Host-Fungus Interactions: Methods and Protocols (Methods in Molecular Biology, 845)

METHODS IN MOLECULAR BIOLOGY™ Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfi...

Author: Alexandra C. Brand | Donna M. MacCallum

50 downloads 829 Views 11MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

METHODS

IN

MOLECULAR BIOLOGY™

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Host-Fungus Interactions Methods and Protocols Edited by

Alexandra C. Brand School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen, UK

Donna M. MacCallum School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen, UK

Editors Alexandra C. Brand, Ph.D. School of Medical Sciences Institute of Medical Sciences University of Aberdeen Foresterhill, Aberdeen, UK [email protected]

Donna M. MacCallum, Ph.D. School of Medical Sciences Institute of Medical Sciences University of Aberdeen Foresterhill, Aberdeen, UK [email protected]

ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-61779-538-1 e-ISBN 978-1-61779-539-8 DOI 10.1007/978-1-61779-539-8 Springer New York Dordrecht Heidelberg London Library of Congress Control Number: 2011945440 © Springer Science+Business Media, LLC 2012 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Cover illustration: Confocal microscopy of Candida albicans phagocytosis by J444.1 macrophages. Macrophage acidic organelles are stained with LysoTracker Red (Invitrogen), and the fungal cells with FITC (Sigma). The image was captured after 4 hours and shows C. albicans bound to and internalised within macrophages. Image courtesy of Leanne. E. Lewis. Printed on acid-free paper Humana Press is part of Springer Science+Business Media (www.springer.com)

Preface The incidence and profile of fungal diseases affecting the human population has undergone considerable change within recent decades, reflecting the availability of interventional medical care and an increase in the prevalence of immunodeficiency syndromes. Microbiologists, medical mycologists, immunologists, and biochemists are increasingly working together to focus on the processes involved in the progression and treatment of fungal disease. Host– Fungus Interactions: Methods and Protocols is designed for research scientists who are involved in this work and interested in undertaking new or comparative studies of interactions between the mammalian host and clinically important fungal pathogens. The aim of this book is to combine approaches for reverse genetics in pathogenic fungi with methods for their application in in vitro and in vivo models of disease. The study of fungal pathogenesis is hugely enhanced by the ability of researchers to employ reverse genetics in the fungi of interest. The first section of this book, therefore, provides methods for the culture and genetic manipulation of the primary fungal pathogens, Histoplasma capsulatum, Coccidioides immitis, and Paracoccidioides brasiliensis, and the opportunistic pathogens, Aspergillus fumigatus, Cryptococcus neoformans, and Candida albicans; the latter group emerging as a major cause of morbidity and mortality in countries where medical interventions are on the increase. Gene deletion, mutation, and regulatable expression are valuable molecular tools that can reveal key virulence determinants during interaction with the host. In addition, the use of fluorescently tagged proteins for cellular localization and as expression reporters offers a wealth of information on fungal biology and spatial/temporal events during infection. Previously, such approaches have been hampered by the unavailability of genome sequences, lack of manipulatable sexual cycles, side effects of using auxotrophic selectable markers, low efficiency of homologous reintegration, and difficulty in fungal transformation. In light of the need to understand emerging fungal diseases, the past decade has seen significant advances in the availability of methods designed to overcome these challenges in the study of pathogenic fungi, including genome availability with improved annotation, whole-genome screening vectors, auxotrophy-independent selectable markers, efficient mRNA amplification, RNAi knockdown, and the generation of Ku− strains to yield high rates of homologous recombination. The second section of this book focuses on methods for investigating host–fungus interactions in model systems. Methods are described to investigate direct interactions between host and fungal cells in vitro, using isolated host cells, cell lines, or tissue models to evaluate host cell recognition and response to fungal cells. Such experiments offer a valuable screening method to identify fungal mutants whose phenotypes warrant further investigation in vivo in infection models or allow specific interactions to be further dissected. Key methods are also described for determining host and fungal responses occurring during infection, e.g., changes in gene expression. The ability to analyze transcriptional changes during initiation and progression of fungal infection in model systems is greatly increasing our understanding of these processes from the perspective of both host and fungus. Finally, protocols for fungal infection models are described. Considerable progress has been made

v

vi

Preface

in implementing the 3Rs (Replacement, Refinement, and Reduction) policy in host–fungus interactions, and this section describes validated models for virulence studies using minihosts, e.g., nematodes, fruit flies, and wax moth larvae. These models allow some analysis of host immune response; however, mammalian models are still required for more accurate modelling of human infection. Protocols for a number of rodent models of invasive and superficial fungal infection are described, which have been optimized for the study of disease progression and response to antifungal agents. The rodent models described cover not only intravenous challenge but also inhalation models, which more accurately reflect the infection route of many free-living pathogenic fungal species. Additional protocols describe refined infection models, such as the use of fluorescent fungi to allow live imaging of infection development, a catheter biofilm infection model, and a model of concurrent vaginal and oral Candida albicans infection. The aim of this volume is to describe available molecular methods and fungal infection models in sufficient detail to encourage researchers to try new approaches to investigating host–fungus interactions with confidence. Foresterhill, Aberdeen, UK

Alexandra C. Brand, Ph.D. Donna M. MacCallum, Ph.D.

Contents Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

GENE DISRUPTION

1 Gene Deletion in Candida albicans Wild-Type Strains Using the SAT1-Flipping Strategy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Christoph Sasse and Joachim Morschhäuser 2 Mini-blaster-Mediated Targeted Gene Disruption and Marker Complementation in Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Shantanu Ganguly and Aaron P. Mitchell 3 Rapid Detection of Aneuploidy Following the Generation of Mutants in Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Megan D. Lenardon and André Nantel 4 Agrobacterium-Mediated Insertional Mutagenesis in Histoplasma capsulatum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Olga Zemska and Chad A. Rappleye 5 Targeted Gene Disruption in Cryptococcus neoformans Using Double-Joint PCR with Split Dominant Selectable Markers. . . . . . . . . . . . . . . Min Su Kim, Seo-Young Kim, Kwang-Woo Jung, and Yong-Sun Bahn 6 Multiple Gene Deletion in Cryptococcus neoformans Using the Cre–lox System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lorina G. Baker and Jennifer K. Lodge 7 Gene Disruption in Aspergillus fumigatus Using a PCR-Based Strategy and In Vivo Recombination in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . Iran Malavazi and Gustavo Henrique Goldman 8 Targeted Gene Deletion in Aspergillus fumigatus Using the Hygromycin-Resistance Split-Marker Approach. . . . . . . . . . . . . . . . . . . . . Fabrice N. Gravelat, David S. Askew, and Donald C. Sheppard 9 Gene Disruption in Coccidioides Using Hygromycin or Phleomycin Resistance Markers. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chiung-Yu Hung, Hua Zhang Wise, and Garry T. Cole

PART II

v xi

3

19

41

51

67

85

99

119

131

MODULATION OF GENE EXPRESSION: RNAI GENE KNOCKDOWN

10 RNAi-Based Gene Silencing Using a GFP Sentinel System in Histoplasma capsulatum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Brian H. Youseff and Chad A. Rappleye

vii

151

viii

Contents

11 RNA Interference in Cryptococcus neoformans . . . . . . . . . . . . . . . . . . . . . . . . . Michael L. Skowyra and Tamara L. Doering 12 Gene Knockdown in Paracoccidioides brasiliensis Using Antisense RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . João F. Menino, Agostinho J. Almeida, and Fernando Rodrigues

PART III

187

MODULATION OF GENE EXPRESSION: REGULATABLE PROMOTERS

13 Tetracycline-Inducible Gene Expression in Candida albicans. . . . . . . . . . . . . . Michael Weyler and Joachim Morschhäuser 14 Galactose-Inducible Promoters in Cryptococcus neoformans var. grubii . . . . . . . Lorina G. Baker and Jennifer K. Lodge 15 Modular Gene Over-expression Strategies for Candida albicans . . . . . . . . . . . Vitor Cabral, Murielle Chauvel, Arnaud Firon, Mélanie Legrand, Audrey Nesseir, Sophie Bachellier-Bassi, Yogesh Chaudhari, Carol A. Munro, and Christophe d’Enfert

PART IV

165

201 211 227

HOST RESPONSES TO INFECTION IN VITRO

16 Interactions Between Macrophages and Cell Wall Oligosaccharides of Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Héctor M. Mora-Montes, Christopher McKenzie, Judith M. Bain, Leanne E. Lewis, Lars P. Erwig, and Neil A.R. Gow 17 Murine Bone Marrow-Derived Dendritic Cells and T-Cell Activation by Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Joanne Gibson, Neil A.R. Gow, and Simon Y.C. Wong 18 Phagocytosis and Intracellular Killing of Candida albicans by Murine Polymorphonuclear Neutrophils. . . . . . . . . . . . . . . . . . . . . . . . . . . Alieke G. Vonk, Mihai G. Netea, and Bart Jan Kullberg 19 Human Oral Keratinocytes: A Model System to Analyze Host–Pathogen Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Torsten Wöllert, Christiane Rollenhagen, George M. Langford, and Paula Sundstrom 20 Simple Assays for Measuring Innate Interactions with Fungi . . . . . . . . . . . . . . Ann M. Kerrigan, Maria da Glória Teixeira de Sousa, and Gordon D. Brown 21 Binding and Uptake of Candida albicans by Human Monocyte-Derived Dendritic Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Annemiek B. van Spriel and Alessandra Cambi 22 Immune Responses to Candida albicans in Models of In Vitro Reconstituted Human Oral Epithelium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jeanette Wagener, Daniela Mailänder-Sanchez, and Martin Schaller 23 Analysis of Host-Cell Responses by Immunoblotting, ELISA, and Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . David L. Moyes and Julian R. Naglik

247

261

277

289

303

319

333

345

Contents

24 In Vitro Model of Invasive Pulmonary Aspergillosis in the Human Alveolus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lea Gregson, William W. Hope, and Susan J. Howard 25 Biofilm Formation Studies in Microtiter Plate Format . . . . . . . . . . . . . . . . . . . Marta Riera, Emilia Moreno-Ruiz, Sophie Goyard, Christophe d’Enfert, and Guilhem Janbon

PART V

ix

361 369

FUNGAL RESPONSES DURING INFECTION

26 Transcript Profiling Using ESTs from Paracoccidioides brasiliensis in Models of Infection. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alexandre Melo Bailão, Maristela Pereira, Silvia Maria Salem-Izacc, Clayton Luiz Borges, and Célia Maria de Almeida Soares 27 Laser Capture Microdissection of Candida albicans from Host Tissue . . . . . . . Caroline Westwater and David A. Schofield 28 Isolation and Amplification of Fungal RNA for Microarray Analysis from Host Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anja Lüttich, Sascha Brunke, and Bernhard Hube

PART VI

397

411

HOST RESPONSES TO INFECTION IN VIVO

29 Cytokine Measurement Using Cytometric Bead Arrays . . . . . . . . . . . . . . . . . . Luis Castillo and Donna M. MacCallum 30 Transcript Profiling of the Murine Immune Response to Invasive Aspergillosis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Zaneeta Dhesi, Susanne Herbst, and Darius Armstrong-James

PART VII

381

425

435

NON-MAMMALIAN MODEL SYSTEMS HOST–FUNGAL INTERACTIONS

FOR

31 Caenorhabditis elegans: A Nematode Infection Model for Pathogenic Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Maged Muhammed, Jeffrey J. Coleman, and Eleftherios Mylonakis 32 Drosophila melanogaster as a Model Organism for Invasive Aspergillosis. . . . . . Michail S. Lionakis and Dimitrios P. Kontoyiannis 33 Galleria mellonella as a Model for Fungal Pathogenicity Testing . . . . . . . . . . . John Fallon, Judy Kelly, and Kevin Kavanagh 34 Embryonated Chicken Eggs as Alternative Infection Model for Pathogenic Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ilse D. Jacobsen, Katharina Große, and Bernhard Hube

PART VIII

447 455 469

487

MAMMALIAN HOSTS AS INFECTION MODELS

35 Mouse Intravenous Challenge Models and Applications . . . . . . . . . . . . . . . . . Donna M. MacCallum

499

x

Contents

36 A Nebulized Intra-tracheal Rat Model of Invasive Pulmonary Aspergillosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Guillaume Desoubeaux and Jacques Chandenier 37 Invasive Models of Histoplasmosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. George Smulian 38 Murine Model of Concurrent Oral and Vaginal Candida albicans Colonisation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Durdana Rahman, Mukesh Mistry, Selvam Thavaraj, Julian R. Naglik, and Stephen J. Challacombe 39 A Luciferase Reporter for Gene Expression Studies and Dynamic Imaging of Superficial Candida albicans Infections . . . . . . . . . . . . . . . . . . . . . Donatella Pietrella, Brice Enjalbert, Ute Zeidler, Sadri Znaidi, Anna Rachini, Anna Vecchiarelli, and Christophe d’Enfert 40 Modeling of Fungal Biofilms Using a Rat Central Vein Catheter . . . . . . . . . . . Jeniel E. Nett, Karen Marchillo, and David R. Andes 41 Orogastrointestinal Model of Mucosal and Disseminated Candidiasis . . . . . . . Karl V. Clemons and David A. Stevens 42 A Nonlethal Murine Cutaneous Model of Invasive Aspergillosis . . . . . . . . . . . Ronen Ben-Ami and Dimitrios P. Kontoyiannis Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

511 519

527

537

547 557 569 583

Contributors AGOSTINHO J. ALMEIDA • Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Braga, Portugal DAVID R. ANDES • Division of Infectious Diseases, Department of Medicine and Medical Microbiology and Immunology, University of Wisconsin, Madison, WI, USA DARIUS ARMSTRONG-JAMES • Department of Microbiology and Department of Infectious Diseases and Immunity, Imperial College, London, UK DAVID S. ASKEW • Department of Pathology and Laboratory Medicine, University of Cincinnati, Cincinnati, OH, USA SOPHIE BACHELLIER-BASSI • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France YONG-SUN BAHN • Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul, Korea ALEXANDRE MELO BAILÃO • Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás, Goiás, Brazil JUDITH M. BAIN • School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK LORINA G. BAKER • School of Science and Technology, Georgia Gwinett College, Lawrenceville, GA, USA RONEN BEN-AMI • Infectious Disease Unit, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel CLAYTON LUIZ BORGES • Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás, Goiás, Brazil GORDON D. BROWN • Section of Immunology and Infection, Institute of Medical Sciences, School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK SASCHA BRUNKE • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany; Integrated Research and Treatment Center, Sepsis und Sepsisfolgen, Center for Sepsis Control and Care (CSCC), Universitätsklinikum Jena, Jena, Germany VITOR CABRAL • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France ALESSANDRA CAMBI • Department of Tumor Immunology, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands LUIS CASTILLO • Departamento de Biología, Facultad de Ciencias, Universidad de La Serena, La Serena, Elqui, Chile STEPHEN J. CHALLACOMBE • Department of Oral Medicine, King’s College London Dental Institute, London, UK

xi

xii

Contributors

JACQUES CHANDENIER • Parasitologie-Mycologie-Médecine tropicale, Centre Hospitalier Régional et Universitaire, Tours, France YOGESH CHAUDHARI • School of Medical Sciences, University of Aberdeen, Aberdeen, UK MURIELLE CHAUVEL • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France KARL V. CLEMONS • California Institute for Medical Research, San Jose, CA, USA; Division of Infectious Diseases, Department of Medicine, Santa Clara Valley Medical Center, San Jose, CA, USA; Division of Infectious Diseases and Geographic Medicine, Department of Medicine, Stanford University, Stanford, CA, USA GARRY T. COLE • Department of Biology and South Texas Center for Emerging Infectious Diseases, University of Texas, San Antonio, TX, USA JEFFREY J. COLEMAN • Division of Infectious Diseases, Massachusetts General Hospital, Boston, MA, USA CHRISTOPHE D’ENFERT • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France GUILLAUME DESOUBEAUX • Parasitologie-Mycologie-Médecine tropicale, Centre Hospitalier Régional et Universitaire, Tours, France ZANEETA DHESI • Department of Microbiology and Department of Infectious Diseases and Immunity, Imperial College, London, UK TAMARA L. DOERING • Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO, USA BRICE ENJALBERT • Institut National des Sciences Appliquées, Toulouse, France LARS P. ERWIG • School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK JOHN FALLON • Medical Mycology Unit, National University of Ireland, Maynooth, County Kildare, Ireland ARNAUD FIRON • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France SHANTANU GANGULY • Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA JOANNE GIBSON • School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK GUSTAVO HENRIQUE GOLDMAN • Departamento de Ciências Farmacêuticas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, São Paulo, Brazil NEIL A.R. GOW • School of Medical Sciences, University of Aberdeen, Aberdeen, UK SOPHIE GOYARD • Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France FABRICE N. GRAVELAT • Department of Microbiology and Immunology, McGill University, Montréal, QC, Canada LEA GREGSON • The University of Manchester, Manchester, UK

Contributors

xiii

KATHARINA GROßE • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany SUSANNE HERBST • Department of Microbiology and Department of Infectious Diseases and Immunity, Imperial College, London, UK WILLIAM W. HOPE • The University of Manchester, Manchester, UK SUSAN J. HOWARD • The University of Manchester, Manchester, UK BERNHARD HUBE • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany; Friedrich-Schiller University, Jena, Germany CHIUNG-YU HUNG • Department of Biology and South Texas Center for Emerging Infectious Diseases, University of Texas, San Antonio, TX, USA ILSE D. JACOBSEN • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany GUILHEM JANBON • Institut Pasteur, Unité de Aspergillus, Paris, France KWANG-WOO JUNG • Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul, Korea KEVIN KAVANAGH • Medical Mycology Unit, National University of Ireland, Maynooth, County Kildare, Ireland JUDY KELLY • Medical Mycology Unit, National University of Ireland, Maynooth, County Kildare, Ireland ANN M. KERRIGAN • Section of Immunology and Infection, Institute of Medical Sciences, School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK MIN SU KIM • Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul, Korea SEO-YOUNG KIM • Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul, Korea DIMITRIOS P. KONTOYIANNIS • The University of Texas MD Anderson Cancer Center, Houston, TX, USA BART JAN KULLBERG • Department of Medicine, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands GEORGE M. LANGFORD • Department of Biology, Syracuse University, Syracuse, NY, USA MÉLANIE LEGRAND • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France MEGAN D. LENARDON • School of Medical Sciences, University of Aberdeen, Aberdeen, UK LEANNE E. LEWIS • School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK MICHAIL S. LIONAKIS • Laboratory of Molecular Immunology, National Institute of Allergy and Infectious Diseases, Bethesda, MD, USA JENNIFER K. LODGE • Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO, USA ANJA LÜTTICH • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany

xiv

Contributors

DONNA M. MACCALLUM • School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen, UK DANIELA MAILÄNDER-SANCHEZ • Department of Dermatology, Eberhard Karls University, Tuebingen, Germany IRAN MALAVAZI • Departamento de Genética e Evolução, Centro de Ciências Biológicas e da Saúde (CCBS), Universidade Federal de São Carlos (UFSCar), São Carlos, SP, Brazil KAREN MARCHILLO • Division of Infectious Diseases, Department of Medicine and Medical Microbiology and Immunology, University of Wisconsin, Madison, WI, USA CHRISTOPHER MCKENZIE • School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK JOÃO F. MENINO • Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Braga, Portugal; ICVS/3B’s PT Government Associate Laboratory, Guimarães, Portugal MUKESH MISTRY • Department of Oral Immunology, King’s College London Dental Institute, London, UK AARON P. MITCHELL • Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA HÉCTOR M. MORA-MONTES • Departamento de Biología, Universidad de Guanajuato, Guanajuato, México EMILIA MORENO-RUIZ • Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France JOACHIM MORSCHHÄUSER • Institut für Molekulare Infektionsbiologie, Universität Würzburg, Würzburg, Germany DAVID L. MOYES • Department of Oral Immunology, King’s College London Dental Institute, London, UK MAGED MUHAMMED • Division of Infectious Diseases, Massachusetts General Hospital, Boston, MA, USA CAROL A. MUNRO • School of Medical Sciences, University of Aberdeen, Aberdeen, UK ELEFTHERIOS MYLONAKIS • Division of Infectious Diseases, Massachusetts General Hospital, Boston, MA, USA JULIAN R. NAGLIK • Department of Oral Immunology, King’s College London Dental Institute, London, UK ANDRÉ NANTEL • Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada AUDREY NESSEIR • Département Génomes et Génétique, Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France; INRA USC2019, Paris, France MIHAI G. NETEA • Department of Medicine, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands JENIEL E. NETT • Division of Infectious Diseases, Department of Medicine and Medical Microbiology and Immunology, University of Wisconsin, Madison, WI, USA MARISTELA PEREIRA • Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás, Goiás, Brazil DONATELLA PIETRELLA • Microbiology Section, Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy

Contributors

xv

ANNA RACHINI • Microbiology Section, Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy DURDANA RAHMAN • Department of Oral Immunology, King’s College London Dental Institute, London, UK CHAD A. RAPPLEYE • Department of Microbiology, Ohio State University, Columbus, OH, USA MARTA RIERA • Centre for Research in Agricultural Genomics (CRAG), Campus UAB Bellaterra, Cerdanyola del Valles, Barcelona, Spain FERNANDO RODRIGUES • Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Braga, Portugal; ICVS/3B’s PT Government Associate Laboratory, Guimarães, Portugal CHRISTIANE ROLLENHAGEN • VA Medical Center, White River Junction, VT, USA SILVIA MARIA SALEM-IZACC • Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás, Goiás, Brazil CHRISTOPH SASSE • Institut für Molekulare Infektionsbiologie, Universität Würzburg, Würzburg, Germany MARTIN SCHALLER • Department of Dermatology, Eberhard Karls University, Tuebingen, Germany DAVID A. SCHOFIELD • Guild Associates Inc., Charleston, SC, USA DONALD C. SHEPPARD • Department of Microbiology and Immunology, McGill University, Montréal, QC, Canada MICHAEL L. SKOWYRA • Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO, USA A. GEORGE SMULIAN • Infectious Disease Division, Cincinnati VA Medical Center, University of Cincinnati, Cincinnati, OH, USA CÉLIA MARIA DE ALMEIDA SOARES • Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás, Goiás, Brazil MARIA DA GLÓRIA TEIXEIRA DE SOUSA • Laboratório de Micologia Médica, Instituto de Medicina Tropical, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brazil ANNEMIEK B. VAN SPRIEL • Department of Tumor Immunology, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands DAVID A. STEVENS • California Institute for Medical Research, San Jose, CA, USA; Division of Infectious Diseases, Department of Medicine, Santa Clara Valley Medical Center, San Jose, CA, USA; Division of Infectious Diseases and Geographic Medicine, Department of Medicine, Stanford University, Stanford, CA, USA PAULA SUNDSTROM • Microbiology and Molecular Pathogenesis Program, Dartmouth Medical School, Hanover, NH, USA SELVAM THAVARAJ • Department of Oral Pathology, King’s College London Dental Institute, London, UK ANNA VECCHIARELLI • Microbiology Section, Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy ALIEKE G. VONK • Department of Medical Microbiology and Infectious Diseases, University Medical Center Rotterdam, Rotterdam, The Netherlands JEANETTE WAGENER • Department of Dermatology, Eberhard Karls University, Tuebingen, Germany

xvi

Contributors

CAROLINE WESTWATER • Department of Craniofacial Biology, Medical University of South Carolina, Charleston, SC, USA MICHAEL WEYLER • Institut für Molekulare Infektionsbiologie, Universität Würzburg, Würzburg, Germany HUA ZHANG WISE • Department of Biology and South Texas Center for Emerging Infectious Diseases, University of Texas, San Antonio, TX, USA TORSTEN WÖLLERT • Department of Biology, Syracuse University, Syracuse, NY, USA SIMON Y.C. WONG • Section of Immunology and Infection, School of Medicine and Dentistry, University of Aberdeen, Aberdeen, UK BRIAN H. YOUSEFF • Department of Microbiology, Ohio State University, Columbus, OH, USA UTE ZEIDLER • Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France OLGA ZEMSKA • Department of Microbiology, Ohio State University, Columbus, OH, USA SADRI ZNAIDI • Institut Pasteur, Unité Biologie et Pathogénicité Fongiques, Paris, France

Part I Gene Disruption

Chapter 1 Gene Deletion in Candida albicans Wild-Type Strains Using the SAT1-Flipping Strategy Christoph Sasse and Joachim Morschhäuser Abstract Targeted gene inactivation is an important method to investigate gene function. In the diploid yeast Candida albicans, the generation of homozygous knock-out mutants requires the sequential replacement of both alleles of a gene by a selection marker. Targeted gene deletion is often performed in auxotrophic host strains, which are rendered prototrophic after the insertion of appropriate nutritional marker genes into the target locus. The SAT1-flipping strategy described in this chapter allows gene deletion in prototrophic C. albicans wild-type strains with the help of a recyclable dominant selection marker. The SAT1 flipper cassette used for this purpose consists of the caSAT1 marker, which confers resistance to the antibiotic nourseothricin, and the caFLP gene, which encodes the site-specific recombinase FLP. The addition of flanking sequences of the target gene allows specific genomic insertion of the SAT1 flipper cassette by homologous recombination and selection of nourseothricin-resistant transformants. Expression of the FLP recombinase results in subsequent excision of the cassette, which is bordered by direct repeats of the FLP recognition sequence FRT, from the genome. The homozygous mutants obtained after two rounds of insertion and recycling of the SAT1 flipper cassette differ from the wild-type parental strain only by the absence of the target gene and can be used for the inactivation of additional genes and the generation of complemented strains using the same strategy. Key words: Candida albicans, Dominant selection marker, Gene deletion, Knock-out mutants, Marker recycling, Nourseothricin resistance, Site-specific recombinase

1. Introduction Candida albicans is a diploid organism without a known haploid phase. To create mutants lacking a specific gene, both alleles of the gene have to be sequentially inactivated. This is usually performed by transforming C. albicans cells with linear DNA fragments containing a selection marker that is flanked by the upstream and downstream sequences of the target gene. Homologous recombination then results in replacement of one of the wild-type alleles in Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_1, © Springer Science+Business Media, LLC 2012

3

4

C. Sasse and J. Morschhäuser

the genome by the selection marker. Gene deletions are often performed in auxotrophic host strains with defects in certain biosynthetic pathways (e.g., for arginine, histidine, and uracil) that can be complemented using the corresponding intact genes (e.g., ARG4, HIS1, or URA3) as selection markers. Homozygous mutants are obtained either by using different markers for the inactivation of the two alleles in a host strain with multiple auxotrophies or by repeated use of a counterselectable, recyclable marker (e.g., URA3) for sequential deletion of both alleles of the target gene (1). These methods are relatively straightforward, but they also have drawbacks. First, their use is limited to laboratory strains with appropriate auxotrophies. Therefore, they cannot be applied to study the role of specific genes in clinical isolates, which are usually prototrophic. Yet, sometimes, the contribution of a gene to a certain phenotype may not be revealed in laboratory strains. For example, the multidrug efflux pump MDR1 is not significantly expressed in most strains under standard growth conditions, but it is constitutively overexpressed in drug-resistant clinical isolates that have acquired gain-of-function mutations in its regulator, the transcription factor MRR1. While the inactivation of MDR1 or MRR1 in a laboratory strain had no effect on drug susceptibility, the role of these genes in drug resistance could be clearly demonstrated by deleting them in MDR1 overexpressing clinical isolates (2–5). Second, the introduction of biosynthetic markers into an auxotrophic host strain that does not contain these genes results in mutants that cannot be directly compared with their parental strain, because they differ not only by the absence of the target gene but also by the presence of the selection markers. Therefore, this strategy requires the inclusion of other control strains that contain the same markers. Despite this, mutants and wild-type control strains still usually differ by the genomic location of the markers (the target locus in the mutants and the native locus or another integration site in the control strain), which can affect the expression level of the marker and the phenotype of the cells (6–8). When a counterselectable, recyclable marker like URA3 is used for sequential gene disruptions, the resulting mutants are isogenic with the auxotrophic parental strain. To restore prototrophy, the URA3 gene is then often reinserted at a common genomic site in both the parental and mutant strains to obtain truly isogenic strains (6). Complemented strains are obtained by reintegrating the target gene together with the selection marker. It should be noted that, in these cases, it is not the prototrophic mutants (which are usually used for phenotypic analyses) but their auxotrophic progenitors that were complemented. The first dominant selection marker that became available for the genetic manipulation of C. albicans was the mycophenolic acid (MPA) resistance marker MPAR, a mutated allele of the C. albicans IMH3 gene (9). IMH3 encodes inosine monophosphate dehydrogenase,

1

Auxotrophy-Independent Gene Deletion in Candida albicans

5

a key enzyme in the de novo biosynthesis of guanine nucleotides that is inhibited by MPA (10, 11). C. albicans cells carrying a single copy of the MPAR marker can grow in the presence of high concentrations of MPA that inhibit the growth of wild-type cells, allowing the selection of MPA-resistant transformants of prototrophic strains. Although the availability of the dominant MPAR marker provided the opportunity to inactivate genes in any C. albicans strain (e.g., the MDR1 gene in drug-resistant clinical isolates, see above), the use of this marker is somewhat tedious. The selection of MPA-resistant transformants takes a relatively long time (about 5–7 days). Additionally, the MPAR marker frequently integrates into the endogenous IMH3 locus, necessitating the screening of many transformants to identify those in which a mutagenesis cassette is inserted into the target gene. These limitations of the MPAR marker were overcome with the development of a new selection marker, caSAT1, which confers resistance to nourseothricin (12). Nourseothricin is a member of the streptothricin group of antibiotics produced by Streptomyces noursei (13). The sat-1 gene from the bacterial transposon Tn1825 encodes streptothricin acetyltransferase, which confers resistance to nourseothricin by inactivating the antibiotic (14, 15). The sat-1 gene was modified for functional expression in C. albicans, resulting in the Candida-adapted caSAT1 gene (see Note 1) that allowed the selection of nourseothricinresistant C. albicans transformants after genomic integration. To enable efficient marker recycling for repeated use, the caSAT1 marker was integrated into a cassette, the SAT1 flipper, which also contains a Candida-adapted FLP gene (caFLP), encoding the site-specific recombinase FLP, under the control of an inducible promoter. The SAT1 flipper cassette is bordered by direct repeats of the minimal FLP recombination target (FRT) sequence (Fig. 1). After the addition of flanking sequences of the target gene, the resulting deletion construct is used for the transformation of the desired C. albicans host strain and the selection of nourseothricin-resistant transformants in which the cassette had integrated into one allele of the target gene by homologous recombination (Fig. 2a). Induction of caFLP expression results in FLP-mediated excision of the SAT1 flipper cassette, which does not replicate and is lost from the cells. The resulting nourseothricin-sensitive derivatives can be identified by their slower growth on plates containing a low concentration of nourseothricin; they form smaller colonies than the original transformants (Fig. 2b). The nourseothricinsensitive heterozygous mutants are then used for a second round of integration and subsequent excision of the SAT1 flipper cassette to obtain the homozygous mutants. Substitution of a complete copy of the target gene for the upstream flanking region in the deletion construct allows reintroduction of the gene into the homozygous mutants using the same strategy, thereby generating complemented strains. There are two versions of the SAT1 flipper available, with

6

C. Sasse and J. Morschhäuser KpnI ApaI XhoI

NotI SacII SacI

FRT PMAL2

caFLP

caSAT1

TACT1

SAT1 flipper cassette (contained in plasmid pSFS2)

FRT

Add target gene flanking sequences ApaI

XhoI

SacII

SacI Deletion construct

caFLP

5‘ FRT PMAL2

caSAT1

TACT1

FRT

3‘

Homologous recombination

5‘

target gene ORF

3‘

5‘

target gene ORF

3‘

Wild-type parental strain

Gene replacement

5‘ FRT PMAL2

caFLP 5‘

caSAT1

TACT1 target gene ORF

FRT

3‘

Heterozygous mutant (nourseothricin-resistant)

3‘

FLP-mediated excision

5‘ 5‘

FRT

Heterozygous mutant (nourseothricin-sensitive)

3‘

target gene ORF

3‘

2nd round of gene replacement

5‘ 5‘ FRT PMAL2

caFLP

FRT

Homozygous mutant (nourseothricin-resistant)

3‘ caSAT1

TACT1

FRT

3‘

FLP-mediated excision

5‘

FRT

3‘

5‘

FRT

3‘

Homozygous mutant (nourseothricin-sensitive)

1

Auxotrophy-Independent Gene Deletion in Candida albicans

7

Fig. 2. Selection of nourseothricin-resistant C. albicans transformants and screening for nourseothricin-sensitive derivatives in which the SAT1 flipper cassette was excised by FLP-mediated recombination. (a) A C. albicans wild-type strain was transformed with a deletion construct containing the SAT1 flipper cassette inserted between flanking sequences of a target gene. The photograph was taken after 2 days of growth of the transformants at 30°C on a YPD plate containing 200 μg/mL nourseothricin. (b) Appearance of large colonies of a nourseothricin-resistant transformant and small colonies of nourseothricin-sensitive derivatives which, after the induction of FLP expression, were grown for 2 days at 30°C on a YPD plate containing 20 μg/mL nourseothricin. (c) Growth of the parental wild-type strain (1), a nourseothricin-resistant transformant (2), and a nourseothricin-sensitive derivative obtained after excision of the SAT1 flipper cassette (3) on a YPD plate containing 200 μg/mL nourseothricin. The plates were incubated for 2 days at 30°C.

either the SAP2 or the MAL2 promoter controlling caFLP expression. The SAP2 promoter can be induced by growing the cells in media containing BSA as the sole nitrogen source, and the MAL2 promoter can be induced in media containing maltose as carbon source. Both cassettes work equally well in our hands and have been used for multiple gene deletions in different strain backgrounds (2, 3, 12, 16–23). Here, we describe the use of the SAT1 flipper cassette with the MAL2 promoter. The complete sequence of this cassette has been deposited in GenBank under accession no. AY524979.

Fig. 1. Construction of homozygous C. albicans mutants by targeted gene deletion using the SAT1-flipping strategy. The structure of the SAT1 flipper cassette is shown on top. The Candida-adapted FLP gene (caFLP, light gray arrow, 1,272 bp) is placed under the control of the inducible MAL2 promoter (PMAL2, bent arrow, 548 bp) and fused to the transcription termination sequence of the ACT1 gene (TACT1, bent line with circle, 388 bp). The caSAT1 marker (1,868 bp) is shown as a hatched arrow and the 34-bp FLP recombination target (FRT ) sites are indicated by the short black arrows. Unique flanking restriction sites are indicated. The size of the whole SAT1 flipper cassette contained in plasmid pSFS2 (from the Kpn I site to the Sac I site) is 4,217 bp. In the example shown, upstream and downstream sequences of the target gene (white boxes, labeled 5¢ and 3¢) are cloned as ApaI–Xho I and Sac II–SacI fragments, respectively, on both sides of the SAT1 flipper cassette to obtain the deletion construct, which can be excised from the vector backbone by digestion with Apa I and Sac I. After the first round of transformation of the wild-type parental strain, nourseothricin-resistant clones are obtained in which the open reading frame (ORF) of one allele of the target gene (dark gray arrow ) is replaced by the SAT1 flipper. FLP-mediated excision of the cassette results in nourseothricin-sensitive derivatives, which are then used for a second round of integration/excision of the SAT1 flipper to obtain homozygous mutants. Apart from the inactivation of the target gene, the final mutants are identical to the wild-type parental strain.

8

C. Sasse and J. Morschhäuser

2. Materials 1. Plasmid pSFS2 (ca. 10 μg of DNA from a miniprep in 50 μL H2O). 2. Appropriate restriction enzymes and buffers from supplier (ApaI, XhoI, SacII, and SacI). 3. DNA clean-up kit (see Note 2). 4. Double-distilled H2O. 5. 50× TAE buffer (1 L): 242 g Tris–HCl, 57.1 mL of acetic acid, 100 mL of 0.5 M EDTA (ethylene diamine tetraacetic acid), pH 8.0; add H2O to 1 L. 6. DNA ligase and buffer. 7. Yeast peptone dextrose (YPD) medium: 1% yeast extract, 2% peptone, 2% glucose. 8. YPD agar plates: YPD medium with 2% agar. 9. 10× TE buffer: 100 mM Tris–HCl, pH 7.5, 10 mM EDTA. 10. 1 M Lithium acetate, adjusted to pH 7.5 with acetic acid. 11. 1 M Dithiothreitol (DTT). 12. 1 M Sorbitol. 13. Electroporation cuvettes (Electroporation cuvette 2 mm, Equibio). 14. Electroporator (Easyject Prima, Equibio). 15. 200 μg/mL Nourseothricin plates: dissolve 20 g peptone, 10 g yeast extract, and 20 g agar in 900 mL double-distilled H2O. After autoclaving, cool to approximately 60°C and add 100 mL of a sterile 20% glucose solution. Add 2 mL of a 100 mg/mL nourseothricin stock solution (clonNAT, Werner Bioagents, Jena, Germany). The nourseothricin stock solution is stored at -20°C. The nourseothricin must be thoroughly dissolved by vortexing before use. 16. 20 μg/mL Nourseothricin plates (prepare as for 200 μg/mL nourseothricin plates but add only 200 μL of the nourseothricin stock solution per liter). 17. Yeast peptone maltose (YPM) medium: 1% yeast extract, 2% peptone, and 2% maltose. 18. 10× Phosphate-buffered saline (PBS) (1 L): 80 g NaCl, 2 g KCl, 14.4 g Na2HPO4⋅2H2O, and 2.4 g KH2PO4, add H2O to 1 L.

1

Auxotrophy-Independent Gene Deletion in Candida albicans

9

3. Methods 3.1. Construction of the Deletion Cassette

1. Design primers for the PCR amplification of 300–500 bp sequences upstream and downstream of the target gene (see Note 3). Incorporate suitable restriction sites in each primer to facilitate directional cloning into plasmid pSFS2 (see Note 4). 2. PCR-amplify the flanking sequences and perform a PCR cleanup. Digest 2 μg each of the PCR products and plasmid pSFS2 using the appropriate enzymes and buffers in 30 μL reaction volumes. In the example given in Note 4, the upstream PCR product is digested with ApaI and XhoI, the downstream PCR product is digested with SacI and SacII, and plasmid pSFS2 is digested once with XhoI and SacII to obtain the SAT1 flipper cassette and once with ApaI and SacI to obtain the vector backbone. 3. Separate the DNA fragments by agarose gel electrophoresis on a 1% agarose gel overnight in 1× TAE buffer at 40 V. After ethidium bromide staining, excise the desired fragments using a sterile scalpel and purify them using a gel extraction kit. Dissolve each of the DNA fragments in 10 μL double-distilled H2O. 4. Set up a ligation reaction in a 25 μL volume using 2.5 μL of the vector, 7 μL of each flanking fragment (upstream and downstream flanking sequences), 5 μL of the SAT1 flipper cassette, 2.5 μL 10× ligation buffer, 1 μL DNA ligase. Incubate overnight at 16°C. 5. Transform competent E. coli cells with the ligation mixture. 6. Plate onto LB plates containing 100 μg/mL ampicillin to select for positive transformants. 7. Check the plasmid construct by restriction enzyme digestion and sequencing of the flanking upstream and downstream fragments. 8. Excise the complete deletion cassette from the plasmid (in the example given in Note 4 by digesting 5 μg plasmid DNA for 3 h with 15 U ApaI and 15 U SacI in a total volume of 50 μL) and separate the fragment from the vector by agarose gel electrophoresis on a 1% agarose gel overnight in 1× TAE buffer at 40 V. After ethidium bromide staining, excise the fragment containing the deletion cassette using a sterile scalpel and purify it using a gel extraction kit. Dissolve the DNA in 6 μL doubledistilled H2O.

10

C. Sasse and J. Morschhäuser

9. Assess the quality and quantity of the eluted fragment by analyzing 1 μL of the sample on an agarose minigel together with a known amount of a size marker. The remaining 5 μL will be used for electroporation and should contain at least 1 μg of DNA for a successful transformation. 3.2. Transformation of C. albicans by Electroporation

1. Inoculate 10 mL YPD with your C. albicans host strain and incubate overnight at 30°C with shaking at 250 rpm. 2. Inoculate 50 mL YPD in an Erlenmeyer flask with 5 μL of the overnight culture and incubate overnight at 30°C with shaking at 250 rpm. 3. When the culture has reached on optical density (OD600 nm) of 1.6–2.2, transfer the cells into a sterile 50 mL Falcon tube and centrifuge for 5 min at 3,300 × g. 4. Discard the supernatant and resuspend the pellet in 8 mL sterile double-distilled H2O. 5. Add 1 mL 10× TE buffer, pH 7.5, and mix. 6. Add 1 mL 1 M lithium acetate, pH 7.5, and mix. 7. Incubate for 1 h at 30°C with shaking at 150 rpm. 8. Add 250 μL 1 M DTT and incubate with shaking at 150 rpm for 30 min at 30°C. 9. Add 40 mL sterile, cold (4°C), double-distilled H2O, mix, and centrifuge the cells for 5 min at 3,300 × g at 4°C. 10. Place the tube on ice and discard the supernatant. Resuspend the cells in 25 mL sterile, cold, double-distilled H2O, and centrifuge for 5 min at 3,300 × g at 4°C. 11. Resuspend the cells on ice in 1 mL sterile, cold 1 M sorbitol, and centrifuge for 5 min at 3,300 × g at 4°C. 12. Discard the supernatant and resuspend the cells in the remaining liquid to obtain a dense suspension (ca. 200 μL). 13. Mix 40 μL of the cell suspension with 5 μL of the purified DNA fragment containing the deletion cassette in a precooled electroporation cuvette. Include a mock electroporation without DNA. 14. Incubate the cuvette with the cells for 5 min on ice. 15. Place the electroporation cuvette into the Equibio electroporator. Electroporate the cells at 1.8 kV and place the cuvette back on ice. 16. Add 1 mL YPD medium to the cells, mix, and transfer the cell suspension to a 2 mL Eppendorf tube (see Note 5).

1

Auxotrophy-Independent Gene Deletion in Candida albicans

11

17. Incubate the cells for 4 h at 30°C with shaking at 150 rpm (see Note 6). 18. Spread 100 μL of the cell suspension on a YPD plate containing 200 μg/mL nourseothricin. In addition, prepare a tenfold dilution series (not from the negative control) and spread 100 μL of the 10−5 and 10−6 dilutions on YPD plates without nourseothricin to determine the number of viable cells (see Note 7). 19. Centrifuge the remaining cells for 2 min at 3,300 × g and discard the supernatant. Resuspend the cells in the remaining liquid and spread them on a YPD plate containing 200 μg/mL nourseothricin (see Note 8). 20. Incubate the plates for 2 days at 30°C (see Fig. 2a and Note 9). 21. Pick six nourseothricin-resistant colonies and streak them onto a new YPD plate with 200 μg/mL nourseothricin. Incubate for 2 days at 30°C. 22. Analyze the clones for the desired allelic replacement by sequential Southern hybridizations using the upstream and downstream flanking fragments of the disruption cassette as probes. 3.3. Excision of the SAT1 Flipper Cassette

1. Pick a single colony of a clone containing the SAT1 flipper cassette in one allele of the target gene from a selection plate. Suspend the cells in 10 mL YPM in an Erlenmeyer flask and incubate overnight at 30°C with shaking at 250 rpm (see Note 10). 2. Prepare a dilution series in 1× PBS and spread 100 μL of the 10−5 and 10−6 dilutions on a YPD plate containing 20 μg/mL nourseothricin. Expect between 50 and 200 colony forming units on the plates. 3. Incubate the plates for 2 days at 30°C. Cells that have lost the SAT1 flipper cassette and become nourseothricin-sensitive appear as small colonies, whereas cells that have retained the SAT1 flipper will form large colonies (see Fig. 2b and Note 11). 4. Pick several small colonies and restreak them on YPD plates and also on YPD plates containing 200 μg/ml nourseothricin. Incubate the plates for 2 days at 30°C to confirm that the clones are nourseothricin-sensitive. There should be no growth at the high nourseothricin concentration, as in the original wild-type parent (see Fig. 2c and Note 12). 5. Verify correct excision of the SAT1 flipper cassette in nourseothricin-sensitive clones by Southern hybridization analysis. One correct nourseothricin-sensitive derivative of at least two independent transformants is then used for a second round of integration/excision of the SAT1 flipper cassette to obtain homozygous mutants.

12

C. Sasse and J. Morschhäuser

4. Notes 1. We use the prefix “ca” (lower case letters) to indicate that a gene from another organism was modified for expression in C. albicans, e.g., caSAT1 and caFLP are not the original sat-1 and FLP genes from the bacterial transposon Tn1825 and Saccharomyces cerevisiae, respectively, but Candida-adapted genes. Some researchers have changed these gene designations and use the prefix “Ca” instead. This is inappropriate. According to the guidelines provided at the Candida genome database (http://www.candidagenome.org/) the prefix “Ca” (capital C) should be used for C. albicans genes when it is necessary to distinguish them from orthologous genes with the same names from another organism. CaSAT1 would, therefore, indicate that the SAT1 gene is from C. albicans, which is not the case. 2. We use Nucleo Spin Extract II (Macherey-Nagel, Düren, Germany). 3. We usually use flanking sequences of ca. 300–500 bp in length. This is sufficient for specific integration into the target locus (usually 80–90% of the clones are correct, although the specificity may be lower in some cases) and reduces the risk of PCR errors that might affect neighboring genes. The cloned flanking sequences should be confirmed by sequencing. Fragments of this size can also be conveniently used as probes in Southern hybridization analyses to confirm correct integration and excision of the SAT1 flipper cassette. 4. The SAT1 flipper cassette in plasmid pSFS2 was constructed in the vector pBluescript II KS and was designed to contain several unique restriction sites on the left (KpnI, ApaI, and XhoI) and right (NotI, SacII, and SacI) borders. These sites can be used for cloning flanking sequences of the target gene that serve for specific genomic integration by homologous recombination. For example, an upstream fragment is amplified by polymerase chain reaction (PCR) with primers that introduce a distal ApaI site and a proximal XhoI site, and a downstream fragment is amplified with primers that introduce a proximal SacII site and a distal SacI site. The fragments are then cloned into the appropriately digested pSFS2. The flanking sequences of the target gene can be sequentially cloned on both sides of the SAT1 flipper cassette, e.g., by first inserting an ApaI–XhoI fragment with upstream flanking sequences on the left side, followed by the insertion of a SacII–SacI fragment with downstream flanking sequences on the right side. In our lab, we usually construct the deletion cassettes in a single cloning step (4, 5). In most cases, we perform a quadruple ligation with the ApaI/SacIdigested vector backbone, the XhoI–SacII SAT1 flipper fragment,

1

Auxotrophy-Independent Gene Deletion in Candida albicans

13

and the ApaI–XhoI upstream and SacII–SacI downstream fragments, which directly generates the desired construct (Fig. 3a). Alternatively, if the target gene has already been cloned into a plasmid, the coding region can be removed by amplifying the vector backbone and flanking sequences by an inverse PCR with divergent primers that introduce restriction sites (e.g., XhoI and SacII), between which the SAT1 flipper cassette can then be inserted (Fig. 3b). Deletion cassettes can also be generated by PCR amplification of the 4.2-kb SAT1 flipper cassette with long primers containing target gene sequences. Although this is the fastest way to obtain the deletion cassette, we do not use this method in our lab, because the frequency of specific integration into the target locus is much lower and more transformants have to be screened. This approach also requires the additional generation of probes to verify correct integration and excision events by Southern hybridization. Southern analysis should always be used for mutant confirmation, because diagnostic PCR can be considered only as a preliminary screening method. For reintroduction of the target gene into the homozygous null mutants, the required complementation cassette can also be easily obtained by substituting a PCR-amplified copy of the gene, including upstream and transcription termination sequences, for the 5¢-flanking sequence in the deletion construct. 5. When starting the generation of mutants from a parental strain, the cell suspension can be divided into two parts at this step. Dividing the transformed cells into two separate suspensions directly after the electroporation (i.e., before allowing them to grow and divide) is a convenient way to obtain two independent sets of transformants. We strongly recommend the generation of at least two independent series of mutants to ensure the reproducibility of their phenotypes. Once independent heterozygous mutants have been obtained, each of them can be used to generate a homozygous mutant. 6. This recovery step is essential to enable the transformed cells to express the streptothricin acetyltransferase encoded by the caSAT1 gene. If plated immediately onto the selection plates, the transformants would be killed by the nourseothricin before they can express the resistance marker. 7. This is for troubleshooting in the event that no transformants are obtained. Too many cells may have been killed by the electroporation if conditions were not optimal. 100 μL of the 10−6 dilution should contain viable cells that form colonies on the YPD plate. 8. This plate is only required if the transformation efficiency is low. In most cases, it can be discarded, because enough transformants are normally recovered from the first plate on which

14

C. Sasse and J. Morschhäuser

a XhoI

ApaI

SacII

SAT1 flipper

+

5‘

Deletion cassette

3‘

+

3‘

ApaI

SacII SacI

SAT1 flipper

5‘

SacII SacI

XhoI

XhoI

ApaI

SacI

ApaI

SacI

Ligate

Vector

Vector

b XhoI

SacII XhoI

SacII

Target gene

Inverse PCR

Vector + flanking sequences

Vector

SAT1 flipper

+ XhoI

SAT1 flipper

SacII

Deletion cassette

Ligate Vector

Fig. 3. Generation of a gene deletion construct with the SAT1 flipper cassette in a single cloning step. (a) Construction of the deletion cassette by a quadruple ligation reaction with the Apa I/Sac I-digested vector backbone, an Xho I–Sac II fragment containing the SAT1 flipper cassette, and Apa I–Xho I and Sac II–Sac I fragments containing the PCR-amplified upstream (5¢) and downstream (3¢) sequences of the target gene. (b) Construction of the deletion cassette by inverse PCR using a plasmid with the cloned target gene and divergent primers (small arrows) that amplify the vector as well as flanking sequences of the target gene. The primers introduce restriction sites (here Xho I and Sac II) between which the SAT1 flipper cassette can be inserted.

1

Auxotrophy-Independent Gene Deletion in Candida albicans

15

only 100 μL of the cell suspension was plated. We usually obtain 100–500 transformants with a gene deletion construct that requires a double cross over for genomic integration. 9. Visible colonies appear after 24 h. If necessary, due to time constraints, these can be picked, restreaked on a selection plate, and be used in parallel to start an overnight culture for the isolation of genomic DNA and Southern hybridization to confirm correct integration. However, the larger colonies obtained after 2 days are more convenient to handle and may already reveal a phenotype, but be aware that colonies that appear only after prolonged incubation (3 days and longer) may be spontaneously resistant, untransformed cells. These do not reach the same resistance level as cells containing the caSAT1 marker and will also be found on the control plate with cells to which no DNA was added. On the other hand, certain mutants may have a slow-growth phenotype and require more time to form visible colonies. 10. YPM medium, which contains maltose instead of glucose, is used to induce the MAL2 promoter that drives expression of the caFLP gene. However, we found that the MAL2 promoter is leaky and the FLP recombinase is also expressed in YPD medium. Therefore, recycling of the SAT1 flipper cassette can usually also be achieved by growing the transformants overnight in YPD medium without selective pressure. The population will contain a sufficient percentage of cells that have lost the SAT1 flipper cassette. This is also apparent when the transformants are analyzed by Southern hybridization. If the cells were grown without selective pressure for DNA isolation, the transformants often exhibit not only the new fragment expected after insertion of the SAT1 flipper cassette but also the fragment resulting from excision of the cassette (both with variable relative signal intensities). Growth in YPM, as described here, induces the MAL2 promoter more efficiently, although excision of the SAT1 flipper cassette still does not occur in all cells of the population (but this is not necessary, because only one sensitive derivative is needed per transformant). 11. In our experience, the activity of nourseothricin can vary between different batches. While a concentration of 200 μg/mL was always appropriate for the selection of nourseothricinresistant transformants, the concentration required to distinguish resistant and sensitive cells on the same plate is a bit more tricky. On plates containing 20 μg/mL nourseothricin, both resistant and sensitive cells usually grow and can be distinguished by their colony size (Fig. 2b). But sometimes we had to lower the nourseothricin concentration to 10 μg/mL, because at higher concentrations the sensitive cells did not grow at all. Conversely, on other occasions, the nourseothricin

16

C. Sasse and J. Morschhäuser

concentration had to be increased to 25 μg/mL because at lower concentrations the sensitive cells grew as well as the resistant cells. We, therefore, recommend testing each new batch of plates by streaking a sensitive and a resistant strain side by side on the same plate to confirm that both grow and can be distinguished. Alternatively, the cells can also be spread at an appropriate dilution on YPD plates after the induction of FLP expression. Among 50 randomly picked colonies that are restreaked on both a YPD plate and a YPD plate containing 200 μg/ml nourseothricin, several sensitive clones will usually be found. 12. For confirming nourseothricin sensitivity, YPD plates containing 100 μg/mL instead of 200 μg/ml nourseothricin are also sufficient. This requires an additional set of plates but reduces costs, as nourseothricin is expensive.

Acknowledgment Work in our laboratory is supported by the Deutsche Forschungsgemeinschaft (DFG). References 1. Noble, S.M., Johnson, A.D. (2007) Genetics of Candida albicans, a diploid human fungal pathogen. Annu Rev Genet 41, 193–211. 2. Dunkel, N., Blass, J., Rogers, P.D., Morschhäuser, J. (2008) Mutations in the multi-drug resistance regulator MRR1, followed by loss of heterozygosity, are the main cause of MDR1 overexpression in fluconazole-resistant Candida albicans strains. Mol Microbiol 69, 827–840. 3. Morschhäuser, J., Barker, K.S., Liu, T.T., BlaßWarmuth, J., Homayouni, R., Rogers, P.D. (2007) The transcription factor Mrr1p controls expression of the MDR1 efflux pump and mediates multidrug resistance in Candida albicans. PLoS Pathog 3, e164. 4. Morschhäuser, J., Michel, S., Staib, P. (1999) Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Mol Microbiol 32, 547–556. 5. Wirsching, S., Michel, S., Morschhäuser, J. (2000) Targeted gene disruption in Candida albicans wild-type strains: the role of the MDR1 gene in fluconazole resistance of clinical Candida albicans isolates. Mol Microbiol 36, 856–865.

6. Brand, A., MacCallum, D.M., Brown, A.J., Gow, N.A., Odds, F.C. (2004) Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus. Eukaryot Cell 3, 900–909. 7. Cheng, S., Nguyen, M.H., Zhang, Z., Jia, H., Handfield, M., Clancy, C.J. (2003) Evaluation of the roles of four Candida albicans genes in virulence by using gene disruption strains that express URA3 from the native locus. Infect Immun 71, 6101–6103. 8. Lay, J., Henry, L.K., Clifford, J., Koltin, Y., Bulawa, C.E., Becker, J.M. (1998) Altered expression of selectable marker URA3 in genedisrupted Candida albicans strains complicates interpretation of virulence studies. Infect Immun 66, 5301–5306. 9. Wirsching, S., Michel, S., Köhler, G., Morschhäuser, J. (2000) Activation of the multiple drug resistance gene MDR1 in fluconazoleresistant, clinical Candida albicans strains is caused by mutations in a trans-regulatory factor. J Bacteriol 182, 400–404.

1

Auxotrophy-Independent Gene Deletion in Candida albicans

10. Köhler, G.A., Gong, X., Bentink, S., Theiss, S., Pagani, G.M., Agabian, N., Hedstrom, L. (2005) The functional basis of mycophenolic acid resistance in Candida albicans IMP dehydrogenase. J Biol Chem 280, 11295–11302. 11. Köhler, G.A., White, T.C., Agabian, N. (1997) Overexpression of a cloned IMP dehydrogenase gene of Candida albicans confers resistance to the specific inhibitor mycophenolic acid. J Bacteriol 179, 2331–2338. 12. Reuß, O., Vik, Å., Kolter, R., Morschhäuser, J. (2004) The SAT1 flipper, an optimized tool for gene disruption in Candida albicans. Gene 341, 119–127. 13. Krügel, H., Fiedler, G., Haupt, I., Sarfert, E., Simon, H. (1988) Analysis of the nourseothricinresistance gene (nat) of Streptomyces noursei. Gene 62, 209–217. 14. Heim, U., Tietze, E., Weschke, W., Tschäpe, H., Wobus, U. (1989) Nucleotide sequence of a plasmid born streptothricin-acetyl-transferase gene (sat-1). Nucleic Acids Res 17, 7103. 15. Joshi, P.B., Webb, J.R., Davies, J.E., McMaster, W.R. (1995) The gene encoding streptothricin acetyltransferase (sat) as a selectable marker for Leishmania expression vectors. Gene 156, 145–149. 16. Coste, A., Turner, V., Ischer, F., Morschhäuser, J., Forche, A., Selmecki, A., Berman, J., Bille, J., Sanglard, D. (2006) A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics 172, 2139–2156.

17

17. Dabas, N., Morschhäuser, J. (2007) Control of ammonium permease expression and filamentous growth by the GATA transcription factors GLN3 and GAT1 in Candida albicans. Eukaryot Cell 6, 875–888. 18. Dabas, N., Morschhäuser, J. (2008) A transcription factor regulatory cascade controls secreted aspartic protease expression in Candida albicans. Mol Microbiol 69, 586–602. 19. Dunkel, N., Liu, T.T., Barker, K.S., Homayouni, R., Morschhäuser, J., Rogers, P.D. (2008) A gain-of-function mutation in the transcription factor Upc2p causes upregulation of ergosterol biosynthesis genes and increased fluconazole resistance in a clinical Candida albicans isolate. Eukaryot Cell 7, 1180–1190. 20. Lermann, U., Morschhäuser, J. (2008) Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans. Microbiology 154, 3281–3295. 21. Ramírez-Zavala, B., Reuß, O., Park, Y.-N., Ohlsen, K., Morschhäuser, J. (2008) Environmental induction of white-opaque switching in Candida albicans. PLoS Pathog 4, e1000089. 22. Reuß, O., Morschhäuser, J. (2006) A family of oligopeptide transporters is required for growth of Candida albicans on proteins. Mol Microbiol 60, 795–812. 23. Staib, P., Lermann, U., Blaß-Warmuth, J., Degel, B., Würzner, R., Monod, M., Schirmeister, T., Morschhäuser, J. (2008) Tetracycline-inducible expression of individual secreted aspartic proteases in Candida albicans allows isoenzyme-specific inhibitor screening. Antimicrob Agents Chemother 52, 146–156.

Chapter 2 Mini-blaster-Mediated Targeted Gene Disruption and Marker Complementation in Candida albicans Shantanu Ganguly and Aaron P. Mitchell Abstract Several gene disruption strategies have been described in Candida albicans to create homozygous mutants. We describe here a recyclable mini-blaster cassette containing C. albicans URA3 gene and 200-bp flanking repeats that is useful for disruption of C. albicans genes. The cassette can be used to create unmarked homozygous mutants which can be complemented at the HIS1 gene locus. This strategy of creating gene disruptions and subsequent complementation can be used to study gene function. Key words: Genetics, Mutants, Complementation

1. Introduction Candida albicans is a major fungal systemic pathogen in humans. The ability of this fungus to cause lethal infections has fueled the need to study its gene function to better understand aspects such as host-pathogen interactions and virulence. The genetic architecture of this pathogen poses two significant obstacles (1). First, C. albicans is a diploid so both alleles of a gene must be altered. Second, it is an asexual organism, so gene disruption and complementation depends upon successive manipulations of a single strain. Loss-of-function or null mutations provide a simple avenue toward interpretation of gene function. In this chapter, we discuss a detailed protocol to introduce a null mutation in a C. albicans gene of interest. We describe use of the mini-blaster strategy to delete both alleles of a gene by alternate transformation and recombination using a recyclable cassette containing the C. albicans URA3 marker (2). This strategy is based on the original Ura-blaster design of Alani and Kleckner (3) that was modified for C. albicans

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_2, © Springer Science+Business Media, LLC 2012

19

20

S. Ganguly and A.P. Mitchell Mini Blaster Cassette in pDDB57 plasmid

URA3

1

3.0 kb 2.0 kb 1.5 kb

2

3

4

5

Mini Blaster Product

1.0 kb 0.5 kb

Loop Out Product

Fig. 1. PCR amplification of the mini-blaster cassette from the pDDB57 plasmid. Gray boxes in the diagram indicate the 200 bp repeats flanking the URA3 ORF. In the gel picture, lanes 1–5 show the ~2,000-bp long cassette and a ~750-bp long loop-out product.

by Fonzi and Irwin (4). The mini-blaster, or “Ura-blaster,” has shorter direct repeats than the Ura-blaster, thus facilitating PCR amplification. Specifically, the mini-blaster cassette carries the URA3-dpl200 marker (Fig. 1), which constitutes the URA3 gene and 200-bp flanking repeats. The flanking repeats permit homologous excision and reutilization of the URA3 marker. The cassette is amplified and targeted using primers bearing 100 bp of homology to the gene locus. These same primers may be used for a more conventional dual-marker gene disruption procedure (5). Transformation with the PCR product confers a Ura + phenotype, creating a heterozygous mutant with one allele of the targeted gene replaced by the cassette. Subsequent growth of the Ura + heterozygote under nonselective conditions, followed by selection on 5-FOA (5-fluoroorotic acid) plates, yields a Ura− heterozygous strain. 5-FOA is used for identification and selection of cells that have undergone spontaneous loss of URA3 to become Ura−. Cells that have retained URA3 can synthesize the enzyme orotidine-5¢-phosphate decarboxylase, which converts 5-FOA into a toxic compound and therefore renders Ura + cells unable to grow on plates containing 5-FOA. Transformation and 5-FOA selection are repeated with the Ura− heterozygote to delete the second allele of the gene, thus generating an unmarked homozygous mutant. Additionally, we describe how use of a distinct primer set for deletion of the second allele can minimize same-allele integration of the cassette in the heterozygous mutant. The mini-blaster strategy enables one to generate unmarked deletion mutants, thus permitting creation of multiply mutant strains.

2

Mini-blaster-Mediated Gene Disruption in C. albicans

21

This strategy is particularly important for deleting genes with similar sequences or overlapping function where mutations for two or more similar genes in the same background are required to assess gene function. Complementation with a wild-type gene copy in these strains can be carried out at the HIS1 gene locus, using vector pDDB78 (6). We note that pDDB78-based complementation can also be used for homozygous mutants created with ARG4 and URA3 cassettes in the BWP17 strain background (5). We discuss the complementation procedure as well. Phenotypic analysis following complementation of each of the genes individually in the deletion background can provide assessment of individual gene function.

2. Materials 2.1. Primer Design

1. Primer set 1 for disrupting first allele of a gene: F1 (forward primer 1): 100 bp upstream of start codon + adapter sequence (T TTC CCA GTC ACG ACG TT) R1 (reverse primer 1): 100 bp downstream of stop codon (reverse complement) + adapter sequence (G TGG AAT TGT GAG CGG ATA). 2. Primer set 2 for disrupting second allele (optional): F2 (forward primer 2): 100 bp downstream of start codon + adapter sequence (T TTC CCA GTC ACG ACG TT) R2 (reverse primer 2): 100 bp upstream of stop codon (reverse complement) + adapter sequence (G TGG AAT TGT GAG CGG ATA). 3. Detect primers to confirm cassette integration at the targeted locus. 4. Complementation primers for complementing the homozygous mutant with a wild-type copy of the deleted gene.

2.2. Escherichia coli Plasmid Extraction/ Purification

1. LB + ampicillin (100 μg/mL) liquid medium: 0.5% yeast extract, 1% NaCl, 1% tryptone, 100 μg/mL ampicillin.

2.3. PCR Reaction to Amplify the Mini-blaster Cassette

1. 10 μM forward primer (F1).

2. Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid Miniprep Kit).

2. 10 μM reverse primer (R1). 3. 10× Ex Taq Buffer PCR buffer (contains 20 mM Mg2+). 4. dNTPs (2.5 mM each). 5. TaKaRa Ex Taq™ DNA polymerase (Takara Bio, Inc.). 6. Template Plasmid: pDDB57, Pubmed accession number: AF173953 (2).

22

S. Ganguly and A.P. Mitchell

2.4. Transformation of the Mini-blaster Cassette into C. albicans

1. C. albicans strain BWP17 (5). 2. YPD + Uri (80 μg/mL) plates: 2% glucose, 2% bacto-peptone, 1% bacto-yeast extract, 2% bacto-agar, 80 μg/mL of uridine. 3. YPD + Uri (80 μg/mL) liquid medium: 2% glucose, 2% bactopeptone, 1% bacto-yeast extract, 80 μg/mL of uridine. 4. Ura-blaster cassette PCR product. 5. LATE (0.1 M LiOAc in 1× TE buffer): 0.372 g/L EDTA disodium salt, 1.21 g/L Tris, 10.2 g/L lithium acetate, pH 7.5. 6. Calf thymus DNA (~10 mg/mL). 7. PLATE (8 mL 50% w/v PEG3350 + 1 mL 10× TE + 1 mL 1 M LiOAc): For 50% w/v PEG3350, dissolve 50 g PEG3350 in 100 mL (final volume) distilled water and filter sterilize after mixing; For 10× TE, 3.72 g/L 1 mM EDTA disodium salt, 12.1 g 10 mM TRIS, pH 7.5; For 1 M LiOAc 102 g/L lithium acetate pH 7.5. 8. CSM-URA plates: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.077% of CSM-URA dropout medium, 2% bacto-agar.

2.5. Marker Recycling Step

1. YPD + Uri (80 μg/mL) liquid medium (see Subheading 2.4, item 3). 2. CSM-URA + 5FOA (1 g/L) plates: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.077% CSM-URA dropout medium, 2% bacto-agar, 5-FOA (1 g/L). 3. YPD + Uri (80 μg/μL) plates (see Subheading 2.4, item 2).

2.6. Confirmation of Heterozygous Mutants

1. 10 μM forward detect primer (FD1). 2. 10 μM reverse detect primer (RD1). 3. 10× PCR buffer with Mg2+: contains 100 mM Tris–HCl pH 9, 15 mM MgSO4, 100 mM KCl, 80 mM (NH4)2SO4, 0.5% NP-40; final MgCl2 concentration of 1.5 mM. 4. dNTPs. 5. Taq DNA polymerase.

2.7. PCR Reaction to Amplify the Mini-blaster Cassette for Disruption of Second Allele

1. 10 μM forward primer (F1 or F2, if desired). 2. 10 μM reverse primer (R1 or R2, if desired). 3. 10× Ex Taq Buffer PCR buffer (contains 20 mM Mg2+). 4. dNTPs (2.5 mM each). 5. TaKaRa Ex Taq™ DNA polymerase. 6. Template Plasmid: pDDB57 (2).

2

2.8. Transformation of the Mini-blaster Cassette into Heterozygous C. albicans Recipient 2.9. Preparation of C. albicans Genomic DNA

Mini-blaster-Mediated Gene Disruption in C. albicans

23

Use reagents in Subheading 2.4, but use the heterozygous yfg1::dpl200/YFG1 strain as the transformation recipient instead of YFG1/YFG1 strain BWP17.

1. YPD + Uri (80 μg/mL) liquid medium (see Subheading 2.4, item 3). 2. TENTS: 1% SDS, 2% Triton X-100, 0.1 M NaCl in 1× TE, filter sterilized. 3. Acid washed beads (425–600 μm), sterilized by autoclaving. 4. Phenol/chloroform/isoamyl alcohol (25:24:1, v/v). 5. Ethanol. 6. 1× Tris–EDTA (1× TE), pH 7.4. 7. 10 mg/mL RNase. 8. 10 M NH4OAc.

2.10. PCR Amplification of Gene of Interest Using Complementation Primers

1. 10 μM comp forward primer (CF). 2. 10 μM comp reverse primer (CR). 3. 10× Ex Taq Buffer PCR buffer (contains 20 mM Mg2+). 4. dNTPs (2.5 mM each). 5. TaKaRa Ex Taq™ DNA polymerase. 6. Genomic DNA: Reference strain (see Note 1).

2.11. Construction of Complementation Plasmid by Homologous Recombination in Saccharomyces cerevisiae and Plasmid DNA Recovery by Mechanical Disruption

1. S. cerevisiae BY4741Δ trp strain (7). 2. YPD plates (see Subheading 2.4, item 2). 3. YPD liquid medium (see Subheading 2.4, item 3). 4. pDDB78 plasmid (6). 5. PCR product: wild-type gene amplified using complementation primers. 6. Restriction Enzymes NotI and EcoRI (New England Biolabs). 7. 10× NE Buffer 3 (New England Biolabs). 8. 100× BSA (New England Biolabs). 9. Calf thymus DNA (~10 mg/mL). 10. PLATE: 8 mL 50% PEG3350 + 1 mL 10× TE + 1 mL 1 M LiOAc. 11. CSM-TRP plates: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.074% of CSM-TRP dropout medium, 2% bacto-agar. 12. CSM-TRP liquid medium: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.074% CSM-URA dropout medium.

24

S. Ganguly and A.P. Mitchell

13. Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid Miniprep Kit). 14. Acid washed glass beads (size: 425–600 μm). 2.12. E. coli Transformation

1. Chemically competent E. coli. 2. LB + Ampicillin (100 μg/mL) plates (see Subheading 2.2, item 1). 3. Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid Miniprep Kit).

2.13. Transformation of Complementation Plasmid in C. albicans

1. C. albicans homozygous Ura− mutants. 2. YPD + Uri (80 μg/μL) plates (see Subheading 2.4, item 2). 3. YPD + Uri (80 μg/μL) liquid medium (see Subheading 2.4, item 3). 4. Restriction Enzyme NruI (New England Biolabs). 5. 10× NE Buffer 3 (New England Biolabs). 6. LATE: 0.1 M LiOAc in 1× TE buffer. 7. Calf thymus DNA (~10 mg/mL). 8. PLATE: 8 mL 50% PEG3350 + 1 mL 10× TE + 1 mL 1 M LiOAc. 9. CSM-HIS plates: 2% glucose, 0.67% yeast nitrogen base (without amino acids), 0.077% CSM-URA dropout medium, 2% bacto-agar, 80 μg/μL uridine.

3. Methods The methods that follow describe a gene disruption procedure in C. albicans in a step-by-step format. We begin with a description of the primer design procedure to be used to amplify the recyclable mini-blaster cassette. This cassette will be transformed into a C. albicans reference strain to integrate by homologous recombination and consequently replace both of alleles of a specific gene of interest in sequential steps (Fig. 2). We will follow up with a detailed protocol to describe recycling of the cassette and a subsequent detection strategy to confirm the deletion of both alleles in an unmarked homozygous deletion mutant. 3.1. Primer Design

1. Refer to the CGD website (http://www.candidagenome.org/) to retrieve the coding sequence of your gene of interest plus 250 bp upstream of the start codon and 250 bp downstream of the stop codon. 2. For generating primer set 1, use 100 bp of noncoding sequence upstream of the start codon and add the adapter sequence at

2

Mini-blaster-Mediated Gene Disruption in C. albicans

25

F1 URA3

R1 Mini-blaster cassette

YFG1 YFG YFG1

URA3

Select on CSM-Ura

YFG1 ~10–4

Grow in non - selective media then plate on 5 - FOA plates

YFG1 Disrupt the other allele using mini blaster cassette amplified using F1-R1 or F2-R2

Fig. 2. Schematic showing the mini-blaster cassette from the plasmid pDDB57. Outcomes of subsequent transformation events are indicated step-wise in the figure. Dotted lines indicate the 100-bp long regions in the primer sequences bearing homology to the gene locus of interest (YFG1 = Your F avorite G ene 1).

the 3¢ end to generate the forward primer of set 1 (F1; see Subheading 2.1). For the corresponding reverse primer, use 100 bp of noncoding sequence downstream of the stop codon (reverse complement) and add the adapter sequence at the 3¢ end to generate the reverse primer of set 1 (R1; see Subheading 2.1). These primers will be used to delete one copy of the gene of interest to generate a heterozygote. 3. For generating primer set 2; use 100 bp of coding sequence downstream from the start codon and add the adapter sequence at the 3¢ end to generate the forward primer of set 2 (F2). For the corresponding reverse primer, use 100 bp of coding sequence upstream of the stop codon (reverse complement) and add the adapter sequence at the 3¢ end to generate the reverse primer of set 2 (R2) (see Note 2). 4. For generation of detect primers: Design a forward detect primer 150–300 bp upstream of the start codon (FD1). A corresponding reverse detect should be designed 150–300 bp downstream of the stop codon (RD1). Design an internal gene-specific forward primer (FD2) in the region 50–300 bp upstream of the stop codon.

26

S. Ganguly and A.P. Mitchell

5. For generation of complementation primers, refer to the CGD website to retrieve the full coding sequence of the gene of interest plus 5¢ and 3¢ noncoding regions. Typically, ~1,500 bp of 5¢ noncoding sequence and ~300 bp of 3¢ noncoding sequence are sufficient to cover the promoter and terminator sequence, respectively. This may vary depending on the intergenic distance and the orientation of the neighboring genes. Design primers covering the entire above retrieved sequence using the Primer 3 software (http://frodo.wi.mit.edu/primer3/). To the forward and reverse primers designed using the software, add the following adapter sequences (these 40-mer sequences flank the NotI and EcoRI restriction site in the pDDB78 vector, Fig. 6) at the 5¢ end to give the following primers: 1. Comp forward (CF): TTCACACAGGAAACAGCTATGAC CA TGATTACGCCAAGCT + primer 3 forward sequence. 2. Comp reverse (CR): TCGACCATATGGGAGAGCTCCCAACGCGTT GGATGCATAG + primer 3 reverse sequence. 3.2. E. coli Transformation, Plasmid Extraction, and Purification

1. Streak out E. coli strain AMB900 (contains plasmid pDDB57) and AMB906 (contains plasmid pDDB78) on LB + ampicillin (100 μg/mL) plates to give single colonies. Incubate overnight at 37°C. Pick and grow a single colony of each in 5 mL of LB + ampicillin (100 μg/mL) liquid medium overnight. 2. The next day, spin down the cultures and extract plasmid DNA using the Fermentas GeneJET™ Plasmid Miniprep Kit (see Note 3). Store both plasmid preps at −20°C until use. The plasmid pDDB57 can be diluted 1:50 to serve as template for subsequent PCR amplification steps.

3.3. PCR Amplification of the Mini-blaster Cassette

1. A typical PCR reaction composition to amplify the cassette from the plasmid pDDB57 is listed below (see Note 4): 10× PCR buffer

5 μL

5 mM dNTPs

4 μL

10 μM forward primer (F1)

1 μL

10 μM reverse primer (R1)

1 μL

Takara Ex Taq™ polymerase

0.5 μL

pDDB57 template (1:50)

1 μL

dH2O

37.5 μL

Total volume

50 μL

2. The PCR program is listed below (see Note 5): Step 1

94°C for 5 min

Step 2

94°C for 1 min

Step 3

56°C for 2 min

2

Mini-blaster-Mediated Gene Disruption in C. albicans

Step 4

72°C for 3 min

Step 5

Repeat steps 2–4 30 times

Step 6

72°C for 8 min

Step 7

4°C/end.

27

3. Check 5 μL of the PCR product on a 0.8% DNA agarose gel containing ethidium bromide to confirm a size of ~2,000 bp (Fig. 1). Typically a smaller amplicon of ~750 bp is also detected, representing loss of the URA3 insert due to crosspriming on the direct repeats. Store the PCR reaction at −20°C until use. 3.4. Transformation of the Mini-blaster Cassette into C. albicans

1. Streak out C. albicans strain BWP17 (5) for single colonies on a YPD + Uri plate (see Note 6). Grow at 30°C for 2 days. 2. Culture a single colony in 5 mL YPD + Uri liquid media. Incubate overnight at 30°C with agitation until the culture is saturated. 3. The following day, dilute the cells to 1:200 in 50 mL YPD + Uri liquid media. Typically, this corresponds to an OD600 = 0.2 on our spectrophotometer. 4. Incubate the diluted culture at 30°C for 4–5 h for the cells to undergo two doublings. This would correspond to an OD600 = 0.8 if the starting OD600 was 0.2 (see Note 7). 5. When the C. albicans culture has reached OD600 = 0.8 , pour it into a 50 mL conical tube, and spin at low speed (~1,000 × g) for 5 min. 6. Discard the supernatant, and wash the cell pellet by gently resuspending it in 5 mL sterile dH2O (do not vortex). 7. Spin at low speed for 5 min, and discard the supernatant. 8. Resuspend the cell pellet in 500 μL of LATE. 9. To set up C. albicans transformation reactions, add the following: LATE cell suspension

100 μL

Calf thymus DNA

10 μL

PCR reaction from Subheading 3.2

25 μL

10. Mix gently. 11. Incubate for 30 min at 30°C. 12. Add 700 μL of freshly made PLATE, and incubate overnight at 30°C (see Note 8). 13. Heat shock the cell mixture at 44°C for 15 min. 14. Spin cells down for 30 s at low speed, and aspirate the supernatant. 15. Wash the cell pellet by resuspending in 1 mL YPD + Uri.

28

S. Ganguly and A.P. Mitchell

16. Spin cells down for 30 s at low speed, and decant the supernatant. 17. Resuspend the cells gently in 100 μL YPD + Uri, and spread on CSM-Ura plates. 18. Grow for 2 days at 30°C. 19. Pick 12 colonies from each transformation plate, streak for singles on CSM-Ura plates, and incubate for 2 days at 30°C. These transformants should be heterozygous mutants. 3.5. URA3 Marker Excision by Recombination

1. Pick a single colony of each of the 12 transformants (see Subheading 3.4, step 19) and inoculate in 2 mL YPD + Uri liquid media. 2. Grow at ~20–24 h at 30°C with shaking. 3. Take 50 μL of the overnight culture solution and plate onto CSM-URA + 5FOA (see Note 9) plates. 4. Incubate for 2 days at 30°C. 5. Pick one colony from each plate and streak for singles on YPD + Uri plates. 6. Grow for 2 days at 30°C. These strains should include heterozygous mutants (yfg1::dpl200/YFG1) as well as mitotic recombinants that have become homozygous for the non-disrupted allele of the gene (YFG1/YFG1).

3.6. Confirmation of Heterozygous Mutants

1. Colony PCR from single colonies using 2 primers. An example of a typical colony PCR reaction is listed below: 10× PCR buffer

5 μL

5 mM dNTPs

4 μL

10 μM forward detect primer (FD1)

1 μL

10 μM reverse detect primer (RD1)

1 μL

dH2O

38.0 μL

Total volume

49.0 μL

2. Add a single colony to the PCR mixture. Retain some cells from each of the colony to be tested so that it can be further processed if the desired PCR results are obtained. 3. Before adding the tubes to the PCR block, start the program and pause it at the first step at 94°C. When the block has reached 94°C, place the tubes containing the PCR mixture and the colony over the block. Allow the thermocycler to boil the colony at 94°C for 5 min. 4. Pause the reaction again and add 1.0 μL of Taq DNA Polymerase to each tube. 5. Unpause the program again and let it run to completion (see Note 10). A typical PCR program is as follows:

2

Mini-blaster-Mediated Gene Disruption in C. albicans

29

Expected outcome FD1

YFG1 RD1

1

2 3

4

5

6

7

8 9 10 11 12 13 14 +

3.0 kb 2.0 kb 1.5 kb 1.0 kb 0.5 kb

Fig. 3. Colony PCR-based detection strategy for heterozygous mutants indicating the positions of detect primers (FD1 and RD1). Shown in the gel picture are colony PCRs from 14 independent transformants (lane 1–14). Plus indicates positive control band in the reference strains encompassing an ORF of size ~1,500 bp. Presence of the wild-type ORF band (~1,500 bp) and a gene disruption band (~750 bp) indicates a heterozygous mutant; as observed in lanes 7, 9, and 12.

Step 1

94°C for 2 min

Step 2

94°C for 45 s

Step 3

50°C for 45 s

Step 4

72°C for 3 min

Step 5

Repeat steps 2–4 35 times

Step 6

72°C for 12 min

Step 7

4°C/end.

6. Run 10 μL of the above reaction on 0.8% agarose gel containing ethidium bromide. Figure 3 shows an example of a colony PCR from disruption of one allele of a gene of size ~1,500 bp. The heterozygous mutant contains the ~1,500 bp band corresponding to the wild-type allele size (along with some the flanking upstream and downstream regions) and the disrupted allele band containing the cassette fragment of ~750 bp (see lanes 7, 9, and 12). 3.7. Creation of Homozygous Mutants

1. Use primer set 1 (F1 and R1) or primer set 2 (F2 and R2) to amplify and check the cassette as per Subheading 3.3. We use primer set 2 when we have been unable to create homozygous mutants through repeated use of primer set 1. Primer set 2 creates a PCR product that is preferentially targeted to the nondisrupted YFG1 allele in the yfg1::dpl200/YFG1 heterozygote. 2. Transform the cassette from the above step into the heterozygous strains (obtained in Subheading 3.6) as described in Subheading 3.4. Streak the transformants on CSM-URA plates for single colonies.

30

S. Ganguly and A.P. Mitchell Alternative outcome

Desired outcome

URA3 FD2 YFG1

URA3

1

2

3

4

5

6

7

RD1

+

1.5 kb 1.0 kb 0.75 kb 0.50 kb 0.25 kb

Fig. 4. Colony PCR-based detection for putative homozygous mutants indicating the positions of detect primers (FD2 and RD1). Lanes 1–7 show PCR analysis on independent colonies. Two possible situations indicated by desired and alternative outcome are shown in the diagram. In the gel picture, lanes marked 4 and 7 indicate an expected outcome situation where the previously undisrupted allele is replaced by the cassette leading to the loss of a wild-type detect band (refer to the positive control lane).

3. Perform a colony PCR to check integration of the cassette at the desired (previously undisrupted locus) using FD2 and RD1 primer sets. The absence of a wild-type band indicates a putative homozygous mutant. 4. Run 10 μL of the above reaction on 0.8% agarose gel containing ethidium bromide. Figure 4 shows an example of a colony PCR indicating integration of the cassette into a previously undisrupted locus. Loss of the ~500 bp wild-type band indicates a putative homozygote (lanes 4 and 7). Use the same colony for the next marker recycling step. Although we are relying on a negative result at this step, we will confirm our observation of a putative homozygous mutant in the next step by performing genomic DNA extractions and subsequent PCR test. 5. Follow the same instructions for marker recycling (see Subheading 3.5). The strains at this stage are predicted to be homozygous Ura− mutants. Streak for single colonies on YPD + Uri plates to prepare frozen stocks and to perform genomic DNA extractions for genotype verification. 3.8. C. albicans Genomic DNA Preparation to Confirm Homozygous Mutants

1. Inoculate 5 mL YPD or YPD + Uri liquid media with the positive homozygous strains from step 5 above and a reference strain (see Note 1). Incubate the culture overnight with agitation at 30°C.

2

Mini-blaster-Mediated Gene Disruption in C. albicans

31

2. Spin down the 5 mL culture at low speed and aspirate supernatant. 3. Add 500 μL TENTS and resuspend. 4. Transfer the resuspended mixture to a fresh microfuge tube containing 200 μL sterile acid washed beads. 5. Add 500 μL phenol/choloroform/isoamylalcohol. 6. Vortex for 2 min. 7. Spin down tubes at 5,000 × g in a benchtop microfuge at 4°C for 10 min. 8. Transfer the aqueous (top) phase to a new microfuge tube. 9. Add 1 mL 100% ethanol. 10. Place at −20°C for at least 1 h. 11. Spin down tubes at 18,800 × g at 4°C for 15 min. 12. Aspirate supernatant and resuspend in 200 μL 1× TE. 13. Add 1 μL 10 mg/mL RNase. 14. Incubate at room temperature for 30 min. 15. Add 40 μL 10 M NH4OAc. 16. Add 500 μL 100% ethanol and mix by inversion. 17. Place at −20°C for 30 min. 18. Spin down tubes at 18,800 × g for 5 min. Decant supernatant. 19. Add 1 mL 70% ethanol to the pellet and immediately decant. 20. Place tubes open in a speed vacuum for 5–10 min or until dry. 21. Resuspend pellet gently in 50 μL 1× TE (see Note 11). Dilute 1:100 (1 μL in 100 μL distilled water) to be used as template for PCR in the subsequent step. 22. Set up PCRs using the following PCR protocol. Use both forward detect primers FD1 and FD2 with reverse detect RD1, in separate reactions, to confirm a homozygous strain. 10× PCR buffer

5 μL

5 mM dNTPs

4 μL

10 μM forward detect primer (FD1)

1 μL

10 μM reverse detect primer (RD1)

1 μL

Taq DNA polymerase

0.5 μL

Genomic DNA template (1:100)

1 μL

dH2O

37.5 μL

Total volume

50 μL

32

S. Ganguly and A.P. Mitchell

A typical PCR program is as follows: Step 1

94°C for 2 min

Step 2

94°C for 45 s

Step 3

50°C for 45 s

Step 4

72°C for 3 min

Step 5

Repeat steps 2–4 35 times

Step 6

72°C for 12 min

Step 7

4°C/end.

23. Run 10 μL of the reaction on a 0.8% agarose gel containing ethidium bromide. The homozygous mutant contains the ~750 bp gene disruption band (labeled “Detect I” in Fig. 5) and lacks the control band using a forward primer (FD2) intrinsic to the gene of interest (labeled “Detect II” in Fig. 5). It should be noted that for Detect I strategy, we observe two closely spaced gene disruption bands as a second primer set F2-R2 was used to disrupt the second allele. Size differences between the double bands should be 200 bp.

Detect I

Detect II

FD1 RD1

FD2 YFG1 RD1

Detect I

1

2 3 4

5 6 7 8 + -

1

2 3 4

5 6 7 8 + -

3.0kb 1.5kb 1.0kb 0.5kb

Detect II 3.0kb 1.5kb 1.0kb 0.5kb

Fig. 5. Genomic DNA confirmation for putative homozygous mutants indicating the positions of detect primers (FD1, FD2, and RD1) in the diagram. Lanes marked 1–8 represent transformants that yielded a negative result in the previous step. Detection strategy I using primers FD1 and RD2 confirms loss of the ~1,500-bp wild-type ORF band and presence of a gene disruption band (~750 bp). Note that we observe two closely spaced gene disruption bands as a second primer set, F2–R2, was used to disrupt the second allele. Size differences between the double bands should be 200 bp. Detection strategy II using primers FD2 and RD1 additionally confirms loss of the wild-type band (~500 bp). Plus sign indicates corresponding positive controls using reference strain genomic DNA. Minus sign indicates “no template” controls.

2

3.9. PCR Amplification of the Gene of Interest Using Complementation Primers

Mini-blaster-Mediated Gene Disruption in C. albicans

33

1. A typical PCR composition to amplify the coding sequence of the gene of interest with the 5¢ and 3¢ noncoding sequences is as follows (use genomic DNA of the reference strain diluted 1:100 from Subheading 3.8 as template, see Note 4): 10× PCR buffer

5 μL

5 mM dNTPs

4 μL

10 μM forward primer (F1)

1 μL

10 μM reverse primer (R1)

1 μL

Takara Ex Taq™ polymerase

0.5 μL

Genomic DNA template (1:100)

1 μL

dH2O

37.5 μL

Total volume

50 μL

2. The PCR program is listed below (see Note 10): Step 1

94°C for 5 min

Step 2

94°C for 1 min

Step 3

56°C for 2 min

Step 4

72°C for 3 min

Step 5

Repeat steps 2–4 30 times

Step 6

72°C for 8 min

Step 7

4°C/end.

3. Check 10 μL of the PCR product on a 0.8% DNA agarose gel containing ethidium bromide to confirm a band of wild-type gene size. Store the PCR reaction at −20°C until use. 3.10. Construction of Complementation Plasmid by Homologous Recombination in S. cerevisiae and Plasmid DNA Recovery by Mechanical Disruption

1. Streak out S. cerevisiae strain BY4741Δ trp (7) for single colonies on a YPD plate. Incubate at 30°C for 2 days. 2. Culture a single colony in 5 mL YPD overnight at 30°C with agitation. 3. The following day, digest 3 μL of the pDDB78 DNA prep using the following restriction enzymes (see Note 12): Extracted plasmid DNA

3 μL

10× NE buffer 3

2 μL

100× BSA

0.2 μL

NotI

0.2 μL

EcoRI

0.2 μL

dH2O

14.4 μL

Total volume

20 μL

4. Mix gently. 5. Allow the reaction to digest for 2 h at 37°C.

34

S. Ganguly and A.P. Mitchell

Fig. 6. A restriction map of pDDB78 plasmid generated using the plasmapper program (http://wishart.biology.ualberta.ca/ PlasMapper/) indicating the location of unique restriction sites.

6. Run 10 μL of digestion reaction on an agarose gel containing ethidium bromide. Both NotI and EcoRI sites lie in the polylinker region close (Fig. 6) to each other, so a linearized vector sequence of ~7,300 bp should be apparent on the gel. Inactivate the restriction enzyme by incubating the digest at 65°C for 20 min. 7. Place 500 μL of the overnight saturated culture of strain BY4741Δ trp in each of three separate microfuge tubes. Centrifuge at 1,450 × g for 2 min and remove most of the supernatant (leave ~100 μL). Add the following to three tubes separately: 1. No DNA: 10 μL of calf thymus DNA. 2. Cut vector: add 1–3 μL of digested vector + 10 μL of calf thymus DNA. 3. Cut vector + PCR insert: add 1–3 μL of digested vector + 10 μL of calf thymus DNA + 5 μL of PCR from Subheading 3.9.

2

Mini-blaster-Mediated Gene Disruption in C. albicans

35

8. Mix gently. 9. Add 500 μL freshly made PLATE, and incubate overnight at 30°C. 10. The next day, centrifuge the tubes at 1,500 × g for 2 min, wash pellet with distilled water and plate onto CSM-TRP plates. Incubate plates at 30°C for 3 days. 11. Pick 10 colonies (more if desired) from the vector + insert plate and culture each in 5 mL CSM-TRP liquid medium at 30°C with agitation (see Note 13). The “cut vector” plate serves as a negative control in the experiment to quantitate the number of transformants obtained by transforming with the vector alone. It should have no colonies or very few colonies compared to the “cut vector plus PCR insert” plate. 12. The next day, spin down the cells, discard the supernatant, and add 250 μL resuspension solution from the GeneJET™ Plasmid Miniprep Kit (Fermentas) (see Note 14). Add the resuspended solution to a screw-cap microfuge tube containing 500 μL glass beads. 13. Vortex the screw cap tubes at top speed in a bench microfuge for 5 min to disrupt cells. 14. Add 250 μL lysis buffer, mix four to six times and incubate for 5 min. 15. Add 350 μL neutralizing buffer, mix immediately and centrifuge at top speed (~18,800 × g) for 10 min. 16. Transfer the supernatant to the filter unit provided with the kit. Centrifuge at top speed for ~30–60 s and discard the eluate in the collection unit. 17. Add 700 μL of wash solution (containing ethanol, refer to kit instructions) and centrifuge again at top speed for ~30–60 s. Discard the eluate in the collection unit. 18. Centrifuge again for 60 s to remove any residual solution on the filter. 19. Transfer the filter unit onto a fresh microfuge tube and add 30–50 μL of elution buffer. 20. Centrifuge at top speed for 1 min and store the 30–50 μL eluate in the microfuge tube at −20°C for use in subsequent step of E. coli transformation. 3.11. E. coli Transformation

1. Thaw chemically competent E. coli on ice. 2. Add 25 μL undiluted complementation plasmid from yeast preps to appropriate volume (~50 μL) of thawed E. coli. 3. Incubate on ice for 10 min. 4. Heat shock mixture at 42°C for 45 s.

36

S. Ganguly and A.P. Mitchell

5. Place on ice for 5 min. 6. Add 1 mL LB, and incubate for 1 h at 37°C with agitation. 7. Spin down cells at low speed for 1 min, decant supernatant, and resuspend cell pellet in 100 μL dH2O. 8. Spread on LB + Amp plates. Incubate overnight at 37°C. 9. Select eight white colonies, and inoculate separately into 2 mL LB + Amp liquid media. 10. Incubate overnight at 37°C with agitation. 11. Spin down cultures and extract plasmid DNA using the GeneJET™ Plasmid Miniprep Kit (Fermentas). 12. Digest the plasmids using appropriate restriction enzymes to confirm the sequence (see Note 15). 3.12. Transformation of Complementation Plasmid into C. albicans

1. Streak out the C. albicans homozygous mutant strain for single colonies on a YPD + Uri plate (see Note 6). Incubate at 30°C for 2 days. 2. Culture a single colony in 5 mL YPD + Uri liquid media overnight at 30°C with agitation until saturated. 3. The following day, dilute the sample to 1:200 in 50 mL YPD + Uri. Typically, this corresponds to an OD600 = 0.2 on our spectrophotometer. 4. Incubate the diluted culture at 30°C for 4–5 h for the cells to undergo two doublings. This would correspond to an OD600 = 0.8 if the starting OD600 was 0.2 (see Note 7). 5. Digest 10 μL of the pDDB78 DNA and the complementation plasmid separately using the following restriction enzymes (see Note 16): Extracted plasmid DNA

10 μL

10× NE buffer 3

2 μL

NruI

0.5 μL

dH2O

7.5 μL

Total volume

20 μL

6. Mix gently. 7. Incubate at 37°C for 2–4 h and confirm for linearized plasmid on an agarose gel containing ethidium bromide to confirm digestion. 8. When the C. albicans culture has reached OD600 = 0.8, pour it into a 50 mL conical tube, and spin at low speed (~1,000 × g) for 5 min. 9. Discard the supernatant, and wash the cell pellet by gently resuspending it in 5 mL sterile dH2O (do not vortex). 10. Spin at low speed for 5 min, and discard the supernatant. 11. Resuspend the cell pellet in 500 μL of LATE.

2

Mini-blaster-Mediated Gene Disruption in C. albicans

37

12. To set up C. albicans transformation reactions, add the following: LATE cell suspension

100 μL

Calf thymus DNA

10 μL

PCR reaction from Subheading 3.2

25 μL.

13. Mix gently. 14. Incubate for 30 min at 30°C. 15. Add 700 μL freshly made PLATE and incubate overnight at 30°C (see Note 8). 16. Heat shock the cell mixture at 44°C for 15 min. 17. Spin cells down for 30 s at low speed, and aspirate the supernatant. 18. Wash the cell pellet by resuspending in 1 mL YPD + Uri. 19. Spin cells down for 30 s at low speed and decant the supernatant. 20. Resuspend the cells gently in 100 μL YPD + Uri and plate on CSM-HIS plates. 21. Incubate for 2 days at 30°C. 22. Pick 12 colonies from each transformation plate, streak on CSM-HIS plates, and incubate for 2 days at 30°C. These transformants should be His + mutants and complemented for the deleted gene. Check for the absence of wild-type gene sequence (in the PDDB78-only transformants) and the presence of the wild-type gene sequence (in the complementation plasmid transformants); using colony PCR (see Subheading 3.6) and detect primer sets FD2 and RD1. Follow up with phenotypic analyses to confirm the genotype.

4. Notes 1. We typically extract genomic DNA from reference strains BWP17 (Arg− Ura− His−) (5), DAY185 (Arg+ Ura+ His+) (8), or DAY286 (Arg+ Ura+ His−) (9). 2. These primer sequences provide unique regions of homology to the undisrupted allele in a heterozygote; where one allele has been disrupted using primer set 1. Thus we designate the primers F2 and R2 as optional above (Subheading 2.1), because homozygous deletions for many genes can be accomplished simply through repeated use of F1–R1-amplified PCR products. 3. Plasmid DNA can be extracted and purified using several methods or several commercially available kits depending on

38

S. Ganguly and A.P. Mitchell

the number of samples. For our purpose, the GeneJET™ Plasmid Miniprep Kit (Fermentas) works well. 4. We have used the high-fidelity Takara Ex Taq™ DNA polymerase (with proof-reading activity) in two instances for the amplification of the mini-blaster cassette and the disrupted gene of interest (for complementation purposes). Any other highfidelity DNA polymerase of choice could be used. For all other detect PCR reaction described in the paper, we recommend the use of Taq DNA polymerase due to cost considerations. For our detection PCRs on colony PCR and genomic DNA preps, the Taq DNA Polymerase from Denville Scientific was used. 5. The PCR reaction is optimal to amplify the mini-blaster cassette. The PCR reaction produces ~2,000-bp long cassette with a background loop-out product of ~750 bp size. We do not perform PCR extraction/purification as long as the ~2,000-bp long band is present. 6. C. albicans strains that are Ura− (with the essential URA3 gene disrupted) require supplementation with uridine at 80 mg/l because disruption of URA3 blocks the ability to synthesize uridine. Supplementation with uracil, which is typical for S. cerevisiae media recipes, is not adequate for C. albicans Ura− cell growth. 7. The doubling time of C. albicans is ~1.5 h. 8. Incubating transformations in PLATE for greater than 16 h significantly reduces the transformation efficiency. 9. 5-FOA plates should be freshly prepared and kept in the dark at 4°C until use. It is advisable to pick and streak colonies onto YPD plates after a maximum of 2–3 days of incubation on 5-FOA at 30°C. 10. This is a generalized PCR program that works for most C. albicans ORFs less than 4 kb in length. Larger ORFs may require longer extension times. 11. We try to avoid shearing genomic DNA by limiting vortexing. 12. The restriction sites for NotI and EcoRI lie in the polylinker sequence of the pDDB78 plasmid; simultaneous digestion with these enzymes linearizes the plasmid which promotes in vivo homologous recombination with the PCR product in the S. cerevisiae strain. 13. S. cerevisiae strains bearing episomal plasmids need to grown in selective conditions (CSM-TRP) to retain the plasmid. 14. We have used the modified GeneJET™ Plasmid Miniprep Kit (Fermentas) protocol to recover plasmids from S. cerevisiae cells. However, other commercially available kits or user developed protocols with other plasmid DNA prep kits may be used.

2

Mini-blaster-Mediated Gene Disruption in C. albicans

39

15. Refer to the pDDB78 plasmid map to select restriction enzymes. For other vectors, use appropriate enzymes keeping in mind the gene sequence and the vector sequence. If your gene of interest has an NruI site in the sequence, use vector pRYS2 digested with SrfI for complementation (10). 16. The purpose of digesting both the complementation vector and the backbone vector (pDDB78) is to make both the complemented and the mutant strain His + for downstream analysis. 100× BSA is not required for NruI activity.

Acknowledgments This work was supported by NIH grant R01 AI067703 to APM. We thank Dr. Carol A. Woolford for her comments on this chapter. References 1. Berman J, Sudbery PE (2002) Candida albicans: a molecular revolution built on lessons from budding yeast. Nat Rev Genet 3: 918–930. 2. Wilson RB, Davis D, Enloe BM, Mitchell AP (2000) A recyclable Candida albicans URA3 cassette for PCR product-directed gene disruptions. Yeast 16: 65–70. 3. Alani E, Cao L, Kleckner N (1987) A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116: 541–545. 4. Fonzi WA, Irwin MY (1993) Isogenic strain construction and gene mapping in Candida albicans. Genetics 134: 717–728. 5. Wilson RB, Davis D, Mitchell AP (1999) Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181: 1868–1874. 6. Spreghini E, Davis DA, Subaran R, Kim M, Mitchell AP (2003) Roles of Candida albicans Dfg5p and Dcw1p cell surface proteins in

7.

8.

9.

10.

growth and hypha formation. Eukaryot Cell 2: 746–755. Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, et al. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCRmediated gene disruption and other applications. Yeast 14: 115–132. Davis D, Edwards JE, Jr., Mitchell AP, Ibrahim AS (2000) Candida albicans RIM101 pH response pathway is required for host-pathogen interactions. Infect Immun 68: 5953–5959. Davis DA, Bruno VM, Loza L, Filler SG, Mitchell AP (2002) Candida albicans Mds3p, a conserved regulator of pH responses and virulence identified through insertional mutagenesis. Genetics 162: 1573–1581. Rauceo JM, Blankenship JR, Fanning S, Hamaker JJ, Deneault JS, et al. (2008) Regulation of the Candida albicans cell wall damage response by transcription factor Sko1 and PAS kinase Psk1. Mol Biol Cell 19: 2741–2751.

Chapter 3 Rapid Detection of Aneuploidy Following the Generation of Mutants in Candida albicans Megan D. Lenardon and André Nantel Abstract Techniques used to generate mutants in Candida albicans commonly result in additional and undesired genetic rearrangements. Detection of aneuploidy is, therefore, an important step forward in the quality control of mutant phenotypes. In this chapter, we describe how to extract genomic DNA and perform a quantitative multiplex PCR to compare the karyotype of any mutant strain to that of its parent and allow the detection of any unwanted aneuploidy. Key words: Aneuploidy, Karyotype, Chromosome structure, Multiplex PCR, Mutant

1. Introduction In the post-genome era, Candida albicans researchers have compiled a growing body of evidence for the widespread occurrence of aneuploidy in C. albicans laboratory strains (reviewed in Rustchenko (1) and Selmecki et al. (2)). Chromosomal instability has been demonstrated in C. albicans strains grown in various conditions. For example, cells grown on L-sorbose tend to lose a copy of chromosome 5 (3), growth on D-arabinose promotes trisomy of chromosome 6 (4), and exposure to 5-fluroorotic acid causes the loss of chromosome 1 (5). Some of the more commonly used laboratory strains of C. albicans also have known karyotypic differences when compared with the reference strain, SC5314. For example, CAI-4 can have an extra copy of chromosome 1, chromosome 2, or both (5, 6), and BWP17 has a deletion in the right arm of chromosome 5 (6). Different stocks of the same strain also exhibit karyotypic differences. For example, Ahmad et al. (7) reported changes in the size and ploidy of chromosome R and chromosome 1 in different stocks of SC5314 and its derivative CAI-4. Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_3, © Springer Science+Business Media, LLC 2012

41

42

M.D. Lenardon and A. Nantel

Aneuploidy can also be created during the routine construction of C. albicans mutant strains. Arbour et al. (8) analyzed over 100 published and unpublished microarray data sets comparing mutant strains to their parents. The results revealed a significant chromosomal bias, indicating that aneuploidies occur frequently during the production of recombinant C. albicans mutant strains. In addition, Bouchonville et al. (9) performed a retrospective analysis of 411 expression array experiments and reported that a high frequency of chromosome number changes occurred in strains that had been transformed with DNA. This is a major cause of concern as it raises the possibility of unintended phenotypic consequences, including those relating to virulence (8). Traditional methods for detecting aneuploidy such as pulse-field gel electrophoresis and contour-clamped homogeneous electrical field (CHEF) gels can be technically challenging (see Selmecki et al. (2) for a review of these techniques). In this chapter, we describe a method for the extraction of genomic DNA from C. albicans and a rapid test for aneuploidy (8). This test is based on a quantitative multiplex PCR assay that produces eight bands of distinct sizes from the left and right arms of each C. albicans chromosome. It can be performed quickly and easily to detect any unwanted karyotypic anomalies in newly generated C. albicans mutant strains before they are used in further experiments.

2. Materials 2.1. Genomic DNA Extraction

1. Lysis solution: 2% (v/v) Triton X-100, 1% (w/v) SDS, 100 mM NaCl, 10 mM Tris–HCl pH 7.4, 1 mM Na2EDTA pH 8.0. 2. Acid-washed glass beads (see Note 1). 3. Phenol:chloroform:isoamyl alcohol (25:24:1) (see Note 2). 4. TE: 10 mM Tris–HCl pH 7.4, 1 mM Na2EDTA pH 8.0. 5. Chloroform. 6. 100% Ethanol. 7. RNase A (10 mg/mL). 8. 3 M Sodium acetate, pH 5.2.

2.2. Test for Aneuploidy

1. QIAGEN® Multiplex PCR Kit (see Note 3). 2. PCR primers: The DNA sequences of the PCR primers and expected product sizes are listed in Table 1. Prepare a master mix for both primer Set A and Set B with the final concentration of each primer at 3.125 μM (25×) (see Note 4). 3. Agilent DNA 7500 Kit (see Note 5). 4. Agilent 2100 Bioanalyzer.

Set A (left arm)

F: ACTTGTACGGCTGGAAAAACT R: GCCAAGTATGAGAGGGTTGAT

F: CGAGTTAAACTTTCGGTTTCC R: ATTGAGGGATTGAACAAGGAG

F: ATGCTCCTGTAATACGCTCCT R: GCTCACACAATCCAACCATAG

F: CACAGAGATGACAGAACACCC R: CTTGATCCCCACCATAGACTT

F: TGACAACATTGGAGATGGTCT R: AGATTTCGAATCACGCTTTTT

F: ACATCATCCTGTAACGCCATA R: CAGGTCAACTCAACTTCCAGA

F: GTCATTCCGAATCTCAAACCT R: TGAAAAGTGCAGGAGAATCAC

F: CCAATATACCCCAATCCAAAC R: AAAGACTTGTTCCACCTCACC

Chromosome

1

2

3

4

5

6

7

R

1430

1153

925

742

588

F: ATTTGGTAGAAGATCGATGGG R: AAGACAACAACGAAGATGCTG

F: AAGTATGCAATTTCTTTGGGG R: TCCTCAGCCTGTTTGTAGTTG

F: TGCGTCTAGATACAACAAGGC R: ACTTGGCATCAACTTCCTTCT

F: CGGTCATGTATTTGATTACGG R: TATCTGCAGACGACTACCCAG

F: GATTTGCGGTGGTTTATTTTT R: AAACTAGTCTACCCTGCCGAA

F: CATGTTTTAGTTGGTCGATGG R: GTAACCGACAAACTCCATGTG

F: TCCTTCTGGCCCTTCTAAGTA R: AAGAGTGAGCTTGTTCTGGGT

383 478

F: CAACTGCCAAACTAGTTCCAA R: TGTTGGTGTTTTACCGTGTTT

Set B (right arm)

301

Product size (bp)

Table 1 Primer sequences used in the multiplex PCR aneuploidy detection assay

1438

1151

917

741

593

471

375

305

Product size (bp)

3 Rapid Detection of Aneuploidy 43

44

M.D. Lenardon and A. Nantel

3. Methods 3.1. Isolation of C. albicans Genomic DNA

1. Prepare a 10 mL overnight culture of each mutant strain and its parent strain in appropriate medium. 2. Harvest cells at 3,350 × g for 4 min. Discard the supernatant. 3. Resuspend cells in 0.2 mL lysis solution and transfer to a 1.5 mL screw-cap tube. 4. Add 0.2 mL acid-washed glass beads and 0.2 mL phenol:chloroform:isoamyl alcohol (see Note 6). 5. Vortex tubes 1 min (see Note 7). 6. Add 0.2 mL TE, mix briefly, and centrifuge for 5 min at 16,000 × g in a microfuge. 7. Transfer the aqueous layer to a new 1.5 mL tube containing 0.2 mL chloroform (see Note 8). Invert the tubes several times and centrifuge for 5 min at 16,000 × g in a microfuge. 8. Repeat step 7. 9. Transfer the aqueous layer to a new tube. 10. Add 1 mL 100% ethanol and invert tubes several times. Centrifuge for 2 min at 16,000 × g. 11. Discard the supernatant and air dry the pellet (see Note 9). 12. Resuspend the pellet in 0.4 mL TE. Add 3 μL RNase A and incubate at 37°C for 5 min. 13. Precipitate the DNA by adding 10 μL 3 M sodium acetate and 1 mL 100% ethanol. Mix well and incubate tubes for 1 h at −80°C, or overnight at −20°C. 14. Centrifuge tubes for 2 min 16,000 × g. Discard the supernatant and air dry the DNA pellet. 15. Resuspend the DNA in 50 μL TE.

3.2. Multiplex PCR Aneuploidy Detection Assay

1. Thaw the 2× QIAGEN Multiplex PCR Master Mix, genomic DNA templates and 25× primer mixes (Set A and Set B). Mix the solutions well before use (see Note 10). 2. Prepare two lots of 1× reaction mix, one containing primer Set A and the other containing primer Set B. Individual reactions contain 25 μL 2× QIAGEN Multiplex PCR Master Mix, 2 μL 25× primer Set A or Set B, and 21 μL dH2O (see Note 11). 3. Mix the 1× reaction mixes well and aliquot 49 μL into 0.2 mL PCR tubes. 4. For each strain to be analyzed, add 2 μL purified genomic DNA template to a tube containing the 1× reaction mix

3

Rapid Detection of Aneuploidy

45

containing primer Set A, and 2 μL template to a tube containing the 1× reaction mix with primer Set B (see Note 12). 5. Place the PCR tubes in a thermal cycler and run with an initial heat-activation step of 95°C for 15 min (see Note 13), 23 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 90 s, and extension at 72°C for 45 s, followed by final extension at 72°C for 7 min (see Note 14). 6. Load 1 μL of each PCR reaction into the wells of an Agilent DNA 7500 Lab Chip and separate the DNA fragments by microcapillary electrophoresis using an Agilent 2100 Bioanalyzer (see Note 15). 7. Calculate the relative ratio of the peak height of the DNA fragments of the mutant and its parent strain in the resulting electropherograms (see Note 16). 8. Divide the ratio for each chromosome by the median of the ratio for all chromosomes. A log2 ratio of > ± 0.2 is considered to be significant and indicative of aneuploidy (see Notes 17 and 18).

4. Notes 1. Glass beads should be approximately 500 μm in diameter. 2. A fresh mixture should be prepared immediately prior to use. Phenol is toxic and corrosive and will cause severe burns if it comes into contact with skin. Wear a lab coat, gloves, eye protection and work in a fume hood. The phenol should be equilibrated in Tris–HCl at pH 8.0 and stored −20°C in the dark. Chloroform is harmful by inhalation. As with phenol, wear a lab coat, gloves, eye protection and work in a fume hood. Chloroform should be stored at room temperature in the dark in a well-ventilated cupboard. 3. QIAGEN catalogue number 206143. 4. Resuspend individual lyophilized PCR primers to a concentration of 100 μM in dH2O. The 25× master mixes are then prepared by mixing 2 μL each primer in each set (16 primers per set) and 32 μL dH2O, giving a final volume of 64 μL. 5. Agilent catalogue number 5067-1506. 6. Perform steps 4–9 in a fume hood. Be careful not to trap any glass beads under the lid as they will interfere with the seal. 7. For optimal breakage of cells, vortex no more than two tubes at once. 8. The aqueous layer is the top layer. Be careful not to disturb the interface between the two layers.

46

M.D. Lenardon and A. Nantel

9. Samples can be air dried in a SpeedyVac drier or by simply leaving the tubes open on the bench. A good indication that the pellets are dry is that you can no longer smell the ethanol. 10. It is not necessary to keep the samples on ice during set-up since the polymerase is not activated until heated at 95°C for 15 min. 11. Prepare enough of each 1× reaction mix for the number of samples to be analyzed. 12. Each multiplex PCR should contain 1–50 ng purified genomic DNA. The specific amount must be evaluated by each individual laboratory. In our hands, either a 1/20 or 1/40 dilution of genomic DNA prepared using the method described in Subheading 3.1 works well. 13. The HotStarTaq DNA polymerase is activated by the initial heat-activation step. 14. Samples can be stored at 4°C overnight or at −20°C for longterm storage. 15. Agilent produces detailed instructions with pictures describing this procedure. We follow the manufacturer’s instructions exactly as written. 16. Following the completion of the run, switch to the “Data” context of the 2100 Expert Bioanalyzer software. View the electropherograms from each sample by clicking on the “Electropherograms” tab. If necessary, adjust the peak height threshold so that the eight peaks corresponding to the PCR product from each chromosome are automatically detected. This can be done by changing the “Height threshold” under the “Integrator Settings” heading in the “Assay Properties” menu. To change the display settings so that the peak heights are displayed in the data table below the electropherogram as shown in the example data for Sample 2 (mutant) and Sample 3 (parent) (Fig. 1a, b), check the “Peak Description” box under the “Electropherogram” menu. 17. Table 2 shows an example of the calculations comparing Sample 2 (mutant) to Sample 3 (parent) (Fig. 1a, b). 18. Alternatively, the electropherograms for each sample can be scaled and compared visually using image processing software such as Adobe Photoshop. To facilitate this type of visual analysis, change the display settings to show all electropherograms and then save the image as a .tif file. An example comparing Sample 2 (mutant) to Sample 3 (parent) is shown in Fig. 1c.

3

Rapid Detection of Aneuploidy

47

Fig. 1. Comparison of the left arms of the chromosomes of a mutant strain (Sample 2) to its parent strain (Sample 3). The PCR products generated in multiplex PCR reactions with primer Set A were separated by microcapillary electrophoresis using an Agilent DNA 7500 Lab Chip and Agilent 2100 Bioanalyzer. (a) Chromatogram and peak data for Sample 2. (b) Chromatogram and peak data for Sample 3. These data were used in the example calculations shown in Table 2. (c) Visual comparison of the scaled electropherograms from Sample 2 (mutant) and Sample 3 (parent). Arrows indicate that that the mutant strain (Sample 2) has an extra copy of the left arms of chromosomes 6 and 7 compared to its parent strain (Sample 3).

383

478

588

742

925

1,153

1,430

2

3

4

5

6

7

R

8.0

10.0

7.2

6.6

6.3

8.7

9.8

7.1

Peak heights for Sample 2

5.8

5.3

4.0

4.8

4.8

6.9

7.5

6.0

Peak heights for Sample 3

Median = 1.344c

1.379

1.887

1.800

1.375

1.313

1.261

1.307

1.183

Ratio (Sample 2:Sample 3)

1.026

1.404

1.340

1.023

0.977

0.938

0.972

0.881

Ratio/median

0.038

0.490b

0.422b

0.033

−0.034

−0.092

−0.040

−0.183

log2

On any given run, the actual PCR product sizes determined by the Bioanlalyzer software (2100 Expert) may differ slightly from the predicted PCR product sizes. This is usually by no more than 10 bp or so b The mutant strain (Sample 2) has an extra copy of the left arm of chromosome 6 and 7 compared to its parent strain (Sample 3) c The median of eight values is calculated by arranging the values in order (1.183, 1.261, 1.307, 1.313. 1.375, 1.379, 1.800, 1.887) and then taking the average of the 4th and 5th values ((1.313 + 1.375)/2 = 1.344)

a

301

Predicted product size (bp) a

1

Chromosome

Table 2 Example calculations for determining aneuploidy based on peak heights for Sample 2 (mutant) and Sample 3 (parent) using primer Set A (left arm of each chromosome)

48 M.D. Lenardon and A. Nantel

3

Rapid Detection of Aneuploidy

49

Acknowledgments M. Lenardon is supported by a project grant from the Wellcome Trust (086827). References 1. Rustchenko, E. (2007) Chromosome instability in Candida albicans. FEMS Yeast Res 7(1), 2–11 2. Selmecki A, Forche A and Berman J (2010) Genomic plasticity of the human fungal pathogen Candida albicans. Eukaryot Cell 9(7):991–1008 3. Kabir MA, Ahmad A, Greenberg JR, Wang YK and Rustchenko E (2005) Loss and gain of chromosome 5 controls growth of Candida albicans on sorbose due to dispersed redundant negative regulators. Proc Natl Acad Sci USA 102(34):12147–12152 4. Rustchenko EP, Howard DH and Sherman F (1994) Chromosomal alterations of Candida albicans are associated with the gain and loss of assimilating functions. J Bacteriol 176(11): 3231–3241 5. Chen X, Magee BB, Dawson D, Magee PT and Kumamoto CA (2004) Chromosome 1 trisomy compromises the virulence of Candida albicans. Mol Microbiol 51(2):551–565

6. Selmecki A, Bergmann S and Berman J (2005) Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol Microbiol 55(5): 1553–1565 7. Ahmad A, Kabir MA, Kravets A, Andaluz E, Larriba G and Rustchenko E (2008) Chromosome instability and unusual features of some widely used strains of Candida albicans. Yeast 25(6):433–448 8. Arbour M, Epp E, Hogues H, Sellam A, Lacroix C, Rauceo J, Mitchell A, Whiteway M and Nantel A (2009) Widespread occurrence of chromosomal aneuploidy following the routine production of Candida albicans mutants. FEMS Yeast Res 9(7):1070–1077 9. Bouchonville K, Forche A, Tang KE, Selmecki A and Berman J (2009) Aneuploid chromosomes are highly unstable during DNA transformation of Candida albicans. Eukaryot Cell 8(10): 1554–1566

Chapter 4 Agrobacterium-Mediated Insertional Mutagenesis in Histoplasma capsulatum Olga Zemska and Chad A. Rappleye Abstract Genome-wide mutagenesis is a powerful method for identifying new genes that contribute to a phenotype of interest. For many fungal pathogens of plants and animals, Agrobacterium tumefaciens-mediated transformation (ATMT) serves as an efficient insertional mutagen. In Histoplasma capsulatum, the T-DNA element transferred by Agrobacterium stably integrates into the genome, and the majority of mutants contain single copies of the inserted sequence. The T-DNA sequence facilitates the determination of the genomic sequence flanking the insertion through hemi-specific PCR techniques, plasmid rescue, or inverse PCR. We present optimized procedures for generating insertional mutants in H. capsulatum using Agrobacterium-mediated transformation and using this for forward and reverse genetic approaches. Key words: Agrobacterium tumefaciens-mediated transformation, Insertional mutagenesis, T-DNA, Forward genetics, Thermal asymmetric interlaced PCR, Histoplasma capsulatum, Fungal pathogen

1. Introduction Disruption of gene function is essential in defining the factors that contribute to the phenotype of an organism. For both forward and reverse genetics, success relies heavily on an efficient mutagen and, in a system where insertion occurs at random loci, the ability to identify the mutated locus. In the system described, the insertional mutagen imparts the advantage of tagging the mutation such that the nucleotide sequence flanking a random insertion can be rapidly determined and the disrupted gene identified. The plant pathogen Agrobacterium tumefaciens is capable of transforming many non-plant species through the transfer of a segment of DNA (transfer-DNA; T-DNA) from the bacterium into the host chromosome (1). Transfer of the T-DNA requires type IV

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_4, © Springer Science+Business Media, LLC 2012

51

52

O. Zemska and C.A. Rappleye

pili contact between the bacterium and the target cell (2). A series of Vir proteins expressed by Agrobacterium initiate T-DNA transfer and production of these Vir proteins (and thus T-DNA transfer) is induced by phenolic compounds produced by wounded plant cells (3). The subsequent integration of transferred sequences into the target genome has led to the development of this system as an insertional mutagen for many fungi including Histoplasma capsulatum (4, 5). Agrobacterium bacteria harboring a T-DNA element engineered to carry an appropriate selection marker (e.g., hygromycin resistance) are cocultured with Histoplasma yeast and supplementation of the media with the vir gene stimulant, acetosyringone, induces the transfer functions (6, 7). After allowing sufficient time for transfer to occur, insertional mutants are obtained by moving the Agrobacterium-Histoplasma coculture to mediacontaining antibiotics to select for T-DNA-bearing cells and counterselect further growth of Agrobacterium. We describe here procedures for generating and identifying insertional mutants in Histoplasma yeast using Agrobacterium tumefaciens-mediated transformation (ATMT). The majority of T-DNA integrations into the Histoplasma genome are single copy (5) and the location of the chromosomal lesion can be determined by comparison of sequences flanking the integrated T-DNA element with the sequence of the Histoplasma genome. Inverse PCR, plasmid rescue, and thermal asymmetric interlaced PCR (TAIL-PCR) have all been successfully used to identify the genes disrupted by T-DNA insertion in Histoplasma (8–11). For TAIL-PCR, amplicons are anchored by a T-DNAspecific forward primer and a degenerate reverse primer that can bind in the region flanking the insertion site (12). Specific PCR products are obtained by alternating high-stringency and lowstringency cycles that allow the T-DNA-specific primer and the degenerate primer to bind, respectively (13). A secondary TAILPCR reaction is performed using the primary reaction as template and a nested T-DNA-specific forward primer (see Fig. 1a). Sequencing of the TAIL-PCR amplicons with a third nested T-DNA-specific forward primer determines the DNA sequence flanking the insertion site which is then compared to the Histoplasma genome sequence. ATMT-based insertional mutagenesis of Histoplasma is also effective for reverse genetics through the creation of mutant libraries that can be screened for T-DNA insertions in specific genes of interest by PCR (14). Pools of insertion mutants are created and part of the yeast population is stored as a frozen bank and part is used for the isolation of DNA. The nucleic acids representing each pool are screened for the presence of a T-DNA element in the targeted region. A nested set of gene-specific primers is used in conjunction with T-DNA primers specific for the left border and right border ends of the T-DNA element (see Fig. 2a). Performance of

4

T-DNA Mutagenesis of Histoplasma

53

Fig. 1. Use of TAIL-PCR to determine the site of T-DNA insertion. (a) The schematic depicts the insertion of T-DNA element in a region of the Histoplasma genome. Half arrows depict the relative locations of the left border T-DNA-specific primers LB6, LB7, and LB8 used for 1° TAIL-PCR, 2° TAIL-PCR, and amplicon sequencing, respectively. A long degenerate primer (LAD1, LAD2, LAD3, or LAD4) binds in the flanking sequence. The left border primers are specific for the T-DNA element carried on vector pCM41. (b) Ethidium bromide-stained agarose gel shows an example of 1° and 2° TAIL-PCR performed on a T-DNA insertion mutant of Histoplasma. Positive PCR amplicons are produced with the LAD1 degenerate primer.

a nested secondary PCR reaction provides increased sensitivity and eliminates false positives. Once a candidate is found, the mutant is recovered from the frozen pool of yeast cells by successively subdividing the population and screening isolates by PCR.

2. Materials All reagents are prepared with ultrapure water (deionized water purified to attain a resistance of 18 MΩ and no more than 10 ppb organic carbon) and stored at room temperature unless otherwise noted. 2.1. H. capsulatum Growth Media and Supplements

1. Histoplasma-macrophage medium (HMM): 1× Ham’s F-12 Nutrient Mix, 1.5% glucose, 5 mM glutamic acid, 0.7 mM cystine, 25 μM FeSO4, 20 mM HEPES, pH 7.2, 0.6% agarose. Dissolve 6 g of agarose (see Note 1) in 500 mL H2O in a 1 L beaker and autoclave for 20 min at 121°C to sterilize.

54

O. Zemska and C.A. Rappleye

Fig. 2. Screening of insertion mutants for disruptions in a gene of interest. (a) The schematic shows a T-DNA element that has inserted into a gene of interest. Half arrows depict the right border (RB primers) or left border (LB primers) used in conjunction with 1° and 2° gene-specific primers (GSPs). The 1° PCR reaction utilize RB3 or LB6 with 1°GSP and this reaction is used as template for a 2° PCR reaction employing RB6 or LB8 with the 2°GSP primer. Production of PCR amplicons indicates a T-DNA element is located near the genespecific primers in the targeted locus. (b) The schematic depicts the strategy to subdivide a positive pool of insertion mutants. Yeast contained in each row and column of a 96-well plate are pooled and PCR performed on these subpools is used to identify the address of the well containing yeast with the insertion in the targeted locus.

Cool agarose to 60°C. Dissolve 10.6 g of F-12 Nutrient Mix, 15 g glucose, 1 g glutamic acid, and 4.8 g HEPES in 400 mL of H2O. Add 10 mL of 100× cystine and adjust pH to 7.2 with NaOH. Bring volume to 500 mL with H2O. Add 5 mL of 5 mM FeSO4 solution and sterilize by filtration through a 0.2μm pore membrane. Aseptically combine Nutrient Mix solution with agarose solution, pour into petri dishes, and leave until solidified. For liquid HMM medium, omit agarose and combine components in a total volume of 1 L prior to sterilization by filtration through a 0.2-μm pore membrane. Store media at 4°C. Before use with Histoplasma, warm plates and liquid HMM to 37°C.

4

T-DNA Mutagenesis of Histoplasma

55

2. 100× Cystine (70 mM): Dissolve 4.2 g cystine in 250 mL 0.5 M HCl and add to 250 mL of H2O. Store at room temperature. 3. 200× FeSO4 (5 mM): Dissolve 14 mg of FeSO4⋅7H2O in 10 mL of H2O (see Note 2). 2.2. Agrobacterium Growth Media and Supplements

1. 20× AB salts: 370 mM NH4Cl, 25 mM MgSO4, 40 mM KCl, 1.8 mM CaCl2, 0.18 mM FeSO4. Dissolve 20 g NH4Cl, 6 g MgSO4⋅7H2O, 3 g KCl, 0.2 g CaCl2, and 50 mg FeSO4⋅7H2O in 1 L of H2O. Autoclave and store at 4°C for up to 6 months. 2. 20× AB buffer: 344 mM K2HPO4, 166 mM NaH2PO4. Dissolve 78.6 g K2HPO4⋅3H2O and 20 g NaH2PO4 in 1 L H2O. The pH should be about 7.0. Autoclave to sterilize. 3. LC medium: 0.8% NaCl, 1.0% tryptone, 0.5% yeast extract, pH 7.0. Dissolve 8 g NaCl, 10 g tryptone, and 5 g yeast extract in 1 L of H2O and adjust pH with 1 M NaOH. Add 1% agar for solid medium. Autoclave 20 min at 121°C to sterilize. For solid media, cool to 60°C, add appropriate antibiotics, and pour into petri dishes. Store at 4°C. 4. Minimal glucose medium (MGM): 1× AB salts, 1× AB buffer, 0.5% glucose. Dissolve 1 g glucose in 180 mL H2O and autoclave. Aseptically, add 10 mL 20× AB salts and 10 mL 20× AB buffer when cool. Store at 4°C. 5. Induction medium (IM): 1× AB salts, 0.5% glucose, 5 mM KH2PO4, 40 mM 4-Morpholineethanesulfonic acid (MES), pH 5.3, 0.1 mM acetosyringone. Dissolve 1 g Glucose, 0.14 g KH2PO4, and 1.6 g MES in 150 mL H2O. Adjust pH to 5.3 with KOH. Add 10 mL 20× AB salts and bring volume to 200 mL with H2O. Filter sterilize through 0.2-μm pore membrane. Before use add acetosyringone to 0.1 mM. 6. 0.2 M Acetosyringone: Dissolve 0.2 g of acetosyringone (3¢,5¢-dimethoxy-4¢-hydroxyacetophenone) in 5 mL DMSO. Divide into 200 μL aliquots and store at −20°C. 7. Kanamycin (100 mg/mL): Dissolve 3.8 g kanamycin sulfate (650 μg/mg) in 25 mL of H2O. Filter sterilize using syringe filter. Divide into 1 mL aliquots and store at −20°C. 8. Spectinomycin (125 mg/mL): Dissolve 2.5 g of spectinomycin dihydrochloride pentahydrate in 20 mL of H2O. Filter sterilize using syringe filter. Divide into 1 mL aliquots and store at −20°C.

2.3. Cocultivation Medium

1. Cocultivation plates: 1× AB salts, 0.5% glucose, 5 mM KH2PO4, 0.7 mM cystine, 10 μM FeSO4, 40 mM MES, pH 5.3, 0.1 mM acetosyringone. Dissolve 3 g of agarose (see Note 1) in 250 mL H2O in a 500 mL beaker and autoclave to sterilize. Cool agarose to 60°C. Dissolve 2.5 g glucose, 0.34 g KH2PO4, and 3.9 g MES in 175 mL H2O. Adjust pH to 5.3 with KOH. Add 25 mL 20× AB salts, 5 mL of 100× cystine, 2.5 mL of 200× FeSO4 and bring up volume to 250 mL with H2O. Add 0.5 mL

56

O. Zemska and C.A. Rappleye

of 0.2 M acetosyringone and filter sterilize through 0.2-μm pore membrane. Aseptically combine solution with agarose solution and pour into 6- or 10-cm diameter petri dishes. When solidified, store at 4°C. Warm plates to room temperature prior to use. 2. Membranes for coculture growth of microorganisms (see Note 3). Use appropriate diameter membrane filters for the petri dishes used. Sterilize membranes by wrapping in aluminum foil and autoclaving 20 min at 121°C. 2.4. Transformant Selection

1. Selection medium (HMM + hygromycin): 1× Ham’s F-12 Nutrient Mix, 1.5% glucose, 5 mM glutamic acid, 0.7 mM cystine, 25 μM FeSO4, 20 mM HEPES, pH 7.2, 150 μg/mL hygromycin B, 200 μM cefotaxime, 0.2% Histoplasmaconditioned medium, 0.6% agarose. Dissolve 6 g of agarose (see Note 1) in 500 mL H2O in a 1 L beaker and autoclave 20 min at 121°C to sterilize. Cool agarose to 60°C. Dissolve 10.6 g of F-12 Nutrient Mix, 15 g glucose, 1 g glutamic acid, and 4.8 g HEPES in 400 mL of H2O. Add 10 mL of 100× cystine and adjust pH to 7.2 with NaOH. Bring volume to 489 mL with H2O. Add 5 mL of 5 mM FeSO4, 3 mL of 50 mg/ mL hygromycin B, 1 mL of 200 mM cefotaxime, and 2 mL of Histoplasma-conditioned medium. Filter sterilize through 0.2-μm pore membrane. Aseptically combine Nutrient Mix solution with agarose solution, pour into petri dishes, and cool to solidify. Store at 4°C. Warm plates to 37°C prior to use. 2. 50 mg/mL hygromycin B solution: Divide stock solution in PBS into 2 mL aliquots and store at 4°C. 3. 200 mM Cefotaxime: dissolve 477 mg of Cefotaxime (>95% pure) in 5 mL H2O. Filter sterilize by passing through a 0.2μm pore membrane and store at −20°C. 4. Histoplasma-conditioned medium: Grow Histoplasma in liquid HMM to stationary phase and remove cells by centrifugation (10 min at 1,000 × g). Filter growth medium through a 0.2-μm pore membrane and divide into 5 mL aliquots. Store at −20°C.

2.5. TAIL-PCR

1. DNA isolation buffer: 100 mM NaCl, 5 mM EDTA, 1% Triton X-100, 20 mM Tris, pH 8.0. To 80 mL of H2O, add 2 mL 5 M NaCl, 1 mL 0.5 M EDTA, 2 mL 1 M Tris, pH 8.0, and 5 mL 20% Triton X-100. 2. 5 M NaCl: dissolve 29.22 g NaCl in 100 mL H2O. Sterilize by autoclaving 20 min at 121°C. 3. 0.5 M EDTA: Dissolve 18.61 g ethylenediamine tetraacetic acid in 70 mL H2O. Adjust pH to 8.0 with drops of 10 M NaOH to get EDTA into solution. Bring up volume to 100 mL with H2O and sterilize by autoclaving 20 min at 121°C.

4

T-DNA Mutagenesis of Histoplasma

57

4. 1 M Tris 8.0: Dissolve 12.1 g Trizma base (Tris-hydroxymethylaminomethane) in 75 mL of H2O. Adjust pH to 8.0 with HCl. Bring up volume to 100 mL with H2O and sterilize by autoclaving 20 min at 121°C. 5. 20% Triton X-100: Using a syringe, add 20 mL of Triton X-100 (t-Octylphenoxypolyethoxyethanol) to 80 mL of H2O. Mix with gentle stirring until homogeneous solution is obtained. 6. 2.0 mL Screw-top cap microfuge tubes with O-rings (nonsterile). 7. 400 to 600-μm diameter, acid-washed glass beads. 8. PCI (phenol:chloroform:isoamyl alcohol 25:24:1). Obtain ready mixed phenol:chloroform:isoamyl alcohol and buffer to pH 8.0 by adding 1/20 volume of 10 mM Tris pH 8.0. Mix well and allow phases to separate overnight at 4°C. Store at 4°C. 9. 3 M Sodium acetate. Dissolve 40.8 g of sodium acetate • 3H2O in 80 mL of H2O. Adjust pH to 5.2 with glacial acetic acid. Bring the final volume to 100 mL. 10. 100% Ethanol (200 proof). 11. 70% Ethanol: Mix 70 mL of ethanol (200 proof) with 30 mL of H2O. 12. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0. Add 1 mL of 1 M Tris, pH 8.0 and 0.2 mL of 0.5 M EDTA to 98.8 mL H2O. 13. T-DNA-specific primers and long degenerate primers (LAD primers) for TAIL-PCR (see Note 4 and Table 1). 14. ExoSAP-IT reagent (USB). 2.6. Targeted Gene Disruption Screening

1. 5× Histoplasma freezing solution: 60% HMM/40% DMSO. To 12 mL of HMM, add 8 mL high-quality DMSO. Sterilize by filtration through a 0.2-μm pore membrane and store at 4°C. 2. Cryogenic freezing vials: capacity 1–1.5 mL. 3. 96-Well, flat bottom, polystyrene plates with lids (sterile). 4. Gene-specific primers (1° GSP and 2° GSP) and T-DNA primers to screen for insertions in the gene of interest. Design genespecific primers with roughly 60% GC content and melting temperatures at least 55°C (see Note 5). T-DNA primers are listed in Table 1. 5. Hemacytometer cell counting chamber.

3. Methods All procedures involving Histoplasma yeast are to be performed within class II Biological Safety Cabinets.

58

O. Zemska and C.A. Rappleye

Table 1 Primers for PCR Primer AC1

Sequence

Tma (°C)

acgatggactccagag

46

b

acgatggactccagagcggccgcVNVNNNGGAA

32/70

LAD-2b

LAD-1

acgatggactccagagcggccgcBNBNNNGGTT

32/70

LAD-3

b

acgatggactccagagcggccgcVVNVNNNCCAA

37/71

LAD-4

b

acgatggactccagagcggccgcBDNBNNNCGGT

40/71

LB6

TGTTGGACTGACGCAACGACCTTGTCAACC

69

LB7

CGGACAGACGGGGCAAAGCTGCCTACCA

71

LB8

CAGGGACTGAGGGACCTCAGCAGGTCG

68

RB3

CGAATTCGAGCTCGGTACAGTGAC

58

RB6

GATTGTCGTTTCCCGCCTTCAG

59

a

Primer melting temperature: where two temperatures are listed, the first is the average temperature for the mixed bases segment and the second is for the full-length primer b Long degenerate primers with mixed bases (see Note 4, (12)) N = A,C,G,T; V = A,C,G; B = C,G,T; D = A,G,T

3.1. Preparation of Histoplasma Yeast

1. Four days before cocultivation of Histoplasma and Agrobacterium, collect Histoplasma yeast to inoculate a pre-growth plate. Histoplasma cells can be harvested from liquid cultures or suspensions made from plate-grown yeast colonies in 1 mL of 37°C HMM. Determine the number of Histoplasma yeast by measuring the optical density at 600 nm (see Note 6). Absorbance of 1.0 is roughly 1 × 108 yeast/mL. 2. Add 5 × 106 Histoplasma yeast to the center of a 10-cm diameter HMM plate in a total volume of 200 μL HMM and spread using a sterile spreader. Incubate plates for 4 days at 37°C under 5% CO2/95% air. 3. Suspend Histoplasma yeast in induction medium by adding 4 mL of induction medium (without acetosyringone) to the 4-day old plate. Use a sterile spreader to scrape the yeast cells and suspend them in the medium. Transfer the suspension by pipette to two 1.5-mL microfuge tubes (see Note 7). 4. Determine the density of yeast in the suspension by measuring the optical density at 600 nm.

3.2. Preparation of Agrobacterium

1. Four or five days before cocultivation of Histoplasma and Agrobacterium, streak out T-DNA vector-harboring Agrobacterium strain from a frozen glycerol stock onto LC medium with appropriate antibiotics (see Note 8). Incubate plates at room temperature for 48–72 h.

4

T-DNA Mutagenesis of Histoplasma

59

2. Two days before cocultivation, inoculate 3 mL of liquid minimal glucose medium with T-DNA vector-harboring Agrobacterium by picking 3–5 colonies of Agrobacterium cells with an inoculation loop into 500 μL of MGM medium in a microfuge tube. Vortex well to disperse clumps of cells and add to 2.5 mL of MGM containing the appropriate antibiotics (see Note 9). Incubate cells 24 h at room temperature with shaking (200 rpm). 3. Collect cells by centrifugation (5 min at 5,000 × g) and remove medium. 4. Resuspend cells in 600 μL of induction medium and determine the culture density by diluting 100 μL of cells in 900 μL of induction medium and measuring the optical density at 600 nm. 5. Dilute the Agrobacterium suspension into 10 mL of induction medium to an OD600 of 0.4. Supplement medium with the appropriate antibiotics and add acetosyringone to 0.1 mM to induce T-DNA transfer functions. Incubate culture approximately 12 h at 25–28°C with shaking (200 rpm). 6. Determine the cell density of the induced culture by measuring the optical density at 600 nm (assume an absorbance of 1.0 equals approximately 5 × 108 Agrobacterium cells/mL). 3.3. Cocultivation of Agrobacterium and Histoplasma

1. Using sterile forceps, place a single membrane or filter on each cocultivation plate. 2. Mix Agrobacterium and Histoplasma cells at 2:1 ratio by combining 1 × 108 Agrobacterium cells with 5 × 107 Histoplasma yeast cells in a sterile tube for each 6-cm diameter plate. For each 10-cm diameter plate, combine 3 × 108 Agrobacterium cells with 1.5 × 108 Histoplasma yeast in a sterile tube. 3. Add additional induction medium to bring up the volumes to 300 or 900 μL to be plated for the 6- and 10-cm diameter plates, respectively. 4. Using a pipette, place 300 or 900 μL of cocultivation mix onto each membrane/filter. Add drops of cocultivation mix across the surface of the filter in a uniform pattern (see Note 3). 5. Allow liquid to be fully absorbed by leaving plates uncovered in the Biological Safety Cabinet for 5–10 min. 6. Incubate plates for 48 h at 25–28°C (see Note 10).

3.4. Selection of Insertional Mutants

1. Using sterile forceps, transfer the membrane/filter paper from induction medium plates to HMM-based selection plates. Pick up edge of membrane and lift it from the induction plate. Gently lay down the filter by its edge on the HMM plate, slowly lowering it so that it lies down without trapping air bubbles underneath the filter.

60

O. Zemska and C.A. Rappleye

2. Incubate selection plates for 7–14 days at 37°C under 5% CO2/95% air until transformants appear as 0.5–1-mm diameter colonies on the filter. 3. Collect transformants for phenotypic screens (see Note 11). 3.5. Identification of Insertion Site by TAIL-PCR

1. Inoculate 5 mL HMM liquid culture with the insertion mutant of interest and grow cells at 37°C with moderate shaking (200 rpm) until saturation. 2. Remove 2 mL of the culture to 2.0-mL microfuge tubes with screw top caps. Spin down the yeast cells for 2 min at 2,000 × g and remove supernatant. Repeat with a second 2 mL of culture. 3. To the yeast pellet, add 200 μL of DNA isolation buffer, 200 μL of glass beads, and 200 μL of PCI. 4. Shake tubes for 2 min in a bead beater to disrupt cells. 5. Separate organic and aqueous phases by centrifugation 5 min at 14,000 × g and remove 180 μL of the aqueous (top) layer to a new 1.5 mL microfuge tube. 6. Add 18 μL of 3 M sodium acetate to the tube with the aqueous phase. 7. Add 500 μL 100% ethanol to precipitate the nucleic acids. Mix well and incubate 5 min at room temperature. Spin down nucleic acid precipitate 10 min at 14,000 × g and remove supernatant. 8. Wash pellet with 500 μL of 70% ethanol and spin 5 min at 14,000 × g. Remove supernatant and air dry pellet briefly. 9. Resuspend pellet in 100 μL of TE buffer and quantify total nucleic acids by absorbance at 260 nm. Dilute nucleic acids to 50 ng/μL in H2O. Store at 4°C. 10. For primary TAIL-PCR, set up four 25 μL PCR reactions, each containing Taq polymerase buffer, 100 μM dNTPs, 200 ng nucleic acid template, 1 U Taq DNA polymerase, and 0.5 μM primer LB6 and 0.5 μM of one of the four long degenerate (LAD) primers. 11. Perform primary TAIL-PCR (see Table 2 for thermocycling parameters). 12. Dilute primary TAIL-PCR reaction 40-fold by adding 5 μL to 195 μL of H2O. 13. For secondary TAIL-PCR: set up a 25 μL PCR reaction containing 0.5 μM LB7 primer, 0.5 μM primer AC1, 100 μM dNTPs, and 1 U Taq DNA polymerase. For each reaction, add 1 μL of the 40-fold dilution of primary TAIL-PCR reaction to the 25 μL reaction mixture (providing 1:1,000 final dilution of 1° PCR reaction).

4

T-DNA Mutagenesis of Histoplasma

61

Table 2 Primary TAIL-PCR reactions Temp. (°C)

Time

Cycles

1 TAIL-PCR 94

2 min

×1

94 63 72

15 s 30 s 2 min

×15

94 25 → 72 72

15 s Ramp 0.1°C per s 2 min

×1

94 65 72 94 65 72 94 40 72

15 s 30 s 2 min 15 s 30 s 2 min 15 s 1 min 2 min

×15

72

5 min

×1

Table 3 Secondary TAIL-PCR reactions Temp. (°C)

Time

Cycles

94

2 min

×1

94 63 72 94 63 72 94 40 72

15 s 30 s 2 min 15 s 30 s 2 min 15 s 1 min 2 min

×15

72

5 min

×1

14. Perform secondary TAIL-PCR (see Table 3 for thermocycling parameters). 15. Visualize primary and secondary TAIL-PCR products by electrophoretic separation through 1.5% agarose (see Note 12). 16. Treat positive TAIL-PCR reactions with ExoSAP-IT to inactivate unused dNTPs and unused primers by adding 2 μL of

62

O. Zemska and C.A. Rappleye

ExoSAP-IT reagent to 5 μL of any positive secondary PCR reaction. Incubate 15 min at 37°C. Inactivate the ExoSAP-IT reagent by heating 15 min at 80°C. 17. Sequence the secondary TAIL-PCR reaction with primer LB8. 18. Align the sequence of the secondary TAIL-PCR product against the Histoplasma genome database to determine the sequence flanking the T-DNA element and to delineate the site of T-DNA insertion. 3.6. Screening Insertion Mutant Libraries for Targeted Gene Disruption

1. Harvest insertion mutants from selection plates by adding 5 mL HMM to the plates, suspending the cells with a sterile spreader, and collecting the cell suspensions by pipette into 15 mL tubes. Combine transformant suspensions from multiple selection plates (if needed) to create pools, each representing approximately 250 insertion mutants (see Note 13). 2. From each pool, use the yeast suspension to inoculate a 6-mL liquid HMM culture to an OD600 of 0.250. Incubate culture 40–48 h at 37°C with shaking (200 rpm). 3. Remove 1.0 mL of culture to a sterile tube and add 250 μL of 5× Histoplasma freezing solution. Mix well and aliquot 250 μL into four cryogenic tubes. Place tubes into a styrofoam container (see Note 14) and place container at −80°C. After 24 h, move tubes to freezer racks for long-term storage at −80°C. 4. Remove 2 mL of the remaining culture to 2 mL microfuge tubes with screw-top caps. Spin down the yeast cells for 2 min at 2,000 × g and remove supernatant. Repeat with a second 2 mL of culture. Prepare DNA as described in Subheading 3.5, steps 3–9. 5. Assemble 20 μL volume 1° PCR reactions using 100 ng of total nucleic acids as template, 0.5 μM gene-specific primer (1° GSP), and 0.5 μM RB3 or LB6 primer (see Fig. 2a). 6. Perform 35 cycles of 1° PCR: 10 s at 94°C, 15 s at 55°C, 3 min at 72°C per cycle. 7. Dilute 1° PCR reaction 1:100 in H2O by sequentially adding 10 μL of 1° PCR reaction to 190 μL of H2O (resulting in 1:20 dilution) and mixing well. Transfer 10–40 μL of H2O to generate a final dilution of 1:100. 8. Assemble 20 μL 2° PCR reaction using 2 μL of the diluted 1° PCR reaction as template (making a final dilution of 1:1,000 1° PCR reaction), 0.5 μM gene-specific primer (2° GSP), and 0.5 μM RB6 or LB8 nested TDNA primer (see Fig. 2a). 9. Perform 35 cycles of 2° PCR reaction: 10 s at 94°C, 15 s at 55°C, 3 min at 72°C per cycle. 10. Analyze 2° PCR reactions by agarose gel electrophoresis. Identify candidate insertion mutant pool(s) as those yielding PCR products.

4

T-DNA Mutagenesis of Histoplasma

63

11. Thaw a frozen aliquot of positive candidate pool and count yeast cells by hemacytometer. Plate 2500 and 250 yeast cells on HMM plates for single colonies. Incubate plates at 37°C until single colonies develop. 12. Dispense 150 μL of HMM medium into each well of 96-well plates. Pick five 1-mm diameter colonies into each well for a total of 480 colonies. 13. Withdraw 50 μL of yeast suspension from the wells in each row and combine into a 2 mL screw-top microfuge tube, one for each row (see Fig. 2b). Withdraw 50 μL of yeast suspension from the wells in each column and combine into a 2 mL screwtop microfuge tube, one for each pooled column. Place 96-well plates containing remaining yeast suspensions at 37°C until the PCR analysis is complete. 14. Collect yeast cells in the row and column pool microfuge tubes by centrifugation (2 min at 2,000 × g) and remove media. Resuspend cells in 200 μL DNA isolation buffer and prepare DNA as before (see Subheading 3.5, steps 3–9). 15. Perform 1° and 2° PCR reactions on each row/column template and analyze by agarose gel electrophoresis. 16. Identify row and column address of the well(s) containing positive mutant yeast. Remove the yeast suspension from those wells and plate tenfold dilutions on HMM plates to obtain single colonies. Incubate plates at 37°C until single colonies develop. 17. Patch 20 single colonies on a new HMM plate for each candidate. Incubate plate at 37°C until thick growth of yeast has occurred (3–5 days). 18. Scrape each yeast patch into individual 2 mL screw-top microfuge tubes containing 200 μL of DNA isolation buffer and isolate total nucleic acids as before (see Subheading 3.5, steps 3–9). Return HMM plate to 37°C to regrow patches. 19. Perform 2° PCR reactions (no need for 1° PCR reaction) on each template and analyze by agarose gel electrophoresis. 20. Identify positive templates and recover targeted insertion mutant from the patched HMM plate.

4. Notes 1. The quality and type of agarose is critical to growth of Histoplasma on solid medium. Test manufacturer’s agarose to determine if it is compatible with yeast growth. SeaKem GTG agarose has worked well.

64

O. Zemska and C.A. Rappleye

2. FeSO4 solution should be made fresh since insoluble oxidized iron products will accumulate. 3. Uncharged nylon membranes (e.g. PALL Biodyne A 0.45-μm pore membranes) seem to provide the highest number of transformants. However, we routinely use the much cheaper Whatman 5 qualitative filter paper as sufficient numbers of transformants are obtained on this support and are not too numerous so that Histoplasma colony morphologies can be reliably determined. Do not spread cocultures on filter paper but add the Agrobacterium-Histoplasma coculture suspension drop wise across the filter and allow it to be absorbed. 4. Degenerate primers are ordered directly from oligonucleotide suppliers using the standard nucleic acid codes for mixtures of nucleotide bases (“N” for A,C,G, or T; “V” for A,C, or G; “B” for C,G, or T; “D” for A,G, or T) (12). A degenerate primer stock will thus contain a mixed population of oligonucleotides that vary at the degenerate positions but have a known anchor sequence in the 5¢ end. 5. We typically design primers to the 3¢ end of the targeted gene enabling us to identify insertions in the promoter regions as well as the CDS (see Fig. 1a). Two primers, one nested (2°GSP) within the other (1°GSP) provide for increased sensitivity and specificity. Insertion location relative to the gene of interest can be initially approximated using the size of the amplicon and the location of the 2°GSP. 6. To determine the optical density of Histoplasma strains that clump, add 333 μL of 3 M NaOH to 666 μL of yeast suspension, mix well, measure the OD at 600 nm, and multiply the reading by 1.5. 7. For clumping strains of Histoplasma yeast, allow large clumps to settle by leaving the microfuge tubes for 30 s at room temperature. Remove dispersed yeast remaining in suspension and transfer to new microfuge tubes. 8. A variety of Agrobacterium strains can be used to transform H. capsulatum including Agrobacterium strains LBA1100, C58C1, GV3101, and AGL1. Appropriate antibiotics will depend on the T-DNA vector and the Agrobacterium system employed. For LBA1100 with pCM41 (8), use 50 μg/mL kanamycin to select for the T-DNA vector and 250 μg/mL spectinomycin to maintain the transfer functions. 9. Agrobacterium cells from plates tend to clump. Disperse the cells thoroughly by vortexing and pipetting. Inoculated medium should be slightly turbid, typically around OD600 = 0.3–0.5. 10. Although 37°C is optimal for maintaining Histoplasma in the yeast phase, do not incubate the coculture at temperatures greater than 28°C since Vir protein functions are compromised at elevated temperatures (15).

4

T-DNA Mutagenesis of Histoplasma

65

11. The method of collection depends on the phenotypic screen to be employed or whether a mutant library is to be created. For morphological phenotypes, desired colonies can be directly picked from the selection medium using sterile toothpicks. For nonvisual phenotypes, pick individual mutants to the appropriate assay medium and proceed with screen. For pools of mutants (e.g., for creating mutant libraries), scrape cells into 2 mL of 37°C HMM with the edge of a sterile spreader. 12. Ideally, a slightly smaller product will be present in the secondary TAIL-PCR reaction compared to the primary reaction (see Fig. 1b, 1° and 2° reactions with LAD1 primer) but sometimes no reaction products are visible in the primary reaction. Regardless, perform secondary reactions and analyze PCR products that are produced by the secondary TAIL-PCR. Integration of T-DNA elements is often imprecise and sometimes truncation of the left border can eliminate primer binding sites. In these cases, new T-DNA-specific TAIL-PCR primers can be designed to locations less proximal to the left border. 13. For sufficient genome coverage, you will need 50,000–100,000 mutants requiring 200–400 pools of 250 mutants/each. Pools can be created and then banked for later screening so that new libraries do not have to be created each time. 14. A convenient and economical freezing container can be constructed by placing the tubes in an empty styrofoam rack for 15-mL conical tubes and then placing the rack into a styrofoam box such as those used for shipping enzymes on dry ice. This provides for a slower sample cooling rate when placed in the −80°C freezer which improves recovery of yeast cells. References 1. Lacroix B, Tzfira T, Vainstein A, et al (2006) A case of promiscuity: Agrobacterium’s endless hunt for new partners. Trends Genet 22: 29–37 2. Lai EM, Kado CI (1998) Processed VirB2 is the major subunit of the promiscuous pilus of Agrobacterium tumefaciens. J Bacteriol 180: 2711–2717 3. Gelvin SB (2003) Agrobacterium-mediated plant transformation: the biology behind the “gene-jockeying” tool. Microbiol Mol Biol Rev 67:16–37 4. Michielse CB, Hooykaas PJ, van den Hondel CA, et al (2005) Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr Genet 48:1–17 5. Sullivan TD, Rooney PJ, Klein BS (2002) Agrobacterium tumefaciens integrates transfer DNA into single chromosomal sites of dimor-

6.

7.

8.

9.

phic fungi and yields homokaryotic progeny from multinucleate yeast. Eukaryot Cell 1: 895–905 Bundock P, den Dulk-Ras A, Beijersbergen A, et al (1995) Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J 14:3206–3214 de Groot MJ, Bundock P, Hooykaas PJ, et al (1998) Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol 16:839–842 Marion CL, Rappleye CA, Engle JT, et al (2006) An alpha-(1,4)-amylase is essential for alpha-(1,3)-glucan production and virulence in Histoplasma capsulatum. Mol Microbiol 62:970–983 Nguyen VQ, Sil A (2008) Temperatureinduced switch to the pathogenic yeast form of Histoplasma capsulatum requires Ryp1,

66

O. Zemska and C.A. Rappleye

a conserved transcriptional regulator. Proc Natl Acad Sci USA 105:4880–4885 10. Webster RH, Sil A (2008) Conserved factors Ryp2 and Ryp3 control cell morphology and infectious spore formation in the fungal pathogen Histoplasma capsulatum. Proc Natl Acad Sci USA 105:14573–14578 11. Hilty J, Smulian AG, Newman SL (2008) The Histoplasma capsulatum vacuolar ATPase is required for iron homeostasis, intracellular replication in macrophages and virulence in a murine model of histoplasmosis. Mol Microbiol 70:127–139 12. Liu YG, Chen Y (2007) High-efficiency thermal asymmetric interlaced PCR for amplification of

unknown flanking sequences. Biotechniques 43:649–654 13. Liu YG, Whittier RF (1995) Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674–681 14. Youseff BH, Dougherty JA, Rappleye CA (2009) Reverse genetics through random mutagenesis in Histoplasma capsulatum. BMC Microbiol 9:236 15. Jin S, Song YN, Deng WY, et al (1993) The regulatory VirA protein of Agrobacterium tumefaciens does not function at elevated temperatures. J Bacteriol 175:6830–6835

Chapter 5 Targeted Gene Disruption in Cryptococcus neoformans Using Double-Joint PCR with Split Dominant Selectable Markers Min Su Kim, Seo-Young Kim, Kwang-Woo Jung, and Yong-Sun Bahn Abstract Cryptococcus neoformans causes fatal meningoencephalitis if not timely treated. Targeted gene disruption for functional analysis of a gene involves overlap PCR for the production of gene disruption cassettes carrying dominant selectable markers, followed by biolistic transformation. However, the conventional overlap PCR method between two flanking regions of the target gene and selectable marker is often inefficient due to the long length of the PCR product and the presence of multiple templates. Here we describe double-joint PCR with split dominant selectable markers for the more convenient generation of a gene-disruption cassette in C. neoformans with high targeted integration frequency (Kim et al., Biochem. Biophys. Res. Commun 390(3):983–988, 2009). Key words: Biolistic transformation, Cryptococcus neoformans, Double-joint PCR, Fungal pathogen, Gene disruption, Nourseothricin acetyltransferase, Neomycin/G418, Overlap PCR, Split dominant selectable markers

1. Introduction Characterizing the function of a gene usually requires targeted gene disruption by homologous recombination. In the basidiomycetous human fungal pathogen Cryptococcus neoformans, the overlap PCR/biolistic transformation method is well established for targeted gene disruption (1–3). For the selection of transformants, dominant selectable markers, including the nourseothricin acetyltransferase gene (NAT), the neomycin resistance gene (NEO), or the hygromycin resistance gene (HYG) (4, 5), are commonly used. Despite its success for gene disruption in C. neoformans, the overlap PCR method is often inefficient due to the long length of the PCR

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_5, © Springer Science+Business Media, LLC 2012

67

68

M.S. Kim et al.

product and the presence of multiple templates. In addition, it is rather time consuming. In contrast, double-joint PCR (DJ-PCR) with split dominant selectable markers has proved to be a more convenient and efficient means for the construction of genedisruption cassettes, with higher targeted integration frequency than the conventional overlap PCR-mediated gene disruption (6). DJ-PCR with split dominant selectable markers avoids most of problems imposed by conventional overlap PCR for the following reasons. First, only two template PCR fragments (approx. 0.7–1 kb of the 5¢- or 3¢-flanking regions of the target gene plus 1 kb of the split marker) are used for DJ-PCR. These, truncated disruption cassettes are more efficient to generate because the shorter PCR fragments require less amplification time (~2 kb in size; 2:30 min) than the conventional overlap PCR (~4 kb in size; 4:30 min). Second, DJ-PCR with split dominant selectable markers does not require any gel-extraction steps during the process and, therefore, saves additional time and labor in the preparation of gene disruption cassettes. Furthermore, targeted integration frequency appears to be higher in the NAT-split marker transformation than that of conventional overlap PCR transformation. Truncated NAT-split markers are less likely to be ectopically integrated by generating the intact NAT marker in the nonnative genomic locus, although integration frequency may be influenced by this locus. The major weakness in the DJ-PCR with NAT-split marker method is that NATr colonies appear more slowly after biolistic cotransformation (3–4 days) than the conventional overlap PCR (2–3 days). It is possible that NAT-split markers require more time for additional recombination inside the cell. Regardless of these concerns, DJ-PCR with NAT-split marker transformation is the method of choice for large-scale gene disruption in C. neoformans. In conclusion, DJ-PCR with NAT-split markers-mediated transformation is a very efficient and easy-to-perform gene disruption method in C. neoformans. 1.1. Safe Handling of C. neoformans

Cryptococcus neoformans is classified as Biosafety Level 2 (BL2). This level is similar to Biosafety Level 1 and includes various bacteria, fungi, and viruses that cause only mild diseases to humans or are not likely to spread via aerosol in a lab. To work in the BL2 lab, personnel must have general training in handling pathogenic agents and perform the experiments with modern precautions (i.e., washing one’s hands with antibacterial soap, washing all exposed surfaces of the lab with disinfectants). The BL2 lab is not necessarily separated in the building and work is generally conducted on open bench tops. All materials used for cultures are decontaminated by autoclaving prior to disposal.

5

Targeted Gene Disruption in C. neoformans

69

2. Materials 2.1. PCR

1. Sterile PCR microfuge tubes. 2. 2.5 mM dNTP. 3. Taq polymerase and its 10× reaction buffer. 4. H2O (distilled water). 5. PCR purification kit. 6. 1% Agarose gel (1× TAE buffer, agarose). 7. Primers (10 pM) (see Table 1). 8. DNA templates: genomic DNA: C. neoformans H99 Serotype A MATα or other serotype strains (see Notes 1 and 2). Plasmid: pNATSTM-containing nourseothricin resistant (NATr) gene marker with STM sequence (see Note 3) and pJAF1-containing neomycin/G418 resistant (NEOr) gene markers (see Note 4). pNATSTM is used for amplifying nourseothricin resistant gene and pJAF1 is used for amplifying neomycin/G418 resistant gene. 9. Thermal cycler.

2.2. Biolistic Transformation

1. YPD liquid medium (1 L): 10 g (w/v) yeast extract, 20 g (w/v) peptone, 20 g (w/v) glucose (see Note 5). 2. Solid YPD medium containing 1 M sorbitol (YPD + 1 M sorbitol): Final conc. 1 M sorbitol and 2% agar. Add to YPD liquid

Table 1 Examples for primer sequence L1

XXXXXXXXXXXXXXXXXXXX

Primer for the 5¢-flanking region

L2

TCACTGGCCGTCGTTTTAC XXXXXXXXXXXXXXXXXX

Primer for the 5¢-flanking region

R1

CATGGTCATAGCTGTTTCCTG XXXXXXXXXXXXXXXXXX

Primer for the 3¢-flanking region

R2

XXXXXXXXXXXXXXXXXXXX

Primer for the 3¢-flanking region

M13Fe

GTAAAACGACGGCCAGTGAGC

M13 Forward-extended for NAT

M13Fe-1

GTAAAACGACGGCCAGTGA

M13 Forward-extended for NEO

M13Re

CAGGAAACAGCTATGACCATG

M13 Reverse-extended for NAT or NEO

NSL-NAT

AACTCCGTCGCGAGCCCCATCAAC

5¢-Region of NAT, pair with M13Fe

NSR-NAT

AAGGTGTTCCCCGACGACGAATCG

3¢-Region of NAT, pair with M13Re

NSL-NEO

ATTGTCTGTTGTGCCCAG

5¢-Region of NEO, pair with M13Fe-1

NSR-NEO

TGGAAGAGATGGATGTGC

3¢-Region of NEO, pair with M13Re

70

M.S. Kim et al.

medium prior to autoclaving (see Subheading 2.2, item 1 and Note 5). 3. Solid YPD medium containing either 100 μg/mL nourseothricin or 50 μg/mL G418. Add reagents after autoclaved medium has cooled to <65°C. 4. Distilled water. 5. 4-mm Glass beads. 6. 30°C Incubator. 7. Centrifuge (2,000 × g). 8. Sterile microfuge tubes. 9. Gene gun: Biolistic PDS-1000/He Particle Delivery System (Bio-Rad). 10. Gold bead microcarrier : 0.6-μm gold beads. 11. Macrocarrier membrane (2.5-cm orange disks). 12. Rupture disk (1,350 psi). 13. Stopping screen. 14. 2.5 M CaCl2. 15. 1 M Spermidine for molecular biology, minimum 98% GC. 16. 100% Ethanol. 17. Nourseothricin (Werner Bio Agents). 18. G418 Disulfate salt, powder, cell culture tested. 19. Cell scraper. 2.3. Smash and Grab Mini-preparation of Genomic DNA

1. YPD liquid medium (see Note 5). 2. Centrifuge (10,000 × g). 3. Phenol:chloroform:isoamyl alcohol 25:24:1 saturated with 10 mM Tris, pH 8.0 1 mM EDTA. 4. 100 and 70% Ethanol. 5. 500 mL TENTS buffer: Mix 50 mL 1 M Tris–HCl, pH 7.5 (final conc.: 10 mM), 1 mL 0.5 M EDTA, pH 8 (final conc.: 1 mM), 10 mL 5 M NaCl (final conc.: 100 mM), 50 mL 20% Triton X-100 (final conc.: 2%), 50 mL 10% SDS (final conc.: 1%) in 339 mL dH2O. 6. Acid-washed glass bead, 425–600 μm. 7. Bead beater. 8. 3 M Sodium acetate (pH 5.2). 9. −80°C Freezer. 10. Screw cap tubes.

2.4. CTAB Genomic DNA Preparation

1. YPD liquid medium (see Subheading 2.2, step 1). 2. Centrifuge (2,000 × g).

5

Targeted Gene Disruption in C. neoformans

71

3. −80°C Freezer or liquid nitrogen. 4. Lyophilizer. 5. Distilled water. 6. 3-mm Glass beads. 7. 37 and 65°C water bath. 8. 500 mL CTAB extraction buffer: 50 mL 1 M Tris–HCl, pH 7.5 (final conc.: 100 mM), 70 mL 5 M NaCl (final conc.: 0.7 M), 10 mL 0.5 M EDTA (final conc.: 10 mM), 5 g CTAB (cetyl trimethylammonium bromide, Sigma), 5 mL 14 M β-mercaptoethanol (final conc.: 1%), add dH2O to 500 mL (see Note 6). 9. Chloroform. 10. Isopropanol. 11. 70% Ethanol. 12. TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0). 13. RNase A. 2.5. Southern Blot Analysis

2.5.1. Southern Blot Analysis in Alkaline Transfer Method

Alkaline transfer method and neutral transfer method are commonly used to transfer nucleic acids in the agarose gel to nitrocellulose membrane in Southern blot analysis. The advantages of alkaline transfer method include easy preparation of denaturation and transfer buffer solutions and less amount of time for gel-to-membrane transfer than neutral transfer method. However, if you want to have high resolution and signal intensity for specific bands, neutral transfer method is recommended. 1. Restriction enzymes. 2. 1% Agarose gel (1× TAE buffer, agarose). 3. 0.4 N NaOH (see Note 7). 4. Nylon membrane. 5. 0.4 N NaOH and 1 M NaCl (see Note 7). 6. UV cross linker (1,200 J/m2 UV exposure). 7. 500 mL modified Church hybridization solution: 1 mL 0.5 M EDTA (final conc.: 1 mM), 33.5 g Na2HPO4 (final conc.: 0.25 M), 5 g hydrolysated casein (final conc.: 1%), 35 g SDS (final conc.: 7%), 1 mL 85% H3PO4 (final conc.: 0.17%), add H2O to 500 mL. 8. Gene-specific probe (produced by PCR amplification and cleaned-up by PCR purification kit). 9. α-[32P] dCTP. 10. Amersham Rediprime II Random Prime Labelling System. 11. 1 L 20× SSC solution (Nucleic acid transfer buffer): 88.23 g Na3 citrate (final conc.: 0.3 M), 175.32 g NaCl (final conc.: 3 M), adjust to pH 7.0 with HCl and add H2O to 1 L.

72

M.S. Kim et al.

12. 1 L washing solution I: 50 mL 20× SSC buffer (final conc.: 2×), 10 mL 10% SDS (final conc.: 0.1%), add H2O to 1 L. 13. 1 L washing solution II: 100 mL 20× SSC buffer (final conc.: 1×), 10 mL 10% SDS (final conc.: 0.1%), add H2O to 1 L. 14. Autoradiography film. 15. Developer and fixer, or suitable automated machine. 2.5.2. Southern Blot Analysis in Neutral Transfer Method

1. Restriction enzymes. 2. 1% Agarose gel (1× TAE buffer, agarose). 3. Nylon membrane. 4. UV cross linker (1,200 J/m2 UV exposure). 5. 500 mL Modified Church hybridization solution. 6. Gene-specific probe (produced by PCR amplification and cleaned-up by PCR purification kit). 7. α-[32P] dCTP. 8. Amersham Rediprime II Random Prime Labelling System. 9. Denaturation solution: 43.83 g NaCl (final conc. 1.5 M), 10 g NaOH (final conc. 0.5 M). Make up to a volume of 500 mL with dH2O. 10. Neutralization solution: 43.83 g NaCl (final conc. 1.5 M), 30.37 g Tris (0.5 M) make up to a volume of 500 mL with dH2O. Adjust to pH 8 with HCl. 11. 1 L 10× SSC solution (nucleic acid transfer buffer): 44.125 g Na3 citrate (final conc. 0.15 M), 87.66 g NaCl (final conc. 1.5 M), adjust to pH 7.0 with HCl and add H2O to 1 L. 12. 1 L Washing solution I (see Subheading 2.5.1, item 12). 13. 1 L Washing solution II (see Subheading 2.5.1, item 13). 14. Autoradiography film. 15. Developer and fixer, or suitable automated machine.

3. Methods The overall experimental procedure for targeted gene disruption in C. neoformans is shown in Fig. 1. 3.1. Primer Design

1. Design primers for the PCR amplification of the 5¢- and 3¢-flanking homologous regions of the target gene and for screening for positive transformants (optimal size: approximately 0.7–1 kb) are PCR-amplified by gene-specific primer pairs, called L1/L2 and R1/R2, respectively (see Fig. 2). The length

5

Targeted Gene Disruption in C. neoformans

73

Design gene disruption strategy • Cryptococcus genome database analysis • Design PCR primers

Production of gene deletion cassette • Perform 1st PCR • Perform 2nd DJ-PCR

Biolistic transformation into C. neoformans cells • Biolistic transformation by gene gun

Screen transformants • Genomic DNA prep. by “Smash & Grab” method • Diagnostic PCR • Genomic DNA prep by CTAB method • Southern blot

Identify gene specific deletion mutants

Fig. 1. The overall flowchart for Cryptococcus gene disruption. To design the gene disruption strategy, identify your target gene using a BLAST search in the Cryptococcus genome database and analyze its predicted genomic DNA structure (exon and intron organization). Based on the predicted genomic DNA structure of the target gene, design disruption and screening PCR primers. To produce the gene deletion cassette, perform the first and second DJ-PCR. Then, introduce gene disruption cassettes into C. neoformans cells through biolistic transformation using a gene gun. Among stable nourseothricin or G418 resistant transformants, confirm whether the target gene is correctly replaced with the disruption cassette by diagnostic PCR and Southern blot analysis with genomic DNAs isolated from the wild-type and mutant strains.

of primers should be around 18–22 bp. To screen for positive transformants, design a screening primer (SO), which is located 100–200 bp upstream of L1. Use the SO primer for diagnostic PCR in pair with B79 primer (TGTGGATGCTGGCGGAGGATA) that binds to the ACT1 promoter region of NAT or NEO marker (see Fig. 2). 2. L2 and R1 primers should contain the reverse-complementary sequence of M13 forward-extended and M13 reverse-extended primers, respectively, that are used for NAT/NEO marker amplification (see Table 1 and Note 8).

a

1st round PCR

M13Fe

200bp

PATCI

L1

R1

5’ - NAT/NEO NSL

5’ flanking region

3’ flanking region NSR NAT/NEO – 3’

L2

R2

TTRPI M13Re

b

2nd round PCR L1 NSL

PATCI

5’ flanking region

5’ - NAT/NEO R2 NAT/NEO – 3’

TTRPI

3’ flanking region

NSR

c

Biolistic transformation by gene gun

Helium gas Rupture Disk

Microcarrier Disk DNA-coated microcarrier

Target cells

d

5’ flanking region

PATCI

5’ - NAT/NEO

NAT/NEO – 3’

TTRPI

3’ flanking region

Triple recombination Target gene

Gene specific deletion mutant NAT / NEO

Fig. 2. The schematic diagram of the double-joint PCR with split dominant selectable markers and biolistic transformation for Cryptococcus gene disruption. (a) At the first-round PCR, 5¢- and 3¢-flanking regions of a target gene are amplified using primers L1/L2 and R1/R2, respectively. The 5¢- and 3¢-NAT/NEO split markers are amplified using primers M13Fe (or M13Fe-1)/NSL and NSR/M13Re, respectively. (b) The 5¢- and 3¢-flanking regions of the target gene and the NAT/NEO split marker produced by the first-round PCR are combined, purified, and used for the template of the second-round DJ-PCR with primers L1/NSL and NSR/ R2, respectively. (c and d) The two amplified constructs are combined, purified, and introduced by biolistic transformation into the Cryptococcus strains where the triple recombination between the target genes and split disruption cassettes occurs.

5

3.2. First-Round PCR

Targeted Gene Disruption in C. neoformans

75

1. Prepare four PCR tubes containing reaction mixtures as follows: 10× Taq buffer

5 ml

2.5 mM dNTP

4 ml

Template (C. neoformans genomic DNA or marker plasmid)

2 μl

Primer 1: L1, R1, M13Fe (M13Fe-1 for NEO marker), or NSR primer

2 μl

Primer 2: L2, R2, NSL, or M13Re primer

2 μl

Taq polymerase

0.25 μl

H2O

To 50 μl

2. Amplify the 5¢- and 3¢-flanking regions of each gene with primer pairs L1/L2 and R1/R2, respectively, by using genomic DNA of the H99 strain (serotype A MATα strain) as a template. Amplify the 5¢- and 3¢ regions of NAT- or NEO-split markers with primers M13 forward extended (M13Fe) and NSL, and primers M13 reverse extended (M13Re) and NSR, respectively, using the plasmid pNATSTM for the amplification of NAT marker or pJAF1 for the amplification of NEO marker (see Notes 1 and 8). 3. Set up the first-round PCR as follows: Step 1: Initial denaturation for 2 min at 95°C. Step 2: Denaturation for 30 s at 95°C. Step 3: Annealing for 30 s at 55°C. Step 4: Extension for 90 s at 72°C. Repeat Steps 2–4 for 35 cycles. Step 5: Final extension for 10 min at 72°C. 4. Analyze 2 μl of each PCR fragment in 1% agarose gel. 5. For double-joint PCR (DJ-PCR), combine 5¢-flanking regions of the target gene and NAT-split markers or 3¢-flanking regions of the target gene and NAT-split markers and then purify the PCR products by PCR purification kit. 3.3. Second-Round PCR (DJ-PCR)

1. Prepare two sterilized PCR microfuge tubes and set up the second-round of PCR. Set up the reaction mixtures as follows: 10× Taq buffer

5 μl

2.5 mM dNTP

4 μl

Template (combined first-round PCR products)

5 μl

Primer 1: L1, NSR primer

2 μl

Primer 2: NSL, R2 primer

2 μl

Taq polymerase

0.25 μl

H2O

To 50 μl

76

M.S. Kim et al.

Amplify the 5¢-flanking region of the gene disruption cassette containing the 5¢-NAT split marker with primer L1 and NSL, and the 3¢-flanking region of the gene disruption cassette containing the 3¢-NAT split marker with primers R2 and NSR with 5 or 10 μl of combined templates. 2. Set up the DJ-PCR as follows: Step 1: Initial denaturation for 2 min at 95°C. Step 2: Denaturation for 30 s at 95°C. Step 3: Annealing for 30 s at 55°C. Step 4: Extension for 150 s at 72°C. Repeat Steps 2–4 for 35 cycles. Step 5: Final extension for 10 min at 72°C. 3. Analyze 2 μl of each PCR fragment on a 1% agarose gel. 4. Combine the two DJ-PCR fragments and purify them using a proprietary PCR purification kit. 5. Use 5 μl of purified, combined DJ-PCR products for biolistic transformation (see Note 9). 3.4. Biolistic Transformation

1. Day 1: Incubate the wild-type or mutant strains to be transformed in 50 mL YPD liquid medium for 16 h at 30°C. Serotype A MATα strain: H99 strains (7). Serotype A MATa strain: KN99a strain (8). Serotype D MATα strain: JEC21 strain (9). Serotype D MATa strain: JEC20 strain (9). 2. Day 2: Next day, spin the cells for 5 min at 2,000 × g in the swinging bucket rotor in the tabletop centrifuge. Remove the supernatant and resuspend cells in 5 mL sterile water. 3. Spread 300 μl of cells per plate (YPD + 1 M sorbitol) by using sterilized 4-mm glass beads or a spreader. 4. Allow plates to dry completely on the bench then incubate for 3 h at 30°C. 5. During incubation, prepare microcarrier particles in the following five steps. 6. Weigh 0.25 g of 0.6-μm gold particles into a 1.5-mL microfuge tube. 7. Add 1 mL of sterile H2O to the particles and vortex the tube continuously for 5 min at room temperature. 8. Collect the particles by centrifugation. 9. Gently remove the supernatant. Resuspend the gold particles in 1 mL 100% ethanol and vortex the suspension for 1 min.

5

Targeted Gene Disruption in C. neoformans

77

10. Aliquot 250-μl gold bead solution in new microfuge tubes and add 750 μl 100% ethanol (1/4 dilution). Store at −20°C (see Note 10). 11. Prepare one aliquot of DNA-coated particles per dish of cells to be shot, as follows (see Note 11): Purified second PCR products

5 μl

Microcarrier particles

10 μl

2.5 M CaCl2

10 μl

1 M spermidine-free base

2 μl

12. After all the ingredients have been added, continue vortexing the tube for few minutes to ensure uniform coating of the particles with DNA. Stand the tube at room temperature for 10 min to allow the particles to settle. 13. Centrifuge at 2,000 × g for 1 min and remove supernatant. 14. Resuspend in 500 μl of 100% ethanol to wash the DNA-coated gold beads. 15. Centrifuge at 2,000 × g for 1 min and remove supernatant. 16. Add 12 μl of 100% ethanol and resuspend the particle pellet by pipetting or vortexing for 30 s. 17. Before application of the gold-coated DNA sample onto macrocarrier membrane, the macrocarrier orange disk and stopping screen should be washed in 100% ethanol and set aside to dry. And the rupture disk (use a 1,350 psi rupture disk) should be washed in isopropanol (see Note 12). 18. Place a macrocarrier membrane, using the red plastic cylindrical holder, on the marocarrier holders that have been washed in ethanol. 19. Spread all the DNA-coated gold beads around the central point of the macrocarrier membrane, and set them aside to dry. While drying, turn on the pump and open the valve of the helium tank. Turn the gold knob of the helium tank clockwise until the pressure reaches ~2,200 psi. 20. All devices, such as the disk chamber, red plastic cylindrical holder, silver cap fixing the macrocarrier holder, and plastic plate holder, need to be sanitized with an ethanol swab. 21. Place a rupture disk into the holder hanging from the ceiling of the chamber and screw the holder back. 22. Place the stopping screen into the disk chamber and set the macrocarrier holder with DNA membrane DNA-side down into the disk chamber. Screw on the silver cap. Place the disk chamber in the top slot of the chamber.

78

M.S. Kim et al.

23. Place the petri dish that was incubated for 3 h (see Subheading 3.4, step 4) on the second top slot of the chamber. Turn on the biolistic machine. 24. Push the “vacuum” button once and wait until the vacuum gauge reach to 28. Switch quickly to the “hold” button. Hold down the “fire” button until you hear the “pop” sound and the vacuum gauge drops to zero. Release the “fire” button and push the “vent” button. 25. Remove the plate when the chamber reaches atmospheric pressure and clean out the machine with 70% ethanol. Turn off the biolistic machine, pump, and helium canister. 26. Incubate the plates at 30°C for 3–4 h to recover. 27. Harvest cells by adding 1 mL YPD liquid medium to the plate and scraping with a cell scraper. Transfer the cells to selective medium (YPD + 100 μg/mL nourseothricin or 50 μg/mL G418), and spread cells using glass beads (see Subheading 3.4, step 3). Allow the plates to dry completely (see Note 13). 28. Incubate the plates at 30°C to grow the (NATr) or (NEOr) transformants. 29. Stable transformants normally appear on selective medium (YPD + Nourseothricin or G418) after 3–4 days incubation at 30°C. 3.5. Modified “Smash and Grab” Mini-preparation of Cryptococcus Genomic DNA for Diagnostic PCR

To screen the positive transformants by diagnostic PCR, each mutant’s genomic DNA is extracted by the following modified “Smash and Grab” method (see Note 14). 1. Culture the positive transformants in 5 mL YPD liquid medium for 16 h at 30°C with shaking at 220 rpm. 2. Next day, spin the cells for 5 min at 2,000 × g in the swinging bucket rotor in the tabletop centrifuge and remove the supernatant. 3. Resuspend pelleted cells in 0.5 mL TENTS buffer and transfer them to screw-cap tubes containing 0.2 mL of 425–600 mm acid-washed glass beads (see Note 15). 4. Add an equal volume of phenol–chloroform (0.5 mL, see Note 16) to the microfuge tube with acid-washed glass beads and break cells for 10 min in a tabletop bead beater. 5. Centrifuge the tubes to separate the organic and aqueous phases (5 min at 10,000 × g). Transfer the aqueous phase (about 450 μl) to new microfuge tubes. 6. To precipitate the DNA, add 50 μl of 3 M sodium acetate (pH 5.2) and 1 mL of 100% cold ethanol and mix well. Stand the DNA sample at −80°C for 30 min (at this point, samples can be stored at −80°C until required).

5

Targeted Gene Disruption in C. neoformans

79

7. Collect the precipitated DNA by centrifugation at 10,000 × g for 20 min at 4°C. Remove the supernatant carefully from the white pellet and discard. Rinse the pellet of DNA with 0.5 mL 70% ethanol. 8. Remove the 70% ethanol by centrifugation and allow the pellet to dry completely in air for about 20 min at room temperature. Dissolve the DNA pellet in 50 μl dH2O at room temperature and store at −20°C. 3.6. Diagnostic PCR

1. In a sterile 0.5 mL microfuge tube, mix in the followed order: 10× ExTaq buffer

2.5 μl

2.5 mM dNTP

2 μl

Template (extracted gDNA)

1 μl

Primer 1 (SO)

1 μl

Primer 2 (B79)

1 μl

ExTaq (Takara)

0.1 μl

H2O

To 25 μl

2. Set up the diagnostic PCR as follows: Step 1: Initial denaturation for 2 min at 95°C. Step 2: Denaturation for 30 s at 95°C. Step 3: Annealing for 30 s at 55°C. Step 4: Extension for 90 s at 72°C. Repeat Steps 2–4 for 25 cycles. Step 5: Final extension for 10 min at 72°C. 3. Analyze 5 μl PCR amplification products on a 1% agarose gel and include a DNA size marker. 3.7. CTAB Genomic DNA Preparation for Southern Blot Analysis

To screen the positive transformants by Southern blot analysis, each mutant’s genomic DNA is extracted by the following “CTAB genomic DNA preparation” method. 1. Grow cells in 50 mL YPD liquid medium overnight with shaking at 220 rpm. 2. Spin cells down for 5 min at 2,000 × g and wash with sterilized 40–50 mL dH2O. 3. Spin down, discard supernatant, and freeze the cell pellets by storing tubes at −80°C for 2–3 h in the deep freezer or by plunging the tubes into liquid nitrogen tanker for 30 min. 4. Lyophilize overnight. 5. Vortex the lyophilized cell pellets vigorously with 3-mm glass beads until a fine powder is generated. 6. Add 10 mL of CTAB extraction buffer and mix by briefly vortexing.

80

M.S. Kim et al.

7. Incubate at 65°C for 30 min, and cool down under cold tap water for 10 min. 8. Mix the cell extracts with 10 mL chloroform (gently mix by inverting 10–20 times) and spin down for 10 min at 2,000 × g for phase separation. 9. Recover 7 mL of the upper aqueous phase and transfer to a new 15 mL conical tube containing 7 mL isopropanol. 10. Immediately mix by inversion 10 times and let it sit for 10 min (see Note 17). 11. Spin down for 5 min at 2,000 × g. 12. Wash the genomic DNA pellet with 5 mL 70% ethanol and allow it to dry completely at room temperature. 13. Resuspend the pellet with 200–500 μl of TE buffer and incubate the sample at 65°C until the pellet is completely dissolved (see Note 18). 14. Add 2 μl of RNaseA (10 mg/mL) to remove any ribosomal RNA and incubate at 37°C for 1–2 h. 15. Use 8–10 μl in the restriction digestion prior to the Southern blot analysis. 3.8. Southern Blot Analysis: Preparation of Probes and Gel Electrophoresis

Southern blot analysis is required for checking targeted deletion and absence of any ectopic integration of the target gene, which can be overlooked by diagnostic PCR. 1. Prepare DNA probes by PCR amplification and radiolabeling with Amersham Rediprime II Random Prime Labelling System. 2. Digest the isolated genomic DNAs with the restriction enzymes appropriate for checking targeted deletion of the gene. 3. Separate the digested genome DNAs and size marker (DNA ladder) using 1% agarose gel-electrophoresis (see Note 19).

3.9. Southern Blot Analysis: Denaturation and Transfer

1. Denature the DNA by covering the gel in 0.4 N NaOH and soaking for 20 min with gentle shaking (see Note 20).

3.9.1. Alkaline Transfer Method

2. Set up the transfer to a nylon membrane in 0.4 N NaOH and 1 M NaCl as shown in Fig. 3. After transferring for 10–24 h, fix transferred nucleic acids to the membrane by 1,200 J/m2 UV exposure in a UV crosslinker (typically, an exposure of about 10 s) (see Note 21).

3.9.2. Neutral Transfer Method

1. Cover the gel with fresh denaturation buffer (0.5 L) and begin shaking for 45 min at room temperature (see Note 22). 2. Discard denaturation buffer and rinse gel twice with distilled water briefly. 3. Cover the gel with fresh neutralization buffer (0.5 L) for 45 min and rinse gel with distilled water briefly.

5

Targeted Gene Disruption in C. neoformans

Weight

Paper towels Wrapping at each edge with Saran plastic wrap Transfer buffer

81

Plastic plate 3 sheets of Whatman paper Nylon membrane

Agarose gel

Whatman paper

Plastic support

Fig. 3. Setting for nucleic acid transfer to the nylon membrane in Southern blot analysis. Plastic agarose gel cast can be used as a plastic support (1). Transfer buffer is drawn from a reservoir via the Whatman filter paper (2) and passes through the agarose gel (3) into the nylon membrane (5) and a stack of Whatman filter papers (7) and paper towels (8). Nucleic acids in the agarose gel are transferred onto a nylon membrane in the stream of the transfer buffer. Plastic wrapping each edge of the agarose gel and nylon membrane prevents direct contact between transfer buffer and the stack of paper towels (4 and 6). The plastic plate (9) and weight (1–1.5 kg, 10) promote a tight and even contact between gel and nylon membrane.

4. Discard solution and place the gel in 10× SSC solution. 5. Set up the transfer to a nylon membrane in 10× SSC buffer as shown in Fig. 3. After transferring for 10–24 h, fix transferred nucleic acids to the membrane by 1,200 J/m2 UV exposure in a UV crosslinker (typically, an exposure of about 10 s) (see Note 21). 3.10. Hybridization and Development Method

1. Apply the nylon membrane inner wall of glass tube by using a long-cylinder-like stick and remove any bubbles trapped between the membrane and the wall of the tube. 2. Add 10–20 mL modified church hybridization buffer to the tube. 3. Rotate the glass tube for at least 3 h in a hybridization oven at a temperature of 65°C. 4. Hybridize the membrane for 24 h at 65°C with modified Church hybridization solution containing the target gene-specific probes that were labeled with α-[32P] dCTP. 5. After hybridization, wash the membrane twice for 10 min in washing solution I and once for 10 min in washing solution II. 6. Expose the membrane to autoradiography film overnight and develop it using developer and fixer solutions (see Note 23).

4. Notes 1. See the website (http://www.broadinstitute.org/annotation/ genome/cryptococcus_neoformans/MultiHome.html) for sequences of C. neoformans is used.

82

M.S. Kim et al.

2. C. neoformans is classified into four different serotypes (A to D). H99 is the MATα wild-type serotype A strain, which is used as the platform strain for genome sequencing. Serotype A is the most commonly isolated serotype of C. neoformans worldwide (>90%). KN99a is the MATa serotype A strain, which is congenic to H99 except for the mating-type locus. JEC21 and JEC20 are the wild-type serotype D strains of MATα and MATa, respectively. Serotypes B and C were recently reclassified as Cryptococcus gattii because they cause life-threatening meningitis in immunocompromised individuals. WM276 and R265 are common wild-type strains for C. gattii. 3. The website for sequence of pNATSTM (http://www.bahnlab.com/bbs/zboard.php?id=data&page=1 &sn1=&divpage=1&sn=of f&ss=on&sc=on&select_ arrange=headnum&desc=asc&no=3). Each number in the end of pNATSTM indicates unique signature tag sequence. 4. The website for sequence of pJAF1 (http://www.bahnlab.com/ bbs/zboard.php?id=data&page=1&sn1=&divpage=1&sn=off& ss=on&sc=on&select_arrange=headnum&desc=asc&no=2). 5. Dissolve 10 g yeast extract, 20 g peptone in 0.8 L dH2O and autoclave. After autoclaving, add 100 ml 20% sterilized glucose solution to the medium and bring to 1 L with dH2O. 6. Before adding β-mercaptoethanol, the solution should be warmed to 65°C to dissolve CTAB into solution. Handle β-mercaptoethanol inside a chemical hood. CTAB extraction buffer can be stored for 4–6 months at room temperature. 7. Prepare fresh 0.4 N NaOH denaturation buffer and 0.4 N NaOH and 1 M NaCl transfer buffer on the day of the experiment. 8. The expected sizes for the first PCR are approximately 800– 1,000 bp (L1/L2, R1/R2, and M13 Fe/NSL) and 1,200 bp (M13 Re/NSR). The expected sizes for the second PCR are approximately 2,200 bp (L1/NSL) and 2,000 bp (NSR/R2). 9. Lyophilize the samples to concentrate the PCR products before performing the biolistic transformation by gene gun. 10. The gold bead solution can be prepared as a stock solution and frozen as aliquots. 11. While continually vortexing the stock solution of microcarrier particles, remove a 10 μl aliquot. 12. The pressure for optimum biolistic transformation is approximately 1,350 psi, but can be modified if necessary. For example, it is difficult to transform strains using 1,350 psi if they have a thicker capsule than wild-type, in which case the pressure for transformation should be increased. 13. After the cells are scraped, divide the collected cell suspension and spread thoroughly onto two different selective media (approx. 400–500 μl each).

5

Targeted Gene Disruption in C. neoformans

83

14. Modified “Smash & Grab” mini-preparation of C. neoformans genomic DNA for diagnostic PCR is an easier method to screen the positive transformants than CTAB genomic DNA preparation for Southern blot analysis. However, the exact mutation locus cannot be confirmed by diagnostic PCR. Therefore, we first perform “Smash & Grab” mini-preparation and diagnostic PCR to confirm the positive transformants, then perform Southern blot. 15. It is recommended that screw-cap tubes are used to prevent leakage. 16. Use Tris buffer-saturated phenol–chloroform solution that completely separates into two phases. The clear, upper aqueous phase is Tris buffer. You should use the lower phase. 17. There will be a cloudy formation of genomic DNA during inversion. 18. The volume of added TE buffer depends on the amount of genomic DNA pellets. It will take some time to completely dissolve the genomic DNA pellet. Incubate pellets at 65°C until they are completely dissolved. Tap the samples frequently during incubation. 19. Maintain a low voltage through the gel (about <1 V/cm) to allow the DNA to migrate slowly. 20. Rinse the gel briefly in distilled water after denaturation in 0.4 N NaOH. 21. Before removing the nylon membrane from the gel, mark the DNA loading position and DNA Ladder on the membrane with pencil. 22. Prepare fresh denaturation buffer (1.5 M NaCl and 0.5 M NaOH) and neutral transfer buffer (1.5 M NaCl and 0.5 M Tris, adjust to pH 8) on the day of the experiment. 23. We need dark rooms to develop autoradiography film. In dark room, the film is hung in developer solution until bands are detected onto the film. Next, the film is transferred into fixer solution for a while. Finally, the film is transferred into distilled water to remove fixer solution.

Acknowledgment This work was supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korean government (MEST) (R01-2008-000-11426-0) and in part by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korean government (MEST) (R11-2008-062-02001-0).

84

M.S. Kim et al.

References 1. Robert C. Davidson1, Jill R. Blankenship1, et al. (2002) A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148 (Pt 8): 2607–15. 2. D L Toffaletti, T H Rude, S A Johnston, et al. (1993) Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J. Bacteriol 175(5):1405–1411. 3. Robert C. Davidson, M. Cristina Cruz, Rey A. L. Sia, et al. (2000) Gene disruption by biolistic transformation in serotype D strains of Cryptococcus neoformans. Fungal Genet. Biol 29(1):38–48. 4. McDade HC, Cox GM. (2010) A new dominant selectable marker for use in Cryptococcus neoformans. Med. Mycol 39(1):151–154. 5. Nelson RT, Pryor BA, Lodge JK. (2003) Sequence length required for homologous

6.

7.

8.

9.

recombination in Cryptococcus neoformans. Fungal Genet. Biol 38(1):1–9. Kim MS, Kim SY, Yoon JK, et al. (2009) An efficient gene disruption method in Cryptococcus neoformans by double-joint PCR with NATsplit markers. Biochem. Biophys. Res. Commun 390(3):983–988. Perfect JR, Ketabchi N, Cox GM, Ingram CW, et al. (1993) Karyotyping of Cryptococcus neoformans as an epidemiological tool. J. Clin. Microbiol 31(12):3305–9. Nielsen K, Cox GM, Wang P, et al. (2003) Sexual cycle of Cryptococcus neoformans var. grubii and virulence of 650 congenic a and isolates. Infect Immun 71(9):4831–41. Moore, T. D., Edman, J. C. (1993) The alphamating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol. Cell. Biol 13(3):1962–70.

Chapter 6 Multiple Gene Deletion in Cryptococcus neoformans Using the Cre–lox System Lorina G. Baker and Jennifer K. Lodge Abstract Reverse genetics is commonly used to identify and characterize genes involved in a variety of cellular processes. There is a limited set of positive selectable markers available for use in making gene deletions or other genetic manipulations in Cryptococcus neoformans. Here, we describe the adaptation of the Bacteriophage P1 Cre–loxP system for use in C. neoformans, and its application in the excision and reuse of the geneticin drug marker. This tool will allow investigators to make multiple, sequential gene deletions in the same strain, which should facilitate the analysis of multigene families. Key words: Cre-recombinase, loxP, G418, Geneticin, NAT, Nourseothricin, HYG, Hygromycin

1. Introduction Selectable drug markers have been used successfully in Cryptococcus neoformans to generate deletion or other kinds of mutant strains, including the addition of epitope tags, point mutations, and swapping of promoter sequences. Currently, four positive selectable drug markers are used in C. neoformans: nourseothricin (NAT) (1), phleomycin, geneticin (G418), and hygromycin (HYG) (2). Using these four markers, many genes have been analyzed for multiple phenotypes, including virulence in animal models, and they have been very effective when manipulating combinations of up to four genes. However, because of the limited number of positive selectable markers for use in C. neoformans, it can be difficult to sequentially alter members of gene families with more than four members. Therefore, we adapted the Cre–loxP system, originally described in Bacteriophage P1 (3), for use in C. neoformans. The Cre–loxP recombinase system includes two short asymmetric DNA

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_6, © Springer Science+Business Media, LLC 2012

85

86

L.G. Baker and J.K. Lodge

sequences termed loxP sites (approximately 34 bp including two inverted repeats) and the Cre-recombinase protein (38 kDa). The Cre protein covalently binds to the two short loxP sites and catalyzes recombination within them; any intervening DNA sequence is looped out and excised from the DNA. The only enzyme required for this action is the Cre-recombinase. Initially, we chose to add loxP sites to the G418 drug marker as described in Patel et al. (4). Subsequently, we have made additional vectors that contain either HYG or NAT drug markers flanked by loxP sites. These markers can be used to make deletion constructs by the overlap PCR method (5), and then used for biolistic transformation of C. neoformans (6). After transformation, stable transformants should be selected by passaging on nonselective medium, with the final passage on medium containing the appropriate drug. Unstable transformants are generally those that have episomal copies of the transforming DNA. To ascertain that the deletion construct replaced the native gene specifically at the native locus, the remaining transformants are then screened by a set of three PCR reactions that analyze the structure at each end of the replacement as well as the length of the entire construct. This analysis allows stable transformants that have not undergone homologous recombination in the 5¢ and/or 3¢ regions, or that have integrated more than one deletion cassette at the desired locus, to be removed from further analysis. To eliminate strains that have had an ectopic insertion event (i.e., insertion at another locus), those strains that pass the PCR screens should be analyzed by Southern blot (7). Once all screens have been completed, the drug marker can be removed using a Cre-recombinase construct driven by an endogenous galactose inducible promoter, PGAL7. The galactose promoter works by an inducible (galactose) and repressible (glucose) system (8). The inclusion of the GAL7 promoter allows for the expression of the Cre-recombinase on medium containing galactose, YPG. The PGAL7:CRE construct is introduced transiently into the strain in the presence of galactose to induce expression of the recombinase and excision of the marker. The drug marker can then be used again in the same strain to delete a different gene (4). Figure 1 provides a schematic of the recycling strategy for the loxP–G418–loxP drug marker using the deletion of LAC1 as an example.

2. Materials 2.1. Growth Media

Prepare all media with deionized water. Add 2% Bacto agar to medium used for plates. 1. YPD: 1% yeast extract, 2% bacto-peptone, and 2% dextrose. 2. YPG: 1% yeast extract, 2% bacto-peptone, and 2% galactose.

6

Cre-lox Marker Recycling in C. neoformans

87

Fig. 1. G418 marker recycling strategy. (a) Flanking loxP sites (triangles) were added to the 2.7 kb G418 drug marker and ligated into a plasmid to create vector pJL517. (b) Vector pJL517 and genomic DNA were used as templates in an overlap PCR that resulted in loxP–G418–loxP cassette flanked by the 5¢ and 3¢ UTR of LAC1. The native LAC1 (4.6 kb between primers LAC1-7 and LAC1-8) was replaced through homologous recombination with this construct. (c) The strain created in (b) was transformed with the uncut plasmid, pJL519 (CRE-recombinase); CRE was transiently expressed by growth on galactose induction medium. Translated Cre-recombinase (ovals) binds to the two-loxP sites. The 2.7 kb G418 construct is looped out, resulting in a PCR product that is 2.0 kb. Reproduced from Patel 2010 with permission from Elsevier (4).

3. For selective YPD or YPG media, add 100 μg/mL nourseothricin or 200 μg/mL geneticin (G418), or 200 U/mL hygromycin. 4. Regeneration medium: 1 M sorbitol, 1 M mannitol, 0.9% yeast nitrogen base, 2.6% glucose, 0.0267% yeast extract, 0.054% bacto-peptone, 0.133% gelatin.

88

L.G. Baker and J.K. Lodge

2.2. Positive Selectable Markers Flanked with lox P Sites (Fig. 2a)

All plasmid constructs are derived from the Invitrogen vector pCR2.1, which is resistant to ampicillin, and are maintained in Escherichia coli (Invitrogen TOP10).Vector sequences are available at the National Center for Biotechnology Information http:// www.ncbi.nlm.nih.gov (see Note 1): 1. G418: Strain #JL517 contains plasmid #pJL517 (4), loxP:PACTIN:G418:TNMT:loxP. 2. HYG: Strain #JL529 contains plasmid #pJL529 (4), loxP:PACTIN:HYG:TGAL7:loxP. 3. NAT: Strain #JL531 contains loxP:PACTIN:NAT:TTRP1:loxP.

2.3. Cre-Recombinase Constructs (Fig. 2b)

plasmid

#pJL531 (4),

All plasmid constructs are derived from the Invitrogen vector pCR2.1, which is resistant to ampicillin, and are maintained in E. coli (Invitrogen TOP10) (see Note 1): 1. G418:Cre-recombinase: Strain #JL541 contains plasmid #pJL541, PACTIN:G418:TNMT:PGAL7:CRE:TGAPDH (4). 2. NAT:Cre-recombinase: Strain #JL519 contains plasmid #pJL519, PACTIN:NAT:TTRP1:PGAL7:CRE:TGAPDH (4).

Fig. 2. Plasmid Maps. (a) Generic map of vector containing positive selectable markers G418, HYG, or NAT. Black boxes indicate M13F or M13R. Gray boxes indicate loxP sequences that flank the entire drug sequence including promoter and terminator, white boxes. (b) Generic map of vector containing the Cre-recombinase gene sequence, gray box, preceded by either the Nat or G418 selectable marker. The GAL7 promoter drives the inducible transcription of CRE (gray box) that is stabilized by the addition of the GapDH terminator, white box.

6

Cre-lox Marker Recycling in C. neoformans

89

Table 1 Primers used for LAC1 deletion construct and screening

a

Process

Primer name

Primer sequencea

lac1Δ construct

LAC1-1 LAC1-2 LAC1-3 LAC1-4 LAC1-5 LAC1-6

CAGTATGTTCCTGATTC GCTTGTTCAGATCGTCTCTCAGATAGCC GGTGTCCATAATACTCTATGCcaggaaacagctatgaccatg catggtcatagctgtttcctgGCATAGAGTATTATGGACACC catggtcatagctgtttcctgCCTCTAAGACATCCACTTTCC GGAAAGTGGATGTCTTAGAGGgttgtaaaacgacggccagtg

5¢ Recombination screen

LAC1-7 LAC1-9

TGCCTTATGCGCGAACTTCAGGTTCACC TGTGAGTGTCGGTATAGCTAC

3¢ Recombination screen

LAC1-8 LAC1-10

TTGATTTCGTTCGCTTGGTGTTTCTGCC GATCCCAATGCATTTGGACCC

Long screen

LAC1-7 LAC1-8

TGCCTTATGCGCGAACTTCAGGTTCACC TTGATTTCGTTCGCTTGGTGTTTCTGCC

5¢ G418 screen

cn Actin-7

TCCTCTCCTCCGACAACC

3¢ G418 screen

NMT-3000

AGTTTGGTCGCTCTCTGTACC

5¢ Hyg screen

cn Actin-7

TCCTCTCCTCCGACAACC

3¢ Hyg screen

cn-Gal term 50

TGTCGGAATGGACGATCGACC

5¢ Nat screen

cn Actin-7

TCCTCTCCTCCGACAACC

3¢ Nat screen

NAT-1

AATTCGTGAAGGCGGTAAGG

Loss of LAC1 screen

LAC1-11 LAC1-12

GGAGGAAGGACAAAGTATCCG CGGTCATACTTACACCCAGTCAG

CRE screen

CRE-5 CRE-6

GTTTCACTGGTTATGCGGCGG ATCGCCATCTTCCAGCAGGCGCAC

Lowercase for lac1Δ indicates drug marker cassette sequence

2.4. Polymerase Chain Reaction Primers

1. Primers for making LAC1-specific deletion construct are listed in Table 1. 2. Primers for screening of putative LAC1-specific deletion transformants are listed in Table 1.

2.5. Gel Purification of Amplicons

1. Electrophoresis rig. 2. Power supply. 3. Agarose gel (1%). 4. Qiagen gel extraction kit (see Note 3).

2.6. Transformation Material

1. Gold bead stock: Add 2 mL of 70% ethanol directly to 250 mg of 0.6-μm gold beads. Vortex well, aliquot 500 μL into four eppendorf tubes. To increase the recovery of gold beads, add

90

L.G. Baker and J.K. Lodge

an additional 2 mL of 70% ethanol to the initial suspension in the eppendorf tube. Vortex well and aliquot 500 μL to the four eppendorf tubes for a final volume of 1 mL of gold beads per eppendorf. Vortex beads 3–5 min at highest speed. Allow the beads to settle at room temperature for 15 min and then centrifuge for 5 s at 4,500 × g. Discard the supernatant. To wash the gold beads, add 1 mL sterile water then vortex at highest speed for 1 min. Allow the beads to settle for 1 min and centrifuge for 5 s at 4,500 × g. Repeat for a total of three washes. After the last wash decant, supernatant and add 1 mL of sterile 50% glycerol (glycerol is diluted with sterile water). Vortex well and store at 40°C. 2. Macrocarriers, screens, rupture disks: For each transformation, sterilize three macrocarriers and stopping screens by dipping them in 100% ethanol. Allow these to air dry inside a sterile Petri dish. Rupture disks 1,100 psi. 3. Biolistic Particle Delivery System: PDS-1000/He. a. Vacuum pump. b. Helium gas. 2.7. Genomic DNA Preparation

1. Glass beads: 425–600 μm. 2. Extraction Buffer: 550 mM Tris–HCl, pH 7.5, 20 mM EDTA, 1% SDS. 3. 5 M KOAc. 4. 5 M NaCl. 5. Phenol:chloroform:isoamyl alcohol 25:24:1, saturated with 10 mM Tris, pH 8.0, 1 mM EDTA. 6. Chloroform. 7. Isopropanol, ethanol. 8. Tris–EDTA pH 7.0.

2.8. Southern Blot Reagents

1. Membranes: Nitrocellulose. 2. Hybridization solution: (0.25 M Na2HPO4, 2 mM EDTA, 0.34% of 85% H3PO4, 7% SDS). 3. Washing solutions: 2× SSC, 0.1% SDS and 0.2× SSC, 0.1% SDS.

3. Methods 3.1. Generation of Deletion Constructs Using loxP-Flanked Drug Markers

We commonly use an overlap PCR gene deletion technology (5) to generate deletion cassettes that include drug markers (1). An example of deletion construct for the replacement of LAC1 using a loxP-flanked drug cassette is provided in Fig. 3 using primers

6

Cre-lox Marker Recycling in C. neoformans

91

from Table 1. See Subheading 3.1, step 7 below for design of primers for different genes (the C. neoformans genome URL located at http://www.broadinstitute.org/annotation/genome/ cryptococcus_neoformans/MultiHome.html). 1. Primers LAC1-1 and LAC1-4 (Table 1) to amplify approximately 1 kb of the 5¢-untranslated region (UTR) of the LAC1 using genomic DNA as the template (see Note 2). 2. Primers LAC1-3 and LAC1-6 are used to amplify the drug marker selection cassette (loxP–G418–loxP) flanked by loxP sites using the appropriate vector template DNA (plasmid DNA from vector pJL517 shown in Fig. 2a) (4). 3. Primers LAC1-5 and LAC1-2 are used to amplify approximately 1 kb of the 3¢ UTR of the LAC1 using genomic DNA as the template. 4. Electrophorese all amplicons on a 1% agarose gel and gel purify (see Note 3). 5. Use 40 ng of each of the three purified amplicons in a PCR reaction with primers LAC1-1 and LAC1-2 (see Note 4). 6. Electrophorese final PCR product and gel purify as in Subheading 3.1, step 4. Continue to transformation protocol. 7. For ease in designing overlap primers for your favorite gene (YFG), replace the 5¢ portion (capital letters) of the LAC1-3 primer with sequence from YFG while retaining the lowercase portion that contains sequence for all drug marker vectors. This will be your new primer 3. The reverse complement of this new primer will be your primer 4. For your primer 5, replace the 3¢ portion (uppercase letters) with YFG sequence while retaining the 5¢ lowercase sequence of this primer. The reverse complement of this new primer will be your primer 6. Primers 1, 2, 7, and 8 should be designed from YFG with primers 7 and 8 being at least 1.2 kb upstream or downstream of primers 3 and 6, respectively (Fig. 3 and Table 1). 3.2. Transformation of C. neoformans Using Biolistics ( 2, 6)

1. Grow cells in 50 mL YPD for 48 h in 30°C shaking at 300 rpm to late log-phase, concentrate by centrifugation (10 min, 652 × g), and resuspend in 5 mL regeneration medium. Spread 140 μL of cell suspension in a circle (approximately 3–3.5 cm in diameter) onto the center of YPD agar plate for transformation. Allow the cells to dry for approximately 30 min in a sterile environment. 2. Ethanol precipitate 1.5 μg of deletion construct DNA in a 1.5mL eppendorf tube and resuspend pellet in 5 μL sterile water. Add the following reagents to the tube containing the DNA in order: 25 μL of gold bead stock, 25 μL 2.5 M CaCl2, and 10 μL 0.1 M spermidine, after each addition mix contents by

92

L.G. Baker and J.K. Lodge

Fig. 3. Overlap PCR strategy for making an LAC1 deletion construct. The arrows indicate primer direction with numbers (1–8) above designating specific primers. Overhang region of primers (3–6) that provide homology for use during the overlap PCR process are designated by bent line at the beginning or end of primers. (a) Primers 4, 5, 7, and 8 are used as described in Subheading 3.1 with genomic DNA as a template and will produce two separate fragments. (b) Primers 3 and 4 are used with the vector containing drug selection marker as template DNA. Primers 1 and 2 are used to amplify the full-length construct from the three fragments that were produced in (a and b) Fragment designations A, B, C are listed above the DNA diagrams.

flicking tube with fingers. Vortex 3 min and allow the DNAcoated beads to settle for 1 min. Briefly spin to pellet the beads, now bound with DNA, to the bottom of the tube and remove the supernatant by aspiration. Gently wash the pellet once with 70 μL 70% ethanol and once with 70 μL 100% ethanol. Resuspend the pellet in 25 μL 100% ethanol by vortexing at medium speed for 10 min. If beads do not easily resuspend, gently pipette up and down. DNA-coated beads should be used the same day as prepared. 3. For each transformation, add 8 μL of suspended DNA-coated gold beads to each of the three sterile macrocarriers. Allow the ethanol suspending the beads to evaporate or use a vacuum dehydration system to speed up the process. Each macrocarrier should contain dried gold beads coated with approximately 0.5 μg DNA. 4. Bombard cells with dried DNA-coated gold beads using a PDS-1000/He Biolistic Particle Delivery System. This system uses helium pressure and a vacuum chamber for the delivery of the DNA-coated gold particles. Use the following parameters for the transformation of C. neoformans: Helium pressure 1,100 psi (the psi of the rupture disk), chamber vacuum of ~27 in. Hg, and target distance of 5 cm (third slot in chamber). Follow the manufacturer’s instructions for the remainder of particle delivery.

6

Cre-lox Marker Recycling in C. neoformans

93

5. Following biolistic transformation, incubate the cells at 30°C for 4 h on nonselective YPD media to allow for recovery (see Note 5). Transfer to drug-selective YPD medium by loosening the cells with 0.8 mL sterile PBS and a spreader from the nonselective plate then aspirating with a pipette. Spread the released and aspirated cells evenly onto the selective plate and place in 30°C incubator. Transformants are typically observed in 3–5 days. 3.3. Confirmation of Site-Specific Homologous Recombination of Deletion Construct (9)

Carry out passaging, DNA preparation, PCR screening, and Southern blot analysis (described below) to verify correct insertion of the antibiotic marker at the target locus. 1. Passaging: To isolate stable transformants, all transformants should be transferred (passaged) every 2 days for a total of four passages on nonselective YPD medium, the fifth and final transfer should be to YPD containing the drug appropriate for the selective marker used. Only those transformants that grow equally well on selective and nonselective media should be considered stable transformants (see Note 6). 2. Genomic DNA preparation: Genomic DNA is prepared by a modified glass bead DNA extraction protocol described (10). Suspend a large loopful of cells in a 1.5-mL microfuge tube in 500 μL extraction buffer, with 400-mg glass beads. Disrupt the cells by vortexing on highest setting for 10 min, followed by 10 min incubation at 70°C. Vortex briefly and add 200 μL 5 M KOAc and 200 μL 5 M NaCl to tubes, mix contents by inverting tubes 5–10 times. Place tubes on ice for 20 min and then centrifuge 20 min at 16,000 × g. Transfer supernatant to new tube, add 500 μL phenol/chloroform, invert to mix, and centrifuge 10 min at 16,000 × g. Transfer top aqueous phase (contains the DNA) to a new tube, add 500 μL chloroform, mix by inversion, and then centrifuge 10 min at 16,000 × g. Transfer top aqueous phase to a new tube. To precipitate the genomic DNA, add 500 μL isopropanol, mix by inversion, and allow tube to sit at room temperature for at least 20 min (see Note 7). To pellet the DNA centrifuge 10 min at 16,000 × g, decant supernatant, and gently wash pellet with 100 μL 75% ethanol. Centrifuge 10 min at 16,000 × g and aspirate ethanol from tube. Allow pellet to dry for 5 min and suspend pellet in 50 μL Tris–EDTA pH 7. 3. PCR Screening: Use 100 ng of genomic DNA for PCR screens. Carry out four separate PCR screenings to confirm homologous recombination at the desired locus and loss of gene from the genome. The first two PCR screens, 5¢ and 3¢ screen, each use three primers to verify homologous integration at the 5¢ and 3¢ ends of the deletion cassette (11) and distinguish homologous recombinants from the wild-type strain. For the first primer, use primer #7 (in the example provided LAC1-7,

94

L.G. Baker and J.K. Lodge

Table 1) a forward primer that anneals upstream of the 5¢ region (or a reverse primer that anneals downstream of the 3¢ region, LAC1-8) used for homologous recombination. Primer 2: use a primer that anneals within the drug marker sequence used in the deletion construct, which anneals in the opposite direction to Primer 7 or 8 to give a PCR product only if the strain is a transformant (see Table 1 for drug-specific primers). The third primer anneals within the deleted DNA sequence in the opposite direction to the first primer and gives a PCR product in a wild-type strain but not in a transformant. In the example provided, this would be primer LAC1-9 and LAC110, respectively (Table 1). The third PCR screen uses LAC1-7 and LAC1-8 (the same primers used in the 5¢ and 3¢ screens mentioned previously). These two primers amplify the entire integration region. This PCR screen gives a band that corresponds either with the wild-type gene length or a band that corresponds to the deleted/drug marker length. The resulting size will demonstrate that a single copy of the transforming DNA inserted at the desired locus (see Note 8). Putative transformants that pass the first three PCR screens are considered to have undergone correct site-specific homologous recombination. These are then checked for loss of the “deleted” gene using a fourth PCR screen (see Note 9). For the fourth PCR screen, design primers that will amplify a 500 bp region of the deleted gene region (i.e., both primers should lie within the deleted region). In the given example, these would be primers LAC1-11 and LAC1-12 (Table 1). Transformants that do not amplify a product in this last PCR screen are considered further and moved onto Southern blot analysis. 4. Southern blot: Southern blot analysis is used to determine if more than one integration event occurred in the genome. Use two restriction enzymes that do not cut in the drug marker sequence (Table 2). Set up a separate restriction digest for each according to the manufacturer’s recommendations using approximately 10 μg of genomic DNA from each strain. Separate the restriction fragments on a 1% agarose gel and transfer to nylon membranes with 10× SSC as transfer buffer. 5. Probe for Southern Blot: Template for Southern blot probe is prepared by PCR using primers listed in Table 3. Electrophoresis template PCR product and gel purify as in Subheading 3.1, step 4. Prepare the selectable marker-specific probe by using a random priming kit using 50 μCi dCTP according to the manufacturer’s instructions. 6. Probing, washing, and exposing Southern blot: UV cross-link the DNA to the nylon membrane. Incubate the blots in 10 mL of hybridization buffer for 1 h at 65°C, add the probe to this solution, and hybridize at 65°C overnight with rotation.

6

Cre-lox Marker Recycling in C. neoformans

95

Table 2 Restriction enzymes for Southern blot screening Marker

Restriction enzyme 1

Restriction enzyme 2

G418

NcoI

XhoI

Hyg

BglII

EcoRV

Nat

BglII

XhoI

Table 3 Primer sets and expected sizes for Southern blot probes

Template pJL529 pJL531 pJL517

Primer name

Primer sequence (5¢–3¢)

Size of PCR amplified probe (bp)

HYG-A HYG-B

GAATTCAGCGAGAGCCTGACC CGATCCTGCAAGCTCCGGATGCC

533

NAT-A NAT-B

CACTCTTGACGACACGGCTTACC TCATGTAGAGCGCCTGCTCGCC

547

G418-A G418-B

TGGATTGCACGCAGGTTCTCC TGCGAATCGGGAGCGGCGATACC

740

Wash the blots twice in 2× SSC, 0.1% SDS at room temperature for 10 min and once for 10 min in 0.2× SSC, 0.1% SDS that has been prewarmed to 65°C. Expose the blot to autoradiography film overnight at −80°C and then develop. More than one band visualized in either of the two digests for any given strain indicates that an ectopic insertion event of the deletion construct occurred. Any strain having this type of event should be removed from further analysis (i.e., keep only strains that have one band in each of the digests). 3.4. Transformation of Confirmed Deletion Strains with CreRecombinase Plasmid

Biolistically transform confirmed strains described in Subheading 3.2. **Briefly: 1. Grow cells in liquid YPG to late log-phase, concentrate, and plate onto YPG agar for biolistic transformation as described above in Subheading 3.2, step 1. 2. Coat 0.6-μm gold beads with 5 μg of nonlinerized plasmid DNA (pJL519 or pJL541, as a non-integrative construct that contains an NAT or G418-resistance cassette, respectively).

96

L.G. Baker and J.K. Lodge

3. Bombard cells as described in Subheading 3.2, step 4. 4. Follow steps described in Subheading 3.2, step 5 for cell recovery and selective plating. 5. Passage 5× for 2 days on nonselective, noninduction YPD medium as described in Subheading 3.3, step 1 (see Note 10). 6. To isolate drug marker sensitive transformants, the last passage should be spread onto three different YPD plates: (a) YPD without drug, (b) YPD supplemented with drug used for the original gene deletion, and (c) YPD supplemented with the drug used on the CRE-recombinase vector. 3.5. Analysis of Cre-RecombinaseMediated Drug Marker Excision and Loss of the PGAL7: CRE Plasmid

This step detects the loss of the original drug marker used for the deletion of YFG and the loss of the drug marker attached to the CRE-recombinase vector. 1. Prepare genomic DNA of transformants that grew only on YPD without drug and NOT on either of the YPD drug selection plates as described in Subheading 3.3, step 2. 2. Use PCR primers 7 and 8 in a PCR reaction with genomic DNA as the template to determine the size of the locus. If the selectable marker has been lost, there should be a reduction of 2.7 kb in the size of the PCR product (see Fig. 4). 3. To determine the loss of the plasmid containing the CRE recombinase gene, all positive transformants should be screened with CRE-specific primers that amplify a 500 bp fragment of CRE (Table 1). Use the pJL519 or pJL541, DNA template as a positive control for the PCR primers.

Fig. 4. Gel electrophoresis of PCR products using LAC1-specific primers LAC1-7 and LAC1-8 for (1) wild-type LAC1, (2) lac1ΔG418R, and (3) lac1ΔG418S. Molecular weights listed to the left side of gel image. Image is reverse negative of original. Reproduced from Patel 2010 with permission from Elsevier (4).

6

Cre-lox Marker Recycling in C. neoformans

97

4. Notes 1. All vectors are available upon request. National Center for Biotechnology Information accession numbers for the vectors are: pJL517 #JF295004, pJL519 #JF295003, pJL529 #JF295005, pJL531 #JF295006, and pJL541 #JF295007. 2. PCR notes and conditions that can be applied to Subheading 3.1, steps 1 and 3. To aid specificity in our PCR amplifications, we include 1.5 M betaine in our reaction mix. Betaine is used as an enhancing agent that increases yield and the specificity of the PCR product by facilitating strand separation. Additionally, to reduce PCR errors we use a high-fidelity polymerase that has proof reading abilities like TaKaRa Ex Taq. We also use fewer total PCR cycles, 25 rather than 35, when making our fragments as well as the complete construct. Example PCR conditions follow: Initial denaturation at 94°C for 5 min followed by 25 cycles of 94°C for 30 s, 58.5°C for 15 s, and 72°C* for 4 min, with a final extension at 72°C* for 10 min. A 25 μL reaction will usually yield enough material for subsequent steps. *Note that some high-fidelity DNA polymerases require a lower extension temperature so refer to the manufacturer’s instructions. 3. We use Qiagen Gel extraction kit as per manufactures instructions; however, any kit or method can be used. 4. Follow PCR conditions as described above in Note 1 with the following exceptions: Increase the extension step during cycling from 4 to 8 min, and to produce enough material for transformation, make eight 50 μL reactions giving a total of 400 μL PCR product for purification in Subheading 3.1, step 6. This step, where all of the different fragments are being “stitched” together, can be problematic. There are several different trouble-shooting techniques that can be used: First, optimize the annealing temperature for the PCR, for example by using a gradient PCR. Secondly, using primers from Table 1, the fragments can be assembled in sections that would supply a larger region of homology between the fragments (A + B, B + C, followed by AB + BC, Fig. 3). 5. Typically all transformations are incubated at 30°C, but when a transformation yields few or no putative transformants, switching all incubations to 25°C can increase the number of transformants that are recovered. This change especially helps if the deletion leads to a temperature sensitive phenotype. 6. The deletion construct can behave as an extrachromosomal episome. As extrachromosomal episomes are not stably maintained in C. neoformans, the passaging process on nonselective medium helps to insure their loss.

98

L.G. Baker and J.K. Lodge

7. At this step, the DNA preps can be left on the bench top for up to 3 days or for longer in 4°C. 8. On rare occasions more than one deletion construct will integrate at the desired locus. Although this event still causes the deletion of the gene, we are uncertain to the stability of this multideletion construct integration. Thus, we tend to discard any strains that have undergone this type of integration event. 9. During biolistic transformation, the “deleted” gene can reintegrate ectopically elsewhere into the genome. This final PCR screen insures a reintegration event of the gene of interest did not occur. Alternatively, a gene of interest by Southern blot would yield the same information. 10. During this time, transcription and translation of Crerecombinase is occurring with the subsequent excision of the drug marker in the gene of interest.

Acknowledgments This work was supported by NIH-NIAID grants R01AI072185 and R01AI050184 to JKL. References 1. McDade, H., and Cox, G. (2001) A new dominant selectable marker for use in Cryptococcus neoformans. Med Mycol 39, 151–154. 2. Hua, J., Meyer, J., and Lodge, J. (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin Diagn Lab Immun 7, 125–128. 3. Sauer, B., and Henderson, N. (1988) Sitespecific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci USA 85, 5166–5170. 4. Patel, R. D., Lodge, J. K., and Baker, L. G. (2010) Going green in Cryptococcus neoformans: The recycling of a selectable drug marker. FG & B 47, 191–198. 5. Davidson, R., Blankenship, J., Kraus, P., Berrios, M., Hull, C., D’Souza, C., Wang, P., and Heitman, J. (2002) A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 138, 2607–2615. 6. Toffaletti, D. L., Rude, T. H., Johnston, S. A., Durack, D. T., and Perfect, J. R. (1993) Gene transfer in Cryptococcus neoformans by use of

biolistic delivery of DNA. J Bacteriol 175, 1405–1411. 7. Missall, T. A., Pusateri, M. E., and Lodge, J. K. (2004) Thiol peroxidase is critical for virulence and resistance to nitric oxide and peroxide in the fungal pathogen, Cryptococcus neoformans. Molecular Microbiology 51, 1447–1458. 8. Ruff, J. A., Lodge, J. K., and Baker, L. G. (2009) Three galactose inducible promoters for use in C. neoformans var. grubii. FG AND B 46, 9–16. 9. Baker, L. G., Specht, C. A., Donlin, M. J., and Lodge, J. K. (2007) Chitosan, the deacetylated form of chitin, is necessary for cell wall integrity in Cryptococcus neoformans. Eukaryot Cell 6, 855–867. 10. Fujimura, H., and Sakuma, Y. (1993) Simplified isolation of chromosomal and plasmid DNA from yeasts. Biotechniques 14, 538–540. 11. Nielsen, K., Cox, G. M., Wang, P., Toffaletti, D. L., Perfect, J. R., and Heitman, J. (2003) Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and alpha isolates. Infect Immun 71, 4831–4841.

Chapter 7 Gene Disruption in Aspergillus fumigatus Using a PCR-Based Strategy and In Vivo Recombination in Yeast Iran Malavazi and Gustavo Henrique Goldman Abstract Aspergillus fumigatus is a ubiquitous, filamentous fungal saprophyte and is the causative agent of the vast majority of aspergillosis in that invasive aspergillosis is the life-threatening form of infection by this fungus. The study of gene function using null mutants in this organism can be achieved through DNA-mediated transformation with an engineered deletion cassette containing about 2 kb of the 5¢- and 3¢-flanking region of the target gene and a selectable marker. Here, we describe the use of a PCR-based strategy and “in vivo” recombination in Saccharomyces cerevisiae to produce gene deletion cassettes for A. fumigatus, using an auxotrophic marker for gene replacement. This protocol produces highly effective deletion cassettes and permits the rapid disruption of genes identified in the recently available A. fumigatus genome. Key words: Aspergillus fumigatus, “In vivo” recombination, Saccharomyces cerevisiae, Gene replacement cassette, Gene disruption

1. Introduction Aspergillus fumigatus is a saprophytic ubiquitous filamentous fungus with a key role in carbon and nitrogen recycling in soil. However, it is also the causative agent of the vast majority of aspergillosis cases, although the mechanisms whereby this species becomes one of the most prevalent opportunistic pathogens are currently not fully understood. Apparently, the factors involved in the survival of this organism in the environment outside the host, e.g., in compost pile or soil under conditions of limited oxygen, thermal variation, and competition for nutrients, might contribute to its success as an opportunistic pathogen in humans. A. fumigatus colonizes the lungs of immunocompromised individuals, leading to invasive aspergillosis, the life-threatening form of infection. The mortality

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_7, © Springer Science+Business Media, LLC 2012

99

100

I. Malavazi and G.H. Goldman

rates for invasive aspergillosis are as high as 95% in patients receiving hematopoietic stem cell transplants under immunosuppressive regimens (1). For this reason, the study of gene function in this opportunistic pathogen has become essential to elucidate the genes and pathways that orchestrate the host interaction, the adaptation of the fungus to the mammalian environment, and, as a consequence, the virulence of A. fumigatus. DNA-mediated transformation of exogenous deletion cassettes targeted to genes of interest has been used successfully in this organism. The ability to introduce an engineered mutation in an organism is vital for both forward and reverse genetic analysis. Reverse genetics, in which the analysis of gene function starts with a cloned uncharacterized gene, relies substantially on methods that interfere in the function of the gene product. Forward genetics, where the analysis of gene function analysis starts with the isolation of a mutant, also employs gene replacement methodologies to confirm predicted phenotypes, for example, by the generation of gainof-function mutants. The generation of deletion cassettes for A. fumigatus gene disruption using a PCR-based strategy and “in vivo” recombination in yeast is based on the procedures first described by Baudin et al. (2) where PCR was used to create gene disruption cassettes for Saccharomyces cerevisiae. However, an important difference between A. fumigatus and S. cerevisiae gene disruption lies in the conditions required by these two organisms for homologous recombination to occur. S. cerevisiae is widely known for its capability to undergo homologous recombination with efficiency rates as high as 95%. Hence, very short DNA sequences are required and an ordinary gene disruption cassette for S. cerevisiae would present about 50–80 bp of homology to the target gene. In contrast, A. fumigatus (and other Aspergillus species) requires sequences of about 1,500–2,000 bp of homology to maximize the frequency of homologous recombination over nonspecific genome integration, which is driven by the mechanism of nonhomologous end joining (NHEJ). To minimize the effects of NHEJ, engineered strains of this organism lacking the main proteins involved in this processes (akuAKU70 and akuBKU80) are now available (3, 4) and offer high rates of homologous integration frequencies through the exclusive activity of the homologous recombination system. Therefore, A. fumigatus null mutants are being generated more rapidly because mutant screening and confirmation is required for a significantly reduced number of candidates. The power of genetic manipulation and screening in the model organism S. cerevisiae is exploited in this technique where the 5¢- and 3¢-flanking regions of a target A. fumigatus gene are fused to a selectable marker. This generates a deletion cassette suitable for DNA-mediated transformation in this fungus. High efficiency and lowtime consumption in generating deletion cassettes is desirable for all applications in A. fumigatus, which has a sexual cycle that still cannot be fully exploited in terms

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

101

of classical genetics. Strain construction, therefore, depends upon the successive manipulation of a single strain. Other methodologies have been described for constructing deletion cassettes through PCR-mediate protocols in Aspergillus spp., such as fusion PCR or overlap PCR (5, 6). Although these techniques have been used conveniently, they largely depend on the ability of the DNA polymerase used in the reaction to perform the fusion of the three independent fragments. Consequently, difficulties have arisen in the PCR amplification of some constructs, leading to inconclusive PCR results and no cassette generation. Our PCR-based strategy and “in vivo” recombination in yeast is conceptually the same as overlap PCR, but S. cerevisiae joins the three independent fragments instead of submitting them to PCR amplification. The same approach has been used successfully in another filamentous fungus, Neurospora crassa, for the high throughput production of gene deletion cassettes (7). We have chosen a PCR-based strategy coupled with the “in vivo” recombination in yeast to permit the rapid disruption of genes identified in the newly available A. fumigatus genome sequence (8).

2. Materials We recommend using ultrapure reagents and double-deionized water (18 MΩ at room temperature) for all solutions and media. Stock solutions may be stored at room temperature after autoclaving, unless indicated otherwise. 2.1. Media for S. cerevisiae, A. fumigatus, and Escherichia coli Cultivation

1. YPD medium for S. cerevisiae growth: 1% w/v yeast extract, 2% w/v peptone, and 2% w/v dextrose. In a glass beaker, dissolve the yeast extract, peptone and dextrose in approximately half of the desired volume (see Note 1). Stir the components with a magnetic bar until they are completely dissolved (see Note 2). Adjust the pH to 6.5 with NaOH 1 M and top up to the final volume. To prepare solid YPD, add 2% (w/v) bacteriological agar. Sterilize in autoclave and store at room temperature (see Note 3). 2. Synthetic complete medium for S. cerevisiae without uracil (SC URA−): 0.67% w/v yeast nitrogen base without amino acids, 2% w/v glucose, 0.01% w/v leucine, 0.01% w/v lysine, 0.01% w/v tryptophan, 0.005% w/v histidine (see Note 4). Make up medium as in Subheading 2.1, item 1 and adjust the pH to 6.5 with NaOH 1 M. For solid SC URA− add 2% (w/v) bacteriological agar. Sterilize in autoclave for 15 min. Store at room temperature. 3. YG (Yeast Extract Glucose) medium for A. fumigatus growth: 0.5% w/v yeast extract, 2% w/v glucose, 0.1% v/v trace elements

102

I. Malavazi and G.H. Goldman

solution. Make up medium as in Subheading 2.1, item 1. For solid YG (YAG) add 2% (w/v) bacteriological agar. Sterilize in autoclave for 15 min. Store at room temperature. For growth of the A. fumigatus pyrG− strain (i.e., a strain carrying a mutation in the pyrG gene) add 1.2 mg/L of each uridine and uracil to YG or YAG (see Note 5). A recipient uridine–uracil auxotrophic strain (e.g., ΔKU80 pyrG-; see ref. (3)) will be used for the deletion cassette transformation in the fungus. 4. A. fumigatus protoplast regeneration medium (YAG + KCl): Add 0.6 M KCl (44 g/l) to YAG medium (see Subheading 2.1, item 3) to protect the transformant protoplasts from osmotic lysis. Do not supplement with uridine and uracil (see Note 6). 5. A. fumigatus protoplast regeneration medium “top agar” (YAG + KCl top agar): Add 1% (w/v) bacteriological agar to YAG + KCl (see Subheading 2.1, item 4 and Note 7). 6. LB (Luria Bertani) medium for E. coli propagation: 0.5% w/v yeast extract, 1% w/v tryptone, 0.5% NaCl. Make up medium as in Subheading 2.1, item 1. Sterilize in autoclave for 15 min. Store at room temperature. To prepare solid LB add 2% (w/v) bacteriological agar. 2.2. Solutions

1. Trace elements solution for A. fumigatus media (1 L of ×1,000 stock): 22 g ZnSO4⋅7H2O, 11 g H3BO3, 5 g MnCl2⋅4H2O, 5 g FeSO4⋅7H2O, 1.6 g CuSO4⋅5H2O, 1.6 g CoCl2⋅6H2O, 1.1 g (NH4)6Mo7O24⋅4H2O, 50 g EDTA. Dissolve each component in the indicated order being sure that the first is fully dissolved before adding the next. Heat the solution until boiling. Cool until 60°C and adjust the pH to 6.5–6.8 using KOH pellets. Store in the dark at room temperature. A precipitate will eventually appears, shake the bottle before using. 2. EDTA 0.5 M, pH 8.0 (1 L): 146.15 g anhydrous EDTA (C10H16N2O8). Add to a glass beaker containing 500 mL of water and a magnetic stirrer. Adjust the pH to 8.0 with NaOH pellets to achieve EDTA complete dissolution (see Note 8). Adjust the volume to 1 L with water. Store at room temperature. 3. TE (Tris–EDTA) Buffer (×10 stock): 100 mM Tris–HCl; 10 mM EDTA, pH 7.5. For 1 L weigh 12.11 g of Tris base (Tris(hydroxymethyl)aminomethane). Add 20 mL EDTA 0.5 M (see Subheading 2.2, item 2). After complete dissolution of Tris, bring the pH to 7.5 using fuming HCl (see Note 9) and make up to 1 L with water. Autoclave for 15 min and store indefinitely at room temperature. 4. Lithium acetate 1 M (1 L of ×10 stock): 66 g of lithium acetate. Make up solution as in Subheading 2.2, item 2. Bring pH to 7.5 with 1 M acetic acid. Make up to 1 L with water. Autoclave for 15 min and store indefinitely at room temperature.

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

103

5. TE 1×/lithium acetate 1×: prepare just before use by mixing 1 volume 10× TE buffer, pH 7.5; (Subheading 2.2, item 3), 1 volume 10× lithium acetate stock solution (Subheading 2.2, item 4) and 8 volumes sterile water. 6. Polyethyleneglycol 3350 (PEG) 250 mL 50% (w/v) stock solution: 125 g of polyethyleneglycol MW 3350 (see Note 10). Add to a glass beaker containing 100 mL of water using a magnetic stirrer and heating. Make up to 250 mL with water and autoclave for 15 min. Store indefinitely at room temperature. 7. Lithium acetate 1× PEG 40%: prepare just before use by mixing 1 volume 10× lithium acetate stock solution (Subheading 2.2, item 4), 8 volumes 50% PEG 3350 (Subheading 2.2, item 6), and 1 volume 10× TE buffer, pH 7.5 (Subheading 2.2, item 3). 8. Sheared salmon sperm DNA (100 mL 10 mg/mL stock): 1 g of Type III salmon DNA sperm sodium salt. Dissolve Type III salmon DNA sperm sodium salt or native deoxyribonucleic acid in about 80 mL of water (see Note 11). Make up to 100 mL. Fragment the DNA by sonication cycles on ice. After shearing, store the stock at −20°C in small aliquots (see Note 12). 9. Tris–HCl 1 M, pH 8.5 (1 L): 121 g Tris base. Make up solution as in Subheading 2.2, item 2. Bring to pH 8.5 with fuming HCl. Make up to 1 L with water. 10. 10% SDS (w/v) stock (1 L): 100 g of SDS. Make up solution as in Subheading 2.2, item 2. Make up to 1 L with water. Store indefinitely at room temperature (see Note 13). 11. Lysis buffer for A. fumigatus and S. cerevisiae genomic DNA extraction: 200 mM Tris–HCl pH 8.5; 250 mM NaCl; 25 mM EDTA; 0.5% SDS (w/v). For 1 L, 200 mL Tris–HCl pH 8.5 (Subheading 2.2, item 9), 50 mL 0.5 M EDTA (Subheading 2.2, item 2), 50 mL of SDS stock (Subheading 2.2, item 10), and 14.61 g of NaCl. Make up to 1 L with water. Store indefinitely at room temperature for up to 1 year. 12. Phenol/chloroform (1:1): Mix 1:1 (v/v) buffered phenol solution (equilibrated with 10 mM Tris–HCl, pH 8.0, 1 mM EDTA) and chloroform (see Note 14). 13. MgSO4⋅7H2O 1 M (1 L): 246.47 g MgSO4⋅7H2O. Make up solution as in Subheading 2.2, item 2. Make up to 1 L with water. Autoclave for 15 min and store indefinitely at 4–8°C. 14. A. fumigatus protoplasting solution 1: 0.8 M (NH4)2SO4, 100 mM citric acid, pH 6.0. For 100 mL, 10.57 g ammonium sulfate, and 1.92 g anhydrous citric acid. Bring the pH to 6.0 with KOH 1 M and make up to 100 mL with water. Autoclave for 15 min and store indefinitely at 2–8°C. 15. A. fumigatus protoplasting solution 2: 1% (w/v) yeast extract, 2% (w/v) sucrose. Autoclave for 15 min and store indefinitely at 4–8°C.

104

I. Malavazi and G.H. Goldman

16. A. fumigatus lytic solution: just before use mix aseptically in a 50 mL conical tube 20 mL protoplasting solution 1 (Subheading 2.2, item 14), 20 mL protoplasting solution 2 (Subheading 2.2, item 15), 6.5 mL magnesium sulfate 1 M (Subheading 2.2, item 13), 400 mg of bovine albumin serum (Sigma B4287), and 300–500 mg of Glucanex 200G (Novozyme) or Lallzyme MMX (Lallemand) (see Note 15). Mix the components and allow the BSA and lytic enzymes do dissolve completely. Filter the lytic solution in a 0.45-μm filter using a sterile syringe (see Note 16). 17. A. fumigatus protoplasting solution 3: 0.4 M (NH4)2SO4, 1% sucrose, 50 mM citric acid. For 100 mL, 5.3 g (NH4)2SO4, 1 g sucrose, 0.96 g of anhydrous citric acid. Bring the pH to 6.0 with KOH 1 M and make up to 100 mL with water. Autoclave for 15 min and store indefinitely at 4–8°C. 18. A. fumigatus protoplasting solution 4: 25% (w/v) PEG 6000, 100 mM CaCl2, 0.6 M KCl, 10 mM Tris–HCl pH 7.5. For 100 mL, 25 g PEG MW 6000, 1.1 g anhydrous CaCl2, 4.5 g KCl. Add 10 mL Tris–HCl 100 mM pH 7.5 (Subheading 2.2, item 3). Make up to 100 mL with water. Autoclave for 15 min and store indefinitely at 2–8°C (see Note 17). 19. MES 100 mM solution: For 100 mL 2.13 g monohydrate MES (2-(N-morpholino)ethanesulfonic acid). Make up solution as in Subheading 2.2, item 2. Bring to pH 6.0 with 1 M KOH. Make up to 100 mL with water. Autoclave for 15 min and store indefinitely at 4–8°C. 20. A. fumigatus protoplasting solution 5: 0.6 M KCl, 50 mM CaCl2, 10 mM MES. For 100 mL, 4.5 g KCl, 0.55 g anhydrous CaCl2, 10 mL 100 mM MES pH 6.0 (Subheading 2.2, item 19). Make up to 100 mL with water. Autoclave for 15 min and store indefinitely at 4–8°C.

3. Methods 3.1. A. fumigatus Genomic DNA Extraction

1. Inoculate 50 mL YG in a 250 mL Erlenmeyer flask with a fresh suspension of 1 × 107 conidia/mL of A. fumigatus Afu293 strain (8) (see Notes 18 and 19). Incubate in a reciprocal shaker at 37°C (250 rpm) for 16 h. Harvest the mycelium by filtration through a Whatman number 1 filter using a vacuum manifold. Wash the mycelium thoroughly with sterile water and snap freeze in liquid nitrogen. 2. Use a pestle and mortar to disrupt the frozen mycelium by grinding to a fine powder (see Note 20). Rapidly transfer about 100 mg of the disrupted mycelium to a 1.5 mL microfuge tube

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

105

(this weight will fill about half of the microfuge tube), add 500 μL of lysis buffer, and vortex thoroughly (see Note 21). Add 500 μL phenol/chloroform (1:1) and vortex the mixture for 10 min to extract nucleic acid. Centrifuge for 15 min (20,800 × g) to clarify the lysate and precipitate proteins. 3. Transfer the aqueous (top) phase to a new 1.5 mL microfuge tube. Add an equal volume of chloroform (~500 μL). Briefly vortex then centrifuge for 5 min at 20,800 × g. 4. Transfer the aqueous phase to a new microfuge tube and add 500 μL of isopropanol to precipitate nucleic acid. Centrifuge for 5 min (20,800 × g) to pellet DNA. 5. Discard the supernatant and wash the pellet with 500 μL cold 70% ethanol. 6. Centrifuge for additional 5 min and discard the ethanol. Air-dry the DNA pellet. 7. Suspend the pellet in 100 μL of DNAse-free water (see Note 22). 8. Store at 4–8°C for use as template DNA in PCR. The quality of genomic DNA extracted should be checked on a 1% agarose gel. A smeared band indicates that shearing has taken place, which renders the DNA unsuitable for use as a PCR template. 3.2. Target Gene Disruption, Primer Design, and PCR Reactions

A set of three pairs of primers must be designed for each gene disruption and will amplify three independent fragments for transformation into the S. cerevisiae recipient strain (FGSC 9721 or FY834 (9)). Two pairs of primers amplify the 5¢- and 3¢-flanking region of the target gene using the template DNA obtained in Subheading 3.1 from the Afu293 strain. The third amplifies the selectable marker from plasmid pCDA21 (10) (Fig. 1a). The selectable marker will replace the targeted allele in the A. fumigatus genome and allow the identification of cells that have incorporated the exogenous piece of DNA. Here we use the most commonly used auxotrophic marker in A. fumigatus, the pyrG gene, which encodes the enzyme orotidine 5¢-phosphate decarboxylase, a gene essential for the synthesis of purines (see Note 23). 1. Design primers to amplify a region of about 2,000 bp each side of the target gene named as ORF 5F/ORF 5R or ORF 3F/ ORF 3R in Fig. 1a (see Notes 24 and 25). 2. Design primers 5F and 3R with homologous sequences to plasmid pRS426 (curved lines in Fig. 1a). For a BamHI/EcoRI cut plasmid, the homologous sequence for the primers 5F and 3R are indicated in Table 1. 3. Linearise pRS426 in a BamHI and EcoRI double-digest (see Notes 26 and 27). In a total volume of 20 μL, add ~5 μg of circular pRS426, 2 μL 10× Restriction Buffer, and 5 U of each enzyme per microgram of plasmid. Make up to 20 μL with

106

I. Malavazi and G.H. Goldman

a ORF 3R

ORF 5R target gene (ORF) ORF 3F

ORF 5F

pyrG FW

pyrG REV

pyrG (Afu2g08360) marker gene template plasmid

b

ORF 3’ flanking region

ORF 5’ flanking region

ORF 5F

pyrG (marker)

ORF 3R

pRS426

URA3

ampR

Fig. 1. Schematic diagram for A. fumigatus gene deletion cassette generation strategy using PCR-based strategy and “in vivo” recombination in S. cerevisiae. (a) A DNA sequence of about 2 kb flanking the target gene to be deleted is obtained using bioinformatics tools available at the A. fumigatus repository databases such as CADRE. These flanking regions are selected for primer design. The primers can be conveniently named as ORF 5F and ORF 5R (to amplify 5¢-flanking region) and primers ORF 3F and ORF 3R which amplifies the 3¢-flanking region. The primers ORF 5F and ORF 3R contains a short homolog sequence to the multiple cloning site the shuttle plasmid pRS426 (curved lines in the scheme). The selectable marker pyrG gene is amplified from a template plasmid harboring the pyrG gene (pCDA21) using the primers pyrG FW and pyrG REV. To promote the fragments fusion, primers ORF 5R and ORF 3R have 5¢ tails homologous to the pyrG gene (zigzag lines) (see Table 1 for primer sequences). Cassette generation is achieved by transforming each independent fragment along with the plasmid pRS426 BamHI/EcoRI cut in the S. cerevisiae strain FGSC9421. (b) Homologous recombination taking place in yeast cells fuses the three independent fragments and generates a circular construct in pRS426. The deletion cassette can be obtained by PCR amplification using the outermost primers ORF 5F and ORF 3R.

MilliQ water and incubate at 37°C for 3–5 h. The digested product can be used for transformation without further purification. Use approx. 200–500 ng plasmid in 5–10 μL per reaction (Table 2).

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

107

Table 1 Primer sequences used in this protocol Primer

Sequence

ORF 5F

5¢-GTAACGCCAGGGTTTTCCCAGTCACGACGnnnnnnnnnnnnnnnnnnnn-3¢

ORF 5R

5¢-GCCTCCTCTCAGACAGAATTCCNNNNNNNNNNNNNNNNNNNN-3¢

ORF 3F

5¢-GTTTGAGGCGAATTCGATATCNNNNNNNNNNNNNNNNNNNN-3¢

ORF 3R

5¢-GCGGATAACAATTTCACACAGGAAACAGCnnnnnnnnnnnnnnnnnnnn-3¢

pyrG FW

5¢-GGAATTCTGTCTGAGAGGAGGC-3¢

pyrG REV

5¢-GATATCGAATTCGCCTCAAAC-3¢

For primers 5F and 3R, “n” indicates the bases referring to the 5¢- and 3¢-flanking regions of the targeted ORF to be designed and the underlined regions are those encompassing the BamHI/EcoRI-digested pRS426 vector For primers 5R and 3F, the homologous regions to the marker gene (pyrG ) are underlined and correspond to the reverse and complementary sequences of primers pyrG FW and pyrG REV. “N” indicates de sequence of 5¢- and 3¢-flanking regions of the targeted ORF See also Fig. 1 for primers locations

Table 2 Yeast transformation components and reactions Tube

Plasmid

PCR products and primers

10 mg/mL sheared salmon sperm DNA a

Purpose

1

–

–

20 μL

Negative control

2

Circular pRS426 (200–500 ng)

–

20 μL

Positive control

3

pRS426 (EcoRI/BamHI digested) (200–500 ng)

ORF 5¢-flanking (0.5–1 μg) ORF 3¢-flanking (0.5–1 μg) pyrG marker (0.5–1 μg)

20 μL

Cassette construction

a

Salmon DNA sperm must be denatured before added to the reaction. Immediately before use, heat the stock for 5 min in a boiling-water bath and quickly chill on ice before use

4. Include the homologous sequences to the 5¢ and 3¢ ends of the pyrG (Afu2g08360) marker gene in primers 5R and 3F (zigzag lines, Fig. 1a) (see Table 1 for sequences). 5. The resulting 40–50 nucleotide primers contain 20 nucleotides which bears homolog sequences either of pRS426 or to the marker gene. This overall primer length allows efficient recombination “in vivo” in yeast and can be synthesized at reasonable costs. Another outstanding advantage of this system is that the

108

I. Malavazi and G.H. Goldman

marker genes can be designed without reciprocal homologous sequences to the 5¢ or 3¢ fragment (gray large arrows Fig. 1a). So, for each ORF deletion using the same marker gene, only two pairs of primers are necessary for synthesis. 6. Resuspend primers in water as 100 μM stock and make a further 20 μM dilution. Make up a 50 μL PCR reaction as follows: 200 mM each dNTP, 200 ng template genomic DNA, 1 μL 20 μM primers, 5 μL 10× PCR Buffer, and 1 U of Taq DNA polymerase with proof-reading capability. Perform PCR as follows: 94°C for 2 min, 36–38 cycles at 94°C, 50 s; 60°C, 50 s; 72°C, 2 min; and a final extension of 72°C for 10 min (see Note 28). 7. Run the entire volume of the three PCR reactions onto a 1% agarose gel to confirm the correct products. 8. Excise the amplicons from the gel using a scalpel and gel-purify using a commercially available kit. 9. Elute the purified PCR products in 20 μL water. Use approx. 200–500 ng of each fragment (~5–10 μL) for the transformation (see Table 2). 3.3. S. cerevisiae Transformation and Deletion Cassette Construction

This transformation protocol is a variation of that described by Gietz et al. (11) (see Note 29). 1. Pick a single colony (~3–5 mm diameter) of S. cerevisiae strain FGSC 9721 from a freshly streaked solid YPD plate and inoculate 10 mL liquid YPD in a 50 mL tube. Incubate for 18–24 h with agitation at 30°C. 2. Inoculate 500 μL of the overnight culture into 50 mL YPD in a sterile 250 mL Erlenmeyer flask. Incubate at 30°C on a shaker for 4–5 h until the absorbance at 600 nm reaches 0.4–0.6 (early log phase) (see Notes 30 and 31). 3. Pellet the cells in a 50 mL centrifuge tube for 2 min at 1,000 × g. 4. Discard the medium and wash the cells with 20 mL of freshly prepared 1× TE, pH 7.5. Pellet the cells (1,000 × g for 2 min). Discard the TE. 5. Suspend the pellet in 800 μL of TE 1×/lithium acetate 1×. 6. Incubate at 30°C for 60 min with moderate shaking. 7. Dispense 200 μL aliquots of cell suspension into microfuge tubes as indicated in Table 2. 8. Incubate tubes at 30°C for 30 min with moderate shaking. 9. Add 1.5 mL lithium acetate 1× PEG 40% to each tube. Mix by inversion and incubate at 42°C for 30 min. 10. Pellet the cells in a microfuge at 2,500 × g for 1 min. 11. Wash the pellet with 1 mL of sterile TE 1×, pH 7.5.

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

109

12. Pellet the cells (2,500 × g; 1 min) and suspend in 80–100 μL of sterile TE 1×. 13. Spread the cells on SC URA− plates using a Drigalski spatula and incubate at 30°C for 3–5 days to visualize recombinant yeast cells. 3.4. Isolation of Recombinant Plasmid from Yeast Genomic DNA

We use a common procedure to prepare yeast genomic DNA but we are interested in the recombinant plasmids pRS426 extracted concomitantly. 1. From the SC URA− transformation plates (number 3 Table 2), choose about 10 colonies for assessing the “in vivo” homologous recombination of the three independent PCR fragments within the plasmid pRS426. 2. Inoculate the colonies in 15 mL SC URA− in 50 mL tubes. 3. Incubate with vigorous shaking at 30°C for 2 days. 4. Harvest cells in a tabletop centrifuge (5 min, ~3,200 × g). 5. Suspend cells in 500 μL lysis buffer and transfer to a 2 mL microfuge tube. Add the same volume of 2- to 4-mm diameter acid-washed glass beads (see Note 32). 6. Vortex vigorously for 10 min. 7. Transfer the lysate to a fresh 1.5-mL screw-cap microfuge tube and add the same volume of phenol:chloroform (1:1). Cap the tubes securely and vortex for 10 min. 8. Microfuge for 10 min at 20,000 × g. 9. Remove the upper aqueous phase to a fresh 1.5-mL microfuge tube. 10. Add 1 mL isopropanol and mix thoroughly by inverting to precipitate DNA (see Note 33). 11. Microfuge for 5 min at maximum speed. Discard the supernatant. 12. Wash the nucleic acid pellet with 500 μL of 70% cold ethanol. Centrifuge again at maximum speed for 5 min and discard the supernatant. 13. Air-dry the pellet for ~15 min at room temperature. 14. Suspend the pellet in 50 μL DNAse-free water. DNA can be stored at −20°C. 15. Proceed with yeast genomic DNA dialysis prior to electrotransformation in E. coli. 16. Pour 30–50 mL water into a petri dish. Float a 25-mm diameter, Type-VS Millipore membrane shiny side up on the dialysis water (see Note 34). Allow the floating filter to wet completely (~5 min) before proceeding. Make sure that there are no air bubbles trapped under the filter.

110

I. Malavazi and G.H. Goldman

17. Carefully pipette about 20 μL of the yeast genomic DNA preparation (Subheading 3.4, step 14) onto the center of the membrane filter. 18. Cover the petri dish and dialyze for 1–1.5 h (see Note 35). 19. Carefully recover the DNA droplet with a micropipette in a microfuge tube and vacuum-dry the DNA solution to approx. 10 μL (see Note 36). 20. Use the entire sample to transform E. coli electrocompetent cells though the standard electroporation technique (see Note 37). 21. Set the electroporation device (e.g., BioRad Gene Pulser) to 2.5 kV, 25 μF, and 200 Ω (see Note 38). 22. From now on work on ice. Chill the electroporation cuvettes Thaw frozen E. coli electrocompetent cells on ice just prior to use. 23. Transfer the DNA and cells to the bottom of a prechilled electroporation cuvette. Wipe the ice and water from the cuvette outside surface. 24. Insert the cuvette into the electroporator chamber and apply the pulse. Immediately remove the cuvette from the chamber, add 800–1,000 μL LB and transfer the sample to a 15 mL tube. Incubate at 37°C with shaking (200 rpm) for 1 h. 25. Evenly spread 200–500 μL of the transformation culture on LB plates containing 100 μg/mL of ampicillin for the selection of positive clones. Incubate at 37°C overnight. 26. Select ~5 E. coli colonies to test. Inoculate into 5 mL LB 100 μg/mL of ampicillin and incubate at 37°C with shaking at 250 rpm for 16–20 h. 27. Pellet the cells at 2,500 × g for 5 min. Discard the medium. 28. Prepare plasmid DNA from these clones using a standard miniprep kit. 29. Use the plasmid DNA as template in a PCR to amplify the deletion cassette (see Note 39). PCR-amplify the cassette using the outermost primers, ORF 5F and ORF 3R (Fig. 1b) in a 50 μL PCR mix: 200 mM of each dNTP, 100–200 ng template recombined plasmid, 1 μL 20 μM primers, 5 μL 10× PCR buffer, 2 U Taq DNA polymerase. Standard PCR conditions can be used, depending on primer design: 94°C for 2 min followed by 36–38 cycles of 94°C, 50 s; 60°C, 50 s; 72°C, 6 min; and a final extension of 72°C for 10 min (see Note 40). 30. Load the entire volume of PCR on a 1% agarose gel to check the cassette amplification. Excise the band from the gel using a scalpel and gel purify the fragment. Use ~5 μg of deletion cassette to transform A. fumigatus.

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

3.5. A. fumigatus Protoplast Transformation

111

DNA can be introduced into A. fumigatus by several methods including electroporation and protoplasting. In this protocol, A. fumigatus protoplasts are generated by enzymatic digestion using a combination of cell wall enzymes. Protoplasts are harvested after digestion and maintained in an osmotically stabilized medium. PEG MW 6000 promotes DNA uptake in the protoplasts which are then plated out in selective YAG medium containing KCl as osmotic balancer. 1. Prepare a conidial suspension of A. fumigatus (pyrG−) recipient strain (see Notes 19 and 41) from a 2–3-day-old culture grown at 37°C as described earlier. The conidial suspension can be maintained at 4°C. 2. Inoculate 1 × 107 spores into 50 mL YAG (supplemented with uridine and uracil) in a 250 mL Erlenmeyer flask. Incubate with shaking (200 rpm) at 37°C for 12–14 h. 3. Harvest hyphae by centrifugation using a benchtop centrifuge at 3,200 × g for 5 min. Discard the supernatant. 4. Resuspend the pellet in A. fumigatus lytic solution in a 250 mL Erlenmeyer flask. Incubate at 30°C with gentle shaking (70–90 rpm) for 5 h. Monitor the protoplasting microscopically (see Note 42). Protoplasts can be identified as round cells containing a large visible vacuole, easily distinguished from germ tubes and undigested hyphae (Fig. 2).

Fig. 2. A. fumigatus protoplasts produced by enzymatic cell wall digestion of ΔKU80 pyrG − strain (3) and recovered in A. fumigatus protoplasting solution 5 prior to transformation Black arrow : protoplast with a large visible vacuole. White arrow : undigested mycelia. Most of it is removed during the filtration step in glass wool after the digestion is finished. Arrow head : lysed protoplast.

112

I. Malavazi and G.H. Goldman

5. Filter the protoplasts in a 50 mL conical tube using sterile glass wool in a sterile syringe to remove the mycelium and to recover the protoplasts. Carefully resuspend the protoplasts after every centrifugation to avoid lysis. Do not pipette up and down or vortex. Protoplasts are very sensitive to detergents, osmotic shock, or physical damage. Figure 2 shows the protoplasts obtained after this filtering step. 6. Pellet the protoplasts at 3,200 × g for 10 min (4°C). Discard the supernatant. From now on keep the protoplasts on ice. 7. Resuspend the protoplasts in 20 mL ice-cold protoplasting solution 3 and centrifuge for 5 min at 4°C (3,200 × g). Discard the supernatant and repeat to remove the protoplasting mixture. 8. Resuspend the protoplasts in ice-cold protoplasting solution 5. The volume will depend on the protoplast yield. Use 100 μL of solution 5 per reaction to be performed. Prepare a “no DNA added” (negative control) and a positive control using circular pRS426 (see Note 43). 9. Incubate the protoplasts on ice for 10 min. 10. For each transformation, add 50 μL of protoplasting solution 4 and mix gently. 11. Remove 150 μL protoplasts to a 1.5 mL microfuge tube containing 2–5 μg of deletion cassette DNA in less than 15 μl water. Do the same for the negative and positive controls. 12. Incubate on ice for 20 min. 13. Add 1 mL protoplasting solution 4 to each tube and incubate at room temperature for 20 min. 14. Transfer each transformation reaction to a 15 mL sterile conical tube containing 13 mL of “top agar” protoplast regeneration medium pre-warmed at 45°C to avoid heat-shock. This medium also provides osmotic stabilization. Gently mix the tubes by inversion. 15. Immediately pour the “top agar” onto the protoplast regeneration medium (YAG 0.6 M KCl). plates. The “top agar” medium must be evenly distributed over the solid regeneration plates. 16. Incubate the solidified plates at 37°C for 3–5 days until colonies appear. Let the plates sit for 1 day in the incubator before inverting them. Rescue transformed colonies by picking conidia from the transformant colonies using a toothpick. 17. Analyze the transformant colonies by PCR or Southern blot to check the homologous integration of the deletion cassette in the genome of the A. fumigatus recipient strain.

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

113

4. Notes 1. YPD is a common medium used in yeast cultivation. It is an undefined, nutritionally complex, rich medium. Although fresh YPD is not mandatory for inoculum growth, it is recommended that YPD is prepared in small volumes to avoid long-term storage. 2. Add the water to the glass beaker prior to the addition of glucose, otherwise it will take a while to dissolve. Yeast extract and peptone are relatively hydrophobic so the magnetic stir bar is very useful. 3. Autoclave the YPD for a maximum of 15 min. Alternatively, a 20% dextrose solution (10× stock) may be prepared separately and filter-sterilized (0.25 μm pore size membranes) or autoclaved. Add the necessary amount of stock to the other sterile components prior to use. 4. The S. cerevisiae recipient strain used in this procedure FGSC 9721 (FY834) is auxotrophic for these amino acids. The FGSC 9721 strain genotype is: Mata his3Δ200 ura3–52 leu2Δ1 lys2Δ202 trp1Δ63. The URA3 gene lesion will be complemented by the pRS426 plasmid harboring the deletion cassette. 5. Uracil is insoluble in the medium until heated. Therefore, add the necessary amount directly in the flask prior to autoclaving. 6. The gene deletion cassette will be introduced in a uridine/ uracil auxotrophic strain (pyrG− recipient strain), so this acts as the selective medium to plate the A. fumigatus transformants. 7. The “Top agar” is a more fluid medium and will be used to spread the transformed protoplasts over a petri dish containing YAG + KCl. Due to their extreme sensitivity to physical damage, protoplasts cannot be spread on solid medium using a Drigalski spatula, for example. 8. EDTA (Ethylenediamine tetraacetic acid) is a chelator and insoluble in water until the 0.5 M solution has reached a pH of 8.0. Below this pH, the solution is white and thick. It will become clear and transparent only at pH 8.0, indicating that the EDTA is completely dissolved in water. To adjust the pH, use about 20 g of NaOH pellets. 9. The addition of concentrated (fuming) HCl (12 M) can cause solution heating. Allow the solution to cool at room temperature before final pH adjustment. 10. The efficiency of S. cerevisiae transformation by the lithium acetate method greatly relies on the PEG 3350 concentration. We recommended that small portions of the stock are kept in a sealed container for long-term storage at room temperature.

114

I. Malavazi and G.H. Goldman

Do not use PEG 6000. PEG may be harmful by inhalation, ingestion, or skin absorption. Avoid inhalation of powder. Wear appropriate gloves and safety glasses. 11. To dissolve salmon sperm DNA, use constant agitation with a magnetic stirrer at room temperature for 2–6 h. Mild heating may be necessary to speed up the process. 12. An alternative sonication is to pass the stock solution rapidly through a 17-gauge hypodermic needle ~20 times. Store sheared salmon sperm DNA at −20°C in small aliquots. Commercially available sheared salmon sperm DNA can be purchased and used in the same manner as described here. 13. SDS precipitates at low temperature. If necessary, warm the solution at 37–40°C. Allow the solution to cool at room temperature before use. Do not autoclave. SDS is irritant do skin and eyes and produces dust during manipulation. Wear gloves and mask for weighing. 14. Phenol:chloroform solution is hazardous. Wear gloves and work in a fume hood. Do not discard phenol:chloroform in the sink. 15. Glucanex 200G or Lallzyme MMX are wine-making enzymes with pectinase and beta-glucanase activity. The time of incubation can be optimized depending on your conditions to maximize protoplasts production. 16. Incubating the lytic solution at 30°C for 5–10 min helps the components to fully solubilize to prevent membrane filter clogging. Homogenize the solution every 2 min during incubation. For filtering, use low-protein-binding filters such as Millipore Millex HV. 17. PEG 6000 is essential for the efficiency of A. fumigatus transformation using the “protoplasts and KCl” protocol. Store in small aliquots in air-tight containers at 4–8°C. Do not use PEG 3350. PEG may be harmful by inhalation, ingestion, or skin absorption. Avoid inhalation of powder. Wear appropriate gloves and safety glasses. 18. All the strains and plasmids used here can be obtained from the FGSC (Fungal Genetics Stock Center), University of Missouri, USA (http://www.fgsc.net). Afu293 is a wild-type strain and is suitable as a template for all PCR reactions. S. cerevisiae (and E. coli) stocks can be maintained indefinitely in the culture medium with 25% glycerol (final concentration) at −70°C. A fumigatus spores can be stored indefinitely in silica stocks. For details on the Aspergillus culture preservation methods refer to FGN 33:47–48, 1986 (available at FGSC: http:// www.fgsc.net/methods/fgscpres.html). 19. To obtain a conidial suspension of A. fumigatus, harvest the spores from an evenly grown 3–5-day-old Afu293 culture plate

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

115

by adding 20 mL of sterile water. Use a sterile Pasteur pipette to gently rub the entire surface of the plate to loosen the conidia. Aspirate the suspension off the plate and filter it through sterile glass wool or Miracloth into a vial. Count the spores using a hemocytometer. 20. Do not let the mycelium warm during this procedure. If necessary add more liquid nitrogen to the mortar while grinding. 21. The mycelium should be completely wetted by the lysis buffer to avoid DNA degradation during the extraction. 22. If necessary, warm the sample at 37–45°C to help DNA solubilization. 23. Drug resistance markers have been successfully used in A. fumigatus, for example phleomycin (ble) (see refs. 12, 13) and pyrithiamine (ptrA) (see refs. 14, 15). To PCR amplify these marker genes, template plasmids can be obtained from FGSC. 24. Two main databases can be used as resources for viewing assemblies and annotated genes arising from various Aspergillus species sequencing and annotation projects: The Central Aspergillus Data Repository (CADRE—http://www.cadre-genomes.org. uk) hosted by the University of Manchester (UK) (see ref. 16) and the Aspergillus Comparative Database hosted at the Broad Institute (USA) (http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html). 25. Select the 2,000 bp flanking region of the target gene using the CADRE database. After loading the ORF of interest (e.g., AFUA_1G00580) go to the “export gene data” as FASTA and apply the feature “Show context of” 2000 bp either side of feature. The ORF as well as the 5¢- and 3¢-flanking region will be returned. Check if the sequence is in the 5¢–3¢ direction. The 5¢and 3¢-flanking regions can be downloaded directly into primer design software such as OligoPerfect™ Designer (Invitrogen Life Technologies freely available at http://tools.invitrogen.com/ content.cfm?pageid=9716). Ideally, primers should be designed to share the same PCR protocol. The following parameters have been used with success for this purpose. Primer size (bp): min 18; optimum 20; max 22. Tm: min 58°C; optimum 60°C; max 62°C %GC: min 20; optimum 50; max 80. 26. The shuttle plasmid pRS426 contains: (a) the auxotrophic marker URA3, for the selection of yeast transformants which allows the recipient yeast strain (FGSC 9721) to grow on uracildepleted medium (SC URA−), (b) the gene-encoding resistance to ampicillin allowing for transformant selection in E. coli. 27. The multiple cloning site of pRS426 is suitable for several restriction enzymes (NCBI accession number U03451.1; for the plasmid map at FGSC see http://www.fgsc.net/clones.html).

116

I. Malavazi and G.H. Goldman

A double pRS426 digestion with BamHI and EcoRI is suitable to linearize the plasmid and avoid self-ligation “in vivo” during transformation. For a double BamHI/EcoRI double digest, use enzymes with buffer compatibility (e.g., New England Biolabs or Invitrogen Life Technologies). A large stock of doubledigested plasmid can be prepared and used in all experiments providing the primers ORF 5F and ORF 3R are designed with the same homologous region to pRS426 for all gene deletions. 28. Many proof-reading polymerases require an extension temperature of 68°C, so this should be noted. 29. Yeast transformation is based on the lithium acetate method whereby alkali cations produce yeast cell competence to take up exogenous DNA. The addition of a buffered PEG promotes the take-up of exogenous into the cells. 30. Freshly prepared cultures of FGSC 9721 are essential to maximize transformation efficiency. 31. The cells must be harvested during the exponential phase, corresponding to an OD600 ranging from 0.4 to 0.6. The conditions given here have been optimized for strain FGSC 9721. 32. Soak glass beads for 2 days in 6 M HCl in a 1 L Erlenmeyer flask. Wash the glass beads under running water until the pH has reached 6.5–7.0. Autoclave and dry prior to use in DNA extraction. 33. DNA yield is increased if the precipitation reaction is incubated at −80°C for one at least 1 h. 34. Cellulose ester membranes are appropriate to dialyze micro volumes of nucleic acid solutions (e.g., MF type, VS filter, mean pore size 0.025 μm, Millipore, VSWP 02500). 35. Do not allow the sample to flip or become covered with water in the petri dish to prevent sample loss. 36. As these DNA preparations contain a large amount of salt, the volume should have increased to more than the original 20 μL. 37. Several E. coli strains, such as DH10B and DH5α, are suitable for high efficiency electrotransformation. The recombinant pRS426 plasmid will be rescued by this method because only circular plasmids can be taken up by E. coli. 38. Chemocompetent E. coli preparation and standard transformation protocol can also be used for transforming the recombined pRS426. 39. Enzyme selection is critical to generate high amounts of gene deletion cassette. Use a high-fidelity polymerase with high processivity that amplifies long fragments. Some adjustment in

7

“In Vivo” Recombination in Yeast Strategy for A. fumigatus Deletion Cassettes

117

the PCR cycling conditions may be required. A further option is to try using the gene deletion cassette directly amplified from the yeast genomic DNA preparation without transforming E. coli. If cassette amplification fails completely, PCR amplify the fragments independently to check if a particular pRS426 clone does not contain the entire cassette. 40. Colony PCR can also be performed for amplifying the deletion cassette; however, we have observed that colony PCR fails very frequently. 41. Several pyrG− A. fumigatus recipient strains are available, among them the wild-type strains CEA17 (17), CEA22 (17), and the KU mutants which have the nonhomologous end joining-deficient genetic background (3, 4). KU-deficient strains have markedly increased frequency of homologous recombination in A. fumigatus. 42. Use half the pellet obtained after overnight culture, or slightly less, for incubation in the lytic solution. Protoplasting is not effective if too many cells are used. Optimization of the amount of mycelium used and the digestion period may be necessary. 43. A negative “no DNA” control and a positive control must be included in this transformation step. The positive control consists of a reaction containing circular plasmid DNA that harbors the selection marker. Absence of colonies in the positive control may indicate that the protoplasts were not efficiently generated or their number was too low. If the quality of the control DNA was verified, prepare new reagents and use a fresh conidial suspension of the recipient strain. Conversely, if colonies appear on the positive control plates but not on the deletion cassette plates, check the quality and amount of the cassette used for transforming the protoplasts. If the problem persists and no colonies are seen after several trials, make sure the cassette has been correctly recombined “in vivo” within the yeast strain. Partial sequencing of the transforming cassette can be informative. In our hands, there have been very few cases where recombination failed because the cassette sequence was not recombined.

Acknowledgments This work was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) to IM and GHG and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) to GHG, both from Brazil.

118

I. Malavazi and G.H. Goldman

References 1. Pannuti CS, Gingrich RD, Pfaller MA, and Wenzel RP. (1991) Nosocomial pneumonia in adult patients undergoing bone marrow transplantation: a 9-year study. J Clin Oncol 9, 77–84. 2. Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, and Cullin C. (1993) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Research 21, 3329–3330. 3. da Silva Ferreira ME, Kress MR, Savoldi M, Goldman MH, Hartl A, Heinekamp T, et al. (2006) The akuB(KU80) mutant deficient for nonhomologous end joining is a powerful tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryotic Cell 5, 207–211. 4. Krappmann S, Sasse C, and Braus GH. (2006) Gene targeting in Aspergillus fumigatus by homologous recombination is facilitated in a nonhomologous end- joining-deficient genetic background. Eukaryotic Cell 5, 212–215. 5. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N, et al. (2006) Fusion PCR and gene targeting in Aspergillus nidulans. Nature Protocols 1, 3111–3120. 6. Yu JH, Hamari Z, Han KH, Seo JA, ReyesDominguez Y, and Scazzocchio C. (2004) Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41, 973–981. 7. Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, et al. (2006) A highthroughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. PNAS USA 103, 10352–10357. 8. Nierman WC, Pain A, Anderson MJ, Wortman JR, Kim HS, Arroyo J, et al. (2005) Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438, 1151–1156.

9. Winston F, Dollard C, and Ricupero-Hovasse SL. (1995) Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C. Yeast 11, 53–55. 10. Chaveroche MK, Ghigo JM, and d’Enfert C. (2000) A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Research 28, E97 11. Gietz D, St Jean A, Woods RA, and Schiestl RH. (1992) Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research 20, 1425. 12. Austin B, Hall RM, and Tyler BM. (1990) Optimized vectors and selection for transformation of Neurospora crassa and Aspergillus nidulans to bleomycin and phleomycin resistance. Gene 93, 157–162. 13. Vogt K, Bhabhra R, Rhodes JC, and Askew DS. (2005) Doxycycline-regulated gene expression in the opportunistic fungal pathogen Aspergillus fumigatus. BMC Microbiology 5, 1. 14. Valiante V, Jain R, Heinekamp T, and Brakhage AA. (2009) The MpkA MAP kinase module regulates cell wall integrity signaling and pyomelanin formation in Aspergillus fumigatus. Fungal Genet Biol 46, 909–918. 15. Kubodera T, Yamashita N, and Nishimura A. (2002) Transformation of Aspergillus sp. and Trichoderma reesei using the pyrithiamine resistance gene (ptrA) of Aspergillus oryzae. Bioscience, biotechnology, and biochemistry 66, 404–406. 16. Mabey JE, Anderson MJ, Giles PF, Miller CJ, Attwood TK, Paton NW, et al. (2004) CADRE: the Central Aspergillus Data REpository. Nucleic Acids Research 32, D401–405. 17. D’Enfert C, Diaquin M, Delit A, Wuscher N, Debeaupuis JP, Huerre M, et al. (1996) Attenuated virulence of uridine-uracil auxotrophs of Aspergillus fumigatus. Infection and Immunity 64, 4401–4405.

Chapter 8 Targeted Gene Deletion in Aspergillus fumigatus Using the Hygromycin-Resistance Split-Marker Approach Fabrice N. Gravelat, David S. Askew, and Donald C. Sheppard Abstract The construction of a fungal strain that lacks a specific gene product is often accomplished by replacing the gene of interest with a selection marker using site-specific recombination. Transformation of Aspergillus fumigatus, like many related fungal species, must overcome two major obstacles. First, the cell wall limits the entry of exogenous DNA, and second, a high rate of nonhomologous recombination leads to random ectopic integration of the marker. Here, we describe an experimental strategy that has been successfully used to overcome these challenges through protoplast transformation with split-marker cassettes. Each cassette is constructed to contain sequences flanking the gene of interest fused to an incomplete fragment of a dominant selection marker. The resistance marker is only functional if both fragments undergo recombination to regenerate an intact resistance cassette. This event is favored by the proximity of the DNA constructs that arises as a result of homologous recombination between the target-gene sequences in the deletion construct with the fungal chromosome. A similar strategy can be employed using a second resistance marker to complement the deletion mutant with an intact allele of the gene of interest. Key words: Aspergillus fumigatus, Directed mutagenesis, Hygromycin, Phleomycin, Protoplasting

1. Introduction Gene deletion is a powerful reverse-genetic approach for the study of gene function and virulence in filamentous fungi such as Aspergillus fumigatus. The most commonly used method for gene deletion is the replacement of a portion, or all, of the open reading frame (ORF) of interest with a selection marker. Although A. fumigatus auxotrophic markers such as pyrG have been used for transformation, dominant selection through the use of drug resistance markers is more common, and allows for the transformation of prototrophic strains. Two drug resistance markers are commonly used for selection of transformants: hph and ble. The hph cassette encodes hygromycin B phosphotransferase which confers resistance to hygromycin, while

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_8, © Springer Science+Business Media, LLC 2012

119

120

F.N. Gravelat et al.

ble encodes the Sh-ble protein that confers resistance to phleomycin. In this protocol, hph is used for the selection of gene disruption mutants, whereas ble is used for the subsequent selection of mutant strains that have been complemented by the reintegration of an intact copy of the wild-type allele of interest. Successful gene targeting in A. fumigatus requires overcoming two main difficulties: breaching the cell wall to allow entry of exogenous DNA and reducing ectopic nonhomologous recombination events (1). Here we present a detailed protocol for the use of protoplasting (2), combined with a hygromycin split-marker selection (3) for the deletion of A. fumigatus genes that has been successful in overcoming these challenges. Protoplasting utilizes a cocktail of enzymes to digest the carbohydrate-rich cell wall of A. fumigatus, thereby releasing membrane bound protoplasts, some of which contain intact nuclei. These protoplasts are then mixed with the transforming DNA, which can bind to the protoplast plasma membrane. Heat shock is thought to induce a localized inversion of the DNA–membrane complex, resulting in internalization of the extracellular DNA and subsequent recombination (2). The use of a split-marker approach greatly improves the recovery of homologous integrants. Briefly, two hybrid DNA constructs are used for cotransformation, each comprising a fusion product of one of the flanking sequences of the targeted gene with an incomplete portion of the drug resistance cassette (Fig. 1). These drug resistance sequences overlap for about 600 bp. Neither marker fragment encodes sufficient sequences to reconstitute the functional resistance protein. Therefore, acquisition of drug resistance requires homologous recombination of the marker halves within their overlapping sequences. The highest probability for this event occurs when the fragment DNAs are in proximity to one another, such as during integration at the target locus. This promotes a triple recombination event which replaces the target gene and reconstitutes the functional drug resistance marker. Nonhomologous recombination events result in the integration of single nonfunctional cassettes in random locations within the genome and do not generate resistant transformants (4–8). To ensure that the phenotype of subsequent mutants is due to the deletion of the targeted gene, and not to a spontaneous secondary mutation, reintroduction of a wild-type allele of the gene using ble selection can be performed. Multiple strategies for complementation in cis or trans can be used; however in this protocol, we will describe a method for complementation at the native locus which allows for reconstruction of the native promoter. This integration is achieved through transformation of the mutant strain with an intact gene that is linked to the ble cassette. Targeted integration of this construct into the disrupted locus is accomplished by homologous recombination, involving sequences upstream of the ORF that are present in the native promoter and sequences downstream of the ORF that are in the hph cassette (Fig. 2).

8

Split Marker Gene Disruption in A. fumigatus

Fig. 1. Gene deletion strategy. For details see Subheading 3.1.

121

122

F.N. Gravelat et al.

Fig. 2. Gene complementation strategy. For details see Subheading 3.2.

8

Split Marker Gene Disruption in A. fumigatus

123

2. Materials 2.1. DNA and DNA Modifications

1. pAN7.1, a fungal transformation vector, is derived from pUC18, and holds the bla cassette encoding a beta-lactamase that confers ampicillin resistance in Escherichia coli, and the hph cassette which confers hygromycin resistance in A. fumigatus. The hph cassette consists of the A. nidulans gpdA gene promoter, fused to the hygromycin B phosphotransferase coding gene, and the A. nidulans trpC gene terminator. 2. p402 is derived from pCR2.1TOPO and contains a truncated version of the A. nidulans gpdA promoter driving the bacterial ble ORF, followed by the yeast CYC1 terminator. Selection in bacteria can be accomplished using ampicillin or kanamycin. 3. Oligonucleotides (primers) and enzymes for PCR: design primers P1–P6 according to the sequence of the targeted gene (see Subheading 3.1, item 1); the other primers are listed in Table 1 (see Note 1). 4. Restriction enzymes: a unique enzyme that does not cut plasmids p402, pAN7.1 or within the target gene, its promoter or terminator. 5. E. coli strain sensitive to ampicillin and kanamycin, for the propagation of vectors and modified vectors (e.g., DH5α). 6. LB culture medium for E. coli propagation: 0.5% yeast extract, 1% NaCl, 1% tryptone. For solid medium, add 2% agar prior to autoclaving. 7. LB-Amp: LB liquid or solid medium with 100 μg/mL ampicillin (add after autoclaving).

Table 1 Oligonucleotides for PCR of the hph disruption cassette fragments Name

Sequence

M13F

CGCCAGGGTTTTCCCAGTCACGAC

M13R

AGCGGATAACAATTTCACACAGGA

1-F

GTCGTGACTGGGAAAACCCTGGCG

1-R

TCCTGTGTGAAATTGTTATCCGCT

HY

CAACCACGGCCTCCAGAAGAAGA

YG

GCGAGAGCCTGACCTATTGCATCT

124

F.N. Gravelat et al.

8. LB-Kan: LB liquid or solid medium with 50 μg/mL kanamycin (add after autoclaving). 9. A commercial kit for plasmid extraction. 2.2. Solutions for Protoplasting

Unless noted, all solutions are sterilized by filtration through a 0.22-μm pore filter. Solutions can be prepared beforehand, except the PEG400 and 2× protoplasting solutions that must be prepared on the day of protoplasting. All solutions should be prepared in detergent-free glassware (rinsed extensively in detergent-free water) or disposable plastic. 1. YG (2 L): 10 g yeast extract, 40 g glucose (dextrose). Add solids to 2 L single distilled water (SDW). Autoclave 20 min at 121°C, and store at room temperature (RT). 2. KCl/citric acid solution (100 mL): add 8.2 g KCl to 50 mL SDW. Add 2.1 g citric acid (monohydrate or 1.9 g anhydrous). Adjust pH to 5.8 with 1 M KOH (2.2 g/40 mL) (see Note 2). Fill to 100 mL with SDW. Store at 4°C. 3. 1 M MOPS Buffer (50 mL): add 10.46 g 3-(N-morpholino) propanesulfonic acid (MOPS) to 30 mL SDW. Adjust pH to 6.5 with 10 M NaOH. Fill to 50 mL with SDW. Store at 4°C. 4. 1 M CaCl2 (50 mL): add 7.35 g CaCl2⋅2H2O to 50 mL SDW. Store at 4°C. 5. MSC (200 mL): Add 36.44 g sorbitol to 150 mL SDW. Add 2 mL 1 M MOPS pH 6.5, and 2 mL 1 M CaCl2. Bring to 200 mL with SDW. Store at 4°C. 6. Protoplasting solution 1: 9 mL KCl/citric acid solution + 480 mg β-D-glucanase (Sigma-Aldrich #49103) + 400 mg bovine serum albumin (BSA). Incubate on ice for 30 min. 7. Protoplasting solution 2: 10 mL KCl/citric acid solution + 250 mg driselase (preparation containing polysaccharide exo- and endo-hydrolases, including cellulase, pectinase, beta-xylanase, and beta-mannanase; Sigma-Aldrich #D9515). Incubate on ice for 30 min. Spin at 2,000 × g for 5 min to remove the starch carrier. 8. 2× Protoplasting solution: mix protoplasting solutions 1 and 2. Filter through 0.45-μm filter. Use immediately. 9. PEG solution: prewarm 4.4 mL MSC solution to 50°C. Add 6 g polyethylene glycol 4000 (PEG4000). Bring to 10 mL with MSC. Filter through 0.45-μm filter. Use within the day.

2.3. Plates for Transformant Selection

Since protoplasts lack a cell wall, selection of transformants is performed on osmotically stabilized medium plates (OSM). They may be poured a maximum of 24 h prior to use, and protected

8

Split Marker Gene Disruption in A. fumigatus

125

from desiccation to maintain the proper osmotic balance. These plates will be overlaid with top agar 24 h after transformation (see Subheading 3.3). 1. Trace Element Solution (500 mL): add 20 mg Na2B4O7⋅10H2O, 200 mg CuSO4⋅5H2O, 500 mg FePO4⋅4H2O, 300 mg MnSO4⋅H2O, 400 mg Na2MoO4⋅2H2O, and 4 g ZnSO4⋅7H2O to 500 mL SDW. Do not autoclave. Store at 4°C in dark. 2. 50× Salt Solution (500 mL): add 13 g KCl, 13 g MgSO4⋅7H2O, 38 g KH2PO4, and 25 ml trace element solution to 500 ml SDW. Add 1–2 ml of chloroform and shake. Do not autoclave, and allow to sit overnight before use. Store at 4°C in dark. 3. 2× Minimum medium (2× MM) (500 mL): dissolve 10 g glucose in 400 mL SDW. Add 20 mL 50× salt solution. Adjust pH to 6.5 with 1 M NaOH. Bring to 500 mL with SDW. Add 15 g agar. Autoclave 20 min at 121°C. Cool to 50°C before mixing with an equal volume of 2× sorbitol solution (below). 4. 0.5 M PIPES buffer (100 mL): dissolve 16.22 g PiperazineN,N¢-bis(2-ethanesulfonic acid) sodium salt (PIPES) in 50 mL SDW. Adjust pH to 6.5 with 1 M NaOH. Bring to 100 mL with SDW. Store at RT. 5. 100× Ammonium tartrate 1 M (100 mL): add 18.41 g NH4 tartrate (C4H12N2O6) and 20 mL 0.5 M PIPES pH 6.5–50 mL SDW. Adjust pH to 6.5 with 1 M NaOH (see Note 3). Bring to 100 mL with SDW. Store at RT. 6. 100× Supplement Solution (500 mL): add 50 mg nicotinic acid, 125 mg riboflavin, 100 mg pantothenic acid, 25 mg pyridoxine, 0.5 mg biotin, 10 mg para-aminobenzoic acid (PABA) to 500 mL SDW. Autoclave. Store at 4°C in dark. 7. 2× Sorbitol solution (500 mL): dissolve 218.6 g sorbitol in 200 mL SDW (see Note 4). Add 10 mL 100× NH4 tartrate. Add 10 mL 100× supplement solution. Adjust pH to 6.5 with 0.1 M NaOH. Bring to 500 mL with SDW. Filter sterilize. Prewarm to 50°C. 8. OSM plates: mix equal volumes 2× MM and 2× sorbitol solution. Pour 20 mL into 10-cm petri dishes and allow to solidify. 9. 2× Top agar (500 mL): Dissolve 10 g glucose in 400 mL SDW. Add 20 mL of 100× salt solution. Adjust the pH to 6.5 with 1 M NaOH. Bring to 500 mL with SDW. Add 10 g agar. Autoclave 20 min at 121°C. Add an equal volume of prewarmed 2× sorbitol. 10. Hygromycin and phleomycin solutions at 100 mg/mL (see Note 5).

126

F.N. Gravelat et al.

3. Methods 3.1. Construction of Hybrid DNAs for Gene Disruption (Fig. 1)

1. Retrieve the flanking regions of the targeted gene from the NCBI GenBank® (http://www.ncbi.nlm.nih.gov/nucleotide/) or from the Aspergillus Genome Database® (http://www. aspergillusgenome.org). 2. Amplification of flanking sequences from genomic DNA: using high-quality genomic DNA and the primers described in Subheading 2.1, step 3, amplify 500 bp to 1 kb of the up- and down-stream flanking sequences of the gene of interest using primers P1,P2 and P3,P4, respectively (Fig. 1) (see Note 6). It is often helpful, though not necessary, to clone these fragments into a T-vector for ease of subsequent manipulation. Analyze the PCR products on an agarose gel to confirm the appropriate product size. 3. Use primers M13R-HY and YG-M13F (Table 1) to PCR amplify the split-marker fragments HY (3,057 bp) and YG (1,629 bp) (Fig. 1). As above, cloning these fragments into a T-vector is convenient for future transformations. 4. Perform hybrid PCR to generate the final split-marker fusion cassettes (Fig. 1). In each PCR, the template should consist of an equimolar mix of the appropriate flanking and marker fragments: use primers P1 and HY for the upstream fragment and primers YG and P4 for the downstream fragment (see Note 7). Analyze the products on an agarose gel to confirm the appropriate product size. 5. Transform protoplasts of A. fumigatus wild-type strain with about 10 μg of an equimolar mix of the two resulting DNA fragments (see Subheading 3.3 for protoplasting). For protoplast transformation purposes, the DNA mix must be in a TE volume equal to or less than 20 μL.

3.2. Construction of Hybrid DNAs for Gene Complementation (Fig. 2)

The outlined complementation strategy allows reconstitution of the native locus for the gene of interest (described as complementation in cis in the following section). It requires the introduction of a unique restriction enzyme site, which is not present within the gene of interest, its promoter, p402, nor pAN7.1. If complementation in trans alone is sought, then the protocol can be simplified as indicated, and requires a unique enzyme that cuts between the ble cassette and the promoter of the gene of interest. 1. For complementation at the native locus, PCR amplify a DNA fragment containing the 3¢ end of the promoter (500–600 bp in length), the entire ORF, and the terminator (about 1 kb in length) of the target gene, using primers P5-P6 (Fig. 2). Primer P5 should incorporate a unique restriction enzyme recognition sequence at the 5’ end of the primer. For complementation in trans, PCR

8

Split Marker Gene Disruption in A. fumigatus

127

amplify a DNA fragment containing the entire predicted promoter and terminator regions, using primers P5b-P6. 2. Clone this PCR product into p402. Ensure the orientation of the gene of interest is OPPOSITE to the ble cassette (see Fig. 2). For complementation in trans, step 3 is not required, proceed directly to step 4. 3. Subclone the p402 fragment containing the targeted gene and the ble cassette into pAN7.1. Ensure the orientation of the gene of interest is the SAME as hph cassette by running a diagnostic restriction enzyme digestion, with at least one RE in the insert and one RE in the plasmid (see Fig. 2). 4. Linearize 10 μg of the resulting plasmid at the unique restriction enzyme site introduced by the P5 primer (complementation in cis), or located between the ble cassette and the targeted gene promoter (complementation in trans). 5. Transform protoplasts of A. fumigatus KO strains with about 10 μg of the resulting DNA fragment (see Subheading 3.3 for protoplasting). For prostoplast transformation purposes, the linearized plasmid must be in a TE volume equal to or less than 20 μL. 3.3. Protoplasting

1. On the day prior to protoplasting, inoculate 5 × 108 conidia in 200 mL of YG medium, incubate at 30°C in an orbital shaker for 12 h. Overgrowth of hyphae reduces protoplasting efficiency and should be avoided. 2. On day 1, harvest the overnight hyphae (see Note 8) using a 0.2-μm bottle top filter and rinse with fresh YG. 3. Resuspend the hyphae in 20 mL fresh YG, add 20 mL of 2× protoplasting solution, and incubate at 30°C with gentle shaking (~75 rpm). 4. Monitor for the development of protoplasts at regular intervals by examining a drop of the suspension between a glass slide and coverslip under a light microscope. Protoplasts are usually apparent within 30 min and are most apparent by ~4 h. At every 30 min time point, gently pipet the culture up and down a few times with a 10-mL pipette prior to examining them. 5. When the quantity of protoplasts is sufficient (see Note 9), pass the suspension through a cell strainer (BD Falcon 40-μm nylon) placed into the neck of a 50-mL flask to remove the hyphal debris. 6. Pellet the protoplasts at 300 × g for 20 min. Resuspend the pellet in 10 mL cold MSC. 7. Remove a 10-μl sample and count with a hemacytometer. 8. Spin down again and resuspend at 5 × 107 protoplasts/mL in 4°C MSC.

128

F.N. Gravelat et al.

3.4. Protoplast Transformation

1. Prepare three tubes with 200 μl of protoplasts (1 × 107) in each. Treat the three tubes separately as following: (a) Transformation tube: Add 20 μl linear DNA suspension in Tris–EDTA solution (TE), for a total of 10 μg of split markers. (b) Negative control: Mix with 20 μl of TE and no DNA. (c) Positive control: Mix with 20 μl of pAN7.1 or p402, i.e., the uncut plasmid bearing the appropriate marker, for a total of 10 μg of plasmid. 2. For all tubes, add 50 μl of RT 60% PEG using a wide-bore P200 pipette tip (see Note 10). Pipet gently up and down to mix. Do not vortex. 3. Incubate on ice for 30 min. 4. Heat shock at 42°C for 3.5 min. 5. Add 500 μl of 60% PEG with a wide-bore P1000 tip, rotate gently to mix. Do not vortex. 6. Incubate at RT for 20 min, then microfuge for 5 min at 600 × g at RT. Remove most of the PEG without disturbing the pellet. 7. Pulse for 1 min at 600 × g. Remove the last of the PEG. 8. Resuspend in 1 mL of MSC and plate the entire volume onto 10 OSM plates for the “transformation” tube, or onto two OSM plates only for the “control” tubes. 9. Incubate overnight at RT to allow the protoplasts to regenerate their walls and express the resistance gene.

3.5. Selection of Transformants

1. Overlay each 20-mL plate with 10 mL of molten (50°C) top agar after adding the appropriate drug: 750 μg/mL hygromycin B (final concentration in the whole plate of 250 μg/mL) for the KO candidates and for the mock transformants; 450 μg/ mL phleomycin (final concentration in the whole plate of 150 μg/mL) for the complemented candidates and for the mock transformants (see Note 11); Overlay one plate with top agar containing no selection agent as a control for protoplast viability. 2. Invert plates after 30 min and place at 37°C (hygromycin); or RT overnight, followed by 30°C (phleomycin, see Note 12). 3. After 24–72 h, ensure the viability of the protoplasts and the validity of the transformation by inspecting, respectively, the “no-drug” control plates, and the positive and negative control plates. 4. As candidate transformants break through the agar top layer, harvest their conidia with a sterile cotton swab or mycelium as an agar plug. Transfer to fresh solid growth medium supplemented with the appropriate selection agent.

8

3.6. Screening of Putative Transformants

Split Marker Gene Disruption in A. fumigatus

129

DNA from putative transformants can be screened for the presence of the disruption/complementation cassette after the first round of selection. Before phenotypic evaluation, all strains should be subcultured three times on solid growth medium containing the appropriate antifungal drug. The subcultures should be performed by isolating, serially diluting and then passaging a single spore each round to ensure that heterokaryons or contaminating strains are not present. Southern blot with a probe specific of the deleted gene, RNA profiling or PCR confirmation of integrations can then be performed in detail as desired.

4. Notes 1. For fusion PCR, the 5¢ ends of primers P2 and P3 should include the 24 bp 1-R and 1-F, respectively, specified in Table 1. Similarly, a restriction site that is absent from p402, pAN7.1, the targeted gene, its promoter and terminator should be added to the 5¢ end of the P5 primer. This site will be used to linearize the final complementation plasmid for transformation. 2. About 30 mL of 1 M KOH are necessary to adjust the pH to 5.8. 3. Alternatively, use 1 M NaNO3 instead of NH4 tartrate, but this solution should still be buffered with PIPES. 4. Dissolving sorbitol requires a minimum of 1 h with stirring. 5. Although hygromycin and phleomycin can be purchased in powder form, most suppliers now provide them as concentrated solutions which are much more convenient. 6. Flanking sequences of between 500 bp and 1 kb seem to yield the highest transformation efficiency. Small fragments are less efficient, and exceeding 1 kb does not improve the frequency of integration. 7. If fusion PCR does not provide the expected product, try one or all of the following tips: (a) Use a temperature gradient for the PCR annealing step. (b) Use a gradient of DNA concentration of the PCR template, but keep an equimolar ratio between the two fragments to be fused. (c) Perform 10–15 PCR cycles WITHOUT primers, then add the primers and fresh PCR enzyme for an extra 20 cycles. In this approach, each fragment serves as the primer for amplification of its corresponding partner. 8. Alternatively, hyphae can be harvested and rinsed by centrifugation, although hyphae are difficult to pellet by centrifugation.

130

F.N. Gravelat et al.

9. 107 Protoplasts are required for each transformation; therefore, you should aim for a minimum of 106 protoplasts per mL in 40 mL. 10. Wide bore tips are commercially available or can be easily made by cutting off the end of a standard pipet tip with sterile scissors. 11. The pH of the medium is crucial for phleomycin selection, as activity is decreased at low pH. 12. Selection by phleomycin tends to generate a high background if the strains are cultivated at 37°C. Growth is slower but with less background when the transformants are left at RT, at 30°C, or a sequential combination of the two as described in this protocol.

Acknowledgments This research was supported by an operating grant from the Canadian Institutes of Health Research. D.C. Sheppard is a Canadian Institute of Health Research Clinician Scientist, and recipient of a Burroughs Welcome Fund Career Award in the Biomedical Sciences. References 1. Sheppard DC, Ibrahim AS, and Edwards JE, Jr (2004) Human mycoses: the role of molecular biology. In: Tkacz JS and Tkacz LL (ed) Advances in Fungal Biotechnology for Industry, Agriculture and Medicine. Kluwer Academic, New York, p. 361–384. 2. Oakley BR, Rinehart JE, Mitchell BL, Oakley CE, Carmona C, Gray GL, and May GS (1987) Cloning, mapping and molecular analysis of the pyrG (orotidine-5’-phosphate decarboxylase) gene of Aspergillus nidulans. Gene, 61:385–99. 3. Catlett NL, Lee BN, Yoder OC, and Turgeon BG (2003) Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet Newsl, 50:9–11. 4. Sheppard DC, Doedt T, Chiang LY, Kim HS, Chen D, Nierman WC, and Filler SG (2005) The Aspergillus fumigatus StuA protein governs the up-regulation of a discrete transcriptional program during the acquisition of developmental competence. Mol Biol Cell, 16:5866–79. 5. Al-Bader N, Vanier G, Liu H, Gravelat FN, Urb M, Hoareau CM, Campoli P, Chabot J,

Filler SG, and Sheppard DC (2010) Role of trehalose biosynthesis in Aspergillus fumigatus development, stress response, and virulence. Infect Immun, 78:3007–18. 6. Gravelat FN, Ejzykowicz DE, Chiang LY, Chabot JC, Urb M, Macdonald KD, al-Bader N, Filler SG, and Sheppard DC (2010) Aspergillus fumigatus MedA governs adherence, host cell interactions and virulence. Cell Microbiol, 12:473–88. 7. Twumasi-Boateng K, Yu Y, Chen D, Gravelat FN, Nierman WC, and Sheppard DC (2009) Transcriptional profiling identifies a role for BrlA in the response to nitrogen depletion, and for StuA in the regulation of secondary metabolite clusters in Aspergillus fumigatus. Eukaryot Cell, 8:104–115. 8. Ejzykowicz DE, Cunha MM, Rozental S, Solis NV, Gravelat FN, Sheppard DC, and Filler SG (2009) The Aspergillus fumigatus transcription factor Ace2 governs pigment production, conidiation and virulence. Mol Microbiol, 72:155–69.

Chapter 9 Gene Disruption in Coccidioides Using Hygromycin or Phleomycin Resistance Markers Chiung-Yu Hung, Hua Zhang Wise, and Garry T. Cole Abstract The following transformation protocol is based on homologous recombination that occurs between a gene disruption or gene replacement construct and a target gene of Coccidioides. The DNA constructs employed contain either the gene that encodes for hygromycin B or phleomycin resistance, which are present in the pAN7.1 or pAN8.1 plasmid vectors, respectively. Hygromycin B or phleomycin are used to select for transformants at concentrations that inhibit growth of the parental strain. Coccidioides protoplasts generated from germinated arthroconidia are used for the transformation experiments. The plasmid DNA constructs are taken up by the protoplasts in the presence of calcium and polyethylene glycol. Twenty to 100 transformants/μg DNA can be obtained in each transformation experiment. Approximately 5–10% of the transformation events are homologous recombinations. Coccidioides cells in all developmental stages, including arthroconidia, are multinucleate. Since all Coccidioides nuclei are haploid, only one run of transformation is sufficient to create a mutant strain. However, the transformed protoplasts develop into heterokaryotic cells that typically contain both the parental and mutated nuclei. To isolate a homokaryotic strain, we perform multiple subcultures of the single colonies which contain heterokaryotic cells on selection plates with hygromycin B or phleomycin to enrich for the mutated nuclei. Homokaryotic mutants can be obtained after three to four subcultures of isolated colonies. In this protocol, we describe the methodology for preparation of Coccidioides protoplasts, transformation and isolation of homokaryotic mutants. Key words: Coccidioides, Gene disruption, Homologous recombination, Hygromycin, Phleomycin

1. Introduction Coccidioides spp. are the causative agent of a human respiratory disease known as coccidioidomycosis or San Joaquin Valley Fever. Two species of Coccidioides have been reported on the basis of molecular and biogeographical differences: Coccidioides immitis is found primarily in the San Joaquin Valley of California, while C. posadasii is widespread throughout endemic regions in the Americas (1).

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_9, © Springer Science+Business Media, LLC 2012

131

132

C.-Y. Hung et al.

In spite of the genetic diversity revealed by comparative genomic sequence analyses of these two species (2), laboratory animal studies have shown no significant difference in either the virulence or growth and development of the organisms. The pathogen is a diphasic fungus that produces mycelia and air-dispersed spores (arthroconidia) when grown on a simple glucose-yeast extract (GYE) agar medium and a complex spherule-endospore cycle when cultured in a defined glucose/salts medium (3). Inhalation of airborne spores by a mammalian host is followed by development of an elaborate parasitic cycle in lung tissue, which is unique amongst the medically important fungi. The parasitic cycle is initiated by conversion of the tiny barrel-shaped arthroconidia (ca. 2 × 6 μm) into multinucleate round cells that grow isotropically to produce large spherules (60 to >100 μm in diameter). The content of a mature spherule undergoes a complex process of differentiation to yield an average of 200–300 endospores in vivo, each with an initial diameter of approximately 4–6 μm. Endospores that are released from the maternal spherule and survive within the host undergo isotropic growth and give rise to a second generation of endosporulating spherules (4). Coccidioides is a formidable opportunistic human pathogen which can cause disease in immunocompromised people, as well as a primary pathogen that can infect healthy individuals who reside and work in or visit the endemic areas. About 60% of primary pulmonary infections with Coccidioides are asymptomatic, evident only by skin test reactivity (5). In the remaining 40%, symptomatic infection can occur in various manifestations: acute pneumonia, chronic progressive pneumonia, appearance of pulmonary nodules and cavities, extrapulmonary non-meningeal disease, or meningitis (6). Coccidioidomycosis has also been reported to be a frequent laboratory-acquired, respiratory disease (7). Plate cultures of the saprobic phase of Coccidioides grown in laboratory incubators produce large numbers of dry spores which can easily contaminate the environment if not handled properly. Live cultures of Coccidioides spp. must be maintained in a facility with biological safety level 3 (BSL3) containment because of the highly infectious nature of Coccidioides arthroconidia (8). Both the saprobic and parasitic phases of the two Coccidioides species are haploid (9). Coccidioides has no known sexual state, but molecular evidence has indicated that recombination occurs within the fungal population (10, 11). Coccidioides genome sequencing projects have been conducted by the Broad Institute of MIT and Harvard University, and the J. Craig Venter Institute. Genome sequences of 13 clinical isolates and one environmental isolate of Coccidioides have been completed to 3–12× coverage using the Whole Genome Shotgun method. The genome sizes range from 25.45 to 28.95 megabases (2, 12). The genome sequences and annotation data of all 14 isolates of C. posadasii and C. immitis are

9

Gene Disruption in Coccidioides

133

publically available (http://www.broadinstitute.org). Disruption of genes in Coccidioides has proved to be a powerful tool for evaluation of putative virulence factors (13–16) and for studies of gene function (17). The first stable integration of plasmid DNA into chromosomes of Coccidioides was reported in 1998 using a biolistic transformation approach (18). However, the biolistic DNA delivery system tends to cause integration of the transferred DNA as tandem repeats, at least from our experience with Coccidioides, and we abandoned this method of transformation. The application of Agrobacterium-mediated transformation to create a mutant strain of Coccidioides has been reported (17), but this method has not been critically evaluated for generation of complemented strains (i.e., reconstitution of the mutant to wild-type strain). Successful transformation and targeted gene disruption in Coccidioides were first achieved by Reichard et al. (13). The transformation procedure was an adaptation of the method reported by Fincham (19) and more recently by d’Enfert et al. (20). Since our report of this initial, successful gene disruption in Coccidioides, we have applied the same method to generate both single gene knockout strains (14, 16) and mutants with double gene replacements or disruptions (15, 21). Here we describe this transformation method, which is suitable for generation of gene knockout strains of Coccidioides by disruption or replacement strategies, as well as for reconstitution of the wild-type gene for confirmation of its function.

2. Materials Prepare all media and buffers using ultrapure water that is purified to reach the resistivity of 18 MΩ cm at 25°C. Use only analytical grade reagents. Store all reagents at 4°C unless otherwise indicated. 1. GYE agar plates: 1% glucose, 0.5% yeast extract, 2% Bactoagar. Add 5 g glucose plus 2.5 g yeast extract to 400 mL water in a 1-L flask and stir the solution until both chemicals are dissolved. Add water to a final volume of 500 mL and then add 10 g of Bacto-agar to the flask. Cover the flask with a piece of aluminum foil and autoclave for 20 min at 121°C and 18 psi. Cool the autoclaved medium to 55–60°C and pour 25 mL into each Petri dish (100 × 15 mm) (see Note 1). 2. GYE liquid medium: 1% glucose, 0.5% yeast extract. Prepare the medium as described in Subheading 2, item 1 but without agar. Two bottles of GYE (100 mL in a 0.5-L flask) are required for each transformation experiment (see Note 2). 3. Osmotic buffer A (OB): 50 mM potassium citrate buffer, pH 5.8, 0.6 M KCl. Make 200 mL for every transformation experiment

134

C.-Y. Hung et al.

by dissolving 1.92 g of citric acid and 8.94 g KCl in 150 mL water; titrate to pH 5.8 with 1 N KOH, and add water to a final volume of 200 mL. Autoclave for 20 min at 121°C, 18 psi (see Note 3). 4. Cell wall–digestion enzymes: add 75 mg Driselase from Basidiomycetes (Sigma), 40 mg lysing enzymes from Trichoderma harzianum (Sigma), and 10 units of chitinase from Streptomyces griseus (Sigma) in 10 mL sterile OB buffer. Prepare the mixture freshly and incubate at 39°C with shaking at 140 rpm for 20 min before use. The use of chitinase is optional, but it appears to enhance the transformation competency of the protoplasts (see Note 4). 5. Osmotic buffer B (OM): 10 mM sodium phosphate buffer, pH 5.8, 1.2 M MgSO4. Dissolve 0.138 g NaH2PO4 H2O and 29.58 g MgSO4 7H2O in 70 mL of water, titrate to pH 5.8 with 1 M NaOH or 1 N H3PO4, and then add water to a final volume of 100 mL. Do NOT autoclave this buffer since the salts will precipitate during autoclaving. Instead, filter the solution through a 0.45-μm pore diameter membrane. Prepare 100 mL of this buffer for each transformation experiment (see Note 5). 6. Trapping buffer (TB): 100 mM MOPS buffer, pH 7.5, 0.6 M sorbitol. Dissolve 2.09 g MOPS and 10.93 g sorbitol in 70 mL of water, titrate to pH 7.5 with 1 M NaOH or 1 N HCl, and then adjust the volume to 100 mL by the addition of water. Filter the buffer through a 0.45-μm pore diameter membrane. Prepare 100 mL of this buffer for each transformation experiment (see Note 6). 7. MOPS buffer containing sorbitol (MS): 10 mM MOPS buffer, pH 6.5, 1 M sorbitol. Dissolve 1.04 g MOPS and 91.07 g sorbitol in 300 mL water, titrate pH to 6.5 with 1 N NaOH and then add water to 500 mL. Filter the buffer through a 0.45μm pore diameter membrane. Prepare 500 mL of this buffer for each transformation experiment (see Note 7). 8. MSC buffer: MS buffer containing 20 mM CaCl2. Dissolve 0.21 g MOPS, 18.22 g sorbitol, and 0.29 g CaCl2 in 70 mL water, titrate to pH 6.5 with 1 N NaOH and then add water to 100 mL. Filter the buffer through a 0.45-μm pore diameter membrane. Prepare 100 mL of this buffer for each transformation experiment (see Note 8). 9. Polyethylene glycol (PEG): 60% (w/v) of PEG in MSC buffer. Dissolve 18 g PEG 3350 (Sigma) in 30 mL of MSC buffer. Stir the mixture overnight and filter it through a 0.45-μm pore diameter membrane. Prepare 1 mL aliquots in 1.5-mL sterile tubes (see Note 9).

9

Gene Disruption in Coccidioides

135

10. GYES soft agar: 1% glucose, 0.5% yeast extract, 1 M sucrose and 0.7% Bacto-agar. Prepare 25 mL for each protoplast transformation experiment (see Note 10). 11. GYES agar plates: 1% glucose, 0.5% yeast extract, 1 M sucrose, 2% Bacto-agar. The medium is prepared as described in Subheading 2, item 1 for GYE agar plates, except 1 M sucrose is added before autoclaving. Pour 15 mL of the autoclaved medium into each Petri plate. Ten plates are required for each protoplast transformation experiment (see Note 11). 12. Hygromycin B (HmB; Sigma): 50 mg/mL of stock solution in water. Filter the solution through a sterile 0.45-μm pore diameter membrane. Prepare 0.5 mL aliquots in 1.5-mL sterile tubes and store at −20°C (see Note 12). 13. Phleomycin (Phl; Sigma): 3 mg/mL of stock solution in water. Filter the solution through a 0.45-μm pore diameter membrane. Prepare 0.5 mL aliquots in 1.5-mL sterile tubes and store at −20°C (see Note 13). 14. GYE soft agar: 1% glucose, 0.5% yeast extract, and 0.7% Bactoagar. Prepare 2.5 mL of this solution for each GYES agar plate (see Note 14). 15. GYE agar plates containing 75 μg/mL of hygromcycin (GYEHmB): Prepare and autoclave 500 mL GYE agar as described in Subheading 2, item 1. Add 0.75 mL of 50 mg/mL hygromycin stock solution into the warm GYE agar and dispense 10 or 20 mL into each 60- × 15-mm or 100- × 15-mm Petri plate, respectively. Let the plates set for 2 h at room temperature and store at 4°C. Avoid exposure to light (see Note 15). 16. GYE agar plates containing 3 μg/mL of phleomycin (GYEPhl): Prepare and autoclave 500 mL GYE agar as described in Subheading 2, item 1. Add 0.5 mL of 3 mg/mL phleomycin stock solution into the warm GYE agar and dispense 10 or 20 mL into each 60- × 15-mm or 100- × 15-mm Petri plate, respectively. Let the plates set for 2 h at room temperature and store at 4°C. Avoid exposure to light (see Note 15). 17. QIAprep Miniprep kit for purification of plasmid constructs (Qiagen). 18. QIAquick PCR purification kit for purification of PCR products (Qiagen). 19. QIAquick Gel Extraction kit for purification of DNA fragments separated on an agarose gel (Qiagen). 20. DNeasy Plant Mini kit for isolation of Coccidioides genomic DNA (Qiagen). 21. Mini Beadbeater (Biospec Products, Inc.).

136

C.-Y. Hung et al.

22. Autoclaved 0.5-mm diameter glass beads for breaking Coccidioides cells. 23. Sterile 2.0-mL conical screw-cap tubes with O-rings for use with the Mini Beadbeater. 24. Liquid Luria-Bertani (LB) medium (50 μg/mL ampicillin): 1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, 50 μg/mL ampicillin. 25. LB agar plates (50 μg/mL ampicillin): as item 24 but with 2% (w/v) agar. 26. 50-mL Polycarbonate Oak Ridge tubes with silicon gasket and screw cap (see Note 16). 27. 10-mL Syringes without needles. 28. 5-μm Glass beads (Kimble-Chase). 29. Nylon wool fiber (Polysciences). 30. Hemocytometer. 31. 1-mL Pipette tips with large orifice to avoid damage to fragile protoplasts (USA Scientific, Inc.). 32. 200-μL Pipette tips with large orifice (USA Scientific, Inc.). 33. Primers for PCR amplification of DNA fragments required for constructing the gene deletion and gene replacement vectors, and for screening Coccidioides transformants.

3. Methods Both gene disruption (13, 16) and gene replacement strategies ((14, 15), Fig. 1a, b) have been successfully applied to create mutant strains of Coccidioides. 3.1. Creation of a Gene Disruption Construct

1. Design primers to amplify a 0.5–1.0 kb DNA fragment of the target gene with reference to the Coccidioides genome database (http://www.broadinstitute.org) for directional cloning into either the upstream or downstream region of the HPH or BLE cassette in the pAN7.1 (GenBank access # Z32698) or pAN.8.1 (GenBank access # Z32751) vector, respectively. The GSP1 and GSP2 primers used to amplify the target gene fragment, which will be inserted into the upstream region of the HPH or BLE cassette as shown in Fig. 1a, should contain one of the three available restriction sites (BglII, BstEII, or StuI) in the vector. Alternatively, the target gene fragment can be inserted into the downstream region of the HPH or BLE cassette and the primers should contain either the XbaI or BbeI sites (see Note 17).

9

Gene Disruption in Coccidioides

a Disruption construct

GSP1 GSP2

pGPD

HPH or BLE

137

tTRPC

Target gene locus Disruption region Disrupted gene locus GSP3

5 flanking GSP5 GSP6

b Replacement construct

HPH1 or BLE1

pGPD

HPH or BLE

HPH2 or BLE2

GSP4

3 flanking GSP7 GSP8 tTRPC

Deletion region Target gene locus

Replaced gene locus GSP9

HPH1 or BLE1

HPH2 or BLE2

GSP10

Fig. 1. Gene disruption (a) and gene replacement (b) constructs used for transformation of Coccidioides. The pAN7.1 and pAN8.1 vectors, which contain genes that encode for hygromycin-resistance (HPH) or phleomycin-resistance (BLE), respectively, are used to create these constructs. Both the HPH and BLE genes are controlled by the promoter of glyceraldehydes 3-phosphate dehydrogenase (pGPD) and the terminator of the TrpC gene of A. nidulans. The location of primers used to screen for the transformants are indicated. Gene-specific primer 3, 9, 4, and 10 (GSP3, 9, 4, 10) are derived from the target gene sequences and are located upstream and downstream, respectively, of the fragment(s) used in the construct. Primers HPH1 and HPH2 are derived from pAN7.1, and BLE1 and BLE2 are derived from pAN8.1.

2. Genomic DNA of Coccidioides for PCR can be isolated using the DNeasy Plant Mini kit (Qiagen). Scrape about 4 cm2 of hyphal mat grown on a GYE plate (about 7–14 days old; »100 mg) into a 2.0-mL conical screw-cap tube containing 0.5-mL of sterile glass beads (0.5-mm diameter) and 0.5 mL of AP1 buffer plus 5 μl RNase A stock solution (100 mg/mL) provided in the kit. Fit the capped tube into a Mini Beadbeater to disrupt the cells for 1 min at the highest speed. Incubate the mixture for 10 min at 65°C and follow the manufacturer’s protocol. Approximately 0.2–1.0 μg of Coccidioides genomic DNA can be obtained. 3. Isolate pAN7.1 or pAN.8.1 plasmids using a QIAprep Miniprep kit as described by the manufacturer’s protocol. 4. Amplify the target DNA fragment from Coccidioides genomic DNA using the designed GSP1 and GSP2 primers containing

138

C.-Y. Hung et al.

selected restriction sites as described in Subheading 3.1, step 1. A small aliquot of the PCR product (2–5 μL) is subjected to agarose gel analysis to confirm size and quality. The remaining product is subjected to purification using a QIAquick PCR purification kit (Qiagen). 5. Digest the PCR products and plasmids with the selected restriction enzymes (BglII, BstEII, StuI, XbaI, or BbeI) which have been designed into the PCR primers. The digested mixtures are subjected to separation on an agarose gel. The desired DNA bands on the gel are excised with a clean sharp blade and the DNA slices are subjected to purification using the QIAquick gel extraction kit. The purified and restricted DNA fragments and vectors are ligated together with T4 ligase to form the disruption construct. 6. Transform the ligation product into a competent E. coli strain and spread on LB plates containing 50 μg/mL ampicillin to select for positive clones. 7. Confirm the correct insertion and orientation of the DNA fragment into the vector by performing colony PCR using the designed GSP1 primer (Subheading 3.1, step 1) and the HPH1 or BLE1 primer. 8. Isolate the verified plasmid DNA containing the disruption construct using the QIAprep Miniprep kit. This construct is used to disrupt the targeted gene (Fig. 1a). The circular plasmid can be used for either direct transformation, or linearization with an appropriate restriction enzyme located close to the middle of the inserted DNA fragment. 9. Precipitate the circular or linearized plasmid with ethanol and resuspend in MSC buffer 1 day before the transformation experiment. The DNA concentration should be maintained at approximately 1 μg/μL. A total of 1–3 μg of the plasmid DNA is required for each transformation experiment. 3.2. Creation of a Gene Replacement Construct

1. Design primers to amplify two DNA fragments of the targeted gene (0.5–1.0 kb each) for directional insertion into the upstream (BglII, BstEII, or StuI site) and downstream (XbaI or BbeI site) of the HPH or BLE cassette in the pAN7.1 or pAN.8.1 vector, respectively (see Subheading 3.1, step 1 and Note 18). The 5¢-flanking fragment generated by GSP5 and GSP6 primers can be the 5¢-UTR or the 5¢-terminus of the coding sequence of the target gene, while the 3¢-flanking fragment generated by GSP7 and GSP8 primers can be the 3¢-terminus or the 3¢-UTRs. Both fragments are inserted into the pAN7.1 or pAN8.1 in the same 5¢ to 3¢ direction as shown in Fig. 1b.

9

Gene Disruption in Coccidioides

139

2. The replacement construct is cloned as described in Subheading 3.1, and the plasmid is purified using the QIAprep Miniprep kit. 3. Linearize the replacement plasmid construct with an appropriate restriction enzyme which does not cut the DNA fragment including the 5¢-flanking region, the HPH or BLE cassette, and the 3¢-flanking region (see Subheading 3.1). 3.3. Preparation of Germ Tubes of Coccidioides

1. Collect arthroconidia from 4 to 8 GYE agar plate cultures of Coccidioides (2–4 weeks old) by scraping the plates with a sterile cell lifter (Corning Inc.) or an inoculation loop. Transfer the arthroconidial mat into an autoclaved Oak Ridge tube provided with a silicone gasket and screw cap. Add 10 mL of sterile GYE liquid medium and 15 autoclaved glass beads (5-mm diameter, Kimble Chase), screw the cap tightly, and shake vigorously by hand for 30 s. 2. Filter the suspension through a 10-mL syringe containing loosely packed Nylon wool fiber (Polysciences) to remove hyphal fragments. Collect the arthroconidia in a sterile Oak Ridge centrifuge tube. 3. Pellet the arthroconidia by centrifugation at 1,200 × g for 10 min at room temperature, discard the supernatant into a beaker containing freshly made 20% bleach, and resuspend the arthroconidia in 10 mL GYE liquid medium. 4. Determine the concentration of arthroconidia using a hemocytometer. 5. Inoculate 100 mL of liquid GYE medium in a 0.5-L flask with 5 × 108 arthroconidia, cover the flask tightly with a piece of aluminum foil, and incubate at 30°C for 11–12 h with shaking at 140 rpm. 6. Monitor the germination process by light microscopy. Germ tube formation typically occurs after 10 h of incubation. Better synchronization of germ tube formation (Fig. 2) results in higher quality of protoplast production. Initiate the protoplast isolation procedure (see Subheading 3.4) before the germ tubes form branches, which would typically occur after approximately 14 h of growth.

3.4. Preparation and Isolation of Coccidioides Protoplasts

1. Precool a centrifuge to 10°C. Transfer the germ tube culture to a clear, sterile 50-mL Oak Ridge centrifuge tube (polycarbonate) provided with a sealed screw cap and centrifuge at 2,800 × g for 10 min at 10°C (see Note 16). Discard the supernatant into a beaker containing freshly made 20% bleach. 2. Wash the germ tubes with 15 mL OB buffer twice. Centrifuge at 2,800 × g for 10 min after each wash. Discard the supernatant carefully to avoid loss of the germ tube pellet. Combine

140

C.-Y. Hung et al.

Fig. 2. Germ tubes of Coccidioides posadasii produced by arthroconidia after 11 h of incubation in GYE medium.

the pellets of separate preparations into one centrifuge tube before the second wash. 3. Resuspend the germ tubes in the cell wall–digestion enzyme mixture (see Subheading 2, step 4). Mix the solution well by gentle aspiration several times using a disposable pipette. 4. Lay the centrifuge tube horizontally on the platform of a shaking incubator and secure it with tape. Incubate the mixture at 30°C for 60 min with shaking at 50 rpm. Periodically take a small aliquot (10 μL) to check for the formation of protoplasts under a microscope. The duration of incubation can be adjusted depending upon the rate of protoplast formation. 5. Pellet the protoplasts by centrifugation at 900 × g for 10 min at 10°C. Carefully discard the supernatant with a sterile, disposable pipette. 6. Resuspend the pellet in 10 mL OM buffer. Gently aspirate the mixture several times with a pipette until there are no visible clumps of cellular material. 7. Overlay 10 mL TB buffer on top of the OM buffer. Dispense the TB buffer slowly along the wall of the centrifuge tube above the surface of the OM buffer to form two layers. The lower layer of OM buffer is denser than the TB buffer. 8. Transfer the tube gently to the centrifuge to avoid mixing the two layers. Centrifuge at 2,800 × g for 15 min at 10°C. 9. Stand the tube vertically in a rack to permit good visibility of the buffer layers after centrifugation. Cell debris is present as a pellet at the bottom of the centrifuge tube, and a white layer of protoplasts forms at the interphase of the OM and TB buffers.

9

Gene Disruption in Coccidioides

141

10. Pre-warm the 60% PEG solution to room temperature (see Subheading 2, step 9). 11. Use a sterile pipette with a long tip to reach the interphase, carefully collect the protoplast layer by aspiration, and transfer it to a sterile 50-mL centrifuge tube. Approximately 5 mL of solution will be typically recovered. 12. Add 45 mL MS buffer to the protoplast suspension (approx. 1:9 ratio of protoplast solution to MS buffer) and centrifuge at 900 × g for 10 min at 10°C. Gently aspirate the supernatant and discard. 13. Wash the protoplasts with 15 mL MSC buffer twice by centrifugation and resuspend the cells in 500 μL MSC buffer. The size of the isolated Coccidioides protoplasts typically ranges from 10 to 30 μm in diameter (Fig. 3). 14. Count the protoplasts using a hemocytometer. Dilute the protoplasts to approx. 108 cells/mL with MSC buffer. 15. Aliquot 100 μL of protoplasts (ca. 107 cells) to each of five 1.5mL Eppendorf tubes using a 1-mL pipette tip with a large orifice to avoid damaging the protoplasts. 3.5. Transformation and Selection of Coccidioides Transformants

Each transformation experiment requires 100 μL of freshly prepared Coccidioides protoplast (ca. 107 cells) in an Eppendorf tube. 1. Add 1–3 μg DNA of a selected transformation construct to the protoplast suspension. Stir gently to mix. Do not vortex or aspirate. 2. Add 30 μL pre-warmed 60% PEG solution using a 200-μL pipette tip with a large orifice. Slowly aspirate the suspension twice to mix well. Incubate on ice for 30 min (see Note 19).

Fig. 3. Coccidioides protoplasts isolated from enzyme-digested germ tubes.

142

C.-Y. Hung et al.

3. Microwave the GYES soft agar to melt and incubate at 46°C. Pre-warm the GYES agar plates (see Subheading 2, step 11) to 30°C (see Note 20). 4. Dispense an additional 900 μl 60% PEG solution to each of the Eppendorf tubes containing Coccidioides protoplasts after the 30 min incubation on ice (see Subheading 3.5, step 3). Mix well by gently rotating the tube (see Note 19). Lay the tube horizontally and incubate at room temperature for 30 min. 5. Pellet the protoplasts using a microcentrifuge at 8,000 rpm for 15 min at room temperature. Gently discard approximately half of the supernatant. Resuspend by aspiration, centrifuge for 2 min, and gently remove the rest of the supernatant. 6. Resuspend the transformed protoplasts in 500 μL MSC buffer. Aliquot 50 μL of the protoplast suspension into each of the 10- × 2-mL sterile Eppendorf tubes. 7. Add 1.8 mL of pre-warmed GYES soft agar to each tube containing the transformed protoplasts. Mix the protoplasts by gently rotating the Eppendorf tubes and then quickly overlay the protoplast suspension onto a pre-warmed GYES agar in the Petri plate. Gently rotate the plate to spread the soft agar evenly on the plate before it solidifies. 8. Incubate the plates at 30°C for 48 h to regenerate the protoplasts. Do not invert the plates because the layer of GYES soft agar may separate from the lower solidified agar layer. Check the surface of the plates using a dissection microscope (40× objective) for the appearance of mycelia (spider web–like colonies). 9. Prepare GYE soft agar containing hygromycin or phleomycin for the next overlay step. Microwave the GYE soft agar to melt. Dispense the total required amount of GYES in a 50-mL conical centrifuge tube and incubate at 46°C. Add appropriate amount of the hygromycin (50 mg/mL) or phleomycin (3 mg/mL) stock solution (see Subheading 2, steps 12 and 13) to the pre-warmed GYE soft agar to reach a concentration of 579 or 23.4 μg/mL, respectively. Add 2.5 mL GYE soft agar that contains the appropriate concentration of the selective antibiotic to each GYES Petri plate. After the selected antibiotic has diffused and equilibrated in the three layers of agar as shown in Fig. 4, the final concentrations of hygromycin or phleomycin are 75 or 3 μg/mL, respectively. These concentrations are sufficient to inhibit growth of the parental strain (see Note 21). 10. Incubate the GYES plates on their upright position at 30°C and avoid exposure to light. The antibiotic-resistant transformants will appear as mycelial colonies after 4–7 days of incubation.

9

Gene Disruption in Coccidioides

143

GYE soft top agar + antibiotic (2.5 ml) GYES soft agar containing protoplasts (1.8 ml)

100x 15 mm Petri plate

GYES agar (15 ml)

Fig. 4. Arrangement of the three layers of agar in the 100- × 15-mm Petri plate.

3.6. Isolation of Homokaryotic Transformants

1. Remove agar plugs of the individual antibiotic-resistant colonies using disposable, sterile pipettes, and transfer each plug to the appropriate GYE-HmB or GYE-Phl agar plates (60 × 15 mm). Each plug should be transferred to a separate agar plate. 2. Incubate the plates at 30°C for 10–14 days, or until the colonies reach about 2 cm in diameter. If the plugs do not generate visible colonies, they are non-transformants (see Note 22). 3. Obtain inocula from the outer edge of the visible colonies with sterile loops and transfer to fresh 100 × 15 mm GYE-HmB or GYE-Phl agar plates. Each transformant requires a separate agar plate. For this and subsequent subculturing steps, apply a microbiological streaking technique to isolate individual colonies. Incubate the plates at 30°C. Colonies should be visible on the plates after 5–7 days of incubation. 4. Select a well grown colony which is separate from other colonies on the plate. Mark this colony on back of the plate. Take an inoculum from the outer edge of the colony and streak it on a fresh GYE-HmB or GYE-Phl agar plate as described above. Incubate the plates at 30°C for10–14 days. 5. Repeat step 4 at least 2 times to enrich for homokaryotic transformants. Typically such homokaryotic transformants of Coccidioides can be obtained after 3 subculturing steps. 6. After 3 subcultures, pick up about 1–4 cm2 of mycelia from a colony for DNA isolation as described in Subheading 3.1, step 2. 7. Screen colonies for homokaryotic transformants generated by the gene disruption or gene replacement strategy using three separate PCRs with three pairs of primers as shown in Fig. 1 (see Note 23). 8. If only heterokaryotic transformants are detected, repeat step 4 (see Subheading 3.6, step 4) at least one more time. The selected transformants are finally subjected to Southern blot analysis with a gene-specific probe to confirm the isolation of homokaryotic mutants of Coccidioides by homologous recombination (see Note 24).

144

C.-Y. Hung et al.

4. Notes 1. These plates are used to culture the saprobic phase of Coccidioides and to produce arthroconidia. Coccidioides will produce arthroconidia on GYE plates after incubation for 2–4 weeks at 30°C. 2. This medium is used to produce germ tubes from Coccidioides arthroconidia. 3. This buffer contains 0.6 M KCl as an osmotic stabilizer and is used to wash the germ tubes and perform cell wall digestion. 4. Each batch of enzyme varies in digestion efficiency. Test the protoplasting efficacy of each batch of newly purchased enzymes before initiating a transformation experiment to determine the optimal amount of each enzyme that should be added to the digestion mixture. 5. This buffer is used in gradient centrifugation for isolation of protoplasts. 6. This buffer is used in gradient centrifugation for trapping protoplasts. 7. This buffer is used to wash protoplasts before incubation with the transformation DNA construct. 8. This buffer is used to facilitate the uptake of the transformation DNA construct by the protoplasts. 9. The quality of PEG varies depending upon the source. The precise function of PEG is not known. However, it may contribute to the efficiency of uptake of the DNA constructs by protoplasts (19). Long term storage of PEG solution will decrease transformation efficiency. We do not recommend use of a PEG solution that has been stored more than 3 months. 10. This medium is used to resuspend transformed protoplasts for overlaying them on GYES agar in Petri plates. 11. This agar contains 1 M sucrose for osmotic stabilization and regeneration of fungal cells from the transformed protoplasts. It is important to pour exactly 15 mL GYES agar into each plate. The amount of antibiotic needed for selection is based on the total volume of three layers of agar in each plate as shown in Fig. 4, which includes the GYES agar, GYES soft agar for overlaying protoplasts, and GYE soft agar for overlaying antibiotics. 12. This antibiotic is used to select for transformants when the HPH gene cassette present in the pAN7.1 vector (Genbank #Z32698) is used.

9

Gene Disruption in Coccidioides

145

13. This antibiotic is used to select for transformants when the BLE gene cassette present in the pAN8.1 vector (GenBank# Z32751) is used. 14. This medium is used to overlay the selected antibiotic as described in Subheading 2, steps 12 and 13, on the GYES agar plates containing the regenerated protoplasts to select for transformants. 15. This medium is used to select for transformants and for isolation of homokaryotic mutants. 16. It is important to use polycarbonate tubes, which have better transparency than polypropylene tubes. 17. The choice of the DNA fragment should lie within the start (ATG) and stop codon of the targeted gene. A longer DNA fragment may enhance the efficiency of crossing-over, but the fragment should be less than 2/3 of the full-length coding sequence to insure the creation of two incomplete copies of the targeted gene after transformation. The first incomplete copy does not have the 3¢-termination sequence nor the 3¢-untranslated region (UTR), while the second copy lacks the 5¢-UTR and start codon. The DNA sequence of the target gene fragment cannot contain the selected restriction sites included in the primers or it will be fragmented during restriction digestion. 18. The minimal length of the 5¢- and 3¢-flanking regions which have been applied successfully in our transformation experiments with Coccidioides is about 0.5 kb. The 5¢- and 3¢-flanking regions can be the 5¢- and 3¢-UTRs of the target gene. However, some of the intergenic sequences of Coccidioides are shorter than 0.5 kb. It is also important to avoid using DNA sequences of contiguous genes that are upstream or downstream of the target gene as the 5¢- and 3¢-flanking regions of the replacement construct. The deleted DNA sequence of the targeted gene should include the start codon and/or the essential functional domain (e.g., active site of a proteinase). 19. Mix immediately to avoid the separation of PEG and protoplasts. 20. This latter step delays the solidification of the soft agar for the subsequent overlay step (see Subheading 3.5, step 8), so that the soft agar can be distributed evenly over the GYES agar layer in the Petri plates. 21. The total volume of the three layers of agar in each plate is 19.3 mL as shown in Fig. 4. In order to achieve the final concentration of hygromycin or phleomycin in the agar to 75 or 3 μg/mL, respectively, the GYE soft top agar needs to contain

146

C.-Y. Hung et al.

579 or 23.4 μg/mL of hygromycin or phleomycin, which is based on the following calculation (75 μg/mL × 19.3 mL = 579 μg/mL × 2.5 mL or 3 μg/mL × 19.3 mL = 23.4 μg/ mL × 2.5 mL). For example, to prepare 25 mL of GYE soft top agar containing 579 μg/mL of hygromycin to overlay 10 GYES agar plates, 24.71 mL of pre-warmed GYE soft top agar is added to a 50-mL conical tube to which 0.29 mL ( = 579 μg/ mL × 25 mL ÷ 50,000 μg/mL) of hygromycin stock solution (50 mg/mL = 50,000 μg/mL) is added (see Subheading 2, step 12). 22. Incubation for 10–14 days on the antibiotic-containing agar plates is required for the colonies to enrich for antibiotic-resistance gene-containing nuclei, and ultimately to select for homokaryotic transformants. 23. Three pairs of primers are designed to conduct PCR screening of the transformants. The first pair includes a forward genespecific primer (GSP3 or GSP9) that anneals to an upstream site of the 5¢-flanking region, and a reverse primer that anneals to the antibiotic cassette (HPH1 or BLE1). The primers are designed to amplify the 5¢ junction of the target gene and the inserted antibiotic cassette. The second pair of primers includes a forward primer (HPH2, or BLE2) that anneals to the antibiotic cassette and a reverse gene-specific primer (GSP4 or GSP10) which anneals to a downstream site of the 3¢-flanking region. The GSP3/GSP4 or GSP9/GSP10 primer pairs are also employed as the third pair of primers to amplify a PCR product which can be used to distinguish between homokaryotic and heterokaryotic transformants. The homokaryotic transformants will have only one PCR product, while the heterokaryotic transformants will have two PCR products. The larger PCR product is derived from the transformed nuclei with an inserted antibiotic-resistant gene cassette, and the shorter product is from the parental (wildtype) nuclei. 24. If a homokaryotic mutant cannot be isolated after four subculturing steps, it is possible that loss of function of the target gene by disruption or replacement is lethal. An alternative gene manipulation method (e.g., gene knockdown strategy using RNA interference) should be considered.

Acknowledgement This work was supported by NIH grants RO1 AI-0711178 and RO1 AI-070891 awarded to GTC.

9

Gene Disruption in Coccidioides

147

References 1. Fisher MC, Koenig GL, Taylor JW (2002) Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia 94:73–84 2. Sharpton TJ, Stajich JE, Rounsley SD, Gardner MJ, Wortman JR, Jordar VS et al (2009) Comparative genomic analyses of the human fungal pathogens Coccidioides and their relatives. Genome Res 19:1722–1731 3. Levine, HB (1961) Purification of the spherule-endospore phase of Coccidioides immitis. Sabouraudia 1:112–115 4. Cole GT, Xue J, Seshan K, Borra P, Borra R, Tarcha E, Schaller R, Yu JJ and Hung CY (2006) Virulence mechanisms of Coccidioides, In: Heitman J, Filler S, Edwards J., and Mitchell A (ed) Molecular principles of fungal pathogenesis. Am. Soc. Microbiol. Press, Washington, D.C. p363–391 5. Smith CE, Pappagianis D, Levine HB, and Saito M (1961) Human coccidioidomycosis. Bacteriol Rev 25:310–320 6. Galgiani JN, Ampel NM, Blair JE, Catanzaro A, Johnson RH, Stevens DA and Williams PL (2005) Coccidioidomycosis. Clin Infect Dis 41:1217–1223 7. Sewell DL (1995) Laboratory-associated infections and biosafety. Clin Micro Rev 8: 389–405 8. US Department of Health and Human Services (2007) Chosewood, CC and Wilson DE (ed) Biosafety in microbiology and biomedical laboratories (BMBL), 5th edn. U.S. Government Printing Office, Washington, DC 9. Pan S and Cole GT (1995) Molecular and biochemical characterization of a Coccidioides immitis-specific antigen. Infect Immun 63:3994–4002 10. Fraser JA, Stajich JE, Tarcha EJ, Cole GT, Inglis DO, Sil A and Heitman J (2007) Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens Histoplasma capsulatum, Coccidioides immitis, and Coccidioides posadasii. Eukary Cell 6: 622–629 11. Mandel MA, Barker BM, Kroken S, Rounsley SD and Orbach, MJ (2007) Genomic and population analyses of the mating type loci in

12.

13.

14.

15.

16.

17.

18.

19. 20.

21.

Coccidioides species reveal evidence for sexual reproduction and gene acquisition. Eukary Cell 6: 1189–1199 Neafsey DE, Barker BM, Sharpton TJ, Stajich JE, Park DJ, Whiston E., Hung CY et al (2010) Population genomic sequencing of Coccidioides fungi reveals recent hybridization and transposon control. Genome Res 20: 938–946 Reichard U, Hung CY, Thomas PW, and Cole GT (2000) Disruption of the gene which encodes a serodiagnostic antigen and chitinase of the human fungal pathogen Coccidioides immitis. Infect Immun 68:5830–5838 Hung CY, Yu JJ, Seshan KR, Reichard U and Cole GT (2002) A parasitic phase-specific adhesin of Coccidioides immitis contributes to the virulence of this respiratory fungal pathogen. Infect Immun 70:3443–3456 Hung CY, Seshan KR, Yu JJ, Schaller R, Xue J, Basrur V, Gardner MJ and Cole GT (2005) Metalloproteinase of Coccidioides posadasii contributes to evasion of host detection. Infect Immun 73:6689–6703 Mirbod-Donovan, F, Schaller RA, Hung CY, Xue J, Reichard U and Cole GT (2006) Urease produced by Coccidioides posadasii contributes to the virulence of this respiratory pathogen. Infect Immun 74:504–515 Kellner EM, Orsborn KI, Siegel EM, Mandel MA, Orbach MJ and Galgiani JN (2005) Coccidioides posadasii contains a single 1,3-betaglucan synthase gene that appears to be essential for growth. Eukary Cell 4:111–120 Yu JJ and Cole GT (1998) Biolistic transformation of the human pathogenic fungus Coccidioides immitis. J Microbiol Meth 33: 129–141 Fincham, JR (1989) Transformation in fungi. Microbiol Rev 53:148–170 d’Enfert C, Weidner G, Mol PC and Brakhage AA (1999) Transformation systems of Aspergillus fumigatus: new tools to investigate fungal virulence. Contrib Microbiol 2:149–166 Xue J, Chen X, Selby D, Hung CY, Yu JJ and Cole GT (2009) A genetically engineered live attenuated vaccine of Coccidioides posadasii protects BALB/c mice against coccidioidomycosis. Infect Immun 77:196–208

Part II Modulation of Gene Expression: RNAi Gene Knockdown

Chapter 10 RNAi-Based Gene Silencing Using a GFP Sentinel System in Histoplasma capsulatum Brian H. Youseff and Chad A. Rappleye Abstract RNA interference (RNAi) has revolutionized reverse genetics in eukaryotic organisms, particularly those in which homologous recombination is inefficient or impractical. The ability to deplete or knock-down a targeted gene product without requiring genetic disruption provides a rapid means of analyzing mutant phenotypes and defining gene functions. In Histoplasma capsulatum, in vivo-produced RNA stem-loop molecules are effective in triggering RNAi of the targeted gene and the RNAi effect is both heritable and stable. The use of a green fluorescent protein (GFP) sentinel for RNAi, in which cosilencing of GFP fluorescence is used as an indicator of target gene depletion, rapidly identifies RNAi lines of H. capsulatum. Here, we describe the construction of RNAi-triggering vectors, generation of silenced lines, and utilization of the GFP sentinel RNAi system in H. capsulatum. Key words: RNA interference, GFP sentinel, Histoplasma capsulatum, Reverse genetics, Fungal pathogen

1. Introduction The ability to manipulate gene function is fundamental in understanding how a gene contributes to the phenotype of an organism. Reverse genetic analysis is a direct approach that can be used to establish the role of each gene; but in Histoplasma capsulatum, as in most pathogenic fungi, generating gene knock-outs by homologous recombination is difficult, time consuming, and often unsuccessful. RNA interference (RNAi) is an effective alternative that can be used to deplete a gene product without requiring molecular disruption of the targeted gene. The methodology for triggering RNAi overcomes many of the technical obstacles associated with creating gene deletions and offers a quicker and more efficient means of assessing the function or role of the targeted gene. Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_10, © Springer Science+Business Media, LLC 2012

151

152

B.H. Youseff and C.A. Rappleye

The normal cellular function of RNAi is believed to be an evolutionarily conserved defense mechanism of the eukaryotic genome, protecting the genetic code from transposable elements and viruses (1). More recent studies have found RNAi also contributes to the regulation of native genes (2). RNAi is triggered by double-stranded RNA molecules which are processed by the cell’s RNAi machinery into short-RNA fragments that guide the RNAinduced silencing endonuclease complex (RISC) to the endogenous gene transcript in a sequence-specific manner (3). Destruction of the homologous mRNA by RISC prevents further synthesis of the gene product resulting in depletion or “knock-down” of the targeted gene function. The overall reduction in gene product levels results from the net contribution of new mRNA synthesis and degradation of transcripts by RNAi. Although depletion is never complete with RNAi, exploitation of this posttranscriptional interference mechanism to target a gene of interest often produces a phenotype similar to that resulting from gene deletion. In H. capsulatum, double-stranded RNAs can effectively trigger RNAi-based depletion of gene products (4). The double-stranded RNA trigger is generated in vivo by the transcription of inverted copies of a region of the targeted gene (see Fig. 1) to produce a stem-loop RNA molecule. In Histoplasma, double-stranded RNA stem lengths greater than 500 bp produce a significant degree of silencing (4). To generate this RNAi trigger in vivo, the construct is inserted into an RNAi vector which is linearized by restriction digest and transformed into Histoplasma yeast by electroporation. RNAi plasmids are transformed into ura5-mutant strains of Histoplasma and selection for plasmid-transformed yeast is achieved by virtue of the plasmid-encoded URA5 gene, which restores uracil prototrophy. The RNAi construct is placed downstream of the constitutive Histoplasma histone-2B promoter to produce high levels of the stem-loop RNA and thus the strongest RNAi effect. RNAi has been used successfully to target a number of Histoplasma genes (4–10). Since the RNAi system utilizes extrachromosomal plasmids, linking a mutant phenotype to the RNAi target can be validated by verifying the wild-type phenotype is restored in segregants that have lost the RNAi plasmid after nonselective growth. The RNAi-triggering construct can be modified to co-target a sentinel or reporter gene to allow determination of RNAi effects for which the loss of a gene product does not generate a visible mutant phenotype. To co-target the sentinel function, regions of the sentinel gene are fused to the ends of the target gene sequence (see Fig. 1). Transcription of this construct generates a single stemloop structure, the chimeric nature of which triggers depletion of both the sentinel function and the target gene product simultaneously. Consequently, knock-down of the gene of interest correlates with the silencing of the sentinel gene function (5, 8, 11, 12). Because GFP is easily imaged, is quantifiable, and is nonessential to Histoplasma, we have used GFP fluorescence as the sentinel function

10

RNAi in Histoplasma

153

1 or 3

target gene 2 or 4 PCR with primers 1&2

1

PCR with primers 3&4

2

3

4

forward fragment

reverse fragment

PH2B TEL

PacI

SpeI

gfp AgeI

gfp

PacI

URA5

AscI XhoI

TEL

pCR473

KanR Fig. 1. Construction and composition of Histoplasma sentinel RNAi vectors. Schematic depicts primers and PCR amplification of the forward and reverse fragments to target a gene of interest by RNAi. Restriction sites are included in the PCR primers used for amplification to provide for the subsequent directional ligation of each into the sentinel RNAi vector, pCR473. The histone-2B promoter (PH2B ) drives transcription of the inverted copies of the gfp sentinel and targeted gene to produce a stem-loop RNA in vivo. The doublestranded region of this RNA molecule will trigger the RNAi effect in Histoplasma. Following construction, vectors are linearized to expose telomeric sequences (TEL) by digestion with PacI which removes the kanamycin-resistance gene (KanR) used for propagation in E. coli. Selection of the RNAi vector in Histoplasma yeast is facilitated by the URA5 gene which restores uracil prototrophy to an ura5 strain.

for RNAi (5). GFP-fluorescent derivatives of two phylogenetically distinct strains of Histoplasma have been constructed to enable the use of GFP transgene fluorescence as the sentinel (13). Here, we describe the construction of sentinel system RNAi vectors, their transformation into Histoplasma yeast, and methodology for monitoring and quantifying depletion of the GFP sentinel in H. capsulatum transformants.

2. Materials All reagents are prepared with ultrapure water (deionized water purified to attain a resistance of 18 MΩ and no more than 10 ppb organic carbon) and stored at room temperature unless otherwise noted.

154

B.H. Youseff and C.A. Rappleye

2.1. Preparation of Histoplasma Yeast Total RNA

1. Histoplasma culture medium (Histoplasma-macrophage medium; HMM): 1× Ham’s F-12 Nutrient Mix, 1.5% glucose, 5 mM glutamic acid, 0.7 mM cystine, 20 mM HEPES, pH 7.2. Dissolve 10.6 g of F-12 Nutrient Mix, 15 g glucose, 1 g glutamic acid, and 4.8 g HEPES in 800 mL of H2O. Add 10 mL of 100× cystine and adjust pH to 7.2 with NaOH. Bring volume to 1 L with H2O. Filter sterilize through 0.22μm pore membrane and store at 4°C. 2. 100× Cystine (70 mM): Dissolve 4.2 g cystine in 250 mL of 0.5 M HCl and add to 250 mL of H2O. 3. 0.5-μm Diameter glass beads. 4. RiboZol RNA extraction reagent (Amresco). 5. Chloroform (CHCl3). 6. Isopropanol. 7. 70% Ethanol. 8. RNAse-free dH2O. 9. DNase (Ambion).

2.2. Construction of RNAi Vector

1. Histoplasma URA5-based RNAi vector pCR473 (see Fig. 1 (13)). The plasmid sequence is at: http://microbiology.osu. edu/files/microbiology/pCR473.doc. 2. Target gene-specific primers: Design primers to the gene of interest to synthesize forward and reverse RNAi fragments corresponding to the same region of the gene (see Fig. 1). Attach appropriate restriction sequences to the 5-prime end of each primer to correctly orient the forward and reverse fragments when cloning into the RNAi vector (see Note 1). 3. Histoplasma yeast total RNA (see Subheading 2.1). 4. Oligo-T-primed, reverse transcribed Histoplasma RNA: Mix 2 μg of Histoplasma RNA with 2 μM oligo-T primer, 0.5 μM dNTPs, in a total volume of 21 μL. Heat to 65°C for 5 min then place on ice. Add to the tube on ice: 6 μL 5× Superscript III buffer, 3 μL 100 mM DTT, 10 U RNaseOUT, and 100 U Superscript III reverse transcriptase. Incubate reverse transcription reaction at 45°C for 60 min. 5. DNA Clean and Concentrator kit. 6. TAE electrophoresis buffer: 40 mM Tris acetate, 1 mM EDTA. For a 50× stock solution, add 242 g Trizma base (Tris– hydroxymethyl-aminomethane), 57 mL of glacial acetic acid, and 18.6 g Na2EDTA⋅2H2O to 800 mL of H2O. Bring volume to 1 L with H2O. For 1× buffer, add 40 m1, 960 mL H2O. 7. Costar Spin-X centrifuge tube filters: 0.45-μm pore cellulose acetate membrane (Corning Life Sciences).

10

RNAi in Histoplasma

155

8. 2× T4 DNA ligase buffer: 10% Polyethylene glycol-8000 (PEG8000), 100 mM Tris–HCl, pH 7.6, 20 mM MgCl2, 2 mM ATP, 2 mM DTT. Dissolve 1 g PEG8000 in 7 mL of H2O. Add 1 mL of 1 M Tris, pH 7.6, 200 μL 1 M MgCl2, 200 μL 100 mM ATP, 200 μL 100 mM DTT. Bring volume to 10 mL with H2O. Split solution into 25 μL aliquots and store at −20°C. 9. 1 M Tris, pH 7.6: Dissolve 12.1 g Trizma base (Tris– hydroxymethyl-aminomethane) in 75 mL of H2O. Adjust pH to 7.6 with HCl. Bring volume to 100 mL with H2O and sterilize by autoclaving 20 min at 121°C. 10. 1 M MgCl2: Dissolve 9.52 g MgCl2 in 100 mL of H2O. 11. 100 mM ATP: Dissolve 55.1 mg adenosine triphosphate (disodium salt) in 1 mL of 10 mM Tris–HCl, pH 7.6. Split solution into 100 μL aliquots and store at −20°C. 12. 100 mM DTT: Dissolve 0.154 g dl-dithiothreitol (threo-1, 4-dimercapto-2,3-butanediol) in 10 mL of H2O. Split solution into 1 mL aliquots and store at −20°C. 13. Transformation-competent E. coli cells (e.g., DH5α). 14. LB medium: 0.5% NaCl, 1.0% tryptone, 0.5% yeast extract, pH 7.0. Dissolve 5 g NaCl, 10 g tryptone, and 5 g yeast extract in 800 mL of H2O and adjust pH with 1 M NaOH. Bring volume to 1 L with H2O. Add 1% agar for solid medium. Autoclave 20 min at 121°C to sterilize. Add appropriate antibiotics before use. 15. 1,000× Kanamycin: (30 mg/mL): Dissolve 1.5 g kanamycin sulfate in 50 mL of H2O. Filter sterilize through 0.22-μm pore syringe filter. Split solution into 1 mL aliquots and store at −20°C. 16. ZR Plasmid Miniprep kit (Zymo Research). 2.3. Transformation of Histoplasma capsulatum

1. Histoplasma GFP-fluorescent sentinel strains (13): OSU22 (G186A background; genotype: ura5-D32 zzz::[PEIFa-gfp, hph]) or OSU32 (G217B background, genotype: ura5-D42 zzz::[PEIFagfp, hph]). 2. Histoplasma-macrophage medium. 3. Solid HMM: 1× Ham’s F-12 Nutrient Mix, 1.5% glucose, 5 mM glutamic acid, 0.7 mM cystine, 25 μM FeSO4, 20 mM HEPES, pH 7.2, and 0.6% agarose. Dissolve 6 g of agarose in 500 mL of H2O in a 1-L beaker and autoclave to sterilize (see Note 2). Cool agarose to 60°C. Dissolve 10.6 g of F-12 Nutrient Mix, 15 g glucose, 1 g glutamic acid, and 4.8 g HEPES in 400 mL of H2O. Add 10 mL of 100× cystine and adjust pH to 7.2 with NaOH. Bring volume to 500 mL with H2O. Add 5 mL of 5 mM FeSO4 solution and filter sterilize through 0.22-μm pore membrane. Combine Nutrient Mix solution with agarose solution, pour into petri dishes, and cool to solidify. Store at 4°C.

156

B.H. Youseff and C.A. Rappleye

4. 200× FeSO4 (5 mM): Dissolve 14 mg of iron(II) sulfate heptahydrate in 10 mL of H2O (see Note 3). 5. 25× Uracil (2.5 mg/mL): Dissolve 1.25 g uracil in 500 mL of H2O. Mix with heat as needed and sterilize by autoclaving 20 min at 121°C. 6. HMM–uracil medium: 4 mL 25× Uracil in 100 mL HMM (final conc = 100 μg/mL uracil). 7. 10% Mannitol solution: 10% mannitol, 10 mM HEPES, pH 7.0. Dissolve 10 g mannitol in 90 mL of H2O. Add 10 mL of 100 mM HEPES, pH 7.0. Sterilize by filtration through a 0.22-μm membrane. 8. 100 mM HEPES: Add 2.38 g HEPES (N-(2-hydroxyethyl) piperazine-N¢-(2-ethanesulfonic acid) to 80 mL of H2O. Adjust pH to 7.0 with 1 M NaOH. Bring volume to 100 mL with H2O and sterilize by filtration through a 0.22-μm membrane. 9. Electroporation cuvettes: 2-mm gap width. 10. Electroporation system capable of delivering 0.75 kV at 600 Ω and 25 μF (e.g., Gene Pulser electroporator and Pulse Controller module, Bio-Rad). 2.4. Transformant Screening

1. GFP imaging system: A simple, and relatively inexpensive imaging system for GFP fluorescence can be devised by adapting common gel documentation equipment (see Fig. 2a). Light from a UV transilluminator is converted to wavelengths around 470 nm that can excite the GFP molecule by a UV-to-blue light conversion screen (e.g., Visi-BlueT, UVP). Residual wavelengths above 500 nm are blocked by placing a 500 nm short-pass filter (e.g., BG3, Schott) between the sample to be imaged and the conversion screen. Detection of emitted GFP fluorescence is achieved through the use of a band pass filter centered at 530 nm and collection of light with a CCD camera. 2. ImageJ Software package. The ImageJ program is free software developed for the quantitative analysis of images. The program can be downloaded at: http://rsbweb.nih.gov/ij/.

3. Methods All procedures involving Histoplasma yeast are to be performed within class II Biological Safety Cabinets. All media for the growth of Histoplasma yeast should be heated to 37°C prior to use. 3.1. Isolation of Histoplasma Yeast Total RNA

1. Collect Histoplasma yeast from a 5 mL culture by centrifugation (2 min at 2,000 × g) and transfer into a 2-mL screw-top microcentrifuge tube.

10

157

CCD

a

RNAi in Histoplasma

515 nm-545 nm emitted light

530/15 nm band-pass filter HMM plate with colonies

420 nm-500 nm excitation light

b

500 nm short-pass filter 470 nm conversion plate UV transilluminator (302 nm)

wild type 14%

OSU22 100%

OSU22 gfp-RNAi 32%

OSU22 gfp : AGS1- RNAi 38%

GFP Fluorescence

Plate Morphology

Fig. 2. Imaging of GFP fluorescence as a sentinel for RNAi knock-down. (a) The schematic depicts modifications to existing gel documentation systems to enable imaging of GFP fluorescence. A blue-light conversion plate and a 500 nm short-pass filter convert 302 nm UV light into 420–500 nm light capable of exciting the GFP molecule. A plate with Histoplasma yeast is placed on this stack of filters. A 515–545 nm band pass filter restricts CCD camera-based light collection to the GFP fluorescence emitted from the Histoplasma yeast. (b) Spots of Histoplasma yeast show the GFP fluorescence and plate morphology of the wild-type G186A strain, the sentinel strain OSU22 that carries a gfp transgene, and two Histoplasma lines carrying RNAi vectors, one targeting gfp (gfp-RNAi) and the other cotargeting gfp and the AGS1 gene (gfp:AGS1-RNAi). Numbers indicate the relative GFP fluorescence compared to the OSU22 strain and confirms knock-down of GFP fluorescence. Morphology change from rough to smooth indicates successful depletion of the alpha-glucan synthase (AGS1) gene product by the gfp:AGS1-RNAi vector. Size bar in colony images represents 1 mm.

2. To the yeast pellet, add 200 μL of 0.5-μm diameter glass beads and 1 mL of RiboZol RNA extraction reagent (Amresco). 3. Disrupt yeast by shaking with beads for 2 min in a bead beater. 4. Collect cell debris by centrifugation (5 min at 12,000 × g). Transfer the supernatant to a new 1.5-mL microfuge tube. 5. Add 200 μL CHCl3 and mix by inverting tube several times. 6. Separate organic and aqueous phases by centrifugation (5 min at 12,000 × g) and transfer aqueous phase (upper layer) to a clean 1.5-mL microfuge tube. 7. Precipitate nucleic acids by adding 500 μL isopropanol and collect by centrifugation (10 min at 12,000 × g).

158

B.H. Youseff and C.A. Rappleye

8. Wash nucleic acid pellet with 500 μL 70% ethanol. Resuspend pellet in 50 μL of RNase-free H2O. 9. Quantify total RNA by absorbance at 260 and 280 nm. 10. Remove contaminating genomic DNA by DNase treatment according to manufacturer’s protocol. 3.2. Construction of RNAi Vector

1. Assemble 200 μL PCR reactions for each RNAi fragment using 1 μL of oligo-T-primed reverse transcribed Histoplasma RNA as template, 0.5 μM of each gene-specific primer, 100 μM dNTPs, and 2 U Taq DNA Polymerase. For each fragment, use the appropriate sense and antisense primer pairs (forward fragment: primers 1 and 2, reverse fragment: primers 3 and 4; see Fig. 1 and Note 4). Perform 35 cycles of PCR: 94°C for 10 s, 55°C for 15 s, 72°C for 60 s per cycle. 2. Analyze 5 μL of each PCR product by electrophoresis through a 1% agarose gel. 3. Purify and concentrate the remaining 195 μL of each RNAi fragment using a DNA Clean and Concentrator column according to manufacturer’s instructions. Elute each RNAi fragment in 20 μL H2O. 4. Digest 20 μL of the forward fragment and 3 μg pCR473 with AscI and XhoI restriction enzymes in a total volume of 30 μL with 1 U AscI and 1 U XhoI. Incubate restriction digests overnight at 37°C. 5. Separate the digestion products by electrophoresis through a 1% agarose gel in TAE buffer. Excise the forward fragment and the digested vector bands using a clean scalpel blade (see Note 5). 6. Separate the DNA from the agarose by spinning the agarose slice through a Spin-X column. Retain the liquid flow-through containing the DNA fragments. 7. Quantify recovered DNA by running 1 μL on a 1% agarose gel with a diluted DNA standard of known concentration. Estimate the concentration of each fragment by comparison of the ethidium bromide staining between fragments and the DNA standard (see Note 6). 8. Ligate the forward fragment to pCR473. Mix the appropriate volumes of vector and fragment for a 3:1 molar ratio in a total volume of 6 μL. Add 6 μL of 2× T4 ligase buffer containing 0.5 U T4 DNA ligase and incubate ligation for 1 h at room temperature. 9. Transform 10 μL of the ligation reaction into transformationcompetent DH5α E. coli cells or other recombination deficient strain. 10. Plate transformants on LB-kanamycin plates. Incubate plates overnight at 37°C.

10

RNAi in Histoplasma

159

11. Screen 5–20 transformants for the forward fragment by colony PCR. Pick colony with a sterile pipette tip and patch cells on a new LB-kanamycin plate. Transfer pipette tip to a PCR tube containing 20 μL of a PCR reaction mix with 0.5 μM of vectorspecific primer LOOP2 (CAATTCACTGGCCGTCGT-TTTAC) and forward fragment primer (e.g., primer 1, Fig. 1), 100 μM dNTPs, and 2 U Taq DNA polymerase (see Note 7). After holding the tubes for 10 min at 94°C, perform 35 cycles of PCR: 94°C for 10 s, 55°C for 15 s, 72°C for 1 min per cycle. 12. Analyze 5 μL of each PCR product by agarose gel electrophoresis. 13. Inoculate 3 mL of LB-kanamycin with a positive transformant picked from the LB-kanamycin master plate. Incubate at 37°C with shaking at 200 rpm for 12–14 h. 14. Isolate plasmid DNA using a ZR Plasmid Miniprep column according to manufacturer’s instructions. 15. Repeat steps 4–15 using the reverse fragment, 3 μg of new vector containing the forward fragment, and 1 U SpeI, and 1 U AgeI for the restriction digest steps (see Note 8). Colony PCR screening of transformants can be performed with a reverse fragment primer (e.g., primer 3; Fig. 1) and primer LOOP4 (CTCGAGGGATGTGCTGCAAGGCGA). 3.3. Transformation of Histoplasma with RNAi Vector

1. Thaw a frozen aliquot of a GFP-expressing Histoplasma sentinel strain (e.g., OSU22) in a 37°C water bath. Make tenfold serial dilutions in HMM–uracil and plate 5 μL spots of the original aliquot and each dilution on an HMM–uracil plate. Incubate plates at 37°C under 5% CO2/95% air until patches of yeast appear (3–5 days). Pick yeast and streak cells on HMM–uracil plates for isolated colonies. 2. Linearize the RNAi vector constructed in Subheading 3.1 and the pCR473 control vector by digestion with PacI restriction enzyme (see Fig. 1). For each, digest 1 μg of plasmid in a total volume of 20 mL with 2 U of PacI restriction enzyme. Incubate restriction digests overnight at 37°C. 3. Confirm linearization by analyzing 1 μL of each restriction digest by separation through a 1% agarose gel. Complete digestion should result in the release of a 1,683 bp fragment from the vector (see Note 9). 4. For each transformation (e.g., the RNAi vector and an empty vector control), inoculate 3 mL of HMM–uracil to an OD600 of 0.25 with GFP-expressing Histoplasma yeast (see Note 10). Incubate culture at 37°C under 5% CO2/95% air with shaking at 200 rpm for 24–36 h, until late exponential growth phase is reached (OD 600 of 1.75–2.25) (see Note 11).

160

B.H. Youseff and C.A. Rappleye

5. Collect yeast cells from the culture by centrifugation for 2 min at 2,000 × g and remove supernatant (see Note 12). Resuspend cells by vortexing in residual liquid. Add 1 mL 10% mannitol and transfer cells to a new 1.5-mL microfuge tube. Spin down cells for 2 min at 2,000 × g and remove supernatant. Repeat 10% mannitol wash one time. 6. Resuspend cells in 200 μL of 10% mannitol per transformation and transfer 200 μL aliquots to individual 0.65-mL microfuge tubes. To each tube add 2 μL (100 ng) of linearized RNAi vector or pCR473 and mix briefly by pipeting (see Note 13). 7. Transfer cells and DNA mixture to individual 2 mm gap electroporation cuvettes and place cuvette in electroporation chamber. 8. Electroporate cells with 0.75 kV at 600 Ω resistance, and 25 μF capacitance (see Note 14). 9. Following electroporation, add 150 μL of HMM to each electroporation cuvette and mix by pipeting. 10. For each transformation, add 100 μL of HMM to one half of an HMM plate. To the 100 μL of HMM, add 50 μL of transformed cell suspension and to the other half of the plate add the remaining 300 μL of the transformation (see Note 15). Spread the two halves of the HMM plate with a sterile spreader. Allow plates to dry and incubate at 37°C with 5% CO2/95% air for 7–12 days until transformants appear. 3.4. Screening of Transformants for Silencing of GFP Sentinel

1. For each transformation, identify the first 8–12 transformants to appear on the plate (see Note 16). 2. Pick individual transformant colonies when approximately 1 mm in diameter with a sterile pipette tip and resuspend cells in 30 μL of HMM by pipeting up and down. Spot 5 μL of the suspension on an HMM plate. For comparisons with GFP-positive and GFP-negative cells, spot 5 μL of an appropriate sentinel strain (e.g., OSU22; GFP-positive uracil auxotroph) and wild-type Histoplasma (GFP-negative) on a separate HMM–uracil plate in the same manner. Allow spots to dry and incubate at 37°C with 5% CO2/95% air until a thick patch of yeast appears. 3. Once spots of yeast have produced thick growth (3–5 days), visualize the GFP fluorescence of each spot using a GFP imaging system (see Fig. 2a). Invert the HMM–uracil control plate with the GFP-positive and GFP-negative control spots on the excitation light platform. Adjust zoom factor and focus camera on the spots. Visualize GFP fluorescence and determine the maximum subsaturating exposure time to collect GFP fluorescence on the GFP-fluorescent parent sentinel strain spot (i.e., OSU22) (see Note 17). Acquire images for the GFP-positive and GFP-negative control spots.

10

RNAi in Histoplasma

161

4. Acquire images for each of the RNAi vector transformants using identical imaging conditions (i.e., zoom, focus, and exposure time). For an example of the results using OSU22 and an RNAi plasmid targeting AGS1, see Fig. 2b. 5. Quantify the relative fluorescence intensity of each spot using ImageJ’s integrated density measurement function. Open the images of the fluorescent spots in ImageJ. Convert the images to a stack by selecting “stacks” > “images to stack” under the “image” menu (see Note 18). Under the “analyze” menu, select “set measurements,” and select “integrated density” to be measured. On the image, draw a selection circle over the spot of interest and measure the integrated density (select “measure” under the “analyze” menu). Move (but do not resize or redraw) the selection circle to each spot and collect integrated density measurements for each. 6. Export the accumulated measurements to a spreadsheet and calculate the GFP fluorescence intensity for each isolate relative to the parent sentinel strain using the integrated density values (IDV) (see Note 19). 7. Select three of the RNAi isolates showing the strongest knockdown of GFP fluorescence and three control transformants (i.e., pCR473 vector only) to compare growth rates. 8. Inoculate 3 mL of HMM to an OD600 of 0.25. Incubate culture at 37°C under 5% CO2/95% air with shaking at 200 rpm. Measure the OD600 every 12–14 h for 5 days and plot relative to time. Compare the growth curve slopes during exponential growth phase of transformants to those of control lines (see Note 20). 9. Select transformants that show equivalent growth characteristics as the control line(s) and streak cells on an HMM plate for isolated colonies. 10. Optionally, validate silencing of the target gene through an independent method (see Note 21). 3.5. Isolation of Histoplasma Yeast that Have Segregated Away the RNAi Vector

1. Inoculate 3 mL HMM–uracil to an OD600 of 0.25 with a Histoplasma strain transformed with the RNAi plasmid of interest and incubate the culture at 37°C under 5% CO2/95% air with shaking at 200 rpm until saturation is reached (3–5 days). 2. Dilute the culture 1:100 into fresh HMM–uracil by adding 30 μL of the saturated culture to 3 mL HMM–uracil. Incubate at 37°C under 5% CO2/95% air with shaking at 200 rpm until saturation is reached (3–4 days). 3. Plate tenfold serial dilutions of the culture on HMM–uracil plates and incubate plates at 37°C with 5% CO2/95% air until isolated colonies appear (7–10 days).

162

B.H. Youseff and C.A. Rappleye

4. Image the GFP fluorescence of the colonies as described in Subheading 3.3 to identify those which have regained GFP fluorescence (and thus lost the RNAi knock-down effect). 5. Pick GFP-positive colonies and patch each onto an HMM and HMM–uracil plate to confirm that the selected segregants have lost the RNAi plasmid (and the URA5 gene present on the plasmid which provides for uracil prototrophy).

4. Notes 1. The following sequences are appended to the 5’ end of primers to facilitate cloning with the indicated restriction enzyme (recognition sequences underlined): AscI (AGGCGCGCC), XhoI (CGCTCGAG), AgeI (GCACCGGT), and SpeI (GCACTAGT). If AscI, XhoI, AgeI, or SpeI restriction sites are present in the RNAi fragment, use alternative enzyme sites in the PCR primers that are cohesive with the AscI, XhoI, AgeI, or SpeI sites in the RNAi vector (i.e., MluI for AscI; SalI for XhoI; XmaI for AgeI; and AvrII, NheI, or XbaI for SpeI). 2. The quality and type of agarose is critical to growth of Histoplasma on solid medium. SeaKem LE agarose (Lonza) has worked well. Test manufacturer’s agarose to determine if it is compatible with yeast growth. 3. FeSO4 solution should be made fresh since insoluble oxidized iron products will accumulate. 4. RNAi fragments of 700–1,000 bp are typically used. We have had success at knocking-down genes of up to 7 kb with 1 kb fragments. Usually the whole CDS is used for genes less than 1 kb. 5. We find using a 1% agarose gel made with TAE buffer containing 0.025% crystal violet to visualize the DNA fragments is a safe and convenient alternative to staining with ethidium bromide. Bands can be viewed and excised using a fluorescent light box in place of a UV transilluminator thereby eliminating UV-damage to the DNA (14). 6. DNA band intensity can be quantified using the integrated density measurement of ImageJ as described in Subheading 3.3. 7. When using colony PCR to screen for positive transformants, the use of one primer that binds to the insert fragment and one primer that binds in the vector sequence dramatically reduces false positives. 8. Parent RNAi vectors have also been developed to use Gateway cloning systems (11).

10

RNAi in Histoplasma

163

9. Optionally, the linearized RNAi vectors can be gel purified before transformation into Histoplasma yeast. 10. To measure the optical density of yeast cultures that clump (i.e., OSU22 and OSU22-derived strains), add 333 μL of 3 M NaOH to 666 μL of yeast suspension, mix well, measure the OD600, and multiply the reading by 1.5. 11. The OD600 values given throughout the protocol are for the OSU22 sentinel strain. If using OSU32, a sentinel strain in the G217B background which grows dispersed in liquid culture, inoculate at an OD600 of 0.50 and grow until an OD600 of 2.75–3.25. In addition, OSU32 cells do not need to be treated with NaOH prior to optical density readings. 12. If transforming a strain that clumps during liquid growth (i.e., OSU22), spin culture for 1 min at 50 × g to remove large clumps prior to collecting the dispersed cells by high speed centrifugation. Large clumps decrease the efficiency of transformation. 13. We find that using 100–200 ng of DNA typically yields a good number of transformants, although successful transformations have been performed with 25–250 ng of DNA. 14. Efficient transformations usually give time constants between 8 and 12 ms. 15. This method results in plating 15 and 85% of the transformation on the two halves of the plate, so that a reasonable separation of transformants is achieved, either on the low or high concentration of cells, depending on the efficiency of the transformation. 16. We have found that the first transformants to appear on the plate, i.e., the larger, faster growing colonies, are more likely to have normal rates of growth. 17. Maximum subsaturating exposure times are typically in the range of 2–4 s. 18. ImageJ automatically scales the image’s brightness and contrast when it is opened. The conversion of the images to a stack ensures that all images are adjusted to the same scale. In addition, image stacks allow the same selection circle to move between images and keeps the same size of the area to be analyzed. 19. Percent GFP fluorescence intensity = (IDV of isolate/IDV of the sentinel strain) × 100%. In general, sentinel GFP expression is reduced by 70–80% in transformants cotargeting a gene of interest with gfp. The silencing of the GFP-fluorescent sentinel when cotargeting another gene is typically not as strong as when gfp is the only gene targeted (i.e., in pCR473), probably due to competition by the separate elements of the chimeric stem-loop for limited RNAi machinery (15). 20. For unknown reasons, not all transformants exhibit the same growth rate, irrespective of the RNAi effect (i.e., the differences

164

B.H. Youseff and C.A. Rappleye

are not due to RNAi of the target gene). This step ensures that the deduced RNAi phenotype is not simply due to a slower growing transformant. For RNAi of targets that might impact the growth of Histoplasma yeast in laboratory culture, multiple transformants should be examined and compared to multiple control transformants. 21. Although the sentinel system efficiently identifies transformants for which the targeted gene is silenced, it is recommended that knock-down of the gene of interest be confirmed through an alternative approach. Techniques that can be employed include the detection of gene-product levels by SDS-PAGE or western blot, biochemical assays of the remaining gene-product’s activity, detection of a visible phenotype (see Fig. 2b), or examination of targeted gene mRNA levels by quantitative RT-PCR (qRTPCR) or northern blot. Method selection is dictated by the gene of interest and the ease of assaying its function. If employing qRT-PCR, at least one primer should be located outside of the region targeted directly by RNAi. References 1. Aliyari R, Ding SW (2009) RNA-based viral immunity initiated by the Dicer family of host immune receptors. Immunol Rev 227:176–188 2. Carthew RW, Sontheimer EJ (2009) Origins and Mechanisms of miRNAs and siRNAs. Cell 136:642–655 3. Rana TM (2007) Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8:23–36 4. Rappleye CA, Engle JT, Goldman WE (2004) RNA interference in Histoplasma capsulatum demonstrates a role for alpha-(1,3)-glucan in virulence. Mol Microbiol 53:153–165 5. Marion CL, Rappleye CA, Engle JT, et al (2006) An alpha-(1,4)-amylase is essential for alpha-(1,3)-glucan production and virulence in Histoplasma capsulatum. Mol Microbiol 62:970–983 6. Nguyen VQ, Sil A (2008) Temperatureinduced switch to the pathogenic yeast form of Histoplasma capsulatum requires Ryp1, a conserved transcriptional regulator. Proc Natl Acad Sci USA 105:4880–4885 7. Zarnowski R, Cooper KG, Brunold LS, et al (2008) Histoplasma capsulatum secreted gamma-glutamyltransferase reduces iron by generating an efficient ferric reductant. Mol Microbiol 70:352–368 8. Cooper KG, Woods JP (2009) Secreted dipeptidyl peptidase IV activity in the dimorphic fungal pathogen Histoplasma capsulatum. Infect Immun 77:2447–2454

9. Bohse ML, Woods JP (2007) RNA interference-mediated silencing of the YPS3 gene of Histoplasma capsulatum reveals virulence defects. Infect Immun 75:2811–2817 10. Nemecek JC, Wuthrich M, Klein BS (2006) Global control of dimorphism and virulence in fungi. Science 312:583–588 11. Krajaejun T, Gauthier GM, Rappleye CA, et al (2007) Development and application of a green fluorescent protein sentinel system for identification of RNA interference in Blastomyces dermatitidis illuminates the role of septin in morphogenesis and sporulation. Eukaryot Cell 6:1299–1309 12. Liu H, Cottrell TR, Pierini LM, et al (2002) RNA interference in the pathogenic fungus Cryptococcus neoformans. Genetics 160:463–470 13. Edwards JA, Alore EA, Rappleye CA (2011) The yeast-phase virulence requirement for alpha-glucan synthase differs among Histoplasma capsulatum chemotypes. Eukaryot Cell 10:87–97 14. Rand KN (1996) Crystal violet can be used to visualize DNA bands during gel electrophoresis and to improve cloning efficiency. Elsevier Trends Journals Technical Tips Online: T40022 15. Castanotto D, Sakurai K, Lingeman R, et al (2007) Combinatorial delivery of small interfering RNAs reduces RNAi efficacy by selective incorporation into RISC. Nucleic Acids Res 35:5154–5164

Chapter 11 RNA Interference in Cryptococcus neoformans Michael L. Skowyra and Tamara L. Doering Abstract RNA interference (RNAi) is an experimental technique used to suppress individual gene expression in eukaryotic cells in a sequence-dependent manner. The process relies on double-stranded RNA (dsRNA) to target complementary messenger RNA for degradation. Here, we describe two plasmid-based strategies we have developed for RNAi in Cryptococcus neoformans. The pFrame vector utilizes the ACT1 promoter to enable the constitutive synthesis of hairpin RNA (hpRNA), the stem of which constitutes the dsRNA trigger. The pIBB103 vector relies on convergent, inducible GAL7 promoters to independently drive the synthesis of the sense and antisense strands of the interfering sequence; these strands anneal to form the initiating dsRNA molecule. Both vectors are designed to co-silence a “sentinel” gene with an easily scored phenotype to help identify clones in which RNAi is most effective. We provide guidelines for selecting a suitable interfering sequence to trigger RNAi in C. neoformans and describe the steps for subcloning into either vector, transforming C. neoformans by electroporation, screening clones for RNAi-related phenotypes, and evaluating the efficacy and specificity of gene silencing by RNAi. Key words: Cryptococcus neoformans, RNA interference, Gene silencing, Gene expression

1. Introduction RNA interference (RNAi) is a way to experimentally suppress the expression of specific genes in eukaryotic cells by using doublestranded RNA (dsRNA) to target homologous messenger RNA (mRNA) for degradation. The technique harnesses components of the post-transcriptional gene silencing machinery that is found in most eukaryotes, including pathogenic fungi (1), and that has been implicated in gene regulation (2) and protection against viruses and mobile genetic elements (3). Briefly, RNAi is triggered by dsRNA that has been either directly introduced into a cell by transformation or synthesized intracellularly from a plasmid or a

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_11, © Springer Science+Business Media, LLC 2012

165

166

M.L. Skowyra and T.L. Doering

chromosomally integrated construct. The endogenous ribonuclease Dicer cleaves the dsRNA molecules into 20–30-bp pieces (4). The resulting small interfering RNA (siRNA) fragments are incorporated into an RNA-induced silencing complex (RISC) that catalyzes the sequence-specific cleavage of mRNA. Since its discovery nearly two decades ago, RNAi has been implemented in a variety of fungi (5, 6), including Cryptococcus neoformans. Early evidence that RNA-mediated silencing functions in C. neoformans was provided in 2002 by Gorlach et al. (7). These investigators successfully suppressed the synthesis of calcineurin A (CNA1) in serotype D and laccase (LAC1) in serotype A using antisense repression, a technique similar to RNAi but triggered by single-stranded RNA complementary to endogenous mRNA. The same year, we reported successful silencing of CAP59 and ADE2 by RNAi in serotype D (8). For these studies, we used an episomally expressed hairpin RNA (hpRNA) consisting of the sense and antisense strands of the target sequence connected by a linker (Fig. 1). The complementary nature of the antiparallel strands

Fig. 1. RNAi mediated by episomally expressed hairpin RNA (hpRNA). (a) Schematic of an hpRNA-expressing construct, which consists of two antiparallel copies of a target sequence separated by a spacer region and placed between suitable promoter (P) and terminator (T) regions. (b) Transcription proceeds only along one strand to yield a singlestranded RNA molecule. (c) The complementary nature of the two antiparallel target sequences allows them to anneal intramolecularly to form a double-stranded duplex RNA that (d) is subject to cleavage by Dicer.

11

RNA Interference in Cryptococcus neoformans

167

Fig. 2. RNAi mediated by convergent promoters. (a) Schematic of a converging promoter construct, which consists of a single copy of a target sequence flanked by promoter (P) and terminator (T) regions on each strand. (b) Transcription proceeds independently in both directions to yield single-stranded RNA molecules corresponding to the sense and antisense strands of the target sequence. (c) The individual transcripts anneal intermolecularly to form an RNA duplex that (d) is subject to cleavage by Dicer.

allows them to anneal intramolecularly to form a double-stranded duplex RNA which is subject to cleavage by Dicer. Since then, we have implemented a simpler system utilizing convergent promoters to drive transcription of both the sense and antisense strands of the target sequence (Fig. 2). The individual transcripts anneal intermolecularly to form an RNA duplex that triggers RNAi. We and others have employed both the hairpin (8–12) and convergent promoter (13) RNAi constructs to study genes implicated in C. neoformans virulence. Our discussion regarding RNAi in this organism will, therefore, focus on these two plasmid-based methods. Over the past several years, the sequenced and annotated genomes of C. neoformans strains representative of serotypes A, B, and D have been made available, facilitating genetic manipulation in this pathogen (see Note 1). Yet despite concomitant improvements in the efficiency of gene disruption in this organism (14–16), RNAi offers several advantages that are not possible or difficult to achieve with gene disruption alone. For example, intracellular synthesis of interfering dsRNA can be driven by various promoters, potentially enabling either constitutive (17, 18) or inducible

168

M.L. Skowyra and T.L. Doering

(19–21) down-regulation that restricts RNAi to a specific time frame or growth phase. Such transient silencing can be used as an alternative to conditional mutations in studying the function of essential genes (5). Furthermore, multiple genes can be silenced in parallel using combinations of dsRNA directed against each transcript. Since RNAi operates at the post-transcriptional level, members of the same gene family or homologous genes in different strains can be targeted using a single motif (22); likewise, specific splice variants can be selectively inhibited by targeting a unique sequence not shared by the other transcripts (23). An exciting application of RNAi that has begun to gain momentum is the capacity for high-throughput library screening in genome analysis (24–26) and the identification of genes involved in host–pathogen interactions (27). In contrast to gene deletion, RNAi does not completely eliminate the expression of the target gene. Consequently, the extent to which a gene is silenced depends on multiple factors, including the kinetics of target gene expression, the efficiency of the interference itself, the stability of the gene product, and the threshold for gene function in the process of interest (5, 28). Although in many cases RNAi does produce a null phenotype, it may also generate a range of partial phenotypes if the targeted gene is insufficiently silenced. To assess the efficacy of RNAi, it is necessary to compare the extent of interference in multiple clones. A qualitative comparison can be made on the basis of observable phenotypes, while a more quantitative approach involves analyzing the abundance of the targeted mRNA by quantitative PCR (qPCR) or RNA blotting, and/or evaluating the abundance of the corresponding gene product by immunodetection or a functional assay. The partial phenotypes produced by incomplete silencing may help to elucidate the roles of essential genes or correlate expression level with observed phenotype. However, incomplete silencing may also result in the lack of a detectable phenotype. A reporter strategy has been used by us in C. neoformans (8) and by others in Histoplasma capsulatum (29) and Blastomyces dermatiditis (30) to compare the extent of interference in specific transformants. This approach involves co-silencing the intended target gene in parallel with an unrelated “sentinel” gene. This sentinel should have an easily scored phenotype and preferably be known to be efficiently silenced. Although this method generally helps to identify clones experiencing stronger interference, silencing of the sentinel and target genes still occurs independently and may not correlate in all cases. In any RNAi experiment, it is critical to confirm that an observed phenotype results exclusively from silencing of the intended target gene. Since the mechanism of RNAi is sequencedependent instead of locus-dependent, RNAi may trigger the suppression of genes whose mRNA contains a sequence similar to the interfering dsRNA (5, 28). Such “off-target” silencing can potentially

11

RNA Interference in Cryptococcus neoformans

169

be minimized by selecting the interfering sequence from within a unique region in the intended target gene, and ensuring that this sequence has low homology to other endogenous genes. One way to confirm the specificity of RNAi is to independently target different regions of the same mRNA to see whether the observed phenotype is recapitulated. In addition, it may be possible to complement an RNAi phenotype with a mutant version of the target gene that has been engineered to differ in sequence from the interfering dsRNA (a technique termed “gene resurrection”) (5, 28). To verify whether the plasmid or experimental conditions themselves potentially cause unintended silencing, a mock transformation should be performed using the vector without the interfering sequence. In this chapter, we detail the use of the two plasmid-based strategies we have developed for RNAi in C. neoformans. The pFrame vector (Fig. 3, Genbank accession number HM352736) is based on the hairpin design we initially used to implement RNAi in this organism (8). It permits constitutive synthesis of an hpRNA construct flanked by the ACT1 promoter (18) and GAL7 terminator (19), and further offers the option of co-silencing endogenous ADE2 as a sentinel for RNAi. The hpRNA construct consists of 510 bp of the ADE2 coding sequence, followed by a custom interfering sequence, a 250-bp spacer fragment derived from GFP (to serve as the loop of the hairpin), the reverse complement of the

Fig. 3. The pFrame vector mediates RNAi by means of a hairpin RNA (hpRNA). It allows the option of assessing the efficacy of RNAi by co-silencing endogenous ADE2. Constitutive synthesis of the hpRNA is regulated by an ACT1 promoter (PACT1) and GAL7 terminator (TGAL7), and proceeds unidirectionally along a construct that consists of a fragment derived from ADE2, a fragment derived from gusA, a spacer derived from GFP, a second region derived from gusA, and the reverse complement of the same ADE2 fragment. Insertion of a custom target fragment is accomplished by sequentially replacing each gusA piece.

170

M.L. Skowyra and T.L. Doering

custom fragment, and the reverse complement of the ADE2 fragment (the spacer is an exogenous sequence with no homology to endogenous genes to avoid potential silencing from the loop itself ). To simplify cloning, two segments of the E. coli b-glucuronidase (gusA) gene have been inserted as placeholders for the two antiparallel segments of the custom interfering sequence. Cloning into pFrame is achieved by sequentially excising each gusA fragment and replacing it with the selected interfering sequence in the appropriate orientation. Following transformation of C. neoformans with the fully assembled vector, clones can be screened for efficacy of RNAi based on colony pigmentation on low-adenine medium: Increased suppression of ADE2 causes greater accumulation of purine precursors and results in a brighter red colony color (8, 31). It should be noted that the URA5 auxotrophic marker (32) included on the plasmid for selection in C. neoformans limits the use of this vector to ura5 mutant strains (see Note 2). The twostep cloning required to assemble the hairpin constructs can be time-consuming, but hpRNA may induce more consistent RNAi than the convergent promoter strategy described below (5). The vector pIBB103 (Fig. 4, Genbank accession number HQ455038) overcomes several technical shortcomings of pFrame (33). It utilizes two convergent, galactose-inducible GAL7 promoters (each paired with a GAL7 terminator) to independently

Fig. 4. The pIBB103 vector mediates RNAi by means of convergent promoters. It triggers co-silencing of endogenous URA5, enabling selection of clones undergoing interference by growth on medium containing 5-fluoroorotic acid. Transcription of both strands of the interfering construct is independently driven by converging, galactose-inducible GAL7 promoters (PGAL7) and terminators (TGAL7). A custom target sequence can be inserted into the SpeI site. Digestion with the endonuclease I-SceI linearizes the plasmid and exposes telomeric repeats (thick black bars) that improve transformation efficiency.

11

RNA Interference in Cryptococcus neoformans

171

drive strong transcription of the sense and antisense strands of the interfering construct with little basal activity (19). One-step cloning of the target sequence into an SpeI restriction site saves time and permits the construction of RNAi libraries. The inclusion of a Geneticin® (G418) resistance marker (34) makes the vector compatible with most C. neoformans strains (see Note 2), and cryptococcal telomeric repeats improve transformation efficiency and intracellular maintenance of the plasmid (35). These repeats are separated by an ~800 bp fragment derived from the bacterial transposon Tn903, which may be released by digestion with the endonuclease I-SceI to expose the telomeric repeats at both ends of the linearized plasmid. A 251-bp fragment derived from serotype D genomic DNA mediates co-silencing of endogenous URA5 and offers the advantage of making RNAi a selectable trait: Transformants can be screened either by negative selection on media lacking uracil or positive selection on media containing 5-fluoroorotic acid (5-FOA) (32, 33). Notably, even weak suppression of URA5 allows growth on 5-FOA (albeit at a growth rate slightly slower than that of a ura5 mutant), without significant inhibition of growth on uracil-deficient media. In the event that targeting URA5 as a sentinel proves inefficient, we suggest alternatively targeting ADE2. The broader range of phenotypes produced from partial suppression of ADE2 should allow a better assessment of the relative efficacy of RNAi. A critical first step for implementing RNAi in C. neoformans is the choice of a suitable interfering sequence that is specific for the gene being targeted. Once selected, the interfering sequence is amplified by PCR using primers that introduce the appropriate restriction enzyme sites for subcloning into the vector of choice. Next, the fully assembled vector is linearized by restriction enzyme digestion to improve the efficiency of transformation (36) and electroporated into C. neoformans (37). After electroporation of the linearized DNA, transformants are selected by growth on appropriate media and screened for suppression of the RNAi sentinel by replica-plating onto suitable media. Those transformants that exhibit inhibition of the sentinel are further assessed for suppression of the target gene(s) by phenotypic analysis. For transformants of interest, the extent and specificity of interference are evaluated as mentioned above.

2. Materials Prepare all reagents using distilled water, unless noted otherwise. Distilled and deionized water (e.g., from a Milli-Q system) will be referred to as ultrapure. Room temperature (22–25°C) will be abbreviated as RT. All media and agar plates should be prepared

172

M.L. Skowyra and T.L. Doering

using standard sterile technique for microbiological work. Unless noted otherwise, agar plates can be made from any of the media recipes (see Note 3). 2.1. Preparation of the pFrame Vector for Triggering RNA Interference

1. Access to the internet to obtain the coding sequence of the target gene and perform bioinformatic operations (see Note 1). 2. A suitable DNA sequence editor (e.g., the free Serial Cloner application from Serial Basics or the DNAStar Lasergene® sequence analysis software suite). 3. Standard PCR reagents. 4. PCR purification kit (e.g., QIAquick® from Qiagen). 5. NdeI, AvrII, XhoI, BglII, and NotI restriction enzymes and appropriate buffers. 6. T4 DNA ligase with appropriate buffer. 7. Gel extraction and spin miniprep kits (e.g., QIAquick® and QIAprep® from Qiagen). 8. Escherichia coli competent cells. 9. 1,000× ampicillin solution (100 mg/mL), prepared in water and filter-sterilized. Store in 500 mL aliquots at −20°C. 10. LB (Luria-Bertani) medium: 1% (w/v) tryptone, 0.5% (w/v) yeast extract, and 1% (w/v) NaCl in water. Stir until mixed completely, then aliquot desired volume to bottles or flasks and autoclave for 25 min. Store at RT. 11. LB agar plates with 100 mg/mL ampicillin: Prepare 1 L (see Note 3) using the above recipe for LB medium. Add 1 mL of 1,000× ampicillin solution to the cooled agar after autoclaving and stir for 5 more minutes before pouring into petri dishes. 12. 100% and 70% (v/v) ethanol prepared in ultrapure water, both chilled at −20°C. 13. 3 M sodium acetate: Dissolve 40.8 g of sodium acetate in 80 mL of ultrapure water. Adjust the pH to 5.2 with glacial acetic acid, then adjust the volume to 100 mL and filter-sterilize. Store at RT. 14. Ultrapure water that has been filter-sterilized or autoclaved.

2.2. Transformation of C. neoformans by the pFrame Vector Using Electroporation

1. Sterile 1.5-mL microfuge tubes, 13-mL culture tubes, and 50-mL conical tubes. 2. Ultrapure water that has been filter-sterilized or autoclaved, and chilled to 4°C. 3. Electroporation buffer (EB): 10 mM Tris–HCl pH 7.5, 1 mM MgCl2, 270 mM sucrose. Prepare in ultrapure water, filtersterilize, and chill at 4°C.

11

RNA Interference in Cryptococcus neoformans

173

4. 1 M Dithiothreitol (DTT), prepared in ultrapure water and filter-sterilized. Store in 500 mL aliquots at −20°C. 5. 0.2-cm Electroporation cuvettes (Bio-Rad). 6. YPD (yeast extract–peptone–dextrose) medium: 1% (w/v) yeast extract, 2% (w/v) peptone, and 2% (w/v) dextrose in water. Stir until mixed completely, then aliquot desired volume to bottles or flasks and autoclave for 25 min. Store at RT. 7. Complete uracil dropout mix: Use a commercially available mixture or prepare from the individual components (see Note 4). 8. Uracil-deficient medium: 0.67% (w/v) yeast nitrogen base without amino acids, 2% (w/v) dextrose, and 0.08% (w/v) complete uracil dropout mix in water. Stir until mixed completely and autoclave for 25 min. Store at RT. 9. Uracil-deficient agar plates: Prepare 1 L as described (see Note 3) using the above recipe for uracil-deficient medium. 2.3. Phenotypic Screening of Transformants Using the ADE2 Sentinel of RNAi

1. Flat-tipped toothpicks, autoclaved. 2. 48-pin Replicator and 100% ethanol. 3. Low-adenine uracil-deficient medium: 0.67% (w/v) yeast nitrogen base without amino acids, 2% (w/v) dextrose, 0.08% (w/v) complete adenine and uracil dropout mix, and 10 mg/L of adenine in water. Stir until mixed completely and autoclave for 25 min. Store at RT. 4. Low-adenine uracil-deficient agar plates: Prepare 1 L as described (see Note 3) using the recipe for low-adenine uracildeficient medium above. 5. Complete adenine and uracil dropout mix: Use a commercially available mixture or prepare from the individual components (see Note 4).

2.4. Extraction of Total RNA and Analysis of mRNA Abundance

1. Uracil-deficient medium: See items 7–9 in Subheading 2.2. 2. 250-mL Erlenmeyer flasks, autoclaved. 3. 1.5-mL Microfuge tubes and 2-mL screw-cap tubes (RNase-free). 4. 0.5-mm Glass beads and Mini beadbeater. 5. TRIzol® reagent. Store at −20°C. 6. Chloroform, isopropanol, and ultrapure water (all RNasefree). 7. 70% (v/v) Ethanol, prepared in RNase-free ultrapure water and chilled at −20°C.

2.5. Preparation of the pIBB103 Vector for Triggering RNA Interference

1. Items 1–4 and 6–14 in Subheading 2.1. 2. Spe I and I-Sce I restriction enzymes and appropriate buffers.

174

M.L. Skowyra and T.L. Doering

2.6. Transformation of C. neoformans by the pIBB103 Vector Using Electroporation

1. Items 1–6 in Subheading 2.2. 2. 20% (w/v) Galactose solution, prepared in water and filtersterilized. Store at RT. 3. 1,000× G418 solution (100 mg/mL), prepared in water and filter-sterilized. Store in 500 mL aliquots at −20°C. 4. YPG (yeast extract–peptone–galactose) medium with 100 mg/ ml G418: For 1 L of medium, combine 10 g of yeast extract and 20 g of peptone in 900 mL of water. Add a stir bar and autoclave for 20–30 min. Cool by gently stirring for 10–15 min at RT, then add 100 mL of 20% galactose solution while stirring. Store at RT. Right before use, add the appropriate volume of 1,000× G418 solution to the desired volume of medium and swirl to mix well. 5. YPG agar plates with G418: Prepare 1 L as described (see Note 3) using the above recipe for YPG medium. Add 1 mL of 1,000× G418 solution to the cooled agar after autoclaving and stir for 5 more minutes before pouring into petri dishes.

2.7. Phenotypic Screening of Transformants Using the URA5 Sentinel of RNAi

1. Items 1–2 in Subheading 2.3. 2. Uracil-deficient agar plates with galactose and G418: For 1 L of medium, combine 6.7 g of yeast nitrogen base without amino acids, 800 mg of complete uracil dropout mix (see item 7 in Subheading 2.2), and 25 g of Bacto agar in 900 mL of water. Autoclave with a stir bar for 20–30 min, then cool by gently stirring for 20–25 min at RT. Add 100 mL of 20% galactose solution (see item 2 in Subheading 2.6) while stirring, then add 1 mL of 1,000× G418 solution (see item 3 in Subheading 2.6). Stir for 5 more minutes until the solutions mix completely, then pour 25 mL per petri plate and store at 4°C sealed in plastic wrap. 3. 5-FOA solution (10 mg/ml): Dissolve 1 g of 5-FOA in 100 mL of water with gentle stirring and heating, then cool and filtersterilize. Prepare right before use. 4. 5-FOA agar plates with galactose and G418: For 1 L of medium, combine 6.7 g of yeast nitrogen base without amino acids, 800 mg of complete uracil dropout mix (see item 7 in Subheading 2.2), 12 mg of uracil, and 25 g of Bacto agar in 800 mL of water. Autoclave with a stir bar for 20–30 min, then cool by gently stirring for 15–20 min at RT. Slowly add 100 mL of 20% galactose solution (see item 2 in Subheading 2.6), 100 mL of 5-FOA solution, and 1 mL of 1,000× G418 solution (see item 3 in Subheading 2.6) to the cooled agar. Stir for 5 more minutes until the solutions mix completely, then pour 25 mL per petri plate and store at 4°C sealed in plastic wrap. Protect from light.

11

RNA Interference in Cryptococcus neoformans

175

3 Methods 3.1. Preparation of the pFrame Vector for Triggering RNA Interference

1. To select a sequence for triggering RNAi, obtain the coding sequence of the target gene from the appropriate database by one of the following methods: a. If the accession number of the target gene is known for a strain whose genome has been sequenced, use it to directly query the appropriate database and retrieve the corresponding locus record (see Note 1); b. If a genomic, cDNA, or protein sequence corresponding to the target gene from another strain or organism is known, use the BLAST sequence alignment tool available through the NCBI (see Note 5) or the Broad Institute to identify the closest homolog in one of the sequenced C. neoformans strains. 2. With the help of a sequence editor application, choose a region within the coding sequence of the target gene that satisfies the following criteria (see Note 6): a. The region should preferably be located within the middle of the coding sequence (see Note 7); b. The region should have minimal homology to the coding sequences of other genes in the same strain (see Note 8); c. The region should not exceed 500 bp in length (see Note 9); d. The proportion of A-T base pairs to G-C base pairs should be approximately equal (see Note 10); e. Avoid repeats longer than 3–5 bp of the same residue (see Note 11); f. The region should not contain the recognition sites for any of the following restriction enzymes: NdeI, BglII, AvrII, XhoI, and NotI (see Note 12). 3. Design a sense oligonucleotide primer (primer A) that overlaps 20–25 bp of the 5¢ end of the selected target sequence. Add an NdeI restriction site (CATATG) to the 5¢ end of this sequence, and then add six randomly arranged nucleotides to the 5¢ end of the resulting primer (see Note 13). Design a second primer (primer B) that differs only by the inclusion of a BglII restriction site (AGATCT) instead of the NdeI site. 4. Design an antisense oligonucleotide primer (primer C) that overlaps 20–25 bp of the 3¢ end of the selected target sequence. Add an AvrII restriction site (CCTAGG) to the 5¢ end of this sequence, and then add six randomly arranged nucleotides to the 5¢ end of the resulting primer (see Note 13). Design a second primer (primer D) that differs only by the inclusion of an XhoI restriction site (CTCGAG) instead of the AvrII site.

176

M.L. Skowyra and T.L. Doering

5. Amplify the selected target sequence by PCR using primers A and C in one reaction and primers B and D in a second reaction (see Note 14). Use cDNA (see Subheading 3.4) as a template if the target sequence overlaps exon junctions. Otherwise, genomic DNA may be used (38). 6. Confirm amplification of the desired fragments by resolving 1–5 mL of each reaction (i.e., 20–50 ng of product) by agarose gel electrophoresis (see Note 15). 7. Purify each fragment using a PCR purification kit and determine the DNA concentration (see Note 16). 8. Digest 1 mg of the fragment generated using primers A and C with 5–10 U each of NdeI and AvrII; digest 1 mg of the fragment generated using primers B and D with 5–10 U each of XhoI and BglII. Incubate for 12–16 h at 37°C (see Note 17) and purify each fragment using a PCR purification kit. Store at −20°C. 9. Prepare the pFrame vector for cloning: Excise one gusA fragment by digesting 1–2 mg of the plasmid with 5–10 U each of NdeI and AvrII for 12–16 h at 37°C. Gel purify the 8-kb vector backbone using a gel extraction kit. 10. Mix 30 ng (6 fmol) of the NdeI-, AvrII-cut plasmid with 5–15 ng (~30 fmol) of the NdeI-, AvrII-cut target fragment on ice. Add water and ligation buffer up to 20 mL. Add 1 mL of T4 DNA ligase and incubate at RT for 30–60 min. 11. Transform competent E. coli with the ligation reaction according to the supplier’s instructions. Plate 20% and 80% of the transformation on LB agar containing 100 mg/mL ampicillin and incubate overnight at 37°C. 12. Screen the transformants by colony PCR or restriction analysis to confirm insertion of the first target fragment, and extract plasmid DNA from a clone containing the desired insert using a spin miniprep kit as specified by the manufacturer. 13. Excise the second gusA fragment: Digest 1–2 mg of the plasmid isolated in step 12 with 5–10 U each of XhoI and BglII for 12–16 h at 37°C. Gel purify the plasmid backbone, ligate to the XhoI-, BglII-cut target fragment, and isolate the completed plasmid as described in steps 10–12 above. Store at −20°C. 14. Prepare the fully assembled plasmid for electroporation: Digest 1–5 mg (see Note 18) of the vector with 5–10 U of NotI for 12–16 h at 37°C, and confirm linearization by resolving 1–2 mL of the digest (50–100 ng of cut plasmid) by agarose gel electrophoresis with 50–100 ng of supercoiled (uncut) plasmid for comparison (see Note 19). 15. Ethanol precipitate the linearized plasmid: Add 3 M sodium acetate (pH 5.0–5.5) equal to 1/10 of the volume remaining

11

RNA Interference in Cryptococcus neoformans

177

after an aliquot has been removed for electrophoresis, and ice-cold 100% ethanol equal to twice the volume. (It is not necessary to purify the digestion reaction before precipitation). Vortex and incubate on ice for at least 10 min. 16. Centrifuge for 20 min at 4°C at 16,000 × g. Aspirate the supernatant fraction (see Note 20). 17. Add 750 mL of ice-cold 70% ethanol to the precipitated pellet, vortex, centrifuge as above, and aspirate the supernatant fraction. Briefly centrifuge again to collect residual ethanol and aspirate the supernatant fraction. 18. Dry the DNA pellet by leaving the tubes open for 5–15 min at RT in a clean, sterile environment, preferably a tissue-culture hood, until all liquid has evaporated. Resuspend the pellet in 5–10 mL of sterile water. Store on ice or at −20°C. 3.2. Transformation of C. neoformans by the pFrame Vector Using Electroporation

Proper sterile technique should be maintained throughout the procedure. Perform steps 3–8 on ice or at 4°C, as appropriate. Chill the electroporation buffer (EB), ultrapure water, 1.5-mL microfuge and 50-mL conical tubes, and the 0.2-cm electroporation cuvettes at 4°C before starting (see Note 21). 1. Inoculate a single colony (see Note 22) of a ura5 mutant strain of C. neoformans from a freshly streaked agar plate (see Note 23) to 50 mL of YPD medium in a 250-mL Erlenmeyer flask. Incubate at 30°C with shaking at 230 rpm until the culture density is approximately 5–15 × 107 cells per mL (see Note 24). 2. Dilute the culture to 2 × 106 cells per mL in fresh YPD (use 50 mL per planned transformation) and grow as above until the culture density is between 6 and 10 × 106 cells per mL (see Note 25). 3. Transfer each culture to a 50-mL conical tube, pellet the cells by centrifugation for 5 min at 4°C, 2,000 × g, and decant the supernatant fraction. 4. Suspend each cell pellet in 5–10 mL of chilled ultrapure water and pool in a single 50-mL conical tube. Adjust the volume to 50 mL with chilled ultrapure water and centrifuge as above. Decant the supernatant fraction and repeat once more with 50 mL of chilled ultrapure water. 5. Suspend the washed cell pellet in 50 mL of chilled EB, add 200 mL of 1 M DTT, invert several times to mix, and incubate on ice for 15 min (see Note 26). Centrifuge as above and decant the supernatant fraction. 6. Suspend the DTT-treated cell pellet in 50 mL of chilled EB, centrifuge as above, and decant the supernatant fraction. 7. Suspend the cell pellet in chilled EB to a final volume of 1–2 mL. Aliquot 3 × 108 cells per transformation to sterile 1.5-mL

178

M.L. Skowyra and T.L. Doering

microfuge tubes, centrifuge for 1 min at 4°C, 2,000 × g, and aspirate the supernatant fraction. 8. Suspend each cell pellet in 20 mL of chilled EB (see Note 27). Add 1–5 mg of the linearized plasmid (see steps 14–18 in Subheading 3.1) in 5–10 mL of sterile ultrapure water, flick the tube to mix, and transfer the cell suspension to a 0.2-cm electroporation cuvette. Repeat for any remaining samples. Include a sample with water alone as a negative control, and a sample with an unmodifed pFrame as a positive control for transformation. 9. Electroporate each sample at 500 V, 25 mF, 1,000 W (see Note 28), and then immediately add 0.5–1 mL of YPD (equilibrated to RT) to the cuvette and transfer the cell suspension to a 13-mL culture tube. 10. Shake the tubes for at 2 h at 30°C. Meanwhile, pre-warm uracil-deficient agar plates to 30°C (see Note 29). 11. Centrifuge the tubes for 1 min at RT, 2,000 × g. Aspirate most of the supernatant fraction, leaving ~200 mL in which to suspend the cell pellet. Plate 20% and 80% of the cell suspension on the pre-warmed agar plates, and incubate at 30°C until colonies appear (see Note 30). 3.3. Phenotypic Screening of Transformants Using the ADE2 Sentinel of RNAi

1. Generate master plates (arrays of single colonies) from the transformation plates: Use sterile flat-tipped toothpicks to transfer individual colonies to fresh uracil-deficient agar plates, applying the cells onto 2–3-mm diameter spots in a pattern corresponding to the pins of a 48-pin replicator (see Note 31). Incubate at 30°C until the colonies have grown up sufficiently (i.e., 1–2 days). 2. Replica plate the uracil-deficient master plates onto low-adenine uracil-deficient agar: Sterilize a 48-pin replicator by passing the tips through a flame until red-hot and cool by pressing it into a sterile agar plate until sizzling stops. Gently touch the pin tips to the colonies on the master plate, and press against the surface of a fresh low-adenine uracil-deficient agar plate, moving the replicator slightly to generate 2–3-mm spots. Rinse the pins in 100% ethanol and repeat for any other master plates. 3. Incubate the agar plates at 30°C until a reddish color begins to develop in some of the clones, suggesting effective RNAi (see Note 32). Inspect the cellular and colony morphology of the clones for expected phenotypes. Any clone of interest should be restreaked for isolation on uracil-deficient agar prior to further characterization.

11

3.4. Extraction of Total RNA and Analysis of mRNA Abundance

RNA Interference in Cryptococcus neoformans

179

TRIzol® reagent contains phenol and is therefore extremely hazardous. Everything that comes in contact with this reagent should be treated as hazardous waste and disposed of according to institutional guidelines. Use only certified RNase-free reagents, pipet tips, and tubes. Clean all equipment with 70% ethanol before starting, and change gloves frequently to avoid RNase contamination from human skin and dust. 1. For each clone of interest, inoculate a single colony from a freshly streaked uracil-deficient agar plate into 25 mL of medium in a 250-mL Erlenmeyer flask. Incubate at 30°C with shaking at 230 rpm until the culture density reaches 1–2 × 108 cells per mL. 2. For each culture, aliquot 3 × 108 cells to a 1.5-mL microfuge tube, centrifuge for 1 min at RT, 400 × g, and aspirate the supernatant fraction. 3. Suspend the cell pellet in 750 mL of TRIzol® reagent and transfer to a 2-mL screw-cap tube on ice. Carefully add 750 mL of glass beads, ensuring that no beads remain on the edge of the tube. 4. Bead-beat each sample 6–10 times using a mini beadbeater at 4°C, alternating 1 min beating with 2 min rests on ice (see Note 33). 5. Let the beads settle for a few seconds, then transfer the cell lysate to a new 1.5-mL microfuge tube on ice. Add 750 mL of TRIzol® to the beads, mix and let the beads settle, and then pool the supernatant fraction with the lysate to obtain ~1 mL total cell homogenate. 6. Continue with the TRIzol® extraction as specified by the manufacturer. Store the total RNA at −80°C. 7. To compare the efficacy of RNAi in different clones, the mRNA abundance can be analyzed by the following methods: a. Perform a Northern blot using the total RNA extracted from each clone as described in Unit 4.9 of the Current Protocols for Molecular Biology series (39); b. Perform quantitative PCR (qPCR) using cDNA prepared from the total RNA (see Note 34) as described in the BIOS Advanced Methods series (40).

3.5. Preparation of the pIBB103 Vector for Triggering RNA Interference

1. Select a sequence to trigger RNAi following the methods given in Subheading 3.1, with the exception that the selected target sequence should not contain the recognition sites for the SpeI and I-SceI restriction enzymes (see Note 12).

180

M.L. Skowyra and T.L. Doering

2. Design a sense oligonucleotide primer that overlaps 20–25 bp of the 5¢ end of the selected target sequence and an antisense primer that overlaps 20–25 bp of the 3¢ end. Add an SpeI restriction site (ACTAGT) to the 5¢ end of each sequence, and then add six randomly arranged nucleotides to the 5¢ end of each resulting primer (see Note 13). 3. Amplify the selected target sequence by PCR using both primers in one reaction (see steps 5–7 in Subheading 3.1). 4. Digest 1 mg of the PCR product with 5–10 U of SpeI for 12–16 h at 37°C, and purify using a PCR purification kit. Store at −20°C. 5. Digest 1–2 mg of the pIBB103 plasmid with 5–10 U of SpeI for 12–16 h at 37°C, and purify using a PCR purification kit. 6. Ligate the SpeI-cut plasmid to the SpeI-cut target fragment and extract the fully assembled plasmid DNA (see steps 10–12 in Subheading 3.1). Store at −20°C. 7. Prepare the fully assembled plasmid for electroporation: See steps 14–18 in Subheading 3.1, with the exception that the completed vector should be digested with 10–15 U of I-SceI. 3.6. Transformation of C. neoformans by the Vector pIBB103 Using Electroporation

See Subheading 3.2, with the exception that, following electroporation, transformants should be selected on pre-warmed YPG agar plates containing 100 mg/mL G418 (see Note 35).

3.7. Phenotypic Screening of Transformants Using the URA5 Sentinel of RNAi

1. Pick single colonies from the transformation plates and transfer to YPG agar plates containing 100 mg/mL G418. Incubate at 30°C until grown up sufficiently (see step 1 in Subheading 3.3). 2. Replica plate the YPG plates onto 5-FOA agar plates containing galactose and G418 as well as onto uracil-deficient agar plates containing galactose and G418 (see step 2 in Subheading 3.3). 3. Incubate at 30°C until the transformants begin to grow on the 5-FOA medium. The same clones should not grow on uracil-deficient medium (see Note 36). Inspect the cellular and colony morphology of the clones for any phenotypes. Any clone of interest should be restreaked for isolation on YPG agar plates containing 100 mg/mL G418 prior to further characterization. 4. The efficacy of target gene down-regulation may be assessed by extracting total RNA and analyzing mRNA abundance as described in Subheading 3.4, with the exception that any clone of interest should be cultivated in YPG medium containing 100 mg/mL G418.

11

RNA Interference in Cryptococcus neoformans

181

4. Notes 1. The genomes of C. neoformans var. neoformans JEC21 and B-3501A (capsule serotype D) are available through the Genome Project database at the National Center for Biotechnology Information (NCBI) at http://www.ncbi.nlm. nih.gov/genomes/leuks.cgi. Those of C. neoformans var. grubii H99 (capsule serotype A) and C. neoformans var. gatii R265 (capsule serotype B) are available through the Fungal Genome Initiative at the Broad Institute of MIT and Harvard at http://www.broadinstitute.org/science/projects/projects. 2. In our experience, RNAi is considerably less effective in serotype A than in serotype D, which we suspect results from the significantly lower expression of the interfering dsRNA from the serotype A GAL7 and ACT1 promoters (21). 3. Add 20 g of Bacto agar per L of medium, along with a stir bar and the other media components to an Erlenmeyer flask with a capacity at least twofold greater than the intended volume. Autoclave for 20–30 min, cool for 20–25 min by gently stirring at RT, then pour 25 mL per petri plate. Leave to solidify overnight at RT, then seal in plastic wrap and store at 4°C to prevent microbial growth. 4. Prepare as described in Unit 13.1 of the Current Protocols in Molecular Biology series (41), omitting the desired nucleotide. 5. The BLAST utility offered by the NCBI can be accessed at http://blast.ncbi.nlm.nih.gov/. For more information or instructions on using BLAST, refer to online documentation by clicking the Help tab. 6. Most of the research on optimizing target fragment selection for RNAi is conducted with respect to siRNA. Although not all of the guidelines established for optimal siRNA selection are directly applicable to longer dsRNA trigger fragments, a detailed discussion and comparison of the current rules and methods can be found in Takasaki (42). Information on using bioinformatic algorithms for optimizing longer dsRNA triggers can be found in Horn and Boutros (43). 7. The termini of mRNA molecules are often highly structured and bound by regulatory proteins, which may impede the RISC from binding to the mRNA at those locations (44). It is generally recommended to avoid target sequences within 50–100 bp of the start or stop codon. 8. Depending on the sequence, regions of homology longer than 15–25 bp (the range for a typical siRNA) might lead to offtarget silencing (45). We recommend using the BLAST utility for this purpose (see Note 5).

182

M.L. Skowyra and T.L. Doering

9. We have found regions of 200–300 bp to be most effective (Hong Liu, unpublished data). A longer sequence may increase the frequency of off-target and partial silencing because of the greater number of different siRNA fragments that can be generated from it by Dicer, each of which might trigger RNAi to a varying extent in different clones. 10. A GC-rich region within the mRNA might adopt a stable secondary structure that could block access of the RISC to the targeted sequence (46). 11. Such repeats decrease the specificity of RNAi and may lead to off-target silencing (45). 12. These sites should be avoided because they are used for cloning into the vector (see Fig. 3 for pFrame or Fig. 4 for pIBB103). If a region lacking a particular restriction enzyme recognition site cannot be found, consider either substituting an enzyme that cleaves to leave a compatible cohesive end or use blunt-end ligation to clone the fragment into the RNAi vector of choice. 13. The additional nucleotides improve restriction enzyme cleavage at the ends of the PCR product obtained with these primers (refer to the technical reference section in the product catalog from New England Biolabs for more information). 14. A high-fidelity DNA polymerase such as AccuPrimeTM pfx DNA Polymerase (Invitrogen) should be used to minimize the incorporation of mutations. If the PCR requires a cDNA template, we recommend using a derivative of Taq DNA polymerase, such as AccuPrimeTM Taq DNA Polymerase High Fidelity (Invitrogen). 15. Refer to Unit 2.5A in the Current Protocols in Molecular Biology series for more information (47). 16. A NanodropTM (Thermo Scientific) or similar microvolume spectrophotometric device provides a rapid way to quantitate nucleic acids. Alternatively, dilute the DNA sample 10- to 100fold in water or a suitable buffer, transfer to a spectrophotometer cuvette, and measure the absorbance at 260 nm. By convention, an absorbance value of 1 = 50 ng/ml of dsDNA. 17. Alternatively, the PCR products may first be TA-cloned into a suitable vector such as pCR®2.1-TOPO® (Invitrogen) and subsequently excised with the appropriate restriction enzymes. 18. The exact amount depends on the strain of C. neoformans that will be transformed, but 2 mg are generally sufficient. 19. A linearized plasmid will migrate as a discrete band at a rate proportional to its length, whereas the uncut supercoiled plasmid will generally migrate faster. 20. A pellet may or may not be visible on the inside wall of the tube. Care should be taken not to aspirate this pellet.

11

RNA Interference in Cryptococcus neoformans

183

21. Keeping the cells cold serves two purposes. First, the viability of the transformed cells is improved by preventing overheating due to the rapid dissipation of voltage during electroporation. Second, the pores induced in the membranes by the electrical pulse close more slowly at lower temperatures, allowing more time for DNA entry into the cells (48). 22. It is imperative to use a single colony to preserve the purity of the strain. If a single colony cannot be picked, we recommend to restreak the strain for isolation prior to this step. 23. It is best for the strain to have been restreaked onto fresh media within several days of the transformation and to have been maintained for no longer than 1–2 months. Optimal transformation efficiency can be achieved using a strain that has recently been revived from a glycerol stock. 24. A more dilute or a more saturated culture will take longer to reach the desired density in the subsequent step. Also, the OD600 may be used to determine the culture density if a suitable conversion factor has been empirically established for the specific strain. 25. Typically, this range is reached within 4–6 h. Transformation efficiency may decrease if the culture is allowed to grow for too long. 26. The DTT reduces disulfide bonds in the cell wall, thereby facilitating entry of the plasmid into the cells. 27. The cells should be suspended in as small a volume as possible to minimize the area of contact with the cuvette electrodes and thus increase the time needed for the voltage established across them to be dissipated, allowing the linear plasmid enough time to enter the cells (48). 28. Use as high a resistance as allowed by the apparatus. Samples that give a time constant longer than 20 ms usually result in a good yield of transformants. 29. It helps to dry the agar plates for 1–2 h before plating the transformants to better absorb the liquid cell suspension. 30. This usually takes 2–3 days. 31. Alternatively, use the pattern of your choice in this step, and a replica block as described in Unit 1.3 of the Current Protocols in Molecular Biology series (49) for the next step. 32. The parent strain and an ade2 mutant strain can be patched onto each low-adenine agar plate to better discriminate between the normal and pink colony colors. 33. The extent of lysis can be estimated by spotting 4 mL of the cell suspension on a glass slide and viewing the cells under a microscope. Bead beating can be stopped when ~75% of the cells look broken or empty (i.e., either the cell wall is cracked or the

184

M.L. Skowyra and T.L. Doering

inside of the cell is completely transparent). Alternatively, the use of zirconium silicate beads may give more efficient lysis. 34. To prepare cDNA, first remove contaminating DNA from the total RNA preparation using DNase, preferably with the Turbo DNA-freeTM kit (Ambion). Alternatively, purify the mRNA using poly-T affinity chromatography using the Oligotex® mRNA mini kit (Qiagen). Next, generate cDNA from either the DNase-treated total RNA or purified mRNA using the SuperScriptTM First-Strand Synthesis System for RT-PCR as per the manufacturer’s instructions . 35. Growing the transformants on medium containing galactose induces the expression of the RNAi construct immediately after transformation. Alternatively, RNAi can be initially suppressed by selecting and maintaining the transformants on medium containing glucose (e.g., YPD). RNAi can then be induced by replica plating the clones onto galactose medium. 36. Both the parent strain and a ura5 mutant strain can be patched onto each agar plate to serve as controls for the growth phenotypes on both selective conditions. The parent strain should express a functional URA5 gene and grow only on the uracildeficient medium, whereas the ura5 mutant strain should only grow on the 5-FOA medium. Since the efficacy of RNAi may differ between strains, it may take up to a week for the transformants to start growing on the 5-FOA.

Acknowledgments We acknowledge the significant contributions of former Doering lab members to developing RNAi for C. neoformans: Tricia Cottrell and Hong Liu for the hairpin approach; and Indrani Bose for the convergent promoter approach. We also thank Morgann Reilly for sequence reconstruction of pIBB103; Brian Haynes for optimizing the RNA extraction protocol; and Meng Yang, Deepa Srikanta, and Zhuo Wang for helpful comments on the manuscript. Studies of RNAi by the Doering group have been supported by NIH R01 GM071007 and the Mallinckrodt Foundation. References 1. Nakayashiki H, Kadotani N, Mayama S (2006) Evolution and diversification of RNA silencing proteins in fungi. J Mol Evol 63:127–135 2. Verdel A, Vavasseur A, Le Gorrec M et al (2009) Common themes in siRNA-mediated epigenetic silencing pathways. Int J Dev Biol 53:245–257

3. Malone CD, Hannon GJ (2009) Small RNAs as guardians of the genome. Cell 136: 656–668 4. Jinek M, Doudna JA (2009) A three-dimensional view of the molecular machinery of RNA interference. Nature 457:405–412

11 5. Nakayashiki H, Nguyen QB (2008) RNA interference: roles in fungal biology. Curr Opin Microbiol 11:494–502 6. De Backer MD, Raponi M, Arndt GM (2002) RNA-mediated gene silencing in non-pathogenic and pathogenic fungi. Curr Opin Microbiol 5:323–329 7. Gorlach JM, McDade HC, Perfect JR et al (2002) Antisense repression in Cryptococcus neoformans as a laboratory tool and potential antifungal strategy. Microbiology 148: 213–219 8. Liu H, Cottrell TR, Pierini LM et al (2002) RNA interference in the pathogenic fungus Cryptococcus neoformans. Genetics 160: 463–470 9. Panepinto J, Komperda K, Frases S et al (2009) Sec6-dependent sorting of fungal extracellular exosomes and laccase of Cryptococcus neoformans. Mol Microbiol 71:1165–1176 10. Panepinto J, Liu L, Ramos J et al (2005) The DEAD-box RNA helicase Vad1 regulates multiple virulence-associated genes in Cryptococcus neoformans. J Clin Invest 115:632–641 11. Reese AJ, Doering TL (2003) Cell wall alpha1,3-glucan is required to anchor the Cryptococcus neoformans capsule. Mol Microbiol 50:1401–1409 12. Hu G, Hacham M, Waterman SR et al (2008) PI3K signaling of autophagy is required for starvation tolerance and virulence of Cryptococcus neoformans. J Clin Invest 118:1186–1197 13. Reilly MC, Levery SB, Castle SA et al (2009) A novel xylosylphosphotransferase activity discovered in Cryptococcus neoformans. J Biol Chem 284:36118–36127 14. Goins CL, Gerik KJ, Lodge JK (2006) Improvements to gene deletion in the fungal pathogen Cryptococcus neoformans: absence of Ku proteins increases homologous recombination, and co-transformation of independent DNA molecules allows rapid complementation of deletion phenotypes. Fungal Genet Biol 43:531–544 15. Kim MS, Kim SY, Yoon JK et al (2009) An efficient gene-disruption method in Cryptococcus neoformans by double-joint PCR with NAT-split markers. Biochem Biophys Res Commun 390:983–988 16. Fu J, Hettler E, Wickes BL (2006) Split marker transformation increases homologous integration frequency in Cryptococcus neoformans. Fungal Genet Biol 43:200–212 17. Varma A, Kwon-Chung KJ (1999) Characterization of the glyceraldehyde-3phosphate dehydrogenase gene [correction of

RNA Interference in Cryptococcus neoformans

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

185

glyceraldehyde-3-phosphate gene] and the use of its promoter for heterologous expression in Cryptococcus neoformans, a human pathogen. Gene 232:155–163 Cox GM, Rude TH, Dykstra CC et al (1995) The actin gene from Cryptococcus neoformans: structure and phylogenetic analysis. J Med Vet Mycol 33:261–266 Wickes BL, Edman JC (1995) The Cryptococcus neoformans GAL7 gene and its use as an inducible promoter. Mol Microbiol 16:1099–1109 Ruff JA, Lodge JK, Baker LG (2009) Three galactose inducible promoters for use in C. neoformans var. grubii. Fungal Genet Biol 46:9–16 Ory JJ, Griffith CL, Doering TL (2004) An efficiently regulated promoter system for Cryptococcus neoformans utilizing the CTR4 promoter. Yeast 21:919–926 Zhao W, Fanning ML, Lane T (2005) Efficient RNAi-based gene family knockdown via set cover optimization. Artif Intell Med 35:61–73 Celotto AM, Lee JW, Graveley BR (2005) Exon-specific RNA interference: a tool to determine the functional relevance of proteins encoded by alternatively spliced mRNAs. Methods Mol Biol 309:273–282 Morris JC, Wang Z, Motyka S et al (2004) An RNAi-based genomic library for forward genetics in the African Trypanosome. In: Sohail M (ed) Gene silencing by RNA interference. CRC Press, Boca Raton Falschlehner C, Steinbrink S, Erdmann G et al (2010) High-throughput RNAi screening to dissect cellular pathways: a how-to guide. Biotechnol J 5:368–376 Mohr S, Bakal C, Perrimon N (2010) Genomic screening with RNAi: results and challenges. Annu Rev Biochem 79:37–64 Prudencio M, Lehmann MJ (2009) Illuminating the host - how RNAi screens shed light on host-pathogen interactions. Biotechnol J 4:826–837 Cottrell TR, Doering TL (2003) Silence of the strands: RNA interference in eukaryotic pathogens. Trends Microbiol 11:37–43 Rappleye CA, Engle JT, Goldman WE (2004) RNA interference in Histoplasma capsulatum demonstrates a role for alpha-(1,3)-glucan in virulence. Mol Microbiol 53:153–165 Krajaejun T, Gauthier GM, Rappleye CA et al (2007) Development and application of a green fluorescent protein sentinel system for identification of RNA interference in Blastomyces dermatitidis illuminates the role of septin in morphogenesis and sporulation. Eukaryot Cell 6:1299–1309

186

M.L. Skowyra and T.L. Doering

31. Sudarshan S, Davidson RC, Heitman J et al (1999) Molecular analysis of the Cryptococcus neoformans ADE2 gene, a selectable marker for transformation and gene disruption. Fungal Genet Biol 27:36–48 32. Edman JC, Kwon-Chung KJ (1990) Isolation of the URA5 gene from Cryptococcus neoformans var. neoformans and its use as a selective marker for transformation. Mol Cell Biol 10:4538–4544 33. Bose I, Doering TL (2011) Efficient implementation of RNA interference in the pathogenic yeast Cryptococcus neoformans. J Microbiol Methods 86:156–159 34. Hua J, Meyer JD, Lodge JK (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin Diagn Lab Immunol 7:125–128 35. Edman JC (1992) Isolation of telomerelike sequences from Cryptococcus neoformans and their use in high-efficiency transformation. Mol Cell Biol 12:2777–2783 36. Toffaletti DL, Rude TH, Johnston SA et al (1993) Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J Bacteriol 175:1405–1411 37. Wickes BL, Edman JC (1994) Development of a transformation system for Cryptococcus neoformans. In: Maresca B, Kobayashi GS (eds) Molecular biology of pathogenic fungi. Telos Press, New York 38. Nelson RT, Hua J, Pryor B et al (2001) Identification of virulence mutants of the fungal pathogen Cryptococcus neoformans using signature-tagged mutagenesis. Genetics 157:935–947 39. Brown T, Mackey K, Du T (2004) Analysis of RNA by northern and slot blot hybridization. In: Ausubel FM, Brent R, Kingston RE et al (eds) Current Protocols in Molecular Biology. Greene Publishing and Wiley-Interscience, New York

40. Dorak MT (ed) (2006) Real-time PCR. 1st edn. Taylor & Francis, Oxford 41. Douglass TA (1993) Basic techniques of yeast genetics. In: Ausubel FM, Brent R, Kingston R et al (eds) Current protocols in molecular biology. Greene Publishing and WileyInterscience, New York 42. Takasaki S (2010) Efficient prediction methods for selecting effective siRNA sequences. Comput Biol Med 40:149–158 43. Horn T, Boutros M (2010) E-RNAi: a web application for the multi-species design of RNAi reagents--2010 update. Nucleic Acids Res 38:W332-339 44. Wilkie GS, Dickson KS, Gray NK (2003) Regulation of mRNA translation by 5’- and 3’-UTR-binding factors. Trends Biochem Sci 28:182–188 45. Qiu S, Adema CM, Lane T (2005) A computational study of off-target effects of RNA interference. Nucleic Acids Res 33: 1834–1847 46. Chan CY, Carmack CS, Long DD et al (2009) A structural interpretation of the effect of GC-content on efficiency of RNA interference. BMC Bioinformatics 10 Suppl 1:S33 47. Voytas D (2000) Resolution and recovery of large DNA fragments. In: Ausubel FM, Brent R, Kingston R et al (eds) Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York 48. Potter H (2010) Transfection by electroporation. In: Ausubel FM, Brent R, Kingston R et al (eds) Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York 49. Elbing K, Brent R (2002) Growth on solid media. In: Ausubel FM, Brent R, Kingston R et al (eds) Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York

Chapter 12 Gene Knockdown in Paracoccidioides brasiliensis Using Antisense RNA João F. Menino, Agostinho J. Almeida, and Fernando Rodrigues Abstract Paracoccidioides brasiliensis is a thermal dimorphic fungus which in the host environment exhibits a multinucleated and multibudding yeast form. The cellular and molecular mechanisms underlying these phenotypes remain to be clarified, mostly due to the absence of efficient classical genetic and molecular techniques. Here we describe a method for gene expression knockdown in P. brasiliensis by antisense RNA (aRNA) technology taking advantage of an Agrobacterium tumefaciens-mediated transformation (ATMT) system. Together, these techniques represent a reliable toolbox that can be employed for functional genetic analysis of putative virulence factors and morphogenic regulators, aiming to the identification of new potential drug targets. Key words: Paracoccidioides brasiliensis, Molecular techniques, aRNA technology, Gene knockdown, ATMT

1. Introduction Paracoccidioides brasiliensis is the etiological agent of Paracoccidioidomycosis, one of the most prevalent systemic mycosis in Latin America. As a thermal dimorphic fungus, P. brasiliensis switches from the environmental mycelial/conidial nonpathogenic form at ambient temperatures to the pathogenic multiple budding yeast form when exposed to temperatures similar to those of the mammalian host (1). The absence of effective molecular techniques has significantly hampered studies in P. brasiliensis relevant for understanding the biology of this fungus as well as the mechanisms that underlie its pathogenicity. We herein report an efficient gene expression knockdown protocol for P. brasiliensis by taking advantage of Agrobacterium tumefaciens-mediated transformation (ATMT) for single-copy genetic integration (PbATMT) developed by our group (3, 5). Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_12, © Springer Science+Business Media, LLC 2012

187

188

J.F. Menino et al.

ATMT makes use of a natural transformation process induced by A. tumefaciens, a bacterial plant pathogen that randomly inserts the transfer-DNA (T-DNA) into the plant genome during infection (2). Fungal ATMT presents advantages over other methods (4) as it (1) shows high efficiency and simplicity, (2) avoids timeconsuming steps and specialized equipment, and (3) can be easily applied in Biosafety Level 3 (BSL3) microorganisms. Furthermore, we and others have applied this PbATMT system to modulate gene expression in P. brasiliensis using antisense-RNA (aRNA) technology with high success (5, 13). This has proved to be a proficient genetic system for fungi whose homologous recombination machinery is still poorly described (6), such as P. brasiliensis, as contrary to other allelic replacement strategies, since aRNA “knocksdown” gene expression rather than “knocking-out” an entire gene. PbATMT and aRNA technology merge as important molecular tools to study functional genetics in P. brasiliensis and advancing research in a field that has previously been lacking this type of technology.

2. Materials All solutions must be prepared using ultrapure water and analytical grade reagents and stored at room temperature (unless indicated otherwise). Sterilize all the culture medium by autoclaving for 20 min at 121°C. Dispose of all waste materials according to safety regulations. 2.1. Antisense Plasmid Construction

1. Escherichia coli strain: JM109 competent cells (Promega). 2. E. coli culture medium (1 L) Luria Bertani (LB): 10 g tryptone peptone, 5 g yeast extract, 10 g NaCl. Suspend the reagents in distilled or deionized water. Adjust to pH 7.0 with NaOH. 3. Plasmids: pCR35 plasmid containing the green fluorescent protein (GFP) gene downstream from the Histoplasma capsulatum calcium-binding protein (CBP1) promoter (7); pUR5750 parental vector for the insertion of recombinant transfer DNA (T-DNA) in P. brasiliensis, harboring an E. coli hygromycin B phosphotransferase (HPH) gene driven by the Aspergillus nidulans glyceraldehyde 3-phosphate (GPD) promoter and transcriptional terminator (TRPC) from pAN7-1 (8). 4. LB medium for positive selection of the clones harboring the pCR35 and pUR5750 constructs: To LB (Subheading 2.1, item 2) add 16 g purified agar. Autoclave. When the medium is cooled to ~50°C, add kanamycin to a final concentration of 50 mg/mL. 5. T4 DNA ligase (Fermentas).

12

2.2. Preparation of Ultracompetent A. tumefaciens Cells (9, 10)

Gene Knockdown in P. brasiliensis

189

1. A. tumefaciens strain: LBA1100 (C58C1 with a disarmed octopine-type pTiB6 plasmid). 2. A. tumefaciens culture medium (LC) (1 L) (11): 10 g bactotryptone, 5 g yeast extract, and 8 g NaCl. Adjust the pH to 7.0 with NaOH and autoclave. 3. LC medium supplemented with 0.1% glucose. 4. HEPES 1 mM (pH 7). 5. 10% Glycerol.

2.3. Electroporation of A. tumefaciens (9, 10)

1. SOC medium (1 L): 5 g Tryptone peptone, 20 g yeast extract, 0.5 g NaCl, 0.186 g KCl. Adjust the pH to 6.7–7.0 with NaOH and autoclave. Add 10 mL of prefiltered 1 M MgSO4⋅7H2O solution and 10 mL of prefiltered 1 M MgCl2⋅6H2O solution. 2. A. tumefaciens culture medium plates for positive selection of the clones harboring pUR5750 constructs: to the culture medium (Subheading 2.2, item 2) add 20 g purified agar. Autoclave. When the medium has cooled to ~50°C, add kanamycin to a final concentration of 100 mg/mL. 3. 0.2-cm Gapped electroporation cuvettes (BioRad Gene@Pulser). 4. Neubauer-counting chamber. 5. Electroporation device: BioRad MicroPulser Electroporator (120/220 V).

2.4. A. tumefaciensMediated Transformation of P. brasiliensis (PbATMT) (3)

1. P. brasiliensis strain: ATCC 60855 (see Note 1). 2. P. brasiliensis solid culture medium (1 L): 52 g Brain Heart Infusion supplemented with 1.6% agar (BHI) (Duchefa) and 1% glucose. 3. A. tumefaciens medium for the clones harboring pUR5750 constructs: LC medium (see Subheading 2.2, item 2) containing 100 mg/mL kanamycin, 250 mg/mL spectinomycin, and 20 mg/mL rifampicin (see Notes 2 and 3). 4. Acetosyringone: prepare a stock solution (1,000× concentrated) in DMSO and store at −20°C (this antibiotic is light sensitive). 5. Stock solutions (1 L each) for the preparation of Induction Medium (IM): ●

K-buffer pH 4.8: 1.25 M KH2PO4 and 1.25 M K2HPO4⋅3H2O. Prepare the solutions individually and set the pH with KH2PO4.

●

M-N: 30 g MgSO4⋅7H2O, 15 g of NaCl.

●

Ca stock: 10 g CaCl2⋅2H2O.

●

Fe stock: 100 mg FeSO4⋅7H2O (after sterilization, a precipitate may be visible; dissolve precipitate by warming to 50°C with stirring before adding to IM).

190

J.F. Menino et al. ●

Micro: 100 mg each of Na2MoO4, MnSO4⋅H2O, ZnSO4⋅7H2O, CuSO4⋅5H2O, and H3BO3.

●

MES 1 M: 195.2 g MES Hydrate (Sigma). Set the pH to 5.5 with NaOH. This solution is light sensitive and has to be filter sterilized.

●

Glucose 20%: 200 g C6H12O6.

●

NH4NO3 20%: 200 g NH4NO3.

Make up each solution to 1 L with distilled H2O and autoclave. 6. IM (500 mL) (10): 0.4 mL K-buffer pH 4.8, 20 mL MES 1 M, 10 mL M-N, 0.5 mL Ca stock, 5 mL glucose 20%, 2.5 mL Micro, 5 mL Fe stock, 1.25 mL NH4NO3 20%, 2.5 mL glycerol 100%. For solid medium, add 10 g of Bacto-agar and just 2.5 mL of glucose 20%. 7. Phosphate-buffered saline (PBS) 1×: 8 g NaCl, 0.20 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4. Dissolve in 800 mL of distilled H2O and adjust pH to 7.4 with HCl or NaOH. Make up to 1 L with distilled H2O. 8. Cocultivation membranes: Hybond-N membrane (Amersham Biosciences), sterilized by heating in an air-dry cabinet for 24 h at 121°C. 9. Neubauer-counting chamber. 10. 100 mg/mL Cefotaxime stock solution made in ultrapure sterile water, filter sterilized and stored at −20°C. 11. BHI selective medium: add hygromycin B (Invitrogen) to a final concentration of 50 mg/mL. 2.5. Genomic DNA Extraction of P. brasiliensis

1. Lysis Buffer: 1 mM EDTA, 10 mM Tris–HCl (set the pH to 8 with NaOH), 1% SDS, 100 mM NaCl. 2. JETquick Blood and cell culture DNA spin kit (Genomed). 3. 1:1 Phenol/chloroform solution.

2.6. Evaluation of the Knockdown Efficiency

1. Trizol (Invitrogen). 2. DyNAmo cDNA Synthesis Kit (Finnzymes). 3. DyNAmo SYBR Green (Finnzymes).

3. Methods Perform all steps of this protocol at room temperature unless specified otherwise. 3.1. Antisense Plasmid Construction

1. Grow up E. coli cells harboring plasmids pCR35 and pUR5750 in 4 mL LB media supplemented with kanamycin to a final concentration of 50 mg/mL. Isolate plasmid DNA using a

12

Gene Knockdown in P. brasiliensis

191

Fig. 1. Primers for amplification of several aRNA sequences from the 5¢ UTR and codingsequence regions of the gene of interest (see Note 5 ).

proprietary kit (QIAprep Spin Miniprep Kit, Qiagen) following the kit manufacturer’s instructions. Elute in 30 mL H2O (the concentration should be in the range of 200–300 mg/mL). 2. Design primers for the amplification of several aRNA sequences from the 5¢ UTR and coding-sequence regions of the gene of interest (Fig. 1) (see Note 4). Add an AscI restriction site to the primer binding to the 3¢ end of the sequence and an XhoI restriction site to the primer binding to the 5¢ end of the sequence (see Note 5). 3. Amplify the aRNA sequences using a standard PCR protocol and a proofreading DNA polymerase (see Note 6). 4. Digest pCR35 plasmid and the aRNA PCR amplicons from Subheading 3.1, step 3 separately with AscI and XhoI restriction enzymes, preparing a mix containing 2 mL of 10× FastDigest buffer (Fermentas), 1 mL of each restriction enzyme (Fermentas), ~1 mg of plasmid DNA, or ~0.2 mg of PCR product, and add water up to 20 mL. Incubate at 37°C for 1 h. 5. Clean the product using a column-based DNA purification method (QIAquick PCR purification Kit, Qiagen) following the kit manufacturer’s instructions. 6. Ligate each AscI–XhoI-digested aRNA amplicon individually into the AscIXhoI sites of plasmid pCR35, using T4 DNA ligase (Fermentas). Prepare a mix containing 1 mL of ligase, 2 mL of 10× T4 DNA Ligase buffer, 3:1 PCR product/Plasmid DNA ratio, and water to 20 mL. Incubate 1 h at 22°C. 7. Transform E. coli competent cells (Promega) by heat shock following kit manufacturer’s instructions, using the mix from Subheading 3.1, step 6. Confirm the presence of constructs in transformants by colony-PCR with exogenous primers p1 and p2 (see Note 7). 8. Isolate plasmid DNA from positive E. coli strains and confirm the presence of constructs by diagnostic restrictive endonuclease treatment of purified plasmid using AscI and XhoI (see Subheading 3.1, step 4). 9. Amplify the DNA fragment from the plasmid harboring the CBP1 promoter, each aRNA sequence, and the terminator using a standard PCR protocol, a proofreading DNA

192

J.F. Menino et al.

Fig. 2. Transfer-DNA (T-DNA) constructs for aRNA silencing of our gene of interest in P. brasiliensis via Agrobacterium tumefaciens-mediated transformation. T-DNA harboring the hygromycin B phosphotransferase (HPH ) gene driven by the Aspergillus n. glyceraldehyde 3-phosphate (GPDA ) promoter and transcriptional terminator (TRPC ) with aRNA oligonucleotide under the control of the calcium-binding protein (CBP1 ) promoter from Histoplasma capsulatum. The construct is carried out in the pUR5750 vector.

polymerase, and exogenous primers p1 and p2 carrying KpnI restriction sites (see Notes 6 and 7). 10. Digest the DNA fragments with KpnI restriction enzyme (see Subheading 3.1, step 4) and clean the product using a columnbased DNA purification method (see Subheading 3.1, step 5). 11. Digest plasmid pUR5750 with KpnI (see Subheading 3.1, step 4). 12. Dephosphorylate with shrimp alkaline phosphatase (SAPFermentas) to prevent self-ligation. Prepare a mix containing 2 mL of 10× Reaction Buffer (Fermentas), 1 mL (1 U) of SAP enzyme (Fermentas), ~1 mg of plasmid DNA, and add nuclease-free water up to 20 mL. Incubate at 37°C for 30 min. Stop the reaction by heating the mix for 15 min at 65°C. 13. Clone each construct individually into KpnI-digested plasmid (Fig. 2) with T4 DNA ligase (see Subheading 3.1, step 5). 14. Transform E. coli competent cells by heat shock following kit manufacturer’s instructions, using the mix from Subheading 3.1, step 13. Confirm the presence of the constructs in transformants by colony-PCR using specific exogenous primers p3 and p4 (see Note 8) and by diagnostic restrictive endonuclease treatment of purified plasmid (see Subheading 3.1, step 4). 15. Isolate the pUR5750 vector harboring the T-DNA constructs for aRNA knockdown using a column-based plasmid purification method (see Subheading 3.1, step 1) (see Note 9). 3.2. Preparation of Ultracompetent A. tumefaciens Cells (12)

1. Inoculate an LC plate (without antibiotics) with A. tumefaciens and incubate for 3 days at 29°C. 2. Inoculate bacteria into 2 mL of LC medium and incubate at 29°C for 6 h with agitation (180 rpm). 3. Inoculate 100 mL of LC medium supplemented with 0.1% glucose with 100 mL of the preculture. Grow the cells overnight at 29°C with shaking at 220 rpm to an OD660 of 1.0–1.5. 4. Chill the culture on ice for 15 min and harvest the cells by centrifugation in a cold rotor at 4,000 × g for 20 min.

12

Gene Knockdown in P. brasiliensis

193

5. Resuspend the pellet in 10 mL of 1 mM HEPES (pH 7) and centrifuge as above. Repeat this washing step three times. 6. Wash the pellet in 10 mL of 10% glycerol solution. 7. Resuspend the pellet in 10% glycerol solution to a final volume of 500–750 mL. The cell concentration is optimally around 1–5 × 1011 cells/mL. 8. Make 40 mL aliquots of the bacterial suspension in sterile 1.5 mL eppendorfs, freeze immediately in liquid nitrogen, and store at −80°C. The cells can be retained for electroporation for at least a year under these conditions without significant loss of transformation efficiency (12). 3.3. Electroporation of A. tumefaciens (12)

1. Gently thaw one aliquot of cells per aRNA product on ice (10–15 min). 2. Chill the electroporation cuvettes on ice. 3. Add 1–5 mL of plasmid DNA (pUR5750) harboring a single T-DNA construct for aRNA (10 ng) to 40 mL of cell suspension and gently mix well. 4. Transfer the mixture to a prechilled electroporation cuvette. Ensure that the suspension is in contact with both electrodes of the cuvette. 5. Apply an electric pulse at 2.5 kV, 25 mF, and 200 W. This should result in a pulse of 12.5 kV/cm with a time constant of approx. 4.7 ms. 6. Immediately add 1 mL of SOC medium, and gently but quickly resuspend the cells with a sterile Pasteur pipette. 7. Transfer the cell suspension to a 1.5-mL Eppendorf sterile tube and incubate at 29°C for 1–1.5 h with vigorous shaking (180 rpm). 8. Plate 100 mL aliquots of dilutions on A. tumefaciens selection medium (see Subheading 2.3). 9. Incubate for 3 days at 29°C.

3.4. A. tumefaciensMediated Transformation of P. brasiliensis (PbATMT) (3)

1. Grow A. tumefaciens LBA1100 for 12–18 h carrying the desired knockdown vector or carrying empty vector in liquid LC selection medium with antibiotics (see Subheading 2.4, step 3) in a water bath, at 28°C with shaker (180 rpm) (for maintenance, use identical solid medium at 28–30°C). Be sure that the temperature is stable and exactly at 28°C. 2. Spin down 1 mL of the cell culture and wash it with IM containing acetosyringone and antibiotics (see Subheading 2.4, steps 4–6). 3. Dilute bacterial cells in IM with antibiotics and acetosyringone (as above) to an OD660 nm of 0.30, and reincubate at 28°C until the OD660 nm reaches 0.80.

194

J.F. Menino et al.

4. Grow P. brasiliensis yeast cells in 200 mL of BHI medium supplemented with 1% glucose to the exponential growth phase (48–60 h, 220 rpm, 36°C) in a 500 mL Erlenmeyer (see Note 10). 5. Centrifuge P. brasiliensis yeast cell samples (4,500 × g for 15 min), wash with IM without antibiotics and acetosyringone. Count cells using a Neubauer-counting chamber and adjust to a final concentration of 1 × 108 cells/mL (see Note 11). 6. Place a sterile Hybond-N membrane on cocultivation solid IM plates containing antibiotics and acetosyringone (see Subheading 2.4, step 6). 7. Mix A. tumefaciens and P. brasiliensis cells at ratios of 10:1, 1:1, 1:5, and 1:10 bacteria to yeast in a final volume of ~500 mL in sterile eppendorf tubes. Inoculate onto a sterile Hybond-N membrane (see Subheading 3.4, step 6). 8. Air dry in a safety cabinet with the lights off (see Note 3) for ~30 min prior to incubation at 25°C for 3 days. This is a very important step in the transformation process (see Note 12) (Fig. 3). 9. Following cocultivation, transfer the membranes, using a sterile set of tweezers, to 15-mL falcon tubes containing 2 mL of nonselective BHI liquid medium containing 200 mg/mL cefotaxime, and dislodge cells using a sterile loop and vortexing for 1 min. After vortexing, leave the caps of the falcon tubes slightly loose to permit aeration. Allow the cells to recover by incubating the suspension for 48 h at 36°C with shaking at 200 rpm. Spin down the culture (4 min at 2,400 × g, room temperature), remove the supernatant and plate the cells on BHI selective medium containing 50 mg/mL hygromycin B (see Note 13). 10. Incubate selection plates at 36°C for 15–20 days and monitor for colony formation.

Fig. 3. Representation of the filter containing plates for cocultivation. Two filters are applied side-by-side per plates for the different chosen ratios (a). The coculture is applied in each membrane, avoiding the leakage out of the membrane (b). Leave the coculture dry for around 30 min (c) (see Note 12).

12

3.5. Selection of Positive Transformants

Gene Knockdown in P. brasiliensis

195

1. Mitotic stability assessment: randomly select HygR P. brasiliensis colonies and restreak onto selective BHI solid medium at least three times. Finally, restreak the transformants onto plates with nonselective medium containing 50 mg/mL hygromycin B a further three times to confirm mitotic stability. After this step, maintain the clones in selective BHI solid medium, restreaking all clones every 3–5 days until confirmation of transformation. 2. To confirm transformation by T-DNA, randomly select hygromycin-resistant (HygR) transformants. 3. Grow selected transformants cells for 72 h in 100 mL BHI selective medium containing 50 mg/mL hygromycin B. 4. Extract genomic DNA mixing in an eppendorf 200 mL of each culture and 200 mL of Lysis Buffer. Vortex the samples thoroughly, add 300mL of the 1:1 phenol/chloroform mix (step 2.5.3) and vortex the samples for 1 min. Heat the tubes at 65°C for 45 min, and freeze them immediately at −80°C for 1 h (minimum). Centrifuge the tubes for 15 min, 1,235 ´ g, at room temperature. Remove the supernatant for genomic DNA isolation using an appropriate kit (JETquick Blood and cell culture DNA spin Kit, Genomed) following the kit manufacturer’s instructions. 5. Test for the presence of T-DNA using a standard PCR protocol for amplification of the HPH gene using total DNA as template (see Note 14) (Fig. 4).

3.6. Evaluation of the Knockdown Efficiency

1. Extract total RNA from exponentially growing P. brasiliensis yeast cultures (72 h). Spin down 15 mL of the cultures (4 min at 2,400 × g, room temperature) and remove supernatant. Add 1 mL of Trizol (Invitrogen), vortex thoroughly, and proceed with a heat shock treatment (20 min at 65°C followed by 60 min at −80°C) for cellular disruption (see Note 15). The following steps are performed according to Trizol manufacturer’s instructions. 2. Perform cDNA synthesis using 0.5–1 mg of template, according to cDNA synthesis kit manufacturer’s instructions (DyNAmo cDNA Synthesis Kit, Finnzymes). 3. Execute Quantitative Real-Time PCR (qPCR) using the fluorescent molecule SYBRGreen (DyNAmo SYBR Green, Finnzymes), specific primers for the gene of interest and 1 mL of cDNA. Quantification is performed by comparing the threshold cycle (Ct) values for the gene of interest with TUB2

Fig. 4. Transformation confirmatory primers for the HPH gene (see Note 14).

196

J.F. Menino et al.

(constitutively expressed housekeeping gene) (4) (see Notes 16 and 17). Target gene expression level in the knockdown strain is then compared to its expression in the P. brasiliensis strain carrying the empty vector.

4. Notes 1. This system has been successfully employed using P. brasiliensis strains ATCC 60855, Pb18, and PbGarcia. 2. Prepare kanamycin and spectinomycin in ultrapure water, filter sterilized, and store at −20°C. 3. Prepare rifampicin in methanol and store at −20°C or at 4°C for short periods of time to avoid precipitation. Note that this antibiotic is light sensitive. 4. Ensure that the chosen sequences do not contain AscI, XhoI, or KpnI restriction sites. We tested several conditions (different sizes and aRNA location) and no relation was observed between these and efficiency of gene downregulation (5). 5. Reverse primer with AscI restriction site sequence shown in bold: 5¢-gcgcggcgcgccnnnnnnnnnnnnnnnnnnnn-3¢; Forward primer with XhoI restriction site sequence shown in bold: 5¢-gcgcctcgagnnnnnnnnnnnnnnnnnnnn-3¢. 6. Proofreading DNA polymerases often need a lower elongation temperature, e.g., 68°C instead of 72°C. 7. Primers for amplification of the CBP1 promoter, each aRNA sequence and terminator, from plasmid pCR35 (with KpnI restriction sites shown in bold): p1 (5¢-ggggtaccccgcggatcacggtatcgatga3¢) and p2 (5¢-ggggtaccccggtacctaggtggatccaat-3¢). 8. pUR5750 KpnI site external primers: p3 (5¢-gatcggtgcgggcctcttcg-3¢) and p4 (5¢-catgacggccatcatgccaa-3¢). 9. Use a column-based method for plasmid isolation due to the large size and low copy number of the pUR5750 vector. Other methods have been tested (e.g., phenol:chloroform:isopropanol (25:24:1) extraction) and found to have a reduced yield compared to the column-based method. 10. It is essential that yeast inocula are derived from cells that have been restreaked on solid-medium every 3–4 days. 11. Each mother cell represents 1 cell; 1 × 108 cells/mL correspond to approximately a 3–4 mL pellet obtained from spinning down a 50 mL culture in a 50-mL falcon tube. 12. We strongly recommend testing several drying times of the cocultures on hybond-N membranes (15–45 min) to achieve the best transformation efficiency.

12

Gene Knockdown in P. brasiliensis

197

13. Hygromycin concentration might depend on the P. brasiliensis strain or even the type of hygromycin B used. 14. HPH confirmation primers: p5 (5¢-gaagtactcgccgatagtgg-3¢) and p6 (5¢-gtcgcggtgagttcaggcat-3¢). 15. Other methods can be used (e.g., phenol:chloroform:isopropa nol (25:24:1) extraction) but higher efficiency is achieved using Trizol. 16. TUB2 primers for RT-PCR: 5¢-agccttgcgtcggaacatag-3¢ and 5¢-acctccatccaggaactcttca-3¢ (5). 17. Knockdown efficiency for the target gene is evaluated by measuring the reduction in gene expression in the knockdown strain in comparison to the wild-type strain. Other effects of gene knockdown might be assessed by analyzing phenotypical and physiological effects or by analyzing gene expression of genes regulated by the knockdown target gene.

Acknowledgments We thank Dr Mark Sturme for critical reading of this chapter and valuable suggestions. This work was supported by a research grant from Fundação para a Ciência e a Tecnologia, Portugal (Ref. PTDC/BIA-MIC/108309/2008). João Menino was financially supported by a fellowship from Fundação para a Ciência e a Tecnologia, Portugal (Ref. SFRH/BD/33446/2008). References 1. Garcia, A.M., et al., Gene expression analysis of Paracoccidioides brasiliensis transition from conidium to yeast cell. Med Mycol. 48(1): p. 147–54. 2. Hoekema, A., et al., Delivery of T-DNA from the Agrobacterium tumefaciens chromosome into plant cells. EMBO J, 1984. 3(11): p. 2485–90. 3. Almeida, A.J., et al., Towards a molecular genetic system for the pathogenic fungus Paracoccidioides brasiliensis. Fungal Genet Biol, 2007. 44(12): p. 1387–98. 4. Michielse, C.B., et al., Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr Genet, 2005. 48(1): p. 1–17. 5. Almeida, A.J., et al., Cdc42p controls yeast-cell shape and virulence of Paracoccidioides brasiliensis. Fungal Genet Biol, 2009. 46(12): p. 919–26. 6. da Silva Ferreira, M.E., et al., The akuB(KU80) mutant deficient for nonhomologous end joining

7.

8.

9.

10.

is a powerful tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryot Cell, 2006. 5(1): p. 207–11. Rappleye, C.A., J.T. Engle, and W.E. Goldman, RNA interference in Histoplasma capsulatum demonstrates a role for alpha-(1,3)-glucan in virulence. Mol Microbiol, 2004. 53(1): p. 153–65. de Groot, M.J., et al., Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol, 1998. 16(9): p. 839–42. Beijersbergen, A., et al., Conjugative transfer by the virulence system of Agrobacterium tumefaciens. Science, 1992. 256(5061): p. 1324–7. Bundock, P., et al., Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J, 1995. 14(13): p. 3206–14.

198

J.F. Menino et al.

11. Molnár, A., et al., miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii. Nature, 2007. 447(7148): p. 1126–1129. 12. den Dulk-Ras, A. and P.J. Hooykaas, Electroporation of Agrobacterium tumefa-

ciens. Methods Mol Biol, 1995. 55: p. 63–72. 13. Hernandez, O., et al., A 32-KDa hydrolase plays an important role in Paracoccidioides brasiliensis adherence to host cells and influences pathogenicity. Infect Immun.

Part III Modulation of Gene Expression: Regulatable Promoters

Chapter 13 Tetracycline-Inducible Gene Expression in Candida albicans Michael Weyler and Joachim Morschhäuser Abstract In addition to gene inactivation, the manipulation of gene expression is another highly useful tool for the analysis of gene function. Several regulatable promoters are available that enable researchers to shut off or turn on the expression of a target gene in Candida albicans, usually by growing the cells in inducing or repressing media. In this chapter, we describe a tetracycline-inducible gene expression system (Tet-On) that allows forced expression of endogenous or heterologous genes in C. albicans by the addition of the small-molecule inducer doxycycline in a growth medium-independent manner. The system is based on a cassette in which a gene of interest can be placed under the control of a Tet-inducible promoter in a single cloning step and integrated into the C. albicans genome with the help of a dominant selection marker. As the cassette contains all necessary components for Tet-inducible gene expression, it can be used to study the effect of forced gene expression on the phenotype of C. albicans cells in any strain without a requirement of additional genetic manipulations. Key words: Candida albicans, Dominant selection marker, Doxycycline, Gene regulation, Inducible gene expression, Tetracycline

1. Introduction A straightforward approach for elucidating the function of a gene in an organism under study is the construction of mutants in which the gene is inactivated and the effect on the phenotype is observed. Although Candida albicans is a diploid organism without a known haploid phase, efficient methods for the generation of homozygous null mutants have been developed and are widely used for the genetic analysis of this fungal pathogen (1) (see Part 1 “Gene disruption” in this volume). However, a phenotypic effect caused by the absence of a gene can only be expected under conditions in which the gene is expressed, and the role of a gene in a biological process may also be obscured by the presence of other genes with overlapping functions. Conversely, forced expression of a gene

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_13, © Springer Science+Business Media, LLC 2012

201

202

M. Weyler and J. Morschhäuser

under conditions in which it is not normally active, or overexpression of a gene to unusually high levels, may provoke phenotypes that are not exhibited by wild-type cells under the same conditions and provide clues about the role of the gene product. Inducible gene expression is, therefore, a valuable complementary tool to gene inactivation for the functional analysis of genes. In addition, by controlling the expression of functionally characterized endogenous or heterologous genes, researchers can also manipulate the behavior of an organism in a desired way. Experimental manipulation of gene expression is facilitated by the availability of regulatable promoters that can be used to turn on or shut off the expression of a target gene at will. Several regulatable promoters are commonly used to control gene expression in C. albicans, for example the PKC1, MAL2, or MET3 promoters (2–4) (see also other chapters of the Sect. “Regulatable promoters” in this volume). These promoters are active in certain growth media and repressed in others, so that gene expression can be induced or downregulated by incubating the cells in the appropriate medium. Yet, it is often desirable to control gene expression in a growth medium-independent fashion by the simple addition of an inducing or repressing substance. Tetracycline, or its derivative doxycycline, is such a small molecule that is used to regulate gene expression in a broad variety of organisms from bacteria to mammals. The Tet system is based on the tetracycline repressor protein TetR from Escherichia coli, which binds to the tet operator (tetO) in the promoter of the tetracycline resistance operon and represses the expression of the tet genes in the absence of tetracycline. Tetracycline binds with high affinity to TetR and promotes dissociation of the repressor from its target sequence, resulting in the expression of the tetracycline resistance genes in the presence of the antibiotic (5). The bacterial Tet system has been modified for use in eukaryotic cells by fusing TetR to a transcriptional activation domain, thereby turning it into a tetracycline-controlled transactivator (tTA) (6). This chimeric transcriptional activator binds to the Tet promoter and forces the expression of any gene that is placed under its control. The addition of doxycycline to the cells results in dissociation of the activator from the promoter and turns off gene expression. The Tet-Off system has been used in C. albicans to shut down the expression of essential genes, which cannot be deleted from the genome, or to induce filamentous growth by depleting the repressor Nrg1 from the cells (7–9). In contrast to the Tet-Off system, which is used to turn off an otherwise constitutively expressed gene by adding doxycycline to the cells, the complementary Tet-On system allows the induction

13

The Tet-On System in Candida albicans

203

of gene expression by the addition of doxycycline. It is based on a mutated Tet repressor whose dependence on tetracycline is reversed, i.e., the reverse Tet repressor (rTetR) binds to tetO only in the presence of tetracycline, but not in its absence (10). In our laboratory, we have established such a Tet-On system for use in C. albicans (11). To this aim, the rtetR gene was fused to the transcription activation domain of the S. cerevisiae GAL4 gene (GAL4AD) and placed under the control of the C. albicans ADH1 promoter. The CTG codons in rtetR and GAL4AD, which would be mistranslated as serine instead of leucine in C. albicans, were changed to the leucine-specific TTG codon to allow functional expression of the reverse tetracycline-controlled transactivator (rtTA) in C. albicans. The Candida-adapted cartTA gene was incorporated into a cassette that contains a tetracycline-controlled promoter, which was obtained by replacing the upstream activating sequences of the OP4 promoter with seven copies of tetO. In addition, the Tet-inducible gene expression cassette contains the dominant caSAT1 selection marker, which confers resistance to the antibiotic nourseothricin and allows the selection of transformants of prototrophic C. albicans wild-type strains (Fig. 1). In the cassette contained in plasmid pNIM1 (GenBank accession no. DQ090840), the caGFP reporter gene is placed under the control of the Tet promoter. The caGFP gene can be excised from pNIM1 using the unique SalI and BglII restriction sites and replaced by a PCR-amplified target gene (your favorite gene, YFG). The whole cassette can be excised from the vector backbone by digestion with SacII on the left side and ApaI or KpnI on the right side and integrated into the ADH1 locus of the desired host strain. The rtTA transactivator is then constitutively expressed from the ADH1 promoter, but does not activate gene expression in the absence of doxycycline, and the engineered strains behave like the wild-type parental strain. Upon addition of doxycycline to the cells, rtTA binds to the Tet promoter and induces expression of the target gene. The GFP expression cassette from pNIM1 can be used to generate otherwise identical control strains and to monitor Tet-induced gene expression in the specific strain background, cell type, and experimental conditions applied by the investigator. The Tet-On system has been used for different purposes in C. albicans, for example for the inducible expression of toxic genes, inhibition of hyphal growth by induced expression of the NRG1 repressor, inducible gene deletion by FLP-mediated site-specific recombination, expression of specific secreted aspartic protease isoenzymes, and for the identificaton of regulators of white-opaque switching, filamentation, and biofilm formation (11–17).

204

M. Weyler and J. Morschhäuser Tet-inducible gene expression cassette in plasmid pNIM1 SacII

BglII

PADH1

cartTA

TACT1

caSAT1

PCR-amplified target gene (YFG) BglII

TACT1

SalI

caGFP

ApaI KpnI

Ptet

3‘ADH1

Digest with SalI and BglII to remove caGFP

SalI YFG caGFP

Digest with SalI and BglII Ligate SacII

BglII

PADH1

cartTA

TACT1

caSAT1

TACT1

SalI

YFG

ApaI KpnI

Ptet

3‘ADH1

ADH1

Parental strain

ADH1

Excise cassette from vector by digestion with SacII and ApaI (or KpnI) Transformation of C.albicans Integration into genomic ADH1 locus by homologous recombination

PADH1

cartTA

Transformant

TACT1

caSAT1

TACT1

YFG

Ptet

3‘ADH1

ADH1

Fig. 1. Tetracycline-inducible gene expression in C. albicans. A schematic of the Tet-inducible gene expression cassette contained in plasmid pNIM1 (vector is pBluescript II KS) is shown at the top. The Candida-adapted cartTA gene, encoding the reverse tetracycline-dependent transactivator, is placed under control of the ADH1 promoter (PADH1) and the caGFP reporter gene is regulated by the tetracycline-dependent promoter (Ptet), which consists of the basal promoter of the OP4 gene and seven copies of the tet operator. The ACT1 transcription termination sequences (TACT1) serve for proper termination of cartTA and caGFP transcription. The dominant caSAT1 selection marker, which confers nourseothricin resistance upon C. albicans transformants, contains its own promoter and termination sequences (not indicated). The caGFP gene can be replaced by a gene of interest (your favorite gene, YFG ) using the unique Sal I and Bgl II restrictions sites. The whole cassette is excised from the vector backbone by digestion with SacII and ApaI (or KpnI) and integrated into the ADH1 locus of the desired host strain by homologous recombination with the flanking ADH1 sequences. The reverse tetracyclinedependent transactivator is then constitutively expressed from the ADH1 promoter and, upon addition of doxycycline, binds to the Tet promoter and drives expression of the target gene.

13

The Tet-On System in Candida albicans

205

2. Materials 1. Plasmid pNIM1 (ca. 10 mg of DNA from a miniprep in 50 mL H2O). 2. Appropriate restriction enzymes and buffers from supplier (SalI, BglII, SacII, and ApaI). 3. Double-distilled H2O. 4. Source of DNA for amplification of the gene of interest (e.g., genomic DNA of strain SC5314). 5. Appropriate primers for amplification of the gene of interest with integrated flanking SalI (or XhoI) and BglII (or BamHI or BclI) restriction sites (see Note 1). 6. DNA polymerase with proof-reading capability (see Note 2). 7. 50× TAE buffer (1 L): 242 g Tris–HCl, 57.1 mL of acetic acid, 100 mL of 0.5 M EDTA (ethylene diamine tetraacetic acid), pH 8.0; add H2O to 1 L. 8. DNA clean-up kit (see Note 3). 9. DNA ligase. 10. Competent E. coli cells (e.g., DH5a). 11. 100 mg/mL stock solution of ampicillin. 12. LB medium (1 L): 10 g of peptone, 5 g of yeast extract, 5 g of NaCl; add H2O to 1 L. 13. LB agar plates with 100 mg/mL ampicillin. 14. Reagents for C. albicans transformation (see Chap. 1). 15. 200 mg/mL nourseothricin plates: dissolve 20 g peptone, 10 g yeast extract, and 20 g agar in 900 mL double-distilled H2O. After autoclaving, cool to approx. 60°C and add 100 mL of a sterile 20% glucose solution. Add 2 mL of a 100 mg/mL nourseothricin stock solution (clonNAT, Werner Bioagents, Jena, Germany). The nourseothricin stock solution is stored at –20°C. The nourseothricin must be thoroughly dissolved by vortexing before use. 16. 50 mg/mL doxycycline stock solution (store in aliquots at −20°C protected from light).

3. Methods 3.1. Construction of the Tet-Inducible Gene Expression Cassette

1. Amplify your gene of interest by PCR with primers that introduce a SalI site in front of the start codon and a BglII site behind the stop codon using a proofreading DNA polymerase

206

M. Weyler and J. Morschhäuser

(e.g., Phusion). If the gene of interest possesses internal SalI or BglII sites, the compatible enzymes XhoI (for SalI) and BamHI or BclI (for BglII) can be used instead (see Note 4). 2. Purify the PCR product (from a 50 mL PCR reaction) using a proprietary DNA clean-up kit and following the manufacturer’s instructions. Elute in 41 mL double-distilled H2O. 3. Add 5 mL restriction digestion buffer, 2 mL SalI (20 U), and 2 mL BglII (20 U). Mix and incubate the reaction for 3 h at 37°C. 4. Digest 3 mg of plasmid pNIM1 in a 50 mL reaction volume with 20 U SalI and 20 U BglII. 5. Separate the DNA fragments by agarose gel electrophoresis on a 1% agarose gel overnight in 1× TAE buffer at 40 V. After ethidium bromide staining, excise the desired fragments using a sterile scalpel and purify them using a gel extraction kit. Dissolve each of the DNA fragments in 20 mL double-distilled H2O. 6. Set up a ligation reaction in a 20 mL volume using 1 mL of the vector, 5 mL of the target gene, 11 mL double-distilled H2O, 2 mL 10× ligation buffer, 1 mL DNA ligase. Incubate overnight at 16°C. 7. Transform competent E. coli cells with the ligation mixture. 8. Plate onto LB plates containing 100 mg/mL ampicillin to select for positive transformants. 9. Check the plasmid construct by digestion with SalI and BglII and agarose gel electrophoresis. 10. Confirm by sequencing that no undesired mutations were introduced during the PCR. 3.2. Construction of Tet-Inducible C. albicans Strains

1. Excise the Tet-inducible gene expression cassette from the recombinant plasmid by digesting 5 mg plasmid DNA for 3 h at 37°C with 15 U SacII and 15 U ApaI (or KpnI) in a total volume of 50 mL (see Note 5). Excise the control cassette with the GFP gene from pNIM1 in the same way and use it to perform all the following steps as with the expression cassette containing the target gene. 2. Separate the DNA fragments by agarose gel electrophoresis on a 1% agarose gel overnight in 1× TAE buffer at 40 V. After ethidium bromide staining, excise the fragment containing the expression cassette and purify it using a gel extraction kit. Dissolve the resulting DNA in 6 mL double-distilled H2O. 3. Assess the quality and quantity of the eluted fragment by analyzing 1 mL of the sample on an agarose minigel together with a known amount of a size marker. The remaining 5 mL will be used for electroporation and should contain at least 1 mg of DNA for a successful transformation.

13

The Tet-On System in Candida albicans

207

4. Transform the desired C. albicans host strain by electroporation following the method described in Chap. 1 in this volume and using the DNA fragment containing the gene expression cassette. 5. Select for nourseothricin-resistant transformants on YPD agar plates containing 200 mg/mL nourseothricin (see Chap. 1). 6. Verify the correct insertion of the cassette into the ADH1 locus by Southern hybridization with the ADH1 flanking sequences (see Note 6). Retain at least two independent transformants to confirm the reproducibility of phenotypes caused by the induced expression of your target gene (see Note 7). 3.3. DoxycyclineInduced Gene Expression

1. Prepare overnight cultures of your strain of interest and a control strain, e.g., the parental strain or (better) the parental strain transformed with the Tet-inducible caGFP expression cassette from pNIM1. 2. Use these precultures to inoculate your experimental cultures in the desired growth medium supplemented with 50 mg/mL doxycycline (see Note 8). As a control, inoculate medium without doxycycline. Strains can also be plated on solid media in the presence and absence of doxycycline or grown under any other condition in which you want to investigate the effect of forced expression of the gene under study. 3. After a suitable time of incubation, liquid cultures or colonies on agar plates (or cells from any other test condition) can be analyzed for a gain-of-function phenotype by comparing them under inducing and noninducing conditions and by comparing the strain of interest with the control strain under inducing conditions (see Notes 9 and 10).

4. Notes 1. We use the following tags in the primers for amplification of our target genes: 5¢-ATATGTCGACAATG…-3¢ (SalI site underlined, start codon in bold) for the forward primer and 5¢-ATATAGATCTA…-3¢ (BglII site underlined, reverse sequence of a TAG stop codon in bold) for the reverse primer. Alternative restriction sites or stop codons can be incorporated in an analogous fashion. 2. We use Phusion polymerase kit (Finnzymes). 3. We use Nucleo Spin Extract II (Macherey-Nagel). 4. If a gene of interest also contains the alternative restriction site (e.g., both a SalI and an XhoI site), one possibility to clone it is via a partial digestion (in this example a partial digestion with

208

M. Weyler and J. Morschhäuser

SalI after complete digestion with BglII), followed by gel purification of the desired full-length fragment. Alternatively, a third unique internal restriction site can be used to clone the gene in two parts. For example, if a unique KpnI site is present before the internal SalI site, the PCR product is digested once with SalI and KpnI to obtain the N-terminal part and once with KpnI and BglII to obtain the C-terminal part of the gene. The two desired fragments are gel-purified and cloned together into the SalI/BglII-digested pNIM1. 5. If the cloned gene contains a SacII site or both an ApaI and a KpnI site, the complete cassette must be excised from the vector backbone by partial digestion. Use a higher amount of plasmid DNA for the partial digestion to obtain sufficient material for a successful transformation of C. albicans. In our hands this worked well in all cases in which it was necessary. 6. We use the following primers to amplify part of the ADH1 flanking sequences contained in pNIM1 for use as probes in Southern hybridizations: 5¢-TGATAGAGACCCAATGCAAA GCC-3¢ and 5¢-GGCACGAGACGGAAACTCTTTAGG-3¢ (421 bp from the ADH1 upstream region); 5¢-AAGGTGCTG AACCAAACTGTGGTGA-3¢ and 5¢-GACAATCTTGATT GGGCATTTGATC-3¢ (647 bp from the ADH1 coding region). In strain SC5314, both probes hybridize to a 3.3 kb SpeI wild-type fragment and to a new 8.0 kb SpeI fragment after integration of the cassette from pNIM1. The sizes of hybridizing fragments expected after integration of the Tet-On cassette containing other genes instead of GFP can be calculated from their sequence. 7. Although the ADH1 promoter is considered to be a relatively strong, constitutively active promoter, its activity nevertheless varies in different media and in different strains and cell types, resulting in variable expression levels of the rtTA transactivator. For example, the ADH1 promoter is much less active in opaque cells than in white cells of strain WO-1 and it is more active in white cells of strain WO-1 than in yeast cells of strain SC5314, which affects the efficiency of Tet-inducible gene expression (11). We also observed a stronger induction in rich YPD medium than in minimal medium. If ADH1 expression levels are too low in your strain background and experimental conditions, integration at a different site should be considered. For example, we replaced the ADH1 flanking sequences with those of the opaque-specific OP4 gene for Tet-inducible gene expression in opaque cells (11). Using the caGFP expression cassette from pNIM1 as a control allows you to monitor the efficiency of doxycycline-induced gene expression in your experimental setup, e.g., by fluorescence microscopy or FACS analysis.

13

The Tet-On System in Candida albicans

209

8. We use 50 mg/mL doxycycline as the standard concentration for Tet-induced gene expression. Higher concentrations of doxycycline may increase gene expression levels, and some researchers have applied doxycycline at a concentration of 200 mg/mL when using the Tet-On system to obtain a stronger effect (12, 16). However, depending on the growth conditions, doxycycline can affect the phenotype of the cells even at 50 mg/mL (11, 17). It is, therefore, prudent to test which doxycycline concentration is optimal to produce a phenotype in the test strain while not, or minimally, affecting the behavior of the control strain. 9. The Tet promoter is not uniformly induced by doxycycline in a culture of C. albicans cells. Therefore, a phenotype may not be observed in all cells of a population at a given time point. Depending on the target gene, the strain background, and the experimental conditions, a sufficient level of gene expression may be obtained only after prolonged incubation or may not be achieved at all in some cells. 10. In addition, we strongly recommend the analysis of at least two independent transformants to ensure that an observed phenotype is caused by the forced expression of the target gene and not by an unspecific genomic alteration, the effect of which may only become evident in the presence of doxycycline.

Acknowledgment Work in our laboratory is supported by the Deutsche Forschungsgemeinschaft (DFG). References 1. Noble, S.M., Johnson, A.D. (2007) Genetics of Candida albicans, a diploid human fungal pathogen. Annu Rev Genet 41, 193–211. 2. Backen, A.C., Broadbent, I.D., Fetherston, R.W., Rosamond, J.D., Schnell, N.F., Stark, M.J. (2000) Evaluation of the CaMAL2 promoter for regulated expression of genes in Candida albicans. Yeast 16, 1121–1129. 3. Care, R.S., Trevethick, J., Binley, K.M., Sudbery, P.E. (1999) The MET3 promoter: a new tool for Candida albicans molecular genetics. Mol Microbiol 34, 792–798. 4. Leuker, C.E., Sonneborn, A., Delbrück, S., Ernst, J.F. (1997) Sequence and promoter regulation of the PCK1 gene encoding phosphoenolpyruvate carboxykinase of the fungal pathogen Candida albicans. Gene 192, 235–240.

5. Hillen, W., Berens, C. (1994) Mechanisms underlying expression of Tn10 encoded tetracycline resistance. Annu Rev Microbiol 48, 345–369. 6. Gossen, M., Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 89, 5547–5551. 7. Nakayama, H., Mio, T., Nagahashi, S., Kokado, M., Arisawa, M., Aoki, Y. (2000) Tetracyclineregulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect Immun 68, 6712–6719. 8. Roemer, T., Jiang, B., Davison, J., Ketela, T., Veillette, K., Breton, A., Tandia, F., Linteau, A., Sillaots, S., Marta, C., Martel, N., Veronneau, S., Lemieux, S., Kauffman, S.,

210

9.

10.

11.

12.

13.

M. Weyler and J. Morschhäuser Becker, J., Storms, R., Boone, C., Bussey, H. (2003) Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Mol Microbiol 50, 167–181. Saville, S.P., Lazzell, A.L., Monteagudo, C., Lopez-Ribot, J.L. (2003) Engineered control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during infection. Eukaryot Cell 2, 1053–1060. Urlinger, S., Baron, U., Thellmann, M., Hasan, M.T., Bujard, H., Hillen, W. (2000) Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci USA 97, 7963–7968. Park, Y.-N., Morschhäuser, J. (2005) Tetracycline-inducible gene expression and gene deletion in Candida albicans. Eukaryot Cell 4, 1328–1342. Huang, G., Yi, S., Sahni, N., Daniels, K.J., Srikantha, T., Soll, D.R. (2010) N-acetylglucosamine induces white to opaque switching, a mating prerequisite in Candida albicans. PLoS Pathog 6, e1000806. Ramírez-Zavala, B., Reuß, O., Park, Y.N., Ohlsen, K., Morschhäuser, J. (2008) Environmental induction of white-opaque

14.

15.

16.

17.

switching in Candida albicans. PLoS Pathog 4, e1000089. Sahni, N., Yi, S., Daniels, K.J., Huang, G., Srikantha, T., Soll, D.R. (2010) Tec1 mediates the pheromone response of the white phenotype of Candida albicans: insights into the evolution of new signal transduction pathways. PLoS Biol 8, e1000363. Spiering, M.J., Moran, G.P., Chauvel, M., Maccallum, D.M., Higgins, J., Hokamp, K., Yeomans, T., d’Enfert, C., Coleman, D.C., Sullivan, D.J. (2010) Comparative transcript profiling of Candida albicans and Candida dubliniensis identifies SFL2, a C. albicans gene required for virulence in a reconstituted epithelial infection model. Eukaryot Cell 9, 251–265. Srikantha, T., Borneman, A.R., Daniels, K.J., Pujol, C., Wu, W., Seringhaus, M.R., Gerstein, M., Yi, S., Snyder, M., Soll, D.R. (2006) TOS9 regulates white-opaque switching in Candida albicans. Eukaryot Cell 5, 1674–1687. Staib, P., Lermann, U., Blaß-Warmuth, J., Degel, B., Würzner, R., Monod, M., Schirmeister, T., Morschhäuser, J. (2008) Tetracycline-inducible expression of individual secreted aspartic proteases in Candida albicans allows isoenzyme-specific inhibitor screening. Antimicrob Agents Chemother 52, 146–156.

Chapter 14 Galactose-Inducible Promoters in Cryptococcus neoformans var. grubii Lorina G. Baker and Jennifer K. Lodge Abstract Inducible promoters are invaluable tools for modulating gene expression (turning transcription on or off ) and have been a key approach for ascertaining gene essentiality in Cryptococcus neoformans. Galactoseinducible promoters have been successfully used in Saccharomyces cerevisiae to manipulate heterologous gene expression. Utilizing S. cerevisiae galactose-inducible genes in a BLAST search of the sequenced C. neoformans var. grubii genome, we found three potential galactose-inducible promoters, PGAL1, PGAL7, and PUGE2 that are induced by galactose and repressed by glucose in this variety. This chapter describes how to make a fusion of these promoters with heterologous genes, how to insert the fused gene back into the genome, and how to induce expression during asexual and sexual growth in C. neoformans var. grubii. Key words: Native galactose promoters, Glucose repression, Galactose induction, qPCR, Mating

1. Introduction To date, inducible promoters have been the best method to confirm the essentiality of genes in Cryptococcus spp. The pathogenic Cryptococcus species complex includes C. gattii and C. neoformans, which has two recognized subspecies, var neoformans and var. grubii. Molecular subtyping suggests a further dissection of these groupings (1). Initial work on inducible promoters focused on var. neoformans; however, with a higher infection incidence in the USA, more robust animal models, and the discovery of an a mating partner, much of the molecular and genetic focus has shifted to var. grubii. Research has also increased on C. gattii due to it causing an outbreak of cryptococcosis initially on Vancouver Island, but since spreading to surrounding parts of Canada and the northwestern

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_14, © Springer Science+Business Media, LLC 2012

211

212

L.G. Baker and J.K. Lodge

USA. Molecular tools, such as inducible promoters, that are developed in one strain of Cryptococcus do not always function well in other varieties or species. There are three well-characterized inducible promoters in C. neoformans var. neoformans. The first is the promoter of MFα1 (PMFα1) from var. neoformans, which is induced on V8 medium (2). Although this promoter drives expression well in all tested varieties, the V8 medium causes slow growth and induces sporulation; as such this specific growth requirement restricts PMFα1’s general use. Second is the PCTR4 which is a copper-repressible promoter that is induced by copper chelation (3). Traditionally, it was the best available option for investigators of both var. neoformans and var. grubii, as it is tightly regulated and exhibits higher levels of induction than other previously described promoters. However, it requires the use of copper-free medium, which may not be suitable for all experimental designs. The final promoter is from GAL7 (PGAL7), which is repressed by glucose and induced by galactose (4). Ory and colleagues found var. neoformans’ PGAL7 to be induced up to 83-fold in var. neoformans, but when this same promoter was expressed heterogenously in var. grubii they observed only a threefold induction. This finding described the limitation and impracticality of utilizing var. neoformans’ PGAL7 for modulating gene expression in situ in var. grubii (3). Therefore, we set out to isolate galactose-inducible promoters from var. grubii. The Leloir pathway has been well established in Saccharomyces cerevisiae and components of this pathway have been exploited for genetic analysis (reviewed in ref. (5)). The enzymes in this pathway involved in the conversion of galactose to glucose-6phosphate are: Gal1p (a kinase), Gal7p (a transferase), and Gal10p (an epimerase). In S. cerevisiae, GAL1, GAL7, and GAL10 are clustered together on chromosome two, but are transcribed from separate promoters (6–9). To find new endogenous promoters that could be regulated in vitro in var. grubii, we focused our search on this pathway. Utilizing S. cerevisiae galactose-inducible genes in a homologous-based search of C. neoformans var. grubii’s genome, we determined that PGAL1, PGAL7, and PUGE2 were repressible and inducible by glucose and galactose, respectively. This approach could be easily adapted for other species and molecular subtypes of Cryptococcus to obtain inducible promoters that function well within them. In this chapter, we describe how to make a construct, how to analyze the gene expression, and how to mate compatible partners with incorporated galactoseinducible promoters.

14

Inducible Promoters in C. neoformans

213

2. Materials 2.1. Media: Prepare all Media with Deionized Water

1. Repression medium: YPD: 1% yeast extract, 2% bacto-peptone, and 2% dextrose. 2. Induction medium: YPG: 1% yeast extract, 2% bacto-peptone, and 2% galactose. 3. Solid media: Include 2% bacto-agar in YPD or YPG (see Note 1). 4. If a minimal medium is desired, substitute dextrose or galactose as the carbon source in your existing protocol. 5. Regeneration medium: 1 M sorbitol, 1 M mannitol, 0.9% yeast nitrogen base, 2.6% glucose, 0.0267% yeast extract, 0.054% bacto-peptone, 0.133% gelatin. 6. For mating assays: V8 broth and agar: 5% V8 juice, 3.7 mM KH2PO4, 4% Bacto agar (for slides and plates) per liter, pH 5.0 with KOH, and 2% glucose or 2% galactose.

2.2. Gel Purification of Amplicons

1. Electrophoreses rig. 2. Power supply. 3. Agarose gel (1%). 4. Qiagen gel extraction kit (see Note 2).

2.3. Polymersase Chain Reaction Primers

1. Primers for making promoter swap constructs are listed in Table 1.

2.4. Gel Purification of Amplicons

1. Electrophoreses rig.

2. Primers for screening of promoter swap transformants are listed in Table 2.

2. Power supply. 3. Agarose gel (1%). 4. Qiagen gel extraction kit (see Note 2).

2.5. Transformation Material

1. Gold bead stock: Add 2 mL of 70% ethanol directly to 250 mg of 0.6-μm gold beads. Vortex well, aliquot 500 μL into four eppendorf tubes. To increase the recovery of gold beads, add an additional 2 mL of 70% ethanol to the initial suspension eppendorf tube. Vortex well and aliquot 500 μL to the four eppendorf tubes for a final volume of 1 mL of gold beads per eppendorf. Vortex beads 3–5 min at highest speed. Allow beads to settle at room temperature for 15 min then centrifuge for 5 s at 4,500 × g. Discard the supernatant. To wash the gold beads, add 1 mL of sterile water then vortex at highest speed for 1 min. Allow beads to settle 1 min

214

L.G. Baker and J.K. Lodge

Table 1 Primers for promoter swap overlap PCR Promoter-swap primers

Primer sequences

GAL1-specific primers NAT_GAL1-5 GAL1_NAT-6 GAL1_ADE2-7 ADE2_GAL1-8

cactggccgtcgttttacaacCTATTAAAGATCGAAGATCAGCTATGC GCATAGCTGATCTTCGATCTTTAATAG gttgtaaaacgacggccagtg GTCTTGTTTTCCGCAGGTATATCATGatggcacccagaaagacggttggtatc gataccaaccgtctttctgggtgccatCATGATATACCTGCGGAAAACAAGAC

GAL7-specific primers NAT_GAL7-5 GAL7_NAT-6 GAL7_ADE2-7 ADE2_GAL7-8

cactggccgtcgttttacaacGATCAGGCGCTGGCTGTGAGTTG CAACTCACAGCCAGCGCCTGATCgttgtaaaacgacggccagtg GCACTCAATTCTCTCCTGAGAATGatggcacccagaaagacggttggtatc gataccaaccgtctttctgggtgccatCATTCTCAGGAGAGAATTGAGTGC

UGE2-specific primers NAT_UGE2-5 UGE2_NAT-6 UGE2_ADE2-7 ADE2_UGE2-8

cactggccgtcgttttacaacGCGGGGAGTACAGGCTAAGCGTAG CTACGCTTAGCCTGTACTCCCCGCgttgtaaaacgacggccagtg GTTTTTGAACAGACTCGAGTTACCATGatggcacccagaaagacggttggtatc gataccaaccgtctttctgggtgccatCATGGTAACTCGAGTCTGTTCAAAAAC

Marker-specific primers ADE2_NAT-3 GAL_ADE2-4

CATTGAGTTCTTAAGAATTAACACGcaggaaacagctatgaccatgattac gtaatcatggtcatagctgtttcctgCGTGTTAATTCTTAAGAACTCAATG

Gene-specific primers ADE2-1 ADE2-2

gcagaagattcagatcttctttatc cgaaggtggttctcaaactgggaag

Note: lower case and uppercase letters in the primers designate which gene sequence the part of the primer is homologous. Example, in the primer NAT_GAL1-5, the lower case letters refer to the NAT drug marker gene sequence and the uppercase letters refer to the Gal 1 promoter sequence

Table 2 Primers used for PCR screening

a

Screen

Primer name

Primer sequencea

5¢ screen 5¢ ADE2 5¢ G418 screen 5¢ Hyg screen 5¢ Nat screen

GALADE2-10 cn Actin-7 cn Actin-7 NAT-1

cggcagtcaccgtaatgtggccc TCCTCTCCTCCGACAACC TCCTCTCCTCCGACAACC AATTCGTGAAGGCGGTAAGG

3¢ screen 3¢ ADE2 3¢ G418 screen 3¢ Hyg screen 3¢ Nat screen

GALADE2-9 NMT-3000 cn-Gal term 50 cn Actin-7

gcttatttccgtggtattcagatcctc AGTTTGGTCGCTCTCTGTACC TGTCGGAATGGACGATCGACC TCCTCTCCTCCGACAACC

Full-length screen ADE2 ADE2

GALADE2-10 GALADE2-9

cggcagtcaccgtaatgtggccc gcttatttccgtggtattcagatcctc

Lowercase indicates ADE2 gene-specific sequence

14

Inducible Promoters in C. neoformans

215

and centrifuge 5 s at 4,500 × g. Repeat for a total of three washes. After the last wash, decant supernatant and add 1 mL of sterile 50% glycerol (glycerol is diluted with sterile water). Vortex well and store at 4°C. 2. Macrocarriers, screens, rupture disks: For each transformation, sterilize three macrocarriers and stopping screens by dipping them in 100% ethanol. Allow these to air dry inside a sterile petri dish. Rupture disks 1,100 psi. 3. Biolistic Particle Delivery System: PDS-1000/He. (a) Vacuum pump. (b) Helium gas. 1. Glass beads: 425–600 μm.

2.6. Genomic DNA Preparation

2. Extraction Buffer: 550 mM Tris–HCl, pH 7.5, 20 mM EDTA, 1% SDS. 3. 5 M KOAc. 4. 5 M NaCl. 5. Phenol:chloroform:isoamyl alcohol 25:24:1, saturated with 10 mM Tris, pH 8.0, 1 mM EDTA. 6. Chloroform. 7. Isopropanol, ethanol. 8. Tris–EDTA pH 7.0. 1. Primers for Southern blot drug marker probes (Table 3).

2.7. Southern Blot Reagents

2. Restriction enzymes for digests of genomic DNA (Table 4). 3. Membranes: Nitrocellulose.

Table 3 Primer sets and expected amplicon size for Southern blot probes Template

Primer name

Primer sequencea

Size of PCR amplified probe (bp)

pHYG7-KB1

HYG-A HYG-B

GAATTCAGCGAGAGCCTGACC CGATCCTGCAAGCTCCGGATGCC

533

NAT-A NAT-B

CACTCTTGACGACACGGCTTACC TCATGTAGAGCGCCTGCTCGCC

547

G418-A G418-B

TGGATTGCACGCAGGTTCTCC TGCGAATCGGGAGCGGCGATACC

740

PHLEO-A PHLEO-B

AGATTTCGATTCCACCGCCGCC GTATCAGGCGCAGGAGCGTCCC

316

pHL001 pMH12-T pMH14P-2

216

L.G. Baker and J.K. Lodge

Table 4 Restriction enzymes for Southern blot screening Marker

Restriction enzyme 1

Restriction enzyme 2

G418

NcoI

XhoI

Hyg

BglII

EcoRV

Nat

BglII

XhoI

Phelo

HindIII

XhoI

4. Hybridization solution: (0.25 M Na2HPO4, 2 mM EDTA, 0.34% of 85% H3PO4, 7% SDS). 5. Washing solutions: 2× SSC, 0.1% SDS and 0.2× SSC, 0.1% SDS. 2.8. RNA Isolation

1. Lyophilizer. 2. RNA isolation kit (see Note 3).

2.9. cDNA and Quantitative PCR

1. cDNA synthesis kit (see Note 4). 2. qPCR Machine. 3. qPCR primers (see Note 5). 4. SYBR green (see Note 6).

3. Methods 3.1. Generation of Promoter Swap Constructs

We use overlap PCR gene deletion technology (10) to generate promoter-specific exchange cassettes that include drug resistance markers (11). Typically, 500 bp preceding the gene of interest (5¢ UTR containing the native gene promoter) is deleted and replaced with a galactose-inducible promoter. With the availability of the genome sequence, check to make sure that sequence you are removing from the 5¢ UTR is not also disrupting another gene (see Note 7). For the promoter swap constructs 978, 1,022, and 1,007 bp of PGAL1, PGAL7, and PUGE2, respectively, are used to replace the endogenous promoter of the gene of interest (see Notes 8 and 9). An example construct replacing the endogenous ADE2 promoter with PGAL7 is provided in Fig. 1 using primers from Table 1 and is described below (see Note 10). See Subheading 3.1, step 8 below for designing primers for your own construct. 1. PCR amplify fragment A: Primers GALADE2-10 and NAT ADE2-4 are used to amplify approximately 1 kb of the 5¢ upstream region of the ADE2 promoter using genomic DNA as the template (see Note 11).

14

Inducible Promoters in C. neoformans

217

Fig. 1. Overlap PCR diagram. Numbered arrows show primer location and direction. Numbers correspond to primers listed in Table 1. The overhang portion of the primer arrows indicates overlap between ADE2 gene/drug selection marker (primers 3 and 4), drug selection marker/galactose-inducible promoter (primers 5 and 6), galactose-inducible promoter/ADE2 gene (primers 7 and 8). Fragment designations A, B, C, D are listed above the diagram.

2. PCR amplify fragment B: Primers ADE2_NAT-3 and GAL7_ NAT-6 are used to amplify the drug marker positive selection cassette using the vector template for nourseothricin (NAT) (11) (see Note 12). 3. PCR amplify fragment C: Primers NAT_GAL7-5 and ADE2_ GAL7-8 are used to amplify the PGAL7 galactose-inducible promoter using genomic DNA as the template. 4. PCR amplify fragment D: Primers GAL7_ADE2-7 and GALADE2-9 are used to amplify approximately 1 kb of the ADE2 gene beginning at the start codon, ATG, using genomic DNA as the template. 5. Use gel-electrophoresis for all amplicons and purify from the gel using your method of choice (see Note 2). 6. 40 ng of each of the four purified amplicons are added together in a PCR reaction with primers GALADE-2 and GALADE-1 (see Note 13). 7. Use gel-electrophoresis (run at about 50 V in a 1% agarose gel) for final PCR product and purify using your method of choice as described in Subheading 3.1, step 5. Quantitate and continue to transformation protocol. 8. For ease in designing over-lap primers for your own favorite gene (YFG), replace the 5¢ portion (capital letters) of the ADE2_NAT-3 primer with sequence from YFG and retain the subsequent lowercase portion of ADE2_NAT-3. This will be your new primer 3. The reverse complement of this new primer will be your primer 4. For your primer 7, replace the 3¢ portion (lowercase letters) of the GAL7_ADE2-7 primer with YFG sequence beginning at the start codon, while retaining the 5¢ sequence of the described primer (uppercase letters). The reverse complement of this new primer will be your primer 8. Primers GALADE2-10, GALADE2-2, GALADE2-1, and GALADE2-9 should be replaced with sequences from YFG.

218

L.G. Baker and J.K. Lodge

3.2. Transformation of C. neoformans var. grubii 3.2.1. Transform Cells Using Biolistic Techniques (12, 13)

1. Grow cells in 50 mL YPG to late log-phase (approximately 2 days), concentrate by centrifugation, resuspend in regeneration medium, and spread 140 μL of cell suspension in a circle (approximately 3–3.5 cm in diameter) onto the center of nonselective YPG agar for transformation. Allow the cells to dry approximately 30 min in a sterile environment. 2. Ethanol precipitate 1.5 μg of deletion construct DNA in a 1.5mL eppendorf tube and resuspend pellet in 5 μL sterile water. Add the following reagents to the tube containing the DNA in order: 25 μL of gold bead stock, 25 μL 2.5 M CaCl2, and 10 μL 0.1 M spermidine, after each addition mix contents by flicking tube with fingers. Vortex 3 min and allow the DNAcoated beads to settle for 1 min. Briefly spin to pellet the beads now bound DNA to the bottom of the tube and remove supernatant by aspiration. Gently wash the pellet once with 70 μL 70% ethanol and once with 70 μL 100% ethanol. Resuspend the pellet in 25 μL 100% ethanol by vortexing at medium speed for 10 min. If beads do not easily resuspend, gently pipette up and down. DNA-coated beads should be used the same day as prepared. 3. For each transformation, add 8 μL of suspended DNA-coated gold beads to each of the three sterile macrocarriers. Allow the ethanol that the beads are suspended in to evaporate or use a vacuum dehydration system to speed up the process. Each macrocarrier should contain dried gold beads coated with approximately 0.5 μg of transforming DNA. 4. Bombard cells with dried DNA-coated gold beads using a PDS-1000/He Biolistic Particle Delivery System. This system uses helium pressure and a vacuum chamber for the delivery of the DNA-coated gold particles. Use the following parameters for the transformation of C. neoformans: Helium pressure 1,100 psi (this is the psi of the rupture disk), Chamber vacuum of ~27 in Hg, and target distance of 5 cm (third slot in chamber). Follow the manufacturer’s instructions for the remainder of particle delivery. 5. Following biolistic transformation, incubate the cells 30°C for 4 h on nonselective YPG media to allow for recovery (see Note 14). Transfer to drug-selective YPG medium by loosening the cells from the nonselective plate with 0.8 mL sterile PBS and scraping loose with spreader. Aspirate with a pipette and spread the cells evenly onto the selective plate and place in 30°C incubator. Transformants are typically observed in 3–5 days.

3.2.2. Confirmation of Site-Specific Homologous Recombination of Deletion Construct (14)

Carry out passaging, DNA preparation, PCR screening, and Southern blot analysis (all described below) to verify correct insertion of the antibiotic marker and galactose-inducible promoter at the target locus.

14

Inducible Promoters in C. neoformans

219

1. Passaging: To isolate stable transformants, all transformants should be transferred (passaged) every 2 days for a total of four passages on nonselective YPG medium, the fifth and final transfer should be to YPG containing the drug appropriate for the selective marker used. Only those transformants that grow equally well on selective and nonselective media should be considered stable transformants (see Note 15). 2. Genomic DNA preparation: Genomic DNA is prepared by a modified glass bead DNA extraction protocol described (15). Suspend a large loop full of cells in a 1.5-mL eppendorf microfuge tube in 500 μL extraction buffer, with 400-mg glass beads. Disrupt the cells by vortexing on highest setting for 10 min, followed by 10 min incubation at 70°C. Vortex briefly and add 200 μL 5 M KOAc and 200 μL 5 M NaCl to tubes, mix contents by inverting tubes five to ten times. Place tubes on ice for 20 min then centrifuge 20 min at 16,000 × g. Transfer supernatant to new eppendorf, add 500 μL phenol/ chloroform, invert to mix, and centrifuge 10 min at 16,000 × g. Transfer top aqueous phase (contains the DNA) to a new tube, add 500 μL chloroform, mix by inversion, and then centrifuge 10 min at 16,000 × g. Transfer top aqueous phase to a new tube. To precipitate the genomic DNA, add 500 μL isopropanol, mix by inversion, allow tube to sit at room temperature for at least 20 min (see Note 16). To pellet the DNA centrifuge 10 min at 16,000 × g, decant supernatant, and gently wash pellet with 100 μL 75% ethanol. Centrifuge 10 min at 16,000 × g and aspirate ethanol from tube. Allow pellet to dry for 5 min and then suspend pellet in 50 μL Tris– EDTA pH 7. 3. PCR Screening: Use 100 ng of genomic DNA for PCR screens. Three separate PCR screenings are carried out to confirm homologous recombination at the desired locus (Table 2). The first two PCR screens, 5¢ and 3¢ screen, each are used to verify homologous integration at the 5¢ and 3¢ to distinguish homologous recombinants from the wild-type strain. Following the example of replacing the ADE2 promoter with PGAL7, the first primer to use would be GALADE2-10 (Table 1) a forward primer that anneals upstream of the 5¢ region (or a reverse primer that anneals downstream of the 3¢ region, GALADE2-9) used for homologous recombination. Primer 2. Use a primer that anneals within the drug marker sequence used in the deletion construct which anneals in the opposite direction to GALADE2-10 or GALADE2-9 to give a PCR product only if the strain is a transformant (see Table 2 for drug-specific primers). The third and final PCR screen uses the gene-specific primers from the 5¢ and 3¢ screens (e.g., these are GALADE2-10 and GALADE2-9). The two gene-specific primers should

220

L.G. Baker and J.K. Lodge

amplify the entire integration region. This PCR screen will give a band that corresponds either with the wild-type promoter length or a band that corresponds to the PGAL7/drug marker insertion length. Additionally, the resulting size will demonstrate that a single copy of the transforming DNA inserted at the desired locus (see Note 17). Putative transformants that pass these PCR screens are considered to have undergone correct site-specific homologous recombination and are considered further and moved onto Southern blot analysis. 4. Southern blot analysis: This type of analysis is used to determine if more than one integration event occurred in the genome during transformation. Use two restriction enzymes that do not cut in the drug marker sequence (Table 4). Set up a separate restriction digest for each enzyme according to the manufacturer’s recommendations using approximately 10 μg of genomic DNA from wild-type and each strain that passed the PCR screens. Separate the restriction fragments on a 1% agarose gel and transfer to nylon membranes with 10× SSC as transfer buffer. 5. Probe for Southern blot: Template for Southern blot probe is prepared by PCR using primers listed in Table 3. Electrophorese template PCR product and gel purify as in Subheading 3.1, step 5. Prepare the selectable marker-specific probe by using a random priming kit using 50 μCi dCTP according to the manufacturer’s instructions. 6. Probing, washing, and exposing Southern blot: UV cross-link the DNA to the nylon membrane. Incubate the blots in 10 mL of hybridization buffer for 1 h at 65°C, add the probe to this solution, and hybridize at 65°C overnight with rotation. Wash the blots twice in 2× SSC, 0.1% SDS at room temperature for 10 min and once for 10 min in 0.2× SSC, 0.1% SDS that has been prewarmed to 65°C. Expose the blot to autoradiography film overnight at −80°C, then develop. More than one band visualized in either of the two digests for any given strain indicates that an ectopic insertion event of the promoter replacement construct occurred. Any strain having this type of event should be removed from further analysis (i.e., keep only strains that have one band in each of the digests). 3.3. Induction/ Repression of Gene of Interest in Broth or on Plates

Testing the essentiality of genes can be carried out either in broth or on agar plates (add 2% Bacto agar). 1. For the broth method, streak cultures to single colonies and grow on fresh YPG plates for 2 days at experimentally appropriate temperature (see Note 18). Inoculate YPD and YPG broth with an equal number of cells. We typically use an optical density (OD) at 660 nm of 0.2, which correspond to

14

Inducible Promoters in C. neoformans

221

approximately 2–4 × 107 cells/mL. Compare the culture OD at 660 nm of the uninduced (YPD) to the induced (YPG) cells at different time points (example T = 0, 4, 8, 12, 24). Alternatively, to determine viability (growth) aliquots from each time point can be spread onto YPG plates, incubated at the appropriate temperature for 2 days and the colony forming units counted. 2. For the plate method, streak cultures to single colonies and grow on fresh YPG plates for 2 days at experimentally appropriate temperature (see Note 18). Inoculate a single colony into 2 mL YPG and grow overnight with shaking at desired temperature. OD culture at 660 nm. Make six tenfold serial dilutions starting at an OD of 1 (an OD of 1 is approximately 2–4 × 108 cells/mL). Spot 5 μL of each dilution onto plates containing YPD or YPG (see Note 19). Take pictures at days 3, 5, and 7. 3.4. RNA Extraction for Quantitative PCR

Gene expression can be determined by a variety of procedures, but qPCR is fast and rapidly becoming the method of choice. 1. Grow promoter swap strains for 24 h in 2 mL YPD and YPG broth, shaking 300 rpm, at 30°C. Collect cells by centrifugation at 3,000 × g for 3 min (see Note 3). 2. Wash pellets three times with 1× phosphate-buffered saline (PBS) to remove residual media. The last centrifugation is performed at 9,500 × g and tightly packs the pellet, which helps to keep the pellet from coming out of the eppendorf during the lyophilization process. 3. Lyophilize-pelleted cells for at least 2 h (time can be increased without detriment to the experiment). 4. Purify RNA using an RNA isolation kit from Agilent with the following modifications to the manufacturer’s protocol for yeast: Homogenize the samples with glass beads by vortexing for 5 min at room temperature on the highest setting; add 600 μL of lysis buffer to the samples; vortex an additional 5 min on highest setting at room temperature and pellet by centrifugation at 16,000 × g for 3 min in a table-top centrifuge. Pass 450 μL of lysate through the mini-prefiltration column by centrifuging at 16,000 × g for 3 min at room temperature. Follow the remainder of the manufacturer’s recommendations for the preparation of RNA from yeast cells. 5. Make cDNA using 1 μg of total RNA for each sample and perform qPCR as per manufacture’s recommendations. Transcript repression/induction by the three-galactose-inducible promoters are compared in Table 5 using the ADE2 transcript as an example.

222

L.G. Baker and J.K. Lodge

Table 5 Average LOG2 ratio of repression and induction of ADE2 Strain name

Average glucose repression in LOG2 ratio

Standard deviation ±

Average galactose induction in LOG2 ratio

Standard deviation ±

PGAL1:ADE2

−4.87

2.41

15.48

5.56

PGAL7:ADE2

−6.08

3.47

21.59

9.59

PUGE2:ADE2

−5.31

2.09

28.06

8.79

Reproduced from Ruff 2009 with permission from Elsevier (17)

3.5. Mating Slides

The Gal promoters can also be induced or repressed during mating. 1. A cell suspension of strains with approximately equal amounts of appropriate opposite mating types (a and α) are mixed together in 500 μL 1 × PBS. 2. Assemble a mating chamber that consists of a sterile glass slide covered with V8 agar (supplemented with or without 2% glucose or 2% galactose). The slide should rest at about a 45° angle inside of a 100 × 15-mm petri dish. This angle is best achieved by placing a sterile 500 μL eppendorf underneath one end of the slide. Melted V8 agar is then pipetted slowly down the inclined slide; some agar will pool at the base of the slide, which holds the slide in place. 3. Slowly drip approximately 100 μL of the cell suspension down the middle of the V8 agar-covered glass slide. 4. Gently add 4 mL of V8 medium (minus agar) to the chamber. This will aid in maintaining nutrients and chamber humidity. 5. Carefully place the mating chambers in the dark at 25°C for 4–5 days, making sure not to splash the liquid V8 onto the agar-covered slide. Check your chambers occasionally (about once every other day) and add additional V8 broth if evaporation is occurring. Additionally, including a beaker of water in the area you are storing your mating chambers will also help to maintain humidity (see Note 20). 6. To take brightfield images of mating slides use a razor blade to cut the pooled V8 agar from the base of the slide. Wipe the underneath portion of the slide with a tissue soaked in 100% ethanol. Allow the ethanol on the slide to dry briefly and then place the slide in a clean petri dish. Cover the slides with cover slips, remove from the petri dish and place on the microscope platform, view on microscope at ×10, ×40, and ×100 magnifications. 7. If progeny are desired, repeat matings on V8 agar plates supplemented with either glucose or galactose. Incubate plates

14

Inducible Promoters in C. neoformans

223

upright at 25°C for 18–21 days in the dark. Gather spores by agar plug and suspend in 500 μL 1 × PBS. Plate suspension on selective medium. Progeny should appear in 4–7 days (see Note 21).

4. Notes 1. We autoclave the glucose and galactose separately from the other media components. This helps to alleviate caramelization of the carbon source. 2. We use Qiagen gel extraction kit for purifying all amplicons from agarose gels, but any comparable kit or procedure can be used. 3. We commonly use Agilent Total RNA Isolation Mini Kit or TRIzol® Reagent for RNA isolation, any comparable kit or procedure may be used. We have found that using a cell pellet larger than 150 μl with the Agilent kit gives smaller yields of less pure RNA. 4. We use the iScript cDNA synthesis kit (Bio-Rad), but any kit of your choosing can be used. 5. If possible design qPCR primer pairs so that they span an intron. If you get two products you will know that your cDNA is contaminated with genomic DNA. Additionally, design the primers to amplify a cDNA product between 100 and 300 bp in length. A few housekeeping gene controls that we have used are Actin, GapDH, and N-myristoyltransferase. 6. Typically, we use SYBR green for quantitative PCR. This method does not discriminate between amplicons (i.e., it detects all double-stranded DNA which may include primer dimers). 7. C. neoformans genome URL is located at http://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html. 8. We mainly use PGAL7 or PUGE2 for our studies and have found both to work well. 9. We do not have the promoters in plasmids. Because we commonly use overlap PCR and readily have genomic DNA available, we have found amplification directly from genomic DNA to be more convenient. 10. To use an alternate galactose-inducible promoter (other than PGAL7), interchange the GAL7-specific primers with GAL1- or UGE2-specific primers (Table 1).

224

L.G. Baker and J.K. Lodge

11. PCR notes and conditions that can be applied to Subheading 3.1, steps 1–4. To aid specificity in our PCR amplifications, we include 1.5 M Betaine in our reaction mix. Betaine is used as an enhancing agent that increases yield and the specificity of the PCR product by facilitating strand separation. Additionally, to reduce PCR errors, we use a high-fidelity polymerase that has proof reading abilities like TaKaRa Ex Taq. We also use fewer total PCR cycles, 25 rather than 35, when making our fragments as well as when making the complete construct. Example PCR conditions follow: Initial denaturation at 94°C for 5 min followed by 25 cycles of 94°C 30 s, 58.5°C for 15 s, and 72°C* for 4 min, with a final extension at 72°C* for 10 min. A 25 μL reaction will usually yield enough material for subsequent steps. *Note that some high-fidelity DNA polymerases require a lower extension temperature so refer to the manufacturer’s instructions. To determine PCR extension time, we use 1 min per 1 kb DNA amplicon. 12. The “NAT” portion of each primer in Table 1 is general for the positive selectable markers and will work on the other markers such as phleomycin, geneticin (G418), and hygromycin (13). 13. Follow PCR conditions as described in Note 10 with the following exceptions: Increase the extension step during cycling from 4 to 8 min and to produce enough material for transformation make eight 50 μL reactions giving a total of 400-μL PCR product for purification in Subheading 3.1, step 5. Additionally, this step where all of the different fragments are being “stitched” together can be problematic. There are several different trouble shooting techniques that can be used. First determine the best annealing temperature to use during the PCR. This is accomplished most easily in a gradient PCR. Secondly, the fragments can be put together in sections that would supply a larger region of homology between the fragments (A + B, B + C, C + D, followed by AB + BC + CD, Fig. 1). 14. Typically all transformations are incubated at 30°C, but when a transformation yields few or no putative transformants switching all incubations to 25°C can increase the number of transformants that are recovered. 15. The transformation construct can behave as an extrachromosomal episome. As extrachromosomal episomes are not stably maintained in C. neoformans the passaging process on nonselective medium helps to insure their loss. 16. At this step, the DNA preps can be left on the bench top for up to 3 days or for longer in 4°C. 17. On rare occasions more than one promoter construct will integrate at the desired locus. We tend to discard any strains that have undergone this type of integration event.

14

Inducible Promoters in C. neoformans

225

Fig. 2. PGAL7:ADE2 compatible mating crosses. (a) Mating slides of V8 or V8 supplemented with 2% galactose or glucose were inoculated with equal amounts of compatible mating partners α and a, incubated in the dark at 25°C for 4 days. Photos are ×40 magnification. Mating strains are indicated to the left of the panels and medium used is indicated on top. Arrows indicate chains of basidiospores. (b) ×10 magnification of mating on V8 supplemented with 2% glucose. Boxed area corresponds to ×40 magnification in (A). Matings are indicated top of panels. All images are representative of at least three independent experiments. Reproduced from Ruff 2009 with permission from Elsevier (17).

18. We do not find it necessary to supplement with 0.1–0.2% glucose to the galactose-containing media as is a common practice with S. cerevisiae (16), personal communication from Mark Johnston. 19. This procedure can also be used with the addition of inhibitors such as, NaCl, SDS, caffeine, calcofluor white, etc. or for testing under different conditions such as growth at different temperatures. 20. The addition of galactose to the mating medium induces hyper-filamentation (see Fig. 2).

226

L.G. Baker and J.K. Lodge

21. Colonies that appear between day 1 and 3 after plating are NOT progeny. These should be marked off as potential isolates.

Acknowledgments This work was supported by an NIH-NIAID grants RO1-AI50184 and RO1-AI072195 to JKL. References 1. Lin, X., and Heitman, J. (2006) The biology of the Cryptococcus neoformans species complex. Annu Rev Microbiol 60, 69–105. 2. del Poeta, M., Toffaletti, D. L., Rude, T. H., Sparks, S. D., Heitman, J., and Perfect, J. R. (1999) Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67, 1812–1820. 3. Ory, J. J., Griffith, C. L., and Doering, T. L. (2004) An efficiently regulated promoter system for Cryptococcus neoformans utilizing the CTR4 promoter. Yeast 21, 919–926. 4. Wickes, B. L., and Edman, J. C. (1995) The Cryptococcus neoformans GAL7 gene and its use as an inducible promoter. Mol Microbiol 16, 1099–1109. 5. Johnston, M. (1987) A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 51, 458–476. 6. Leloir, L. F. (1951) Enzymatic transformation of uridine diphosphate glucose into a galactose derivative. Arch Biochem 33, 186–1–90. 7. Torchia, T. E., Hamilton, R. W., Cano, C. L., and Hopper, J. E. (1984) Disruption of regulatory gene GAL80 in Saccharomyces cerevisiae: effects on carbon-controlled regulation of the galactose/melibiose pathway genes. Mol Cell Biol 4, 1521–1527. 8. Torchia, T. E., and Hopper, J. E. (1986) Genetic and molecular analysis of the GAL3 gene in the expression of the galactose/melibiose regulon of Saccharomyces cerevisiae. Genetics 113, 229–2–46. 9. Tschopp, J. F., Emr, S. D., Field, C., and Schekman, R. (1986) GAL2 codes for a mem-

10.

11.

12.

13.

14.

15.

16.

17.

brane-bound subunit of the galactose permease in Saccharomyces cerevisiae. J Bacteriol 166, 313–318. Davidson, R., Blankenship, J., Kraus, P., Berrios, M., Hull, C., D’Souza, C., Wang, P., and Heitman, J. (2002) A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 138, 2607–2615. McDade, H., and Cox, G. (2001) A new dominant selectable marker for use in Cryptococcus neoformans. Med Mycol 39, 151–154. Toffaletti, D. L., Rude, T. H., Johnston, S. A., Durack, D. T., and Perfect, J. R. (1993) Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J Bacteriol 175, 1405–1411. Hua, J., Meyer, J., and Lodge, J. (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin Diagn Lab Immun 7, 125–128. Baker, L. G., Specht, C. A., Donlin, M. J., and Lodge, J. K. (2007) Chitosan, the deacetylated form of chitin, is necessary for cell wall integrity in Cryptococcus neoformans. Eukaryot Cell 6, 855–867. Fujimura, H., and Sakuma, Y. (1993) Simplified isolation of chromosomal and plasmid DNA from yeasts. Biotechniques 14, 538–540. Gerik, K. J., Gary, S. L., and Burgers, P. M. J. (1997) Overproduction and affinity purification of Saccharomyces cerevisiae Replication Factor C. J Biol Chem 272, 1256–1262. Ruff, J. A., Lodge, J. K., and Baker, L. G. (2009) Three galactose inducible promoters for use in C. neoformans var. grubii. FG and B 46, 9–16.

Chapter 15 Modular Gene Over-expression Strategies for Candida albicans Vitor Cabral, Murielle Chauvel, Arnaud Firon, Mélanie Legrand, Audrey Nesseir, Sophie Bachellier-Bassi, Yogesh Chaudhari, Carol A. Munro, and Christophe d’Enfert Abstract Over-expression is a valid functional genomics approach to characterise genes of unknown function on a genome-wide scale. Strains are engineered to over-express a specific gene and the resulting gain-of-function phenotype assessed. Here, we describe the strategy we are adopting to synthesise a Candida albicans ORFeome collection and the options available to create over-expressing strains from this collection. Key words: Gateway cloning, Over-expression, TAP tagging, Genetic transformation, Western blotting, Strain storage, Integrative vectors

1. Introduction There has been exponential growth in the number of available fungal genome sequences over recent years. Despite this wealth of sequence information, a significant number of fungal genes remain uncharacterised and the functions assigned to the majority of genes are based on sequence homology alone. The classical method of elucidating gene function is by disrupting or deleting each gene and examining the resulting null mutant for measurable phenotypes. In fungi such as the human pathogen, Candida albicans, which is constitutively diploid and lacks a full sexual cycle, gene knockouts can be problematic and time consuming. One approach that circumvents the need to generate null mutants is to engineer strains that over-express the gene of interest by placing the gene under the control of a strong promoter. An over-expression strategy

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_15, © Springer Science+Business Media, LLC 2012

227

228

V. Cabral et al.

has been used, for example, in the model yeast Saccharomyces cerevisiae and has successfully led to the discovery of new signalling pathways (1) and new functions and target genes of transcription factors (2). This strategy is particularly valuable in the analysis of the function of genes that are members of multigene families. Classical gene deletion of one member of a gene family may not confer a demonstrable phenotype due to functional redundancy within the family or compensatory activation of other family members. However, over-expression of one family member may result in altered cellular properties. The choice of promoter, i.e. a strong constitutive promoter versus a regulatable promoter, is extremely important and there are advantages and disadvantages to both. In addition, it is crucial that the level of over-expression itself does not frequently confer a fitness disability to the cells. The environmental conditions that activate the promoter of choice should also be considered. Are they relevant to in vitro growth of the fungus and, in human pathogens, will the promoter be active and drive strong levels of expression in vivo. Several promoters have been utilised to over-express a selected number of genes in C. albicans, for example ADH1 (3), PCK1 (4), TEF1 (5), TDH3 (6, 7), and a tetracycline-inducible promoter (8). Over-expression strategies have already been applied on a small scale to investigate C. albicans gene function, interactions with the host and virulence attributes such as biofilm formation and morphogenesis. Over-expression using the TEF1 and TDH3 promoters has been utilised to identify the target genes of regulators of biofilm formation (Bcr1 and Zap1) and host interactions (Rim101) and to study their roles in those processes (5–7). Fu et al. (9) placed a number of cell wall protein genes under the control of a tetracycline-inducible promoter. Over-expression of IFF4 increased adhesion to epithelial cells and to plastic and, in a mouse model of vaginal candidiasis, there was a higher fungal burden in the vagina under conditions that induced IFF4 overexpression. Furthermore, the strain over-expressing IFF4 was more susceptible to killing by neutrophils, was attenuated in virulence in an immunocomponent systemic candidiasis model but had normal virulence in neutropenic mice (9). Several studies have used a strain where expression of the transcriptional regulator, Nrg1, has been placed under the control of a tetracycline-repressible promoter and expression modulated by exposure to different concentrations of doxycycline (expression levels are high in the absence of doxycycline) (10). This approach has been applied to study the role of Nrg1 and filamentation in pathogenesis in a mouse model (11) and in biofilm formation and dispersal (12). Similarly, the role of the Ume6 transcriptional regulator in morphogenesis and virulence has also been investigated using a strain engineered to constitutively over-express UME6 (13). On a larger scale, a library of strains over-expressing more than 100 different putative transcription

15

Over-expression Strategies for Candida albicans

229

factors has been generated using the tetracycline-inducible promoter (14), leading to the identification of Tec1 as a component of the pheromone response pathway of C. albicans. This chapter describes the high-throughput methods we have adopted to generate a C. albicans ORFeome collection and how we have taken advantage of the highly efficient Gateway™ technology to shuttle the cloned genes into vectors for over expression in C. albicans. Figure 1 provides an overview of the procedures used for recombination-mediated cloning of an ORF, shuttling the ORF into an over-expression vector and the generation of a C. albicans over-expression strain. This approach can be used to generate an ORFeome collection for any organism that has an available genome sequence. The construction of over-expression strains in other species is dependent upon (1) the ability to transform the species, (2) how well the species undergoes homologous recombination, and (3) the availability of a strong, preferably inducible, promoter. The generation of a library of C. albicans over-expressing strains will facilitate a number of genome-wide applications, including the elucidation of gene function by studying the phenotype of the over-expression mutants. Suppression screens can also be performed to determine whether over-expression of certain genes can complement the genetic or chemical blockade of specific pathways. Such screens can be applied to investigate a wide range of aspects of C. albicans’ cell biology and pathogenesis. This will improve the annotation of the C. albicans genome, define the function of novel genes (or at least assign them to a cellular process or pathway), and gain a better understanding of C. albicans pathobiology.

2. Materials 2.1. C. albicans and Bacterial Strains 2.2. Plasmids (see Note 1)

C. albicans and bacterial strains used in the different procedures are listed in Table 1. 1. pDONR207, a gentamycin-resistant entry vector carrying a ccdB/chloramphenicol-resistance cassette for Gateway cloning (Invitrogen) (Fig. 2a). 2. CIp10-PCK1p-GTW-TAPtag, a derivative of CIp10 (15) that harbours the C. albicans PCK1 promoter (4), a ccdB/chloramphenicol-resistance Gateway® cloning cassette (Reading frame B), a TAP-tag coding sequence (16) and the S. cerevisiae URA3 terminator (Fig. 2b). 3. CIp10-GTW-TETp, a derivative of CIp10 (15) that harbours a doxycycline-inducible promoter with seven copies of the Tet operator sequence (8), a ccdB/chloramphenicol-resistance Gateway cloning cassette (Reading frame B), and the S. cerevisiae URA3 terminator (Fig. 2c).

230

V. Cabral et al.

Fig. 1. Outline of the strategy used to establish C. albicans over-expression strains using Gateway™-mediated cloning and integrative transformation. Step 1: A target ORF (ORFx) is amplified from genomic DNA using oligonucleotides that match the ten first codons (Fwd) and the ten last codons (Rev) of ORFx and carry at their 5-prime ends sequences corresponding

15

Over-expression Strategies for Candida albicans

231

Table 1 Candida albicans and bacterial strains Strain Candida albicans SC5314 CEC955

CEC2175 CEC161 Escherichia coli K-12 DH5a TOP10 ccdBR

Genotype

Reference

Wild-type ura3D::limm434/ura3D::limm434 his1D::hisG/HIS1 arg4D::hisG/ARG4 ADH1/adh1::ADH1pcartTA::SAT1::TETp-caGFP ura3D::limm434/ura3D::limm434 his1D::hisG/HIS1 arg4D::hisG/ARG4 ADH1/adh1::ADH1p-cartTA::SAT1 ura3D::limm434/ura3D::limm434 his1D::hisG/HIS1 arg4D::hisG/ARG4

(18) Lab collection

fhuA2 D(argF-lacZ)U169 phoA glnV44 F80 D(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 F- mcrA D(mrr-hsdRMS-mcrBC) F80 D(lacZ)M15 DlacX74 deoR recA1 araD139D(ara-leu)7697 galK rpsL endA1 nupG tonA::Ptrc-ccdA

(20)

Lab collection (19)

Invitrogen

4. pNIM1 (8), a pBLUESCRIPT KS(−) derivative with a SacII– KpnI cassette containing a C. albicans adapted reverse Tetdependent transactivator (rtTA) and the caGFP reporter gene placed under the control of a doxycycline-dependent promoter with seven copies of the Tet operator sequence, flanked by C. albicans ADH1 promoter and 3¢ sequences for targeting to the C. albicans ADH1 locus.

Fig. 1. (continued) to the attB1 and attB2 recombination sites, respectively. Step 2 : Using the Invitrogen Gateway® BP clonase™, the PCR product is recombined into pDONR207, yielding an entry clone (pDONR207::ORFx). The recombination mix is transformed into E. coli DH5a. The original pDONR207 plasmid is counter-selected because of the presence of the ccdB gene which is toxic to DH5a cells. In the recombinant plasmids selected using gentamycin-resistance (GentR), the ccdB gene is replaced by ORFx. Step 3: Recombination between the CIp10-PCK1p-GTW-TAPtag vector and the ORFx entry clone is achieved using the Gateway® LR clonase™ (Invitrogen), yielding an over-expression plasmid for ORFx (CIp10-PCK1p-ORFx-TAPtag). The recombination mix is transformed into E. coli DH5a. The presence of the toxic ccdB gene product counter-selects the non-recombined vector. The desired recombined over-expression plasmid is selected by ampicillin-resistance (AmpR). Step 4: The over-expression plasmid is integrated at the C. albicans RPS1 locus following linearization using Stu I or I-SceI and transformation into a C. albicans ura3Δ/ura3Δ strain. The RPS1 locus was selected as the site of integration as it is a validated ribosomal protein high expression locus in C. albicans (15). Integration of the over-expression plasmid results in PKC1p-driven over-expression of ORFx in frame with the TAP-tag coding region and the production of a TAP-tagged protein. This strategy can be parallelized for the whole ORFeome and adapted to other fungal species provided an annotated genome sequence and appropriate transformation procedures and vectors are available for these species.

232

V. Cabral et al.

Fig. 2. Schematic maps of the entry and destination vectors used for cloning and over-expression of Candida albicans ORFs. The pDONR207 (a) is used for Gateway™-mediated cloning of PCR-amplified ORFs that harbour attB1 and attB2 recombination sites. ORFs are subsequently transferred through Gateway™-mediated recombination into the CIp10PCK1p-GTW-TAPtag (b) or CIp10-TETp-GTW (c) over-expression vectors that harbour the URA3 gene for selection of C. albicans transformants. Derivatives of these over-expression vectors can be targeted to the C. albicans RPS1 locus when linearized with StuI or I-SceI. Cloning of ORFs in CIp10-PCK1p-GTW-TAPtag allows production of TAP-tagged proteins when C. albicans cells are grown in gluconeogenic conditions while cloning in CIp10-TETp-GTW allows the production of untagged proteins when C. albicans cells are grown in the presence of doxycycline.

Table 2 Oligonucleotides Forwarda

5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGN27-3¢

Reverseb

5¢-GGGACCACTTTGTACAAGAAAGCTGGGTN30-3¢

c

5¢-ATACTACTGAAAATTTCCTGACTTTC-3¢

CIpURd

5¢-ATTACTATTTACAATCAAAGGTGGTC-3¢

CIpUL

a

The N27 sequence corresponds to codons 2–10 of the target ORF The N30 sequence corresponds to the reverse complement of the last 10 codons of the target ORF excluding the stop codon c Located 107 bp upstream of the start codon of C. albicans RPS1 d Located 120 bp from the 3¢ end of the URA3 gene in CIp10 derivatives b

5. pNIM1 Tet-GFP, a NcoI–Bgl II derivative of pNIM1 that lacks the caGFP reporter gene and its doxycycline-dependent promoter. 2.3. Oligonucleotides

2.4. Media

Oligonucleotides useful for these procedures are listed in Table 2 (see Note 2). Working solutions are generally in water at 5 mM. 1. YPD: 1% Yeast extract, 2% Bacto-peptone, 2% Autoclave 10 min 120°C.

D-glucose;

2. SD: 0.67% Yeast Nitrogen Base w/o amino acids (Difco), 2% D-glucose; Autoclave 10 min 120°C. 3. YNB casamino acids: 0.67% Yeast Nitrogen Base w/o amino acids (Difco), 2% casamino acids; Filter sterilise.

15

Over-expression Strategies for Candida albicans

233

4. Doxycycline 500×: 25 mg/mL in water; store at −20°C and keep in the dark. 5. SOC: 20 mL YPD, 2 mL LB, 1 mL 1 M HEPES pH 7.0–7.6. 6. Gentamycin stock solution: 10 mg/mL in water, filter sterilised. 7. Ticarcillin stock solution: 50 mg/mL in water, filter sterilised. 8. For solid media, add 15 g/L Bacto-agar to YPD, SD, or YNB prior to autoclaving. 2.5. PCR and Gateway™ Cloning

1. MasterPure™ Yeast Biotechnologies).

DNA

purification

kit

(Epicentre®

2. Eppendorf MixMate® (see Note 3). 3. Swinging bucket table-top centrifuge. 4. Phusion® High-Fidelity DNA Polymerase (New England Biolabs). 5. 5× Phusion™ HF Buffer (New England Biolabs). 6. 10 mM dNTP mix. 7. 100% Ethanol stored at room temperature. 8. 5 M NaCl. 9. 1× TE pH 7.5: 10 mM Tris–HCl pH 7.5, 1 mM EDTA, pH 7.5. 10. Gateway® BP clonase™ II Enzyme Mix (Invitrogen). 11. Gateway® LR clonase™ II Enzyme Mix (Invitrogen). 12. Proteinase K solution 2 mg/mL (Invitrogen; supplied with Gateway® BP and LR clonase™ II Enzyme Mixes). 13. Escherichia coli DH5a competent cells prepared using standard protocols (17). 14. BREATHseal, sterile (Greiner bio-one, Ref 676051). 2.6. Plasmid Preparation

1. Clearing plate (Millipore™ MultiScreen® HTS 96-well Filtration System). 2. Plasmid plate (Millipore™ MultiScreen™ PLASMID). 3. 96-Well microtiter plate. 4. Solution P1 + RNase A: 25 mM Tris–HCl pH 8, 10 mM EDTA pH 8, 10 mg/mL RNase A. 5. Solution P2: 0.2 M NaOH, 1% SDS. 6. Solution P3: 3.6 M KoAC, 6 M CH3COOH (use at 4°C). 7. 1× TE pH 7.5: 10 mM Tris–HCl pH 7.5, 1 mM EDTA, pH 7.5. 8. Sterilised water.

234

V. Cabral et al.

2.7. C. albicans Transformation

1. 1 M Filter-sterilised lithium acetate. 2. 10× TE pH 7.5: 10 mM Tris–HCl pH 7.5, 1 mM EDTA, pH 7.5 (Sterilised). 3. 50% (w/v) Filter-sterilised PEG 4000. 4. Lithium acetate/TE solution: 2 mL 1 M lithium acetate, 2 mL 10× TE pH 7.5, 16 mL H2O. 5. 10 mg/mL Salmon sperm DNA: denature at 95°C for 10 min and repeat prior to transformation. 6. PEG/LiAc/TE solution: 2 mL 1 M lithium acetate, 2 mL 10× TE pH 7.5, 16 mL 50% PEG 4000.

2.8. Protein Analysis

1. Lysis buffer: 0.1 M NaOH, 0.05 M EDTA, 2% SDS, 2% b-mercaptoethanol. 2. 4 M Acetic acid. 3. Loading buffer: 0.25 M Tris–HCl pH 6.8, 50% Glycerol, 0.05% bromophenol blue. 4. NuPage 10% gels (Invitrogen). 5. Novex® Midi Gel System (Invitrogen). 6. Fermentas Spectra Multicolor Broad Range Protein Ladder SM1841. 7. iBlot™ Dry Blotting System (Invitrogen). 8. iBlot® Gel Transfer Stacks Nitrocellulose, regular (Invitrogen). 9. Ponceau red: 0.1% Ponceau red, 5% acetic acid. 10. TBS Milk: 100 mM Tris–HCl pH 7.5, 50 mM NaCl, 5% dried skimmed milk. 11. TBS: 100 mM Tris–HCl pH 7.5, 50 mM NaCl. 12. Peroxidase-coupled anti-peroxidase antibodies. 13. ECL kit (GE Healthcare).

3. Methods 3.1. Amplification of C. albicans ORFs and Cloning in a Gateway™Compatible Donor Vector (see Note 4)

1. Prepare a stock of genomic DNA from a 20 mL overnight culture in YPD at 30°C of C. albicans strain SC5314 using the MasterPure™ Yeast DNA purification kit according to the suppliers instructions. 2. Determine the genomic DNA concentration by measuring the A260 (1 A260 = 50 mg/ml) and adjust genomic DNA concentration to a final concentration of 70 ng/mL. 3. In a 96-well, PCR-compatible plate placed on ice, distribute 2.5 mL of forward and reverse ORF-specific oligonucleotides (5 mM; final concentration in PCR reaction is 0.5 mM; see Subheading 2.2 and Note 2 for design).

15

Over-expression Strategies for Candida albicans

235

4. Prepare a mix that contains 3,575 mL H2O, 1,100 mL 5× Phusion™ HF Buffer, 110 mL 10 mM dNTPs, 110 mL 70 ng/mL genomic DNA, 55 mL Phusion® High-Fidelity DNA Polymerase. 5. Distribute 45 mL PCR mix in each well of the PCR plate (see Note 5). 6. Perform the PCR reaction using the following steps: 30 s at 98°C; 27 cycles of 10 s at 98°C, 30 s at 60°C, 2–5 min at 72°C; one final elongation step of 10 min at 72°C (see Note 6). 7. Precipitate amplified DNA by adding 100 mL 100% ethanol and 1 mL 5 M NaCl to the PCR reaction. Cover the PCR plate with a film and mix for 15 s at 239 × g using an Eppendorf MixMate®. Pellet DNA by centrifugation for 1 h at 2,700 × g at 4°C in a table-top swinging bucket centrifuge. 8. Discard supernatant by inverting the PCR plate over the sink. 9. Centrifuge the PCR plate placed upside down on a paper napkin on a plate-specific rotor arm for 1 min at 60 × g. 10. Add 10 mL 1× TE pH 7.5 and resuspend DNA by mixing for 10 min at 106 × g on an Eppendorf MixMate®. 11. Add 1 mL pDONR207 DNA (approx. 180 ng/mL) to each well of a new 96-well PCR-compatible plate. 12. Centrifuge 96-well plate briefly (15 s at 60 × g) to allow plasmid DNA to settle at the bottom of the wells. 13. Add 3 mL PCR products to each well and centrifuge plate briefly (15 s at 60 × g). 14. Perform Gateway™ BP reaction (see Note 7) by adding 1 mL Gateway® BP clonase™ II Enzyme Mix and centrifuge plate briefly (15 s at 60 × g). 15. Cover the plate with film and incubate over-night at room temperature. 16. Add 1 mL Proteinase K solution (see Note 8) and centrifuge plate briefly (15 s at 60 × g). 17. Incubate 10 min at 37°C. 18. Place on ice and add 45 mL E. coli DH5a competent cells (see Note 9). 19. Incubate 20 min on ice. 20. Heat-shock cells for 30 s at 42°C and place on ice for 2 min. 21. Add 150 mL SOC, cover the plate with a sterile, gas-permeable film (BREATHseal) and incubate 90 min at 37°C. 22. Plate 100 m L on LB plus 10 m g/mL gentamycin plates using 4.5-cm Petri dishes and incubate overnight at 37°C (see Note 10).

236

V. Cabral et al.

23. Pick one colony per transformation plate and inoculate into 400 mL LB plus 10 mg/mL gentamycin in a 96-deep-well plate. 24. Seal the plate with an oxygen-permeable film and incubate 48 h at 37°C. 25. Centrifuge at 1,301 × g for 5 min and discard the supernatant. 26. Leave at −20°C for at least 15 min. 27. Unfreeze the plate at room temperature with agitation using an Eppendorf MixMate® at 106 ´ g. 28. Add 100 mL of Solution P1 + RNase A and agitate for 10–30 min at room temperature (Eppendorf MixMate® at 106 ´ g). 29. Add 100 mL of Solution P2 and agitate gently for 3–5 min (Eppendorf MixMate® at 106 ´ g). 30. Add 100 mL of Solution P3 and agitate gently for 10 min (Eppendorf MixMate® at 106 ´ g) until a precipitate is formed. 31. Using a multi-channel pipette, transfer the lysate to a Millipore™ MultiScreen® HTS 96-well Filtration System clearing plate. Place the clearing plate on top of a manifold, and adjust the vacuum to 8 in. of Hg (0.27 bar—203 Torr). Apply the vacuum for 3 min, drawing the lysate through the clearing plate into a Millipore™ MultiScreen™ plasmid plate. 32. Remove the clearing plate from inside the manifold and place the plasmid plate on top of the empty manifold. Adjust the vacuum to 15–20 in. of Hg and direct filtrate to waste. 33. Add 200 mL of water to each well of the plasmid plate. Adjust the vacuum to 15–20 in. of Hg and direct filtrate to waste. 34. Add 100 mL of TE buffer to each well of the plasmid plate and agitate at room temperature for 30–60 min (Eppendorf MixMate® at 106 ´ g) to resuspend plasmid DNA. 35. Transfer resuspended plasmids to a 96-well plate and store at −20°C (see Note 11). 3.2. Transfer of C. albicans ORFs to a Gateway™Compatible OverExpression Vector

1. Perform Gateway™ LR reaction (see Note 12) and transformation into E. coli DH5a according to steps 11–22 in Subheading 3.1, except that (a) the pDONR207 plasmid is replaced by the CIp10-PCK1p-GTW-TAPtag or CIp10TETp-GTW plasmid (approx. 50 ng/mL); (b) the PCR product is replaced by 2 mL of the cognate pDONR207 derivatives obtained in step 35, Subheading 3.1; (c) the Gateway® BP clonase™ II Enzyme Mix is replaced by the Gateway® LR clonase™ II Enzyme Mix; and (d) the transformation mixtures are plated on LB plus 50 mg/mL ticarcillin plates and incubated at 30 or 37°C according to the recipient expression vector (see Note 13).

15

Over-expression Strategies for Candida albicans

237

2. Prepare plasmid DNA as described in Subheading 3.1, steps 23–35. 3. Evaluate the resulting plasmids by performing an EcoRV digest and agarose gel electrophoresis of the digested plasmids (see Note 14). 3.3. Integrative Transformation of C. albicans

1. In a 96 1.2 ml deep-well plate, mix 16 mL of plasmid DNA of the CIp10-derivatives generated in Subheading 3.2, 2 mL of StuI restriction enzyme buffer and 2 mL of StuI restriction enzyme (see Note 15). Incubate the digestion mixture overnight at 37°C. 2. Inoculate five freshly-grown colonies of a ura3/ura3 strain in 20 mL of YPD and grow overnight at 30°C (see Note 16). 3. Inoculate 1 L of YPD at OD600 nm = 0.2 from the overnight culture. 4. Incubate 4 h at 30°C with shaking (200 rpm) until OD600 nm = 0.6–0.8 (around 107 cfu/mL). 5. Transfer the culture into the appropriate number of 50-ml Falcon tubes and centrifuge 5 min at 2,000 × g at 4°C. 6. Discard supernatant and resuspend cells gently in 200 mL icecold 1× TE pH 7.5 and conduct subsequent steps on ice. 7. Centrifuge 5 min at 2,000 × g at 4°C. 8. Discard supernatant and resuspend cells gently in 20 mL freshly made ice-cold lithium acetate/TE solution. 9. Centrifuge 30 s at 2,000 × g at 4°C, discard supernatant and resuspend gently in 4 mL ice-cold lithium acetate/TE. 10. Place the deep-well plate with StuI-digested plasmid on ice, add 5 mL denatured salmon sperm DNA and keep 5 min on ice. 11. Add gently 50 mL of cells obtained at step 9. 12. Add gently 300 mL of ice-cold freshly prepared PEG/LiAc/ TE solution, cover with a sterile plastic film and mix by inverting five to six times. 13. Incubate overnight at 30°C. 14. Heat-shock the transformation mixture by placing the 96-deepwell plate 15 min at 44°C in a water bath. 15. Add 500 mL of SD medium to each well. 16. After 2–5 min, centrifuge 30–45 s at 2,000 × g. 17. Discard supernatant carefully, resuspend the cells in 500 mL SD medium, and centrifuge 30–45 s at 2,000 × g. 18. Discard supernatant carefully and resuspend cells gently in 150 mL SD medium.

238

V. Cabral et al.

19. Plate cells on SD agar medium (see Note 17). 20. Incubate at 30°C for 2–3 days. 21. Isolate two independent transformants per transformation on SD agar medium (see Note 17). 22. Inoculate one colony of each isolated transformant in a 96-deepwell plate containing 0.5 mL YPD, grow for 24 h at 30°C, add 0.5 mL 80% glycerol, and store at −80°C (see Note 18). 23. In parallel, use a pipette tip to place some cells of the same colonies at the bottom of two PCR plates. 24. Place the two PCR plates in a microwave oven at full intensity for 2 min (see Note 19). 25. Prepare a mix that contains 2,780 mL H2O, 500 mL 10× Taq DNA Polymerase buffer, 200 mL MgCl2, 100 mL 10 mM dNTPs, 200 mL CIpUL (5 mM; Table 2), 200 mL CIpUR (5 mM; Table 2), 20 mL Taq DNA Polymerase. 26. Add 20 ml of PCR mix to each well in the two PCR plates and perform the PCR reaction: 2 min at 94°C followed by 35 cycles of 30 s at 94°C, 30 s at 54°C and 1 min at 72°C and a final 2 min extension step at 72°C. 27. Analyse the PCR reactions on an agarose gel. Integration of the CIp10 derivatives at the RPS1 locus should yield an approx. 1 kb PCR product. 3.4. PCK1p-Driven Over-Expression and Analysis of TAP-Tagged Proteins by Western Blotting

1. From a freshly grown colony, wash cells in water and adjust concentration to an OD600 = 0.5 in 20 mL YNB 2% casamino acids (see Note 20). 2. Incubate cells at 30°C (see Note 21). 3. After 4–6 h growth, collect an equivalent of 10 OD600 nm of cells by centrifugation for 5 min at 4,000 × g. 4. Resuspend cells in 200 mL Lysis buffer and place the tube at 90°C for 10 min. 5. Bring the lysate to neutral pH by adding 5 mL 4 M acetic acid and vortexing for 30 s. 6. Place the tube at 90°C for 10 min to maximise solubilisation. 7. Add 50 mL Loading buffer and centrifuge for 5 min at 4,000 rpm. 8. Transfer supernatants to new tubes and heat samples for 3 min at 90°C. 9. Immediately load samples and a protein ladder on a NuPage 10% SDS-PAGE gel, run the gel for 1 h at 200 V and transfer the proteins on nitrocellulose using the iBlot™ Dry Blotting System according to manufacturer’s instructions.

15

Over-expression Strategies for Candida albicans

239

Fig. 3. Detection of over-expressed TAP-tagged proteins by western blot. Three C. albicans ORFs (A–C) have been cloned in the CIp10-PCK1p-GTW-TAPtag vector and the resulting plasmids, along with a control plasmid (−), have been introduced at the C. albicans RPS1 locus. The resulting strains have been grown in the presence or absence of 2% casaminoacids and whole cell extracts have been separated by SDS-PAGE and probed with a peroxidase-coupled antibody allowing the detection of TAP-tagged proteins in gluconeogenic conditions only.

10. To verify proper transfer of the proteins, stain the nitrocellulose membrane with Ponceau red for 10 min and rinse in distilled water. 11. Incubate the blot in TBS-milk solution for 20 min. 12. Remove the pre-blotting solution and replace by TBS-milk solution with Peroxidase-coupled anti-peroxidase antibodies at a 1:2,000 dilution (see Note 22). 13. Incubate for 2 h at 4°C. 14. Rinse the blot three times with TBS and detect proteins using the ECL kit according to the supplier’s instructions (Fig. 3). 3.5. TETp-Driven Over-Expression on Solid Medium

1. Grow an overnight culture in YPD from a freshly isolated colony. 2. Wash cells in water and adjust cell density to OD600 = 1.5 (approx. 2 × 107 cfu/mL). 3. Prepare serial dilutions in water and spot 2–5 mL on appropriate solid medium containing 50 mg/mL doxycycline and the same medium without doxycycline as a control (see Note 23). 4. Incubate plates 3–5 days in the dark at the desired temperature (Fig. 4).

240

V. Cabral et al.

Fig. 4. Analysis of over-expression strains by spotting assay. Two C. albicans ORFs (A and B) have been cloned in the CIp10-TETp-GTW vector and the resulting plasmids have been introduced at the C. albicans RPS1 locus. The resulting strains have been grown on solid medium in the presence or absence of 50 mg/mL doxycycline.

4. Notes 1. Plasmid DNA is prepared using the PureLink™ QuickPlasmid Miniprep Kit (Invitrogen) according to the manufacturer’s instructions. 2. The forward and reverse oligonucleotides are designed to target the gene of interest and allow the recombination of the PCR product at the attP1 and attP2 sites of pDONR207. Hence, the forward primer has the attB1 sequence at its 5¢ end and ends with 30 nucleotides corresponding to codons 1-10 of the target ORF. Similarly, the reverse primer has the attB2 sequence at its 5¢ end and ends with the reverse complement of the last 10 codons of the target ORF excluding the stop codon. The sequence of the target ORFs and the corresponding 5¢ and 3¢ codons are retrieved from the Candida Genome Database (http://www.candidagenome.org/). These oligonucleotides will allow the eventual production of a TAP-tagged protein if the CIp10-PCK1p-GTW-TAPtag vector is used or an untagged protein if the CIp10-GTW-TETp vector is used. However, because of the design of the reverse oligonucleotide, transfer of the cloned ORF into standard Gateway-compatible vectors for the production of C terminally tagged proteins will not allow the production of a tagged protein. If this is an aim of the cloning, then a reverse oligonucleotide of sequence 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCN30-3¢ should be used. In this case, cloning of the ORF in the CIp10PCK1p-GTW-TAPtag vector will not result in the production of a TAP-tagged protein.

15

Over-expression Strategies for Candida albicans

241

3. The use of this piece of equipment is highly recommended for carrying out the procedure as it allows efficient mixing of solutions/resuspension of pellets within 96-well microtiter plates. 4. This protocol is written for simultaneously amplifying and cloning 96 C. albicans ORFs of similar size but can be easily adapted to the amplification and cloning of a single ORF. 5. A repeating pipette can be used to distribute this solution in the 96-well plate. 6. The time for elongation is varied according to the size of the amplicons. We use 2 min for amplicons with size up to 2,000 bp, 3 min for amplicons ranging from 2,000 to 4,000 bp, 4 min for amplicons ranging from 4,000 to 5,000 bp, and 5 min for amplicons longer than 5,000 bp. When a large number of ORFs are amplified, oligonucleotides should be arranged by amplicon size in the microtiter plate. If a small subset of ORFs is amplified, an optimal elongation time should be chosen so that all ORFs are properly amplified whatever their size. The Phusion® High-Fidelity DNA Polymerase comes with 5× Phusion™ HF Buffer and 5× Phusion™ GC Buffer, the latter being used when amplification with the former is unsuccessful. Please refer to the manufacturer’s instructions if using another high-fidelity polymerase as some need lower temperatures for elongation. 7. The Gateway™ BP reaction uses the Gateway® BP clonase™, a mixture of the Lambda phage integrase and Integration Host Factor, that allows specific recombination between attB and attP sites carried by the PCR product and pDONR207 plasmids, respectively, yielding a so-called entry clone (Fig. 1, step 2). 8. Proteinase K treatment is used to degrade the BP clonase and avoid unwanted recombinations. 9. Commercial E. coli DH5a competent cells can be used instead of competent cells prepared using standard protocols. 10. The remainder of the transformation mix can be retained by adding 80 mL 50% glycerol and storing at −80°C. 11. We highly recommend that the plasmids are sequenced at this stage to ensure that they contain the expected ORF and that no error has been introduced through the PCR step. We generally sequence (1) the 5¢ end of each cloned ORF using standard Sanger sequencing and (2) pools of plasmids using the Solexa/ Illumina technology. This way, the appropriate assignment of plasmids in 96-well plates is confirmed and ORFs are fully sequence verified. Plasmids can also be verified by digestion with BsrGI, which cuts within pDONR207 and on each side of the cloned ORF. Importantly, the sequence of the cloned ORF should be analysed for the presence of any BsrGI sites to aid the interpretation of the restriction pattern.

242

V. Cabral et al.

12. The Gateway™ LR reaction uses the Gateway® LR clonase™, a mixture of the Lambda phage integrase, Integration Host Factor and excisionase, that allows specific recombination between attL and attR sites carried by the entry clone and the destination vector, respectively (Fig. 1, step 3). 13. E. coli strains harbouring derivatives of CIp10-TETp-GTW should be systematically grown at 30°C as growth at higher temperatures results in the progressive loss of tetO repeats. 14. EcoRV digestion is used as there are EcoRV sites flanking the cloned ORFs in the CIp10-PCK1p-GTW-TAPtag and CIp10TETp-GTW derivatives. Importantly, the sequence of the cloned ORF should be checked for the presence of any EcoRV sites to aid the interpretation of the restriction pattern. 15. In the event the cloned ORF contains one or several StuI sites, plasmid DNA is digested by I-SceI prior to C. albicans transformation. I-SceI recognises an 18 bp sequence which is not found in the C. albicans genome and a restriction site for I-SceI was introduced in CIp10-PCK1p-GTW-TAPtag and CIp10TETp-GTW to allow linearization of all their derivatives whatever the cloned ORF. Although it would appear simpler to digest CIp10 derivatives with I-SceI systematically, it is our experience that StuI digestion are less expensive, more efficient and result in a lower frequency of ectopic integration. 16. Plasmids which bear the URA3 gene and where over-expression is not driven from the TETp promoter can be introduced into any C. albicans ura3/ura3 strain (e.g. strain CEC161, Table 1). For TETp-driven expression, it is necessary to use a C. albicans ura3/ura3 strain that has been modified through introduction of the pNIM1 or pNIM1ΔTet-GFP plasmid at the ADH1 locus as this will allow the constitutive expression of the C. albicans-adapted reverse Tet-dependent transactivator (rtTA) and, consequently, doxycycline-dependent expression of the ORFs cloned into CIp10-TETp-GTW. This is achieved by digestion of either pNIM1 or pNIM1ΔGFP plasmids by KpnI and SacII and transformation into a C. albicans ura3/ ura3 strain according to the transformation protocol described in Subheading 3.3 and selection for nourseothricin resistance (8). Integration at the ADH1 locus is confirmed by a PCR reaction using genomic DNA of the transformants and oligonucleotides Vect60 (5¢-ACAAGCTCATTGAGTGACGAA AAG-3¢) and Vect61 (5¢-TTTACGGGTTGTTAAACCTT CGAT-3¢) that should yield a 1,067 bp PCR product (see Chaps. 1 and 13). 17. Supplements should be added to the SD agar medium according to the auxotrophies of the transformed strain, except that for uridine and uracil which is complemented upon transformation

15

Over-expression Strategies for Candida albicans

243

by CIp10 derivatives. In the case of the C. albicans strains listed in Table 1, no supplement is needed as transformants are prototrophs. 18. Two transformants are analysed for each transformation. Hence, two 96-well plates, one with a first set of transformants and another with the second set of transformants, should be used when working with 96 ORFs. 19. This step will lyse the cells. The efficiency of lysis is decreased if there are too many cells present, therefore smaller quantities of cells are optimal. 20. We have observed that cells display a more homogeneous morphology when inoculated from freshly grown colonies. Under these conditions, higher yields of TAP-tagged proteins are obtained after 4–6 h growth in gluconeogenic conditions. 21. 30°C is the temperature of choice but other temperatures can be used. 22. TAP-tagged proteins harbour a domain of Staphylococcus aureus protein A that binds strongly to immunoglobulins so any peroxidase-coupled antibody can be used to detect the recombinant proteins. The use of peroxidase-coupled antiperoxidase antibodies will allow signal amplification and facilitate detection of the TAP-tagged proteins. 23. Doxycycline-mediated over-expression can be obtained in any medium of interest. The preculture and possibly the doxycycline concentration used to trigger over-expression should be optimised for the chosen medium.

Acknowledgements Work in the laboratories of CdE and CM is supported by the Wellcome Trust (The C. albicans ORFeome project, WT088858MA). Work in the CdE laboratory is also supported by the Agence Nationale de la Recherche (KANJI, ANR-08-MIE-033-01) and the European Commission (EURESFUN, LSHM-CT-2005-518199; FINSysB, PITN-GA-2008-214004). Audrey Nesseir is the recipient of a PhD fellowship of the DIM-Maladies Infectieuses. Vitor Cabral is the recipient of a PhD fellowship of the European Commission (FINSysB, PITN-GA-2008-214004) and Mélanie Legrand and Arnaud Firon were recipients of post-doctoral fellowships of Institut Pasteur (Bourse Roux). We are grateful to Pilar Gutierrez-Escribano for suggesting the microwave procedure for colony PCR.

244

V. Cabral et al.

References 1. Sopko, R., Huang, D., Preston, N., Chua, G., Papp, B., Kafadar, K., Snyder, M., Oliver, S. G., Cyert, M., Hughes, T. R., Boone, C., and Andrews, B. (2006) Mapping pathways and phenotypes by systematic gene overexpression, Mol Cell 21, 319–330. 2. Chua, G., Morris, Q. D., Sopko, R., Robinson, M. D., Ryan, O., Chan, E. T., Frey, B. J., Andrews, B. J., Boone, C., and Hughes, T. R. (2006) Identifying transcription factor functions and targets by phenotypic activation, Proc Natl Acad Sci USA 103, 12045–12050. 3. Hiller, D., Sanglard, D., and Morschhauser, J. (2006) Overexpression of the MDR1 gene is sufficient to confer increased resistance to toxic compounds in Candida albicans, Antimicrob Agents Chemother 50, 1365–1371. 4. Leuker, C. E., Sonneborn, A., Delbruck, S., and Ernst, J. F. (1997) Sequence and promoter regulation of the PCK1 gene encoding phosphoenolpyruvate carboxykinase of the fungal pathogen Candida albicans, Gene 192, 235–240. 5. Nobile, C. J., Andes, D. R., Nett, J. E., Smith, F. J., Yue, F., Phan, Q. T., Edwards, J. E., Filler, S. G., and Mitchell, A. P. (2006) Critical role of Bcr1dependent adhesins in C. albicans biofilm formation in vitro and in vivo, PLoS Pathog. 2, e63. 6. Nobile, C. J., Solis, N., Myers, C. L., Fay, A. J., Deneault, J. S., Nantel, A., Mitchell, A. P., and Filler, S. G. (2008) Candida albicans transcription factor Rim101 mediates pathogenic interactions through cell wall functions, Cell Microbiol 10, 2180–2196. 7. Nobile, C. J., Nett, J. E., Hernday, A. D., Homann, O. R., Deneault, J. S., Nantel, A., Andes, D. R., Johnson, A. D., and Mitchell, A. P. (2009) Biofilm matrix regulation by Candida albicans Zap1, PLoS biology 7, e1000133. 8. Park, Y. N., and Morschhauser, J. (2005) Tetracycline-inducible gene expression and gene deletion in Candida albicans, Eukaryot Cell 4, 1328–1342. 9. Fu, Y., Luo, G., Spellberg, B. J., Edwards, J. E., Jr., and Ibrahim, A. S. (2008) Gene overexpression/suppression analysis of candidate virulence factors of Candida albicans, Eukaryot Cell 7, 483–492. 10. Saville, S. P., Lazzell, A. L., Monteagudo, C., and Lopez-Ribot, J. L. (2003) Engineered control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during infection, Eukaryot. Cell 2, 1053–1060.

11. Saville, S. P., Thomas, D. P., and Lopez Ribot, J. L. (2006) A role for Efg1p in Candida albicans interactions with extracellular matrices, FEMS Microbiol Lett 256, 151–158. 12. Uppuluri, P., Pierce, C. G., Thomas, D. P., Bubeck, S. S., Saville, S. P., and Lopez-Ribot, J. L. (2010) The transcriptional regulator Nrg1p controls Candida albicans biofilm formation and dispersion, Eukaryot Cell 9, 1531–1537. 13. Carlisle, P. L., Banerjee, M., Lazzell, A., Monteagudo, C., Lopez-Ribot, J. L., and Kadosh, D. (2009) Expression levels of a filament-specific transcriptional regulator are sufficient to determine Candida albicans morphology and virulence, Proc Natl Acad Sci USA 106, 599–604. 14. Sahni, N., Yi, S., Daniels, K. J., Huang, G., Srikantha, T., and Soll, D. R. (2010) Tec1 mediates the pheromone response of the white phenotype of Candida albicans: insights into the evolution of new signal transduction pathways, PLoS biology 8, e1000363. 15. Murad, A. M., Lee, P. R., Broadbent, I. D., Barelle, C. J., and Brown, A. J. (2000) CIp10, an efficient and convenient integrating vector for Candida albicans, Yeast 16, 325–327. 16. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999) A generic protein purification method for protein complex characterization and proteome exploration, Nat Biotechnol 17, 1030–1032. 17. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 18. Gillum, A. M., Tsay, E. Y., and Kirsch, D. R. (1984) Isolation of the Candida albicans gene for orotidine-5’-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations, Mol. Gen. Genet. 198, 179–182. 19. Firon, A., Aubert, S., Iraqui, I., Guadagnini, S., Goyard, S., Prevost, M. C., Janbon, G., and d’Enfert, C. (2007) The SUN41 and SUN42 genes are essential for cell separation in Candida albicans, Mol. Microbiol. 66, 1256–1275. 20. Taylor, R. G., Walker, D. C., and McInnes, R. R. (1993) E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing, Nucleic Acids Res 21, 1677–1678.

Part IV Host Responses to Infection In Vitro

Chapter 16 Interactions Between Macrophages and Cell Wall Oligosaccharides of Candida albicans Héctor M. Mora-Montes, Christopher McKenzie, Judith M. Bain, Leanne E. Lewis, Lars P. Erwig, and Neil A.R. Gow Abstract The fungal cell wall is the armour that protects the cell from changes in the external environment. The wall of Candida albicans, an opportunistic human pathogen, is also the immediate point of contact with the host immune system and contains most of the pathogen-associated molecular patterns recognised by innate immune cells. Along with the use of mutants altered in cell wall composition, the isolation and purification of cell wall components has proven useful in the identification of receptors involved in the sensing of these molecules, and assessment of the relative relevance of ligand-receptor interactions during the sensing of C. albicans by the immune system. Here, we describe protocols for the isolation of cell wall chitin, N-linked and O-linked mannans from C. albicans, and how they can subsequently be used to assess immunological activities such as phagocytosis and cytokine production by myeloid cells. Key words: Candida albicans, Cell wall, Chitin, Macrophages, N-linked mannan, O-linked mannan, Pathogen-associated molecular patterns, Phagocytosis

1. Introduction Recent years have seen considerable research activity focussed on the identification of the PAMPs (pathogen-associated molecular patterns) of fungi and their cognate PRRs (pattern recognition receptors; 1). The identification of these ligands and their receptors has the potential to provide the means to control the nature of immune recognition responses to fungi by adjunct immunotherapy. One approach has been the use of mutants with defined alterations in cell wall composition as tools to investigate which cell wall components stimulate specific immune responses (2–5). A complementary approach has been to purify specific cell wall components of a fungus and to present these to immune cells and observe their

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_16, © Springer Science+Business Media, LLC 2012

247

248

H.M. Mora-Montes et al.

immune reactivity. This chapter provides some guidelines as to how to prepare such molecules for experiments. The major components of the C. albicans cell wall are covalently bonded to each other. Therefore, the extraction of pure wall components requires relatively harsh treatments and care must be taken to check the purity of the resulting purified molecules. The C. albicans cell wall is similar, but by no means identical, in structure to that of Saccharomyces cerevisiae (6). Consequently, many of the purification protocols originated from work in this rather distantly related yeast. The outer wall of C. albicans is enriched with highly glycosylated mannoproteins that are more than 80–90% mannose sugar by mass and represent 35–40% of the dry weight of the wall (6). This mannoprotein layer is fibrillar in appearance and is attached via a GPI-remnant to β-1,6 glucan, which is in turn attached to either β-1,3 glucan or chitin (1, 6). These two latter molecules form the skeletal inner cell wall layer. Chitin, a homopolymer of N-acetyl glucosamine, represents only about 2–4% of the dry weight of the cell wall, while β-1,6 glucan and β-1,3 glucan represent 20 and 40% of the wall, respectively. Chitin is unique in the cell wall in being resistant to both acid and alkali extractions. Purification of this molecule takes advantage of this property. If purified molecules from the cell wall (mannan, glucan, chitin, etc.) are to be used in immunological experiments, it is important to establish the purity of the material generated, both in terms of contamination by other wall components and also by LPS and other bacterial components that may introduce spurious experimental results. It should also be kept in mind that while some cell wall components, such as chitin or β-1,3 glucan, appear to be highly conserved in structure and composition, chitin can adopt a number of different architectures (7) and glucans can have variable levels of branching (8). These differences may influence the way in which the molecules interact with human cells and immune receptors. Also, the structures of the O-linked and N-linked mannans of different Candida species, and of other fungi, differ in important ways that generate diversity in the biological response to these molecules. It is not possible to provide a comprehensive account of all the ways in which these purified wall components can be used to explore immunological phenomena. Therefore, we focus on some recent examples of the study of such interactions in the context of the uptake and interaction with macrophages (9).

2. Materials Sterilise all solutions when possible, otherwise autoclave bottles and deionised water used for reagent preparation. Solutions should be manipulated aseptically.

16

Inhibition of Phagocytosis by Cell Wall Components

249

2.1. Culture of Candida albicans

1. YEPD: 1% (w/v) yeast extract, 2% (w/v) mycological peptone, 2% (w/v) anhydrous glucose. Dissolve in deionised water and autoclaved to sterilise. For solid medium, add 2% (w/v) agar prior to autoclaving.

2.2. Chitin Extraction and Purification

1. 5% KOH (w/v) in deionised water. Store at room temperature (see Note 1). 2. 40% (v/v) H2O2: glacial acetic acid (1:1 v/v). Mix equal volumes of glacial acetic acid and 40% H2O2 solution (see Note 1). Since H2O2 spontaneously decomposes quickly at room temperature, prepare a fresh solution every time and discard the leftovers. 3. 95% Lactic acid (w/v) in deionised water (see Note 1). 4. 400 μg/mL chitin/chitosan (from crab shells, Sigma-Aldrich) (w/v) in deionised water. This solution can be kept at −20°C for up to 6 months. 5. 100 mM glycine–NaCl buffer. Dissolve 7.51 g glycine and 5.84 g NaCl in 900 mL deionised water, adjust pH to 3.2 with 0.1 M HCl. Make the solution up to 1 L with deionised water, and store at 4°C for up to 6 months. 6. 75 μg/mL Cibacron Brilliant Red 3B-A (also known as Reactive red 4, Sigma-Aldrich) (w/v) in 100 mM glycine– NaCl buffer. Store at 4°C for up to 2 months.

2.3. Extraction of N-Linked and O-Linked Mannans

Sterilise all solutions when possible, otherwise use autoclaved bottles and deionised water for reagent preparation. Solutions should be aseptically manipulated. 1. 100 mM NaOH (w/v) in deionised water. Store at room temperature (see Note 1). 2. 3 M NaOAc, pH 5.2. Dissolve 12.3 g NaOAc in 30 mL deionised water, adjust pH to 5.2 with 0.1 M NaOH. Make the solution up to 50 mL with deionised water and store at room temperature for up to 6 months. 3. Endoglycosidase H (Roche). 4. pH test strips (pH range 2–13). 5. 100 mM HCl (v/v) in deionised water. Store at room temperature (see Note 1).

2.4. Mannan Purification

Sterilise all solutions when possible, otherwise autoclave bottles and deionised water used for reagent preparation. Use aseptic technique throughout. 1. Exchange resin AG50W-X12 H+ 100–200 mesh size (BioRad). Step 1: Resuspend 25 g of resin in 250 mL 0.5 M NaOH and gently mix with a magnetic stirrer for 60 min at room

250

H.M. Mora-Montes et al.

temperature. Stop stirring and wait 5–10 min until the resin has totally sedimented. Step2: Pour off the liquid, add 250 mL deionised water, and stir for 60 min at room temperature. Again wait until the resin has sedimented. Step 3: Decant the liquid and reconvert to the H+ form by adding 250 mL 0.5 M HCl. Repeat stirring and pouring steps three times, add 500 mL deionised water, and repeat stirring and pouring steps one final time. Add 200 mL deionised water and store at 4°C for up to 1 year (see Notes 1 and 2). 2. Exchange resin AG 4-X4 100–200 mesh size (Bio-Rad). Resuspend 25 g resin in 250 mL 0.5 M NaOH to convert to the OH− form. Gently mix with a magnetic stirrer for 60 min at room temperature. Stop stirring and wait 5–10 min until the resin has totally sedimented. Pour off the liquid and add 500 mL deionised water. Repeat the stirring and pouring steps once more. Add 200 mL deionised water and store at 4°C for up to 1 year (see Note 1). 3. Poly-prep chromatography columns: 9 cm high, 2 mL bed volume (0.8 × 4 cm), 10 mL reservoir, with end cap and tip closure (Bio-Rad). 4. Chromatography column A: Add 1.25 mL AG 4-X4 resin to a poly-prep chromatography column. Wait until the resin has sedimented and carefully add 1.25 mL AG50W-X12 H+. Prepare just before use and do not use more than once (see Note 3). 5. Chromatography column B: Add 1.25 mL AG50W-X12 H+ resin to a poly-prep chromatography column. Wait until the resin has sedimented and carefully add 1.25 mL AG 4-X4 resin. Prepare just before use and do not utilise it more than once (see Note 3). 2.5. Assessing the Purity of Isolated Cell wall Oligosaccharides

1. 2 M Trifluoroacetic acid (v/v) in deionised water (see Note 1). 2. Carbohydrate analyzer system (Dionex), equipped with an ED50 electrochemical detector with gold electrode, a GS50 pump gradient, and a CarboPac PA200 analytical column (3 × 250 mm) with a CarboPac PA200 guard column (3 × 50 mm). 3. Extra pure 200 mM NaOH solution (w/v). De-gas deionised water with the help of sonication and vacuum: fill a container with 1 L deionised water, place it in a sonicator, and draw a vacuum for 1–10 min while sonicating the sample. Immediately transfer 1 L of de-gassed, deionised water into the eluent bottle of the carbohydrate analyzer system. Remove 10.5 mL and add 10.5 mL of NaOH, extra pure, 50% solution in water (Acros Organics) (see Notes 1 and 4). 4. Glucosamine stock solution: 1 mg/mL glucosamine in deionised water.

16

Inhibition of Phagocytosis by Cell Wall Components

251

5. Mannose stock solution: 1 mg/mL mannose in deionised water. 6. Pierce Coomassie Protein Assay Kit. 2.6. Culture of J774.1 Macrophages

1. J774.1 Murine macrophage cell line from European Collection of Cell Cultures. 2. Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with: 10% (v/v) foetal calf serum (FCS), 200 U/mL penicillin/streptomycin (pen/strep) antibiotics (Invitrogen Ltd, Paisley, UK) and 2 mM L-glutamine. 3. 12-well tissue culture plates.

2.7. Assessment of Uptake

1. 1× Phosphate buffer saline PBS. 2. Stainfast Cell Diff Kit (Laboratory Services). 3. Inverted microscope with 40× objective lens.

2.8. Assessment of Macrophage Killing by C. albicans

1. 1× PBS. 2. Trypan Blue solution (0.4%) (Sigma-Aldrich CHEMIE, Steinheim, Germany). 3. 3% Paraformaldehyde solution in 1× PBS (Thermo Scientific, Rockford, IL, USA). 4. Inverted microscope with 40× objective lens.

3. Methods 3.1. Culture of C. albicans for Extraction of Cell wall Oligosaccharides

Work with sterile containers and solutions. 1. Inoculate one colony of C. albicans into 10 mL of YEPD broth in a 50 mL Falcon tube. Incubate overnight at 30°C with shaking at 200 rpm. 2. Take 3 mL of overnight culture and inoculate 100 mL of YEPD broth in a 500 mL flask. Incubate overnight using conditions described in Subheading 3.1, step 1. 3. Split the culture into four 50 mL Falcon tubes. Harvest cells by centrifuging at 2,500 × g for 5 min. 4. Washing and combining cells: discard the supernatants. Add 20 mL deionised water to two of the Falcon tubes and resuspend the cells. Add the resuspended cells to the tubes with the pelleted cells. Resuspend and centrifuge at 2,500 × g for 5 min. Discard supernatants. Add 20 mL deionised water to one Falcon tube, resuspend cells, and add them to the other tube with the pellet. Centrifuge at 2,500 × g for 5 min, discard the supernatant and add 5 mL deionised water. 5. Incubate cells for 1 h at 56°C (see Note 5). 6. Wash cells three times with 20 mL deionised water.

252

H.M. Mora-Montes et al.

3.2. Chitin Extraction and Purification (Adapted from ref. 10)

Work with sterile containers and solutions. 1. Resuspend cells obtained in Subheading 3.1, step 6 with 10 mL 5% KOH, and boil them at 100°C for 30 min. 2. Wash three times with 20 mL deionised water. 3. Resuspend in 10 mL 40% H 2O2: glacial acetic acid. Split suspension into two and transfer to 25 mL glass universal tubes with screw caps. Autoclave at 121°C for 15 min. 4. Centrifuge at full speed in a bench-top centrifuge, save pellet, and wash five times with 3 mL deionised water. 5. Resuspend pellet in 1 mL 5% KOH, boil at 100°C for 30 min and wash five times with 3 mL deionised water. 6. Repeat step 5 twice. Resuspend the pellet in 200–500 μl deionised water (see Note 6). 7. Assess chitin deacetylation using the method described by Muzarelli (11): generate a six point standard curve using twofold serial dilutions of chitosan standard (see Subheading 2.2, step 4) in 100 mM glycine–NaCl buffer, with the highest concentration at 400 μg/mL. Take 300 μl of each chitin/chitosan solutions or samples, add 5 μl of lactic acid solution and pipette up and down until the particles are completely dissolved. Add 3 mL Cibacron brilliant red 3B-A solution, mix well, and incubated 5 min at room temperature. Measure absorbance at 572 nm. From the calibration curve, extrapolate the chitosan concentration in the sample.

3.3. Extraction of N-Linked and O-Linked Mannans (Adapted from ref. 3)

Work with sterilised containers and solutions 1. Split cells obtained in Subheading 3.1, step 6 into two fractions. 2. For O-mannan extraction, resuspend half the cells in 15 mL 100 mM NaOH and incubate overnight at room temperature with gentle orbital or reciprocal shaking. 3. Centrifuge at 2,500 × g for 10 min. Harvest the supernatant and adjust pH to 7.0 with 100 mM HCl solution. Monitor pH by placing 20 μl on a pH test strip. Freeze–dry sample. 4. For N-mannan extraction, resuspend cells in 1 mL deionised water. Add 1 μl 3 M NaOAc, pH 5.2, and 5 μl endoglycosidase H (25 mU) per each 24 μl sample. Incubate overnight at 37°C. 5. Repeat step 3, adjusting pH with 100 mM NaOH solution.

3.4. Mannan Purification

Work with sterile containers and solutions when possible, and separately process N-linked and O-linked glycans. 1. Resuspend lyophilised mannan from Subheading 3.3, steps 3 and 5, each in 1 mL deionised water.

16

Inhibition of Phagocytosis by Cell Wall Components

253

2. Pass N-mannan sample through column A (see Subheading 2.4, step 4) and wash with 14 mL deionised water. 3. Collect all the eluted material in a single Falcon tube and freeze-dry. 4. Repeat steps 1–3. 5. Resuspend sample in 1 mL deionised water, pass it through column B (see Subheading 2.3) and wash with 14 mL deionised water. 6. Collect all the eluted material in a single Falcon tube and freeze-dry (see Note 7). 3.5. Assessing the Purity of Isolated Cell wall Oligosaccharides (Adapted from refs. 3 and 13)

1. Generate a standard curve with bovine serum albumin (range 1–25 μg/mL). 2. Place 50 μl of each sample (chitin, N-mannan, and O-mannan) in two wells of a 96-well plate and add 100 μl deionised water. Prepare a blank well containing 150 μl deionised water. Add 150 μl of the Coomassie Reagent. Mix well by pipetting up and down for 30 s. Incubate for 10 min at room temperature. 3. Measure the absorbance at 595 nm on a plate reader. Substract the background absorbance from the blank and extrapolate the protein concentration from a standard calibration curve previously generated in Subheading 3.5, step 1. If the protein concentration is lower than 1 μg/mL continue this protocol, otherwise see Notes 6 and 7. 4. Place 50–100 μl of each sample in a screw cap Eppendorf tube. 5. Add 700 μl 2 M trifluoroacetic acid and tightly close the cap, incubate 3 h at 100°C in a thermal block (see Note 1). 6. Remove tubes from the block. Set block temperature to 75–80°C (see Note 1). Wait 10–15 min for the tube temperature to cool down and carefully remove the cap. 7. Place tubes back into the block and incubate until the acid has completely evaporated (see Note 1). Add 1 mL deionised water and incubate in the block until the water has evaporated. Repeat twice. 8. Add 100 μl deionised water and use a 200 μl pipette tip to scratch the tube walls to remove the yellowish/brownish material. Mix well by pipetting up and down and incubate at room temperature for 10 min. Centrifuge at full speed for 10 min using a bench microfuge. Save the supernatant (Volume A) and store at −20°C until use. 9. Prepare a calibration curve for glucosamine quantification by adding 96 μl deionised water to 4 μl glucosamine stock solution. This will be the maximum standard concentration of 100 ng glucosamine. Use it to generate a six point standard curve by

254

H.M. Mora-Montes et al.

preparing twofold serial dilutions in deionised water. Take 20 μl (Volume B) of each sample and inject it to the carbohydrate analyzer system. Follow the same protocol to prepare a calibration curve for mannose quantification, using the mannose stock solution. 10. Elute samples with an isocratic gradient of 3.2 mM NaOH with a flux rate of 0.15 mL/min for 20 min. Wash column with 200 mM NaOH for 10 min with a flux rate of 0.8 mL/ min and equilibrate with 3.2 mM NaOH for 10 min using the same flux rate. Purified samples must display one sharp peak corresponding to glucosamine or mannose, for chitin or mannan preparation, respectively. If more than one peak is observed within the chromatogram see Notes 6 and 7. 11. Calculate the glucosamine and mannose concentrations as follows: Extrapolate the sugar concentration (Value B) from the calibration curves that were produced using an injected volume of 20 μl (Volume B). The sugar concentration in the hydrolysate (Value A) will be: (sugar concentration in injected volume (Value B) × total volume (Volume A))/aliquot volume (Volume B). 3.6. Preparation of J774.1 Macrophages

Work under aseptic conditions. Adapted from ref. 12. 1. Culture J774.1 macrophages in 75-cm2 tissue culture flasks containing supplemented DMEM (see Subheading 2.6, step 2) at 37°C and 5% CO2. For sub-culturing considerations, see Note 8. 2. Detach cell monolayer from the bottom of the flask by gently scraping using a cell scraper. 3. Pipette cell suspension into a 50 mL centrifuge tube and pellet cells by centrifuging at 1,000 × g for 5 min. 4. Remove supernatant and tap the bottom of the tube to disperse the cell pellet in the residual medium. Resuspend in 20 mL fresh supplemented DMEM, pre-warmed to 37°C. 5. Remove a 10 μl aliquot and determine the number of cells per millilitre using a haemocytometer. 6. Plate 5 × 105 macrophages in 1 mL supplemented DMEM into each well of a 12-well tissue culture plate and incubate overnight at 37°C and 5% CO2 (see Note 9).

3.7. Preparation of C. albicans

1. Inoculate a single colony of C. albicans into 5 mL of YEPD liquid medium (see Subheading 2.1) in a 20 mL universal tube. IMPORTANT: must be done under aseptic conditions. 2. Secure lid to remain slightly vented and incubate overnight at 30°C with shaking at 200 rpm.

16

3.8. Phagocytosis Assay

Inhibition of Phagocytosis by Cell Wall Components

255

1. Plate J774.1 cells on 12-well tissue culture plates as described in Subheading 3.6, step 1 and prepare C. albicans cells as described in Subheading 3.7 (see Note 10). 2. Prepare wells with J774.1 cells in duplicate or triplicate, according to parameters of the experiment. 3. Dilute the overnight C. albicans culture 1:100 for ease of counting. Determine cell concentration using a haemocytometer (see Note 11). 4. Add 5 × 105 C. albicans cells in medium to half of the wells containing J774.1 macrophages and 1.5 × 106 C. albicans cells in medium to the other half (see Note 12). 5. Co-culture cells for 1 or 3 h at 37°C and 5% CO2, depending on the application (see Note 13). 6. Wash wells twice with 1× PBS at room temperature to remove unbound C. albicans. 7. Gently shake off any excess PBS. 8. Stain cells using the Stainfast Cell Diff Kit system (see Note 14). 9. Wash off excess stain using 1× PBS. 10. Add 1 mL 1× PBS to each well before analysis of uptake to prevent samples drying out during microscopic examination. 11. Should stains leach over time, restain using solutions 2 and 3 of the Stainfast Cell diff Kit system.

3.9. Analysis of Uptake Assay (12)

1. After staining, analyse the following: (a) Percentage uptake— the number of macrophages in a randomly selected population of 100 macrophages that have phagocytosed 1 or more C. albicans cells, and (b) Phagocytic index—the total number of C. albicans cells in a population of 100 fungal cells that have been phagocytosed. 2. Phagocytosed C. albicans cells are defined as those which have been completely enveloped by the macrophage cell membrane (see Fig. 1, black arrow). 3. A C. albicans cell that is bound to the macrophage membrane, but has not been enveloped, is not deemed to be phagocytosed. 4. Count 100 macrophages in each well blinded. Count macrophages clockwise from the top left of the area to be counted. Include macrophages that have not ingested C. albicans and those that have. 5. Record the number of macrophages in the population that have ingested C. albicans and the number of ingested fungal cells. 6. Refrain from counting cells from the middle and edge of the wells.

256

H.M. Mora-Montes et al.

Fig. 1. Light microscopy of bone marrow-derived macrophage (BMDM) uptake of C. albicans. The black arrow indicates a C. albicans cell that has been complete enveloped by the macrophage cell membrane.

7. Percentage uptake (%) = # macrophages with ingested C. albicans/ total # macrophages × 100. 8. Phagocytic index = # ingested C. albicans/total # macrophages counted × 100. 3.10. Killing Assay

In this assay, the ability of hyphae of C. albicans to escape the macrophage is quantified (see (9)). 1. Follow steps 1–7 in Subheading 3.8. 2. Stain macrophage cells using 150 μl Trypan Blue per well. Incubate for 2 min at room temperature (see Note 15). 3. Wash off excess stain twice using 1× PBS. 4. Fix cells with 150 μl 3% paraformaldehyde solution for 3 min at room temperature. 5. Wash off 3% paraformaldehyde with 1× PBS. 6. Add 1 mL 1× PBS to each well before analysis of the number of macrophages killed by C. albicans to prevent sample from drying out during microscopic examination.

3.11. Analysis of Killing Assay

1. After staining, determine the number of macrophages in a population of 100 cells that have been killed by C. albicans. 2. Macrophages that are stained blue and contain C. albicans hyphal cells that pierce the macrophage membrane are defined as “killed” (Fig. 2).

16

Inhibition of Phagocytosis by Cell Wall Components

257

Fig. 2. Light microscopy of J774.1 macrophage killing by C. albicans. The black arrow indicates a J774.1 macrophage that has been perforated by a C. albicans hyphal cell. The macrophage has internalised Trypan Blue, an indicator of loss of cell viability.

3. Count 100 macrophages in each well blinded. Count macrophages clockwise from the top left of the area to be counted. Include stained and unstained macrophages. 4. Record the number of macrophages out of the population that have been stained blue. 5. Refrain from counting cells from the middle and edge of the wells. 6. Killed macrophages (%) = # Trypan Blue stained macrpohages/ total # macrophages.

4. Notes 1. Strong acid and bases can cause serious burns. Wear protective laboratory coat, gloves, and goggles to reduce injury chances. Perform preparation and manipulation of solutions within a fume hood. 2. The exchange resin Dowex® 50WX4 hydrogen form 100–200 mesh size may be used instead resin AG50W-X12 H+. 3. A common mistake during column preparation is the addition of 1.25 mL of each resin. Instead, add 1.5 mL of the first resin solution into the column, wait until it has sedimented and, if the upper limit of the resin has not reached the 1.25 mL mark, add more of the first resin solution until the mark is reached

258

H.M. Mora-Montes et al.

(use 500 μl aliquots with sedimentation steps in between). Follow the same strategy to add the second resin (its upper limit must reach the 2.5 mL mark). 4. If CO2 is present in the 200 mM NaOH solution, the resin within the CarboPac PA200 column will absorb it and produce sodium carbonate. Presence of carbonate will affect the sugar binding to the resin and therefore, the final retention times. In addition to de-gassing, to reduce the CO2 concentration within the 200 mM NaOH solution, use commercially available extra pure NaOH solutions instead of pellets (the latter contain a significant amount of carbonate).Try to minimise the contact of extra pure NaOH solution with atmospheric air, and do not agitate the solution too much. To take the aliquot from the extra pure solution, introduce the pipette only 2–3 cm and gently aspirate. Do not take it from the bottom because any carbonate present in the solution will tend to precipitate and accumulate in this area. Discard the extra pure NaOH solution when one-third of the original volume remains because this will be richer in carbonate. To dispense the extra pure NaOH solution in the water, introduce the pipette 2–3 cm and slowly release the base, avoiding the introduction of air bubbles. Tightly close the lid and shake well to obtain an even distribution of NaOH. 5. This step inactivates C. albicans to prevent the secretion or activity of enzymes that could modify mannan structures. Do not increase the temperature for heat killing; incubation at 56°C kills C. albicans without releasing intracellular content. Higher temperatures may lead to the contamination of mannan preparations with intracellular components. Steps 5 and 6 may be omitted for chitin extraction. 6. The protein concentration of the sample is determined in Subheading 3.5. If isolated chitin is still contaminated with protein and/or other polysaccharides, step 6 described in Subheading 3.2 should be performed again. 7. The protein concentration of the sample is determined in Subheading 3.5. If isolated mannans are still contaminated with protein and/or other polysaccharides, steps 5 and 6 described in Subheading 3.4 should be performed again. 8. J774.1 macrophages should be sub-cultured every 3–5 days at a dilution of 1:20. It is important to closely monitor the density of macrophages, as J774.1 macrophages will become activated if allowed to become too dense. 9. Using J774.1 macrophages after passage 24 is not recommended. This is due to decreased cell viability. 10. Macrophage density is important in this assay. If too sparse, the macrophages will not adhere to the plate; if too dense, the macrophages will not phagocytose.

16

Inhibition of Phagocytosis by Cell Wall Components

259

11. Overnight cultures of C. albicans will be very dense after incubation. To easily determine the number of fungal cells/ mL, a dilution factor of 1:100 is required prior to using a haemocytometer. After counting, this dilution factor must be accounted for, therefore remember to multiply by 100 the calculated number of cells per millilitre, to obtain the correct cell concentration in the yeast culture. 12. Adding C. albicans cells to J774.1 macrophages with the ratios 1:1 and 3:1 provides optimum densities to observe minimum and maximum phagocytosis. 13. Co-culturing C. albicans and J774.1 macrophages for 1 h allows for analysis of percentage uptake and phagocytic index only. It is insufficient time for significant hyphal morphogenesis to occur and perforate the macrophage cell membrane. Co-culture for 3 h is sufficient time for analysis of percentage uptake, phagocytic index, and percentage killing. 14. The Stainfast Cell Diff Kit is a three stage system. The first stage fixes cells. The second stage uses Modified Aqueous Eosin to stain the cytosol of J774.1 macrophages. The final stage uses Modified Aqueous Azure II as a nuclear stain. 15. Trypan Blue stains dead/dying cells. This arises because nonviable macrophages lose cell membrane integrity and are unable to exclude the stain.

Acknowledgements NARG acknowledges a Programme grant from the Wellcome Trust (08088). HMMM is supported by grant No. Repatriación 117063 from Consejo Nacional de Ciencia y Tecnología, México. References 1. Netea, M.G., Brown, G.D., Kullberg, B-J, Gow N.A.R. (2008). An integrated model of pattern recognition of Candida albicans in innate immunity. Nat Rev Microbiol 6, 67–78. 2. Netea M.G., Gow N.A.R., Munro C.A., Bates S., Collins C., Ferwerda G., Hobson R.P., Bertram G., Hughes H.B, Jansen T., Jacobs L., Buurman E.T., Gijzen K., Williams D.L., Torensma R., Van der Meer J.W.M., McKinnon A., Odds F.C., Brown A.J.P., and Kullberg B.J. (2006). Immune sensing of Candida albicans: cooperative recognition of mannans and glucan by lectin and Toll-like receptors. J Clin Invest 6, 1642–1650. 3. Mora-Montes H.M., Bates S., Netea M.G., Díaz-Jiménez D.F., López-Romero E., Zinker

S., Ponce-Noyola P., Kullberg B.J., Brown A.J., Odds F.C., Flores-Carreón A., and Gow, N.A.R. (2007). Endoplasmic reticulum α-glycosidases of Candida albicans are required for N glycosylation, cell wall integrity, and normal host-fungus interaction. Eukaryot Cell 6, 2184–2193. 4. Cambi A., Netea M. G., Mora-Montes H. M., Gow N. A. R., Hato S. V., Lowman D. W., Kullberg B. J., Torensma R., Williams D. L., and Figdor, C. G. (2008). Dendritic cell interaction with Candida albicans critically depends on N-linked mannan. J Biol Chem 283, 20590–20599. 5. Mora-Montes, H.M., Bates S., Netea M.G., Castillo L., Brand A., Buurman E.T., Díaz-Jiménez

260

6.

7.

8.

9.

H.M. Mora-Montes et al. D. F., Kullberg B.J., Brown, A.J.P., Odds F.C., and Gow N.A.R. (2010). A multifunctional mannosyltransferase family in Candida albicans determines cell wall mannan structure ad hostfungus interactions. J Biol Chem 285, 12087–12095. Klis F.M., de Groot P. and Hellingwerf K. (2001). Molecular organisation of the cell wall of Candida albicans. Med Mycol 39 Suppl 1, 1–8. Lenardon M.D., Whitton R.K., Munro C.A., Marshall D. and Gow N.A.R. (2007). Individual chitin synthase enzymes synthesise microfibrils of differing structure in the fungal cell wall. Mol Microbiol 65, 1164–1173. Chen J. and Seviour R. (2007). Medicinal importance of fungal β-(1–3), (1–6) glucans. Mycol Res 111, 635–652. McKenzie C.G.J., Koser U., Bain J.M., MoraMontes H.M., Barker R.N., Gow N.A.R., and Erwig, L.P. (2010). Contribution of Candida

10.

11.

12.

13.

albicans cell wall components to recognition by and escape from murine macrophages. Infect Immun 78, 1650–1658. Gow N.A.R., Gooday G.W., Newsam R.J. and Gull, K.(1980). Ultrastructure of the septum in Candida albicans. Curr Microbiol 4, 357–359. Muzzarelli R.A. (1998). Colorimetric determination of chitosan. Anal Biochem 260, 255–257. McPhillips KA, and Erwig LP. (2009). Assessment of apoptotic cell phagocytosis by macrophages. Methods Mol Biol;559, 247–256. Plaine A., Walker L., Da Costa G., MoraMontes H. M., McKinnon A., Gow N. A. R., Gaillardin C., Munro C. A., and Richard, M. L. (2008). Functional analysis of Candida albicans GPI-anchored proteins: Roles in cell wall integrity and caspofungin sensitivity. Fungal Genet Biol 45, 1404–1414.

Chapter 17 Murine Bone Marrow-Derived Dendritic Cells and T-Cell Activation by Candida albicans Joanne Gibson, Neil A.R. Gow, and Simon Y.C. Wong Abstract Dendritic cells (DCs) detect and respond to microbes or their components by producing cytokines and other molecules that can activate the proliferation and differentiation pathways of T cells. Investigation of DC responses to pathogens would thus provide important insights into how T-cell responses most appropriate for the pathogen are induced. Here, we describe methods for the use of mixed leukocyte reactions, to determine the proliferative and cytokine responses of murine splenic T cells in response to co-culture with bone marrow-derived DCs stimulated with Candida albicans. Key words: Bone marrow-derived dendritic cells, T-cell polarisation, Proliferation assay, T-cell cytokine response

1. Introduction The study of the interactions between the innate and adaptive arms of the immune system can provide significant insights into the mechanisms for the generation of an appropriate and protective immune response to pathogenic challenge. In accordance with this, complete immunity to the majority of pathogenic organisms, including Candida albicans, often requires the activation of antigen-presenting cells and T cells of the innate and adaptive arms of the immune system, respectively (1). Dendritic cells (DCs) are the most effective of the antigen-presenting cells and hence serve as a critical link to T-cell activation. The ability to generate relatively large numbers of DCs from progenitor cells in the bone marrow and to maintain these cells in vitro has been critically important for defining roles of DCs in health and disease. Herein, we describe

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_17, © Springer Science+Business Media, LLC 2012

261

262

J. Gibson et al.

the culture of bone marrow-derived DCs or BMDCs (2, 3), and the isolation of splenic T cells. We then study the proliferation of and cytokine production by splenic T cells in response to co-culture with BMDCs primed with C. albicans. This co-culture condition is referred to as a mixed leukocyte reaction. Rapid expansion of pathogen-specific T cells is often triggered by pathogen-primed DCs. While the quantification of T-cell proliferation generally requires the pulsing of the T cells with [3H] thymidine (4, 5), we employ an alternative method which instead utilises carboxyfluorescein diacetate succinimidyl ester (CFDA-SE). This labelling method is safer because it eliminates the use of a radioactive substance. An additional advantage is that in conjunction with flow cytometry, CFDA-SE labelling facilitates the simultaneous quantification of T-cell proliferation and viability. In principle, CFDA-SE passively diffuses through cell membranes. It is retained in the cytoplasm of the labelled cells following the removal of acetates by intracellular esterases and covalent coupling of the succinimidyl group to intracellular molecules. The subsequent equal division of the highly fluorescent CFSE content between mother and daughter cells permits the tracking of up to seven cell divisions (6). Flow cytometry also provides additional insights into the proliferating T cells through the use of phenotyping antibodies such as anti-CD4 and anti-CD8 antibodies (7, 8). For example, CD8+ T cells have the ability to kill tumour cells and cells infected with intracellular pathogens. In contrast, most CD4+ T cells do not have cytolytic ability and their key role is to help to activate other immune cells. CD4+ T cells are divided into at least three helper subsets (Th1, Th2, and Th17) that secrete signature cytokines (gamma interferon, interleukin 4, and interleukin 17, respectively) to promote immune responses tailored made for the pathogen. We thus also described here a method to allow the quantification of T-cell cytokine secretion in response to C. albicans-primed BMDCs in a mixed leukocyte reaction.

2. Materials Prepare all solutions and store them at 4°C unless otherwise stated. All solutions, buffers, and media must be sterile and lipopolysaccharide (LPS)-free (and are commercially available). 2.1. C. albicans Culture

1. Yeast nitrogen base (YNB) glucose agar: Dissolve 3.75 g YNB, 11.2 g glucose, 11.2 g technical grade agar in distilled H2O and top it up to 560 mL with distilled H2O. Autoclave and pour immediately into sterile Petri dishes. 2. Sabouraud broth (1 L): Dissolve 10 g mycological peptone and 40 g glucose in 800 mL distilled H2O. Top up to 1 L with distilled H2O, autoclave and store at room temperature.

17

2.2. Dendritic Cell Culture

Dendritic Cell Mediated Activation of T Cells by C. albicans

263

1. C57BL/6 mice. 2. Scissors, forceps, 2 and 10 mL syringes, 25G needles. 3. R0, cell isolation medium: 500 mL RPMI 1640, 500 ml 50 mM 2-mercaptoethanol, 5 mL each of 5,000 IU/mL penicillin, 5 mg/mL streptomycin. 4. Phosphate-buffered saline (PBS), pH 7.2. 5. R10, cell culture media: 500 mL of R0, 55 mL foetal bovine serum (FBS) Ultra low IgG (GIBCO). Inactivate the FBS by incubating it in a 56°C water bath for 30 min prior to addition to R0. 6. 100 mm cell strainer, for use on a 50-mL Falcon tube. 7. 0.4% Trypan blue stain. 8. Recombinant granulocyte/macrophage colony-stimulating factor (GM-CSF) (R & D Systems). 9. Petri dishes, 100 × 15 mm.

2.3. Co-culture Plates

1. Sterile 48-well tissue culture plates, with low evaporation lid. 2. Plate coating antibody: Dilute sterile purified anti-CD3 (clone 145-2C11) antibody (BD Biosciences) to a concentration of 0.5 mg/mL in PBS, pH 7.2.

2.4. Depletion of Granulocytic, Gr-1 Positive, Cells

1. Purified sterile anti-Gr-1 (Ly-6C and Ly-6G) antibody (BD Biosciences). 2. Sheep anti-rat Dynabeads (Invitrogen). 3. 13 mL tubes for LS selection (see Subheading 2.5, item 5) or similar round bottom tubes. 4. Magnet: Dynal MPC-15.

2.5. Isolation of Splenic T Cells

1. 100 mm cell strainer, for use on a 50-mL Falcon tube. 2. Red blood cell lysing buffer (Sigma-Aldrich). 3. Pan T-cell selection kit II, solutions, column and magnet (Miltenyi Biotec). 4. Selection buffer containing PBS, pH 7.2, with 0.5% bovine serum albumin (BSA) and 2 mM EDTA: Dilute MACS BSA stock solution 1:20 with autoMACS rinsing solution. 5. LS selection column. 6. QuadroMACS Separator magnet.

2.6. Flow Cytometric Analysis

1. FACS wash: PBS, 2 nM sodium azide, 5% w/v BSA, and 5 mM EDTA. 2. FACS Fc receptor blocking solution (FACS block): To FACS wash, add 50 mL/mL rat serum and 8 mL/mL anti-CD16/ CD32 antibody.

264

J. Gibson et al.

3. Fluorochrome-conjugated antibodies with distinct spectral properties (BD Biosciences). For BMDC phenotyping, we used anti-CD11b.PerCP-Cy5.5 and anti-CD11c.PE antibodies. For T-cell phenotyping, we used an anti-CD3.PE-Cy7 antibody. 2.7. Mixed Leukocyte Reaction: Quantification of T-Cell Proliferation

1. CFDA-SE stock solution: Allow lyophilized CFDA-SE and high-quality dimethylsulfoxide (DMSO) to warm to room temperature. Dissolve 50 mg CFDA-SE in 18 mL DMSO. Solid CFDA-SE is stable for 6 months when stored at £−20°C, but the stock solution should be prepared just prior to use and protected from light. 2. Sterile PBS, pH 7.2. Store at room temperature. 3. Round bottom 96-well plate. 4. Antibodies: anti-CD3.PE-Cy7, anti-CD4.pacific blue, and anti-CD8.APC. 5. Propidium iodide (PI), 6 mM: Dilute the 1 mg/mL stock solution (Molecular Probes) 1:250 in FACS wash. 6. A flow cytometer with blue, violet, and red lasers, and filter sets corresponding to l = 530/30, 610/20 or 610, 780/60, 450/50, and 660/20 nm for the detection of the emission of CFSE, PI, anti-CD3.PE-Cy7, anti-CD4.pacific blue, and anti-CD8.APC antibodies, respectively.

3. Methods All procedures should be carried out using buffers and media maintained at 4°C, unless otherwise stated. Cells should also be stored on ice when necessary. 3.1. C. albicans Culture

1. Inoculate 10 mL autoclaved Sabouraud broth with a single colony, from streaked YNB glucose agar plates and incubate the culture overnight at 30°C with shaking at 200 rpm. 2. Transfer 1 mL of the overnight culture into 100 mL Sabouraud broth, at room temperature, and incubate for 4 h at 30°C with shaking at 200 rpm. 3. Pellet the cells by centrifugation at 2,000 × g for 5 min. Resuspend the cells in autoclaved PBS. Wash three times, using centrifugation, at room temperature for 5 min. 4. Take 10 mL of cells and dilute 1:100. Count the cells using a haemocytometer. Resuspend at 1 × 108 cells/mL in PBS before heat killing at 56°C for 1 h. Store at −20°C. 5. Prepare stock solutions of the heat killed C. albicans by diluting the cells to a density of 1 × 107 cells/mL in R0.

17

3.2. Dendritic Cell Culture

Dendritic Cell Mediated Activation of T Cells by C. albicans

265

1. On Day 0, collect the femurs and tibias from two C57BL/6 mice and place them on ice in 5 mL R0 (see Notes 1–3). 2. Place the bones in a Petri dish and aspirate the R0 before sterilising in 70% ethanol (5 mL) for 1 min. 3. Wash twice in PBS. Following the second wash, place a small volume of PBS in the Petri dish to prevent the bones from drying out. 4. Remove the tips of the bones, using sterilised scissors (see Note 4), and flush out the bone marrow into R0, using a 10-mL syringe with a 25-gauge needle. 5. Centrifuge at 4°C for 5 min at 500 × g. 6. Resuspend the cells in 10 mL R0 (see Notes 5 and 6) and remove any remaining cell clumps by pouring the cell suspension through the 100-mm sterile cell strainer. Remove 20 mL, mix 1:1 (v/v) with 0.4% Trypan blue stain solution and count the number of live cells. 7. Seed in 10-cm Petri dishes at 2 × 106 cells per plate in 10 mL pre-warmed R10, supplemented with GM-CSF (final concentration 20 ng/mL). Place in a humidified incubator at 37°C, 5% CO2 for 8 days. 8. On Day 2 of the culture, add 10 mL pre-warmed R10 supplemented with GM-CSF (see Note 7). On Days 5 and 7, exchange 10 mL of the media for fresh, pre-warmed, R10 supplemented with GM-CSF (see Note 8).

3.3. Co-culture Plates

1. Prepare the co-culture plate by adding 100 mL of the anti-CD3 plate coating antibody solution (see Note 9) to the first six or three wells of a 48-well plate for the quantification of T-cell proliferation (Subheading 3.7) and the quantification of cytokine production (Subheading 3.9), respectively. Incubate at 37°C for 2 h. 2. Wash the wells twice in sterile PBS and add 500 mL R10 into each well.

3.4. Depletion of Granulocytic (Gr-1+) Cells

1. On Day 8 of the BMDC culture, harvest the non-adherent cells in a Falcon tube and wash them once in R0. 2. Resuspend the cells at 1 × 107 cells per mL in R0 and incubate with 10 mg/mL anti-Gr-1 antibody (Ly-6C and Ly-6G) for 20 min, at 4°C (see Note 10). 3. Centrifuge at 4°C for 8 min at 500 × g. 4. Remove supernatant, resuspend the cells in the original volume of R0 with 100 mL/mL sheep anti-rat Dynabeads and incubate for 30 min at 4°C on a shaking/rotating incubator. 5. Triple the volume of R0, transfer to a 13 mL selection tube and apply a magnetic field using a Dynal magnet.

266

J. Gibson et al.

6. Collect the supernatant that is depleted of Gr-1+ cells, which are retained in the magnetic field. To maximise the number of cells recovered, resuspend the beads in the original volume of R0 and place on the magnetic field a second time and collect the enriched fraction. 7. Count the Gr-1-depleted cells and plate them at a density of 5 × 104 cells per well in 48-well plates. Add 500 mL pre-warmed R10 and place in a humidified incubator at 37°C, 5% CO2 (see Note 11). 8. Store the remaining cells on ice to perform phenotype analysis by flow cytometry (Subheading 3.6). 3.5. Isolation of Splenic T Cells

1. Harvest the spleens from the same mice used for BMDC culture, and place the spleens in approximately 5 mL of R0 (see Note 12). 2. Place the spleens in a 100-mm sterile cell strainer, on a 50-mL Falcon tube, and pipette a small volume of R0 onto the spleens. Using the plunger of a 2-mL syringe mechanically disrupt the spleen cells through the filter, with the addition of additional R0 when required. This will allow the collection a suspension of individual cells. 3. Centrifuge at 4°C for 5 min at 500 × g (see Note 13). 4. Resuspend the cells in 1 mL red blood cell lysis buffer per spleen and incubate at room temperature for 1 min with gentle agitation, which will lyse only the erythrocytes (see Note 14). 5. Add approx. 20 mL R0 and centrifuge at 4°C for 5 min at 500 × g. 6. Wash the cells once in 10 mL R0, using centrifugation at 4°C for 5 min at 500 × g and resuspend the cells in 30 mL R0. 7. Count the cells and resuspend in 40 mL per 1 × 107 total cells in the selection buffer and add 10 mL of the biotinylated antibody cocktail (from the pan T-cell selection kit II) per 1 × 107 total cells (see Note 15). 8. Incubate at 4°C for 10 min. 9. Add 30 mL of the selection buffer and 20 mL of the anti-biotin MicroBeads (from the pan T-cell selection kit II) per 1 × 107 total cells. 10. Incubate for a further 15 min, at 4°C. 11. Add 2 mL selection buffer per 1 × 107 cells and centrifuge at 4°C for 10 min at 500 × g. 12. During the centrifugation in step 11, prepare the LS column(s) by placing it in the QuatroMACS separator unit and rinsing with 3 mL selection buffer.

17

Dendritic Cell Mediated Activation of T Cells by C. albicans

267

13. Resuspend the cell pellet in 500 mL selection buffer per 1 × 108 of the total cells and apply 500 mL to each LS selection column (see Note 16). Collect the flow-through which contains the enriched T-cell fraction. 14. Allow the column reservoir to empty and wash the column three times with 3 mL selection buffer, combining with the effluent from step 13. 15. If using multiple LS columns pool all the effluents and centrifuge at 4°C for 5 min at 500 × g and resuspend in 10 mL selection buffer. 16. To quantify the proliferation of the T cells, proceed to Subheading 3.7 or to quantify the secretion of cytokines from splenic T cells proceed to Subheading 3.9. 17. Store the remaining cells on ice to perform a phenotype FACS (Subheading 3.6). 3.6. FACS Phenotype of the BMDC and T Cells

1. Collect the BMDCs pre- and post-Gr-1 depletion (Subheading 3.4, steps 1 and 6, respectively) and the splenic T cells pre- and post-CFDA-SE labelling (Subheading 3.5, step 17 and Subheading 3.7, step 5, respectively). 2. Pellet the cells, using centrifugation at 4°C for 5 min at 500 × g. 3. Resuspend the cells at approximately 1 × 106 cells/mL in FACS block. 4. Incubate on ice for 30 min. 5. Pipette 100 mL cell suspension into FACS tubes and add 1 mL of the appropriate antibody to each (see Table 1 and Note 17). 6. Incubate on ice for 30 min. 7. Wash the cells twice in 1 mL FACS Wash, using centrifugation of 4°C for 5 min at 500 × g. 8. On a cytometer, with the appropriate lasers and detection filters, run the unstained and single positive control tubes to adjust the forward and side scatter gates (FSC and SSC, respectively) and apply compensation between fluorochromes. 9. Run the phenotype FACS tubes (see Note 18).

3.7. Quantification of T-Cell Proliferation by Mixed Leukocyte Reaction

See Fig. 1a for a schematic representation of the principle components which are required for each well for the proliferation assay described below. 1. On Day 0, resuspend the splenic T cells (from Subheading 3.5, step 15) at 1 × 106 cells/mL in sterile pre-warmed PBS. Add 0.2 mL/mL CFDA-SE stock solution (final concentration of 1 mM CFDA-SE). 2. Incubate the cells for 8 min at 37°C in a light-protected environment.

268

J. Gibson et al.

Table 1 Flow cytometry tubes required for bone marrow-derived dendritic cell and splenic T-cell phenotyping FACS tube

Cells

CD11b

CD11c

CD3.PE-Cy7

1

BMDC

−

−

−

2

BMDC

+

−

−

3

BMDC

−

+

−

4

Pre-selection BMDC

+

+

−

5

Post-selection BMDC

+

+

−

6

Unlabelled T cells

−

−

−

7

CFSE-labelled T cells

−

−

−

8

Unlabelled T cells

−

−

+

9

CFSE-labelled T cells

−

−

+

The absence or the inclusion of the respective antibody in the FACS tubes are indicated as (−) or (+), respectively

a CFSE-labelled Gr-1-ve +/+/syngeneic T cells BMDCs

C. albicans

Label with αCD3, αCD4 and αCD8 antibodies

Collect cells

7 day incubation

Discrimination of dead cells with PI

Flow cytometric analysis

b Unlabelled Gr-1-ve +/- syngeneic +/BMDCs T cells

5 day incubation

C. albicans

Collect supernatant

ELISA / Multiplex determination of cytokine concentration

Fig. 1. Schematic representations of the work flow for the determination of T-cell proliferation and of the secretion of T-cell cytokines in response to stimulation with bone marrow-derived, granulocyte-depleted (i.e. Gr1-negative) dendritic cells (BMDCs) and C. albicans: (a) The proposed method to determine the proliferation of CFSE-labelled syngeneic T cells. T cells are identified by an antibody specific for the CD3 molecule. T cells are further subdivided into two major subsets by their expression of either the CD4 or CD8 molecule. Using flow cytometry, proliferating T-cell populations (CD3+CD4+ and CD3+CD8+ cells) are detected by a reduction in CFSE fluorescence intensity as compared to similarly CFSE-labelled, but non-proliferating T cells. (b) A method to determine the induction of the secretion of T-cell cytokines in response to stimulation with BMDCs and C. albicans.

17

Dendritic Cell Mediated Activation of T Cells by C. albicans

269

3. Increase the volume of the cells to 50 mL with R10 to stop the reaction and incubate on ice for 5 min. 4. Wash the cells twice in 10 mL R0, using centrifugation at 4°C for 5 min at 500 × g. 5. Count the CFSE-labelled cells and resuspend at 1 × 106 cells per mL in pre-warmed R10. In the same centrifugation step, also resuspend the unlabelled T cells at 1 × 106 cells per mL in pre-warmed R10. 6. Pipette 500 mL of the CFSE-labelled and -unlabelled T cells to the appropriate wells of the pre-prepared plate (from Subheading 3.4, step 7). Be sure to include control wells of unlabelled and labelled T cells (in the wells previously coated with the aCD3 antibody. see Subheading 3.3), BMDC and CFSE-labelled T cells without stimulation and test wells which include BMDC, CFSE-labelled T cells, and fungal cells (with the potential to test multiple fungal strains or morphologies). 7. Pipette 5 mL of the stock heat killed C. albicans cells (from Subheading 3.1, step 5) to the appropriate wells (at the final ratio of 1:10:1 BMDC:T cells:C. albicans). 8. Incubate the plate in a humidified incubator at 37°C, 5% CO2 for 7 days. 9. On Day 7 (see Note 19) of the mixed leukocyte reaction, centrifuge the plate at 4°C for 5 min at 500 × g. 10. Resuspend the cells in 200 mL FACS wash and transfer to a round bottom 96-well plate. Transfer the appropriate cells to FACS control wells, which must include unstained cells, single positive cells and fluorescence minus one control samples (see Table 2). 11. Centrifuge the cells at 4°C for 5 min at 500 × g and resuspend them in 100 mL FACS block for the control wells and 50 mL FACS block for the test wells. Incubate on ice for 30 min. 12. Prepare a stock solution of the antibodies for the test samples, which contains the three antibodies in FACS block at a dilution of 1 in 50 for CD3.PE-Cy7 and CD4.pacific blue and 1 in 100 for CD8.APC. This should be stored on ice in a light-protected environment until required. 13. Pipette 50 mL of the antibody stock solution into the test wells and pipette 0.5 or 1 mL of the appropriate antibodies into the control wells (for a final dilution of 1 in 200 and 1 in 100, respectively). 14. Incubate on ice for 30 min in a light-protected environment. 15. Wash the cells once in 200 mL FACS wash, using centrifugation at 4°C for 5 min at 500 × g.

270

J. Gibson et al.

Table 2 Flow cytometry tubes required for the determination of T-cell proliferation FACS tube

Cells

CD3.PE-Cy7

CD4.pacific blue

CD8.APC

PI

1

Unlabelled

−

−

−

−

2

CFSE-labelled

−

−

−

−

3

Unlabelled

+

−

−

−

4

Unlabelled

−

+

−

−

5

Unlabelled

−

−

+

−

6

Unlabelled

−

−

−

+

7

Unlabelled

+

+

+

+

8

CFSE-labelled

−

+

+

+

9

CFSE-labelled

+

−

+

+

10

CFSE-labelled

+

+

−

+

11

CFSE-labelled

+

+

+

−

12

CFSE-labelled

+

+

+

+

The absence or the inclusion of the respective antibody in the FACS tubes are indicated as (−) or (+), respectively

16. Transfer the cell suspension in 200 mL FACS wash to labelled FACS tubes. Add 200 mL of the 6 mM PI stock solution to the test wells and the appropriate control wells (for a final dilution of 1 in 500). 17. Incubate on ice for 5 min. 18. Run the samples on a flow cytometer with the appropriate lasers and detectors, using the unlabelled cells to set the FSC and SSC and the removal of the autofluorescent signals. Run the single positive cells to apply compensation between the fluorochromes. 19. Run the test samples recording 10,000 events which are CD3+PI−, which correspond to live T cells. 3.8. Analysis of T-Cell Proliferation

1. Using flow cytometry analysis software, gate 10,000 live T (CD3+PI−) cells (P1 in Fig. 2a, left). 2. Plot the (P1) gated population on a dot plot with the x-axis corresponding to pacific blue and the y-axis to APC to determine the level of CD4 and CD8 expression on live T cells, respectively (see Note 20). Sub-gate the population into CD3+CD4+ PI− (P2) and CD3+CD8+ PI− (P3) (Fig. 2a, right). 3. To obtain the number of cells in each of the two major T-cell subsets (CD4+ or CD8+) that have proliferated, sub-gate the

Fig. 2. Analysis of dendritic cell-mediated T-cell proliferation induced in response to C. albicans. Bone marrow-derived dendritic cells were incubated with CFSE-labelled splenic T cells with and without stimulation with C. albicans for 5 days. Following the co-culture, cells were labelled with anti-CD3.PE-Cy7, anti-CD4.pacific blue, anti-CD8.APC, and PI. Dead cells (PI+) were detected in the PE-TexasRed channel. Gates were set to count only live T cells, CD3+PI− events (P1). These events as represented by dots are shown in (a), left graph. The events were sub-gated to identify CD3+PI−CD4+ (P2 population) and CD3+PI−CD8+ (P3 population) and as shown in (a), right graph. Proliferating T-cell subpopulations (CD3+CD4+ and CD3+CD8+ cells) were detected by a reduction in CFSE fluorescence intensity as compared to similarly CFSE-labelled, but non-proliferating T cells. The percentage of the parental [(P2) and (P3)] populations which proliferated and thus shifted into the CFSEdim population (detected in the FITC channel) in response to no stimulation (b) compared to that induced with stimulation (c) can then be determined.

272

J. Gibson et al.

CFSEdim population within the P2 and P3 populations (Fig. 2b, c, left and right graphs, respectively). 4. Calculate the cell division index (CDI) for each T-cell subsets as modified from ref. (6) using the following formula: Percentage of P2 cells which are CFSEdim with stimulation (Fig. 2c). Percentage of P2 cells which are CFSEdim without stimulation (Fig. 2b). The above example is the CDI for the CD3+CD4+PI− population. 3.9. Quantification of Cytokine Production by Mixed Leukocyte Reaction

See Fig. 1b for a schematic representation of the principle components which are required for each well for the cytokine production assay described below. 1. At Day 0, resuspend the splenic T cells (from Subheading 3.5, step 15) at 1 × 106 cells/mL in pre-warmed R10. Pipette 500 mL into the appropriate wells of the pre-prepared plate (from Subheading 3.4, step 7), for a final cell density of 5 × 105 cells per well. 2. Pipette 5 mL of the stock heat-killed C. albicans cells (from Subheading 3.1, step 5) into the appropriate wells (at a final ratio of 1:10:1, BMDC: T cells: C. albicans). Control wells contain T cells only, BMDCs only, BMDCs and T cells without stimulation, or BMDCs with fungal cells. In contrast, test wells contain all three components (i.e. BMDC, T cells, and fungal cells). Multiple fungal strains or morphologies can be tested simultaneously for their ability to prime BMDCs and activate T cells in similar mixed leukocyte reactions. 3. Incubate the plate in a humidified incubator at 37°C, 5% CO2 for 5 days (see Note 21). 4. On Day 5 of the mixed leukocyte reaction centrifuge the plate at 4°C for 5 min at 500 × g. 5. Collect the supernatant and store it at −20°C for future analysis using multiplex flow cytometry kits or enzyme linked immunosorbent assays.

4. Notes 1. Approximately 1 × 108 cells will be recovered from the femurs and tibias of two mice. 2. The collection of femurs and tibias does not require sterile conditions because of the subsequent ethanol sterilisation. However, we do sterilise the forceps and scissors in 70% ethanol prior to use. Using this method we have never experienced any contamination in our cultures.

17

Dendritic Cell Mediated Activation of T Cells by C. albicans

273

3. Pinning the limbs of the mice before the removal of the bones makes it easier to visualise the bone orientation. The ankle, knee, and hip joints should be removed to separate the bones and the flesh removed, for which abrasion with paper towels is sufficient. 4. The bone marrow can be seen as a red discolouration in the bones. Care should be taken to remove only the tips of the bones, which will result in the minimal loss of the marrow. 5. The cells are very sticky and therefore the potential for loss of cells is greatest at this point. When resuspending the cells, only pipette a small volume initially and continue slowly pipetting until the cells are suspended individually. 6. Red blood cell lysis can also be performed at this stage, using red blood cell lysing buffer, but we found that the presence of erythrocytes in the original culture did not affect the phenotype of our cells. 7. The cells are very sensitive to excess agitation and this will affect the phenotype of the cells generated. Therefore, one must be very gentle when moving the plate to prevent this. In addition, media should be slowly added to the plate in a drop-wise fashion at the edge of the plate, where the cells are less dense. 8. The media changes can also be performed on Days 3 and 6 but we found that the extra exchange generated the optimum phenotype for us. 9. To maintain the viability of the T cells that will be cultured in the absence of BMDCs, control wells require coating with aCD3 antibody. 10. To be certain that a sufficient number of cells are recovered following the selection steps, assume that 50% of the cells will be lost. 11. When few wells will be utilised for the culture, prevent evaporation of the culture media by filling the wells at the edges of the culture plate with R0 and use only the internal wells for samples. 12. Approximately 1 × 108 cells will be recovered from a single spleen. Therefore, scale up the subsequent methods as required. 13. The cell pellet is not very stable. Pour off the supernatants gently following each centrifugation step, to minimise the disruption of the pellet and the loss of cells. 14. Following the lysis of erythrocytes, the cell pellet in the following step will appear an off yellow/pale pink in colour, instead of red. If the lysis was not successful then repeat the lysis step. 15. Following the selection, T-cell recovery is approximately 10–15% of the total splenocytes. Therefore, always select an excess number of splenocytes to allow the completion of the experiment.

274

J. Gibson et al.

16. Each column can be used to select 1 × 108 labelled cells. 17. It is also optimal to confirm by flow cytometry that the BMDCs have maintained an immature phenotype (i.e. low expression of activation markers such as CD40, CD80, and CD86). 18. Following Gr-1 depletion, the BMDC population we generate is 75–90% CD11b+CD11c+, while the splenic T-cell population isolated is ³95% CD3+. 19. It is advisable to perform a time course experiment for the fungal species/strains to be tested. Include, for example, Days 3, 5, 7, and 10 to obtain the optimal time point for the induction of proliferation. 20. CD4 or CD8 subpopulations of T cells are typically analysed separately for proliferation and cytokine production to determine whether pathogen-DC interaction induces helper and/ or cytolytic T-cell responses. CDI > 2 is considered as a positive proliferative response. 21. If the concentration of cytokines is being determined using a multiplex assay kit, a small sample volume (£100 ml) of the supernatant can be collected at any time during the 5-day mixed leukocyte reaction.

Acknowledgements Joanne Gibson’s PhD studentship was sponsored by SUMMIT plc and BBSRC. We also thank Tenovus Scotland, University of Aberdeen (SW and JG) and the Wellcome Trust (Grant 08088) for their support in our research in this area. References 1. Montagnoli, C., Bacci, A., Bozza, S., Gaziano, R., Mosci, P., Sharpe, A.H., and Romani, L. (2002) B7/CD28-dependent CD4+CD25+ regulatory T cells are essential components of the memory-protective immunity to Candida albicans. J Immunol 169, 6298–6308. 2. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S., and Steinman, R.M. (1992) Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med 176, 1693–1702. 3. Lutz, M.B., Kukutsch, N., Ogilvie, A.L.J., Robner, S., Koch, F., Romani, N., and Schuler,

G. (1999) An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223, 77–92. 4. Pietrella, D., Bistoni, G., Corbucci, C., Perito, S., and Vecchiarelli, A. (2006) Candida albicans mannoprotein influences the biological function of dendritic cells. Cell Microbiol 8, 602–612. 5. d’Ostiani, C.F., Sero, G.D., Bacci, A., Montagnoli, C., Spreca, A., Mencacci, A., Ricciardi-Castagnoli, P., and Romani, L. (2000) Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans: Implications for initiation of T helper cell

17

Dendritic Cell Mediated Activation of T Cells by C. albicans

immunity in vitro and in vivo. J Exp Med 191, 1661–1674. 6. Mannering, S.I., Morris, J.S., Jensen, K.P., Purcell, A.W., Honeyman, M.C., van Endert, P.M., and Herrison, L.C. (2003) A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods 283, 173–183. 7. Marin, L., Minguela, A., Torìo, A., MoyaQuiles, M.R., Muro, M., Montes-Ares, O.,

275

Parrado, A., Álvarez-López, D.M.R., and Garcìa-Alonso, A.M. (2003) Flow cytometric quantification of apoptosis and proliferation in mixed lymphocyte culture. Cytometry A 51, 107–118. 8. Aranami, T., Iwabuchi, K., Onoé, K. (2002) Syngeneic mixed lymphocyte reaction (SMLR) with dendritic cells: direct visualisation of dividing T cell subsets in SMLR. Cell Immunol 217, 67–77.

Chapter 18 Phagocytosis and Intracellular Killing of Candida albicans by Murine Polymorphonuclear Neutrophils Alieke G. Vonk, Mihai G. Netea, and Bart Jan Kullberg Abstract Polymorphonuclear neutrophils (PMNs) are important phagocytes in the control of Candida infections. The phagocytic contribution of PMNs to host defence can by assessed by various methods, such as microbiological assays. However, assessment and definition of intracellular killing capacity can be a source of considerable confusion. A comparison of the growth of Candida in the presence of PMN with the growth of Candida in phagocyte-free suspensions may lead to an overestimation of killing capacity because PMNs can use both intracellular and extracellular killing mechanisms. Here, we describe the use of an adherent monolayer of exudate peritoneal PMNs that is used to differentiate between the process of phagocytosis and intracellular killing. Key words: Phagocytosis, Neutrophils, Candida albicans, Biological assay, In vitro

1. Introduction Antigen-presenting cells such as polymorphonuclear neutrophils (PMNs) constitute an essential component of both innate and adaptive cell-mediated immunity against Candida albicans infections (1, 2). One way to assess the contribution of PMNs to host defence is by means of a microbiological assay. A comparative study of several assays showed that the use of an adherent monolayer of murine exudate peritoneal PMNs is a robust method for distinguishing between the processes of phagocytosis and intracellular killing (3), thus avoiding misinterpretation. Firstly, granulocytes are able to kill Candida yeast both intracellularly (by phagolysosomal fusion) and extracellularly (4, 5), but this is often not taken into account in assays that simply compare the growth rate of C. albicans in the presence of phagocytes with the growth rate of Candida yeast in the absence of phagocytes (6–8). Secondly, such

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_18, © Springer Science+Business Media, LLC 2012

277

278

A.G. Vonk et al.

assays do not distinguish between ingestion and intracellular killing, where apparent differences in “killing” of Candida yeast may actually be due to differences in ongoing phagocytosis or varying phagocytosis efficiency. In addition, the definition of intracellular killing used warrants a cautious approach. Some reports express “killing” as (1 − (CFU after incubation in the presence of phagocytes/CFU of Candida cultured without phagocytes)) × 100 (8), where it may be more appropriate to describe this phenomenon as percentage growth inhibition rather than killing (6). We define the percentage intracellular killing of C. albicans as (1 − (CFU after incubation in the presence of phagocytes/numbers of CFU phagocytosed)) × 100 (2, 9). Furthermore, researchers should be aware that protocol-related issues that influence the outcome of killing assays include the types of mouse and Candida strains used, the choice of eliciting agent (PMNs elicited by the injection of proteose peptone displayed significantly enhanced candidacidal activity compared to those elicited by thioglycollate (10)) and the growth phase of the Candida suspension at the moment of PMN transfer. Here we describe a protocol that allows the unequivocal determination of phagocytosis and killing of C. albicans yeast in an adherent monolayer of murine exudate PMNs and we discuss the issues that can affect the results.

2. Materials 2.1. Preparation at Day = −2

1. Frozen C. albicans aliquot (strain ATCC 10261 MYA-3573 (UC820)). 2. Sabouraud agar Petri dish. 3. Sterile loop (10 μL). 4. Incubator at 37°C.

2.2. Preparation at Day = −1

1. Candida strain on the Sabouraud agar Petri dish. 2. 40 mL Sabouraud broth, prepared according to manufacturer’s prescription. 3. Incubator at 37°C. 4. Orbital shaker. 5. Proteose peptone 10% (Difco Laboratories), 1 mL/mouse. 6. Sterile ice-cold phosphate-buffered saline (PBS) containing 50 U/mL heparin (PBS-heparin), 4 mL/mouse. 7. Numbered sterile tubes (10 mL) for the collection of peritoneal exudates, 1 tube/mouse. 8. Sterile 1-mL syringe. 9. Sterile needles, 25 gauge (1/mouse).

18

279

1. Laminar flow cabinet. 2. Light microscope. 3. Bürker counting chamber. 4. Vortex. 5. Ice. 6. 1- and 0.5-mL pipettes with sterile tips. 7. 10 mL (excess) 0.1% Trypan Blue dye with 3 drops/ml Zapoglobin (TBZ). 8. 20 mL (excess) MEM: Modified eagle’s medium (Gibco Life technologies) supplemented with 0.2 mL gentamicin (1%), 0.2 mL glutamine (1%), and 0.2 mL pyruvate (1%). Filter the solution through a sterile 0.2-μm pore-size syringe filter. 9. Sterile syringes 10 mL (1/mouse). 10. Sterile needles 21 or lower gauge (1/mouse). 11. Sterile ice-cold PBS (4 mL/mouse). 12. Centrifuge at 4°C. 13. Inverted microscope. 14. 50 mL RPMIS: RPMI 1640 (Dutch Modification; ICN Biomedicals) supplemented with 0.5 mL gentamicin (1%), phagocytosis and killing

increasing number of Candida

2.3. On Day = 0 (see Notes 1 and 2; Fig. 1)

Phagocytosis and Intracellular Killing of C. albicans

0

phase:

2

lag

4

6

exponential

8

10

stationary

12

h

lysis

Fig. 1. Hypothetical growth rate of yeast in a closed liquid system. Candida has a doubling time of approximately 1 h. The arrow indicates the moment of monolayer wash in an ideal situation when Candida batch culture does not have to be diluted or undergo medium replacement. The dotted arrow indicates entrance into lag phase of growth after medium exchange/dilution. Gray areas indicate the best time period in which to assess intracellular killing.

280

A.G. Vonk et al.

0.5 mL glutamine (1%), 0.5 mL pyruvate (1%), and 2.6 mL fetal calf serum FCS (~5%). Filter the solution through a sterile 0.2-μm pore-size syringe filter. 15. Cytospin (Shandon) centrifuge with all accessories. 16. 5 mL 5% human serum albumin (HSA). 17. Glass slides (precleaned with 95% ethanol). 18. 10 mL (excess) Sabouraud broth supplemented with 0.1 mL gentamicin (1%), 0.1 mL glutamine (1%), and 0.1 mL pyruvate (1%) (SAB). Filter the solution through a sterile 0.2-μm pore-size syringe filter. 19. 10-mL glass tube containing 5 mL sterile PBS (see Note 3). 20. Sterile mouse serum, 130 μL (see Note 4). 21. Glass tube (5 or 10 mL) for opsonisation. 22. Incubator at 37°C with 5% CO2. 23. Sterile distilled water. 24. Sterile 96-well flat bottom plate per study group/mouse strain (Costar). 25. Numbered non-sterile 0.5-mL eppendorf tube to collect nonadherent monolayer cells (1/mouse). 26. Numbered sterile 1.5-mL eppendorf tube (for t = 15 min to collect uningested Candida) (1/mouse). 27. Numbered sterile 1.5-mL eppendorf tube containing 400 μL sterile ice-cold water (for t = 3 h to collect Candida yeast that were ingested but not killed) (1/mouse).

3. Methods Carry out all procedures at room temperature in the laminar flow cabinet. All centrifugation steps are performed with the brake turned on. 3.1. Preparation Prior to Assay

1. At Day = −2, scrape the surface of a C. albicans frozen aliquot with a 10 μL sterile loop and streak onto a Sabouraud agar Petri dish. 2. Incubate for 24 h at 37°C. 3. At Day = −1, suspend one to three C. albicans colonies in 40 mL of Sabouraud broth. 4. Incubate the C. albicans suspension for 24 h at 37°C in an orbital shaker (200 rpm).

3.2. Recruitment of Peritoneal PMNs

1. On Day = 0, inject each unaesthetetised mouse intraperitoneally with 1 mL proteose peptone (at 8.00 a.m.; see Table 1).

18

Phagocytosis and Intracellular Killing of C. albicans

Table 1 Time table phagocytosis and killing (day of assay)

8.00

PMN related inject i.p. proteose peptone

Candida Phagocytosis

prepare and put ready

Killing 2.00

perfrom peritoneal lavage

2.30

create final PMN concentration

2.45

start Candida opsonisation

3.00

add PMN to wells

3.15

create final opsonised Candida concentration

3.30

harvest non-adherent PMN

3.45

add opsonised start phagocytosis Candida

4.00

harvest uningested Candida (end phagocytosis)

4.30

plate uningested Candida

5.00

count non-adherent PMN BREAK

6.45

scrape wells (end killing)

continue scraping.... 7.45

plate well scrapings

start killing

281

282

A.G. Vonk et al.

2. After 4 h, sacrifice each mouse by cervical dislocation and rinse the peritoneal cavity of each mouse with 4 mL sterile ice-cold PBS-heparin and collect the peritoneal exudates in separate numbered sterile tubes on ice (see Note 5). 3. Centrifuge at 500 × g, 10 min, 4°C and remove supernatant. 4. Resuspend pellet in 1 mL ice-cold PBS. 5. Repeat step 3. 6. Resuspend pellet in 1 mL RPMIS. 7. Count a 1:50 dilution in TBZ with a Bürker counting chamber (see Note 6). 3.3. Suspension of PMNs (see Note 7)

1. Number the slides, place corresponding filters on top of each slide and pipette HSA around the hole in the filter, this wets the filter and allows more cells to reach the slide. 2. Place numbered slides, filters, and cytofunnels into the cytoclips. Ensure that each filter and slide pair are flush with each other and that the hole in the filter is correctly positioned so that cells can reach the slide. 3. Place the cytoclips into appropriate slots in the cytospin. 4. Load 50-μL sample of the PMN cell suspension into the appropriate cytofunnel and spin for 10 min at 500 rpm at high acceleration, remove slides and air dry at room temperature. Stain with Giemsa to assess % of PMNs. 5. Dilute to a final concentration of 5 × 106 PMN/mL RPMIS.

3.4. Opsonisation of Candida Cells

1. Take a 18-mL sample of the 40 mL C. albicans suspension and centrifuge at 1,500 × g for 5 min. 2. Resuspend in 5 mL PBS (~1 × 108 yeast/mL). 3. Count a 1:50 dilution in TBZ with a Bürker counting chamber (see Note 6). 4. Dilute to a final concentration of 1 × 105 C. albicans yeast/mL in 2.5 mL MEM. 5. Add 130 μL mouse serum (5%; see Note 8). 6. Opsonize for 30–45 min at room temperature while generating the monolayer of PMNs.

3.5. Phagocytosis and Killing Assay

1. Pipette 100 μL PMN suspension into a well in a 96-well plate (5 × 105 cells/well). 2. Incubate the plate for 30 min at 37°C in air and 5% CO2 to generate a monolayer. 3. Carefully aspirate supernatant and transfer to the numbered non-sterile 0.5-mL eppendorf tube (see Note 9). 4. Gently add 200 μL prewarmed MEM to remove non-adherent cells.

18

Phagocytosis and Intracellular Killing of C. albicans

283

5. Carefully aspirate supernatant and add to the corresponding numbered non-sterile 0.5-mL eppendorf tube containing the supernatant harvested in step 3 (see Note 9). 6. Place plates on an inverted microscope and confirm that the monolayer of PMNs is practically confluent. 7. Prepare a Candida cell sample for the growth control wells by taking a 0.5 mL aliquot of the opsonised Candida cell suspension and adding to 0.5 mL SAB (5 × 104 Candida yeast/mL MEM/SAB that contains 2.5% serum). 8. Prepare the Candida cell sample for phagocytosis by adding 2 mL MEM to the remaining 2 mL opsonised suspension (5 × 104 Candida yeast/mL MEM with 2.5% serum; see Note 10). 9. Pipette 200 μL Candida suspension into the wells containing PMN monolayers and to three empty growth control wells (Effector:Target ratio = approximately 30:1). 10. Incubate plate at 37°C, 5% CO2 for 15 min to allow phagocytosis (this is the start time for phagocytosis and killing). 11. Aspirate supernatant from each well without disturbing the monolayer, and place in correspondingly numbered sterile eppendorf tube (this is the endpoint of phagocytosis; see Note 11 and Table 1). 12. Wash monolayers gently with 200 μL prewarmed MEM, add to the correspondingly numbered eppendorf tube containing the washings from step 11 (now containing 400 μL). Store on ice. 13. Add 200 μL MEM/SAB to each well containing a PMN monolayer. 14. Incubate plate at 37°C, 5% CO2 for 3 h to allow killing. 15. Scrape the bottom of each well (monolayers and growth control wells) with a sterile pipette tip. Leave this tip behind in the well (this is the endpoint of killing; see Note 12). 16. Aspirate scrapings from each well using a new sterile pipette tip. Add scrapings to a corresponding numbered sterile 1.5mL eppendorf tube containing 400 μL ice-cold water and place on ice. Dispose of this pipette tip (see Note 13). 17. Add 200 μL ice-cold water to each well (monolayers and growth control wells). 18. Scrape the bottom of each well with the pipette tip that was left in place. 19. Aspirate the scrapings using a new sterile pipette tip and vigorous pipetting to wash any remaining cells from the bottom of the well.

284

A.G. Vonk et al.

20. Add scrapings to the eppendorf tubes already containing 600 μL ice-cold water and scrapings. 21. Repeat steps 17–20 (the eppendorf tube contains a final volume of 1 mL). 22. Perform 2 serial (1:10) dilutions on the well washings into new tubes. 23. Vortex all the samples and spread 100 μL of each onto numbered Sabouraud agar plates using a sterile Drigalski spatula (see Note 14). 24. Invert the plates and incubate at 37°C for 24–48 h. 25. Count colony forming units and carry out the following calculations: Phagocytosis The percentage of phagocytized microorganisms is defined as (1 − (number of uningested CFU/CFU at the start of incubation)) × 100. Killing The percentage of yeast killed by the phagocytes is defined as: (1 − (CFU after incubation in the presence of phagocytes/ numbers of CFU phagocytosed)) × 100.

4. Notes 1. The amounts of media provided are enough for the generation of 20 monolayers and 3 growth control wells. All other materials are provided per mouse. Three growth control wells are required to check for “stationary phase” (see Note 2). 2. Always perform growth curve analysis of the C. albicans strain under study to make sure cells are in stationary or lag phase (see Fig. 1) because doubling times may vary (11) and it cannot be assumed that phagocytosed yeast grow at the same rate as non-phagocytosed yeast. The assessment of killing in the exponential phase may yield false low results (cells may continue to grow intracellularly and overwhelm the PMN). The opposite holds true for killing assessment in the lysis phase, where Candida cells die anyway. Consequently, the timing of the monolayer wash (arrow in Fig. 1) should ideally coincide with the addition of a yeast suspension in stationary phase. Bear in mind that the initial Candida batch culture often needs to be diluted to the required concentration, which alters growth kinetics. Cells may enter lag phase, which is prolonged by transfer from rich to poor medium. However, lag phase can

18

Phagocytosis and Intracellular Killing of C. albicans

285

be viewed as a another form of zero growth, which does not distort killing numbers. Also, dilution or replacement of the medium may induce morphological changes. This may result in false low readings because yeast that multiply as pseudohyphae produce 1 CFU (in our hands, this occurred with RPMI). Thus, morphological changes are unwanted when the aim of the assay is to study the intracellular killing of yeast and not extracellular killing of (pseudo)hyphae. Therefore, growth curve analysis by plating serial dilutions needs to be undertaken prior to undertaking this assay and must be accompanied by microscopy to optimize the system for the Candida species and medium. Transfer of C. albicans ATCC 10261 (UC820) into MEM with or without 50% Sabouraud broth showed stationary growth at 37°C in the first 3–4 h after dilution without morphological changes. 3. Candida yeast do not adhere to glass tubes as readily as they do to plastic materials. 4. Fresh sterile mouse serum or a thawed aliquot that was stored at −80°C can be used to save time. Also, if pooled serum is collected and stored, the same stock is used in repeat experiments, which contributes to reproducibilty. To obtain sterile serum: Perform a sterile cardiac puncture of anesthetized mice after shaving and aseptically cleaning the skin of the pre-and parasternal areas. Pool blood of several mice into a sterile glass tube and allow it to coagulate at room temperature for 1 h. Detach the clot from the tube wall using a sterile pipette tip. Centrifuge at 2,250 × g for 10 min, aspirate the serum and centrifuge this at 15,000 × g for 5 min to remove all cells including platelets. Use serum from wild-type mice in all experimental steps that require addition of mouse serum to negate the effect of undetermined factors in serum. 5. To expose the peritoneal membrane, grasp the skin of the abdomen with two forceps and gently tear it, making sure not to tear the membrane. Now you have a clear view of the peritoneal cavity and the location of its organs. Inject the PBSheparin via a 25-gauge needle (orange) without puncturing the intestines. Use the forefinger and thumb to gently pin down the head with one hand and than grasp the base of the tail with the other hand. Shake the tail gently to dislodge cells in the abdominal cavity. Harvest the exudate with a 21-gauge needle (or a lower gauge number) inserted at the lower right side with the lumen directed towards the inside. To avoid the loss of lavage fluid, pull up the plunger of the syringe during needle insertion. Exert an outwardly directed force at the peritoneum via the needle to create space for suction. 6. To count the cell suspension, both hemacytometers and electronic cell counting devices can be used. The hemacytometer

286

A.G. Vonk et al.

has the added advantage of allowing cell viability determinations being made during counting. Count all cells within 25 smaller squares. Cells touching either the top or left sides of the squares are included in the number of cells per square (cells touching the right and lower boundaries are not counted). The 25 squares equal a volume of 25 × 1/5 mm × 1/5 mm × 1/10 mm = 0.1 mm3 = 0.1 μL when Newton’s rings are observed (an indication that the height of the chamber is 1/10 mm). Calculate the number of cells/mL: 0.1 μL × 10,000 (conversion rate to 1 mL) × 50 (dilution factor in TBZ). 7. Numbers of cells and the percentage of PMNs may differ depending on the mouse strain. Because of the tight experimental schedule, assess the percentage of PMNs in peritoneal exudates of the mouse strains on the day prior to the experiment. In our hands, analysis of the exudates of eight mice per mouse strain were reproducible. We accepted an average percentage of PMNs plus/minus 10 per cent per mouse strain. The average PMN percentage of a certain mouse strain was used to dilute each of the individual lavage fluids of that strain to a final concentration of 5 × 106 PMN (PMN only)/mL RPMIS. Resident peritoneal macrophages may contaminate the peritoneal lavage fluid obtained 4 h after injection of proteose peptone but have not been shown to be potent killers of C. albicans (3, 10). 8. The 2.5 mL of C. albicans suspension of 1 × 105/mL MEM contains 5% serum on the assumption that a higher percentage of serum would improve opsonisation. 9. Tilt the plate towards you while slowly aspirating the supernatant from the side of the well. Avoid touching the monolayer. The supernatant contains unadhered phagocytes that can prevent Candida cells reaching the monolayer of PMNs. Later, during the 3 h killing period (see Table 1), assess the number of non-adherent PMNs. Add 100 μL TBZ to the eppendorf containing the 300 μL supernatant/wash and count the PMNs in a Bürker counting chamber (see Note 6). The number of nonadherent PMNs can be determined as follows: cell count in TBZ × 10,000 × 0.4. The percentage of adherence is calculated as (1 − (number of non-adherent cells/5 × 105)) × 100. 10. The percentage of serum should not be higher than this because it may reduce monolayer adherence. 11. Determine the number of uningested Candida yeast during the 3 h killing period, after step 13 (see Table 1). The plating of serial dilutions of the uningested Candida yeast is given in step 22. 12. Leaving the pipette tips in the wells helps to identify completed samples.

18

Phagocytosis and Intracellular Killing of C. albicans

287

13. Distilled water is used to lyse PMNs and release ingested but viable Candida cells into suspension. This enables more precise quantification because cells are no longer clustered within phagocytic compartments. Additionally, lysis of PMNs stops the process of killing. 14. The same Drigalski spatula can be used to spread a sample from the highest dilution (least cells) to the lowest. References 1. Jensen J., Warner T., and Balish E. (1994) The role of phagocytic cells in resistance to disseminated candidiasis in granulocytopenic mice. J Infect Dis 170, 900–5. 2. Kullberg B.J., van ‘t Wout J.W., van Furth R. (1990) Role of granulocytes in increased host resistance to Candida albicans induced by recombinant interleukin-1. Infect Immun 58, 3319–24. 3. Vonk A.G., Wieland C.W., Netea M.G., and Kullberg B.J. (2002) Phagocytosis and intracellular killing of Candida albicans blastoconidia by neutrophils and macrophages: a comparison of different microbiological test systems. J Microbiol Methods 49, 55–62. 4. Cech P. and Lehrer R.I. (1984) Heterogeneity of human neutrophil phagolysosomes: functional consequences for candidacidal activity. Blood 64, 147–51. 5. Urban C.F., Reichard U., Brinkmann V., and Zychlinsky A. (2006) Neutrophil extracellular traps capture and kill Candida albicans yeast and hyphal forms. Cell Microbiol 4, 668–76. 6. Djeu J.Y., Blanchard D.K., Halkias D., and Friedman H. (1986) Growth inhibition of Candida albicans by human polymorphonuclear neutrophils: activation by interferon-

7.

8.

9.

10.

11.

gamma and tumor necrosis factor. J Immunol 137, 2980–4. Mencacci A., Cenci E., Del Sero G. et al. (1998) Defective co-stimulation and impaired Th1 development in tumor necrosis factor/ lymphotoxin-alpha double-deficient mice infected with Candida albicans. Int Immunol 10, 37–48. Schaffner A., Douglas H., and Braude A. (1982) Selective protection against conidia by mononuclear and against mycelia by polymorphonuclear phagocytes in resistance to Aspergillus. Observations on these two lines of defense in vivo and in vitro with human and mouse phagocytes. J Clin Invest 69, 617–31. Kullberg B.J., van ‘t Wout J.W., Hoogstraten C., and van Furth R. (1993) Recombinant interferon-gamma enhances resistance to acute disseminated Candida albicans infection in mice. J Infect Dis 168, 436–43. Ashman R.B. and Papadimitriou J.M. (1995) Production and function of cytokines in natural and acquired immunity to Candida albicans infection. Microbiol Rev 59, 646–72. Stöver, A.G., Witek-Janusek, L., and Mathewsa H.L. (1998) A method for flow cytometric analysis of Candida albicans DNA. J Microbiol Methods 33, 191–196.

Chapter 19 Human Oral Keratinocytes: A Model System to Analyze Host–Pathogen Interactions Torsten Wöllert, Christiane Rollenhagen, George M. Langford, and Paula Sundstrom Abstract Host–pathogen interactions are complex and dynamic processes that result in a variety of responses. The ability of the host to respond appropriately to the presence of a microbial agent defines the outcome of these interactions. Fungal infections are a problem of growing clinical importance and are responsible for serious health problems in multimorbid patients. Different model systems, including primary cells and cell lines derived from different tissues, are used to study several processes that contribute to the virulence of pathogenic fungi. In this chapter, we describe an in vitro assay to characterize the response of human oral keratinocytes (OKF6/TERT-2) to the presence of the human pathogenic fungus, Candida albicans. The dynamic cellular changes such as expression of differentiation markers can be monitored by epifluorescence deconvolution microscopy. Analyses of immunofluorescence data by linescan analysis and fluorescence intensity measurements are described to identify changes in protein expression levels. The use of this in vitro model system will also provide new information about host cell behavior and identify potential drug targets in the future. Key words: Keratinocytes, Candida albicans, Differentiation markers, Immunofluorescence, Linescan analysis, Fluorescence intensity

1. Introduction Candida albicans is an opportunistic fungal pathogen that is typically found on mucosal surfaces of healthy individuals, where it resides in equilibrium with the microbial flora and the host immune system (1). Rodent models have been commonly used to study mucosal host–Candida interactions, including Candida pathogenesis and immunity, and antifungal drug treatments (2, 3). For economical and ethical reasons, and because their host–Candida interactions are similar to humans, vertebrate models are excellent systems. Disadvantages of rodent systems are that rat and mouse

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_19, © Springer Science+Business Media, LLC 2012

289

290

T. Wöllert et al.

mucosal models, unlike humans, are not normally colonized with C. albicans, are costly and time-consuming, and minimal symptoms of disease may occur. Cell lines and organotypic model systems have also been used to study the contribution of individual factors thought to be important during the invasion by C. albicans of distinct human tissues (4, 5). Advantages over nonvertebrate model systems are the precise control of host and environment and the great potential for genetic studies, such as the generation and usage of knockout models. An additional benefit of cell biological applications for analyzing host–Candida interactions is the availability of advanced image analysis software. The software provides not only image acquisition and measurement tools but also automated control of the microscope and its attached components such as cameras, shutters, and epi-illumination optics. The software also contains applications for manipulating the size, scale, and contrast of single images or image sequences and provides further algorithmbased image processing. Image analysis software produces quantitative data based on the analysis of single images, time series, and multi-image stacks resulting in information about cell or particle movements, the cell cycle status, or the number of present cells in a cell culture vessel by counting the nuclei. Various PC-based software packages are available, e.g., MetaMorph (Molecular Devices), NIS elements (Nikon Instruments, Inc.), Volocity (Improvision, Inc.), CellTrak (MotionAnalysis Corp.), BD IPLab imaging (BD Biosciences), and ImageJ (National Institutes of Health). In this chapter, we use human oral keratinocytes (OKF6/ TERT-2) as an additional model system in which to study the basic cellular biology of C. albicans–host cell interactions (Fig. 1) (6). Prior to coculture with wild-type C. albicans, OKF6/TERT-2 cells that were grown in low-calcium conditions to ~30% confluence resemble keratinocytes in the intermediate layers of the stratified squamous epithelium that do not express late differentiation markers (7, 8). The assay described here combines cell culture and imaging techniques, such as wide-field epifluorescence deconvolution microscopy and linescan analysis, to monitor distinct differentiation states of OKF6/TERT-2 cells at defined time intervals in response to the presence of C. albicans (Fig. 2). Understanding the molecular mechanisms of the interaction between C. albicans and the host epithelium is important for designing new strategies to prevent spread of the organism that may lead to severe mucosal disease and increase the risk of systemic disease in compromised hosts. In vitro systems using cells that form the epithelial barrier to study C. albicans mutants are useful tools for deciphering the host–pathogen cross-talk that takes place on the wet mucosal surfaces of human hosts.

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

291

Fig. 1. Interaction of human oral keratinocytes with the pathogenic fungus Candida albicans. (a) Example of human oral keratinocytes (OKF6/TERT-2) that were grown at 30% confluence and stained for F-actin with 0.5 mM rhodamine/phalloidin. (a¢) Corresponding pseudo-colored image indicates relative intensity levels for F-actin as visualized in (a). (b) Fluorescence and (b¢) DIC images of hyphae-forming C. albicans (strain UnoPP-1) that were stained with Calcofluor white (CW) after coculture with human oral keratinocytes. (c) C. albicans hyphae associate with human oral keratinocytes. The boxed region is magnified in right panels to show the presence of an actin mantle around cell-associated hyphae. F-actin was stained with rhodamine/phalloidin and C. albicans with Calcofluor white (CW). Bars represent 20 mm.

2. Materials 2.1. Cell Culture

1. Human oral keratinocytes (OKF6/TERT-2) (Harvard Skin Disease Research Center & BWH/Partners) ((9); see Note 1). 2. Keratinocyte serum-free medium (K-SFM) (Invitrogen) supplemented with bovine pituitary extract (BPE) and 0.2 ng/mL epidermal growth factor (EGF). BPE and EGF are supplied with K-SFM. 3. Penicillin/streptomycin (100×).

292

T. Wöllert et al.

Fig. 2. Fluorescence images of expression levels of early and late differentiation markers in human oral keratinocytes after coculture with C. albicans. Human oral keratinocytes were cocultured with C. albicans for defined time intervals (0, 3, 6, 12, and 24 h) and processed for immunostaining and fluorescence deconvolution microscopy for each individual differentiation marker. The early differentiation markers (involucrin and keratin 19) were downregulated, while the late differentiation markers (SPRR3 and keratin 13) were upregulated in human oral keratinocytes after coculture with C. albicans. Bar represents 20 mm.

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

293

4. 1 M CaCl2 in molecular grade water and filter sterilized before storage at 4°C. 5. Sterile phosphate-buffered saline (PBS) (1×). 6. 0.05% Trypsin in ethylenediamine tetraacetic acid (EDTA) (see Note 2). 7. Freezing medium: 20% DMSO in 1 mL K-SFM. 8. 10-cm Cell culture dishes (Falcon). 9. 15-mL Tubes. 10. 0.22-mm PVDF syringe-driven filter unit (Millipore). 11. 60-mL Syringe. 2.2. C. albicans Culture

1. C. albicans strain UnoPP-1 (10). 2. Yeast nitrogen base (YNB) medium: Dissolve 1.7 g YNB (Difco), 5 g ammonium sulfate, 9 g glucose, 10 mL of 0.02% biotin in 1 L of distilled water and filter sterilize. 3. YNB plates: Dissolve all supplements for YNB medium (see above) except for biotin and 15 g agar in 1 L of distilled water and autoclaved. Cool the medium until it is hand-hot, add 10 mL of 0.02% biotin and pour plates.

2.3. Immunostaining Components

1. Paraformaldehyde: 4% Paraformaldehyde in PBS containing 4% sucrose, pH 7.3. Store at –20°C. 2. Ammonium chloride: 50 mM solution in aqua destillata. Store at 4°C. 3. Triton X-100: 2% stock solution in PBS. Store at 4°C. 4. Gelatin blocking buffer (Sigma-Aldrich): 2% stock solution in PBS. Store at –20°C. 5. PBS. Store at 4°C. 6. Polyvinyl alcohol-mounting medium with DABCO, antifading agent (Fluka). 7. Microscope slides (75 × 25 mm) and coverslips (11 × 11 mm).

2.4. Antigens and Conjugates

1. Anti-keratin 13 monoclonal antibody (Sigma-Aldrich), antiinvolucrin monoclonal antibody (US Biological), anti-SPRR3 polyclonal antibody (Alexis), and anti-keratin 19 polyclonal antibody (Abcam). 2. Goat anti-mouse IgG and goat anti-rabbit IgG labeled with Alexa Fluor 488 or Alexa Fluor 594 (Molecular Probes). 3. Rhodamine/phalloidin.

2.5. Immunofluorescence Deconvolution Microscopy

1. Zeiss Axioplan2 microscope equipped with a 40×/1.0 NA Plan Apo lens and a 63×/1.4 NA Plan Apo objective lens, and filter sets for FITC, TRITC, and DAPI fluorescence. 2. Orca-2 C4742-98 dual scan-cooled CCD camera (Hamamatsu Photonics).

294

T. Wöllert et al.

3. X-Cite120 light source for epifluorescence microscopy (EXFO America). 4. PC computer with fast processor and high random access memory (RAM). 5. MetaMorph image acquisition and analysis software (Molecular Devices). 2.6. Data Analysis

1. MetaMorph image acquisition and analysis software (Molecular Devices). 2. Microsoft Office Excel (Microsoft Corp.).

3. Methods 3.1. Cell Culture of OKF6/TERT-2 Keratinocytes

1. Combine the supplements (1.089 mL BPE and 0.2 ng/mL EGF) and 0.3 mM CaCl2 with the keratinocyte serum-free medium (K-SFM). Add 100 mg/ml penicillin/streptomycin from 100× stock solution. Filter sterilize the medium with a 0.22-mm PVDF syringe-driven filter unit and store at 4°C. 2. Maintain the oral mucosal cell line, OKF6/TERT-2 keratinocytes in K-SFM at 37°C in 5% CO2 in air. Before coculture with C. albicans, grow cells in 10-cm plastic cell culture dishes and feed every other day with 10 mL of K-SFM. 3. Passage the OKF6/TERT-2 keratinocytes when they reach ~30% confluence (~7–9 × 105 cells) with trypsin/EDTA. Remove the K-SFM from the cell culture dish and wash cells with 10 mL PBS. Add 2 mL trypsin/EDTA solution to the cells and incubate for 2–10 min at 37°C until the cells are rounded up and detached from the cell culture dish. Add 8 mL of K-SFM to the cells and transfer to a 15-mL centrifugation tube. Centrifuge at 850 rpm for 5 min in a clinical centrifuge. A 1:3 split (~1 × 105 cells) of the OKF6/TERT-2 cells will provide experimental cell cultures that will reach ~30% confluence after 2 days. 4. To cryopreserve OKF6/TERT-2 keratinocytes, prepare a cell solution of 2 × 105 mL and add a similar volume of freezing medium slowly in single drops. Add 1 mL of the freezing medium/cell solution to each cryovial. Freeze the cells at –80°C overnight, followed by long-term storage in liquid nitrogen.

3.2. Coculture of OKF6/ TERT-2 Keratinocytes with C. albicans

1. Inoculate C. albicans cultures into 10-mL YNB medium in an Erlenmeyer flask. 2. Incubate in a rotary shaker at 250 rpm at 30°C overnight (see Note 3).

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

295

3. Pellet the overnight culture of C. albicans in a tabletop centrifuge and resuspended in 10 mL PBS. Count the cells using a hemocytometer. 4. Replace the medium of the 10-cm cell culture dish containing ~30% confluent OKF6/TERT-2 keratinocytes with 10 mL fresh and prewarmed K-SFM. 5. Add 8.5 × 106 cells to one 10-cm cell culture dish at a final concentration of 8.5 × 105 mL−1. The yeast : OKF6/TERT-2 keratinocyte ratio should be about 0.3:1.0. 6. Incubate cell culture dishes for defined time intervals (e.g., 0, 3, 6, 12, and 24 h) at 37°C in 5% CO2 in air. 3.3. Immunostaining of OKF6/TERT-2 Keratinocytes

All steps are carried out at room temperature. 1. Prepare solutions of 0.2% Triton X-100 in PBS and 0.2% gelatin blocking buffer in PBS. 2. Prepare a 4% paraformaldehyde solution in PBS containing 4% sucrose. Heat ~80 mL PBS to a temperature of ~60°C in a 100-mL glass beaker and add paraformaldehyde. To dissolve paraformaldehyde completely, add a few drops of 0.8–1 N NaOH to the solution until it is clear. Correct the pH to 7.3 after the solution is cooled down. Add 4 g sucrose and PBS to a final volume of 100 mL and store aliquots at –20°C. 3. Remove coverslips with bound cells from the 10-cm cell culture dish after coculture with C. albicans and place into single wells of a 24-well plate. Wash in 500 mL PBS and fix for 20–30 min in 500 mL 4% paraformaldehyde solution containing 4% sucrose. 4. React free aldehydes with 500 mL ammonium chloride for 10 min. 5. Wash cells twice in 500 mL PBS and permeabilize with 500 mL 0.2% Triton X-100 for 5 min. 6. Wash cells twice in 500 mL PBS and block in 500 mL PBS containing 0.2% gelatin blocking buffer for 1 h. 7. Dilute primary antibodies [anti-keratin 13 (1:100), anti-involucrin (1:100), anti-SPRR3 (1:100), and anti-keratin 19 (1:100)] in 0.2% gelatin blocking buffer in PBS. Centrifuge for 2 min using a tabletop centrifuge (25,000 × g) (see Note 4). 8. Incubate fixed cells with primary antibodies for 1 h. 9. Dilute secondary antibodies to 1:300 in 0.2% gelatin blocking buffer in PBS. Centrifuge for 2 min using a tabletop centrifuge (25,000 × g). 10. Wash cells twice in 500 mL PBS containing 0.2% gelatin blocking buffer for 2 and 10 min. Incubate with appropriate fluorophore-conjugated secondary antibodies (goat anti-mouse or

296

T. Wöllert et al.

anti-rabbit Alexa Fluor 488 or Alexa Fluor 594) for at least 45 min. 11. In some experiments, stain the cell wall of C. albicans with Calcofluor white, and cells for F-actin with 0.5 mM rhodamine/phalloidin or DNA using 1 mg/mL 4¢,6-diamidino-2phenylindole (DAPI) (see Note 5). 12. Wash cells twice in 500 mL PBS containing 0.2% gelatin blocking buffer for 2 and 10 min. Wash twice more in 500 mL PBS. 13. Rinse coverslips in distilled water and mount upside down onto microscope glass slides using ~20 mL/coverslip polyvinyl alcohol mounting medium with DABCO. Dry coverslips overnight in the dark (see Note 6). 3.4. Immunofluorescence Deconvolution Microscopy

1. For epifluorescence microscopy, place a droplet of immersion oil on the bottom and the top of the microscope slide (see Notes 7–8). 2. Adjust the size and position of the field diaphragm to illuminate the area of interest only. Switch the light from the ocular to the charge-coupled device (CCD) camera with the beam splitter (see Note 9). 3. Optimize the camera conditions and exposure time. To obtain the pixel values, acquire a single image in the auto exposure mode and move the mouse pointer over the brightest specimen area and over the background. The pixel values are displayed on the status bar at the bottom of the screen (11, 12) (see Note 10). 4. If necessary, use pixel binning to increase the signal intensity (signal-to-noise ratio) of the specimen. This method combines the signal from multiple pixels, which results in shorter exposure times, an increased pixel size, and a decreased camera resolution. 5. Acquire single images at one optical section and expose with and optimized camera conditions. In addition, acquire a background (blurry or out-of-focus) image after defocusing the specimen. Save all images as 12 or 16 bit tif images. 6. Deconvolve a single focal plane using the “No Neighbors” command from the 2D Deconvolution option located in the Process menu (Fig. 3a). The No Neighbors approach performs image deconvolution by excluding out-of-focus information (Scaling Factor) contained in single or adjacent planes (see Note 11). The Auto Result Scale can be selected to automatically match the result scale with the scaling factor. The filter size, the scaling factor, and the result scale can be changed manually to modify the image deconvolution process. In addition, the background noise can be reduced with background noise

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

297

Fig. 3. Deconvolution of fluorescence images of human oral keratinocytes after staining with the early differentiation marker keratin 19. (a) Screen shot of the MetaMorph imaging software during online deconvolution using the No Neighbors method from the Process menu (black arrow). (b and c) Magnified images of those shown in (a) before (b) and after (c) using the No Neighbors deconvolution method. This method uses an unsharp mask operator to sharpen up a single image plane. (b¢) and (c¢) show enlargements of the boxed regions in (b) and (c). Bars represent 20 mm.

298

T. Wöllert et al.

suppression. An example of individual immunofluorescence images before and after No Neighbors 2D deconvolution are shown in Fig. 3b, c. Note the sharper image details in Fig. 3c compared to Fig. 3d. 3.5. Linescan Analysis and Fluorescence Intensity Measurements

1. Calibrate the pixel-to-distance conversion factor using a reference image (e.g., a calibrated stage micrometer) that has been acquired with the same objective lens used for image acquisition. Use the Calibrate Distance dialog box from the Measure menu to set up and change the calibration settings. 2. Perform a background subtraction from the source image prior to Linescan analysis. Select the Background and Shading correction command from the Process menu. Use the Subtract background function to subtract pixel intensities in a background image from pixel intensities of the corresponding positions in the source image (Fig. 4a, b). The output from this function is shown in a new window (Fig. 4c). The Background and Shading correction window from the Process menu is shown in Fig. 4d.

Fig. 4. Background subtraction as a method to separate image information from background intensities. (a) Fluorescence image (Source) of human oral keratinocytes that were stained for the early differentiation marker keratin 19 after coculture with C. albicans. (b) Pixel intensities from the background image (Background) are subtracted from pixel intensities of the corresponding positions in the original or source image (a) and is outputted to a new image (c, Result); a − b = c. (a¢, b¢, and c¢) show enlargements of the boxed regions in (a, b, and c). Bar represents 20 mm. (d) The Background and Shading correction window allows one to modify settings for background corrections.

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

299

Fig. 5. Fluorescence intensity measurements of immunofluorescence images by linescan analysis. (a) Fluorescence image after background subtraction shows human oral keratinocytes that were stained for the early differentiation marker keratin 19 after coculture with C. albicans. A one pixel width single line is placed randomly into a single cell followed by linescan analysis using the MetaMorph imaging software. Bar represents 20 mm. (b) The fluorescence intensity values along the selected line are displayed in the graph window. (c) Graph settings such as type and style can be modified by using the Graph settings window.

3. Save the data obtained from the background-subtracted pixel intensity measurements to the data log with the Open Data Log command from the Log menu. Configure the data (e.g., x, y, z values and pixel average) with the configuration list in the Configure Log dialog box. 4. To measure and graph pixel intensity values in a backgroundsubtracted image, draw a line for the linescan randomly into single cells using the Line Region Tool from the Toolbar (Fig. 5a) (13). Select the one pixel-width line with the mouse cursor to activate the region. Edit the position and the length of line by double clicking it in the image window (see Note 12). 5. The fluorescence intensities will be displayed in the graph window. The linescan graph can be printed and configured (e.g., graph type and style, line style, and line width) by choosing Print or Graph settings from the Pop-up menu (Fig. 5b, c). 6. Export data obtained from fluorescence intensity measurements into Excel for further analysis.

300

T. Wöllert et al.

4. Notes 1. Human oral keratinocytes (OKF6/TERT-2) can be obtained only from the Harvard Skin Disease Research Center & BWH/ Partners. 2. Prepare small aliquots of trypsin/EDTA to avoid activity loss by repeated thaw–freeze cycles. In the laminar flow hood, aliquot 12 mL trypsin/EDTA into 15-mL sterile centrifuge tubes. Store labeled aliquots at –20°C. 3. Liquid C. albicans cultures can be prepared either by inoculation from a glycerol stock stored at –80°C or from a single colony picked from an YNB plate. 4. Incubation of coverslips containing keratinocytes with primary and secondary antibodies can also be done in a humidified chamber. For this, coverslips are placed upside down onto 30–50 mL droplets of antibody solutions that are placed onto parafilm in a 15-cm plastic cell culture dish embedded with moisturized filter paper. 5. Because DAPI will pass through intact cell membranes it can be used to stain the DNA in live and fixed cells. 6. A wide variety of mounting media from different companies are available for fluorescence microscopy, e.g., MBL International (Woburn), Lab Vision (Freemont), Dako (Carpinteria), VECTASHIELD (Burlingame), and ProLong (Molecular Probes). Different mounting media are designed for mounting tissue and/or cells on a slide to retain fluorescence and antifading during prolonged storage. Some mounting media are not recommended for certain fluorophores (e.g., Cy2) and a plastic sealant should be used for permanently sealing of coverslips, e.g., Mowiol 4-88 (Polysciences, Inc.) or a polyvinyl alcohol (PVA)-mounting medium such as DABCO (Sigma-Aldrich). Nail polish is not suitable for sealing coverslips for fluorescence microscopy because the organic solvent (isopropyl alcohol) can affect the fluorescence of certain fluorophores (e.g., GFP). 7. To obtain high resolution images of fluorescent specimen, high NA (numerical aperture) oil immersion objective lenses (1.4NA or higher) are recommended. 8. Immersion oils should be used as recommended by the manufacturer. General purpose immersion oils can be used for different microscopic applications (e.g., brightfield, darkfield, phase, and fluorescence microscopy), while other types help to improve specifically signal-to-noise ratios in fluorescence microscopy. Different types of immersion oil should not be combined.

19

Measuring OKF6/TERT-2 Cell Responses to C. albicans

301

9. A CCD camera such as the Hamamatsu C4742-98-24NR (ORCAII) provides a low light level detection with high signal-to-noise ratio and high resolution (1,280 × 1,024 pixels). This camera is cooled to –50°C to reduce heat and hence image noise and can be used to generate multicolor images from specimens stained with multiple fluorescent dyes. 10. A too long exposure time will result in oversaturation of the camera, the specimen is photo-bleached or bleed through from another wavelength can occur. A too short exposure time will lower the signal-to-noise ratio. The ratio between the brightest specimen pixel value and the least bright background pixel value should be ~3:1. More detailed protocols can be found in (11, 12). 11. The simplest approach to deconvolve images is the No Neighbors method, which uses an unsharp mask operator to sharpen up a single image plane. Using this method a blurred (or out-of-focus) version of an image is subtracted from the image itself. The other commonly used deconvolution methods are Nearest Neighbor, Linear Methods, Statistical Image Restoration, and Blind Methods. There are two notable categories of algorithms used for 2D deconvolution: (1) deblurring algorithms and (2) image restoration algorithms. The No Neighbors and Nearest Neighbors methods are deblurring algorithms. 12. A maximum of 200 pixels can be scanned for areas that are wider than the one pixel width of the region line.

Acknowledgments We thank Mary C. Young for technical assistance. This work was supported by NSF grant MCB-0517303 (G.M.L.) and NIH grant DE011375 (P.S.). Paula Sundstrom is a Burroughs Wellcome Scholar in Molecular Pathogenic Mycology. References 1. Schulze, J., and Sonnenborn, U. (2009). Yeasts in the gut: from commensals to infectious agents. Dtsch Arztebl Intl 106, 837–842. 2. Samaranayake, Y.H., and Samaranayake, L.P. (2001). Experimental oral candidiasis in animal models. Clin Microbiol Rev 14 , 398–429. 3. Naglik, J.R., Fidel, P.L. Jr, and Odds, F.C. (2008). Animal models of mucosal Candida infection. FEMS Microbiol Lett 283, 129–139.

4. Dongari-Bagtzoglou, A., and Kashleva, H. (2006). Development of a novel three-dimensional in vitro model of oral Canidida infection. Microb Pathog 40, 271–278. 5. Park, H., Liu, Y., Solis, N., Spotkov, J., Hamaker, J., Blankenship, J.R., Yeaman, M.R., Mitchell, A.P., Liu, H., and Filler, S.G. (2009). Transcriptional responses of Candida albicans to epithelial and endothelial cells. Eukaryot Cell 8, 1498–1510.

302

T. Wöllert et al.

6. Rollenhagen, C., Wöllert, T., Langford, G.M., and Sundstrom, P. (2009). Stimulation of cell motility and expression of late markers of differentiation in human oral keratinocytes by Candida albicans. Cell Microbiol 11, 946–966. 7. Kartasova, T., van Muijen, G.N., van PeltHeerschap, H., and van de Putte, P. (1988). Novel protein in human epidermal keratinocytes: regulation of expression during differentiation. Mol Cell Biol 8, 2204–2210. 8. Jetten, A.M., George, M.A., Smits, H.L., and Vollberg, T.M. (1989). Keratin 13 expression is linked to squamous differentiation in rabbit tracheal epithelial cells and down-regulated by retinoic acid. Exp Cell Res 182, 622–634. 9. Dickson, M.A., Hahn, W.C., Ino, Y., Ronfard, V., Wu, J.Y., Weinberg, R.A., Louis, D.N., Li, F.P., and Rheinwald, J.G. (2000). Human keratinocytes that express hTERT and also

10.

11.

12.

13.

bypass a p16 (INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol 20, 1436–1447. Postlethwait, P., and Sundstrom, P. (1995). Genetic organization and mRNA expression of enolase genes of Candida albicans. J Bacteriol 177, 1772–1779. Langford, G.M. (2001). Video-enhanced microscopy for analysis of cytoskeleton structure and function. Methods Mol Biol 161, 31–43. Wöllert, T., and Langford, G.M. (2009). High resolution multimode light microscopy of cell migration: long-term imaging and analysis. Methods Mol Biol 586, 3–21. Komarova, Y., Lansbergen, G., Galjart, N., Grosveld, F., Borisy, G.G., and Akhmanova, A. (2005). EB1 and EB3 control CLIP dissociation from the ends of growing microtubules. Mol Biol Cell 16, 5334–5345.

Chapter 20 Simple Assays for Measuring Innate Interactions with Fungi Ann M. Kerrigan, Maria da Glória Teixeira de Sousa, and Gordon D. Brown Abstract In recent decades, there has been a steady rise in immunocompromised populations and consequently a dramatic increase in the clinical relevance of normally non-pathogenic and commensal fungi such as Aspergillus fumigatus and Candida albicans. Understanding how these fungi interact with the host immune system is important for the development of immunotherapeutic approaches. Here, we describe a number of methods which have been developed to investigate the interactions of fungi with host leukocytes in vitro, including measuring fungal binding and induction of cytokines, phagocytosis, the respiratory burst, and fungal killing. Key words: Fungi, Macrophages, Phagocytosis, Respiratory burst, Thioglycollate, Cytokine

1. Introduction The clinical relevance of fungal diseases has increased over the last few decades, primarily as a consequence of the dramatic rise in immunocompromised individuals that has occurred as a result of modern medical interventions, immunosuppressive therapies, and AIDS. It is therefore not surprising that efforts to understand the underlying mechanisms of anti fungal immunity have intensified, and led to an immense increase in our knowledge of this area. It has emerged that an innate immune response, relying primarily on neutrophils and macrophages, is sufficient for controlling infections by some fungal species. On the other hand, full protection against most fungi also requires an adaptive immune response that is initiated and directed by cells of the innate immune system (1). Fungi are detected by the innate immune system mainly through the recognition of fungal cell wall components by phagocytic cells. Fungal cell walls are rich in carbohydrate polymers which Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_20, © Springer Science+Business Media, LLC 2012

303

304

A.M. Kerrigan et al.

provide structural support for the organisms. The cell wall consists primarily of an inner network of β-glucans and chitin, covered by an outer layer of mannosylated proteins, but the specific composition of the cell wall varies between different fungal species and even between different morphological forms of the same species. Phagocytes and other innate cells express pattern recognition receptors (PRRs) which specifically detect and bind fungal components. Many PRRs involved in fungal detection have now been identified, but it must be highlighted that the interaction of intact fungi with host cells is complex and involves multiple PRRs. It should also be noted that some fungi can actively target permissive host receptors (on endothelial cells for example), thereby escaping recognition by phagocytes (2). Furthermore, certain fungal species can mask their cell wall-associated molecular patterns (3–6). Although our understanding of host–fungal interactions has increased tremendously, so too has our appreciation that these interactions are multifaceted, complex, and far from completely understood. In this chapter, we will describe some simple assays that can be used to examine interactions of fungi with host leukocytes. We will specifically focus on murine macrophages in these assays. Under normal circumstances, the number of macrophages present in the murine peritoneal cavity is insufficient for extensive in vitro studies. Injection of thioglycollate medium into the peritoneum of mice or rats induces localised sterile inflammation and subsequent recruitment of leukocytes in a characteristic pattern (7–9). This method is described in Subheading 3.2 and has been established as an effective approach to isolate peritoneal macrophages. These cells can be used to gain insight into the fungi (e.g. the use of cell wall mutants of a particular fungal species may provide relevant information about fungal components), or simply into whether a particular fungus elicits a particular host response. The experiment may also be designed to examine the mechanisms underlying host responses— mice which have genetic deficiencies in a specific factor, for example a cell surface receptor, can be useful in this context. In Subheading 3.2 we describe a simple fungal binding assay using fluorescently labelled particles and how to investigate the induction of cytokines. Subheading 3.3 describes a method which is used to determine whether thioglycollate-elicited macrophages mediate uptake of fungal particles. In Subheading 3.4, we describe an assay which enables the investigator to determine whether a respiratory burst occurs following incubation of thioglycollate-elicited macrophages with fungal particles. Finally, in Subheading 3.5, we describe a simple killing assay. Although our descriptions pertain to the use of thioglycollateelicited peritoneal macrophages, the researcher should note that these assays can be adapted for use with cell lines. Cell lines can be particularly useful, for example, to explore the potential of a receptor

20

Leukocyte Interactions with Fungi

305

to bind or induce cytokine production in response to a particular fungus by using cell lines transfected with the receptor of interest. Furthermore, the assays described here can also be adapted for use with other primary cells, for example thioglycollate-elicited neutrophils, alveolar macrophages and bone marrow-derived macrophages/dendritic cells. The choice of fungi or fungal particle will depend on the aims of the individual researcher. We have routinely used Candida albicans and zymosan, a commercially available β-glucan-rich particle prepared from Saccharomyces cerevisiae, during our investigations of the host cell surface receptor Dectin-1 (10). For the purposes of providing an example only, we have therefore included details on how to include such fungal particles in these assays.

2. Materials 2.1. Fluorescent Labelling of Fungal Particles

For the purposes of providing an example we will describe the labelling of C. albicans with Rhodamine Green-X (see Note 1). 1. C. albicans. 2. Yeast peptone dextrose (YPD): 1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose in distilled water. Autoclave at 121°C for 15 min. For solid medium, add 2% (w/v) agar to the medium prior to autoclaving. 3. Phosphate-buffered saline (PBS). 4. Rhodamine Green-X: 10 mg/mL stock solution in DMSO.

2.2. Induction of Sterile Peritonitis and Recovery of Peritoneal Cells

1. Specific pathogen-free mice (see Note 2), typically 6–8 weeks old, preferably C57BL/6 or BALB/c (see Note 3). 2. 4% Brewer modified thioglycollate medium: 4% (w/v) solution in distilled water. Boil solution to dissolve all solids and then autoclave to sterilise. Age the solution in a dark room for 3 months, if possible (see Note 4). Thereafter divide into aliquots and store at −20°C until use. 3. 70% ethanol in water. 4. Harvest medium: Sterile ice-cold 5 mM EDTA in PBS without calcium and magnesium. 5. RPMI10: RPMI-1640 medium supplemented with 10% heatinactivated foetal calf serum, 2 mM L-glutamine, 100 U/mL penicillin, and 0.1 mg/mL streptomycin. 6. Turk’s solution: 10 mg crystal violet powder, 3 mL glacial acetic acid. Make up volume to 100 mL with water. Store solution at room temperature for up to 1 year.

306

A.M. Kerrigan et al.

2.3. In Vitro Recognition and Cytokine Production Assays

1. Thioglycollate-elicited Subheading 2.2).

peritoneal

macrophages

(see

2. RPMI10 (see Subheading 2.2, step 5). 3. FITC-zymosan (see Note 5). 4. Carboxyfluorescein diacetate succinimidyl ester: 10 mM stock in DMSO. 5. 3% Triton X-100: 3% (v/v) Triton X-100 in distilled water. Store at room temperature. 6. Fluorometer with appropriate filter sets for exciting FITC and measuring the emitted fluorescence. FITC has excitation and emission spectrum peak wavelengths at approximately 494 and 519 nm, respectively (see Note 6).

2.4. In Vitro Phagocytosis Assays

1. Thioglycollate-elicited peritoneal macrophages (see Subheading 2.2). 2. RPMI10 (see Subheading 2.2, step 5). 3. Cytochalasin D: 5 mM stock solution in DMSO. 4. Lidocaine–EDTA solution: PBS containing 4 mg/mL lidocaine hydrochloride (final concentration), 10 mM EDTA, pH 8.0. Filter sterilise and store at 4°C. 5. FACS block: PBS containing 5% (v/v) heat-inactivated goat serum (see Note 7), 0.5% (w/v) BSA, 2 mM NaN3. Store at 4°C. 6. FACS wash: PBS containing 0.5% (w/v) BSA, 2 mM NaN3. Store at 4°C. 7. FITC-zymosan (see Note 5). 8. Anti-zymosan antibody and allopycocyanin (APC)-goat antirabbit IgG (see Note 8). 9. 2% formaldehyde solution: PBS containing 2% (v/v) formaldehyde (see Note 9).

2.5. In Vitro Respiratory Burst Assays

1. Thioglycollate-elicited peritoneal macrophages (see Subheading 2.2). 2. RPMI10 (see Subheading 2.2, step 5). 3. Dihydrorhodamine 123 (DHR123) 5 mM stock in DMSO. 4. Stop solution: PBS containing 1% (w/v) BSA. 5. Zymosan (see Note 5).

2.6. In Vitro Fungal Killing Assay

1. Live C. albicans culture in YPD broth (see Note 10). 2. Thioglycollate-elicited peritoneal macrophages (see Subheading 2.2). 3. RPMI10 (see Subheading 2.2, step 5). 4. Sterile water. 5. YPD agar plates (see Subheading 2.1, step 2).

20

Leukocyte Interactions with Fungi

307

3. Methods 3.1. Fluorescent Labelling of Fungal Particles

1. From appropriate stocks, streak C. albicans cells onto YPD agar plate using an inoculating loop. Incubate for 24 h at 37°C. 2. Inoculate 50 mL YPD broth with some colonies from plate and incubate for 16 h at 37°C with shaking at 200 rpm. 3. Centrifuge cells for 5 min at 600 × g. Resuspend fungal pellet in 10 mL PBS (room temperature). Perform this wash step at least three times. 4. Count cells using a haemocytometer. Adjust to a density of 3.2 × 106 yeast/mL in PBS. 5. Place cells into a 2 mL microfuge tube and add Rhodamine Green-X to a final concentration of 200 μg/mL. 6. Cover tube with foil and rotate gently for 30 min at room temperature. 7. Centrifuge cells for 5 min at 600 × g. Resuspend fungal pellet in 10 mL PBS (room temperature). Repeat this wash step at least ten times until free Rhodamine Green-X is removed and the supernatant becomes clear.

3.2. Induction of Sterile Peritonitis and Recovery of Elicited Macrophages

1. Day 0: Fill a 1 mL syringe with 4% Brewer thioglygollate medium. Attach 26-G needle and inject 1 mL of the solution into the peritoneal cavity. Allow inflammatory response to proceed for 4 days (see Note 11). 2. Day 4: Euthanize mice by CO2 asphyxiation or rapid cervical dislocation. Place mouse in tissue culture hood and perform all subsequent procedures using aseptic techniques (see Note 12). 3. Sterilise abdomen with 70% ethanol. 4. Make a skin incision of approximately 10 mm over the caudal half of the abdomen with sterile scissors. Expose the underlying abdominal wall by holding the two sides of the cut and gently but firmly pulling apart the skin. 5. Fill a 10-mL syringe with ice-cold sterile harvest medium. With the bevelled side of a 21-G needle facing inward, insert needle through peritoneal wall in lower abdominal area, preferably in a region where there is fat. Insert needle gently and not too deeply ensuring that no organs are perforated. Inject 10 mL of harvest medium into peritoneal cavity (see Note 13). Remove the needle. 6. Gently massage the peritoneum for 10 s. 7. Re-insert needle bevelled side facing inward into the peritoneal cavity and slowly withdraw peritoneal fluid. If 10 mL was injected one would expect to recover approximately 8 mL (see Note 14).

308

A.M. Kerrigan et al.

8. Remove needle from syringe and dispense fluid into a 50-mL conical tube. Store on ice until ready for next step (see Note 15). 9. Collect peritoneal cells by centrifugation for 10 min at 400 × g, and 4°C. Resuspend cell pellet in cold RPMI10 and count (see Note 16). 3.3. In Vitro Recognition and Cytokine Production Assays

1. Plate the peritoneal cells in 1 mL RPMI10 at a density of 2.5 × 105 cells per well in a 24-well tissue culture plate. Culture overnight in a humidified incubator at 37°C containing 5% CO2 (see Note 17). 2. The next day, place plates on ice and wash cells three times with ice-cold RPMI10 (see Note 18). Replace with 500/450/400 μL RPMI10 (see Note 19). 3. Specific blocking agents can be added at this point if desired, such that addition of 50 μL to the appropriate wells gives the desired final concentration. Incubate for 20 min on ice (see Note 20). 4. Resuspend FITC-zymosan in RPMI10 and add to cells such that addition of 50 μL to appropriate wells gives a ratio of 25 zymosan particles per cell (see Note 21). 5. Allow particles to bind for 30 min on ice (see Note 22). 6. Wash three times with RPMI10 to remove unbound particles. (For binding analysis only proceed to step 9 or, if cytokine analysis is required, proceed to step 7). 7. Replace medium with 1 mL RPMI10 and culture cells for a further 3 h at 37°C for analysis of production of early induced cytokines such as TNF, or for 18–24 h at 37°C for measurement of cytokines such as IL-12 and IL-10. 8. After incubation, harvest supernatants, divide into aliquots of 120 μL and store at −80°C until required for cytokine analysis. 9. Rinse untreated cells with PBS and add 1 mL of 10 μM CFSE. Incubate for 5 min at room temperature. Wash three times with ice-cold RPMI10 and proceed with lysis as for all other wells (see Note 23). 10. Lyse cells by adding 150 μL 3% Triton X-100, pH 7.5. Use rubber back of syringe plunger to detach cells and transfer 100 μL to black 96-well plates. 11. Using a fluorometer, set excitation at 490 nm and measure emission at 514 nm (see Note 24).

3.4. In Vitro Phagocytosis Assay

1. Isolate thioglycollate-elicited peritoneal macrophages (see Subheading 3.2 and Note 25). 2. The day before the assay, plate macrophages in 2 mL RPMI10 at 2.5 × 105 cells per well in six-well tissue culture plates.

20

Leukocyte Interactions with Fungi

309

Culture overnight in a humidified incubator at 37°C containing 5% CO2. 3. On the day of the assay, pre-treat macrophages with 10 μM Cytochalasin D to inhibit phagocytosis. Incubate for 40 min in a humidified incubator at 37°C containing 5% CO2 (see Note 26). 4. Wash cells three times with ice-cold RPMI10. 5. Place plates on ice and add FITC-zymosan particles in a final volume of 2 mL RPMI10 so that there are five particles per cell (see Note 27). Maintain 10 μM Cytochalsin D where required. Leave plates on ice and allow particles to settle. Bind for 1 h ensuring that plates are kept horizontal. 6. Wash cells three times with ice-cold RPMI10 to remove unbound particles. 7. Add 2 mL pre-warmed RPMI10 (maintaining Cytochalsin D where required) and incubate cells for 45 min in a humidified incubator at 37°C containing 5% CO2 (see Note 28). Transfer plates to ice and incubate with 1 mL lidocaine–EDTA for 10 min (see Note 29). 8. Detach cells by scraping gently with a cell lifter and transfer to a centrifuge tube. Centrifuge at 400 × g for 10 min at 4°C. 9. Resuspend pellet in 100 μL FACS block and transfer cells to a 96-well V-bottom plate for staining (see Note 30). 10. Incubate cells in FACS block for 30 min on ice. 11. Add primary zymosan opsonising antibody 1:1,000, diluted in FACS block and incubate for 1 h on ice. 12. Centrifuge samples at 4°C, 350 × g for 3 min. Remove supernatants by aspiration. Wash with 100 μL cold FACS wash. 13. Repeat wash step three times. 14. Resuspend cells in allopycocyanin (APC)-conjugated goat antirabbit IgG 1:200 (for detection of zymosan antibody), diluted in FACS block and incubate for 45 min on ice. 15. Wash cells three times as before. 16. Resuspend cells in FACS wash and add an equal volume of 2% formaldehyde to fix. 17. Analyse samples by flow cytometry to determine level of internalisation (Fig. 1). To determine zymosan internalisation, analysis is performed by gating on the FITC-positive cell population which will have bound and/or internalised zymosan particles. The percentage of internalisation is then determined by comparing the APC-negative (FITC+, APC−: particle internalised) and the APC-positive (FITC+, APC+: particle not internalised) cell populations.

310

A.M. Kerrigan et al.

Fig. 1. Schematic figure to demonstrate phagocytosis experiment and analysis. (a) FITC-zymosan is added to cells (cell line, transfected cell line, or primary cells) expressing a zymosan-binding receptor (it is crucial to minimise particle number and to synchronise phagocytosis, see Note 27). Zymosan will bind to cells but may or may not be internalised depending on the phagocytic potential of the receptor of interest. Both possible scenarios are depicted and both will result in cells being FL1 positive. To analyse internalisation, a zymosan-specific antibody is added, followed by an APC-conjugated secondary antibody. (b) Schematic figure of FACS analysis to determine whether internalisation has occurred. If zymosan has been internalised, antibodies will not bind and cells will remain FL1 positive only. If zymosan has bound to the cells but remains on the outside, the antibodies will bind and these cells will be FL1 and FL4 positive. The percentage of internalisation can be determined by comparing these populations to one another.

20

3.5. Measurement of Respiratory Burst

Leukocyte Interactions with Fungi

311

1. Isolate thioglycollate-elicited peritoneal macrophages (see Subheading 3.2 and see Note 31). 2. Resuspend cells at 2 × 106 cells in 500 μL RPMI10 in falcon tubes and place on ice. 3. Add blocking agent if required and incubate for 20 min on ice (see Note 20). 4. Add unlabelled zymosan to cells at a ratio of five particles per cell (see Note 32) and DHR123 at a final concentration of 1 μM (see Note 33). Maintain concentration of blocking agent if used. 5. Centrifuge samples at 350 × g for 5 min at 4°C. 6. Resuspend in the same media by briefly vortexing or pipetting. 7. Immediately transfer a 150 μL aliquot to a new tube containing 350 μL ice-cold Stop solution. This sample at time 0 will provide the baseline for analysis. 8. Place remaining sample in 37°C water bath. At 30 and 60 min (see Note 34), briefly resuspend samples by flicking tube or pipetting before taking 150 μL aliquots and adding to Stop solution. 9. Analyse samples by flow cytometry. First, run control cells with no particles to set the forward and side scatter gates at an appropriate level. Then assess FL-1 of whole population and determine mean fluorescence intensity (MFI). Next run stimulated cells and determine MFI. Subtract MFI of unstimulated samples and plot time on the x-axis and MFI on the y-axis to compare different experimental conditions.

3.6. Measurement of Macrophage Killing of Fungi

1. Isolate thioglycollate-elicited peritoneal macrophages (see Subheading 3.2). 2. The day before the assay, plate macrophages in 1 mL RPMI10 at 1 × 106 cells per well in 24-well tissue culture plates. Culture overnight in a humidified incubator at 37°C containing 5% CO2. 3. Prepare a live fungal culture of C. albicans (see Subheading 3.1, step 2). 4. On the day of assay, wash the C. albicans several times with PBS (see Subheading 3.1, step 3). 5. Resuspend in PBS and vortex well before counting. (Keep at 37°C until ready to use). 6. Wash macrophages three times with RPMI10 (pre-warmed to 37°C). 7. Add 1 mL pre-warmed RPMI10 to cells. Prepare X wells per time point to be assayed (see Note 35).

312

A.M. Kerrigan et al.

8. Add C. albicans at a ratio of 0.4 yeast per macrophage (see Note 36). 9. Incubate macrophages and fungal cells together for 30 min in a humidified incubator at 37°C containing 5% CO2. 10. Wash four times with pre-warmed RPMI10 to remove any unbound fungal cells. 11. For time 0 samples, lyse cells by adding 1 mL of sterile water to the well and scraping with a rubber syringe back. Add 100 μL of the lysis mixture to a 1.5-mL microtube containing 900 μL sterile water and vortex thoroughly. 12. For further time points (e.g. 1, 3, 12, and 24 h), replace 1 mL RPMI10 and incubate in a humidified incubator at 37°C containing 5% CO2. At appropriate times remove media and repeat the above step. 13. Make 1 in 10 serial dilutions (100 μL into 900 μL sterile water) to achieve quantifiable fungal colonies following incubation on agar plates as detailed below (see Note 37). 14. Plate 100 μL of dilutions on pre-warmed YPD agar plates (see Note 38). Once plated samples have been absorbed into agar, invert plates and incubate for 24–48 h at 37°C. 15. Count the colonies. Sample taken at time 0 will indicate how many live fungi were in the macrophages at start of the experiment and comparison of other counts will indicate the percentage killing.

4. Notes 1. Fungal particles and fluorescent labelling reagents of choice can be used. Cell densities and concentration of labelling reagent should be optimised accordingly. 2. It is of critical importance to use pathogen-free mice, as any ongoing infection will almost certainly have an effect on macrophage physiology. 3. The choice of strain is important as variations in thioglycollateelicited peritoneal leukocyte recruitment in four analysed strains have been reported (C57BL/6 > BALB/c > CD1 > 129Sv/J) (11). For C57BL/6 or BALB/c mice one can generally expect to harvest 1–2 × 107 peritoneal exudate cells of which 50–75% may be macrophages. 4. The yield of inflammatory cells will increase if the solution is aged in the dark at room temperature (typically for 3 months); this is believed to be due to an increase in advanced glycation end products (12).

20

Leukocyte Interactions with Fungi

313

5. Zymosan is used here as a specific example but fluorescently labelled fungal particles of choice can be used. It is not necessary to use fluorescently labelled particles if only cytokine production is to be analysed, or for the respiratory burst experiments. Zymosan preparations are commercially available and stocks should be prepared according to manufacturer’s instructions. As particle aggregation can occur during freezing, it is necessary to sonicate the particles (6 × 30 s, 150 W) after thawing to obtain as homogenous a suspension as possible. 6. Ensure fluorometer has appropriate filter sets for exciting the selected fluorophore. In combination with a light source, the excitation filter allows only light which excites the molecule of interest to reach the sample. The emission filter allows the fluorescence from the sample to pass to the detector and blocks stray light. 7. The type of serum contained in FACS block is selected specifically for the antibodies used in this assay. The species from which the serum is isolated should correspond to the species in which the secondary antibody is raised. 8. Antibodies chosen will depend on choice of fluorescent fungal particles. For FITC-zymosan, Zymosan A Bioparticles opsonising reagent (Invitrogen) is appropriate as a primary detection method. Where possible, fluorophores should be chosen which do not overlap in their spectral emissions. The examples provided here FITC (zymosan) and APC (goat anti-rabbit IgG) are detected in FL-1 and FL-4 channels, respectively, and their emission profiles are distinct. If, for example, FITC (zymosan) and Phycoerythrin (goat anti-rabbit IgG) were chosen, spectral overlap is likely to occur thereby necessitating extensive compensation and making it more difficult to measure the true fluorescence emitted by each. The researcher should also be aware that some commercially available fluorescent particles are likely to be too bright to allow compensation (as is the case with FITC-zymosan). 9. Caution: formaldehyde is a carcinogen and must be handled with care inside a fume hood. 10. C. albicans is used here as a specific example, but other live fungal cultures can be used as desired. 11. Thioglycollate-elicited neutrophils can be isolated by allowing the inflammatory response to proceed for a shorter time point (between 4 and 24 h). 12. Macrophages are highly sensitive to endotoxin and therefore care must be taken to ensure that all reagents are of high quality and endotoxin free. 13. Injection of a small amount of air can help to expand cavity thereby making it easier to manipulate needle for fluid recovery.

314

A.M. Kerrigan et al.

14. Recovered fluid should appear pale and cloudy. A pale pink to red colour indicates blood contamination but for this application a small number of red blood cells will not have adverse effects. However if in doubt, these samples should be discarded. 15. Peritoneal lavage can be repeated on an individual mouse to maximise recovery of cells. 16. Trypan blue exclusion can be used to determine cell viability. The use of Turk’s fluid allows the morphological identification of macrophages which display a unique “fried egg”-like appearance under these conditions (Fig. 2). However, this is sometimes difficult to see and it is also thought that not all macrophages take on such an appearance. It should therefore be used as a guide. Fluids from stimulated peritoneal cavities will vary and can range from 50 to 75% macrophages. 17. During overnight incubation, cells will adhere to plates in a monolayer, of which over 90% should be macrophages. 18. This protocol can be directly applied to use with transfected cell lines. 19. The volume replaced will depend on the specific sample—for untreated samples replace 500 μL, for samples to which fluorescently labelled particles are to be added replace 450 μL, and for samples to which specific blocking agents are to be added replace 400 μL. 20. For example, to block Dectin-1, add 100 μg/mL glucan phosphate. 21. FITC-zymosan is again used as an example here. This step should be optimised for chosen particles and initially a range of ratios should be tested. 22. This binding step is normally performed on ice but, in some cases, temperature can affect binding. Dectin-1 isoforms, for

Fig. 2. Turk’s staining of thioglycollate-elicited macrophages. Arrow indicates membrane that is sometimes difficult to identify—fine focusing can help with this.

20

Leukocyte Interactions with Fungi

315

example, display different zymosan-binding characteristics and a temperature of 37°C is required to ensure efficient binding by all isoforms (13). To ensure uniform distribution of particles, plates should be levelled using a spirit level. This is particularly important for incubations that occur on ice as plate can easily be tipped from the horizontal. 23. If cells from different sources are being compared, for example, from wild-type and knock-out mice, or differently transfected cell lines, it is necessary to account for any differences in cell density. CFSE is a colourless and non-fluorescent compound until its acetate groups are cleaved by intra-cellular esterases to yield highly fluorescent, amine-reactive 5(6)-carboxyfluorescein succinimidyl ester. When this amine-reactive compound reacts with amine-containing residues of intra-cellular proteins, the resulting dye–protein adducts are retained inside cells. CFSE is often used to follow cell division; however, in this case it is used to assess differences in cell numbers. 24. These wavelengths are appropriate for FITC and should be changed if required. To account for differences in cell numbers, the CFSE fluorescence reading for each sample type is used to normalise the other fluorescence readings. 25. This protocol can be directly applied to cell lines with some minor modifications regarding incubation times. It can also be adapted to use with thioglycollate-elicited neutrophils or purified peripheral blood neutrophils, but then the cells should be kept in suspension. 26. Cytochalasin D is a cell-permeable toxin that potently inhibits actin polymerisation and therefore blocks phagocytosis. It is included here as a negative control. Cytochalasin D is soluble in DMSO which can adversely affect many cell types, it is therefore advisable to make a 1,000× stock solution in DMSO and dilute the stock in RPMI10 for use. For example, to pre-treat macrophages with 10 μM Cytochalasin D, take 10 μL of a 10 mM stock solution of Cytochalasin D and add to a final volume of 10 mL RPMI10. Then add 2 mL of this media to appropriate wells. A DMSO only control at an equivalent concentration should also be included. 27. As for the recognition assay it is important to optimise the numbers of particles used. For this phagocytosis assay, it is of critical importance to minimise the ratio of particles to cells because if a cell internalises a number of particles but has one remaining on the cell surface, this will be interpreted as a cell which has not internalised anything. For FITC-zymosan binding and internalisation analysis, 1–5 particles per cell is appropriate. It is also important for the initial binding step to be carried out on ice in order to synchronise phagocytosis.

316

A.M. Kerrigan et al.

28. This incubation time will vary with different cell types used, but will typically be between 30 min and 2 h. For example if NIH3T3 fibroblasts are used, cells can be incubated for up to 2 h (these are non-phagocytic cells which, when transfected with an individual receptor, can be used to determine the phagocytic potential of that receptor). For RAW264.7 macrophages and primary macrophages, an incubation time of 30 min is sufficient. It is recommended that researchers initially determine the optimum time for their particular cell type. 29. EDTA functions as a Ca2+ chelator and therefore disrupts integrin-mediated cell attachments, which are Ca2+-dependent. Lidocaine is an anaesthetic that inhibits cell to substrate adhesion and spreading. Its mechanisms are not well understood, but it is used as an agent for cell harvesting and subculturing. 30. A 96-well plate format is ideal for examining multiple samples while using very small amounts of antibody. The use of a V-bottomed plate allows the clear visualisation of the cell pellet in the V, thereby making the process of washing easier and minimising cell loss. 31. This protocol can be directly applied to thioglycollate-elicited neutrophils and cell lines. 32. As before zymosan is used an example here and fungal particles of choice can be used. It is important that the ratio of particles to cells is optimised. 33. DHR123 is a non-fluorescent reactive oxygen species (ROS) indicator that is oxidised by H2O2, an end product of the respiratory burst, to rhodamine, which emits a bright fluorescent signal upon excitation by blue light. Cells loaded with DHR123 but not treated with any stimulus should be used to assess background levels of H2O2 production. 34. These time points are appropriate to monitor the respiratory burst from thioglycollate-elicited macrophages following zymosan stimulation. However, the kinetics of the respiratory burst response may vary significantly with the stimulus used and investigators should initially incorporate a broad time range as well as referring to the literature to determine suitable time points for their specific investigation. 35. Macrophage activating or inhibiting agents of interest can be included at this point, if required. Of particular relevance for fungal studies is interferon-γ, which activates macrophages and has been shown to enhance fungal killing in many instances. The investigator should use the literature to initially select starting concentrations and incubation times, but should optimise these parameters thereafter.

20

Leukocyte Interactions with Fungi

317

36. This step must be optimised for the specific particle and it is recommended that a range of ratios are tested. The addition of live C. albicans at a ratio of 0.4 yeast per macrophage is appropriate. 37. Change tips for each dilution to eliminate carryover of fungi. 38. This method is not appropriate to assess killing of filamentous fungi. There are, however, alternative approaches such as quantitative measurement of fungal ribosomal RNA after incubation of leukocytes with fungi. References 1. Hohl, T. M., Rivera, A., Lipuma, L., Gallegos, A., Shi, C., Mack, M., and Pamer, E. G. (2009) Inflammatory monocytes facilitate adaptive CD4 T cell responses during respiratory fungal infection, Cell Host Microbe 6, 470–481. 2. Brandhorst, T. T., Wuthrich, M., FinkelJimenez, B., Warner, T., and Klein, B. S. (2004) Exploiting type 3 complement receptor for TNFalpha suppression, immune evasion, and progressive pulmonary fungal infection, J Immunol 173, 7444–7453. 3. Zaragoza, O., Rodrigues, M. L., De Jesus, M., Frases, S., Dadachova, E., and Casadevall, A. (2009) The capsule of the fungal pathogen Cryptococcus neoformans, Adv Appl Microbiol 68, 133–216. 4. Rappleye, C. A., Eissenberg, L. G., and Goldman, W. E. (2007) Histoplasma capsulatum alpha-(1,3)-glucan blocks innate immune recognition by the beta-glucan receptor, Proc Natl Acad Sci USA 104, 1366–1370. 5. Aimanianda, V., Bayry, J., Bozza, S., Kniemeyer, O., Perruccio, K., Elluru, S. R., Clavaud, C., Paris, S., Brakhage, A. A., Kaveri, S. V., Romani, L., and Latge, J. P. (2009) Surface hydrophobin prevents immune recognition of airborne fungal spores, Nature 460, 1117–1121. 6. Gantner, B. N., Simmons, R. M., and Underhill, D. M. (2005) Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments, Embo J 24, 1277–1286.

7. Gallily, R., Warwick, A., and Bang, F. B. (1967) Ontogeny of macrophage resistance to mouse hepatitis in vivo and in vitro, J Exp Med 125, 537–548. 8. Gallily, R., and Feldman, M. (1967) The role of macrophages in the induction of antibody in x-irradiated animals, Immunology 12, 197–206. 9. Baron, E. J., and Proctor, R. A. (1982) Elicitation of peritoneal polymorphonuclear neutrophils from mice, J Immunol Methods 49, 305–313. 10. Taylor, P. R., Tsoni, S. V., Willment, J. A., Dennehy, K. M., Rosas, M., Findon, H., Haynes, K., Steele, C., Botto, M., Gordon, S., and Brown, G. D. (2007) Dectin-1 is required for beta-glucan recognition and control of fungal infection, Nat Immunol 8, 31–38. 11. White, P., Liebhaber, S. A., and Cooke, N. E. (2002) 129X1/SvJ mouse strain has a novel defect in inflammatory cell recruitment, J Immunol 168, 869–874. 12. Li, Y. M., Baviello, G., Vlassara, H., and Mitsuhashi, T. (1997) Glycation products in aged thioglycollate medium enhance the elicitation of peritoneal macrophages, J Immunol Methods 201, 183–188. 13. Heinsbroek, S. E., Taylor, P. R., Rosas, M., Willment, J. A., Williams, D. L., Gordon, S., and Brown, G. D. (2006) Expression of functionally different dectin-1 isoforms by murine macrophages, J Immunol 176, 5513–5518.

Chapter 21 Binding and Uptake of Candida albicans by Human Monocyte-Derived Dendritic Cells Annemiek B. van Spriel and Alessandra Cambi Abstract The innate immune response was once considered to be limited to basic and unspecific “ingest and kill” mechanisms that would provide the first anti-microbial defense before the specific humoral and cellular immune response was mounted. In the last decade, however, several families of pattern-recognition receptors (PRRs) have been identified that have substantially revolutionized our understanding of host-pathogen interactions, which turned out to be highly specific and dynamic. The central players in this process are the antigen-presenting dendritic cells (DCs), which express a variety of membrane-associated as well as cytosolic PRRs, each able to sense specific molecular patterns present at the surface of microorganisms and to transduce specific signals that activate the DCs. The present challenge is to dissect the complex interactions between the PRR repertoire of the host DCs and the invading pathogens. In this chapter, we describe a flow cytometry-based assay that allows the quantification of binding of the pathogenic fungus Candida albicans specifically by human monocyte-derived DCs. Furthermore, we provide a protocol to visualize PRRs that are involved in the uptake of C. albicans using fluorescently labeled antibodies and confocal microscopy. Both methods can be applied to determine binding and uptake of other pathogens by different types of immune cells. Key words: Fungal glycans, Candida albicans, Dendritic cell, Binding, Uptake, Pattern-recognition receptors, Glycosylation, Flow cytometry, Confocal microscopy

1. Introduction In healthy individuals, the innate immune system efficiently provides protection from the numerous fungal species that normally coexist with humans. Candida albicans is a commensal fungus that colonizes the skin and the mucosal surfaces of healthy individuals, without causing disease. However, when host defense mechanisms are compromised, as is the case for patients undergoing chemotherapy or organ transplantation, C. albicans can become the cause of life-threatening fungal infections (1).

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_21, © Springer Science+Business Media, LLC 2012

319

320

A.B. van Spriel and A. Cambi

Until recently, little was known about the mechanisms used by DCs, the major players in linking innate and acquired immunity, to recognize C. albicans as a pathogenic microorganism, or how this interaction triggered an inflammatory immune response. In the past decade, more insights have been gained into the specific recognition of various classes of microorganisms by the innate immune system, and in particular the important role of antigen-presenting DCs in fungal recognition (2–6). DCs sense invading pathogens through so-called pattern-recognition receptors (PRRs), which recognize conserved microbial chemical signatures generally referred to as pathogen-associated molecular patterns (PAMPs) (7). The cell wall of C. albicans is a well-defined architecture of several types of polysaccharide chains, including mannan, betaglucan, and chitin, which are arranged in different layers to confer rigidity and stability to the fungal surface (8, 9). Since the mannans are localized at the outermost layer, mannan detection represents one of the first steps in the recognition of C. albicans by the host innate immune cells. In addition, beta-glucan moieties, which can extend at specific sites through the mannan layer and reach the surface of the cell wall, also activate the immune system (10). The two major classes of PRRs on DCs that mediate fungal recognition are the Toll-like receptors (TLRs) (11) and the C-type lectin-like receptors (CLRs) (12). In particular, TLR2 senses phospholipomannan (13), while TLR4 recognizes O-linked mannans (14). The primary CLRs that recognize fungal polysaccharide structures are the beta-glucan receptor Dectin-1 (10) and the macrophage mannose receptor (MR) and the dendritic cell-specific ICAM-3 grabbing non-integrin (DC-SIGN) both recognizing mannan moieties (2, 5). Clearly, a well-orchestrated network of different PRRs mediates the interactions between C. albicans and the DCs. To dissect the specific contribution of each receptor, we have established a flow cytometry-based binding assay that enables determination of the percentage of DCs able to bind to C. albicans cells. The use of a variety of inhibitors allows the determination of the specific contribution of each PRR involved in this interaction. Furthermore, whereas the TLRs exclusively sense PAMPs, the CLRs are also known to mediate uptake (phagocytosis) of the pathogens into DCs. Using fluorescently conjugated antibodies against the CLRs of interest, intracellular vesicles containing ingested fungal particles (also known as phagosomes) can be specifically labeled for imaging by confocal microscopy. DCs reside mostly in the tissues, and the number of DCs circulating in the blood is therefore very limited. In contrast, monocytes, which are presumed to be precursors of DCs, are present in high numbers in peripheral blood. Therefore, we describe a method to induce differentiation of peripheral bloodderived monocytes into monocyte-derived DCs (mo-DCs) (15).

21 Candida albicans Interaction with Dendritic Cells

321

These mo-DCs represent a widely accepted and validated DC prototype that is currently used in anti-cancer clinical trials (16). In summary, we here present a general method for quantifying binding of C. albicans to mo-DCs by flow cytometry and an experimental procedure based on confocal microscopy to visualize the phagocytic receptors involved in C. albicans uptake. These protocols are not limited to the study of CandidamoDCs interactions and phagocytosis. The same general procedure can be used to analyze the interactions of many different immune cells with a variety of microorganisms.

2. Materials 2.1. Isolation of Peripheral Blood Mononuclear Cells from Buffy Coats

1. Buffy coat. 2. Lymphoprep. 3. Phosphate buffer saline (PBS): 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, and 1.47 mM KH2PO4 at pH 7.4. 4. Sodium citrate solution 45.5% (diluting solution). 5. Sodium citrate 45.5%/5 mL, BSA 10%/500 mL PBS (washing solution). 6. Bovine serum albumin fraction V (BSA) 10% in PBS. 7. 50-mL Tubes. 8. RPMI-1640.

2.2. Dendritic Cell Culture Medium

Store all RPMI-based medium at 4°C. 1. 75-cm2 Tissue culture flasks. 2. RPMI-1640. 3. Ultraglutamine 1. 4. Antibiotics-antimycotics (AA). 5. Fetal calf serum (FCS). 6. Human serum (HS). 7. Recombinant human interleukin-4 (IL-4). 8. Recombinant human granulocyte macrophage-stimulating factor (GM-CSF). 9. RPMI serum-free medium: add 2.5 mL AA and 5 mL Ultraglutamine to 500 mL RPMI-1640. 10. RPMI serum-containing medium: add 2.5 mL AA, 50 mL FCS, and 5 mL Ultraglutamine to 500 mL RPMI-1640. 11. Adherence medium: add 2.5 mL AA, 10 mL HS, and 5 mL Ultraglutamine to 500 mL RPMI-1640. 12. PBS.

322

A.B. van Spriel and A. Cambi

2.3. Dendritic Cell Phenotyping

1. V-bottom 96-well plate. 2. Antibodies (Fluorescein isothiocyanate (FITC)/Phycoerythrin (pe)-conjugated: CD14-PE), CD80-FITC, CD86-PE, CD83-PE, MHC-I-PE, MHC-II-FITC, DC-SIGN-FITC, and mannose receptor (MR)-FITC. 3. Bovine serum albumin (BSA).

2.4. Cell Labeling and Binding Assay

1. Candida albicans yeast cells. 2. Sabourad maltose broth: suspend 50 g in 1 L of distilled water. Mix well until completely dissolved. Dispense and autoclave at 121°C for 15 min. 3. Sabourad 4% glucose plates: suspend 5.0 g bactoneopeptone, 40 g glucose (or dextrose) and 19 g agar in 1 L of distilled water. Mix well until completely dissolved. Adjust pH to 5.6, heat to 100°C for 5 min, and pour into petri dishes (Ø 10 cm). 4. Fluorescein isothiocyanate (FITC) buffer: add 0.1 mg FITC powder to 1 mL 0.05 M carbonate-bicarbonate (NaHCO3/ Na2CO3) buffer and adjust pH to 9.5. 5. TSA buffer: 20 mM Tris pH 8.0, 150 mM NaCl, 1 mM CaCl2, 2 mM MgCl2, and 1% BSA in distilled water (store at 4°C for up to 2 weeks). 6. PBA buffer: 1% BSA and 0.05% NaN3 in PBS (store at 4°C for up to 4 weeks). 7. Allophycocyanine (APC)-conjugated anti-CD45RO. 8. Inhibitors: anti-CLR blocking antibody (90 μg/mL), mannose (450 μg/mL), mannan (450 μg/mL), glucan (450 μg/ mL), and EDTA (6 mM). 9. 1% Paraformaldehyde in PBS (freshly made).

2.5. Labeling of Proteins on CandidaBearing Phagosomes

1. Water-repelling DAKO pen. This pen contains a water-repellent and acetone- and alcohol-insoluble material that is not influenced by temperature. 2. Fibronectin (Stock of 1 mg/mL). 3. Round glass coverslips for light microscopy (Ø 12 mm). 4. Mowiol anti-fade medium. 5. Methanol (−20°C). 6. PBS with 3% BSA.

2.6. Devices

1. Light microscope. 2. Hemocytometer. 3. Static and shaking incubator (37°C, 5% CO2). 4. Flow cytometer.

21 Candida albicans Interaction with Dendritic Cells

323

5. Confocal laser scanning microscope equipped with a 405 diode, Argon (458, 477, 488, 514 nm), 543 HeNe, and 633 HeNe lasers.

3. Methods 3.1. Isolation of Peripheral Blood Mononuclear Cells

This method is based on Repnik et al. (15). 1. Transfer the buffy coat (35–40 mL) to a T75 culture flask. Add 140 mL diluting solution to it (approximate dilution 4.5×, final volume 180 mL). 2. Add 30 mL of the diluted buffy coat to a 50-mL tube. 3. Pipette slowly 10 mL Ficoll under the blood (see Notes 1 and 2). 4. Spin cells down at room temperature (RT) (suggested centrifugation program: acceleration time 240 s; running time 25 min at 800 × g; break time 5 min; break 0 min). 5. Using a 5-mL pipette, remove the interphase but do not take the erythrocytes. Pool 2 interphases in one 50-mL tube (3 tubes). 6. Add diluting solution to a total volume of 50 mL. 7. Spin cells down RT, 10 min, (900 × g). 8. Remove the supernatant and resuspend the pellet in washing solution in a 50-mL tube. 9. Spin cells down at 4°C, 5 min (900 × g). 10. Repeat step 9 until the supernatant is clear. 11. Pool cells in two 50-mL tubes and repeat wash steps until supernatant is clear again. 12. Pool cells in 50 mL and count the cells (the expected number ranges between 200 and 400 × 106 cells/mL). 13. Wash the pooled cells once with RPMI serum-free medium.

3.2. Monocyte-Derived Dendritic Cell Preparation

1. Resuspend PBMCs PBMC/mL).

in

adherence

medium

(1.25 × 107

2. Add 8 mL medium containing PBMCs in a 75-cm2 Costar tissue culture flask. 3. Adhere monocytes for 1 h at 37°C in 5% CO2. 4. Remove the medium (containing lymphocytes) from the adherent monocytes. 5. Add 6 mL PBS to the monocytes. 6. Tap flask on the edge border of a table to remove remaining lymphocytes.

324

A.B. van Spriel and A. Cambi

7. Remove the PBS and add 6 mL fresh PBS to the monocytes. 8. Repeat steps 7 and 8 for at least four times, until almost all loosely bound lymphocytes are removed from the flask after inspection by light microscopy. 9. Wash the adherent monocytes two times with 6 mL PBS. 10. Add 8 mL RPMI-1640 containing 10% FCS, IL-4 (300 U/ mL), and GM-CSF (450 U/mL) to the flask. 11. Culture monocytes at 37°C (5% CO2) for 3 days. 12. Add 4 mL RPMI-1640 containing 10% FCS, IL-4 (450 U/ mL), and GM-CSF (675 U/mL) to the flask (see Note 3). 13. Culture monocytes at 37°C in 5% CO2 for another 3 days (see Note 3). 14. Harvest immature monocyte-derived dendritic cells (mo-DC) that are in suspension by pipetting medium from flasks into 50-mL tubes. 15. Wash the bottom of the flask once with ice-cold PBS and add to previously collected medium (see Note 4). 16. Add 6 mL ice-cold PBS to the cells that are still attached to the bottom of the flask and store horizontally in fridge for 15 min. 17. Tap flask to loosen remaining cells (check this with the light microscope). 18. If the cells are not all loose, put the flask back in the fridge for an additional 15 min. 19. Add cell suspension to the previously collected medium and spin down at 900 × g for 5 min at 4°C. 20. Wash with PBS and resuspend mo-DC in PBA. 3.3. Phenotyping of Dendritic Cells

1. Dilute mo-DC to 3 × 106 cells/mL in PBA and keep them on ice. 2. Add 25 μL cells/well in a V-bottom 96-well plate (see Note 5). 3. Add 25 μL antibody (or isotype control)/well: CD14-PE, CD80-FITC, CD86-PE, CD83-PE, MHC-I-PE, MHC-IIFITC, DC-SIGN-FITC, and MR-FITC. All antibodies and isotype controls are diluted in PBA (final concentration depends on manufacturer’s instructions available on the data sheet, usually the range is between 0.5 and 5 μg/mL). 4. Incubate on ice for 20 min in the dark. 5. Add 125 μL PBA. 6. Centrifuge for 1 min 900 ´ g at 4°C. 7. Discard the supernatant by quickly turning the plate upside down above a sink and dry the plate by firmly pressing it onto filter paper. The cell pellet will not detach from the bottom of the wells.

21 Candida albicans Interaction with Dendritic Cells

325

Fig. 1. Phenotype of immature mo-DCs in flow cytometry. The standard phenotype of immature mo-DCs is established by flow cytometry after labeling of cell surface markers (gray histogram) with specific antibodies. Isotype controls (white histogram) should always be included. Importantly, while the expression levels of these markers can vary from donor to donor, it is important to note that immature mo-DCs must always have low expression levels of the maturation marker, CD83.

8. Resuspend cell pellet in 100 μL PBA for analysis by flow cytometry (see Note 6). A typical example of the optimal mo-DC immature phenotype analyzed by FACS is shown in Fig. 1. 3.4. Dendritic Cell Labeling for C. albicans Binding Assay

1. Wash mo-DCs (from Subheading 3.2, step 20) with PBA and dilute them to 3 × 106 cells/mL in PBA. 2. Incubate 3 × 106 DCs with anti-CD45-APC (1:200) in 50 μL PBA in a V-bottom 96-well plate for 20 min on ice in the dark. 3. Centrifuge 1 min 1,400 rpm at 4°C. 4. Wash twice with PBA. 5. Resuspend the pellet of CD45-APC-labeled mo-DCs in TSA buffer to a concentration of 5 × 106 cells/mL and keep them on ice (see Note 7).

3.5. Candida Albicans Culturing and Labeling

1. Pick a yeast colony from Sabourad glucose plate. 2. Culture in 5 mL Sabourad maltose broth overnight at 37°C while shaking at 200 rpm. 3. Centrifuge at 900 × g 5 min at room temperature (RT). 4. Wash three times in PBS. 5. Count yeast cells using a hemocytometer and dilute to 2 × 108 cells/mL with FITC buffer. 6. Incubate 20 min at RT in the dark.

326

A.B. van Spriel and A. Cambi

7. Wash with PBS. 8. Wash twice with TSA buffer. 9. Dilute to 50 × 106 yeast cells/mL TSA (see Note 8). 3.6. Binding Assay

1. Add 10 μL/well of CD45-APC-labeled mo-DCs (5 × 106 cells/ mL in TSA buffer) in a V-bottom 96-well plate at RT. 2. Add 10 μL/well of TSA or inhibitor (see Subheading 2) dissolved in TSA. Mix thoroughly by gently pipetting the cells up and down (see Note 9). 3. Incubate for 10 min in the dark at RT. 4. Add 10 μL/well of FITC-labeled Candida cells (50 × 106 yeast cells/mL TSA). Mix thoroughly by gentle pipetting, and incubate for 30 min at 37°C (see Note 10). 5. Add 100 μL/well of TSA to resuspend the samples for analysis by flow cytometry (see Note 11). 6. The amount of mo-DCs that bind to Candida particles is defined as the percentage of APC-labeled mo-DCs that are also positive for FITC with respect to the total APC-labeled mo-DC population (Fig. 2).

Fig. 2. How to determine the percentage of mo-DCs binding to C. albicans by flow cytometry. (a) Side scatter (SSC) and forward scatter (FSC) dot plots indicate the different populations of C. albicans cells (left panel) and immature mo-DCs (right panel). (b) The fluorescence intensity of FITC-labeled Candida and APC-labeled mo-DCs is shown in the dot plot quadrants: in 1, the signal of both unlabelled Candida and mo-DCs; in 2, the signal of FITC-labeled Candida; in 3, the signal of APC-labeled mo-DCs; and in 4, the signal of the APC-labeled mo-DCs that have bound FITC-labeled Candida. A region of interest (ROI) can be drawn in this plot to specify the cell population that will be further analyzed. (c) The histogram plots are generated from the ROI described in B. Therefore, they show the FITC signal deriving from the APC-labeled mo-DCs only. By setting a marker (M1) using APC-labeled DCs that have not interacted with Candida as negative control (left panel), the percentage of mo-Dcs that have bound FITC-labeled Candida can be determined (right panel).

21 Candida albicans Interaction with Dendritic Cells

3.7. Phagocytosis of C. albicans by mo-DCs and Labeling of Candida-Bearing Phagosomes

327

1. Take glass coverslips (Ø 12 mm) and draw a circle around the edge of the coverslip with a water-repellent Dako pen (see Note 12). Put each coverslip into a well in a 6-well plate. 2. Coat the coverslip by adding 500 μL fibronectin (50 μg/mL in PBS) in the middle and incubate for 1 h at 37°C. 3. Discard liquid by aspirating with a pipette and add 1 × 105 moDCs in 500 μL RPMI-1640 (without serum) to each coverslip. 4. Allow the mo-DCs to adhere for 30–60 min at 37°C. 5. Add 5 × 105 FITC-labeled Candida albicans resuspended in 500 μL TSA buffer (see Note 10). Add only 500 μL TSA buffer to the coverslip that will be used as negative control. 6. Incubate for 60 min at 37°C. 7. Discard unbound C. albicans by aspirating the liquid from the coverslips with a pipette. Wash the mo-DCs twice with 3 mL TSA buffer and twice with 3 mL PBS at RT. 8. Fix the samples with 1% paraformaldehyde in 500 μL PBS for 20 min at RT. 9. After washing with PBS, permeabilize cells by adding 500 μL ice-cold methanol for 5 min on ice (see Note 13). 10. Wash two times with PBS and block with PBS containing 3% BSA for 60 min at RT (see Note 14). 11. Discard the buffer and add 250 μL of the primary antibody (10 μg/mL in PBS containing 3% BSA) for 60 min RT (see Note 15). Add 250 μL of control isotype antibody (10 μg/mL in PBS containing 3% BSA) to the coverslip that will be used as negative control (see Subheading 3.7, step 5) for 60 min RT. 12. Discard the solution with the excess of antibody, wash twice with PBA, and add 250 μL of the isotype-specific flourescently labeled secondary antibody (10 μg/mL in PBA) for 60 min RT. 13. Discard the solution with the excess of antibody, wash twice in PBA. 14. Add 5 μL of Mowiol to the middle of a clean rectangular glass slide. 15. Discard the PBA from the round coverslip and put the coverslip upside down onto the slide allowing the Mowiol to spread in between the two glass surfaces. Avoid the formation of air bubbles (see Note 16). 16. Store the Mowiol mounted samples overnight at RT in the dark to allow Mowiol polymerization and proper sealing of the samples. 17. Store the samples at 4°C until inspection by confocal microscopy (Fig. 3).

328

A.B. van Spriel and A. Cambi

Fig. 3. Visualization of Candida-bearing phagosomes by confocal laser scanning microscopy. Upon co-incubation, mo-DCs phagocytose the C. albicans yeast cells. After fixation and permeabilization, Candida-bearing phagosomes can be stained to determine the presence of specific receptors. In this figure, two CLRs, MMR (red) and DC-SIGN (green), have been stained with fluorescent antibodies. Both receptors colocalize in the phagosomes containing C. albicans particles (blue), as indicated by the yellow color in the merged panel. In the lower left corner of the merged panel, the inset shows an enlarged phagosome as an example. The pictures were captured using sequential imaging on a confocal scanning laser microscope and represent one focal plane in the middle of the cells.

4. Notes 1. Ficoll solution must be at room temperature in order to get a good separation. The centrifugation step with Ficoll must also be done at room temperature. 2. When pipetting the Ficoll gradient, there are two ways to do it. Method 1: pipette the blood into a 50-mL tube and slowly add the Ficoll underneath the blood. When removing the pipette from the tube, you can keep your finger on the top to close off the system, or you can just slowly pull the pipette out while touching the side of the tube. Method 2: first, pipette the Ficoll

21 Candida albicans Interaction with Dendritic Cells

329

into a 50-mL tube and subsequently slowly add the blood on top of the Ficoll while tilting the tube sideways so that the blood streams gently along the side of the tube. Make sure not to mix the two solutions. 3. This step can also be performed after 2 days of culturing but, consequently, step 14 needs to be extended to 4 days because the differentiation of monocytes into immature mo-DCs always takes a total of 6 days. 4. The collected medium containing the harvested mo-DCs can be stored on ice or at 4°C while waiting for steps 17–19. 5. Use a multichannel pipette to simultaneously add the same amount of cells into several different wells to speed up the procedure. 6. After this step, the samples can be fixed in 0.5–1% paraformaldehyde in PBS for 30 min on ice, washed twice in PBS, resuspended in 100 μL PBA and kept at 4°C for up to 48 h before flow cytometry analysis. 7. C. albicans blastoconidia can make aggregates that might cause an overlapping side and forward scatter profile with the moDCs. Therefore, labeling DC with APC and Candida with FITC allows the discrimination between those aggregates (which are FITC positive only) and the real Candida-DC interactions (which are double-positive for FITC and APC). It should also be noted that this C. albicans binding assay can also be applied to other (mouse and human) immune cell types (17). For example, macrophages can be labeled with CD68, monocytes with CD14, and neutrophils with CD16B antibodies. 8. FITC-labeled Candida cell suspensions can be stored in aliquots at −80°C at a concentration of 500 × 106 yeast cells/mL for up to 1 year. Avoid thawing/freezing cycles to prevent loss of the FITC signal intensity. 9. Note that the stated concentrations of inhibiting agents are three times higher than the final concentrations that will be reached in the well. Furthermore, when the blocking agent is EDTA, the CD45-APC-labeled mo-DCs must be resuspended in PBS and the EDTA solution must be prepared in PBS. The high calcium concentration in the TSA buffer would lead to EDTA saturation and insufficient chelation of calcium present at the binding site of the CLRs, resulting in a false positive binding value. 10. The concentration of C. albicans, i.e., the ratio between C. albicans and mo-DCs, also known as multiplicity of infection (MOI), as well as the incubation time at 37°C, can be varied when a concentration range or a time-course type of experiment has to be performed.

330

A.B. van Spriel and A. Cambi

11. Do not centrifuge the samples to wash away the unbound C. albicans. This is not necessary, since the addition of TSA dilutes the mixture and prevents/delays any additional interactions that might occur after the incubation time. On the contrary, physical interactions between mo-DCs and Candida particles will be induced during centrifugation, thereby overestimating the binding. Importantly, the measurement of binding percentage must be performed immediately after the incubation time is finished. Samples can be kept on ice while measuring. This prevents unwanted additional interactions between mo-DCs and C. albicans due to prolonged co-incubation times that may also give false positive data. 12. This circle provides a barrier to liquids such as antibody solutions and washing buffers applied to the coverslip. 13. Check on the antibody data sheet provided by the manufacturer whether the antibodies directed against the proteins to be stained can withstand methanol treatment. As an alternative to methanol, Triton X-100 or saponin can be used as permeabilization reagents. Be aware that permeabilization with Triton X-100 or methanol is irreversible, whereas permeabilization with saponin is reversible. Therefore, the same procedure can be followed for methanol and Triton X-100. Instead, when saponin is used, step 10 is not necessary, while steps 12 and 13 must be performed with solutions containing saponin before washing with PBA. 14. If necessary, the blocking step can be performed in PBA overnight at 4°C. 15. The suggested concentration of primary antibody is usually applicable to the majority of mouse monoclonal antibodies used and guarantees saturating conditions for labeling. However, the optimal concentration should be tested for each antibody. 16. A maximum of 2 coverslips can be mounted side-by-side on top of a Mowiol-bearing glass slide. Use a 5 μL drop of Mowiol to seal each coverslip and keep enough space between the coverslips to allow easy handling under the confocal microscope.

Acknowledgements This work was supported by a NWO Veni grant 916.66.028 from the Netherlands Organization for Scientific Research to AC, and by the Dutch Cancer Society (KWF Grant 2007-3917) and the Netherlands Organization for Scientific Research (NWO-ALW) to AvS.

21

Candida albicans Interaction with Dendritic Cells

331

References 1. McNeil, M. M., Nash, S. L., Hajjeh, R. A., Phelan, M. A., Conn, L. A., Plikaytis, B. D., and Warnock, D. W. (2001) Trends in mortality due to invasive mycotic diseases in the United States, 1980–1997, Clin Infect Dis 33, 641–647. 2. Cambi, A., Gijzen, K., de Vries, J. M., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G., Kullberg, B. J., Romani, L., and Figdor, C. G. (2003) The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells, Eur J Immunol 33, 532–538. 3. d’Ostiani, C. F., Del Sero, G., Bacci, A., Montagnoli, C., Spreca, A., Mencacci, A., Ricciardi-Castagnoli, P., and Romani, L. (2000) Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans. Implications for initiation of T helper cell immunity in vitro and in vivo, J Exp Med 191, 1661–1674. 4. Netea, M. G., Gijzen, K., Coolen, N., Verschueren, I., Figdor, C., Van der Meer, J. W., Torensma, R., and Kullberg, B. J. (2004) Human dendritic cells are less potent at killing Candida albicans than both monocytes and macrophages, Microbes Infect 6, 985–989. 5. Newman, S. L., and Holly, A. (2001) Candida albicans is phagocytosed, killed, and processed for antigen presentation by human dendritic cells, Infect Immun 69, 6813–6822. 6. Romani, L., Bistoni, F., and Puccetti, P. (2002) Fungi, dendritic cells and receptors: a host perspective of fungal virulence, Trends Microbiol 10, 508–514. 7. Janeway, C. A., Jr., and Medzhitov, R. (2002) Innate immune recognition, Annu Rev Immunol 20, 197–216. 8. Klis, F. M., de Groot, P., and Hellingwerf, K. (2001) Molecular organization of the cell wall of Candida albicans, Med Mycol 39 Suppl 1, 1–8. 9. Masuoka, J. (2004) Surface glycans of Candida albicans and other pathogenic fungi: physiological roles, clinical uses, and experimental challenges, Clin Microbiol Rev 17, 281–310.

10. Brown, G. D., Herre, J., Williams, D. L., Willment, J. A., Marshall, A. S., and Gordon, S. (2003) Dectin-1 mediates the biological effects of beta-glucans, J Exp Med 197, 1119–1124. 11. Netea, M. G., van der Graaf, C., Van der Meer, J. W., and Kullberg, B. J. (2004) Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system, J Leukoc Biol 75, 749–755. 12. Cambi, A., and Figdor, C. G. (2003) Dual function of C-type lectin-like receptors in the immune system, Curr Opin Cell Biol 15, 539–546. 13. Jouault, T., Ibata-Ombetta, S., Takeuchi, O., Trinel, P. A., Sacchetti, P., Lefebvre, P., Akira, S., and Poulain, D. (2003) Candida albicans phospholipomannan is sensed through toll-like receptors, J Infect Dis 188, 165–172. 14. Netea, M. G., Gow, N. A., Munro, C. A., Bates, S., Collins, C., Ferwerda, G., Hobson, R. P., Bertram, G., Hughes, H. B., Jansen, T., Jacobs, L., Buurman, E. T., Gijzen, K., Williams, D. L., Torensma, R., McKinnon, A., MacCallum, D. M., Odds, F. C., Van der Meer, J. W., Brown, A. J., and Kullberg, B. J. (2006) Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors, J Clin Invest 116, 1642–1650. 15. Repnik, U., Knezevic, M., and Jeras, M. (2003) Simple and cost-effective isolation of monocytes from buffy coats, J Immunol Methods 278, 283–292. 16. Figdor, C. G., de Vries, I. J., Lesterhuis, W. J., and Melief, C. J. (2004) Dendritic cell immunotherapy: mapping the way, Nat Med 10, 475–480. 17. van Spriel, A. B., van den Herik-Oudijk, I. E., van Sorge, N. M., Vile, H. A., van Strijp, J. A., and van de Winkel, J. G. (1999) Effective phagocytosis and killing of Candida albicans via targeting FcgammaRI (CD64) or FcalphaRI (CD89) on neutrophils, J Infect Dis 179, 661–669.

Chapter 22 Immune Responses to Candida albicans in Models of In Vitro Reconstituted Human Oral Epithelium Jeanette Wagener, Daniela Mailänder-Sanchez, and Martin Schaller Abstract In this protocol, we describe the application of commercially available three-dimensional organotypic tissues of human oral mucosa to study the interaction between Candida albicans and epithelial cells. Infection experiments show high reproducibility and can be used to analyse directly pathogen/epithelial cell interactions. However, the system is also very flexible. Using histological, biochemical, immunological, and molecular methods, it is possible to analyse several stages of infection by C. albicans wild type or mutant strains and demonstrate the consequence of disrupting genes encoding putative virulence factors required for host cell invasion and immune defence induction. This model provides information about host and pathogen protein and gene expression during direct interactions with each other. It can additionally be supplemented with other host factors, such as immune cells, saliva, and probiotic bacteria, which are relevant for host immune defence in the oral cavity. Key words: Candidiasis, Mucosal infection, Reconstituted human epithelium, Candida albicans, Probiotic bacteria

1. Introduction Three-dimensional organotypic tissue models such as reconstituted human epithelium (RHE) have recently become a useful tool with which to study oral epithelial C. albicans infections (1–6). These models of mucosal candidiasis closely parallel the in vivo situation and allow studies of the physiological functions of pathogen virulence factors by using Candida mutant strains (7–11). At least two commercially available oral models are now available (SkinEthic Laboratory and MatTek Corporation). Both are grown at the airliquid interface on microporous membranes in chemically defined medium to form an oral mucosa analogue. The advantages of these models, compared to more complex systems, are the focused analysis of defined conditions and the easier integration of the immune

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_22, © Springer Science+Business Media, LLC 2012

333

334

J. Wagener et al.

cells of the skin that are relevant to defence. These days, vaginal and epidermal models can also be purchased from these companies in order to study different host niches. RHE models are therefore a very promising tool to study host/ pathogen interactions, and the effects of antimicrobial substances can be easily tested to give insights into new clinical approaches. Several methods can be successfully used to analyse the infected model. Epithelial cell damage caused by C. albicans can be quantified by lactate dehydrogenase (LDH) detection, cytokine response can be analysed by ELISA, and protein and RNA transcription analysis can be done from a single sample to study signal transduction pathways.

2. Materials (see Note 1 ) 2.1. Establishment of the Oral Candidiasis Model

1. Sabouraud dextrose agar: 1% (w/v) peptone, 4% (w/v) glucose (Dextrose), 1.2% (w/v) agar, 1% (v/v) penicillin (10,000 U/ mL)/streptomycin (10 mg/mL). 2. Phosphate-buffered saline (PBS), cell culture grade. 3. 0.9% NaCl solution. 4. YPD (Yeast extract peptone dextrose) liquid media: 1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose (dextrose).

2.2. Preparation, Pre-incubation, and Infection of Tissue Model

1. 6-Well tissue culture plate, sterile with lid. 2. Tweezers, sterile. 3. SkinEthic reconstituted human oral epithelium (RHO/S/5), small: tissue surface 0.5 cm2, age day 5, oral head and neck squamous cell carcinoma cell line TR146 (SkinEthic, Nice, France). 4. SkinEthic maintenance medium (SkinEthic) without antibiotics and antimycotics. 5. EpiOral tissue model (ORL-200), small: tissue surface 0.6 cm2, normal human oral keratinocytes (NHOK), non-diseased from adult human oral tissue obtained from patients undergoing tooth extractions (MatTek). 6. MatTek maintenance medium (MatTek) without antibiotics and antimycotics. 7. Surgical disposable scalpels, sterile no. 11 and 21.

2.3. LDH Cell Damage Assay

1. Cytotoxicity Detection Kit (LDH) (Roche Diagnostics). 2. L-Lactate dehydrogenase (L-LDH) (Roche Diagnostics). 3. 96-Well plate. 4. Microplate photometer (wavelengths 492 and 620 nm).

22

2.4. RNA/Protein Isolation and Quantitative RT-PCR

Candida albicans in Reconstituted Human Oral Epithelium

335

1. NucleoSpin RNA/Protein Kit (Macherey-Nagel). 2. iScript™cDNA Synthesis Kit (Bio-Rad). 3. Glass beads, acid-washed, 425–600 μm (30–40 US sieve). 4. LightCycler (Roche). 5. LightCycler® FastStart DNA MasterPLUS SYBR Green I (Roche). 6. peqGOLD RNAPure (Peqlab).

2.5. Immunoblot

1. Protein quantification assay (Macherey-Nagel). 2. Resolving gel buffer: 1.5 M tris-HCl, 0.4% SDS, pH 8.8. 3. Stacking gel buffer: 0.5 M tris-HCl, 0.4% SDS, pH 6.8. 4. Rotiphorese Gel 30 (37.5% acrylamide/ 1% bisacrylamide solution) (Carl Roth). 5. 10% (w/v) ammonium persulphate (APS) solution. 6. N,N,N,N ¢-tetramethylethylenediamine (TEMED). 7. Resolving gel (12%): 1.04 mL resolving gel buffer, 2 mL Gel 30, 1.94 mL ddH2O, 20 μL APS (10%), and 10 μL TEMED. 8. Stacking gel (4.4%): 1.35 mL stacking gel buffer, 0.73 mL Gel 30; 0.4 mL distilled water, 12.5 μL APS (10%), and 10 μL TEMED. 9. SDS-PAGE running buffer: 25 mM Tris, 0.2 M glycine, 0.1% SDS, pH 8.4. 10. Ponceau S solution. 11. Mini-Protean System (BioRad). 12. Semi-dry transfer buffer: 25 mM Tris, 0.2 M glycine, 20% methanol, pH 8.5. 13. Whatman paper. 14. Semi-dry blotter (Biometra). 15. Hybond-P (PVDF) membrane (GE Healthcare). 16. Tris buffered saline (TBS): 20 mM Tris, 150 mM NaCl, pH 7.6. 17. TBS-T: 0.05% Tween20 in TBS. 18. 5% (w/v) Non-fat dry milk, bovine serum albumin (BSA), or foetal calf serum (FCS) in TBS-T. 19. Anti-rabbit IgG, HRP-linked or anti-mouse IgG, HRP-linked antibody. 20. 20× LumiGLO Reagent and Peroxide (CellSignaling). 21. X-ray film (GE Healthcare). 22. Protec OptiMax® X-ray processor (Röntgen Bender).

336

J. Wagener et al.

2.6. Immune Fluorescence Microscopy

1. Microtome with cryostat (Frigocut 2700, Leica). 2. Tissue-Tek OCT compound 4583 (Sakura Finetek Europe). 3. RPMI 1640 medium. 4. Silane-coated slides. 5. PLP: 2% paraformaldehyde and 0.125% lysine in PBS. 6. PBS. 7. 10% donkey serum in PBS (Sigma). 8. 0.1% BSA, 0.1% Tween in PBS. 9. Fluorescent dye for nuclear staining, e.g. TOPRO or YOPRO (Invitrogen Molecular Probes). 10. Specific rabbit and mouse antibodies against protein of interest. 11. Donkey-anti-mouse-Cy5 (Dianova). 12. Donkey-anti-rabbit-Cy3 (Dianova). 13. Confocal laser scanning microscope (Leica TCS SP, Leica).

2.7. Supplementation of the Model with PMNs

1. Foetal bovine serum, certified (Lonza). 2. Giemsa stain (Carl Roth). 3. Polymorphprep (Axis-Shield). 4. May-Grunwald stain (Carl Roth). 5. RPMI 1640 medium. 6. NaCl solution, 0.2 and 1.6%. 7. Trypan blue stain, 0.4%.

2.8. Supplementation with Lactobacillus spp.

1. MRS agar (deMan, Rogosa): 1% (w/v) peptone, 0.4% (w/v) yeast extract, 0.1% (v/v) Tween-80, 0.5% (w/v) sodium acetate, 0.02% (w/v) magnesium sulphate, 0.8% (w/v) bovine bouillon, 2% (w/v) glucose, 0.2% (w/v) potassium diphosphate, 0.2% (w/v) ammonium citrate, 0.005% (w/v) manganese sulphate, 1% (w/v) agar, pH 6.2. 2. Barium chloride. 3. H2SO4, 98%.

2.9. Supplementation with Antimicrobial Peptides or Cytokines 2.10. Knockdown of Epithelial Gene Expression Using RNA Interference

1. LL-37 synthetic peptide (Innovagen). 2. Recombinant cytokines, purified (R&D). 1. HiPerFect transfection reagent (Qiagen). 2. Negative control siRNA Alexa Fluor 488 (Qiagen).

22 Candida albicans in Reconstituted Human Oral Epithelium

2.11. Inhibition of Epithelial Protein Expression Using Neutralizing Antibodies

337

1. Anti-human monoclonal antibodies (mAb) against receptor/ protein of interest. 2. Isotype controls.

3. Methods 3.1. Semisynchronization of Fungal Cells

1. Two days before the planned infection, cultivate yeast cells on Sabouraud dextrose agar for 24 h at 37°C. 2. Suspend 2–3 colonies in 5 mL 0.9% NaCl solution. Wash the cells once in 5 mL 0.9% NaCl solution. All centrifugation steps are for 5 min at 800 × g. Count the C. albicans cells using a Neubauer chamber. Suspend 2 × 106 cells in 10 mL YPD medium. Incubate for 16 h at 25°C with orbital shaking at 150 rpm. 3. Wash the cells three times in 10 mL 0.9% NaCl solution, count the cells, and suspend 4 × 107 cells in 10 mL fresh YPD medium. Incubate for 24 h at 37°C with orbital shaking at 150 rpm. 4. Wash the cells three times with PBS. Adjust the final inoculum to the desired density with PBS solution (see Note 2).

3.2. Preparation, Pre-incubation, and Infection of Tissue Model

1. Early on the morning of day 0, warm the medium supplied with the RHE kit to 37°C. After warming, add 1 mL medium into every well of a 35-mm-diameter culture dish (6-well plate) under a sterile airflow. 2. Open the 24-well plate and carefully remove the inserts containing the epithelial tissue. Remove any remaining agarose that adheres to the outside of the insert by gently blotting on a sterile filter paper. Place the insert in the middle of the prefilled culture dish (1 insert per well) (Fig. 1a) (see Note 3). 3. Place the 6-well plates containing the tissue in a humidified incubator at 37°C with 5% CO2 until starting the experiment (see Note 4). 4. Infect the 0.5 cm2 tissue using 2 × 106 C. albicans yeast cells in 50 μL PBS (Fig. 1b). Uninfected controls should contain 50 μL PBS alone. Incubate tissues at 37°C with 5% CO2 at 100% humidity for 24 h (see Note 5). 5. For infection periods longer than 24 h, change the medium daily (1 mL medium per tissue insert per day) (see Note 6).

338

J. Wagener et al.

Fig. 1. Schematic diagram of the experimental design. (a) RHE on a polycarbonate filter fed by medium through the filter substratum. (b) C. albicans-infected RHE. (c) Supplementation with PMNs (Lactobacillus spp., AMPs, or cytokines) to the apical side of pre-infected RHE. (d) PMNs added to the basal side of the polycarbonate filter after inversion of the preinfected RHE.

3.3. Medium Collection, Removal, and Dissection of Tissue

1. At the end of the experiment, carefully take out each insert and place it on a Petri dish. 2. Cut out the polycarbonate filter carrying the epithelial tissue using a sharp scalpel (see Note 7). 3. Collect the culture medium by centrifuging at 2,000 × g to remove particulates (see Note 8).

3.4. Analysis of Cell Damage by LDH Assay

1. Analyse LDH activity using a Cytotoxicity Detection Kit (LDH), according to the manufacturer’s protocol (see Note 9).

3.5. RNA/Protein Isolation and Quantitative RT-PCR

1. Isolate total RNA and/or protein from tissue samples using a NucleoSpin®RNA/Protein Kit according to the manufacturer’s protocol (see Note 10). 2. Make cDNA from 1 μg total RNA in a reverse transcriptase reaction according to the manufacturer’s protocol. 3. Perform quantitative real-time PCR in a LightCycler using 20 ng of cDNA and FastStart DNA MasterPLUS SYBR Green I (see Note 11).

3.6. Immunoblotting

1. Determinate protein concentration of samples using protein quantification assay according to the manufacturer’s protocol. 2. Heat samples at 95°C for 5 min and pulse-heated sample in a microfuge at maximum speed for 30 s to bring down condensate. 3. Load 10 μg proteins per lane on a sodium dodecyl sulphate (SDS) polyacrylamide gel. Include pre-stained standards and/ or protein standards for the detection format you chose and, if possible, appropriate positive controls.

22 Candida albicans in Reconstituted Human Oral Epithelium

339

4. Electrophorese at 90 V until the sample has entered the running gel from the stacking gel and then continue at 120 V until the dye front has reached the bottom of the gel. 5. Transfer to a PVDF membrane by semi-dry or tank transfer system. 6. Visualize transferred proteins with Ponceau S solution by soaking the blot in solution for 5 min, then rinsing with distilled water until bands are visible. 7. Block the membrane in 5% (w/v) non-fat dry milk in TBS-T or 5% (w/v) FCS/BSA in TBS-T for a minimum of 2 h at room temperature or at 4°C overnight with mild shaking. 8. Add appropriate antibody diluted in same buffer used in Subheading 3.6, step 5 (or as indicated by the antibody manufacturer). Incubate on a shaker for 2 h at room temperature or at 4°C overnight. 9. Wash the blot three times with TBS-T, each wash for 5–10 min with mild shaking. 10. Add appropriate secondary antibody diluted in TBS-T according to the manufacturer’s protocol and incubate on a shaker for 1 h at room temperature. 11. Wash membrane three times for 5–10 min with TBS-Ton a shaker. 12. Incubate membrane with ECL substrate solution according to the manufacturer’s protocol. 13. Place membrane in a plastic film wrap and expose the membrane to X-ray film in a dark room. 14. Develop film in an X-ray film processor. 3.7. Immune Fluorescence Microscopy

1. Cryofix the tissue sample in RPMI 1640 medium with liquid nitrogen or directly into Tissue-Tek on a microtome with cryostat. 2. Place 5 μm sections on silane-coated slides and fix the sections in 2% paraformaldehyde and 0.125% lysine in PBS for 2 min. 3. Wash for 5 min with PBS. Wash for 10 min with PBS/BSA/ Tween-20 and 10% donkey serum in PBS for 30 min at room temperature. 4. Incubate for 2 h with the specific rabbit and mouse antibodies against antigen of interest. 5. Wash sections with PBS/BSA/Tween-20 for 30 min. Add fluorescence-labelled secondary antibodies (e.g. donkey-antirabbit-Cy3 and donkey-anti-mouse-Cy5, both 1:500) for 60 min. 6. Wash again for 30 min with PBS/BSA/Tween-20.

340

J. Wagener et al.

7. Stain the nuclei with YOPRO or TOPRO. 8. Analyse sections using a confocal laser scanning microscope or fluorescence microscope. 3.8. Supplementation of the Model with PMNs (see Note 12)

1. Isolate polymorphonuclear cells (PMN) from heparinized whole blood using Polymorphprep according to the manufacturer’s protocol (see Note 13). 2. Wash the PMNs three times with PBS, after removing residual erythrocytes by hypotonic lysis, if necessary (see Note 14). 3. Suspend the PMNs in RPMI 1640 medium with 10% FCS. 4. Use Giemsa staining and light microscopy to ensure that a pure population of PMNs (>90% purity) with typical morphology has been isolated (see Note 15). 5. Asses the cell number of vital PMNs by trypan blue staining using a Neubauer chamber. 6. PMNs can integrated in the pre-infected epithelium in two ways: either supplement the model with 2 × 106 PMNs in 50 μL RPMI 1640/10% FCS by adding the cells directly to the apical epithelial layers after 12 h infection and incubate for additional 12 h at 37°C and 5% CO2 at 100% humidity (Fig. 1c), or invert the pre-infected model after 12 h using tweezers and add the PMNs on the basal side of the polycarbonate filter (Fig. 1d). This prevents direct contact between PMNs, epithelial cells, and C. albicans but allows soluble factors (e.g. cytokines) to pass through the filter (see Note 16).

3.9. Supplementation with Lactobacillus spp.

1. Cultivate Lactobacillus spp. on MRS agar for 3 days at 37°C and 5% CO2. 2. Suspend a sample of the culture in PBS, wash once with PBS, and measure OD600 to determine cell number using McFarland standard No.4 (see Note 17). Adjust to a density of 6 × 109/ mL in PBS. 3. Supplementation of Lactobacillus spp. can be done in three different ways: ●

Either pre-incubate the uninfected epithelium with 50 μL Lactobacillus spp. for 12 h at 37°C and 5% CO2 in a humidified incubator. Infect the tissue with C. albicans according to the procedure in Subheading 3.2, step 4.

●

Or infect the tissue with C. albicans according to the procedure in Subheading 3.2, step 4. Add Lactobacillus spp. directly to the apical epithelial layers of the 12-h-infected model and incubate the model for additional 12 h (Fig. 1c).

●

Or inoculate the epithelial tissue model with C. albicans together with Lactobacillus spp. for 24 h at 37°C and 5% CO2 in a humidified incubator.

22 Candida albicans in Reconstituted Human Oral Epithelium

3.10. Supplementation with Antimicrobial Peptides or Cytokines (see Table 1)

341

Supplementation of epithelium with AMPs, single cytokines, or cytokine cocktails can be done in the following three ways (see Note 6): 1. Add appropriate concentration of AMP or cytokine diluted in 50 μL PBS to the apical layer of the tissue and pre-incubate for 1 h before starting the standard infection protocol. 2. Add appropriate concentration of AMP or cytokine diluted in 50 μL medium to the apical side of the 12-h-infected tissue and incubate for additional 12 h (Fig. 1c). 3. Add appropriate concentration of AMP or cytokine diluted in 50 μL PBS to the basal side of the 12-h-infected tissue and incubate for additional 12 h (Fig. 1d).

3.11. Knockdown of Epithelial Gene Expression Using RNA Interference

1. siRNA solution and transfection reagent are prepared according to the manufacturer’s protocol (see Note 18). 2. Incubate the epithelium with 50 μL transfection complexes (diluted in PBS) for an appropriate period of time (e.g. 1 h) at 37°C with 5% CO 2 in a humidified incubator (see Note 19).

Table 1 Antibodies and isotype controls for immunoblot, fluorescence microscopy, and blocking and neutralizing experiments Molecule

Isotype

Clone

Company

Application

TLR2

Rabbit polyclonal Mouse IgG2a

H-175 TLR2.1

Santa Cruz Imgenex

IB, IF N, IF

TLR4

Rabbit polyclonal Mouse IgG2a

H-80 HTA125

Santa Cruz Imgenex

IB, IF N, IF

MyD88

Rabbit polyclonal

Cell Signaling

IB, IF

β-actin

Rabbit polyclonal

13E5

Cell Signaling

IB, IF

LL-37

Polyclonal rabbit Mouse IgG1

3D11

Innovagen Hycult

IF IB

hBD-2

Polyclonal goat

PeproTech

IB, IF

hBD-3

Polyclonal rabbit

PeproTech

IB, IF

IL-8/CXCL-8

Mouse IgG1

24822

R&D Systems

N

TNF

Mouse IgG1

28401

R&D Systems

N

Isotype control

Mouse IgG1

R&D Systems

N

Isotype control

Mouse IgG2a

eBioscience

N

IB immunoblot, IF immunofluorescence, N neutralization

342

J. Wagener et al.

3. Remove the transfection solution carefully from the apical side of the epithelium and wash three times with PBS. 4. Transfer the tissue into fresh medium and start infection according to the protocol in Subheading 3.2, step 4. 3.12. Inhibition of Epithelial Protein Expression Using Neutralizing Antibodies

1. Use anti-human monoclonal antibodies and appropriate isotype controls to block epithelial protein expression (see Note 20). 2. Dilute the specific antibodies and isotype controls in PBS, add to the epithelium, and incubate for 1 h at 37°C with 5% CO2 at 100% humidity (see Note 6). 3. Infect the tissue with C. albicans according to the protocol in Subheading 3.2, step 4.

4. Notes 1. Ensure that all materials are sterile and maintained under sterile conditions during RHE experiments, for RNA isolation solutions must be RNAse-free. Endotoxin-free material is essential for immunological studies with the RHE. 2. This procedure ensures that the C. albicans cells are at a similar growth phase when added to the RHE surface and is an important factor in obtaining reproducible results. For a 24-h infection period, a concentration of 4 × 107 yeast cells per mL will result in a strong infection of the epithelium. Cell number of inocula can be adapted depending on test conditions (colonization to overwhelming infection), but make sure that the inocula are equally distributed over the epithelial surface. 3. Take care that the epithelium does not dry out and that no air bubbles are formed underneath the insert. Make sure that the medium level outside the insert does not extend above the epithelial surface. 4. If cytokine analyses are planned after the infection studies, it is advisable to culture the tissue overnight or for at least 12 h prior to the experiment to allow the tissue to recover from the stress of shipping. 5. Cultures can be continued for at least 1 week with good retention of normal morphology. Therefore, the cultures must be fed every 24 h with fresh maintenance (EpiOral, MatTek) or growth medium (RHO, SkinEthic). 6. In co-incubation experiments with neutralizing antibodies, enzyme inhibitors, or antimicrobial peptides, the inocula and the medium must contain the correct concentration of the reagents of interest.

22

Candida albicans in Reconstituted Human Oral Epithelium

343

7. All samples should be collected under sterile conditions. If more than one type of analysis is to be carried out, cut the epithelium into several sections using a rounded scalpel. For RNA/protein isolation, transfer epithelium into a 1.5-mL reaction tube and quick-freeze samples in liquid nitrogen. 8. Samples for LDH determination can be stored at +4°C without significant loss of LDH activity for a few days. Freeze samples for cytokine/antimicrobial peptide analysis in liquid nitrogen and store at −20 to −80°C until assayed. Avoid repeated freeze-thaw cycles. 9. The LDH activity assay is based on the measurement of cytoplasmic enzyme activity released by damaged cells. The amount of enzyme activity detected in the culture supernatant correlates to the proportion of damaged cells. The analysis of LDH activity in the supernatant of the infected tissue is therefore a good tool to analyse the damage of the epithelium caused by C. albicans. 10. For isolation of epithelial RNA, only use a NucleoSpin® RNA II Kit. If you want to simultaneously isolate mammalian and fungal RNA, vortex the sample for 10 min with 0.5 mL cold glass beads in 1 mL RNAPure (for example) to break up fungal cell walls. RNAPure chemically stabilizes RNA during the isolation process. 11. It is also possible to perform microarray analysis from the mammalian and fungal RNA. For mammalian RNA, we used commercial PCR arrays (RT² Profiler PCR Arrays, SA Biosciences) to analyse pathway-specific expression profiles. 12. Include equally treated uninfected/infected control samples in every experimental setup. 13. It is possible to supplement the model with other immune cells of interest, such as mast cells, dendritic cells, or monocytes. 14. For hypotonic lysis, resuspend the cell pellet in 3 mL cold 0.2% NaCl solution. Restore isotonicity precisely after 30 s by adding 3 mL ice-cold 1.6% NaCl solution and 4 mL PBS. This procedure can be repeated once or twice with care, and the 30 s limit must be carefully observed since prolonged periods of hypotonicity result in neutrophil damage. 15. Smear the cell preparation for Giemsa staining on standard microscope slides and air-dry. Fix cells with 100% methanol for 1–2 min and stain with May-Grunwald solution for 4 min. Rinse with distilled water, air-dry, and examine slides under light microscope. 16. Invert the insert carefully and place it back in the middle of each well. Ensure that the insert is not moving towards the edge of the well that will cause loss of medium/sample.

344

J. Wagener et al.

Add every 60–120 min medium to the basal side of the filter to feed inverted samples. 17. Prepare McFarland standard No.4 by mixing 0.4 mL barium chloride solution 1% (w/v) with 9.6 mL sulphuric acid 1% (v/v). The optical density at wavelength 600 should have an absorbance of 0.669. This correlates with a cell density of 1.2 × 109 cells/mL. 18. We used HiPerfect Transfection Reagent for a period of 24 h and achieved up to 75% efficiency depending on siRNA concentration. It is essential to test several siRNAs, concentrations, and transfection time periods to get the best results. 19. Ensure that the transfection complexes are equally distributed on the epithelial surface. 20. In our experiments, the optimal concentration for the suggested monoclonal antibodies varies from 0.001 to 20 μg/mL. Titration of every new antibody is required to receive optimal results (see Table 1). References 1. Naglik, J.R., D. Moyes, J. Makwana, et al. (2008) Quantitative expression of the Candida albicans secreted aspartyl proteinase gene family in human oral and vaginal candidiasis. Microbiology 154 (Pt 11): p. 3266–80. 2. Schaller, M., M. Bein, H.C. Korting, et al. (2003) The secreted aspartyl proteinases Sap1 and Sap2 cause tissue damage in an in vitro model of vaginal candidiasis based on reconstituted human vaginal epithelium. Infect Immun 71 (6): p. 3227–34. 3. Schaller, M., U. Boeld, S. Oberbauer, et al. (2004) Polymorphonuclear leukocytes (PMNs) induce protective Th1-type cytokine epithelial responses in an in vitro model of oral candidosis. Microbiology 150 (Pt 9): p. 2807–13. 4. Schaller, M., H.C. Korting, W. Schafer, et al. (1999) Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis. Mol Microbiol 34 (1): p. 169–80. 5. Schaller, M., W. Schafer, H.C. Korting, et al. (1998) Differential expression of secreted aspartyl proteinases in a model of human oral candidosis and in patient samples from the oral cavity. Mol Microbiol 29 (2): p. 605–15. 6. Weindl, G., J.R. Naglik, S. Kaesler, et al. (2007) Human epithelial cells establish direct antifun-

gal defense through TLR4-mediated signaling. J Clin Invest 117 (12): p. 3664–72. 7. Albrecht, A., A. Felk, I. Pichova, et al. (2006) Glycosylphosphatidylinositol-anchored proteases of Candida albicans target proteins necessary for both cellular processes and host-pathogen interactions. J Biol Chem 281 (2): p. 688–94. 8. de Boer, A.D., P.W. de Groot, G. Weindl, et al. The Candida albicans cell wall protein Rhd3/ Pga29 is abundant in the yeast form and contributes to virulence. Yeast 27 (8): p. 611–24. 9. Green, C.B., G. Cheng, J. Chandra, et al. (2004) RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms. Microbiology 150 (Pt 2): p. 267–75. 10. Nailis, H., S. Kucharikova, M. Ricicova, et al. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of modeldependent and -independent gene expression. BMC Microbiol 10: p. 114. 11. Spiering, M.J., G.P. Moran, M. Chauvel, et al. Comparative transcript profiling of Candida albicans and Candida dubliniensis identifies SFL2, a C. albicans gene required for virulence in a reconstituted epithelial infection model. Eukaryot Cell 9 (2): p. 251–65.

Chapter 23 Analysis of Host-Cell Responses by Immunoblotting, ELISA, and Real-Time PCR David L. Moyes and Julian R. Naglik Abstract Intracellular responses to external pathogens/stimuli are crucial to the host’s response to infection. The methods used to analyse these responses fall into many categories. Activation of proteins as part of a signal cascade can be screened for using conventional immunoblotting techniques or immunoprecipitation to identify the presence of modified proteins or protein complexes. Transcription factor activity can be screened for by EMSA or ELISAs to identify DNA binding of these factors. Finally, expression of activated genes can be quantified using real-time PCR methods. Here, we will show how to perform these assays and discuss the relative merits of each. Key words: Immunoblotting, Transcription factor, Cell signalling, Immunoprecipitation, ELISA, Real-time PCR, Electrophoresis, Phosphorylation, Protein modification

1. Introduction 1.1. Immunoblotting

Detection of proteins by immunoblotting is a well-established technique, enabling the detection of specific proteins and confirmation of their molecular weight by use of electrophoresis and antibodies (1, 2). It can be used to discriminate between a precursor protein and the processed form by size, and its usefulness in identifying intracellular signal pathway activation has been further enhanced by the development of antibodies capable of distinguishing a modified protein from its unmodified form—e.g. antibodies that recognise the phosphorylated form of a protein only (phosphospecific antibodies). Whenever immunoblotting is being used to demonstrate changes in the levels of either a protein or its modification, it is important to also establish the levels of a loading control protein—e.g. a-actin or tubulin. This is to ensure that the levels of protein loaded for each sample are equivalent, enabling

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_23, © Springer Science+Business Media, LLC 2012

345

346

D.L. Moyes and J.R. Naglik

direct comparison of observed bands. In this chapter, we give a standard methodology for carrying out immunoblot analysis on protein samples, from generating the samples to developing the blots. 1.2. Immunoprecipitation

Immunoprecipitation is a technique which uses one antibody coupled to an insoluble matrix to selectively isolate one protein or a group of proteins for further analysis by a second antibody. Generally, it is used to determine whether two different proteins are physically associated in a sample. However, when phosphospecific (or other modification-specific) antibodies for a protein are not available, the modification state of a protein can be determined by immunoprecipitation methods using an antibody to either the modification or the protein to isolate it from the sample and then a second antibody to detect the presence of protein/modification in an immunoblot. Whatever the investigation, it is important that either the two antibodies are derived from different species or that the antibody to be used in immunoblotting is biotinylated. The choice of antibody for the immunoprecipitation step is important. Many antibodies that are good for use in immunoblotting are not necessarily good for immunoprecipitation. This is due to the potential difference in the epitopes recognised. Whilst antibodies used in immunoblotting recognise linear epitopes (as the proteins are denatured for running on SDS-PAGE gels), immunoprecipitation requires antibodies that will recognise conformational epitopes in a folded protein. The lysis buffer used to generate samples is also important in immunoprecipitation. If too strong a lysis buffer is used, or a buffer which denatures proteins is used, then either any protein–protein interactions will be degraded or the antibody being used to precipitate the target group will be damaged and unable to recognise/ bind to its epitope. Equally, the lysis buffer needs to dissociate non-specific interactions between proteins to ensure a low background. For this reason, most people use either RIPA buffer or a similar lysis buffer. RIPA buffer (or radioimmunoprecipitation assay buffer) was developed for use in this assay.

1.3. Transcription Factor ELISA

Transcription factors are the on/off switches for genes. They are proteins that bind either directly or indirectly with specific DNA sequences and thereby regulate the transcription of an associated gene (3). Identifying the transcription factors (TFs) involved in a cellular response can be problematic. Immunoblotting and PCRbased methods identify the presence of the protein or the gene but tell us nothing about the activity of the TF. Many of these factors are constitutively present in resting cells, so identifying their existence within cell tells us little of their role. Activity of the TF can be quantified by using reporter constructs consisting of a plasmid

23

Analysis of Signalling and Transcription Factors

347

with a promoter sequence containing the binding site for the TF coupled to a reporter gene. The problem with using this method, however, is that it is laborious. Firstly, the plasmid construct must be generated, then the cells need to be transfected, and only then can stimulations be performed. The efficacy of the assay is affected by several factors, including the effects of transfection on the cell population and whether or not the construct is efficient in inducing reporter gene production when the TF binds to its target sequence. Alternatively, TF activity can be assessed by measuring binding to its DNA sequence. Traditionally, this meant performing an electrophoretic mobility shift assay (EMSA) involving incubating cell nuclear extracts with a radio-labelled oligonucleotide containing the TF consensus sequence and separating the resulting mix on a polyacrylamide gel (4, 5). TF-bound DNA would be retarded in its movement through the gel, resulting in a distinct band appearing. Precise identification of a TF can be made by incubating the nuclear extract–DNA mix with an antibody specific to the suspected TF, resulting in further retardation if the TF is present. The problems with this method are its use of radiolabelled probes, it is laborious, it takes around 3–5 days to gain a result, and it is non-quantitative. Recently, quantification of DNA-binding activity of TFs by using an ELISA-based system has been developed. Rather than using a conventional antibody to capture the TF, an oligonucleotide is coupled to the wells of a 96-well microtitre plate. Binding of the TF to this oligonucleotide can then be determined using antibodies as per the traditional ELISA method. This system allows for the quick (~3.5 h) and quantitative assessment of the DNA-binding activity of TFs in a cellular extract. Several different companies sell kits for these ELISAs. 1.4. Real-Time PCR

Real-time PCR (qPCR) is a method of quantifying the levels of DNA in a sample (6). Real-time reverse transcriptase PCR (qRT-PCR) has now largely superseded the use of Northern blots and ribonucleotide protection assays (RPAs) as the method of choice for analysing and quantifying gene expression. The reasons for this are speed, ease of use, and accuracy of quantitation. Unlike Northern blotting and RPAs, qRT-PCR does not involve the use of radio-labelled probes, agarose gels, or photographic film exposure. From RNA to result, data can be obtained in as little as 3 h. The process involves the use of either intercalating dyes such as SYBR green or fluorescent-labelled probes (TaqMan). The assay type to be used depends largely on the gene being assayed and operator preference. We will give the methodology for the SYBR green reaction, although the TaqMan system is almost identical.

348

D.L. Moyes and J.R. Naglik

2. Materials 2.1. Immunoblotting: Cell Lysis

1. RIPA buffer: 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS (7). 2. Protease inhibitors: 1 mM phenylmethylsulfonyl fluoride (PMSF), 5 mg/mL aprotinin, 5 mg/mL leupeptin (final concentration in lysis buffer) (or any commercial protease inhibitor cocktail). 3. Phosphatase inhibitors: 125 mM NaF (sodium fluoride), 250 mM b -glycerophosphate, 25 mM NaVO 3 (sodium vanadate) in ultrapure water. Alternatively use a commercially available phosphatase inhibitor cocktail. 4. PBS: 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM KH2PO4. Adjust to a final pH of 7.4.

2.2. Immunoblotting: SDS-PAGE

1. 30% Acrylamide mix: 29.2% acrylamide, 0.8% Bis-acrylamide. 2. 1.5 M Tris–HCl (pH 8.8). 3. 1 M Tris–HCl (pH 6.8). 4. 10% SDS. 5. 10% Ammonium persulfate in ultrapure water. 6. N,N,N,N ¢-Tetramethylethylenediamine (TEMED). 7. SDS running buffer: 0.025 M tris (pH 8.8), 0.193 M Glycine, 10% SDS in deionised water. 8. Loading buffer: 10% SDS, 6 mg bromophenol blue, 45% glycerol, 0.3 M Tris (pH 6.8) in deionised water. 9. 1 M Dithiothreitol (DTT). 10. Commercially available pre-stained protein marker.

2.3. Immunoblotting: Electrotransfer

1. Nitrocellulose membrane. 2. Transfer buffer: 0.025 M Tris, 0.193 M glycine, 10% methanol in deionised water. 3. Tris-buffered saline (TBS) 10×: 1.5 M NaCl, 0.1 M Tris–HCl (pH 7.4). 4. TBS-Tween (TBST): 0.1% Tween 20 in 1× TBS. 5. Blocking buffer: 5% non-fat dried skimmed milk in 1× TBS. 6. Phospho-antibody buffer: 5% bovine serum albumin (BSA) in TBST.

23

Analysis of Signalling and Transcription Factors

349

7. Secondary antibody buffer: 5% non-fat dried skimmed milk in TBST. 8. Species-specific secondary HRP-conjugated antibody. 9. ECL developing reagent. 10. X-ray photographic film. 2.4. Immunoprecipitation

1. RIPA buffer: See Subheading 2.1, item 1. 2. PBS: See Subheading 2.1, item 4. 3. Protein A/G sepharose slurry (see Note 1). 4. Sample loading buffer: 10% SDS, 6 mg bromophenol blue, 45% glycerol, 0.3 M Tris (pH 6.8) in deionised water.

2.5. Transcription Factor ELISA: Nuclear Lysis

1. 10× PBS: 0.1 M phosphate buffer, pH 7.5; 1.5 M NaCl; 27 mM KCl. 2. PIB (phosphatase inhibitor buffer): 125 mM NaF (sodium fluoride), 250 mM b-glycerophosphate, 250 mM PNPP (paranitrophenyl phosphate), and 25 mM NaVO3 (sodium vanadate) in 18 MW (ultrapure) water. Add the chemicals to ultrapure water. Vortex before incubating the solution at 50°C for 5 min. Vortex again and store at −20°C. 3. PBS/PIB: Add 0.5 ml PIB to 10 ml 1× PBS. 4. HB (hypotonic lysis buffer): 20 mM HEPES, pH 7.5; 5 mM NaF; 10 mM Na2MoO4 (sodium molybdate); 0.1 mM EDTA in ultrapure water. 5. 10% NP-40. Use Nonidet P-40 or Igepal.

2.6. Real-Time PCR: cDNA Synthesis

1. Reverse transcriptase reaction buffer (included with the reverse transcriptase enzyme). 2. Reverse transcriptase enzyme (e.g. AMV, MMLV, HIV-RT). 3. 10 mM dNTP. 4. 10 mM anchored oligo dT(15). Anchored oligo dT begins with an A, G, or C before a run of 15 Ts. This ensures that the primer binds at the 3¢ terminus of the gene coding region. 5. Nuclease-free water.

2.7. Real-Time PCR: qPCR

1. qPCR master mix (see Note 2). 2. Primers (also TaqMan probe if this form of assay is being carried out). 3. Reference dye—e.g. ROX. 4. Nuclease-free water.

350

D.L. Moyes and J.R. Naglik

3. Methods 3.1. Immunoblotting: Sample Lysis and Preparation

All sample lysis steps should be carried out on ice unless otherwise stated.

3.1.1. For Adherent Cells

1. At the end-point of the treatment of interest, place the tissue culture plate/dish on ice and remove the culture medium (see Note 3). 2. Wash the plate with ice-cold PBS and remove by aspiration. 3. Add ice-cold RIPA lysis buffer containing protease and phosphatase inhibitors. Add enough to cover the surface—typically 150 mL for a 12-well plate or up to 350 mL for a 6-cm dish (see Note 4). 4. Incubate on ice for 30 min, ensuring that the cells remain covered in RIPA lysis buffer. 5. Scrape the plate/dish with a cell scraper and transfer the lysate to a pre-chilled 1.5-mL microfuge tube. 6. Spin the lysate at full speed (~14,000 × g) in a microfuge for 10 min at 4°C. 7. Transfer the supernatant to a new tube and discard the pellet. The supernatant can now be aliquoted and stored at −80°C prior to further analysis. Avoid repeated freeze-thaw cycles. 8. Assay the supernatant for protein content using either a Bradford (8) or BCA assay (9).

3.1.2. For Suspension Cells

1. Pellet the cells by spinning in a centrifuge at 100 × g for 5 min at 4°C. 2. Discard the supernatant and resuspend the pellet with icecold PBS. 3. Re-pellet the cells as in step 1. 4. Discard the PBS and resuspend the pellet in ice-cold RIPA lysis buffer containing protease and phosphatase inhibitors. Add 100 mL of RIPA lysis buffer per 1 × 106 starting cells. 5. Incubate on ice for 30 min. 6. Proceed to Subheading 3.1.1, step 6.

3.2. Immunoblot: Sample Preparation

1. For each sample, make a solution containing 100 mM DTT, 1× loading buffer, and 1 mg/mL of protein (this concentration can be varied for abundant or scarce proteins). 2. Incubate the samples at 90°C for 5–10 min. 3. Briefly centrifuge before loading to spin down condensate.

23

3.3. SDS-PAGE and Transfer

Analysis of Signalling and Transcription Factors

351

Carry out all procedures at room temperature unless otherwise stated (see Note 5): 1. Cast a resolving gel. In a 30-mL tube, mix 3.3 mL of ultrapure water, 2.5 mL of 1.5 M Tris pH 8.8, 100 mL of 10% SDS, and 4 mL of 30% acrylamide mix. Next, add 100 mL 10% ammonium persulfate, followed by 4 mL TEMED. Mix and pour into a 10-cm × 8-cm × 1-mm gel cassette. Leave enough space for the comb and stacking gel and overlay with a small amount of isobutanol. Leave to polymerise until the remaining gel in the tube has set (approx. 20 min). 2. Wash the isobutanol from the top of the set gel with some ultrapure water and carefully blot away any excess. 3. Prepare the stacking gel mix by adding together 2.1 mL of ultrapure water, 380 mL of Tris pH 6.8, 30 mL 10% SDS, and 500 mL 30% acrylamide mix. Next, add 30 mL 10% ammonium persulfate followed by 3 mL TEMED. Fill the remainder of the gel cassette to the top and immediately insert a gel comb without introducing any air bubbles. Leave to set until the remaining gel mix has set (approx. 20 min) (see Note 6). 4. Once the gel has set, remove the comb and carefully rinse out the wells with ultrapure water. Assemble the gel tank apparatus as indicated by the manufacturer, adding SDS running buffer to both the upper and lower buffer chambers. Ensure that the wells are fully submerged. 5. Add the pre-stained protein marker to one well and then carefully load the samples in the remaining wells. The volumes added will vary depending on the size of the well. Typically, 15 mL for a 15-well gel, 20 mL for a 12-well gel, and 30 mL for a 10-well gel. 6. Electrophorese at 100–150 V until the dye front reaches the bottom of the gel. The electrode in the upper buffer chamber (closest to the samples) should be the negative cathode (black).

3.4. Wet Transfer to Nitrocellulose Membrane

1. After electrophoresis, carefully pry apart the gel plates using a spatula. The gel will remain on one of the two plates. Chop away (see Note 7) and remove the stacking gel. Transfer the resolving gel to a dish of transfer buffer. 2. Cut four pieces of Whatman filter paper to size (approx. 10 cm × 8 cm—larger than the gel) and soak in transfer buffer. 3. Cut one piece of nitrocellulose membrane to size (approx. 8 cm × 7.5 cm—slightly larger than the gel) and soak in transfer buffer. 4. Assemble the gel sandwich as shown in Fig. 1. In a tray containing transfer buffer, open the transfer cassette and place a sponge soaked in transfer buffer on the bottom surface. Next,

352

D.L. Moyes and J.R. Naglik

Fig. 1. Assembly of a transfer cassette.

place two pieces of pre-soaked Whatman filter paper followed by the gel. Ensure that there are no air bubbles between the gel and the paper. Place the pre-soaked membrane on the gel followed by two pieces of pre-soaked Whatman filter paper. To ensure that there are no air bubbles trapped in the sandwich, carefully role a tube or pipette across the surface of the sandwich being careful not to apply too much pressure. Place another pre-soaked sponge on top and close the cassette. 5. Place the assembled transfer sandwich/cassette in the transfer tank, being careful to position the gel towards the cathode (negative, black electrode) and the membrane towards the anode (positive, red electrode). 6. Transfer either at 90 V for 1 h or at 14 V overnight. In both cases, transfer should be conducted at 4°C or with a cooling system to ensure that the buffer does not heat up too much. 7. After transfer, open the cassette and check the membrane to confirm the pre-stained markers have transferred to the membrane. 8. Rinse the membrane in ultrapure water (see Note 8) and proceed to immunoblotting.

23

3.5. Immunoblotting

Analysis of Signalling and Transcription Factors

353

All steps should be performed at room temperature unless otherwise stated. 1. Place the membrane in blocking buffer and incubate on a shaking platform for 1 h. 2. Wash the membrane with TBS:T twice for 5 min. 3. Add the primary detection antibody (see Note 9). 4. Incubate the membrane with the primary antibody for 1 h at room temperature or overnight at 4°C on a shaking platform. 5. Wash the membrane with TBS:T three times for 1 h in total on a shaking platform. 6. Add the secondary HRP conjugate diluted in secondary antibody buffer. Incubate on a shaking platform for 1 h. 7. Wash as in step 5. 8. Develop the membrane using an ECL substrate according to the manufacturer’s instructions and expose to X-ray film.

3.6. Immunoprecipitation

1. Lyse the cells with RIPA buffer as described in Subheading 3.1. 2. Pre-clear the lysate by transferring 10–500 mg of protein to a 1.5-ml microfuge tube and then adding 50 mL of normal rabbit serum with 100 mL of Protein A/G sepharose slurry per mL of lysate. This will help to remove any non-specific binding activity from the lysate. 3. Incubate at 4°C on a rotary mixer for 30–60 min. 4. Spin at 14,000 × g for 10 min at 4°C. 5. Keep the supernatant for immunoprecipitation and discard the pellet. 6. For immunoprecipitation, add the recommended amount of antibody (usually 1–5 mg of affinity purified polyclonal) to the pre-cleared lysate. 7. Incubate at 4°C on a rotary mixer for 1 h at room temperature or overnight at 4°C. 8. Add 70–100 mL of Protein A/G sepharose slurry (see Note 10). 9. Incubate at 4°C on a rotary mixer for 4 h. 10. Spin at 14,000 × g for 10 min at 4°C. 11. Discard the supernatant and resuspend the pellet in 500 mL RIPA buffer. 12. Repeat the washing steps (steps 11 and 12) for three washes in total. 13. After the final spin, discard the supernatant and resuspend the pellet in 25–50 mL of sample loading buffer with 100 mM DTT and prepare for SDS-PAGE by heat-treating as for immunoblot sample preparation (see Subheading 3.2, steps 1–3) (see Note 11).

354

D.L. Moyes and J.R. Naglik

3.7. Transcription Factor ELISA: Nuclear Lysis

All steps should be carried out on ice or at 4°C unless otherwise stated (see Note 12). 1. Remove the cell culture medium and wash the cells with 4 mL PBS/PIB. 2. Remove the PBS/PIB. 3. Add 4 mL of PBS/PIB and lift the cells using a soft cell scraper/ lifter. Transfer the cell suspension to a pre-chilled 15-mL polypropylene tube and centrifuge at 50 × g for 5 min at 4°C to form a pellet. 4. Aspirate the PBS/PIB from the cell pellet and resuspend the pellet in 500 mL of HB. Transfer the cell suspension to a prechilled 1.5-mL microfuge tube. 5. Incubate on ice for 15 min. 6. Add 50 mL 10% NP-40 and vortex the tubes for 10 s. 7. Centrifuge the tubes for 30 s and remove the supernatant (see Note 13). 8. Wash the pellet with 500 mL HB and re-spin for 30 s to ensure a firm nuclear pellet. Remove the HB wash and discard. 9. Resuspend the nuclear pellet with 50 mL of complete lysis buffer (CLB) (see Note 14). After resuspension, vortex for 10 s, before incubating on ice on an orbital shaker at 150 rpm for 30 min. 10. Vortex for 30 s before centrifuging at 14, 000 × g at 4°C for 10 min. 11. Collect the supernatant, aliquot it, and store at −80°C. Avoid repeated freeze-thaw cycles. 12. Protein concentration can be determined using either a Bradford or BCA-based assay system.

3.8. TransAM ELISA Detection of Transcription Factor DNA Binding

The following protocol is for use with Active Motif’s TransAM kits using the buffers and reagents supplied with the kit (see Note 15). 1. Determine the number of wells required for the samples, blank, and controls and the correct number of microwell strips needed removed from 4°C. Cover any unused wells with some plate sealer tape while the assay is performed (see Note 16). 2. Add the correct amount of binding buffer to each well (the volume used here will be determined by the assay). Ensure that the buffer covers the entire bottom surface of the well. 3. Add 2–20 mg of nuclear extract in CLB—the exact volume will be determined by the assay, but the final volume of binding buffer and nuclear extract should be 50 mL. The same procedure should be used for any positive controls added. For blank wells, add CLB to the binding buffer.

23

Analysis of Signalling and Transcription Factors

355

4. Incubate the samples at room temperature on an orbital shaker at 100 rpm for 1 h. 5. Wash the wells three times with 200 mL of wash buffer. Flick the contents of the well into a sink to empty the wells. After the final wash, invert the plate and tap on paper towels to remove any excess wash buffer. 6. Add 100 mL of diluted primary antibody to each well. Antibodies will be diluted in 1× antibody binding buffer, with the exact dilution, depending on the primary antibody being used. 7. Incubate the plate at room temperature without agitation for 1 h. 8. Wash the wells three times (repeat of step 5). 9. Add 100 mL of diluted secondary HRP-conjugated antibody (1:1,000 dilution in 1× antibody binding buffer, unless stated otherwise). 10. Incubate the plate at room temperature without agitation for 1 h. 11. Wash the wells four times (repeat of step 5). 12. Add 100 mL of the supplied TMB substrate solution to the wells and leave in the dark for 2–20 min or until the blue colour has developed sufficiently. DO NOT OVERDEVELOP (see Note 17). 13. Add 100 mL of the supplied stop solution (1 M H2SO4). 14. Read the absorbance on a plate reader at 450 nm. If a reference wavelength is required, read at 655 nm. 3.9. Real-Time PCR

Both the cDNA synthesis and the qPCR reactions should be set up in accordance with the manufacturer’s guidelines and the instrument being used to perform the reactions. The methods given here are examples of protocols that can be used. 1. Add 2 mL of 10 mM anchored oligo dT(15) to 9 mL of RNA (between 100 ng and 2 mg). 2. Incubate at 70°C for 5 min. 3. Immediately place the tubes on ice for at least 2 min. 4. Make up the reaction to 20 mL with concentrated reaction buffer, 2 mL dNTP, reverse transcriptase (10 U of MMLV or AMV, 1 U of HIV RT), and nuclease-free water. RNase inhibitor can also be added according to manufacturer’s protocols. 5. Incubate at 42–44°C for 1 h followed by 95°C for 10 min to inactivate the enzyme. 6. The cDNA can be stored at 4°C for immediate use or −20°C for later use (see Note 18).

356

D.L. Moyes and J.R. Naglik

7. Assemble a master mix of primers (and TaqMan probe if used), master mix buffer, reference dye, and water. Take care to avoid any non-specific contamination (see Note 19). 8. Aliquot the reaction master mix into the reaction tubes. Typically, reaction volumes should be 10–25 mL. 9. Add 1 mL of cDNA per reaction. 10. Place the tubes in a real-time PCR machine and run the programme for the primers. 3.10. qRT-PCR: Two Standard Curve Analysis

There are several different methods of analysis used to quantify gene expression, all of which require reactions be performed for the gene(s) of interest (GOI) and at least one reference gene. The selection of reference gene is important and should be a gene unaffected by the cell treatment. If possible, it should also be a gene with a similar quantity to the gene(s) of interest. The most commonly used analysis method is DDCt analysis. This method has been fully described elsewhere (10) and will not be covered here. Although DDCt analysis is commonly used to identify changes in gene expression, there are problems with using this method. Both the GOI and the reference gene PCRs must have the same reaction efficiency, but perhaps the most limiting factor of this system is that it only gives comparative data. Thus, comparing treatment groups (e.g. patient group vs. control group) can be problematic. To get around this problem, the two standard curve analyses can be used. In contrast to DDCt analysis, two standard curve analyses generate values which can be used either to generate a relative concentration, or for direct comparison, allowing different groups to be compared easily. Unlike DDCt analysis, two standard curve analyses require that a standard curve be run alongside the samples. This standard curve can be generated using several different templates: (1) a plasmid containing the cloned gene of interest, (2) genomic DNA if the primers (and probe if using the TaqMan system) recognise genomic DNA as well as cDNA, and (3) a reference cDNA generated from either RNA from a cell line or pooled RNA from primary cells or several cell lines. The standard curve is made up of a series of serial dilutions and is assigned values either directly relating to the amount of template added (in the case of the plasmid or genomic DNA templates) or an arbitrary value (reference cDNA). The value is relatively unimportant, so long as the differences between the points on the standard curve are consistent with the dilution factor— i.e. arbitrary values of 100 and 10 if the dilution factor between these two standards is 1:10. After the qPCR reaction is completed, Ct values are generated by applying a threshold within the exponential phase of the reaction (Fig. 2). The Ct value is the cycle number at which the fluorescence value for that reaction reaches the threshold level.

23

Analysis of Signalling and Transcription Factors

357

Fig. 2. Ct value determination. The Ct value is the X-axis value (cycle number) at which the level of fluorescence reaches the threshold level.

Sample values are then extrapolated from this standard curve. Having obtained values for the samples for both the GOI and the reference gene, the normalised concentration can then be calculated as follows: Normalised concentration =

GOI concentration Reference gene concentration

This will give a measure of the concentration of the gene, which can be expressed as arbitrary units. The relative concentration can then be calculated as the fold change between a reference sample and the sample of interest if required or the raw numbers used directly for further comparison.

4. Notes 1. Protein A and protein G have different affinities for the different immunoglobulins. To determine which one to use, check the affinities on manufacturers’ websites. The choice of solid substrate to be used is down to individual preference. The main choices are agarose, sepharose, and superparamagnetic beads. The protocol we describe is for either agarose or sepharose beads. The principal is identical for superparamagnetic beads, although instead of collecting the beads by centrifugation, they are collected using a magnet.

358

D.L. Moyes and J.R. Naglik

2. qPCR master mixes are available from many suppliers and are the best to use. They contain a mix of reaction buffer, enzyme, and dNTPs. Mixes specifically for SYBR green reactions will also contain SYBR green. Some may contain the reference dye premixed, whilst for others, it needs to be added prior to running the reaction. Not all qPCR machines require the use of a reference dye, so you should check your machine’s instructions prior to use to find out if you need to use one. 3. Cells should be placed on ice as soon as possible after the experimental end-point to inhibit any cellular processes that may affect the results. 4. It is important when lysing cells to add both protease and phosphatase inhibitors to the lysis buffer, ensuring that the proteins of interest are neither degraded nor de-phosphorylated upon lysis. 5. This is a standard technique for separating proteins based on their molecular weight using polyacrylamide gels (11). The quantities stated are for a minigel (approx. 8 cm × 10 cm × 1 mm). The quantities of each reagent required for larger gels can be scaled up from the volumes given by determining the amount of water required to fill the gel cassette. 6. Pre-cast gels can also be bought if preferred. In this case, use the manufacturer’s suggestions for the protein size to be detected. 7. Use a vertical ‘chop’ rather than a horizontal ‘slice’, as the later will potentially tear the gel. 8. At this point, the membrane can be stained with a reversible stain such as Ponceau S to ensure that the proteins have transferred and that there are no air bubbles. If unstained markers were used, this should be carried out to ensure that transfer has taken place and to carefully mark the location of the protein markers on the membrane with a biro. 9. The dilution of antibody used will depend on the antibody and should be given by the manufacturer or determined experimentally. The dilution buffer for the antibody will depend on the antibody used. In general, phospho-specific antibodies give better results using 5% BSA–TBS:T, whilst non-phospho-specific antibodies will give good results using either 5% BSA– or 5% milk–TBS:T. 10. The slurry will stick to the sides of the pipette, so keep pipetting to a minimum. 11. It is not unusual on developing a Western blot from immunoprecipitated samples to see bands at 25 and 55 kD. These bands are the light and heavy chains of the antibody used in the immunoprecipitation step. They are much reduced in appearance by using antibodies from different species in the

23

Analysis of Signalling and Transcription Factors

359

two stages and can be eliminated by using a biotinylated antibody with streptavidin-HRP for detection by Western blot. 12. The volumes in this protocol are optimised for use with a confluent 10-cm dish of adherent cells (approx. 9 × 106 cells). 13. The supernatant contains the cytoplasmic protein fraction and can be kept for further use if required. If this is the case, then transfer the supernatant to a 1.5-mL microfuge tube and store at −80°C. 14. Resuspending the pellet may take careful mechanical agitation of the pellet, and the pellet is unlikely to completely resuspend. It should, however, be broken up. 15. There are several commercially available transcription factor ELISAs available. Be sure to use one that uses oligonucleotides as the capture molecule, such as Active Motif’s TransAM kits. 16. The TransAM assays can typically be used with 2–20 mg of nuclear extract, but the exact quantity will depend on the transcription factor being investigated, the cell line, and stimulus used. Typically, we use 5 mg of protein for detecting AP-1 and NF-kB TF proteins in C. albicans-infected epithelial cells. 17. Overdeveloping may result in inaccurate determination of TF binding (and possibly high background) as the optical measurements may either lie outside the linear range of the spectrophotometer or exceed the maximum reading. In these circumstances, the TransAm ELISA may need repeating. 18. The cDNA can be used either neat or diluted up to 1:5, depending on the amount of RNA used to synthesis the cDNA and the abundance of the genes of interest. 19. The exact concentration of primers and probe to be used in the reaction should be determined experimentally, but typical values would be around 600 nM for primers and 200 nM for probes. References 1. Renart J, Reiser J, Stark GR: (1979) Transfer of proteins from gels to diazobenzyloxymethylpaper and detection with antisera: A method for studying antibody specificity and antigen structure. Proc Natl Acad Sci USA; 76:3116–3120. 2. Towbin H, Staehelin T, Gordon J: (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc Natl Acad Sci USA;76:4350–4354. 3. Latchman DS: (1997) Transcription factors: An overview. Int J Biochem Cell Biol;29: 1305–1312.

4. Fried M, Crothers DM: (1981) Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res;9:6505–6525. 5. Garner MM, Revzin A: (1981) A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: Application to components of the Escherichia coli lactose operon regulatory system. Nucleic Acids Res;9:3047–3060. 6. VanGuilder HD, Vrana KE, Freeman WM: (2008) Twenty-five years of quantitative PCR for gene expression analysis. Biotechniques;44: 619–626.

360

D.L. Moyes and J.R. Naglik

7. Ngoka LC: (2008) Sample prep for proteomics of breast cancer: Proteomics and gene ontology reveal dramatic differences in protein solubilization preferences of radioimmunoprecipitation assay and urea lysis buffers. Proteome Sci;6:30. 8. Bradford MM: (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem;72:248–254. 9. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto

EK, Goeke NM, Olson BJ, Klenk DC: (1985) Measurement of protein using bicinchoninic acid. Anal Biochem;150:76–85. 10. Livak KJ, Schmittgen TD: (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta c(t)) method. Methods;25:402–408. 11. Shapiro AL, Vinuela E, Maizel JV, Jr.: (1967) Molecular weight estimation of polypeptide chains by electrophoresis in sds-polyacrylamide gels. Biochem Biophys Res Commun;28: 815–820.

Chapter 24 In Vitro Model of Invasive Pulmonary Aspergillosis in the Human Alveolus Lea Gregson, William W. Hope, and Susan J. Howard Abstract Cellular bilayer models can be used to simulate many biological compartments. Here, we describe a cell culture model of the human alveolus that enables the study of early invasive pulmonary aspergillosis. The cellular bilayer is constructed with human alveolar epithelial cells and human pulmonary artery endothelial cells. The cells are grown on a semipermeable polyester membrane. This model can be used to study the pathogenesis, immunobiology and pharmacology of invasive pulmonary aspergillosis. Key words: Aspergillus, Aspergillosis, Tissue culture

1. Introduction Transwells® are semipermeable synthetic membranes that enable the growth of various cell types and the simulation of biological compartments. Here, we describe a cellular bilayer grown on a polyester insert that mimics the alveolar-capillary barrier. This bilayer model can be used to study many aspects related to the pathophysiology and pharmacology of invasive pulmonary aspergillosis. This bilayer model was originally developed to investigate the pathogenesis of Mycobacterium tuberculosis (1, 2). The model was subsequently adapted to study Aspergillus fumigatus, including the kinetics of clinically relevant biomarkers, the invasion of hyphae, the effect of antifungal agents and the antifungal effect of immunological effectors (3, 4). Human alveolar epithelial cells are grown on the upper surface of a polyester membrane that is perforated with 3-μm pores. Human pulmonary artery endothelial cells are grown on the under surface. The cellular bilayer defines two compartments: (1) an upper

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_24, © Springer Science+Business Media, LLC 2012

361

362

L. Gregson et al.

compartment that simulates the alveolar airspace and (2 ) a lower compartment that simulates the pulmonary capillary. The alveolar compartment is inoculated with A. fumigatus conidia, where they germinate to form hyphae. These tissue invasive forms penetrate the cellular bilayer, thus mimicking invasion in the human lung. Antifungal agents can be applied to the endothelial compartment to simulate the systemic administration of these compounds. Immunological effectors can be added to the alveolar or endothelial compartment. Invasion can be assessed directly (e.g. by confocal microscopy) or via the measurement of fungal-related biomarkers.

2. Materials Prepare solutions at room temperature and store at 4°C, unless otherwise stated. Media containing Foetal bovine serum (FBS) can be used for up to 1 month. 2.1. Construction of the Cellular Bilayer

1. Human pulmonary artery endothelial cells (HPAECs, see Note 1). 2. EGM-2 BulletKit (medium; see Note 1) is prepared following the manufacturer’s instructions by adding the provided supplements required to support the growth of HPAECs (ascorbic acid, heparin, hydrocortisone, human endothelial growth factor, 2% FBS, vascular endothelial growth factor, human fibroblast growth factor-B and R3-insulin-like growth factor-1) to the supplied basal medium EBM-2 (see Note 1). 3. Human alveolar A549 epithelial cells (see Note 2). 4. EBM-10%: 10% FBS (see Note 1) in EBM-2 basal medium (see Note 1). 5. Hank’s buffered salt solution (HBSS) with phenol red without calcium and magnesium (see Note 1). 6. 0.25% Trypsin-EDTA solution. 7. Transwell® permeable supports (inserts), 3-μm polyester membranes, 6.5-mm (24-well) inserts (see Note 3). 8. Vented T75 and T162 flasks.

2.2. Experimental Components

1. Phosphate buffered saline (PBS). 2. Potato dextrose agar (PDA); prepared according to the manufacturer’s instructions. 3. EBM-2%: 2% FBS (see Note 1) in EBM-2 basal medium (see Note 4). 4. EBM-2 basal medium (see Note 1). 5. Green fluorescent protein (GFP)-expressing strain of A. fumigatus (3, 5, 6).

24

In Vitro Model of the Human Alveolus

363

6. Antifungal compound, for example, dissolve pure posaconazole powder in dimethyl sulfoxide, to produce a stock solution at 1,600 mg/L. Stocks of drug to be stored at −80°C until use. 7. Vented T25 flasks. 8. Non-woven sterile gauze/swabs 7.5 × 7.5 cm, 4-ply.

3. Methods Carry out all procedures at room temperature in a class II safety cabinet unless otherwise specified. Decontaminate cabinet (and equipment to be used within) before and after use with 70% industrial methylated spirits or 70% alcohol. Incubate at 37°C in 5% CO2 unless otherwise stated. All media should be warmed to 37°C prior to use (see Note 5). Avoid creating bubbles in tissue culture media, particularly during mixing steps. Minimise the length of time that cells are out of the incubator. 3.1. Construction of the Cellular Bilayer

Refer to Fig. 1 (flow diagram of procedure) for timings throughout. Media volumes are approximate during construction of the bilayer, with the exception of cell adjustment and application to the polyester membrane. Use sterile forceps to handle inserts. HPAEC and A549 cells are stored in liquid nitrogen, following the supplier’s instructions. 1. On day 1, resurrect HPAECs from liquid nitrogen ( see Note 6) into a vented T162 flask with 30 mL BulletKit medium and incubate for 24 h. 2. Change the HPAEC medium 24 h after resurrection and after a further 48 h (refer to Fig. 1). Do this by aspirating and discarding old medium with a serological pipette, then replace with fresh medium and re-incubate (see Note 7). 3. On day 4, resurrect A549 cells from liquid nitrogen (see Note 6) into a vented T75 flask with 15 mL EBM-10% medium and incubate for 24 h. 4. On day 5, change A549 medium. 5. On day 6, (Fig. 1) prepare HPAEC layer as follows: Aspirate medium from HPAEC flask with a serological pipette. Wash the surface of the flask with 20-mL of HBSS twice (see Note 8). Cover entire surface of cells with 6 mL trypsin, rock back and forth several times, and incubate at 37°C for ~5 min (see Note 9). Once detached, quickly re-suspend the cells in 20 mL BulletKit. Ensure maximal cell retrieval by gently rinsing the flask surface with the cell suspension and a serological pipette. Transfer the cells into a sterile 50-mL centrifuge tube

364

L. Gregson et al.

Day 1

resurrect HPAEC cells

Day 2

change HPAEC medium

Day 3

Day 4

change HPAEC medium

resurrect A549 cells

change A549 medium

Day 5

Day 6

prepare HPAEC layer

Day 7

prepare A549 layer

Day 8

change bilayer medium

Day 9

? change bilayer medium

Day 10

change bilayer medium

Day 11

? change bilayer medium

Day 12

conduct experiment

Fig. 1. Flow diagram of in vitro model preparation.

and centrifuge for 5 min at 125 × g. Remove the supernatant (taking care not to disturb the cellular pellet); re-suspend the pellet in BulletKit (approximately 1 mL per HPAEC flask) by gently mixing up and down with a Gilson pipette. Count the cells using a haemocytometer and adjust to 1 × 106 cells per mL in BulletKit (see Note 10). Invert the required number of inserts in a sterile tray (see Note 11), pipette 100 μL 1 × 106 cell/mL HPAECs onto the undersurface of each inverted insert (giving 1 × 105 cells per insert) and incubate inverted for 2 h. Flip inserts (to the correct way up) and place in 600 μL BulletKit in a 24-well tissue-culture-treated plate (see Note 12). Add 100 μL EBM-10% into the top compartment of the insert and incubate overnight.

24

In Vitro Model of the Human Alveolus

365

6. On day 7, (Fig. 1) prepare the A549 layer as follows: Transfer the inserts into fresh BulletKit (600 μL). Aspirate the previous days EBM-10% from the top compartment and incubate until required. Aspirate the medium from the A549 flask. Quickly wash the surface of the flask with 15 mL HBSS twice (see Note 8). Cover the entire surface of the cells with 6 mL trypsin, rock back and forth several times, and incubate at 37°C for ~5 min (see Note 9). Once detached, add 15 mL EBM-10% and gently wash the flask surface with the cell suspension. Transfer cells into a sterile 50-mL centrifuge tube and centrifuge for 5 min at 125 × g. Remove the supernatant whilst avoiding the cell pellet. Re-suspend the pellet in EBM-10% (approximately 1-mL per A549 flask). Count cells with a haemocytometer and adjust to 5.5×105 cells/mL in EBM-10%. Add 100 μL 5.5 × 105 cells/mL A549 onto the top layer of each insert (giving 5.5 × 104 cells per insert) and incubate (see Note 13). 7. Change insert medium every 24–48 h (Fig. 1). Do this by transferring the inserts into a new 24-well plate containing 600 μL fresh BulletKit whilst aspirating any medium from the top compartment. 3.2. Experiment

1. Subculture the A. fumigatus GFP strain onto PDA in a vented T25 flask. Incubate at 37°C (atmospheric CO2) for 7 days. 2. In a class II safety cabinet, harvest A. fumigatus spores by adding approximately 20-mL PBS and gently agitate the surface with a sterile swab or loop. Aspirate the fluid and place in 50-mL sterile centrifuge tube. Vortex vigorously for ~1 min. Aseptically place sterile gauze over a 50-mL sterile centrifuge tube, transfer the spore suspension through the gauze (see Note 14). Centrifuge the spore suspension at 1,000 × g for 10 min. Gently discard the supernatant. Re-suspend the pellet in 20 mL PBS to wash. Vortex for approximately 1 min and centrifuge at 1,000 × g for 10 min. Wash spores one further time in PBS. Store at 4°C until required (for up to 1 week). 3. Transfer inserts into 600-μL of EBM-2% whilst aspirating any residual medium from the top compartment. Vortex harvested spores vigorously for approximately 1 min. Count spores with a haemocytometer and dilute inoculum to 1 × 104 cfu/mL in EBM-2 basal medium. Ensure the inoculum is vigorously vortexed before each dilution step and prior to use. Inoculate the top compartment of the inserts with 100-μL 1 × 104 cfu/ mL spore suspension (1 × 103 spores per insert). Incubate at 37°C in 5% CO2 for 2 h. Remove the liquid from the top compartment (spores will have attached to the A549 monolayer) to maintain an air/liquid interface. Apply the antifungal drug of interest in EBM-2% to the lower compartment 6 h postinoculation.

366

L. Gregson et al.

4. Downstream analysis was performed 24 h after inoculation using galactomannan detection by commercial kit to determine the fungal burden and HPLC measurement of antifungal drug levels.

4. Notes 1. We use HPAEC cells, EGM-2 BulletKit medium, EBM-2 basal medium, FBS and HBSS supplied by Lonza. Omit gentamicin/ amphotericin from the EGM-2 medium if the latter may confound the experimental results. Alternatively, 100 units/mL penicillin and 0.1 mg/mL streptomycin can be used to reduce bacterial contamination, if required. 2. We use A549 cells from LGC Standards. 3. We use Transwells® produced by Costar Corning. 4. Use 2% FBS in the lower compartment during the experiment to simulate the human protein concentrations of the pulmonary capillary. 5. Ideally, media should be warmed on the day of use, but in our experience, it may be warmed for up to 24 h prior to use. Also, the appropriate volume of media should be aliquoted to avoid warming media more than twice. 6. Cells resurrected from liquid nitrogen should be defrosted swiftly to minimise damage from dimethyl sulfoxide (DMSO) in the storage media; warming in the crease of a gloved hand is preferable to a water bath to reduce the risk of contamination. 7. Aspirating or dispensing media by pipetting is preferable to pouring to minimise the risk of infection. 8. Gently rock the flask back and forth approximately six times, aspirate the HBSS and discard. Washing removes any traces of FBS which inhibits the action of trypsin. 9. Detachment of cells can be monitored by checking under a microscope (with experience detachment can also be visualised macroscopically when the flask is held up to a light source). The length of time the cells are outside the incubator should be minimised. Move to next step once approximately 95% cells have detached. Do not agitate the A549 cells by tapping or shaking whilst waiting for the cells to detach as this can cause clumping and atypical growth. 10. A small aliquot of the cell suspension may be diluted to facilitate counting. Optionally, the cells can be diluted in trypan blue (Sigma) to exclude counting non-viable cells.

24

In Vitro Model of the Human Alveolus

367

11. Invert the inserts, for example, in 140-mm glass sterile Petri dishes, which can be subsequently hot air–sterilised. Other sterile glass or plasticware can also be used, although caution should be taken with the height of the vessel, to avoid disrupting the cell suspension on inverted inserts. 12. Avoid spilling medium down the side of the inserts during flipping to minimise the risk of infection. 13. Removing EBM-2% after 2 h following addition of A549 cells creates an air/liquid interface, which is more physiologically appropriate for this pulmonary model. Alternatively, a liquid/ liquid interface can be adopted by simply leaving the medium in contact with both sides of the bilayer. 14. The gauze filtration step removes large clumps of hyphae, medium and hydrophobic spores, which eases subsequent counting. We do not use Tween in our inoculum, but this could be tried (0.05% Tween 80) if excessive conidial clumping is seen. References 1. Birkness, K. A., Deslauriers, M., Bartlett, J. H., White, E. H., King, C. H., and Quinn, F. D. (1999) An in vitro tissue culture bilayer model to examine early events in Mycobacterium tuberculosis infection. Infect Immun 67, 653–8. 2. Bermudez, L. E., Sangari, F. J., Kolonoski, P., Petrofsky, M., and Goodman, J. (2002) The efficiency of the translocation of Mycobacterium tuberculosis across a bilayer of epithelial and endothelial cells as a model of the alveolar wall is a consequence of transport within mononuclear phagocytes and invasion of alveolar epithelial cells. Infect Immun 70, 140–6. 3. Hope, W. W., Kruhlak, M. J., Lyman, C. A., Petraitiene, R., Petraitis, V., Francesconi, A., Kasai, M., Mickiene, D., Sein, T., Peter, J., Kelaher, A. M., Hughes, J. E., Cotton, M. P., Cotten, C. J., Bacher, J., Tripathi, S., Bermudez, L., Maugel, T. K., Zerfas, P. M., Wingard, J. R., Drusano, G. L., and Walsh, T. J. (2007) Pathogenesis of Aspergillus fumigatus and the

kinetics of galactomannan in an in vitro model of early invasive pulmonary aspergillosis: implications for antifungal therapy. J Infect Dis 195, 455–66. 4. Lestner, J. M., Howard, S. J., Goodwin, J., Gregson, L., Majithiya, J., Walsh, T. J., Jensen, G. M., and Hope, W. W. (2010). Pharmacokinetics and pharmacodynamics of amphotericin B deoxycholate, liposomal amphotericin B, and amphotericin B lipid complex in an in vitro model of invasive pulmonary aspergillosis. Antimicrob Agents Chemother 54, 3432–41. 5. Wasylnka, J. A., and Moore, M. M. (2002) Uptake of Aspergillus fumigatus conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect Immun 70, 3156–63. 6. Wasylnka, J. A., and Moore, M. M. (2003) Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci 116, 1579–87.

Chapter 25 Biofilm Formation Studies in Microtiter Plate Format Marta Riera, Emilia Moreno-Ruiz, Sophie Goyard, Christophe d’Enfert, and Guilhem Janbon Abstract Although Candida biofilms have been clearly identified as playing an increasingly important role in human disease, their biology and the reason for their poor susceptibility to antifungal agents remain largely unknown. Over recent years, various models have been developed in order to better characterize Candida biofilms. Here, we describe a number of rapid, inexpensive microtiter-format techniques and strategies which can be used for large-scale screening procedures aimed at identifying genes involved in Candida biofilm formation and/or potential antifungal agents with activity against pathogen cells growing under these conditions. The procedures could also be easily adapted for studying biofilm structures with a range of microscopy techniques. Key words: Biofilm, Candida albicans, Candida glabrata, Microtiter plates

1. Introduction A biofilm is defined as a community of microorganisms attached to a surface: it contains an exopolymer matrix and exhibits distinctive phenotypic properties (1). Biofilm cell physiology clearly differs from that of planktonic cells and is notably characterized by increased antibiotic resistance (2). Although a few studies have been published on biofilm formation in Coccidioides immitis and Cryptococcus neoformans, most of the fungal biofilm work has focused on Candida. The Candida species (and C. albicans and C. glabrata in particular) are major nosocomial pathogens and are responsible for various types of local and (often life-threatening) systemic infections. Medical implants (such as catheters, heart valve prostheses, and joint replacements) are all susceptible to colonization by microorganisms with the ability to attach to the device and

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_25, © Springer Science+Business Media, LLC 2012

369

370

M. Riera et al.

form a biofilm on its surface. Candida cells in biofilms display phenotypic traits that differ dramatically from those of their planktonic counterparts. Resistance to therapeutic drugs is remarkably high and is associated with increased expression of certain drug efflux pumps. Biofilms can thus constitute reservoirs for subsequent reinfestation (3). Furthermore, mucosal infections by Candida (thrush, vaginitis) are probably associated with the formation of biofilms that may limit the efficiency of currently available antifungal treatments. Despite clear evidence of the clinical relevance of such structures, little is known about the molecular mechanisms responsible for biofilm formation by C. albicans and other yeasts. Over the last few years, a number of different models have been developed in order to better characterize Candida biofilms, including (1) growth of adherent populations on small portions of catheters, acrylic strips, or silicone squares, (2) growth on cellulose acetate using a perfused biofilm fermenter, and (3) growth on plastic slides using a microfermenter and (4) microtiter plates (4–6). Lastly, different animal models of catheter-associated C. albicans biofilm infection have been set up (7–9). These models have mostly been used to study the structure of Candida biofilms and the resistance to various antifungals. Together, it has been shown that Candida biofilms on catheter materials (1) feature yeast cells in their lower layers and mycelia in their upper layers, (2) contain polysaccharide matrix polymers, and (3) are significantly more resistant than planktonic cells to fluconazole and (to a lesser extent) amphotericin B. Furthermore, in vitro models have enabled characterization of three phases in C. albicans biofilm development. The first step is cell adherence to the surface, which is followed by an intermediate phase during which microcolonies are formed and produce an extracellular matrix. Finally, a maturation phase occurs, during which biofilm growth is accomplished by cells embedded in extracellular material. One should note that a biofilm’s structure is dependent on the growth conditions, the model used, and the surface on which the biofilm is formed (10). In practice, a range of biofilm models can be used, depending on the experimental objectives. For example, transcriptome and proteome analyses require the formation of a large quantity of biofilm material, and so perfused fermenters or microfermenters are well suited to such work (5). However, when a rapid assay is needed or when screening procedures are involved, microtiter-format biofilms are probably the best choice. In this model, the biofilm can form either directly on the well material itself or on a fragment of another material placed in the well. In this latter situation, the piece of plastic on which the biofilm is formed can be recovered and used directly for microscopy analysis. Thus, in very recent years, microtiter-format models have been used to identify genes involved in Candida biofilm formation for the first time. By way of an example, a biofilm model on a silicone square placed in 12-well plates

25

Biofilm Formation

371

was used to screen a collection of C. albicans transcription factor knockout mutants, and the BCR1 gene was shown to be necessary for biofilm formation but not for filamentation (11). Similarly, this model permitted the identification of the ZAP1 gene as an important regulator of matrix formation in C. albicans biofilm (12). Furthermore, a 96-well plate model was used to show that the Yak1p kinase is required for biofilm formation by C. glabrata (13). The same model has been used to demonstrate the involvement of the Mkc1p kinase in C. albicans biofilm formation (14). Similarly, microtiter-format biofilms (formed either directly on the wall of the well or on a fragment of plastic placed in the well) have been used to study the antifungal resistance or sensitivity of Candida cells within this complex structure (15–17). In this chapter, we describe a number of microtiter-format protocols and strategies for studying Candida biofilm formation. 1.1. Quantification of Biofilm Formation in 96-Well Plates Using the XTT Colorimetric Assay

This is a rapid, colorimetric method for measuring cell viability, based on reduction of the XTT tetrazolium salt (2,3-bis(2-methoxy4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) by mitochondrial dehydrogenases. The method has previously been shown to yield an excellent correlation with biofilm dry weight (18) and is a modified version of the protocol originally described by Ramage and colleagues (19). An example of the results one can typically expect is displayed in Fig. 1.

1.2. Preparation of Microtiter-Format Candida Biofilms for Microscopy Analysis

It is quite difficult to use microscopy to study the structure of a biofilm formed on the wall of a microtiter well. In order to overcome this difficulty, a fragment of plastic (silicone or a piece of catheter, etc.) on which the biofilm can grow is placed in the well. The piece of plastic is subsequently recovered and the biofilm can then be fixed or labeled, depending on the microscopy technique used (scanning electron microscopy, cryoelectron microscopy, confocal microscopy, etc.). A typical scanning electron micrograph of a C. glabrata biofilm is shown in Fig. 2.

1

2

3

b XTT reduction (OD=492nm)

a

0.3 0.2 0.1 0 15

30

60 90 Time (min)

120

Fig. 1. XTT assay in a 96-well plate. (a) A typical example obtained with C. glabrata mutant strains. Lane 1: wild type (wildtype strain BG2) Lane 2: Biofilm− mutant strain. Lane 3: Biofilm++ mutant strain. (b) Graphic representation of the kinetics of XTT reduction as a function of the duration of incubation of adherent cells with XTT.

372

M. Riera et al.

Fig. 2. Scanning electron micrograph of a C. glabrata biofilm (strain GL137). The technique used to prepare the cells does not enable observation of the potentially present exopolymer matrix. The micrograph was produced by Brigitte Arbeille (Biologie Cellulaire et Microscopie Electronique, Tours, France) and is reprinted with the author’s personal permission.

1.3. Quantification of Candida Biofilms Using Fluorescein Diacetate

This assay is based on the production of biofilm in microtiter plates (modified from 16), followed by detection using fluorescein diacetate. Fluorescein diacetate (FDA) is a fluorogenic indicator of cell viability (see Fig. 3). FDA is hydrolyzed by the esterases in metabolically active cells, yielding intensely fluorescent fluorescein. This assay can be used to quantify C. albicans biofilms (17) and shows higher accuracy in the early stages of biofilm formation; this is probably due to the fact that the assay only reflects the number of metabolically active, accessible cells in the biofilm (see Fig. 3). In the early stages of biofilm formation, FDA-based quantification is linearly correlated with the actual biomass, but this is not the case in the later stages. Consequently, measurements made at various time points during the later stages of biofilm formation would not differ significantly.

2. Materials 2.1. Quantification of Biofilm Formation in 96-Well Plates Using the XTT Colorimetric Assay

1. 96-Well plates. 2. SC (synthetic, minimal defined medium for yeast): 6.7 g/L yeast nitrogen base w/o amino acids, 0.77 g/L drop-out uracil, and 0.1 g/L uracil. 3. SC medium with 2% glucose.

25

a

b

Biofilm Formation

373

1600 1400

Fluorescence

1200 1000 800 600 400 200 0 2 hours 6 hours 24 hours

Fig. 3. An FDA assay in a 96-well plate. (a) Structure of fluorescein diacetate (FDA). (b) Biofilm formation in C. albicans SC5314 measured via FDA-derived fluorescein production. One microtiter plate was used per time point, with the same strain or condition being represented in 11 wells. The standard deviation was less than 10% in all cases. Three independent sets of assays were performed.

4. PBS buffer (pH 7.4): 8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4⋅7H2O, and 0.24 g/L KH2HPO4. 5. XTT 10× stock solution: 5 mg/mL in PBS buffer. Store at 4°C. 6. Menadione 100× stock solution: 100 μM in acetone. Store at 4°C. 7. XTT-menadione working solution: 5 mL 10 × XTT stock solution, 44.5 mL PBS, and 0.5 mL menadione 100× stock solution. 8. 96-Well plate reader (492 nm filter). 2.2. Microtiter-Format Candida Biofilms for Microscopy Analysis

1. 24-Well plates. 2. Round, plastic coverslips. 3. Fixation buffer: 0.07 M sodium cacodylate buffer (pH 7.3), 1.2% glutaraldehyde, and 0.05% ruthenium red. 4. Wash buffer: 0.07 M sodium cacodylate buffer (pH 7.3) and 0.05% ruthenium red. 5. Postfixation buffer: 0.07 M sodium cacodylate/sodium hydroxide buffer (pH 7.3) and 1% osmium tetroxide. 6. Scanning electron microscope.

2.3. Quantification of Candida Biofilms Using Fluorescein Diacetate

1. 96-Well polystyrene microtiter plates, flat-bottomed (TPP). 2. 96-Well microtiter plates for fluorimetry. 3. Fluorescein diacetate (FDA) 50× stock solution: 2 g/L in acetone. Store at −20°C.

374

M. Riera et al.

4. FDA working solution: 0.2 mL FDA 50× stock solution, 9.8 mL PBS. 5. RPMI 1640 GlutaMAX (20 g/L glucose). 6. SD (synthetic minimal defined medium for yeast): 6.7 g/L yeast nitrogen base w/o amino acids and 4 g/L glucose. 7. A microtiter plate reader (with 486 ± 14 nm and 535 ± 25 nm excitation and emission filters, respectively).

3. Methods 3.1. Quantification of Biofilm Formation in 96-Well Plates Using the XTT Colorimetric Assay

1. Inoculate a single colony into 10 mL SC medium containing 2% glucose. Grow overnight at 37°C, with shaking at 80 rpm. 2. Centrifuge the overnight culture at 10,000 × g and wash the pellet in sterile H2O. 3. Measure the OD600 and dilute the culture to OD600 = 1 in SC medium containing 0.2% glucose. 4. Dispense 100 μL per well into polystyrene 96-well plates and grow overnight at 37°C, without agitation. Fill the last row with 100 μL SC medium per well to serve as the negative control. 5. Wash the microtiter plate; first, remove the culture (planktonic and nonadherent cells) by inverting the plate. Wash the plate three times by immersing in distilled water, followed by vigorous inversion to remove all remaining liquid. 6. Wash the plate again by carefully pipetting 100 μL of PBS buffer into each well and then completely removing any remaining fluid by pipetting. 7. Add 100 μL fresh XTT-menadione solution to each well. 8. Incubate the microplate for 90 min at 37°C without agitation. 9. Measure the OD492 for each well using a microtiter plate reader.

3.2. Preparation of Microtiter-Format Candida Biofilms for Microscopy Analysis

1. Inoculate a single colony into 10 mL SC medium containing 2% glucose. Grow overnight at 37°C with shaking at 80 rpm. 2. Determine the OD600 of the overnight culture. Calculate the amount of overnight culture necessary to inoculate a new 10 mL culture at OD600 = 1. 3. Centrifuge the calculated amount of overnight culture and wash the pellet in H2O.

25

Biofilm Formation

375

4. Centrifuge and resuspend the pellet in 10 mL SC medium containing 0.2% glucose (final OD600 = 1). 5. Add a plastic coverslip to each well in the 24-well plate. Dispense 0.5 mL of culture per well. The coverslip should remain at the bottom of well, completely immersed in the culture medium. Grow overnight at 37°C without agitation. 6. Remove the culture medium carefully by pipetting and then wash once with PBS buffer. For scanning electronic microscopy (SEM): 7. Fix the biofilm samples for 1 h in 2 mL fixation buffer at room temperature (see Note 1). 8. Wash the samples with wash buffer. 9. Postfix the samples in 2 mL of postfixation buffer for 1 h at room temperature. 10. Process the samples using the critical-point drying method (20) and view under the SEM. 3.3. Quantification of Candida Biofilms Using Fluorescein Diacetate

1. Inoculate a single colony in 10 mL SD medium containing 0.4% glucose. Incubate overnight at 30°C under agitation 80 rpm. 2. Dilute to OD600 = 0.05 in 10 mL RPMI-1640 GlutaMAX medium, buffered with 100 mM HEPES. 3. Inoculate 100 μL per well into a 96-well polystyrene microtiter plate (8 wells per strain). Fill the last row with 100 μL RPMI medium per well to serve as the negative control. 4. Seal the microtiter plate with Parafilm and incubate at 37°C for between 2 and 24 h without agitation (see Note 2). 5. Wash the microtiter plate; first, remove the culture (planktonic and nonadherent cells) by inverting the plate. Then, wash the plate three times by immersing in distilled water, followed by vigorous inversion to remove any remaining liquid (see Note 3). 6. Next, wash the plate again by dispensing 100 μL PBS per well. Remove the liquid by vigorous inversion. 7. Blot with paper towels to remove any residual liquid. 8. Add 100 μL of FDA solution per well. Wrap the plate in aluminum foil and incubate for 1 h at 37°C without agitation. 9. Transfer the supernatants to a microtiter plate for fluorimetry. Measure the fluorescence with a 486 ± 14 nm excitation filter and a 535 ± 25 nm emission filter.

376

M. Riera et al.

4. Notes 1. Biofilms obtained through this procedure can also be observed using cryomicroscopy. The excess liquid is removed, and the biofilm is directly proceeded to freeze-drying and heavy metal shadowing. 2. Alternatively, the medium containing nonadherent cells can be removed after 1 h and replaced by fresh medium. 3. Alternatively, steps 5–7 can be replaced by washing the plates using a Hydroflex automatic plate washer (Tecan) with two cycles of aspiration and dispensation of PBS and a final aspiration step. References 1. Donlan R.M. and Costerton J.W. (2002) Biofilms: survival mechanisms of clinical relevant microorganisms. Clin Microbiol Rev 15, 167–193. 2. Costerton J.W., Stewart P.S., and Greenberg E.P. (1999) Bacterial biofilms: a common cause of persistent infections. Science 284, 1318–1322. 3. Goldmann D.A. and Pier G.B. (1993) Pathogenesis of infections related to intravascular catheterization. Clin Microbiol Rev 6, 176–192. 4. Douglas L.J. (2003) Candida biofilm and their role infection. Trends Microbiol 11, 30–36. 5. García-Sanchez S., Aubert S., Iraqui I., Janbon G., Ghigo J.M., and d’Enfert C. (2004) Transcriptome invariance in biofilm populations of Candida albicans. Eukaryot Cell 3, 536–545. 6. Ramage G., VandeWalle K., Wickes B.L., and Lopez-Ribot J.L. (2001) Standardized method for in vitro antifungal susceptibility testing of Candida albicans biofilms. Antimicrob Agents Chemother 45, 2475–2479. 7. Andes D., Nett J., Oschel P., Albrecht R., Marchillo K., and Pitula A. (2004) Development and characterization of an in vivo central venous catheter Candida albicans biofilm model. Infect Immun 72, 6023–6031. 8. Ricicova M., Kucharikova S., Tournu H., Hendrix J., Bujdakova H., Van Eldere J., Lagrou K., and Van Dijck P. (2010) Candida albicans biofilm formation in a new in vivo rat model. Microbiology 156, 909–919. 9. Schinabeck M.K., Long L.A., Hossain M.A., Chandra J., Mukherjee P.K., Mohamed S., and Ghannoum M.A. (2004) Rabbit model of Candida albicans biofilm infection: liposomal

10.

11.

12.

13.

14.

15.

16.

amphotericin B antifungal lock therapy. Antimicrob Agents Chemother 48, 1727–1732. Chandra J., Patel J.D., Li J., Zhou G., Mukherjee P.K., McCormick T.S., Anderson J.M., and Ghannoum M.A. (2005) Modification of surface properties of biomaterials influences the ability of Candida albicans to form biofilms. Appl Environ Microbiol 71, 8795–8801. Nobile C.J. and Mitchell A.P. (2005) Regulation of cell-surface genes and biofilm formation by the C. albicans transcription factor Bcr1p. Curr Biol 15, 1150–1155. Nobile C.J., Nett J.E., Hernday A.D., Homann O.R., Deneault J.S., Nantel A., Andes D.R., Johnson A.D., and Mitchell A.P. (2009) Biofilm matrix regulation by Candida albicans Zap1. PLoS biology 7, e1000133. Iraqui I., Garcia-Sanchez S., Aubert S., Dromer F., Ghigo J.-M., d’Enfert C., and Janbon G. (2005) The Yak1p kinase controls expression of adhesins and biofilm formation in Candida glabrata in a Sir4p dependent pathway. Mol Microbiol 55, 1259–1271. Kumamoto C.A. (2005) In contact-activated kinase signals Candida albicans invasive growth and biofilm development. Proc Natl Acad Sci USA 102, 5576–5581. Bachmann S.P., VandeWalle K., Ramage G., Patterson T.F., Wickes B.L., Graybill J.R., and Lopez-Ribot J.L. (2002) In vitro activity of caspofungin against Candida albicans biofilms. Antimicrob Agents Chemother 46, 3591–3596. Kuhn D.M., George T., Chandra J., Mukherjee P.K., and Ghannoum M.A. (2002) Antifungal susceptibility of Candida biofilms: unique efficacy of amphotericin B lipid formulations and echinocandins. Antimicrob Agents Chemother 46, 1773–1780.

25 17. Ramage G. and Lopez-Ribot J.L. (2005) Techniques and antifungal susceptibility testing of Candida albicans biofilms. Methods Mol Med 118, 71–79. 18. Hawser S.P. and Douglas L.J. (1994) Biofilm formation by Candida species on the surface of catheter materials in vitro. Infect Immun 62, 915–921.

Biofilm Formation

377

19. Ramage G., Wickes B.L., and Lopez-Ribot J.L. (2001) Biofilms of Candida albicans and their associated resistance to antifungal agent. Am Clin Lab 20, 42–44. 20. Cagle G.D. (1974) Critical-Point Drying: Rapid method for the determination of bacterial extracellular polymer and surface structures. Appl Microbiol 28, 312–316.

Part V Fungal Responses During Infection

Chapter 26 Transcript Profiling Using ESTs from Paracoccidioides brasiliensis in Models of Infection Alexandre Melo Bailão, Maristela Pereira, Silvia Maria Salem-Izacc, Clayton Luiz Borges, and Célia Maria de Almeida Soares Abstract Transcript profiling is an invaluable strategy to study differential gene expression. Here we describe a detailed protocol for applying a subtractive hybridization technique, representational difference analysis (RDA), as a molecular strategy for the identification of differentially expressed genes in studies of hostfungus interaction. Bioinformatics tools that can be used in the analysis of expressed sequence tags (ESTs) are also detailed. Key words: Paracoccidioides brasiliensis, In vivo and ex vivo models of infection, RDA, ESTs, Bioinformatics tools

1. Introduction Representational difference analysis (RDA) couples subtractive hybridization to PCR-mediated kinetic enrichment for the detection of differences between genomes and transcriptomes. This method, first described by Lisitsyn and coworkers (1), was initially applied to the detection of differences between two genomes. Subsequently, Hubank and Schatz (2) adapted RDA for use with complementary DNA (cDNA), with Pastorian and coworkers (3) optimizing the methodology for identification of differentially expressed mRNAs. Differentially expressed cDNA sequences in two distinct populations (one designated driver and the other tester) are determined based upon a combination of subtractive hybridization and PCR amplification of the fragments present in one population but not in other. Following these steps, those

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_26, © Springer Science+Business Media, LLC 2012

381

382

A.M. Bailão et al.

fragments present in both populations are eliminated, leaving only the differentially expressed populations. This technique is a good strategy to be used when microarrays and/or genome sequences are not available. Besides that, RDA is cheaper and fast expression analysis method. In this chapter, we describe an application of the RDA methodology in the search for genes potentially relevant to pathogenesis of the pathogenic dimorphic fungus, Paracoccidioides brasiliensis. The methodology described has been adapted from previous RDA studies (3) and provides a through description of the RDA method employed to identify differentially expressed genes in yeast cells derived from infected mice and from ex vivo models of infection. The detailed laboratory protocol provides a step-by-step description of the procedure and includes a description of tools that can be used in the bioinformatic analysis of the obtained expressed sequence tags (ESTs).

2. Materials All solutions and reagents should be prepared and stored at room temperature, unless indicated otherwise. Dispose all used materials following waste disposal regulations. 2.1. Reagents for Infection Models

1. P. brasiliensis strain/isolate. 2. 40% Glucose solution. Sterilize by filtration. 3. Gentamicin (10 mg/mL). 4. Fava-Netto’s medium. Add 400 mL water to a 1-L beaker. Add 10 g bacteriological peptone, 5 g yeast extract, 3 g proteose peptone, 5 g beef extract, and 5 g NaCl. Adjust the volume to 900 mL with water. Mix and adjust pH to 7.2. Sterilize by autoclaving. Cool and add 1 mL gentamicin and 100 mL glucose solution. For semisolid medium, add 10 g agar prior to autoclaving. 5. 4–6-week-old BALB/c mice. 6. Isotonic saline (0.9% NaCl) solution. 7. Syringes (3 mL) and needles (22G1"). 8. Tissue grinder or homogenizer. 9. Organ culture medium. Add 400 mL water to a 1-L graduated container. Add 50 g of Brain and Heart Infusion (BHI) broth medium. Add water to 800 mL, mix, and adjust pH to 7.0. Add 10 g agar and make up to 860 mL with water. Sterilize by autoclaving (as described above). Cool and then add 100 mL glucose solution, 40 mL heat-inactivated fetal calf serum (FCS) (see Note 1), and 1 mL gentamicin.

26

Transcript Profiling from P. brasiliensis

383

10. Heparinized tubes: 10 mL BD Vacutainer® heparin blood collection tubes. 11. Human type II pneumocyte cell line A549 (ATCC). 12. Dulbecco’s modified Eagle’s medium (DMEM). Dissolve one vial of DMEM powder in 900 mL water and supplement with 100 mL heat-inactivated FCS (10% v/v final concentration) and 1 mL gentamicin. Sterilize by filtration. 13. 1× Phosphate buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 10 mM sodium phosphate (dibasic), 2 mM potassium phosphate (monobasic), pH 7.4. Sterilize by autoclaving. 14. Trypsin: Dissolve 0.02 g trypsin and 0.002 g EDTA in 10 mL 1× PBS. Store at −20°C. 15. 75 cm2 polypropylene tissue culture flasks. 2.2. RNA Extraction Components

1. Trizol reagent (GIBCO). 2. Glass beads (212–300 mm). Baked at 180°C for 4 h. 3. Chloroform. 4. Phenol/chloroform/isoamyl alcohol, 25:24:1. 5. 100% Isopropanol. 6. DEPC-treated water. Add 50 mL diethyl pyrocarbonate (DEPC) to 500 mL water, incubate at 4°C, with stirring, for 16 h, sterilize by autoclaving, and store at 4°C. 7. Precipitation solution: 0.8 M NaCl, 1.2 M sodium citrate (Na3C6H5O7) in RNase-free water. Store at 4°C. 8. Wash solution (75% ethanol). Store at 4°C.

2.3. Components for Representational Difference Analysis

Prepare all solutions using ultrapure RNase-free water and molecular grade reagents: 1. SuperScript® II Reverse Transcriptase (Invitrogen). Store at −20°C. 2. TE: 10 mM Tris–HCl, 1 mM EDTA, pH 7.5. Store at 4°C. 3. High-fidelity Taq polymerase, e.g., Platinum® Taq DNA polymerase (Invitrogen). Store at −20°C. 4. 10 mM dNTP mix. Store at −20°C. 5. RNaseOUT (Invitrogen). Store at −20°C. 6. Oligonucleotide primers (10 mM). Primer sequences are listed in Table 1. 7. Oligonucleotide adapters (500 mM). Adapter sequences are listed in Table 2. 8. Hybridization buffer: 3 mM EDTA, 30 mM EPPS (N-(2hydroxyethyl)piperazine-N¢-(3-propanesulfonic acid)). 9. 7.5 M ammonium acetate solution. Store at 4°C.

384

A.M. Bailão et al.

Table 1 Oligonucleotide primers for representational difference analysis Primer

DNA sequence (5¢–3¢)

cDNA

AGCAGTGGTATCAACGACAGAGTACGCGGG

CDS

AAGCAGTGGTATCAACGCAGAGTACT(30)N1N

PCRII

AAGCAGTGGTATCAACGCAGAGT

Table 2 Adapters for representational difference analysis Adapter

DNA sequence (5¢–3¢)

JBam12

GATCCGTTCATG

JBam24

ACCGACGTCGACTATCCATGAACG

NBam12

GATCCTCCCTCG

NBam24

AGGCAACTGTGCTATCCGAGGGAG

RBam12

GATCCTCGGTGA

RBam24

AGCACTCTCCAGCCTCTCTCACCGAG

10. 5 M NaCl. 11. 96% Ethanol. 12. 70% Ethanol. Store at 4°C. 13. Bsp143I restriction endonuclease (10 U/mL). Store at −20°C. 14. GFX purification kit (GE Healthcare). 15. T4 DNA ligase (5 U/mL). 16. pGEM®-T Easy Vector System (Promega). 17. Electrocompetent DH5a E. coli. 18. Electroporation cuvettes. 19. Electroporation apparatus. 20. Ampicillin (100 mg/mL). Sterilize by filtration. Store at −20°C. Add 50 mL for each 50 mL of LB agar that should be under 55°C. 21. X-GAL (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) (20 mg/mL) in dimethyl formamide (DMF). Store at −20°C. Add 75 mL for each 50 mL of LB agar that should be under 55°C.

26

Transcript Profiling from P. brasiliensis

385

22. 100 mM IPTG (isopropyl beta-D-thiogalactopyranoside). Sterilize by filtration and store at −20°C. Add 50 mL for each 50 mL of LB agar that should be under 55°C. 23. LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7.4). Store at 4°C. For plates, add 1.2% agar prior to autoclaving. 24. tRNA solution (1 mg/mL): Dilute 1 mg of yeast tRNA (Invitrogen) in 1 mL RNase-free water. 2.4. Components for Confirmation of Differential Expressed Genes Obtained by RDA Analysis

1. 96-well plates. 2. Sterile dH2O. 3. Slot-blot apparatus (GE Healthcare). 4. Nylon membrane. 5. Vacuum pump. 6. Gene Image Random Prime Labeling kit (GE Healthcare St. Giles, United Kingdom). 7. Gene Image CDP-Star detection module (GE Healthcare St. Giles, United Kingdom). 8. Platinum Taq DNA polymerase and 10× buffer. Store at −20°C. 9. Gene-specific oligonucleotide primers designed to confirm differential expression of RDA products (50 mM). 10. 2.5 mM dNTP mix. Store at −20°C.

2.5. Bioinformatic Analyses

1. Computer, with Internet access.

3. Methods 3.1. Mouse Intraperitoneal Infection

1. Grow P. brasiliensis yeast cells on Fava-Netto’s agar plates for 7 days at 37°C (see Note 2). 2. Transfer 5 × 106 P. brasiliensis yeast cells from the agar to 100 mL liquid Fava-Netto’s medium. 3. Incubate cultures at 36°C at 150 rpm for 72 h (see Note 3). 4. Harvest the fungal cells by centrifugation for 15 min at 3,500 × g. Wash cells twice with isotonic saline solution. Resuspend the cells in saline and enumerate by hemacytometer count. Adjust the cell suspension to 1 × 108 cells/mL. 5. Infect six male BALB/c mice intraperitoneally (see Note 4) (4), with 0.5 mL of fungal cell suspension using a syringe and 22 G needle. 6. Sacrifice the mice by cervical disjunction at 7 days postinfection. Aseptically dissect the liver from mice using scissors and

386

A.M. Bailão et al.

forceps and keep in saline. Transfer the livers to a tissue grinder, add 5 mL saline, and homogenize. Plate 100 mL homogenate on organ culture medium agar plates. 7. Incubate the plates at 36°C for 14 days (see Note 5). 8. Harvest the fungal colonies by using inoculating loops and follow the RNA extraction protocol. RNA from in vitro grown yeast cells cultured on the same medium must be collected as the control sample. 3.2. Mouse Systemic Infection

1. Prepare fungal cells for infection as in Subheading 3.1. 2. Infect 6 male mice (4-week-old) intravenously with 1 × 108 in a 100-mL volume (5). 3. Anesthetize mice and obtain blood samples by cardiac puncture at 10 and 60 min postinfection. Blood should be collected in heparinized tubes (see Notes 6 and 7). 4. Blood should also be collected from uninfected control animals. The control animals only receive sterile saline. 5. The collected blood was centrifuge to pellet cells, at 2,000 × g for 5 min. The cells were submitted to RNA extraction (Subheading 3.4).

3.3. A549 Pneumocyte Infection

1. Seed 1 × 107 A549 cells in a 75-cm2 flasks in 20 mL DMEM and incubate at 37°C in 5% CO2 for 18 h. 2. Add exponentially growing P. brasiliensis yeast cells to the pneumocyte culture, at a final concentration of 108 yeast cells/mL. 3. After 48 h, pour off the DMEM medium and non-adhered yeasts cells. 4. Wash the monolayer three times with 1× PBS, add 5 mL trypsin solution, and incubate for 30 min, at room temperature, to release the cells. 5. Transfer the infected cells to a 50-mL tube and collect by centrifugation at 3,000 × g for 10 min. Submit cells to total RNA extraction (Subheading 3.4). Uninfected pneumocytes should be used as negative controls.

3.4. RNA Extraction

1. For in vitro grown cells, harvest 300 mg yeast cells from culture medium and place in a frozen 2-mL polypropylene RNasefree tube. In order to obtain total RNA from fungus incubated with blood, pellet the cells by centrifugation (2,000 × g for 5 min) and then lyse the red blood cells with cold water. Pellet the fungal cells and wash them four times with cold water. For blood obtained from systemic mice infection, use the whole collected cells to proceed with extraction.

26

Transcript Profiling from P. brasiliensis

387

2. Immediately add 0.7 mL Trizol® reagent and 300 mg glass beads to each tube, mix vigorously for 15 min, and incubate at room temperature for 10 min (see Note 8). 3. Centrifuge the lysate at 10,000 × g for 5 min at 4°C and transfer the supernatant to a new 2-mL RNase-free tube. 4. For each 0.75 mL of recovered Trizol, add 0.2 mL chloroform, mix vigorously for 1 min, and incubate for 10 min at room temperature. 5. Centrifuge the tube at 10,000 × g for 5 min at 4°C and transfer the supernatant to a new 2-mL RNase-free tube. 6. Add an equal volume of phenol/chloroform/isoamyl alcohol, mix, and incubate for 10 min at room temperature. 7. Centrifuge the mixture at 10,000 × g for 5 min at 4°C and transfer the supernatant to a new 2-mL RNase-free tube. 8. For each 0.75 mL of recovered Trizol, add 0.25 mL precipitation solution and 0.25 mL isopropanol. Mix gently and incubate for 10 min at room temperature. 9. Harvest precipitated total RNA by centrifugation at 10,000 × g for 30 min at 4°C, remove the supernatant, and add 1 mL wash solution for each 0.75 mL of Trizol. 10. Centrifuge at 10,000 × g for 5 min at 4°C, remove the supernatant, and allow the pellet to air-dry for 30 min. 11. Resuspend the RNA pellet in 50 mL DEPC-treated water. Aliquot and store at −80°C. 12. Quantify and analyze the RNA quality using a spectrophotometer (A260/A280) and by visualization of rRNAs on 1.2% TBE agarose gel (see Fig. 1). 3.5. Representational Difference Analysis

RDA reactions should always be carried out in an RNase-/DNasefree environment. All reagents must be molecular biology grade:

Fig. 1. Total RNA obtained from P. brasiliensis yeast cells recovered from infected mice. Arrows indicate ribosomal RNA subunits.

388

A.M. Bailão et al.

1. To synthesize cDNA, mix 1–2 mg total RNA with 2 mL CDS primer. In a second tube, mix 2 mL SuperScript II, 4 mL firststrand buffer (supplied with enzyme), 1 mL DTT (supplied with enzyme), 2 mL 10 mM dNTP mix, 1 mL RNaseOUT, and 2 mL cDNA primer. Heat the RNA mixture at 72°C for 2 min. Transfer the samples to ice, wait 2 min, and then add the enzyme-containing mixture from tube 2 to the RNA sample. Incubate at 42°C for 90 min. Inactivate the reaction at 65°C for 5 min and then adjust the reaction volume to 100 mL with TE buffer. Store at −20°C. 2. For second-strand synthesis and cDNA amplification, mix 3 mL of the first-strand reaction, 1.5 mL Taq DNA polymerase, 10 mL 10× PCR buffer (supplied with Taq DNA polymerase), 4 mL 50 mM MgSO4 (supplied with Taq DNA polymerase enzyme), 2 mL PCR primer (10 mM), 2 mL 10 mM dNTP mix, and 77.5 mL of water. Perform a 25-cycle PCR reaction using the program: 95°C for 1 min, 95°C for 15 s, 55°C for 30 s, and 68°C for 5 min. 3. Run 10 mL of the amplified cDNA on a 1.5% agarose gel. The cDNA will appear as a smear with sizes ranging from 500 to 3,000 bp. Purify the cDNA using the GFX kit, following the manufacturer’s instructions, and elute the cDNA with 50 mL water. Run 5 mL of the purified cDNAs on a 1.0% agarose gel to verify cDNA integrity. Quantify cDNAs by spectrophotometry (see Note 9). 4. Digest cDNAs with the restriction enzyme Bsp143I as follows: Mix 500–1,000 ng cDNA (reserve 5 mL of undigested cDNA to verify digestion step), 0.5 mL Bsp143I (10 U/mL), 5 mL 10× buffer Bsp143I (supplied with the enzyme), and make up to 50 mL with water. Incubate the reaction at 37°C for 3 h. 5. Run 5 mL of the digested cDNA along with the 5 mL undigested sample on a 1.5% agarose gel. The size range of the digested cDNA must be lower than the undigested one (Fig. 2). Purify the digested samples using the GFX kit (elute with 30 mL water) and run the purified cDNAs on a 1.0% agarose gel to verify the cDNA integrity. Quantify samples by spectrophotometry. 6. To identify in vivo upregulated genes, it is necessary to ligate adapters to the cDNAs synthesized from fungal cells from infected mice. To isolate genes upregulated during in vitro growth (downregulated during infection), it is necessary to ligate adapters to the cDNAs synthesized from fungal cells grown in culture medium. Add 5 mL of each adapter (NBam12 and NBam24) to 20 mL of the tester cDNA. Incubate in a thermocycler using the following program: 55°C for 30 min, 53°C for 1 min, 52°C for 1 min, 50°C for 1 min, 45°C for 5 min, 40°C for 5 min, 30°C for 5 min, 25°C for 5 min, 20°C for 3 min, 15°C for 5 min, 10°C for 5 min, and 4°C for 30 min.

26

Transcript Profiling from P. brasiliensis

389

Fig. 2. Digestion of the synthesized cDNAs in RDA assays. The digested cDNAs have a size range lower than the undigested ones. The numbers on the left-hand side refer to the molecular size marker.

Add 0.5 mL T4 DNA ligase, 4 mL 10× ligase buffer (supplied with enzyme), and 5.5 mL water. Incubate at 16°C for 16 h. Purify using GFX kit and quantify the adapter-ligated cDNAs. 7. For subtractive hybridization, mix 200 ng control cDNA (driver) and 20 ng tester cDNAs, obeying 10:1 ratio (see Note 10). 8. Add 50 mL 7.5 M ammonium acetate and 375 mL ethanol. Incubate at −70°C for at least 2 h. Centrifuge at 12,000 × g for 30 min. 9. Wash the cDNA pellet twice with 70% ethanol and allow to air-dry at room temperature for 30 min. 10. Resuspend the cDNA mixture in 4 mL hybridization buffer. Add 1.5 mL 5 M NaCl to a second tube. Heat both tubes in a thermocycler at 95°C for 1 min, and then quickly transfer the cDNA mixture into the tube containing NaCl. Cover the hybridization reaction with 50 mL of mineral oil. Incubate at 95°C for 3 min and then at 67°C for 20 h (see Note 11). At this point, adjust the hybridization reaction volume to 45.5 mL with water. 11. To PCR amplify differentially expressed products 1 (DP1), mix10 mL 10× PCR buffer, 8 mL 50 mM MgSO4, 5 mL 10 mM dNTP mix, and 70.4 mL water. Transfer 10 mL of the mixture to a second tube, add 0.5 mL Taq DNA polymerase, and keep on ice. To the remaining mix in the first tube, add 0.1 mL adapter NBam24 and 6 mL hybridization reaction (template).

390

A.M. Bailão et al.

12. Heat the NBam24 reaction at 72°C for 2 min, add the Taq DNA polymerase mixture, and incubate for 5 min at 72°C. 13. Perform a 7-cycle PRC reaction using the following program: 95°C for 1 min, 7 cycles of 95°C for 45 s, 72°C for 4 min, and a final cycle of 72°C for 10 min. 14. After this, perform a second PCR amplification reaction using 6 mL of the first PCR reaction as the template. Use the same PCR program and reaction conditions, as described in step 13, but carry out 30 cycles. 15. Run 10 mL of the first and second PCR reactions on a 1.5% agarose gel. Purify using GFX kit (eluting in 50 mL of water) and quantify the remaining DP1 PCR products. 16. Remove the NBam adapters by digesting DP1 PCR reaction 2 products with the restriction enzyme Bsp143I as follows: Mix 1.0 mg DP1 PCR products (save 5 mL of the undigested), 0.5 mL Bsp143I (10 U/mL), 5 mL 10× buffer Bsp143I (supplied with the enzyme), and adjust the reaction volume to 50 mL with water. Incubate at 37°C for 3 h. 17. Run 5 mL digested DP1 and 5 mL undigested sample on a 2.0% agarose gel. The size range of the digested cDNA must be a little lower than undigested one (Fig. 3). 18. Purify the digested samples using the GFX kit (elute with 30 m L of water) and run the purified cDNAs on a 1.0% agarose gel to verify the cDNA integrity. Quantify samples by spectrophotometry. 19. Anneal and ligate the second adaptors set, as follows: Ligate RBam12 and RBam24 adapters to the remaining digested DP1 using the conditions described in Subheading 3.5, step 6.

Fig. 3. Digestion of the differential products obtained from the first round of RDA. Digested DP1s generate a small band (indicated by the arrow ) that corresponds to released adapters.

26

Transcript Profiling from P. brasiliensis

391

20. Perform the second round of subtractive hybridization using RBam-ligated DP1 as the tester, with a driver/tester ratio of 100:1 (200 ng of driver and 2 ng of tester). Follow the method described in this section from step 7, producing differentially expressed products 2 (DP2). 21. PCR amplify the DP2 using adapter RBam24 and the conditions described in Subheading 3.6, step 11. 22. Ligate amplified DP2 PCR products into pGEM-T Easy vector by mixing 80 ng DP2, 0.5 mL pGEM-T Easy vector, 0.5 mL T4 DNA ligase, and 1 mL 10× T4 DNA ligase buffer. Incubate at 16°C for 16 h. 23. Precipitate the ligation reaction by adding 50 mL 7.5 mM of ammonium acetate, 1 mL of yeast tRNA, and 375 mL ethanol to the ligation reaction. Incubate at −70°C for at least 2 h. Centrifuge at 12,000 × g for 30 min. Wash pellet twice with 200 mL of 70% ethanol. Resuspend in 5 mL of water. 24. Transform electrocompetent DH5a E. coli with the ligation reaction as follows: Add 1 mL of the ligation reaction to 80 mL electrocompetent cells. Mix gently and transfer the mixture to an electroporation cuvette. 25. Apply a voltage of 1,800 V. Add 1 mL LB medium and incubate at 37°C for 1 h. 26. Plate 50 mL of the transformation on an LB agar plates, containing ampicillin, X-GAL, and IPTG, and incubate overnight at 37°C. Recombinant clones (white, with no b-galactosidase activity) are carried forward for plasmid DNA extraction and insert sequencing. 27. Plasmid DNA extraction and DNA sequencing reactions should be carried out in 96-well plates due to the numbers of plasmids required to be analyzed (see Note 12). 3.6. Confirmation of Differential Expressed Genes Obtained by RDA Analysis

1. An initial screening to confirm differential expression of RDA products can be carried out by slot-blot analysis: (a) In a 96-well plate, make doubling dilutions, in water, of individual DP2-containing plasmids, from 1:2,000 to 1:64,000 (6 dilutions generated). (b) Transfer 100 mL of each DNA dilution by vacuum to a nylon membrane using a slot-blot system. (c) Label 50 ng cDNA obtained from control and treated samples with fluorescein using the Gene Images Random Prime Labeling kit, following the manufacturer’s instructions. (d) Hybridize the labeled cDNAs to the slot-blot membranes.

392

A.M. Bailão et al.

(e) Detect signals using the Gene Image CDP-Star detection module in accordance with manufacturer’s instructions. 2. Differentially expressed products can also be analyzed by Reverse Transcriptase (RT)-PCR once the sequence of the plasmid insert is known: (a) Synthesize cDNAs using total RNA extracted from infected pneumocytes and uninfected controls, as described in Subheading 3.5, step 1. (b) Design and synthesize specific forward and reverse products for the sequence of interest. (c) Using the cDNAs produced as templates, set up 25 mL PCR reactions as follows: 1 mL cDNA, 2.5 mL 10× PCR buffer, 0.5 mL MgCl 2, 2.5 m L 2.5 mM dNTPs mixture, 0.5 m L forward primer, 0.5 mL reverse primer, and 0.2 mL Platinum Taq. Perform a 35-cycle PCR reaction using the following program: 95°C for 1 min, 35 cycles of 95°C for 15 s, 50–62°C for 30 s (see Note 13), 72°C for 1 min per Kb PCR product, and a final hold at 4°C. (d) Run 5 m L of the PCR reactions on a 1.5% agarose gel. If differentially expressed, PCR products should be present in the infected sample and absent in the uninfected control, as shown in Fig. 4.

Fig. 4. Detection of the RDA-cDNA products by RT-PCR. RNAs were extracted from pneumocyteinfecting yeast cells isolated after 48 h of infection (PI). RNA from control, uninfected pneumocytes was used as the reference. P. brasiliensis gene names refer to target genes previously identified as differentially expressed by RDA (5); hsp30, 30 kDa heat shock protein; ctr3, a high-affinity copper transporter; gapdh, glyceraldehyde-3-phosphate dehydrogenase; gln1, glutamine synthetase; ef-1g, elongation factor 1g chain; hsp70, 70 kDa heat shock protein. Control reactions with Homo sapiens ribosomal protein L34 are indicated by c+.

26

Transcript Profiling from P. brasiliensis

393

Further confirmation of differential in vivo expression of specific products can be carried out by Northern analysis or quantitative real-time PCR (qRT-PCR) (see Note 14). 3.7. Bioinformatic Analyses 3.7.1. Preprocessing cDNA Sequences

1. Run Phred (6) to allow reading of the DNA sequence files, DNA base assignment, and quality assessment of bases assigned; available at http://www.phrap.org/phredphrapconsed.html (see Note 15). 2. Run Crossmatch (http://genome.uc.edu/genome/HelpPages/ phred-phrap-polyphred/swat-crossmatch.html) to remove vector sequences that might be present within each cDNA sequence. It is also important to remove adaptor sequences, the poly-A tail and the low-quality bases (see Note 16). 3. Eliminate any contaminant sequences, such as ribosomal, mitochondrial, or other sequences from a host organism, by running Blastn (see Notes 17 and 18) (7). 4. Assemble ESTs corresponding to the same transcript into contigs using either phrap (http://www.phrap.org) or cap3 (http:// genome.cs.mtu.edu/cap/cap3.html) programs (see Note 19).

3.7.2. Sequence Analysis and Annotation

1. Compare the contig and singlet DNA sequences with public databases (see Notes 20 and 21) in order to identify potential homologs and to assign putative functions to the ESTs. Blastx can be used (see Notes 17–18 and 22) (7). 2. To attribute a biological function for the gene product, run blast2GO (http://www.blast2go.org/) to search for functional categories (see Note 23). Alternatively, functional categories can be assigned using other databases, e.g., the Munich Information Center for Protein Sequences (MIPS) (http://mips.gsf.de/) database. 3. Where appropriate, run further in silico analyses to help characterize the protein of interest and/or hypothetical/predicted proteins (see Note 24). 4. To confirm differential gene expression, in silico transcription profiling (digital Northern analysis) can be performed (8) (see Note 25).

4. Notes 1. The FCS is inactivated by heating at 65°C for 30 min. 2. P. brasiliensis is a class II microorganism. The fungus should be handled under a hood. The handler must take basic precautions as wearing gloves, mask, and lab coat. All the contaminated material must be incinerated or sterilized before disposal.

394

A.M. Bailão et al.

3. Growth of P. brasiliensis for 72 h under these culture conditions is the time required for the fungal cultures reach exponential phase. 4. Use male BALB/c mouse because they are susceptible for P. brasiliensis infection. It has been the standardized protocol with 4-week-old mice (9, 10). Use sufficient mice to get enough total RNA to do RDA and confirmation experiments. Visually, the infected mice only present ruffled hair. They must be checked every day. 5. It takes about 14 days before the fungal colonies starts to be visualized. 6. Use ketamine and xylazine to anesthetize the mice intravenously. 7. About 5 × 105 yeast cells can be recovered. 8. It should be 15 min for P. brasiliensis because its cell wall is really thick. 9. Quantify cDNAs using 260 nm absorbance in spectrophotometer. 10. An excess (ten times) of driver cDNA is used, relative to tester cDNA, to force the subtraction of the nonregulated genes. 11. A long incubation time is necessary to increase the subtractive hybridization efficiency (3). 12. The number of plasmids sequenced depends upon the appearance of new sequences. The DNA sequencing should be stopped when the sequenced products do not represent new sequences in the pool of those already obtained. 13. The primer annealing temperature will vary depending upon the oligonucleotide primer pair annealing temperatures. 14. It is strongly suggested that the results found in the in vitro conditions analyzed are confirmed in an in vivo model, preferentially using real-time RT-PCR due to its high sensitivity. The differential gene expression found during incubation of P. brasiliensis cells with human blood may be confirmed using an intravenous model of mice blood infection (10), as described in Subheading 3.2. 15. This software reads DNA sequencing trace files, calls bases, and assigns a quality value to each called base. Phred can be downloaded at http://www.phrap.org/phredphrapconsed. html. This is a free program, but written permission from the author and the University of Washington is required. 16. Vector and adaptor sequences must be removed because they are not part of the insert, which is the aim of the study. The polyA tail and the low-quality regions must be removed because they can interfere with further alignment of the sequence. 17. BLAST (Basic Local Alignment Search Tool): This program compares your nucleotide or protein sequences to sequences present in database and calculates the statistical significance of matches.

26

Transcript Profiling from P. brasiliensis

395

This tool can be used to infer functional and evolutionary relationships between sequences and can also help to identify members of gene families. BLAST searches can be run at http://blast.ncbi.nlm.nih.gov/. Blastn specifically compares query nucleotide sequences with a nucleotide sequence database. Further detailed information about BLAST is available BLAST help page (http://blast.ncbi.nlm.nih.gov/Blast. cgi?CMD=Web&PAGE_TYPE=BlastDocs). 18. After comparison to the database sequences, an output file is generated with the analysis of each compared sequence. The similarity of each EST (query) with the sequences present in the database can be evaluated by two parameters: the “score” that attributes points to the number of coincidences between the amino acids of the query sequence and sequences present in the databank; and the “e-value” that evaluates the probability that the alignment could have occurred by chance. A detailed explanation on similarity scores is available at http://www.ncbi. nlm.nih.gov/BLAST/tutorial/Altschul-1.html. 19. Assembly of the contigs consists of joining sequences according to the EST sequence similarity and the quality of each base. It becomes possible to establish a consensus sequence by joining several ESTs corresponding to the same transcript. Sequences that do not form contigs are called singlets. 20. There are several publically accessible protein sequence databases available via BLAST (http://www.ncbi.nlm.nih.gov/BLAST/ blastcgihelp.shtml#protein_databases), with the one chosen depending upon the researcher’s questions. 21. To perform large-scale BLAST analyses (batch BLAST), the database(s) must be downloaded to a local computer/server. Detailed information is available at http://blast.ncbi.nlm.nih. gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastTips#6. 22. The Blastx algorithm compares all reading frames of the translated nucleotide sequence with all proteins present in a database. The best alignments are considered the putative identity of the sequence. If the best hit(s) of an EST is (are) hypothetical protein(s), predicted protein(s), or uncharacterized protein(s), other searches can be carried out in order to try to determine a putative function to the transcript. 23. Blast2GO (http://www.blast2go.org/) defines biological function using Gene Ontology (GO) terms. The GO project is a bioinformatics initiative with the aim of providing a controlled vocabulary to describe gene and gene product attributes across species and databases (http://www.geneontology. org/). This annotation describes, when possible, three categories to the same gene product: biological process, cellular component, and molecular function (11).

396

A.M. Bailão et al.

24. The following software programs/databases can be used to further analyze sequences: Interpro (http://www.ebi.ac.uk/ interpro/) searches for protein signatures within an amino acid sequence, Pfam (http://pfam.sanger.ac.uk/) searches for protein families, the KEGG pathway database (http://www. genome.jp/kegg/pathway.html) can be used to assign Enzyme Commission (EC) numbers and metabolic pathways, and PSORT (http://psort.ims.u-tokyo.ac.jp/) predicts protein sorting and localization signals within amino acids sequences. 25. “Transcript profiles” or “digital Northerns” are generated by counting the number of sequenced ESTs for a given gene within the whole sequenced EST populations. Differentially expressed genes can then be detected from variations in the counts of their cognate sequence tags when comparing two or more cDNA libraries. The probability of differential regulation can be computed using the link to the web interface available at http://igs-server.cnrs-mrs.fr/SpipInternet/spip. php?article168. These analyses can be performed only for nonnormalized cDNA libraries. References 1. Lisitsyn, N.A.(1995) Representational difference analysis: finding the differences between genomes. Trends Genet. 11(8): 303–7. 2. Hubank, M. and D.G. Schatz (1994) Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 22(25): 5640–8. 3. Pastorian, K., L. Hawel, 3rd, and C.V. Byus (2000) Optimization of cDNA representational difference analysis for the identification of differentially expressed mRNAs. Anal Biochem. 283(1): 89–98. 4. Cano, L.E., L.M. Singer-Vermes, C.A. Vaz, M. Russo and V.L. Calich (1995) Pulmonary paracoccidioidomycosis in resistant and susceptible mice: relationship among progression of infection, bronchoalveolar cell activation, cellular immune response, and specific isotype patterns. Infect Immun. 63(5): 1777–83. 5. Fradin, C., M. Kretschmar, T. Nichterlein, C. Gaillardin, C. d’Enfert and B. Hube (2003) Stage-specific gene expression of Candida albicans in human blood. Mol Microbiol. 47(6): 1523–43. 6. Ewing, B. and P. Green (1998) Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res. 8(3): 186–94.

7. Altschul, S.F.,T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller and D.J. Lipman (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17): 3389–402. 8. Audic, S. and J.M. Claverie (1997) The significance of digital gene expression profiles. Genome Res. 7(10): 986–95. 9. Costa, M., C.L. Borges, A.M. Bailão, G.V. Meirelles, Y.A. Mendonca, S.F Dantas, F.P. de Faria, et al. (2007) Transcriptome profiling of Paracoccidioides brasiliensis yeast-phase cells recovered from infected mice brings new insights into fungal response upon host interaction. Microbiology. 153: 4194–207. 10. Bailão, A.M., A. Schrank, C.L. Borges, V. Dutra, E.E. Walquiria Ines Molinari-Madlum, M.S. Soares Felipe, M.J. Soares Mendes-Gianinni, et al.(2006) Differential gene expression by Paracoccidioides brasiliensis in host interaction conditions: representational difference analysis identifies candidate genes associated with fungal pathogenesis. Microbes Infect. 8: 2686–97. 11. Ashburner, M., C.A. Ball, J.A. Blake, D. Botstein, H. Butler, J.M. Cherry, A.P Davis, et al.(2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 25: 25–9.

Chapter 27 Laser Capture Microdissection of Candida albicans from Host Tissue Caroline Westwater and David A. Schofield Abstract Laser microdissection is a technique in which specific populations of cells are acquired from sections of complex tissue under direct microscopic visualization. The technique can be used to selectively harvest or ablate host and/or fungal cells from a variety of biological specimens, including human, animal, or plant tissue sections. When coupled with downstream applications such as proteomic and molecular analyses, laser microdissection can address a variety of important biological questions specifically related to the in vivo host-fungus interaction. In this chapter, we describe how laser microdissection enables researchers to selectively isolate Candida albicans cells from host-infected tissue. Detailed protocols are provided for tissue handling and processing, slide preparation, and laser capture microdissection (LCM). Using these methods, we highlight the use of LCM to examine infection-related C. albicans gene expression. Key words: Laser capture microdissection, Host-fungal interaction, Tissue preparation, RNA analysis, Gene expression

1. Introduction Laser microdissection (LMD) is a valuable tool that can facilitate the selective sampling of individual cells, or a group of cells, from complex heterogeneous biological samples (1). This procedure has been applied to a diverse range of specimens including histological tissue sections, cytological smears, and live cell cultures (2–7). There are three general types of LMD available: ultraviolet (UV) cutting systems, infrared (IR) capture systems, and dual UV/ IR-based systems. Regardless of the instrument used, the basic steps in the LMD process are visual (microscopic) identification of target cells, dissection or ablation of selected cell populations, and downstream analysis of the microdissected sample.

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_27, © Springer Science+Business Media, LLC 2012

397

398

C. Westwater and D.A. Schofield

Fig. 1. The three principal steps in laser capture microdissection (LCM). Step 1: A cap containing a thermolabile polymer is placed on a tissue section. The optical-grade cap acts as an optic and focuses the infrared laser in the same plane as the tissue section. Step 2: Upon firing the infrared laser beam, the thermolabile polymer expands and makes contact with the tissue section only in the vicinity of the laser beam, forming a polymercell composite. Step 3: Removal of the cap from the tissue surface selectively detaches the cells adhering to the polymer.

Laser cutting microdissection platforms include automated systems such as the Zeiss PALM MicroBeam, the Leica LMD, the MMI CellCut Plus, and the ArcturusXT (dual IR/UV) (5, 8–10). In general, UV-LMD systems use a UV laser to cut selected cells from tissue sections that are mounted on a carrier membrane. Microdissected cells are then catapulted under pressure into a collection cap (PALM system), released by gravity into a tube beneath the microscope stage (Leica LMD system), or collected using an adhesive cap (CellCut Plus system). Laser cutting systems are ideal for microdissection procedures that involve thick (>20 μm) or whole mounted tissue sections (e.g., plant tissue). Since UV-based systems use a very narrow diameter laser beam (<1 μm), this system also provides fast, precise, and accurate dissection. Laser capture microdissection (LCM) platforms were developed originally at the National Institutes of Health (NIH) and commercialized through a CRADA agreement with Arcturus Inc. (now offered through Applied Biosystems, Life Technologies) (9, 11–13). LCM systems deliver a gentler technique that preserves cell morphology and maintains the integrity of cellular constituents within the captured material (11). In the LCM system, a thermoplastic polymer film located at the bottom of an optical-grade plastic cap is placed over a glass slide containing a tissue section (Fig. 1, step 1). A low-energy IR laser is then pulsed over the cells or tissue of interest, causing the polymer to soften and expand down into the tissue at the position of the target beam (Fig. 1, step 2). The polymer surrounds the target cells, and the resulting polymer-cell composite is removed from the slide when the cap is lifted (Fig. 1, step 3). This process can be repeated multiple times across the entire cap surface until sufficient target cells are collected. DNA, RNA, and protein obtained from LCM-harvested cells can subsequently be used for downstream applications such as genomic, transcriptomic, and proteomic analysis (11).

27

Laser Capture Microdissection of Candida

399

In this chapter, we describe the application of LCM as an approach to specifically isolate fungal cells from host-infected tissue and illustrate the suitability of LCM-extracted RNA for analyzing infection-related changes in Candida albicans gene expression. The protocol describes in detail the key steps in the microdissection process, namely, (a) tissue preparation, (b) slide fixation and dehydration, (c) laser capture microdissection, and (d) downstream analysis of isolated RNA.

2. Materials 2.1. Specimen Freezing and Tissue Sectioning Components

1. Freshly harvested tissue samples. 2. Liquid nitrogen. 3. Cryostat-microtome apparatus with disposable microtome blades. 4. Tissue-Tek cryomolds. 5. Tissue-Tek compound.

optimum

cutting

temperature

(O.C.T.)

6. 2-Methylbutane (isopentane). 7. Dry ice. 8. Forceps. 9. Brushes. 10. Glass slides, plain, uncharged, precleaned. 11. Microslide box. 2.2. Fixation and Dehydration Components

1. Slide staining jars. 2. Forceps. 3. Ethanol 100%, HistoGene LCM Frozen Section Staining Kit (KIT0419). 4. Nuclease-free distilled water. 5. Ethanol; 95% (vol/vol) and 75% (vol/vol) in nuclease-free water. 6. Xylene, HistoGene LCM Frozen Section Staining Kit (KIT0419). 7. Humid chamber and horizontal staining rack. 8. Desiccant. 9. Lint-free paper towels.

2.3. Laser Capture Microdissection Components

1. IR-LCM manual system (PixCell) or IR/UV-LCM automated system (ArcturusXT). 2. CapSure HS LCM caps (Arcturus).

400

C. Westwater and D.A. Schofield

3. CapSure Macro LCM caps (Arcturus). 4. CapSure Cleanup pads (Arcturus), optional. 2.4. RNA Purification and Analysis Components

1. PicoPure RNA Isolation Kit and User Guide (Arcturus). 2. RNase-free DNase (Qiagen). 3. Microcentrifuge. 4. Incubation oven (42°C). 5. Microcentrifuge tubes, 0.5 mL (see Note 1). 6. Lidless support tubes, 2 mL (PGC Scientific). 7. Bioanalyzer 2100 and RNA 6000 LabChip kit (Agilent). 8. RiboAmp HS RNA Amplification Kit and User Guide (Arcturus). 9. Thermal cycler with heated lid.

3. Methods 3.1. RNase-Free Precautions

Minimize RNase contamination by adhering to the following recommendations throughout the protocol: 1. Wear disposable gloves and change them frequently. 2. Use RNase-free certified solutions, glassware, and plasticware, including nuclease-free barrier pipette tips. 3. Use disposable scalpels and microtome blades. 4. Wash forceps and bake at 210°C for 4 h before use. 5. Clean work area with commercial RNase decontamination solutions (e.g., RNaseZap (Applied Biosystems) or RNase AWAY (Invitrogen)).

3.2. Specimen Freezing and Embedding in O.C.T. Compound

1. Place freshly harvested tissue inside a polypropylene tube. 2. Close the tube and freeze immediately in liquid nitrogen (see Notes 2 and 3). 3. Store the tissue at −80°C until you are ready for tissue embedding. 4. Prepare an isopentane/dry ice bath (see Note 4). 5. Place an empty, labeled cryomold in the isopentane/dry ice bath for 1 min. 6. Add a thin layer of O.C.T. embedding medium to the cryomold and cool until it is slushy and viscous. 7. Place the frozen tissue specimen into the O.C.T./cryomold. Using forceps, orient the tissue in the desired orientation and press until it is flush with the bottom of the cryomold.

27

Laser Capture Microdissection of Candida

401

8. Add O.C.T. to the cryomold until the tissue is completely covered and the cryomold is filled. 9. Wait for the O.C.T. to harden (the O.C.T. will appear white when frozen). 10. Store the frozen blocks at −80°C until ready to use or proceed immediately to tissue sectioning and slide preparation. 3.3. Tissue Sectioning and Slide Preparation

1. Precool the cryostat-microtome to the temperature recommended by the manufacturer (usually −24°C to −30°C). 2. Wipe the cryostat-microtome knife holder and antiroll plate with 100% ethanol to avoid cross-contamination between samples. Remove and discard the old microtome blade. Use a set of brushes designated for RNA work (brushes can be treated with RNaseZap). 3. Cool the specimen stage and brushes in the cryostat. 4. Place an airtight microslide box on dry ice near the cryostat. 5. Remove the cryomold containing the embedded specimen from −80°C. While inside the cryostat-microtome, remove the frozen O.C.T.-embedded tissue from its cryomold and mount the tissue block to the metal specimen stage with O.C.T. medium (see Note 5). 6. Equilibrate the tissue (at least 10 min) to the cryostat temperature (−24°C to −30°C). 7. Attach and orient the specimen stage to the microtome holder. 8. Install a fresh disposable microtome blade into the blade holder. A fresh microtome blade should be used for each specimen block. 9. Trim the block until the tissue becomes visible. 10. Set the cutting thickness to 5–8 μm. 11. Cut serial sections from the frozen tissue block. Up to two sections can be positioned in the center of a room temperature, labeled plain, uncharged, microscope slide (see Note 6). Discard any slide with folded or wrinkled sections. 12. Place the slides immediately in the cold microslide box on dry ice. Do not allow the tissue sections to dry or warm to room temperature. 13. Proceed to Subheading 3.4 or store slides in a tightly closed box with desiccant at −80°C for up to 1 month.

3.4. Fixation and Dehydration

1. Label nine staining jars as follows: (a) 75% ethanol, (b) nuclease-free water, (c) 75% ethanol, (d) 95% ethanol, (e) 95% ethanol, (f) 100% ethanol, (g) 100% ethanol, (h) xylene, and (i) xylene (see Notes 7 and 8).

402

C. Westwater and D.A. Schofield

2. Fill the labeled slide jars with 25 mL of the appropriate solution. 3. All tissue sections to be microdissected in a single session should be fixed and, if necessary, stained simultaneously in batches of four slides (see Notes 9 and 10). Remove each batch of slides from the −80°C freezer and place on a lint-free paper towel and allow the slides to thaw for no more than 15 s. Use forceps to transfer slides sequentially from jars (a) through (i) as described below. Blot the slide on lint-free paper towel between each solution to prevent carryover from the previous solution (see Note 11): Fix with 75% ethanol for 30 s; jar (a) Rinse with nuclease-free water for 30–45 s; jar (b) Wash with 75% ethanol for 30 s; jar (c) Wash with 95% ethanol for 30 s; jar (d) Wash with 95% ethanol for 30 s; jar (e) Dehydrate with 100% ethanol for 30–60 s; jar (f) Dehydrate with 100% ethanol for 30–60 s; jar (g) Dehydrate with xylene for 2 min; jar (h) Dehydrate with xylene for 5 min; jar (i) 4. Remove the slides from the slide jar and prop each slide on end on top of a paper towel to allow excess liquid to drain away. Place the slides on a slide rack in a box containing fresh desiccant and store for 10 min (see Note 12). Remove one slide and proceed to Subheading 3.5. 3.5. Laser Capture Microdissection

Microdissection can be performed with the manual Arcturus PixCell or automated ArcturusXT system (Applied Biosystems, Life Technologies). The LCM process consists of five basic steps: (a) instrument setup, (b) inspection of the tissue section, (c) selection of the target cells, (d) microdissection, and (e) collection of the dissected cells. For downstream applications such as RNA analysis, the entire procedure (as described in Subheadings 3.4 and 3.5) should be limited to less than 30 min. The following brief overview provides a summary of the detailed instructions described in the Arcturus LCM System User Guide: 1. Start up the LCM instrument and launch the system’s operating software according to the manufacturer’s User Guide (see Note 13). 2. Place the “roadmap” periodic acid-Schiff (PAS) stained and coverslipped slide (see Note 9) onto the stage and locate the cells of interest. Adjust the focus and brightness if needed. Acquire the “roadmap” image (a low- and/or high-power objective image of the area of interest or specific cells to be dissected).

27

Laser Capture Microdissection of Candida

403

3. Place a consecutive unstained, non-coverslipped slide onto the stage (see Note 14). Adjust the focus and brightness if needed. Locate the area of interest using histological reference points from the “roadmap” slide. Place a CapSure cap onto the slide. 4. Perform a laser focus and spot test in an area without tissue using the small (7.5 μm) spot size setting and the 10× objective. Adjust the target beam until the beam reaches the sharpest intensity and most concentrated light. Fire the laser and observe the wetted polymer after firing. Adjust the IR laser settings so the laser pulse produces a melted polymer spot with a sharp dark outer ring and a clear center. Poor spots will have a fuzzy appearance and will lack a distinct black ring. Once you have obtained a properly “wetted” spot, measure the diameter of the spot. If the diameter is not similar in size to the selected laser spot size, then adjust both the laser power and duration settings. Only cells lying within the diameter of the black melted polymer will be targeted for microdissection with each laser pulse (see Note 15). The IR test spot should be performed for each initial cap placement and anytime the cap is repositioned on the slide. 5. Align the laser directly over the cells of interest and acquire the “Before LCM” image (Fig. 2). Microdissect the cells of interest by manually firing the laser (PixCell system, see Note 16) or automatically capturing previously marked areas of interest (ArcturusXT system). 6. After the target cells have been collected on the cap, remove the cap by lifting it off the slide. Acquire the “After LCM” and “Cap” image (Fig. 2) (see Note 17). Observe the cap for debris and/or adhesion of nonspecific tissue (see Note 18). 7. When complete (see Note 19), snap the polymer end of the cap onto a 0.5-mL microcentrifuge tube and proceed immediately to RNA extraction. 3.6. RNA Purification and Analysis

1. Prepare RNA from microdissected cells using the PicoPure RNA Isolation Kit (Arcturus) (refer to User Guide, including Appendix A) (see Note 20). RNA can be used immediately or stored at −80°C until needed. Quality control by direct agarose gel analysis of the RNA is not feasible at this stage (see Note 21). 2. Subject LCM-derived RNA to two rounds of linear amplification (see Notes 22 and 23) using the RiboAmp HS RNA Amplification Kit (Arcturus) (see Notes 24 and 25). 3. Determine the quantity and quality of the amplified RNA (aRNA) by UV spectrophotometry, the Agilent Lab-on-a-Chip System (RNA 6000 Nano Assay Kit), and/or agarose gel electrophoresis.

404

C. Westwater and D.A. Schofield

Fig. 2. Laser capture microdissection of C. albicans-infected mouse tissue. Frozen-tissue sections (8 μm) were prepared from gnotobiotic transgenic epsilon 26 mice orally inoculated with C. albicans. Unstained tongue tissue before LCM (a), after LCM (b), and the captured cells on the cap (c). Consecutive PAS-stained slide illustrates fungal invasion and destruction of the mucosal epithelium (d). Arrow in panels b and c represents IR test fire spot indicating proper laser focusing, adequate laser power, and acceptable performance of the polymer (i.e., properly melted spot).

Using the procedures described above, we have successfully obtained sufficient C. albicans RNA from LCM-generated hostinfected tissue samples to perform microarray hybridization experiments (data not shown) and qRT-PCR gene expression analysis (Fig. 3).

4. Notes 1. These tubes are specifically recommended because they do not leak when the LCM cap is in place and the tube is inverted. 2. Ensure tissue is snap-frozen in liquid nitrogen immediately (<5 min after the animal is euthanized). Time is critical since C. albicans cells can rapidly change their global transcriptional profile in response to environmental changes (15).

27

Laser Capture Microdissection of Candida

405

Fig. 3. C. albicans gene expression analysis during the host-fungal interaction. Differential gene expression was analyzed using relative (gel images) and real-time (fold changes) RT-PCR. RT-PCR was performed with amplified RNA isolated from C. albicans cells colonizing the gastrointestinal tract (ceca contents), invading oral tissue (tongue tissue, LCMcaptured), or grown under laboratory conditions (in vitro). In vivo samples were isolated from orally inoculated gnotobiotic transgenic epsilon 26 mice 2–3 weeks after monoassociation. Genes expressed during oral infection (tongue) were compared to ceca and/or in vitro samples (arrows, fold changes). Duplicate samples were analyzed for each condition. The predicted RT-PCR product sizes (bp) were EFB1 (constitutively expressed mRNA), 184; ZRT1, 177; and MAL2, 113. Lane M, 100 bp DNA ladder. Lane 1, negative PCR control.

3. The type of fixation method used impacts greatly on the quality of DNA, RNA, and proteins obtained from microdissected cells. In general, the longer the fixative takes to infiltrate the tissue, the more likely RNA or protein degradation will occur due to nuclease and protease activity. Although formalin-fixed, paraffin-embedded (FFPE) samples are a popular choice in histology laboratories, retrieval of high-quality nucleic acids from FFPE tissues poses a significant technical challenge (14). Gene expression analyses on RNA isolated from FFPE tissues are particularly problematic because formalin fixation traps and cross-links RNA to other molecules. In addition, RNA is usually modified and degraded to such a degree that it is not compatible with many downstream molecular techniques. For these reasons, we highly recommend that samples are frozen and embedded in O.C.T. for optimal RNA recovery. 4. Place dry ice in an appropriate container and slowly pour isopentane into the container until the isopentane level is just above the layer of dry ice. The isopentane will bubble upon contact with the dry ice. When this has subsided, the isopentane is ready for use. Isopentane has a very low flash point and should be kept away from naked flames. Perform the procedure in a fume hood or well-ventilated space. 5. Frequent cycling of the tissue block from −80°C to −20°C for cryosectioning will accelerate RNA degradation. However, it is

406

C. Westwater and D.A. Schofield

best to store the tissue block rather than storing the cut tissue sections; therefore, it is recommended that a sufficient number of slides be prepared for only 1 month’s usage. 6. Lung tissue may be cut onto charged or silanized slides to prevent nonspecific adherence to the thermolabile polymer cap; however, samples prepared on charged slides may exhibit reduced microdissection efficiency. 7. The staining jars must be cleaned between each batch of slides. Rinse jars with 100% ethanol, distilled water, and then treat with RNase removal solution (RNaseZap or RNase AWAY) according to the manufacturer’s protocol. Rinse the jars with nuclease-free water and allow the jars to dry. 8. Ethanol is hydroscopic. Store ethanol in tightly closed containers to avoid introducing moisture from the air. Xylene is flammable and a contact hazard. Wear gloves and handle in the fume hood. 9. It is useful to stain the first section and then every fifth section using periodic acid-Schiff’s reagent (PAS). These coverslipped slides cannot be used for microdissection but can be imaged and used as a histological reference (“roadmap” image) for fungal localization within consecutive sections. 10. Slides intended for microdissection can be directly stained to facilitate cell identification; however, RNA damage can occur during conventional staining procedures, resulting in loss of representation of certain genes in microarray hybridization. Wang et al. (16) has shown that traditional histological staining methods such as hematoxylin and eosin (H&E), Nissl stain, methyl green pyronin, and immunofluorescence significantly affect the integrity of RNA. Several companies have developed specialized staining procedures that avoid exposing tissue sections to aqueous solutions that reactivate endogenous RNase activity and are optimized for minimal preparation time (e.g., the Arcturus HistoGene LCM Frozen Section Staining Kit and Ambion LCM Staining Kit) (17). Unfortunately, these stains lack fungal specificity (e.g., cresyl violet [basic nuclear stain], acridine orange [fluorescent nucleic acid stain], and a proprietary stain equivalent to H&E). 11. For best results, change the water and ethanol solutions for each batch of four slides, or every time a new tissue specimen is processed, to avoid cross-contamination. Xylene can be changed every 6–8 slides. 12. It is imperative that the slide be completely dry before cap placement because xylene dissolves the LCM cap polymer. 13. It is recommended that a dehumidifier be placed near the LCM station to keep the ambient humidity in the range of 25–45%. High humidity can severely compromise LCM experiments.

27

Laser Capture Microdissection of Candida

407

If the humidity and temperature in the room are high, the tissue may become rehydrated. Samples with residual moisture are subject to hydrostatic forces that will make it difficult to separate the tissue from the slide after LCM. 14. Coverslips, mounting media, and immersion oil are not compatible with microdissection. The reduction in refractive index and scattering of light passing through the tissue will make the section appear darker, and the detail of a given tissue stain will be lost as the slide dries. 15. Complete dehydration of the tissue is critical; otherwise, the melted thermoplastic film may not bond to the tissue properly resulting in poor cell capture. To reduce this problem, (a) replace the ethanol and xylene with fresh solutions, (b) increase the incubation time for the 100% ethanol and xylene rinses to enhance dehydration (see Subheading 3.4, step 3), and (c) modify the staining protocol, if applicable. 16. When manually capturing large areas of tissue, it is best to microdissect from the center of the area and work out toward the perimeter. 17. Poor transfer of microdissected tissue from the slide to the cap may occur for the following reasons: (a) poor contact of the cap with the tissue (especially near folded tissue sections or when near previously used areas of the cap), (b) incomplete dehydration and drying, (c) sections are too thick, and (d) laser power is inadequate. This issue is usually overcome by (a) lifting and resetting the cap, (b) selecting an unused area of the cap, (c) using an entirely new cap, or (d) increasing the laser power to ensure adequate polymer melting. 18. Nonspecific adherence of tissue to the polymer cap can be removed prior to placement in extraction buffer by using a CapSure Cleanup pad (the glue strip on an unused Post-it note also works just as well). Nonspecific adherence may suggest that the tissue section was inadequately fixed or overdehydrated. 19. The amount of tissue required and the number of sections that need to be cut will vary depending on the abundance of the desired cell population within the tissue, the abundance of the mRNA transcript to be analyzed, the tissue preparation procedures, and the efficiency of the microdissection operator. The tissue type can also influence the outcome because RNase activities vary dramatically across different tissues. 20. The PicoPure RNA Isolation Kit is a spin column-based purification method, which has been optimized for RNA recovery from LCM captured cells on CapSure LCM caps. In this system, cells are extracted from the LCM cap and the RNA captured on a preconditioned RNA purification column. The column is

408

C. Westwater and D.A. Schofield

washed and a DNase treatment is performed to remove genomic DNA. The column is washed again and total cellular RNA eluted in a low ionic strength buffer. 21. RNA recovered from LCM material is not expected to exceed the minimum concentration (200 ng) required for traditional gel-based analysis. RNA may be analyzed for quality and approximate yield using the Agilent RNA 6000 Pico assay with the Agilent 2100 Bioanalyzer. The Agilent Pico LabChip kit requires a small sample volume and a minimum of 50 pg/μL total RNA for analysis. 22. The amount of RNA recovered from LCM samples is very small and is a limiting factor for subsequent downstream analysis. 23. Previous studies have shown that two rounds of linear amplification can be used reliably, without compromising RNA quality or skewing patterns of gene expression (15, 18–22). Although sequence-specific biases introduced during amplification are negligible, it is important that all samples compared during downstream analysis are amplified and treated in a similar manner (21). 24. A number of amplification kits are available from a variety of vendors (18). For all amplification kits, it is important to irradiate the work bench/hood every 3–4 days to remove contaminants from previous amplification experiments. 25. The RiboAmp HS Kit generates microgram quantities of amplified RNA (aRNA) from picogram quantities of total RNA using two rounds of a five-step amplification process. Briefly, mRNA is reverse transcribed with an oligo dT primer containing a T7 promoter sequence (1st strand synthesis). The mRNAcDNA hybrid is converted to double-stranded cDNA (2nd strand synthesis) and the cDNA purified on a Purification Column. aRNA is subsequently generated by in vitro transcription with T7 RNA polymerase. The aRNA is then purified on a Purification Column. aRNA quantity and quality can be determined by UV spectrophotometry, the Agilent Lab-on-aChip System (RNA 6000 Nano Assay Kit), and/or agarose gel electrophoresis.

Acknowledgments The authors thank Dr. Edward Balish, Dr. Bernhard Hube, Dr. Bart Frank, and Dr. Debra Hazen-Martin for informative discussions. We also thank the Gnotobiotic Animal Research Core at the Medical University of South Carolina. This work was supported by NIH grants R43DE017033, R21AI078098, and R21AI076721.

27

Laser Capture Microdissection of Candida

409

References 1. Murray, G. I. (2007) An overview of laser microdissection technologies. Acta Histochem 109, 171–176. 2. Zhu, G., Xiao, H., Mohan, V. P., Tanaka, K., Tyagi, S., Tsen, F., Salgame, P., and Chan, J. (2003) Gene expression in the tuberculous granuloma: analysis by laser capture microdissection and real-time PCR. Cell Microbiol 5, 445–453. 3. Semblat, J. P., Silvie, O., Franetich, J. F., Hannoun, L., Eling, W., and Mazier, D. (2002) Laser capture microdissection of Plasmodium falciparum liver stages for mRNA analysis. Mol Biochem Parasitol 121, 179–183. 4. Klitgaard, K., Molbak, L., Jensen, T. K., Lindboe, C. F., and Boye, M. (2005) Laser capture microdissection of bacterial cells targeted by fluorescence in situ hybridization. Biotechniques 39, 864–868. 5. Schutze, K., Niyaz, Y., Stich, M., and Buchstaller, A. (2007) Noncontact laser microdissection and catapulting for pure sample capture. Methods Cell Biol 82, 649–673. 6. Ramsay, K., Jones, M. G., and Wang, Z. (2006) Laser capture microdissection: a novel approach to microanalysis of plant-microbe interactions. Mol Plant Pathol 7, 429–435. 7. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., and Wildermuth, M. C. (2010) Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci USA 107, 460–465. 8. Kolble, K. (2000) The LEICA microdissection system: design and applications. J Mol Med 78 , B24-25. 9. Bagnell, C. R. (2006) Laser Capture Microdissection. In: Coleman, W. B. and Tsongalis, G. J. (Ed). Molecular Diagnostics: For the Clinical Laboratorian. Second Edition, Humana Press, NJ, p. 219–224. 10. Vogel, A., Horneffer, V., Lorenz, K., Linz, N., Huttmann, G., and Gebert, A. (2007) Principles of laser microdissection and catapulting of histologic specimens and live cells. Methods Cell Biol 82, 153–205. 11. Espina, V., Wulfkuhle, J. D., Calvert, V. S., VanMeter, A., Zhou, W., Coukos, G., Geho, D. H., Petricoin, E. F., 3rd, and Liotta, L. A. (2006) Laser-capture microdissection. Nat Protoc 1, 586–603. 12. Bonner, R. F., Emmert-Buck, M., Cole, K., Pohida, T., Chuaqui, R., Goldstein, S., and Liotta, L. A. (1997) Laser capture microdissection: molecular analysis of tissue. Science 278, 1481–1483.

13. Emmert-Buck, M. R., Bonner, R. F., Smith, P. D., Chuaqui, R. F., Zhuang, Z., Goldstein, S. R., Weiss, R. A., and Liotta, L. A. (1996) Laser capture microdissection. Science 274, 998–1001. 14. Schofield, D. A., Westwater, C., Paulling, E. E., Nicholas, P. J., and Balish, E. (2003) Detection of Candida albicans mRNA from formalin-fixed, paraffin-embedded mouse tissues by nested reverse transcription-PCR. J Clin Microbiol 41, 831–834. 15. Thewes, S., Kretschmar, M., Park, H., Schaller, M., Filler, S. G., and Hube, B. (2007) In vivo and ex vivo comparative transcriptional profiling of invasive and non-invasive Candida albicans isolates identifies genes associated with tissue invasion. Molecular Microbiology 63, 1606–1628. 16. Wang, H., Owens, J. D., Shih, J. H., Li, M. C., Bonner, R. F., and Mushinski, J. F. (2006) Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA. BMC Genomics 7, 97. 17. Mikulowska-Mennis, A., Taylor, T. B., Vishnu, P., Michie, S. A., Raja, R., Horner, N., and Kunitake, S. T. (2002) High-quality RNA from cells isolated by laser capture microdissection. Biotechniques 33, 176–179. 18. Nygaard, V., and Hovig, E. (2006) Options available for profiling small samples: a review of sample amplification technology when combined with microarray profiling. Nucleic Acids Res 34, 996–1014. 19. Feldman, A. L., Costouros, N. G., Wang, E., Qian, M., Marincola, F. M., Alexander, H. R., and Libutti, S. K. (2002) Advantages of mRNA amplification for microarray analysis. Biotechniques 33, 906–912, 914. 20. Rudnicki, M., Eder, S., Schratzberger, G., Mayer, B., Meyer, T. W., Tonko, M., and Mayer, G. (2004) Reliability of T7-based mRNA linear amplification validated by gene expression analysis of human kidney cells using cDNA microarrays. Nephron Exp Nephrol 97, e86-95. 21. Schneider, J., Buness, A., Huber, W., Volz, J., Kioschis, P., Hafner, M., Poustka, A., and Sultmann, H. (2004) Systematic analysis of T7 RNA polymerase based in vitro linear RNA amplification for use in microarray experiments. BMC Genomics 5, 29. 22. Zakikhany, K., Naglik, J. R., SchmidtWesthausen, A., Holland, G., Schaller, M., and Hube, B. (2007) In vivo transcript profiling of Candida albicans identifies a gene essential for interepithelial dissemination. Cell Microbiol 9, 2938–2954.

Chapter 28 Isolation and Amplification of Fungal RNA for Microarray Analysis from Host Samples Anja Lüttich, Sascha Brunke, and Bernhard Hube Abstract Transcriptional profiling is a powerful tool to investigate the interplay between pathogens and their hosts. For several pathogenic fungi, like Candida albicans, genome-wide microarrays are now available, and alternative methods, such as Serial Analysis of Gene Expression (SAGE) or RNASeq, are becoming increasingly widespread. In other chapters of this book, in vitro models for studying fungal infections are described. Here, we provide information on methods to isolate fungal RNA from these models and to investigate transcriptional changes during experimental infections. The protocols focus on C. albicans but are applicable to many other fungi with minor modifications. Key words: RNA isolation, RNA amplification, RNA quality control, Candida albicans

1. Introduction Isolation of RNA is essential for measuring gene expression at the transcriptional level. High throughput RNA-based technologies, such as microarrays, can provide important information about transcriptional changes, for example, during host–pathogen interactions (1). For such transcriptional profiling technologies, it is essential to isolate a sufficient amount of high-quality RNA, without DNA and protein contamination. For microarray analysis, at least 1 μg of RNA is generally considered necessary. However, if the starting material is limited, it is possible to overcome the requirement for large quantities of RNA by sophisticated amplification techniques. There are several protocols for amplifying RNA, mostly relying on T7-based anti-sense RNA amplification (2). RNA is a relatively stable molecule, which can, nonetheless, be rapidly degraded by widespread and extremely stable RNase enzymes. This results in shorter RNA fragments, which can negatively impact upon microarray analyses and other downstream Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_28, © Springer Science+Business Media, LLC 2012

411

412

A. Lüttich et al.

applications. Furthermore, rare transcripts may be lost and may therefore not be detected in subsequent steps. One simple approach to determine RNA quality is to use lab-on-a-chip solutions such as the “Agilent 2100 Bioanalyzer.” These instruments allow quantification and quality control of RNA samples in a short time (3). Compared to most animal or bacterial cells, RNA isolation from fungi is more demanding. This is mainly due to the thick fungal cell wall, which is difficult to disrupt. However, because transcriptional changes can occur within minutes, disruption must be achieved in as little time as possible (4, 5). Therefore, speed is essential to ensure that RNA levels reflect the experimental condition of interest rather than a response to the isolation procedure itself (physical treatments such as centrifugation, chemicals, temperature, etc.). One commonly used method to rapidly disrupt fungal cell walls is treatment with phenol and SDS combined with freeze–thaw cycles. Another common and efficient technique is a high-speed homogenisation in the presence of glass beads and denaturing reagents. With samples from infection models, both methods will result in a mixture of host and pathogen RNA. However, some models allow removal of the bulk of host RNA by taking advantage of the different RNA isolation kinetics from host and fungal cells (described in Subheading 2.1). Nonetheless, in our experience host:pathogen RNA ratios of up to 5:1 are acceptable even for sensitive microarray applications ((6) and unpublished data). In this chapter, we describe two methods for total RNA extraction from host samples infected with pathogenic yeasts. The first protocol describes fungal RNA isolation from infected monolayer cells and the second deals with RNA isolation from infected tissues. These protocols are not applicable to RNA extraction from fixed tissue.

2. Materials 2.1. Isolation from Monolayer Cells

1. Six-well plate with infected host cell monolayers. 2. Liquid nitrogen-resistant ice bucket large enough for a cell culture plate. 3. Liquid nitrogen. 4. Sterile 1× PBS (optional). 5. peqGOLD RNAPure (Peqlab) or alternative phenol-based mixtures for cell lysis and RNase inactivation. 6. Cell scrapers. 7. Refrigerated centrifuge. 8. AE buffer (50 mM sodium acetate pH 5.5, 10 mM EDTA) treated with 0.1% Diethylpyrocarbonate (DEPC) (see Note 1).

28

Isolation of Fungal RNA from Infection Models

413

9. 10% SDS solution, treated with 0.1% DEPC and autoclaved. 10. 25:24:1 phenol/chloroform/isoamyl alcohol (P:C:I). 11. Temperature-controlled water bath. 12. Isopropyl alcohol. 13. 3 M sodium acetate, pH 5.5. 14. 70% ethanol (in RNase-free water). 15. RNase-free water or RNase-free TE buffer (10 mM Tris pH 7.5, 1 mM EDTA) (see Note 2). 2.2. Isolation from Tissue

1. Flash-frozen tissue or organs. 2. Scalpel (treated with RNaseZap or baked at ³200°C). 3. Acid-washed glass beads (0.2–0.5 mm) (see Note 3). 4. Homogeniser (e.g. Precellys 24 (Peqlab) or FastPrep (Thermo Scientific)). 5. Sterile, RNase-free screw cap tubes. 6. RNAPure reagent (Peqlab). 7. Chloroform. 8. Refrigerated centrifuge. 9. Isopropyl alcohol. 10. 70% ethanol (in RNase-free water).

2.3. DNase Treatment

1. RNase-free DNase solution (e.g. Baseline-ZERO™ DNase, Epicentre Biotechnologies). 2. RNA purification kit (e.g. RNeasy Mini Kit, Qiagen).

2.4. RNA Quality Control

1. Ice and ice bucket. 2. Agilent 2100 Bioanalyzer or another automated electrophoresis system, for example Bio Rad Experion Automated Electrophoresis Station. 3. RNA 6000 Nano or Pico kit (Agilent). 4. RNA ladder (part of the kit). 5. RNase decontamination solution. 6. RNase-free water. 7. Microcentrifuge. 8. Heating block or temperature-controlled water bath.

2.5. RNA Amplification and Labelling for Use with Oligo Microarrays

1. Low Input Quick Amp Labeling Kit, two-color (Agilent). or Low Input Quick Amp Labeling Kit, no dye (Agilent) plus cyanine-labelled nucleotides Cy3-CTP/Cy5-CTP (e.g. GE Healthcare). 2. Ice and ice bucket.

414

A. Lüttich et al.

3. Microcentrifuge and vortex. 4. Temperature-controlled water bath. 5. Standard PCR thermocycler with heated lid (optional). 6. RNase-free water. 7. RNeasy Mini Kit (Qiagen) or similar purification Kit. 8. 96% ethanol. For an additional amplification step (before labelling process), where less than 50 ng RNA has been extracted: ExpressArt® C&E Amplification kit (nano and pico version) (AmpTec) or Ovation RNA Amplification Systems (NuGEN).

3. Methods To avoid RNase contamination, always wear disposable gloves and change them frequently. The main source of RNases in the lab is the skin. Work surfaces and pipettes should be cleaned with an RNase decontamination solution according to the manufacturer’s directions (e.g. RNase Away, Molecular BioProducts). Always use RNase-free tips, tubes, and plasticware. After resuspending RNA, keep it on ice for further applications or store long term at −80°C. 3.1. Isolation from Infected Monolayer Cells

To obtain sufficient fungal RNA, all wells of a six-well-plate with infected monolayers must be combined (see Note 4). It is essential that samples are flash-frozen in liquid nitrogen immediately after isolation/preparation as RNA quality decreases rapidly at the sample collection stage. Initial RNA isolation steps should be carried out under a fume hood to avoid inhalation of phenol fumes. 1. Fill the ice bucket with liquid nitrogen to a depth of 2 cm. 2. At the chosen sampling time, remove the cell culture medium and (optional) wash your sample with sterile PBS (depending upon the experimental design). 3. Add 500 μL RNAPure, or alternative phenol-based mixture, to each well and immediately put the plate into the liquid nitrogen until the liquid freezes. 4. Remove the plate and leave at room temperature until the solution has thawed. 5. Using a cell scraper, loosen the cells and combine three wells in a 1.5-mL screw cap tube. 6. Pipette the solution up and down several times with a 1-mL pipette to lyse the monolayer cells (see Note 5). 7. Collect the fungal cells by centrifugation for 8 min at 20,000 × g.

28

Isolation of Fungal RNA from Infection Models

415

8. Remove the RNAPure carefully without disturbing the fungal cell pellet. This step removes the majority of host RNA from the sample (see Notes 5 and 6). 9. Resuspend the cell pellet from one tube with 400 μL AE buffer. Transfer the suspension to the second tube containing the same sample and resuspend the pellet. 10. Add 40 μL 10% SDS and vortex the sample for 30 s at the highest setting. 11. Add 440 μL P:C:I and gently invert the tube to mix. 12. Incubate the tubes at 65°C in a water bath for 5 min. 13. Transfer the tubes to −80°C until phenol crystals begin to appear (3–5 min). 14. Incubate the samples again at 65°C for 5 min. 15. Optional: repeat steps 12 and 13 to enhance the efficiency of cell lysis. 16. Centrifuge for 10 min at 21,000 × g and 4°C to separate aqueous (contains the RNA), interphase and organic phases (both contain DNA and proteins). 17. Carefully transfer the upper aqueous phase to a fresh RNAsefree 1.5-mL tube. 18. Optional: If the interphase is very thick or if fractions of the interphase have been transferred to the new tube, repeat the P:C:I extraction. Again, add 1 volume P:C:I to the sample, mix and centrifuge as described above. Transfer the upper phase to a fresh RNAse-free 1.5-mL tube. 19. Add 1 volume of isopropyl alcohol and adjust the salt concentration to 0.3 M with 3 M sodium acetate (pH 5.5). 20. Mix the samples thoroughly by pipetting, and chill for at least 1 h at −20°C. Longer incubation at −20°C is recommended if a high RNA yield (³10 μg/mL) is expected. If a low RNA yield is expected, add RNase-free glycogen (maximum final concentration of 1 μg/μL) to facilitate precipitation. 21. Centrifuge at 21,000 × g and 4°C for 20 min. 22. Remove the isopropyl alcohol carefully and wash the RNA pellet by adding 1 mL ice-cold 70% ethanol and vortex briefly. 23. Centrifuge at 16,000 × g and 4°C for 10 min. 24. Remove ethanol (see Note 7) and repeat the washing step (optional). 25. Air-dry the RNA pellet for about 5 min and resuspend the pellet in RNase-free water, TE buffer, or store as an ethanol precipitate (see Note 8). To aid RNA resuspension, incubate at 65°C for 5 min. 26. Store RNA at −80°C until required (ideally, store in aliquots to avoid repeated freeze–thaw cycles).

416

A. Lüttich et al.

3.2. Isolation from Infected Tissue

For general handling guidelines to prevent RNA degradation see Subheading 3.1. 1. Immediately freeze the tissue sample in liquid nitrogen and store at −80°C or continue immediately with RNA isolation. 2. Cut the tissue with an RNase-free scalpel. Try to dissect infected tissue for subsequent steps, discarding non-infected host tissue. Weigh the sample. 3. To each 100 mg tissue, add 2 mL RNAPure reagent in an appropriate RNAse-free tube. 4. Add acid-washed glass beads (approximately half the volume of the total liquid) to the tube. 5. Vortex the sample in a homogeniser (typical setting 2 × 30 s at 5.5 ms−1). 6. Incubate the sample for 5 min at room temperature to ensure separation of nucleotides and proteins. Add 0.2 volumes of chloroform and vortex for 15 s. 7. Incubate the sample for 7 min on ice. 8. Centrifuge the sample at 21,000 × g for 15 min at 4°C to separate phases. 9. Transfer the upper aqueous phase (containing the RNA) into a fresh RNAse-free 1.5-mL tube (do not touch the interphase). 10. Add 1 volume isopropyl alcohol and follow protocol 3.1 from step 19.

3.3. DNase Treatment

Prior to amplification or cDNA synthesis, most kits recommend a DNase treatment step. DNase treatment should be carried out according to the manufacturer’s protocol using, for example, the Baseline-ZERO™ DNase (Epicentre Biotechnologies). To remove DNAse after the treatment, use the RNeasy Mini Kit (Qiagen) or similar products, or specialised kits for samples with low RNA content (see Note 9).

3.4. RNA Quality Control with the BioAnalyzer

Lab-on-a-chip systems, such as the Agilent BioAnalyzer, require only a small RNA volume (1 μL) for analysis. In addition, the procedure is mostly automated and, therefore, highly reproducible. If you do not have access to a BioAnalyzer or similar instrument, the quality and purity of RNA can be assessed by spectrophotometry; high purity RNA has an A260/A280 of 1.9–2.1. The BioAnalyzer calculates an RNA Integrity Number (RIN) for analyzed samples, ranging from 1 (poor quality) to 10 (highest quality RNA). For the applications described here (amplification and microarray analyses), the RIN value should be at least 8 or higher. Consult the BioAnalyzer user guide for interpretation of results. It should be borne in mind that the RNA concentration calculated by the BioAnalyzer software is composed of both host and

28

Isolation of Fungal RNA from Infection Models

417

fungal RNA. An estimate of the ratio of host:fungal RNA is possible by BioAnalyzer (see Note 10) or by RT-PCR in combination with gel electrophoreses (see Note 11). Bioanalyzer RNA quality control: 1. Prepare the gel according to the manufacturer’s protocol. 2. Pipette 1 μL aliquots of the RNA samples into 0.5-mL tubes. Pipette 1 μL RNA ladder into a 0.5 tube. 3. Heat denature samples and RNA ladder for 2 min at 70°C in a thermocycler with the lid set to 95°C. 4. Immediately cool the samples on ice. 5. Prepare and dispense the gel–dye mix according to the manufacturer’s protocol. Load samples and the RNA ladder into Bioanalyzer chip wells according to the manufacturer’s protocol. 6. Run the chip in the Bioanalyzer within 5 min of sample loading. 7. The Bioanalyzer software will attempt to calculate the RIN for each RNA sample. If the software cannot calculate the RIN (due to the 26S/28S rRNA double peaks from fungal and mammalian RNA), a RIN value can be estimated from the peak heights, or from standards run on the same chip (see Note 10). 3.5. RNA Amplification and Labelling

If the amount of fungal RNA isolated is at least 1 μg, RNA amplification is normally not necessary. In this case, it is possible to use the RNA directly in reverse transcription and cDNA labelling reactions. There are several different cDNA labelling methods available depending on the microarray technology to be used. If the fungal RNA amount is less than 1 μg, but greater than 50–100 ng then RNA amplification should be carried out. If less than 50–100 ng RNA have been extracted, an additional amplification step is also required. After performing these steps, one should have sufficient amounts of high-quality RNA for amplification and labelling. Here, we do not describe the entire amplification and labelling protocol in detail. Please follow the steps outlined in the corresponding user manuals. In the following section, some general aspects are discussed. Use more than 500 ng RNA with the “Low Input Quick Amp Labeling Kit” when you have a mixture of host and fungal RNA to be sure that the fungal RNA is present in an adequate amount (in our hands, a ratio of 1:5 fungal vs. host RNA is acceptable). If your original RNA amount is so low (less than 50 ng/μl RNA) that pre-amplification is essential, use the purified aRNA (anti-sense RNA) from this step in subsequent labelling reactions. If RNA yields are still lower than 50 ng after the first RNA preamplification step, perform a second round of pre-amplification prior to labelling.

418

A. Lüttich et al.

In general it is advisable not to handle more than six samples in parallel. When working with cyanine-labelled nucleotides avoid exposure to light.

4. Notes 1. DEPC is toxic and should be used only under a fume hood. Treat buffer with 0.1% (v/v) DEPC overnight at 37°C with constant agitation. Autoclave the buffer to inactivate the DEPC. Alternatively, several companies provide nuclease-free reagents, which are not DEPC-treated. 2. Solutions containing Tris (e.g. TE buffer) cannot be treated with DEPC, because the DEPC reacts with the Tris and inactivates it. RNase-free TE buffer can be purchased. 3. Acid-washed glass beads can be purchased or prepared. To prepare glass beads, weigh 100 g glass beads into a 250-ml glass bottle. Add sufficient 5.8 M HCl to cover the glass beads. Incubate at room temperature for 1 h, and then carefully remove the HCl and add ultrapure H2O (approximately 80 mL). Swirl the bottle for 10 s to stir the beads, pour off the water and repeat the washing step for a total of 10 washes. Autoclave the beads and dry at 50°C overnight. Store glass beads at room temperature. 4. We recommend six-well plates for co-incubation of monolayer cells with Candida albicans cells (approximately 5 × 106 cells/ well). Pooling all six wells will provide sufficient fungal RNA for microarray analysis (without an additional amplification step), even with short co-incubation times such as 30 min. 5. It is important to pipette up and down several times and with sufficient pressure to completely detach and lyse monolayer cells. The host cell content will then be in solution allowing removal of the majority of host RNA in the subsequent centrifugation step. 6. This supernatant, containing host DNA and RNA, can be processed for simultaneous transcriptional analysis of host responses. 7. It is essential to remove all ethanol. After removal of the supernatant, shortly spin the sample again and carefully remove residual ethanol with a 10 μL pipette. 8. For short-term storage at −80°C, dissolve the RNA in RNasefree water or TE buffer. For long-term storage at −80°C, store

28

Isolation of Fungal RNA from Infection Models

419

the RNA in an ethanol precipitate (with sodium acetate) mixture. We recommend dissolving RNA in RNAse-free water if the sample is to be used within 1 month; this guarantees that buffer components will not cause problems in downstream procedures. 9. If the RNA amount is expected to be very low, use dedicated kits, such as the RNeasy Micro Kit (Qiagen) or the NucleoSpin® RNA Clean-up XS (Macherey-Nagel), according to the manufacturer’s protocol. However, in protocols using oligo-dT priming (such as in the kits listed under Subheading 2.5) small amounts of contaminating DNA do not normally significantly affect the amplification process. Therefore, this DNase step can be omitted, which also avoids sample loss associated with the procedure. This may be especially important for the small RNA amounts typically obtained in these experiments. 10. The BioAnalyzer (Agilent) can detect three rRNA peaks when running RNA isolated from co-cultures, e.g. a macrophage– fungal co-culture. The first peak corresponds to the 18S rRNA from host and fungal cells, the second peak to the fungal 26S rRNA, and the third peak to the host 28S rRNA (Fig. 1). If the total area of the two 26S/28S rRNA peaks is approximately twice the area of the single 18S rRNA peak, RNA quality is very good. Smaller ratios are normally acceptable; however, the 26S RNA peaks should be larger than the 18S peak. With inclusion of RNA standards (samples with defined ratios of host and fungal RNA), a rough estimate of the host:fungus RNA ratio is possible. Use the integral function of the BioAnalyzer software to calculate the ratio of the areas under the 26S/28S peaks (second and third peak), and compare to the standards. 11. Take 1 μL of the isolated total RNA and run a reverse transcription (RT-) PCR with a fungus-specific primer pair (e.g. 18S rRNA probe). For comparisons, use 1 μL of total fungal RNA with known concentrations (e.g. 500, 50, and 5 ng/μL) in the same RT-PCR run. Run 5 μL of each reaction on an agarose gel and compare the intensity of the RNA sample band with those generated from known RNA concentrations. This allows determination of the fungal RNA content in the sample and, from simple calculations, the ratio of host:fungal RNA can be determined.

420

A. Lüttich et al.

Fig. 1. Electropherograms generated by Agilent Bioanalyzer showing high-quality total RNA from different samples. (a) Human (macrophage) RNA, (b) fungal (C. albicans) RNA, and (c) mixture of both RNA species. The two distinct peaks in (a, b) represent the 18S and 28S rRNA. The first peak in (c) represents the 18S rRNA from both, while the second peak corresponds to the fungal (f) 28S rRNA, and the third peak to the 28S rRNA from the human (h) RNA; FU = fluorescence units.

References 1. Wilson D, Thewes S, Zakikhany K, Fradin C, Albrecht A, Almeida R et al (2009) Identifying infection-associated genes of Candida albicans in the postgenomic era. FEMS Yeast Res 9:688–700 2. Phillips J and Eberwine JH (1996) Antisense RNA Amplification: A linear Amplification

Method for Analyzing the mRNA Population from Single Living Cells. Methods 10:283–88 3. Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, Gassmann M et al (2006) The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 7

28

Isolation of Fungal RNA from Infection Models

4. Fradin C, Kretschmar M, Nichterlein T, Gaillardin C, d’Enfert C, Hube B (2003) Stagespecific gene expression of Candida albicans in human blood. Mol Microbiol 47:1523–43 5. Hube B (2004) From commensal to pathogen: stage- and tissue-specific gene expression of Candida albicans. Curr Opin Microbiol 7:336–41

421

6. Thewes S, Kretschmar M, Park H, Schaller M, Filler S G, Hube B (2007) In vivo and ex vivo comparative transcriptional profiling of invasive and non-invasive Candida albicans isolates identifies genes associated with tissue invasion. Mol Microbiol 63:1606–28

Part VI Host Responses to Infection In Vivo

Chapter 29 Cytokine Measurement Using Cytometric Bead Arrays Luis Castillo and Donna M. MacCallum Abstract Cytokines can be measured by enzyme-linked immunosorbent assay (ELISA) or multiplex assay. Both techniques are commonly used in immunology to detect the presence of antibody or antigen in a sample. However, multiplex bead array technology provides the means to simultaneously measure multiple analytes in a single reaction, thereby saving time and resources. This method can detect up to 30 proteins at once, using a relatively small sample volume, without losing sensitivity, accuracy, or reproducibility. In this chapter, we describe the cytometric bead array (CBA) approach to simultaneously measure multiple cytokines in biological samples such as spleen, kidney, or serum from mice infected with the human fungal pathogen Candida albicans. Key words: Cytometric bead array, Cytokines, Candida albicans, Fluorescence-activated cell sorter, Beads

1. Introduction To measure cytokines secreted from cells, researchers commonly use conventional ELISA (enzyme-linked immunosorbent assay) techniques. ELISA methods are restricted to measuring one cytokine at a time and, moreover, samples are rapidly used up when several ELISA reactions have to be performed. Although new plates are available to measure multiple cytokines in human samples in a single ELISA, it is limited to measuring eight cytokines per well (1). The launch of a multiplex cytometric bead array (CBA) system by BD Biosciences and the Luminex system by the Luminex Corporation have provided the possibility of analysing several proteins in a small volume of fluid (2–5). CBA assays provide the means to measure up to 30 proteins simultaneously in small volume samples (typically 25–50 μL) and it is possible to quantify a variety of soluble and intracellular proteins, such as cytokines, chemokines, growth factors, and phosphorylated proteins (6, 7).

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_29, © Springer Science+Business Media, LLC 2012

425

426

L. Castillo and D.M. MacCallum

Moreover, CBA sets are available to detect cytokines for several species, such as human, rat, and mouse. CBA assays were validated for measurement of cytokines from serum and tissue culture; however, this method is also useful for measurement of cytokines in supernatants from organ homogenates (8). Taking advantage of the CBA assay, we have measured cytokines in biological samples in mice infected with Candida albicans (8). C. albicans is the most common aetiological agent of candidiasis. In the intravenous (IV) challenge model for experimental C. albicans infection in mice, the fungus typically proliferates in kidneys but is cleared from the spleen (9, 10), indicating differential host responses in these two organs. However, few studies have associated tissue damage with tissue-specific immune response (8, 11). We have studied production of cytokines and chemokines in kidneys, spleen, and serum from BALB/c mice infected intravenously with different C. albicans strains (8). The use of the CBA assay allowed us to quantify a range of cytokines and chemokines in supernatants from homogenised kidneys and spleens, or in serum, at intervals up to 72 h post-challenge. Here we present the protocol to carry out the CBA assay using such biological samples.

2. Materials 2.1. Reagents

1. CBA Mouse cytokine Flex Sets (BD Biosciences) (see Note 1). 2. BD CBA Mouse/Rat Soluble Protein Master Buffer kit (see Note 2). 3. 1.8-mL microcentrifuge tubes. 4. 30–50 mL sterile containers (e.g. Universal tubes or Falcon tubes). 5. 96-well round-bottomed plates. 6. Multi-channel pipette (30–300 μL). 7. Blunt-bottomed 1.8-mL tubes containing 500 μL saline plus protease inhibitors (see Note 3). 8. Microcentrifuge tubes containing 0.5 μL protease inhibitor cocktail for collection of blood. Add 0.5 μL protease inhibitor cocktail (Sigma-Aldrich) to each tube (see Note 4).

2.2. Equipment and Software

1. CAT homogeniser (CAT X1030D). 2. Centrifuge with 96-well plate rotor. 3. Digital shaker. 4. FACSArray Bioanalyzer (BD Biosciences) or alternatively a dual-laser flow cytometer equipped with a 448 nm or 532 nm

29

Cytokine CBA Assay

427

and a 633 nm or 635 nm laser capable of distinguishing fluorescence at 576, 660, and >680 nm. 5. FCS (Flow Cytometric Standard) Filter v.1.0.2 software (Soft Flow, Inc.). 6. FCAP Array v.1.0.1 software (Soft Flow, Inc.). 2.3. Samples

Obtain kidney, spleen, and serum samples from female BALB/c mice infected intravenously with Candida albicans. Intravenous challenge of mice with pathogenic fungi is described in Chapter 35.

3. Methods 3.1. Sample Collection

1. Put mice under terminal anaesthesia prior to performing cardiac puncture (see Note 5). Immobilise the anaesthetised mouse. Using a 1-mL syringe and 22 G needle, insert the needle approximately 5 mm from the centre of the thorax towards the animal’s chin, 5–10 mm deep, with the syringe at 25–30° relative to the mouse chest. Withdraw blood and dispense into tubes containing protease inhibitor cocktail. Store samples at 4°C for 2 h. Centrifuge tubes for 10 min at 16,000 × g at 4°C and transfer serum (supernatant) to a fresh tube. Store samples at −20°C. 2. Aseptically remove kidneys and spleen and place in tubes containing 500 μL saline plus protease inhibitors. Homogenise samples using a CAT homogeniser to produce a homogenous suspension. Centrifuge the tubes at 16,000 × g for 5 min at 4°C. Transfer supernatants to new microcentrifuge tubes and store at −20°C until use.

3.2. CBA Assay: Preparation of Standards

1. Remove and open one vial of lyophilised standard from each BD CBA mouse cytokine Flex Set to be tested. 2. Pool all standard spheres into one 30-mL universal tube. 3. Reconstitute with 4 mL of assay diluent. Leave the standard solution to equilibrate for at least 15 min before making any dilution. This will be the Top Standard at a concentration of 2,500 pg/mL. 4. Label microcentrifuge tubes in the following order: 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, and 1:256, and add 500 μL of assay diluent to each tube. 5. Perform doubling dilutions by transferring 500 μL from the Top standard to the 1:2 dilution tube and thoroughly mix before continuing to the next tube. Repeat the process until you finish with the 1:256 tube. Prepare one tube containing assay diluent only to serve as the 0 pg/mL control tube.

428

L. Castillo and D.M. MacCallum

3.3. Preparation of CBA Mouse Flex Set Reagent

1. Calculate the total number of samples to be tested by adding the number of standards and samples. Calculate the volume of each Capture Bead required (see Note 6). 2. Determine the volume of capture bead diluent required for the experiment (see Note 7). 3. For each cytokine flex set, add 45 μL Capture beads (10 cytokines in our example) into a universal tube labelled “Mixed Capture Beads” (see Note 8). Add the calculated volume of capture bead diluent. 4. Calculate the total volume of PE Detection bead reagents and detection bead diluent required for the experiment by repeating steps 1–3, (see Notes 6 and 7). 5. For each cytokine flex set, add 45 μL of each PE Detection bead reagent (see Note 8) into a universal tube labelled “Mixed PE Detection reagents.” Add the calculated volume of detection reagent diluent. Protect the beads from light by covering the tube with tin foil. Keep the tube at 4°C until use.

3.4. BD CBA Assay Procedure

1. Wet the 96-well plate by adding 100 μL wash buffer to each well. Aspirate liquid from the wells. 2. Vortex the tube labelled Mixed Capture Beads for at least 10 s. Add 25 μL mixed Capture Beads into each of the wells to be used (in our example, 90 wells). 3. For wells A1 to A10, add 25 μL of standard, from lowest (0 pg/mL) to highest concentration (2,500 pg/mL). 4. Add neat or diluted samples (25 μL) to the remaining wells (see Notes 9 and 10). Cover the plate with a plastic adhesive plate seal. 5. Place the plate on a digital shaker and mix at 500 rpm for 5 min. Incubate the plate for 1 h at room temperature. 6. Add 25 μL of the Mixed PE Detection reagent to each well and cover the plate with a plastic adhesive plate seal. Keep plate protected from light by wrapping in tin foil. Place the plate on a digital shaker and mix at 500 rpm for 5 min. Incubate the plate for 1 h at room temperature. 7. Centrifuge the plate at 240 × g for 5 min and carefully remove the supernatant using a multi-channel pipette or a 96-well aspirator and pump (aspirator pressure should not exceed 10 in. Hg). Remove 65 μL of the supernatant leaving 10 μL residual volume (see Note 11). 8. Add 150 μL Wash Buffer to each assay well and cover the plate with a plastic adhesive plate seal. Place the plate on the digital shaker and mix at 500 rpm for 5 min. 9. Read the plate on the FACSArray Bioanalyzer and export the data as FCS 2.0 data files.

29

Cytokine CBA Assay

429

Fig. 1. Scatter Plots representing the distribution of ten bead populations. (a) Bead populations, each representing a single cytokine, obtained from the BD FACSArray Bioanalyzer. (b) Selection of bead populations by drawing around the clusters. (c) Results post-filtering using FCS software.

3.5. Quantitative Analysis

1. The FACSArray Bioanalyzer creates individual files for each well analysed. 2. Reduce the background of the experiment using the FCS filter software prior to analysing the data (see Note 12). To filter results, open the results folder on the Bioanalyzer and select any file. Each distinct bead population represents one cytokine (Fig. 1a). Select the bead populations by drawing around them (Fig. 1b), and save the filtered results as separate FCS 2.0 files in a new folder (Fig. 1c). 3. Use FCAP Array software to plot standard curves and calculate sample concentrations. The software is intuitive and easy to manipulate. To begin the analysis, click the “New Experiment” icon in the application toolbar and then click “next” to advance to the Test Samples view. 4. Enter the total number of samples to be analysed (do not include standard samples) and click “next.” 5. For the option “Dilution and number of Replicates” modify values in cases where the samples have been diluted or where there are sample replicates. Click “next” to advance to “Selecting Saved Plex” menu. 6. In this section, enter new beads into the Bead Library or create a group for the beads in your Plex (see Note 13). Click “Edit” to display the Bead Library dialogue. Enter murine cytokine names in the option “Analyte ID.” Enter the specific alphanumeric code for each cytokine (e.g. B4 for murine IL-6) in the Bead ID option and click “add” (see Note 14). Repeat this step for each cytokine analysed. 7. On the left hand side of the Plex Components view, you will now have a list with the cytokines added. Select the ten beads listed on the left side of the window and add to the selected

430

L. Castillo and D.M. MacCallum

Fig. 2. Cytokine assignment. (a) Assignment of bead populations to individual cytokines. (b) Each bead population has an alphanumeric designation, indicating its position relative to other beads.

beads listing on the right. Click “next” to advance to clustering parameter. 8. Load the file with the filtered data and select BD FACSArray in the instrument name option. Check that all ten clusters are identified. Click “next” to advance to Analyte Assignment. 9. Assign beads to clusters using the cluster position map. Select the first bead (cytokine) in the Bead cluster list and assign the bead to its corresponding cluster (Fig. 2a). The Bead ID location code indicates the relative position for each bead (cytokine) and should help you locate the associated cluster (Fig. 2b). Repeat this step for each bead (cytokine) and click “next” to advance to Qualitative/Quantitative analyses. 10. In the Quantitative option, select 4 Parameter logistic to fit the equation. Click “next” to advance to Standard. 11. Enter the standard values from lowest to highest concentration. Be sure to check that you specify the correct unit of measurement (pg/mL). Click “next” to advance to Reporting messenger. In this option, specific conditions or messages can be added which will be printed in the final report. Click “next” to advance to Plate Layout Options. 12. Select 96-well plate in the plate or rack selection. Select the option to read the plate row by row in the “assignment method selection.” More options can be modified, dependent on your own template. Click “next” to advance to Experiment Name. 13. Give the experiment a name and click on Finish to close the Experimental view. 14. Check whether the Standard and Samples have the correct positions in the plate (Fig. 3). Click on the File Assignment tab.

29

Cytokine CBA Assay

431

Fig. 3. Map of sample and standard positions within the 96-well plate. The first ten wells (A1 to A10) correspond to standards (low to high concentration), with the remaining wells containing samples.

15. Transfer the data from the right side of the File Assignment view to the left side. Ensure that all data is transferred. The files on the right side of the File Assignment view will now be marked to denote that they have been assigned. 16. To analyse data, check whether the “Start analyzing” icon is active and click it to start the process. 17. Export the final analysed data in a Microsoft Excel compatible format by creating a file with a .csv extension. 18. Cytokine data will be expressed as pg/mL; however, for tissue cytokine levels it is recommended that cytokines be expressed as pg/g of tissue (see Note 15). To obtain cytokine levels as pg/g tissue divide cytokine pg/mL by g/mL of tissue analysed.

4. Notes 1. Each Flex Set contains one vial each of Capture Beads, Phycoerythrin (PE) Detection Reagent, and two vials of cytokine standard. At present, murine kits are available for detection of IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-12p70, IL-13, IL-17, IL-21, IFNγ, G-CSF, GM-CSF, TNF, KC, MIG, MIP-1α, RANTES, and MIP-1β. We have used the CBA assay to measure 10 or 12 cytokines in a single reaction. In our experience it is difficult to measure more than

432

L. Castillo and D.M. MacCallum

12 cytokines in a single reaction due to “tails” on bead populations which interfere with the analysis. 2. The master buffer kit provides sufficient reagents for the analysis of 500 samples, and includes wash buffer, capture bead diluent, detection reagent diluent, and assay diluent. 3. To maintain protein stability, we recommend the use of protease inhibitors to avoid any protein degradation. We have observed that samples without protease inhibitor show a reduction in cytokine levels over time. To prepare saline plus protease inhibitors, add one complete mini protease inhibitor cocktail tablet (Roche Diagnostics Ltd.) per 10 mL saline. 4. The protease inhibitor cocktail contains a higher concentration of protease inhibitors compared to the solution produced using complete mini protease inhibitor cocktail tablets in saline. This allows a much smaller volume of protease inhibitor to be added to the small blood volumes obtained from mice by cardiac puncture. 5. Mice can be placed under terminal anaesthesia using either gaseous or injectable anaesthetic. 6. This protocol will use an example of 10 standards and 40 samples, with 10 cytokines being measured. Therefore, the number of wells to test in our example is 90 (10 standards + 80 samples in duplicate). Thus, if we consider that 0.5 μL Capture beads are necessary for one test, 45 μL of each cytokine capture bead suspension is required. For each assay, 0.5 μL PE detection reagent is also required; therefore, the same calculation can be used to determine the volume of PE detection reagent required for the experiment. 7. To calculate the volume of capture bead diluent required, begin by multiplying the number of tests by 25 μL (each assay requires mixed capture bead suspension in a volume of 25 μL), i.e. a total of 2,250 μL in our example. However, the total volume of Capture beads must be considered in the calculation; therefore, the volume of capture bead diluent required is 2,250–450 μL (45 μL of each Capture Bead x 10 different cytokines) = 1,800 μL capture bead diluent. The same calculation is carried out to determine the volume of PE detection diluent required for the experiment. 8. Vortex each capture bead and PE Detection reagent for 20 s before use. 9. To ensure that samples do not contain residual tissue debris, spin samples for 2 min at 16,000 × g at 4°C prior to use. 10. We have found that C. albicans-infected kidneys contain high levels of the cytokine MIG. Therefore, for measurement of MIG levels, we recommend diluting samples 1:5 prior to use.

29

Cytokine CBA Assay

433

For other cytokines and chemokines we have not found it necessary to dilute samples. 11. Carefully remove the supernatant and discard. To avoid disturbing the bead pellet, angle the pipette such that the tip is pointed away from the pellet of Capture beads. 12. FCS Filter is a free programme available at http://www.softf l o w. c o m / F r a m e . p h p ? P a g e = F C S F i l t e r & S u b P a g e = / Downloads. 13. The bead library can also be populated by downloading bead definitions from the CBA Flex Set Web site (http://www. bdbiosciences.com/flexset). 14. The alphanumeric code for each cytokine analysed corresponds to the bead location on the bead cluster map (Fig. 2). 15. Calculate the grams of tissue analysed by adding the dissected organs to pre-weighed tubes containing saline solution plus protease inhibitors. Calculate organ/tissue weights by reweighing the tubes prior to homogenising and subtracting the preweighed value.

Acknowledgements LC was supported by a grant (080088) from the Wellcome Trust and research in the laboratory of DMM is supported by grants from the Wellcome Trust (089930) and National Centre for the Replacement, Reduction and Refinement of Animals in Research (NC3Rs). References 1. Nold-Petry, C.A., Nold, M.F., Nielsen, J.W., Bustamante, A., Zepp, J.A., Storm, K.A., Hong, J.W., Kim, S.H., and Dinarello, C.A. (2009) Increased cytokine production in interleukin-18 receptor alpha-deficient cells is associated with dysregulation of suppressors of cytokine signalling. J Biol Chem 284, 25900–25911. 2. Chen, R., Lowe, L., Wilson, J.D., Crowther, E., Tzeggai, K., Bishop, J.E., and Varro, R. (1999) Simultaneous quantification of six human cytokines in a single sample using microparticle-based flow cytometric technology. Clin Chem 45, 1693–1694. 3. Tárnok, A., Hambsch, J., Chen, R., and Varro, R. (2003) Cytometric bead array to measure

six cytokines in twenty-five microliters of serum. Clin Chem 49, 1000–1002. 4. Earley, M.C., Vogt, R.F., Shapiro, H.M., Mandy, F.F., Kellar, K.L., Bellisario, R., Pass, K.A., Marti, G.E., Stewart, C.C., and Hannon, W.H. (2002) Report from a workshop on multianalyte microsphere assays. Cytometry 50, 239–242. 5. Kettman, J.R., Davies, T., Chandler, D., Oliver, K.G., and Fulton, R.J. (1998) Classification and properties of 64 multiplexed microsphere sets. Cytometry 33, 234–243. 6. Carson, R.T., and Vignali, D.A. (1999) Simultaneous quantitation of 15 cytokines using a multiplexed flow cytometric assay. J Immunol Methods 227, 41–52.

434

L. Castillo and D.M. MacCallum

7. Lund-Johansen, F., Davis, K., Bishop, J., and de Waal Malefyt, R. (2000) Flow cytometric analysis of immunoprecipitates: high-throughput analysis of protein phosphorylation and protein-protein interactions. Cytometry 39, 250–9. 8. MacCallum, D.M., Castillo, L., Brown, A.J., Gow, N.A., and Odds, F.C. (2009) Earlyexpressed chemokines predict kidney immunopathology in experimental disseminated Candida albicans infections. PLoS One 4, e6420. 9. Spellberg, B., Ibrahim, A.S., Edwards, J.E., and Filler, S.G. (2005) Mice with disseminated

candidiasis die of progressive sepsis. J Infect Dis 192, 336–343. 10. MacCallum, D.M. and Odds, F.C. (2005) Temporal events in the intravenous challenge model for experimental Candida albicans infections in female mice. Mycoses 48, 151–161 11. Mullick, A., Elias, M., Picard, S., Bourget, L., Jovcevski, O., Gauthier, S., Tuite, A., Harakidas, P., Bihun, C., Massie, B., and Gros, P. (2004) Dysregulated inflammatory response to Candida albicans in a C5-deficient mouse strain. Infect Immun 72, 5868–76.

Chapter 30 Transcript Profiling of the Murine Immune Response to Invasive Aspergillosis Zaneeta Dhesi, Susanne Herbst, and Darius Armstrong-James Abstract Invasive aspergillosis is an opportunistic infection for which complex host–pathogen interactions determine infection outcome. In particular, immunosuppressive therapies and other host factors, such as neutropenia, need to be taken into account when modelling the immune response to aspergillosis. Mammalian models have been developed in order to gain a deeper understanding of these biological interactions, which cannot be easily replicated in vitro. In vivo transcript profiling is emerging as a valuable technique to gain an overview of host responses to invasive infections. This approach can be applied to specific tissue sections, whole organs, or peripheral blood leukocyte populations. Here we describe a microarray technique for analyzing transcript profiles from whole lung homogenates in the context of invasive aspergillosis. This approach has the advantage of enabling a broad overview of the immune responses that govern disease outcome. The generic techniques described, however, have wider application to other infectious processes and tissue types. Key words: Aspergillosis, Lung, Immune response, Murine, Microarray

1. Introduction Invasive aspergillosis is now the most common fungal cause of death in modern health-care systems (1). This rise in mortality appears to have been driven by increasing numbers of patients at risk from invasive disease, as a consequence of a rapidly expanding number of novel immunosuppressive agents (2). The greatest risk factors for invasive aspergillosis are currently neutropenia and steroid exposure (3). Classically, two standard models of murine invasive aspergillosis have been used, both for studies of fungal virulence and for host response to disease. The first model is a cyclophosphamidehydrocortisone-based model, which leads to rapid induction of Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_30, © Springer Science+Business Media, LLC 2012

435

436

Z. Dhesi et al.

profound neutropenia. Whilst profound neutropenia is most commonly encountered during intensive conditioning for haematological allogenic stem cell transplantation, it is notable that the immunosuppressive regimen used in this model is most reflective of classical regimens used for solid malignancies (4). The second classic model of invasive aspergillosis is a high-dose steroid model based entirely on hydrocortisone immunosuppression (5). This immunosuppressive regimen does not result in neutropenia, and is more representative of aspergillosis in the context of graft-versushost disease, long-term steroid therapy (e.g. obstructive pulmonary disease), and solid organ transplant rejection, where steroid immunosuppression is employed routinely. In vivo transcript profiling is an attractive approach to understanding the pathogen or host response during invasive aspergillosis, as it enables an overview of the transcriptional response during this biological process (6). However this approach is limited, first because transcript abundance does not always predict protein concentration or activity, and second because organ-level transcript profiling does not easily yield information on the relative abundance of immune cell types at the site of infection, or which cells are responsible for the transcript signal in question. Here we describe a protocol for the analysis of host pulmonary immune responses that employs genomic oligo microarrays to assay organ-level transcriptional responses in neutropenic invasive aspergillosis.

2. Materials 2.1. Preparation of Aspergillus fumigatus inoculum

1. Aspergillus complete medium (for 20 mL slopes in 50-mL Falcon Tubes). 2. Aspergillus minimal medium (7). 3. Sealable plastic box. 4. Sterile agar plates. 5. Aspergillus fumigatus strains Af 239 and AfCEA10 (recommended pathogenic sequenced strains). 6. Sterile 50-mL Falcon tubes. 7. Autoclaved miracloth (Calbiochem). 8. Sterile saline (Baxter Healthcare Ltd). 9. Centrifuge.

2.2. Immunosuppression of CD1 Mice with Hydrocortisone and Cyclophosphamide

1. Cyclophosphamide 20 mg/mL in normal saline (150 mg/kg, ENDOXANA, Asta Medica). 2. Hydrocortisone 100 mg/mL in sterile water (112.5 mg/kg, HYDROCORTISTAB, Sovereign Medical).

30

Microarrays for Fungal Immunity

437

3. Outbred male CD1 mice, 18–22 g (Harlan). 4. 1-mL syringes. 5. 25G hypodermic needles. 6. Antibiotic drinking water (sterile water with tetracycline 1 mg/L and ciprofloxacin 64 mg/L). 2.3. Intra-nasal Inoculation of A. fumigatus into the Murine Lung

2.4. Harvesting and Preservation of the Murine Lung 2.5. Isolation of Total RNA from the Murine Lung

1. Isoflurane (Sigma-Aldrich). 2. Anaesthetic apparatus. 3. Gauze paper. 4. 1-mL syringes. 1. Sterile dissection kit. 2. Canister of liquid nitrogen. All RNA-related procedures should be undertaken in RNAse-free conditions in a Class 2 Cabinet. 1. Large pestle and mortar. 2. Canister of liquid nitrogen. 3. TRIzol (Invitrogen). 4. Isopropyl alcohol, microbiology grade. 5. Bench-top micro-centrifuge. 6. DEPC (Diethyl Pyrocarbonate, Sigma-Aldrich)-treated water (see Note 1). 7. Chloroform. 8. 70% ethanol Lithium Chloride buffer (4 M LiCl, 20 mM Tris– HCl pH 7.5, 10 mM EDTA). 9. Bioanalyser Nanodrop Series (Agilent UK). 10. Spectrophotometer and cuvettes. 11. TBE buffer (1 L DEPC-treated water with 10.6 g Tris base, 5.5 g boric acid, and 5 mL 0.5 M EDTA). 12. Gel electrophoresis apparatus. 13. Agarose.

2.6. Immunofluorescent Labelling of ReverseTranscribed cDNA

1. Water baths at 70°C, 42°C, and 37°C. 2. Random primer (3 μg/μL). 3. Oligo-dT primer (3 μg/μL). 4. Nuclease-free water. 5. 80% ethanol. 6. Micro-centrifuge. 7. Spectrophotometer.

438

Z. Dhesi et al.

8. Microcuvette. 9. Cy3™ dCTP (GE Healthcare). 10. Cy5™ dCTP (GE Healthcare). 11. dNTP mix ChipShot™Direct Labelling System. 12. Silver foil. 13. 3 M Sodium acetate pH 5.2. 2.7. Hybridisation of cDNA Probes to Microarray Slides

1. Agilent Mouse 4 × 44 Gene Expression Microarrays. 2. Agilent Hybridisation Chamber. 3. Agilent Gasket slide. 4. Hybridisation oven, 65°C. 5. Rotating platform. 6. Micro-centrifuge tubes, 1.5 ml smL. 7. Magnetic stir bars 2. 8. Magnetic stir plate. 9. Micro-centrifuge. 10. Agilent slide staining dishes with slide racks. 11. Forceps. 12. Ice. 13. Agilent Gene Expression Hybridisation Kit. 14. Agilent Gene expression Wash Buffer Kit. 15. Heating block, 65°C. 16. Vacuum concentrator.

2.8. Capture and Normalisation of Microarray Data

1. GenePix 4000b semi-confocal microarray scanner (Axon Instruments). 2. GenePix Pro software (Axon Instruments).

3. Methods 3.1. Preparation of A. fumigatus inoculum (see Note 2)

All procedures involving manipulation of A. fumigatus should be undertaken in a Class 2 cabinet in order to prevent aerial spore contamination. 1. Inoculate A. fumigatus from source Aspergillus minimal medium agar plates onto 3 Aspergillus complete medium slopes and culture at 37°C in a sealed plastic box for 3 days. 2. Harvest slopes by flooding each with 10 mL sterile saline and decant into fresh sterile falcon tube. Filter the spore suspension through a fresh sterile miracloth into a fresh sterile falcon tube.

30

Microarrays for Fungal Immunity

439

3. Wash the spore suspension twice, by pelleting at 3,000 × g for 5 min and resuspending in 10 mL sterile saline. 4. Calculate spore concentration by haemocytometer count of 1:10 dilution. 5. Pellet spores by centrifugation at 3,000 × g for 5 min and resuspend in sterile saline to yield a concentration of 1.25 × 107/ mL. 6. Verify viable counts from administered inocula by plating serial dilutions of the inocula on Aspergillus complete medium agar plates and culture at 37°C for 2 days. 3.2. Immunosuppression of CD1 Mice with Hydrocortisone and Cyclophosphamide

House groups of mice in individually vented cages and allow free access to food and antibiotic water (see Notes 3 and 4). 1. Immunosuppress mice with cyclophosphamide (150 mg/kg) intraperitoneal injections on days −3 and −1, and a single dose of hydrocortisone acetate (112.5 mg/kg) administered subcutaneously on day −1. 2. For controls, inject mice with equivalent volumes of normal saline.

3.3. Intra-nasal Inoculation of A. fumigatus into the Murine Lung

3.4. Harvesting and Preservation of the Murine Lung

1. Fill the anaesthetic apparatus with isoflurane and ensure good oxygen supply. Prime the chamber to enable good mixing of anaesthetic and oxygen. 2. Wait 1 min, then anesthetise mice by isoflurane inhalation in the chamber and inoculate lungs with A. fumigatus by intranasal instillation of 5 × 105 conidia in 40 μL normal saline. Four mice may be anaesthetized at any one time. 1. Cull mice at desired time points by cervical dislocation, and immediately ex-sanguinate by aortic transection after sternotomy and perform pneumonectomy. 2. Snap freeze lungs in liquid nitrogen. 3. Store frozen lungs at −80°C until required for RNA extraction.

3.5. Isolation of Total RNA from the Murine Lung

1. Pre-cool a pestle and mortar with liquid nitrogen. 2. Homogenise lungs by placing in pestle and mortar in liquid nitrogen and gently tapping the lungs with the pestle. The lungs shatter into fine particulate matter. 3. Add TRIzol to homogenised tissue at a ratio of 10 mL TRIzol per gram of tissue and further homogenise until lung tissue is entirely dissolved. 4. Keep samples at room temperature for 5 min to allow dissociation of the nucleoprotein complexes.

440

Z. Dhesi et al.

5. Transfer to micro-centrifuge tubes and centrifuge at 12,000 × g for 10 min. Transfer the clear supernatant to a fresh tube. After addition of 0.4 volumes of chloroform, shake the samples vigorously for 15 s by hand and leave for 3–10 min at room temperature. 6. Centrifuge at 12,000 × g for 5 min. 7. Transfer the aqueous phase (see Note 5) to a fresh micro-centrifuge tube, taking care not to transfer any of the interphase. 8. Precipitate the RNA by adding 0.5 mL isopropyl alcohol per mL TRIzol reagent and keep samples at room temperature for 5–15 min (see Note 6). 9. Centrifuge at 12,000 × g for 10 min. The RNA pellet should form a gel-like precipitate on the bottom and side of the tube. 10. Remove the isopropyl alcohol supernatant carefully. Wash the pellet with 1 mL 70% ethanol and centrifuge at 12,000 × g for 10 min. 11. Briefly air dry the RNA pellet and dissolve in 500 μL DEPCtreated water. 12. Add an equal volume of lithium chloride buffer and precipitate for at least 1 h at −20°C. 13. Centrifuge at maximum speed for 30 min (see Note 7). 14. Wash the pellet twice with 70% ethanol. Dry the pellet and resuspend in 50 μL of DEPC-treated water. 15. Quantify RNA by measuring spectrophotometric absorbance at 260/280 nm and run on 1% agarose gel (TBE) to visualise and check for quality of RNA. Alternatively, assess purity with the Bioanalyzer Nanodrop Series microfluidics platform. 16. For further RNA cleanup, carry out a second round of isolation using the Qiagen RNeasy Mini Kit (http://www.qiagen. com/products/rnastabilizationpurification/rneasysystem/ rneasymini.aspx). 3.6. Immunofluorescent Labelling of ReverseTranscribed Total RNA

1. Add 5 μg total RNA to 1 μL random primers (3 μg/μL) and 1 μL oligo(dT) primers (2 μg/μL) and make up to 20 μL with nuclease-free water. 2. Incubate for 10 min at 70°C and place on ice. 3. Prepare labelling mixes as detailed in Table 1. There is no need to perform dye swaps with Agilent arrays. 4. Add a labelling mix to each sample on ice, vortex and briefly centrifuge. 5. Incubate at room temperature for 10 min in the dark (under silver foil).

30

Microarrays for Fungal Immunity

441

Table 1 cDNA labelling mixes Solution

Cy3 Probe

Cy5 probe

ChipShot™ RT buffer

8 μL

8 μL

MgCl2

4.8 μL

4.8 μL

dNTP mix, total RNA

2 μL

3 μL

Cy3 dCTP

1 μL

–

Cy5 dCTP

–

1 μL

ChipShot™ reverse transcriptase

3.2 μL

3.2 μL

Nuclease-free water

1 μL

–

Total volume

20 μL

20 μL

6. Incubate for 2 h at 42°C in the dark, and then add 1 μL RNase H and 0.35 μL RNase solution to each reaction. Incubate at 37°C for 15 min. 7. Add 4 μL sodium acetate and 225 μL binding solution to each sample, vortex briefly and apply to a ChipShot™ column in a collection tube. Stand for 5 min, and then spin at 10,000 × g for 1 min. 8. Discard flow through and wash with 500 μL 80% ethanol at 10,000 × g for 1 min. Repeat ethanol washes two more times. 9. Place column in a new collection tube, and elute by adding 60 μL elution buffer, standing for 1 min and spinning at 10,000 × g for 1 min. 10. Quantify cDNA and dye incorporation using a Nanodrop ND-1000 (see Note 8). 3.7. Hybridisation of cDNA Probes to Microarray Slides

Hybridization procedures for Agilent 4 × 44 K mouse gene expression arrays are based upon the manufacturer’s instructions (Agilent Gene Expression Hybridization Kit). 1. Add 500 μL nuclease-free water to 10× blocking agent. 2. Vortex for 10 s, and then centrifuge briefly. 3. Lyophilise 825 ng cDNA (Cy3 or Cy5 labelled) in a vacuum concentrator and resuspend in 41.8 μL nuclease-free water. 4. Add 11 μL 10× blocking agent and 2.2 μL 25× fragmentation buffer. 5. Gently mix by vortexing briefly.

442

Z. Dhesi et al.

6. Incubate for 30 min at 65°C and place immediately on ice. 7. Add 55 μL 2× hybridization buffer and mix carefully by pipetting, taking care to avoid the introduction of bubbles. 8. Spin for 1 min in a micro-centrifuge at full speed and place immediately on ice. 9. Place a clean slide gasket in the Agilent SureHyb chamber and dispense 100 μL of the combined hybridization probes into the gasket well. 10. Lower the Agilent microarray slide active face-down (numeric barcode face-up) onto the slide gasket to form a sandwich. 11. Assemble the SureHyb chamber and clamp shut. 12. Place on a rotating platform in an oven at 65°C at 10 rpm, and incubate for 17 h. 13. Disassemble the clamp assembly, and place the array sandwich immediately in a slide staining dish containing Gene Expression Wash Buffer 1. 14. Open the sandwich from the barcode end with forceps. Allow the gasket to fall to the bottom of the dish and transfer the microarray slide to a slide rack in a second slide staining dish containing Gene Expression Wash Buffer 1 and a magnetic stirrer. 15. Stir the wash buffer for 1 min and then transfer the slide rack to another slide staining dish containing Gene Expression Wash Buffer 2 warmed to 37°C and stir for a further minute. Repeat this wash step. 16. Slowly remove the slide rack in order to avoid the formation of drops on the sides. 17. Place slide in an Agilent slide holder with the barcode facing upwards and proceed to the data capture. 3.8. Capture and Normalisation of Microarray Data

1. Turn on the GenePix 4100b Scanner (see Note 9). 2. Place slide in GenePix scanner with the array features face down. 3. Click “Preview Scan.” An array image will be produced. 4. Click on the scan area tool and use the cursor to select the image area containing the array features. 5. In the hardware setting, adjust the photomultiplier settings so that the maximum intensity for each channel is just below saturation and the count ratio in the histogram tab is equal to 1.0 (see Note 10). 6. In the hardware settings change the pixel size to 5 μm and the lines to average to 3. 7. Press the Data Scan tab.

30

Microarrays for Fungal Immunity

443

8. To save the image, Click “File” and save as a Multi-Image TIFF. 9. Select the File button. Select “Load Array List.” Select the Agilent Mouse Array file that was included with the slides. 10. Click “Open.” 11. Adjust the blocks with the cursor so that they are aligned with the array features. Then click “Find Blocks.” Once this is done, click “Align Features.” 12. Click on the “Zoom area” tool to zoom in on the blocks with the cursor. 13. Click on Blocks or Features and use the cursor keys to resize the Feature Indicators so that they are well aligned. 14. In order to flag bad features, select the Feature button and select a flag to apply to a feature. 15. Once happy that the feature extraction image is optimally aligned, click “Analyse.” 16. Save the GPR file. 17. Proceed with further microarray analysis to identify changes in gene expression during infection relative to control samples (see Note 11).

4. Notes 1. Preparation of DEPC-treated water: Add 1 mL DEPC to 1 L of sterile water in a Class 2 hood, as DEPC is toxic, and leave overnight with the hood switched on and the bottle sealed. Autoclave for at least 15 min to inactivate the DEPC. 2. Practise preparation of inocula prior to actual mouse experiments by preparing the inocula and then plating to enumeration spore concentration by plate culture. 3. Housing in ventilated cages ensures that no bacterial infections should occur during immunosuppression. 4. We find four biological replicates are required for each condition in order to enable statistical significance for subsequent microarray analysis. 5. The mixture separates into the lower red (phenol–chloroform) phase, the interphase, and the colourless upper aqueous phase. 6. Samples can be left overnight at this stage at 4°. 7. Samples can be left overnight at this stage at 4°. 8. There is a specific microarray dye incorporation feature in the NanoDrop. Acceptable yields of cDNA are 1.2–2.4 μg, and

444

Z. Dhesi et al.

yields of incorporated dye are 100–225 pmol for Cy3™ probes and 50–160 pmol for Cy5™ probes. 9. The scanner generally requires warming up for 15 min prior to usage. 10. This is achieved by iteratively changing the PMT settings and then repeating the preview scan and rechecking the histogram readings. This process is aimed at enabling maximal data acquisition whilst enabling the intensities of the two wavelengths to be balanced. 11. The TIGR Array suite is a user-friendly freeware solution for microarray analysis. References 1. Clark TA, Hajjeh RA (2002). Recent trends in the epidemiology of invasive mycoses. Curr Opin Infect Dis 15, 569–574. 2. Singh N (2005). Invasive aspergillosis in organ transplant recipients: new issues in epidemiologic characteristics, diagnosis, and management. Med Mycol 43 Suppl 1, S267–70. 3. Kontoyiannis DP, Marr KA, Park BJ, Alexander BD, et al. (2010). Prospective surveillance for invasive fungal infections in hematopoietic stem cell transplant recipients, 2001-2006: overview of the Transplant-Associated Infection Surveillance Network (TRANSNET) Database. Clin Infect Dis 50, 1091–1100. 4. Tang CM, Cohen J, Krausz T, Van Noorden S, Holden DW (1993). The alkaline protease of

Aspergillus fumigatus is not a virulence determinant in two murine models of invasive pulmonary aspergillosis. Infect Immun 61, 1650–1656. 5. Sidransky H, Verney E, Beede H (1965). Experimental Pulmonary Aspergillosis. Arch Pathol 79, 299–309. 6. Armstrong-James DP, Turnbull SA, Teo I, Stark J, Rogers NJ, Rogers TR, Bignell E, Haynes K (2009). Impaired interferon-gamma responses, increased interleukin-17 expression, and a tumor necrosis factor-alpha transcriptional program in invasive aspergillosis. J Infect Dis 200, 1341–1351. 7. Cove DJ (1966). The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim Biophys Acta 113, 51–56.

Part VII Non-mammalian Model Systems for Host–Fungal Interactions

Chapter 31 Caenorhabditis elegans : A Nematode Infection Model for Pathogenic Fungi Maged Muhammed, Jeffrey J. Coleman, and Eleftherios Mylonakis Abstract Recent work suggests that fungal virulence factors important in human disease have evolved through interactions with environmental predators such as amoebae, nematodes, and insects. This has allowed the use of simple model hosts for the study of fungal pathogenesis; specifically, the nematode Caenorhabditis elegans has become a model host to study medically important fungi. Alternative model hosts can be used as easy tools to identify virulence factors of pathogens, to study evolutionarily preserved immune responses, and to identify novel antifungal compounds with low cost. This chapter describes assays utilizing the nematode in studies on fungal-host interactions and antifungal drug discovery. These assays include the nematode killing assay, the progeny permissive assay, and antifungal compound discovery assay. Key words: Antifungal, Caenorhabditis elegans, Cryptococcus, Survival assay

1. Introduction Caenorhabditis elegans, a free-living soil nematode, is a widely used invertebrate in vivo model for infection and has been utilized in the study of host-pathogen interactions and antimicrobial compound discovery. C. elegans has many advantages favorable for use as a model host, such as its short reproductive cycle producing genetically identical progeny, an evolutionary conserved immune response pathway, and availability of molecular tools (such as an annotated genome and RNA interference libraries). The nematode also provides a cost-efficient and ethically acceptable alternative to mammalian models. Furthermore, in drug discovery, applications of this model system can give clues about compound toxicity and an indication if the compound has any interaction with the host immune system.

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_31, © Springer Science+Business Media, LLC 2012

447

448

M. Muhammed et al.

In the laboratory, the nematode can be easily maintained and propagated on nematode growth medium (NGM), and fed on a lawn of Escherichia coli (auxotrophic strain OP50). There are two sexual forms of C. elegans : the predominant hermaphrodite and males. The hermaphrodite produces both eggs and sperm and subsequently can self-fertilize producing hundreds of progeny. The time to complete the C. elegans life cycle is dependent on temperature. For example, when the nematode is maintained at 15°C, it takes approximately 5 days for progeny to develop and lay eggs; however, at 25°C the process is completed in two and a half days. C. elegans has been utilized as a model host for several clinically relevant fungal pathogens, including Candida albicans, Candida glabrata, Cryptococcus neoformans, and Histoplasma capsulatum (1–4). Two assay types utilizing C. elegans to study host-pathogen interactions have been used: the liquid media assay and the solid media assay. Choosing the appropriate assay depends on the purpose of the experiment. For example, C. albicans readily forms hyphae in the liquid environment, and the liquid assay would be the choice if the goal is to study the role of filamentation in virulence. Use of the liquid media assay is also preferred in drug discovery since it facilitates the study of large libraries of chemical compounds. In this chapter, we will summarize representative assays that have been developed to allow C. elegans to be used in the study of fungal pathogenesis and antifungal compound discovery.

2. Materials 2.1. Caenorhabditis elegans Growth

1. Caenorhabditis elegans strains (glp4; sek1 strain, N2 Bristol strain) (see Note 1). 2. 5 mg/mL cholesterol: Make up solution in ethanol. 3. 1 M KPO4 buffer: Add 108.3 g KH2PO4 and 35.6 g K2HPO4 to 1,000 mL distilled water and adjust to pH 6. Autoclave and keep at room temperature. 4. Nematode growth medium (NGM) agar: Add 3 g NaCl, 2.5 g peptone, and 17 g agar to 975 mL distilled water and autoclave. After cooling, add 25 mL 1 M KPO4 buffer, 1 mL 1 M MgSO4, 1 mL 1 M CaCl2, and 1 mL 5 mg/ml cholesterol. Pour the medium into 10-cm culture plates. 5. Broth: Add 12.5 g LB powder to 1,000 mL distilled water and autoclave. Keep at room temperature. 6. E. coli OP50 strain: Cultured in LB broth and grown for 24 h at 37°C. 7. NGM/E. coli: Spread 100 μL of the E. coli OP50 culture on each NGM plate to create a lawn (see Note 2). Keep at room temperature until dry and then allow growth for 2 days at 37°C. Store at 4°C.

31

Utilization of Caenorhabditis elegans as a Tool to Study Fungal Pathogenesis

449

8. M9 solution: Add 3 g KH2PO4, 6 g Na2HPO4, and 5 g NaCl to 1,000 mL of distilled water and autoclave. After cooling, add 1 mL 1 M MgSO4. Keep at room temperature. 9. 100% Bleach. 10. 5 M NaCl. 11. Dissecting microscope. 12. Shaker. 2.2. Growth of Fungal Cultures

1. 1,000× kanamycin stock solution: Make a 45 mg/mL solution in distilled water, filter-sterilize, and store at −20°C. 2. 1,000× ampicillin stock solution: Make a 100 mg/mL solution in distilled water, filter-sterilize, and store at −20°C. 3. 1,000× streptomycin stock solution: Make a 100 mg/mL solution in distilled water, filter-sterilize, and store at −20°C. 4. Yeast peptone dextrose (YPD) broth plus antibiotics. 5. Add 10 g yeast extract and 20 g peptone to 800 mL distilled water and autoclave. After cooling, add 200 mL filter-sterilized 10% glucose and store at room temperature. Add antibiotics kanamycin (45 μg/mL), streptomycin (100 μg/mL), and ampicillin (100 μg/mL) prior to use. 6. Brain heart infusion (BHI) broth: Add 37 g BHI powder to 1,000 mL distilled water. Autoclave. Keep at room temperature. 7. BHI agar plus antibiotics: Add 37 g BHI powder and 12.5 g agar to 1,000 mL of distilled water and autoclave. After cooling, add 1 mL kanamycin (45 μg/mL), 1 mL streptomycin (100 μg/mL), and 1 mL ampicillin (100 μg/mL), and pour the media into culture plates appropriate for the experiment. 8. C. albicans strain DAY185. 9. Cryptococcus neoformans strains. 10. Roller drum. 11. 20% BHI in M9.

3. Methods 3.1. Nematode Synchronization

1. Cut a ~1-cm × ~1-cm square of NGM agar containing recently hatched nematodes from stock plates (stored at 15°C) with any sterilized sharp tool. Transfer the agar square to a new NGM/E. coli plate—place the upper surface of the square directly on to the surface of the new plate.

450

M. Muhammed et al.

2. Leave worms at 15°C for 3–4 days until the worms become gravid (see Note 3). 3. After the worms became gravid, wash the plate with 6 mL M9 buffer and pour the M9 (containing the gravid worms) into a 15-mL centrifuge tube. 4. Add M9 buffer to a total volume of 15 mL. 5. Centrifuge for 30 s at 1,500 × g. 6. Carefully remove the supernatant, leaving the worms in 500 μL buffer. 7. Add 400 μL 100% bleach plus 100 μL 5 M NaOH to the tube and vortex until the cuticles of half of the worms have ruptured. Monitor worms under the dissecting microscope during this step to avoid breaking the nematode eggs (see Note 4). 8. Wash the eggs with M9 as follows: Fill the tube with M9, centrifuge for 30 s at 1,500 × g, and remove the supernatant, leaving the eggs in 500 μL buffer. Repeat this step four times. 9. After the final wash, remove the supernatant and add 5 mL M9. 10. Leave the tube at room temperature on a shaker for at least 18 h to allow the eggs to hatch. 11. Transfer the hatched worms to fresh NGM/E. coli plates and incubate at 25°C for 36 h (see Note 5). Nematode worms are now at the L4 stage and are ready for use in experiments. 3.2. Preparation of Nematodes for the Assays

1. To transfer synchronized L4 nematodes, add 6 mL M9 buffer to the NGM plates that contain synchronized L4 nematodes and transfer to a 15-mL centrifuge tube. 2. Add M9 buffer to a total volume of 15 mL. 3. Centrifuge at 1,500 × g for 30 s. 4. Remove the supernatant and leave the nematodes in 500 μL M9. 5. Repeat this step four times to avoid transfer of E. coli cells. 6. After the final wash, remove the supernatant, leaving the nematodes in ~500 μL M9 buffer. 7. Using a dissecting microscope, determine the nematode concentration by counting the number of nematodes in 3 μL aliquots of the nematode suspension. Adjust to the desired concentration. 8. Vortex the nematode suspension prior to use in assays.

3.3. Assays 3.3.1. Cryptococcus Killing Assay

1. Inoculate C. neoformans strains to be assayed into 2 mL YPD plus antibiotics (see Note 6) and grow on a roller drum at 30°C for 48 h.

31

Utilization of Caenorhabditis elegans as a Tool to Study Fungal Pathogenesis

451

2. Spread 10 μL of each culture on a 35-mm tissue culture plate containing BHI agar (see Note 7). 3. Incubate plates at 30°C for 2 days. 4. Transfer 40–50 synchronized L4 nematodes (glp4; sek1 strain) (see Notes 8 and 9) onto each plate. 5. Incubate the plates at 25°C. 6. Score C. elegans survival at 12–24-h intervals (3) (see Note 10). 3.3.2. Cryptococcus Progeny Assay

1. Inoculate C. neoformans strains into 2 mL YPD plus antibiotics and grow on a roller drum at 30°C for 48 h. 2. Spread 10 μL of each culture on a 35-mm tissue culture plate containing BHI agar (see Note 6). 3. Incubate the plate at 30°C for 2 days. 4. Transfer 20–25 synchronized nematodes (N2 Bristol strain) onto each plate (see Note 11). 5. Incubate plates at 25°C. 6. Transfer worms every 24 h to fresh lawns of C. neoformansBHI agar plates throughout the reproductive period of the nematode. 7. Each time after removing the parents, spread the lawn face down on a 100-mm NGM/E. coli plate and allow the eggs to hatch. Count the number of nematodes over the next several days (5) (see Notes 12 and 13).

3.3.3. Liquid Candida albicans Assay (Preinfection) for Antifungal Compounds Evaluation

1. Inoculate C. albicans DAY185 in 2 mL YPD plus the three antibiotics at 30°C for 16–20 h and spread 100 μL of the culture on 100-mm culture plates containing BHI agar (Fig. 1). 2. Allow the plates to grow at 30°C for 48 h. 3. Transfer 1,000 glp4; sek1 nematodes to the C. albicans lawn on BHI agar plates as described in Subheading 3.2. 4. Incubate the plates at 25°C for 2–4 h. 5. Fill each well in a 96-well plate with 75 μL of 20% BHI in M9. 6. Add 15–20 worms per well by pipette (see Note 14). 7. Transfer compounds to be tested to each well to achieve a final concentration of the compound between 0.25 and 2 μg/mL (see Note 15). 8. The final volume should not exceed ~100 μL per well. 9. Cover the plates with membranes (see Note 16) and incubate the plates at 25°C for 5 days. Score the number of dead nematodes and calculate the percentage survival (1, 6, 7).

452

M. Muhammed et al.

Fig. 1. C. elegans–based screening of antifungal agents using two different methods (coinfection or preinfection). In the coinfection method, C. elegans nematodes are incubated in wells containing both the fungal pathogen and the target compound. In the preinfection method, the C. elegans nematodes are first incubated on a lawn of the fungal pathogen and then transferred to a well containing the target compound. The expected results are shown.

4. Notes 1. If wild-type worms are used, results of assays can be obscured by internally hatched eggs (“bagging”); therefore carefully monitor the mother’s movement to make sure that the movement did not result from the internal hatchlings. This can happen in all worm assays but is more common in the Cryptococcus progeny assay. An alternative is to use a C. elegans strain that cannot produce progeny (e.g., the glp4; sek1 strain). 2. Try not to break the surface of the agar, as the nematodes may burrow into the agar making it difficult to score if they are alive or dead. 3. Because of the transparent body of the nematode, the eggs are visible inside the gravid worms. 4. Do not exceed 4 min incubation as this leads to a decrease in egg viability. 5. It is recommended to not exceed 2,000 nematodes on a single 100-mm NGM plate as the nematodes may starve during development if all the OP50 is consumed.

31

Utilization of Caenorhabditis elegans as a Tool to Study Fungal Pathogenesis

453

6. The antibiotics will kill E. coli OP50. 7. When making the fungal pathogen lawns, try not to spread the culture to the edge of the plate. This may increase the chances of the worms moving to the sides of the culture plate making scoring difficult. 8. The mutant nematodes of glp-4 are temperature-sensitive sterile at 25°C. 9. The sek-1 gene encodes a mitogen-activated protein kinase kinase involved in the evolutionarily conserved p38 innate immune response pathway. 10. Worms are considered dead when they fail to respond to the touch of a platinum wire pick for the solid assays or when they fail to “swim” in the liquid assays. 11. When using the N2 Bristol wild-type strain, transfer the nematodes during the reproductive period to a new plate; otherwise, the newly hatched progeny will look like the original assay nematodes, obscuring the resulting data. 12. The numbers reported are the total progeny produced over the first 72 h of egg laying. 13. Only nematodes that survive all 3 days of the experiment are included in the data (viable progeny is defined as larvae in the first-stage (or older) of development). 14. Do not exceed 25 worms in each well of a half-volume 96-well microtiter plate. 15. Two wells in each row are used as negative controls, containing only the drug diluent, e.g., DMSO. The other wells in each row contain different concentrations of the drugs to be tested. As a positive control, amphotericin B is assayed at 1, 0.5, 0.25, 0.125, and 0.0625 μg/mL. 16. The membranes are double-layered, and the upper layer must be carefully removed so that the worms will not asphyxiate. References 1. Breger J, Fuchs BB, Aperis G, Moy TI, Ausubel FM, Mylonakis E (2007) Antifungal chemical compounds identified using a C. elegans pathogenicity assay. PLoS Pathog 3: e18. 2. Thakur JK, Arthanari H, Yang F, Pan SJ, Fan X, Breger J, Frueh DP, Gulshan K, Li DK, Mylonakis E, Struhl K, Moye-Rowley WS, Cormack BP, Wagner G, Näär AM (2008) A nuclear receptorlike pathway regulating multidrug resistance in fungi. Nature 452: 604–609. 3. Mylonakis E, Ausubel FM, Perfect JR, Heitman J, Calderwood SB (2002) Killing of

Caenorhabditis elegans by Cryptococcus neoformans as a model of yeast pathogenesis. Proc Natl Acad Sci USA 99: 15675–15680. 4. Johnson CH, Ayyadevara S, McEwen JE, Shmookler Reis RJ (2009) Histoplasma capsulatum and Caenorhabditis elegans: a simple nematode model for an innate immune response to fungal infection. Med Mycol 47: 808–813. 5. Tang RJ, Breger J, Idnurm A, Gerik KJ, Lodge JK, Heitman J, Calderwood SB, Mylonakis E (2005) Cryptococcus neoformans gene involved

454

M. Muhammed et al.

in mammalian pathogenesis identified by a Caenorhabditis elegans progeny-based approach. Infect Immun 73:8219–8225. 6. Tampakakis E, Okoli I, Mylonakis E (2008) A C. elegans-based, whole animal, in vivo screen for the identification of antifungal compounds. Nat Protocols 3: 1925–1931.

7. Okoli I, Coleman JJ, Tampakakis E, An WF, Holson E, Wagner E, Conery AL, Larkins FJ, Wu G, Stern A, Ausubel FM, Mylonakis E (2009) Identification of antifungal compounds active against Candida albicans using an improved high-throughput Caenorhabditis elegans assay. PLoS ONE 4: e7025.

Chapter 32 Drosophila melanogaster as a Model Organism for Invasive Aspergillosis Michail S. Lionakis and Dimitrios P. Kontoyiannis Abstract Mammalian hosts have traditionally been considered the “gold standard” models for studying pathogenesis and antifungal drug activity in invasive aspergillosis (IA). Nevertheless, logistical, economical, and ethical constraints make these host systems difficult to use for high-throughput screening of putative Aspergillus virulence factors and novel antifungal compounds. Here, we present Drosophila melanogaster, a heterologous non-vertebrate host with conserved innate immunity and genetic tractability, as an alternative, easy-to-use, and inexpensive pathosystem for studying Aspergillus pathogenesis and antifungal activity. We describe three different infection protocols (i.e., injection, rolling, ingestion) that introduce Aspergillus conidia at different anatomical sites of Toll-deficient Drosophila flies. These reproducible assays can be used to (1) determine the virulence of various Aspergillus strains and to (2) assess the anti-Aspergillus activity of orally absorbed antifungal agents in vivo. These methods can also be adapted to study pathogenesis and antifungal drug activity against other medically important human fungal pathogens. Key words: Drosophila, Fruit fly, Invertebrate mini-host model, Aspergillus, Aspergillosis, Virulence, Pathogenesis, Antifungal efficacy

1. Introduction Invasive aspergillosis (IA) is the leading cause of infectious death in patients with leukemia and in recipients of allogeneic hematopoietic stem cell transplantation (1, 2). Although significant advances have occurred over the past decade in antifungal treatment, patients who develop IA still have unfavorable prognoses, reflecting their significant net state of immunosuppression and the suboptimal in vivo efficacy of modern antifungals (1, 2). Thus, new antifungal drug development and introduction of novel therapeutic strategies are important directions in Aspergillus research (3).

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_32, © Springer Science+Business Media, LLC 2012

455

456

M.S. Lionakis and D.P. Kontoyiannis

Since the early 2000s, new antifungal drugs with promising in vitro anti-Aspergillus activity have been added to our armamentarium against IA: the new-generation broad-spectrum triazoles and the echinocandins. Because in vitro susceptibility testing of antifungals alone or in different combinations does not reliably correlate with in vivo clinical efficacy (4, 5), evaluation of antifungal activity relies on IA animal model studies, typically using immunocompetent or immunosuppressed mammals, such as rodents, rabbits, and guinea pigs (6–9). Use of these conventional host systems is costly, time consuming, and poses ethical controversies, especially when it comes to testing various antifungal combinations that requires large number of animals. Not surprisingly, use of these animal models is typically limited to testing only one Aspergillus isolate in a small number of animals. The recent completion of the Aspergillus fumigatus genome sequencing project (10), along with significant strides in fungal genetics, has led to a surge of genetic information pertaining to the contribution of individual genes to Aspergillus virulence. For instance, Aspergillus strains with defects in siderophore biosynthesis (DsidA, DsidC, DsidD, DsidF) (11, 12), melanin (Dalb1) (13) or gliotoxin production (DgliP) (14), PABA metabolism (H515) (15), thermotolerance (DcgrA) (16), ras signaling (DrhbA) (17), or starvation stress response (DcpcA) (18) have been shown to be hypovirulent in mammalian models of IA. Several other molecular factors that may be required for an Aspergillus strain to be an effective pathogen are likely to be discovered in the near future. This explosion in functional genomics creates the need for high-throughput screening strategies capable of determining the role of individual Aspergillus genes in virulence. Because studying the pathogenesis of IA in conventional mammalian models is labor intensive, expensive, and has logistical limitations, these hosts present a significant “bottleneck” in large-scale screening of putative Aspergillus mutants. Because of these limitations, several studies of pathogenesis in Aspergillus fumigatus and a variety of other fungal and non-fungal human pathogens have been recently reported in non-vertebrate mini-hosts, including the fruit fly Drosophila melanogaster (19–23), the roundworm Caenorhabditis elegans (24), the greater wax moth Galleria mellonella (25), and the amoebae Acanthamoeba castellanii and Dictyostelium discoideum (26, 27). Besides their genetic tractability, the availability of robust research tools (i.e., full-genome microarrays and RNA interference libraries) (28) and the fact that they are easy to use, inexpensive, and less time consuming than mammalian host systems, critical components of their innate immunity are evolutionarily conserved through mammalian hosts, making these invertebrate pathosystems appealing for studying microbial pathogenesis (29, 30). Drosophila in particular has two distinct, highly conserved signaling pathways that are critical for defending against invading

32 Drosophila melanogaster and Aspergillosis

457

pathogens: Imd against Gram-negative bacteria and Toll against fungi and Gram-positive bacteria (31). The Toll signaling pathway, which was initially discovered as a key regulator of embryonic dorsoventral patterning in Drosophila (19), is a protease cascade homologous to complement activation by the lectin pathway in mammals (31). Upon fungal challenge, Toll activation leads to downstream production of potent fungicidal peptides that protect flies against fungi (19, 20). On the other hand, Drosophila mutants lacking different components of the Toll cascade are highly susceptible to an array of fungal microorganisms including Aspergillus fumigatus, Aspergillus terreus, Cunninghamella bertholletiae, Rhizopus oryzae, Mucor circinelloides, Scedosporium prolificans, Scedosporium apiospermum, Fusarium moniliforme, Candida albicans, and Cryptococcus neoformans (19, 23, 32–37). Because flies can be grown, manipulated, and analyzed in large numbers in a time-efficient manner and with significantly less labor and cost than conventional animal models, Drosophila can be used as an in vivo model system for large-scale screening of Aspergillus virulence factors and of drugs for anti-Aspergillus activity (32, 38). Herein, we describe three infection assays that introduce Aspergillus conidia (1) directly into the fly hemolymph (injection assay), (2) at the gastrointestinal mucosa (ingestion assay), or (3) on the skin surface (rolling assay) (32). All three assays are easy to perform and reproducibly result in high mortality in Toll-deficient flies after Aspergillus challenge as opposed to WT Drosophila, which are resistant to IA (32). A comparative analysis of hypovirulent Aspergillus strains between mice and Drosophila reveals high-level concordance between these host systems for testing Aspergillus virulence factors (39). Moreover, treatment of Aspergillus-infected Toll-deficient flies with voriconazole results in significant improvement in survival and reduction in tissue fungal burden (32). Finally, treatment of Aspergillus-infected Toll-deficient flies with the combination of voriconazole and terbinafine was found to be synergistic (32), in agreement with the in vitro synergism of these agents against Aspergillus fumigatus (40). Hence, Drosophila melanogaster fruit flies with impaired Toll pathway can be successfully used for studying the pathogenesis of IA and the efficacy of antifungal drugs (used alone or in combination) against Aspergillus.

2. Materials 2.1. Aspergillus Inoculum Preparation

1. Aspergillus fumigatus clinical isolate AF293 wild-type (WT) strain and gliP-deleted Aspergillus fumigatus strain derived from AF293 (14). Of note, AF293 is the strain sequenced in the Aspergillus genome sequencing project (http://www.sanger. ac.uk/Projects/A_fumigatus/) (10). Other hypovirulent

458

M.S. Lionakis and D.P. Kontoyiannis

Aspergillus fumigatus strains along with their isogenic WT strains can also be assayed (e.g., alb1-deleted Aspergillus fumigatus strain B-5233/RGD12-8 and its isogenic WT Aspergillus strain, B-5233) (13). 2. YAG agar plates: 15 g agar, 10 g glucose, 5 g yeast extract, 10 mL of 1 M MgSO4, 2 mL vitamin mix (1 g p-aminobenzoic acid, 1 g niacin, 1 g pyridoxine HCl, 1 g riboflavin, 1 g thiamine HCl, 1 g cholin HCl, 2 mg d-biotin in 1 L distilled water; store at 4°C in the dark after autoclaving), and 1 mL trace elements (100 mL 0.25 M EDTA pH 8.0, 1 g FeSO4 × 7H2O, 8.8 g ZnSO4 × 7H2O, 0.4 g CuSO4 × 4H2O, 0.15 g MnSO4 × 4H2O, 0.1 g Na2B4O7 × 10H2O, and 0.1 g NaMoO4 × 2H2O in 1 L distilled water; store at room temperature) in 1 L distilled water. Pour autoclaved medium into sterile petri dishes (~20–25 mL per dish) and allow to solidify overnight at room temperature. Store at 4°C for up to 3 months. 3. Sterile disposable petri dishes (100 × 15 mm) (BD Biosciences). 4. Glass spreaders. 5. Glycerol. 6. Hemocytometer. 2.2. Drosophila Infection Assays

1. Adult fly lines (see Note 1): OregonR WT flies have a functional Toll pathway and are inherently resistant to Aspergillus challenge; T lr632/T lI-RXA Toll-deficient flies have a null (TlI-RXA) and a temperature-sensitive loss-of-function (Tlr632) allele and, therefore, lack a functional Toll pathway, making them susceptible to Aspergillus and other fungal infections when maintained at 29°C. At the end of the experiment, infected flies should be killed by freezing at −20°C and disposed of as a biohazard material. 2. Fly food: 4.4% cornmeal, 3% yeast, 1% agar, 0.6% sucrose, 0.36% propionic acid, and 0.11% Tegosept (Genesee Scientific Corporation). Aliquot 10–15 mL per fly food vial. 3. Stereoscopic microscope equipped with a controllable CO2flow fly pad (Fig. 1). 4. Fly incubators with high humidity (60–75%), adjustable temperature, and a 12-h light/12-h dark cycle. 5. Size 0 paintbrush (see Note 2). 6. Tungsten stainless steel needle (tip diameter, 0.01 mm), held in a pin vise (Ernest F. Fullam). 7. Bunsen burner. 8. Fly food vials containing 15 mL YAG medium. Pour the autoclaved medium into the fly vials and allow to solidify overnight. Store at 4°C for up to 3 months.

32

Drosophila melanogaster and Aspergillosis

459

Fig. 1. A CO2-flow fly pad used to anesthetize Drosophila flies.

9. Fly food vials (Genesee Scientific Corporation). 10. Sterile disposable petri dishes (100 × 15 mm) (BD Biosciences). 2.3. Fly Tissue Fungal Burden Quantification by qPCR

1. 0.85% NaCl. 2. Bead-beater homogenizer. 3. DNeasy Kit (Qiagen). 4. Oligonucleotide primers and FAM-TAMRA probe. The sequences of Aspergillus fumigatus 18S rRNA (GenBank accession no. AB008401) gene-specific primers and dual-labeled fluorescent hybridization probe are as follows: forward primer, 5¢-GGCCCTTAAATAGCCCGGT-3¢; reverse primer, 5¢-TGAGCCGATAGTCCCCCTAA-3¢; and probe, 5¢-FAMAGCCAGCGGCCCGCAAATG-TAMRA-3¢ (Applied Biosystems). 5. PCR components: TaqMan Universal PCR Master Mix (Applied Biosystems), MicroAmp optical 96-well reaction plates (Applied Biosystems), MicroAmp optical caps (Applied Biosystems), and ABI PRISM 7900HT sequence detection system (Applied Biosystems).

2.4. Fly Antifungal Treatment

1. Antifungal agent(s), e.g., voriconazole (Sigma), or other orally absorbable drugs, e.g., terbinafine (Novartis). Prepare stock solutions of 40 mg/mL. 2. Inactive dry yeast granules (Genesse Scientific Corporation). 3. Spatula.

460

M.S. Lionakis and D.P. Kontoyiannis

3. Methods 3.1. Aspergillus Inoculum Preparation

1. Streak frozen glycerol stock of Aspergillus fumigatus AF293 (or any other Aspergillus strain(s) of interest) onto YAG agar plates and incubate at 37°C for 24 h. 2. Inoculate a single colony using a sterile loop onto a fresh YAG agar plate and incubate at 37°C for 72 h. 3. Collect conidia from the uniform lawn of Aspergillus conidia that forms on the agar surface by adding 0.5 mL of autoclaved water and using a glass spreader to create a conidial suspension. 4. Count conidia using a hemocytometer. 5. Prepare working suspensions of Aspergillus conidia by diluting to the desired concentration (range, 107–1010 conidia/mL).

3.2. Drosophila Infection Assays 3.2.1. Injection Assay

1. Anesthetize flies by placing them on the CO2-flow fly pad (Fig. 1; see Note 3). 2. Sterilize a tungsten needle with a flame, and after cooling the needle, dip it into the Aspergillus conidial suspension (see Note 4). 3. Insert the needle midway into the dorsolateral aspect of the fly thorax (Fig. 2a). 4. Inject 30–50 adult female flies per group (age 2–4 days; see Notes 5–7) (19, 32). 5. Return injected flies to the fly food vial (see Note 8). 6. For controls, inject 30–50 female flies (age 2–4 days) with a sterile needle (septic injury control). 7. Observe the flies closely over the first 3 h postinjection. Flies that die within this period (typically < 5%) have died due to injection injury. These flies should be excluded from the survival analysis. 8. Maintain infected flies at 29°C, the temperature at which susceptibility to infection is maximal due to the temperaturesensitive loss-of-function (T lr632) allele. 9. Transfer flies to fresh food vials every 2 days and monitor mortality every 3–6 h (see Note 9).

3.2.2. Ingestion Assay

1. Grow a fresh lawn of Aspergillus conidia in the YAG-containing fly vials by adding 100 mL of a 1 × 108 conidia/mL solution to the surface of the agar and incubating at 37°C for 72 h. 2. Place 30–50 female flies (age 2–4 days) into the vials and allow them to feed on the Aspergillus conidia for 6–8 h (Fig. 2b; see Note 10). 3. As starvation controls, place 30–50 female flies (age 2–4 days) into vials that contain YAG medium only for 6–8 h.

32 Drosophila melanogaster and Aspergillosis

461

Fig. 2. Drosophila infection routes. (a) Injection assay. A CO2-anesthetized fly is pricked at its dorsolateral thorax with a needle previously dipped in a concentrated Aspergillus solution. (b) Ingestion assay. A group of flies feeds on the surface of a fresh lawn of Aspergillus conidia pre-grown inside a YAG-containing fly vial. (c) Rolling assay. A group of anesthetized flies were rolled for 2 min on a petri dish covered by a fresh carpet of conidia. (d) After rolling, Aspergillus uniformly covers the surface of the flies.

4. Observe the flies closely over the first 3 h post-ingestion. Flies that die within this period (typically < 1%) have died due to starvation and/or stress related to the procedure; exclude these flies from the survival analysis. 5. Maintain infected flies at 29°C, the temperature at which susceptibility to infection is maximal due to the temperaturesensitive loss-of-function (Tlr632) allele. 6. Transfer flies to fresh food vials every 2 days and monitor mortality every 3–6 h (see Note 11). 3.2.3. Rolling Assay

1. Anesthetize female flies (age 2–4 days) by placing them on the CO2-flow fly pad for 3–4 min (see Notes 3 and 12). 2. Transfer anesthetized flies to the surface of a YAG petri dish containing a pre-grown fresh carpet of Aspergillus conidia (Subheading 3.1). 3. Roll flies on the conidial lawn for 2 min (Fig. 2c) to coat the entire fly surface in Aspergillus conidia (Fig. 2d). 4. After rolling, transfer flies into temporary fly food vials for 1–2 h. During this time, flies will wake up and move around,

462

M.S. Lionakis and D.P. Kontoyiannis

with a substantial amount of Aspergillus conidia falling off (Fig. 2d) onto the food surface (see Note 13). 5. After this 1–2 h recovery period, transfer the flies to fresh vials. 6. As rolling-associated injury controls, roll 30–50 female flies (age 2–4 days) on empty petri dishes that do not contain agar for 2 min. 7. Observe the flies closely over the first 3 h post-rolling. Flies that die within this period (typically < 1%) have died from rolling injury; exclude these flies from the survival analysis. 8. Maintain infected flies at 29°C, the temperature at which susceptibility to infection is maximal due to the temperaturesensitive loss-of-function (Tlr632) allele. 9. Transfer flies to fresh food vials every 2 days and monitor mortality every 3–6 h (see Note 14). 3.3. Fly Tissue Fungal Burden Quantification by qPCR

1. Store groups of 20 infected or control flies at −80°C. 2. When ready to proceed with DNA extraction, wash flies twice with 0.85% NaCl to remove conidia from their exterior. 3. Homogenize flies in 1 mL PBS. 4. To create samples for a 7-point standard curve, spike groups of 20 uninfected flies with 101–107 AF293 conidia and process in the same way as sampled flies. 5. Extract DNA by using the DNeasy tissue kit following the manufacturer’s instructions. 6. Prepare a 25-mL PCR reaction using 12.5 mL of PCR 2× master mix, 6.1 mL of water, 5 mL of DNA sample, 0.5 mL of the probe (200 nM), and 0.45 mL each of the forward and reverse primers (900 nM). Run a PCR reaction as follows: 2 min at 50°C, followed by 10 min at 95°C, and then, 15 s at 95°C, followed by 1 min at 65°C; the latter two steps are repeated for 40 cycles. 7. Interpolate the threshold cycle (CT) for each sample from the 7-point standard curve. 8. Report qPCR results as conidial A. fumigatus DNA equivalents (see Note 15).

3.4. Fly Antifungal Treatment 3.4.1. Preparation of Antifungal-Containing Fly Food Vials

1. Flame-sterilize a spatula and use it to make superficial abrasions on the fly food surface. 2. Add voriconazole or the antifungal drug of choice onto the surface of the fly food (see Notes 16 and 17). 3. Fill a 1-mL pipette tip with dry inactive yeast granules and slowly drop them onto the damp food surface (Fig. 3a; see Notes 18 and 19).

32 Drosophila melanogaster and Aspergillosis

463

Fig. 3. Antifungal therapy. (a) Dry yeast granules are dispensed onto antifungal drug previously added onto the fly food surface. Note how the yeast particles are entirely soaked by the antifungal agent. (b) Prior to exposure to antifungal drug-containing food vials, flies are starved for 6–8 h in empty vials.

4. Allow the vials to sit for 24–48 h at room temperature to dry prior to use, otherwise flies will stick to the damp surface and will die. Vials are now ready to use for the antifungal protection experiments. 3.4.2. Treatment of Drosophila with Antifungal Drugs

1. Place 30–50 female flies (age 2–4 days) in empty vials for 6–8 h to starve (Fig. 3b) (see Note 20). 2. After this starvation period, transfer flies into the antifungalcontaining vial and allow feeding for 24 h before infecting with Aspergillus. As an alternative to prophylaxis, the therapeutic effect of the drug can be determined by starting treatment immediately after infection. 3. Maintain flies at 29°C, the temperature at which susceptibility to infection is maximal due to the temperature-sensitive lossof-function (Tlr 632) allele. 4. For controls, infect 30–50 female flies (age 2–4 days) with Aspergillus and place them in vials with fly food that does not contain the antifungal agent. 5. Transfer infected flies to fresh antifungal-containing food vials every 24 h and monitor mortality every 3–6 h (see Note 21).

464

M.S. Lionakis and D.P. Kontoyiannis

4. Notes 1. For breeding flies, incubation at the optimal humidity and temperature is required. It is necessary to add distilled water to the vials every 3–5 days to prevent them drying out. Also, flies should be maintained at 25°C as this temperature increases the yield of emerging adults. Under these optimal conditions, it takes ~8–12 days from the time the female flies lay their eggs in the fly food until the adults emerge. 2. To avoid injuring flies, use a paintbrush to handle them. 3. To anesthetize flies, remove the fly food vial cover and rapidly reverse the vial and attach it onto the fly pad. By doing that, flies will fall on the surface of the pad and will fall asleep within 5–10 s. 4. Vortex the Aspergillus suspension in between fly inoculations to ensure that all flies have been infected with a similar inoculum. 5. Age plays a critical role in fly survival following infection (i.e., 10–15-day-old flies are more susceptible to Aspergillus infection compared to 2–4-day-old flies). Therefore, it is important to use 2–4-day-old flies in all experiments (42). Also, we recommend the use of female flies as they are larger, easier to handle, and relatively more resistant to injection injury compared to male flies. 6. It takes ~5–10 min to inject ten flies. 7. One of the advantages of using flies instead of rodents is that flies can be grown and analyzed in large numbers in a timeefficient and economical manner. As such, it is feasible to obtain enough flies to use ~30–50 flies per group for virulence and antifungal efficacy studies, and this provides sufficient power for statistical analyses. 8. Anesthetized infected flies should be returned to food vials placed on their side until the flies recover from anesthesia. This usually only takes a few minutes and prevents flies from sticking to the food and dying. 9. Typically, using an Aspergillus working solution of 1 × 1010/mL, which delivers ~20,000 conidia per fly, Toll-deficient flies infected with WT Aspergillus begin dying ~48 h postinjection and universally succumb to aspergillosis within 6–8 days postinfection (32). In contrast, OregonR WT flies start dying ~96 h postinjection, with ~25% mortality by day 8 postinfection (32). 10. Do not allow flies to feed on Aspergillus for more than 6–8 h because they will die of dehydration/starvation as YAG medium and conidia are not optimal nutrition (32). For example, 24 h of feeding will result in ~50% fly mortality.

32 Drosophila melanogaster and Aspergillosis

465

11. Typically, Toll-deficient flies infected by ingestion with WT Aspergillus begin dying ~48 h postinfection, with 80–90% mortality occurring within 6–8 days postinfection (32). In contrast, OregonR WT flies start dying ~96 h postinfection and only develop ~10% mortality by day 8 postinfection (32). 12. Anesthetized flies should be allowed to rest for 3–4 min on the CO2-flow fly pad before rolling, instead of the few seconds that would otherwise be sufficient to anesthetize them. By allowing a longer period, flies remain anesthetized during rolling, allowing for uniform exposure to Aspergillus. If flies do wake up during rolling, they move around the petri dish and are not exposed to Aspergillus in a uniform manner. 13. The intermediate 1–2-h step is required, as without it the surface of the food becomes covered with Aspergillus conidia that will have fallen from the fly surface/wings (Fig. 2d). The fallen conidia prevent the flies from feeding and also continually expose the flies to Aspergillus and would lead to the death of a substantial proportion of flies within the initial 24-h period (~50%). 14. Toll-deficient flies infected with WT Aspergillus by rolling start dying ~48 h postinfection and develop ~75% mortality within 6–8 days postinfection (32). In contrast, OregonR WT flies start dying ~96 h post-ingestion and only develop ~10% mortality by day 8 postinfection (32). 15. The measurement unit “conidial equivalents” is used to quantify Aspergillus fungal burden and infers that only one nucleus is present per fungal cell, as in the conidial developmental program of growth of Aspergillus. To calculate tissue fungal burden as conidial equivalents, a standard curve is first prepared by homogenizing 20 uninfected flies in 1 mL of PBS containing 107, 106, 105, 104, 103, 102, or 101 conidia. After DNA extraction, PCR is run and the threshold cycle (CT) value corresponding to each conidial inoculum is obtained. Then, the samples from infected flies are processed, DNA is extracted, PCR is run, and the CT values from infected flies are obtained. Then, the PCR software will calculate the fungal burden as conidial equivalents based on the CT value of the sample and the CT values of the standard curve (41). 16. An optimal volume of diluted drug to add to the surface of fly food is 200 mL. If more is added, it will not be absorbed by the fly food and yeast granules; flies will get stuck in the food and die. Insufficient volume will not fully soak the added yeast granules and exposure to the drug will be suboptimal. 17. Antifungal drugs should be prepared as high-concentration stock solutions, e.g., 40 mg/mL. This allows testing of very high antifungal drug concentrations, or combination of drugs, in the fly food without having to exceed the optimal 200-mL volume.

466

M.S. Lionakis and D.P. Kontoyiannis

18. The dried yeast granules should not be dispensed all at once. Add a small amount initially, allow them soak up the drug, and then add some more. Continue until all of the yeast granules are soaked by the drug volume you have added. This process should take ~5 min. Ensure that you add only the amount of yeast granules necessary to saturate with the volume of the drug (Fig. 3a). Excessive yeast granules will expose the flies to yeast particles that are not soaked with the antifungal drug. This will lead to suboptimal exposure of the flies to the drug tested. On the other hand, insufficient yeast particles results in flies getting stuck in the food since the yeast granules will not be sufficient to soak the added volume of drug and the food surface will be sticky. 19. Yeast granules are essential for antifungal drug ingestion by the flies. If the antifungal drug is added directly to the fly food surface without yeast particles, two problems can occur. First, absorption of the drug will be erratic because flies will not eat as much of the drug-containing fly food, and second, the granules help absorb the liquid drug preventing the flies from sticking in the food and dying. Vials should be prepared in small batches and used within 5–10 days. This will prevent the yeast granules from drying out. 20. Starvation for 6–8 h encourages better ingestion of the antifungal containing food. However, flies should not be starved for longer periods as many flies will die, e.g., starvation for 24 h will result in the deaths of 50–75% of flies. 21. Typically, Toll-deficient Drosophila infected with Aspergillus and exposed to voriconazole have significantly better survival compared to untreated flies. At day 8 postinfection, survival of voriconazole-treated flies is ~50–60%, ~40–50%, and ~50–60% following injection, ingestion, and rolling infection, respectively (as compared to survival of <5%, ~20–25%, and ~10–20% in untreated flies). Finally, survival of flies treated with the combination of voriconazole and terbinafine at day 8 postinfection by rolling is ~80%, suggesting synergy between these two antifungal drugs, as survival of flies treated with either drug was much lower (32). References 1. Kontoyiannis DP, Marr KA, Park BJ et al (2010) Prospective surveillance for invasive fungal infections in hematopoietic stem cell transplant recipients, 2001–2006: overview of the Transplant-Associated Infection Surveillance Network (TRANSNET) Database. Clin Infect Dis 50:1091–1100.

2. Ben-Ami R, Lewis RE and Kontoyiannis DP (2009) Invasive mould infections in the setting of hematopoietic cell transplantation: current trends and new challenges. Curr Opin Infect Dis 22:376–384. 3. Kontoyiannis DP and Lewis RE (2003) Combination chemotherapy for invasive fungal

32

Drosophila melanogaster and Aspergillosis

infections: what laboratory and clinical studies tell us so far. Drug Resist Update 6:257–269. 4. Pfaller MA and Rinaldi MG (1993) Antifungal susceptibility testing. Current state of technology, limitations, and standardization. Infect Dis Clin North Am 2:435–444. 5. Lionakis MS, Lewis RE, Chamilos G and Kontoyiannis DP (2005) Aspergillus susceptibility testing in patients with cancer and invasive aspergillosis: difficulties in establishing correlation between in vitro susceptibility data and the outcome of initial amphotericin B therapy. Pharmacotherapy 25:1174–1180. 6. Lewis RE, Prince RA, Chi J and Kontoyiannis DP (2002) Itraconazole preexposure attenuates the efficacy of subsequent amphotericin B therapy in a murine model of acute invasive pulmonary aspergillosis. Antimicrob Agents Chemother 46:3208–3214. 7. Petraitis V, Petraitiene R, Lin P et al (2005) Efficacy and safety of generic amphotericin B in experimental pulmonary aspergillosis. Antimicrob Agents Chemother 49: 1642–1645. 8. van de Sande WW, Mathot RA, ten Kate MT et al (2009) Combination therapy of advanced invasive pulmonary aspergillosis in transiently neutropenic rats using human pharmacokinetic equivalent doses of voriconazole and anidulafungin. Antimicrob Agents Chemother 53:2005–2013. 9. Vallor AC, Kirkpatrick WR, Najvar LK et al (2008) Assessment of Aspergillus fumigatus burden in pulmonary tissue of guinea pigs by quantitative PCR, galactomannan enzyme immunoassay, and quantitative culture. Antimicrob Agents Chemother 52:2593–2598. 10. Nierman WC, Pain A, Anderson MJ et al (2005) Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438:1151–1156. 11. Schrettl M, Bignell E, Kragl C et al (2004) Siderophore biosynthesis but not reductive iron assimilation is essential for Aspergillus fumigatus virulence. J Exp Med 200: 1213–1219. 12. Schrettl M, Bignell E, Kragl C et al (2007) Distinct roles for intra- and extracellular siderophores during Aspergillus fumigatus infection. PLoS Pathog 3:1195–1207. 13. Tsai HF, Chang YC, Washburn RG, Wheeler MH and Kwon-Chung KJ (1998) The developmentally regulated alb1 gene of Aspergillus fumigatus: its role in modulation of conidial morphology and virulence. J Bacteriol 180: 3031–3038.

467

14. Spikes S, Xu R, Nguyen CK, Chamilos G et al (2008) Gliotoxin production in Aspergillus fumigatus contributes to host-specific differences in virulence. J Infect Dis 197:479–486. 15. Brown JS, Aufauvre-Brown A, Brown J, Jennings JM, Arst H Jr and Holden DW (2000) Signature-tagged and directed mutagenesis identify PABA synthetase as essential for Aspergillus fumigatus pathogenicity. Mol Microbiol 36:1371–1380. 16. Bhabhra R, Miley MD, Mylonakis E et al (2004) Disruption of the Aspergillus fumigatus gene encoding nucleolar protein CgrA impairs thermotolerant growth and reduces virulence. Infect Immun 72:4731–4740. 17. Panepinto JC, Oliver BG, Fortwendel JR, Smith DL, Askew DS and Rhodes JC (2003) Deletion of the Aspergillus fumigatus gene encoding the Ras-related protein RhbA reduces virulence in a model of Invasive pulmonary aspergillosis. Infect Immun 71:2819–2826. 18. Krappmann S, Bignell EM, Reichard U, Rogers T, Haynes K and Braus GH (2004) The Aspergillus fumigatus transcriptional activator CpcA contributes significantly to the virulence of this fungal pathogen. Mol Microbiol 52:785–799. 19. Lemaitre B, Nicolas E, Michaut L, Reichhart JM and Hoffmann JA (1996) The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86:973–983. 20. Lemaitre B, Reichhart JM and Hoffmann JA (1997) Drosophila host defense: differential expression of antimicrobial peptide genes after infection by various classes of microorganisms. Proc Natl Acad Sci USA 94:14614–14619. 21. Apidianakis Y, Rahme LG, Heitman J, Ausubel FM, Calderwood SB and Mylonakis E (2004) Challenge of Drosophila melanogaster with Cryptococcus neoformans and role of the innate immune response Eukaryot Cell 3:413–419. 22. Mylonakis E, Casadevall A and Ausubel FM (2007) Exploiting amoeboid and non-vertebrate animal model systems to study the virulence of human pathogenic fungi. PLoS Pathog 3:e101. 23. Alarco AM, Marcil A, Chen J, Suter B, Thomas D and Whiteway M (2004) Immune-deficient Drosophila melanogaster: a model for the innate immune response to human fungal pathogens. J Immunol 172:5622–5628. 24. Mylonakis E, Ausubel FM, Perfect JR, Heitman J and Calderwood SB (2002) Killing of Caenorhabditis elegans by Cryptococcus neoformans as a model of yeast pathogenesis. Proc Natl Acad Sci USA 99:15675–15680.

468

M.S. Lionakis and D.P. Kontoyiannis

25. Mylonakis E, Moreno R, El Khoury JB et al (2005) Galleria mellonella as a model system to study Cryptococcus neoformans pathogenesis. Infect Immun 73:3842–3850. 26. Steenbergen JN, Shuman HA and Casadevall A (2001) Cryptococcus neoformans interactions with amoebae suggest an explanation for its virulence and intracellular pathogenic strategy in macrophages. Proc Natl Acad Sci USA 98:15245–15250. 27. Steenbergen JN, Nosanchuk JD, Maliaris SD and Casadevall A (2003) Cryptococcus neoformans virulence is enhanced after growth in the genetically malleable host Dictyostelium discoideum. Infect Immun 71:4862–4872. 28. De Gregorio E, Spellman PT, Rubin GM and Lemaitre B (2001) Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc Natl Acad Sci USA 98:12590–12599. 29. Brennan CA and Anderson KV (2004) Drosophila: the genetics of innate immune recognition and response. Annu Rev Immunol 22:457–483. 30. Hoffmann JA and Reichhart JM (2002) Drosophila innate immunity: an evolutionary perspective. Nat Immunol 3:121–126. 31. De Gregorio E, Spellman PT, Tzou P, Rubin GM and Lemaitre B (2002) The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J 21: 2568–2579. 32. Lionakis MS, Lewis RE, May GS et al (2005) Toll-deficient Drosophila flies as a fast, highthroughput model for the study of antifungal drug efficacy against invasive aspergillosis and Aspergillus virulence. J Infect Dis 191: 1188–1195. 33. Ben-Ami R, Lamaris GA, Lewis RE and Kontoyiannis DP (2010) Interstrain variability in the virulence of Aspergillus fumigatus and Aspergillus terreus in a Toll-deficient Drosophila fly model of invasive aspergillosis. Med Mycol 48:310–317.

34. Chamilos G, Lewis RE, Hu J et al (2008) Drosophila melanogaster as a model host to dissect the immunopathogenesis of zygomycosis. Proc Natl Acad Sci USA. 105:9367–9372. 35. Pongas GN, Ben-Ami R, Lewis RE, Walsh TJ and Kontoyiannis DP (2009) Culture medium composition affects the lethality of Cunninghamella bertholletiae in a fly model of mucormycosis. Antimicrob Agents Chemother 53:4569. 36. Lamaris GA, Chamilos G, Lewis RE and Kontoyiannis DP (2007) Virulence studies of Scedosporium and Fusarium species in Drosophila melanogaster. J Infect Dis 196: 1860–1864. 37. Chamilos G, Lionakis MS, Lewis RE et al (2006) Drosophila melanogaster as a facile model for large-scale studies of virulence mechanisms and antifungal drug efficacy in Candida species. J Infect Dis 193:1014–1022. 38. Lionakis MS and Kontoyiannis DP (2005) Fruit flies as a minihost model for studying drug activity and virulence in Aspergillus. Med Mycol 43 Suppl 1:S111-114. 39. Chamilos G, Bignell EM, Schrettl M et al (2010) Exploring the concordance of Aspergillus fumigatus pathogenicity in mice and Tolldeficient flies. Med Mycol 48:506–510. 40. Ryder NS and Leitner I (2001) Synergistic interaction of terbinafine with triazoles or amphotericin B against Aspergillus species. Med Mycol 39:91–95. 41. Bowman JC, Abruzzo GK, Anderson JW et al (2001) Quantitative PCR assay to measure Aspergillus fumigatus burden in a murine model of disseminated aspergillosis: demonstration of efficacy of caspofungin acetate. Antimicrob Agents Chemother 45:3474–3481. 42. Kontoyiannis DP, Lionakis MS and Halder G (2004) Toll pathway in Drosophila melanogaster: A possible role to study the impact of immune senescence in poor responses against Aspergillus fumigatus. 14th Focus on Fungal Infections, New Orleans, LA, USA, Abstract # 31.

Chapter 33 Galleria mellonella as a Model for Fungal Pathogenicity Testing John Fallon, Judy Kelly, and Kevin Kavanagh Abstract Insects are convenient models for assessing the virulence of microbial pathogens or for assessing the efficacy of antimicrobial drugs and give results comparable to those that can be obtained using mammals. Galleria mellonella larvae are easy to purchase and inoculate and provide results within 48 h. Various parameters may be used to monitor the effect of a pathogen on the insect and, as a consequence, measure its relative virulence. Larval death, changes in immune cells (haemocytes) numbers, or the extent of proliferation of the pathogen within the insect haemocoel are good indicators of virulence and of the insect’s immune response. Analysing the humoral immune response also gives insight into the interaction of the pathogen with the insect. Changes in gene expression or the expression of key antimicrobial peptides provide data on this element of the insect’s response and, through extrapolation, how the mammalian immune system might respond. G. mellonella larvae, therefore, provide a quick and convenient means of measuring microbial virulence and are a useful alternative to the use of mammals for this type of screening. Key words: Aspergillus, Candida, Fungi, Galleria, Haemocytes, Microbial virulence, Mini-host

1. Introduction The insect immune system shares a number of structural and functional similarities with the mammalian innate immune system and, as a consequence, insects may be used in place of mammals for screening microbial pathogens or for assessing the potency of antimicrobial drugs (1). Larvae of the greater wax moth Galleria mellonella are inexpensive to purchase, easy to inoculate, and can give results within 48 h. We have employed G. mellonella larvae to assess the virulence of yeast (2) and Aspergillus fumigatus (3), with strong correlations between the virulence in larvae and mice of Candida albicans (4) and Cryptococcus (5) demonstrated. The use of insects as a screening model is now well established for many pathogens

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_33, © Springer Science+Business Media, LLC 2012

469

470

J. Fallon et al.

(4–6), with Galleria and other insects, such as Drosophila and Manduca, often referred to as “mini-hosts” (7, 8). Changes in G. mellonella larva viability can be used to measure the relative virulence of microbial pathogens and/or mutants. Monitoring the insect immune response to microbial pathogens can also be useful as this gives an insight into the virulence of “weak” pathogens and provides information on how the mammalian innate immune system may respond. Measuring changes in the haemocyte density and the fungal load gives information on the cellular immune response to the pathogen and the proliferation of the pathogen in the host, respectively (9). In addition, it is also possible to monitor the expression of genes for selected antimicrobial peptides as a means of assessing the humoral immune response of larvae (10). Analysing changes in the proteome of infected larvae can also be very useful for monitoring alterations in expression of low molecular weight antimicrobial peptides. We have used this latter technique to demonstrate that larvae mount a “proportionate” immune response when inoculated with pathogen-derived material (11). Insects are also a useful in vivo screening system for assessing the potency of antimicrobial agents (12–15). In this application, larvae can be infected with the cells or conidia of a pathogen and then given a pre-determined dose of the antimicrobial agent. An alternative is possible where the larvae are given the agent in advance of the pathogen. It should be emphasised, however, that administration of an antimicrobial agent to larvae induces a protective immune response and that any protective effect could be due to the combined effect of the antimicrobial agent and the insect’s enhanced immune response (15). Controls to account for the increased immune response of the insect must be included in order to see the actual effect of the drug in vivo. The use of insects as in vivo models to assess fungal virulence has grown in popularity in recent years (1, 7, 8). Although there are many advantages to the use of insects, G. mellonella larvae in particular, it must be emphasised that the insect immune system is only analogous to the mammalian innate immune system, and therefore, insect models give no insight into the role of the adaptive immune system in combating infections in mammals. In addition, larvae lack many of the organs attacked specifically by fungal pathogens, e.g. brain, lungs, kidneys, and spleen, so they cannot be used to model organ-specific pathologies. However, G. mellonella does provide a convenient initial screening system for studying pathogens that cause systemic infection, although as with all minihosts, validation of results may require further confirmatory mammalian testing. This chapter describes a range of methods for use with G. mellonella larvae for evaluating the virulence of fungal pathogens or

33 Galleria mellonella Fungal Model

471

for assessing the efficacy of antimicrobial agents. It details techniques for measuring the effect of the pathogen or drug on the insect immune response and describes methods for quantifying the response of the larvae to the different agents.

2. Materials 2.1. Inoculation of Galleria mellonella Larvae with Candida albicans

1. Sixth instar Galleria mellonella larvae (Lepidoptera: pyralidae, greater wax moth) (Mealworm Company) (see Note 1). 2. Myjector syringe (Terumo Europe). 3. YEPD (2% (w/v) glucose (Sigma-Aldrich), 2% (w/v) bacto peptone (Difco), 1% (w/v) yeast extract (Oxoid)). 4. Stationary phase culture of Candida albicans (1–2 × 109 cells/ mL) grown in YEPD at 30°C and 200 rpm. 5. Phosphate buffered saline (PBS). 6. Petri dishes (9 cm). 7. Filter paper circles (9 cm).

2.2. Determination of Haemocyte Density of Galleria mellonella

1. Infected and control G. mellonella larvae. 2. Sterile needles (23 G, Terumo). 3. Sterile tubes (1.5 mL). 4. 1-Phenyl-3-(2-thiazolyl)-2-thiourea. 5. Ice-cold PBS containing 0.37% (v/v) 2-mercaptoethanol. 6. Haemocytometer. 7. Microscope.

2.3. Determination of Candida albicans Fungal Load in Infected Galleria mellonella Larvae

1. Sixth instar G. mellonella larvae. 2. Stationary phase culture of C. albicans. 3. Sterile (pre-autoclaved) pestle and mortar. 4. PBS. 5. YEPD-erythromycin agar plates: 2% (w/v) glucose, 2% (w/v) bacteriological peptone, 1% (w/v) yeast extract, and 2% (w/v) agar and 1 mg/mL erythromycin (Sigma-Aldrich).

2.4. Assessment of Caspofungin In Vivo Activity Against Candida albicans

1. C. albicans-infected G. mellonella larvae. 2. Caspofungin (Cancidas™, Merck & Co.). 3. PBS. 4. Petri dishes (9 cm). 5. Filter paper circles (9 cm).

472

J. Fallon et al.

2.5. Extraction of Galleria mellonella RNA and Antimicrobial Gene Expression Analysis

1. Sixth instar G. mellonella larvae. 2. Sterile (RNase-free) pestles and mortars. 3. Liquid nitrogen. 4. Sterile tubes (1.5 mL). 5. TRI® Reagent (Sigma-Aldrich). 6. Vortex mixer. 7. Chloroform. 8. Isopropanol. 9. 75% (v/v) ethanol. 10. DEPC-treated water. 11. Deoxyribonuclease I (AMP-D1) kit (Sigma-Aldrich). 12. RNase-free agarose. 13. 10× FA buffer (200 mM 3-(N-morpholino)propanesulfonic acid (MOPS), 50 mM sodium acetate, 10 mM EDTA, pH 7). 14. 37% (v/v) formaldehyde. 15. 0.5% (w/v) SDS. 16. 10 mg/mL ethidium bromide. 17. Agarose gel electrophoresis equipment. 18. 5× RNA gel loading dye (for 10 mL: 80 μL 0.5 M EDTA, pH 8, 720 μL 37% (v/v) formaldehyde, 2 mL glycerol, 3.084 mL formamide, 4 mL 10× FA buffer, and 16 μL saturated aqueous bromophenol blue solution). 19. 1× TAE buffer (1/50 dilution of 50× stock: 24.2% (w/v) Trisbase, 5.71% (v/v) acetic acid, 0.05 M EDTA (pH 8)). 20. Nanodrop 1000 spectrophotometer. 21. Superscript III First-Strand Synthesis System (Invitrogen). 22. DMSO (molecular grade). 23. 10 mM dNTP mix (Promega). 24. Water (molecular grade). 25. Accutaq™ LA DNA polymerase. 26. 10 μM forward and reverse primers (Table 1, (10)). 27. Thermal cycler. 28. Blue/orange 6× loading dye (Promega).

2.6. Analysis of Proteomic Changes in Infected Larvae by 2D Gel Electrophoresis and LC/MS

1. Pre-chilled (−20°C) 1.5-mL tubes. 2. Sterile deionised water. 3. Bradford reagent. 4. IEF Buffer (8 M urea, 2 M thiourea, 4% (v/v) CHAPS, 1% Triton-X 100, 65 mM DTT, 10 mM tris base).

33 Galleria mellonella Fungal Model

473

Table 1 PCR primers and conditions for analysis of antimicrobial gene expression Gene

Primer

Sequence 5¢-3¢

Actin

ACT1F

GGGACGATATGGAG AAGATCTG CACGCTCTGTGAG GATCTTC

ACT1R Transferrin

TRANSF

CCCGAAGATGAA CGATCAC CGAAAGGCCTAG AACGTTTG

TRANSR

IMPI

IMPIF IMPIR

Galiomicin

GALIOF GALIOR

Gallerimycin

Product size (bp)

GALLERF GALLERR

PCR conditions 1 cycle: 98°C, 2 min

400

535

35 cycles: 94°C, 1 min; 55°C, 1 min; 72°C, 1.5 min

ATTTGTAACGGT GGACACGA CGCAAATTGGT ATGCATGG

409

1 cycle: 72°C, 10 min

CCTCTGATTGCA ATGCTGAGTG GCTGCCAAGTTA GTCAACAGG

359

Final hold: 4°C

GAAGATCGCTT TCATAGTCGC TACTCCTGCAGT TAGCAATGC

175

Primer sequences are taken from (10)

5. IPG Buffer (ampholytes) pH 3–10 (GE Healthcare). 6. Bromophenol blue powder. 7. Iso-electric focusing (IEF) machine (Ettan IPGphor II, Amersham Biosciences). 8. IEF coffins (Amersham Biosciences). 9. IEF strips (GE Healthcare). 10. PlusOne strip cover fluid (GE Healthcare). 11. Test tubes (at least 13 cm long). 12. Dithiothreitol (DTT). 13. Iodoacetamide (IAA). 14. Equilibration buffer (30% glycerol, 2% SDS, 6 M urea, 50 mM tris base). 15. 1.5 M Tris–HCl, pH 8.8. 16. 10% SDS, filter-sterilised and stored at room temperature to prevent crystallisation.

474

J. Fallon et al.

17. 30% acrylamide. 18. 10% ammonium persulphate. 19. N,N,N,N ¢-Tetramethyl-ethylene diamine (TEMED). 20. SDS-PAGE standards (Bio-Rad). 21. 1× Running buffer (1 in 10 dilution of 10× stock: 30 g Trizma base, 144 g glycine, 10 g SDS in 1 L distilled water). 22. Agarose. 23. Coomassie stain. 24. Siliconised 1.5-mL centrifuge tubes washed with 100% acetonitrile. 25. Sterile scalpels or pipette tips washed in 100% methanol (scalpels should be used to excise larger spots or bands, with sterile pipette tips useful for excising smaller gel pieces). 26. Destaining buffer (100 mM (NH4HCO3): acetonitrile; 1:1).

ammonium

bicarbonate

27. 100% acetonitrile. 28. Trypsin digestion buffer (13 ng/μL sequencing grade trypsin (Promega) in 10 mM NH4HCO3, 10% (v/v) acetonitrile). 29. Extraction buffer (1:2 (v/v) 5% formic acid: 100% acetonitrile). 30. 0.1% formic acid made using LC/MS-grade water. 31. 0.22-μm cellulose filter tubes. 32. Liquid chromatography-mass spectrometry (LC-MS). 2.7. Extraction and Analysis of Peptides from Galleria mellonella Larvae

1. Peptide extraction buffer (HPLC grade methanol:glacial acetic acid: HPLC grade water, 9:0.1:0.9); chilled on ice prior to use. 2. Freeze drier for lyophilisation. 3. 0.1% (v/v) trifluoroacetic acid (TFA) made in HPLC-grade water. 4. n-Hexane. 5. Ethyl acetate. 6. Bradford reagent (Biorad). 7. 1.5-mL tubes.

3. Methods 3.1. Inoculation of Galleria mellonella Larvae with Candida albicans

1. Place ten healthy larvae on Whatman filter paper placed in sterile 9-cm Petri dishes. 2. Grow a C. albicans culture to stationary phase (1–2 × 109/mL) in YEPD broth at 30°C, with shaking at 200 rpm. Harvest cells by centrifugation (2,056 × g for 5 min), wash in PBS and

33 Galleria mellonella Fungal Model

475

Fig. 1. Inoculation of Galleria mellonella larvae by injection through the proleg.

Fig. 2. Larval morphology. (a) Healthy Galleria mellonella larvae. (b) Larvae killed as a result of Aspergillus fumigatus infection 48 h previously. Note the dark colour of cadavers due to melanisation.

re-suspend in PBS at various cell densities, ranging from 5 × 105, 1 × 106, 2.5 × 106 to 5 × 106 per 20 μL (see Note 2). 3. Inoculate larvae by injecting 20 μL through the last left proleg into the haemocoel using a Myjector syringe (Fig. 1) and place at 30°C in the dark for up to 96 h (see Note 3). Untouched larvae and larvae injected with 20 μL of water or PBS should be included as controls. 4. Assess larvae at regular intervals (every 24 h) for viability and disease progression. For assessment of viability, larvae should be gently probed with a needle, and if no response is observed, the larvae may be considered to be dead. Changes in cuticle melanisation can also be used to monitor the severity of an infection (Fig. 2) (see Note 4).

476

J. Fallon et al.

Fig. 3. G. mellonella haemocytes. G. mellonella haemocytes were extracted and viewed by light microscopy (40× objective). Note variations in size and granularity.

3.2. Determination of Haemocyte Density of Galleria mellonella

1. Pierce the backs of the anterior end (“head”) of three randomly chosen larvae with a sterile needle and collect the yellow haemolymph (“blood”) into a single pre-chilled tube containing a few grains of 1-phenyl-3-(2-thiazolyl)-2-thiourea (see Notes 5 and 6). 2. Dilute haemolymph 1 in 10 in cold PBS containing 0.37% (v/v) 2-mercaptoethanol to reduce clotting and melanisation. Mix gently by pipetting. 3. Count haemocytes on a haemocytometer (Fig. 3) and calculate the original density in the larvae (see Note 7).

3.3. Determination of Fungal Load of Galleria mellonella Inoculated with Candida albicans

1. Inoculate ten G. mellonella larvae with C. albicans (5 × 105 cells/20 μL) and incubate for 24 h at 30°C. 2. Select three random larvae and place in a sterile pestle with 3 mL PBS and grind to a pulp with a mortar. 3. Dilute the resulting homogenate with PBS and plate 100-μL samples onto YEPD-erythromycin plates (see Notes 8 and 9). 4. Incubate plates at 30°C for 24 h and enumerate colony-forming units. 5. Calculate larval fungal load by multiplying the colony-forming units by the relevant dilution factor (see Note 10).

3.4. Assessment of In Vivo Activity of Caspofungin in C. albicans-Infected G. mellonella

1. Infect G. mellonella larvae with C. albicans as described above (see Note 11), including relevant control groups (see Note 12). 2. At 1 h post-infection, inoculate larvae with a 20-μL volume of caspofungin (e.g. 0.2, 0.1, or 0.05 μg/mL) or PBS (as control). Place at 30°C for up to 96 h.

33 Galleria mellonella Fungal Model

477

3. Assess larval viability at 24-h intervals. 4. As an alternative to assess the effectiveness of caspofungin, inject larvae with caspofungin 1 or 4 h prior to infection with C. albicans. 3.5. Extraction of Galleria mellonella RNA and Antimicrobial Gene Expression Analysis

For RNA extractions, RNase-free materials should be used and precautions taken to minimise RNase contamination (see Note 13). 1. Place three G. mellonella larvae in a mortar (see Note 14); cover with liquid nitrogen (about 5 mL). Grind with a pestle until the larvae resemble a fine powder. 2. Add 3 mL TRI® reagent and mix. Leave to rise slightly in temperature until liquid becomes less viscous. 3. Transfer liquid to 1.5-mL tubes (1 mL in each) and centrifuge at 12,000 × g for 10 min at 4°C. 4. Transfer the supernatant to a new tube. Do not pool supernatants. To each tube, add 200 μL chloroform and vortex for 15 s. Leave to stand at room temperature for 10 min. 5. Centrifuge tubes as before and transfer the upper layer to a new tube and add 500 μL isopropanol. Invert the tubes several times and allow to stand at room temperature for 10 min. 6. Centrifuge tubes as before. Discard the supernatant and wash the pellet in 100 μL 75% ethanol by vortexing. Centrifuge tubes as before and remove ethanol completely. Allow tubes to air dry by placing in a Laminar flow hood on ice. 7. Re-suspend the pellet in 80 μL DEPC-treated water. 8. Remove contaminating DNA using the deoxyribonuclease I (AMP-D1) kit in accordance with the manufacturer’s instructions to DNase treat samples. 9. Determine RNA concentration using the Nanodrop 1000 spectrophotometer. 10. Aliquot RNA and store at −80°C. 11. Prior to use, wash the gel rig and tank with 0.5% (w/v) SDS, rinse with DEPC-treated water followed by ethanol, and allow to air dry. 12. In order to visualise RNA, prepare 100 mL of 1% (w/v) agarose in 1× FA buffer. Heat the mixture until dissolved and allow to cool to hand-hot. Add 1.8 mL 37% (v/v) formaldehyde plus 1 μL of 10 mg/ml ethidium bromide prior to pouring the gel. 13. Prior to running, equilibrate the gel in 1× FA running buffer for at least 30 min. 14. Add 4 μL RNA to 4 μL 5× RNA gel loading dye; heat to 65°C for 5 min and chill on ice.

478

J. Fallon et al.

Fig. 4. Visualisation of antimicrobial gene expression. RNA extracted from infected larvae was used as the template for cDNA synthesis and subsequent PCR reactions to examine expression of antimicrobial peptide genes; (1) larvae injected with PBS, (2) larvae injected with 0.19 μg/mL caspofungin, (3) larvae injected with 0.095 μg/mL caspofungin, and (4) larvae injected with 0.048 μg/mL caspofungin.

15. Load the samples into the wells of the gel and run at 50 V in 1× FA buffer for approximately 40 min. Visualise bands using a UV transilluminator. 16. Synthesise cDNA using 1 μg RNA and the Superscript III First-Strand Synthesis System for RT-PCR kit according to manufacturer’s instructions. cDNA should be stored at −20°C. 17. Analyse expression of G. mellonella antimicrobial genes by qRT-PCR using primers and PCR cycle conditions outlined in Table 1. The Actin housekeeping gene can be used as a control. Each PCR reaction (20 μL volume) contains 1 μg/μL cDNA, 2 μL 10× LA Buffer, 0.4 μL DMSO, 1 μL 10 mM dNTP mix, 14.6 μL water, 0.4 μL 10 μM forward primer, 0.4 μL 10 μM reverse primer, and 0.2 μL AccuTaq™ LA DNA polymerase. Solutions were mixed by pipetting and placed immediately into the thermal cycler. 18. Mix 4 μL of PCR product with 4 μL blue/orange 6× loading dye. 19. Visualise PCR products by running samples on a 1% (w/v) agarose gel (1 g agarose in 100 mL 1× TAE) with the addition of 2 μL 10 mg/mL ethidium bromide. Run gel at 50 V for 30 min and view using a UV transilluminator (Fig. 4). 3.6. Analysis of Proteomic Changes in Infected Larvae by 2D Gel Electrophoresis and LC/MS

The gel fragment tryptic digestion part of the protocol is a modification of the method described by Schevchenko et al. (17). 1. Bleed ten fungal-infected G. mellonella larvae into a pre-chilled 1.5-mL tube (as in subheading 3.2) and centrifuge at 800 × g for 2 min at 4°C to pellet haemocytes. Transfer the cell-free supernatant to a fresh tube. 2. Make a 1 in 50 dilution of the crude cell-free haemolymph in deionised water and quantify protein content using Bradford method as per the manufacturer’s instructions. Calculate the protein concentration of the neat cell-free haemolymph.

33 Galleria mellonella Fungal Model

479

3. Add 350 μg protein to 100 μL IEF buffer and allow to solubilise for approximately 15 min at room temperature. 4. Add 2 μL ampholytes, pipette four to five times to mix, and allow to stand at room temperature for 15 min. 5. Add a further 150 μL IEF buffer and add a few grains of bromophenol blue to the solution and mix by pipetting. 6. Pipette 250 μL of the sample into an IEF coffin, tilt the IEF coffin to ensure an even distribution, and place a 13-cm IEF strip on top. Cover the strip with PlusOne DryStrip Cover Fluid. 7. Place the coffins into the IEF machine. Apply the following strip-focusing method per strip: 12 h at 50 V, 15 min at 250 V, increasing to 8,000 V with gradient increase over 5 h, and then hold at 8 h at 8,000 V. Once focusing is complete, strips may be stored at −70°C with the gel side of IEF strip facing upwards. 8. Aliquot 10 mL equilibration buffer into two separate test tubes. Dissolve 0.2 g DTT in the first equilibration tube and 0.4 g iodoacetamide in the second equilibration tube. Add a few grains of bromophenol blue to the second equilibration tube. 9. Transfer the IEF strip to the first equilibration solution, seal with paraffin film, and incubate horizontally on a rocking table for 15 min. 10. Transfer to the second equilibration solution and allow to equilibrate as in step 9. 11. Once equilibration is complete, rinse briefly with deionised water and place on top of the separating gel (see Note 15). Prepare a gel for 2D electrophoresis (see Note 16). 12. Place a piece of filter paper soaked in SDS-PAGE ladder at the corner of the gel and seal with a 1% agarose solution made with 1× SDS-PAGE running buffer. 13. Run gel at 80 V overnight and stain with Coomassie stain (Fig. 5). 14. Cut gel pieces from 2D gels (see Note 17) and transfer to individual siliconised tubes. 15. Wash stain from the gel piece using destaining buffer (200 μL) at room temperature and vortex occasionally. Repeat this step if required to remove all of the stain (see Note 18). 16. Remove all of the destaining buffer and resuspend the gel pieces in sufficient 100% acetonitrile to cover the gel piece (see Note 19). 17. Remove the acetonitrile. At this point, gel pieces can be stored at −20°C; alternatively proceed to step 20. 18. Add 60 μL trypsin digestion buffer to each tube containing gel pieces.

480

J. Fallon et al.

Fig. 5. G. mellonella larval haemolymph proteome. (a) A control larvae and proteome of larvae challenged with beta-glucan. (b) Note the increased expression of spots corresponding to specific proteins.

19. Place all tubes on ice for 30 min (see Note 20). 20. Add sufficient trypsin buffer to cover the gel pieces and keep on ice for approximately 60 min. Inspect all tubes to ensure that all the gel pieces remain covered. 21. Add 10 mM AmBic:10% vol/vol buffer to ensure that the gel plug is hydrated during enzymatic cleavage (see Note 21). 22. Incubate tubes at 37°C for 4–24 h to allow for tryptic digestion of protein (see Note 22). 23. Centrifuge the tryptic digests at 5,000 × g for 5 min and transfer the supernatant to a clean tube. 24. Add approximately 100 μL extraction buffer to the remaining gel piece pellet and incubate at 37°C for 15 min to extract peptides. 25. Centrifuge and transfer the supernatant to the tryptic digestion supernatant from step 23. 26. Vacuum dry the pooled supernatants to completion. 27. Store at −20°C until required for LC/MS analysis. 28. Prior to LC/MS analysis, resuspend the dried supernatants in 15 μL 0.1% formic acid and remove any debris by adding to a 0.22-μm cellulose acetate filter and centrifuging the tube at 20,000 × g for 3 min. 29. Transfer 10 μL of each sample to an LC/MS vial for analysis (see Note 23). 3.7. Extraction and Analysis of Peptides from G. mellonella Larvae

Peptide extraction is performed by the method of Cytrynska et al. (16) with slight modifications. 1. Bleed ten larvae into a pre-chilled 1.5-mL tube and centrifuge at 800 × g for 2 min at 4°C to pellet haemocytes. Transfer the cell-free supernatant to a fresh tube.

33 Galleria mellonella Fungal Model

481

2. Make a 1/10 dilution of cell free haemolymph in peptide extraction buffer and leave to stand on ice for 30 min to precipitate high-molecular-weight proteins. 3. Centrifuge at 20,000 × g for 30 min at 4°C. 4. Transfer supernatant to a fresh tube and lyophilise in a freeze drier until dry. 5. Resuspend lyophilised extract in 200 μL 0.1% TFA. 6. Add an equal volume of n-hexane and mix thoroughly to remove lipid. Centrifuge at 20,000 × g for 10 min. 7. Remove the upper lipid-containing fraction and add an equal volume of ethyl acetate to the lower water fraction. Centrifuge at 20,000 × g for 10 min. 8. Remove the lower aqueous layer to a clean 1.5-mL tube. 9. Quantify the protein content by Bradford assay as per the manufacturer’s instructions. 10. Equalise the protein concentration in a 100 μL volume to allow comparative analysis between different treatments. 11. Run samples on an HPLC using 220 nm as the reference wavelength for detection of peptide bonds. Where multiple wavelength analysis is possible, wavelengths of 254 and 280 nm should also be used for detection of disulphide bonds and aromatic residues, respectively. HPLC gradients should be as detailed in Table 2. 12. If possible, fractionate individual peaks according to the HPLC manufacturer’s guidelines (Fig. 6). 13. Lyophilise individual peaks overnight and store at −20°C until tryptic digestion and characterisation by MALDI-ToF or LC/ MS analysis (see Note 24).

Table 2 HPLC conditions Time (min)

Solvent

0–5

5% acetonitrile

Step and hold

5–40

5–100% acetonitrile

Gradient

40–42

100% acetonitrile

Step and hold

42–44

100–5% acetonitrile

Gradient

482

J. Fallon et al.

Fig. 6. Visualisation of G. mellonella antimicrobial peptides following HPLC fractionation.

4. Notes 1. G. mellonella larvae may be stored in wood shavings in the dark at 15°C prior to use. Larvae chosen for experiments should weigh between 0.2 and 0.4 g and used within 3–4 weeks of receipt. Larvae are discarded if they appeared dark in colour due to melanisation. 2. A range of doses is used to ascertain the lethal dose for different C. albicans strains. 3. The majority of larvae are dead after 96 h. 4. Larvae that melanise rapidly upon inoculation with a pathogen generally do not survive long, while those showing slow or little melanisation tend to survive. 5. Phenyl-3-(2-thiazolyl)-2-thiourea prevents melanisation of the haemolymph. 6. It should be possible to collect approximately 50–60 μL from each larva. Ensure all white flocular material is removed; this is the fat body and will impede counting. 7. Haemocyte density varies in response to different pathogens, and ascertaining the density can give an indication of the relative virulence of a pathogen (9).

33 Galleria mellonella Fungal Model

483

8. Addition of erythromycin to the YEPD plates prevents bacterial growth. 9. For larvae infected 24 h previously, we generally dilute homogenate 1/2,000 in PBS prior to plating. After 24 h at 30°C, there are typically 106 colonies per plate. 10. Virulent pathogens proliferate rapidly in the insect while weak or avirulent strains either grow slowly or are eliminated by the insect immune response (9). 11. We routinely use group sizes of 30, with three plates each containing ten larvae. 12. Antimicrobial drugs can provoke an immune response in larvae so suitable control groups must be included in order to assess the actual antimicrobial activity of the test agent (15). 13. To remove contaminating RNases, glassware should be baked at 220°C for 12 h prior to use. Diethyl pyrocarbonate (DEPC) is a strong inhibitor of RNases. It can be used at a concentration of 0.1% (v/v) to treat water, which should be left stirring overnight, followed by incubation at 37°C for a minimum of 4 h prior to sterilisation by autoclaving. DEPC-treated water should be used to prepare all buffers required for RNA extraction. All bottle lids, O-rings, and magnetic stirrers should be soaked overnight in DEPC water and autoclaved prior use. All chemicals should be weighed without the use of a spatula. Gloves must be worn at all times and changed regularly. Pipette tips and tubes should be taken from freshly opened bags and autoclaved twice prior to use. 14. Three larvae are required to obtain sufficient RNA for gene expression analysis. 15. Separating gels should be prepared at least 5 h in advance to allow better polymerisation of the separating matrix. 16. To pour a gel, begin by thoroughly washing the glass plates with warm soapy water, rinse with 70% ethanol, and dry with lint-free tissue paper to remove any residual contamination on the glass. The glass plates that we routinely use are 200 mm wide and 200 mm long on the front and are 223 mm long at the back, and the gels (12.5% acrylamide) poured are approximately 190 mm × 160 mm and 1.5 mm thick. To prepare sufficient gel solution, mix 60 mL 1.5 M Tris–HCl, 76 mL deionised water, 100 mL 30% (w/v) acrylamide, 2.4 mL 10% (w/v) SDS, 1.5 mL 10% (w/v) APS, and 60 μL TEMED. 17. Ensure pieces are no more than 2-mm thick to allow better destaining and trypsin absorption. 18. This usually takes 1 h but may take longer depending on the size of the gel piece. This process can be made faster if larger pieces are sliced using a clean scalpel.

484

J. Fallon et al.

19. Upon addition of the acetonitrile, the gel pieces should turn white and shrink. 20. The 30-min incubation on ice allows the trypsin digestion buffer to penetrate the gel slices and also prevents trypsin autodigestion. 21. The volume added is judged by eye, but it is recommended to have at least 0.5 mm above the gel pieces. 22. The incubation time is flexible, but the best results are usually achieved from an overnight (16 h) incubation. 23. LC/MS analysis will vary depending on the instrument used and the type of sensitivity required for analysis; therefore, it is not possible to write a specific protocol for this. 24. In our studies, we routinely use LC/MS for the characterisation of proteins. References 1. Kavanagh K. and Reeves E.P. (2004). Exploiting the potential of insects for in vivo pathogenicity testing of microbial pathogens. FEMS Microbiology Reviews. 28: 101–112. 2. Cotter G., Doyle S. and Kavanagh K. (2000). Development of an insect model for the in vivo pathogenicity testing of yeasts. FEMS Immunol. & Med. Microbiol. 27: 163–169. 3. Reeves E.P., Messina C.G.M., Doyle S. and Kavanagh K. (2004). Correlation of gliotoxin production and virulence of Aspergillus fumigatus in Galleria mellonella. Mycopathologia 158: 73–79 4. Brennan M., Thomas D.Y., Whiteway M.,, and Kavanagh K. (2002). Correlation between virulence of Candida albicans mutants in mice and Galleria mellonella larvae. FEMS Immunol. & Med. Microbiol 34: 153–157. 5. Mylonakis E., Moreno R., El Khoury J.B., Idnurm A., Heitman J., Calderwood S.B., Ausubel F.M. and Diener A. (2005). Galleria mellonella as a model system to study Cryptococcus neoformans pathogenesis. Infect. Immun. 73: 3842–3850. 6. Lionakis M.S., Lewis R.E., May G.S., Wiederhold N.P., Albert N.D., Halder G., and Kontoyiannis D.P. (2005). Toll-deficient Drosophila flies as a fast, high-throughput model for the study of antifungal drug efficacy against invasive aspergillosis and Aspergillus virulence. J Infect Dis. 191: 1188–95. 7. Fuchs B. and Mylonakis E. (2006). Using nonmammalian host to study fungal virulence and host defense. Curr. Opin Microbiol. 9: 346–351.

8. Mylonakis E. (2008). Galleria mellonella and the study of fungal pathogenesis: making the case for another genetically tractable model host. Mycopathol. 165: 1–3. 9. Bergin D., Brennan M.. and Kavanagh K. (2003). Fluctuations in haemocyte density and microbial load may be used as indicators of fungal pathogenicity in larvae of Galleria mellonella. Microb. Infect. 5: 1389–1395. 10. Bergin D., Murphy L., Keenan J., Clynes M. and Kavanagh K. (2006). Pre-exposure to yeast protects larvae of Galleria mellonella from a subsequent lethal infection by Candida albicans and is mediated by the increased expression of antimicrobial peptides. Microb. Infect. 8: 2105–2112. 11. Mowlds P., Coates C., Renwick J. and Kavanagh K. (2010). Dose-dependent cellular and humoral responses in Galleria mellonella larvae following β-glucan inoculation. Microb. Infect. 12: 146–153. 12. Tickoo S., and Russell S. (2002). Drosophila melanogaster as a model system for drug discovery and pathway screening. Curr Opin Pharmacol. 2: 555–60. 13. Hamamoto H., Kurokawa K., Kaito C., Kamura K., Manitra Razanajatovo I., Kusuhara H., Santa T., and Sekimizu K. (2004). Quantitative evaluation of the therapeutic effects of antibiotics using silkworms infected with human pathogenic microorganisms. Antimicrob. Agent. Chemother. 48: 774–779. 14. Hamamoto H., Tonioike A., Narushima K., Horie R., and Sekimizu K.(2009). Silkworm as a model animal to evaluate drug candidate

33 Galleria mellonella Fungal Model toxicity and metabolism. Comp. Biochem. Physiol. 149: 334–339 15. Rowan R., Moran C., McCann M., and Kavanagh K. (2009). Use of Galleria mellonella larvae to evaluate the in vivo anti-fungal activity of (Ag2(mal)(phen)3). Biometals 22: 461–7. 16. Cytrnska, M., Mak, P., Zdybicka-Barabas, A., Suder, P., and Jacubowicz T. (2007).

485

Purification and characterization of 8 peptides from Galleria mellonella immune haemolymph. Peptides 28:3: 533–546. 17. Shevchenko, A., Tomas, H., Havlis,J., Olsen, J.V., and Mann, M. (2006). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols 1: 2856–2860.

Chapter 34 Embryonated Chicken Eggs as Alternative Infection Model for Pathogenic Fungi Ilse D. Jacobsen, Katharina Große, and Bernhard Hube Abstract Embryonated eggs have been used as infection models for decades in virology and bacteriology. However, they can also be used as an attractive alternative infection model for studying fungal pathogenesis. Here, we discuss some general aspects which need to be considered when working with embryonated eggs as infection models. Furthermore, we provide detailed protocols and technical tips for infection of embryonated eggs with Aspergillus fumigatus and Candida albicans via the chorioallantois membrane, as well as sampling methods for downstream analyses. Key words: Embryonated eggs, Virulence, Alternative infection model, Aspergillus fumigatus, Candida albicans

1. Introduction Infection models are essential tools in investigating host-pathogen interaction, pathogenicity mechanisms, virulence attributes of pathogenic fungi, and therapy studies. Thus, in vivo models, mainly using laboratory rodents, such as mice, have been developed for many microbial pathogens. These models have been critical for understanding host-pathogen interactions as well as for developing better therapeutical approaches (1) and represent the current “gold standard” of in vivo virulence testing. However, ethical considerations and legal restrictions limit the use of mammals for infection studies. Further limitations arise from the requirement for specialized animal facilities and personal, as well as cost. Alternative in vivo infection models using lower animals have therefore been developed in recent years. Embryonated chicken eggs provide an alternative in vivo infection model which requires little specialized equipment, is easy to

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_34, © Springer Science+Business Media, LLC 2012

487

488

I.D. Jacobsen et al.

handle and is available at lower costs than murine models. This model has been successfully used in studying virulence determinants of viruses and bacteria (2, 3), as well as Candida albicans (4, 5), during recent decades. We have recently investigated the suitability of embryonated chicken eggs, infected on the chorioallantoic membrane (CAM), to determine the virulence potential of defined gene knockout mutants of Aspergillus fumigatus (6). We found the model to be highly reproducible with good correlation to results obtained from infection studies in mice. In addition to measuring virulence in survival experiments, the chicken embryo model allows quantification of fungal burden, histological assessment of invasiveness, and quantification of the host immune response on the transcriptional level (6). While murine models undoubtedly remain the “gold standard” for assessing strain virulence, the embryonated egg model can be useful as a screening tool to define the most interesting mutants for subsequent testing in mice. In this chapter, we describe the handling and preparation of embryonated eggs for infection, infection of the CAM, determination of embryonic viability, and collection of samples for downstream analyses. We have successfully used this method not only for A. fumigatus (6) but also for other pathogenic fungi, e.g. C. albicans (unpublished data) and Lichtheimia spp. (unpublished data) (see Note 1).

2. Materials 2.1. Preparation of Eggs for Infection

1. Fertilized chicken eggs (see Note 2). 2. Egg incubator set to 37.6°C and 60% relative humidity (see Note 3). Specialized egg incubators (e.g. from Grumbach, Germany) additionally allow automated turning of eggs. Ideally, the incubator should be placed in a room which can be darkened to allow easier evaluation of viability by candling. 3. A suitable tray for eggs. 4. A strong, focused light source (e.g. a torch) or specialized lamp for candling (see Note 4). 5. Skin or surface disinfectant (e.g. Braunol; Braun, Melsungen, Germany) and cotton swaps.

2.2. Preparation of the Fungal Inoculum (see Note 5)

1. Clonal strains of Candida albicans or Aspergillus fumigatus. 2. For C. albicans inocula: YPD (1% yeast extract, 1% peptone, 1% dextrose) agar plates and liquid YPD media, appropriate incubator (30°C, shaking at 200 rpm possible). 3. For A. fumigatus inocula: malt extract agar (Difco, Germany) slants, sterile PBS (pH 7.4) containing 0.1% Tween 20 and 40 μm cell strainers.

34

Embryonated Egg Model

489

4. Sterile PBS (pH 7.4). 5. Neubauer counting chamber (Fisher Scientific, Germany) or comparable device. 2.3. Infection of the CAM

1. Safety cabinet. 2. A circular drill (e.g. dentist drill). 3. A dentist hook. 4. A soft peleus ball (pipette controller). 5. Light source. 6. Sterile needles (25 G) and syringes (1 mL). 7. Paraffin sticks and open flame. 1. Several sets of sterile forceps and scissors (various sizes).

2.4. Collection of Samples

2. Bowl containing 70% ethanol.

2.4.1. Fungal Burdens

1. Sterile petri dishes. 2. Weighing balance. 3. Tissue homogenizer. 4. Tubes with PBS. 5. YPD agar plates.

2.4.2. Host Cytokine Response

1. Test tubes with RNAlater (Qiagen, Germany).

2.4.3. Histology

1. Sample pots with buffered formalin.

2. Optional: 8-mm biopsy punch.

2. Biopsy bags or pads (e.g. bio-wraps, Leica, Germany).

3. Methods 3.1. Legal and Ethical Considerations

In most countries, animal welfare laws and regulations apply only to birds at or after hatching. Consequently, no licence/permit is required to work with chicken embryos. However, special regulations may apply in some countries, such as an embryo age limit for permit-free experimentation or an obligation to inform the local animal welfare officer about planned experiments. It is essential to enquire about the necessary regulations from your organization or governmental animal welfare officer. Chicken eggs hatch on day 20/21 of incubation. Thus, all experiments must be terminated prior to this time. In general, termination on day 18 was found to give a sufficient observation time, whilst ensuring that incubation ended well before hatching.

490

I.D. Jacobsen et al.

When terminating an experiment, surviving embryos must be killed humanely prior to disposal of the eggs. An easy and humane way of killing the embryos is rapid hypothermia: eggs are placed on ice (>30 min) or frozen. For sampling, embryos should be anaesthetized or killed by placing on ice prior to opening the eggs. Embryos should be decapitated using sharp scissors prior to disposal or necropsy. 3.2. Experimental Design

The experimental design (number of eggs needed, age at the time of infection, and duration of the experiment) varies depending on the experimental goal and can have a major influence on results. The following considerations need to be taken into account when planning and performing infection of embryonated eggs: 1. Developmental stage at the time of infection (see Note 6). 2. Number of eggs required (see Note 7). 3. Controls (see Note 8).

3.3. Preincubation of Eggs and Candling

1. In the morning of day 0, place eggs into the incubator, the blunt pole of all eggs facing in the same direction. 2. From day 3 onwards, turn eggs lengthwise every 6 h (specialized incubators can be programmed to do this). 3. In the evening prior to infection, check incubated eggs for embryonic development and survival by candling: in a darkened room, place a strong light source onto one pole of the egg. The light shines through the shell and thus illuminates internal structures. In developing, viable eggs, the blood vessel pattern of the CAM is clearly visible. The embryo appears as dark shape (size increasing with age) within the interior of the egg and moves frequently. Embryo movement is triggered by warmth from the light source. Discard any non-developed or nonviable eggs. 4. Mark the natural air space with a pencil (see Note 9). 5. Individually number or otherwise mark each egg with a pencil to allow identification of different infection groups.

3.4. Preparation of the Infection Inoculum 3.4.1. Candida albicans

1. Three days prior to infection, subculture the fungal strains on YPD agar at 30°C. 2. Evening before infection, inoculate 20 mL liquid YPD with a single colony and incubate for 12–14 h at 30°C with shaking (approximately 200 rpm). 3. On the day of infection, harvest 10 mL culture by centrifugation (5 min, 3,000 × g, 4°C). Wash twice with ice cold PBS (pH 7.4). 4. Resuspend cells in cold PBS and enumerate cell concentration using a Neubauer counting chamber. Adjust to the desired

34

Embryonated Egg Model

491

infectious dose (100 μL per egg) with sterile PBS (pH 7.4) (see Note 10 and 11). 5. Maintain infection inocula on ice until all infections are performed. To confirm the infectious dose, perform serial dilutions and plate the appropriate dilution on YPD agar. Colonies are counted after incubation at 30°C for 26 to 48 h. 3.4.2. Aspergillus fumigatus

1. One week prior to infection, subculture the fungal strains on malt agar slants and incubate at room temperature. 2. Regularly check for growth and sporulation. 3. On the day of infection, harvest conidia in 3–5 mL sterile PBS (pH 7.4) containing 0.1% Tween 20 and filter through a 40-μm cell strainer. Repeat filtering if the conidial suspension contains mycelia. 4. Enumerate conidia/mL using a Neubauer counting chamber. Adjust to the desired dose (100 μL per egg) with sterile PBS (pH 7.4) and recount to confirm the correct concentration (see Note 10 and 11).

3.5. Infection of the CAM

1. Remove a group of 10–20 eggs from the incubator and place on a suitable tray (see Note 12). 2. Swab the blunt pole and upper longitudinal side of each egg with skin disinfectant and place the egg tray in a safety cabinet. 3. Carefully drill a hole in the middle of the blunt pole using a dentist drill or comparable device (see Note 13). The hole should penetrate the shell and shell membrane into the natural air space but must not disrupt the CAM. 4. Carefully drill a hole in the longitudinal side of the egg. The hole should only penetrate the shell and must leave the shell membrane and the CAM intact. 5. Repeat for all eggs of the group. 6. Use a disinfected dentist hook to carefully disrupt the shell membrane beneath the hole in the longitudinal side and at the blunt pole. 7. Darken the room and use candling to visualize removal of the natural air space (Fig. 1). Place the inlet of a soft peleus ball over the hole at the blunt end of the egg and gently aspirate air. Removal of the natural air space is seen as darkening of the air space. In parallel, air should flow into the second hole at the longitudinal site, causing lowering of the CAM and creation of an artificial air space. The artificial air space appears as a sharp, oval, lighter area under the shell. Withdraw only enough air to remove the natural air space. 8. After the artificial air space has been constructed in all eggs, lighten the room. Apply 100 μL of the infection inoculum

492

I.D. Jacobsen et al.

Fig. 1. Schematic drawing of an egg prepared for CAM infection. Note the artificial air space, which separates the shell membrane and the CAM, thus allowing application of the fungal inoculum.

through the hole at the longitudinal site directly onto the CAM using a sterile needle and syringe. The needle need only be inserted a few mm into the hole. Avoid deep insertion as the needle can penetrate the CAM. 9. Seal both holes by warming the paraffin stick and gently rubbing it over the perforation. 10. Place eggs back into the incubator. 11. Candle eggs once to twice daily to monitor embryonic survival (see Note 14). 12. At the end of the experiment, humanely kill surviving embryos by chilling on ice or freezing prior to autoclaving and disposal. 3.6. Collection of Samples

The downstream processing of samples from infected eggs (CAM or parts of the embryo) is performed in a similar manner as for other animal tissue samples. 1. Select living embryos by candling. 2. Place eggs on ice for 20 min to anaesthetize or humanely kill the embryos prior to manipulation. 3. For aseptic sampling, place the chilled egg into a bowl with 70% ethanol for 2–3 min to sterilize the surface. 4. Allow the surface to dry. 5. Open the egg shell using sterile scissors to cut the upper shell in half beginning from the hole at the blunt end of the egg. Insert the scissors deep enough to cut both the shell and the adjacent CAM. Remove the cut shell with CAM. 6. If no post-mortem examination of the embryo is required, decapitate the embryo using sharp scissors.

34

Embryonated Egg Model

493

7. For determination of fungal burden (C. albicans), remove the CAM from the shell using sterile forceps and place the sample into a sterile petri dish or other container for weighing. Subsequent homogenization, dilution, and plating to determine fungal burden is carried out as detailed for the mouse model of C. albicans infection. 8. For determination of the host cytokine response at the transcriptional level, locate alterations of the CAM (A. fumigatus: mycelium, destruction of blood vessels; C. albicans: plaque formation, thickening of the CAM) and remove small sections of the surrounding areas. 9. For sampling the CAM for histology, cut the shell, with the CAM areas of interest, into a suitable size (e.g. embedding paper size). Place biopsy bags moistened with formalin onto the shell fragment. Carefully detach the CAM on one edge from the shell membrane, grab CAM and paper with forceps and carefully pull away the shell. Fold biopsy bag over the CAM and place into buffered formalin. The biopsy bag prevents the CAM from rolling up during the fixation and paraffin embedding. 10. To take samples from the embryo, carefully remove the embryo from the surrounding membranes. If sterile samples are required, place the embryo into 70% ethanol for a few seconds and allow it to dry. Decapitate the embryo using sharp scissors. 11. Using sterile scissors and forceps, perform a post-mortem examination and remove organs required for analyses.

4. Notes 1. Embryonated eggs have been published as a suitable alternative infection model for A. fumigatus and C. albicans. We have also used this model successfully for Aspergillus terreus and Lichtheimia spp. (unpublished data); however, no significant mortality was observed with Candida glabrata (comparable to most murine models) and Cryptococcus neoformans, even at high infectious doses (108 cells/egg). When testing the suitability of this model for other fungal pathogens, it is essential to begin by determining the dose dependency of mortality. 2. Fertilized chicken eggs can be purchased either from companies specialized in laboratory animal breeding or vaccine production or, at a significantly lower price, from local commercial chicken breeders producing fertilized eggs for the poultry industry. In all cases, fertilized eggs should be kept cool (4–10°C) if transported for more than a few hours. Prior to

494

I.D. Jacobsen et al.

incubation, freshly laid fertilized eggs can be stored for up to 1 week at 4–8°C without significant loss of viability. 3. Specialized egg incubators (e.g. from Grumbach, Germany) additionally allow automated turning of eggs. Ideally, the incubator should be placed in a room which can be darkened to allow easier evaluation of viability by candling. 4. Specialized lamps are recommended for candling. Ideally, the light source should be framed by a flexible rubber ring to prevent light side scatter when the lamp is attached to the egg. Furthermore, a handle suitable for fixing the light source to a stand is convenient for egg air space marking and for candling during infection. 5. Clonal strains of Candida albicans or Aspergillus fumigatus should be stored at −70°C. Fresh infection inocula should always be prepared and used within a few hours. 6. The immune system matures continuously during embryogenesis: thus, immune maturation could have major influences on experimental outcome. Generally, embryos become more resistant to infection as the immune system develops. For C. albicans infections, we found infection on day 10 to be most suitable, as embryos at this age tolerate the manipulations well and are sufficiently sensitive to infection. In contrast, C. albicans infected embryos on day 12 display only limited mortality making it impossible to perform virulence comparisons in eggs of this age. For A. fumigatus, virulence comparisons can be performed by infection on day 10 or day 12. Although infection on day 12 leads to delayed killing, the mortality rate is high enough to allow for comparisons. Testing a strain in eggs of different ages may give some information on whether pathogen interaction with the immune system is involved in pathogenesis. 7. For survival experiments, 20 eggs per group gave reliable and reproducible results and were sufficient for statistical analysis using the log-rank test. Generally, for fungal burden or analysis of host response, inter-individual variation is similar to that found in mouse experiments. In addition, not all eggs will be fertile, and early embryonic deaths can also occur. Therefore, an additional 15–20% of eggs should be incubated to ensure that a sufficient number of viable embryos are available at the time of infection. Fertilization rates can vary depending on the season (lower in winter), and extreme temperatures during transport can influence early embryo survival. 8. To evaluate egg quality and the effects of egg manipulations on embryonic survival, a PBS mock-infected control group is strongly recommended in all experiments. Survival of this

34

Embryonated Egg Model

495

group (CAM infection on day 10) should be 80–100%. Younger embryos are more susceptible to manipulation, and thus, manipulation alone can lead to increased mortality. 9. Fix the candling lamp to an appropriate stand (light shining upwards) and place the egg with the longitudinal side against the light source. 10. The following infectious doses have been used for survival experiments: C. albicans, 107 cells/egg and A. fumigatus, 103 conidia/egg. These doses typically lead to 80–100% mortality for known virulent strains. To increase sensitivity for detection of attenuated A. fumigatus mutants, additional infections are performed with a lower dose (102 conidia/egg). 11. Sampling for downstream applications, such as fungal burdens, histology, and analysis of host responses, should be performed on live embryos. Therefore, lower infectious doses may be required in experiments involving sampling. We use the following infectious doses for sampling: C. albicans, 105 cells/egg and A. fumigatus, 102 conidia/egg. These doses typically lead to 30–50% mortality. Therefore, when calculating the required number of eggs for sampling, expected mortality rates must be taken into account. 12. Eggs should not be allowed to cool during the infection process as this can reduce viability. Limit the period when eggs are out of the incubator to 10–15 min. Inexperienced experimenters should begin with small groups of eggs, increasing the numbers as they become more experienced. With experience, approximately 100 eggs can be infected per hour (including all manipulations). 13. Handheld drills from hardware stores can be used, but the advantage of dentist drills is that they are very long lasting and are equipped with a food pedal for controlling drill speed. 14. With some experience, judging survival by candling is very rapid (>100 eggs in 10 min). However, within the first 12 h post-infection, evaluation can be more difficult as creation of the artificial air space can cause transient detachment of the CAM from the shell membrane, making visualization of blood vessels more difficult. Reattachment usually occurs within 24 h. Note that the artificial air space does not recede in all eggs – however, this does not influence embryo viability. Embryonic death is characterized by the absence of movement. The intricate blood vessel pattern disintegrates within the first few hours after death. Therefore, in eggs where the embryo died several hours ago, the blood vessel pattern is completely lost and the interior of the egg becomes a contracted, dark mass surrounded by large, bright areas.

496

I.D. Jacobsen et al.

References 1. Clemons, K. V., and D. A. Stevens (2005). The contribution of animal models of aspergillosis to understanding pathogenesis, therapy and virulence. Med Mycol 43 Suppl 1:S101110. 2. Adam, R., S. Mussa, D. Lindemann, T. A. Oelschlaeger, M. Deadman, D. J. Ferguson, R. Moxon, and H. Schroten (2002). The avian chorioallantoic membrane in ovo--a useful model for bacterial invasion assays. Int J Med Microbiol 292:267–275. 3. Townsend, M. K., N. J. Carr, J. G. Iyer, S. M. Horne, P. S. Gibbs, and B. M. Pruss (2008). Pleiotropic phenotypes of a Yersinia enterocolitica flhD mutant include reduced lethality in a chicken embryo model. BMC Microbiol 8:12.

4. Gow, N. A., Y. Knox, C. A. Munro, and W. D. Thompson (2003). Infection of chick chorioallantoic membrane (CAM) as a model for invasive hyphal growth and pathogenesis of Candida albicans. Med Mycol 41:331–338. 5. Härtl, A., H. G. Hillesheim, W. Kunkel, and E. J. Schrinner (1995). [The Candida infected hen’s egg. An alternative test system for systemic anticandida activity]. Arzneimittelforschung 45:926–928. 6. Jacobsen, I. D., K. Grosse, S. Slesiona, B. Hube, A. Berndt, and M. Brock (2010). Embryonated eggs as an alternative infection model to investigate Aspergillus fumigatus virulence. Infect Immun. 78(7):2995–3006.

Part VIII Mammalian Hosts as Infection Models

Chapter 35 Mouse Intravenous Challenge Models and Applications Donna M. MacCallum Abstract Murine intravenous (IV) challenge models have been widely used in medical mycology to study fungal virulence, host responses, and antifungal efficacy. This chapter describes the well-characterised Candida albicans IV challenge model, where fungal cells are administered directly into the mouse bloodstream to initiate a systemic infection. The preparation of tissue samples from infected mice to allow evaluation of disease progression and host responses is also described. Key words: Mouse, Intravenous, Infection, Virulence, Antifungal drugs, Immunity

1. Introduction Mouse intravenous (IV) challenge models have been a feature of medical mycology for over 50 years, with the virulence of many pathogenic fungi assessed in this way (1–10). Although the model bypasses the requirement for the fungus to escape the gut and cross endothelial barriers to enter the bloodstream, it reliably generates acute, disseminated infections involving deep organs. However, some species, e.g. Candida glabrata, are incapable of generating lethal infections in immunocompetent mice, and immunosuppression is required before a lethal infection can develop, even when “hypervirulent” fungal strains are created (11). The best characterised mouse fungal infection model is the Candida albicans IV challenge model (1, 2, 12, 13). This is a reliable, reproducible model and mimics severe human disseminated disease (13). Because this model is so well characterised, it has been extensively used to study C. albicans virulence (14, 15), host responses (16), and antifungal therapy efficacy (17).

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_35, © Springer Science+Business Media, LLC 2012

499

500

D.M. MacCallum

In this chapter, I describe the C. albicans murine IV challenge model, where a bolus of fungal cells is administered into the lateral tail vein of mice, and infection progression is monitored by weight change and fungal organ burdens. Issues surrounding the use of different C. albicans strains/isolates and mouse strains, as well as various downstream uses for mouse samples post-infection, are also discussed. Although this chapter concentrates on C. albicans, the principles are the same for IV infection of mice with other pathogenic fungi.

2. Materials 2.1. Candida albicans Growth and Preparation of Inocula

1. C. albicans clinical isolates or laboratory strains (see Note 1) 2. YPD: 1% (w/v) yeast extract, 2% (w/v) mycological peptone, and 2% (w/v) glucose. 3. Sabouraud agar plates: 1% (w/v) mycological peptone, 4% (w/v) glucose, and 2% (w/v) agar. 4. NGY medium: 0.1% (w/v) Neopeptone, 0.4% (w/v) glucose, and 0.1% (w/v) yeast extract (see Note 2). 5. Wire inoculation loop or disposable plastic inoculation loops. 6. Sterile physiological saline (see Note 3). 7. Neubauer haemocytometer.

2.2. Infection of Experimental Animals

1. Female BALB/c mice, 6–8 weeks old (specific pathogen-free) (Harlan) (see Notes 4–9). 2. Weighing balance. 3. Heat lamp or warm box (see Note 10). 4. Mouse restraining device (see Note 11). 5. 26-G or 27-G syringe needles (see Note 12). 6. 1-mL Leur-Lok syringes. 7. Tissues/cotton wool.

2.3. Assessing Experimental Infection

1. Blunt-ended microcentrifuge tubes (2 mL) containing 0.5 mL sterile physiological saline (optional: protease inhibitors added to saline) (weights recorded). 2. 70% Ethanol. 3. Sterile scissors and forceps. 4. CAT homogeniser (model: X1030D) and dispersal tool.

35

Murine IV Challenge Model

501

3. Methods 3.1. Experimental Planning

Prior to beginning any procedures involving animals, the investigator must ensure that they have the necessary permissions required (see Note 13). The investigator should also have an experimental plan which includes the following: 1. Calculation of the number of animals required per experimental group. This depends upon the level of variation observed between experimental animals (which can be affected by the skill and experience of the animal researcher), as well as the level of difference expected between control and experimental groups. Using our well-established C. albicans intravenous challenge model in female BALB/c mice, we rarely require more than 6 animals per group. 2. A plan of any procedures to be carried out post-infection, e.g. antifungal therapy schedules, including entry route and frequency of antifungal doses. 3. Samples required from infected animals and clearly defined experimental end points. Experimental end points can be predetermined sampling time points or may rely upon identification of severely ill animals. All researchers working with infected mice should be able to recognise signs of severe illness, which include hunched posture, ruffled coat, weight loss, immobility, and decreased body temperature. Mice are humanely terminated (cervical dislocation or terminal anaesthesia) when they show signs of severe illness.

3.2. Preparation of C. albicans Inocula

1. Retrieve C. albicans isolates/strains to be tested in mice from −80°C freezer stocks and grow on Sabouraud or YPD agar at 30°C. 2. Prepare a culture for inoculum preparation. Using an inoculation loop, touch the surface of a single colony on the agar plate, then aseptically inoculate a sterile glass test tube containing 5 mL NGY medium. Repeat for all C. albicans strains/ isolates to be tested. 3. Incubate the tubes in a rotating wheel at 30°C for 16–24 h. 4. Harvest the cultures by centrifugation and wash twice with sterile physiological saline or water. Resuspend the washed cells in sterile physiological saline and determine cell numbers per mL using a Neubauer haemocytometer. Dilute the cell suspension with sterile physiological saline to obtain the desired cell concentration (see Note 14). 5. To determine the actual inoculum level used to infect the mice, spot aliquots of 1:10 serial dilutions of the inoculum on Sabouraud agar plates and incubate the plates overnight at

502

D.M. MacCallum

35°C. Count the colony-forming units (CFU) for each dilution, and then calculate the CFU per mL for the neat inoculum. Calculate the actual inoculum as CFU/g mouse body weight as follows: multiply by the volume (in mL) injected and then divide by the mouse weight (in g). 6. Transport inocula to the animal facility in packaging which satisfies local rules regarding transport of biosafety level 2/hazard group 2 and/or genetically modified organisms. 3.3. Intravenous Infection of Mice

1. Randomly allocate female BALB/c mice into the groups required for the experiment at least one day prior to infection. Mark mice to allow identification and monitoring of individual animals, and record individual weights prior to infection. 2. Heat mice to allow clear visualisation of the lateral tail veins (Fig. 1) (see Note 15). 3. Mix inocula by inversion prior to loading into 1-mL syringes. Take great care to ensure that all air bubbles are removed from the syringe (see Note 16). 4. Place a mouse in the restraining device, with the animal standing and its tail in a normal position. Hold the tail firmly to

Fig. 1. Murine lateral tail veins. (a) Mouse lateral tail vein in a restrained mouse; the arrow indicates the lateral tail vein. (b) Schematic of the anatomy of the tail vein, indicating the positions of the two lateral tail veins.

35

Murine IV Challenge Model

503

prevent the mouse from moving, but do not hold the tail too tightly as this will restrict blood flow. Locate the lateral tail veins by turning the tail gently through 90° (Fig. 1); the lateral tail veins are obvious in albino mice. 5. Bend the mouse tail over one finger, and gently insert the syringe needle into a lateral tail vein. The tail vein is just under the surface of the tail and, in BALB/c and other albino mouse strains, the needle should remain visible even when within the vein. There should be no resistance as the needle enters the vein. 6. Gently depress the syringe plunger to dispense the correct volume. Again, there should be no resistance. Any resistance or evidence of whitening and/or swelling of the tails suggests that the needle is not in the correct position. A successful injection is indicated by the vein lightening as the inoculum is dispensed and then filling again with blood. 7. In the case of an unsuccessful injection, a second attempt should be made using either the other lateral tail vein or another spot closer to the base of the tail in the same vein. 8. Quickly stop any bleeding by holding a tissue or piece of cotton wool over the injection spot for a short time. Return mice to their cage. 9. Monitor mice for at least 5 min post-injection to look for any adverse reaction. 3.4. Evaluating Fungal Infection

After C. albicans infection is initiated by intravenous challenge, mice are either monitored to evaluate alterations in disease progression or may be treated with antifungal agents to evaluate efficacy of the agent against the fungus in vivo. Regardless of the downstream procedures performed, monitor mice for changes in health.

3.5. Daily Mouse Monitoring

1. Check mice at least once daily post-infection. Evaluate mouse condition and record individual mouse weights. Weight loss is a good indicator of disease progression, with 20% weight loss predictive of imminent death in BALB/c mice (12). Humanely terminate mice that lose 20% of their initial body weight by cervical dislocation or by terminal anaesthesia. Record death as having occurred on the following day.

3.6. Sampling and Evaluating Fungal Infection

1. At time of death, or at predetermined time points (animals terminated by cervical dislocation or terminal anaesthesia), spray carcasses with 70% ethanol and dissect the sampled organs with aseptic precautions. In most cases, the kidneys are sampled in this model as this is the organ where C. albicans infection progresses (1, 2, 12). Other organs and blood (cardiac puncture; see Chap. 29 “Cytokine Measurement using Cytometric Bead

504

D.M. MacCallum

Arrays (CBA)” by Castillo & MacCallum) are sampled as required by the experimental plan. Harvested organs can yield valuable information, such as fungal burden, cytokine/ chemokine profiles, histological changes, immune cell population analysis, and RNA for gene expression analyses. 2. To determine organ fungal burdens, weigh the organs and homogenise in 0.5 mL saline. Plate dilutions of the organ homogenate on Sabouraud agar and incubate overnight at 35°C. Count the colonies, and then calculate fungal colonyforming units (CFU) per mL homogenate. Express fungal burdens per gram of tissue by dividing the fungal CFU/mL by the weight of tissue per mL homogenate. 3. For cytokine analyses, homogenise mouse organs in saline with added protease inhibitors to prevent degradation of cytokines during storage (see Chap. 29). 4. For histology, preserve tissue pieces either in formalin (for paraffin wax embedding) or in OCT with subsequent flash-freezing in liquid nitrogen (for frozen sections). Cut 8-μm sections on a microtome (paraffin blocks) or with a cryostat (frozen blocks), and then stain as required to visualise fungi, organ structures, and/or immune infiltrates. 5. For RNA extraction and subsequent analysis of gene expression, flash-freeze pieces of tissue in liquid nitrogen or dispense droplets of organ homogenates into liquid nitrogen. Allow the liquid nitrogen to evaporate, and store frozen material at −80°C. 6. For other organ analyses, place dissected organs either in sterile containers or in sterile saline, and then return to the laboratory.

4. Notes 1. Candida albicans isolates and strains. In the mouse IV challenge model, C. albicans clinical isolates show variation in virulence (18, 19). Laboratory strains, used in the creation of genetically modified strains, can also have altered virulence, which may be due to chromosomal aneuploidies (20). Therefore, the behaviour of a chosen isolate/strain should be characterised in the mouse intravenous challenge model prior to use for further assays or analyses. 2. C. albicans growth medium. We routinely use NGY medium to prepare inocula for mouse infection as this medium gives reproducible cell numbers per mL when C. albicans is grown

35

Murine IV Challenge Model

505

under our standard conditions and there is little evidence of filamentous growth. Other growth media and/or conditions are used only if required to maintain yeast phase growth or if required experimentally. Researchers should endeavour to use a single growth medium for inoculum preparation as this allows comparison between experiments, but it is also important as C. albicans virulence is altered when the fungus is grown in different media (21). 3. Sterile saline. In our research, fungal cells for IV administration are suspended in sterile physiological saline intended for administration to human patients. The saline is supplied as a sterile solution and has the added advantage, from an immunological point of view, of being pyrogen-free. 4. Mouse strains. A number of different mouse strains have been used in C. albicans intravenous challenge models of infection. These include outbred and inbred mouse strains, with inbred mouse strains showing less biological variation between individual animals. However, different mouse strains vary considerably in their susceptibility to C. albicans intravenous infection, with some strains, such as A/J and DBA/2 (complement C5 deficient) mice, much more susceptible to C. albicans intravenous infection (22–24). The choice of mouse strain may be dictated when knockout mouse strains are to be used. The majority of knockout mouse strains have been created in a C57BL/6 background. This significantly affects the ease with which injections are performed. Albino (e.g. BALB/c and CD-1) mouse strains have no pigment in their tails, allowing tail veins to be more easily visualised. In contrast, black mice, such as C57BL/6, have pigmented tails which makes it much more difficult to distinguish the tail veins. For investigators with little experience of IV injections, it is recommended that initial experiments be performed in albino mice whenever possible. 5. Commercially purchased mice. Mice purchased from a commercial supplier should be allowed an adjustment period of 5–7 days prior to any experimentation being performed. 6. Specific pathogen-free mice. Use of specific pathogen-free mice is particularly important in immunology as mice infected with other pathogens may have altered immune responses. The ability to maintain mice as specific pathogen-free will depend upon the containment level of the animal facility and the housing conditions of the mice. 7. Male versus female mice. Although there has been some discussion as to whether there are differences in susceptibility to

506

D.M. MacCallum

infection between male and female mice (25, 26), there are advantages to using female mice. Male mice tend to fight, with biting leading to tail scars; this again makes IV injections more difficult. 8. Mouse age and infection susceptibility. In our experiments, we tend to use mice within a defined age group (6–8 weeks). This is of importance as older mice have been shown to be more susceptible to C. albicans IV challenge (27, 28). If mice of different ages must be used within an experiment, it is important to ensure that the different groups of mice are age matched. 9. Housing. Housing conditions for mice, including number of mice per cage and the cage area required per mouse, are dictated by local regulations. Mice infected with different C. albicans strains should not be maintained in the same cage. 10. Heat lamp versus warm box. Visualisation of mouse tail veins is considerably easier in mice which have previously been warmed either under a heat lamp or in a warm box. Using a heat lamp, mice only require heating for approximately 5 min prior to injection; however, a warm box can require heating periods of up to 30 min to obtain similar effects. Local rules may determine which method can be used. It is of utmost importance that mice being heated are never left unsupervised and should be removed from the heat source before they show signs of overheating (lying prostrate and/or gasping). 11. Mouse restraining devices. Mice handled in a confident, considerate manner do not require anaesthesia or sedation for tail vein injection. Indeed, anaesthesia can lead to increased stress and suffering for the experimental animal. The use of a good mouse restraining device is, however, essential for good IV injections. A number of different restraining devices can be made or purchased; these range from modified 50-mL centrifuge tubes to commercially produced plastic holders. Holders should allow the mouse to feel secure, while allowing the investigator to hold and manipulate the tail. 12. Syringe needles. Needles come in a variety of lengths; for IV injection, 10–13-mm needles are the most suitable. 13. Legal matters. Research involving experimental animals is differentially regulated in different parts of the world. In the USA, animal research is largely controlled at the institutional level by an Animal Care and Use Committee. However, in the European Union, a single EU directive covers animal research, although there remains considerable variation in legislation in different countries. For instance, in France and in the UK,

35

Murine IV Challenge Model

507

both institutional and project licences are required prior to any animal research being carried out. However, there is an additional requirement in the UK for any person carrying out regulated procedures on animals to hold a personal licence. 14. Fungal inoculum level. The inoculum level chosen for a specific experiment is determined by the C. albicans isolate/strain, the fungal growth conditions used, the mouse strain, and the infection level required. In all cases, pilot experiments are required to optimise the inoculum level for any given set of conditions. A new investigator should practice preparing inocula on several occasions prior to inocula preparation for mouse infection to ensure a good correlation between the desired inoculum level and the actual inoculum as determined by viable cell count. In our work, we aim to use inocula levels where control mice routinely survive for approximately 7 days, e.g. for C. albicans isolate SC5314 grown in NGY medium and used to infect female BALB/c mice (specific pathogen-free, 6–8 weeks old), an inoculum of approximately 3 × 104 CFU per g mouse body weight is required for survival times of 5–7 days (18). 15. Mouse tail anatomy. A mouse in a normal standing position has three visible blood vessels. One runs down the centre of the tail, with two more visible veins running down either side of the tail (approximately 90° from the centre line). These two lateral tail veins are the ones that should be used for IV infection with C. albicans. Often, one vein appears to be more visible than the other due to lighting conditions, but either vein can be used, as it has been demonstrated that this does not affect infection development (12). 16. Air bubbles in syringes. It is highly important that all air bubbles be removed from syringes prior to dispensing inocula into the bloodstream of mice. This is accomplished by flicking the syringe held in an upright position and then depressing the plunger until liquid erupts from the needle. Introduction of air into the mouse bloodstream leads to immediate signs of distress (immobility and rapid heartbeat); the mouse should be terminated immediately.

Acknowledgements Research in the laboratory of DMM is supported by grants from the Wellcome Trust (089930) and National Centre for the Replacement, Reduction and Refinement of Animals in Research (NC3Rs).

508

D.M. MacCallum

References 1. Louria, D. B. (1965) Pathogenesis of candidiasis. Antimicrob. Agents Chemother. 5, 417–426. 2. Louria, D. B., Brayton, R. G., and Finkel, G. (1963) Studies on the pathogenesis of experimental Candida albicans infections in mice. Sabouraudia. 2, 271–283. 3. Gilfillan, G. D., Sullivan, D. J., Haynes, K., Parkinson, T., Coleman, D. C., and Gow, N. A. (1998) Candida dubliniensis: Phylogeny and putative virulence factors. Microbiology. 144, 829–838. 4. Hanson, L. H., Clemons, K. V., Denning, D. W., and Stevens, D. A. (1995) Efficacy of oral saperconazole in systemic murine aspergillosis. J. Med. Vet. Mycol. 33, 311–317. 5. Schmidt, A. (2002) Animal models of aspergillosis - also useful for vaccination strategies? Mycoses. 45, 38–40. 6. Graybill, J. R., Bocanegra, R., Luther, M., Fothergill, A., and Rinaldi, M. J. (1997) Treatment of murine Candida krusei or Candida glabrata infection with L-743,872. Antimicrob. Agents Chemother. 41, 1937–1939. 7. Fromtling, R. A., Shadomy, H. J., and Jacobson, E. S. (1982) Decreased virulence in stable, acapsular mutants of Cryptococcus neoformans. Mycopathologia. 79, 23-29. 8. Sinski, J. T., and Soto, P. J.,Jr. (1966) Onset of coccidioidomycosis in mouse lung after intravenous injection. Mycopathol. Mycol. Appl. 30, 41–46. 9. Polak, A. (1984) Experimental infection of mice by Fonsecaea pedrosoi and Wangiella dermatitidis. Sabouraudia. 22, 167–169. 10. Smith, J. M. B., and Jones, R. H. (1973) Localization and fate of Absidia ramosa spores after intravenous inoculation of mice. J. Comp. Path. 83, 49–55. 11. MacCallum, D. M., Findon, H., Kenny, C. C., Butler, G., Haynes, K., and Odds, F. C. (2006) Different consequences of ACE2 and SWI5 gene disruptions for virulence of pathogenic and nonpathogenic yeasts. Infect. Immun. 74, 5244–5248. 12. MacCallum, D. M., and Odds, F. C. (2005) Temporal events in the intravenous challenge model for experimental Candida albicans infections in female mice. Mycoses. 48, 151-161. 13. Spellberg, B., Ibrahim, A. S., Edwards, J. E., Jr, and Filler, S. G. (2005) Mice with disseminated candidiasis die of progressive sepsis. J. Infect. Dis. 192, 336–343.

14. Navarro-Garcia, F., Sanchez, M., Nombela, C., and Pla, J. (2001) Virulence genes in the pathogenic yeast Candida albicans. FEMS Microbiol. Rev. 25, 245–268. 15. Odds, F. C., Gow, N. A. R., and Brown, A. J. P. (2006) Towards a molecular understanding of Candida albicans virulence, in Molecular principles of fungal pathogenesis (J. Heitman, S. G. Filler, J. E. Edwards Jr, and A. P. Mitchell, Eds.) ASM Press, Washington DC. 16. Tuite, A., Mullick, A., and Gros, P. (2004) Genetic analysis of innate immunity in resistance to Candida albicans. Genes Immun. 5, 576–587. 17. Graybill, J. R. (2000) The role of murine models in the development of antifungal therapy for systemic mycoses. Drug Resist Updat. 3, 364–383. 18. MacCallum, D. M., Castillo, L., Nather, K., Munro, C. A., Brown, A. J., Gow, N. A., and Odds, F. C. (2009) Property differences among the four major Candida albicans strain clades. Eukaryot. Cell. 8, 373–387. 19. Asmundsdottir, L. R., Erlendsdottir, H., Agnarsson, B. A., and Gottfredsson, M. (2009) The importance of strain variation in virulence of Candida dubliniensis and Candida albicans: results of a blinded histopathological study of invasive candidiasis. Clin. Microbiol. Infect. 15, 576–585. 20. Selmecki, A., Bergmann, S., and Berman, J. (2005) Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol. Microbiol. 55, 1553–1565. 21. Odds, F. C., Van Nuffel, L., and Gow, N. A. (2000) Survival in experimental Candida albicans infections depends on inoculum growth conditions as well as animal host. Microbiology. 146, 1881–1889. 22. Hector, R. F., Domer, J. E., and Carrow, E. W. (1982) Immune responses to Candida albicans in genetically distinct mice. Infect. Immun. 38, 1020–1028. 23. Marquis, G., Montplaisir, S., Pelletier, M., Mousseau, S., and Auger, P. (1986) Straindependent differences in susceptibility of mice to experimental candidosis. J. Infect. Dis. 154, 906–909. 24. Ashman, R. B., Fulurija, A., and Papadimitriou, J. M. (1996) Strain-dependent differences in host response to Candida albicans infection in mice are related to organ susceptibility and infectious load. Infect. Immun. 64, 1866–1869.

35 25. Ashman, R. B., Kay, P. H., Lynch, D. M., and Papadimitriou, J. M. (1991) Murine candidiasis: sex differences in the severity of tissue lesions are not associated with levels of serum C3 and C5. Immunol. Cell Biol. 69, 7–10. 26. Rogers, T., and Balish, E. (1976) Experimental Candida albicans infection in conventional mice and germfree rats. Infect. Immun. 14, 33–38.

Murine IV Challenge Model

509

27. Ashman, R. B., Papadimitriou, J. M., and Fulurija, A. (1999) Acute susceptibility of aged mice to infection with Candida albicans. J. Med. Microbiol. 48, 1095–1102. 28. Murciano, C., Villamon, E., Yanez, A., O’Connor, J. E., Gozalbo, D., and Gil, M. L. (2006) Impaired immune response to Candida albicans in aged mice. J. Med. Microbiol. 55, 1649–1656.

Chapter 36 A Nebulized Intra-tracheal Rat Model of Invasive Pulmonary Aspergillosis Guillaume Desoubeaux and Jacques Chandenier Abstract Animal models are particularly useful for the study of many infectious diseases, including those caused by fungi. Invasive pulmonary aspergillosis is most frequently studied in mouse models. We present here an animal model of this disease based on undernourished immunocompromised rats infected with Aspergillus fumigatus spores by intra-tracheal nebulisation. Key words: Aspergillosis, Animal model, Rat, Aerosolisation

1. Introduction Aspergillosis is an avian disease with major economic repercussions. Diverse models of this infection were initially developed in bird species: chickens, ducks, turkeys, guinea fowl, and quails. However, towards the end of the twentieth century, the increasing importance of invasive forms of this disease in human medicine (1) has led to increasing experimentation in mammals. Rabbits, guinea pigs, cows, and monkeys have all been studied, but the majority of research is based on rodent models, particular those involving mice (2–4). However, the small size of the mouse makes some protocols difficult, particularly those requiring the repeated sampling of biological material. In this context, rat models present a number of advantages. Rats are inexpensive, easy to manipulate, are large enough to allow for repeated blood sampling and also allow for in vivo imaging. The model presented here is based on previous rat model work (5, 6) but is a new one never used before or elsewhere to our

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_36, © Springer Science+Business Media, LLC 2012

511

512

G. Desoubeaux and J. Chandenier

knowledge. The animals are fed a low protein diet and are immunocompromised by cyclophosphamide treatment. Once experimental neutropenia has been established, Aspergillus fumigatus spores are administered by intra-tracheal nebulizer with a Microsprayer IA-1B®. Infection leads to the reproducible development of an experimental pulmonary disease within 3–6 days, with a global mortality of 80% after 10 days. The results of Aspergillus antigen determinations on blood samples correlate with anatomical and pathological data, consistent with published findings (7). Similarities between the clinical and biological aspects of the rat model and those encountered in the human disease confirm the value of this invasive pulmonary aspergillosis model (8).

2. Materials 2.1. Animal Rearing and Handling

1. Rats: male Sprague-Dawley rats (Harlan; see Note 1), aged 6–8 weeks, weight 200–225 g (see Note 2). 2. Protected environment housing; ventilated racks with controlled humidity and temperature (Iffa Credo) containing type 3 cages (50 cm × 25 cm × 20 cm) (Tecniplast; see Note 3). 3. Standard diet (Special Diets Services): 18% Crude protein, 6.6% ash, 3.7% crude fibre, crude 3.1% lipid, 1% calcium, 0.7% phosphorus, 0.39% methionine, 0.26% sodium, 0.18% magnesium, 20,000 IU/kg vitamin A, 2,000 IU/kg vitamin D3, 74 IU/kg vitamin E, 15 mg/kg copper. Standard diet should be stored in a granular form in 12.5 kg bags, in cool, dry conditions. 4. Precision balance (max = 1,000 g; d = 0.01 g). 5. Low protein diet (Safe): 20% maize starch, 9.2% casein, 55.2% sucrose, 5.4% maize oil, 5.5% cellulose, 1% vitamin mix, 1.3% mineral mix, 2.1% calcium phosphate, 0.1% dl-methionine, 0.2% calcium carbonate. The low protein diet should be stored as powder and/or granules, in vacuum packaging, in cool, dry conditions. Once opened, packs should be stored at 4°C, with any surplus disposed of at the end of the protocol. 6. Drinking water for immunocompromised animals: add 333 mg tetracycline hypochloride (Sigma-Aldrich) and 300 mg powdered paracetamol (Efferalgan, Bristol-Myers-Squibb) to 1 L sterile water (see Note 4). 7. Cyclophosphamide IV solution: reconstitute immediately before use by adding 25 mL sterile 0.9% NaCl to 500 mg Endoxan® (Baxter).

2.2. Preparation of A. fumigatus Spores

1. A. fumigatus strain (see Note 5). 2. Petri dish containing Sabouraud agar + chloramphenicol + gentamicin (Becton Dickinson).

36

Rat Aspergillosis Model

513

3. Sterile PBS (0.9% NaCl). 4. Disposable 1-mL plastic pipettes (Deltalab). 5. Sterile solution of 0.1% Triton X-100 (ICN Biomedicals) in PBS. 2.3. Infection of Animals

1. Isoflurane Aerrane® solution for inhalation (Baxter). 2. Anaesthesia apparatus; basic model with portable stainless steel frame and flow metre with vaporiser and distribution ramp, with an anaesthesia chamber induction cage system for rats and mice (250 × 150 × 170 mm), complete with a detachable valve (Équipement vétérinaire). 3. Invacare 5 Oxygen Concentrator 230® (VAC). 4. Rodent work stand (part no. 000A3467) (Hallowell EMC) (Fig. 1). 5. MDS paediatric otoscope (Hallowell EMC); use as a laryngoscope (see Note 6). 6. Nebulizer system: Microsprayer IA-1B® (Penn Century) (Fig. 2). The Microsprayer IA-1B® consists of an angled stainless steel tube that can be mounted on a 1-mL syringe, with an atomizer at the tip. Liquid is pushed through the system with the syringe, resulting in the formation of an aerosol of droplets (diameter of 25–30 μm).

Fig. 1. An anaesthetised rat on the work stand prior to infection.

514

G. Desoubeaux and J. Chandenier

Fig. 2. Aerosols produced by the MicroSprayer IA-1B® (reprinted with permission of PennCentury).

2.4. Post-mortem Analyses

1. 2.5% Thiopental sodium (Pentothal®; Abbott). 2. Platelia® Aspergillus galactomannan ELISA kit (Bio-Rad). 3. Acetic formalin (Labonord).

3. Methods 3.1. Animal Handling

1. Allow animals to rest in the animal facility for at least 7 days before the start of the experiment. 2. Place two animals in each cage (see Note 3). 3. Provide the standard diet and water ad libitum during the acclimatisation phase. 4. Weigh animals at the same time every day during the protocol. On days when the protocol does not require anaesthesia, conscious animals can be weighed (see Note 7). 5. Five days before infection with A. fumigatus (D-5), treat animals with cyclophosphamide (75 mg/kg) by intraperitoneal injection (see Note 8). 6. Transfer animals to the low protein diet (see Note 9) with the drinking water formulated for immunocompromised animals. 7. On D1, D3, and D7, treat animals with cyclophosphamide (60 mg/kg) by intraperitoneal injection. During daily weighing sessions, evaluate the clinical condition of the animal (see Subheading 3.4 and Note 10). 8. When deterioration of the clinical state suggests that death is imminent, kill the animal by intraperitoneal injection of 0.5 mL 2.5% Pentothal®.

36

Rat Aspergillosis Model

515

9. During animal dissection, collect blood by puncture of the abdominal aorta and sample the lungs and placed them in acetic formalin. Inspect organs to determine whether there is any macroscopic damage; store samples in acetic formalin for pathological analysis. 3.2. Preparation of A. fumigatus Inoculum (see Note 11)

1. Grow a culture of the A. fumigatus strain on Sabouraud agar + chloramphenicol + gentamicin at 37°C. 2. After 5 days of growth, flood the Petri dish with 15 mL sterile 0.1% Triton X-100 in PBS and collect the spores by careful aspiration from the plate surface using a disposable plastic pipette. 3. Wash the spores by centrifuging at 1,700 × g, discard the supernatant and resuspend in 50 mL sterile 0.1% Triton X-100 in PBS. Repeat, resuspending the pellet in 10 mL sterile PBS. Determine the spore concentration by haemocytometer count and adjust to 107 spores/mL in sterile PBS (see Note 12). 4. To check the viability and number of spores nebulised, plate a sample of the spore suspension onto a Petri dish containing Sabouraud agar + chloramphenicol + gentamicin. Place the dish in a steam room either at 30 or 37°C for 5 days. Fungal growth is evident after 48 h.

3.3. Infection of Animals

1. Place animals in the anaesthesia chamber. 2. Place animals under general anaesthesia by the inhalation of 5% isoflurane in oxygen. 3. As the animals lose consciousness shake the spore suspension and remove 150 μL with a 1-mL syringe. 4. Place an unconscious rat on the plateau of the rodent work stand. 5. Incline the plateau at 45°. 6. Intubate the animal. 7. Slide the stem of the Microsprayer IA-1B® between the vocal cords and nebulize 100 μ L of the suspension into the lungs, with the help of the laryngoscope/paediatric otoscope (Fig. 3). Carefully withdraw the Microsprayer IA-1B® and the laryngoscope. 8. Replace the animal in its cage, lying on its site, with the nostrils unobstructed (see Note 13).

3.4. Monitoring Disease Progression

Disease progression is evaluated each day based upon physical condition and natural/induced behaviours (see Note 14). 1. Visit rats at least once daily to assess their general condition and behaviour. Evaluate animals for altered responses to and changes in coat appearance. The litter should also be examined

516

G. Desoubeaux and J. Chandenier

Fig. 3. Intubation and infection using the MicroSprayer IA-1B® with the rat inclined at 45°.

to detect changes in the colour of the urine, potentially indicating the presence of biliary pigments, markers of liver damage. Bleeding in the eyes or from the nose, due to haematological problems resulting from cyclophosphamide treatment, may be observed (25% animals), but does not appear to be associated with infection. Rapid, sometimes noisy, breathing is indicative of pulmonary disease. 2. Weigh animals systematically each day of the experiment. A 20% reduction of their initial body weight is judged as a marker of profound and severe infection. 3. Sacrifice rats when the experimental end point is reached, following the recommendations in Subheading 3.1. The animal’s clinical condition is judged critical when there are severe alterations in behaviour, such as prostration and abolition of feeding, toileting or drinking, and also clinical evidence of severe disease, e.g. “cracking” pulmonary noise and excessive bleeding. 3.5. Sample Analysis

1. Serum galactomannan determinations on blood samples should be carried out by ELISA according to the Platelia kit manufacturer’s protocol (see Note 15). 2. Pathological analyses should be carried out by a specialist laboratory. Briefly, embed fixed organs in paraffin; cut 4-μm sections and stain with HES (haematoxylin–eosin–saffron) or Grocott silver stain.

36

Rat Aspergillosis Model

517

4. Notes 1. Since writing the initial paper on this work (8), we have changed animal supplier. No changes in the characteristics of this model were observed with the use of rats from a new supplier (Janvier) (unpublished results). 2. Weight limits at the time of delivery must be respected. As animals remain in their cages for 1 week prior to the experiments, very small differences at the outset can increase to unacceptable proportions within this period. The change in weight influences the dose of cyclophosphamide necessary for the immunosuppression protocol here used. The heavier the rats, the greater the delay in neutropenia and susceptibility to infection. 3. The classification of A. fumigatus as a level 2 pathogen by the European Classification of Microorganisms (EU Directive 2000/54/CE) makes it necessary to house animals in ventilated cages. Housing and handling of animals conforms to the European Convention for the Protection of Vertebrate Animals used for Experimentation and Other Scientific Purposes (ETS no. 123)—Article 5 (Guidelines for Accomodation and Care of Animals). 4. Tetracycline is added to the drinking water to prevent opportunistic bacterial infection. An analgesic (paracetamol) is added to the drinking water as recommended by the regional ethics committee for animal experimentation for Centre-Limousin, the local institutional review board which authorised this protocol. 5. An A. fumigatus strain of known pathogenicity in humans or animals, or listed as such in a reference collection, should be used for infection experiments. Our own strain was isolated from a hospitalised patient’s sample, in the Oncohematology Department of Tours Hospital. 6. The paediatric otoscope is easier to manipulate in rats compared to a laryngoscope. 7. Rats are fairly easy to handle under stress-free conditions. 8. Experienced animal handlers can carry out peritoneal injections without anaesthesia. 9. At the start of the protocol animals should be fed with the granulated low protein diet. The powdered form should be given when the animals find it difficult to grasp and chew granules. 10. Evaluation of the animal’s clinical state is difficult and requires experience. This element plays a key role in decisions concerning possible euthanasia of an animal, where a poor decision can lead to the loss of the animal, resulting in the loss of information.

518

G. Desoubeaux and J. Chandenier

11. All stages requiring manipulation of A. fumigatus spores should be carried out in a microbiological safety cabinet. 12. The remaining spore suspension may be stored at room temperature and used to prepare fresh fungal cultures for several months. 13. Animals recover from anaesthesia in 1–2 min, but should be carefully monitored during recovery. When there are doubts concerning recovery from anaesthesia, the animal should be held, a lung massage carried out and pure oxygen administered. 14. A few scoring tables exist, which attempt to prevent the animal feeling pain (9); however, at this point, experience is essential to evaluate the rats’ clinical status. 15. In our protocol, this galactomannan measurements are carried out on blood samples obtained post-mortem. Depending on rat size, blood samples can be taken at regular intervals. Since our first publication (8), the threshold for a positive result in the Platelia test for diagnosis of human disease has been reduced from an index of 1.5 to an index of 0.5 (10).

Acknowledgement We thank J. Montharu for constant and excellent technical assistance. References 1. Denning DW. (1998) Invasive aspergillosis. Clin Infect Dis 26: 781–803. 2. Polak A. (1998) Experimental models in antifungal chemotherapy. Mycoses 41: 1–30. 3. Latge JP. (1999) Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev 12: 310–350. 4. Clemons KV & Stevens DA. (2005) The contribution of animal models of aspergillosis to understanding pathogenesis, therapy and virulence. Med Mycol 43: S101–S110. 5. Schmitt HJ, Bernard EM, Hauser M, Amstrong D, Bakker-Woudenberg IAJM & Verbrugh HA. (1988) Aerosol amphotericin B is effective for prophylaxis and therapy in a rat model of pulmonary aspergillosis. Antimicrob Agents Chemother 32: 1676–1679. 6. Leenders ACAP, de Marie S & ten Kate MT. (1996) Liposomal amphotericin B (Ambisome) reduces dissemination of infection as compared with amphotericin B deoxycholate (Fungizone) in a rat model of pulmonar y aspergillosis. J Antimicrob Chemother 38: 215–225.

7. Becker MJ, de Marie S, Willemse D, Verbrugh HA & Bakker-Woudenberg IAJM. (2000) Quantitative galactomannan detection is superior to PCR in diagnosing and monitoring invasive pulmonary aspergillosis in an experimental rat model. J Clin Microbiol 38: 1434–1438. 8. Chandenier J, Bernard S, Montharu J, Bailly E, Fétissof F, de Monte M, Desoubeaux G, Diot P & Richard-Lenoble D. (2009) The utility of a nebulized intra-tracheal rat model of invasive pulmonary aspergillosis. Mycoses 52: 239–245. 9. Morton DB, Griffiths PH. Guidelines on the recognition of pain, distress and discomfort in experimental animals and an hypothesis for assessment. (1985) Vet Rec. 20: 431–6. 10. De Pauw B, Walsh TJ, Donnelly JP, et al (2008) Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin Infect Dis 46: 1813–1821.

Chapter 37 Invasive Models of Histoplasmosis A. George Smulian Abstract Histoplasmosis results from infection with the fungal organism Histoplasma capsulatum. Most Histoplasma research today uses models based on primary pulmonary infection. Following inhalation, conidia are rapidly ingested and intracellularly convert to the yeast form. After initial pulmonary infection, organisms are carried throughout the body giving rise to disseminated infection. Three murine infection models have been developed which mimic human disease. These comprise models of primary infection following initial exposure to the organism, secondary exposure to Histoplasma following spontaneous recovery from primary disease and a model of reactivated infection following spontaneous clearance of primary disease. This chapter describes these models and explores variability introduced with the use of mice of varied genetic backgrounds and different H. capsulatum strains. Key words: Histoplasma capsulatum, Animal models, Dimorphic, Intranasal infection

1. Introduction Histoplasmosis results from infection with the fungal organism Histoplasma capsulatum. Exposure to the organism occurs via the respiratory route following inhalation of infectious particles (1). Micro- or macroconidia, sexual spores, or hyphal fragments act as the infectious propagules giving rise to infection. Following inhalation, conidia are rapidly ingested and convert to the yeast form intracellularly. After initial pulmonary infection, organisms are carried throughout the body giving rise to disseminated infection. Most individuals spontaneously clear the infection and recover but live organisms can remain within the body and reactivate at a later stage. Most Histoplasma research today uses models based on primary pulmonary infection, although older studies utilized intraperitoneal and intravenous routes of infection (2–4). A model of central

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_37, © Springer Science+Business Media, LLC 2012

519

520

A.G. Smulian

nervous system (CNS) infection following intracranial inoculation of organisms has also been described (5). This chapter focuses primarily on infections initiated via the respiratory tract following intranasal inoculation of organisms. Three murine models of infection have been developed which mimic human disease; primary infection following initial exposure to the organism, secondary exposure to Histoplasma organisms following spontaneous recovery from primary disease and a model of reactivated infection following spontaneous clearance of primary disease (3, 6, 7).

2. Materials 1. H. capsulatum strain(s) (see Note 1). 2. Histoplasma macrophage (HM) medium: 10.6 g Hams F12powered tissue culture medium, 5.96 g HEPES, 1 g glutamic acid, 10 mL 100× cysteine solution (0.84 g cysteine, 50 mL 1 N HCl, adjust to 100 mL with water and filter sterilize), and 25 μM ferrous sulfate; adjust to 1,000 mL, pH to 7.5 and filter sterilize. 3. HMM plates: HM medium as above but adjust volume to 500 mL to give 2× HMM media and warm to 50–60°C. Prepare 500 mL agarose by adding 10 g SeaKem ME® agarose to water and autoclave for 20 min. Allow agarose to cool to 50–60°C, mix with 2× HMM and pour plates. 4. Phosphate-buffered saline (PBS). 5. Hemocytometer. 6. Sterile centrifuge tubes. 7. Anesthesia equipment. 8. Mice (see Note 2). 9. Rat anti-mouse-CD4, rat anti-mouse-CD8, and (optional) rat anti-mouse-Th1.2 antibodies (National Cell Culture Center).

3. Methods 3.1. Preparation of H. capsulatum Inoculum (see Note 3)

All manipulation of H. capsulatum should be performed in a biosafety cabinet using approved protocols (8). 1. Scrape H. capsulatum yeast phase organisms from a plate or slant of actively growing colonies. Inoculate cells into 1–2 mL HMM media, vortex briefly to generate a single cell suspension, and remove an aliquot for enumeration using a hemocytometer.

37

Animal Models of Histoplasmosis

521

2. Inoculate 5–50 mL HM medium in an Erlenmeyer flask or sterile culture tube with sufficient cells to obtain a concentration of 3 × 106 yeast/mL. Grow with shaking for 72 h at 37°C to reach mid-log phase. 3. Harvest the culture and centrifuge at 1,000 × g for 5 min to remove clumped organisms. Remove the hazy supernatant, containing suspended small clumps or single yeasts to a fresh tube. Determine the cell concentration by hemocytometer count. 4. Calculate the number of fungal cells and total volume required for the experimental inoculum (see Note 4). 5. Remove the required volume of cell suspension, transfer to a sterile centrifuge tube, centrifuged at 5,000 × g for 5 min to pellet the yeast cells, remove the supernatant, and resuspend the cell pellet in the desired volume of HM medium to produce the desired H. capsulatum inoculum. 6. To verify the inoculum viability and cell concentration, remove 5 μL from the prepared inoculum and prepare serial dilutions (1:10, 1:100, 1:1,000, and 1:10,000) with sterile PBS. Spread 5 mL of the 1:1,000 and 1:10,000 dilutions on HMM plates and incubate at 37°C for 7–10 days to verify the viability and concentration of the inoculum. For an inoculum of 8 × 104 cells/mL, the plates should contain 400 and 40 colonies, respectively, for the two dilutions. 3.2. Intranasal Inoculation of H. capsulatum

Administration of anesthesia should be performed under the guidelines developed by the Institutional Animal Care and Use Committee (or equivalent). 1. Place individual mice, or small groups of animals, in an induction chamber and deliver mixed anesthesia/gas from an anesthesia circuit containing an isoflurane vaporizer fed with oxygen or medical grade air (see Note 5). 2. Remove lightly anesthetized mice from the anesthesia chamber. 3. Administer 25 μL of the inoculum into the nostril of each mouse held in a supine position (see Note 6). 4. Mix the inoculum suspension between animals to ensure that all animals are equally infected. 5. Return mice to their cage and monitor their condition until they are fully awake.

3.3. Monitoring Infection

The typical time course of primary infection is shown in Fig. 1. Typical sampling time points include day 4 (early infection), days 7–10 (peak organism burdens), and days 14, 21, and 28 (monitoring spontaneous clearance in immunocompetent animals). 1. Euthanize mice using protocols and procedures approved by the American Veterinary Medical Association (AVMA) or other appropriate authorities.

522

A.G. Smulian

Fig. 1. Typical time course of primary Histoplasma capsulatum infection. C57BL/6 mice were infected by intranasal inoculation with 2 × 106 H. capsulatum yeast cells. Organism burden was enumerated by culture of lung (a) and spleen (b) tissue homogenates. Organism burden increased during the first week to reach peak levels by day 7. Between day 21 and 28, a cell-mediated immune response was mounted, the infection cleared and organism burden declined below 102 CFU, the detection level of the assay. Fungal burdens at day 28 in the lung, and spleen burdens on day 1 and day 28, were below the level of detection.

2. Aseptically remove lungs, spleen, and liver for enumeration of organism burden, histology, monitoring of host inflammatory response and/or isolation of RNA or DNA. Handling of tissues should be appropriate for intended use. 3. For enumeration of organism tissue burdens, weigh infected tissues and then place in an appropriate volume of sterile PBS and mechanically disrupt using a manual tissue homogenizer (e.g., Tenbroeck or Dounce homogenizer) or powered tissue disruptor (e.g., gentle MACS dissociator®). 4. Prepare serial dilutions of the tissue homogenates and plate on HMM plates. Incubate plates at 37°C for 5–14 days and then determine colony forming units (CFU) for each sample. Calculate organs burdens either per gram tissue or per organ. 3.4. Primary Histoplasma Infection

Infection outcome will vary depending upon the inoculum size and the mouse strain used. 1. Inoculate mice intranasally with 2 × 106 yeast cells as in Subheading 3.2 (see Note 7). 2. Allow infection to develop and then spontaneously recover (6) (see Note 8). Typically, a progressive infection develops, peaking at 7–10 days, with spontaneous clearance occurring at 3–4 weeks post-challenge (6).

3.5. Secondary Histoplasma Infection

1. Inoculate mice intranasally with 1 × 104 yeast cells as in Subheading 3.2. 2. Allow infection to develop and then spontaneously recover (6).

37

Animal Models of Histoplasmosis

523

3. After 6 weeks, rechallenged animals intranasally with 5 × 106 yeast cells. Typically, a progressive infection develops with spontaneous clearance occurring between 2 and 3 weeks post-challenge. 3.6. Reactivation Histoplasmosis

1. Inoculate mice intranasally with 2 × 106 yeast cells. 2. Allow infection development and spontaneous recovery (7). 3. Six weeks after primary infection, administer 100 μg rat anti-mouseCD4 and rat anti-mouse CD8 antibodies to each mouse by intraperitoneal injection. 4. Repeat antibody treatment weekly until the end of the experiment. Infection reactivation becomes evident 2–6 weeks after T-cell depletion (see Note 9).

4. Notes 1. A variety of H. capsulatum strains have been used in animal experiments, including widely used laboratory strains and individual clinical isolates (9, 10). The most widely used laboratory strains G217B and G186AR were derived many years ago from clinical isolates but have undergone repeated laboratory passage. Despite having lost mating competence with prolonged passage, these strains have maintained virulence in animal models. The full-genomic sequence is available for G217B and G186AR, in addition to the sequence of a more recently isolated clinical strain designated Nam1. The availability of genomic sequence data for these strains affords significant advantages in their use for experimentation compared to uncharacterized isolates and allows comparison and reproducibility of experiments between laboratory groups. In animal models, H. capsulatum G217B exhibits greater virulence compared to G186AR. 2. Considerable variability has been reported in the susceptibility of inbred mouse strains to experimental histoplasmosis (2, 3, 11, 12). SWR/J and A/J strain mice are reported to be most resistant to experimental histoplasmosis, while C57BL/6 and C57BL/10SN10 mice are the most susceptible with up to a 300-fold increase in lung fungal burdens 10 days after experimental exposure. DBA/2J mice demonstrate intermediate levels of infection. For routine experiments, C57BL/6 mice serve as a readily available host strain which yield robust infections. Although numerous knockout mouse strains, including T- and B-cell deficient, TNF-α deficient, and IFN-γ deficient strains, have been used to explore specific aspects of host immunity, specifics of the susceptibility traits are beyond the scope of this chapter (13–15).

524

A.G. Smulian

3. Although natural infection occurs via the inhalation of conidia, experimental models predominantly use yeast phase organisms to initiate infection. For the safety of the research personnel, growth of mycelia phase organisms to generate conidia, harvesting of conidia and animal inoculation must all be performed under BSL3 conditions. Therefore, unless clear justification in the experimental design exists to warrant the use of conidia to initiate infection, H. capsulatum yeast cells should always be used. 4. As an example, if ten mice are to be infected with 2 × 106 yeasts per animal in a volume of 25 μL, then allowing for 20% potential wastage, a total of 2.4 × 107 organisms should be pelleted and resuspended in 300 μL HM medium. 5. Anesthesia using 3–4% isoflurane will produce light anesthesia in mice within 30–60 s. 6. The inoculum droplet is inhaled into the lungs as the anesthetized animal breathes. 7. In this primary infection model, intranasal inoculation of 2 × 107 yeast cells per mouse results in a lethal infection, with death occurring between 7 and 21 days. 8. Based on past experience, organism burdens during acute infection reach a mean of ~108 CFU/lung with standard deviations of ±0.35 log10. Group sizes of six mice per group will have an 80% power to detect statistically significant mean differences between groups with α (two sided) = 0.05. 9. In animals where anti-Th1.2 antibodies (1 mg intraperitoneally per week) were administered in addition to anti-CD4 and anti-CD8 antibodies, there is more rapid reactivation, greater organism burden and animals can succumb to progressive infection. References 1. Kauffman CA. (2007) Histoplasmosis: a clinical and laboratory update. Clin Microbiol Rev. 20:115–32. 2. Chick EW and Roberts GD. (1974) The varying susceptibility of different genetic strains of laboratory mice to Histoplasma capsulatum. Mycopathol Mycol Appl. 52:251–3. 3. Deepe GS. (1993) Histoplasma capsulatum and V beta a mice: cellular immune responses and susceptibility patterns. J Med Vet Mycol. 31:181–8. 4. Nosanchuk JD and Gacser A. (2008) Histoplasma capsulatum at the host-pathogen interface. Microbes Infect. 10:973–7. 5. Haynes RR, Connolly PA, Durkin MM, et al. (2002) Antifungal therapy for central nervous

system histoplasmosis, using a newly developed intracranial model of infection. J Infect Dis. 185:1830–2. 6. Deepe GS Jr, and Gibbons RS. (2006) T cells require tumor necrosis factor-alpha to provide protective immunity in mice infected with Histoplasma capsulatum. J Infect Dis. 193:322–30. 7. Allen HL and Deepe GS Jr. (2006) B cells and CD4-CD8- T cells are key regulators of the severity of reactivation histoplasmosis. J Immunol. 177:1763–71. 8. U.S. Department of Health and Human Services Dept., Public Health Service, National Institutes Health, and Centers for Disease Control and Prevention. (2009) Biosafety in

37 Microbiological and Biomedical Laboratories. 5th edition U.DS. Government Priniting Office, Washington D.C. 9. Retallack DM and Woods JP. (1999) Molecular epidemiology, pathogenesis, and genetics of the dimorphic fungus Histoplasma capsulatum. Microbes Infect. 1:817–25. 10. Magrini V and Goldman WE. (2001) Molecular mycology: a genetic toolbox for Histoplasma capsulatum. Trends Microbiol. 9:541–6. 11. Patton RM, Riggs AR, Compton SB and Chick EW. (1976) Histoplasmosis in purebred mice: influence of genetic susceptibility and immune depression on treatment. Mycopathologia. 60:39–43.

Animal Models of Histoplasmosis

525

12. Mayfield JA and Rine J. (2007) The genetic basis of variation in susceptibility to infection with Histoplasma capsulatum in the mouse. Genes Immun. 8:468–74. 13. Deepe GS Jr, Romani L, Calich VL et al. (2000) Knockout mice as experimental models of virulence. Med Mycol. 38 Suppl 1:87–98. 14. Deepe GS Jr. (2007) Tumor necrosis factoralpha and host resistance to the pathogenic fungus, Histoplasma capsulatum. J Investig Dermatol Symp Proc. 12:34–7. 15. Allendoerfer R and Deepe GS Jr. (1997) Intrapulmonary response to Histoplasma capsulatum in gamma interferon knockout mice. Infect Immun. 65:2564–9.

Chapter 38 Murine Model of Concurrent Oral and Vaginal Candida albicans Colonisation Durdana Rahman, Mukesh Mistry, Selvam Thavaraj, Julian R. Naglik, and Stephen J. Challacombe Abstract Investigations into the complex interaction between the fungal pathogen Candida albicans and its human host require the use of animals as in vivo models. A major advance is the creation of a low-oestrogen murine model of concurrent oral and vaginal C. albicans colonisation that resembles human candidal carriage at both mucosal sites. Weekly intramuscular (5 μg) and subcutaneous (5 μg) oestrogen administration was determined as optimal, enhancing oral colonisation but essential for vaginal colonisation. Using a clinical C. albicans oral isolate, persistent colonisation for up to 6 weeks can be achieved at both sites in two strains of mice (BALB/c and C57BL/6). This concurrent model of mucosal colonisation reduces the numbers of experimental mice by half, and opens up new avenues of research in assessing potential mucosal vaccine candidates and in studying delicate host–pathogen interactions during the most natural state of C. albicans epithelial colonisation. Key words: Murine model, Concurrent, Oral, Vaginal, Candida albicans, Colonisation, Histology

1. Introduction Mucosal candidiasis is by far the most frequent of all Candida infections but our understanding of Candida–host interactions at human epithelial surfaces is elementary. Investigations into this complex interaction usually require the use of animals as an in vivo model of infection, since the environment can be controlled and manipulated to derive universally comparable data (1). Over the last decade, a number of clinically relevant models of systemic and mucosal candidiasis have been established. While systemic models rely on intravenous injection of Candida albicans, mucosal (oral) inoculation more closely mimics the predominant gastrointestinal

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_38, © Springer Science+Business Media, LLC 2012

527

528

D. Rahman et al.

portal of entry leading to systemic dissemination (2). However, establishment of mucosal infection models generally requires the use of immunosuppressive agents, antibiotic or oestrogen treatment, or the use of germ-free animals (1, 3–7). Murine vaginitis models are dependent upon prolonged pseudoestrus, usually induced with 17-β-oestrodiol, since rodents have a short 4-day oestrus cycle (8–11). In the absence of pseudoestrus, vaginal infections are short-lived and usually cleared by the second week. Oestrogen levels appear to be the main hormonal factor affecting host susceptibility, with an oestrogen range of 10–200 μg/ mouse/week establishing infection for up to 5 weeks; usually a relatively high dose of 100 μg/mouse/week is used (9). Susceptibility to vaginal candidiasis is independent of the major histocompatibility locus H-2 haplotype (10), with most mouse strains susceptible to oestrogen-induced C. albicans vaginitis (10, 12). One exception is the CD-1 mouse, which is innately less susceptible to candidal infection, probably due to its resistance to oestrodiol endocrine disruption (13). A number of oral infection models have also been described, with persistent infections requiring immunosuppression (1). In the absence of immunosuppression, the fungal burden is variable and is usually cleared by the second week (14) To establish oral candidiasis, mice are usually treated with steroids (15), often with the addition of tetracycline (5, 16). Initially, fungal burdens can be high, but after cessation of immunosuppressive drug administration fungal burdens diminish to very low levels, demonstrating the importance of immune competency in controlling fungal infections at mucosal surfaces. A highly desirable model is one that permits a relatively high level of C. albicans colonisation of oral and vaginal sites concurrently in the same mouse over a 4- to 6-week period. This would allow detailed investigations into the delicate host–fungus interactions that exist at epithelial surfaces and also the analysis of fungal pathogenicity, host immunity, and the efficacy of antifungal therapies at multi-sites. Here, we describe how to establish a concurrent model of oral and vaginal C. albicans colonisation to permit such investigations (17). The C. albicans strain, as well as the dose and route of oestrogen administration, is key to establishment of this model.

2. Materials 2.1. C. albicans and Culture Media

1. C. albicans strains: SC5314 laboratory strain (18) and a clinical isolate (529L) from a female patient with oral candidiasis attending the Oral Medicine Clinic at Guy’s Hospital, London, UK. 2. Heart Infusion Broth (HIB) (BDSciences)/10% glycerol (v/v).

38

Murine Model of Candida Colonisation

529

3. Sabouraud dextrose (SD) agar and liquid media (Oxoid Ltd). 4. Phosphate-buffered saline (PBS, pH 7.2). 5. 1% Trypan blue. 6. Haemocytometer (cell counting chamber). 7. Standard optical microscope. 2.2. Mouse Model

1. Female BALB/c, C57BL/6, or DBA/2 mice (see Note 1) (Harlan). 2. Oestradiol valerate (Sigma). 3. Sesame oil (Sigma). 4. Saline (0.91% w/v NaCl). 5. Cotton bud swabs.

2.3. Histological Analysis

1. Scalpels. 2. 10% (v/v) formol-saline. 3. 10% (v/v) EDTA (ethylenediaminetetraacetic acid). 4. Poly-L-lysine-coated slides. 5. Xylene. 6. 100% (v/v) Industrialised methylated spirit (IMS). 7. 1% (v/v) Periodic acid. 8. Schiff’s reagent. 9. Haematoxylin. 10. Light microscope.

3. Methods 3.1. Preparation of C. albicans Cells for Mouse Inoculation

1. Store stock cultures of C. albicans in 1 mL sterile HIB/10% glycerol in cryotubes at −20°C. 2. Remove a frozen cryotube vial and thaw at room temperature. 3. Resuspend C. albicans by pipetting and plate 100 μL on SD agar plates. Incubate plates overnight at 37°C. 4. Pick a colony using a sterile loop and transfer to 10 mL SD liquid medium in a 30-mL tube and grow overnight at 25°C in an orbital shaking incubator (25 rpm). 5. Wash cells three times in sterile PBS by centrifugation at 2,000 rpm (537 × g) for 10 min and resuspend the C. albicans cells in 10 mL PBS. 6. For oral and vaginal inoculation, prepare a C. albicans stock suspension of 108 cells/mL by counting cells in a haemocytometer (1:100 dilutions in 1% Trypan blue (see Note 2) under a microscope).

530

D. Rahman et al.

3.2. Establishment of Murine Model of Concurrent Oral and Vaginal Colonisation 3.2.1. Oestrogen Administration and Fungal Inoculation

All animals work must be performed under and comply with strict Institutional and/or government guidelines.

1. Dissolve oestradiol valerate in sesame oil to create a 1 mg/mL stock solution, vortex for 2 min, and place in an incubator at 37°C for 30 min with regular mixing every 10 min (see Note 3). 2. Beginning 1 week before experimentation, administer a dose of 5 μg (0.25 mg/kg) oestradiol valerate per mouse per week both subcutaneously (sc) (100 μL of 50 μg/mL oestradiol valerate) and intramuscularly (im, alternating weekly between right and left hind legs) (50 μL of 100 μg/mL oestradiol valerate). Inject control mice with sesame oil only (see Note 4). 3. After 1 week, anaesthetise mice with IsoFlo (100%w/w Inhalation Vapour, liquid Isoflurane (Abbott)) in a respiratory chamber with the flow rate of oxygen at 2 L/min. 4. Inoculate the oral cavity with 100 μL of C. albicans stock suspension in PBS using a pipette (i.e. 107 C. albicans cells per inoculation) and spread the inoculum with cotton buds and rub onto the teeth and gums. 5. For vaginal inoculations, insert 2.5 × 106 C. albicans cells into the vaginal cavity using a pipette (25 μL of the 108 cells/ml C. albicans stock preparation) (see Note 5).

3.2.2. Sample Collection and Determination of Fungal Burdens

1. Anaesthetise mice with IsoFlo (as Subheading 3.2.1) to keep the animals calm. 2. Determine oral fungal burdens by swabbing the mucosa (see Note 6). Moisten a cotton bud in saline, swab the buccal mucosa, right and left, and then place the cotton bud in 0.2 mL saline. 3. Centrifuge the cotton buds in saline for 2 min at 1,000 rpm (134 × g) and resuspend the pellet in 0.2 mL saline (see Note 7). Plate 100 μL of the thoroughly mixed suspension of cells on SD agar plates. Incubate at 37°C overnight and determine fungal burdens by counting the number of colony forming units (CFU) present (see Notes 8 and 9). 4. Determine vaginal burdens by vaginal wash. Wash the vagina twice with 50 μL PBS using a pipette, flushing four times for each collection, before plating the entire 100 μL on SD agar plates. Incubate at 37°C overnight and determine fungal burdens by counting the number of CFU present (see Notes 8 and 9). 5. Collect oral and vaginal swabs weekly for the duration of the experiment (usually 6 weeks) (see Note 10).

38 3.2.3. Histological Analysis of Mucosal Colonisation

Murine Model of Candida Colonisation

531

1. Euthanize mice by CO2 inhalation (schedule 1 method). 2. Remove the mouse heads at the base of the neck with a scalpel and then crudely dissect the whole area around the vulva and vagina with sharp scissors. 3. Place dissected vulvo-vaginal and decapitated mouse heads in 10% (v/v) formol-saline (see Note 11) for a minimum of 48 h at room temperature. 4. Decalcify mouse heads using EDTA by placing mouse heads in toto in a minimum of four times the volume of 10% (v/v) EDTA. Agitate the decalcifying tissue at room temperature and replace the decalcification solution every 3–4 days. Allow slow decalcification for up to 4 weeks at room temperature. The decalcification end point should be assessed by fluoroscopy (see Note 12). 5. Slice the whole of the vaginal tract and the oral cavity and oropharynx in the coronal (medio-lateral) plane. Slices should be 2–3 mm thick and the heads should extend from the lower incisors cranially to the tongue base caudally. Whole-mount sections are demonstrated in the inset in Fig. 1c, d. 6. Process the tissue slices and embed in paraffin wax using standard procedures. 7. Cut 5-μm tissue sections from the paraffin blocks. Carry out thorough sampling by ribboning out the paraffin block and mounting every tenth section on poly-L-lysine-coated slides (see Note 13). 8. Visualise C. albicans cells in sections by periodic acid–Schiff (PAS) staining. 9. Deparaffinise sections in xylene, dehydrate in 100% (v/v) IMS and rinse in running tap water. Rinse slides in distilled water, and then place in 1% (v/v) periodic acid for 10 min, followed by a rinse in tap water. 10. Place slides in Schiff’s reagent for 20 min, followed by a wash in running tap water for 5 min. 11. Counterstain nuclei by staining with haematoxylin for 20 s and washing in tap water (see Note 14). Dehydrate, clear and mount slides using routine procedures. 12. Examine all sections by light microscopy. Scan all mucosal sites; namely vulval, vaginal, cervical sites in vulvo-vaginal samples and dorsum of tongue, buccal mucosa, floor of mouth, palate, lingual alveolar mucosa, nasal, and pharyngeal mucosa of oral samples. Fungal cells at various mucosal sites are demonstrated in Fig. 1.

532

D. Rahman et al.

Fig. 1. Representative photomicrographs of histological sections from mice colonised with C. albicans 529L. (a and b) Coronal sections through the vagina of oestrogen-treated (a) and -untreated (b) animals at 3 weeks post-inoculation. (c–e) Histological sections through the oral cavity of oestrogen-treated animals at 2 weeks (c), 3 weeks (d), and 5 weeks (e) postinoculation. The inset demonstrates the whole-mount coronal section and the boxed area represents the intra-oral site of colonisation by C. albicans 529L (c, buccal mucosa; d, floor of mouth; e, Lingual alveolar mucosa). (f–h) Histological coronal sections through the vagina of oestrogen-treated animals at 2 weeks (f), 3 weeks (g), and 5 weeks (h) post-inoculation. To visualise C. albicans, sections were stained with PAS and counterstained with haematoxylin. Scale bars = 100 μm. Reprinted from ref. 17 with permission from Elsevier.

4. Notes 1. Mice should be 6–8 weeks of age, weighing 20–22 g, and should be maintained on a normal diet. 2. Trypan blue will stain dead C. albicans cells blue and these should not be counted. 3. It is important that the oestrogen valerate solution is prepared fresh just prior to use. Working solutions of oestrogen valerate (50 and 100 μg/mL) should be prepared by diluting stock solution (1 mg/mL) in sesame oil just prior to use. 4. It is vitally important to administer oestrodial valerate on a weekly basis throughout the experimental time course. Our model is based on low-dose oestrogen using 5 μg/mouse/week

38

Murine Model of Candida Colonisation

533

administered at two sites (sc and im). This oestrogen dose is significantly lower than other models, which usually utilise an oestrogen range of 50–200 μg/mouse/week. Other models also do not administer oestrogen at both sc and im sites. We found that the optimal dose to establish oral colonisation after 7 days was 5 μg of oestrogen per mouse and for vaginal colonisation it was 10 μg/mouse. At doses greater than 10 μg, the mice often developed mild-to-severe bacterial vaginitis. Further optimisation experiments revealed that sc oestrogen administration enhanced vaginal colonisation and im administration enhanced oral colonisation (unknown mechanism) and that a combined weekly oestrogen dose of 5 μg sc and 5 μg im/mouse was more efficacious than either route alone to establish maximal colonisation at both mucosal sites (17). Using these low levels of oestrogen, no adverse effects, such as swelling or redness, were observed vaginally or orally. Higher oestrogen doses will have secondary effects and may affect immune-based effector responses, thereby increasing the severity of fungal infection. The idea behind the model is that such immune-based effects are eliminated, thereby permitting the assessment of potential mucosal vaccine candidates and in studying delicate host–pathogen interactions during the most natural state of C. albicans mucosal colonisation. 5. Mice are only inoculated once with C. albicans. Depending on the purpose of the study and the size of the experiment, different strains of mice can be inoculated with different strains of C. albicans. Since oral and vaginal colonisation can be established concurrently in the same mouse, this immediately reduces mouse numbers for experimentation by half, which is a major advantage over other available models. 6. We found that oral swabbing (rather than oral saline wash or saliva collection) was the most reproducible and reliable method for sampling C. albicans from the oral cavity. 7. Snap off the end of the swab and keep it inside the tube during centrifugation. This will elute any C. albicans cells in the swab into the saline. 8. Oral and vaginal colonisation is highly dependent on the C. albicans and mouse strain utilised. The use of the C. albicans clinical isolate (529L) usually results in continued oral and vaginal colonisation up to week 5/6 in 100% of BALB/c mice, 80–100% of C57BL/6 mice, but not DBA/2 mice. The laboratory strain SC5314 is cleared from both mucosal sites in all strains of mice by week 2. Week 3/4 is usually used as the optimal time point to determine colonisation efficiency when comparing data between mouse and fungal strains. 9. Fungal burdens can vary substantially. Using C. albicans 529L, oral burdens vary between single figures to 2,500 CFU/ml. Vaginal burdens are usually one to two logs higher (~103– 105 CFU/ml) in the first 3–4 weeks, but there is a gradual

D. Rahman et al.

Week 1 6

cfu/ml (log 10)

5 4 3 2 1

Ba lb Ba /c lb + Ba / c 53 lb + 1 4 Ba /c + 5 31 D lb/c 529 4 B A + L D / 2 52 BA + 9 5 L D /2 + 31 BA 4 D / 53 C BA 2+ 14 57 /2 5 2 C BL + 9L 57 / 6 5 BL + 29 C /6 5 L 3 5 C 7BL + 5 1 4 5 7 / 31 BL 6 + 4 / 6 52 + 9L 52 9L

0

Oral swabs Vaginal washings

Week 5 6

cfu/ml (log 10)

5 4 3 2 1 0 Ba lb Ba /c lb + 5 Ba /c + 31 lb 5 4 Ba /c + 314 lb 5 D /c + 29L BA / 52 D 2 + 9L BA 5 D /2 314 BA + / 5 D 2 + 31 C BA 52 4 57 /2 9 + L C BL 52 57 /6 + 9L C BL 53 57 /6 + 14 C BL 53 57 /6 1 BL + 5 4 /6 29 + L 52 9L

534

Fig. 2. Persistent oral and vaginal colonisation is dependent on both mouse and C. albicans strains. Three strains of mice (BALB/c, DBA/2, and C57BL/6) (n = 6) were induced into a pseudoestrus state. Mice were inoculated orally and vaginally with two strains of C. albicans, the clinical human isolate 529L and the laboratory strain SC5314. Oral swabs and vaginal washings were collected at weekly intervals and C. albicans CFU/mL in individual mice are shown at 1 and 5 weeks post-inoculation. Reprinted from ref. 17 with permission from Elsevier.

decrease in burdens after week 4 to levels similar to that found orally (Fig. 2). 10. Samples are collected at weekly intervals from the same mice. Fungal burdens have usually recovered by the time of the next collection. This significantly reduces mouse numbers for experimentation. 11. Samples should be stored in 10% (v/v) formol-saline using at least four times the tissue volume.

38

Murine Model of Candida Colonisation

535

12. We have found end point testing by fluoroscopic or X-ray visualisation to be the most reliable method. The decalcification end point is achieved when the soft and hard tissues, including teeth, are of similar radiolucency. Slow decalcification using EDTA is the best method for preserving the tissue morphology. For this reason, rapid nitric acid decalcification should be avoided. 13. Analysis of every tenth section from the entire paraffin block significantly reduces the possibility of missing fungi between sections, especially in the control mouse group. 14. Fungi in tissues sections should be stained pink, with host tissue cell nuclei stained blue. References 1. Samaranayake YH, Samaranayake LP (2001) Experimental oral candidiasis in animal models. Clin Microbiol Rev 14:398–429. 2. de Repentigny L (2004) Animal models in the analysis of Candida host-pathogen interactions. Curr Opin Microbiol 7:324–329. 3. Rahman D, Challacombe SJ (1995) Oral immunization against mucosal candidiasis in a mouse model. Adv Exp Med Biol 371B:1663–1666. 4. Rahman D, Mistry M, Challacombe SJ (1997) Mucosal antibodies to Candida antigens in saliva and vaginal secretions after intranasal immunisation. J Dent Res 76, 328. 5. Kamai Y, Kubota M, Kamai Y, Hosokawa T, Fukuoka T, Filler SG (2001) New model of oropharyngeal candidiasis in mice. Antimicrob Agents Chemother 45:3195–3197. 6. Mellado E, Cuenca-Estrella M, Regadera J, Gonzalez M, Diaz-Guerra TM, RodriguezTudela JL (2000) Sustained gastrointestinal colonization and systemic dissemination by Candida albicans, Candida tropicalis and Candida parapsilosis in adult mice. Diag Microbiol Infect Dis 38:21–28. 7. Naglik JR, Fidel PL, Odds FC (2008) Animal models of mucosal Candida infection. FEMS Microbiol Lett 283:129–139. 8. Fidel P Jr, Sobel JD (1999) Murine models of Candida vaginal infections. In: Sande M, Zak O, editors. Handbook of animal models of infection.London, United Kingdom: Academic Press: 741–748. 9. Fidel P Jr, Cutright J, Steele C (2000) Effects of reproductive hormones on experimental vaginal candidiasis. Infect Immun 68:651–657. 10. Calderon L, Williams R, Martinez M, Clemons KV, Stevens DA (2003) Genetic susceptibility to vaginal candidiasis. Med Mycol 41:143–147.

11. Clemons KV, Spearow JL, Parmar R, Espiritu M, Stevens DA (2004) Genetic susceptibility of mice to Candida albicans vaginitis correlates with host estrogen sensitivity. Infect Immun 72:4878–4880. 12. Fidel P, Jr., Cutright JL, Sobel JD (1995) Effects of systemic cell-mediated immunity on vaginal candidiasis in mice resistant and susceptible to Candida albicans infections. Infect Immun 63:4191–4194. 13. Spearow JL, Doemeny P, Sera R, Leffler R, Barkley M (1999) Genetic variation in susceptibility to endocrine disruption by estrogen in mice. Science 285:1259–1261. 14. Elahi S, Pang G, Clancy R, Ashman RB (2000) Cellular and cytokine correlates of mucosal protection in murine model of oral candidiasis. Infect Immun 68:5771–5777. 15. Deslauriers N, Coulombe C, Carre B, Goulet JP (1995) Topical application of a corticosteroid destabilizes the host-parasite relationship in an experimental model of the oral carrier state of Candida albicans. FEMS Immunol Med Microbiol 11:45–55. 16. Takakura N, Sato Y, Ishibashi H, Oshima H, Uchida K, Yamaguchi H, et al (2003) A novel murine model of oral candidiasis with local symptoms characteristic of oral thrush. Microbiol Immunol 47:321–326. 17. Rahman D, Mistry M, Thavaraj S, Challacombe SJ, Naglik JR (2007) Murine model of concurrent oral and vaginal Candida albicans colonization to study epithelial host-pathogen interactions. Microbes Infect 9:615–622. 18. Gillum AM, Tsay EY, Kirsch DR (1984) Isolation of the Candida albicans gene for orotidine-5’-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182.

Chapter 39 A Luciferase Reporter for Gene Expression Studies and Dynamic Imaging of Superficial Candida albicans Infections Donatella Pietrella, Brice Enjalbert, Ute Zeidler, Sadri Znaidi, Anna Rachini, Anna Vecchiarelli, and Christophe d’Enfert Abstract Real-time imaging of fungal infections is becoming integral to the study of host–pathogen interactions, as it allows monitoring of the spatial and temporal progression of pathogen growth or of the host response in a single animal as well as reducing the number of animals used to obtain significant data. We present different applications of a novel luciferase reporter gene constructed from the coding sequences of the Candida albicans PGA59 gene, encoding a GPI-linked cell wall protein, and the Gaussia princeps luciferase gene. Upon addition of the coelenterazine substrate, light produced by the surface-exposed luciferase can be used to quantify gene expression from a variety of C. albicans promoters as well as monitoring cutaneous, subcutaneous, and vaginal infections. Key words: Luciferase, Gaussia princeps, Imaging, Reporter, Gene fusion, Vulvovaginal candidiasis, Subcutaneous candidiasis, Superficial infection

1. Introduction The study of host–pathogen interactions has recently benefited from the development of real-time imaging in small animals. Realtime imaging approaches take advantage of sensitive charge-coupled device (CCD) cameras to detect low levels of light emitted from luciferase reporters in vivo (1). They allow monitoring of the spatial and temporal progression of pathogen growth or of the host response in a single animal, making it possible to reveal the spread of pathogens to unexpected infection sites as well as significant variations in pathogen/host responses that can be masked by the heterogeneous

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_39, © Springer Science+Business Media, LLC 2012

537

538

D. Pietrella et al.

behavior of individual animals. Moreover, real-time monitoring allows for a reduction in the number of animals required to generate statistically significant datasets (1). Real-time imaging of Candida albicans infections has been pioneered by Doyle et al. (2, 3) who used the firefly luciferase gene expressed under the control of the C. albicans ENO1 promoter to image different forms of C. albicans infections. This approach was successful in a vulvovaginal candidiasis model and allowed monitoring of the efficacy of an antifungal treatment. However, it suffered drawbacks, such as a limited permeability of hyphal cells to the firefly luciferase substrate, luciferin, and monitoring of disseminated candidiasis was unsuccessful. In this chapter, we present a novel luciferase reporter whereby the naturally secreted Gaussia princeps luciferase (4) is targeted to the cell surface of C. albicans using the targeting signals of the C. albicans GPI-linked cell wall protein Pga59 (5) (Fig. 1a). This approach resulted in a highly sensitive reporter, referred to as gLUC59, localized at the cell surface and allowing detection of luciferase in intact yeast and hyphal cells even when expressed from a weak promoter (6). gLUC59 has been used successfully to monitor different forms of superficial C. albicans infections where the luciferase substrate coelenterazine can be directly delivered at the site of infection (Fig. 2). The efficacy of antifungal treatments, e.g., a β-glucan-conjugate vaccine and anti-β-glucan antibodies, against the development of different superficial C. albicans infections could be efficiently monitored (6, 7). Importantly, these studies showed that imaging superficial candidiasis with gLUC59-expressing C. albicans strains was more reliable than colony-forming unit (CFU) counts in assessing the extent and duration of these infections. However, it should be noted that monitoring systemic candidiasis has so far been unsuccessful when using C. albicans strains expressing the gLUC59 luciferase (6, 8). Here, we present protocols for measuring C. albicans promoter activity in in vitro grown cells and monitoring of superficial, namely cutaneous, subcutaneous, and vaginal, C. albicans infections by imaging infected animals in the IVIS imaging system.

2. Materials 2.1. Plasmids and C. albicans Strains 2.2. Equipment

Plasmids and C. albicans strains of interest for imaging infections using the gLUC59 reporter are listed in Table 1 (see Note 1). 1. IVIS-200™ imaging system (Xenogen Corporation). 2. Anesthesia chamber (Xenogen Corporation). 3. Flat-bottom black-wall 96-well plates (see Note 2). 4. Infinite M200 PRO multimode plate reader (Tecan).

39

a

In Vivo Imaging of Candida Infections

light

coelenterazine

ext

N

ER cyt

539

CW cyt

C

b

CIp10::ACT1p-gLUC59 7735 bp

c

HindIII

..AATCATTCAAAaagcttTATTAAAATGATGCAATTCTCA.. M

M

Q

F

S

Fig. 1. The cell surface exposed gLUC59 luciferase. (a) gLUC59 is synthesized as a fusion between the amino-terminal signal peptide of Pga59 (gray line), the Gaussia princeps luciferase (black line), and the mature and carboxy-terminal hydrophobic domains of Pga59 (gray line). Upon entry into the endoplasmic reticulum (ER), the Pga59 amino-terminal signal peptide and carboxy-terminal hydrophobic domain are cleaved and the protein is modified by addition of a glycophosphatidylinositol (GPI) anchor. The GPI-modified protein is then shuttled to the cytoplasmic membrane where the GPI anchor is processed, allowing gLUC59 to become anchored to cell wall (CW) β-glucans and exposed at the cell surface. Owing to the cell surface exposure of gLUC59, light is produced upon addition of coelenterazine to intact cells. (b) The CIp10::ACT1pgLUC59 vector is a derivative of the C. albicans CIp10 integrative vector (10) that harbors the C. albicans URA3 transformation marker (URA3 ; white arrow) and that, upon cleavage by Stu I, integrates at the C. albicans RPS1 locus (RPS1; white arrow). A Xho I/Hin dIII fragment encompassing the ACT1 promoter (ACT1p; gray arrow ) was cloned upstream of the gLUC59 luciferase reporter gene. gLUC59 is a fusion between the C. albicans PGA59 gene (PGA59; black arrow ) and the Gaussia princeps luciferase gene that has been adapted for efficient expression in C. albicans (gLUC; gray box). Propagation of CIp10::ACT1p-gLUC59 is achieved in E. coli in the presence of ampicillin (bla; white arrow). The ACT1 promoter is easily exchanged by other promoter regions using a Xho I/Hin dIII digest. (c) Nucleotide sequence at the junction between the ACT1 promoter and the gLUC59 reporter gene. Replacement of the ACT1 promoter (gray ) by another promoter should ensure that an ATG start codon does not occur upstream and out-of-frame of the gLUC59 ATG start codon (black ).

540

D. Pietrella et al.

Fig. 2. In vivo imaging of mice infected with bioluminescent Candida albicans. (a) Cutaneous infection. Immunosuppressed mice were inoculated on a shaved and abraded skin area with C. albicans cells either expressing the gLUC59 cell surface exposed luciferase (gLUC59+) or not (gLUC59−). gLUC59+-infected mice were treated intraperitoneally with a placebo (−), econazole (10 mg/kg body weight), or amphotericin B (amB; 10 mg/kg) every day post infection. At day 7 post infection, coelenterazine was deposited at the site of infection and mice were imaged in the IVIS-200™ imaging system (Xenogen Inc.) (4). (b) Subcutaneous infection. Uninfected mice or mice inoculated subcutaneously with C. albicans cells expressing the gLUC59 cell surface exposed luciferase (gLUC59+) or not (gLUC59−) received a coelenterazine injection at the site of infection at 4 days post infection and imaged in the IVIS-200™ imaging system (4). Background luminescence with control strains is frequently observed especially in inflamed regions. (c) Vaginal infection. Mice, previously treated with adjuvant (−LAM) or vaccinated with adjuvant plus a β-glucan conjugate (+LAM) were injected into the vaginal lumen with a suspension of C. albicans cells expressing the gLUC59 cell surface exposed luciferase. At days 4 and 13 post infection, mice received an intravaginal injection of coelenterazine and were imaged in the IVIS-200™ imaging system (7).

39

In Vivo Imaging of Candida Infections

541

Table 1 Plasmids and C. albicans strains Plasmid

Promoter

C. albicans strain

Reference

CIp10::gLUC59

–

CA1399

(6)

CIp10::gLUC59, ura3::SAT1

–

CIp10::ACT1p-gLUC59

ACT1p

Constitutive expression

CIp10::ACT1p-gLUC59, ura3::SAT1

ACT1p

Constitutive expression

CIp10::TDH3p-gLUC59

TDH3p

Constitutive expression

CIp10::TDH3p-gLUC59, ura3::SAT1

TDH3p

Constitutive expression

CIp10::ADH1p-gLUC59

ADH1p

Constitutive expression

CEC2183

Lab collection

CIp10::TEF1p-gLUC59

TEF1p

Constitutive expression

CEC2180

Lab collection

CIp10::EFT3p-gLUC59

EFT3p

Constitutive expression

CEC975

(6)

CIp10::TRR1p-gLUC59

TRR1p

Oxidative stress-induced (strong)

CA1435

(6)

CIp10::TRR1p-gLUC59

TRX1p

Oxidative stress-induced (strong)

CA1400

(6)

CIp10::IPF9996p-gLUC59

IPF9996p

Oxidative stress-induced (weak)

CA1434

(6)

CIp10::HWP1p-gLUC59

HWP1p

Hyphal-specific

CEC971

(6)

CIp10::ALS3p-gLUC59

ALS3p

Hyphal-specific

CEC939

(9)

CIp10::HSP70p-gLUC59

HSP70p

Heat shock responsive

CEC2134

Lab collection

CIp10::MKC1p-gLUC59

MKC1p

PKC cell integrity pathway CEC2136 induced (weak)

Lab collection

CIp10::UTR2p-gLUC59

UTR2p

Calcineurin pathway induced

CEC2138

Lab collection

CIp10::CRZ1p-gLUC59

CRZ1p

Calcineurin pathway induced

CEC2140

Lab collection

2.3. Media and Reagents

Lab collection CA1398

(6) Lab collection

CEC2181

Lab collection Lab collection

1. YPD: 1% yeast extract (Difco), 2% Bacto-peptone (Difco), 2% D-glucose; autoclave 10 min at 120°C; add 1.5% Bacto-agar for solid medium. 2. 1 M coelenterazine (Molecular Probes; see Note 3) in methanol. 3. 500 μg/mL coelenterazine (Synchem; see Note 3) in 1:9 methanol:PBS.

542

D. Pietrella et al.

4. 1 mg/mL coelenterazine (Synchem; see Note 3) in 1:4 methanol:PBS. 5. Estradiol valerate sesame oil. 6. LA buffer: 0.5 M NaCl, 0.1 M KH2PO4 pH 6.7, 1 mM EDTA, 0.6 mM NaN3, 1 mM phenylmethylsulfonide fluoride cocktail (Boehringer). 2.4. Animals (see Note 4)

Six-week-old female CD1 mice (Harlan), housed in groups of 4–6 mice per cage, were allowed to acclimatize for 1 week prior to experimentation. Animals were maintained under specific pathogen-free (SPF) conditions that included testing sentinel animals for unwanted infections; according to the Federation of European Laboratory Animal Science Association standards, no infections were detected.

3. Methods 3.1. Measurement of Luciferase Activity from In Vitro Grown Candida albicans Cells Expressing gLUC59 Constructs (see Note 5)

1. Using C. albicans cells from an overnight culture, inoculate two 20 mL cultures of YPD to OD 0.1. 2. Allow cells to grow for 2 h at 30°C with shaking. 3. Take a 1 mL sample from both cultures, measure the OD600, and keep on ice. 4. If examining fungal cell responses to a compound, add the compound of interest to one of the two cultures and then continue incubation of both cultures at 30°C. 5. Collect 1 mL samples from the untreated and treated cultures at different time points, measure the OD600, and keep on ice. 6. Centrifuge 1 mL samples for 3 min at 3,000 ´ g at 4°C in an Eppendorf centrifuge. 7. Resuspend cells in 500 μL cold LA buffer and centrifuge for 3 min at 3,000 ´ g at 4°C. 8. Resuspend cells in 250–500 μL cold LA buffer to obtain the same cell/volume concentration in all samples and keep on ice (see Note 6). 9. Put 100 μL of each sample in duplicate into a flat-bottom black-wall 96-well plate. 10. Add 100 μL of freshly made 2 μM coelenterazine in LA buffer to each well. Pipet up and down once. 11. Measure immediately in a luminometer (e.g. Infinite M200 PRO plate reader; see Note 7).

39

3.2. Real-Time Imaging of C. albicans Cutaneous Infection (see Note 8)

In Vivo Imaging of Candida Infections

543

1. Three days prior to infection, immunosuppress mice by intraperitoneal injection of cyclophosphamide (150 mg/kg). 2. One day prior to infection, inoculate a 5 mL YPD culture with a freshly grown colony of C. albicans strain CA1398 and grow at 20–30°C with shaking for 16 h. 3. On the day of infection, harvest cells, wash twice in sterile endotoxin-free physiological saline, enumerate by hemocytometer, and adjust to a final concentration of 5 × 108 CFU/mL in sterile physiological saline. 4. Immunosuppress mice by intraperitoneal injection of cyclophosphamide (150 mg/kg). 5. Anesthetize mice by intraperitoneal injection of 80 μL pentobarbital (50 mg/kg), shave an area of 4 cm2 on the lower back (Fig. 1a) to remove the fur, and then abrade the skin with sand paper until glistening (see Note 9). 6. Deposit 20 μL of the C. albicans cell suspension on the abraded area. 7. Monitor infection every day for 7 days post infection by anesthetizing mice with 2.5% isoflurane and depositing 20 μL coelenterazine (500 μg/mL) on the abraded skin area and imaging the animal dorsal side up in the IVIS-200™ imaging system under anesthesia with 2.5% isoflurane (see Note 10). 8. For infections continuing for more than 3 days, perform a third immunosuppressive treatment by intraperitoneal injection of cyclophosphamide (50 mg/kg) on day 3 post infection.

3.3. Real-Time Imaging of C. albicans Subcutaneous Infection

1. One day prior to infection, inoculate a 5 mL YPD culture with a freshly grown colony of C. albicans strain CA1398 and grow at 20–30°C with shaking for 16 h. 2. On the day of infection, harvest cells, wash twice in sterile endotoxin-free physiological saline, enumerate by hemocytometer, and adjust to a final concentration of 108 CFU/mL in sterile physiological saline. 3. Inoculate mice subcutaneously in the right thigh with 100 μL of the C. albicans cell suspension. 4. After challenge, and every day post infection (see Note 11), inject mice subcutaneously with 100 μL coelenterazine (500 μg/mL) and image animals in the IVIS-200™ imaging system under anesthesia with 2.5% isoflurane (see Note 10).

3.4. Real-Time Imaging of Vaginal Candidiasis

1. Five days prior to infection, induce pseudo-estrus in mice by subcutaneous injection of 0.2 mg estradiol valerate in 100 μL sesame oil. Repeat injection weekly to maintain pseudo-estrus. 2. One day prior to infection, inoculate a 5 mL YPD culture with a freshly grown colony of C. albicans strain CA1398 and grow at 20–30°C with shaking for 16 h.

544

D. Pietrella et al.

3. On the day of infection, harvest cells, wash twice in sterile endotoxin-free physiological saline, enumerate by hemocytometer, and adjust to a final concentration of 109 CFU/mL in sterile physiological saline. 4. Anesthetize mice with 2.5% (v/v) isoflurane gas (see Note 12). 5. Infect mice with 10 μL of the C. albicans cell suspension administered from an Eppendorf 0.5–10 μL mechanical pipette into the vaginal lumen, close to the cervix. To encourage vaginal contact and adsorption of fungal cells, hold mice head down for 1 min following inoculation. 6. Inoculate a 5 mL YPD culture with a freshly grown colony of C. albicans strain CA1398 and grow at room temperature with shaking for 16 h. 7. On day 1 post infection, repeat steps 3–5. 8. Allow mice to recover for 24–48 h, during which time the C. albicans vaginal infection will establish. 9. From day 4, add 10 μL coelenterazine (5 mg/mL) to the vaginal lumen and image animals in the IVIS-200™ imaging system under anesthesia with 2.5% isoflurane (see Note 10).

4. Notes 1. Methods presented in this chapter only make use of strain CA1398. However, we also provide a list of the plasmids and strains which could be used in in vitro or in vivo experiments; these strains are available upon request. 2. Alternatively, black plates with transparent bottoms can be used, allowing simultaneous OD600 measurements. 3. Coelenterazine from different suppliers varies in quality. Highquality coelenterazine from Molecular Probes is used for in vitro experiments. Lower quality coelenterazine from Synchem is used for animal experiments. Coelenterazine derivatives with increased stability, such as ViviRen (Promega), have not proven different from standard coelenterazine in our hands. 4. Animal experiments should adhere to ethical rules in place in the laboratory/animal facility where they are performed. In our case, all animal experiments adhered to the EU Directive 86/609. Experiments were performed according to the guidelines of the European Convention for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes. (ETS No. 123). The protocol was approved by the Perugia University Ethics Committee (Comitato Universitario di Bioetica) (permit numbers 41-2005B and 34/2003-A).

39

In Vivo Imaging of Candida Infections

545

5. Luciferase activity can also be measured in a tube luminometer or detected by autoradiography (4). 6. Cell concentration in the assay can vary as it has been shown, using strain CA1398 expressing gLUC59 under the control of the ACT1 promoter, that luciferase activity varies linearly when using cell concentrations from 103 to 108 cells/mL. The use of identical cell concentrations for a given strain exposed to different conditions will facilitate comparisons between conditions. 7. Luciferase activity is expressed in relative luciferase units/cell. There is no requirement for a standard curve. 8. Groups of 4–6 animals are generally used for each strain tested. 9. Under these anesthesia conditions, mice remain asleep for 2 h. The whole treatment—shaving, skin abrasion, and C. albicans cells deposition—takes a maximum of 2 min and does not require analgesia. Upon recovery from anesthesia, mice are active without signs of pain. 10. The duration for imaging varies according to the infection model. In our hands, using strain CA1398, expressing gLUC59 under the control of the ACT1 promoter, imaging was carried out for 10–60 s in the cutaneous model of infection, 1–5 min in the subcutaneous model of infection, and 1–2 min in the vaginal candidiasis model. The imaging duration should be such that saturation at the site of infection is not achieved. 11. For the time of the studies, no adverse effects were observed due to repeated subcutaneous injection with coelenterazine. 12. Anesthesia is required for vaginal infection in order to inject the yeast suspension close to the cervix. To encourage vaginal contact and adsorption of fungal cells, mice are held head down for 1 min following inoculation (this procedure could be uncomfortable for mice when awake).

Acknowledgements We are grateful to Al Brown for his contributions to the development of the luciferase reporter. Work in the laboratories of CdE and AV is supported by the European Commission (Galar Fungail 2 Marie Curie Research Training Network, MRTN-CT-2003-504148; FINSysB Marie Curie Initial Training Network, PITN-GA-2008-214004). Work in the laboratory of CdE is also supported by the Agence Nationale de la Recherche (KANJI, ANR-08-MIE-033-01). Brice Enjalbert was the recipient of a postdoctoral fellowship of the European Commission (Galar Fungail 2, MRTN-CT-2003-504148). UZ is the recipient of a postdoctoral fellowship of the program

546

D. Pietrella et al.

Carnot Maladies Infectieuses. SZ is the recipient of a postdoctoral fellowship of the European Commission (FINSysB, PITN-GA2008-214004). References 1. Hutchens, M., and Luker, G. D. (2007) Applications of bioluminescence imaging to the study of infectious diseases, Cell Microbiol 9, 2315–2322. 2. Doyle, T. C., Nawotka, K. A., Kawahara, C. B., Francis, K. P., and Contag, P. R. (2006) Visualizing fungal infections in living mice using bioluminescent pathogenic Candida albicans strains transformed with the firefly luciferase gene, Microbial pathogenesis 40, 82–90. 3. Doyle, T. C., Nawotka, K. A., Purchio, A. F., Akin, A. R., Francis, K. P., and Contag, P. R. (2006) Expression of firefly luciferase in Candida albicans and its use in the selection of stable transformants, Microbial pathogenesis 40, 69–81. 4. Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., and Breakefield, X. O. (2005) Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo, Mol Ther 11, 435–443. 5. Moreno-Ruiz, E., Ortu, G., de Groot, P. W., Cottier, F., Loussert, C., Prevost, M. C., de Koster, C., Klis, F. M., Goyard, S., and d’Enfert, C. (2009) The GPI-modified proteins Pga59 and Pga62 of Candida albicans are required for cell wall integrity, Microbiology 155, 2004–2020.

6. Enjalbert, B., Rachini, A., Vediyappan, G., Pietrella, D., Spaccapelo, R., Vecchiarelli, A., Brown, A. J., and d’Enfert, C. (2009) A multifunctional, synthetic Gaussia princeps luciferase reporter for live imaging of Candida albicans infections, Infect Immun 77, 4847–4858. 7. Pietrella, D., Rachini, A., Torosantucci, A., Chiani, P., Brown, A. J., Bistoni, F., Costantino, P., Mosci, P., d’Enfert, C., Rappuoli, R., Cassone, A., and Vecchiarelli, A. (2010) A betaglucan-conjugate vaccine and anti-beta-glucan antibodies are effective against murine vaginal candidiasis as assessed by a novel in vivo imaging technique, Vaccine 28, 1717–1725. 8. d’Enfert, C., Vecchiarelli, A., and Brown, A. J. (2010) Bioluminescent fungi for real-time monitoring of fungal infections, Virulence 1, 174–176. 9. Vediyappan, G., Rossignol, T., and d’Enfert, C. (2010) Interaction of Candida albicans biofilms with antifungals: transcriptional response and binding of antifungals to betaglucans, Antimicrob Agents Chemother 54, 2096–2111. 10. Murad, A. M., Lee, P. R., Broadbent, I. D., Barelle, C. J., and Brown, A. J. (2000) CIp10, an efficient and convenient integrating vector for Candida albicans, Yeast 16, 325–327.

Chapter 40 Modeling of Fungal Biofilms Using a Rat Central Vein Catheter Jeniel E. Nett, Karen Marchillo, and David R. Andes Abstract Candida frequently grows as a biofilm, or an adherent community of cells protected from both the host immune system and antimicrobial therapies. Biofilms represent the predominant mode of growth for many clinical infections, including those associated with placement of a medical device. Here, we describe a model for Candida biofilm infection of one important clinical niche, a venous catheter. This animal model system incorporates the anatomical site, immune components, and fluid dynamics of a patient venous catheter infection and can be used for study of biofilm formation, drug resistance, and gene expression. Key words: Biofilm, Catheter, Candida albicans, Animal model, Drug resistance, Device infection

1. Introduction The use of biofilm models has fueled investigation of this unique manner of growth and has been vital for characterizing associated phenotypic properties and gene expression patterns (1–3). Because Candida infection of commonly placed medical devices, such as a dentures, venous catheters, or urinary catheters, involves biofilm growth, models closely mimicking infection at these clinical sites are of interest (4). To date, the in vivo model most commonly used for Candida biofilm study is the venous catheter model described here (5–8). This model emulates one of the most common clinical biofilm infections and mimics environmental host conditions at this site, including anatomical location, flow conditions, and exposure to host cells, serum proteins, and immune factors. The catheter is secured in the jugular vein without disruption of blood flow and then tunneled subcutaneously and positioned in a wire casing for protection. Inoculation of the catheter occurs 24 h after catheter placement to allow for a conditioning period of host protein

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_40, © Springer Science+Business Media, LLC 2012

547

548

J.E. Nett et al.

deposition on the catheter surface (4, 9, 10). Throughout the experiment, the model uses the clinically relevant anticoagulant, heparin, although other anticoagulants can be utilized. The rat venous catheter model can be used as a tool to answer a variety of scientific questions and has identified C. albicans biofilms with altered morphology, adhesion, matrix production, and drug susceptibility (8, 11, 12). Confocal microscopy and scanning electron microscopy can successfully illustrate intact biofilm architecture, including the fungal cell morphology, presence of extracellular matrix, and the incorporation of host cells (5). Adjusting the duration of biofilm formation from 6 to 72 h can capture the time course of this process from cell adhesion to development of a multicellular community with both yeast and hyphal fungal cell morphologies, host cell components, extracellular matrix, and open areas or channels. Sonication effectively removes cells for microbiological enumeration or cellular analyses, such as gene expression profiling or cell biology studies (13). Microbiological counts can be used to quantify the viable biofilm mass and are a simple method of measuring the impact of a luminal drug therapy or comparing the difference in viable burden among several genetic strains. In addition, organs and blood from distant sites can be collected for measurement of viable burden and assessment of biofilm dispersion or dissemination of disease. Although vascular catheters may be infected by hematogenous seeding from a distant vascular site, the model has primarily been utilized for study following intraluminal infection. The latter results in more reproducible cell number and biofilm cell mass among experiments.

2. Materials 2.1. Animals

2.2. Medications

Specific-pathogen-free male Sprague–Dawley rats weighing 350 g (Harlan). 1. Heparin sodium for injection 1,000 USP units/mL (APP Pharmaceuticals). 2. Xylazine (Sigma-Aldrich). 3. Buprenorphine 0.3 mg/mL (Hospital Pharmacy). 4. Ketamine HCl 500 mg/10 mL (Bedford Laboratories). 5. Double antibiotic ointment: bacitracin zinc and polymyxin B sulfate (Fougera).

2.3. Surgical Materials

1. Polyethylene tubing with 1.14 mm inner diameter and 1.57 mm outer diameter (PE 160, Intramedic, Becton Dickinson). 2. Three-way large-bore stopcock with rotating male luer lock adapter (Baxter Healthcare Corporation).

40

Fungal Biofilm Catheter Model

549

3. Rodent jacket, rat 250–350 g (Braintree Scientific, Inc.). 4. Tether, 18¢ sewn (Braintree Scientific, Inc.). 5. Scrub Care Surgical Scrub Brush-Sponge/Nail Cleaner (Cardinal Health). 6. Polysulfone Button Tether for rats, 0.090 in. lumen, 12 in. (30 cm) (sterile) (Instech Solomon). 7. Skin stapler 5.7 × 3.9 mm (Ethicon Endo-Surgery). 8. Surgical suture, sterile, nonabsorbable, silk black braided 2-0 18″ (3.0 metric, 45 cm) (Ethicon, Inc.). 9. Surgical dissecting microscope (Stereo Zoom Microscope with fiber optic illuminator control (PZMIII-BS), World Precision Instruments). 10. Sterile syringes. 11. Surgical attire: sterile surgical gloves, sterile gown, and surgical mask. 12. Rodent hair clipper (A5 power pro clipper, Oster). 13. Rat dissecting kit (World Precision Instruments). 14. Far infrared warming pad 14″ × 14″ (Kent Scientific Corporation). 2.4. Fungal Isolates and Media

2.5. Materials for Evaluation of Selected Endpoints 2.5.1. Microbiological Counts (Optional) 2.5.2. Confocal or Fluorescent Microscopy (Optional)

1. C. albicans, C. glabrata, or C. parapsilosis fungal strains. 2. YPD medium supplemented with uridine: 1% yeast extract, 2% Bacto-peptone, 2% glucose, and 80 μg/mL uridine. 1. Sonicating water bath (FS 14 with 40-kHz transducer, Fisher Scientific). 2. Sabouraud dextrose agar (SDA plates: 4% glucose, 1% peptone, 1.5% agar, pH 5.6). 3. Tissue homogenizer (Polytron 3100, Brinkman Instruments). 1. Fluorescent probes: calcofluor white or Fluorescent Brightener 28 (Sigma-Aldrich), FUN1 live/dead yeast stain (Molecular Probes, Invitrogen), and concanavalin A Alexa Fluor 488 (Molecular Probes, Invitrogen). 2. Glass-bottom petri dish (coverslip 1.5, 35-mm disk P325G 1.5–14°C, MatTek). 3. Confocal or fluorescent microscope with inverted objective (such as Zeiss Axiovert 200).

2.5.3. Scanning Electron Microscopy (Optional)

1. Glutaraldehyde (25%) (Sigma-Aldrich). 2. Formaldehyde (37%) (Sigma-Aldrich). 3. Phosphate-buffered saline (PBS) (0.15 M NaCl, pH 7.4). 4. Osmium tetroxide (Electron Microscopy Sciences).

550

J.E. Nett et al.

5. Critical point drier (Tousimis). 6. Gold sputter coater (Auto Conductavac IV, Seevac, Inc.). 7. Ultrasmooth carbon adhesive tabs (12 mm, Electron Microscopy Sciences). 8. Aluminum mounts (12.7 mm, Electron Microscopy Sciences). 9. Scanning electron microscope (JSM-6100, JEOL). 2.5.4. Candida Biofilm Cell Nucleic Acid Collection (Optional)

1. AE buffer (50 mM sodium acetate, pH 5.2, 10 mM EDTA). 2. Liquid nitrogen. 3. Reagents for hot phenol RNA extraction (5).

3. Methods 3.1. Preparation of Catheters

1. Cut polyethylene tubing into 50 cm in length. This catheter length is calculated based on placement in the jugular vein 2 cm above the right atrium, subcutaneous tunneling, and extension though an external protective device to the top of the animal cage where it will be secured for access. The volume of this catheter length is approximately 500 μL; including the luer stub and stop cock, the total catheter volume is approximately 700 μL. 2. Sterilize catheters by ethylene oxide gas sterilization as autoclaving may destroy them.

3.2. Preparation of Surgical Equipment

1. Sterilize surgical equipment, including surgical gowns, drapes, tethers, and surgical tools by autoclaving. 2. Use prepackaged, sterilized stopcocks with luer stubs, sutures, and surgical gloves.

3.3. Catheter Placement (see Notes 1–3)

1. Anesthetize animals by intraperitoneal injection of a mixture of ketamine (80 mg/kg) and xylazine (8 mg/kg). This anesthesia protocol should produce anesthesia for approximately 120 min. 2. Prepare the animal for the surgical procedure by removing hair from the midscapular space, anterior chest, and neck with a rodent clipper (see Note 4). Prepare the skin area with an antiseptic surgical scrub brush. 3. Create a sterile field under the surgical microscope by placing the rat in the supine position and preparing the surgical area with sterile drapes. Wear sterile gloves, mask, and gown. 4. Make a vertical incision in the skin of the anterior neck just right of midline and use blunt surgical dissection to expose the right jugular vein.

40

Fungal Biofilm Catheter Model

551

5. To subcutaneously tunnel the catheter, create a second incision at the scruff and use blunt surgical dissection toward the initial surgical incision. Next, tunnel the proximal end of the catheter through this subcutaneous space to the midscapular space and externalize the catheter at the site of the second surgical incision. 6. Stabilize the jugular vein and make a longitudinal incision of a few millimeters to the vein wall using the vannas scissors from the dissection kit. Instill heparinized saline (100 U/mL) into the catheter and insert the catheter in the vein (superior vena cava) opening. Advance to a site above the right atrium (approximately 2 cm). If the catheter is appropriately placed, blood should be able to be easily withdrawn. Conversely, if the catheter is in the atrium, it may be difficult to withdraw blood. Secure the catheter to the vein with (2-0) silk ties. 7. Secure the catheter to the subscapular skin scruff via a button using surgical staples (Fig. 1a). Close both incisions with surgical staples and apply antibiotic ointment. Position a tether and rodent jacket on the animal to protect the catheter (Fig. 1b). Secure the distal catheter segment and stopcock above the cage to allow easy access to catheter. 8. Monitor the animal and wrap in a warming pad until it can lift its head and remain sternal. 9. Administer narcotic analgesia with buprenorphine (0.05 mg/kg) subcutaneously twice daily for 24 h. 10. Allow the catheter to remain in place for 24 h prior to infection to allow the catheter surface to become conditioned with host proteins (see Note 5).

Fig. 1. Surgical placement of a rat jugular venous catheter. (a) The catheter is inserted and secured in the jugular vein of an anesthetized animal. (b) The wire casing and rodent jacket protect the catheter and prevent the animal from disrupting the catheter.

552

J.E. Nett et al.

3.4. Animal and Catheter Maintenance

1. Monitor the animals for signs of distress every 8 h through the study. If necessary, consider additional administration of buprenorphine (0.05 mg/kg) subcutaneously twice daily for analgesia. 2. Examine the anterior neck incision and the catheter exit site daily for signs of inflammation or purulence. In our experience with this protocol, superficial infections are uncommon. 3. House animals in an environmentally controlled room with 12 h light–dark cycle and maintain on a standard ad libitum rat diet. Following surgery and for the duration of the experiments, house animals singly in shoe box cages with normal bedding.

3.5. Preparation of Inoculum

1. Store fungal strains in 15% (vol/vol) glycerol stock at −80°C. Prior to experiments, maintain strains on YPD medium supplemented with uridine. C. albicans, C. glabrata, and C. parapsilosis have successfully produced biofilms in this model (14). 2. Grow strains in YPD medium supplemented with uridine at 30°C on an orbital shaker set to 200 rpm. Harvest cells during late logarithmic phase (this time period can vary among strains and thus should be determined experimentally). Enumerate the cells by means of hemocytometer count. Adjust the final density to 1 × 106 cells/mL in YPD supplemented with uridine.

3.6. Infection of Catheter

1. Instill 700 μL of the fungal inoculum in the catheter using a sterile syringe and the stopcock. This volume should fill the catheter lumen (see Notes 6 and 7). 2. Allow the inoculum to dwell for 6 h, then withdraw or flush the catheter. Lock the catheter with same volume of sterile heparinized saline (heparin 100 U/mL, 0.15 M NaCl).

3.7. Lock Treatment of Catheter (Optional)

1. Prepare antifungal drugs or other agents to be tested in sterile saline (0.15 M NaCl). 2. After 24 h of biofilm growth, withdraw or flush the heparinized saline from the catheter. 3. Instill the drug (700 μL) in the catheter with a sterile syringe and lock in place (see Note 8).

3.8. Harvesting the Catheter

1. Sacrifice animals by CO2 asphyxiation. Typical collection times are 24 h after infection or 24 h after treatment administration (see Note 8). 2. Aseptically remove the catheter from the animal. Collect the proximal catheter segment (approximately 8 cm). 3. Gently place the proximal catheter tip (that was inserted in the animal) on sterile gauze. Allow the catheter fluid to drain the length of the catheter by capillary action (see Note 9).

40

Fungal Biofilm Catheter Model

553

4. Collect the proximal segment of catheter that was inserted in to the animal (approximately 2 cm in length). This segment can be prepared for microbiological enumeration, microscopy, or nucleic acid collection. 3.9. Endpoint Determination

1. Place the catheter section in 1 mL sterile saline.

3.9.1. Microbiological Counts (Optional)

3. To ascertain the extent of disease dissemination, remove the kidneys or other internal organs from the animal. Place in a suitable volume of saline and homogenize.

2. Sonicate the sample for 10 min and vigorously vortex for 30 s.

4. Plate serial dilutions (1:10) of the catheter fluid and organ material on SDA plates and incubate for 24 h at 30°C. 5. Enumerate fungal colony counts as an estimate of fungal viable burden per organ. 3.9.2. Fluorescent or Confocal Microscopy (Optional)

1. Cut the catheter segment perpendicular to the catheter length with an 11-blade scalpel into multiple 2–3-mm-long “doughnut” segments. 2. Stain the catheter segments with fluorescent probes; FUN1 (50 μM), concanavalin Alexa Fluor 488 conjugate (200 mM) or calcofluor white (22.5 μg/mL) at 30°C for 30 min in the dark. 3. Place catheter segments on the coverslip of a glass-bottom petri dish with the cut edge against the coverslip. Image the luminal surface of the catheter by fluorescent or confocal microscopy using the light source and filters appropriate for the selected dyes (5).

3.9.3. Scanning Electron Microscopy (Optional)

1. Cut the catheter segment perpendicular to the catheter length with an 11-blade scalpel into multiple 2–3-mm-long “doughnut” segments. 2. Place segments in fixative (1% glutaraldehyde, 4% formaldehyde in PBS) for 16 h at 4°C. 3. Gently remove fixative and add 1 mL PBS for 10 min to wash samples. 4. Place samples in osmium tetroxide (1% in PBS) for 30 min (see Note 10). 5. Gently remove osmium tetroxide and add 1 mL PBS for 10 min to wash samples. 6. Dehydrate samples by treating samples to a series of ethanol washes (30% for 10 min, 50% for 10 min, 70% for 10 min, 95% for 10 min, and 100% for 10 min). 7. Use critical point drying according to instruction to accomplish final desiccation. Our protocol uses three 10-min CO2 soaks prior to achieving critical point.

554

J.E. Nett et al.

Fig. 2. Scanning electron micrographs of a Candida albicans biofilm on a rat venous catheter. Catheter segments were harvested, processed, and imaged as described in Subheading 3.9.3. The image at ×50 magnification (a) shows the biofilm attached to the luminal catheter surface. At ×1,000 magnification (b), hyphae, yeast, and extracellular matrix of the biofilm can be visualized.

8. Section catheter segments lengthwise and mount the specimens on aluminum stubs with the luminal side visible. 9. Coat samples with gold appropriate for scanning electron microscope using a sputter coater. Our protocol coats samples for 2.5–3 min. 10. Image the luminal surface of catheter samples using scanning electron microscopy (Fig. 2) (5). 3.9.4. Nucleic Acid Collection (Optional)

1. Flash freeze catheter segments with liquid nitrogen in AE buffer (50 mM sodium acetate, pH 5.2, 10 mM EDTA) (see Note 11). 2. Cells from two to five catheters which have been in place for 12–24 h may be pooled to yield higher quantities of RNA (see Note 12). 3. Isolate RNA using the hot phenol method (5).

4. Notes 1. Prior to performing the catheter placement procedure, individuals should be trained in small animal surgery techniques. 2. The procedure that is described can be completed by an individual; however, it can be helpful to include an assistant to make tools and the device readily available when needed during the procedure.

40

Fungal Biofilm Catheter Model

555

3. We do not immunosuppress the animals prior to catheter insertion and biofilm infection. For investigation of host response, immunosuppression could be considered. 4. We found that shaving the animal prior to surgery helps prevent contamination of the catheter with fur or skin bacteria, reducing chances of superficial infection. 5. The 24 h period prior to inoculation allows a conditioning period for deposition of host protein on the catheter surface, enhancing adherence and biofilm formation. 6. The inoculum of cells is critical for biofilm formation. Using lower concentrations of cells typically does not lead to a mature biofilm, perhaps related to quorum sensing (15). If a smaller biofilm is desired, examining an early time point is recommended rather than decreasing the inoculum. 7. The model uses direct inoculation of the catheter lumen to initiate infection and biofilm formation. This method produces reliable formation of biofilm on the luminal catheter surface. To represent a hematogenous source of infection, an alternative method of inoculation, such as tail vein inoculation, may be used. However, this method is less well studied and may not necessarily produce a biofilm on the luminal surface. 8. We have not established a maximal duration of catheter insertion but have had catheters successfully placed for up to 72 h. The animals appear healthy and we see no reason why this duration may not be substantially lengthened. 9. Draining the blood from the catheter prior to imaging allows easier viewing of the Candida biofilm. In the absence of this step, blood in the catheter may clot and obscure the biofilm. Draining also removes nonadherent cells prior to microbiological enumeration. 10. Osmium tetroxide is toxic and should only be used in a hood with protective gloves, lab coat, and eye wear. Proper disposal is required. 11. Catheter sections can be flash frozen in RNA later; however, RNA yields and subsequent gene expression patterns were similar to those frozen in AE buffer. 12. The total Candida RNA yield obtained varies among catheters but is approximately 1 μg per catheter tip.

Acknowledgement This work was supported by the National Institutes of Health (RO1 AI073289-01).

556

J.E. Nett et al.

References 1. Chandra, J., Kuhn, D. M., Mukherjee, P. K., Hoyer, L. L., McCormick, T., and Ghannoum, M. A. (2001) Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. Journal of Bacteriology 183, 5385–5394. 2. Hawser, S. P., Baillie, G. S., and Douglas, L. J. (1998) Production of extracellular matrix by Candida albicans biofilms. Journal of Medical Microbiology 47, 253–256. 3. Ramage, G., Vandewalle, K., Wickes, B. L., and Lopez-Ribot, J. L. (2001) Characteristics of biofilm formation by Candida albicans. Rev Iberoam Micol 18, 163–170. 4. Kojic, E. M., and Darouiche, R. O. (2004) Candida infections of medical devices. Clinical Microbiology Reviews 17, 255–267. 5. Andes, D., Nett, J., Oschel, P., Albrecht, R., Marchillo, K., and Pitula, A. (2004) Development and characterization of an in vivo central venous catheter Candida albicans biofilm model. Infection and Immunity 72, 6023–6031. 6. Mukherjee, P. K., Mohamed, S., Chandra, J., et al. (2006) Alcohol dehydrogenase restricts ability of the pathogen Candida albicans to form a biofilm on catheter surfaces through an ethanol-based mechanism. Infection and Immunity 74, 3804–3816. 7. Nobile, C. J., Nett, J. E., Hernday, A. D., et al.,(2009) Biofilm matrix regulation by Candida albicans Zap1. PLoS Biology 7, e1000133. 8. Uppuluri, P., Nett, J., Heitman, J., and Andes, D. (2008) Synergistic effect of calcineurin

9.

10.

11.

12.

13.

14.

15.

inhibitors and fluconazole against Candida albicans biofilms. Antimicrob Agents Chemother 52, 1127–1132. Nett, J., and Andes, D. (2006) Candida albicans biofilm development, modeling a hostpathogen interaction. Current Opinion in Microbiology 9, 340–345. Nikawa, H., Nishimura, H., Hamada, T., Kumagai, H., and Samaranayake, L. P. (1997) Effects of dietary sugars and, saliva and serum on Candida biofilm formation on acrylic surfaces. Mycopathologia 139, 87–91. Nett, J. E., Sanchez, H., Cain, M. T., and Andes, D. R. (2010) Genetic basis of Candida biofilm resistance due to drug-sequestering matrix glucan. The Journal of Infectious Diseases 202, 171–175. Nobile, C. J., Schneider, H. A., Nett, J. E., Sheppard, D. C., Filler, S. G., Andes, D. R., and Mitchell, A. P. (2008) Complementary adhesin function in C. albicans biofilm formation. Curr Biol 18, 1017–1024. Nett, J. E., Lepak, A. J., Marchillo, K., and Andes, D. R. (2009) Time course global gene expression analysis of an in vivo Candida biofilm. The Journal of Infectious Diseases 200, 307–313. Nett, J., Lincoln, L., Marchillo, K., and Andes, D. (2007) Beta-1,3 glucan as a test for central venous catheter biofilm infection. The Journal of Infectious Diseases 195, 1705–1712. Hogan, D. A. (2006) Talking to themselves: autoregulation and quorum sensing in fungi. Eukaryotic Cell 5, 613–619.

Chapter 41 Orogastrointestinal Model of Mucosal and Disseminated Candidiasis Karl V. Clemons and David A. Stevens Abstract Animal models of infection are invaluable tools in studies of pathogenesis, immunological response, and for the testing of experimental therapeutics, which cannot be done in humans. Murine models of infection are used most often for these studies and provide numerous advantages, including availability of immunological reagents, many strains with defined genetics, and ease of handling and cost considerations. Here we describe a model of orogastrointestinal candidiasis. Outbred mice are immunosuppressed using weekly doses of 5-fluorouracil to induce neutropenia and damage the mucosal epithelial layer, and are also maintained on a broad-spectrum antibiotic regimen to reduce secondary bacterial infection. Mice are infected orally to allow for the colonization of Candida albicans on the mucosal surfaces of the tongue, esophagus, stomach, small intestine, and cecum. Within 5 days, yeast disseminate from the gastrointestinal tract, to establish sites of infection in the kidneys and liver. Utilizing colony-forming units (CFU) recovered from specific tissues as the parameter for severity of infection, various therapeutic interventions can be examined for efficacy and capacity to eliminate colonization or disseminated infection. Studies of comparative virulence, host response, and pathogenesis are also possible using this model. Key words: Candidiasis, Murine models, Mucosal candidiasis, Orogastrointestinal candidiasis, Candida albicans

1. Introduction Mucosal candidiasis is often associated with specific patient populations, particularly those that have an immunodeficiency, such as those with AIDS or cancer chemotherapy patients. Patients with AIDS show heavy colonization of the oral and esophageal mucosa, but dissemination to other body sites, and establishment of infection, from the mucosa occurs relatively rarely (1). In contrast, disseminated candidiasis occurs frequently in cancer chemotherapy

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_41, © Springer Science+Business Media, LLC 2012

557

558

K.V. Clemons and D.A. Stevens

patients and has been thought to arise as a result of translocation of the yeast from sites of mucosal colonization into the bloodstream (2, 3). A number of murine models of mucosal candidiasis have been described using immunodeficient SCID mice, antibiotic-treated mice, neonatal mice, and immunosuppressed mice (corticosteroid suppression, cyclophosphamide, methotrexate, etc.) (reviewed in (4–7)). Some reports of candidal gastrointestinal disease in mouse models mimicking that in cancer patients used neutropenia and immunosuppression to try to achieve dissemination, but used death as an end point. When we studied these, we found many of the deaths were due to disseminated bacterial infection. In our own work on antifungal therapeutics, we noted that suitable models for use in studies of antifungal treatment efficacy were lacking and worked to develop a standardized model of mucosal orogastrointestinal candidiasis due to Candida albicans that could be used for evaluating antifungal therapeutics. Because of the nature of the diseases in humans as described above, we developed two separate models of orogastrointestinal candidiasis. One model emulates patients with AIDS and is done using immunodeficient SCID mice (8, 9). In this model, no dissemination of C. albicans from the gut occurs. The second model standardized in our laboratory is one emulating neutropenic cancer chemotherapy patients and is done using immunosuppressed outbred mice (10). This model results in dissemination of C. albicans from the gut to the visceral organs and establishes stable colonization of the mucosal surfaces of the tongue, esophagus, stomach, small intestine, and cecum. Colonization and dissemination are demonstrable as early as day 3 postinfection, peaking between day 10 and 15 postinfection (10). We have used each of these models in preclinical drug trials and found them to have utility. Here we describe the performance of the model of mucosal candidiasis that results in dissemination of yeast from the gut to establish infection in the kidneys and liver. A broad-spectrum antibiotic regimen is initiated prior to infection and maintained for the duration of the experiment to reduce secondary bacterial infection that could interfere with subsequent results. Mice are immunosuppressed with weekly doses of 5-fluorouracil beginning 2 days before infection to induce the neutropenia and also cause damage to the mucosal epithelial layer, which is necessary for the yeast to translocate across the intestinal tract into the bloodstream (11). Utilizing this model, we have demonstrated its potential for use in evaluating antifungal therapy, showing the efficacy of itraconazole therapy in reduction of fungal burdens from the various tissues assayed (10).

41

Orogastrointestinal Candidiasis Model

559

2. Materials 1. Five-week-old female CD-1 mice from the virus antibody-free colony (VAF) purchased from Charles River Laboratories (see Note 1). 2. Antibiotics: gentamicin, clindamycin, vancomycin, and imipenem/cilastin, all suitable for injection (see Note 2). 3. 5-Fluorouracil (5-FU) for injection (see Note 3). 4. Candida albicans culture (see Note 4). 5. Sabouraud dextrose (50 mg/L) (SDAc).

agar

plates

with

chloramphenicol

6. Synthetic Amino Acid Medium Fungal (SAAMF) (12) (see Note 5). To make 2× SAAMF medium, prepare SAAMF I (see Note 6) and SAAMF II (see Note 7) solutions. Add SAAMF I solution to SAAMF II solution and mix. Add 2 mL Mineral Solution B (see Note 8). Add 100 mL BME vitamins + biotin solution (see Note 9). Stir to mix. Titrate to pH 7.4 by slowly adding drops of 10 N NaOH. Make volume up to 1 L with dH2O. Filter sterilize and store at 4°C (see Note 10). Dilute 1:2 with sterile dH2O for use as culture medium. 7. Yeast nitrogen base (YNB) with 0.5% glucose. Make as a 10× solution: 6.7 g YNB and 5 g glucose in 100 mL dH2O. Filter sterilize and store at 4°C. Dilute to 1× for use as a culture medium. 8. Sterile 100-mL Erlenmeyer flasks with cotton plugs. 9. Incubator shaker. 10. Hemacytometer. 11. Sterile calcium alginate swabs (Fisherbrand®, Ultrafine Aluminum Applicator Swab) and sterile cotton tipped swabs. 12. Tuberculin syringes and 26-G needles, and 20-mL syringes and 18-G needles. 13. Sterile saline with 100 U/mL penicillin and 100 μg/mL streptomycin added. 14. Sterile phosphate buffered saline (pH 7) and sterile water. 15. Dissecting instruments: dissecting scissors and forceps. 16. Copland jar with 70% ethanol to dip scissors and forceps into and a squeeze bottle of 70% isopropanol used to wet the fur. 17. Sterile tubes used to make dilutions of tissue homogenates. 18. Sterile 100 × 15-mm petri plates and 60 × 15-mm petri plates. 19. Mechanical tissue homogenizer (e.g., Tissumizer, Tekmar) with a probe for 5-mL volumes.

560

K.V. Clemons and D.A. Stevens

3. Methods Because laboratory animals are used in this model, it is critical to obtain approval for studies of this type from the animal care and use committee and likely also the biological use committee of the home institution. The requirements for housing, as well as specialized husbandry of the animals, should be discussed and organized with the attending Veterinarian and Animal Care staff. In addition, performance of the experiment requires antibiotic and immunosuppressive treatments of the mice, as well as preparation of the C. albicans inoculum at the same time. Careful planning is necessary to coordinate these activities between laboratory personnel and Animal Facility personnel. Overall, the performance of the orogastrointestinal model of candidiasis described in the methods section is labor intensive over the 18 days of each experiment and requires the coordination of activities within the laboratory and also within the Animal Facility. We routinely end the model 15 days after infection and determine the colony-forming units (CFU) in the various tissues. This results in 7 samples per mouse requiring homogenization, dilution, and plating. The involvement of three or more laboratory personnel facilitates these activities to reduce the work load on any one individual and make it possible to perform larger experiments. Preparation of materials, pre-labeling of plates and dilutions tubes, and organization of activities prior to determination of CFU are critical. 3.1. C. albicans Inoculum Preparation

1. Four days prior to infection, remove C. albicans from long-term storage and streak for isolation onto SDAc plates (100 × 15 mm) and incubate for 2 days at 35°C. 2. Use a sterile loop to transfer the organism to sterile 100-mL Erlenmeyer flasks containing 25 mL of liquid medium (e.g., 1× SAAMF or 1× YNB), and incubate with shaking (140 rpm) at 35°C for 48 h. 3. On the day of infection, harvest the organism by centrifugation at 1,000 × g for 15 min at room temperature, and wash twice by centrifugation in sterile saline. 4. Suspend the pelleted yeast in saline and count using a hemacytometer. Make dilutions of the inoculum in sterile water containing antibiotics to attain a final number of >5 × 107 yeast cells per mL. One hundred milliliters of this suspension is placed in a sterile water bottle for subsequent ingestion by the mice (see Note 11). 5. Confirm inoculum viability by plating samples of tenfold serial dilutions (undiluted through to 10−7) onto SDAc plates (100 × 15 mm) (see Note 12). Incubate plates at 37°C for 24–48 h, enumerate the colonies, and calculate the number of yeast per mL in the original inoculum.

41

3.2. Antibiotic and 5-FU Treatment of Mice

Orogastrointestinal Candidiasis Model

561

1. Start the antibiotic regimen 3 days prior to infection. Replace the standard drinking water with the prepared drinking water containing gentamicin (0.2 mg/mL), clindamycin (1 mg/mL), and vancomycin (1 mg/mL). Provide freshly prepared antibiotic containing drinking water daily throughout the experiment. Using a tuberculin syringe and 26 G needle, inject the imipenem/cilastin subcutaneously for the first 3 days and then intraperitoneally thereafter (see Note 2). 2. Administer the first dose of 5-FU, given intravenously using a tuberculin syringe with a 26 G needle, 2 days prior to infection(see Note 13). Weigh mice and calculate the dose of 5-FU so that 200 mg/kg body weight is administered. Subsequent doses are administered every 7 days thereafter and are also based on body weight.

3.3. Infection of Mice

1. The water bottles are removed for 8 h from each cage of mice to be infected. At that time, water bottles containing the 100 mL of inoculum suspension of >5 × 107 CFU/mL of C. albicans and antibiotics are put into place. The mice are allowed to drink from this suspension for 24 h. 2. After the 24 h of allowing the mice to drink the water containing the yeast, remove water bottles containing the inoculum suspension, and replace with drinking water containing antibiotics. This is now considered day 0 of infection.

3.4. Sampling of Tissues for Determination of Yeast Burdens

1. End the experiment on an appropriate day (see Note 14). 2. Euthanatize each mouse using method approved by the Animal Care and Use committee. We use CO2 asphyxia to euthanatize mice at our institution. 3. Wet the fur on the abdomen of the animal with 70% isopropanol and open the peritoneal cavity along the midline using iris scissors and forceps dipped in the ethanol. First, cut the skin and pull to expose peritoneal wall. Cut through peritoneum at the level of the intestines. Cut toward the ribcage. Cut the lateral sides of the ribcage and lift rib cage up and out of the way to expose the thoracic cavity. 4. Tissues and organs are removed from each mouse in the same order each time: esophagus, stomach, small intestine, cecum, liver, and kidneys (see Note 15). The tongue is sampled last. 5. Remove the esophagus by locating the stomach and gently pulling it down enough to expose esophagus coming from stomach. Gently move the heart and lungs, as well as the liver to expose as much of the total length of the esophagus as possible. Cut the longest piece (more than 1 cm) that can be seen, by cutting the upper end of esophagus near throat (not stomach end). Gently pull stomach out of cavity and about

562

K.V. Clemons and D.A. Stevens

7 cm of small intestine. Gently tease away excess mesentery tissue away from stomach and intestine and place these tissues into an empty petri plate. Place wooden stick with 1-cm mark at juncture of stomach and esophagus and measure 1 cm of the esophagus away from the stomach. Cut the 1-cm sample of the esophagus away from the stomach and place the tissue in 5 mL saline with penicillin and streptomycin in a labeled tube. 6. Remove the stomach from the small intestine at the duodenal bulb. Place the stomach in a sterile petri plate. Open the stomach by cutting starting at the duodenal bulb until the stomach lays out flat. Remove stomach contents by rinsing the walls of the stomach with sterile water using a 20-mL syringe and an 18-G needle. Place the stomach into a labeled tube with 5 mL of saline with penicillin and streptomycin. Keep syringe and needle sterile. 7. For the small intestine, measure 5 cm from the cut end. Remove the 2.5-cm section distal to the duodenal bulb and place in a labeled tube containing 5 mL of saline with penicillin and streptomycin. 8. The cecum is a sac-like structure found at the juncture of the small and large intestine. Using forceps, pull the entire cecum out of the peritoneal cavity. Using the marked wooden stick, measure 1 cm from the beginning of the cecum in a distal direction, remove the 1 cm of tissue and place the tissue in a labeled tube with 5 mL saline with penicillin and streptomycin. It is not necessary to rinse away the lumenal contents from the cecum. 9. Remove the entire liver, and place in a 60 × 15-mm sterile petri plate. Weigh the plate containing the tissue to the milligram level. Remove the liver to a labeled tube containing 5 mL saline with penicillin and streptomycin. Reweigh the empty plate and determine the wet weight of the organ. 10. Remove both kidneys and determine wet weight as described in step 9. Place the kidneys in a labeled tube containing 5 mL saline with penicillin and streptomycin. 11. The tongue is sampled by swabbing using a calcium alginate swab (see Note 16). Using sterile forceps, pull the tongue to expose the dorsal and ventral surfaces. Pre-prepare labeled tubes containing 0.4 mL PBS. Moisten the swab with the PBS and rub vigorously over the exposed surfaces of the tongue. Place the swab into the tube of PBS and set aside for at least 1 h. 3.5. Homogenization of the Tissues and Plating for CFU Determination

1. Homogenize each organ using a mechanical homogenizer to obtain a smooth suspension of dispersed tissues (see Note 17). 2. Each tissue homogenate is serially diluted in three tenfold steps (i.e., 1:10 dil.: 0.5 mL homogenate into 4.5 mL of sterile saline with penicillin and streptomycin).

41

Orogastrointestinal Candidiasis Model

563

3. Plate samples of homogenate and dilutions in duplicate on SDAc (100 × 15 mm). 4. Incubate dried plates at 35°C for 24–48 h and enumerate colonies. Plates with 30–300 colonies provide the most accurate counts. 5. Calculate CFU in the tissue sample based on the colony count and back calculate to determine the CFU per tissue sample or organ. 6. Mix the tubes containing the calcium alginate swabs made from the tongue on high speed on a vortex mixer to facilitate release of yeasts. Remove the swab and discard. 7. Make three tenfold serial dilutions (i.e., 0.1 mL sample + 0.9 mL saline with penicillin and streptomycin). 8. Plate 50 μL samples of each dilution in duplicate onto SDAc plates (100 × 15 mm). Plates can be divided into quadrants and four samples placed onto a single plate. 9. Incubate plates as described in step 4. 10. Enumerate the number of colonies and calculate the CFU per mL.

4. Notes 1. Mice are housed five mice per cage, and we use ten mice to comprise each group (i.e., control or treatment) in an experiment. All caging equipment, bedding (hardwood chip), and food should be sterilized prior to use. The drinking water provided to the animals will contain antibiotics (see Note 2) in sterile water. In addition, because the mice will be severely immunosuppressed, the use of micro-isolator caging or positive pressure laminar-flow housing is recommended to reduce potential secondary bacterial infection. Caging should be changed at least twice weekly and animals handled using clean latex gloves or surgical gloves. We have chosen to use outbred female CD-1 mice in our studies. However, there is no reason that male CD-1 mice could not be used. Should a different strain of mice (e.g., BALB/c, C57BL/6) be needed for specific studies, the investigator will need to perform pilot studies. We have noted in the course of our research that BALB/c mice are more sensitive to the 5-FU dose compared to CD-1 mice, and they are also more sensitive to the high concentrations of antibiotics used. Thus, it would be necessary to empirically determine appropriate dosages of 5-FU and antibiotics for use with another strain of mouse.

564

K.V. Clemons and D.A. Stevens

2. The antibiotic regimen used in our studies was determined empirically to be high dose and broad spectrum (10). This prevents the confounding effects of severe disseminated bacterial infections. It consists of gentamicin (0.2 mg/mL), clindamycin (1 mg/mL), and vancomycin (1 mg/mL) added to sterile drinking water. It is assumed that mice drink 5 mL water/day. The antibiotic drinking water is made fresh daily and placed in sterile water bottles. We have found that 125 mL in each bottle will suffice for five mice for 24 h. Imipenem/cilastin (5 mg/mouse) is given by daily subcutaneous injection for 3 days and then intraperitoneally thereafter. The route of imipenem/cilastin is changed to intraperitoneal to ensure absorbance of the antibiotic, which precipitates rapidly, by the serosal surfaces in the abdomen. This is done because the most severe and critical neutropenia begins 3 days after administration of 5-FU and is maintained throughout the remainder of the experimental period. Antibiotic treatment begins 3 days prior to infection and continues throughout the duration of the experiment. We obtain these antibiotics from our hospital pharmacy, but they can also be obtained from veterinary supply houses. 3. 5-FU is a hazardous agent, requiring precautions. The primary investigator, giving treatments to the mice, should wear personal protective gear in the form of eye protection, gloves, mask, and fluid repellant laboratory gown and should avoid inhalation or contact with the drug. Dispose of the residual 5-FU as per institutional policies for disposal of hazardous drug waste. 4. We recommend that archival stocks of the strain of C. albicans to be used are kept frozen at −80°C in 40% glycerol. Multiple vials should be frozen, and each vial used a minimum of times to avoid repeated freezing and thawing. We have found that storing C. albicans in this manner has maintained the virulence level of the strain used in our studies, strain #5, for well over 20 years. This strain is available from us to interested investigators. 5. The original recipe for Synthetic Amino Acid Medium Fungal (SAAMF) (12) called for the addition of Tris as a buffer. Because Tris is inhibitory to the growth of some organisms, bacteria, and fungi, the recipe was modified by removing the Tris and increasing the MOPS (4-morpholinepropanesulfonic acid) in the formulation. Although somewhat complex and difficult to prepare, we have found the modified SAAMF to be an excellent defined medium, which readily supports the growth of fungi. 6. To prepare SAAMF I: Add 9.7 g SAAMF I dry ingredients (20× mix: 21.0 g L-arginine, 11.6 g L-lysine, 6.2 g L-histidine, 7.2 g L-tyrosine, 2.0 g L-tryptophan, 6.4 g L-phenylalanine, 3.0 g L-methionine, 9.6 g L-threonine, 10.4 g L-leucine, 10.4 g

41

Orogastrointestinal Candidiasis Model

565

L-isoleucine, 9.2 g L-valine) to a large beaker or flask. Add 450 mL distilled water. Stir (midrange speed setting) and heat gently on a hot plate until the powder dissolves. Add ~12 mL of 10 N NaOH until the solution is clear.

7. To prepare SAAMF II: Weigh 56.04 g SAAMF II dry ingredients (20× mix: 400 g D-glucose, 30.0 g fumaric acid, 20.0 g pyruvic acid (Na salt), 10 g K2HPO4·3H2O, 50.4 g L-glutamine, 20.0 g L-asparagine, 20.0 g L-proline, 10.0 g glycine) and place in 1-L Erlenmeyer flask. Add 0.5 g ammonium acetate and 69.08 g MOPS. Add 200 mL distilled water and stir until almost all are dissolved. 8. Mineral B solution is prepared using two different solutions (Parts 1 and 2). To prepare Part 1 solution, add 6.75 g FeCl3 · 6H2O, 2.0 g Zn SO4 · 7H2O and 0.90 g MnSO4·4H2O to 12 mL conc. HCl, and then bring to a final volume of 25 mL with dH2O. To make Part 2 solution, add 1.10 g CaCl2 ·6H2O and 20.33 g MgCl2 · 6H2O to 0.5 mL conc. HCl, and then bring to a final volume of 100 mL with dH2O. For the working Mineral B solution, add 1 mL Part 1 solution to 100 mL Part 2 solution. Mix and store protected from light at room temperature. This solution has a long shelf life. 9. BME + biotin solution is prepared by thawing BME vitamin solution (Gibco MEM Vitamin Solution; 100 mL) and adding 10 mg biotin per 100 mL vitamin solution. Protect from light. 10. The 2× SAAMF medium sometimes precipitates upon prolonged storage at 4°C. If this is a problem, the medium should be stored as a 1× solution. 11. In our laboratory, we have found that to reliably initiate consistent colonization and subsequent dissemination of C. albicans, the number of yeasts in the inoculum should be >5 × 107 yeast per mL, and we most often use >108 yeast per mL as the infecting inoculum. This number of yeast cells settles rapidly in the water bottle resulting in a higher actual number of yeast per mL that the mice ingest while drinking. We have noted no aversion by the mice to drinking the suspension of yeasts. Because the actual inoculum can vary from experiment to experiment, it is critical to include controls in each experiment for comparison to experimental groups. 12. In our laboratory, we plate 50 μL samples of each dilution in duplicate from 10−5 through to 10−7. 13. Only laboratory personnel proficient in intravenous injection should perform the injections to reduce the potential of accidental needlesticks and exposure to 5-FU; mice should be restrained during injection of 5-FU. Each mouse receives a dose of 200 mg 5-FU/kg body weight; we do not dilute the 5-FU, and thus, the volume injected is dependent on body

566

K.V. Clemons and D.A. Stevens

weight. Mice are dosed every 7 days beginning 2 days prior to infection. Weight loss of animals is expected to occur during the course of the experiment as 5-FU at 200 mg/kg is just below a lethally toxic dose. In accord with the institutional requirements and under the advice of the attending veterinarian, criteria for euthanasia should be determined and followed closely. Weight loss of greater than 30% (percentage may differ at individual institutions) is usually considered a basis for euthanasia. 14. We have determined that day 15 postinfection is an appropriate time to end the experiment and to determine the number of yeast remaining in the various tissues. Termination of the experiment at this time allows sufficient progression and dissemination to be useful in studies of antifungals or immunomodulators. 15. It is necessary to obtain standardized samples of the various tissues of the gastrointestinal tissues, particularly when preclinical trial drug studies are done, which base efficacy on comparative CFU remaining in a tissue. To do this, we decided upon the length of the tissue rather than the weight. Thus, a way to measure the length of the tissues is necessary. For convenience, we use the wooden handles of cotton-tipped applicators. One is marked to show a 1 cm length and is used for measurements of the esophagus and cecum; a second is marked to denote 2.5 cm and again at 5 cm and is used to measure the sample of the small intestine. 16. We have found that vigorous swabbing of the tongue surfaces is an effective way to sample the tissue. It is important to rotate the swab while rubbing it over the surface of the tissue. Whitish plaques of yeast form particularly on the ventral surface and are easily visible, usually as early as days 3–5 of infection. The calcium alginate is soluble in PBS improving the release of the yeasts into suspension for plating. Vigorous mixing using a vortex mixer for 20–30 s facilitates the release of the yeast. 17. The tissues of the intestinal tract are fibrous, muscular, or both and difficult to homogenize. Thus, a mechanical homogenizer is required. We use a Tissumizer (Tekmar) with a STN probe, which is small enough to be placed into a test tube containing 5 mL of sample. Other manufacturers’ mechanical homogenizers would also be suitable. The tissue is homogenized using a speed setting of approximately 10,000 rpm, moving the probe up and down into the sample until a smooth suspension is attained. This usually takes 20–45 s. A higher speed is not used because of excess foam formation, which interferes with the subsequent dilution and plating of the homogenate. To prepare the probe for the next tissue, we immerse it in 40 mL 70% isopropanol and run at a lower speed for 10–15 s, allow the probe to drain and remove any attached fibrous tissues using sterile forceps,

41

Orogastrointestinal Candidiasis Model

567

and follow this with two consecutive rinses in tubes containing 40 mL sterile water. Allow the probe to drain and then homogenize the next sample. The esophagus and small intestine may take longer as the small samples make it necessary to check that the tissues are being dispersed and are not just floating in the tube or caught in probe. References 1. Janoff, E N, and Smith, P D. (1988) Perspectives on gastrointestinal infections in AIDS. Gastroenterol Clin North Am 17: 451–463. 2. Anaissie, E, and Pinczowski, H. (1993) Invasive candidiasis during granulocytopenia. Recent Results Cancer Res 132: 137–145. 3. Anaissie, E J, and Bodey, G P. (1990) Fungal infections in patients with cancer. Pharmacotherapy 10: 164S–169S. 4. Cole, G T, Halawa, A A, and Anaissie, E J. (1996) The role of the gastrointestinal tract in hematogenous candidiasis: from the laboratory to the bedside. Clin Infect Dis 22 (Suppl 2): S73–88. 5. Samaranayake, Y H, and Samaranayake, L P. (2001) Experimental oral candidiasis in animal models. Clin. Microbiol. Rev. 14: 398–429. 6. Allen, C M. (1994) Animal models of oral candidiasis. A review. Oral Surg Oral Med Oral Pathol 78: 216–221. 7. Capilla, J, Clemons, K V, and Stevens, D A. (2007) Animal models: an important tool in mycology. Med Mycol 45: 657–684.

8. Clemons, K V, and Stevens, D A. (2000) Treatment of orogastrointestinal candidosis in SCID mice with fluconazole alone or in combination with recombinant granulocyte colonystimulating factor or interferon-gamma. Med Mycol 38: 213–219. 9. Clemons, K V, and Stevens, D A. (2001) Efficacy of ravuconazole in treatment of mucosal candidosis in SCID mice.Antimicrob Agents Chemother 45: 3433–3436. 10. Clemons, KV, Gonzalez, GM, Singh, G, Imai, J, Espiritu, M, Parmar, R, and Stevens, D A. (2006) Development of an orogastrointestinal mucosal model of candidiasis with dissemination to visceral organs. Antimicrob Agents Chemother 50: 2650–2657. 11. Koh, A Y, Kohler, J R, Coggshall, K T, Van Rooijen, N, and Pier, G B. (2008) Mucosal damage and neutropenia are required for Candida albicans dissemination. PLoS Pathog 4: e35. 12. Hoeprich, P, and Finn, P. (1972) Obfuscation of the activity of antifungal antimicrobics by culture media. J Infect Dis 126: 353–361.

Chapter 42 A Nonlethal Murine Cutaneous Model of Invasive Aspergillosis Ronen Ben-Ami and Dimitrios P. Kontoyiannis Abstract Cutaneous models allow researchers to dynamically monitor infection by visually determining changes in skin lesion dimensions over time. We present a nonlethal cutaneous model of invasive aspergillosis (IA) in nude BALB/c mice and describe its use to determine altered virulence in Aspergillus strains and response to antifungal drugs. In addition, as an example of the versatility of this model, we show how the cutaneous model can be used to assess the effect of IA on angiogenesis in vivo. Key words: Aspergillosis, Cutaneous, Model, Virulence, Drug, Angiogenesis

1. Introduction Cutaneous infection models have been used extensively to study the pathogenesis and in vivo response to antibacterial agents of Gram-positive bacteria (1, 2). The potential benefits of these models include their technical simplicity, reproducibility, and the ability to visually monitor the infected tissue over time. Moreover, because cutaneous models are nonlethal, they allow prolonged monitoring and repeated manipulations of infected animals. Cutaneous aspergillosis occurs in 5–10% of invasive aspergillosis (IA) cases, making the skin the second most commonly involved site in aspergillosis after the lungs (3, 4). Here, we describe a nonlethal experimental model of soft tissue IA in murine thighs, which allows dynamic monitoring of tissue fungal burden by the assessment of cutaneous lesion dimensions. This model is highly adaptable and can serve as a platform for studies of virulence and antifungal drug efficacy. Furthermore, as an example of the versatility of the cutaneous IA model, we describe its use in determining the effects of Aspergillus fumigatus on angiogenesis in vivo.

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_42, © Springer Science+Business Media, LLC 2012

569

570

R. Ben-Ami and D.P. Kontoyiannis

2. Materials 2.1. Aspergillus Culture and Inoculum Preparation

1. Yeast extract agar glucose (YAG) medium: yeast extract 5 g/L, glucose 10 g/L, agar 15 g/L, 1 mM MgCl2, trace elements 1 mL/L. Prepare in distilled water, autoclave, and allow to cool before use. Trace element solution is prepared using the following amounts per 1 L ddH2O: 100 mL 0.25 M EDTA pH 8.0, 1 g FeSO4 ⋅ 7H2O, 8.8 g ZnSO4 ⋅ 7H2O, 0.4 g CuSO4, 0.15 g MnSO4, 0.1 g Na2B4O7 ⋅ 10H2O, 0.1 g NaMoO4. 2. Phosphate-buffered saline (PBS). 3. Tween 20. 4. Drigalsky (“L”-shaped) spreaders. 5. 40-μm Nylon filters.

2.2. Animal Care, Inoculation, and Monitoring

1. Mice: 8-week-old nude (nu/nu) BALB/c mice (National Cancer Institute, Bethesda, MD) weighing 18–20 g (see Note 1). 2. Cyclophosphamide: prepare a solution in sterile saline; such that mice receive a dose of 100 mg/kg mouse body weight in 200 μL (see Note 2). 3. 1-mL Syringes and 21-G needles. 4. Drinking water containing tetracycline (1 g/L). 5. Anesthesia vaporizer system. 6. Digital calipers.

2.3. Thigh Tissue Harvesting

1. Surgical tools: scissors, forceps, scalpel, and blade. 2. 10% Formalin. 3. Collection tubes (2 mL). 4. Saline.

2.4. Determination of Tissue Fungal Burden

1. Weighing paper. 2. Acid washed 3-mm glass beads. 3. Bead mill homogenizer (Biospec). 4. Platelia galactomannan immunoassay kit (BioRad laboratories). 5. Microplate spectrophotometer (e.g., PowerWave HT, BioTek Instruments). 6. Section preparation and staining facilities.

2.5. Assessment of Antifungal Drug Therapy

1. Antifungal drug(s)—choice dependent upon study plan.

42

2.6. In Vivo Matrigel Assay

Cutaneous Model of Invasive Aspergillosis

571

1. Matrigel (BD Biosciences) 10 mg/mL in PBS. Thaw overnight on ice at 4°C. 2. Basic fibroblast growth factor (bFGF; R&D Systems); 25 μg/mL in PBS + 1 mg/mL bovine serum albumin (BSA). 3. Heparin (Fisher 1 mg/mL BSA.

Scientific);

20,000

U/mL

in

PBS +

4. Section preparation and staining facilities. 5. Microscope with digital camera. 6. ImageJ software program National Institutes of Health).

(http://rsb.info.nih.gov/ij/;

3. Methods 3.1. Aspergillus Culture and Inoculum Preparation

Perform all Aspergillus culture manipulations in a biosafety level 2 hood. 1. If using Aspergillus spores previously stored in glycerol, transfer a loopful of the suspension to a YAG plate and streak to ensure viability and purity. Incubate at 37°C for 48–72 h. 2. Collect a single Aspergillus colony using a sterile swab, resuspend in 200 μL sterile saline and spread on YAG. Place in a humid incubator at 37°C for 48–72 h, until colony is fluffy and green. 3. Prepare spore collection solution by diluting Tween 20 in sterile PBS to produce a 0.08% (v/v) solution. 4. Pipette 5 mL spore collection solution onto the Aspergillus culture plate. Tilt the plate to allow even distribution of the solution. Use a Drigalsky spreader to gently rub the surface of the colony thereby releasing the conidia into the solution (see Note 3). 5. Aspirate the conidial suspension into a 15-mL tube. 6. Wash the conidia three times with PBS by centrifugation at 1,880 × g for 5 min. 7. Filter the suspension using 40-μm nylon filters. 8. Resuspend the conidia in 3 mL sterile PBS. Determine the conidial concentration using a hemacytometer and adjust the concentration to 5 × 107 conidia/mL. This is the inoculum suspension (see Note 4). 9. Determine the conidial viability by preparing tenfold serial dilutions in sterile PBS and spreading 100 μL of each dilution on YAG plates. Incubate plates at 37°C for 36 h and count the number of colonies per plate. Calculate the proportion (percentage) of viable conidia (see Note 5).

572

R. Ben-Ami and D.P. Kontoyiannis

3.2. Animal Care, Inoculation, and Monitoring

1. House nude (nu/nu) BALB/c mice (see Note 6) in pre-sterilized, filter-topped cages and provide them with sterile (autoclaved) food and drinking water containing tetracycline. 2. Immunosuppress mice by intraperitoneal injections of cyclophosphamide (100 mg/kg) given 4 days and 1 day prior to inoculation (see Notes 7 and 8). 3. On the day of inoculation, anesthetize mice by inhalation of 2% isoflurane/oxygen using a vaporizer-chamber system (see Note 9). 4. Remove an anesthetized mouse from the isoflurane chamber and place it on a clean surface. Inject 100 μL of the conidial suspension subcutaneously into the thigh by pulling the skin away from the thigh and injecting slowly so that a bleb is formed. Mark the outline of the injection area with a marker. The bleb will remain visible for about 1 h before the suspension is absorbed (see Notes 10 and 11). Repeat for each mouse in the treatment group. 5. Inoculate additional mice with 100 μL sterile saline solution injected subcutaneously using the same technique as above. These mice represent negative controls. 6. Maintain neutropenia by repeating intraperitoneal cyclophosphamide injections (100 mg/kg) on days 2 and 5 post-infection. 7. Monitor mice for the development of skin lesions. These typically develop ~48 h after inoculation and consist of a pale patch, which may be raised and swollen, surrounded by erythema (Fig. 1).In some lesions, a necrotic area (eschar) may appear at the site of inoculation. 8. Measure the skin lesion size daily using digital calipers. Measure both width (W, smallest diameter) and length (L, largest diameter) and record the results. The skin lesion area is approximated with the ellipse area formula: Lesion area = π × 0.5 W × 0.5 L. 9. Monitor mice daily for signs of morbidity (see Note 12). Mice displaying signs of morbidity should be euthanized (see Note 13) and their death recorded as occurring on the following day (see Note 14).

3.3. Determination of Tissue Fungal Burden

1. Euthanize all mice on day 7 after inoculation (see Note 13). 2. Use sterile scissors, forceps, and scalpel to excise the infected thigh tissue, including skin and underlying thigh muscles. Do not excise bone. 3. Place excised tissue in a sterile collection tube for the determination of fungal burden by galactomannan content (Subheading 3.3.1). 4. For the purpose of histopathological examination, place thigh tissue in a collection tube containing 1 mL 10% formalin

42

Cutaneous Model of Invasive Aspergillosis

573

Fig. 1. Experimental cutaneous aspergillosis. A typical skin lesion of invasive aspergillosis in a nude BALB/c mouse 48 h after inoculation. The mouse was immunsuppressed using cyclophosphamide (100 mg/kg) 4 days and 1 day prior to inoculation, and then injected subcutaneously with 5 × 105 A. fumigatus conidia into the right thigh. Reprinted with permission of the American Society for Microbiology (11).

(Subheading 3.3.2). Immediately label collection tubes so that the animal identifier number, Aspergillus strain, drug treatment regimen, and side of the excised thigh can be traced to each sample. 3.3.1. Tissue Fungal Burden Measurement

1. Weigh each thigh tissue specimen on sterile weighing paper. Return specimen to collection tube and add 1 mL sterile saline solution and 7–8 acid washed glass beads to each tube. 2. Homogenize specimens using a bead mill homogenizer; set speed to 42 and time to 2 (approximately 20 s). 3. Transfer homogenates (without beads) to 1.5-mL microfuge tubes and centrifuge at 20,800 × g for 10 min. 4. Remove 10 μL of each supernatant and dilute 1:100 in sterile saline. Freeze undiluted homogenates at −80°C for later use. 5. Assay 300 μL of each diluted specimen using the Platelia™ galactomannan immunoassay kit following the manufacturer’s instructions (5) (see Notes 15 and 16) (Fig. 2).

574

R. Ben-Ami and D.P. Kontoyiannis

Fig. 2. Correlation between skin lesion areas and tissue fungal burden. Pearson’s coefficient was used to calculate the linear correlation between tissue fungal burden, as determined by galactomannan content, and skin lesion area in the cutaneous invasive aspergillosis model. Reprinted with permission of the American Society for Microbiology (11).

3.3.2. Histopathological Analysis

1. Remove lung specimens from 10% formalin and embed in paraffin wax. 2. Cut 3 μm sections on a microtome. 3. Stain sections with the Grocott-Gomori methenamine-silver nitrate (GMS) method to visually assess hyphal burden (see Note 17), and with hematoxylin and eosin to assess tissue damage and inflammatory response (see Notes 18 and 19).

3.4. Comparison of Aspergillus Strain Virulence

The cutaneous model is well suited for screening strains, such as those with null mutations in specific genes of interest, for altered virulence. Because the end point of this model is skin lesion size rather than mortality, screening can be performed using smaller numbers of animals than would be required if using a standard pulmonary model. For example, a sample size of five mice per group is sufficient to detect a 50% reduction in the mean lesion area with 90% power. If a significant difference is detected, we repeat the experiment two additional times for a total of 15 mice per group. 1. Immunosupress and inoculate groups of mice with different Aspergillus strains (Subheading 3.2). Typically, mutant Aspergillus strains are compared with the isogenic wild-type strains (see Note 11).

42

Cutaneous Model of Invasive Aspergillosis

575

2. Determine and record skin lesion areas daily (Subheading 3.2). 3. Kill all mice on day 7 after inoculation and excise thigh tissue for the determination of tissue fungal burdens and histopathology (Subheadings 3.4 and 3.5). 4. Compare skin lesion areas, fungal burden and histopathology among thighs inoculated with different strains (see Note 20) (Fig. 3). 3.5. Assessment of Antifungal Drug Treatment

The ability to visually monitor cutaneous lesion size over time offers an opportunity to dynamically assess the response of IA to antifungal therapy (see Note 21). 1. Assign mice into treatment groups, including a non-treatment control group. 2. Select the drugs, dosing regiments, and routes of administration required to address the experimental question. 3. Monitor and record skin lesion areas daily (Subheading 3.2). At each time point, compare lesion areas among the different treatment groups. 4. At the end of the experiment (day 7 post-infection), excise thigh tissue, determine fungal burden (Subheading 3.3.1) and compare among treatment groups.

3.6. In Vivo Angiogenesis Assay

A. fumigatus secretes a large array of secondary metabolites with diverse biological functions (6). Importantly, secondary metabolites, such as siderophores, gliotoxin, and pseurotin, are secreted by A. fumigatus during in vivo infection (7, 8) and may aid invasive growth. Because the site of infection is easily accessible, the cutaneous model allows a secondary metabolism bioassay to be applied directly to the infected tissue. As an example of this, we have modified the in vivo angiogenesis assay developed by Passaniti (9) for use with the cutaneous aspergillosis model. The assay was originally used to assess the pro- or antiangiogenic activity of a test substance in vivo. We have utilized the Matrigel assay to demonstrate the antiangiogenic activity of A. fumigatus secondary metabolites and to trace this activity to the immunosuppressive molecule gliotoxin (10). 1. Perform immunosuppression and inoculation of BALB/c mice as described in Subheading 3.2. Inject control mice subcutaneously with normal saline. 2. On day 2 after inoculation of A. fumigatus, thaw Matrigel overnight at 4°C (see Note 22). 3. On day 3 after inoculation, mix thawed Matrigel with bFGF (150 ng/mL) and heparin (64 U/mL).

576

R. Ben-Ami and D.P. Kontoyiannis

Fig. 3. Use of the cutaneous model to compare the virulence of catalase gene deletion mutants with the isogenic wild-type strain. BALB/c nude mice were inoculated simultaneously with catalase-deficient mutants and their parental wildtype strains in opposite thighs. (A) Deletion of the spore-specific catA gene was associated with significant reduction in the mean skin lesion area and in galactomannan content. (C) Site of wild-type inoculation (left arrow); site of DcatA inoculation (right arrow). (E) Failure of DcatA spores (arrows) to germinate and produce invasive hyphae was seen in GMS-stained tissue. (B) Deletion of the mycelium-specific catalase genes cat1 and cat2 was associated with a small reduction in skin lesion area and a nonsignificant reduction in tissue galactomannan content. (F) Histopathologic analysis revealed that Dcat1Dcat2 conidia germinated but formed shorter hyphal elements compared with the wild-type strain (D) (original magnification ×200). Bars and error bars represent means and standard error, respectively (ten mice per A. fumigatus strain). *p < 0.05. Reprinted with permission of the American Society for Microbiology (11).

42

Cutaneous Model of Invasive Aspergillosis

577

Fig. 4. Excision of Matrigel plug from mouse thigh. Matrigel plug excised from an uninfected (control) BALB/c mouse 5 days after implantation. Note the deep red appearance of the plug, indicating neovascular proliferation within the Matrigel.

4. Anesthetize mice by 2% isoflurane inhalation (Subheading 3.2). 5. Using a 21-G needle, inject 500 μL of the Matrigel mix subcutaneously between the Aspergillus injection site and the dorsal midline at a distance of 10 mm from the infection site (see Note 23). Similarly, inject control mice with Matrigel. 6. Kill mice at different time points after injection of the Matrigel. Growth of neovessels into the Matrigel is normally observed 72 h after Matrigel injection; therefore, we usually start killing mice 3 days after injection and at 2 days increments thereafter. 7. Excise Matrigel plugs (see Note 24) (Fig. 4), fix in 10% formalin and embed in paraffin wax. Cut 3 μm sections. 8. Stain slides with Masson trichrome stain and observe under a microscope fitted with a digital camera (see Note 25). 9. Capture images of ten randomly selected fields per specimen at ×200 magnification. Measure cell density with imageJ software program (http://rsb.info.nih.gov/ij/; National Institutes of Health) (see Note 26) (Fig. 5).

Fig. 5. Use of the cutaneous model to determine the effects of A. fumigatus on angiogenesis in vivo. The antiangiogenic effects of A. fumigatus in mice with cutaneous invasive aspergillosis were assessed using an in vivo matrigel assay. In uninfected control mice, endothelial cell migration and capillary network formation occurred 5 days after implantation of the matrigel and 7 days after implantation erythrocyte-filled lacunae formed in the matrigel. In contrast, angiogenesis was significantly suppressed in matrigel plugs extracted from A. fumigatus wild-type (Af293)-infected mice 5 and 7 days after inoculation. Plugs obtained from mice infected with a secondary metabolism-defective A. fumigatus strain (DlaeA) exhibited endothelial cell infiltration similar to that of plugs obtained from uninfected control mice. Insets show enhanced details of endothelial networks. **p < 0.001 compared to matrigel plugs obtained from uninfected control mice or from DlaeA-infected mice. Originally published in Blood (10); © the American Society of Hematology.

42

Cutaneous Model of Invasive Aspergillosis

579

4. Notes 1. Mice are housed in pre-sterilized, filter-topped cages (five mice per cage) and provided with sterile food and drinking water containing tetracycline (1 g/L). 2. The required cyclophosphamide solution concentration and volume to be prepared may be calculated as follows: Concentration (mg / mL) = 500 [average mouse weight (kg)],

Volume to be prepared (mL) = 1.2 [(number of mice)/5]. 3. Because Aspergillus conidia are hydrophobic, repeated application of the spreader may be required to harvest the conidia. 4. The conidial suspension can be prepared up to 1-day prior to inoculation without loss of efficacy. Conidia collected on the day prior to inoculation should be kept at 4–8°C; the suspension should be warmed to room temperature, filtered, and the concentration adjusted to 5 × 107 conidia/mL on the day of use. 5. The proportion of viable conidia (percent) is then calculated as follows: Percentage = (1,000 × D × CFU)/C, where D is the dilution of the suspension, CFU is the number of colony forming units counted on plate, and C is the conidial concentration (cells/mL) in the original suspension. 6. Optimal results in terms of skin lesion measurement were achieved using nude BALB/c mice (weighing 18–20 g). However, in experiments where precise monitoring of skin lesion size is not essential, it is possible to use regular BALB/c mice and shave the thigh skin area prior to inoculation (10). 7. Monitor animal weight daily. Loss of more than 10% of body weight suggests cyclophosphamide toxicity. In such cases, reduce subsequent cyclophosphamide doses by 25% and continue to monitor weight. 8. The cutaneous model is strongly dependent on neutropenia in mice (11). When first establishing the model, it is good practice to assess white blood cell counts in a subgroup of mice following two doses of cyclophosphamide. Anesthetize mice by 2% isoflurane inhalation (Subheading 3.2, step 3) and collect ~1 ml whole blood by cardiac puncture into ethylenediamine tetra acetic acid (EDTA)-containing tubes. Euthanize mice immediately after blood collection. Analyze blood for white blood cell count on a Coulter analyzer (Beckman Coulter). 9. It is essential to monitor the depth of anesthesia. Mice are sufficiently anesthetized when breathing becomes slow and rhythmic. Monitor for hypothermia during anesthesia; if mice

580

R. Ben-Ami and D.P. Kontoyiannis

are cool to the touch warm them under a heating lamp or on a warming pad. 10. Immediately record all inoculations in a table, including time and date, side (right or left), and the inoculated Aspergillus strain. 11. In some experiments, it may be desirable to inoculate both thighs simultaneously. This is especially useful when comparing mutant Aspergillus strains with isogenic wild-type strains. In general, we have found that bilateral inoculations are well tolerated by mice. However, special care must be taken to monitor for early signs of morbidity (see Note 12). 12. Morbidity is defined as one or more of the following conditions (1) rapid breathing rate accompanied by intermittent slow, labored breathing, (2) non-weight-bearing lameness, (3) hunched posture, (4) hypothermia (animal cool or cold to touch), (5) cyanosis, and (6) induration (necrosis or ulceration of the skin measuring more than 15 mm in diameter). 13. Preferred methods of euthanasia include CO2-induced asphyxiation and cervical dislocation. 14. As this is a nonlethal model, animal death occurs rarely. If dead animals are observed, the reasons might include a nonoptimized immunosuppressive regimen (e.g., excessive cyclophosphamide dose per animal weight) and failure to maintain aseptic technique during inoculation, resulting in bacterial sepsis. 15. Minimize contact of specimen with dust/air, due to the sensitivity of the Platelia test (1 ng/mL galactomannan). Any possibility of contamination during the various steps of the procedure must be prevented to avoid false-positive results. 16. The manufacturer has only validated the Platelia assay for serum; therefore, results must be presented with careful interpretation. 17. In GMS-stained tissue, hyphae appear black against a greenblue background. 18. Histopathologic parameters of fungal growth and invasiveness include the overall extent of hyphal growth, the degree of hyphal extension from subcutaneous tissue into the underlying muscle and hyphal elongation (11). 19. For some Aspergillus mutant strains with attenuated virulence, ungerminated conidia may be visible in subcutaneous tissue indicating a defect in the initiation of hyphal growth in vivo. For other mutant strains, hyphal elongation may be limited as compared to the isogenic wild-type strain. For example, we found that catalase null mutant strains show different behavior

42

Cutaneous Model of Invasive Aspergillosis

581

in this model, depending upon the morphotype-specific catalase that has been deleted (11), e.g., DcatA, which lacks conidial catalase activity, fails to germinate and produces skin lesions that are significantly smaller than those of the isogenic wildtype strain. In contrast, Dcat1Dcat2, which is deficient in hyphal catalase activity, is able to germinate but produces short, stunted hyphae in tissue (Fig. 3). 20. The virulence of Aspergillus strains in the cutaneous model may not directly correlate with virulence as determined in standard pulmonary models (11). Putative Aspergillus virulence traits may be differently expressed in different tissues; therefore, altered virulence in the cutaneous model should be validated in a standard pulmonary model of aspergillosis. 21. The activity of antifungal drugs in the cutaneous model may not necessarily parallel that of the same drugs against invasive pulmonary aspergillosis. For example, tissue drug concentrations and the interaction of antifungal drugs with local immune and inflammatory responses may differ between anatomical sites. Thus, the results of drug treatment experiments should not be translated to invasive pulmonary aspergillosis without prior validation using a pulmonary model. 22. Matrigel is liquid at 4°C but forms a gel when heated to room temperature. Therefore, Matrigel should be kept on ice at all times. Also, syringes and needles should be maintained on ice until use. 23. When warmed to body temperature, Matrigel polymerizes to form subcutaneous plugs; endothelial cells migrate into the Matrigel plugs within 48 h after injection and fully formed capillary networks can be observed after 3–4 days. 24. Excise as much of the Matrigel plug as possible, together with the surrounding soft tissue. Matrigel plugs from control (noninfected) thighs should be reddish-pink. 25. The Masson trichrome stain is useful for differentiating cells from surrounding connective tissue. Cell cytoplasm is stained pink, nuclei are stained dark-red/purple, and connective tissue (including Matrigel) appears blue. 26. In imageJ, convert images to 8-bit grayscale (Image → Type → 8 bit). Adjust the threshold value (Image → Adjust → Threshold, then move slider so that red areas correspond with endothelial cells and Apply). To measure the endothelial cell area, select Analyze and Measure.

582

R. Ben-Ami and D.P. Kontoyiannis

References 1. Craig WA. Pharmacokinetic/pharmacodynamic parameters: rationale for antibacterial dosing of mice and men. Clin Infect Dis 1998;26:1–10. 2. Bunce C, Wheeler L, Reed G, Musser J, Barg N. Murine model of cutaneous infection with gram-positive cocci. Infect Immun 1992;60: 2636–40. 3. Burgos A, Zaoutis TE, Dvorak CC, et al. Pediatric invasive aspergillosis: a multicenter retrospective analysis of 139 contemporary cases. Pediatrics 2008;121:e1286–e94. 4. Patterson TF, Kirkpatrick WR, White M, et al. Invasive aspergillosis. Disease spectrum, treatment practices, and outcomes. I3 Aspergillus Study Group. Medicine (Baltimore) 2000;79:250–60. 5. Bio-Rad PlateliaTM Apergillus EIA package insert. 2010. 6. Keller NP, Turner G, Bennett JW. Fungal secondary metabolism - from biochemistry to genomics. Nat Rev Microbiol 2005;3:937–47.

7. McDonagh A, Fedorova ND, Crabtree J, et al. Sub-telomere directed gene expression during initiation of invasive aspergillosis. PLoS Pathog 2008;4:e1000154. 8. Lewis RE, Wiederhold NP, Chi J, et al. Detection of gliotoxin in experimental and human aspergillosis. Infect Immun 2005;73:635–7. 9. Passaniti A, Taylor RM, Pili R, et al. A simple, quantitative method for assessing angiogenesis and antiangiogenic agents using reconstituted basement membrane, heparin, and fibroblast growth factor. Lab Invest 1992;67:519–28. 10. Ben-Ami R, Lewis RE, Leventakos K, Kontoyiannis DP. Aspergillus fumigatus inhibits angiogenesis through the production of gliotoxin and other secondary metabolites. Blood 2009;114:5393–9. 11. Ben-Ami R, Lewis RE, Leventakos K, Latge JP, Kontoyiannis DP. Cutaneous model of invasive aspergillosis. Antimicrob Agents Chemother 2010;54:1848–54.

INDEX A Aerosolisation MicroSprayer IA-1B® ............................................... 514 Nebulizer system........................................................ 513 safe handling, C. neoformans......................................... 68 Agrobacterium tumefaciens-mediated transformation (ATMT).................. 52, 187, 188 Alternative infection model, pathogenic fungi. See Embryonated Chicken eggs Aneuploidy, testing PCR primers................................................................ 42 primer sequences ................................................... 42, 43 Angiogenesis, in vivo assay .............................. 575, 577–578 Antifungal compounds evaluation ........................... 451–452 Antifungal drugs assessment ................................................................. 570 dry yeast granules............................................... 463, 466 HPLC measurement ................................................. 366 in vitro anti-aspergillus activity.................................. 456 immune and inflammatory response .......................... 581 lock treatment, Catheter ............................................ 552 mucosal host–Candida interaction ............................. 289 novel therapeutic strategy .......................................... 455 phenotypic evaluation ................................................ 129 Toll pathway .............................................................. 457 treatment, Drosophila ................................................. 463 and virulence.............................................................. 569 Antifungal efficacy .......................................................... 464 Antisense RNA (aRNA). See Paracoccidioides brasiliensis, antisense RNA Aspergillosis. See Invasive aspergillosis; Invasive pulmonary aspergillosis Aspergillus A. fumigatus, gene disruption (see Deletion cassettes, Aspergillus fumigatus) A. fumigatus, targeted gene deletion animal models ...................................................... 456 antifungal drug development ............................... 455 CAM ................................................................... 493 clonal strains ........................................................ 494 fungal inoculum ................................................... 488 fungal microorganisms ......................................... 457

growth and sporulation ........................................ 491 inoculum preparation ........................... 457–458, 460 siderophore biosynthesis ...................................... 456 toll-deficient flies ................................................. 457 virulence............................................................... 456 Aspergillus fumigatus, bilayer model.................................. 361 Aspergillus nidulans gpdA gene promoter................................................... 123 trpC gene terminator ................................................. 123 ATMT. See Agrobacterium tumefaciens-mediated transformation

B Beads. See Cytometric bead arrays Biofilm formation catheter materials....................................................... 370 defined ....................................................................... 369 FDA................................................................... 372–375 identification, ZAP1 gene .......................................... 371 medical implants................................................ 369–370 microtiter-format Candida, preparation ..................................... 371, 373–375 models........................................................................ 370 mucosal infections ..................................................... 370 structure ..................................................................... 370 transcriptome and proteome analysis ......................... 370 XTT colorimetric assay ..................................... 371–374 Bioinformatics tools ................................................ 385, 393 Biolistic transformation bio-rad.. ....................................................................... 70 DJ-PCR products ........................................................ 76 DNA-coated gold beads .............................................. 77 dominant markers ........................................................ 74 gene gun ...................................................................... 82 PCR method ............................................................... 6 7 vacuum, hold, fire, pop, vent button............................. 78 wild-type/mutant strains ............................................. 76 YPD liquid medium .................................................... 69 Biosafety level 2 (BL2) ...................................................... 68 Bone marrow-derived dendritic cells C. albicans culture............................................... 262, 264 CD4+T....................................................................... 262

Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8, © Springer Science+Business Media, LLC 2012

583

HOST-FUNGUS INTERACTIONS 584 Index Bone marrow-derived dendritic cells (Continued ) CFDA-SE ................................................................. 262 co-culture plates................................................. 263, 265 DCs................................................................... 261–262 dendritic cell culture .......................................... 263, 265 depletion .................................................... 263, 265–266 description ................................................................. 261 flow cytometric analysis ..................................... 263–264 mixed leukocyte reaction ........................... 267–270, 272 pathogen-specific T cells ........................................... 262 phenotype, FACS ...................................................... 267 splenic T cells, isolation ............................. 263, 266–267 T-cell proliferation ............................................. 270–272

C CADRE. See Central Aspergillus Data Repository Caenorhabditis elegans assays nematodes ....................................................... 450 Cryptococcus killing assay ............................................ 451 Cryptococcus progeny assay.......................................... 451 description ................................................................. 447 fungal pathogens........................................................ 448 growth, fungal cultures .............................................. 449 liquid Candida albicans assay .............................. 451–452 nematodes .................................................................. 447 nematode synchronization ................................. 449–450 NGM......................................................................... 448 Calcium-binding protein (CBP1) ................... 188, 191, 192 CAM. See Chorioallantoic membrane Candida albicans. See also Inducible gene expression antifungal resistance/sensitivity...................... 371 biofilm formation ...................................................... 369 vs. caspofungin in vivo activity .................................. 471 cell wall oligosaccharides ................................... 250–253 chitin/β-1, 3 glucan ................................................... 248 chitin extraction and purification....................... 249, 252 commensal fungus ..................................................... 319 complementary approach ................................... 247–248 complementation plasmid............................................ 24 concurrent oral and vaginal colonisation fungal burdens ..................................................... 530 mucosal colonisation .................................... 531–532 oestrogen administration ..................................... 530 oestrogen-treated ................................................. 532 culture.. .............................................................. 249, 564 culture media ..................................................... 528–529 culturing and labeling ........................................ 325–326 determination, fungal load ................................. 471, 476 EDTA........................................................................ 535 embryonated eggs ...................................................... 493 extraction, N-and O-linked mannans ................ 249, 252 FAD................................................................... 372–375 fluorescence images, human oral keratinocytes .......................................... 290, 292

genomic DNA homozygous mutant .............................................. 32 inoculate 5 mL YPD.............................................. 30 PCR protocol................................................... 31–32 preparation............................................................. 23 spin down .............................................................. 31 glycosylated mannoproteins ....................................... 248 histological analysis ................................................... 529 immune...................................................................... 533 immunosuppression ................................................... 528 inoculation, Galleria mellonella larvae .......................................471, 474–475, 490 inoculum preparation................................................. 560 interaction, human oral keratinocytes ................ 290, 291 J774.1 macrophages ........................................... 251, 254 macrophage killing .................................... 251, 256–257 mannan purification .......................... 249–250, 252–253 microscopy analysis .................................................... 373 microtiter-format preparation.................................... 371 mini-blaster cassette CSM-Ura plates .................................................... 28 heterozygous .......................................................... 23 transformation reactions ........................................ 27 YPD + Uri (80 mg/mL) plates ............................... 22 mouse inoculation ........................................................... 529 model ........................................................... 493, 529 mucosal candidiasis............................................................ 527 infections ............................................................. 370 orogastrointestinal candidiasis ............................. 558 murine vaginitis models ............................................. 528 oral swabbing ............................................................. 533 PAMPs and PRRs ..................................................... 247 persistent oral and vaginal colonisation ..................... 534 phagocytosis assay...................................................... 255 phenotypic trait ......................................................... 370 plasmid transformation CSM-HIS plates ................................................... 37 pDDB78 DNA...................................................... 36 preparation................................................................. 254 uptake assessment ...................................... 251, 255–256 URA3 marker excision ................................................. 28 visceral organs ............................................................ 558 YPD media ................................................................ 488 Candida glabrata nosocomial pathogens................................................ 369 scanning electron micrograph ............................ 371, 372 Yak1p kinase .............................................................. 371 Candidiasis. See also Orogastrointestinal candidiasis C. albicans..................................... 426 IFF4, over-expression ................................................ 228 model, oral ................................................................. 334 mucosal model ........................................................... 333

HOST-FUNGUS INTERACTIONS 585 Index real-time imaging .............................................. 543–544 vaginal susceptibility .................................................. 528 vulvovaginal, model ................................................... 538 Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) description ................................................................. 262 and DMSO ............................................................... 264 pre-and post-labelling................................................ 267 Catheter animal and maintenance ............................................ 552 flash frozen, RNA...................................................... 555 harvesting .......................................................... 552–553 infection..................................................................... 552 inoculum, preparation ................................................ 552 lock treatment ............................................................ 552 placement .......................................................... 550–551 preparation................................................................. 550 rat venous .................................................................. 554 CBAs. See Cytometric bead arrays Cell signalling .......................................................... 335, 341 Cell wall. See Candida albicans Central Aspergillus Data Repository (CADRE) .............................................. 106, 115 CFDA-SE. See Carboxyfluorescein diacetate succinimidyl ester CFU. See Colony-forming units CHEF. See Contour-clamped homogeneous electrical field Chitin, extraction and purification .......................... 249, 252 Chorioallantoic membrane (CAM) fungal burden............................................................. 493 fungal inoculum ......................................................... 492 infected eggs .............................................................. 492 infection..................................................................... 489 Chromosome structure D-arabinose promotes trisomy .................................... 41 mutant and parent strain.............................................. 47 plasmid DNA ............................................................ 133 primer sequences ......................................................... 43 primer Set A ................................................................ 48 retrospective analysis.................................................... 42 Coccidioides spp. asymptomatic and symptomatic infection ......................................................... 132 biolistic transformation approach .............................. 133 coccidioidomycosis .................................................... 132 DNA fragment .......................................................... 145 endospores ................................................................. 132 genome sequences...................................................... 132 hygromycin/phleomycin, concentration ............. 145–146 materials cell wall–digestion enzymes ................................. 134 GYE agar plates and liquid medium ........... 133, 135 GYES soft agar.................................................... 135

HmB.................................................................... 135 MOPS buffer containing sorbitol ........................ 134 MSC buffer ......................................................... 134 OB. .............................................................. 133–134 PCR amplification ............................................... 136 PEG .................................................................... 134 phleomycin .......................................................... 135 QIAprep Miniprep kit ......................................... 135 TB........................................................................ 134 methods gene disruption construct............................. 136–138 gene replacement construct.......................... 138–139 germ tubes, preparation ....................................... 139 homokaryotic transformants, isolation................. 143 protoplasts, isolation and preparation .......... 139–141 transformants, selection and transformation ....................................... 141–143 molecular and biogeographical .......................... 131–132 parasitic phases .......................................................... 132 saprobic phase ............................................................ 132 transformants, PCR screening ................................... 146 Colonisation C. albicans ................................................................... 528 mucosal... ................................................................... 533 oral............................................................................. 533 vaginal........................................................................ 530 Colony-forming units (CFU).......................... 560, 562–563 Complementation.....................................120, 122, 126–127 See also Marker complementation Concurrent C. albicans ................................................................... 533 murine model fungal burdens ..................................................... 530 mucosal colonisation .................................... 531–532 oestrogen administration and fungal inoculation ..................................................... 530 Confocal microscopy. See also Dendritic cells C. albicans mo-DCs ....................................... 321 ingested fungal particles ............................................ 3 20 Contour-clamped homogeneous electrical field (CHEF) .................................... 42 Cre-recombinase constructs ..................................................................... 88 mediated drug marker excision .................................... 96 plasmid .................................................................. 95–96 protein.................................................................... 85–86 Cryptococcus killing assay ................................................................ 451 progeny assay ............................................................. 451 Cryptococcus killing assay .................................................. 451 Cryptococcus neoformans adenine medium ........................................................ 170 biolistic transformation .........................69–70, 76–78, 98 Cre–loxP recombinase system ................................ 85–86

HOST-FUNGUS INTERACTIONS 586 Index Cryptococcus neoformans (Continued ) CTAB genomic DNA preparation ........................ 70–71 drug markers, use ................................................... 85, 86 electroporation ................................... 172–173, 177–178 galactose promoter ....................................................... 86 gene disruption flowchart ...................................... 72, 73 genomic DNA pellets ............................................ 70, 83 hybridization and development method ...................... 81 incubations .................................................................. 97 loxP sites ...................................................................... 86 materials Cre-recombinase constructs................................... 88 gel purification ....................................................... 89 genomic DNA preparation .................................... 90 LAC1 deletion construct and screening ................. 89 media ............................................................... 86–87 PCR primers.......................................................... 89 selectable markers flanked, lox P sites .................... 87 Southern blot reagents ........................................... 90 transformation ................................................. 89–90 methods CRE-recombinase vector ....................................... 96 generation, deletion constructs ........................ 90–91 genomic DNA preparation .................................... 93 passaging................................................................ 93 PCR screening ................................................. 93–94 Southern blot ................................................... 94–95 transformation, biolistics.................................. 91–93 YPD plates ...................................................... 95–96 NAT..... ........................................................................ 67 NEO/HYG ................................................................... 67 PCR diagnostic............................................................... 79 DJ-PCR........................................................... 75–76 first-round ............................................................. 75 fragments ............................................................... 68 materials ................................................................ 69 PCR conditions ........................................................... 97 pIBB103 Vector ................................................. 174, 180 primer design NAT/NEO marker amplification ........................... 73 PCR amplification ........................................... 72–73 schematic diagram, DJ-PCR ........................... 73, 74 RNAi... ...................................................................... 167 safe handling................................................................ 68 serotypes classification ................................................. 82 Smash and Grab Mini-preparation ....................... 78–79 southern blot analysis alkaline transfer method .................................. 71–72 CTAB genomic DNA preparation .................. 79–80 denaturation and transfer ................................. 80–81 neutral transfer method ......................................... 72 preparation, probes and gel electrophoresis............ 80 transformants ............................................................... 86

trouble-shooting techniques ........................................ 97 Cryptococcus progeny assay ............................................... 451 Cutaneous nonlethal murine model. See Invasive aspergillosis Cytokine IL-12 and IL-10........................................................ 308 production assays and in vitro recognition materials .............................................................. 306 methods ............................................................... 308 thioglycollate-elicited macrophages ........................... 304 Cytokines measurement. See Cytometric bead arrays Cytometric bead arrays (CBAs) advantages.................................................................. 426 assay.............. ............................................................. 427 BD, assay procedure........................................... 428–429 C. albicans, aetiological agent ..................................... 426 cytokine assignment .................................................. 430 cytokines and chemokines ......................................... 426 description ................................................................. 425 ELISA 425 equipment and software..................................... 426–427 mouse flex set reagent ................................................ 428 quantitative analysis ........................................... 429–431 reagents...................................................................... 426 sample and standard positions, 96-well plate .................................................. 431 sample, samples collection ......................................... 427 scatter plots ................................................................ 429

D DCs. See Dendritic cells Deletion cassettes, Aspergillus fumigatus BamHI and EcoRI ..................................................... 116 cellulose ester membranes .......................................... 116 colony PCR ............................................................... 117 databases .................................................................... 115 drug resistance markers.............................................. 115 E. coli strains .............................................................. 116 EDTA........................................................................ 113 enzyme selection ................................................ 116–117 fusion/overlap PCR ................................................... 101 “in vivo” recombination ............................. 100–101, 106 KU-deficient strains .................................................. 117 media... .............................................................. 101–102 methods construction ................................................. 108–109 genomic DNA extraction ............................ 104–105 isolation ....................................................... 109–110 PCR reactions and primer design ................ 105–108 protoplast transformation ............................ 111–112 S. cerevisiae transformation .......................... 108–109 target gene disruption .................................. 105–108 Millipore Millex HV filter......................................... 114 Neurospora crassa ......................................................... 101 opportunistic pathogen, humans.......................... 99–100

HOST-FUNGUS INTERACTIONS 587 Index PCR-based strategy ................................... 100–101, 106 primer design software............................................... 115 pyrG-recipient strains ................................................ 117 role....... ........................................................................ 99 salmon sperm DNA................................................... 114 shuttle plasmid pRS426. ............................................ 115 solutions............................................................. 102–104 “top agar” ................................................................... 113 transformation use ..................................................... 114 YPD medium ............................................................ 113 Dendritic cells (DCs) addition, TSA ............................................................ 330 blastoconidia, C. albicans ............................................ 329 DCs interaction and C. albicans ................................. 320 description ................................................................. 261 EDTA, CD45-APC-labeled mo-DCs ...................... 329 gradient and solution, Ficoll .............................. 328–329 innate immune system ............................................... 319 major classes, PRRs ................................................... 320 materials cell labeling and binding assay ............................. 322 culture medium .................................................... 321 devices.......................................................... 322–323 isolation, peripheral blood mononuclear cells ...... 321 phagosomes proteins labeling .............................. 322 phenotyping ......................................................... 321 methods binding assay, C. albicans .............................. 325–326 culturing and labeling .................................. 325–326 monocyte-derived preparation ..................... 323–324 peripheral blood mononuclear cells isolation.................................................. 323 phagocytosis, C. albicans............................... 327–328 phenotyping ................................................. 324–325 mo-DCs ............................................................ 320–321 multichannel pipette .................................................. 329 pathogen-specific T cells ........................................... 262 PRRs and PAMPs ..................................................... 320 Triton X-100/saponin................................................ 330 Differentiation markers fluorescence images............................................ 290, 292 squamous epithelium ................................................. 290 Dimorphic fungus ................................................... 1 87, 382 DJ-PCR. See Double-joint PCR DMSO. See High-quality dimethylsulfoxide Dominant selection marker caSAT1 ............................................................... 203, 204 gene expresion ........................................................... 203 genetic manipulation ..................................................... 4 Double-joint PCR (DJ-PCR) dominant markers ........................................................ 68 NAT-split markers ....................................................... 75 PCR microfuge tubes ............................................ 75–76 purification kit ............................................................. 76

schematic diagram ................................................. 73, 74 Doxycycline ADH1 promoter ........................................................ 203 gene expression .......................................................... 207 phenotype, cells ......................................................... 209 Tet-Off system .................................................. 202–203 Drosophila melanogaster antifungal drug development ..................................... 455 defined, IA................................................................. 455 fly antifungal treatment ............................. 459, 462–463 fly tissue fungal burden quantification ....................... 459 in vitro anti-Aspergillus activity .................................. 456 infection assays .......................................... 457, 458–462 inoculum preparation, Aspergillus ................457–458, 460 siderophore biosynthesis ............................................ 456 Toll signaling pathway ............................................... 457 tractability and availability, genetic ............................ 456 Drug, antifungal activity........................................................................ 581 therapy ....................................................................... 570 treatment ................................................................... 575 Drug resistance auxotrophic markers .................................................. 119 gene deletion strategy ........................................ 120, 121 markers ...................................................................... 115 MDR1/MRR1 inactivation ........................................... 4 PCR gene deletion technology .................................. 216

E Electrophoresis and antibodies............................................................ 345 nitrocellulose membrane .................................... 351–352 ELISA. See Enzyme-linked immunosorbent assay Embryonated chicken eggs CAM...... ............................................488, 489, 491–492 experimental design ................................................... 490 fertilized eggs............................................................. 493 fungal inoculum ................................................. 488–489 handheld drills ........................................................... 495 in vivo infection ................................................. 487–488 immune system .......................................................... 494 infection inoculum ............................................. 490–491 legal and ethical considerations ......................... 489–490 models, infection........................................................ 487 murine models ........................................................... 488 preincubation ............................................................. 490 preparation, eggs ........................................................ 488 samples collection ...................................... 489, 492–493 sampling .................................................................... 495 Enzyme-linked immunosorbent assay (ELISA) detection, transcription factor DNA binding ................................................... 354–355 nuclear lysis ....................................................... 349, 354 transcription factor ............................................ 346–347

HOST-FUNGUS INTERACTIONS 588 Index Escherichia coli chemocompetent ....................................................... 116 electrocompetent cells ................................................ 110 plasmid extraction and purification AMB900................................................................ 26 and cultures............................................................ 26 DNA miniprep kit ................................................. 21 propagation ................................................................ 102 stocks... ...................................................................... 114 strains......................................................................... 116 transformation ....................................................... 24, 26 chemical competent ......................................... 24, 35 fermentas ............................................................... 36 Expressed sequence tags (ESTs). See Transcript profiling

F FBS. See Foetal bovine serum FDA. See Fluorescein diacetate Flow cytometry C. albicans and mo-DCs ............................................ 321 percentage, DCs binding ........................................... 320 phenotype, immature mo-DCs.................................. 325 Fluorescein diacetate (FDA) cell viability ........................................................ 372, 373 quantification, Candida biofilms ........................ 373, 375 Fluorescence intensity and linescan analysis background subtraction ............................................. 298 immunofluorescence images ...................................... 299 Foetal bovine serum (FBS) ...................................... 362, 366 Forward genetics................................................................ 51 Fruit fly..................................................................... 456, 457 Fungal biofilms animals....................................................................... 548 Candida biofilm cell nucleic acid collection ............... 550 catheters maintenance......................................................... 552 placement..................................................... 550–551 confocal/fluorescent microscopy ................................ 549 endpoint determination microbiological counts ......................................... 553 nucleic acid collection .......................................... 554 scanning electron microscopy ...................... 553–554 harvesting .......................................................... 552–553 hematogenous source ................................................. 555 host conditions .......................................................... 547 in vivo ........................................................................ 547 inoculum, preparation ................................................ 552 lock treatment ............................................................ 552 media and isolation .................................................... 549 medications................................................................ 548 microbiological counts ............................................... 549 rat venous catheter model .......................................... 548 scanning electron microscopy .................................... 549 sonication .................................................................. 548 surgical equipment and materials....................... 548–550

Fungal pathogen, basidiomycetous .................................... 67 Fungal RNA, microarray analysis “Agilent 2100 Bioanalyzer”........................................ 412 amplification and labelling ................................ 417–418 BioAnalyzer ....................................................... 416–417 contamination and decontamination ......................... 414 DNase treatment ............................................... 413, 416 electropherograms.............................................. 419, 420 enzymes and fragments ............................................. 411 isolation, infected tissue ............................................. 416 isolation, monolayer cells ................................... 412–415 oligo................................................................... 413–414 pathogenic yeasts ....................................................... 412 phenol and SDS combination.................................... 412 protocols .................................................................... 411 quality control ............................................................ 413 tissue isolation ........................................................... 413 transcriptional profiling technology........................... 411 Fungi. See also Galleria mellonella antibodies .................................................................. 313 C. albicans ................................................................... 316 Candida albicans and zymosan ................................... 305 carbohydrate polymers ....................................... 303–304 CFSE fluorescence .................................................... 315 Cytochalasin D .......................................................... 315 cytokine production ........................................... 304–305 DHR123 ................................................................... 316 EDTA functions ........................................................ 316 FACS block ............................................................... 313 FITC-zymosan.......................................................... 314 fluorescently labelled particles ................................... 304 glycation end products ............................................... 312 innate immune response ............................................ 303 macrophage activating/inhibiting agents ................... 316 macrophage physiology.............................................. 312 materials assays, in vitro phagocytosis ................................. 306 cytokine production assays ................................... 306 fluorescent labelling ............................................. 305 in vitro fungal killing assay .................................. 306 in vitro respiratory burst assays ............................ 306 induction, sterile peritonitis ................................. 305 methods cytokine production assays ................................... 308 fluorescent labelling ............................................. 307 in vitro phagocytosis assay ........................... 308–310 killing macrophage measurement ................ 311–312 measurement, respiratory burst ............................ 311 sterile peritonitis and macrophages recovery .................................................. 307–308 murine macrophages .................................................. 304 NIH3T3 fibroblasts................................................... 316 peritoneal lavage ........................................................ 314 phagocytes and PRRs ................................................ 304 thioglycollate-elicited neutrophils.............................. 313

HOST-FUNGUS INTERACTIONS 589 Index turk’s staining ............................................................. 314 wild-type and knock-out mice ................................... 315 Zymosan .................................................................... 313

G Galactose-inducible promoters amplicons................................................................... 213 cDNA and quantitative PCR .................................... 216 deletion construct .............................................. 218–220 gel purification........................................................... 213 gene interest, broth and plates ........................... 220–221 genomic DNA ........................................................... 215 hyper-filamentation ................................................... 225 Leloir pathway ........................................................... 212 mating slides ...................................................... 222–223 media with deionized water ....................................... 213 NAT...... ..................................................................... 224 primers............................................................... 213, 214 promoter swap constructs .................................. 216–217 Qiagen gel ................................................................. 223 RNA extraction ................................................. 221, 222 RNA isolation............................................................ 216 S.cerevisiae .................................................................. 212 Southern blot reagents ....................................... 215–216 transformation, C. neoformans var. grubii ................... 218 transformation material ..................................... 213, 215 Galactose induction. See Galactose-inducible promoters Galleria mellonella caspofungin in vivo activity ....................... 471, 476–477 defined, mini-hosts ............................................ 469–470 description ................................................................. 469 2D gel electrophoresis and LC/MS ... 472–474, 478–480 extraction and analysis, peptides ................ 474, 481–482 fungal load ................................................................. 471 haemocyte density ............................................. 471, 476 in vivo screening system ............................................ 470 immune response, microbial pathogens ..................... 470 inoculation ................................................. 471, 474–475 “proportion-ate” ......................................................... 470 RNA and antimicrobial gene expression analysis ......................... 472, 477–478 Gateway™ cloning .......................................................... 233 Gaussia princeps..........................................................538, 539 Gene deletion, Candida albicans biosynthetic pathways .................................................... 4 diploid organism ............................................................ 3 flanking sequences ....................................................... 12 flipper cassette, SAT1............................................. 5, 6–7 homozygous construction .............................................. 7 IMH3 encode ............................................................ 4–5 materials ........................................................................ 8 MDR1/MRR1 ...............................................................4 methods deletion cassette construction ............................ 9–10

excision, SAT1 flipper cassette ............................... 11 transformation ................................................. 10–11 nourseothricin........................................................ 15–16 nourseothricin-resistant selection .............................. 5, 7 nucleo spin extract II ................................................... 12 prefix “ca” ..................................................................... 12 promoter, SAP2..............................................................7 visible colonies ............................................................. 15 wild-type alleles ......................................................... 3–4 YPD plates .................................................................. 13 YPM medium.............................................................. 15 Gene disruption. See also Cryptococcus neoformans Coccidioides spp. constructs use, transformation ............................. 137 gene replacement ................................................. 137 genomic DNA ..................................................... 137 HPH/BLE cassette ...................................... 136, 137 plasmid DNA ...................................................... 138 QIAprep Miniprep kit ......................................... 138 QIAquick PCR purification kit (Qiagen)................................................. 137–138 deletion cassettes A. fumigatus .......................................................... 100 S. cerevisiae............................................................ 100 design primers ........................................................... 105 Gene expression C. albicans ................................................................... 399 host-fungal interaction .............................................. 405 linear amplication ...................................................... 408 qRT-PCR .................................................................. 404 RNA isolation............................................................ 405 target kinetics ............................................................ 168 Gene expression and dynamic imaging ACT1 promoter ......................................................... 545 anesthesia................................................................... 545 animals ............................................................... 542, 544 CCD.... ...................................................................... 537 cutaneous infection ............................................ 543, 545 equipment .................................................................. 538 firefly luciferase gene ................................................. 538 gLUC59............................................................. 538, 539 host–pathogen interactions ........................................ 537 in vivo imaging, mice......................................... 538, 540 luciferase activity................................................ 542, 545 media and reagents ............................................ 541–542 plasmids and C. albicans strains.......................... 538, 541 subcutaneous infection....................................... 543, 545 vaginal candidiasis ............................................. 543–544 Gene knockdown............................................................. 197 Gene over-expression C. albicans and bacterial strains .................................. 229 constitutive vs. regulatable promoter ......................... 228 IFF4 strain................................................................. 228 integrative transformation ................................. 237–238 media...... ........................................................... 232–233

HOST-FUNGUS INTERACTIONS 590 Index Gene over-expression (Continued ) oligonucleotides ......................................................... 232 ORFeome collection .................................................. 229 ORFs and cloning amplification ................................................ 234–236 transfer ......................................................... 236–237 pathogenesis and biofilm formation .......................... 228 PCK1p-driven ................................................... 238–239 PCR and gateway™ cloning ...................................... 233 plasmid preparation ................................... 229, 232, 233 protein analysis .......................................................... 234 sequence homology.................................................... 227 suppression screens .................................................... 229 TETp-driven ..................................................... 239–240 transformation, C. albicans ......................................... 234 Gene silencing ................................................................. 165 Geneticin (G418) marker recycling strategy ............................................. 87 positive selectable markers ........................................... 88 Genetics, architecture ........................................................ 19 Germ tubes, Coccidioides C. posadasii...........................................................1 39, 140 protoplasts isolation ................................................... 141 GFP sentinel RNAi system, H. capsulatum cellular function ......................................................... 152 construction and composition.................................... 153 double-stranded RNAs .............................................. 152 extrachromosomal plasmids ....................................... 152 ImageJ software ......................................................... 163 materials construction ................................................. 154–155 preparation........................................................... 154 transformant screening ........................................ 156 transformation ............................................. 155–156 methods construction ................................................. 158–159 isolation ....................................................... 161–162 RNAs isolation ............................................ 156–158 screening, transformants .............................. 160–161 transformation ............................................. 159–160 qRT-PCR .................................................................. 164 reverse genetic analysis .............................................. 151 RISC.......................................................................... 152 sentinel function ................................................ 152–153 sequences ................................................................... 162 triggering constructs .................................................. 152 in vivo generation ...................................................... 152 Glucose repression ................................................... 221, 222 Glyceraldehyde 3-phosphate (GPD) ...................... 188, 192 Glycosylation mannoproteins ........................................................... 248 outer wall, C. albicans ................................................. 248 G418 marker recycling strategy ......................................... 87

H Haemocytes density, Galleria mellonella ...................................471, 476 2D gel electrophoresis ....................................... 478–480 High-quality dimethylsulfoxide (DMSO) ........................................................ 264 Histology CAM.... ..................................................................... 493 samples collection ...................................................... 489 sampling, downstream applications ........................... 495 Histoplasma capsulatum ATMT......................................................................... 52 description ................................................................... 51 intranasal inoculation................................................. 521 materials Agrobacterium media and supplements ................... 55 cocultivation medium ...................................... 55–56 media and supplements.................................... 53–55 TAIL-PCR ...................................................... 56–57 targeted gene disruption screening .................. 57, 58 transformant selection ........................................... 56 methods Agrobacterium preparation ................................ 58–59 cocultivation........................................................... 59 insertional mutants selection ............................ 59–60 preparation............................................................. 58 TAIL-PCR ...................................................... 60–62 targeted gene disruption .................................. 62–63 monitoring ......................................................... 521–522 preparation......................................................... 520–521 primary infection ....................................................... 522 reactivation ................................................................ 523 screening, insertion mutants disruptions................ 52, 54 secondary infection ............................................ 522–523 strains......................................................................... 523 TAIL-PCR use...................................................... 52, 53 Histoplasma-macrophage medium (HMM) ...................... 53 Histoplasmosis, invasive model antibodies .................................................................. 524 H. capsulatum.............................................................. 519 knockout mouse strains ............................................. 523 materials .................................................................... 520 methods, H. capsulatum intranasal inoculation ........................................... 521 monitoring ................................................... 521–522 preparation................................................... 520–521 primary infection ................................................. 522 reactivation .......................................................... 523 secondary infection ...................................... 522–523 pulmonary infection........................................... 519–520 Homologous recombination, homokaryotic mutants ................................... 143

HOST-FUNGUS INTERACTIONS 591 Index Host-fungal interaction ................................................... 405 HYG. See Hygromycin Hygromycin (HYG) .................................................... 85, 87 Hygromycin B phosphotransferase (HPH) gene ............................................... 188, 192, 195 Hygromycin, Coccidioides HmB concentrations...................................... 142, 145–146 GYE soft agar...................................................... 142 use........................................................................ 135 resistance (HPH), gene disruption .................... 136–138 Hygromycin resistance gene (HYG) .................................. 67 Hygromycin-resistance split-marker approach, A. fumigatus auxotrophic markers .................................................. 119 ble cassette.................................................................. 120 drug resistance markers...................................... 119–120 fusion PCR ................................................................ 129 gene complementation strategy ............................ 120, 122 deletion strategy........................................... 120, 121 targeting............................................................... 120 hph cassette ................................................................ 120 hybrid DNAs construction gene complementation ................................. 126–127 gene disruption .................................................... 126 materials DNA and DNA modifications .................... 123–124 plates ............................................................ 124–125 solutions............................................................... 124 methods negative control ................................................... 128 positive control .................................................... 128 protoplasts ........................................................... 127 transformation tube ............................................. 128 and phleomycin ......................................................... 129 protoplasts ................................................................. 120 transformants screening, putative ............................................... 129 selection ............................................................... 128

I IM. See Induction medium Imaging cutaneous infection .................................................... 543 gLUC59-expressing................................................... 538 in vivo, C. albicans ...............................................538, 540 real-time ............................................................ 537, 538 subcutaneous infection............................................... 543 vaginal candidiasis ............................................. 543–544 Immune response murine CD4+ T cells ....................................................... 262 pathogenic challenge............................................ 261

“proportionate” .......................................................... 470 RHE (see In vitro RHE, C. albicans) virulent pathogens ..................................................... 483 Immunity.... ............................................................. 504, 505 Immunoblotting α-actin/tubulin .......................................................... 345 analysis....................................................................... 346 electrophoresis and antibodies ................................... 345 materials cell lysis ................................................................ 348 electrotransfer .............................................. 3 48–349 precipitation ......................................................... 349 SDS-PAGE ......................................................... 348 methods precipitation ......................................................... 353 sample lysis and preparation ................................ 350 sample preparation ............................................... 350 SDSPAGE and transfer....................................... 351 wet transfer, nitrocellulose membrane .............................................. 351–352 precipitation............................................................... 346 steps performed, room temperature ........................... 353 Immunofluorescence, deconvolution microscopy materials ............................................................ 293–294 methods ............................................................. 296–298 Immunoprecipitation antibody ..................................................................... 346 lysis buffer.................................................................. 346 methods ..................................................................... 353 physically associated proteins..................................... 346 western blot ............................................................... 358 Inducible gene expression caSAT1 selection ........................................................ 203 cassette............................................................... 205–206 doxycycline ........................................................ 207, 209 hyphal growth ............................................................ 203 materials .................................................................... 205 phenotypic effect ....................................................... 201 pNIM1 ...................................................... 203, 204, 208 promoters................................................................... 202 rtetR gene .................................................................. 203 Tet-inducible construction................................. 206–207 tetracycline......................................................... 202, 204 Tet system.................................................................. 202 Induction medium (IM) .................................................... 55 Infection animals....................................................................... 500 C. albicans ............................................................503, 505 experimental assessment ............................................ 500 fungus........................................................................ 503 “hypervirulent” fungal strains .................................... 499 mice..... .............................................................. 502, 504 monitoring ................................................................. 503

HOST-FUNGUS INTERACTIONS 592 Index Insertional mutagenesis. See Histoplasma capsulatum Integrative vectors, C. albicans.................................. 237–238 Intranasal infection .................................................. 522, 523 Intravenous. See Mouse intravenous challenge models Invasive aspergillosis antifungal drugs, cutaneous model............................. 581 conidial suspension .................................................... 579 cutaneous model ........................................................ 579 histopathologic parameters ........................................ 580 masson trichrome stain .............................................. 581 materials animal care, inoculation and monitoring ............. 570 antifungal drug therapy........................................ 570 culture and inoculum preparation ........................ 570 in vivo matrigel assay ........................................... 571 thigh tisse harvesting ........................................... 570 tissue fungal burden ............................................. 570 matrigel...................................................................... 581 methods animal care, inoculation and monitoring ..................................................... 572 antifungal drug treatment .................................... 575 culture and inoculum preparation ........................ 5 71 in vivo angiogenesis assay ............................ 575–578 vs. strain virulence ....................................... 574–575 tissue fungal burden ..................................... 572–574 morbidity ................................................................... 580 mutant strains .................................................... 580–581 soft tissue IA, murine thighs...................................... 569 Invasive pulmonary aspergillosis antifungal agents........................................................ 362 bilayer model ............................................................. 361 cellular bilayer, definition ........................................... 362 decontaminate cabinet ............................................... 363 experimental components .................. 362–363, 365–366 flow diagram, in vitro model preparation........... 363, 364 human alveolar epithelial cells ........................... 361–362 Transwells®................................................................ 361 Invertebrate mini-host model .......................................... 456 In vitro RHE, C. albicans cytokine analyses ....................................................... 342 epithelial RNA, isolation ........................................... 343 HiPerfect transfection reagent ................................... 3 44 LDH activity assay .................................................... 343 materials antimicrobial peptides/cytokines ......................... 336 epithelial gene expression..................................... 336 immune fluorescence microscopy......................... 336 immunoblot ......................................................... 335 inhibition, epithelial protein expression ............... 337 Lactobacillus spp. .................................................. 336 LDH cell damage assay ....................................... 334 oral candidiasis model .......................................... 334 PMNs .................................................................. 336

RNA/protein isolation and quantitative RT-PCR ........................................................ 335 tissue model ......................................................... 334 McFarland standard, preparation............................... 344 methods antimicrobial peptides/cytokines ......................... 341 epithelial gene expression............................. 341–342 epithelial protein expression................................. 342 immune fluorescence microscopy................. 339–340 immunoblotting ........................................... 338–339 Lactobacillus spp. .................................................. 340 LDH assay ........................................................... 338 medium collection, removal and dissection ....................................................... 338 polymorphonuclear cells (PMN) ......................... 340 preparation, pre-incubation and infection ................................................. 337–338 RNA/protein isolation and quantitative RT-PCR ........................................................ 338 semisynchronization, fungal cells ......................... 337 microarray analysis..................................................... 343 samples collection ...................................................... 343 smear cell preparation, Giemsa stain ......................... 343 In vivo and ex vivo models of infection ................... 382, 394 “In vivo” recombination, PCR-based strategy S. cerevisiae.................................................................. 106 yeast................................................................... 100–101

K Keratinocytes C. albicans ................................................................... 289 CCD camera ............................................................. 301 cell lines and organotypic model systems................... 290 2D deconvolution algorithm categories ..................... 301 disadvantages, rodent systems ............................ 289–290 fluorescence microscopy............................................. 300 image analysis software .............................................. 290 immersion oils ........................................................... 300 incubation, coverslips ................................................. 300 materials antigens and conjugates ....................................... 293 C. albicans culture................................................. 293 cell culture.................................................... 291–293 data analysis ......................................................... 294 immuno fluorescence deconvolution microscopy ............................................. 293–294 immunostaining components............................... 293 methods cell culture, OKF6/TERT-2 ................................ 294 coculture, OKF6/TERT-2 and C. albicans ............................................... 294–295 immunofluorescence deconvolution microscopy ............................................. 296–298 immunostaining, OKF6/TERT-2 ............... 295–296

HOST-FUNGUS INTERACTIONS 593 Index linescan analysis and fluorescence intensity measurements ........................................ 298–299 mucosal surfaces, human host .................................... 290 OKF6/TERT-2 cells ......................................... 290, 291 photo-bleached/bleed ................................................ 301 trypsin/EDTA ........................................................... 300 Knock-out mutants ......................................................... 151

L LAC1 deletion construction PCR strategy ............................................................... 92 and screening ............................................................... 89 Lactate dehydrogenase (LDH) activity assay .............................................................. 343 analysis....................................................................... 338 cell damage assay ....................................................... 334 detection .................................................................... 334 determination ............................................................ 343 Laser capture microdissection (LCM) components ....................................................... 399–400 defined ....................................................................... 397 description ......................................................... 402–403 embedding, O.C.T. compound .......................... 400–401 fixation and dehydration components........ 399, 401–402 freezing and tissue sectioning, specimens .................. 399 low-energy IR laser.................................................... 398 NIH........................................................................... 398 principal steps ............................................................ 398 protocols .................................................................... 399 purification and analysis, RNA .................. 400, 403–404 RNase-free precautions.............................................. 400 systems....................................................................... 398 tissue sectioning and slide preparation ....................... 401 LCM. See Laser capture microdissection Linescan analysis background subtraction ............................................. 298 epifluorescence deconvolution microscopy ................ 290 and fluorescence intensity .......................................... 298 immunofluorescence images ...................................... 299 Liquid Candida albicans assay .................................. 451–452 loxP flanked drug markers ............................................. 90–91 sites.......... ............................................................. 86, 87 Luciferase. See Gene expression and dynamic imaging Lung fungal burdens ................................................... 522, 523 murine harvesting and preservation ......................... 437, 439 intra-nasal inoculation ................................. 437, 439 isolation, total RNA............................. 437, 439–440 nonspecific adherence ................................................ 406 parasitic cycle ............................................................. 132 Luria Bertani (LB) medium ............................................ 102

M Macrophages. See also Candida albicans alveolar and bone marrow-derived cells ..................... 305 induction, sterile peritonitis ............................... 307–308 murine ....................................................................... 304 thioglycollate-elicited fungal particle ......................... 304 Marker complementation amplification and reaction, PCR complementation primers ................................ 23, 33 mini-blaster cassette ............................ 21, 22, 26–27 C. albicans complementation plasmid ...................................... 24 genomic DNA, preparation ....................... 23, 30–32 mini-blaster cassette ............................ 22, 23, 27–28 plasmid transformation .................................... 36–37 URA3 marker excision ........................................... 28 complementation plasmid, S. cerevisiae .................. 33–35 construction, complementation plasmid ................ 23–24 disruption, URA3 blocks.............................................. 38 E. coli plasmid extraction and purification ................. 21, 26 transformation ..................................... 24, 26, 35–36 equences/overlapping function .................................... 21 5-fluoroorotic acid plates ............................................. 20 F1–R1-amplified PCR products ................................. 37 marker recycling .......................................................... 22 mutants heterozygous .............................................. 22, 28–29 homozygous ..................................................... 29–30 pDDB57, plasmid ................................................. 24, 25 plasmid construction, S. cerevisiae .......................... 33–35 primer design CF ......................................................................... 26 CR ......................................................................... 26 downstream, stop codon ........................................ 25 forward primer 1 and 2 .............................. 21, 24–25 upstream, start codon ............................................. 25 Ura-blaster design.................................................. 19–20 Marker recycling, caFLP......................................................5 Mating gal promoters ..................................................... 222–223 hyper-filamentation ................................................... 225 MGM. See Minimal glucose medium Microarray capture and normalisation ......................... 438, 442–443 fungal RNA (see Fungal RNA, microarray analysis) hybridisation, cDNA probes ...................... 438, 441–442 hybridization.............................................................. 406 TIGR Array .............................................................. 444 Microbial virulence .......................................................... 470 Microtiter plates. See Biofilm formation ‘Mini-host’, defined ......................................................... 470 Minimal glucose medium (MGM) ................................... 55

HOST-FUNGUS INTERACTIONS 594 Index Model, cutaneous. See Invasive aspergillosis Molecular techniques ...................................................... 187 MOPS. See 3-(N-morpholino) propanesulfonic acid MOPS buffer containing sorbitol (MS) .......................... 134 Mouse. See Mouse intravenous challenge models Mouse intraperitoneal infection .............................. 385–386 Mouse intravenous challenge models assessing experiment .................................................. 500 C. albicans ........................................................... 500–502 endothelial barriers .................................................... 499 evaluation and sampling .................................... 503–504 experimental animals infection .................................. 500 experimental plan ...................................................... 501 fungal infection .......................................................... 503 fungal inoculum level ................................................. 507 intravenous infection ......................................... 502–503 laboratory strains ....................................................... 504 monitoring ................................................................. 503 NGY medium............................................................ 504 sterile saline ............................................................... 505 syringes ...................................................................... 507 MPA. See Mycophenolic acid MS. See MOPS buffer containing sorbitol MSC buffer ..................................................................... 134 Mucosal and disseminated candidiasis AIDS ....................................................................... 557 antibiotic and 5-fu treatment ..................................... 561 antifungal treatment .................................................. 558 C. albicans inoculum preparation ............................... 560 CFU determination ........................................... 562–563 esophagus .................................................................. 567 imipenem/cilastin ...................................................... 564 immunodeficiency ..................................................... 557 materials .................................................................... 559 mice, infection ........................................................... 561 murine models ........................................................... 558 vigorous swabbing...................................................... 566 yeast burdens ..................................................... 561–562 Mucosal candidiasis ................................................. 557, 558 Mucosal infection ............................................................ 528 Multiplex PCR, aneuploidy detection assay genomic DNA template ........................................ 44–45 QIAGEN .................................................................... 44 thermal cycler .............................................................. 45 Murine immune response capture and normalisation ................................. 442–443 harvesting and preservation ............................... 437, 439 hybridization, cDNA probes...................... 438, 441–442 immuno-fluorescent labelling ............................ 440–441 immuno-suppression, CD1 mice ............... 436–437, 439 inoculum, Aspergillus fumigatus ...................436, 438–439 intra-nasal inoculation ....................................... 437, 439 isolation, total RNA................................... 437, 439–440 microarray data .......................................................... 438

reverse-transcribed cDNA ................................. 437–438 Murine models, oral and vaginal colonisation fungal burdens ........................................................... 530 mucosal colonisation .......................................... 531–532 oestrogen administration and fungal inoculation ....... 530 Mutants construction, C. albicans ............................................... 42 heterozygous colony PCR-based detection strategy .................... 29 FD1 and RD1.................................................. 22, 28 PCR mixture and block ......................................... 28 PCR program .................................................. 28–29 homozygous colony PCR-based detection ................................. 30 F1 and R1/F2 and R2............................................ 29 heterozygous strains ............................................... 29 marker recycling..................................................... 30 and parent strain .......................................................... 45 Mycophenolic acid (MPA) ..................................................4

N NAT gene. See Nourseothricin acetyltransferase gene National Institutes of Health (NIH) ............................... 398 Nematode growth medium (NGM) ........................ 448–452 Neomycin/G418, resistant gene markers ........................... 69 Neomycin resistance gene (NEO)...................................... 67 Neutrophils. See Polymorphonuclear neutrophils NGM. See Nematode growth medium NIH. See National Institutes of Health N-linked mannans ........................................................... 252 3-(N-morpholino) propanesulfonic acid (MOPS) .......... 134 Nourseothricin acetyltransferase (NAT) gene.................... 67 Nourseothricin (NAT), positive selectable markers ............................................................ 88 Nourseothricin resistance C. albicans transformants ...............................................5 colonies and streak ....................................................... 11 heterozygous mutant .....................................................6

O O.C.T. See Optimum cutting temperature O-linked mannans ........................................................... 252 Optimum cutting temperature (O.C.T.).......... 399–401, 405 Oral colonisation................................................................ 533 concurrent fungal burdens ..................................................... 530 mucosal colonisation .................................... 531–532 oestrogen administration and fungal inoculation .......................................... 530 swabbing .................................................................... 533 Orogastrointestinal candidiasis ............558. See also Mucosal and disseminated candidiasis Osmotic buffer ........................................................ 133, 134

HOST-FUNGUS INTERACTIONS 595 Index Over-expression. See Gene over-expression Overlap PCR conventional ................................................................ 68 method .................................................................. 67–68

P PAMPs. See Pathogen-associated molecular patterns Paracoccidioides brasiliensis. See Transcript profiling Paracoccidioides brasiliensis, antisense RNA AscI restriction ........................................................... 196 A. tumefaciens electroporation ............................................. 189, 193 mediated transformation.............. 189–190, 193–194 ultracompetent ..................................... 189, 192–193 column-based method ............................................... 196 description ................................................................. 187 fungal ATMT ............................................................ 188 gene expression .......................................................... 188 genomic DNA extraction .......................................... 190 hygromycin ................................................................ 197 knockdown efficiency ................................ 190, 195–196 plasmid construction.................................. 188, 190–192 positive transformants................................................ 195 T-DNA...................................................................... 192 Pathogen-associated molecular patterns (PAMPs) .......... 247 Pathogenesis ............................................................ 456, 457 Pattern-recognition receptors (PRRs) C. albicans and DCs network ..................................... 320 DCs invading pathogens ........................................... 320 major classes .............................................................. 320 PCI. See Phenol:chloroform:isoamyl alcohol 25:24:1 PCR. See Polymerase chain reaction pFrame Vector materials .................................................................... 172 methods ............................................................. 175–176 Phagocytosis. See also Polymorphonuclear neutrophils Cytochalasin D .......................................................... 309 flow cytometry, internalisation levels ................. 309, 310 in vitro assay materials .............................................................. 306 methods ............................................................... 308 Phenol:chloroform:isoamyl alcohol 25:24:1 (PCI) ............ 57 Phleomycin, Coccidioides concentration ..................................................... 145–146 gene disruption construction ............................. 136–138 GYE agar plates ................................................ 135, 142 and hygromycin ................................................. 125, 129 selection ..................................................................... 130 use.............................................................................. 135 Phosphorylation antibodies .................................................................. 345 modification state, protein ......................................... 346 Plasmid maps .................................................................... 88 Polymerase chain reaction (PCR)

complementation primers, gene CF and CR ............................................................ 23 coding sequence ..................................................... 33 program ................................................................. 33 diagnostic..................................................................... 79 DJ-PCR ................................................................ 75–76 first-round ................................................................... 75 fragments ..................................................................... 68 materials, primer sequence ........................................... 69 mini-blaster cassette F1/F2 and R1/R2 .................................................. 22 plasmid pDDB57 ............................................ 20, 26 program ........................................................... 26–27 template plasmid.................................................... 21 Polymorphonuclear neutrophils (PMNs) assay preparation ........................................................ 280 candidacidal activity................................................... 278 cell suspension ........................................................... 285 definition ................................................................... 278 description ................................................................. 277 growth curve analysis ................................................. 285 opsonisation, Candida cells ........................................ 282 peritoneal ........................................................... 280–282 phagocytosis and killing assay ............................ 282–284 preparation, day =-1 ................................................... 278 preparation, day =-2 ................................................... 278 stationary/lag phase ........................................... 279, 284 suspension.................................................................. 282 Proliferation assay ............................................................ 267 Protein modification antibody ..................................................................... 346 immunoblot ............................................................... 346 Protoplasting development .............................................................. 127 hyphae reduces........................................................... 127 quantity...................................................................... 127 solutions..................................................................... 124 transformation ........................................................... 128 Protoplast regeneration medium A. fumigatus ................................................................ 102 “top agar” ................................................................... 112 PRRs. See Pattern-recognition receptors

Q QIAprep Miniprep kit..................................... 135, 137–139 QIAquick gel extraction kit ................................................ 135, 138 PCR purification kit .......................................... 135, 138 Quantitative PCR (qPCR) .............................. 216, 221, 223

R Rapid detection, aneuploidy C. albicans laboratory strains ........................................ 41 CHEF ......................................................................... 42

HOST-FUNGUS INTERACTIONS 596 Index Rapid detection, aneuploidy (Continued ) data and electropherograms ......................................... 46 materials genomic DNA extraction ...................................... 42 testing .............................................................. 42–43 methods isolation, C. albicans ............................................... 44 multiplex PCR, detection assay ....................... 44–45 mutant vs. parent ................................................... 46, 47 PCR primers................................................................ 45 peak description and electropherogram ................. 46, 47 primer Set A .......................................................... 46, 48 tris–HCl ...................................................................... 45 Rat model, invasive pulmonary aspergillosis A. fumigatus spores ..................................... 512–513, 515 animal rearing and handling ...................... 512, 514–515 cyclophosphamide ..................................................... 517 diverse models ........................................................... 511 galactomannan measurements ................................... 518 infection, work stand prior......................................... 513 laryngoscope/paediatric otoscope .............................. 515 microsprayer, nebulizer system .......................... 513, 514 monitoring ......................................................... 515–516 neutropenia ................................................................ 512 post-mortem analyses ................................................ 514 sample analysis........................................................... 516 tetracycline................................................................. 517 RDA. See Representational difference analysis Real-time PCR Northern blots and RPAs .......................................... 347 cDNA Synthesis .................................................. 349 protocols ...................................................... 355–356 qPCR................................................................... 349 standard curve analysis................................. 356–357 SYBR green/fluorescent-labelled probe..................... 347 Reconstituted human epithelium (RHE) C. albicans-infected .................................................... 338 in vitro (see In vitro RHE, C. albicans) models........................................................................ 334 polycarbonate filter fed .............................................. 338 pre-infected ............................................................... 338 Reporter gLUC59 ............................................................ 538, 541 luciferase ............................................................ 537, 538 Representational difference analysis (RDA).................................................... 387–391 description ................................................................. 381 differential expressed genes........................................ 385 gene-specific oligonucleotide primers........................ 385 pathogenic dimorphic fungus .................................... 382 Respiratory burst in vitro assays ............................................................. 306 incubation, thioglycollate-elicited macrophages .................................................. 304 measurement.............................................................. 311

Reverse genetics analysis ................................................. 151 RHE. See Reconstituted human epithelium RNA amplification .......................................................... 411 RNA analysis, purification............................... 400, 403–404 RNA interference (RNAi) ADE2 ....................................................................... 170 antiparallel strands ............................................. 166–167 calcineurin A (CNA1) ................................................ 166 C. neoformans .......................................................174, 180 components ............................................................... 165 convergent promoters ................................................ 167 E. coli β-glucuronidase ............................................... 170 electroporation ................................... 172–173, 177–178 endogenous ribonuclease ........................................... 166 galactose-inducible GAL7 .................................. 170–171 gene deletion.............................................................. 168 genetic manipulation ................................................. 167 hpRNA ...................................................................... 166 mRNA abundance ............................................. 173, 179 multiple genes ............................................................ 168 PCR........................................................................... 171 pFrame vector ............................................ 172, 175–177 phenotypic screening ......................................... 173, 178 pIBB103 vector ..................................169, 173, 179–180 plasmid-based strategy .............................................. 169 resistance marker ....................................................... 171 “sentinel” gene ........................................................... 168 URA5 sentinel ................................................... 174, 180 vector (see GFP sentinel RNAi system, H. capsulatum ) RNA isolation. See Fungal RNA, microarray analysis RNA quality control, BioAnalyzer ............................412, 413, 416–417

S Saccharomyces cerevisiae complementation plasmid BY4741Δ trp.......................................................... 33 CSM-TRP plates................................................... 35 cut vector ............................................................... 35 microfuge tubes...................................................... 34 pDDB78 DNA enzymes ....................................... 33 plasmapper program .............................................. 34 CSM-TRP................................................................... 38 deletion cassettes ....................................................... 100 genomic DNA extraction .......................................... 103 growth, YPD medium ............................................... 101 PCR-based strategy and “in vivo” recombination ...... 106 recipient strain use ..................................................... 113 stocks.... ..................................................................... 114 strain FGSC 9721 ..................................................... 108 synthetic complete medium ....................................... 101 transformation ................................................... 108–109 SAT1 flipper cassette gene deletion.......................................................... 13, 14

HOST-FUNGUS INTERACTIONS 597 Index methods colonies appearance ........................................... 7, 11 parental wild-type strain .................................... 7, 11 YPD plates ............................................................ 11 PCR............................................................................. 12 plasmid pSFS2............................................................. 12 Site-specific recombinase, FLP ...........................................5 Southern blots analysis......................................................................... 94 probes..................................................................... 94, 95 restriction enzymes ...................................................... 95 washing and exposing ............................................ 94–95 Split dominant selectable markers overlap PCR ................................................................ 68 schematic diagram, double-joint PCR................... 73, 74 Subcutaneous candidiasis................................................. 543 Superficial infection C. albicans ................................................................... 538 gLUC59-expressing................................................... 538 Synthetic Amino Acid Medium Fungal (SAAMF) ...................................... 559, 564, 565 Synthetic complete medium, S. cerevisiae ........................ 101

T TAIL-PCR. See Thermal asymmetric interlaced PCR TB. See Trapping buffer T cell cytokine response BMDCs..................................................................... 262 dendritic analysis ....................................................... 271 pathogen-DC interaction .......................................... 274 secretion............................................................. 262, 268 T-DNA. See Transfer-DNA Tetracycline. See Inducible Gene expression Thermal asymmetric interlaced PCR (TAIL-PCR) and amplicon sequencing ............................................. 53 DNA isolation buffer................................................... 56 ExoSAP-IT ........................................................... 61–62 integration, T-DNA elements...................................... 64 LAD primers ......................................................... 57, 58 PCI...... ........................................................................ 57 reactions dilute primary ........................................................ 60 primary perform .............................................. 60, 61 secondary perform ................................................. 61 T-DNA insertion, Histoplasma .................................... 52 Thioglycollate alveolar macrophages ................................................. 305 sterile inflammation and leukocytes........................... 304 turk’s staining ............................................................. 314 Tissue culture .......................................................... 363, 364 Tissue preparation ................................................... 399, 407 Transcription factor commercial ELISA .................................................... 359 ELISA ............................................................... 346–347

nuclear lysis materials .............................................................. 349 method ................................................................ 354 Transcript profiling A549 pneumocyte infection....................................... 386 bioinformatic analysis ................................ 382, 385, 393 description, RDAs ..................................................... 381 differential expressed genes........................ 385, 391–393 extraction components, RNA .................... 383, 386–387 hybridization and PCR amplification ........................ 381 infection models ................................................ 382–383 mouse intraperitoneal infection .............................. 385–386 systemic infection ................................................ 386 RDAs................................................. 383–385, 387–391 Transfer-DNA (T-DNA) Agrobacterium initiate ............................................. 51–52 bearing cells ................................................................. 52 and gene-specific primers ............................................ 57 insertion ....................................................................... 62 TAIL-PCR primers..................................................... 65 transfer functions ......................................................... 59 vector-harboring Agrobacterium ..............................58, 59 Trapping buffer (TB)....................................................... 134

V Vaginal C. albicans ................................................................... 533 colonisation fungal burdens ..................................................... 530 mucosal colonisation .................................... 531–532 oestrogen administration and fungal inoculation ..................................................... 530 infections ................................................................... 528 mucosal sites .............................................................. 531 Virulence A. fumigatus ................................................................ 494 Aspergillus strain ......................................... 574–575, 581 catalase gene deletion mutants................................... 576 gene knockout ........................................................... 488 growth medium ......................................................... 505 pathogenic fungi ................................................ 487, 499 Vulvovaginal candidiasis .................................................. 538

W Western-blotting, PCK1p-driven over-expression ...................................... 238–239

Y Yeast peptone dextrose (YPD) medium..........................................................................8 plates............................................................................ 13 Yeast transformation, components and reactions ......................................................... 107 YPD. See Yeast peptone dextrose

Host-Fungus Interactions: Methods and Protocols (Methods in Molecular Biology, 845)

Host-Pathogen Interactions: Methods and Protocols (Methods in Molecular Biology)

Yeast Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Molecular Imaging: Methods and Protocols (Methods in Molecular Biology)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology, v787)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology 787)

Molecular Profiling: Methods and Protocols (Methods in Molecular Biology, 823)

DNA'Protein Interactions: Principles and Protocols (Methods in Molecular Biology)

Molecular Toxicology Protocols (Methods in Molecular Biology)

Bioinformatics. Methods and Protocols in Molecular Biology

Protein'Ligand Interactions: Methods and Applications (Methods in Molecular Biology)

Microchip Capillary Electrophoresis: Methods And Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Epidermal Cells: Methods and Protocols (Methods in Molecular Biology) (Methods in Molecular Biology Series)

Protein'Protein Interactions: Methods and Applications (Methods in Molecular Biology)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Human Embryogenesis: Methods and Protocols (Methods in Molecular Biology)

Immunological Tolerance: Methods and Protocols (Methods in Molecular Biology)

Clostridium difficile: Methods and Protocols (Methods in Molecular Biology, 646)

Hepatocytes: Methods and Protocols (Methods in Molecular Biology 640)

Biofuels: Methods and Protocols (Methods in Molecular Biology 581)

Bioconjugation Protocols: Strategies and Methods (Methods in Molecular Biology)

Riboswitches: Methods and Protocols (Methods in Molecular Biology)

Bioinformatics Methods and Protocols (Methods in Molecular Biology)

Argonaute Proteins: Methods and Protocols (Methods in Molecular Biology 725)

Surface Plasmon Resonance: Methods and Protocols (Methods in Molecular Biology)

Neuropeptides: Methods and Protocols (Methods in Molecular Biology 789)

Microbial Toxins: Methods and Protocols (Methods in Molecular Biology 739)

Retinoids: Methods and Protocols (Methods in Molecular Biology)

Human Papillomaviruses: Methods and Protocols (Methods in Molecular Biology)

Tumor Biomarker Discovery: Methods and Protocols (Methods in Molecular Biology)

Potassium Channels: Methods and Protocols (Methods in Molecular Biology)

Host-Fungus Interactions: Methods and Protocols (Methods in Molecular Biology, 845)

Host-Pathogen Interactions: Methods and Protocols (Methods in Molecular Biology)

Yeast Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Molecular Imaging: Methods and Protocols (Methods in Molecular Biology)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology, v787)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology 787)

Molecular Profiling: Methods and Protocols (Methods in Molecular Biology, 823)

DNA'Protein Interactions: Principles and Protocols (Methods in Molecular Biology)

Molecular Toxicology Protocols (Methods in Molecular Biology)

Bioinformatics. Methods and Protocols in Molecular Biology

Protein'Ligand Interactions: Methods and Applications (Methods in Molecular Biology)

Microchip Capillary Electrophoresis: Methods And Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Epidermal Cells: Methods and Protocols (Methods in Molecular Biology) (Methods in Molecular Biology Series)

Protein'Protein Interactions: Methods and Applications (Methods in Molecular Biology)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Human Embryogenesis: Methods and Protocols (Methods in Molecular Biology)

Immunological Tolerance: Methods and Protocols (Methods in Molecular Biology)

Clostridium difficile: Methods and Protocols (Methods in Molecular Biology, 646)

Hepatocytes: Methods and Protocols (Methods in Molecular Biology 640)

Biofuels: Methods and Protocols (Methods in Molecular Biology 581)

Bioconjugation Protocols: Strategies and Methods (Methods in Molecular Biology)

Riboswitches: Methods and Protocols (Methods in Molecular Biology)

Bioinformatics Methods and Protocols (Methods in Molecular Biology)

Argonaute Proteins: Methods and Protocols (Methods in Molecular Biology 725)

Surface Plasmon Resonance: Methods and Protocols (Methods in Molecular Biology)

Neuropeptides: Methods and Protocols (Methods in Molecular Biology 789)

Microbial Toxins: Methods and Protocols (Methods in Molecular Biology 739)

Retinoids: Methods and Protocols (Methods in Molecular Biology)

Human Papillomaviruses: Methods and Protocols (Methods in Molecular Biology)

Tumor Biomarker Discovery: Methods and Protocols (Methods in Molecular Biology)

Potassium Channels: Methods and Protocols (Methods in Molecular Biology)

Recommend Documents