. 3. Centrifuge for 10 min at 9500g. Transfer the supernatant to a fresh microcentrifuge tube. 4. Precipitate the DNA with 0.6 volume of isopropanol at room temperature for 30 min. Centrifuge at 13,600g for 10 min at 4°C. 5. Remove the supernatant by gentle aspiration. Dry in the Savant SpeedVac® Concentrator. 6. Dissolve the pellet in 200 µL of DNA resuspension buffer. Incubate the tube at 50°C for 1 h. Spin down at maximum speed for 30 s. 7. Add an equal volume of phenol:chloroform:isoamyl alcohol. Mix by vortexing. Centrifuge at 13,600g for 5 min at 4°C. 8. Transfer the supernatant to a fresh tube. Add two volumes of ethanol at –80°C for 10 min. Centrifuge at 13,600g for 10 min at 4°C. Remove the supernatant by gentle aspiration. 9. Wash the pellet with 0.5 mL of –20°C precooled 70% ethanol. Remove the supernatant, and allow the pellet to dry in the Savant SpeedVac Vacuum. 10. Dissolve the nucleic acid pellet in 20 µL of TE/RNase A buffer.

3.1.4. Restriction Enzyme Digestion and Southern Blot Hybridization 3.1.4.1. DNA DIGESTION WITH RESTRICTION ENZYMES, ELECTROPHORETIC SEPARATION, AND SOUTHERN BLOTS

The following protocol is for the DNA purified from cells harvested from two 100-mm culture plates (approx 1 × 107 cells). Prepare a bulk restriction enzyme cocktail buffer for analyses of multiple samples. 1. Put 20 µL of DNA preparation from under Subheading 3.1.3.2. in a sterile microfuge tube. 2. Add 4 µL of 10X suitable restriction enzyme digestion buffer and 10 units of a single-cut enzyme. Bring the reaction volume up to 40 µL by adding distilled water, and mix by tapping the tube. 3. Remove 20 µL of the mixture to a fresh microcentrifuge tube and add 7–10 U of Dpn I. Mix by tapping the tube.

Transient Transfection and Cell-Free Assays

339

4. For optimal digestion, incubate the reaction mixture for more than 12 h at 37°C. 5. Stop the reactions by adding one-fifth volume of 6X DNA gel-loading buffer. 6. Separate the digested DNA through a 0.8% regular agarose gel in 1X TAE buffer until the bromophenol blue (BPB) running dye reaches the bottom of the gel (see Note 13). 7. Soak the gel in 0.25 N HCl for approx 15 min until the BPB dye turns. After 10 more min, rinse the gel with distilled water and then blot with 0.4 N NaOH for 4 h by passive transfer to Nytran nylon membrane using the Schleicher & Schuell TurboBlotter™ device or other comparable apparatus. 8. Nucleic acid is crosslinked to the membrane by using a UV Stratalinker at the damp membrane setting.

3.1.4.2. DNA PROBE PREPARATION AND HYBRIDIZATION

Use linearized or supercoiled origin plasmid DNA as the template. Label the probe with [32P-α-]dCTP by random hexamer priming with the Megaprime DNA Labeling System. Denature the probe by boiling for 5 min prior to use. 3.1.4.3. DNA HYBRIDIZATION AND AUTORADIOGRAPHIC ANALYSIS 1. Sandwich the Nytran membranes between two sheets of Schleicher & Schuell 589-WH filter paper and place in the hybridization tubes. 2. Add 50 mL of hybridization buffer and then add denatured probe directly to the buffer. 2. Hybridize at 65°C overnight in the hybridization oven. 3. Wash the membrane twice in buffer I for 15 min at room temperature and then wash twice in buffer II for 15 min at 65°C. Dry the membrane in the air, wrap it in Saran Wrap, and expose to either X-ray film or a PhosphorImager plate. 6. Quantify the bands by using ImageQuant®.

3.2. Cell-Free Replication HPV cell-free replication is conducted with purified E1 and E2 proteins and mammalian crude cell extract containing cellular replication proteins. We routinely use human 293 cell extracts prepared from exponentially growing cultures. Cell-free replication requires supercoiled DNA as templates, because the E1 protein efficiently unwinds only supercoiled DNA (13). In neutral agarose gels, replication products are fast-migrating supercoiled Form I DNA, relaxed Form II DNA, and slow-migrating replication intermediates. Usually the intermediates dominate over the finished products. There can also be a ladder of topoisomers of the Form I DNA, because the cell extracts are relatively deficient in histones. The products are detected via 32P-α-dCTP (or another dNTP) incorporated into the DNA products. Any reaction that generates few or no replication intermediates is a failed reaction. The ladders of Form I and Form II DNA generated in those reactions

340

Lin, Broker, and Chow

represent repair synthesis of damaged template DNA. All the more reason that one should start with supercoiled DNA banded by CsCl–ethidium bromide equilibrium ultracentrifugation. When a reaction fails, the reason could be the quality of the cell extracts, the quality of the viral proteins, or both. To check the quality of the cell extracts, one could conduct a replication reaction on SV40 ori-containing plasmid in the presence of SV40 T antigen. Many cloning vectors contain the SV40 ori, and the commercially available SV40 T antigen is adequate for this purpose. In setting up the replication assay, we usually use approx 100–120 µg of cell extracts, the stock of which should be at least 10 mg/mL, and 40 ng of plasmid DNA, in a reaction of 25 µL. One then titrates the amounts of E1 and E2 proteins used in the reaction by changing one variable at a time. There is larger latitude in the range of E2 protein concentrations than the E1 protein concentration. In our hands, 8–20 ng of E2 protein is sufficient. A higher E2 concentration increases replication, but too high a concentration can reduce replication, because either it interferes with E1 dihexamer formation or it inhibits the E1 helicase activity ([13]; unpublished observation). For these reasons, we recommend titrating the E1 protein by setting the E2 at, for example, 15–20 ng. Fig. 2 is an example of cell-free replication in the presence of a fixed amount of E2 but a variable amount of the E1 protein. As discussed above, a high concentration of E1 (or DNA template) can result in ori-independent replication. The E2 protein, which interacts with E1 protein, can target E1 to the ori, enhancing ori-specific replication and suppressing replication of template that contains no ori. A relatively simple and convenient way to ensure ori-specific replication is to leave out the E2 protein. There should not be any high-molecular-weight replication intermediates. If there are, reduce the amount of E1 protein. In our hands, 10–30 ng of E1 protein is usually optimal, depending on the quality of the particular E1 protein preparation. Once the range of E1 protein is set, one can then vary the amounts of E2 to further optimize the replication assay. When setting up the system, it is advisable to be as thorough as possible by using ori and non-ori DNA as templates to ensure E2-dependent and ori-dependent replication. A simplified titration is advisable when one makes new preparations of E1 and E2 proteins.

3.2.1. Expression Plasmids E1 and E2 proteins can be expressed either from E. coli from inducible vectors such as pET vectors or from insect cells from recombinant baculoviruses. Tagging at the amino-terminus facilitates protein purification. For construction of bacterial expression vectors and recombinant baculoviruses, readers should consult other molecular technology manuals. The protocols below are for proteins that are epitope tagged.

Transient Transfection and Cell-Free Assays

341

Fig. 2. An autoradiogram illustrating the effect of human papillomavirus (HPV)-11 E1 protein concentration on the efficiency of cell-free DNA replication. Lanes 1–5, replication mixtures contained 40 ng of origin DNA, 100 µg of 293 cell extracts, appropriate buffer, 10 ng of purified E2 protein, and 25 ng, 20 ng, 15 ng, 10 ng, or 5 ng of purified E1 proteins, respectively. Lane 6, no EE-E1 protein. The absence of the slow-migrating RI in lane 6 indicates that the labeled Form I product represents repair synthesis on nicked or gapped DNA templates present in the DNA preparation, rather than a product of ori-specific DNA replication. This level of replication should be subtracted as background in processing replication achieved in lanes 1–5. See ref. 4 for ori-independent replication in the presence of high concentrations of E1 and ori DNA.

3.2.2. Viral Protein Expression 3.2.2.1. THE INDUCTION OF THE E1 AND E2 PROTEINS IN INSECT CELLS

The protocol for insect cell infection was adapted from Invitrogen MAXBAC™ Baculovirus Expression System User Manual Version 1.4. For infecting the suspension culture, the appropriate cell density is 1.5–2.0 × 106 cells/mL. Count the cells and determine the viability by trypan blue. Cells must be at least 98% viable. One liter of insect cells at 1–2 × 106 /mL are infected by either recombinant E1 or E2 baculovirus at multiplicity of infection (MOI) of 10, and cells are harvested 48–60 h after infection. 3.2.2.2. THE INDUCTION OF THE E1 AND E2 PROTEINS IN E. COLI

E1 and E2 genes are each cloned into a T7 promoter-based vector, pET, and expressed in E. coli BL21 (DE3) pLysS. For HPV-11 E1 protein, E. coli BL21 (DE3) pLysS is grown at 37°C overnight in LB medium containing 100 µg/mL ampicillin, followed by adding IPTG to 0.2 mM the next morning and a further

342

Lin, Broker, and Chow

incubation at 18°C for 24 h. For the E2 protein, E. coli BL21(DE3) pLysS is grown at 37°C in LB medium containing 100 µg/mL ampicillin to an OD600 of 0.8–0.9, followed by adding IPTG to 0.2–0.3 mM. The induction temperature is set to 18°C and the culture is then incubated for 15–16 h.

3.2.3. Viral Protein Purification 3.2.3.1. PURIFICATION OF HPV E1 PROTEIN

All the steps are conducted either in the 4°C cold room or on ice (4,13). 1. From insect cells: Approx 4 × 109 Sf9 cells are harvested by centrifugation at approx 900g for 10 min. Wash the pellet (approx 6 mL) two times with a total of 200 mL ice-cold 1X PBS, and then resuspend in 15 mL buffer A and keep on ice for 10 min. Disrupt the cells either by Dounce homogenization (approx 30 strokes) or with insect cell lysis buffer (resuspend the cells in 50 mL insect cell lysis buffer and vigorously shake for 1 min on ice). Harvest the nuclear pellet (approx 5 mL) by centrifugation at 2000g for 15 min and resuspend in 30 mL buffer B. Recover the nuclear soluble fraction by sonication (four times for 30 s each at 35–40 W power and 30 s pulse in between) and then centrifugation (24,500g for 20 min). 2. From E. coli: Harvest the induced bacterial cultures by centrifugation at 4000g for 15 min. Wash the cell pellet with PBS and then resuspend 6 L of cultures in 60 mL buffer Q. Recover the soluble fraction after sonication (four times for 30 s each at 48–56 W power and 30-s pulse in between) and centrifugation at 20,000g for 30 min (4,15). Keep the soluble fraction on ice for 15–30 min. If the bacterial lysis mixture is still very sticky, repeat sonication on ice until the bacterial chromosomal DNA is sheared, and then re centrifuge. 3. Pass the soluble fraction from steps 1 or 2 through a Q-Sepharose column (approx 10 mL of Sepharose beads packed into a 1.5 cm × 10 cm column) which has been pre-equilibrated in buffer Q. After loading the lysate, wash the column with lysis buffer. We use the Biologic LP chromatography system for this and subsequent steps (through Subheading 3.2.3.1., step 7). 4. Elute the protein from the column with buffer C. 5. Prepare Protein A–Sepharose CL-4B immunoaffinity column with the appropriate monoclonal antibody if the protein is epitope-tagged. The protocol for preparation of immunoaffinity column is as described by (23). Briefly, 6 mg monoclonal antibodies are conjugated to 5 mL of Protein A–Sepharose (Pharmacia Amersham). Pre-equilibrate the column in buffer C. 6. Apply the eluent from step 4 at 0.3 mL/min. Re-apply the flow-through over the immunoaffinity column to increase the yield. 7. Wash the column with buffer D until very little protein is detected in the flowthrough. Elute the E1 protein with 100 mM triethylamine buffer. Dialyze (with Pierce Slide-A-Lyzer® 10K Dialysis Cassettes) the eluted protein against the storage buffer at 4°C for 2 h at 1/1000 ratio. 8. Concentrate the protein with the Millipore® Centricon.

Transient Transfection and Cell-Free Assays

343

9. Western blot with antibody to E1 or to the epitope tag to establish identity. Analyze a small aliquot of the protein in a 10% SDS-PAGE for size and stain with Coomassie brilliant blue or a newer, more sensitive dye (see Note 14). Protein concentration is determined by comparison to a series of known dilutions of BSA. 10. Store the E1 protein in aliquots of 10–20 µL at 100 or 50 ng/µL (1 µg/ microcentrifuge tube) at –80°C. Once thawed, the E1 protein can be refrozen once, after which its activity is greatly reduced or abolished.

3.2.3.2. PURIFICATION OF HPV E2 PROTEINS 1. Lyse insect cells or bacterial cells as described under Subheading 3.2.3.1., steps 1–2. 2. For the soluble fraction from insect cells, pass the clarified supernatant through a 5-mL High S Econo-Pac® cartridge that has been pre-equilibrated with buffer Q. 3. Wash the S column with approx 20 mL buffer Q with 100 mM NaCl and elute with 15 mL of buffer C at the rate of 1 mL/min. Follow steps 8–10 under Subheading 3.2.3.1. for dialysis and storage. 4. Load the High S eluent onto an immunoaffinity column as described for the purification of epitope-tagged E1 protein. 5. Wash the affinity column with approx 30 mL buffer D. 6. Pre-equilibrate with 10 mM phosphate buffer (pH 6.8) before eluting with 100 mM triethylamine. 7. For bacterial lysates, adjust the soluble fraction with 5 M NaCl to a final concentration of 100 mM NaCl and apply it onto a 10-mL bed volume of MacroPrep® High Q medium which has been equilibrated with buffer Q containing 100 mM NaCl. 8. Load the High-Q flow-through onto a 1-mL High S Econo-Pac® cartridge preequilibrated with buffer Q containing 100 mM NaCl. 9. After washing with 20 mL buffer Q with 100 mM NaCl, elute the column with a linear 45-mL NaCl gradient from 100–800 mM NaCl in buffer Q. If the E2 purity is poor or the concentration is low, pool the peak fractions from S-column and load onto an immunoaffinity column (see Subheading 3.2.3.2., step 3).

3.2.4. Mammalian Cell Growth For preparation of cellular extracts, harvest monolayer 293 cells grown in DMEM supplemented with 10% calf serum to 70% confluence. Harvest suspension 293 cells grown in Joklik’s medium with 5% calf serum to a density of 5 × 105 cells/mL. The suspension cultures are expanded daily by growth to 1.5 × 105 cells/mL or every other day by growth to 2.5 × 105 cells/mL. Cells must be in log-phase growth.

3.2.5. Mammalian Cell Lysates The protocols for preparing cellular extracts from human 293 cells are adapted from Li and Kelly (24) and Stillman and Gluzman (25).

344

Lin, Broker, and Chow

1. To prepare approx 3-mL cell extracts sufficient for approx 300 cell-free replication assays, harvest 3.5 L of 5 × 105 cells/mL suspension cultures by centrifugation at 900g for 10 min at 4°C. Alternatively, monolayer cells at approx 70% confluence from 60 100-mm tissue-culture plates are harvested by trypsinization. Pellet the cells and resuspend in 25 mL of ice cold DMEM supplemented with 5% FBS. Collect the cells by centrifugation at 900g for 10 min at 4°C. 2. Carefully decant the medium and keep the cell pellet on ice. The volume of the pellet should be approx 4.2 mL. 3. Wash the pellet once with ice-cold PBS and once with ice-cold hypotonic buffer. Collect the cells by centrifugation at 900g for 10 min at 4°C. 4. Resuspend the cell pellet gently in 7 mL hypotonic buffer and incubate at 4°C for 10 min. 5. Lyse the cells by passing through a 25-gage needle (seven-eighths of an inch in length) seven times or by Dounce homogenization with a B pestle for approx 40 strokes. 6. Keep the lysate on ice for 30 min. 7. Separate the soluble extracts from cell debris by centrifugation at 10,000g for 10 min at 4°C using a Sorvall® SS34 rotor without applying the brake. 8. Determine the protein concentration using the Bradford assay. It should be at least 10 mg/mL. A lysate of lower concentration does not support replication adequately. 9. Aliquot the cell extract into 100-µL fractions, quick-freeze in liquid nitrogen, and then store at –80°C. The lysate can be refrozen a few times, after which the activity is reduced or lost.

3.2.6. Replication Assay A standard reaction mixture of 25 µL contains optimal amounts of HPV-11 E1 and E2 proteins, 40 ng of HPV origin DNA, 100–120 µg of active 293 cellular extract, and reaction buffer mix with 32P-α-dCTP (see Subheading 2.3.) (4,5,7,9,11,13,15). Reiterative titrations of the viral proteins are best conducted using 40 ng supercoiled ori DNA and 100–120 µg cell extracts by varying E1 or E2 protein concentration (see general guidance in Subheading 3.2.).

3.2.7. Processing Replication Products 1. For each reaction, combine the reagents into a 1.8-mL tube on ice in the following order: (1) 17 µL replication mixture (see Subheading 2.3.), which includes cell extracts, reaction buffer, substrates, ATP-regenerating system, and ori DNA, (2) E2 protein, (3) E1 protein; adjust the final volume to 24 µL with sterile H2O. Mix the contents gently by tapping, and place it in 37°C water bath for 1 h. This pre-incubation step serves two purposes. The first is to allow the preinitiation complex to form. The second is to allow any repair synthesis to occur in the absence of 32P-α-dCTP. 2. Add 1 µL of 32P-α-dCTP labeling mixture. Mix by gentle pipetting.

Transient Transfection and Cell-Free Assays

345

3. Incubate the reaction mixture in a 37°C water bath for 1 h. 4. Terminate the reaction by adding 204 µL of the stop solution, and place it in a 37°C water bath for 30 min. 5. Extract the solution with an equal volume of phenol/chloroform/isoamyl alcohol. Add 100 µL of 7.5 M ammonium acetate and 800 µL of 100% ethanol to precipitate the DNA at –80°C for 15 min. 6. Centrifuge at the maximum speed in a microfuge for 15 min. Remove the supernatant with a Pipetman or equivalent. Wash the DNA pellet with 800 µL of cold (–20°C), 70% ethanol. Vacuum-dry the pellet. 7. Dissolve the DNA pellet in 15 µL TE buffer and add 3 µL DNA loading dye. 8. Apply the DNA samples to a 0.8% agarose gel (14 cm × 11 cm) (prepare and run in 1X TAE buffer) and electrophorese at 100 V for approx 3–4 h, until the BPB dye reaches the bottom of the gel. 9. Soak the gel in 10% methanol/10% acetic acid buffer for 15 min. Dry the gel under vacuum at 45°C for 1 h.

3.2.8. Autoradiography and Data Analysis Expose the gel to either X-ray film or a PhosphorImager plate for 2 h to overnight. For quantification, X-ray film can be scanned with a densitometer. Data from the PhosphorImager can be analyzed with ImageQuant or equivalent software. 4. Notes 1. Green fluorescent protein (GFP) fusion proteins are more stable than native proteins, and vectors of fusion protein using the CMV promoter can support transient replication (19,26). 2. HeLa cell extracts support HPV ori replication poorly due to a deficiency of available cyclin E/cdk2, and should be avoided (8). 3. Native E2 protein can also be purified easily (4). 4. For consistent and high-quality DNA preparation, we prefer using supercoiled DNA purified by banding in CsCl–ethidium bromide equilibrium density gradients to that obtained through commercial kits. The quality of the plasmid DNA is important for the transfection and for cell-free replication as well. 5. We usually use an ori DNA segment of 300 bp in length cloned in a common vector such as pUC19 (or other similar vectors). This region contains three copies of E2BS flanking a single E1BS. A longer region containing four copies E2BS also works. 6. Cuvettes can be cleaned by flushing with distilled water and sterilizing by irradiation in the UV Stratalinker; they may be reused a few times. 7. Monoclonal antibodies from hybridoma culture medium can be purified by precipitation with ammonium sulfate and column chromatography. For technical details, readers should consult Antibodies: A Laboratory Manual, Chapter 8, by Harlow and Lane (23).

346

Lin, Broker, and Chow

8. This system or any comparable system that has a UV detector to follow the protein profile, a computer to record elution profiles, and a fraction collector for collecting eluent will facilitate protein purification. 9. PCR-based methods to quantify transient replication have also been reported (27,28) (see Chapter 25). 10. The loss of the E1 and E2 expression vectors serves as an indicator for complete Dpn I digestion of unreplicated DNA. However, over-digestion by using excess Dpn I enzyme could reduce the detection of hemimethylated, replicated DNA. 11. DNA/Ca-phosphate precipitates should also work. But transfection efficiency may be inconsistent among different precipitates and among different investigators. This may become an issue if one plans to compare protein mutations, ori mutations, or replication inhibitors. Electroporation under identical control settings eliminates this variable. 12. The cell line must have a good transfection efficiency of over 10% (2). Under these conditions, the transfection efficiency was 10–50%, depending on the cell lines. One may need to modify the voltage to obtain the best results for any particular cell line. The easiest test is to transfect a plasmid expressing the enhanced GFP to assess the cell viability and transfection efficiency, if an inverted microscope with fluorescence optics is available 13. If a relatively large origin DNA was used, the running time should be lengthened for good separation of DNA fragments of different lengths. 14. The E1 protein has an apparent molecular mass of over 80 kDa by SDS-PAGE.

Acknowledgments The research was supported by USPHS CA38200 and CA83675. We gratefully acknowledge all our past and present students and postdoctoral fellows who have initiated this research. We also thank our many collaborators. Their invaluable contributions have made this research possible. References 1. Yang, L., Li, R., Mohr, I. J., Clark, R., and Botchan, M. R. (1991) Activation of BPV-1 replication in vitro by the transcription factor E2. Nature 353, 628–632. 2. Ustav, M. and Stenlund, A. (1991) Transient replication of BPV-1 requires two viral polypeptides encoded by the E1 and E2 open reading frames. EMBO J. 10, 449–457. 3. Chiang, C.-M., Ustav, M., Stenlund, A., Ho, T. F., Broker, T. R., and Chow, L. T. (1992b) Viral E1 and E2 proteins support replication of homologous and heterologous papillomaviral origins. Proc. Natl. Acad. Sci. USA 89, 5799–5803. 4. Kuo, S.-R., Liu, J.-S., Broker, T. R., and Chow, L. T. (1994) Cell-free replication of the human papillomavirus DNA with homologous viral E1 and E2 proteins and human cell extracts. J. Biol. Chem. 269, 24,058–24,065. 5. Lee, K. Y., Broker, T. R., and Chow, L. T. (1998) Transcription factor YY1 represses cell-free replication from human papillomavirus origins. J. Virol. 72, 4911–4917.

Transient Transfection and Cell-Free Assays

347

6. Kasukawa, H., Howley, P. M., and Benson, J. D. (1998) A fifteen-amino-acid peptide inhibits human papillomavirus E1-E2 interaction and human papillomavirus DNA replication in vitro. J. Virol. 72, 8166–8173. 7. Ma, T., Zou, N., Lin, B.-Y., Chow, L. T., and Harper, J. W. (1999) Interaction between cyclin-dependent kinases and human papillomavirus replication—initiation protein E1 is required for efficient viral replication. Proc. Natl. Acad. Sci. USA 96, 382–387. 8. Lin, B.-Y., Ma, T., Liu, J.-S., et al. (2000) HeLa cells are phenotypically limiting in cyclin E/ CDK2 for efficient human papillomavirus DNA replication. J. Biol. Chem. 275, 6167–6174. 9. Conger, K. L., Liu, J.-S., Kuo, S.-R., Chow, L. T., and Wang, T. S.-F. (1999) Human papillomavirus DNA replication. Interactions between the viral E1 protein and two subunits of human DNA polymerase alpha/primase. J. Biol. Chem. 274, 2696–2705. 10. Bonne-Andrea, C., Santucci, S., Clertant, P., and Tillier, F. (1995) Bovine papillomavirus E1 protein binds specifically DNA polymerase alpha but not replication protein A. J. Virol. 69, 2341–2350. 11. Liu, J.-S., Kuo, S.-R., Makhov, A. M., et al. (1998) Human Hsp70 and Hsp40 chaperone proteins facilitate human papillomavirus-11 E1 protein binding to the origin and stimulate cell-free DNA replication. J. Biol. Chem. 273, 30,704–30,712. 12. Han, Y., Loo, Y. M., Militello, K. T., and Melendy, T. (1999) Interactions of the papovavirus DNA replication initiator proteins, bovine papillomavirus type 1 E1 and simian virus 40 large T antigen, with human replication protein A. J. Virol. 73, 4899–4907. 13. Lin, B.-Y., Makhov, A. M., Griffith, J. D., Broker, T. R., and Chow, L. T. (2002) Chaperone proteins abrogate inhibition of the human papillomavirus (HPV) E1 replicative helicase by the E2 protein. Mol. Cell. Biol. 22, 6592–6604. 14. Chiang, C.-M., Dong, G., Broker, T. R., and Chow, L. T. (1992a) Control of human papillomavirus type 11 origin of replication by the E2 family of transcription regulatory proteins. J. Virol. 66, 5224–5231. 15. Liu, J.-S., Kuo, S.-R., Broker, T. R., and Chow, L. T. (1995) The functions of the human papillomavirus type 11 E1, E2 and E2C proteins in cell-free DNA replication. J. Biol. Chem. 270, 27283–27291. 16. Kaufman, R. J. and Murtha, P. (1987) Translational control mediated by eucaryotic initiation factor-2 is restricted to specific mRNAs in transfected cells. Mol. Cell. Biol. 7, 1568–1571. 17. Ustav, M., Ustav, E., Szymanski, P., and Stenlund, A. (1991) Identification of the origin of replication of bovine papillomavirus and characterization of the viral origin recognition factor E1. EMBO J. 10, 4321–4329. 18. Piirsoo, M., Ustav, E., Mandel, T., Stenlund, A., and Ustav, M. (1996) Cis and trans requirements for stable episomal maintenance of the BPV-1 replicator. EMBO J. 15, 1–11. 19. Deng, W., Jin, G., Lin, B.-Y., Van Tine, B. A., Broker, T. R., and Chow, L. T. (2003) mRNA splicing regulates human papillomavirus type 11 E1 protein production and DNA replication. J. Virol. 77, 10,213–10,226.

348

Lin, Broker, and Chow

20. Kingston, R. E., Chen, C. A., and Okayama, H. (1987) Introduction of DNA into mammalian cells. In Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., et al., eds), John Wiley & Sons, Inc., New York, pp. 9.0.3–9.0.6. 21. Sambrook, J. and Russell, D. W. (2001) Introducing cloned genes into cultured mammalian cells. In Molecular Cloning: A Laboratory Manual (Sambrook, J. and Russell, D. W., eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY: pp. 16.1–16.62. 22. Hirt, B. (1967) Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26, 365–369. 23. Harlow, E. and Lane, D. (1988) Immunoaffinity purification. In Antibodies: A Laboratory Manual (Harlow, E. and Lane, D., eds), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY: pp. 511–552. 24. Li, J. J. and Kelley, T. J. (1984) Simian virus 40 DNA replication in vitro. Proc. Natl. Acad. Sci. USA 81, 6973–6977. 25. Stillman, B. and Gluzman, Y. (1985) Replication and supercoiling of simian virus 40 DNA in cell extracts from human cells. Mol. Cell. Biol. 5, 2051–2060. 26. Zou, N., Lin, B.-Y., Duan, F., et al. (2000) The hinge of the human papillomavirus type 11 E2 protein contains major determinants for nuclear localization and nuclear matrix association. J. Virol. 74, 3761–3770. 27. Taylor, E. R. and Morgan, I. M. (2003) A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication. Virology 315, 103–109. 28. Titolo, S., Brault, K., Majewski, J., White, P. W., and Archambault, J. (2003). Characterization of the minimal DNA binding domain of the human papillomavirus E1 helicase: fluorescence anisotropy studies and characterization of a dimerization-defective mutant protein. J. Virol. 77, 5178–5191.

Quantitation of HPV DNA Replication

349

25 Detection and Quantitation of HPV DNA Replication by Southern Blotting and Real-time PCR Iain M. Morgan and Ewan R. Taylor Summary This provides a brief introduction into the mechanism of DNA replication by the E1 and E2 proteins and describes the traditional Southern blotting technique that is used to monitor E1- and E2-mediated DNA replication. It also includes a novel real-time polymerase chain reaction (PCR) approach for monitoring E1- and E2-mediated DNA replication that has enhanced sensitivity and quantitation compared with Southern blotting, and a discussion of when to use the Southern blotting and real-time PCR techniques.

1. Introduction The viral proteins E1 and E2 mediate replication of human papillomavirus (HPV) genomes (1). The origin of replication is located in the long control region (LCR) of the HPV genome and consists of an A/T-rich sequence flanked by three E2 DNA binding sequences (2). The E2 protein forms homodimers and binds to 12-bp palindromic DNA sequences. There are four E2 binding sites in the HPV-16 LCR; following binding to the LCR, E2 can regulate transcription from the adjacent promoter, and therefore regulate E6 and E7 expression (3–5). The amino-terminal domain of E2 also interacts with the viral E1 protein; the consequence of this interaction is recruitment of the E1 protein to the viral origin of replication, resulting in interaction with the A/Trich sequence. Following recruitment of E1 to the origin of replication, this protein initiates DNA synthesis and is the major viral replication factor. It is not clear whether the E2 protein plays additional roles to that of E1 recruitment in HPV DNA replication. In order to dissect E1- and E2-mediated DNA replication, a transient DNA replication assay has been developed (6). This assay involves the transfection of at least three plasmids into cell lines—one plasmid containing the origin of From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

349

350

Morgan and Taylor

DNA replication, one capable of expressing the E1 protein, and one capable of expressing the E2 protein. The E1 and E2 proteins are expressed in the transfected cells, bind to the viral origin of replication, and replicate the plasmid containing this sequence. After 2–3 d, low-molecular-weight DNA is harvested from the transfected cells and digested with an enzyme that will linearize the replicated plasmid. The DNA is also digested with Dpn1; this is a frequent cutter, with a 4-bp recognition site that must be dam methylated in order for Dpn1 to recognize and cut the site. This type of methylation occurs only in bacteria, and therefore the input plasmids used in the transfection (prepared in bacteria) are digested into small fragments following Dpn1 treatment. The freshly replicated DNA is left undigested with Dpn1; the digested DNA is then analyzed using Southern blotting to identify the freshly replicated DNA. We have recently adapted this technique to use real-time polymerase chain reaction (PCR) to monitor E1- and E2-mediated DNA replication, and this provides enhanced quantitation (7). This chapter describes the traditional Southern blotting technique and our recent adaptation for HPV 16. Figure 1 diagrams the steps required to carry out both of these techniques. See also Chapter 24 for similar methods using HPV 11. 2. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

Cell line, e.g., C33a (ATCC). Plasmids pOri, pOri16M, pCMV-E1, pCMV-E2 ([email protected]). 2.5 M CaCl2. 2X HEPES-buffered saline (HBS): 280 mM NaCl, 1.5 mM Na2HPO4·2H2O, 50 mM HEPES (pH adjusted to 7.05 with 0.1 M NaOH). Hirt solution: 0.6% SDS, 10 mM ethylenediaminetetraacetic acid (EDTA). 5 M NaCl. Phenol:chloroform:isoamyl alcohol (25:24:1 v/v). 3 M Sodium acetate (pH 5.2). Ethanol (100% and 70%). DpnI, MboI, XmnI, PvuII restriction enzymes. Restriction enzyme buffer 2 (New England Biolabs; NEB): 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol (pH 7.9). Bovine serum albumin (BSA) (1 mg/mL). Prime It II probe labeling kit (Stratagene). Redivue α 32P dCTP (Amersham). NICK columns (Amersham). Tris-EDTA :10 mM Tris-HCl (pH 7.5), 1 mM EDTA. 3 MM filter paper. Hybond-N nylon membrane (Amersham). 20X SSC: 3 M NaCl, 0.3 M tri-sodium citrate. Denaturation solution: 1.5 M NaCl, 0.5 M NaOH. Neutralization solution: 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.0).

Quantitation of HPV DNA Replication

351

Fig. 1. Outline of transient DNA replication assay and the methods for replicated pOri16M detection. The human papillomavirus (HPV)16 Ori-containing plasmid (pOri16M) and the E1 and E2 expression plasmids are transfected into the target cell line. Three days post transfection, low-molecular-weight DNA is harvested. In the harvested DNA there are the bacterially dam-methylated plasmids (pOri16M, pCMV-E1, and pCMV-E2) that were initially transfected, and the freshly replicated unmethylated pOri16M plasmid DNA. For Southern blot detection, all plasmid DNA is linearized by XmnI digestion. Subsequent digestion with DpnI multiply digests the transfected dam-methylated DNA; the unmethylated replicated DNA is DpnI resistant. Agarose gel electrophoresis and subsequent Southern blotting using a pOri16derived probe allows the detection of replicated pOri16M at 3 kb, and input pOri16M, pCMV-E1, and pCMV-E2 at approx 1 kb. For real-time polymerase chain reaction (PCR) detection of replicated pOri16M, all dam-methylated input plasmid DNA is digested with DpnI, the unmethylated replicated DNA is DpnI resistant. A subsequent treatment of the sample with exonuclease III results in the digestion of all DpnI-treated DNA. The replicated pOri16M plasmid is detected by real-time PCR using a primer and probe set specific for the pOri16M plasmid.

352

Morgan and Taylor

22. 10X loading buffer: 65% (w/v) sucrose, 10 mM Tris-HCl (pH7.5), 10 mM EDTA, 0.3% (w/v) bromophenol blue. 23. Spectrolinker XL1500 UVC light box (Spectronics Corporation). 24. Exo Klenow DNA polymerase. 25. dNTPs: 200 µM dATP, dGTP, dTTP (Roche). 26. 0.5X TBE: 5.4 g Tris base, 2.75 g boric acid, 2 mL 0.5 M EDTA (pH 8.0). 27. 1% Agarose gel buffered with 0.5X TBE containing 0.5 µg/mL ethidium bromide. 28. DNA kb ladder. 29. QIAquick Gel Extraction Kit (Qiagen). 30. Hybridization oven and tubes (Hybaid). 31. QuikHyb hybridization solution (Stratagene). 32. 2X SSC with 0.1% sodium dodecyl sulfate (SDS). 33. 0.1X SSC with 0.1% SDS. 34. Storm 840 Phosphorimager, screens, and ImageQuant software (Amersham). 35. Exonuclease III. 36. AmpliTaq. 37. Oligonucleotides (Invitrogen). 38. Dual labeled probe (Cruachem Ltd). 39. Geneamp PCR buffer (Applied Biosystems). 40. 1 M MgCl2 (Sigma). 41. ABI 7700 light cycler, 96-well plates, and sequence detector software (Applied Biosystems). 42. Fetal calf serum (Invitrogen). 43. Dulbecco’s modified Eagle’s medium (DMEM) glutamax (Invitrogen). 44. Penicillin and streptomycin solution (Invitrogen). 45. Trypsin solution (Invitrogen). 46. Cell scrapers. 47. Phosphate-buffered saline (PBS): 0.01 M phosphate buffer, 0.0027 M KCl, 0.137 M NaCl (pH 7.4). 48. Forward primer 5'ATCGGTTGAACCGAAACCG 3'. 49. Reverse primer 5'TAACTTCTGGGTCGCTCCTG 3'. 50. Probe 5'FAM-ACCAAAAGAGAACTGCAATGTTTCAGGATCC-TAMRA 3'.

3. Methods The methods described below outline (1) the transfection of cells with DNA, (2) harvesting of low-molecular-weight DNA from cells and its treatment with restriction enzymes, (3) the Southern blotting analysis of the harvested and digested DNA, and (4) real-time PCR analysis of the harvested and digested DNA.

3.1. Transfection of Cells The cell line that is routinely used in our lab for the analysis of HPV-16 E1 and E2 DNA replication is C33a. This cell line was derived from a cervical carcinoma and contains no endogenous HPV sequences that may express proteins and interfere with the analysis of exogenously introduced proteins.

Quantitation of HPV DNA Replication

353

3.1.1. Plasmid Vectors Required for the Transient DNA Replication Assay Three plasmids are required to carry out a transient DNA replication assay; a plasmid containing the HPV origin of replication (pOri), a plasmid that results in expression of E1 (pCMV-E1), and a plasmid that results in expression of E2 (pCMV-E2). Our plasmids are all based on the HPV-16 virus and have been described and used in DNA replication assays (6,8). For the real-time PCR protocol, the pOri plasmid was adapted by introducing a Dpn1 site (7) to assist in differentiating the freshly replicated from the input plasmid in the real-time PCR protocol (see below for details). The resulting plasmid was called pOri16M and was used in all of the Southern blotting and real-time DNA replication assays described here.

3.1.2. Preparation of the Calcium Phosphate Cocktail and Transfection of the Cells 1. Plate 6 × 105 cells per 100-mm dish. 2. The following day, prepare the calcium phosphate solution by mixing 500 µL of a solution containing the plasmid DNA in 250 mM CaCl2 (see Table 1) dropwise with gentle mixing to 500 µL of 2X HBS. 3. The mixture is then incubated for 30 min at room temperature. 4. The 1-mL solution is then added to the 100-mm dish containing the cells and 10 mL of medium. This should be done last thing in the day. 5. The following morning, remove the medium, wash the cell monolayer twice with 10 mL of PBS, and re-feed with medium containing 10% fetal calf serum (FCS). You should observe some dead cells prior to washing as a result of the toxicity of the precipitate, but the cells should look healthy following washing and re-feeding.

3.2. Harvesting Low-Molecular-Weight DNA From the Transfected Cells and Digestion With Restriction Enzymes 3.2.1. Harvesting Low-Molecular-Weight DNA 1. Three days posttransfection, remove the medium and wash the monolayer twice with 10 mL of PBS. 2. To lyse the cells, add 800 µL of Hirt solution and incubate at room temperature for 5 min. 3. Using a cell scraper, transfer the Hirt solution to a 1.5-mL microcentrifuge tube. 4. Add 200 µL of 5 M NaCl and incubate overnight at 4°C. 5. Centrifuge the samples (20,000g, 30 min, 4°C) and transfer the supernatant to a fresh 1.5-mL tube. 6. Add an equal volume of phenol:chloroform:isoamyl alcohol (24:24:1 v/v/v) to the cell extract. 7. Mix the aqueous DNA and organic phases by vortexing and separate by centrifugation in a microfuge (20,000g, 5 min, room temperature). 8. Carefully remove the upper aqueous phase (making sure none of the interphase is taken) and transfer to a clean 1.5-mL tube.

354

Morgan and Taylor

Table 1 Typical Replication Assay CaCl2–DNA Mixture

1 2 3 4 5 6 7 8

pOri16M

pCMV–E1

10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL) 10 µL (@ 100 ng/µL)

– 5 µL (@ 1 µg/ µL) – 5 µL (@ 1 µg/µL) 5 µL (@ 1 µg/µL) 5 µL (@ 1 µg/µL) 5 µL (@ 1 µg/µL) 5 µL (@ 1 µg/ µL)

pCMV–E2

pCMV

10 µL (@ 1 µg/µL) 5 µL – (@ 1 µg/µL) 10 µL 9 µL (@ 100 ng/µL) (@ 1 µg/µL) 10 µL 5 µL (@ 100 pg/µL) (@ 1 µg/µL) 10 µL 5 µL (@ 1 ng/µL) (@ 1 µg/µL) 10 µL 5 µL (@ 10 ng/µL) (@ 1 µg/µL) 10 µL 4 µL (@ 100 ng/µL) (@ 1 µg/µL) 5 µL – (@ 1 µg/µL) –

2.5 M CaCl2

H2 O

50 µL

430 µL

50 µL

430 µL

50 µL

421 µL

50 µL

420 µL

50 µL

420 µL

50 µL

420 µL

50 µL

421 µL

50 µL

430 µL

9. Precipitate the DNA by adding 1/10th volume of 3 M sodium acetate (pH 5.2) and 2 volumes of 100% ethanol. Mix and leave at –20°C for 1 h. 10. Pellet the DNA by centrifugation (20,000g, 20 min, 4°C), wash with 500 µL 70% ethanol to remove any traces of salt, and centrifuge again (20,000g, 5 min, 4°C). 11. Remove the ethanol and air-dry the DNA pellet. 12. Resuspend the pellet in 100 µL of sterile distilled water.

3.2.2. Restriction Enzyme Digestion of the Harvested Low-Molecular-Weight DNA 1. Aliquot 25 µL of the DNA solution into a fresh 1.5-mL tube. 2. Make the volume up to 50 µL with 1X NEB buffer 2, 10 U of Xmn1, 10 U of Dpn1, 100 µg/mL BSA, and sterile water. 3. Incubate overnight at 37°C. The sample is then ready for loading onto an agarose gel.

3.3. Detection of DNA Molecules Replicated by E1 and E2 Using Southern Blotting The traditional method for the detection of E1- and E2-mediated DNA replication is Southern blotting. Below is a detailed description of this technique as carried out in our lab (see Notes 1–4).

Quantitation of HPV DNA Replication

355

Fig. 2. Southern blot of E1/E2-dependent DNA replication in C33a cells. The replication template, pOri16M, and the E1 and E2 expression vectors were transfected as indicated. Seventy-two hours later, low-molecular-weight DNA was harvested and digested by Xmn1 and Dpn1. The Southern blot of the samples shows the digested input plasmid DNA at approx 1.2 kb and the replicated pOri16M band at 3 kb. Linearized pOri16M is loaded at 40 pg, 10 pg, and 4 pg as markers in the left three lanes.

3.3.1. Electrophoresing the Digested DNA Through an Agarose Gel 1. Prepare a 1% agarose gel in 0.5X TBE. 2. After it sets, place the gel in a tank containing 0.5X TBE, 0.5 µg/mL ethidium bromide. 3. The samples prepared under Subheading 3.2.2. are made up to 55 µL using 10X loading buffer and then loaded into the wells on the agarose gel. A 1-kb DNA ladder is loaded into the first well in the gel. 4. Separate the DNA by running at 70–100 V constant voltage until the dye front is 1–3 cm from the end of the gel. Load an Xmn1-digested linearized pOri16M plasmid in free lanes to provide a reference for size and quantity (4 pg, 10 pg, 40 pg, see Fig. 2). 5. Visualize the separated DNA by illumination on a short wave (312 nm) ultraviolet (UV) light box. Place a ruler by the side of the gel and take a photograph for future reference (in the photograph make sure the ruler is visible).

356

Morgan and Taylor

3.3.2. Preparation of the Agarose Gel for Southern Blotting 1. Wash the gel in distilled water and agitate gently in denaturation solution for 2 × 30 min. 2. Wash the gel in distilled water and agitate gently in neutralization solution for 2 × 30 min. 3. Finally, rinse the gel twice in distilled water.

3.3.3. Southern Blotting of the Agarose Gel 1. Place 20X SSC solution in a glass dish. 2. Place two 3MM paper wicks on a platform above the 20X SSC in order to draw the SSC upward. 3. Place three squares of 20X SSC-soaked 3MM filter paper the size of the gel on top of the platform covered with the wicks. 4. Place the gel on top of the squares of 3MM paper. 5. Cut a square of Hybond-N nylon membrane the same size as the gel and presoak in distilled water for 5 min. 6. Place the nylon membrane onto the gel. 7. Place five dry squares of 3MM paper (cut to the same size as the gel) on top of the membrane. 8. Stack paper towels on top to a depth of 4 cm and gently compress overnight with a 200-g weight to assist transfer. 9. The following morning, disassemble the tower and briefly wash the Hybond-N membrane in 2X SSC. 10. Crosslink the DNA to the membrane through irradiation with 1600 J/m2 of UVC at 254 nm using a Spectrolinker XL1500. 11. Finally, bake the membrane for >1 h at 80°C in a hybridization oven.

3.3.4. Probing the Southern Blot 1. Digest 2 µg of pOri16M with 10 U of PvuII and run on a 0.5X TBE, 1% agarose gel. 2. Cut the agarose containing the resultant 700-bp fragment out of the gel and purify the DNA using the QIAquick Gel Extraction Kit. 3. Using the Stratagene Prime-it II® random primer labeling kit according to the manufacturer’s instructions, label 25 ng of the DNA fragment by incubating at 37°C for 10 min in a reaction containing random 9mer primers, 5U of Exo Klenow DNA polymerase, 200 µM dATP, dGTP, and dTTP, and 5 µL of Redivue α 32P dCTP (50 µCi). 4. Purify the probe using a NICK Column according to manufacturer’s instructions. The purified probe is eluted with 400 µL of TE buffer and stored at –20°C in a lead-lined pot. 5. Incubate the nylon membrane prepared under Subheading 3.3.3. with 15 mL of QuickHyb hybridization solution in a conical hybridization tube. Revolve in a hybridization oven for 1 h at 68°C. 6. Incubate the probe for 5 min in a boiling-water bath and mix 100 µL with 1 mL of warm Quickhyb solution.

Quantitation of HPV DNA Replication

357

7. Add the probe to the hybridization tube and incubate at 68°C for 1 h. The probe hybridizes with pOri16M and all pCMV-derived vectors. 8. Wash the membrane twice for 15 min at room temperature with 2X SSC/0.1% (w/v) SDS solution. 9. Wash the membrane once for 40 min at 60°C with a 0.1X SSC/0.1% (w/v) SDS solution. 10. Seal the membrane in Saran wrap and expose to a phosphor screen overnight.

3.3.5. Analysis and Quantitation of the Southern Blot 1. Develop the image stored on the phosphor screen using a Storm™ 840 image system and visualize using ImageQuant™ software. 2. Measure the strength of replication by measuring the intensity of the bands representing the replicated DNA molecules.

3.4. Using Real-Time PCR Analysis to Quantitate E1- and E2-Mediated DNA Replication The use of Southern blotting for the analysis of E1- and E2-mediated DNA replication is far from ideal. This technique is hazardous, due to radioactivity; time consuming, as it takes 2 wk from initial setting up of cells until result; semi-quantitative, as a result of differential transfer of DNA onto membrane from the gel and from differential hybridization of the probe to the membrane; and sample limiting, as only so many samples can be run down an agarose gel at one time. To overcome all of these problems, we have developed a real-time PCR assay for the detection of E1- and E2-mediated DNA replication. This technique is an adaptation of the Southern blotting technique; the cell transfection and the harvesting of the low-molecular-weight DNA is carried out exactly as described under Subheadings 3.1.1., 3.1.2., and 3.2.1. See Note 5 for a discussion of when to use either of the techniques and Notes 6–8 for a description of some of the problems that can arise and their resolutions. Figure 3 represents the results of a typical experiment carried out in C33a cells and analyzed using this technique.

3.4.1. Preparation of the Harvested DNA for Real-Time PCR Analysis 1. Digest 25 µL of the DNA harvested from the cell and prepared as described under Subheading 3.2.1. overnight with Dpn1 in a final volume of 50 µL. 2. The following morning, treat the Dpn1-digested sample with 100 U of exonuclease III for 30 min. 3. Incubate the reaction for 30 min at 70°C to de-activate the exonuclease III.

3.4.2. Real-Time PCR Analysis of Harvested and Enzyme-Treated DNA 1. Incubate 30 µL of the sample prepared under Subheading 3.4.1. in a solution containing 5.5 mM MgCl2; 200 µM dATP, dCTP, and dGTP; 400 µM dUTP;

358

Morgan and Taylor

Fig. 3. An example of the results obtained using the real-time polymerase chain reaction (PCR) technique to monitor DNA replication. C33a cells were transfected with pOri16M, pCMV-E1, and pCMV-E2 as indicated (see Table 1 also). 72 h later, low-molecular-weight DNA was harvested and digested with Dpn1 and exonuclease III. The replicated pOri16M was detected in these samples using real-time PCR, and the values obtained are graphed as pg on an exponential scale.

900 nM of each primer; 100 nM probe, 1 U Amplitaq®, in 1X Geneamp® buffer at a final volume of 150 µL (see Note 9 for details of the primers and probe). 2. Aliquot 50 µL of this into 3 × well in a 96-well real-time plate. 3. Measure the quantity of pOri16M DNA detectable in the sample by assaying the real-time PCR plate on an ABI Prism 7700 using the universal real-time PCR conditions (95°C 10 min hot-start, 95°C for 30 s, and 60°C for 1 min, in 40 cycles).

3.4.3. Analysis of the Real-Time PCR Data 1. Analyze the real-time PCR data using the Sequence Detector 1.7 software. This calculates the standard curve (from 12 steps of 100 pg to 10–5 pg of pOri16M) and the quantity of DNA for each individual sample well.

Quantitation of HPV DNA Replication

359

2. Run each digested sample (see Subheading 3.4.2.) in triplicate. For each sample, calculate the final quantity of DNA present by taking the average of the two least divergent samples. This undigested pOri16M represents the replicated molecules.

4. Notes 1. If there is nothing detectable on the Southern blot, check that your technique is working by simply adding defined amounts of linearized pOri16M on a gel and Southern blotting. It should be easy to detect down to 4 pg of DNA using this technique; if you are not, then this problem must be solved before proceeding further. The problem could be probe preparation, gel preparation, transfer to membrane, or hybridization of probe to membrane. 2. If there is detectable input DNA on the Southern blot but there are no replicated molecules, then a range of E2 concentrations should be tried when first attempting the DNA replication assay. Too little E2 co-transfected will result in no replication; too much and there is squelching that again results in no, or poor, DNA replication. A typical window of concentrations to try would be 1 ng, 10 ng, 100 ng, and 1000 ng. The pOri16M can also be limiting, and it is also advisable to test a variety of pOri16M concentrations. 3. If there is detectable input DNA on the Southern blot but there are no replicated molecules, and the assay has been tried with a variety of E2 and pOri16M concentrations, remember that this is a replication assay, and therefore the cells must be healthy and dividing in order for good replication to occur. It is necessary to test any new cell line at a number of cell densities in this assay. If too dense or sparse, the cells will not replicate well and will also be susceptible to increased toxicity following the calcium phosphate precipitation technique. 4. A smear or unexpected bands down one or more of the lanes usually indicates a partial digest with either the Xmn1 or the Dpn1; test that these enzymes are still working. Occasionally this can be due to the actual sample itself; care must be taken when doing the DNA preparation to follow the protocol detailed above, in particular to ensure that the phenol/chloroform extraction proceeded well and that the aqueous/phenol interface is not disrupted during removal of the aqueous phase. Additionally, incomplete digestion may occur when too much DNA is digested in too small a volume. A simple remedy for this is to digest the DNA in a larger total volume and then ethanol precipitate the digested DNA to concentrate it for loading onto an agarose gel. Incomplete DNA digestion can be identified by two methods: a. When the agarose gel is UV-illuminated, samples that have been sufficiently digested will appear to have a faint maximal intensity just above 12 kb and the DNA will smear down the gel (see Fig. 4). In samples where the digest has been poor, there will be a strong band of cellular DNA just above 12 kb with a lesser smear down the gel (see lanes 13, 15, 16, and 18 in Fig. 4). These observations highlight the efficiency of Xmn1 digestion of cellular DNA; however, they closely reflect the efficiency of Dpn1 digestion also.

360

Morgan and Taylor

Fig. 4. Image of an agarose gel prepared for Southern blot. Hirt-extracted DNA was treated with Xmn1 and Dpn1, and the digested DNA was separated on an agarose gel. The DNA was visualized by ethidium bromide/ultraviolet illumination. Loaded on the left of the gel is a 1-kb DNA marker ladder, and the sizes of selected bands are shown in kb. Lanes 1–18 contain DNA digested with Dpn1 and Xmn1. The restriction-enzyme digest has worked efficiently in all lanes except 13, 15, 16, and 18. See Note 4 for an explanation of this potential problem as well as possible solutions. b. A probe that can hybridize to both pOri16M- and pCMV-derived vectors ensures that the replicated pOri16M observed on a Southern blot of Xmn1/ Dpn1-digested DNA is due to bona fide replication and not due to a failure of the Dpn1 digest. On blots where there is an incomplete Dpn1 digestion, there will be digested bands at the bottom of the gel, suggesting that the digest has worked; however, at approx 5 kb there will be bands representing pCMV-E1, pCMV-E2, or pCMV. Only when there are no CMV-derived bands on the upper portion of gel can you be confident that the Dpn1 digest has worked (see Fig. 2). 5. There are a few factors that should be considered when deciding to use either the Southern blotting or real-time PCR technique. There are clear advantages to using real-time PCR, as it is quantitative, non-toxic, and much easier and faster to process than Southern blotting. However, there are occasions where Southern blotting may be the only method available. In the real-time PCR procedure, a high background can be detected when elevated levels of pOri16M are used (100 ng to 1 µg), and therefore cell lines in which E1 and

Quantitation of HPV DNA Replication

6.

7.

8.

9.

361

E2 replicate DNA poorly and require elevated levels of pOri16M may not be suitable for the real-time PCR protocol. See ref. 7 for an in-depth description of the real-time PCR protocol and an example of standardizing a cell line for use with this technique. In the real-time PCR technique, if there is no detectable increase in signal in samples where DNA replication is predicted, then DNA replication may not have occurred, due to the reasons discussed in Notes 2 and 3. It is advisable to carry out a Southern blot to check whether this is the case. There are three possible reasons for too high a signal following PCR in the no replication control: (1) the Dpn1 and/or ExoIII digest did not work properly, (2) there was too much pOri16M used in the transfection, and (3) there could be contamination. Check that the enzymes are working by treating DNA with the enzymes and visualizing the DNA on a gel to confirm that it gives the expected pattern. Always carry out a titration with the pOri16M in the transfection to determine the levels that do not give too high a background signal. Finally, check that the reagents used in the protocol are not contaminated, by carrying out a reaction in the absence of added DNA. To enhance the quantitation of the real-time PCR technique it is possible to monitor the amounts of input plasmid present in the DNA sample harvested from the transfected cells. This serves to correct for transfection efficiency and efficiency of DNA harvest. To do this, the harvested DNA is treated with the restriction enzyme Mbo1; this enzyme recognizes the same sequence as Dpn1 with the crucial difference that it digests only nonmethylated DNA and therefore digests the freshly replicated DNA while maintaining the input DNA. The amount of this DNA can then be monitored by Southern blotting or the real-time PCR technique. Results obtained with the Dpn1 treatment can then be expressed relative to the levels of Mbo1 DNA detected; this controls for transfection and DNA-harvesting efficiency. An example of this approach is detailed in Taylor and Morgan (7). The design of primers and probes was carried out using Primer Express software (Applied Biosystems). The primer set chosen amplifies a 99-bp region of the HPV16 Ori cloned into pOri16M and has the Dpn1 site at the 3' end of the probe-binding site. This Dpn1 site was introduced using PCR; see ref. 6 for details.

Acknowledgments E. R. T. was supported by a studentship from the Biotechnology and Biological Sciences Research Council (BBSRC). The Royal Society also supported this work. References 1. LaPorta, R. F. and Taichman, L. B. (1982) Human papilloma viral DNA replicates as a stable episome in cultured epidermal keratinocytes. Proc. Natl. Acad. Sci. USA 79, 3393–3397.

362

Morgan and Taylor

2. Desaintes, C. and Demeret, C. (1996) Control of papillomavirus DNA replication and transcription. Semin. Cancer Biol. 7, 339–347. 3. Bouvard, V., Storey, A., Pim, D., and Banks, L. (1994) Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes. EMBO J. 13, 5451–5459. 4. Steger, G. and Corbach, S. (1997) Dose-dependent regulation of the early promoter of human papillomavirus type 18 by the viral E2 protein. J Virol. 71, 50–58. 5. Vance, K. W., Campo, M. S., and Morgan, I. M. (1999) An enhanced epithelial response of a papillomavirus promoter to transcriptional activators. J. Biol. Chem. 274, 27,839–27,844. 6. Del Vecchio, A. M., Romanczuk, H., Howley, P. M., and Baker, C. C. (1992) Transient replication of human papillomavirus DNAs. J. Virol. 66, 5949–5958. 7. Taylor, E. R. and Morgan, I. M. (2003) A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication. Virology 315, 103–109. 8. Boner, W., Taylor, E. R., Tsirimonaki, E., Yamane, K., Campo, M. S., and Morgan, I. M. (2002) A functional interaction between the human papillomavirus 16 transcription/replication factor E2 and the DNA damage response protein TopBP1. J. Biol. Chem. 277, 22,297–22,303.

Analysis of E7/Rb Associations

363

26 Analysis of E7/Rb Associations Sandra Caldeira, Wen Dong, and Massimo Tommasino Summary The product of the early gene E7 is one of the major transforming proteins of human papillomaviruses (HPVs). It exerts its activity by associating with and altering the biological functions of several cellular proteins involved in the control of fundamental events, such as cell proliferation and apoptosis. The best-characterized activity of E7 from HPV type 16, the most frequently detected type in cervical cancer, is its ability to bind and induce degradation of the tumor-suppressor retinoblastoma protein (pRb) via the ubiquitin pathway. pRb plays a key role in cell-cycle control by negatively regulating, via direct association, the activity of several transcription factors, including members of the E2F family. The neutralization of pRb functions mediated by E7 results in constitutive activation of the transcription factors, with consequent loss of cell-cycle control. Several studies have shown that the oncogenic potential of a specific HPV type is dependent on the efficiency of E7 in targeting pRb. In this chapter, we describe two methods to measure the efficiency of the E7 proteins from different HPV types in neutralizing the pRb functions. The first one, the plate-binding assay, allows the determination of the pRb binding affinity of E7 proteins, while the second one permits the analysis of their impact on the pRb pathway in intact cells.

1. Introduction E7 is one of the major transforming proteins of human papillomaviruses (HPV) (1). Although more than 100 HPV types have been identified, only a few E7 proteins from the high-risk mucosal HPV types have been extensively characterized. In particular, the majority of studies have focused on E7 from HPV 16, since this is the most commonly detected HPV type, not only in invasive cervical carcinoma (ICC), but also in its precursor lesions, cervical intraepithelial neoplasia (CIN) (2,3). HPV-16 E7 is a small, acidic phosphoprotein that is functionally related to a gene product of another DNA tumor virus, the adenovirus (Ad) E1A protein (4,5). On the basis of the similarity in primary structure between the two viral From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

363

364

Caldeira, Dong, and Tommasino

Fig. 1. Schematic diagram of human papillomavirus (HPV)-16 E7 protein. The position of the three conserved regions (CR) is indicated by the numbers at the bottom of the figure. CR2 contains the LXCXE domain (amino acids 22–26), which mediates the association with the pocket proteins, and two serines at positions 31 and 32, which are phosphorylated by casein kinase II. CR3 contains two CXXC motifs that are involved in zinc binding and in protein stabilization.

proteins, they can be divided into three domains: conserved regions (CR) 1, 2, and 3 (Fig. 1). Mutational analysis of HPV-16 E7 has shown that integrity of all three CRs is essential for its biological functions. The transforming properties of HPV-16 E7 have been characterized in different cell types. Immortalized rodent fibroblasts, such as NIH 3T3, are transformed by E7 and acquire the ability to grow in serum-deprived medium and in soft agar (6). In addition, HPV-16 E7 alone, or in cooperation with E6 with higher efficiency, is able to immortalize primary human keratinocytes, which are the natural host cells of the virus (6). These properties of E7 are due mainly to its ability to associate with and inactivate the members of the pocket protein family, which is comprised of the product of the tumor-suppressor retinoblastoma gene (pRb) and two related proteins, p107 and p130 (1). The pocket proteins are key negative cell-cycle regulators (7), and their interaction with E7 leads to loss of cell-cycle control, favoring the exit of quiescent cells from G0 and entry into the S phase. Several studies have shown that the determination of the efficiency of E7 in inactivating pRb is a valid approach to assessing the oncogenic potential in

Analysis of E7/Rb Associations

365

vivo of a specific HPV type. Comparative analyses between the different HPV types have revealed that the E7 proteins can be divided into three groups, according to their ability to target pRb: (a) E7 proteins that do not bind pRb, or bind with low affinity (8); (b) E7 proteins that bind pRb with high affinity (9,10); and (c) E7 proteins that bind pRb with high affinity and promote its rapid degradation via the proteasome pathway (11,12). The data available to date indicate that the induction of pRb degradation is a feature of the E7 proteins from the oncogenic HPV types. In this chapter, we describe assays for the determination of the efficiency of E7 in inactivating pRb. 2. Materials 2.1. Plate-Binding Assay 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26.

pET-21a+ bacterial expression vector (Novagen/Calbiochem). pGEX2T bacterial expression vector (Amersham/Pharmacia). Protease-deficient Escherichia coli strain BL21 (Life Technologies). Standard molecular-biology reagents (any source). Bacterial transformation kit (any source). Luria-Bertani (LB) medium. Ampicillin. Isopropyl-β-D-thio-galactopyranoside (IPTG). Bind/wash buffer: 4.3 mM Na2HPO4, 1.5 mM KH2PO4, 2.7 mM KCl, 140 mM NaCl, 0.1% Tween-20, 0.002% NaN3 (pH 7.3). Sonicator. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) equipment. T7-tag-specific monoclonal antibody (Novagen/Calbiochem). T7-tag purification kit (Novagen/Calbiochem). Elution buffer: 0.1 M citric acid (pH 2.2). Anti-mouse immunoglobulin (Ig)G antibody conjugated with horseradish peroxidase (HRP) (Promega). Bovine serum albumin (BSA). 30 mM Tris-citric acid (pH 6.0). Coomassie Brilliant Blue R-250 (Pharmacia). Carbonate buffer (pH 9.6): 1 volume of Na 2CO 3 (0.05 M) and 4 volumes NaHCO3 (0.05 M). Glutathione-casein (13). Ninety-six microwell PolySorp™ plates (Nunc). Blocking buffer: 0.2% casein, 0.05% Tween-20 in phosphate-buffered saline (PBS). Tetramethylbenzidine (Sigma). Hydrogen peroxide (30%). 1 M sulfuric acid. Enzyme-linked immunosorbent assay (ELISA) reader.

366

Caldeira, Dong, and Tommasino

2.2. Determination of E7-Induced Degradation of pRb in NIH 3T3 Cells 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.

16. 17. 18. 19. 20. 21. 22. 23.

Retroviral vectors, e.g., pLXSN (Clontech) and pBabe (14). Bacteria strain STBL2 (Life Technologies). Bacterial transformation kit (any source). LB medium. Ampicillin. Standard molecular-biology reagents (any source). Rodent fibroblasts (NIH3T3, ATCC No. CRL 1658). Packaging cell line Bosc 23 (ATCC No. CRL 11270). Chloroquine (Sigma). 2X HBS: 50 mM HEPES (pH 7.12), 10 mM KCl, 12 mM dextrose, 280 mM NaCl, 1.5 mM Na3PO4). CaCl2. Fetal calf serum (FCS) (any source; test before use). Dulbecco’s modified Eagle’s medium (DMEM). Polybrene (Sigma). IP buffer: 20 mM Tris-HCl (pH 8.0), 200 mM NaCl, 0.5% Nonidet P40, 1 mM ethylenediaminetetracetic acid (EDTA), 10 mM NaF, 0.1 M Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 1 µg/mL leupeptin, 10 µg/mL soybean trypsin inhibitor, 10 µg/mL tosyl phenylalanine chloromethyl ketone, 1 µg/mL aprotinin, 10 µg/mL tosyl lysine chloromethyl ketone. Lowry-based assay to determine protein concentration (any source). SDS-PAGE equipment. Polyvinylidene difluoride membrane (NEN Life Sciences). Trans-Blot semidry electrophoretic transfer cell (Bio-Rad). Anti-hemagglutinin (HA) epitope antibody (MMS-101R, Babco). Anti-pRb (14001A, Pharmingen). Anti-β-tubulin (TUB2.1, Sigma). Anti-mouse IgG antibody conjugated with HRP (Promega).

3. Methods 3.1. In Vitro Assays to Determine E7-pRb Interactions Several methods have been developed to determine the efficiency of E7 proteins from different HPV types in binding pRb—e.g., glutathione S-transferase (GST)-pull-down assay, yeast two-hybrid assay, and plate-binding assay. The GST-pull-down assay is widely used in the HPV field and involves the use of bacterial recombinant E7 proteins. The E7 genes are fused in-frame to the carboxy-terminal sequence of the Schistosoma japonicum GST and expressed in bacteria. The recombinant proteins are immobilized on sepharose glutathione beads and incubated with cellular extracts. After extensive washing of the sepharose beads, the amount of pRb associated with E7 is determined by immunoblotting. A schematic representation of this assay is shown in Fig. 2A.

Analysis of E7/Rb Associations

367

The yeast two-hybrid assay takes advantage of the fact that several eukaryotic transcriptional activators have two physically separable and functionally independent domains—the DNA-binding domain (DNA-BD) and the transcriptional activation domain (TAD). Fusion of these domains to two interacting proteins will result in full reconstitution of the transcriptional activator that is able to bind a specific promoter and activate the transcription of a reporter gene, such as lacZ (Fig. 2B). To characterize the E7-pRb interaction by a yeast two-hybrid assay, the E7 protein is fused to the transcriptional activation domain, while pRb is fused to the DNA-binding domain (for an example, see ref. 15). It is important to keep in mind that HPV-16 E7 has an intrinsic transactivation activity, and it is essential to fuse E7 to the TAD, since its fusion to the DNA-BD will result in activation of the reporter gene independently of the interaction with pRb. Like the GST pull-down assay, the plate-binding assay uses recombinant bacterial proteins. The plate is first saturated with casein, to which glutathione has previously been covalently linked (13). As a second step, a bacterial extract containing GST-pRb fusion protein is added to the plate. The bacterial proteins are removed by extensive washing, while the GST-pRb fusion protein remains immobilized on the plate. Bacterial recombinant E7 protein fused at the N-terminus to the T7 tag is finally added, and after washing, the amount of E7 associated with pRb is determined using a specific anti-T7-tag monoclonal antibody (all steps are summarized in Fig. 2C). In contrast to the two previous methods, the plate-binding assay offers the possibility to quantify the affinity for pRb of E7 proteins from different HPV types. For this reason, only this method is described in detail below.

3.1.1. Production of E7 proteins The E7 genes are cloned by standard techniques in-frame and downstream of the T7-tag sequence that is located in the multi-cloning site of the bacterial expression vector pET21a+. The fusion of E7 with the T7 tag is essential for purification of the recombinant protein (see Subheading 3.1.2.). In addition, the presence of a tag allows comparison of the pRb-binding affinity of different E7s, because the same monoclonal antibody can be used in the different assays. After completion of the cloning, perform the following steps: 1. Transform the protease-deficient strain BL21 with the different E7 constructs using standard techniques, e.g., electroporation or heat-shock protocol. 2. After transformation, plate the bacteria on LB medium containing 100 mg/L of ampicillin and grow at 37°C overnight. 3. Use a single colony to inoculate 20 mL of LB/ampicillin medium and grow overnight at 37°C.

368

Caldeira, Dong, and Tommasino

Analysis of E7/Rb Associations

369

4. Dilute 2 mL of overnight stationary phase culture in 200 mL of LB/ampicillin medium and grow at 37°C until the absorbance reaches 0.5–0.6 at 600 nm. 5. Cool the culture to a temperature of 30°C. 6. Initiate the expression of the E7 fusion protein by addition of IPTG to a final concentration of 1 mM. 7. After 4–5 h at 30°C, harvest the bacteria by centrifugation (5000g, 5 min) and freeze at –20°C or immediately process for purification of the recombinant proteins (see Note 1). 8. To purify the E7 proteins, resuspend the bacteria in 2 mL of bind/wash buffer and lyse them by sonication on ice (30 pulses of 2 s interrupted by 1-s intervals, microtip amplitude 30%). 9. After centrifugation of the bacterial lysate (16,000g, 5 min), purify the T7-E7 fusion proteins batch-wise using the T7-tag purification kit. Briefly, wash 200 µL of a 50% (v/v) agarose beads suspension with the T7 antibody twice with bind/wash buffer and add 1 mL of bacterial extract. After incubation for 30 min at 4°C in a rotator, collect the beads by centrifugation (see Note 2). Wash the beads five times with bind/wash buffer and elute the bound T7-tagged protein by adding 300 µL of elution buffer. Neutralize the buffer after elution by adding 45 µL of 1 M Tris base (pH 10.4). When larger amounts of purified protein are required, column purification can be performed (see Note 3). 10. Determine the concentration of the purified E7 fusion proteins spectrophotometrically at 280 nm using a calibration curve obtained with serial dilutions of BSA dissolved in 30 mM Tris-citric acid (pH 6.0). 11. Check the purity of the recombinant proteins by SDS-PAGE. One or two micrograms of purified recombinant proteins are applied onto a 15% SDS-polyacrylamide gel and visualized by Coomassie Brilliant Blue R-250 staining. We have successfully synthesized several T7-E7 fusion proteins from different HPV types. The results of a representative experiment are shown in Fig. 3, in which five different E7 proteins were purified.

Fig. 2. (opposite page) Schematic representation of three pRb-E7 association assays. (A) glutathione S-transferase (GST) pull-down assay. The GST-E7 fusion proteins are bound to glutathione-sepharose 4B beads. After washing, the sepharose beads are incubated with mammalian cellular extracts, and the levels of the pRb bound to GST-E7 are determined by Western blotting. (B) Yeast two-hybrid assay. The E7 protein is fused to the transcriptional activation domain (TAD), while pRb is fused to the DNAbinding domain (DNA-BD). Transactivation of the reporter gene (e.g., β-galactosidase) can occur only when the two proteins interact. (C) Plate-binding assay. GST-pRb is bound to a plastic surface previously coated with glutathione-casein. T7-E7 fusion proteins are added to each well, and the unbound fusion proteins are removed by extensive washing. Finally, the level of T7-E7 protein associated with pRb is quantified using a murine monoclonal T7-tag antibody and a secondary HRP-conjugated anti-mouse immunoglobulin antibody.

370

Caldeira, Dong, and Tommasino

Fig. 3. Purification of bacterial recombinant T7-E7 proteins. T7-E7 recombinant proteins of HPV types 10, 16, 38, 48, and 60 were purified using anti-T7 tag antibody sepharose beads. Two micrograms of each recombinant protein were applied onto 15% sodium dodecyl sulfate-polyacrylamide gel and stained with Coomassie Blue. The positions of the molecular-mass markers in kDa are indicated on the left of the figure.

3.1.2. Production of Bacterial Lysate Containing GST-pRb Fusion Protein To generate the GST-pRb fusion protein, part of the pRb gene that encodes the E7-interacting domain (also termed the pocket domain) is cloned in the bacterial expression vector pGEX2T. It is not necessary to use the full-length pRb gene, since it yields much less fusion protein and does not increase the sensitivity of the assay. We have found that a fragment covering the coding region from amino acid 373 to amino acid 929 gives similar results to the fulllength protein in this assay for several E7 proteins. 1. Transform the protease-deficient strain of BL21 bacteria with the pGEX2TpRb construct and grow in LB/ampicillin medium as described under Subheading 3.1.1. 2. After the bacterial culture has reached an absorbance of approx 0.4 at 600 nm, initiate the induction of GST-pRb expression by adding IPTG to a final concentration of 0.1 mM. 3. Grow the bacteria for 3–4 h at 30°C and then lyse them by sonication as described in Subheading 3.1.1. (see Note 4).

Analysis of E7/Rb Associations

371

3.1.3. Plate-Binding Assay Each assay should be performed in triplicate in separate plates. The assay comprises several steps, described in detail as follows: 1. Coat the 96-microwell plate with glutathione-casein by adding 100 µL of glutathione-casein solution to each well, and leave the plate overnight at 4°C (see Note 5). 2. Remove the glutathione-casein solution and add 200 µL of blocking buffer (for 1 h at 37°C or overnight at 4°C). 3. Remove the blocking buffer. 4. Wash the plate five times by immersion in a tank containing PBS/Tween-20 0.05%. Remove the washing solution by inverting and tapping the plate on paper towels. 5. Add bacterial extract containing GST-pRb fusion protein to each well. The amount of bacterial extract to use is dependent on the yield of GST-pRb protein, which can vary in different laboratories (see Note 6). 6. Incubate the plate at 4°C for 1 h. 7. Wash the plate as described in step 4. 8. Add 100 µL of purified bacterial recombinant T7-E7 fusion proteins (stock solution approx 500 ng/mL in blocking buffer). 9. Incubate the plate for 2 h at 4°C. 10. Wash the plate as described in step 4. 11. Add 100 µL T7 tag-specific monoclonal antibody (dilution 1/10,000 in blocking buffer) to determine the amount of T7-E7 protein associated with GST-pRb. 12. Incubate the plate at room temperature for 45 min. 13. Wash the plate as described in step 4. 14. Add the secondary anti-mouse IgG antibody conjugated with HRP (1/5000 dilution in blocking buffer). 15. Incubate the plate at room temperature for 45 min. 16. Wash the plate as described in step 4. 17. Start the colorimetric reaction by adding 100 µL of tetramethylbenzidine with 0.003% H2O2 as substrate. 18. Stop the enzymatic reaction by adding 50 µL of 1 M sulfuric acid to each well. 19. Determine the absorbance at 450 nm using an ELISA reader. For the controls, see the conditions described in Note 7.

3.1.4. Determination of KD KD is calculated using the equation KD = ([pRb] [E7])/[pRb-E7]. At [E750%], half of the pRb is free and half is bound to E7; thus, [pRb] = [pRb-E7] so that KD = [E750%]. The concentration of E7 giving 50% of the maximal specific optimal density (OD) [E750%] can be determined by fitting the experimental data (normalized OD values at different E7 concentrations) with a single rectangular hyperbola using the program SigmaPlot (SPSS Science, Chicago, IL).

372

Caldeira, Dong, and Tommasino

Fig. 4. Human papillomavirus (HPV)-16 E7-pRb plate-binding assay. Increasing concentrations of HPV-16 E7 (from 0.7 pM to 0.8 µM) were added to the wells, in which a 40 nM solution of GST-pRb had been previously placed. The colorimetric reaction was developed for 5 min. The optimal density represents the normalized average of triplicate determinations. The line shows the fit of the experimental data with a single rectangular hyperbola (Sigma plot). The KD was determined using the formula described in the Methods section and corresponds to the amount of HPV-16 E7 (4.5 nM) sufficient to bind 50% of the pRb molecules immobilized on the well.

To facilitate the plotting of the data and to allow comparative analysis, normalize the OD values taking into consideration the maximum reachable OD value of a specific E7 as 100%. One representative experiment using HPV-16 E7 is shown in Fig. 4. In some cases, E7 protein can be 75% pure. However, even under these conditions, the calculated KD does not differ more than 25% from the real value.

3.2. Characterization of the Ability of E7 to Promote pRb Degradation in Immortalized Rodent Fibroblasts Immortalized rodent fibroblasts, such as NIH 3T3, represent an easy-tohandle and reliable model system to assay the efficiency of E7 in targeting pRb. Several studies have shown that HPV-16 E7 is able to bind and induce degradation of murine and human pRb with similar efficiency. Thus, E7-induced degradation can be easily monitored in NIH 3T3 cells.

Analysis of E7/Rb Associations

373

Recombinant retroviral systems are widely used by several laboratories for expression of the E7 genes into target cells. The retroviruses are capable of delivering genes to target cells with high efficiency in a manner that allows integration of the introduced genetic elements and long-term, stable expression of the genes.

3.2.1. Generation of E7 Recombinant Retroviruses High-titer recombinant retroviruses carrying the desired genes are generated by transient transfection of the Bosc-23 ecotropic packaging cell line (capable of delivering genes to dividing murine or rat cells) (see Note 8). This packaging line is derived from 293-T cells (Ad5- and SV40-transformed, human, embryonic kidney 293 cell line) and contains the retroviral structural genes gag, pol, and env, as well as the origin of replication (ori) of Moloney murine leukemia virus (MMuLV). When transfected with the retroviral expression vector that provides the RNA packaging signal Y, plus transcription and processing elements, the cells are able to generate retroviral particles carrying the recombinant vector. The particles can then be used to infect the target cells and transmit the recombinant genes. However, they cannot replicate within the target cells, because these lack all the viral structural genes. As retroviral vectors, we have used pBabe (14) or pLXSN vectors (Clontech). To obtain the E7 genes, the viral DNA of interest is amplified by polymerase chain reaction (PCR) using primers that contain sequences that both flank the open reading frames (ORFs) and introduce restriction sites. Cloning is performed by standard recombinant DNA techniques (see Note 9). Few E7 antibodies are commercially available, and they do not recognize all E7 proteins. Therefore, to verify the expression of the different E7 genes, a specific epitope is added to the viral gene. We normally clone our E7 genes in-frame with the hemagglutinin (HA) tag at the N terminus. Our previous data showed that addition of HA tag to the E7 proteins does not alter the ability of the viral protein to promote pRb degradation.

3.2.2. Transient Transfection of the Packaging Cell Line Bosc 23 by Calcium Phosphate Precipitation The DNA used for transfection should be of high quality. We have obtained good results using the Maxi Prep kit from Qiagen. 1. Plate 2.5–4 × 106 cells on 10-cm dishes in 5–10 mL growth medium (DMEM + 10% FCS) and incubate for 18–24 h before transfection at 37°C, under 5% CO2 (see Note 10). 2. Transfect subconfluent cells (70%) with the empty or the recombinant retroviral vectors by calcium phosphate precipitation. Fifteen minutes before transfection, change the medium to fresh medium containing 2.5 µM chloroquine (see Note 11).

374

3. 4. 5. 6.

Caldeira, Dong, and Tommasino Prepare the following transfection cocktail: 10 µg of DNA + 62 µL 2 M CaCl2 + H2O to a final volume of 500 µL. Add this mix to 500 µL of 2X HBS (drop-wise with gentle agitation), (see Note 12). Spread the mix drop by drop across the whole plate. Be very gentle in agitating the plate (back and forth, left and right) and return it to the incubator for 8–10 h. Remove the chloroquine-containing medium and wash the cells twice with PBS to remove remaining chloroquine and precipitated DNA (see Note 13). Add 5 mL DMEM containing 10% FCS medium and incubate overnight. Change the medium 24 h after transfection. Collect the virus-containing medium at 48 h after transfection, when the production and release of virus is maximal. The medium is normally aspirated with a syringe and filtered through a 0.22-µm filter into a 5-mL Falcon tube and used to infect the target cells (see Note 14).

3.2.3. Infection of the Target Cells 1. Plate the target cells 24 h before infection in order to have approx 50% confluence the day after. The number of plates (10 cm diameter) to be prepared is (n + 1) for n infections. The extra plate is used as a negative control for the antibiotic selection after the infection (see also step 6 below). 2. Centrifuge the virus-containing medium for 5 min at 500g . If the viral supernatant was kept at –70°C, place it at room temperature and centrifuge it as soon as it is thawed. 3. Add polybrene to the viral supernatant to a final concentration of 4 µM (see Note 15). 4. When ready to infect, substitute the growth medium of the target cells by the medium containing the retrovirus prepared as described under Subheading 3.2.2. and return the plate to the incubator. 5. After 3 h, add 5 mL of fresh growth medium. 6. At 48 h after infection, select the cells with the appropriate antibiotics (see Note 16). At this time, the cells should be nearly confluent in the plate and must be split for selection. The split ratio depends on the growth rate of the cells and the efficiency of the infection, and has to be determined experimentally (see Note 17). Noninfected cells are exposed to the same concentration of antibiotics as a control to determine when selection is terminated. After selection, culturing is continued in antibiotic-containing medium.

3.2.4. pRb Degradation Assay in NIH 3T3 Cells For the pRb degradation assay, cells infected with HPV-16 E7 retroviruses can be used as a positive control, while we generally use empty vector retrovirus as a negative control. At the end of the selection, total cellular extracts are prepared to ascertain the expression of E7 protein and the levels of pRb. 1. Lysis of the cells should be performed at 75% confluence, so it may be necessary to split the cells during selection.

Analysis of E7/Rb Associations

375

2. After removal of the medium, wash the cells twice in ice-cold PBS (see Note 18). 3. Carefully aspirate the PBS from the plate and lyse the cells in IP buffer (for 20 min at 4°C). We normally use 200–300 µL IP buffer per 10-cm dish. Centrifuge the extract at 13,000g for 15 min at 4°C. 4. Recover the supernatant and determine the protein concentration using a Lowrybased assay. 5. Because we fuse our E7 genes to the HA tag, we use an HA-tag monoclonal antibody to detect their expression. Western blotting is a standard molecularbiology technique and it will not be described here in detail. Briefly, we fractionate 100 µg of extract (see Note 19) by electrophoresis in a 15% SDSpolyacrylamide gel and transfer it to a polyvinylidene difluoride (PVDF) membrane (DuPont) using the Trans-Blot semidry electrophoretic transfer cell (see Note 20). 6. After the transfer, the membrane is washed twice in 5% milk powder/PBS and then incubated overnight at 4°C (or 2–3 h at room temperature) in the same buffer containing the anti–HA tag antibody (diluted 1/1000). The membrane is then processed following a standard immunoblotting protocol using a secondary antibody conjugated with HRP (see Note 21). 7. The ability of E7 to induce pRb degradation is evaluated by determining intracellular levels of pRb by immunoblotting using the same cellular extracts. Cellular extract (100 µg) is loaded onto an 8% SDS-polyacrylamide gel. 8. After protein transfer as described previously, immunoblotting is performed using an anti-pRb antibody (diluted 1/1000). To exclude the possibility that variations in pRb levels may be due to different loading onto the SDS-polyacrylamide gel of the different cellular extracts, the same membrane is incubated with an antibody of the product of a housekeeping gene, β-tubulin antibody (diluted 1/1000) (see Note 22). A representative experiment is shown in Fig. 5.

By comparing the amounts of pRb in extracts expressing the different E7 proteins as well as our positive (HPV-16 E7) and negative (empty vector) controls, it is possible to evaluate the ability of the E7s to promote pRb degradation. 4. Notes 1. We obtained similar yields for the majority of the E7 proteins, but in some cases low levels of recombinant proteins are obtained. Adjusting the time of induction of protein expression or the temperature of the bacterial culture may increase the yield. 2. Incubation at 4°C in this step reduces degradation, as no protease inhibitors were used. Alternatively, protease inhibitors can be used, as they do not influence the purification efficiency or subsequent assays. In this case, the incubation can be performed at room temperature to facilitate the antibody/antigen reaction. 3. If larger amounts of purified fusion protein are required, column purification can be performed. For this purpose, 2 mL of 50% (v/v) suspension of beads are

376

Caldeira, Dong, and Tommasino

Fig. 5. Determination of pRb levels in NIH 3T3 expressing human papillomavirus (HPV)-1 or HPV-16 E7. One-hundred micrograms of protein extracts of cells expressing the different E7 proteins as indicated in the figure were applied on 8% (for pRb detection) or 15% (for E7 detection) polyacrylamide-sodium dodecyl sulfate gel, transferred onto polyvinylidene difluoride membrane, and incubated with an anti-HA tag, a pRb, or β-tubulin antibody. β-tubulin signal was used as loading control. applied on a chromatography column. Equilibrate the column with 10 volumes of bind/wash buffer and then apply 1 mL of bacterial extract. Wash the column with 10 volumes of bind/wash buffer and elute the bound proteins with five serial 1-mL volumes of elution buffer into five separate tubes containing 150 µL of 1 M Tris base (pH 10.4). The column can be recycled five times with minimal loss of binding activity. 4. It is important to check the expression of GST-pRb fusion protein before performing the plate-binding assay. The level of recombinant protein can be determined easily by Western blotting using an anti-GST antibody. The bacterial extract can be divided into aliquots, kept at –20°C, and used for several independent experiments. 5. Glutathione-casein can be synthesized as previously described (13) and dissolved in 50 mM carbonate buffer (pH 9.6) at a final concentration of 2 ng/µL. 6. For determination of the minimal saturation amount of GST-pRb, coat the microwell plate with glutathione-casein and, after blocking, add to the plate increasing concentrations of total protein extract of GST-pRb-expressing cells (from 1 µg/mL to 5 mg/mL). Wash off unbound bacterial proteins and incubate the plate at room temperature for 45 min with polyclonal rabbit GST antibody (1:2000 dilution in blocking buffer, Sigma). After washing (see Subheading 3.1.3., step 4), incubate the plate at room temperature for 45 min with secondary anti-rabbit IgG antibody HRP conjugate (1:5000 dilution in blocking buffer, Promega) and perform the colorimetric reaction. The minimal concentration of

Analysis of E7/Rb Associations

7.

8.

9.

10.

11. 12.

13.

14. 15.

16. 17. 18.

19.

377

bacterial extract sufficient to saturate the well will correspond to the point at which the intensity of the colorimetric reaction has reached a plateau. To determine the specificity of the assay, two different controls are included, in which either GST-pRb or T7-E7 protein is replaced by 100 µg of BL21 protein extract. The protocol can be followed to transfect amphotropic packaging cell lines (e.g., Phoenix) and generate amphotropic retroviruses that are capable of delivering genes to dividing cells of most mammalian species, including human. It is recommended to use STBL2 bacteria (Life Technologies) for amplifying any retroviral plasmid, since these bacteria are engineered to stabilize repeats and retroviral sequences. The plating step is very critical for obtaining good transfection efficiency. Cells have to be very well homogenized so that they will not grow in clumps. In addition, Bosc 23 cells are quite fragile and detach very easily. Handle them gently. Chloroquine inhibits lysosomal DNAses, helping DNA, delivered by Ca2PO4, through the lysosomes. All solutions should be at room temperature at the time of transfection. 2X HBS is stored in aliquots at –20°C. Each aliquot is defrosted immediately before the transfection. The remaining 2X HBS solution can be kept at 4°C for at most 1 wk and used for an independent transfection. pH is extremely important. The main reason for failure of calcium phosphate transfections is poor HBS. Always test your batch in a pilot experiment. It is important to be very gentle during this operation to avoid detachment of the cells. Check the plate under the microscope. If sandy dots of precipitated DNA are still present in the plate, repeat the washing step. The medium containing the recombinant retrovirus can be frozen at –70°C and kept for many months. However, freezing and thawing reduces the viral titer. Polybrene neutralizes the negative charge present on the surface of the virus and the cell, thereby reducing electrostatic repulsion and increasing the infection efficiency. Puromycin or neomycin can be used at final concentrations of 2 µg/mL or 1000 µg/mL, respectively. As a reference, NIH 3T3 cells infected with HPV-16 E7 retroviruses can be easily split 1:5, when 90% confluent. It is extremely important to completely remove the culturing medium. Residual medium containing fetal calf serum will interfere with the determination of protein concentration of the cellular extracts. The protein concentration will be too high because of the fetal calf serum proteins in the medium. In some cases, the protein concentration is very low. In order to have a small enough volume for loading onto SDS-polyacrylamide gel, protein extracts can be concentrated by acetone precipitation. A protein extract containing the desired amount of proteins is mixed with nine volumes of ice-cold acetone and incubated for 20 min at –20°C. After centrifugation (10 min at maximum speed in a standard bench centrifuge), the pellet is directly resuspended in SDS loading buffer.

378

Caldeira, Dong, and Tommasino

20. The transfer of the proteins onto the PVDF membrane is normally completed after 90 min at 130 mA. However, the conditions can vary from one laboratory to another. It is always best to check the efficiency of protein transfer by staining the membrane after the transfer with Ponceau red or using stained protein markers (e.g., Rainbow from Amersham). 21. We normally use as secondary antibodies anti-mouse or anti-rabbit IgG antibodies conjugated with HRP (Promega) diluted 1/5000. 22. pRb and β-tubulin have different molecular weights (approx 105 and 55 kDa, respectively). Therefore, immunoblotting for these two proteins can be performed in parallel, simply cutting the membrane into two parts.

Acknowledgments The authors thank all the members of the laboratory for their interest and cooperation in the work described here, and Dr John Cheney for English revision. References 1. Munger, K., Basile, J. R., Duensing, S., et al. (2001) Biological activities and molecular targets of the human papillomavirus E7 oncoprotein. Oncogene 20, 7888–7898. 2. Clifford, G. M., Smith, J. S., Plummer, M., Munoz, N., and Franceschi, S. (2003) Human papillomavirus types in invasive cervical cancer worldwide: a meta-analysis. Br. J. Cancer 88, 63–73. 3. Munoz, N., Bosch, F. X., de Sanjose, S., et al. (2003) Epidemiologic classification of human papillomavirus types associated with cervical cancer. N. Engl. J. Med. 348, 518–527. 4. Phelps, W. C., Yee, C. L., Münger, K., and Howley, P. M. (1988) The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53, 539–547. 5. Vousden, K. H. and Jat, P. S. (1989) Functional similarity between HPV16E7, SV40 large T and adenovirus E1a proteins. Oncogene 4, 153–158. 6. Mansur, C. P. and Androphy, E. J. (1993) Cellular transformation by papillomavirus oncoproteins. Biochim. Biophys. Acta 1155, 323–345. 7. Morris, E. J. and Dyson, N. J. (2001) Retinoblastoma protein partners. Adv. Cancer Res. 82, 1–54. 8. Munger, K., Werness, B. A., Dyson, N., Phelps, W. C., Harlow, E., and Howley, P. M. (1989) Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 8, 4099–4105. 9. Giarre, M., Caldeira, S., Malanchi, I., Ciccolini, F., Leao, M. J., and Tommasino, M. (2001) Induction of pRb degradation by the human papillomavirus type 16 E7 protein is essential to efficiently overcome p16INK4a-imposed G1 cell cycle arrest. J. Virol. 75, 4705–4712.

Analysis of E7/Rb Associations

379

10. Caldeira, S., Dong, W., Tomakidi, P., Paradiso, A., and Tommasino, M. (2002) Human papillomavirus type 32 does not display in vitro transforming properties. Virology 301, 157–164. 11. Boyer, S. N., Wazer, D. E., and Band, V. (1996) E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitinproteasome pathway. Cancer Res. 56, 4620–4624. 12. Jones, D. L. and Munger, K. (1997) Analysis of the p53-mediated G1 growth arrest pathway in cells expressing the human papillomavirus type 16 E7 oncoprotein. J. Virol. 71, 2905–2912. 13. Sehr, P., Zumbach, K., and Pawlita, M. (2001) A generic capture ELISA for recombinant proteins fused to glutathione S-transferase: validation for HPVserology. J. Immunol. Meth. 253, 153–162. 14. Morgenstern, J. P. and Land, H. (1990) Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res. 18, 3587–3596. 15. Ciccolini, F., Di Pasquale, G., Carlotti, F., Crawford, L., and Tommasino, M. (1994) Functional Studies of E7 proteins from different HPV types. Oncogene 9, 2342–2348.

Transformation Assays for HPV Oncoproteins

381

27 Transformation Assays for HPV Oncoproteins Paola Massimi and Lawrence Banks Summary A cornerstone of human papillomavirus (HPV) research was the demonstration that those HPV types associated with the development of cervical cancer encode two potent oncoproteins, while those HPV types associated with only benign lesions do not. Thus both HPV-16 E6 and E7 will transform established rodent cells and will efficiently cooperate with other activated oncogenes in the transformation of primary rodent cells. In addition, the virus also encodes for the E5 oncoprotein, which also possesses a weaker transforming activity in established rodent cells. In this chapter we describe how the transforming activities of the HPV oncoproteins can be assessed.

1. Introduction Carcinogenesis occurs through a multistep process, and multiple oncogenes are required for the full transformation of normal primary cells in vitro (1–3). Assays for assessing the transforming activity of the different human papillomavirus (HPV) oncoproteins fall into three categories: (a) transformation of established rodent cells; (b) transformation of primary rodent cells; (c) immortalization of primary human cells. A key feature in all cases is that only the high-risk HPV types score positive in these assays. The first indication that HPV 16 encoded a transforming activity came from studies of the viral early region expressed in retroviral constructs. In these studies, E7 was found to be the most potent oncogene (4–6), followed by E6, which can transform established rodent cells but with less efficiency (7,8). E5 was also found to possess transforming activity in 3T3 A31 cells (7), which was further stimulated by the addition of epidermal growth factor (EGF) (9,10). The use of primary rodent cells represents a more relevant assay with respect to the transforming activity of HPV in vivo, since the target cells are primarily epithelial in origin. Target cells can be primary baby rat kidney cells (BRK) or primary mouse kidney From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

381

382

Massimi and Banks

cells (BMK). The presence of a cooperating activated oncogene (typically EJ-ras) is required in these assays (11,12). In BRK cells, the principal transforming activity is encoded by the E7 oncoprotein in high-risk HPVs (13–16), while in BMK cells, E6 has a transforming activity close to or equivalent to that of E7 (17,18). Perhaps the most relevant system with respect to the activity of the HPV oncogenes in human tumors is the immortalization of primary human keratinocytes (from genital tract or oral mucosa). In these cells, E7 alone can induce hyper-proliferation, although they eventually undergo senescence (19–26). However, E6 and E7 from high-risk but not from low-risk HPV types efficiently induce immortalization of these cells and do not require the presence of another activated oncogene. Moreover, E7 is able to induce immortalization of human keratinocytes in the absence of E6, albeit at low frequency (27,28), and E5 has been demonstrated to stimulate mitogenesis enhanced by addition of EGF in primary human cells (29,30). In this chapter we describe the design and implementation of assays to measure the transforming activities of HPV E5, E6, and E7 in established rodent cells, as well as the oncogene cooperating activities of HPV E6 and E7 in primary rodent cells. A key element in these assays as well as those described in Chapter 29 is the quality of the DNA used to express the viral oncoprotein; therefore, we also include in this chapter a description of the method we use to prepare our plasmid DNA. 2. Materials 2.1. Cells 1. NIH 3T3, 3T3 A31 (established mouse fibroblasts) (American Type Culture Collection). 2. Baby mouse kidney primary cells derived from 9-d-old mice BALB/c (BMK) (Harlan-Italy). 3. Baby rat kidney primary cells derived from 9-d-old rats Wistar Hannover (BRK) (Harlan-Italy).

2.2. Cell Culture 1. Dulbecco’s modified Eagle’s medium (DMEM). 2. Supplemented DMEM: DMEM with 10% FBS, 1% glutamine, 200 U/mL penicillin, and 100 µg/mL streptomycin. 3. Sterile phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4). 4. Versene buffer (1X): 1 mM EDTA, 0.17 M NaCl, 3 mM KCl, 10 mM Na2HPO4, 1.6 mM KH2PO4 (pH 7.2). 5. Trypsin/ethylenediamine tetraacetic acid (EDTA) 0.05% in 10X Versene. 6. 100-mm Tissue-culture dishes. 7. Inverted microscope.

Transformation Assays for HPV Oncoproteins

383

2.3. DNA Preparation 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

Luria broth: 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCl per 1 L. Ampicillin (50 mg/mL). Chloramphenicol (34 mg/mL in ethanol). Solution 1: 50 mM glucose, 25 mM Tris-HCl (pH 8), 10 mM EDTA. Solution 2: 0.2 N NaOH, 1% sodium dodecyl sulfate (SDS). Solution 3: 3 M potassium acetate (pH 4.8), 5 M glacial acetic acid. 2-propanol. Cesium chloride. Ethidium bromide (10 mg/mL). TE: 10 mM Tris-HCl (pH 8), 1 mM EDTA. 2.5-mL Syringes. 10-mL Syringes. 18-Gage needles. Sylanized corex glass tubes. Beckman Quick-Seal tubes. Heat-sealing instrument (Beckman). Beckman centrifuge (Ti70 rotor). Sorvall centrifuge (GS3, SS34 rotors). Spectrophotometer.

2.4. Transfection of Cells 1. TE: 10 mM Tris (pH 8.0), 1 mM EDTA. 2. 2X HEPES-buffered saline (HBS): 2.8 M NaCl, 250 mM HEPES (pH 7), 150 mM Na2HPO4 (pH 7.12) (see Note 1). 3. 2.5 M CaCl2. 4. 1X Versene. 5. Glycerol. 6. Expression plasmids (see Note 2).

2.5. Cell Colony Staining 1. Sterile PBS 2. Paraformaldehyde (10% in PBS). 3. Giemsa Blue stain (10% in PBS).

2.6. Establishing Primary Cell Cultures 1. Sterile PBS. 2. Serum free supplemented DMEM: DMEM with 1% glutamine, 200 U/mL Penicillin and 100 µg/mL Streptomycin. 3. Trypsin/EDTA 0.25% in Versene 10X. 4. Fetal bovine serum (FBS). 5. Sterile forceps and scissors. 6. 60-mm Tissue-culture dishes. 7. 100-mm Tissue-culture dishes.

384

Massimi and Banks

8. 50-mL Falcon tubes. 9. Geneticin (G418) (Sigma).

2.7. Picking Colonies 1. 2. 3. 4. 5. 6.

Sterile PBS. Trypsin/EDTA 0.05% in Versene 10X. Plastic cloning rings. Vacuum grease. 24-, 12-, and 6-well tissue-culture plates. 75-cm2 Tissue-culture flasks

2.8. Western Blots 1. Cell lysis buffer: 250 mM NaCl, 0.15% NP40, 50 mM HEPES (pH 7), 1% aprotinin, 100 µM TLCK, 200 µM TPCK, 1 mM phenylmethylsulfonyl fluoride (PMSF). 2. 2X SDS gel-loading buffer: 100 mM Tris-HCl (pH 6.8), 200 mM dithiothreitol (DTT), 4% SDS, 0.2% Bromophenol Blue, 20% glycerol. 3. Electrophoresis buffer: 25 mM Tris, 250 mM glycine—electrophoresis grade (pH 8.3), 0.1% SDS. 4. Transfer buffer: 39 mM glycine, 48 mM Tris base, 0.037% SDS, 20% methanol. 5. Nitrocellulose 0.22 µm (Schleier & Schuell). 6. Antibodies: e.g., anti-HPV E7 Ab (Santa Cruz); rabbit anti-mouse biotin conjugated (DAKO); avidin-peroxidase conjugated (DAKO). 7. Blocking solution: 10% powdered milk in PBS. 8. Antibody diluting solution: 10% powdered milk in PBS/0.5% Tween. 9. Washing buffer: 0.5% Tween in PBS. 10. ECL Kit (Amersham).

2.9. Assessing Anchorage-Independent Growth in Soft Agar 1. 2. 3. 4. 5.

60-mm Tissue-culture dishes. 5-mL Bijoux tubes. Difco Noble Agar. FBS. p-iodonitrotetrazolium violet.

3. Methods 3.1. Large-Scale Preparation of Plasmid DNA For any transformation assays as well as in vitro translation, the quality of the DNA used is critical. We suggest plasmid preparation using the following cesium chloride/ethidium bromide gradient protocol (31). 1. Plasmids are amplified by growing bacteria overnight at 37°C in 400 mL of Luria broth supplemented with the appropriate antibiotic (e.g., 50 µg/mL of ampicillin) with vigorous shaking in a rotary shaker (see Note 3).

Transformation Assays for HPV Oncoproteins

385

2. The next day, the bacteria are pelletted at 12,500g in a GS3 Sorvall rotor using a polyallomer tube (or its equivalent) for 10 min. 3. The pellet is lysed in 18 mL of alkaline solution 1 (32) and left to stand at room temperature for 5 min. 4. Then 40 mL of freshly made solution 2 are added and the suspension mixed by gently inverting the tube several times. After an incubation on ice for 10 min, 20 mL of ice-cold solution 3 are added and the tube is again inverted several times until the liquid phases are no longer distinguishable and a flocculent white precipitate (comprising chromosomal DNA, high-molecular-weight RNA, and membrane complexes) is formed. 5. After 30 min on ice, the suspension is centrifuged for 10 min at 20,000g and the supernatant is then filtered through three layers of cheesecloth into a fresh tube containing 0.6 volume of 2-propanol. 6. The nucleic acids are recovered by centrifugation at 20,000g for 15 min, the supernatant is carefully decanted, and the bottle is left open to allow the pellet to dry. The DNA pellet is then dissolved in 11.5 mL of TE (pH 8). For every 1 mL of TE suspension, then add 1 g of solid CsCl. The solution is mixed gently to allow the salt to dissolve, and then 0.6 mL of ethidium bromide (10 mg/mL in water) are added for every 10 mL of the DNA/CsCl solution. Everything is centrifuged for 15 min at 20,000g in a Sorvall to eliminate the complexes formed between the ethidium bromide and the residual bacterial proteins. 7. Using a 10-mL syringe fitted with a large (18-gage) needle, the clear red solution is transferred into a Beckman Quick-Seal, or equivalent tube suitable for centrifugation, in a Beckman vertical Ti70 rotor. The tube is sealed using a heatsealing instrument and is centrifuged for 24 h at 150,000g at 24°C in vacuum. At the end of the centrifugation, two bands of DNA located in the center of the gradient are visible in ordinary light: the upper band, which should usually contain less material, consists of linear bacterial (chromosomal) DNA and nicked circular plasmid DNA; the lower band consists of closed circular plasmid DNA. The pellet at the bottom consists of ethidium bromide/RNA complexes (Fig. 1). The circular plasmid is collected in a fresh tube with an 18-gauge needle on a 2.5-mL syringe, after having inserted another needle in the top of the tube to allow air to enter. The ethidium bromide is removed through several extractions with a TE/2-propanol/Cs/Cl saturated solution, until the pink color disappears from both the aqueous and the organic phases. 8. DNA is then precipitated in a sylanized corex glass tube with 2 volumes of TE and 2.5 volumes of absolute ethanol. After an incubation of 3 h at –20°C, the tube is centrifuged at 25,000g in a SS34 Sorvall rotor for 20 min. The DNA pellet is dried, dissolved in sterile TE, and the final concentration measured by OD260 in a spectrophotometer.

3.2. Transfection of Established Rodent Cells In the context of HPV, the most potent viral oncoprotein in established rodent cells is E7. Together with plasmid DNA encoding HPV-16 E7, which

386

Massimi and Banks

Fig. 1. Scheme of plasmid DNA extraction. The upper band in the gradient contains linear bacterial DNA and nicked circular plasmid DNA; the lower contains closed circular plasmid DNA. The band on the top contains proteins, and the pellet on the bottom is made by ethidium bromide and RNA. The plasmid DNA is collected with a syringe, inserting a needle in the top of the tube to allow air to enter.

could be considered the positive control of the assay, it is possible to include other candidate genes that have to be tested for their transforming capacity. 1. Established mouse fibroblasts NIH 3T3 and 3T3 A31 are cultured in supplemented DMEM in an incubator at 37°C with 5% CO2. 2. 1 × 105 cells are plated in 100-mm tissue-culture dishes the day preceding so that they can be around 50% confluent at the transfection step (see Note 4).

The established amount of HPV-16 E7 DNA necessary to get a reasonable percentage of transformed cells is 5 to 7 µg for a 100-mm dish. A selectable marker also needs to be included in the transfection, and the neomycin gene (such as psv2neo or pCDNA3) conferring resistance to Geneticin-sulphate (G-418) is one of the choices (33). One to two micrograms of this plasmid should be added in the transfection, which is carried out using a standard calcium phosphate co-precipitation procedure (6). 1. All of the single DNA plasmids used for one-dish transfection are placed in a 1.5-mL tube containing TE to a final volume of 190 µL plus 22 µL of 2.5 M CaCl2. 2. 200 µL of this mixture are then transferred drop-wise to 200 µL of 2X HBS (Fig. 2).

Transformation Assays for HPV Oncoproteins

387

Fig. 2. Scheme of DNA transfection. DNA is placed together with 22 µL of 2.5 M CaCl2 plus 190 µL of TE in an Eppendorf and then is mixed with 200 µL of 2X HEPESbuffered saline for 40 min. DNA is then placed on the cells, which are subjected to a glycerol shock after 4–5 h. 3. After incubation for 40 min at room temperature, the DNA mixture is added to the dish of cells containing 4.5 mL of freshly added medium. 4. After 5 h, the cells are washed with 1X Versene solution followed by serum-free medium. 5. The cells are then exposed to a solution of 14% glycerol in DMEM without serum for 1 min. After two washes with serum-free DMEM, supplemented DMEM is added back to the cells together with the appropriate concentration of the selection: 400 µg/mL of G-418. 6. The cells are then left to select over a period of 1–2 wk. Individual colonies can be selected by ring cloning (see below), or a polyclonal pool of transformed cells can be established. The readout for transformation in these assays is by assessing the ability of these cells to grow in an anchorage-independent manner. This is done in soft agar and is described below under Subheading 3.7.

3.3. Extraction and Culture of Primary Epithelial Cells 1. BMK or BRK cells are obtained by tissue extraction from kidneys of 9-d-old mice (BALB/c) or rats (Wistar Hannover), respectively (see Note 5). 2. After sacrifice, the animals are washed several times with 100% absolute ethanol to avoid any type of external contamination during cell preparation. The kidneys are removed from each animal by cutting the back until the organs are visible (Fig. 3A) (see Note 6). The kidneys, once extracted, are placed immediately in a

388

Massimi and Banks

Fig. 3. Scheme of epithelial cell extraction. Kidneys are extracted from sacrificed animals (A,B) and are homogenized and trypsinized (C,D). Cells are subsequently placed in tissue-culture dishes (E) and cultured as normal with complete Dulbecco’s modified Eagle’s medium.

3.

4.

5. 6.

50-mL Falcon tube containing serum-free supplemented DMEM (Fig. 3B) (see Note 7). The kidneys are then washed three times in serum-free supplemented DMEM to eliminate the residues of blood and adipocytes. This is also an important step, since the fat present close to the kidneys can interfere with the following trypsinization. The organs are then placed in a 60-mm dish with 2 mL of serum-free supplemented DMEM, where they are chopped with scissors into small homogeneous pieces (Fig. 3C). The material is then transferred into a fresh 50-mL tube and washed three times with serum-free DMEM, and then once with PBS. The cells are then subjected to a series of three 15-min incubations at 37°C/10% CO2 in 5 mL of 0.25% trypsin/10X Versene. At the end of each incubation, the supernatant is removed into another 50-mL Falcon tube containing 15 mL FBS, which is essential for stopping the trypsin reaction (Fig. 3D). These cells should also be kept at 37°C. At the end of the three trypsinizations, the cells are centrifuged for 10 min at 3000g. The pellet is resuspended in 10 mL of supplemented DMEM (with FBS), and, at this point, the cells are ready to be plated in 100-mm tissue-culture dishes. These should be divided between the appropriate number of dishes and cultured overnight at 37°C (Fig. 3E).

Transformation Assays for HPV Oncoproteins

389

3.4. Transfection of Epithelial Cells After one day in culture, BRK cells are ready to be transfected. In the case of BMK it is usually necessary to leave them for an additional 24 h. Transformation of primary epithelial cells requires the cooperation of several genes (2,34), and in this context different oncogenes have been classified as establishment genes and transforming genes (1,2,35). In the case of HPV, E6 and E7 function as establishment oncogenes, while ras and fos act as transforming oncogenes. Transfection of primary epithelial cells is carried out in exactly the same way as described above for established cells (6). Typically, 5 µg of pJ4Ω HPV16 E7 or E6 would be combined together with 3 µg of EJ-ras expression plasmid plus 1–2 µg of psv2neo.

3.5. Selection of Colonies and Generation of Transformed Cell Lines 1. Following transfection and glycerol shock, the cells are placed onto selection (200 µg/mL of G-418). The medium is changed on the plates every 3–4 d and the colonies are left to develop and grow for at least 2 wk. 2. After this time, single distinct colonies are clearly visible in the HPV-16 E7 plus EJ-ras transfections. There will be essentially two types of transformed colonies with distinct morphology: one, where cells are very spikey and weakly adherent (Fig. 4A); the other, where cells are very flat and form epithelial sheets (Fig. 4B). Both of these are transformed cells. It is also possible to find some contaminations of fibroblast colonies that are clearly recognizable by their different morphology (Fig. 4C). If the experiment has been designed to compare the number of the transformed colonies obtained with different DNAs, these fibroblastic colonies have to be eliminated from the total number. 3. At this stage of the assay, the colonies can be stained to allow visualization and counting. Cells are washed with PBS and fixed with 10% paraformaldehyde/PBS for 20 min. After several washes with PBS, the dishes are stained with 10% Giemsa Blue in PBS for 1 h. Following extensive washes in water, the blue colonies are visible on the plate (Fig. 5). 4. If cell lines need to be established, then the dish is washed with PBS and single colonies are picked by trypsinization using plastic cloning rings that are commercially available. The rings are fixed on the plate using vacuum grease, and 50 µL of trypsin are placed in the ring and left to react for 5 min. 50 µL of DMEM with 10% FBS are added to stop the trypsin reaction, and the cells are then transferred to a 24-well tissue-culture plate. When confluent, the cells are passaged to 12-well and then to 6-well plates, and ultimately to a 75-cm2 flask.

3.6. Verification of Continued Oncoprotein Expression Although it is very unusual to obtain transformed colonies from BRK cells harboring both oncoproteins, BMK cells on the other hand are more susceptible to higher levels of background transformation. In the case of established

390

Massimi and Banks

Fig. 4. Different cell morphologies that could be present in a transformation assay. (A) Spiky and weakly adherent cells. (B) Flat cells which can form epithelial sheets. (C) Fibroblast cells.

Fig. 5. Staining of colonies. Cells are fixed with 10% paraformaldeyde and stained with Giemsa Blue. (A) ras alone transfection. (B) Human papillomavirus (HPV)-16 E7 + ras transfection.

Transformation Assays for HPV Oncoproteins

391

rodent cells, the proliferation is possible without the added oncogene; therefore, in all these cases it is essential that any lines that are generated be analyzed for the continued expression of the oncoprotein of interest. The following describes such an analysis for E7, but this is relevant for any other combination of viral or cellular proteins. 1. The cells are extracted in lysis buffer and proteins are separated on SDS-PAGE gel, then electrophoretically transferred to nitrocellulose 0.22-µm membrane following the Maniatis protocol (31). 2. Membranes are blocked to avoid aspecific signal with incubation in 10% milk in PBS at 37°C for 1 h, then incubated with anti-E7 antibody diluted 1:100 in PBS with 10% milk powder and 0.5% Tween. After 2 h, the blot is washed in PBS/ 0.5% Tween and then incubated with biotinylated anti-mouse antibody diluted 1:1000 in PBS/10% milk powder/0.5% Tween for another hour. After several washes of the membrane, the final incubation is carried out with avidin-peroxidase conjugate diluted 1:1000 in PBS/10% milk/0.5% Tween. The reaction is then developed using the ECL kit, according to the manufacturer’s instructions.

3.7. Soft Agar Assays A key characteristic of transformed cells is their ability to grow in an anchorage-independent manner (36–39). This can be assessed easily by performing a soft agar assay. 1. Following the method developed by Macpherson and Montagnier (40), prepare 0.5% agar in supplemented DMEM by boiling the agar at 5% concentration in distilled water and diluting it 1/10 in supplemented DMEM at 45°C. 3 mL of this agar solution are poured into 60-mm tissue-culture dishes and left to set. The remaining agar is kept at 45°C. 2. Cells of interest are trypsinized, counted, and diluted to be at a concentration of 3 × 105/mL. One mL of this suspension is added to a 5-mL bijoux tube containing 2 mL of agar solution. This is mixed, and 0.5 mL are added to the previously prepared dishes and left to set. 3. Then the plates are incubated at 37°C overnight, and the following day the dishes are overlaid with a further 2 mL of 0.5% agar/DMEM solution. If the cells are fully transformed, then small colonies start to appear within 3–4 d. Colonies can be stained overnight with p-iodonitrotetrazolium violet (1 g/L) in PBS, photographed, and counted through an inverted microscope.

4. Notes 1. The pH is critical for the efficiency of the transfection. 2. The choice of expression plasmid obviously depends on the nature of the assays; however, efficient transformation can be obtained with pJ4Ω HPV-16 E7 (6,7,12–15), pJ4Ω HPV-16 E6 (8,16), or pJ4Ω HPV-16 E5 (9,10). The cooperating oncogene of choice is EJ-ras (11,16,17) and selectable marker (geneticin sulphate: G-418) encoded by psv2neo (6,7,12–15).

392

Massimi and Banks

3. It is also optional to amplify plasmids that replicate to only moderate copy numbers in their host bacteria (e.g., pJ4Ω), by adding 400 µL of chloramphenicol (34 mg/mL in ethanol) to a final concentration of 170 µg/mL. This treatment has the added advantage of inhibiting bacterial replication and reducing viscosity of the lysate, thereby simplifying purification of the plasmid DNA. Plasmids of a later generation (e.g., pCDNA3) replicate to such high copy numbers that amplification is unnecessary. 4. It is very important that cells are not over-confluent prior to transfection, because this could reduce transfection efficiency as well as the efficiency of the antibiotic selection. 5. The number of animals that have to be sacrificed depends on the number of cells that are required for the following experiments. In an average preparation, it is possible to extract enough cells from one rat kidney to plate three to four dishes (100 mm), which will be 50% confluent the following day. In the case of mice, assume an additional day of growth prior to transfection. 6. During the extraction, it is also important to avoid the intestine, which is situated very close to the right-hand side kidney, because this is a major source of bacterial contamination. 7. It is extremely important at this stage, as well as later, not to allow the organs to desiccate.

References 1. Land, H., Parada, L. F., and Weinberg, R. A. (1983) Cellular oncogenes and multistep carcinogenesis. Science 222, 771–778. 2. van der Eb, A. J. and Bernards, R. (1984) Transformation and oncogenicity by adenoviruses. Curr. Top. Microbiol. Immunol. 110, 23–51. 3. Heilmann, V. and Kreienberg, R. (2002) Molecular biology of cervical cancer and its precursors. Curr. Womens Health Rep. 2, 27–33. 4. Sunokawa, Y., Takebe, N., Kasamatsu, T., Terada, M., and Sugimura, T. (1986) Transforming activity of human papillomavirus type 16 DNA sequence in a cervical cancer. Proc. Natl. Acad. Sci. USA 83, 2200–2203. 5. Yasumoto, S., Burkhardt, A. L., Doniger, J., and DiPaolo, J. A. (1986) Human papillomavirus type 16 DNA-induced malignant transformation of NIH 3T3 cells. J. Virol. 57, 572–577. 6. Matlashewski, G. J., Osborn, K., Murray, A., Banks, L., and Crawford, L. V. (1987) Transformation of mouse fibroblasts with HPV type 16 DNA using a heterologous promoter. In Cancer Cells, Papillomaviruses vol. 5 (Steinberg, B.M., Brandsma, J.L., and Taichman, L. B., eds.), New York, Cold Spring Harbor, pp. 195–199. 7. Bedell, M. A., Jones, K. H., Grossman, S. R., and Laimins, L. A. (1989) Identification of human papillomavirus type 18 transforming genes in immortalized and primary cells. J. Virol. 63, 1247–1255. 8. Sedman, S. A., Barbosa, M. S., Vass, W. C., et al. (1991) The full-length E6 protein of human papillomavirus type 16 has transforming and trans-activating

Transformation Assays for HPV Oncoproteins

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

19.

20.

21. 22.

393

activities and cooperates with E7 to immortalize keratinocytes in culture. J. Virol. 65, 4860–4866. Pim, D., Collins, M., and Banks, L. (1992) Human papillomavirus type 16 E5 gene stimulates the transforming activity of the epidermal growth factor receptor. Oncogene 7, 27–32. Leechanachai, P., Banks, L., Moreau, F., and Matlashewski, G. (1992) The E5 gene from human papillomavirus type 16 is an oncogene which enhances growth factor-mediated signal transduction to the nucleus. Oncogene 7, 19–25. Matlashewski, G., Schneider, J., Banks, L., Jones, N., Murray, A., and Crawford, L. (1987) Human papillomavirus type 16 DNA cooperates with activated ras in transforming primary cells. EMBO J. 6, 1741–1746. Crook, T., Morgenstein, J. P., Crawford, L. V., and Banks, L. (1989) Continued expression of HPV 16 E7 protein is required for maintenance of the transformed phenotype of cells co-transformed by HPV16 plus EJ-ras. EMBO J. 8, 513–519. Phelps, W. C., Yee, C. L., Munger, K., and Howley, P. M. (1988) The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53, 539–547. Storey, A., Pim, D., Murray, A., Osborn, K., Banks, L., and Crawford, L. (1988) Comparison of the in vitro transforming activities of human papillomavirus types. EMBO J. 7, 1815–1820. Kanda, T., Watanabe, S., and Yoshiike, K. (1988) Immortalisation of primary rat cells by human papillomavirus type 16 subgenomic DNA fragments controlled by the SV40 promoter. Virology 165, 321–325. Vousden, K. H., Doniger, J., DiPaolo, J. A., and Lowy, D. R. (1988) The E7 open reading frame of human papillomavirus type 16 encodes a transforming gene. Oncogene Res. 3, 167–175. Storey, A. and Banks, L. (1993) Human papillomavirus type 16 E6 gene cooperates with EJ-ras to immortalize primary mouse cells. Oncogene 8, 919–924. Pim, D., Storey, A., Thomas, M., Massimi, P., and Banks, L. (1994) Mutational analysis of HPV-18 E6 identifies domains required for p53 degradation in vitro, abolition of p53 transactivation in vivo and immortalisation of primary BMK cells. Oncogene 9, 1869–1876. Durst, M., Dzarlieva-Petrusevska, R. T., Boukamp, P., Fusenig, N. E., and Gissmann, L. (1987) Molecular and cytogenetic analysis of immortalized human primary keratinocytes obtained after transfection with human papillomavirus type 16 DNA. Oncogene 1, 251–256. Pirisi, L., Yasumoto, S., Feller, M., Doniger, J., and DiPaolo, J. A. (1987) Transformation of human fibroblasts and keratinocytes with human papillomavirus type 16 DNA. J. Virol. 61, 1061–1066. Kaur, P. and McDougall, J. K. (1988) Characterization of primary human keratinocytes transformed by human papillomavirus type 18. J. Virol. 62, 1917–1924. Schlegel, R., Phelps, W. C., Zhang, Y. L., and Barbosa, M. (1988) Quantitative keratinocyte assay detects two biological activities of human papillomavirus DNA and identifies viral types associated with cervical carcinoma. EMBO J. 7, 3181–3187.

394

Massimi and Banks

23. McCance, D. J., Kopan, R., Fuchs, E., and Laimins, L. A. (1988) Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc. Natl. Acad. Sci. USA 85, 7169–7173. 24. Pecoraro, G., Morgan, D., and Defendi, V. (1989) Differential effects of human papillomavirus type 6, 16, and 18 DNAs on immortalization and transformation of human cervical epithelial cells. Proc. Natl. Acad. Sci. USA 86, 563–567. 25. Woodworth, C. D., Doniger, J., and DiPaolo, J. A. (1989) Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma. J. Virol. 63, 159–164. 26. Park, N. H., Min, B. M., Li, S. L., Huang, M. Z., Cherick, H. M., and Doniger, J. (1991) Immortalization of normal human oral keratinocytes with type 16 human papillomavirus. Carcinogenesis 12, 1627–1631. 27. Hudson, J. B., Bedell, M. A., McCance, D. J., and Laiminis, L. A. (1990) Immortalization and altered differentiation of human keratinocytes in vitro by the E6 and E7 open reading frames of human papillomavirus type 18. J. Virol. 64, 519–526. 28. Halbert, C. L., Demers, G. W., and Galloway, D. A. (1991) The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol. 65, 473–478. 29. Straight, S. W., Hinkle, P. M., Jewers, R. J., and McCance, D. J. (1993) The E5 oncoprotein of human papillomavirus type 16 transforms fibroblasts and effects the downregulation of the epidermal growth factor receptor in keratinocytes. J. Virol. 67, 4521–4532. 30. Venuti, A., Salani, D., Poggiali, F., Manni, V., and Bagnato, A. (1998) The E5 oncoprotein of human papillomavirus type 16 enhances endothelin-1-induced keratinocyte growth. Virology 248, 1–5. 31. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). Molecular Cloning, a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. 32. Birnboim, H. C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523. 33. Southern, P. J. and Berg, P. (1982) Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J. Mol. Appl. Genet. 1, 327–341. 34. Ruley, H. E. (1983) Adenovirus early region 1A enables viral and cellular transforming genes to transform primary cells in culture. Nature 304, 602–606. 35. Rassoulzadegan, M., Naghashfar, Z., Cowie, A., et al. (1983) Expression of the large T protein of polyoma virus promotes the establishment in culture of “normal” rodent fibroblast cell lines. Proc. Natl. Acad. Sci. USA 80, 4354–4358. 36. Noda, T., Yajima, H., and Ito, Y. (1988) Progression of the phenotype of transformed cells after growth stimulation of cells by a human papillomavirus type 16 gene function. J. Virol. 62, 313–324. 37. Miyasaka, M., Takami, Y., Inoue, H., and Hakura, A. (1991) Rat primary embryo fibroblast cells suppress transformation by the E6 and E7 genes of human papillomavirus type 16 in somatic hybrid cells. J. Virol. 65, 479–482.

Transformation Assays for HPV Oncoproteins

395

38. Hurlin, P. J., Kaur, P., Smith, P. P., Perez-Reyes, N., Blanton, R. A., and McDougall, J. K. (1991) Progression of human papillomavirus type 18-immortalized human keratinocytes to a malignant phenotype. Proc. Natl. Acad. Sci. USA 88, 570–574. 39. Leechanachai, P., Banks, L., Moreau, F., and Matlashewski, G. (1992) The E5 gene from human papillomavirus type 16 is an oncogene which enhances growth factor-mediated signal transduction to the nucleus. Oncogene 7, 19–25. 40. Macpherson, I. and Montagnier, L. (1964) Agar suspension culture for the selective assay of cells transformed by polyoma virus. Virology 23, 291–294.

Adeno-Associated Virus and HPV Interaction

397

28 Analysis of Adeno-Associated Virus and HPV Interaction Paul L. Hermonat, Hong You, C. Maurizio Chiriva-Internati, and Yong Liu Summary It is slowly becoming accepted that adeno-associated virus (AAV) is another significant factor involved in cervical carcinogenesis. However, unlike human papillomavirus (HPV), which is positively associated with cervical cancer, AAV is negatively associated with this cancer. This negative association appears to be through a direct and complex bi-directional interaction between AAV and HPV. Essentially all assays used for studying HPV can be used for studying the AAV-HPV interaction. This is because both viruses are productive in the same tissue, the stratified squamous epithelium (skin). Their relationship can be studied on the level of the complete virus and their complete life cycle using the organotypic epithelial raft culture system, which generates a stratified squamous epithelium. Their relationship can be studied in various other tissue-culture models measuring oncogenic potential. Their interaction can also be studied on the component level, as both protein–protein and protein–DNA interactions are known. Their relationship has even been studied using transgenic animals. The AAV-HPV relationship can be broken down into two halves—AAV-encoded products, which affect HPV biology, and HPV-encoded products, which affect AAV biology. To date, the former are much better studied than the latter. The rep gene and its largest product, Rep78, are responsible for most of AAV’s effects upon HPV. This chapter largely focuses on AAV’s effect on the HPV life cycle.

1. Introduction It is well known that human papillomaviruses (HPV) are positively associated with cervical cancer. Although less well known, multiple epidemiological studies substantiate that adeno-associated virus (AAV) is negatively associated with this same cancer. Through the use of the organotypic epithelial raft culture system and other assays, we now know there is a complex bidirectional interaction between AAV and papillomaviruses, with both positive and negative aspects.

From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

397

398

Hermonat et al.

1.1. Epidemiology of AAV and Cervical Cancer AAV is naturally found in the female genital tract, often in association with HPV (1–4). Multiple sero-epidemiological studies have demonstrated an inverse association between anti-AAV antibody and cervical cancer (5–7). As antibody titers reflect virus challenge, these studies are consistent with AAV infection playing a protective role against cervical cancer. A recent blinded epidemiologic study identifying AAV DNA isolated from normal and diseased cervical samples, has also confirmed the negative association of AAV with cervical carcinogenesis (odds ratio association with high-grade cervical lesions of 0.32) (8).

1.2. Early Studies on AAV Interaction With Bovine Papillomavirus and Identification of AAV Rep78 as the Antipapillomavirus Protein The possibility of an AAV–papillomavirus interaction was first investigated using bovine papillomavirus (BPV) in C127 mouse fibroblasts as a model. In these early experiments, AAV Rep78 was found to both inhibit BPV-induced oncogenic transformation and BPV DNA replication (9–11). Chimeric BPVAAV genomes, which include the Rep78 coding sequences, were also found to be defective in both of these activities (12).

1.3. Later Studies on AAV Interaction With HPV Once assays were developed for studying HPV-induced oncogenic transformation, AAV was found to have a similar inhibitory affect on HPV 16 and 18 (13–15). AAV was also found to inhibit HPV in animal models, including transgenics (16,17). It is the Rep78 protein, encoded by the AAV rep gene, which is responsible for this inhibition (9,13–15). Thus, the study of AAV Rep78, an “anti-oncogene analog,” and its mechanism of action, is a unique opportunity and perspective from which to study the molecular origins of cancer. Rep78 is known to affect HPV through its interaction with papillomavirus DNA, its encoded proteins, and a variety of relevant cellular proteins (18–25). Figure 1 shows the inhibition of HPV-16-directed oncogenic transformation of C127 cells by AAV Rep78 expression. Figure 2 shows a compilation of Rep78’s published interactions with papillomavirus proteins and DNA. Figure 3 demonstrates the binding of AAV-encoded Rep78 to the HPV-16 p97 promoter region. AAV also benefits from HPV. AAV, like HPV, is productive in skin (26), but AAV replication is enhanced by HPV (27,28). New advances are expected in the study of AAV–HPV interaction in the organtypic raft culture system, a model of squamous epithelium, as both viruses are productive in this tissue, it being their natural host. The latest results from such studies indicate that the presence of AAV temporally accelerates the HPV life cycle (29).

Adeno-Associated Virus and HPV Interaction

399

Fig. 1. Inhibition of human papillomavirus (HPV)-16-directed oncogenic transformation of contact-inhibited C127 cells by adeno-associated virus (AAV) Rep78. Eighty percent confluent plates of C127 cells were transfected with 4 µg of pL67R (HPV 16/ras) plus 8 µg of an AAV plasmid where indicated. After growth for 3 wk, the cells were fixed with formaldehyde and stained with methylene blue. Note that wildtype Rep78 inhibited foci formation, whereas mutant Rep78 did not.

Fig. 2. Established direct interactions of adeno-associated virus Rep78 with human papillomavirus.

Fig. 3. Binding of Rep78 to the p97 region of human papillomavirus (HPV) 16. The indicated amounts of MBP-Rep78 and 32P-labeled p97 (nt 14-106) were incubated together, and then the sample was electrophoresed on a nondenaturing polyacrylamide gel. Note that a protein–DNA complex (indicated by the arrow) forms in a dosagedependent manner for Rep78.

400

Hermonat et al.

2. Materials 1. pAT–HPV 16 (available from Dr. Richard Schlegel, BSB/113, Pathology, Georgetown University Medical Center, 3900 Reservoir Rd., NW, Washington, DC 20057, e-mail [email protected]). 2. pL67R (available from Dr. Paul L. Hermonat, address above). 3. pMal-Rep78 (MBP-Rep78) (available from Dr. Paul L. Hermonat, address above). 4. pKEX-Rep78 (available from Dr. Jurgen Kleinschmidt, Angewandte Tumorvirologie, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 242, 69120 Heidelberg, Germany, e-mail: [email protected]). 5. pSM620 (available from Dr. Paul L. Hermonat, address above). 6. p97 CAT (available from Dr. Peter M. Howley, Pathology, Rm 630, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115, e-mail [email protected]). 7. T-47D cell nuclear extract (Geneka Corp., HPV-negative breast ductal carcinoma). 8. Protein Purification and Expression System (New England Biolabs). 9. HeLa cell nuclear extract (Geneka Corp., HPV-positive cervical carcinoma). 10. Primary human foreskin keratinocytes (obtained from clinics). 11. CIN612 9E cells (available from Dr. Craig Meyers, Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033, e-mail [email protected]). 12. Keratinocyte serum-free medium (Gibco/BRL). 13. Dulbecco’s modified Eagle’s medium (DMEM). 14. LipofectACE (Gibco/BRL). 15. Binding buffer: 25 mM HEPES KOH (pH 7.5), 10 mM MgCl 2, 1 mM dithiothreitol (DTT), 2% glycerol, 25 µg bovine serum albumin, 50 mM NaCl, 0.01% NP40, and 0.5 µg poly (dI-dC) per ng of DNA. 16. Heparin-agarose (Sigma H6508). 17. Column-washing buffer: 0.254 M NaCl-phosphate-buffered saline (PBS) (pH 7.4). 18. Column elute buffer: 0.554 M NaCl-PBS (pH 7.4). 19. In vitro transcription reaction mixture: 0.5 µg of DNA template; 20 mM HEPES (pH 7.9); 5 mM MgCI2; 100 mM KCl; 0.5 mM DTT; 20% glycerol; 25 µM [32P] GTP, 400 µM ATP, CTP, and UTP; and 8 U of chosen nuclear extract in a total volume of 25 µL. 20. Cesium chloride. 21. Stop solution: 300 mM Tris HCl (pH 7.9), 0.5% sodium dodecyl sulfate (SDS), 300 mM sodium acetate, 2 mM ethylenediamine tetraacetic acid (EDTA), and 3 µg/mL tRNA. 22. 10-cm Tissue-culture plates. 23. Fetal bovine serum. 24. 1 mM Calcium chloride. 25. 0.5 µg/mL Hydrocortisone. 26. 293 Cells (ATCC). 27. Adeno-associated virus (AAV, available from ATCC).

Adeno-Associated Virus and HPV Interaction 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45.

401

Adenovirus type 2 (available from ATCC). DNase I. Deoxycholic acid (Sigma). 2.5-cm-Diameter glass column (Sigma C4669) that includes a Luer Lock (Sigma S7396). Filtration membrane (Sigma S7271). Biomax-100K NMWL-filter device (Millipore). Centricon 10-kDa cut-off membrane filters (Amicon). HPV 31b virus. Ultrafree-15 centrifugal filter device with 10K NMWL membrane (Millipore). Primer 1: 5'ACAAGCAGGATTGAAGGCCA, HPV 16 nt 7043-7065. Primer 2: 5'CATATCACCAGC TCACCGTC, nt 615-633 of pSV2CAT. Phenol-chloroform. Ethanol. Formamide, 0.1% xylene cyanol, 0.1% bromophenol blue. 6% Polyacrylamide, 7 M urea gel. 5% Glycerol. 0.5X TBE buffer: 45 mM Tris-borate, 1 mM EDTA. 32P ATP (5000 Ci/mmol, Amersham).

3. Methods (see Note 1) 3.1. Assays for Studying the Effects of AAV and Its Rep78 Gene on Inhibition of HPV-Induced Oncogenic Transformation

3.1.1. Focus Formation Assays A wide variety of related focus formation assays are available, and some of these are covered in Chapter 27. The differences in these assays are the specific HPV plasmid being used, the specific contact-inhibited cell line used, whether G418 selection is needed for the enrichment of transfected cells, and the length of culture time needed to allow for oncogenic foci to appear. These assays can be modified to study AAV-HPV interaction by the inclusion of an AAV plasmid. Appropriate AAV-containing plasmids would include the cloned wild-type AAV plasmid pSM620 (30) or the AAV Rep78 expression plasmid pKEX-Rep78 (14). Usually in these assays a 2-to-1 ratio of AAV plasmid to HPV plasmid is used.

3.1.2. Transformed Keratinocyte Outgrowth Assay Another assay related to focus formation is the transformed keratinocyte outgrowth assay (15). In this assay, oncogenically transformed keratinocytes will outgrow normal primary keratinocytes and fibroblasts when grown in calcium-supplemented DMEM. To more easily observe oncogenic transformation, a chimeric HPV-16/c-H-ras plasmid was generated in which the p97 promoter and the E6 and E7 genes were left intact and the E1 coding sequence

402

Hermonat et al.

was replaced with the coding sequences of c-H-ras, with ras expressed from the p97 promoter. Thus, this plasmid contained three oncogenes; it was called pL67R (representing LCR, E6, E7, ras). 1. Grow cultures of normal primary human foreskin keratinocytes in keratinocyte serum-free medium, to 80% confluence in 10-cm plates. 2. Transfect these primary cells with 4 µg of pL67R (HPV-16 E6, E7, ras plasmid) plus 8 µg of an AAV plasmid such as pSM620 (wild-type AAV) or pKEX-Rep78, using LipofectACE as specified by the manufacturer. 3. At 1 wk posttransfection, replace the medium with 50% keratinocyte serum-free medium/50% DMEM with 7% fetal bovine serum, 1 mM CaCl, and 0.5 µg/mL hydrocortisone. 4. At 4 and 5.5 wks posttransfection, split the cells 1:4. 5. At 7 wk, formalin fix and methylene blue stain the plates. The oncogenically transformed keratinocytes have a growth advantage over fibroblasts and non-transformed keratinocytes, and eventually replace these cells. The oncogenically transformed cells stain as very dark and dense areas. Quantitate the percent coverage of HPV and HPV+AAV-treated plates and compare them to each other and the null control. Using duplicate plates, the HPV and AAV DNA sequences can be identified by isolating total cellular DNA, digesting the DNA with appropriate restriction enzymes, size separating the DNA by agarose gel electrophoresis, and probing with radio-labeled AAV or HPV sequences.

3.1.3. Cell Growth in Soft Agar Tumor cell growth in soft agar is another standard assay system that can be used to study AAV inhibition of HPV, and this assay is covered in Chapter 27. This assay can be modified by the inclusion of an AAV plasmid, such as the wild-type AAV plasmid pSM620 (30) or the AAV Rep78 expression plasmid pKEX-Rep78 (14).

3.1.4. Tumor Growth in Mice There are a variety of tumor growth model systems in animals (e.g., see Chapter 16) that be used to study AAV inhibition of HPV, but these are too extensive to be covered in this chapter. These assays can be modified by the inclusion of an AAV plasmid, such as the wild-type AAV plasmid pSM620 or the AAV Rep78 expression plasmid pKEX-Rep78.

3.2. Effect of AAV and Rep78 on the HPV Life Cycle (see Notes 2–4) 3.2.1. Studying AAV’s Effect on HPV Replication During Productive Infection, in the Organotypic Epithelial Raft Culture System Both HPV and AAV are productive in the organotypic epithelial raft culture system (26,28,29). Thus, this system will be a central and important assay for

Adeno-Associated Virus and HPV Interaction

403

much future research and is described in detail in Chapters 12–14. An important point to address here is that HPV is a relatively slow virus, taking 10–12 d of culture to produce progeny virus. In sharp contrast, AAV is relatively fast, completing its life cycle in approx 3–5 d. Moreover, when the two viruses are together, the presence of AAV stimulates the more rapid completion of the HPV life cycle, reducing it from 10–12 d to 4–6 d (29). The standard raft assay can be modified by infecting HPV-positive keratinocytes with wild-type AAV. Alternatively, these cells can be transfected with an AAV plasmid using a lipofection agent. Studying many variables is possible, e.g., the temporal introduction of the viruses. Primary keratinocytes could be infected with AAV first before the introduction/infection of HPV. Changes in viral DNA levels can then be analyzed by isolating total cellular DNA, size separating the DNA by agarose gel electrophoresis, Southern blotting the DNA, and probing with appropriate sequences. 3.2.1.1. GENERATION OF PURIFIED AAV VIRUS STOCK 1. Infect 293 cells with AAV and adenovirus type 2, both at multiplicity of infection of 5. 2. At 36 h, freeze-thaw the cells three times and column purify the AAV virus particles by the technique described by Auricchio et al. as below (34). 3. Treat AAV virus solution with DNase I (10 U/mL for 1 h at 37°C). 4. Treat virus solution with a final concentration of 0.5% deoxycholic acid for 30 min at 37°C. 5. Prepare column by pipetting 8 mL of heparin-agarose suspension into a 2.5-cmdiameter glass column that includes a Luer lock. 6. After flow through, apply a filtration membrane on top of the agarose bed. 7. Equilibrate the column with 25 mL of column-washing buffer. 8. Close the lock. Apply the AAV virus solution onto the heparin-agarose column and open the lock to allow 1 drop/s. 9. After loading the virus solution, wash the column with 50 mL of column-washing buffer. 10. Elute the AAV virus with 15 mL of column eluate buffer. 11. If needed, concentrate the AAV virus to approx 1 mL using a Biomax-100K NMWL filter device. 12. Assess the purity of the viral preparation (100 µL) on a 4–20% SDS-polyacrylamide gel, detecting the proteins by Coomassie staining. The presence of only VP1 (62 kDa), VP2 (73 kDa), and VP3 (87 kDa) indicates viral purity. 13. Titer purified virus by dot blot comparison. Treat 100 µL of virus stock with proteinase K at 50 µg/mL for 1 h at 37°C. This will release the encapsidated DNA. 14. Precipitate the DNA by adding 10 µg of carrier tRNA, NaCl to a final concentration of 0.1 M, and adding 2.5 vol of ethanol.

404

Hermonat et al.

15. After centrifugation, re-solubilize the DNA pellet in 5 µL of water, then add 10 µL of 0.4 N NaOH, 0.5 M NaCl for 10 min. Also prepare DNA standards of AAV DNA containing 106, 107, 108, and 109 copies of pSM620 plasmid DNA, and denature them in a similar manner. 16. Neutralize the samples with 200 µL of 0.5 M Tris-HCl, 1 M NaCl (pH 7.2) and immediately add to a dot blot apparatus, under suction, containing a pre-wetted nylon membrane. 17. Probe the dot blot membrane with 32P-labeled pSM620 DNA under standard conditions, wash with 1X SSC, and autoradiograph. 18. Compare the signal of the virus stock to the known standards to obtain a titer in encapsidated genomes per mL.

3.2.1.2. GENERATION OF PURIFIED HPV-31B VIRUS STOCK

HPV-31b virus stock can be generated from mature organotypic epithelial cell rafts generated using CIN612 9E cells, abbreviated to “612” hereafter, as described by You et al. (35). These cells harbor a wild-type, fully active HPV31b genome at approx 50 copies per cell, and can be rafted. 1. Twelve days after raising the raft to the air interface, harvest the raft tissues, mince, and homogenize in DMEM. 2. Treat the “rough” virus stocks with DNase I and titer it by dot blot hybridization to give the number of encapsidated genomes per mL. 3. For further purification, a cesium chloride (CsCl) gradient can be used. Add CsCl to the rough virus stock at the density of 1.3 g/mL. Form a gradient by ultracentrifugation at 135,000g for 24 h at 4°C. To harvest the fractions, puncture the tube and collect 1-mL fractions from the bottom. 4. Use 0.1 mL of each fraction and 0.1 mL of the “rough” cell lysate (without CsCl purification) for harvesting DNA, and analyze the amount of HPV DNA by Southern blotting and hybridization with 32P-HPV-31b DNA probe. 5. Dialyze the highest HPV-31b virus-containing fraction using an Ultrafree-15 centrifugal filter device with 10K NMWL membrane. After removal of the initial salt by three wash cycles with PBS at 2000 g, centrifuged at 4°C, store the purified HPV-31b virus stock at –80°C.

3.2.2. Effect of AAV/Rep78 on Regulation of HPV Transcription 3.2.2.1. STUDYING AAV REP78’S EFFECT ON THE HPV-16 P97 PROMOTER TRANSIENT CHLORAMPHENICOL ACETYLTRANSFERASE ASSAY

BY

Transient chloramphericol acetyltransferase (CAT) assays are a wellaccepted standard for studying promoter regulation. However, an often overlooked point is that this assay really includes both transcriptional and translational regulation. This assay is described in more detail in Chapter 22. Briefly, carry out transient CAT assays as follows: 1. Calcium phosphate transfect the p16P (p97-CAT) plasmid (4 µg) (36) plus the wild-type cloned-AAV plasmid pSM620 (30) or the Rep78 expression plasmid

Adeno-Associated Virus and HPV Interaction

405

pKEX-Rep78 plasmid (8 µg of either plasmid) (14). Variable amounts of CAT and AAV plasmid can be used, but usually twice as much AAV plasmid is transfected. 2. Forty-eight hours after transfection, cell extracts are prepared, equalized for protein content by spectroscopic analysis at 280 nm, and assayed for CAT activity. Alternatively, a marker expression plasmid can be co-transfected with the CATcontaining plasmid to determine transfection efficiency and allow for differences in transfection efficiency, if one’s transfection efficiency is found to be significantly variable.

3.2.2.2 STUDYING AAV REP78’S EFFECT ON THE HPV-16 P97 PROMOTER, BY IN VITRO TRANSCRIPTION IN NUCLEAR EXTRACTS

This is another standard assay for studying transcriptional regulation that has the advantage of allowing the addition of specific well-defined proteins, usually transcription factors, for the study of specific effects. 1. For studying the p97 promoter, an HPV-16 p97 CAT DNA fragment can be used as a template for transcription. Generate the p97 CAT-DNA fragment by standard PCR amplification using primer 1, complementary to the p97 sequences, and primer 2, complementary to the CAT sequences. Use the plasmid p16P (p97CAT) as the PCR template (36). The product will be 1.2 kb. 2. Carry out the in vitro transcription in a 25-µL reaction mixture with 8 U HeLa nuclear extract or 5 µg of T-47D nuclear extract. Incubate the reactions at 30°C for 60 min, and then terminate by adding 175 µL of stop solution. 3. Extract the RNA with phenol chloroform, precipitate with ethanol, and finally dissolve in 10 µL of formamide containing 0.1% each of xylene cyanol and bromophenol blue. 4. Analyze the samples on a 6% polyacrylamide, 7 M urea gel by autoradiography. The p97-specific RNA product is of approx 300 bases.

3.2.2.3. STUDYING AAV REP78’S INTERACTION WITH THE HPV-16 P97 DNA BY ELECTROPHORETIC MOBILITY SHIFT ASSAY (SEE NOTE 5)

Rep78 is known to bind to the long control region (LCR)/upstream regulatory region of papillomaviruses, and the electrophoretic mobility shift assay (EMSA) is a standard assay for observing such protein–DNA interaction. 1. A purified Rep78 protein must be generated using pMAL-Rep78 (37). Perform the purification of MBP-Rep78 using the Protein Purification and Expression System, following the kit directions. 2. Collect fractions and analyze them by SDS-polyacrylamide gel electrophoresis. 3. Concentrate the purified fractions using Centricon 10-kDa cut-off membrane filters. 4. Routinely, these procedures result in MBP-Rep78 protein of 70–90% purity with a yield of 200 µg/L bacterial culture. 5. Various regions of interest of the HPV-16 LCR may be used as protein-binding substrates.

406

Hermonat et al.

6. The sequences of interest, once generated as a synthetic double-stranded substrate, should be 5' end labeled with polynucleotide kinase using 32P ATP (5000 Ci/mmol). EMSA assays can be conducted as described in chapter 20. In brief, to carry out the EMSA assay, approx 1 ng of 5' end labeled DNA substrate should be incubated with increasing amounts of MBP-Rep78 for 10 min at room temperature in binding buffer. 7. Electrophorese the incubated products on a 4% polyacrylamide gel (40:1 acrylamide and bis-acrylamide weight ratio) with 5% glycerol in 0.5X TBE buffer at 100 V for approx 3 h. 8. After running the gel, it should be dried and autoradiographed at –70°C.

Converse to studying AAV’s affect on HPV is the analysis of HPV’s affect on AAV. While AAV is known to be fully productive in the organotypic epithelial raft culture system (26), HPV is also known to significantly enhance AAV replication (27,28). The organotypic epithelial raft culture system is very appropriate for studying HPV’s effects on the AAV life cycle. Again, AAV is the faster replicating virus in this system, so the times of harvest should be day 5 or before. Many experimental variables can be tried. AAV can be introduced either into HPV-positive keratinocytes or into normal keratinocytes transfected with an HPV subgenomic construct. Yet another variation can be dual infection by both AAV and HPV virus particles. Changes in viral DNA levels can then be analyzed by isolating total cellular DNA, size separating the DNA by agarose gel electrophoresis, and Southern blotting. 4. Notes 1. Any assay used to study HPV can be altered to study AAV’s effects on HPV. Thus, the full range of assays is not discussed here. 2. The main AAV effector is the Rep78 protein, the largest one of four proteins encoded by AAV’s rep gene. This has been determined by both the Hermonat and Kleinschmidt laboratories (11,13,14). A good choice of plasmid for expressing Rep78 is pKEX-Rep78 (Dr. Kleinschmidt), as it is mutated so that the smaller Rep proteins will not be expressed. 3. AAV Rep78 has the capability to interact with both DNA and proteins (18,19). 4. If you are observing AAV–HPV interaction in the organotypic raft culture system, be aware that wild-type AAV also replicates in this culture system. 5. For studying AAV Rep78’s in vitro biochemical interaction with HPV proteins and DNA, the use of the purified maltose-binding protein (MBP)-Rep78 fusion protein produced from the plasmid pMal-Rep78 in bacteria is recommended.

References 1. Han, L., Parmley, T. H., Keith, S., Kozlowski, K. J., Smith, L. J., and Hermonat, P. L. (1996) High prevalence of adeno-associated virus (AAV) type 2 rep DNA in cervical materials: AAV may be sexually transmitted. Virus Genes 12, 47–52.

Adeno-Associated Virus and HPV Interaction

407

2. Walz, C., Deprez, A., Dupressoir, T., Durst, M., Rabreau, M., and Schlehofer, J. R. (1997) Interaction of human papillomavirus type 16 and adeno-associated virus type 2 co-infecting human cervical epithelium. J. Gen. Virol. 78, 1441–1452. 3. Malhomme, O., Dutheil, N., Rabreau, M., Armbruster-Moraes, E., Schlehofer, J. R., and Dupressoir, T. (1997) Human genital tissues containing DNA of adeno-associated virus lack DNA sequences of the helper viruses adenovirus, herpes simplex virus or cytomegalovirus but frequently contain human papillomavirus DNA. J. Gen. Virol. 78, 1957–1962. 4. Walz, C. M., Anisi, T. R., Schlehofer, J. R., Gissmann, L., Schneider, A., and Muller, M. (1998) Detection of infectious adeno-associated virus particles in human cervical biopsies. Virology 247, 97–105. 5. Mayor, H. D., Drake, S., Stahmann, J., and Mumford, D. M. (1976) Antibodies to adeno-associated satellite virus and herpes simplex in sera from cancer patients and normal adults. Am. J. Obstet. Gyn. 126, 100–105. 6. Georg-Fries, B., Biederlack, S., Wolf, J., and zur Hausen, H. (1984) Analysis of proteins, helper dependence, and seroepidemiology of a new human parvovirus. Virology 134, 64–71. 7. Smith, J. S., Herrero, R., Erles, K., et al. (2001) Adeno-associated virus seropositivity and HPV-induced cervical cancer in Spain and Columbia. Internat. J. Cancer 94, 520–527. 8. Coker, A. L., Russell, R. B., Bond, S. M., et al. (2001) Adeno-associated is associated with lower risk of high grade cervical squamous intraepithelial lesions. Exper. Molec. Pathol. 70, 83–89. 9. Hermonat, P. L. (1989) The adeno-associated virus Rep78 gene inhibits cellular transformation induced by bovine papillomavirus. Virology 172, 253–261. 10. Schmitt, J., Schlehofer, J. R., Mergener, K., Gissman, L., and zur Hausen, H. (1989) Amplification of bovine papillomavirusDNA by N-methyl-N-nitro-Nnitrosoquanidine, ultraviolet irradiation, or infection with herpes simplex virus. Virology 172, 253–261. 11. Hermonat, P. L. (1992) Inhibition of bovine papillomavirus plasmid DNA replication by adeno-associated virus. Virology 189, 329–333. 12. Hermonat, P. L., Meyers, C., Parham, G. P., and Santin, A. D. (1998) Inhibition/ stimulation of bovine papillomavirus by adeno-associated virus is time as well as multiplicity dependent. Virology 247, 240–50. 13. Hermonat, P. L. (1994) Adeno-associated virus inhibits human papillomavirus type 16: a viral interaction implicated in cervical cancer. Cancer Res. 54, 2278–2281. 14. Horer, M., Weger, S., Butz, K., Hoppe-Seyler, F., Geisen, C., and Kleinschmidt, J. A. (1995). Mutational analysis of adeno-associated virus Rep protein-mediated inhibition of heterologous and homologous promoters. J. Virol. 69, 5485–5496. 15. Hermonat, P. L., Plott, R. T., Santin, A. D., Parham, G. P., and Flick, J. T. (1997) The adeno-associated virus Rep78 gene inhibits oncogenic transformation of primary keratinocytes by a human papillomavirus type 16-ras chimeric. Gyn. Oncol. 66, 487–494.

408

Hermonat et al.

16. Su, P. F. and Wu, F. Y. (1996) Differential suppression of the tumorigenicity of HeLa and SiHa cells by adeno-associated virus. Brit. J. Can. 73, 1533–1537. 17. Walz, C. M., Correa-Ochoa, M. M., Muller, M., and Schlehofer, J. R. (2002) Adeno-associated virus type 2-induced inhibition of the human papillomavirus type 18 promoter in transgenic mice. Virology 293, 172–181. 18. Zhan, D.-J., Santin, A. D., Parham, G. P., Li, C., Meyers, C., and Hermonat, P. L. (1999) Binding of the human papillomavirus type 16 p97 promoter by adenoassociated virus (AAV) Rep78 major regulatory protein correlates with inhibition. J. Biol. Chem. 274, 31,619–31,624. 19. Hermonat, P. L., Santin, A. D., and Zhan, D.-J. (2000) Binding of the human papillomavirus type 16 E7 oncoprotein and the adeno-associated virus Rep78 major regulatory protein in vitro and in yeast, and the potential for downstream effects. J. Hum. Virol. 3, 113–124. 20. Marcello, A., Massimi, P., Banks, L., and Giacca, M. (2000) Adeno-associated virus type 2 rep protein inhibits human papillomavirus type 16 E2 recruitment of the transcriptional coactivator p300. J. Virol. 74, 9090–9098. 21. Chon, S. K., Rim, B. M., and Im, D. S. (1999) Adeno-associated virus Rep78 binds to E2-responsive element 1 of bovine papillomavirus type 1. IUBMB Life 48, 397–404. 22. Hermonat, P. L., Santin, A. D., and Batchu, R. B. (1996) The adeno-associated virus Rep78 major regulatory, transformation suppressor protein binds cellular Sp1 and evidence of a biological effect. Cancer Res. 56, 5299–5304. 23. Hermonat, P. L., Santin, A. D., Batchu, R. B., and Zhan, D. J. (1998) The adenoassociated virus Rep78 major regulatory protein binds the cellular TATA-binding protein, TBP. Virology 245, 120–127. 24. Prasad, C. K., Meyers, C., Zhan, D. J., et al. (2003) The adeno-associated virus major regulatory protein Rep78-c-Jun-DNA motif complex modulates AP-1 activity. Virology 314, 423–431. 25. Su, P. F., Chiang, S. Y., Wu, C. W., and Wu, F. Y. (2000) Adeno-associated virus major rep78 protein disrupts binding of TATA-binding protein to the p97 promoter of human papillomavirus type 16. J. Virol. 74, 2459–2465. 26. Meyers, C., Mane, M., Kokorina, N., Alam, S., and Hermonat, P. L. (2000) Ubiquitous adeno-associated virus type 2 replicates in a model of normal skin. Virology 272, 338–346. 27. Ogston, P., Raj, K., and Beard, P. (2000) Productive replication of adeno-associated virus can occur in human papillomavirus type 16 (HPV-16) episome-containing keratinocytes and is augmented by the HPV-16 E2 protein. J. Virol. 74, 3494–3504. 28. Meyers, C., Alam, S., Mane, M., and Hermonat, P. L. (2001) Altered biology of adeno-associated virus type 2 and human papillomavirus during dual infection of natural host tissue. Virology 287, 30–39. 29. Agrawal, N., Mane, M., Chiriva-Internati, M., Roman, J. J., and Hermonat, P. L. (2002) Temporal acceleration of the human papillomavirus life cycle by adeno-

Adeno-Associated Virus and HPV Interaction

30.

31.

32. 33.

34.

35. 36.

37.

409

associated virus (AAV) type 2 super-infection in natural host tissue. Virology 297, 203–210. Samulski, R. J., Srivastava, A., Berns, K. I., and Muzyczka, N. (1983) Rescue of adeno-associated virus from recombinant plasmids: gene correction within the terminal repeats of AAV. Cell 33, 135–143. Walz, C. M., Correa-Ochoa, M. M., Muller, M., and Schlehofer, J. R. (2002) Adenoassociated virus type 2-induced inhibition of the human papillomavirus type 18 promoter in transgenic mice. Virology 293, 172–181. Su, P. F. and Wu, F. Y. (1996) Differential suppression of the tumorigenicity of HeLa and SiHa cells by adeno-associated virus. Brit. J. Cancer 73, 1533–1537. Selvakumar, R., Ahmed, R., and Wettstein, F. O. (1995) Tumor regression is associated with a specific immune response to the E2 protein of cottontail rabbit papillomavirus. Virology 208, 298–302. Auricchio, A., Hildinge,r M., O’Connor, E., Gao, G. P., and Wilson, J. M. (2001) Isolation of highly infectious and pure adeno-associated virus type 2 vectors with a single-step gravity-flow column. Hum. Gene Ther. 12, 71–76. You, H., Liu, Y., Agrawal, N., et al. (2003) Infection, replication and cytopathology of human papillomavirus type 31 in trophoblasts. Virology 316, 281–289. Romanczuk, H., Thierry, F., and Howley, P. M. (1990) Mutational analysis of cis elements involved in E2 modulation of human papillomavirus type 16 P97 and type 18 P105 promoters. J. Virol. 64, 2849–2859. Batchu, R. B., Miles, D. A., Rechtin, T. M., Drake, R. R., and Hermonat, P. L. (1995) Cloning, expression and purification of full length Rep78 of adeno-associated virus as a fusion protein with maltose binding protein in Escherichia coli. Biochem. Biophys. Res. Comm. 208, 714–720.

Substrate Degradation Induced by HPV E6 Oncoproteins

411

29 In Vitro Assays of Substrate Degradation Induced by High-Risk HPV E6 Oncoproteins Miranda Thomas and Lawrence Banks Summary The high-risk mucosal human papillomavirus E6 proteins were the first viral proteins that were shown to use the ubiquitin proteasome pathway for the inactivation of their cellular target proteins. The first substrate to be identified was the p53 tumor suppressor protein, and since then many other substrates for E6-induced degradation have been described. All of these require the presence of high-risk mucosal E6 together with the E1, E2, and E3 enzymes of the ubiquitin pathway. This activity of E6, although complex, is nonetheless amenable to in vitro analysis. Many different protocols have been described over the years for performing these assays. In this chapter we describe the most easily used and robust procedure that is routinely used in our laboratory.

1. Introduction Many cellular processes involve the controlled destruction of proteins: a good example is the degradation of cyclins used as signaling for progression through the cell cycle (1,2). A number of viruses use the proteasomal mechanisms of their host cell to alter the cellular environment to favor their own replication (3). The points where viruses impinge on cellular pathways are interesting, both for understanding how the virus replicates and, perhaps, for understanding how to stop it from doing so. Because these are complicated processes, in vitro assays are an extremely useful tool for unraveling them, and for providing potential links in the pathways that can then be further assessed by in vivo assays. 2. Materials 1. TNT coupled in vitro transcription/translation system (Promega). These kits use either rabbit reticulocyte lysate or wheat germ extract as a translation medium, and have a comprehensive set of instructions for their use (see Note 1). From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

411

412

Thomas and Banks

2. RNase-free sterile de-ionized water. 3. RNase inhibitor (Ambion). 4. Radiolabeled amino acid: [35S]-labeled methionine (Met) or cysteine (Cys), or [14C]-labeled leucine (Leu) (see Note 2). 5. In vitro expression plasmids (see Note 3 for selection, Note 4 for preparation, and Note 5 for storage). 6. TE buffer: 10 mM Tris-HCl (pH 8.0), 1 mM ethylenediaminetetraacetic acid (EDTA) 7. E1A buffer: 250 mM NaCl, 50 mM HEPES (pH 7.0), 0.1% NP40. 8. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gel loading buffer: 160 mM Tris HCl (pH 6.8), 1.6% SDS, 16 mM β-mercaptoethanol, 50% glycerol. 9. Antibody reactive with the target protein of the assay. 10. Protein A-Sepharose or protein G-Sepharose in E1A buffer. 11. Solutions and apparatus for SDS-PAGE separation of protein products. 12. X-ray film. 13. Sterile RNase-free microfuge tubes. 14. Sterile RNase-free pipet tips.

3. Methods 3.1. In Vitro Translation Before starting the translation, check the amino acid sequence of your proteins to determine which radiolabeled amino acid is the most appropriate (see Notes 2 and 6). 1. In vitro translate your proteins using the TNT kit (see Notes 7 and 8). 2. Run 1 µL of each translation reaction on SDS-PAGE, dry the gel, and expose on film or on a phosphorimager. 3. Analyze the success of your translation and decide on the amounts of each translation product to use (see Note 9).

3.2. In Vitro Degradation The proportions of target protein to human papillomavirus (HPV) E6 protein need to be determined empirically, as does the optimal assay time. For example, we would usually suggest a ratio of one p53 to three E6 (as determined from the radiolabel by phosphorimager or by film), using 0-, 30-, and 60-min time points. For Dlg, which is less effectively degraded in the presence of E6, a ratio of 1:5 and time points of 1 and 2 h would be better (see Fig. 1 and Note 10). 1. First calculate the volume of each time-point sample. In the example shown in Table 1, we would recommend 6.5 to 6.8 µL each. 2. Set up reaction tubes on ice (see Note 11), using water-primed lysate (wpl) to equalize the volumes. Do not use any additional buffers (see Note 12). Shown in Table 1 is a representative assay. To reduce variation from pipetting errors, each

Substrate Degradation Induced by HPV E6 Oncoproteins

413

Fig. 1. A cartoon representing the variation in the kinetics of E6-induced in vitro degradation (7–9). Table 1 Example of a Degradation Assay Set-Up Loading control

A䉳 B䉳 C䉳

Tube 1 2 3 4 5 6 7

Target

}

p53 6 µL

} }

p53 4 µL p53 4 µL

E6

} }

– – – 16E6 11 µL 18E6 9 µL

WPL*

}

16.5 µL – –

}

2 µL

Time (min) at 30°C 0 30 60 30 60 30 60

*Water-primed lysate. The in vitro translated proteins are mixed in the bold assay tubes (3, 5, and 7 here). 1-µL samples are removed for input controls (lettered tubes). Zero time-point sample is taken into tube 1 and frozen. Assay tubes are placed at 30°C. Samples are taken at 30 min into tubes 2, 4, and 6, and then frozen. Samples are taken at 60 min into fresh tubes labeled 3, 5, and 7, and frozen. Bold assay tubes are discarded as radioactive waste.

3. 4. 5. 6.

reaction (e.g., p53 alone for three time points) should be set up in a single tube and the time points removed from it. The bold tube numbers are the reaction tubes; the last time point is removed into a fresh tube and any remaining reaction mixture discarded as radioactive waste. Take 1 µL of each reaction mixture into 3 µL of gel loading buffer for loading controls. Either run these immediately on SDS-PAGE gel (use 15% polyacrylamide to see E6 inputs) or hold on dry ice (or –80°C) and run them together with the assay samples. Take your zero time-point sample into tube number 1, hold on dry ice (or –80°C). Put reaction tubes at 30°C. Take samples (see Note 13) into labeled chilled tubes at the relevant time points; hold each on dry ice (or –80°C). Discard reaction tubes after taking the final time points. These will probably have some residue of reaction mixture. This is preferable to finding that you do not

414

Thomas and Banks

have enough for a complete last time-point sample: some liquid always adheres to the outside of a pipet tip. 7. Having frozen your final samples on dry ice or at –80°C, they can be stored until required, or thawed and processed immediately. 8. Run the samples from tubes A, B, and C in Table 1 (the loading controls) on a 15% SDS-PAGE gel along with the final assay samples, dry, and expose the gel to X-ray film.

3.3. Immunoprecipitation Immunoprecipitation is used simply to separate the target protein from the reaction mixture and thus to produce a cleaner result. Reticulocyte lysate is a very highly concentrated protein solution, and the radiolabel can stick to the hemoglobin, thus making very dirty-looking SDS-PAGE gels and autoradiographs; this also makes the analysis of the results much more difficult (see Note 12). Immunoprecipitation is obviously not necessary if your translations were very efficient and thus your time-point samples are very small, e.g., up to 3 µL; in this case the background smear is negligible and the samples can be run on a minigel with a great saving of time and reagents. 1. Thaw your time-point samples; keep them on wet ice. 2. Add an appropriate antibody (see Note 14) to immunoprecipitate the remaining target protein; incubate on ice for 1 h. 3. Add sepharose-protein A or -protein G, as appropriate for your antibody; incubate on ice with occasional shaking or on a rotating wheel at 4°C for 30 min. 4. Wash samples twice with 1 mL of E1A buffer (see Note 15). 5. Remove as much E1A buffer as possible and add 20 µL of gel-loading buffer. 6. Run samples and loading controls on SDS-PAGE (at a polyacrylamide percentage suited to the target protein). 7. Dry gel and expose on film.

4. Notes 1. It used to be necessary to first transcribe your DNA, to purify the resulting mRNA, and then to translate your protein of interest from the purified mRNA. Although it is perfectly feasible to do this if necessary, the TNT kits provide a number of advantages that should be considered. Although they are expensive, they save a considerable amount of time. In addition, working with purified RNA is notoriously tricky and requires very good technical ability to keep batches consistent and free from RNases. If you use a kit, you do not have to develop the same level of technical expertise before you can get proteins to use in your assays. 2. Although in vitro translated (ivt) proteins can be labeled with 14C-leucine if they have neither methionine nor cysteine residues, it is generally more effective to label them with 35S. Assessment of the quality of translation is quicker, and thus your experiments can start sooner, while your translation product is still fresh. A radionuclide specifically intended for in vitro translation is advisable, such as the

Substrate Degradation Induced by HPV E6 Oncoproteins 35S-methionine/cysteine

TransLabel sold by ICN or the

35S-cysteine

415

sold by Amersham. 3. There are many vectors available for the in vitro translation of proteins, but the plasmids of choice are pSP64- or pCDNA3-based plasmids containing your genes of interest cloned downstream of the SP6 or T7 promoters, respectively. In general, all else being equal, SP6 promoters translate slightly better than T7 promoters in rabbit reticulocyte lysate and markedly better in wheat germ extract, but the pCDNA3 plasmids have the advantage of containing the cytomegalovirus (CMV) promoter, allowing the same plasmid to be used for in vivo expression in eukaryotic cells. In our hands, the T3 promoter is weaker and rarely produces equivalent levels of protein. In any case, it is worth ensuring that your gene of interest contains a Kozak sequence with the initiation codon (4–6), as this can increase translation levels considerably. 4. Alkaline SDS lysis and cesium chloride gradient centrifugation are the best methods of preparing clean and concentrated DNA for in vitro transcription/translation (see Chapter 27 for protocol). In the case of pCDNA3-based plasmids, this has the additional advantage of producing DNA suitable for transfecting into most eukaryotic cell lines. If you are constructing a vector for protein expression, you will almost certainly mini-prep your DNA for restriction enzyme digestion to ensure that your DNA fragment is present. Mini-prep method: spin out 1.5 mL of an overnight bacterial culture (2 min at full speed in a bench-top microfuge). Resuspend the pellet in 100 µL solution I (50 mM glucose, 25 mM Tris HCl (pH 8.0), 10 mM EDTA); after 5 min, add 200 µL of solution II (0.2 M NaOH, 1% SDS) on ice; after a further 5 min, add 150 µL of solution III (5 M potassium acetate, pH 4.8). Mix by shaking and spin in a bench-top microfuge for 5 min. Transfer 400 µL of supernatant into 1 mL ethanol and freeze on dry ice for 5 min. Spin in microfuge for 10 min; resuspend the pellet in 20 µL water. This DNA prep can also be used to check whether the protein is translated from any of your clones (this is particularly useful if you are cloning the fragment into a single site). However, the DNA should be treated for 1 h with RNase and then subjected to phenol/chloroform extraction and ethanol precipitation, before the translation reaction, which should, incidentally, contain at least twice the usual amount of RNase inhibitor. Remember to include a DNA construct that is known to be translatable in vitro as a positive control. You should also be aware that although a positive result is very useful (you only have to maxiprep DNA that is known to work), a negative result means nothing—you may just not be a very good miniprepper! So use this as a short-cut only if you are sure of yourself and can spare the reagents to do it. 5. Concentrated DNA stocks (either in sterile TE buffer or in sterile water) should be stored at –20°C, and more dilute working stocks (1 µg/µL in water) should be prepared from them, and also kept at –20°C. In general, it is advisable to keep the working stock in small aliquots to reduce the number of freeze–thaw cycles. Excessive freeze/thawing of the DNA, especially of the more dilute working stock, can damage it and reduce the level of translated product.

416

Thomas and Banks

6. For simple degradation assays, involving only one target protein plus an E6 protein, it is usual to use the amino acid most abundant in that protein: HPV E6 proteins are always translated using 35S-cysteine. However, if you intend to compare several target proteins, it is advisable to label each as equally as possible. For example, MAGIs-1, -2, and -3 have 13, 14, and 14 Cys residues, respectively, compared with 15, 25, and 22 Met residues. Cys labeling is thus the choice if comparing MAGI-1 with the others, whereas Met labeling might be preferable when looking at the degradation of MAGI-2 or MAGI-3 alone. 7. Always use fresh lysate. Although proteins can be translated in reticulocyte lysate that has been thawed more than once, you are unlikely to get good degradation from such translates. Other components of the proteasome pathway found in the lysate are very susceptible to freezing and thawing. Equally, although freezing once at –80°C after translating your proteins should not affect things too much, do not re-use previously thawed and refrozen aliquots of protein. Use them instead in GST-pulldown assays, or as positive controls or molecular-weight markers for Western blots. 8. Always set up at least one translation reaction primed with water, rather than DNA. Water-primed lysate (wpl) is used to equalize the volumes of degradation assays. Experience alone will tell you how much you are likely to need, so it is worth freezing it in several aliquots. 9. The standard size of one translation reaction as recommended in the Promega kits is 50 µL; however, half of that is often more than enough, particularly for target proteins. To check the levels of protein expression, take 1 µL of the translation reaction and run it on an SDS-PAGE gel, dry the gel, and assess your translation efficiency by exposure overnight on film, or by phosphorimager analysis. The latter has the advantage of being quicker and more quantifiable; a film, however, gives a clearer image, thus allowing you to assess the quality, as well as quantity, of your translated protein. 10. Certain reports have suggested that extended or even overnight incubations are required to see degradation, even of p53 in the presence of HPV-16 E6. By our standards, these count as failed assays: I would seriously doubt whether any E6-induced degradation of target protein could be reliably distinguished from the “noise” of simple protein instability under such conditions. If you do not see any degradation of a known target protein in 2 h, then the conditions of your assay probably need to be optimized. An indication of the approximate half-lives of various HPV E6 targets in in vitro degradation assays is shown in Fig. 1. 11. Because you are assaying degradation, all samples should be kept on ice at all times when not actually undergoing the degradation incubation at 30°C! 12. A number of early publications gave in vitro degradation methods using various buffered solutions to dilute the translated proteins and reduce the supposed inhibitory effects of hemoglobin upon in vitro degradation. In our hands, hemoglobin has never been inhibitory, but the use of these buffers has completely blocked any degradation. The notion may have arisen from the fact that running large volumes of radiolabeled reticulocyte lysate on an SDS-PAGE gel results in

Substrate Degradation Induced by HPV E6 Oncoproteins

417

a smear that makes it very difficult to see any individual protein bands. We have addressed this point by using an immunoprecipitation step to remove excess hemoglobin. 13. With degradation assays having long incubations, such as Dlg, or MUPP1 assays, it is advisable to spin the reaction tubes briefly in a bench-top microfuge before taking samples, as moisture evaporates from the reaction mixture and may condense on the lid, thus altering the concentration of the reaction mixture. In shorter assays, with targets such as MAGI-1, the variation in concentration is negligible in comparison with the variation in time points that would be caused by doing this. 14. The choice of antibody is important, as it is obviously necessary to immunoprecipitate as much of the protein as possible. Often a high-affinity polyclonal serum is very effective; alternatively, a mixture of monoclonal antibodies recognizing different epitopes on the protein is used. For example, in p53 degradation assays, we use either a polyclonal rabbit serum or a mixture of the pAb1801, pAb1802, and pAb1803 monoclonal antibodies. 15. Washing of these immunoprecipitations should not be done with the same rigor as would be used in a true immunoprecipitation reaction; two washes of 1 mL E1A buffer are usually adequate to remove excess reticulocyte lysate without losing significant amounts of the target protein.

References 1. Hershko, A. (1997). Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr. Opin. Cell Biol. 9, 788–799. 2. Obaya, A. J. and Sedivy, J. M. (2002). Regulation of cyclin-Cdk activity in mammalian cells. Cell. Mol. Life Sci. 59, 126–142. 3. Banks, L., Pim, D., and Thomas, M. (2003). Viruses and the 26S proteasome: hacking into destruction. Trends Biochem. Sci. 28, 452–459. 4. Kozack, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nuc. Acids Res. 15, 8125–8148. 5. Kozack, M. (1990). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA 87, 8301–8305. 6. Kozack, M. (1991). An analysis of vertebrate mRNA sequences: intimations of translational control. J. Cell. Biol. 115, 887–903. 7. Thomas, M., Laura, R., Hepner, K., et al. (2002) Oncogenic human papillomavirus E6 proteins target the MAGI-2 and MAGI-3 proteins for degradation. Oncogene 21, 5088–5096. 8. Pim, D., Thomas, M., Javier, R., Gardiol, D., and Banks, L. (2000). HPV E6 targeted degradation of the discs large protein: evidence for the involvement of a novel ubiquitin ligase. Oncogene 19, 719–725. 9. Lee, S. S., Glaunsinger, B., Mantovani, F., Banks, L., and Javier, R. T. (2000) Multi-PDZ domain protein MUPP1 is a cellular target for both adenovirus E4-ORF1 and high-risk papillomavirus type 18 E6 oncoproteins. J. Virol. 74, 9680–9693.

Induction or Inhibition of Apoptosis by HPV Proteins

419

30 Measuring the Induction or Inhibition of Apoptosis by HPV Proteins Anna M. Kowalczyk, Geraldine E. Roeder, Katie Green, David J. Stephens, and Kevin Gaston Summary Many viral proteins influence the cellular pathways that control cell proliferation and cell death. Some viral proteins trigger apoptotic cell death, and this may be important in host defense and viral spread. In other cases, viral proteins inhibit apoptosis. In this chapter, we will describe some of the methods that can be used to investigate the induction or inhibition of apoptosis by papillomavirus proteins.

1. Introduction Viral replication often requires host cell proliferation, and viruses have evolved multiple strategies to induce cell-cycle progression. Viral infection can also trigger cell suicide, and many viruses encode proteins that inhibit cell death. However, in some cases viruses might induce cell death in order to promote the spread of viral particles or viral genomes, as uninfected cells take up the remains of their dead neighbors (1). Cell death can occur via either of two pathways: 1. Necrosis occurs after severe or sudden injury, such as physical or chemical trauma, and is characterized by cell swelling and rupture followed by release of the cell contents and the stimulation of an inflammatory response (2). 2. Apoptosis is a more controlled form of cell death and is characterized by cell shrinkage, membrane boiling or blebbing, as well as nuclear condensation and DNA fragmentation (2,3). The endpoint of apoptosis is the formation of membrane-bound apoptotic bodies that are rapidly engulfed by phagocytes.

This chapter describes some of the methods that can be used to study the induction or inhibition of apoptosis by viral proteins. Several studies have From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

419

420

Kowalczyk et al.

shown that under some circumstances, the human papillomavirus (HPV) E2 and E7 proteins can induce apoptosis, whereas the HPV E6 protein can inhibit apoptosis (reviewed in ref. 4). Although these experiments typically involve protein over-expression and they are thus not necessarily representative of events in the HPV life cycle, apoptosis is an easily measurable endpoint, which allows a quantitative assessment of the effects of these proteins on the cell (5,6). Techniques such as flow cytometry examine an entire population of cells and can determine the percentage of cells that are undergoing apoptotic cell death (7). In contrast, the death of individual cells can be observed using microscopy, either in combination with specific markers or simply by observing changes in cell morphology (5). Alternatively, the activity of apoptosisassociated enzymes such as caspases can be determined. We describe several of these different assays and outline their relative strengths and weaknesses. 2. Materials 1. Green fluorescent protein (GFP) and red fluorescent protein (RFP) expression plasmids (e.g., pEGFP-C1 and pHcRED-C1, Clontech). 2. 6-Well plates. 3. 100-mm-Diameter tissue-culture dishes. 4. Sterile 75-cm2 tissue-culture flasks. 5. 22 × 22 mm Glass cover slips. 6. Mowiol adhesive: 2.4 g Mowiol (Calbiochem), 6 g glycerol, 6 mL H2O, 12 mL 0.2 M Tris-HCl (pH 8.5). 7. 1-mm-Thick glass microscope slides. 8. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 (pH 7.4). 9. 4% w/v paraformaldehyde in PBS. 10. Bisbenzimide (Hoechst 33258) (Sigma) (keep in darkness). 11. Dead End™ Fluorometric terminal uridyl-nucleotide end labeling (TUNEL) System: (9.6 mL equilibration buffer, 300 µL nucleotide mix (6 × 50 µL), 1500 U terminal deoxynucleotidyl transferase (TdT) enzyme (3 × 500 U), 70 mL 20X SSC, 10 mg proteinase K, plastic cover slips) (Promega). 12. 4% Methanol-free formaldehyde solution in PBS (pH 7.4). 13. 0.2% Triton® X-100 solution in PBS. 14. 0.1% Sodium borohydride in PBS. 15. 2X SSC: 0.33M NaCl, 0.03 M tri-sodium citrate. 16. 0.1% Triton® X-100, 5 mg/mL bovine serum albumin (BSA) in PBS. 17. Propidium iodide (Sigma) (50 µg/mL in PBS). 18. H2B-GFP HeLa cells (8). 19. Glass-bottom dishes (MatTek). 20. Borosilicate glass capillaries or Femtotips (Eppendorf). 21. Capillary puller (optimally, a programmable horizontal Flaming-Brown type such as Sutter P-97).

Induction or Inhibition of Apoptosis by HPV Proteins

421

22. High-vacuum silicone grease. 23. Pure plasmid DNA (Qiagen midi/maxi kit or cesium chloride preparation). 24. Microinjection and micromanipulation devices: Eppendorf Femtojet, Eppendorf micromanipulator 5171 and controller, Eppendorf Injectman. 25. Phase-contrast microscope for microinjection and fluorescence microscope for live-cell imaging, equipped with fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), and Cy3 filter sets. 26. Microinjection and imaging medium: phenol red-free MEM (Sigma), 30 mM HEPES (pH 7.4), 0.5 g/L sodium bicarbonate. For longer term imaging, this is supplemented with fetal calf serum (10%). 27. Microloader tips (Eppendorf). 28. Diamond-tipped pen (Fischer). 29. Trypsin/ethylenediamine tetraacetic acid (EDTA) (1%). 30. BD ApoAlert™ Caspase Colorimetric Assay Kit (100 mL cell lysis buffer, 16 mL 2X reaction buffer, 800 µL DTT (1 M), 2 × 100 mL dilution buffer, 1 mL caspase8 substrate, IETD-pNA) (BD Biosciences). 31. Cell scrapers. 32. 100-µL Quartz cuvet. 33. Spectrophotometer. 34. FACScalibur (Becton Dickinson). 35. Fluorescence activated cell sorter (FACS) tubes (Falcon). 36. Leica Q550 fluorescent microscope with a Leica DC500 camera. 37. Ethanol (70%). 38. Methanol.

3. Methods 3.1. Cell Morphology Apoptosis is characterized by a number of morphological events, including chromosomal DNA condensation, DNA fragmentation, cell membrane blebbing, cell shrinkage, and the formation of small apoptotic bodies (3). Examining cell morphology is therefore a useful method for the identification of cells undergoing apoptosis ([5,7,9] and see Note 1).

3.1.1. Fluorescence Microscopy Fluorescence microscopy allows the identification of apoptotic cells on the basis of their morphology. In addition to any plasmids expressing HPV proteins, cells can be co-transfected with plasmids expressing green or red fluorescent protein (GFP and RFP, respectively) (see Note 2). GFP and RFP are expressed uniformly across the cell and aid observation of the cytoplasm when cells are viewed under FITC or TRITC filter sets, respectively. Cells should be fixed and stained with bisbenzimide (see Note 3). Bisbenzimide stains cell nuclei, allowing the visualization of nuclear morphology under ultraviolet (UV) illumination and hence assessment of the apoptotic status of cells (Fig. 1).

422

Kowalczyk et al.

Fig. 1. Chromatin condensation and membrane blebbing in apoptotic cells. HeLa cells were transiently co-transfected with pEGFP-C1 (Clontech) and pWEB-E2 (5) using Fugene 6. Twenty-four hours later, the cells were fixed, stained with bisbenzimide stain, and mounted on slides. Cells were visualized using a ×40 oilimmersion lens fitted to an epifluorescent confocal microscope. (A) Bright field microscopy. (B) The same field of cells visualized using a fluorescein isothiocyanate (FITC) filter set. The transfected cell expressing green fluorescent protein (GFP) is clearly visible. (C) The same field of cells stained with bisbenzimide and visualized using a 4',6-diamidino-2-phenylindole hydrochloride (DAPI) filter set. N indicates a normal nucleus. “A” indicates an apoptotic nucleus showing chromatin condensation. 1. Seed 3 × 105 cells onto 22 × 22 mm cover slips in six-well plates and incubate overnight at 37°C in 5% CO2. 2. Following the induction of protein expression (see Note 4) and an appropriate incubation period, discard the medium by inverting the plate. 3. Wash the cells twice with PBS (see Note 5). 4. Fix the cells with 1 mL 4% w/v paraformaldehyde/PBS per well (see Note 5). 5. Incubate at 22°C for 30 min. Meanwhile, defrost bisbenzimide in darkness. 6. Wash the cells twice with PBS (see Note 5). 7. To each well (pipetting onto well side) add 1 mL bisbenzimide (1 µg/mL) and incubate in darkness at 22°C for 30 min (see Note 3). 8. Wash the cells three times in PBS, but to facilitate removal of the cover slip, do not discard the third wash. 9. Using a p1000 pipet, apply a 10-mm-diameter drop of Mowiol adhesive to a glass slide (see Note 6). 10. While ensuring that the cover slip is still covered in PBS, tilt the plate slightly to one side and, using a pair of very finely tipped forceps, gently lift the edge of the cover slip. 11. Remove the cover slip from the well, blotting the edge onto a piece of tissue to remove excess moisture. Invert the cover slip and slowly lower onto Mowiol, allowing one edge to stick before using forceps to carefully lower the rest. Gently press the cover slip onto Mowiol with forceps to remove any air bubbles. 12. Leave in the dark at 22°C overnight.

Induction or Inhibition of Apoptosis by HPV Proteins

423

Fig. 2. Fluorometric terminal uridyl-nucleotide end labeling (TUNEL) assays. HeLa cells were transiently co-transfected with pHcRED C1 and pWEB-E2 (5) using Fugene 6. Eighteen hours later, the cells were fixed, labeled with fluorescein-12-dUTP, stained with bisbenzimide, and mounted on slides. Cells were visualized using a ×40 lens fitted to an epifluorescent microscope. (A) A fluorescein-12-dUTP-labeled apoptotic cell visualized using a fluorescein isothiocyanate (FITC) filter set. (B) The same field of cells stained with bisbenzimide and visualized using a 4',6-diamidino-2phenylindole hydrochloride (DAPI) filter set. (C) The same field of cells visualized using a tetramethylrhodamine isothiocyanate (TRITC) filter set. A transfected cell expressing red fluorescent protein (RFP) is clearly visible. “N” indicates a normal nucleus. “A” indicates an apoptotic/TUNEL-positive nucleus.

13. Before examining, wipe over the slide with 70% ethanol to remove any excess Mowiol. 14. Count apoptotic cells (see Note 7).

3.1.2. Fluorometric TUNEL Assays TUNEL assays use DNA fragmentation as a marker of apoptosis (Fig. 2 and see Note 8). 1. Seed 3 × 105 cells onto 22 × 22 mm glass cover slips in a six-well plate and incubate overnight at 37°C in 5% CO2. 2. Following the induction of protein expression (see Note 4) and an appropriate incubation period, discard the medium by inverting the plate. 3. Wash the cells twice with PBS (see Note 5). 4. Fix the cells by adding 1 mL 4% w/v methanol-free formaldehyde solution in PBS (pH 7.4) and incubating at 4°C for 30 min. 5. Wash twice with PBS for 5 min (see Note 5). 6. Permeabilize the cells by adding 0.2% Triton® X-100 solution in PBS and leaving on ice for 10 min. 7. Wash twice in PBS (see Note 5). 8. Block for 10 min in 0.1% sodium borohydride in PBS. 9. Wash twice in PBS (see Note 5).

424

Kowalczyk et al.

10. Pipet off excess PBS and cover the cells with 100 µL of equilibration buffer (see Note 9). 11. Incubate at 22°C for 10 min. 12. Thaw the nucleotide mix and prepare sufficient TdT incubation buffer (see Note 9). 13. After 10 min, remove the equilibration buffer (see Note 10) and add 50 µL of TdT incubation buffer (see Note 9). 14. Wrap the plate in foil to protect the cells from light, and incubate at 37°C for 60 min to allow the tailing reaction to occur. 15. Add 2 mL 2X SSC to each well. 16. Wash the cells three times in 0.1% Triton® X-100, 5 mg/mL BSA in PBS. 17. Wash the cells twice in PBS (see Note 5). 18. Process the cover slips as described in steps 9–14 in the previous method.

3.1.3. Microinjection of Single Cells for Live-Cell Imaging Capillary microinjection of single living cells is a technique in which DNA or proteins are injected using glass capillaries with very fine tip diameters ([10,11] and see Note 11). We use the example here of imaging changes in cell shape and chromatin structure following microinjection of the HPV-16 E2 protein (Fig. 3). 1. Equilibrate the microscope to 37°C. 2. Grow H2B-GFP HeLa cells (see Note 12) on glass-bottom dishes at 37°C in 5% CO2 to approx 70% confluence (see Note 13). 3. Pull capillaries to the appropriate size. For the Sutter P-97, use a heat setting 5°C above the ramp temperature for the filament. Alternatively, use Eppendorf Femtotips (see Note 11). 4. Dilute plasmid DNA (encoding E2 and HcRed) (see Note 14) to 50 µg/mL each in ddH2O and centrifuge at 25,000g for 30 min; transfer the supernatant to a fresh tube. 5. Load a capillary with 2 µL of diluted plasmid DNA using a microloader pipet tip (see Notes 15–17). 6. Fix the capillary to the micromanipulator (see Note 18). 7. Transfer cells to imaging medium (about 4 mL in a dish is needed) and mark a cross on the base of the dish using a diamond-tipped pen for location of injected cells. 8. Using a ×10 phase-contrast objective, locate the capillary above the cells (see Note 19) and inject cells directly into the nucleus. 50–100 cells should be sufficient per dish. 9. Return cells to growth medium and incubate at 37°C and 5% CO2 for 2 h. Further dishes of cells can now be used. 10. Transfer the cells to pre-warmed imaging medium. Completely fill the dish and seal the lid back on, using high-vacuum silicone grease (see Note 20). 11. Using a ×100 1.4 N.A. oil-immersion lens, locate injected cells by focusing initially with phase contrast to locate the cross on the cover slip, followed by HcRed fluorescence to identify injected cells.

Induction or Inhibition of Apoptosis by HPV Proteins

425

Fig. 3. Time-lapse video microscopy of apoptosis in microinjected cells. Still pictures taken every 10 min were extracted from a larger data set of pictures taken every 30 s. Two HeLa cell nuclei are present in each frame. The lower of the two nuclei was microinjected with a plasmid expressing the human papillomavirus (HPV)-16 E2 protein (pWEB-E2). (A) H2B-green fluorescent protein (GFP) visualized using a fluorescein isothiocyanate (FITC) filter set. Chromatin condensation is clearly visible at 12 h 40 min and increases with time. (B) Ds-Red visualized using a tetramethylrhodamine isothiocyanate (TRITC) filter set. Blebbing of the plasma membrane is first apparent at 13 h 30 min and is clearly visible at later time points. 12. Once suitable cells have been found, start time-lapse imaging of both GFP and HcRed fluorescence (see Note 21). Images should be acquired with very short exposure times (e.g., 50 ms) with a delay between frames of 30 s (120 frames/h). Continue imaging through apoptosis. This may take up to 5 h (600 frames) (see Notes 22 and 23). 13. Individual time-lapse sequences of each channel can then be merged to an RGB image and played back (Fig. 3).

3.2. Flow Cytometry Flow cytometry is a technique in which individual cells in a suspension can be analyzed (7). To measure apoptosis within a population of cells, propidium iodide is used to stain the DNA (Fig. 4) (see Note 24). 1. Grow 3 × 106 cells in a 75-cm2 flask at 37°C and 5% CO2 until 70% confluent. 2. Following the induction of protein expression (see Note 4) and an appropriate incubation period, remove and keep the medium (see Note 25). 3. Wash the cells twice with 1X PBS (see Note 5). 4. Trypsinize the cells and add to the medium collected in step 2.

426

Kowalczyk et al.

Fig. 4. Flow cytometry. 2.3 × 106 HeLa cells were transiently transfected with (A) 7.5 µg of pWEB or (B) 7.5 µg of pWEB-E2 using Fugene 6. Twenty-four hours posttransfection, the cells were trypsinized and harvested from the medium, then fixed and stained with propidium iodide before analysis by flow cytometry. 5. Pellet the cells by centrifugation at 1500g for 5 min at 20°C. 6. Discard the supernatant and wash the pellet in PBS, then repeat step 5. 7. Fix cells by resuspending in 1 mL ice-cold methanol and incubating at –20°C for 5 min. 8. Pellet the cells by centrifuging at 3000g for 10 min at 4°C. 9. Resuspend the cell pellet in 3 mL propidium iodide (50 µg/mL in PBS) and leave at 4°C for 30 min. 10. Harvest the cells by centrifuging at 3000g for 10 min at 4°C. 11. Discard the supernatant and resuspend the cell pellet in 300 µL PBS. 12. Transfer to a fluorescence activated cell sorter (FACS) tube. 13. Keep in the dark until analysis by flow cytometry.

3.3. Caspase Assays Caspases are a family of cysteine proteases that, upon activation, cleave cellular substrates after an aspartic acid residue (12). Caspases are synthesised as inactive zymogens and are activated in a number of apoptotic pathways. Caspase activity is relatively easy to assay and is therefore a useful indicator of apoptosis (Fig. 5) (see Note 26). 1. Seed 2 × 106 cells in a 100-mm-diameter dish and incubated overnight at 37°C in 5% CO2. 2. Following the induction of protein expression (see Note 4) and an appropriate incubation period, discard the medium and wash the cells twice in PBS (see Note 5). Following washing, leave the dishes upside down on a piece of absorbent paper to remove any remaining PBS. 3. To each dish add 50 µL of ice-cold lysis buffer (see Note 27).

Induction or Inhibition of Apoptosis by HPV Proteins

427

Fig. 5 Caspase assays HeLa cells were treated with the concentrations of staurosporine (a compound known to induce apoptosis) shown for 4 h and then assayed for caspase-8 activity as described in the text. 4. 5. 6. 7. 8.

Scrape off the cells using cell scraper and collect the lysate in a 1.5-mL tube. Incubate on ice for 10 min (see Note 28). Centrifuge the lysate at 13,000g for 10 min at 4°C. Transfer the supernatant to a fresh tube and place on ice. To each supernatant add 50 µL dithiothreitol (DTT)/reaction buffer mix (see Note 27). 9. Add 5 µL 4 mM caspase substrate (see Note 27). 10. Incubate at 37°C for 1.5 h. 11. Read samples at 405 nm in a 100-µL quartz cuvet using a spectrophotometer.

4. Notes 1. Cells should be seeded on glass cover slips before the introduction of HPV proteins by transient transfection, viral transformation, microinjection, or other protein/DNA delivery method. Our research typically uses plasmids to express HPV proteins. However, we have also used adenoviral vectors and the direct delivery of purified proteins. Apoptosis is typically evident 8–12 h after protein expression, and typically reaches a maximum after 12–48 h. 2. pEGFP-C1 (Clontech) and pHcRED-C1 (Clontech) are suitable GFP and RFP expression plasmids, respectively. Care should be taken not to express excessive amounts of GFP or RFP, since this can induce apoptosis in some cell types. We typically transfect cells with 300 ng of plasmid DNA. GFP/RFP expression is also indicative of successful transfection. 3. Alternatively, 4',6-diamidino-2-phenylindole hydrochloride (DAPI) can be used. 4. HPV protein expression can be achieved by several means, including transient or stable transfection, microinjection of plasmid DNA, viral infection, or the direct

428

5. 6. 7.

8.

9. 10. 11.

Kowalczyk et al. delivery of proteins using microinjection or commercially available carriers such as BioPORTER® Protein Delivery Reagent (Gene Therapy Systems, Inc.). Typically, transient transfection can be achieved using reagents such as Fugene (Roche), Tfx (Promega), Transfast (Promega), Metafectene (Biontex), Geneporter (Gene Therapy Systems, Inc), or Lipofectin (Invitrogen). To avoid dislodging the cells, wash the cover slips by tilting the plate and gently applying solutions to the side of the well. Alternatively, Vector Shield can be used and cover slip edges sealed with nail varnish to prevent movement of cover slip. To quantify apoptosis induced or inhibited by HPV proteins, at least 100 transfected cells (those expressing GFP/RFP) should be counted and their cytoplasmic and nuclear morphology assessed for apoptotic characteristics (Fig. 1). A percentage value can then be obtained for the number of transfected cells that are apoptotic. This should be repeated at least twice per slide and on at least two independent slides. Untransfected cells and cells transfected with empty vectors (or infected with control viruses) should be counted to determine the background level of apoptosis in any particular cell line. In the Dead End Fluorometric TUNEL System (Promega), the enzyme terminal deoxynucleotidyl transferase (TdT) catalytically attaches fluorescein-12-dUTP to the 3' OH group of DNA fragments. Fluorescein-12-dUTP-labeled DNA can then be visualized by fluorescence microscopy, using a FITC filter set (Fig. 2A). As a comparison, propidium iodide or bisbenzimide can be used to stain all cells, which can then be visualized by fluorescence microscopy, using TRITC or DAPI filter sets (Fig. 2B). When looking at HPV protein–induced apoptosis, cells can be co-transfected with a plasmid expressing RFP to allow identification of the transfected cells by fluorescence microscopy, using a TRITC filter set (Fig. 2C). These reagents are supplied in the Dead End™ Fluorometric TUNEL System (Promega). Tilt the plate and remove the buffer using a tissue. Do not allow cells to dry out. Microinjection is now a widely available technique, with many suppliers providing solutions for microinjection and micromanipulation. We use a system from Eppendorf (Hamburg, Germany), but others are available from suppliers such as BioRad or Narishige. Prepulled capillaries are available from suppliers (e.g., Femtotip from Eppendorf) or can be pulled from borosilicate glass capillaries (internal diameter 0.94 mm) using a capillary puller, such as the Sutter Instruments P-97 or Narishige PN-30. Best results are obtained with programmable horizontal pullers, but vertical and manual options are available. We use capillaries that contain a central filament, which facilitates backfilling of the sample. Pre-pulled capillaries offer excellent reproducibility but are expensive. The benefit of pulling one’s own capillaries is the ability to modify the tip size and shape by adjusting the settings used for pulling. Settings on Flaming-Browntype pullers (such as the Sutter) can be changed to produce capillaries of the desired form. We commonly find that a single setting will produce capillaries for microinjection of both DNA and protein into cultured mammalian cells.

Induction or Inhibition of Apoptosis by HPV Proteins

429

12. For the identification of chromatin structure, we have used a stable HeLa cell line expressing a histone H2B-GFP fusion protein (H2B-GFP) (8). In order to view the overall shape of the cells, we co-express HcRed (Clontech, Palo Alto, CA), which fills the cytoplasm. This also facilitates the identification of injected cells. 13. A key consideration when performing microinjection experiments is the nature of the substrate for cell growth. Microinjection of suspension cultures is possible but obviously more difficult than using adherent cells. Adherent cells can be grown on glass cover slips before microinjection. In order to image through a plastic dish and glass cover slip, one must use a long-working-distance objective. This is usually not a problem, since low power (×10) phase-contrast objectives allow the user to inject many cells without needing to change the position of the microscope stage. However, an alternative is to use specially designed dishes that have a glass cover slip instead of a plastic base, allowing use with highnumerical-aperture (N.A.) oil- or water-immersion lenses. We routinely grow cells on glass-bottom dishes (MatTek) rather than cover slips, and we have developed protocols for long-term imaging of these cells. These dishes are available from a number of suppliers, including MatTek (Ashland, MA) and World Precision Instruments (Sarasota, FL), and can be coated with collagen or polylysine if required. 14. An alternative to the use of genetically encoded reporters is to use a non-toxic reporter of injection, such as fluorescently labeled dextran or serum albumin. 15. We routinely load 2 µL into a capillary using a gel loader tip and inject plasmid DNA at capillary concentrations of 20–50 µg/mL and protein solutions at 1 mg/mL. Prior to microinjection, cells are transferred to buffered medium, pre-equilibrated to the temperature to be used for injection. Optimally, cells should be removed from the incubator for only 10–15 min for injection, during which time sufficient cells can be injected for most experiments. There is a trade-off here between the number of cells that can be injected and the time that cells are left in microinjection medium. 16. Injection of plasmid DNA requires a lag time for expression of E2. Expression from microinjection tends to occur relatively quickly; GFP fluorescence can be detected approx 30 min after injection of plasmid DNA. The major caveat is that, unless inhibitors of protein synthesis are added, expression levels continue to rise as the experiment progresses. This then does not provide an accurate measure of whether a critical concentration of E2 is needed for the induction of apoptosis or whether it is solely a time-dependent effect. The advantage of DNA injection over protein injection is that it is simpler in terms of both sample preparation and also injection itself (protein solutions tend to be more viscous). 17. Plasmids should be of high purity for microinjection. Cesium-chloride-purified plasmid DNA works well, as do plasmids purified using kits such as Qiagen Maxi and Midi kits, as well as those from other suppliers. Plasmids purified with these kits should be centrifuged at 20,000g after resuspension to remove any impurities that pass through the columns during use. 18. The manipulators are mounted (either left- or right-handed, according to user preference and microscope configuration) on a suitable microscope frame. Most

430

19.

20.

21.

22.

23.

Kowalczyk et al. micromanipulators are adaptable to a range of microscope frames. The technique of microinjection relies heavily on hands-on instruction and practice. Many of the specific details of methods need to be determined empirically. Location of the capillary once mounted on the system is often difficult. Position the capillary above the lens aperture and lower to a point above the cells. Move the capillary in large sweeps across the field of view; a shadow of the out-offocus needle will be visible. Center this shadow and slowly lower the capillary until nearly in focus. The z level for the capillary can be set by gently lowering onto a cell adjacent to the nucleus; a bright spot should be visible before the cell is punctured. Set this as your z-limit. Move the capillary away and try to inject a nearby cell. Pressure settings and minor adjustments of the z-limit may be needed to achieve optimal injection. Good injection will cause a visible but not too dramatic swelling of cells. Use the following Injectman settings: compensation pressure, 50 hPa; injection pressure, 100–200 hPa; injection time, 0.1–0.4 s. It is imperative to have controlled environmental conditions for live cell imaging. Our microscope is housed in a heated Perspex box (Solent Scientific, Portsmouth, UK). Dishes are filled completely with imaging medium (supplemented with fetal calf serum) and sealed. This prevents gas exchange, eliminating the need for control of CO2 concentration, and maintains HeLa cells in a continually dividing state for periods of >48 h. The key problem in these experiments is focal stability. Long-term imaging requires stable focus, and continual switching on and off of temperature and CO2 regulators can cause significant focal drift. Imaging systems should be switched on several hours before imaging commences to ensure thorough equilibration of temperature. The use of spectrally distinct fluorophores (GFP and HcRed) and sequential acquisition enables specific analysis of each in isolation. Combination of these images into an RGB image facilitates accurate identification of the temporal sequence of events. For live cell imaging we use a TILL Photonics (Gräfelfing, Germany) imaging system based on an Olympus IX-70 frame with monochromatic illumination (eliminating the need for excitation filters) and a double dichroic emission filter tailored for FITC and Cy3 (Chroma 5100; Chroma, Rockingham, VT). However, the specific experiment and availability of equipment will largely determine which imaging system is used. In this example, we employ a wide-field microscope, but scanning or spinning-disk confocal microscopes could also be used. Our system provides relatively low levels of excitation light through a fiber-optic coupling from the monochromator. This facilitates long-term imaging by reducing photodamage. Alternatives are to use appropriate neutral-density filters in the illumination path or greatly reduce exposure times. When imaging, alternative lenses are suitable but a ×60 or ×100 high-N.A. lens will provide suitable resolution and light throughput. Exposure times of 50 ms, combined with appropriate grayscaling of images for presentation gives good images while minimizing light exposure. Individual settings should be determined for each experiment. Delays in the time-lapse sequence will need to be included to accommodate the timeframe of imaging.

Induction or Inhibition of Apoptosis by HPV Proteins

24.

25. 26.

27. 28.

431

Thirty-second or 1-min delays between acquisitions will reduce the amount of data acquired. One must ensure that the time delay is big enough to limit the data but acquisition is rapid enough to ensure that one has adequate time resolution. Propidium iodide binds stoichiometrically to DNA, providing a quantitative measurement of the DNA content within a cell, a key indicator of cell-cycle progression and of apoptosis. Cells that are not progressing through the cell cycle are said to be in G0. When cell division is triggered, the cell enters the G1 phase of the cell cycle and prepares for DNA replication. Upon completion of G1, the cell enters S phase, where the DNA content of the cell is doubled before the cell enters G2. Finally, the cell enters mitosis (or M) and divides. Cells undergoing apoptosis have a DNA content less than that seen in G0/G1 cells and are therefore referred to as the sub-G0 population (see Fig. 4). Late-stage apoptotic cells detach from the plastic and float in the growth medium. We use the BD ApoAlert Caspase Colorimetric Assay (BD Biosciences), in which spectrophotometric detection of the chromophore p-nitroaniline (pNA), produced after the cleavage of a specific substrate, is used to quantify caspase activity (Fig. 5). However, several similar assays are commercially available. These reagents are supplied with the BD ApoAlert™ Caspase Colorimetric Assay Kit (BD Biosciences). Meanwhile, defrost the substrate and make your 1:100 dilution of the DTT/reaction buffer mix.

References 1. Roulston, A., Marcellus, R. C., and Branton, P. E. (1999) Viruses and apoptosis. Annu. Rev. Microbiol. 53, 577–628. 2. Searle, J., Kerr, J. F. R., and Bishop, C. J. (1982) Necrosis and apoptosis—distinct modes of cell-death with fundamentally different significance. Pathol. Annu. 17, 229–259. 3. Earnshaw, W.C. (1995) Nuclear changes in apoptosis. Curr. Opin. Cell Biol. 7, 337 43. 4. Dell, G. and Gaston, K. (2001) Human papillomaviruses and their role in cervical cancer. Cell. Mol. Life Sci. 58, 1923–1942. 5. Webster, K. J., Parish, J., Pandya, M., Stern, P. L., Clarke, A. R., and Gaston, K. (2000) The human papillomavirus (HPV) 16 E2 protein induces apoptosis in the absence of other HPV proteins and via a p53-dependent pathway. J. Biol. Chem. 275, 87–94. 6. Desaintes, C., Demeret, C., Goyat, S., Yaniv, M., and Thierry, F. (1997) Expression of the papillomavirus E2 protein in HeLa cells leads to apoptosis. EMBO J. 16, 504–514. 7. Sanchez-Perez, A. M., Soriano, S., Clarke A. R., and Gaston, K. (1997) Disruption of the human papillomavirus type 16 E2 gene protects cervical carcinoma cells from E2F-induced apoptosis. J. Gen. Virol. 78, 3009–3018. 8. Kanda, T., Sullivan, K. F., and Wahl, G. M. (1998) Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Curr. Biol. 8, 377–385.

432

Kowalczyk et al.

9. Webster, K., Taylor, A., and Gaston, K. (2001) Oestrogen and progesterone increase the levels of apoptosis induced by the human papillomavirus type 16 E2 and E7 proteins. J. Gen. Virol. 82, 201–213. 10. Graessmann, M. and Graessmann, A. (1983) Microinjection of tissue culture cells. Methods Enzymol. 101, 482–492. 11. Stephens, D. J. and Allan, V. J. (2003) Light microscopy techniques for live cell imaging. Science 300, 82–86. 12. Nuñez, G., Benedict, M. A., Hu, Y., and Inohara, N. (1998) Caspases: the proteases of the apoptotic pathway. Oncogene 17, 3237–3245.

Codon Optimization of Papillomavirus Genes

433

31 Codon Optimization of Papillomavirus Genes Martin Müller Summary Early and late genes of human and animal papillomaviruses show a codon composition seemingly unfavorable for expression in mammalian cells. It remains unclear how the viruses manage to achieve high levels of late gene expression during the viral life cycle. One possible solution could be that the availability of certain t-RNAs changes with progressing stages of cellular differentiation. Previous studies have demonstrated that modification of codon usage of papillomavirus late (L1 and L2) and early genes (E7) can overcome poor expression of these proteins both in transient and in stable expression systems. This was shown not only for human but also for plant cells. Two strategies can be employed to alter codon usage: elimination of only those codons that are rarely used in a particular expression system, or exchange of all possible codons by the ones most frequently used. Currently, there are two protocols for codon modification—a template-less polymerase chain reaction (PCR)-based protocol, in which very long overlapping oligodeoxynucleotides are used in an overlap-extension reaction, or a ligase chain reaction, in which shorter oligodeoxynucleotides are fused together after an annealing procedure. Both methods are presented and discussed.

1. Introduction Earlier attempts to express various papillomavirus proteins in mammalian cells, but also in vivo, using transient and stable transfection methods, were met with only limited success. This became particularly obvious when studying the functions of the papillomavirus structural genes L1 and L2, for which, in contrast to the nonstructural papillomavirus genes, high protein yield had been expected during the viral life cycle when virions are assembled. However, it seems that the papillomaviruses are able to keep expression of the structural genes under very tight control by mechanisms involving not only transcription but also translational regulation. In order to produce and study the viral capsids, two different strategies have been followed to increase the amount of the L1 and L2 protein in mammalian cells. First, negative regulatory From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

433

434

Müller

elements present on the L1 and L2 mRNA have been identified and subsequently eliminated (1–7). These elements control posttranscriptional events such as mRNA stability and nuclear export of the late messages. However, although inactivation of these elements led to a somewhat increased accumulation of the L1 and L2 proteins, the overall protein yield had still not been satisfactory. The second strategy was the use of heterologous viral expression systems—in particular, the use of recombinant vaccinia viruses (VV) (see Chapter 33) and recombinant semliki forest viruses (SFV) (8,9). These expression systems allow high-yield production of L1 assembled into virus-like particles and the investigation of intracellular functions of the L1 and L2 gene. It is not fully understood why L1 and L2 can be expressed by VV or SFV. A possible explanation is that in both systems, the genes are transcribed in the cytoplasm, circumventing nuclear events such as regulators of nuclear export. The major limitation for the use of these expression systems is the cytopathic effect of the recombinant VV and SFV preventing expression over longer periods of time. In addition, there is indeed evidence that heterologous viral proteins interfere with the analysis of L1 and L2 functions. In the past, modification of the codon usage of several genes has been very successful to increase protein yield in a number of expression systems, including mammalian cells (10–13). Probably the most acknowledged example is the optimization of the green fluorescent protein (GFP) expression, without which the widespread use of GFP as a reporter gene in mammalian cells would not have been possible (12,13). What is codon optimization, or better, codon improvement (it is difficult to define an “optimal” codon composition)? Two strategies have been used: (1) replacement of extremely rare codons from the mRNA by codons frequently used in the respective expression host, or (2) replacement of all possible codons by codons most frequently used in the chosen cell system. Codons occurring at high frequencies can be identified for many different organisms by the use of various databases (14). Preferably, one would opt for codons frequently found in proteins expressed at high levels, but such information is as yet available for yeast cells only. The rationale in codon optimization is that low concentrations of certain t-RNAs are a limiting factor for protein translation (15,16). Eliminating only the rarest codons of a given gene can be achieved by standard mutagenesis techniques. For example, by this strategy about one-fifth of the codons of the GFP gene have been optimized for successful expression in mammalian cells. The more radical procedure of optimizing all possible codons (usually up to two-thirds of all codons) requires de novo synthesis of the complete coding sequence, but the results obtained by this method seem to be generally more promising. Both methods have been used to improve expression of early and late papillomavirus genes (17–22) (see Chapter 32). The results in particular have been very convincing

Codon Optimization of Papillomavirus Genes

435

Fig. 1. Expression of codon-optimized L1 genes in human cells. Different mammalian expression constructs encoding codon-optimized human papillomavirus (HPV)16 L1 (L1h) or a C-terminally truncated L1h fused to unmodified HPV-16 E7 were introduced into the human cell line 911 by transient transfection (calcium-phosphate precipitation). Expression of the L1 protein was analyzed by Western blotting and indirect immunofluorescence using an L1-specific monoclonal antibody (Camvir-I). Interestingly, the expression of the L1/E7 fusion constructs is comparable to the L1h construct, although the E7 portion shows a codon usage which is not favorable for human cells. Note that the L1hE7 protein lacks a nuclear localization signal due to the truncation of L1. In two constructs, a SV40 NLS was inserted between L1h and E7.

in the case of the structural genes (see Fig. 1) but also of the early protein E7. The use of optimized genes allowed the development of nucleic acid-based vaccines, the production of infectious papillomavirus pseudovirions and the analysis of intracellular functions of the viral proteins (20,23). Despite the success of the newly generated papillomavirus genes, the mechanism(s) by which codon optimization leads to increased protein accumulation remains elusive. The radical optimization of the coding sequence not only alters the codon usage but very likely wipes out all or most of the regulatory elements present on the mRNA. Additionally, altering the mRNA sequence can have a strong impact on the mRNA stability (17). For some of the L1 genes, it was demonstrated, however, that codon optimization improved protein expression mainly by enhancing translational efficiency, as it would be expected (15,16,20). Nevertheless, some observations also clearly indicate that the results from optimization may be difficult to predict and that the reason for improved expression

436

Müller

might not be as simple to explain. For example, when testing L1 optimized for expression in human (L1h) or plant (L1p) cells with the original L1 gene (L1ori), we found that both modified genes show a strongly improved protein yield in mammalian cells compared to L1ori. However, surprisingly, only the L1h gene was expressed successfully in plant cells (17). In addition, L1ori and L1h can both be expressed in insect cells using recombinant baculoviruses, despite their contrasting codon composition. Nevertheless, it is also clear that in most instances expression of the optimized papillomavirus genes proved to be clearly superior compared to the unmodified genes, and many published and on-going studies have only been possible using expression-optimized genes. 2. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

PWO polymerase and buffer (Roche). Oligodesoxynucleotides. dNTPs. T4-DNA ligase and buffer. Restriction enzymes. Electrocompetent Escherichia coli DH5α and E. coli SURE bacteria. Agarose gel electrophoresis equipment. Themocycler. DNA-sequencing equipment. Pfu ligase and buffer. Oligo-desoxynucleotide (sets). T4 polynucleotide kinase and buffer (NEB). ATP. Cloning vector (such as pUC or pBluescript). Isopropyl-β-D-thiogalactopyranoside (IPTG), X-Gal. Expression vector. Transfection reagent, mammalian cells. Glass wool or QIAquick Gel extraction kit. Site-directed mutagenesis kit (e.g., Quickchange Stratagene).

3. Methods 3.1. Design of the Synthetic Gene

3.1.1. Codon Optimization It is recommended to replace as many codons in the gene as possible with codons most frequently used in the species for which expression is to be optimized (see Note 1). The most frequently used codons for humans are shown in Table 1. For other species, the reader should refer to the Kazusa codon-usage database (http://www.kazusa.or.jp/codon). Generation and editing of a codon-

Codon Optimization of Papillomavirus Genes

437

Table 1 Codons Frequently Used in Human Genes Ala: GCC, GCU Arg: AGG, CGC, CGG Asn: AAC Asp: AAC Cys: UGC Gln: CAG Glu GAG Gly: GGC, GGG His: CAC Ile: AUC

Leu: CUG Lys: AAG Met: AUG Phe: UUC Pro: CCC Ser: AGC, UCC Thr: ACC Trp: UGG Tyr: UAC Val: GUG, GUC

The most frequently found codons of human genes are shown. For five of the amino acids, more than one codon can be used in codon optimization, because these codons are found at comparable frequencies.

optimized sequence can be achieved by the use of a word processor. The protein sequence (in the three-letter format) is converted to a DNA sequence by replacing the amino acids with their respective codon(s). Alternatively, Web tools are available that aid in the generation of synthetic genes (http:// genome.nci.nih.gov/publications/papilloma_ADAP.html). Because there are multiple possible codons for most of the amino acids (e.g., the three codons: AGG, CGC, CGG for arginine are found with similar frequencies in human genes), it is recommended to alternate codons whenever possible (see Note 1). This will result in a less monotonous sequence of the resulting gene and thereby avoid artifacts by false priming during the polymerase chain reaction (PCR) reactions.

3.1.2. Kozak Sequence In addition to the alteration of the codon sequences, it is recommended to insert a Kozak consensus sequence, (GCC)GCCA/GCCAUGG flanking the AUG initiation codon, as this has been shown to improve the efficiency of translation initiation (24).

3.1.3. Introduction of Unique Restriction Endonuclease Sites For cloning purposes, the synthetic genes are usually flanked by unique sites for restriction endonucleases. Current methods of gene synthesis are prone to high rates of error, resulting in point mutations and deletions. To aid removal

438

Müller

Fig. 2. Polymerase chain reaction (PCR)-based gene synthesis. Synthetic genes are designed with altered codon usage and contain additional unique recognition sites for restriction endonucleases (A, Re). Long oligodeoxynucleotides (ODN, 80–90mers) are synthesized, covering both sense and anti-sense strands (B). The ODNs on each strand are spaced by about 60 nt; ODNs of sense and anti-sense strand have an overlap of approx 20–22 nt. ODNs are annealed and the gaps are filled in a PCR. Using this, two or more fragments of the synthetic gene are produced (C). These fragments overlap each other and can be used as template in a combined primer-extension/PCR (overlap extension method; C–E).

of possible mutations, it is recommended to introduce additional unique recognition sites for restriction endonucleases every 200–300 basepairs (bp). This can be mostly achieved by altering single nucleotide positions, leaving the overall codon preference unaltered. It is further advisable to synthesize longer genes in fragments of 400–500 bp, which can be later assembled into a fulllength gene.

3.2. PCR-Based Method for Gene Synthesis 3.2.1. Oligodeoxynucleotides A set of overlapping oligodesoxynucleotides (ODN) spanning the complete synthetic gene needs to be synthesized (25). The ODNs are typically 80 (up to 100) nucleotides (nt) in length (see Note 2). The ODNs on each strand are spaced at approx 60 nt; ODNs of sense and antisense strands have an overlap of approx 20–22 nt, as shown in Fig. 2. Purity and quality of the ODNs are crucial for avoiding artifacts during the gene synthesis.

Codon Optimization of Papillomavirus Genes

439

3.2.2. Gene Assembly by PCR 1. Four to eight ODNs can be used simultaneously in a single PCR as follows: 1 mM dNTP mix, 1X reaction buffer, 50 pmol of each ODN, and 2 U PWO polymerase, in a total volume of 50 µL. 2. The reaction is carried out in a thermocycler using the following settings: 96°C for 5 min, followed by 30 cycles of 1 min at 96°C, 1 min at 52°C, 1 min at 72°C, then a final step of 72°C for 10 min.

3.3. Alternative Method for Gene Synthesis: Ligase Chain Reaction-Based Method The PCR-based procedure for de novo gene synthesis involves the use of very long oligodeoxynucleotides in combination with one or more rounds of PCR amplification, eventually leading to the accumulation of point mutations and small deletions as a result of false priming events. Especially for humanized genes, which typically possess a very high GC content (up to 80%), this can be a considerable problem. The quality of the product very much depends on the integrity and quality of the long ODNs. The ligase chain reaction (LCR) based method allows gene synthesis with high accuracy, using much shorter ODNs that are easier to produce (26,27). In this strategy, both strands of the gene are completely synthesized in the form of ODNs (usually 40-mers). Again, ODNs derived from sense and antisense strands are staggered to allow complete annealing of the strands (see Fig. 3). Nicks between the annealed ODNs are sealed by the a thermostable DNA ligase, allowing the annealing process to be carried out at high temperatures, which minimizes the risk of artifacts due to secondary structures present in the ODNs.

3.3.1. Oligodeoxynucleotides A set of ODNs completely covering both sense and antisense strands is synthesized (see Note 2). ODNs from the sense strand overlap those of the antisense strand by 20 nt, as shown in Fig 3.

3.3.2. Phosphorylation of Oligodeoxynucleotides 1. To allow ligation of the annealed ODNs, all but the two 5' outermost ODNs of both strands need to be phosphorylated. For this, a mixture containing equal amounts of the ODNs is treated with ATP and T4 polynucleotide kinase in the following reaction: 1X polynucleotide kinase reaction buffer, 100 U T4 polynucleotide kinase, 2 µM each ODN, 1 mM ATP, in a total volume of 100 µL. 2. The reaction is carried out for 2 h at 37°C. 3. The kinase is then inactivated for 20 min at 65°C. 4. The phosphorylated ODNs are precipitated with ethanol and finally dissolved together with the two unphosphorylated ODNs in 50 µL H2O (4 µM each ODN).

440

Müller

Fig. 3. Long chain reaction (LCR)-based gene synthesis. In contrast with the polymerase chain reaction (PCR)-based method, shorter synthetic oligodesoxynucleotides (ODNs) (35–45 mers) are completely covering the sense and anti-sense strands (A). ODNs from the sense strand overlap with those of the anti-sense strand, allowing the annealing of the ODNs to the synthetic gene fragment. Nicks between the annealed ODNs are sealed by a heat-stable DNA ligase (B). Using this, two or more fragments of the synthetic gene are produced (C). These fragments overlap each other and can be used as template in a combined primer-extension/PCR (overlap extension method; C–E).

3.3.3. Ligase Chain Reaction 1. The phosphorylated ODNs are annealed and ligated in the following reaction: 2 µM of each of the phosphorylated and the two unphosphorylated ODNs), 1X Pfu DNA ligase reaction buffer, 10 U Pfu DNA ligase, in a total volume of 100 µL. 2. The LCR is carried out in a thermocycler using the following settings: 96°C for 5 min, followed by 15 cycles of 30 s at 96°C, 1.5 min at 55°C, 90 s at 70°C, and a final cycle of 30 s at 96°C, 2 min at 55°C, and 10 min at 70°C.

Codon Optimization of Papillomavirus Genes

441

3.4. Isolation of Assembled DNA Fragments Assembled gene fragments (from PCR- and LCR-based gene synthesis) are analyzed by agarose gel electrophoresis. Fragments are isolated from the gels and purified by the “freeze-squeeze” method, i.e., by freezing the gel fragment and subsequently spinning the DNA-containing solution through a glass-wool cushion. Alternatively, commercially available purification kits (e.g., QIAquick, Qiagen) can be used to recover the fragments. If the fragments cover the complete gene, restriction digests with subsequent cloning will be carried out. If the fragments cover only parts of the synthetic gene, they will be used in a combined primer extension/PCR (overlap extension method, as shown in Figs. 2 and 3C–E).

3.5. Generation of Full-Length Genes From Fragments For longer synthetic genes, both the PCR- and the LCR-based gene assembly protocol will produce overlapping gene fragments (see Fig. 3D). These fragments can be fused by cycles of denaturation, priming, and elongation (overlap extension). The resulting full-length product can be amplified by PCR. All steps are carried out in a single reaction. 1. Set up the following reaction: 0.2 mM dNTPs, 1X reaction buffer, 10–50 ng of each overlapping DNA fragment, 25 pmol of each primer, 2 U of PWO polymerase, in a total of 50 µL. 2. Carry out the reaction in a thermocycler using the following settings: 96°C for 5 min, followed by 30 cycles of 1 min at 96°C, 1 min at 55°C, and 90 s at 72°C, then a final step of 72°C for 10 min.

3.6. Cloning into Vectors Isolated, full-length fragments are digested with the appropriate restriction enzymes and inserted into a suitable cloning vector, which is then transformed into a suitable E. coli strain (see Note 3). Multiple clones of each fragment are selected and analyzed by DNA sequencing. Mutations can be eliminated by exchange of correct subfragments between different clones or by site-directed mutagenesis (see Note 4). Fully assembled genes are transferred into a suitable expression vector, and expression is analyzed by Western blotting and/or indirect immunofluorescence (see Note 5). 4. Notes 1. Gene design. Despite advances in molecular biology techniques, gene synthesis remains a laborious and also costly undertaking. It is therefore crucial to invest sufficient efforts in the design of the synthetic gene. At this early step, additional features can be easily introduced into the product at no extra costs. Later modifi-

442

2.

3.

4.

5.

Müller cations might be difficult due to the nature of some synthetic genes. In which vectors will the gene be used? Should there be the possibility of protein tagging or fusion, or the expression of protein domains in addition to the full-length protein? Is there a need for the addition of sequences 5' or 3' to the coding sequence, such as ribosome binding sites in the case of genes to be expressed in prokaryotes? Highly repetitive sequences (especially long CG stretches) should be avoided. Scan the novel gene for the presence of putative mRNA degradation signals or splice sites. Quality of ODNs. The quality of the ODNs is crucial to the procedure, especially if long ODNs (>70 nts) are used for PCR-based gene synthesis. Order highest quality ODNs, purified by high-performance liquid chromatography (HPLC). Mutations accumulating in defined positions might indicate that one or more ODNs are of bad quality. Recombination and stability. Synthetic genes typically show a rather monotonous sequence, with a number of repeats due to the strongly reduced codon usage. For cloning and propagation, it is therefore advisable to use E. coli strains devoid of recombination, such as E. coli SURE. Elimination of mutations. Most of the assembled DNA fragments will contain one or more mutations. It is advisable to sequence multiple clones of each fragment. If appropriate restriction sites are available, exchange of intact parts between the different clones can speed up elimination of mutations. There are various methods to eliminate point mutations and small deletions, including commercially available kits (e.g., Quickchange, Stratagene). Problems cloning synthetic genes. In our experience, synthetic genes are sometimes difficult to handle in downstream cloning procedures. For unknown reasons, some of the genes are rather resistant for subcloning into expression vectors. Alternative vectors or alternative cloning strategies might solve these problems.

References 1. Carlsson, A. and Schwartz, S. (2000) Inhibitory activity of the human papillomavirus type 1 AU-rich element correlates inversely with the levels of the elav-like HuR protein in the cell cytoplasm. Arch. Virol. 145, 491–503. 2. Kennedy, I. M., Haddow, J. K., and Clements, J. B. (1990) Analysis of human papillomavirus type 16 late mRNA 3‚Ä processing signals in vitro and in vivo. J. Virol. 64, 1825–1829. 3. Kennedy, I. M., Haddow, J. K., and Clements, J. B. (1991) A negative regulatory element in the human papillomavirus type 16 genome acts at the level of late mRNA stability. J. Virol. 65, 2093–2097. 4. Rollman, E., Arnheim, L., Collier, B., et al. (2004) HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses. Virology 322, 182–189. 5. Schwartz, S. (2000) Regulation of human papillomavirus late gene expression. Ups. J. Med. Sci. 105, 171–192.

Codon Optimization of Papillomavirus Genes

443

6. Sokolowski, M., Tan, W., Jellne, M., and Schwartz, S. (1998) mRNA instability elements in the human papillomavirus type 16 L2 coding region. J. Virol. 72, 1504–1515. 7. Sokolowski, M., Zhao, C., Tan, W., and Schwartz, S. (1997) AU-rich mRNA instability elements on human papillomavirus type 1 late mRNAs and c-fos mRNAs interact with the same cellular factors. Oncogene 15, 2303–2319. 8. Day, P. M., Roden, R. B., Lowy, D. R., and Schiller, J. T. (1998) The papillomavirus minor capsid protein, L2, induces localization of the major capsid protein, L1, and the viral transcription/replication protein, E2, to PML oncogenic domains. J. Virol. 72, 142–150. 9. Zhou, J., Stenzel, D. J., Sun, X. Y., and Frazer, I. H. (1993) Synthesis and assembly of infectious bovine papillomavirus particles in vitro. J. Gen. Virol. 74 (Pt 4), 763–768. 10. Andre, S., Seed, B., Eberle, J., Schraut, W., Bultmann, A., and Haas, J. (1998) Increased immune response elicited by DNA vaccination with a synthetic gp120 sequence with optimized codon usage. J. Virol. 72, 1497–1503. 11. Uchijima, M., Yoshida, A., Nagata, T., and Koide, Y. (1998) Optimization of codon usage of plasmid DNA vaccine is required for the effective MHC class Irestricted T cell responses against an intracellular bacterium. J. Immunol. 161, 5594–5599. 12. Yang, T. T., Cheng, L., and Kain, S. R. (1996) Optimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein. Nucleic Acids Res. 24, 4592–4593. 13. Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., and Muzyczka, N. (1996) A “humanized” green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J. Virol. 70, 4646–4654. 14. Nakamura, Y., Gojobori, T., and Ikemura, T. (2000) Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Res. 28, 292. 15. Gu, W., Li, M., Zhao, W. M., et al. (2004) tRNASer(CGA) differentially regulates expression of wild-type and codon-modified papillomavirus L1 genes. Nucleic Acids Res. 32, 4448–4461. 16. Zhou, J., Liu, W. J., Peng, S. W., Sun, X. Y., and Frazer, I. (1999) Papillomavirus capsid protein expression level depends on the match between codon usage and tRNA availability. J. Virol. 73, 4972–4982. 17. Biemelt, S., Sonnewald, U., Galmbacher, P., Willmitzer, L., and Müller, M. (2003) Production of human papillomavirus type 16 virus-like particles in transgenic plants. J. Virol. 77, 9211–9220. 18. Buck, C. B., Pastrana, D. V., Lowy, D. R., and Schiller, J. T. (2004) Efficient intracellular assembly of papillomaviral vectors. J. Virol. 78, 751–757. 19. Cid-Arregui, A., Juarez, V., and zur Hausen, H. (2003) A synthetic E7 gene of human papillomavirus type 16 that yields enhanced expression of the protein in mammalian cells and is useful for DNA immunization studies. J. Virol. 77, 4928–4937.

444

Müller

20. Leder, C., Kleinschmidt, J. A., Wiethe, C., and Müller, M. (2001) Enhancement of capsid gene expression: preparing the human papillomavirus type 16 major structural gene L1 for DNA vaccination purposes. J. Virol. 75, 9201–9209. 21. Liu, W. J., Gao, F., Zhao, K. N., et al. (2002) Codon modified human papillomavirus type 16 E7 DNA vaccine enhances cytotoxic T-lymphocyte induction and anti-tumour activity. Virology 301, 43–52. 22. Mossadegh, N., Gissmann, L., Müller, M., Zentgraf, H., Alonso, A., and Tomakidi, P. (2004) Codon optimization of the human papillomavirus 11 (HPV 11) L1 gene leads to increased gene expression and formation of virus-like particles in mammalian epithelial cells. Virology 326, 57–66. 23. Görnemann, J., Hofmann, T. G., Will, H., and Müller, M. (2002) Interaction of human papillomavirus type 16 L2 with cellular proteins: identification of novel nuclear body-associated proteins. Virology 303, 69–78. 24. Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947–950. 25. Jayaraman, K., Fingar, S. A., Shah, J., and Fyles, J. (1991) Polymerase chain reaction-mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish peroxidase. Proc. Natl. Acad. Sci. USA 88, 4084–4088. 26. Au, L. C., Yang, F. Y., Yang, W. J., Lo, S. H., and Kao, C. F. (1998) Gene synthesis by a LCR-based approach: high-level production of leptin-L54 using synthetic gene in Escherichia coli. Biochem. Biophys. Res. Commun. 248, 200–203. 27. Khorana, H. G. (1979) Total synthesis of a gene. Science 203, 614–625.

Generation of HPV Pseudovirions Using Transfection

445

32 Generation of HPV Pseudovirions Using Transfection and Their Use in Neutralization Assays Christopher B. Buck, Diana V. Pastrana, Douglas R. Lowy, and John T. Schiller Summary It has recently become possible to generate high-titer papillomavirus-based gene-transfer vectors. The vectors, also known as papillomavirus pseudoviruses (PsV), have been useful for studying papillomavirus assembly, entry, and neutralization, and may have future utility as laboratory gene-transfer tools or vaccine vehicles. This chapter outlines a simple method for production of PsV and their use in a high-throughput papillomavirus neutralization assay. The production method is based on transfection of a 293 cell line, 293TT, engineered to express high levels of SV40 large T antigen. The cells are co-transfected with codon-modified papillomavirus capsid genes, L1 and L2, together with a pseudogenome plasmid containing the SV40 origin of replication. Pseudogenome encapsidation within L1/L2 capsids is largely sequence independent, and plasmids entirely lacking PV sequences can be packaged efficiently, provided they are less than 8 kilobases in size. Non-infectious virus-like particles (VLPs) can also be produced after transfection of 293TT cells with L1 alone. Efficient purification of the PsV or VLPs is achieved by Optiprep (iodixanol) density gradient ultracentrifugation. Using these methods, it is possible to produce highly purified PsV with yields of at least 109 transducing units from a single 75-cm2 flask of cells. PsV encapsidating a secreted alkaline phosphatase (SEAP) reporter plasmid were used to develop a high-throughput in vitro neutralization assay in a 96-well plate format. Infection of 293TT cells is monitored by SEAP activity in the culture supernatant, using a highly sensitive chemiluminescent reporter system. Antibody-mediated PsV neutralization is detected by a reduction in SEAP activity. The neutralization assay has similar analytic sensitivity to, and higher specificity than, a standard VLP-based enzyme-linked immunosorbent assay (ELISA).

1. Introduction Several methods for in vitro production of papillomavirus virions or pseudovirions (PsV) have been reported. They include production in keratinocyte raft culture (see Chapters 12 and 14), in cultured monolayers of From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

445

446

Buck et al.

mammalian cells after infection with recombinant vaccinia or Semliki Forest virus vectors expressing L1 and L2 (see Chapter 33), or in the test tube after reassembly of capsomeres in the presence of plasmid DNA (1–4). However, none of these strategies efficiently produces high titers of PsV. Because hightiter PsV carrying an easily scored marker gene were unavailable, papillomavirus neutralization assays have been laborious, both in terms of production of the infectious capsids and in the conduct of the neutralization assays. In this chapter, we provide a simple and flexible procedure for generating papillomavirus pseudovirions with titers in excess of 109 transducing units per mL. We have used PsV produced by this method to develop a simple highthroughput assay for detecting papillomavirus-neutralizing antibodies. The PsV production strategy outlined under Subheadings 3.1. and 3.2. is based on maximizing the production of the two PV capsid proteins, L1 and L2, together with a target reporter plasmid (pseudogenome), in mammalian cells. Because expression of L1 and L2 is normally very low in cultured mammalian cells, L1 and L2 genes with extensive codon modification (see Chapter 31), must be used to overcome negative regulatory features of the wild-type open reading frames (ORFs) (reviewed in ref. 5). These codon changes do not change the primary amino acid sequence of the proteins, but do lead to a large increase in capsid protein production. To generate high-copy-number pseudogenomes for packaging, an SV40 origin of replication (ori) is inserted into the target plasmid, and the pseudovirus is produced in cells that express high levels of SV40 large T antigen (LT). 293T is an adenovirus-transformed human embryonic kidney cell line that was transfected with the SV40 genome. However, this line expresses very low levels of LT because of a splicing bias in favor of small t antigen (6). We generated a subclone, designated 293TT, expressing high levels of LT, by stable transfection of 293T cells with an expression plasmid encoding a cDNA for LT. This line supports high-level replication of plasmids containing the SV40 ori. Cotransfection of 293TT cells with plasmids containing strong eukaryotic promoters driving L1 and L2, together with the pseudogenome plasmid containing the ori and a marker gene, results in high-level expression of the three components and generation of hightiter PsV. Alternatively, non-infectious L1 virus-like particles (VLPs) can be produced after transfection of 293TT cells with a plasmid containing a codonmodified L1 gene and the SV40 ori. PsV stocks can consist of simple crude extracts of detergent-lysed producer cells. However, for many applications it is desirable to separate PsV capsids from cell components. A simple and efficient scheme for papillomavirus PsV and VLP purification is presented under Subheading 3.3. It is based on separation of the capsids from cell debris and detergent by high-salt extraction followed by ultracentrifugation in an Optiprep (iodixanol) step gradient. Under

Generation of HPV Pseudovirions Using Transfection

447

the conditions employed, Optiprep produces a combined velocity sedimentation and buoyant density gradient. It produces excellent separation of PV capids from cell components and also achieves partial separation of PsV from VLPs. Unlike CsCl, which is often used for gradient purification of virus particles, Optiprep has relatively low osmotic content and is nontoxic to cells at concentrations of up to 30% w/v (7). Although Optiprep is considered a relatively gentle ultracentrifugation medium, the capsids of most papillomavirus types are too fragile to withstand purification immediately after release from producer cells. It was therefore necessary to devise a method to “mature” the capsids into a more stable conformation. A method for maturing PV capsids by simple overnight incubation of the crude cell lysates at 37°C is presented under Subheading 3.2.2. Employing the production, maturation, and purification strategies reported herein, it is possible to generate high-titer mature PsV stocks with particle-toinfectivity ratios of less than 10, using green fluorescent protein (GFP) as a marker of infection. PsVs encapsidating a secreted alkaline phosphatase (SEAP) reporter plasmid were used to develop the in vitro neutralization assay presented in Subheading 3.4. Transduction of 293TT cells is monitored by SEAP activity in the culture supernatant, using a highly sensitive chemiluminescent reporter system. Antibody-mediated PsV neutralization is detected by a reduction in SEAP activity. This is the first PV neutralization assay to be adapted to a highthroughput 96-well plate format. A single 75-cm2 flask can produce sufficient SEAP PsV for conducting thousands of assays. The neutralization assay appears to be as sensitive as, but more specific than, a standard VLP-based enzyme-linked immunosorbent assay (ELISA), and requires similar operator effort to that of an ELISA. The assay should have utility in both vaccine and sero-epidemiology studies. 2. Materials 1. 293TT cells (8). 2. DMEM-10: Dulbecco’s modified Eagle’s medium (DMEM), 10% 56°C inactivated fetal calf serum (FCS), 1% nonessential amino acids, 1% Glutamax-I (Invitrogen). 3. 50 mg/mL Hygromycin B stock (Roche). 4. 0.05% trypsin/ethyenediamine tetraacetic acid (EDTA) (Invitrogen). 5. OptiMEM-I (Invitrogen). 6. Lipofectamine 2000 (Invitrogen). 7. Papillomavirus L1 or L1/L2 expression plasmid (8–11). 8. “Pseudogenome” reporter plasmid (e.g., pYSEAP [Fig. 1], 10). 9. Siliconized pipet tips (VWR). 10. Siliconized 1.5-mL screw-cap tubes (Fisher, Cat. No. 05-541-63).

448

Buck et al.

Fig. 1. Maps of plasmids p16L1-GFP and pYSEAP.

Generation of HPV Pseudovirions Using Transfection

449

11. Siliconized 1.5-mL flip-cap tubes (Fisher, Cat. No. 0554131). 12. Dulbecco’s phosphate-buffered saline (PBS) (Invitrogen, Cat. No. 14287-080). 13. 10% Brij58 (polyoxyethylene 20 cetyl ether) (Sigma) in Dulbecco’s PBS (stable for 2 mo at 4°C). 14. Lysis buffer: (Dulbecco’s PBS supplemented with 0.25% Brij58, 9.5 mM MgCl2, 0.1% Benzonase [Sigma], and 0.1% Plasmid Safe [Epicentre]). Prepare just prior to use. 15. 5 M NaCl. 16. 46% Optiprep: for 100 mL (77 mL 60% Optiprep (Sigma D1556), 10 mL 10X PBS, 12.5 mL 5 M NaCl, 45 µL 2 M CaCl2, 25 µL 2 M MgCl2, 210 µL 1 M KCl). Protect from light and store at room temperature for up to 2 mo. 17. Dulbecco’s PBS/0.8 M NaCl: for 100 mL (77 mL sterile water, 10 mL 10X PBS, 12.5 mL 5 M NaCl, 45 µL 2 M CaCl2, 25 µL 2M MgCl2, 210 µL 1 M KCl). Filtersterilize; stable for at least 2 mo at room temperature. 18. Polyallomer ultracentrifuge tubes (Beckman). 19. Swinging bucket ultracentrifuge rotor rated for >200,000g (e.g., SW55ti). 20. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) equipment. 21. Neutralization/growth media: DMEM without phenol red (see Note 1), 10% FCS (heat inactivated at 56°C), 1% MEM nonessential amino acids (Invitrogen, Cat. No. 11140-050), 1% HEPES (Invitrogen, Cat. No. 15630-106), 1% Glutamax-I (Invitrogen, Cat. No. 35050-061), 1% antibiotic-antimycotic (Invitrogen, Cat. No. 15240-062). 22. Dilution plates: untreated, sterile, U-bottom 96-well (Corning Costar, Cat. No. 3788). 23. 96-Well flat-bottom tissue-culture treated plates (Corning Costar, Cat. No. 3596). 24. Assay plates: Optiplate-96, white for luminescence, isotopic, and fluorescence (Perkin Elmer, Cat. No. 6005299). 25. Multichannel pipettor. 26. Sterile reservoir for use with multichannel pipettor. 27. Polystyrene 15- or 50-mL conical tubes. 28. Positive controls for neutralization assay: either known neutralizing antibodies or heparin 16,000 kD from porcine intestinal mucosa (Sigma H-4784) (12). 29. Chemiluminescent Great Escape SEAP detection kit (BD Bioscience/Clontech, Cat. No. 631701). 30. Microplate Luminometer (e.g., MLX luminometer, DYNEX).

3. Methods The methods described below outline (1) culture and transfection of 293TT cells, (2) harvest of PsV, (3) purification of PsV by ultracentrifugation through an Optiprep gradient, and (4) use of PsV in neutralization assays.

3.1. Culture and Transfection of 293TT Cells PsV are produced in 293TT cells by transient co-transfection of plasmids encoding the papillomavirus structural genes, L1 and L2, together with a

450

Buck et al.

reporter plasmid (pseudogenome). The protocol uses production of an HPV-16 PsV encoding SEAP reporter as an example. See Notes 2 and 3 for information about production of VLPs and other PsV types.

3.1.1. Thawing 293TT Cells 293TT are cultured in DMEM-10. To thaw 293TT cells, place the cells directly into a 150-cm2 flask with 25 mL of DMEM-10 supplemented with an additional 10% FCS. It is not necessary to spin the cells out of their freezing medium. Like other types of 293 cell lines, 293TT do not adhere tightly. It may take as many as 3 d for the cells to attach after thawing.

3.1.2. Passaging 293TT Cells Split 293TT cells 1:5 to 1:20 when they reach 80–90% confluence. Detach cells by gently rinsing the flask once with several mL of trypsin, followed by a 5–10 min incubation in 2 mL of fresh trypsin in a humidified 37°C incubator. It is important to trypsinize the cells thoroughly, since insufficient trypsinization can lead to shredding of cell clumps. Inactivate trypsin by resuspending the cells in DMEM-10 and split directly into a fresh flask. After recovery from the thaw, DMEM-10 can be supplemented with 400 µg/mL hygromycin B to promote maintenance of T antigen expression. Although 293TT cells can typically be passaged for several months without alteration of PsV production or titration characteristics, an early passage should be frozen in aliquots for longterm storage.

3.1.3. Transfection Use Invitrogen’s Lipofectamine2000 essentially according to the package insert. 1. Preplate 10 million 293TT cells in 20 mL of DMEM-10 (no hygromycin or antibiotics) in a 75-cm2 flask 16 to 24 h prior to transfection. 2. Mix 13 µg each of p16L1-GFP, p16-L2h, and pYSEAP (see Notes 2 and 3) with 2 mL of OptiMEM-I. 3. In a separate tube mix 85 µL of Lipofectamine 2000 with 2 mL of OptiMEM-I. 4. Incubate the two mixtures separately at room temperature for 10 to 30 min, then combine and incubate for at least an additional 20 min. 5. Add the resulting lipid/DNA complexes directly to the preplated cells. It is not necessary to change medium prior to transfection. 6. Incubate the cells with the lipid/DNA complexes for 4 to 6 h, then remove the complexes and add fresh DMEM-10 prewarmed to 37°C. Add the fresh DMEM-10 to the top of the flask to avoid dislodging cells. Incubating cells overnight in lipid/DNA mix results in significant cytotoxicity without much improvement in transfection efficiency.

Generation of HPV Pseudovirions Using Transfection

451

From this point forward, treat cells and all their products like an infectious agent (see Note 4). Incubate the transfected cells overnight, then split 1:2 or 1:3, depending on cell density. Use bleach or 70% ethanol to disinfect all plasticware before it exits the hood.

3.2. Harvest and Maturation PsV are released from 293TT cells by detergent lysis. Although the PsV are infectious immediately after release, pseudovirions must be given time to mature prior to purification. Maturation is accomplished by simple overnight incubation of the cell lysate at 37°C. The matured PsV is solubilized by addition of sodium chloride to the lysate, which allows clarification of the lysate by low-speed centrifugation.

3.2.1. Collect Cells Collect producer cells by trypsinization about 44 h after transfection (see Note 5). If there are many floating cells, collect them by centrifugation and combine with trypsinized cells. Resuspend the cells in 10 mL of DMEM-10 and count viable cells by trypan blue exclusion. An initial transfection of a T-75 flask should yield about 50 million cells. Spin down the cells and discard the supernatant. Transfer the cells into a siliconized (see Note 6) 1.5- or 2.0-mL screw-cap tube using 2 × 0.5 mL of DPBS. Spin down the cells and discard supernatant.

3.2.2. Cell Lysis and Capsid Maturation Suspend cells at approx 100 million cells per mL in lysis buffer. Note that the cell pellet occupies nearly a third of the final volume. For example, add about 400 µL of lysis buffer to a cell pellet of 60 million cells. Incubate cell lysate at 37°C for at least 16 h (see Note 7). Mix the tube by inversion occasionally, particularly during the first 2 h of the incubation.

3.2.3. Salt Extraction Note that Optiprep gradients (see Subheading 3.3.) must be allowed to diffuse at least an hour prior to performing salt extraction. 1. Chill the matured lysate on ice for 5 min. 2. Bring salt concentration up to 850 mM by adding 0.17 volume of 5 M NaCl. Incubate on ice for 10 to 20 min. If desired, a sample of salt-treated lysate can be withdrawn for titering (see Note 10). Crude stock must be diluted at least 1:500 to avoid detergent toxicity to the target cells. 3. Clarify the salt lysate by spinning for 15 min at 2000g in a refrigerated microcentrifuge.

452

Buck et al.

4. Transfer the supernatant onto an Optiprep gradient (see Subheading 3.3.) or see Note 8 for alternative purification methods. 5. Additional PsV can be recovered by resuspending the pellet with a few hundred µL of cold Dulbecco’s PBS/0.8 M NaCl, spinning again for 15 min, then adding the wash to the top of the Optiprep gradient.

3.3. Optiprep Purification PsV is purified by ultracentrifugation through an Optiprep step gradient. This section also outlines methods for biochemical analysis of the purified PsV.

3.3.1. Preparation of Optiprep Gradients Use DPBS/0.8 M NaCl to dilute 46% Optiprep stock (see Subheading 2.) to 27%, 33%, and 39%. Use 50-mL conical centrifuge tubes to allow easier syringe draws (discussed later). Pour Optiprep gradients in thin-wall polyallomer 5-mL tubes (e.g., Beckman 326819) by underlaying (27%, then 33%, then 39%) 1.4-mL steps using a 3-mL syringe fitted with a long needle. If necessary, pour a balance gradient. Allow the gradients to diffuse at room temperature for 1 to 4 h.

3.3.2. Ultracentrifugation Gently layer clarified cell lysate and wash (see Subheading 3.2.3.) onto the linearized gradient. The tubes should be full and the tubes/buckets should be balanced to within ±5 mg. Spin for 3.5 h, 16°C, at 234,000g in an SW55ti rotor. Set the acceleration and deceleration to “slow.” Too rapid an acceleration/deceleration may stir the gradients. Other types of rotors can be used successfully—for example, SW40.1Ti at 200,000g for 4.75 h or SW32 at 125,000g for 5.75 h.

3.3.2. Fraction Collection The L1 band may be faintly visible as a uniform light gray layer a little over a third of the way up the gradient. Collect gradient fractions by puncturing the bottom of the tube slightly off center with a 26-gage syringe needle. Collect fractions in siliconized microcentrifuge tubes. Collect the first approx 750 µL as one fraction, then collect 6- to 8-drop (approx 250 µL) fractions up to fraction 10. Discard the top approx 2 mL of the gradient.

3.3.3. Screening Fractions Because L1 is the major protein present in core fractions of the gradient (Fig. 2), fractions containing PsV can be identified rapidly by SDS-PAGE minigel analysis of 5 µL of each fraction. The colloidal coomassie reagent Microwave Blue (Protiga) offers a rapid and sensitive method for staining SDS-

Generation of HPV Pseudovirions Using Transfection

453

Fig. 2. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of Optiprep fractions.

PAGE gels. Fractions containing significant amounts of L1 (55 kD) should be pooled, aliquoted, and frozen at –80°C. Peak L1 content is generally found between fractions 4 and 8. SDS-PAGE analysis of bovine serum albumin standards ranging from 2 µg to 50 ng, or BCA protein assay (Pierce), can be used to quantitate L1 yield. Overall L1 yield should be about 200 µg of L1 from a 75-cm2 flask transfected with p16L1 GFP. Notes 9 and 10 discuss alternative methods for screening fractions.

3.4. Neutralization Assay The methods described below outline (1) titration of the SEAP-PsV stock, (2) luminometry to detect SEAP production, and (3) determination of the neutralization titer of test sera. The PsV used for this assay encapsidates a reporter plasmid, pYSEAP, encoding SEAP. When PsV infect 293TT cells, the pYSEAP reporter plasmid, which carries an SV40 ori, is replicated to high copy number. This leads to high-level production of alkaline phosphatase that is secreted into the culture medium, and so can be easily assayed. Antibodymediated neutralization of the PsV results in a corresponding reduction in SEAP expression.

3.4.1. Titration of SEAP-PsV Stocks Before assaying for neutralizing activity of test sera, it is important to titrate the PsV stock to determine the inoculum that will be used in each assay. The goal of the titration is to determine the minimum amount of PsV required to

454

Buck et al.

give a robust signal in the SEAP assay (see Subheading 3.4.2.) that is well above background but within the linear range of the assay. Typically, this falls in a range between 30 and 100 relative light units (RLUs) in the absence of neutralizing antibodies, with a background of no more than 1 RLU when the PsV is maximally neutralized with the positive control antibody or heparin. The method to titrate the stock is as follows: 1. 2. 3. 4. 5.

6. 7.

8. 9. 10.

11. 12. 13. 14.

Calculate the number of plates needed to titer the PsV. Trypsinize 293TT cells and suspend in neutralization/growth medium. Count the cells and preplate 2–5 h before the PsV are added (see Note 11). Dilute the cells to 300,000/mL in the neutralization/growth medium and place in a sterile reservoir. Using a multichannel pipettor, deliver 100 µL of cell suspension to each of the internal wells of a 96-well tissue-culture treated plate. To avoid evaporation, do not use external wells and instead fill surrounding wells with 120–150 µL of medium with phenol red (Table 1). Replace cover and place cells at 37°C in an incubator until ready to add the PsV. Using siliconized tubes and tips, make serial dilutions of the PsV. Each dilution is tested in triplicate, and enough should be diluted for at least six wells—three with and three without positive neutralization control. Depending on the papillomavirus type, appropriate dilution ranges between 1:300 and 10,000. Place 80 µL of the diluted PsV into the wells of the dilution plates. To the wells that will have untreated PsV, add 20 µL of neutralization/growth medium. Dilute the positive neutralization antibody (or heparin) such that it is fivefold more concentrated than its known 95% neutralizing dilution. For example: V5 (anti-HPV16 monoclonal) at 1:250,000 5B6 (anti-bovine papillomavirus [BPV] monoclonal) at 1:25,000 Rabbit anti-VLP polyclonal sera at 1:10,000 to 1:1,000,000 Heparin H-4784 at 1 mg/mL Dilute the antibody another fivefold by adding 20 µL of diluted antibody (above) to triplicate wells containing 80 µL of diluted PsV. Once the PsV and positive neutralization control(s) are combined, place on ice for 1 h. Add the whole mixture to the preplated cells. Return to the incubator for 72 h. The medium should not be replaced during these 72 h (see Note 12).

3.4.2. Chemiluminescent Detection of Secreted Alkaline Phosphatase For this section of the protocol use a multichannel pipettor when transferring liquids from one plate to the other. Make up kit reagents as indicated below and transfer to a reservoir so you can also use a multi-channel pipettor for those steps. Although SEAP activity can be detected colorimetrically, chemi-

Generation of HPV Pseudovirions Using Transfection

455

Table 1 Schematic for a 96-Well Plate for Titering PsV*

*Striped cells should be filled with 120 µL of medium with phenol red to avoid evaporation from inner wells. HPV, human papillomavirus.

luminescent methods, such as the one described here, are generally preferable since they offer a much higher signal-to-noise ratio (see Note 13). 1. After the 72 h incubation, lightly shake plates to obtain a homogeneous sample of the supernatant. 2. Transfer 50 µL of supernatant to the corresponding well of a sterile 96-well polystyrene plate 3. Spin the plate at 1000g for 5 min. 4. Use Great Escape reagents according to manufacturer’s instructions. Briefly: 5. Add 45 µL of 1X dilution buffer directly into wells of a white optiplate-96 assay plate.

456

Buck et al.

6. Transfer 15 µL of clarified supernatant to the plate, cover with plastic coverfoil, and incubate 30 min at 65°C. 7. Incubate plates on ice 2–5 min. 8. Add 60 µL of room temperature 1X assay buffer and incubate at room temperature for 5 min. 9. Dilute chemiluminescence substrate and add 60 µL to each well. 10. Incubate at room temperature for 20 min. 11. Read on MLX Microplate Luminometer (Dynex Technologies) set at Glow-Endpoint 0.20 s/well RAW Data Handling Average readings at 20 min after adding substrate.

The relative light units (RLUs) obtained from triplicate samples should not vary by more than 10 or 15%. If they vary more than that, check the notes section to try to troubleshoot the problem.

3.4.3. Neutralization Assay Once the PsV has been titrated, test sera (see Notes 14 and 15) can be assayed to determine endpoint neutralization titers. To monitor inter-assay variability, the following controls should be included for each plate: (1) at least two wells of cells in neutralization/growth media without PsV or serum, (2) at least four wells of PsV-infected cells to which no antibody was added, (3) cells treated with PsV pre-incubated with a known serum, with at least 4 dilutions that span the 50% neutralizing titer that has been recorded in other experiments, and (4) cells treated with PsV pre-incubated with at least one dilution of a known non-neutralizing serum. See Table 2 for a typical arrangement of samples. 1. Preplate cells as described under Subheading 3.4.1. 2. Perform serial dilutions of the unknown sera (see Note 14) in sterile polystyrene plates. Be sure to take into account the 1:5 dilution of the serum once 20 µL of diluted serum are added to 80 µL of the PsV. 3. Prewet a sterile multichannel pipet reservoir with neutralization/growth medium to prevent sticking of PsV to the reservoir. 4. Dilute PsV in neutralization/growth medium to the concentration determined under Subheading 3.4.1. in a 15- or 50-mL polystyrene centrifuge tube. 5. Vortex briefly and decant into the prewetted reservoir. 6. Using siliconized tips and a multichannel pipettor, transfer 80 µL of the diluted PsV to each well of a 96-well dilution plate. If siliconized tips are unavailable, pipet diluted PsV up and down five times before delivering to the first row of the plates, then use the same tips for all other rows. 7. Add 20 µL of the test or control sera to the PsV and incubate on ice for 1 h. 8. Add the entire volume of the virus-antibody mixture to the corresponding wells of the plate using a multichannel pipettor. 9. Return the plate to the incubator for 72 h.

Generation of HPV Pseudovirions Using Transfection

457

Table 2 Schematic Drawing for a Typical Setup for Determining Neutralizing Titer of Unknown Sera With Human Papillomavirus (HPV)-16 PsV*

*Striped wells should be filled with 120 µL of medium with phenol red to avoid evaporation from inner wells.

10. The medium should not be changed. 11. The supernatant is then assayed for presence of SEAP (see Subheading 3.4.2.). The titer is defined as the reciprocal of the highest dilution of serum that reduces the SEAP activity by at least 50% in comparison to the reactivity in the wells that received PsV but no antibody.

458

Buck et al.

If the same PsV stock is used to repeat the neutralization, then the 50% neutralizing titer should be the same, or vary by three- or fourfold. If the results vary by more than fourfold, the assay should be repeated a third time. Report the geometric mean titer of all assays performed. 4. Notes 1. The presence of phenol red tends to give a higher background in the chemiluminescent (and colorimetric—see Note 10) detection assay; therefore, medium without phenol red is preferred for the assays. 2. Maps of plasmids useful for PsV production are available at the website http:// ccr.cancer.gov/Staff/links.asp?profileid=5637. Care should be taken when re-transforming the plasmids, because the collection uses a wide variety of different drug-resistance markers. It is currently possible to generate BPV1, HPV-16, and HPV-18 PsV. Additional types are in development in various labs. For BPV1, it was possible to create a single large plasmid that drives expression of both L1 and L2 (pSheLL). The large size of the plasmid precludes self-packaging. For other papillomavirus types, L1 and L2 must be co-transfected on separate plasmids. In some instances, L1 and PsV yield can be increased substantially if plasmids expressing L1 under the control of the human elongation factor (EF)1α promoter also carry an SV40 origin of replication (e.g., p16L1-GFP, [11] and peL1fB, [10]). The protocol can be adapted to production of non-infectious L1-only VLPs simply by omitting the L2 and reporter plasmid components from the transfection step. 3. Although essentially any plasmid under 8 kb in size can be packaged by L1 and L2, PsV production efficiency varies with different reporter plasmids for reasons that are not fully understood. In general, smaller (approx 6 kb) plasmids expressing a reporter gene under control of EF1α promoter give better titer yield than plasmids expressing genes under control of CMV promoter. The presence of an SV40 ori on the target plasmid is not strictly required, but does typically augment titer yield by 5- to 10-fold. PsV carrying GFP reporter plasmids (e.g., pfwB, [11]) are convenient, since they can be easily titered by fluorescence-activated cell sorting (FACS). 4. Because PsV are capable of transferring foreign DNA, they should be handled using full biosafety level 2 precautions. It is important to note that the promiscuity of packaging by L1 and L2 can lead to generation of PsV with encapsidated fragments of cellular DNA, possibly including SV40 large tumor antigen, adenovirus oncogenes, or unknown oncogenes present in 293TT cells. Mature PsV can be inactivated by 70% ethanol, but, like many other types of non-enveloped virus particles, they are resistant to a wide spectrum of physical insults, including various detergents and proteases, prolonged heating at 56°C, 50 mM EDTA, and sodium chloride up to at least 1.5 M (unpublished results). PsV are probably also resistant to dessication (13). High-titer PsV should never be harvested using tip sonication, which can create potentially dangerous aerosols.

Generation of HPV Pseudovirions Using Transfection

459

5. In most cases, substantial amounts of PsV are generated within 24 h posttransfection. However, maximum titer yield is typically approx 44 h posttransfection. Although the SV40 ori+ plasmid DNA content increases approx fivefold between 44 and 52 h, very little additional PsV titer appears during this period. Titer yield at 72 h is generally poor, presumably due to cell death triggered by over-replication of SV40 ori+ plasmid DNA. 6. It is important to use siliconized tubes and pipet tips, because PsV adsorb nonspecifically to polypropylene (14). Long-term storage of purified PsV or VLPs at 4°C can result in loss due to nonspecific sticking, even in siliconized and polystyrene tubes (see also Note 9). 7. During the overnight incubation of the cell lysate, pseudovirions “mature” into a more stable configuration. During maturation, disulfide bonds gradually form between L1 molecules, and the capsid becomes condensed and shows improved regularity in electron micrographs (11). Although the immature PsV are infectious immediately after cell lysis, they are too fragile to withstand purification. It is sometimes practical to use crude cell lysates as PsV stock. If purification is not necessary, the maturation step can be omitted and the stock can be frozen in aliquots after addition of salt (see Subheading 3.2.3.). It is important to perform the maturation step in high-density cell lysates. Cell lysates at densities of 20 million cells per mL or less suffer dramatic nonspecific protein aggregation. The nonspecific aggregation can lead to poor separation of capsids from cell debris in Optiprep gradients. Although it is possible to accelerate the maturation process by addition of oxidants (e.g., 5 mM oxidized glutathione), the accelerated maturation can lead to formation of irregular capsids (unpublished observation). 8. If ultracentrifugation equipment is unavailable, VLPs or PsV can be partially purified over disposible HiTrap Heparin HP affinity columns (Pharmacia Catalog No. 17 0406-01) (15). Papillomavirus capsids bind the columns in buffers with 0.3 M NaCl and elute at 0.8 M NaCl. Phosphate or MOPS can be used for buffering. Because papillomavirus virions are too large to enter pores in the crosslinked agarose matrix of the columns, the overall binding capacity of the columns can be as low as 100 µg of L1 per mL of column volume. Because many cellular proteins bind the columns, the degree of purification is quite poor compared to Optiprep gradient ultracentrifugation. It is possible to exchange PsV out of salt, detergent, or Optiprep-containing solutions using Amicon centrifugal filter devices (e.g., Millipore UFC81008). Finally, PsV stocks can be purified (or re-purified) by buoyant density centrifugation in a self-forming Optiprep gradient. PsV have an apparent density of about 1.20 g/mL in Optiprep, whereas empty papillomavirus capsids are closer to 1.25 g/mL. Separation of the two species can be achieved by mixing the PsV stock into 30% Optiprep/0.8 M NaCl followed by equilibrium centrifugation in an NVT65 rotor at 65,000 rpm for 4 h. 9. For some papillomavirus types (particularly BPV1), a significant percentage of L1 particles may lack encapsidated DNA. Empty capsids migrate to the higherdensity fractions (i.e., toward the bottom of the tube) relative to DNA-filled infectious PsV. For some applications, it may be desirable to achieve a lower

460

10.

11. 12. 13.

Buck et al. particle-to-infectivity ratio by discarding fractions containing empty capsids. If gradient SDS-PAGE gels are available (e.g., NuPAGE precast 4–12% Bis-Tris/ MOPS gels [Invitrogen]), it is often possible to discriminate between the two types of particles by visualization of histone-sized proteins (approx 15 kD) in fractions with significant PsV titer (Fig. 2). Another rapid method for screening fractions is to extract encapsidated DNA from 20 µL of each fraction using microcentrifuge silica columns (e.g., PCR Purification Kit [Qiagen]). In most instances, the extracted DNA can be easily visualized by agarose gel electrophoresis followed by staining with ethidium bromide or SYBR Green I (Sigma). Finally, the fractions can be titered for SEAP- or GFP-transducing activity individually (see Subheading 3.4.1. and Note 10). A drawback to titering the fractions is that they must be stored during the 2–3 d it takes to perform the titration. In order to avoid loss by nonspecific adsorption to the tube walls (see Note 6), the fractions (or aliquots of pooled fractions) should be stored at –80°C. Alternatively, it is possible to saturate nonspecific binding by adding 10% FCS to PsV stocks, allowing storage for up to a month at 4°C. Although mature PsV stocks typically suffer less than a 25% loss of titer during freezing, repeated freeze-thaw cycles should be avoided. PsV stocks are stable at –80°C for at least a year. If a GFP-expressing plasmid (e.g., p16L1-GFP [Fig. 1] or pfwB) was included in the transfection, it is possible to titer the stock using a FACS machine. For pfwB, titer yield should be at least 109 GFP-transducing units per 75-cm2 flask. GFPbased titration should be performed as follows: • Preplate 293TT cells in DMEM-10 in a 24-well plate at 1 × 105 cells in 0.5 mL per well. Incubate overnight. Alternatively, preplate 2 × 105 cells in 0.5 mL of DMEM-10 an hour or two in advance. Cells should be <50% confluent. • Use a 2.5-µL pipet with short siliconized tips (BioPlas) to add 1 µL of PsV stock directly to a well of preplated cells. It may be necessary to dilute the stock 1:10 or 1:100 into DPBS/0.8 M NaCl (use siliconized tubes and tips). Incubate cells 44 to 52 h. • Trypsinize cells and resuspend in DPBS with 1% FCS. Analyze cells by FACS. Adjust an FL1 marker region to exclude at least 99.8% of untransduced control cells. Choose a PsV dilution that gives between 1 and 25% of cells falling in the FL1+ marker region. For titer (in transducing units per mL), use the formula [fraction of cells FL1+] × [200,000 cells inoculated] × [1000 µL/mL] × [stock dilution (if any)]. The timing of plating of cells in the neutralization assay is important. Preplating overnight, or just before adding PsV results in suboptimal transduction. Because 293TT cells detach very easily, replacement of the media once the procedure has been started is not recommended. Although the chemiluminescent assay is more sensitive for detecting SEAP compared to colorimetric substrates, chemiluminescent methods require access to a microplate luminometer and are substantially more expensive. Adaptation of the neutralization assay to use of colorimetric substrates is currently under development. Because of the lower sensitivity of colorimetric substrates, 3- to 10-fold

Generation of HPV Pseudovirions Using Transfection

461

more PsV must be used if a colorimetric readout is to be performed. With many PsV/antibody combinations, the neutralization assay probably operates under conditions of antibody excess (16). For this reason, modest changes in the amount of input PsV typically do not alter the 50% neutralization cutoff (Ioannis Bossis, Ratish Gambhira, Yuk-Ying S. Pang, and Richard B.S. Roden, unpublished observation). Thus, for some types of experiments, colorimetric reagents may be an acceptable substitute for chemiluminescent methods. For colorimetric detection of SEAP, prepare colorigenic substrate buffer by diluting diethanolamine (Acros Organics, Cat. No. 113920025) 1:5 with water, then add MgCl2 to 1 mM. Add one-thousandth volume of 0.5 M ZnCl2 (stock will be somewhat cloudy). Store the completed substrate buffer at 4°C. Add one P-nitrophenyl phosphate (PNP) tablet (Sigma, Cat. No. N-2765) to 20 mL of substrate buffer and dissolve for 20 min at room temperature. While the PNP is dissolving, transfer 40 µL of clarified supernatant (see Subheading 3.4.2.) into a 96-well plate containing 20 µL per well PBS with 0.05% CHAPS (Sigma, Cat. No. C5070-1G). Add 200 µL of PNP solution per well and incubate 2 h. Read on a microplate spectrophotometer at 405 nm wavelength. 14. Heparin and its biochemical relatives interfere with papillomavirus infection. Do not use plasma collected in heparinated tubes. 15. Sera frequently have nonspecific interfering activity at dilutions of 1:20 or lower, so 1:40 is a typical starting dilution. Although highly neutralizing anti-VLP sera may need to be diluted one to a few million to encompass the 50% neutralization cutoff, titers of sera from naturally HPV-infected women typically range between 1:40 and 1:10,000. BPV1 pseudovirions should be used as a control for nonspecific neutralizing activity in anti-HPV sera. Serum is considered positive in an HPV neutralization assay only if it neutralizes HPV PsV at a fourfold higher dilution than it neutralizes BPV PsV.

References 1. Meyers, C. and Laimins, L. A. (1994) In vitro systems for the study and propagation of human papillomaviruses. Curr. Top. Microbiol. Immunol. 186, 199–215. 2. Roden, R. B., Greenstone, H. L., Kirnbauer, R., et al. (1996) In vitro generation and type-specific neutralization of a human papillomavirus type 16 virion pseudotype. J. Virol. 70, 5875–5883. 3. Unckell, F., Streeck, R. E., and Sapp, M. (1997) Generation and neutralization of pseudovirions of human papillomavirus type 33. J. Virol. 71, 2934–2939. 4. Touze, A. and Coursaget, P. (1998) In vitro gene transfer using human papillomavirus-like particles. Nucleic Acids Res. 26, 1317–1323. 5. Schwartz, S. (2000) Regulation of human papillomavirus late gene expression. Ups J Med Sci 105, 171–192. 6. Fu, X. Y. and Manley, J. L. (1987) Factors influencing alternative splice site utilization in vivo. Mol. Cell Biol. 7, 738–748. 7. Andersen, K. J., Vik, H., Eikesdal, H. P., and Christensen, E. I. (1995) Effects of contrast media on renal epithelial cells in culture. Acta Radiol. Suppl. 399, 213–218.

462

Buck et al.

8. Buck, C. B., Pastrana, D. V., Lowy, D. R., and Schiller, J. T. (2004) Efficient intracellular assembly of papillomaviral vectors. J. Virol. 78, 751–757. 9. Leder, C., Kleinschmidt, J. A., Wiethe, C., and Muller, M. (2001) Enhancement of capsid gene expression: preparing the human papillomavirus type 16 major structural gene L1 for DNA vaccination purposes. J. Virol. 75, 9201–9209. 10. Pastrana, D. V., Buck, C. B., Pang, Y. Y., et al. (2004) Reactivity of human sera in a sensitive, high-throughput pseudovirus-based papillomavirus neutralization assay for HPV16 and HPV18. Virology 321, 205–216. 11. Buck, C. B., Thompson, C. D., Pang, Y.-Y. S., Lowy, D. R., and Schiller, J. T. (2005) Maturation of papillomavirus capsids. J. Virol. 79, 2839–2846. 12. Selinka, H. C., Giroglou, T., Nowak, T., Christensen, N. D., and Sapp, M. (2003) Further evidence that papillomavirus capsids exist in two distinct conformations. J. Virol. 77, 12,961–12,967. 13. Roden, R. B., Lowy, D. R., and Schiller, J. T. (1997) Papillomavirus is resistant to desiccation. J. Infect. Dis. 176, 1076–1079. 14. Volkin, D. B., Shi, L., and Sanyal, G. (2002) Stabilized human papillomavirus formulations. U.S. patent 6,358,744 B1. 15. Joyce, J. G., Tung, J. S., Przysiecki, C. T., et al. (1999) The L1 major capsid protein of human papillomavirus type 11 recombinant virus-like particles interacts with heparin and cell-surface glycosaminoglycans on human keratinocytes. J. Biol. Chem. 274, 5810–5822. 16. Klasse, P. J. and Sattentau, Q. J. (2002) Occupancy and mechanism in antibodymediated neutralization of animal viruses. J. Gen. Virol. 83, 2091–2108.

Generation of HPV Pseudovirions Using Vaccinia Virus

463

33 Generation and Applications of HPV Pseudovirions Using Vaccinia Virus Martin Sapp and Hans-Christoph Selinka Summary This chapter outlines the generation and application of human papillomavirus type 33 (HPV 33) pseudovirions. These pseudovirions are structurally indistinguishable from native virions and are therefore valuable tools for the study of papillomavirus/cell interactions. The method describes (1) the construction of vaccinia viruses recombinant for the major and minor HPV capsid proteins, L1 and L2, respectively, (2) the transfection of Cos7 cells with a marker plasmid replicating to high copy numbers, (3) the expression of L1 and L2 using the vaccinia virus expression system, (4) the extraction, purification, and analysis of HPV-33 pseudovirions, (5) pseudoinfection assays, (6) pre- and post-attachment neutralization of pseudovirions, and (7) the use of inhibitors for study of binding and uptake of pseudovirions. The methods described have been successfully adopted for HPV 16 and 18 and may thus be applied for other HPV types, too.

1. Introduction Because some viruses cannot be easily propagated in vitro as a result of special requirements, e.g., regarding cell differentiation, surrogate systems have been developed to study the infection process of these viruses. In addition to genome-free virus-like particles, which allow the study of certain aspects of virus/cell interactions, pseudoviruses carrying foreign genes have been generated for this purpose (1–3). These pseudoviruses have turned out to be valuable tools for the analysis of virus internalization pathways and virus morphogenesis, for determination of neutralizing antibodies, as well as for testing drugs interfering with the virus infection. We here describe a method for generating pseudovirions of human papillomaviruses (HPV), to circumvent the strict dependence on terminally differentiating keratinocytes for their replication (4). HPV are nonenveloped viruses, which are composed of 360 copies of the major capsid protein L1, probably 12 copies of the minor capsid protein L2, and an From: Methods in Molecular Medicine, Vol. 119: Human Papillomaviruses: Methods and Protocols Edited by: C. Davy and J. Doorbar © Humana Press Inc., Totowa, NJ

463

464

Sapp and Selinka

8-kb circularized double-stranded DNA genome in the form of chromatin (5). We have chosen the approach of expressing the capsid proteins in cells harboring high copy numbers of a marker plasmid to generate HPV pseudovirions. In contrast to alternative procedures, which package naked DNA in or outside virus-like particles (6–9), these pseudovirions are structurally indistinguishable from native virions and allow the complete packaging of any histoneassociated DNA up to 8 kb (10,11). They allow the study of single-cell infections and a fast and easy quantitative analysis of infection events. 2. Materials 2.1. Basic Technical Equipment 1. Polymerase chain reaction (PCR) equipment. 2. Agarose gel equipment. 3. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blot equipment. 4. Gel dryer. 5. Cell-culture equipment. 6. Table-top centrifuge. 7. Electroporator and electroporation chambers (e.g., GIBCO Cellporator®). 8. Dounce homogenizer with tight-fitting pestle. 9. Sonicator. 10. 5-mL Polyallomer centrifugation tubes (e.g., OptiSeal®, Beckman). 11. Ultracentrifuge and rotors (e.g., Beckman Vti65 and SW40). 12. Density refractometer. 13. Fluorescence microscope.

2.2. Viruses, Cells, and Plasmids 1. Vaccinia viruses (VV): wild-type VV strain WR; temperature-sensitive VV strain ts7; T7 RNA polymerase recombinant VV strain vTF7-3 (12). 2. Plasmids: pTM1, kindly provided by Bernhard Moss (12); pEGFP-C1 (Clontech); pHPV33, kindly provided by Gerard Orth (13); pEGFPGFP-NLS (14) or pEGFP-C1 (Clontech). 3. Cell lines: HuTK–143 B (ATCC: CRL-8303); Cos7 (ATCC: CRL-1651). 4. Bacterial cells: E. coli DH5α; ElectroMAX™ DH5α-E cells.

2.3. Buffers, Chemicals, and Other Materials 1. Hypotonic Dounce buffer: 10 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, 0.5% NP40 (pH 7.6). 2. HEPES-buffered saline (HBS) buffer: 21 mM HEPES, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 6 mM glucose (pH 7.05). 3. 2X HBS buffer: 42 mM HEPES, 274 mM NaCl, 10 mM KCl, 1.4 mM Na2HPO4, 12 mM glucose (pH 7.05).

Generation of HPV Pseudovirions Using Vaccinia Virus 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25.

26. 27. 28. 29.

465

250 mM CaCl2. 10% Triton X-100. β-mercaptoethanol. 250 mM Ethylenediamine tetraacetic acid (EDTA) (pH 8.0). 10% SDS. Chloroform/isoamylalcohol (24:1). Buffered phenol (pH 7.0). Ethanol (100% and 70%). 10 mM HEPES (pH 7.2). TE buffer: 10 mM Tris-HCl, 1 mM EDTA (pH 8). Phosphate-buffered saline (PBS) buffer: Dulbecco’s PBS without calcium and magnesium: 0.2 g/L KCl, 0.2 g/L KH2PO4, 8.0 g/L NaCl, 1.15 g/L Na2HPO4. PBS supplemented with 2.5 mM EDTA. Dulbecco’s modified Eagle’s medium (DMEM). Supplemented DMEM: DMEM containing 10% fetal calf serum (FCS) and antibiotics. Laemmli sample buffer: 50 mM Tris-HCl, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 5% β-mercaptoethanol (pH 6.8). Luria-Bertani (LB) kanamycin. Cesium chloride (CsCl). 0.3% Crystal violet in 4% ethanol. Proteinase K. Restriction endonucleases: BamH1, BspH1, EcoRI, NcoI. DNA-modifying enzymes: Deep Vent® DNA Polymerase (NEB), DNase I. Oligonucleotides: a. ON-33L1-1-5': 5'-GGCCTCATGACCGTGTGGCGGCCTAGTG-3'. b. ON-33L1-499S-3': 5'-GGCCGGATCCACACAATT ACACAAAGTG-3'. c. ON-33L2-1-5': 5'-GGCGAATTCATGAGACACAAAAGATCT-3'. d. ON33L2-467S-3': 5'-GACGGATCCAGGTACACTGTGGCC-3'. e. ON-GFP-5': 5'-GCCGAATTCTATGGTGAGCAAGGGCGAGGAG-3'. f. ON-GFP-3': 5'-CTCGGATCCTTATTTTTTAACCTTTTTGCGTTTCTTGTACAGCTCGTCCAT-3'. T7-coupled reticulocyte lysate system (Promega). 5-bromo-2'-deoxyuridine (BrdU). HPV capsid protein-specific antibodies: e.g., L1-specific Cam Vir-1 (Chemicon) and 33L1-7 (15), and 33L2-specific 33L2-1 (16). Magnetic beads loaded with rabbit anti-mouse IgG (e.g., Dynabeads).

3. Methods We generate HPV pseudovirions by expression of L1 and L2 using recombinant vaccinia viruses (VV) in Cos7 cells harboring high copy numbers of a marker plasmid (Fig. 1). The methods described below outline (1) the generation of HPV type 33 (HPV 33) pseudovirions bearing a green fluorescent pro-

466

Sapp and Selinka

Fig. 1. Important steps in pseudovirus production.

tein coding sequence, (2) their purification and analysis, (3) standard infection assays, and (4) neutralization and inhibition assays performed with these pseudovirions.

3.1. Transfer Plasmids for Generation of L1 and L2 Recombinant Vaccinia Viruses As a result of its size, the generation of recombinant VV can be achieved only by homologous recombination. This requires the use of transfer vectors carrying the target genes surrounded by vaccinia virus sequences. The construction of the transfer plasmids for L1 and L2 of HPV 33 is described here as an example. This includes (a) the description of the transfer vector pTM1, (b) the amplification of the L1 and L2 genes by PCR and their cloning into pTM1, as well as (c) the in vitro transcription/translation to control for the functionality of the expression cassette.

3.1.1. pTM1 Transfer Plasmid The pTM1 transfer vector is a pUC-based plasmid (12,17). The vector contains the vaccinia virus thymidine kinase coding sequence, whose open reading frame was destroyed by insertion of the bacteriophage T7 promoter and terminator, which enclose an encephalomyocarditis virus sequence (EMC) to allow cap-independent translation, and a multiple cloning site.

3.1.2. Amplification of the HPV-33 L1 and L2 Open Reading Frames Plasmid pHPV33 harbors the complete HPV-33 genome cloned via its singular BglII site (position 2796) into the BglII site of pBR322link (13). The open reading frame of HPV-33 L1 can be amplified by PCR with oligonucleotides ON-33L1-1-5' and ON-33L1-499S-3' using proofreading thermostable DNA polymerase. The resulting fragment can be cloned via the BspH1 and BamH1 sites (boldfaced letters) into the NcoI and BamH1 sites of pTM1 using standard molecular-biology techniques. The L2 gene can be amplified from

Generation of HPV Pseudovirions Using Vaccinia Virus

467

pHPV33 by PCR with ON-33L2-1-5' and ON-33L2-467S-3'. The resulting fragment can be cut with EcoRI and BamHI and cloned into the EcoRI and BamHI sites of pTM1. The L1 and L2 genes of the resulting plasmids pTM33L1 and pTM33L2 have to be sequenced to confirm the absence of mutations.

3.1.3. In Vitro Transcription/Translation Since the generation of recombinant vaccinia viruses is a time-consuming step, it is recommended to control the correctness of the expression cassette by combined in vitro transcription/translation using 35S-labeled methionine (see Note 1). This is done using the Promega T7 coupled reticulocyte lysate system. The analysis involves SDS-10% PAGE and exposure of the dried gel to a film overnight (see Note 2).

3.2. Generation of Recombinant Vaccinia Viruses This section describes (a) the purification of wild-type (wt) VV-DNA, (b) the infection of cells defective for thymidine kinase gene with temperature-sensitive helper virus, (c) cotransfection of cells with transfer vector and wtVV-DNA, (d) selection for recombinant vaccinia viruses using 5-bromo-2'deoxyuridine, and (e) plaque purification of recombinant viruses.

3.2.1. Preparation of Wild-Type Vaccinia Virus DNA 1. Ten 150-mm dishes of confluent HuTK–143 B cells are grown in DMEM supplemented with 10% FCS. After washing with 20 mL each of serum-free DMEM, plates are subsequently infected with wtVV in 5 mL of serum-free DMEM at a multiplicity of infection (MOI) of 0.1 at room temperature (RT) for 1 h under repeated agitation. Medium is replaced by supplemented DMEM and grown for 24 h at 37°C in a CO2 incubator. 2. Cells are washed with PBS and scraped off the plate in 1.5 mL of PBS. For the further treatment, two 1.5-mL aliquots are required. Additional tubes can be stored up to 2 y at –70°C. 3. To each 1.5-mL cell suspension add 30 µL Triton X-100 (10%), 1.5 µL β-mercaptoethanol, and 48 µL EDTA (250 mM, pH 8.0). Invert the tube three to six times slowly. 4. Centrifuge the cell lysate for 2.5 min at 3000g in a tabletop centrifuge. Transfer the supernatant into a new 1.5-mL reaction tube and spin for 10 min at 13,000g. Discard the supernatant and combine the pellets in 200 µL TE buffer (see Note 3). 5. Add 13.4 µL NaCl (3 M), 20 µL SDS (10%), 0.6 µL β-mercaptoethanol, and 3 µL proteinase K (10 mg/mL). Incubate overnight at 56°C. From now on, the large VV DNA is sensitive to shearing. Strictly avoid vortexing and always use widemouthed pipet tips. 6. Extract the solution twice with 400 µL of buffered phenol, followed by two extractions with chloroform/isoamylalcohol, and precipitate the VV-DNA with ice-cold ethanol.

468

Sapp and Selinka

7. Remove the DNA from the solution by winding around a glass dipstick (e.g., Pasteur pipet), wash it by dipping twice into 70% ethanol, and air dry. Resuspend the DNA in up to 300 µL TE and store at 4°C. Determine the DNA concentration.

3.2.2. In Vivo Recombination 1. Seed HuTK–143 B cells into six-well plates (4 × 105/well) and grow them overnight. Wash cells with DMEM and infect with temperature-sensitive vaccinia virus ts7-VV at an MOI of 0.1 for 1 h in a total volume of 1 mL. Replace virus with 2 mL supplemented DMEM and incubate for 2 h at 33°C in a CO2 incubator. Remove cells from the incubator and increase temperature to 39°C. 2. Add 1 µg each of transfer vector and wtVV-DNA to 125 µL of 2X HBS buffer. Slowly add 125 µL of 250 mM CaCl2 while mixing gently. 3. Incubate for 30 min at room temperature to form the precipitate. 4. Meanwhile, wash cells twice with 2 mL each of serum-free DMEM. 5. Slowly drop the precipitate onto the cell monolayer. 6. Replace the calcium precipitate after 1 h at room temperature with 2 mL of serumfree DMEM and incubate for 2 h at 39°C. Wash cells twice with DMEM (see Note 4), add 5 mL of supplemented DMEM, and grow cells for 48 h at 39°C to kill temperature-sensitive helper viruses.

3.2.3. Selection With BrdU In recombinant VV, the target genes replace the wt thymidine kinase. This can be used for elimination of thymidine kinase-positive wtVV due to their incorporation of 5-bromo-2'-deoxyuridine (BrdU). 1. Discard the cell-culture supernatant carefully and scrape cells in 900 µL of 10 mM HEPES (pH 7.2) off the plates. Lyse cells by two cycles of freezing and thawing. Add 100 µL of 10-fold-concentrated PBS. 2. Use the lysate to infect confluent HuTK–143 B cells in six-well plates. Incubate for 48 h at 37°C in the presence of 0.2 mg/mL BrdU. 3. Repeat steps 1 and 2 twice. Cell lysis induced by infection with recombinant VV should become obvious. 4. To control for the successful recombination, the unpurified lysates are tested for the presence of L1- or L2-containing recombinant VV by co-infection with the helper virus vTF7-3. Co-infect HuTK–143 B cells with 300 µL of the final lysate and vTF7-3 (MOI 1) for 1 h at room temperature and grow cells for 24 h. Scrape cells off the plates in PBS, wash once with PBS, and lyse cells in 100 µL of Laemmli sample buffer. Analyze 10 µL for the synthesis of L1 or L2 by Western blot.

3.2.4. Plaque Purification of Recombinant VV 1. Prepare 10-fold serial dilutions of the lysates (10–2 to 10–7) in PBS. Use these to infect HuTK–143 B cells grown in six-well plates.

Generation of HPV Pseudovirions Using Vaccinia Virus

469

2. Remove the VV-lysates and overlay cells with 0.625% agarose in DMEM supplemented with 10% FCS following standard protocols. 3. Check for the formation of plaques daily. 4. Pick plaques using a filtered pipet tip (ideally 1-mL tips) and dispense the agarose into 1 mL of DMEM. Incubate overnight at 4°C. 5. Amplify VV using HuTK–143 B cells grown in six-well plates. Repeat amplification until complete lysis of the monolayer is seen after a 24-h incubation. 6. Test individual recombinant VV for expression of L1 and L2 by co-infection with vTF7-3 as described above. 7. Positive VV can now be amplified in large scale and stored at –70°C.

3.2.5. Determination of Plaque-Forming Units For generation of pseudovirions, it is important to determine the number of plaque-forming units (PFU) of recombinant VV, which should be in the range of 5 × 107 to 1 × 109. 1. Prepare 10-fold serial dilutions of the lysates (10–3 to 10–8) in PBS. Use these to infect HuTK–143 B cells grown in 6-well plates and grow cells for 24 h. 2. Carefully wash cells with PBS and stain with crystal violet. 3. Count the number of plaques and multiply by the dilution factor to obtain the PFU/mL.

3.3. Production of HPV Type 33 L1L2 Pseudovirions The method outlined below is based on the use of 2 × 108 cells, corresponding to approx 40 150-mm dishes.

3.3.1. Construction of a GFP Marker Plasmid A reporter plasmid needs to fulfill the following requirements: firstly, its size should not exceed the size of the natural HPV genome, 8 kb. Smaller plasmids are encapsidated, suggesting the lack of a minimal size requirement (10). In contrast, plasmids larger than 8 kb are incorporated at low efficiency, if at all (18,19). Secondly, it should encode a marker that allows easy detection, like β-galactosidase, luciferase, or green fluorescent protein (GFP). A GFPencoding marker plasmid encapsidated by HPV pseudovirions allows identification of successfully infected cells by their green fluorescence. Thirdly, the plasmid should contain a simian virus 40 (SV40) origin of replication to allow T antigen-driven amplification. Normally, we use a dimeric GFP fused with a nuclear localization signal (pEGFPGFP-NLS). Expression of this fusion protein facilitates specific analysis of infection events by bright nuclear staining. This plasmid is based on pEGFP-C1 (Clontech). The GFP fragment of plasmid pEGFP-C1 was amplified by PCR using as forward primer ON-GFP-5', containing an EcoRI restriction site, and as reverse

470

Sapp and Selinka

primer ON-GFP-3', containing a BamHI restriction site adjacent to the nuclear location signal sequence of HPV-33 L1 (amino acid position 493–499). The PCR fragment was cut with EcoRI and BamHI, purified, sequenced, and cloned adjacent to the original GFP sequence into the EcoRI/BamHI-digested pEGFPC1 vector by standard molecular-biology techniques (14).

3.3.2. Electroporation of Cos7 Cells Generally, any method allowing efficient transfection of cells may be used. Due to transfection efficiency and cost considerations, we prefer to apply electroporation according to the following protocol. Both the quality of the purified plasmid DNA (see Note 5) and that of Cos7 cells (see Note 6) is critical for obtaining high levels of transfection. All subsequent steps should be performed on ice, if not stated otherwise. 1. For detachment, Cos7 monolayer cells are incubated with 3 mL of PBS/2.5 mM EDTA for 1 min at RT, followed by a 5- to 10-min incubation at 37°C after removal of PBS/EDTA. 2. Resuspend Cos7 cells at 5 × 106 cells/mL in HBS buffer. 3. Transfer 1 mL of cells into precooled electroporation chambers. 4. Add 12 µg of the GFP marker plasmid resuspended in HBS, PBS, or TE buffer. Alternatively, DNA and cells may be mixed prior to distribution into electroporation chambers. 5. Close electroporation chamber and mix carefully by inverting the chamber. 6. Electroporation conditions: 200–220 V, 333 µF, low Ohm, fast charge rate (see Note 7). 7. For optimal pulse recovery, cells should be kept on ice for at least 5 min. 8. Harvest cells with a Pasteur pipet and resuspend in complete culture medium. Plate cells into 150-mm dishes. 9. Transient GFP protein expression is monitored after 24–48 h incubation at 37°C in a CO2 incubator (see Note 8).

3.3.3. Infection of Transfected Cells With Recombinant Vaccinia Viruses Approximately 48 h after transfection (see Note 9), Cos7 cells are infected with recombinant VV encoding the HPV-33 L1 and HPV-33 L2 capsid proteins. Expression of these capsid proteins by recombinant vaccinia viruses requires simultaneous expression of the vTF7-3 vaccinia helper virus encoding the phage T7 RNA polymerase (see Note 10). 1. Remove culture supernatants of transfected cells. Rinse cells once with 25 mL of PBS or serum-free DMEM per plate. 2. Five mL of serum-free medium (DMEM) containing vac33L1, vac33L2, and vTF7-3 (each with an MOI of 1) is added to each plate (see Note 11). 3. Incubate for 1 h at room temperature with occasional moving of the plates. 4. Replace supernatant by DMEM/10% FCS and incubate for 40–48 h at 37°C.

Generation of HPV Pseudovirions Using Vaccinia Virus

471

3.4. Purification and Analysis of Pseudovirions At this stage, cells are mostly detached and can be easily harvested by simple pipetting. Although some cells may have already released pseudovirions into the culture supernatant, the bulk of DNA-containing pseudovirions is still found in cell nuclei. Therefore, supernatants may be discarded and DNA-containing pseudovirions in addition to empty virus-like particles can be prepared from nuclear lysates.

3.4.1. Preparation of Nuclear Lysates All steps are performed on ice. 1. Harvest vaccinia virus-infected cells by centrifugation (10 min, 300g). 2. Wash cells with PBS and resuspend in 10 mL of hypotonic Dounce buffer (see Note 12). 3. Disrupt cells in a tight-fitting Dounce homogenizer (40–50 strokes). 4. Sediment cell nuclei by centrifugation (10 min, 900g, 4°C). 5. Resuspend pellet in 10 mL of hypotonic Dounce buffer. 6. Disrupt cell nuclei by sonication (3 × 45 s, 100 W output). 7. Remove nuclear debris by centrifugation at 4°C (10 min, 9000g). 8. Save supernatant for further purification steps.

3.4.2. CsCl Density Gradient Purification Subsequently, pseudovirions are subjected to buoyant density gradient centrifugation. During this procedure, pseudovirions are not only separated from nuclear debris but also from the high content of DNA-free VLPs still present in these preparations (Fig. 2). 1. Transfer supernatants (Subheading 3.4.1.) to 15-mL conical tubes and add 0.4 g CsCl per mL solution to obtain a density of 1.29 g/cm3. This should be confirmed by determination of the refractory index, and, if required, density should be adjusted. 2. Incubate 60–90 min at RT (this step is required for complete destruction of contaminating vaccinia viruses by NP40). 3. Transfer solution to 5-mL polyallomer centrifugation tubes. 4. Ultracentrifugation: e.g., Beckman Vti65, 250,000g, 12°C, overnight (see Note 13). 5. Collect 0.25-mL fractions from the bottom of the centrifuge tubes.

3.4.3. Analysis of Pseudovirus-Containing Fractions The next step requires identification of fractions harboring pseudovirions. Determination of the fraction density by measuring the refractive index in a density refractometer allows separation of DNA-containing pseudovirus fractions (1.33 g/cm3) and fractions containing VLPs (1.29 g/cm3). This separation may be confirmed by Western-blot analysis (5 µL of each fraction) using a

472

Sapp and Selinka

Fig. 2. Analysis of a buoyant cesium chloride density gradient centrifugation. Nuclear extracts containing human papillomavirus (HPV)-33 pseudovirions were subjected to cesium chloride gradient centrifugation. Fractions 5 to 22 were analyzed for presence of L1 and L2 protein by Western blot (A), using monoclonal antibodies 33L17 (15) and 33L2-1 (16), and in infectivity assays (B). Positions of pseudovirions and DNA-free virus-like particles at densities of 1.33 g/cm3 and 1.29 g/cm3, respectively, are indicated.

HPV capsid protein L1-specific antibody. In addition, the presence of infectious particles is determined. A detailed description of pseudovirus infection assays is presented under Subheading 3.5. For purposes that require specific knowledge of particle-to-infectious-events ratio, the encapsidated marker plasmid may be quantified by the following procedure. 1. Dialyze 100 µL each of fractions with densities from 1.35 to 1.30 g/cm3 for at least 6 h against 5 L of PBS at 4°C. 2. Adjust the dialyzed solution to 10 mM MgCl2 and add a total of 10 U DNase I. Incubate for 1 h at 37°C. 3. Phenol/chloroform extract and ethanol precipitate DNA overnight at –20°C. 4. Resuspend the pellet in 15 µL of TE and transform E. coli by electroporation using, for example, ElectroMAX DH5α-E cells. 5. Use purified marker plasmid of known concentration (a total of 5 pg) as standard for determination of transformation efficiency. 6. Plate transformed cells onto LB plates containing kanamycin, grow overnight at 37°C, and count colonies. 7. The amount of encapsidated marker plasmid can be calculated from the ratio of colonies arising from transformation of cells with the probe of interest and the standard.

Generation of HPV Pseudovirions Using Vaccinia Virus

473

3.4.4. Further Purification of Pseudovirions by Sucrose Step Gradients Pseudovirions purified by CsCl gradient centrifugation may be directly used in pseudovirus infection assays (see Note 14). Dialysis of pseudovirus-containing fractions against PBS prior to the addition to cells is required if more than 10 µL per 250 µL of culture medium needs to be added (see Note 15). However, stability of dialyzed pseudoviruses is reduced, and they should therefore be stored in aliquots at –20°C. In addition to pseudovirions, significant amounts of only partially assembled L1 and L2 capsid proteins are still present in these CsCl fractions. These may interfere in some assays, e.g., analyses of pseudovirus interactions with the cell surface. For further purification, pseudovirus-containing CsCl fractions may be subjected to sucrose step gradient centrifugation (Fig. 3). For this purpose, pseudovirus-containing CsCl fractions are dialyzed against PBS or alternatively diluted 1:5 with PBS to reduce the salt concentration of the sample. A sucrose step gradient is prepared in a siliconized 12-mL polyallomer ultracentrifugation tube (e.g., Beckman SW40) by carefully pipetting 3 mL of 30% sucrose dissolved in PBS containing 50 µg/mL bovine serum albumin (BSA) on top of a 2-mL layer of 70% sucrose in PBS/BSA (see Note 16). The gradient is loaded with up to 6.5 mL of pseudovirus-containing fractions, placed into a SW40 rotor, and spun at 4°C for 4 h at 270,000g). Subsequently, the gradient is collected from the bottom in 0.5-mL aliquots and 5 µL each of fractions 1–6 are tested in infectivity assays (discussed later). Combine pseudovirus-containing fractions and store in aliquots at –20°C. One can expect to have a yield of approx 106 infectious units.

3.5. Pseudovirus Infection Assays Pseudovirions prepared by the methods described above can be used in various infection assays. This allows (1) the quantification of infectious events, (2) the determination of the neutralization capacity of antisera, (3) the study of drugs possibly interfering with HPV binding, internalization, and intracytoplasmic transport, and consequently (4) the analysis of the mechanisms underlying the HPV infection process. In contrast to PCR analysis, this approach allows determination of the exact number of infectious events.

3.5.1. Infection Assay 1. Cos7 cells are freshly seeded into 24-well plates (4 × 104 cells/well) (see Note 17). 2. Replace medium after cell attachment by 250 µL DMEM without FCS containing pseudovirions. The volume of pseudovirions is normally in the range of 0.5 µL–5 µL, and should preferably be titrated to yield 50–500 infectious units. 3. After 1 h at 4°C under constant agitation, the pseudovirions are replaced by 1 mL supplemented culture medium, and incubation is continued at 37°C for 72 h (see Note 18).

474

Sapp and Selinka

Fig. 3. Purification of pseudovirions by sucrose step gradient. (A) Pseudovirus containing fractions of cesium chloride gradients were combined, dialyzed, and subjected to sucrose step gradient centrifugation. Fractions were analyzed by silver staining (I), L1-specific Western blot (II), and marker gene-specific polymerase chain reaction without prior DNase I digestion (III). In this case, a pSVβgal marker plasmid had been packaged. (B) As a control, fractions containing DNA-free virus-like particles were analyzed in parallel. Although marker plasmid is detectable in most fractions of the gradients, it is present in pseudovirus-containing but not in virus-like particle-containing fractions.

Generation of HPV Pseudovirions Using Vaccinia Virus

475

Fig. 4. (A) Electron micrograph of human papillomavirus (HPV)-33 pseudovirions negatively stained with uranyl acetate. (B) Readout of a pseudoinfection assay. Infected cells are detectable by their bright green nuclear fluorescence. A merged photograph of phase-contrast and fluorescence microscopy is shown. 4. Infectious events are determined by counting cells with nuclear green fluorescence (Fig. 4).

3.5.2. Neutralization Assay Pseudovirions are suitable tools in HPV diagnosis and research for largescale characterization of virus-specific neutralizing antibodies, which arise during natural HPV infection or in immunized individuals. This neutralization can be achieved either by preincubation of pseudovirions with antisera (preattachment neutralization) or by addition of antisera after attachment of pseudovirions to cells (post-attachment neutralization) (20). 3.5.2.1. PRE-ATTACHMENT NEUTRALIZATION 1. Pseudovirions are preincubated for 1 h at 4°C with serial dilutions of antisera or purified antibodies in a total volume of 30 µL. 2. Subsequently, add 220 µL of supplemented DMEM and transfer the sample to freshly plated Cos7 cells, as outlined under Subheading 3.5.1. 3. Incubate for 72 h at 37°C in a CO2 incubator and determine infectious events.

476

Sapp and Selinka

3.5.2.2. POSTATTACHMENT NEUTRALIZATION 1. Allow pseudovirions to bind to Cos7 cells for 1 h at 4°C. 2. Remove unbound virions by washing with 500 µL of DMEM. 3. Add antisera diluted in 250 µL of supplemented DMEM and incubate for 1 h at 37°C. 4. Replace antisera by 1 mL of supplemented DMEM, continue incubation, and score infections as outlined above.

3.5.3. Pseudovirus Depletion Assay In addition, a pseudovirus depletion assay may be performed to determine the virus-binding capacities of nonneutralizing antibodies. Here, virus-specific antibodies are coupled to magnetic beads and subsequently incubated with pseudovirions. Antibodies recognizing surface-exposed epitopes will capture pseudovirions from the solution. 1. Load magnetic beads with antibodies of interest according to the protocol supplied by the manufacturer. Controls with unrelated antibodies and uncoupled magnetic beads should be run in parallel (see Note 19). 2. Extensively wash the beads to remove unbound antibodies, and add pseudovirions diluted in 250 µL of supplemented DMEM. 3. Incubate for at least 2 h at 4°C under constant agitation. 4. Remove magnetic beads and add supernatant to Cos7 cells. Proceed as outlined under Subheading 3.5.1.

3.5.4. Analysis of Virus–Cell Interactions Instead of antibodies, other reagents interfering with virus/cell interactions may also be used. Therefore, this assay can be applied for characterization of putative receptor molecules. For example, binding of HPV pseudovirions to cells is blocked in the presence of heparin, indicating that the primary attachment molecule is a heparan sulphate proteoglycan (20–23). In principle, this assay may thus be suitable for searching for drugs that interfere with HPV infection. Alternatively, cells may be treated with degrading or modifying enzymes—e.g., heparinases, proteases, lipases, or glycosidases—prior to pseudovirus binding, thus allowing a further characterization of the cell-surface molecules required for HPV binding and internalization.

3.5.5. Analysis of HPV Internalization Since HPV internalization is rather slow, taking many hours for completion, the use of drugs interfering with specific uptake pathways requires modification of the pseudovirus infection assay. These drugs are often cytotoxic and therefore cannot be applied to cells for an extended period of time. The use of time windows for the application of drugs circumvents this problem ([21,24]

Generation of HPV Pseudovirions Using Vaccinia Virus

477

Fig. 5. A pseudoinfection inhibition protocol. Infection is a slow process, taking up to 24 h. Significant inhibition of such slow internalization requires exposure to inhibitors for shorter time intervals. These are defined by use of virus-neutralizing antibodies. (A) Inhibitors are applied during a specific time window. Timing and length of exposure to drugs may be varied depending on the inhibitors used. Following removal of inhibitors, surface-exposed pseudovirions are neutralized by human papillomavirus (HPV)-specific antibodies. (B,C) Controls required for calculation of infectious events initiated during the time window (B) and for determination of cell viability after drug treatment (C). Dotted lines depict possible outcomes of such an experiment.

and Fig. 5). We suggest the following protocol to study internalization of HPV with pseudovirions. 1. Infect cells as described under Subheading 3.5.1. 2. After shifting cells to 37°C, drugs at various concentrations are added at different time points. 3. Drugs are removed usually after a 6-h incubation period by extensive washing with DMEM.

478

Sapp and Selinka

4. Supplemented DMEM containing an excess of neutralizing antibodies is added in order to prevent infection of still surface-exposed pseudovirions. 5. Incubation is continued for a total of 72 h and infectious events in the presence and absence of the studied drugs are scored (see Note 20).

4. Notes 1. Alternatively, constructs can be tested by transient expression in mammalian cells. To this end, subconfluent monolayer cells are infected with helper virus vTF7-3 at a MOI of 5 (see Subheading 3.2.1.). Cells are subsequently transfected by lipofection with 4 µg of the recombinant plasmids. Five to ten hours later, cells are harvested and processed for Western blot with capsid proteinspecific antibodies. 2. The L1 protein has an apparent molecular mass of 55 kDa, as determined by SDS-PAGE. The molecular mass of L2 protein, apparently 72 kDa, is considerably larger than the predicted 50.5 kDa. This seems to be an intrinsic property of L2 proteins from several papillomaviruses and is not due to post-translational modifications. 3. If problems arise due to loose pellets during removal of the supernatant, centrifuge the sample again at 3000g for 2 min. 4. During this step, calcium precipitates are removed. If you experience problems with detaching vaccinia virus-infected cells, replace the supernatant without further washing steps. 5. Purity of DNA is considered a critical parameter for efficient transfection, and even more critical when transfection is followed by subsequent packaging into virus-like particles. In our hands, purification by commercially available DNA purification kits resulted in efficient transfection but not reproducibly in the formation of pseudovirions. Best results were obtained by purifying the marker plasmid by two subsequent cesium chloride density purification steps. 6. The quality of Cos7 cells is very important, both for generation of pseudovirions and pseudoinfection. Virus yields and pseudoinfection can vary dramatically. Best results were obtained using cells with low passage numbers. We always use freshly thawed cell aliquots for expansion and subsequent electroporation. Never use cells grown longer than 4 wks for pseudoinfection. We made the observation that high-level expression of syndecans reduces infectivity. Although approx 10,000 marker plasmid-encapsidating particles are required for one infectious event, up to 106 infectious units can be generated. In addition to marker plasmid DNA, cellular DNA is being incorporated (1). 7. It may be advisable to test electroporation parameters for your Cos7 cell line. Slight differences may result in drastic changes in transfection efficiency and cell survival. If cell lines other than Cos7 are used, the parameters for electroporation have to be newly established for each cell line. 8. If cells have reached confluency at 24 h after transfection, it is recommended to split them 1:2. 9. Often, expression of GFP is obvious 24 h after transfection. However, we suggest waiting for 48 h, because amplification of the marker plasmid by SV40 T

Generation of HPV Pseudovirions Using Vaccinia Virus

10.

11. 12.

13. 14. 15.

16.

17.

18.

19. 20.

479

antigen is important to achieve high yields of pseudovirions; however, after 48 h, many transfected cells begin to die as a result of the T antigen-driven run offreplication. Of course, expression systems other than the VV system, which allow high-level expression of L1 and L2, can be used. However, due to the unusual codon usage and the presence of negative regulatory elements within the L1 and L2 coding sequences (25,26), codon-optimized (humanized) L1 and L2 genes have to be used for nonviral transient expression of capsid proteins (27,28), see Chapters 31 and 32. In our hands, we did not see significant differences in yields using MOIs between 0.1 and 2. This is probably due to the spread of the virus to neighboring cells. VV partially copurify with pseudovirions. It is therefore crucial to eliminate the VV, which interfere in pseudovirus infection assays. This is achieved by addition of the detergent NP40, which does not affect pseudovirions. NP40 is present throughout the purification, since extended incubation is required for complete destruction of VV. At this step, disrupted cells may be stored at –20°C for a month without any loss in pseudovirus recovery. Colder temperatures may result in precipitation of cesium chloride. At this stage, pseudovirions can be stored at 4°C for at least 1 y without significant loss of infectivity. We still recommend storage in aliquots at –20°C. Dialysis for 1 h is sufficient to remove 90% of the cesium chloride, which is good enough for use in pseudoinfection. At this stage, pseudovirions can be frozen in aliquots at –20°C. Avoid repeated freezing and thawing. Once thawed, the aliquots can be kept up to 1 mo at 4°C without significant loss in infectivity. Although sucrose gradient centrifugation significantly increases the purity of the pseudovirus preparation, this may result in considerable reduction in yield. The use of siliconized tubes is highly recommended. The presence of BSA in the gradient also reduces the loss but may be a disadvantage for some assays— e.g., direct coupling of particles to enzyme-linked immunosorbent assay (ELISA) plates. Binding of pseudovirions can also be performed at larger scale with detached cells. In this case, cells are resuspended at 2 × 105 cells/mL, pseudovirions are added, and the mixture is incubated in a head-over-head rotator for 1 h at 4°C. Under these conditions, binding is completed after 30 to 45 min. Cells are collected by centrifugation (300g), washed once with DMEM, resuspended in supplemented DMEM, and dispensed into 24-well plates (4 × 104 cells/well). In contrast with binding assays performed in suspension, saturation of binding is not achieved within 1 h. Therefore, we normally do not remove unbound virions. However, when kinetics of uptake are being studied, removal of unbound virions is an obligatory step. These controls are crucial, since virions may also attach nonspecifically to the beads. The infectious events occurring before the addition of drugs should also be determined in parallel assays by neutralizing antibodies, which are added at the onset of the chosen time window. This number has to be subtracted from the total num-

480

Sapp and Selinka ber of infections to allow the quantification of infections initiated within this time window. Comparison of the number of infections in the presence or absence of drugs is a direct measure for the inhibitory potential of these chemicals. To exclude that lack of infectivity is due to cytotoxic effects of the drugs, surfaceexposed pseudovirions are not neutralized in control reactions to determine the total infectability of drug-treated cells (Fig. 5).

Acknowledgments The authors thank B. Moss for providing reagents for the T7 polymerasebased vaccinia virus expression system and G. Orth for pHPV33. We are grateful to former and current members of the lab, especially F. Unckell, T. Giroglou, F. Schäfer, and L. Florin for their contributions in development and improvement of the system. This work was supported by grants to M. Sapp from Deutsche Forschungsgemeinschaft and Stiftung Rheinland-Pfalz für Innovation. References 1. Unckell, F., Streeck, R. E., and Sapp, M. (1997) Generation and neutralization of pseudovirions of human papillomavirus type 33. J. Virol. 71, 2934–2939. 2. Stauffer, Y., Raj, K., Masternak, K., and Beard, P. (1998) Infectious human papillomavirus type 18 pseudovirions. J. Mol. Biol. 283, 529–536. 3. Krauzewicz, N., Stokrova, J., Jenkins, C., Elliott, M., Higgins, C. F., and Griffin, B. E. (2000) Virus-like gene transfer into cells mediated by polyoma virus pseudocapsids. Gene Ther. 7, 2122–2131. 4. McMurray, H. R., Nguyen, D., Westbrook, T. F., and McAnce, D. J. (2001) Biology of human papillomaviruses. Int. J. Exp. Pathol. 82, 15–33. 5. Howley, P. M. (1996) In Fields Virology Vol. 2, (Fields, B. N., Knipe, D. M., Howley, P. M., et al., eds.), Lippincott-Raven Publishers, Philadelphia, pp. 2045–2076. 6. Touze, A. and Coursaget, P. (1998) In vitro gene transfer using human papillomavirus-like particles. Nucl. Acids Res. 26, 1317–1323. 7. Kawana, K., Yoshikawa, H., Taketani, Y., Yoshiike, K., and Kanda, T. (1998) In vitro construction of pseudovirions of human papillomavirus type 16: incorporation of plasmid DNA into reassembled L1/L2 capsids. J. Virol. 72, 10,298–10,300. 8. Müller, M., Gissmann, L., Cristiano, R. J., et al. (1995) Papillomavirus capsid binding and uptake by cells from different tissues and species. J. Virol. 69, 948–954. 9. Yeager, M. D., Aste-Amezaga, M., Brown, D. R., et al. (2000) Neutralization of human papillomavirus (HPV) pseudovirions: a novel and efficient approach to detect and characterize HPV neutralizing antibodies. Virology 278, 570–577. 10. Fligge, C., Schäfer, F., Selinka, H. C., Sapp, C., and Sapp, M. (2001) DNAinduced structural changes in the papillomavirus capsid. J. Virol. 75, 7727–7731. 11. Schäfer, F., Florin, L., and Sapp, M. (2002) DNA binding of L1 is required for human papillomavirus morphogenesis in vivo. Virology 295, 172–181.

Generation of HPV Pseudovirions Using Vaccinia Virus

481

12. Moss, B., Elroy-Stein, O., Mizukami, T., Alexander, W. A., and Fuerst, T. R. (1990) New mammalian expression vectors. Nature 348, 91–92. 13. Beaudenon, S., Kremsdorf, D., Croissant, O., Jablonska, S., Wain-Hobson, S., and Orth, G. (1986) A novel type of human papillomavirus associated with genital neoplasias. Nature 321, 246–249. 14. Giroglou, T., Sapp, M., Lane, C., et al. (2001) Immunological analyses of human papillomavirus capsids. Vaccine 19, 1783–1793. 15. Sapp, M., Kraus, U., Volpers, C., Snijders, P. J., Walboomers, J. M., and Streeck, R. E. (1994) Analysis of type-restricted and cross-reactive epitopes on virus-like particles of human papillomavirus type 33 and in infected tissues using monoclonal antibodies to the major capsid protein. J. Gen. Virol. 75, 3375–3383. 16. Volpers, C., Sapp, M., Snijders, P. J., Walboomers, J. M., and Streeck, R. E. (1995) Conformational and linear epitopes on virus-like particles of human papillomavirus type 33 identified by monoclonal antibodies to the minor capsid protein L2. J. Gen. Virol. 76, 2661–2667. 17. Fuerst, T. R., Niles, E. G., Studier, F. W., and Moss, B. (1986) Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83, 8122–8126. 18. Zhao, K. N., Sun, X. Y., Frazer, I. H., and Zhou, J. (1998) DNA packaging by L1 and L2 capsid proteins of bovine papillomavirus type 1. Virology 243, 482–491. 19. Buck, C. B., Pastrana, D. V., Lowy, D. R., and Schiller, J. T. (2004) Efficient intracellular assembl of papillomaviral vectors. J. Virol. 78, 751–757. 20. Selinka, H. C., Giroglou, T., Nowak, T., Christensen, N. D., and Sapp, M. (2003) Further evidence that papillomavirus particles exist in two distinct conformations. J. Virol. 77, 12,961–12,967. 21. Giroglou, T., Florin, L., Schäfer, F., Streeck, R. E., and Sapp, M. (2001) Human papillomavirus infection requires cell surface heparan sulfate. J. Virol. 75, 1565–1570. 22. Shafti-Keramat, S., Handisurya, A., Kriehuber, E., Meneguzzi, G., Slupetzky, K., and Kirnbauer, R. (2003) Different heparan sulfate proteoglycans serve as cellular receptors for human papillomaviruses. J. Virol. 77, 13,125–13,135. 23. Combita, A. L., Touze, A., Bousarghin, L., Sizaret, P. Y., Munoz, N., and Coursaget, P. (2001) Gene transfer using human papillomavirus pseudovirions varies according to virus genotype and requires cell surface heparan sulfate. FEMS Microbiol. Lett. 204, 183–188. 24. Selinka, H. C., Giroglou, T., and Sapp, M. (2002) Analysis of the infectious entry pathway of human papillomavirus type 33 pseudovirions. Virology 299, 279–287. 25. Wiklund, L., Sokolowski, M., Carlsson, A., Rush, M., and Schwartz, S. (2002) Inhibition of translation by UAUUUAU and UAUUUUUAU motifs of the AU-rich RNA instability element in the HPV-1 late 3' untranslated region. J. Biol. Chem. 277, 40,462–40,471. 26. Oberg, D., Collier, B., Zhao, X., and Schwartz, S. (2003) Mutational inactivation of two distinct negative RNA elements in the human papillomavirus type 16 L2 coding region induces production of high levels of L2 in human cells. J. Virol. 77, 11,674–11,684.

482

Sapp and Selinka

27. Zhou, J., Liu, W. J., Peng, S. W., Sun, X. Y., and Frazer, I. (1999) Papillomavirus capsid protein expression level depends on the match between codon usage and tRNA availability. J. Virol. 73, 4972–4982. 28. Leder, C., Kleinschmidt, J. A., Wiethe, C., and Müller, M. (2001) Enhancement of capsid gene expression: preparing the human papillomavirus type 16 major structural gene L1 for DNA vaccination purposes. J. Virol. 75, 9201–9209.

Index

483

Index 293T cells, 446 293TT cells, 446, 450 3' untranslated region (UTR), 291, 298, 300 3A cell line, see Trophoblasts A A431 cells, 16, 326 AAV, 397 BPV interaction, 398 epidemiology, 398 HPV effect on, 406 HPV interaction, 398 life-cycle, 403 Rep78, 398, 406 rep gene, 398 AAV effect on HPV life-cycle, analysis, 402 AAV virus stock, generation, 403, 404 EMSAs, 405, 406 HPV-31b virus stock, generation 404 raft culture, 402, 403, 406 transcription, 404 CAT assay, 404, 405 in vitro transcription, 405 AAV inhibition of HPV-induced transformation, 401 cell growth in soft agar, 402 focus formation assays, 401 transformed keratinocyte outgrowth assay, 401, 402 tumour growth in mice, 402 Abnormal mitoses, 46, 74 Actinic keratoses, 115 Adeno-associated virus, see AAV Adenovirus E1A, 363

Air–liquid interface, 131, 148, 182, 187, 197 Allografts, 204 Amplification of papillomavirus oncogene transcripts, see APOT Aneuploidization, 75 Antibody staining, 49, 79 Antigen retrieval, 49, 78, 88, 419–432, see also Immunodetection of proteins, in paraffin-embedded tissue sections Apoptosis, 419, 420 caspases, 420, 426 cell membrane shrinkage, 419 DNA fragmentation, 419 induction/inhibition by HPV proteins, 419 E2, 420, 424 E6, 420 E7, 420 membrane blebbing, 419 nuclear condensation, 419 Apoptosis, analysis, 421 caspase assays, 426, 427, 431 flow cytometry, 425, 426, 431 fluorescence microscopy, 421, 422 fluorometric TUNEL assays, 423, 424, 428 microinjection, 424, 425, 428, 429, 430 APOT, 75, 79–81 DNase digest, 80 E4 sequences, 80 hybridization, 80, 81 PCR amplification, 80 reverse transcription, 80, 82

483

484 oligo(dT)17-primer, 75, 80 results interpretation, 81, 82 RNA isolation and quality, 79, 81, 82 sequencing, 81 Athymic mice, see Nude mice B β-Galactosidase, 221, 233, 297–300, 311, 469 Baby mouse kidney primary cells, (BMK), 381, 382, 387, 389 Baby rat kidney primary cells (BRK), 381, 382, 387, 389 Baculovirus expression system, 341, 342, 343 Biomarkers, 41, 73, 75, 84–100 use in daily routine, 91, 93, 97, 98 Bird’s eye cells, 34 Bisulfite sequencing, 262, 265, 273 agarose-embedded bisulfite modification, 274 liquid bisulfite modification, 273, 274 PCR amplification, 275 primer design, 273 BLAST, 124 C Carcinogenesis, 73, 217, 218, 381 Carcinogens, 73, 218 Carcinoma, of the cervix, 15, 41, 42, 46, 47, 61, 75, 77, 101, 130, 136, 262, 363, 397, 398 HPV DNA, prevalence in cancer, 15, 61 CaSki, 16, 263 CAT reporter gene assays, 297–300, 311 Cdk2, 331 Cell cycle, 74, 93, 130 Cell lines, 158, see also Fibroblast feeder cells

Index from HPV genome transfection, 161–165 from tissue biopsy, 133, 134 harvesting from cervical carcinoma, 136, 137 harvesting from CIN, 135 Cervical cancer, see Carcinoma of the cervix Cervical dysplasia, see Dysplasia Cervical intraepithelial neoplasia, see CIN Cervical neoplasia, see CIN Cervical scrapes, see Cervical smears Cervical smears, 74, 101, 106, 317, 318 Chloramphenicol, 310, 311 Chloramphenicol acetyl transferase assays, see CAT assays Cholera toxin, 130, 143, 160, 173, 190 Chromosomal instability, 73, 75 CIN, 20, 86, 136, 262, see also LSIL and HSIL CIN1, 42, 85, 131 CIN2, 42, 85 CIN3, 42, 46, 77, 85 Grade, 42, 85 assessment, 41, 85, histological analysis, 41 HPV association, 16, 61, 317, 363, progression, 85, 318 CIN612, cell line, 132, 263, 404 Cis-responsive elements, HPV 188, 262, 264 Classification, of papillomaviruses, 2, 129, see also Types of papillomavirus genera definition, 11 species definition, 11 subtypes, definition, 11, 125 types, definition, 11, 125 variants, definition, 11, 125 Codon modification, see Codon optimization Codon optimization, 433–436,

Index assembled DNA fragment isolation, 441 cloning into vectors, 441, 442 full-length gene generation, 441 gene synthesis by PCR, 438 gene assembly, 439 oligodeoxynucleotides, 438, 442 L1, 446 ligase chain reaction, 439, 440 oligodeoxynucleotides, 439, 442 phosphorylation of ODN, 439 synthetic gene design, 436, 441, 442 Kazusa codon usage database, 436 Kozak sequence, 437 restriction site introduction, 437 Collagen, 144, 148, 166, 167, 181, 182, 187, 196, 197, 242 Columnar epithelium, 262 Common warts, 33 Cottontail Rabbit Papillomavirus, see CRPV CRPV 37, 207, 217–220 CRPV DNA introduction into rabbits, 221, 232, 233 Gold particle preparation, 222, 223 intracutaneous inoculation, 224, 233 CRPV model system, anaesthesia, 233 latency, 219, 230 malignant progression experiments, 231, 232 rabbit care, 231 CRPV virus infection of rabbits, 225, 233 clinical effects, 226 data collection, 226 clinical outcomes, 226, 227. 228 statistical analyses, 226, 227, 228 intervention experiments, 230 cell-mediated immunity, 231 neutralizing antibody assay, 231 stringency, 230 systemic vs local effects, 230

485 mutagenesis studies, 228 considerations, 229 construction of mutant genomes, 228 inoculation of mutant DNA, 229 Cutaneous HPV, associated lesions 3, 27, 28, 115 Cyclin E, 331 Cystic papilloma, see Epidermoid cyst Cytological smears, see Cervical smears Cytopathic effect (CPE), 27, 33–38 Cytopathogenic effect, see Cytopathic effect D dam methylation, 350, see also Dpn I resistance DEPC treatment, 175, 311 Degradation assays, E6-induced, 411 expression plasmids, 415 immunoprecipitation, 414, 417 in vitro degradation, 412, 413, 414, 416, 417 in vitro translation, 412, 416 plasmid DNA preparation, 415 plasmid DNA storage, 415 protein radiolabeling, 414, 416 transcription/translation kits, 414 Dermal equivalent, see Rafts Detection of papillomaviruses, 62 DNA, 49, 101, 115 gene expression, 61 proteins, 49 Differentiation, 130–132, 157, 185, 188, 198, 217, 261, 279, 280, 289 cellular, 34, 86, 129, 141, 147, 148, 154 187 HPV life-cycle dependency, 158, 171 in methylcellulose, 167–169 in rafts, 161, 166, 167, 182, 185, 188, 195, 197, 199, 280

486 Dlg, 412 DNA polymerase, 331 DNA replication, see Replication DNase I protection assay, 262, 265, 268 DNA fragment labeling, 269, 276 DNase I footprinting reaction, 269 marker A+G sample preparation, 269, 272, 276 Dpn I resistance, 253, 335, see also dam methylation Dysplasia, 42, 74, 75, 91, 187 Dysplastic lesions, see Dysplasia E E1, 331, 339, 340, 349, 350 E1 ORF, 75 E2, 51, 253, 331, 339, 340, 349, 350 E2F, 74 E2 ORF, 75 E4 protein, 37, 51 E5, 142, 381, 382 E5 ORF, 318 E6, 73, 75, 129, 263, 381, 382, 411, see also Degradation assays, E6induced, E7, 42, 51, 73, 74, 75, 129, 142, 263, 381, 382, see also pRb, association with E7 Eccrine duct, 36 Ectocervix, 45, 262 EGF, see Epidermal growth factor EIA, see Enzyme immuno-assay Electrophoretic mobility shift assays, see EMSAs Electroporation, 178, 185, 188, 194, 336, 337, 346, 470, 472, 478 ELISA, 42 EMSAs, 262, 265, 272, 292, 306, 312 competition assays, 265, 306 gel electrophoresis, 272, 273 oligonucleotide labelling, 272 protein/DNA complex assembly, 272, 276 supershift, 265, 304, 307, 312

Index Encapsidation, HPV, 247, 248 Endocervix, 262 Enhancers, core enhancer, 264, 265 epithelial specific, 264, 265 Enzyme immunoassay (EIA), 102 β-globin PCR, 106 biotinylated DNA, capturing 108, 109, 113 crude extract preparation, 106, 107, 112, 113 DNA denaturation, 109, 113 GP5+/GP6+ PCR, 107, 108, 113 hybrid detection, 109, 110, 113 probe hybridization, 109 results interpretation, 109 Eosin, 28, 31–33, 41, 44, 47, see also Hematoxylin and eosin (H&E) staining Epidermal growth factor, 130, 143, 160, 167, 173, 190, 198, 381, 382 Epidermal ridges, 31 Epidermal stem cells, 30, 36 Epidermodysplasia verruciformis, see EV Epidermoid cysts, 34–37 Epigenetic regulation, of transcription, 261, 262, 265 Episomal HPV genomes, 131, 132, 154, 157, 158, 164, 171, 178, 180, 185, 253, 258, 279 Episomal maintenance, 171 Epithelial specificity, see Tissue tropism Epithelium, see Columnar epithelium and Squamous epithelium EV, 115 EV HPV detection and typing broad spectrum PCR, 115, 116 colony PCR, 124, 126 DNA cloning, 123 DNA sequence analysis, 123–126 hair sampling, 119, 125 isolation of DNA

Index from hair, 119, 120, 125 from punch biopsy, 119, 120, 126 multiple HPV types, 123, 124 PCR analysis, A-Myb PCR, 121, 122, 126 EV-HPV PCR, 115, 116, 121, 126 Enzyme-linked immunosorbent assay, see ELISA F Feeder cells, see Fibroblast feeder cells Fibroblast feeder cells, see also Rafts 3T3 J2 132, 137, 172, 239 culture, 133, 162, 163, 176, 185 freezing, 163 irradiation, 133, 130 mitomycin C treatment, 133, 176, 178, 185 human foreskin fibroblasts, 148 M1 3T3, 142 culture, 145 NIH3T3, 189, 196, 199 Fibroblast, 3T3A31, 386, 382 Fibroblast, NIH3T3, 189, 199, 364, 366, 372, 382 Firefly luciferase, 297, 298 FISH, see Fluorescence in situ hybridization Flat warts, 33 Fluorescence in situ hybridization, 53 detection and visualization, 54 DIG labelled probes synthesis, 53 in situ hybridization, 54 protein–DNA double detection, 55, 58 Footprinting, see DNAse I protection assay G Gel shifts, see Electrophoretic mobility shift assays Gene gun, see Helium-driven delivery device. Gene expression, differentiationdependent, 172

487 Genome amplification, 157, 158, 171, 172, 185 Genome of HPV, 261, 464 GFP, 421, 427, 434, 447, 469 fused to NLS, 469 H HaCat cells, 175, 183, 263 Hair bulb, 119, 125 Hair follicles, 36 Hematoxylin, 41, 28, 31–33, 41–44, 53, 79, 198, see also Hematoxylin and eosin (H&E) staining Hematoxylin and eosin (H&E) staining, 27, 31–33, 41, 42, 43, 47, 88, 91, 198 Heparan sulphate, 476 HeLa, 81, 263, 298, 326, 345 H2B-GFP cell line, 424, 429 Helium-driven delivery device, 221 High grade squamous intraepithelial lesion (HGSIL), 42, see also CIN High-risk HPV (HR-HPV), 15, 42, 61, 73, 74, 91, 101, 129, 142, 171, 188, 205, 217, 219, 317, 363, 381, 382, 411 Histochemical analysis, 27 Histochemistry, cutaneous lesions, 27 dehydration, clearing, and infiltration, 31 deparaffinization, 33 embedding, 31, 36 fixation, 30, 36 histopathological examination, 33 lesion selection, 30 rehydration, 33 sectioning, 31, 36 specimen sampling, 30 staining, see Hematoxylin and eosin (H&E) staining Histological sections, 74, 77 Histology, 41, 198 Histone, 262

488 acetylation, 265 deacetylation, 265 HPV1, 33–38 HPV2, 33 HPV3, 33, 34 HPV4, 35, 37, 38 HPV5a, 122 HPV6, 65, 66, 109 HPV8, 122 HPV11, 65, 109, 332 HPV15, 122 HPV16, 16, 38, 42, 61, 62, 65, 109, 132, 142, 147, 237, 239, 249, 262, 263, 274, 318, 350, 363 HPV17, 122 HPV18, 61, 65, 66, 109, 142, 263, 332 HPV20, 122 HPV24, 122 HPV26, 109 HPV31, 61, 65, 66, 109, 132, 142, 237, 249 HPV33, 61, 65, 66, 109, 132 HPV34, 109 HPV35, 61, 65, 109 HPV36, 122 HPV38, 122 HPV39, 61, 65, 66, 109 HPV40, 109 HPV42, 109 HPV43, 109 HPV44, 109 HPV45, 61, 65, 109 HPV51, 61, 65, 109 HPV52, 61, 109 HPV53, 109 HPV54, 61 HPV55, 109 HPV56, 61, 65, 109 HPV57, 109 HPV58, 61, 65, 109 HPV59, 61, 65, 109 HPV60, 34, 35, 38 HPV61, 109 HPV63, 34–36, 38

Index HPV65, 34, 35, 37, 38 HPV66, 61, 65, 66, 109 HPV68, 61, 65, 109 HPV70, 61, 109 HPV71, 109 HPV72, 61, 109 HPV73, 109 HPV81, 109 HPV82, 109 HPV83, 109 HPV84, 109 HPVcand, 12. HPV infectivity, in vitro assay, 183, 184 RNA isolation, 183 CDNA synthesis, 183 PCR amplification, 183 Human leukocyte antigen B7 gene, 20. Hybrid Capture 2 method, 101 Hyperchromasia, 46, 47 I ICTV, 11 Immortalization, 130, 142, 381, 382 Immortalized cells, 141, 142, 183, 187, 188, 197, 199, 364, 372 Immunodetection of proteins, in paraffin-embedded tissue sections, 51, 54 antigen retrieval, 52, 56, 57 microwave treatment, 52, 57 pressure cooking, 52 proteolytic treatment, 52, 57 immunodetection, 52, 57 tissue section preparation, 51, 56 visualization, 53 enzyme substrate detection, 53 immunofluorescence, 53 Immunoquantitation, 88, 93, 94 evaluation of immunopositivity, 89 evaluation of MIB-1-positive cell cluster criterion, 89, 94, 95, 96 Ki67 immunoquantitation, 89 QPRODIT, 88

Index staining, 88 syntactic structure analysis, 89–91 Immunostaining, see Immunodetection of proteins Inapparent lesions, 115 Inclusion warts, 33, 34 Infectious cycle, see Life cycle INK4a, see p16INK4a In situ hybridization, 49, 54, 198, 263, see also Fluorescence in situ hybridization Integrated HPV genomes, 73, 75, 77, 81, 82, 185, 279, 336 E1, E2 ORF disruption, 75 early poly A deletion, 75 fragile sites, 75 Integration, 130, 132, 318 Integration state, 61 International Committee on Taxonomy of Viruses, see ICTV Intracytoplasmic inclusion granules, see ICB ICB, 33, 38 eosinophilic granules, see Gr-ICB FI-ICB, 34–36 filamentous type ICB, see FI-ICB Gr-ICB, 33–35, 37 Hg-ICB, 34, 35, 37, 38 homogenous type ICB, see Hg-ICB K Keratin cytoskeleton, 38 Keratinocyte culture, 176, 185 HPV-containing keratinocytes, 176 primary HFKs, 176 Keratohyaline granules, 33 KG cell line, 132 Ki67, 86, 93 Koilocytes, 45 L L1 ORF, 2, 62, 102, 121, 291, 298, 433, 436 L1, 51

489 L1 protein, 434, 446, 463, 478 L2 protein, 51, 434, 446, 463, 478 L2 genes, 433 L2, ORF, 291, L2, 51 Latent infection, 219 LCR, see URR Lentivirus, 188, 193 Life cycle, HPV 49, 129, 130, 141, 142, 157, 158, 171, 205, 217, 237, 239, 247, 262, 280, 318, 433 Long control region, see URR Low grade squamous intraepithelial lesion (LGSIL), 42, 46, see also, CIN Low-risk HPV, 102, 129, 142, 205, 317, 382 Luciferase, 297, 469 Luciferase assays, 297, 298 M Malignant progression, 15, 75, 75, 129, 217, 218 Methylation, of DNA 253, 261, 262, 265, 273, 335, 350, Methylcellulose, 157, 158, 167, 168, 280 Medium–air interface, see Air–liquid interface Minimum spanning tree (MST), 91 Mitogenesis, 382 Molecular markers of cancer, see Biomarkers Moloney Murine Leukemia Virus, MoMLV, 192 mRNA quantitation, 280 mRNA stability, 266, 434, 435 mRNA nuclear export, 434 Mucosal genital HPV, 317 Mutagenesis, 218, 302, 311, 434, 441 Myrmecia, 33–35 N NCBI database, 124

490 Necrosis, 419 Negative regulatory elements, see NREs Nested PCR, 6, 7, 10, 75, 80, 115, 116, 121, 184 Nested RT-PCR, 318 electrophoresis of PCR products, 324 primer design, 321, 325 PCR, 322, 326, 327 reverse transcription, 322, 326, RNA isolation, 325 sample, collection and preparation, 321 Neoplastic lesions, 130 Neutralizing antibody, 447, 463 NHKs, 158, differentiation in harvesting, 168 methylcellulose, 167, 168 raft culture, 166, 167 fibroblast contamination removal, 162, 165 freezing, 162, 165 isolation from neonatal foreskin, 161 maintenance in monolayer, 161, 162 passaging, 164 RNA isolation, 166, 168 transfection, 162, 164, 168 G418 selection, 164, 168 HPV genome preparation, 163 viral DNA isolation, 165, 168 NIKS cell line, 141, 142, 153 NIKS cell culture, see also Fibroblast feeder cells and Rafts keratinocyte passaging, 146, 153, 154 NIKS transfection, 146 DNA preparation, 146, 147 G418 selection, 147, 148, 154 transfection into NIKs, 147, 154 Nonmelanoma skin cancer, 115 Non-oncogenic HPV, see Low risk HPV Normal human keratinocytes, see NHKs

Index Northern blot analysis, 254, 255, 285, 286 Novel HPV types, 1, 34, 116 definition, 2, 3 identification, 1 isolation, 1 cloning of amplicons, 7, 10, 11 deparaffinization, 6 DNA extraction, 5, 9 DNA integrity analysis, 8, 10 gel electrophoresis, 10 PCR, 6–11 sectioning, 9 sequence analysis, 8, 11 NREs, 291, 292, 300, 301, 302, 433, 434 binding protein purification, 292, 307, 309, 313 identification, 297 transfection, 298 mapping, 300, 301, 302 probe preparation, 303, 304, 311, 312 UV cross-linking, 304, 312 Nuclease mapping, S1/ExoVIII, 285, 286 Nucleosomes, 265 Nude mice, 137, 203, 204 O Oncogenes, HPV 73, 129, 381, see also E5, E6, and E7 Oncogenic HPV, see High-risk HPV Oncoproteins, HPV, 263, 411, see also E5, E6, and E7 Optiprep, 446, 449 Organotypic culture, see Raft culture ori, 331, 332, 349 Origin of replication, see ori Oryctolagus cuniculus, 219 P p107, 364

Index p130, 364 p16, see p16INK4a p16INK4a, 41, 73, 91 analysis as progression marker, 73, 74, 77 controls, 81 cytology, 79 histology, 78 staining and mounting, 79 tissue sectioning, 78 p53, 73, 142, 412 Papillomas, 218, 225–233, see also Warts Papillomavirus infection, see Life-cycle Paraffin-embedded, formalin fixed tissue, 6, 8, 49, 78 staining of, 49 Parakeratosis, 45 Pathophysiology, 237 PCNA, 331 PCR, see also APOT, Nested PCR, QPCR, and RT-PCR, 6–8, 18– 22, 43, 44, 47, 107, 108, 110, 121–125, 229, 250, 273, 300, 311, 373, 405, 438, 439, 466 PCR precautions, 112, 125, 126, 320 PHK, 187, 188, 189 Phylogeny, papillomavirus, 3, 16, 122 Pigmented warts, 34, 35 Placenta, 237 Plantar warts, 30, 33 Polyadenylation, 279, 291, 292, 303 Polycistronic transcripts, 279 Polymerase chain reaction, see PCR pRb, 73, 74, 93, 142, 364 pRb, association with E7, 363 degradation assay, 372–375, 377, 378 E7 protein production, 367, 369, 375 E7 recombinant retrovirus generation, 373, 377 GST-pull-downs, 366 GST-pRb production, 370, 376

491 Kd determination, 371, 372 plate-binding assay, 366, 367, 371, 376, 377 target cell infection, 374, 377 yeast two-hybrid, 366, 367 Precautions, for working with HPV, 153, 154, 214 Premalignant (cutaneous) lesions, 115 Prevalence, cutaneous HPV, 116 Primer extension analysis, 286 Primers, A-Myb1, 117 A-Myb2, 117 βglobin, forward, 43 βglobin reverse, 43 BGPCO3, 103 CP62, 117, 121 CP65, 4, 6, 7, 10, 117, 121 CP66, 4, 7, 10 CP69, 4, 7, 10, 117, 121 CP70, 4, 6, 7, 10, 117, 121 cutaneous HPV, type specific, 118 (dT)7-P3, 78, 80 E61A, 16, 21 E61B, 16, 21 E62A, 16, 21 E62B, 16, 21 FAP59/64, 4, 8, 11 GP5+/6+, 3, 4, 7, 42, 62, 102, 103, 104 HPV16E7 forward, 42 HPV16E7 reverse, 42 HPV16-P1, 78, 80 HPV16-P2, 78, 80 HPV18-P1, 78, 80 HPV18-P2, 78, 80 M13, reverse, 119 MY09/MY11, 3, 62 p3, 78 PGMY, 62, 102 SPF10, 102 T7, 119 Prognosis, 61

492 Prognostic markers, 318 Progression markers, see Biomarkers Promoters, in HPV activity, 264, 279 differentiation dependent, 188 early, 264 identification, 263, 264 late, 264 mapping, 285 p97, 264, 398, 401–405 Promoter identification, 263, 264 5' cDNA end determination, 264 primer extension, 264 RNase protection, 264 Proteosomal degradation, 411 Pseudogenome, 446 Pseudovirions, 248, 256 biosafety, 458 codon optimization, 435 infection assays, 473, 474, 475 interaction with cells, 476–479 internalization analysis, 476, 479 isolation from yeast, 255, 256, 258 PFU determination, 469 storage, 479 titering by FACS, 460 Pseudovirions, generation by transfection, 445 culture and transfection of 293TT cells, 449, 450 passaging 293TT cells, 450 thawing 293TT cells, 450 transfecting 293TT cells, 450 harvest and maturation, 451 cell collection, 451, 459 cell lysis and capsid maturation, 451, 459 salt extraction, 451 optiprep purification, 452, 459 fraction collection, 452 optiprep gradient preparation, 452 screening fractions, 452, 460 ultracentrifugation, 452 plasmids, 458

Index Pseudovirions, generation using vaccinia virus, 463, 464 in vitro transcription/translation, 467 PCR amplification of L1/L2 ORFs, 466 pseudovirion production, 469 electroporation, 470, 478 GFP marker plasmid construction, 469 vaccinia virus infection, 470 pseudovirion purification and analysis, 471 CsCl density gradient purification, 471 nuclear lysate preparation, 471, 479 pseudovirus-containing fraction analysis, 471, 472 sucrose step gradients, 473 recombinant vaccinia virus generation, 467 brdU selection, 468 in vivo recombination, 468, 478 plaque purification, 468, 469 wild-type DNA preparation, 467 transfer plasmid, 466 Pseudovirions, use in neutralization assays, 445–447, 453, 456, 461, 475 chemiluminescent detection of SEAP, 454, 455, 460 depletion assay, 476 postattachment neutralization, 476 preattachment neutralization, 475 titration of SEAP-PsV stocks, 453 Pseudoviruses, see pseudovirions Punctate warts, 34, 35 Pyknotic nuclei, 34, 86 Q QPCR, 42, 219, 286, 349, 350, 357–359 QPCR, for detection of HPV gene expression 61, 62

Index annealing temperature optimization, 65, 70 calibration, 67 analytical efficiency, 67 primer-dimers, 67, 70 clinical applications, 67, 68 housekeeping genes, 68, 70 reverse transcription, 68 RNA extraction, 67 TOMBOLA trial, 67 Ct (cycle threshold) values, 64 E2, 62, 64–66 E4, 62, 64–66 E6, 62, 64–66 melt-curve analysis, 62, 68 primers checkerboard experiment, 64 design, 63, 69 optimization, 63 reproducibility, 66 specificity, 65, 66, 67 SYBR Green dye, 62, 63, 69 variation, intra, inter-assay, 66, 70 Quantitative microscopy, 86 Quantitative PCR, see QPCR R Raft culture, 131, 141, 157, 158, 171, 187, 188, 247, 280, 397, 445, see also Fibroblast feeder cells AAV in, 398, 402–403, 406 brdU incorporation, 150 CIN612 differentiation in, 263, 404 collagen mix, see dermal equivalent preparation dermal equivalent preparation, 148, 166, 167, 181, 196–197, 199 harvesting, for histology, 150, 197, 198 for virus preparation, 151–154, 182, 183, 185 lifting rafts, 149, 182, 197, 199 NHK differentiation in, 166, 167 NIKS differentiation in, 148, 149

493 plating keratinocytes, 148, 149, 167, 182, 197, 242 retrovirus-transduced PHK differentiation in, 195–197 RAG mice, 207 Ras, 382, 402 Rb, see pRb Real-time PCR see QPCR Receptor, for HPV, analysis, 476 Recircularlized HPV genomes, 188 Refractive index, 471 Regression, 73, 218, 219, 228, 229, 230 Regulatory motifs, see NREs and Cisresponsive elements, HPV Renal capsule, 204 Renilla luciferase, 298 Replication protein A, see RPA Replication factor C, see RFC Replication, HPV, 157 trophoblast system, 237 yeast system, 247 Replication, HPV DNA, analysis, cell free assays, 331, 332, 339, 344, 345 expression plasmids, 340 mammalian cell lysate preparation, 343 protein expression, 341 protein purification, 342 transient transfection, 331, 332, 335, 349 low Mr DNA purification, 337, 353 mammalian cell preparation, 336 QPCR, 357–359, 361 restriction enzyme digest, 338, 354 Southern blot, 338, 339, 354–357 transfection, 336, 346, 352, 353 Restriction fragment length polymorphism see RFLP Rete ridge, 36 Retrovirus mediated gene transfer, 154, 187, 188, 381, see also Raft culture

494 Bosc23 cell culture, 193 cloning strategy, 192 ecotropic virus production, 193, 194, 198, 373, 374 PHK isolation from neonatal foreskins, 195 recombinant retrovirus production, 192, 193, 198 retrovirus infection, 195, 198, 199, 374 stable amphotropic producer cell production, 194, 195, 198, 377 vectors, 190, 191, 366, 373 Reverse line blot (RLB) genotyping, 102 chemiluminescent detection, 110, 111, 112 covalent coupling of oligonucleotide probes to the membrane, 110, 111, 113 hybridization with PCR produce, 110 stripping of membranes for reuse, 112, 113 Reverse transcriptase (RT)-polymerase chain reaction (PCR), see RTPCR Reversion, 218 RFC, 331 RFP, 421, 427 RFLP, 16 agarose gel electrophoresis, 20 checkerboard analysis, 23 clinical sample preparation, 18 cloning into pGEM, 22 DNA sequencing, 22 sequence analysis, 22 E5 variants, 16, 19 E5 PCR, 18, 19 E5 RFLP, 19 E6 variants, 16, 20 E6 PCR, 21. E6 RFLP, 21, 22 position 131, A(G variant, 20 housekeeping genes, 23

Index mixed infections, 20 polymerase chain reaction (PCR), 18 proteinase K treatment, 18, 23 restriction enzyme digests, 19, 21–23 Ribonuclease protection assay, 279–281 fragment separation and detection, 284, 285, 289, 290 hybridization, 284, 289 probe preparation, 282, 283, 287, 288 probe purification, 283, 288, 289 RNase digestion, 284 RNA isolation, 286 template preparation, 282 Ridged wart, 34 RNA, nuclear export. 291, 303 precautions, 311 stability, 291, 303 working with, 287 RPA, see Ribonuclease protection assay RPA (replication protein A), 331 RT-PCR, 184, 242, 243, 317, 318, 320, 325, 326 S Saccharomyces cerevisiae, 247 S. cerevisiae, HPV propagation in, 247 DNA replication assay, 253, 258 E2 function in replication and transcription, 253, 254 encapsidation analysis, 256, 259 HPV-genome constructs, 249 HPV-ORF expression vectors, 251 isolation of DNA from yeast, 251, 258 isolation of mRNA from yeast, 254, 255 pseudovirion isolation, 255, 256, 258, 259 trans-acting function, modelling, 253, 258 yeast nutritional markers, 249, 257 yeast strains, 251, 257

Index yeast transformation, 251, 257 SCID mice, 137, 203, 204, 205 SCID mouse model comfort and euthanasia of mice, 209 graft growth, 213, 214 graft infection, 210, 214 graft placement, 211 anaesthesia, 211 cutaneous, 212 sub-cutaneous, 211, 212 handling, of mice, 206 housing, of mice, 208 neonatal foreskin collection, 209, 213 strains, of mice, 206 tagging, 211, 214 virus preparation, 210, 214 SCID-NOD mice, 207 Screening programs, 61, 74, 101 SEAP, see Secreted alkaline phosphatase Secreted alkaline phosphatase, 447, 453–457 Semi-solid medium, see Methylcellulose Semliki forest virus, recombinant, 434, 446 Senescence, 142, 382 Shope papillomavirus, see CRPV Signal amplification systems, ABC reagents, 51, 55, 59 TSA fluorescence systems, 51, 56, 58, 59 SiHa, 16, 104, 263, 274, 326 Silencers, 264 Site-directed mutagenesis, see Mutagenesis Southern blotting, 1, 75, 178–181, 185, 242, 253, 256, 335, 336, 338– 350, 353–357, 359–361, 403, 404, 406 Species specificity, 129, 203, 217 Specificity, tissue, see Tropism, tissue Splice site locating, 280

495 Splicing, differential, 266, 279, 292, 303 Spontaneous abortions, 237 Squamous cell carcinoma, (SCC), 46, 218 Squamous epithelium, 45, 74, 89, 129, 131, 148, 171, 187, 217, 237, 241, 262, 279, 398 Squamous intra-epithelial precursor lesions (SIL), 130, see also CIN Staining, see Immunodetection of proteins Stem cells, epithelial, 27. Stratified squamous epithelium, see Squamous epithelium Sulci, 36 SV40 origin of replication, 446, 469 Sylvilagus floridanus, 219 T Therapeutics, 218, 219 Tissue tropism, see Tropism, tissue Topoisomerases, 331 Transcription, analysis of HPV, 279 Transcription factor binding site identification, 265 Transcription factors, 262 Transcription, quantitation, 285 Transcription regulation, analysis, 261, 262 Transcription termination, 266 Transcripts (HPV), 317, 318, see also APOT 5' end mapping, 280 detection by nested RT-PCR, 317 regulatory motifs analysis, 291 Transfection, 146, 147, 154, 162–164, 168, 229, 239, 240, 263–265, 288, 292, 298, 299, 311, 331, 336, 337, 345, 349, 352, 353, 373, 374, 385–390, 402, 427, 428, 433, 445, 449–451 Transformation, 73, 130, 318, 364, 381, 389, 398, 401

496 Transformation assays, 381, 382, 401, 402, see also AAV inhibition of HPV-induced transformation expression plasmids, 391 extraction and culture of primary epithelial cells, 382, 387, 392 large scale plasmid DNA preparation, 384, 385, 392 soft agar assays, 391 transfection of established rodent cells, 385–387, 392 transfection of primary epithelial cells, 389 verification of continued oncogene expression, 389, 391 Transformation zone, 45, 262 Translation, of viral transcripts 261, 433 Trophoblasts, 237 Trophoblasts, HPV life-cycle in, 239 antibody-neutralizing analysis, 242 endometrial cell-binding assay, 243 infectious center assay, 240 infectious virion production analysis, 241, 242 recircularlized DNA preparation, 239 spliced transcript analysis, 240, 243 transfection, 239, 243 Tropism, tissue, 27, 129, 261, 263 Types of papillomavirus, 1, 129, see also Classification of papillomaviruses α-papillomaviruses, 3 B1 subgroup, 115, 121 β-papillomaviruses, 3 definition, 11, 125 γ-papillomaviruses, 3 µ-papillomaviruses, 3 Typing, HPV 62, 101 cutaneous, 115

Index EV type, 123, 126 genotyping, 62 homology, 2 sequencing, HPV DNA, 62 using QPCR, 43, 48 U Upstream regulatory region, see URR URR, 188, 192, 262, 332, 349 V Vaccines, 218, 230, 231 Vaccinia virus, recombinant, see Pseudovirions, generation using vaccinia virus Vaginal intra-epithelial lesion grade 1 (VAIN1), 132 Viral load, 15, 42, 61, 62, 318 Variant (HPV), identification, 15, see also RFLP Virion morphogenesis, 172 Virus like particles, (VLPs), 446, 447, 450, 458, 459, 471 Voronoi diagram, 91 W–Y W12 cell line, 131 Warts, 129, 130, see also Papillomas ano-genital, 131 common, 33 cutaneous, 33, 131 HPV3-induced, 33 inclusion, 33, 34 laryngeal, 131 minimal, 32, plantar, 30 pigmented, 34 punctate, 34, 35 ridged, 34 Xenografts, 203, 204 Yeast, see Saccharomyces cerevisiae

M E T H O D S I N M O L E C U L A R M E D I C I N E TM Series Editor: John M. Walker

Human Papillomaviruses Methods and Protocols Edited by

Clare Davy and John Doorbar Division of Virology, The National Institute for Molecular Research, Mill Hill, London, UK

Human papillomaviruses (HPV) are an important class of pathogens responsible for a variety of diseases, including cervical cancer, the second most commonly found female cancer worldwide. In Human Papillomaviruses: Methods and Protocols, leading basic researchers and clinical scientists describe in detail a wide variety of established and cutting-edge techniques they have developed to study the lifecycle and biological properties of this formidable virus. The authors use these readily reproducible methods, ranging from PCR to propagation of HPV in vitro, to detect and type papillomavirus infections, study the papillomavirus lifecycle, and to produce and functionally analyze papillomavirus proteins. The protocols follow the successful Methods in Molecular Medicine™ series format, each offering step-by-step laboratory instructions, an introduction outlining the principles behind the technique, lists of the necessary equipment and reagents, and tips on troubleshooting and avoiding known pitfalls. Authoritative and highly practical, Human Papillomaviruses: Methods and Protocols offers both novice and experienced investigators a set of highly successful analytical tools for unlocking the secrets of the human papillomaviruses and their pathologies.

Features • Highly successful techniques for investigating the human papillomavirus • Hands-on protocols for producing and functionally analyzing papillomavirus proteins

• Readily reproducible methods for detecting and typing papillomavirus infections • Step-by-step instructions to ensure successful results

Contents Identification of New Papillomavirus Types. Identification of HPV Variants. Histochemical Analysis of Cutaneous HPV-Associated Lesions. Histological Analysis of Cervical Intraepithelial Neoplasia. Detection of Papillomavirus Proteins and DNA in Paraffin-Embedded Tissue Sections. Detection and Quantitation of HPV Gene Expression Using Real-Time PCR. Analysis of p16INK4a and Integrated HPV Genomes as Progression Markers. Use of Biomarkers in the Evaluation of CIN Grade and Progression of Early CIN. HPV DNA Detection and Typing in Cervical Scrapes. HPV DNA Detection and Typing in Inapparent Cutaneous Infections and Premalignant Lesions. Establishing HPV-Containing Keratinocyte Cell Lines From Tissue Biopsies. Using an Immortalized Cell Line to Study the HPV Life Cycle in Organotypic “Raft” Cultures. Differentiation of HPV-Containing Cells Using Organotypic “Raft” Culture or Methylcellulose. Propagation of Infectious, High-Risk HPV in Organotypic “Raft” Culture. Retrovirus-Mediated Gene Transfer to Analyze HPV Gene Regulation and Protein Functions in Organotypic “Raft” Cultures. The HPV Xenograft Severe Combined Immunodeficiency Mouse Model. The Cottontail Rabbit Papillomavirus Model of High-Risk HPV-Induced Disease. Studying the HPV Life

Methods in Molecular Medicine™ • 119 ISSN 1543–1894 Human Papillomaviruses: Methods and Protocols ISBN: 1-58829-373-4 E-ISBN: 1-59259-982-6 humanapress.com

Cycle in 3A Trophoblasts and Resulting Pathophysiology. Replication and Encapsidation of Papillomaviruses in Saccharomyces cerevisiae. Analysis of the Regulation of Viral Transcription. Analysis of HPV Transcription by RPA. Analysis of Regulatory Motifs Within HPV Transcripts. Detection of HPV Transcripts by Nested RT-PCR. Analysis of HPV DNA Replication Using Transient Transfection and Cell-Free Assays. Detection and Quantitation of HPV DNA Replication by Southern Blotting and Real-Time PCR. Analysis of E7/Rb Associations. Transformation Assays for HPV Oncoproteins. Analysis of Adeno-Associated Virus and HPV Interaction. In Vitro Assays of Substrate Degradation Induced by High-Risk HPV E6 Oncoproteins. Measuring the Induction or Inhibition of Apoptosis by HPV Proteins. Codon Optimization of Papillomavirus Genes. Generation of HPV Pseudovirions Using Transfection and Their Use in Neutralization Assays. Generation and Application of HPV Pseudovirions Using Vaccinia Virus. Index.