Generation and Effector Functions of Regulatory Lymphocytes (Novartis Foundation Symposia)

Novartis Foundation Symposium 252

GENERATION AND EFFECTOR FUNCTIONS OF REGULATORY LYMPHOCYTES

2003

GENERATION AND EFFECTOR FUNCTIONS OF REGULATORY LYMPHOCYTES

The Novartis Foundation is an international scienti¢c and educational charity (UK Registered Charity No. 313574). Known until September 1997 as the Ciba Foundation, it was established in 1947 by the CIBA company of Basle, which merged with Sandoz in 1996, to form Novartis. The Foundation operates independently in London under English trust law. It was formally opened on 22 June 1949. The Foundation promotes the study and general knowledge of science and in particular encourages international co-operation in scienti¢c research. To this end, it organizes internationally acclaimed meetings (typically eight symposia and allied open meetings and 15^20 discussion meetings each year) and publishes eight books per year featuring the presented papers and discussions from the symposia. Although primarily an operational rather than a grant-making foundation, it awards bursaries to young scientists to attend the symposia and afterwards work with one of the other participants. The Foundation’s headquarters at 41 Portland Place, London W1B 1BN, provide library facilities, open to graduates in science and allied disciplines. Media relations are fostered by regular press conferences and by articles prepared by the Foundation’s Science Writer in Residence. The Foundation o¡ers accommodation and meeting facilities to visiting scientists and their societies.

Information on all Foundation activities can be found at http://www.novartisfound.org.uk

Novartis Foundation Symposium 252

GENERATION AND EFFECTOR FUNCTIONS OF REGULATORY LYMPHOCYTES

2003

Copyright & Novartis Foundation 2003 Published in 2003 by John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester PO19 8SQ, UK National 01243 779777 International (+44) 1243 779777 e-mail (for orders and customer service enquiries): [email protected] Visit our Home Page on http:// www.wileyeurope.com or http://www.wiley.com All Rights Reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, scanning or otherwise, except under the terms of the Copyright, Designs and Patents Act 1988 or under the terms of a licence issued by the Copyright Licensing Agency Ltd, 90 Tottenham Court Road, London W1T 4LP, UK, without the permission in writing of the Publisher. Requests to the Publisher should be addressed to the Permissions Department, John Wiley & Sons Ltd,The Atrium, Southern Gate, Chichester,West Sussex PO19 8SQ, England, or emailed to [email protected], or faxed to (+44) 1243 770620. This publication is designed to provide accurate and authoritative information in regard to the subject matter covered. It is sold on the understanding that the Publisher is not engaged in rendering professional services. If professional advice or other expert assistance is required, the services of a competent professional should be sought. Other Wiley Editorial O⁄ces John Wiley & Sons Inc., 111 River Street, Hoboken, NJ 07030, USA Jossey-Bass, 989 Market Street, San Francisco, CA 94103-1741, USA Wiley-VCH Verlag GmbH, Boschstr. 12, D-69469 Weinheim, Germany John Wiley & Sons Australia Ltd, 33 Park Road, Milton, Queensland 4064, Australia John Wiley & Sons (Asia) Pte Ltd, 2 Clementi Loop #02-01, Jin Xing Distripark, Singapore 129809 John Wiley & Sons Canada Ltd, 22 Worcester Road, Etobicoke, Ontario, Canada M9W 1L1 Wiley also publishes its books in a variety of electronic formats. Some content that appears in print may not be available in electronic books. Novartis Foundation Symposium 252 x+315 pages, 42 ¢gures, 19 tables Library of Congress Cataloging-in-Publication Data Generation and e¡ector functions of regulatory lymphocytes / [editors, Gregory Bock and Jamie Goode]. p. cm. ^ (Novartis Foundation symposium ; 252) Includes bibliographical references and index. ISBN 0-470-85074-4 (alk. paper) 1. Lymphocytes. 2. Tcells. 3. Immune response ^Regulation. I. Bock, Gregory. II. Goode, Jamie. III. Series. QR185.8.L9G46 2003 571.9’6^dc22 2003057598 British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library ISBN 0 470 85074 4 Typeset in 101
2 on 121
2 pt Garamond by DobbieTypesetting Limited, Tavistock, Devon. Printed and bound in Great Britain by T. J. International Ltd, Padstow, Cornwall. This book is printed on acid-free paper responsibly manufactured from sustainable forestry, in which at least two trees are planted for each one used for paper production.

Contents Symposium on Generation and e¡ector functions of regulatory lymphocytes, held atthe Novartis Foundation, London, 9^11July 2002 Editors: Gregory Bock (Organizer) and Jamie Goode This symposium was based on a proposal made by Matthias von Herrath and Je¡rey Bluestone Jean-Francois Bach

Chair’s introduction 1

Shimon Sakaguchi, Shohei Hori,Yoshinori Fukui,Takehiko Sasazuki, Noriko Sakaguchi and Takeshi Takahashi Thymic generation and selection of CD25+CD4+ regulatory T cells: implications of their broad repertoire and high self-reactivity for the maintenance of immunological self-tolerance 6 Discussion 16 Ethan M. Shevach, Ciriaco A. Piccirillo, Angela M. Thornton and Rebecca S. McHugh Control of T cell activation by CD4+CD25+ suppressor T cells 24 Discussion 36 Adam P. Kohm, Pamela A. Carpentier and Stephen D. Miller Regulation of experimental autoimmune encephalomyelitis (EAE) by CD4+CD25+ regulatory T cells 45 Discussion 52 Elisa Boden, Qizhi Tang, Helene Bour-Jordan and Je¡reyA. Bluestone The role of CD28 and CTLA4 in the function and homeostasis of CD4+CD25+ regulatory T cells 55 Discussion 63 Clare Baecher-Allan, Julia A. Brown, Gordon J. Freeman and David A. Ha£er CD4+CD25+ regulatory cells from human peripheral blood express very high levels of CD25 ex vivo 67 Discussion 88 v

vi

CONTENTS

Fiona Powrie, Simon Read, Christian Mottet, Holm Uhlig and Kevin Maloy Control of immune pathology by regulatory T cells 92 Discussion 98 General discussion I TGFb 106 Maria Grazia Roncarolo, Silvia Gregori and Megan Levings Type 1 T regulatory cells and their relationship with CD4+CD25+ Tregulatory cells 115 Discussion 127 Leonard C. Harrison, Natasha R. Solly and Nathan R. Martinez speci¢c regulatory T cells 132 Discussion 141

(PRO)insulin-

Qing-Sheng Mi, Craig Meagher and Terry L. Delovitch CD1d-restricted NKT regulatory cells: functional genomic analyses provide new insights into the mechanisms of protection against Type 1 diabetes 146 Discussion 160 Eli Sercarz, Emanual Maverakis, Peter van den Elzen, Loui Madakamutil and Vipin Kumar Seven surprises in theTCR-centred regulation of immune responsiveness in an autoimmune system 165 Discussion 171 Kathryn J.Wood, Hidetake Ushigome, Mahzuz Karim, Andrew Bushell, Shohei Hori and Shimon Sakaguchi Regulatory cells in transplantation 177 Discussion 188 Kim J. Hasenkrug Discussion 199

CD4+ regulatory T cells in chronic viral infection 194

General discussion II

203

Marca H. M.Wauben, Esther N. M.’t Hoen and Leonie S.Taams Modulation of T cell responses after cross-talk between antigen presenting cells and T cells: a giveand-take relationship 211 Discussion 220 Jacques Banchereau, Joseph Fay,Virginia Pascual and A. Karolina Palucka Dendritic cells: controllers of the immune system and a new promise for immunotherapy 226 Discussion 235

vii

CONTENTS

Chrystelle Asseman and Matthias von Herrath autoimmune responses 239 Discussion 253 General discussion III

Regulation of viral and

Active immune regulation 257

MargaretJ. Dallman, Brian Champion andJonathan R. Lamb in the peripheral immune system 268 Discussion 276

Notch signalling

Lucienne Chatenoud CD3 antibody treatment stimulates the functional capability of regulatory T cells 279 Discussion 286 Allan McI Mowat, Anne M. Donachie, LucyA. Parker, Neil C. Robson, Helen Beacock-Sharp, Lindsay J. McIntyre, Owain Millington and Fernando Chirdo The role of dendritic cells in regulating mucosal immunity and tolerance 291 Discussion 302 Index of contributors Subject index

308

306

Participants Abul K. Abbas Department of Pathology, University of California San Francisco, Room M 590, 513 Parnassus Avenue, San Francisco, CA 94143, USA Chrystelle Asseman (Novartis Foundation Bursar) LaJolla Institute for Allergy and Immunology, 10355 Science Center Drive, San Diego, CA 92121, USA Jean-Francois Bach (Chair) Laboratoire d’Immunologie, Ho“pital Necker, 161 rue de Se' vres, 75743 Paris Cedex 15, France Jacques Banchereau Baylor Institute for Immunology Research, 3434 Live Oak, Suite 205, Dallas,TX 75204, USA Je¡rey Bluestone UCSF Diabetes Center, 513 Parnassus Ave Box 0540, San Francisco, CA 94143-0540, USA Lucienne Chatenoud Laboratoire d’Immunologie, Ho“pital Necker, 161 rue de Se' vres, F-75743 Paris Cedex 15, France Cristina Cuturi INSERM U437, CHU de Nantes, 30 solJ. Monnet, 44093, Nantes, France Margaret Dallman Department of Biology, Sir Alexander Fleming Building, Imperial College of Science,Technology and Medicine, South Kensington, London SW7 2AZ, UK Terry Delovitch TheJohn P. Robarts Research Institute, 1400 Western Road, London, Ontario, Canada N6G 2V4 Richard Flavell Department of Immunobiology,Yale University School of Medicine, HHMI, 310 Cedar Street, FMB412, Box 208011, New Haven, CT 06520-8011, USA David Ha£er Center for Neurologic Diseases, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, MA 02115, USA viii

ix

PARTICIPANTS

Leonard Harrison Autoimmunity and Transplantation Division,The Walter and Eliza Hall Institute of Medical Research,The Royal Melbourne Hospital PO, Parkville, 3050 Victoria, Australia Kim Hasenkrug Laboratory of Persistent Viral Diseases, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, Hamilton, MT 59840, USA Stephen Miller Immunobiology Center, Northwestern University School of Medicine, 303 E. Chicago Avenue, Chicago, IL 60611-3072, USA Av Mitchison Department of Immunology,Windeyer Institute of Medical Science, University College London Medical School, 46 Cleveland Street, London W1P 6DB, UK Allan Mowat Department of Immunology and Bacteriology,Western In¢rmary, Glasgow G11 6NT, UK Virginia Pascual Baylor Institute for Immunology Research, 3434 Live Oak, Suite 205, Dallas,TX 75204, USA Fiona Powrie University of Oxford, Sir William Dunn School of Pathology, South Parks Road, Oxford OX1 3RE, UK Maria Grazia Roncarolo San Ra¡aeleTelethon Institute for GeneTherapy (HSR-TIGET),Via Olgettina 58, I-20132 Milano, Italy Shimon Sakaguchi Department of Experimental Pathology, Institute for Frontier Medical Sciences, Kyoto University, 53 Shogoin Kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan Eli Sercarz The LaJolla Institute for Allergy and Immunology, 10355 Science Center Drive, San Diego, CA 92121, USA Ethan Shevach Cellular Immunology Section, NIAID Laboratory of Immunology, Building 10, Room 11N315, 10 Center Drive, MSC1892, Bethesda, MD 20892-1892, USA Matthias von Herrath Department of Immune Regulation, LaJolla Institute for Allergy and Immunology, 10355 Science Center Drive, San Diego, CA 92121, USA

x

PARTICIPANTS

MarcaWauben Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, PO Box 80.165, NL-3508 TD Utrecht, The Netherlands Christoph Walker Novartis Pharma UK, Novartis Horsham Research Centre, Wimblehurst Road, Horsham RH12 5AB, UK Kathryn Wood The Nu⁄eld Department of Surgery, University of Oxford, John Radcli¡e Hospital, Headley Way, Headington, Oxford OX3 9DU, UK

Chair’s introduction Jean-Franc ois Bach Laboratoire d’Immunologie, Ho“ pital Necker, 161 Rue de Se' vres, 75743 Paris, Cedex 15, France

The notion of T cell-mediated suppression/regulation is not new. In 1971, Richard Gershon published a classical paper describing the capacity of T cells from mice immunized by sheep red blood cells (SRBCs) to down-regulate the production of anti-SRBC antibodies in na|« ve recipients (Gershon & Kondo 1970). This so-called infectious tolerance opened the ¢eld of suppressor T cells which gave rise to an unusually abundant future in the following decade. It is not necessary to review here all the claims that were made in this period and all the problems that were then raised both at the experimental and the interpretational levels. In any event, these problems ineluctably led to the discredit of the whole ¢eld, which disappeared from the scene in the early 1980s. It was only a few years later that new experiments were performed and eventually published indicating that T cellmediated regulation was a real phenomenon, probably important in the control of the development of autoimmune and alloimmune responses. This resurrection relied on three sets of observations. The ¢rst one was undoubtedly the proposal by Mosmann & Co¡man (1989) of the Th1/Th2 paradigm. The demonstration that Th1 cytokine could down-regulate Th2 cell di¡erentiation and function, and reciprocally Th2 cytokines could down-regulate Th1 cells through a non-antigenspeci¢c cytokine-mediated mechanism provided a new explanation for the suppressor T cells which had been described 10 years earlier. Fifteen years later, the Th1/Th2 paradigm is still very vivid, even if its generality is not as apparent as it was initially thought. A second observation which proved to be crucial for the emergence of the suppressor cell concept was that of bystander suppression. Oral administration of an autoantigen can induce tolerance to that antigen. Surprisingly enough, this tolerance extends to antigens other than the tolerogen in as much as this antigen is expressed at the same site (organ or cell) as the tolerogen (Al Sabbagh et al 1994). Here again, cytokines were implicated in the phenomenon. It was assumed that the initial regulatory reaction produced by a tolerogen led to the local production of cytokines that show suppressive activity against immune responses directed at other antigens at the lesion site. The third set of observations dealt with the reappraisal of the thymectomy experiments performed in the late 1960s. It had been shown at that time that 1

2

BACH

thymectomy at day 2^5 induced polyautoimmune syndrome (Nishizuka & Sakakura 1969). It was shown in the early 1990s that such polyautoimmune syndrome could be prevented by the administration of CD4+CD25+ T cells (Asano et al 1996), excluding other explanations of the thymectomy induced autoimmunity (e.g. absence of selection in the thymus). One should lastly mention experiments performed in various laboratories including ours showing the presence in healthy mice of regulatory cells capable of preventing disease onset in various autoimmune models. We indeed showed in non-obese diabetic (NOD) mice that CD4+ T cells from pre-diabetic NOD could prevent the transfer of diabetes a¡orded by diabetogenic T cells (derived from diabetic NODs) when injected into immunoincompetent recipients (Boitard et al 1989). Still unanswered questions If there is a general although not absolute consensus about the existence of regulatory T cells today, many questions remain unanswered. CD4+ T cells may be regulatory. How many distinct T cell subsets comprise the CD4+ regulatory T cells? The study of phenotypes is helpful, looking either at membrane markers or at cytokine production, pro¢le and dependency. It must be admitted, however, that study of phenotypes and cytokine production has not yielded convergent results. As far as markers are concerned, CD25 is probably the most reliable marker, although CD45RB (Powrie et al 1993) and CD62L (Herbelin et al 1998) are also useful and do not de¢ne exactly the same cells. Maybe other markers such as CTLA4 and glucocorticoid-induced tumour necrosis factor (TNF) receptor GITR (Zelenika et al 2002, McHugh et al 2002, Shimizu et al 2002) will prove useful, perhaps in a complementary fashion to CD25 and CD62L. The mode of action of regulatory T cells is very uncertain, and probably variable from one subset to another. Cytokines are logical candidates. They probably play a central role for Th2 cells and Treg1 cells (Groux et al 1997). Their role for CD25+ T cells is more dubious, although a number of data have recently incriminated transforming growth factor (TGF)b (Nakamura et al 2001). A special role could be played by interleukin (IL)10, at least in certain models, such as colitis. It could be of crucial importance to determine the respective role of cytokines for the various T cell subsets, both in terms of their mode of action but also of their growth and di¡erentiation. Antigen speci¢city is a very open question, except of course for Th2 cells and Treg1 cells, the de¢nition of which is based on stimulation by antigen. More work is needed to determine the speci¢city of CD25+ T cells. Do CD25+ T cells act in a speci¢c fashion particularly with regard to organ-speci¢c antigens? Can the antigen-speci¢c CD25+ T cells recently described in allograft and tumour

CHAIR’S INTRODUCTION

3

immunity be assimilated to the CD25+ T cells controlling the expression of physiological autoimmunity? Candidate regulatory T cells may be used with bene¢t for immunotherapy Soluble autoantigens and altered peptide ligands apparently act by stimulating Th2 cells (Bach & Chatenoud 2001). CD3 antibody appears to act by stimulating CD25+ T cells and, more precisely, by enhancing TGFb production by such cells (Chatenoud 2003, this volume). a galactosyl ceramide acts by stimulating NKT cells and has been shown to protect from diabetes onset in NOD mice (Sharif et al 2001, Hong et al 2001). It would be important to search for other methods leading to the stimulation of the various regulatory T cell subsets and to analyse the feasibility of their clinical applications. Conclusions: working hypothesis More than 10 types of regulatory T cells have been described so far (Table 1). One may assume that some of these T cell types represent the variable expression of a single T cell lineage, although this has not been proven. Theoretically one may believe that totally di¡erent lines of suppressor T cells exist. If this is the case, it would be important to determine the conditions of their di¡erentiation. At ¢rst glance, one is tempted to separate cells which appear spontaneously in ontogeny without deliberate intervention, such as CD25+ T cells or NKT cells. It is interesting to note that depletion of these cells or genetic prevention of their appearance leads to an increase of autoimmune disease in mice genetically prone to develop the disease. Thus, depletion of CD25+ T cells in NOD mice accelerates diabetes onset and absence of NKT cells as a¡orded by genetic invalidation of CD1d (Wang et al 2001) leads to accelerated diabetes onset in TABLE 1

Classi¢cation of regulatory cells

Natural/innate

Adaptive

CD25+ T cells NKT cells NK cells g/d T cells Veto cells

Th1 cells Th2 cells Tr1 cells CD45RBlow T cells CD8+ T cells Anti-idiotypic T cells

4

BACH

NOD mice. On the other hand, as mentioned above, Th2 cells, Treg1 cells and maybe g/d CD8+ T cells (Harrison et al 1996) appear after administration of antigens either as immunogens as in the case of experimentally induced autoimmune disease, or as tolerogens as is the case when tolerance is induced in spontaneously autoimmune mice by administration of soluble autoantigens. This distinction is reminiscent of the opposition classically made between innate and adaptive immunity. The word innate in the context of immunoregulation may be misleading since it is usually reserved to TCR-mediated immunity. Maybe it would be more adequate to use the word ‘natural’ which relates to the appearance of the cells in question independently of any contact with foreignness. References Al Sabbagh A, Miller A, Santos LM, Weiner HL 1994 Antigen-driven tissue-speci¢c suppression following oral tolerance: orally administered myelin basic protein suppresses proteolipid protein-induced experimental autoimmune encephalomyelitis in the SJL mouse. Eur J Immunol 24:2104^2109 Asano M, Toda M, Sakaguchi N, Sakaguchi S 1996 Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387^396 Bach JF, Chatenoud L 2001 Tolerance to islet autoantigens and type I diabetes. Annu Rev Immunol 19:131^161 Boitard C, Yasunami R, Dardenne M, Bach JF 1989 T cell-mediated inhibition of the transfer of autoimmune diabetes in NOD mice. J Exp Med 169:1669^1680 Chatenoud L 2003 CD3 antibody treatment stimulates the functional capability of regulatory T cells. In: Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Found Symp 252) p 279^290 Gershon RK, Kondo K 1970 Cell interactions in the induction of tolerance: the role of thymic lymphocytes. Immunology 18:723^737 Groux H, O’Garra A, Bigler M et al 1997 A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Harrison LC, Dempsey-Collier M, Kramer DR, Takahashi K 1996 Aerosol insulin induces regulatory CD8 gamma delta T cells that prevent murine insulin-dependent diabetes. J Exp Med 184:2167^2174 Herbelin A, Gombert JM, Lepault F, Bach JF, Chatenoud L 1998 Mature mainstream TCR ab+CD4+ thymocytes expressing L-selectin mediate ‘active tolerance’ in the nonobese diabetic mouse. J Immunol 161:2620^2628 Hong S, Wilson MT, Serizawa I et al 2001 The natural killer T-cell ligand a-galactosylceramide prevents autoimmune diabetes in non-obese diabetic mice. Nat Med 7:1052^1056 McHugh RS, Whitters MJ, Piccirillo CA et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Mosmann TR, Co¡man RL 1989 TH1 and TH2 cells: di¡erent patterns of lymphokine secretion lead to di¡erent functional properties. Annu Rev Immunol 7:145^173 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor b. J Exp Med 194:629^644 Nishizuka Y, Sakakura T 1969 Thymus and reproduction: sex-linked dysgenesia of the gonad after neonatal thymectomy in mice. Science 166:753^755

CHAIR’S INTRODUCTION

5

Powrie F, Leach MW, Mauze S, Caddle LB, Co¡man RL 1993 Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal in£ammation in C. B-17 scid mice. Int Immunol 5:1461^1471 Sharif S, Arreaza GA, Zucker P et al 2001 Activation of natural killer T cells by alphagalactosylceramide treatment prevents the onset and recurrence of autoimmune Type 1 diabetes. Nat Med 7:1057^1062 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3:135^ 142 Wang B, Geng YB, Wang CR 2001 CD1-restricted NK T cells protect nonobese diabetic mice from developing diabetes. J Exp Med 194:313^320 Zelenika D, Adams E, Humm S et al 2002 Regulatory T cells overexpress a subset of Th2 gene transcripts. J Immunol 168:1069^1079

Thymic generation and selection of CD25+CD4+ regulatory T cells: implications of their broad repertoire and high self-reactivity for the maintenance of immunological self-tolerance Shimon Sakaguchi*{, Shohei Hori*{, Yoshinori Fukui{, Takehiko Sasazuki{, Noriko Sakaguchi*{ and Takeshi Takahashi* *Department of Experimental Pathology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, {Laboratory of Immunopathology, Research Center for Allergy and Immunology, The Institute for Physical and Chemical Research (RIKEN), Yokohama 230-0045, and {Division of Immunogenetics, Department of Immunobiology and Neuroscience, Medical Institute of Bioregulation, Kyushu University, and CREST, Japan Science and Technology Corporation, Fukuoka 812-8582, Japan Abstract. Besides positive and negative selection of T cells, another function of the thymus in maintaining immunological self-tolerance is the production of CD25+CD4+ regulatory T cells capable of preventing autoimmune disease. They acquire the regulatory activity through the thymic selection process, and are released to the periphery as a functionally and phenotypically mature population. Our recent study with transgenic mice in which every class II MHC molecule covalently binds the same single peptide has revealed that a particular self-peptide/MHC ligand in the thymus can positively select a broad repertoire of functionally mature CD25+CD4+ regulatory T cells as well as na|« ve T cells. Interestingly, the regulatory T cells bear higher reactivity than other T cells to the selecting ligand in the thymus even after negative selection by the ligand. This broad repertoire and high self-reactivity of CD25+CD4+ regulatory T cells, together with their high level expression of various accessory molecules, may guarantee their prompt and e⁄cient activation upon encounter with a diverse range of self peptide/MHC complexes in the periphery, ensuring dominant control of self-reactive T cells. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 6^23

One aspect of peripheral self-tolerance is maintained by regulatory CD4+ cells naturally occurring in normal na|« ve animals (Sakaguchi 2000, Shevach 2000, Maloy & Powrie 2001). Direct evidence for the key contribution of these 6

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

7

naturally arising regulatory T cells to self-tolerance is that removal of a subpopulation of CD4+ T cells from the normal immune system leads to spontaneous development of various autoimmune diseases in genetically susceptible animals; and reconstitution of the removed population prevents the development of autoimmunity (Sakaguchi et al 1985, Powrie & Mason 1990). The normal thymus seems to be continuously producing this autoimmunepreventive regulatory T cell population (Itoh et al 1999, Seddon & Mason 2000). Here we discuss how the thymus produces the regulatory T cells and how their sensitivity and repertoire in recognizing self-antigens contribute to their function of controlling self-reactive T cells. Self-tolerance maintained by CD25+CD4+ regulatory T cells Autoimmune diseases can be produced in normal rodents simply by removing a T cell subpopulation, without immunization with self-antigens in potent adjuvant. For example, when splenic cell suspensions from normal mice or rats are depleted of CD5high, CD45RClow, or CD25+CD4+ T cells and the remaining cells are transferred to syngeneic T cell-de¢cient animals, autoimmune disease spontaneously develops in multiple organs of the recipients within a few months; co-transfer of the removed population inhibits the development of autoimmunity (Sakaguchi et al 1985, 1995, Powrie & Mason 1990) (Fig. 1). Expression of the CD25 molecule is so far most speci¢c for such an autoimmune-preventive T cell population present in normal na|« ve animals. CD25+ T cells, which constitute 5^10% of peripheral CD4+ T cells and less than 1% of peripheral CD8+ T cells in mice and humans, are CD5high and CD45RBlow. Removal of these CD25+ T cells from normal mice produced autoimmune disease in a wider spectrum of organs and with higher incidences than removal of CD5high cells or CD45RBlow T cells (Sakaguchi et al 1995). The autoimmune diseases thus induced are immunopathologically similar to the human counterparts, e.g. Hashimoto’s thyroiditis, type A autoimmune gastritis with pernicious anaemia, insulindependent diabetes mellitus, Addison’s disease (autoimmune adrenalitis), premature ovarian failure with autoimmune oophoritis or male infertility with autoimmune orchitis. These ¢ndings indicate that the normal immune system harbours self-reactive T cells su⁄ciently pathogenic in speci¢city and a⁄nity to initiate autoimmune diseases, that their activation and expansion is held in check in the normal periphery by a regulatory CD4+ T cell subpopulation, and that elimination or reduction of this population su⁄ces to break natural self-tolerance, leading to spontaneous activation and expansion of self-reactive T cells which mediate chronic and destructive autoimmune disease (Fig. 1). The CD25+CD4+ T cells in the periphery of normal na|« ve mice have the following immunological characteristics (Takahashi et al 1998, Thornton &

8

SAKAGUCHI ET AL

FIG. 1. Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells. While the normal thymus deletes T cells highly reactive with self-antigens expressed in the thymus, it continuously produces potentially pathogenic self-reactive CD4+ T cells, which persist in the periphery at CD25
quiescent state. The normal thymus also continuously produces anergic and suppressive CD25+CD4+ T cells. On APCs, they suppress the activation and expansion of CD4+ self-reactive T cells (and CD8+ self-reactive T cells) from CD25
dormant state. They are unique in requiring a signal through CTLA4 for their activation. Signal through GITR, on the other hand, attenuates their suppressive activity. When regulatory CD25+CD4+ T cells are eliminated or substantially reduced, or their regulatory function is impaired (for example, by blockade of CTLA4 or signal transduction through GITR), CD25
self-reactive T cells become activated, expand and di¡erentiate to autoimmune e¡ector T cells.

Shevach 1998, Itoh et al 1999). First, they potently suppress the activation/ proliferation of other T cells in vitro when the two populations are co-cultured with antigen-presenting cells (APCs) and stimulated with antigen. They need stimulation through TCR to exert the suppressive activity; and, upon TCR stimulation, they suppress the proliferation of not only T cells with the same antigen speci¢city but also other T cells speci¢c for other antigens; i.e. CD25+CD4+ regulatory T cells stimulated by a speci¢c antigen exerts antigennon-speci¢c suppression (Takahashi et al 1998). Second, although CD25+CD4+ regulatory T cells require antigenic stimulation for their functional activation, they themselves are non-proliferative (i.e. anti-proliferative or anergic) to in vitro

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

9

antigenic stimulation, and this anergic state is closely linked with suppression. Importantly, the anergic/suppressive state of CD25+CD4+ T cells appears to be their basal and default condition. When CD25+CD4+ T cells are TCR-stimulated and treated with interleukin (IL)2 (or anti-CD28), anergy/suppression is broken, but they spontaneously revert to their original anergic state and re-acquire the suppressive activity when IL2 (or anti-CD28 antibody) is removed (Takahashi et al 1998). Third, the roles of accessory molecules are di¡erent between CD25+ CD4+ regulatory T cells and other T cells. For example, the majority of CD25+ CD4+ T cells in normal na|« ve mice constitutively express CTLA4 (CD152) and GITR (glucocorticoid-induced tumour necrosis factor receptor family gene) at high levels. (Takahashi et al 2000, Read et al 2000, Solomon et al 2000, Shimizu et al 2002, McHugh et al 2002). Blockade of CTLA4 or active signal transduction through GITR abrogates CD25+CD4+ T cell-mediated suppression, thereby producing autoimmune diseases similar to those induced by elimination of CD25+CD4+ T cells. The expression pattern of other accessory molecules on CD25+ CD4+ regulatory T cells (e.g. CD45RBlow, CD44high, CD5high, CD54 [ICAM1]high, CD11a/CD18 [LFA1]high, partly CD62Llow) is in part similar to ‘primed’, ‘activated’, or ‘memory’ T cells (Sakaguchi et al 1995, Itoh et al 1999), suggesting that the regulatory T cells may be primed and continuously stimulated by self-antigens in the normal internal environment. Thymic production of CD25+CD4+ regulatory T cells: another key function of the thymus in self-tolerance How are such autoimmune-preventive regulatory T cells produced in the immune system? The following ¢ndings indicate that the normal thymus produces the majority, if not all, of the CD25+CD4+ regulatory T cells in a functionally mature form. First, transfer of CD4+CD8+ mature thymocyte suspensions depleted of CD25+ thymocytes produces various autoimmune diseases in syngeneic nude mice, as shown with the transfer of CD25
CD4+ spleen cells (Itoh et al 1999) (Fig. 1). Neonatal thymectomy can also produce similar autoimmune diseases presumably by blocking the thymic production of CD25+CD4+ regulatory T cells from the beginning of their production (Asano et al 1996, Suri-Payer et al 1998). Second, CD25+CD4+CD8
thymocytes in normal na|« ve mice are naturally anergic and exhibit equivalent in vitro suppressive activity to that of CD25+CD4+ T cells in the periphery (Itoh et al 1999). Third, the expression pattern of cell surface accessory molecules is similar between CD25+CD4+ CD8
thymocytes and CD25+CD4+ T cells in the periphery; for example, both constitutively express CTLA4 and GITR, being CD45RBlow, CD44high, and CD5high (Itoh et al 1999, Takahashi et al 2000, Shimizu et al 2002) and are characteristically resistant to superantigen-induced clonal deletion

10

SAKAGUCHI ET AL

(Papiernik et al 1998). Furthermore, in TCR-transgenic mice, RAG2-de¢ciency abrogated both CD25+CD4+ thymocytes and T cells, which predominantly express endogenous TCRa chains (Itoh et al 1999). These ¢ndings collectively indicate that the normal thymus is continuously producing not only pathogenic self-reactive CD4+ T cells but also functionally mature regulatory CD25+CD4+ T cells that control them, and releasing both to the periphery. The ¢ndings also suggest that CD25+CD4+ regulatory thymocytes and T cells may have a developmental continuity as a common T cell lineage and constitute a T cell subpopulation functionally distinct from other T cells or thymocytes. Thymic selection of CD25+CD4+ regulatory T cells by self-peptide/MHC Several ¢ndings reported so far suggest that thymic generation of phenotypically and functionally mature CD25+CD4+ regulatory T cells may require unique selection events. For example, in mice expressing transgenic TCR speci¢c for non-self antigens, a large fraction of CD25+CD4+ T cells expressed endogenous TCR a chains whereas other CD4+ T cells mainly expressed transgenic TCR a and b chains. Furthermore, RAG2 de¢ciency, which blocks the gene rearrangement of the endogenous TCR a-chain locus, abrogated the thymic development of CD25+CD4+ T cells in TCR transgenic mice (Itoh et al 1999). In a double-transgenic strain that expressed a transgene-encoded speci¢c peptide in the thymic stromal cells at a certain high level, the majority of T cells expressing transgenic TCR a and b chains speci¢c for the peptide di¡erentiated into CD25+CD4+ regulatory T cells (Jordan et al 2001, Kawahata et al 2002). The regulatory T cells failed to develop, however, when double-transgenic mice expressed either low-a⁄nity transgenic TCR for the same peptide or a high concentration of the peptide in the thymic stromal cells because of insu⁄cient positive selection or strong negative selection, respectively. Furthermore, H2DMa-de¢cient mice, in which class II MHC molecules display a limited array of self-peptides, developed CD25+CD4+ regulatory T cells, whereas MHC class IIde¢cient mice, which can generate a small number of CD4+ T cells restricted to classical or non-classical MHC class I antigens, did not (Bensinger et al 2001). These ¢ndings altogether suggest that the thymic generation of CD25+CD4+ regulatory T cells may require rather high avidity interactions between TCRs and self-peptide/class II MHC ligands on the thymic stromal cells. To assess more directly this possible high self-reactivity of CD25+CD4+ regulatory T cells, we analysed B2L-TKO mice, a transgenic strain in which every class II MHC molecule covalently binds the same single peptide Ea52-68 (Fukui et al 1997). We addressed whether a particular single peptide/MHC ligand can positively and negatively select CD25+CD4+ regulatory T cells that are phenotypically and functionally similar to those found in normal mice, and, if

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

11

FIG. 2. The presence of CD25+CD4+ regulatory T cells in the thymus and periphery of B2LTKO mice. (A) Thymocyte suspensions (top), which were depleted of CD4+CD8+ T cells by anti-CD8 and complement treatment, or lymph node and spleen cell suspensions (bottom) prepared from a 2-month-old B2L-TKO mice were stained with FITC-anti-CD25 and PEanti-CD4. (B) B2L-TKO CD25+CD4+ T cells, CD25
CD4+ T cells, or the mixture of the two populations at various ratios were stimulated with anti-CD3 mAb along with irradiated autologous APCs. They were also stimulated with B6 APCs. (C) B2L-TKO CD25+ or CD25
CD4+ T cells were stimulated for 3 days with B6 or autologous B2L-TKO spleen cells in the presence or absence of exogenous IL2 (100 U/ml) and the amount of incorporated [3H]TdR during last 12 h of the culture was shown. A representative of four independent experiments.

this is the case, the degree of diversity of the TCR repertoire, in particular, whether they are more reactive than other T cells to the selecting ligand. B2L-TKO mice did indeed develop CD25+ T cells as 1.73+0.5% of CD4+CD8
thymocytes (n ¼5) or 3.26+8% of CD4+ splenic T cells (n ¼11) (Fig. 2A). The majority of splenic CD25+ CD4+ T cells were CTLA4high, GITRhigh, CD5high, CD44high, CD54high, CD11a/CD18high and CD45RBlow, being similar to CD25+CD4+ T cells in normal na|« ve mice. Functionally, B2L-TKO CD25+CD4+ T cells were anergic and suppressive upon TCR stimulation whereas CD25
CD4+ T cells were not (Fig. 2B). Stimulation by B6 APCs elicited proliferative responses in B2L-TKO CD25-CD4+ T cells, but not in CD25+CD4+ T cells, whereas B6 APCs and IL2

12

SAKAGUCHI ET AL

induced strong proliferation of both populations, indicating that they recognized diverse natural self-peptides bound to I-Ab molecules as non-self (Fig. 2B,C). By contrast, stimulation with autologous B2L-TKO spleen cells and IL2 constantly elicited signi¢cantly high proliferative responses in B2L-TKO CD25+CD4+ T cells but not in CD25
CD4+ T cells, which showed higher responses than the former to other TCR stimuli (such as anti-CD3 antibody stimulation) (Fig. 2C). The TCR repertoire of CD25+CD4+ T cells in B2L-TKO mice is as diverse as that in normal mice, and similar to the repertoire of CD25
CD4+ T cells. For example, there is no signi¢cant di¡erence between the two populations in the proportion of T cells expressing particular Vb gene segments (T. Takahashi, unpublished data). Assessment by the immunoscope technique of the CDR3 size of TCR a or b chains utilizing a particular Va or Vb family also revealed repertoire diversity (S. Hori, unpublished data). Taken together, these results indicate that a particular peptide/MHC ligand in the thymus can positively select (or fail to negatively select, or both) CD25+CD4+ regulatory T cells with a diverse TCR repertoire and that the selected CD25+CD4+ regulatory T cells have higher avidity for the ligand compared with that of other T cells also selected by the same ligand. In normal animals, summation of each broad repertoire selected by each self-peptide/MHC ligand may well form a broad repertoire of CD25+CD4+ regulatory T cells, which is almost ‘duplicated’ in the CD25+ and CD25
CD4+ population, but with higher reactivity of the former in total to the thymic self-peptide/MHC ligands. Are CD25+CD4+ regulatory T cells highly self-reactive in the normal periphery? A critical question then is whether CD25+CD4+ regulatory T cells present in the periphery of normal animals are more reactive with peripheral self-antigens. This indeed appears to be the case since CD25+CD4+ T cells from normal na|« ve mice showed higher in vitro proliferative responses than CD25
CD4+ T cells to autologous APCs presenting diverse self-peptides when stimulated with the APCs in the presence of IL2; and the responses could be signi¢cantly reduced by blocking class II MHC molecules with speci¢c antibody (Fig. 3). Furthermore, such self-stimulated CD25+CD4+ regulatory T cells can suppress the activation/proliferation of other T cells. For example, in the co-culture of CD25
CD4+ T cells from OVA-peptide-speci¢c TCR transgenic mice and CD25+CD4+ T cells from normal non-transgenic mice, the latter stimulated by autologous APCs signi¢cantly suppressed the peptide-speci¢c proliferation of the former when the concentration of the peptide was relatively low (Fig. 3). At high peptide concentration, CD25
CD4+ T cells overcame the suppression, exhibiting equivalent degrees of responses as CD25
CD4+ T cells alone. Thus,

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

13

FIG. 3. High self-reactivity of CD25+CD4+ regulatory T cells in the normal periphery and their suppression in the physiological state. (A) CD25+ or CD25
CD4+ T cells from a normal BALB/c spleen were stimulated with autologous APCs in the presence of IL2 (100 U/ml) for 3 days. Anti-pan-class II MHC monoclonal antibody (CA4) or rat Ig was added to the wells. A representative result of four independent experiments. (B) CD25
CD4+ T cells from DO11.10 TCR transgenic mice expressing the transgenic TCRs speci¢c for OVA-peptide (323^339) were co-cultured with an equal number of CD25+CD4+ T cells from the transgenic mice or normal non-transgenic wild-type (WT) BALB/c mice in the presence of various concentrations of the OVA peptide.

the self-reactive speci¢city of CD25+CD4+ regulatory T cells, their high level expressions of various accessory molecules and their speci¢c mode of intracellular signal transduction through TCR or accessory molecules (such as CTLA4) may make them highly sensitive in their ability to recognize various self-antigens in the periphery and therefore easily activated by them. The regulatory T cells continuously stimulated by self-antigens may exert suppression not only on self-reactive T cells but also on T cells with other antigen-speci¢cities as well as through antigen-nonspeci¢c suppression, leading to some degree of general immunosuppression in normal animals. The suppression may be su⁄cient to control self-reactive T cells, which generally bear low-a⁄nity TCRs, but insu⁄cient to suppress T cells with high a⁄nity TCRs for non-self antigens. Implications of high sensitivity of CD25+CD4+ regulatory T cells to self-antigens in maintaining self-tolerance The diverse TCR repertoire of CD25+CD4+ regulatory T cells and their high sensitivity to self-antigens have the following implications for their role in maintaining natural self-tolerance. First, given that the CD25
CD4+ T cell population in normal na|« ve animals has a pathogenic self-reactive repertoire even after thymic negative selection (Fig. 1),

14

SAKAGUCHI ET AL

it is highly likely that CD25+CD4+ regulatory T cells also contain a similar selfreactive repertoire including the speci¢cities for the self-antigens to be targeted in autoimmune disease. Considering that suppression exerted by antigen-stimulated CD25+CD4+ regulatory T cells is antigen-nonspeci¢c, CD25+CD4+ T cells expanded by stimulating them with target self-antigens may e¡ectively suppress autoimmune responses even if the antigens may not be the primary self-antigen initiating the autoimmunity. The self-antigen-speci¢c regulatory T cells thus prepared can be used to treat or prevent autoimmune disease. Second, if CD25+CD4+ regulatory T cells, or at least a proportion of them, are continuously stimulated by self-antigens in the normal physiological state and therefore continuously exerting some degree of suppression in vivo (Fig. 3), they may hamper immune responses bene¢cial for the hosts, for example, against autologous tumour cells or invading infectious agents. Indeed, e¡ective tumour immunity can be provoked in mice by removing CD25+CD4+ T cells prior to inoculation of tumour cells (Shimizu et al 1999). Removal of CD25+CD4+ T cells also elicited strong immune responses to infecting agents in chronically infected animals (Hori et al 2002). Third, the high sensitivity of CD25+CD4+ regulatory T cells to self-antigens indicates that they may also be sensitive to self-mimicking non-self antigens, easily activated by them, hence able to suppress activation of other T cells by the mimicking antigens. Considering high cross-reactivity of the TCR in peptide/ MHC recognition and consequent promiscuity in self-non-self discrimination, exposure of self-reactive T cells to self-mimicking non-self peptides may not be rare events (Ohno 1991, Mason 1998, Hemmer et al 1998). Similarly, T cell clones established by repeated stimulation with a particular self-antigen can be activated in vitro by many structurally similar or dissimilar non-self peptides (Wucherpfennig & Strominger 1995). It is generally di⁄cult, however, to induce autoimmune disease in normal animals by immunizing with self-mimicking antigens or peptides. One reason for this di⁄culty may be the low threshold for activation of regulatory T cells by self-mimicking antigens, and resulting dominant suppression on self-reactive T cells to be activated by molecular mimicry. The regulatory T cells may have evolved to prevent autoimmunity due to molecular mimicry.

Acknowledgements We thank Dr K. J. Wood for critically reading the manuscript. This work was supported by grants-in-aid from the Ministry of Education, Science, Sports and Culture, the Ministry of Human Welfare and the Organization for Pharmaceutical Safety and Research of Japan.

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

15

References Asano M, Toda M, Sakaguchi N, Sakaguchi S 1996 Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387^396 Bensinger SJ, Bandeira A, Jordan MS, Caton AJ, Laufer TM 2001 Major histocompatibility complex class II-positive cortical epithelium mediates the selection of CD4+25+ immunoregulatory T cells. J Exp Med 194:427^438 Fukui Y, Ishimoto T, Utsuyama M et al 1997 Positive and negative CD4+ thymocyte selection by a single MHC class II/peptide ligand a¡ected by its expression level in the thymus. Immunity 6:401^410 Hemmer B, Vergelli M, Pinilla C, Houghten R, Martin R 1998 Probing degeneracy in T-cell recognition using peptide combinatorial libraries. Immunol Today 19:163^168 Hori S, Carvalhi TL, Demengeot J 2002 CD25+CD4+ regulatory T cells suppress CD4+ T cellmediated pulmonary hyperin£ammation driven by Pneumocystis carinii in immunode¢cient mice. Eur J Immunol 32:1282^1291 Itoh M, Takahashi T, Sakaguchi N et al 1999 Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317^5326 Jordan MS, Boesteanu A, Reed AJ et al 2001 Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat Immunol 2:301^306 Kawahata K, Misaki Y, Yamauchi M et al 2002 Generation of CD4+CD25+ regulatory T cells from autoreactive T cells simultaneously with their negative selection in the thymus and from nonautoreactive T cells by endogenous TCR expression. J Immunol 168: 4399^4405 Maloy KJ, Powrie F 2001 Regulatory T cells in the control of immune pathology. Nat Immunol 2:816^822 Mason D 1998 A very high level of crossreactivity is an essential feature of the T-cell receptor. Immunol Today 19:395^404 McHugh RS, Whitters MJ, Piccirillo CA et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Ohno S 1991 To be or not to be a responder in T-cell responses: ubiquitous oligopeptides in all proteins. Immunogenetics 34:215^221 Papiernik M, de Moraes ML, Pontoux C et al 1998 Regulatory CD4 T cells: expression of IL-2R alpha chain, resistance to clonal deletion and IL-2 dependency. Int Immunol 10: 371^378 Powrie F, Mason D 1990 OX-22high CD4+ T cells induce wasting disease with multiple organ pathology: prevention by OX-22low subset. J Exp Med 172:1701^1708 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD4+ CD25+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Sakaguchi S 2000 Regulatory T cells: key controllers of immunologic self-tolerance. Cell 101:455^458 Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T 1985 Organ-speci¢c autoimmune diseases induced in mice by elimination of T-cell subset. I. Evidence for the active participation of T cells in natural self-tolerance; de¢cit of a T-cell subset as a possible cause of autoimmune disease. J Exp Med 161:72^87 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor a-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155: 1151^1164

16

DISCUSSION

Salomon B, Lenschow DJ, Rhee L et al 2000 B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431^440 Seddon B, Mason D 2000 The third function of the thymus. Immunol Today 21:95^99 Shevach EM 2000 Regulatory T cells in autoimmunity. Annu Rev Immunol 18:423^449 Shimizu J, Yamazaki S, Sakaguchi S 1999 Induction of tumor immunity by removing CD25+CD4+ T cells: a common basis between tumor immunity and autoimmunity. J Immunol 163:5211^5218 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3: 135^142 Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1998 CD4+ CD25+ T cells inhibit both the induction and e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Takahashi T, Kuniyasu Y, Toda M et al 1998 Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969^1980 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310 Thornton A, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Wucherpfennig KW, Strominger JL 1995 Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clone speci¢c for myelin basic protein. Cell 80:695^705

DISCUSSION Bach: I’d like to press you on antigen speci¢city. At the end of your talk you alluded to transplantation and tumour immunity, and also anti-infectious immunity. How would you see the speci¢city of CD25+ T cells in these models? Are they di¡erent from ordinary T cells speci¢c for a whole variety of antigens? Do you think that the reaction is restricted to the antigen that is initially recognized, or do you think that there is a phenomenon of bystander suppression, which would expand their function to other cell types? I have some di⁄culty in putting together the self-reactive CD25+ T cells and the cells that Kathryn Wood will speak about in transplantation (Wood et al 2003, this volume). Sakaguchi: They are as diverse as ordinary T cells in their usage of TCR Va/Vb subfamilies as revealed with normal mice and single-peptide/MHC transgenic mice. On the other hand, their TCR repertoire seems to be more skewed to recognizing self antigens. They need antigenic or TCR stimulation to exert suppression, which is antigen-non-speci¢c in its e¡ector phase and may mediate bystander suppression. Considering these properties of CD4+CD25+ regulatory T cells, it is highly likely that they are continuously activated to certain degrees by recognizing self-antigens in the normal internal milieu as illustrated by their cell surface phenotype, and exerting a basal level of suppression in the

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

17

physiological state. This basal level of suppression may suppress immune responses in general to some degree. For example, it may hamper the development of e¡ective tumour immunity or antimicrobial immunity in chronic infection. This means that if you remove these regulatory T cells, you can enhance tumour and microbial immunity and immune responses in general. They can also suppress immune responses to alloantigens as they can be strongly stimulated by alloantigens as ordinary T cells. Abbas: I want to come back to the question of why in the thymus some cells are not deleted but turn into regulatory cells. I want to suggest an alternative idea and see how you respond. The idea is that where T cells see self antigen in the cortex of the thymus, they will be deleted, because double-positive thymocytes are poised for deletion. But if they see self-antigens in the medulla, then they have passed the deletion stage and will turn into regulatory cells. One of the surprises that has come out of work by Bruno Kyewski (Derbinski et al 2001) and others is that a huge number of self antigens are expressed in the medulla, which is not the site of negative selection. Perhaps the reason why self antigens are present in the medulla is to generate regulatory T cells: it is not avidity, it is all anatomy. Sakaguchi: For example, Bensinger et al (2001) showed that thymic cortical epithelial cells alone can contribute to the generation of regulatory T cells. In the medulla, they also succumb to clonal deletion as ordinary T cells do. We don’t know how they become anergic or acquire suppressive activity through these selection processes. Bluestone: I’d propose an alternative explanation to that of Abul Abbas. Since the repertoire looks like it is very broad, perhaps if these cells encounter self-antigens too early before they have matured their signalling complex appropriately to delete, this kind of partial signalling of T cells might divert them to the CD25+ regulatory cells. Sakaguchi: That’s possible. Harrison: Self-antigen-expressing cells referred to a moment ago are not just present in the thymus, but also the periphery. We don’t know how these selfantigens are expressed. They may be expressed on class II MHC, but this isn’t known for sure. There is also controversy about the nature of the cell type. Can you tell us something about the generation of these regulatory cells in the periphery? We have heard that they may be generated in response to oral antigen, but we don’t know much about what is happening in the periphery. Sakaguchi:It is a controversial issue. What we can say at the moment is that normal thymus is de¢nitely producing them. There are some reports showing that regulatory T cells with similar phenotype and function as naturally arising CD4+CD25+ regulatory T cells can develop in the periphery from na|« ve T cells in oral tolerance or upon exposure to low dose antigens (Thorstenson & Khoruts 2001). There are also recent reports that when certain T cells are stimulated by

18

DISCUSSION

immature DCs they can somehow become regulatory (Jonuleit et al 2000). It is critically important to determine in these experiments whether CD4+CD25+ regulatory T cells already present in the periphery are somehow expanded or strengthened in their suppressive activity, or whether na|« ve CD25
T cells can di¡erentiate into regulatory T cells upon antigen exposure. Even if the latter is the case, there is a possibility that naturally occurring regulatory T cells may be present also in the CD25
fraction (Stephens & Mason 2000), and such a population may somehow become CD4+CD25+ regulatory T cells upon antigenic stimulation. Bach: We can go further on this. You mentioned that in vitro they do not proliferate much. What is the evidence that they proliferate in vitro in response to an autoantigen? Do you have any data suggesting the enhancement of the pool of these cells in certain settings? Another way to pose the question is what kind of evidence do you have about the autoantigen speci¢city? If there was such speci¢city one might think that the autoantigen-speci¢c clones in the periphery would be expanded. Don Mason has published a paper indicating that there could be further education in the periphery (Seddon & Mason 1999). Sakaguchi: The direct demonstration of the autoantigen speci¢city of regulatory T cells in the natural population hasn’t yet been done. As I mentioned, the TCR repertoire is almost duplicated between CD25+ and CD4+CD25
cells with possible a bit skewing of the former to self. If we accept that CD4+CD25
T cells contain pathogenic self-reactive T cells causing gastritis, IDDM and other autoimmune diseases, it is natural to think that the CD4+CD25+ population contains regulatory T cells speci¢c for self-antigens in the gastric mucosa or Langerhans islets. CD4+CD25+ regulatory T cells can be expanded in vitro when they are stimulated with antigen in the presence of high dose IL2 or along with strong CD28 co-stimulation. This means that regulatory T cells recognizing selfantigens may expand in certain situations in vivo. We have evidence that alloantigen-reactive CD4+CD25+ regulatory cells can expand in vivo when stimulated with alloantigens. We haven’t directly demonstrated that self-antigenspeci¢c regulatory T cells can expand in vivo. Shevach: One way to determine the antigenic speci¢city of the CD4+CD25+ T cells is to use an e¡ector cell of de¢ned speci¢city. In the gastritis model, we have developed several transgenic mice that recognize a de¢ned peptide from the autoantigen, the H/K ATPase. Fortunately, this autoantigen has been knocked out by several groups, so the question will be, can we take CD25+ cells from mice that lack the autoantigen, and how e⁄ciently will they suppress the autoreactive T cell that recognizes an epitope on the a chain of the H/K ATPase. We are just waiting to get enough mice backcrossed onto the right backgrounds to do these experiments. Bluestone: That may be problematic. There are recent data on the plasticity of repertoire development, and the precise autoantigen may not be the only thing

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

19

that those T cells develop in response to. Because of other self antigens that share peptide sequences, it could well be that you get some sharing of peptide speci¢city. Shevach: The model is good enough for us to get some idea of e⁄ciency, so we could see whether 1 million cells do it versus 20 000. One would think that if they really see the same autoantigen that if you lack the autoantigen, than the population as a whole would be less e⁄cient. Bluestone: In some ways that is Shimon Sakaguchi’s experiment. The single peptide MHC and diverse repertoire would suggest that there is a lot of plasticity in how the repertoire is developed in the CD25+ population as well. Shevach: Shimon, have you ever used one of your anti-CD3-generated clones to suppress in vivo? Sakaguchi: Not yet. Von Herrath: Returning to the question of antigen speci¢city, has anyone taken out the CD25high cells in a disease model, and just put them on antigen? This would be a parallel to the diabetes model that Jean-Franc ois Bach introduced. You could stimulate them on peptides and see after this antigen-speci¢c stimulation whether they suppress more potently. This would be the reverse experiment to what Ethan Shevach has suggested. You would expect that if they see both antigens then at some stage they should then suppress better. Shevach: We are actually doing this. Ha£er: We have done this experiment with myelin basic protein and Copaxone. Perhaps not surprisingly, stimulation with self protein did not activate the CD4+CD25+ regulatory T cells. Shevach: I think it would work, actually. We have preliminary experiments in which the e¡ector cells are a homogeneous pathogenic transgenic population and we have cured the animal by taking CD25+ cells from a normal mouse. The experiment that remains to be performed is whether CD25+ cells extracted from that mouse which has been cured be more potent suppressors in a secondary transfer? Harrison: Given that the NOD mouse T cells don’t respond well to anything, if you stimulate GITR, say in vitro, does this enhance the response to antigen? Sakaguchi: Anti-GITR antibody has some co-stimulatory activity in vitro, but this is not very strong. Harrison: So it doesn’t inhibit suppressor activity in the test-tube? If you immunize with a speci¢c antigen and you put anti-GITR in, does this enhance the recall e¡ect of the antigen? Shevach: We have done this with anti-CD3 on puri¢ed CD25
cells from normal mice, and it has no e¡ect. Delovitch: I wanted to raise a point that was mentioned by Jean-Franc ois Bach about increasing the interaction between di¡erent regulatory T cell types. Can a particular subset(s) of autoreactive regulatory T cells control the activity of the CD4+CD25+ T cells in vivo? Is there anything known about that?

20

DISCUSSION

Sakaguchi: I assume you are asking about a possible interplay between CD4+CD25+ regulatory T cells and NKT cells in immmunological selftolerance. I think it is possible. NKT cells secrete lots of IL4 and IFNg. CD4+CD25+ regulatory T cells can be expanded more easily with antigen, IL2 and IL4 than without IL4. This suggests that IL4 secreted by NKT cells can enhance the expansion of CD4+CD25+ regulatory T cells. This kind of interaction may well be occurring in the in vivo situation. Delovitch: Is there evidence for this? Sakaguchi: These are in vitro data. Von Herrath: I have a speci¢c question about your class II transgenic model. I think this is intriguing and a little surprising. What you get out is that there are CD25high cells that proliferate better as judged by BrdU incorporation, and they also proliferate better in vitro when they see the antigen on their syngeneic APCs. These mice tend to make more of these regulatory cells. Did you screen for other e¡ector molecules? I would assume that if they are proliferating they are also making molecules such as chemokines. Is there a distinctive pro¢le? One would assume that the regulatory cells should not make IFNa. Sakaguchi: We haven’t looked at chemokines much. There are a couple of reports on chemokines and CD4+CD25+ regulatory T cells (Bystry et al 2001, Iellem et al 2001). CD4+CD25+ regulatory T cells are not producing IFNg. What we found is that there is a di¡erence between in vivo and in vitro situations. When they are stimulated strongly in vitro, for example with anti-CD3 antibody, they didn’t show any proliferation. But in vivo, even in their normal physiological state they are more proliferating than other T cells. This surprised us. It must mean something, for example, they are continuously proliferating by recognizing self-antigens. Bach: Are you speaking of phenotype? How can you di¡erentiate these cells which appear in vivo from the conventionally activated T cells? Sakaguchi: All I can say is that when you inject BrdU into normal na|« ve mice, CD4+CD25+ T cells incorporate BrdU 3^5-fold more than CD4+CD25
T cells. They are not ordinary activated T cells. Hasenkrug: These may be completely di¡erent cells, but we found that if we purify CD4 cells on the basis of CD69 positivity, they are suppressive in vitro, just from normal mice. This is a small population of cells. CD69
CD4+ cells were not suppressors. Maybe they are the same cells and they are not only proliferating but also activated. Shevach: There is a slight enrichment of CD25+ cells in the CD69 pool, but I would never use it as a marker for suppressor cells. Hasenkrug: Yes, I don’t think you can use it as a marker because it is obviously an early activation marker as well. Powrie: When you look at the BrdU incorporation among the CD25+ cells, you are comparing with CD25
cells. This is a heterogeneous population of cells, the

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

21

majority of which are na|« ve. If you actually compare CD25+ and CD25
cells within the CD45RBlow fraction, do you see a di¡erence? In relation to this, have you or Ethan looked at CD45RBlow cells in terms of preventing gastritis? Sakaguchi: We haven’t looked at that. Shevach: That’s a good experiment but we haven’t done it. Powrie: In relation to the idea that di¡erent populations of cells may regulate di¡erent diseases, I think it’s important to be clear which particular phenotypes work in particular models. Mitchison: What population do you normally take your CD25+ cells from? If you take them from a mature mouse, or even a mature mouse that is making an immune response to the relevant antigen, can you still ¢sh out a suppressor population, or are they downed in normal CD25s? Sakaguchi: That is an important question. Usually we are using na|« ve SPF mice. They are usually less than 4 months old. If they are immunized, we ¢nd the regulatory activity is in a CD25high population. A CD25-intermediate population may include activated T cells. Somehow we can di¡erentiate between the two by the expression level of CD25. But it is not completely clear. Bach: Speaking of ontogeny, at what age do you ¢rst see CD25+ cells in the thymus and spleen? In the NOD mouse we did a systematic study of this. In the thymus we can ¢nd them as early as 10 days of age. In the spleen we have to wait 4^5 weeks. Sakaguchi: In normal B6 or Balb/C mice we can ¢nd CD25+ cells in the periphery from day 3 onwards. In the thymus, they can be detected before day 3. Bach: I was speaking not so much of the phenotype of these cells but of their capacity to protect against diabetes in a co-transfer model. Sakaguchi: I can’t say that because it is di⁄cult to enrich CD25+ cells from newborn mice. Flavell: Many of these questions concern a general point: how homogeneous are these cells and what is their ability to mediate these functions on a cell per cell basis, either in vivo or in vitro? Part of the problem is the markers, which are relatively general. What is the evidence that the CD25+ cell population consists of one homogeneous collection of cells, each of which has the ability to do this? Ha£er: Can you de¢ne homogeneous? Flavell: Every cell can suppress. E¡ector speci¢city. Shevach: We have attempted to de¢ne a more potent subset with the CD25+ population. About 30% of the CD4+CD25+ population expresses CD103, the integrin aE. CD103+ CD25+ T cells are about 4^5 times more potent suppressors than CD103
CD25+ T cells, but latter population also has signi¢cant suppressive activity. Ha£er: Getting back to the issue of which molecules are involved in suppression, it is pretty clear that the more turned on the e¡ector cells are, the

22

DISCUSSION

harder they are to suppress. When we use anti-CTLA4, anti-PDL1 or anti-GITR we ¢nd a higher proliferative response in the e¡ector cells themselves. How sure are you that the inhibition is due to the blocking of important interactions? Could it just be that the e¡ector cells are just more turned on and harder to suppress? Sakaguchi: So far we haven’t found any candidate molecule that speci¢cally mediates suppression. There is a report that a membrane form of TGFb may be involved in this suppression. In our hands we haven’t so far any evidence that TGFb directly mediates suppression. Chatenoud: There are interesting discrepancies between the in vitro and the in vivo data you showed with the anti-CTLA4 antibody. In particular, what happens if instead of using the whole antibody you inject Fab fragments in vivo? Do they have an e¡ect? Do you would need some sort of cross-linking for the in vivo e¡ect that is not needed for the in vitro blockade? What can we really extrapolate from in vitro to in vivo? Are those clones that you derive in vitro able to suppress in vivo? This is an important question. Sakaguchi: We haven’t done that. Your question is important. We are faced with this kind of discrepancy between in vitro and in vivo experiments. In the in vivo situation, even if you inject whole antibody, we can’t say how this a¡ects the T cells by blocking or through active signal transduction. In the literature there are so many di¡erent results.

References Bensinger SJ, Bandeira A, Jordan MS, Caton AJ, Laufer TM 2001 Major histocompatibility complex class II-positive cortical epithelium mediates the selection of CD4+25+ immunoregulatory T cells. J Exp Med 194:427^438 Bystry RS, Aluvihare V, Welch KA, Kallikourdis M, Betz AG 2001 B cells and professional APCs recruit regulatory T cells via CCL4. Nat Immunol 2:1126^1132 Derbinski J, Schulte A, Kyewski B, Klein L 2001 Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nat Immunol 2:1032^1039 Iellem A, Mariani M, Lang R et al 2001 Unique chemotactic response pro¢le and speci¢c expression of chemokine receptors CCR4 and CCR8 by CD4+CD25+ regulatory T cells. J Exp Med 194:847^853 Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH 2000 Induction of interleukin 10producing, nonproliferating CD4+ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 192:1213^1222 Seddon B, Mason D 1999 Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor beta and interleukin 4 in the prevention of autoimmune thyroiditis in rats by peripheral CD4+CD45RC
cells and CD4+CD8
thymocytes. J Exp Med 189:279^288 Stephens LA, Mason D 2000 CD25 is a marker for CD4+ thymocytes that prevent autoimmune diabetes in rats, but peripheral T cells with this function are found in both CD25+ and CD25
subpopulations. J Immunol 165:3105^3110

THYMIC SELECTION OF CD25+CD4+ REGULATORY T CELLS

23

Thorstenson KM, Khoruts A 2001 Generation of anergic and potentially immunoregulatory CD25+CD4+ T cells in vivo after induction of peripheral tolerance with intravenous or oral antigen. J Immunol 167:188^195 Wood KJ, Ushigome H, Karim M, Bushell A, Hori S, Sakaguchi S 2003 Regulatory cells in transplantation. In: Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Found Symp 252) p 177^193

Control of T cell activation by CD4+CD25+ suppressor T cells Ethan M. Shevach, Ciriaco A. Piccirillo, Angela M. Thornton and Rebecca S. McHugh Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA

Abstract. Although the concept of a separate lineage of T cells speci¢cally equipped to suppress immune responses was initially proposed more than 30 years ago, progress in this area of immunoregulation has been hampered by the lack of solid biochemical and molecular data to support the existence of the soluble products of these purported suppressor T cells. Studies over the past 5^10 years have identi¢ed a distinct lineage of CD4+CD25+ regulatory or suppressor T cells that control autoreactive e¡ector cells and prevent autoimmunity. The mechanism by which CD4+CD25+ T cells inhibit T cell activation in vivo or in vitro is still poorly de¢ned. While autoreactive e¡ector T cells undergo massive proliferation and expansion following injection into immunocompromised recipients, CD4+CD25+ T cells do not inhibit this lymphopaenia-induced proliferation and act later in the activation process at the site of immune damage in the target organ. The development of in vitro models that partially mimic the in vivo properties of the CD4+CD25+ regulatory T cells has facilitated their characterization. A member of the tumour necrosis receptor family, the GITR is expressed on CD4+CD25+ T cells and after interaction with its ligand down-regulates suppressor activity. Multiple methods of manipulating both the numbers of CD4+CD25+ suppressor T cells and their activation status are now available and will rapidly be applied to therapy of autoimmune, infectious and malignant diseases. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 24^44

Regulation of immune responses in vivo Organ-speci¢c autoimmunity can be induced by thymectomy of mice on day 3, but not day 7, of life (d3Tx). It was proposed that autoimmune e¡ectors emerged from the thymus during the ¢rst 3 days of life and that suppressor T cells developed slightly later in ontogeny and began to populate the peripheral lymphoid tissues between day 4 and day 7 of life (Nishizuka & Sakakura 1969). Autoimmunity could be prevented by a thymus transplant or by injection of adult CD4+ T cells by day 10^14 of life. It is also likely that in the adult animal suppressor T cells 24

CD4+CD25+ SUPPRESSOR T CELLS

25

constantly prevent the activation of autoreactive e¡ector cells. This hypothesis was much more di⁄cult to test as no markers were available to identify the regulatory T cell population. The major advance in this area was the observation by Sakaguchi et al (1995) that elimination of a minor population (*10%) of CD4+ T cells that coexpressed the CD25 antigen from adult CD4+ T cells followed by transfer of CD25 cells to an immunode¢cient host resulted in the development of a spectrum of autoimmune diseases that closely resembled the diseases seen after d3Tx. Conversely, the induction of disease post-d3Tx could be prevented by reconstitution of the animals with CD4+CD25+, but not CD4+CD25 , T cells by day 10^14 of life (Suri-Payer et al 1988). Collectively, these studies solidi¢ed the role of CD4+CD25+ T cells as the major subset of cells that plays a critical role in suppression of autoreactivity. Our studies on the in vivo function of CD4+CD25+ T cells have focused on their role in the prevention of autoimmune gastritis (AIG), the disease that develops with the highest frequency when BALB/c mice are subject to d3Tx. We have identi¢ed the major proton pump of the gastric parietal cell, the H/K ATPase, as the target antigen for the pathogenic autoreactive T cells (Suri-Payer et al 1999). CD4+ T cells from gastric lymph nodes of gastritic mice demonstrated both a vigorous proliferative response and a Th1 pattern of cytokine production when challenged with puri¢ed H/K ATPase in culture. More importantly, both Th1 and Th2 cell lines speci¢c for distinct peptide epitopes on the a chain of the H/K ATPase could transfer gastritis to immunocompromised, but not normal, recipients. The capacity of both these cell lines to transfer disease to nu/nu or SCID recipients could be inhibited by co-transfer of CD4+CD25+ T cells from normal BALB/c mice. Thus, CD4+CD25+ T cells are able to inhibit not only the initiation of disease after d3Tx, but also fully di¡erentiated e¡ector T cells at least when transferred prior to the development of disease in the target organ. Suppression of disease in vivo did not appear to be mediated by suppressor cytokines as CD4+CD25+ T cells from interleukin (IL)4-de¢cient ( / ) and IL10 / mice were as e⁄cient as CD4+CD25+ T cells from wild-type (WT) mice in their capacity to inhibit disease in co-transfer studies (McHugh et al 2001a). In addition, the suppression of disease following treatment of recipients of CD4+CD25+ and CD4+CD25 T cells could not be reversed by administration of high concentrations of anti-transforming growth factor (TGF)b (Piccirillo et al 2002). In order to de¢ne more fully the pathogenesis of organ-speci¢c autoimmune disease and the role of CD4+CD25+ T cells in disease prevention, we have developed a TCR transgenic (Tg) model that allows a clear dissection of e¡ector vs. suppressor T cell function. We generated a TCR Tg mouse expressing the TCR from the Th1 clone described above (McHugh et al 2001b). All of the Tg mice developed severe AIG relatively early in life that closely resembled the AIG seen

26

SHEVACH ET AL

after d3Tx or after transfer of CD4+CD25 T cells to immunode¢cient recipients. Thymocytes from the TCR Tg mice could readily transfer disease into BALB/c nu/nu recipients but not into normal WT animals. As few as 103 thymocytes could transfer disease into immunoincompetent animals, while more than 107 thymocytes were required to induce only moderate disease in WT recipients; it is highly likely that the endogenous population of CD4+CD25+ T cells prevents the induction of disease in normal animals. In preliminary studies, co-transfer of CD4+CD25+ T cells from BALB/c animals prevents the induction of disease induced by thymocytes from the TCR Tg animals following transfer into nu/nu recipients. The further use of these TCR Tg mice should facilitate the analysis of several important questions regarding the antigenic speci¢city of the CD4+CD25+ T cells. Mice de¢cient in both components of the H/K ATPase have been generated (Spicer et al 2000) and evaluation of the capacity of CD4+CD25+ derived from such mice to prevent disease induced by T cells derived from the TCR Tg should be able to directly answer the question of whether the suppressor and e¡ectors recognize the same antigen. The mechanism by which CD4+CD25+ T cells prevent the development of organ-speci¢c autoimmune disease remains unknown. One of the ¢rst questions one might raise is how do they know where to go? What directs CD4+CD25+ T cells to the site of autoimmune attack? The recognition of organ-speci¢c antigens by CD4+CD25+ T cells might be the most important factor that attracts them to the lymph nodes draining the target organ. However, if they respond to more ubiquitously expressed antigens, what directs them to the speci¢c organ? Do they respond to chemokines produced by antigen presenting cells (APCs) or perhaps produced by the autoreactive e¡ector cells? Do they prevent the initiation of the disease process by preventing the initial events in the process of antigen recognition? Do they play a modulatory role at some stage during the di¡erentiation of autoreactive e¡ector cells following antigen priming? If they are speci¢c for an organ-derived antigen, do they develop immunologic memory for this antigen so that they will be more e¡ective in preventing the development of disease following transfer to secondary recipients? One other important issue of a more general nature is that most models of regulatory T cell function in vivo involve transfer of e¡ector cells to recipients that lack CD25+ T cells. In most cases, cells are transferred to immunoincompetent mice that lack T cells (nu/nu) or T and B cells (SCID or RAG / ). Even d3Tx involves induction of a generalized state of partial lymphocyte depletion. It has therefore been suggested that one of the main mechanisms involved in CD25mediated suppression is competition for space, cytokines, or co-stimulatory signals in the environment of the lymphopaenic recipient (Stockinger et al 2001). It also remains possible that any activated cell population derived from

CD4+CD25+ SUPPRESSOR T CELLS

27

conventional CD4+CD25 T cells might also exert suppressor function in the lymphopaenic environment. To assess directly the role of CD4+CD25+ T cells in autoimmunity and to distinguish their ability to suppress disease from their potential ability to control lymphocyte expansion in the lymphopaenic environment, we have attempted to de¢ne the requirements for induction of disease following selective depletion of CD4+CD25+ T cells from the young adult animal using a depleting anti-CD25 antibody (McHugh & Shevach 2002). Although we were successfully able to deplete CD4+CD25+ T cells for as long as 3^4 weeks, only a minority of animals developed gastritis. One problem with this approach is that the CD4+CD25+ pool might have been repopulated with new CD4+CD25+ thymic emigrants following depletion. Indeed, at 6 weeks following antibody treatment, the percentage of CD4+CD25+ T cells had risen to 4% (normal 10%). To determine whether this low number of CD25+ T cells was able to prevent the induction of disease, we transferred cells from these mice to nu/nu recipients. All the recipients developed signs of gastritis. The disparity between the ability to transfer disease to a lymphopaenic recipient while the lymphocyte-su⁄cient donor did not manifest signs of disease raised the question of whether the lymphocyte-su⁄cient environment was responsible for prevention of disease. Indeed, Annacker et al (2001) have proposed that a primary function of the CD4+CD25+ T cell population is to regulate the homeostatic proliferation of CD4+CD25 T cells in an IL10-dependent manner. However, both CD4+CD25+ and CD4+CD25 T cells proliferated equally well when transferred into a lymphopaenic recipient and co-transfer CD4+CD25+ did not inhibit this early proliferative response of the CD4+CD25 cells (Fig. 1).

FIG. 1. CD4+CD25+ T cells do not a¡ect the lymphopaenia-induced proliferation of CD4+CD25 cells. CFSE-labelled CD4+CD25 (left panel), CFSE-labelled CD4+CD25+ T cells and unlabelled CD4+CD25 T cells (middle panel), or CFSE-labelled CD4+CD25 + unlabelled CD4+CD25+ T cells (right panel) were injected into nu/nu recipients and proliferation was measured by dilution of CFSE on day 7 after transfer. Co-transfer of CD4+CD25+ T cells does not inhibit proliferation of the CD4+CD25 T cells at this time point.

28

SHEVACH ET AL

TABLE 1 Immunization of CD25-depleted Mice with H/K ATPase Results in AIG Treatment

AIG

Anti-CD25 H/K ATPase Anti-CD25+H/K ATPase

+/ ++++

Only 5^10% of CD25-depleted mice spontaneously develop AIG. Immunization of normal mice with the H/K ATPase does not induce AIG, while immunization of CD25-depleted mice results in severe AIG in 100% of the animals.

However, all animals that received CD25 T cells alone developed AIG, while cotransfer of CD25+ T cells completely prevented the development of gastric pathology. In contrast to the lack of e¡ect of CD4+CD25+ T cells on the early (3^21 days after transfer) proliferation of CD4+CD25 T cells, they do exert a potent e¡ect on the expansion of CD25 T cells when the animals are studied 2^6 months after transfer (Annacker et al 2001). However, recipients of CD4+CD25 T cells almost always develop autoimmune disease after 2 months and the CD4+CD25 T cells would have undergone both lymphopaenia-induced proliferation and autoantigen-speci¢c activation and expansion. It is likely that the inhibition of expansion of CD4+CD25 T cells months after transfer by cotransfer of CD4+CD25+ T cells re£ects regulation of autoreactive e¡ector T cell function. So why do we fail to observe the development of autoimmune disease following depletion of CD4+CD25 T cells? One possibility is that autoreactive T cells require an additional signal in order to develop into autoreactive e¡ector cells. Such a signal might be provided by the proliferative response induced following transfer to lymphopaenic recipients. As immunization of normal BALB/c mice with the target autoantigen, the H/K ATPase, never induces AIG in normal mice due to the presence of regulatory T cells (Suri-Payer et al 1988), we immunized mice that had been depleted of CD25+ T cells with the H/K ATPase in incomplete Freund’s adjuvant. All of the immunized animals manifested severe AIG 5 weeks following immunization, while no disease was observed following immunization of control mice (Table 1). We conclude from this study that TCR stimulation can also provide the second signal for activation of the autoreactive e¡ectors in the absence of regulatory T cells. It remains possible that other environmental insults might also be capable of inducing autoimmune disease in the CD25-depleted host (Fig. 2). The implications of these results for the therapeutic use of depleting anti-CD25 antibodies for enhancement of immune responses will be discussed below.

CD4+CD25+ SUPPRESSOR T CELLS

29

FIG. 2. Depletion of CD4+CD25+ T cells is not su⁄cient for the induction of autoimmunity. Treatment of animals with anti-CD25 results in marked depletion of the CD25+ cells, but the treated animals fail to develop autoimmune disease. A second signal is needed for disease induction and this second signal can be provided by lymphopaenia-induced proliferation, immunization with the target autoantigen, or perhaps by other environmental stimuli.

Regulating the regulator The mechanism whereby CD25+ T cells mediate their suppressive e¡ects remains unknown and appears to be mediated by a cell contact-dependent pathway (Thornton & Shevach 1998). In addition, in preliminary studies we have shown that cell contact between activated CD25+ T cells and responder cells requires that the responder cell ¢rst be activated via their TCR (C. A. Piccirillo, E. M. Shevach, unpublished). Suppression may therefore be mediated by a ligand induced on the CD25+ T cells engaging a receptor induced on the responder CD4+ or CD8+ T cells (Fig. 3). A number of molecular pathways are logical candidates for this receptor/ counter-receptor role including members of TNF/TNF receptor (TNFR) superfamily. It is also possible that an unknown ligand is induced on the CD4+CD25+ T cell and then interacts with a cell surface molecule induced on the CD25 T cell that contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) that leads to the activation of a phosphatase that mediates suppression. We have employed DNA microarray technology to compare patterns of gene expression in both resting and activated CD25+ and in CD25 T cells (McHugh et al 2002). The major goal of these studies was to search for molecules that might

30

SHEVACH ET AL

FIG. 3. CD4+CD25+ T cells mediate suppression of the activation of CD4+CD25 responders by a cell contact-dependent mechanism. Following activation of the CD4+CD25+ T cells, they express an unknown molecule that mediates suppressor e¡ector function by binding to an unknown receptor on the responder CD4+CD25 responders.

be involved in the e¡ector phase of suppression. As expected, these two populations of T cells di¡ered in only a small number of the 11 000 genes and expressed sequence tags (ESTs) tested. Approximately 1500 genes were modulated equally in the two populations following stimulation with anti-CD3 and IL2, and only 97 were di¡erentially expressed. Several genes were identi¢ed that distinguish the CD25+ population (Table 2). Among these genes, it is of interest that three members of the suppressors of cytokine signalling (SOCS) family (Starr et al 1997) appeared to be preferentially induced after activation of the CD25+ T cells. Elevated levels of SOCS expression may be required to control the size of the CD25+ population in vivo to achieve a ¢ne balance between the necessity to suppress autoreactivity and the ability to allow appropriate responses to foreign antigens. Analysis of the DNA microarray data identi¢ed many candidate genes that could potentially be involved in the suppressive function of the CD25+ T cells. As monoclonal or polyclonal antibodies were available to many of the products of TABLE 2

Genes preferentially expressed in activated CD4+CD25+ T cells

Surface receptors: Secreted molecules: Signal transduction:

CD2, OX40, CD25, IL2Rb, GITR, GIR, Ly6, Galectin1, Thy1 IL10, IL17, ETA1, Enkephalin, ECM1, MIP-1a, MIP-1b CIS, SOCS1, SOCS2, SLAP130

CD4+CD25+ SUPPRESSOR T CELLS

31

TABLE 3 Anti-GITR reverses suppression but does not prevent the induction of suppressor activity Anti-GITR added to

Suppression

A. Co-culture of CD4+CD25+ and CD4+CD25 B. Co-culture of activated CD4+CD25+ and CD4+CD25 C. Preculture of CD4+CD25+ with anti-CD3 and IL2

reversed slightly reversed maintained

(A) The anti-GITR was added to cultures of freshly explanted CD4+CD25+ T cells and CD4+CD25 responders. (B) The anti-GITR was added to cultures of CD4+CD25+ T cells that had been pre-activated with anti-CD3 and IL2 in the absence of anti-GITR and fresh CD4+CD25 responders. (C) The antiGITR was added to the pre-culture of the CD4+CD25+ T cells with anti-CD3 and IL2. The CD4+CD25+ T cells were then washed and added to fresh CD4+CD25 responders in the absence of anti-GITR. All cocultures were activated with anti-CD3 and suppression of proliferation was measured at 72 hours.

the di¡erentially expressed genes, we tested the capacity of these antibodies to reverse suppression in co-cultures of CD25+ and CD25 T cells. Only a polyclonal antiserum to a member of the TNFRSF, the mouse GITR (TNFRSF18, Nocentini et al 1997), extracellular domain was able to reverse suppression induced by freshly isolated CD25+ T cells on the response of both CD4+ and CD8+ responders to anti-CD3 (Table 3). However, the anti-GITR was only minimally e¡ective in neutralization of suppression mediated by preactivated CD25+ T cells. Furthermore, addition of the anti-GITR to the preactivation culture with IL2 and anti-CD3 had no e¡ect on the subsequent suppressor function of the cells. As the GITR is expressed on two populations of cells (resting CD25+ and activated CD25 cells) that do not manifest suppressor activity, it is therefore very unlikely that the GITR is the molecule responsible for mediating suppressor e¡ector function. It was also important to rule out the possibility that reversal of suppression was not mediated by the anti-GITR acting on the CD25 T cell. Culture of CD25+, but not CD25 , T cells with anti-GITR in the presence of IL2, but in the absence of anti-CD3, resulted in a vigorous proliferative response. Thus, anti-GITR is capable of directly inducing a signal in the CD25+ population that allows it to respond to IL2. This study is also consistent with a model in which the anti-GITR functions as an agonist for the GITR providing a signal that instructs the CD4+CD25+ T cells not to mediate their suppressive functions, although it does not prevent them from developing into potent suppressors. The murine GITR is a 228 amino acid type I transmembrane protein with three cysteine pseudorepeats in the extracellular domain and resembles TNFRSF members CD27 and 4-1BB in the intracellular domain. Four di¡erent splice variants of the murine GITR have been identi¢ed (Nocentini et al 2000) and one

32

SHEVACH ET AL

FIG. 4. The GITR/GITR-L interaction regulates the function of CD4+CD25+ T cells. The tissue speci¢c suppression of the GITR-L is still poorly characterized. Three hypothetical models are shown in which the GITR-L is expressed in DC, CD4+CD25 T cells, or CD4+CD25+ T cells. The end result of all three models is the same
attenuation of the suppressor function of the CD4+CD25+ T cells that express the GITR.

of the variants bears a unique cytoplasmic domain due to a reading frame shift resulting in a cytoplasmic domain with signi¢cant homology with the cytoplasmic region of CD4 and CD8 that interacts with p56lck. It has not yet been determined which splice variants are expressed by CD25+ T cells. Thus, interaction of the GITR with the GITR-L may deliver a signal to regulate the suppressive function of CD25+ T cells. The human GITR-L has been cloned, is a member of the TNFRSF, has not been found to be expressed on T or B cells, but was readily identi¢ed in umbilical vein endothelial cells (Gurney et al 1999). We have cloned the murine GITR-L, but have not yet performed a detailed analysis of its expression pattern. It is possible that the murine GITR-L is expressed on other cell types. We have illustrated potential patterns of its expression in Fig. 4 and at present can only speculate about its possible functions. If the GITR-L is expressed on APCs such as dendritic cells or macrophages, it is possible that its expression is

CD4+CD25+ SUPPRESSOR T CELLS

33

up-regulated during a vigorous in£ammatory response. Engagement of the GITR by the GITR-L in such a site may temporarily prevent CD25-mediated suppression and facilitate a productive immune response to a pathogen. An equally viable alternative is that the GITR-L is induced on responder CD25 e¡ector cells during some stage of their di¡erentiation. Engagement of the GITR on CD25+ T cells by the GITR-L on e¡ector cells may diminish suppression during in£ammation during the immune response to an infectious agent. Conversely, expression of the GITR-L by e¡ectors at the site of an autoimmune response may abolish suppression and facilitate the progression of destructive immunopathology, e.g. the progression of insulitis to frank diabetes in IDDM. Lastly, since other members of the TNFRSF and their ligands may be expressed by the same cell type or even on a single cell, it is worth considering the possibility that the GITR-L may be induced at certain times on CD25+ T cells themselves and engage the GITR on the same cell or on a neighbouring CD25+ T cell. Studies are in progress to directly address these questions. Clinical implications The manipulation of regulatory cell function in vivo during the course of a normal or pathological immune response should represent an important area for future developments. Further studies of the normal physiology of regulatory cells may yield important insights into how to control both their numbers and functional activity in vivo. One goal would be to enhance regulatory cell function in autoimmunity, allergy and graft rejection and to inhibit regulatory cell function for enhancement of the immune response to tumour vaccines or weak vaccines to infectious agents. Curiously, a non-depleting anti-CD25 antibody has been used clinically to inhibit the function of CD25 expressed on e¡ector cells, rather than regulatory cells, in transplant models and in autoimmune uveitis (Nussenblatt et al 1999). The potential e¡ects of this antibody on regulatory T cell function in man have not been studied. Although human CD4+CD25+ T cells might be completely eliminated by use of a depleting anti-CD25 antibody as in the murine models, such an approach may be contraindicated in humans over the age of 20 as repopulation of the CD4+CD25+ cell pool from new thymus emigrants may have declined during the ageing process. In addition, anti-CD25 could potentially also deplete CD25+ e¡ector T cells. A second approach would be targeting the as yet unknown molecules responsible for mediating suppressor e¡ector function. An antibody directed to either partner of this purported receptor ligand pair (Fig. 3) might be the ideal agent to transiently inhibit suppressor cell activity and permit immune responses to weak vaccines. The GITR/GITR-L interaction also represents an important potential target for modulation of CD4+CD25+ T cell function (Fig. 5). One possible approach would

34

SHEVACH ET AL

FIG. 5. Manipulation of the GITR/GITR-L interaction may suppress or enhance suppressor T cell function. Engagement of the GITR by agonistic antibodies or by an agonistic GITR-L-Fc soluble molecule would lead to decreased suppression. Conversely, blocking GITR/GITR-L interaction with a soluble GITR-Fc or with an anti-GITR-L antibody would lead to enhancement of suppressor T cell function.

be to inhibit suppressor function with an agonistic anti-GITR antibody and this approach has been validated by the studies of Shimizu et al (2002) and Sakaguchi et al (2003, this volume). A soluble GITR-L-Fc fragment might also have similar agonist properties to transiently neutralize suppression. It is di⁄cult to predict the outcome of blocking the GITR/GITR-L interaction in vivo with either an anti-GITR-L antibody or GITR-Fc. It is not yet known whether the GITR interacts with GITR-L in the normal steady state or in pathologic conditions to down-modulate suppressor cell function. If this is the case, the administration of these reagents should result in enhanced suppressor function and represent a valuable addition to our armamentarium of tools to enhance immunosuppression and treat debilitating autoimmune diseases. Lastly, it should be emphasized that approaches to grow and expand regulatory T cells for enhancement of suppressor function in vivo also represent a useful area for future study. Again, increased understanding of the factors that control regulatory cell numbers, for example manipulation of the function of the SOCS genes, may represent an important adjunct to this therapeutic approach. References Annacker O, Pimenta-Araujo, Burlen-Defranoux O, Barbosa TC, Cumano A, Bandeira A 2001 CD25+CD4+ T cells regulate the expansion of peripheral T cells through the production of IL-10. J Immunol 166:3008^3018

CD4+CD25+ SUPPRESSOR T CELLS

35

Gurney AL, Marsters SA, Huang A et al 1999 Identi¢cation of a new member of the tumor necrosis family factor and its receptor, a human ortholog of mouse GITR. Curr Biol 9:215^218 McHugh RS, Shevach EM 2002 Cutting edge: depletion of CD4+CD25+ regulatory T cells is necessary, but not su⁄cient, for induction of organ-speci¢c autoimmune disease. J Immunol 168:5979^5983 McHugh RS, Shevach EM, Thornton AM 2001a Control of organ-speci¢c autoimmunity by immunoregulatory CD4+CD25+ T cells. Microbes Infect 3:919^927 McHugh RS, Shevach EM, Margulies DH, Natarajan K 2001b A T-cell receptor transgenic model of severe spontaneous organ-speci¢c autoimmunity. Eur J Immunol 31: 2094^2103 McHugh RS, Whitters MJ, Piccirillo CA et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Nishizuka Y, Sakakura T 1969 Thymus and reproduction: sex-linked dysgenesia of the gonad after neonatal thymectomy in mice. Science 166:753^755 Nocentini G, Giunchi L, Ronchetti S et al 1997 A new member of the tumor necrosis factor/ nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci USA 94:6216^6221 Nocentini G, Ronchetti S, Bartoli A et al 2000 Identi¢cation of three novel mRNA splice variants of GITR. Cell Death Di¡er 7:408^410 Nussenblatt RB, Fortin E, Schi¡man R et al 1999 Treatment of noninfectious intermediate and posterior uveitis with the humanized anti-Tac mAb: a phase I/II clinical trial. Proc Natl Acad Sci USA 96:7462^7466 Piccirillo CA, Letterio JJ, Thornton AM et al 2002 CD4+CD25+ regulatory T cells can mediate suppressor function in the absence of transforming growth factor b1 production and responsiveness. J Exp Med 196:237^246 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunological self-tolerance maintained by activated T-cells expressing IL-2 receptor a-chains (CD25) breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Sakaguchi S, Hori S, Fukui Y et al 2003 Thymic generation and selection of CD25+CD4+ regulatory T cells: implications of their broad repertoire and high self-reactivity for the maintenance of immunological self-tolerance. In: Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Found Symp 252) p 6^23 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3: 135^142 Spicer Z, Miller ML, Andringa A et al 2000 Stomachs of mice lacking gastric H,K-ATPase alpha-subunit have achlorhydria, abnormal parietal cells, and ciliated metaplasia. J Biol Chem 275:21555^21565 Starr R, Willson TA, Viney EM et al 1997 A family of cytokine-inducible inhibitors of signalling. Nature 387:917^921 Stockinger B, Barthlott T, Kassiotis G 2001 T cell regulation: a special job or everyone’s responsibility? Nat Immunol 2:757^758 Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1988 CD4+CD25+ T cells inhibit both the induction and the e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Suri-Payer E, Amar AZ, McHugh RS, Natarajan K, Margulies DH, Shevach EM 1999 Postthymectomy autoimmune gastritis: ¢ne speci¢city and pathogenicity of anti-H/K ATPasereactive T cells. Eur J Immunol 29:669^677

36

DISCUSSION

Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296

DISCUSSION Shevach: We have recently shown that the persistence of Leishmania major in the skin following healing in resistant C57BL/6 mice is controlled by an endogenous population of CD4+CD25+ regulatory T cells (Belkaid et al 2002). During the course of infection by L. major, CD4+CD25+ T cells accumulate in the chronic dermis where they suppress by both IL10 dependent and independent mechanisms the ability of CD4+CD25 e¡ector T cells to completely eliminate the parasite from the site. The sterilizing immunity that is achieved in mice with impaired IL10 activity is followed by the loss of immunity to re-infection, suggesting that the equilibrium that is established between e¡ector and regulatory T cells in sites of chronic infection may re£ect both parasite and host survival strategies. Banchereau: Is there any role for B cells here? Is it antibody mediated? In the human, IL10 is a powerful plasma cell inducer. Shevach: All these experiments are done in the absence of B cells in RAGde¢cient mice reconstituted only with T cells. Bach: I have a question concerning the interpretation of the various populations of the CD25+ T cells that could exist. You say that IL10 could be involved. We did not ¢nd it to be so in the NOD mouse. Even if you take normal CD25+ T cells before they are exposed to infectious agents, how can you be sure that the cells that react to the infectious agents have anything to do with the CD25+ cells studied in the co-culture? As you mentioned, CD25 is not stable. The CD25+ compartment does not only includes the regulatory cells. It could well be that IL10 is produced by a subset of these cells that have nothing to do with the subset controlling autoimmunity. IL10 knockout mice can express regulatory function towards self, and the NOD mouse data show the same. Shevach: CD25+ cells freshly explanted from a normal SPF mouse and stimulated with anti-CD3 make IL10 mRNA and protein. I don’t know the frequency of these cells, and we haven’t been able to determine this yet by intracellular staining. The IL10 they produce does not appear to be responsible for suppression of any of the in vitro phenomena that have been studied. It also does not appear to be responsible for the suppression of gastritis. In in£ammatory bowel disease, however, it is absolutely responsible for suppression of the disease. Here it appears to play an important role. Cell contact may also be playing a role even in IBD. The only comment I can currently make regarding the use of CD25 as a marker is to say that it is pretty good but it isn’t perfect.

CD4+CD25+ SUPPRESSOR T CELLS

37

Chatenoud: The other distinction is the in vivo model used. On the one side you have the organ-speci¢c autoimmune diseases and you showed very clearly that cytokine-producing cells don’t work. On the other side you have the models, such as colitis, in which microbial agents are implicated in the response and this is the situation where you can ¢nd evidence for cytokine-producing T cells that mediate regulation. Shevach: That is something else. L. major infection of the ear is an intracellular infection, and IL-10 may speci¢cally suppress the responses of infected cells to respond to the anti-parasitic e¡ects of IFNg. Mowat: Presumably the e¡ector mechanism must depend on what needs to be inhibited. If it is an infection in the gut, where there are lots of di¡erent e¡ector cells, you may have to inhibit macrophages and other in£ammatory cells, whereas an autoimmune disease inhibiting a T cell directly may be su⁄cient. Shevach: The model we favour is that the IL10 and TGFb are required to ¢rst put out the in£ammatory ¢re in in£ammatory bowel disease and then cell-contact dependent mechanisms of suppression take over. Bach: The point I wanted to make clear is that I do understand that the cells suppressing in your infectious system are initially CD25+, but the key question is whether it is the same subset as the others? Can we say this at the moment? Shevach: There is expansion in the animal, of course. Abbas: Are you all implying that the endogenous thymic-derived regulatory cells and the peripheral activation-induced cells are di¡erent and work di¡erently? The impression I’m getting is that the peripheral cells are the ones that work via cytokines and the endogenous thymic-derived cells don’t. Shevach: No. That was never true. Powrie: There is no evidence that is the case. Bach: It may well be that in Fiona Powrie’s model it is essentially an antigenstimulated peripheral activation. Even if regulatory cells in a colitis model share some properties with regulatory cells in a day 3 thymectomy model, including the CD25 marker, there is still room for what Abul Abbas said. Powrie: CD25+ cells from the thymus can prevent colitis. Bach: Of course. All T cells come from the thymus, anyway. Powrie: Furthermore, CD25+ cells that prevent in£ammatory bowel disease can be isolated from germ-free mice, suggesting those cells are not driven into the memory pool by replicating bacteria. Bach: Is it necessary for colitis to occur in order to get a pool of memory cells? Powrie: What we really have no idea about is the speci¢city of the cells that regulate in the di¡erent disease models. If we had a clone, we could ask in these di¡erent systems whether or not one clone is able to regulate the di¡erent diseases. Chatenoud: In a way the answer is there, because there is not protection from gastritis.

38

DISCUSSION

Shevach: CD25+ T cells from IL10 / mice e⁄ciently protect against gastritis. Powrie: That doesn’t mean they are di¡erent subsets of cells. It could be one subset of cells requiring di¡erent e¡ector functions depending on what is being regulated. Bluestone: I am getting a little confused here. If we were talking about a Th cell we wouldn’t be having this discussion. CD4+ cells develop in the thymus, and they migrate into the periphery with some precursor frequency for the antigens that they recognize. Depending on the environment, the population may expand. And cytokines are used by CD4+ cells di¡erentially, depending on the sites, and there is an issue of antigen speci¢city. We know these CD25+ cells have a repertoire. Since they have a repertoire, the only di¡erence between them and bona ¢de CD4+ cells are the in vitro data showing a lack of requirement for a speci¢c antigen for them to suppress. Ethan Shevach, you are arguing that this bystander suppression is cytokine independent. This is the only thing that distinguishes the CD25+ cell from any other T cell. Though in vivo it could be very di¡erent. Shevach: CD25+ T cells from IL4 / mice also protect, and anti-TGFb at high concentrations also does not reverse suppression. Delovitch: Perhaps this is the point. When we use the IL10 knockout in each of the three models, perhaps another cytokine is compensating. Has anyone begun to look systematically to see whether this is the issue? Shevach: What are you going to look for? Delovitch: Is there up- or down-regulation of other cytokines or chemokines, or their receptors? Perhaps this is a¡ecting migration. Shevach: It is likely that chemokines play an important role in the migration of CD25+ T cells into the site of in£ammation. The speci¢c chemokines involved have yet to be de¢ned. In the L. major model, chemokines produced or induced by the parasite early in the course of infection may promote the migration of CD25+ T cells into the lesion. Bluestone: It could be made in the lesion. Shevach: Yes, but they all come from the injected CD25+ cells. Abbas: They could be dividing locally. Bluestone: Some time ago Lucienne Chatenoud showed that regulatory cells seem to be able to migrate to sites of in£ammation very e¡ectively. But this doesn’t explain why they are 50% there: they could go to the site and then expand there. Powrie: All we can say at the moment is that they accumulate. Mowat: The phenotype you described was very much that of an activated T cell. You’d expect to ¢nd these more commonly in tissues than in secondary lymphoid organs. Taking CD25+ cells from lymph nodes and spleen may not be what these cells are doing in vivo. They have so many adhesion molecules that would allow them to get into tissues that perhaps this is where they are actually working.

CD4+CD25+ SUPPRESSOR T CELLS

39

Wood: If you take them from grafts, they can function as well (if not slightly better) than cells taken from the periphery. Insitu the cells are certainly as functional. Mowat: If you take a normal mouse gut, it has lots of CD4+CD25+ cells in the normal lamina propria. These may be regulatory cells. This is a normal animal eating a normal diet. Harrison: We have evidence (L. C. Harrison, N. R. Solly & D. Funda, unpublished results) that these cells in the gut require the presence of gd intraepithelial lymphocytes. If intraepithelial lymphocytes (IELs) are absent from the gut, e.g. after neonatal thymectomy or in germ-free mice, CD4+ regulatory cells in the lamina propria cannot be generated, e.g. by oral antigen. Flavell: In the diabetes system, when we looked it was speci¢cally in the pancreatic lymph nodes and islets where the cells capable of blocking in the model were found. Shevach: This is the way life should be! They go where they are needed and they probably expand locally. Mitchison: What is the status of GITR as a marker? Shevach: It’s useless. Just like CD25! It basically marks the CD25+ population in the normal mouse. It is induced with activation, with roughly the same kinetics as CD25. 100% of activated CD25 T cells express GITR after three days of polyclonal activation by anti-CD3. Bluestone: There’s one exception in vivo. There is a drug on the market, an antiCD25 monoclonal antibody that works because it blocks pathogenic processes in vivo. The anti-GITR doesn’t appear to do this in vivo. If anything, it promotes pathogenic responses. Shevach: We are talking about using them as markers here; function is a completely di¡erent story. Mitchison: Why do you say it is useless? It has the same properties as CD25. It may not be improvement, but surely it isn’t useless. Shevach: The most useful marker would be one that di¡erentiates a suppressor from an activated e¡ector. Bach: What is the distribution of GITR among T cells? Shevach: It basically marks the CD25+ population. Sakaguchi: There is still the possibility that CD25 but GITR+ cells in the CD4+ population may have some regulatory activity, although they are less regulatory than CD4+CD25+ T cells. If it is the case, it may explain why some CD4+CD25 T cells, which are CD45RBlow, sometimes show a regulatory activity. Hasenkrug: Could you explain the e¡ect on loss of memory by anti-CD25? Shevach: In the L. major model loss of antigen leads to loss of T cell memory. Bluestone: This has been known in transplantation for a long time; it is not just in infectious diseases. It is generally true that tolerance is active, and in the absence of antigen tolerance is lost.

40

DISCUSSION

Hasenkrug: We are talking about antigen-speci¢c memory. Ra⁄ Ahmed has shown elegantly that antigen is not needed for the maintenance of immunological memory (Murali-Krishna et al 1999). Shevach: This is for CD8+ cells and viruses. Abbas: It has also been shown for CD4+ cells, and it has been shown with conditional knockout of T cell receptors. This could very well be a quantitative thing. David Sacks’ lab probably uses a large challenge of Leishmania. In order for immunity to be maintained to a large high-dose challenge you may need continuous low level activation. Shevach: I don’t think so. Abbas: It is now well established that in order to maintain T cell memory you don’t need antigen recognition. Shevach: I disagree. It depends on the infection. Hasenkrug: You don’t know what the mechanism is for the loss of memory here. It may not be loss of antigen. Shevach: The antigen goes away. No L. major can be isolated from the ears of mice that have been treated with anti-IL10 receptor. Hasenkrug: That doesn’t mean that this is the cause of the loss of memory, though. Powrie: Does anti-CD25 do the same as anti-IL10 receptor? You were suggesting that anti-IL10 receptor is solely a¡ecting the regulatory T cell. Shevach: We haven’t tested the e¡ects of anti-CD25 depletion in the L. major model. Bach: I’d like to come back to the interesting discussion about the ligand. What do you know about this ligand? Shevach: Not much! We are currently doing expression studies to see where and when it is expressed. As far as I know there is no antibody to the mouse ligand, and no one has really studied the tissue distribution of the mouse ligand. What has been published is with the human ligand, and involves rather cursory blots of tissue extracts, and some subtle things could easily have been missed. The gene was cloned from an endothelial cell library, so endothelial cells were positive. We cloned it from a thymocyte library. Mitchison: Ethan, I suppose you know that recombinant immunotoxins targeting CD25 are used to treat Sezary’s syndrome (Kreitman 2001). Do you know anything about any side e¡ects of this treatment? Shevach: Robert Nussenblatt and collaborators at the NEI/NIH (Nussenblatt et al 1999) have been treating an autoimmune uveitis with anti-CD25 to inhibit e¡ector cell function. What Bob told me is that in about a dozen patients they have had remarkable therapeutic success. These patients have been taken o¡ other immune suppressors. They treat the patients only with the humanised antiCD25 antibody, which is non-depleting and blocks the action of IL2. In the

CD4+CD25+ SUPPRESSOR T CELLS

41

peripheral blood of the patients, they ¢nd cells coated by the antibody. Presumably, these are the normal CD25+ T cells and this has nothing to do with the therapeutic e¡ects of the antibody, which is probably blocking the ability of IL2 to stimulate e¡ector cells. Ha£er: At the Federation of Clinical Immunology Society meeting Roland Martin presented phase I trials with anti-CD25 monoclonal antibody in multiple sclerosis patients (MS). There was a decrease in new lesions on magnetic resonance imaging. One interesting ¢nding was a marked increase in expression of CTLA4 on CD4+ cells in the peripheral blood. Bach: There has been a lot published on the use of anti-CD25 antibody in transplantation. It is interesting that so far there have been no data suggesting any side e¡ects in terms of induction of autoimmunity. Another drug that had the potential to elicit autoimmunity was cyclophosphamide. In experimental models this drug-enhanced autoimmunity in the NOD mouse. So far I have just seen one paper indicating that cyclophosphamide in humans will enhance autoimmunity. Ha£er: It’s a major treatment for autoimmune diseases. Returning to my previous comment, we are going to start anti-CD25 treatment in MS patients. An obvious question is to look at these regulatory T cells, and whether this antibody has the paradoxical e¡ect of increasing their function. Bluestone: What will you use as a marker? Ha£er: We will look at suppressor function using CD25high populations. Bluestone: That’s a problem. We have talked to a lot of people who do these studies. As a minimum, you block the receptor with the antibody. What most people have found is that the receptor levels go down signi¢cantly after treatment with anti-CD25 in transplants. You need another marker. Ha£er: That is a good point, we may want to try other markers of these T cells if they can be found. Abbas: Most of the transplant studies have been done with either cyclosporin or rapamycin. I wonder if anyone has looked at the ability of cyclosporin to block suppressor function? Chatenoud: The meaningful experiments are those in vivo showing that each time one treats with a monoclonal antibody, such as anti-CD3 in the NOD mouse or CD40 ligand in the transplant situation, cyclosporine given in the ¢rst few days after the treatment will prevent the tolerance induction. It doesn’t happen if cyclosporine treatment is begun after the end of the treatment with the biological agent. Abbas: But those experiments haven’t looked at the e¡ects of cyclosporine on regulatory T cells. Wood: In our system where we use antigen and anti-CD4 to set up tolerance before we challenge with the graft, if we give a high dose of cyclosporine or

42

DISCUSSION

FK506 at the time we are inducing unresponsiveness, we can’t identify functional CD25+ cells at the time of transplant. If we don’t give the cyclosporine of FK506 we generate CD25+ alloantigen-speci¢c cells. Abbas: Then the combination of cyclosporine and anti-CD25 would accelerate graft rejection, if you accept all these data. Bluestone: No, because the anti-CD25 still blocks/depletes the e¡ector cell. Chatenoud: You need to look at how the combination is done. Usually, the cyclosporine is given at the end of the antibody treatment. Bach: There was a paper by G. Opelz, who established a transplant registry that allowed him to compare the e¡ect of various drug combinations in a large set of patients (Opelz 1995). Interestingly, when two groups of patients were compared, one of which had anti-CD3 and cyclosporine given at the same time, and anti-CD3 antibody alone and starting cyclosporine later, the second group did signi¢cantly better than the ¢rst one. There are also data on the e¡ects of corticosteroids. The idea is that the systematic association of cyclosporine and corticosteroids in protocols aiming at tolerance induction is not very good, although in practice there are many patients who become quasi-tolerant after some years. Rapamycin, as far as we know, does not interfere with the induction of regulation. Bluestone: Everyone is talking about single markers, but is there a cocktail that one could use? The one we use is CD62L in conjunction with CD25+. E¡ector T cells, for the most part, don’t express CD62L. These cells do look like activated cells in some ways, but in other ways they resemble na|« ve cells. Shevach: I don’t think so. CD62L can go down and come up on an e¡ector cell. None of these markers are absolute. If one looks in a chronic situation where you have e¡ector cells, what can you say about CD62L expression? Is it the perfect marker for a na|« ve cell? In our hands, CD62low CD25+ cells also have suppressive functions. Powrie: What about CD103 (aE integrin)? Shevach: It is expressed on every intraepithelial lymphocyte. Mowat: When you were talking earlier about the 30% of CD4+CD25+ cells that were aE positive, was this from peripheral tissues? Shevach: Yes, peripheral lymph node. Mowat: Even in the lamina propria of the gut, only about 30^40% of the CD4+ cells are aE-positive. Shevach: CD103 doesn’t go up in the CD25 cells after they are activated, in contrast to GITR and OX40. Bach: I have a question concerning CD122. You mentioned that CD25+ T cells express the b chain of IL2. To what extent do they do this in the mouse, and can you comment about the role of the IL2 receptor in the function of these cells?

CD4+CD25+ SUPPRESSOR T CELLS

43

Shevach: In the mouse, the antibody to the IL2 receptor b chain is a rather weak reagent and doesn’t stain very well. CD25+ T cells express high levels of CD122 mRNA. In the functional experiment I showed, the anti-GITR doesn’t induce the IL2Rb, yet the cells respond to 10 units of IL2, which would require the expression of the entire IL2R complex. Functionally, they behave as if they express CD122. Several groups have shown that you can stain all human CD25+ cells with antiCD122. Chatenoud: The di¡erence between the expression of the a chain alone or the a, b, g is that the a⁄nity is not the same. The ¢rst data that I recall from the one of the initial papers by with Shimon Sakaguchi is that the regulatory CD4+CD25+ emigrating from the thymus only expressed the a chain of the receptor. This means they may need a lot of IL2 in order to proliferate. Shevach: They don’t appear to express the b chain because the antibody used is a poor one. If you look at the mRNA level they have the b chain. Chatenoud: The issue can be solved on a pharmacological basis: what is the a⁄nity of the receptor they express? High, intermediate or low? Powrie: In the human thymus they express the b chain. Chatenoud: This could just be a di¡erence between humans and mice. It is an important question, because this might represent a way to di¡erentiate conventionally activated cells that express a high-a⁄nity IL2 receptor from those only expressing the a chain. The issue is still open. Shevach: One could do the pharmacological experiments, but functionally it is much more complicated. We all trigger these cells in vitro with lots of IL2, but they have something that prevents them from responding to IL2 unrelated to the a⁄nity of their receptors. This is a tricky business. Harrison: Didn’t you once say that when they are activated their SOCS2 expression rises? Shevach: Yes, it goes up a lot. Harrison: Perhaps that is why they don’t respond to growth factors? Bluestone: The other thing they express highly is LKLF. They won’t go into cycle as long as they are expressing this. Bach: Shimon Sakaguchi, did you say that when you add IL2 they proliferate, and then they do not suppress any more? Sakaguchi: If you add a high dose of IL2, along with TCR stimulation, the CD25+CD4+ regulatory T cells lose regulatory activity. In addition to this e¡ect of IL2 on the suppression, IL2 and IL2 receptors on CD25+ cells are important for their survival. If you inject anti-IL2 antibody in vivo only once, the CD25+ cell pool gradually decreases and in two or three months autoimmune disease develops. Abbas: There are data coming out from several di¡erent labs using IL2 or IL2 receptor knockouts, suggesting that IL2 is required for the maintenance of these

44

DISCUSSION

regulatory cells. Other people are suggesting that it is needed for suppressive function. Mowat: What about IL15 knockouts? Abbas: There is no evidence for abnormalities in regulatory T cells. References Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL 2002 CD4+CD25+ immunoregulatory T lymphocytes control Leishmania major persistence and the development of concomitant immunity. Nature 420:502^507 Kreitman RJ 2001 Toxin-labeled monoclonal antibodies. Curr Pharm Biotechnol 2:313^325 Murali-Krishna K, Lau LL, Sambhara S, Lemonnier F, Altman J, Ahmed R 1999 Persistence of memory CD8 T cells in MHC class I-de¢cient mice. Science 286:1377^1381 Nussenblatt RB, Fortin E, Schi¡man R et al 1999 Treatment of noninfectious intermediate and posterior uveitis with the humanized anti-Tac mAb: a phase I/II clinical trial. Proc Natl Acad Sci USA 96:7462^7466 Opelz G 1995 E⁄cacy of rejection prophylaxis with OKT3 in renal transplantation. Collaborative Transplant Study. Transplantation 60:1220^1224

Regulation of experimental autoimmune encephalomyelitis (EAE) by CD4+CD25+ regulatory T cells Adam P. Kohm, Pamela A. Carpentier and Stephen D. Miller1 Department of Microbiology-Immunology and the Interdepartmental Immunobiology Center, Northwestern University Medical School, Chicago, IL 60611, USA

Abstract. Multiple endogenous mechanisms exist to inhibit thymic development of functional autoreactive T cells. In spite of this, autoreactive CD4+ T cell populations persist in normal individuals and retain the capacity to initiate autoimmune disease. Thus, additional regulatory mechanisms operative in the peripheral immune system are required to protect against both the generation of self-directed immune responses and the initiation of autoimmune diseases. One such mechanism involves the active inhibition of T cell responses by CD4+CD25+ regulatory T (Treg) cells. In this study, we investigated the protective role of Treg cells during experimental autoimmune encephalomyelitis (EAE), a model of multiple sclerosis (MS). Our ¢ndings indicate that Treg cells confer signi¢cant protection from the development of MOG35^55-induced EAE that may result from the promotion of a protective Th2 response and decreased homing of autoreactive cells to the CNS. Importantly, Treg cells di¡erentially expressed elevated levels of ICAM1 and P selectin, molecules which may facilitate T^T cell interactions and contribute to the mechanism by which Treg cells inhibit CD4+ T cell responses. Collectively, these ¢ndings support a role for Treg cells as an active regulatory mechanism that may protect individuals from the onset of MS, as well as other autoimmune diseases. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 45^54

Several endogenous regulatory mechanisms are operative during thymic development of CD4+ T cells which aid in preventing the generation of selfreactive T cells. However, the emergence of autoreactive T cell populations appears to be inevitable, since these populations persist in normal individuals and 1This

chapter was presented at the symposium by Stephen D. Miller, to whom correspondence should be addressed. 45

46

KOHM ET AL

retain the capacity of initiating and/or propagating various autoimmune diseases (Kreuwel & Sherman 2001). To combat this, numerous protective mechanisms, such as activation-induced anergy and various regulatory cell populations, have evolved with the collective goal of inhibiting the generation and/or e¡ector functions of autoreactive CD4+ T cells. One such immunoregulatory population is the T regulatory (Treg) cell which is typically de¢ned as the CD4+CD25+CD62Lhigh population of cells in na|« ve mice. While Treg cells may be divided into subpopulations based upon the expression of several surface molecules, such as CD62L, CD38, and CD45RB, each subpopulation appears to retain a functional equivalent immunosuppressive phenotype in vitro (Kuniyasu et al 2000). While there is a general agreement that Treg cells inhibit CD4+ T cell proliferation in a TCR-dependent manner (Thornton & Shevach 2000), there is less agreement on whether Treg cells target APC function or directly in£uence e¡ector T cell responses via T^T cell interactions (reviewed in Shevach 2002). Further controversy surrounds the mechanism by which Treg cells exert their immunosuppressive function with proposed functional mediators including interleukin (IL)10, surface CTLA4 expression, surface CD25 expression that functions as an IL2 ‘sink’, co-stimulatory molecule blockade, and surface or secreted TGFb expression (Shevach 2002). Regardless, Treg cells appear to inhibit both the initiation of na|« ve CD4+ T cell responses, as well as restimulation of previously activated cells, and therefore may be active regulators of autoimmune responses at the a¡erent and/or e¡erent levels. In the current study, we investigate the contribution of Treg cells to the regulatory mechanisms associated with the initiation and progression of experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis (MS). MOG35^55-induced EAE in C57BL/6 mice (Mendel et al 1995) is a CD4+ Th1 cell-mediated autoimmune disease (Begolka et al 1998) in which MOG35^55-speci¢c autoreactive T cells enter the CNS to initiate a cascade of in£ammation, tissue destruction, and demyelination leading to clinical paralysis. Collectively, our ¢ndings support a role for Treg cells in conferring protection against the progression of MOG35^55-induced EAE. This protective Treg cell phenotype may be mediated, in part, by promoting a disease-protective Th2-like immune response and/or preventing CNS in£ammation, possibly via mechanisms involving elevated levels of ICAM1 and P selectin. Together, these ¢ndings support a role of Treg cells in conferring protection against the onset of autoimmune demyelination. Treg cells inhibit autoantigen-speci¢c Th1 responses in vitro In vivo work from several groups strongly supports a role for Treg cells in conferring protection against autoimmune diseases (Sakaguchi et al 1995,

CD4+CD25+ Treg CELLS PROTECT AGAINST EAE PROGRESSION

47

TABLE 1 E¡ect of Treg cells on proliferation and IFN-c production of a MOG35^55-speci¢c Th1 line Regulatory cells employed a

MOG35^55 Th1 e¡ector function b

Phenotype

Source

Pre-treatment

Proliferation

IFNg Production

CD4+CD25

Spleen

None

+++

+++

Non-Treg

Spleen

rIL2

+++

+++

Lymph node

None

+++

+++

Lymph node

rIL2

+++

+++

CD4+CD25+

Spleen

None

Treg

Spleen

rIL2

Lymph node

None

Lymph node

rIL2

a CD4+CD25+ Treg or CD4+CD25 non-Treg cells were derived from either the spleens or peripheral lymph nodes of na|« ve C57BL/6 mice and co-cultured with a given number of a MOG35^55-speci¢c Th1 line either directly or after incubation in recombinant IL2 (rIL2) for 24 hours. b +++, normal proliferation or IFNg production as compared to cultures with no added cells; , inhibited proliferation or IFNg production as compared to cultures with no added cells.

Suri-Payer et al 1998, Salomon et al 2000, Read et al 2000, Furtado et al 2001). To begin dissecting the role of Treg cells in regulating self-directed immune responses during EAE, we utilized a Th1 line speci¢c for an immunodominant epitope of myelin oligodendrocyte glycoprotein (MOG35^55) known to initiate EAE in C57BL/6 mice. In agreement with ¢ndings from previous studies employing mitogenic stimulation, Treg cells isolated from either the spleen or lymph nodes of na|« ve mice inhibited both the proliferation of and interferon (IFN)g production by MOG35^55-speci¢c T cells in vitro (Table 1). While one interpretation of the Treg cell-induced inhibition of IFNg production may be that Treg cells directly inhibit the e¡ector function/activation of target CD4+ T cells, it is also possible that Treg cells simply function to block the expansion of an antigenspeci¢c population of T cells. Importantly, previous ¢ndings suggest that TR cells fail to prevent the initial activation of target CD4+ T cells, but subsequently induce cell cycle arrest (Thornton & Shevach 2000). During this scenario, the target CD4+ T cells may receive adequate activation signals to di¡erentiate into fully functional e¡ector cells, but the function of these cells may be limited by the

48

KOHM ET AL

induction of cell cycle arrest at some point following 24 hours of activation. Such a mechanism may explain the observed Treg-induced e¡ects on both proliferation and cytokine production, since additional signalling events within the target T cell may accompany the induction of cell cycle arrest to in£uence functional aspects of the cell. However, currently it is still unclear whether the measured reduction in IFNg production is the result of direct e¡ects on cytokine production or whether it is simply a consequence resulting from the inhibition of antigen-speci¢c cell expansion. Elevated CD25 (IL2 receptor) expression is a hallmark of the Treg cell phenotype (Sakaguchi et al 1995) and a number of studies have reported that the addition of exogenous rIL2 to Treg cell/CD4+ T cell co-cultures reverses the suppressive phenotype of regulatory cells (Thornton & Shevach 1998, Itoh et al 1999). Such an observation is supported by the ¢ndings that Treg cells may inhibit the production of IL2 (Thornton & Shevach 1998). However, the possibility remains that the apparent in£uence of Treg cells on IL2 production may be the result of an alternative overriding mechanism a¡ecting multiple parameters of T cell function. Alternatively, intracellular signals originating from IL2 receptor stimulation may directly in£uence Treg cell e¡ector function. However, ¢ndings from the current study do not support this hypothesis, since overnight incubation in the presence of rIL2 prior failed to in£uence Treg cell function (Table 1). In light of this, the present studies support the expression of CD25 as a phenotypic, but not functional, marker of Treg cells. However, since the kinetics of IL2 exposure may be a critical factor in this model system, we currently cannot discount the functional contribution of elevated CD25 expression to Treg cell function. Regardless of the exact mechanism by which Treg cells exert their e¡ector function, in vitro ¢ndings support a protective role for Treg cells during autoimmune responses by preventing autoreactive T cell function. Treg cells confer protection against EAE disease progression Several previous studies have investigated the role of Treg cells in regulating T cell e¡ector function in models of autoimmune disease as well as transplant rejection. Consistent with their proposed role as active regulators of autoimmune responses, the depletion of Treg cells in neonatal animals results in the spontaneous induction of autoimmune gastritis in both the thymectomy and nu/nu model systems (Sakaguchi et al 1995, Suri-Payer et al 1998) and Treg cells also block the gastritis resulting from the transfer of H/K ATPase-speci¢c e¡ector T cells. Similarly, the co-transfer of Treg cells in an adoptive model of diabetes conferred signi¢cant protection against the onset of diabetes in the non-obese diabetic (NOD) mouse (Salomon et al 2000), suggesting that Treg cells may in£uence both na|« ve and established immune responses. Thus, Treg cells may block the initiation of

CD4+CD25+ Treg CELLS PROTECT AGAINST EAE PROGRESSION

49

TABLE 2 CD4+CD25+ Treg cells inhibit the progression of MOG35^55-induced EAE in na|« ve C57BL/6 recipients Cells transferred to na|« ve C57BL/6 recipients a

Incidence of disease b

Mean day of onset (SEM) c

Mean peak clinical score (SEM)d

None 2106 CD4+CD25 non-Treg 2106 CD4+CD25+ Treg

5/5 5/5 4/5

15.40.25 15.60.25 16.81.29

2.20.20 2.40.25 1.40.4*

a

Na|« ve C57BL/6 mice were primed with MOG35^55/CFA 3 days following adoptive transfer of 2106 CD4+CD25 non-Treg cells or CD4+CD25+ Treg cells puri¢ed from na|« ve C57BL/6 donors. Data are representative of multiple experiments. b Number of clinically a¡ected animals/total number of immunized mice. c Mean day of ¢rst appearance of clinical signs of disease. d Mean clinical score for animals at the peak of disease. *P50.05 vs. recipients of both no cells and of 2106 CD4+CD25 non-Treg.

aberrant immune responses, as well as inhibiting the function of established autoreactive e¡ector cells. To extend these ¢ndings, we investigated the role of Treg cells in regulating the progression of EAE. MOG35^55-induced EAE (Mendel et al 1995) is a CD4+ Th1mediated autoimmune disease (Begolka et al 1998) in which autoreactive T cells speci¢c for myelin components enter the CNS resulting in a cascade of in£ammation, tissue destruction, and demyelination. To determine the role of Treg cells in regulating the progression of MOG35^55-induced EAE, we isolated Treg cells from lymph nodes of na|« ve C57BL/6 donors and 2106 cells were adoptively transferred into na|« ve recipients 3 days prior to active induction of EAE. Consistent with previous ¢ndings, supplementation of the Treg cell population suppressed the development of clinical paralysis (Table 2), prevented CNS in£ammation and increased the number of T cells secreting Th2-like cytokines, such as IL4 and IL5 (data not shown). This elevated number of MOG35^55-speci¢c Th2 cells may be a result of Treg cell-mediated inhibition of the pathogenic Th1-like responses which may then ablate inhibitory in£uences on the expansion of both antigen-speci¢c and bystander Th2 responses. However, the number of cells secreting EAE-promoting Th1 cytokines, such as IFNg and tumour necrosis factor (TNF)a (Karin et al 1994, Begolka et al 1998), were similar in both the lymph nodes and spleen at the peak of disease in both Treg and non-Treg recipients. This ¢nding is surprising, since Treg cells e¡ectively inhibit the expansion of antigen-speci¢c T cell populations in vitro as previously discussed. While it is possible that Treg cells directly in£uence Th2 cell function, no studies have examined the e¡ect of Treg cells on either na|« ve T cell di¡erentiation or the e¡ector function of di¡erentiated Th1 and Th2 cells, with the exception of the

50

TABLE 3 Treg cells

KOHM ET AL

Adhesion molecule and chemokine receptor expression on CD4+CD25+

Adhesion molecule/chemokine receptor a4-integrin (CD49d)

ICAM1 (CD54) ICAM2 (CD102) VLA4 (a4b1 integrin) (CD49d/CD29) E selectin (CD62E) P selectin (CD62P) L selectin (CD62L) CD44 LFA1a (CD11a)

Relative expression on CD4+CD25+ Treg cells as compared to CD4+CD25 Non-Treg cells a + ++ + ++ ++

CXCR3 CCR5 a Expression levels the same ( ), elevated (+) or signi¢cantly elevated (++) on CD4+CD25+ Treg cells as compared to CD4+CD25 non-Treg cells.

MOG35^55-speci¢c Th1 cells used in the current study (Table 1). Thus the possibility exists that Treg cells may di¡erentially in£uence either the di¡erentiation or function of these two populations. In light of the possible mechanisms by which Treg cells may in£uence T cell function, additional studies are necessary to further dissect the mechanism by which Treg cells modulate CD4+ T cell function and autoimmune disease progression. Adhesion molecule and chemokine receptor expression on Treg cells Chemokine gradients originating from the site of antigenic challenge serve as a probable means of regulating Treg cell tra⁄cking in vivo. However, there are few reports of di¡erential chemokine receptor expression on Treg cells in comparison to non-Treg cells. In support of this possibility, a recent study reported the speci¢c expression of CCR8 by Treg cells, in comparison to non-Treg cells (Iellem et al 2001). To extend these ¢ndings, we examined the expression of additional chemokine receptors on Treg cells but observed no alterations in the level of either CXCR3 or CCR5 expression on the Treg cell surface, in comparison to na|« ve CD4+CD25 T cells (Table 3). Importantly, our future studies will continue to investigate both the regulation and function of chemokines on resting and activated Treg cell populations.

CD4+CD25+ Treg CELLS PROTECT AGAINST EAE PROGRESSION

51

An alternative mechanism that may in£uence Treg cell homing is the di¡erential expression of adhesion/integrin molecules. Our results support this possibility, since we have found that both ICAM1 and P selectin expression were signi¢cantly elevated on resting Treg cells, in comparison to non-Treg cells (Table 3). These ¢ndings were surprising, since previous reports concerning P selectin expression have been limited to activated platelets and endothelium (Shebuski & Kilgore 2002). However, since P selectin is known to facilitate T cell^endothelium interactions (Luscinskas et al 1995), elevated expression of this adhesion molecule may prove to be one mechanism promoting the direct interaction of Treg cells with target CD4+ T cells in vivo. This is an attractive hypothesis, in light of previous ¢ndings suggesting that Treg cells must directly interact with target T cells to exert their suppressive phenotype, and we are currently examining the contribution of P selectin/P selectin ligand interactions to governing Treg function both in vitro and in vivo using the EAE model. Acknowledgements This work was supported in part by U.S. Public Health Service National Institutes of Health Research Grants NS30871 and NS26543.

References Begolka WS, Vanderlugt CL, Rahbe SM, Miller SD 1998 Di¡erential expression of in£ammatory cytokines parallels progression of central nervous system pathology in two clinically distinct models of multiple sclerosis. J Immunol 161:4437^4446 Furtado GC, Olivares-Villagomez D, Curotto de Lafaille MA, Wensky AK, Latkowski JA, Lafaille JJ 2001 Regulatory T cells in spontaneous autoimmune encephalomyelitis. Immunol Rev 182:122^134 Iellem A, Mariani M, Lang R et al 2001 Unique chemotactic response pro¢le and speci¢c expression of chemokine receptors CCR4 and CCR8 by CD4+CD25+ regulatory T cells. J Exp Med 194:847^853 Itoh M, Takahashi T, Sakaguchi N et al 1999 Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317^5326 Karin N, Mitchell DJ, Brocke S, Ling N, Steinman L 1994 Reversal of experimental autoimmune encephalomyelitis by a soluble peptide variant of a myelin basic protein epitope: T cell receptor antagonism and reduction of interferon gamma and tumor necrosis factor alpha production. J Exp Med 180:2227^2237 Kreuwel HT, Sherman LA 2001 The T-cell repertoire available for recognition of self-antigens. Curr Opin Immunol 13:639^643 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S 2000 Naturally anergic and suppressive CD25+CD4+ T cells as a functionally and phenotypically distinct immunoregulatory T cell subpopulation. Int Immunol 12:1145^1155 Luscinskas FW, Ding H, Lichtman AH 1995 P-selectin and vascular cell adhesion molecule 1 mediate rolling and arrest, respectively, of CD4+ T lymphocytes on tumor necrosis factor alpha-activated vascular endothelium under £ow. J Exp Med 181:1179^1186

52

DISCUSSION

Mendel I, Kerlero de Rosbo N, Ben-Nun A 1995 A myelin oligodendrocyte glycoprotein peptide induces typical chronic experimental autoimmune encephalomyelitis in H-2b mice: ¢ne speci¢city and T cell receptor V beta expression of encephalitogenic T cells. Eur J Immunol 25:1951^1959 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Salomon B, Lenschow DJ, Rhee L et al 2000 B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431^440 Shebuski RJ, Kilgore KS 2002 Role of in£ammatory mediators in thrombogenesis. J Pharmacol Exp Ther 300:729^735 Shevach EM 2002 CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389^400 Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1998 CD4+CD25+ T cells inhibit both the induction and e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Thornton AM, Shevach EM 2000 Suppressor e¡ector function of CD4+CD25+ immunoregulatory T cells is antigen nonspeci¢c. J Immunol 164:183^190

DISCUSSION Abbas: I can see why you think that P selectin might be involved in the homing of these T cells to the site of in£ammation. But what is it doing in the in vitro suppression assay? Miller: That’s a great question. Perhaps it is putting the target cells and e¡ector cells together, to allow the suppressive signal to be delivered. Abbas: Do e¡ector Th1 cells express PSGL1? Miller: Yes. E¡ector Th1 cells do express the P selectin ligand, PSGL1, but we haven’t used the antibody to try to inhibit the regulation by the wild type T regulatory cells. This is in progress. Mitchison: You still have to ¢nd out whether the e¡ects seen in vivo are the result of a Th2 shift, or a direct e¡ect on the expansion of Th1 cells. Miller: The anti-IL4 experiment needs to be done in vivo to see whether this is the actual mechanism, or whether it is something to do with the limited expansion of antigen-speci¢c cells in the T regulatory cell recipients. Shevach: The way you immunize mice de¢nitely generates IFNg production in bulk cultures. So what happened in those supernatants? You say you didn’t suppress IFNg, but what happens if you look in the supernatants instead of the Elispots?

CD4+CD25+ Treg CELLS PROTECT AGAINST EAE PROGRESSION

53

Miller: Thus far we have only assayed responses by Elispot and have not looked at IFNg in the culture supernatants. Shevach: How does 7D4 monoclonal anti-CD25 deplete? It is an IgM antibody. My impression was that IgMs don’t deplete well. Miller: It depletes perfectly well. In fact, the other anti-CD25 antibody doesn’t deplete as e⁄ciently in our hands. Powrie: PC61 de¢nitely depletes. Sercarz: Ordinarily we get these ordered relapses in the SJL model. In this case, when you have depleted the CD25s, do you get an explosion of many responses directed against multiple myelin epitopes involved in epitope spreading? Miller: That is a great question; we are looking at this now. Bach: SJL mice have another defect, which is in their NKT cells. It is interesting to note that both NOD mice and SJL mice have a defect in NKT cells. Is this because of a problem in the thymus? As far as NKT cells are concerned, we believe the NKT defect is IL7 dependent. Abbas: You enhanced PLP disease in the SJL mice in which T regulatory cells were depleted using anti-CD25. Can you reveal disease with PLP in the SJL strain? Have you treated a normally PLP-resistant strain with anti-CD25? Miller: You need a system where the animal can respond to the epitope presented by that MHC. I don’t know of an epitope like that in SJL mice. Bluestone: What about B10.S? Miller: That could be possible because B10.S is semi-resistant to PLP139induced EAE. Shevach: Some of the epitopes in BALB/C are known and they are pretty resistant. Miller: I would use the BALB/c because this is the strain that Jim Allison has shown can be made susceptible using anti-CTLA4. Bluestone: I’d like to ask a question about the tra⁄cking issue. Might P selectin and tra⁄cking be a red herring? Miller: At this point we are not sure. We know that EAE transfer is not dependent on P and E selectin. It has been published that the anti-P and anti-E delivered in combination will not inhibit EAE transfer. A colleague of mine at Northwestern has P selectin and E selectin double knockouts, and we have shown that they get EAE much more severely than wild-type mice. Bluestone: I have a general question. We have all become pretty enamoured with the adoptive transfer model, but at some level it is surprising to me. We are taking a million cells, putting them into an animal that must have 2 or 3 million regulatory cells already. This is enhancing the frequency by 50%, and all of a sudden it goes from a big disease to one where there is little or no in£ammation anymore. The other thing is that we see the transferred cells home primarily to the lymph nodes and not to the spleen, yet we know that regulatory cells are in the spleen. Is there

54

DISCUSSION

something about the way that we purify the cells, and then put them back in i.v., that causes them to fail to home normally? There seems to be something odd about the way that we set up the experiments, in terms of where these cells go. Shevach: The way one normally puri¢es CD25+ cells by positive selection leaves them covered with £uorescent beads. Bluestone: I don’t know a good way around this per se, except that we always try complement positive selection experiments with a depletion experiment which helps. It strikes me that we are going to be misled in some of our chemokine and tra⁄cking experiments if we rely on the adoptive transfer model only. Von Herrath: If you give them i.v. the majority will initially be in the lung. Bach: In many other models when you do transfer experiments in immunode¢cient animals there is the pitfall of homeostasis-driven proliferation. This doesn’t apply here though. Mowat: Does the P selectin mouse have any autoimmune phenotype? Miller: Other than our ¢nding that they are hypersensitive to MOG peptideinduced EAE, not that I am aware of. I don’t know whether anyone has really looked at this in terms of spontaneous autoimmunity.

The role of CD28 and CTLA4 in the function and homeostasis of CD4+CD25+ regulatory T cells Elisa Boden, Qizhi Tang, Helene Bour-Jordan and Je¡rey A. Bluestone1 UCSF Diabetes Center, University of California, San Francisco, 513 Parnassus Avenue, Box 0540, HSW Room 1114, San Francisco, CA 94143-0540, USA

Abstract. CD4+CD25+ T cells regulate a variety of autoimmune and alloimmune responses including the development of autoimmune diabetes in non-obese diabetic (NOD) mice. We have examined the role of CD28/CTLA4/B7 interactions in the expansion and survival of CD4+CD25+ regulatory T cells (Treg) in this setting. CD28/ B7 interactions are essential in the development of Treg in the thymus and for their survival in the periphery. The CD28-mediated homeostasis of these cells is independent of IL2, OX40, CD40L, and survival factor Bcl-XL. In addition, analysis of Treg from CTLA4-de¢cient mice suggests that CTLA4 expression is not required for their development or function. However, non-activating anti-CTLA4 antibodies blocked the suppressor activity of regulatory cells in vitro. Thus, clinical application of co-stimulatory blockade using agents such as CTLA4Ig in the treatment of autoimmune disease may result in complicated outcomes. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 55^66

The ability of the immune system to di¡erentiate between self and non-self provides defence against foreign pathogens while preserving the integrity of host tissues. Several mechanisms have been implicated in the induction of T cell tolerance to self-antigen that prevents the development of autoimmunity. Central tolerance is achieved in the thymus via deletion of T cells with high a⁄nity receptors for thymic self-antigens (Kappler et al 1987, Kisielow et al 1988). Peripheral tolerance provides a second level of protection, whereby selfreactive T cells that have escaped thymic deletion are rendered anergic or are deleted upon encounter with self-antigen in the periphery (Rocha & von Boehmer 1991). We now know that peripheral self-tolerance is actively maintained by a subset of CD4+ T cells with immunoregulatory function that 1This

paper was presented at the symposium by Je¡rey A. Bluestone, to whom correspondence should be addressed. 55

56

BODEN ET AL

constitutively express the interleukin (IL)2 receptor a chain, CD25 (Sakaguchi et al 1995, Asano et al 1996). CD4+CD25+ regulatory T cells (Treg) constitute 5^ 15% of peripheral CD4+ T cells in both mice and humans and exhibit potent in vitro and in vivo regulatory activity (Sakaguchi et al 1995, Thornton & Shevach 1998, Dieckmann et al 2001, Jonuleit et al 2001, Levings et al 2001, Stephens et al 2001, Taams et al 2001). These cells have been shown to regulate a number of autoimmune syndromes in mouse and rats and, most recently, have been implicated in the regulation of several diseases in humans (Herold et al 2002). This presentation addresses the role of Treg in NOD mice. The potential importance of cell surface molecules including CD28 and CTLA4 is discussed in the context of regulatory T cell development and function. The data suggest that the homeostasis of these cells is maintained as a dynamic population likely controlled by continued interaction with nominal antigens. CD4+CD25+ control of autoimmune diabetes in NOD mice is CD28-dependent The role of CD28 co-stimulation has been studied in the spontaneous autoimmune T cell-mediated diabetes of NOD mice. Surprisingly, although CD28 interaction with B7 molecules is believed to play a major role in T cell activation, CD28 knockout (KO) and B7-1/B7-2 KO NOD mice develop early onset and higher incidence of diabetes compared to their littermate controls. Similar ¢ndings were obtained in transgenic NOD mice that express the gene for production of soluble CTLA4Ig and in NOD mice treated with murine CTLA4Ig treatment at 2^4 weeks of age corresponding to the ¢rst visible signs of the autoreactive process (Lenschow et al 1996, Salomon et al 2000). CD4+CD25+ regulatory T cells constitute about 5% of the circulating CD4+ T cells in NOD mice (Salomon et al 2000). Although this number is signi¢cantly lower than that observed in other strains, NOD Treg are functionally competent since adoptive transfer of puri¢ed regulatory cells suppress disease mediated by diabetogenic CD4+ T cells. Examination of NOD mice in which the CD28/B7 pathway was disrupted demonstrated a profound decrease in the number of peripheral CD4+CD25+ T cells. Reversal of disease was achieved by reconstitution of the CD4+CD25+ T cell population from wild-type NOD mice, implicating CD28/B7 interaction in the peripheral homeostasis of CD4+CD25+ cells (Salomon et al 2000). Role of CD28 pathway in homeostasis of Treg cells The previous studies using knockout mice could not distinguish a role for CD28 in thymic development versus peripheral homeostasis of Treg. We therefore injected normal mice with CTLA4Ig or with a combination of anti-B7-1 and anti-B7-2

CD28 AND CTLA4

57

monoclonal antibodies (mAbs) and monitored the number of CD4+CD25+ T cells in the periphery and thymus. The mice treated with CD28 antagonists demonstrated a 60^80% reduction in Treg in the periphery. This was not simply a result of a loss of CD25 expression as similar results were obtained using CSFE (carboxy£uorescein succinimidyl ester) to track transferred Treg in vivo. In addition, CD28/ B7 blockade in thymectomized wild-type mice resulted in a similar reduction in Treg consistent with a direct role for CD28 in peripheral expansion and/or survival of the Treg population. However, these results did not rule out a potential role for CD28 in Treg development. In fact, CD28 KO mice showed a clear reduction of CD4+CD25+ cells in the thymus. The Treg population was reduced to a similar degree in the thymus and in the periphery following treatment of wild-type mice with CD28 antagonists. These data suggest an important role for CD28 in both the development and maintenance of the Treg subset. Several mechanisms can be envisioned to explain the e¡ects of CD28 blockade on regulatory T cell development and activity. First, it is possible that CD28 controls proliferation or survival of the Treg. Alternatively, CD28 may control expression of other cell surface markers that are essential for Treg function. In order to address the ¢rst possibility, we examined the e¡ect of CD28 blockade on Treg homeostatic proliferation in vivo. The majority of in vitro studies show that Treg are anergic to TCR-mediated stimulation (Read et al 1998, Takahashi et al 1998, Taams et al 2001). However, the cells are clearly able to proliferate in vivo as demonstrated by the use of CSFE-labelling to follow Treg populations. In these studies, we demonstrated, based on dilution of the CSFE dye, that between 5^10% of the CD4+CD25+ cells go into cycle within one week after adoptive transfer into normal hosts. Interestingly, treatment of mice with anti-B7 antibodies blocked the Treg proliferation. This was not simply due to inhibition of IL2 production as injection of mice with excessive IL2 did not a¡ect the loss of Treg cells. Moreover, the e¡ects of CD28 blockade did not appear to be due to increased apoptosis since overexpression of Bcl-XL did not prevent Treg loss in this setting. Thus, it appears that CD28 co-stimulation is essential for the development and expansion of the Treg. The basis for CD28-based Treg homeostasis remains unclear but cannot be explained simply by its e¡ects on cell survival or IL2driven proliferation. Rather, an unknown growth factor that regulates CD4+CD25+ T cell growth in vivo may be downstream of CD28/B7 signalling pathway. It is possible that this factor does not exist in our current in vitro cultures, explaining why most investigators characterize these cells as anergic. Role of other co-stimulatory pathways in Treg homeostasis Interruption of the CD40^CD154 (CD40L) interactions, similar to CD28/B7 blockade, has been shown in experimental rodent and primate transplant models

58

BODEN ET AL

to represent a powerful strategy to inhibit allograft rejection (Hancock et al 1996). In rodents, peri-operative treatment with anti-CD40L can promote inde¢nite survival of murine cardiac allografts (Hancock et al 1996). In these studies, it has been suggested that this blockade is mechanistically linked to suppression of B7 expression and thus, blockade of CD28. Therefore, we examined the role of the CD40 pathway in Treg function. Studies in NOD mice showed that in contrast to CD28 blockade, CD40L blockade abrogated disease. Analyses of the CD4+CD25+ subset in CD40L KO mice demonstrated normal numbers and function of Treg both in vitro and in vivo. Similarly, the co-stimulatory molecule, OX40, expressed on Treg cells and shown to be involved in cell survival (Maxwell et al 2000, Rogers et al 2001) was studied. Although Treg express OX40, OX40 KO mice have normal numbers and function of the Treg cells. Role of CTLA4 in Treg homeostasis CTLA4 is a CD28 homologue that binds to CD28 ligands, B7-1 and B7-2. However, CTLA4 engagement results in the attenuation of T cell activation as demonstrated by the development of a fatal lymphoproliferative disease in CTLA4-de¢cient mice (Tivol et al 1995, Waterhouse et al 1995). Bone marrow chimeric mice containing CTLA4-de¢cient and CTLA4-expressing T cells do not develop disease (Bachmann et al 1999). Thus, CTLA4 expression on a subset of T cells can down regulate T cell activation in a dominant fashion similar to the immunoregulatory action of CD4+CD25+ T cells. Furthermore, while CTLA4 is up-regulated on most T cells only after T cell activation, it is constitutively expressed by CD4+CD25+ regulatory T cells (Salomon et al 2000, Takahashi et al 2000), suggesting a possible role for CTLA4 in the function and maintenance of these cells. Previous reports established that CD28 is required to up-regulate CTLA4 expression (Alegre et al 1996). Therefore, the reduction of regulatory T cells in CD28-de¢cient mice could be attributed to altered CTLA4 expression in CD28de¢cient CD4+CD25+ T cells. To discriminate between the e¡ects of B7 blockade on CD28 versus CTLA4, the e¡ect of anti-B7 antibody treatment on Treg was studied in CTLA4-de¢cient mice. Typically, CTLA4-de¢cient mice die at 3 to 4 weeks of age as a result of a generalized lymphoproliferative disease (Tivol et al 1995, Waterhouse et al 1995). However, blockade of CD28/B7 interactions delays T cell activation and thereby prolongs the life of CTLA4-de¢cient mice (Tivol et al 1997). Therefore, these mice were treated with anti-B7 antibodies beginning 9 days after birth and the regulatory T cells were studied over time. In addition, a third cell-surface marker, CD62L (L-selectin) was used to di¡erentiate between regulatory T cells and activated CD25-expressing cells. CD62L is down regulated on activated T cells, but has been described as a marker expressed on

CD28 AND CTLA4

59

T cells with regulatory activity (Lepault & Gagnerault 2000). Although the treatment with anti-B7 mAbs reduced the percentage of CD4+CD25+CD62L+ T cells in CTLA4 KO mice, the majority of CD4+CD25+CD62L+ T cells recovered by one month after treatments were ended. Thus, CTLA4 does not regulate the depletion or recovery of regulatory T cells upon in vivo B7 blockade. This observation is consistent with studies demonstrating that the administration of anti-CTLA4 antibodies to wild-type NOD mice in a treatment regimen that blocks CTLA4 function in vivo (Karandikar et al 1996), did not deplete CD4+CD25+ T cells from the spleen and lymph nodes. Most importantly, the regulatory population in anti-B7-treated CTLA4-de¢cient mice was reconstituted in these animals prior to the beginning of generalized T cell activation and proliferation, as the majority of the CD4+CD25+ T cells were CD62L+ on day 28 after the end of anti-B7 treatment. Thus, CTLA4 is not necessary for the development or homeostasis of regulatory T cells in the periphery and the e¡ects of B7 blockade are due directly to the absence of CD28 ligation. CTLA4 has been reported to have a critical role in the regulatory function of Treg cells (Read et al 2000, Takahashi et al 2000). The contribution of CTLA4 to regulatory T cell function in vitro has been studied using CD4+CD25+ T cells from CTLA4-de¢cient mice. In these studies, regulatory T cells were reported to have only 50% of the suppressor activity of wild-type regulatory T cells in vitro (Takahashi et al 2000). It is important to note that in these previous studies activated T cells expressing CD25 were not excluded from the CD4+CD25+ population tested for suppressor activity and may have compromised the regulatory activity of this population. In vivo, CTLA4 blockade using mAbs has been reported to abrogate the ability of CD4+CD25+ T cells to protect from autoimmunity in a model of intestinal in£ammation (Read et al 2000). However, the exacerbation of autoimmune disease in this model could be attributed to CTLA4 blockade on self-reactive responder T cells rather than the impairment of regulatory T cell function. We examined the role of CTLA4 in the suppressor function of regulatory T cells using CTLA4-de¢cient mice expressing a transgene encoding a soluble form of the CTLA4Ig fusion protein (Lenschow et al 1996). CTLA4Ig binds B7-1 and B7-2, preventing CD28 co-stimulation and thereby delaying massive T cell activation in these mice. These transgenic mice maintain normal numbers of regulatory T cells in the periphery and thymus. This may be due to low levels of CTLA4Ig in the serum, resulting in incomplete CD28/B7 blockade that is su⁄cient to delay lymphoproliferative disease, but not the development of regulatory T cells. The regulatory T cells from CTLA4 de¢cient, CTLA4Ig transgenic mice were examined functionally. CFSE-labelled wild-type responder T cells were stimulated with anti-CD3 and T-depleted antigen presenting cells (APCs) in the

60

BODEN ET AL

presence or absence of CD4+CD62L+CD25+ regulatory T cells from CTLA4de¢cient CTLA4Ig transgenic mice. CTLA4-de¢cient CD4+CD62L+CD25+ T cells were able to suppress proliferation of wild-type responder cells almost completely, suggesting that CTLA4 is not essential for regulatory T cell function in vitro. To ensure that this result was not due to compensatory mechanisms occurring in mice genetically de¢cient in CTLA4, we attempted to alter the suppressive capability of wild-type cells by blocking CTLA4 using anti-CTLA4 Fab fragments. In order to prevent the e¡ect of CTLA4 blockade on responder T cells, CD4+CD62L+CD25 responder T cells from CTLA4-de¢cient CTLA4 Ig transgenic mice were labelled with CFSE and used as responder cells. Co-culture with wild-type CD4+CD62L+CD25+ T cells inhibited the proliferation of these responder cells from CTLA4-de¢cient mice. Addition of anti-CTLA4 Fab fragments completely abrogated the suppressor function of wild-type regulatory T cells. Taken together, our results demonstrate that while CTLA4-de¢cient regulatory T cells are functional in vitro, CTLA4 blockade negates suppressor function of wild-type regulatory T cells. Regulatory T cells from CTLA4-de¢cient mice express higher levels of membrane bound TGFb1 than wild-type regulatory T cells The inhibitory cytokine, transforming growth factor (TGF)b has been implicated in the function of regulatory T cells and it has been suggested that TGFb functions downstream of CTLA4 signalling in this setting (Read et al 2000, Nakamura et al 2001). We were interested to know whether CTLA4 de¢cient regulatory T cells expressed membrane-bound TGFb It has been shown that CD4+CD25+ T cells express higher levels of the latent form of TGFb (LAP) than CD4+CD25 T cells in the resting state. Activated CD4+CD25+ T cells show increased expression of cell-surface bound TGFb compared with CD4+CD25 T cells (Nakamura et al 2001). Interestingly, we found that nearly all of the membrane-bound LAP on resting wild-type CD4+CD25+ T cells and the active membrane-bound TGFb1 on activated wild-type CD4+CD25+ T cells was contained in the CD62Llow fraction. Wild-type CD4+CD62L+CD25+ T cells did not express TGFb. In contrast, CTLA4-de¢cient CD4+CD62L+CD25+ T cells expressed markedly increased membrane-bound LAP in resting state and TGFb after activation. It is important to note that although the CD62Lhigh subset of CTLA4-de¢cient CD4+CD25+ T cells showed up-regulation of TGFb on the cell surface, the majority of TGFb-expressing cells were actually among the CD62Llow fraction of CD4+CD25+-expressing T cells. Nonetheless, the increased expression of TGFb on CTLA4 de¢cient cells might be a compensatory mechanism by which CTLA4-de¢cient Treg could function in the absence of CTLA4 signalling.

CD28 AND CTLA4

61

However, we could not demonstrate abrogation of CTLA4-de¢cient or wild-type regulatory T cell suppressor function with anti-TGFb antibody. Concluding remarks We have demonstrated that CD28 plays a critical role in both the development and peripheral homeostasis of Treg. The peripheral pool of CD4+CD25+ regulatory T cells is very dynamic and CD28 regulates its size, in part, through controlling the homeostatic proliferation of these cells. The mechanism of this regulation is not clear, but it does not appear to be mediated through IL2 or survival factor such as Bcl-XL. CD28 function in regulatory T cell homeostasis could be integrated in a model where the added strength of signal via the T cell receptor (TCR) (signal 1) and co-stimulatory signals (signal 2) determine regulatory T cell survival in the periphery and lead to positive selection of regulatory T cells in the thymus. We propose that, like na|« ve T cells, regulatory T cells require signalling via the TCR to survive in the periphery. However, the threshold for the overall strength of signal allowing cell survival may be higher for regulatory T cells than for na|« ve cells, and CD28 co-stimulation may be necessary to reach this threshold. We have shown that CTLA4/B7 interaction does not play a critical role in peripheral regulatory T cell homeostasis. In addition, CTLA4-de¢cient CD4+CD62L+CD25+ T cells are functional regulatory cells in vitro with suppressor activity as e⁄cient as their WT counterparts. However, CTLA4 blockade of WT regulatory T cells completely abrogates suppressor function of these cells. The discrepancy in the data is di⁄cult to reconcile. One explanation of this apparent contradiction in data is that the CTLA4 signalling necessary for suppressor activity is somehow bypassed in CTLA4-de¢cient regulatory T cells. Indeed, CTLA4-de¢cient CD4+CD62L+CD25+ T cells express both increased level of membrane-bound LAP at resting stage and increased levels of active membrane-bound TGFb1 after activation when compared with wild-type regulatory T cells. Thus, it is possible that membranebound TGFb might provide a strong inhibitory signal that bypasses CTLA4 activation in de¢cient T cells. Although numerous aspects of the biology of regulatory T cells remain unclear, the role of CD28 in Treg development and homeostasis indicates a novel regulatory function for CD28 in the maintenance of peripheral tolerance and the prevention of autoimmunity. In addition, a new level of complexity in the function of CD28/ CTLA4/B7 interactions has now been identi¢ed. Increased understanding of the delicate balance of various mechanisms governing the homeostasis and activation of both pathogenic and regulatory T cell subsets will be necessary to develop e¡ective and safe treatments for autoimmune diseases.

62

BODEN ET AL

Acknowledgements This work was supported by JDF grant #4-1999-841 (J.A.B.). E.B. is an HHMI medical student fellow. Q.T. is supported by NIAID fellowship #F32 AI 10360.

References Alegre ML, Noel PJ, Eisfelder BJ et al 1996 Regulation of surface and intracellular expression of CTLA4 on mouse T cells. J Immunol 157:4762^4770 Asano M, Toda M, Sakaguchi N, Sakaguchi S 1996 Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387^396 Bachmann MF, Kohler G, Ecabert B, Mak TW, Kopf M 1999 Cutting edge: lymphoproliferative disease in the absence of CTLA-4 is not T cell autonomous. J Immunol 163:1128^1131 Dieckmann D, Plottner H, Berchtold S, Berger T, Schuler G 2001 Ex vivo isolation and characterization of CD4+CD25+ T cells with regulatory properties from human blood. J Exp Med 193:1303^1310 Hancock WW, Sayegh MH, Zheng XG, Peach R, Linsley PS, Turka LA 1996 Costimulatory function and expression of CD40 ligand, CD80, and CD86 in vascularized murine cardiac allograft rejection. Proc Natl Acad Sci USA 93:13967^13972 Herold KC, Hagopian W, Auger JA et al 2002 Anti-CD3 monoclonal antibody in new-onset type 1 diabetes mellitus. N Engl J Med 346:1692^1698 Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J, Enk AH 2001 Identi¢cation and functional characterization of human CD4+ CD25+ T cells with regulatory properties isolated from peripheral blood. J Exp Med 193:1285^1294 Kappler JW, Roehm N, Marrack P 1987 T cell tolerance by clonal elimination in the thymus. Cell 49:273^280 Karandikar NJ, Vanderlugt CL, Walunas TL, Miller SD, Bluestone JA 1996 CTLA-4: a negative regulator of autoimmune disease. J Exp Med 184:783^788 Kisielow P, Bluthmann H, Staerz UD, Steinmetz M, von Boehmer H 1988 Tolerance in T-cellreceptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333:742^746 Lenschow DJ, Herold KC, Rhee L et al 1996 CD28/B7 regulation of Th1 and Th2 subsets in the development of autoimmune diabetes. Immunity 5:285^293 Lepault F, Gagnerault MC 2000 Characterization of peripheral regulatory CD4+ T cells that prevent diabetes onset in nonobese diabetic mice. J Immunol 164:240^247 Levings MK, Sangregorio R, Roncarolo MG 2001 Human CD25+ CD4+ T regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. J Exp Med 193:1295^1302 Maxwell JR, Weinberg A, Prell RA, Vella AT 2000 Danger and OX40 receptor signaling synergize to enhance memory T cell survival by inhibiting peripheral deletion. J Immunol 164:107^112 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor beta. J Exp Med 194:629^644 Read S, Mauze S, Asseman C, Bean A, Co¡man R, Powrie F 1998 CD38+ CD45RBlow CD4+ T cells: a population of T cells with immune regulatory activities in vitro. Eur J Immunol 28:3435^3447

CD28 AND CTLA4

63

Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Rocha B, von Boehmer H 1991 Peripheral selection of the T cell repertoire. Science 251: 1225^1228 Rogers PR, Song J, Gramaglia I, Killeen N, Croft M 2001 OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 15:445^455 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Salomon B, Lenschow DJ, Rhee L et al 2000 B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431^440 Stephens LA, Mottet C, Mason D, Powrie F 2001 Human CD4+CD25+ thymocytes and peripheral T cells have immune suppressive activity in vitro. Eur J Immunol 31:1247^1254 Taams LS, Smith J, Rustin MH, Salmon M, Poulter LW, Akbar AN 2001 Human anergic/ suppressive CD4+CD25+ T cells: a highly di¡erentiated and apoptosis-prone population. Eur J Immunol 31:1122^1131 Takahashi T, Kuniyasu Y, Toda M et al 1998 Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969^1980 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310 Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Tivol EA, Borriello F, Schweitzer AN, Lynch WP, Bluestone JA, Sharpe AH 1995 Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3:541^547 Tivol EA, Boyd SD, McKeon S et al 1997 CTLA4Ig prevents lymphoproliferation and fatal multiorgan tissue destruction in CTLA-4-de¢cient mice. J Immunol 158:5091^5094 Waterhouse P, Penninger JM, Timms E et al 1995 Lymphoproliferative disorders with early lethality in mice de¢cient in CTLA-4. Science 270:985^988

DISCUSSION Bach: I want to ask about another co-stimulation pathway, ICOS: do you know anything about the involvement of this pathway? Bluestone: Richard Flavell sent us some ICOS knockout mice, and these have regulatory cells which seem to work ¢ne in vitro. Ha£er: Human anti-ICOS hasn’t blocked in our systems. Bluestone: Every knockout we have looked at except CD28 and IL2 has had normal regulatory cells. Banchereau: What about the TGFb knockout? Bluestone: Jim Allison has done this and says that the regulatory cells are ¢ne. This suggests that TGFb is not functionally very important in this setting.

64

DISCUSSION

Shevach: One possibility everyone ignores is that TGFb may not be an e¡ector molecule. Instead, it may act back on the CD25+ cells to enhance their function. Bluestone: But then anti-TGFb should inhibit. Shevach: It depends on the system. In a suboptimal system perhaps some enhancement by TGFb is needed. TGFb is de¢nitely not required for suppression. Bluestone: Perhaps animals that are missing TGFb when they develop and learn to function without it. CTLA4 knockouts don’t need CTLA4 to suppress. Powrie: If you take T cells that can’t respond to TGFb, they can’t be suppressed in vivo. Shevach: In vitro they can be readily suppressed. Bluestone: It is still a conundrum for us how CTLA4 works in these cells. Chatenoud: Unless something has no redundancy at all in the system, such as IL7, the knockouts are not meaningful. IL2 knockouts reject skin grafts. Does this mean that IL2 is not important for graft rejection? Abbas: That is not a fair statement. You are just looking at one function of IL2. Many of us would argue that this is the wrong function. The knockout mouse drops dead, so clearly IL2 is not redundant for life. Chatenoud: What I am saying is that although it is true that knockouts may provide some answers these have to be interpreted in the context of the high intrinsic redundancy of the cytokine network. Bluestone: Ideally, we want a conditional knockout where we could take a cell in the periphery and selectively knockout TGFb. Abbas: A lot of people make the statement that if a gene is knocked out then other genes can compensate. I understand as a theoretical idea that other things that were not very active can kick in and become active. But I am constantly looking for examples of where something that was previously silent kicks in because a gene was deleted from the germline. It’s hard to ¢nd one. Flavell: I have an example. We knocked out Rac2. The expression of Rac1, a related molecule, then goes up. We thought we’d be clever and we took the cells in vitro from a conditional Rac2 knockout, and we added Tat Cre, which goes through the membrane of the cell and deletes it in real time. As we were watching the cells, Rac1 came up. It is compensated for within a day or two of the deletion event. Bluestone: I also wouldn’t discount the possibility that there are di¡erent subsets of regulatory cells with varying ability to function in the absence of other molecules. The good news then is that CD28 must be really important! It doesn’t get compensated for
no matter what. Von Herrath: Let’s turn the question about these knockout mice around. One possibility we should look at is that these CD25high cells could still be quite heterogeneous. Depending on what you knock out, and the environment you look in, you might get di¡erent e¡ector mechanisms or regulation, for example if

CD28 AND CTLA4

65

certain knockout mice are more susceptible to pathogens or simply harbour an altered gut £ora. This might particularly apply to the in vivo experiments. Bluestone: It’s a question of redundancy. Is this redundancy at the level of the cell or at the level of the animal? If I could block those CTLA4 knockout regulatory cells with anti-TGFb, I would be very happy and I would say that this is the redundancy. So far I have not been able to do this. Abbas: The data you showed indicated that it is the CTLA4 knockout that expresses more membrane TGFb. So you are going to put to rest the idea that CTLA4 is a signal for TGFb production. Bluestone: Correct. But I would argue that CTLA4 can lead to TGFb production by regulating TCR signalling. Think of CTLA4 as a brake. If you put the brake on it may not totally stop, but starts producing TGFb. CTLA4 puts a partial break on T cells, just as cyclosporine does when used in suboptimal doses, and TGFb is not a direct result of CTLA4 signalling but is a consequence of suboptimal TCR signalling. Under a variety of conditions, such as anti-CD3 treatment, there is suboptimal TCR signalling, which causes TGFb and IL10 production. Regulatory cells may be a consequence of some kind of suboptimal negative selection in the thymus, as opposed to super-optimal activation. Powrie: Then your result is the wrong way round. When you take away CTLA4 you have more TGFb. If TGFb is turned on by an attenuated TCR signal, you would not expect to see more. Bluestone: Your points are well taken but there may be a spectrum here. When CTLA4 is made during development it is keeping the cells in a totally resting state. There are three states of a cell in CTLA4 knockouts. First, a totally na|« ve resting state where nothing is made. Second, a fully activated cell, which kills the animal. Then there is an odd population that probably would have been deleted in the normal animal, but because the animal is missing CTLA4 it actually makes it some way through thymic development and doesn’t delete. Instead, it starts making TGFb. Delovitch: In the NOD mouse model the developing T cells in the thymus are de¢cient in TCR signalling upon TCR stimulation and show de¢cient upregulation of CTLA4. On the basis of your reasoning, this would increase the subpopulations of regulatory T cells, but this is not the case. How can you explain this? Bluestone: I don’t know how good the evidence is that NOD mice start out with a de¢ciency in regulatory cells, as opposed to one that develops over time. Shevach: You activated the CD25 positive cells and negative cells from the CTLA4 knockout, and looked at cell surface TGFb. What do the resting cells look like? Bluestone: The only thing we ¢nd on the resting cells that is di¡erent between the knockout and the wild-type is LAP. We didn’t ¢nd TGFb on the resting cells.

66

DISCUSSION

Bach: You didn’t mention the nice story you have with the B7-2 knockout mice. Do you have any more data on these? Bluestone: B7-2 knockout NOD mice don’t get diabetes. The bad news is that they die of paralysis. The reason for this is that they seem to have skewed their repertoire towards targeting peripheral nerves rather than the pancreas. We thought this was a regulatory cell phenomenon. It turns out that you can intermix the regulatory cells and do adoptive transfers, and block both diseases the same way. What is taking place here may have to do with tra⁄cking: somehow B7-2 is important in up-regulating a chemokine or homing receptor. Since there is B7-1 expressed in the nerves, I think the cells are going to the nerves where they are activated. Mowat: Do CTLA4 knockout cells release active TGFb into supernatants as well as having it on the membrane. Bluestone: We have not actually looked at that. We found message but everyone said that this doesn’t mean anything. We did cell surface expression and tried antibody blocking as a way to look for active TGFb, but we haven’t found any e¡ect yet.

CD4+CD25+ regulatory cells from human peripheral blood express very high levels of CD25 ex vivo Clare Baecher-Allan*, Julia A. Brown, Gordon J. Freeman{ and David A. Ha£er*1 *Laboratory of Molecular Immunology, Center for Neurologic Diseases, Brigham and Women’s Hospital and {Department of Adult Oncology, Dana Farber Cancer Institute, and Harvard Medical School, 77 Ave Louis Pasteur, Boston, Massachusetts, 02115, USA

Abstract. Selective isolation of only those CD4+ T cells that display the highest levels of CD25 by FACS results in a highly homogeneous regulatory population as de¢ned by functional activity and the expression of multiple surface antigens. Thus greater than 98% of CD4+CD25high cells express CD45RO in the absence of CD45RA expression. Upon TCR stimulation CD4+CD25high cells are both anergic and tolerogenic as they inhibit proliferation and cytokine secretion by activated CD4+CD25
responder T cells in a contact-dependent manner. In contrast, CD4+ cells that express lower levels of CD25 are more heterogeneous in their levels of expression of CD45RO, HLA-DR and CD122, and do not exhibit anergic or suppressive characteristics. Providing either CD28 costimulation or IL2 to a maximal anti-CD3 stimulus results in a modest induction of proliferation and the loss of observable suppression by CD4+CD25high regulatory cells. Unlike CTLA4 blockade, blocking the interaction of PD-1 with its ligand PD-L1 a¡ects the level of suppression. However, since this reduction in suppression by aPD-L1 can be overcome by increasing the number of CD4+CD25high T cells in the co-culture assay, the mechanism of CD4+CD25high regulation can proceed in the absence of PD-1/PD-L1 interactions, although it is not as e⁄cient. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 67^91

Autoreactive T cells capable of recognizing tissue-speci¢c antigens are not necessarily deleted in the thymus as they can be cloned from lymph nodes of mice and the circulation of humans (Ito et al 1993, Kaslow et al 1998, Ota et al 1990). These self-reactive T cells must require exquisite regulation and their activation can result in autoimmune disease. Besides careful control of the expression of 1This

paper was presented at the symposium by David Ha£er. Correspondence should be addressed to Clare Baecher-Allan. 67

68

BAECHER-ALLAN ET AL

co-stimulatory molecules necessary for activation of na|« ve, autoreactive T cells, accumulating evidence suggests that populations of regulatory T cells also function in a critical role to modulate autoimmune responses. It was thus of interest when Kojima and Prehn discovered that thymectomy on neonatal day 3 led to the development of multi-organ autoimmune disease (Kojima & Prehn 1981). Subsequently, it was demonstrated that the neonatal thymectomized mice lacked CD4+CD25+ T cells and adoptive transfer of this population into day 3 thymectomized animals or co-transfer with disease inducing CD4+CD25
lymphocytes into nude mice prevented autoimmune disease (Sakaguchi et al 1985, Asano et al 1996, Sakaguchi et al 1995). Adoptive transfer of these regulatory cells has been shown to o¡er protection from diabetes as naturally occurs in the NOD mouse (Salomon et al 2000), from colitis upon co-transfer with CD45RBhigh cells into SCID recipients (Read et al 2000), and from gastritis upon co-transfer with a gastral-speci¢c e¡ector T cell clone (Suri-Payer et al 1998). Thus, the CD4+CD25+ cell subset can regulate self-responses of autoreactive T cells. CD4+CD25+ regulatory cells have been the subject of intense study as their function appears critical in maintaining self tolerance. Murine CD4+CD25+ regulatory T cells have been shown to suppress proliferation of co-cultured CD25
T cells only upon stimulation with soluble as compared to the more highly cross-linked plate-bound anti-CD3 (Thornton & Shevach 1998, Itoh et al 1999). Furthermore, in vitro studies have demonstrated that the suppressive ability of murine CD4+CD25+ T cells is inhibited by providing anti-CD28 co-stimulation or exogenous interleukin (IL)2 in conjunction with TCR stimulation and thus allows responder cell proliferation (Thornton & Shevach 1998, Itoh et al 1999). They inhibit IL2 production by responder T lymphocytes within 16 hours of coculture, and are themselves unable to secrete IL2 (Thornton & Shevach 1998, Papiernik et al 1998). In vivo and in vitro studies addressing the potential role of CD28 in the biology of CD4+CD25+ T cells suggest that CD4+CD25+ T cells require CD28 and B7 for development and peripheral homeostasis as CD28
/
or B7-1
/
B7-2
/
NOD mice exhibited a severe de¢cit of these regulatory cells with associated worsening of diabetes (Salomon et al 2000). Here, we report the identi¢cation of a subset within the CD4+CD25+ T cells in the circulation of normal humans that exhibit strong in vitro regulatory function (greater than 95% inhibition of aCD3 induced proliferation) with similar characteristics to murine CD4+CD25+ regulatory cells. This CD4+CD25high T cell subset in humans comprises approximately 1^2% of circulating CD4+ T cells, unlike in rodents where between 6^10% of CD4+ T cells demonstrate regulatory function. While the entire population of CD4+CD25+ T cells expressing both low and high CD25 levels exhibit regulatory function in the mouse, only the CD4+ population that expresses the highest levels of CD25 demonstrates regulatory

HUMAN REGULATORY T CELLS

69

function in humans. These CD4+CD25high cells inhibit proliferation and cytokine secretion induced by TCR cross-linking of CD4+CD25
responder T cells in a contact dependent manner. Although higher numbers of CD4+CD25+high T cells are required, these regulatory cell can still suppress proliferation in the absence of the PD-1/PD-L1 or CTLA4/B7 pathways. Thus, regulatory CD4 T cells expressing high levels of the IL2 receptor exist in human peripheral blood, providing the opportunity to determine whether alterations in this population of T cells are involved in the induction of human autoimmune disorders. Methods Cell culture reagents. Cells were cultured in RPMI 1640 media supplemented with 2 nM L-glutamine, 5 mM HEPES, and 100 U/mg per ml penicillin/streptomycin (all from BioWhittaker, Walkersville, Maryland), 0.5 mM NaPyruvate, 0.05 mM non-essential amino acids (both from Gibco, Rockville, Maryland), and 5% human AB serum (Gemini Bio-Products, Woodland, California) in 96 well U-bottom plates (CoStar, Corning, New York). The aCD3 (clone UCHT1 for plate-bound assays and clone Hit3a for soluble conditions) and anti-CD28 (clone 28.2, at 5 mg/ml) antibodies were purchased from Pharmingen (San Diego, California). The anti-CD28 (clone 3D10) was provided by Genetics Institute, Cambridge Massachusetts. (In subsequent assays, the UCHT1 antiCD3 mAb was shown to give the same results as the Hit3a mAb when tested in soluble form, data not shown.) For plate-bound anti-CD3 stimulation, 50 ml of the anti-CD3 antibody diluted into PBS (Gibco) at the indicated concentration of 5.0 mg/ml or 0.05 mg/ml, was added to the each culture well, placed at 378C for 4 h, and then washed two times with PBS.The anti-PD-L1antibody (2A3) (Latchman et al 2001) was used at 10 mg/ml. The mouse anti-human CTLA4 Fab (monoclonal antibody 20A) was provided by Genetics Institute (Cambridge, Massachusetts) and has been shown to functionally block interaction with B7-1/2 (Anderson et al 2000). Recombinant human IL2 (rhIL2, Teceleukin, obtained from the National Cancer Institute) was added to those indicated cultures to a ¢nal concentration of 50 U/ml. Cell isolation and stimulation. Human blood mononuclear cells were isolated from freshly drawn human blood by Ficoll-Hypaque (Amersham Pharmacia, Piscataway, New Jersey) gradient centrifugation. The CD4CD25
, CD4CD25low, and CD4CD25high populations were isolated from 1108 peripheral blood mononuclear cells by sorting using a FACS Vantage SE (Becton Dickenson, Franklin Lakes, New Jersey). These cells were incubated with 400 ml each antiCD4-CyChrome (#555348, IgG1, Pharmingen) and anti-CD25-PE (#IM0479, IgG2a, Immunotech, Brea, California). Control samples (110 6) were stained

70

BAECHER-ALLAN ET AL

with anti-CD4-CyChrome and IgG2a (#33035X, Pharmingen) or anti-CD25PE and IgG1-CyChrome (#33818X, Pharmingen). The analysis and sort gates were restricted to the population of lymphocytes by means of their forward (FS) and side scatter (SS) properties. Large, activated T cells were excluded. Upon re-analysis, the FS/SS properties of the CD4+CD25high cells were not appreciably di¡erent from those of the CD4+CD25
population indicating that these cell populations are similar in size. T cell depleted accessory cells were isolated by negative selection of peripheral blood mononuclear cells by incubation with anti-TCR pan a /b antibody (Immunotech) followed by gentle removal by Bio-Mag Goat anti-mouse IgG coated magnetic beads (Polysciences, Inc., Warrington, Pennsylvania) then by irradiation at 3300 rads. The indicated number of CD4+CD25
or high cells (from 2.5^5103/well) were plated with a 10-fold excess of T cell depleted accessory cells. Extremely low numbers of cells were added to these cultures as they were incubated for up to 7 days. To determine proliferation, we removed half of the culture supernatant (100 ml) from each well before adding 1 mCi of [3H]thymidine (NEN, Boston, Massachusetts) for the ¢nal 16 h of culture before harvesting on the day designated in each ¢gure legend. All assays exhibited less then 10% SEM and were repeated in a minimum of three independent experiments using blood from di¡erent donors. Transwell analysis. The CD4+CD25
, CD4+CD25high and Tcell-depleted accessory cells populations were isolated as described above and cultured in transwell plates, purchased from Costar (Corning, New York). Both chambers of each transwell received Tcell depleted accessory cells (5105/well) and soluble anti-CD3 (10 mg/ ml) plus soluble anti-CD28 (5 mg/ml) as described. The proliferation of CD4+CD25
cells (510 4) plated in the lower chamber of each transwell was monitored in the presence or absence of direct contact with 510 4 CD4+CD25high regulatory cells. [3H]thymidine (4 mCi) was added at day 4, and the wells were harvested at day 5. FACS analysis of surface antigens. Human peripheral blood mononuclear cells were isolated post Ficoll gradient separation and stained with anti-CD4-CyChrome (IgG1, #555348, Pharmingen) and either anti-CD25-PE (IgG2a, #IM0479) or anti-CD25-FITC (IgG2a, #IM0478), both purchased from Immunotech. As the third colour, the samples stained with anti-CD4-CyChrome and anti-CD25-PE were also stained with either IgG1-FITC (#IM0639) or anti-CD62L-FITC (IgG1, #IM1231) from Immunotech, IgG2b-FITC (#MG2b01, Caltag), or antiCD45RA-FITC (IgG2b, #31264X, Pharmingen). As the third colour, the samples stained with anti-CD4-CyChrome and anti-CD25-FITC were also stained with either IgG1-PE (#33815X), IgG2a-PE (#555574), anti-HLA DR-PE (IgG2b,

HUMAN REGULATORY T CELLS

71

#32415X), or anti-CD122(IL2Rb)-PE (IgG1, #18745B) from Pharmingen; antiCD45RO-PE (IgG2a, #IM1307), anti-CD58(LFA3)-PE (IgG2a, IM1430), or antiCD71-PE (IgG1, #IM2001) from Immunotech, or IgG2b-PE (#6603450) from Coulter. The samples were run on an EPICS Flow Cytometer, collecting data on 2105 lymphocytes (gated by forward and side scatter properties) and analysed using the Cell Quest software. Although appropriate isotype controls were run for each sample, since they gave similar results, only the IgG1 isotype third colour stain is shown. Cytokine analyses by ELISA. The supernatants that were removed before addition of [3H]thymidine, and were diluted and analysed on Immulon 4 ELISA plates (Dynex Technologies, Chantilly, Virginia) using the antibody pairs: IFNg(M700A, M-701-B Biotin, Endogen, Woburn, Massachusetts), IL10 (#18551D, 18562D-Biotinylated, Pharmingen) and IL13 (554570, Biotinylated #555054, Pharmingen), developed with an avidin-peroxidase conjugate (1:10 000 dilution) (A-7419, Sigma, St. Louis, Missouri) and TMB peroxides substrate (#50-76-06, Kiekegaard and Perry Laboratories, Gaithersburg MD). Instead of IL4, IL13 was assayed as a prototypical Th2 cytokine due to limitations in the detection of IL4 in culture supernatants of humanTcells likely due to its consumption and the fact that these assays were set up with very low numbers of Tcells per well. IL2 mRNA analyses by reverse transcription/semi-quantitative PCR (RT/SQ-PCR). 60 wells of cultured CD4+CD25
, CD4+CD25high, or co-cultured cells were stimulated with soluble anti-CD3/anti-CD28 (and Tcell-depleted accessory cells) as before. After 5 days RNA was isolated from the collected cells by solubilization in TRIzol reagent and converted into cDNA via the Superscript II Reverse Transcriptase protocol using Oligo dT (Itoh et al 1999, Papiernik et al 1998, Latchman et al 2001, Anderson et al 2000, Baecher-Allan & Barth 1993, Takahashi et al 2000, Sallusto et al 1999) (all reagents purchased from Gibco BRL, Rockville, Maryland). Actin and IL2 messages were ampli¢ed using the actin primers: 50 :AACCCCAAGGCCAACCGCGAGAAGATGACC and 30 :GGT GATGACCTGGCCGTCAGGCAGCTCGTA and the IL-2 primers: 50 : TACAG GATGCAACTCCTGTCTTGCATTGCA, and 30 : GTTGCTGTCTCATCAGCA TATTCACAC ATG. PCR (100 ml) was performed using 2.5 units Taq DNA Polymerase, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 mM primers, and cycling parameters of 948C 20 then the indicated number of cycles of: 948C 20 s, 608C 30 s, 728C 1min. Upon combining all reagents, the initial PCR reaction was split into 5 wells, one for removal every three cycles within the desired range. (Additional PCR controls [not shown], and past work demonstrated that a three cycle delay in the appearance of a PCR product under these conditions were

72

BAECHER-ALLAN ET AL

indicative of a fourfold di¡erence in input template; Baecher-Allan & Barth 1993). Reaction products were analysed on 2% Agarose/TBE gels. Results Restricting the isolation of CD4+ cells to those cells that express the highest levels of CD25 results in a highly pure population as de¢ned by the analysis of surface molecules including CD45RO and MHC Class II (HLA-DR). Approximately half of the circulating human peripheral blood lymphocytes express CD4, and of these roughly 10% express the IL2 growth factor receptor a chain, CD25. Peripheral blood lymphocytes do not stain very strongly for CD25. Unlike what is seen in the mouse, in the human, the CD25+ population is not as clearly discernable (Fig. 1a) (Thornton & Shevach 1998, Takahashi et al 2000). Rather, the CD4+ T cells with the highest level of CD25 (CD4+CD25high) appear as a tail to the right from the major population containing both CD4+CD25low and CD4+CD25
cells. The CD25high cells represent 1^2% of the total CD4+ T cell population, while the CD25low cells can represent up to 16% of CD4+ T cells. The CD4+CD25
/low/high T cells were analysed for expression of additional surface antigens to gain insight into their mechanism of action and to more fully characterize this regulatory population in humans. The di¡erent levels of surface antigen expression were compared among the CD4+CD25
, CD4+CD25low and CD4+CD25high cell subsets (Fig. 1b). CD45RO, which can be associated with proliferative responses to recall antigens, was expressed at signi¢cantly higher levels by the CD4+CD25high population (99%) as compared to the CD4+CD25low (89%) or CD4+CD25
(33%) subset. In contrast, the expression of CD45RA, considered a marker for na|« ve T cells, showed the opposite expression pro¢le. Greater than 50% of the CD4+CD25
subset and 25% of the CD4+CD25low subset expressed CD45RA in contrast to only 4% of the CD4+CD25high T cells. These three T cell populations de¢ned by varying levels of CD25 expression exhibited marked di¡erences in a number of additional surface antigens which have been used to de¢ne functionally distinct populations (Fig. 1b). The CD4+CD25high cells expressed the highest levels of the peripheral lymph node homing receptor, L selectin (CD62L) (Sallusto et al 1999). The CD4+CD25high cells also expressed the highest frequency and intensity of the IL2R b chain (CD122) and LFA3 (CD58) compared to the other T cell subsets. The IL2R b chain was expressed by only 6% of CD4+CD25
cells, by 28% of the CD4+CD25low cell subset, and by over 85% of the CD4+CD25high cells. Unlike mouse T cells, activated human T cells express HLA Class II molecules on their surface allowing them to assume the role of antigen-presenting cells (Ko et al 1979). Importantly, the low level of HLA-DR expression observed in human blood was found to be limited to the CD4+CD25high cells (*20%) compared to

HUMAN REGULATORY T CELLS

73

FIG. 1. Human peripheral blood contains CD4+ cells expressing high and low levels of CD25. Human CD4+CD25high cells are CD45RO+, CD45RA
, and express surface antigens associated with activated cells. (a) Mononuclear cells from freshly drawn human blood were stained with di¡erent combinations of anti-CD4-CyChrome, mIgG1-CyChrome, mIgG2aPE, and antiCD25-PE. The cells in these analyses were gated on lymphocytes via their forward and side scatter properties. The CD4+CD25
, CD4+CD25low and CD4+CD25high populations were sorted using the indicated sorting gates. (b) Human peripheral blood mononuclear cells were stained with either anti-CD25-PE, anti-CD4-CyChrome and anti-CD45RA-FITC or antiCD62L-FITC; or anti-CD25-FITC, anti-CD4-CyChrome and anti-CD45RO-PE, anti-CD58PE, anti-CD71-PE, anti-CD122-PE, or anti-DR-PE. Control samples stained with IgG2bFITC, IgG2a-FITC, or IgG2b-PE and IgG2a-PE as the third colour are not shown as they were identical to the staining pattern for the IgG1 isotype control. The histogram analysis of the CD4+CD25
and CD4+CD25low populations were scaled to 150 while the scale for the analysis of the CD4+CD25high population was set at 30. The analysis was performed with CellQuest software. (From Baecher-Allan et al 2001, with permission.)

less than 2% of the CD4+CD2
and CD4+CD25low populations. The CD4+CD25high subset also exhibited preferential expression of the transferrin receptor which is usually expressed on the surface of activated lymphocytes and all cells entering proliferation (Bayer et al 1998). Thus, the CD4+CD25high

74

BAECHER-ALLAN ET AL

regulatory cells express a number of surface antigens associated with activation, migration, and antigen presentation. Thus if the potentially regulatory cell population was to be selected without regard to the level of CD25+ expression, it would be highly heterogeneous. Thus, we used FACS to isolate highly pure, populations of cells that di¡ered in their levels of expression of CD25. CD25+ regulatory cells comprise the *1^2% of CD4+ T cells in human peripheral blood that express the highest levels of CD25 CD4+CD25high, CD4+CD25low and CD4+CD25
T cells were sorted using the gates shown (Fig. 1a) in order to address whether either population exhibited regulatory cell characteristics such as hyporesponsiveness and suppression of proliferation as described in the murine system. The CD4+CD25+ (high or low) cells, CD4+CD25
cells, or a one to one mixture (co-cultures) were stimulated by sub-maximal cross-linking of the TCR (plate-bound anti-CD3 at 0.05 mg/ml,) and monitored for proliferation by [3H]thymidine incorporation. The CD4+CD25low cells responded to TCR cross-linking with a strong proliferative response and did not suppress the proliferation of the co-cultured CD4+CD25
cells at either 5 (data not shown) or 7 days (Fig. 2). In striking contrast, the CD4+CD25high cells cultured alone did not respond to this sub-maximal TCR stimulation. Moreover, the CD4+CD25high T cells were able to strongly inhibit the proliferation of

FIG. 2. Human peripheral blood contains both CD4+CD25high regulatory cells and CD4+CD25low non-regulatory cells. The CD4+CD25low (top) and the CD4+CD25high (bottom) T cells were stimulated alone at 3103 cells/well and in co-culture with 3103 CD4+CD25
responder T cells in the presence of 3104 T cell-depleted accessory cells. The CD4+CD25
cells were also stimulated alone. The data is representative of three independent experiments, and is presented as the mean of proliferation at day 7+SEM. The stimulus used for activation was plate bound anti-CD3 at the submaximal concentration of 0.05 mg/ml. (From Baecher-Allan et al 2001, with permission.)

HUMAN REGULATORY T CELLS

75

FIG. 3. Measurement of the kinetics of CD4+CD25
suppression of proliferation mediated by CD4+CD25high cells. CD4+CD25high and CD4+CD25
cells (5103/well) were cultured alone or together at various ratios in the presence of soluble anti-CD3 (5 mg/ml) and soluble anti-CD28 (5 mg/ml) and 5104 T cell-depleted accessory cells. In the co-cultured wells, the number of CD4+CD25
responder T cells remained constant while the number of CD4+CD25high cells varied by serial threefold dilution. (a) Proliferation was determined at day 3 (squares), day 5 (diamonds) and day 7 (circles) post initiation of culture, with [3H]thymidine added during the last 16 h. (b) IFNg levels were assayed by ELISA from supernatants removed from the cultures just before [3H]thymidine addition. (From Baecher-Allan et al 2001, with permission.)

CD4+CD25
responder T cells (Fig. 2). This inhibition was highly signi¢cant as the CD4+CD25high T cells reproducibly reduced proliferation of CD4 cells by 69% at day 5 and over 98% by day 7, compared to the response of the CD4+CD25
cells cultured alone. Kinetics of CD4+CD25high T cell regulatory function A series of experiments were performed to examine both the kinetics and the degree of suppression mediated by CD4+CD25high T cells. Using soluble antiCD3/anti-CD28 stimulation, di¡erent numbers of CD4+CD25high cells (serial threefold dilutions) were co-cultured with a constant number of CD4+CD25
responder cells. Proliferation was monitored at days 3, 5 and 7 (Fig. 3a). Although there was almost no detectable proliferation on day 3, by day 5 there were barely detectable levels of proliferation which showed little inhibition. In

76

BAECHER-ALLAN ET AL

contrast, the inhibitory e¡ect of the CD4+CD25high T cells was striking by day 7. The CD4+CD25high T cells inhibited the proliferative response of the co-cultured CD4+CD25
cells in a dose-dependent manner (Fig. 3a). These data show that 93% and 80% suppression occurs at the (1:1) and at the (0.3:1) cell ratio (CD4+CD25high regulatory cells to CD4+CD25
responder cells) respectively. Although, the suppression dropped to only 31% when the cells were co-cultured at a ratio of 1:9, this is similar to what is seen upon titration of the murine CD4+CD25+ regulatory cells. The kinetics of cytokine secretion in these co-cultures was also monitored from supernatants removed just before 3H-thymidine addition. CD4+CD25high T cells stimulated with soluble anti-CD3/anti-CD28 did not secrete IFNg, IL10 or IL13, while CD4+CD25
responder cells were found to secrete only IFNg. Upon titration of the regulatory cells into the co-culture, there was a dose-dependent inhibition of IFNg secretion (Fig. 3b) which was apparent by the ¢fth day of culture and more prominent by day 7. Thus the suppression of IFNg secretion was observable well before suppression of proliferation.

CD4+CD25high cells require contact in order to regulate CD4+CD25
T cells CD4+CD25high T cells were found to exert their regulatory function on CD4+CD25
T cells in a contact-dependent manner. These studies were performed using transwell chambers to either allow the two T cell populations to be in contact in the same well or to be separated by a membrane that is permeable to soluble molecules. As can be seen in Fig. 4, if CD4+CD25high cells were stimulated in the upper chamber, there was little e¡ect on the growth of the CD4+CD25
cells in the lower chamber. In contrast, when the two populations were co-cultured in the same lower well, there was a marked inhibition of proliferation.

CD4+CD25high cells inhibit IL2 mRNA production in co-cultures We addressed whether co-culture with human CD4+CD25high cells resulted in a decrease in the levels of IL2 mRNA as has been shown in the analysis of mouse CD4+CD25+ cells (Thornton & Shevach 1998). RNA samples of anti-CD3/antiCD28 (soluble)-stimulated cultures of CD4+CD25
, CD4+CD25high or cocultures, were analysed for their levels of actin and IL2 mRNA by semiquantitative RT/PCR (Baecher-Allan & Barth 1993). As shown in Fig. 5, the levels of IL2 mRNA were signi¢cantly decreased in the co-cultures even though it contained twice the amount of cDNA as in the CD4+CD25
only sample as indicated by the levels of actin product.

HUMAN REGULATORY T CELLS

77

FIG. 4. Analysing the dependence of CD4+CD25high T cell-mediated suppression on cell contact. CD4+CD25high and CD4+CD25
cells (5103/well) were stimulated in the lower chamber of a transwell plate in the absence of additional T cells, or in the presence of CD4+CD25high cells that were either stimulated in the same lower well or in the separate upper chamber of the transwell. The data represents total cpm from the cultures at day 5. (From Baecher-Allan et al 2001, with permission.)

FIG. 5. Quanti¢cation of IL2 mRNA levels in cultures of CD4+CD25
or co-cultures. SQ/ PCR analysis of mRNA isolated from CD4+CD25
(left), CD4+CD25high (middle), or co-cultures (right lane) was performed to determine the relative levels of actin (top) and IL-2 message (bottom). The actin PCR samples were analysed after 24 and 27 cycles of ampli¢cation while the IL2 PCR samples were analysed after ampli¢cation of 27 and 30 cycles. (From Baecher-Allan et al 2001, with permission.)

78

BAECHER-ALLAN ET AL

Di¡erences in the stimulation and the presence or absence of co-stimulation, greatly a¡ects the proliferation and regulation of CD4+CD25
T cell proliferation We next examined whether di¡erences in strength of signal could overcome either the suppression mediated by CD4+CD25high cells. Cultures were stimulated with two di¡erent doses of plate-bound anti-CD3 in order to compare the e¡ect of varying the quantity of the same quality of TCR signal (i.e. that delivered by plate-bound anti-CD3). TCR stimulation through plate bound anti-CD3 at 5 mg/ ml (maximal response) or 0.05 mg/ml (sub-maximal) alone (Fig. 6) did not reverse the non-responsive state of the CD4+CD25high cells. However, co-cultures stimulated with maximal plate-bound anti-CD3 exhibited only 69% inhibition, while stimulation with sub-maximal plate-bound anti-CD3 exhibited greater than 99% inhibition of proliferation. Providing either co-stimulation with CD28 crosslinking or the addition of IL2 to the maximal anti-CD3 (5 mg/ml) stimulus resulted in both CD4+CD25high proliferation (albeit at a low level) and the complete loss of regulation. Thus signalling through the TCR with a strong stimulus caused either the target cell population to become refractory to inhibition or the regulatory cell population to lose its e¡ector function. Soluble anti-CD3 stimulation resulted in both CD4+CD25high cell nonresponsiveness and 495% inhibition of co-culture proliferation similar to what was observed in cultures stimulated with sub-maximal plate-bound anti-CD3. As predicted, the addition of IL2 to soluble anti-CD3 stimulated co-cultures resulted in a loss of regulatory function. Surprisingly, however, the suppression apparent in soluble anti-CD3 stimulated co-cultures could not be reversed by providing soluble anti-CD28 co-stimulation. A second anti-CD28 mAb (3D10) was also unable to abrogate suppression in conjunction with soluble anti-CD3 stimulation demonstrating that this phenomenon was not reagent speci¢c (data not shown). It appears that the signal generated by the soluble anti-CD3 condition is so ‘weak’ that even with anti-CD28 cross-linking, suppression can still occur. CD4+CD25high T cells were also found to inhibit secretion of IFNg (Th1) and IL13 (Th2) cytokines (Fig. 7). IL10 was produced with only the strongest stimulation conditions, and often in the absence of suppression of proliferation. However, it is important to note that IL10 can be secreted by other types of regulatory T cells such as Treg1 cells as well as non-T cell populations (Groux et al 1997a, 1996). Analysis of IFNg secretion indicates that it mirrored the level of proliferation with each stimulus (Fig. 7a). In general, when the proliferation was inhibited by co-culture with the CD4+CD25high cells, the secretion of IFNg was also decreased. However, the soluble anti-CD3 alone co-culture condition was an exception since there was little decrease in IFNg secretion in light of a striking inhibition of proliferation. IL13 was only secreted by CD4+CD25
under conditions of strong TCR signalling by maximal plate-bound anti-CD3 or under conditions of weaker TCR

FIG. 6. The strength and quality of the TCR signal a¡ects the ability of the CD4+CD25high cells to suppress the proliferation of the co-cultured CD4+CD25
cells. CD4+CD25high and CD4+CD25
cells (2.5103/well) were cultured alone or together in the presence of the indicated stimuli and 2.5104 T cell depleted accessory cells. The cells were stimulated in wells that had been coated with either 5 mg/ml (maximal) or 0.05 mg/ml (submaximal) anti-CD3 mAb, or by the addition of soluble anti-CD3 at 5 mg/ml. In some cases as noted, additional stimulatory signals were provided by anti-CD28 or recombinant human IL2 at 50 U/ml. Proliferation was determined at day 6, with 3H-thymidine added for the last 16 h of culture. These stimuli have been shown to have similar e¡ects on the CD4+CD25
and CD4+CD25high populations in three multiple experiments. (From Baecher-Allan et al 2001, with permission.)

HUMAN REGULATORY T CELLS 79

80

BAECHER-ALLAN ET AL

FIG. 7. The CD4+CD25high cells do not secrete cytokine, but can suppress the secretion of IFNg and IL13 by co-cultured CD4+CD25
cells in a dose dependent manner. Culture supernatants were removed from the proliferation cultures depicted in Fig. 3 before the addition of 3H-thymidine incorporation (at day 5). Levels of (a) IFNg, (b) IL10 and (c) IL13 were determined from culture supernatants by ELISA. All data represent the mean +SEM of duplicate assays. (From Baecher-Allan et al 2001, with permission.)

HUMAN REGULATORY T CELLS

81

signals augmented with exogenous IL2 or anti-CD28 co-stimulation (Fig. 7c). In all conditions where the CD4+CD25
cells secreted IL13, the corresponding coculture resulted in a signi¢cant decrease in IL13 secretion regardless of whether there was inhibition of proliferation. Notable is the complete suppression of IL13 in co-cultures stimulated with soluble anti-CD3 + IL2 even though there was little to no inhibition of proliferation. Thus it appears that IL13 secretion may be more sensitive, than IFNg secretion or proliferation, to the e¡ects of coculture with regulatory cells under conditions of di¡erent strengths of signal. As discussed above, it was important mechanistically to further examine whether IL10 was secreted by the CD4+CD25high regulatory cells in co-culture assays, as this cytokine is inhibitory to T cell activation (Asseman et al 1999, Powrie et al 1993). No culture stimulated with soluble anti-CD3 secreted IL10 even though these cultures exhibited marked suppression (Fig. 7b). Furthermore, while IL10 was produced in the cultures of CD4+CD25
cells alone and co-cultures stimulated with plate-bound anti-CD3 supplemented with IL2 or anti-CD28, it was not secreted by stimulation of the CD4+CD25high cells (alone) under any condition. Thus, there was no correlation between suppression and the secretion of IL10. Role of CTLA4 and PD-L1 in CD4+CD25high mediated regulation We examined whether the PD-1, PD-L1 and CTLA4 receptors on CD4+CD25high T cells were important for CD4+CD25high mediated suppression of CD4+ T cells. We chose to examine the PD-1, PD-L1 and CTLA4 receptors on CD4+CD25high T cells, as their engagement is known to induce cell cycle arrest. PD-1 and its ligand, PD-L1, are induced on subsets of activated T cells and are involved in programmed cell death (Ishida et al 1992, Agata et al 1996). PD-1^PD-L1, interaction delivers a negative signal that down regulates T cell proliferation and cytokine production in the context of suboptimal TCR stimulation (Freeman et al 2000). CTLA4 is similarly expressed by activated T cells and can deliver a negative signal that results in down regulation of T cell activation (Green¢eld et al 1998). Thus, inhibitory anti-PD-L1 or anti-CTLA4 mAbs were tested to determine if they a¡ected the suppression induced by CD4+CD25high T cells (Fig. 8). When analysed directly from the blood, CD4+CD25high T cells did not express CTLA4 or PD-L1 on the cell surface (data not shown). In the mouse, CTLA4 has also been found to be constitutively expressed but in the cytoplasm of CD4+CD25+ regulatory T cells rather than on the cell surface (Read et al 2000, Takahashi et al 2000). However, due to the observed kinetics of suppression and the fact that peak levels of CTLA4, PD-1 and PD-L1 expression can be induced on T cells by 2^3 days post activation (Agata et al 1996, Green¢eld et al 1998, Vibhakar et al 1997), it was possible that these molecules could be involved in regulation by

FIG. 8. Blocking anti-CTLA4 Fab or anti-PD-L1 antibody in the inhibition of regulatory function of the CD4+CD25high cells. CD4+CD25high and CD4+CD25
cells (5103/well) were cultured alone or together at the indicated ratios in the presence of soluble anti-CD3 (5 mg/ml), soluble anti-CD28 (5 mg/ml) and 5104 T cell-depleted accessory cells. These cells were also cultured in the presence of mIgG (squares, 5 mg/ml), antiCTLA4 Fab (diamonds, at 5 mg/ml), anti-PD-L1 (circles, at 10 mg/ml), or anti-CTLA4 and anti-PD-L1 (triangles). Proliferation (a) was determined after 7 days of culture and the concentration of IFNg (b) and IL13 (c) were assayed from supernatants removed on day 6, as above. The insert graph within (a) displays the data as percent proliferation, where the mean of proliferation of co-cultures supplemented with the indicated blocking reagents was divided by the di¡erent baseline mean of proliferation of the cultures of CD4+CD25
cells only supplemented with the same antibody reagents. (From Baecher-Allan et al 2001, with permission.)

82 BAECHER-ALLAN ET AL

HUMAN REGULATORY T CELLS

83

CD4+CD25high cells. Adding anti-CTLA4 Fab mAb to CD4+CD25high/ CD4+CD25
co-cultures did not alter the levels of suppression of proliferation (Fig. 8a). Similarly, anti-CTLA4 Fab mAb had no e¡ect on IFNg secretion (Fig. 8b) while inducing a paradoxical decrease in the secretion of IL13 by CD4+CD25
T cells, as previously described (Anderson et al 2000) (Fig. 8c). Since engagement of PD-1 on the T cell surface leads to decreased proliferation (Freeman et al 2000), CD4+CD25
T cells exhibited a marked increase in proliferation upon blocking the interaction of PD-1 with PD-L1. However, as a result of adding increasing numbers of regulatory cells to the co-cultures, it can be seen that the CD4+CD25high T cells could still suppress proliferation in the presence of anti-PD-L1. Importantly, signi¢cantly more regulatory T cells were required to attain the similar percent inhibition of proliferation seen with the addition of the isotype control (Fig. 8a insert). These data suggest that PD-L1/ PD-1 interactions may mediate a small part of the inhibitory interaction. The blockade of PD-L1 enhanced the secretion of both IFNg and IL13 by responder cells only, which was subsequently, inhibited upon co-culture with CD4+CD25high regulatory T cells in a dose dependent fashion. The addition of both anti-CTLA4 and aPD-L1 together mirrored that of ‘anti-PD-L1 only’ cultures for proliferation and IFNg secretion while the levels of IL13 more closely mirrored the e¡ect of blocking CTLA4 (Fig. 8c). Discussion Here, we describe the isolation and characterization of the human counterpart to the murine CD4+CD25+ regulatory subset from human peripheral blood. These CD4+CD25high T cells were hypo-responsive to TCR engagement yet were able to totally inhibit [3H]thymidine incorporation or cytokine secretion by co-cultured CD4+ T cells. Depending upon the strength of the TCR signal, the addition of CD28 co-stimulation with stronger TCR stimuli resulted in a loss of regulation. Importantly, the di¡erent strengths and qualities of these stimuli may act to alter the e¡ector cell function or the target cell susceptibility or both. Moreover, CD4+CD25high T cells did not secrete detectable IFNg, IL13 or IL10 with any stimulation condition, but rather were able to inhibit the secretion of IFNg and IL13 by co-cultured, activated CD4+ T cells. Human CD4 regulatory function was only observed when the cells expressed high levels of CD25 and were isolated apart from the CD25low T cells. The mouse CD4+CD25+ regulatory subset is isolated from all CD25-expressing cells regardless of their level of CD25 expression (Sakaguchi et al 1995, Thornton & Shevach 1998, Itoh et al 1999). If similar criteria are followed to isolate these cells from human blood, the resulting CD25+ cells (high and low together) did not exhibit a hypo-responsive phenotype or signi¢cant suppressive function. CD4+

84

BAECHER-ALLAN ET AL

T cells expressing low levels of the IL2 receptor (CD25) strongly proliferated to sub-maximal TCR stimulation and showed no suppressive ability. Furthermore, restricting the isolation of regulatory cells to those CD4+ cells expressing high levels of CD25 increases the homogeneity of the regulatory population, expressing a number of surface antigens that are usually associated with activated T cells. Interestingly, the CD4+CD25high T cells we identi¢ed expressed high levels of both IL2 receptor a chain (CD25), and IL2 receptor b chain (CD122), making up the high a⁄nity IL2R. Thus these regulatory T cells may be poised for a quick response or alternatively, constantly turned on and performing continual low level regulatory activity. As the functional anergy and suppression by murine CD4+CD25+ regulatory cells and the CD25high subpopulation of human CD4+ cells are essentially identical, we conclude that they represent homologous populations. The mechanism of suppression mediated by CD4+CD25high cells appears to be linked to TCR signals encountered by each T cell population. Thornton and Shevach demonstrated that although murine CD4+CD25+ cells failed to proliferate after TCR stimulation alone, they could proliferate quite well if exogenous IL2 was also provided (Thornton & Shevach 1998). And yet this addition of IL2 or anti-CD28 abolished the suppression of the proliferation of the co-cultured cells. Interestingly, in the human, we found that although antiCD28 co-stimulation also inhibited suppression, we found it only did so in the context of certain TCR signals. Our data demonstrate that the addition of costimulatory signals did not abrogate regulatory function if the coincident TCR signal strength was low, thus linking the mechanism of suppression to TCR strength of signal. In contrast, the addition of IL2 to co-cultures ablated suppression in all cases regardless of the strength of the TCR stimulus. In the case of pathogen responses, either B7-1 or B7-2 expressed on the surface of activated human T cells, may provide important co-stimulation that would augment the strength of the signals and thus ablate suppression by CD4+CD25high cells (Green¢eld et al 1998, Hollsberg et al 1997). This suggests that suppression by regulatory cells during signi¢cant in£ammatory responses in vivo may be kept in check by the secretion of IL2 by antigen-responsive T cells or TCR signal strength. Thus, with time as activated T cells no longer secreted IL2, the CD4+CD25high cells may be able to exert suppression and turn o¡ the previously antigen-activated T cells. In contrast to strong, non-self, immune responses, the response to self-antigen is weak. Suppression of potentially autoreactive T cell responses is desirable in contrast to responses against foreign microbial antigens where the signals are stronger and suppression could be detrimental. We are currently determining whether the strength of the TCR signal alters the sensitivity of the responder cell to suppression or whether it inactivates the regulatory cell.

HUMAN REGULATORY T CELLS

85

The mechanism of action by which CD4+CD25+ T cells so e¡ectively inhibit proliferation of CD4 T cells remains unknown, but is independent of cytokine secretion. Although IL10 was secreted by CD4+CD25
cells, the presence or absence of IL10 did not correlate with suppression in co-cultures. To rule out the possibilities that IL10 was consumed or was in very low abundance, additional experiments demonstrated that the addition of blocking aTGFb or aIL10 antibodies had no e¡ect on the ability of CD4+CD25high cells to suppress the proliferation of co-cultured CD4+CD25
cells (data not shown). Thus, the cytokine independent suppression by CD4+CD25high cells is an important distinction as secretion of these two cytokines has been found to be integral to the function of other types of regulatory T cells (Groux et al 1997b). The mechanism of regulation by CD4+CD25+ cells may require contact with multiple molecules on the surface of the CD25high regulatory cell. Our experiments show no role for CTLA4 and a small role for PD-1 in the functional suppression by regulatory CD4+CD25high T cells. The involvement of this molecule in the mouse system is extremely controversial as two groups demonstrated exactly opposing e¡ects of blocking CTLA4 in vitro, while it appeared to have an e¡ect in the in vivo NOD autoimmunity model (Thornton & Shevach 1998, Takahashi et al 2000) (Salomon et al 2000, Read et al 2000). In contrast, blocking the interaction of PD-1 with one of its ligands, PD-L1, did reduce the level of suppression observed in these co-cultures. Somewhat expected as a result of its inhibitory e¡ect on proliferation (Freeman et al 2000), blocking PD1 engagement by anti-PD-L1 increased 3H-thymidine incorporation by target CD4 T cells. Furthermore, as signi¢cantly more regulatory CD4+CD25high T cells were required to suppress the proliferative response in the presence of anti-PD-L1, it indicates that these cells may utilize this pathway in addition to others in order to reach their main suppressive objective. Since increasing the number of regulatory cells resulted in complete suppression, there are multiple mechanisms that can be used by these cells or there are subpopulations within the CD25high population that use di¡erent single methods to suppress responses. The possibility exists that combined blockade of the two de¢ned ligands for PD-1, might have a more pronounced e¡ect (Latchman et al 2001). In summary, we report that it is the CD25high subpopulation of CD4+CD25+ T cells in the circulation of humans that exhibit practically identical in vitro characteristics to the CD4+CD25+ regulatory cells isolated in mice. With TCR cross-linking, CD4+CD25high cells did not proliferate and totally inhibited proliferation and cytokine secretion by activated CD4+CD25
responder T cells in a contact-dependent manner. Furthermore, the e¡ect of the type of TCR stimulation and the ability to abrogate only a portion of the suppression mediated by these CD4+CD25high cells via blockade of the PD-1 pathway indicates that regulation by CD4+CD25+ cells is the result of highly complex, multifactorial interactions.

86

BAECHER-ALLAN ET AL

The work by Thornton and Shevach establishing an in vitro model system that mimics the function of CD4+CD25+ T cells in in vivo models, demonstrated that although murine CD4+CD25+ cells failed to proliferate after TCR stimulation alone, they could proliferate quite well if exogenous IL2 was also provided (Thornton & Shevach 1998). And yet this addition of IL2 or anti-CD28 abolished the suppression of the proliferation of the co-cultured cells. Interestingly, in the human, we found that although anti-CD28 co-stimulation also inhibited suppression, we found it only did so in the context of certain TCR signals. As the suppression by murine CD4+CD25+ regulatory cells and the CD25high subpopulation of human CD4+ cells are essentially identical, we conclude that they represent homologous populations. Acknowledgements We would like to thank Dr Guifang Cai for technical assistance in analysing cytokine expression levels and Drs Howard Weiner and Vijay Kuchroo for critical review of the manuscript. The work was supported by the NIH grants: RO1NS2424710, PO1AI39671 and PO1NS38037 (DAH), and AI39671, AI41584 and CA84500 (GJF); and grants from the National Multiple Sclerosis Society (RG2172B6 and RG2949A) and the Juvenile Diabetes Foundation for Research (1-1989-124). References Agata Y, Kawasaki A, Nishimura H et al 1996 Expression of the PD-1 antigen on the surface of stimulated mouse T and B lymphocytes. Int Immunol 8:765^772 Anderson DE, Bieganowska KD, Bar-Or A et al 2000 Paradoxical inhibition of T-cell function in response to CTLA-4 blockade; heterogeneity within the human T-cell population. Nat Med 6:211^214 Asano M, Toda M, Sakaguchi N, Sakaguchi S 1996 Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387^396 Asseman C, Mauze S, Leach MW, Co¡man RL, Powrie F 1999 An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal in£ammation. J Exp Med 190:995^1004 Baecher-Allan CM, Barth RK 1993 PCR analysis of cytokine induction pro¢les associated with mouse strain variation in susceptibility to pulmonary ¢brosis. Reg Immunol 5:207^217 Baecher-Allan CM, Brown JA, Freeman GJ, Ha£er DA 2001 CD4+CD25high regulatory cells in human peripheral blood. J Immunol 167:1245^1253 Bayer AL, Baliga P, Woodward JE 1998 Transferrin receptor in T cell activation and transplantation. J Leukoc Biol 64:19^24 Freeman GJ, Long AJ, Iwai Y et al 2000 Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J Exp Med 192:1027^1034 Green¢eld EA, Nguyen KA, Kuchroo VK 1998 CD28/B7 costimulation: a review. Crit Rev Immunol 18:389^418

HUMAN REGULATORY T CELLS

87

Groux H, Bigler M, de Vries JE, Roncarolo MG 1996 Interleukin-10 induces a long-term antigen-speci¢c anergic state in human CD4+ T cells. J Exp Med 184:19^29 Groux H, Sornasse T, Cottrez F et al 1997a Induction of human T helper cell type 1 di¡erentiation results in loss of IFN-gamma receptor beta-chain expression. J Immunol 158:5627^5631 Groux H, O’Garra A, Bigler M et al 1997b A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Hollsberg P, Scholz C, Anderson DE et al 1997 Expression of a hypoglycosylated form of CD86 (B7-2) on human T cells with altered binding properties to CD28 and CTLA-4. J Immunol 159:4799^4805 Ishida Y, Agata Y, Shibahara K, Honjo T 1992 Induced expression of PD-1, a novel member of the immunoglobulin gene superfamily, upon programmed cell death. EMBO J 11:3887^3895 Ito Y, Nieda M, Uchigata Y et al 1993 Recognition of human insulin in the context of HLADRB1*0406 products by T cells of insulin autoimmune syndrome patients and healthy donors. J Immunol 151:5770^5776 Itoh M, Takahashi T, Sakaguchi N et al 1999 Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317^5326 Kaslow HR, Guo Z, Warren DW, Wood RL, Mirche¡ AK 1998 A method to study induction of autoimmunity in vitro: co-culture of lacrimal cells and autologous immune system cells. Adv Exp Med Biol 438:583^589 Ko HS, Fu SM, Winchester RJ, Yu DT, Kunkel HG 1979 Ia determinants on stimulated human T lymphocytes. Occurrence on mitogen- and antigen-activated T cells. J Exp Med 150:246^255 Kojima A, Prehn RT 1981 Genetic susceptibility to post-thymectomy autoimmune diseases in mice. Immunogenetics 14:15^27 Latchman Y, Wood CR, Chernova T et al 2001 PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol 2:261^268 Ota K, Matsui M, Milford EL, Mackin GA, Weiner HL, Ha£er DA 1990 T-cell recognition of an immunodominant myelin basic protein epitope in multiple sclerosis. Nature 346:183^187 Papiernik M, de Moraes ML, Pontoux C, Vasseur F, Penit C 1998 Regulatory CD4 T cells: expression of IL-2R alpha chain, resistance to clonal deletion and IL-2 dependency. Int Immunol 10:371^378 Powrie F, Menon S, Co¡man RL 1993 Interleukin-4 and interleukin-10 synergize to inhibit cellmediated immunity in vivo. Eur J Immunol 23:3043^3049 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T 1985 Organ-speci¢c autoimmune diseases induced in mice by elimination of T cell subset. I. Evidence for the active participation of T cells in natural self-tolerance; de¢cit of a T cell subset as a possible cause of autoimmune disease. J Exp Med 161:72^87 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A 1999 Two subsets of memory T lymphocytes with distinct homing potentials and e¡ector functions. Nature 401:708^712 Salomon B, Lenschow DJ, Rhee L et al 2000 B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431^440

88

DISCUSSION

Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1998 CD4+CD25+ T cells inhibit both the induction and e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310 Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Vibhakar R, Juan G, Traganos F, Darzynkiewicz Z, Finger LR 1997 Activation-induced expression of human programmed death-1 gene in T-lymphocytes. Exp Cell Res 232:25^28

DISCUSSION Abbas: You used the term ‘strength of signal’ somewhat operationally. When you are saying that stronger signals make cells resistant, is that because you are inducing more responder cells into the responding population and there is a limit to how you can shut o¡? Or is this because each individual cell is accumulating so many signalling intermediates that you can’t knock them down below the necessary threshold. To some extent you can distinguish those. You can do single-cell assays to look at how many are induced into the responding population and how many are reduced. This is what thymidine incorporation will not tell you. Ha£er: We have done CFSE labelling, and these data suggest that the Treg also inhibit cells entering the cell cycle. This would argue that it is not the increase in cells. Abbas: So it is not just the increase in the number of cells responding. Ha£er: Still, there could be that e¡ect. Bluestone: One part of the data that is not clear to me given the hypothesis is that your earliest experiments showed the cells were most e⁄cient when you looked at seven days instead at ¢ve, but they only worked if they were added early to the culture. Why do you only see the most dramatic e¡ect at day 7? Ha£er: We see it at day 5 but there is much more suppression at day 7. Bluestone: Since thymidine incorporation is the last 8 h of cultures, this would argue that you are working at the latest stages. Yet it is active very early, which would argue that you have now suppressed some kind of signal. The most logical thing is IL2 production. Shevach: IL2 is shut down in 12 h in the mouse. Roncarolo: The problem is that in our hands, when we look at suppression at day 7, and use activated CD25
cells as a control, they will suppress as well. This level of suppression at day 7 is not really speci¢c. If we look earlier, however, we really see the e¡ect of the regulatory cells. Bluestone: In this system, which really seems to depend on long-term culture to see the suppression, are we looking at a direct or indirect e¡ect? IL2 production

HUMAN REGULATORY T CELLS

89

should have been turned o¡ very rapidly by these things, and I would have imagined that day 5 would have been equally potent to day 7. Ha£er: We see very good suppression on day 5. It still goes down about 80%. It is just that it goes down to 0 at day 7. Also we see very early turn-o¡ of IL2 mRNA transcription in the e¡ector cells when we look using PCR. I wouldn’t say that we don’t get suppression on day 5; I think we get good suppression on day 5, it just seems to go further. Perhaps the last bit of suppression seen between days 5 and 7 is IL2 consumption. If we go to day 7 with e¡ector cells stimulating CD25low cells, we haven’t seen suppression on day 7. Bluestone: We don’t have to go back too many years ago to the work on ConA suppressors. There was always this IL2 consumption caveat. In these in vitro assays we will do well not to forget history here and make sure we do the experiments in a way in which we can rule out relatively trivial artefactual mechanisms by which these things are working in vitro. Ha£er: What we are trying to do is recreate a model in vitro which re£ects what is happening in vivo. What happens in the mouse system? Shevach: Every one is dead after 72 h. Suppression is fairly rapid, and is ¢rst manifest as a cell cycle arrest for 24^48 h. The G1^S arrest is then followed by cell death; we recover very few viable cells after 72 h of culture. Abbas: Has the IL2 consumption issue been laid to rest? Shevach: In my mind it has, because we don’t see mRNA for IL2 in co-cultures. Roncarolo: We did an experiment in which we transduced CD25
cells with CD25. We got an extremely high level of expression. Even if you have an extremely high level of CD25, they don’t acquire suppressor activity. At least by the expression of the CD25, which can be related to the IL2 consumption, it doesn’t seem to induce suppression. Shevach: We use that control in every experiment. Von Herrath: Is there no di¡erence between the IL2 receptor as expressed on activated CD25+ cells compared with the lineage-derived CD25+ cells that we get out? As far as we can tell, are these IL2 receptors the same? Abbas: You can look at the biological response to IL2 to see whether they respond the same. Shevach: The CD25+ cells don’t respond to IL2. That is the problem. They are much harder to activate. It requires ¢ve to 10 times more IL2 to trigger proliferation of CD25+ T cells than that needed to trigger a similar response of CD25
T cells to a ¢xed concentration of anti-CD3. Mitchison: What about survival as distinct from proliferation? Do the CD25+ cells need IL2 to survive? Shevach: They die quickly without it. Ha£er: They don’t grow well, even with it. Sakaguchi: In vivo they require IL2 for their survival, in our hands.

90

DISCUSSION

Wauben: I would like to go back to your comments on the MHC class II expression on human regulatory T cells. The rat is an excellent model to study MHC class II expression on these cells, since activated rat T cells do express, like human T cells, MHC class II. If we isolate CD25+ T cells from the rat thymus, and then isolate the high CD25+ expressing cells, we ¢nd high expression of MHC class II on these cells. These cells are the best suppressors in our hands. We use the rat T cell clones that are speci¢c for an HSP peptide or MBP peptide as a readout system for antigen-speci¢c suppression. Furthermore, we ¢nd that suppression is dependent on the antigen concentration used in this assay. If you use an optimal concentration of HSP or MBP peptide, it is very hard to down-regulate the response. So we suggest that there are multiple levels of regulation and that the multiple levels of regulation we have described for T cell^T cell presentation (Taams et al 1999) also count for CD25+ T cell-induced regulation. Ha£er: Might it be possible that what we have seen in humans, in terms of regulation by these cells, might be because they are a type of Treg, and that is why they are doing it? Wauben: I’ll address this in my paper. In the co-culture work, did you titrate the antigen concentration to see whether a low or high amount of stimulus present gives a di¡erence in the suppression e¡ect? Ha£er: Yes, we have, but we haven’t yet done mixing experiments. Abbas: To my knowledge virtually all the knowledge on human T cells presenting antigen is based on peptides. I don’t know of a native foreign globular protein antigen being processed and displayed by a T cell in association with class II MHC. Ha£er: What about GP120, published in Nature a number of years ago (Kwong et al 1998)? Abbas: It may be true, but it is a little dangerous to extend this story to the whole world of possible antigens. Wauben: That isn’t necessary. Perhaps we are looking for a particular antigen that is expressed at the site of infection. If you think, for example, the HSPs that are up-regulated, it could be possible that these are presented in the context of MHC class II. Ha£er: When you have in£ammation in an organ and there is tissue breakdown, there are peptides. No matter how much we purify MBP, there are always enough breakdown products just from serum enzymes which degrade the protein to peptides. Mitchison: How about suppressing CD8+ cells? Ha£er: They can do it in mice. Roncarolo: If you restimulate your e¡ector cells after they have been suppressed, they become anergic. There are two independent groups in Germany who claim that when CD25
cells are primed with CD25+ cells, they become IL10 producing

HUMAN REGULATORY T CELLS

91

or TGFb producing (they disagree on the cytokines). They become regulatory cells. When I read those papers, I thought that some of the in vivo e¡ect we see might be related to the fact that the CD25+ cells are the ¢rst step towards IL10 or TGFb producing Treg cells. Ha£er: We have not been able to measure secreted TGFb from the regulatory cells. We have not done those other experiments. Roncarolo: Have you seen them in the e¡ectors? Ha£er: They are not in the culture. Abbas: What you are saying is that the regulatory cells act on the e¡ectors and turn the e¡ectors into TGFb-producing cells. Is that correct? Roncarolo: They say that when they take the human CD25+ cells and suppress the na|« ve cells, and take the CD25
cells and put them in a suppressor assay, they become Treg1 cells. They produce IL10 and TGFb, but the two groups disagree on which cytokines are important for the suppression of these cells. They both come to the conclusion that they generate Treg1 cells. There is speculation that this is how it works in vivo. Powrie: We published that CD45RBlow cells can inhibit IL10 knockout CD45RBhigh cells. Under these circumstances, the progeny of the RBhigh population do not have to secrete IL10 to be suppressed. Shevach: We have tried hard to do this experiment in the mouse but we can’t recover viable cells from the in vitro cultures. References Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J, Hendrickson WA 1998 Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648^659 Taams LS, van Eden W, Wauben MH 1999 Dose-dependent induction of distinct anergic phenotypes: multiple levels of T cell anergy. J Immunol 162:1974^1981

Control of immune pathology by regulatory T cells Fiona Powrie, Simon Read*, Christian Mottet, Holm Uhlig and Kevin Maloy Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford, OX1 3RE, UK and *Department of Biochemistry and Molecular Biology, University of Melbourne, Melbourne 3010, Australia

Abstract. CD4+CD25+ Treg cells inhibit colitis in the severe combined immune de¢cient (SCID) T cell adoptive transfer model. Cells with this function are present in the thymus suggesting that Treg cells capable of inhibiting bacteria-induced immune pathology are similar to those that inhibit organ-speci¢c autoimmunity. CD4+CD25+ Treg cells inhibit both T cell-dependent and T cell-independent intestinal in£ammation. The latter point illustrates that in addition to direct e¡ects on other T cells, Treg cells can also prevent immune pathology in vivo by inhibiting the actions of innate immune cells. Treg cells suppress intestinal in£ammation through mechanisms that involve interleukin 10 and transforming growth factor b and blockade of the negative regulator of T cell activation CTLA4 abrogates Treg cell function in vivo. Importantly adoptive transfer of CD4+CD25+ Treg cells to mice with established colitis reverses in£ammation and restores normal intestinal architecture suggesting that CD4+CD25+ Treg cells may be utilized for cellular therapy of in£ammatory diseases. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 92^105

The same immune e¡ector mechanisms that have evolved to protect the host from infectious agents can also induce immune pathology. This immunological balancing act is a feature of immune regulation in the intestine where there is a need to mount protective immunity towards pathogens whilst not activating damaging in£ammatory responses towards harmless commensal bacteria. An intact immune system is key to normal intestinal homeostasis, as mice with a variety of immunological defects, particularly those a¡ecting T cells, develop an in£ammatory bowel disease (IBD)-like syndrome (Powrie 1995, Blumberg et al 1999). Evidence emerging from these studies suggests that a breakdown in tolerance to resident bacteria can lead to the development of a chronic in£ammatory response in the intestine. Whilst numerous mechanisms may contribute to immune regulation in the intestine, our own work highlights an important role for CD4+ regulatory T cells (Treg) in this process. 92

IMMUNE PATHOLOGY

93

Suppression of colitis by CD4+CD25+ Treg: role of immune-suppressive cytokines and CTLA4 Transfer of CD4+CD45RBhigh T cells to immune de¢cient recipients leads to the development of a wasting disease and colitis 6^8 weeks after T cell transfer (Powrie et al 1993, Morrissey et al 1993). Immune pathology in the intestine resembles that seen in IBD in humans and includes epithelial cell hyperplasia, goblet cell depletion and transmural in£ammation. Colitis is associated with a Th1 response in the intestine and treatment with anti-interferon (IFN)g, anti-tumour necrosis factor (TNF)a or anti-interleukin (IL)12p40 monoclonal antibodies (mAbs) inhibits disease (Singh et al 2001). The dysregulated Th1 response is driven by resident bacteria as colitis fails to develop in T cell-restored immunede¢cient recipients raised under germ-free conditions (Singh et al 2001, Aranda et al 1997). Development of colitis induced by transfer of CD4+CD45RBhigh T cells can be inhibited by co-transfer of the CD4+CD45RBlow population, indicating that cells within the antigen-experienced T cell pool in normal mice can control pathologic T cell responses. Treg cell function enriches within the CD25+ subset of peripheral CD4+CD45RBlow cells as well as CD4+ thymocytes (Singh et al 2001, Read et al 2000). This population, originally identi¢ed by Sakaguchi et al (1995), has been found to suppress a number of T cell-mediated responses, including autoimmune disease, allograft rejection, anti-tumour immunity and T cell activation in vitro (Maloy & Powrie 2001, Shevach 2000). However control of intestinal in£ammation is not restricted to CD4+CD25+ cells as CD4+CD25
T cells also prevent colitis, albeit with reduced potency (Read et al 2000). Regulatory activity amongst CD4+CD25
cells has been noted in other experimental systems (Stephens & Mason 2000, Curotto de Lafaille & Lafaille 2002) and further work is required to establish the relationship between these phenotypically distinct subsets. The precise mechanisms by which Treg cells regulate immune responses are poorly understood (Maloy & Powrie 2001, Shevach 2000). In vitro studies have demonstrated that they inhibit the activation of other T cells either directly, via cognate cell contact-dependent mechanisms, or, indirectly via inhibition of antigen presenting cell (APC) function. With regard to control of intestinal in£ammation there is clear evidence that the immune suppressive cytokines IL10 and TGFb play a role as administration of anti-TGFb (Powrie et al 1996) or antiIL10R mAb (Asseman et al 1999) abrogates the ability of CD4+CD45RBlow cells to inhibit colitis. Furthermore, CD4+CD45RBlow cells from IL10
/
mice fail to inhibit intestinal in£ammation and when transferred alone to immune de¢cient recipients induce colitis (Asseman et al 1999). These studies suggest that IL10 synthesis by cells contained within the CD4+CD45RBlow population is crucial for their immune suppressive function.

94

POWRIE ET AL

It is now apparent that T cells can express a number of receptors that upon ligand binding inhibit T cell activation. One such example is CTLA4, a member of the CD28 family that also binds to CD80 and CD86. CTLA4
/
mice develop a fatal lymphoproliferative disorder demonstrating that CTLA4 plays a non-redundant role in immune regulation (Salomon & Bluestone 2001). Strikingly, expression of CTLA4 amongst peripheral CD4+ T cells is restricted primarily to CD25+ cells (Read et al 2000, Salomon & Bluestone 2001, Takahashi et al 2000). CTLA4 may contribute to Treg function as treatment with anti-CTLA4 antibody abrogates the ability of CD4+CD25+ cells to inhibit colitis (Read et al 2000). Precisely how antiCTLA4 antibody works to a¡ect Treg cell function in vivo is not known. One possibility is that it acts to cross-link CTLA4, sending an agonistic inhibitory signal to Treg cells. However, this is di⁄cult to reconcile with the fact that antiCTLA4 Fab1 fragments also abrogate Treg function in vivo (R. Greenwald, S. Read, F. Powrie and A. Sharpe, unpublished data). CTLA4 expression is not restricted to Treg cells, it is also present on e¡ector T cells making it possible that anti-CTLA4 acts to enhance the development or function of Th1 e¡ector cells that mediate intestinal in£ammation. However, blockade of CTLA4 does not alter the kinetics of wasting disease or increase the incidence or severity of colitis in CD4+CD45RBhigh restored mice (Read et al 2000). Takahashi et al reported that inhibition of T cell activation in vitro by CD4+CD25+ cells could be blocked by inclusion of anti-CTLA4 Fab molecules even under circumstances in which CTLA4 was present only on the Treg population (Takahashi et al 2000). These results, together with our own, favour the view that blockade of CTLA4 on Treg cells leads to loss of suppressor activity. If CTLA4 is involved in the function of CD4+CD25+ Treg cells then how is it working? One possibility is that signalling via CTLA4 alters the threshold of T cell receptor (TCR) signalling to favour the survival or enhance the activation of the suppressor function of Treg cells. Further understanding of this awaits identi¢cation of the molecular mechanism(s) by which these cells inhibit T cell activation. However, a signal through CTLA4 does not seem to be essential for the function of CD4+CD25+ Treg cells in vivo as CD4+CD25+ cells from CTLA4
/
mice still inhibit colitis (R. Greenwald, S. Read, F. Powrie and A. Sharpe, unpublished data). This may re£ect alterations in the selection of Treg cells in the thymus in the absence of CTLA4 or the use of alternative negative regulatory molecules. Suppression of the innate immune response by CD4+CD25+ Treg cells Colitis in T cell-restored immune de¢cient mice is characterized by an accumulation of CD4+ T cells and dendritic cells (DCs) in the mesenteric lymph nodes (MLNs) and colon of a¡ected mice (Malmstrom et al 2001). 20^30% of DCs

IMMUNE PATHOLOGY

95

in the MLN appear to be activated and express CD134L. Binding of CD134L to its receptor CD134 provides co-stimulatory signals to activated T cells (Gramaglia et al 1998). CD134L expression by DCs in the MLNs may be involved in the perpetuation of intestinal in£ammation as administration of an anti-CD134L mAb, known to block CD134^CD134L binding, prevents the accumulation of activated DCs and inhibits development of colitis (Malmstrom et al 2001). Similarly, transfer of CD4+CD25+ Treg cells also prevents the accumulation of activated DCs in immune de¢cient mice transfused with CD4+CD45RBhigh T cells. Indeed there are similar numbers of CD134L+ DCs in the MLNs of SCID mice given a mixture of potentially pathogenic and regulatory T cells as found in unmanipulated SCID mice (Malmstrom et al 2001). These results suggest that, like administration of anti-CD134L, Treg cells act to impede the ability of DCs to induce a sustained T cell response. To determine whether CD4+CD25+ Treg cells can mediate e¡ects on the innate immune system directly, we established a T cell-independent model of intestinal in£ammation using Helicobacter hepaticus infection. H. hepaticus, is a Gramnegative spiral bacterium that colonizes the intestinal crypts of the caecum and colon, establishing a life-long infection (Fox et al 1994). Infection of immunode¢cient 129 SvEv RAG
/
mice with H. hepaticus leads to intestinal in£ammation in the colon and the caecum (Maloy et al 2003). This is accompanied by accumulation of macrophages, neutrophils, DCs and NK cells both locally in the intestine and in the spleen. Pathology is the consequence of dysregulated in£ammatory response towards H. hepaticus as treatment with antiTNF or anti-IL12p40 prevents disease development. Importantly, transfusion of 129 SvEv RAG
/
mice with CD4+CD25+ Treg cells prior to H. hepaticus infection prevents immune pathology in the intestine. The protective e¡ect of Treg cells is not a consequence of reduced colonisation levels of the bacteria as Treg cell transfer had no measurable e¡ect on H. hepaticus DNA levels in the caecum or colon. Similar to suppression of T cell-mediated intestinal in£ammation treatment with anti-IL10R or anti-TGFb inhibits the immunosuppressive function of Treg cells. Furthermore, CD4+CD25+ Treg cells from IL10
/
mice failed to inhibit colitis, suggesting that IL10 production by Treg cells themselves is required. The protective CD4+CD25+ Treg cells were isolated from mice free from H. hepaticus infection indicating that Treg cells can suppress immune pathology triggered by organisms to which they have not been exposed. Whether they do this through recognition of self-peptides or peptides derived from foreign antigens or both is not known. These studies provide the ¢rst evidence that CD4+CD25+ Treg cells inhibit immune pathology mediated by cells of the innate immune system. Whilst Treg cells have been shown to mediate direct e¡ects on T cells in vitro, the ¢nding that Treg cells negatively regulate the chronic activation of innate immune cells suggests

96

POWRIE ET AL

the activities of Treg cells in vivo are likely to be complex, involving e¡ects on multiple cell types. The requirement for Treg cells to have to control activation of the innate immune system to inhibit intestinal in£ammation may explain the obligate roles of IL10 and TGFb in this process. Treg cell-mediated suppression of T cell activation in vitro is less dependent on immunosuppressive cytokines, as is inhibition of organ-speci¢c autoimmune diseases (Maloy & Powrie 2001, Shevach 2000). It may be that the e¡ector mechanisms utilised by Treg cells to control immune pathology are dictated by the nature of the in£ammatory response that is regulated. It is highly likely that Treg activity is not an all or nothing phenomenon but that Treg cells act to quantitatively regulate both innate and adaptive immune responses to allow protective immunity to proceed without harmful immune pathology. As a consequence of this delicate balancing act, Treg cells may in some circumstances impede protective immunity towards pathogens. Indeed, CD4+CD25+ Treg cells were found to suppress protective immunity towards Pneumocystis carinii in T cell restored immunode¢cient mice (Hori et al 2002). Cure of colitis by CD4+CD25+ Treg cells The wide-ranging immunosuppressive properties of CD4+CD25+ Treg cells highlights their potential use as therapeutic agents for in£ammatory and autoimmune diseases. However, to be of practical use in the clinic, Treg cells must be able to inhibit ongoing T cell responses and reverse established pathology. To assess this, immunode¢cient mice that had received CD4+CD45RBhigh cells and developed colitis were given a single transfusion of Treg cells. Treated mice typically started to recover with weight gain from 2 weeks after Treg cell transfer. By 10 weeks the histological colonic abnormalities were almost completely resolved with normalization of the epithelial cell hyperplasia and reduction of the in£ammatory in¢ltrate (Mottet et al 2003). After transfer into colitic mice Treg cells were found to proliferate in the MLNs and colon, where they inhibited the proliferation of pathogenic CD4+ T cells. These data suggest that Treg cells may act in both secondary lymphoid tissue and locally at e¡ector sites to resolve in£ammation. Concluding remarks There is now overwhelming evidence that regulatory T cells suppress a variety of pathological e¡ector immune responses. Their ability to reverse established in£ammation makes them attractive candidates as therapeutic agents. Enhancement of their function may inhibit IBD and autoimmune disease whereas their removal may enhance anti-tumour immunity and host resistance to

IMMUNE PATHOLOGY

97

infectious diseases. Whilst there are still many questions outstanding regarding the origin and function of regulatory T cells, their potential therapeutic utility should make e¡orts to further characterize these cells worthwhile. Acknowledgements S. Read, K. Maloy and F. Powrie are funded by the Wellcome Trust and H. Uhlig by EU grant QLRT-CT-1999-00050. C. Mottet is funded by The Swiss National Science Foundation and the Roche Research Foundation.

References Aranda R, Sydora BC, McAllister PL et al 1997 Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45RBhigh T cells to SCID recipients. J Immunol 158:3464^4373 Asseman C, Mauze S, Leach MW, Co¡man RL, Powrie F 1999 An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal in£ammation. J Exp Med 190:995^1004 Blumberg RS, Saubermann LJ, Strober W 1999 Animal models of mucosal in£ammation and their relation to human in£ammatory bowel disease. Curr Opin Immunol 11:648^656 Curotto de Lafaille MA, Lafaille JJ 2002 CD4+ regulatory T cells in autoimmunity and allergy. Curr Opin Immunol 14:771^778 Fox JG, Dewhirst FE, Tully JG et al 1994 Helicobacter hepaticus sp. nov., a microaerophilic bacterium isolated from livers and intestinal mucosal scrapings from mice. J Clin Microbiol 32:1238^1245 Gramaglia I, Weinberg AD, Lemon M, Croft M 1998 Ox-40 ligand: a potent costimulatory molecule for sustaining primary CD4 T cell responses. J Immunol 161:6510^6517 Hori S, Carvalho TL, Demengeot J 2002 CD25+CD4+ regulatory T cells suppress CD4+ T cellmediated pulmonary hyperin£ammation driven by Pneumocystis carinii in immunode¢cient mice. Eur J Immunol 32:1282^1291 Malmstrom V, Shipton D, Singh B et al 2001 CD134L expression on dendritic cells in the mesenteric lymph nodes drives colitis in T cell-restored SCID mice. J Immunol 166:6972^6981 Maloy KJ, Powrie F 2001 Regulatory T cells in the control of immune pathology. Nat Immunol 2:816^822 Maloy KJ, Salaun L, Cahill R, Dougan G, Saunders NJ, Powrie F 2003 CD4+CD25+ TR cells supress innate immune pathology through cytokine-dependent mechanisms. J Exp Med 197:111^119 Morrissey PJ, Charrier K, Braddy S, Liggitt D, Watson JD 1993 CD4+ T cells that express high levels of CD45RB induce wasting disease when transferred into congenic severe combined immunode¢cient mice. Disease development is prevented by cotransfer of puri¢ed CD4+ T cells. J Exp Med 178:237^244 Mottet C, Uhlig HH, Powrie F 2003 Cutting edge: cure of colitis by CD4+CD25+ regulatory T cells. J Immunol 170:3939^3943 Powrie F 1995 T cells in in£ammatory bowel disease: protective and pathogenic roles. Immunity 3:171^174 Powrie F, Leach MW, Mauze S, Caddle LB, Co¡man RL 1993 Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal in£ammation in C. B-17 scid mice. Int Immunol 5:1461^1471

98

DISCUSSION

Powrie F, Carlino J, Leach MW, Mauze S, Co¡man RL 1996 A critical role for transforming growth factor-beta but not interleukin 4 in the suppression of T helper type 1-mediated colitis by CD45RBlow CD4+ T cells. J Exp Med 183:2669^2674 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Salomon B, Bluestone JA 2001 Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu Rev Immunol 19:225^252 Shevach EM 2000 Regulatory T cells in autoimmmunity. Annu Rev Immunol 18:423^449 Singh B, Read S, Asseman C et al 2001 Control of intestinal in£ammation by regulatory T cells. Immunol Rev 182:190^200 Stephens LA, Mason D 2000 CD25 is a marker for CD4+ thymocytes that prevent autoimmune diabetes in rats, but peripheral T cells with this function are found in both CD25+ and CD25
subpopulations. J Immunol 165:3105^3110 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310

DISCUSSION Bluestone: An important question is whether or not CTLA4 function is ligand dependent. As you know, the CTLA4 knockout dies. B7-1 and B7-2 knockout mice do not die, and the double knockout that you used does not die. The argument is that this is because of CD28 problems. When Arlene treats the triple knockout with anti-CD28, they die because now you have activation of T cells but no CTLA4 to turn them down. If this is true, then why
when B7-1 and B7-2 knockout mice are treated with anti-CD28
don’t they die? There is nothing to oppose CTLA4 in a double knockout unless there is another ligand out there. With that aside
because a lot of the data can’t be explained if there is another ligand out there
the only way this can make sense is if CTLA4 functions in a ligand-independent manner by associating with the TCR complex. The reason the antibody keeps showing us this blocking is because we are disrupting this ligand-independent function of CTLA4. When we do these experiments in fully B7-de¢cient settings we will get the exact same results, that anti-CTLA4 will work. It is not telling us necessarily what we think it is. Powrie: There is a problem there in that if one would transfer CD45RBhigh cells into a B7-de¢cient recipient we probably won’t get any disease. Bluestone: If you use pre-activated cells you probably will. Powrie: Do you think that scenario is likely with a Fab in vivo?

IMMUNE PATHOLOGY

99

Bluestone: When this antibody, even in a F(ab0 )2 fragment, is bound to CTLA4, it has this ability to internalize so rapidly that it seems to internalize everything o¡ the cell surface very rapidly when anti-CTLA4 antibody is bound to it. I don’t quite understand the biochemistry here. But I think the Fabs may do exactly the same thing. Powrie: Another possibility, given Jim Allison’s ¢ndings that CTLA4 regulates the high avidity cells, is that there maybe di¡erential roles for CTLA4 in particular T cell subsets. In the T cell transfer model of colitis it may be that the CD45RBhigh cells are lower avidity (because the higher avidity bacteria-reactive cells are in the memory pool) and that these are not so in£uenced by CTLA4 in this particular cell transfer system. In contrast, the CD25+cells are targeted by anti-CTLA4. I think our data do indicate that in this particular situation antibody does perturb the function of the regulatory cell, as opposed to the pathogenic e¡ector cells. Shevach: I’d like to return to the issue of putting the regulatory cells in late and seeing them work. This may depend on the disease one is looking at. In the model of gastritis we and others work on, we see a loss of gastric parietal cells and an inability to generate new ones. When they go, they cannot be regenerated because part of the pathology is a developmental arrest in gastric mucosa. Regulatory cells will never bring this back. Powrie: A feature of the gut is that it is very regenerative and this is important in clinical settings. In the case of gastritis, perhaps you may be able to combine Treg cells with some stem cell therapy, like in the pancreatic model where cytokines are given that enhance b cell regeneration. Harrison: This does work in the NOD mouse: if you induce regulatory cells up to 10^12 weeks of age the mice have a lower incidence of diabetes. This doesn’t, however, address the question of target tissue regeneration. It would be interesting if the immune system itself, i.e. regulatory T cells, had a role in this! Powrie: It depends on what you are trying to reverse. Harrison: Why do your CD45RBhigh cells go to the gut and cause colitis? Powrie: I think that this is the major antigenic drive in these colonies of very clean mice. They still have an enormous load of commensal bacteria that are a source of stimulation to the innate immune system. When you transfer na|« ve cells into an immunode¢cient mouse, the major drive will come from the commensal £ora. If we look at systems where we tip the balance of immune homeostasis, what the animals develop is in£ammatory bowel disease. There are 40 or 50 models of in£ammatory bowel disease based on manipulating immune molecules or cells. Harrison: But they only get in£ammation in that mucosal site, presumably because of some particular microbial population. Powrie: They do get other in£ammatory lesions, such as lung in£ammation, myocarditis and gastritis. There is a multi-organ pathology. We have studied colitis because it is by far the most severe and frequent.

100

DISCUSSION

Harrison: When you said that the germ-free mice don’t get this disease because they don’t have bacteria, they also don’t have a normal intestine, either. They don’t develop normal mucosal immune function. Is this because of the lack of bacteria? Powrie: Certainly, when they are colonised with bacteria they develop colitis. Harrison: If we induce or inject any of our regulatory cells in the NOD mouse, they always seem to go to the site that we want them to go to
the site of in£ammation. When we have looked at other locations such as salivary glands and other organs, it does seem to be relatively speci¢c for the pancreatic lymph node and the islets. Does anyone know whether these regulatory cells might recognize some product of an in£amed cell, such as heat shock proteins? Powrie: This is an interesting possibility. Alternatives include particular homing receptors. Bach: I’d like to come back to the question of homeostasis that I raised early. Your studies and others are done in lymphopaenic mice. There has been a suggestion that this lymphopaenia can stimulate T cell proliferation and activation through a homeostasis mechanism, and which could lead to proliferation and activation of pathogenic T cells, such as the CD44RBhigh cells. Then the CD44RBlow cells would compensate for this. What are your views on this? Have you any experimental models where you have created less lymphopaenia by adding more CD44RBhigh cells or complementing with other cell types? Powrie: That is not something we have done. Presumably, what you are asking is whether the disease is induced by a homeostatic proliferation of CD45RBhigh cells. Bach: Is there any contribution by the homeostatic mechanism to the exacerbation of pathogenic cells in the lymphopaenic mice. Powrie: There could be. To my mind, it hasn’t been proven how much the £ora in£uences homeostatic proliferation. Do we know, for example, whether homeostatic proliferation occurs in germ-free mice? In immunode¢cient mice in the absence of T cells we can ¢nd evidence of activated DCs that we don’t ¢nd in germ-free mice. The frequency of OX40L+ DCs in the mesenteric lymph nodes of an immunode¢cient mouse is higher than in a normal mouse. I think this activation of the innate immune system may drive the pathogenicity that we see upon transfer of low numbers of CD45RBhigh cells and that this is quantitatively regulated by the CD25+ population. How this relates to homeostatic proliferation is not clear. Shevach: This is a very complicated issue because several things are going on at once. In our hands, CD25+ cells do not control the ¢rst 21 d of the lymphopaeniainduced proliferation seen when CD25
cells are injected into SCID or RAG
/
mice. Beyond 21 days, the mice develop autoimmune disease and we therefore have antigen-driven proliferation. Where it has been shown that CD25+ cells control what has been called homeostatic proliferation, it has usually been done

IMMUNE PATHOLOGY

101

between three and six months after transfer, and lots of things have taken place in that mouse, including the development of colitis. Proliferation is antigen driven at this point. Powrie: There is very good evidence that development of colitis is antigen driven and depends on resident bacteria. The role of homeostatic proliferation is not really clear. Harrison: Not necessarily. Bach: Incidentally, in the NOD mouse the regulatory cells are present in the initial weeks of life under SPF conditions. However, can bacteria dampen the immune response in these mice? Harrison: Many of the patients we see with autoimmune disease are lymphopaenic, and many of them have a reduced autologous or syngeneic mixed lymphocyte reaction (SMLR). Have you seen a connection between those two phenomena and a lack of suppressor cells? There used to be a relationship. Shevach: You should see the opposite: an elevated SMLR. Shimon Sakaguchi has shown this in the absence of regulatory cells. The old observation doesn’t make sense. Harrison: If regulatory cells are seeing self peptide on class II MHC, you would expect the SMLR to be low in autoimmune disease. Shevach: Regulatory cells don’t proliferate. Harrison: That is why there is lymphopaenia! Mitchison: Fiona Powrie, can you tell us some more about the TGFb-secreting cells? They are present in the CD45RBlow population. But then they are lost from sight. Do those cells end up in the CD45RBhigh or RBlow population? Powrie: All we can say is that if we transfer CD25+ cells and administer an antiTGFb antibody, this abrogates the ability of the CD25+ cells to suppress. We don’t have compelling data that CD25+ cells themselves or their progeny in vivo produce the TGFb. We are doing the various knockouts and chimeras to be able to address this question. Warren Strober has published data that CD25+cells suppress in vitro as a consequence of membrane bound TGFb, but we have not looked at this ourselves. Mitchison: The indication is that there are two populations of cells, one making TGFb and the other making IL10. Powrie: I don’t think we can say this without single-cell analyses. These two cytokines may mediate the immune regulatory activity of these cells in di¡erent ways. Mowat: When you transfer in the regulatory cells, how quickly do the mice start getting better? They must be losing weight still at that point. Powrie: Two weeks after transfer mice look better and start to gain weight. Mowat: The colonic crypts appear to be quite long still. Does all the pathology go away?

102

DISCUSSION

Powrie: It is not completely normal: there is still some hyperplasia, but it is greatly reduced. Mowat: Is there still in¢ltrate there? Powrie: It is substantially diminished. Von Herrath: In the Helicobacter system the regulatory cells depend on IL10. Is this similar to the controls that Ethan Shevach has done? Can you generate them a priori from the CD25
population? Ethan couldn’t. Powrie: CD25
CD45RBlow cells do not inhibit T-cell dependent H. hepaticusinduced in£ammation, at least at the cell doses we have tested. Von Herrath: What happens if you take CD25
cells, activate them to make them positive, and then transfer them? Powrie: We haven’t done this in H. hepaticus infection. We have done this in the cure of colitis, and these cells don’t work. Asseman: You said that CD25+ cells are able to abrogate T cell-independent colitis, and this is dependent on IL10. Is the pathology identical in this T cell independent model? Powrie: In£ammation is less severe in the absence of T cells. Shevach: In that model are the CD25+ cells being triggered through their TCR? Powrie: We can take them from mice that have not been infected with Helicobacter. This suggests that it is not a classic memory cell response to Helicobacter. Shevach: We can cure all kinds of things with normal CD25+ T cells, so that doesn’t count. Powrie: I don’t know what they are responding to. No one does. Shevach: But in this model do you think that the cells are being triggered through their TCRs? Powrie: Yes. I would ¢nd it di⁄cult to see how they are working otherwise. How would you test this in vivo? Abbas: You commented on the IBD model and the therapy aspects. If it is going to be quite this non-speci¢c
some antigen is going to trigger CD25+ cells and they can inhibit some or all responses
then the likelihood of using these cells for cell therapy is pretty slim. Powrie: I don’t think it is an all-or-nothing situation. I think Treg cells go to an in£ammatory site and accumulate there. Whether they inhibit the response will depend on the level of stimulation of the innate immune response. For example, we can induce intestinal in£ammation with anti-CD40 and this cannot be inhibited by CD25+ cells. Bluestone: There are two parts to this. They go to special places, but also for their longevity they need to continue to recognize and be stimulated by antigens. The therapeutic opportunity here is probably one in which where you are not looking

IMMUNE PATHOLOGY

103

(like you are in these models) for a turnaround in a couple of days, but to encourage those cells at the sites to expand, or to get them to the sites and let them do their own expanding. Thus a year later they will still be doing their job and not nonspeci¢cally. Abbas: But wouldn’t you think a site of infection is a ‘special place’? Powrie: I would predict that they would accumulate at a sight of infection. There are data to support this. Ha£er: In human autoimmune disease to begin with there will be basic defects of dysregulation. We don’t know what these are. If you can induce these cells, all you may be doing is bringing them back to a homeostatic status. I wouldn’t look at this in the way that a mouse immunologist looks at a knockout that is there or not there. Instead, I would think in terms of subtle defects that need to be corrected in some way. Mowat: You don’t even need to look at it in terms of therapy. The gut is dealing with this all the time physiologically. In fact, most of the antigens you meet through your gut you are tolerant to. There are probably regulatory cells against commensal £ora and food antigens. Yet we make protective immune responses against things such as Salmonella and invasive antigens. We are doing this all the time physiologically. Powrie: Perhaps the CD25+ cells modulate that, and if you took them out you would make more of a response against Salmonella. In some ways this could be deleterious. What they do is attenuate the overall response to prevent immune pathology in a quantitative way while allowing protective immunity when you have strong innate immune cell activation as with a pathogenic bacterium. Mitchison: So far as tolerance in the gut is concerned, the TGFb-secreting population is just as good a candidate as the CD25+ cell population. That puts Th3 and Treg cells on an equal footing. Powrie: Clearly Treg1 cells can do similar things to CD25+ cells with regard to regulation of this in£ammatory bowel disease model. They are not the only cell type involved in immune regulation. Something like the gut that is exposed to a strong proin£ammatory stimulus may bene¢t from a variety of di¡erent immune mechanisms, not least of all being IgA, which is not in this system at all. TGFb may also be linked with CD25+ cells, so that if one drew Venn diagrams there would be some overlap in e¡ector functions. Bach: What are Th3 cells? If we propose that TGFb may be used by CD25+ cells, what is the basis for the de¢nition of Th3 cells? Powrie: They are based on clones. These are cells that have been grown out from mice that have undergone speci¢c immunization protocols. Bach: What are the properties of these clones? Ha£er: They are cloned out of gut tissue. They secrete TGFb and IL4. They are antigen-speci¢c. It is not clear, though, whether or not we are dealing with a very

104

DISCUSSION

mixed subset with these Treg. I wouldn’t be surprised if one subset of the Th3 cells might be Treg cells, depending on how we de¢ne them. Bach: What do you precisely mean by Treg? Powrie: I mean a population of CD4+CD45RBlow cells capable of preventing colitis in our model system. It seems likely that the term ‘Treg’ encompasses a number of di¡erent T cell populations. The lineage relationships between them is not known. Bach: I heard recently that di¡erent data may be obtained in nude mice and SCID mice. Is the CD25+ cell-induced gastritis seen in both? Powrie: This is the experience of several groups around the world. There are various cell populations present in nude mice that are absent in RAG mice, including some thymic-independent intestinal T cells and B cells. These may play a key role in host defence and immune regulation. If you treat a normal mouse with anti-CD25 you do not get in£ammatory bowel disease or gastritis. The gut has several mechanisms of protection and it is not su⁄cient just to take away the CD25+ cells. Flavell: In your regulation of the innate response, how do you know that it is an ab T cell in the CD25+ group that is actually doing that rather than some innate cell. Evolutionarily it is awkward to think about this. There is a bunch of organisms who have to do this innate regulation without any T cells. One should consider the possibility that it is an innate cell that is involved. Powrie: When we have reanalysed the cells by FACS they are over 99% ab positive. We don’t have to transfer very many cells to see this. Harrison: You raised the di¡erence between the RAG
/
mice and nude mice, and mentioned extrathymic-derived T cells, which constitute many of the intraepithelial leukocytes (IELs) in the gut. There are data (Mengel et al 1995, Ke et al 1997) showing that if cells are blocked with gd antibody at the time you try to induce regulatory cells with mucosally administered antigen, you don’t get them. You need to have IELs of the extrathymic variety working in order to generate through mucosa the various varieties of T cells that we are talking about. This is a critical ¢nding in the literature that has been overlooked. It might help us to connect what is happening in the mucosa, in terms of the requirement for a normal mucosa in order to get colitis and on the other hand having a normal mucosa in order to get regulation. These cells are the ¢rst line of defence in the mucosa, so it makes sense that they might condition underlying DCs in the lamina propria to be ‘tolerogenic’ for the induction of CD4+ regulatory T cells. Powrie: That is an important point. How they relate to the CD25+ cells that one can ¢nd in the thymus is another issue. Harrison: There is a thymus^mucosa axis. It is a two-way thing.

IMMUNE PATHOLOGY

105

References Ke Y, Pearce K, Lake JP, Ziegler HK, Kapp JA 1997 gd T lymphocytes regulate the induction and maintenance of oral tolerance. J Immunol 158:3610^3618 Mengel J, Cardillo F, Aroeira LS, Williams O, Russo M, Vaz NM 1995 Anti gd T cell antibody blocks the induction and maintenance of oral tolerance to ovalbumin in mice. Immunol Lett 48:97^102

General discussion I

TGFb Flavell: I wanted to brie£y describe some of our results on TGFb. This work exploits a system that we set up a few years ago, based on transgenic mice that have a dominant-negative TGFb receptor. Leonid Gorelik, who made these mice truncated the type II receptor, which blocks signalling. These mice develop a very profound immune-activated phenotype, which is re£ected in a series of autoimmune diseases. These include in£ammatory bowel disease (IBD; this is bacterial dependent), in£ammation in the lungs, autoantibodies and accumulation of immune complexes in the kidneys. Depending on the genetic background, other phenotypes ensue. On the Balb/C background the mice get liver in£ammatory disease, and the NOD mouse develops very acute diabetes within a few weeks of birth. It is an example of where there is a di¡erence of immune repertoire, consequences are di¡erent. The basic phenomenon is increased tissue-speci¢c and systemic autoimmunity. Bach: Are they hypertrophic? Flavell: They have wasting disease when the IBD develops. However, in the lines that we study this doesn’t occur for several months of life. They develop pretty normally for the ¢rst several months. After that they develop wasting disease. Mitchison: What happens with regard to the role that TGFb is supposed to play in embryonic development? Flavell: We are not a¡ecting the production of TGFb in these mice. All we are a¡ecting is the ability of T cells to respond to it. This transgene is directed only towards the CD4+ and CD8+ T cells. The rest of the body is acting pretty normally. The reason I wanted to mention this mouse in this context is that it allows us to ask, if we have a cell of this nature (I’ll talk about CD8+ cells), whether it can be inhibited in its function to develop an autoimmune response by regulatory T cells. The system we use for this is diabetes. It is a published system developed by Alison Green who did the experiments (Green & Flavell 2000). It is a complex transgenic system, but the basic phenomenon uses induced TNFa gene expression in the islets. These mice then develop diabetes very acutely. If we induce this at birth, they will develop diabetes within 4^6 weeks. Alison noted that the necessary duration of TNFa expression for acute 106

GENERAL DISCUSSION I

107

disease was 28 days. She saw that if one induces for shorter periods, then disease is protracted, taking a lot time to happen. Then when she looked in the draining lymph nodes she saw that regulatory cells (CD4+CD25+) accumulate, increasing in number up to about 20% in the nodes and the islets. They then wane as disease occurs. When she shut o¡ expression early, what happened was that these numbers stayed up: there was a correlation between the numbers of these cells and the time it took to get sick. If she kept those Treg numbers high by shutting o¡ the expression then the regulatory cells were high in number and the mice took a long time to get sick. Adoptive transfer studies were then done to establish that the protective e¡ect was indeed due to these cells. It was a very sensitive system: she could protect with only 2000 of these cells. These cells again are derived from the pancreatic lymph node. Those from other environments are not strongly protective. Using this system Alison and Leonid went on to ask what happens in a system of this nature if one uses, instead of a normal CD8+ cell, a CD8+ cell carrying the dominant-negative TGFb receptor as the autoaggressive cell. In the ¢rst study, they did an adoptive transfer. 2000 cells are su⁄cient to do this. In this study we transferred 10 000 of these pancreatic lymph node Treg cells, ¢ve times more than is required to block normal diabetes. Normally, the recipient mouse develops diabetes about 10 d after the initiation of the transfer process. If the Treg are put in, this process is blocked. Importantly, if you put in 30 000 of the CD8+ cells which derive from the dominant-negative mouse together with the Treg, all of the mice develop disease. The regulatory cells cannot block their function. In order to address this in a di¡erent kind of transfer model she did the experiment in the other direction. She took a recipient mouse that actually carries the regulatory cells. She put 30 000 transgene-positive or transgene-negative autoaggressive cells into this mouse, in both cases derived from the pancreatic lymph node. In the ¢rst experiment transferring mixed CD8+ cells blocks disease completely. We then transferred either activated or na|« ve cells derived from that lymph node. You can imagine that because of the fact that these CD8+ cells have a propensity to get activated, we are not comparing apples with apples. This experiment shows what happens if you take out memory CD8+ cells (CD8+CD44+) and compare these with either the dominant negative memory cells or the wild-types. The wild-type cells are inhibited by this regulatory environment. Mice given the memory cells derived from the transgene positive develop disease instantaneously. The regulatory cells in that recipient mouse can’t inhibit the function of these memory cells if they carry that dominant negative. The same is true when na|« ve cells are used. Transfer of na|« ve dominant negative cells (CD44low CD8high) causes disease. Controls don’t develop disease in this time frame. Both na|« ve and ‘memory’ cells are susceptible to this inhibition, although it looks like the na|« ve cells are more susceptible. Fiona Powrie has data using cells from these mice. In this case it is CD4+ autoaggressive cells.

108

GENERAL DISCUSSION I

Powrie: The basic question we have been asking is if we take CD45RBhigh cells from one of these dominant-negative transgenic mice that can’t respond to TGFb, can they be regulated by the CD25+ cells with regard to colitis induction? The answer is that they can’t. If the responding T cells can’t receive a TGFb-mediated signal, then the CD25+ population is not able to suppress. Harrison: I have a bit of a problem with the logic of that. Why do you assume that the regulatory cells don’t work, and normally when they do they necessarily work through the TGFb pathway in e¡ector cells? It could be that the e¡ector cells are di¡erent in all sorts of ways. It doesn’t necessarily require a signal through TGFb to suppress them. Flavell: Let’s reduce your question to a more general one: do we know that the e¡ect is a direct e¡ect between regulatory cells and these cells? What the experiment says is that the end point of the response requires a signal through TGFb in order for the thing to be shut o¡. In the absence of that this doesn’t work. Abbas: Je¡ Bluestone made this point with CTLA4 earlier. Why can’t you postulate that TGFb or CTLA4 are not the mediators of regulation, but in their absence these cells are hyper-responsive? They just respond so much better that they can’t be suppressed any more. It is this tuning idea, rather than the direct mediator idea. I am not sure you can exclude the idea that these cells are just hyper-responsive, and under the conditions of your experiment they are just responding too much for you to suppress them. Shevach: A bigger response is harder to suppress. Powrie: There is no evidence that there is a bigger response in the RBhigh dominant-negative cells with respect to colitis. Abbas: But you haven’t really done careful dose titrations. In the Gorelik & Flavell (2000) paper they showed that the TGFb dominant-negative receptor expressing cells are hyper-responsive. They give much bigger responses than the wild-type. Powrie: With the na|« ve RBhigh population, if we isolate them, transfer and look at their accumulation, there is no evidence that they accumulate more than normal cells, or that they are more potent in inducing colitis. Bluestone: The arguments made here are no di¡erent than the arguments that you heard when you did the anti-TGFb antibody treatment. You showed that the absence of TGFb in the environment makes it harder to suppress. Bach: One may argue from these data that the presence of TGFb is mandatory for T cell-mediated suppression of colitis. Coming back to Abul Abbas’ question, one does not yet fully understand how TGFb works in this context. Abbas: The point is, if you buy this sort of hyper-responsiveness idea, you could speculate that the actual suppressive molecule is ‘X’, and it has nothing to do with TGFb, but normally when you activate T cells they make a small amount of TGFb that functions to dampen their response. In the absence of TGFb, the cells respond

GENERAL DISCUSSION I

109

much more and exceed the limit of suppressibility; for instance, instead of 10 units of response we get 1000 units of response, and we can only suppress 100. Powrie: It should be possible to overcome this by quantitatively putting in more CD25+ cells. Bluestone: On a per cell basis this may not be possible. More may not be better. Bach: These data should be considered alongside the anti-TGFb antibody data. Shevach: Have you reversed suppression with anti-TGFb? Flavell: We haven’t tried. Shevach: This would get around Abul Abbas’ argument. It should be very easy. Bluestone: The best experiment would involve prede¢ning the repertoire, getting everything out of the periphery and then turning this thing on conditionally. This will tell you for sure. Delovitch: Is the apparent hyper-responsiveness associated with the relative resistance of those cells to activation-induced cell death through TGFb signal? Flavell: It is the reverse. If anything these cells are more susceptible to apoptosis because TGFb is somewhat protective against this e¡ect. Bluestone: Have you done the reciprocal experiment, asking whether the regulatory cells from these animals are functional? This would be a neat thing to know. Flavell: I think it has been done. Shevach: I’d like to present some data on the function of TGFb in vitro in mediating suppression by CD25+ cells (Piccirillo et al 2002). This is a 100% negative study. This work was prompted by my colleague Warren Strober’s observation that antibody to TGFb completely reversed suppression (Nakamura et al 2001). In our hands antibody to TGFb of any type at any concentration always fails to reverse suppression. This is done with freshly explanted CD25+ cells, but more importantly it is done with pre-activated CD25+ T cells that according to Strober are supposed to express abundant membrane TGFb We have also attempted to reverse suppression with a soluble TGFb-R2 receptor (which Richard Flavell was talking about). This particular experiment was done with CD8 responders. If we take CD8 responders and add TGFb we suppress the response of these cells to anti-CD3. If we put in soluble receptor we reverse the suppression mediated by recombinant human TGFb. If we do the same experiment using CD25+ T cells this suppression is not reversed. The next thing we used was T cells derived from SMAD3-de¢cient mice. SMAD3 is a critical model involved in TGFb-mediated signalling. Wild-type T cells responsive to anti-CD3 can be suppressed by TGFb. In contrast the response of SMAD3 knockout CD4+ T cells to anti-CD3 can not be suppressed by a high concentration of TGFb. However, they are fully suppressed by CD4+CD25+ T cells from wild-type mice. We have also done the reverse experiment, asking whether CD25+ T cells from SMAD3 knockout mice will suppress. They

110

GENERAL DISCUSSION I

suppress perfectly normally. This doesn’t exclude the possibility that TGFb acting on the CD25+ cell could potentially have some sort of augmenting e¡ect, but it is not critically needed for their suppressive function. Lastly, we utilized a di¡erent dominant-negative TGFb-R2 dominant negative mouse than the one described by Richard Flavell that is also non-responsive to TGFb. CD4+CD25+ T cells from these mice were also fully suppressible by CD25+ T cells from wild-type mice. We did the converse experiment here as well showing that the CD25+ cells from the dominant-negative R2 receptor mice were fully functional. Lastly, we actually bit the bullet and isolated CD4+CD25+ T cells from very young TGFb knockout mice. We didn’t see any di¡erence between the percentages of CD25+ cells between the wild-type and TGFb knockout mice of the same age. More importantly, when we looked at the CD25 cells from these knockout mice, they had no sign of activation. The functional phenotype of the CD25+ T cells from 10 day old TGFb de¢cient mice was the same as that of CD25+ T cells of wild-type mice. They were both anergic and suppressive. Furthermore, depletion of CD25+ T cells from lymph node and spleen preparations from TGFb knock out mice led to enhanced proliferation. We conclude that TGFb plays very little, if any role in the suppressor e¡ector function of CD4+CD25+ T cells in vitro. Ha£er: Fiona Powrie’s system is very di¡erent, so I can understand some discrepancies there. But Warren’s system is similar to yours and you have exchanged reagents. Shevach: We exchanged reagents and we didn’t see cell surface staining with mice from the same facility. So our di¡erent results are very hard to explain. The concept that suppression is mediated by cells that express a cell surface inhibitory cytokine remains very attractive. The only unifying explanation I can o¡er is that in some circumstances where you have CD25+ cells that are not potent suppressors, TGFb made by either CD25+ or CD25 T cells may feed back and augment the function of the CD25+ cells in vitro. There is some evidence for this. David Horowitz has shown that TGFb induces suppressor cells that functionally resemble CD25+ cells by culturing CD25 cells in TGFb (Yamigawa et al 2001). Bruce Blazar has a paper where he shows that TGFb augments the suppressor function of CD25+ cells (Taylor et al 2002). Our experiments with the SMAD3 knockouts show that TGFb is not needed for suppression, but TGFb could still play a co-stimulatory role in augmentation of suppressor activity of CD25+ T cells. Bach: Shimon Sakaguchi, did you ¢nd TGFb on the membranes of your cells? Sakaguchi: In our hands we can stain the CD25+ cells by anti-TGFb antibody, but the expression is not as high as that published by Warren Strober. We think that membrane TGFb exists, but we can’t neutralize its e¡ect by any anti-TGFb antibody.

GENERAL DISCUSSION I

111

Banchereau: Can you block the antibody binding with an excess of TGFb? Shevach: We haven’t done this, and Warren Strober tells me that he hasn’t either. It is only with the chicken polyclonal antibody that anyone can see cell surface staining. Mitchison: You should repeat these experiments using cells grown in the sort of TGFb-enriched environment that the pancreatic lymph node provides. Shevach: You can mimic this in vitro. This is what Bruce Blazar essentially does. He cultures CD25+ T cells with anti-CD3, IL2 and TGFb, and gets out better suppressors. Chatenoud: We have been working on regulatory T cells in the in vivo NOD mouse model for many years now. I am always reluctant to extrapolate too many things from in vivo to in vitro systems. We badly need reliable in vitro markers and functional assays to monitor these regulatory T cells. Without wanting to be controversial, I am not sure even after all the discussion so far at this meeting that what the in vitro systems are really re£ecting what we do see in vivo. We speak of CD25 as a marker, but we all agree that there is evidence to show that it is not ‘the only and de¢nitive’ marker. For these reasons, I would tend to trust better the in vivo data. In the NOD model CD4+ cells are present in prediabetic animals that control the e¡ect of the pathogenic cells. We can reveal the activity of these cells in adoptive co-transfer. These cells also stain for L selectin (CD62L). This is a good marker in the NOD mouse to distinguish diabetogenic cells from the regulatory cells. CD25 is also a marker, but in the very young NOD mice (5^8 weeks), the CD4+CD62L+CD25 cells are also endowed with regulatory properties. Once the animals reach 12 weeks of age when the insulitis starts to be destructive, only the CD4+CD62L+CD25+ population is inhibitory in adoptive co-transfer. In this experiment we have tried for a long time to look at which could be the anticytokine antibodies that were inhibiting these e¡ects. We have now results pointing to two candidates able to reverse the protection that are anti-TGFb and anti-CTLA4 antibodies. We injected two di¡erent TGFb antibodies three times a week (1 mg per animal/injection for at least six consecutive injections). In the literature more than one paper using di¡erent models showed that both these antibodies did e¡ectively blocking mouse and rat TGFb. These antibodies are mouse monoclonals produced against human TGFb that cross-react with mouse or rat TGFb. Concerning the in vitro data the suppression mediated by CD25+ cells on CD25 cells proliferation is visible using cells from fairly young NOD mice (4^6 weeks of age). When the animals reach 8 weeks of age, some show the inhibition but the majority don’t. When the animals are diabetic, none show inhibition. I don’t know if we can really match these results with the in vivo co-transfer data where we see. Bach: Could it depend on the mouse strain?

112

GENERAL DISCUSSION I

Shevach: In fact, except for the studies with BALB/c mice where you only had modest suppression and easily reversed it with anti-TGFb (as I suggested earlier, this is exactly the situation where TGFb may play some augmenting role) all your other studies are done with NOD mice where something has happened to the mouse early in life. You may have induced a suppressor cell that makes TGFb at some point in the evolution of the disease process in the NOD and this cell then plays an important role. But de¢ne the speci¢cs of your model. In the cell transfer studies, how old were the donors? Chatenoud: The cells were from young 6 week old pre-diabetic mice. Shevach: Still one can assume that something may have gone on. This mouse has seen antigen, so some priming has taken place. You might have primed CD25 cells to become CD25+ and make TGFb, or in£uenced the di¡erentiation of CD25+ cells by exposure to antigen such that they made TGFb. Chatenoud: We are just saying that in vivo there is compelling evidence in di¡erent models for a central role of TGFb. Mitchison: The strength-of-signal law for generating a hyper-reactive population predicts in your system that treatment of MOG-induced disease with anti-TGFb, would exacerbate disease. Does it do so? Bach: We did this in young NOD mice. The mice became ill and many of them died. We didn’t have an opportunity to look at the outcome of diabetes. Perhaps this could be done at a later age where they might be less sensitive to this e¡ect. Flavell: The critical thing about this experiment is that it has to be done in the absence of regulatory cells. Banchereau: There could be a trivial explanation that the antibody is one that makes immune complexes and has a tendency to aggregate. Now you start doing things at dose levels which have nothing to do with what you are looking for. Chatenoud: Still, antibodies to IL4 and IL10 receptor don’t work, and control antibodies don’t work. You would have to say that the aggregates are e⁄cient only when they are made of the two di¡erent antibodies to TGFb we used. Abbas: When you do these co-cultures you usually titrate the number of regulatory cells versus responder cells. But I see relatively few published data titrating the amount of anti-CD3 and anti-CD28. You are usually picking a good dose of anti-CD3 and then titrating your cell populations. If it is true that whether or not there is a TGFb e¡ect is dependent on the strength of signal, then you should be titrating the activating stimuli, i.e.anti-CD3 and/or anti-CD28. Shevach: Suppression was not reversed even at low concentrations of antiCD3. Bluestone: If Ethan is right we should all commit to doing the following simple experiment. We take the same strain of mouse, the same antibodies, and the only di¡erence should be if we all do the experiments where we titrate the number of

GENERAL DISCUSSION I

113

regulatory cells so that we have a lousy culture versus a good one, the anti-TGFb should reverse in those settings in which we have lousy suppression. Chatenoud: When we do inhibition studying ligand interactions, we never put ourselves in conditions where we have the plateau with the maximum inhibition. We always use conditions in which the response is infra-optimal. The same applies in vivo to the co-transfer systems. The systems in which anti-cytokine antibodies were able to reverse protection were always those using limiting numbers of cells. Bluestone: If step one is that we could all prove that in an IC50 we can reverse with TGFb, then it becomes a semantic argument about who believes this system is better. Is it best to have the best suppressor cell in the world so you can’t reverse it with TGFb or not? Then you can ask the question as to whether TGFb is a necessary mediator in that system. Shevach: We have done the experiment and we don’t see that. By limiting CD25+ cells and strength of stimulus, in more than 20 experiments, we have never seen a reversal of modest suppression by anti-TGFb. However, we probably make more highly puri¢ed CD25+ cells than most labs. Bluestone: At some point you should be able to make poor CD25s! Roncarolo: I tend to agree with Lucienne Chatenoud. In human culture, when we use the bulk CD25+ cells, we don’t see any e¡ect of anti-TGFb, even at 50 mg/ml. We have 99% suppression. When we take the CD25high T suppressor clones, which is a minority of the CD25s, their suppression is reversed by anti-TGFb. But the suppression is less good: we never get 90% suppression. TGFb clearly plays a role in the suppression mediated by CD4+CD25+ T cells, but probably multiple components are involved in this mechanism. In strong suppression perhaps other signals come in and play a role. Powrie: What is the most relevant in vivo? Roncarolo: It depends on the environment. Shevach: TGFb has been used to treat certain autoimmune diseases in humans. Miller: It was withdrawn because of all kinds of toxicity. Bluestone: If you told me tomorrow that TGFb was the master key, there would be a hundred drug companies that would be trying to make an antagonist to that pathway without the side e¡ects. It is not a given that just because an antiTGFb antibody has side e¡ects that this means this pathway is dead for pharmacotherapy. Shevach: I wouldn’t do it. Mowat: Another issue might be that cells from di¡erent tissues used in di¡erent experiments are going to have di¡erent requirements for TGFb. Shevach: It isn’t the master mediator. This is clear from our data. Does it play a role at all? That is up in the air: it seems to play a role sometimes. The question is, who makes it? I seriously think there is a receptor^ligand pair in mediating this cell contact suppression, and we are still looking for it.

114

GENERAL DISCUSSION I

References Gorelik L, Flavell RA 2000 Abrogation of TGFb signaling in T cells leads to spontaneous T cell di¡erentiation and autoimmune disease. Immunity 12:171^181 Green EA, Flavell RA 2000 The temporal importance of TNFa expression in the development of diabetes. Immunity 12:459^469 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor b. J Exp Med 194:629^644 Piccirillo CA, Letterio JJ, Thornton AM et al 2002 CD4+CD25+ regulatory T cells can mediate suppressor function in the absence of transforming growth factor b1 production and responsiveness. J Exp Med 196:237^246 Taylor PA, Lees CJ, Blazar BR 2002 The infusion of ex vivo activated and expanded CD4+CD25+ immune regulatory cells inhibits graft-versus-host disease lethality. Blood 99:3493^3499 Yamagiwa S, Gray JD, Hashimoto S, Horwitz DA 2001 A role of TGF-b in the generation and expansion of CD4+CD25+-regulatory T cells from human peripheral blood. J Immunol 166:7282^7289

Type 1 T regulatory cells and their relationship with CD4+CD25+ T regulatory cells Maria Grazia Roncarolo, Silvia Gregori and Megan Levings San Ra¡aele Telethon Institute for Gene Therapy, Via Olgettina 58, 20132 Milan, Italy

Abstract. Suppression by T regulatory (Treg ) cells is essential for the induction of peripheral tolerance. Several types of CD4+ Treg cells have been described in a number of systems. Although the precise mechanisms which mediate Treg cells e¡ector activity remain to be de¢ned, it is well established that they can suppress immune responses via cell^cell interactions and/or the production of interleukin (IL)10 and transforming growth factor (TGF)b. Type 1 T regulatory (Treg1) cells are de¢ned by their ability to produce high levels of IL10 and TGFb, and these cytokines mediate their ability to suppress pathological immune responses in the settings of transplantation, allergy, and autoimmune diseases. Treg1 cell activity is not necessarily bene¢cial, and they can also suppress immune responses to antigens from tumours and pathogens. The di¡erentiation of Treg1 cells in vivo is likely controlled by certain dendritic cells that promote IL10 production and may express tolerogenic co-stimulatory molecules. Another subset of CD4+ Treg cells is de¢ned by constitutive expression of CD25. Naturally occurring human CD4+CD25+ Treg cells are distinct from Treg1 cells. Suppressive CD4+CD25+ T cell clones do not synthesize IL10 but produce TGFb which contributes to the suppression of proliferation mediated by these cells. However, CD4+CD25+ Treg cells may be involved in the process inducing the di¡erentiation of Treg1 cells. In conclusions, many questions on the basic biology of Treg cells remain to be answered, but the development of therapeutic strategies designed to harness their immunoregulatory e¡ects can already be envisaged. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 115^131

One of the fundamental features of the immune system is its ability to distinguish between self and non-self, and between antigens delivered in harmful and nonharmful contexts. The mechanisms that have evolved to ensure immune homeostasis and tolerance are highly complex, and like most biological systems, are not foolproof. Thus, loss of tolerance to self-antigens or to innocuous foreign antigens can result in autoimmune diseases or allergies, respectively. On the other hand, inappropriate tolerance to antigens such as those present in tumours 115

116

RONCAROLO ET AL

or virus-infected cells can result in loss of immunity with uncontrolled tumour growth or chronic infections. Peripheral mechanisms of tolerance should control immune responses to selfantigens that are not expressed in the thymus, and to foreign antigens that are encountered in the peripheral tissues. Well characterized mechanisms of peripheral T cell tolerance include cell death with consequent clonal deletion, development of a state of non-responsiveness of T cells, and active suppression mediated by suppressor/regulatory cells. This latter mechanism of peripheral tolerance was ¢rst described more than 30 years ago (Gershon & Kondo 1971), but only recently has the existence of this phenomenon been widely accepted by the scienti¢c community and T regulatory (Treg) cells have become the subject of intensive investigation. There is evidence that cells with a regulatory/suppressor function exist within all major T and NK cell subsets (Roncarolo & Levings 2000), although most attention has been focused on Treg cells with a CD4+ phenotype. Knowledge on how CD4+ Treg cells arise in the thymus and/or in the periphery, and on the precise mechanism which control their e¡ector function is still limited. However, it is generally agreed that CD4+ Treg cells exert their suppressive e¡ects either via expression of inhibitory cell-surface molecules or via production of immunoregulatory cytokines, such as interleukin (IL)10 and transforming growth factor (TGF)b. For several years, we have been studying a subset of CD4+ Treg cells, de¢ned as type 1 T regulatory (Treg1 or Tr1) cells, which produce immunosuppressive cytokines and contribute to the induction of peripheral tolerance. In this review the main biological characteristics of these cells are summarized and their relationship with CD4+CD25+ Treg cells is discussed. Type 1 regulatory cells Treg1 cells display a unique pro¢le of cytokine production that is distinct from that of Th0, Th1 or Th2 cells. The main cytokines produced by Treg1 cells are IL10 and TGFb which are involved in down-regulation of immune responses mediated by na|« ve and memory T cells (Roncarolo et al 2001a). Although the levels of IL10 and TGFb produced in vitro by Treg1 cells may not be signi¢cantly higher than those produced by classical Th2 cells (Levings et al 2001a), Treg1 cells make these cytokines in the absence of signi¢cant levels of IL2 or IL4 (Groux et al 1997), which are potent T cell growth factors. The ability of Treg1 cells to produce interferon (IFN)g is controversial, due to di¡erences between the biology of these cells isolated from inbred and/or T cell receptor (TCR) transgenic mice and humans. Treg1 cells from humans usually produce IFNg, although at levels which are at least one log lower than those produced by Th1 cells (Levings et al 2001a), whereas murine Treg1 cells generally do not (Barrat et al 2002).

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

117

Treg1 cells proliferate poorly following polyclonal TCR-mediated or antigenspeci¢c activation, but their proliferation can be signi¢cantly enhanced by exogenous IL2 and IL15 (Bacchetta et al 2002). Despite their low proliferative capacity, cloned Treg1 cells express normal levels of T cell activation markers such as CD25, CD40L, CD69, HLA-DR and CTLA4 (Bacchetta et al 2002), following TCR-mediated activation. The di⁄culties associated with identifying Treg1 cells on the basis of their cytokine production pro¢le promoted several studies aiming to identify speci¢c cell-surface markers. Treg1 cell clones, in resting state, constitutively express high levels of the IL15Ra chain (M. Levings, unpublished data) and of the IL2/IL15Rb and g common chains (Bacchetta et al 2002). In addition, Treg1 cells express several chemokine receptors, including some associated with the Th1 or Th2 phenotype (Sebastiani et al 2001). However, Treg1 cells do not express T1/ST2, an IL-1R-like molecule present on Th2 cells (Lecart et al 2001). Interestingly, it was reported that Treg1, but not Th1 or Th2 cell clones express CCR7, a receptor recently implicated in homing to lymph nodes (Sebastiani et al 2001), but we have not been able to con¢rm these data (M. Levings, unpublished data). It can be concluded that at present neither a single cell-surface marker nor a combination of markers that could be used to track and purify Treg1 cells has been identi¢ed. Treg1 cells regulate the responses of na|« ve and memory T cells in vitro and in vivo, and can suppress both Th1 and Th2 cell-mediated pathologies (Roncarolo et al 2001b). Treg1 cells exert suppressive e¡ects on a variety of cell types mainly via production of IL10 and TGFb. It has been demonstrated that supernatants from activated Treg1 cells strongly inhibit the capacity of in vitro generated dendritic cells (DCs) to induce alloantigen-speci¢c proliferation (Cavani et al 2000, Lecart et al 2001). Treg1 cells speci¢c for a variety of antigens, including alloantigens, viral and bacterial antigens and recall antigens, such as tetanus toxoid, have been isolated strongly suggesting that Treg1 cells with di¡erent TCR speci¢city can arise in vivo. The di¡erentiation of Treg1 cells in vivo is generally induced in the chronic presence of low levels of antigen. This evidence is consistent with the concept that Treg cell activity depends on a continuous supply of antigen (Waldmann & Cobbold 2001). Although Treg1 cells must encounter their antigen to exert their suppressive e¡ect, once activated, they seem to be able to suppress in an antigen non-speci¢c manner (Groux et al 1997, Roncarolo et al 2001b). The ¢rst suggestion that Treg1 cells are involved in maintaining peripheral tolerance came from studies on severe combined immunode¢cient (SCID) patients successfully transplanted with HLA-mismatched allogenic stem cells. Despite the HLA disparity, these patients do not develop graft versus host disease (GVHD) in the absence of immunosuppressive therapy. Interestingly, high levels of IL10 are detected in the plasma of these patients and a signi¢cant

118

RONCAROLO ET AL

proportion of donor-derived T cells, which are speci¢c for the host HLA antigens and produce high levels of IL10, can be isolated in vitro (Bacchetta et al 1994). In addition, high spontaneous IL10 production by peripheral blood mononuclear cells (PBMCs) before bone marrow transplantation is associated with a subsequent low incidence of GVHD and transplant-related mortality (Baker et al 1999, Holler et al 2000). Studies of patients who spontaneously developed tolerance to kidney or liver allografts revealed the presence of CD4+ T cells which suppress na|« ve T cell responses via production of IL10 or TGFb (VanBuskirk et al 2000). Taken together these data indicate that Treg1 cells can regulate tolerance in the setting of bone marrow and solid organ transplantation. Furthermore, Treg1 cells are determinant for maintaining self-tolerance, as suggested by the isolation of autoreactive Treg1 cell clones from the peripheral blood of healthy donors (Kitani et al 2000). A decreased frequency of IL10producing CD4+ T cells is observed in the in£amed synovium and peripheral blood of patients with rheumatoid arthritis (Yudoh et al 2000) indicating that a de¢ciency in Treg1 cells may contribute to the loss of self-tolerance in autoimmune diseases. The ¢rst demonstration that Treg1 cells can play a role in controlling autoimmunity in vivo come from the observation that therapy of experimental autoimmune encephalomyelitis (EAE) with a soluble peptide derived from myelin basic protein results in elevated levels of IL10 and di¡erentiation of peptide-speci¢c Treg1 cells which can inhibit the disease (Wildbaum et al 2002). Similarly, OVA-speci¢c Treg1 cells di¡erentiated in vitro in the presence of vitamin D3 and dexamethasone protect mice from EAE when OVA is administered at the site of in£ammation (Barrat et al 2002). Treg1 cells are also important in down regulation of immune responses toward allergens such as phospholipase A2 (the major allergen in bee venom) and nickel (Roncarolo et al 2001b). DCs from bronchial lymph nodes produce high levels of IL10 following intranasal exposure to ovalbumin, and adoptive transfer of these DCs results in antigen-speci¢c T cell suppression (Akbari et al 2001). This antigenspeci¢c suppression is mediated by Treg1 cells (Akbari et al 2002). Overall these studies demonstrate that Treg1 cells are certainly bene¢cial for the induction of tolerance to self-, allo- and non-harmful foreign antigens, such as allergens. However, Treg1 cells speci¢c for infectious agents or tumour antigens may interfere with the host’s immune response and thus be detrimental. Presumably, it is advantageous for pathogens to evolve strategies to enhance the di¡erentiation of Treg1 cells which would then limit the protective immune response and allow long-term infection of the host (McGuirk & Mills 2002). Haemagglutinin from Bordetella pertussis inhibits IL12 and enhances IL10 production from DCs in the lung and bronchial lymph nodes (McGuirk et al 2002). Priming of na|« ve CD4+ T cells with these modulated DCs induced the di¡erentiation of antigen-speci¢c Treg1 cells, which ultimately inhibit protective

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

119

Th1-mediated responses against B. pertussis both in vitro and in vivo. Similarly, in chronic helminthes infections, where patients have relatively little sign of dermatitis despite the presence of small worms in the skin, antigen-speci¢c Treg1 cells can be obtained. These cells are able to inhibit proliferation of other T cells (Satoguina et al 2002). Collectively, these data indicate that Treg1 cells are antigen-speci¢c T regulatory cells which can be generated in di¡erent settings including transplantation, autoimmune diseases, allergy and infectious diseases. Based on this notion, antigen speci¢c Treg1 cells can be generated in vitro and subsequently infused in vivo to down-regulate T cell mediated pathology. Role of dendritic cells in the in vivo di¡erentiation of Treg1 cells DCs may control the di¡erentiation of Treg1 cells in vivo (Mahnke et al 2002, Roncarolo et al 2001b). Several types of DCs have been described so far, which are able to present antigen in a tolerogenic or immunogenic form depending on their stage of maturation and biological properties. Myeloid DCs can be rendered tolerogenic by several forms of manipulation including: ‘freezing’ in an immature state (Dhodapkar et al 2001, Jonuleit et al 2000), treatment with IL10 (Steinbrink et al 2002) or immunosuppressive agents such as vitamin D3 and dexamethasone (Barrat et al 2002, Penna & Adorini 2000); and exposure to certain types of bacteria (McGuirk et al 2002) or certain endogenous proteins such as heavy chain ferritin (Gray et al 2002). In addition, DCs can also be transduced with retroviral vectors which encode tolerogenic molecules such as IL10, TGFb, CTLA4 or Serrate (one of the ligands for Notch proteins) (Hackstein et al 2001). It is currently unknown whether the phenotype and function of DCs generated using all these di¡erent strategies are equivalent. The ability of tolerogenic DCs to induce Treg1 cells is linked to the inhibition of IL12 and the increase of IL10 production. However, the synthesis of IL10 either by the T cells or by antigen-presenting cells (APCs) is necessary but not su⁄cient for Treg1 cell di¡erentiation. Factors which act in concert with IL10 to inhibit the expression of transcription factors that promote the production of Th2- and Th1-associated cytokines are probably also required (Barrat et al 2002). Indeed, IFNa, a cytokine which can inhibit expression of both IL2 and IL4, synergizes with IL10 to induce the di¡erentiation of Treg1 cells (Levings et al 2001a). In contrast, although TGFb inhibits the di¡erentiation of both Th1 (Gorelik & Flavell 2002) and Th2 cells (Gorelik et al 2002) this cytokine does not synergize with IL10 to induce Treg1 cells in vitro (Levings et al 2001a). The lack of expression of co-stimulatory molecules does not correlate well with the capacity of DCs to induce Treg1 cells. For example, monocyte-derived DCs exposed to heavy chain ferritin induce the di¡erentiation of IL10-producing

120

RONCAROLO ET AL

T cells, despite high expression of the co-stimulatory molecules CD86 and B7H1 (PD-L1). Similarly, B. pertussis-treated DCs which induce the di¡erentiation of antigen-speci¢c Treg1 cells expressed normal levels of CD86 and CD40 (McGuirk et al 2002). It is possible that rather than the loss of co-stimulatory molecules, the engagement of other molecules which act as dominant tolerogenic factors is important for the generation of Treg1 cells (Greenwald et al 2002). For example, bronchial DCs induced after a nasal antigen challenge promote the di¡erentiation of Treg1 cells via a mechanism which requires expression of ICOS-L (Akbari et al 2002). Furthermore, CD58, the ligand for CD2, has recently been shown to determine the di¡erentiation of human Treg1 cells (Wakkach et al 2001). Expression of soluble suppressive molecules such as the tryptophan-catabolizing enzyme indoleamine 2,3-dioxygenase (IDO), which is up regulated by IL10 and induces T cell hypo-responsiveness (Munn et al 2002), may also be involved. Thus, although therapeutic strategies that rely solely on blockade of costimulatory molecules may inhibit immune responses in the short-term, they may be ine⁄cient at inducing long-term tolerance mediated by Treg1 cells. As described above, the Treg1-inducing ability of DCs may depend on their state of di¡erentiation or features of the microenvironment in which DC^T cell contact occurs. An alternative possibility is that specialized subsets of DCs, dedicated to tolerance induction exist. A subset of DEC205+B220+CD19 DCs isolated from the liver and activated in vitro with IL3 and CD40 cross-linking able to induce Treg1 cells has been described (Lu et al 2001). Furthermore, human plasmacytoid DCs (DC2s) have been shown to have intrinsic tolerogenic functions. Na|« ve CD8+ T cells primed with allogeneic DC2s, activated via CD40, become IL10-producing cells and suppress proliferation of CD8+ T cells (Gilliet & Liu 2002). In addition, human DC2 cells activated by viruses can induce a population of IL10-producing CD4+ T cells (Kadowaki et al 2000). Interestingly, donors who undergo haematopoietic stem cell mobilization with G-CSF have a *¢vefold increase in DC2 cells in their periphery (Arpinati et al 2000), and it has recently been reported that CD4+ T cells from these donors are enriched for Treg1 cells (Rutella et al 2002). Identi¢cation and isolation of a source of DCs which can be used to e⁄ciently di¡erentiate and expand antigen-speci¢c Treg1 cells in vitro and/or in vivo will be a major step towards their use as a cellular therapy to control undesired immune responses. However, it may be possible that di¡erent types of DCs induce the di¡erentiation of distinct types of Treg cells with unique phenotypes and functions. CD4+CD25+ Treg cells In addition to Treg1 cells, another subset of CD4+ Treg cells that constitutively express the IL2Ra chain (CD25) has been extensively described in mice and

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

121

humans. CD4+CD25+ Treg cells are generated in the thymus, and are thought to arise via ‘altered negative selection’ by self-peptides (Sakaguchi et al 2001, Shevach 2002). CD4+CD25+ Treg cells can potently suppress proliferation and cytokine production by both CD4+ and CD8+ T cells. Their suppressive activity is related to their ability to inhibit IL-2 production and promote cell cycle arrest in both CD4+ and CD8+ T cells. This suppression requires direct cell^cell contact, and may involve signals through CTLA4 (Read et al 2000, Takahashi et al 2000) and/or glucocorticoid-induced TNF receptor (GITR) (McHugh et al 2002, Shimizu et al 2002, Zelenika et al 2002). The role of immunoregulatory cytokines such as IL10 and TGFb in the suppression mediated by CD25+CD4+ Treg cells, and thus their relationship to Treg1 cells, is still controversial. It has been reported in both the mouse and human that Treg cells secrete more IL10 than CD4+CD25 T cells (Dieckmann et al 2001, Papiernik et al 1997, Stephens et al 2001). CD4+CD25+ Treg cells from IL10-de¢cient mice fail to protect immunode¢cient animals from a CD45RBhighCD4+ T cell-induced wasting disease (Annacker et al 2001). Similarly, CD4+CD25+ Treg cells prevent in£ammatory bowel disease via an IL10-dependent mechanism (Asseman et al 1999). IL10 is also required for CD4+CD25+ Treg cell-mediated regulation of superantigen-induced production of pro-in£ammatory cytokines (Pontoux et al 2002). In contrast, CD4+CD25+ Treg cells isolated from IL10-de¢cient mice retain their suppressive capacity in vitro and in vivo in a model of autoimmune gastritis (Suri-Payer & Cantor 2001, Thornton & Shevach 1998). In addition, regulation of organ-speci¢c autoimmunity by TCR-transgenic CD4+CD25+ Treg cells is not dependent on IL10 (Apostolou et al 2002). Moreover, studies with human CD4+ T cells did not demonstrate a role for IL10 in in vitro suppressor assays (Baecher-Allan et al 2001, Dieckmann et al 2001, Jonuleit et al 2001, Levings et al 2001b, Ng et al 2001, Taams et al 2001). On the other hand, several studies suggest that TGFb, which is produced by CD4+CD25+ Treg cells at high levels, is a key factor mediating their suppressive e¡ects. Indeed it has been reported that TGFb produced by CD4+CD25+ Treg cells, and bound to their cell-surface, is the major mechanism by which murine CD4+CD25+ Treg cells suppress T cell responses (Nakamura et al 2001). The concept that TGFb mediates the e¡ects of CD4+CD25+ Treg cells has been supported by in vivo data in a colitis model induced by CD4+CD45RBhigh splenic T cells (Powrie et al 1996). However, CD4+CD25+ Treg cells from TGFb1-de¢cient mice are fully suppressive in vitro, and target cells which were genetically altered to be unresponsive to TGFb are susceptible to suppression mediated by CD4+CD25+ Treg cells (Piccirillo et al 2002). In the human system membrane-bound TGFb, in combination with CTLA4, has been reported to contribute to the suppressive activity of CD4+CD25+

122

RONCAROLO ET AL

thymocytes (Annunziato et al 2002). However, we have been unable to con¢rm these data with CD4+CD25+ Treg cells isolated from peripheral blood. To further investigate the role of IL10 and TGFb in the suppressive function of CD4+CD25+ Treg cells, and to re-examine the potential relationship between these cells and Treg1 cells, we analysed human CD4+CD25+ T suppressor cells at the clonal level. Unlike Treg1 cell clones, suppressive CD4+CD25+ T cell clones do not produce IL10 or IFNg (Levings et al 2002). However, suppressive CD4+CD25+ T cell clones do produce TGFb, and this molecule, although not bound to the cell-membrane, has a small (*20%) but signi¢cant role in suppression of proliferation (Levings et al 2002). Suppressive CD4+CD25+ T cell clones can be distinguished from e¡ector T cell clones based on the high expression of CD25, CTLA4 and GITR molecules. These ¢ndings suggest that naturally occurring human CD4+CD25+ Treg cells are distinct from IL10-producing Treg1 cells. Consistent with this hypothesis is the observation that CD4+CD25 T cells are rendered anergic by IL10, and can di¡erentiate into Treg1 cells in the absence of CD4+CD25+ Treg cells (Levings et al 2002). On the other hand it is possible that CD4+CD25+ Treg cells are involved in the di¡erentiation of IL10- and/or TGFbproducing CD4+ T cells. In recent studies suppression experiments with preactivated and ¢xed CD4+CD25+ Treg cells showed that the suppressed CD4+ target T cells start to produce IL10 or TGFb (Dieckmann et al 2002, Jonuleit et al 2002) and are capable of suppressing T cell responses via a cytokine-dependent mechanism. These data indicate that the phenomenon of infectious tolerance, which has been known to exist in vivo for many years (Zelenika et al 2001), can also operate in vitro. In conclusion, human CD4+CD25+ Treg cells suppress T cell responses by a variety of mechanisms which act in concert, and whose relative contribution in vivo may depend on the local microenvironment.

Concluding remarks Treg1 and CD4+CD25+ Treg cells are two subsets of Treg cells that actively regulate peripheral tolerance. These Treg cells appear to be distinct in terms of biological functions and mechanisms of action. In addition, di¡erent ontogenies regulate their emergence: Treg1 cells are induced in the periphery in an antigen-speci¢c manner in the presence of immunomodulatory cytokines, whereas CD4+CD25+ Treg cells naturally occurs in the thymus. Treg1 cells are antigen-speci¢c Treg cells which can be generated in di¡erent setting including transplantation, autoimmune diseases, allergy and infectious diseases, and need to be activated in antigen-speci¢c manner to exert their suppressive activity. Conversely, CD4+CD25+ Treg cells need to be activated via TCR but their antigen-speci¢city is still unde¢ned.

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

123

It is possible that Treg1 and CD4+CD25+ Treg cells play di¡erent roles in the maintenance of immunological tolerance. The latter can be positively selected in the thymus upon interaction with APCs expressing tissue autoantigens. After leaving the thymus they would be mainly responsible for maintaining peripheral tolerance to self by down-regulating the activity of autoreactive T cells which escaped negative selection in the thymus. Conversely, Treg1 cells may emerge in the periphery upon encountering antigens toward which our organism is chronically exposed (i.e. allergens, gut bacterial antigens, food antigens etc.). The main function of these Treg cells would be to make sure that no e¡ector immune responses against non-pathogenic antigens are developed. According to this view, immunological homeostasis would be the result of a constant balance between Treg cells and T e¡ector cells. In steady state conditions Treg1 cells, CD4+CD25+ Treg cells and most likely other Treg cell subsets, may have very specialized functions which do not overlap. However, in situations where the equilibrium between Treg and T e¡ector responses is broken, or in cases where a malfunction in specialized Treg subsets occurs, more than one subset of Treg cells can intervene by migrating to the site of in£ammation and acting in concerted action in order to prevent pathology. Thus, breaking of tolerance should occur only when more than one mechanism fails to control in£ammatory and e¡ector immune responses.

References Akbari O, DeKruy¡ RH, Umetsu DT 2001 Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nat Immunol 2:725^731 Akbari O, Freeman GJ, Meyer EH et al 2002 Antigen-speci¢c regulatory T cells develop via the ICOS^ICOS-ligand pathway and inhibit allergen-induced airway hyperreactivity. Nat Med 8:1024^1032 Annacker O, Pimenta-Araujo R, Burlen-Defranoux O, Barbosa TC, Cumano A, Bandeira A 2001 CD25+ CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J Immunol 166:3008^3018 Annunziato F, Cosmi L, Liotta F et al 2002 Phenotype, localization, and mechanism of suppression of CD4+CD25+ human thymocytes. J Exp Med 196:379^387 Apostolou I, Sarukhan A, Klein L, von Boehmer H 2002 Origin of regulatory T cells with known speci¢city for antigen. Nat Immunol 3:756^763 Arpinati M, Green CL, Heimfeld S, Heuser JE, Anasetti C 2000 Granulocyte-colony stimulating factor mobilizes T helper 2-inducing dendritic cells. Blood 95:2484^2490 Asseman C, Mauze S, Leach, MW, Co¡man RL, Powrie F 1999 An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal in£ammation. J Exp Med 190:995^1004 Bacchetta R, Bigler M, Touraine JL et al 1994 High levels of interleukin 10 production in vivo are associated with tolerance in SCID patients transplanted with HLA mismatched hematopoietic stem cells. J Exp Med 179:493^502

124

RONCAROLO ET AL

Bacchetta R, Sartirana C, Levings MK, Bordignon C, Narula S, Roncarolo MG 2002 Growth and expansion of human T regulatory type 1 cells are independent from TCR activation but require exogenous cytokines. Eur J Immunol 32:2237^2245 Baecher-Allan C, Brown JA, Freeman GJ, Ha£er DA 2001 CD4+CD25high regulatory cells in human peripheral blood. J Immunol 167:1245^1253 Baker KS, Roncarolo MG, Peters C, Bigler M, DeFor TA, Blazar BR 1999 High spontaneous IL-10 production in unrelated bone marrow transplant recipients is associated with fewer transplant-related complications and early deaths. Bone Marrow Transplant 23: 1123^1129 Barrat FJ, Cua DJ, Boonstra A et al 2002 In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2-inducing cytokines. J Exp Med 195:603^616 Cavani A, Nasorri F, Prezzi C, Sebastiani S, Albanesi C, Girolomoni G 2000 Human CD4+ T lymphocytes with remarkable regulatory functions on dendritic cells and nickel-speci¢c Th1 immune responses. J Invest Dermatol 114:295^302 Dhodapkar MV, Steinman RM, Krasovsky J, Munz C, Bhardwaj N 2001 Antigen-speci¢c inhibition of e¡ector T cell function in humans after injection of immature dendrtitic cells. J Exp Med 193:233^238 Dieckmann D, Plottner H, Berchtold S, Berger T, Schuler S 2001 Ex vivo isolation and characterization of CD4+CD25+ T cells with regulatory properties from human blood. J Exp Med 193:1303^1310 Dieckmann D, Bruett CH, Ploettner H, Lutz MB, Schuler G 2002 Human CD4+CD25+ regulatory, contact-dependent T cells induce interleukin 10-producing, contactindependent type 1-like regulatory T cells. J Exp Med 196:247^253 Gershon RK, Kondo K 1971 Infectious immunological tolerance. Immunology 21:903^914 Gilliet M, Liu YJ 2002 Generation of human CD8 T regulatory cells by CD40 ligand-activated plasmacytoid dendritic cells. J Exp Med 195:695^704 Gorelik L, Flavell RA 2002 Transforming growth factor-beta in T-cell biology. Nat Rev Immunol 2:46^53 Gorelik L, Constant S, Flavell RA 2002 Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 di¡erentiation. J Exp Med 195:1499^1505 Gray CP, Arosio P, Hersey P 2002 Heavy chain ferritin activates regulatory T cells by induction of changes in dendritic cells. Blood 99:3326^3334 Greenwald RJ, Latchman YE, Sharpe AH 2002 Negative co-receptors on lymphocytes. Curr Opin Immunol 14:391^396 Groux H, O’Garra A, Bigler M et al 1997 A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Hackstein H, Morelli AE, Thomson AW 2001 Designer dendritic cells for tolerance induction: guided not misguided missiles. Trends Immunol 22:437^442 Holler E, Roncarolo MG, Hintermeier-Knabe R et al 2000 Prognostic signi¢cance of increased IL-10 production in patients prior to allogeneic bone marrow transplantation. Bone Marrow Transplant 25:237^241 Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH 2000 Induction of interleukin-10producing, nonproliferating CD4+ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 192:1213^1222 Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J, Enk AH 2001 Identi¢cation and functional characterization of human CD4+CD25+ T cells with regulatory properties isolated from peripheral blood. J Exp Med 193:1285^1294 Jonuleit H, Schmitt E, Kakirman H, Stassen M, Knop J, Enk AH 2002 Infectious tolerance: human CD25+ regulatory T cells convey suppressor activity to conventional CD4+ T helper cells. J Exp Med 196:255^260

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

125

Kadowaki N, Antonenko S, Lau JY, Liu YJ 2000 Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med 192:219^226 Kitani A, Chua K, Nakamura K, Strober W 2000 Activated self-MHC-reactive T cells have the cytokine phenotype of Th3/T regulatory cell 1 T cells. J Immunol 165:691^702 Lecart S, Boulay V, Raison-Peyron N et al 2001 Phenotypic characterization of human CD4+ regulatory T cells obtained from cutaneous dinitrochlorobenzene-induced delayed type hypersensitivity reactions. J Invest Dermatol 117:318^325 Levings MK, Sangregorio R, Galbiati F, Squadrone S, de Waal Malefyt R, Roncarolo MG 2001a IFN-alpha and IL-10 induce the di¡erentiation of human type 1 T regulatory cells. J Immunol 166:5530^5539 Levings MK, Sangregorio R, Roncarolo MG 2001b Human CD25+CD4+ T regulatory cells suppress na|« ve and memory T-cell proliferation and can be expanded in vitro without loss of function. J Exp Med 193:1295^1302 Levings MK, Sangregorio R, Sartirana C et al 2002 Human CD25+CD4+ T suppressor cell clones produce TGF-beta, but not IL-10, and are distinct from type 1 T regulatory cells. J Exp Med 196:1335^1346 Lu L, Bonham CA, Liang X et al 2001 Liver-derived DEC205+B220+CD19 dendritic cells regulate T cell responses. J Immunol 166:7042^7052 Mahnke K, Schmitt E, Bonifaz L, Enk AH, Jonuleit H 2002 Immature, but not inactive: the tolerogenic function of immature dendritic cells. Immunol Cell Biol 80:477^483 McGuirk P, Mills KH 2002 Pathogen-speci¢c regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol 23:450^455 McGuirk P, McCann C, Mills KH 2002 Pathogen-speci¢c T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 195:221^231 McHugh RS, Whitters MJ, Piccirillo CA et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Munn DH, Sharma MD, Lee JR et al 2002 Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science 297:1867^1870 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor beta. J Exp Med 194:629^644 Ng WF, Duggan PJ, Ponchel F et al 2001 Human CD4+CD25+ cells: a naturally occurring population of regulatory T cells. Blood 98:2736^2744 Papiernik M, do Carmo Leite-de-Moraes M, Pontoux C et al 1997 T cell deletion induced by chronic infection with mouse mammary tumor virus spares a CD25-positive, IL-10producing T cell population with infectious capacity. J Immunol 158:4642^4653 Penna G, Adorini L 2000 1 Alpha,25-dihydroxyvitamin D3 inhibits di¡erentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation. J Immunol 164:2405^2411 Piccirillo CA, Letterio JJ, Thornton AM et al 2002 CD4+CD25+ regulatory T cells can mediate suppressor function in the absence of transforming growth factor beta1 production and responsiveness. J Exp Med 196:237^246 Pontoux C, Banz A, Papiernik M 2002 Natural CD4+CD25+ regulatory T cells control the burst of superantigen-induced cytokine production: the role of IL-10. Int Immunol 14:233^239 Powrie F, Carlino J, Leach MW, Mauze S, Co¡man RL 1996 A critical role for transforming growth factor-beta but not interleukin 4 in the suppression of T helper type 1-mediated colitis by CD45RBlow CD4+ T cells. J Exp Med 183:2669^2674

126

RONCAROLO ET AL

Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Roncarolo MG, Levings MK 2000 The role of di¡erent subsets of T regulatory cells in controlling autoimmunity. Curr Opin Immunol 12:676^683 Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK 2001a Type 1 T regulatory cells. Immunol Rev 182:68^79 Roncarolo MG, Levings MK, Traversari C 2001b Di¡erentiation of T regulatory cells by immature dendritic cells. J Exp Med 193:F5^F9 Rutella S, Pierelli L, Bonanno G et al 2002 Role for granulocyte colony-stimulating factor in the generation of human T regulatory type 1 cells. Blood 100:2562^2571 Sakaguchi S, Sakaguchi N, Shimizu J et al 2001 Immunologic tolerance maintained by CD25+ CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol Rev 182:18^32 Satoguina J, Mempel M, Larbi J et al 2002 Antigen-speci¢c T regulatory-1 cells are associated with immunosuppression in a chronic helminth infection (onchocerciasis). Microbes Infect 4:1291^1300 Sebastiani S, Allavena P, Albanesi C et al 2001 Chemokine receptor expression and function in CD4+ T lymphocytes with regulatory activity. J Immunol 166:996^1002 Shevach EM 2002 CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389^400 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3:135^ 142 Steinbrink K, Graulich E, Kubsch S, Knop J, Enk AH 2002 CD4+ and CD8+ anergic T cells induced by interleukin-10-treated human dendritic cells display antigen-speci¢c suppressor activity. Blood 99:2468^2476 Stephens LA, Mottet C, Mason D, Powrie F 2001 Human CD4+CD25+ thymocytes and peripheral T cells have immune suppressive activity in vitro. Eur J Immunol 31:1247^1254 Suri-Payer E, Cantor H 2001 Di¡erential cytokine requirements for regulation of autoimmune gastritis and colitis by CD4+CD25+ T cells. J Autoimmun 16:115^123 Taams LS, Smith J, Rustin MH, Salmon M, Poulter LW, Akbar AN 2001 Human anergic/ suppressive CD4+CD25+ T cells: a highly di¡erentiated and apoptosis-prone population. Eur J Immunol 31:1122^1131 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310 Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188: 287^296 VanBuskirk AM, Burlingham WJ, Jankowska-Gan E et al 2000 Human allograft acceptance is associated with immune regulation. J Clin Invest 106:145^155 Wakkach A, Cottrez F, Groux H 2001 Di¡erentiation of regulatory T cells 1 is induced by CD2 costimulation. J Immunol 167:3107^3113 Waldmann H, Cobbold S 2001 Regulating the immune response to transplants: a role for CD4+ regulatory cells? Immunity 14:399^406 Wildbaum G, Netzer N, Karin N 2002 Tr1 cell-dependent active tolerance blunts the pathogenic e¡ects of determinant spreading. J Clin Invest 110:701^710 Yudoh K, Matsuno H, Nakazawa F, Yonezawa T, Kimura T 2000 Reduced expression of the regulatory CD4+ T cell subset is related to Th1/Th2 balance and disease severity in rheumatoid arthritis. Arthritis Rheum 43:617^627

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

127

Zelenika D, Adams E, Humm S, Lin CY, Waldmann H, Cobbold SP 2001 The role of CD4+ Tcell subsets in determining transplantation rejection or tolerance. Immunol Rev 182:164^179 Zelenika D, Adams E, Humm S et al 2002 Regulatory T cells overexpress a subset of Th2 gene transcripts. J Immunol 168:1069^1079

DISCUSSION Bluestone: How do you clone cells that are anergic? Roncarolo: You need to clone them with high doses of anti-CD3 monoclonal antibody (mAb), irradiated allogenic PBMCs and an EBV-transformed B cell line as feeder cells, and cytokines (IL2 from day 3). The Treg1 cell clones do not divide and expand as a normal clone. We plate 400 000 cells, and after 11 days we get around two million (around ¢vefold increase with IL2, and 15-fold increase with IL2 + IL15). In contrast, when we expanded human CD25+ cell lines we got 20fold expansion. However, when we analysed these cells at the clonal level the majority were contaminant e¡ector cells, and not T regulatory cells. Shevach: What cytokines did you use? Roncarolo: In the ¢rst Treg1 cloning we added IL2, and IL15, but later on we just used IL2 at low concentration plus feeder cells, and add IL2 plus IL15 during the subsequent restimulations. Shevach: What was the plating e⁄ciency? Roncarolo: We have usually a cloning e⁄ciency of 28^30% when we start from CD4+ T cells. Starting from puri¢ed CD25+ cells, the cloning e⁄ciency was 10%. This compared to 40% when cloning from the CD25 cells. Shevach: Is it a little hazardous to use the percentages of clones to go back to the situation in the normal peripheral blood. Roncarolo: We can’t conclude anything about the frequency of CD4+CD25+ Treg cells in vivo. We are biased because we have to select cells that proliferate, although we exclude the highly proliferative cells up-front. We can’t conclude anything about the frequency because there may be many more suppressor cells we don’t pick up in the in vitro cloning because they don’t grow. Shevach: How do you get the cells that don’t respond to IL2 to grow? Roncarolo: They grow with anti-CD3 mAb, a mixture of irradiated mononuclear cells and EBV-cell lines, and IL2. Ha£er: Do you add IL15 at all? Roncarolo: At the beginning of the cloning we use only IL2, and during the expansion we add also IL15. Ha£er: How much anti-CD3 did you use? Roncarolo: 50^100 mg/ml immobilized anti-CD3 mAb. Bluestone: Does the CD25 expression correlate with the presence of a lot of IL2? It could be that they are not proliferating well so it is the IL2 that is causing

128

DISCUSSION

up-regulation of the IL2 receptor, which is not uncommon. I know they don’t proliferate with IL2, but do they up-regulate CD25 in response to IL2? Roncarolo: The suppressor clones have very high CD25 expression. This is stable and doesn’t change during activation or exposure to exogenous IL2. The e¡ector cells have CD25 going up and down depending on the state of activation. Hasenkrug: I’m curious about the IFNa synergy with IL10, especially since IFNa often occurs in response to a viral infection. Theoretically, how would this work? Roncarolo: When we got those data we thought that the cells responsible for in vivo Treg1 di¡erentiation would be the DC2-like cells described by Yang Jiu Liu. These cells, when infected with viral peptide, produce high levels of IFNa. Yang Jiu Liu did experiments showing that these DC2 cells primed the CD8+ T cells to become IL10-producing Treg1 cells. He didn’t do the experiments with the CD4+ T cells. Then two reports showed that the immature DCs induce Treg1 di¡erentiation and we were able to reproduce these data in our laboratory. Unless we think that there are di¡erent types of IL10-producing Treg1 cells depending on the antigen, I cannot reconcile the two ¢ndings. It is possible the immature DCs prime Treg1 cells which are mainly there to control self-reactive responses, whereas DC2 cells induce the di¡erentiation of Treg1 cells which have to shut o¡ viral responses. Bach: CD25 cells have essentially been studied in autoimmunity models. Treg1 cells also react to autoantigens. Do you have data suggesting that Treg1 cells could be autoreactive? Roncarolo: We don’t, but there’s a paper by Kitani et al (2000) in which human Treg1 clones speci¢c for self MHC were described. This is the only clear example so far of human self-reactive Treg1 cells. Dallman: I’d like to ask about the speci¢city of the cells. In your patients, I believe you reported that they recognized alloantigens directly. Is this just because of the way that you have grown them out? Have you any evidence that these cells recognize alloantigen through the indirect pathway? Roncarolo: No, we don’t. In the patients we isolate these cells just from peripheral blood by random cloning. In vitro, we always use allogenic monocytes, even when we use mononuclear cells as responders. We have never looked at the role of the indirect versus the direct pathway, but we should. Shevach: What bothers me about the Treg1 clones is that in your hands, at least, they make IFNg. As a clinician, would you rather get a Treg1 clone that made IFNg and IL10, or the other kind of Treg1 clones that only make IL10? Roncarolo: If you refer to the Treg1 cells described by O’Garra and colleagues (Barrat et al 2002), these cells do not make IFNg because during in vitro di¡erentiation an anti-IFNg mAb was added. They generate the IL10-producing cells in the presence of anti-IL4, anti-IL12 and anti-IFNg, so there is no chance of getting IFNg-producing cells there. The levels of IFNg in Treg1 cells are at least one

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

129

log lower than what you would see in Th1 cells. The levels of IFNg in Treg1 cells compared to Th1 cells are very di¡erent. Whether IFNg plays a role in the suppressor function of Treg1 cells is still unclear. The cells that we get ex vivo directly from the gut also produce IFNg. Powrie: Presumably you have included anti-IFNg in various assays. Roncarolo: No. Powrie: IFNg can be highly suppressive. Bluestone: Work by Fadi Lakkas suggests that a little bit of IFNg may be good for tolerance induction (Hassan et al 1999). IFNg knockout mice are very di⁄cult to tolerize. You don’t want a big pathogenic response to the IFNg. In all the anti-CD3 patients, another cytokine besides IL10 that we see is IFNg. I don’t know why, but I wouldn’t start out with the presumption that IFNg is always bad. Shevach: But it has the potential for being hazardous, if you are going to put these cells back into patients. Is it a risk? That’s all I’m asking. Looking at some of these data, I wouldn’t call these cells Treg1 clones but Th1 clones that make a little bit of IL10. Roncarolo: But they don’t make IL2 and make low levels of IFNg. Shevach: If you culture mouse Th1 clones for a long time they frequently lose their ability to make IL2. The signature feature of Th1 cells is IFNg production. Ha£er: Not in humans, necessarily. Roncarolo: We have tried to grow these cells, we haven’t succeeded in ¢nding a trick to make billions of them. With IL15 Treg1 we can manage to get enough to do what we want. But it is clear that there is something missing there for growing these cells, which may be something that only exists in vivo. We are now trying di¡erent stromal cell lines as feeders. However, we can distinguish these cells very clearly because when we activate them, and we look after three or four hours, the only cytokine we see is IL10. In Th1 cell clones we never see this very early activation of IL10 production. To call these cells Th1 cells is wrong. Abbas: One message that has come through from all the studies with humans is that just about every human T cell clone makes at least some IFNg. Even well established, highly polarized Th2s make low levels of IFNg. Roncarolo: Not the CD25+ T cells, though. This is the ¢rst time I have seen a clone really negative for IFNg. Abbas: This low level of IFNg that you are seeing in your Treg1 cells is probably not signi¢cant. This is the same low level that is seen in just about every human T cell clone. Roncarolo: Fiona Powrie is right, though: we should do the experiment with anti-IFNg mAb to be sure. Abbas: It may be because the IFNa up-regulates IL12 receptor b chain, leading to this positive ampli¢cation loop.

130

DISCUSSION

Flavell: Why are you saying this is a low level? There are nanogram amounts of IFNg and picogram amounts of IL10. I don’t know what the a⁄nities are for those molecules for their receptors, but they are in a similar molar range. Roncarolo: When we say low or high, we are relating this to the levels in human Th0/Th1/Th2 cell clones. The IL10 production from the cells of the transplanted patients is much higher compared to that produced by the Treg1 cells we generate in vitro. In the patients we had in the order of 50^60 ng/ml, whereas for the cells that we generate in vitro it is in the order of 1000^2000 pg/ml. There is still a huge di¡erence in Treg1 cells primed in vivo and Treg1 cells generated in vitro. Flavell: If you do intracellular staining, are the cells within a clone all making these multiple cytokines at the same time, or is it di¡erent cells making di¡erent things? Roncarolo: When we do intracytoplasmic staining the clone is never 100% positive. This doesn’t just apply to Treg1 cells, but any human cell clone. We always see a population of positive and a population of negative cells. This is related to the cell cycles, which are not synchronized. Flavell: If you triple-stain for TGFb, IL10 and IFNg, is it the same cells making all three? Roncarolo: We don’t have a good stain for TGFb. We can do IFNg and IL10, and detect cells which are double positive and de¢ne them Treg1 cells. TGFb is measured in the supernatants of T cell clones. Powrie: Th1 clones in the human make IL10. So is the amount of IL10 higher in the Treg1 population? Roncarolo: If you compare the cells generated in vivo with those generated in vitro, it is much higher in the in vivo cells. For the Treg1 cells generated in vitro the levels of IL10 production vary. Ha£er: If you use IL12, how does it compare? IL12 induces a lot of IL10. Roncarolo: If we polarize with IL12 we get Th1 cells not Treg1 cells. Mitchison: Is it your thinking that TGFb and IL10 make a kind of natural pair that would be expected to synergize because their mode of action is so very di¡erent? Roncarolo: That’s what I think. TGFb is there mostly to inhibit the other cells. IL10 does a speci¢c job. I may be wrong. Every time we put TGFb in the culture, it profoundly suppresses all the other cells. This is not seen with IL10. Mitchison: It also suppresses an enormous range of genes. This is what DNA microarrays tell us. Powrie: Are these Treg1 cells more refractory to TGFb? There are data showing that TGFb causes outgrowth, or di¡erential survival, of CD25+ cells. Roncarolo: When we did the di¡erentiation in the presence of TGFb, even when we put IL10 we saw inhibition of all cytokines. Shevach: Is that done with IL2?

RELATIONSHIP BETWEEN Treg1 AND CD4+CD25+ Treg CELLS

131

Roncarolo: Yes. Flavell: IL2 will not a¡ect cytokine production. TGFb will block cycling, which is reversed by IL2, but TGFb also blocks induction of transcription factors such as GATA3. This is not a¡ected by cycling. What you are saying therefore makes perfect sense. Chatenoud: You mentioned circulating IL10. Is it really circulating IL10 that you see in the patients? Roncarolo: It is in the serum of the tolerant patients transplanted with allogenic stem cells, at a concentration of 80^100 pg/ml. Chatenoud: Does this impact on the CD4/CD8 type of reconstitution in these patients? For instance do the patients exhibit an inversion of the CD4:CD8 ratio? Roncarolo: All these patients have an inverted CD4:CD8 ratio, which they keep for long time. However, these patients are healthy and have a normal response to pathogens. Banchereau: You mentioned that you saw a decrease in regulatory T cells in your grafted patients. Have you had a chance to test whether these are the same regulatory T cell clones? Roncarolo: We haven’t looked. Also, the way we clone now is di¡erent from the way we cloned 20 years ago. All we can say is that the cells are still there 15^20 years later. All these patients have an inverted CD4:CD8 ratio, which they keep. This 24 year old boy said to me that he is never sick. So it is clear that they have a normal response to pathogens. References Barrat FJ, Cua DJ, Boonstra A et al 2002 In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2-inducing cytokines. J Exp Med 195:603^616 Hassan AT, Dai Z, Konieczny BT et al 1999 Regulation of alloantigen-mediated T-cell proliferation by endogenous interferon-gamma: implications for long-term allograft acceptance. Transplantation 15:124^129 Kitani A, Chua K, Nakamura K, Strober W 2000 Activated self-MHC-reactive T cells have the cytokine phenotype of Th3/T regulatory cell 1 T cells. J Immunol 165:691^702

(Pro)insulin-speci¢c regulatory T cells Leonard C. Harrison, Natasha R. Solly and Nathan R. Martinez1 The Walter & Eliza Hall Institute of Medical Research, PO The Royal Melbourne Hospital, Parkville, 3050 Victoria, Australia

Abstract. Regulatory anti-diabetogenic T cells (Treg) can be induced by the mucosal administration of insulin or proinsulin peptides, in the non-obese diabetic (NOD) mouse model of autoimmune type 1 diabetes. Naso-respiratory insulin (which avoids insulin degradation) induces CD8+ aa TCR gd Treg whereas peptides that bind to the NOD MHC class II molecule, I-Ag7, insulin B9-23 and proinsulin B24-C36, induce CD4+ Treg. Following naso-respiratory delivery of insulin to NOD mice increased numbers of CD8+ gd T cells expressing interleukin (IL)10 are detected in the pancreatic lymph nodes. Neonatal (3 day) thymectomy (NTX) dramatically accelerates diabetes development in NOD mice, associated with lymphopaenia and a block in the maturation of mucosal intraepithelial lymphocytes (IEL), especially extrathymicderived CD8+ aa TCR gd IEL. Regulatory anti-diabetogenic T cells cannot be elicited by naso-respiratory insulin in NTX-NOD mice. Reconstitution of NTX-NOD mice with CD8+ aa TCR gd T cells prevents diabetes. CD8+ gd Treg are conceivably physiological and insulin-speci¢c, induced by exposure to insulin in maternal milk. These ¢ndings infer an immunoregulatory role for extrathymic-derived IEL, developing under the in£uence of the thymus and conditioned by early exposure to the exogenous environment. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 132^145

Type 1 diabetes is an autoimmune disease in which T cells mediate destruction of insulin-producing b cells in the islets of the pancreas. At least three molecules have been identi¢ed as targets of the immune attack on b cells: (pro)insulin, glutamic acid decarboxylase (GAD) and tyrosine phosphatase-like insulinoma antigen IA-2. Of these, only proinsulin is expressed predominantly in the b cell and an increasing body of evidence implicates proinsulin as a key autoantigen driving b-cell destruction (Table 1). 1Present

address: Queensland Institute of Medical Research, PO Royal Brisbane Hospital, Herston 4029, Queensland, Australia. 132

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

TABLE 1 . . . . . .

133

Evidence that proinsulin drives b cell destruction in type 1 diabetes

(Pro)insulin is the only b cell-speci¢c autoantigen Immunity to (pro)insulin is the earliest marker of pre-clinical disease in humans (Ziegler et al 1999, Colman et al 2000, Kimpimaki & Knip 2001) Disease susceptibility in humans maps to human insulin gene 50 VNTR (Pugliese et al 1997, Va¢adis et al 1997) The majority of T-cell clones isolated from the pancreatic islets of NOD mice are insulinspeci¢c (Daniel et al 1995) Transgenic proinsulin in APCs prevents insulitis/diabetes in NOD mice (French et al 1997) Administration of insulin (Zhang et al 1991, Bergerot et al 1994, Harrison et al 1996, Muir et al 1995) or proinsulin peptides (Daniel & Wegmann 1996, Martinez & Harrison 2002) by ‘tolerogenic’ routes (mainly mucosal) suppresses diabetes incidence in NOD mice.

TABLE 2 Mucosal administration of (pro)insulin induces two types of Treg depending on antigen form and route Treg

Form

Route

Reference

CD4

Insulin B9-23 Proinsulin B24-C36

Nasal

Daniel & Wegmann 1996 Martinez et al 2003

CD4 CD8+ gd

Insulin Insulin

Oral Aerosol, nasal

Bergerot et al 1994 Harrison et al 1996

Since the demonstration more than a decade ago that oral insulin administration could partially suppress the development of diabetes in NOD mice (Zhang et al 1991), several studies have shown that insulin or peptides from proinsulin administered by the oral or naso-respiratory mucosal routes induce Treg (Table 2). These cells have been identi¢ed by adoptive co-transfer experiments, in which they suppress the transfer of diabetes by spleen cells from recently-diabetic mice into young, irradiated NOD mice or NOD.SCID mice. Initially, Bergerot et al (1994) reported that oral insulin induced CD4+ Treg. This was con¢rmed by several investigators, including Homann et al (1999) who showed that oral insulin induced CD4+ T cells to secrete IL4 and IL10 that prevented diabetes triggered by lymphocytic choriomeningitis virus (LCMV) infection of mice expressing LCMV antigen transgenically in b cells. Subsequently, CD4+ Treg were also reported to be induced by peptides from insulin (B9-23) (Daniel & Wegmann 1996) or proinsulin (B24-C36) (Martinez et al 2003) that bind to the NOD mouse MHC class II molecule, I-Ag7 (Harrison et al 1997). An exception is the induction of CD8+ Treg bearing TCR gd by intranasal or aerosol insulin in NOD mice (Harrison et al 1996, H
nninen & Harrison 2000). Thus, at least two types of

134

HARRISON ET AL

Treg can be induced by (pro)insulin depending on antigen form and route of administration (Table 2). Di¡erences in Treg phenotype depending on route of administration re£ect the fact that oral insulin is degraded whereas intranasal or aerosol insulin is essentially undegraded on contact with the mucosa. The remainder of this overview focuses on CD8+ gd Treg which phenotypically have markers of IEL, and on the hitherto unheralded role of IEL in immune regulation.

CD8+ cd Treg Small numbers of CD8+gd T cells puri¢ed from the spleens of aerosol insulintreated NOD mice block adoptive transfer of diabetes (Fig. 1) (Harrison et al 1996, H
nninen & Harrison 2000). The properties of these cells are summarized in Table 3. They are induced by conformationally intact insulin, but studies with mutated insulin indicate that insulin bioactivity is not a prerequisite. The

FIG. 1.

CD8+ gd T cells from insulin aerosol-treated mice block adoptive transfer of diabetes.

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

TABLE 3 . . . . .

. . .

135

CD8+ cd T cells induced by naso-respiratory insulin

Recognize conformationally-intact, but not necessarily biologically-active, insulin Inhibit adoptive transfer of diabetes by ‘diabetogenic’ T cells Inhibit cyclophosphamide-accelerated diabetes Delay onset of spontaneous diabetes Associated with decreased splenic T-cell proliferation to insulin B chain epitope (aa9^23) and glutamic acid decarboxylase (if insulin in medium), and increased IL4 and especially IL10 secretion Are CD8 aa (not depleted by anti-CD8 b1 + C 0 ) ¼ extrathymic derived Preferentially localize to pancreatic lymph nodes and produce IL10 Are induced in b2 microglobulin
/
NOD mice

regulatory function of these CD8+ gd T cells is not a¡ected by antibodycomplement mediated depletion of CD8+ b cells expressing the TCR chain, leading to the conclusion that they express the CD8+aa homodimer characteristic of extrathymic-derived IEL (Lefrancois 1991, Poussier & Julius 1994). IEL normally have a sessile association with mucosal epithelial cells and are not thought to circulate. However, small numbers of CD8+ gd T cells (less than 2%) are present in mouse spleen and peripheral blood. Whether insulin-induced CD8+ gd Treg are derived from the mucosa or (as seems less likely) elsewhere, e.g. the spleen by antigen absorbed or transported from the naso-respiratory mucosa, is at present unclear. After intranasal or aerosol insulin, CD8+ gd Treg are found to be selectively localized in pancreatic lymph nodes, where they constitute up to 5% of total cells and by intracellular labelling express IL10 (H
nninen & Harrison 2000). Treatment of recipient mice with antibody to IL10 just prior to co-transfer of CD8+ gd Treg and ‘diabetogenic’ T cells prevents suppression of diabetes development (Fig. 2). The ability of antibody to IL10 to block the regulatory e¡ect of CD8+ gd Treg strongly implies that it is mediated by IL10. This is consistent with our original ¢nding of increased IL10 secretion by spleen cells from NOD mice given aerosol insulin and by the apparent ‘bystander e¡ect’ of these spleen cells to suppress T cell proliferation to another islet antigen, GAD (Harrison et al 1996). To investigate the molecular basis of induction of CD8+ gd Treg, we employed b2 microglobulin
/
NOD mice that lack expression of classical MHC class I molecules and remain diabetes-free. CD8+ gd Treg could still be induced by aerosol insulin in these mice, indicating that MHC class I and other MHC-like molecules dependent on b2 microglobulin for surface expression are not required for the induction of these Treg. Like antibody molecules, gd TCRs recognize intact

136

HARRISON ET AL

FIG. 2. IEL numbers are dramatically reduced in NTX mice.

antigenic structures (Allison et al 2001), consistent with the requirement for undegraded insulin. We have not been able to demonstrate binding of 125I-labelled insulin to gd receptors on these cells and the molecular basis of insulin recognition remains unresolved. A critical regulatory role for IEL The primary role of the immune system is defence against pathogens, within the context of maintaining homeostasis between ‘self’ and ‘non-self’. The mucosa is the major interface between internal ‘self’ and external ‘non-self’. The mucosal immune systems play a critical role in maintaining a balance between defence against pathogens and tolerance to resident bacteria and a plethora of potential immunogenic molecules ingested or inhaled. IEL don’t constitute a discrete, organised, lymphoid tissue but are distributed between and at the basement membrane of mucosal epithelial cells. However, they are the most numerous and arguably fundamentally important lymphocyte, in the mouse being equivalent in

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

TABLE 4

137

Evidence for an immunoregulatory role of IEL

1) Bacterial colonization dramatically increases thymic- and extrathymic-derived IEL in germfree mice 2) Under germ-free conditions, autoimmune, diabetes-prone NOD mice have an increased incidence of diabetes which is decreased under conventional conditions of housing and feeding 3) Oral tolerance cannot be induced in mice pre-treated with blocking antibody to TCR gd, or in TCRd
/
mice 4) CD8+ aa TCR gd cells induced by mucosal administration of (intact) insulin in NOD mice prevent adoptive transfer of diabetes 5) Neonatal thymectomy triggers organ-speci¢c autoimmune disease and is associated with impaired development of IEL

number to all T cells present in the spleen and lymph nodes (Rocha et al 1991), and having a ‘gatekeeper’ role as the ¢rst lymphoid cells to make contact with external non-self. In mice, approximately half the IELs express Thy1, ab TCR and CD8 ab heterodimer; the rest express gd (*40%) or ab (*10%) TCR and CD8 aa homodimer, and are unique in having an extrathymic ontogeny (Lefrancois et al 1996). In humans, gd T cells constitute a lesser proportion of the small intestinal IELs, although this increases in the large intestine. Several lines of evidence point to an important immunoregulatory role of IEL (Table 4). The essential role of the normal mucosa in maintaining immune homeostasis is illustrated by the e¡ects of germ-free versus ‘dirty’ environments on diabetes incidence in NOD mice. The incidence of spontaneous diabetes in NOD mice di¡ers greatly in colonies around the world and appears to be inversely related with exposure to microbial infection (Pozzilli et al 1993). The high incidence of diabetes in NOD mice housed under speci¢c pathogen-free conditions is reported to be reduced by conventional conditions of housing and feeding (Suzuki 1987). Under such conventional ‘dirty’ conditions, bacterial colonization of the intestine is accompanied by an increase in the number of IELs (Imaoka et al 1996) and by maturation of mucosal immune function (KawaguchiMiyashita et al 1996). gd T cells, in particular gd IELs, may be key to understanding mucosa-mediated immunoregulation. A somewhat overlooked ¢nding is that mice treated with antibody to gd TCR and TCR d
/
mice are resistant to low-dose oral tolerance induction (Mengel et al 1995, Ke et al 1997). These studies were performed with oral ovalbumin, shown by many investigators to induce CD4+ Treg. Taken together these data suggest that gd IEL may condition submucosal dendritic cells to be ‘tolerogenic’ and mediate induction of CD4 Treg.

138

HARRISON ET AL

Neonatal thymectomy and Treg in autoimmune diabetes Many investigators have demonstrated that neonatal thymectomy (NTX) 2^5 days after birth leads to organ-speci¢c autoimmune disease (reviewed in Tung 1994, Bonomo et al 1995), depending on the mouse strain. Tung (1994) suggested that post-NTX autoimmune disease results from an imbalance between pathogenic self-antigen reactive T cells and regulatory T cells. NTX depletes many T-cell populations, some of which may be involved in regulating immunity to selfantigens. For example, NTX led to a de¢ciency of CD4+ CD25+ T cells, reconstitution of which prevented post-NTX autoimmune gastritis (Asano et al 1996, Suri-Payer et al 1998), and NTX has been reported to impair development of regulatory NK T cells (Hammond et al 1998). In addition, Lin et al (1993) showed that NTX impaired the development of IEL, but IEL have not previously been implicated in post-NTX autoimmune disease. In the NOD mouse, we found that NTX greatly accelerated the development of diabetes. By 250 days of age, nearly 100% of female mice were diabetic compared to 50% of sham controls, whereas in males the respective values were 80% and 510%. We con¢rmed that this dramatic e¡ect of NTX on diabetes incidence was accompanied by marked impairment in the development of IEL in the small intestine (Fig. 2), and of bronchial and nasal associated lymphoid tissues. Failure to develop IEL after NTX was associated with failure of naso-respiratory insulin to induce Treg, previously shown to bear CD8+ aa and TCR gd markers (Harrison et al 1996). This was not surprising, given the marked decrease in CD8+ aa TCR gd IEL observed after NTX along with the decrease in other T cell subsets. A vital role for IELs was suggested by the ¢nding that treatment of euthymic female mice with a single dose of neutralizing antibody to aE integrin (CD103), a marker of IEL, at 18 days of age signi¢cantly accelerated diabetes development (data not shown). To determine if the de¢ciency of CD8+ aa gd IEL after NTX could be responsible for accelerated diabetes development, NTX mice were reconstituted with 1106 CD8+ aa gd IEL at 4, 6, 8 and 10 weeks of age, and diabetes incidence monitored. To isolate pure CD8+ aa gd IEL, we took advantage of the fact that b2 microglobulin
/
NOD mice lack conventional CD8+ ab, CD8+ aa and CD8+ ab T cells (Das et al 2000). When we isolated IEL from the small intestine of b2 microglobulin
/
NOD mice, 95% or more of the cells were CD8+ aa TCR gd. Reconstitution of NTXNOD mice with these cells prevented development of diabetes (data not shown). This protective e¡ect was abrogated by concomitant treatment of mice with the GL3 monoclonal antibody to gd TCR. As further control, IEL that were irradiated before being injected had no protective e¡ect. Thus, gd IEL and not potentially contaminating bacterial products or CD4+ T cells mediated the protection. In contrast to reconstitution with CD8+ aa gd IEL, reconstitution with a single dose of splenocytes from 6 week-old wild-type NOD females did

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

139

not suppress diabetes development. It is not known whether these regulatory CD8+ aa gd T cells used for reconstitution are antigen-speci¢c. However, by analogy with similar cells induced by naso-respiratory insulin, they could conceivably be induced physiologically by insulin in maternal milk. Oral insulin is degraded in the stomach when administered to adult mice, but insulin in maternal milk might not be if the immature neonatal gut lacked ‘insulinase’ activity or if the insulin was associated with another protein. This would have important implications for early exposure of the mucosa to environmental in£uences that could modify autoimmune disease development in susceptible individuals. In our reconstitution studies of NTX-NOD mice, it is important to stress that only puri¢ed CD8+ aa TCR gd cells, and not thymic-derived splenic CD4+CD8+ T cells, prevented diabetes. However, others have shown that thymic-derived regulatory CD4+ cells, speci¢cally splenic CD4+CD25+ T cells, prevent postNTX autoimmune gastritis in BALB/c mice (Asano et al 1996, Suri-Payer et al 1998), and that low-dose oral ovalbumin may activate CD4+CD25+ T cells capable of suppressing delayed hypersensitivity (Zhang et al 2001). These ¢ndings do not, however, constitute proof that lack of these regulatory CD4 T cells is the primary defect in NTX-NOD mice. Our evidence for a primary defect at the level of the IEL may be consistent with studies showing that oral tolerance to ovalbumin cannot be induced if mice are pre-treated with neutralising antibody to gd TCR or in TCR d
/
mice (Mengel et al 1995, Ke et al 1997). We hypothesise that IEL, via an e¡ect on submucosal dendritic cells, are necessary for the generation of downstream regulatory T cells such as CD4+CD25+ cells. CD8+ aa TCR gd T cells, phenotypically similar to IEL, induced by naso-respiratory insulin express IL10, which can condition dendritic cells to acquire ‘tolerogenic’ properties and induce regulatory CD4+ T cells (Roncarolo & Levings 2000). These studies in the NTX-NOD model provide further evidence for a thymus-mucosa immune axis that in£uences development and maintenance of peripheral selftolerance.

Conclusions Among the emerging panoply of Treg, CD8+ aa TCR gd cells induced by intact insulin may be a special case illustrating a broader and fundamental immunoregulatory role of IEL. An emerging body of evidence indicates that IEL have a primary sentinal role in the mucosal expanse, the major interface between ‘self’ and ‘non-self’. Understanding the immunoregulatory function of IEL in greater detail could contribute to a more uni¢ed concept of Treg in immune homeostasis.

140

HARRISON ET AL

References Allison TJ, Winter CC, Fournie JJ, Bonneville M, Garboczi DN 2001 Structure of a human gd T-cell antigen receptor. Nature 411:820^824 Asano M, Toda M, Sakaguchi N, Sakaguchi S 1996 Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387^396 Bergerot I, Fabien N, Maguer V, Thivolet C 1994 Oral administration of human insulin to NOD mice generates CD4+ T cells that suppress adoptive transfer of diabetes. J Autoimmun 7:655^663 Bonomo A, Kehn PJ, Payer E, Rizzo L, Cheever AW, Shevach EM 1995 Pathogenesis of post-thymectomy autoimmunity. Role of syngeneic MLR-reactive T cells. J Immunol 154:6602^6611 Colman PG, Steele C, Couper JJ et al 2000 Islet autoimmunity in infants with a Type I diabetic relative is common but is frequently restricted to one autoantibody. Diabetologia 43:203^209 Daniel D, Wegmann DR 1996 Protection of nonobese diabetic mice from diabetes by intranasal or subcutaneous administration of insulin peptide B-(9-23). Proc Natl Acad Sci USA 93: 956^960 Daniel D, Gill RG, Schloot N, Wegmann DR 1995 Epitope speci¢city, cytokine production pro¢le and diabetogenic activity of insulin speci¢c T-cell clones isolated from NOD mice. Eur J Immunol 25:1056^1062 Das G, Gould DS, Augustine MM et al 2000 Qa-2-dependent selection of CD8a/a T cell receptor a/b+ cells in murine intestinal intraepithelial lymphocytes. J Exp Med 192:1521^1528 French MB, Allison J, Cram DS et al 1997 Transgenic expression of mouse proinsulin II prevents diabetes in nonobese diabetic mice. Diabetes 46:34^39 Hammond K, Cain W, van Driel I, Godfrey D 1998 Three day neonatal thymectomy selectively depletes NK1.1+ T cells. Int Immunol 10:1491^1499 H
nninen A, Harrison LC 2000 Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model. Immunological Rev 173:109^119 Harrison LC, Dempsey-Collier M, Kramer DR, Takahashi K 1996 Aerosol insulin induces regulatory CD8 gamma delta T cells that prevent murine insulin-dependent diabetes. J Exp Med 184:2167^2174 Harrison LC, Honeyman MC, Trembleau S et al 1997 A peptide binding motif for I-A(g7), the class II MHC molecule of NOD and Biozzi ABH mice. J Exp Med 185:1013^1021 Homann D, Holz A, Bot A et al 1999 Autoreactive CD4+ T cells protect from autoimmune diabetes via bystander suppression using the IL-4/Stat6 pathway. Immunity 11:463^472 Imaoka A, Matsumoto S, Setoyama H, Okada Y, Umesaki Y 1996 Proliferative recruitment of intestinal intraepithelial lymphocytes after microbial colonization of germ-free mice. Eur J Immunol 26:945^948 Kawaguchi-Miyashita M, Shimizu K, Nanno M et al 1996 Development and cytolytic function of intestinal intraepithelial T lymphocytes in antigen-minimized mice. Immunology 89: 268^273 Ke Y, Pearce K, Lake JP, Ziegler HK, Kapp JA 1997 gd T lymphocytes regulate the induction and maintenance of oral tolerance. J Immunol 158:3610^3618 Kimpimaki T, Knip M 2001 Disease-associated autoantibodies as predictive markers of type 1 diabetes mellitus in siblings of a¡ected children. J Pediatr Endocrinol Metab 14: 575^587 Lefrancois L 1991 Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J Immunol 147:1746^1751 Lefrancois L, Fuller B, Olson S, Puddington L 1996 Development of intestinal intraepithelial lymphocytes. In: Kagno¡ MF, Kiyono H (eds) Essentials of mucosal immunology. Academic Press, San Diego, California, p 183^193

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

141

Lin T, Matsuzaki G, Kenai H, Nakamura T, Nomoto K 1993 Thymus in£uences the development of extrathymically derived intestinal intraepithelial lymphocytes. Eur J Immunol 23:1968^1974 Martinez NR, Augstein P, Moustakas AK et al 2003 Disabling an integral CTL epitope allows suppression of autoimmune diabetes by intranasal proinsulin peptide. J Clin Invest 111: 1365^1371 Mengel J, Cardillo F, Aroeira LS, Williams O, Russo M, Vaz NM 1995 Anti-gd T cell antibody blocks the induction and maintenance of oral tolerance to ovalbumin in mice. Immunol Lett 48:97^102 Muir A, Peck A, Clare-Salzler M et al 1995 Insulin immunization of nonobese diabetic mice induces a protective insulitis characterized by diminished intraislet interferon-gamma transcription. J Clin Invest. 95:628^634 Poussier P, Julius M 1994 Thymus independent T cell development and selection in the intestinal epithelium. Annu Rev Immunol 12:521^553 Pozzilli P, Signore A, Williams AJ, Beales PE 1993 NOD mouse colonies around the world  recent facts and ¢gures. Immunol Today 14:193^196 Pugliese A, Zeller M, Fernandez A Jr et al 1997 The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat Genet 15:293^297 Rocha B, Vassalli P, Guy-Grand D 1991 The V beta repertoire of mouse gut homodimeric alpha CD8+ intraepithelial T cell receptor alpha/beta + lymphocytes reveals a major extrathymic pathway of T cell di¡erentiation. J Exp Med 173:483^486 Roncarolo M-G, Levings MK 2000 The role of di¡erent subsets of T regulatory cells in controlling autoimmunity. Curr Opin Immunol 12:676^683 Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1998 CD4+CD25+ T cells inhibit both the induction and e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Suzuki T 1987 Diabetogenic e¡ects of lymphocyte transfusion on the NOD or NOD nude mouse. In: Rygaard J, Brunner N, Graem N, Spang-Thomsen M (eds) Immune de¢cient animals in biomedical research. Karger, Basel, p 112^116 Tung KS 1994 Mechanism of self-tolerance and events leading to autoimmune disease and autoantibody response. Clin Immunol Immunopathol 73:275^282 Va¢adis P, Bennett ST, Todd JA et al 1997 Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat Genet 15:289^292 Zhang ZJ, Davidson L, Eisenbarth G, Weiner HL 1991 Suppression of diabetes in nonobese diabetic mice by oral administration of porcine insulin. Proc Natl Acad Sci USA 88: 10252^10256 Zhang X, Izikson L, Liu L, Weiner HL 2001 Activation of CD25+CD4+ regulatory T cells by oral antigen administration. J Immunol 167:4245^4253 Ziegler AG, Hummel M, Schenker M, Bonifacio E 1999 Autoantibody appearance and risk for development of childhood diabetes in o¡spring of parents with type 1 diabetes: the 2-year analysis of the German BABYDIAB Study. Diabetes 48:460^468

DISCUSSION Bach: I have a comment and a question. What you said about thymic factors was reminiscent of work I did some 30 years ago. New data we got recently also ¢t with what you said in an unexpected fashion. In the old work we described a thymic peptide which we called thymulin. This was detected using rosette-forming cells

142

DISCUSSION

in the spleen, modi¢ed by adult thymectomy. Recently, we looked back at the phenotype of these cells, which were at the time de¢ned in a very rudimentary fashion. We found that the target of this thymic peptide was CD8+ gd T cells. When we look at the production of this factor in NOD mice, it is de¢cient. This makes an interesting correlation with what you say. If there is some kind of stromal factor, then the critical question is the timing of thymectomy. Concerning the e¡ect of thymectomy in NOD mice, the data you mentioned from our lab show that it is at three weeks of age. But there is an interesting di¡erence between this and Shimon Sakaguchi’s data, in which the thymectomy window is closed at day 7 or so in BALB/c mice. In NOD mice the disease is still accelerated in a dramatic fashion when the thymus is removed at three weeks of age. We know that the window is closed at 6 weeks, so there is a big di¡erence. In the type of data that you presented, what ages of thymectomy did you study? Harrison: Everything you say is correct. I showed the results of thymectomy between three and seven days of age from experiments by Natasha Solly in my lab. Later, there is still an e¡ect in females, but by three weeks there is no longer an e¡ect in males. This suggests that there is a sex hormone-dependent e¡ect on the development of this axis between the thymus and the mucosa. It seems to us from preliminary data that the male IELs may develop faster. In this regard, it may be relevant that the transfer of diabetes by splenic T cells from diabetic mice requires irradiation of recipients to deplete ‘regulatory’ cells, after 2^3 weeks of age in male recipients but not until 5^6 weeks of age in female recipients Mowat: I’m not sure how you think gd IELs in the gut are involved in this. You said you can only get this e¡ect if you give aerosol insulin, but it doesn’t work with oral insulin. IELs in the respiratory tract are very di¡erent from IELs in the gut. Most studies looking at the extrathymic IELs in the gut show that they don’t go anywhere else. They stay in the gut. How do you tie this all together? Harrison: We are forced into this situation because we can’t purify enough of these cells from the naso-respiratory tract to do our reconstitution experiments. For our experiments we have to purify them from the gut. Mowat: They are very di¡erent. Harrison: We are trying to work out whether they are in fact sessile or not. If we purify them and label them with CFSE (carboxy£uorescein succinimidyl ester) how do they redistribute? Do they go back to the mucosal lymph nodes and the gut? Whether they move out of there in the ¢rst place, I have no idea. All I can say at present is that the phenotype of regulatory, anti-diabetogenic T cells, CD8+ aa TCR gd, induced by naso-respiratory insulin (that remains intact) is the same as that of extrathymic-derived IELs. Mowat: In intact mice, where people have looked at nude mice in which extrathymic IELs have been generated, there are no peripheral gd cells. They stay in the gut.

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

143

Harrison: We don’t know how they get to the pancreatic lymph node, but the cells there are both CD8+ aa and gd. They make IL10 and they are only seen if you give nasal or aerosol insulin. We have shown with OVA-responsive TCR transgenic OT-I (CD8) or OT-II (CD4) cells that even if the volume of antigen instilled into the nose is kept down to 10 ml or less there is stimulation of proliferation of T cells in both local and distal mucosal lymph nodes. We presume that the cells we see in the pancreatic node are coming from these mucosal sites. In terms of the thymectomy, we just couldn’t get enough cells from the naso-respiratory tract to do reconstitution experiments. We have to use CD8+ aa TCR gd cells puri¢ed from the gut (of b2 microglobulin
/
NOD mice). I then mentioned that insulin is present in milk. If it was not degraded in the neonatal gut it may be having the same e¡ect in the young gut, physiologically, as it does in the older nose, experimentally. Mowat: In your demonstration of the e¡ect of anti-aE, you used this in preweaned mice where there are virtually no IELs. Harrison: There are hardly any, but there are a few. It was given at day 18 and we assumed that its e¡ect would last a week or so. If we gave it later, perhaps we would see a stronger e¡ect. I take your point about IELs being sessile. We don’t know anything about their tra⁄cking. Technically we were forced to use gut to purify them, yet insulin administration was intranasal. If we could ¢nd a way of preventing degradation of insulin when it is given orally, we would try it that way. Von Herrath: I am interested in the diabetogenic potential of the aggressive lymphocytes in these IEL-de¢cient mice. This comes back to the threshold level argument we had yesterday about TGFb. Have you done transfer experiments to see whether the cells in the IEL-de¢cient mice are just set at a higher level and are harder to regulate, or are these cells as easy to regulate in an adoptive transfer experiment as the aggressive cells that you would get out of a normal mouse? Harrison: We haven’t looked at that. Von Herrath: I have a question about the CD8+ aa cells. Do these cells have anything to do with the regulatory capability of these gd cells? Harrison: We believe that the CD8+ aa and the gd cells are one and the same cell. Von Herrath: The CD8+ aa binds to TL antigen. Have you looked at the regulatory function of this interaction? Harrison: We don’t think it is TL, because we have not been able to ¢nd expression of TL in the b2 microglobulin
/
mouse with an antibody that binds to the heavy chain. We did immunoblots as well. TL doesn’t seem to be expressed in the gut in b2 microglobulin
/
mice, in which we can generate these regulatory cells. Bluestone: You have to be careful when you say TL, because there are about eight genes that encode the TL locus, some of which are b2 microglobulin-dependent and others of which are less so.

144

DISCUSSION

Harrison: How these cells are generated is still a mystery. However, if you block the TCR gd, or CD103, and then try to induce regulatory CD4+ cells with oral insulin you can’t. Miller: Is there any speci¢city on the e¡ector end of these cells? You showed that they can inhibit adoptive transfer by splenocytes. How about BDC2.5 T cells? Are they working by bystander suppression? Harrison: We are trying to do those experiments with diabetogenic T cell clones but we don’t have anything to report yet. We assume they do have a bystander e¡ect because they secrete IL10, and originally showed that after induction by insulin they could reduce the response to another islet antigen, glutamic acid decarboxylase (Harrison et al 1996, H
nninen & Harrison 2000). Bach: What is so special about the nose? Harrison: It sticks out and it is easy to get at, and it doesn’t degrade insulin. Bach: There are many ways of administering this antigen. Is what you see special to the nasal epithelium? Harrison: Aerosol application into the lung also works. We just think it is a site where there is not much degradation of this particular antigen, so that it can then be recognised by the gd TCR. Alan Mowat would know more about special properties of nasal mucosa versus gut. Mowat: There is very rapid uptake of antigen from the nasal mucosa. There is also reported to be di¡erent populations of dendritic cells which perhaps have regulatory properties. This is really targeting antigen in quite large intact amounts to populations of DCs which induce regulatory cells. This is a possible explanation. Harrison: It requires the anterior cervical lymph node. Mowat: There’s something unusual about the local lymphoid tissues as well. Delovitch: It may be appropriate for you to summarize the recent data from clinical studies with nasal or aerosolized insulin. Harrison: We treated 38 children with islet autoantibodies at risk for type 1 diabetes with intranasal insulin, to determine if this treatment was safe and would induce immune change consistent with ‘mucosal tolerance’. We got changes indicating it had an e¡ect. It increased the insulin antibody levels quite signi¢cantly. Whole insulin inhibits APC function, so for T cell assays ex vivo we used denatured insulin as antigen. In the group as a whole we found suppression of T cell responses to denatured insulin. The children have been followed up for more than three years, and none who had normal ¢rst phase insulin response to glucose at the beginning have shown any deterioration. This was a cross-over study and so we can’t conclude whether or not this treatment prevents loss of b cell function. However, from historical controls, we would have expected almost 50% of them to get diabetes within 5 years. At least it was safe and didn’t accelerate diabetes, which was the primary question.

(PRO)INSULIN-SPECIFIC REGULATORY T CELLS

145

References Ha« nninen A, Harrison LC 2000 Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model. Immunol Rev 173:109^119 Harrison LC, Dempsey-Collier M, Kramer DR, Takahashi K 1996 Aerosol insulin induces regulatory CD8 gamma delta T cells that prevent murine insulin-dependent diabetes. J Exp Med 184:2167^2174

CD1d-restricted NKT regulatory cells: functional genomic analyses provide new insights into the mechanisms of protection against Type 1 diabetes Qing-Sheng Mi*1, Craig Meagher*1 and Terry L. Delovitch{2 *Autoimmunity/Diabetes Group, Robarts Research Institute and {Department of Microbiology and Immunology, University of Western Ontario, 1400 Western Road, London, ON, Canada N6G 2V4

Abstract. De¢ciencies in NKT cell number and function mediate the development of Type 1 diabetes (T1D). NKT cell activation with the CD1d ligand a-galactosylceramide (a-GalCer) corrects these de¢ciencies and prevents the onset and recurrence of T1D in NOD mice. To investigate how a-GalCer accomplishes this, we conducted three sets of studies. First, gene microarray analyses showed that a-GalCer treatment decreases interleukin (IL)16 and increases IL10 and MIP1b gene expression in the spleen. Anti-IL16 antibody treatment protects NOD mice against insulitis and T1D, and neutralization of MIP1b abrogates IL4 induced protection from T1D. Second, a-GalCer treatment of NOD.IL4 / mice demonstrated that IL4 expression is required for prevention of T1D but not for NKT cell development. Third, we found that diabetes resistance in three novel congenic NOD.B6Idd4 mouse strains is associated with an increased number of NKT cells in pancreatic lymph nodes (PLNs). This increase was not evident in the spleen or PLNs of NOD.MIP1a / mice after a-GalCer treatment. Our data suggest that MIP1b is a candidate gene in Idd4 that regulates NKT cell function and diabetes susceptibility. By controlling the expression and activity of IL16 and MIP1b a-GalCer treatment may modulate the number, localization and function of NKT cells and regulate susceptibility to T1D. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 146^164

Type 1 diabetes (T1D) is an autoimmune disease characterized by the selective T cell-mediated destruction of insulin-producing b cells in pancreatic islets. During the spontaneous development of T1D in non-obese diabetic (NOD) 1These

authors made equal contributions. paper was presented at the symposium by Terry L. Delovitch, to whom correspondence should be addressed.

2This

146

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

147

mice, this T cell destruction may result from a breakdown of self-tolerance towards islet b cell autoantigens elicited by an imbalance in the control of diabetogenic e¡ector CD4+ T helper 1 (Th1) cells by di¡erent subsets of regulatory T cells (Delovitch & Singh 1997). Natural killer T (NKT) cells comprise one of these subsets of regulatory T cells that mediate tolerance and prevention of T1D (Hong et al 2001, Sharif et al 2001, Sharif et al 2002, Kitamura et al 1999, Lehuen et al 1998, Shi et al 2001, Singh et al 2001, Wang et al 2001). A causal role for NKT cells in T1D is attributed to both a numerical and functional de¢ciency in NOD mice, BB rats, and human T1D patients (Sharif et al 2002). NKT cells are characterized by the co-expression of a semi-invariant T cell receptor (TCR) and the NK1.1 natural killer receptor, a burst of interleukin 4 (IL4) and interferon g (IFNg) cytokine secretion on activation, and the recognition of glycolipid molecules bound to the non-polymorphic MHC class Ib molecule CD1d (Benlagha & Bendelac 2000, Elewaut & Kronenberg 2000, Park et al 1998). TCRa chains expressed by NKT cells consist of Va1-Ja281 gene segments and exhibit a preferential association with the Vb8.2, Vb2 and Vb7 TCRb chains in mice (Taniguchi et al 1996). Three subsets of NKT cells, each having a distinct tissue distribution pattern, have been identi¢ed based on their CD4 and CD8 expression pro¢les (Hammond et al 1999). The majority of NKT cells in the liver and lymphoid organs are CD4+ or CD4 CD8 , and unconventional populations of CD8+ NKT cells have been identi¢ed in the liver and spleen (Emoto et al 2000, Hammond et al 1999). Although the natural ligands recognized by NKT cells remain unknown, the synthetic glycolipid agalactosylceramide (a-GalCer) isolated from the Agelas mauritanius marine sponge can activate NKT cells (Kawano et al 1997, Kitamura et al 1999) and has proven informative about how NKT cells regulate susceptibility to autoimmune disease and T1D. Recently, we and others have shown that administration of a-GalCer to NOD mice before and after the onset of insulitis protects against the spontaneous and cyclophosphamide (CY)-induced development of T1D (Hong et al 2001, Sharif et al 2001, Wang et al 2001, Racke et al 2002). Extended treatment of female NOD mice with a-GalCer increases NKT cell frequency in the spleen and pancreatic lymph nodes (PLNs) but not the islets, highlighting the importance of the PLNs for NKT cell-mediated regulation of T1D. In this synopsis, we present a progress report of our recent ¢ndings from three sets of studies aimed at further elucidating the mechanism(s) of a-GalCer induced activation of NKT cells and protection from T1D. First, cDNA microarray analyses were conducted to characterize changes in gene expression pro¢les of cytokines, chemokines and their respective receptors in NOD mice in response to a-GalCer. Second, NOD.IL4 / mice de¢cient in IL4 production were used to investigate whether a-GalCer-induced IL4 expression is required for NKT cell

148

MI ET AL

development or prevention of T1D. Third, the control of NKT cell mediated protection from T1D by a gene(s) linked to the Idd4 diabetes susceptibility locus was evaluated in three novel congenic NOD.B6Idd4 diabetes-resistant mouse strains that we previously generated (Grattan et al 2002). Pro¢le of gene expression induced by a-GalCer Previously, we found an increase in the number and function of NKT cells in the spleen and PLN of NOD mice protected from T1D by a-GalCer treatment (Sharif et al 2001, 2002). To investigate how a-GalCer regulates this increase, we used cDNA SuperArray technology to analyse changes in gene expression pro¢les after treatment of NOD mice with a-GalCer or vehicle. Although CC chemokines mediate the recruitment of islet in¢ltrating T cells to the pancreas (Cameron et al 2000), little is known about the role of these chemokines in NKT cell activation and a-GalCer induced protection from T1D. We reasoned that a-GalCer may protect from insulitis and T1D via the regulation of expression of selected CC chemokines and CC chemokine receptors (CCR). To investigate this possibility, female NOD mice (10^12 week-old) were treated with a single dose (5 mg/dose) of a-GalCer or vehicle. At 6 hours after treatment, splenic RNA was isolated and gene expression was evaluated by microarray analyses. In response to a-GalCer, signi¢cant increases (5twofold) in expression were observed for the eotaxin, IP10, MIG, and MIP1b chemokines, whereas expression of SDF1 and 6Ckine were signi¢cantly reduced (Table 1). Similarly, the expression of the CCR2, CCR3, CCR6 and CXCR4 chemokine receptors was also reduced. The observed increase in splenic MIP1b expression in response to a-GalCer is of particular interest. Previously, we found that IL4-mediated protection of NOD mice from T1D is associated with an elevated expression of MIP1b in the spleen and islets (Cameron et al 2000). Here, we show that this protection is abrogated by treatment with a neutralizing anti-MIP1b antibody (Table 2). Accordingly, enhanced MIP1b expression in the spleen and islets correlates closely with protection from T1D. In addition, the surface expression of CCR5 is up-regulated on a-GalCer-activated human NKT cells (Motsinger et al 2002). Thus, MIP1b/CCR5 interactions may mediate NKT cell activity and recruitment to the spleen, PLN and islets. Since a-GalCer induces the rapid synthesis and secretion of IL4 by NKT cells in NOD mice (Sharif et al 2001), we investigated whether protection of NOD mice from T1D elicited by a-GalCer is mediated by a Th2-like chemokine/chemokine receptor response. Polarization to a Th2-like chemokine response was not detected upon activation by a-GalCer, as changes in the expression of several chemokines and chemokine receptors involved in both Th1 and Th2 dominant immune responses were observed (Table 1). For example, eotaxin is a CC chemokine

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

149

TABLE 1 Microarray analyses of changes in gene expression in spleen after a-GalCer stimulation Gene Chemokine/chemokine receptor Eotaxin MIP1b MIG IP-10 6 Ckine SDF-1 CCR2 CCR3 CCR9 CXCR4 Cytokine/cytokine receptor IL16 IL10 IL10-Rb

Increasea

Decreaseb

+ + + +

+ +

a,b Changes in gene expression represent at least a twofold increase (+) or decrease ( ). Female NOD mice (9^10 week-old) were treated with a-GalCer (5 mg) or vehicle control. Total spleen RNA was isolated at 6 hours after treatment. RNA samples (5 mg) were used to analyse the expression of chemokine, cytokine and related receptor genes. The relative amounts of gene transcripts were estimated by comparing the signal intensities with the signals derived from GAPDH and b actin transcripts.

associated with the development of a Th2-like immune response, whereas IP10 and MIG are secreted in response to IFNg during a Th1-dominant immune response (Dufour et al 2002). Nonetheless, a recent report suggests that either certain NKT cell populations or NKT cells at di¡erent stages of development may promote a Th1 or Th2 immune response (Benlagha et al 2002, Lee et al 2002). Human CD4+ and CD4 CD8 NKT cells are distinguishable by their distinctive pro¢les of cytokine secretion and pattern of expression of chemokine receptors (Lee et al 2002). Upon activation, CD4+ NKT cells secrete primarily IL4 and IL13 and CD4 CD8 NKT cells secrete mainly IFNg and TNFa. Since CD25 is expressed only by CD4+ NKT cells, CD4+ NKT cells may be a subset of CD4+CD25+ T cells that regulate tolerance to islet autoantigens (Chatenoud et al 2001, Lee et al 2002, Salomon et al 2000). On the basis of the pattern of cytokine production and CCR5 expression by CD4 CD8 NKT cells, it is tempting to speculate that CD4 CD8 NKT cells promote a pathogenic Th1-like response and that CD4+ NKT cells

150

TABLE 2 diabetes

MI ET AL

Neutralization of MIP1b abrogates IL4-mediated protection from Type 1

Diabetes incidence (weeks post-transfer) Treatment Donor/recipient NOD-IgG/IgGa NOD-IL4/IgGb NOD-IL4/antiMIP-1bc

0

1

2

3

4

5

6

7

8

9

10

11

0/17 0/17 0/17 0/17 0/17 2/17 5/17 8/17 13/17 13/17 15/17 17/17 0/10 0/10 0/10 0/10 0/10 0/10 0/10 0/10 0/10 4/10 4/10 4/10 0/9 0/9 0/9 0/9 0/9 0/9 1/9 3/9 5/9 8/9 9/9

a

Female NOD mice were administered vehicle (PBS+1% mouse serum) by intraperitoneal (i.p.) injection thrice weekly from 3^12 weeks of age. Splenic T cells (5106) were then adoptively transferred into NOD.Scid recipient mice. Recipient mice were subsequently treated i.p. with goat IgG (50 mg/dose) thrice weekly for 11 weeks. b Female NOD mice were administered recombinant mouse IL4 (100 ng/dose) i.p. thrice weekly from 3^12 weeks of age, and splenic T cells (5106) were then adoptively transferred into NOD.Scid recipient mice. Recipient mice were subsequently treated i.p. with goat IgG (50 mg/dose) thrice weekly for 11 weeks. c Female NOD mice were administered recombinant mouse IL4 (100 ng/dose) i.p. thrice weekly from 3^12 weeks of age, and splenic T cells (5106) were then adoptively transferred into NOD.Scid recipient mice. Recipient mice were subsequently treated i.p. with a neutralizing goat anti-mouse MIP1b polyclonal antibody thrice weekly for 11 weeks.

promote a Th2-like response that protects against T1D. The latter idea is supported by a recent study indicating that NKT cell regulatory function might be developmentally controlled (Benlagha et al 2000). Our microarray analyses also show that a-GalCer stimulates a signi¢cant increase in IL10 expression in the spleen of NOD mice (Table 1), in support of our previous ¢nding that IL10 plays a key role in mediating a-GalCer induced protection from T1D (Sharif et al 2001). In parallel, a fourfold or greater decrease in a-GalCer induced IL16 gene expression was observed (Table 1), which persists until 8 days after a-GalCer treatment (our unpublished data). This is the ¢rst report of a potential role for IL16 in the development and/or function of NKT cells that regulate susceptibility to an autoimmune disease. IL16 is a pro-in£ammatory cytokine produced by several cell types, including CD4+ and CD8+ T cells and dendritic cells (DCs), and many roles for IL16 in the regulation of immune responses have been described (Cruikshank et al 2000). The interaction of IL16 with its CD4 receptor can induce steric changes in CD4^MHC class II binding that prevent subsequent antigen induced IL2Ra expression, IL2 secretion, and CD95 expression by CD4+ T cells. Interestingly, IL16 can recruit and prime CD4+ T cells in an antigen-independent manner during an in£ammatory response. This stimulation may not only increase the number of cells recruited but also augment the number of viable cells at that site by the inhibition of antigen-speci¢c activation-induced cell death.

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

151

TABLE 3 Anti-IL16-mediated protection from T1D in female NOD mice is partially reversible by neutralization of MIP1b

Treatment group

Diabetes incidence at 30 weeks of age

IgGa Anti-IL16b Anti-IL16+anti-MIP1b c

7/9 (78%) 3/12 (25%) 5/8 (63%)

a Administered murine IgG (200 mg) i.p. three times weekly from 3^14 weeks of age. b Administered neutralizing mouse anti-human IL16 antibody (200 mg) i.p. three times weekly from 9^14 weeks of age. c Co-administered anti-IL16 (200 mg)+neutralizing goat anti-mouse MIP1b (100 mg) three times weekly from 9^14 weeks of age.

The development of multiple sclerosis in humans and experimental allergic encephalomyelitis in mice is mediated by IL16 and is characterized by a reduction in NKT cell number (Biddison et al 1997, 1998, Mars et al 2002, Singh et al 2001). This raises the possibility that IL16 down-modulates NKT cell activity and that a-GalCer treatment reverses this e¡ect of IL16. To test this possibility, we analysed whether IL16 mediates the onset of T1D in NOD mice. Treatment with a neutralizing anti-IL16 antibody between 9^14 weeks of age protected against the development of T1D (Table 3). Anti-IL16 treatment did not signi¢cantly increase the number of NKT cells in the spleen or PLNs, as detected by staining with a-GalCer CD1d-loaded tetramers (unpublished data). Thus, aGalCer treatment of NOD mice may protect against T1D by inhibiting the expression and function of IL16 and not by enhancing the number of CD1dreactive NKT cells. Since the binding of IL16 to CD4 desensitizes the ability of MIP1b to signal through its CCR5 receptor and recruit CD4+ T cells (Mashikian et al 1999), anti-IL16 treatment may block this desensitization and enable MIP1b to signal normally via CCR5. Support for this idea derives from our ¢nding that co-neutralization of MIP1b and IL16 increases the incidence of T1D from 25%^63% at 35 weeks of age (Table 3). Thus, enhanced MIP1b activity leads to partial protection from T1D upon inactivation of IL16, and this may explain the close correlation between the elevated expression of MIP1b in the spleen and islets and protection against T1D (Cameron et al 2000). Protection from T1D by a-GalCer occurs in an IL4-dependent manner Protection against T1D in NOD mice by a-GalCer is associated with a polarized Th2 milieu marked by elevated IL4 and IL10 and reduced IFNg levels in the spleen

152

MI ET AL

TABLE 4 Diabetes incidence in NOD and NOD.IL4 cyclophosphamide

/

mice challenged with

Incidence of diabetes (weeks) NOD mice

0

1

2

3

4

5

NOD.IL4 / + vehicle NOD + vehicle NOD.IL4 / + a-GalCer NOD + a-GalCer

0/7 0/8 0/8 0/8

0/7 0/8 0/8 0/8

0/7 1/8 0/8 1/8

4/7 5/8 4/8 2/8

5/7 5/8 5/8 2/8

5/7 5/8 5/8 2/8

Female NOD or NOD.IL4 / mice (7^8 week-old) were challenged with CY and received a-GalCer (5 mg/ mouse) or vehicle i.p. on days 0, 2, 4, 6 and 8. The incidence of diabetes was monitored for 5 weeks.

and pancreas as well as up-regulation of IL10R transcripts in the spleen (Sharif et al 2001). In Va14-Ja281 TCR transgenic NOD mice, protection from T1D is also associated with elevated levels of IL4 and reduced IFNg mRNA transcripts in islets and a dominant Th2 (higher IgG1:IgG2c ratio) response to the glutamic acid decarboxylase 65 islet autoantigen (Lehuen et al 1998). To further investigate the signi¢cance of this elevated level of IL4, we analysed whether NOD mice de¢cient in IL4 expression are protected from T1D upon treatment with a-GalCer. NOD.IL4 / mice, generated by back crossing of B6.IL-4 / mice to the NOD genetic background for 12 generations, were not protected against CY-induced T1D upon treatment with a-GalCer (Table 4). This indicates that IL4 is required for a-GalCer mediated protection from T1D. In addition, this IL4 de¢ciency does not exacerbate CY-induced T1D, which is consistent with a previous report that neither the kinetics nor the frequency of onset of spontaneous T1D is a¡ected by the IL4 mutation in NOD mice (Wang et al 1998). An increased frequency of NKT cells in the spleen and PLNs of a-GalCer treated NOD mice was recently demonstrated in two studies (Hong et al 2001, Sharif et al 2001). Both studies concur that the PLN is an important site of NKT cell-mediated regulation of T1D. The expansion and activation of NKT cells in PLN induced by a-GalCer may elicit the preferential recruitment of tolerogenic CD8a myeloid DCs to lymphoid tissues and possible elimination of immunogenic CD8a+ lymphoid DCs by the cytotoxic activity of a-GalCer-stimulated NKT cells (Naumov et al 2001). To determine whether IL4 is required for a-GalCer to promote the expansion of NKT cells in secondary lymphoid organs, we examined the frequency of NKT cells in the spleen and PLN of NOD.IL4 / mice following a-GalCer therapy. After 8 days of treatment (5 mg/mouse, every

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

153

other day), no signi¢cant increase in the frequency of NKT cells between NOD and NOD.IL4 / mice was observed (unpublished data). However, a-GalCer treatment stimulated about a twofold increase in the frequency of NKT cells in the PLN of NOD.IL4 / mice relative to that seen in NOD mice. Thus, while IL4 is not required for a-GalCer-induced NKT cell expansion, IL4 is required for a-GalCer protection from T1D. In NOD.IL4 / mice, IL4 activity may be compensated by another cytokine(s) such as IL10, as we previously reported (Sharif et al 2001). The latter result is consistent with an immunoregulatory role for NKT cell-derived IL10 (Sonoda & Stein-Streilein 2002). Genetic control of NKT cell development by Idd4-linked genes in NOD mice The de¢ciency in NKT cell number and function in NOD mice, particularly in the thymus and spleen (Baxter et al 1997, Gombert et al 1996), may re£ect a defect in the development of the NKT cell pool in NOD mice. Indeed, thymic precursor cells derived from NOD mice fail to develop into NKT cells upon transfer to NOD.Scid recipients (Yang et al 2001). Since CC chemokines can in£uence the migration of T cells to PLNs and islets in NOD mice (Cameron et al 2000), CC chemokine genes in Idd4 may regulate the migration to and function of NKT regulatory cells at these sites. Recently, we generated three novel NOD.B6Idd4 congenic mouse strains that are resistant to the development of spontaneous and CY-induced T1D (Grattan et al 2002). Genetic analyses of these strains limited Idd4 to a 5.2 cM interval that contains two subloci, Idd4.1 and Idd4.2, with the CC chemokine gene family localized in Idd4.2. Our studies of whether these Idd4 subloci govern the function of NKT cells show that there is no di¡erence in the number of NKT cells in the spleen of NOD.B6Idd4A, NOD.B6Idd4B, NOD.B6Idd4C and NOD mice (Table 5). However, the number of NKT cells in the PLNs of these NOD.B6Idd4 mice are signi¢cantly higher than that in age-matched NOD mice. In contrast, no TABLE 5

Frequency of NKT cells in NOD.B6Idd4 congenic micea

Strain

Spleen (%)

PLN (%)

NOD.B6Idd4A NOD.B6Idd4B NOD.B6Idd4C NOD

1.1 0.8 0.9 0.9

2.8 1.8 2.2 0.8

a

NKT cells in the spleen and PLN of NOD.B6Idd4 and NOD mice (10^15 week-old) were stained immuno£uorescently by anti-CD3 and CD1d loaded a-GalCer tetramers.

154

MI ET AL

di¡erences were observed between NOD.B6Idd4 and NOD mice in the number of the CD4+CD25+, CD4+CD62L+ and CD4+CD69+ regulatory T cell subsets before and after anti-CD3 stimulation (unpublished data). Thus, B6-derived Idd4 loci may control NKT cell mediated protection from T1D, especially the recruitment of NKT cells to the PLNs. Increases in the number of NKT cells in the PLNs of all three NOD.B6Idd4 congenic strains suggest that Idd4-mediated protection from T1D in these strains is mediated in part by the migration of NKT cells to PLNs. These NKT cells in the PLNs may in turn regulate T1D in NOD mice by locally controlling the frequency and function of DC subsets (Racke et al 2002).

Candidate genes in Idd4 may regulate NKT cell function and protection from diabetes CC chemokine genes map to Idd4.2 (Grattan et al 2002) and the MIP1a CC chemokine plays an early e¡ector role in the development of insulitis in NOD mice (Cameron et al 2000). The ratio of expression of MIP1a:MIP1b in the pancreas correlates directly with the severity of insulitis and progression to T1D (Cameron et al 2000). This relationship also distinguishes NOD littermate pairs discordant for T1D, where a relative increase in MIP1a and decrease in MIP1a is detectable in the pancreas of diabetic sibs. Furthermore, MIP1a-de¢cient NOD.MIP1a / mice are protected from insulitis and T1D. It follows that the temporal modulation of CC chemokines can intervene with the development of insulitis and T1D. Thus, the chemokine and chemokine receptor phenotype of potentially autoreactive e¡ector T cells and regulatory T cells, including NKT cells, likely determines whether islet b cell destruction occurs. To further test this hypothesis, we examined whether MIP1a modulates NKT cell function by analyses of NKT cells in NOD.MIP1a / mice. We found that the number of NKT cells in the spleen and PLNs does not di¡er between NOD and NOD.MIP1a / mice before and after a-GalCer treatment (Fig. 1), and that a-GalCer treatment does not enhance protection against CY-induced T1D in NOD.MIP1a / mice (Fig. 2). These results suggest that MIP1a is not a candidate Idd4.2 gene that regulates NKT cell function in NOD mice. However, our cDNA microarray analyses show that anti-CD3 activated splenic T cells from the three NOD.B6Idd4 congenic strains express elevated levels of MIP1b compared to similarly activated T cells from NOD mice (our unpublished data). These data again correlate elevated MIP1b expression with protection from T1D and enhanced recruitment of NKT cells to the PLN. It remains to be determined whether MIP1b can recruit NKT cells to

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

155

FIG. 1. Frequency of NKT cells in the spleen and PLN following short and long-term treatment with a-GalCer or vehicle. For short-term treatment, female NOD.MIP1a / , NOD.MIP1a+/+ and NOD mice (10^12 week-old) were treated with one dose (5 mg/dose) of aGalCer, and the spleens (A) and PLN (B) were harvested 6 hours later. For long-term treatment, mice were treated with a-GalCer (5 mg/dose) on days 0, 2, 4, 6 and 8, and the spleens (A) and PLN (B) were harvested 8 days later. The percentage of NKT cells was determined by staining with aGalCer-loaded CD1d tetramers, as described (Sharif et al 2001).

the PLN in the NOD.B6Idd4 mice and mediate protection from T1D in this manner. Concluding remarks We have further elucidated the mechanism of protection of NOD mice from T1D achieved by treatment with a-GalCer. Our studies demonstrate that a-GalCer

156

MI ET AL

FIG. 2. Incidence of cyclophosphamide-induced diabetes in NOD.MIP1a / mice. Female NOD.MIP1a / , NOD.MIP1a+/+ and NOD mice (7^8 week-old) were challenged with cyclophosphamide (200 mg/kg body weight) at day 0 and day 10, and were then treated with 5 mg/mouse a-GalCer or vehicle (sodium polysorbate) every other day for 8 days. The incidence of diabetes was determined by monitoring blood glucose levels (Cameron et al 2000).

protects NOD mice from T1D not only by promoting the development and increasing the number of CD1d-restricted NKT cells, but perhaps more signi¢cantly by stimulating the migration to and activation of these NKT cells in the PLN (Fig. 3). It is in the PLN where an important regulatory circuit may enable NKT cells to change and control the function of DC subsets and in turn Th1 and Th2 cells (Naumov et al 2001, Racke et al 2002). Our results suggest that IL16 and MIP1b may play pivotal and reciprocal roles in controlling these NKT^DC interactions. These ¢ndings may prove important for two reasons. First, this is the ¢rst report of a potential role for IL16 as a pro-in£ammatory cytokine in the development of T1D. Second, our results implicate MIP1b as a candidate gene in Idd4 that controls susceptibility or resistance to T1D by di¡erential stimulation of the recruitment to and/or expansion of NKT cells in the PLN. Finally, our results raise the possibility that immunomodulation of IL16 and MIP1b activity may represent novel immunotherapeutic strategies for the prevention of T1D in the future.

FIG. 3. Proposed mechanism of protection from T1D by treatment with a-GalCer. Treatment of NOD mice with a-GalCer activates NKT cells upon the engagement of their TCR with a-GalCer loaded CD1d molecules on interacting antigen presenting cells (APC). This treatment also results in the decreased expression of IL16 and increased expression of MIP1b in the spleen, respectively. These changes in expression may stimulate a decrease in the recruitment of CD4+ e¡ector T cells to the PLN and an increase in the recruitment of CD4+ regulatory T cells and NKT cells to the PLN. In the spleen and/or PLN, activated NKT cells may exert their regulatory functions in T1D by favouring the: (1) maturation and recruitment of DC2 cells and promotion of a Th2 polarized environment and (2) the lysis of DC1 and reduction in Th1 activity. This combination of events likely mediate protection against T1D in a-GalCer-treated mice.

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES 157

158

MI ET AL

Acknowledgements We thank all members of our laboratory for encouragement and advice, and Dr Bill Cruikshank (The Pulmonary Center, Boston University School of Medicine) for providing us with an antiIL16 antibody. This work was supported by grants from the Juvenile Diabetes Research Foundation International, Ontario Research and Development Challenge Fund, Canadian Institutes of Health Research and London Health Sciences Center Multi-Organ Transplant Program (to T.L.D.). Terry Delovitch is the Weinstein Scientist in Diabetes. Craig Meagher is a recipient of a Canadian Diabetes Association Predoctoral Fellowship Award in honour of the late Helen E. Lewis.

References Baxter AG, Kinder SJ, Hammond KJ, Scollay R, Godfrey DI 1997 Association between alphabetaTCR+CD4 CD8 T-cell de¢ciency and IDDM in NOD/Lt mice. Diabetes 46:572^582 Benlagha K, Bendelac A 2000 CD1d-restricted mouse V alpha 14 and human V alpha 24 T cells: lymphocytes of innate immunity. Semin Immunol 12:537^542 Benlagha K, Kyin T, Beavis A, Teyton L, Bendelac A 2002 A thymic precursor to the NK T cell lineage. Science 296:553^555 Biddison WE, Taub DD, Cruikshank WW, Center DM, Connor EW, Honma K 1997 Chemokine and matrix metalloproteinase secretion by myelin proteolipid protein-speci¢c CD8+ T cells: potential roles in in£ammation. J Immunol 158:3046^3053 Biddison WE, Cruikshank WW, Center DM, Pelfrey CM, Taub DD, Turner RV 1998 CD8+ myelin peptide-speci¢c T cells can chemoattract CD4+ myelin peptide-speci¢c T cells: importance of IFN-inducible protein 10. J Immunol 160:444^448 Cameron MJ, Arreaza GA, Grattan M et al 2000 Di¡erential expression of CC chemokines and the CCR5 receptor in the pancreas is associated with progression to type I diabetes. J Immunol 165:1102^1110 Chatenoud L, Salomon B, Bluestone JA 2001 Suppressor T cells
they’re back and critical for regulation of autoimmunity! Immunol Rev 182:149^163 Cruikshank WW, Kornfeld H, Center DM 2000 Interleukin-16. J Leukoc Biol 67:757^766 Delovitch TL, Singh B 1997 The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD. Immunity 7:727^738 Dufour JH, Dziejman M, Liu MT, Leung JH, Lane TE, Luster AD 2002 IFN-gamma-inducible protein 10 (IP-10; CXCL10)-de¢cient mice reveal a role for IP-10 in e¡ector T cell generation and tra⁄cking. J Immunol 168:3195^3204 Elewaut D, Kronenberg M 2000 Molecular biology of NK T cell speci¢city and development. Semin Immunol 12:561^568 Emoto M, Zerrahn J, Miyamoto M, Perarnau B, Kaufmann SH 2000 Phenotypic characterization of CD8+ NKT cells. Eur J Immunol 30:2300^2311 Gombert JM, Herbelin A, Tancrede-Bohin E, Dy M, Carnaud C, Bach JF 1996 Early quantitative and functional de¢ciency of NK1+-like thymocytes in the NOD mouse. Eur J Immunol 26:2989^2998 Grattan M, Mi QS, Meagher C, Delovitch TL 2002 Congenic mapping of the diabetogenic locus Idd4 to a 5.2-cM region of chromosome 11 in NOD mice: identi¢cation of two potential candidate subloci. Diabetes 51:215^223 Hammond KJ, Pelikan SB, Crowe NY et al 1999 NKT cells are phenotypically and functionally diverse. Eur J Immunol 29:3768^3781

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

159

Hong S, Wilson MT, Serizawa I et al 2001 The natural killer T-cell ligand alphagalactosylceramide prevents autoimmune diabetes in non-obese diabetic mice. Nat Med 7:1052^1056 Kawano T, Cui J, Koezuka Y et al 1997 CD1d-restricted and TCR-mediated activation of valpha14 NKT cells by glycosylceramides. Science 278:1626^1629 Kitamura H, Iwakabe K, Yahata T et al 1999 The natural killer T (NKT) cell ligand alphagalactosylceramide demonstrates its immunopotentiating e¡ect by inducing interleukin (IL)-12 production by dendritic cells and IL-12 receptor expression on NKT cells. J Exp Med 189:1121^1128 Lee PT, Benlagha K, Teyton L, Bendelac A 2002 Distinct functional lineages of human V(alpha)24 natural killer T cells. J Exp Med 195:637^641 Lehuen A, Lantz O, Beaudoin L et al 1998 Overexpression of natural killer T cells protects Valpha14-Jalpha281 transgenic nonobese diabetic mice against diabetes. J Exp Med 188:1831^1839 Mars LT, Laloux V, Goude K et al 2002 Cutting edge: V alpha 14-J alpha 281 NKT Cells naturally regulate experimental autoimmune encephalomyelitis in nonobese diabetic mice. J Immunol 168: 6007^6011 Mashikian MV, Ryan TC, Seman A, Brazer W, Center DM, Cruikshank WW 1999 Reciprocal desensitization of CCR5 and CD4 is mediated by IL-16 and macrophage-in£ammatory protein-1 beta, respectively. J Immunol 163:3123^3130 Motsinger A, Haas DW, Stanic AK, Van Kaer L, Joyce S, Unutmaz D 2002 CD1d-restricted human natural killer T cells are highly susceptible to human immunode¢ciency virus 1 infection. J Exp Med 195:869^879 Naumov YN, Bahjat KS, Gausling R et al 2001 Activation of CD1d-restricted T cells protects NOD mice from developing diabetes by regulating dendritic cell subsets. Proc Natl Acad Sci USA 98:13838^13843 Park SH, Chiu YH, Jayawardena J, Roark J, Kavita U, Bendelac A 1998 Innate and adaptive functions of the CD1 pathway of antigen presentation. Semin Immunol 10:391^398 Racke FK, Clare-Salzer M, Wilson SB 2002 Control of myeloid dendritic cell di¡erentiation and function by CD1d-restricted (NK) T cells. Front Biosci 7:D978^D985 Salomon B, Lenschow DJ, Rhee L et al 2000 B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431^440 Sharif S, Arreaza GA, Zucker P et al 2001 Activation of natural killer T cells by alphagalactosylceramide treatment prevents the onset and recurrence of autoimmune Type 1 diabetes. Nat Med 7:1057^1062 Sharif S, Arreaza GA, Zucker P, Mi QS, Delovitch TL 2002 Regulation of autoimmune disease by natural killer T cells. J Mol Med 80:290^300 Shi FD, Flodstrom M, Balasa B et al 2001 Germ line deletion of the CD1 locus exacerbates diabetes in the NOD mouse. Proc Natl Acad Sci USA 98:6777^6782 Singh AK, Wilson MT, Hong S et al 2001 Natural killer T cell activation protects mice against experimental autoimmune encephalomyelitis. J Exp Med 194:1801^1811 Sonoda KH, Stein-Streilein J 2002 Ocular immune privilege and CD1d-reactive natural killer T cells. Cornea 21:S33^S38 Taniguchi M, Koseki H, Tokuhisa T et al 1996 Essential requirement of an invariant V alpha 14 T cell antigen receptor expression in the development of natural killer T cells. Proc Natl Acad Sci USA 93:11025^11028 Wang B, Gonzalez A, Hoglund P, Katz JD, Benoist C, Mathis D 1998 Interleukin-4 de¢ciency does not exacerbate disease in NOD mice. Diabetes 47:1207^1211 Wang B, Geng YB, Wang CR 2001 CD1-restricted NK T cells protect nonobese diabetic mice from developing diabetes. J Exp Med 194:313^320

160

DISCUSSION

Yang Y, Bao M, Yoon JW 2001 Intrinsic defects in the T-cell lineage results in natural killer Tcell de¢ciency and the development of diabetes in the nonobese diabetic mouse. Diabetes 50:2691^2699

DISCUSSION Bluestone: Could you comment on the role of both MIP1b and IL16? If you look at it in an adoptive transfer or NKT cell-de¢cient study and ask whether these molecules are playing a role in the migration of the pathogenic cells directly, what do you see? Delovitch: We have addressed this question in mice with normal numbers of NKT cells, but not in an NKT-de¢cient setting. Craig Meagher, a student in my lab, has obtained similar data in adoptive transfer studies. In an NKT-de¢cient setting, he used adoptive transfer of NOD T cells into NOD.SCID mice. We now have NOD.CD1 knockouts and will address that speci¢c question. In the adoptive transfer study, we see the same results that anti-IL16 protects from diabetes. VonHerrath: Mitch Kronenberg has also looked at this. When he gives a-GalCer the NKT cells rapidly make large amounts of IL4 and IFNg. At least in Mitch’s hands they don’t polarize very well. Delovitch: First, Mitch’s results apply to B6 mice. Second, we used Mitch’s multilow dose a-GalCer treatment protocol which he originally showed polarizes Th2like responses very well. Von Herrath: Does the IFNg you induce play any role in the protection? Is this necessary? Perhaps there is some type of killing event of certain types of DCs. Has anyone looked at this? Delovitch: Craig Meagher has looked at a small number of animals. In one set of ¢ve NOD mice, IFNg did not reverse the NKT cell activity or a¡ect migration of NKT cells to the pancreatic lymph nodes (PLNs). Further to your point, Brian Wilson and Mike-Clare Salzler have shown that the expansion and activation of NKT cells in PLN induced by a-GalCer may elicit the preferential recruitment of tolerogenic CD8a myeloid DCs to lymphoid tissues and possible elimination of immunogenic CD8a+ DCs by the cytotoxic activity of a-GalCer-stimulated NKT cells. Bach: Speaking of cytokines, you mentioned that the IL10 knockout was still sensitive to a-GalCer, whereas the anti-IL10 receptor antibody broke the e¡ect. Can you explain this? Delovitch: I am not yet sure how to explain this e¡ect. Banchereau: Could it be that there are multiple IL10s? This is a family of six molecules.

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

161

Powrie: This antibody is against the IL10 receptor a chain, and those IL10-like molecules have not been shown to bind this a chain. But there could be other molecules out there. Delovitch: Qing-sheng Mi, a Senior Research Associate in my lab has conducted microarray analyses as he wanted to determine which other cytokines are up- and down-regulated in the NOD.IL10 knockout mice. Our feeling is that IL10 may be up-regulated early during the response of NKT cells. Subsequently, when we come back later and treat with the anti-IL10 receptor antibody, IL10 expression is lower at this time and the e¡ect of the anti-IL10 receptor antibody may be diminished at this time. We don’t have a good handle on this yet, and more experimentation is required. Shevach: There is general agreement that the CD4+CD25+ T cell population has enhanced expression of CCR5. In our hands, CD4+CD25+ T cells actually make MIP1a and MIP1b, at least at the mRNA level. It’s hard to know who is moving around and what you are neutralizing here. Delovitch: We haven’t yet analysed chemokine expression by a puri¢ed population of NKT cells. We plan to address this question by analysing sorted CD1d/a-GalCer tetramer-positive NKT cells. Miller: How late can you start the administration of a-GalCer in the diabetic process? Our experience in experimental autoimmune encephalomyelitis (EAE) is that if it is given early or just after the induction it works well, but if we wait and administer it at the peak of acute disease or after mice enter remission, it doesn’t work at all. Delovitch: The result I showed you involved a-GalCer treatment at 10 weeks of age, i.e. after the development of insulitis but before the onset of diabetes. We have similar results when the treatment was initiated at 15 weeks of age. These data indicate that a-GalCer treatment is e¡ective when begun even after the onset of invasive insulitis. However, similar to the EAE model, it does not work when given at the peak of disease onset. Bach: I’d like to address the question of whether NKT cell de¢ciency has anything to do with the onset of diabetes in the NOD mouse. NOD mice show decreased production of IL4 in comparison to other mouse strains. This is true both in vitro and in vivo. We showed that IL7 very rapidly corrected this defect, in a matter of hours. We have also showed that NOD mice express CD1d at normal levels in the thymus. We hypothesized that there was something wrong with IL7 in the mouse thymus, but we couldn’t prove it. We showed that Va14-Ja281 transgenic NOD mice that over-express NKT cells were partly protected from diabetes, but only in transgenic lines showing clear over-production of IL4. Protection was not perfect but it was protection. The next question was to know whether this was a pharmacological e¡ect of large numbers of NKT cells overproducing IL4 and IL10. We were particularly interested when the CD1d /

162

DISCUSSION

NOD mice became available. This was done in several labs at the same time, and the overall e¡ect is interesting. There is an acceleration of diabetes onset. These mice were given to us by Luc van Kaer, but in his hands there was no acceleration. When the mice came to us in Paris and were decontaminated on a regular basis, they showed acceleration. This shows, in an indirect fashion, that the protective e¡ect of infections on diabetes does not require NKT cells. Intriguingly, we have produced Ja281 knockout NOD mice, and there is no acceleration of diabetes in them. We are facing the data that CD1d knockout mice show accelerated diabetes while Ja281 knockout mice do not. Does this mean that the important cell is not the conventional NKT cell, but rather another related cell that does not use Ja281? This is a hypothesis we have to consider. A recent paper (Mars et al 2002) published in conjunction with our lab using the transgenic mice overexpressing NKT cells, shows that EAE is prevented. CD1d knockout mice do not show accelerated expression of the disease. With regard to a-GalCer, as I mentioned earlier, NOD mice are de¢cient in their number and function of NKT cells. They are also de¢cient in their response to a-GalCer. But a-GalCer acts su⁄ciently well to induce protection against diabetes. In a di¡erent protocol using a smaller amount of material for a shorter time, we did get protection when we gave the product early, but when we gave it later there was no more e¡ect. But in that case, when we administered IL7 plus a-GalCer we did get protection. IL7 by itself is not su⁄cient, but it does seem to sensitize mice to the e¡ect of a-GalCer. It’s a complex situation. Ha£er: I’d like to make a comment about humans with diabetes. We have been cloning cells from pancreatic draining lymph nodes of individuals with type 1 diabetes. So far we have been unable to clone any NKT cells. It looks like these cells may also be de¢cient in diabetic subjects. Banchereau: Can you get them in controls? Ha£er: Yes. Bach: There have been data from Albert Bendelac on the levels of NKT cells in diabetic and pre-diabetic which have not always been convergent. It is a matter of debate. Ha£er: Unfortunately, he is using a CD1d tetramer loaded with a-GalCer and then uses TCR Va24 expression to identify the cells. In our hands, Va24 competes using the same tetramer. He hasn’t done single cell cloning with the a-GalCer tetramer, which I think one has to do using tetramers. He also stimulates ex vivo with ionomycin, which probably yields a very strong stimulation in terms of IL4 and IFNg secretion. Flavell: With regard to the experiment on the Ja281 knockout, one of the potential complications is that this knockout mouse is made on a 129/J background and is then crossed onto the NOD background. Given that there

MECHANISMS OF NKT CELL PROTECTION AGAINST TYPE 1 DIABETES

163

was no increased diabetes, what is the phenotype of the corresponding wild-type mouse that has the same introduced TCR locus from the 129/J to the NOD background? Were you able to analyse that mouse as well? Bach: We have now backcrossed the IL10 knockout mouse onto the NOD background, so the fact that we get diabetes in the backcrossed mice indicates that we have eliminated most of the initial mouse transgenes. Bluestone: How much analysis is done on these strains in terms of the closeness of all these knockouts to Idd loci? Bach: We can’t answer that. The problem is that it is not Idd ‘loci’ but a whole region. It is very di⁄cult to pinpoint the actual Idd loci. On one occasion when we worked on mice which show abnormal NKT cell function, we mapped one of the genes close to the Idd loci, but we could never show that it was the same Idd locus. Delovitch: In our lab, we routinely genotype for about 15 of the Idd loci, to make sure that they are NOD-like. Flavell: We do the same thing, but we can have mice that are completely NOD at all these loci, but with further backcrossing the diabetes incidence still goes up. There are genes that are suppressing diabetes that we haven’t yet mapped. These mapping experiments are done between di¡erent strains and no one has done a systematic one from 129 to see what the loci are. There is a potential problem with unknown Idd loci in 129 mice. Mitchison: I’d like to make a formal statement about a-GalCer, on behalf of investigators who have tried to obtain it from Kirin without success. The ¢eld will only move forward when the agent becomes generally accessible. In the meanwhile, all work that depends on using this molecule should be regarded as unreproducible. Bach: We didn’t have any major di⁄culties getting any. As a historical note, the NOD mice were not available for many years, and they only became available after the editors of the major international immunology journals decided that there would be no more papers published on them unless they were provided to the scienti¢c community. Sercarz: They were brought into the USA illegally! Mitchison: I’d like to mention a molecule that hasn’t come into this discussion yet, CSK. CSK is a down-regulator of Srk family kinase activity. Knockouts for CSK are up-regulated in many di¡erent ways, including lymphocyte migration. A dermatitis gene named Derm1 has been mapped to the CSK region (Kohara et al 2001). That dermatitis seems similar to dermatitis observed in CSK conditional knockouts by my colleague J. Roes. Mowat: Is there any evidence that IL7 is de¢cient in NOD mice? Bach: IL7 is produced in minute amounts. It is produced by the thymic stroma, but we haven’t been able to quantitate it in su⁄ciently precise fashion to answer that important question.

164

DISCUSSION

Shevach: What prompted you to use IL7 in that experiment? Bach: This was because we were studying in a systematic fashion the growth factors for di¡erent T cell subsets. We showed that the best growth factor for the NKT cells was IL7. When thymocytes are grown in the presence of IL7 they are enriched in NKT cells. References Kohara Y, Tanabe K, Matsuoka K et al 2001 A major determinant quantitative-trait locus responsible for atopic dermatitis-like skin lesions in NC/Nga mice is located on Chromosome 9. Immunogenetics 53:15^21 Mars LT, Laloux V, Goude K et al 2002 Cutting edge: V alpha 14-J alpha 281 NKT cells naturally regulate experimental autoimmune encephalomyelitis in nonobese diabetic mice. J Immunol 168:6007^6011

Seven surprises in the TCR-centred regulation of immune responsiveness in an autoimmune system Eli Sercarz, Emanual Maverakis*, Peter van den Elzen*, Loui Madakamutil* and Vipin Kumar Torrey Pines Institute for Molecular Studies, 3550 General Atomics Court, San Diego, CA 92121 and *La Jolla Institute of Allergy and Immunology, 10355 Science Center Drive, San Diego, CA 92121, USA

Abstract. Self-reactivity is potentially so devastating to the organism that a variety of regulatory devices have evolved to control it. One broadly used strategy is that employing the processed T cell receptor (TCR) as a target for TCR-speci¢c regulatory cells. In several autoimmune models, feedback regulation employing both CD4+ and CD8+ T cells of TCR speci¢city can be shown to occur and to account for remission from the transient disease state, or for its prevention. We will focus here on the experimental autoimmune encephalomyelitis (EAE) model in the B10.PL (H-2u) mouse. In this model, the acetylated 1^9 N-terminal antigenic determinant from myelin basic protein (MBP) induces a transient paralytic disease owing to the activation of selfdirected, high-a⁄nity, CD4+ T cells. Although the response is multiclonal, a particularly aggressive member of this repertoire, bearing a Vb8.2,Jb2.7 receptor, which we have termed a ‘driver clone’, appears to be largely responsible for the disease process. A CD4+ T cell directed against a TCR determinant in the framework region of the Vb chain, and a CD8+ T cell directed against an upstream, distinct framework determinant, both of which are necessary for regulation, bring about a reversal of the disease process. To accomplish this, there must be a Th1 milieu during the induction of regulation, which is provided in part by the CD4+ regulatory cells themselves. To act as a target, the Vb8.2 MBP-reactive T cell must be activated, and the Th1 driver clone(s) is down-regulated via apoptotic killing, leaving a group of Th2, MBP-speci¢c clones of weak a⁄nity, which themselves may help in perpetuating long-term regulation. Similar results are also found in the collagen arthritis and NOD diabetes models. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 165^176

Experiments on T cell vaccination were ¢rst performed in Irun Cohen’s laboratory more than 20 years ago (Ben-Nun et al 1981). Their idea was that you might be able to raise immunity to some aspect of the aggressive self-reactive T cell which would then prevent pathogenic, autoimmune manifestations. In fact, the experiments were a great success, and T cell vaccination with a pathogenic arthritis-inducing 165

166

SERCARZ ET AL

rat clone prevented any further possibility of inducing arthritis in that rat. Speci¢city controls included a clone which could induce experimental autoimmune encephalitis (EAE), and the criss-cross experiments worked according to expectation. The rather astounding feature of these experiments was that no other response to the same antigenic peptide could be raised in the vaccinated animal. Such a result suggested immediately that the response to this antigen was restricted, in that other T cells used the same V gene family for their response, and implied that there was an additional regulatory response to a V region product, a T cell receptor (TCR) determinant. However, stepping back for a moment, since these experiments preceded the description of the TCR, a full recognition of the meaning of the results was not possible. A similar conclusion had been reached even earlier by Darcy Wilson in experiments studying the nature of regulation of graft vs. host reactivity (Bellgrau & Wilson 1978). What was necessary was a test of the notion that the downregulatory reactivity could be directed against the T cell receptor. This was provided by Arthur Vandenbark et al (1989), and Howell et al (1989) who immunized with TCR peptides in a rat system and noted clear protection from the attempted induction of disease. There was some ambiguity in this work regarding the nature of the regulatory cell(s). We therefore decided to initiate a thorough analysis of this type of regulatory system in the mouse where much more was known about T cell receptors, genes and signalling, and furthermore, many more reagents were available. Our hope was to de¢ne the cellular components of a feedback circuit which would target the autoaggressive cell. In the B10.PL mouse, the disease-causing antigenic determinant from myelin basic protein (MBP) is at its N-terminus, and is acetylated (¼AcASQKRPSQR). The response to this peptide, or to MBP itself, is highly restricted to the Vb8.2 gene family, and for this reason we prepared long, 30-mer overlapping Vb8.2 peptides of a dominant T cell clone, 172.10, speci¢c for Ac1^9, to be used as potential immunogens. (These peptides, 1^30, 21^50, 41^70, 61^90, and 76^101, from the b chain, were called B1^B5; the a chain peptides were also made and tested, but these results will not be discussed here.) What follows are some of the surprises we encountered in our studies of this system. The ¢rstsurprise, the strong immunogenicity of TCR peptides. Vb8.2-containingTCRs are plentiful within the animal and presumably within the thymus.We therefore were unsure whether any of the Vb-speci¢c T cells had escaped negative selection and would therefore be available in the adult B10.PL mouse. In fact, there was a vigorous proliferative immune response evident upon immunization with peptides B2, B4 or B5! However, when challenge occurred with the Vb chain itself, within a single chain TCR (sc-TCR) construct, only B5 could recall a proliferative response, indicating its immunodominance within the molecule. In

TCR-CENTRED IMMUNE REGULATION

167

accord with this dominance, the B5 peptide also contained a potent regulatory determinant which could itself shut o¡ the response to MBP and prevent any symptom of EAE. The regulatory determinant was contained within the Vb gene-coded, rather than the NDNJ-CDR3, region of the molecule as determined with truncated peptides. Presumably, in a well-regulated system, it would not be reasonable for a non-dominant T cell to be involved, because it might never get engaged to perform its task. In any event, the potent, dominant response to B5 was an early surprise in our quest to understand the system. The second surprise, the spontaneous appearance of CD4 and CD8 regulators. In the previously mentioned studies (Vandenbark et al 1989, Howell et al 1989), theTCR peptides had been used as immunogens in the experiments. But in a system displaying feedback suppression, it would be preferable if the regulatory T cells arose spontaneously without the necessity for priming with the TCR peptides themselves. In one of the key experiments in this 10-year study (Kumar & Sercarz 1993), we showed that the CD4+ T regulatory cell (Treg) appeared in cultures made from spleens of MBP or Ac1^9-injected mice, 30 days but not 10 days after antigenic stimulation. Thus, peptide B5 could elicit a proliferative response in these cultures, but not B2 or B4, which however were themselves immunogenic in vivo when injected as peptides. As will be shown below, when it became clear that both CD4 and CD8 components of the regulatory complex were necessary for control, it was evident that the CD8 suppressive cell, speci¢c for a distinct region of the Vb8.2 TCR, also arose spontaneously following antigen injection. It remained to explore the longevity and the location of each component of the regulatory duo for maintaining homeostasis. Thethird surprise wasthatboth CD4 and CD8 Tcells were necessary foradequate regulation. In several regulatory models (Furtado et al 2001, Sakaguchi et al 2001, Shevach 2002) CD8+ T cells have not been implicated in achieving e¡ector T cell control. Although we have induced protection with either immunogen for CD4+ or CD8+ T cells, we have assumed that the partner cell has been recruited endogenously. The following results a⁄rm that each cell type is required for regulation: CD8 knockout animals cannot regulate; alterations in single chain TCR molecules which either replace required residues in the CD4 determinant, B5, or in the CD8 determinant, 41^50, ablate regulation which can be achieved with the unaltered sc-TCR (Kumar et al 1997); and anti-Vb14 antibody, targeting theVb14 CD4 regulatory cell, converts the acute disease into a chronic one (Kumar et al 1996). The CD4 Tcell produces interferon (IFN)g, interleukin (IL)4 and IL5, but not transforming growth factor (TGF)b or IL10.

168

SERCARZ ET AL

The fourth surprise was that aTh1 environment was necessary for successful regulation. We had asked earlier whether we might have achieved better regulation if the B5-speci¢c cells wereTh2 rather thanTh1. By intranasally instilling B5 together with IL4, the results were devastating in the ¢rst experiment with 5 mice: each of the mice died, EAE being obviously exacerbated in the type 2 milieu thus created. In later experiments, it was shown that B5 plus IL12, again provided intranasally, gave the typical regulatory response of protection (Kumar & Sercarz 1998). This information ¢ts the IFNg cytokine secretion pattern of the Vb14 Treg, as well as the additional fact that IFNg knockout mice also failed to regulate (V. Kumar et al, unpublished data). Whether or not EAE is induced depends critically on the nature of the cytokine polarization pro¢le of the regulatory CD4+ T cells. Protection only resulted when the regulatory CD4+ T cells were in a type 1 milieu. The ¢fth surprise was that the CD4+ regulatory cells also belonged to a public repertoire. The aggressive autoreactive Tcell population in B10.PL EAE is a public one, bearing Vb8.2Jb2.7 receptors, and its expansion in found in each mouse. It was therefore of interest that the CD4+ regulatory Tcells which arose upon the appearance of the public clone were themselves public. No matter how the regulatory cells appeared, whether through immunization with the B5 peptide, or spontaneously after immunization with antigen, each animal produced Treg withVb14Jb1.2 receptors, as well as a scattering of receptors withVb14 and other Jb usage (L. Madakamutil et al, unpublished results). At present, the V gene usage of the CD8+ T suppressor cells is not known, but to date, this T cell circuitry with at least two public clonal members (the CD4+ Vb8.2 Te¡ and the CD4 Vb14 Treg) ¢ts very well into the notion of the immune homunculus, advanced by Irun Cohen (Cohen & Young 1991). It was his prediction that just as certain neural receptors and ligands occupy a more important position in neural circuitry, the same should be true for the immune system. The implication was that there was evolutionary selection for a receptor on the autoreactive cell which could be regulated by T cells, again focused on that same ‘homuncular’ sign, the appropriate peptide-MHC complex, processed from the T cell receptor. The sixth surprise was that the self-reactiveTcells which cause EAE are a very small population with very high a⁄nity receptors. It was known from T hybridoma studies that the response to Ac1^9 was largely restricted to Vb8.2 Tcells. In fact, our recent work has shown that the response speci¢c for Ac1^9, either induced by this peptide itself or by MBP, is very heterogeneous, but that only one or two members of this array of clones that areVb8.2Jb2.7 are responsible for disease causation, and can be termed ‘driver clones’ (Sercarz 2000).The dominant driver clone in this regard is a‘public’

TCR-CENTRED IMMUNE REGULATION

169

one that appears in each B10.PL treated with Ac1-9 or MBP, and has the characteristic CDR3 sequence of DAGGGY.We have studied the dose ^response of this clone and found it to respond to sub-microgram doses of antigen. Likewise, Garcia et al (2001) have examined tetramer binding by this clone and discovered that it was of very high a⁄nity.This perhaps can be attributed to the triple glycine at the point in CDR3 where the ligand is bound, providing a large degree of £exibility, which also should govern the degeneracy of this receptor. In fact, it happens that this TCR is unusually degenerate in its speci¢city, and we have found several unrelated peptides (in their MHC context) that react with it strongly. There is at least one other TCR which is public in this strain’s response to Ac1-9, but DAGGGY can be found in the spinal cord, while the same is not true for DAGSGN (van den Elzen et al 2003). We have shown that even if the Ac1-9 immunogen is given in low doses in IFA, DAGGGY appears in the absence of any sign of paralysis, and then disappears, as a result of exhaustion or of regulation, and the animal is now non-susceptible to autoimmune induction with this same antigen. This result suggests that in the absence of DAGGGY, the BIO.PL mouse is no longer susceptible to EAE from Ac1-9. An implied consequence of the dearth of pathogenic clones is that it may not be necessary to regulate many clones in order to achieve protection: once the dominant clone is down-regulated, it may be unnecessary to think about controlling its recruits. Theseventhsurpriserelatestothecircumstancesthatsurround theapoptosisoftheself-reactiveVb8.2 CD4 T cell. These features of the system were studied by staining transgenic populations of autoreactive T cells with CFSE, followed by their adoptive transfer, in order to determine their fate in recipient syngeneic animals. The recipient mice were treated with B5 peptide or B1 peptide (control) as an inducer of regulation, plus or minus antigen (Ac1-9).We observed that the CFSE-labelled aggressive cells multiplied nicely if, and only if, the speci¢c antigen were given to the recipients. B5-protected mice did not prevent theVb8.2 Tcells from dividing in the presence of antigen, but there was a drastically altered pro¢le of division, with very shallow peaks along the abscissa showing that the cells divided without any accumulation of cells undergoing division; rather they seemed to be drained away from the system. This was one expectation from the experiment: that the target CFSE-labelled cells would be apoptosed by the regulatory CD8+ Tcells in the system. In fact, annexin-Vstaining showed that apoptosis had indeed occurred. Of special interest was that non-antigen stimulated Vb8.2 T cells were not apoptosed, and that in the absence of CD8+ Tcells, likewise, there was no downregulation of the aggressive cells. Thus, to summarize, and in accord with results obtained in following the fate of Vb8.2 T cells after stimulation (van den Elzen et al 2003), there is a vigorous

170

SERCARZ ET AL

expansion of a small subpopulation of pathogenic Vb8.2 T cells with a DAGGGY motif in their CDR3 regions, followed by their demise and disappearance from the spleen and the spinal cord, presumably as targets of CD8 regulatory activity. Only antigen-primed T cells su¡er this fate, and both CD4+ and CD8+ T cells are necessary for the down-regulation to occur. The major population of low avidity T cells producing Th2 cytokines, may itself perform a regulatory function. It is evident that there are many ways for regulatory cells to modulate the immune system. Several regulatory candidates which can act to induce widespread suppression are cytokine-secreting cells (Th3, TR1, et al), NKT and CD4+CD25+ T cells, the latter a major preoccupation of this symposium. It is worthwhile to point out that susceptible individuals will fall prey to a single autoimmune disease at a time, and if the CD4+CD25+ T cell were the chief regulatory device and if it failed, it would be expected that many more autoreactive T cells of di¡ering speci¢cities would be released from regulation. Speci¢c features of the CD4+CD25+ regulators
their speci¢city for antigen, their V gene usage and their mechanism(s) of regulation
are eagerly awaited (of which some features are already known in our TCR-centred system). Actually, we presume that there is a hierarchy of interactive regulators
a few of the generic variety mentioned above, some dedicated to prevention of autoreactive responses, while there are other strategies such as TCR-centred regulation which abrogate self-reactivity after the T cell has been activated, in a feedback manner. Although the system described here is speci¢c for an activated T cell with a particular V region, it can be predicted that regulators speci¢c for a de¢ned CDR3 region might coexist in some cases.

Acknowledgements This work was funded in part by grants from the National Institutes of Health and the National Multiple Sclerosis Society.

References Bellgrau D, Wilson DB 1978 Immunological studies of T-cell receptors. I. Speci¢cally induced resistance to graft-versus-host disease in rats mediated by host T-cell immunity to alloreactive parental T cells. J Exp Med 148:103^114 Ben-Nun A, Wekerle H, Cohen IR 1981 Vaccination against autoimmune encephalomyelitis with T-lymphocyte line cells reactive against myelin basic protein. Nature 292:60^61 Cohen IR, Young DB 1991 Autoimmunity, microbial immunity and the immunological homunculus. Immunol Today 12:105^110 Furtado GC, Olivares-Villagomez D, Curotto de Lafaille MA, Wensky AK, Latkowski JA, Lafaille JJ 2001 Regulatory T cells in spontaneous autoimmune encephalomyelitis. Immunol Rev 182:122^134

TCR-CENTRED IMMUNE REGULATION

171

Garcia KC, Radu CG, Ho J, Ober RJ, Ward ES 2001 Kinetics and thermodynamics of T cell receptor^autoantigen interactions in murine experimental autoimmune encephalomyelitis. Proc Natl Acad Sci USA 98:6818^6823 Howell MD, Winters ST, Olee T, Powell HC, Carlo DJ, Brosto¡ SW 1989 Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides [erratum in Science 247:1167]. Science 246:668^670 Kumar V, Sercarz E 1993 The involvement of TCR-peptide-speci¢c regulator CD4+ T cells in recovery from antigen-induced autoimmune disease. J Exp Med 178:909^916 Kumar V, Sercarz E 1998 Induction or protection from experimental autoimmune encephalomyelitis depends on the cytokine secretion pro¢le of TCR peptide-speci¢c regulatory CD4 T cells. J Immunol 161:6585^6591 Kumar V, Stellrecht K, Sercarz E 1996 Inactivation of T cell receptor peptide-speci¢c CD4 regulatory T cells induces chronic experimental autoimmune encephalomyelitis (EAE). J Exp Med 184:1609^1617 Kumar V, Coulsell E, Ober B, Hubbard G, Sercarz E, Ward ES 1997 Recombinant T cell receptor molecules can prevent and reverse experimental autoimmune encephalomyelitis: dose e¡ects and involvement of both CD4 and CD8 T cells. J Immunol 159:5150^5156 Sakaguchi S, Sakaguchi N, Shimizu J et al 2001 Immunologic tolerance maintained by CD25+ CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol Rev 182:18^32 Sercarz E 2000 Driver clones and determinant spreading. J Autoimmun 14:275^277 Shevach EM 2002 CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389^400 van den Elzen P, Maverakis E, Hu¡man D, Kumar V, Wilson SS, Sercarz EE 2003 A repertoire shift is a key feature in recovery from autoimmunity: loss of driver T cells and maintenance of a benign repertoire. Submitted Vandenbark AA, Hashim G, O¡ner H 1989 Immunization with a synthetic T-cell receptor Vregion peptide protects against experimental autoimmune encephalomyelitis. Nature 341:541^544

DISCUSSION Powrie: Does this mode of regulation work for diseases that are not driven by a dominant Vb8.2 response? Sercarz: We have been exploring two systems. In diabetes and IDDM we have been looking at the Vb4 population, speci¢c for p 530^543, and it is invasive. After the ¢rst three weeks of life, you can ¢nd these transcripts in the islets. We are starting to explore this system in depth. We have also started to examine this in the SJL model. We have detected a number of public clones there. We started out with the SJL hoping that we could understand why remissions occur followed by new expansions. Bach: In the case of diabetes where there is no good evidence for a primary autoantigen, do you ¢nd these dominant clones? Sercarz: Yes, we do ¢nd predominant clones. The Vb4s share many CDR3 amino acid sequences. Miller: Are these clones from the pancreas or are they expanded with GAD in vitro?

172

DISCUSSION

Sercarz: They are found directly in the islets. We have been looking for them in islets. Bach: The point is that in EAE there is an antigen driving the response, but in diabetes there isn’t. Sercarz: We are now trying to use dimers to look at particular speci¢cities of GAD65. Of course, even though many Vb4s share the CDR3 region, they could be of other speci¢cities. Von Herrath: How does the TCR-centred regulation system relate to the Qa1brestricted CD8+ T cells that Harvey Cantor and Leonard Chess have described? Are you postulating that this is a third cell? If I remember correctly, Harvey ¢nds these cells after Vb8 immunization in the NOD model, just as you do. These need IFNg and are restricted by a peptide that binds to the Qa1b molecule. Are these also induced in your system? Sercarz: We don’t know what our CD8+ T cells recognize, or whether it is in the context of the class IA or class IB molecule. The di⁄culty is that 41^50 does not ¢t the motif of Qa1. We have no peptides that ¢t the Qa1 motif. I don’t think that anyone knows whether the Qa1 motif is that restrictive. Their evidence is very strong that Qa1 is involved. Shevach: Why have a CD4+ T cell involved at all? You have an e¡ector cell that recognizes the antigen that makes perfectly good IFNg. It can prime the APC to upregulate its expression of class I and present the TCR-derived peptides to the CD8 killer cells. Sercarz: The driver clone not only is predominant but it also recruits other cells that propagate the response. And then, those CD4+ Treg are needed to control it. If we prevent them from arising, we don’t get regulation. We can take a single-chain TCR and mutate the residues between 83 and 93. These are the ones in B5 that are relevant and we lose protection. We can change the 41^50 in the same single chain TCR, and we also fail to get regulation. Shevach: How about transferring the speci¢c transgenic T cells into a mouse that just has CD8s? Sercarz: That would be a good experiment. Miller: Do you think this is restricted to the Vb8 situation? Sercarz: We hope not! Miller: In the SJL mouse you can deplete CD8 cells and use SJL b2 knockouts, and if you induce EAE with PLP139^151 in these animals they remit quite normally. Sercarz: This is evidence for redundancy in regulatory mechanisms. Mowat: Can you grow out the CD1 cells from animals recovering from disease, and show the CD8 response in normal recovery? Sercarz: Our strategy was to identify the TCR and then look for those cells. We couldn’t look for CD8s in general.

TCR-CENTRED IMMUNE REGULATION

173

Bach: Have you tried di¡erent strains of mice? Do you know anything about the genetic dependency of the various Vb gene usages? Sercarz: No. We have just used the PL/J and B10.PL strains. There are some recombinant inbreds that could be used. Bach: With regard to the role of CD8+ regulatory T cells, do you know any other examples of autoimmune disorders where this is well documented? Sercarz: No. Harrison: If you read the older papers by Harold Weiner and colleagues, before 1991, the oral antigen-induced regulatory cells were CD8s. Sercarz: Were they also producing TGFb? Harrison: Yes, I think so. Miller: Exclusively, but it is my understanding that the CD8+ nature of these regulatory cells was not reproducible in the hands of others. Bluestone: There’s recent human work by Suciu-Foca and the regulatory cells in her system are CD8+ (Liu et al 2001). Roncarolo: She says that these cells work through the DCs, by up-regulating ILT3 and 4, and that these are the negative signals that induce the CD4+ Treg cells. This is her working hypothesis. Harrison: Eli Sercarz, you said that your cells didn’t express TGFb. Sercarz: This work was actually done by Janet Thorbecke who could not ¢nd TGFb in Vipin Kumar’s CD4+ Treg clones. Harrison: Other people have shown that during the remission phase of EAE that there are protective cells that express TGFb. Miller: You are referring to the work by Karpus & Swanborg (1991) in recovery from EAE in the Lewis rat induced by immunization with MBP68^88. These were CD4+ T cells that produced TGFb, but not CD8. These cells were TCR speci¢c. Bach: In the recovery phase of EAE weren’t there data initially with CD4+ cells that they could transfer the protection? Sercarz: The CD4+ cells can transfer the protection, but those experiments should have been done in CD8 knockouts; otherwise, the CD4+ cells could recruit CD8s. Mitchison: What about driver clones in MS? The original Immunoscope group in Paris validated the procedure in MS, but I don’t remember what they found. Sercarz: They found a heterogeneous assortment of apparently private clones. Cuturi: I wanted to comment on the Immunoscope analysis, which we also used to do in Nantes. The limit of the Immunoscope is that it is only a qualitative analysis. When there is a peak you can say that there is an expansion, but only in relation to the other peaks. It could be also that the other peaks are going up. Sercarz: When there is a dominant peak, 10 times higher than all others, and when later it disappears, there is no question about the result.

174

DISCUSSION

Cuturi: In Nantes, we applied quantitative PCR for speci¢c Vbs. Then we could say for sure whether the peak had gone down or come up. Bluestone: If I understood what you were saying in general, for the most part you think that the mechanism controlling the driver clones is deletional. In this case, I’m interested in what you think the therapeutic opportunity is in patients with long-term multiple remitting disease, or progressive diabetes or rheumatoid arthritis. Can you envisage a way that a deletional mechanism like this can work in a situation of epitope spreading? Sercarz: In any epitope spread, it is of regulatory advantage to get there early. It might be that we could treat prediabetic patients, for example, once the driver clone was identi¢ed. In the SJL system, experiments by Kuchroo showed that in the SJL, there were ¢ve di¡erent hybridoma Vbs out of the six that they analysed (Kuchroo et al 1994). They thought it therefore hopeless to look for a driver clone or a public clone. Nevertheless, when we looked for the public clones, we found them. They used the hybridoma method, which I don’t think is the best way to study this. Bluestone: In Steve Miller’s system, with the SJL relapsing/remitting, by the second relapse the original initiating ‘driver’ clone, which is something that would respond to PLP139, is not playing a major role in the relapse. If you tolerize to another epitope, 178, this prevents relapse but the original 139 has no e¡ect. At least in this model, once you get through one relapse it has spread out beyond the original epitope. Sercarz: This suggests to me that an e⁄cient regulator arises during the remission, which is a hopeful sign for future therapies. Bluestone: The question is whether these TCR peptides are going to get you into that system. For the last day or so we have been discussing suppressor systems that are by default non-speci¢c, or at least broadly reactive. What you talked about is a case in which there is clear deletion, so it doesn’t spread beyond the speci¢city of the initial clone. From a therapeutic perspective, considering that there is increasing interest in using TCR receptor peptides as immunotherapeutics, how do you imagine that they are likely to work? Would you have to do some sort of pan T cell depletion ¢rst? Sercarz: We would have to do some sampling, to ¢nd out what the driver clone is. We have used the strategy of looking for a public clone in the spinal cord, and we ¢nd an intense collection. As we have shown, these disappear. It might be di⁄cult to ¢nd the right time in a patient. I would hope that one could detect these clones early on after the very ¢rst symptoms that one ¢nds in MS. This may be transient. In the B10.PL mouse there is a transient symptomology. Steve, in the case of the SJL, do the predominant p139^151 clones really disappear? Miller: They don’t appear to contribute to the progression of the disease, but they have not disappeared. You can always take the spleens from these mice,

TCR-CENTRED IMMUNE REGULATION

175

re-stimulate with the initiating peptide in culture, and transfer disease to a new na|« ve recipient. However, in the animal from which these are derived, before the in vitro expansion these cells don’t appear to be contributing to the disease. They are therefore under some sort of regulation and they have not been deleted. I don’t know what sort of regulation this is. That is an important question. Sercarz: It should be explored. Mitchison: If we could change the course of history, and your work had been completed 20 years ago, no one would ever have tried to make a CD8+ TCR transgenic mouse, because we would have expected the transgenic cells to be wiped out in the periphery by regulators. How do you account for the success in making TCR transgenics? Sercarz: In our EAE system, the target cell is CD4+. In the TCR transgenes made by Lafaille and Tonegawa in their beautiful experiments (Lafaille et al 1994), they got spontaneous EAE as long as the mouse was also RAG negative. But if they were RAG+ (adding as few as 2% of all the rest of the T cells) only 15% of the animals ever acquired the disease and EAE came on very late. Mitchison: The typical TCR transgenic mouse has a few endogenous TCRrearranged cells, so why aren’t the transgenic cells wiped out? Sercarz: Some of them do get wiped out through regulation. In many cases, the animal does not contract a spontaneous disease. Von Herrath: Not necessarily. It seems that they have to ¢rst be needed. They have to die, be taken up and an immune response is then made to this TCR peptide. Bluestone: It’s a huge percentage of thymocytes that die by apoptosis at the TCR double-positive stage. What Av Mitchison is saying has been an on-going theoretical challenge: the T cell receptor peptides themselves will both expand and restrict the repertoire by precisely these kinds of mechanisms. Mitchison: I think it has something to do with immunological tolerance of the transgenic TCRs. Sercarz: There are 20% Vb8.2 T cells in the thymus, and yet we don’t get tolerance among the regulatory populations. Bach: To come back to Je¡ Bluestone’s question about therapy, one must admit that the evidence for private clones in human diseases is not strong. Even in the socalled ‘pre-diabetics’ they have had an immunological disease for quite a few years. Perhaps it is too late. If you don’t get some kind of bystander suppression it will be di⁄cult to use this as a therapeutic strategy. Sercarz: As we get better at de¢ning the preconditions, this could change. Bach: In the case of diabetes people look from birth. They ¢nd signs of islet reactivity as early as a few months of age. One wonders whether this epitope spreading also starts early on. This would make it di⁄cult to have a speci¢c action.

176

DISCUSSION

References Karpus WJ, Swanborg RH 1991 Protection against experimental autoimmune encephalomyelitis requires both CD4+ T suppressor cells and myelin basic protein-primed B cells. J Neuroimmunol 33:173^177 Kuchroo VK, Collins M, al-Sabbagh A et al 1994 T cell receptor (TCR) usage determines disease susceptibility in experimental autoimmune encephalomyelitis: studies with TCR Vb8.2 transgenic mice. J Exp Med 179:1659^1664 Lafaille JJ, Nagashima K, Katsuki M, Tonegawa S 1994 High incidence of spontaneous autoimmune encephalomyelitis in immunode¢cient anti-myelin basic protein T cell receptor transgenic mice. Cell 78:399^408 Liu Z, Yu B, Fan J, Cortesini R, Suciu-Foca N 2001 CD8+CD28
T cells suppress alloresponse of CD4+ T cells both in primates and rodents. Transplant Proc 33:82^83

Regulatory cells in transplantation Kathryn J. Wood*{, Hidetake Ushigome{, Mahzuz Karim*, Andrew Bushell*, Shohei Hori{ and Shimon Sakaguchi{ *Nu⁄eld Department of Surgery, University of Oxford, John Radcli¡e Hospital, Oxford OX3 9DU, UK and {Department of Experimental Pathology, Institute for Frontier Medical Sciences, Kyoto University, Sakyo-ku, Kyoto 606-8507, Japan

Abstract. Regulatory T cells can play an important role in both the induction and maintenance of tolerance to donor alloantigens in vivo. Regulatory activity speci¢c for donor alloantingens is enriched amongst CD4+CD25+ T cells in some settings and can be induced by manipulating the immune system before transplantation. Donor alloantigen-speci¢c CD4+CD25+ regulatory T cells can control aggressive CD4+ as well as CD8+ T cells thereby preventing rejection and can mediate linked unresponsiveness. In vivo, donor alloantigen speci¢c CD4+CD25+ cells are dependent on interleukin (IL)10 and CTLA4 for functional activity. These populations of regulatory cells induced by manipulating the adult immune system therefore have properties in common with naturally occurring regulatory T cells. The active regulation/suppression of immune responsiveness to donor alloantigens o¡ers a way to silence aggressive immune responses directed to donor alloantigens thereby preventing damage to the graft from being in£icted. The generation of regulatory T cells with de¢ned alloantigen speci¢city could provide dynamic control of rejection responses and o¡ers a potential route to permanent graft survival without the need for life-long non-speci¢c immunosuppression. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 177^193

Tolerance to donor alloantigens is most likely a dynamic process that changes in character as the immune system continues to be exposed and respond to donor antigens in vivo. Controlling the balance between the aggressive and regulatory T cells may be a very e¡ective way not only to prevent graft rejection but also for inducing and maintaining speci¢c unresponsiveness to a de¢ned set of donor alloantigens in vivo. Immune regulation does not necessarily have to operate independently of other mechanisms that can facilitate tolerance to donor alloantigens, especially deletion of high avidity donor reactive T cells. Rather regulatory T cells may function in concert with other mechanisms depending on the microenvironment that exists in vivo at each stage of the response. The precise combination of mechanisms in operation at any one time will depend upon the manipulations that have been used to modulate immune responsiveness as well as the source and character of the persisting donor alloantigen. 177

178

WOOD ET AL

The success of clinical transplantation in the long term continues to be limited by the ongoing need for non-speci¢c immunosuppressive therapy in the majority of transplant patients. Although continuous drug therapy reduces the risk of graft rejection it also brings with it unwanted e¡ects such as increased susceptibility to infection and malignancy, and most importantly it does not appear to facilitate the development of immunological tolerance to the graft. Antigen recognition and delivery of at least some signals to the responding cell appears to be a pre-requisite for unresponsiveness to subsequent antigen stimulation. Therefore, the mechanism of action of the majority of immunosuppressive drugs, that is inhibition of T cell activation, may be suboptimal for the induction of tolerance to donor alloantigens as they are currently used clinically. Over many years an increasing number of immune manipulations have been shown to induce operational tolerance to alloantigens in vivo through a regulatory/suppressor mechanism. These include a short course of non-speci¢c immunosuppression at the time of transplantation (Homan et al 1979, Hall et al 1985), alloantigen delivery alone (Fabre & Morris 1972, Wood et al 1985), or in combination with agents that either deplete (Wood & Monaco 1980, Pearson et al 1992, Qin et al 1993, Bushell et al 1995) or block the function of accessory, adhesion or co-stimulatory molecules expressed by peripheral leukocytes at the time of alloantigen recognition (Lin et al 1993, Parker et al 1995, Saitovitch et al 1996a). The existence of lymphocyte populations that regulate/suppress antigen speci¢c immune responses were ¢rst described and shown to be present in mice made tolerant of a skin graft over thirty years ago (Gershon & Kondo 1970, Kilshaw et al 1975). However, only recently have the phenotypic and functional characteristics of the cells responsible for transplantation tolerance been characterised in detail. The majority of alloantigen speci¢c regulatory T cells identi¢ed to date lie within the CD4+ population and will be the focus here. Other T cell subsets, including CD8+, CD8+CD28
, and TCR+CD4
CD8
(‘double negative’) populations have also been shown to contain cells with regulatory capacity but will not be discussed further here. Immunoregulation of graft rejection by donor alloantigen-speci¢c CD45RBlowCD4+CD25+ T cells Donor-speci¢c blood transfusion when combined with depleting or non-depleting anti-CD4 antibody can induce operational tolerance to both donor major histocompatibility complex (MHC) and minor histocompatibility antigens in vivo (Pearson et al 1992, Saitovitch et al 1996a). Immunoregulatory activity within the CD4+ T cells could be detected in vivo in both the induction and maintenance phases of the response and was shown to be responsible for tolerance induction (Bushell

REGULATORY CELLS IN TRANSPLANTATION

179

et al 1995) (M. Niimi & K.J. Wood, unpublished data). In contrast, using the same cell populations it was more challenging to demonstrate similar regulation in vitro (Roelen et al 1998). Indeed, assays capable of detecting the functional activity of alloantigen speci¢c regulatory cells reliably in vitro have been di⁄cult to develop (Young et al 1997). For the most-part when T cells from tolerant recipients are cultured in vitro they proliferate normally in response to donor alloantigens and produce Th1 cytokines in a manner indistinguishable from that of na|« ve T cells; responses that are clearly not an accurate re£ection of their functional activity in vivo (Mohler & Streilein 1989). We therefore proposed that the inability to detect regulation in vitro was due to functional heterogeneity amongst donor alloantigen speci¢c T cells and that the conditions in the cultures favoured aggressive rather than regulatory cells that are known to proliferate only slowly. This hypothesis was based upon data from studies investigating the important regulatory interactions that occur amongst T cells to control responsiveness to self antigens in vivo (Morrissey et al 1993, Powrie et al 1993, Sakaguchi et al 1995, Suri-Payer et al 1998). In the maintenance phase of operational tolerance to alloantigens in vivo, i.e. in mice with long-term surviving allografts, clear evidence for functional heterogeneity in the response of CD4+ T cells in the periphery to donor alloantigens was obtained (Hara et al 2001). Alloantigen speci¢c regulatory T cells were contained within the CD45RBlow and CD4+CD25+ populations, while no regulatory activity could be detected in CD45RBhigh or CD4+CD25
cells present in mice with long-term surviving cardiac allografts (Hara et al 2001) (Fig. 1). In addition to the regulatory activity being contained in the CD45RBlow, CD4+CD25+ T cells, donor alloantigen-speci¢c CD4+CD25+ regulatory T cells exhibited some of the functional properties previously described for the naturally occurring regulatory populations in vivo, including the a dependency on interleukin (IL)10 for functional activity (Hara et al 2001), suggesting that naturally occurring regulatory cells and those generated following immune manipulation have some features in common. Of major interest, from the perspective of using regulatory mechanisms to improve graft outcome, is determining whether regulatory T cell populations speci¢c for donor MHC antigens can be induced/expanded by manipulating the host T cells either in vivo or ex vivo before transplantation. Administration of an allogeneic blood transfusion (C57BL/10;H-2b) in combination with a nondepleting anti-CD4 monoclonal (YTS 177) to adult CBA.CA (H-2k) mice was found to enable detection of CD4+CD25+ T cells with regulatory activity speci¢c for the alloantigens of the blood donor (H-2b) 28 days later; the time at which transplantation of a cardiac allograft from the blood donor would have resulted in long term graft survival (Kingsley et al 2002). In contrast, under the same conditions, regulatory T cells capable of preventing the rejection of a fully

180

WOOD ET AL

FIG. 1. Evidence that CD4+CD25+ T cells present in the maintenance phase of tolerance to donor alloantigens can prevent rejection initiated by CD4+CD45RBhigh T cells from na|« ve mice. Survival of B10 skin grafts transplanted onto T cell depleted CBA mice reconstituted with 5105 CD4+CD45RBhigh cells puri¢ed from na|« ve mice either alone (dotted line) (n ¼ 7) or together with either 5105 CD4+CD25+ cells (dashed line) (n ¼ 6) or 5105 CD4+CD25
cells (solid line) (n ¼ 4) from CBA mice with long-term surviving C57BL/10 cardiac allografts.

allogeneic, C57BL/10 graft in vivo could not be detected in CBA mice that had received either a blood transfusion or anti-CD4 treatment alone, nor in na|« ve CBA mice (Kingsley et al 2002). These data suggested that manipulation of na|« ve adult mice with donor alloantigen and anti-CD4 therapy could result in the induction and/or expansion of regulatory T cells speci¢c for MHC antigens in vivo before transplantation. The alloantigen speci¢city of the regulatory T cells generated by manipulating the immune system is of critical importance to ensure that immune responsiveness in the recipient is not inhibited non-speci¢cally. To address this question, we treated na|« ve CBA mice with BALB/c (H-2d) blood transfusion in combination with anti-CD4 therapy. CD4+CD25+ cells puri¢ed from the manipulated mice 28 days later were not able to prevent the rejection of a C57BL/10 (H-2b) graft (Kingsley et al 2002). These ¢ndings con¢rmed that the immunoregulatory activity that develops after a single infusion of donor alloantigen in combination with anti-CD4 is immunologically speci¢c.

REGULATORY CELLS IN TRANSPLANTATION

181

CD4+CD25+ regulatory T cells can mediate linked unresponsiveness Linked unresponsiveness is a powerful mechanism that can potentially be used to great advantage in the setting of transplantation. A number of years ago we showed that it was not necessary to pretreat recipients with the full complement of donor MHC antigens to induce speci¢c unresponsiveness to a vascularized cardiac allograft providing the graft expressed at least one of the antigens used in the pretreatment inoculum (Madsen et al 1988). Thus intravenous infusion of recipient cells expressing a single allogeneic class I molecule that was subsequently present on the allograft was su⁄cient to induce prolonged graft survival and when the cells were combined with a T cell modulating such as antiCD4 or anti-CD154 operational tolerance to the donor alloantigens developed (Saitovitch et al 1996b, Wong et al 1997). Linked unresponsiveness can operate both in the induction of speci¢c unresponsiveness as above as well as the maintenance phase of unresponsiveness (Davies et al 1996). To investigate if regulatory T cells were responsible for the development of linked unresponsiveness in vivo, adult CBA mice were treated with cells expressing a single allogeneic class I molecule (H-2Kb) in combination with anti-CD4 therapy. 28 days later CD4+CD25+ T cells were puri¢ed from the spleen and cotransferred with CD4+CD45RBhigh cells from na|« ve mice that when transferred alone have the capacity to trigger rejection of a B10 skin graft. The CD4+CD25+ cells from mice pretreatment with H-2Kb were able to prevent rejection of the B10 skin grafts, expressing not only H-2Kb but the other major and minor histocompatibility antigens of the B10 haplotype (M. Karim, A.R. Bushell and K.J. Wood, unpublished data). These data suggest that regulatory T cells are responsible for linked unresponsiveness in vivo (Fig. 2). Moreover, these ¢ndings also support the idea that CD4+CD25+ regulatory T cells recognise and respond to donor alloantigens as an allopeptide presented by a recipient antigen presenting cell, the indirect pathway of allorecognition (Hara et al 2001).

CD4+CD25+ regulatory T cells can prevent graft rejection by CD8+ T cells In some donor^recipient combinations CD8+ T cells play a key role in graft destruction at both the initiation and e¡ector phases of the response. Both donor and recipient factors (Van Maurik et al 2002a), as well as the strategy used to modulate the immune response contribute to determining the precise nature of the involvement of CD8+ cells in the rejection response (Honey et al 1999, Trambley et al 1999, Jones et al 2000). For regulatory T cells to be an important mechanism for inducing tolerance to donor alloantigens they must not only be able to inhibit the rejection of grafts mediated by CD4+ T cells, as in the co-transfer system used above (Hara et al

182

WOOD ET AL

FIG. 2. CD4+CD25+ donor alloantigen speci¢c T cells recognize donor antigen as an allopeptide presented by recipient antigen presenting cells, indirect allorecognition and can regulate the response of na|« ve direct pathway CD4+ and CD8+ T cells.

2001, Kingsley et al 2002), but they must also be capable of preventing rejection triggered by CD8+ T cells. We have shown previously that CD8+ T cells from a T cell receptor (TCR) transgenic mouse, BM3, can reject skin grafts that express H-2Kb (Jones et al 2001); as few as 1000 BM3 transgenic T cells when transferred to a T-cell-de¢cient host were su⁄cient. To determine whether CD4+CD25+ cells with immunoregulatory activity for B10 alloantigens were able to regulate the response of CD8+ T cells in vivo, we puri¢ed CD4+CD25+ cells from mice with long-term surviving B10 allografts and co-transferred them with BM3 CD8+ T cells one day before transplantation of a B10 skin graft. CD4+CD25+ regulatory T cells were able to prevent rejection by CD8+ cells, demonstrating that these cells can exert very powerful control of alloantigen driven immune responses in vivo (Van Maurik et al 2002b). Origin of donor alloantigen-speci¢c regulatory CD4+CD25+ T cells The origin of CD4+CD25+ T cells speci¢c for donor alloantigens is an important question. Are they induced only following manipulation including exposure to donor alloantigens or do they pre-exist in either the thymus or the periphery? Prior exposure to donor alloantigens exposure was found to be required for the detection of alloantigen speci¢c immunoregulatory activity within CD4+CD25+

REGULATORY CELLS IN TRANSPLANTATION

183

T cells when the donor and recipient were mismatched for major as well as minor histocompatibility antigens; immunoregulatory activity speci¢c for donor alloantigens could not be detected in na|« ve mice (Hara et al 2001, Kingsley et al 2002). We cannot rule out that CD4+CD25+ immunoregulatory T cells speci¢c for major histocompatibility antigens exist in na|« ve unmanipulated recipients, however, the frequency of this population of cells is below the threshold of detection in the assay systems used to date. CD4+CD25+ T cells from na|« ve animals have been shown to prevent the rejection of grafts mismatched for minor histocompatibility antigens (Graca et al 2002) but many more CD4+CD25+ cells from na|« ve mice were required to mediate the same level of suppression (Graca et al 2002), suggesting that a low frequency of CD4+CD25+ cells that are either speci¢c for or cross-react with minor histocompatibility antigens are present in na|« ve mice. The frequency of cells reactive with MHC antigens in na|« ve mice may therefore be even lower that the number reactive with minor histocompatibility antigens, making the regulatory activity very di⁄cult to detect. Alternatively, detection of regulatory activity speci¢c for MHC antigens may require pre-exposure to alloantigen. One could argue that regulatory T cells present in na|« ve mice that can prevent the onset of autoimmune disease may have been exposed to the relevant self antigens during development of the immune system. The origin of alloantigen-speci¢c regulatory cells clearly needs further investigation. We and others have shown that operational tolerance to donor alloantigens, both MHC and minor antigens, can be induced in adult mice in the absence of the thymus, suggesting that the thymus is not essential for either the expansion of this population, if they pre-exist in the periphery, or for their generation if they do not (Cobbold et al 1990, Niimi et al 1998).

Role of cytokines and CTLA4 in the function of CD4+CD25+ alloantigen-speci¢c regulatory T cells in vivo The role of cytokines and CTLA4 in the functional activity of regulatory T cells is controversial with con£icting data being reported in in vivo and in vitro systems. For the donor alloantigen-speci¢c CD4+CD25+ T cells that play a role in both the induction of maintenance of unresponsiveness to donor alloantigens after exposure to donor alloantigen in combination with a T cell modulating agent, neutralization of IL10 (Hara et al 2001) or blockade of its utilization by targeting IL10R (Kingsley et al 2002) regulatory activity was abrogated when the cells were adoptively transferred to immunode¢cient hosts invivo (Fig. 2). Neutralizing IL4 did not have a similar e¡ect. In other transplant models TGFb has also been shown to play a role in immunoregulation after alloantigen pretreatment (Josien et al 1998).

184

WOOD ET AL

CD4+CD25+ cells present in mice tolerant of donor alloantigens express high levels of CTLA4 (CD152), as has been observed for regulatory populations that can control responses to self antigens (Read et al 2000, Takahashi et al 2000). Blockade of CTLA4 at the time of adoptive transfer of CD4+CD25+ cells speci¢c for donor MHC antigens abrogates their ability to prevent rejection, suggesting that regulatory activity in vivo is dependent at some level on CTLA4 (Kingsley et al 2002). In contrast, the regulatory activity present in spleen cells containing CD4+CD25+ present in mice that had accepted a skin graft mismatched for minor histocompatibility antigens after administration of non-depleting anti-CD4 and anti-CD8 monoclonal antibodies, was not abrogated by anti-IL10, anti-IL4 or anti-CTLA4 (Graca et al 2002). Thus the precise conditions that prevail in vivo at the site where the regulatory cells reside and/or function may determine the dependency on di¡erent mediators for regulatory activity.

Impact of GITR ligation on allograft survival in vivo CD4+CD25+ regulatory T cells in normal mice have recently been shown to express high levels of glucocorticoid-induced tumour necrosis factor receptorrelated gene (GITR or TNFRSF18) without antigen stimulation (McHugh et al 2002, Shimizu et al 2002). Stimulation of regulatory cells through GITR inhibits their suppressive activity in vitro (McHugh et al 2002, Shimizu et al 2002) and breaks immunological self tolerance in vivo (Shimizu et al 2002). CD4+CD25
T cells are induced to express GITR after activation (and its function in this setting was originally described as inhibiting T cell receptormediated apoptosis). Thus stimulation through GITR may have a di¡erential e¡ect depending on the functional activity of the population of CD4+ cells expressing the molecule as well as the context in which ligation of GITR takes place; inhibition of immunoregulation by CD4+CD25+ T cells and sustained activity of CD4+CD25
T cells. To test the hypothesis that GITR ligation would inhibit the activity of established donor alloantigen speci¢c regulatory T cells responsible for maintaining operational tolerance to donor alloantigens in vivo, we treated mice with long term surviving cardiac allografts (median survival time [MST] 4100 days) with either DTA1, an agonist antibody speci¢c for GITR (Shimizu et al 2002) or control rat Ig at weekly intervals for 4 weeks. Previously we had shown that donor alloantigen speci¢c CD4+CD25+ regulatory T cells were present and responsible for controlling immune responsiveness to donor alloantigens in long-term surviving mice (Hara et al 2001). In both DTA1 and control Ig-treated long-term survivors, graft survival was not a¡ected (n ¼4 per group; A. Bushell, H. Ushigome, S. Sakaguchi and K.J. Wood, unpublished data). Thus ligation of

REGULATORY CELLS IN TRANSPLANTATION

185

TABLE 1 GITR ligation at the time of donor speci¢c blood transfusion (C57BL/6) induces accelerated rejection of C57BL/6 cardiac allografts in BALB/c recipients

Group

Number of mice

Median graft survival Graft survival (days) (days)

Untreated DST day-7 1 mg DTA1 day 8+DST day 7 1 mg control rat Ig day 8+DST day 7

6 6 6

6, 7, 7, 8, 8, 8 9, 9, 9, 10, 10, 10 3, 4, 4, 4, 5, 5

7.5 9.5 4

6

8, 9, 9, 10, 10, 10

9.5

GITR in the maintenance phase of tolerance to donor alloantigens was not able to break operational tolerance in vivo. Next, the impact of GITR ligation on the induction phase of unresponsiveness was investigated, as here one might expect that GITR ligation could potentially either inhibit the ability of regulatory T cells to prevent graft rejection and/or sustain the activity of aggressive T cells that trigger and mediate graft destruction. Donor speci¢c transfusion 7 days before transplantation can lead to graft prolongation as mentioned above (Peugh et al 1988). When BALB/c (H-2d) mice received a donor speci¢c blood transfusion (250 ml C57BL/6 [H-2b]) 7 days before transplantation of a C57BL/6 heart graft, graft survival was prolonged (MST 9.5 days versus 7.5 days in transfused versus untreated mice respectively (n ¼6 per group) (H. Ushigome, K.J. Wood and S. Sakuguchi, unpublished data) (Table 1). In contrast, when BALB/c mice were treated with a single dose of DTA1 (1 mg) the day before transfusion graft rejection was accelerated signi¢cantly (MST 4 days versus 9.5 days, DTA1-treated versus control rat Ig treated mice respectively, n ¼6 per group) (H. Ushigome, K.J. Wood and S. Sakuguchi, unpublished data). The molecular mechanisms responsible for this accelerated response are currently under investigation. These data suggest that GITR ligation can markedly augment immune responsiveness in vivo and therefore may have utility as a therapeutic approach in settings such as vaccination or tumour immunotherapy. Conclusions E¡ective and selective control of immune reactivity to donor alloantigens is a prerequisite for the induction of transplantation tolerance that results in rejection-free, long-term graft survival in the absence of non-speci¢c immunosuppression. The

186

WOOD ET AL

active regulation/suppression of immune responsiveness to donor alloantigens o¡ers an e¡ective way to silence aggressive immune responses directed to donor alloantigens thereby preventing damage to the graft from being in£icted. Characterization of the phenotype and function of regulatory T cells is facilitating the development of novel strategies for the induction of speci¢c unresponsiveness to donor alloantigens after transplantation.

Acknowledgements The work of the authors was supported by The Wellcome Trust, National Kidney Research Foundation, Roche Organ Transplant Research Foundation and Japanese Ministry of Education, Science, Sports and Culture.

References Bushell AR, Morris PJ, Wood KJ 1995 Transplantation tolerance induced by antigen pretreatment and depleting anti-CD4 antibody depends on CD4+ T cell regulation during the induction phase of the response. Eur J Immunol 25:2643^2649 Cobbold SP, Martin G, Waldmann H 1990 The induction of skin graft tolerance in MHCmismatched or primed recipients: primed T cells can be tolerized in the periphery with antiCD4 and anti-CD8 antibodies. Eur J Immunol 20:2747^2755 Davies JD, Leong LY, Mellor A, Cobbold SP, Waldmann H 1996 T cell suppression in transplantation tolerance through linked recognition. J Immunol 156:3602^3607 Fabre JW, Morris PJ 1972 The mechanism of speci¢c immunosuppression of renal allograft rejection by donor strain blood. Transplantation 14:634^640 Gershon R, Kondo K 1970 Cell interactions in the induction of tolerance: the role of thymic lymphocytes. Immunology 18:723^737 Graca L, Thompson S, Lin C-Y, Adams E, Cobbold SP, Waldmann H 2002 Both CD4+CD25+ and CD4+CD25
regulatory cells mediate dominant transplantation tolerance. J Immunol 168:5558^5565 Hall BM, Jelbart ME, Gurley KE, Dorsch SE 1985 Speci¢c unresponsiveness in rats with prolonged cardiac allograft survival after treatment with cyclosporine. Mediation of speci¢c suppression by T helper/inducer cells. J Exp Med 162:1683^1694 Hara M, Kingsley C, Niimi M et al 2001 IL-10 is required for regulatory T cells to mediate tolerance to alloantigens in vivo. J Immunol 166:3789^3796 Homan WP, Fabre JW, Morris PJ 1979 Nature of the unresponsiveness induced by cyclosporin A in rats bearing renal allografts. Transplantation 28:439^441 Honey K, Cobbold SP, Waldmann H 1999 CD40 ligand blockade induces CD4+T cell tolerance and linked suppression. J Immunol 163:4805^4010 Jones ND, van Maurik A, Hara M et al 2000 CD40-CD40 ligand-independent activation of CD8+ T cells can trigger allograft rejection. J Immunol 165:1111^1118 Jones ND, Turvey SE, Van Maurik A et al 2001 Di¡erential susceptibility of heart, skin and islet allografts to T cell mediated rejection. J Immunol 166:2824^2830 Josien R, Douillard P, Guillot C et al 1998 A critical role for transforming growth factor beta in donor transfusion induced allograft tolerance. J Clinical Invest 102:1920^1926 Kilshaw P, Brent L, Pinto M 1975 Suppressor T cells in mice made unresponsive to skin allografts. Nature 255:489^491

REGULATORY CELLS IN TRANSPLANTATION

187

Kingsley CI, Karim M, Bushell AR, Wood KJ 2002 CD25+CD4+ Regulatory T cells prevent graft rejection: CTLA-4- and IL-10-dependent immunoregulation of alloresponses. J Immunol 168:1080^1086 Lin H, Bolling SF, Linsley PS et al 1993 Long-term acceptance of major histocompatibility complex mismatched cardiac allografts induced by CTLA4Ig plus donor-speci¢c transfusion. J Exp Med 178:1801^1806 Madsen JC, Superina RA, Wood KJ, Morris PJ 1988 Immunological unresponsiveness induced by recipient cells transfected with donor MHC genes. Nature 332:161^164 McHugh RS, Whitters MJ, Piccirillo C et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Mohler KM, Streilein JW 1989 Lymphokine production by MLR-reactive reaction lymphocytes obtained from normal mice and mice rendered tolerant of class II MHC antigens. Transplantation 47:625^633 Morrissey PJ, Charrier K, Braddy S, Liggitt D, Watson JD 1993 CD4+ T cells that express high levels of CD45RB induce wasting disease when transferred into congenic sever combined immunode¢cient mice. Disease development is prevented by co-transfer of CD4+ T cells. J Exp Med 178:273^244 Niimi M, Pearson TC, Larsen CP et al 1998 The role of the CD40 pathway in alloantigen induced hyporesponsiveness in vivo. J Immunol 161:5331^5337 Nocentini G, Giunchi L, Ronchetti S et al 1997 A new member of the tumor necrosis factor/ nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci USA 94:6216^6221 Parker DC, Greiner DL, Phillips NE et al 1995 Survival of mouse pancreatic islet allografts in recipients treated with allogeneic small lymphocytes and antibody to CD40 ligand. Proc Natl Acad Sci USA 92:9560^9564 Pearson TC, Madsen JC, Larsen CP, Morris PJ, Wood KJ 1992 Induction of transplantation tolerance in the adult using donor antigen and anti-CD4 monoclonal antibody. Transplantation 54:475^483 Peugh WN, Wood KJ, Morris PJ 1988 Genetic aspects of the blood transfusion e¡ect. Transplantation 46:438^443 Powrie F, Leach MW, Mauze S, Caddle LB, Co¡man RL 1993 Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal in£ammation in CB-17 scid mice. Int Immunol 5:1461^1471 Qin S, Cobbold SP, Pope H et al 1993 ‘‘Infectious’’ transplantation tolerance. Science 259: 974^977 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Roelen DL, Bushell AR, Niimi M et al 1998 Immunoregulation by CD4+ T cells in the induction of speci¢c immunological unresponsiveness to alloantigens in vivo: evidence for a reduction in the frequency of alloantigen speci¢c cytotoxic T cells. Hum Immunol 59:529^539 Saitovitch D, Bushell AR, Morris PJ, Wood KJ 1996a Kinetics of induction of transplantation tolerance with a nondepleting anti-CD4 monoclonal antibody and donor-speci¢c transfusion before transplantation. A critical period of time is required for the development of immunological unresponsiveness. Transplantation 61:1642^1647 Saitovitch D, Morris PJ, Wood KJ 1996b Recipient cells expressing single donor MHC locus products can substitute for donor-speci¢c transfusions in the induction of transplantation tolerance when pretreatment is combined with anti-CD4 monoclonal antibody: evidence for a vital role of CD4+ T cells in the induction of tolerance to class I molecules. Transplantation 61:1532^1538

188

DISCUSSION

Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self tolerance maintained by activated T cells expressing IL-2 receptor alpha chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3: 135^142 Suri-Payer E, Amar AZ, Thornton AM, Shevach EM 1998 CD4+CD25+ T cells inhibit both the induction and e¡ector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212^1218 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance is maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte associated antigen 4. J Exp Med 192:303^310 Trambley J, Bingaman AW, Lin A et al 1999 Asialo GM1+ CD8+ T cells play a critical role in costimulation blockade-resistant allograft rejection. J Clin Invest 104:1715^1722 Van Maurik A, Wood KJ, Jones N 2002a Impact of both donor and recipient strains on cardiac allograft survival following blockade of the CD40-CD154 costimulatory pathway. Transplantation 74:740^743 Van Maurik A, Wood KJ, Jones N 2002b Cutting edge:CD25+CD4+ alloantigen speci¢c regulatory T cells that can prevent CD8+ T cell mediated graft rejection: implication for anti-CD154 immunotherapy. J Immunol 169: 5401^5404. Wong W, Morris PJ, Wood KJ 1997 Pretransplant administration of a single donor class I MHC molecule is su⁄cient for the inde¢nite survival of fully allogeneic cardiac allografts: evidence for linked epitope suppression. Transplantation 63:1490^1494 Wood ML, Monaco AP 1980 Suppressor cells in speci¢c unresponsiveness to skin allografts in ALS-treated, marrow-injected mice. Transplantation 29:196^200 Wood KJ, Evins J, Morris PJ 1985 Suppression of renal allograft rejection in the rat by class I antigens on puri¢ed erythrocytes. Transplantation 39:56^62 Young N, Roelen D, Iggo N et al 1997 E¡ect of one-HLA-haplotype-matched and HLAmismatched blood transfusions on recipient T lymphocyte allorepertoires. Transplantation 63:1160^1165

DISCUSSION Harrison: How do you know that the expansion of the e¡ector cells isn’t due to the suppression of the suppressors? Wood: I don’t. All I can say is that we have functional data that indicate that e¡ector cells are present in numbers that will give an accelerated rejection response. We are currently sorting cells and carrying out adoptive transfer studies to assess their potency. Miller: Which donor population do you use to induce tolerance? What works best? Wood: There is a minimum dose of donor antigen needed to induce unresponsiveness. When excess antigen is given, however, tolerance is sometimes lost, so there is a window in terms of antigen dosing that is e¡ective in this system. In terms of which cells are most e¡ective, this is an interesting issue. Data from Joren Madsen published in 1988 showed that if we took

REGULATORY CELLS IN TRANSPLANTATION

189

recipient ¢broblasts and transfected into them a donor MHC class I gene, this population of recipient cells expressing a single donor MHC class I antigen was able to induce speci¢c unresponsiveness (Madsen et al 1988). However, recent unpublished data of ours show that immature recipient-derived dendritic cells transduced with the donor class 1 molecule, on a per cell basis, are the most e¡ective population we have identi¢ed to date. However, I don’t think the source of cell is an absolute driver. Roncarolo: How general is this? Can you also induce it with other antigens? Wood: We haven’t looked at this, but it has implications for how this system might work in a clinical setting. Bluestone: I have a question about the anti-GITR studies. I am trying to ¢gure out what you thought was going to happen. Do you think this antibody is cross-linking Fc receptor in vivo, or is it blocking the GITR^ GITR ligand interaction? Wood: I’ll leave Shimon Sakaguchi to answer this because it is his antibody. Sakaguchi: The blockade had no e¡ect at least in vitro, as Fab fragments of antiGITR were unable to abrogate the suppression. Extending this to in vivo, we think that anti-GITR antibody may cross-link the GITR molecules on CD4+CD25+ T cells and thereby transduce a signal that can attenuate their suppressive activity. Bluestone: So your thought is that it cross-links and then it activates. If this is the case, you should be able to see, in the in vivo setting, evidence for changes in the CD25+ population under those conditions. They should expand. Wood: The CD25+ Vb6 cells do increase in number. But so far we haven’t looked at the functional capacity of these cells on a per cell basis; this is in progress. Bluestone: In your simple transplant model where you reduced rejection from 7.5 to 4 days, if you do the exact same thing and treat with PC61, what happens? Wood: We haven’t done this. Bluestone: I thought you concluded that this was evidence that the antibody was acting on the e¡ectors. Wood: From the accelerated rejection, this would be the most straightforward interpretation. The antibody may not be acting on the e¡ectors themselves, to go back to Len’s question, but may alter the way in which the e¡ectors are generated, for example by inhibiting the function of regulatory cells. I think GITR ligation could be doing things on both sides of the equation; we need to go further and dissect the di¡erent elements in details. Bluestone: I think you would get the same results if you deleted the CD25+ cells before you inject the antigen: there would be an accelerated response. Shevach: Is there any evidence that your e¡ector cells actually express GITR? You are putting this in very early, and most of the CD25
cells are GITR negative. Most of the CD25+ cells are GITR positive.

190

DISCUSSION

Wood: In a FACS analysis we have used a panel of antibodies to determine what is happening to the antigen reactive leukocytes over the ¢rst 14 days after treatment. This shows that there is activation of cells in the system. However, I agree that we haven’t teased this out completely yet. Shevach: Why aren’t your cells Treg1 cells as characterized by Dr Roncarolo? Do you know whether these CD25+ cells you take out of the graft derive from the naturally occurring CD25+ pool? Wood: I don’t know the relationship between these two populations. Both populations can exist; we have not addressed this in our experimental system so far. Roncarolo: They are two separate populations, but we haven’t worked out whether there is a relationship between them. Powrie: But you can certainly have Treg1 cells within a CD25+ population. Roncarolo: This does occur. It is possible to drive the di¡erentiation of Treg1 cells from the CD25+ population, but we always interpret this as the Treg1 cells deriving from the cells that are not real suppressor cells. Shevach: What is the di¡erence between your model and what Herman Waldmann recently published (Graca et al 2002) where IL10 played no role at all? Wood: Herman’s skin graft model is a minor-antigen-mismatch-only system where antibody therapy is given from the time of transplantation. Also, he uses thymectomized recipients in most cases. He doesn’t use antigen in the pretreatment approach as I have described here. There are similarities as well as di¡erences between the two models. Bach: In Herman’s model there is evidence for infectious tolerance. Do you have any evidence for this? Wood: We have some evidence that these cells do propagate their activity, but we haven’t studied this extensively. Roncarolo: Related to that, when you say that there is linked unresponsiveness, if you immunize these mice with an antigen how do they respond? Wood: We have been doing these experiments looking at responses to in£uenza virus. The long-term survivors and the mice that receive the adoptively transferred CD25+ cells make very good responses to £u in vitro. We feel that alloantigen pretreatment in the presence of anti-CD4 generates speci¢c regulatory activity. Banchereau: I am confused. You put in an anti-CD4 antibody, and the Treg cells are CD4+. So what is happening? Wood: That’s an important question. If we use a depleting antibody and give very high doses of anti-CD4 we don’t get regulation. Regulation only occurs when the dose of depleting antibody is selected to give a residual population of CD4+ cells. Clearly, in a depletion system there needs to be a residual population of CD4s in the system. However, importantly, when we use the non-depleting antibody we can also induce regulatory cells. We have data to suggest that there

REGULATORY CELLS IN TRANSPLANTATION

191

is a signalling defect in the cells that encounter antigen in the presence of the antibody that impacts on the functional activity of those cells. Mitchison: Have you seen a bigger e¡ect with anti-CD4 monoclonal antibodies directed against a membrane-proximal domain? Wood: Our antibodies are directed towards the more external domains. Mitchison: Our group found that monoclonal antibodies directed at the proximal domains of CD4 are the most e¡ective in modulating Th1/Th2 balance (Gimsa et al 1999). Wood: We have compared four antibodies extensively: YTA 3.1, YTS 177, GK1.5 and KT6. They are all e¡ective in this system but there are subtle parameters that are di¡erent between the non-depleting antibodies (YTS 177 and KT6). Bach: Can you speculate on the mode of action of the non-depleting anti-CD4 antibodies? Wood: The data we have suggest that there is an e¡ect on LAT. We are seeing a defect in the signal transduction through the receptor in the presence of the antiCD4, such that we are getting a changed environment intracellularly in the CD4+ cells. Mowat: Do you think then that you are driving di¡erentiation of CD4+CD25+ regulatory cells because of that signalling defect? Or are you blocking low^ medium a⁄nity T cells and allowing higher a⁄nity cells to outgrow these? Wood: We don’t have data that address that question. Bluestone: It is interesting that the bivalent anti-CD3 antibody prevents good raft formation. Anti-CD4 also prevents good raft formation. In this setting there appears to be suboptimal phosphorylation of LAT among other things, because Fyn is actually serving as the kinase as opposed to LCK. This leads to downstream changes in signal transduction such that the T cells give a very di¡erent pro¢le of cytokines. I would argue that what is going on here is actually cell autonomous, and not di¡erential population expansion. Wood: This sounds similar to our data, but we can’t pin it down precisely. Abbas: Are those changes that you see in all the T cells or only a small fraction? Wood: The signalling studies have been done using CD4+ cells from mice pretreated with anti-CD4 and donor alloantigen restimulated in vitro with antiCD3. This has made life di⁄cult. As far as we can tell the changes that we are seeing are within the population we are analysing. Abbas: If it is a LAT phosphorylation defect it could get swamped out by all the normals. Mowat: In the MLS system, where you are looking at Vb6 expansion, in these kinds of models these were one of the ¢rst systems in which peripheral tolerance was looked at. The surviving cells are quite often unresponsive in this system. Are these CD4+CD25+ cells that survive Vb6s after you give MLS disparate cells to the normal animal? If so, does the anti-GITR prevent that?

192

DISCUSSION

Wood: The data that I showed indicated that both the Vb6 CD25+ and CD25
populations the cells were expanded in vivo. They were persisting for longer at higher levels in the mice that received the DTA1. We haven’t yet dissected out the speci¢c functions. Shevach: a French group showed that it is the CD25+ cells that survive MLS challenge in vivo and the anti-GITR treatment may reverse this survival advantage (Papiernik et al 1998). Flavell: Is there any evidence against the concept that all anergic CD4+ cells would do this? In other words, if you generate anergy by all the protocols available, do you end up with a cell that suppresses? Wood: No, not in vivo. Shevach: Robert Lechler (Lombardi et al 1994) would probably say yes, both with human and mouse T cell clones, that have been anergized. Wood: As far as I am aware, in vivo he has only demonstrated this in an experimental system where donor and recipient are mismatched for a single antigen. We have generated anergic T cells responding to donor MHC antigens in vitro using a similar system and showed that they can suppress in vitro but so far we have failed to demonstrate suppression in vivo when we adoptively transfer the anergic cells. Shevach: They believe that these cells work through the APC by preventing APC di¡erentiation (Vendetti et al 2000). Abbas: But if you take T cells after aqueous peptide-induced tolerance in a T cell receptor transgenic, they will not suppress the response of normal T cells. Mowat: If you do the same experiment with antigen-induced tolerance, you can anergize DO11.10 cells in an adoptive transfer system, but they will not suppress in vitro. Abbas: But at least in two systems the antigen-speci¢c tolerant cells are not suppressed. They are also not stably CD25high clones. Wood: We have anergized in vitro, both clones and na|« ve T cells, but when we put them in vivo they don’t function as regulatory cells in our model. Shevach: Shimon Sakaguchi, have you actually shown that the antibody does protect against apoptosis? Sakaguchi: We haven’t done that. Shevach: The only evidence for this seems to be an overexpression experiment by putting the GITR into a T cell hybridoma resulting in protection from apoptosis induced by plate-bound anti-CD3 (Nocentini et al 1997). Neither ligand nor antibody to the GITR were used in these studies. Wood: There’s also a recent paper using GITR knockouts. Shevach: The phenotype of the animals was not very striking, They had a modestly enhanced proliferative response to polyclonal T cell activation stimuli (Ronchetti et al 2002).

REGULATORY CELLS IN TRANSPLANTATION

193

References Gimsa U, Mitchison A, Allen R 1999 Inhibitors of Src-family tyrosine kinases favour Th2 di¡erentiation. Cytokine 11:208^215 Graca L, Thompson S, Lin C-Y, Adams E, Cobbold SP, Waldmann H 2002 Both CD4+CD25+ and CD4+CD25
regulatory cells mediate dominant transplantation tolerance. J Immunol 168:5558^5565 Lombardi G, Sidhu S, Batchelor R, Lechler R 1994 Anergic T cells as suppressor cells in vitro. Science 264:1587^1589 Madsen JC, Superina RA, Wood KJ, Morris PJ 1988 Immunological unresponsiveness induced by recipient cells transfected with donor MHC genes. Nature 332:161^164 Nocentini G, Giunchi L, Ronchetti S et al 1997 A new member of the tumor necrosis factor nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci USA 94:6216^6221 Papiernik M, de Moraes ML, Pontoux C, Vasseur F, Penit C 1998 Regulatory CD4+ T cells: expression of IL-2Ra chain, resistance to clonal deletion and IL-2 dependency. Int Immunol 10:371^378 Ronchetti S, Nocentini G, Riccardi C, Pandol¢ PP 2002 Role of GITR in activation response of T lymphocytes. Blood 100:350^352 Vendetti S, Chai J-G, Dyson J, Simpson E, Lombardi G, Lechler R 2000 Anergic T cells inhibit the antigen-presenting function of dendritic cells. J Immunol 165:1175^1181

CD4+ regulatory T cells in chronic viral infection Kim J. Hasenkrug Laboratory of Persistent Viral Diseases, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, MT 59840, USA

Abstract. Regulatory T lymphocytes play a central role in maintaining an immunological balance between responsiveness to foreign antigens and suppression of responsiveness to self-antigens. We recently discovered that infection of mice with Friend retrovirus skewed the balance toward suppression by causing an expansion of immunosuppressive regulatory cells. Immunosuppression was transferable to na|« ve mice by adoptive transfer of CD4+ T cells. Our current studies examine the in vivo role of CD4+ regulatory T lymphocytes in controlling normal immune responses and investigate ways to prevent or reverse immunosuppression by these cells. Regulatory cells have now been implicated as factors in the establishment and/or maintenance of persistence in human infections with parasites, Bordetella pertussis, hepatitis C virus, and HIV. Thus ¢ndings from the Friend virus mouse model may provide insights into new therapies or preventive strategies against persistent pathogens. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 194^202

Regulatory T cells are essential for the maintenance of immunological homeostasis and the prevention of autoimmune diseases (Mason & Powrie 1998, Sakaguchi 2000, Shevach 2002). They maintain tolerance to self antigens by downregulating immune responses through various mechanisms including cell^cell contact (Nakamura et al 2001) and secretion of immunosuppressive cytokines such as interleukin (IL)10 (Asseman et al 1999, Hara et al 2001, Trinchieri 2001) and transforming growth factor (TFG)b (Chen et al 1998, Powrie et al 1996, Prud’homme & Piccirillo 2000). Regulatory T cells appear to exert their e¡ects directly on T cells (Piccirillo & Shevach 2001), but they may also act indirectly through e¡ects on antigen presenting cells such as dendritic cells (DCs) (Taams et al 1998). At least two types of CD4+ regulatory T cells exist, but their relationship is not well understood. Tr1 cells secrete high levels of IL10 which down-regulate expression of MHC class II, tumour necrosis factor (TNF)a, and B7 costimulatory molecules on DCs. Th3 cells predominantly secrete TGFb (Shevach 2002) which has immunosuppressive e¡ects on B cells, T cells and also 194

VIRAL INFECTION

195

macrophages. The determination of how these di¡erent types of cells arise and function during homeostasis, infection, and autoimmune disease is of high interest and extreme importance. Regulatory T cells are also likely involved in the down-regulation of immune responses to infectious agents following the resolution of acute diseases. Given the extraordinary diversity of mechanisms that viruses and other infectious agents have evolved to evade destruction by the immune system (Xu et al 2001), it should come as no surprise that various microorganisms have targeted the suppressive nature of regulatory T cells as a window of escape. A general immunological principle is that constant environments tend to be tolerated, whereas changing environments elicit reactions (Tanchot et al 2001). Thus an acute infection typically stimulates a strong immune response, but if a microorganism can evade complete eradication and establish itself in a niche where it doesn’t elicit in£ammatory responses, the immune system may adapt to it as if it were self. How does a microorganism go from eliciting stimulatory signals to tolerizing ones? While this is an open question, one can envision possible scenarios that can then be experimentally tested. Often an immune response to an acute infection is initiated by the binding of infectious agents to pattern recognition receptors such as Toll-like receptors on DCs. Binding to Toll-like receptors then stimulates the DCs to mature and migrate to secondary lymphoid organs such as the nodes. DC maturation can also be stimulated by pro-in£ammatory cytokines released by virus-infected cells. The maturation of DCs is key to the induction of immune responses because it induces high expression of MHC class I and class II molecules for cognate recognition by antigen-speci¢c T cells. Possibly even more important is that maturation induces high expression of costimulatory molecules such as B7 that can bind to CD28 to deliver the necessary second signals for T cell activation. By contrast, immature DCs provide suboptimal or negative signals that tend to tolerize rather than activate antigen-speci¢c T cells (Jonuleit et al 2000, Roncarolo et al 2001, Shortman & Heath 2001, Steinman & Nussenzweig 2002). Recognition of immature DCs by T cells usually occurs in a quiescent microenvironment, where T cells that recognize self-antigens have the potential to generate severe immunopathological damage if they were to become stimulated. Co-stimulation of T cells through CD152 (CTLA4) when B7 levels are low (immature DCs) rather than through CD28 when B7 levels are high (mature DCs) may be an important factor in maintaining a suppressive rather than an e¡ector state (Chen et al 1998, Read et al 2000, Takahashi et al 2000). Thus a possible mechanism that pathogens might utilize to establish persistence is a transition from antigen presentation predominantly by mature DCs to presentation predominantly by immature DCs.

196

HASENKRUG

The consequences of chronic infections can range from an asymptomatic carrier state to severe pathology and death. Immunosuppression from drugs to prevent transplant rejection or to treat cancer, or virus-induced immunosuppression can exacerbate chronic infections and cause death. Thus the immune system exerts control over chronic infections even though it cannot eliminate them. Recent ¢ndings suggest that the induction of partial tolerance through regulatory T cells may be a popular mechanism by which chronic microorganisms escape immunological destruction. For example, T cells derived from tuberculosis patients who were anergic to TB antigens in vivo and in vitro predominantly made the Treg1-type cytokine IL10 (Boussiotis et al 2000). Another pathogen with a propensity for chronicity is Borrelia burgdorferi, the causative agent of Lyme disease. A high percentage of T cell lines from Lyme disease patients also displayed a Treg1 phenotype in a recent study (Pohl-Koppe et al 1998). IL10 also appears to be involved in the chronicity of Schistosomiasis mansoni (Montenegro et al 1999), Schistosomiasis haematobia (Remoue et al 2001), and possibly in human immunode¢ciency virus infections as well (Ostrowski et al 2001). In another human study Th3/Treg1 cells were associated with hyporesponsiveness to a helminth infection (Doetze et al 2000). The induction of regulatory cells also appears to be involved in immunological escape by Bordetella pertussis (McGuirk et al 2002) and hepatitis C viruses in humans (MacDonald et al 2002). In a mouse model for leishmaniasis, treatment with anti-IL10 receptor antibodies allowed sterile cure of infection suggesting a possible therapy to prevent chronic infection (Belkaid et al 2001). We have used mouse infection with Friend leukaemia virus to study mechanisms of chronicity (Hasenkrug et al 1998, Iwashiro et al 2001a, Iwashiro et al 2001b). Recently we found that mice persistently infected with Friend virus developed approximately twice the normal percentage of splenic CD4+ regulatory T cells although their total numbers of CD4+ T cells was not altered. The regulatory cells were characterized by cell surface expression of CD69, CD25 and/or CD38 activation markers (Read et al 1998). Associated with the rise in regulatory T cells was a generalized immunosuppression characterized by weak allogeneic mixed lymphocyte responses in vitro, and loss of the ability to reject certain tumour transplants in vivo. In vitro studies showed that suppression of the mixed lymphocyte reactions was attributable to CD4+ T cells and could be partially reversed by blocking CTLA4 or TGFb but not IL10. We found that CD4+ T cells co-expressing the CD69 early activation marker were immunosuppressive in vitro regardless of whether they were obtained from persistently infected mice or na|« ve mice. This indicates that these cells may be active in normal uninfected mice. The CD4+ regulatory cells from persistently infected mice inhibited blast formation and proliferation of CD8+ T cells in mixed lymphocyte cultures and decreased levels of CTL activity. Immunosuppression in vivo was also mediated

VIRAL INFECTION

197

by CD4+ T cells acting on CD8+ T cells. Normal na|« ve mice typically reject transplants of Friend virus-induced FBL3 tumours within 3 weeks after transplantation. Rejection of FBL3 is a CD8+ T cell-dependent mechanism. However, like persistently infected mice, na|« ve mice adoptively transferred with CD4+ T cells obtained from persistently infected mice could not reject FBL3 tumours. Adoptive transfer of CD8+ T cells obtained from persistently infected mice did not a¡ect the ability of na|« ve mice to reject their tumours. Recently we administered antibodies in vivo to block immunosuppressive molecules and/or receptors during the ¢rst week of Friend virus infection. We then analysed CD4+ T cell subsets at 8 weeks post infection to look for e¡ects on levels of regulatory T cells. Blocking TGFb or IL10R dramatically reduced the levels of splenic CD4+ T cells expressing C25 and/or CD38 at 8 weeks post infection with Friend virus. Blocking CTLA4 had only a minor e¡ect. Thus, the Friend virus-induced expansion of these cells appeared dependent on TGFb and IL10. Treated and control groups of mice were challenged with FBL3 tumours, and we found improved anti-tumour responses in the treated mice indicating a reduction in Friend virus-induced immunosuppression. These ¢ndings provide further evidence that Friend virus-induced immunosuppression is at least partly due to expanded numbers of regulatory T cells and demonstrate a feasible treatment approach that is very short in duration but which has long-term e¡ects.

References Asseman C, Mauze S, Leach MW, Co¡man RL, Powrie F 1999 An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal in£ammation. J Exp Med 190:995^1004 Belkaid Y, Ho¡mann KF, Mendez S et al 2001 The role of interleukin (IL)-10 in the persistence of Leishmania major in the skin after healing and the therapeutic potential of anti-IL-10 receptor antibody for sterile cure. J Exp Med 194:1497^1506 Boussiotis VA, Tsai EY, Yunis EJ et al 2000 IL-10-producing T cells suppress immune responses in anergic tuberculosis patients. J Clin Invest 105:1317^1325 Chen W, Jin W, Wahl SM 1998 Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4+ T cells. J Exp Med 188:1849^1857 Doetze A, Satoguina J, Burchard G et al 2000 Antigen-speci¢c cellular hyporesponsiveness in a chronic human helminth infection is mediated by T(h)3/T(r)1-type cytokines IL-10 and transforming growth factor-beta but not by a T(h)1 to T(h)2 shift. Int Immunol 12:623^630 Hara M, Kingsley CI, Niimi M et al 2001 IL-10 is required for regulatory T cells to mediate tolerance to alloantigens in vivo. J Immunol 166:3789^3796 Hasenkrug KJ, Brooks DM, Dittmer U 1998 Critical role for CD4+ T cells in controlling retrovirus replication and spread in persistently infected mice. J Virol 72:6559^6564 Iwashiro M, Messer RJ, Peterson KE, Stromnes IM, Sugie T, Hasenkrug KJ 2001a Immunosuppression by CD4+ regulatory T cells induced by chronic retroviral infection. Proc Natl Acad Sci USA 98:9226^9230

198

HASENKRUG

Iwashiro M, Peterson K, Messer RJ, Stromnes IM, Hasenkrug KJ 2001b CD4+ T cells and gamma interferon in the long-term control of persistent friend retrovirus infection. J Virol 75:52^60 Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH 2000 Induction of interleukin 10producing, nonproliferating CD4+ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 192:1213^1222 MacDonald AJ, Du¡y M, Brady MT et al 2002 CD4 T helper type 1 and regulatory T cells induced against the same epitopes on the core protein in hepatitis C virus-infected persons. J Infect Dis 185:720^727 Mason D, Powrie F 1998 Control of immune pathology by regulatory T cells. Curr Opin Immunol 10:649^655 McGuirk P, McCann C, Mills KH 2002 Pathogen-speci¢c T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 195:221^231 Montenegro SM, Miranda P, Mahanty S et al 1999 Cytokine production in acute versus chronic human Schistosomiasis mansoni: the cross-regulatory role of interferon-gamma and interleukin- 10 in the responses of peripheral blood mononuclear cells and splenocytes to parasite antigens. J Infect Dis 179:1502^1514 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor beta. J Exp Med 194:629^644 Ostrowski MA, Gu JX, Kovacs C, Freedman J, Luscher MA, MacDonald KS 2001 Quantitative and qualitative assessment of human immunode¢ciency virus type 1 (HIV-1)-speci¢c CD4+ T cell immunity to gag in HIV-1-infected individuals with di¡erential disease progression: reciprocal interferon-gamma and interleukin-10 responses. J Infect Dis 184:1268^1278 Piccirillo CA, Shevach EM 2001 Cutting edge: control of CD8+ T cell activation by CD4+CD25+ immunoregulatory cells. J Immunol 167:1137^1140 Pohl-Koppe A, Balashov KE, Steere AC, Logigian EL, Ha£er DA 1998 Identi¢cation of a T cell subset capable of both IFN-gamma and IL-10 secretion in patients with chronic Borrelia burgdorferi infection. J Immunol 160:1804^1810 Powrie F, Carlino J, Leach MW, Mauze S, Co¡man RL 1996 A critical role for transforming growth factor-beta but not interleukin 4 in the suppression of T helper type 1-mediated colitis by CD45RBlow CD4+ T cells. J Exp Med 183:2669^2674 Prud’homme GJ, Piccirillo CA 2000 The inhibitory e¡ects of transforming growth factor-beta-1 (TGF-beta1) in autoimmune diseases. J Autoimmun 14:23^42 Read S, Mauze S, Asseman C, Bean A, Co¡man R, Powrie F 1998 CD38+ CD45RBlowCD4+ T cells: a population of T cells with immune regulatory activities in vitro. Eur J Immunol 28:3435^3447 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Remoue F, To Van D, Schacht AM et al 2001 Gender-dependent speci¢c immune response during chronic human Schistosomiasis haematobia. Clin Exp Immunol 124:62^68 Roncarolo MG, Levings MK, Traversari C 2001 Di¡erentiation of T regulatory cells by immature dendritic cells. J Exp Med 193:F5^F9 Sakaguchi S 2000 Regulatory T cells: key controllers of immunologic self-tolerance. Cell 101:455^458 Shevach EM 2002 CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389^400

VIRAL INFECTION

199

Shortman K, Heath WR 2001 Immunity or tolerance? That is the question for dendritic cells. Nat Immunol 2:988^989 Steinman RM, Nussenzweig MC 2002 Avoiding horror autotoxicus: the importance of dendritic cells in peripheral T cell tolerance. Proc Natl Acad Sci USA 99:351^358 Taams LS, van Rensen AJ, Poelen MC et al 1998 Anergic T cells actively suppress T cell responses via the antigen-presenting cell. Eur J Immunol 28:2902^2912 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310 Tanchot C, Barber DL, Chiodetti L, Schwartz RH 2001 Adaptive tolerance of CD4+ T cells in vivo: multiple thresholds in response to a constant level of antigen presentation. J Immunol 167:2030^2039 Trinchieri G 2001 Regulatory role of T cells producing both interferon gamma and interleukin 10 in persistent infection. J Exp Med 194:F53^F57 Xu XN, Screaton GR, McMichael AJ 2001 Virus infections: escape, resistance, and counterattack. Immunity 15:867^870

DISCUSSION Roncarolo: Are you saying that the Treg cells are preventing complete clearance of the virus? Hasenkrug: It is possible. In a number of persistent infections, such as tuberculosis, there is a predominance of cells that look like Treg-type cells, making either IL10 or IFNg plus IL10. What I have done is gone back in the literature and tried to ¢nd these types of cells, and they are there. It may be that organisms are utilizing this regulatory response to hide from the immune system. It is not surprising that they would do that. Roncarolo: You are right: there are many examples, such as human hepatitis C, in which we see these IL10-producing cells in patients with chronic infections. But no one has really compared these patients with those who have complete clearance of the virus. Hasenkrug: The recent Kingston Mills paper (MacDonald et al 2002) actually did that. The patients with persistent infections were the ones that were making CD4+ cells producing IL10. Roncarolo: Was I mistaken, or did you also show that the CD69+ cells from the uninfected mice inhibited mixed lymphoctye responses? Hasenkrug: That is what we found several times. It looks as if the cells that are normally active in these animals are cells not responding to infections, but cells down-regulating immune responses. This is my interpretation of these data. It is a very small subset: CD69+ ranged from 5^15%. This population just about doubles after persistent infection. Mitchison: Do you plan to investigate the e¡ect in infection with simian immunode¢ciency virus (SIV)?

200

DISCUSSION

Hasenkrug: We have to do a lot more work to establish the basic concepts of whether these cells are really involved. Certainly, it looks like in SIV and also HIV that they might be. Mario Ostrowski published a recent paper showing that in HIV patients that were doing poorly, they had a predominance of CD4 cells that were making IL10 (Ostrowski et al 2002). We know that HIV patients have a lot of IL10. Asseman: I’d like to describe some recent data. We have tried to induce regulatory cells speci¢c for non-self antigens, generated from naive or primed precursors in the periphery. We have taken two approaches. In the ¢rst, we start from na|« ve precursors and generate regulatory cells in vitro. In the second, we start from in vivo primed precursors. We decided to use LCMV antigens as a source of non-self antigens as we work with an LCMV-induced diabetes model in the laboratory. Therefore if we obtain any LCMV-speci¢c regulatory cells, they could be used in this model. The second reason is that it is unknown whether regulatory cells can be generated during a normal immune response, as opposed to naturally occurring regulatory cells. Infection with the Armstrong strain of LCMV in immunocompetent mice induced an expansion of speci¢c T cells, leading to virus clearance. After clearance, the pool of activated cells is dramatically reduced. These are mostly activated CD8+ cells, and they are mainly cleared by apoptosis. From 4 weeks post-infection, remaining virus-speci¢c cells are mainly CD4+ and CD8+ memory cells and there is no ongoing infection or immune response. We used CD25+ and CD25 cells only from the CD45RBlow population which is a subset of antigen-experienced cells. It is known that CD25 cells are mainly e¡ector cells. Four to six weeks post-infection, if we isolate CD25 cells and activate them for four days with LCMV-pulsed APCs, they do respond and proliferate. If we do the same with the CD25+ population, they do not respond. This shows that at this stage of infection, the CD25expressing cells are anergic. However they are not regulatory; when mixed at a ratio of two CD25 to one CD25+ cell, there is no or poor inhibition of proliferation. Our interpretation is that there is no LCMV-speci¢c regulatory cell generated following infection or that a four-day stimulation is not enough to trigger regulatory cells. Therefore we used a three-week stimulation approach with LCMV-pulsed APCs in the presence of IL2. The ¢rst observation was that the CD25+ cells never really expanded. The ¢rst week of stimulation of the CD25 population led to some expansion, but after two weeks, cells were no longer proliferating. The way we tested the generation of regulatory cells was to take the cells after four weeks of culture, add them to CD4+ or CD8+ cells from memory mice and activate with LCMV-pulsed APCs in the absence of IL2 for four days. CD4+ cells from LCMV-infected mice respond well to stimulation with LCMV-pulsed APCs. When they are mixed with cultured CD25+ cells, the expansion is greatly reduced. We observe the same results with CD8+ cells from

VIRAL INFECTION

201

memory mice. They respond to LCMV-pulsed APC stimulation, and when they are mixed with CD25+ cells, proliferation is reduced. Interestingly, we observe the same regulatory activity with cultured CD25 cells. We have done the same experiments with cells isolated from na|« ve mice that have not been primed with LCMV. After culture, CD25+ cells but not CD25 cells could inhibit proliferation of CD4+ cells from memory mice. Cultured CD25+ cells could also regulate proliferation of memory CD8+ cells, while in contrast cultured CD25 cells had a helper-like activity and increased proliferation. We then studied whether cultured cells isolated from memory mice could have an e¡ect in vivo. We gave a single injection of cultured CD25+ or CD25 cells to mice which had been infected with LCMV two weeks previously. Four weeks after injection, splenocytes were recovered, stained with CFSE and stimulated in vitro with LCMV-pulsed APCs. We observed that both CD8+ and CD4+ cells have reduced ability to divide upon secondary stimulation when they were isolated from mice that had received either CD25+ or CD25 cells. What do this cultured population of cells look like? After two to three weeks of culture, they are still mainly CD4+. Interestingly, although these two populations are regulatory, at least at this ratio of 2:1, they do not express the same level of CD25. Cultured CD25+ cells are expressing higher levels of CD25 than cultured CD25 cells. We looked at CD122 expression, but could not detect any, so we don’t know if high expression of CD25 means high expression of functional IL2 receptor. Powrie: If you try freshly isolated CD25+ cells that have not been cultured, do they work in this system? Asseman: No, they don’t. Bluestone: The important thing here is the antigen-speci¢city issue. There are two ways one could test this. One is to culture the cells without the LCMV for three weeks. The other is to test their ability to work on cells from a di¡erent virus. Asseman: We haven’t done either yet. Bluestone: How much do these cells expand over the three weeks? Asseman: They don’t expand at all. After the ¢rst week of culture they have expanded a little but then they stay at the same level. Abbas: If there are contaminating e¡ector cells in that population, is it possible that these e¡ector cells are dying out? Asseman: Yes, with this chronic stimulation I would think so. Shevach: In vitro priming of mouse T cells to any kind of antigen has been a very di⁄cult task over the years. In general when people have attempted to do these experiments, what one gets are fetal calf serum (FCS)-speci¢c cells. Asseman: This is a possibility, however the fact that CD25 cells from na|« ve mice do not develop into regulatory cells seems to indicate that we do potentiate LCMVspeci¢c regulatory cells following activation with LCMV-pulsed APCs, and not FCS-speci¢c cells.

202

DISCUSSION

Shevach: There are all kinds of controls you have to do to rule this out. Asseman: In vivo we used a single injection of cultured cells and the e¡ect was there. Shevach: I’d be hesitant to say what you have, on the basis of what you have shown in vitro. In fact, if you could activate a CD25+ cell with FCS or self antigens in the presence of IL2, it would have non-speci¢c suppressor activity. In fact, these cells would suppress everything, including LCMV. One important experiment you need to do is to show that CD25+ T cells from primed mice speci¢cally proliferate when stimulated with LCMV-infected APCs and IL2. References MacDonald AJ, Du¡y M, Brady MT et al 2002 CD4 T helper type 1 and regulatory T cells induced against the same epitopes on the core protein in hepatitis C virus-infected persons. J Infect Dis 185:720^727 Ostrowski MA, Gu JX, Kovacs C, Freedman J, Luscher MA, MacDonald KS 2002 Quantitative and qualitative assessment of human immunode¢ciency virus type 1 (HIV-1)-speci¢c CD4+ T cell immunity to gag in HIV-1-infected individuals with di¡erential disease progression: reciprocal interferon-gamma and interleukin-10 responses. J Infect Dis 184:1268^1278

General discussion II

Abbas: From what we have heard so far, it seems to me that the role of cytokines in immune regulation has been demonstrated in several in vivo models. However, it has proved di⁄cult to demonstrate this in co-culture-type experiments. Many of us who are relative neophytes to the ¢eld use the co-culture types of suppression experiment. It makes me wonder what we are looking at. Are we looking at phenomena that are meaningful? If not, what do we look at? Sakaguchi: One problem we have is that we usually use strong stimulation to obtain good suppression. For example, we use a high concentration of anti-CD3 antibody for in vitro stimulation. I think we had better conduct in vitro experiments with weaker stimulation as well. We may see then the e¡ect of cytokines, in addition to the e¡ect of a contact-dependent mechanism. Harrison: I have a simple question in relation to technique. The serum is full of cytokines, binding proteins and soluble receptors. If we are looking at cytokine secretion, we generally try to avoid serum. Is this an issue for other people? Flavell: Serum per se is not physiological. Shevach: It is a compromise we all make. Bluestone: It depends on the question you want to ask. If the question one wants to ask is to try to de¢ne on a molecular level the ability of cells to regulate other cells, and what molecules might be involved in this, then you are forced to ask some questions in vitro. A lot of the success of Ethan Shevach and Shimon Sakaguchi has come from being able to ask these questions in vitro. I guess I would be a little less dogmatic in that I wouldn’t suggest that whatever you ¢nd in vitro must therefore be the reality in vivo. The questions one asks in vivo are somewhat di¡erent. In vivo what you want to know is, in this setting, what of these many parameters that can be identi¢ed in vitro are functional, and at what stages? This is far more complex. One doesn’t have to avoid one and not the other. My experience has been the immune response to make everyone wrong and everyone right at the same time, so we need to keep things in perspective. Continuing on both paths has got to be productive. Bach: It remains the case that when we have to work in humans, it is not easy. What can we do that is interpretable in terms of quantitation of the induced regulation? Maria Grazia Roncarolo, you have been doing therapeutic trials and in vitro tests: how can you rely on human in vitro assays? 203

204

GENERAL DISCUSSION II

Roncarolo: In the clinic, from my own experience we probably need both in vitro and in vivo studies. We started from the clinical observation and went in vitro. Before going back to the patients we had to demonstrate that these anergized cells didn’t induce GVHD in the murine system. But in the ¢rst ¢ve patients we did, we injected cells that normally would induce GVHD and they didn’t. At least so far the data in the ¢ve patients we have treated con¢rmed what we saw in vitro in the mouse system. Of course, we don’t have the ideal assay to look for a surrogate marker for tolerance in regulatory cells, but at least we have some tools that we can use. I think we need to look just for IL10-producing cells in these patients. These IL10 producing cells have regulatory function in vitro that perhaps you could say is associated with a certain e¡ect in vivo. Now that we know that CD25+ regulatory cells are part of the regulatory cell population, we can look at this with a marker. We have a number of indirect assays that give us clues, although we lack the magic assay for tolerance. Bach: A central question is that when we look at mice in in vivo studies, to what extent is the co-culture a representation of the in vivo situation? Shevach: Everyone in this room has done the co-culture experiments. We have all done the in vivo experiments as well. We know that they can be very di¡erent. Roncarolo: There are many examples where the mouse in vitro and in vivo data don’t hold in the human. The best example is the anti-CD40 ligand monoclonal antibody. There are beautiful data in the mouse that it induces Treg cells and tolerance. In the human this doesn’t work, either in vitro or clinical trials. Shevach: In the mouse it doesn’t work in vitro. Roncarolo: Bruce Blazar has beautiful data. Shevach: Read his paper (Taylor et al 2001)! He potentiated the action of the CD25+ cells by preventing the activation of the e¡ectors. I bet you could also do this in humans. Roncarolo: We can’t do this in humans. Bluestone: In the human studies two antibodies have been tested. One of them dropped out of the clinically immediately because it caused thromboembolic events. The other antibody was given to 200 patients 3 weeks ago, and one or a couple of patients had a thromboembolic event. Normally, a small percentage of the patients in these types of trials have complications so it is not clear yet that this is due to the antibody. If you are saying that the di¡erence between the mouse and human is that human platelets express CD40 ligand and mouse platelets don’t, that I would be willing to discuss. But to say that anti-CD40L antibody doesn’t work in humans is unfair. It actually works very well in monkeys. Roncarolo: It doesn’t work in terms of induction of anergy in humans in vitro. Bluestone: I would argue that there are very few people who can get that experiment to work in mouse as well.

GENERAL DISCUSSION II

205

Chatenoud: I understood from the various papers concerning CD40L that the conclusion was the CD4+ cells were tolerized but not CD8s. Does this hold true? If it does, it would explain a lot of things. Bluestone: There are a number of interesting results which have yet to be reconciled. One is the CD4/CD8 issue. In some transplant settings, CD4s dominate the rejection and CD8s play very little role. The other issue that no one takes into account is the antibody itself. There are some recent data from Randy Noelle that in a CD40 knockout the MR1 (the antibody that everyone uses in the mouse) had a signi¢cant e¡ect in that animal that didn’t express CD40. The argument was that this antibody signals. To try to go back and forth and mouse and human, and di¡erent reagents. I am very impressed by the monkey data, which makes me think there is something to this antibody therapy. Roncarolo: Do you mean these results are impressive for the induction of Treg cells and tolerance? Bluestone: For the induction of tolerance. Chatenoud: Tolerance is broken by FK506. Bluestone: It is prevented by FK506. Roncarolo: So you have induction of antigen-speci¢c tolerance. Bluestone: Yes, to the extent that skin grafts from the donor are accepted, and skin grafts from a third party are rejected. Bach: If we come back to the human versus mouse studies, there is an extra factor to take into account, which is the explicit usage in humans of peripheral blood. In Nantes I recently heard data indicating that there may be something unique about human peripheral blood T cells. Separating a T cell pool from peripheral blood might be di¡erent from one found in organs. This was done in tolerant animals as well as humans. Does anyone know whether there is any di¡erence in these coculture systems between circulating lymphocytes and lymphocytes from the thymus or spleen? Shevach: Surely e¡ector cells will be di¡erent if you are looking at organ-speci¢c autoimmunity. In the animal model of gastritis, seen after day 3 thymectomy the only site you can detect T cells that speci¢cally recognize the antigen is the draining gastric lymph node. They are present at a very low frequency anywhere else. These mice have 9 months of severe autoimmune gastritis and autoreactive e¡ector cells ought to be circulating, but their frequency is too low to detect by proliferation assays. In the gastric lymph node, however, you can easily ¢nd them. Bach: This ¢ts with what has been done in transplantation, where it has proved di⁄cult to show e¡ector cells in blood. Shevach: We have a problem if we want to study regulation of e¡ector function: we cannot easily identify the e¡ector cells. Bluestone: We are getting better at that. In type I diabetes we can ¢nd these cells in the peripheral blood. They occur at a precursor frequency of about 1 in 3000, but

206

GENERAL DISCUSSION II

you can use tetramers to get them out, grow them up and look at them. I wouldn’t necessarily assume that because pathogenic cells aren’t circulating that this means that regulatory cells aren’t circulating. One of the interesting observations we have made is that in the anti-CD3 treatment, besides the draining lymph node and the pancreas, the place we see the greatest di¡erence in regulatory cells is actually the peripheral blood of mice. Bach: In mice, has anyone looked in the co-culture system? It should be done. Chatenoud: In the NOD mouse it is laborious to look for the e¡ector cells in peripheral blood. The problem here is that we are drawing conclusions without the data. No one works on the blood in mice. This perhaps should be done. It is complicated, but it is possible. At the beginning of the transfer experiments Francoise Lepault spent a lot of time looking at the organs where she could ¢nd the antigen-speci¢c T cells that could transfer diabetes easily. These organs are the bone marrow, the circulating blood and the spleen. From the lymph nodes it was consistently di⁄cult to get antigen-speci¢c cells that could transfer diabetes e¡ectively. She got these cells from peripheral blood, though. We don’t look enough at this because it is di⁄cult. Harrison: It is not very easy to see antigen-speci¢c T cells in humans, i.e. in blood. Bluestone: In new onset diabetics and a high percentage of diabetics it is possible to see tetramer T cells in peripheral blood. They are there at a frequency of 1 in 3000, so after one round of in vitro expansion there is a 10-fold increase in these cells and they can be seen. Powrie: Can you use other markers to home in on these? Bluestone: There is no problem seeing virus-speci¢c CD8+ cells directly out of the patient. CD4s are more di⁄cult. Can we get £ow cytometry sensitive enough to detect 1 in 3000? There are people who are spending a lot of e¡ort on this. There may be ways to do this using ampli¢cation systems such as PCR on a bead. Powrie: I was suggesting using other markers so you are actually homing in on activated cells that, for example, express particular integrins. Bluestone: In tetramers if you go to a green laser, tetramers with PE label £uoresce about 10-fold brighter. Dump channels are also being used. Harrison: Shouldn’t you see one in 3000 on an Elispot? Banchereau: Yes, we do see this. Bluestone: The problem is that these cells are very susceptible to apoptosis, and unless you do the in vitro assays correctly they die very rapidly. Mowat: Do diabetogenic T cells in humans have b7 integrins on them? Harrison: Yes, a4b7, as published by Arno H
nninen. Bluestone: I don’t know how to de¢ne a diabetogenic T cell in humans. Mowat: Let’s say you want to look in the pancreatic lymph nodes or in the islet in¢ltrates. In human gut disease what people do is purify out CD45RO+ a4b7+

GENERAL DISCUSSION II

207

cells from, for example, blood. This then increases the precursor frequency su⁄ciently to allow you to look at what might be antigen-speci¢c cells. This is one possibility. Bluestone: I am a big fan of biomarkers for pathogenic T cells, but what we really want in this group are good markers for the non-pathogenic cells which presumably are mediating regulation. How are we going to identify the regulatory cells if they are in the peripheral blood? This is the challenge. I actually think we have some good ways of looking at pathogenic cells in certain settings. It is the tolerant cells that I don’t know how to look for. Bach: How would you detect the pathogenic cells in autoimmune disease? Bluestone: In kidney transplantation, for example, it is very easy. I believe that the data that Jerry Nepom has are good and may be relevant to GAD-reactive cells in the pancreas. Bach: How do you know that they are particularly diabetogenic? They are CD4+ T cells binding GAD tetramers. Miller: How do you determine that these cells have a frequency of one in 3000 if you are expanding them? Bluestone: CFSE. The way you do the experiment is to take whole blood and purify the CD4+ cells. You then label them with CFSE and stimulate them in vitro. Jerry does this with the GAD tetramer itself with anti-CD28. These are puri¢ed CD4+ T cells stimulated with anti-CD28 plus GAD tetramer. Then he waits either one or two rounds of expansion before FACS analysis. He usually gates on the CD25 brighter cells, but in the CFSE he doesn’t have to do that. Instead, he looks at the tetramer-positive cells and then calculates on the basis of their generation and the brightness of the green how many cells must have been there at the beginning. Bach: How can you say that they are pathogenic? Bluestone: The necessary experiments involve taking these cells and putting them back into a transgenic mouse that expresses the human class II MHC, and looking to see whether they will induce diabetes. Bach: My reservation here is that CD4+ pathogenic T cells usually work in vivo in conjunction with CD8+ T cells. Will human CD4+ cells collaborate with the mouse CD8+ cells? Von Herrath: Proving that a cell is diabetogenic is humans will come from trials and correlative studies. What else can we do? Bluestone: I agree that this is not easy, but I feel more comfortable when I see a cell that makes a lot of interferon (IFN)g and tumour necrosis factor (TNF), and has characteristics suggesting it is more likely to be pathogenic than regulatory. However, it is possible that it is inert. Mowat: The patients who might be the ones to look at are those with siblings with diabetes or who have other autoimmune diseases linked to diabetes but not

208

GENERAL DISCUSSION II

clinical diabetes. They might be the equivalent of NOD mice with known destructive in¢ltrates and perhaps regulatory cells. Bluestone: We still su¡er from not being able to identify the tolerant cells at all. Mowat: If you ¢nd GAD-speci¢c cells in a person who is genetically at risk for diabetes but who doesn’t have the disease, you might predict that they are regulatory cells. Harrison: There’s work by Bob Anderson (Anderson et al 2000) showing that when coeliac disease patients are on a gluten-free diet for 2^3 weeks they exhibit no peripheral blood IFNg Elispots to HLA-DQ2-restricted gliadin peptide. With reintroduction of gluten, this response disappears within 6^12 days. The appearance in the blood correlated with lack of exposure. This suggests either that exposure to antigen causes the cells to go into the lesion and out of the blood or somehow makes them anergic. Mowat: This has been known for years in coeliac disease. No one has been able to grow antigen-speci¢c cells out of blood from active coeliac patients, but they could be obtained from mucosa. E¡ector cells are not in blood when there is tissue damage. Bluestone: I think this is a huge problem. There is a drug that is being pursued by Novartis called FTY720. It is very interesting because it alters the cell homing so that cells leave lesions almost immediately. If you take a kidney that is undergoing massive graft rejection and treat it with FTY720, the kidney biopsy is clear. I thought of a simple experiment involving taking mice or humans with an ongoing tolerogenic response, such as Lucienne Chatenoud’s mice who have all of this in¢ltrate six months out, that is non-pathogenic, treating them with FTY720 and sampling the lymphatics and blood every hour to see whether these cells start coming back into the circulation. This may be the way to use peripheral blood as a marker. There may be ways that we can re¢ll the peripheral blood at least temporarily. Would you do this in a patient? If it is an immunosuppressive drug that is approved, we might be willing to give it to a patient for a day. Wood: We don’t know about tra⁄cking and regulation. You would have to know that you weren’t compromising the localization of cells that were protecting the graft from rejection and that key cells that ¢lled the peripheral blood temporarily were able to return to their original site of origin you removed FTY720 treatment the following day. Bluestone: Peripheral blood is where the light is. We have two choices. We either move the light, which means we do biopsies of the pancreas, which will never be common, or we move the keys under the light. I am trying to think of ways of moving the keys under the light. Roncarolo: One way you could do this is to create a DTH response by giving the antigen locally in the skin. Harrison: This didn’t work, at least for us with islet antigens.

GENERAL DISCUSSION II

209

Banchereau: We could prove that there was correlation in the induction of anticancer tumour-speci¢c responses, and we had a correlation between the blood Elispot to the tumour antigen. But we did not have a correlation between the DTH and the tumour response. Flavell: What has this got to do with the question, which was the relative evaluation in vivo of in vitro suppression? Bluestone: I think it does, because I think the ability to sample the in vivo setting and to be able to get data out, especially human beings, that would or would not correlate with the in vitro data where you have a piece of plastic to harvest from, can be complicated by both the mechanistic issues and sampling issues. Von Herrath: Do you think it will be impossible to amplify regulators, in a similar way to what Jerry Nepom has done for the aggressive lymphocytes, from human blood? It is possible to grow them in vitro in mouse experiments so that after several weeks they would regain suppressive activity? You could sort and then amplify them hoping to end up with the right population. In principle, it should be possible to grow these cells out even if they are a priori somewhat anergic meaning they do not proliferate well. Bluestone: The critical concern is not whether you can ¢nd ways to grow these cells. Instead, what makes it di⁄cult on the pathogenic cell side is that you have to be able to distinguish a patient from a normal. Whatever you do you have to be able to do uniquely in the patient and not in the normal, and vice versa. I don’t know a way of growing out a CD25+ cell from a patient that would be di¡erent than a CD25+ cell that you would take out from a normal. To me this is the challenge: being able to identify why that patient is di¡erent from the normal in that setting. Bach: One should not be too pessimistic about the possibility of getting biopsies. One condition in which biopsies are done on a regular basis is heart transplantation. Even pancreatic biopsies are possible. It is a somewhat controversial issue: there has been a group in Japan who have done a lot of them successfully, but many people were unhappy about this. With the progress of imaging techniques biopsies like this are increasingly less risky. Wood: A lot of the data we referred to from clinical studies were obtained by biopsy samples being expanded in culture and then analysed. Bach: Did she ¢nd di¡erences between the blood and tissue populations? Wood: She found the cells in the blood as well. The cells didn’t di¡er in phenotype, but quantitatively there were di¡erences. Bach: This means that there are two hurdles. One is to have access to the tissue, without any ethical problems. The second is to have miniaturized techniques for looking at the relevant cells. Miller: In experimental autoimmune encephalitis (EAE), one of the nice things about the model is that you can perfuse a mouse and take its spinal cord out, and take the T cells out. Our experience is that it is extremely hard at the peak of acute

210

GENERAL DISCUSSION II

PLP139 disease to get a proliferative response from CD4+ T cells that are taken from the target organ. But it is easy to measure IFNg production and/or Elispots from those same cells. Expanding the cells will give you false information about what cells are in an organ and what they are doing. Harrison: If you look down the microscope in those situations you can see cells that are responding by size increase. If you measure [3H]uridine uptake you ¢nd that they are making RNA, but they may never get past that point to make DNA. Often when we add antigen we can see this, but we can’t measure DNA synthesis by [3H]thymidine uptake. Abbas: Does this suggest that in co-culture experiments, where by far the most common assay is thymidine incorporation, that we should all start doing one or two additional things? Shevach: Yes. Abbas: Like what? Shevach: A more speci¢c assay might be quantitative analysis of IL2 mRNA using real time PCR, as the primary signal induced in the responder CD25 T cells is inhibition of IL2 transcription. Harrison: With human blood, should we subset the cells? If by depleting CD25+ cells from a prediabetic compared to an HLA-matched control, you got a much stronger response than in the control, this would suggest that the pre-diabetic cells had been under some sort of suppression. Bluestone: I think that is a great idea. I run an organization, the Immune Tolerance Network, that is critically dependent on the ability to be able to distinguish between a patient and a normal, and no one has convinced me of an assay yet that can reliably distinguish between a patient and a normal in almost any autoimmune disease. Jerry Nepom’s work is the ¢rst in diabetes where I have been convinced that he can tell the di¡erence in T cells between a patient and a normal. Harrison: I authored a paper a couple of years ago showing that there were 44 studies in the last 10 years on T cells in type 1 diabetes, but only three of them used HLA matched controls. Bluestone: Asacommunitywehaveto¢xthisproblem.Themicepeoplehavehadfar less trouble with this is in almost any assay that they use. This suggests that it is either a peripheral blood issue or that there are other things that we are just not appreciating. References Anderson RP, Degano P, Godkin AJ, Jewell DP, Hill AV 2000 In vivo antigen challenge in celiac disease identi¢es a single transglutaminase-modi¢ed peptide as the dominant A-gliadin T-cell epitope. Nat Med 6:337^342 Taylor PA, Noelle PJ, Blazar BR 2001 CD4+CD25+ immune regulatory cells are required for induction of tolerance to alloantigen via costimulatory blockade. J Exp Med 193:1311^1318

Modulation of T cell responses after cross-talk between antigen presenting cells and T cells: a give-and-take relationship Marca H. M. Wauben*, Esther N. M. ’t Hoen* and Leonie S. Taams*{ *Department of Infectious Diseases & Immunology, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.165, 3508 TD Utrecht and {Department of Rheumatology & Clinical Immunology, UMC, Utrecht, The Netherlands

Abstract. T cells presenting antigens in the context of MHC class II can induce anergy. In rat CD4+ T cell clones we have shown that depending on the depth of anergy other T cell responses can be inhibited in the presence of professional antigen presenting cells (APCs). This inhibition is cell-contact dependent, and APCs recovered from co-cultures with suppressive anergic T cells are modulated in their capacity to activate T cells. No changes in cell surface expression of MHC molecules, B7-1/B7-2, and OX40L were detected. Remarkably cell clusters formed by anergic T cells appeared to be more tight than clusters of activated T cells, and after £uorescent cell surface labelling of T cells, transfer of label was more profound in co-cultures of anergic T cells and APCs compared to activated T cells and APCs. Previously, it has been shown that activated T cells can absorb molecules from APCs in a unidirectional process. We now have evidence that also APCs can absorb cell surface molecules from T cells during APC^T cell co-cultures. We speculate that the quantity and quality of molecule reshu¥ing during cross-talk between T cells and APCs play a role in the regulation of the T cell response. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 211^225

A controlled balance between the initiation and termination of immune responses is essential for the maintenance of immune homeostasis. One mechanism by which this is achieved is via regulatory T cells. Regulatory T cells are part of the normal immune repertoire, and the lack of such cells results in the spontaneous development of autoimmune diseases. Nowadays several T cell subsets have been proposed to mediate such immunoregulatory e¡ects, including Th2 cells (Liblau et al 1995), interleukin (IL)10 and/or transforming growth factor (TGF)b producing 211

212

WAUBEN ET AL

cells (Buer et al 1998, Groux et al 1997, Bridoux et al 1997), CD45RClow in rats (Powrie & Mason 1990) and CD45RBlow in mice (Powrie et al 1994), CD4+CD25+ T cells (Sakaguchi et al 1995, Thornton & Shevach 1998, Taams et al 2001), and anergic T cells (Lombardi et al 1994, Taams et al 1998). The mode of action of these regulatory cells varies from the secretion of suppressive cytokines to cell^cell contact dependent mechanisms. Previously we have shown that T cells anergized after T cell^T cell presentation are not functionally inert but act as regulatory cells by actively suppressing other T cell responses (Taams et al 1998). Many similarities exist between the T cell^T cell presentation induced anergic T cells, and the naturally occurring CD4+CD25+ regulatory T cells. Like the natural CD4+CD25+ T cells, T cell^T cell presentation induced anergic T cells express CD25 and both cell populations do not proliferate in response to antigenic stimulation and can potently suppress the activation of other CD4+ T cells upon T cell receptor stimulation. This suppression is cell-contact dependent and independent of IL4, IL10 or TGFb. Interestingly, in both cell systems linked suppression can be induced, i.e. the regulatory cells can suppress T cells with di¡erent antigen speci¢cities provided that their cognate ligand is present. Although the working mechanism of all the regulatory T cell types varies, they all require a certain level of speci¢city to avoid a general down regulation of T cellmediated immunity. It has been proposed that antigen-speci¢c immunoregulation is achieved via the antigen presenting cell (APC), which serves to bring together T cells speci¢c for the displayed antigens and allows these T cells to negotiate with the APC and with each other whether to become an activating or an inhibitory cell cluster (Taams & Wauben 2000). Via this model regulatory T cells can suppress responses of other T cells present in the same cluster, a phenomenon called linked suppression. To investigate the role of APC^T cell interaction in T cell regulation we used the experimentally induced anergy model of T cell^T cell presentation in the rat. Results and discussion MHC class II expression on activated T cells: a role in immune regulation? Activated T cells from a wide variety of mammalian species express MHC class II molecules and present MHC class II/peptide complexes to CD4+ T cells. Human and rat activated T cells have been shown to actively synthesize MHC class II molecules during activation (Lamb et al 1983, Broeren et al 1995). Interestingly it has been demonstrated for both mouse and rat activated T cells that they can absorb MHC class II molecules from professional APCs (Lorber et al 1982, Arnold & Mannie 1999, Huang et al 1999, Hwang et al 2000, Kedl et al 2002). Although

APC/T CELL CROSS-TALK

213

the functional signi¢cance of MHC class II expression on T cells has not been demonstrated in vivo, in vitro MHC class II-restricted antigen presentation by T cells has been associated with the induction of anergy (Lamb et al 1983, Sidhu et al 1992, Lombardi et al 1994, Mannie et al 1996,Taams et al 1998). As such it can be envisaged that both actively synthesised as well as acquired MHC/peptide complexes derived from APCs presented on T cells may contribute to immune regulation. We have shown that depending on the MHC class II peptide ligand density displayed on the activated T cell, T cell^T cell presentation can result in distinct anergic phenotypes in the responder T cells, a phenomenon we referred to as multiple levels of T cell anergy (Fig. 1, Taams et al 1999). When low MHC class II peptide ligand densities are displayed by an activated T cell, the responder T cell will not become activated and a subsequent co-culture with professional APCs presenting the proper ligand will result in T cell activation. Increasing the MHC class II peptide concentration during T cell^T cell presentation will result in anergy induction. Depending on the antigen concentration the anergic T cells become modulatory and can induce down regulation of the T cell-activating capacity of the professional APC, thereby inducing linked suppression (Fig. 1). The speci¢city of the down-regulatory e¡ect is warranted by the fact that anergic T cells only modulate APCs that present their speci¢c ligand. These ¢ndings support our view that activated T cells can play a role in immune regulation via MHC class II-restricted antigen presentation. T cell suppression mediated by anergic T cells We showed that rat CD4+ T cell clones, rendered anergic through T cell^T cell presentation were able to suppress the responses of clonal and polyclonal T cells in an active and antigen-dependent manner (Taams et al 1998). We proposed that suppression was mediated via modulation of the APC since we did not have evidence for competition for ligand or locally produced IL2, cytotoxicity or the production of inhibitory soluble factors. To exert suppression the speci¢c antigen for the anergic T cells needed to be presented, and cell^cell contact between anergic T cells, APCs and responder T cells was needed (Fig. 1, Taams et al 1998). We found that anergic T cells were able to down-regulate the T cellactivating capacity of APCs (Taams et al 2000). Importantly upon removal of anergic T cells the suppressive APC phenotype persisted indicating that anergic T cells conditioned the APC to become a mediator of suppression (Taams et al 2000). This phenomenon of APC modulation by anergic T cells has also been demonstrated in mice and humans (Vendetti et al 2000, Frasca et al 2002). Although the APC modulation is clearly cell-contact dependent and independent of soluble factors like IL10 or TGFb, the mode of action is largely

214

WAUBEN ET AL

FIG. 1. Multiple levels of T cell anergy.

unknown. It has been reported in mice that there seems to be a slight reduction of MHC class II, CD80 and CD86 expression on APCs after interaction with anergic T cells. However, in the rat (Fig. 2B, Taams et al 2000) and human (Frasca et al 2002) there is no evidence for such down-regulation. Interestingly, the inhibition of the T cell-activating capacity of APCs induced by anergic T cells appears to be a dominant e¡ect since immature, mature and recently ‘licensed’ APCs can be modulated (Taams et al 2000, Frasca et al 2002). We therefore do not favour the idea that modulation of APCs is due to the absence of a certain molecule on anergic T cells involved in APC activation, such as OX40 or CD40L.

APC/T CELL CROSS-TALK

215

FIG. 2. Change in expression of di¡erent molecular markers on (A) rat T cells and (B) rat APCs after contact with T cells and APCs as indicated.

Cross-talk between APCs and T cells: searching for unique cell surface markers on anergic T cells It is possible that anergic T cells express a certain surface molecule which upon interaction with its ligand on the APC mediates a dominant tolerogenic signal. However, until now we have been unsuccessful in the identi¢cation of such a molecule on rat anergic T cells (Fig. 2A). On the naturally occurring CD4+CD25+ regulatory T cells a constitutive expression of CTLA4 was observed and it has been suggested that the immune suppressive function is dependent on signalling via CTLA4 (Takahashi et al 2000, Read et al 2000). Also in vivo generated anergic CD4+ T cells revealed increased levels of the negative regulators CTLA4 and PD1 (Lechner et al 2001).

216

WAUBEN ET AL

However, it still remains to be determined how these cells suppressively control other T cells upon stimulation via CTLA4 and TCR. Like T cells anergized via T cell^T cell presentation, CD4+CD25+ T cells suppress only upon activation, suggesting that T cell receptor stimulation induces the expression of a cell surface protein that mediates the suppressor function by binding to its receptor on responder T cells or APCs. Recently comparison of gene expression in CD4+CD25+ and CD4+CD25
T cells revealed di¡erential gene and protein expression of CTLA4, glucocorticoidinduced TNF receptor (GITR), 4-1BB and OX40, which were increased in both resting and activated CD4+CD25+ cells (McHugh et al 2002). Furthermore, by raising monoclonal antibodies capable of neutralizing in vitro CD4+CD25+ suppression, GITR appeared to be predominantly expressed on CD4+CD25+ regulatory T cells (Shimizu et al 2002). It has been postulated that GITR plays a crucial role in the activation of the CD4+CD25+ T cell-mediated suppressor function (Shimizu et al 2002, McHugh et al 2002). Cross-talk between APCs and T cells: molecular reshu¥ing Interactions between T cells and APCs lead to conjugate formation and rapid segregation of supramolecular activation clusters at the contact site. For anergic Th1 clones it has been shown that the general receptor of phosphoinositides 1 (GRP1) was selectively induced in anergic T cells (Korthauer et al 2000). The role of GRP1 in anergy is not clear. GRP1 is located in the plasma membrane and regulates integrin (LFA1/ICAM1) mediated adhesion. Interestingly in the rat system of T cell^T cell induced anergy we have observed a very tight clustering of anergic T cells compared to non-anergic T cells (Table 1). After £uorescent cell surface labelling of T cells it was shown that in APC co-cultures with resting T cells no label was transferred to APCs, while in co-cultures with activated T cells, transfer was visible after analysis by confocal microscopy. However APCs cocultured with anergic T cells were much more strongly labelled (Table 1). It has been shown that exposure to APCs causes T cells to rapidly absorb a variety of cell surface molecules from the APC including peptide^MHC complexes, Ig, B7, CD4, OX40L and ICAM1 (Huang et al 1999, Arnold & Mannie 1999, Kedl et al 2002, Hwang et al 2000, Patel et al 1999, Sabzevari et al 2001, Baba et al 2001). The biological signi¢cance of molecule uptake by T cells is unclear. It has been hypothesized that e⁄cient MHC-peptide stripping of APCs by T cells can play a role in a⁄nity maturation of T cell responses (Kedl et al 2002), or that absorption and internalisation of such complexes reduce the possibility of over stimulation of the antigen speci¢c population of T cells. Alternatively T cell mediated internalization of APC-derived ligands could play a role in T cell^APC dissociation (Hwang et al 2000). On the other hand the passively acquired

APC/T CELL CROSS-TALK

TABLE 1

217

T cell^APC interactions: molecular reshu¥ing of cell surface molecules

Resting T cell Activated T cell Anergic T cell

Adhesion/cluster formation

T!APC £uorescent label transfer

T!APC cell surface molecule transfer

7 + +++

7 + ++

7 + ++

complexes presented on activated T cells may play an active role in immune regulation by the induction of fratricide, as shown by speci¢c lysis by CD8+ neighbouring cells (Huang et al 1999) or by T cell^T cell presentation (Arnold & Mannie 1999, Patel et al 1999, Sabzevari et al 2001). How molecules are actually transferred from APCs to T cells is unclear. For both CD28 and T cell receptor-mediated absorption the transfer of molecules from APCs to T cells has been described as a unidirectional process (Hwang et al 2000), possibly mediated via detached membrane fragments or APC-derived vesicles (Arnold & Mannie 1999). Remarkably, we have found by confocal microscopy and FACS analysis that £uorescent label derived from T cells can be detected on co-cultured APCs, suggesting that the process of molecular reshu¥ing is bi-directional instead of unidirectional (Table 1). Since we could not fully exclude that the transfer of label was due to non-speci¢c events, we analysed whether we could detect transfer of MHC class II molecules from the activated T cells to APCs. Indeed it appeared that APCs can pick-up and functionally present MHC class II peptide complexes derived from activated T cells (E. ’t Hoen & M. Wauben, unpublished results). Recently, it has been published that upon activation via the T cell receptor, human T cells release microvesicles containing adhesion molecules, MHC class I and II molecules, and phosphorylated zeta and CD3/ TCR (Blanchard et al 2002). Although we previously have shown that only marginal suppressive e¡ects were observed in a trans-well system while coculture of anergic T cells together with professional APCs and responder T cells led to a very e⁄cient suppression (Taams et al 1998), we do not rule out the possibility that microvesicles or detached membrane fragments are involved in APC modulation. In summary, we would like to postulate that anergy induction via T cell^T cell presentation, resembling many features with the naturally existing CD4+CD25+ T cells, plays a physiological role in immune regulation, and that the MHCpeptide ligand concentration on the activated T cell, either acquired or actively synthesized, determines the level of anergy induction. Furthermore we would

218

WAUBEN ET AL

like to speculate that the quantity and quality of molecular reshu¥ing during crosstalk between T cells and APCs is a¡ected by the strength of interaction and the activation state of the T cells, and that this phenomenon plays a role in immune regulation.

Acknowledgements The work of Dr M.H.M. Wauben has been made possible by a fellowship of the Royal Netherlands academy of Arts and Sciences. The work of E. ’t Hoen was supported by an EU Network grant (APTNET, No. BIO4-CT97-2151).

References Arnold PY, Mannie MD 1999 Vesicles bearing MHC class II molecules mediate transfer of antigen from antigen-presenting cells to CD4+ T cells. Eur J Immunol 29:1363^1373 Baba E, Takahashi Y, Lichtenfeld J et al 2001 Functional CD4 T cells after intercellular molecular transfer of OX40 ligand. J Immunol 167:875^883 Blanchard N, Lankar D, Faure F et al 2002 TCR activation of human T cells induces the production of exosomes bearing the TCR/CD3/zeta complex. J Immunol 168:3235^3241 Bridoux F, Badou A, Saoudi A et al 1997 Transforming growth factor
(TGF-
)dependent inhibition of T helper cell 2 (Th2)-induced autoimmunity by self-major histocompatibility complex (MHC) class II-speci¢c, regulatory CD4+ T cell lines. J Exp Med 185:1769^1775 Broeren CP, Wauben MHM, Lucassen MA et al 1995 Activated rat T cells synthesize and express functional major histocompatibility class II antigens. Immunology 84:193^201 Buer J, Lanoue A, Franzke A, Garcia C, von Boehmer H, Sarukhan A 1998 Interleukin 10 secretion and impaired e¡ector function of major histocompatibility complex class IIrestricted T cells anergized in vivo. J Exp Med 187:177^183 Frasca L, Scotta C, Lombardi G, Piccolella E 2002 Human anergic CD4+ T cells can act as suppressor cells by a¡ecting autologous dendritic cell conditioning and survival. J Immunol 168:1060^1068 Groux H, O’Garra A, Bigler M et al 1997 A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Huang JF, Yang Y, Sepulveda H et al 1999 TCR-mediated internalization of peptide-MHC complexes acquired by T cells. Science 286:952^954 Hwang I, Huang JF, Kishimoto H et al 2000 T cells use either T cell receptor or CD28 receptors to absorb and internalise cell surface molecules derived from antigen presenting cells. J Exp Med 191:1137^1148 Kedl RM, Schaefer BC, Kappler JW, Marrack P 2002 T cells down-modulate peptide-MHC complexes on APCs in vivo. Nat Immunol 3:27^32 Korthauer U, Nagel W, Davis EM et al 2000 Anergic T lymphocytes selectively express an integrin regulatory protein of the cytohesin family. J Immunol 164:308^318 Lamb JR, Skidmore BJ, Green N, Chiller JM, Feldmann M 1983 Induction of tolerance in in£uenza virus-immune T lymphocyte clones with synthetic peptides of in£uenza hemagglutinin. J Exp Med 157:1434^1447 Lechner O, Lauber J, Franzke A, Sarukhan A, von Boehmer H, Buer J 2001 Fingerprints of anergic T cells. Curr Biol 11:587^595

APC/T CELL CROSS-TALK

219

Liblau RS, Singer SM, McDevitt HO 1995 Th1 and Th2 CD4+ T cells in the pathogenesis of organ-speci¢c autoimmune diseases. Immunol Today 16:34^38 Lombardi G, Sidhu S, Batchelor R, Lechler R 1994 Anergic T cells as suppressor cells in vitro. Science 264:1587^1589 Lorber MI, Loken MR, Stall AM, Fitch FW 1982 I-A antigens on cloned alloreactive murine T lymphocytes are acquired passively. J Immunol 128:2798^2803 Mannie MD, Rendall SK, Arnold PY, Nardella JP, White GA 1996 Anergy-associated T cell antigen presentation: a mechanism of infectious tolerance in experimental autoimmune encephalomyelitis. J Immunol 157:1062^1070 McHugh RS, Whitters MJ, Piccirillo CA et al 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311^323 Patel DM, Arnold PY, White GA, Nardella JP, Mannie MD 1999 Class II MHC/peptide complexes are released from APC and are acquired by T cell responders during speci¢c antigen recognition. J Immunol 163:5201^5210 Powrie F, Mason D 1990 OX-22 high CD4+ T cells induce wasting disease with multiple organ pathology: prevention by the OX-22low subset. J Exp Med 172:1701^1708 Powrie F, Correa-Oliveira R, Mauze S, Co¡man RL 1994 Regulatory interactions between CD45RBhigh and CD45RBlow CD4+ T cells are important for the balance between protective and pathogenic cell-mediated immunity. J Exp Med 179:589^600 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Sabzevari H, Kantor J, Jaigirdar A et al 2001 Acquisition of CD80 (B7-1) by T cells. J Immunol 166:2505^2513 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Sidhu S, Deacock S, Bal V, Batchelor JR, Lombardi G, Lechler RI 1992 Human T cells cannot act as autonomous antigen-presenting cells, but induce tolerance in antigen-speci¢c and alloreactive responder cells. J Exp Med 176:875^880 Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3: 135^142 Taams LS, Wauben MHM 2000 Anergic T cells as active regulators of the immune response. Hum Immunol 61:633^639 Taams LS, van Rensen AJML, Poelen MCM et al 1998 Anergic T cells actively suppress T cell responses via the antigen presenting cell. Eur J Immunol 28:2902^2912 Taams LS, van Eden W, Wauben MHM 1999 Dose-dependent induction of distinct anergic phenotypes: multiple levels of T cell anergy. J Immunol 162:1974^1981 Taams LS, Boot EPJ, van E den W, Wauben MHM 2000 ‘Anergic’ T cells modulate the T cell activating capacity of antigen-presenting cells. J Autoimmun 14:335^341 Taams LS, Smith J, Rustin MH, Salmon M, Poulter LW, Akbar AN 2001 Human anergic/ suppressive CD4+CD25+ T cells: a highly di¡erentiated and apoptosis-prone population. Eur J Immunol 31:1122^1131 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310

220

DISCUSSION

Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Vendetti S, Chai JG, Dyson J, Simpson E, Lombardi G, Lechler R 2000 Anergic T cells inhibit the antigen-presenting function of dendritic cells. J Immunol 165:1175^1181

DISCUSSION Bach: What are the anergic cells that you are using? Wauben: They were derived from T cell^T cell presentation. We incubate activated T cells which are positive for MHC class II with peptide, and this induces anergy. These cells are high in CD25, do not make IL2 and do not proliferate. They have a suppressive phenotype. Bach: What is the APC preparation you have been using? Wauben: In most of our experiments presented here we used puri¢ed splenic B cells, but we also used dendritic cells in some experiments. Shevach: You compared your work with Robert Lechler’s. He is quite speci¢c in asserting that if they take a fully activated APC, either in the mouse or human system, the anergic T cells are not suppressive. The APC that is so-called ‘fully licensed’ is not suppressible. Ha£er: We also published that some years ago (LaSalle et al 1992). Wauben: We published some years ago that a fully licensed APC can still be suppressed by an anergic T cell clone (Taams et al 2000). Shevach: ‘Fully licensed’ is sort of a non-term. Can you be more speci¢c? Wauben: Working in the rat we don’t have the reagents such as anti-CD40. We have licensed them with an activated Th clone. This is the ultimate licensing of an APC. Ha£er: If you take the exosome preparations, are they suppressive? If you take that whole preparation and mix it with T cells, will they suppress the response? Wauben: We need to do these experiments. Ha£er: One of the things we found with these T^T interactions is that if we lyse the cells and just take the membrane preparation, it is very e¡ective in inducing either activation or suppression, depending on the system (Brod et al 1990). Wauben: Our result is not just an artefact caused by membrane fragments, because we showed the phenomenon ¢rst with whole cells. Ha£er: You raised some interesting questions. This T^T phenomenon is a very powerful one, certainly in human systems. It is ignored by mouse immunologists because mouse T cells tend not to express class II MHC. It is suppressive, but we have no idea what the mechanism is. The sine qua non of the whole response is a clumping of T cells. If you break up the clumping you don’t get anergy. The question is whether or not the T^T interaction would have passing of membrane that is somehow involved in the anergy

APC/T CELL CROSS-TALK

221

induction. Do the T cells present antigen to themselves? In the human system they don’t. In the rat system do you require two T cells? Are the exosomes being passed from T cell to T cell? Wauben: We haven’t formally demonstrated this. Abbas: Except for some of the oral tolerance models, just about every model of antigen-induced tolerance in vivo that I am aware of does not show bystander tolerance. It is speci¢c for the tolerizing antigen. Wauben: What about nasal tolerance? Abbas: It is only a model of mucosal tolerance. Nasal and oral tolerance I put together as mucosal tolerance. But in i.v. peptide or graft tolerance models, the speci¢city is for the tolerizing antigen only. Wauben: In graft tolerance, is there never linked suppression? Bach: There is. Wauben: There is in our system as well, but we need the speci¢c stimulus for the anergic T cell. This is important because this is the level of speci¢city that is needed in the system so that you do not down-regulate every response. There is speci¢city at the level of the anergic cell. This system isn’t essentially di¡erent from nasal or oral tolerance. The only thing I can’t ¢t easily is the i.v. tolerance model. For me, this is the exception. This often uses very high doses of antigen and apoptosis plays a role. Von Herrath: If you have an antigen and the T cell disappears or doesn’t do anything anymore, then you have this antigen-speci¢c tolerance. But with oral antigens or some other immunizations, if you induce a cell that actually has e¡ector function that regulates the response you are looking at, then you get these bystander e¡ects. Whether or not you should call this tolerance is unclear. Abbas: Why I am thinking about the aqueous peptide-type models is that the power of the system is that it is very clean. You know which population is being tolerized. The experiments that people like Mark Jenkins have done, putting in two T cells of di¡erent speci¢cities, are very clean. One is tolerized, the other is una¡ected during tolerance induction. Wauben: In a transgenic system this seems very relevant. In a lot of other systems there is linked suppression. Mowat: What physiological system is i.v. peptide relevant to? Ha£er: Oral tolerance. When you feed antigens, a lot of them ¢lter into the circulation. Abbas: The long-standing speculation that oral tolerance is relevant to the fact that we don’t respond to food antigens is nothing but that: a speculation. These experimental systems allow us to look at mechanisms and speci¢city, and so on, but who knows what they are relevant to. Harrison: There’s less speculation there than here!

222

DISCUSSION

Bach: I.v. peptides do induce bystander suppression as well. This has been shown in diabetes. Wauben: Then there is bystander suppression in every system. Miller: With peptide-coupled, ECDI-¢xed cells, we ¢nd that it is absolutely antigen speci¢c and there is no bystander suppression. Harrison: Perhaps it kills enough cells that this can’t occur. Maybe these anergic cells have to stay around. Mitchison: Isn’t it entirely a matter of physical linkage? If the antigens get into two di¡erent APCs then you don’t get linkage but if they get into the same APC you do. Bluestone: I don’t understand why everyone can’t be right in this discussion. What we now know about peripheral tolerance is that there are multiple mechanisms, deletional as well as antigen speci¢c. Von Herrath: I would like to know a bit more about these anergic cells in terms of the cytokines and chemokines that they make. From what Ethan Shevach has shown and what you have described here, these anergic cells have this tendency to hang around other cells. This is intriguing and unexpected. I would have thought if they are not proliferating that they would sit there and perhaps make some chemokines and cytokines. But they hang around the CD8 responder cells. Does this relate to what they or the responder cells are making? Shevach: The curious thing in the comparison of the microarray of activated CD25+ cells and CD25
cells, looking at how many genes are uniquely expressed, is that out of the 90 genes that were di¡erentially expressed, 75 were in the CD25+ cells. ‘Anergy’ is a term, but these cells are making lots of things, including chemokines. Activated CD25+ cells make MIP1a and b. Wauben: We haven’t analysed our cells with the microarray system, but we think that the observed increased adhesion and clustering of anergic T cells is an important point. Bluestone: Not all anergic cells are the same but Harald von Boehmer published a paper a few years ago on the expression of genes in anergic T cells (Lechner et al 2001). He found a lot of genes that were co-expressed with CD25+ cells. It is certainly possible that these cells are expressing a lot of the same chemokines. Adhesion and the P selectin issue comes to bear here as well. Wauben: I agree. Miller: In most anergy models antigen-speci¢c cells proliferate in response to the initial encounter with antigen. Delovitch: I have a question on the properties of the exosomes. You touched on apoptosis. Do you ever ¢nd evidence for expression of FAS or FASL on the membranes? Wauben: We haven’t analysed that, but we can analyse this in our FACS assay. Delovitch: Do you ever see apoptosis in your cultures after strong anti-CD3 stimulation?

APC/T CELL CROSS-TALK

223

Wauben: There is a lot of cell death occurring during T cell^T cell presentation. The clusters are very tight. If we look with the microscope we can see that the cells inside these clusters are not in good shape. Ha£er: Just to make a comment about why these methods are very important, in situations of autoimmunity and in£ammation, there are really high concentrations of self-antigen being released. One could easily imagine that having activating T cells expressing MHC might be a fail-safe mechanism helping to prevent the autoimmune response. Miller: How carefully have people looked for mouse T cells picking up MHC from mouse APCs in an in£ammatory autoimmune situation? Wauben: A lot of people have looked, and this has been published. Mitchison: B cells readily pick up pieces of foreign cell membrane containing MHC molecules (Mitchison 1992). Miller: This is not unique to rat, then. Mouse T cells can pick up peptide/MHC from APCs? Ha£er: How can you say that? Wauben: This is an important di¡erence. We do not know which peptides are presented by the actively synthesized MHC class II molecules on rat and human T cells. If the peptides presented by the actively synthesized MHC II molecules play a role in the regulation, this would make a di¡erence between passively acquired MHC class II molecules and actively synthesized MHC class II molecules, making the regulation system in human and rats di¡erent from mice which express exclusively passively acquired MHC class II on T cells. Mitchison: I’d like to draw attention to a paradox in the mouse^rat comparison. Their MHC II molecules are very closely comparable. You might expect that in the rat, where MHC II molecules are expressed not only in professional APCs, but also in T cells (a di¡erent kind of environment from dendritic cells), that MHC II expression would be genetically more variable than in the mouse. The reverse is true: laboratory strains and wild mice are highly diverse in the regulatory sequences of their MHC II molecules. In laboratory rats, the diversity in the coding sequence is approximately equal to that of the mouse, but we found no variability in the promoter sequences (Mitchison & Roes 2002). Abbas: Unless you can actually do a conditional deletion of class II MHC in T cells, which is obviously not feasible in the species in which this is an easily demonstrable phenomenon, how do you prove that it is important? Everyone will accept that class II is expressed on T cells. What is the experiment that will prove it is of any physiological signi¢cance? Wauben: It is hard to prove. If the peptides presented by the MHC class II on the activated T cell play an important role in triggering regulatory cells it is maybe possible to identify these peptides. As you said already, a T cell is not a good APC, so it does not present all the foreign peptide antigens. We need to see what

224

DISCUSSION

antigen is presented on the MHC on the activated T cell. Perhaps it is a unique feature of the T cell that it has a very strict peptide repertoire presented by MHC class II. Abbas: Is there enough class II for you to be able to a⁄nity purify it and then pull out peptides? Wauben: We are trying this, but it is very hard. Von Herrath: A possibility would be that if the T cells that already express their TCR peptides would share them with the APCs. In this way, the APCs don’t need to process them any more. Sercarz: Have you followed the fate of the TCR after exosomal transfer? Wauben: No. Bluestone: We are all so interested in developing clever ideas about how these cells work. You have shown that there is a tremendous aggregation e¡ect that seems to be enhanced in the anergic or regulatory cells. Could it be that it puts the cells in a di⁄cult position to get the appropriate signals from the cells they want to, and you have basically mucked them up? Wauben: That could be true. However, in the experiments in which we isolated the APCs where the anergic cells were no longer present, the APCs were modulated. This makes us think that the process is much more active. Bluestone: I’m not suggesting that it is a purely passive blockade. But rather than thinking about suppression always as an active event in which the suppressor cell delivers some kind of a signal, perhaps it is a passive event that alters the necessary active events of the APC and T cell. By not allowing the APC to get its full signal process going, the APC actually turns itself o¡. It is not that some other cell turns itself o¡; it is the APC not being in an appropriate environment to get its full activation signal. It’s like a computer programmer putting in the wrong password: not only is access to the program denied, but sometimes that program itself shuts down. Wauben: That’s an interesting idea. It could explain why an already licensed APC can be down-regulated. Mowat: When you described the transfer of antigens on the exosomes to B cells and DCs, was this using T cells that were anergized or activated? Wauben: This was with anergized T cells. We can also isolate exosomes from activated T cells as well. It is not a unique feature of anergic cells, although we think that the anergic T cells make more exosomes. References Brod SA, Purvee M, Benjamin D, Ha£er DA 1990 T^T cell interactions are mediated by adhesion molecules. Eur J Immunol 20:2259^2268 LaSalle JM, Tolentino PJ, Freeman GJ, Nadler LM, Ha£er DA 1992 Early signaling defects in human T cells anergized by T cell presentation of autoantigen. J Exp Med 176:177^186

APC/T CELL CROSS-TALK

225

Lechner O, Lauber J, Franzke A, Sarukhan A, von Boehmer H, Buer J 2001 Fingerprints of anergic T cells. Curr Biol 11:587^595 Mitchison NA 1992 Latent help to and from H-2 antigens. Eur J Immunol 22:123^127 Mitchison NA, Roes J 2002 Patterned variation in murine MHC promoters. Proc Natl Acad Sci USA 99:10561^10566 Taams LS, Boot EP, van Eden W, Wauben MH 2000 Anergic T cells modulate the T cell activating capacity of antigen-presenting cells. J Autoimmun 14:335^341

Dendritic cells: controllers of the immune system and a new promise for immunotherapy Jacques Banchereau*, Joseph Fay*, Virginia Pascual*{ and A. Karolina Palucka* *Baylor Institute for Immunology Research, 3434 Live Oak, Dallas, TX 75204 and {UTSW Medical Center, Dallas, TX, USA

Abstract. Dendritic cells (DCs) can be utilized either as vectors or as targets for therapy. Patients with metastatic melanoma received CD34-DC vaccine that contains Langerhans’ cells and interstitial DCs. DCs were pulsed with MART1, tyrosinase, MAGE3, gp100 and Flu-MP peptides, and KLH. DCs induced an immune response to control antigens in 16/18 patients. An enhanced immune response to 1 or more melanoma antigens (MelAgs) was seen in these 16 patients. The two patients failing to respond experienced rapid tumour progression. Six out of seven patients with immunity to two or fewer MelAgs had progressive disease 10 weeks after study entry, in contrast to tumour progression in only 1/10 patients with immunity to 4 two MelAgs. Since tumour immunotherapy targets autologous antigens we can learn from systemic autoimmunity such as systemic lupus erythematosus (SLE). As opposed to normal monocytes, SLE monocytes induce proliferation of allogeneic CD4+ T cells. SLE sera induce monocyte di¡erentiation towards DCs in an IFNa-dependent mechanism. Spiking autologous serum with IFNa reproduces DC di¡erentiation. 50% of SLE patients have high serum levels of IFNa, which could explain T/B lymphopenia. Yet, plasmacytoid DCs, a major IFNa source, are 80% decreased. pDCs and IFNa may play a role in SLE pathogenesis and therapy. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 226^238

The immune system is controlled by dendritic cells (DCs). The innate immune system includes proteins such as complement factors, interferons, and several cell types such as NK cells and phagocytic cells. These cells recognize microbes and their products through receptors (such as Toll-like receptors), which are encoded by single genes. The adaptive immune system is based on lymphocytes, which through gene rearrangement create unique clones with speci¢c receptors that carry immunological memory that permits them to swiftly mount a response upon re-exposure. Upon microbe invasion, B and T cells become, respectively, antibody producing cells and helper or cytotoxic T e¡ector cells. B cells can 226

DENDRITIC CELL IMMUNOTHERAPY

227

directly recognize native antigens. In contrast, T cells recognize fragments of the antigens bound to MHC molecules expressed on the antigen presenting cell (APC). While MHC class I and II molecules present peptides, CD1 molecules present nonprotein antigens. APCs include macrophages, B cells, ¢broblasts, epithelial cells, as well as DCs. These DCs are uniquely able to induce primary immune responses, i.e. to stimulate na|« ve lymphocytes. Biology of dendritic cells Paul Langerhans ¢rst saw DCs in 1868 within the skin epithelium. In 1973 Ralph Steinman, identi¢ed a rare cell type from mouse spleen that is involved in the induction of immune responses. For nearly 20 years, DCs had to be painstakingly isolated from tissues and the progress was slow. In 1992, culture systems were discovered that produced large amounts of mouse and human DCs thereby accelerating their study (Banchereau et al 2000). Besides their rarity, the complexity of DCs lies in two other aspects: di¡erent subsets and di¡erent stages of maturation (Banchereau et al 2000, Liu et al 2001). Two major DC pathways are thought to exist (Fig. 1). First, a myeloid pathway, which generates two subsets, Langerhans’ cells (LCs), found in strati¢ed epithelia such as skin, and interstitial DCs (intDCs), found in all other tissues. These subsets can produce large amounts of interleukin (IL)12. A second pathway includes plasmacytoid DCs (pDCs), which within a few hours of viral encounter secrete large amounts of type I interferon (IFN) (Liu et al 2001), an antiviral cytokine. Therefore, pDCs represent a ¢rst barrier to the expansion of intruding viruses, thus acting as part of the innate immune response. Importantly these cells subsequently di¡erentiate into DCs able to induce immune responses thus acting as part of adaptive immunity (Fig. 2). Circulating DC precursors represent less than 1% of white blood cells. These precursors replenish the immature DCs that sit within tissues and are endowed with mechanisms to capture invading microbes such as receptor-mediated endocytosis (lectins, Fc receptors), macropinocytosis and phagocytosis. Minute amounts of captured antigens are processed into small peptides while DCs move towards the draining secondary lymphoid organs. There, the DCs present the peptides to T cells and complete their maturation after receiving signals from the antigen-speci¢c T cells (Lanzavecchia & Sallusto 2001). Each of the three DC subsets expresses a unique lectin. LCs express Langerin, critical to the formation of Birbeck granules. The intDCs express DC-SIGN that binds (1) ICAM1 on T cells facilitating MHC^peptide complex recognition; (2) ICAM3 expressed on endothelial cells therefore allowing transmigration of DCs into tissues; and (3) HIV protein (gp120), thereby allowing transport of the virus into the draining lymph node. pDCs express another lectin called BDCA2. Toll receptors are also

228

BANCHEREAU ET AL

FIG. 1. Subsets of human dendritic cells. Blood DCs, mobilized by FLT3 ligand, contain both CD11c+ myeloid DCs and CD11c
plasmacytoid DCs. Most clinical studies to date have been carried out with DCs made by culturing monocytes with GM-CSF and IL4. These preparations contain cells that resemble intDCs and are devoid of LCs. These DCs are immature and require exogenous factors (CD40 ligand or macrophage cytokines) for maturation. DCs can also be generated by culturing CD34+ haematopoietic progenitor cells (HPCs) with GM-CSF and TNFa that produces two DC subsets: LCs and intDCs. Adding IL4 to CD34 cultures with GM-CSF/TNF skews di¡erentiation towards intDCs. A distinct subset of HPCs, CD34+CD45RA
, gives rise in vitro to plasmacytoid DCs upon culture with FLT3 ligand.

FIG. 2. The life cycle of dendritic cells. Circulating precursor DCs enter tissues as immature DCs. They can also directly encounter pathogens (e.g. viruses), which induce secretion of cytokines (e.g. IFNa or IL12), which in turn activate e¡ector cells of innate immunity such as granulocytes, macrophages and NK cells. Following antigen capture, immature DCs migrate to lymphoid organs where, after maturation, they display peptide^MHC complexes, which allow selection of rare circulating antigen-speci¢c lymphocytes. These activated T cells help DCs in terminal maturation, which allow lymphocyte expansion and di¡erentiation. Activated T lymphocytes traverse in£amed epithelia and reach the injured tissue, where they eliminate microbe and/or microbe-infected cells. Activated B cells migrate into various areas where they mature into plasma cells that produce antibodies that neutralize the initial pathogen.

DENDRITIC CELL IMMUNOTHERAPY 229

230

BANCHEREAU ET AL

di¡erentially expressed. For instance Toll 9 (a receptor for demethylated DNA) is expressed only by pDCs. Such di¡erential expression of molecules that are e⁄cient anchors for pathogens, may have a determining in£uence on the type of immune response generated against a given microbe. The launch of an immune response is a complex process. When in£uenza virus infects epithelial cells from the lung mucosa, surface MHC^virus peptide complexes on these epithelial cells are in su⁄cient numbers to be recognized by CTLs but these infected cells appear incapable of initiating a virus-speci¢c T cell response. Part of the reason for this is because of the absence of co-stimulatory molecules. DCs, through the expression of many co-stimulatory molecules initiate and sustain these T cell responses. However, di¡erent pathogens can induce di¡erent types of immune responses. For example, in response to intracellular microbes (viruses and certain bacteria) CD4+ T helper (Th) cells di¡erentiate into Th1 cells secreting IFNg. This allows di¡erentiation of cytotoxic cells that mediate destruction of infected cells. Extracellular pathogens such as helminths induce the development of Th2 cells, which produce IL4, IL5 and IL13. These cytokines control the production of IgE and eosinophils that mediate destruction of the pathogen. Indeed, generating the appropriate type of immune response can be a matter of life or death itself as can be illustrated by leprosy where the tuberculoid form represents a protective type 1 response while the lepromatous form is often a lethal type 2 response. Such T cell polarization, i.e. whether the T cell will produce type 1 and/or type 2 cytokines, is now known to be controlled by DCs. DCs are also known to have major e¡ects on B cells. DCs can present nondegraded antigens to B cells therefore allowing selection of antigen-speci¢c B cells. Furthermore, DCs enhance the growth and di¡erentiation of B cells that have received signals from T cells. DCs also induce them to switch their isotypes and most notably, in the case of human B cells, to secrete IgA2 the prototype mucosal immunoglobulin that represents a major barrier against mucosal pathogens. Dendritic cells as vaccines to enhance immunity Studies in mice have shown that injection of DCs loaded with tumour-associated antigens (TAAs) leads to antitumour immune responses resulting in tumour rejection. Early trials in humans have shown the safety of TAA-loaded DCs as well as some clinical and immune responses. Recent studies concentrated on establishing maximal immune responses to control antigens and tumour antigens. Many issues remain to be addressed before DC therapy becomes an integral part of active immunotherapy, i.e. modulation of the immune system for therapeutic purposes (Banchereau et al 2001a). These include the choice of the DC

DENDRITIC CELL IMMUNOTHERAPY

231

subset to be administered and the way to generate it. The most popular way is to culture blood monocytes with the cytokines that permit generation of interstitial-like DCs, i.e. GM-CSF (granulocyte/macrophage colony-stimulating factor) and IL4. Alternatively, haematopoietic stem cells yield DCs when cultured with GMCSF and tumour necrosis factor (TNF). This latter methodology, which generates both LCs and interstitial DCs, permitted us to demonstrate that induction of TAA-speci¢c immune responses in patients’ blood correlates with induction of clinical responses (Banchereau et al 2001b). In our study, 18 HLA A*0201+ patients with metastatic melanoma were injected subcutaneously with CD34+ progenitor-derived autologous DCs, which included LCs. DCs were pulsed with peptides derived from four melanoma antigens (MelanA/MART1, tyrosinase, MAGE3 and gp100), as well as in£uenza matrix peptide (Flu-MP) and keyhole limpet haemocyanin (KLH) as control antigens. Overall immunological e¡ects were assessed by comparing response pro¢les using marginal likelihood scores. DC injections were well tolerated except for progressive vitiligo in two patients. DCs induced an immune response to control antigens (KLH, Flu-MP) in 16 of 18 patients. An enhanced immune response to one or more melanoma antigens (MelAgs) was seen in these same 16 patients, including 10 patients who responded to 4 two MelAgs. The two patients failing to respond to both control and tumour antigens experienced rapid tumour progression. Of 17 patients with evaluable disease, 6/7 patients with immunity to two or fewer MelAgs had progressive disease 10 weeks after study entry, in contrast to tumour progression in only 1/10 patients with immunity to 4 two MelAg. Regression of more than one tumour metastasis was observed in seven of these patients. The overall immunity to melanoma antigens following DC vaccination is associated with clinical outcome (P ¼0.015). A single DC vaccination was su⁄cient for induction of KLH-speci¢c responses in six patients and Flu-MP-speci¢c responses in eight patients. The analysis of immune response kinetics revealed that a single DC vaccine was su⁄cient to induce tumour-speci¢c e¡ectors to 51 melanoma antigen in ¢ve patients. None of these ¢ve patients showed early disease progression. Only 1/6 patients with rapid KLH-response experienced early disease progression. Rapid and slow Flu-MP responders did not di¡er with regard to disease progression. Another important parameter to establish is the dose and frequency of DC administration. Unlike traditional chemotherapy, the highest dose may not be yielding the best clinical response. Likewise, too frequent administration may result in activation-induced cell death, resulting in elimination of T cells able to kill cancer cells. It is believed that optimal antitumour e¡ects will be obtained with many vaccinations, possibly over a lifelong schedule. As with many classical vaccines, DC vaccines will likely be administered through the skin. A signi¢cant

232

BANCHEREAU ET AL

focus of research is the antigen loading. At present, DCs are mostly loaded with peptides from de¢ned (tumour) antigens that bind to MHC Class I and II antigens. This presents numerous limitations such as (1) the restriction to a given MHC type; (2) the limited number of TAAs, which restricts vaccination therapy to mostly melanoma for which many TAAs have been identi¢ed and (3) the limited repertoire of elicited immune e¡ectors which may not allow eradication of the multiple tumour variants. Targeting DCs to induce tolerance The body has evolved means to avoid immune system attack on self components. Two mechanisms exist, central and peripheral tolerance, both of which are controlled and maintained by DCs. Central tolerance occurs in thymus where newly generated T cells with a receptor that recognizes components exposed by mature thymic DCs are deleted. However, many self antigens may not access the thymus while other are expressed later in life. Upon activation, these autoreactive cells may lead to autoimmunity. Hence, there is a need for peripheral tolerance, which occurs in lymphoid organs by induction of T cell anergy, i.e. unresponsiveness, rather than deletion. The development of peripheral tolerance involves immature DCs (Steinman et al 2000). These cells sitting within tissues capture the remains of cells that die in the process of physiological tissue turnover. As there is no in£ammation accompanying this process, the DCs remain immature and migrate towards the draining lymph nodes. These immature DCs, which lack co-stimulatory molecules, present the tissue antigens to autoreactive T cells, which in absence of co-stimulation, enter into a state of anergy. Breaking this anergic state, e.g. through increased availability of mature DCs, may result in autoimmunity. This concept is illustrated by our recent studies in patients su¡ering from the systemic lupus erythematosus (SLE) (Fig. 3). There, the plasmacytoid subset releases large amounts of IFNa, which induces monocytes to di¡erentiate into DCs. These DCs phagocytose cell nuclei that circulate in these patients blood and their components are presented to autoreactive T cells and B cells, leading to the generation of anti-nuclear antibodies including anti-double stranded DNA antibodies, the hallmark of SLE. These autoantibodies form immune complexes that deposit in the kidneys, or the vessel walls eventually leading to kidney failures or vasculitis, life-threatening complications of the disease. Thus, unabated myeloid DC induction and alterations in the balance between DC subsets contribute to autoimmunity. Yet, only a fraction of patients display circulating IFNa, thereby raising the question of whether this re£ects disease heterogeneity. Because IFNa may represent a major therapeutic target in SLE, as TNF does in arthritis, we approached this question by analysing the genes expressed by patient leukocytes using oligonucleotide microarray

FIG. 3. Central role of DC subsets and IFNa in the pathogenic loop of SLE. Plasmacytoid DCs, triggered by viruses, release high levels of IFNa which induces monocytes to di¡erentiate into DCs able to capture circulating apoptotic cells. Upon subsequent IFNa-induced maturation, these DCs present self-antigens to autoreactive CD4+ T cells. Those DCs also directly support B cell proliferation and di¡erentiation, and such me¤ nage a' trois generates high numbers of plasma cells producing autoantibodies. Autoantibodies bind circulating nucleosomes forming immune complexes that sustain IFNa production by pDCs. High levels of IFNa in SLE could also explain the T and B lymphopaenia through direct suppressive e¡ects on thymus and bone marrow, respectively.

DENDRITIC CELL IMMUNOTHERAPY 233

FIG. 4. Approaches to DC-based immune intervention. (1) ‘Classic’ vaccines that target DCs randomly. (2) Today’s antigen-loaded ex vivo generated DCs as vaccines. (3) Tomorrow’s in vivo targeting of speci¢c DC subsets by vectors/antibodies charged with antigen, e¡ector molecules, T cell cytokines as well as DC subset-speci¢c ligands.

234 BANCHEREAU ET AL

DENDRITIC CELL IMMUNOTHERAPY

235

technology (Blanco et al 2001). We found that blood mononuclear cells from all active SLE patients over-express IFN-regulated genes. This signature is extinguished by treatment with high dose i.v. steroids, further pointing to IFN as a speci¢c target for therapeutic intervention. Thus, understanding the pathophysiology of the disease may allow the generation of new drugs that will target the cause of the disease (excessive IFNa production leading to unabated DC activation) rather than attempt to treat the late symptoms. In this present case one would like to ¢nd ways to inhibit the excessive interferon production or to prevent its e¡ects. Conclusion What we learn from studying autoimmunity will help us induce strong tumourspeci¢c immunity. What we learn from ex vivo generated DC vaccines will permit us to develop ‘intelligent missiles’. These generic vaccines equipped with (tumour) antigens, chaperones, DC activation molecules and speci¢c ligands will target distinct DC subsets to induce the type of immunity desired to counteract the pathological insult (Fig. 4). References Banchereau J, Briere F, Caux C et al 2000 Immunobiology of dendritic cells. Ann Rev Immunol 18:767^811 Banchereau J, Schuler-Thurner B, Palucka AK, Schuler G 2001a Dendritic cells as vectors for therapy. Cell 106:271^274 Banchereau J, Palucka AK, Dhodapkar M et al 2001b Immunological and clinical responses to CD34+ progenitor-derived dendritic cell vaccine. Cancer Res 61:6451^6458 Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J 2001 Induction of dendritic cell di¡erentiation by IFN-alpha in systemic lupus erythematosus. Science 294:1540^1543 Lanzavecchia A, Sallusto F 2001 Regulation of T cell immunity by dendritic cells. Cell 106: 263^266 Liu YJ, Kanzler H, Soumelis V, Gilliet M 2001 Dendritic cell, plasticity and cross-regulation. Nat Immunol 2:585^589 Steinman RM, Turley S, Mellman I, Inaba K 2000 The induction of tolerance by dendritic cells that have captured apoptotic cells. J Exp Med 191:411^416

DISCUSSION Bach: You did not allude to another important factor in lupus, which is the nucleosome complexes. There is an additional recent observation of the possible accumulation of Toll-like receptor 9. What kind of e¡ect would this stimulation with Cpg give in your system? Banchereau: We believe that the type of DCs that are made in response to interferon are very di¡erent from other DCs such as IL4-generated DCs. We

236

DISCUSSION

think that the type of DC is critical for the presentation of antigen. These SLE-DCs may capture the dead neutrophils (or whatever cell type is involved) and present them in a fashion that permits the development of the nucleosome complex speci¢cities while other DCs will not. Bach: Do you see that as an initial event? Banchereau: We view the excess IFNa production as the key event is in SLE development. The ‘500’ genetic mutations that can induce lupus may eventually lead to an uncontrolled IFNa production. This is why the disease is so clear on the arrays. This IFNa is now going to be boosting two pathways: the adaptive immunity pathway and the innate immunity pathway. We are trying to make a monoclonal antibody that would neutralize IFNa. Powrie: There is a correlation with elevated IL10 in lupus patients. There are clinical strategies targeting this. Banchereau: In my opinion, IL10 is one of the last molecules of the whole cytokine cascade to target. It is the molecule that makes the plasma cell as in humans, IL10 is a plasma cell di¡erentiation factor. Powrie: Is there any link between your IFNa stimulation and IL10 production? Banchereau: We haven’t looked to see whether there are regulatory T cells in these patients, but there is plenty of IFNa and IL10. Thus if we listen to Maria Grazia Roncarolo, this should make plenty of regulatory T cells. Roncarolo: These patients have high IL10 and a number of clear signs that this IL10 is operational. Banchereau: Blocking IL10 is one strategy for treatment of lupus. Certainly, there are data in the literature indicating that there is circulating IL10. Bach: There are claims that blocking IL10 does improve the situation. Banchereau: There is a study on six patients showing some bene¢cial e¡ect of antiIL10 (Llorente et al 2000). Roncarolo: Exactly. This is one report claiming that there was improvement with anti-IL10 antibody. The immature neutrophils that you see are basically the same type of immature neutrophils seen in children on low doses of steroids. Can you really show that this is not related to steroids? Pascual: We are absolutely sure, because one-third of these patients are brand new patients who have not been treated before. Bluestone: It could be their own steroids, triggered by the disease process. Banchereau: Do you know whether there are higher levels of steroids in these patients? Pascual: No. Harrison: You have to give pharmacological doses to get this sort of level of neutrophil response, don’t you? Pascual: We do not treat them with high oral dose steroids. These are children and daily doses of steroids have side e¡ects. We use a pulsed therapy, with 30 mg

DENDRITIC CELL IMMUNOTHERAPY

237

per kilo per day for three days, weekly at the beginning and then tapering down. Bluestone: Regarding the melanoma DC vaccine study and the autoproliferation you observed in vitro in patients responding clinically, you tried removing the CD25+ cells and in one patient you had increased autoreactivity. Banchereau: Yes, that was in the spontaneous proliferation. Bluestone: Did you do the same experiment in trying to generate the CTL? Banchereau: We haven’t looked yet but that is a good suggestion. The problem we have is that when we look at the CD25+ cells it doesn’t correlate with the status of the patients’ disease. Bluestone: Broadly, you could just get rid of CD4s because you are looking at a CD8 response, and I am assuming you are adding IL2 to your cultures to get a good CTL response. Banchereau: We do IL7 for three days and then add a little bit of IL2 for the last 4 days. Bluestone: One way to interpret the KLH data is that through the DCs themselves you are inducing an autoreactive response. I understand you might not be able to get rid of cancer if you don’t generate an autoimmune response, but the patients might not be much better o¡ in this case. What are the implications of this for therapy? Banchereau: This has puzzled us. We would need to make clones and identify their speci¢city. We were wondering whether there would be KLH speci¢city here. Remember, in the spontaneous proliferation observed in cultures we do not add KLH. Yet, it may be that KLH is still present on a circulating DC, and perhaps this DC stays in the patients for a long time. This could also be a cross-presentation e¡ect when the DCs are dying. Bluestone: You don’t know that this is a KLH response at all. You are putting in DCs and getting a response. Banchereau: That is correct. Bluestone: If you mix DCs pretreatment with T cells post-treatment, or vice versa, do you get any autoreactive response? Banchereau: No. You need DCs and T cells both post-treatment. It is not pure simple autoreaction. Roncarolo: I have a general question. When people do a haematopoietic stem cell transplantation, they often use GM-CSF-mobilized blood as source of CD34+ cells. We increasingly think that these cells are very di¡erent from the bone marrow in terms of things such as DC progenitors. Did you ever compare the DCs generated from the blood CD34+ cells with DCs generated from CD34+ cells isolated from cord blood or bone marrow? Banchereau: I have not done this formally. Those are di⁄cult experiments to get through the Institutional Review Board.

238

DISCUSSION

Mitchison: A ¢nding that is encouraging for the immunologists is that in cases where tumour progression seems to have been delayed but not prevented by immunization, the eventual relapse is associated with loss of expression of the speci¢c antigen used for immunization (Jager et al 2001). Have you seen this? Banchereau: We put four tumour antigen peptides in the cocktail to avoid tumour escape. If we had a single peptide in we thought that the tumour would come back. Mitchison: How did you know that ¢ve years ago? Banchereau: It seemed logical: tumours change fast and if you put pressure on the tumour with a single CTL, a tumour cell will arise not expressing this tumour antigen. This is why we think that this study has been successful. It was essential for us to avoid tumour escape. Now we have other strategies, including a trial with dead cells for cross-presentation. References Jager D, Jager E, Knuth A 2001 Immune responses to tumour antigens: implications for antigen speci¢c immunotherapy of cancer. J Clin Pathol 54:669^674 Llorente L, Richaud-Patin Y, Garcia-Padilla C et al 2000 Clinical and biologic e¡ects of antiinterleukin-10 monoclonal antibody administration in systemic lupus erythematosus. Arthritis Rheum 43:1790^1800

Regulation of viral and autoimmune responses Chrystelle Asseman and Matthias von Herrath La Jolla Institute for Allergy and Immunology, Division of Immune Regulation, 10355, Science Center Drive, San Diego, CA 92121, USA

Abstract. We have studied the induction and e¡ector function of Th2-like regulatory cells in mouse models for type 1 diabetes (NOD and RIP-LCMV). CD4+ lymphocytes with speci¢city for insulin can be induced by immunization with the insulin B chain via the oral route or by DNA vaccination. Such cells are protective upon adoptive transfer and prevent diabetes development in syngeneic pre-diabetic recipients. In comparison to non-regulatory insulin B-speci¢c cell lines, they produce high amounts of interleukin (IL)4 and IL10, whereas interferon (IFN)g and tumour necrosis factor (TNF)a levels are comparable. Indeed, IL4 is essential for the protective capability, as evidenced by use of IL4-de¢cient mice and sorting of IL4+ versus IL4 lymphocytes prior to transfer. Mechanistically, these cells act as bystander suppressors in the pancreatic draining node, the location where their cognate antigen, insulin B, is presented during the pre-diabetic in£ammatory process. As a consequence, the autoaggressive response is locally dampened. We propose that this is achieved by modulation of antigen presenting cells that lose the ability to propagate aggressive responses after exposure to IL4 or IL10 in vitro. The clinically attractive side of our strategy is that it only acts as the site of in£ammation, thus circumventing systemic side e¡ects. In order to avoid induction of insulin B-speci¢c autoaggressive T cells we have demonstrated that administration of IL4 or IL10 at the time of immunization is bene¢cial and therefore should be part of a potential future clinical application. Interestingly, these Th2-like regulators share in our systems no features with the so-called CD25+ regulatory cells, whose antigen speci¢city is still unclear. However, we have recent evidence that virus speci¢c CD25+ cells can be generated and are able to a¡ect antiviral responses in vivo. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 239^256

About regulatory cells The main focus in immunology has been directed towards the understanding of immunity generated in response to infection, vaccination/immunization or during autoimmunity. Consequently, most investigators have focused on de¢ning parameters that constitute an e¡ective host defence or an autoaggressive 239

240

ASSEMAN & VON HERRATH

response. However, why host-defence responses almost always return to baseline levels and autoimmunity usually develops very slowly remain important questions. It is known that activation induced cell death is a major negative feedback loop that eliminates e¡ector T cells after a certain time, but it is not the only one (Abbas 1996). When studying immune regulation, one discovers a multitude of e¡ector cells that function themselves as negative feedback on other immune responses. One could view such regulatory cells as the ‘secondary side’ of immunity that is frequently overlooked, because we tend to focus on the more immediately obvious primary responses, for example lymphocytes that kill virally infected cells or autoaggressive T cells. Regulation and regulatory cells are thus absolutely essential for the balance of our immune system and the number of feedback loops is directly proportional to the baseline-stability that is achieved and maintained (see Fig. 1). Based on these considerations, one can expect a great deal of variety of regulatory cells that will exhibit diverse functions. Furthermore, a cell that has counter-regulatory function in one situation can be a primary e¡ector cell in another. This conclusion makes it necessary that we carefully evaluate the cells with balancing function for each disease or experimental situation. This is usually achieved through adaptive transfer experiments resulting in identi¢cation of a cell capable of actively suppressing the immunological process under evaluation in a recipient. During this conference, we will see presentations that encompass the major regulatory components of our immune system. These include antigen speci¢c regulatory cells such as modulated antigen presenting cells (APCs) and Th2-like CD4+ lymphocytes (Arreaza et al 2001, Homann et al 1999, Yamamoto et al 2001) as well as more general regulators encompassing CD25high, NKT (Bach 2001a, 2001b), Tr1 (Levings et al 2001, Roncarolo et al 2001) and possibly g/d CD8+ lymphocytes (Hanninen & Harrison 2000). The most current knowledge on their e¡ector functions will be presented and discussed, which should open up new avenues for their use in immune based interventions primarily in autoimmunity but possibly also in other areas. In the past 5 years our laboratory put a strong focus on the investigation of regulatory lymphocytes. Our primary interest was initially devoted to autoreactive CD4 lymphocytes with regulatory e¡ector functions that decrease activity of autoaggressive T cells in type 1 diabetes (Homann et al 1999). Such cells are therapeutically attractive, because they can be elicited by external immunization and could at some point become a directional goal of antigenspeci¢c immunotherapy (Coon et al 1999). In the following, we will describe our experience in this area and discuss obstacles and possible avenues, before induction of antigen-speci¢c regulators become a clinical reality. More recently, another genre of regulators has begun to fascinate us, the socalled CD25+ lymphocytes (McHugh et al 2001, Shevach et al 2001). These cells

VIRAL AND AUTOIMMUNE RESPONSES

241

FIG. 1. Regulation might play ubiquitous roles in maintaining homeostasis and adjusting the immune system back to baseline levels following infections and preventing development of autoimmunity.

are under much debate and controversy, because their antigen-speci¢cities and e¡ector functions are not known. Likely, the CD25high cells encompass a variety of di¡erential T lymphocytes, which makes their study di⁄cult and may account for much of the controversies surrounding them. A common denominator, when dissecting regulatory mechanisms, appears to be the antigen-presenting cell: at this level both, autoreactive CD4 lymphocytes, CD25high cells and possibly other regulators (Th3 TGFb producers? [Haanen et al 1999]) might act by transforming APCs into negative regulators of the immune system. An overview of this network, as one could view it in general, is shown in Fig. 2. Cytokine-dependent regulatory lymphocytes Th2-like CD4 cells are known to counterbalance Th1/Tc1 responses, which works through the action of cytokines such as IL4 that suppress production of other mostly more in£ammatory cytokines, such as IL12 or interferon (IFN)g (Homann et al 1999). Furthermore, APCs are likely modulated by such cells (Homann et al 1999) resulting in an incapacitated APC phenotype that is less e⁄cient in sustaining an ongoing (auto)-immune response (Fig. 2A). In most models, these cells have a given antigen speci¢city and can be autoreactive

242

ASSEMAN & VON HERRATH

(‘autoreactive regulators’). They have therefore high therapeutic potential, since they can be induced by external immunization. Similar to the Th3-like regulators (see below) (Miller et al 1993), they proliferate poorly and can almost be regarded as anergic from this standpoint, if it were not for their ability to produce cytokines and possibly chemokines. We and others have identi¢ed, isolated and transferred such CD4 cells with speci¢city for insulin (Bergerot et al 1999, Coon et al 1999, Homann et al 1999, Ruiz et al 1999, Shaw et al 1997). From studies using cytokine de¢cient mice it has become clear that IL4 is at least one of the essential cytokines these cells require to be regulatory in vivo. This is supported by the fact that only the IL4 producing fraction of insulin B (insB)-speci¢c cell lines is capable of protecting prediabetic mice in transfer experiments and by studies that demonstrate an exquisite protective function of IL4 in type 1 diabetes. However, such cells also produce other cytokines and their potential involvement in regulation is still unclear. In particular, IL10 might exert important functions and in this aspect the insB-speci¢c regulators might resemble Tr1 lymphocytes (see below). How precisely do these cells work in vivo? After adoptive transfer they are found in lymphoid organs, but only proliferate under conditions, where they see their cognate antigen (insB). This occurs solely in the pancreatic draining lymph node of pre-diabetic mice that have ongoing b-cell destruction, a process during which intracellular insulin will be taken up and its fragments presented by professional APCs. Their e¡ector functions exert a suppressive e¡ect that is evident through decreased activity of aggressive lymphocytes only locally in the pancreatic lymph node and islets, which illustrates the potential for low systemic side e¡ects in antigen-speci¢c regulation (Fig. 2) (Homann et al 1999). In our hands, no evidence could be found for attributing these Th2-like regulators to the CD25+ family. Indeed, CD25+ expression did not correlate with their suppressive capability and one has to therefore regard them as a separate entity. Tr1 CD4 lymphocytes were ¢rst discovered in humans (Roncarolo et al 2001) and are characterized by secretion of high levels of IL10. They can downmodulate antigen speci¢c responses in vitro and in vivo, but are of unknown antigen speci¢city themselves (Cottrez et al 2000, Levings et al 2001). Since IL10 has profound e¡ects on APCs, most of them dampening, their clinical interest is high; however, it is still quite unclear how they can be induced in vivo in a therapeutic fashion. It is possible that such cells are the human counterpart of the antigen-speci¢c Th2-like regulators described in the previous paragraph in the mouse, because of their phenotypic and functional similarity. The fact that they can also a¡ect Th2 responses argues against this assumption (Cottrez et al 2000). This notion will become clearer after more facts about their antigen speci¢cities become known.

VIRAL AND AUTOIMMUNE RESPONSES

243

244

ASSEMAN & VON HERRATH

FIG. 2. (A) During an autoimmune response, autoreactive cells are activated locally by APCs presenting self-antigens. This activation induces the release of in£ammatory mediators like IFNg and TNFa that in turn induce a cascade of reactions leading to tissue destruction. Naturally occurring CD4+ CD25+ cells may be attracted by certain chemokines (such as CCL4; Bystry et al 2001), produced by stimulated APCs, to the site of in£ammation and undergo activation. As a result of being activated, CD4+CD25+ cells up-regulate the expression of CTLA4, membranebound TGFb and secretion of TGFb. These molecules are negative regulators of immune responses and will down-modulate activated autoreactive cells, either directly (for example by interaction with TGFb RII expressed on autoreactive cells) or indirectly by modulating the function of APCs. This close control of potentially autoreactive cells by regulatory cells ensure that, altogether, autoimmune pathologies remain a rare phenomenon. (B) In case of infection (for example by a virus), the production of cytokines/enhancement of cytolytic activity by e¡ector cells activated by viral antigens is crucial for controlling the viral expansion. Due to the recruitment of DCs and expression of various cytokines/chemokines, it is likely that in addition to e¡ector cells, regulatory cells also migrate to the site of in£ammation. In vitro studies have shown that regulation by CD4+CD25+ cells is antigen and MHC non-speci¢c, meaning Treg cells can exert their suppressive activity by bystander suppression. Therefore the concomitant presentation of self and viral peptides should activate Treg cells that in turn would suppress the antiviral response. Alternatively, Treg cells could require in vivo TCR activation by the same antigen as the cells they do suppress. It would be plausible, given the high e⁄ciency of Treg cells demonstrated in di¡erent systems, that some mechanisms of control have evolved to ensure that regulation of immune responses occurs adequately, through tight antigen speci¢city. This is the line of investigation we have been addressing recently by studying the generation of Treg cells speci¢c for viral antigens following LCMV infection. LCMV infection leads to a strong immune response that allows a rapid clearance of the virus. Elimination of the virus is followed by a dramatic reduction in the pool of activated cells, mainly achieved for CD8+ cells through apoptosis. However a fraction of cells are spared from that purging process and become part of the antigen experienced/ memory cell compartment. We hypothesized that speci¢c regulatory cells could be generated during the establishment of the memory cell compartment. The common view would be that viral speci¢c Treg cells would suppress isolated cells that had escaped apoptosis. In addition, viral speci¢c Treg cells could suppress activated cells before they undergo apoptosis and therefore allow the di¡erentiation of these activated cells into memory/e¡ector cells. Whether such regulatory cells are generated and whether their suppressive activity follows an identical pattern involving CTLA4 and TGFb are currently under investigation.

VIRAL AND AUTOIMMUNE RESPONSES 245

246

ASSEMAN & VON HERRATH

Speci¢c regulatory approaches in type 1 diabetes The existence of autoantigen-speci¢c regulatory cells bears the unique opportunity to rather ‘gently’ in£uence the immune system. This relies in particular on the fact that antigen-speci¢c regulatory lymphocytes will only become activated, when and where they see their cognate antigen. In the case of organ-speci¢c diseases, this will result in localized e¡ector functions, if antigens speci¢c for the target cell or organ are used for immunization (Coon et al 1999, Fathman et al 2000, Shaw et al 1997). This type of strategy has been the focus of our laboratory for many years. We were successful in inducing autoreactive regulatory CD4 lymphocytes directed to the insulin B chain, which is an islet speci¢c autoantigen in type 1 diabetes. Two approaches are noteworthy: 1.

Oral feeding of insulin favours the induction of a regulatory response to the insulin B chain (insB). When insulin is fed orally to RIP-LCMV mice (an experimental model of virally induced diabetes), disease development is reliably prevented in more than 50% of the animals (Homann et al 1999, von Herrath et al 1996). The feeding of insulin results in induction of insulin speci¢c CD4 responses that can protect from diabetes through a mechanism requiring IL4. These cells can therefore be considered Th2-like regulators, because of the cytokines they secrete (IL4 and IL10). However, they do not behave like regular Th2 cells, because their phenotype in vitro and in vivo is mostly anergic and too strong a stimulation will result in loss of their suppressive capability. Bystander suppression of aggressive responses mediated by these cells occurs only in the pancreatic draining lymph node and is likely mediated by reduction of co-stimulatory capacity of APCs after their exposure to IL4 or IL10. Similarly, the oral insulin strategy has been successful in the NOD mouse model for type 1 diabetes and the involvement of TGFb has been demonstrated. It is not clear, whether such TGFb producers are of a separate, Th3 phenotype or whether these cells are possibly a subgroup of the CD25+ regulatory cells (Miller et al 1993, Zhang et al 2001, 1990). Based on these encouraging ¢ndings from experimental models it is worrisome that all human oral antigen trials have failed to date. The reasons for this disappointment could be manifold. For example, translating the e¡ective oral antigen dose from mice to humans is not trivial and in trials the dose would have been (by an approximate factor of 200) too low, if one would apply direct relativity in terms of organism size. Second, the response curves to oral antigens are bell-shaped and both (too high as well as too low) doses are ine¡ective (Weiner et al 1994). This ¢nding necessitates a very precise dose regimen and possibly monitoring on an individual basis, which

VIRAL AND AUTOIMMUNE RESPONSES

2.







247

has not yet been achieved in humans. Lastly, any autoantigen, even if administered orally, can induce autoaggressive responses, which could counterbalance the bene¢cial e¡ect of regulatory T cells (Blanas et al 1996, Hanninen et al 2001). To circumvent these di⁄culties, our laboratory has utilized a novel strategy for induction of autoreactive regulators, DNA vaccination, which will be discussed in the following paragraph. DNA vaccines with vectors expressing islet antigens can prevent type 1 diabetes in experimental mouse models (RIP-LCMV (Coon et al 1999) and NOD (Bot et al 2001). As for the oral insulin administration, CD4+ bystander suppressors secreting IL4 and IL10 and enhancing a more Th2 environment in islets and draining lymph nodes mediate the protection. The advantage of this strategy is that response modulators in form of cytokines can be applied more easily at the time of immunization and that the antigenic sequence can be engineered to be devoid of cytotoxic T cell epitopes thus preferentially driving a CD4 regulatory response. In our hands, addition of IL4 or IL10 enhances protection (our unpublished results). In this way, augmentation of autoaggressive responses can be avoided and clinical safety enhanced. However, before this approach can be applied for prevention of diabetes in humans, the following milestones will need to be achieved: Since achievement of protection varies on an individual basis, monitoring anticipation of therapeutic success by tracking induction of regulatory lymphocytes in peripheral blood will be essential. In this way, not only can the frequency of immunization be adjusted individually, but also the induction of aggressive lymphocytes can be avoided (see for example Hanninen et al 2001). It is quite clear at this stage that the choice of autoantigen can have important e¡ects on the outcome of immunization (aggressive versus regulatory responses). For example, porcine insulin B chain has had bene¢cial e¡ects, whereas utilization of autologous mouse insulin can possibly accelerate disease. Better guidelines for choosing the best antigen need to be devised. It is possible that this can be achieved by monitoring induction of isletantigen speci¢c lymphocytes in peripheral blood.

Regulatory cells with unknown antigen speci¢city and e¡ector function CD4+CD25+ cells are involved in regulating autoimmunity in several experimental situations (Read et al 2000, Sakaguchi et al 1995, Taylor et al 2001). Their antigen speci¢city is unclear and their e¡ector mechanism appears to require cell contact between the responding and the regulatory T cells, possibly involving APCs. Questions that need to be addressed are, whether there are better markers than

248

ASSEMAN & VON HERRATH

the IL2a receptor. Clearly, CD25+ lymphocytes will always contain a signi¢cant fraction of merely activated T cells without regulatory function and therefore further understanding is urgently needed. In our opinion, the ongoing mechanistic controversies surrounding CD25+ lymphocytes could be explained by the consideration that the population of CD25+ cells will contain di¡erent types of suppressor cells that act via distinct mechanisms. This would explain, why in some of the mechanistic examples detailed below the in vitro requirements for regulation are di¡erent from those in vivo; furthermore, in vivo, depending on the targeted antigens, the requirements for maintenance of tolerance can also be di¡erent. Thus, some observations of CD25+-mediated regulation that appear to be relevant in one system but do not apply in others could be due to the fact that di¡erent sub-populations possibly with di¡erent antigenic speci¢city are mediating the e¡ect. Mechanisms of suppression by CD25+ cells: requirement for TGFb and/or CTLA4 but not IL10? Initially it was reported that regulation by CD25+ lymphocytes was TGFb independent (Takahashi et al 1998, Thornton & Shevach 1998). However a recent paper indicates that activated CD25+ cells express surface-bound TGFb and even produce TGFb following strong activation in vitro (Nakamura et al 2001). In addition, exogenous TGFb inhibits responder cell (CD25 ) proliferation, and in an experimental model of colitis, treatment with anti-TGFb can abrogate the protection conferred by CD25+ cells (Read et al 2000). In contrast, studies using antibody blockade of TGFb in vitro (Takahashi et al 1998, Thornton & Shevach 1998) could not identify any role for TGFb in CD25+-mediated regulation (Shevach et al 2001). Paralleling the di¡erent outcomes observed with TGFb, CTLA4 (which upon triggering has been shown to induce TGFb expression (Chen et al 1998)) has been involved in regulation in some systems (Read et al 2000, Takahashi et al 2000) but not in others (Thornton & Shevach 1998). The observation that upon activation CTLA4 is expressed by both CD25+ cells and responders, but that only expression of CTLA4 on Treg cells is required for regulation (CTLA4-de¢cient responders are normally suppressed) would explain that partial neutralization (by antibodies) of CTLA4 on Treg cells could not alter induction of regulation. Generation and functional activities of CD25+ are independent of IL10 since these cells are present in IL10-de¢cient mice and functional in vitro (Thornton & Shevach 1998). However, these mice develop colitis, indicating a lack of regulation against self or bacterial antigens speci¢cally restricted to the large intestine (Kuhn et al 1993). In agreement with this observation, IL10de¢cient CD25+ cells isolated from mesenteric lymph nodes are able to induce

VIRAL AND AUTOIMMUNE RESPONSES

249

colitis when transferred into RAG-2KO recipients (Asseman et al 2003). In contrast, IL10-de¢cient CD25+ cells isolated from spleens are not colitogenic, indicating that regulatory functions of CD25+ cells triggered by antigens derived from the intestinal environment are dependent on IL10. Self-antigen speci¢city of CD25+ regulators? Since CD25+ cells are generated in the thymus (Itoh et al 1999), it is reasonable to postulate that they recognize self antigens. Of interest is the observation that although OVA-speci¢c TCR transgenic mice do not express the speci¢c OVA peptide in the thymus, they possess Treg cells (anergic and suppressive) with speci¢city for OVA (Takahashi et al 1998). In this case, the reason these regulatory cells are selected in the thymus is the presence of dual TCRs (due to rearrangement of transgenic b chain with endogenous a chain) and such regulatory cells are absent in transgenic RAG-de¢cient (or SCID) mice. This suggests that, once committed as regulatory cells, a di¡erent antigen (in that case triggering a second receptor, but in general, any agonist/cross-reactive antigen) can trigger regulatory cells and induce suppression. One could therefore hypothesize that any non-self antigen in the periphery with enough homology to trigger self-speci¢c CD25+ Treg cells could induce immunosuppression. This ‘self-restricted’ view of naturally occurring CD25+ cells should therefore be reconsidered and experimental systems set up to test this hypothesis. It has been reported that, once activated, CD25+ cells mediate their function by bystander immunosuppression (antigen and MHC independent) in vitro (Takahashi et al 1998, Thornton & Shevach 2000). In addition, CD25+ cells are activated at lower antigen concentrations than CD25 cells (Takahashi et al 1998). Although these in vitro data are convincing and reproducible, one has to be puzzled by the logical conclusion that in vivo a relative abundance of self-antigens could potentially chronically activate Treg cells. This would result in almost ubiquitous bystander suppression and one would have to wonder, how productive immune responses could still be induced? We would like to propose that it is more likely, since the repertoire of CD25+ cells is diverse, that their activation and induction of suppression is antigen speci¢c. Our studies indicate that such antigen-speci¢c CD25+ cells can be propagated in vitro on viral antigens and also play a role in down-modulating anti-viral responses in vivo (see also Figs 1 and 2B). In these experiments, CD4+CD25+ lymphocytes were isolated from LCMV-immune mice and propagated for 3 weeks on viral antigen in vitro in the presence of IL2. Such cells had potent capability to downmodulate autologous (LCMV-speci¢c) responses in vitro and in vivo. From these preliminary ¢ndings one can assume that it is possible to generate antigen speci¢c

250

ASSEMAN & VON HERRATH

CD25+ regulators. Future studies will dissect whether these cells are more potent in regulating responses directed to their own viral antigen or whether such cells are acting antigen non-speci¢cally on other populations.

The theme of APC modulation Antigen presenting cells are the key drivers of most if not all immune responses. Their precise maturation and activation stage is of course essential for the class and magnitude of any resulting T cell activation (Banchereau & Steinman 1998, Blanco et al 2001, Casares et al 1997, Pulendran et al 2001). It has been observed that regulatory lymphocytes can impact APCs and modulate their state (Taams et al 2000). This can occur by cell^cell contact or by cytokines. Immature APCs might be less capable of driving immune responses and can turn T cells o¡ in certain situations. Furthermore there have been several instances, where APCs were modulated, for example via blockade of co-stimulation, and they assumed regulatory functions. In certain instances they induced regulatory lymphocytes. Thus, there appears to be a ¢ne-tuned network between regulatory cells, APCs and non-regulatory lymphocytes. Who is a player on which side depends on the read out, i.e. relation to host defence, organ-speci¢c immunopathology, and autoimmunity. In our laboratory, we have recently discovered an interesting cell type that shares phenotypic and functional qualities from both APCs and NK cells (Homann et al 2002). Such bitypic NK/DCs are DX5/NK1.1 and CD11c positive and increase in number in the spleen following viral (LCMV) infection. They only acquire antigen-speci¢c regulatory function if CD40L co-stimulation is blocked during this acute viral infection (immune activation) event. As a consequence, NK/DCs are capable of suppressing viral and autoimmune responses in our experimental models. How such cells can turn o¡ e¡ector functions in both CD4 and CD8 populations is unclear, and so is their origin. It is possible that they arise from a common progenitor and exert suppressive activity through certain cytokines or cell^cell contact. The theme of APCs with regulatory function is intriguing and might depend on the precise in£ammatory environment in which an APC takes up and presents antigen. Along these lines, apoptotic cells appear to be capable of generating regulatory APCs, whereas necrotic cells are not (Ferguson et al 2002). In our studies and those of others it has so far been di⁄cult to precisely di¡erentiate between regulatory or stimulatory APCs and the ¢eld is still confused. It is possible that we are still lacking knowledge about certain crucial regulatory cells or that APC phenotype and functions are by far more heterogeneous than previously assumed.

VIRAL AND AUTOIMMUNE RESPONSES

251

Acknowledgements This is publication 501 from the La Jolla Institute for Allergy and Immunology. This work was supported by grants DK 51091 and U-19 AI51973 to MGVH and JDFI 3-2000-902 to Chrystelle Asseman. We thank Diana Frye for assistance with the manuscript preparation. References Abbas AK 1996 Die and let live: eliminating dangerous lymphocytes. Cell 84:655^657 Arreaza GA, Sharif S, Cameron MJ, Chen W, Delovitch T 2001 Role of regulatory T cells in the pathogenesis of autoimmune diabetes. Curr Dir Autoimmun 4:308^332 Asseman C, Read S, Powrie F 2003 IL-10 is required for T cell mediated control of colitis induced by antigen-experienced but not naive T cells. J Immunol, in press Bach J 2001a Immunotherapy of insulin-dependent diabetes mellitus. Curr Opin Immunol 13:601^605 Bach JF 2001b Non-Th2 regulatory T-cell control of Th1 autoimmunity. Scand J Immunol 54:21^29 Banchereau J, Steinman RM 1998 Dendritic cells and the control of immunity. Nature 392: 245^252 Bergerot I, Arreaza GA, Cameron MJ et al 1999 Insulin B-chain reactive CD4+ regulatory Tcells induced by oral insulin treatment protect from type 1 diabetes by blocking the cytokine secretion and pancreatic in¢ltration of diabetogenic e¡ector T-cells. Diabetes 48:1720^1729 Blanas E, Carbonne FR, Allison J, Miller, Heath WR 1996 Induction of autoimmune diabetes by oral administration of autoantigen. Science 274:1707^1709 Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J 2001 Induction of dendritic cell di¡erentiation by IFN-alpha in systemic lupus erythematosus. Science 294:1540^1543 Bot A, Smith D, Bot S et al 2001 Plasmid vaccination with insulin B chain prevents autoimmune diabetes in nonobese diabetic mice. J Immunol 167:2950^2955 Bystry RS, Aluvihare V, Welch KA, Kallikourdis M, Betz AG 2001 B cells and professional APCs recruit regulatory T cells via CCL4. Nat Immunol 2:1126^1132 Casares S, Inaba K, Brumeanu TD, Steinman RM, Bona CA 1997 Antigen presentation by dendritic cells after immunization with DNA encoding a major histocompatibility complex class II-restricted viral epitope. J Exp Med 186:1481^1486 Chen W, Jin W, Wahl SM 1998 Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4+ T cells. J Exp Med 188:1849^1857 Coon B, An LL, Whitton JL, von Herrath MG 1999 DNA immunization to prevent autoimmune diabetes. J Clin Invest 104:189^194 Cottrez F, Hurst SD, Co¡man RL, Groux H 2000 T regulatory cells 1 inhibit a Th2-speci¢c response in vivo. J Immunol 165:4848^4853 Fathman CG, Costa GL, Seroogy CM 2000 Gene therapy for autoimmune disease. Clin Immunol 95:39^43 Ferguson TA, Herndon J, Elzey B, Gri⁄th TS, Schoenberger S, Green DR 2002 Uptake of apoptotic antigen-coupled cells by lymphoid dendritic cells and cross-priming of CD8+ T cells produce active immune unresponsiveness. J Immunol 168:5589^5595 Haanen JB, Wolkers MC, Kruisbeek AM, Schumacher TN 1999 Selective expansion of crossreactive CD8+ memory T cells by viral variants. J Exp Med 190:1319^1328 Hanninen A, Harrison LC 2000 Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model. Immunol Rev 173:109^119

252

ASSEMAN & VON HERRATH

Hanninen A, Braakhuis A, Heath WR, Harrison LC 2001 Mucosal antigen primes diabetogenic cytotoxic T-lymphocytes regardless of dose or delivery route. Diabetes 50:771^775 Homann D, Holz A, Bot A et al 1999 Autoreactive CD4+ lymphocytes protect from autoimmune diabetes via bystander suppression using the IL-4/Stat6 pathway. Immunity 11:463^472 Homann D, Jahreis A, Wolfe T et al 2002 CD40L blockade prevents autoimmune diabetes by induction of bitypic NK/DC regulatory cells. Immunity 16:403^415 Itoh M, Takahashi T, Sakaguchi N et al 1999 Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317^5326 Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W 1993 Interleukin-10-de¢cient mice develop chronic enterocolitis. CEL 75:263^274 Levings MK, Sangregorio R, Galbiati F et al 2001 IFN-alpha and IL-10 induce the di¡erentiation of human type 1 T regulatory cells. J Immunol 166:5530^5539 McHugh RS, Shevach EM, Thornton AM 2001 Control of organ-speci¢c autoimmunity by immunoregulatory CD4+CD25+ T cells. Microbes Infect 3:919^927 Miller A, al-Sabbagh A, Santos LM, Das MP, Weiner HL 1993 Epitopes of myelin basic protein that trigger TGF-beta release after oral tolerization are distinct from encephalitogenic epitopes and mediate epitope-driven bystander suppression. J Immunol 151:7307^7315 Nakamura K, Kitani A, Strober W 2001 Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor beta. J Exp Med 194:629^644 Pulendran B, Kumar P, Culter CW, Mohamadzadeh M, Van Dyke T, Banchereau J 2001 Lipopolysaccharides from distinct pathogens induce di¡erent classes of immune responses in vivo. J Immunol 167:5067^5076 Read S, Malmstrom V, Powrie F 2000 Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal in£ammation. J Exp Med 192:295^302 Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK 2001 Type 1 T regulatory cells. Immunol Rev 182:68^79 Ruiz PJ, Garren H, Ruiz IU et al 1999 Suppressive immunization with DNA encoding a selfpeptide prevents autoimmune disease: modulation of T cell costimulation. J Immunol 162:3336^3341 Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M 1995 Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151^1164 Shaw MK, Lorens JB, Dhawan A et al 1997 Local delivery of interleukin 4 by retrovirustransduced T lymphocytes ameliorates experimental autoimmune encephalomyelitis. J Exp Med 185:1711^1714 Shevach EM, McHugh RS, Piccirillo CA, Thornton AM 2001 Control of T-cell activation by CD4+ CD25+ suppressor T cells. Immunol Rev 182:58^67 Taams LS, Boot EP, van Eden W, Wauben MH 2000 ‘Anergic’ T cells modulate the T-cell activating capacity of antigen-presenting cells. J Autoimmun 14:335^341 Takahashi T, Kuniyasa Y, Toda M et al 1998 Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969^1980 Takahashi T, Tagami T, Yamazaki S et al 2000 Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303^310

VIRAL AND AUTOIMMUNE RESPONSES

253

Taylor PA, Noelle RJ, Blazar BR 2001 CD4+CD25+ immune regulatory cells are required for induction of tolerance to alloantigen via costimulatory blockade. J Exp Med 193:1311^1318 Thornton AE, Shevach EM 1998 CD4+ CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Thornton AM, Shevach EM 2000 Suppressor e¡ector function of CD4+CD25+ immunoregulatory T cells is antigen nonspeci¢c. J Immunol 164:183^190 von Herrath MG, Dyrberg T, Oldstone MB 1996 Oral insulin treatment suppresses virusinduced antigen-speci¢c destruction of beta cells and prevents autoimmune diabetes in transgenic mice. J Clin Invest 98:1324^1331 Weiner HL, Friedman A, Miller A et al 1994 Oral tolerance: immunologic mechanisms and treatment of animal and human organ-speci¢c autoimmune diseases by oral administration of autoantigens. Annu Rev Immunol 12:809^837 Yamamoto AM, Chernajovsky Y, Lepault F et al 2001 The activity of immunoregulatory T cells mediating active tolerance is potentiated in nonobese diabetic mice by an IL-4-based retroviral gene therapy. J Immunol 166:4973^4980 Zhang ZY, Lee CS, Lider O, Weiner HL 1990 Suppression of adjuvant arthritis in Lewis rats by oral administration of type II collagen. J Immunol 145:2489^2493 Zhang X, Izikson L, Liu L, Weiner HL 2001 Activation of CD25+CD4+ regulatory T cells by oral antigen administration. J Immunol 167:4245^4253

DISCUSSION Bach: Thinking about intervention in humans, you are right in saying that it is necessary to get in at an early stage, which is a pre-diabetic stage. Then you are facing the risk of inducing the disease, which is unacceptable in an apparently healthy child for whom the development of disease is not certain. There have been some reports of disease acceleration. In the various systems you have used, have you seen this type of acceleration? Von Herrath: We had to create a contrived model to address this question and used RIP-GP transgenic GAD over-expressors. These double transgenic mice showed a marked acceleration and increased incidence of diabetes after receiving plasmid DNA vaccines expressing GAD. Otherwise, we have surprisingly never seen an acceleration of disease. In general it is a possibility. This is why I think that adding cytokine at the time of immunization in humans will be the best strategy, without giving a systemic cytokine therapy. As to why we rarely see acceleration of disease, I don’t think we fully understand. Most of our insulin B-speci¢c cell lines have a regulatory phenotype and function. Perhaps this has something to do with the repertoire of these autoreactive cells that causes many of them to have bene¢cial e¡ector functions. Abbas: Is this ¢nding that the DNA vaccines give Th2 responses peculiar to the NOD mouse? Or is it peculiar to the fact that you are using an autoantigen? It is certainly not true of conventional antigens in other mouse strains. Von Herrath: I think it is peculiar to the autoantigen. They work on other mouse backgrounds. It has to have something to do with the targeting of an autoreactive

254

DISCUSSION

repertoire that is intrinsically weaker than the LCMV repertoire, and therefore it lends itself to a lesser likelihood of an aggressive response. Abbas: Have you done the control experiment in the same NOD mouse immunizing with an Ova plasmid or something other than insulin or GAD? Von Herrath: Yes. Abbas: Does this give you a strong Th1 response? Von Herrath: Yes. Shevach: Have you ever transferred that cell line you had
which is a typical Th2 cell by my criteria
to an immunode¢cient mouse to see whether it could cause disease? Von Herrath: No. If you expand these cells drastically and get too many of them, this is a possibility. All these processes are in balance. If all of a sudden there is a massive excess of Th2 cells, they could probably also cause disease. Shevach: That is hard to control. You have a good Th2 response, which looks protective. You would like to augment it. I worry about this. Von Herrath: It is a general worry. If we compare all these diabetogenic clones, some of them have a more Th2-like phenotype. A similar concept applies to IL10: when IL10 transgenic over-expressing mice were made there was an acceleration of disease. Thus, all of these factors are level dependent. The RIP-LCMV mice had rather high levels of IL10 and you can argue that Treg1 cells will not reach this level in vivo. Shevach: I have observed induction of severe immune pathology with a Th2 cell line that cannot make IL4, but does make IL10 and TNFa. Harrison: I’d like to follow up on your comment about whether it is possible to induce disease by this sort of treatment. This was real concern for us. We think it is a double-edged sword and that this may depend on the antigen. If we give proinsulin protein or DNA intranasally to NOD mice, this generates both CD4+ regulatory T cells and CTLs. On balance the mice don’t have a signi¢cant decrease in the incidence of diabetes, but the CD4+ T cells are very good regulatory cells. We can get diabetes prevention by blocking CTL co-induction with antiCD40L antibody at the time of giving intranasal treatment, or by mutating proinsulin to delete anchor residues for class I MHC-binding epitopes. This is clear-cut. Von Herrath: Both of these points are valid. CD40L is something we would argue is going in the direction of combining things. If we combine it with CD3, for example, this may be less likely to happen. We have not mutated out the CTL epitopes in our plasmids, but we now have constructs that shuttle antigen presentation preferentially to MHC class II (limp2 constructs), that were made to get enhanced CD4+ cell activation. Expressing antigen preferentially through the class II presentation pathway might be helpful to get away from the class I presentation.

VIRAL AND AUTOIMMUNE RESPONSES

255

Hasenkrug: In terms of human therapy this is not practical. You can’t mutate out all the CTL epitopes. Von Herrath: That’s why we want to stay with these response modi¢ers, given the caveat that too much is never going to be good. Delovitch: In the case where you were concerned about the insulin autoantibody production, you looked at total IgG antibody. Did you have a chance to look at isotypes? Von Herrath: No. Delovitch: I’m curious about the di¡erences observed in di¡erent systems. In your system and Roland Tisch’s system, you use cytokine plus antigen for vaccination and get better protection. When we use our IL4 cytokine per se, we get equal protection. Does it depend on the level of expression and the persistence of expression of the cytokine? Von Herrath: In all these studies we have done the cytokine plasmid alone in controls, and these didn’t protect. We don’t get good systemic levels. There are ¢ndings in another system that uses adenovirus recombinants expressing IL10 to prevent NOD type 1 diabetes. They get the best protection when they see IL10 serum levels. Mowat: When you transfer the regulatory cells, is this after you have infected with LCMV? Von Herrrath: Yes. Mowat: At the point when you transfer the regulatory cells and they go to the pancreatic lymph node is there any insulitis present in these animals at that time? Von Herrath: Yes. The insulitis after LCMV infection in RIP-LCMV mice occurs rather early. Viral antigen is found in the pancreas but not the islets for at least ¢ve days. Distinctly after that (when virus is already being cleared), insulitis develops. We think viral infection it is a prerequisite to get diabetes in this model. The in¢ltrates in RIP-LCMV mice, however, are in general less pronounced than in the NOD mouse. Mowat: So the antigens are all LCMV speci¢c. Von Herrath: Early on (day 0^5 post LCMV infection), RIP-LCMV transgenic mice don’t have a typical picture of peri-insulitis. At that early stage it is a typical response to a virus and similar things are seen in many organs. Insulitis occurs around the time when systemic clearance of LCMV is happening. Importantly, the insulitic lesion involves multiple antigen speci¢cities due to antigenic spreading (i.e. to insulin and GAD) and only 4% of the CD8+ lymphocytes at that point for example are LCMV speci¢c. Mowat: You said that you only ¢nd regulatory cells in the pancreatic lymph nodes and not the islet; I was trying to get a feel for where the aggressive T cells were at the same time. Von Herrath: In the lymph nodes as well as the islets.

256

DISCUSSION

Mitchison: I am intrigued by the Th2 peri-insulitis that you see in the course of the induced disease. We observed a similar e¡ect of Th2 activity required to initiate disease in collagen-induced arthritis (Hesse et al 1996). Does this peri-insulitis actually contribute to the disease? If it is blocked with anti-CD4 antibody, does that have any e¡ect? Von Herrath: CD4 blockade abrogates disease by eliminating aggressive Th1 cells in RIP-LCMV mice. Overall, kinetically, my personal bias is that there is not a cataclysmic event. There is a heterogeneous in¢ltrate from the start with some aggressive cells and some that are regulatory. These cells sit there for a while. When the islets are under attack I also think that there is some islet regeneration. This will create an equilibrium that might account for some of this picture where we feel that the lymphocytes are mostly around the islets. Over time the aggressive component increases more and more, until enough b cell loss has occurred that diabetes develops. Mitchison: Have you tried to interfere by using anti-IL4? Von Herrath: Yes. At least from what we know of in the IL4 knockout mice, there is no drastic acceleration of disease in the absence of IL4, similar to IL4de¢cient NOD mice. This, however, does not argue against the essential role of IL4, after Th2-like regulators have been induced by antigen-speci¢c immunization. Mitchison: In the collagen-induced arthritis model, if you give anti-IL4 antibody this impedes disease, although later on it accelerates. So the IL4 knockout isn’t very informative there Von Herrath: I agree; we haven’t done the anti-IL4. Reference Hesse M, Bayrak S, Mitchison A 1996 Protective major histocompatibility complex genes and the role of interleukin-4 in collagen-induced arthritis. Eur J Immunol 26:3234^3237

General discussion III Active immune regulation Bluestone: I thought it would be useful to summarize a little bit of what we know and don’t know about active immune regulation. I hope we can then think of ways of collaborating or designing experiments that might help to resolve some of these issues as they crop up. The two major areas of discussion during this meeting have concerned the phenotype and function of regulatory T cells. Depending on the model system and the lab, this seems to be variable. Where do we stand on potential phenotypes of subsets of regulatory cells? What do we agree on? Does the controversy have to do with in vitro versus in vivo, or something else? Von Herrath: One thing that struck me from Ethan Shevach’s paper (Shevach et al 2003, this volume) is that some of the confusion with the CD25high cells comes in because of the lineage argument. Ethan uses this as a separate lineage that arises in na|« ve mice. If you start looking at the other end, where there are infections and immune activation and so on, in most models you don’t know whether they come from that original lineage itself. This contributes to the confusion: they can be activated e¡ector cells even if they are suppressed in vitro, for example. While we lack a better lineage marker it might make sense to classify these cells at the other end, according to e¡ector phenotype. Thus we might say that we have an interleukin (IL)10-producing cell that protects, or a transforming growth factor (TGF)b-producing cell that protects, or a CD25high cell that makes something that you don’t know that protects. This would make the classi¢cation of these cells more straightforward. It might also account for some of the in vitro/in vivo con£icts. Ha£er: Taking that a step further, one can then divide the function into cells that require cell^cell contact to suppress, as opposed to cells that require secretion of factors to suppress. Shevach: Cells do all these things. I don’t think we can make that distinction. Abbas: To date the best phenotypic markers for regulatory cells are CD4+CD25highL selectinhigh. Do people agree? Ha£er: For na|« ve mice, but not for humans. Von Herrath: The problem with these lineage aspects in na|« ve mice is that they don’t necessarily hold. Bluestone: So without upsetting anyone, one could say it this way: CD25+ cells are better overall at mediating these activities than CD25 cells. 257

258

GENERAL DISCUSSION III

Powrie: The di¡erence here is whether you are looking in vivo or in vitro. CD25+ cells look unique in terms of suppression in vitro, but CD25 cells can mediate some activity in vivo. Bluestone: Would you agree that both in vitro and in vivo there is a potency di¡erence? Powrie: Yes. In the thymus the di¡erence is much clearer in that only CD4+CD25+ cells from here suppress in vivo. Roncarolo: You are now making the assumption that these are the cells that would regulate against every possible antigen. It is possible that for some antigens the CD25+ cells will not do anything and the CD25 cells are the ones doing the job. Abbas: Can you give an example? Roncarolo: The work done on TGFb and IL10-producing cells coming from CD25 cells. Abbas: What about an example of where CD25+ cells don’t regulate responses? Roncarolo: There are no clear demonstrations of the antigen speci¢city of CD25+ T cells. But there are a lot of papers indicating that Treg1 cells are antigen speci¢c. Bluestone: Let’s start out with the phenotype of unmanipulated cell directly out of a human or an animal. The CD25+ cells are signi¢cantly greater than the CD25 cells. This is most prominent in the thymus, which is greater than the peripheral pool. Chatenoud: It is even more pronounced than that. If we do co-transfers, in the thymus the suppressive capacity in the co-transfer is only in the CD25+ cells. Bluestone: One could then suggest that the thymus is more unmanipulated than the periphery. When looking in the thymus one is really focused on the CD25+ regulatory cells that may be cell contact dependent. This is the pristine regulatory cell. When one looks in the periphery, the CD25+ regulatory cell still dominates over the CD25 cell. However, depending on the in£ammatory setting, the disease indication, or the tissue localization, regulatory T cells can produce other factors that in£uence the ability of the intrinsic capacity of these cells to regulate. Shevach: However, CD25 cells never really suppress in vitro unless they are manipulated. Powrie: They don’t. Even if you take CD25 RBlow cells, which is a fairer comparison, they don’t. Shevach: In a mouse, CD25 cells never suppress. Bluestone: Ethan, you are the ¢rst to say that CD25 is not the best marker for regulatory cells that we can imagine. Is that correct? Shevach: Yes. Bluestone: Therefore, it is probably OK to say that nothing is absolute. There may be circumstances in which in the absence of manipulation (we are talking in the periphery here, so the animal in vivo may have had some e¡ect) that a CD25 cell

GENERAL DISCUSSION III

259

suppresses. We have examples where in the CD28 knockout, CD25 expression goes way down. The cells still suppress in vitro. There is no reason to say that CD25 cells will never suppress in vitro. Shevach: But has anyone ever seen this? Powrie: We have done a lot of experiments with CD25 CD45low cells in our in vitro assays, which in an unmanipulated situation do not suppress. Bluestone: Let me try this. Just as I said that the thymus is greater than the periphery for this phenotype, is it fair to say that in vitro is greater than in vivo? Shevach: We’re talking about just adding cells into a co-culture straight from a mouse. CD25 T cells, no matter what other membrane markers they express, do not function as suppressors. Powrie: I agree. Bluestone: So this phenotype is much more pronounced in the thymus than the periphery, and much more pronounced in vitro than in vivo. Should we add some more markers, such as CD45RB or L selectin? Shevach: CD4+CD25+CD62Llow cells suppress in our studies. Bluestone: I would agree that any given marker may not be as good as CD25, but I do think that a constellation of markers may be better than any single marker. Shevach: Perhaps to distinguish an e¡ector from a suppressor. Roncarolo: In the human CD69 might be the best marker to distinguish between e¡ectors and suppressors. Bluestone: So we agree on CD25, but we believe that any other marker is at best controversial, and people should be working together to see whether we can get common markers that we all agree on. Bach: With regard to CD45RB, I think that as a marker this adds something unique and interesting. It marks the pattern of autoimmune reactions. It remains true that in mice depleted in CD45RBlow there is major colitis and some but not much gastritis. On the other hand we have data that when CD25 is depleted, this results in major gastritis and marginal colitis. This means that there is something unique to this marker. Flavell: Within a CD25+ group, does RBlow indicate anything other than e¡ector versus suppressor? Powrie: Yes. Flavell: Ethan Shevach, of your CD25+ cells, what proportion is RBlow? Shevach: Let’s talk about RB. We are all talking about RBhigh and RBlow. We see three populations of cells in the mouse: high ones, intermediate ones and low ones. In our hands the CD25+ cells are never in that RBhigh population, but they are spread over the intermediate and low peaks. When most people, including Fiona Powrie, sort for RBlows, they go for the lowest population. This is problematic in terms of markers. Jean Fran cois Bach, I don’t think you are right. The RB marker is only valid for e¡ector cells. If one wants to make a na|« ve population of e¡ector cells,

260

GENERAL DISCUSSION III

one should go for RBhigh cells. Using CD25 cells as a pure source of e¡ector cells is potentially hazardous as they may contain memory cells with suppressor functions. The di¡erence between colitis and the gastritis is primarily based on whether nu/nu mice or SCID mice are being used. The antibody present in the nu/nu mouse may protect against irritable bowel disorder (IBD). Bach: That is not true. We did the CD25 T cells in SCID mice, and we got marginal colitis. Perhaps this is due to the fact that we removed e¡ector cells. This is always the problem when you separate cells with a marker. This is true for L selectin. When we remove L selectin-negative cells in a NOD mouse, we don’t know whether we are enriching regulatory cells or depleting e¡ector cells. Bluestone: Let’s say the following. The CD25+ cells can be divided into at least two subsets. One is a CD45RBlow, and one is intermediate for RB. Shevach: They are not RBhigh, this is all I can say. Flavell: What is the speci¢c activity of those two groups? Shevach: They are exactly the same in vitro. Bluestone: Let us say then that there are two populations of CD25+ cells. These populations cannot be distinguished in vitro, but it has been suggested that they might be slightly di¡erent in vivo. Bach: What I was saying was that when I take the unmanipulated CD4+ T cell population and remove the CD25+ cells, I see a di¡erent pattern of autoimmunity to that seen with CD45RBlow cells. I don’t know the reason for that. Mowat: There are colleagues in my department who have completely opposite data to that. When they put in CD25 cells they got the worst colitis I have ever seen. Bach: It depends on the degree of separation. Powrie: No, it depends on the colonies you are working with. This is something that cannot be compared between these various institutes. There are groups who have been working with CD4+ cells who have published that they get colitis when they transfer these cells to certain colonies of immunode¢cient mice. In your example where you don’t get colitis, it may be because the bacteria needed for colitis are absent. We have colonies of RAG mice that we can transfer CD45RBhigh cells to without seeing colitis. When we give these animals certain bacteria, we do see colitis. We can’t just talk about the immune cells that we are manipulating. Hasenkrug: Instead of trying to separate these, why don’t we just call them CD45RB ‘low to medium’ cells. Bluestone: Perhaps we would agree that the low-to-intermediate cells are much better than the highs. I thought I heard Jean Fran cois Bach say that in the same system where he depletes either CD25+ cells or CD45RBlow cells he gets di¡erent results with the same colonies. Can we at least agree that it is possible that these two subsets are not 100% overlapping in terms of their functionally suppressive activity?

GENERAL DISCUSSION III

261

Powrie: There is some suppressive activity in the CD45RBlowCD25 pool. Bluestone: It is possible then, that within these pools there are two subsets. Why they are di¡erent and how they mediate their di¡erences remains unclear, but this remains an important point, because depending on what people use to separate out their subsets, when we compare results there might be slight di¡erences. Abbas: As a follow-up to this discussion, one of the questions we were intending to address was what we are going to do next. How many people have actually done this formal side-by-side comparison of cell depletion based on CD25 versus CD45RB expression? From what I am hearing, Shimon Sakaguchi, Fiona Powrie and Ethan Shevach have not done this as a formal comparison within their own colonies. What is intriguing is that if they are giving you qualitatively di¡erent disease phenotypes, this has to be saying something important. Shevach: You shouldn’t do that experiment. I would never make e¡ector cells by only depleting CD45RBlows the way that Fiona did years ago. I don’t think she would anymore, either. Bluestone: What Abul Abbas is saying is that there are some people that have suggested that in vivo if you deplete the CD25+ cells and compare this to the depletion of the CD45RBlow cells, there is a di¡erent autoimmune response. Roncarolo: What is wrong with the idea that in the CD45RBlow cells there is a population of Treg1-like cells that has both CD25+ and CD25 components. Bach: This is my suggestion. Bluestone: Abbas is suggesting that if this experiment was done in a couple of di¡erent laboratories and no di¡erences were seen, then there would be no need to go any further. Ethan thinks there is no di¡erence. But if we did ¢nd a di¡erence in the same colony, then this might raise a set of questions. Powrie: The experiment we have done and published is CD45RBhigh cells together with either CD45RBlowCD25 or CD45RBlowCD25+ cells, or unseparated CD45RBlow cells. The read-out is colitis, and the CD25+ population is more potent than the CD25 population for the suppression of colitis. Chatenoud: From what we have discussed already, if I was an outsider to this ¢eld I would conclude there is no marker. We just have tools to enrich the populations. Let’s move to the function, and think about other interesting things we have discussed. We are enriching better in di¡erent models. I think we have to do these experiments in the various colonies, but can we really say that we have a marker? Bluestone: I think what I have heard is that if people were teaching graduate students to do these experiments, at the moment most people would suggest that as a ¢rst-cut experiment we should use CD25. Chatenoud: It is not a marker. It is important for the discussion thereafter. Not any CD25+ cell is going to be a regulatory cell. This is important because of the way the results from these experiments are discussed.

262

GENERAL DISCUSSION III

Bluestone: I generally agree, but we run the risk that if we are not willing to at least place some degree of con¢dence in something, we won’t make progress. Chatenoud: We have better tools to purify and enrich those di¡erent populations. Bluestone: At the moment CD25 seems to be the best of the markers we have, but not a perfect marker. There are other markers that may have some interesting di¡erences in the populations that they di¡erentiate, but there are no clear data to prove that these di¡erent populations are functionally di¡erent. It would be very interesting for someone who believes this strongly enough, and someone who believes the opposite to compare these subsets within the CD25+ population. Shevach: The only marker that will potentially di¡erentiate subsets in vivo and in vitro is CD103 (the aE integrin), which is expressed on about one-third of the CD25+ T cells and does not appear to be induced on the CD25 T cells. Flavell: What was the speci¢c activity of the CD103+CD25+ subset? Shevach: CD103+CD25+ cells are 3^5-fold more potent in suppressing in vitro than CD103 CD25+. Sakaguchi: There is still the possibility that GITR is a better marker of regulatory T cells in vivo than CD25. Some of CD4+CD25 T cells weakly express GITR and no one so far has done the experiment of removing the GITR+ cells from the CD25 population. This might cause more severe auto immune disease. Bluestone: The good news then is that CD103 and GITR are emerging as possible markers. P selectin is also a possibility. Mitchison: Is there an anti-GITR reagent applicable in humans? Roncarolo: We are looking at this. Sakaguchi: It is commercially available. Bluestone: The next thing I would like to do is discuss the function of the unmanipulated, what now look like CD25+ cells (which perhaps are also CD103+GITR+CTLA4+DR+) and how they work. What do we agree on in terms of the function of these cells in vitro and in vivo? In vitro, it sounds like we generally agree that their function is contact dependent, and known cytokine independent. Roncarolo: I don’t agree: they aren’t cytokine independent. Shevach: You can’t reverse suppression with anti-IL10. Roncarolo: When we add 50 mg/ml of TGFb we see partial reversal. Bluestone: What I have heard at this meeting is that under conditions of maximized suppression, it is di⁄cult to demonstrate a role for cytokines. In a situation where there is not maximal suppression, for example in human cells and in the NOD mouse where the regulatory cells are somewhat dysfunctional, this may not be the case. There are some pieces of evidence that there is a potential for cytokine involvement, whether that cytokine is made by the regulatory cell, or the cytokine is working on the regulatory cell.

GENERAL DISCUSSION III

263

Shevach: This is in a minority of studies. Bluestone: Is there an experimental design that might resolve this? Richard Flavell is developing a mouse in which it possible to drive the TGFb in a way that makes it possible to identify the cells that are making it. A similar kind of animal might be made with a TGFb receptor, which would enable us to track when and where the receptor is coming up. Are there other ways that we might be able to set up a system which is able to dissect this problem? Flavell: Conditional knockouts are one option. If we could eliminate the function of TGFb in CD4+ cells we could see whether it is needed. This would enable us to get away from the complication of multiple cells. Abbas: Is it worth making a CD25 promoter Cre transgenic? Flavell: You would still get e¡ector cells deleting. Mitchison: Shouldn’t we be thinking of ways to jack Ethan’s system, where we can visualize cell^cell interactions of Treg cells, up to a point where it could be used for high-throughput screening for inhibitory drugs? Bluestone: That’s a great idea. One approach we could take is to do a highthroughput screen on these cells and see whether we can reverse the reactivity. So is it fair to say that in this in vitro system, IL10 and TGFb are the candidates for any cytokine e¡ect under non-maximal suppression conditions? Shevach: I’d remove IL10. Abbas: That conclusion seems remarkably counter-intuitive. You would expect that in the situation of maximal suppression, the whole kitchen sink would be present. Bluestone: The problem is my terminology. It shouldn’t be maximal suppression; it should be maximal conditions. A round-bottomed plastic well where cells come into great contact may allow for a very robust cell contact-mediated suppression. Whereas under conditions where there are dendritic cells and other cells present, then you need other things to help. Chatenoud: The read-out is also important. We need other read-outs than just proliferation, such as IL2 mRNA or IFNg. Bluestone: We could do with a good reporter mouse. In vivo, do people think that the data generally support a role for cytokine-dependent and cytokineindependent suppression? Miller: There aren’t enough data yet. Ha£er: Which model are you talking about? Bluestone: We have colitis, gastritis, diabetes and MOG experimental autoimmune encephalitis (EAE). How many models do you need? Powrie: We have enough models, but surely this will be dependent on what is being regulated. Miller: In some of those models the role of cytokines hasn’t been ascertained.

264

GENERAL DISCUSSION III

Bluestone: There are multiple models here that have been tested. Let’s go model by model. In gastritis, does it favour cytokine dependence or non-cytokine dependence? Shevach: Non-cytokine. Bluestone: In colitis? Shevach: There’s positive evidence for a role for cytokines. Bluestone: In diabetes? Bach: There’s evidence for a role for TGFb. Von Herrath: Can you really say that the cells used in the diabetes model are unmanipulated? Bluestone: My de¢nition of manipulation is an intentional attempt to alter the immunological properties of cells. Abbas: If the cells are taken from the thymus, they are as unmanipulated as you will ever get. Bluestone: The more I am listening to this, I am thinking that perhaps we should compare thymically derived cells with peripherally derived cells. We may ¢nd this will be an interesting dichotomy that I don’t think has been studied back to back. Roncarolo: We are doing this in human, comparing the fetal thymic CD25+ cells with adult thymic cells, cord blood cells and peripheral blood cells. Flavell: It is worth adding that one can discuss how the cytokine works, but this is irrelevant to the question that you are asking. The cytokine is regulating that response. All this discussion about strength of signal is basically irrelevant to the issue, as long as the repertoire is constant. Then the cytokine is impacting the autoagressive phenomenon at some level. Bluestone: Moving on, is graft versus host (GVH) cytokine dependent or independent? Roncarolo: Dependent. Bluestone: Heart transplant? Wood: We haven’t done it with heart transplants, only skin grafts. This is cytokine dependent. Chatenoud: If you consider the GVH and skin transplant situations to be nonmanipulated, you could also include the models of autoimmunity induced by mercuric chloride could be on your list, and in these situations there is also a cytokine-dependent e¡ect (Bridoux et al 1997). Bluestone: When I say ‘unmanipulated’, I mean that the cells that I have been using to regulate the disease have been isolated from a pristine animal and transferred into an animal with disease, without doing anything to them in between. Powrie: Thyroiditis is cytokine dependent. Bluestone: I would make two points from this. First, the N is a lot higher than people commonly think it is. Second, these models are shockingly cytokine

GENERAL DISCUSSION III

265

dependent. What might be the di¡erence? In vitro there is quite a split between the cytokine-dependent and cytokine-independent situations, but in vivo it is very clear. The essential question is which cells are making the cytokines and why? There are two possible answers. One is that in vivo there are environmental di¡erences that make it more like the sub-maximal immunosuppression in vitro, or there could be other cells making cytokine. Cytokines might be involved without being the direct mediator. It will be essential in these in vivo models to ¢gure out which cells are making cytokines and which are acting on it. Banchereau: I am a little worried that when you use antibodies to an activity you may have immune complexes or cell depletion that is a totally indirect e¡ect of the activity. Bluestone: But what is nice about most of these models is that suppression can be accomplished both ways. I feel much more comfortable with this. Abbas: None of this rules out a role for contact-dependent mechanisms, and you will never be able to unless you identify the relevant molecules. Shevach: The other variable besides environment is time. In most of the in vivo experiments we are usually talking 4^6 weeks rather than 48^72 h in vitro. Bluestone: This leads us to the logical next step, which would be to say that perhaps what manipulation is about is an in vitro way of trying to go through what may be happening in vivo. A lot of what we do in vitro may or may not re£ect what happens in vivo. This is why in the manipulated systems there appears to be a higher cytokine dependence than the unmanipulated systems. So let’s go to the non-manipulated systems. In vitro most data indicate that regulatory cells are generated by a cytokine cocktail that includes IL10 and IFNg. Roncarolo: Other systems involve vitamin D3 and immature DCs. Powrie: There are also some data on TGFb. Wauben: T cell^T cell presentation is also involved. Bluestone: In how many of these have the manipulated cells been used in vivo to regulate an immune response? Roncarolo: IL2 and vitamin D3. Bluestone: Have any of them demonstrated that the cell that comes out of the other end has a marker that is reliable? Banchereau: Is production of IL10 a marker? Abbas: Looking at this from the outside it concerns me that the number of published examples of any of these protocols having been used to generate regulatory cells that work in vivo is extremely small. There is one paper for each one, or maybe two. And usually just from one group. Bluestone: It needs more work. Are there any common markers on the input cells here that we can agree on? Shevach: Let’s phrase it another way. Are there any hard data that these cells can be generated from CD25 cells?

266

GENERAL DISCUSSION III

Powrie: Yes. Bluestone: Right now, it looks in general like the cells that are being generated here
both the precursor as well as the product
are actually di¡erent from the unmanipulated cells we have been discussing at length. Bach: We shouldn’t forget Th2 cells which are also regulatory cells in certain systems. Roncarolo: My general impression is that there are not many studies of transfer of in vitro generated cells. But there is more than one paper by more than one group. For IL10-induced cells there is our original paper, plus Groux’s paper on allergy, and a paper on transplantation (Zeller et al 1999). For vitamin D3, O’Garra’s group has done this (Barrat et al 2002). I agree we need more work, but it’s not as bad as Abul Abbas implied. Shevach: Do you know how many people have tried to replicate the Groux et al (1997) paper and have failed? Roncarolo: People didn’t get a pure population of IL4 cells. When we went back to our experiments in several of them we saw contamination of IL4+ cells. Bluestone: Let’s just for a second look in vivo. There are a number of in vitro models which can be manipulated with cytokines to induce a cell that functions both in vitro and in some cases in vivo. Generally these cells require cytokines, the activity is mediated through cytokines and it is a non-overlapping subset of cytokines with the unmanipulated CD25+ cells that we have been discussing. In vivo, I will blankly say that the same thing has generally been true. We can now throw in a few more things, such as the involvement of gd cells in oral administration. Len Harrison, do you think that cytokines are involved in gd cellmediated regulation? Harrison: Yes. After naso-respiratory insulin, CD8+ gd T cells are found preferentially in pancreatic lymph nodes secreting IL10 (up to 5% of cells compared to 51% in controls), and anti-IL10 antibody prevents them blocking adoptive transfer of diabetes by T cells from diabetic mice. Bluestone: There may be other cells subsets involved. We believe that NK1.1s are cytokine dependent. It is pretty similar to in vitro in this setting, in that under conditions in which cells are manipulated the regulation in vivo is generally cytokine dependent. Von Herrath: I would like to propose a common thread. Apart from cytokines, what might unify these di¡erent cells is that most of them don’t proliferate well. They seem to proliferate much worse than e¡ector cells. This might be a characteristic of these regulators. Perhaps a good regulator in vivo is a cell that makes some cytokine and does not proliferate well. Roncarolo: People who have worked with murine cells have been using totally the wrong medium with which it isn’t possible to generate murine Treg1 cells.

GENERAL DISCUSSION III

267

When O’Garra and Bruce Blazar started to use the medium we use for human work, they could get them. You have to switch medium. Bluestone: I want to make the following proposition. Just like the immune system is focused on two di¡erent elements, the innate and adaptive, so is the regulatory system. We have innate regulators and we have adaptive regulators. What we have been talking about for the last hour are these two systems. There are innate immune regulators, which can be dominated by a thymically derived CD25+ cell selected on a self-antigen repertoire designed for regulating innate autoimmune responses as well as some in£ammatory responses. This is a system that pre-exists. In the periphery, what we do when we manipulate is induce and promote an adaptive immune regulatory system where the Treg and some of these other cells can be very active participants. There is some cross-over. The goal for all of us is to ¢gure out ways to take advantage of these two systems, and knowing when one is going to be operating rather than the other. References Barrat FJ, Cua DJ, Boonstra A et al 2002 In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2-inducing cytokines. J Exp Med 195:603^616 Bridoux F, Badou A, Saoudi A et al 1997 Transforming growth factor beta (TGF-b)-dependent inhibition of T helper cell 2 (Th2)-induced autoimmunity by self-major histocompatibility complex (MHC) class II-speci¢c, regulatory CD4+ T cell lines. J Exp Med 185:1769^1775 Groux H, O’Garra A, Bigler M et al 1997 A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Shevach EM, Piccirillo CA, Thornton AM, McHugh RS 2003 Control of T cell activation by CD4+CD25+ suppressor T cells. In: Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Found Symp 252) p 24^44 Zeller JC, Panoskaltsis-Mortari A, Murphy WJ et al 1999 Induction of CD4+ T cell alloantigenspeci¢c hyporesponsiveness by IL-10 and TGF-b. J Immunol 163:3684^3691

Notch signalling in the peripheral immune system Margaret J. Dallman, Brian Champion* and Jonathan R. Lamb{ Department of Biological Sciences and Centre for Molecular Microbiology and Infection, Imperial College, London SW7 2AZ, *Lorantis Ltd, 307 Cambridge Science Park, Cambridge CB4 0WG and {Immunobiology Group and Respiratory Medicine Unit, MRC Centre for In£ammation Research, University of Edinburgh, Teviot Place, Edinburgh EH8 9AG, UK

Abstract. Peripheral T cell tolerance is critical in the regulation of immune responses to self antigens, and has implications in the control of autoimmunity, allergic responses and transplant rejection. Here we discuss recent and unpublished data demonstrating that ligation of the cell surface receptor Notch on T cells inhibits immune responses and results in the generation of a regulatory T cell population. Using animal models, we show that prior exposure to antigen can inhibit the response to challenge in an antigenspeci¢c fashion. This inhibition is accompanied by the generation of cells with apparent regulatory capacity and we further show that exposure of T cells to Notch and T cell receptor signals together enhances interleukin 10 production, at least in cell culture systems. We discuss how Notch signalling may integrate with other signals to induce tolerance. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 268^278

During the development of the mature immune system from a single pluripotent haemopoietic stem cell, many cell fate decisions must be made. The signals involved in these decisions include those delivered by cytokines and cell contact via cell surface proteins. With respect to the latter, the Notch signalling pathway has recently attracted attention. From early haematopoiesis through thymic maturation, this pathway in£uences the development of leukocytes including T cells (Robey 1997, Washburn et al 1997, Deftos et al 1998, Milner & Bigas 1999, Pui et al 1999, Radtke et al 1999, Yasutomo et al 2000, Koch et al 2001, Wolfer et al 2001, Allman et al 2002). This article focuses on our recent proposal that Notch signalling continues to be important in the di¡erentiation of T cells in the mature peripheral immune system (Hoyne et al 1999, 2000) and illustrates how this pathway may be used in the bene¢cial manipulation of immunity in organ transplantation. The functional consequences of Notch signalling are discussed 268

NOTCH SIGNALLING

269

and we speculate on how this knowledge can integrate with current concepts of immunity. The critical nature of tolerance in maintaining homeostasis within the immune system is perhaps best illustrated by the activity of naturally occurring regulatory T cells (Treg) (Sakaguchi et al 1996, Mason & Powrie 1998), the subject of many papers in this symposium. Such cells, which may di¡erentiate in the thymus, can control the immune response to self-antigens for which T cell deletion is not complete or has not occurred centrally. Tolerance, maintained by regulatory CD4+ T lymphocytes, can also emerge following a wide variety of experimental manipulations of the immune system (Metzler & Wraith 1993, Qin et al 1993, Lombardi et al 1994, Groux et al 1997, Hoyne et al 1997, Thornton & Shevach 1998, Richards et al 2000, Barrat et al 2002). The precise relationship between naturally occurring Treg cells and those induced through experimental manipulation is unclear, but it seems likely that similar mechanisms could be responsible for the induction and functioning of both populations. The therapeutic implications of an ability to induce Treg cells in a controlled and antigen-speci¢c fashion are widespread and have been the focus of much attention (Groux et al 1997, Zhai & Kupiec-Weglinski 1999). The Notch signalling pathway The Notch receptor is a transmembrane protein, which activates an evolutionary conserved signalling pathway that controls cell fates, both by inhibiting cell di¡erentiation and through inductive signals that determine cell types (Weinmaster 1998, Artavanis-Tsakonas et al 1999, Milner & Bigas 1999). First described in Drosophila, it is now clear that there are vertebrate homologues (Notch1^4, Robey 1997) with very similar function. Binding of Notch to its ligands (Delta and Serrate in Drosophila), induces cleavage of an intracellular portion of the protein which associates with the CSL proteins (suppressor of hairless in Drosophila and Xenopus, LAG-1 in Caenorhabditis elegans, and RBP-Jk/ KBF2/CBF1 in mammals), allowing their conversion to transcriptional activators and translocation to the nucleus (reviewed in Weinmaster 1998). Here target genes (such as HES1 ) are transcriptionally activated. An alternative CSL-independent pathway, of which Deltex appears to be an e¡ector, is also thought to be important in Notch signalling (Robey et al 1996, Milner & Bigas 1999). There are ¢ve described vertebrate ligands for Notch: Jagged1 and 2 (orthologues of Serrate), and Delta-like 1, 3, 4. In developmental systems the signals delivered by Delta and Jagged/Serrate appear to be at least partly non-redundant. Since Notch acts to in£uence the fate of diverse cell types at di¡erent stages of development the general view has been that Notch signals act primarily to inhibit the di¡erentiation of speci¢c cell types allowing cell extrinsic cues to determine cell fate. Indeed much

270

DALLMAN ET AL

experimental data are consistent with this idea (Artavanis-Tsakonas et al 1999, Ju et al 2000). However, recent data suggests that under certain circumstances Notch may act itself in an instructive role (Gaiano & Fishell 2002). Activation of the Notch pathway may also have e¡ects on proliferation, di¡erentiation and cell death in the immune system. Notch signalling has been shown to inhibit apoptosis in mature T cell lines (Deftos et al 1998, Osborne & Miele 1999), but can promote apoptosis in B cells (Morimura et al 2000). Whilst activationinduced cell death may contribute to the induction of peripheral T cell tolerance (Li et al 1999, Wells et al 1999), a degree of protection from apoptosis may be important in allowing the T cell to receive further di¡erentiation signals such as those required for generation of the Treg phenotype. Results and discussion APCs constitutively expressing Notch ligand are not immunogenic and can induce tolerance to co-expressed antigens We have previously reported that splenic-derived antigen-presenting cells (APCs) transduced with a retrovirus encoding human Jagged1 can induced tolerance to peptides borne by these cells. The tolerance demonstrates epitope spreading to encompass the entire protein and can be transferred by CD4+ cells (Fig. 1, Hoyne et al 2000). We adopted a similar approach in a transplantation model, but in this case stably transfected mouse L cells (CD80+, H-2k) with both alloantigen (H-2Ab or H-2Kb) and Notch ligand. For these experiments we chose to use a Notch ligand of the alternative family, Delta (Fig. 2). We have made the following observations using a popliteal lymph node assay in the C57BL/104C3H strain combination (Fig. 3): (1) mouseDelta-like1 (mDl1), H-2Ab or H-2Kb transfected L cells are not immunogenic (2) these cells can control the response to a subsequent challenge with the same, but not a third party (BALB/c) antigen (3) neither H-2Ab nor H-2Kb, mDl1 transfected cells alone can control the response to a challenge with lymph node cells of H-2b origin, but mixtures of H-2Ab and H-2Kb, mDl1 transfected cells are e¡ective in this respect (4) mDl1, H-2Ab and H-2Kb cell transfectants inhibit T cells responding to directly presented, but not to indirectly presented alloantigen (5) the e¡ects observed are not apparently due to apoptosis in the responding population of cells In no cases was there a bene¢cial e¡ect of control H-2Ab and H-2Kb transfected cells that did not express mDl1.

FIG. 1.

Antigen speci¢c tolerance induced by Jagged1+ DCs can be transferred by CD4+ but not CD8+ T cells.

NOTCH SIGNALLING 271

272

DALLMAN ET AL

FIG. 2. Protocol for transplantation experiments.

In a fully vascularized model of heart transplantation using the same strain combination (Fig. 4) we found that: (1) neither H-2Ab nor H-2Kb mDl1 transfected cells alone can control the response to a fully mismatched graft of H-2b origin, but mixtures of H-2Ab and H-2Kb mDl1 transfected cells can signi¢cantly prolong graft survival to a median survival time (MST) of 43.5 days (2) identical bene¢cial e¡ects were observed following pre-treatment with H-2Ab and H-2Kb mDl1 transfected cells given either i.p. or i.v. whereas the modest bene¢cial e¡ects observed with H-2Ab and H-2Kb transfected cells were only seen when these cells were given i.v. (MST 24 days i.v., 13.5 days i.p.)

FIG. 3. Protocol for popliteal lymph node assay.

NOTCH SIGNALLING

273

FIG. 4. Protocol for transgenic experiments.

(3) prolongation of graft survival is antigen-speci¢c and no e¡ects were seen on the survival of third party (BALB/c) grafts. Active regulation is involved All grafts were eventually rejected even in animals pretreated with H-2Ab and H2Kb mDl1 transfected cells. Since T cells recognizing alloantigen indirectly are not a¡ected by our regimen, this is perhaps not surprising. However, in this strain combination MHC class II / grafts (which will not provide stimulation directly to class II-reactive cells in the recipient) are rejected by wild-type recipients in only a marginally delayed fashion (mean survival time 14 days, Bruce Rosengard, personal communication). The greater survival in our animals can therefore not be explained simply by a failure of the H-2Ab and H-2Kb mDl1 transfected cells to inhibit the indirect pathway of presentation. We therefore tested the possibility that an active regulatory population of cells was involved in the mDl1-induced e¡ects by depleting CD4+ or CD8+ cells at the time of transplantation. Consistent with previous ¢ndings (Chen et al 1992) the CD4+ antibody further enhanced graft survival presumably due to depletion of cells capable of rejecting the graft. However, depletion of CD8+ cells abrogated the bene¢cial e¡ects of the H-2Ab and H-2Kb mDl1 transfected cells. These data implicate a CD8+ T regulatory cell in the Notch ligand-induced e¡ects observed. Further, our data are consistent with the possibility that such regulatory cells are able to a¡ect T cells recognizing antigen indirectly. The eventual loss of grafts is likely due to loss of these cells since the activating signal (i.e. APCs of graft origin) are lost rapidly from the

274

DALLMAN ET AL

graft (Larsen et al 1990) and it is clear that tolerance can only be maintained by the continued presence of antigen (Chen et al 1996).

Integration with other signals: Notch signals can induce enhanced production of IL10 by T cells The phenotype of mice bearing deletions in Il2, Il10, Tgfb or Ctla4 is one of immune dysregulation which is manifest by either localized (e.g. in the bowel in Il10 knockout mice) or generalized (in the case of Il2, Ctla4 and Tgfb knockout mice) in£ammation. This information alone indicates that if Notch signalling is important in the development of peripheral tolerance to self, it is likely to be so only under the in£uence of or due to the induced expression of one or more of the above mentioned proteins. Both in the development and action of naturally occurring Treg, and in experimental models of tolerance, IL10 and TGFb have been identi¢ed as important mediators (Weiner et al 1994, Mason & Powrie 1998, Zhai & KupiecWeglinski 1999, Groux 1997, Richards et al 2000, Barrat et al 2002). In some models of peripheral tolerance IL4, IL2 and IFNg have also been implicated (Dai & Lakkis 1999). The latter two cytokines may be important in limiting the cell to a single round of proliferation and/or programming the cell for apoptosis, phenomena that appear to be required in at least some models of experimentally induced peripheral tolerance (Li et al 1999, Wells et al 1999). Using a Dl1^IgG fusion protein, we have found that Notch signals delivered to T cells in culture, together with TCR and co-stimulatory signals result in increased expression of IL10 whereas other cytokines including IFNg are frequently reduced. These data suggest that Notch signalling either directs cell di¡erentiation towards an IL10-producing phenotype, inhibits the di¡erentiation towards a Th1/Th2 phenotype and/or allows preferential expansion of IL10 producing cells. Experiments are underway to test these possibilities. In summary, Notch signalling delivered to mature peripheral T cells allows the emergence of an antigen-speci¢c tolerant phenotype. We have evidence that this tolerance is accompanied by the expansion and/or di¡erentiation of regulatory T cells with IL10 playing an important role in this process.

Acknowledgements Work from these groups is funded by The Wellcome Trust, the Medical Research Council, the British Lung Foundation, the National Kidney Research Fund, the European Union (BIO4CT97-2262) and Lorantis Ltd.

NOTCH SIGNALLING

275

References Allman D, Punt JA, Izon DJ, Aster JC, Pear WS 2002 An invitation to T and more: notch signaling in lymphopoiesis. Cell 109:S1^S11 Artavanis-Tsakonas S, Rand MD, Lake RJ 1999 Notch signaling: cell fate control and signal integration in development. Science 284:770^776 Barrat FJ, Cua DJ, Boonstra A et al 2002 In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2-inducing cytokines. J Exp Med 195:603^616 Chen Z, Cobbold S, Metcalfe S, Waldmann H 1992 Tolerance in the mouse to major histocompatibility complex-mismatched heart allografts, and to rat heart xenografts, using monoclonal antibodies to CD4 and CD8. Eur J Immunol 22:805^810 Chen ZK, Cobbold SP, Waldmann H, Metcalfe S 1996 Ampli¢cation of natural regulatory immune mechanisms for transplantation tolerance. Transplantation 62:1200^1206 Dai Z, Lakkis FG 1999 The role of cytokines, CTLA-4 and costimulation in transplant tolerance and rejection. Curr Opin Immunol 11:504^508 Deftos ML, He YW, Ojala EW, Bevan MJ 1998 Correlating notch signaling with thymocyte maturation. Immunity 9:777^786 Gaiano N, Fishell G 2002 The role of notch in promoting glial and neural stem cell fates. Annu Rev Neurosci 25:471^490 Groux H, O’Garra A, Bigler M et al 1997 A CD4+ T-cell subset inhibits antigen-speci¢c T-cell responses and prevents colitis. Nature 389:737^742 Hoyne GF, Jarnicki AG, Thomas WR, Lamb JR 1997 Characterization of the speci¢city and duration of T cell tolerance to intranasally administered peptides in mice: a role for intramolecular epitope suppression. Int Immunol 9:1165^1173 Hoyne GF, Dallman MJ, Lamb JR 1999 Linked suppression in peripheral tolerance to house dust mite derived allergen Der p 1. Int Arch Allergy Immunol 118:122^124 Hoyne GF, Le Roux I, Corsin-Jimenez M et al 2000 Serrate 1-induced Notch signalling regulates the decision between immunity and tolerance made by peripheral CD4+ T cells. Int Immunology 12:177^185 Ju B-G, Jeong S, Bae E, Hyun S, Carroll SB, Yim J, Kim J 2000 Fringe forms a complex with Notch. Nature 405:191^195 Koch U, Lacombe TA, Holland D et al 2001 Subversion of the T/B lineage decision in the thymus by lunatic fringe-mediated inhibition of Notch-1. Immunity 15:225^236 Larsen CP, Morris PJ, Austyn JM 1990 Migration of dendritic leucocytes from cardiac allografts into host spleens: a novel pathway for initiation of rejection. J Exp Med 171:307^314 Li Y, Li XC, Zheng XX, Wells AD, Turka LA, Strom TB 1999 Blocking both signal 1 and signal 2 of T-cell activation prevents apoptosis of alloreactive T cells and induction of peripheral allograft tolerance. Nat Med 5:1298^1302 Lombardi G, Sidhu S, Batchelor R, Lechler R 1994 Anergic T cells as suppressor cells in vitro. Science 264:1587^1589 Mason D, Powrie F 1998 Control of immune pathology by regulatory T cells. Curr Opin Immunol 10:649^655 Metzler BD, Wraith C 1993 Inhibition of experimental immune encephalomyelitis by inhalation but not oral administration of the encephalitogenic peptide. In£uence of MHC binding a⁄nity. Int Immunol 5:1159^1165 Milner LA, Bigas A 1999 Notch as a mediator of cell fate determination in hematopoiesis: evidence and speculation. Blood 93:2431^2448 Morimura T, Goitsuka R, Zhang Y, Saito I, Reth M, Kitamura D 2000 Cell cycle arrest and apoptosis induced by Notch1 in B cells. J Biol Chem 275:36523^36531 Osborne B, Miele L 1999 Notch and the immune system. Immunity 11:653^663

276

DISCUSSION

Pui JC, Allman D, Xu L et al 1999 Notch1 expression in early lymphopoiesis in£uences B versus T lineage determination. Immunity 11:299^308 Qin S, Cobbold SP, Pope H et al 1993 ‘‘Infectious’’ transplantation tolerance. Science 259: 974^977 Radtke F, Wilson A, Stark G et al 1999 De¢cient T cell fate speci¢cation in mice with an induced inactivation of Notch 1. Immunity 10:547^558 Richards DF, Fernandez M, Caul¢eld J, Hawrylowicz CM 2000 Glucocorticoids drive human CD8+ T cell di¡erentiation towards a phenotype with high IL-10 and reduced IL-4, IL-5 and IL-13 production. Eur J Immunol 30:2344^2354 Robey E 1997 Notch in vertebrates. Curr Opin Genet Dev 7:551^557 Robey E, Chang D, Itano A et al 1996 An activated form of Notch in£uences the choice between CD4 and CD8 T cell lineages. Cell 87:483^492 Sakaguchi S, Toda M, Asano M, Itoh M, Morse SS, Sakaguchi N 1996 T cell-mediated maintenance of natural self-tolerance: its breakdown as a possible cause of various autoimmune diseases. J Autoimmun 9:211^220 Thornton AM, Shevach EM 1998 CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287^296 Washburn T, Schweigho¡er E, Gridley T et al 1997 Notch activity in£uences the ab versus gd T cell lineage decision. Cell 88:833^843 Weiner HL, Friedman A, Miller A et al 1994 Oral tolerance: immunologic mechanisms and treatment of animal and human organ-speci¢c autoimmune diseases by oral administration of autoantigens. Annu Rev Immunol 12:809^837 Weinmaster G 1998 Notch signaling: direct or what? Curr Opin Genet Dev 8:436^442 Wells AD, Li XC, Li Y et al 1999 Requirement for T-cell apoptosis in the induction of peripheral transplantation tolerance. Nat Med 5:1303^1307 Wolfer A, Bakker T, Wilson A et al 2001 Inactivation of Notch 1 in immature thymocytes does not perturb CD4 or CD8T cell development. Nat Immunol 2:235^241 Yasutomo K, Doyle C, Miele L, Germain RN 2000 The duration of antigen receptor signalling determines CD4+ versus CD8+ T-cell lineage fate. Nature 404:506^510 Zhai YJ, Kupiec-Weglinski W 1999 What is the role of regulatory T cells in transplantation tolerance? Curr Opin Immunol 11:497^503

DISCUSSION Wood: You were talking about accumulation at sites of antigen challenge. What about looking sequentially in the grafts on the ligand plus versus minus animals? Dallman: We haven’t done that experiment yet. We have tried to do a lot of phenotypic analysis on the popliteal lymph node cells. We can’t see any di¡erences in the two situations, which from what I have been hearing is perhaps not surprising. We are now going to a TCR transgenic system so that we can perhaps track the antigen-speci¢c cells in a more careful way. This gives us a lot more opportunity to look carefully at what happens to the cells and what the Notch signalling is doing in terms of phenotype and function. Powrie: Are you eliciting the IL10 from antigen-experienced pools of T cells? Dallman: We don’t know. They are extremely clean animals. Roncarolo: Can you induce IL10 in other, non-T cells? Dallman: We haven’t looked at that.

NOTCH SIGNALLING

277

Delovitch: Is there speci¢city of Notch signalling with regard to ligands? Dallman: There is a vanishingly small amount of information about the relative interactions between the di¡erent receptors and di¡erent ligands. There are a couple of papers where people have primarily looked at fusion constructs to try to assess the hierarchy of interaction, but in the immune system we don’t have any information. All I can say is that in di¡erent situations we see di¡erent expression levels of the di¡erent notch receptors and ligands. I have no idea what this means at the moment. Flavell: What about IL4 and IL5? Dallman: In the primary culture I showed there is no e¡ect. IL13 is the only cytokine we have really looked at in detail. We see very little IL4 in these cultures. IL13 seems to go along with IL10, but it is not as dramatic. The only really consistent observation in the primary cultures is the increase in IL10. Flavell: What do you see with restimulation? Dallman: The IFNg goes down consistently and the other cytokines are a bit variable. Miller: If you recover the cells from the ¢rst culture and co-culture them with fresh cells, do they inhibit? Dallman: We are doing that experiment. Mowat: When we have tried to induce tolerance in John’s inducible d transgenic mice, we can get tolerance with doses of antigen that are normally neutral. When you do your popliteal lymph node system, have you come back and tried to challenge these animals once you have primed them with your original L cells? Dallman: Yes, we have done multiple challenges. The e¡ect seems to be long lived. We have to keep putting the antigen in. If we wait a long time then we lose the e¡ect. Abbas: Are there data addressing the possibility that Notch is a physiological regulator of normal immune responses? I understand the therapeutic potential of what you have done, but normally does it come on and signal? Dallman: We would love to know that. We’ve tried to accumulate these sorts of data but with little success. The best way to do this experiment is to block Notch signalling, but that is di⁄cult. Bach: There are several diseases involving defects in Notch. Do they have immune abnormalities? Dallman: They are not null mutations. Bach: There is a disease that involves Notch3 mutations. These patients show hereditary dementia. Dallman: It is certainly of interest, but these still have an active Notch signalling pathway because of the number of di¡erent receptors and ligands. Bluestone: Does the d-mediated inhibition work in trans or only in cis?

278

DISCUSSION

Dallman: We have tried to address that question by using Notch ligand transfectants of syngeneic origin with allogeneic cells. We haven’t got clean data yet. Bluestone: I recall in the original published work there were some di¡erences between using serrate versus d in terms of the perceived mechanism. There was a sense they worked di¡erently. Dallman: There are in vitro data from Gerard Hoyne suggesting this might be the case, particularly in terms of cell death and IFNg production. Mitchison: Could you simply be weakening the signal from MHC-TCR ligation? Have you tried comparing the Notch e¡ect with other means of weakening that signal, for example by reducing copy number of a transfected MHC, or by using a wounded promoter? Dallman: Kathryn Wood originally did the experiments looking at di¡erent levels of expression. Wood: When we used the original transfectants, as we increased cell number we actually lost unresponsiveness when we used the antigen delivery system alone, in other words without anti-CD4. Mitchison: It is not a very good way of doing it, is it? It assumes that you are getting multiple interactions of the antigenic cells with one target cell, otherwise the number e¡ect doesn’t really matter. What happens if you reduce the level of expression? Wood: I agree with you. We did then generate several populations of transfectants that expressed high, intermediate and low. We saw similar e¡ects in terms of seeing an optimum e¡ect with one of the populations. Mitchison: Was this an optimal suppressing e¡ect? Wood: We were looking for optimal unresponsiveness in the in vivo intravenous antigen delivery.

CD3 antibody treatment stimulates the functional capability of regulatory T cells Lucienne Chatenoud Ho“ pital Necker, INSERM U580, 161 rue de Se' vres, 75015 Paris, France

Abstract. Autoimmune diabetes progression in NOD mice is under the control of CD4+ regulatory T cells. In the thymus these regulatory cells are CD25+-like CD4+ cells shown to control physiologic organ-speci¢c autoimmunity. In contrast, in the periphery, both CD4+CD25+ and CD4+CD25
cells exhibit regulatory capacities. We have accumulated evidence showing an important role of transforming growth factor b (TGFb) in this T cell-mediated regulation in vivo. Additionally, onset of autoimmune diabetes was preceded by a functional abnormality of CD4+CD25+ regulatory T cells as assessed by their inability to suppress in vitro the proliferation of polyclonally activated CD25
T cells. Antibodies to CD3 are potent immunosuppressants now generally applied as non Fcreceptor (FcR) binding monoclonals (F(ab0 )2 fragments in mice and humanized Fcmutated monoclonals in humans). They were shown to induce durable regression of overt diabetes in NOD mice by restoring self-tolerance. The data from our laboratory were the ¢rst to show that in NOD mice anti-CD3 antibodies could reverse recent onset of disease by restoring tolerance to b cell antigens. Thus in NOD mice presenting fullblown diabetes, a ¢ve consecutive day treatment with low doses of the hamster anti-CD3 monoclonal antibody 145 2C11 induced complete and durable disease remission, within 2^4 weeks in the absence of insulin treatment. This result has led to clinical trials, presently ongoing, in recent onset type 1 diabetic patients using non FcR binding monoclonal antibodies to CD3 that are well tolerated since they are devoid of the mitogenic activity that was a hallmark of ¢rst generation CD3 antibodies such as OKT3. Concerning the mechanistic aspects, data from the NOD mouse model indicate that CD3 antibodies promote (1) immediate clearance of insulitis, followed by (2) ‘resetting’ of specialized subsets of immunoregulatory CD4+ T cells mediating active tolerance similar to those that control the onset of spontaneous diabetes. Our recent data show that in CD3treated NOD mice, these immunoregulatory T cells concentrate in the CD4+CD62L+ compartment and part of the population shares the CD25 marker. Furthermore, we also obtained evidence in CD3-treated NOD for a signi¢cant increase (in the pancreatic and mesenteric lymph nodes but not in the spleen) in the proportion of CD4+CD25+CTLA4+ T cells which produce TGFb. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 279^290

279

280

CHATENOUD

For several decades, immunological tolerance was interpreted as the consequence of the deletion or the anergy of speci¢c T and/or B lymphocytes induced upon encounter with the tolerogen. It is now apparent that in many settings, including physiological tolerance as well as tolerance to autoantigens and alloantigens, immune tolerance is ‘active’: that is, mediated by a subset of specialized regulatory T cells (Sakaguchi 2000, Shevach 2000, 2002, Roncarolo & Levings 2000, Bach & Chatenoud 2001, Chatenoud et al 2001). This has been particularly well documented for tolerance to soluble antigens and tissue alloantigens induced under the cover of depleting or non-depleting CD4 antibodies used alone or in combination with CD8 antibodies (Wofsy et al 1985, Benjamin & Waldman 1986, Qin et al 1993, Cobbold et al 1992). Active tolerance may also be induced following administration of other monoclonal antibodies such as those speci¢c for CD40 ligand and CD3 (Cobbold et al 1992, Larsen et al 1996, Kirk et al 1999, Balasa et al 1997, Nicolls et al 1993, Plain et al 1999, Chatenoud et al 1994). Much of our e¡ort concentrated on delineating the spectrum of the immunosuppressive and tolerogenic activities of CD3 monoclonal antibodies, and on dissecting the mechanisms of the tolerance induced by this antibody (Chatenoud et al 1994, 1997, 1984, 1982). Here we shall present data indicating that CD3 antibodies act very selectively on preactivated CD4+CD25+ regulatory T cells, resulting in transforming growth factor (TGF)b dependent immunoregulation. Immunosuppressive activities of CD3 antibodies Available monoclonal antibodies to CD3 are exclusively directed against the e chain of the CD3 complex (Clevers et al 1988). These antibodies have been demonstrated in mice, rats and man to be potent immunosuppressants capable of delaying rejection of organ allografts and preventing the onset of autoimmune diseases (Cosimi et al 1981, Ortho Multicenter Transplant Study Group 1985, Goldstein 1987, Nooij et al 1986, Hirsch et al 1988, 1990, Herold et al 1992, Hughes et al 1994). OKT3, a murine anti-human CD3 antibody, marketed since the mid 1980s, has been, and still remains to some extent, a major component of the immunosuppressive armamentarium used in clinical organ transplantation (Cosimi et al 1981, Ortho Multicenter Transplant Study Group 1985, Goldstein 1987). This antibody, however, can lead to a number of side-e¡ects that have signi¢cantly limited its use in transplantation and totally prevented its use in the ¢eld of clinical autoimmune diseases. OKT3 induces a major in vivo T cell activation that gives rise to a massive (though transient) cytokine release. Some of these cytokines, notably tumour necrosis factor (TNF), interferon (IFN)g and interleukin (IL)6 provoke a major clinical syndrome which may be the source of major discomfort despite preventive corticosteroid treatment that is routinely administered just before the ¢rst OKT3 injection (Chatenoud et al 1990, 1991,

CD3 ANTIBODY TREATMENT

281

Abramowicz et al 1989). Other side-e¡ects include immunization against the idiotypes of the murine antibody. This anti-idiotypic response is a neutralizing one, and it fully abrogates the therapeutic activity of the monoclonal antibody (Chatenoud et al 1986a,b). Anti-CD3 induced tolerance In addition to this non-antigen-speci¢c immunosuppressive activity, CD3 antibodies may induce tolerance to allo- or autoantigens (Nicolls et al 1993, Plain et al 1999, Chatenoud et al 1994, 1997). In the case of the non-obese diabetic (NOD) mouse, that spontaneously develops an autoimmune insulin-dependent diabetes mellitus closely resembling the human disease, CD3 antibodies may prevent diabetes onset if administered in the neonatal period (Hayward & Schreiber 1989), but surprisingly enough they also induce a remission of disease when administered shortly after diabetes onset (Chatenoud et al 1994, 1997). The latter e¡ect may be obtained both with the entire CD3 antibody, which is mitogenic, and with its F(ab0 )2 fragments which are not mitogenic and do not promote the ‘cytokine release’ syndrome (Chatenoud et al 1994, 1997, Hirsch et al 1990). This is an important point, since it opened up the perspective of using the CD3 antibodies in autoimmune diseases in which the cytokine release syndrome is hardly acceptable. Non-mitogenic CD3 monoclonal antibodies, which have been used in the clinic not only in transplantation but also in autoimmunity and have been proven to be safe, have also been characterized (Alegre et al 1994, Bolt et al 1993, Routledge et al 1995, Woodle et al 1999, Friend et al 1999). A recent open clinical trial has shown that a humanized non-mitogenic version of OKT3, huOKT3g1[Ala-Ala], slowed down diabetes progression without harmful side e¡ects in recently diagnosed patients (Herold et al 2002). CD3 antibody-induced tolerance is of the active type Tolerance induction in NOD mice de¢ned in an operational way (prevention or cure of diabetes in the absence of generalized non-speci¢c immunosuppression) has been shown to be broken down by cyclophosphamide treatment (Chatenoud et al 1997). Although cyclophosphamide may have various modes of action, one may postulate that in this particular setting cyclophosphamide acts by destroying regulatory cells known to be particularly sensitive to this alkylating agent (Yasunami et al 1988). CD3-induced tolerance is also broken down by antiCTLA4 antibody (our unpublished data). Whatever the mechanisms of action of this antibody are (blockade of e¡ector cells or boosting of regulatory cells in an agonistic fashion), the recurrence of diabetes after CTLA4 antibody treatment brings strong support in favour of immunoregulation as a mechanism of action of

282

CHATENOUD

the CD3 antibody, rather than anergy or deletion of e¡ector cells. Another argument is the demonstration of the increased capability of CD4+CD25+ T cells from CD3-treated NOD mice to protect from diabetes transfer (our unpublished results). CD3 antibody up-modulates CD25+ T cells with regulatory activity Monitoring of the number of CD4+CD25+ T cells in lymphoid organs of NOD mice treated with non-mitogenic CD3 antibody showed a signi¢cant rise in CD25+ T cells in lymph nodes, and more particularly in peri-pancreatic lymph nodes, but not in the spleen (our unpublished results). Such CD25+ T cells are for the most part CD62L+ and express intracytoplasmic and membrane CTLA4. Interestingly, CD62L+ or CD25+ T cells sorted out from the spleen of CD3 protected mice inhibited diabetes transfer into NOD SCID recipients by diabetogenic T cells (from the spleen of diabetic NOD). Such CD62L+CD25+ regulatory T cells are also found in pre-diabetic NOD mice, but not in NOD mice age-matched with the CD3 antibody treated mice (our unpublished results). The cellular mode of action of CD3 antibodies is not clear. It has been shown that they act for the most part by antigen modulation, that is to say, a redistribution of the CD3/TCR antibody complex followed by shedding or internalization (Chatenoud et al 1984, 1982, Hirsch et al 1988, 1990). CD3 antibodies have also been reported to induce apoptosis of activated T cells (Wesselborg et al 1993). It is di⁄cult to relate these two mechanisms to the activation of the CD25+ T cells just described. One is more tempted to relate it to the T cell activation which still persists in spite of the removal or mutation of the Fc portion of the CD3 antibody molecule. In fact, we have demonstrated that non-activating CD3 antibody F(ab0 )2 fragments do induce transient T cell activation as assessed by cytokine gene transcription, even if the level of this activation is much lower than that observed with the intact molecule. It remains to be understood why this partial stimulation induces, in such a selective fashion, the proliferation and activation of CD25+ T cells. The fact that CD3 antibody works best in mice treated at the late stage of diabetes onset (rather than at the pre-diabetic stage) favours the idea that the antibody works better on preactivated than on na|« ve CD4+ T cells. This ¢nding is in keeping with previous reports of Bluestone’s group indicating that non-activating CD3 antibodies (but not the entire CD3 molecule) act more selectively on Th2 cells than on Th1 cells (Smith et al 1998, 1997). The CD3 antibody induces long-term TGF b production by CD25+ T cells Cytokine production following the administration of a short treatment with the non-activating CD3 antibody evolves in two phases. The ¢rst phase corresponds

CD3 ANTIBODY TREATMENT

283

to the time of antibody administration. One observes production of moderate amounts of Th2 cytokines and TGFb. Production of Th2 cytokines is, however, transient, and is no longer detectable two weeks after the end of antibody treatment. Interestingly, in the weeks following the antibody treatment, one observes a major production of TGFb, particularly by both spleen and lymph node CD4+ lymphocytes. This is remarkable because it tends, if anything, to increase after cessation of antibody treatment, and is thus not the mere result of antibody induced T cell activation. Such TGFb is essentially but not exclusively produced by CD4+CD25+ T cells. It is also produced to some extent by CD4+CD25
T cells. In any event, its role in CD3-induced tolerance is apparent, since treatment of CD3 antibody-treated mice by anti-TGFb antibody abrogates tolerance induction. The importance of TGFb produced under the e¡ect of the CD3 antibody is also exempli¢ed by the restoration of the in vitro suppressive activity of CD25+ T cells, as assessed in co-culture with CD25
T cells in the weeks following antibody treatment. This suppressor e¡ect is also abrogated by anti-TGFb.

Conclusions Taken together, these data indicate that CD3 antibody-induced active tolerance is, for the most part, mediated by the stimulation of CD4+CD25+ T cells which produce TGFb. Such regulatory T cells have been demonstrated independently of the antibody treatment in prediabetic mice and are probably very close, if not identical, to the CD25+ T cells reported to protect from the polyautoimmune syndrome induced by day 3 thymectomy. One may argue about the speci¢city of the tolerance induced under the cover of CD3 antibodies which are initially nonantigen speci¢c. In fact, it is very plausible that the CD25+ T cells that are activated by a non-mitogenic CD3 antibody are selected by their state of reactivation, which is itself dependent on the T cell reactivity towards locally expressed autoantigens. Thus, the tolerance induced by CD3 antibodies would appear to be independently antigen speci¢c, in as much as autoantigens drive the reactivation of the T cells that would ultimately be sensitive to CD3 antibodies. In any event, these results should be considered as one of the ¢rst pieces of evidence of the pharmacological stimulation of CD25+ T cells. Such stimulation could be opposed to the stimulation of Th2 cells, which essentially operate after the administration of soluble autoantigens or altered peptide ligands. Most of the data discussed here might be extended to other autoimmune diseases, allergic diseases and transplantation. Much remains to be discovered, however, on the modalities leading to the selective activation of CD25+ T cells and about the mechanisms by which such activation leads to long-term TGFb production.

284

CHATENOUD

References Abramowicz D, Schandene L, Goldman M et al 1989 Release of tumor necrosis factor, interleukin-2, and gamma-interferon in serum after injection of OKT3 monoclonal antibody in kidney transplant recipients. Transplantation 47:606^608 Alegre ML, Peterson LJ, Xu D et al 1994 A non-activating ‘humanized’ anti-CD3 monoclonal antibody retains immunosuppressive properties in vivo. Transplantation 57:1537^1543 Bach J-F, Chatenoud L 2001 Tolerance to islet autoantigens in type 1 diabetes. Annu Rev Immunol 19:131^161 Balasa B, Krahl T, Patstone G et al 1997 CD40 ligand-CD40 interactions are necessary for the initiation of insulitis and diabetes in nonobese diabetic mice. J Immunol 159:4620^4627 Benjamin RJ, Waldmann H 1986 Induction of tolerance by monoclonal antibody therapy. Nature 320:449^451 Bolt S, Routledge E, Lloyd I et al 1993 The generation of a humanized, non-mitogenic CD3 monoclonal antibody which retains in vitro immunosuppressive properties. Eur J Immunol 23:403^411 Chatenoud L, Bach J-F 1984 Antigenic modulation: a major mechanism of antibody action. Immunol Today 5:20^25 Chatenoud L, Baudrihaye MF, Kreis H, Goldstein G, Schindler J, Bach J-F 1982 Human in vivo antigenic modulation induced by the anti-T cell OKT3 monoclonal antibody. Eur J Immunol 12:979^982 Chatenoud L, Baudrihaye MF, Chko¡ N, Kreis H, Goldstein G, Bach J-F 1986a Restriction of the human in vivo immune response against the mouse monoclonal antibody OKT3. J Immunol 137:830^838 Chatenoud L, Jonker M, Villemain F, Goldstein G, Bach J-F 1986b The human immune response to the OKT3 monoclonal antibody is oligoclonal. Science 232:1406^1408 Chatenoud L, Ferran C, Legendre C et al 1990 In vivo cell activation following OKT3 administration. Systemic cytokine release and modulation by corticosteroids. Transplantation 49:697^702 Chatenoud L, Legendre C, Ferran C, Bach J-F, Kreis H 1991 Corticosteroid inhibition of the OKT3-induced cytokine-related syndrome^dosage and kinetics prerequisites. Transplantation 51:334^338 Chatenoud L, Thervet E, Primo J, Bach J-F 1994 Anti-CD3 antibody induces long-term remission of overt autoimmunity in nonobese diabetic mice. Proc Natl Acad Sci USA 91:123^127 Chatenoud L, Primo J, Bach J-F 1997 CD3 antibody-induced dominant self tolerance in overtly diabetic NOD mice. J Immunol 158:2947^2954 Chatenoud L, Salomon B, Bluestone JA 2001 Suppressor T cells^they’re back and critical for regulation of autoimmunity! Immunol Rev 182:149^163 Clevers H, Alarcon B, Wileman T, Terhorst C 1988 The T cell receptor/CD3 complex: a dynamic protein ensemble. Annu Rev Immunol 6:629^662 Cobbold SP, Qin S, Leong LY, Martin G, Waldmann H 1992 Reprogramming the immune system for peripheral tolerance with CD4 and CD8 monoclonal antibodies. Immunol Rev 129:165^201 Cosimi AB, Burton RC, Colvin RB et al 1981 Treatment of acute renal allograft rejection with OKT3 monoclonal antibody. Transplantation 32:535^539 Friend PJ, Hale G, Chatenoud L et al 1999 Phase I study of an engineered aglycosylated humanized CD3 antibody in renal transplant rejection. Transplantation 68:1632^1637 Goldstein G 1987 Overview of the development of Orthoclone OKT3: monoclonal antibody for therapeutic use in transplantation. Transplant Proc 19:1^6

CD3 ANTIBODY TREATMENT

285

Hayward AR, Shreiber M 1989 Neonatal injection of CD3 antibody into nonobese diabetic mice reduces the incidence of insulitis and diabetes. J Immunol 143:1555^1559 Herold KC, Bluestone JA, Montag AG et al 1992 Prevention of autoimmune diabetes with nonactivating anti-CD3 monoclonal antibody. Diabetes 41:385^391 Herold KC, Hagopian W, Auger JA et al 2002 Anti-CD3 monoclonal antibody in new-onset type 1 diabetes mellitus. N Engl J Med 346:1692^1698 Hirsch R, Eckhaus M, Auchincloss H Jr, Sachs DH, Bluestone JA 1988 E¡ects of in vivo administration of anti-T3 monoclonal antibody on T cell function in mice. I. Immunosuppression of transplantation responses. J Immunol 140:3766^3772 Hirsch R, Bluestone JA, de Nenno L, Gress RE 1990 Anti-CD3 F(ab0 )2 fragments are immunosuppressive in vivo without evoking either the strong humoral response or morbidity associated with whole mAb. Transplantation 49:1117^1123 Hughes C, Wolos JA, Giannini EH, Hirsch R 1994 Induction of T helper cell hyporesponsiveness in an experimental model of autoimmunity by using nonmitogenic anti-CD3 monoclonal antibody. J Immunol 153:3319^3325 Kirk AD, Burkly LC, Batty DS et al 1999 Treatment with humanized monoclonal antibody against CD154 prevents acute renal allograft rejection in nonhuman primates. Nat Med 5:686^693 Larsen CP, Elwood ET, Alexander DZ et al 1996 Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature 381:434^438 Nicolls MR, Aversa GG, Pearce NW et al 1993 Induction of long-term speci¢c tolerance to allografts in rats by therapy with an anti-CD3-like monoclonal antibody. Transplantation 55:459^468 Nooij FJ, Jonker M, Balner H 1986 Di¡erentiation antigens on rhesus monkey lymphocytes. II. Characterization of RhT3, a CD3-like antigen on T cells. Eur J Immunol 16:981^984 Ortho Multicenter Transplant Study Group 1985 A randomized clinical trial of OKT3 monoclonal antibody for acute rejection of cadaveric renal transplants. Ortho Multicenter Transplant Study Group. N Engl J Med 313:337^342 Plain KM, Chen J, Merten S, He XY, Hall BM 1999 Induction of speci¢c tolerance to allografts in rats by therapy with non-mitogenic, non-depleting anti-CD3 monoclonal antibody: association with TH2 cytokines not anergy. Transplantation 67:605^613 Qin SX, Cobbold SP, Benjamin R, Waldmann H 1989 Induction of classical transplantation tolerance in the adult. J Exp Med 169:779^794 Qin SX, Cobbold SP, Pope H et al 1993 ‘‘Infectious’’ transplantation tolerance. Science 259: 974^977 Roncarolo MG, Levings MK 2000 The role of di¡erent subsets of T regulatory cells in controlling autoimmunity. Curr Opin Immunol 12:676^683 Routledge EG, Falconer ME, Pope H, Lloyd IS, Waldmann H 1995 The e¡ect of aglycosylation on the immunogenicity of a humanized therapeutic CD3 monoclonal antibody. Transplantation 60:847^853 Sakaguchi S 2000 Regulatory T cells: key controllers of immunologic self- tolerance. Cell 101:455^458 Shevach EM 2000 Regulatory T cells in autoimmmunity. Annu Rev Immunol 18:423^449 Shevach EM 2002 CD4+ CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389^400 Smith JA, Tso JY, Clark MR, Cole MS, Bluestone JA 1997 Nonmitogenic anti-CD3 monoclonal antibodies deliver a partial T cell receptor signal and induce clonal anergy. J Exp Med 185:1413^1422 Smith JA, Tang Q, Bluestone JA 1998 Partial TCR signals delivered by FcR-nonbinding antiCD3 monoclonal antibodies di¡erentially regulate individual Th subsets. J Immunol 160:4841^4849

286

DISCUSSION

Wesselborg S, Janssen O, Kabelitz D 1993 Induction of activation-driven death (apoptosis) in activated but not resting peripheral blood T cells. J Immunol 150:4338^4345 Wofsy D, Mayes DC, Woodcock J, Seaman WE 1985 Inhibition of humoral immunity in vivo by monoclonal antibody to L3T4: studies with soluble antigens in intact mice. J Immunol 135:1698^1701 Woodle ES, Xu D, Zivin RA et al 1999 Phase I trial of a humanized, Fc receptor nonbinding OKT3 antibody, huOKT3gamma1[Ala-Ala] in the treatment of acute renal allograft rejection. Transplantation 68:608^616 Yasunami R, Bach J-F 1988 Anti-suppressor e¡ect of cyclophosphamide on the development of spontaneous diabetes in NOD mice. Eur J Immunol 18:481^484

DISCUSSION Harrison: I have a comment about adult-onset autoimmune diabetes. You showed this as being a slow curve from childhood. The jury is still out on that. It may be a slowly progressive disease initiated in childhood, but it may also occur de novo in adults. Chatenoud: I was recently talking to Jean Jacques Robert who is a paediatrician who sees diabetic children. He was telling me that increasingly they ¢nd overt diabetes in six month old babies. I was just trying to make the point that I am not sure that the types of strategies we use in adult patients are going to work in this type of aggressive disease Harrison: In the adults that we see with ‘autoimmune’ diabetes, who represent about 10% of ‘type 2 diabetics’, antibodies to glutamic acid decarboxylase (GAD) are usually the only immune marker. The evidence that these people have the type of autoimmune b cell destruction typical of children is actually not all that strong. Does this in any way in£uence your decision to use OKT3? Chatenoud: No. The hope is that the basic physiopathological mechanisms of the disease will not be so di¡erent in the various patients. The problem may be more the rapidity of the intervention; the more acute the disease the faster the treatment must be started. Harrison: Apart from age, are you not in any way concerned that people with adult-onset autoimmune diabetes, de¢ned only by the presence of GAD antibodies, are likely to respond di¡erently than children? Chatenoud: Indeed, the patients that are included in present trials are always antibody positive. Miller: With regard to Matthias Von Herrath’s model, could you state when during the course of the virus infection you give the antibody? Chatenoud: At three di¡erent times. We had three di¡erent protocols. The ¢rst involved giving the antibody for ¢ve days starting at day 0, at the time of the infection until day 5. The second was starting at day 8 until day 12, and the ¢nal one involved starting at the moment at which 40% of the animals were already diabetic.

CD3 ANTIBODY TREATMENT

287

Miller: So there was no delay in viral clearance. Von Herrath: With the full antibody there were problems in viral clearance. Associated with this there was increased immune pathology and ultimately these animals died. The ones treated with the anti-CD3 F(ab0 )2 antibody that is nonmitogenic have no problems and clear the virus with regular kinetics. Bach: CD3 antibody F(ab0 )2 fragment causes a very selective type of immune suppression. This is also true for cyclosporin: patients treated with cyclosporin for a long time at immunosuppressive doses show very few infections. Bluestone: It looks as if F(ab0 )2 is actually working at what we would otherwise call subtherapeutic doses. If you take out lymph node from these animals they still have a lot of T cell receptor expressed on their cell surface. I think it is an active mechanism of signalling but it doesn’t necessarily compromise the normal ability of these cells to respond to antigen. Miller: If you think you are inducing tolerance to the relevant antigens, do you induce tolerance to the virus antigens also? Von Herrath: Not necessarily. This is an argument that Abul Abbas has proposed several times. The quality of an antiviral response and the quality of these autoimmune responses are intrinsically quite di¡erent Miller: I think LCMV may be an exception, because CTL generation apparently doesn’t require much T cell help. Von Herrath: Development of autoimmunity in the LCMV lines that we use for testing immune interventions and regulatory cells requires CD4 help. Bluestone: Any kind of sledge-hammer approach like this raises concerns about its e¡ect on overall immunity. I’d like to describe some of our data on anti-CD3. Lucienne pointed out that OKT3 as a therapy doesn’t make a lot of sense. A lot of her studies were with the anti-CD3 Fos construct that we developed. Most of our mouse work has used anti-CD3 with an IgG tail that doesn’t bind Fc receptor. It would be interesting to compare these two directly because there have been some subtle di¡erences reported. The human study has been done with humanized OKT3 mutated at two positions in the Fc, 234 and 235, to wipe out the Fc receptor and complement binding activity. A lot of work suggests that the non-mitogenic anti-CD3 has similar e¡ects to that seen in the mouse. In peripheral blood of the mouse the most profound e¡ect we see in the Treg population is that if you treat animals with anti-CD3 you see a dramatic increase in their numbers. One of the things anti-CD3 does is therefore to induce or mobilize the Treg cells. The other thing is that it has a signi¢cant e¡ect on the pathogenic T cells. It seems to largely turn o¡ Th1 cells by inhibiting IL2 production. It inhibits LCK-dependent phosphorylation of the T cell receptor complex and AP1 activation. First, the clinical data. We decided to work on the population that we thought might have some residual islet cell mass. We treated these patients within six weeks after they were diagnosed with

288

DISCUSSION

type 1 diabetes giving them a two week treatment (by injection) of the antibody. We did this using increasing doses. The FDA was worried about side-e¡ects and our population had patients as young as 7. We started by giving patients 5 mg, increasing until we got a therapeutic dose, which we continued on with. We treated 21 patients and had 21 controls. The paper that is published (Herold et al 2002) only deals with the ¢rst 12, but I’ll describe the full data as we now have them. We used C peptide as a read-out of insulin production. The control group deteriorated and the amount of insulin they produced went down. The patients treated with anti-CD3 maintained their ability to make insulin. At 18 months there was a drop, but even at two years there is a signi¢cant di¡erence after just a two week treatment. If you look at how much insulin is required by these patients, the control patients who are losing their islet mass need increasingly more, but the treated patients need less insulin now than they did at time of diagnosis. This is a durable e¡ect. How does it work? We know that there is bivalent cross-linking which leads to partial phosphorylation of the TCR complex. There is phosphorylation of some proteins in the TCR itself. There is very little activation of LAT, and very little phosphorylation of ZAP-70. This leads to a very di¡erent set-up in the downstream signalling such that Fynmediated signalling leads to good activation of NF-kB but not good activation of AP1. There is no IL2 production to speak of. If we take a bulk population of T cells and either stimulate them with a soluble form or a cross-linked form; we get no IL2 production but we get good IL4 production in this population. If you try to re-stimulate them there is still some proliferation, but it is all IL4producing cells. There is no Th1 or IL2-producing cells. We have seen this both in vitro and in vivo. Pulling all this together we can say that this anti-CD3 appears to be acting on both a pathogenic T cell in that it causes anergy of Th1s and promotion of Th2s, it deletes what look like the pathogenic cells, and it also acts on the regulatory cells in a very di¡erent way. My prejudice is that it is this kind of partial signalling that is good for a regulatory cell but bad for a pathogenic cell. In another trial we have been doing islet transplantation, giving this antibody in conjunction with rapamycin and late low-dose FK506. We have some interesting results. The most prominent is that in all of our transplantations that are out long term we see a tremendous increase in peripheral CD4+CD25+ cells. These cells are suppressive in vitro. Roncarolo: Would you expect the same results with rapamycin alone in the transplant setting? Bluestone: That’s a good experiment. In the NOD mouse it doesn’t work, but I don’t know about humans. There is only one major side-e¡ect in the patients treated with anti-CD3. That is they get a rash on their ¢ngertips and torso. Is this happening in your trial too, Lucienne? Chatenoud: Yes.

CD3 ANTIBODY TREATMENT

289

Bluestone: About a week later the skin peels o¡ and they are ¢ne. It is not a vasculitis; it looks like eczema. The major cytokine we see in the serum of about 80% of the patients is IL10. When we take T cells from these patients at one week and stain intracellularly, we see a large number of IL10-producing IFNg-negative cells. The question is, what are these cells? They are CD25
. Shevach: Have you tried to tie the IL10 together with the rash? Bluestone: Yes, but we don’t have proof yet. Roncarolo: What about TGFb and IL5? Bluestone: There’s nothing dramatic going on with IL5, but with TGFb we have had a lot of trouble with reagents. Bach: What is unexpected is that with OKT3, which would normally be expected to induce much more cytokine release, we don’t see this. Bluestone: It is a balance that I don’t understand. If we do PCR in the spleen of these mice, the anti-CD3 induces IFNg and IL2, and the non-mitogenic appears to induce the TGFb and the IL10. The only other thing I will point out about the patients is that we get a £ip in the CD4:CD8 ratio, such that there is an absolute increase in the CD8+ cells. We know IL10 is a growth factor for CD8, so this could be the answer. What is interesting is that out of all the patients we have looked at so far there is a 100% correlation between this £ip and whether they respond. In the ¢rst 12 patients the nine that responded all had the £ip, and the three that didn’t respond didn’t have this £ip. In our transplant patients we have had four out of six that are long-term graft survivors and they have all £ipped. The two that didn’t did not. Roncarolo: Do you see an increase in total IgE? Bluestone: Haven’t looked. We should do this. Chatenoud: It has been described that patients who experience dose-dependent side-e¡ects when they get high doses of rapamycin have a dominant Th2 reaction that seems to localize in the lung. In the bronchoalveolar lavages a signi¢cant number of Th2-type cells are found without a major increase in IgE levels. Bach: We see this rash earlier. We don’t have the same protocol, because we give the vaccine straight away. This suggests it is probably associated with the initial cytokine release. Delovitch: How long does the rash persist for? Bluestone: 24 h, and the eczema resolves in about a week. Roncarolo: After I spoke to you about this rash I went back to the data in humans with IL10, and a rash is not reported. The only clinical situation in which we saw this consistent rash with children was with GM-CSF. Mitchison: Je¡ Bluestone, if we stitch together everything we have heard this afternoon about Notch, that cell should be called an ‘RSC’, a reduced signalling cell! Shevach: If you separate your cells into CD25+ and CD25
cells, do you see a di¡erence when you stimulate with anti-CD3?

290

DISCUSSION

Bluestone: No. If we take a puri¢ed population of CD25+ and CD25
, stimulate them with anti-CD3 for ¢ve minutes and so an immunoblot of phosphorylated proteins, there is zero di¡erence between the two. Shevach: In the animals that have received anti-CD3, and in which you have induced some CD25+ cells, how do they respond when they are stimulated in vitro? Bluestone: I haven’t looked at signalling of CD25+ cells out of the treated animals. In the whole population there are Th2-like cytokine responses, but it is a polyclonal situation. Reference Herold KC, Hagopian W, Auger JA et al 2002 Anti-CD3 monoclonal antibody in new-onset type 1 diabetes mellitus. N Engl J Med 346:1692^1698

The role of dendritic cells in regulating mucosal immunity and tolerance Allan McI Mowat, Anne M Donachie, Lucy A. Parker, Neil C. Robson, Helen Beacock-Sharp, Lindsay J. McIntyre, Owain Millington and Fernando Chirdo Department of Immunology and Bacteriology, University of Glasgow, Western In¢rmary, Glasgow G11 6NT, UK

Abstract. The intestinal immune system discriminates between invasive pathogens and antigens that are harmless, such as food proteins and commensal bacteria. The latter groups of antigens normally induce tolerance and a breakdown in this homeostatic process can lead to diseases such as coeliac disease or Crohn’s disease. The nature of the intestinal immune response depends on how antigen is presented to CD4+ T cells by dendritic cells (DCs). Both oral tolerance and priming are in£uenced by the numbers and activation status of DCs in the gut and its draining lymphoid tissues, and our current work indicates that dietary proteins are taken up preferentially by DCs in the lamina propria of the small intestine. These then migrate to interact with antigenspeci¢c CD4+ T cells in the mesenteric lymph node. In vivo and in vitro studies using puri¢ed lamina propria DCs suggest these may play a unique role in the regulation of intestinal immune responses. We propose that local DCs are the gatekeepers of the mucosal immune system, inducing tolerance under physiological conditions, but being su⁄ciently responsive to in£ammatory stimuli to allow T cell priming and protective immunity when necessary. In addition, we will discuss evidence that adjuvant vectors such as ISCOMS may be e¡ective mucosal vaccines due to an ability to activate intestinal DCs. 2003 Generation and e¡ector functions of regulatory lymphocytes. Wiley, Chichester (Novartis Foundation Symposium 252) p 291^305

The intestine encounters more antigen than any other part of the body and so contains the largest proportion of the immune system. The gut-associated lymphoid tissues (GALT) comprise organized tissues such as the Peyer’s patches (PPs) and mesenteric lymph nodes (MLNs) that are generally considered to be inductive sites, while the e¡ector cells are distributed throughout the mucosa itself (Mowat & Viney 1997). This sophisticated immune apparatus is necessary to generate strong protective immunity against pathogenic infections, but much of the intestinal antigen load consists of harmless materials such as food proteins and commensal bacteria. It would be wasteful to direct active immune responses against these antigens and in fact, such responses cause intestinal disorders such as 291

292

MOWAT ET AL

coeliac disease and Crohn’s disease (Garside et al 1999, Mowat & Weiner 1999). For these reasons, the default response to harmless antigens in the gut is the induction of immunological hypo-responsiveness. In addition to its physiological role, this phenomenon of oral tolerance can be exploited to deliver immunotherapy against autoimmune and in£ammatory diseases (Faria & Weiner 1999, Mowat & Weiner 1999) and it is also an important obstacle to the development of oral vaccines. Therefore it would be important to identify the mechanisms by which the intestinal immune system can discriminate between harmless and invasive antigens. In common with other parts of the immune system, the activation status of intestinal antigen presenting cells (APCs) seems to determine whether an antigen induces tolerance or productive immunity. In older work, we found that agents which produce generalized activation of APCs in vivo prevented the induction of tolerance by feeding ovalbumin (OVA) to mice (Mowat 1987, Strobel et al 1985), but the cellular basis of these e¡ects was not determined. More recently, evidence has accumulated that local dendritic cells (DCs) are the key players in these decision-making processes in the intestinal immune system.

Role of DCs in oral tolerance The intestine and its lymphoid organs contain large numbers of DCs, including a number of unique subsets (Iwasaki & Kelsall 2001, Mowat & Viney 1997). Many are in ideal positions to take up antigen directly from the lumen and the lymph draining the gut contains DCs that can be loaded with antigen by feeding (MacPherson & Liu 1999). Administration of the haemopoietic cytokine £t3 ligand (£t3L) selectively expands DC numbers in mice, with considerable increases in the populations of all DCs in the PPs, MLNs and intestinal mucosa (Viney et al 1998). Under these conditions, mice become more susceptible to the induction of oral tolerance by feeding OVA, with doses of antigen that normally produce no e¡ect, or that can prime normal animals, now inducing solid tolerance (Viney et al 1998, Williamson et al 1999a). The DCs involved in taking up fed proteins do not appear to be inherently tolerogenic, as administration of interleukin (IL)1 to £t3L-treated mice activates intestinal DCs and prevents the induction of oral tolerance by feeding OVA (Williamson et al 1999a). In addition, the oral immunogenic cholera toxin induces much enhanced local and systemic immune responses in £t3L-treated mice (Williamson et al 1999a). Thus it appears that DCs are the gatekeepers of the mucosal immune response, supporting the induction of tolerance to foods and other harmless antigens under physiological conditions, but also being responsible for allowing active immunity to develop when invasive pathogens or other dangerous materials are encountered.

DCs IN IMMUNITY AND TOLERANCE

293

Lamina propria as a site of uptake of protein antigens If DCs are indeed the principal APCs involved in the decision between tolerance and immunity, it will be important to establish where the relevant DCs are and where they interact with T cells. Amongst other things, these factors will decide whether mucosal administration of antigen can have local or systemic e¡ects, or both. Conventional opinion is that M cells in the follicle-associated epithelium (FAE) of PPs are the principal route for the uptake of antigens from the intestine (Neutra et al 1996) and there are large numbers of DCs in the PPs, including in the region immediately under the FAE. Accumulating evidence also suggests that PP DCs comprise several distinct subsets, including some that produce IL10 rather than IL12 and polarize na|« ve T cells to a Th2 or regulatory phenotype (Iwasaki & Kelsall 1999, 2000, 2001). Together with older information that fed antigens can be detected on APCs isolated from PPs (Richman 1981) and more recent ¢ndings that activation of antigen-speci¢c T cells can be detected rapidly in the PPs after feeding antigen (Marth et al 1996, Meyer et al 2001, Alpan et al 2001, Smith et al 2002, Sun et al 1999, Van Houten & Blake 1996, Williamson et al 1999b), these results support the idea that PPs are an important site for the uptake and presentation of tolerogenic antigens. Nevertheless, this has not been shown directly and studies examining the induction of oral tolerance in mice lacking PP have proved contradictory (Fujihashi et al 2001, Spahn et al 2002). It is also important to remember that DCs are also present in other parts of the intestine and GALT, including the lamina propria (LP) and MLNs. We were particularly interested in examining the role of LP DCs, as the surface area of the villus mucosa is so much greater than that of PPs and our previous work had indicated that the expansion of DCs was particularly marked in the LP of £t3Ltreated mice with increased susceptibility to oral tolerance (Viney et al 1998). More recently, we have examined where fed protein antigen is taken up in the intestine and investigated the properties of DCs isolated from the lamina propria. In the ¢rst experiments, we treated mice with £t3L to expand DC numbers, fed them 200 mg OVA, and then isolated cells from the PPs, MLNs, LP and spleen from 15 minutes to 72 hours later. These unseparated cells were then used as APCs to stimulate na|« ve OVA-speci¢c T cell receptor (TCR) transgenic CD4+ T cells in vitro in the absence of further antigen. This showed that antigen loaded APCs could be isolated from the LP within 15 minutes of feeding, with high levels of APC activity being detectable in this tissue at 1 hour, before declining and being almost completely absent by 20 hours (Fig. 1). A similar time course of antigen loading was found in PPs and MLNs, but the levels of APC activity in these tissues were of a much lower magnitude than in LP (Fig. 1B), even when the numbers of DCs in the di¡erent tissues were corrected for. Interestingly, APCs appeared to persist in MLNs for somewhat longer than in PPs or LP, while spleen showed low levels

294

MOWAT ET AL

FIG. 1. Uptake of antigen into lamina propria (LP), PPs and MLNs after feeding ovalbumin. BALB/c mice were treated with £t3L for 9 days, fed 200 mg OVA and tissues removed at intervals thereafter. After isolation, cells were treated with mitomycin c and cultured with na|« ve OVA-speci¢c DO11.10 TCR transgenic CD4+ T cells for 48 hours. The results shown are the responses in the presence of loaded APCs as a ratio to those obtained using OVA 323^ 339 as a positive control. Most of the uptake was in LP (A); PP and MLN showed a similar time course of uptake, but this was much less (A,B).

of APC activity and only at 24 hours (data not shown). A similar pattern was observed in non-£t3L-treated mice, with maximal uptake in LP and much less in other tissues. However, the level of antigen uptake was considerably lower than in £t3L-treated mice. Together these results indicate that the LP is the principal site of uptake for orally administered protein antigens and that DCs may be the APC involved.

Lamina propria DCs To con¢rm these ¢ndings and to explore further the role of DCs in LP in mucosal immunity, we have established techniques for obtaining puri¢ed populations of DCs from LP. After removal of the epithelium, small intestine was digested with collagenase and DNAase to obtain single cell suspensions from the LP. In normal mice, LP contains 1^2% CD11c+ DCs, but after treatment with £t3L this increased to up to 25% (Fig. 2A). CD11c+ cells were then enriched using two positive

DCs IN IMMUNITY AND TOLERANCE

295

FIG. 2. Isolation and characterization of LP DCs. Mice were treated with £t3L for 9 days and LP cells were isolated by digestion with collagenase and DNAase. DCs were puri¢ed by two positive selection steps using anti-CD11c and MACS columns. The initial population of LP contained 28% CD11c+ DC and this was enriched to *90% after puri¢cation. The DC were both CD11chighClass II MHChigh and CD11cintClass II MHCint and contained CD11b+ and CD8a+ subsets. The expression of CD40, CD80 and CD86 on CD11c+ cells was low.

selection MACS columns, routinely yielding *5105 DCs/mouse of 80^90% purity (Fig. 2A). Most of these were CD11chighClass II MHChigh, although in most experiments, there was a small number of CD11cintClass II MHCint DCc, whose nature is unclear (Fig. 2). The majority (50^60%) were CD11b+CD8a+, 20% were CD11b CD8a+ and a further 20% had a CD11b CD8a phenotype (Fig. 2), similar to the unusual subset described recently in murine Peyer’s patches (Iwasaki & Kelsall 2000, 2001). 5^10% CD4+ DCs could also be detected in most experiments (Table 1). The expression of activation-related markers on LP DCs was variable, presumably re£ecting the length and relative trauma of the isolation procedure. However, with care, the majority were CD80low/ , CD86low/ and CD40 and there were no di¡erences between LP DCs and DCs isolated from spleen or PP using the same procedure (Fig. 2). Overnight incubation with LPS induced virtually all LP DCs to express CD80, CD86 and CD40, indicating their ability to respond to in£ammatory stimuli (data not shown).

296

MOWAT ET AL

TABLE 1

Phenotypic subsets of lamina propria DCs

Subset

%

CD11b+CD8a CD11b CD8a CD11b CD8a+ CD11b+CD4+ CD11b+CD8a+ DEC205+

60% 21% 19% *5% 0% 5^15%

Puri¢ed LP DCs had e⁄cient endocytic activity as measured by uptake of FITCdextran, which was equivalent to that of PP DCs (Fig. 3A). In addition, LP DCs pulsed with OVA in vitro were capable of stimulating na|« ve antigen-speci¢c CD4+ T cells, although their APC activity was somewhat less than that of equivalent numbers of spleen or PP DCs (Fig. 3B). To examine their role as APCs in vivo, we puri¢ed LP and PP DCs from mice fed OVA 1 hour previously and used these to stimulate DO11.10 T cells in vitro in the absence of added antigen. Under these conditions, LP DCs induced high levels of T cell proliferation, whereas the same numbers of PP DCs were less active (Fig. 3C). These results con¢rm the preferential loading of LP APCs by fed protein antigens and support the idea that DCs are responsible for this activity. In preliminary studies, we have gone on to explore the possible immunoregulatory roles of LP DCs in vivo. DCs were puri¢ed from OVA-fed mice and transferred subcutaneously into syngeneic mice that had also been adoptively transferred a day previously with a small number of CFSE-labelled DO11.10 T cells. As controls, mice received either OVA/CFA, equivalent numbers of PP DCs from OVA-fed mice, or bone marrow-derived DCs that had been pulsed with OVA in vitro. As anticipated, immunization with OVA/CFA induced clonal expansion and activation of the TCR transgenic OVA-speci¢c CD4+ T cells in the draining lymph node, as assessed by FACS detection of CD4+KJ1.26+ T cells, CD69 expression and cell division as determined by loss of CFSE staining (Fig. 4A^C). Similar results were obtained in recipients of in vivo loaded PP DCs, although the degree of T cell activation was somewhat less than that observed with LP DCs (data not shown). 10 days after priming with LP DCs, recipient mice had low, but detectable levels of OVA-speci¢c IgG antibodies in serum, which were not seen in mice given PP DCs. However, when mice were challenged with OVA/CFA 10 days after transfer of DCs, the recipients of OVAloaded LP DCs had signi¢cantly lower antigen-speci¢c delayed-type hypersensitivity (DTH) responses compared with immunized controls, or with

DCs IN IMMUNITY AND TOLERANCE

297

FIG. 3. Functions of LP DCs. (A) DCs from LP and PP had equivalent abilities to endocytose FITC-dextran in vitro. (B) Presentation of OVA to antigen-speci¢c CD4+ T cells by puri¢ed LP and spleen DCs. DCs were puri¢ed, pulsed with OVA for 2 hours and used at di¡erent ratios to stimulate na|« ve DO11.10 cells for 48 hours. (C) Uptake of fed antigen by LP and PP DCs in vivo. BALB/c mice were treated with £t3L for 9 days, fed 200 mg OVA and DCs puri¢ed, before being cultured at di¡erent ratios with na|« ve OVA-speci¢c DO11.10 cells for 48 hours.

recipients of normal LP DCs (Fig. 4D). This suppression was not seen in mice primed with bone marrow DCs that were loaded with OVA in vitro. Thus, in vivo loaded LP DCs can present antigen to speci¢c CD4+ T cells when transferred into na|« ve recipients, but these T cells may be tolerized as a result of this encounter. These ¢ndings con¢rm and extend earlier work in which unseparated APCs from the LP of antigen-fed mice induced speci¢c tolerance in normal recipients (Harper 1996) and are consistent with the hypothesis that uptake of fed proteins by LP DCs is central to the induction of oral tolerance. Interestingly, our most recent studies support this idea further, as we have found that puri¢ed LP DCs contain high levels of mRNA for IL10, but not IL12 or TNFa, whereas freshly isolated bone marrow DCs show the opposite pattern (data not shown). If con¢rmed, our ¢ndings suggest that under physiological conditions, LP DCs share the features of resting DCs isolated from other mucosal sites including the PPs and respiratory tract (Iwasaki & Kelsall 1999, Stumbles et al 1998) and that their role in these

298

MOWAT ET AL

FIG. 4. E¡ects of antigen-loaded LP DC in vivo. LP DCs were puri¢ed from OVA-fed BALB/c mice and transferred subcutaneously into na|« ve BALB/c mice that had been adoptively transferred with CFSE-labelled D011.10 cells 1 day before. Immunization of adoptive transfer recipients with OVA/CFA caused clonal expansion (A), CD69 expression (B) and cell division, as measured by CFSE labelling (C) in the draining lymph node, peaking 5^7 days. OVA-loaded DCs from lamina propria produced little clonal expansion compared with unloaded DCs (A), but most of the OVA-speci¢c T cells expressed CD69 (B) and had undergone cell division (C). Mice given in vivo OVA-loaded LP DCs had suppressed DTH responses when challenged 10 days later with OVA/CFA, compared with responses in mice given unloaded DCs (D). This e¡ect was not seen in mice given BM DCs which had been loaded with OVA in vitro.

circumstances is to induce anergy, or deviation to a regulatory phenotype in antigen-speci¢c T cells. It seems most likely that this interaction will occur in the draining MLNs, rather than in the mucosa itself. Na|« ve CD4+ T cells are virtually absent from the LP (MacDonald & Pender 1998) and most studies using adoptively transferred TCR transgenic T cells have shown that CD4+ T cells recognize fed antigens in the MLNs within a few hours (Alpan et al 2001, Smith et al 2002, Sun et al 1999, Van Houten & Blake 1996, Williamson et al 1999b). In addition, tolerogenic DCs are present in the MLNs of antigen-fed mice (Akbari et al 2001, Alpan et al 2001), probably having reached there from the gut wall via the draining lymph (MacPherson & Liu 1999). It will be of interest to de¢ne the factors which

DCs IN IMMUNITY AND TOLERANCE

299

determine the functions and migration pathways of mucosal DCs during the induction of oral tolerance.

Dendritic cells in determining the immunological consequences of oral administration of antigen As we have noted, intestinal DCs are not an inherently tolerogenic population and activation of DCs with agents such as IL1 prevents the induction of oral tolerance (Williamson et al 1999a). This ability of local DCs to alter their functions in response to environmental stimuli is consistent with the plasticity of DCs in other tissues (Banchereau & Steinman 1998) and will be an essential factor in the generation of protective immunity against infection. In addition, it may prove useful in the targeting of mucosal vaccine vectors. An example of this is provided by immune stimulating complexes (ISCOMS) containing Quil A as adjuvant. Protein antigens incorporated into these lipophilic particles are highly immunogenic by the oral route, inducing speci¢c antibody responses, CD4+ T cell activity and priming class I MHC restricted CD8+ T cells (Mowat et al 1999). Our recent work has shown that ISCOMS stimulate a number of aspects of the innate immune system in vivo, including the recruitment of DCs (Mowat et al 1999, Smith et al 1999). ISCOMS are readily taken up by DCs in vivo and in vitro and immature DCs are activated after contact with ISCOMS (Fig. 5). After

FIG. 5. Activation of cytokine production in DCs by ISCOMS. DCs were cultured from mouse BM using GM-CSF and stimulated with ISCOMS containing 10 mg/ml OVA, or with 1 mg/ml LPS for 4 hours. The levels of mRNA for IFNb, TNFa and IL12 were measured by real time PCR (Taqman) and assessed relative to expression of the housekeeping gene Hprt.

FIG. 6. Role of DCs in immune responses to ISCOMS. Bone marrow DCs pulsed with ISCOMS containing OVA present antigen to na|« ve TCR transgenic CD8+ (A) and CD4+ T cells (B) in vitro. Expansion of DCs in vivo enhances (C) CD4- and (D) CD8-mediated immune responses to OVA ISCOMS. Mice were treated with £t3L for 9 days, transferred with either D011.10 CD4+ (C) or OT1 CD8+ (D) TCR transgenic T cells, 1 day before subcutaneous immunisation with OVA ISCOMS. Immunization with OVA ISCOMS produced clonal expansion of both CD4+ and CD8+ T cells in the draining lymph node and this was increased in mice treated with £t3L, especially that of CD8+ T cells.

300 MOWAT ET AL

DCs IN IMMUNITY AND TOLERANCE

301

loading with ISCOMS containing OVA, DCs present the antigen extremely e⁄ciently to antigen speci¢c CD4+ and CD8+ T cells (Fig. 6A,B) and expansion of DCs with £t3L leads to markedly enhanced CD4+ and CD8+ T cell mediated immune responses in vivo (Fig. 6C,D). Interestingly, £t3L has similar e¡ects on local and systemic immune responses to the mucosal adjuvant cholera toxin (Williamson et al 1999a) and together, these ¢ndings illustrate the potential bene¢ts of targeting mucosal DCs in the design of novel mucosal vaccines. Acknowledgements The work of the authors cited here is supported by the Wellcome Trust and the EC. References Akbari O, DeKruy¡ RH, Umetsu DT 2001 Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nat Immunol 2:725^731 Alpan O, Rudomen G, Matzinger P 2001 The role of dendritic cells, B cells and M cells in gutoriented immune responses. J Immunol 166:4843^4852 Banchereau J, Steinman RM 1998 Dendritic cells and the control of immunity. Nature 392: 245^252 Faria AMC, Weiner HL 1999 Oral tolerance: mechanisms and therapeutic applications. Adv Immunol 73:153^264 Fujihashi K, Dohi T, Rennert PD et al 2001 Peyer’s patches are required for oral tolerance to proteins. Proc Natl Acad Sci USA 98:3310^3315 Garside P, Mowat AM, Khoruts A 1999 Oral tolerance in disease. Gut 44:137^142 Harper HM, Cochrane L, Williams NA 1996 The role of small intestinal antigen-presenting cells in the induction of T-cell reactivity to soluble protein antigens: association between aberrant presentation in the lamina propria and oral tolerance. Immunology 89:449^456 Iwasaki A, Kelsall BL 1999 Freshly isolated Peyer’s patch, but not spleen, dendritic cells produce interleukin 10 and induce the di¡erentiation of T helper type 2 cells. J Exp Med 190:229^239 Iwasaki A, Kelsall BL 2000 Localization of distinct Peyer’s patch dendritic cell subsets and their recruitment by chemokines macrophage in£ammatory protein MIP-3alpha, MIP-3beta, and secondary lymphoid organ chemokine. J Exp Med 191:1381^1394 Iwasaki A, Kelsall BL 2001 Unique functions of CD11b+, CD8alpha+ and double negative Peyer’s patch dendritic cells. J Immunol 166:4884^4490 MacDonald TT, Pender SLF 1998 Lamina propria T cells. Chem Immunol 71:103^117 MacPherson GG, Liu LM 1999 Dendritic cells and Langerhans cells in the uptake of mucosal antigens. Curr Top Microbiol Immunol 236:33^53 Marth T, Strober W, Kelsall BL 1996 High dose oral tolerance in ovalbumin TcR-transgenic mice: systemic neutralization of IL-12 augments TGF-beta secretion and T cell apoptosis. J Immunol 157:2348^2357 Meyer AL, Benson J, Song F et al 2001 Rapid depletion of peripheral antigen-speci¢c T cells in TcR-transgenic mice after oral administration of myelin basic protein. J Immunol 166: 5773^5781 Mowat AM 1987 The regulation of immune responses to dietary protein antigens. Immunol Today 8:93^98 Mowat AM, Viney JL 1997 The anatomical basis of intestinal immunity. Immunol Rev 156: 145^166

302

DISCUSSION

Mowat AM, Weiner HL 1999 Oral tolerance: basic mechanisms and clinical implications. In: Ogra PL, Mestecky J, Lamm ME, Strober W, McGhee JR, Bienenstock J (eds) Mucosal immunology. 2nd edn, Academic Press, San Diego, p 587^617 Mowat AM, Smith RE, Donachie AM, Furrie E, Grdic D, Lycke N 1999 Oral vaccination with immune stimulating complexes. Immunol Lett 65:133^140 Neutra MR, Frey A, Kraehenbuhl J-P 1996 Epithelial M cells: gateways for mucosal infection and immunization. Cell 86:345^348 Richman LK, Grae¡ AS, Strober W 1981 Antigen presentation by macrophage-enriched cells from the mouse Peyer’s patch. Cell Immunol 62:110^118 Smith RE, Donachie AM, Grdic D, Lycke N, Mowat AM 1999 Immune stimulating complexes induce an IL-12 dependent cascade of innate immune responses. J Immunol 162:5536^5546 Smith KM, Davidson JM, Garside P 2002 T-cell activation occurs simultaneously in local and peripheral lymphoid tissue following oral administration of a range of doses of immunogenic or tolerogenic antigen although tolerized T cells display a defect in cell division. Immunology 106:144^158 Spahn TW, Weiner HL, Rennert PD et al 2002 Mesenteric lymph nodes are critical for the induction of high-dose oral tolerance in the absence of Peyer’s patches. Eur J Immunol 32:1109^1113 Strobel S, Mowat AM, Ferguson A 1985 Prevention of oral tolerance induction to ovalbumin and enhanced antigen presentation during a graft-versus-host reaction in mice. Immunology 56:57^64 Stumbles PA, Thomas JA, Pimm CL et al 1998 Resting respiratory tract dendritic cells preferentially stimulate helper cell type 2 Th2 responses and require obligatory cytokine signals for induction of Th1 immunity. J Exp Med 188:2019^2031 Sun J, Dirden-Kramer B, Ito K, Ernst PB, Van Houten N 1999 Antigen-speci¢c T cell activation and proliferation during oral tolerance induction. J Immunol 162:5865^5875 Van Houten N, Blake SF 1996 Direct measurement of anergy of antigen-speci¢c T cells following oral tolerance induction. J Immunol 157:1337^1341 Viney JL, Mowat AM, O’Malley JM, Williamson E, Fanger NA 1998 Expanding dendritic cells in vivo enhances the induction of oral tolerance. J Immunol 160:5815^5825 Williamson E, Westrich GM, Viney JL 1999a Modulating dendritic cells to optimize mucosal immunization protocols. J Immunology 163:3668^3675 Williamson E, O’Malley JM, Viney JL 1999b Visualizing the T cell response elicited by oral administration of soluble protein antigen. Immunology 97:565^572

DISCUSSION Miller: If you take DCs from the spleen of LP-fed mice, are they able to present antigen endogenously? Mowat: We have not done very many of these studies. When we did the studies using spleen or mesenteric lymph node without puri¢cation of DCs, and just fed the animals, we got very little activity from these cells. We have done very few experiments purifying DCs from these sites. We looked at MLNs and spleen only an hour after feeding, so we can’t say anything about other times. This doesn’t mean that something isn’t happening later on, but we now need to study this. Miller: In your tolerance induction experiment, was the route that you administered the DCs from the LP intravenous?

DCs IN IMMUNITY AND TOLERANCE

303

Mowat: No, it was subcutaneous. We give them into one footpad and then challenge them with antigen in the opposite footpad. Banchereau: People say that if a DC doesn’t mature it may induce tolerance. This raises two questions. Hawiger et al (2001) has shown that if you target DCs in vivo with an antibody, this is tolerogenic. If you add an anti-CD40 antibody, this is immunogenic. Have you done the experiment with £t3 in which you added antiCD40 at the same time, and seen immunogenicity rather than tolerogenicity? Mowat: We have tried soluble anti-CD40, and there are a lot of timing problems with this. We also gave IL1 at the end of the £t3L treatment programme. This activates the DCs in the gut and elsewhere and it completely breaks tolerance. Banchereau: In the sequential event one would guess that those LP DCs would be resistant to LPS, because there is LPS all around in the gut. If you want those cells to do the job of inducing tolerance, you would like them to be resistant. Do they express Toll4 ligand? Mowat: I have no idea. The presence of LPS in the gut is a major issue. Whether this is having an e¡ect or not is uncertain. If you take LPS out of the system there is a defect in oral tolerance, so some of this is needed for tolerance. If LPS is given intravenously to mice, this accelerates the output of DCs from the gut wall. We have not done enough with our puri¢ed DCs and LPS treatment to know whether these respond entirely normally in terms of the response of costimulatory molecules. Miller: Has anyone every compared DCs from C3H/HEJ mice that can’t signal via TLR4 in response to LPS? Mowat: If you look at DCs in the gut, they are going out every couple of days. Something is making them move out, yet they are tolerogenic under these conditions. It is not like the situation of Langerhans in skin, where if they are given an in£ammatory signal they up-regulate co-stimulatory molecules and chemokine receptors, and then leave. There’s a dichotomy in the gut between maturational activation and migration. Banchereau: Can you observe their migration? Mowat: We have not, but others have. Our cells leave the gut and we don’t know where they are going. We assume they go to mesenteric lymph node. Abbas: Do the tolerized DO11.10 cells become suppressive? Mowat: We don’t know. In one experiment we took lamina propria DCs and cocultured them with DO11.10 cells in vitro. We tried to get the DO11.10 cells in that situation to show tolerance or to be regulatory. We got nothing. Mitchison: There is an expectation that H-2E is a better regulatory cell inducer than H-2A. It would be good to know whether the expression of class II you saw was somehow biased towards E rather than A. Mowat: We discussed this about 15 years ago. Mice that don’t express H-2E are slightly more di⁄cult to tolerize than mice that do.

304

DISCUSSION

Bluestone: There are a whole series of knockout mice now available that have a variety of outcomes in terms of the presence or absence of PPs and peripheral lymph nodes. It would be fairly straightforward to ask where in this setting you will get the same results? Mowat: It is straightforward in theory, and the experiments have been done. There are four papers looking either at mice lacking PPs or p55 knockout mice. Two of these say that PPs are needed for oral tolerance, and two say they aren’t. Bluestone: What about AlyAly mice? Mowat: This hasn’t been looked at. There’s one paper that suggests that MLNs are needed, and that in the LTB knockout mouse lacking these doesn’t show tolerance. But the anatomy of these mice is so di¡erent, it is di⁄cult to get clear results. Harrison: We have found with human blood cells that exposure to LPS appears to anergize T cells. If you ask the T cells to respond to tetanus, the proliferative and IL2 responses are markedly decreased, but this can be overcome by adding back IL2. Paradoxically, it seems that chronic exposure of APCs to LPs seems to cause them to become tolerogenic. Mowat: I don’t think that there is a separate subset of DCs in the gut LP and PPs: I’m sure it is the same precursors that go everywhere. But when they go into the gut they are exposed to a microenvironment that has LPS and other bacterial products plus a range of other stimuli. This milieu might already contain lots of regulatory T cells. These dendritic cells have been instructed by the microenvironment to keep this tolerance going. It is only when you do something else to them that they will do something else. I’m sure this is why the microenvironment is important in terms of inducing regulatory cells. Roncarolo: Speaking of the microenvironment, we have data that IL15 is the major growth factor for these IL10-producing cells. In the LP there is a lot of IL15 around. Which cells produce it? The DCs? Mowat: I don’t know. We are looking at this now. One group showed that IL15 is being made by epithelial cells in the gut. This may be where it is coming from. It may be maintaining the regulatory cell population in the LP. This is a beautiful idea. Hasenkrug: I am confused about one thing. Why do T cells proliferate in the presence of these tolerogenic DCs? Mowat: Because they are seeing antigen. If you do these cultures for two or three days, one assumes that the DCs are actually reacting to the T cells that they are ‘seeing’ under these conditions in a plastic well. The microenvironment is not the same as it is in vivo. They present the antigen and then they start proliferating, and the DC reacts to that. Abbas: In just about every model of tolerance where you can ask that question, the T cells seem to go through this phase of proliferation and then get shut down.

DCs IN IMMUNITY AND TOLERANCE

305

Bach: I would like to ask the experts’ opinion on the intriguing observations in humans and animal models on the protective e¡ects of probiotics on allergic and autoimmune diseases. There have been remarkable clinical trials showing that administration of non-pathogenic lactobacilli to pregnant atopic women and newborns protected the newborns from atopic dermatitis in a signi¢cant fashion. We have the same data for the NOD mouse. Mowat: My information is that some of these things work by inducing IL10. Bach: Indeed, there was a correlation between IL10 production and protection. Mowat: Where these bacteria are acting is a big issue at the moment. Between the bacteria and the DCs and T cells are the epithelial cells. There is increasing evidence that the epithelial cell is the transducer of that signal from the bacteria to the DCs. You could imagine that the commensal bacteria inhibit the signalling of pathogenic bacteria. The epithelial cell may be making di¡erent mediators in response to probiotic organisms which then push the di¡erentiation of the local DCs towards a more tolerogenic phenotype. Reference Hawiger D, Inaba K, Dorsett Y et al 2001 Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J Exp Med 194:769^779

Index of contributors Non-participating co-authors are indicated by asterisks. Entries in bold indicatepapers; other entries refer to discussion contributions. *Champion, B. 268 Chatenoud, L. 22, 37, 41, 42, 43, 64, 111, 112, 113, 131, 205, 206, 258, 261, 262, 263, 264, 279, 286, 288, 289 *Chirdo, F. 291 Cuturi, C. 173, 174

A Abbas, A. K. 17, 37, 38, 40, 41, 42, 43, 44, 52, 53, 64, 65, 88, 89, 90, 91, 102, 103, 108, 112, 129, 191, 192, 201, 203, 210, 221, 223, 224, 253, 254, 257, 258, 261, 263, 264, 265, 277, 303, 305 Asseman, C. 102, 200, 201, 202, 239

D

B

Dallman, M. J. 128, 268, 276, 277, 278 Delovitch, T. L. 19, 20, 38, 65, 109, 144, 146, 160, 161, 163, 222, 255, 277, 289 *Donachie, A. M. 291

Bach, J.-F. 1, 16, 18, 20, 21, 36, 37, 39, 40, 41, 42, 43, 53, 54, 63, 66, 100, 101, 103, 104, 106, 108, 109, 110, 111, 112, 128, 142, 144, 160, 161, 162, 163, 164, 171, 172, 173, 175, 190, 191, 203, 204, 205, 206, 207, 209, 220, 221, 222, 235, 236, 253, 259, 260, 261, 264, 266, 277, 287, 289, 305 *Baecher-Allan, C. 67 Banchereau, J. 36, 63, 111, 112, 131, 160, 162, 190, 206, 209, 226, 235, 236, 237, 238, 265, 303 *Beacock-Sharp, H. 291 Bluestone, J. A. 17, 18, 19, 38, 39, 41, 42, 43, 53, 54, 55, 63, 64, 65, 66, 88, 89, 98, 99, 103, 108, 109, 112, 113, 127, 129, 144, 160, 163, 173, 174, 175, 189, 191, 201, 203, 204, 205, 206, 207, 208, 209, 210, 222, 224, 236, 237, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 277, 278, 287, 288, 289, 290, 304 *Boden, E. 55 *Bour-Jordan, H. 55 *Brown, J. A. 67 *Bushell, A. 177

F *Fay, J. 226 Flavell, R. 21, 39, 64, 104, 106, 108, 109, 112, 130, 131, 162, 163, 192, 203, 209, 259, 260, 262, 263, 264, 277 *Freeman, G. J. 67 *Fukui, Y. 6 G *Gregori, S. 115 H Ha£er, D. A. 19, 21, 41, 63, 67, 88, 89, 90, 91, 103, 104, 110, 127, 129, 130, 162, 220, 221, 223, 257, 263 Harrison, L. C. 17, 19, 39, 43, 99, 100, 101, 104, 105, 108, 132, 142, 143, 144, 173, 188, 203, 206, 208, 210, 221, 222, 236, 254, 266, 286, 304 Hasenkrug, K. J. 20, 39, 40, 128, 194, 199, 200, 254, 260, 304 *’t Hoen, E. N. M. 211 *Hori, S. 6, 177

C *Carpentier, P. A. 45 306

INDEX OF CONTRIBUTORS

K *Karim, M. 177 *Kohm, A. P. 45 *Kumar, V. 165 L *Lamb, J. R. 268 *Levings, M. 115 M *Madakamutil, L. 165 *Maloy, K. 92 *Martinez, N. R. 132 *Maverakis, E. 165 *McHugh, R. S. 24 *McIntyre, L. J. 291 *Meagher, C. 146 *Mi, Q.-S. 146 Miller, S. D. 45, 52, 53, 54, 113, 144, 161, 171, 172, 173, 174, 188, 207, 209, 222, 223, 263, 277, 286, 287, 302, 303 *Millington, O. 291 Mitchison, A. 21, 39, 40, 52, 89, 90, 101, 103, 106, 111, 112, 130, 163, 173, 175, 191, 199, 222, 223, 238, 255, 256, 262, 263, 278, 289, 303 *Mottet, C. 92 Mowat, A. 37, 38, 39, 42, 44, 54, 66, 101, 102, 103, 113, 142, 143, 144, 163, 172, 191, 192, 206, 207, 208, 221, 224, 255, 260, 277, 291, 302, 303, 304, 305 P *Palucka, A. K. 226 *Parker, L. A. 291 Pascual, V. 226, 236 *Piccirillo, C. A. 24 Powrie, F. 20, 21, 37, 38, 40, 42, 43, 53, 64, 65, 91, 92, 98, 99, 100, 101, 102, 103, 104, 105, 108, 109, 113, 129, 130, 161, 171, 190, 201, 206, 236, 258, 259, 260, 261, 263, 264, 265, 276 R *Read, S. 92 *Robson, N. C. 291

307

Roncarolo, M. G. 88, 89, 90, 91, 113, 115, 127, 128, 129, 130, 131, 173, 189, 190, 199, 204, 205, 208, 236, 237, 258, 259, 261, 262, 264, 265, 266, 276, 288, 289, 304 S *Sakaguchi, N. 6 Sakaguchi, S. 6, 16, 17, 18, 19, 20, 21, 22, 39, 43, 89, 110, 177, 189, 192, 203, 262 *Sasazuki, T. 6 Sercarz, E. 53, 163, 165, 171, 172, 173, 174, 175, 224 Shevach, E. M. 18, 19, 20, 21, 24, 36, 37, 38, 39, 40, 42, 43, 52, 53, 54, 64, 65, 88, 89, 91, 99, 100, 101, 102, 108, 109, 110, 111, 112, 113, 127, 128, 129, 130, 161, 164, 172, 189, 190, 192, 201, 202, 203, 204, 205, 210, 220, 222, 254, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 289, 290 *Solly, N. R. 132 T *Taams, L. S. 211 *Takahashi, T. 6 *Tang, Q. 55 *Thornton, A. M. 24 U *Uhlig, H. 92 *Ushigome, H. 177 V *van den Elzen, P. 165 von Herrath, M. 19, 20, 54, 64, 89, 102, 143, 160, 172, 175, 207, 209, 221, 222, 224, 239, 253, 254, 255, 256, 257, 264, 266, 287 W Wauben, M. H. M. 90, 211, 220, 221, 222, 223, 224, 265 Wood, K. J. 39, 41, 177, 188, 189, 190, 191, 192, 208, 209, 264, 276, 278

Subject index atopy, probiotics 305 autoantigen speci¢city 18, 46^48 autoimmune diabetes 56, 138^139, 286 autoimmune disease CD25+ T cell removal 7 patient/normal distinction 210 prevention by CD4+CD25+ 2, 25^29 probiotics 305 TGFb treatment 113 type 1 T regulatory cells 118 autoimmune gastritis (AIG) 25^26, 27^28, 48 autoimmune response 165^171, 239^253 autoimmune uveitis, anti-CD25 antibody 33, 40^41 autoreactive regulators 241^242 autoreactivity, type 1 regulatory T cells 128

A Ac1^9 168^169 active immune regulation 257^267 active tolerance 280, 281^282 adaptive regulators 266^267 adhesion molecules 51 adoptive transfer 53^54 allergy probiotics 305 type 1 regulatory T cells 118 alloantigens 178, 182^183 anergy CD4+CD25+ 8^9 cloning 127^128 cytokines and chemokines 222 MHC class II 213 T cell suppression 213^214 anti-CD25 antibody 33, 39^42 anti-CD28 86 antigen presenting cells (APCs) anergic T cell modulation 213^214 apoptotic cells 250 cross-talk with T cells 215^218 dendritic cells 293^294 linked suppression 212 microvesicle modulation 217 necrotic cells 250 negative regulators 241 Notch ligand expression 270^273 self-inactivation 224 Th2-like CD4 cell modulation 241^242 antigen-speci¢c memory 39^40 antigen speci¢city 2^3, 16^17, 18, 19, 247 apoptosis antigen presenting cells 250 CD3 antibodies 282 GITR (Glucocorticoid-Induced Tumour necrosis factor Receptor) 192 Notch signalling 270 T-cell^T-cell presentation 222^223 Vb 8.2 CD4 T cells 169^170 arthritis, collagen-induced 256

B B2L-TKO mice 10^12 B7 68 B cells apoptosis and Notch signalling 270 dendritic cell e¡ects 230 bacterial infection 230 4-1BB 216 biopsies 209 Birbeck granules 227 bitypic NK/DCs 250 Bordetella pertussis immunological escape 196 type 1 T regulatory cells 118^119 Borrelia burgdorferi 196 BrdU incorporation 20^21 bystander suppression 1 C CC chemokines 148 CCR5 148, 161 CCR7 117 CCR8 50 308

SUBJECT INDEX

CD3 antibody treatment 3, 279^286, 287^289 apoptosis 282 CD25+ 3, 282 immunosuppression 280^281 rash 288^289 TGFb 3, 282^283 tolerance 281^282 CD4 167 CD4:CD8 ratio 131, 289 CD4+ intraepithelial lymphocytes 39 NKT cells 149^150 proinsulin mucosal administration 133 public repertoire 168 self-tolerance 6^7 spontaneous appearance 167 T cell subsets 2 viral infection 194^199 CD4+CD25 27, 28 CD4+CD25+ 120^122 accessory molecules 9 anergy 8^9 antigen speci¢city 18, 247 autoimmune disease prevention 2, 25^29 basal level of suppression 16^17 BrdU incorporation 20^21 CCR5 161 CD4+CD25 proliferation 27, 28 CD28-based homeostasis 56^57, 68 CD40L 58 chemokines 20 colitis 93^94, 96 contact-dependent regulation 76 CTLA4 9, 58^60, 81^83, 85, 94, 121, 183^184 cytokines 183^184 donor alloantigens 182^183 experimental autoimmune encephalomyelitis 45^52 gene expression 30 generation 17^18 GITR (Glucocorticoid-Induced Tumour necrosis factor Receptor) 9, 121, 216 graft rejection 178^180, 181^182 IL2 68, 72, 76, 84, 86, 88^89 IL10 121, 122 immune response hampering 14, 17 immunological characteristics 7^9 innate immune response suppression 94^96

309

intraepithelial lymphocytes (IEL) 139 kinetics 75^76 lamina propria 39 Leishmania major 36, 37, 38 linked unresponsiveness 181 NKT cell interplay 20 PD-L1 81^83, 85 peripheral blood 67^88 self-mimicking non-self antigens 14 self-peptide/MHC 10^12 self-reactivity 12^13 self-tolerance 7^9, 13^14, 68 T cell activation control 24^36 TGFb 60^61, 109^110, 121^122 thymic generation and selection 6^16 CD8 167 CD8+ aa 138^139, 143 autoimmune disorders 173 gd 4, 133, 134^136, 266 graft rejection 181^182 CD25 marker role 2 peripheral blood 67^88 CD25 gene expression 29^30 suppression 257^259 CD25+ 240^241 age at appearance 21 antigen speci¢city 2^3, 16^17, 18, 19 autoimmune disease production 7 CD3 3, 282 cell contact 29 chemokines 38 cytokines 2 gene expression 29^30 GITR-L 32^33 homogeneity 21 IL2 expression 42^44 IL10 36, 248^249 self-antigen speci¢city 249^250 suppression mechanisms 248^249 CD28, CD4+CD25+ homeostasis 56^57, 68 CD40L 58, 204^205 CD45RB 260, 261 graft rejection 178^180 homeostatic proliferation 100^101 marker role 2, 259 CD58 120 CD62L (L selectin) 2, 42, 59, 72, 111

310

CD69 196, 199 CD103 42, 262 CD122 42^43 CD134L 95 CDR3 169 cell contact 29, 36, 76 cell culture 69 cell cycle arrest 47^48 cell isolation and stimulation 69^70 central tolerance 232 chemokines anergic cells 222 CC 148 CD4+CD25+ 20 CD25+ migration 38 receptor expression 50 co-cultures 203, 204, 206 coeliac disease, gluten-free diet 208 colitis CD4+CD25+ suppression 93^94, 96 dendritic cells 94^95 IL10 2 collagen-induced arthritis (CIA) 256 corticosteroids 42 CSK 163 CSL proteins, Notch signalling 269 CTLA4 CD4+CD25+ 9, 58^60, 81^83, 85, 94, 121, 183^184 CD25+ suppression 248^249 co-stimulation 195 di¡erential roles 99 immune suppression 215^216 ligand-dependent function 98 marker role 2 TGFb and 60^61, 65^66 cyclophosphamide 41, 281 cyclosporin 41^42, 287 ‘cytokine-release’ syndrome 281 cytokines anergic cells 222 CD4+CD25+ 183^184 co-cultures 203 ELISA analysis 71 £t3 (cytokine) and £t3L (ligand) 292 gd cell-mediated regulation 266 graft versus host disease (GVHD) 264 regulatory lymphocytes 241^242 suppressive activity 1 type 1 T regulatory cells 2, 116

SUBJECT INDEX

D DAGGGY 169 DC-SIGN 227 Delta-like 1, 3, 4 269 dendritic cells (DCs) 226^235, 291^302 antigen-presenting cells (APCs) 293^294 B cell e¡ects 230 biology 227^230 bitypic NK/DCs 250 colitis 94^95 DC2 cells 120, 128 lamina propria 294^299 lectin expression 227 maturation 195 nasal mucosa 144 oral antigen administration 299^301 precursors 227 subsets 227 T cell polarization 230 tolerance induction 232, 235, 292 tolerogenic conditioning 104^105, 120, 138, 139 Toll-like receptors 195 Toll receptors 227, 230 type 1 T regulatory cells 117, 119^120 vaccines 230^232, 237, 301 Derm1 163 diabetes 3, 48 autoimmune 56, 138^139, 286 glutamic acid decarboxylase (GAD) 132, 286 OKT3 281, 286, 287 prediabetic therapy 174, 175, 253, 254 tetramer T cells 206 TGFb 106^107 diabetes, type 1 b cell destruction 132^133 DNA vaccines 247, 253^254 a-GalCer protection 151^153, 161 MIP1b 151, 154^155 NKT cells 146^160, 161, 162 oral feeding of insulin 246^247 regulatory approaches 246^247 treatment-induced 254^255 diabetogenic T cells 206^207 DNA microarrays 29^30 DNA vaccines 247, 253^254 dominant clones 171^172 driver clones 168^169, 173, 174

SUBJECT INDEX

E E selectin 53 ELISA, cytokine analysis 71 embryonic development, TGFb 106 eotaxin 148^149 epitope spread 174 experimental autoimmune encephalomyelitis (EAE) CD4+CD25+ 45^52 IL16 151 INFg 49, 52^53 self-reactive T cells 168^169 Th1 and Th2 49^50 F FACS analysis 70^71 £t3 ligand (£t3L) 292 Flu-MP 231 follicle associated epithelium (FAE) 293 fratricide 217 Friend leukaemia virus 196^197 FTY720 208 G a-galactosylceramide (a-GalCer)

accessibility 163 IL4 dependence 151^153 IL7 sensitization 162 IL10 150, 160 IL16 150^151 NKT stimulation 3, 147, 148^151, 161 gastritis, gastric parietal cells 99 glucocorticoid-induced TNF receptor (GITR) apoptosis 192 CD4+CD25+ 9, 121, 216 GITR-L interaction 32^34, 189 graft survival 184^185, 189 marker role 2, 39, 262 splice variants 31 suppressor function 31^33, 121 glutamic acid decarboxylase (GAD) 286 gluten-free diet 208 gp120 227 graft rejection 58, 178^180, 181^182, 205 graft versus host disease (GVHD) cytokine dependence 264 IL10 117^118, 204 GRP1 216

311

gut-associated lymphoid tissue (GALT) 291 H Helicobacter hepaticus 95, 102 helminths Th2 cells 230 type 1 T regulatory cells 119, 196 hepatitis C 196, 199 HIV 196, 200 HIV protein 227 H/K ATPase 25, 28 HLA class II molecules 72 homeostatic proliferation 27, 28, 100^101 human peripheral blood 67^88, 90^91, 205 I ICAM1 51, 227 ICAM3 227 ICOS 63 Idd4-linked genes 153^155 IgA2 230 IgMs 53 immune homunculus 168 immune pathology 92^98 immune response regulation 24^29 immune stimulating complexes (ISCOMS) 299^301 Immunoscope 173 immunosuppression 178, 215^216, 280^281 immunotherapy see therapy indoleamine 2,3-dioxygenase (IDO) 120 infectious tolerance 1, 122 in£ammatory bowel disease (IBD) 36, 37 in£uenza virus 230 innate immune response suppression, CD4+CD25+ 94^96 innate regulators 266^267 insulin nasal/aerosolized 144^145 oral feeding 246^247 aE integrin 42, 262 integrin molecules 51 interferon, plasmacytoid dendritic cells 227 interferon g (INFg) 76, 78 cell-induced inhibition 47^48 experimental autoimmune encephalomyelitis 49, 52^53 IL10 synergy 37, 128

312

interferon g (INFg) (cont.) NKT cell activity 160 systemic lupus erythematosus therapy 232, 235, 236 tolerance induction 129 type 1 T regulatory cells 116, 119, 128^129 interleukin 2 (IL2) anti-GITR 31 CD4+CD25+ 68, 72, 76, 84, 86, 88^89 CD25+ expression 42^44 IL2R b chain 72, 84 in£ammatory response 84 inhibition 48 mRNA analysis by RT/SQ-PCR 71^72 interleukin 4 (IL4) 151^153, 161, 242 interleukin 7 (IL7) 53, 161, 162, 163^164 interleukin 10 (IL10) 101, 194 CD4+CD25+ 121, 122 CD8+gd blocking 135 CD25+ 36, 248^249 Friend leukaemia virus 196^197 a-GalCer 150, 160 graft versus host disease 117^118, 204 HIV 200 human peripheral blood cells 78, 81, 85, 90^91 IFNg synergy 37, 128 infection 196, 199 intestinal in£ammation 93, 96 Leishmania major 37 multiple 160^161 NKT cell response 161 Notch signalling 274, 276 plasma cell induction 36 probiotics 305 regulatory T cell action 2 skin rash 289 systemic lupus erythematosus (SLE) 236 TGFb synergy 130 transplantation 179, 183 type 1 T regulatory cells 116, 119, 130, 194, 242 interleukin 12 (IL12) dendritic cells 227 type 1 T regulatory cells 119 interleukin 13 (IL13) 78, 81 interleukin 15 (IL15), lamina propria 304 interleukin 16 (IL16) experimental allergic encephalomyelitis (EAE) 151 a-GalCer 150^151

SUBJECT INDEX

multiple sclerosis 151 NKT^DC interactions 156 pathogenic cell migration 160 interstitial dendritic cells 227 intraepithelial lymphocytes (IEL) CD4+ generation 39 dendritic cell tolerogenic conditioning 104^105, 138, 139 neonatal thymectomy 138 regulatory role 136^138 sex hormone dependent e¡ects 138, 142 J Jagged1 and 2 269 K keyhole limpet haemocyanin (KLH) 231, 237 L L selectin (CD62L) 2, 42, 59, 72, 111 lamina propria CD4+CD25+ 39 dendritic cells 294^299 IL15 304 protein antigen uptake 293^294 Langerhan’s cells 227 Langerin 227 LAP 60 LAT 191 LCMV antigens 200^201 lectin expression, dendritic cells 227 BDCA2 227 Leishmania major 36, 37, 38 leishmaniasis 196 leprosy 230 linked suppression 212, 213, 221 linked unresponsiveness 181 lipopolysaccharide 303 LKLF 43 Lyme disease 196 M melanoma 231, 237 memory 39^40 mesenteric lymph nodes (MLN) 94^95, 291, 298^299 MHC, thymic selection of CD4+CD25+ 10^12

SUBJECT INDEX

MHC class II 72, 90, 212^213 microvesicles 217 MIP1a 154 MIP1b 148, 151, 154^155, 156, 160 molecular mimicry 14 molecular reshu¥ing 216^218 mucosal administration 133^134, 144^145, 301 multiple levels of T cell anergy 213 multiple sclerosis anti-CD25 antibody 41 driver clones 173 IL16 151 N naso-respiratory mucosal administration 133^134, 144^145 natural killer T (NKT) cells bitypic NK/DCs 250 CD4+ 149^150 CD4+CD25+ interplay 20 characteristics 147 diabetes 146^160, 161, 162 a-GalCer activation 3, 147, 148^151, 161 Idd4-linked genes 153^155 IL7 53 IL10 161 INFg 160 MIP1a 154 MIP1b 154^155, 156 subsets 147 TCRa chains 147 necrotic cells, antigen presenting cells 250 nickel allergy 118 Notch signalling 268^276 antigen presenting cells 270^273 apoptosis 270 IL10 production 274, 276 inhibitory role 269^270 instructive role 270 regulator role 277 speci¢city 277 vertebrate ligands 269 O OKT3 280^281, 286, 287, 289 oral insulin 246^247 oral mucosal administration 133^134 oral tolerance 221, 292, 304

313

OX40 58, 216 P P selectin 51, 52 pancreatic lymph nodes 147, 152, 156 PD1 81, 83, 85, 215 PD-L1 81^83, 85, 120 peripheral tolerance 116, 232 Peyer’s patches (PPs) 291, 293, 304 phospholipase A2 118 plasmacytoid dendritic cells 227, 230 plasticity 18^19 polyautoimmune syndrome 2 prediabetes intervention 174, 175, 253, 254 probiotics 305 proinsulin-speci¢c T cells 132^141 PSGL1 (P-selectin ligand), Th1 expression 52 Q Qa1 172 R Rac1 and Rac2 64 RAG2 de¢ciency 10 rapamycin 42 rash, CD3 antibody treatment 288^289 RB 259^260 regulatory T cells classi¢cation 3 history 1 interaction between cell types 19^20 mode of action 2 reverse transcription/semi-quantitative PCR (RT/SQ-PCR), IL2 mRNA analysis 71^72 rheumatoid arthritis 118 S Schistosomiasis haematobia 196 Schistosomiasis mansoni 196 selectins E selectin 53 L selectin (CD62L) 2, 42, 59, 72, 111 P selectin 51, 52 self-antigen generation 17^18 sensitivity 13^14

314

self-antigen (cont.) speci¢city 249^250 self-peptide, thymic selection of CD4+CD25+ 10^12 self-reactivity, CD4+CD25+ 12^13 self-tolerance 55^56 CD4+ 6^7 CD4+CD25+ 7^9, 13^14, 68 type 1 T regulatory cells 118 Serrate 269 serum 203 severe combined immunode¢ciency (SCID), stem cell transplantation 117^118 Sezary’s syndrome 40 simian immunode¢ciency virus (SIV) 199^200 SJL mouse 172, 174^175 skin rash, CD3 antibody treatment 288^289 SMAD3 109^110 SOCS2 43 suppressors of cytokine signalling (SOCS) family 30 syngeneic mixed lymphocyte reaction 101 systemic lupus erythematosus 232^233, 235^236 T T cell^T cell presentation 212, 213, 220^221, 223 TCR peptides, therapeutic use 174^175 TCR transgenics 175 tetramer T cells 206 Th1 1, 168 autoantigen-speci¢c responses 46^48 experimental autoimmune encephalomyelitis 49^50 microbial infection 230 PSGL1 (P-selectin ligand) expression 52 Th2 4 cytokines 1, 2 experimental autoimmune encephalomyelitis 49^50 helminths 230 immunotherapy 3 Th2-like CD4 cells 241^242 Th3 103^104, 194, 196 therapy 3 CD3 antibody 3, 279^286, 287^289 CD4+CD25+ in colitis 96 dendritic cell vaccines 230^232, 237, 301

SUBJECT INDEX

INFg 232, 235, 236 prediabetes 174, 175, 253, 254 TCR peptides 174^175 TGFb 113 tumour progression 238 thymectomy 1^2, 9^10, 138^139 thymulin 142 thymus alloantigens 183 CD4+CD25+ 6^16 medullary self antigens 17 TL antigen 143^144 tolerance 1, 178, 269 active 280, 281^282 central 232 dendritic cells 232, 235, 292 IFNg 129 peripheral 116, 232 Toll-like receptors 195 Toll receptors 227, 230 Toll9 230 transferrin receptor 73 transforming growth factor (TGF) b 91, 101, 106^114, 194 autoimmune disease treatment 113 CD3 3, 282^283 CD4+CD25+ 60^61, 109^110, 121^122 CD25+ suppression 248^249 CTLA4 and 60^61, 65^66 diabetes 106^107 embryonic development 106 enhancer role 63^64 Friend leukaemia virus 196^197 IL10 synergy 130 in£ammatory bowel disease 37 intestinal in£ammation 93, 96 regulatory T cell action 2 secreting cells 101 suppressive role 22 transplantation 183 type 1 T regulatory cells 116, 119, 130^131 transgenics 175 transplantation 177^188 anti-CD25 antibody 33, 41, 42 GITR 184^185, 189 graft rejection 58, 178^180, 181^182, 205 immunosuppressive therapy 178, 280^281 linked unresponsiveness 181 TGFb 183 type 1 T regulatory cells 117^118 transwell analysis 70

SUBJECT INDEX

treatment see therapy tuberculosis 196, 199 tumour-associated antigens 230^232 tumour immunity 14, 17 tumour necrosis factor (TNF) a 49 tumour progression, immunization 238 type 1 T regulatory cells 4, 115^127 allergen response 118 autoreactivity 128 CCR7 expression 117 CD58 120 cytokines 2, 116 dendritic cells 117, 119^120 di¡erentiation 117 IFNg 116, 119, 128^129 IL10 116, 119, 130, 194, 242 IL12 119 infection 196 markers 117 proliferation 117 self-tolerance 118

315

suppressive e¡ects 117 TGFb 116, 119, 130^131 transplantation 117^118 U unmanipulated cells 262^265 V vaccines dendritic cells 230^232, 237, 301 type 1 diabetes 247, 253^254 Vb gene segments 12 Vb 8.2 T cells 166, 169^170 viral infection CD4+ 194^199 immune response 230, 239^253 incomplete clearance 199 plasmacytoid dendritic cells 227