METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of ...
25 downloads
1902 Views
24MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of Technology Pasadena, California Founding Editors
SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London NW1 7BY, UK First edition 2010 Copyright # 2010, Elsevier Inc. All Rights Reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@ elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made For information on all Academic Press publications visit our website at elsevierdirect.com ISBN: 978-0-12-381001-4 ISSN: 0076-6879 Printed and bound in United States of America 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Sara Al-Chalabi Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Maho Amano Laboratory of Advanced Chemical Biology, Graduate School of Advanced Life Science, Frontier Research Center for Post-Genome Science and Technology, Hokkaido University, Sapporo, Japan I. Jonathan Amster Department of Chemistry, University of Georgia, Athens, Georgia Hiromune Ando Department of Applied Bioorganic Chemistry, Faculty of Applied Biological Sciences, Gifu University, Yanagido, Gifu, and Institute for Integrated Cell-Material Sciences (iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto, Japan Aristotelis Antonopoulos Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Timor Baasov The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion—Israel Institute of Technology, Haifa, Israel George Barany Department of Chemistry, University of Minnesota, Minneapolis, Minnesota, USA Adam W. Barb Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA Michelle R. Bond Division of Translational Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, and Department of Chemistry, Stanford University, Stanford, California, USA
xv
xvi
Contributors
Andrew J. Borgert Center for Magnetic Resonance Research, University of Minnesota, Minneapolis, Minnesota, USA Terry D. Butters Department of Biochemistry, Oxford Glycobiology Institute, University of Oxford, Oxford, United Kingdom Ke´vin Canis Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Wengang Chai Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom Yasunori Chiba Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Robert Childs Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom Richard D. Cummings Department of Biochemistry, Emory University School of Medicine, Atlanta, Georgia, USA Anne Dell Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Steffen Eller Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, and Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Berlin, Germany A. Tony Etienne Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Ten Feizi Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom
Contributors
xvii
Yukari Fujimoto Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Koichi Fukase Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Michiko N. Fukuda Glycobiology Unit, Tumor Microenvironment Program, Cancer Center, SanfordBurnham Medical Research Institute, La Jolla, California, USA Paola Grassi Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Naoko Goto-Inoue Department of Molecular Anatomy, Hamamatsu University School of Medicine, Handayama, Higashi-ku, Hamamatsu, Shizuoka, Japan Rebecca Harrison Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Stuart M. Haslam Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Takahiro Hayasaka Department of Molecular Anatomy, Hamamatsu University School of Medicine, Handayama, Higashi-ku, Hamamatsu, Shizuoka, Japan Jun Hirabayashi Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Yuzuru Ikehara Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Hideharu Ishida Department of Applied Bioorganic Chemistry, Faculty of Applied Biological Sciences, Gifu University, Yanagido, Gifu, Japan Mohd Nazri Ismail Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom
xviii
Contributors
Yoko Itakura Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Hiromi Ito Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Masayuki Izumi Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Jihye Jang-Lee Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Yasuhiro Kajihara Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Akihiko Kameyama Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Jeyakumar Kandasamy The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion—Israel Institute of Technology, Haifa, Israel Koichi Kato Institute for Molecular Science and Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, Higashiyama, Myodaiji, Okazaki, Aichi, and Department of Structural Biology and Biomolecular Engineering, Graduate School of Pharmaceutical Sciences, Nagoya City University, Tanabe-dori, Mizuho-ku, Nagoya; The Glycoscience Institute, Ochanomizu University, Ohtsuka, Bunkyo-ku, Tokyo, Japan Norihito Kawasaki Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan Kay-Hooi Khoo Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei, Taiwan Makoto Kiso Department of Applied Bioorganic Chemistry, Faculty of Applied Biological Sciences, Gifu University, Yanagido, Gifu, and Institute for Integrated Cell-Material
Contributors
xix
Sciences (iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto, Japan Ken Kitajima Bioscience and Biotechnology Center, Graduate School of Bioagricultural Science, Nagoya University, Nagoya, Japan Jennifer J. Kohler Division of Translational Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, USA Atsushi Kuno Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Tatiana N. Laremore Department of Chemistry and Chemical Biology, Rensselaer Polytechnic Institute, Troy, New York, USA Franklin E. Leach III Department of Chemistry, University of Georgia, Athens, Georgia ¨nen Anne Leppa Department of Biosciences, Division of Biochemistry, University of Helsinki, Viikinkaari, Helsinki, Finland Robert J. Linhardt Department of Chemistry and Chemical Biology, and Departments of Chemical and Biological Engineering and Biology, Center for Biotechnology and Interdisciplinary Studies, Rensselaer Polytechnic Institute, Troy, New York, USA Mian Liu Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA Yan Liu Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom David Live Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA Todd L. Lowary The Alberta Ingenuity Centre for Carbohydrate Science, Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada Shino Manabe RIKEN Advanced Science Institute, Saitama, Japan
xx
Contributors
Atsushi Matsuda Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Hitoshi Matsumoto Department of Molecular Biochemistry and Clinical Investigation, Osaka University Graduate School of Medicine, Yamada-oka, Suita, Japan Takahiko Matsushita Graduate School of Advanced Life Science and Frontier Research Center for Post-Genome Science and Technology, Hokkaido University, Sapporo, Japan Eiji Miyoshi Department of Molecular Biochemistry and Clinical Investigation, Osaka University Graduate School of Medicine, Yamada-oka, Suita, Japan Kenta Moriwaki Department of Molecular Biochemistry and Clinical Investigation, Osaka University Graduate School of Medicine, Yamada-oka, Suita, Japan Claudia Muhle-Goll European Molecular Biology Laboratory, Heidelberg, Germany Hisashi Narimatsu Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Shin-Ichiro Nishimura Laboratory of Advanced Chemical Biology, Graduate School of Advanced Life Science, Frontier Research Center for Post-Genome Science and Technology, Hokkaido University, Sapporo, Japan Simon J. North Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Igor Nudelman The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion—Israel Institute of Technology, Haifa, Israel Mary K. O’Reilly Departments of Chemical Physiology and Molecular Biology, The Scripps Research Institute, La Jolla, California, USA Ryo Okamoto Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan
Contributors
xxi
Angelina S. Palma Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom Poh-Choo Pang Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom James C. Paulson Departments of Chemical Physiology and Molecular Biology, The Scripps Research Institute, La Jolla, California, USA Varvara Pokrovskaya The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion—Israel Institute of Technology, Haifa, Israel Myles B. Poulin The Alberta Ingenuity Centre for Carbohydrate Science, Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada Chihiro Sato Bioscience and Biotechnology Center, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan Takashi Sato Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Peter H. Seeberger Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, and Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Arnimallee, Berlin, Germany Mitsutoshi Setou Department of Molecular Anatomy, Hamamatsu University School of Medicine, Handayama, Higashi-ku, Hamamatsu, Shizuoka, Japan Atsushi Shimoyama Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Shinichiro Shinzaki Department of Molecular Biochemistry and Clinical Investigation, Osaka University Graduate School of Medicine, Yamada-oka, Suita, Japan
xxii
Contributors
Kemal Solakyildirim Department of Chemistry and Chemical Biology, Rensselaer Polytechnic Institute, Troy, New York, USA Katsunori Tanaka Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Hiroaki Tateno Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Alana Trollope Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Markus Weishaupt Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, and Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Berlin, Germany Chad M. Whitman Division of Translational Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, and Department of Chemistry, Stanford University, Stanford, California, USA Yoshiki Yamaguchi Structural Glycobiology Team, Systems Glycobiology Research Group, Chemical Biology Department, RIKEN, Advanced Science Institute, Hirosawa, Wako, Japan Nao Yamakawa Bioscience and Biotechnology Center, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan Kazuo Yamamoto Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan Naoki Yamamoto Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Jian Yin Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, and Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Arnimallee, Berlin, Germany
Contributors
xxiii
Tohru Yoneyama Department of Urology, Hirosaki University of Medicine, Hirosaki, Japan Seok-Ho Yu Division of Translational Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, USA Shin-Yi Yu Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei, Taiwan Yibing Zhang Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom
PREFACE
In 2006, we published three volumes in the Methods in Enzymology dedicated to Glycobiology field as follows: Glycobiology (Volume 415), Glycomics (Volume 416), and Functional Glycomics (Volume 417). We have seen a tremendous progress in the Glycobiology field since then. In particular, an explosive progress has been made in immunology, neuroglycbiology, glycomics, signal transduction, and many other disciplines, examining each unique system and employing new technology. The Academic Press kindly gave another opportunity to update the introduction of new methods to a large variety of readers who like to contribute to the advancement of Glycosciences. In the current series of Methods in Enzymology, Glycomics (Volume 478), Functional Glycomics (Volume 479), and Glycobiology (Volume 480) have been dedicated to disseminate information on the methods of determining the biological roles of carbohydrates, thanks to Academic Press Manager, particularly to Ms. Zoe Kruze and Ms. Delsy Retchagar. In the current book A Glycomics (Volume 478), wide topics of glycomics are covered, and glycomics revealed by mass spectrometric analysis, by carbohydrate-binding proteins, and chemical glycobiology are described. The latter include protein–carbohydrate interaction, synthetic carbohydrate chemistry, and identification of carbohydrate-binding protein by carbohydrate mimicry peptides. I have tried to present as new development as possible of these expanding fields in this book. The second volume (Volume 479) covers new development in glycosciences, including functional studies of glycosylation in stem cells, functions revealed by gene knockout mouse, glycan defects in muscular dystrophy and carcinoma. The third volume (Volume 480) covers proteoglycan function, infection, immunity, and carbohydrate-binding proteins including galectin, and new development including O-glycosylation in Notch and other signaling. I believe that we have a collection of outstanding contributors who represent respective expertise and field. I believe that this book will be useful to a wide variety of readers from graduate students, researchers in academic, and industry, to those who would like to teach Glycobiology and Glycosciences at various levels. We hope that this book will contribute to further explosive progress in Glycosciences and Glycobiology. MINORU FUKUDA xxv
METHODS IN ENZYMOLOGY
VOLUME I. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME II. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME III. Preparation and Assay of Substrates Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME IV. Special Techniques for the Enzymologist Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME V. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VI. Preparation and Assay of Enzymes (Continued) Preparation and Assay of Substrates Special Techniques Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VII. Cumulative Subject Index Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME IX. Carbohydrate Metabolism Edited by WILLIS A. WOOD VOLUME X. Oxidation and Phosphorylation Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME XI. Enzyme Structure Edited by C. H. W. HIRS VOLUME XII. Nucleic Acids (Parts A and B) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XIII. Citric Acid Cycle Edited by J. M. LOWENSTEIN VOLUME XIV. Lipids Edited by J. M. LOWENSTEIN VOLUME XV. Steroids and Terpenoids Edited by RAYMOND B. CLAYTON xxvii
xxviii
Methods in Enzymology
VOLUME XVI. Fast Reactions Edited by KENNETH KUSTIN VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B) Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND VOLUME XX. Nucleic Acids and Protein Synthesis (Part C) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXI. Nucleic Acids (Part D) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXII. Enzyme Purification and Related Techniques Edited by WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis (Part A) Edited by ANTHONY SAN PIETRO VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B) Edited by ANTHONY SAN PIETRO VOLUME XXV. Enzyme Structure (Part B) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVI. Enzyme Structure (Part C) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVII. Enzyme Structure (Part D) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVIII. Complex Carbohydrates (Part B) Edited by VICTOR GINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXXI. Biomembranes (Part A) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXII. Biomembranes (Part B) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B) Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
Methods in Enzymology
VOLUME XXXV. Lipids (Part B) Edited by JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues, and Organ Systems) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XLI. Carbohydrate Metabolism (Part B) Edited by W. A. WOOD VOLUME XLII. Carbohydrate Metabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Edited by KLAUS MOSBACH VOLUME XLV. Proteolytic Enzymes (Part B) Edited by LASZLO LORAND VOLUME XLVI. Affinity Labeling Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure (Part E) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLVIII. Enzyme Structure (Part F) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLIX. Enzyme Structure (Part G) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME L. Complex Carbohydrates (Part C) Edited by VICTOR GINSBURG VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES VOLUME LII. Biomembranes (Part C: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER
xxix
xxx
Methods in Enzymology
VOLUME LIII. Biomembranes (Part D: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LIV. Biomembranes (Part E: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LV. Biomembranes (Part F: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVI. Biomembranes (Part G: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVII. Bioluminescence and Chemiluminescence Edited by MARLENE A. DELUCA VOLUME LVIII. Cell Culture Edited by WILLIAM B. JAKOBY AND IRA PASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME LX. Nucleic Acids and Protein Synthesis (Part H) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME 61. Enzyme Structure (Part H) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 62. Vitamins and Coenzymes (Part D) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and Inhibitor Methods) Edited by DANIEL L. PURICH VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes and Complex Enzyme Systems) Edited by DANIEL L. PURICH VOLUME 65. Nucleic Acids (Part I) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME 66. Vitamins and Coenzymes (Part E) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 67. Vitamins and Coenzymes (Part F) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 68. Recombinant DNA Edited by RAY WU VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C) Edited by ANTHONY SAN PIETRO VOLUME 70. Immunochemical Techniques (Part A) Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE
Methods in Enzymology
xxxi
VOLUME 71. Lipids (Part C) Edited by JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Edited by JOHN M. LOWENSTEIN VOLUME 73. Immunochemical Techniques (Part B) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 74. Immunochemical Techniques (Part C) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE VOLUME 77. Detoxication and Drug Metabolism Edited by WILLIAM B. JAKOBY VOLUME 78. Interferons (Part A) Edited by SIDNEY PESTKA VOLUME 79. Interferons (Part B) Edited by SIDNEY PESTKA VOLUME 80. Proteolytic Enzymes (Part C) Edited by LASZLO LORAND VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I) Edited by LESTER PACKER VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN VOLUME 83. Complex Carbohydrates (Part D) Edited by VICTOR GINSBURG VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus and the Cytoskeleton) Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM VOLUME 86. Prostaglandins and Arachidonate Metabolites Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates, Stereo-chemistry, and Rate Studies) Edited by DANIEL L. PURICH VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II) Edited by LESTER PACKER
xxxii
Methods in Enzymology
VOLUME 89. Carbohydrate Metabolism (Part D) Edited by WILLIS A. WOOD VOLUME 90. Carbohydrate Metabolism (Part E) Edited by WILLIS A. WOOD VOLUME 91. Enzyme Structure (Part I) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc Receptors, and Cytotoxicity) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 94. Polyamines Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80 Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and Targeting (General Methods; Eukaryotes)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing and Recycling) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 99. Hormone Action (Part F: Protein Kinases) Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN VOLUME 100. Recombinant DNA (Part B) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 101. Recombinant DNA (Part C) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 102. Hormone Action (Part G: Calmodulin and Calcium-Binding Proteins) Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 104. Enzyme Purification and Related Techniques (Part C) Edited by WILLIAM B. JAKOBY
Methods in Enzymology
xxxiii
VOLUME 105. Oxygen Radicals in Biological Systems Edited by LESTER PACKER VOLUME 106. Posttranslational Modifications (Part A) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 107. Posttranslational Modifications (Part B) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and Characterization of Lymphoid Cells) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 109. Hormone Action (Part I: Peptide Hormones) Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY VOLUME 110. Steroids and Isoprenoids (Part A) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 111. Steroids and Isoprenoids (Part B) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 112. Drug and Enzyme Targeting (Part A) Edited by KENNETH J. WIDDER AND RALPH GREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds Edited by ALTON MEISTER VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116. Immunochemical Techniques (Part H: Effectors and Mediators of Lymphoid Cell Functions) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117. Enzyme Structure (Part J) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 118. Plant Molecular Biology Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH VOLUME 119. Interferons (Part C) Edited by SIDNEY PESTKA VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101 VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 122. Vitamins and Coenzymes (Part G) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
xxxiv
Methods in Enzymology
VOLUME 123. Vitamins and Coenzymes (Part H) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and Chloroplasts: General Approaches and Transport Systems) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and Chloroplasts: Protonmotive Force) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 127. Biomembranes (Part O: Protons and Water: Structure and Translocation) Edited by LESTER PACKER VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and Molecular Biology) Edited by JERE P. SEGREST AND JOHN J. ALBERS VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology, and Metabolism) Edited by JOHN J. ALBERS AND JERE P. SEGREST VOLUME 130. Enzyme Structure (Part K) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 131. Enzyme Structure (Part L) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and Cell-Mediated Cytotoxicity) Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE VOLUME 133. Bioluminescence and Chemiluminescence (Part B) Edited by MARLENE DELUCA AND WILLIAM D. MCELROY VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile Apparatus and the Cytoskeleton) Edited by RICHARD B. VALLEE VOLUME 135. Immobilized Enzymes and Cells (Part B) Edited by KLAUS MOSBACH VOLUME 136. Immobilized Enzymes and Cells (Part C) Edited by KLAUS MOSBACH VOLUME 137. Immobilized Enzymes and Cells (Part D) Edited by KLAUS MOSBACH VOLUME 138. Complex Carbohydrates (Part E) Edited by VICTOR GINSBURG
Methods in Enzymology
xxxv
VOLUME 139. Cellular Regulators (Part A: Calcium- and Calmodulin-Binding Proteins) Edited by ANTHONY R. MEANS AND P. MICHAEL CONN VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134 VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids) Edited by P. MICHAEL CONN AND ANTHONY R. MEANS VOLUME 142. Metabolism of Aromatic Amino Acids and Amines Edited by SEYMOUR KAUFMAN VOLUME 143. Sulfur and Sulfur Amino Acids Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 146. Peptide Growth Factors (Part A) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147. Peptide Growth Factors (Part B) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 148. Plant Cell Membranes Edited by LESTER PACKER AND ROLAND DOUCE VOLUME 149. Drug and Enzyme Targeting (Part B) Edited by RALPH GREEN AND KENNETH J. WIDDER VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Edited by GIOVANNI DI SABATO VOLUME 151. Molecular Genetics of Mammalian Cells Edited by MICHAEL M. GOTTESMAN VOLUME 152. Guide to Molecular Cloning Techniques Edited by SHELBY L. BERGER AND ALAN R. KIMMEL VOLUME 153. Recombinant DNA (Part D) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 154. Recombinant DNA (Part E) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 155. Recombinant DNA (Part F) Edited by RAY WU VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport: The Na, K-Pump) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
xxxvi
Methods in Enzymology
VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport: Calcium, Proton, and Potassium Pumps) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 158. Metalloproteins (Part A) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 164. Ribosomes Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE VOLUME 165. Microbial Toxins: Tools for Enzymology Edited by SIDNEY HARSHMAN VOLUME 166. Branched-Chain Amino Acids Edited by ROBERT HARRIS AND JOHN R. SOKATCH VOLUME 167. Cyanobacteria Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A) Edited by JACEK HAWIGER VOLUME 170. Nucleosomes Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model Membranes) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation and Characterization) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
Methods in Enzymology
xxxvii
VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167 VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and Dynamics) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 178. Antibodies, Antigens, and Molecular Mimicry Edited by JOHN J. LANGONE VOLUME 179. Complex Carbohydrates (Part F) Edited by VICTOR GINSBURG VOLUME 180. RNA Processing (Part A: General Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 181. RNA Processing (Part B: Specific Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 182. Guide to Protein Purification Edited by MURRAY P. DEUTSCHER VOLUME 183. Molecular Evolution: Computer Analysis of Protein and Nucleic Acid Sequences Edited by RUSSELL F. DOOLITTLE VOLUME 184. Avidin-Biotin Technology Edited by MEIR WILCHEK AND EDWARD A. BAYER VOLUME 185. Gene Expression Technology Edited by DAVID V. GOEDDEL VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and Antioxidants) Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 187. Arachidonate Related Lipid Mediators Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK VOLUME 188. Hydrocarbons and Methylotrophy Edited by MARY E. LIDSTROM VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects) Edited by LESTER PACKER
xxxviii
Methods in Enzymology
VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications) Edited by LESTER PACKER VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 193. Mass Spectrometry Edited by JAMES A. MCCLOSKEY VOLUME 194. Guide to Yeast Genetics and Molecular Biology Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN VOLUME 196. Molecular Motors and the Cytoskeleton Edited by RICHARD B. VALLEE VOLUME 197. Phospholipases Edited by EDWARD A. DENNIS VOLUME 198. Peptide Growth Factors (Part C) Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194 VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays, Purification, Antibodies, Functional Analysis, Cloning, and Expression) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 202. Molecular Design and Modeling: Concepts and Applications (Part A: Proteins, Peptides, and Enzymes) Edited by JOHN J. LANGONE VOLUME 203. Molecular Design and Modeling: Concepts and Applications (Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs) Edited by JOHN J. LANGONE VOLUME 204. Bacterial Genetic Systems Edited by JEFFREY H. MILLER VOLUME 205. Metallobiochemistry (Part B: Metallothionein and Related Molecules) Edited by JAMES F. RIORDAN AND BERT L. VALLEE
Methods in Enzymology
xxxix
VOLUME 206. Cytochrome P450 Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON VOLUME 207. Ion Channels Edited by BERNARDO RUDY AND LINDA E. IVERSON VOLUME 208. Protein–DNA Interactions Edited by ROBERT T. SAUER VOLUME 209. Phospholipid Biosynthesis Edited by EDWARD A. DENNIS AND DENNIS E. VANCE VOLUME 210. Numerical Computer Methods Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation, and Antioxidation) Edited by LESTER PACKER VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis) Edited by LESTER PACKER VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B) Edited by JACEK J. HAWIGER VOLUME 216. Recombinant DNA (Part G) Edited by RAY WU VOLUME 217. Recombinant DNA (Part H) Edited by RAY WU VOLUME 218. Recombinant DNA (Part I) Edited by RAY WU VOLUME 219. Reconstitution of Intracellular Transport Edited by JAMES E. ROTHMAN VOLUME 220. Membrane Fusion Techniques (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 221. Membrane Fusion Techniques (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors) Edited by LASZLO LORAND AND KENNETH G. MANN
xl
Methods in Enzymology
VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian Blood Coagulation Factors) Edited by LASZLO LORAND AND KENNETH G. MANN VOLUME 224. Molecular Evolution: Producing the Biochemical Data Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN, AND ALLAN C. WILSON VOLUME 225. Guide to Techniques in Mouse Development Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods for Probing Metal Ion Environments in Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 228. Aqueous Two-Phase Systems Edited by HARRY WALTER AND GO¨TE JOHANSSON VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227 VOLUME 230. Guide to Techniques in Glycobiology Edited by WILLIAM J. LENNARZ AND GERALD W. HART VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 232. Hemoglobins (Part C: Biophysical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 233. Oxygen Radicals in Biological Systems (Part C) Edited by LESTER PACKER VOLUME 234. Oxygen Radicals in Biological Systems (Part D) Edited by LESTER PACKER VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria with Host Cells) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 237. Heterotrimeric G Proteins Edited by RAVI IYENGAR VOLUME 238. Heterotrimeric G-Protein Effectors Edited by RAVI IYENGAR
Methods in Enzymology
VOLUME 239. Nuclear Magnetic Resonance (Part C) Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER VOLUME 240. Numerical Computer Methods (Part B) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 241. Retroviral Proteases Edited by LAWRENCE C. KUO AND JULES A. SHAFER VOLUME 242. Neoglycoconjugates (Part A) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 243. Inorganic Microbial Sulfur Metabolism Edited by HARRY D. PECK, JR., AND JEAN LEGALL VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases Edited by ALAN J. BARRETT VOLUME 245. Extracellular Matrix Components Edited by E. RUOSLAHTI AND E. ENGVALL VOLUME 246. Biochemical Spectroscopy Edited by KENNETH SAUER VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases Edited by ALAN J. BARRETT VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in Enzyme Dynamics) Edited by DANIEL L. PURICH VOLUME 250. Lipid Modifications of Proteins Edited by PATRICK J. CASEY AND JANICE E. BUSS VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and Thiyl Radicals) Edited by LESTER PACKER VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal Transduction and Gene Regulation) Edited by LESTER PACKER VOLUME 253. Adhesion of Microbial Pathogens Edited by RON J. DOYLE AND ITZHAK OFEK VOLUME 254. Oncogene Techniques Edited by PETER K. VOGT AND INDER M. VERMA VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
xli
xlii
Methods in Enzymology
VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved in Transport) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 258. Redox-Active Amino Acids in Biology Edited by JUDITH P. KLINMAN VOLUME 259. Energetics of Biological Macromolecules Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids Edited by THOMAS L. JAMES VOLUME 262. DNA Replication Edited by JUDITH L. CAMPBELL VOLUME 263. Plasma Lipoproteins (Part C: Quantitation) Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 265. Cumulative Subject Index Volumes 228, 230–262 VOLUME 266. Computer Methods for Macromolecular Sequence Analysis Edited by RUSSELL F. DOOLITTLE VOLUME 267. Combinatorial Chemistry Edited by JOHN N. ABELSON VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase) Edited by LESTER PACKER VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes) Edited by LESTER PACKER VOLUME 270. High Resolution Separation and Analysis of Biological Macromolecules (Part A: Fundamentals) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 271. High Resolution Separation and Analysis of Biological Macromolecules (Part B: Applications) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 272. Cytochrome P450 (Part B) Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 273. RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA
Methods in Enzymology
xliii
VOLUME 274. RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA VOLUME 275. Viral Polymerases and Related Proteins Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL VOLUME 276. Macromolecular Crystallography (Part A) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 277. Macromolecular Crystallography (Part B) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 278. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 279. Vitamins and Coenzymes (Part I) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 280. Vitamins and Coenzymes (Part J) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 281. Vitamins and Coenzymes (Part K) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 282. Vitamins and Coenzymes (Part L) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 283. Cell Cycle Control Edited by WILLIAM G. DUNPHY VOLUME 284. Lipases (Part A: Biotechnology) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289 VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 287. Chemokines Edited by RICHARD HORUK VOLUME 288. Chemokine Receptors Edited by RICHARD HORUK VOLUME 289. Solid Phase Peptide Synthesis Edited by GREGG B. FIELDS VOLUME 290. Molecular Chaperones Edited by GEORGE H. LORIMER AND THOMAS BALDWIN VOLUME 291. Caged Compounds Edited by GERARD MARRIOTT VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN
xliv
Methods in Enzymology
VOLUME 293. Ion Channels (Part B) Edited by P. MICHAEL CONN VOLUME 294. Ion Channels (Part C) Edited by P. MICHAEL CONN VOLUME 295. Energetics of Biological Macromolecules (Part B) Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON VOLUME 296. Neurotransmitter Transporters Edited by SUSAN G. AMARA VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture Edited by LEE MCINTOSH VOLUME 298. Molecular Motors and the Cytoskeleton (Part B) Edited by RICHARD B. VALLEE VOLUME 299. Oxidants and Antioxidants (Part A) Edited by LESTER PACKER VOLUME 300. Oxidants and Antioxidants (Part B) Edited by LESTER PACKER VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C) Edited by LESTER PACKER VOLUME 302. Green Fluorescent Protein Edited by P. MICHAEL CONN VOLUME 303. cDNA Preparation and Display Edited by SHERMAN M. WEISSMAN VOLUME 304. Chromatin Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE VOLUME 305. Bioluminescence and Chemiluminescence (Part C) Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT VOLUME 307. Confocal Microscopy Edited by P. MICHAEL CONN VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of Enzyme Catalysis) Edited by DANIEL L. PURICH AND VERN L. SCHRAMM VOLUME 309. Amyloid, Prions, and Other Protein Aggregates Edited by RONALD WETZEL VOLUME 310. Biofilms Edited by RON J. DOYLE
Methods in Enzymology
VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 313. Antisense Technology (Part A: General Methods, Methods of Delivery, and RNA Studies) Edited by M. IAN PHILLIPS VOLUME 314. Antisense Technology (Part B: Applications) Edited by M. IAN PHILLIPS VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A) Edited by KRZYSZTOF PALCZEWSKI VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B) Edited by KRZYSZTOF PALCZEWSKI VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 319. Singlet Oxygen, UV-A, and Ozone Edited by LESTER PACKER AND HELMUT SIES VOLUME 320. Cumulative Subject Index Volumes 290–319 VOLUME 321. Numerical Computer Methods (Part C) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 322. Apoptosis Edited by JOHN C. REED VOLUME 323. Energetics of Biological Macromolecules (Part C) Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 324. Branched-Chain Amino Acids (Part B) Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene Expression and Protein Purification) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell Biology and Physiology) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
xlv
xlvi
Methods in Enzymology
VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C: Protein–Protein Interactions and Genomics) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases Involved in Vesicular Traffic) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 330. Hyperthermophilic Enzymes (Part A) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 331. Hyperthermophilic Enzymes (Part B) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 334. Hyperthermophilic Enzymes (Part C) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 335. Flavonoids and Other Polyphenols Edited by LESTER PACKER VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and Molecular Biological Aspects) Edited by RON J. DOYLE VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and Physicochemical Aspects) Edited by RON J. DOYLE VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 340. Drug–Nucleic Acid Interactions Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING VOLUME 341. Ribonucleases (Part A) Edited by ALLEN W. NICHOLSON VOLUME 342. Ribonucleases (Part B) Edited by ALLEN W. NICHOLSON VOLUME 343. G Protein Pathways (Part A: Receptors) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
Methods in Enzymology
xlvii
VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 346. Gene Therapy Methods Edited by M. IAN PHILLIPS VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A: Selenoproteins and Thioredoxin) Edited by HELMUT SIES AND LESTER PACKER VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol Enzymes and Proteins) Edited by HELMUT SIES AND LESTER PACKER VOLUME 349. Superoxide Dismutase Edited by LESTER PACKER VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 352. Redox Cell Biology and Genetics (Part A) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 353. Redox Cell Biology and Genetics (Part B) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and Characterization of Enzyme Reaction Intermediates) Edited by DANIEL L. PURICH VOLUME 355. Cumulative Subject Index Volumes 321–354 VOLUME 356. Laser Capture Microscopy and Microdissection Edited by P. MICHAEL CONN VOLUME 357. Cytochrome P450, Part C Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and Function of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 359. Nitric Oxide (Part D) Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 360. Biophotonics (Part A) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 361. Biophotonics (Part B) Edited by GERARD MARRIOTT AND IAN PARKER
xlviii
Methods in Enzymology
VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 364. Nuclear Receptors Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF VOLUME 365. Differentiation of Embryonic Stem Cells Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER VOLUME 366. Protein Phosphatases Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN VOLUME 367. Liposomes (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 368. Macromolecular Crystallography (Part C) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 369. Combinational Chemistry (Part B) Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN VOLUME 370. RNA Polymerases and Associated Factors (Part C) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 371. RNA Polymerases and Associated Factors (Part D) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 372. Liposomes (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 373. Liposomes (Part C) Edited by NEJAT DU¨ZGU¨NES VOLUME 374. Macromolecular Crystallography (Part D) Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A) Edited by C. DAVID ALLIS AND CARL WU VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B) Edited by C. DAVID ALLIS AND CARL WU VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C) Edited by C. DAVID ALLIS AND CARL WU VOLUME 378. Quinones and Quinone Enzymes (Part A) Edited by HELMUT SIES AND LESTER PACKER VOLUME 379. Energetics of Biological Macromolecules (Part D) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 380. Energetics of Biological Macromolecules (Part E) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS
Methods in Enzymology
xlix
VOLUME 381. Oxygen Sensing Edited by CHANDAN K. SEN AND GREGG L. SEMENZA VOLUME 382. Quinones and Quinone Enzymes (Part B) Edited by HELMUT SIES AND LESTER PACKER VOLUME 383. Numerical Computer Methods (Part D) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 384. Numerical Computer Methods (Part E) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 385. Imaging in Biological Research (Part A) Edited by P. MICHAEL CONN VOLUME 386. Imaging in Biological Research (Part B) Edited by P. MICHAEL CONN VOLUME 387. Liposomes (Part D) Edited by NEJAT DU¨ZGU¨NES VOLUME 388. Protein Engineering Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL VOLUME 389. Regulators of G-Protein Signaling (Part A) Edited by DAVID P. SIDEROVSKI VOLUME 390. Regulators of G-Protein Signaling (Part B) Edited by DAVID P. SIDEROVSKI VOLUME 391. Liposomes (Part E) Edited by NEJAT DU¨ZGU¨NES VOLUME 392. RNA Interference Edited by ENGELKE ROSSI VOLUME 393. Circadian Rhythms Edited by MICHAEL W. YOUNG VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C) Edited by THOMAS L. JAMES VOLUME 395. Producing the Biochemical Data (Part B) Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON VOLUME 396. Nitric Oxide (Part E) Edited by LESTER PACKER AND ENRIQUE CADENAS VOLUME 397. Environmental Microbiology Edited by JARED R. LEADBETTER VOLUME 398. Ubiquitin and Protein Degradation (Part A) Edited by RAYMOND J. DESHAIES VOLUME 399. Ubiquitin and Protein Degradation (Part B) Edited by RAYMOND J. DESHAIES
l
Methods in Enzymology
VOLUME 400. Phase II Conjugation Enzymes and Transport Systems Edited by HELMUT SIES AND LESTER PACKER VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases Edited by HELMUT SIES AND LESTER PACKER VOLUME 402. Biological Mass Spectrometry Edited by A. L. BURLINGAME VOLUME 403. GTPases Regulating Membrane Targeting and Fusion Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 404. GTPases Regulating Membrane Dynamics Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates Edited by A. L. BURLINGAME VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 408. DNA Repair (Part A) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 409. DNA Repair (Part B) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench Protocols) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 411. DNA Microarrays (Part B: Databases and Statistics) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 414. Measuring Biological Responses with Automated Microscopy Edited by JAMES INGLESE VOLUME 415. Glycobiology Edited by MINORU FUKUDA VOLUME 416. Glycomics Edited by MINORU FUKUDA VOLUME 417. Functional Glycomics Edited by MINORU FUKUDA
Methods in Enzymology
li
VOLUME 418. Embryonic Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 419. Adult Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 420. Stem Cell Tools and Other Experimental Protocols Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for Genomic Engineering Edited by KELLY T. HUGHES VOLUME 422. Two-Component Signaling Systems, Part A Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 423. Two-Component Signaling Systems, Part B Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 424. RNA Editing Edited by JONATHA M. GOTT VOLUME 425. RNA Modification Edited by JONATHA M. GOTT VOLUME 426. Integrins Edited by DAVID CHERESH VOLUME 427. MicroRNA Methods Edited by JOHN J. ROSSI VOLUME 428. Osmosensing and Osmosignaling Edited by HELMUT SIES AND DIETER HAUSSINGER VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics Edited by JON LORSCH VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical Methods Edited by JON LORSCH VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and Chemical-Based Approaches Edited by JON LORSCH VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid Analysis Edited by H. ALEX BROWN VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and Lipids in Disease Edited by H. ALEX BROWN
lii
Methods in Enzymology
VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling Edited by H. ALEX BROWN VOLUME 435. Oxygen Biology and Hypoxia Edited by HELMUT SIES AND BERNHARD BRU¨NE VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A) Edited by ROBERT K. POOLE VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B) Edited by ROBERT K. POOLE VOLUME 438. Small GTPases in Disease (Part A) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 439. Small GTPases in Disease (Part B) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 442. Programmed Cell Death, General Principles for Studying Cell Death (Part A) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 443. Angiogenesis: In Vitro Systems Edited by DAVID A. CHERESH VOLUME 444. Angiogenesis: In Vivo Systems (Part A) Edited by DAVID A. CHERESH VOLUME 445. Angiogenesis: In Vivo Systems (Part B) Edited by DAVID A. CHERESH VOLUME 446. Programmed Cell Death, The Biology and Therapeutic Implications of Cell Death (Part B) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA Decay Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN
Methods in Enzymology
liii
VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality Control RNA Decay Pathways Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 450. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A) Edited by DANIEL J. KLIONSKY VOLUME 452. Autophagy in Mammalian Systems (Part B) Edited by DANIEL J. KLIONSKY VOLUME 453. Autophagy in Disease and Clinical Applications (Part C) Edited by DANIEL J. KLIONSKY VOLUME 454. Computer Methods (Part A) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 455. Biothermodynamics (Part A) Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED) VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport Complexes and Reactive Oxygen Species Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases, Protein Phosphatases and Mitochondrial Diseases Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and Peptides Edited by DAVID A. HOPWOOD VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and Carbohydrates Edited by DAVID A. HOPWOOD VOLUME 460. Chemokines, Part A Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 461. Chemokines, Part B Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 462. Non-Natural Amino Acids Edited by TOM W. MUIR AND JOHN N. ABELSON VOLUME 463. Guide to Protein Purification, 2nd Edition Edited by RICHARD R. BURGESS AND MURRAY P. DEUTSCHER VOLUME 464. Liposomes, Part F Edited by NEJAT DU¨ZGU¨NES
liv
Methods in Enzymology
VOLUME 465. Liposomes, Part G Edited by NEJAT DU¨ZGU¨NES VOLUME 466. Biothermodynamics, Part B Edited by MICHAEL L. JOHNSON, GARY K. ACKERS, AND JO M. HOLT VOLUME 467. Computer Methods Part B Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 468. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part A Edited by DANIEL HERSCHLAG VOLUME 469. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part B Edited by DANIEL HERSCHLAG VOLUME 470. Guide to Yeast Genetics: Functional Genomics, Proteomics, and Other Systems Analysis, 2nd Edition Edited by GERALD FINK, JONATHAN WEISSMAN, AND CHRISTINE GUTHRIE VOLUME 471. Two-Component Signaling Systems, Part C Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 472. Single Molecule Tools, Part A: Fluorescence Based Approaches Edited by NILS WALTER VOLUME 473. Thiol Redox Transitions in Cell Signaling, Part A Chemistry and Biochemistry of Low Molecular Weight and Protein Thiols Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 474. Thiol Redox Transitions in Cell Signaling, Part B Cellular Localization and Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 475. Single Molecule Tools, Part B: Super-Resolution, Particle Tracking, Multiparameter, and Force Based Methods Edited by NILS G. WALTER VOLUME 476. Guide to Techniques in Mouse Development, Part A: Mice, Embryos, and Cells, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 477. Guide to Techniques in Mouse Development, Part B: Mouse Molecular Genetics, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 478. Glycomics Edited by MINORU FUKUDA
C H A P T E R
O N E
Mass Spectrometric Analysis of Sulfated N- and O-Glycans Kay-Hooi Khoo and Shin-Yi Yu Contents 4 7 7 9 10 13 14
1. Introduction and Overview 2. Sample Preparation 2.1. From biological sources to glycoprotein extracts 2.2. From glycoproteins to released N- and O-glycans 2.3. Permethylation and microscale fractionation 3. MS Analyses and Data Interpretation 3.1. MALDI-based MS and MS/MS analysis 3.2. Interpretation of MALDI-MS profile of permethylated sulfated glycans 3.3. CID MS/MS of permethylated sulfated glycans 4. Future Perspectives Acknowledgments References
17 20 23 24 24
Abstract Sulfated N- and O-glycans carried on a myriad of cell-surface adhesion molecules and receptors are often not detected by current approaches in mass spectrometry (MS)-based glycomic mapping of cells and tissues. This is in part due to a natural lower abundance, compounded further by their negatively charged nature, which adversely disfavors their ionization and detection amid a sea of often much more abundant, nonsulfated, sialylated glycans. However, this particular limitation can actually be taken advantage of to effect highly selective enrichment and sensitive MS screening in negative ion mode, provided the ubiquitous sialic acids can first be neutralized. It has been demonstrated that permethylation not only fulfills this role adequately but further confers better MS/MS fragmentation characteristics for more efficient structural mapping and sequencing. Protocols and general practical considerations are described here which would enable one to readily prepare permethylated
Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei, Taiwan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78001-0
#
2010 Elsevier Inc. All rights reserved.
3
4
Kay-Hooi Khoo and Shin-Yi Yu
sulfated glycans, fractionate them away from the more abundant nonsulfated ones in simple steps for high-sensitivity MS analysis, and sensibly interpret the initial sulfoglycomic screening data thus obtained.
1. Introduction and Overview Sulfation, occurring on specific locations of terminal oligosaccharyl epitopes (Fig. 1.1), modifies the physicochemical properties of a glycotope and thereby alters its cognate recognition by specific endogenous lectins that perceive and translate the encoded immunobiological functions. It is clear that such specific recognition codes imparted by the unique sulfation pattern on an assorted surface markers of leukocytes and endothelial venules (Kawashima, 2006; Rosen, 2004) cannot be critically delineated without them being first structurally defined within the full context of their underlying carriers. Mass spectrometry (MS) and various modes of separation techniques, coupled with chemical modifications and glycosidase digestions, are the corner stones of high-sensitivity approach in structural determination of complex glycans derived from biological sources (Geyer and Geyer, 2006; North et al., 2009). More recently, these glycosylation analyses have evolved into what is referred to as glycomics, which involves mapping the lacdiNAc S 4 4 GalNAc-4-O- S HNK-1 4 3
3 S
3⬘ sulfo sialyl LeX 6⬘ sulfo sialyl LeX 6 sulfo sialyl LeX 6 sulfo sialyl S 6′ S 6 LacNAc 4 3 4 4 3 3 S 6 3 S ± 3 3 6 ± ± ± ± ± 4 Gal-3-O-
Gal-6-O-
S
S
GlcNAc-6-O-
S
S
4 SdA
3
4 3 SLeX
± S
GlcA-3-O- S 4 3
Gal
GlcA
GlcNAc GalNAc
Neu5Ac Fuc
3 ±
4 3
3 ±
±
6 4 3
6
6
±
3 3 MECA-79 epitope (sulfated LacNAc on extended core 1)
Figure 1.1 Various commonly occurring sulfated glycotopes. Additional sulfation on the GlcNAc or Gal would preclude formation of sialyl Lewis X (SLeX), yielding instead sulfo sialyl LeX. Since sulfation on GlcNAc precedes its subsequent b4-galactosylation, a2-3 sialylation, and a3 fucosylation in that order, various forms of incompletely sialylated and/or fucosylated sulfo LacNAc are also commonly found, along with nonextended sulfated GlcNAc termini. In B cells, occurrence of a2-6 sialylated 6-sulfo LacNAc has been reported (Kimura et al., 2007). The critical peripheral lymph node addressins that mediate lymphocyte homing are thought to correspond to sialomucins with Core 2 O-glycans carrying 6-sulfo sialyl LeX on both arms. However, various incompletely elaborated sulfated glycotopes are also present. The minimal epitope recognized by mAb MECA-79, which stains HEV, corresponds to a sulfated LacNAc extending out from Core 1. Addition of terminal GalNAc on sialyl LacNAc leads to formation of the SdA antigen, which is currently not known if it may also be 6-O-sulfated on the internal LacNAc unit.
MS Analysis of Sulfated Glycans
5
complexity and characteristics of the glycome of a cell, tissue, or organism, at a particular pathophysiological or genetically altered state (Haslam et al., 2006; Zaia, 2008). While a single dimensional MS mapping proves to be relatively straightforward and informative in cases of providing a ‘‘first rough impression’’ and identifying drastic glycomic changes, it is clear from the onset that more subtle glycomic changes are often apparent only by applications of multistage fractionation and MS analyses at increasing levels of sophistication. Added to the need in resolving complex isomeric mixtures is a practical demand for an ever increasing sensitivity to detect glycans of low abundance, and/or those multiply substituted with negatively charged constituents. The sulfated glycome, in particular, is often refractory to MS-based glycomic mapping, and yet arguably constitutes one of the most glycobiologically relevant structural entities. At present, analysis of the more abundant sulfated O-glycans derived from epithelial mucins is less of a problem. Underivatized native O-glycans are commonly separated into neutral and negatively charged fractions by microscale fractionation on anion exchange media, followed by desalting on Carbograph or porous graphitized carbon (PGC) media, before subjecting to micro- or nanoLC–MS/MS on a PGC-based capillary column, in negative ion mode (Karlsson and Thomsson, 2009; Robbe-Masselot et al., 2009). A tremendous amount of structural information can be obtained from the reconstructed MS profiles and MS/MS data on those peaks that were selected for analysis. Even so, a closer scrutiny of the reported data often leads to many uncertainties with respect to the extent of isomeric variations, linkages, and location of sulfates. Such is the intrinsic nature of an automated LC–MS/MS runs, with single-stage fragmentation (MS2) on native glycans. Another good recent work is illustrated by one working on the sulfated glycans derived from glycolipids of colonic cancer cells (Shida et al., 2009). The reducing end of the native glycans was tagged with a fluorophore, for example pyridylamine, to allow two-dimensional HPLC separation. Structural identification of each of the detected peaks was mostly inferred from molecular weight information by MS analysis, the HPLC coordinates as compared to standard references, and their shifts after specific exoglycosidase digestions. On the other hand, for membrane-bound sialomucins such as those isolated from lymphoid cells or tissues, practical cases of applications using the aforementioned approaches have yet to be reported, presumably due to limited sample amount and the complexity of tissue extraction. A more recent work on isolated CD34 from tonsils (Hernandez Mir et al., 2009) illustrates the current limitations. The expected 6-sulfo sialyl LeX epitope was only detectable in a minor population of CD34, after three sequential steps of affinity capture, using first a general lectin against sialylated mucins, then mAb against CD34, and finally L-selectin to enrich for the binding population. In this and many other examples, the final yield of glycans is
6
Kay-Hooi Khoo and Shin-Yi Yu
often only sufficient for a rough MALDI-MS mapping in negative ion mode without MS/MS, while limited structural information was obtained by observing mass shifts after selective exoglycosidase digestion. In comparison with MS analysis of native glycans with or without reducing end tagging, MS analysis of permethylated glycans may not rank as the most sensitive MS technique to just obtain molecular weight information, but clearly endowed with several distinct advantages, particularly in deriving detailed structural information on novel epitopes through a series of reliable linkage-specific fragment ions. Without the O-Me tag, multiple cleavages are often indistinguishable from single cleavage and thus not conducive to definitive assignment of the branching pattern. This is highly relevant as the specifically located sialic acids and fucoses (Fig. 1.1), which collectively constitute the various important glycotopes, are also those that are most readily lost during collision-induced dissociation (CID) MS/MS in preference to cleavages at the backbone LacNAc unit, rendering assignment often ambiguous. Likewise, MS in-source neutral loss of these labile residues during ionization process cannot be distinguished from naturally existing range of glycoform heterogeneity with various degrees of incomplete sialylation and fucosylation. Another major issue is sialylation, which also contributes to negative charges unless first neutralized (often inefficient and incomplete (Toyoda et al., 2008)) or removed (not desirable). In contrast, MALDI-MS mapping of permethylated glycans coupled with a complementary low- and high-energy CID on Q/TOF and TOF/ TOF, respectively, is unrivaled in its simplicity, robustness, and definitive sequencing ability (Yu et al., 2006). Furthermore, inherent within the sample preparation procedures are effective means to remove hydrophilic salts from biological matrices, especially when dealing with glycomics of whole cell lysates. We have thus taken the lead over the last few years to develop the enabling sample preparation techniques for sulfoglycomics, based on MALDI-MS and CID MS/MS analyses of permethylated glycans. Both our own data (Mitoma et al., 2007; Yu et al., 2009) and that similarly undertaken by others (Lei et al., 2009) have since shown that the commonly used NaOH/DMSO slurry permethylation method first introduced by Ciucanu and Kerek (Ciucanu and Kerek, 1984) can fully retain the sulfate while neutralizing all negative charges carried on the sialic acids. This derivatization effectively leaves the sulfated glycans as the only negatively charged species and thus can be preferentially detected in negative ion mode screening at high sensitivity, and/or efficiently separated from the overwhelmingly high abundant, nonsulfated species, for them to be additionally detected by MALDI-MS in positive ion modes and subjected to linkage and sequence informative high-energy CID MS/MS, albeit at a lower sensitivity. We describe below a routinely applicable protocol as practiced in our laboratories for such a first screen MALDI-MS analysis while the more
MS Analysis of Sulfated Glycans
7
advanced approaches, some of which still under development and must be tailored for each specific applications, are only briefly discussed in general terms under future perspectives. Please read chapter 4 of Volume 480 of this series for ‘‘Glycomics Profiling of Heparan Sulfate Structure Activity’’.
2. Sample Preparation Over the last 5 years or so, a generic glycomic analysis workflow and associated methodologies for handling glycoprotein extracts from biological fluids, cells, and tissue samples are already in routine operation in many leading glycoanalytical laboratories, and well described in published work, including chapters in this series. The overall workflow we routinely used is essentially similar to the one adopted and publicized by the analytical core of the Consortium for Functional Glycomics ( Jang-Lee et al., 2006). In brief, following detergent or guanidine chloride extraction from cells, reduction alkylation and tryptic digestion of the proteins, N-glycans are released by PNGase F whereas the O-glycans are additionally released from the de-Nglycosylated peptides by reductive elimination. These glycan preparation steps are not further described in detail here other than a general descriptive account, with notes given in cases where alternatives are recommended and can be favorably considered. We have since extended this platform to analysis of sulfated glycans by further optimizing the permethylation protocols and to introduce screening by MALDI-MS in negative ion mode using a better matrix to enhance detection sensitivity (Yu et al., 2009). The key issue as compared with previous permethylation protocols (Dell et al., 1994; Jang-Lee et al., 2006) is to avoid aqueous-phase partition particularly for smaller O-glycans, and/ or the multisulfated ones. Subsequent microscale fractionation based on amine-beads packed in microtips allows enrichment of the sulfated glycans away from the predominating nonsulfated ones, so as to enable better chances of detection and sequencing in positive ion mode, taking advantages of the fragmentation characteristics already established. This extended workflow (Fig. 1.2) represents the first screen sulfoglycomic strategy that would be applied to any not previously analyzed sample to confirm the presence of sulfated N- and/or O-glycans, and to gauge their complexity, abundance, and most salient features.
2.1. From biological sources to glycoprotein extracts Apart from secreted glycoproteins found in biological fluids or culture media, most glycoproteins of interest are membrane glycoproteins, which are typically extracted from cell lysates using either chaotropic agents (e.g.,
8
Kay-Hooi Khoo and Shin-Yi Yu
Glycoproteins extracts Glycome cells and tissue
Glycans
NaOH/DMSO perMe glycans
C18 SPE
± Glycosidase ± Fractionation
Sulfated + nonsulfated glycans
NH2 SPE
Analysis of nonsulfated glycans by +ve MALDI-MS and MS/MS Screening for presence of sulfated glycans by –ve MALDI-MS
Nonsulfated glycans Sulfated glycans
–ve & +ve MS + MS/MS
Figure 1.2 Schematic workflow for a sulfoglycomic analysis. Extending from released glycans, the key steps are C18 Sep-Pak clean up of the permethylated glycans and the subsequent amine-beads fractionation of the sulfated permethylated glycans from the nonsulfated ones if preliminary screen by MS in negative ion mode reveals their presence. SPE, solid-phase extraction.
urea, guanidine hydrochloride) or mild detergents. With the former, cell lysates are often first delipidated by organic solvent, usually a combination of chloroform/methanol/water, and this fraction can be used for analysis of glycolipids if needed (Guerardel et al., 2006; Parry et al., 2007). However, optimizing for a good recovery of glycolipids may require repeated cycles of extractions with organic solvents of increasing polarity, which may compromise the yield of glycoproteins from remaining cell pellets. This should be avoided if only the N- and O-glycans are to be profiled. In our laboratories, we typically use 6 M guanidine hydrochloride (in 50 mM Tris–HCl, pH 8.4) for extraction after a simple delipidation of lyophilized cell lysates (Yu et al., 2009). Solubilized (glyco)proteins are then reduced by 20 mM dithiothreitol (Sigma) in 6 M guanidine–HCl, followed by alkylation with 50 mM iodoacetamide (Sigma) in 6 M guanidine–HCl, and subsequently dialyzed against ddH2O. The alternative use of detergents (e.g., 1% CHAPS, 1% Triton X-100) to solubilize membrane proteins from total cell lysates or microsomal fraction without the first delipidation step often produces cleaner extracts and sometimes is needed to preserve the conformation of glycoproteins for subsequent affinity capture or activity assays used in purification. It is popular for glycoproteins to be further subjected to rounds of lectin/ antibody captures, with possibilities for buffer exchange, or for glycans eventually to be recovered from protein SDS-PAGE gel bands or PVDF blots (Hernandez Mir et al., 2009). Otherwise, a common problem for MSbased glycomic analysis is the subsequent removal of detergents which is not trivial. The selective loss introduced by methods such as trichloroacetic acid, acetone, or ethanol precipitation, or passing through specialized detergentremoving columns, can be an important factor needs considerations. In this context, CHAPS, which forms low molecular weight micelles is more readily removed by dialysis or gel filtration than Triton X-100, which has a low critical micelle concentration (CMC) and forms high molecular weight micelles. The use of 1% CHAPS has recently been successfully
MS Analysis of Sulfated Glycans
9
demonstrated for direct glycomic analysis (Babu et al., 2009) while we have been able to use 1% Triton X-100 followed by TCA precipitation, with no significant difference in the resulting glycomic profiles as compared with those obtained through guanidine–HCl. However, neither has been critically evaluated for applications to sulfoglycomics.
2.2. From glycoproteins to released N- and O-glycans (Glyco)proteins are commonly digested with a combination of trypsin (Sigma) and chymotrypsin (Sigma), each for 4 h, in 50 mM ammonium bicarbonate buffer, pH 8.4, at 37 C, followed by treatment with PNGase F (Roche) (Note 1). Released N-glycans are isolated from the de-N-glycosylated peptides by passing through C18 Sep-Pak cartridge (Waters, Part No. WAT051910) in 5% acetic acid (Note 2). Retained peptides are then eluted with 20–60% propanol/5% acetic acid and used for subsequent release of O-glycans by reductive elimination (1 M NaBH4/ 0.05 N NaOH, 37 C, 3 days) (Note 3). After terminating the chemical reaction by dropwise addition of glacial acetic acid on ice, the neutralized sample is taken through Dowex 50 8 column (50–100 mesh, Hþ form, Bio-Rad) in 5% acetic acid, dried, and coevaporated with 10% acetic acid in methanol to remove borates. Notes 1. Sequencing grade trypsin is recommended if a portion of the tryptic peptides is to be additionally subjected to proteomic analysis for peptide mapping and protein identification. Otherwise, any good commercial source of trypsin supplemented by less specific chymotrypsin will be preferable to effect more extensive proteolytic cleavages at lower cost. Optional reverse-phase isolation of the resulting glycopeptides/peptides by, for example, C18 Sep-Pak can be performed prior to N-glycan release by PNGase F, so as to obtain a cleaner sample free from contaminating free glycans, as previously recommended ( Jang-Lee et al., 2006). However, it may run the risk of losing glycopeptides that are too hydrophilic and thus not favorably retained by C18. For this reason, we have omitted this additional step and relying instead on other subsequent clean up steps at the glycan level. 2. For the same reason as above and to minimize sample handling so as to optimize yield, the PNGase F digested sample can be directly subjected to reductive elimination without first isolating away the released N-glycans. This will lead to reduced N-glycans and O-glycans to be recovered within a single fraction after subsequent desalting steps. The disadvantage, however, is that it may unnecessarily complicate the resulting glycomic map, especially if the usually smaller O-glycans extend to larger ones and overlap with the mass range populated by the N-glycans.
10
Kay-Hooi Khoo and Shin-Yi Yu
3. Lower temperature and longer reaction time are used instead of the usual reductive elimination conditions (45 C, 16 h) to avoid too harsh a treatment of the sulfated O-glycopeptides. For the O-glycans, the released oligoglycosyl alditols can be further subjected to mild periodate cleavages to derive the C2 and C4 halves for mapping of 6-arm and 3-arm extensions, respectively (Wu et al., 2007). The additional use of endoglycosidases such as endo-b-galactosidase and a range of exoglycosidases are common practice designed to help assignment of stereoisomers and terminal epitopes. The glycans derived thereof, with and without additional chemical or enzymatic cleavages, are then subjected to permethylation and first screened by MALDI-MS, with several most intense peaks and/or those of ambiguous molecular composition assignment be selected for a complementary low- and high-energy CID MALDI MS/MS sequencing (Yu et al., 2006).
2.3. Permethylation and microscale fractionation Strategic considerations—In general, if the cells to be analyzed contain any significant amount of sulfated glycans, such as the leukocytes, or cell lines transfected with sulfotransferases, it is a good practice to start with permethylating the glycan sample derived from only an equivalent of 107 cells or less as a first attempt. This means that one can start with 1/10th of a sample prepared from 108 cells or 1/5th of that from 5 107 cells, for example, and leave enough native sample for additional clean-up, fractionation, desialylation, and/or glycosidase digestions, when needed. On the other hand, if the yield of the sulfated glycans is significantly less than anticipated as revealed by first MS screen, all or the majority of the remaining samples can be permethylated to attempt securing at least a decent mapping at the MS level. As described above, the actual permethylation step including the preparation of the NaOH/DMSO slurry is similar to the conventional methods already well described in the literature. Any laboratory already well versed in NaOH permethylation can readily adapt their own protocols by incorporating a suitable clean up step after the reaction. In this context, a direct fractionation of the permethylated glycans by reverse-phase C18 Sep-Pak cartridge often leads to overlapping separations and can be avoided by pooling together the eluates, if so desired. Subsequent anion exchange step can be more efficient in isolating the negatively charged sulfated glycans away from other nonbinding, nonsulfated, neutral glycans. The main purpose of the initial C18 Sep-Pak step then is to simply function as a cleanup procedure for the reaction mixtures containing sodium salts and DMSO, substituting for the more commonly used chloroform/water partition. The latter will not efficiently retain the sulfated glycans in the organic phase except for the monosulfated, larger N-glycans. Under these general considerations, many
MS Analysis of Sulfated Glycans
11
variations in terms of judicious choice of the microscale fractionation scheme are possible and largely sample dependent. The protocols described below include a description of the anticipated fractionation behaviors of each different classes of N- and O-glycans, based on which one can device a permutation of steps most sensible for the sample to be analyzed. 2.3.1. Methods (1) An aliquot of the glycan sample to be permethylated is dried down in a screw-capped glass tube or reaction vial. (2) Add approximately 200 ml of a slurry of finely ground NaOH pellets (Merck, pellets for analysis, ISO grade) in dimethyl sulfoxide (DMSO, Merck, purity 99.9%, max. 0.025% H2O) to the sample, followed by addition of 50–100 ml of methyl iodide (Merck, purity 99%, stabilized with silver for synthesis). (3) Gently vortex the reaction mixture for 3 h at 4 C and then quench the reaction on ice with 200 ml of cold water, followed by careful neutralization with 5% aqueous acetic acid until reaching a final pH of about 5–6 (checked with pH indicator paper). Note: Nonsialylated, sulfated glycans are often more readily fully permethylated, with a reaction time ranging from less than 20 min to longer than 3 h, at room temperature or 4 C, without any adverse effect. In contrast, best yield of fully permethylated, sialylated, sulfated glycans appears to be favored by lowering the reaction temperature concomitant with a longer reaction time. (4) Pass the neutralized reaction mixture directly through a primed C18 Sep-Pak cartridge (Waters, Part No. WAT051910) to obtain the desalted, permethylated glycans. a. Condition the Sep-Pak cartridge by sequential washing with acetonitrile (3 ml), methanol (3 ml), and water (3–5 ml) before sample loading. b. Hydrophilic salts and contaminants are step-wise washed off with 5 ml each of water, 2.5% and 10% acetonitrile. c. Permethylated glycans carrying one or two negative charges conferred by sulfates are next eluted with 5 ml of 25% acetonitrile. Note that in addition to disulfated N-and O-glycans, part of monosulfated O-glycans and smaller N-glycans, as well as some small nonsulfated O-glycans will be collected in this fraction. d. Permethylated glycans with a single charge can then be eluted with the next 5 ml of 50% acetonitrile. Note that a substantial amount of monosulfated N-glycans and larger monosulfated O-glycans, along with most of the nonsulfated N-glycans and O-glycans will be found in this fraction. A final elution step of 75–100% acetonitrile can be included to recover any larger, nonsulfated glycans.
12
(5)
(6) (7)
(8)
Kay-Hooi Khoo and Shin-Yi Yu
e. It may be advantageous to pool the 25–50% acetonitrile fractions since some overlapping of monosulfated glycans in both these two fractions is inevitable. On the other hand, it may be desirable to keep them separate as the earlier eluting 25% acetonitrile fraction is enriched with multiply sulfated glycans that are not overwhelmed by the neutral and monosulfated ones. For applications to MS analyses, the permethylated samples thus obtained can be further cleaned up and/or concentrated by using a ZipTipC18 (Millipore, Cat. No. ZTC18S096) or any other equivalent microtip devices. Occasionally, samples eluted off from the initial C18 Sep-Pak may not be sufficiently clean or free of suppressing contaminants to register any MS signal but will do so after such additional microscale clean up. a. Redissolve the permethylated glycans in 20 ml of 10% acetonitrile. b. Condition the ZipTipC18 with 10 ml of 50% acetonitrile followed by 10 ml of 0.1% trifluoroacetic acid. c. Pipette the sample in ZipTipC18 several times (10–20 times) to allow binding. d. Wash away salts and other hydrophilic contaminants with 10 ml of 0.1% trifluoroacetic acid (repeated pipetting for three to five times). e. Elute the permethylated sulfated glycans with 10 ml of 50% acetonitrile/0.1% trifluoroacetic acid, which can be collected into microtubes or directly spotted onto the MALDI target plate. Note that direct spotting from ZipTip is a most efficient way to apply as much of the sample for MALDI-MS analyses. MALDI-MS screening in positive and negative ion modes (see later). Although permethylation can be effected on crude biological extracts, excessive high salt content and other contaminants may prevent efficient full methylation. This is not normally a severe problem for analysis of nonsulfated glycans in positive ion mode but glycans with undermethylation on the sialic acids have been observed to present the major signals in negative ion mode instead of the less abundant sulfated glycans. Under such circumstances, the permethylated sample can be subjected to a second round of permethylation, which often improves overall signal quality and reduces or abolishes negative ion signals contributed by under-methylated species. Alternatively, a further clean up of the remaining native N- and Oglycan samples by graphitized carbon column prior to permethylation is recommended. a. Condition the carbon column (graphitized carbon column, Supleco, Cat. No. 57088) by sequential washing with acetonitrile (3 ml), 75% acetonitrile/0.1% trifluoroacetic acid (3 ml), 50% acetonitrile/0.1% trifluoroacetic acid (3 ml), 25% acetonitrile/0.1% trifluoroacetic acid (3 ml), and water (3–5 ml).
MS Analysis of Sulfated Glycans
13
Note: Other micro-column or microtip packed with porous or non-PGC beads can be used depending on sample amount. b. Dissolve the native glycans in 200 ml of water for loading onto the graphitized carbon column. Salts are washed away with 2 5 ml water. c. Step-wise elute the glycans with 2 ml of 25% acetonitrile/0.1% trifluoroacetic acid, 50% acetonitrile/0.1% trifluoroacetic acid, and 75% acetonitrile/0.1% trifluoroacetic acid, and dry down. d. Note that simple fractionation can also be accomplished with the graphitized carbon column by first eluting the neutral glycans in 25–75% acetonitrile, and then the acidic glycans in 25–75% acetonitrile/0.1% trifluoroacetic acid. (9) To facilitate MS detection and analyses in positive ion mode, the permethylated sulfated glycans can be conveniently separated from coeluting nonsulfated ones by using a microcolumn device self-packed with amine-beads. ˚ pore a. Take up the amine beads (Nucleosil, 5 mm particle size, 100 A size) in methanol and pack into a pipette tip with its tapered end plugged by filter paper. Depending on the sample quantity to be handled, the volume of the packed beads can range from as little as 0.5 ml similar to a ZipTip size, to about 5 ml or more, using microtips of different sizes in conjunction with different wash/elution volumes (up to 5 or more of the bead volume). b. Condition the packed amine microtip (total bead volume 2 ml) by sequential washing with 10 ml each of 95% acetonitrile/0.1% formic acid, 50% acetonitrile/ 0.1% formic acid, and 95% acetonitrile/0.1% formic acid. c. Dissolve the permethylated glycans in acetonitrile for loading, with two to three times reloading of the flow through. Nonsulfated and thus neutral permethylated glycans and other hydrophobic contaminants are collected in the final unbound fraction, to be pooled with additional 50 ml wash of 95% acetonitrile. d. Elute the monosulfated permethylated glycans with 30 ml of 2.5 mM ammonium acetate in 50% acetonitrile, and di- or multisulfated ones with 30 ml of 10 mM ammonium acetate in 50% acetonitrile, respectively.
3. MS Analyses and Data Interpretation In general, MS analyses of the permethylated glycan samples can be considered and undertaken at three different stages within the overall workflow. The first stage serves primarily as a quick screen to detect the presence
14
Kay-Hooi Khoo and Shin-Yi Yu
or otherwise of sulfated glycans by MALDI-MS in negative ion mode while an accompanying positive ion mapping would inform the overall glycomic complexity. Any excessive contaminants, high degree of incomplete methylation, or unexpected low yield, will be revealed at this stage. As described above, a repermethylation of the permethylated sample, or to attempt a second permethylation after additional sample clean up, may help to improve data quality. More importantly, screening at this stage will inform if there is sufficient amount of sulfated glycans detected for subsequent stages of analyses, aiming at gaining more structural information. Depending on the signal intensity registered, it can be decided if there is merit in further isolating the sulfated glycans by additional amine-beads fractionation, so as to enable MS/ MS analysis in positive ion mode. Alternatively, more of the remaining native sample (or from a new preparation) should be permethylated, with or without precleaning, fractionation, desialylation, and other treatments. Either during the initial screen or subsequent ones after additional sample preparation, one to several major peaks of interest can be selected for MS/MS analysis. These may not always be the most abundant molecular ions detected but ideally correspond to the ones that are most informative with respect to producing data that will confirm the presence of a particular sulfated glycotope. In both these first and second stages, MALDI-based MS and MS/MS analyses is preferable since it is more straightforward, rapid, easier to operate, and thus less demanding in terms of technical skill and instrument time. However, for laboratory without MALDI-based instrument, offline nanospray (nanoESI)based analyses is equally applicable. Based on the data collated and knowledgebased interpretation, a final third stage may be carried out, aiming at either a targeted approach to identify specific glycan/glycotope of interest not revealed by initial mapping, or a more comprehensive glycomic mapping at MS2 level, usually by subjecting to automated LC–MS/MS. While general protocols for sample preparation can be formulated and readily followed by most laboratories equipped to carry out general biochemical analysis, the actual mileage gained with respect to the MS data quality and final useful information that can be gleaned will vary greatly among different laboratories supported by respective common MS facilities. The MS data acquisition parameter itself is highly instrument dependent. So are the performance (sensitivity, accuracy, and resolution) and afforded MS/ MS fragmentation characteristics. Only some general guidelines can be given here, which are based primarily on our own experience with our own MALDI-MS instrument (AB 4700 Proteomics Analyzer).
3.1. MALDI-based MS and MS/MS analysis As mentioned, the best conditions for spotting permethylated glycan samples onto MALDI target plate is instrument (the material and format of the target plate) and environment (humidity, ambient temperature) dependent,
MS Analysis of Sulfated Glycans
15
and need to be carefully optimized by individual laboratories for best results. In these respects, the commercially available trisulfated neocarrahexose standard (Dextra Laboratory, Cat. No. C1010), which can be permethylated directly, and the bovine thyroid stimulating hormone (bTSH, Sigma-Aldrich, Product No. T8931), which requires a full procedure of tryptic digest, PNGase F treatment, and RP C18 Sep-Pak before permethylation, and thus can be additionally used to check against the glycan release protocols, are very useful performance benchmark standards. For highest sensitivity, the ‘‘best’’ MALDI matrices to be used for detecting permethylated glycan samples in positive and negative ion modes are found to be different. In general, the 2,5-dihydroxybenzoic acid (DHB) matrix is commonly considered as well suited for detecting glycans in the positive ion mode. However, it was found to be less sensitive in supporting detection of negatively charged glycans in negative ion mode, especially when the sample contains significant amount of salts. Alternative matrices such as arabinosazone (Chen et al., 1997), 2,4,6-trihydroxyacetophenone (THAP) (Papac et al., 1996), and 3,4-diaminobenzophenone (DABP), have each found preferences and registered better results in different labs. In our hands, DABP, which was originally used to detect oligonucleotides by MALDI-MS (Fu et al., 2006; Xu et al., 2006), was found to give best sensitivity for detecting permethylated sulfated glycans in the negative ion mode, at a laser energy setting similar to that used for DHB. It does, however, induce a higher degree of in source neutral loss of sodium sulfite (102) from di- and multiply sulfated glycans in negative ion mode. 3.1.1. Methods (1) Premix an aliquot (typically 0.5 ml) of suitably concentrated permethylated sulfated glycan sample in acetonitrile 1:1 (v:v) with DHB matrix (10 mg/ml in 50% acetonitrile), or 1:1 (v:v) with DABP matrix (10 mg/ml in 75% acetonitrile/0.05% trifluoroacetic acid) (Acros Organics, NJ, USA) in a microtube, and then carefully spot 0.5–1 ml of the sample/matrix mixture onto a heated MALDI target plate (placed above a 50 C hot plate). (2) In cases where the analyte fails to crystallize well in a small focused spot, a respotting of new aliquot tends to produce better results than recrystallization. A substantial amount of practice and experience is needed to be able to comfortably handle the spotting process, which can be an important factor to successful analysis. It is a good practice to keep the matrix solution relatively fresh and observe that it remains mostly colorless for DHB, while the yellow DABP solution does not turn brownish red. (3) Optimal instrument parameter and laser energy setting can be predetermined against the aforementioned standards.
16
Kay-Hooi Khoo and Shin-Yi Yu
a. A fully permethylated, trisulfated neocarrahexose is normally eluted in the 25% acetonitrile fraction from C18 Sep-Pak. Using DHB as matrix, MALDI-MS analysis should afford a major [Mþ4Na3H]þ molecular ion signal at m/z 1419.2922 (accurate monoisotopic mass) in positive ion mode, and an [Mþ2Na3H] signal at m/z 1373.3126 (accurate monoisotopic mass) in negative ion mode. Up to 3 and 2 degrees of successive losses of sodium sulfite from the parent ion may be observed in positive and negative ion modes, respectively. The effect of substituting the DHB matrix with DABP for analysis in negative ion mode can be evaluated, particularly in terms of sensitivity gain versus extent of sodium sulfite loss. Importantly, fully methylated disulfated molecular ions should not be detected at any significant level to give assurance that the permethylation process does not induce unwarranted desulfation. As a gauge of sensitivity, 100 pmol of starting material should afford strong signals when 1/20th equivalent of the permethylated sample is spotted. b. The bTSH N-glycans include both mono- and disulfated glycans. Using DHB as matrix, MALDI-MS analysis in negative ion mode should give a major [MþNa2H] molecular ion signal at m/z 2456.0548, corresponding to a core fucosylated biantennary complex type N-glycan with two sulfated LacdiNAc termini. As above, loss of sodium sulfite (102 U) may be observed along with an [MH] signal at 88 U lower, corresponding to monosulfated species. The relative amount of these signals varies according to instrument, matrix used, and sample preparation but the disulfated species should always be significantly more abundant than the monosulfated one, which may even not be detected at all. Other major signals that can be detected include the [MH] of hybrid type N-glycans containing one sulfated LacdiNAc, with and without fucose, at m/z 2081.9729, and 1907.8837, respectively. Switching to positive ion mode allows one to further evaluate how readily these negatively charged mono- and disulfated glycans can be observed, with the disulfated biantennary glycan now detected as [Mþ3Na2H]þ at m/z 2502.03436 or 102 U thereof due to loss of one or more sodium sulfite. In this regard, bTSH is a good standard as it does not contain significant level of nonsulfated glycans and thus allow the permethylated sulfated glycans to be directly observed in the positive ion mode, without further fractionation. (4) For MALDI-MS instrument equipped with capability of CID MS/MS such as the MALDI Q/TOF or MALDI TOF/TOF, the observed signals can be selected for MS/MS analyses in positive and/or negative ion modes. Similarly, the sulfated glycans from bTSH can first be evaluated for their fragmentation characteristics and optimization of laser and CID
MS Analysis of Sulfated Glycans
17
settings. Prior to this, it is expected that the MS instruments have been well set up to perform MS/MS analysis on nonsulfated permethylated glycans and one is familiar with the fragmentation pattern afforded.
3.2. Interpretation of MALDI-MS profile of permethylated sulfated glycans MALDI-MS normally affords only singly charged molecular ions, typically as sodiated forms for permethylated glycans in positive ion mode. In general, each sulfate group, when present, will be additionally balanced by an extra sodium cation. Glycans carrying n sulfate groups will therefore be detected as molecular ion species conforming to the general formula of [Mþ (nþ1)NanH]þ. When switching to negative ion mode, permethylated glycans, with all OH groups being derivatized to O-Me and the carboxylic group of sialic acids methyl esterified, do not deprotonate or acquire a counter anion readily and thus are not normally observed unless sulfated. This feature makes detection in negative ion mode rather selective and extremely informative for a first screen for the presence of sulfated glycans before attempting any further fractionation. Monosulfated species typically ionize as [MH] whereas additional sulfates are likewise counter balanced by sodium, giving rise to singly charged [Mþ(n1)NanH] molecular ions in the negative ion mode. It is useful to note that the same sulfated glycan signals detected in negative ion mode are thus expected to shift to 46 U higher in positive ion mode by carrying two extra sodium. It is also consistent with the observation that each neutral loss of sulfate occurs in the form of losing both the sulfite (80 U) and its sodium counter cation (22 U), and registered as 102 U. This essentially produces an ‘‘under-methylated’’ species, with the original O-SO3Na being converted to free OH. A signal detected at 14 U lower than a monosulfated species can thus be interpreted as suggestive evidence for the presence of disulfated species having lost a sodium sulfite (Fig. 1.3A). In our experience, intact multiply sulfated glycans from cells and tissues, as opposed to more abundant standard sulfated glycoprtoeins, are not readily observed in a MALDI-MS-based sulfoglycomic analysis, even in negative ion mode. Instead, these can be more favorably detected as ‘‘under-methylated’’ monosulfated species at multiples of 14 U lower, after losing their extra sodium sulfite moieties. The use of DABP to increase overall detection sensitivity in negative ion mode unfortunately also promotes loss of sodium sulfite to the extent that the parents that retain the extra sulfates may be completely absent. Since these in-source generated fragment ions are indistinguishable from molecular ion signals corresponding to genuine undermethylated species, additional evidence is highly desirable.
18
Kay-Hooi Khoo and Shin-Yi Yu
A
14 u
100 % Intensity
1821.7
14 u
1835.7 50
2182.9
1747.7
2196.9
0 B
S
100
% Intensity
S
50
1747.8
1835.9 2197.1
0 1680
% Intensity
C
100
−SO Na 3
−SO
3Na
1821.9
S2
Na
2183.1
S2 Na
50
0 1680
2010 m/z
2340
Figure 1.3 Distinguishing disulfated glycans from under-methylation by fractionation. Without separation (A), signals at 14 U lower than a monosulfated species may indicate the presence of a genuinely under-methylated species, or a disulfated species of the same glycosyl composition having lost its extra sulfate group by in source fragmentation. By further subjecting this permethylated sample to fractionation by amine-beads, monosulfated glycans would be eluted in the earlier 2.5 mM NH4OAc/50% acetonitrile fraction (B) whereas the disulfated glycans in the 10 mM NH4OAc/50% acetonitrile fraction (C).
In general, the fractionation scheme as described in previous sections will help. By C18 Sep-Pak, di- and multiply sulfated species are normally collected only in the 25% acetonitrile fraction and thus the 14 U or ‘‘under-methylation’’ signals should mostly be detected there and not in the 50% acetonitrile fraction. Alternatively, if fractionation is not attempted at the C18 Sep-Pak stage, the mono- and disulfated species that constitute the 14 U signal pairs detected initially can be fractionated subsequently by
MS Analysis of Sulfated Glycans
19
differential elution off the amine-beads (Fig. 1.3B and C). A more direct evidence can then be obtained by subjecting the fraction enriched with multiply sulfated glycans to an offline nanoESI-MS analysis, which is more likely to retain the extra sulfate moieties. With experience and performed carefully, any genuine under-methylation should be minimum and generally does not pose a significant problem. However, for sulfoglycomic analysis in negative ion mode, under-methylation occurring at the carboxylic group of sialic acid can contribute to preferential detection of nonsulfated, sialylated glycans. Care should therefore be taken to not mistakenly attribute these negative ion signals to sulfated glycans, which may in turn be obscured. This issue cannot be addressed by fractionation but can be alleviated by repermethylation. Removal of sialic acids by neuraminidase prior to permethylation will overcome this problem and confirm the presence of sulfated glycans, but at the expense of losing any information on sialylated, sulfated epitope. With the above considerations in mind, one can set out to assign the glycosyl composition of the detected peaks with ease, using the general formula of X m=z ¼ ðCH3 þ OCH3 Þ þ glycosyl residual masses þ ðOSO 3 OCH3 Þ for singly charged, permethylated, monosulfated [MH] molecular ion in negative ion mode. (CH3 þ OCH3) accounts for the reducing and nonreducing end masses, which is 46 U in nominal mass and can be modified accordingly if the reducing end is reduced, or further tagged. For example, another 16 U (2H þ CH2) is added for the O-glycans released by reductive elimination. The first sulfated group added will account for a mass increment of 65 U and contributing to the negative charge. Thereafter, each additional sulfate group contributes to 88 U mass increment, assuming an O-SO3Na substituting for O-Me, as discussed above. For simplicity, one canPderive the m/z for [MH] of permethylated, sulfated molecular ions as glycosyl residual masses þ 111 U þ 88(n 1), where n ¼ number of sulfate groups contained. A full list of the glycosyl residual masses has been tabulated (Dell et al., 1994), the most common ones being 204, 245, 174, 361, and 391 U, for the nominal masses of Hex, HexNAc, dHex, Neu5Ac, and Neu5Gc, respectively. The calculation for positive molecular ions is similar, but adding another 46 U in general to account for the extra two sodium, as discussed above. With some glycobiology background knowledge particularly a familiarity with the range of core and terminal structures permitted by the host biosynthesis machinery, manual assignment is relatively simple. It can also be easily automated using a variety of publicly available software program, or self-written scripts. One should, however, bear in mind that such
20
Kay-Hooi Khoo and Shin-Yi Yu
glycosyl composition assignment is often equivocal because of similarity in mass of several glycosyl permutation. This includes the 88 U increment, which can be assigned as carrying an extra O-SO3Na in place of O-Me as described, or an extra LacNAc unit (449 U) in place of Neu5Ac (361 U). 2 Fuc (174 2 ¼ 348 U) differs from a Neu5Ac by 13 U, which can be confused with aforementioned under-methylation (14 U), especially at high masses when the overlapping isotopic clusters cannot be adequately delineated. In nonhuman samples, the additional presence of Neu5Gc further complicate assignment as the difference between Neu5Ac and Neu5Gc at 30 U, also coincides with the difference between Hex and dHex, and that nonhuman samples often also carries extra a3-Gal caps. All these factors contribute to uncertainty associated with glycosyl composition based on MS data alone, and is particularly problematic with low resolution and/or accuracy data. Provided sample amount is not limiting, further MS/MS analysis on selected or all major peaks is therefore highly recommended.
3.3. CID MS/MS of permethylated sulfated glycans As noted, direct MALDI CID MS/MS manually acquired on selected peaks after initial MS mapping is most straightforward and elegantly simple for novice and expert alike. In our laboratories, routine positive ion mode MS/ MS data are manually acquired on both MALDI Q/TOF (Q/TOF Ultima, Micromass) and MALDI TOF/TOF (AB 4700 Proteomic Analyzer) for low- and high-energy CID, respectively. We also have limited experience on the AB 4800 MALDI TOF/TOF instrument and verified that similar high-energy CID fragmentation pattern as afforded by 4700 instrument can be obtained, with a caveat that the instrument must be specifically tuned up. The advantage of the TOF/TOF instruments is that, depending on analytical need, glycan fragmentation pattern akin to low-energy CID as afforded by ion traps, or Q/TOFs can also be obtained, in addition to what it is supposed to afford, namely a true high-energy CID. It should be further noted that, multiple collision events producing multiple cleavages occur more readily in the collision cell of a Q/TOF whereas most cleavages including those unique concerted double cleavages on the same glycosyl residue as observed on a TOF/TOF (Spina et al., 2004; Yu et al., 2006) are likely resulting from single collision. This translates into a fundamental difference between the two modes of CID MS/MS in that successive neutral losses of terminal structural motifs delimited by HexNAc, or the Neu5Ac, will not normally be observed on TOF/TOF. Conversely, with higher collision energy at kilovolt range, only the TOF/TOF readily provides linkage-specific cross ring and other concerted cleavages, which are more demanding in assignment. These fragmentation characteristics (Fig. 1.4) have been extensively discussed (Yu et al., 2006, 2008) and not repeated here, except for a few key points to help beginners to enter the field.
21
MS Analysis of Sulfated Glycans
A
B 1,5
X
Y
MeO
H
C′′/Y O
O 1,5
E
B
MeNAc
MeO
G O R
O,4
D
A
X
C′′ [ C-2 H ]
O
A MeO
R-O
Y S
Y
O
3,5
B
O
O
MeO
N-Glycan O
O
O
O
S B
Core 1
S B
B
3 O
O Y
Core 2 O 6
Z
3 O
Z
O-Glycans
Figure 1.4 Common fragmentation pattern observed under MALDI CID MS/MS. The Domon and Costello nomenclature (Domon and Costello, 1988) for the glycosidic cleavage Y, Z and B, C ions, as well as the cross ring cleavage X and A ions, are commonly adopted. For high-energy CID MS/MS on MALDI-TOF/TOF, Spina et al. (2004) extended the nomenclature system to additional concerted cleavage ions around the ring, namely the E, F, G, ions. Further incorporating the D ion proposed by Harvey (2005), we integrated the system and additionally introduced the H ion, along with C00 , and C00 /Y ions (Yu et al., 2006). Only the more readily produced and/or useful ions are illustrated in (A). For low-energy CID MS/MS, the most abundant ions are the B and Y ions (B). Multiple cleavages often produce fragment ions corresponding to the core having lost all antennary extension. Z ions are mostly restricted to elimination of the 3linked substituents and most commonly observed for eliminating the 3-arm of O-glycan cores, and the Fuc of LeX.
(1) In reference to the commonly adopted Domon and Costello nomenclature (Domon and Costello, 1988), the most universal pair of fragment ions afforded by all different MS instruments is the B and Y ions. In the case of permethylated glycans, the Y ions correspond mostly to loss of terminal Neu5Ac and Neu5Ac-R-HexNAc, where R can be any combination of Hex and Fuc. These are most useful in identifying nonreducing terminal epitopes and would be further corroborated by the abundant B ions observed at the low mass range (Fig. 1.4B). While the masses of Y ions are dependent on the parent, the neutral loss itself and the corresponding B ions are characteristics of each specific epitope. It is a distinct limitation of ion traps that detection of these low mass B ions are disfavored by the 1/3rd cut-off rule although somewhat compensated by ability to perform MSn. (2) In Q/TOFs, successive neutral losses of the antennary units are common and by enumerating the free OH groups carried on the remaining core structures, the number of branching can be readily inferred. In TOF/TOF, all B and Y ions are normally resulting from single cleavage and are likewise mostly restricted to HexNAc and Neu5Ac. At these and other sites, high-energy CID is more prone to provide a complete series of cross ring cleavage 1,5X ions, which is very informative for a
22
Kay-Hooi Khoo and Shin-Yi Yu
full sequencing of glycosyl residues delimited by HexNAc. This is particularly so for some unusual terminal epitopes found in lower animals with additional galactosylation. For mammalian structures, the 1,5X ions derived from cleavages at the mannoses on the 3- and 6-arms of the trimmanosyl core is advantageous in defining the respective antennary substituents. (3) True linkage-specific ions are normally represented by the A ions, for example, 3,5A and 2,4A ions, which unfortunately are not abundantly produced even with high-energy CID, especially when sample amount is limiting. We found that other concerted cleavages such as the D and G ions are more readily observed instead and can provide linkage information (Fig. 1.4A). (4) Importantly, in positive ion mode, the additional presence of 6-OSO3Na on HexNAc or Hex does not significantly alter the established fragmentation pattern (Yu et al., 2009). In contrast to its ready loss during ionization in source, as discussed earlier, sulfated species selected for CID MS/MS does not exhibit further neutral loss of sodium sulfite. This allows direct applications of all previously established fragmentation patterns and rules to sulfated glycans but taking into account the mass increment conferred by the sodium sulfite moiety. (5) In negative ion mode, all fragment ions should retain a negative charge for them to be detected and therefore in the case of permethylated sulfated glycans, only ions retaining the sulfate moiety will generally be observed. An abundant ion at m/z 97 is ubiquitously present, corresponding to HSO4 and serves to confirm that the selected parent ion is indeed sulfated, but does not provide any further structural information. More useful are the B ions at m/z 324, 528, 702, 889/ 919, and 1063/1093, corresponding to sulfated HexNAc, LacNAc, LeX, Neu5Ac/Gc-LacNAc, and Neu5Ac/Gc-LeX, respectively, which will inform the kind of terminal sulfated epitopes presented (Mitoma et al., 2007). In practice, real cases of MALDI MS/MS applications to sulfoglycomics of biological samples are limited not in technical principles but more so by sensitivity. We have demonstrated that all the useful fragmentation described previously (Yu et al., 2006) can be similarly reproduced on sulfated glycans by a complementary of low- and high-energy CID in positive ion mode, including the O-glycans derived from Peyers patches of a single mouse (Yu et al., 2009). However, in further push for sensitivity to get below the 1–10 million cell threshold, especially for cells that do carry sulfated glycans but only at very low abundance or to specifically identify a particular unique sulfated glycotope, a further leap of MS/MS sensitivity is needed. Otherwise, sulfoglycomic mapping will only be realized at MS level.
MS Analysis of Sulfated Glycans
23
4. Future Perspectives This chapter serves primarily to document a readily adapted set of protocols for preparing samples suitable for sulfoglycomic analysis based on MALDI-MS analysis of permethylated glycans. Taking into consideration the technical skills and time required, MALDI-MS screening in negative ion mode for permethylated glycans, with and without additional fractionation away of the much more abundant nonsulfated glycans, represents the most sensitive way of detecting the presence of monosulfated N- and O-glycans. Subsequent to this first screen, two immediate technical hurdles need to be crossed for advancing further sulfoglycomics. The first is to identify multiply sulfated species. It can almost be assumed that if monosulfated glycans are detected, di and multiply sulfated ones should also be present. The only issue is how abundant and whether the current experimental approach is sufficiently sensitive to detect them. The second is to effect comprehensive MS/MS, ideally on each of the detected sulfated glycan peaks, which again boils down to the issue of sensitivity versus how much starting materials one is willing to prepare. At a more structural details level, a critical issue is the ability to distinguish the positions of sulfate and thereby define the particular sulfo-glycotopes, for example, 6- or 60 -sulfo LeX. Our first attempt at this direction is to prime the sample preparation procedures toward MS/MS analysis in positive ion mode. With MALDI TOF/TOF, all issues related to structural details can, in principle, be addressed provided sample amount is not limiting in affording decent positive ion signals in the first place. However, to progress further, we have increasingly been relying on nanoESI-MS and MS/MS in more advanced MS instruments, such as the Thermo LTQ-Orbitrap Velos system. An offline analysis often allows detection at high resolution and accuracy of multiply sulfated glycans without losing the extra sulfates during MS ionization, at a sensitivity comparable to or better than MALDI-MS in negative ion mode. Signals observed can then be directly selected for MS/ MS, with a choice of CID MSn using the ion trap or a more Q/TOF like MS2 analysis using the HCD cell coupled with Orbitrap detection. Alternatively, a total ion mapping (Aoki et al., 2007) can be performed by fragmenting across the entire useful mass range using the HCD to avoid low mass cut-off and to use Orbitrap measurement for higher resolution. The initial results are very promising. With stable nanospray, the entire process can be accomplished within 10–15 min. Finally, an LC–MS/MS with several permutation of scan functions can be programmed for an even more in depth mining of the sulfoglycome.
24
Kay-Hooi Khoo and Shin-Yi Yu
We are thus cautiously optimistic about the future with more anticipated advances in MS instruments. In the meantime, it is hoped that all laboratories engaging in glycobiology research can adequately prepare the permethylated sample to the stage described in details in this chapter, including a first screen by MALDI-MS in negative ion mode, while leaving the more advanced MS analysis to experts with access to state-of-the-art MS instruments.
ACKNOWLEDGMENTS The authors wish to acknowledge financial support provided by Academia Sinica and Taiwan NRPGM to the common Mass Spectrometry Facilities for Proteomics and Glycomics, established at the Institute of Biological Chemistry, Academia Sinica, over the last 5 years or so to make this body of work in MS methodologies development for sulfoglycomics possible.
REFERENCES Aoki, K., Perlman, M., Lim, J. M., Cantu, R., Wells, L., and Tiemeyer, M. (2007). Dynamic developmental elaboration of N-linked glycan complexity in the Drosophila melanogaster embryo. J. Biol. Chem. 282, 9127–9142. Babu, P., North, S. J., Jang-Lee, J., Chalabi, S., Mackerness, K., Stowell, S. R., Cummings, R. D., Rankin, S., Dell, A., and Haslam, S. M. (2009). Structural characterisation of neutrophil glycans by ultra sensitive mass spectrometric glycomics methodology. Glycoconj. J. 26, 975–986. Chen, P., Baker, A. G., and Novotny, M. V. (1997). The use of osazones as matrices for the matrix-assisted laser desorption/ionization mass spectrometry of carbohydrates. Anal. Biochem. 244, 144–151. Ciucanu, I., and Kerek, F. (1984). A simple and rapid method for the permethylation of carbohydrates. Carbohydr. Res. 131, 209–217. Dell, A., Reason, A. J., Khoo, K. H., Panico, M., McDowell, R. A., and Morris, H. R. (1994). Mass spectrometry of carbohydrate-containing biopolymers. Methods Enzymol. 230, 108–132. Domon, B., and Costello, C. E. (1988). A systematic nomenclature for carbohydrate fragmentations in FAB-MS/MS spectra of glycoconjugates. Glycoconj. J. 5, 397–409. Fu, Y., Xu, S., Pan, C., Ye, M., Zou, H., and Guo, B. (2006). A matrix of 3,4-diaminobenzophenone for the analysis of oligonucleotides by matrix-assisted laser desorption/ ionization time-of-flight mass spectrometry. Nucleic Acids Res. 34, e94. Geyer, H., and Geyer, R. (2006). Strategies for analysis of glycoprotein glycosylation. Biochim. Biophys. Acta 1764, 1853–1869. Guerardel, Y., Chang, L. Y., Maes, E., Huang, C. J., and Khoo, K. H. (2006). Glycomic survey mapping of zebrafish identifies unique sialylation pattern. Glycobiology 16, 244–257. Harvey, D. J. (2005). Structural determination of N-linked glycans by matrix-assisted laser desorption/ionization and electrospray ionization mass spectrometry. Proteomics 5, 1774–1786. Haslam, S. M., North, S. J., and Dell, A. (2006). Mass spectrometric analysis of N- and O-glycosylation of tissues and cells. Curr. Opin. Struct. Biol. 16, 584–591.
MS Analysis of Sulfated Glycans
25
Hernandez Mir, G., Helin, J., Skarp, K. P., Cummings, R. D., Makitie, A., Renkonen, R., and Leppanen, A. (2009). Glycoforms of human endothelial CD34 that bind L-selectin carry sulfated sialyl Lewis x capped O- and N-glycans. Blood 114, 733–741. Jang-Lee, J., North, S. J., Sutton-Smith, M., Goldberg, D., Panico, M., Morris, H., Haslam, S., and Dell, A. (2006). Glycomic profiling of cells and tissues by mass spectrometry: Fingerprinting and sequencing methodologies. Methods Enzymol. 415, 59–86. Karlsson, N. G., and Thomsson, K. A. (2009). Salivary MUC7 is a major carrier of blood group I type O-linked oligosaccharides serving as the scaffold for sialyl Lewis x. Glycobiology 19, 288–300. Kawashima, H. (2006). Roles of sulfated glycans in lymphocyte homing. Biol. Pharm. Bull. 29, 2343–2349. Kimura, N., Ohmori, K., Miyazaki, K., Izawa, M., Matsuzaki, Y., Yasuda, Y., Takematsu, H., Kozutsumi, Y., Moriyama, A., and Kannagi, R. (2007). Human Blymphocytes express alpha2-6-sialylated 6-sulfo-N-acetyllactosamine serving as a preferred ligand for CD22/Siglec-2. J. Biol. Chem. 282, 32200–32207. Lei, M., Mechref, Y., and Novotny, M. V. (2009). Structural analysis of sulfated glycans by sequential double-permethylation using methyl iodide and deuteromethyl iodide. J. Am. Soc. Mass Spectrom. 20, 1660–1671. Mitoma, J., Bao, X., Petryanik, B., Schaerli, P., Gauguet, J. M., Yu, S. Y., Kawashima, H., Saito, H., Ohtsubo, K., Marth, J. D., Khoo, K. H., von Andrian, U. H., et al. (2007). Critical functions of N-glycans in L-selectin-mediated lymphocyte homing and recruitment. Nat. Immunol. 8, 409–418. North, S. J., Hitchen, P. G., Haslam, S. M., and Dell, A. (2009). Mass spectrometry in the analysis of N-linked and O-linked glycans. Curr. Opin. Struct. Biol. 19, 498–506. Papac, D. I., Wong, A., and Jones, A. J. (1996). Analysis of acidic oligosaccharides and glycopeptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Anal. Chem. 68, 3215–3223. Parry, S., Ledger, V., Tissot, B., Haslam, S. M., Scott, J., Morris, H. R., and Dell, A. (2007). Integrated mass spectrometric strategy for characterizing the glycans from glycosphingolipids and glycoproteins: Direct identification of sialyl Le(x) in mice. Glycobiology 17, 646–654. Robbe-Masselot, C., Herrmann, A., Maes, E., Carlstedt, I., Michalski, J. C., and Capon, C. (2009). Expression of a core 3 disialyl-Le(x) hexasaccharide in human colorectal cancers: A potential marker of malignant transformation in colon. J. Proteome Res. 8, 702–711. Rosen, S. D. (2004). Ligands for L-selectin: Homing, inflammation, and beyond. Annu. Rev. Immunol. 22, 129–156. Shida, K., Misonou, Y., Korekane, H., Seki, Y., Noura, S., Ohue, M., Honke, K., and Miyamoto, Y. (2009). Unusual accumulation of sulfated glycosphingolipids in colon cancer cells. Glycobiology 19, 1018–1033. Spina, E., Sturiale, L., Romeo, D., Impallomeni, G., Garozzo, D., Waidelich, D., and Glueckmann, M. (2004). New fragmentation mechanisms in matrix-assisted laser desorption/ionization time-of-flight/time-of-flight tandem mass spectrometry of carbohydrates. Rapid Commun. Mass Spectrom. 18, 392–398. Toyoda, M., Ito, H., Matsuno, Y. K., Narimatsu, H., and Kameyama, A. (2008). Quantitative derivatization of sialic acids for the detection of sialoglycans by MALDI MS. Anal. Chem. 80, 5211–5218. Wu, A. M., Khoo, K. H., Yu, S. Y., Yang, Z. G., Kannagi, R., and Watkins, W. M. (2007). Glycomic mapping of pseudomucinous human ovarian cyst glycoproteins: Identification of Lewis and sialyl Lewis glycotopes. Proteomics 7, 3699–3717. Xu, S., Ye, M., Xu, D., Li, X., Pan, C., and Zou, H. (2006). Matrix with high salt tolerance for the analysis of peptide and protein samples by desorption/ionization time-of-flight mass spectrometry. Anal. Chem. 78, 2593–2599.
26
Kay-Hooi Khoo and Shin-Yi Yu
Yu, S. Y., Wu, S. W., and Khoo, K. H. (2006). Distinctive characteristics of MALDI-Q/ TOF and TOF/TOF tandem mass spectrometry for sequencing of permethylated complex type N-glycans. Glycoconj. J. 23, 355–369. Yu, S. Y., Khoo, K. H., Yang, Z., Herp, A., and Wu, A. M. (2008). Glycomic mapping of O- and N-linked glycans from major rat sublingual mucin. Glycoconj. J. 25, 199–212. Yu, S. Y., Wu, S. W., Hsiao, H. H., and Khoo, K. H. (2009). Enabling techniques and strategic workflow for sulfoglycomics based on mass spectrometry mapping and sequencing of permethylated sulfated glycans. Glycobiology 19, 1136–1149. Zaia, J. (2008). Mass spectrometry and the emerging field of glycomics. Chem. Biol. 15, 881–892.
C H A P T E R
T W O
Mass Spectrometric Analysis of Mutant Mice Simon J. North, Jihye Jang-Lee, Rebecca Harrison, Ke´vin Canis, Mohd Nazri Ismail, Alana Trollope, Aristotelis Antonopoulos, Poh-Choo Pang, Paola Grassi, Sara Al-Chalabi, A. Tony Etienne, Anne Dell, and Stuart M. Haslam Contents 1. Overview 2. Methods 2.1. General advice 2.2. Protocol 1: Preparation of samples for glycan release 2.3. Protocol 2: Preparation of glycans for analysis 2.4. Protocol 3: Optional sample preparation steps 2.5. Protocol 4: Derivatization and analysis of released samples 2.6. Protocol 5: Glycobioinformatics 3. Interpretation of Glycomic Data 4. Example Project: Characterization of Pancreatic Tissue from WildType and Mgat4a Knockout Mice 4.1. MALDI-TOF MS mass fingerprinting 4.2. MALDI-TOF/TOF MS sequencing 4.3. Enzymatic digestion—a-galactosidase treatment 4.4. Linkage analysis by GC–MS 4.5. Summary 5. Summary of Glycan Structural Observations in Murine Tissues, Cells, and Knockouts Acknowledgments References
28 31 31 31 34 40 49 57 59 62 62 62 65 67 69 69 73 74
Abstract Mass spectrometry (MS) has proven to be the preeminent tool for the rapid, high-sensitivity analysis of the primary structure of glycans derived from diverse biological sources including cells, fluids, secretions, tissues, and Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78002-2
#
2010 Elsevier Inc. All rights reserved.
27
28
Simon J. North et al.
organs. These analyses are anchored by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) analysis of permethylated derivatives of glycan pools released from the samples, to produce glycomic mass fingerprints. The application of complimentary techniques, such as chemical and enzymatic digestions, GC–MS linkage analysis, and tandem mass spectrometry (MS/MS) utilizing both electrospray (ES) and MALDI-TOF/TOF, together with bioinformatic tools allows the elucidation of incrementally more detailed structural information from the sample(s) of interest. The mouse as a model organism offers many advantages in the study of human biology, health, and disease; it is a mammal, shares 99% genetic homology with humans and its genome supports targeted mutagenesis in specific genes to produce knockouts efficiently and precisely. Glycomic analyses of tissues and organs from mice genetically deficient in one or more glycosylation gene and comparison with data collected from wild-type samples enables the facile identification of changes and perturbations within the glycome. The Consortium for Functional Glycomics (CFG) has been applying such MS-based glycomic analyses to a range of murine tissues from both wild-type and glycosylation-knockout mice in order to provide a repository of structural data for the glycobiology community. In this chapter, we describe in detail the methodologies used to prepare, derivatize, purify, and analyze glycan pools from mouse organs and tissues by MS. We also present a summary of data produced from the CFG systematic structural analysis of wild-type and knockout mouse tissues, together with a detailed example of a glycomic analysis of the Mgat4a knockout mouse.
1. Overview The mouse model system has long been providing the field of glycobiology with a steady stream of important information concerning the function of glycans and glycan-associated molecules in mammalian systems. By using targeted mutagenesis to knockout specific genes, the means are provided to investigate the biological importance of individual glycosyltransferases or specific glycan epitopes (Ioffe and Stanley, 1994; Metzler et al., 1994). Such methods have been used to reveal important aspects of glycan functions in the mammalian system (Bhaumik et al., 1998; Chui et al., 1997; Ellies et al., 1998), but have been somewhat limited by the lack of structural information. Complimentary knowledge of the precise nature of the glycan structural alterations perpetrated by these genetic abnormalities is an essential component in the investigation of these mice and their phenotypes, capable not only of providing concrete confirmation of structural features thereby proving or disproving hypotheses (Moody et al., 2001, 2003; North et al., 2010b), but also of indirectly revealing previously unknown biosynthetic information (Akama et al., 2006). However, though the glycosylation of various murine glycoproteins and some specific tissues has been established
Mass Spectrometric Analysis of Mutant Mice
29
structurally (Parry et al., 2006, 2007; Sutton-Smith et al., 2000, 2002), the glycan repertoires—or glycomes—of many murine tissues, organs, and cell types are poorly defined. Recognizing this issue, the Consortium for Functional Glycomics (CFG) has dedicated considerable resources toward providing a repository of information concerning the whole system analysis of the N-, O-, and glycolipid-linked structural glycomes of murine tissues. This data represents a foundation of structural knowledge and is available free of charge as a resource for the scientific community (CFG). Systematic structural characterizations of tissues and organs from pairs of age and sex matched C57BL/6 littermates as well as cell populations, for both wild-type and genetic knockouts, have been carried out utilizing a modern glycomics methodology based around mass spectrometry (MS). Structural glycobiological advancements made in the last 30 years have been driven in large part by advancements in mass spectrometric technology and techniques. MS today plays an integral role in the structural characterization of N- and O-linked glycans, glycolipids, and glycoconjugates. Within this chapter, we describe a refined, heavily tested glycomic methodology (Dell et al., 1994; Jang-Lee et al., 2006; Sutton-Smith et al., 2000) specifically tailored to structurally define N-linked, O-linked, and glycolipid-derived glycans from murine tissues, organs, and cell populations. The underlying strategy is based upon methods developed in the 1980s (Dell and Ballou, 1983; Fukuda et al., 1984a,b, 1985) and has been periodically updated to suit modern instrumentation and include other methodological developments (Dell, 1990; Dell et al., 1994; Jang-Lee et al., 2006; Sutton-Smith et al., 2000), but is still based upon the principle that permethylated glycans yield molecular ions at very high sensitivity, irrespective of the type of MS employed (Wada et al., 2007, 2010). In brief, pools of glycans are released sequentially from proteolytically digested biological samples. These glycan pools—N-linked, O-linked, and polar and nonpolar glycolipid-derived glycans—are then derivatized by permethylation prior to analysis by a range of mass spectrometric techniques. At present, the most commonly used instrumentation for profiling work is matrix-assisted laser-desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) or the tandem time-of-flight version MALDI-TOF/ TOF MS. Sequence information is obtained by collisionally activated decomposition (CAD) carried out by tandem mass spectrometry equipment, with electrospray (ES) and MALDI-TOF/TOF methods described in detail. Methods for the optional chemical or enzymatic degradation of the samples and linkage analysis by gas chromatography–mass spectrometry (GC–MS), as well as guidelines for the utilization of some glycoinformatic tools are also included. The complete methodology is shown in Fig. 2.1. The information generated from these methods are commonly further enhanced by the parallel analysis by glycan gene microarray screening (Bax et al., 2007; Comelli et al., 2006; Montpetit et al., 2009).
30
Simon J. North et al.
Protocol 1: Preparation of mice
Protein pellet
2.1: Cleavage of S-S bridges and protection of Cys
Supernatant 3.2b: Polar recovery 3.2c: Nonpolar recovery Upper phase
2.2: Proteolytic digest
Lower phase 2.3: Glycopeptide purification
Polar glycolipids
Nonpolar glycolipids
2.4: N-glycan release 2.5: N-glycan purification Propanol fraction
3.2d: Glycolipid oligosaccharide release 3.2e: Glycolipid oligosaccharide purification
2.6: O-glycan release
Aq. fraction
Polar glycolipid derived glycans
Nonpolar glycolipid derived glycans
2.7: O-glycan purification
N-linked glycans
O-linked glycans
Protocol 2: Preparation of glycans for analysis
Protocol 3: Optional sample preparation steps
3.2a: Glycolipid partitioning
1.2: Homogenization 1.3: Cell lysis
1.1: Excision of tissues/organs or isolation of cells
3.1: Homogenization/lysis with glycolipid extraction
3.3: Chemical digestion of released glycans 3.4: Enzymatic digestion of released glycans
Protocol 4: Derivatisation and analysis of released samples
4.1: Permethylation of released glycan pools 4.2: Permethylated glycan purification Permethylated glycan pools
4.3: MALDI-TOF Mass spectrometry Mass-fingerprinting 4.5: Electrospray Mass spectrometry Sequencing
Protocol 5: Bioinformatics
4.6: Partially methylated alditol acetates
4.4: MALDI-TOF-TOF Mass spectrometry Sequencing
5a: Cartoonist 5b: Glycoworkbench
4.7: Gas-chromatography Mass spectrometry Linkage analysis
Glycan structural data
CFG database
Figure 2.1 Overall strategy for the preparation and analysis of glycans from biological samples.
Mass Spectrometric Analysis of Mutant Mice
31
By employing these methods, the analytical glycotechnology core (Core C) of the CFG has produced detailed structural data on hundreds of murine tissue, organ, and cell samples. All of this data is deposited in the open access CFG databases (http://www.functionalglycomics.org) and is too vast a resource to completely distil into a single chapter (North et al., 2010a). However, within the second half of this chapter, we have compiled tables summarizing the major structural features observed in the wild-type and transgenic mouse samples analyzed by Core C. Sample MALDI mass spectra of selected mouse tissue and cell samples are also included, as well as an exemplar application of the methodology in the comparative analysis of a wild-type and mgat4a knockout mouse pancreas sample.
2. Methods 2.1. General advice 1. For all aqueous solutions, water additions, and cleaning of equipment, use ‘‘ultrapure’’ 18.2 MOcm3 distilled/deionized water. 2. Wherever possible, use glassware, Pyrex disposable culture tubes, and glass disposable pipettes rather than plastic. It should be noted that acid hydrolysis reactions involving hydrofluoric acid (HF) is the major exception to this rule (see Protocol 3.3a). 3. Ensure all glassware is thoroughly cleaned and dried before use. 4. Avoid the use of detergents wherever possible. Do not wash equipment with detergents, for example. 5. Avoid the use of anything that could contaminate your sample with carbohydrates (cellulose from culture-tube screw-caps or tissue paper while cleaning equipment, for example).
2.2. Protocol 1: Preparation of samples for glycan release 1.1: Excision of tissues/organs or isolation of cells 1. Mouse tissues and organs analyzed by the CFG were harvested from 6to 8-week old sex-matched C57BL/6 mice obtained from the Scripps Research Institute (La Jolla, CA) custom breeding core and sacrificed by cervical dislocation. The excised samples were snap-frozen immediately after harvesting and stored at 80 C ready for homogenization. Various commercial sources for transgenic mice are available, including The Jackson Laboratory ( JAX), The Mutant Mouse Regional Resource Centre (MMRRC), or the Knock Out Mouse Project (KOMP). 2. Cells, once isolated according to the relevant protocol, should be pelleted having been washed three times with phosphate buffered saline (PBS),
32
Simon J. North et al.
especially if they might contain any trace of culture media (fetal calf serum (FCS) especially is a very rich source of contaminating glycoproteins). The cells should be resuspended in 100 mM ammonium bicarbonate in water, boiled for 10 min, and then lyophilized and stored at 80 C ready for cell lysis. 1.2: Homogenization For screening the glycans in mammalian tissues, 100–400 mg of tissue is sufficient for a series of MS analyses including sequential exoglycosidase digestions, MS/MS studies, and linkage analyses. As a rough guide to physical amounts, high-quality mapping data can be obtained from 10% of a single mouse kidney. The use of a dedicated electric homogenizer removes the need for dicing of tissues or organs in most cases, but for larger or more awkward samples, mince the excised tissue into small (1–2 mm3) cubes using a clean scalpel and glass Petri dish, prior to homogenization. Obtain an approximate wet-weight of the sample prior to homogenization. Note: if you intend to extract glycolipids (optional) in addition to N- and O-linked glycans, see Protocol 3.1a. Materials 1. Homogenization buffer (50 ml): 1% CHAPS (v/v) in 25 mM Tris, 150 mM sodium chloride (NaCl), 5 mM EDTA in water, pH 7.4 (adjusted with dilute acetic acid). Place on ice or refrigerate. 2. Dialysis buffer (4.5 l): 50 mM ammonium hydrogen carbonate, pH 7.4 (adjusted with dilute acetic acid). Store at 4 C. 3. Cleaning solution A (50 ml): 80% (v/v) methanol in H2O. 4. Cleaning solution B (50 ml): 33%:33%:33% (v:v:v) methanol, formic acid, H2O 5. Cleaning solution C (50 ml): 50% (v/v) chloroform in methanol 6. Methanol 7. Snakeskin dialysis tubing, cut off point of 7 kDa (Pierce, Prod # 68700). Soak tubing in water prior to usage. 8. Ingenieurbu¨ro CAT X-120 homogenizer with a T6 or 6.1 dispersion shaft (a T17 shaft is also useful for large tissues) 9. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), dialysis clips, magnetic stirrer, 15 and 50 ml FalconÒ (Blue MaxTM) polypropylene tubes (BDH). Method 1. Cleaning the homogenizer: a. Immerse the tip of the shaft into cleaning solution A in a 50 ml Falcon tube and operate at low to intermediate settings for 60 s.
Mass Spectrometric Analysis of Mutant Mice
33
b. Examine the tip and carefully remove any debris with a fine needle taking care not to scratch the shaft. Repeat this process if required. c. Remove the dispersion shaft assembly, place into Cleaning Solution B in a 50 ml Falcon tube and sonicate for 10 min. d. Reassemble the homogenizer, and repeat step (1) with the following solutions: (a) methanol, (b) Cleaning Solution C, (c) methanol, (d) H2O (twice) e. Operate at a low to intermediate setting in an empty Falcon tube for 1 min. The homogenizer is now ready for use. 2. Place the sample (depending on size) into a fresh 15 or 50 ml Falcon tube, add 5 or 10 ml (respectively) of ice cold homogenization buffer and place the tube on ice. Place the tip of the homogenizer at the bottom of the tube and operate in 10 s bursts (pausing for 10 s in-between) at intermediate to high settings for 2 min, while keeping the sample on ice. Ensure that the tissue is properly homogenized. 3. Transfer the homogenized sample into the presoaked dialysis tubing and dialyse against the dialysis buffer at 4 C for 48 h. Use constant stirring and replace the dialysis buffer at regular intervals (approximately every 12 h). 4. Once dialysis is complete, transfer the sample into labeled glass culture tubes, cover with perforated Parafilm and lyophilize. 1.3: Cell lysis For the screening of cell isolates, 1 106 cells is considered the recommended lower limit to produce MALDI-MS profiling data from N- and O-linked glycoprotein-derived glycans. Larger cell numbers are usually required if further analytical techniques such as MALDI and/or ES-MS/ MS, chemical and enzymatic digestions, and assignment of glycolipid-derived glycan residues is desired. Using smaller sample quantities is possible, but will likely limit the types of analysis possible, leading to lower levels of structural information. The use of multiple independent biological replicates is also advised. Note: if you intend to extract glycolipids (optional) in addition to N- and O-linked glycans, see Protocol 3.1b. Materials 1. Cleaning solution A (50 ml): 80% (v/v) methanol in H2O 2. Cleaning solution B (50 ml): 33%:33%:33% (v:v:v) methanol, formic acid, H2O 3. Cleaning solution C (50 ml): 50% (v/v) chloroform in methanol 4. Methanol 5. Extraction buffer (50 ml): 1% CHAPS (v/v) in 25 mM Tris, 150 mM sodium chloride (NaCl), 5 mM EDTA in water, pH 7.4 (adjusted with dilute acetic acid). Place on ice or refrigerate.
34
Simon J. North et al.
6. Snakeskin dialysis tubing, cut off point of 7 kDa (Pierce, Prod # 68700). Soak tubing in water prior to usage. 7. Sonicator (Vibra-Cell-Sonics, model CV188), glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), dialysis clips, magnetic stirrer, 15 ml FalconÒ (Blue MaxTM) polypropylene tubes (BDH). Method 1. Cleaning the sonicator: a. Immerse the head of the sonicator into water in a 50 ml Falcon tube and operate on continuous mode at 20 amps for 10 s. b. Repeat step 1 with Cleaning Solution B c. Immerse the sonicator in water in a 50 ml Falcon tube and sonicate using a sonication bath for 10 min. d. Repeat step (1) with the following solutions: (a) water, (b) methanol, (c) Cleaning Solution C, (d) methanol, (e) H2O (twice) e. Operate continuous mode at 20 amps in an empty Falcon tube for 1 min. The sonicator is now ready for use. 2. Resuspend the lyophilized cell pellet by addition of 2 ml of ice cold extraction buffer in a 15 ml Falcon tube. Place on ice. 3. Immerse the tip of the sonicator into the sample and sonicate for 10 s on continuous mode at 40 amps. Pause for 15 s. Repeat five times. 4. Transfer the lysed sample into the presoaked dialysis tubing and dialyse against the dialysis buffer at 4 C for 48 h. Use constant stirring and replace the dialysis buffer at regular intervals (approximately every 12 h). 5. Once dialysis is complete, transfer the sample into 15 ml Falcon tubes, cover with perforated Parafilm and lyophilize.
2.3. Protocol 2: Preparation of glycans for analysis 2.1: Cleavage of S-S bridges and protection of Cys In order to efficiently release glycans using enzymes, the glycoprotein must first be denatured to allow access to potentially inaccessible glycosylation sites. This is routinely achieved by means of reduction/alkylation of the S-S bridges, followed by proteolytic digestion. This slightly modified protocol adds GuHCl to assist solubilization of the more difficult samples. 2.1: Materials 1. Tris buffer (50 ml): 0.6 M Tris, pH 8.5 (adjusted with dilute acetic acid). Degas by gently bubbling nitrogen gas through the solution for 30 min. 2. GuHCl stock solution (10 ml): 8 M guanidine hydrochloride (GuHCl) in water.
Mass Spectrometric Analysis of Mutant Mice
35
3. Tris–GuHCl buffer (5 ml): 0.6 M Tris in 4 M guanidine hydrochloride (GuHCl), pH 8.5 (adjusted with HCl). Add 0.363 g Tris to 2.5 ml of GuHCl Stock Solution. Adjust pH and top up to 5 ml with water. Degas by gently bubbling nitrogen gas through the solution for 30 min. 4. DTT solution (5 ml): 2 mg/ml dithiothreitol (DTT) in Tris–GuHCl Buffer. 5. IAA solution (5 ml): 12 mg/ml iodoacetic acid (IAA) in Tris buffer. 6. Dialysis buffer (4.5 l): 50 mM ammonium hydrogen carbonate, pH 7.4 (adjusted with dilute acetic acid). Store at 4 C. 7. Snakeskin dialysis tubing, cut off point of 7 kDa (Pierce, Prod # 68700). Soak tubing in water prior to usage. 8. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), dialysis clips, magnetic stirrer, heating block at 37 C. Method 1. Add 1–2 ml of the DTT Solution to the sample, use the minimum volume depending on solubility (for more difficult or larger samples, split into aliquots). If dealing with a protein pellet, the exact amount will depend upon pellet size—again, for larger samples, split into aliquots. Mix thoroughly, breaking up lumps as necessary, until the vast majority of the sample is solubilized. Cap the tube and incubate at 50 C for 2 h. Briefly centrifuge. 2. Add 1 ml of the IAA solution to the sample tube, cap the tube, and incubate for a further 90 min at room temperature in the dark. 3. The reaction is terminated by dialysis. Transfer the sample into the presoaked dialysis tubing and dialyse against the dialysis buffer at 4 C for 48 h. Use constant stirring and replace the dialysis buffer at regular intervals (approximately every 12 h). 4. Once dialysis is complete, transfer the sample into labeled glass culture tubes (or 15 ml Falcon tubes if volume is an issue), cover with perforated Parafilm and lyophilize. The sample is now ready for proteolytic digestion. 2.2: Proteolytic digestion For most glycomic experiments, trypsin digestion is ideal. However, alternatives such as endoproteinase Glu-C, chymotrypsin, or cyanogen bromide can be substituted. The method below is sufficient for samples of up to around 1 g of intact starting material. For larger samples, more trypsin will be required—typically a 1:50/1:100 ratio of enzyme to protein (w/w) is required to digest the sample. Be aware that large quantities of trypsin do carry a risk of contamination from exogenous glycans.
36
Simon J. North et al.
Materials 1. Digestion buffer (50 ml): 50 mM ammonium hydrogen carbonate, pH 8.4 (adjusted with aqueous ammonia). 2. Dilute acetic acid (50 ml): 5% (v/v) acetic acid in H2O 3. Trypsin solution: 1 mg/ml porcine pancreas trypsin in digestion buffer. Weigh out 0.5–1.5 mg of TPCK-treated trypsin and add an appropriate amount of digestion buffer (i.e., 0.5–1.5 ml) to make a 1 mg/ml solution. 4. Heating block at 37 C. Method 1. Add 1 ml of the trypsin solution to the reduced/carboxymethylated sample and incubate at 37 C for 16 h. Ensure the sample is completely suspended in the solution, topping up with digestion buffer if necessary. 2. Terminate the reaction by heating to 100 C for 2 min. 3. Add 1 drop of dilute acetic acid (more may cause precipitation) to neutralize the sample. 4. Proceed directly to glycopeptide purification (i.e., do not lyophilize) 2.3: Glycopeptide purification This purification step is necessary to remove any remaining hydrophilic contaminants from the peptides and putative glycopeptides prior to glycan release. Materials 1. Purification column: OasisÒ HLB Plus cartridge (Waters). 2. Dilute acetic acid (200 ml): 5% (v/v) acetic acid in H2O 3. Elution buffers (4 50 ml): 20%, 40%, and 100% (v:v) propan-1-ol in dilute acetic acid. 4. Methanol 5. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), retort stand and clamp, 20 ml glass syringe. Method 1. Assemble the glass syringe with the Oasis purification column attached. Clamp the body of the syringe in a retort stand and position a waste beaker underneath the apparatus. Ensure all solutions are prepared in advance and you have labeled three clean screw-capped culture glass tubes. 2. Condition the Oasis column by eluting sequentially with 5 ml methanol, 5 ml dilute acetic acid, 5 ml propan-1-ol, and 15 ml dilute acetic acid.
Mass Spectrometric Analysis of Mutant Mice
37
3. Carefully load the sample dropwise directly onto the column. For most samples from whole tissues, splitting the sample between multiple columns will be necessary. 4. Wash the sample with 20 ml dilute acetic acid. This fraction will only contain hydrophilic contaminants and may be discarded. 5. Elute stepwise with 4 ml of each of the three Elution buffers, collecting into clean, labeled glass culture tubes. 6. Reduce the volume of the fractions in a vacuum centrifuge (SpeedVacÒ) until you can combine the fractions into a single tube. 7. Cover with perforated Parafilm and lyophilize. Keep at 80 C ready for glycan release. 2.4: N-Glycan release Release of N-linked glycans from the peptide backbone is commonly achieved enzymatically by way of PNGase F (Tarentino and Plummer, 1994; Tarentino et al., 1985) or PNGase A (Tretter et al., 1991). PNGase A is used in situations where samples contain a1-3 fucose linked to the reducing end N-acetylglucosamine (GlcNAc). This is a common modification in plants and invertebrates, but is not known to naturally occur in mammalian samples, so barring special circumstances PNGase F digestion is sufficient. Materials 1. Peptide: N-glycosidase F (PNGase F) in glycerol (Roche EC 3.5.1.52). This can be kept for long periods of time in the freezer at 20 C. If lyophilized PNGase F is used, then once it has been dissolved use immediately as the activity of the enzyme may decline. 2. Enzyme buffer (50 ml): 50 mM ammonium hydrogen carbonate, pH 8.4 (adjusted with ammonia). 3. Heating block at 37 oC. Method 1. Dissolve the lyophilized propan-1-ol fraction(s) in 200 ml of enzyme buffer and combine if necessary. 2. Add 3–4 U of PNGase F and incubate for 24–48 h at 37 C, adding a fresh 3–4 U aliquot of PNGase F after 24 h. 3. Cover with perforated Parafilm and lyophilize. Keep at 80 C ready for purification. 2.5: N-Glycan purification This purification step is necessary to separate the released, hydrophilic N-glycans from the remaining peptides and O-glycopeptides.
38
Simon J. North et al.
Materials 1. Purification column: C18 Sep-PakÒ Short Body Classic Cartridges (Waters) 2. Dilute acetic acid (200 ml): 5% (v/v) acetic acid in H2O 3. Elution buffers (4 50 ml): 20%, 40%, and 100% (v:v) propan-1-ol in dilute acetic acid. 4. Methanol 5. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), retort stand and clamp, 5 ml glass syringe. Method 1. Assemble the glass syringe with the Sep-Pak purification column attached. Clamp the body of the syringe in a retort stand and position a waste beaker underneath the apparatus. Ensure all solutions are prepared in advance and you have labeled four clean screw-capped culture glass tubes. 2. Condition the Sep-Pak column by eluting sequentially with 5 ml methanol, 5 ml dilute acetic acid, 5 ml propan-1-ol, and 15 ml dilute acetic acid. 3. If necessary, resuspend the sample in a small volume of dilute acetic acid, before carefully loading the sample dropwise directly onto the column. 4. Elute stepwise with 5 ml of dilute acetic acid (do not discard, see note below) followed by 4 ml of each of the three elution buffers, collecting into clean, labeled glass culture tubes. 5. Reduce the volume of the fractions in a vacuum centrifuge (SpeedVacÒ) to approximately 1–2 ml. Combine the propan-1-ol fractions into a single tube. 6. Cover each sample with perforated Parafilm and lyophilize. Keep at 80 C in preparation for derivatization (Protocol 4.1) or further chemical/enzymatic degradations (optional, Protocols 3.3 and 3.4). Note: The acetic acid fraction contains the total released N-glycan pool. The combined propan-1-ol fraction contains the remaining O-glycopeptides. 2.6: O-Glycan release An enzyme, O-glycosidase, is available and capable of releasing some O-glycans. However, it has a very restricted specificity so is thus only suitable for specialist use in conjunction with other enzymes. O-Glycan release is therefore typically achieved chemically by way of an alkaline b-elimination. The reaction is carried out under reducing conditions to prevent glycan degradation by the ‘‘peeling’’ reaction by reducing terminal N-acetylgalactosamine (GalNAc) residues to their alditol forms and hence is commonly referred to as reductive elimination.
Mass Spectrometric Analysis of Mutant Mice
39
Materials 1. 0.1 M potassium hydroxide (KOH) stock solution (100 ml) 2. 1 M potassium borohydride (KBH4) solution in 0.1 M KOH (0.5–1.5 ml): weigh out 25–50 mg of KBH4 and dissolve in the 0.1 M KOH stock solution to give a concentration of 54–55 mg/ml. 3. Glacial acetic acid 4. Heating block at 45 C. Method 1. Add 400 ml of the KBH4 solution to the combined propan-1-ol fractions, in a glass culture tube. 2. Cap the tube with a Teflon-lined screw top and incubate at 45 C for 20–24 h. Briefly centrifuge. 3. Terminate the reaction by addition of a few (3–5) drops of glacial acetic acid, adding dropwise until the effervescence is observed to cease. 4. The sample is now ready for purification by cation exchange chromatography. 2.7: O-Glycan purification The freshly released O-glycans first need to be desalted before any further experiments are carried out. This is achieved by use of a Dowex cation exchange column. Materials 4 M hydrochloric acid (HCl) (500 ml) Dilute acetic acid (200 ml): 5% (v/v) acetic acid in H2O Methanolic acetic acid: 10% (v/v) acetic acid in methanol (50 ml) Washed Dowex beads (50 W-X8 (H) 50–100 mesh) (100 g): Place 100 g of dry beads in a 250 ml screw cap glass bottle. Add 100 ml of 4 M HCl and decant. Repeat this two more times, then wash the beads by adding, agitating, and decanting 25–30 times with water to remove residual HCl. Wash the beads three times with dilute acetic acid before finally storing them immersed in dilute acetic acid ( 200 ml). The treated beads can be kept equilibrated in this state for many months. 5. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), glass Pasteur pipettes, glass wool, silicone tubing (length 10 cm, internal diameter of 1–2 mm), adjustable (screw) clips, retort stand, and clamp. 1. 2. 3. 4.
40
Simon J. North et al.
Method 1. Clamp the desalting column (a Pasteur pipette plugged at the tapered end with a small amount of glass wool) in a retort stand with a waste beaker beneath. Insert the tapered end of the Pasteur pipette into a piece of silicone tubing (10 cm length with internal bore diameter of 1–2 mm) and use a screw-adjustable clip to close the tip of the tubing. 2. Fill the column with dilute acetic acid. Open the clip to allow the acid to slowly run out. As the acid level drops, fill the column with washed Dowex beads. Fill the column to the crimp in the Pasteur. 3. Wash the column with 20 ml of dilute acetic acid. Do this slowly, do not allow the level of liquid to drop below the Dowex level. Use the clip to control flow. 4. Place a labeled glass culture tube under the column and load the reductively eliminated sample, allowing it to slowly flow onto the column, closing the clip once the entire sample has moved into the beads. 5. Top up the column with dilute acetic acid before opening the clip and allowing the liquid to slowly pass through the column and into the collection tube. Keep topping up the column with dilute acetic acid until 2.5 ml of eluent has been collected. 6. Replace the collection tube with a fresh labeled tube and repeat step 5. 7. Reduce the volume of the two samples in a vacuum centrifuge (SpeedVacÒ) to approximately 1–2 ml. Cover the samples with perforated Parafilm and lyophilize. 8. Borates introduced during the reductive elimination step now need to be removed by coevaporation. Add 0.5 ml of methanolic acetic acid to the lyophilized sample, before evaporating under a gentle stream of nitrogen gas at room temperature. Repeat this process four times. 9. The first 2.5 ml sample now contains the total released and reduced O-glycan pool. Keep at 80 C in preparation for derivatization (Protocol 4.1) or further chemical/enzymatic degradations (optional, Protocols 3.3 and 3.4). The second 2.5 ml aliquot should not contain much beyond contaminating material, but should be stored at 80 C in case it is needed.
2.4. Protocol 3: Optional sample preparation steps 3.1a. Homogenization with glycolipid extraction See Protocol 1.2 for general notes on tissue preparation. Before proceeding, weigh the tissue and calculate the volume of water represented, using the assumptions that 80% of tissue mass is water and 1 g H2O ¼ 1 ml H2O.
Mass Spectrometric Analysis of Mutant Mice
41
Materials Cleaning solutions (see Protocol 1.2) Methanol Chloroform Tris buffer (50 ml): 0.6 M Tris, pH 8.5 (adjusted with dilute acetic acid). Degas by gently bubbling nitrogen gas through the solution for 30 min. 5. Snakeskin dialysis tubing, cut off point of 7 kDa (Pierce, Prod # 68700). Soak tubing in water prior to usage. 6. Ingenieurbu¨ro CAT X-120 homogenizer with a T6 or 6.1 dispersion shaft (a T17 shaft is also useful for large tissues) 7. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), dialysis clips, magnetic stirrer, benchtop centrifuge, 15 and 50 ml FalconÒ (Blue MaxTM) polypropylene tubes (BDH).
1. 2. 3. 4.
Method 1. Clean the homogenizer as described in Protocol 1.2 2. Place the sample (depending on size) into a fresh 15 or 50 ml Falcon tube, add 4 volumes of ice-cold water and place the tube on ice. Place the tip of the homogenizer at the bottom of the tube and operate in 10 s bursts (pausing for 10 s in-between) at intermediate to high settings for 2 min, while keeping the sample on ice. Ensure that the tissue is properly homogenized. 3. Calculate the aqueous volume in ml by adding the total volume of water used in step 2 in ml to 80% of the tissue mass in g. Add 2.67 times the aqueous volume of methanol to the sample and mix vigorously at room temperature. 4. Add 1.33 times the aqueous volume of chloroform and mix vigorously at room temperature. 5. Centrifuge at 3000 rpm for 10 min. At this point, the glycolipids will be contained within the supernatant, with the pellet containing the remaining protein extract. 6. Carefully remove the supernatant from the pellet. This fraction is now ready for glycolipid partitioning (Protocol 3.2). 7. Remove excess methanol/chloroform from the pellet by placing under a gentle stream of nitrogen gas for 1–2 min. Do not allow the sample to dry completely. 8. Add 50 ml of Tris buffer to the pellet and replace under the nitrogen stream. Again, do not allow the sample to dry. The protein pellet is now ready for cleavage of S-S bridges and protection of Cys (Protocol 2.1). 3.1b: Cell lysis with glycolipid extraction See Protocol 1.3 for general notes on cell isolate preparation.
42
Simon J. North et al.
Materials Cleaning solutions (see Protocol 1.3) Methanol Chloroform Snakeskin dialysis tubing, cut off point of 7 kDa (Pierce, Prod # 68700). Soak tubing in water prior to usage. 5. Sonicator (Vibra-Cell-Sonics, model CV188), glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), dialysis clips, magnetic stirrer, centrifuge, 15 ml FalconÒ (Blue MaxTM) polypropylene tubes (BDH).
1. 2. 3. 4.
Method 1. Cleaning the sonicator: a. Immerse the head of the sonicator into water in a 50 ml Falcon tube and operate on continuous mode at 20 amps for 10 s. b. Repeat step 1 with cleaning solution B c. Immerse the sonicator in water in a 50 ml Falcon tube and sonicate using a sonication bath for 10 min. d. Repeat step (1) with the following solutions: (a) water, (b) methanol, (c) Cleaning Solution C, (d) methanol, (e) H2O (twice) e. Operate continuous mode at 20 amps in an empty Falcon tube for 1 min. The sonicator is now ready for use. 2. Resuspend the lyophilized cell pellet by addition of 2 ml of ice cold water in a 15 ml Falcon tube. Place on ice. 3. Immerse the tip of the sonicator into the sample and sonicate on ice for 10 s on continuous mode at 40 amps. Pause for 15 s. Repeat five times. 4. Add 2.67 sample volumes of methanol, cap, and mix vigorously 5. Add 1.33 sample volumes of chloroform, cap, and mix vigorously 6. Centrifuge at 3000 rpm for 10 min At this point, the glycolipids will be contained within the supernatant, with the pellet containing the remaining protein extract. 7. Carefully remove the supernatant from the pellet. This fraction is now ready for glycolipid partitioning (Protocol 3.2). 8. Remove excess methanol/chloroform from the pellet by placing under a gentle stream of nitrogen gas for 1–2 min. Do not allow the sample to dry completely. 9. Add 50 ml of Tris buffer to the pellet and replace under the nitrogen stream. Again, do not allow the sample to dry. 10. The protein pellet is now ready for cleavage of S-S bridges and protection of Cys (Protocol 2.1).
Mass Spectrometric Analysis of Mutant Mice
43
3.2: Glycolipid preparation The supernatant collected from the homogenization with glycolipid extraction procedure (Protocol 3.1) contains the extracted glycolipid pool from the sample, which can now be further partitioned into polar and nonpolar glycolipids. These pools are then purified, the oligosaccharide portions are released, and the glycolipid-derived glycans purified. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
Methanol Chloroform Acetonitrile (MeCN) Butan-1-ol Acetonitrile/TFA solution 1(50 ml): 80% acetonitrile in 0.1% (v/v) trifluoroacetic acid (TFA) in H2O Acetonitrile/TFA solution 2 (50 ml): 25% acetonitrile in 0.05% (v/v) TFA in H2O Methanol/water solution (50 ml): 50% (v/v) methanol in H2O Methanol/chloroform solution (20 ml): 50% (v/v) methanol in chloroform Dilute acetic acid (50 ml): 5% (v/v) acetic acid in H2O Purification column 1: tC18 (Plus) Sep-PakÒ Cartridge (Waters) Purification column 2: C18 Sep-PakÒ Short Body Classic Cartridges (Waters) Purification column 3: Hypercarb PGC column (Hypersep SPE column, 6 ml column volume, 1 g bed weight, Thermo) Digestion buffer (50 ml): Prepare 50 ml of 50 mM sodium acetate in water, pH 5.5 (adjusted with acetic acid). Add 100 mg sodium cholate to produce a 0.2% w/v solution. Ceramide glycanase, rEGCase II (Takara) Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), 10 ml glass syringe, benchtop centrifuge, retort stand, and clamp.
3.2a: Glycolipid partitioning 1. Measure the volume of the supernatant collected from the homogenization with glycolipid extraction procedure (Protocol 3.1). 2. Add 0.173 volumes of water and mix thoroughly. 3. Centrifuge for 15 min at 3000 rpm. 4. Separate the upper layer (polar glycolipids) and lower layer (nonpolar glycolipids) and place into a clean, dry glass culture tubes.
44
Simon J. North et al.
3.2b: Polar glycolipid recovery 1. Assemble the glass syringe with the tC18 (Plus) Sep-Pak purification column attached. Clamp the body of the syringe in a retort stand and position a waste beaker underneath the apparatus. Ensure all solutions are prepared in advance and you have labeled two clean screw-capped culture glass tubes. 2. Condition the Sep-Pak column by eluting sequentially with 5 ml methanol, 5 ml methanol/water solution, 5 ml methanol/chloroform solution, and 15 ml methanol/water solution. 3. Carefully load the sample onto the column, using the glass syringe as a reservoir. 4. Wash the column with 15 ml of methanol/water solution. 5. Elute stepwise with 5 ml of methanol followed by 5 ml of methanol/ chloroform solution, collecting into clean, labeled glass culture tubes. 6. Reduce the volumes of both fractions under a gentle stream of nitrogen gas, then combine. Replace under the nitrogen flow and evaporate to dryness. The polar glycolipids are now ready for oligosaccharide release. 3.2c: Nonpolar glycolipid recovery 1. 2. 3. 4.
Add 15 ml chloroform to the lower layer (nonpolar glycolipid) sample. Add 15 ml water and mix vigorously. Centrifuge for 15 min at 3000 rpm. Discard upper aqueous layer, transfer the lower chloroform layer to a fresh tube and repeat. Reduce the volume of the remaining chloroform layer under a gentle stream of nitrogen gas and before the sample dries completely, transfer to a clean glass culture tube before evaporating any remaining solvent. The nonpolar glycolipids are now ready for oligosaccharide release.
3.2d: Glycolipid oligosaccharide release 1. Resuspend the sample (either the polar glycolipids or the nonpolar glycolipids) in a minimum volume (0.2–1 ml) of digestion buffer. 2. Add 25 mU of ceramide glycanase and incubate at 37 C for 24 h. 3. Add a further 25 mU of enzyme and incubate at 37 C for a further 24 h. 3.2e: Glycolipid oligosaccharide purification 1. Add water to the ceramide digest sample to bring the volume up to 2 ml. 2. Add 2 ml of butan-1-ol and mix vigorously. Discard the upper (butan-1-ol) layer. 3. Repeat steps 1–2 twice more, before removing any lingering butan-1-ol by evaporation under a gentle flow of nitrogen gas for 20 min.
Mass Spectrometric Analysis of Mutant Mice
45
4. Assemble the glass syringe with the C18 Sep-PakÒ purification column attached. Clamp the body of the syringe in a retort stand and position a waste beaker underneath the apparatus. Ensure all solutions are prepared in advance and you have labeled three clean screw-capped culture glass tube. 5. Condition the Sep-Pak column by eluting sequentially with 5 ml methanol and 10 ml dilute acetic acid. 6. Carefully load the sample dropwise directly onto the column. 7. Elute with 5 ml of dilute acetic acid, collecting into a clean, labeled glass culture tube. 8. Further purify eluted glycans by Hypercarb column chromatography. Use a 5 ml syringe fitted to push the solvent through the column. 9. Condition the Hypercarb column by eluting sequentially with 3 columns of Acetonitrile/TFA solution 1, and 3 columns of water. 10. Carefully load the sample (from step 7) 11. Wash with 3 columns of water. 12. Elute with 2 columns of Acetonitrile/TFA solution 2. Collect in clean glass culture tube. 13. Reduce the volume of the fraction in a vacuum centrifuge (SpeedVacÒ) to approximately 1–2 ml. 14. Cover each sample with perforated Parafilm and lyophilize. Keep at 80 C in preparation for derivatization (Protocol 4.1) or further chemical/enzymatic degradations (optional, Protocols 3.3 and 3.4). 3.3: Chemical digestion of released glycans The treatment of released, purified glycan pools with chemical or enzymatic (Protocol 3.4) degradation processes is a powerful tool and can assist MS screening and MS/MS sequencing of glycans by providing information on structural features, linkages, monosaccharide identification, and stereochemistry. These experiments are most usually carried out following an initial analysis of the sample by MS or MS/MS, in order that the degradation (s) employed may be tailored to answer specific structural ambiguities. 3.3a: Acid hydrolysis Acid hydrolysis using HF is a popular chemical treatment employed in the analysis of carbohydrates. The process has been shown to release phosphorylcholine (PC) from N-glycans (Haslam et al., 1997) and is capable of hydrolyzing phosphodiester bonds in glycosylphosphatidilinositol(GPI)anchored proteins (Schneider and Ferguson, 1995). Most commonly, however, it is utilized to selectively cleave fucose residues. HF treatment removes a1-3-linked fucose residues rapidly, while a1-2,4 and 6-linked fucoses are released at a much slower rate.
46
Simon J. North et al.
Materials 1. 48% HF solution 2. Dilute acetic acid (50 ml): 5% (v/v) acetic acid in H2O 3. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), 1.5 ml Eppendorfs. Carry out all reactions in plastic, since HF will dissolve glass. Handle with care. Method 1. Add 50 ml of HF solution to the purified, released sample in a plastic Eppendorf and incubate at 4 C for 20 h. 2. Terminate the reaction by drying under a gentle stream of nitrogen gas. 3. Redissolve the sample in a minimum volume of dilute acetic acid and transfer to a fresh glass culture tube. Cover the sample with perforated Parafilm and lyophilize. 4. The sample is now ready for further degradations via enzymatic treatment or derivatization by permethylation (see Protocol 3.4 (optional) or Protocol 4.1) 3.3b: Mild periodate oxidation Periodate oxidation has long been a widely used tool in carbohydrate chemistry (Angel and Nilsson, 1990; Bobbitt, 1956). It is particularly useful for O-glycan structural determination. Under mild conditions, cleavage occurs specifically between the C4 and C5 carbons of the core N-acetylgalactosaminitol. This allows the O-glycan core type to be determined (Stoll et al., 1990). Materials 1. Oxidation buffer (50 ml): 100 mM ammonium acetate (pH 6.5, adjusted with acetic acid) 2. Oxidation solution (1 ml): 20 mM sodium m-periodate in oxidation buffer 3. Ethylene glycol 4. Reduction buffer (50 ml): 2 M ammonium hydroxide 5. Reduction solution (5 ml): 10 mg/ml sodium borohydride (NaBH4) in reduction buffer 6. Acetic acid Method 1. Add 100 ml of oxidation solution to the released O-glycan sample and incubate at 0 C for 20 h in the dark 2. Terminate the reaction with the addition of 2–3 ml of ethylene glycol
Mass Spectrometric Analysis of Mutant Mice
47
3. Stand at room temperature for 1 h, then cover the sample with perforated Parafilm and lyophilize. 4. Add 400 ml of reduction solution and incubate at room temperature for 2 h 5. Terminate the reaction by addition of a few (3–5) drops of glacial acetic acid, adding dropwise until the effervescence is observed to cease. 6. The sample is now ready for purification by cation exchange chromatography (see Protocol 2.7: O-glycan purification) 3.4: Enzymatic digestion of released glycans Enzymatic digestions of glycan pools are relatively simple experiments that are capable of yielding large amounts of structural information. Most commonly, the enzymes utilized fall into one of three categories—glycosyltransferases (which add sugar residues to nonreduced positions), exoglycosidases (which cleave nonreducing end terminal sugar residues), and endoglycosidases (which cleave internal glycosidic bonds). These enzymes typically have extremely specific substrates, only cleaving or extending glycans with the correct residue, linkage, and anomeric stereochemistry. Materials 1. a-Mannosidase Cleaves all a(1-2,3,6)-linked mannose residues (Lundblad et al., 1976) Digestion buffer (50 ml): 50 mM ammonium acetate, pH 4.5 (adjusted with dilute acetic acid) Enzyme solution: 0.5 U of a-mannosidase ( Jack Bean, EC 3.2.1.24 (Sigma)) in 100 ml of digestion buffer. 2. a-Galactosidase Cleaves all a-linked, nonreducing terminal galactose residues (Kobata, 1979). Digestion buffer (50 ml): 50 mM ammonium formate, pH 6.0 (adjusted with HCl) Enzyme solution: 0.5 U of a-galactosidase (green coffee beans, EC 3.2.1.22 (Sigma)) in 100 ml of digestion buffer. 3. b-Galactosidase Cleaves all b-linked, nonreducing terminal galactose residues. Fucose linked to the penultimate N-acetylglucosamine will block cleavage of the galactose (Miyatake and Suzuki, 1975). Digestion buffer (50 ml): 50 mM ammonium acetate, pH 4.6 (adjusted with dilute acetic acid) Enzyme solution: 10 mU of b-galactosidase (bovine testes, EC 3.2.1.23 (Sigma)) in 100 ml of digestion buffer.
48
Simon J. North et al.
4. b-N-Acetylhexosaminidase Cleaves terminal b-N-acetylglucosamine and b-N-acetylgalactosamine residues (Kobata, 1979) Digestion buffer (50 ml): 50 mM ammonium formate, pH 5.0 (adjusted with HCl) Enzyme solution: b-N-acetylhexosaminidase (bovine kidney, EC 3.2.1.52 (Sigma)) in 100 ml of digestion buffer. 5. Endo-b-galactosidase Cleaves internal b(1-4) galactose linkages in unbranched, repeating poly-N-acetyllactosamine [GlcNAcb(1-3)Galb(1-4)]n structures (Scudder et al., 1983) Digestion buffer (50 ml): 50 mM ammonium acetate, pH 5.5 (adjusted with dilute acetic acid) Enzyme solution: 5 mU of endo-b-galactosidase (Bacteroides fragilis, EC 3.2.1.103 (Sigma)) in 100 ml of digestion buffer. 6. a(2-3,6,8) Neuraminidase Cleaves all nonreducing terminal sialic acid residues (Corfield et al., 1983). Digestion buffer (50 ml): 50 mM ammonium acetate, pH 5.5 (adjusted with dilute acetic acid) Enzyme solution: 20 U of a(2-3,6,8) neuraminidase (Vibrio cholerae, EC 3.2.1.18 (Sigma)) in 100 ml of digestion buffer. 7. a(2-3) Neuraminidase Cleaves exclusively the nonreducing terminal a(2-3) unbranched sialic acid residues (Corfield et al., 1983) Digestion buffer (50 ml): 50 mM ammonium acetate, pH 5.5 (adjusted with dilute acetic acid) Enzyme solution: 0.025 U of a2-3-neuraminidase (Streptococcus pneumoniae, EC 3.2.1.18 (Sigma)) in 100 ml of digestion buffer. 8. Sialidase A Cleaves all nonreducing terminal branched and unbranched sialic acids, including the Sda epitope (GaINAcbl-4[NeuAca2-3]Galbl4GlcNAc-R) (Uchida et al., 1977) Digestion buffer: 50 mM sodium acetate, pH 5.5 (adjusted with dilute acetic acid) Enzyme solution: 170 mU of sialidase A (recombinant from Arthrobacter ureafacien, expressed in E. Coli, EC 3.2.1.18 (Glyko)) in 100 ml of digestion buffer. Method 1. Add 100 ml of the chosen enzyme solution (see above) to the released, purified glycan sample and incubate at 37 C for 48 h. 2. Add additional 100 ml aliquots of freshly prepared enzyme solution every 12 h.
Mass Spectrometric Analysis of Mutant Mice
49
3. Cover the sample with perforated Parafilm and lyophilize. Keep at 80 C in preparation for derivatization (Protocol 4.1) or further chemical/ enzymatic degradations.
2.5. Protocol 4: Derivatization and analysis of released samples 4.1: Permethylation of released glycan pools Analysis of native glycans is possible, but since they do not ionize as well as other biomolecules (such as peptides (Harvey, 1999)), it is desirable to derivatize prior to analysis. This bestows a compensatory increase in sensitivity, as well as a hydrophobicity increase which is advantageous when trying to remove salt contaminants. Derivatization methods can be broadly categorized into those that employ reducing end tagging and those that serve to protect most or all of the functional groups. Tagging facilitates chromatographic separation and enhances reducing-end fragmentation, with current common tagging reagents including aminopyridine (Kuraya and Hase, 1996), 2-aminobenzamide (Chen and Flynn, 2007), and 1-phenyl-3-methyl pyrazolone (Mason et al., 2006). Protection of the functional groups by permethylation is generally preferable, however. In addition to greatly enhancing the sensitivity of detection with the smallest increase in molecular weight, permethyl derivatives fragment very selectively, producing a limited number of easily interpretable structurally diagnostic ions and allowing easy discrimination between single and multiple cleavage events (Dell, 1990; Dell et al., 1994; Jang-Lee et al., 2006). Materials 1. Methyl iodide 2. Anhydrous dimethyl sulfoxide (10 ml): careful use of a septum-sealed bottle or ampoules of anhydrous dimethyl sulfoxide (DMSO) such as HiDry Anhydrous DMSO solvent (Romil) removes the need for calcium hydride treatment (Dell, 1990) 3. Sodium hydroxide pellets 4. Chloroform 5. Glass pestle and mortar, glass Pasteur pipettes. Ensure all equipment is completely dry before use. Method 1. Place approximately 3–5 sodium hydroxide pellets into the mortar and add 3 ml of DMSO
50
Simon J. North et al.
2. Crush the pellets into a slurry, adding more DMSO if necessary. This step needs to be carried out quickly in order to avoid excessive moisture absorption. 3. Using a glass Pasteur pipette, add a small amount (0.5–1 ml) of the slurry directly to the purified glycan sample 4. Add 0.5 ml of methyl iodide, cap the tube, and mix vigorously (use an automatic shaker if available) for 10 min at room temperature. 5. Quench the reaction by slow, dropwise addition of water with constant agitation, until the effervescence is observed to cease. 6. Add 2 ml of chloroform 7. Top up with water to give a total volume of 5 ml and mix vigorously. 8. Allow the mixture to separate into two layers (briefly centrifuge if necessary) 9. Discard upper aqueous layer, and repeat steps 7 and 8 four more times 10. Dry the remaining chloroform layer under a gentle stream of nitrogen gas. The permethylated glycans are now ready for permethylated glycan purification. 4.2: Permethylated glycan purification The newly hydrophobic permethyl derivatives can now be separated from any aqueous contaminants (such as salts, a common culprit of poor MS) by way of a chromatographic separation. Materials 1. Purification column: C18 Sep-PakÒ Short Body Classic Cartridges (Waters) 2. Elution buffers (4 50 ml): 15%, 35%, 50%, and 75% (v:v) acetonitrile in water. 3. Acetonitrile 4. Methanol 5. Methanol/water solution (10 ml): 50% (v/v) methanol in H2O 6. Glass culture tubes (13 100 mm, Corning), culture tube caps (Fisher), Teflon inserts (Owens Polyscience), retort stand and clamp, 5 ml glass syringe. Method 1. Assemble the glass syringe with the C18 Sep-Pak purification column attached. Clamp the body of the syringe in a retort stand and position a waste beaker underneath the apparatus. Ensure all solutions are prepared in advance and you have labeled four clean screw-capped culture glass tubes. 2. Condition the Sep-Pak column by eluting sequentially with 5 ml methanol, 5 ml water, 5 ml acetonitrile, and 15 ml water.
Mass Spectrometric Analysis of Mutant Mice
51
3. Redissolve the sample in 200 ml of methanol/water and carefully load the sample dropwise directly onto the column. 4. Elute stepwise with 5 ml of water (discard) followed by 3 ml of each of the four elution buffers (15%, 35%, 50%, and 75%), collecting into clean, labeled glass culture tubes. 5. Reduce the volume of the fractions in a vacuum centrifuge (SpeedVacÒ) to approximately 0.5 ml. 6. Cover each sample with perforated Parafilm and lyophilize. The samples are now ready for MS analysis. Note: The fraction that contains the largest proportion of permethylated glycans depends upon the glycan pool. Smaller, less hydrophobic O-glycans tend to elute mostly in the 35% fraction, while the larger N-glycans tend to be observed eluting in the 50% fraction of their respective separations. Keep all the fractions, storing in screw-capped tubes at room temperature. Mass spectrometric analysis of derivatized glycan pools Early glycomic investigations utilized fast atom bombardment (FAB) mass spectrometry (Dell and Ballou, 1983; Fukuda et al., 1984b) for the analysis of glycan mixtures. This has since been superseded by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) on both single and double TOF instruments for mass-mapping of samples, offering increases in throughput and sensitivity in the analysis of derivatized isolated pools of glycans (Yu et al., 2006). Interpretation of MALDI spectra produced from the methods described here are based upon prior knowledge of glycan biosynthesis, with specific masses usually coinciding with unique glycan compositions. These MALDI ‘‘fingerprints’’ or mass maps are used to inform prior to further experimentation designed to clarify antennal sequences or branching patterns. This may take the form of enzymatic or chemical treatments (Protocols 3.3 and 3.4) or by application of tandem mass spectrometry (MS/MS) to the fragmentation of individual molecular ions in the sample. A diverse array of such instrumentation is available from all of the major MS manufacturers. Though a detailed discussion of their various merits and limitations is outside the scope of this chapter (Dell et al., 2007, 2008; North et al., 2009; Zaia, 2008), alternatives for the tandem and multistage (MSn) mass spectrometric analysis of glycans include the older triple-quadrupole ES instrumentation (Dell et al., 1994; Fenn et al., 1989; Yost and Enke, 1978), ion traps (especially the more modern linear ion traps (Wang et al., 2006)), and electron capture dissociation (ECD) and electron transfer dissociation (ETD), two methods which do not solely use the more common collisionally activated dissociation (CAD) method to induce fragmentation, instead using additional, alternate mechanisms (Perdivara et al., 2009; Sihlbom et al., 2009). The techniques employed at present in our laboratory are matrix-assisted laser
52
Simon J. North et al.
desorption-ionization, tandem time-of-flight mass spectrometry (MALDITOF-TOF MS) and ES tandem mass spectrometry (ES-MS/MS), both of which are common instrumentation in biopolymer MS facilities. The fragmentation pathways established for permethyl derivatives of carbohydrates using FAB-MS (Dell, 1987) are preserved in all CAD-based tandem mass spectrometric techniques. The major ions produced arise from cleavage of the positively charged parent ions on the nonreducing side of the glycosidic bond to form an oxonium ion (A-type cleavages, producing B ions), glycosidic bond cleavages on either side of the glycosidic oxygen (bcleavages, producing Y ions), and cross-ring cleavages producing A-ions, where the charge may reside on either the reducing or nonreducing end of the molecule, depending upon the nature of the sample. The mechanisms for the generation of these daughter ions (as well as other products) are well documented elsewhere (Dell et al., 1994, 2007; Mechref and Novotny, 2002), and standardized nomenclature for the assignment of glycan fragments in MS follows the system suggested in 1988 (Domon and Costello, 1988). 4.3: MALDI-TOF MS Prior to analysis by MALDI-TOF MS, the sample is cocrystallized with a large excess of a matrix material, a low molecular weight material which absorbs strongly at the wavelength of the incident laser, and the mixture is deposited on a metal plate. Irradiation of this mixture by the laser induces the accretion of a large amount of energy in the condensed phase through electronic excitation of the matrix molecules. This causes desorption of analyte and matrix ions from the surface of the crystal. MALDI is regarded as a ‘‘soft’’ ionization method, producing mainly singly charged ions of the form [MþH]þ or related salt adducts such as [MþNa]þ or [MþK]þ, with little fragmentation. This makes it an ideal technique for the initial ‘‘fingerprinting’’ or mass-profiling of glycan mixtures. Materials 1. Matrix for permethylated glycans (100–500 ml): 20 mg/ml 2,5-dihydroxybenzoic acid (DHB) in 5:5 (v/v) methanol/water. Make fresh and keep in the dark. For glycolipid-derived samples, use a 10 mg/ml solution. 2. Matrix for peptide calibrants (100–500 ml): 10 mg/ml a-cyano-4-hydroxycinnamic acid in 50% acetonitrile in 0.1% (v/v) TFA in water. Make fresh and keep in the dark. 3. External peptide calibrant solution: 100 mg/ml of peptide/protein mix (leucine enkephalin, bradykinin (fragment-8), angiotensin I, adrenocorticotropic hormone fragment (ACTH) 1–17, ACTH fragment 18–39,
Mass Spectrometric Analysis of Mutant Mice
53
ACTH fragment 7–38, ACTH fragment 1–39 and insulin (bovine pancreas)) in 0.1% (v/v) TFA in water. 4. Methanol 5. ABI Voyager-DE STR MALDI-TOF (or similar), 100 spot MALDI plate, 0.5 ml Eppendorf tubes. Method 1. Thoroughly clean the MALDI plate with methanol before a fresh use and ensure it is completely dry. 2. Dissolve the dry, permethylated glycan sample in 10 ml of methanol 3. Take a 1 ml aliquot of the sample and mix with 1 ml of matrix solution in a fresh tube 4. Take a 2 ml aliquot of the external calibrant solution and mix with 2 ml of matrix solution in a fresh tube 5. Spot a 1 ml aliquot of each sample to be analyzed (plus calibrants) onto individual spots on the MALDI plate, and dry under vacuum for 20 min. Once completely dry, the plate is ready to be loaded into the MALDI mass spectrometer. 6. Before sample analysis, perform a calibration. Use a laser intensity of 2200 and record 50 shots/spectrum. Accumulate 3–4 spectra and calibrate. 7. Typical MALDI parameters for permethylated glycan analysis Mode: Positive reflectron, with delayed extraction Mass range: m/z 500–5000 Low mass gate: m/z 500 Accelerating volts: 20 kV Grid: 60–78% Delay time: 220–280 ns 4.4: MALDI-TOF-TOF tandem mass spectrometry MALDI-TOF-TOF MS is functionally identical to MALDI-TOF MS, as described in Protocol 4.3 for the ABI Voyager, with an additional TOF analyser arranged in tandem for the analysis of CAD fragments. However, this state of the art instrumentation offers increased performance in terms of upper mass range, sensitivity, and signal-to-noise ratios in addition to the ability to generate and analyze glycan fragments (Babu et al., 2009; North et al., 2010b; Pang et al., 2009; Stone et al., 2009). These instruments are capable of producing CAD fragments at both low and high energies, while preserving the resolution and sensitivity of the single-TOF instrumentation (Vestal and Campbell, 2005).
54
Simon J. North et al.
Materials 1. Matrix for permethylated glycans (100–500 ml): 20 mg/ml 2,5-DHB acid in 5:5 (v/v) methanol/water. Make fresh and keep in the dark. For glycolipid-derived samples, use a 10 mg/ml solution. 2. Matrix for peptide calibrants (100–500 ml): 10 mg/ml a-cyano-4-hydroxycinnamic acid in 50% acetonitrile in 0.1% (v/v) TFA in water. Make fresh and keep in the dark. 3. External peptide calibrant solution (MS mode): 100 mg/ml of peptide/ protein mix (Calmix—leucine enkephalin, bradykinin (fragment-8), angiotensin I, ACTH fragment 1–17, ACTH fragment 18–39, ACTH fragment 7–38, ACTH fragment 1–39 and insulin (bovine pancreas)) in 0.1% (v/v) TFA in water. 4. External peptide calibrant solution (MS/MS mode) (1 ml): 1 pmol/ml solution of [Glu1]-fibrinopeptide B in 1:3 (v/v) acetonitrile/5% acetic acid (v/v) in water 5. Methanol 6. ABI 4800 MALDI TOF/TOFTM (or similar), MALDI plate, 0.5 ml Eppendorf tubes. Method 1. Preparation of the MALDI plate, samples, and spotting are as described in Protocol 4.3: MALDI-TOF MS, remembering to additionally spot 1 ml of MS/MS mode calibration solution mixed with an equal volume of peptide matrix. 2. Before MS sample analysis, perform a calibration upon the MS peptide calibrant spot. Use a laser intensity of 3500 and record 50 shots/spectrum. Accumulate 10 spectra and calibrate. 3. Before MS/MS sample analysis, perform an MS/MS mode calibration upon the MS/MS peptide calibrant spot, using the above settings. 4. Typical MALDI TOF/TOF parameters for permethylated glycan sequencing Mode: Positive reflectron, with metastable ion suppression Laser intensity: 5000–6000 Shots: 1000 shots/spectrum, accumulate 10 spectra Mass range: m/z 50–5000 Accelerating volts: 20 kV Source-collision cell potential difference: 1 kV CID: On CID gas type: Inlet 1—Medium weight Collision gas: Argon Collision gas pressure: 10 4 mbar
Mass Spectrometric Analysis of Mutant Mice
55
4.5: Electrospray tandem mass spectrometry (ES-MS/MS) The ES is produced by applying a large electrical field, under atmospheric pressure, to a liquid passing through a conductively coated capillary tube, producing an ‘‘electrospray’’ of charged droplets. This aerosol eventually gives rise to gaseous ions, whose charge distribution is proportional to the number of ionizable groups in the molecule. ES-MS/MS instrumentation is very helpful to have access to, since multiple different types of mass spectrometer generate useful complimentary data. The widely available Q-TOF style ES-MS instrumentation (Morris et al., 1996) is ideal, employing relatively low-energy collisional activation within the collision chamber, thus producing product ions resulting mainly from cleavage at labile glycosidic bonds without the complexity of additional cross-ring fragmentation (Kui Wong et al., 2003; Moody et al., 2003; North et al., 2006). Materials 1. Quadrupole orthogonal acceleration time of flight (Q-TOF) mass spectrometer (Micromass, UK) fitted with a Z-spray API source (or similar) 2. NanoES spray capillaries (Protana) 3. Methanol 4. External peptide calibration solution (1 ml): 1 pmol/ml solution of [Glu1]-fibrinopeptide B in 1:3 (v/v) acetonitrile/5% acetic acid (v/v) in water Method 1. Calibrate the mass spectrometer with 3 ml of the external peptide calibration solution. 2. Dissolve the dry, permethylated glycan sample in 10 ml of methanol 3. Load 2 ml of the sample into a NanoES capillary, break the tip, and position at the source for analysis 4. Typical ES-MS/MS settings for fragmentation of permethylated glycans Mode: Positive ion mode Drying gas: Nitrogen Collision gas: Argon Collision gas pressure: 10 4 mbar Collision gas energy: 30–80 eV Potential at nanoflow tip: 1.5 kV Desired nanoflow rate: 10–30 nL/min
56
Simon J. North et al.
4.6: Preparation of partially methylated alditol acetates Prior to linkage analysis by GC–MS, the permethylated glycans must first be converted into partially methylated monosaccharides which are then converted into their alditol forms (Albersheim et al., 1967). The methyl groups of the permethylated sample act as permanent labels for hydroxyl groups not involved in ring formation or glycosidic bonding. The partially methylated alditols are then O-acetylated, labeling the free hydroxyl groups thus allowing identification of former linkage sites. Materials 1. Hydrolysis solution (1 ml): 2 M TFA 2. Reduction solution (1 ml): 10 mg/ml sodium borodeuteride (NaBD4) in 2 M ammonium solution. 3. Methanolic acetic acid (25 ml): 10% (v:v) acetic acid in methanol 4. Glacial acetic acid 5. Acetic anhydride 6. Chloroform Method 1. Incubate the dry permethylated glycan sample in 200 ml of hydrolysis solution at 121 C for 2 h. This produces partially methylated monosaccharides. Dry under a gentle stream of nitrogen gas. 2. Incubate the dry sample in 200 ml of reduction solution at room temperature for 2 h. 3. Terminate the reaction by addition of a few (3–5) drops of glacial acetic acid, adding dropwise until the effervescence is observed to cease. Dry under a gentle stream of nitrogen gas (samples do not need to be completely dry) 4. Borates introduced during the reduction now need to be removed by coevaporation. Add 1 ml of methanolic acetic acid to the sample, before evaporating under a gentle stream of nitrogen gas at room temperature. Repeat this process four times. 5. Incubate the dry sample in 200 ml of acetic anhydride at 100 C for 1 h in order to acetylate, then evaporate under a gentle stream of nitrogen gas 6. Add 2 ml of chloroform to the dry sample 7. Top up with water to give a total volume of 5 ml and mix vigorously. 8. Allow the mixture to separate into two layers (briefly centrifuge if necessary) 9. Discard upper aqueous layer, and repeat steps 7 and 8 four more times
Mass Spectrometric Analysis of Mutant Mice
57
10. Dry the remaining chloroform layer under a gentle stream of nitrogen gas. The partially methylated alditol acetates (PMAA) are now ready for linkage analysis by GC–MS. 4.7: Gas-chromatography–mass spectrometry (GC–MS) Analysis of the PMAA derivatives by GC–MS facilitates the identification of monosaccharide constituents and glycosidic bond positions, generally termed ‘‘linkage analysis.’’ It should be noted that the preparation of the PMAA derivatives (Protocol 4.6) does irreversibly disrupt the glycosidic bonds of the sample, in addition to destroying any sialic acids present due to the nature of the conditions. This should therefore be an experiment to be carried out once MS and MS/MS analyses of the permethylated glycans has been completed, unless there is sufficient sample to take an aliquot. Identification of monosaccharides is achieved by comparison of GC retention time and electron impact mass spectrometry (EI-MS) spectra with standards, while relative quantitation can be carried out by comparison of ion chromatogram peak areas. Particularly powerful information can be obtained by comparing GC–MS data before and after enzymatic/chemical degradations (Dell et al., 2007; Haslam et al., 1997; Kui Wong et al., 2003; North et al., 2010b). An excellent repository of standardized data for reference purposes can be found at the Complex Carbohydrate Research Centre (CCRC) Website—http://www.ccrc.uga.edu/ specdb/ms/pmaa.html. Materials 1. Perkin Elmer Clarus 500 Gas Chromatograph–Mass Spectrometer (GC–MS) or similar 2. RTX-5MS column (30 m 0.25 mm internal diameter, 5% diphenyl/ 95% dimethyl polysiloxane stationary phase, Restek Corp.) 3. Hexanes (Sigma Aldrich). Method 1. Dissolve the partially methylated alditol acetate (PMAA) samples in a small volume (20 ml) of hexanes 2. Inject 1 ml of dissolved sample onto the column at 60 C. Use a linear gradient, increasing to 300 C over 30 min at a rate of 8 C/min.
2.6. Protocol 5: Glycobioinformatics The computational challenges presented by glycobiological analysis and the approaches being taken to tackle them are addressed in a number of excellent recent articles (Aoki-Kinoshita, 2008; von der Lieth et al., 2006;
58
Simon J. North et al.
York et al., 2010). It should be emphasized that all of the tools mentioned here are only ever used to supplement or assist a researcher’s analyses, never to replace them entirely. Glycobiological analysis is too complex and variable a subject to rely on a fully automated approach, at least at present. Though it is not really possible to satisfactorily cover the emerging field of glycobioinformatics methods in a short section here, we feel it will be useful for researchers to have a short summary of a few of the tools available at present—where to find them, how best to utilize them, and where to look for support. This is not intended to be a complete or exhaustive list in any way, indeed no two laboratories use the same tools or algorithms, instead tending to favor specific or bespoke programs produced in response to the data processing requirements of their environment. Instead this is more to illustrate which utilities we use to compliment our experimental methodology. 2.6.1. The PARC mass spectrometry viewer (PMSV) Use: This is a very useful and widely applicable tool, specifically designed to enable the interactive viewing of ACSII format MS data. A major issue when trying to work with raw data in MS (like other fields reliant on specialist equipment) is the proprietary and/or poorly documented data formats of the output. This restricts the utility of the data to those who have access to the original analysis software. However, it is usually possible to export such data in ASCII format or similar, and with the use of software designed to display such information, enables any researcher to make use of the raw data files. It is also capable of displaying annotations by use of companion files via Cartoonist (below). Source: http://bio.parc.com/mass_spec (free download) Compatibility: Solaris, Mac OS X, Windows Support: Usage instructions and contact information available from the above site 2.6.2. Cartoonist Use: Cartoonist is an algorithm for the analysis and annotation of MS data from N-linked and O-linked glycan samples, specifically MALDI mass profiles of mammalian samples. It is designed to mimic the approach of a human expert in the annotation of MS data and is used in tandem with the PMSV (above) to allow the nonexpert user to utilize the data presented by the various repositories in a more meaningful way. At present, Cartoonist is available as a free web-based tool, though it is still evolving and may become available as a standalone download in the future. Source: http://bio.parc.com/cartoonist/newrun Compatibility: Solaris, Mac OS X, Windows
Mass Spectrometric Analysis of Mutant Mice
59
Support: Usage instructions and contact information available from the above site (Goldberg et al., 2005, 2009; Jang-Lee et al., 2006) 2.6.3. GlycoWorkBench Use: GlycoWorkBench is a suite of software tools designed for rapid drawing of glycan structures and for assisting the process of structure determination from MS data. The graphical interface of GlycoWorkBench provides an environment in which structure models can be rapidly assembled, their mass computed, their fragments automatically matched with MSn data and the results compared to assess the best candidate. GlycoWorkBench can greatly reduce the time needed for the interpretation and annotation of mass spectra of glycans. Source: http://www.glycoworkbench.org/attachment/wiki/WikiStart/Gly coWorkbench.1.1.3480.zip Compatibility: Linux, Mac OS X, Windows Support: http://www.glycoworkbench.org/raw-attachment/wiki/Wiki Start/GlycoWorkbench_short_manual.1.2.4105.pdf (Ceroni et al., 2008)
3. Interpretation of Glycomic Data The MALDI analyses of the permethylated N- and O-linked glycan pools from specific defined systems provide highly sensitive mass profiles. The assignments made within these profiles should be viewed primarily as unequivocal monosaccharide unit compositions for each peak. Knowledge of the specific biosynthetic pathways utilized by the system being analyzed is then used to provide the most informed suggestion for the structural identity of the glycoprotein-derived N-linked and O-linked glycans. For example, since N- and O-glycans are constructed from common pathways, the observation of a specific structural motif leads to the expectation of other related intermediate structures along the same pathway. This can also be indicative of the relative activities of the various glycosyltransferases present in the sample. The symbolic nomenclature used to annotate the resultant spectra is that used by the CFG (Fig. 2.2) (Varki et al., 2009). Even with very well informed biosynthetic knowledge, the possibility of alternative sequences for these putative assignments cannot initially be ruled out. Wherever possible, therefore, ES-MS/MS or MALDI-TOF-TOFMS/MS, in conjunction with additional data derived from experiments such as linkage analysis and enzyme digests, are applied to differentiate alternative possibilities. In most cases, structural cues are obtained from the fragmentation analysis of signals within the spectrum. This can lead,
60
Simon J. North et al.
A Glycan residues Monosaccharide
Abbreviation Symbol
Permethylated residue mass
Deoxyhexose Fucose
Fuc
174
Hexose Mannose Galactose Glucose
Man Gal Glc
204 204 204
GalNAc
245
GlcNAc N-Acetylglucosamine Sialic acid NeuAc N-Acetylneuraminic acid N-Glycolylneuraminic acid NeuGc
245
N-Acetylhexosamine N-Acetylgalactosamine
361 391
B Nonreducing and reducing ends Permethylated mass of ends
Glycan structure
H RO
CH2OR
CH2OR
CH2OR
O
O
O
H OR
Non-reducing end H
H
H OR
H O
H
H
H
H
OR H OR
Residues
Reducing end
H
OR
R + OR = 46
O
OR
H
n
H
OR
H
R = H for underivatised glycans R = CH3 for permethyl derivatives
Figure 2.2 (A) Symbol nomenclature as outlined by the Consortium for Functional Glycomics Nomenclature Committee (May 2004) (Varki et al., 2009). Full documentation available from: http://glycomics.scripps.edu/CFGnomenclature.pdf. (B) The mass of a permethylated sugar is calculated by adding the sum of the increment (or residue) masses of the sugars (a) to the sum of the masses of the reducing and nonreducing ends (b).
for example, to the establishment of the propensity for a cell or tissue type to produce antennal LacNAc extensions versus tri- or tetraantennary structures, or fucosylate on the antennae rather than (or as in most cases, as well as) on the N-glycan core. Where such features have been established, they are included in the structural representations. Structural features that remain ambiguous are represented in a manner that conveys this to the reader. Where there are large numbers of antennal fucosylation events, combined with sialic acid capping and multiple LacNAc extensions, it is impossible to give a single definitive glycan structure. Indeed, in our experience such structures inevitably exist in multiple
61
Mass Spectrometric Analysis of Mutant Mice
A
B
C ×2
×19
D
E ×1
×3
F
×2 b4
b4 b4 b2 b2
b4 a3
b4 b6
a6 b4 b4 a6
Figure 2.3 Representation of structural ambiguity: (A) Gives a typical representation of a triantennary structure. For convenience, only a single branching pattern is shown. Also, this composition could correspond to a biantennary structure with an extended antenna. Further experiments would be required to distinguish these structural features. (B) Shows an example of the use of brackets to convey both structural identity and variation. The cartoon indicates the presence of multiple (19) polylactosamine extensions but the exact length of an extended antennae is not indicated, nor on which antenna or antennae they are found. (C) Is an example of a structure with both sialic acid capping and LacNAc extensions. The sialic acids are able to cap unextended antennae, as well as the longer polyLacNAc type so in the absence of more definitive structural evidence these moieties are represented as shown. (D) Displays an example of a structure with both antennal fucosylation and sialylation. It is biosynthetically possible that the fucosylation and sialylation are on the same or different antennae. In the absence of any further structural evidence for a specific sample these residues are represented as shown. (E) Shows an example of a structure with antennal fucosylation. Linkages are not indicated on the cartoons nor should they be directly inferred from them. For example, it is not inferred that the fucosylated antennae is exclusively on the 3-linked or 6-linked mannose of the core. (F) Is an example of the use of the nomenclature system to fully annotate a structure where all of the linkage information is known.
isoforms, which are conveyed by use of brackets within the assignments (see Fig. 2.3 for visual examples) with the intention that the reader can better appreciate the potential for heterogeneity within such peaks.
62
Simon J. North et al.
4. Example Project: Characterization of Pancreatic Tissue from Wild-Type and Mgat4a Knockout Mice The mannosyl (a-1,3-)-glycoprotein b-1,4-N-acetylglucosaminyltransferase, isozyme A (Mgat4a) gene encodes an enzyme—N-acetylglucosaminyltransferase IVa (GlcNAcT-IVa)—that is responsible for the transfer of a GlcNAc residue in a b1-4 linkage onto the 3-arm of the trimannosyl core during N-glycan biosynthesis. In structural terms, knocking out this gene (together with the second isozyme, Mgat4b) diminishes the system’s ability to make tetraantennary N-glycans (Takamatsu et al., 2010). We present this data as a case study for the purpose of illustrating the application of the glycomic analysis methodology described within this chapter. All the samples analyzed were provided by Jamey Marth, Sanford-Burnham Medical Research Institute at UC Santa Barbara, USA (Ohtsubo et al., 2005).
4.1. MALDI-TOF MS mass fingerprinting The MALDI-TOF spectra—or mass fingerprints—of the N-glyan pool derived from wild-type (panel A) and Mgat4a knockout (panel B) mouse pancreatic tissue are shown in Fig. 2.4. In each case, the N-glycans consist of high mannose and bi-, tri- and potentially tetraantennary glycans. The complex glycans predominantly contain fucose on their cores, with antennal fucose being present in significant quantities. The antennae are terminated by both sialic acids (NeuAc/NeuGc) and Gal-a-Gal epitopes, with the latter being much more abundant. The most prevalent complex structure in the spectrum is a core-fucosylated, biantennary glycan bearing two Gal-a-Gal terminal groups (m/z 2651, Fuc1Hex7HexNAc4). Based upon relative intensities, there is a significant reduction in abundance of the higher mass complex glycans (m/z > 3000) in the knockout spectrum. Interestingly, the peak at m/z 2530, corresponding to either a bisected triantennary or a tetraantennary N-glycan, is completely absent in the knockout. The initial MALDI-TOF profiles seem to indicate that a significant perturbation of glycan production has been caused by the ablation of the Mgat4a gene.
4.2. MALDI-TOF/TOF MS sequencing In order to further clarify the structures present in the two samples, glycan sequencing using tandem MS/MS technology is performed using MALDITOF/TOF MS. These experiments are capable of providing insights into branching patterns, terminal epitopes, and can also inform on linkage
63
Mass Spectrometric Analysis of Mutant Mice
A
3071
3101 3142
3246
2040
2418
2448
2478
2489
2693
2897
3026
% Intensity
3306 3348
3551 3433
and/or
3620
2996
3899
and/or
3725
3755
3929
3959
4116
3869
2852 2622
2396
2244
3695
3463
2635
2326
50
3276
2652
100
2081 2966 and/or
2809
4056
2192
4086
4348
4378
4408
2285 2530
0 2000
2500
3000 3500 Mass (m/z)
4000
4500
B 100 2418
2448 2478
2489
2652
2897
3026
3071
3101 3246
3276
3306
% Intensity
2040
2635
50
2693
and/or 2244
2326
3695
2996
2285
3725
3755
3869
3929
2622 2852
3463
and/or 2966 3959 2081
4086
2396 2192 2809 3551
0 2000
2500
3000
3500
4000
4500
Mass (m/z)
Figure 2.4 MALDI-MS spectra of 50% (v:v) aqueous acetonitrile fractions of permethylated N-glycans from wild-type (panel A) and Mgat4a knockout mouse (panel B) pancreas. Structural assignments correspond to tentative structures based on compositions and knowledge of N-glycan biosynthesis.
positions. The spectra in Fig. 2.5 represent the data generated from two such analyses on the ions present at m/z 3755 in wild-type and Mgat4a knockout mouse pancreas. Key fragmentations are shown schematically and the peaks labeled with the corresponding product ions. The composition of this molecular ion (Fuc1Hex10HexNAc6) together with biosynthetic knowledge indicates that it is most likely to correspond
64
Simon J. North et al.
A HO
100
HO
1958
HO
3088 3074
2625 2407 1768
690
474
% Intensity
2231
HO HO
50
3292
2421 HO HO
2421
HO HO HO
HO
472
HO
HO
1958
+
[M+Na] 3755
2639
HO
2231
1768
1110
HO
2625
2407
HO HO
0 400
HO
Minor component Major component
HO
690 474
2435
1820 2530 Mass (m/z)
3240
3950
B 2639 1972
100
HO
3088 2407 1768
690 2188
474 Major component Minor component
HO
% Intensity
HO
3074
HO HO
2421
50
2625 HO HO
0 400
HO
2639
[M+Na]+ 3755
3292
1972
HO HO
HO
1768
690
HO
HO HO
2421 2188
1110
1820
2530
3240
3950
Mass (m/z)
Figure 2.5 MALDI-TOF/TOF spectra of the molecular ion m/z 3755 (Fuc1Hex10HexNAc6) from the 50% (v:v) aqueous of permethylated N-glycans from wild-type (panel A) and Mgat4a knockout mouse (panel B) pancreas. Assignments of the fragment ions generated are indicated, with the bold/red numbering indicating diagnostic fragment ions. Structures in each panel indicate the most abundant structure in the respective N-glycan sample.
with two potential structures, one triantennary and one tetraantennary. In each sample, fragmentation of this molecular ion produces major product ions corresponding to the single b-cleavage of HexHexNAc (m/z 3292)
Mass Spectrometric Analysis of Mutant Mice
65
and Hex2HexNAc (m/z 3088). Lack of fragment ions at m/z 1291 (FucHex3HexNAc2) and m/z 2669 (corresponding to the single b-cleavage of FucHex3HexNAc2), together with small peaks at m/z 474 indicate that the fucose is attached exclusively to the core of the glycan rather than the antennae in this peak. In addition, a low abundance fragment ion at m/z 2639 that contains one free -OH group is also observed. This corresponds to the loss of Hex3HexNAc2 from the molecular ion, thus implying the presence of the triantennary structure in both the wild-type and Mgat4a knockout mouse pancreas. In the wild-type sample, there is also a signal at m/z 1958 representing a triple independent b-cleavage of two Hex2HexNAc moieties and a HexHexNAc. This supports the presence of the tetraantennary isomer, suggesting that a mixture of both the tri- and tetraantennary structures shown in Fig. 2.5 is present in the wild-type mouse pancreas. In order to determine which of the isomers are more abundant, the peak heights of the signals at m/z 3292 (single b-cleavage of HexHexNAc) and m/z 2639 (single b-cleavage of HexHexNAc and Hex2HexNAc) were compared. From the spectrum, it is evident that the signal at m/z 3239 is higher relative to 2639, implying that the tetraantennary N-glycan is likely to be the more abundant structure in the wild-type mouse pancreas. In addition, to the signals observed in the wild type, additional signals are present in the knockout mouse pancreas. These include fragment ions at m/z 1972 and 2188, which are consistent with the double b-cleavage of Hex2HexNAc-HexHexNAc and Hex2HexNAc, and a single b-cleavage of Hex2HexNAc-HexHexNAc. Comparison of peak heights of signals at m/z 3292 and 2639 showed an increase of m/z 2639 relative to 3292 (Fig. 2.5, panel B). Taken together, these data suggest that the more abundant structure in the Mgat4a knockout mouse pancreas is the triantennary structure. Overall the data from these MS/MS analyses indicates that there is a mixture of isomers in both the wild-type and knockout mouse samples, with the tetraantennary structure in the majority in the wild-type pancreas while the triantennary dominates in the case of the Mgat4a knockout.
4.3. Enzymatic digestion—a-galactosidase treatment To clarify the anomeric configurations and the nature of the terminal epitopes, enzymatic digestions were carried out upon the mouse pancreas samples. In this example, an a-galactosidase digest was carried out. This glycosidase acts to cleave all a-linked, nonreducing terminal galactose residues (Kobata, 1979) in the sample. Once the digest was complete, an aliquot of each sample was permethylated and analyzed by MALDI-TOF MS. Figure 2.6 shows the result of the digests, with the wild-type sample in panel A and the Mgat4a knockout in panel B.
66
Simon J. North et al.
A 100
% Intensity
2244
2040 2070
50
2693 and/or and/or
2938
3041
3142
2081 2326
2192
2867 2418 2489 2635
2396
0 2000
2852
2400
3491
3026
3317
2800
3200
3600
4000
3600
4000
Mass (m/z)
B 100
% Intensity
2244
50
2040 2070
2693
and/or
2938
and/or
3142
3317
2081 2326
2418
2867
2489 2192
0 2000
2396
2400
2635
2852
3026 3041
2800
3200 Mass ( m/z)
Figure 2.6 MALDI-TOF profiles of a-galactosidase digestions of the 50% (v:v) aqueous acetonitrile fractions of permethylated N-glycans from wild-type (panel A) and Mgat4a knockout mouse (panel B) pancreas.
Comparison of these spectra with those of the untreated samples (Fig. 2.4) shows that a number of previously abundant signals are now totally absent (e.g., m/z 2448, 2652, 2809, 2987, and 3101). These results confirm the presence of terminal Gal-a-Gal epitopes in both the wild-type and knockout mouse pancreas. The remaining complex-type structures in the spectra were resistant to the digest, while those structures that in the untreated samples displayed Gal-a-Gal terminal structures have been trimmed and mass shifted.
67
Mass Spectrometric Analysis of Mutant Mice
4.4. Linkage analysis by GC–MS PMAA derived from the wild-type and knockout mouse pancreas were subjected to GC–MS linkage analyses. The total ion chromatograms (TIC) are displayed in Fig. 2.7 and key features of the data are tabulated in Table 2.1. The TIC and tabulated key features illustrate that the wild-type and the knockout pancreatic N-glycans contain similar components. It is noticeable from the TIC, however, that there has been a decrease in the abundance of 2,4-linked Man, which is consistent with the genotype of this mouse. In addition, a slight increase in 2-linked Man in the knockout mouse pancreas is observed. This corresponds with MALDI-MS data showing that biantennary structures are relatively more abundant than triand tetraantennary structures. This data continues to support the hypothesis that ablation of the Mgat4a gene has an effect on the branching of N-glycans in the pancreas and is consistent with results from the MALDI-MS and MS/MS experiments.
A t-Man 18.75
% Intensity
100
t-Gal 19.02
50
t-Fuc 17.22
2-Man 19.92 3-Gal 20.22
3,6-Man 21.70 2,6-Man 2,4-Man 21.14 6-Gal 21.53 20.74
4-GlcNAc 23.54 t-GlcNAc 22.64
4,6-GlcNAc 24.86
0
17.00 17.50 18.00 18.50 19.00 19.50 20.00 20.50 21.00 21.50 22.00 22.50 23.00 23.50 24.00 24.50 25.00
Elution time (min)
B
t-Man 18.76
100
% Intensity
2-Man 19.93 t-Gal 19.03 50
t-Fuc 17.24
3-Gal 20.23
3,6-Man 21.71 2,6-Man 2,4-Man 6-Gal 21.17 21.54 20.76
4-GlcNAc 23.54 t-GlcNAc 22.66
4,6-GlcNAc 24.86
0 17.00 17.50 18.00 18.50 19.00 19.50 20.00 20.50 21.00 21.50 22.00 22.50 23.00 23.50 24.00 24.50 25.00
Elution time (min)
Figure 2.7 Total ion chromatogram (TIC) of the partially methylated alditol acetates from the 50% acetonitrile N-glycan fractions of wild-type (panel A) and Mgat4a knockout (panel B) mouse pancreas.
Table 2.1 GC–MS linkage analysis of partially methylated alditol acetates derived from the 50% (v:v) aqueous acetonitrile fractions of the permethylated N-glycans derived from the wild-type and Mgat4a knockout mouse pancreas
Elution time (min) (WT)
Elution time (min) (KO)
Characteristic fragment ions
17.224 18.753 19.024 19.921 20.12 20.222 20.742 21.145 21.526 21.699 22.156 22.643 23.536 24.387 24.857
17.237 18.761 19.032 19.938 20.133 20.23 20.755 21.17 21.538 21.707 22.194 22.656 23.541 24.383 24.84
102, 115, 118, 131, 162, 175 102, 118, 129, 145, 161, 205 102, 118, 129, 145, 161, 205 129, 130, 161, 190, 204, 234 118, 129, 161, 202, 234 118, 129, 161, 203, 234, 277 99, 102, 118, 129, 162, 189, 233 87, 88, 99, 113, 130, 190, 233 87, 88, 129, 130, 189, 190 118, 129, 189, 202, 234 118, 139, 259, 333 117, 129, 145, 205, 247 117, 159, 233 117, 159, 346 117, 159, 261
The relative abundances were set against the most abundant sugar residue.
Assignments
Relative abundance (WT)
Relative abundance (KO)
Terminal fucose Terminal mannose Terminal galactose 2-linked mannose 3-linked mannose 3-linked galactose 6-linked galactose 2,4-linked mannose 2,6-linked mannose 3,6-linked mannose 3,4,6-linked mannose t-GlcNAc 4-linked GlcNAc 3,4-linked GlcNAc 4,6-linked GlcNAc
0.24 1.00 0.40 0.47 0.02 0.33 0.02 0.13 0.06 0.67 0.02 0.06 0.33 Trace 0.04
0.39 1.00 0.43 0.87 0.03 0.41 0.04 0.05 0.08 0.62 0.01 0.04 0.27 Trace 0.03
Mass Spectrometric Analysis of Mutant Mice
69
4.5. Summary This biological example illustrates the power of the MS-based glycomics approach described within this chapter for the analysis of cells and tissues from mutant mice. From a single murine pancreas, N-glycans can be purified, derivatized, and profiled by MALDI-MS to produce mass fingerprints and inform on the monosaccharide constituents of the glycans. These compositions, together with knowledge of the well-defined N-glycan biosynthetic pathways, allow the assignment of tentative N-glycan structures and structural isomers. Evidence from further analytical methods such as enzymatic digests, MS/MS sequencing and GC–MS linkage analysis enables the refinement of these assignments and incrementally increases the level of confidence and information, depending on how many of these methods are applied to the sample. In this case, both the wild-type and Mgat4a knockouts are observed to carry similar components, though in very different relative abundances. The majority of components are core fucosylated, while LacNAc, Lex and Gala1-3Gal are the major nonreducing end structures. Higher molecular weight components carry these terminal structures on tandem repeats of LacNAc. The major difference between the two samples is the significant decrease in abundance of tetraantennary structures in the Mgat4a knockout pancreas. These observations strongly correlate with results from the enzymatic assay studies showing that GlcNAcT-IVa activity is highest in the pancreas of the wild-type mouse and that the activity in the homozygous knockout is significantly reduced (Ohtsubo et al., 2005). These structural analyses imply that in murine pancreas GlcNAcT-IVa is the main enzyme catalyzing the reaction of transferring a GlcNAc residue via a b1-4 linkage onto the 3-arm of the b-linked mannose of the pentasaccharide core of N-glycans. The presence of 2,4-linked Man in the knockout mouse pancreas indicates that the loss of this enzyme only leads to a partial compensation by GlcNAcT-IVb (Takamatsu et al., 2010).
5. Summary of Glycan Structural Observations in Murine Tissues, Cells, and Knockouts There now follows a series of tables (Tables 2.2–2.5), summarizing in a general fashion the structural observations derived from the analysis of murine tissues and cell isolates, from both wild-type C57Bl/6 and glycosylation-related genetic knockout mice. The data corresponding to these observations is available from the glycan profiling data pages of the CFG—http://www.functionalglycomics.org.
Table 2.2 Summary of glycan-related gene knockout mice studied by the CFG and summarized in this chapter (Araki et al., 1999; Ellies et al., 1998; Hashimoto et al., 1983; Homeister et al., 2001; Kurosawa et al., 1996; Maly et al., 1996; Ponder et al., 1985; Priatel et al., 2000) Original publication name
Gene symbol
C2 GlcNAcT
Gcnt 1
FucT-IV FucT-VII FucT-IV and FucT-VII ST3Gal-I
Fut4 Fut7 Fut7
St6galnac-II
St6galnac2
Mgat4a
Mgat4a
St3gal1
Gene name(s)
Reported function
Primary reference
C2 GlcNAcT, b-1,6 N-acetylglucosaminyltransferase, IGnT, 5630400D21Rik a-1,3 fucosyltransferase-IV a-1,3 fucosyltransferase VII a-1,3 fucosyltransferase IV and a-1,3 fusosyltransferase VII Siat4, ST3GalI, CMP-N-acetylneuraminate: b-galactosidase aSiat7, Siat7b, ST6GalNAc II
Synthesis of Core 2 branch on serine- and threoninelinked O-glycans Synthesis of selectin ligands Synthesis of selectin ligands Synthesis of selectin ligands
Ellies et al. (1998)
Core 1 O-glycan sialylation
Priatel et al. (2000)
Synthesis of the Sialyl-Tn antigen Synthesis of the b1-4 branch of N-glycans
Kurosawa et al. (1996)
Mannoside acetylglucosaminyltransferase 4, isoenzyme A, 9530018I07Rik, GnT-IVa
Homeister et al. (2001) Maly et al. (1996) Homeister et al. (2001)
Araki et al. (1999)
71
Mass Spectrometric Analysis of Mutant Mice
Table 2.3 Summary table of N-glycan structures observed in the analysis of tissues and cells from C57Bl/6 wild-type mice
Wehi-3
Neutrophils
Thymus
Testes
Spleen
Small intestine
Pancreas
Ovaries
Lung
Liver
Kidney
Heart
Example of structure
Colon
Structural characteristics
Brain
Observation in C57BI/6 wild-type murine tissues and cell isolates
N-glycosylation (high mannose) a6
High mannose
a6
a3
b4
b4
a3
N-glycosylation (hybrid) a6
Hybrid structures
a6 a3 b2
b4
+/- a6 b4
a3
m m m m m
m m m m m m m m
N-glycosylation (complex)
Heavily truncated structures
a6
b2 b2
b4
b4
b4
+/- a6 b4
b4
+/- a6 b4
a6 b4
+/- a6 b4
m
a3
m
m
m m
m m
b4
Bi-antennary structures Tri-antennary structures
a6
b2 b2
a3
a6
b2 b2
a3
b4
b6
Tetra-antennary structures
b2 b2
a3 b4
Bisecting GlcNAc Sialylation
b4
+/- a6 b4
b2
a3
b2
a6 b4
+/- a6 b4
b2
a3
b2
b4
a6
a6
b2
Gal-a-Gal
b2
a6 b4
b2
a3
Core fucose
b2
a6 b4
b2
a3
Lewis
x/a
(antennal fucose)
Sialyl lewis
x/a
Antennal Fuc (multiple)
b4
a6 b4
b2
a3
b2
a6 b4
b2
a3
b2
a6
m Only
+/- a6 b4
m m m m m m
m m
+/- a6 b4
m
m
a3
b2
b2
m m m
Only
LacNAc extensions
b2
m m m
m
b4 a6
b4
m
a6
m
+/- a6 b4
b4
b4 a6
b4
b4
a3
m
m
b4
Sd
a
b2 b2
a6
a6
m
a3
Structural assignments are based upon MALDI-TOF, MALDI-TOF/TOF, and ESI-MS analyses, with t linkages assigned according to known biosynthetic pathways. ¼ present, x ¼ absent, m ¼ present in minor amounts. The data corresponding to this summary can be found within the CFG databases at http://www.functionalglycomics.org (Babu et al., 2009; Comelli et al., 2006; North et al., 2010a,b).
72
Simon J. North et al.
Table 2.4 Summary table of O-glycan structures observed in the analysis of tissues and cells from C57Bl/6 wild-type mice
WeHi-3
Neutrophils
Thymus
Testes
Spleen
Small intestine
Pancreas
Ovaries
Lung
Liver
Kidney
Heart
Example of structure
Colon
Structural characteristics
Brain
Observation in C57BI/6 wild-type murine tissues and cell isolates
Core-1 O-glycosylation
Core-1
b3
Sialylated core-1
b3
Only
Only
Only
Only
Only
Only
Core-2 O-glycosylation b6
Core-2
b3 b6
Sialylated core-2 x
Lewis (antennal fucose)
b3
b6 b3
Fucosylation and sialylation
b6
m
b3
Sialyl lewis
x
b6 b3
m
b6
LacNAc extensions
Sd
a
b3
b6 b3 b6
Gal-a-Gal
b3
O-mannosyl
O-mannosyl Sialylated O-mannosyl
Structural assignments are based upon MALDI-TOF, MALDI-TOF/TOF, and ESI-MS analyses, with linkages assigned according to known biosynthetic pathways. ✓ ¼ present, x ¼ absent, m ¼ present in minor amounts, ¼ analysis inconclusive due to paucity of data. The data corresponding to this summary can be found within the CFG databases at http://www.functionalglycomics.org (Babu et al., 2009; Comelli et al., 2006; North et al., 2010a,b).
73
Mass Spectrometric Analysis of Mutant Mice
Table 2.5 Summary table of N-glycan and O-glycan structures observed in analysis of tissues of C57Bl/6 in the absence of specified glycan-related genes (see Table 2.2). Mutant mouse tissues-changes relative to wild-type Thymus
Testes
Spleen
Small intestine
Kidney
Colon
Brain
Spleen
Kidney
FucT IV + FucT VII Thymus
FucT VII Thymus
Example of structure
Spleen
Structural characteristics
Kidney
FucT IV
N-glycosylation (high mannose) a6
High mannose
a3
a6 b4
b4
a3
N-glycosylation (hybrid) a6
Hybrid structures
a3 b2
a6 b4
No changes in reltive levels of N- or O-linked glycosylation were observed in any of these mutants
+/- a2 b4
a3
N-glycosylation (complex)
Heavily truncated structures
b2 b2
a6
b4
b4
a3
b4
Mutant mouse tissues-changes relative to wildtype Thymus
Lymph nodes
Kidney
Thymus
Testes
Core 2 GalNAcT Spleen
Small intestine
Kidney
Colon
ST3Gal I Brain
Example of structure
Testes
Structural characteristics
Kidney
St6GalNAc II
Core-1 O-glycosylation
Core-1
b3
Sialylated core-1
b3
Core-2 O-glycosylation b6
Core-2
b3
Structural assignments are based upon MALDI-TOF, MALDI-TOF/TOF, and ESI-MS analyses, with linkages assigned according to known biosynthetic pathways. Upward arrows indicate a relative increase in abundance, downward arrows indicate a relative decrease in abundance, an equals sign indicates no significant change in abundance and structural archetypes not detected are indicated with a cross. The data corresponding to this summary can be found within the CFG databases at http://www.functionalglycomics.org (Babu et al., 2009; Comelli et al., 2006; North et al., 2010a,b).
ACKNOWLEDGMENTS This work was supported by the Analytical Glycotechnology Core (Core C) of the Consortium for Functional Glycomics Grant GM 62116, The Biotechnology and Biological Sciences Research Council Grants BBF0083091 and B19088, and The Wellcome Trust.
74
Simon J. North et al.
REFERENCES Akama, T. O., et al. (2006). Essential and mutually compensatory roles of a-mannosidase II and a-mannosidase IIx in N-glycan processing in vivo in mice. Proc. Natl. Acad. Sci. USA 103, 8983–8988. Albersheim, P., et al. (1967). A method for the analysis of sugars in plant cell-wall polysaccharides by gas–liquid chromatography. Carbohydr. Res. 5, 340–345. Angel, A. S., and Nilsson, B. (1990). Linkage positions in glycoconjugates by periodate oxidation and fast atom bombardment mass spectrometry. Methods Enzymol. 193, 587–607. Aoki-Kinoshita, K. F. (2008). An introduction to bioinformatics for glycomics research. PLoS Comput. Biol. 4, e1000075. Araki, K., et al. (1999). Exchangeable gene trap using the Cre/mutated lox system. Cell. Mol. Biol. (Noisy-le-grand) 45, 737–750. Babu, P., et al. (2009). Structural characterisation of neutrophil glycans by ultra sensitive mass spectrometric glycomics methodology. Glycoconj. J. 26, 975–986. Bax, M., et al. (2007). Dendritic cell maturation results in pronounced changes in glycan expression affecting recognition by siglecs and galectins. J. Immunol. 179, 8216–8224. Bhaumik, M., et al. (1998). Progression of hepatic neoplasms is severely retarded in mice lacking the bisecting N-acetylglucosamine on N-glycans: Evidence for a glycoprotein factor that facilitates hepatic tumor progression. Cancer Res. 58, 2881–2887. Bobbitt, J. M. (1956). Periodate oxidation of carbohydrates. Adv. Carbohydr. Chem. 48, 1–41. Ceroni, A., et al. (2008). GlycoWorkbench: A tool for the computer-assisted annotation of mass spectra of glycans. J. Proteome Res. 7, 1650–1659. Chen, X., and Flynn, G. C. (2007). Analysis of N-glycans from recombinant immunoglobulin G by on-line reversed-phase high-performance liquid chromatography/mass spectrometry. Anal. Biochem. 370, 147–161. Chui, D., et al. (1997). Alpha-mannosidase-II deficiency results in dyserythropoiesis and unveils an alternate pathway in oligosaccharide biosynthesis. Cell 90, 157–167. Comelli, E. M., et al. (2006). A focused microarray approach to functional glycomics: Transcriptional regulation of the glycome. Glycobiology 16, 117–131. Corfield, A. P., et al. (1983). The specificity of viral and bacterial sialidases for alpha(2-3)- and alpha(2-6)-linked sialic acids in glycoproteins. Biochim. Biophys. Acta 744, 121–126. Dell, A. (1987). F.A.B.-mass spectrometry of carbohydrates. Adv. Carbohydr. Chem. Biochem. 45, 19–72. Dell, A. (1990). Preparation and desorption mass spectrometry of permethyl and peracetyl derivatives of oligosaccharides. Methods Enzymol. 193, 647–660. Dell, A., and Ballou, C. E. (1983). Fast-atom-bombardment, negative-ion mass spectrometry of the mycobacterial O-methyl-D-glucose polysaccharide and lipopolysaccharides. Carbohydr. Res. 120, 95–111. Dell, A., et al. (1994). Mass spectrometry of carbohydrate-containing biopolymers. Methods Enzymol. 230, 108–132. Dell, A., et al. (2007). Mass spectrometry of glycoprotein glycans: Glycomics and glycoproteomics. In ‘‘Comprehensive Glycoscience, Vol. 2,’’ ( J. P. Kamerling, ed.), pp. 69–100. Elsevier, UK. Dell, A., et al. (2008). Glycomics and Mass Spectrometry . pp. 2191–2217, Springer-Verlag Berlin Heidelberg New York, Leipzig, Germany. Domon, B., and Costello, C. E. (1988). Structure elucidation of glycosphingolipids and gangliosides using high-performance tandem mass spectrometry. Biochemistry 27, 1534–1543.
Mass Spectrometric Analysis of Mutant Mice
75
Ellies, L. G., et al. (1998). Core 2 oligosaccharide biosynthesis distinguishes between selectin ligands essential for leukocyte homing and inflammation. Immunity 9, 881–890. Fenn, J. B., et al. (1989). Electrospray ionization for mass spectrometry of large biomolecules. Science 246, 64–71. Fukuda, M., et al. (1984a). Structure of branched lactosaminoglycan, the carbohydrate moiety of band 3 isolated from adult human erythrocytes. J. Biol. Chem. 259, 8260–8273. Fukuda, M., et al. (1984b). Structure of sialylated fucosyl lactosaminoglycan isolated from human granulocytes. J. Biol. Chem. 259, 10925–10935. Fukuda, M. N., et al. (1985). Embryonal lactosaminoglycan. The structure of branched lactosaminoglycans with novel disialosyl (sialyl alpha 2–9 sialyl) terminals isolated from PA1 human embryonal carcinoma cells. J. Biol. Chem. 260, 6623–6631. Goldberg, D., et al. (2005). Automatic annotation of matrix-assisted laser desorption/ionization N-glycan spectra. Proteomics 5, 865–875. Goldberg, D., et al. (2009). Glycan family analysis for deducing N-glycan topology from single MS. Bioinformatics 25, 365–371. Harvey, D. J. (1999). Matrix-assisted laser desorption/ionization mass spectrometry of carbohydrates. Mass Spectrom. Rev. 18, 349–450. Hashimoto, Y., et al. (1983). Genetic regulation of GM2 expression in liver of mouse. J. Biochem. 93, 895–901. Haslam, S. M., et al. (1997). Characterisation of the phosphorylcholine-containing N-linked oligosaccharides in the excretory-secretory 62 kDa glycoprotein of Acanthocheilonema viteae. Mol. Biochem. Parasitol. 85, 53–66. Homeister, J. W., et al. (2001). The alpha(1, 3)fucosyltransferases FucT-IV and FucT-VII exert collaborative control over selectin-dependent leukocyte recruitment and lymphocyte homing. Immunity 15, 115–126. Ioffe, E., and Stanley, P. (1994). Mice lacking N-acetylglucosaminyltransferase I activity die at mid-gestation, revealing an essential role for complex or hybrid N-linked carbohydrates. Proc. Natl. Acad. Sci. USA 91, 728–732. Jang-Lee, J., et al. (2006). Glycomic profiling of cells and tissues by mass spectrometry: Fingerprinting and sequencing methodologies. Methods Enzymol. 415, 59–86. Kobata, A. (1979). Use of endo- and exoglycosidases for structural studies of glycoconjugates. Anal. Biochem. 100, 1–14. Kui Wong, N., et al. (2003). Characterization of the oligosaccharides associated with the human ovarian tumor marker CA125. J. Biol. Chem. 278, 28619–28634. Kuraya, N., and Hase, S. (1996). Analysis of pyridylaminated O-linked sugar chains by twodimensional sugar mapping. Anal. Biochem. 233, 205–211. Kurosawa, N., et al. (1996). Molecular cloning and genomic analysis of mouse Galbeta1, 3GalNAc-specific GalNAc alpha2, 6-sialyltransferase. J. Biol. Chem. 271, 15109–15116. Lundblad, A., et al. (1976). Mannosidosis. Storage material, alpha-mannosidase specificity and diagnostic methods. Adv. Exp. Med. Biol. 68, 301–311. Maly, P., et al. (1996). The alpha(1, 3)fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell 86, 643–653. Mason, K. E., et al. (2006). Characterization of sulfated oligosaccharides in mucopolysaccharidosis type IIIA by electrospray ionization mass spectrometry. Anal. Chem. 78, 4534–4542. Mechref, Y., and Novotny, M. V. (2002). Structural investigations of glycoconjugates at high sensitivity. Chem. Rev. 102, 321–369. Metzler, M., et al. (1994). Complex asparagine-linked oligosaccharides are required for morphogenic events during post-implantation development. EMBO J. 13, 2056–2065. Miyatake, T., and Suzuki, K. (1975). Partial purification and characterization of betagalactosidase from rat brain hydrolyzing glycosphingolipids. J. Biol. Chem. 250, 585–592.
76
Simon J. North et al.
Montpetit, M. L., et al. (2009). Regulated and aberrant glycosylation modulate cardiac electrical signaling. Proc. Natl. Acad. Sci. USA 106, 16517–16522. Moody, A. M., et al. (2001). Developmentally regulated glycosylation of the CD8alphabeta coreceptor stalk modulates ligand binding. Cell 107, 501–512. Moody, A. M., et al. (2003). Sialic acid capping of CD8beta core 1-O-glycans controls thymocyte-major histocompatibility complex class I interaction. J. Biol. Chem. 278, 7240–7246. Morris, H. R., et al. (1996). High sensitivity collisionally-activated decomposition tandem mass spectrometry on a novel quadrupole/orthogonal-acceleration time-of-flight mass spectrometer. Rapid Commun. Mass Spectrom. 10, 889–896. North, S. J., et al. (2006). Glycomic studies of Drosophila melanogaster embryos. Glycoconj. J. 23, 345–354. North, S. J., et al. (2009). Mass spectrometry in the analysis of N-linked and O-linked glycans. Curr. Opin. Struct. Biol. 19, 498–506. North, S. J., et al. (2010a). Mouse and human glycomes. In ‘‘Handbook of Glycomics,’’ (D. C. Richard and J. M. Pierce, eds.), pp. 263–327. Academic Press, San Diego. North, S. J., et al. (2010b). Glycomics profiling of Chinese hamster ovary cell glycosylation mutants reveals N-glycans of a novel size and complexity. J. Biol. Chem. 285, 5759–5775. Ohtsubo, K., et al. (2005). Dietary and genetic control of glucose transporter 2 glycosylation promotes insulin secretion in suppressing diabetes. Cell 123, 1307–1321. Pang, P. C., et al. (2009). Analysis of the human seminal plasma glycome reveals the presence of immunomodulatory carbohydrate functional groups. J. Proteome Res. 8, 4906–4915. Parry, S., et al. (2006). Glycomics investigation into insulin action. Biochim. Biophys. Acta 1760, 652–668. Parry, S., et al. (2007). Integrated mass spectrometric strategy for characterizing the glycans from glycosphingolipids and glycoproteins: Direct identification of sialyl Le(x) in mice. Glycobiology 17, 646–654. Perdivara, I., et al. (2009). Elucidation of O-glycosylation structures of the beta-amyloid precursor protein by liquid chromatography-mass spectrometry using electron transfer dissociation and collision induced dissociation. J. Proteome Res. 8, 631–642. Ponder, B. A., et al. (1985). An allelic difference determines reciprocal patterns of expression of binding sites for Dolichos biflorus lectin in inbred strains of mice. J. Embryol. Exp. Morphol. 87, 229–239. Priatel, J. J., et al. (2000). The ST3Gal-I sialyltransferase controls CD8þ T lymphocyte homeostasis by modulating O-glycan biosynthesis. Immunity 12, 273–283. Schneider, P., and Ferguson, M. A. (1995). Microscale analysis of glycosylphosphatidylinositol structures. Methods Enzymol. 250, 614–630. Scudder, P., et al. (1983). Isolation and characterization of an endo-beta-galactosidase from Bacteroides fragilis. Biochem. J. 213, 485–494. Sihlbom, C., et al. (2009). Localization of O-glycans in MUC1 glycoproteins using electroncapture dissociation fragmentation mass spectrometry. Glycobiology 19, 375–381. Stoll, M. S., et al. (1990). Microscale sequencing of O-linked oligosaccharides using mild periodate oxidation of alditols, coupling to phospholipid and TLC-MS analysis of the resulting neoglycolipids. Eur. J. Biochem. 189, 499–507. Stone, E. L., et al. (2009). Glycosyltransferase function in core 2-type protein O glycosylation. Mol. Cell. Biol. 29, 3770–3782. Sutton-Smith, M., et al. (2000). A rapid mass spectrometric strategy suitable for the investigation of glycan alterations in knockout mice. Tetrahedron Asymmetry 11, 363–369. Sutton-Smith, M., et al. (2002). MS screening strategies: investigating the glycomes of knockout and myodystrophic mice and leukodystrophic human brains. Portland Press, University of York, Biochemical Society Symposium 69, pp. 105–115.
Mass Spectrometric Analysis of Mutant Mice
77
Takamatsu, S., et al. (2010). Physiological and glycomic characterization of N-acetylglucosaminyltransferase-IVa and -IVb double deficient mice. Glycobiology 20, 485–497. Tarentino, A. L., and Plummer, T. H., Jr. (1994). Enzymatic deglycosylation of asparaginelinked glycans: Purification, properties, and specificity of oligosaccharide-cleaving enzymes from Flavobacterium meningosepticum. Methods Enzymol. 230, 44–57. Tarentino, A. L., et al. (1985). Deglycosylation of asparagine-linked glycans by peptide: N-glycosidase F. Biochemistry 24, 4665–4671. Tretter, V., et al. (1991). Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase F cannot release glycans with fucose attached alpha 1–3 to the asparagine-linked N-acetylglucosamine residue. Eur. J. Biochem. 199, 647–652. Uchida, Y., et al. (1977). Distribution of neuraminidase in Arthrobacter and its purification by affinity chromatography. J. Biochem. 82, 1425–1433. Varki, A., et al. (2009). Symbol nomenclature for glycan representation. Proteomics 9, 5398–5399. Vestal, M. L., and Campbell, J. M. (2005). Tandem time-of-flight mass spectrometry. Methods Enzymol. 402, 79–108. von der Lieth, C. W., et al. (2006). The role of informatics in glycobiology research with special emphasis on automatic interpretation of MS spectra. Biochim. Biophys. Acta 1760, 568–577. Wada, Y., et al. (2007). Comparison of the methods for profiling glycoprotein glycans–HUPO Human Disease Glycomics/Proteome Initiative multi-institutional study. Glycobiology 17, 411–422. Wada, Y., et al. (2010). Comparison of methods for profiling O-glycosylation: HUPO human disease glycomics/proteome initiative multi-institutional study of IgA1. Mol. Cell. Proteomics 4, 719–727. Wang, Y., et al. (2006). Approaches to the study of N-linked glycoproteins in human plasma using lectin affinity chromatography and nano-HPLC coupled to electrospray linear ion trap–Fourier transform mass spectrometry. Glycobiology 16, 514–523. York, W. S., et al. (2010). Integration of glycomics knowledge and data. In ‘‘Handbook of Glycomics,’’ (D. C. Richard and J. M. Pierce, eds.), pp. 177–195. Academic Press, San Diego. Yost, R. A., and Enke, C. G. (1978). Selected ion fragmentation with a tandem quadrupole mass-spectrometer. J. Am. Chem. Soc. 100, 2274–2275. Yu, S. Y., et al. (2006). Distinctive characteristics of MALDI-Q/TOF and TOF/TOF tandem mass spectrometry for sequencing of permethylated complex type N-glycans. Glycoconj. J. 23, 355–369. Zaia, J. (2008). Mass spectrometry and the emerging field of glycomics. Chem. Biol. 15, 881–892.
C H A P T E R
T H R E E
Glycosaminoglycan Characterization by Electrospray Ionization Mass Spectrometry Including Fourier Transform Mass Spectrometry Tatiana N. Laremore,* Franklin E. Leach III,† Kemal Solakyildirim,* I. Jonathan Amster,† and Robert J. Linhardt*,‡ Contents 1. Overview 2. Preparation of Crude PG/GAG 3. Disaccharide Profiling Using Ion-Pairing Reverse-Phase (IP RP) HPLC with MS Detection 4. CS/DS Disaccharide Preparation 4.1. Materials and solutions for CS/DS disaccharide preparation 4.2. Method for CS/DS disaccharide preparation 5. ESI IP RP LC MS Analysis of CS/DS Disaccharides 5.1. Materials for CS/DS disaccharide analysis 5.2. Solutions for CS/DS disaccharide analysis 5.3. Method for CS/DS disaccharide analysis 6. HS Disaccharide Preparation 6.1. Materials and solutions for HS disaccharide preparation 6.2. Method for HS disaccharide preparation 7. ESI IP RP LC MS Analysis of HS Disaccharides 7.1. Materials for HS disaccharide analysis 7.2. Solutions for HS disaccharide analysis 7.3. Method for HS disaccharide analysis 8. Direct Infusion ESI FTMS Analysis of Oligosaccharides and Polysaccharides Separated by Preparative Continuous-Elution PAGE 9. Preparation of Bikunin GAG
81 83 84 84 84 85 85 85 86 87 88 88 89 90 90 91 91
92 93
* Department of Chemistry and Chemical Biology, Rensselaer Polytechnic Institute, Troy, New York, USA Department of Chemistry, University of Georgia, Athens, Georgia Departments of Chemical and Biological Engineering and Biology, Center for Biotechnology and Interdisciplinary Studies, Rensselaer Polytechnic Institute, Troy, New York, USA
{ {
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78003-4
#
2010 Elsevier Inc. All rights reserved.
79
80
Tatiana N. Laremore et al.
9.1. Materials and solutions for GAG release by b-elimination under reducing conditions 9.2. Method for GAG release by b-elimination under reducing conditions 9.3. Materials and solutions for preparative CE PAGE separation of the bikunin GAG chains 9.4. Method for preparative CE PAGE separation of the bikunin GAG chains 9.5. Materials and solutions for purification of gel-eluted GAG fractions for FTMS analysis 9.6. Method for purification of gel-eluted GAG fractions for FTMS analysis 9.7. ESI FTMS analysis of bikunin GAG chains separated by preparative PAGE 9.8. Materials and solutions for the ESI FTMS analysis of gel-eluted bikunin GAG fractions 9.9. Method for the ESI FTMS analysis of gel-eluted bikunin GAG fractions 10. An Approach to FTMS Data Interpretation 11. Direct Infusion ESI FT-ICR MS Analysis of Bikunin GAG Mixture 11.1. Method for the ESI FT-ICR MS analysis of bikunin GAG mixture 12. Structural Characterization of GAG Oligosaccharides by Tandem Mass Spectrometry 12.1. Method for structural characterization of GAG oligosaccharides by tandem MS 13. Summary Acknowledgments References
93 94 95 96 97 97 99 99 99 100 101 101 102 103 105 106 106
Abstract Electrospray ionization mass spectrometry (ESI MS) is a versatile analytical technique in glycomics of glycosaminoglycans (GAGs). Combined with enzymology, ESI MS is used for assessing changes in disaccharide composition of GAGs biosynthesized under different environmental or physiological conditions. ESI coupled with high-resolution mass analyzers such as a Fourier transform mass spectrometer (FTMS) permits accurate mass measurement of large oligosaccharides and intact GAGs as well as structural characterization of GAG oligosaccharides using information-rich fragmentation methods such as electron detachment dissociation. The first part of this chapter describes methods for disaccharide compositional profiling using ESI MS and the second part is dedicated to FTMS and tandem MS methods of GAG compositional and structural analysis.
ESI MS and FTMS of GAGs
81
1. Overview Electrospray ionization (ESI) is a soft ionization method and is most suitable for mass spectrometric (MS) analysis of glycosaminoglycans (GAGs) (Bielik and Zaia, 2010; Zaia, 2005, 2008, 2009). The spray conditions can be modified to suppress the loss of sulfo groups and enhance the abundance of a certain types of ions, such as, for example, sodium cationized or protonated species and ions with specific charge states (Zaia, 2005). Compatibility of ESI with liquid chromatographic (LC) separation is another advantage of this ionization method for GAG analysis. There are 17 different structures of GAG-derived 4,5-unsaturated disaccharides but only 8 unique masses; therefore, an LC separation step is required to distinguish the isomers. The sensitivity of ESI MS applications in glycomics of GAGs is superior to other methods of ionization and is continuously improving (Flangea et al., 2009; Staples et al., 2009, 2010; Zamfir et al., 2004, 2009). Modern ESI sources with spray emitter diameters on the order of mm support nL/min flow rates (nano-ESI), resulting in very fine sprays and softer, more efficient desolvation conditions, which in turn leads to an order of magnitude enhancement in the analytical sensitivity (Zaia, 2008, 2009). Due to their acidity, GAG oligosaccharides are usually analyzed by ESI MS in the negative ionization mode. However, under certain experimental conditions, GAG oligosaccharides can be detected as positive ions with comparable or even greater sensitivity (Gunay et al., 2003). ESI MS in GAG analysis can be divided into two broad categories: the disaccharide composition analysis and the larger oligosaccharide and polysaccharide analysis. The two categories provide complementary information and aid in elucidation of structure–function relationship of GAGs. This chapter describes the ESI MS methods for chondroitin sulfate/dermatan sulfate (CS/DS) and heparan sulfate (HS) disaccharide composition analysis using ion-pairing reverse-phase (IP RP) LC as the separation method. In our laboratory, the methods here described of disaccharide composition profiling are routinely used in determining the effects of different stimuli on GAG expression in various cells, tissues, and small organisms (Nairn et al., 2007; Sinnis et al., 2007; Warda et al., 2006; Zhang et al., 2009a,b). While the disaccharide compositional profiling is robust and wellestablished approach to GAG analysis, ESI MS analysis of intact GAGs and large oligosaccharides requires high resolving power of the Fourier transform mass spectrometry (FTMS). The challenges in the MS analysis of intact GAGs arise from physicochemical properties of these biopolymers. GAG component of a single PG is a polydisperse, structurally heterogeneous mixture of chains having different sulfation patterns and associated with innumerable combinations of cations through electrostatic interactions in a physiological solution. Thus, the success of an ESI FTMS analysis of intact GAGs depends on the spray solution conditions (pH and ion composition) and on purity of
82
Tatiana N. Laremore et al.
the GAG sample. This chapter describes two methods for analyzing intact GAG component of a PG bikunin over a narrow molecular weight (MW) range. First method uses continuous-elution polyacrylamide gel electrophoresis (CE PAGE) for separation of bikunin GAG prior to the ESI FTMS analysis. In the second method, the GAGs are ionized as a mixture, and a quadrupole mass filter is used in a manner of sliding window to allow a narrow m/z ‘‘band’’ of ions reach the Fourier Transform Ion Cyclotron Resonance (FT-ICR) mass analyzer (Chi et al., 2008). The advantages of the latter method are its speed and the low analyte requirement: the MW and composition of the bikunin GAG was determined in a matter of hours using less than 10 mg of the GAG mixture. However, only five chain lengths with two different sulfation states were identified, representing a small fraction of the bikunin GAG ensemble. The former method requires a significant amount of the analyte (300 mg) and is time-consuming, but it permits the MW and composition analysis over entire MW distribution of bikunin GAG. In addition, the isolated GAG fractions are amenable for further characterization, for example, disaccharide or oligosaccharide compositional and structural analysis. A single-stage high-resolution MS analysis provides information about the oligosaccharide composition, whereas a tandem MS analysis allows for the determination of the type and position of each structural element in the oligosaccharide (Saad and Leary, 2005; Tissot et al., 2008; Wolff et al., 2008a; Zamfir et al., 2002, 2003, 2004, 2009). During a tandem MS experiment, a selected ion, that is, precursor ion is activated to induce its fragmentation. The resulting fragment ions provide information about the number and positions of O-sulfo, N-sulfo, and N-acetyl groups and in some cases help to distinguish the C-5 epimers of uronic acid (Wolff et al., 2007b). The convention for the oligosaccharide fragment ion assignment follows the Domon and Costello nomenclature (Fig. 3.1). For tandem mass analysis, precursor ion activation can be categorized as a threshold or electron-based method. The threshold activation methods, including collision-induced dissociation (CID) and infrared multiphoton dissociation (IRMPD) (Zimmerman et al., 1991), typically cleave the most labile bond in sulfated GAGs, the sulfate half-ester (Zaia, 2005). Selection of a precursor ion in which sulfo groups are ionized or paired with a metal cation minimizes the loss of SO3 (Wolff et al., 2008b; Zaia and Costello, 2003). Recently, electron detachment dissociation (EDD) (Budnik et al., 2001) has been applied in the structural characterization of sulfated GAGs. Compared to the threshold activation methods, EDD results in more abundant cross-ring fragmentation (Wolff et al., 2007a). During this ion activation method, a multiply charged anion is irradiated with electrons of moderate kinetic energy (19 eV) resulting in the formation of an excited state intermediate. The intermediate then undergoes fragmentation due to electron detachment or electronic excitation (i.e., electron-induced dissociation, EID) (Fig. 3.2).
83
ESI MS and FTMS of GAGs
Y3 n,m
1,5
Z3
X3
HOH2C
HOOC O
5
4
OH HO
2
OH
1
A1
O OH
O
OH
O OH
NH2
B1 n,m
X0
HOH2C O
0 OH
3
n,m
Z1
HOOC O
OH
O
Y1
X1
0,2
C1
A3
NH2 B3 C3
n,m
A4
Figure 3.1 The Domon-Costello nomenclature for naming hexose fragments. Glycosidic cleavages are denoted with B or C if they contain the nonreducing end (NRE), and Y or Z if they contain the reducing end (RE). Cross-ring cleavages are denoted by A or X with A containing the NRE and X containing the RE. Cross-ring superscripts indicate the cleaved bonds and subscripts indicated the position along the oligosaccharide. Complementary cleavage subscripts add up to the length of the oligosaccharide, for example, B3 þ Y1 indicate a tetrasaccharide.
EID e– n– Pn– 19eV (P )* n≥2 –e– P(n–1)•
EDD
An–, B(n–1)
Even electron C(n–1)•, D(n–1) Odd and even electron
Figure 3.2 A scheme of electron-based activation of multiply charged anions during the EDD experiment.
The experimental conditions for high-resolution tandem MS characterization of GAG oligosaccharides are described later in this chapter.
2. Preparation of Crude PG/GAG Procedures for extraction of proteoglycans (PGs) and GAGs from tissues, cells, or whole organisms vary depending on a type of biological sample and are described in great detail in recent literature (Guimond et al., 2009; Iozzo, 2001). A workflow for preparation of crude PG/GAG sample includes (1) tissue or cell homogenization or disruption in a small volume of a neutral pH buffer; (2) PG extraction in a buffered 4 M guanidinium chloride solution containing 0.5–2% CHAPS; (3) buffer exchange to 8 M urea containing 0.5–2% CHAPS; and (4) anion exchange chromatographic enrichment
84
Tatiana N. Laremore et al.
of PGs. If the protein component, including PG core protein, of the tissue or cell sample has to be identified by proteomics methods, protease inhibitors are added to the homogenization and extraction buffers to prevent nonspecific proteolysis. The 4 M guanidinium chloride buffer must be exchanged to a 6– 8 M urea buffer containing 0.5–2% CHAPS because guanidinium chloride is incompatible with the ion exchange separation. PGs bound to the anionexchange medium are washed with the urea/CHAPS buffer, followed by a low-salt buffer, such as 0.15 M sodium chloride to remove contaminants associated with PGs through electrostatic interactions. The PGs are released from the anion-exchange medium with an increasing salt gradient or with a high-salt buffer, and the resulting crude PG fraction is desalted for subsequent enzymatic treatment and analysis. To further enrich and purify the GAG, peptidoglycans (pGs) are obtained from the crude PG fraction by the digestion with DNAse followed by a nonspecific proteolysis and the pGs are purified from the mixture in the second anion-exchange step. The desalted pG fraction is subjected to further treatment with specific GAG lyases to identify the GAGs in the sample and determine their disaccharide composition. Alternatively, GAGs are released from the protein/peptide core of PGs/pGs by b-elimination under reducing conditions prior to the lyase treatment.
3. Disaccharide Profiling Using Ion-Pairing Reverse-Phase (IP RP) HPLC with MS Detection Disaccharide compositional analysis affords information about the types of disaccharides present in each sample and their relative or absolute amounts and relies on the well-characterized disaccharide standards. It is worth noting that the ion pairing alkyl amines persist in the LC–MS system and their use is best confined to a dedicated instrument.
4. CS/DS Disaccharide Preparation 4.1. Materials and solutions for CS/DS disaccharide preparation 1. Chondroitin ABC lyase (EC 4.2.2.4) from Proteus vulgaris (Seikagaku, Japan; or Associates of Cape Cod, East Falmouth, MA); 10 mU/ 1 mg of CS (Linhardt, 2001). 2. A controlled temperature bath or dry block. 3. Centrifuge capable of achieving 13,000 g. 4. Digestion buffer (optional): 5 mM Tris, 6 mM sodium acetate buffer, pH 8 (adjusted with HCl). Distilled water can be used instead of the
ESI MS and FTMS of GAGs
85
buffer for the digestion, especially for low amounts of CS, to avoid buffer salt interference during the LC separation. 5. Centrifugal filter with a 30,000 MWCO membrane (e.g., Millipore Ultracel YM-30, cat. # 42410).
4.2. Method for CS/DS disaccharide preparation 1. Purified, desalted PG or pG sample is reconstituted in distilled water or in the digestion buffer; and an aliquot of solution containing an appropriate amount of the chondroitin ABC lyase (approximately 10 mU/mg substrate) is added to the sample. 2. The digestion is allowed to proceed overnight at 37 C, after which the lyase is inactivated by heating the digestion for 5 min in a boiling water bath. 3. The disaccharides are separated from the enzyme and the non-CS polysaccharides using a centrifugal filter with 30K MWCO membrane. 4. The centrifugal filter flow-through containing the CS disaccharides is directly amenable for LC–MS analysis. However, if the sample volume is significantly greater than the volume necessary for the LC–MS analysis (>20 mL), the volume can be reduced by lyophilizing.
5. ESI IP RP LC MS Analysis of CS/DS Disaccharides 5.1. Materials for CS/DS disaccharide analysis 1. CS/DS 4,5-unsaturated disaccharide standards (Fig. 3.3) are available from Seikagaku (Associates of Cape Cod, East Falmouth, MA) and from Iduron, Manchester, UK. a. DUA-GalNAc b. DUA-GalNAc4S c. DUA-GalNAc6S d. DUA2S-GalNAc e. DUA2S-GalNAc4S f. DUA2S-GalNAc6S g. DUA-GalNAc4S6S h. DUA2S-GalNAc4S6S 2. Ion-pairing reagent, n-hexylamine (HXA, Sigma, St. Louis, MO). 3. Organic modifier, 1,1,1,3,3,3-hexafluoroisopropanol (HFIP, Sigma, St. Louis, MO). 4. Acquity UPLC bridged ethyl hybrid (BEH) C18 column, 2.1 150 mm, 1.7 mm and Acquity BEH C18 VanGuard pre-column, 2.1 5 mm, 1.7 mm (Waters). The use of silica-supported C18 column packing is not
86
Tatiana N. Laremore et al.
OY
OX HO
O
O
O
OZ
OH NHAc
HO2C Shorthand notation
X
Y
Z
0S
H
H
H
379.1
481.2
[M+HXA+H]
2
ΔUA-GalNAc ΔUA2S-GalNAc
2S
SO3H
H
H
459.1
662.2
[M+2HXA+H]+
3
ΔUA-GalNAc6S
6S
H
H
SO3H
459.1
662.2
[M+2HXA+H]
4
ΔUA-GalNAc4S
4S
H
SO3H
H
459.1
662.2
[M+2HXA+H]+
5
ΔUA2S-GalNAc6S
2S6S
SO3H
H
SO3H
539.0
843.3
[M+3HXA+H]+
6
ΔUA2S-GalNAc4S
2S4S
SO3H SO3H
H
539.0
843.3
[M+3HXA+H]+
7
ΔUA-GalNAc4S6S
4S6S
SO3H
SO3H
539.0
843.3
[M+3HXA+H]+
8
ΔUA2S-GalNAc4S6S
2S4S6S
SO3H
619.0
1024.4
[M+4HXA+H]+
CS disaccharides in order of elution 1
a
H SO3H SO3H
Mmono Observed m/z
Major ion +
+
a
Hyaluronan is completely comprised of an isobaric disaccharide ΔUA-GlcNAc having the same 1→3 linkage.
Figure 3.3 Structures, monoisotopic masses, and observed m/z of eight CS/DS disaccharide standards.
recommended for this method because of a limited compatibility of the silica packing with basic mobile phases (pH > 8) at elevated temperatures. 5. 0.2 mm membrane filters for mobile phase filtration (Millipore prod. # JGWP04700 or similar). 6. Glass vials, small volume inserts, and screw caps with silicone/PTFE septa for Agilent 1200 autosampler (MicroSolv, Eatontown, NJ; cat. # 9502S-0CV, 95001-04N, and 9502S-10C-B). 7. Access to an LC–MS instrument equipped with a UV detector and column heater and capable of supporting 100 mL/min flow rate (Agilent 1100 LC–MSD with ion trap mass analyzer and diode array UV detector is used in our laboratory).
5.2. Solutions for CS/DS disaccharide analysis 1. Mobile phase A: 15 mM HXA, 100 mM HFIP in HPLC-grade water. 2. Mobile phase B: 15 mM HXA, 100 mM HFIP, 75% acetonitrile in HPLC-grade water. 3. CS/DS disaccharide standard mixture in HPLC-grade water, 2 mL per injection, containing 10 ng of each disaccharide standard (40 ng/mL total disaccharide concentration). 4. CS/DS digest: >20 ng disaccharides in >5 mL of digestion buffer or HPLC-grade water. Injection volume of 5 mL requires a >5 mL sample volume to avoid introducing air into the column. The requirement for the additional sample volume depends on the autosampler needle off-set and the shape of the vial insert.
ESI MS and FTMS of GAGs
87
5.3. Method for CS/DS disaccharide analysis 1. Mobile phase solutions are filtered through 0.2 mm filters. Due to their small particle size, UPLC columns are easily blocked by particulates in the mobile phase. 2. The column temperature is set to 45 C, and the column is allowed to equilibrate with 100% A at 100 mL/min. 3. The UV detector is set to record absorbance at 232 nm. 4. An LC method consisting of a 10-min isocratic segment of 0% B, and a linear gradient segment of 0–50% B over 10–40 min is created. 5. The sample injection volume is set at 5 mL (2 mL for the standards mixture). If a series of disaccharide samples are introduced through an autosampler, an appropriate injection sequence is created including 1 injection of the standards for every 8–10 sample injections to monitor the MS detection sensitivity. 6. MS parameters are set as follows: positive ionization mode, skimmer 40 V, capillary exit 40 V, source temperature 350 C, drying gas (N2) 8 L/min, nebulizing gas (N2) 40 psi. An example of a data set obtained during CS/DS disaccharide analysis is shown in Figs. 3.4 and 3.5. Under the experimental conditions described here, the disaccharides elute in order of increasing number of sulfo groups (Fig. 3.3). The total ion chromatogram (TIC) is a plot of total ion signal as a function of time (Fig. 3.4A). The extracted ion chromatogram (EIC) is a plot of selected ion’s signal as a function of time, and in Fig. 3.4B, the ion signals at m/z 481, 662, 843, and 1024 are extracted from the TIC. The TIC, the EIC, or the UV absorbance chromatogram can be used for constructing the disaccharide compositional profile of a sample in which peak area of an individual disaccharide is a percentage of the sum of peak areas for all detected disaccharides (S/N > 3). In the positive-ion mass spectra, major peaks are singly charged and correspond to the HXA adducts of disaccharides with one HXA per acidic site in the disaccharide (Fig. 3.5). Minor peaks represent various Na/H/ HXA exchange products. Saccharide mass spectra acquired under the described experimental conditions exhibit a characteristic pattern of peaks separated by 79 mass units which can be attributed to the HXA/Na exchange. The pattern can be used as an aid in assigning unusual saccharide peaks, for example, trisaccharides. Absolute quantification is best achieved by constructing a standard curve based on several dilutions of the disaccharide standards and using the resulting linear relationship for calculating the amounts of disaccharides in the sample. Our instrument affords good linearity in both UV absorbance and MS signal intensity (R2 0.97) with standard mixtures containing 20–100 mg/mL total CS/DS disaccharides.
88
Tatiana N. Laremore et al.
Relative intensity %
A
1
5 67
3 2 4
8
0 3
100 EIC
Relative intensity %
B
100 TIC
5
2 4
6 7 8
1
0 50 UV
Abs 232 nm (mAU)
C
8 1 5 6
7
23 4
0 0
10
30
40
Retention time (min)
Figure 3.4 Elution profiles of CS/DS disaccharides separated by IP RP HPLC: (A) total ion chromatogram, (B) extracted ion chromatogram for m/z 481, 662, 843, and 1024, and (C) absorbance trace at 232 nm.
6. HS Disaccharide Preparation 6.1. Materials and solutions for HS disaccharide preparation 1. Heparin lyase I (EC 4.2.2.7) from Flavobacterium heparinum, heparin lyase II (no EC number) from F. heparinum, and heparin lyase III (EC 4.2.2.8) from F. heparinum can be obtained from Seikagaku, Japan (Associates of Cape Cod, East Falmouth, MA). A 4-mU amount of each heparin lyase (12 mU total) is sufficient to depolymerize 1 mg of HS (Linhardt, 2001). 2. A controlled temperature bath or dry block.
89
ESI MS and FTMS of GAGs
700
662.3 685.1
803.0 825.0
800
764.2
Δ79
700
800
500
D
[M+4HXA+H]+
600
700
800
700
Δ79
866.1
787.0
707.8 729.9
641.1
945.3
Δ79
561.2
520.4
464.3 481.3
583.2
[M+2HXA+H]+
1000
900 m/z
662.2
m/z
B
[M+3HXA+H]+
800
m/z
1024.4
600
781.1
601.9
500
710.1
Δ79 534.4
492.3
436.2
464.3
513.3
843.3
C
[M+HXA+H]+
725.9 742.2
481.2
A
Δ79
Δ79
900
1000
m/z
Figure 3.5 Positive-ion ESI mass spectra of CS/DS disaccharides: (A) unsulfated disaccharide, (B) monosulfated disaccharide, (C) disulfated disaccharide, and (D) trisulfated disaccharide. Characteristic loss of 79 mass units can be attributed to HXA/Na exchange, ( 101 þ 22).
3. Centrifuge capable of achieving 13,000 g. 4. Digestion buffer (optional): 10 mM sodium phosphate buffer, pH 7.4 (adjusted with phosphoric acid). Distilled water can be used instead of the buffer for the digestion, especially for low amounts of HS, to avoid buffer salt interference during the LC separation. 5. Centrifugal filter with a 30,000 MWCO membrane (e.g., Millipore Ultracel YM-30, cat. # 42410).
6.2. Method for HS disaccharide preparation 1. Purified, desalted PG or pG sample is reconstituted in distilled water or the digestion buffer; and an aliquot of solution containing an appropriate amount of the heparin lyases I, II, and III (approximately 12 mU/mg substrate) is added to the sample. 2. The digestion is allowed to proceed overnight at 35 C, after which the lyases are inactivated by heating the digestion for 5 min in a boiling water bath.
90
Tatiana N. Laremore et al.
3. The disaccharides are separated from the enzymes and the non-HS polysaccharides using a centrifugal filter with 30,000 MWCO membrane. 4. The centrifugal filter flow-through containing the HS disaccharides is directly amenable for LC–MS analysis. However, if the sample volume is significantly greater than the volume necessary for the LC–MS analysis (>8 mL), the volume can be reduced by lyophilizing.
7. ESI IP RP LC MS Analysis of HS Disaccharides 7.1. Materials for HS disaccharide analysis 1. HS 4,5-unsaturated disaccharide standards (Fig. 3.6) are available from Seikagaku, Japan (Associates of Cape Cod, East Falmouth, MA) and from Iduron, Manchester, UK. a. DUA-GlcNAc b. DUA-GlcNS c. DUA-GlcNAc6S d. DUA2S-GlcNAc e. DUA2S-GlcNS f. DUA-GlcNS6S g. DUA2S-GlcNAc6S h. DUA2S-GlcNS6S 2. Ion-pairing reagent, tributylamine (TrBA). 3. Ammonium acetate(NH4OAc). 4. Acetic acid for adjusting pH. 5. Zorbax SB-C18 column (Agilent Technologies), 0.5 250 mm, 5 mm. The recommended pH range for this column is 1–8. 6. A syringe pump, such as Harvard Apparatus Pump 11 Pico Plus or similar, and a 1-mL glass syringe (e.g., 1-mL, blunt tip, precision glass syringe, National Scientific product # NS600001) for delivering 5 mL/min postcolumn flow of acetonitrile. We have found that the addition of acetonitrile aids in solvent evaporation and analyte ionization, dramatically improving the quality of the resulting mass spectra. 7. 0.2 mm membrane filters for mobile phase filtration (Millipore prod. # JGWP04700 or similar). 8. Glass vials, small volume inserts, and screw caps with silicone/PTFE septa for Agilent 1200 autosampler (MicroSolv, Eatontown, NJ; cat. # 9502S-0CV, 95001-04N, and 9502S-10C-B). 9. Access to an LC–MS instrument equipped with a UV detector and capable of supporting 10 mL/min flow rate (An Agilent 1100 LC– MSD with ion trap mass analyzer and diode array UV detector is used in our laboratory).
91
ESI MS and FTMS of GAGs
OZ OX O
HO
O O
OH
HO NHY
HO2C
HS disaccharides in order of elution
Shorthand notation
X
Y
Z
Mmono
Observed m/z Major ion
1
ΔUA-GlcNAc
0S
H
Ac
H
379.1
377.8
[M-H]-
2
ΔUA-GlcNS
NS
H
SO3H
H
417.1
415.8
[M-H]-
3
ΔUA-GlcNAc6S
6S
H
Ac
SO3H
459.1
457.7
[M-H]-
4
ΔUA2S-GlcNAc
2S
SO3H
Ac
H
459.1
457.7
[M-H]-
5
ΔUA-GlcNS6S
NS6S
497.0
495.6
[M-H]-
6
ΔUA2S-GlcNS
SO3H
SO3H
2SNS
7
ΔUA2S-GlcNAc6S
2S6S
8
ΔUA2S-GlcNS6S
2SNS6S
H
SO3H SO3H SO3H
Ac
SO3H SO3H
H
497.0
495.6
[M-H]-
SO3H
539.0
537.7
[M-H]-
SO3H
577.0
575.6
[M-H]-
Figure 3.6 Structures, monoisotopic masses, and observed m/z of eight HS disaccharide standards.
7.2. Solutions for HS disaccharide analysis 1. Mobile phase C: 12 mM TrBA, 38 mM NH4OAc, 15% acetonitrile in HPLC-grade water, pH 6.5 adjusted with acetic acid. 2. Mobile phase D: 12 mM TrBA, 38 mM NH4OAc, 65% acetonitrile in HPLC-grade water, pH 6.5 adjusted with acetic acid. 3. HS disaccharide standard mixture, 2 mL containing 50 ng of each disaccharide standard in HPLC-grade water (200 ng/mL total disaccharide concentration). The sensitivity of the HS disaccharide analysis is lower than that of the CS/DS disaccharides. 4. HS digest: 40 ng disaccharides in >2 mL of digestion buffer or HPLCgrade water. Injection volume of 2 mL requires a >2 mL sample volume to avoid introducing air into the column. The requirement for the additional sample volume depends on the autosampler needle off-set and the shape of the vial insert. Lower than 40 ng amounts of HS disaccharides can be detected, but may result in a noisy UV baseline.
7.3. Method for HS disaccharide analysis 1. Mobile phase solutions are filtered through the 0.2 mm filters. 2. The column is allowed to equilibrate with 100% C at 10 mL/min at room temperature. 3. The UV detector is set to record absorbance at 232 nm. 4. A two-segment LC gradient is programmed as follows: 0% D, 0–20 min; 0–50% D, 20–25 min.
92
Tatiana N. Laremore et al.
5. The 1-mL Hamilton syringe is filled with acetonitrile, connected to the postcolumn part of the LC system through a T-connector, positioned in the syringe pump, and the pump flow rate is set to 5 mL/min. 6. The sample injection volume is set to 2 mL. If a series of disaccharide samples are introduced through an autosampler, an appropriate injection sequence must be created which includes a standard disaccharide mixture injection after every 8–10 sample injections to periodically monitor the MS detection sensitivity. 7. MS parameters are set as follows: negative ionization mode, skimmer 40 V, capillary exit 40 V, source temperature 325 C, drying gas (N2) 5 L/min, nebulizing gas (N2) 20 psi. The data obtained during HS disaccharide analysis in the negative ion mode is straightforward to interpret because the disaccharides appear as [MH] ions (Fig. 3.6). An example of elution profile of HS disaccharide standards is shown in Fig. 3.7. The EIC was plotted based on ion signals at m/z 378, 416, 458, 496, 538, and 576. The TIC recorded using 50 ng of each HS disaccharide standard (400 ng total amount) exhibits S/N < 3 (not shown) and therefore is not usable for the relative quantification analysis. The EIC or the UV absorbance chromatogram can be used for constructing the disaccharide compositional profile of the sample as well as for absolute quantification, provided that a linear relationship between a disaccharide signal and its amount is established using the appropriate standards.
8. Direct Infusion ESI FTMS Analysis of Oligosaccharides and Polysaccharides Separated by Preparative Continuous-Elution PAGE High resolving power and mass accuracy of FTMS are necessary for the molecular weight analysis of GAG polysaccharides and large oligosaccharides due to the formation of multiply charged ions in ESI of these polyanions. As is true for any type of analyte, the sample for MS analysis must be of highest possible purity and homogeneity to obtain a good quality mass spectrum. This requirement is especially important for the GAGs since they produce low ion yields, have a high propensity to form adducts with cations present in solution, and usually exhibit more than one charge state in the ESI mass spectra. Separation of highly polydisperse GAG mixtures can be achieved off-line using preparative PAGE; and the resulting components can be purified from buffer salts and analyzed by ESI FTMS. This method has proven useful in our laboratory for the preparation of heparin oligosaccharide MW markers (Laremore et al., 2010) and heparosan (K5 polysaccharide) MW markers (Ly et al., 2010) as well as in the MW analysis of the proteoglycan bikunin GAG chains. Urinary bikunin is a 16 kDa PG modified
93
ESI MS and FTMS of GAGs
Relative intensity %
A 100
3 EIC
8 7 4 1
2 5
6
0
B
1 250 UV Abs 232 nm (mAU)
8 3 2
7 4
5
6
0 0
10
20 30 Retention time (min)
40
Figure 3.7 Elution profiles of HS disaccharides separated by IP RP HPLC: (A) Extracted negative-ion chromatogram for m/z 378, 416, 458, 496, 538, and 576, and (B) absorbance trace at 232 nm.
with a 5–7 kDa GAG chain on Ser10 and a 2 kDa N-glycan on Asn45 (Chi et al., 2008; Enghild et al., 1999). Bikunin GAG is a CS-A type polysaccharide comprised by GlcA-GalNAc4S and GlcA-GalNAc0S disaccharides (Capon et al., 2003; Enghild et al., 1991, 1999; Fries and Kaczmarczyk, 2003). A method described here is used in our laboratory for MW analysis of intact GAG released from the urinary bikunin PG by b-elimination under reducing conditions. The analytical workflow consists of (1) separation of the GAG mixture using preparative CE PAGE, (2) analysis of gel-eluted fractions by analytical PAGE, and (3) purification and ESI FTMS MW analysis of fractions of interest.
9. Preparation of Bikunin GAG 9.1. Materials and solutions for GAG release by b-elimination under reducing conditions 1. Bikunin proteoglycan, 1 mg (Mochida Pharmaceuticals, Tokyo, Japan). To obtain a sufficient amount of each purified GAG fraction for the ESI FTMS analysis, ca. 300 mg GAG mixture is required for CE PAGE
94
2. 3. 4. 5. 6. 7. 8. 9.
Tatiana N. Laremore et al.
separation. Since the GAG is approximately 30% of the bikunin PG mass, the use of such large quantity of the PG as 1 mg is justified. Amicon Ultra 10,000 MWCO centrifugal filter for volumes <500 mL (Millipore cat. # UFC5010BK). Narrow range pH paper (colorpHast nonbleeding pH-indicator strips, pH 4.0–7.0, EMD cat. # 9582). Strong-anion exchange (SAX) spin column for volumes <400 mL, high capacity (VivaPure Q Mini-H, Sartorius Stedim, part # VSIX01QH24). A microcentrifuge that can achieve 500 g and 13,000 g relative centrifugal force (rcf). 0.5 M sodium hydroxide (NaOH) containing 0.5 M sodium borohydride (NaBH4) for the b-elimination reaction under reducing conditions. Glacial acetic acid. Anion exchange loading solution: 50 mM sodium chloride in distilled water. Anion exchange elution solution: 1.5 M sodium chloride in distilled water.
9.2. Method for GAG release by b-elimination under reducing conditions 1. The lyophilized PG is dissolved in the 0.5 M NaOH, 0.5 M NaBH4 solution in a 20-mL glass vial and the b-elimination reaction is allowed to proceed for 15–18 h at 4 C. Bikunin PG is soluble at a concentration of 10 mg/mL, thus it is advisable to keep the reaction volume low for subsequent work-up. 2. The reaction mixture is neutralized by adding 5-mL aliquots of glacial acetic acid until pH of the solution is between 5.5 and 7.5. The addition of acid to a borohydride solution generates hydrogen gas, resulting in extensive foaming. Using the wide 20-mL vial, adding acetic acid in small aliquots, and gentle swirling of the reaction after each addition will prevent overflow of the mixture. 3. The b-elimination reaction products are desalted using a 10,000 MWCO centrifugal filter by centrifugation of three 400-mL volumes of distilled water at 13,000 g. 4. The desalted b-elimination reaction products, 20–50 mL in the centrifugal filter, are diluted with the anion-exchange loading solution to 400 mL. (Once the sample is transferred out, the filter can be rinsed with water, kept hydrated, and reused for desalting the GAG after the anion-exchange step.) 5. An SAX spin column is conditioned by centrifugation of 400 mL loading solution at 500 g for 5 min. If the solution does not pass completely
ESI MS and FTMS of GAGs
95
through the SAX packing in 5 min, the time of centrifugation can be increased keeping the same rcf setting. 6. The b-elimination reaction products are loaded onto the conditioned SAX spin column by centrifugation at 500 g for 5 min. 7. The bound GAG is washed with 400 mL loading solution twice by centrifugation for 5 min at 500 g. 8. Purified GAG is eluted with two 100-mL aliquots of the 1.5 M NaCl elution solution. The flow-through is collected and desalted using the 10,000 MWCO centrifugal filter as described above. The desalted GAG sample (20–50 mL) can be stored at 20 C until the analysis.
9.3. Materials and solutions for preparative CE PAGE separation of the bikunin GAG chains 1. Mini-Prep electrophoresis cell (Bio-Rad cat. # 170-2908) with a power source (Bio-Rad PowerPac Universal Power Supply, cat. # 164-5070). 2. Gel-casting equipment for mini-gels: casting frames, casting stand, glass plates with 0.75 mm spacers, short glass plates, combs for 15 wells. 3. Mini-gel electrophoresis cell (Mini-PROTEAN Tetra Cell, Bio-Rad cat. # 165-8000). 4. Peristaltic pump capable of supporting the 80 mL/min flow rate (BioRad Model EP-1 Econo Pump, cat. # 731-8140). 5. Fraction collector (Bio-Rad Model 2110 Fraction Collector, cat. # 731-8120). 6. Glass culture tubes for collecting fractions (13 100 mm, Fisher Scientific) 7. A vacuum pump for degassing the gel monomer solutions. 8. Molecular weight markers (e.g., oligosaccharide ladder). 9. Electrode running buffer: 1 M glycine, 0.2 M Tris, pH 8.3 (achieved by dissolution). Mini-Prep electrophoresis cell requires 100 mL electrode running buffer. 10. Resolving gel buffer (lower chamber buffer and elution buffer): 0.1 M boric acid, 0.1 M Tris, 0.01 M disodium EDTA, pH 8.3 (achieved by dissolution). Mini-Prep electrophoresis cell requires 400 mL lower chamber buffer and 60–100 mL elution buffer. An additional volume of resolving gel buffer is required for soaking the elution frit and dialysis membrane and for purging the lines during the cell assembly. 11. Resolving gel monomer solution, 15% total acrylamide (15% T): 14.08 w/v acrylamide, 0.92% w/v N,N0 -methylene-bis-acrylamide, 5% sucrose in the resolving gel buffer. The monomer solution is filtered through a 0.22 mm filter using vacuum filtration assembly and degassed for an additional 10–15 min under vacuum. A 7 mm diam. 10 cm resolving gel column requires 4 mL monomer solution. The solution can be stored at 4 C for several months.
96
Tatiana N. Laremore et al.
12. Stacking gel monomer solution, 5% T: 4.75% w/v acrylamide, 0.25% w/v bis-acrylamide in the resolving gel buffer, pH 6.3 adjusted with HCl. The monomer solution must be filtered through a 0.22 mm filter using vacuum filtration assembly and degassed for an additional 10– 15 min under vacuum. The stacking gel volume is 1.5- to twofold greater than the volume of sample. 13. 10% (100 mg/mL) ammonium persulfate (APS) aqueous solution prepared fresh. 14. 50% w/v sucrose solution containing 10 mg/mL phenol red (tracking dye). Dissolve 5 g sucrose in enough distilled water to make 10 mL solution and add 100 mL of 1 mg/mL phenol red solution. The sucrose solution can be stored for several months at 4 C. The 1 mg/mL phenol red solution can be stored at 20 C for a year. 15. Water-saturated butanol for gel overlay.
9.4. Method for preparative CE PAGE separation of the bikunin GAG chains 1. To cast a 15% T resolving gel column, 4 mL monomer solution is combined with 4 mL N,N,N0 ,N0 -tetramethylenediamine (TEMED) and 12 mL 10% APS solution, quickly mixed and poured into the gel tube. The gel tube is tapped to remove bubbles, the gel is overlaid with water-saturated butanol, and allowed to polymerize for 1–2 h. The butanol is replaced with resolving gel buffer and the gel is left to polymerize overnight. 2. The resolving gel buffer is removed, and a 0.5 mL stacking gel is cast on top of the resolving gel. The stacking gel contains 1 mL TEMED and 30 mL 10% APS per 1 mL of stacking gel monomer solution. The gel is overlaid with water-saturated butanol and allowed to polymerize for 1 h. The overlay is decanted, and the gel surface is gently rinsed with distilled water. 3. The Mini-Prep electrophoresis cell is assembled as described in the manufacturer instructions. The lower chamber and the elution chamber are filled with the resolving gel buffer, and the upper chamber is filled with the electrode running buffer. 4. The elution buffer flow rate is set to 80 mL/min, and the fraction collector is set to collect 3-min fractions. 5. The desalted GAG sample containing approximately 300 mg GAG in 20–50 mL water is diluted to 125 mL with the electrode running buffer and mixed with 125 mL 50% sucrose containing 10 mg/mL phenol red. The red dye in the sample solution allows tracking the ion front migration during the electrophoresis. 6. The power supply is programmed for an 8-h run at a constant power of 1 W. It takes approximately 2 h for the ion front to reach the bottom of
ESI MS and FTMS of GAGs
97
the gel column, during which time the effluent can be collected in a small waste container. 7. Once the phenol red band has reached the bottom of the gel column, the fractions are collected, and the first fraction containing phenol red is numbered 1. 8. The gel-eluted fractions are analyzed using 0.75 mm 68 mm 86 mm mini-gels. The buffers and the acrylamide monomer solutions used for preparative PAGE are used for the analytical PAGE. One mini-gel requires 4 mL of resolving gel monomer solution, 4 mL TEMED, and 24 mL 10% APS to catalyze polymerization. A stacking gel requires 1 mL of the monomer solution, 1 mL TEMED, and 30 mL 10% APS. The buffer volume requirements vary depending on the electrophoresis cell model. Under the experimental condition described here, bikunin GAGs start eluting after 3.5–4 h, and after 7.5 h, GAGs are not detected in the gel-eluted fractions by PAGE visualized with silver staining. An example of the PAGE analysis of fractions 49–55 is shown in Fig. 3.8 (inset). The GAG fractions must be purified from the elution buffer using anion-exchange chromatography prior to the FTMS analysis; otherwise, the GAG signal in FT mass spectra is suppressed by disodium EDTA clusters (Laremore et al., 2010).
9.5. Materials and solutions for purification of gel-eluted GAG fractions for FTMS analysis 1. Strong anion-exchange mini-spin columns, medium capacity (VivaPure Q Mini M, Sartorius Stedim, part # VS-IX01QM24). 2. Amicon Ultra 10,000 MWCO centrifugal filter for volumes <500 mL (Millipore cat. # UFC5010BK). 3. A microcentrifuge that can achieve 500 g and 13,000 g rcf. 4. Anion exchange loading solution: 50 mM sodium chloride in distilled water. 5. Anion exchange elution solution: 1.5 M sodium chloride in distilled water. 6. Anion exchange sample solution: 120 mM sodium chloride in distilled water. 7. 0.1 M silver nitrate solution.
9.6. Method for purification of gel-eluted GAG fractions for FTMS analysis 1. The SAX spin-column is conditioned with 400 mL of 50 mM NaCl solution by centrifugation at 500 g for 5 min. 2. Gel-eluted fractions containing GAGs (240 mL) are brought to 50 mM NaCl concentration by adding 160 mL of the sample solution and loaded on the preconditioned spin-columns by centrifugation at 500 g for 5 min.
98
Tatiana N. Laremore et al.
A
49 50
51 Mix 52
53 54 55
Relative abundance
1043.4085 z=6
695.2702 z=9
828.6245 z=7 782.3043 z=8
700
(m/z) × z + z 6266
695.3 782.3 828.6 894.2
9 8 7 7
6267 6266 5807 6266
966.9 1043
6 6
5807 6266
1073
6
6442
1160 1236
5 5
5807 6186
800
1072.7462 z = 6 1160.4777 z=5 1236.3011 z=5
900
1000
1100
1200
m/z
B
Relative abundance
z 10
894.2060 z=7 966.8962 z=6
625.6426 z = 10
600
m/z 625.6
1043.4085 z=6 1043.5751 1043.2419 z=6 z=6
Mass
1043.7420 z=6 1043.0748 z=6
1043.9087 z=6
Mass – 652
6442 6266 6186
459 13 12 12
379 15 15 15
5807
11
14
GalNAc (GlcA-GalNAc)13 (SO3)6 LR Mmono calculated 6263.4755 Mmono observed 6263.4918
1044.0755 z=6
Mmono 6263.4450 1042.9075 z=6
1044.2423 z=6 1044.4095 z = 6 1044.9126
1042.7511 z=?
1042.5
Number of disaccharides Mass – 652
z=6
1043.0
1043.5
1044.0 m/z
1044.5
1045.0
Figure 3.8 PAGE and the negative ion ESI FTMS analysis of a bikunin GAG fraction isolated using continuous-elution PAGE: an example of data interpretation.
ESI MS and FTMS of GAGs
99
3. The bound GAGs are washed twice with 400 mL of loading solution by centrifugation at 500 g for 5 min each time, and eluted with two 100-mL portions of elution solution by centrifugation at 500 g for 5 min. 4. The GAGs eluted from the SAX spin column are desalted using the 10,000 MWCO centrifugal filter until the flow-through tests negative for chloride ion with 0.1 M silver nitrate solution. The final volume of purified GAG sample should be 20–30 mL, and this solution can be used for the direct infusion ESI FTMS.
9.7. ESI FTMS analysis of bikunin GAG chains separated by preparative PAGE ESI is a soft ionization method during which analytes in solution are delivered to a spray tip held at a several kilovolt potential. The charge separation on the surface of solution emerging from the spray tip causes the liquid to form a jet and explode into a plume of droplets which are then evaporated in a stream of drying gas. Followed the desolvation, analyte ions enter the inlet orifice of the mass spectrometer. While the mechanisms of ESI are still under investigation, the experimental evidence suggests that the composition of the spray solution affects the type of ionic species observed in the mass spectra. In our experience, 0.1% formic acid in 50% aqueous methanol (Laremore et al., 2010; Wolff et al., 2008b) suppresses Na/H heterogeneity in the GAG mass spectra, simplifying the data interpretation. An LTQ XL Orbitrap mass spectrometer (Thermo Fisher Scientific, San Jose, CA) interfaced with Agilent 1200 nano-LC pump was used for the MW analysis of the PAGE-separated bikunin GAG chains.
9.8. Materials and solutions for the ESI FTMS analysis of gel-eluted bikunin GAG fractions 1. Mobile phase: 0.1% v/v formic acid in 50% v/v aqueous methanol. 2. Purified GAG samples in HPLC-grade water, volume reduced to 20–30 mL. 3. Glass vials, small volume inserts, and screw caps with silicone/PTFE septa for Agilent 1200 autosampler (MicroSolv, Eatontown, NJ; cat. # 9502S-0CV, 95001-04N, and 9502S-10C-B). 4. ESI tuning mix or a GAG oligosaccharide standard.
9.9. Method for the ESI FTMS analysis of gel-eluted bikunin GAG fractions 1. The mobile phase flow is set to 50 mL/min. 2. The mass spectrometer is tuned using an available tuning mix to obtain abundant negative ion(s) in the 600–900 m/z region of the mass
100
Tatiana N. Laremore et al.
spectrum. Typical instrument parameters include spray voltage 3 kV, capillary temperature 200 C, capillary voltage 15 V, tube lens 100 V, the sheath and auxiliary gas flow rates of 20 and 5 units, respectively. 3. The GAG samples are transferred into the autosampler vials and placed in the sample tray. It is recommended to include a wash injection in the analysis sequence if several GAG samples are to be analyzed. A vial containing HPLC-grade water can be added to a sample tray and the water can be injected after each GAG injection to minimize carryover between the GAG injections. 4. An injection volume of 5 mL should afford a good quality mass spectrum. 5. The mass spectra are acquired in the negative ion mode, at a resolution of 30,000 over a range of 400–1500 m/z.
10. An Approach to FTMS Data Interpretation An example of FT mass spectrum of a gel-eluted bikunin GAG fraction #50 is shown in Fig. 3.8. The mass spectrometer was tuned using bovine lung heparin tetradecasaccharide which was prepared in our laboratory using the CE PAGE method described here for separation and purification of bikunin GAG chains (Laremore et al., 2010). The bikunin GAG mass spectrum appears to be complex; however, manual deconvolution of 10 abundant peaks reveals four masses (Fig. 3.8A, inset), only three of which correspond to different chain lengths, since two masses differ by 80 mass units corresponding to a sulfo group. An expanded view of the isotopic peak envelope of the most abundant ion at m/z 1043 shows that the monoisotopic peak (circled in Fig. 3.8B) has m/z 1042.9075. Manual deconvolution affords the monoisotopic mass of this GAG chain: M ¼ ðm=z þ 1:0078Þ z ð1042:9075 þ 1:0078Þ 6 ¼ 6263:4918 To find out what composition corresponds to this mass, it is useful to set the lower and upper limits of possible chain lengths. Based on the bikunin GAG disaccharide composition (Chi et al., 2008; Enghild et al., 1999), the shortest chain would contain the linkage region (LR) tetrasaccharide with a mass of 652 Da and all GlcA-GalNAc4S disaccharides with a residue mass of 459 Da. The longest chain would contain the LR tetrasaccharide and all GlcA-GalNAc0S disaccharides with a residue mass of 379 Da (Fig. 3.8B, inset). The range of chain lengths for the GAG with a mass of 6263.4918 units is 28–34 monosaccharides. A CS GAG chain can be comprised by odd
ESI MS and FTMS of GAGs
101
or even number of monosaccharides, and in each case its monoisotopic mass can be expressed as follows: Modd ¼ 379:1115 di þ 79:9568 s þ 652:2062 þ 203:0794 Meven ¼ 379:1115 di þ 79:9568 s þ 652:2062 The number of disaccharides is denoted di, the number of sulfo groups is denoted s; and the monoisotopic masses of the LR tetrasaccharide and the nonreducing end GalNAc residues are included in the GAG mass calculations. The two expressions are used in creating an Excel spreadsheet mass calculator for chain lengths of 28–34 monosaccharides and the best match between the observed and the calculated monoisotopic masses is found. Thus, bikunin GAG with a mass of 6263.4918 units contains 31 monosaccharides, including the LR tetrasaccharide, and 6 sulfo groups (Fig. 3.8B).
11. Direct Infusion ESI FT-ICR MS Analysis of Bikunin GAG Mixture Analysis of intact GAG mixtures is a new frontier in glycomics of GAGs and requires the use of state-of-the-art mass analyzers such as FT-ICR. Mass spectra of polydisperse GAG mixtures are highly complex, exhibiting multiple charge states and various degrees of sodium/hydrogen exchange, which inherently limit the ion signal of any single channel. There is also a space charge limit for ion capacity in the FT-ICR analyzer, which further limits the ability to simultaneously detect ions over the entire m/z range. To overcome the space charge limitation, a quadrupole isolation window of approximately 20 m/z can be used to increase the ion signal within the isolated range and provide sufficient signal-to-noise to make an accurate mass measurement of intact GAGs in the mixture (Fig. 3.9). The ESI FT-ICR analyses described here were performed on a 7T Bruker Apex IV QeFTMS instrument fitted with an Apollo II electrospray ion source.
11.1. Method for the ESI FT-ICR MS analysis of bikunin GAG mixture 1. Bikunin GAG mixture is dissolved in 50% aqueous methanol to approximately 0.1 mg/mL and ionized through backed nanospray (1200 V) at 10 mL/h. Due to the small amount of analyte, nanospray is employed instead of microspray. 2. A 20 m/z window is established for the quadrupole mass filter. This window is then incrementally stepped across the desired m/z range, allowing for overlap between windows. At each window setting, a
102
Tatiana N. Laremore et al.
C
Relative intensity, %
Intensity, arb. units
A
B
400
600
1000 m/z
1200 500
550
600
650 m/z
700
750
800
Figure 3.9 An illustration of the MS signal improvement achieved with quadrupole mass filter: ESI FT ICR MS analysis of intact bikunin GAG mixture (A) without mass filter, and (B) with a 20 m/z mass window. Overlapping small windows can be combined into a full m/z range mass spectrum with improved S/N.
mass spectrum is obtained with 24 acquisitions signal-averaged per mass spectrum. For each mass spectrum, 512K points are acquired, padded with one zero fill, and apodized using a sinebell window. Longer time domain transients can be acquired to obtain higher resolution if desired. 3. Once the data is acquired, the individual-window spectra are summed to obtain a full mass spectrum with enhanced S/N. The approach to interpretation of the resulting mass spectra is described in the preceding section and in the reference by Chi et al. (2008).
12. Structural Characterization of GAG Oligosaccharides by Tandem Mass Spectrometry The tandem MS experiments described here are performed on a Bruker Apex Ultra QeFTMS instrument (Billerica, MA). The Apex Ultra is a hybrid FT-ICR MS and contains a mass selective quadrupole for precursor ion isolation prior to activation. The instrument is fitted with an Apollo MTP dual ion source, a 25 W CO2 laser (Synrad model J48-2, Mukilteo, WA) for IRMPD, and an indirectly heated hollow cathode (HeatWave, Watsonville, CA) for generating electrons (Fig. 3.10). The precursor ion charge state and/ or degree of Na/H exchange is affected by the solvent composition.
103
ESI MS and FTMS of GAGs
Quadrupole mass filter/ion guide
Capillary Skimmers
Quad entrance
Electrostatic ion optics
Indirectly heated cathode
Argon
Source focus lens
e–
Hexapole
ICR cell Hexapole collision
CO2 laser e–
Superconducting 7 Tesla magnet Ion funnels Rough pump
Hexapole exit Drag pump
Turbo pumps
Turbo pumps
Figure 3.10 A diagram of the Bruker Apex QeFTMS instrument.
Currently, we use 50% methanol in HPLC-grade water containing (1) 0.1% v/v of concentrated ammonium hydroxide solution; (2) 0.1% v/v formic acid; and (3) 1 mM sodium hydroxide. The presence of ammonium hydroxide in the spray solution increases its pH resulting in more abundant negative ions of GAGs with significant Na/H heterogeneity. The addition of formic acid lowers the pH and results in reduced Na/H heterogeneity in the GAG mass spectra. The addition of sodium hydroxide to the spray solution promotes the formation of sodium-cationized precursor ions.
12.1. Method for structural characterization of GAG oligosaccharides by tandem MS 1. GAG oligosaccharide solutions are prepared at an approximate concentration of 10–20 mg/mL. The concentration is optimized based on the size and degree of sulfation of the analyte. 2. Depending on the amount of the GAG oligosaccharide available for the analysis, microspray or nanospray is selected for the ionization. In microspray, the sample is sprayed through a metal capillary (Agilent part G2427A) at 120 mL/h with an applied voltage of 4400 V. In backed nanospray, a pulled fused silica spray tip is used (New Objective, Woburn, MA; part FS360-20-10-N-20), and the sample is injected into a sample loop and pushed at 10 mL/h with an applied voltage of approximately 1200 V. The voltage settings are instrument-dependent and should be optimized to achieve desired ion signal.
104
Tatiana N. Laremore et al.
3. A single-stage mass spectrum is acquired, and a precursor ion is chosen and isolated with a window of 5–10 m/z. Care should be taken to tune the instrument-specific voltages in the region between the quadrupole mass filter and FT-ICR mass analyzer to minimize preliminary ion activation and subsequent loss of SO3. 4. Precursor ion is accumulated in the collision cell for 0.5–4 s prior to activation. This time depends on the analyte concentration and signal intensity of the precursor ion. 5. Once the precursor ion is isolated, the desired tandem MS experiment is conducted. Experiments conducted within the FT-ICR analyzer, such as IRMPD and EDD, may require refinement of the quadrupole isolation with an applied radiofrequency waveform such as CHEF (de Koning et al., 1997) or SWIFT (Guan and Marshall, 1996). To further increase the precursor ion intensity, gating trapping can be employed to repeatedly fill the analyzer cell until the space charge capacity is reached. a. CID is performed in the high-pressure collision cell of the Apex instrument where ions undergo collisions with an inert gas, typically argon. The DC voltage applied to the collision cell rods should be tuned to convert 30–40% of the precursor ion to products (typically 5–15 V). This restriction limits the conversion of product ions into secondary products. b. IRMPD is performed in the FT-ICR analyzer of the Apex instrument. IR photons are produced on the lee-side of the instrument and conducted into the UHV region of the analyzer by a BaF2 window. A hollow electron dispenser cathode allows for on-axis alignment of the laser. Precursor ions are typically irradiated with 60–70% attenuation of the laser power for 10–80 ms. As in CID, the IRMPD pulse should be tuned to convert approximately 30–40% of the precursor ion to products to avoid secondary fragmentation. Care should be taken to properly align the laser, as the beam overlap is sensitive to the ion cloud position within the analyzer. c. EDD is performed in the FT-ICR analyzer of the Apex instrument. The EDD experiment is controlled by four parameters which are instrument-specific and depend on the instrument geometry: (1) electron cathode heater current; (2) electron cathode bias; (3) electron extraction lens bias; and (4) electron pulse duration. While the values of these parameters are dependent upon instrument geometry, the electron kinetic energy is typically 19 eV with an electron current of approximately 15 mA entering the analyzer. These values should be optimized for each experimental setup and can be readily achieved by monitoring the electron current (Leach et al., 2008). During a typical tandem MS experiment, 24–36 acquisitions are signal averaged per mass spectrum. An example of the IRMPD and EDD mass spectra of an HS tetrasaccharide (DUAGlcNAc6S-GlcAGlcNAc6S) is
105
ESI MS and FTMS of GAGs
B2
Y1
Intensity (×107)
~ x2 Y32– B3
2-
[M-2H] -SO3
4 2, 4
2
Y3-SO32– 0,2
B1 C
A2-SO3
A3-SO3 B3-SO3
Z32– C2-SO3
B2-SO3
0,2
1
B2''
0,2
6
Z3-SO3 Y3-SO3
0,2
A3
Y32– X1
~ x50
[M-2H]
A3 B3-SO3 B3'-CO2
C32–
3,5
A2 Z1 C -SO 2 3
B1 C1
Z2-CO2 Z2' -CO2 Z2 B2 Z2 B'' 1,5 2 C2'' A2 C2
Y2
1,5
X2
0,2
A3 A3
300
400
500
0,2
B'3 B3
1,5
200
[M-H] -SO3
EDD
Z3-CO2
Z3''-H2SO4
Y3-CO2
X32–
2
Y3
Z3-SO3 Z''-SO 3 3
3,5 2−
[M-2H] -SO3 1,5
4 X0
1−
2−
Y1 A2
[M-H]
[M-H] -H2SO4
Y2
1,5
2,4
1–
1−
C2 Z Y2-SO3 2
X1
0
Intensity (×106)
IRMPD
2−
[M-2H]
6
600 m/z
C3'' C3
Z3' Z3 A4-SO3
0,2
1,4
X2
Y3-SO3 1,5
X3-SO3
700
800
X3
2,4
1,3
X3 or X3 − [M-2H] *-CO2 − 0,3 1,5 [M-2H] * X '' X3 3 0,3 − X3 [M-H]
0,2
Z3''
A4
900
1000
Figure 3.11 An example of the tandem MS spectra, IRMPD and EDD, of an HS tetrasaccharide (DUAGlcNAc6S-GlcAGlcNAc6S) with the assigned fragments.
shown in Fig. 3.11. For each mass spectrum, 512K points are acquired, padded with one zero fill, and apodized using a sinebell window. Longer time domain transients can be acquired to obtain higher resolution if desired. External calibration of mass spectra affords a mass accuracy of 1 ppm, which can be achieved using negative-ion standards such as insulin A-chain or sodium trifluoroacetate. These standards produce a suitable range of calibrant peaks spanning the typical product range of 150–1500 m/z. Internal calibration affords a mass accuracy of <1 ppm and is performed using confidently assigned glycosidic bond cleavage products as internal calibrants. Due to the large number of low-intensity products formed, only the peaks with S/N > 10 are reported. The assignment of fragmentation products is based on accurate mass measurement and can be assisted by software tools such as Glycoworkbench (Ceroni et al., 2008).
13. Summary ESI MS is a versatile and sensitive technique for identification and quantification of GAGs when used in combination with enzymology, permitting the detection of subtle changes in disaccharide composition of
106
Tatiana N. Laremore et al.
GAGs biosynthesized under different environmental or physiological conditions. ESI coupled with high-resolution mass analyzers such as FTMS provides information about MW and composition of large oligosaccharides and intact GAGs. The sequence and fine-structure analysis of GAG oligosaccharides obtained by partial enzymatic treatment of GAG polysaccharides is possible using fragmentation methods such as IRMPD and EDD.
ACKNOWLEDGMENTS Financial support from National Institutes of Health Grants GM38060, GM090127, and HL096972 is gratefully acknowledged.
REFERENCES Bielik, A. M., and Zaia, J. (2010). Historical overview of glycoanalysis. Methods Mol. Biol. 600, 9–30. Budnik, B. A., Haselmann, K. F., and Zubarev, R. A. (2001). Electron detachment dissociation of peptide di-anions: An electron-hole recombination phenomenon. Chem. Phys. Lett. 342, 299–302. Capon, C., Mizon, C., Lemoine, J., Rodie-Talbere, P., and Mizon, J. (2003). In acute inflammation, the chondroitin-4 sulphate carried by bikunin is not only longer, it is also undersulphated. Biochimie 85, 101–107. Ceroni, A., Maass, K., Geyer, H., Geyer, R., Dell, A., and Haslam, S. M. (2008). GlycoWorkbench: A tool for the computer-assisted annotation of mass spectra of glycans. J. Proteome Res. 7, 1650–1659. Chi, L., Wolff, J. J., Laremore, T. N., Restaino, O. F., Xie, J., Schiraldi, C., Toida, T., Amster, I. J., and Linhardt, R. J. (2008). Structural analysis of bikunin glycosaminoglycan. J. Am. Chem. Soc. 130, 2617–2625. de Koning, L. J., Nibbering, N. M. M., van Orden, S. L., and Laukien, F. H. (1997). Mass selection of ions in a Fourier transform ion cyclotron resonance trap using correlated harmonic excitation fields (CHEF). Int. J. Mass Spectrom. 165, 209–219. Enghild, J. J., Salvesen, G., Hefta, S. A., Thogersen, I. B., Rutherfurd, S., and Pizzo, S. V. (1991). Chondroitin-4-sulfate covalently cross-links the chains of the human blood protein pre-a-inhibitor. J. Biol. Chem. 266, 747–751. Enghild, J. J., Thogersen, I. B., Cheng, F., Fransson, L. A., Roepstorff, P., and RahbekNielsen, H. (1999). Organization of the inter-alpha-inhibitor heavy chains on the chondroitin sulfate originating from Ser(10) of bikunin: Posttranslational modification of IalphaI-derived bikunin. Biochemistry 38, 11804–11813. Flangea, C., Schiopu, C., Sisu, E., Serb, A., Przybylski, M., Seidler, D. G., and Zamfir, A. D. (2009). Determination of sulfation pattern in brain glycosaminoglycans by chip-based electrospray ionization ion trap mass spectrometry. Anal. Bioanal. Chem. 395, 2489–2498. Fries, E., and Kaczmarczyk, A. (2003). Inter-alpha-inhibitor, hyaluronan and inflammation. Acta Biochim. Pol. 50, 735–742. Guan, S. H., and Marshall, A. G. (1996). Stored waveform inverse Fourier transform (SWIFT) ion excitation in trapped-ion mass spectometry: Theory and applications. Int. J. Mass Spectrom. Ion Processes 158, 5–37.
ESI MS and FTMS of GAGs
107
Guimond, S. E., Puvirajesinghe, T. M., Skidmore, M. A., Kalus, I., Dierks, T., Yates, E. A., and Turnbull, J. E. (2009). Rapid purification and high sensitivity analysis of heparan sulfate from cells and tissues: Toward glycomics profiling. J. Biol. Chem. 284, 25714–25722. Gunay, N. S., Tadano-Aritomi, K., Toida, T., Ishizuka, I., and Linhardt, R. J. (2003). Evaluation of counterions for electrospray ionization mass spectral analysis of a highly sulfated carbohydrate, sucrose octasulfate. Anal. Chem. 75, 3226–3231. Iozzo, R. V. (2001). Proteoglycan Protocols. Humana Press, Totowa, NJ. Laremore, T. N., Ly, M., Solakyildirim, K., Zagorevski, D. V., and Linhardt, R. J. (2010). Highresolution preparative separation of glycosaminoglycan oligosaccharides by polyacrylamide gel electrophoresis. Anal. Biochem. 401, 236–241, doi:10.1016/j.ab.2010.03.004. Leach, F. E., Wolff, J. J., Laremore, T. N., Linhardt, R. J., and Amster, I. J. (2008). Evaluation of the experimental parameters which control electron detachment dissociation, and their effect on the fragmentation efficiency of glycosaminoglycan carbohydrates. Int. J. Mass Spectrom. 276, 110–115. Linhardt, R. J. (2001). Analysis of glycosaminoglycans with polysaccharide lyases. Curr. Protoc. Mol. Biol. Chapter 17, Unit17 13B. Ly, M., Wang, Z., Laremore, T. N., Zhang, F., Zhong, W., Pu, D., Zagorevski, D. V., Dordick, J. S., and Linhardt, R. J. (2010). Analysis of E. coli K5 capsular polysaccharide heparosan. Anal. Bioanal. Chem. doi: 10.1007/s00216-010-3679-7. Nairn, A. V., Kinoshita-Toyoda, A., Toyoda, H., Xie, J., Harris, K., Dalton, S., Kulik, M., Pierce, J. M., Toida, T., Moremen, K. W., and Linhardt, R. J. (2007). Glycomics of proteoglycan biosynthesis in murine embryonic stem cell differentiation. J. Proteome Res. 6, 4374–4387. Saad, O. M., and Leary, J. A. (2005). Heparin sequencing using enzymatic digestion and ESI-MSn with HOST: A heparin/HS oligosaccharide sequencing tool. Anal. Chem. 77, 5902–5911. Sinnis, P., Coppi, A., Toida, T., Toyoda, H., Kinoshita-Toyoda, A., Xie, J., Kemp, M. M., and Linhardt, R. J. (2007). Mosquito heparan sulfate and its potential role in malaria infection and transmission. J. Biol. Chem. 282, 25376–25384. Staples, G. O., Bowman, M. J., Costello, C. E., Hitchcock, A. M., Lau, J. M., Leymarie, N., Miller, C., Naimy, H., Shi, X., and Zaia, J. (2009). A chip-based amide-HILIC LC/MS platform for glycosaminoglycan glycomics profiling. Proteomics 9, 686–695. Staples, G. O., Naimy, H., Yin, H., Kileen, K., Kraiczek, K., Costello, C. E., and Zaia, J. (2010). Improved hydrophilic interaction chromatography LC/MS of heparinoids using a chip with postcolumn makeup flow. Anal. Chem. 82, 516–522. Tissot, B., Ceroni, A., Powell, A. K., Morris, H. R., Yates, E. A., Turnbull, J. E., Gallagher, J. T., Dell, A., and Haslam, S. M. (2008). Software tool for the structural determination of glycosaminoglycans by mass spectrometry. Anal. Chem. 80, 9204–9212. Warda, M., Toida, T., Zhang, F., Sun, P., Munoz, E., Xie, J., and Linhardt, R. J. (2006). Isolation and characterization of heparan sulfate from various murine tissues. Glycoconj. J. 23, 555–563. Wolff, J. J., Amster, I. J., Chi, L., and Linhardt, R. J. (2007a). Electron detachment dissociation of glycosaminoglycan tetrasaccharides. J. Am. Soc. Mass Spectrom. 18, 234–244. Wolff, J. J., Chi, L., Linhardt, R. J., and Amster, I. J. (2007b). Distinguishing glucuronic from iduronic acid in glycosaminoglycan tetrasaccharides by using electron detachment dissociation. Anal. Chem. 79, 2015–2022. Wolff, J. J., Laremore, T. N., Busch, A. M., Linhardt, R. J., and Amster, I. J. (2008a). Electron detachment dissociation of dermatan sulfate oligosaccharides. J. Am. Soc. Mass Spectrom. 19, 294–304.
108
Tatiana N. Laremore et al.
Wolff, J. J., Laremore, T. N., Busch, A. M., Linhardt, R. J., and Amster, I. J. (2008b). Influence of charge state and sodium cationization on the electron detachment dissociation and infrared multiphoton dissociation of glycosaminoglycan oligosaccharides. J. Am. Soc. Mass Spectrom. 19, 790–798. Zaia, J. (2005). Principles of mass spectrometry of glycosaminoglycans. J. Biomol. Mass Spectrom. 1, 3–36. Zaia, J. (2008). Mass spectrometry and the emerging field of glycomics. Chem. Biol. 15, 881–892. Zaia, J. (2009). On-line separations combined with MS for analysis of glycosaminoglycans. Mass Spectrom. Rev. 28, 254–272. Zaia, J., and Costello, C. E. (2003). Tandem mass spectrometry of sulfated heparin-like glycosaminoglycan oligosaccharides. Anal. Chem. 75, 2445–2455. Zamfir, A., Seidler, D. G., Kresse, H., and Peter-Katalinic, J. (2002). Structural characterization of chondroitin/dermatan sulfate oligosaccharides from bovine aorta by capillary electrophoresis and electrospray ionization quadrupole time-of-flight tandem mass spectrometry. Rapid Commun. Mass Spectrom. 16, 2015–2024. Zamfir, A., Seidler, D. G., Kresse, H., and Peter-Katalinic, J. (2003). Structural investigation of chondroitin/dermatan sulfate oligosaccharides from human skin fibroblast decorin. Glycobiology 13, 733–742. Zamfir, A., Seidler, D. G., Schonherr, E., Kresse, H., and Peter-Katalinic, J. (2004). On-line sheathless capillary electrophoresis/nanoelectrospray ionization-tandem mass spectrometry for the analysis of glycosaminoglycan oligosaccharides. Electrophoresis 25, 2010–2016. Zamfir, A. D., Flangea, C., Sisu, E., Serb, A. F., Dinca, N., Bruckner, P., and Seidler, D. G. (2009). Analysis of novel over- and under-sulfated glycosaminoglycan sequences by enzyme cleavage and multiple stage MS. Proteomics 9, 3435–3444. Zhang, F., Zhang, Z., Thistle, R., McKeen, L., Hosoyama, S., Toida, T., Linhardt, R. J., and Page-McCaw, P. (2009a). Structural characterization of glycosaminoglycans from zebrafish in different ages. Glycoconj. J. 26, 211–218. Zhang, Z., Xie, J., Liu, H., Liu, J., and Linhardt, R. J. (2009b). Quantification of heparan sulfate disaccharides using ion-pairing reversed-phase microflow high-performance liquid chromatography with electrospray ionization trap mass spectrometry. Anal. Chem. 81, 4349–4355. Zimmerman, J. A., Watson, C. H., and Eyler, J. R. (1991). Multiphoton ionization of laser-desorbed neutral molecules in a Fourier transform ion cyclotron resonance mass spectrometer. Anal. Chem. 63, 361–365.
C H A P T E R
F O U R
Large-Scale Glycomics for Discovering Cancer-Associated N-Glycans by Integrating Glycoblotting and Mass Spectrometry Maho Amano and Shin-Ichiro Nishimura Contents 1. Introduction 2. Overview of Glycoblotting Utilized by BlotGlyco Beads 2.1. Pretreatment and release of N-glycans 2.2. Enrichment of glycans onto BlotGlyco beads (glycoblotting) 2.3. On-beads derivatization of sialic acids 2.4. Recovery of oligosaccharides from the beads 2.5. Discovery of glycan-related cancer biomarker utilized by glycoblotting 2.6. Monitoring mouse ES cell differentiation by N-glycomics utilized by glycoblotting 2.7. Potential applications for O-glycomics and glycosphingolipidomics 2.8. The concept of reverse glycoblotting and GFRG References
110 111 112 113 115 115 116 121 122 123 124
Abstract It has known that the glycosylation plays an important role in the biological states, such as development, aging, and diseases. Although genomic and proteomic approaches have been intensively studied for diagnosis and disease treatment, glycomics have been laggard compared to them due to the hardness of the purification procedure from crude biological materials. Recently, we have developed ‘‘glycoblotting’’ method, a high-throughput and quantitative technique for comprehensive glycomics, which enables to enrich and quantify glycans from crude biological materials, such as serum, tissue Laboratory of Advanced Chemical Biology, Graduate School of Advanced Life Science, Frontier Research Center for Post-Genome Science and Technology, Hokkaido University, Sapporo, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78004-6
#
2010 Elsevier Inc. All rights reserved.
109
110
Maho Amano and Shin-Ichiro Nishimura
biopsy, and cell lysate [Niikura, K., Kamitani, R., Kurogochi, M., Uematsu, R., Shinohara, Y., Nakagawa, H., Deguchi, K., Monde, K., Kondo, H., and Nishimuram S.-I. (2005). Versatile glycoblotting nanoparticles for high-throughput protein glycomics. Chem. Eur. J. 11, 3825–3834; Nishimuara, S.-I., Niikura, K., Kurogochi, M., Matsushita, T., Fumoto, M., Hinou, H., Kamitani, R., Nakagawa, H., Deguchi, K., Miura, N., Monde, K., and Kondo, H. (2005). High-throughput protein glycomics: Combined use of chemoselective glycoblotting and MALDI-TOF/TOF mass spectrometry. Angew. Chem. Int. Ed. 44, 91–96]. The automated machine for glycoblotting, ‘‘SweetBlot,’’ fixed to use optimized protocol allows us to obtain quantitative profile of 40–50 kinds of major glycoforms from 5 ml of human serum within 11 h. Based on the method, we have detected potential differences of N-glycome between sera from hepatocellular carcinoma (HCC) and healthy donor [Miura, Y., Hato, M., Shinohara, Y., Kuramoto, H., Furukawa, J.-i, Kurogochi, M., Shimaoka, H., Tada, M., Nakanishi, K., Ozaki, M., Todo, S., and Nishimura, S.-I. (2008). BlotGlycoABCTM, an integrated glycoblotting technique for rapid and large scale clinical glycomics. Mol. Cell. Proteomics 7, 370–377]. The method also permitted cellular quantitative N-glycomics to monitor the process of dynamic cellular differentiation of mouse embryonic stem cells into neural cells [Amano, M., Yamaguchi, M., Takegawa, Y., Yamashita, T., Terashima, M., Furukawa, J.-i., Miura, Y., Shinohara, Y., Iwasaki, N., Minami, A., and Nishimura, S.-I. (2010). Threshold in stage-specific embryonic glycotypes uncovered by a full portrait of dynamic N-glycan expression during cell differentiation. Mol. Cell. Proteomics 9, 523–537]. In this chapter, we will discuss glycoblotting method including the potentials not only for exploration of glycan-related cancer biomarker but also for detection of cellular differentiation.
1. Introduction It has been reported that N-glycan profile from serum glycoproteins in patients suffering from cancer, rheumatoid arthritis, and inflammatory diseases are distinct from that of healthy donors (Kyselova et al., 2007; Nakagawa et al., 2007). Because glycosylation is an important posttranslational modification of proteins, which is afforded to achieve independently of genes, to regulate its biological functions, expression patterns of glycoforms can be affected by various individual states, such as crisis, pathology, and progression of disease. Thus, it seems appropriate that alteration in glycan structure/amount is regarded as signals for aberrant physiological and pathological conditions. Large scale and comprehensive glycomics is a promising approach to facilitate glycomics for applications to diagnosis and treatment for disease. Unlike the genes and proteins, glycans generally cannot be amplified in vitro. Therefore, it is important to purify and enrich glycans from slight amount of biological materials without any bias. ‘‘Glycoblotting’’ method, which we
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
111
have developed, is a novel technology allowing to overcome this problem (Niikura et al., 2005; Nishimuara et al., 2005). The automated machine for glycoblotting, ‘‘SweetBlot,’’ fixed to use optimized protocol improving the throughput, allows us to obtain quantitative profile of 40–50 kinds of major glycoforms from 5 ml of human serum within 11 h. Glycan-based biomarkers with high sensitivity and high specificity are expected to contribute not only for diagnosis and treatment of diseases including cancer, but also for cell engineering utilized by embryonic stem (ES) cells and induced pluripotent stem (iPS) cells. In that field, it is urgently required the index to assess the quality of the individual ES or iPS cells (Chan et al., 2009; Gala´n and Simo´n, 2010; Sakurada et al., 2008; Takahashi et al., 2007). Glycoblotting also enables comprehensive and quantitative cellular glycomics monitoring real-time glycoform alteration during cell differentiation, which allows for the identification of target cells and assess the quality of cells (Amano et al., 2010). Here, we will review a practical system for N-glycomics based on glycoblotting method, which enables quantitative and global information of glycoform in serum, cell lysate, and tissues. The potential applications for O-glycomics and glycosphingolipidomics will be also mentioned briefly.
2. Overview of Glycoblotting Utilized by BlotGlyco Beads Our strategy of a glycoblotting-based high-throughput, quantitative, and comprehensive glycomics designed for biological materials is diagrammed in Fig. 4.1. In brief, (i) enzymatic release of entire N-glycans from glycoproteins in serum, cell lysate, and tissue extract, (ii) glycoblotting, the key step for specific chemistry-based enrichment of entire N-glycans by BlotGlyco beads, (iii) methyl-esterification of carboxyl group to prevent the significant cleavage at the sensitive O-glycoside linkage of sialosides during the high-energy ionization process in mass spectrometry (MS), (iv) subsequent labeling with a reagent to enhance MS sensitivity by trans-imination, (v) quantitative MS-based glycomics and statistics including typing subgroups of characteristic glycoforms, namely glycotypes, in the presence of internal standard. One of the prominent points of the glycoblotting method is to be enabled to perform all the steps only in single tube and single well of multiwall filter plate, achieving rapid processing and significantly reduced sample loss. The reaction conditions and all the procedures are carefully optimized by using various biological materials, such as human and animal sera, cultured cells, and animal tissues to maximize efficacy of N-glycan enrichment and reproducibility (Amano et al., 2010; Furukawa et al., 2008; Kita et al., 2007).
112
Maho Amano and Shin-Ichiro Nishimura
Pretreatment of samples and glycoblotting Cells ~confluent @ 6 cm-f dish (~5 × 106 cells) Tissue ~10 mg wet waight (i) Solubilized by PHM in NH4HCO3, reduction-alkylation 5 mL of and protease and PNGaseF serum digestion
id
NA
D
BlotGlycoTM
(v)
an
glyc
tein
opro
Glyc
(iii)
Wash
Pe
Free
Glycoblotting
(ii)
Lip
de pti
On-bead derivatization
(iv)
Release of labeled glycans
Automated pretreatment and purification by SweetBlot
MALDI-TOF-MS-based quantitative analysis
Data analysis
Figure 4.1 Basic workflow of the glycoblotting method utilized by BlotGlyco bead. f means inner diameter.
Furthermore we have developed an automated system for glycoblotting, ‘‘SweetBlot.’’ It makes possible to obtain quantitative profile of 40–50 kinds of major glycoforms from 5 ml of human serum within 11 h.
2.1. Pretreatment and release of N-glycans The key concept of glycoblotting method is the chemical ligation of reactive aldehyde groups in reducing terminal of N-glycans by means of hydrazine- or aminooxy-functionalized polymers (Robinson, 1969). Therefore, it is required to prepare oligosaccharides carrying hemiacetal structure equivalent to aldehyde group from glycoproteins. To the purpose, peptide N-glycosidase F (PNGase F) is very useful because the enzyme can produce reducing sugars from the glycopeptides regardless of their N-glycan structures (Yosizawa et al., 1966). In case of serum, each experimental step will be written as (S-1) to (S-12’) while for cells (C-1) to (C-5). (S-1) 20 ml aliquot of serum is diluted to 110 ml with 95 mM ammonium bicarbonate (ABC) containing 0.05% of 1-propanesulfonic acid, 2-hydroxyl3-myristamido (PHM).
113
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
(S-2) The solubilized proteinous materials are reduced by 10 mM 1,4-dithiothreitol (DTT) at 60 C for 30 min followed by alkylation with 17.6 mM iodoacetamide by incubation in the dark at room temperature for 60 min. (S-3) The mixture is then treated with 400 U of trypsin (Sigma-Aldrich) at 37 C, overnight, followed by heat-inactivation of the enzyme at 90 C for 10 min. (S-4) After cooling to the room temperature, N-glycans of glycopeptides are released from trypsin-digested samples by incubation with 2 U of PNGase F (Roche Applied Science) at 37 C, overnight. For analysis of cultured cells, the step for lysis and concentration of protein fraction should be included in the procedure described above. In brief, (C-1) Cell number corresponding to confluent at 6 cm-f culture dish is required for glycoblotting-based N-glycomics. Cells are scraped in phosphate buffered saline (PBS) containing 10 mM EDTA and washed with PBS. (C-2) Following to suspending in 60–160 ml of PBS, cells are lyzed by incubation with 1% Triton X-100 for an hour on ice. The lysates are centrifuged at 15,000 rpm for 10 min at 4 C and the obtained supernatant is added to cold acetone (1:4) to precipitate proteinous materials. A portion of the lysate should be removed before acetone precipitation and quantified by protein assay. (C-3) The precipitates are collected by centrifuge at 12,000 rpm for 15 min at 4 C followed by serial wash with acetonitrile. The resulted precipitates are dissolved in 50 ml of 80 mM ABC containing 0.02% of PHM and incubated at 60 C for 10 min. (C-4) Reductive-alkylation, trypsin digest, and PNGase F treatment can be done as the same procedure to serum protocol.
2.2. Enrichment of glycans onto BlotGlyco beads (glycoblotting) TM
TM
We have developed two kinds of beads, BlotGlyco ABC and BlotGlyco H, to enrich the released glycans specifically from the crude biological mixtures (Fig. 4.2) (Furukawa et al., 2008; Miura et al., 2008). They bear hydrazide-group on their surface for chemo-selective ligation to reducing sugars. Because the former one carries fluorescent probe ahead of the hydrazine on its surface via disulfide bond, enriched glycans can be labeled and quantitatively released by treatment with reducing reagent. The latter is useful for recovering sugars by means of trans-imination. In this case, sugars are ligated to the bead via hydrazone bond, which can be transferred to an aminooxy probe through oxime bond formation, making glycans possible to be tagged with a desirable label for the subsequent analysis. Now,
114
Maho Amano and Shin-Ichiro Nishimura
HO HO
O
O
N OH NHAc
RO HO
BlotGlyco H
O
R
H2N
OH
NH
NHAc
HO OH
O
HN O
Release by trans-imination
HO
H2N-O-R′
O O R
O
Glycoblotting
NHAc
HO
HO O N
OH R
O
R′ O
NHAc
HO OH
BlotGlyco ABC
NH2 HN
H2N
O S
HN
S
O
NH2
HO OH
N R
O
NHAc
HO OH
HN NH
O S
O
S
Release by reduction DTT or TCEP
NH2
HO OH N R
O
NHAc
HO OH
HN NH
O SH
O
Figure 4.2 Oligosaccharide recovery from BlotGlyco beads. When glycans are released from BlotGlyco ABC bead they are labeled by fluorescent tag. On the other hand, glycans captured by BlotGlyco H can be labeled flexibly.
because of this reason as well to the application for glycoformed-focused TM reverse genomics (GFRG), our group usually uses BlotGlyco H (Kurogochi et al., 2007). (S-5) 20 ml of PNGase F-digested sample, corresponding to 2.5 ml of serum, is appropriate for glycoblotting. 500 ml of BlotGlyco H beads (10 mg/ml suspension, Sumitomo Bakelite Co.) is aliquoted onto a well of a MultiScreen Solvinert filter plate (Millipore). PNGase F-digested samples were dissolved with 20 ml of water and applied to the well followed by the addition of 180 ml of 2% acetic acid in acetonitrile (ACN). The plate was incubated at 80 C for 45 min to capture total glycans in sample mixtures specifically onto beads via stable hydrazone bonds. (S-6) The plate was washed with 200 ml of 2 M guanidine–HCl in ABC followed by washing with the same volume of water and 1% triethyl amine in methanol (MeOH). Each washing step was performed twice, respectively. (S-7) Unreacted hydrazide functional groups on beads were capped by incubation with 10% acetic anhydride in MeOH for 30 min at room temperature. Then the solution was removed by vacuum. (S-8) Then the beads was serially washed with 2 200 ml of 10 mM HCl, MeOH, and dioxane, respectively.
115
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
(C-5) In case of cell sample, because N-glycan amount existing in cells are very dependent on clones, at first we recommend to use the PNGase Fdigested lysate corresponding to 100–200 mg of protein for glycoblotting to confirm if it is enough to detect N-glycans. Sample mixture can be dried up by SpeedVac and stored at 20 C until use. Then samples are dissolved with water adjusting the concentration. All of the procedures in glycoblotting are exactly identical to those of serum (S-5 to S-120 ).
2.3. On-beads derivatization of sialic acids As well known, sialic acids are generally hard to be analyzed quantitatively, resulting from removing or decomposition during the ionization in MS analysis in addition to the formation of cation adducts. Although some groups have reported on other methods for sialic acid protection, such as esterification, permethylation, and amidation, they cause unneglectable sample loss due to transfer of the reaction mix and further purification (Kang et al., 2005; Sekiya et al., 2005). To resolve this problem, we integrated the sialic acid protection in glycoblotting method, utilized by the reagent, 3-methyl-1-p-tolyltriazene (MTT) (Miura et al., 2007) (Fig. 4.3). This reagent can directly methyl esterifies sialic acids trapped on the beads. As a result, quantitative MS analysis can be performed for neutral and acidic N-glycans simultaneously. The methyl esterification protocol can be extended to phosphates by using slightly modified procedure, though this cannot be applied to sulfates. (S-9) The protection of sialic acids is carried out by incubation with 150 mM MTT in dioxane at 60 C to dryness. It usually took 90 min in conventional oven. (S-10) The bead was applied to serial wash with 200 ml of dioxane, water, MeOH, and water again.
2.4. Recovery of oligosaccharides from the beads Both BlotGlyco beads allow recovery of reducing sugars from the beads by mild acid hydrolysis of hydrazone bond and subsequent labeling using conventional fluorescent tags, although detailed protocol depends on the 3-methyl-1-p-tolytriazene HO
OH
HO
O
O
−
O
O
H N R
HO
N
OH
N HO
O
AcHN HO
O
AcHN HO
Figure 4.3 Methyl esterification of sialic acid on the BlotGlyco beads.
OCH3
O
R
116
Maho Amano and Shin-Ichiro Nishimura
type of beads. From BlotGlyco ABC beads, oligosaccharides can be quantitatively released by addition of reductant and the recovered sugars can be directly subjected to MALDI-TOF/MS or HPLC analysis. On the other hand, BlotGlyco H is designed to tag the sugars with desirable labeling reagent carrying aminooxy group by trans-imination in high yield. Taken together, glycoblotting utilized by BlotGlyco beads enables broad applications in sample preparation for wide range of glycomics study (Furukawa et al., 2008). (S-11) The glycans blotted on beads are subjected to the trans-iminization reaction with aoWR (aminooxy-functionalized peptide reagent) for 45 min at 80 C. (S-12) WR-tagged glycans are eluted by adding 100 ml of water. (S-120 , optional) If it is required to remove excess reagents, eluted samples TM can be purified by Mass PREP HILIC mElution Plate (Waters, Milford, MA, USA) as same to manufacturers’ description, although it is recommended to add 1% acetic acid into all of the buffers to prevent forming subproducts, lactone. The purified N-glycans can be five- to 20-fold concentrated by SpeedVac followed by direct dissolution with appropriate matrix and are crystallized. For example, we usually mix 1 ml of 2,5-dihydroxylbenzoic acid (DHB; 10 mg/ml in 30% ACN) for 1 ml of the analytes tagged with N-a-((aminooxy)-acetyl) tryptophanylarginine methyl ester (aoWR), and then they are subjected to MALDI-TOF-MS analysis in reflector, positive ion mode typically summing 1000 shots. The intensity of the isotopic peaks of each glycan is normalized to the internal standard (A2 amide glycan) with known concentration. The glycan structures are speculated using Glycomod Tool (http://br.expasy.org/tools/glycomod/) and GlycoSuite DB (http://glycosuitedb.expasy.org/glycosuite/glycodb).
2.5. Discovery of glycan-related cancer biomarker utilized by glycoblotting In order to explore novel biomarker serum is a good sample, because we can obtain it from large number of subjects by relatively noninvasive way. It is suited for quantitative and large-scale glycomics, if total glycans are recovered in high yield, enabled by glycoblotting method. We have reported normal human serum glycome subjected by glycoblotting method using both type of the beads and observed good reproducibility between them and detected totally 40–50 kinds of N-glycans (Furukawa et al., 2008; Miura et al., 2008) (Fig. 4.4, Table 4.1). In order to demonstrate the eminence of our system in large-scale clinical glycomics, we applied glycoblotting utilized by BlotGlyco ABC and MALDI-TOF/MS analysis to sera from patients suffering from hepatocellular carcinoma (HCC) (83 patients and 20 normal control). Relative areas of all the identified sugar peaks were calculated. When we chose the
117
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
Intens. (a.u.)
× 104 2.5
35
BlotGlyco ABC
2.0 1.5 1.0 0.5
7 1
12
19 20
26 29
38
42
4445
49
0.0 × 104
BlotGlyco H
Intens. (a.u.)
1.5 1.0 0.5 0.0 1500
1750
2000
2250
2500
2750
3000
3250
m/z
Figure 4.4 Comparison of MALDI-TOF/MS spectra of glycans enriched by BlotGlyco ABC and BlotGlyco H. Human serum was subjected to glycoblotting using BlotGlyco ABC beads and BlotGlyco H and sequentially analyzed by MALDI-TOF/ MS. Acceptive reproducibility is observed. Peak numbers are labeled. Observed difference of m/z at each corresponding peak is a result from the distinction of tag.
ratios of every two peaks among the acquired showing significant differences (two-sided t-test, p < 0.001) between HCC and control, sequential forward-selection algorithm finally selected three features that could distinguish HCC from normal controls with 100% accuracy (Miura et al., 2008). In order to be practical at the real clinical field, ‘‘large-scale’’ glycomics should be performed by automated system. As described, very recently we have developed an automated machine for glycoblotting, ‘‘SweetBlot,’’ which is fixed to use optimized protocol for glycoblotting utilized by BlotGlyco H bead, and can analyze 96 samples at once (Fig. 4.5). In most recent protocol, it takes only 11 h, that means, only 7 min is required for one analyte, from aliquot the samples to quantify each glycans. By means of SweetBlot we have obtained the same results on the same samples analyzed above. We have also confirmed the reproducibility of the results by increased number of patients and normal control obtained from distinct organizations (Fig. 4.6). The ratios of every two peaks corresponding to sugars among the acquired provide us very important information to understand mechanism and the treatment of the disease. In some case, glycans set as denominator and numerator can be a competitor each other in N-glycan biosynthesis
118
Maho Amano and Shin-Ichiro Nishimura
Table 4.1 N-glycans derived from human serum by glycoblotting method Peak #
Composition
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42
(Hex)2 þ (Man)3(GlcNAc)2 (HexNAc)2 þ (Man)3(GlcNAc)2 (Hex)3 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)1(dHex)1 þ (Man)3(GlcNAc)2 (HexNAc)2(dHex)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)2 þ (Man)3(GlcNAc)2 (HexNAc)3 þ (Man)3(GlcNAc)2 (Hex)4 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)2(dHex)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2 þ (Man)3(GlcNAc)2 (HexNAc)3(dHex)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3 þ (Man)3(GlcNAc)2 (Hex)5 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)1(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2(dHex)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3(dHex)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3 þ (Man)3(GlcNAc)2 (Hex)6 þ (Man)3(GlcNAc)2 (Hex)3(HexNac)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)2(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2(NeuAc)1þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3(dHex)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3(dHex)2 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)4 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3(dHex)2(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)1(HexNAc)3(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)3(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)4(dHex)1 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)2(dHex)1(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)3(dHex)1(NeuAc)1 þ (Man)3(GlcNAc)2 (Hex)2(HexNAc)3(dHex)1(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)3(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(NeuAc)1 þ (Man)3(GlcNAc)2
119
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
Table 4.1 (continued) Peak #
Composition
43 44 45 46 47 48 49 50
(Hex)3(HexNAc)3(dHex)1(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)3(NeuAc)3 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(NeuAc)2 þ (Man)3(GlcNAc)2 (Hex)3(HexNAc)3(dHex)1(NeuAc)3 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(NeuAc)3 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(dHex)1(NeuAc)3 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(NeuAc)4 þ (Man)3(GlcNAc)2 (Hex)4(HexNAc)4(dHex)1(NeuAc)4 þ (Man)3(GlcNAc)2
A
8-channel nozzle head Arm to carry the plate
Ultrasonic cleaning unit
B Target plate for MALDI-TOF/MS
Thermal cycler-type incubator
Spotting the sample onto the plate
Pretreatment
Reaction plate
Sample cooler
Glycoblotting
Recover/De-salting Wash/chemical reaction
Vacuum manifold
Figure 4.5 Picture of SweetBlot. (A) Appearance of the machine. (B) Inside of the machine. Samples are set at sample cooler at first and then are aliquoted into reaction plate automatically. Reagents used for pretreatment and glycoblotting are also set there. After addition of the first reagents carrying arm moves to reaction plate into thermal cycler-type incubator, reaction then starts. At final, of all the procedure released glycans are mixed with matrix and spotted onto MALDI-TOF/MS target.
pathway in the body. For example, Fig. 4.7 showed us that HCC prefers to add bisecting GlcNAc compared to galactose, a significant diverge tendency of biosynthesis pathway. Only quantitative and comprehensive glycomics
120
Maho Amano and Shin-Ichiro Nishimura
b1,2
a1,6 b1,4 b1,4 b1,0
a1,6 b1,4 b1,4 b1, 0 b1,2
a1,3 a1,3
F-test = 2.5973 ×10–44 t-test = 3.4065 ×10–7 U-test = 1.2966 ×10–18 True positive rate
6
4
2
1.0
7.69
0.8
6.15
0.6
4.61
0.4
3.07
0.2
1.54
0.0
0 Control
0 0.0
HCC
0.2
0.4 0.6 0.8 False positive rate AUC = 0.957
1.0
Figure 4.6 Box-plot expression and ROC curve of the selected feature which distinguished HCC and control significantly at the first study (Miura et al., 2008) was reexamined, by using new protocol on the basis of BlotGlyco H, for newly obtained samples from different organization.
b1,2
a1,6 a1,6
b1,4 b1,4
b1,4
b1,2 b1,2
2.0
b1,4
b1,0
b1,0 a1,3
a1,3
F-test = 1.7417e-80 t-test = 2.5666e-19 True positive rate
U-test = 4.3689e-33 1.5 1.0 0.5
1.0
2.28
0.8
1.83
0.6
1.38
0.4
0.93
0.2
0.48
0.0
0.0 Control
HCC
0.04 0.0
0.2
0.4 0.6 0.8 False positive rate AUC = 0.998
1.0
Figure 4.7 Box-plot expression and ROC curve of the selected feature. This feature is composed by two glycans located in competitive biosynthesis pathway each other.
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
121
makes it possible to perform such statistical analysis on clinical glycobiology and pioneer definitive biomarker for diagnosis and treatment based on its pathology.
2.6. Monitoring mouse ES cell differentiation by N-glycomics utilized by glycoblotting As described repeatedly, glycoblotting is able to be used for cellular glycomics. We note that the present protocol is readily feasible for any type of mammalian cells and the efficiency of glycoblotting is not dependent on cell type when the required cell numbers (e.g., confluence on a 6 cm dish; approximately 5 106 cells) can be prepared (Amano et al., 2010). Therefore, this method is a powerful tool to obtain information of relationship between specific glycoform and character of individual cancer cells, such as malignancy or resistance to chemicals. Thus, glycoblotting can totally support for consummating cancer research from the view of glycobiology. Not only in cancer but in the stem cell biology glycoblotting is expected to be required. Glycosphingolipids such as SSEA-3 and SSEA-4, both are classified as a subtype of ‘‘globoseries,’’ have been commonly utilized as a marker for identification of ES cells (Lanctot et al., 2007). Sialic acidcontaining glycans have been reported as a potential biomarker of tumor malignancy (Varki and Varki, 2007). These reports might suggest that there is a significant ‘‘threshold’’ or ‘‘critical point’’ in the expression level of the key N-glycan subtypes against cell surface area to initiate this dynamic cellular differentiation. Therefore, it can be possible that real-time monitoring of cellular N-glycome in the course of differentiation and proliferation can allow for the identification of cells in interest and assessment of the quality of individual stem cells and differentiated cells. We subjected mouse ES cells (n ¼ 3) in individual differentiating stage to N-glycomics based on glycoblotting utilized by BlotGlyco H. Figure 4.8 is MALDI-TOF/MS spectra of N-glycans from mouse ES cells in each stage. In order to facilitate quantitative N-glycan profiling analysis, the expression level of individual N-glycans should be normalized by contained internal standard (calculation is exactly the same to that in case of serum), and represented by using a standardized unit (pmol/200 mg cellular proteins). Glycoform significantly changed in mouse ES cells through neural differentiation was apparent as demonstrated in glycotyping analysis on cells in each stage (Fig. 4.9). This result indicates the importance of the stage-specific embryonic glycotype-bisecting (BS) as new class biomarkers for identifying and monitoring processes of mouse ES cell differentiation into neural cells, though the effect of feeder cells and other various factors of individual culture conditions used on the ratio of glycotypes must be examined carefully.
122
Maho Amano and Shin-Ichiro Nishimura
Internal standard
Es cells
Neuron stem sphere
Neuron stem cell
Neuron (day 1)
Neuron (day 3)
Neuron (day 7)
Bar = 100 mm
1000
1200
1400
1600
1800
2000 m/z
2200
2400
2600
2800
Figure 4.8 MALDI-TOF/MS spectra of N-glycans from mouse ES cells during differentiation, enriched by glycoblotting.
We should set a goal to compare and accumulate a database of whole N-glycans expression levels of feasible human ES cell and iPS cell lines established by different labs and to make these resources readily available to the scientific community as soon as possible.
2.7. Potential applications for O-glycomics and glycosphingolipidomics Glycoblotting method is also applicable to O-glycomics and glycosphingolipidomics. We have established a standard protocol of glycoblotting-based O-glycomics for glycoproteins and glycosphingolipids (GSL) (Miura et al., submitted for publication; Nagahori et al., 2009). For former case, glycoblotting is carried out in combination with nonenzymatic chemical treatment to release reducing O-glycans predominantly from various glycoprotein samples. To apply GSL analysis, chemoselective approach is applicable as well to use of endo-type glycoceramidase, an enzyme which release sugars from GSLs. Unsaturated bond in ceramide moiety is selectively oxidized to form aldehydes by means of ozonolysis, then subsequently subjected to glycoblotting onto BlotGlyco beads. Besides structural
123
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
(10% BS, 7)
(45% HM, 8) Neural stem sphere (53.7 pmol) (5% BS, 2) (61% HM, 5) Neuron stem cell (51.2 pmol)
(45% others, 25)
(9% BS, 4)
(34% others, 18)
(56% HM, 7) Neuron day 1 (65.8 pmol)
(15% BS, 6)
(45% others, 21)
(46% HM, 8)
Neuron day 3 (80.7 pmol) (14% BS, 6) (40% HM, 8)
(39% others, 20)
Neuron day 7 (94.9 pmol) (46% others, 24)
Figure 4.9 Barcoding (glycotyping) analysis of mouse ES cells differentiated to neural cells. HM, high-mannose type; BS, bisecting type; Others, other type of glycans. The size of individual pie express total amount of N-glycan.
determination of O-glycans, MALDI-TOF/MS analysis can provide information of acyl chain in ceramide (Nagahori et al., 2009).
2.8. The concept of reverse glycoblotting and GFRG Discovery of unique glycans or glycoforms, provided by glycoblotting method, should lead into the next knowledge of function of carrier glycoproteins and host’s phenotype. In reverse glycoblotting technique, glycans in interest are considered as a tag, which can be enriched onto BlotGlyco bead by means of chemical ligation, and then sequentially applied to MS analysis. This method allows us to perform focused glycoproteomics to identify the proteins carrying the ‘‘tag,’’ namely, glycans in interest. Until now, we have reported the methodology to enrich glycopeptides bearing sialic acid that is one of the most important glycans for humans (Kurogochi et al., 2007, 2010) and galactose in nonreducing terminal (Shimaoka et al., 2007). In this approach, we are tripping back the central dogma, from posttranslational modification (glycome) to proteins (proteomics) and genes (genome). This is the concept of GFRG, which enables a reasonable proteomics/genomics focused on unique glycans in individual states, expected to provide crossing ‘‘-omics’’ information to be applied in basic biology and clinical medicine, although technical improvement is needed.
124
Maho Amano and Shin-Ichiro Nishimura
REFERENCES Amano, M., Yamaguchi, M., Takegawa, Y., Yamashita, T., Terashima, M., Furukawa, J.-i., Miura, Y., Shinohara, Y., Iwasaki, N., Minami, A., and Nishimura, S.-I. (2010). Threshold in stage-specific embryonic glycotypes uncovered by a full portrait of dynamic N-glycan expression during cell differentiation. Mol. Cell. Proteomics 9, 523–537. Chan, E. M., Ratanasirintrawoot, S., Park, I.-H., Manos, P. D., Loh, Y.-H., Huo, H., Miller, J. D., Hartung, O., Rho, J., Ince, T. A., Daley, G. Q., and Schlaeger, T. M. (2009). Live cell imaging distinguishes bona fide human iPScells from partially reprogrammed cells. Nat. Biotechnol. 27, 1033–1038. Furukawa, J.-i., Shinohara, Y., Kuramoto, H., Miura, Y., Shimaoka, H., Kurogochi, M., Nakano, M., and Nishimura, S.-I. (2008). Comprehensive approach to structural and functional glycomics based on chemoselective glycoblotting and sequential tag conversion. Anal. Chem. 80, 1094–1101. Gala´n, A., and Simo´n, C. (2010). Monitoring stemness in long-term hESC cultures by realtime PCR. Methods Mol. Biol. 584, 135–150. Kang, P., Mechref, Y., Klouckova, I., and Novotny, M. V. (2005). Solid-phase permethylation of glycans for mass spectrometric analysis. Rapid Commun. Mass Spectrom. 19, 3421–3428. Kita, Y., Miura, Y., Furukawa, J.-i., Nakano, M., Shinohara, Y., Ohno, M., Takimoto, A., and Nishimura, S.-I. (2007). Quantitative glycomics of human whole serum glycoproteins based on the standardized protocol for liberating N-glycans. Mol. Cell. Proteomics 6, 1437–1445. Kurogochi, M., Amano, M., Fumoto, M., Takimoto, A., Kondo, H., and Nishimura, S.-I. (2007). Reverse glycoblotting allows rapid-enrichment glycoproteomics of biopharmaceuticals and disease-related biomarkers. Angew. Chem. Int. Ed. 46, 8808–8813. Kurogochi, M., Matsushita, T., Amano, M., Furukawa, J-i., Shinohara, Y., Aoshima, M., and Nishimura, S.-I. (2010). Sialic acid-focused quantitative mouse serum glycoproteomics by multiple reaction monitoring assay. Mol. Cell. Proteomics. (in press). Kyselova, Z., Mechref, Y., Al Bataineh, M. M., Dobrolecki, L. E., Hickey, R. J., Vinson, J., Sweeney, C. J., and Novotny, M. V. (2007). Alterations in the serum glycome due to metastatic prostate cancer. J. Proteome Res. 6, 1822–1832. Lanctot, P. M., Gage, F. H., and Varki, A. P. (2007). The glycans of stem cells. Curr. Opin. Chem. Biol. 11, 373–380. Miura, Y., Shinohara, Y., Furukawa, J.-i., Nagahori, N., and Nishimura, S.-I. (2007). Rapid and simple solid-phase esterification of sialic acid residues for quantitative glycomics by mass spectrometry. Chem. Eur. J. 13, 4797–4804. Miura, Y., Hato, M., Shinohara, Y., Kuramoto, H., Furukawa, J.-i., Kurogochi, M., Shimaoka, H., Tada, M., Nakanishi, K., Ozaki, M., Todo, S., and Nishimura, S.-I. (2008). BlotGlycoABCTM, an integrated glycoblotting technique for rapid and large scale clinical glycomics. Mol. Cell. Proteomics 7, 370–377. Nagahori, N., Abe, M., and Nishimura, S.-I. (2009). Structural and functional glycosphingolipidomics by glycoblotting with an aminooxy-functionalized gold nanoparticle. Biochemistry 48, 583–594. Nakagawa, H., Hato, M., Takegawa, Y., Deguchi, K., Ito, H., Takahata, M., Iwasaki, N., Minami, A., and Nishimura, S.-I. (2007). Detection of altered N-glycan profiles in whole serum from rheumatoid arthritis patients. J. Chromatogr. B 853, 133–137. Niikura, K., Kamitani, R., Kurogochi, M., Uematsu, R., Shinohara, Y., Nakagawa, H., Deguchi, K., Monde, K., Kondo, H., and Nishimuram, S.-I. (2005). Versatile glycoblotting nanoparticles for high-throughput protein glycomics. Chem. Eur. J. 11, 3825–3834.
Large-Scale Glycomics by Glycoblotting and Mass Spectrometry
125
Nishimuara, S.-I., Niikura, K., Kurogochi, M., Matsushita, T., Fumoto, M., Hinou, H., Kamitani, R., Nakagawa, H., Deguchi, K., Miura, N., Monde, K., and Kondo, H. (2005). High-throughput protein glycomics: Combined use of chemoselective glycoblotting and MALDI-TOF/TOF mass spectrometry. Angew. Chem. Int. Ed. 44, 91–96. Robinson, B. (1969). Recent studies on the Fischer indole synthesis. Chem. Rev. 69, 227–250. Sakurada, K., McDonald, F. M., and Shimada, F. (2008). Regenerative medicine and stem cell based drug discovery. Angew. Chem. Int. Ed. 47, 5718–5738. Sekiya, S., Wada, Y., and Tanaka, K. (2005). Derivatization for stabilizing sialic acids in MALDI-MS. Anal. Chem. 77, 4962–4968. Shimaoka, H., Kuramoto, H., Furukawa, J.-i., Miura, Y., Kurogochi, M., Kita, Y., Hinou, H., Shinohara, Y., and Nishimura, S.-I. (2007). One-pot solid-phase glycoblotting and probing by transoximization for high-throughput glycomics and glycoproteomics. Chem. Eur. J. 13, 1664–1673. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872. Varki, N. M., and Varki, A. (2007). Diversity in cell surface sialic acid presentations: Implications for biology and disease. Lab. Invest. 87, 851–857. Yosizawa, Z., Sato, T., and Schmid, K. (1966). Hydrazinolysis of a1-acid glycoprotein. Biochim. Biophys. Acta 121, 417–419.
C H A P T E R
F I V E
In Vitro and In Vivo Enzymatic Syntheses and Mass Spectrometric Database for N-Glycans and O-Glycans Hiromi Ito, Yasunori Chiba, Akihiko Kameyama, Takashi Sato, and Hisashi Narimatsu Contents 1. Overview 2. In Vitro Syntheses of N- and O-Linked Glycan Libraries Using Recombinant Human Glycosyltransferases 2.1. Materials and equipment 2.2. Preparation of recombinant human enzymes 2.3. Preparation and purification of PA-labeled N-linked glycan library 2.4. Construction of O-linked glycopeptide library 2.5. Conversion of O-linked glycopeptide library to O-linked glycan library 2.6. Esterification of sialylated N- and O-linked glycans for MSn spectra library 3. In Vivo Production of Mammalian-Type O-Linked Glycopeptides in Yeast 3.1. Materials and equipment 3.2. Yeast transformation 3.3. Expression and purification of MUC1a-6xHis peptide 4. An Application of the Library to Glycan Analysis 4.1. Construction of an observed tandem mass spectral database 5. Glycan Analysis Using the Glycan Mass Spectral Database ‘‘GMDB’’ 5.1. CID spectra acquisition 5.2. How to use the GMDB 6. Navigator System for Glycan Analysis Using the Glycan Mass Spectral Database Acknowledgment References
128 129 130 131 133 134 135 136 136 136 137 139 141 142 143 143 143 146 148 148
Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Open Space Laboratory C-2, Umezono, Tsukuba, Ibaraki, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78005-8
#
2010 Elsevier Inc. All rights reserved.
127
128
Hiromi Ito et al.
Abstract In the GlycoGene Project, we have comprehensively cloned novel human genes associated with the synthesis of glycans using bioinformatics technology. Recombinant glycosyltransferases can be expressed in various expression systems. Diverse glycan structures are easily and rapidly achieved using these glycosyltransferases in vitro. Additionally, we have developed an in vivo production system for mammalian mucin-type glycopeptides using a genetically engineered yeast strain. This system enables the generation of glycopeptides which are O-glycosylated on a specific position by introducing different types of ppGalNAc-T genes. As an application of the glycan and glycopeptide libraries to glycan analysis, we have constructed a multistage tandem mass (MSn) spectral database containing observed MSn spectra. Using the MSn spectral database, it is possible to identify glycan structures very easily and rapidly by spectral matching.
1. Overview Glycans attached to proteins and sphingolipids are ubiquitous in biological systems, and are involved in important functions such as inflammation, the immunological response, metastasis, and bacterial and viral infection. Biological functions of glycoconjugates and biomedical applications of glycans have become subjects of the attention of researchers. However, progress in understanding how structure and function are correlated with biological activities of glycans has been slow, because obtaining homogeneous glycans for biochemical studies is difficult. Therefore, the development of synthetic methods to make authentic glycoconjugates more readily available is necessary and libraries of the synthetic glycans and glycopeptides are essential to the development of carbohydrate-based research. For the preparation of glycans and glycopeptides, enzymatic approaches employing glycosyltransferases or engineered whole cells are powerful alternatives to chemical methods. In particular, the incorporation of recombinant glycosyltransferases into synthetic protocols makes significant shortening of preparation times possible in achieving various glycan structures. This is because extensions of glycan structures are readily accomplished by sequential addition of each enzyme and the corresponding donor substrate. We have constructed a public database of human glycogenes including glycosyltransferases, sulfotransferases, and sugar-nucleotide transporters (GGDB: http://riodb.ibase.aist.go.jp/rcmg/ggdb/), many of which have been cloned and expressed in various expression systems (Narimatsu, 2004; Taniguchi et al., 2001). Therefore, a large variety of structurally defined glycans (e.g., N- and O-linked glycans and glycolipid glycans) have been synthesized with the help of these recombinant glycosyltransferases
In Vitro and In Vivo Enzymatic Syntheses
129
(Ito et al., 2005). On the other hand, in vivo production is a rapidly emerging method for large-scale and low-cost generation of glycans and glycopeptides. We have recently developed a novel system for in vivo production of mammalian glycopeptides having mucin-type O-linked glycans (e.g., Tn and core1 structures), using a genetically engineered yeast strain (Amano et al., 2008). In addition, this yeast system is able to produce standard glycopeptides in which the sites and the numbers of O-glycosylations are regulated, by selecting and introducing different types of ppGalNAc-T genes. Thus, we have achieved the in vitro and in vivo syntheses of glycans and glycopeptides using enzymatic approaches. A large variety of structurally defined oligosaccharides and glycopeptides can be useful as standards in developing the means for structural analysis of glycans using mass spectrometry (MS). A major difficulty in analyzing glycan structure using MS is how to generate specific information from MSn analyses and how to interpret the structures of the resultant fragment ions. To overcome these problems, we have constructed a glycan mass spectral database (GMDB: http://riodbdev.ibase.aist.go.jp/rcmg/glycodb/ Ms_ResultSearch) which stores observed MSn spectra (i.e., MS2, MS3, and MS4 spectra) of authentic glycans (e.g., N- and O-linked glycans and glycolipid glycans). Therefore, GMDB enables identification of glycan structures very easily and rapidly by spectral matching, without the need for detailed assignments of each fragment ion.
2. In Vitro Syntheses of N- and O-Linked Glycan Libraries Using Recombinant Human Glycosyltransferases Enzymatic synthesis is a rapid and straightforward method for construction of diverse structures, compared with chemical synthesis. In the past few years, approximately 180 glycogenes, encoding glycosyltransferases, sulfotransferases, and sugar-nucleotide transporters, have been cloned (Narimatsu, 2004; Taniguchi et al., 2001). We have constructed a human glycogene library (i.e., glycosyltransferases, sulfotransferases, and sugar-nucleotide transporters) using the GATEWAYTM system. This is a convenient system for expressing proteins encoded by genes introduced into this vector; the relevant target expression systems would include Escherichia coli, yeast, insect cells, and mammalian cells. Therefore, it is possible to prepare N- and O-linked glycan libraries containing a large variety of glycan structures using glycosyltransferases which are expressed in human embryonic kidney (HEK) 293T cells. To date, we have succeeded in synthesizing various structures: approximately 300 types of O-linked glycans and 50 types of both N-linked glycans and
130
Hiromi Ito et al.
glycolipid glycans in vitro. In synthesis of the N-linked glycan library, complex-type N-linked glycans have multiantennary structures with the same sugar sequence such as GlcNAc and LacNAc at the nonreducing terminus. Since glycosylation of N-linked glycans may generate positional isomers, it is necessary to separate the positional isomers obtained, after each enzyme reaction. Therefore, we select the starting substrates, which are derivatized by reducing end tagging (e.g., 2-aminopyridine (PA) and 2-aminobenzamide (AB)) which can be used for fluorescence detection in high-performance liquid chromatography (HPLC) (Bigge et al., 1995; Hase, 1994). In the synthesis of the O-linked glycan library, we have developed a method for the construction of molecular weight-tagged libraries (Ito et al., 2005). By repeating incomplete glycosyltransferase reactions, that is, by terminating each reaction halfway in a single tube in order to rapidly and readily achieve a diversity of glycan structures, it is possible to construct a library which has theoretically 2n (n is the number of reaction steps) glycan structures in a single tube. These libraries are designed as molecular weight-tagged libraries, that is, each product in a tube has a different molecular weight. Accordingly, the structure of each component in the library can be identified immediately using MS.
2.1. Materials and equipment Expression system: HEK 293T cells KOD-plus-polymerase (TOYOBO) pFLAG-CMVTM-3 Expression Vector (Sigma-Aldrich) LIPOFECTAMINE 2000 Reagent (Invitrogen) ANTI-FLAGÒ M2 Agarose Affinity Gel (Sigma-Aldrich) FLAGÒ tagged bacterial alkaline phosphatase (FLAGÒ BAP; SigmaAldrich) 50 mM Tris-buffered saline (TBS): 50 mM Tris–HCl (pH 7.4) and 150 mM NaCl prepared in Milli-Q water Sugar nucleotide (CMP-Neu5Ac, UDP-GlcNAc, GDP-Fuc, UDP-Gal, and UDP-GalNAc; Sigma-Aldrich) is prepared at an appropriate concentration in Milli-Q water and stored frozen The basic reaction mixture: 25 mM HEPES buffer (pH 7.0) and 10 mM MnCl2 Reversed-phase column for HPLC: PALPAK Type R column (4.6 250 mm, 5 mm; Takara Bio) Solvent A: 10 mM ammonium acetate (pH 4.0) in Milli-Q water Solvent B: 10 mM ammonium acetate (pH 4.0) in 10% acetonitrile (v/v) Carboxyfluorescein (FAM)-labeled Muc1a tandem repeat peptide (FAMAHGVTSAPDTR) is prepared by custom peptide synthesis Calibrant solution: Peptide calibration standard II (Bruker Daltonics) in 200 mL of 0.1% TFA in 25% acetonitrile
In Vitro and In Vivo Enzymatic Syntheses
131
Matrix solution: 10 mg/mL of 2,5-dihydroxybenzoic acid (2,5-DHB, proteomics grade; Wako) in 30% ethanol Sodium borohydride (NaBH4; Wako) Sodium hydroxide pellets (NaOH; Wako) Acetic acid (LC/MS grade; Wako) Trifluoroacetic acid (HPLC grade; Wako) Lithium acetate (Wako) Iodomethane (MeI; Wako) Dimethyl sulfoxide (DMSO, 1Pure; Wako) Reversed-phase solid-phase extraction (SPE) cartridge: ZipTip C18 (Millipore), Sep-Pak C18 (50 mg/1 mL; Waters) and Oasis HLB (10 mg/1 mL; Waters) Cation-exchange SPE cartridge: Oasis MCX (30 mg/1 mL; Waters) Porous graphitized carbon (PGC; Alltech Associates)
2.2. Preparation of recombinant human enzymes Recombinant human glycosyltransferases are expressed in HEK 293T cells as soluble enzymes. Cloning and expression of glycosyltransferases use the GATEWAYTM system (Invitrogen), which is a convenient system for expressing proteins encoded by genes introduced into this vector and for investigation of suitable expression systems (Ito et al., 2007). The DNA fragment encoding the catalytic domain of human glycosyltransferase is amplified by KOD-plus-polymerase (TOYOBO) using each primer set shown in Table 5.1 and inserted into pENTR/D-TOPO (Invitrogen) to construct the GATEWAYTM entry clone. Each entry clone is then used in the LR reaction to transfer the gene into the mammalian expression vector, pFLAG-CMV3-DEST, which is constructed using pFLAG-CMVTM-3 (Sigma-Aldrich) and the GATEWAYTM vector conversion system (Invitrogen). Each resulting plasmid is transfected into HEK 293T cells using LIPOFECTAMINE 2000 (Invitrogen) according to the manufacturer’s instructions to produce soluble recombinant human glycosyltransferase with an N-terminal FLAG tag. After 48 h incubation at 37 C, each enzyme is purified from culture medium using an anti-FLAG M2 agarose affinity gel (Sigma-Aldrich). A 10–50 mL volume of culture medium is mixed with anti-FLAG M2 agarose affinity gel and rotated slowly at 4 C overnight. The gel is then washed two to five times with 50 mM Tris buffered saline and finally suspended in 100 mL of TBS. The yield of purified glycosyltransferase is estimated by Western blotting analysis, compared to that of FLAG-tagged bacterial alkaline phosphatase (Sigma-Aldrich). Enzymatic reactions of all recombinant glycosyltransferases are performed using the agarose suspension as enzyme source.
Table 5.1 List of glycosyltransferases
Enzyme
1 b1,4GalNAcT 2 a1,2Fuc-T 3 a1,3Fuc-T 4 a1,3Fuc-T 5 a2,6Sia-T 6 a1,3Gal-T
Gene
Catalytic domain (aa)
Fwd primer (5’–3’)
B4GALNT3
57–999
caccAGGTACGGCAGCTGGAGAGAAC CTACAGCGTCTTCATCTGGCGA
FUT2 FUT4 FUT6 ST6GALNAC1 A3GALT (ABO)
31–343 55–405 37–359 38–600 43–354
caccCGGCTAGCGAAGATTCAAGCCA caccTGGGCGTCGCCAACCCCGTCGC caccTCTCAAGACGATCCCACTGTGT caccCCTCAAACAAAGCCTTCCAGGC caccATGCCAGGAAGCCTGGAACGGG
Rev primer (5’–3’)
TTAGTGCTTGAGTAAGGGGGAC TCACCGCTCGAACCAGCTGGCC TCAGGTGAACCAAGCCGCTATG TCAGTTCTTGGCTTTGGCAGTT TCACGGGTTCCGGACCGCCTGG
133
In Vitro and In Vivo Enzymatic Syntheses
2.3. Preparation and purification of PA-labeled N-linked glycan library The reaction mixture (20–50 mL) contains 25 mM HEPES buffer (pH 7.0), 10 mM MnCl2, PA-labeled N-linked glycan as an acceptor substrate (1; Fig. 5.1), and an appropriate concentration of UDP-GalNAc. A purified b4GalNAc-T3 solution is added to the reaction mixture and incubated at 37 C. The reaction is monitored using matrix-assisted laser-desorption/ ionization time-of-flight mass spectrometry (MALDI-TOF MS: ReflexIV; Bruker-Daltonics) by directly applying the reaction solution to the target plate. The enzyme reaction is stopped by heating before the starting substrate is perglycosylated. The GalNAc-transferred products (2–4; two mono- and one diglycosylated product) are separated and purified using HPLC. The purified di-GalNAc-transferred product (4; Fig. 5.1) and FUT4 are added to the basic reaction mixture containing an appropriate concentration of GDP-Fuc for fucosylation. After incubation at 37 C, the reaction is monitored using MS and stopped by heating before going to completion. The a1,3-fucosylated products (5–7; Fig. 5.1) are separated using HPLC. The a1,2- and a1,3-fucosylation products of PA-labeled biantennary N-linked glycans (8; Fig. 5.1) are synthesized by FUT2 and FUT6, respectively. b 4GalNAc-T3 PA
PA
1
2
PA
FUT4
PA 3
PA
5
4
PA 4
PA
6
PA
PA
7
PA
PA
FUT2 9
10
11
PA 8
FUT6 PA
12
GalNAc
Gal
GlcNAc
PA
13
Man
PA
14
Fuc PA Pyridylamino
Figure 5.1 Examples of preparation of a PA-labeled N-linked glycan containing isomeric structures.
134
Hiromi Ito et al.
Each fucosylation reaction is monitored by MS and stopped before going to completion, in the same way. The mono-and difucosylated products (9–14; Fig. 5.1) are separated using HPLC. For monitoring of each enzyme reaction using MS, approximately 0.1 mL of reaction solution is deposited on the stainless steel MALDI target plate and allowed to air dry. Then, 0.5–1 mL of matrix solution (10 mg of 2,5-DHB dissolved in 1 mL of 30% ethanol) is used to cover the sample on the target plate and air dried. MS spectra of the reaction mixture are acquired in the positive mode. For separation and purification using HPLC, each enzyme reaction mixture is filtered through an Ultrafree-MC column (Millipore) in order to remove the immobilized recombinant enzyme. The filtrate is subjected to reversed-phase HPLC on a PALPAK Type R column (4.6 250 mm; Takara Bio). The mobile phases are 10 mM ammonium acetate (pH 4.0) with Milli-Q water (solvent A) and 10% acetonitrile (solvent B). The products are eluted with a linear gradient ranging from 5% to 15% of solvent B in solvent A at a flow rate of 1 mL/min for 60 min at 40 C. Eluted products are detected by the fluorescence intensity at 400 nm (excitation, 320 nm) with a fluorescence detector, RF-10AXL (Shimadzu).
2.4. Construction of O-linked glycopeptide library As an example, elongation of the carbohydrate chain from a starting O-linked glycopeptide (1; Fig. 5.2) is achieved by sequential addition of each enzyme (ST6GalNAcI, FUT2, and a3GalT) and their respective donor substrates (CMP-Neu5Ac, GDP-Fuc, and UDP-Gal) to a single tube (Fig. 5.2). Each reaction is monitored using MALDI-TOF MS (ReflexIV; Bruker-Daltonics) by directly applying the reaction solution to the target plate, and the reaction is stopped at around a 50% yield by inactivating the enzyme. The detailed procedures of the synthesis of O-linked glycopeptides are as follows. The reaction mixture (20–50 mL) contains 25 mM HEPES buffer (pH 7.0), 10 mM MnCl2, CMP-Neu5Ac, glycopeptide with Galb1-3GlcNAcb13GalNAca1- on the FAM-labeled MUC1a tandem repeat peptide (FAMAHGVTSAPDTR), and purified ST6GalNAcI. After incubation at 37 C, enzyme is inactivated at 100 C for 5 min. Next, an appropriate concentration of GDP-Fuc and the purified FUT2 are added to the reaction solution. The reaction solution is incubated at 37 C and then heated at 100 C for 5 min. UDP-Gal and the purified a3GalT are then added to the reaction mixture, which is incubated at 37 C for 3 h and the reaction is then stopped by heating. Each enzyme reaction is monitored using MS by directly applying the reaction solution to the target plate. Finally, the resulting mixture is filtered through an Ultrafree-MC column (Millipore), and the glycopeptides are then purified with a reversed-phase SPE cartridge (e.g., ZipTip C18 (Millipore), Sep-Pak C18 and Oasis HLB (Waters)).
135
In Vitro and In Vivo Enzymatic Syntheses
Synthesized glycopeptide structures
Observed m/z + [M + H] 2038.285
1
2184.368 2
2329.438
1
ST6GalNAcI
FUT2
a3GalT
CMP-NeuAc
GDP-Fuc
UDP-Gal
3
2346.454 4 Gal GalNAc GlcNAc
2475.520 5
Fuc Neu5Ac FAM-labeled Muc1a peptide
2637.616 6
Figure 5.2 Construction of a molecular weight-tagged library. Extension of O-linked glycopeptide library including B antigen structures and the observed m/z values in MALDI-TOF mass spectrum of the prepared library.
2.5. Conversion of O-linked glycopeptide library to O-linked glycan library The desalted O-linked glycopeptides are purified using a reverse-phase SPE cartridge Oasis HLB (10 mg/mL; Waters) and then subjected to reduction. 20–50 mL of 500 mM NaBH4 in 50 mM NaOH are applied to each purified O-linked glycopeptide mixture and incubated at 45–50 C overnight. The reaction solution is neutralized by adding 1–2.5 mL of acetic acid (LC/MS grade; Wako). The released and reduced O-linked glycans are desalted using a cation-exchange SPE cartridge Oasis MCX (30 mg/1 mL; Waters). Alditols are eluted with 500 mL of distilled water and dried with a Speed-Vac. The remaining borate is removed by the addition of 50–100 mL of 1% acetic acid in methanol and drying in a Speed-Vac several times. The additional purification procedure for acquiring MSn spectra is as follows. A homemade microcolumn is packed with 20 mL of porous graphitized carbon (PGC; Alltech Associates) onto the top of a SPE C-TIP (200 mL; Nikkyo Technos). The microcolumn is washed and equilibrated with 100 mL of 0.1% TFA in 50% aqueous acetonitrile, 0.1% TFA in 95% aqueous acetonitrile, and distilled water, prior to loading the samples. The desalted O-linked glycan alditols are redissolved in 20 mL of distilled water and applied to the pretreated microcolumn. Salts are removed by washing with 200 mL of distilled water, followed by elution of alditols with 200 mL of 0.1% TFA in 50% aqueous acetonitrile and dried with a Speed-Vac.
136
Hiromi Ito et al.
2.6. Esterification of sialylated N- and O-linked glycans for MSn spectra library Esterification of sialylated N- and O-linked glycans is performed using the following procedure. To the released O-linked glycan alditols are added 10 mL of 50 mM lithium acetate. After incubation at 25 C for 2 h, the reaction solution is dried with a Speed-Vac. To the dried sample is added 20 mL of 500 mM iodomethane (Wako) in DMSO (1Pure; Wako) and the mixture is incubated at 25 C for 4 h in the dark. Excess iodomethane in the reaction solution is removed under a gentle stream of nitrogen and the resulting solution is dried with a Speed-Vac. Using a homemade microcolumn packed with 20 mL of PGC (Alltech Associates) onto the top of a SPE C-TIP (200 mL; Nikkyo Technos), the esterified samples are desalted, eluted with 200 mL of 50% aqueous acetonitrile and dried with a Speed-Vac.
3. In Vivo Production of Mammalian-Type O-Linked Glycopeptides in Yeast Extracellular proteins and membrane proteins on the surface of mammalian cells are O-glycosylated, where the GalNAc modification attached to serine (Ser) or threonine (Thr) in the protein chain by an alpha-glycosidic linkage is commonly observed (Hollingsworth and Swanson, 2004). This modification is catalyzed by a family of almost 20 different UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferases (ppGalNAc-T) (Clausen and Bennett, 1996; Narimatsu, 2004; Tarp and Clausen, 2008; Ten Hagen et al., 2003). Analysis of O-glycosylation of a protein is complicated because the defined consensus sequence for O-glycosylation has yet to be revealed. O-GalNAc modification is often found clustered in the Ser/Thrrich domains of proteins, such as the mucins (Perez-Vilar and Hill, 1999), which are resistant to digestion by proteases. This may cause many difficulties in the analysis of O-glycosylation attachment sites in the protein sequence and the type and size of the oligosaccharide portion. Therefore, authentic samples with O-GalNAc modification will help the analysis of glycopeptides by MS. We have developed a genetically engineered yeast strain capable of producing mucin-type sugar chains (Amano et al., 2008). This yeast system is able to produce glycopeptides modified at different glycosylation sites by introducing different types of ppGalNAc-T genes at a reasonably low cost. Here, we present a method for production of a glycopeptide in which a specific position is modified with O-GalNAc.
3.1. Materials and equipment Autoclaved Milli-Q water YPDA Medium (Clontech)
In Vitro and In Vivo Enzymatic Syntheses
137
Minimal SD Agar Base (Clontech) DO Supplement (Clontech) Lithium acetate Polyethylene glycol, #3350-4000 Dithiothreitol Plasmid DNA (see Table 5.1). The listed vectors are available from the authors through a Material Transfer Agreement for specified academic research not sponsored by companies. Restriction enzymes: EcoRV, NheI (Takara Bio) Gel extraction kit (e.g., WizardÒ SV Gel and PCR Clean-Up System from Promega) Colony PCR solution (e.g., GoTaqÒ Master Mix from Promega) 1 M potassium monophosphate 1 M potassium diphosphate TALON Metal Affinity Resin (Clontech) Imidazol NaCl 5C18-ARII column (Nacalai Tesque) Acetonitrile Trifluoroacetic acid Autoclave Baffled shake flask, 500 mL Refrigerated centrifuge (Hitachi) High-speed refrigerated microcentrifuge Microcentrifuge tubes Falcon 15-mL conical tubes (BD) Falcon 50-mL conical tubes (BD) Incubator shaker at 30 C Oven at 30 C Oven at 37 C Vortex Speed-Vac Disposable column HPLC apparatus
3.2. Yeast transformation Yeast integration pRS vectors were obtained from Stratagene (now discontinued). All expression vectors are prepared from cultures of E. coli DH5a using the plasmid purification kit from Qiagen or Promega. The concentration is estimated through absorbance measurements at 260 nm. Five to ten micrograms of plasmid are digested by the appropriate restriction enzyme (Table 5.2). After confirmation of complete digestion of plasmid
Table 5.2 List of vectors Sequence of the specific primers
Amplified length by PCR (bp)
Reference
Fw: AAGCAGTCGGC GAATCTGTG Rv: TTTCCTCAAGG CCGCGTTTC Fw: GCGCCTGAAGTC ACATATCCC Rv: CCTTCACCTT GGTGAGCAAC Fw: TGGAGAAAT GGGGAAACCAG Rv: GGAAGGGTG ACGTTTCGAAG
708
Soldo et al. (2003)
1085
Segawa et al. (2002)
1494
White et al. (1995)
250
Amano et al. (2008)
Vector
Auxotrophic Enzyme for Enzyme or marker linearization transporter
pGalE
LEU2
EcoRV
Bacillus subtilis UDP-Gal 4epimerase (GalE)
pUGT2
URA3
EcoRV
Homo sapiens UDP-Gal/ UDP-GalNAc transporter (UGT2)
pGALNT1 TRP1
EcoRV
Homo sapiens UDP-Nacetylgalactosamine: polypeptide Nacetylgalactosaminyltransferase1 (ppGalNAc-T1) Saccharomyces cerevisiae a factor Fw: TTAGCTGCTC CAGTCAACAC prepro sequence and a Rv: GGTGATGGT partial domain of human GATGTCTAGTG MUC1 (AHGVTSAPDTR)
pMUC1a
HIS3
NheI
In Vitro and In Vivo Enzymatic Syntheses
139
by electrophoresis on agarose gel, a band corresponding to the linearized plasmid is extracted with the extraction kit. Two micrograms of plasmid are used for the transformation. If the concentration of plasmid solution is still low, it should be adjusted to 1 mg/mL by ethanol precipitation. Saccharomyces cerevisiae strain W303-1A (MATa leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100), which is available from Thermo Scientific Open Biosystems, is precultured in 5 mL of YPAD liquid medium at 30 C overnight. Next day, another 5 mL of YPAD medium is inoculated with 100 mL of preculture and cultured again at 30 C. When the culture reaches OD600 ¼ 1.0, 1 mL of culture is moved to a microcentrifuge tube and is centrifuged at 1000 g and 4 C for 5 min. The cell pellet is washed with cold water and recentrifuged. The cells are suspended in transformation buffer (40% polyethylene glycol, 0.1 M dithiothreitol, 0.2 M lithium acetate), 2 mL of linearized plasmid (2 mg) and 3 mL of denatured salmon sperm DNA (10 mg/mL) are added and mixed by vortexing. The mixture is then incubated at 45 C for 30 min. After cooling on ice, the suspension is plated out onto an appropriate SD agar plate and incubated at 30 C until colonies appear. More than 10 colonies are picked up by toothpick and each colony is resuspended in 10 mL of colony polymerase chain reaction (PCR) solution containing 2.5 pmol of specific primers for amplification of integrated genes. We usually employ the following PCR conditions: [94 C for 15 s, 58 C for 30 s, 72 C for 1 min] 30 cycles. Note that colonies should be replicated to another SD agar plate by streaking with the toothpick used for colony PCR. The colony showing a positive result is kept for the next transformation. The clones that have the genes encoding UDP-Gal 4-epimerase (Soldo et al., 2003), UDP-Gal/UDP-GalNAc transporter (Segawa et al., 2002), ppGalNAc-T1 (White et al., 1995), and MUC1a6xHis peptide are selected by colony PCR, and the positive clone is cultured overnight in 5 mL of YPAD medium. The culture is mixed with the same volume of 60% glycerol and is stored at 80 C until use.
3.3. Expression and purification of MUC1a-6xHis peptide Before cultivation of yeast cells, the clone should be cultured on the SD agar medium and it is recommended that colony PCR be carried out, to confirm the genes integrated. For MUC1a, yeast cells are grown at 30 C for 2–3 days in 50 mL of YPAD medium in a 500 mL baffled shake flask while shaking (120 rpm). The supernatant is recovered by centrifugation at 1000 g and 4 C for 5 min. If cell debris or other insoluble particles are observed, the supernatant should be passed through a 0.45 mm membrane filter. MUC1a-6xHis peptide is purified from the culture supernatant by affinity chromatography using a TALON column (1 5 cm). The column is equilibrated with 20 mM potassium phosphate buffer (pH 7.4) containing 500 mM NaCl, the medium is also adjusted to pH 7.4 with 1 N NaOH, and
140
Hiromi Ito et al.
the culture supernatant is then applied to the column. The sample and the buffer are allowed to flow by gravity (approximately 1 drop/s). The column is washed with 10 column volumes of the buffer and the peptide is eluted with 5 column volumes of 20 mM potassium phosphate buffer (pH 7.4) containing 500 mM imidazol. The eluted glycopeptide is then separated by reversed-phase HPLC using a 5C18-ARII column. Sample elutes from the HPLC column at a flow rate of 1 mL/min, and glycopeptide is detected by absorbance at 210 nm. The following two solvents are used as eluents: (E1) 0.05% TFA in water and (E2) 0.05% TFA in acetonitrile. After injection of the samples, the ratio of E2 is kept at 0.5% (v/v) for 10 min and then linearly increased to 30% (v/v) over 20 min. MUC1a (AHGVT5SAPDTR)-6xHis peptide with one GalNAc molecule attached to Thr-5 is eluted at 25.1 min in our HPLC system (Fig. 5.3). Only traces of nonglycosylated MUC1a-6xHis are observed; however, lack of the introduced gene(s) sometimes causes production of the nonglycosylated form, which is observed at 26.1 min on HPLC. Note that degradation by carboxypeptidase of the His-tag in the C-terminus of the peptide sometimes occurs, and the truncated products are eluted faster (24.5–24.8 min) than that of full MUC1a-6xHis on HPLC. Separation of the truncated form on HPLC must be significant to allow isolation of MUC1a-6xHis.
Absorbance (210 nm)
GalNAc-MUC1a-6xHis
MUC1a-6xHis
23
24 Time (min)
25
26
Figure 5.3 Elution profile of GalNAc-MUC1a-6xHis peptide purified by TALON Metal Affinity Resin, on a C18 reversed-phase column. Arrows indicate the elution positions of both MUC1a-6xHis peptide with one GalNAc and MUC1a-6xHis peptide.
In Vitro and In Vivo Enzymatic Syntheses
141
The purified glycopeptide is measured by MS. For example, we determine the molecular mass of glycopeptides by using an Ettan MALDI-TOF/ Pro MS (Amano et al., 2008). Glycopeptide purified by HPLC is dried and redissolved in 0.5% TFA/50% acetonitrile. Next, the peptide solution is mixed with CTH matrix (a-cyano-4hydroxycinnamic acid). The mixture is then spotted onto sample plates and allowed to dry. All spectra are generated with the instrument in the positive-ion mode. The protonated molecular ion of MUC1a-6xHis with one GalNAc residue is observed at m/z 2136. We have succeeded in producing the MUC1a peptide containing core1 (Galb1-3GalNAca1-O-) (Amano et al., 2008) or core2 (Galb1-3 (GlcNAcb1-6)GalNAca1-O-) (data not shown) structures by introduction of the genes encoding core1 synthase and core2 synthase into the yeast clone described above. Moreover, substitution of the ppGalNAc-T1 gene for the other ppGalNAc-T gene causes modification of the different Ser and Thr sites. Therefore, the yeast system we describe here is able to produce glycopeptides modified at different glycosylation sites and is applicable to use as a standard for analysis of glycopeptides by MS.
4. An Application of the Library to Glycan Analysis Currently, identification of proteins can be easily accomplished using MS. This is not only due to technical advances in MS, but also to the presence of genomic information as templates. Recently, we have comprehensively cloned genes associated with the synthesis of glycans in humans, and then translated these glycogenes into recombinant glycosyltransferases using a variety of expression systems. Currently, glycans or glycopeptides with various structures can be arbitrarily synthesized in a test tube, by combining various enzymes as described above. The means by which glycan structural analysis may be accomplished from corresponding genomic information, that is, isolating most of the glycans present in the human body, may no longer be a fantasy (Kameyama, 2006). Glycan analysis is not as straightforward as peptide sequencing or DNA sequencing because of the difficulties arising from their structural complexities, such as variations in branching, linkage, and stereochemistry. Recently, tandem mass spectrometry has revealed that glycans may have characteristic fragmentation patterns in their collision-induced dissociation (CID) spectra. Using the glycan library, we have recently constructed an observed multistage tandem mass spectral database (GMDB: http://riodbdev. ibase.aist.go.jp/rcmg/glycodb/Ms_ResultSearch) which allows identification of oligosaccharides very easily and rapidly by spectral matching.
142
Hiromi Ito et al.
4.1. Construction of an observed tandem mass spectral database N-linked glycans were labeled with PA by reductive amination. O-linked glycans were obtained by reductive b-elimination of the glycopeptides prepared by enzymatic synthesis in vitro as described above. Mass spectra were acquired with a MALDI quadrupole ion trap TOF MS (AXIMA-QIT; Shimadzu). For sample preparation, 0.5 mL of a 2 mM analyte solution was deposited on the target plate and allowed to dry. Then, 0.5 mL of 2,5-DHB acid solution (10 mg/mL in 30% ethanol) was used to cover the matrix on the target plate and allowed to dry. All CID spectra were obtained from Na adduct ions, and collisional energy was adjusted to reduce the intensity of the precursor ion to less than 15% of the area of a base peak (Fig. 5.4). Argon was used as a collision gas. The CID spectra display a little variability in intensity, particularly in higher order MSn spectra. To compensate such variability, MS2 spectra of structurally defined glycans were acquired twice, while MS3 spectra of all major fragment ions in the MS2 spectra were acquired three times. All m/z values and intensities of signals in the MS2 and MS3 spectra, and sample information, such as the structures of the glycans, labeling reagent, and experimental conditions (m/z value of precursor ion, acquisition mode, matrix, etc.), were stored in a relational database. Glycan structures were described with an extensible markup language format we have developed (Kikuchi et al., 2005).
Basepeak 0<
Ip Ib
< 0.15 Yes
p m/z
Adjust CID energy and reacquire a CID spectrum
No
Store the data in a relational DB
Figure 5.4 Logic flow of evaluation of a valid CID spectrum for construction of an MSn spectral library. Ib, intensity of base peak; Ip, intensity of precursor ion.
In Vitro and In Vivo Enzymatic Syntheses
143
5. Glycan Analysis Using the Glycan Mass Spectral Database ‘‘GMDB’’ GMDB currently stores MS2, MS3, and MS4 spectra of N- and O-linked glycans, and glycolipid glycans as well as the partial structures of these glycans. O-linked glycans were converted to the corresponding alditols before MS acquisition. The other types of glycan stored in the GMDB are mostly tagged with PA, which can be used for fluorescence detection in HPLC.
5.1. CID spectra acquisition Comparing MSn spectra of analyte with MSn spectral images of various glycans in the GMDB, we can estimate glycan structure of the analyte. For reliable matching, CID spectra of an analyte should be acquired with a MALDI-QITTOF mass spectrometer according to the following protocol: (1) Place 0.5 mL of a sample solution on a target plate (specular surface stainless steel plate, 2 mm diameter) and allow it to dry. (2) Cover the dried analyte on the target plate with 0.5 mL of the matrix solution (10 mg/mL of 2,5-DHB acid in 30% ethanol) and allow it to dry. (3) Recrystallize the dried material by adding 0.15 mL of 99.5% ethanol to the matrix–analyte mixture on the target plate. (4) Acquire MS spectra of glycans in the positive ion mode. (5) Acquire MS2 spectra of Na adduct ions derived from the glycans. For the acquisition of CID spectra, adjust the CID energy so that the signal of the precursor ion almost disappears. If the intensity of the precursor ion in the spectrum is more than 15% of the base peak, the spectrum must be discarded and reacquired with a larger CID energy. Use an automatic acquisition function with the regular raster that governs the laser shot patterns. (6) Acquire MS3 spectra of a fragment ion in the MS2 spectra in the same manner as described above for MS2 acquisition.
5.2. How to use the GMDB The acquired MS2 spectra are compared with relevant spectral images in the GMDB. There are two ways of searching the relevant images. One is a query on glycan composition, and another is on m/z value. To do a query on glycan composition, click a link for ‘‘Glycan Composition’’ on the left hand column on the top page. Then input the numbers of each component monosaccharide unit (Hex, HexNAc, dHex, Pent, HexA, Neu5Ac, Neu5Gc) and modification group (Sulfo, Phospho) in the corresponding boxes (Fig. 5.5A). The number of adduct ions is also input in the corresponding boxes. In the case of MALDI MS of glycans, simply enter ‘‘1’’ in a box of ‘‘Naþ’’ unless you have doped the sample with another metal ion. The labeling group can be chosen from a group list, which is automatically popped up by clicking a tab. In the
144
Hiromi Ito et al.
Figure 5.5 Search windows in the GMDB. (i) Links for ‘‘m/z’’ or ‘‘Glycan Composition.’’ (A) Search window for glycan composition. (ii) The numbers of monosaccharides, (iii) the number of adduct ions, (iv) a labeling group, (v) Search button. (B) Search window for m/z value. (vi) m/z value, (vii) tolerance.
current version of the GMDB, ‘‘PA’’ and ‘‘OL’’ should be chosen for N-linked glycans and O-linked glycans, respectively. Next, click a ‘‘Search’’ button. To do a query on m/z value, click a link for ‘‘m/z’’ on the left hand column on the top page (Fig. 5.5B). Then, input the m/z value of a precursor ion of your spectrum, and enter an appropriate value (normally 0.5–1.0) in the ‘‘tolerance’’ box. Next, click the ‘‘Search’’ button. In general, the relevant spectral images can be found more easily by m/z search than by search according to composition.
In Vitro and In Vivo Enzymatic Syntheses
145
After pushing the search button, the ‘‘Spectral Database Search Result’’ window will open regardless of the search pathways (Fig. 5.6). In the window, the relevant glycan structures are shown with the tree-structured list of m/z values. These indicate m/z values of precursor ions stored in the GMDB. When executing a query on m/z value, relevant precursor ions are highlighted in yellow (Fig. 5.6B). You can choose any data by clicking the m/z value of the precursor ion whose spectrum you want to see. If you want to cancel a selection, simply click the highlighted number. To view your selection, click the button ‘‘Show Spectra.’’ The spectral images appear with the corresponding glycan structures in the ‘‘Spectrum’’ window (Fig. 5.7). Spectral images can be magnified by
Figure 5.6 Examples of the search result window. (A) Search result window for glycan composition search. The list of glycans which have the same composition as the queried glycan composition is shown in the window. (B) Search result window for m/z search. The list of glycans which have MSn spectra of the queried m/z value is shown in the window. The precursor ions of the stored MSn spectra for each glycan are depicted as a tree-structured list. Click precursor ions of the MSn spectra you want to view. The numbers are highlighted in yellow (i). Then, press the ‘‘Show Spectrum’’ button (ii).
146
Hiromi Ito et al.
Figure 5.7 Example of spectrum window. MSn spectra you selected are shown along with their glycan structures. You can easily compare these spectra in the window. (i) Range for magnification, (ii) redraw button, (iii) print button, (iv) precursor ion.
defining a range of display. After inputting an appropriate value for display range, click the ‘‘Redraw’’ button to see magnified spectral images. If you want to print the spectral images, simply click the ‘‘Print’’ button. The spectral images should be carefully compared with the analyte MS2 spectra by visual evaluation. When multiple spectra show similarity to the analyte MS2 spectra, go back to the ‘‘Search Result’’ window and click any m/z values of MS3 precursors in the tree-structured list of the candidates which have similar MS2 spectra. Find the precursor ions that can be used to discriminate isomers by comparing their MS3 spectra. The precursor ion of the particular spectra is indicated at the upper left of the spectra. In the case of MS4 spectra, the fragmentation path is also indicated.
6. Navigator System for Glycan Analysis Using the Glycan Mass Spectral Database While one glycan has one precursor ion for the MS2 spectrum, there are many precursor ions for MS3 or higher order MSn spectra in the analysis for one glycan. When the spectral matching of MS2 cannot determine
147
In Vitro and In Vivo Enzymatic Syntheses
glycan structure, only a few precursor ions among the many give spectra which are useful in discriminating glycan isomers. Therefore, selection of an appropriate fragment ion is important when multiple glycans show similarity to the analyte in their MS2 spectra. However, visual evaluation is not so straightforward in determining spectral similarity using the GMDB. In addition, visual evaluation comparing spectral images is often ambiguous. We have now devised a navigator system for selection of precursor ions in glycan analysis using the glycan mass spectral database, by means of a collaboration with Shimadzu Corporation and Mitsui Knowledge Industry (Kameyama et al., 2005). This system evaluates spectral similarity by calculation of Euclidian Distance spectra. Figure 5.8 summarizes the process flow of glycan analysis using this system. By spectral matching of MS2 spectra of analytes, the system picks up the candidate glycans from the stored glycan structures in the GMDB. The system then makes a suggestion as to which fragment ion should be selected as the next precursor. This suggestion is made by calculations of Euclidean Distances between the candidate’s MS3 spectra stored in the GMDB. The candidate’s MS3 spectra of the next precursor have the highest dissimilarity among the MS3 spectra of precursor
MS m/z 1725
MSn spectral DB 1200
1600
2000
MS2(m/z 1725) Spectral matching b4 600
1000
1400
b2 b2
Candidate 1 : ONG-cd Candidate 2 : ONG-a6
b2 b4
The next precursor m/z 1280
Suggest crucial ions to discriminate isomers
b2
a6 a3
a6 a3
a6
b4 b4
a6
b4 b4
PA
PA
3
MS (m/z 1280) Spectral matching 200
600
ONG-a6 answer
1000
Figure 5.8 Process flow of glycan analysis using the navigator system. The system picks up the candidate glycans by spectral matching of analyte MS2 spectrum data. The similarities of spectra are evaluated by calculating the Euclidean Distances of the spectra. The system then suggests the crucial fragment ions to discriminate candidates in the MS3 spectra. The operator merely takes an MS3 spectrum of the suggested precursor ion, and query. Eventually, the system performs the final judgment by spectral matching of the MS3 spectra, and gives the answer.
148
Hiromi Ito et al.
ions stored in the GMDB. An MS3 spectrum of the suggested ion in the MS2 spectrum of the analyte is acquired, and the spectral data are sent to the search server. Eventually, the system makes the final judgment from the spectral matching of the MS3, and gives a search result with matching scores. Using this system, an operator normally takes two CID spectra, one MS2 and one MS3 of the analyte to get an answer. The CID spectra do not need to be assigned. That is the point of this system.
ACKNOWLEDGMENT This work was performed as part of the R&D Project of the Industrial Science and Technology Frontier Program supported by the New Energy and Industrial Technology Development Organization (NEDO).
REFERENCES Amano, K., Chiba, Y., Kasahara, Y., Kato, Y., Kaneko, M. K., Kuno, A., Ito, H., Kobayashi, K., Hirabayashi, J., Jigami, Y., and Narimatsu, H. (2008). Engineering of mucin-type human glycoproteins in yeast cells. Proc. Natl. Acad. Sci. USA 105, 3232–3237. Bigge, J. C., Patel, T. P., Bruce, J. A., Goulding, P. N., Charles, S. M., and Parekh, R. B. (1995). Nonselective and efficient fluorescent labeling of glycans using 2-amino benzamide and anthranilic acid. Anal. Biochem. 230, 229–238. Clausen, H., and Bennett, E. P. (1996). A family of UDP-GalNAc: Polypeptide N-acetylgalactosaminyl-transferases control the initiation of mucin-type O-linked glycosylation. Glycobiology 6, 635–646. Hase, S. (1994). High-performance liquid chromatography of pyridylaminated saccharides. Methods Enzymol. 230, 225–237. Hollingsworth, M. A., and Swanson, B. J. (2004). Mucins in cancer: Protection and control of the cell surface. Nat. Rev. Cancer 4, 45–60. Ito, H., Kameyama, A., Sato, T., Sukegawa, M., Ishida, H.-K., Nakahara, Y., and Narimatsu, H. (2005). Molecular-weight-tagged glycopeptide library: Efficient construction and applications. Angew. Chem. Int. Ed. Engl. 44, 4547–4549. Ito, H., Kameyama, A., Sato, T., Kiyohara, K., Nakahara, Y., and Narimatsu, H. (2007). Strategy for the fine characterization of glycosyltransferase specificity using isotopomer assembly. Nat. Methods 7, 577–582. Kameyama, A. (2006). Glycomics using mass spectrometry. Trends Glycosci. Glycotechnol. 18, 323–341. Kameyama, A., Kikuchi, N., Nakaya, S., Ito, H., Sato, T., Shikanai, T., Takahashi, Y., Takahashi, K., and Narimatsu, H. (2005). A strategy for identification of oligosaccharide structures using observational multistage mass spectral library. Anal. Chem. 77, 4719–4725. Kikuchi, N., Kameyama, A., Nakaya, S., Ito, H., Sato, T., Shikanai, T., Takahashi, Y., and Narimatsu, H. (2005). The carbohydrate sequence markup language (CabosML): An XML description of carbohydrate structures. Bioinformatics 21, 1717–1718. Narimatsu, H. (2004). Construction of a human glycogene library and comprehensive functional analysis. Glycoconj. J. 21, 17–24.
In Vitro and In Vivo Enzymatic Syntheses
149
Perez-Vilar, J., and Hill, R. L. (1999). The structure and assembly of secreted mucins. J. Biol. Chem. 274, 31751–31754. Segawa, H., Kawakita, M., and Ishida, N. (2002). Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose. Eur. J. Biochem. 269, 128–138. Soldo, B., Scotti, C., Karamata, D., and Lazarevic, V. (2003). The Bacillus subtilis Gne (GneA, GalE) protein can catalyse UDP-glucose as well as UDP-N-acetylglucosamine 4-epimerisation. Gene 319, 65–69. Taniguchi, N., Honke, K., and Fukuda, M. (eds.), (2001). Handbook of Glycosyltransferases and Related Genes, Springer-Verlag, Tokyo. Tarp, M. A., and Clausen, H. (2008). Mucin-type O-glycosylation and its potential use in drug and vaccine development. Biochim. Biophys. Acta 1780, 546–563. Ten Hagen, K. G., Fritz, T. A., and Tabak, L. A. (2003). All in the family: The UDPGalNAc:polypeptide N-acetylgalactosaminyltransferases. Glycobiology 13, 1R–16R. White, T., Bennett, E. P., Takio, K., Srensen, T., Bonding, N., and Clausen, H. (1995). Purification and cDNA cloning of a human UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem. 270, 24156–24165.
C H A P T E R
S I X
Identification of Fucosylated Haptoglobin as a Novel Tumor Marker for Pancreatic Cancer and Its Possible Application for a Clinical Diagnostic Test Eiji Miyoshi, Shinichiro Shinzaki, Kenta Moriwaki, and Hitoshi Matsumoto Contents 154
1. Introduction 2. Discovery of Fucosylated Haptoglobin as a Marker for Pancreatic Cancer 3. Mass Spectrometry Analysis of the Oligosaccharide Structure on Haptoglobin 4. Identification of an Inducible Factor that Stimulates the Production of Haptoglobin 5. Clinical Application of Lectin–Antibody ELISA to Measure Fucosylated Haptoglobin 6. Closing Remarks Acknowledgments References
155 156 157 160 162 162 163
Abstract Fucosylation is one of the most important oligosaccharide modifications in cancer and inflammation. The fucosylation level is increased in total cellular proteins of cancer cells as well as in sera of patients with cancer. Recently, on AAL blot analysis, we found a fucosylated glycoprotein of 40 kDa in sera of patients with pancreatic cancer. Based on its N-terminal sequence, this protein was identified as haptoglobin. Fucosylated haptoglobin was increased in sera of patients with several kinds of cancer and the positive rate was higher in pancreatic cancer. The level of fucosylated haptoglobin was not correlated Department of Molecular Biochemistry and Clinical Investigation, Osaka University Graduate School of Medicine, Yamada-oka, Suita, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78006-X
#
2010 Elsevier Inc. All rights reserved.
153
154
Eiji Miyoshi et al.
with total haptoglobin, suggesting that a factor other than inflammation could regulate the production of fucosylated haptoglobin. Mass spectrometry analysis revealed the detailed oligosaccharide structure of fucosylated haptoglobin purified from sera of patients with pancreatic cancer. For clinical applications, we developed a lectin–antibody ELISA system for quantifying fucosylated haptoglobin. In this review, we would like to summarize the history of the identification of fucosylated haptoglobin as a marker for pancreatic cancer and its possible application for a clinical diagnostic test.
Abbreviations AAL AFP AFP-L3 ELISA ROC
Aleuria aurantia lectin a-Fetoprotein Fucosylated a-fetoprotein Enzyme-linked immunosorbent assay Receiver operating characteristics
1. Introduction Pancreatic cancer is a highly lethal disease, being the fourth commonest cause of death from cancer in men and women, and the 5-year survival rate for all stages of the disease being less than 5% (Doi et al., 2008; Greenlee et al., 2000; Ueno et al., 2009). Surgical resection remains the only potentially curative intervention for pancreatic cancer but is contraindicated in most patients because they are diagnosed at an advanced stage. Among the minority of patients who undergo surgical resection, the median survival rate is only 20 months, the 5-year survival rate being only 8–20% (Doi et al., 2008). To diagnose patients with pancreatic cancer at an early stage, careful and detailed image examinations such as ultrasonography, computed tomography, and positron emission tomography (PET) are required. An early stage of pancreatic cancer comprises tumors of less than 2 cm in diameter and no metastasis. Tumor markers are not available for detecting such small cancers because a characteristic marker produced by cancer cells will be diluted in the large volume of blood. The detection of high-risk groups/diseases for pancreatic cancer, like liver cirrhosis for hepatomas, using tumor markers is very promising if possible. Previously used markers such as CA19-9 or CEA are not available for this purpose. Another use of a tumor marker is as a sign of cancer recurrence or as an index for therapy. While both chemotherapy and
Fucosylated Haptoglobin and Pancreatic Cancer
155
radiotherapy are effective in certain cases of pancreatic cancer, earlier administration of these therapies is recommended if unresectable pancreatic cancer exists. However, they have side effects and it is important to select the best therapeutic protocol for quality of life. For this purpose, such tumor markers should be used if possible. Fucosylation is one of the most common modifications involving oligosaccharides on glycoproteins or glycolipids. Fucosylation comprises the attachment of a fucose residue to N-glycans, O-glycans, and glycolipids. Fucosylation is one of the most important types of glycosylation in cancer. Hakomori and coworkers presented the first paper on cancer and fucosylation in 1979 (Baumann et al., 1979). In this paper, the authors compared the fucosylation levels of glycolipids in hepatoma cells and normal hepatocytes. While certain kinds of fucosyltransferases involved differ between glycoproteins and glycolipids, the donor substrate, GDP-fucose, is common. Fucosylation is regulated by several kinds of fucosyltransferases, the GDPfucose synthetic pathway, and a GDP-fucose transporter. Before these complicated mechanisms of fucosylation were clarified, fucosylated target proteins were found and used as tumor markers. The most representative case is fucosylated a-fetoprotein (AFP-L3), which was reported by Drs. Breborowicz and Taketa (Simm et al., 1979; Watanabe et al., 1975). We found fucosylated haptoglobin in sera of patients with pancreatic cancer a few years ago (Okuyama et al., 2006). The history of this finding, detailed oligosaccharide analyses, the molecular mechanisms underlying its production, and the possibility of its clinical usefulness as a tumor marker for pancreatic cancer are reviewed in this paper.
2. Discovery of Fucosylated Haptoglobin as a Marker for Pancreatic Cancer Our preliminary study suggested that pancreatic cancer cells produce a variety of fucosylated proteins in the conditioned medium. To identify fucosylated proteins in the sera of patients with pancreatic cancer, Aleuria aurantia lectin (AAL) blot analyses have been performed. The total binding of serum proteins to AAL is increased in pancreatic cancer cases as compared to in healthy controls. Among these proteins, an increase in the fucosylation of an approximately 40 kDa material was observed of a high frequency in the sera of patients with pancreatic cancer. The N-terminal amino-acid sequencing revealed that its sequence was ILGGHLDAKG, corresponding to the haptoglobin b chain. To exclude another fucosylated glycoprotein of 40 kDa, immune-precipitation of haptoglobin followed by AAL blotting was performed. As expected, fucosylated haptoglobin was confirmed with this method and an equal amount of haptoglobin was precipitated as
156
Eiji Miyoshi et al.
confirmed by Western blot analysis (Fig. 6.1). Since fucosylated haptoglobin was detected on simple AAL blotting, we investigated whether it was positive or negative, using sera of patients with several kinds of cancer. The positive rate was highest in pancreatic cancer among all cancers and inflammatory diseases examined.
3. Mass Spectrometry Analysis of the Oligosaccharide Structure on Haptoglobin Since AAL recognizes many types of fucosylated oligosaccharides such as Lewis type and core fucose, we performed mass spectrometry analysis of haptoglobin. A much higher level of fucosylation was observed for haptoglobin purified from sera of patients with pancreatic cancer, compared to
(kDa)
CBB staining AAL blot
206 IP: @Haptoglobin WB: AAL
115 98
IgG Haptoglobin
rs tee lun
ca n
rm
al
vo
tic
No
cre a Pa n
Pa nc
No
rm
al
vo
lun tee rea rs tic can cer
nc er ca
tic
nc rea
Pa
No
rm
al vo lu
nte
ers
cer
54
Figure 6.1 Identification of AAL-binding proteins in serum of pancreatic cancer cases. (Left panel) 0.5 ml aliquots of sera were electrophoresed on 8% acrylamide gels, and stained with CBB after blotting onto a PVDF membrane. AAL blot analysis was performed using the same samples. An approximately 40 kDa protein was excised from the membrane and identified as the haptoglobin b chain based on its N-terminal amino-acid sequence. N indicates normal controls and P indicates pancreatic cancer. (Middle panel) Immunoprecipitation of haptoglobin followed by AAL blotting showed that the approximately 40 kDa protein was really fucosylated haptoglobin. (Right panel) Western blotting of haptoglobin indicated that equal amounts of haptoglobin had precipitated. These data are cited from Okuyama et al. (2006) with slight modifications. (See Color Insert.)
Fucosylated Haptoglobin and Pancreatic Cancer
157
that in healthy volunteers (Okuyama et al., 2006). However, all of these oligosaccharides are not always derived from haptoglobin, because haptoglobin can bind many glycoproteins. Therefore, we performed site-specific oligosaccharide analysis of haptoglobin. Haptoglobin has four potential sites for N-glycans. After trypsin treatment, mass spectrometry analysis was performed (Nakano et al., 2008). Interestingly, site 3 of haptoglobin N-glycan had different oligosaccharides from the other sites (Fig. 6.2). A characteristic oligosaccharide exhibiting fucosylation was observed of site 3 on haptoglobin purified from pancreatic cancer sera. This finding suggests that the fucosylation via fucosyltransferases is dependent on the whole oligosaccharide structure or the amino-acid structures around N-glycans. If the sensitivity of mass spectrometry analysis for glycopeptides is increased, novel modes of serum glyco-marker, site-specific glycopeptide analysis might be found. However, complicated/difficult methods are not recommended for clinical laboratory tests.
4. Identification of an Inducible Factor that Stimulates the Production of Haptoglobin Haptoglobin is an acute-phase protein produced in the liver. It is a heterotetramer consisting of two a subunits and two b subunits linked through interchain disulfide bonds, and a potential receptor molecule for glycosylation changes in diseases (Turner, 1995). Haptoglobin also acts as an antioxidant, has antibacterial activity, and plays a role in the modulation of many aspects of the acute-phase response (Wassell, 2000). Therefore, its polymorphisms are linked to cardiovascular and renal diseases. Ectopic production of haptoglobin was reported previously in cases of inflammation and cancer (Turner, 1995). However, it remains unknown how fucosylated haptoglobin is produced in several types of cancer. In our previous study, the mechanism underlying the production of fucosylated haptoglobin in pancreatic cancer was investigated (Okuyama et al., 2006). The expression of haptoglobin mRNA was observed in a small number of pancreatic cancer cell lines. The addition of conditioned medium of pancreatic cancer cells to a hepatoma cell line, Hep3B, increased the production of haptoglobin, suggesting that pancreatic cancer cells secrete an inducible factor that stimulates the production of haptoglobin. It is an important issue as to which organ/cells produce fucosylated haptoglobin in pancreatic cancer. At least three pathways exist, that is, pancreatic cancer cells themselves, infiltrating lymphocytes around pancreatic cancers, and hepatocytes produce fucosylated haptoglobin (Fig. 6.3). Interleukin 6 (IL6) was found to be a soluble factor secreted by T cells that induces the activation of B cells (Kishimoto and Hirano, 1988), and to have
Eiji Miyoshi et al.
NV (<40)
NV (>60)
CP
2 4-F
1 3-F 1 4-F 1
2-F
4–0
Site 3
3–0
2 4-F
1 3-F 1 4-F 1
n.d. n.d. 2-F
4–0
n.d.
100 90 80 70 60 50 40 30 20 10 0
2–0
(%)
Site 1 (site2 and 4; similar pattern)
3–0
100 90 80 70 60 50 40 30 20 10 0
2–0
(%)
158
PC
Figure 6.2 Relative abundance (%) of glycopeptide glycoforms, including N-glycan binding sites of haptoglobin from sera of patients with pancreatic cancer (PC), and chronic pancreatitis (CP), and normal volunteers (NV). Relative abundance was calculated based on the signal intensities of corresponding glycopeptides derived from the results of mass spectrometry analyses. The error bars represent the standard deviation (S.D.) calculated for each sample. To compare four groups (NV (< 40 years old), NV (> 60 years old), CP, and PC) nonrepeated measured ANOVA (two-tail) was used, and then each pair of groups was compared by means of Bonferroni correction (two-tail). Site 3 had characteristic oligosaccharide structure, compared to other sites. These data are cited from Nakano et al. (2008) with slight modifications.
a variety of biological functions (Akira et al., 1990). IL6 is increased in acute inflammation and can induce the expression of haptoglobin in the liver. As expected, production of haptoglobin by a hepatoma cell line, Hep3B, was increased when the cells were cocultured with a pancreatic cancer cell line, PSN-1 (Narisada et al., 2008; Okuyama et al., 2006). The addition of a
159
Fucosylated Haptoglobin and Pancreatic Cancer
Control
Pancreatic cancer
Liver Fut8 , GDP-Fuc
Hpt
Pancreas
Blood
Hpt ECM PC WBC
Hpt
Hpt Inducible factor IL6
Hpt, haptoglobin; PC, pancreatic cancer ECM, extracelluar matrix; WBC, white blood cell
Figure 6.3 There are three possibilities as to the production of fucosylated haptoglobin in sera of patients with pancreatic cancer. Pancreatic cancer cells themselves and tumor-infiltrating lymphocytes produce fucosylated haptoglobin, and pancreatic cancer tissues produce IL6, resulting in the induction of production of fucosylated haptoglobin in the liver.
neutral antibody for IL6 to the conditioned medium of this coculture system suppressed induction of the production of haptoglobin, suggesting that IL6 is an inducible factor that stimulates the production of haptoglobin (Narisada et al., 2008). Ancrile et al. reported that the expression of IL6 was enhanced by the activation of oncogenic Ras (Ancrile et al., 2008). Pancreatic cancer exhibits a high rate of Ras mutations (Hruban et al., 1993), and certain kinds of pancreatic cancer cell lines express IL6. Activation of the Ras oncogene in pancreatic cancer followed by the secretion of IL6 would be one pathway, which induces the production of haptoglobin in the liver. Fucosylation is regulated by several kinds of fucosyltransferases and their donor substrate, GDP-fucose, which is synthesized by FX and GMDS, and a GDP-fucose transporter (Miyoshi et al., 2008). These fucosylation-related molecules were upregulated with IL6 treatment, indicating that increases in IL6 production by pancreatic cancer cells induce the production of fucosylated haptoglobin in the liver. According to our hypothesis, micrometastasis of pancreatic cancer cells in the liver might be the in vivo situation in this coculture system. To determine the level of fucosylated haptoglobin in conditioned medium, we developed a lectin–antibody ELISA system (Fig. 6.4). The lectin used was AAL, as described above. In this ELISA system, a Fab fragment of an anti-haptoglobin antibody was used because IgG has one chain of fucosylated N-glycan. When the conditioned medium
160
Eiji Miyoshi et al.
Lectin
Haptoglobin
Anti haptoglobin Ab (Fab alone)
Figure 6.4 Establishment of a lectin–antibody ELISA system for measuring fucosylated haptoglobin. The bottom of ELISA plate was coated with the Fab fragment of an anti-haptoglobin antibody and AAL was used to detect fucosylated oligosaccharides on haptoglobin. The conditioned medium of pancreas cancer cell line PK8 transfected with an expression vector for haptoglobin was used as a standard.
of pancreas cancer cell line PK8 transfected with an expression vector for haptoglobin was used as a standard, determination of fucosylated haptoglobin was very quantitative (Narisada et al., 2008). The next goal of our project is to apply this lectin-ELISA for a clinical laboratory test.
5. Clinical Application of Lectin–Antibody ELISA to Measure Fucosylated Haptoglobin In this assay (Fig. 6.4), a good correlation between the relative level of fucosylated haptoglobin and the absorbance of a standard sample was observed from 4 to 70 U/ml (Matsumoto et al., 2010). The sera of 72 cases of pancreatic cancer and 22 healthy volunteers were assayed (Fig. 6.5A). The levels of fucosylated haptoglobin in pancreatic cancer patients were significantly higher than those in healthy volunteers (median, 12.01 U/ml; range, 0.71–44.73 vs. median, 4.45 U/ml; range, 0.88–16.31; p < 0.05 with the Wilcoxon test). After a receiver operating characteristics (ROC) curve was drawn, the cut-off index for the fucosylated haptoglobin level on lectin–antibody ELISA was taken as 10 U/ml. The positive rate of fucosylated haptoglobin was approximately 50% in pancreatic cancer cases and less than 10% in normal volunteers. The positive rate in pancreatic cancer cases was higher at stage IV (advanced clinical stage) than other stages. ROC curves for fucosylated haptoglobin, CA19-9, and the combination of CA19-9 and fucosylated haptoglobin were obtained for
161
Fucosylated Haptoglobin and Pancreatic Cancer
A
B
p < 0.05
1.00
50
Sensitivity
FHp ELISA (U/ml)
0.80 40 30 20
0.60 FHp + CA19-9 CA19-9
0.40
FHp FHp (fucosylated haptoglobin)
10
0.20
0 HV
PC
0.00 0.00
0.20
0.40 0.60 0.80 1-specificity
1.00
Figure 6.5 Determination of fucosylated haptoglobin and the ROC curve for diagnosis of pancreatic cancer. (A) The levels of fucosylated haptoglobin in pancreatic cancer cases (n ¼ 72) and healthy volunteers (n ¼ 22) were determined by lectin ELISA. (B) ROC curves were obtained for discrimination between pancreatic cancer and chronic pancreatitis. The areas under the curves (AUC) for fucosylated haptoglobin, CA19-9, and the combination of CA19-9 and fucosylated haptoglobin were 0.628, 0.825, and 0.867, respectively. These data are cited from Matsumoto et al. (2010) with slight modifications.
discrimination between pancreatic cancer and chronic pancreatitis (Fig. 6.5B). The sensitivity and specificity of the lectin–antibody ELISA of the diagnosis for pancreatic cancer were 50% and 91%, respectively, compared to those for normal volunteers and 50% and 79%, respectively, compared to those for chronic pancreatitis. While the sensitivity for fucosylated haptoglobin was approximately 50%, the combination of CA19-9 and fucosylated haptoglobin gave a higher area under the curve than with CA19-9 alone, suggesting that CA19-9 and fucosylated haptoglobin are independent markers for pancreatic cancer. Zhao et al. (2007) found that the level of fucosylated haptoglobin was increased in pancreatic cancer, compared to in chronic pancreatitis, using glycoprotein microarrays and multilectin detection. Increases in fucosylated haptoglobin were observed in other types of cancer such as hepatomas (Ang et al., 2006), prostate cancer (Fujimura et al., 2008), and lung cancer (Ueda et al., 2007). When fucosylated haptoglobin was assayed by lectin–antibody ELISA, using sera from cases of various kinds of cancer (Matsumoto et al., 2010), the results were consistent with previous ones reported as determined by other methods (Ang et al., 2006; Fujimura et al., 2008; Ueda et al., 2007; Zhao et al., 2007). However, the levels of fucosylated haptoglobin determined on lectin– antibody ELISA were not always consistent with the AAL blot data.
162
Eiji Miyoshi et al.
The discrepancy between AAL blotting and lectin–antibody ELISA was approximately 15–20%. Both the sensitivity and specificity were higher for AAL blotting than lectin–antibody ELISA. However, the quantification of fucosylated haptoglobin was difficult and the possible examination of many samples was not satisfactory with AAL blotting. Haptoglobin has four potential sites for N-glycans and each N-glycan has a unique oligosaccharide structure (Nakano et al., 2008). Fucosylation of certain sites of N-glycans would be difficult to recognize with AAL on lectin–antibody ELISA. The reason for the higher sensitivity of AAL blotting would be the destruction of protein structures on SDS-PAGE. In contrast, fucosylation of other sites might be more sensitively recognized with AAL on lectin–antibody ELISA. Therefore, lectin–antibody ELISA is more sensitive than AAL blotting in certain cases.
6. Closing Remarks While the sensitivity with fucosylated haptoglobin is approximately 50–60% for a diagnosis of pancreatic cancer, CA19-9 and fucosylated haptoglobin are independent markers for pancreatic cancer. If the detection is improved, the sensitivity of lectin–antibody ELISA might be increased. The positive rate of fucosylated haptoglobin at an early stage of pancreatic cancer (clinical stage I or II) is 20–30%, suggesting that fucosylated haptoglobin is not suitable as a tumor marker for detecting early cancers or highrisk groups. However, certain cases at clinical stage I or II showed high levels of fucosylated haptoglobin (Matsumoto et al., 2010). IL6 induced the production of fucosylated haptoglobin in Hep3B cells (Narisada et al., 2008). If IL6 produced from cancer cells induces the production of fucosylated haptoglobin in the liver, why is the positive rate of fucosylated haptoglobin significantly higher in pancreatic cancer? One possibility is that pancreatic cancer is located near the liver or portal vein (Von Hoff et al., 2005). Another possibility is that micrometastasis of pancreatic cancer cells in the liver stimulates hepatocytes around tumors. If so, fucosylated haptoglobin could be a predictive marker for liver metastasis and one of the indices for concentrated chemotherapy. Validation studies involving large numbers of samples at different hospitals are required.
ACKNOWLEDGMENTS We thank Drs. Nobuto Koyama and Kyoko Kamihagi (Takara Bio, Shiga, Japan) for preparing the lectin–antibody ELISA kit for fucosylated haptoglobin, and Ms. Noriko Okuyama, Ms. Megumi Narisada, and Dr. Miyako Nakano for the many experiments. The project was mainly supported by a grant from the Japan Science and Technology Agency ( JST) and global COE program in Osaka University.
Fucosylated Haptoglobin and Pancreatic Cancer
163
REFERENCES Akira, S., Hirano, T., Taga, T., and Kishimoto, T. (1990). Biology of multifunctional cytokines: IL 6 and related molecules (IL 1 and TNF). FASEB J. 4(11), 2860–2867. Ancrile, B., Lim, K. H., and Counter, C. M. (2008). Oncogenic Ras-induced secretion of IL6 is required for tumorigenesis. Genes Dev. 21(14), 1714–1719. Ang, I. L., Poon, T. C., Lai, P. B., Chan, A. T., Ngai, S. M., Hui, A. Y., Johnson, P. J., and Sung, J. J. (2006). Study of serum haptoglobin and its glycoforms in the diagnosis of hepatocellular carcinoma: A glycoproteomic approach. J. Proteome Res. 5(10), 2691–2700. Baumann, H., Nudelman, E., Watanabe, K., and Hakomori, S. (1979). Neutral fucolipids and fucogangliosides of rat hepatoma HTC and H35 cells, rat liver, and hepatocytes. Cancer Res. 39, 2637–2643. Doi, R., Imamura, M., Hosotani, R., et al. (2008). Japan Pancreatic Cancer Study Group. Surgery versus radiochemotherapy for resectable locally invasive pancreatic cancer: Final results of a randomized multi-institutional trial. Surg. Today 38, 1021–1028. Fujimura, T., Shinohara, Y., Tissot, B., Pang, P. C., Kurogochi, M., Saito, S., Arai, Y., Sadilek, M., Murayama, K., Dell, A., Nishimura, S., and Hakomori, S. I. (2008). Glycosylation status of haptoglobin in sera of patients with prostate cancer vs. benign prostate disease or normal subjects. Int. J. Cancer 122(1), 39–49. Greenlee, R. T., Murray, T., Boldon, S., and Wingo, P. A. (2000). Cancer statistics, 2000. CA Cancer J. Clin. 50, 7–33. Hruban, R. H., van Mansfeld, A. D., Offerhaus, G. J., van Weering, D. H., Allison, D. C., Goodman, S. N., Kensler, T. W., Bose, K. K., Cameron, J. L., and Bos, J. L. (1993). K-ras oncogene activation in adenocarcinoma of the human pancreas. A study of 82 carcinomas using a combination of mutant-enriched polymerase chain reaction analysis and allele-specific oligonucleotide hybridization. Am. J. Pathol. 143(2), 545–554. Kishimoto, T., and Hirano, T. (1988). Molecular regulation of B lymphocyte response. Annu. Rev. Immunol. 6, 485–512. Matsumoto, H., Shinzaki, S., Narisada, M., Kawamoto, S., Kuwamoto, K., Moriwaki, K., Kanke, F., Satomura, S., Kumada, T., and Miyoshi, E. (2010). Clinical application of a lectin-antibody ELISA to measure fucosylated haptoglobin in sera of patients with pancreatic cancer. Clin. Chem. Lab. Med. 48, 505–512. Miyoshi, E., Moriwaki, K., and Nakagawa, T. (2008). Biological function of fucosylation in cancer biology. J. Biochem. 143(6), 725–729. Nakano, M., Nakagawa, T., Ito, T., Kitada, T., Hijioka, T., Kasahara, A., Tajiri, M., Wada, Y., Taniguchi, N., and Miyoshi, E. (2008). Site-specific analysis of N-glycans on haptoglobin in sera of patients with pancreatic cancer; a novel approach for the development of tumor markers. Int. J. Cancer 122(10), 2301–2309. Narisada, M., Kawamoto, S., Kuwamoto, K., Moriwaki, K., Nakagawa, T., Matsumoto, H., Asahi, M., Koyama, N., and Miyoshi, E. (2008). Identification of an inducible factor secreted by pancreatic cancer cell lines that stimulates the production of fucosylated haptoglobin in hepatoma cells. Biochem. Biophys. Res. Commun. 377(3), 792–796. Okuyama, N., Ide, Y., Nakano, M., Nakagawa, T., Yamanaka, K., Moriwaki, K., Murata, K., Ohigashi, H., Yokoyama, S., Eguchi, H., Ishikawa, O., Ito, T., et al. (2006). Fucosylated haptoglobin is a novel marker for pancreatic cancer: A detailed analysis of the oligosaccharide structure and a possible mechanism for fucosylation. Int. J. Cancer 118(11), 2803–2808. Simm, S., Markowska, J., Tomaszkiewicz, T., Herwichowska, K., and Breborowicz, J. (1979). Monitoring the course of malignant neoplasms of the genital organs in women by means of determination of blood serum levels of fucose, sialic acid, CEA and AFP. Ginekol. Pol. 50(12), 1029–1036.
164
Eiji Miyoshi et al.
Turner, G. A. (1995). Haptoglobin. A potential reporter molecule for glycosylation changes in disease. Adv. Exp. Med. Biol. 376, 231–238. Ueda, K., Katagiri, T., Shimada, T., Irie, S., Sato, T. A., Nakamura, Y., and Daigo, Y. (2007). Comparative profiling of serum glycoproteome by sequential purification of glycoproteins and 2-nitrobenzensulfenyl (NBS) stable isotope labeling: A new approach for the novel biomarker discovery for cancer. J. Proteome Res. 6(9), 3475–3483. Ueno, H., Kosuge, T., Matsuyama, Y., et al. (2009). A randomized phase III trial comparing gemcitabine with surgery-only in patients with resected pancreatic cancer: Japanese Study Group of Adjuvant Therapy for Pancreatic Cancer. Br. J. Cancer 101, 908–915. Von Hoff, D. D., Evans, D. B., and Hruban R. H. (2005). Pancreatic Cancer Chapters 11– 12, pp. 155–180, Jones and Bartlett Publishers. Wassell, J. (2000). Haptoglobin: Function and polymorphism. Clin. Lab. 46, 547–552. Watanabe, A., Taketa, K., and Kosaka, K. (1975). Microheterogeneity of rat alpha-fetoprotein. Ann. N. Y. Acad. Sci. 259, 95–108. Zhao, J., Patwa, T. H., Qiu, W., Shedden, K., Hinderer, R., Misek, D. E., Anderson, M. A., Simeone, D. M., and Lubman, D. M. (2007). Glycoprotein microarrays with multi-lectin detection: Unique lectin binding patterns as a tool for classifying normal, chronic pancreatitis and pancreatic cancer sera. J. Proteome Res. 6(5), 1864–1874.
C H A P T E R
S E V E N
Differential Glycan Profiling by Lectin Microarray Targeting Tissue Specimens Atsushi Kuno, Atsushi Matsuda, Yuzuru Ikehara, Hisashi Narimatsu, and Jun Hirabayashi Contents 1. Overview 2. Differential Analysis of Glycoproteins Derived from One-Dot Sections of Tissue Microarray 2.1. Methods for preparation of Cy3-labeled glycoprotein from formalin-fixed tissue sections 2.2. Methods for lectin microarray analysis and data processing 2.3. Methods for selection of the best lectin probe 3. Differential Glycan Analysis Between Cancer Lesions and Normal Regions in the Same Tissue Section 3.1. Method for dissecting specific regions in tissue sections 4. (Optional)Glycan Profiling of a Target Glycoprotein Extracted from Tissue Specimens 4.1. Differential glycan analysis of a fixed target glycoprotein in tissue sections by antibody-assisted lectin profiling Acknowledgments References
166 168 168 170 172 174 174 176 176 177 177
Abstract Glycome is defined by the glycosylation machinery with which each cell is equipped, and this differs between species. It is evident that cells show drastic change during cell progression and differentiation associated with tumorigenesis and malformation. Histochemical approaches to analyze molecular and cellular dynamics provide useful clues to answering questions about glycan functions associated with pathology. However, development of glyco-biomarker discovery will require differential glycan analysis in a number of clinical specimens where disease lesions and normal regions from the same tissue sections Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78007-1
#
2010 Elsevier Inc. All rights reserved.
165
166
Atsushi Kuno et al.
are compared. In this chapter, we describe a simple but powerful method using an ultrasensitive lectin microarray, which enables rapid and systematic differential glycan analysis targeting restricted regions of formalin-fixed tissue specimens, for example, one-dot sections formatted on tissue arrays. Using this advanced technology followed by an objective statistical analysis, we can select lectin probes to best fit subsequent enrichment procedures to identify target glycoproteins that discriminate diseased and normal regions in the tissue specimens.
1. Overview Cell differentiation and proliferation are associated with changes in cellular-level glycosylation, and this is attributed to significant differences in glycosylation machinery among cells. Aberrant glycosylation is also strongly correlated with tumor progression and malignancy, as evidenced by observed changes in expression of a tumor-specific marker, CA19-9 antigen (sialyl-Lea) (Fukuda, 1996) and metastasis-associated extension of the b1-6 branch on N-glycans (Taniguchi et al., 1999). Specific glycoconjugates (e.g., glycoproteins) can be useful markers to inform us of ‘‘what is going on now’’ with respect to disease. Discovery of disease-specific glyco-biomarkers requires detection by specific probes, typically antibodies showing affinity to a certain class of glycans or lectins (general name defined for carbohydratebinding proteins). For instance, Helix pomatia agglutinin (HPA) has affinity for aGalNAc and has been used for histochemical localization of specific glycoconjugates related to lymph node metastasis of several cancers (Brooks and Leathem, 1991; Kakeji et al., 1991; Schumacher et al., 1994; Tho¨m et al., 2007). This also implies that lectin becomes a relevant probe to enrich glycoproteins reflecting the glyco-alteration in tumor metastasis. This ‘‘enrichment’’ procedure (not only to selectively enrich particular types of glycoproteins but also remove unrelated ones) is of particular importance because clinical samples usually comprise numerous glycoproteins with different origins (i.e., with different glycosylation features). Therefore, the biomarker approach will not work properly without paying attention to changes in glycosylation. A strategy based on the above concept of ‘‘glycoproteomics’’ is described, along with the development of the concept of pragmatic ‘‘glyco-biomarker pipelines’’ (Liu et al., 2010; Narimatsu et al., 2010). To select the best probe for detecting glyco-alteration, we need prior structural information of the disease-specific glyco-alteration. This is usually made by comparative analyses of a series of tissue specimens using recent advances in laser microdissection technology (Kondo and Hirohashi, 2006). This technique permits analysis of N-glycans and glycolipids extracted from
167
Tissue Glycan Profiling using Lectin Array
a small portion of tissue specimens using liquid chromatography and mass spectrometry (Korekane et al., 2007; Misonou et al., 2009). At present, however, relatively large tissue specimens are required for differential profiling techniques and this has prevented extensive retrospective analyses. Lectin-based glycan profiling is an alternative approach to obtain global structural information from a rapid and direct method (Hirabayashi, 2004). On the basis of this principle, we established a highly feasible procedure for tissue-based differential glycan profiling (Matsuda et al., 2008). Significant advantages of this system include: (1) high-throughput performance with a simple and rapid pretreatment manipulation, (2) multiplex analysis by 43 lectins with defined binding specificities covering both N- and O-glycans, and (3) ultra-sensitivity sufficient to detect glycoproteins derived from very small regions (i.e., ‘‘one-dot’’ section comprising about 1000 cells corresponding to 1.5 mm diameter and 5 mm thicknes of tissue array) dissected from conventional formalin-fixed paraffin-embedded specimens. In this regard, it should be emphasized that this advanced technique was realized only with the high sensitivity lectin microarray system (Kuno et al., 2005; Fig. 7.1). A major advantage of this technique is that formalin-fixed tissue sections can be used for differential glycan profiling, thus allowing retrospective analysis of clinical specimens derived from individuals on the same day. Using this method, we identified Wisteria floribunda agglutinin (WFA) as the most reliable lectin probe to detect cholangiocarcinoma (CC)-specific glyco-alteration by direct comparison between relevant sections, for example, cancer and non-cancerous regions (Matsuda et al., 2010). In this chapter, we describe the method for tissue-targeted glycan profiling
LecChipTM
GlycoStationTM
Reader1200
Data storage (> 1.0 TB)
PC for data analysis
Figure 7.1 An overview of the lectin microarray system. The system is composed of an evanescent-field fluorescence scanner GlycoStationTM Reader1200, a hard disk for data (> 1 TB) storage, a PC for data analysis, and a lectin microarray chip. Commercialized lectin microarray LecChipTM is purchased from GP Bioscience, Inc.
168
Atsushi Kuno et al.
using both commercial tissue arrays and clinical specimens. The protocol for scratching tissue sections has been updated since the original report published in 2008, and is included here in detail.
2. Differential Analysis of Glycoproteins Derived from One-Dot Sections of Tissue Microarray Recent advances in tissue array technology enable us to use a variety of tissue sections from patients with different diseases (Kononen et al., 1998). All specimens on commercially available tissue array have received approval from the Ethics Committee, and so tissue array has been frequently utilized for histochemical studies, expression analyses by q-PCR, and so on. We describe here a method of differential analysis of tissue glycoproteins extracted from one-dot sections of tissue arrays (Fig. 7.2).
2.1. Methods for preparation of Cy3-labeled glycoprotein from formalin-fixed tissue sections 1. Deparaffinization: Formalin-fixed paraffin-embedded tissue microarrays are deparaffinized by incubating in xylene (2 10 min) and with sequential incubations in (i) 100% EtOH for 10 min, (ii) 95% EtOH for 10 min, (iii) 90% EtOH for 5 min, (iv) 80% EtOH for 5 min, (v) 70% EtOH for 5 min, and (vi) MilliQ water for 5 min. The tissue microarrays are then dried at room temperature (RT). Comment: Contrast of each specimen on the tissue array was enhanced using hematoxylin and eosin (HE) staining before the differential analysis. Two or more sequential tissue array sections were therefore prepared. In our previous report (Matsuda et al., 2008), two sequential tissue arrays comprising three dots for each specimen was purchased from Cybrdi, Inc. (Gaithersburg, MD), with one dot used for lectin staining, and the other two dots used for lectin microarray analysis (Fig. 7.3). 2. Tissue scratching: Each specimen on the array glass slide is viewed using a microscope and scratched using a needle (gauge size: 21 gauge) connected to a disposable syringe. The scratched tissue fragments are collected into a 1.5-mL microtube containing 200 mL of 10 mM citrate buffer (pH 6.0) and incubated for 1 h at 95 C (antigen retrieval). The heat treated solution is centrifuged at 20,000g for 5 min, and the supernatant discarded. Comment: We recently adapted this protocol, using a disposable scalpel (AS ONE Co., Osaka, Japan) in place of the needle because it
169
Tissue Glycan Profiling using Lectin Array
I. Preparation of Cy3-labeled glycoprotein
1. Deparaffinization
2. One-dot tissue scratching
3. Protein extraction
4. Cy3labeling
II. Lectin microarray analysis and data processing
Normal vs. Tumor 1. Sample injection Binding reaction 2. Scanning
3. Data-processing
III. Selection of the best lectin probe P < 0.001
P = 0.002 60 40
40 30 20
20
10
0
0 N T N T 1. Statistical analysis
2. Lectin staining
Figure 7.2 A scheme for manipulation of lectin microarray analysis targeting tissue arrays.
can scratch one-dot tissue with a single stroke. Fragmentation of deparaffinized tissue is prevented by spraying distilled water on the edge of the needle or scalpel. 3. Protein extraction: The pellet is rinsed with 200 mL of PBS, centrifuged at 20,000g for 5 min, and the subsequent pellet resuspended in 20 mL of PBS containing 0.5% Nonidet P-40 (NP-40) with gentle sonication. The suspension is stored on ice for 1 h, and the cell debris is pulled down by centrifugation at 20,000g for 5 min. The supernatant is transferred to a new tube (designated detergent-solubilized glycoprotein extract).
170
Atsushi Kuno et al.
For HE staining
Qualification of tissue sections
Bad
Good Disposable scalpel
For lectin assay Two deparaffinized colon tissue arrays with 63 dots (three dots per one specimen) 1.5 mm in diameter, 5 mm thickness
Figure 7.3
Scratched for lectin microarray Left for lectin histochemistry
How to scratch one-dot tissue section from a colon tissue array.
4. Cy3 labeling: Ten micrograms of Cy3-SE (GE Healthcare, UK) is added to the detergent-solubilized glycoprotein extract and then incubated at RT for 1 h in the dark. The reaction product is applied onto a spin column (BioRad, Hercules, CA) containing Sephadex-G25 (GE Healthcare) to remove the excess fluorescent reagent. The product is eluted by adding 50 mL of probing buffer (1.0% Triton X-100 and 500 mM glycine in Tris-buffered saline (TBS)) to the column and centrifuging at 1500g for 1 min. The volume of the eluant is adjusted to 200 mL with the probing buffer and incubated for 2 h at RT to inactivate any residual fluorescent reagent.
2.2. Methods for lectin microarray analysis and data processing 1. Sample injection and binding reaction: The Cy3-labeled protein solution is diluted with the probing buffer to an appropriate concentration. The analyte solution is applied to the lectin microarray glass slide produced as described previously (Uchiyama et al., 2006, 2008). The glass slide is incubated with gentle rotation at 20 C for over 12 h. Comment: The density and species of the tissue array dots are not always identical to one another, causing significant deviation in signal intensities among the analytes (Fig. 7.4). Thus, various concentrations of Cy3-labeled protein solution should be simultaneously subjected to lectin microarray analysis to obtain results with appropriate signal intensities.
171
Tissue Glycan Profiling using Lectin Array
A
1/2
1/4
1/8
B
Figure 7.4 Glycan profiles of tissue dots of lung adenocarcinoma (A) and normal lung (B). (Left) HE staining images of tissue dots used in this study. (Right) Scan images of Cy3-labeled glycoprotein solutions. A series of dilute protein solutions were subjected to the lectin microarray. Among them, 1/8 dilution solution of lung adenocarcinoma and 1/2 dilution solution of normal lung were selected and used for comparative analysis.
2. Scanning: After the binding reaction, the glass slide is washed three times with the probing buffer, and then scanned with GlycoStationTM Reader 1200 (GP Bioscience, Inc.), saving the scanned image as a TIFF file for analysis by Array Pro Analyzer version 4.5 (Media Cybernetics, Inc.), and as a JPEG file. The net intensity value is obtained from the mean of three spots after subtraction of the respective background values. Comment: GlycoStationTM Reader 1200 allows acquisition of a series of scan images with different gain conditions. For best results, we recommend that array scanning is performed with at least five gain conditions. The most suitable dilution should be selected for the following data-processing. 3. Data-processing: Data processing described previously (Kuno et al., 2008) is necessary to substantiate differential glycan profiling using clinical samples. To cover a wider dynamic range of signal intensities, a lectin microarray glass slide should be scanned under two different gain conditions; higher gain to ‘‘rescue’’ weak signals below 1000 (IntH ðlectin f Þ ) and lower gain to ‘‘suppress’’ excessively strong signals over 40,000 (IntLðlectin dÞ ). Appropriate lectins are selected by ‘‘merging’’ lectins with the signal intensities ranging from 1000 to 40,000 under both higher and lower gain conditions. A Factor (F) value is determined as the average of higher/lower ratios calculated for individual merging lectins by Eq. (7.1):
172
Atsushi Kuno et al.
L F ¼ AverageðIntH i =Inti Þ
ð7:1Þ
The over-range intensities (>40,000) obtained under the higher gain condition (e.g., IntH ðlectin cÞ ) are replaced with theoretical intensities (IntTðlectin cÞ ) by Eq. (7.2): IntTðlectin cÞ ¼ IntLðlectin cÞ F
ð7:2Þ
For other lectins with no over-range using the higher gain condition, signal intensities are used with no modification. The merged data is normalized relative to the strongest intensity among the positive-spots under the given conditions (this type of normalization is designated ‘‘max-normalization’’). However, normalization procedures vary depending on the purpose of the studies, for example, normalization by the mean of signal intensities of all lectins and by a particular lectin (see also Chapter 8).
2.3. Methods for selection of the best lectin probe 1. Statistical analysis: To select the most diagnostic lectin, all of the processed data obtained above are statistically analyzed between two independent specimens, for example, cancer and non-cancer. Since data distribution of every lectin signal is probably indicated as asymmetric or symmetric with large-tails, nonparametric statistics, such as chi-square test and Mann–Whitney U-test, are applied. 2. Lectin staining: The deparaffinized tissue array for lectin staining is incubated in 10 mM citrate buffer (pH 6.0), and then autoclaved at 121 C for 20 min (antigen retrieval). After cooling and washing the slide with PBS, endogenous peroxidase is blocked by incubating the slide in methanol containing 0.3% H2O2 at RT for 10 min. The tissue section is rinsed with PBS, blocked with PBS containing 1% BSA, and then incubated for 1 h at RT with 2 mg/mL of biotinylated lectin in 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES). Detection of the binding lectin is made with Histofine Simple Stain MAX-PO (Nichirei Co., Tokyo, Japan). A more practical example of differential profiling is described using sections from colon cancer patients (16 cases of grade III) and normal colon tissues (12 cases) obtained from Cybrdi, Inc. (Frederick, MD). As a result of differential analysis using the normalized data (Fig. 7.5A), it was found that 11 lectins showed significant alterations in the mean binding signals. Disialyl-T binder MAH, a2,6-Sia binders SSA, SNA and TJA-I, an a1,6-branched mannose
173
Tissue Glycan Profiling using Lectin Array
A
C
Normal mean
Cancer mean
29.17 18.78 39.96 19.38 13.83 24.46 17.26 22.17 17.33 9.42 2.76
52.17 37.75 77.12 32.38 24.81 11.48 6.06 11.03 7.5 3.53 5.47
SNA SSA TJA-I RCA120 HHL BPL WFA ACA HPA DBA MAH B
SSA
SNA 60
90 80 70 60 50 40 30 20 10 0
50 40 30 20 10
N
G III HHL
50 40 30 20 10 0
N
G III
N
120 100 80 60 40 20 0
G III
40 30 20 10 0
WFA
G III ACA
50 40
30
30
20
20
10
10
0
0
–10
G III
N
G III
40
N
RCA120 50
N
BPL
50 40 30 20 10 0 –10
TJA-I
N
G III
N
G III
Figure 7.5 Differential glycan analysis between colon normal control and adenocarcinoma (grade III) tissues. Twenty-one and 23 cases of individual patients were used for normal colon and adenocarcinoma, respectively. Acquired signal patterns were normalized against a lectin showing the maximum intensity in each analysis, that is, UDA for colon adenocarcinoma and STL for normal control colon, respectively. (A) Differential glycan analysis between adenocarcinoma and normal controls in a colon tissue array using only data for 11 lectins are shown. (B) Box and whisker plots representation of the data obtained by the selected eight lectins, which shows the average (dot), the 75th and 25th percentiles (the top and bottom of the box, respectively), the median (line through the middle of the box), and the maximum and minimum (the top and bottom of the whiskers, respectively). (C) WFA staining of colon normal tissue dot.
174
Atsushi Kuno et al.
binder HHL, and an N-acetyl-lactosamine binder RCA120 showed apparent increase in binding to adenocarcinoma tissues (grade III), while a T/Tnantigen binder BPL, a core 1 binder ACA, a-GalNAc binders HPA and DBA, and an a/b-GalNAc binder WFA showed an apparent decrease in binding. In the next step, signal variance was statistically analyzed using a two-sided w2 test. As shown in Fig. 7.5B, eight lectins, that is, SSA, SNA, TJAI, HHL, RCA120, BPL, ACA, and WFA yielded good statistical scores (P < 0.001). Among them, WFA showed the best score for discrimination between both normal and grades IþII (P < 0.0001) and between normal and grade III. This observation indicates that glycan epitopes recognized by WFA are drastically reduced in carcinogenesis, even in well-differentiated tumor cells. This phenomenon was confirmed by a histochemical approach employing biotin-labeled WFA and normal and grades III specimens, where WFA staining was observed on mucin-producing goblet-like cells in the normal control specimens (Fig. 7.5C), but not in grade III specimens. Substantial disappearance of the goblet-like cells in grade III specimens was noted, in accordance with the tumor progression.
3. Differential Glycan Analysis Between Cancer Lesions and Normal Regions in the Same Tissue Section Archival formalin-fixed, paraffin-embedded surgical specimens are ideal for differential profiling using the above lectin microarray as they allow comparisons of cancerous and normal regions of tissue. Thus, multiple (> 40) lectins can be compared (bottom of Fig. 7.6C), eliminating possible dispersion attributable to individual differences. An actual procedure to dissect specific regions manually from tissue sections is described below (in case there is no microdissection machine).
3.1. Method for dissecting specific regions in tissue sections Two sequential tissue sections are prepared: one is for HE staining (top of Fig. 7.6A) and the other for tissue dissection (bottom of Fig. 7.6A). Cancer and normal regions are first assigned from the HE-stained tissue specimen using a microscope (we recommend to ask opinions from expert pathologists for rigorous clinical assignment). The relevant tissue fragments (corresponding to 1.0 mm2 and 5 mm thickness) are scratched from the sections using a needle (gauge size: 21 gauge) under a microscope and processed as described above for preparation of Cy3-labeled protein solution.
175
Tissue Glycan Profiling using Lectin Array
B
A
CC
N
CC
Lectins
N
CC N
A B C D E F G H I J K L M N O P Q R S T U V W
Normalized signal C
D
WFA
30.00
N
15.00
0.00
N
CC CC
15.00 10.00 5.00 0.00
N
CC
Figure 7.6 Differential glycan analysis between cholangiocarcinoma (CC) and normal BDE (N). (A) Regions of cholangiocarcinoma (CC) and normal BDE (N) in the same tissue section and scratched are shown. Two sequential tissue sections were prepared for HE staining and tissue dissection. The relevant tissue fragments (corresponding to 1.0 mm2 and 5 mm thickness) were scratched from the glass slide using a needle (gauge size: 21 gauge) under a microscope. (B) A vertical bar graph representation of the data obtained for 23 representative lectins and 10 specimens. (C) A box and whisker plot (top) and a dot graph (bottom) representation of the data obtained for WFA. The data show significant differences in signals between CC and normal BDE lesions in the same specimens. (D) Fluorescence staining with WFA in CC and normal (N) tissues. WFA was visualized by Alexa 488 (green fluorescence). All panels are as viewed by fluorescence microscopy.
176
Atsushi Kuno et al.
An example was recently reported using cancerous lesions and normal bile duct epithelium (BDE) from the CC specimen each derived from the same patient (14 and 10 cases with and without stones, respectively). The results obtained for the cases of patients without stones are summarized in Fig. 7.6. To identify lectins specific for CC, we analyzed 10 cases of paraffinembedded, formalin-fixed CC tissue sections, which included both cancerous lesions and normal BDE. We obtained intense signals of 23 lectin spots on 43lectin microarray and found significant (P < 0.0001) differences in four lectins (Fig. 7.6B), with the highest score obtained for WFA (Fig. 7.6C). To confirm the result of lectin microarray, histochemical lectin staining was performed to visualize the expression of WFA-reactive glycans using biotinylated WFA. Significant WFA staining was detected with high frequency in CC (bottom of Fig. 7.6D), but with much less frequency in normal BDE (top of Fig. 7.6D). Taken together, we have shown for the first time specific expression of WFA-reactive glycans in CC.
4. (Optional)Glycan Profiling of a Target Glycoprotein Extracted from Tissue Specimens If one has already identified a target glycoprotein, specific tissue regions in specimens can be immunohistochemically assigned with assured dissection (initial step in Fig. 7.7). For focused differential glycan analysis, a target glycoprotein is enriched from the protein extract by immunoprecipitation (Fig. 7.7) and lectin microarray analysis is subsequently performed, in this case, by a modified procedure designated the ‘‘antibody-overlay detection’’ method (Kuno et al., 2009).
4.1. Differential glycan analysis of a fixed target glycoprotein in tissue sections by antibody-assisted lectin profiling One of the sequential tissue sections is immunostained using an antibody against the glycoprotein of interest. The area on the counterpart sections is dissected using a disposable scalpel with the aid of the microscope. After extraction of the protein from the obtained tissue fragments, a target protein is enriched preferably using antibody-immobilized resin. The enriched protein solution is directly applied to lectin microarray, and the array is incubated at 20 C for 12 h. After the binding reaction, 20 mg of human serum polyclonal IgG (Sigma) is added to the array followed by 30-min incubation to mask nonspecific binding sites. The reaction solution is discarded and the glass slide is washed three times with PBS containing 1% Triton X-100 (PBSTx). Biotinylated antibody solution (60 mL) dissolved
177
Tissue Glycan Profiling using Lectin Array
Immuno-staining
Sample injection and binding reaction
Tissue scratch and protein extraction
Crude protein mixture
Enriched protein Immunoprecipitation
Figure 7.7 Differential analysis of podoplanin enriched from tissue specimens of seminoma xenocraft. After immunostaining with an antipodoplanin antibody, a podoplanin-positive area on the counterpart sections was selectively dissected (excised volume estimated to be approximately 3.6 mm3). hPod was enriched with antipodoplanin antibody-immobilized Sepharose, and was analyzed by antibody-overlay lectin microarray.
in PBSTx is applied to the array, and then the reaction is allowed to proceed at 20 C for 1 h. After washing three times with PBSTx, 60 mL of Cy3-labeled streptavidin (GE Healthcare) solution in PBSTx is added, and the array is incubated at 20 C for 30 min. The glass slide is rinsed with PBSTx, and array scanning and data analyses are performed as described above.
ACKNOWLEDGMENTS We thank Nobuko Ohmichi and Sachiko Unno for manipulating lectin microarray analysis. Thanks also to Yoshiko Kubo and Jinko Murakami for supply of lectin microarray. This work was supported by New Energy and Industrial Technology Development Organization (NEDO) in Japan.
REFERENCES Brooks, S. A., and Leathem, A. J. (1991). Prediction of lymph node involvement in breast cancer by detection of altered glycosylation in the primary tumour. Lancet 338, 71–74. Fukuda, M. (1996). Possible roles of tumor-associated carbohydrate antigens. Cancer Res. 56, 2237–2244.
178
Atsushi Kuno et al.
Hirabayashi, J. (2004). Lectin-based structural glycomics: Glycoproteomics and glycan profiling. Glycoconj. J. 21, 35–40. Kakeji, Y., Tsujitani, S., Mori, M., Maehara, Y., and Sugimachi, K. (1991). Helix pomatia agglutinin binding activity is a predictor of survival time for patients with gastric carcinoma. Cancer 68, 2438–2442. Kondo, T., and Hirohashi, S. (2006). Application of highly sensitive fluorescent dyes (CyDye DIGE Fluor saturation dyes) to laser microdissection and two-dimensional difference gel electrophoresis (2D-DIGE) for cancer proteomics. Nat. Protoc. 1, 2940–2956. Kononen, J., Bubendorf, L., Kallioniemi, A., Barlund, M., Schraml, P., Leighton, S., Torhorst, J., Mihatsch, M. J., Sauter, G., and Kallioniemi, O.-P. (1998). Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat. Med. 4, 844–847. Korekane, H., Shida, K., Murata, K., Ohue, M., Sasaki, Y., Imaoka, S., and Miyamoto, Y. (2007). Evaluation of laser microdessection as a tool in cancer glycomic studies. Biochem. Biophys. Res. Commun. 352, 579–586. Kuno, A., Uchiyama, N., Koseki-Kuno, S., Ebe, Y., Takashima, S., Yamada, Y., and Hirabayashi, J. (2005). Evanescent-field fluorescence-assisted lectin microarray: A new strategy for glycan profiling. Nat. Methods 2, 851–856. Kuno, A., Itakura, Y., Toyoda, M., Takahashi, Y., Yamada, M., Umezawa, A., and Hirabayashi, J. (2008). Development of a data-mining system for differential profiling of cell glycoproteins based on lectin microarray. J. Proteomics Bioinform. 1, 68–72. Kuno, A., Kato, Y., Matsuda, A., Kaneko, M. K., Ito, H., Amano, K., Chiba, Y., Narimatsu, H., and Hirabayashi, J. (2009). Focused differential glycan analysis with the platform antibody-assisted lectin profiling (ALP) for glycan-related biomarker verification. Mol. Cell. Proteomics 8, 99–108. Liu, Y., He, J., Li, C., Benitez, R., Fu, S., Marrero, J., and Lubman, D. M. (2010). Identification and confirmation of biomarkers using an integrated platform for quantitative analysis of glycoproteins and their glycosylations. J. Proteome Res. 9, 798–805. Matsuda, A., Kuno, A., Ishida, H., Kawamoto, T., Shoda, J.-I., and Hirabayashi, J. (2008). Development of an all-in-one technology for glycan profiling targeting formalin-embedded tissue sections. Biochem. Biophys. Res. Commun. 370, 259–263. Matsuda, A., Kuno, A., Kawamoto, T., Matsuzaki, H., Irimura, T., Ikehara, Y., Zen, Y., Nakanuma, Y., Yamamoto, M., Ohkohchi, N., Shoda, J.-I., Hirabayashi, J., et al. (2010). Wisteria floribunda agglutinin-positive MUC1 is a sensitive biliary marker for human intrahepatic cholangiocarcinoma. Hepatology 52, 174–182. Misonou, Y., Shida, K., Korekane, H., Seki, Y., Noura, S., Ohue, M., and Miyamoto, Y. (2009). Comprehensive clinico-glycomic study of 16 colorectal cancer specimens: Elucidation of aberrant glycosylation and its mechanistic causes in colorectal cancer cells. J. Proteome Res. 8, 2990–3005. Narimatsu, H., Sawaki, H., Kuno, A., Kaji, H., Ito, H., and Ikehara, Y. (2010). A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics. FEBS J. 277, 95–105. Schumacher, U., Higgs, D., Loizidou, M., Pickering, R., Leathem, A., and Taylor, I. (1994). Helix pomatia agglutinin binding is a useful prognostic indicator in colorectal carcinoma. Cancer 74, 3104–3107. Taniguchi, N., Miyoshi, E., Ko, J. H., Ikeda, Y., and Ihara, Y. (1999). Implication of N-acetylglucosaminyltransferases III and V in cancer: Gene regulation and signaling mechanism. Biochim. Biophys. Acta 1455, 287–300. Tho¨m, I., Schult-Kronefeld, O., Burkholder, I., Goern, M., Andritzky, B., Blonski, K., Kugler, C., Edler, L., Bokemeyer, C., Schumacher, U., and Laack, E. (2007). Lectin histochemistry of metastatic adenocarcinomas of the lung. Lung Cancer 56, 391–397.
Tissue Glycan Profiling using Lectin Array
179
Uchiyama, N., Kuno, A., Koseki-Kuno, S., Ebe, Y., Horio, K., Yamada, M., and Hirabayashi, J. (2006). Development of a lectin microarray based on an evanescentfield fluorescence principle. Methods Enzymol. 415, 341–351. Uchiyama, N., Kuno, A., Tateno, H., Kubo, Y., Mizuno, M., Noguchi, M., and Hirabayashi, J. (2008). Optimization of evanescent-field fluorescence-assisted lectin microarray for high-sensitivity detection of monovalent oligosaccharides and glycoproteins. Proteomics 8, 3042–3050.
C H A P T E R
E I G H T
A Versatile Technology for Cellular Glycomics Using Lectin Microarray Hiroaki Tateno, Atsushi Kuno, Yoko Itakura, and Jun Hirabayashi Contents 1. Introduction 2. Strategy for Systematic Development of Cell Discrimination Procedures Using Lectin Microarray 3. Production of the Lectin Microarray 4. Sample Preparation and Lectin Microarray Hybridization 5. Data Normalization 6. Glycan Profiles of CHO, Lec2, Lec8, and Lec1 7. Unsupervised Clustering and Principal Component Analysis 8. Significance Difference Test 9. Discriminant Analysis 10. Differential Analysis Between CHO and Lec1 11. Validation 12. Concluding Remarks Acknowledgments References
182 182 183 185 185 186 189 190 191 192 193 193 195 195
Abstract All cells in nature are covered with a dense and complex array of glycans. The total glycan repertoire expressed on cells, ‘‘the cellular glycome,’’ varies at every level of biological organization, and in response to intrinsic and extrinsic stimuli. The cellular glycome is often referred to as the ‘‘cell face,’’ which reflects the condition and type of the cell. In other words, cells can be discriminated in detail by characterization of their individual cellular glycome. Based on this concept, we describe our strategy for profiling the cellular glycome using lectin microarray followed by lectin-based cell discrimination using Chinese hamster ovary cells and their glycosylation-defective mutants (Lec1, Lec2, and Lec8) as models. The results add to the understanding and applications of ‘‘Cellular Glycomics.’’ Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Central 2, Umezono, Ibaraki, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78008-3
#
2010 Elsevier Inc. All rights reserved.
181
182
Hiroaki Tateno et al.
1. Introduction It is a universal principle that all cells in nature are covered with a dense and complex array of glycans. These cell surface glycans are known to mediate many important biological phenomena, including structural and physical roles as well as specific recognition by both extrinsic and intrinsic lectins (Gagneux and Varki, 1999). Diversity in glycosylation exists at every level of biological organization; between species, and among different tissues, cell types, and molecules within the same organism. Changes in glycosylation also occur in relation to both inner and outer cellular environmental changes such as cell activation, differentiation, inflammation, and malignant transformation. Therefore, the cellular glycome is often referred to as the ‘‘cell face,’’ which reflects cellular conditions. Cells can be discriminated in detail by characterization of their individual cellular glycome. Consistently, many tumor and stem cell markers are glycans such as CA199, SSEA3/4, Tra1-60, and Tra1-81. The complexity and diversity of glycans seem to be greater than that can be explained simply by evolutionary pressure, called the ‘‘Red Queen Effect’’ (Gagneux and Varki, 1999). Before a comprehensive explanation for glycan diversity is possible, full comprehension of the glycan diversity of cellular life is a challenging issue in need of solution. In fact, no information is available on the glycans in many organisms. Although we can presume the importance of changes in cell surface glycans from traces of information obtained by a relatively small set of lectins or antibodies, we still do not know how and to what degree cell surface glycans change. One of the reasons is that there has been no practical technology to survey global changes in the cellular glycome in a highthroughput and sensitive manner. In the previous chapter (Chapter 7), we described development of a lectin microarray for glycan profiling, and its application to the discovery of disease-related biomarkers. Here, we demonstrate the experimental feasibility of lectin microarray, followed by lectin-based cell discrimination procedures without antibodies, in profiling the cellular glycome.
2. Strategy for Systematic Development of Cell Discrimination Procedures Using Lectin Microarray A strategy for development of cell discrimination procedures using a lectin microarray is shown in Fig. 8.1. The strategy comprises four steps: sample preparation (I), lectin microarray (II), statistical analysis (III), and validation (IV). Here, we applied this systematic approach for wild-type
183
Cellular Glycomics Using Lectin Microarray
I: Sample prep.
II: Lectin microarray
Preparation of Cy3-labeled cell membrane fractions or CMRA-labeled live cells
Production of lectin microarray
Lectin microarray analysis
Data normalization
Unsupervised cluster analysis
Principal component analysis III: Statistical analysis Significance difference test
Canonical discriminant analysis
IV: Validation
Cell staining, lectin blotting, etc.
Figure 8.1 A strategy for the systematic development of cell discrimination procedures based on lectin microarray.
(WT) and glycosylation-defective mutants (Lec1, Lec2, and Lec8) of Chinese hamster ovary (CHO) cells used as models. Lec2, Lec8, and Lec1 are deletion mutants of CMP-Sia transporter, UDP-Gal transporter, and MGAT1 (mannosyl (a-1,3-)-glycoprotein-b-1,2-N-acetylglucosaminyltransferase), respectively.
3. Production of the Lectin Microarray The lectin microarray was produced as previously described with minor modifications (Kuno et al., 2005; Uchiyama et al., 2006, 2008). Briefly, lectins were dissolved at a concentration of 0.5 mg/mL in a spotting solution (Matsunami Glass), and spotted onto epoxysilane-coated glass slides (Schott) in triplicate using a noncontact microarray printing robot, MicroSys 4000 (Genomic solutions). The glass slides were incubated at 25 C for 3 h to allow lectin immobilization. The lectin-immobilized
184
Hiroaki Tateno et al.
glass slides were then washed with probing buffer (25 mM Tris–HCl, pH 7.5, 140 mM NaCl (TBS) containing 2.7 mM KCl, 1 mM CaCl2, 1 mM MnCl2, and 1% Triton X-100), blocked with blocking reagent N102 (NOF Co.) at 20 C for 1 h, and stored in TBS containing 0.02% NaN3 at 4 C until use. The spot quality and reproducibility of the produced microarrays were then checked using a Cy3-labeled 10-mix probe containing 250 mg/mL asialofetuin (Sigma-Aldrich), 25 ng/mL Siaa23Galb1-4GlcNAc-BSA (Dextra), 10 ng/mL Fuca1-2Galb1-3GlcNAcb13Galb1-4Glc-BSA (Dextra), 10 ng/mL bGlcNAc-BSA (Dextra), 10 ng/mL GalNAca1-3(Fuca1-2)Gal-BSA (Dextra), 10 ng/mL Gala1-3Galb14GlcNAc-BSA (Dextra), 10 ng/mL Mana1-3(Mana1-6)Man-BSA (Dextra), 10 ng/mL aFuc-BSA (Dextra), 10 ng/mL aGalNAc-BSA (Dextra), and 10 ng/mL Siaa2-6Galb1-4Glc-BSA (Dextra) in probing buffer. The concentration of each compound was optimized to provide maximum fluorescence without saturation of binding sites of immobilized lectins. A representative image is shown in Fig. 8.2.
Positioning marker (Cy3-BSA)
A LTL
TJAI
GNA
STL
VVA
1
PSA
PHAL
HHL
UDA
DBA
2
LCA
ECA
BSA
PWM
SBA
3
UEAI
RCA120
BSA
Jacalin
GSLI
4
AOL
PHAE
BPL
PNA
PTLI
5
AAL
DSA
TJAII
WFA
MAH
6
MAL
GSLII
EEL
ACA
WGA
7
SNA
NPA
ABA
MPA
GSLI-A4
SSA
ConA
LEL
HPA
GSLI-B4
Rubber sheet
Glass slide
B
Figure 8.2 (A) Lectin spotting pattern. (B) A representative image of lectin microarray data obtained using the Cy3-labeled 10-mix probe for quality check.
Cellular Glycomics Using Lectin Microarray
185
4. Sample Preparation and Lectin Microarray Hybridization To profile the cellular glycome using lectin microarray (Kuno et al., 2005), two methods are currently available. One is to use cell membrane fractions (Ebe et al., 2006; Kuno et al., 2008) and the other is direct profiling of live cells (Tateno et al., 2007). Here, we applied cell membrane fractions of CHO, Lec2, Lec8, and Lec1 for lectin microarray analysis. Detailed protocols are also available on the website of GP Biosciences (http://www.gpbio.jp/ english/index.html). 1. Cells were cultured in T150 flasks, each cell line in three flasks. On reaching 80% confluence, cells were recovered, washed with PBS three times, and stored at 80 C until use. 2. Hydrophobic fractions were prepared using CelLytic MEM Protein Extraction (Sigma-Aldrich) in accordance with the manufacturer’s procedures with minor modifications. 3. After protein quantification using BCA assay (Thermo Fisher Scientific), hydrophobic fractions were fluorescently labeled with Cy3 MonoReactive dye (GE) and excess Cy3 was removed with Sephadex G-25 desalting columns (GE). 4. After dilution, Cy3-labeled hydrophobic fractions were incubated with lectin microarray at 20 C overnight. 5. After washing with probing buffer, bound fluorescence was scanned using a GlycoStationTM Reader 1200 (GP Biosciences). 6. Data were analyzed with the Array-Pro Analyzer ver.4.5 (Media Cybernetics). To determine the optimal protein concentration, varying concentrations of the hydrophobic fraction (0.016, 0.03, 0.06, 0.125, 0.25, 0.5, and 1 mg/mL) of each cell line were first analyzed by lectin microarray. Fluorescence intensity was increased in a concentration-dependent manner. As the binding curves of some lectins reached saturation at a concentration of 1 mg/mL, we analyzed samples at a concentration of 0.5 mg/mL, which provided maximum fluorescence without saturation of the binding sites of immobilized lectins.
5. Data Normalization The routine application of lectin microarray for profiling the cellular glycome requires establishment of optimized analytical methods to ensure the proper interpretation of the data. Normalization is a common data processing procedure for microarray, which adjusts the data from each microarray to
186
Hiroaki Tateno et al.
Table 8.1 Normalization methods
Max Mean Particular lectin Median
The signal intensity was multiplied by a normalization factor N for each array, which was calculated by N ¼ 1/m, where m is: The highest signal intensity of all of the lectins on the array The mean of all of the lectins on the array The signal intensity of one selected lectin on the array The median of all of the lectins on the array
account for possible systematic variation in factors such as microarray quality, scanner detection stability, sample preparation reproducibility, and labeling efficiency. Previously, Kuno et al. (2008) developed a gain-merging procedure to increase the dynamic range. Here, we evaluated the effects of four different normalization methods to determine the optimal normalization procedure to process lectin microarray data: ‘‘max,’’ ‘‘mean,’’ ‘‘particular lectin,’’ and ‘‘median’’ (Table 8.1). Hydrophobic fractions from the four different cell lines (CHO, Lec1, Lec2, and Lec8), each in triplicate (total 12 cells), were incubated on a microarray containing 43 lectins. The set of 12 samples was analyzed in quadruplicates using different batches of microarrays that had been printed on different days. The effect of normalization on the reproducibility between replicate data sets was evaluated by examining the coefficients of variation (CV) between replicate experiments. The CV of each lectin (SD divided by average) among the quadruplicate measurements of triplicate samples (total 12 measurements) was calculated for each normalization method. The average CVs of lectins with >3000 signal intensity (approximately 3000 is the lower limit of quantitative detection of fluorescence by the scanner after gain-merging) was compared between the nonnormalized data and each set of normalized data. Since the median of 43 lectins gave ‘‘0’’ in many samples, this normalization method was considered to be unsuitable for the processing of lectin microarray data. Among the three normalization methods, the mean normalization gave significantly lower average CVs (0.18–0.26) in comparison with the nonnormalized data (0.24–0.31) (Fig. 8.3). We therefore adopted the mean normalization to process lectin microarray data in this study. It should be noted, however, that the most adequate normalization procedures vary depending on the purpose of the study.
6. Glycan Profiles of CHO, Lec2, Lec8, and Lec1 Glycan profiles of CHO cells and their glycosylation-defective mutants, Lec2, Lec8, and Lec1, were compared (Fig. 8.4). Representative structures of N- and O-glycans of each cell line are also shown in Fig. 8.4. CHO cells express a broad range of complex-type N-glycans, high-
187
CV average of lectins with >3000 signal intensity
Cellular Glycomics Using Lectin Microarray
35 30 25 20 15 10 5 0 CHO
Lec1
Lec2
Lec8
Cell Non-normalized Mean-normalized
Max-normalized LEL-normalized
Figure 8.3 Comparison of the effects of normalization procedures. CHO, Lec1, Lec2, and Lec8, each prepared in triplicate, were incubated on a microarray containing 43 lectins. The set of 12 cells was analyzed in quadruplicate using different batches of microarrays. The fluorescence intensity was first processed with the gain-merging procedure (Kuno et al., 2008) and the effect of normalization between replicate data sets was evaluated by examining the coefficients of variation (CV) between the replicate experiments. The CV of each lectin (S.D. divided by average) between the quadruplicate measurements of triplicate samples (total 12 measurements) was calculated for each normalization method. Data are shown as the average CVs of lectins with > 3000 signal intensity after gain-merging.
mannose-type N-glycans, and very few hybrid-type N-glycans (North et al., 2010). Consistently, CHO cells bound to asialo complex-type N-glycan binders (PHAL, ECA, and RCA120) (Itakura et al., 2007) and high-mannose-type N-glycan binders (NPA, ConA, GNA, and HHL) (Mega et al., 1992; Van Damme et al., 2007). Characteristically, CHO cells express a23Sia, but not a2-6Sia. Indeed, the signals of an a2-3Sia-binder (MAL), but not a2-6Sia binding lectins (SNA, SSA, TJAI) were observed (Yabe et al., 2009). Significant signals were also observed for core-fucosylated biantennary N-glycan binders (PSA and LCA) (Tateno et al., 2009) and broader fucose binders (AOL and AAL) (Matsumura et al., 2009), indicating the expression of core-fucosylated biantennary N-glycans. Interestingly, CHO cells bound to PHAE, suggesting the expression of bisecting GlcNAc, which agrees with a recent finding (North et al., 2010). The expression of polylactosamine was also confirmed by the signals of LEL and STL, which are specific for polylactosamine. Regarding O-glycans, major structures are core 1 (Galb1-3GalNAc) and its sialylated forms such as sialyl T (Siaa2-3Galb13GalNAc) and disialyl T (Siaa2-3Galb1-3(Siaa2-6)GalNAc) (North et al., 2010). Consistent with this, CHO cells exhibited significant binding to ABA
188
Hiroaki Tateno et al.
CHO
700 Asn
Ser / Thr
Asn
Ser / Thr
Asn
Ser / Thr
Asn
Ser / Thr
350
0
Lec2
700
350
0
Lec8
700
350
0
Lec1
700
350
LTL PSA LCA UEAI AOL AAL MAL SNA SSA TJAI PHAL ECA RCA120 PHAE DSA GSLII NPA ConA GNA HHL BPL TJAII EEL ABA LEL STL UDA PWM Jacalin PNA WFA ACA MPA HPA VVA DBA SBA GSLI PTLI MAH WGA GSLIA4 GSLIB4
0
Figure 8.4 Glycan profiles of CHO, Lec2, Lec8, and Lec1. Data are shown as the average of 12 samples for each cell line.
(Nakamura-Tsuruta et al., 2006), Jacalin (Tachibana et al., 2006), ACA, and MPA, which bind to core 1 and sialyl T (Kuno et al., 2009) as well as MAH specific to disialyl T. Lec2 is a CMP-sialic acid Golgi transporter deletion mutant which expresses little or no sialylated glycoconjugates. Consistently, the signals of MAL, the a2-3Sia binder, were abolished, while those of asialo N-glycans (PHAL, ECA, and RCA120) were increased, consistent with the glycosylation phenotype of Lec2. In terms of O-glycans, no binding was observed for MAH, which bind to disialyl T, while the signals of core 1 binders (BPL, ACA, and MPA) were increased correspondingly. Lec8 is a UDP-Gal Golgi transporter deletion mutant, which expresses little or no galactosylated glycoconjugates compared to Lec2. The signals of Gal-binders (ECA, RCA120, BPL, TJA-II, PNA, WFA, and ACA) were clearly decreased, while those of a GlcNAc-binder, GSLII (NakamuraTsuruta et al., 2006), were increased. Lec1 is a MGAT1 deletion mutant which is incapable of synthesizing complex- and hybrid-type N-glycans. Indeed, the signals of high-mannosetype N-glycan binders (NPA, GNA, and HHL) were increased, while little or no binding was observed for Sia-, Gal-, and GlcNAc-terminated complex-type N-glycan binders such as MAL, PHAL, ECA, RCA120, PHAE,
189
Cellular Glycomics Using Lectin Microarray
and GSLII. However, the signals of PSA, LCA, AOL, and AAL were detected. This might be due to the presence of core-fucosylated highmannose-type N-glycans as reported recently (North et al., 2010).
7. Unsupervised Clustering and Principal Component Analysis The normalized data were analyzed by two multivariable analyses, unsupervised clustering and principal component analysis, to achieve overall classification of the samples without supervision. As shown in Fig. 8.5,
Lec2
Lec1
Lec8
CHO-1-1 CHO-2-1 CHO-3-1 CHO-1-4 CHO2-4 CHO-1-2 CHO-1-3 CHO3-2 CHO-2-3 CHO2-2 CHO-3-3 CHO-3-4 Lec2-2-1 Lec2-1-1 Lec2-1-3 Lec2-1-2 Lec2-4-1 Lec2-2-3 Lec2-4-2 Lec2-3-2 Lec2-2-2 Lec2-3-1 Lec2-3-3 Lec2-4-3 Lec1-1-1 Lec1-3-1 Lec1-3-2 Lec1-1-3 Lec1-3-3 Lec1-2-1 Lec1-4-3 Lec1-1-2 Lec1-2-2 Lec1-4-1 Lec1-2-3 Lec1-4-2 Lec8-2-1 Lec8-1-2 Lec8-1-3 Lec8-1-1 Lec8-4-1 Lec8-2-2 Lec8-2-3 Lec8-3-2 Lec8-3-3 Lec8-3-1 Lec8-4-3 Lec8-4-2
CHO
SNA SSA TJA-I PHA-L PHA-E RCA120 ECA BPL WFA TJA-II SBA PNA AAL PSA LCA ConA UDA Jacalin NPA GNA HHL LEL STL DSA WGA ACA PWM MAL MAH UEA-I AOL ABA MPA EEL LTL WA DBA GSL-II HPA GSL-I PTL-I GSL-IA4 GSL-IB4
Figure 8.5 Unsupervised clustering. Mean-normalized data were analyzed by Cluster 3.0. Positive: red, negative: green. Clustering method: complete linkage. The heat map with clustering was acquired using Java Treeview. A representative N-glycan structure of each cell line is illustrated above.
190
Hiroaki Tateno et al.
PC2 6 CHO Lec1
Lec1
4
Lec2 CHO 2
Lec8
0
PC1 –6
–4
–2
0
2
4
6
8
–2 Lec8 –4 Lec2 –6
–8
Figure 8.6 Principal component analysis.
samples of the same cell line were grouped into the same cluster. Lec2 was clustered more closely to CHO than to Lec1 and Lec8 as expected, since the difference of Lec2 from CHO is only the absence of a2-3Sia in glycoconjugates, whereas both Lec8 and Lec1 further lack galactose on N-glycans (Fig. 8.4). In principal component analysis, the four cell lines were clearly separated by two components, PC1 and PC2 (Fig. 8.6). These results demonstrate that the four cell lines are clearly discriminated on lectin microarray depending on their glycan structures.
8. Significance Difference Test To select lectins discriminating the four cell lines, the data were first analyzed by the Kruskal–Wallis test (Scheffe´’s method), a nonparametric test for multiple comparisons, which does not assume a normal population. For statistical analysis of lectin microarray data, we used nonparametric tests rather than parametric tests, in case obtained lectin microarray data might not follow normal distribution and variance. Among 43 lectins, 36 were selected as significantly different lectins with a p-value < 0.01 between
191
Cellular Glycomics Using Lectin Microarray
A
Intensity
500 MAL PHAL GSLII HHL
250
0 CHO
Lec2
Lec8
Lec1
Cells B
Eq.2 6 4
Lec1
CHO
2 Eq.1 –20
CHO Lec1
0 –15
–10 Lec8
–5
–2
0
–4
5
10
15
Lec2 Lec8
Lec2
–6 –8 Eq1:Y = 0.096PHAL + 0.045MAL – 0.047HHL – 0.062GSLII + 7.03 Eq.2: Y = 0.065MAL + 0.018HHL – 0.002PHAL – 0.134GSLII – 4.92
Figure 8.7 (A) Glycan profiles of CHO, Lec2, Lec8, and Lec1 based on four lectins. (B) Canonical discriminant analysis.
certain pairs of the cell lines. Among these 36 lectins, we further selected four, MAL, PHAL, GSLII, and HHL, which differentially interact with the four cell lines. As shown in Fig. 8.7A, the four cell lines gave clearly distinct profiles on the four lectins.
9. Discriminant Analysis Using the four lectins, we developed two discriminant formulas by linear discriminant analysis as follows (Fig. 8.7B): Y ¼ 0:096PHAL þ 0:045MAL 0:047HHL 0:062GSLII þ 7:03 ð8:1Þ Y ¼ 0:065MAL þ 0:018HHL þ 0:002PHAL 0:134GSLII 4:92 ð8:2Þ
192
Hiroaki Tateno et al.
Using the above two equations, the four cell lines could be clearly differentiated (Fig. 8.7B). The discriminant analysis is indeed a useful statistical procedure to construct cell discrimination formulas based on the data obtained by lectin microarray.
10. Differential Analysis Between CHO and Lec1 Having constructed discriminant formulas of the four cell lines using linear discriminant analysis, we also showed a simpler strategy to construct formulas to distinguish two cell types. First, the mean-normalized data of CHO and Lec1 were analyzed by the Mann–Whitney U-test, a nonparametric test to select significantly different lectins between them (Fig. 8.8). Eight lectins with significantly higher signals and with p-value <0.001 (two-tailed) in CHO than in Lec1 were extracted, whereas seven lectins had significantly lower signals. We then selected PHAE among the nine lectins with significantly higher signals and HHL among the seven lectins with lower signals, and plotted their signal intensities for CHO and Lec1 (Fig. 8.9A). In CHO cells, the signals of PHAE were higher than those of HHL, whereas the opposite is true in Lec1 cells. When the signal values of HHL were subtracted from those of PHAE, the derived scores of all CHO cell samples gave values >0, whereas those of all Lec1 cell samples were <0 (Fig. 8.9B). Therefore, a discrimination formula to distinguish CHO and Lec1 was constructed as follows: Y ¼ PHAE HHL If Y 0;
CHO cells
If Y < 0;
Lec1 cells
CHO < Lec1
CHO > Lec1 Lectin
P-value (two-tailed)
Lectin
P-value (two-tailed)
PHAE
0.0000
HHL
0.0000
PHAL
0.0000
GNA
0.0000
MAL
0.0000
NPA
0.0000
DSA
0.0000
PSA
0.0000
RCA120
0.0000
LCA
0.0000
ECA
0.0000
ConA
0.0001
GSLII
0.0000
PWM
0.0005
WGA
0.0000
AOL
0.0003
Figure 8.8
Mann–Whitney U-test.
ð8:3Þ
193
Cellular Glycomics Using Lectin Microarray
A
CHO
Relative intensity
600
Lec1
PHAE HHL
300
0
1
4
B
7
10
13 16 Sample
CHO
19
22
Lec1
Score
300
0
–300
0
12
24
Y = PHAE – HHL(Eq. 3) Y ³ 0, CHO Y < 0, Lec1
– 600
Sample
Figure 8.9 (A) Relative intensity of PHAE and HHL for CHO and Lec1 cells. (B) Scores of the discrimination formula (Y ¼ PHAE HHL) obtained for CHO and Lec1 cells.
11. Validation The lectin microarray data were then validated by flow cytometry, a conventional analytical method (Fig. 8.10). PHAE, PHAL, MAL, DSA, and RCA120, which gave higher signals to CHO than to Lec1 (Mann–Whitney U-test) (Fig. 8.8), bound more intensely to CHO than to Lec1. Inversely, HHL, GNA, NPA, PSA, and LCA, giving lower signals to CHO than to Lec1, indeed exhibited lower fluorescence intensities to CHO than to Lec1. Therefore, the data of lectin microarray correspond well to those of flow cytometry.
12. Concluding Remarks Here, we described the applications of lectin microarray for profiling the cellular glycome, and systematic and strategic development of cell discrimination procedures using lectins without antibodies. Indeed, the glycan profiles of
194
Hiroaki Tateno et al.
Cell number
PHAE
0
10
2
3
10
PHAL
4
10
5
10
0
10
2
3
10
2
3
10
4
10
5
10
0
GNA
HHL
0
10
MAL
4
10
5
10
0
10
2
3
10
10
2
3
10
DSA
4
10
5
10
0
NPA
4
10
5
10
0
10
2
3
10
10
2
3
10
RCA120
4
10
5
10
0
PSA
4
10
5
10
0
10
2
3
10
10
2
3
10
4
10
5
10
LCA
4
10
5
10
0
10
2
3
10
4
10
5
10
Lectin : Control
: CHO
: Lec1
Figure 8.10 Flow cytometry. Cells (2 105) suspended in 100 mL PBS/BSA (10 mM phosphate buffer, pH 7.2, 0.15 M NaCl, and 1% BSA) were incubated with 20 mg/mL Cy3-labeled lectins on ice for 1 h and analyzed by flow cytometry.
CHO and its mutants obtained by lectin microarray clearly reflected their glycosylation phenotypes. The data were also supported by flow cytometry, demonstrating that lectin microarray is a useful tool for profiling the cellular glycome. Since lectin microarray requires only 10–100 ng of protein for each analysis (sensitive), and multiple samples (e.g., 100 samples) can be analyzed simultaneously (high-throughput), this technology has obvious potential advantages over others (e.g., mass spectrometry and multiple liquid chromatography mapping) to become a standard technique for analyzing global changes of the cellular glycome. The profiles are quite useful for cell discrimination. To distinguish more than three cell types, canonical discriminant analysis should be a convenient statistical method to construct lectin-based discriminant formulas. For discrimination of two cell types, discriminant formulas can be constructed more easily by the use of two lectins selected from the Mann–Whitney U-test. The procedures described in this chapter could also be widely used for the systematic development of cell discrimination procedures to distinguish a wide a range of cells. The strategy could be readily applicable to the evaluation of properties and conditions of various cell types. For example, the differentiation state and propensity of stem cells might be adequately evaluated by means of lectin microarray. Furthermore, the protocols described here are also applicable to the analysis of the cellular glycomes of various microorganisms, such as fungi, bacteria, and viruses, as described by others (Hsu et al., 2006). This should lead to understanding as yet unknown glycan functions in the light of evolutionary strategies of complex life systems. Research from this aspect is now ongoing.
Cellular Glycomics Using Lectin Microarray
195
ACKNOWLEDGMENTS We thank Noboru Uchiyama, Keiko Hiemori, Mihoko Fukumura, Yoshiko Kubo, and Jinko Murakami for technical assistance. This work was supported by New Energy and Industrial Technology Development Organization (NEDO) in Japan.
REFERENCES Ebe, Y., et al. (2006). Application of lectin microarray to crude samples: Differential glycan profiling of lec mutants. J. Biochem. 139, 323–327. Gagneux, P., and Varki, A. (1999). Evolutionary considerations in relating oligosaccharide diversity to biological function. Glycobiology 9, 747–755. Hsu, K. L., et al. (2006). Analyzing the dynamic bacterial glycome with a lectin microarray approach. Nat. Chem. Biol. 2, 153–157. Itakura, Y., et al. (2007). Systematic comparison of oligosaccharide specificity of Ricinus communis agglutinin I and Erythrina lectins: A search by frontal affinity chromatography. J. Biochem. 142, 459–469. Kuno, A., et al. (2005). Evanescent-field fluorescence-assisted lectin microarray: A new strategy for glycan profiling. Nat. Methods 2, 851–856. Kuno, A., et al. (2008). Development of a data-mining system for differential profiling of cell glycoproteins based on lectin microarray. J. Proteomics Bioinform. 1, 68–72. Kuno, A., et al. (2009). Focused differential glycan analysis with the platform antibody-assisted lectin profiling for glycan-related biomarker verification. Mol. Cell. Proteomics 8, 99–108. Matsumura, K., et al. (2009). Comparative analysis of oligosaccharide specificities of fucosespecific lectins from Aspergillus oryzae and Aleuria aurantia using frontal affinity chromatography. Anal. Biochem. 386, 217–221. Mega, T., et al. (1992). Characterization of carbohydrate-binding specificity of concanavalin A by competitive binding of pyridylamino sugar chains. J. Biochem. 111, 396–400. Nakamura-Tsuruta, S., et al. (2006). Comparative analysis by frontal affinity chromatography of oligosaccharide specificity of GlcNAc-binding lectins, Griffonia simplicifolia lectin-II (GSL-II) and Boletopsis leucomelas lectin (BLL). J. Biochem. 140, 285–291. North, S. J., et al. (2010). Glycomics profiling of Chinese hamster ovary cell glycosylation mutants reveals N-glycans of a novel size and complexity. J. Biol. Chem. 285, 5759–5775. Tachibana, K., et al. (2006). Elucidation of binding specificity of Jacalin toward O-glycosylated peptides: Quantitative analysis by frontal affinity chromatography. Glycobiology 16, 46–53. Tateno, H., et al. (2007). A novel strategy for mammalian cell surface glycome profiling using lectin microarray. Glycobiology 17, 1138–1146. Tateno, H., et al. (2009). Comparative analysis of core-fucose-binding lectins from Lens culinaris and Pisum sativum using frontal affinity chromatography. Glycobiology 19, 527–536. Uchiyama, N., et al. (2006). Development of a lectin microarray based on an evanescentfield fluorescence principle. Methods Enzymol. 415, 341–351. Uchiyama, N., et al. (2008). Optimization of evanescent-field fluorescence-assisted lectin microarray for high-sensitivity detection of monovalent oligosaccharides and glycoproteins. Proteomics 8, 3042–3050. Van Damme, E. J., et al. (2007). Phylogenetic and specificity studies of two-domain GNArelated lectins: Generation of multispecificity through domain duplication and divergent evolution. Biochem. J. 404, 51–61. Yabe, R., et al. (2009). Engineering a versatile tandem repeat-type alpha2-6sialic acid-binding lectin. Biochem. Biophys. Res. Commun. 384, 204–209.
C H A P T E R
N I N E
Applications of Heparin and Heparan Sulfate Microarrays Jian Yin*,† and Peter H. Seeberger*,† Contents 1. Introduction 2. Preparation of Amino-Functionalized HS/Heparin Oligosaccharides 3. Microarray Analysis of HS/Heparin–FGF Binding 3.1. Materials and equipment 3.2. Fabrication of HS/heparin microarrays 3.3. Incubation with HS/heparin-binding FGFs 3.4. Binding affinities of HS/heparin with FGFs 4. A HS/Heparin Microarray to Determine the Binding Profiles of Heparin Dendrimers to FGF-2 4.1. Materials and equipment 4.2. Preparation of glycodendrimers and amine-functionalized 5 kDa heparin 4.3. Fabrication of HS/heparin microarrays 4.4. Incubation with FGF-binding heparin oligosaccharide dendrimers 4.5. Binding affinities of heparin oligosaccharide dendrimers to FGFs 5. HS/Heparin Interaction with Chemokines as Determined by Microarray Analysis 5.1. Materials and equipment 5.2. Fabrication of HS/heparin microarray and incubation with chemokines 5.3. Binding affinities of HS/heparin with chemokines 6. HS/Heparin Microarray for Determination of Their Interaction with NCRs 6.1. Materials and equipment
198 201 202 204 204 206 206 207 207 209 210 210 211 211 211 212 212 213 213
* Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, Germany Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Arnimallee, Berlin, Germany
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78009-5
#
2010 Elsevier Inc. All rights reserved.
197
198
Jian Yin and Peter H. Seeberger
6.2. Fabrication of HS/heparin microarray and incubation with chemokines 6.3. Binding affinities of HS/heparin to NCRs 7. Conclusions Acknowledgments References
214 214 214 215 215
Abstract Carbohydrate microarrays have become crucial tools for revealing the biological interactions and functions of glycans, primarily because the microarray format enables the investigation of large numbers of carbohydrates at a time. Heparan sulfate (HS) and heparin are the most structurally complex glycosaminoglycans (GAGs). In this chapter, we describe the preparation of a small library of HS/ heparin oligosaccharides, and the fabrication of HS/heparin microarrays that have been used to establish HS/heparin-binding profiles. Fibroblast growth factors (FGFs), natural cytotoxicity receptors (NCRs), and chemokines were screened to illuminate the very important biological functions of these glycans.
1. Introduction Oligonucleotides (Insight, 2004) and proteins (Insight, 2003) have been the primary focus of most scientific studies on biomacromolecules, and the significance of carbohydrates in biological systems (see Fig. 9.1) has been underappreciated by the scientific community. Recently, however, the number of chemists, biochemists, and biologists active in the GPI-anchored protein
GPI-anchored protein
N-glycoprotein
Extracellular fluid
O-glycoprotein
GPI
Glycan
Glycosphingolipid Proteoglycan
GPI
Lipid bilayer
Cytoplasm
Figure 9.1 Schematic view of a cell membrane with glycosphingolipids, N- and Oglycoproteins, proteoglycans, and glycosylphosphatidylinositol (GPI)-anchored proteins.
199
Heparin/Heparan Sulfate Microarrays
glycosciences has been steadily increasing (Insight, 2007), resulting in new strategies and ideas for the purification, synthesis, analysis, and pharmaceutical applications of carbohydrates (Laughlin and Bertozzi, 2009; Murrey and Hsieh-Wilson, 2008; Seeberger and Werz, 2007). Carbohydrate microarrays (see Fig. 9.2) are a powerful technology as they can reveal carbohydrate–protein interactions. These insights can be exploited to evaluate and identify sugar ligands in both endogenous receptor systems and pathogen–host interactions (Feizi et al., 2003; Love and Seeberger, 2002; Shin et al., 2005). By covalently or noncovalently immobilizing many different carbohydrates at a time on a solid surface, this technology exhibits a clear advantage over conventional strategies, such as surface plasmon resonance (SPR) or isothermal titration calorimetry (ITC) (Dam and Brewer, 2002; Lis and Sharon, 1972). Consequently, the carbohydrate microarray has become a high-throughput analytic tool for elucidating the function of carbohydrates in biological processes (De Paz and Seeberger, 2006; Horlacher and Seeberger, 2008; Liang et al., 2008). Glycosaminoglycan (GAG) microarrays were developed in the last decade and have emerged as an important tool to address the many unanswered scientific questions related to the structure and function of GAGs in biological systems (De Paz and Seeberger, 2008; De Paz et al., 2006a; Gandhi and Mancera, 2008; Laremore et al., 2009). Heparan sulfate (HS) and heparin, the most complex polysaccharides of the GAG family, play an important role in fundamental physiological processes, such as cell growth and differentiation, blood coagulation, and inflammatory responses (Capila and Linhardt, 2002; Gama and HsiehWilson, 2005; Noti and Seeberger, 2005). The highly negatively charged HS and heparin sequences have been studied extensively due to their well understood role in anticoagulation (Lindahl and Li, 2009). HS and heparin are structurally related polysaccharides (see Fig. 9.3), and the differences between the two polysaccharides are widely regarded as quantitative and
Synthetic or isolated carbohydrates
NH2 NH2 NH2
O
N O O O
Addition of protein
Immobilization A
HN HN HN O O O
B
HN HN HN O O O
NHS-derivatized glass slide
Figure 9.2 General strategy for the preparation of microarrays containing synthetic or isolated carbohydrates.
200
Jian Yin and Peter H. Seeberger
OH
OH O
O
Heparan sulfate
HO2C
O
OH O
O
O
HO2C
OX
O
HO HN O Ac
HO HN O Y
X = H or SO−3 Y = H, SO−3 or Ac
OH
OX
Major aptotic disaccharide repeating unit
Minor variable disaccharide repeating unit
OSO−3 OX O
Heparin
HO2C
OH O HO O
HN Y
O
OX
Minor variable disaccharide repeating unit
HO2C O
OH O
O
O HO HN O O3SO
− −
X = H or SO−3 Y = H, SO−3 or Ac
OSO3
Major aptotic disaccharide repeating unit
Figure 9.3 Major and minor disaccharide repeating units in heparan sulfate and heparin.
not qualitative (Lindahl and Kjellen, 1991). HS chains often contain extended domains with a level of sulfation greater than that found in heparin sequences, as well as a higher level of acetylated glucosamines. Moreover, heparin is only biosynthesized and stored in mast cells, whereas HS is expressed on cell surfaces and in the extracellular matrix of proteoglycans (Varki et al., 1999). HS/heparin microarrays were used to determine the binding profiles of these polysaccharides with different proteins (Marson et al., 2009; Mercey et al., 2008; Shipp and Hsieh-Wilson, 2009). Our group has developed several different carbohydrate microarrays to elucidate the function of carbohydrates in various biological systems, such as the identification of human immunodeficiency virus (HIV) vaccine candidate antigens (Adams et al., 2004), the detection of pathogenic bacteria (Disney and Seeberger, 2004a), and the evaluation of aminoglycoside antibiotics (Disney and Seeberger, 2004b; Disney et al., 2004). Synthetic HS/ heparin sequences (Orgueira et al., 2003) were employed to fabricate HS/ heparin microarrays to determine binding profiles of fibroblast growth factors (FGFs) (De Paz et al., 2006b,c; Noti et al., 2006), chemokines (De Paz et al., 2007a), and natural cytotoxicity receptors (NCRs) (Hecht et al., 2009). Heparin dendrimers (De Paz et al., 2007b) served to compare the efficiency
Heparin/Heparan Sulfate Microarrays
201
of heparin binding to FGF-2. Here, we describe the preparation of heparin microarrays using synthetic heparin oligosaccharides. A summary of binding profiles with several biologically significant proteins is provided.
2. Preparation of Amino-Functionalized HS/Heparin Oligosaccharides The synthesis of complex carbohydrates is difficult, but the synthesis of HS/heparin is even more challenging, since the variability in monomer sulfation results in highly complex structures (see Fig. 9.4). Since the early 1980s, the synthesis of HS and heparin sequences has aroused the keen interests of organic chemists, and different approaches have been developed (Arungundram et al., 2009; Polat and Wong, 2007; Zhang et al., 2008). Our approach relies on GlcN-IdoA disaccharides, which are designed to serve as the repeating unit of the major sequence of HS/heparin fragments. Differentially protected glucosamines as well as iduronic acids were synthesized to prepare disaccharide modules (Lohman et al., 2003; Orgueira et al., 2003). Following methods established in our laboratory, the glucosamine building blocks were readily available in sufficient quantities, and a ‘‘de novo’’ approach allowed for the synthesis of glucuronic and iduronic acid units via relatively short routes from noncarbohydrate precursors (Adibekian et al., 2007; Timmer et al., 2005). Acyl groups served to acetate esters mark the hydroxyl groups to be sulfated, while benzyl ethers masked hydroxyl groups that will not be modified. The amine group of glucosamine required the installation of different protecting groups, such as azides. In succession, 2-azidoglucopyranose trichloroacetimidates served as glycosylating agent and iduronic acid units served as nucleophiles for the stereoselective preparation of 1,2-cis glycosidic linkages. One of two different methods was used to place an amine-terminated linker at the reducing end of HS/heparin oligosaccharides ranging in length from di- to hexamers and containing different sequences and sulfation patterns (Noti et al., 2006). One strategy involved conversion of a glycosyl trichloroacetimidate to an n-pentenyl glycoside by coupling with n-pentenyl alcohol, followed by radical elongation of the pentenyl moiety using 2-(benzyloxycarbonylamino)-1-ethanethiol. Saponification with lithium hydroperoxide and potassium hydroxide solution completed the conversion of sulfide to sulfone without detectable sulfoxide intermediates. Alternatively, to avoid elaborate linker modifications at the late stage of oligosaccharide synthesis, and to improve upon the moderate yields observed during the radical elongation of the pentenyl moiety of tetra- and hexasaccharides, an amineprotected pentyl linker, such as n-benzyloxycarbonyl-5-aminopentane-1-ol, was installed at the reducing end prior to oligosaccharide construction. Both amine-terminated linkers allowed for immobilization onto
202
Jian Yin and Peter H. Seeberger
–
OSO3 O
O – O3SO
AcHN O HO
CO2H O
OSO3–
O OH HO
O AcHN
48 modified decasaccharide building blocks
OH O
HO2C O
255 million decasaccharides 5.3 million octasaccharides 11,592 hexasaccharides
–
O3SO
OPG1 PGO PG1O
O PG4N O 2 PG O
CO2PG5 O
OPG1 X
O
PGO PG1O
3
OPG
CO2PG O
N3 O
O 1 PG O 3 OPG
PG2O
PGO PG1O
2 PG O
PGO 1 PG O
CO2Me O OPG
O X N3
X 3
CO2PG
OPG2
OPG2 O Y
PGO PG2O
O Y
N3
N3
OPG1 O
OPG1 Y
N3
1
O N3 O
PGO PG1O
OPG
32 trisaccharide building blocks
OPG1
8 decasaccharide building blocks
5
PGO 2 PG O
O N3
PGO PG2O
OPG
PG2O 5
Y
5
O
PG O2C PGO
X
1 glucuronic acid building block
X
O OPG
1 iduronic acid building block
4 glucosamine building blocks
Figure 9.4 Retrosynthetic analysis of a general, modular approach to the preparation of heparan sulfate and heparin oligosaccharides.
N-hydroxysuccinimide (NHS)-activated glass slides, and the creation of HS/heparin microarrays. In this way, a collection of 13 synthetic HS/ heparin oligosaccharides (see Fig. 9.5) were prepared that was ready for HS/heparin microarray fabrication.
3. Microarray Analysis of HS/Heparin–FGF Binding FGFs bind to the extracellular matrix of target tissues by interacting with heparin-like glycosaminoglycans (HLGAGs) (Mohammadi et al., 2005; Noti and Seeberger, 2005). The FGF family of proteins contains 23
OSO3–
OSO3– O HO2C O HO NH – HO O3SO – O3SO
O HO2C OH O O O NH – HO O3SO – O3SO
OSO3– O HO2C OH O O O OH O NH – O HO O3SO – O3SO
O 3
O S
NH2
OSO3– O HO2C O HO2C OH O O O NH –O SO HO O 3 HO NH –O SO HO Ac 3 2 Ac
1
OH HO2C OH O O O OH O OH O HO C O 2 OH NH O OH HO HO – O HO2C O O O3SO O NH HO O HO HO – O3SO NH HO HO – O3SO 3 OH O O OH OH O O HO2C OH NH O HO OH O HO2C O O – O3SO O OH O HO2C – NH O SO HO O O 3 – NH –O SO HO HO O3SO 3 – – O3SO O3SO
NH2
3
3
NH2
5
OSO3– O HO2C O HO NH –O SO HO 3 – O3SO
OSO3– O HO2C OH O O O OH O NH – O HO O3SO – O3SO
7
OSO3–
S
OH O O OH OH O O HO2C NH O HO OH O HO2C O Ac O NH HO HO HO 9 Ac HO
NH2
3
OH O O OH OH O O HO2C NH O HO OH O HO2C O – O O3SO NH HO HO HO – HO O3SO
3
NH2
8
OSO3– O
HO NH HO – O3SO
O
O
3
O S
NH2
HO2C HO
10
HO
OH O O
S 3
11
HO2C
O
O
NH2
3
OH O HO2C OH O OH O O OH O HO C O 2 OH NH O HO HO OH O O HO2C O Ac O NH O HO HO HO NH HO HO Ac 4 Ac OH O O OH OH HO C O 2 O OH NH O HO OH O O HO2C O Ac O OH HO2C NH – O O HO O3SO O NH –O SO HO HO Ac 3 – Ac O3SO 6
O
O
OSO3– HO2C OH O O O O OH O NH – O HO O3SO Ac
–
O3SO –
O3SO
OH O O
O
O S 3
OSO3– HO2C OH O O O O HO NH – HO O3SO – O3SO 13
O 3
NH2 3
3
O 3
O S
NH2
12
Figure 9.5 A small library of heparan sulfate and heparin-containing 13 synthetic oligosaccharides.
NH2
NH2
NH2
O S
NH2
204
Jian Yin and Peter H. Seeberger
different members and is involved in developmental and physiological processes (Noti and Seeberger, 2005). The best-studied members of the FGF family are FGF-1 (acidic FGF) and FGF-2 (basic FGF). Recent studies explained the complexity of the molecular mechanism involved in HS/ heparin-mediated FGF signaling; however, the HS/heparin sequences used for those studies were obtained through either enzymatic or chemical depolymerization methods (Pellegrini, 2001; Powell et al., 2004). Therefore, it was necessary to further investigate FGF signaling using carbohydrate microarrays assembled with chemically defined HS/heparin oligosaccharides for more precise structure–activity relationship studies. We developed a technique for the preparation and use of a microarray format containing synthetic HS/heparin oligosaccharides with varying sulfation patterns to determine HS/heparin–FGF binding affinities (see Fig. 9.6) (De Paz et al., 2006b; Noti et al., 2006).
3.1. Materials and equipment Sodium phosphate buffer (pH 9.0, 50 mM) Automated arraying robot (Perkin Elmer) NHS-activated slides (CodeLink, Amersham Biosciences) FGF-1, FGF-2, FGF-4, anti-FGF-2, and anti-FGF-4 (PeproTech EC) Anti-FGF-1 (Santa Cruz Biotechnology, Inc.) AlexaFluro-546-labled anti-rabbit IgG (Molecular Probes) PBS buffer (pH 7.5, 10 mM) HybriSlip hybridization covers (Grace Bio-Labs) Nanopure water Fluorescence reader (LS400, Tecan) Scan Array Express software (Perkin Elmer) Gene Spotter software (Microdiscovery GmbH)
3.2. Fabrication of HS/heparin microarrays The HS/heparin microarrays were prepared using the following protocol (De Paz et al., 2006b; Noti et al., 2006): HS/heparin oligosaccharides were dissolved in sodium phosphate buffer (pH 9.0, 50 mM), and were arrayed onto NHS-activated CodeLink slides (Blixta et al., 2004) using an automated arraying robot. Slides were printed in 50% relative humidity at 22 C, followed by incubation overnight in a saturated NaCl chamber that provides an environment of 75% relative humidity. The robot delivered 1 nL of sugar solutions at four different concentrations (2 mM, 400, 80, and 16 mM), and the resulting spots had an average diameter of 200 mm with a distance of 500 mm between the centers of adjacent spots. All samples were printed in replicates of 16. Slides were then washed with water (three times) to remove
-
OSO3 O
OSO3
OH O
HO2C O HO NH O HO O3SO O3SO
OAc O BnO BnO
Solution phase synthesis
O NH O HO O3SO
OAc O MeO2C
N3 O
OBn O BnO O
HO2C -
O3SO
OH S O O 5 O O
MeO2C OBn O O
N3 O
NH2
Immobilization of oligosaccharides on NHS slides HS/heparin microarrays
3
OAc O
PivO BnO BnO
AcO
N3 O
MeO2C
OBn O O BnO
OAc O
MeO2C
N3 O
OBn O O
PivO
AcO
Solid phase synthesis OAc O BnO BnO
OAc O MeO2C
N3 O
OBn O BnO O
MeO2C
–
HO HO NH O − O3SO
NBnZ 3
PivO
N3 O
AcO
OSO3 O
-
OSO3 O
OBn O O
HO2C −
OH O
O3SO
O HO NH O − O3SO
HO2C −
OH O O
O3SO
3
NH2
Immobilization of oligosaccharides on NHS slides HS/heparin microarrays
Figure 9.6 A general method for the preparation of microarrays containing synthetic HS/heparin oligosaccharides.
206
Jian Yin and Peter H. Seeberger
the remaining unbound carbohydrates from the chip. Remaining succinimidyl groups were quenched by placing slides in a solution preheated to 50 C that contained 100 mM ethanolamine in sodium phosphate buffer (pH 9.0, 50 mM) for 1 h. Slides were rinsed several times with distilled water, dried by centrifugation, and stored in a desiccator before proceeding with binding studies.
3.3. Incubation with HS/heparin-binding FGFs The binding assay, as well as image acquisition and signal processing, was performed using the protocol described in Noti et al. (2006). Solutions used for chip hybridization were sterile filtered through a 0.2 mm syringe filter before use. The FGF hybridization solutions were prepared by diluting the stock solutions to a concentration of 4–20 mg/mL with PBS buffer (pH 7.5, 10 mM) containing BSA (1%). Array incubations were performed as follows (Noti et al., 2006): FGF solution (100 mL) was placed between array slides and plain coverslips and incubated for 1 h at room temperature. The arrays were washed with PBS (pH 7.5, 10 mM) containing 1% Tween 20 and 0.1% BSA, two times with water, and then centrifuged for 5 min to ensure dryness. For detection of bound FGF, arrays were incubated with antihuman FGF polyclonal antibody (4–20 mg/mL) and then washed in a similar manner as above. Finally, AlexaFluor-546-labeled anti-rabbit IgG (20 mg/mL) secondary antibody was used, and the slides were again washed. All arrays were scanned using an LS400 scanner, and fluorescence spotter intensities were integrated using appropriate software.
3.4. Binding affinities of HS/heparin with FGFs The binding affinities of 12 different HS/heparin oligosaccharides (see Fig. 9.5, 1–8 and 10–13) for FGFs were assayed using the microarray. FGF-2 bound strongly to hexasaccharides 1, 2, and 5, tetrasaccharide 7, and had weak affinity for disaccharide 10 and monosaccharide 12. No binding was observed for hexasaccharides 3, 4, and 6. These findings indicated at least two sulfate groups on each disaccharide are required for oligosaccharide recognition by FGF-2. Meanwhile, further experiments indicated that the sulfate group at position 6 of the glucosamine unit was unnecessary for recognition, since the binding affinities of FGF-2 for hexasaccharides 1 and 5 were similar, a finding that supports the work of Pellegrini (2001). Incubation of FGF-1 with the microarray showed that FGF-1 binds hexasaccharides 1, 2, and 5 weakly suggesting that a higher negative charge density, with three sulfate groups on each disaccharide, is required for FGF-1 binding. The monosaccharide 12, which exhibited the strongest binding affinity for FGF-1 of all the synthetic oligosaccharides tested, was previously reported to be a potential inhibitor of angiogenesis
Heparin/Heparan Sulfate Microarrays
207
with anticancer properties (Cochran et al., 2003; Karoli et al., 2005). Our analysis indicated that the nonsulfated oligosaccharides also bound FGF-1 tightly, as reported by Ornitz et al. (1995). These findings suggested that FGF can specifically recognize structural features of nonsulfated HS/heparin backbone instead of ionic interactions with sulfate groups. Finally, our microarray screen demonstrated that FGF-4 bound hexasaccharide 1 more tightly than oligosaccharides 2, 5, and 7. Comparison of structures 1 and 7 shows that, while the two oligosaccharides are equally sulfated, oligosaccharide 7 is shorter, implying that the distribution of the sulfate groups has a significant effect on FGF-4 binding.
4. A HS/Heparin Microarray to Determine the Binding Profiles of Heparin Dendrimers to FGF-2 Dendrimers are hyperbranched synthetic macromolecules of defined structure and molecular weight that have been evaluated for biomedical applications (Haag and Kratz, 2006). Multivalent presentation of sugar epitopes on an appropriate macromolecular scaffold increases conjugate binding due to a cluster effect, and enhances carbohydrate–protein interactions (Suda et al., 2006). Installation of terminal sugar residues on dendrimers was reported to create a multivalent display that mimicked cell-surface glycans (Rele et al., 2005). Recently, a HS/heparin oligosaccharide microarray was employed by our group to determine the inhibition of heparin– protein interactions by heparin dendrimers (De Paz et al., 2007b). In this study, anionic polyamidoamine (PAMAM) dendrimers were employed to prepare multivalent conjugates of synthetic heparin oligosaccharides (see Fig. 9.7). Dendrimer binding to FGF-2 was analyzed by HS/heparin microarrays and SPR measurements on gold chips.
4.1. Materials and equipment Sodium phosphate buffer (pH 9.0, 50 mM) sciFLEXARRAYER noncontact printer (Scienion AG) NHS-activated slides (CodeLink, Amersham Biosciences) FGF-2, anti-FGF-2 (PeproTech EC) AlexaFluro-546-labled goat anti-rabbit IgG (Invitrogen, Carlsbad) HBS-EP buffer (pH 7.4, 10 mM, 150 mM NaCl, 3 mM EDTA, 0.005% (v/v) surfactant P20) (BIAcore) HybriSlip hybridization covers (Grace Bio-Labs) Nanopure water Fluorescence reader (LS400, Tecan)
ONa
O
NaO
O
R NaO
O ONa
N
N
O
N
N HN
O
O N N H
NaO
O
R O NaO
N
N HO
HN
NH
O
O
ONa
NH
O N H
O N
NaO O
R
O
ONa
R
N
O
NaO
O NaO
O
ONa O NaO
HN
N
N
HO3C OH O O
O 3
O S
NH2
-
NaO O
O
NH2
O3SO
O3SO
N
O
O
O S
10
-
R
O
N
N
1 10 12 13 ONa
O
HN
NH
= = = = =
ONa
O
O
O
NH O
N
HN N
N
N
NaO
O
HN
N H
NH
N
R R R R R
N
O O
NH
O
O
N H
HOD-1: HOD-2: HOD-3: HOD-4: HOD-5:
O ONa
N
O O
O N
O N
O
R
O 3
HO NH HO O3SO
NH
O
HN
NH O
O
H N
OSO3O O
O ONa
O
N
N
N H
O N
O
O
O
HN
O
N
O
O N
HN
N
Heparin oligosaccharide dendrimers (HOD)
ONa
O
R
NaO
N
O
N
NaO
NaO
O
HN
NH
O
O
O
ONa
NH
HN NaO
R
O
O
OSO3O HO2C OH O O O HO NH HO O3SO O3SO
O 3
12
O S
NH2
13
OSO3O HO2C OH O OSO3O HO2C OH O O OSO3O NH -O SO O HO HO2C OH 3 O O O O O3SO NH -O SO HO O HO 3 NH -O SO HO O3SO 3 O3SO
1
Figure 9.7 Structure of heparin oligosaccharide dendrimers (HOD).
O
O S
3
NH2
Heparin/Heparan Sulfate Microarrays
209
Gene Spotter software (Microdiscovery GmbH) Starburst PAMAM dendrimer generation 2.5 containing 32 sodium carboxylate surface groups (Sigma-Aldrich) Microcon centrifugal filter units (Millipore, Billerica) Deaminated heparin (5 kDa) (Sigma-Aldrich) SPR measurements device (BIAcore 3000, BIAcore) SPR measurements software (BIAcore) CM5 chips (BIAcore)
4.2. Preparation of glycodendrimers and aminefunctionalized 5 kDa heparin The terminal carboxylate groups on PAMAM dendrimer were activated using the following protocol (De Paz et al., 2007b): Commercially available methanolic PAMAM solution was coevaporated with CH2Cl2 twice under reduced pressure. The residue (20 mg, 3.2 mmol) was dissolved in anhydrous DMSO (2 mL). EDC (23.6 mg, 122 mmol, 1.2 equivalents per carboxylate group) and NHS (14.2 mg, 122 mmol, 1.2 equivalents per carboxylate group) were added, and the reaction mixture stirred under argon atmosphere for 24 h. Four heparin oligosaccharide dendrimers (HOD) were synthesized using the protocol (De Paz et al., 2007b) exemplified by the synthesis of HOD-4. Triethylamine (10 mL) and monosaccharide 10 (3.0 mg, 5.6 mmol, 1.1 equivalents per carboxylate group) were added to an aliquot of the activated PAMAM solution (100 mL, 0.16 mmol). DMSO (100 mL) was then added to dissolve the sugar. The reaction mixture was stirred under argon for 24 h and then lyophilized to remove the DMSO. The residue was dissolved in water, purified by centrifugal ultrafiltration (Microcon 3 kDa, 40 min, 14,000 rpm) and washed twice with water. Lyophilization in water afforded the corresponding dendrimer HOD-4 as a white powder (1.4 mg). Some batches were submitted to an additional purification step through Sephadex G-25 (prepacked PD-10 column; Amersham Biosciences) in order to remove the glycerin which coats Microcon ultrafiltration membranes and may eventually contaminate the dendrimer sample. The ratio of sugar to dendrimer was 8.6 (27% loading of monosaccharide 10 on the dendrimer) based on the 1H NMR spectrum in D2O (300 MHz). The molecular weight of HOD-4 (10.5 kDa) was estimated based on NMR integration. To estimate the molecular weight, it was presumed that all the sulfate groups of the sugar and the carboxylic acid groups of the dendrimer were presented as sodium salts. Three other HODs were also prepared by using this same protocol. Amine-functionalized 5 kDa heparin was prepared as follows (De Paz et al., 2007b). Deaminated 5 kDa heparin (2 mg, 0.4 mmol) was dissolved in
210
Jian Yin and Peter H. Seeberger
MES buffer (0.4 mL, 50 mM, pH 6.8). 1,11-Diamino-3,6,9-trioxaundecane (0.8 mg, 4 mmol) in DMF (25 mL) and NaCNBH3 (50 mL, 0.16 M solution in water) were added and the reaction mixture was stirred at room temperature for 18 h. To remove excess linker, the solution was submitted to centrifugal ultrafiltration (Microcon 3 kDa, 40 min, 14,000 rpm). After washing three times with water the precipitate was diluted with water and lyophilized to give a white solid (2 mg) which was stored at 20 C prior to use.
4.3. Fabrication of HS/heparin microarrays The HS/heparin microarrays were prepared using the following protocol (De Paz et al., 2007b): Amine-functionalized heparin (average molecular weight 5 kDa) was dissolved in sodium phosphate buffer (50 mM, pH 9.0) and spatially arrayed onto NHS-activated CodeLink slides by an automated arraying robot. Each glass slide was subdivided into eight different sections with heparin printed on each section, at two different concentrations (0.5 and 1 mM) in 17 replicates. Slides were printed in 50% relative humidity at 22 C, followed by incubation overnight in a saturated aqueous NaCl solution chamber that provides a 75% relative humidity environment. The robot delivered approximately 1 nL heparin solution and the resulting spots had an average diameter of 200 mm with a distance of 500 mm between the centers of adjacent spots. Slides were then washed three times with water to remove unbound carbohydrate from the surface. Remaining succinimidyl groups were quenched by placing slides in a solution preheated to 50 C that contained 100 mM ethanolamine in sodium phosphate buffer (50 mM, pH 9.0) for 1 h. Slides were rinsed several times with distilled water, dried by centrifugation, and stored in a dessicator before proceeding with binding experiments.
4.4. Incubation with FGF-binding heparin oligosaccharide dendrimers After attaching an 8-well hybridization chamber to the slide, each block was incubated with 40 mL of a mixture of FGF-2 (29 nM) and a competitor in PBS buffer (10 mM, pH 7.5) containing BSA (1%) for 1 h at room temperature. Glycodendrimers HOD-1–HOD-4, PAMAM dendrimer 5, oligosaccharides 1, 10, 12, and 13, sucrose octasulfate, and deaminated 5 kDa heparin were added as competitors at concentrations ranging from 0.5 nM to 2.5 mM. A solution of FGF-2 (29 nM) without competitor was used as positive control. The arrays were washed twice with PBS (10 mM, pH 7.5) containing 1% Tween 20 and 0.1% BSA, twice with water, and then centrifuged for 3 min to ensure dryness. For detection of bound FGF2, arrays were incubated with anti-FGF-2 (20 mg/mL) and then washed in a similar manner as above. Afterwards, 100 mL of antibody solution was
Heparin/Heparan Sulfate Microarrays
211
placed between the array slide and a plain coverslip and incubated for 1 h at room temperature. Alexa Fluor 546-labeled anti-rabbit IgG (20 mg/mL) was applied to detect bound rabbit primary antibodies. After washing, the heparin arrays were scanned with an LS400 scanner, and fluorescence spotter intensities were integrated using appropriate software. All the competition assays were carried out at least in duplicate.
4.5. Binding affinities of heparin oligosaccharide dendrimers to FGFs The binding affinity of FGF-2 to the dendrimers was analyzed by determining the IC50 values of soluble dendrimers with heparin-coated microarrays. Dendrimer HOD-1 exhibited more effective binding than monovalent oligosaccharide 1. Significant binding affinities were found with dendrimers HOD-3 and HOD-4 instead of negligible affinities with monosaccharide 12 and disaccharide 13. These findings indicated that HS/ heparin derivatized dendrimers were bound stronger by FGF-2 than monovalent oligosaccharides.
5. HS/Heparin Interaction with Chemokines as Determined by Microarray Analysis Chemokines are a family of small secreted proteins which are of extraordinary importance in lymphocyte migration and the recruitment of leukocyte subsets to sites of inflammation (Rot, 1992; Rot and von Andrian, 2004). Chemokines are released from a wide range of cells and function predominantly as chemoattractants for leukocytes; recruiting them from the blood to sites of infection or inflammation. Generating a profile of chemokine binding to defined HS/heparin sequences was intended to provide insight into chemokine function at the molecular level. Consequently, binding analyses of eight different chemokines (CCL21, IL-8, CXCL12, CXCL13, CCL19, CCL25, CCL28, and CXCL16) and a small library of HS/heparin oligosaccharides were conducted using HS/ heparin microarrays and SPR measurements (De Paz et al., 2007a).
5.1. Materials and equipment Sodium phosphate buffer (pH 9.0, 50 mM) Automated arraying robot (Perkin Elmer) NHS-activated slides (CodeLink, Amersham Biosciences) CXCL12, CCL19, CCL21, CXCL13, CCL28, CCL25, CXCL16, and anti-CXCL16 (PeproTech EC)
212
Jian Yin and Peter H. Seeberger
Anti-CXCL12 (Aviva Systems Biology) Anti-CXCL13 (eBioscience) Anti-CCL19 (Abgent) Anti-CCL21 (Abcam) Anti-CCL28 and anti-CCL25 (R&D System) IL-8 and anti-IL-8 (Novartis) AlexaFluro-546-labled anti-rabbit IgG and anti-goat IgG (Molecular Probes) HybriSlip Hybridization covers (Grace Bio-Labs) Nanopure water Fluorescence reader (LS400, Tecan) Scan Array Express software (Perkin Elmer) Gene Spotter (Microdiscovery GmbH) SPR measurement with BIAcore 3000 (BIAcore, Uppsala, Sweden) SPR express software (BIA control software) HBS-EP buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% (v/v) surfactant P20) and CM5 chips (BIAcore) Starburst PAMAM dendrimer generation 2.5 containing 32 sodium carboxylate surface groups and deaminated heparin (5 kDa) (Sigma-Aldrich)
5.2. Fabrication of HS/heparin microarray and incubation with chemokines An identical protocol to that described previously (Noti et al., 2006) was employed (De Paz et al., 2007a).
5.3. Binding affinities of HS/heparin with chemokines Significant binding of CCL21 to hexasaccharides 1, 2, and 5, tetrasaccharide 7, and monosaccharide 12 was observed. In contrast, binding to hexasaccharide 6 and disaccharide 13 was rather weak. CXCL13 displayed decreased affinity to all oligosaccharides compared with CCL21. Incubation of CXCL12 or CCL19 with the HS/heparin microarray demonstrated that these chemokines bound the synthetic HS/heparin oligosaccharides only weakly or not at all. A 5 kDa heparin sample was used as a control to confirm the known binding profiles of heparin with the chemokines. Our results suggest that synthetic HS/heparin oligosaccharides, hexamer length or less, which lack certain sulfation patterns, were dispensable for CXCL12 and CCL19 activation. Further studies with the SPR technology confirmed the above observations. Four other chemokines were tested: IL-8, CCL25, CCL28, and CXCL16. The IL-8 profile indicated that binding to sulfated oligosaccharides was not as a result of nonspecific charge–charge interactions, but that the 2-O-sulfate groups on the IdoA units were crucial for this specific
Heparin/Heparan Sulfate Microarrays
213
interaction. CCL25 and CCL28, two closely related chemokines expressed in epithelial cells, had similar binding profiles compared with the profiles generated for IL-8 and CCL21. This suggests that tetra- and hexasaccharides with a minimum of two sulfate groups on each disaccharide unit constitute a general recognition motif for these chemokines. Furthermore, this work indicated that N-sulfate and 6-O-sulfate groups played important roles in HS/heparin binding to CCL16. Chemotaxis assays that showed the effect of dendrimers on cells in vitro, suggested that the structure of HS/heparin-containing dendrimers could influence the design of chemokine-modulating agents (De Paz et al., 2007a).
6. HS/Heparin Microarray for Determination of Their Interaction with NCRs Natural killer (NK) cells are a type of cytotoxic lymphocyte that constitute a major component of the innate immune system, and play an important role in rejecting tumors and cells infected by viruses (Vivier et al., 2008). NK cell regulation is mediated by activating and inhibiting receptors on NK cell surfaces. The NCRs, NKp30, NKp44, and NKp46, are key for NK cell regulation, and are central to triggering the tumor cell recognition pathway (Moretta et al., 2001). Since carbohydrate–protein interactions are known to be important for NK cell targeting, we again used microarray technology (Hecht et al., 2009), and SPR measurements to investigate the potential for NKp30, NKp44, and NKp46 to bind synthetic HS/heparin.
6.1. Materials and equipment Sodium phosphate buffer (pH 9.0, 50 nM) Piezoelectric spotting robot (S11, Scienion) NHS-activated slides (CodeLink, Amersham Biosciences) AlexaFluro-647-labled a goat anti-human IgG (HþL) antibody (Invitrogen) HBS-N buffer; surfactant P20 and CM5 chips (BIAcore) HybriSlip Hybridization covers (Grace Bio-Labs) Array-ProAnalyzer software (MediaCybernetics) Nanopure water Fluorescence reader (LS400, Tecan) Gene Spotter (Microdiscovery GmbH) SPR measurement with BIAcore T100 (BIAcore) NCRs: NCRs were expressed as recombinant soluble IgG Fc chimeras. NKp30 and NKp44 consisted of a single IgG-like V-type domain fused to human IgG1. NKp46D2 was an IgG1 fusion protein containing only
214
Jian Yin and Peter H. Seeberger
the membrane-proximal D2 domain of NKp46. NKp30, NKp44, and NKp46D2 were expressed in CHO cells.
6.2. Fabrication of HS/heparin microarray and incubation with chemokines A protocol identical to that described previously was used (Hecht et al., 2009; Noti et al., 2006).
6.3. Binding affinities of HS/heparin to NCRs Both NKp30 and NKp46D2 bound the highly sulfated oligosaccharides 1, 2, 5, 7, and 10, which were all synthetic HS/heparin molecules with two to three sulfate groups on each disaccharide unit. All three NCRs bound to iduronic acid containing O-sulfate groups at the C2 and C4 position (monosaccharide 12). However, the NCRs did not bind to the remaining monosaccharides 10 or 11, showing that the NCRs prefer highly sulfated HS/heparin structures as binding partners. Additional SPR measurements suggested that HS/heparin oligosaccharides represent only fragments of the natural NCR binding epitopes. This was supported inhibition studies of NCR binding to tumor cells. Natural HS/heparin was a significantly more potent inhibitor of NCR binding than even the synthetic HS/heparin sequences that tightly bound the receptors in the microarray studies, indicating that the synthetic HS/heparin oligosaccharides were not identical to natural HS/heparin ligands.
7. Conclusions Carbohydrate microarrays have become important tools for glycomics as they save both time and materials in determining carbohydrate–protein interactions. The limiting factor for all glycan microarray studies is access to defined oligosaccharides. Access to a small collection of 13 synthetic HS/ heparin oligosaccharides provided a first example of the power of heparin microarrays. In a short time period, the binding specificities of several heparin-binding proteins were elucidated. Based on information gathered from the microarrays, novel multivalent displays such as heparin dendrimers were designed to modulate heparin activity in vivo. Currently, a host of other proteins are being screened for heparin oligosaccharide binding and the insights will allow us to correlate binding with biological function. While much has been achieved with the first set of heparin arrays, a more diverse set of synthetic GAG oligosaccharides is needed. To this end, we are currently advancing the automated synthesis of such complex
Heparin/Heparan Sulfate Microarrays
215
oligosaccharides. With more diverse structures in hand, screening by using the methods established in this chapter will yield more in-depth details about GAG–protein interactions and their biological implications.
ACKNOWLEDGMENTS We thank the Max Planck Society for very generous support and the European Research Council (ERC Advanced Grant to PHS). We thank all present and past members of Seeberger group who contributed to the results reported in this chapter.
REFERENCES Adams, E. W., Ratner, D. M., Bokesch, H. R., McMahon, J. B., O’Keefe, B. R., and Seeberger, P. H. (2004). Oligosaccharide and glycoprotein microarrays as tools in HIV glycobiology: Glycan-dependent gp120/protein interactions. Chem. Biol. 11, 875–881. Adibekian, A., Bindschaedler, P., Timmer, M. S. M., Noti, C., Schuetzenmeister, N., and Seeberger, P. H. (2007). De novo synthesis of uronic acid building blocks for assembly of heparin oligosaccharides. Chem. Eur. J. 13, 4510–4522. Arungundram, S., Al-Mafraji, K., Asong, J., Leach, III, F. E., Amster, I. J., Venot, A., Turnbull, J. E., and Boons, G.-J. (2009). Modular synthesis of heparan sulfate oligosaccharides for structure–activity relationship studies. J. Am. Chem. Soc. 131, 17394–17405. Blixta, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., et al. (2004). Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc. Natl. Acad. Sci. USA 101, 17033–17038. Capila, I., and Linhardt, R. J. (2002). Heparin–protein interactions. Angew. Chem. Int. Ed. Engl. 41, 391–412. Cochran, S., Li, C. P., Fairweather, J. K., Kett, W. C., Coombe, D. R., and Ferro, V. (2003). Probing the interactions of phosphosulfomannans with angiogenic growth factors by surface plasmon resonance. J. Med. Chem. 46, 4601–4608. Dam, T. K., and Brewer, C. F. (2002). Thermodynamic studies of lectin–carbohydrate interactions by isothermal titration calorimetry. Chem. Rev. 102, 387–429. De Paz, J. L., and Seeberger, P. H. (2006). Recent advances in carbohydrate microarrays. QSAR Comb. Sci. 25, 1027–1032. De Paz, J. L., and Seeberger, P. H. (2008). Deciphering the glycosaminoglycan code with the help of microarrays. Mol. BioSyst. 4, 707–711. De Paz, J. L., Horlacher, T., and Seeberger, P. H. (2006a). Oligosaccharide microarray to map interaction of carbohydrates in biological system. Methods Enzymol. 415, 269–292. De Paz, J. L., Noti, C., and Seeberger, P. H. (2006b). Microarrays of synthetic heparin oligosaccharides. J. Am. Chem. Soc. 128, 2766–2767. De Paz, J. L., Spillmannb, D., and Seeberger, P. H. (2006c). Microarrays of heparin oligosaccharides obtained by nitrous acid depolymerization of isolated heparin. Chem. Commun. 3116–3118. De Paz, J. L., Moseman, E. A., Noti, C., Polito, L., von Andrian, U. H., and Seeberger, P. H. (2007a). Profiling heparin–chemokine interactions using synthetic tools. ACS Chem. Biol. 2, 735–744.
216
Jian Yin and Peter H. Seeberger
De Paz, J. L., Noti, C., Bo¨hm, F., Werner, S., and Seeberger, P. H. (2007b). Potentiation of fibroblast growth factor activity by synthetic heparin oligosaccharide glycodendrimers. Chem. Biol. 14, 879–887. Disney, M. D., and Seeberger, P. H. (2004a). The use of carbohydrate microarrays to study carbohydrate–cell interactions and to detect pathogens. Chem. Biol. 11, 1701–1707. Disney, M. D., and Seeberger, P. H. (2004b). Aminoglycoside microarray to explore interactions of antibiotics with RNAs and proteins. Chem. Eur. J. 10, 3308–3314. Disney, M. D., Magent, S., Blanchard, J. S., and Seeberger, P. H. (2004). Aminoglycoside microarray to study antibiotic resistance. Angew. Chem. Int. Ed. Engl. 43, 1591–1594. Feizi, T., Fazio, F., Chai, W., and Wong, C.-H. (2003). Carbohydrate microarray: A new set of technologies at the frontiers of glycomics. Curr. Opin. Struct. Biol. 13, 637–645. Gama, C. I., and Hsieh-Wilson, L. C. (2005). Chemical approaches to deciphering the glycosaminoglycan code. Curr. Opin. Chem. Biol. 9, 609–619. Gandhi, N. S., and Mancera, R. L. (2008). The structure of glycosaminoglycans and their interactions with proteins. Chem. Biol. Drug Des. 72, 455–482. Haag, R., and Kratz, F. (2006). Polymer therapeutics: Concepts and applications. Angew. Chem. Int. Ed. 45, 1198–1215. Hecht, M.-L., Rosental, B., Horlacher, T., Hershkovitz, O., De Paz, J. L., Noti, C., Schauer, S., Porgador, A., and Seeberger, P. H. (2009). Natural cytotoxicity receptors NKp30, NKp44 and NKp46 bind to different heparan sulfate/heparin sequences. J. Proteome Res. 8, 712–720. Horlacher, T., and Seeberger, P. H. (2008). Carbohydrate arrays as tools for research and diagnostics. Chem. Soc. Rev. 37, 1414–1422. Insight (2003). Proteomics. Nature 422, 191–237. Insight (2004). Human genomics and medicine. Nature 429, 439–481. Insight (2007). Glycochemistry & glycobiology. Nature 446, 999–1051. Karoli, T., Liu, L. G., Fairweather, J. K., Hammond, E., Li, C. P., Cochran, S., Bergefall, M., Trybala, E., Addison, R. S., and Ferro, V. (2005). Synthesis, biological activity, and preliminary pharmacokinetic evaluation of analogues of a phosphosulfomannan angiogenesis inhibitor (PI-88). J. Med. Chem. 48, 8229–8236. Laremore, T. N., Zhang, F., Dordick, J. S., Liu, J., and Linhardt, R. J. (2009). Recent progress and applications in glycosaminoglycan and heparin research. Curr. Opin. Chem. Biol. 13, 633–640. Laughlin, S. T., and Bertozzi, C. R. (2009). Imaging the glycome. Proc. Natl. Acad. Sci. USA 106, 12–17. Liang, P. H., Wu, C. Y., Greenberg, W. A., and Wong, C. H. (2008). Glycan arrays: Biological and medical applications. Curr. Opin. Chem. Biol. 12, 86–92. Lindahl, U., and Kjellen, L. (1991). Heparin or heparan sulfate—What is the difference? Thromb. Haemost. 66, 44–48. Lindahl, U., and Li, J.-P. (2009). Interaction between heparin sulfate and proteins—Design and functional implication. Int. Rev. Cell Mol. Biol. 276, 105–159. Lis, H., and Sharon, N. (1972). Lectins: Cell-agglutinating and sugar-specific proteins. Science 177, 949–959. Lohman, G. J. S., Hunt, D. K., Hoegermeier, J. A., and Seeberger, P. H. (2003). Synthesis of iduronic acid building blocks for the modular assembly of glycosaminoglycans. J. Org. Chem. 68, 7559–7561. Love, K. R., and Seeberger, P. H. (2002). Carbohydrate arrays as tools for glycomics. Angew. Chem. Int. Ed. 41, 3583–3586. Marson, A., Robinson, D. E., Brookes, P. N., Mulloy, B., Wiles, M., Clark, S. J., Fielder, H. L., Collinson, L. J., Cain, S. A., Kielty, C. M., McArthur, S., Buttle, D. J., et al. (2009). Development of a microtiter plate-based glycosaminoglycan array for the investigation of glycosaminoglycan–protein interactions. Glycobiology 19, 1537–1546.
Heparin/Heparan Sulfate Microarrays
217
Mercey, E., Sadir, R., Maillart, E., Roget, A., Baleux, F., Lortat-Jacob, H., and Livache, T. (2008). Polypyrrole oligosaccharide array and surface plasmon resonance imaging for the measurement of glycosaminoglycan binding interactions. Anal. Chem. 80, 3476–3482. Mohammadi, M., Olsen, S. K., and Goetz, R. (2005). A protein canyon in the FGF–FGF receptor dimer selects from an a` la carte menu of heparan sulfate motifs. Curr. Opin. Struct. Biol. 15, 506–516. Moretta, A., Bottino, C., Vitale, M., Pende, D., Cantoni, C., Mingari, M. C., Biassoni, R., and Moretta, L. (2001). Activating receptors and coreceptors involved in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19, 197–223. Murrey, H. E., and Hsieh-Wilson, L. C. (2008). The chemical neurobiology of carbohydrates. Chem. Rev. 108, 1708–1731. Noti, C., and Seeberger, P. H. (2005). Chemical approaches to define the structure–activity relationship of heparin-like glycosaminoglycans. Chem. Biol. 12, 731–756. Noti, C., De Paz, J. L., Polito, L., and Seeberger, P. H. (2006). Preparation and use of microarrays containing synthetic heparin oligosaccharides for the rapid analysis of heparin–protein interactions. Chem. Eur. J. 12, 8664–8686. Orgueira, H. A., Bartolozzi, A., Schell, P. H., Litjens, R., Palmacci, E. R., and Seeberger, P. H. (2003). Modular synthesis of heparin oligosaccharides. Chem. Eur. J. 9, 140–169. Ornitz, D. M., Herr, A. B., Nilsson, M., Westman, J., Svahn, C. M., and Waksman, G. (1995). FGF binding and FGF receptor activation by synthetic heparan-derived di- and trisaccharides. Science 268, 432–436. Pellegrini, L. (2001). Role of heparan sulfate in fibroblast growth factor signalling: A structural view. Curr. Opin. Struct. Biol. 11, 629–634. Polat, T., and Wong, C.-H. (2007). Anomeric reactivity-based one-pot synthesis of heparinlike oligosaccharides. J. Am. Chem. Soc. 129, 12795–12800. Powell, A. K., Yates, E. A., Fernig, D. G., and Turnbull, J. E. (2004). Interactions of heparin/heparan sulfate with proteins: Appraisal of structural factors and experimental approaches. Glycobiology 14, 17R–30R. Rele, S. M., Cui, W. X., Wang, L. C., Hou, S. J., Barr-Zarse, G., Tatton, D., Gnanou, Y., Esko, J. D., and Chaikof, E. L. (2005). Dendrimer-like PEO glycopolymers exhibit antiinflammatory properties. J. Am. Chem. Soc. 127, 10132–10133. Rot, A. (1992). Endothelial-cell binding of Nap-1/II-8-role in neutrophil emigration. Immunol. Today 13, 291–294. Rot, A., and von Andrian, U. H. (2004). Chemokines in innate and adaptive host defense: Basic chemokinese grammar for immune cells. Annu. Rev. Immunol. 22, 891–928. Seeberger, P. H., and Werz, D. B. (2007). Synthesis and medical applications of oligosaccharides. Nature 446, 1046–1051. Shin, L., Park, S., and Lee, M. (2005). Carbohydrate microarrays: An advanced technology for functional studies of glycans. Chem. Eur. J. 11, 2894–2901. Shipp, E. L., and Hsieh-Wilson, L. C. (2009). Profiling the sulfation specificities of glycosaminoglycan interactions with growth factors and chemotactic proteins using microarrays. Chem. Biol. 12, 731–756. Suda, Y., Arano, A., Fukui, Y., Koshida, S., Wakao, M., Nishimura, T., Kusumoto, S., and Sobel, M. (2006). Immobilization and clustering of structurally defined oligosaccharides for sugar chips: An improved method for surface plasmon resonance analysis of protein– carbohydrate interactions. Bioconjug. Chem. 17, 1125–1135. Timmer, M. S. M., Adibekian, A., and Seeberger, P. H. (2005). Short de novo synthesis of fully functionalized uronic acid monosaccharides. Angew. Chem. Int. Ed. 44, 7605–7607. Varki, A., Cummings, R. D., Esko, J. D., Freeze, H. H., Stanley, P., Bertozzi, C. R., Hart, G. W., and Etzler, M. E. (1999). Essentials of Glycobiology Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
218
Jian Yin and Peter H. Seeberger
Vivier, E., Tomasello, E., Baratin, M., Walzer, T., and Ugolini, S. (2008). Functions of natural killer cells. Nat. Immunol. 9, 503–510. Zhang, Z., McCallum, S. A., Xie, J., Nieto, L., Corzana, F., Jimenez-Barbero, J., Chen, M., Liu, J., and Linhardt, R. J. (2008). Solution structures of chemoenzymatically synthesized heparin and its precursors. J. Am. Chem. Soc. 130, 12998–13007.
C H A P T E R
T E N
Measurement of Glycan-Based Interactions by Frontal Affinity Chromatography and Surface Plasmon Resonance Chihiro Sato, Nao Yamakawa, and Ken Kitajima Contents 1. Introduction 2. Frontal Affinity Chromatography (FAC) as a Tool for the Measurement of Glycan-Based Interactions 2.1. FAC principle 2.2. Materials and equipment 2.3. Preparation of affinity adsorbents 2.4. Preparation of neurotransmitters 2.5. Operation of frontal affinity chromatography 2.6. Interaction between polySia and neurotransmitter 3. Surface Plasmon Resonance (SPR)-Based Biosensors as a Tool for the Measurement of Glycan-Based Interactions 3.1. Materials and equipment 3.2. Preparation of biotinylated glycans 3.3. Immobilization of biotinylated glycans on an Au sensor chip 3.4. Immobilization of BDNF on a CM5 sensor chip 3.5. Biacore analysis 4. Conclusions Acknowledgments References
220 221 221 224 224 225 225 226 227 227 228 228 229 229 230 231 231
Abstract Proteins and lipids are often modified with glycan chains, which due to their large hydration effect and structural heterogeneity, significantly alter the surface physicochemical properties of proteins and biomembranes. This ‘‘glycoatmosphere’’ also serves as a field for interactions with various molecules, Bioscience and Biotechnology Center, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78010-1
#
2010 Elsevier Inc. All rights reserved.
219
220
Chihiro Sato et al.
including other glycans, lipids, peptides, proteins, and small molecules such as neurotransmitters and drugs as well as lectins. Therefore, sensitive techniques for measuring these glycan-based interactions are becoming more and more necessary, with the appropriate method largely depending on the interacting molecules. In this chapter, we focus on frontal affinity chromatography (FAC) and surface plasmon resonance (SPR) for examining polysialic acid-involved interactions with neurotransmitters and neurotrophins. FAC is characterized by its applicability to analyze weak interactions that are difficult to measure using conventional methods, and by the ease of principle and experimental procedures. SPR is advantageous due to the availability of suitable surface materials and for real-time monitoring with nonlabeled analytes.
1. Introduction Glycosylation is one of the major modifications of proteins and lipids, and a wide variety of glycosylations have been reported. However, the phenomenon of glycosylation remains somewhat mysterious due to a lack of appropriate methodologies for determining glycan structures as well as their biological functions. Recent methods of genetic perturbation for glycan-related enzymes have greatly impacted the understanding of the biological significance of glycans, even if the results are severe or benign. The underlying mechanisms which link gene expression to the resultant phenotypes, however, remain unknown. In this respect, it is important to understand glycan-based interactions with cellular components containing not only proteins, but also glycans, lipids, and other natural substances using appropriate analytical methods. In this chapter, we focus on the measurement of new polysialic acid (polySia)-based interactions using frontal affinity chromatography (FAC) and a surface plasmon resonance (SPR)-based Biacore instrument. PolySia is a polymerized structure of sialic acid present on neural cell adhesion molecules (NCAMs) as a posttranslational modification (Sato, 2004, 2010; Troy, 1996). PolySia-modified NCAM has been well studied in the development of the nervous system since the modification is spatiotemporally regulated (Bonfanti, 2006; Rutishauser, 2008). PolySia is expressed in embryonic brains during neural differentiation and mostly disappears in adult brains, although NCAM expression levels remain unchanged. Based on its bulky polyanionic nature, polySia is thought to function as an antiadhesive molecule against cell–cell and extracellular matrix interactions (Angata et al., 2006; Bonfanti, 2006; Rutishauser, 2008). However, we recently demonstrated by native PAGE analysis that an important neurotrophin in the brain, brain-derived neurotrophic factor (BDNF), interacts with polySia directly to form a large complex (Kanato et al., 2008). Therefore, polySia likely serves an important role as a
Measurement of Glyca-Based Interactions by Frontal Affinity
221
neurogenetic regulator similar to glycosaminoglycans that have been shown to bind growth factors and signaling molecules, such as Wnt (Schwartz and Domowicz, 2004). We thus proposed the hypothesis that, as a novel functional role, polySia may serve as a reservoir of neuroactive molecules, such as neurotrophins, growth factors, and neurotransmitters (Kanato et al., 2008, 2009). To gain insight into this potential novel function of polySia, we applied FAC and SPR for measuring polySia–neurotransmitter and polySia–neurotrophin interactions, respectively.
2. Frontal Affinity Chromatography (FAC) as a Tool for the Measurement of Glycan-Based Interactions Affinity chromatography is a commonly used and powerful tool for the purification of molecules that specifically interact with a target counterpart molecule. In the 1970s, Kasai and Ishii were the first to demonstrate that affinity chromatography is applicable to quantitative analysis for the estimation of dissociation constants for protein–ligand interactions (Kasai and Ishii, 1973). Kasai and his colleagues also applied FAC for the measurement of glycan–lectin interactions (Arata et al., 1997; Oda et al., 1981), which represented the first estimation of Kd. Hindsgaul et al. improved this method through the use of microcolumns and MS as a detector (Ng et al., 2005), allowing materials to be conserved and shortening the time required for analysis. This LC–MS system is particularly applicable for high-throughput screening. At the same time, Hirabayashi also developed an enhanced, high-throughput lectin–glycan interaction-analysis system between immobilized lectins and soluble fluorescent (PA)-labeled glycans (Kuno et al., 2005). Owing to improvements of these FAC-systems, FAC is a widely accepted technique for the analysis of lectin–glycan interactions. The FAC system has been well established and a number of wellwritten reviews are available (Hirabayashi et al., 2003; Kasai et al., 1986; Tateno et al., 2007). In this book, Kamiya and Kato also describe a lectin– glycan interaction revealed using a FAC system; in this chapter, we therefore focus on the general principle and methods for analyzing glycan-polymer and small molecule interactions.
2.1. FAC principle In frontal analysis, the elution front of an analyte and its concentration at a plateau level are measured when the analyte solution at various concentrations is eluted. For the analysis, the volume of the analyte solution should exceed the column volume. Under the assay conditions, as the free analyte
222
Chihiro Sato et al.
concentration is always fixed and equal to the initial concentration of analyte, dynamic equilibrium is achieved in the plateau region. Prior to the analysis, the column is packed with a resin on which the ligand of interest (termed B) is immobilized. The column is then isocratically eluted with an excess column volume of analyte (termed A) and the resulting elution curve of A is monitored. Based on the starting point of analyte elution (the elution front), the interaction between B and A can be detected. The retardation of elution (see line 2 in Fig. 10.1) indicates that analyte A interacts with B (Fig. 10.1). In contrast, an analyte which does not interact with B is eluted in the void volume of the column (see line 1 in Fig. 10.1). The generation of a retard volume (VV0) means a volume of an A–B complex formed as a result of specific interaction. Therefore, the area, [A]0(V V0), represents the amount of the A–B complex. Provided the column volume is u, the equation [A]0(VV0) ¼ u [AB] is realized. The dissociation constant (Kd) can be determined from Eq. (10.1), which is based on the equation: A þ B , AB. Kd ¼ ½A½B=½AB ¼ ½A0 ½B0 ½AB =½AB ¼ u½B0 =ðV V0 Þ ½A0 ð10:1Þ
Concentration of analyte
As [B]0 is the concentration of the immobilized ligand, and the effective ligand content can be obtained with the equation Bt ¼ u [B]0. Therefore, Eq. (10.1) can be followed by Eq. (10.2).
1 (no interaction with B) 2 (interaction with B)
[A]0
[A]0(V−V0)
0
V0
V
Elution volume
Figure 10.1 Schematic elution profiles of FAC. The immobilized ligand (B) is packed into a column and a volume in excess of the total column volume of analyte (A) is then eluted. Line 1 is the curve for the analyte that does not interact with B. The elution volume represents the void volume (V0) of the column. Line 2 is the curve for the analyte that interacts with B. The retard (VV0) indicates a specific interaction between A and B. The shaded area, [A]0(VV0), is the amount of the complex [AB].
Measurement of Glyca-Based Interactions by Frontal Affinity
Kd ¼ Bt=ðV V0 Þ ½A0
223
ð10:2Þ
The value for Bt is obtained from analyte concentration-dependent experiments using either a Lineweaver–Burk type plot, that is, 1/[A]0 versus 1/(V V0)[A]0, or a Woolf–Hofstee type plot, that is, (V V0) versus (V V0) [A]0. Equation (10.2) can be simplified to Eq. (10.3) where [A]0 (10 8 M) is negligible for the Kd value (e.g., >10 6 M). Kd ¼ Bt=ðV V0 Þ;
if ½A0 Kd
ð10:3Þ
The elution volume of an analyte (V ) is determined graphically as the volume corresponding to the elution point, which occurs at the half value of the plateau of the elution curve. V0 is determined as the V of the appropriate control sample without affinity for the immobilized ligand. The values of Bt and Kd are determined from the intercept of the axis and the slope of the fitted curves (Woolf–Hofstee-type plots, (V V0) vs. (V V0)[A]0) (Fig. 10.2), respectively, and Eq. (10.3) can be changed to Eq. (10.4). ½A0 ðV V0 Þ ¼ KdðV V0 Þ þ Bt
ð10:4Þ
Bt [A]0(V−V0)
Amount of complex
It should be noted that strong interactions cannot be measured with this system, as this method is based only on the retardation of elution and not the
Slope = −Kd
0
(V–V0) Retardation of analyte
Figure 10.2 The Woolf–Hofstee plot for the determination of Bt and Kd. Based on Eq. (10.4), [A]0 (V V0) ¼ Kd (V V0) þ Bt, the obtained data can be plotted. The x- and y-axes represent the retarded elution of analyte A (V V0) and the amount of A–B complex ([A]0 (V V0)), respectively. Therefore, from the intercept of y-axis, the Bt (effective ligand content) is calculated. The Kd value is obtained from the slope (¼ Kd).
224
Chihiro Sato et al.
complete loss of the analyte from the eluate. Therefore, this method is suited for the measurement of relatively weak interactions that are occasionally encountered, as in the case of glycan-based interactions.
2.2. Materials and equipment Polysialic acid (colominic acid) (Wako) Affigel 102 or Affigel Hz (Bio-rad) 1-ethyl-3-(3-diethylaminopropyl)-carbodiimide (Bio-rad) Phosphate-buffered saline (PBS) (pH 7.2; 10 mM; 137 mM NaCl; 2.7 mM KCl) 5. Neurotransmitters (epinephrine and dopamine) 6. Column (4.0 mm 10 mm, 126 ml, GL Science) 7. HPLC system (Rheodyne injector equipped with a 2 ml-PEEK sample loop and a UV-detector connected to an integrator) 1. 2. 3. 4.
2.3. Preparation of affinity adsorbents For the FAC analysis, two types of polySia (colominic acid)-immobilized resins are used which differed on whether polySia is immobilized through the reducing (Fig. 10.3A) or nonreducing (Fig. 10.3B) terminal end. To prepare the resin with reducing end-immobilized polySia, 5 ml (packed volume) of Affigel 102 in 25 mM Na2HPO4 (pH 6.0) are added to 2 ml of 50 mg/ml colominic acid, and the pH of the resulting solution is adjusted to 5.0 with 1 N HCl. After the addition of 8 mg 1-ethyl-3-(3-diethylaminopropyl)-carbodiimide, the reaction mixture is kept at 4 C for 4 h with gentle mixing by rotation. After washing with PBS, the gel is blocked with acetic anhydrite at room temperature for 30 min and washed with PBS and 1 M NaCl. Based on the amount of unbound polySia measured by the resorcinol method, the extent of immobilization of polySia is estimated to be 0.8 mmol/ml. To prepare the resin to which polySia is immobilized through the nonreducing terminal end (Fig. 10.3B), 5 ml (packed volume) of Affigel Hz in 50 mM sodium acetate buffer (pH 5.5) are added to 2 ml of 48 mg/ml periodate-oxidized colominic acid (prepared by incubation with 25 mM sodium periodate in 100 mM sodium acetate (pH 5.5) followed by desalting), and incubated at 25 C overnight with gentle mixing. After washing the gel with PBS, unbound colominic acid is measured by the resorcinol method to estimate the amount of immobilized colominic acid. The immobilization extent of colominic acid is estimated to be 0.7 mmol/ ml. The two types of resins are each packed into an empty column (4.0 mm 10 mm, 126 ml, GL Science) using a syringe. The prepared columns can be stored at 4 C until use.
225
Measurement of Glyca-Based Interactions by Frontal Affinity
A
H3C
O
H
C
N
O OH
COO− H3C
OH
O
OH
B
O H3C
C
Affi-Gel Hz
H
C
N
H N
O CH
O
H
OH
C
N N
OH
OH
O
N
Affi-Gel 102
OH
n
N
NH NH
O
COO−
H3C
O
H
C
N
O
O
OH
OH
COO−
OH
O
OH
n
NH
Figure 10.3 PolySia-immobilized beads used for FAC analysis. (A) polySia-affigel 102. (B) Affigel Hz-polySia.
2.4. Preparation of neurotransmitters A variety of neurotransmitters are commercially available. In this study, we selected epinephrine and dopamine for FAC analyses with the immobilized polySia ligand. For the analysis, each neurotransmitter is dissolved in PBS or an appropriate buffer at concentrations ranging from 0 to 30 nM.
2.5. Operation of frontal affinity chromatography A FAC system consists of a pump ( JASCO PU-980i), an injector with a sample loop, a column, and a UV detector ( JASCO 875-UV) connected to a chromato-PRO integrator (Run Time Corporation, Kanagawa, Japan). The 2 ml-sample loop (PEEK) and the column are either kept in an oven (CTO-6A, Shimadzu) or water bath at 25 or 37 C. Prior to analysis, the column is equilibrated with PBS at a flow rate of 0.125 ml/min until a flat baseline of absorbance was achieved. The sample injector is turned to the load position, and 10–20 ml of air is injected using a syringe to empty the sample loop completely. The analyte solution dissolved in PBS is then injected to fill the 2 ml-sample loop. Note that 50–100 ml of excess analyte
226
Chihiro Sato et al.
solution is required to completely fill the 2 ml-sample loop. The injector is then turned to the inject position to flow the analyte into the column at a rate of 0.125 ml/min. The analyte eluted from the column is monitored with a UV-detector and the elution curve is recorded for 8 min. After importing the recorded data into Microsoft Excel, the elution volume of the analyte (V) can be calculated, which represents the volume at which half of the plateau concentration is attained. To calculate V0, the elution data from the noninteracting control material (acetylcholine) is used.
2.6. Interaction between polySia and neurotransmitter Using either polySia-affigel 102 or affigel Hz-polySia, the interaction between polySia and the catecholamine neurotransmitters, i.e., epinephrine and dopamine could be observed. Typical elution profiles for epinephrine with polySia-affigel 102 at 37 C are shown in Fig. 10.4A. For the analyses, acetylcholine was used as a noninteracting neurotransmitter with polySia for the determination of V0. The VV0 values were measured for analyte concentrations ranging from 10 to 30 nM. Based on Eq. (10.4), the Kd value determined for epinephrine was 3.1 10 5 (M). Using the FAC, the interaction between two molecules can be examined under different conditions. For example, the effect of pH on the dopamine–polySia interaction was examined by varying the pH of the equilibration buffer and the analyte solution. The Kd value was affected by pH (Fig. 10.4B), indicating that the microenvironmental pH of the cell surface is important for the interaction between dopamine and polySia.
30 nM Acetylcholine
100
20 nM 10 nM
B 3.0
80
Kd(10−5)
% of plateau
A
60 40
2.5
20 0
0
0.2
0.4 0.6 V (ml)
0.8
1.0
2.0 5.5
6.0
6.5
7.0
7.5
8.0
8.5
pH
Figure 10.4 The interaction between polySia and catecholamine neurotransmitters as analyzed by FAC. (A) Typical elution profiles for epinephrine. The neurotransmitter was dissolved in PBS at a concentration of 10, 20, and 30 nM and 2 ml of each solution was applied to the column (126 ml) through the 2 ml-sample loop at a flow rate of 0.125 ml/min at 37 C. Each elution curve for epinephrine was superimposed on that of acetylcholine. The observed retardation of elution was dependent upon the concentration of epinephrine. (B) The Kd values for the interaction of dopamine–polySia at different pHs were calculated by FAC analysis. The Kd value for this interaction was dependent upon the pH of the solution.
Measurement of Glyca-Based Interactions by Frontal Affinity
227
3. Surface Plasmon Resonance (SPR)-Based Biosensors as a Tool for the Measurement of Glycan-Based Interactions An SPR-based biosensor was first reported in 1983 (Liedberg et al., 1983) and led to the development of the Biacore instrument. Although Biacore is the most commonly used, several other SPR-based instruments exist for analyzing molecular interactions. The principle of SPR is well documented in other reviews, including a recent one (Willander and Al-Hilli, 2009); thus, in this chapter, we focus on experimental procedures using a Biacore instrument to examine interactions between polySia and a neurotrophin. In order to reliably detect interactions by SPR, we recommend examining several sensor chips with respect to immobilization of the target ligand and the specificity of interaction. Biacore provides numerous types of sensor chips. For example, the CM5 chip is coated with carboxymethyldextran (100 nm thickness of dextran layer), and is the most commonly used because it effectively immobilizes ligands and low nonspecific binding can be achieved. Two other dextran-coated chips, CM4 and CM3, are available and contain a low amount of carboxyl groups and short chain-length dextran (30 nm thickness of dextran), respectively. The carboxyl groups in dextran are activated with either N-ethyl-N0 -[3-(dimethylamino)propyl] carbodiimide) (EDC) or N-hydroxysuccinimide (NHS) to allow conjugation with ligands through their -NH2, -SH, -COOH, and -CHO groups after the addition of appropriate reagents. Other special sensor chips are also available for the immobilization of tagged molecules. These include the SA chip, which is coated with a streptavidin-conjugated dextran for the immobilization of biotinylated ligands, and the NTA chip, which is coated with a NTA-conjugated dextran for immobilization of His-tagged ligands. Although CM5 is widely used, as the carboxymethyldextran coating on this chip contains many anions, it is important to confirm that observed interactions are specific and not due to nonspecific electrostatic forces. When nonspecific interactions are suspected, an Au chip without any coating should be used. In this chapter, we describe the use of the CM5 and Au chips for the immobilization of proteins and glycans, respectively.
3.1. Materials and equipment 1. 2. 3. 4.
Polysialic acid (polySia) (colominic acid) (Wako) Heparan sulfate (HS) (Seikagaku Co.) Tri-N-acetyl-chitotriose (!1GlcNAcb4!)3 (Seikagaku co.) Sensor Chip CM5 or Au (GE Healthcare)
228
Chihiro Sato et al.
Biotin-LC-hydrazide (Pierce) Sephadex G-25 (GE Healthcare) 4,4-thio-dibutylic acid (DBA, Aldrich) N-Ethyl-N0 -[3-(dimethylamino)propyl]carbodiimide) (EDC) N-Hydroxysuccinimide (NHS) Streptavidin HBS-EP (0.01 M HEPES, 0.15 M NaCl, 3 mM EDTA, 0.005% polysorbate 20 (v/v)), pH 7.4) 12. Brain-derived neurotrophic factor (BDNF, Almone) 13. Biacore 2000 (GE Healthcare) 5. 6. 7. 8. 9. 10. 11.
3.2. Preparation of biotinylated glycans To prepare biotinylated glycans, chitotriose (GlcNAc)3 (2 mg/ml), polySia (10 mg/ml), or heparan sulfate (HS) (10 mg/ml) in 50 mM sodium acetate buffer (pH 5.5) are mixed with biotin-LC-hydrazide (final concentration, 5 mM) dissolved in DMSO. After incubation at 50 C for 2 h, NaBH3CN in methanol (22.4 mM final concentration) is added to the reaction mixture. The biotinylated glycans are then applied to a Sephadex G-25 column (1.2 cm 60 cm) and eluted with water to remove free biotin.
3.3. Immobilization of biotinylated glycans on an Au sensor chip The Au sensor surface is washed once with acetone and after drying, the chip is immersed in 10 mM DBA in ethanol to form a self-assembly membrane (SAM) on the Au surface. After gently shaking for 30 min at room temperature, the sensor surface is washed with ethanol three times and allowed to dry. The chip is then placed in a solution of EDC and NHS (a 1:9 mixture of 130 mM EDC in water and 144 mM NHS in 1,4-dioxane) at room temperature for 30 min with gentle shaking to activate the SAM on the Au surface. After adding water, the surface is incubated for 5 min, and then washed the Au surface. The Au chip containing surface-activated SAM is placed on the sensor chip support using the sensor chip assembly unit, and is set in a Biacore 2000 instrument. After priming with water for 7 min, a 0.1 mg/ml streptavidin solution is loaded twice, each time for 7 min at a flow rate of 10 ml/min. The immobilized streptavidin is monitored by the resonance unit (RU) value and typically reaches 490–580 RU. To destroy the excess activated groups, 1 mM ethanolamine is injected into the system for 7 min. After washing with HBS-EP, the target biotinylated glycan (0.1 mg/ml in 500 mM HBS-EP) is injected to allow immobilization on the Au surface (Fig. 10.5). The captured glycans can be monitored and reach around 30 RU for (GlcNAc)3, 120 RU for polySia, and 120 RU for HS.
229
Measurement of Glyca-Based Interactions by Frontal Affinity
O H
O H H3 C
C N
OH OH OH
O
H COO− C 3
C N
O OH OH
O n
O
H
C
N
OH
O N H
H N
Bio tin Streptavidin
O
OH
H N
O C DBA*
S S Au sensor chip
Figure 10.5 PolySia-immobilized Au sensor chip using 40 -dithiodibutyric acid (DBA). DBA was incubated on an Au surface to make self-assembly membrane (SAM). The SAM was activated with NHS and EDC, and then streptoavidin was conjugated. By flowing biotinylated polySia, polySia-immobilized Au surface was applicable to measure interaction.
3.4. Immobilization of BDNF on a CM5 sensor chip To immobilize the neurotrophin BDNF, a research grade CM5 chip is set in a Biacore 2000. After washing with 40% glycerol, activation of the sensor chip surface is performed with a mixture of 400 mM EDC and 100 mM NHS for 7 min at a flow rate of 10 ml/min. Immediately after activation, a BDNF solution (5 ng/ml) in sodium acetate buffer (pH 5.0) is added. After the RU reaches an appropriate value, 1 mM ethanolamine is flowed for 7 min to destroy activated residues (Kanato et al., 2009).
3.5. Biacore analysis The interactions between BDNF and several glycans can be measured using a Biacore 2000 instrument. For the interaction of immobilized glycans with BDNF, varying concentrations of BDNF (0–220 nM) in HBS-EP are injected over the glycan-immobilized sensor chips at a flow rate of 20 ml/min. For the analysis of the interactions between immobilized BDNF and glycans, varying concentrations of polySia (0–80 mM) and HS (0–36 mM) in HBS-EP are injected over the BDNF-immobilized sensor chip at a flow rate of 20 ml/min. After 120 s, HBS-EP is flowed over the sensor surface to monitor the dissociation phase. Following 180 s of dissociation, the sensor surface is fully regenerated by the injection of 10 ml of 3 M NaCl. Using a range of polySia concentrations (0–80 mM) as the analyte and the BDNF-immobilized CM5 sensor chip, several sensorgrams can be obtained (Fig. 10.6). The polySia is flowed for 120 s at 20 ml/min for the association phase, and HBS-EP is then flowed for 120–300 s to monitor the dissociation phase. The sensorgrams allow not only the Kd value, but also the ka (M 1s 1) and kd (s 1) values to be calculated. The Kd value of polySia toward BDNF is 9.1 10 6 (M), whereas that of HS toward BDNF is 1.5 10 9 (M) (Kanato et al., 2009). Interestingly, HS displays nearly the identical affinity to BDNF and polySia as determined by gel-shift assays
230
Chihiro Sato et al.
Analyte
Buffer
200 150 80 mM
RU
100
40 mM 20 mM 10 mM 5 mM
50 0
0
50
100 150 200 250 300 Time (s)
Figure 10.6 SPR sensorgrams for the interaction between polySia and BDNF. BDNF was immobilized on a CM5 sensor chip. Several concentrations of polySia (5–80 mM) were flowed over the chip, and the sensorgrams were monitored. BDNF in HBS-EP (analyte) flowed for 0–120 s; HBS-EP (buffer) flowed for 120–300 s.
using native PAGE (Kanato et al., 2008, 2009). It is clearly indicated that polySia requires amine-groups of BDNF for binding and that HS does not require amine group of BDNF for binding. The binding modes of BDNF toward polySia and HS are different. The reverse mode of interaction, that is, immobilized glycans and flowing BDNF, can be also measured. We usually adopt the Au sensor chip for immobilization of polySia to exclude the relatively high affinity of BDNF for the dextran matrix on the CM5 chip. For both the polySiaand HS-immobilized Au sensor chips, BDNF (0–220 mM) is flowed at 20 ml/min for 120 s, followed by elution with HBS-EP. Based on the sensorgram of poySia or HS subtracted with that of (GlcNAc)3, the Kd values of polySia and HS were calculated to be 6.4 10 9 (M) and 2.5 10 9 (M), respectively. Notably, the dissociation constants of polySia obtained using glycan-immobilized and BDNF-immobilized chips are 1000 times different in magnitude, while those of HS are much the same. These results suggest that the binding mechanism is different between the BDNF-polySia and the BDNF-HS complexes.
4. Conclusions FAC has been widely used for analyzing lectin–carbohydrate interactions. The principle and the system of FAC are very simple and it has a merit for measurements of relatively low-affinity interactions that are often the case with
Measurement of Glyca-Based Interactions by Frontal Affinity
231
glycan-based interactions. This chapter features a new application of FAC to a measurement of interaction between glycans and small molecules. Indeed, the polySia–neurotransmitter interaction is demonstrated by this method. Thus, FAC can be applied to non-protein-based interactions that remain unnoticed and low-affinity interactions that are difficult to measure by other methods. With the FAC system, in addition to Kd value, its subtle changes depending on environmental conditions can be easily determined. In FAC, interactions are measured in the flow of analytes, and thus can mimic those in natural flow system such as bloodstream by changing the flow rate using appropriate HPLC pump. This chapter also features an improved protocol in Biacore to measure glycan-based interactions. Biacore has been widely used for glycan-based interactions using glycans immobilized onto the surface of CM-coated chip or flowing glycans as analytes. However, it is a problem that analytes sometimes bind to CM surface nonspecifically. In the improved protocol, we adopted a noncoated Au surface instead of the CM surface. Indeed, with this method, a novel specific interaction between polySia and BDNF together with the Kd value is demonstrated. In the fields of glycomics, researchers are searching for new glycan-based interactions with microarrays and other methods described in this book. Therefore, methodologies have become more and more important to understand quantitatively how specific and how strong the interaction occurs. Furthermore, not only binding but also releasing processes that may be regulated by the microenvironment of cell surface are crucial for functional regulation of the interacting molecule. To understand precise conditions of functioning of the glycan-based interactions, high-throughput and quantitative methods that can be applied under various conditions (flow or static, pH, salt, cations, and so on) would be important.
ACKNOWLEDGMENTS This research was supported in part by Grants-in-Aid for Scientific Research (C) (20570107) (to C. S.) from the Ministry of Education, Science, Sports and Culture and Grants-in-Aid for the Global COE Program: Advanced Systems Biology (to K. K. and N. Y.). We also thank Mr. Ryo Isomura and Miss Sayaka Ono for the results presented in this chapter.
REFERENCES Angata, K., Lee, W., Mitoma, J., Marth, J., and Fukuda, M. (2006). Cellular and molecular analysis of neural development of glycosyltransferase gene knockout mice. Methods Enzymol. 417, 25–37. Arata, Y., Hirabayashi, J., and Kasai, K. (1997). The two lectin domains of the tandemrepeat 32-kDa galectin of the nematode Caenorhabditis elegans have different binding properties. Studies with recombinant protein. J. Biochem. 121, 1002–1009.
232
Chihiro Sato et al.
Bonfanti, L. (2006). PSA-NCAM in mammalian structural plasticity and neurogenesis. Prog. Neurobiol. 80, 129–164. Hirabayashi, J., Arata, Y., and Kasai, K. (2003). Frontal affinity chromatography as a tool for elucidation of sugar recognition properties of lectins. Methods Enzymol. 362, 353–368. Kanato, Y., Kitajima, K., and Sato, C. (2008). Direct binding of polysialic acid to a brainderived neurotrophic factor depends on the degree of polymerization. Glycobiology 18, 1044–1053. Kanato, Y., Ono, S., Kitajima, K., and Sato, C. (2009). Complex formation of a brainderived neurotrophic factor and glycosaminoglycans. Biosci. Biotechnol. Biochem. 73, 2735–2741. Kasai, K., and Ishii, S. (1973). Unimportance of histidine and serine residues of trypsin in the substrate binding function proved by affinity chromatography. J. Biochem. 74, 631–633. Kasai, K., Oda, Y., Nishikata, M., and Ishii, S. (1986). Frontal affinity chromatography: Theory for its application to studies on specific interactions of biomolecules. J. Chromatogr. 376, 33–47. Kuno, A., Uchiyama, N., Koseki-Kuno, S., Ebe, Y., Takashima, S., Yamada, M., and Hirabayashi, J. (2005). Evanescent-field fluorescence-assisted lectin microarray: A new strategy for glycan profiling. Nat. Methods 2, 851–856. Liedberg, B., Nylander, C., and Lundstro¨m, I. (1983). Surface plasmon resonance for gas detection and biosensing. Sens. Actuators 4, 299–304. Ng, E., Yang, F., Kameyama, A., Palcic, M., Hindsgaul, O., and Schriemer, D. (2005). High-throughput screening for enzyme inhibitors using frontal affinity chromatography with liquid chromatography and mass spectrometry. Anal. Chem. 77, 6125–6133. Oda, Y., Kasai, K., and Ishii, S. (1981). Studies on the specific interaction of concanavalin A and saccharides by affinity chromatography. Application of quantitative affinity chromatography to a multivalent system. J. Biochem. 89, 285–296. Rutishauser, U. (2008). Polysialic acid in the plasticity of the developing and adult vertebrate nervous system. Nat. Rev. Neurosci. 9, 26–35. Sato, C. (2004). Chain length diversity of sialic acids and its biological significance. Trends Glycosci. Glycotech. 14, 331–344. Sato, C. (2010). Polysialic Acid. Bentham Science, UAE. (in press). Schwartz, N., and Domowicz, M. (2004). Proteoglycans in brain development. Glycoconj. J. 21, 329–341. Tateno, H., Nakamura-Tsuruta, S., and Hirabayashi, J. (2007). Frontal affinity chromatography: Sugar–protein interactions. Nat. Protoc. 2, 2529–2537. Troy, F. A. II. (1996). Sialobiology and the polysialic acid glycotope. In ‘‘Biology of the Sialic acid,’’ (Rosenerg, ed.). pp.95–144. Plenum press, New York. Willander, M., and Al-Hilli, S. (2009). Analysis of biomolecules using surface plasmons. Methods Mol. Biol. 544, 201–229.
C H A P T E R
E L E V E N
Detection of Weak-Binding Sugar Activity Using Membrane-Based Carbohydrates Kazuo Yamamoto and Norihito Kawasaki Contents 1. Introduction 2. Construction of Plasmids for Biotinylated Soluble Lectins 2.1. Materials 2.2. Methods 3. Preparation of Biotinylated Soluble Lectins and PE-Labeled Lectin Tetramer 3.1. Materials 3.2. Methods 4. Construction of Plasmids for the Fc-Fusion Protein and Purification of the Lectin–Fc Fusion Protein 4.1. Materials 4.2. Methods 5. Binding Assay for PE-Labeled Lectin Tetramer Using Flow Cytometry 5.1. Materials 5.2. Methods 6. Cells with Altered Glycans or Modification of Cell-Surface Glycans 6.1. Materials 6.2. Methods References
234 234 234 235 236 236 236 237 237 237 238 238 238 239 239 239 240
Abstract Protein–sugar interactions underlie many biological events. Although protein– sugar interactions are weak, they are regulated in physiological conditions including clustering, association with other proteins, pH condition, and so on. The elucidation of the precise specificities of sugar-binding proteins is essential for understanding their biological functions. To detect the weak-binding activity of carbohydrate-binding proteins to sugar ligands, we studied lectin tetramer binding Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78011-3
#
2010 Elsevier Inc. All rights reserved.
233
234
Kazuo Yamamoto and Norihito Kawasaki
to cell-surface carbohydrates by flow cytometry. Tetramerization of lectins enhanced their avidity for sugar ligands, and sugar chains displayed on the cell surfaces were easily accessible to such soluble lectins. In this chapter, we describe methods to (1) prepare biotinylated soluble lectin, (2) obtain R-phycoerythrinlabeled lectin tetramer, and (3) measure tetramer binding to various lectin-resistant cell lines or cells treated with sugar-processing inhibitors. This approach enabled us to detect the weak sugar-binding activity of lectins (Ka 104 M 1), especially those from animals, and also to elucidate their specificity for sugar ligands.
1. Introduction Lectin is a protein that causes cell aggregation via surface sugar chains. Many plant lectins have been classified based on their sugar-binding specificities and they are a widely used tool for the purification and characterization of many glycoproteins, glycolipids, and some glycoconjugates. It is well known that many kinds of sugar-binding proteins are also present in animals. These proteins act as receptors for sugar-containing ligands, although they cannot induce cell aggregation. The elucidation of animal lectin ligands is essential for understanding various biological functions, such as sugar-mediated signaling. However, animal lectins are quite different from classical plant lectins in their sugar-binding ability; the Ka values of plant lectin–sugar interactions range approximately from 106 to 107 M 1, while those of animal lectin–sugars are much weaker (almost 104 M 1). Furthermore, although one can easily prepare large amounts of plant lectins, animal lectins cannot be detected without an antibody against them. Thus, several methods used to analyze plant lectins are not suitable for animal lectins. We have established a highly sensitive method to monitor the interaction of animal lectins and sugars (Hu et al., 2009; Kawasaki et al., 2007, 2008; Mikami et al., 2010; Yamaguchi et al., 2007).
2. Construction of Plasmids for Biotinylated Soluble Lectins 2.1. Materials Quikchange II site-directed mutagenesis kit (Qiagen) pBluescript II SK(þ) vector (Stratagene) pET-3c vector (New England Biolabs) Plasmid harboring lectin cDNA Primers for PCR DNA polymerase for PCR
235
Detection of Weak Lectin Activity
2.2. Methods To construct plasmids of a soluble lectin domain with an enzymatic biotinylation sequence, cDNA encoding a lectin domain was amplified by polymerase chain reaction (PCR) using appropriate primers and a lectin cDNA as a template. The amplified DNA was inserted between the Sma I sites of the pBluescript SK II vector. To introduce several amino acid substitutions to obtain sugar-binding defective mutants, the respective nucleotide(s) were substituted by PCR-based mutagenesis using a Quikchange II site-directed mutagenesis kit and mutated primers. A cDNA encoding the enzymatic biotinylation sequence GGGLNDIFEAQKIEWHE was introduced between Nde I and BamH I sites of pET-3c expression vector in Escherichia coli cells by ligation with a synthetic DNA of 50 -ggaattccatatggaattcccgggggcggtctgaacgacatcttcgaagctcagaaaatcgaatggcacgaataaggatccgcg-30 (Nde I, Sma I, and BamH I sites are underlined) (Wada et al., 2004) (pET-3cbio, Fig. 11.1). The cDNAs encoding a lectin domain were again PCR-amplified and ligated into between Nde I and Sma I sites of pET-3cbio (Fig. 11.1).
Nde I
Nde I
Lectin domain
Bio tag BamH I Nde I Sma I
Sma I
PCR Nde I
BamH I
Sma I
pET-3c
I Bam H
pET-3cbio
N
de
I
Sma I
Sma I
Lectin domain
pET-3cbioLec
Figure 11.1 Preparation of plasmids encoding a soluble lectin domain with a biotinylation tag. PCR-amplified or synthetic biotin-tagged DNA with Nde I and BamH I sites at 50 - and 30 -end, respectively, is inserted between the Nde I and BamH I sites of pET-3c (pET-3cbio). After digestion with both Nde I and Sma I, the PCR-amplified lectin domain cDNA is inserted between the Nde I and Sma I sites of pET-3cbio (pET3cbioLec).
236
Kazuo Yamamoto and Norihito Kawasaki
3. Preparation of Biotinylated Soluble Lectins and PE-Labeled Lectin Tetramer 3.1. Materials BL21(DE3)pLysS E. coli cells Isopropyl b-thiogalactopyranoside Solubilization buffer: 50 mM Tris–HCl, pH 8.0, containing 6 M guanidine, 1 mM DTT, and 0.1 mM EDTA Refolding buffer: 100 mM Tris–HCl, pH 7.5, containing 0.4 M L-arginine, 5 mM reduced glutathione, 0.5 mM oxidized glutathione, and 0.5 mM phenylmethanesulfonyl fluoride (PMSF) Dialysis buffer: 20 mM Tris–HCl, pH 7.5, containing 25 mM NaCl and 0.1 mM EDTA UNO Q-6 ion-exchange column (12 mm 53 mm; Bio-Rad) UNO Q buffer A: 20 mM Tris–HCl, pH 7.5, containing 25 mM NaCl UNO Q buffer B: 20 mM Tris–HCl, pH 7.5, containing 500 mM NaCl Biotin ligase BirA (Avidity) Superdex-75 10/300 GL column (10 mm 300 mm; GE Healthcare BioSciences) HBS: 20 mM HEPES–NaOH, pH 7.4, containing 150 mM NaCl R-phycoerythrin (PE)-conjugated streptavidin (BD Biosciences)
3.2. Methods The soluble lectin domain with a C-terminal biotinylation tag was expressed in the BL21(DE3)pLysS strain of E. coli in the presence of 1 mM isopropyl b-thiogalactopyranoside, and recovered as soluble proteins or inclusion bodies. Recovered inclusion bodies were solubilized in solubilization buffer, diluted with refolding buffer to a protein concentration of 6 mM, and refolded in vitro by dialysis against dialysis buffer at 4 C for 24 h. Instead of EDTA, several metal ions were occasionally added to the refolding and dialysis buffers to enhance the correct folding of denatured polypeptides. The pH condition was critical to obtaining large amounts of recombinant proteins. The dialyzed fraction was applied to a UNO Q-6 column, and then equilibrated with 20 mM Tris–HCl, pH 7.5, containing 25 mM NaCl. The column was eluted with 18 ml of a linear gradient of NaCl from 25 to 500 mM in the same buffer. The purity of each fraction was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) according to the method of Laemmli. Purified proteins fused to a C-terminal biotinylation tag were biotinylated with a biotin ligase, BirA (Fig. 11.2). The remaining free biotin was removed by gel filtration using a
237
Detection of Weak Lectin Activity
Biotin ligase PE-labeled SA Biotinylation tag
Biotin
Figure 11.2 Strategies for preparing PE-labeled lectin tetramer. The purified recombinant soluble lectin domain with a C-terminal biotinylation tag is enzymatically biotinylated with BirA, and then tetramerized with PE-labeled streptavidin (PE-SA).
Superdex-75 10/300 GL column, and eluted with 20 mM HEPES–NaOH, pH 7.4, containing 150 mM NaCl (HBS). Biotinylation was confirmed with a gel-shift assay using SDS-PAGE of the sample without boiling (Kawasaki et al., 2007). To prepare the R-PE-labeled soluble lectin tetramer, biotinylated lectin was mixed with PE-conjugated streptavidin (PE-SA) at a molar ratio of 4:1 for 1 h on ice (Fig. 11.2). If it was difficult to prepare the soluble lectin domain in E. coli cells, then a lectin domain fused with human IgG-Fc was used instead (Yamaguchi et al., 2010), although it should be noted that the avidity of the dimeric Fc-fusion protein is weaker than that of tetramer complexed with streptavidin (Knibbs et al., 1998).
4. Construction of Plasmids for the Fc-Fusion Protein and Purification of the Lectin–Fc Fusion Protein 4.1. Materials pRc/CMV vector (Invitrogen) HEK293T cell Lipofectamine 2000 (Invitrogen) Protein G-Sepharose (GE Healthcare) Equilibration buffer: 20 mM NaOAc, pH 5.6, containing 150 mM NaCl Elution buffer: 100 mM glycine–HCl, pH 2.8 Anti-human Fc antibody (Zymed)
4.2. Methods cDNA fragment encoding the Fc segment of human IgG1 was cloned into a pRC/CMV vector (pRc/CMV-Fc). The cDNA corresponding to the lectin domain was PCR-amplified using primers and a lectin cDNA as a
238
Kazuo Yamamoto and Norihito Kawasaki
template. The PCR product was then inserted into a pRc/CMV-Fc to generate a lectin–Fc fusion protein (pRc/CMV-LecFc). HEK293T cells were transfected with pRc/CMV-LecFc using Lipofectamine 2000, and culture supernatants were collected. Expression of lectin–Fc fusion protein in the culture supernatant was confirmed by Western blotting using an antihuman Fc antibody. To purify the lectin–Fc fusion protein, the culture supernatant was applied to a Protein G-Sepharose column equilibrated with equilibration buffer, washed with the same buffer, and eluted with elution buffer. The eluted fraction was neutralized with 1 M Tris–HCl, pH 9.5.
5. Binding Assay for PE-Labeled Lectin Tetramer Using Flow Cytometry 5.1. Materials HEPES buffered saline (HBS): 20 mM HEPES–NaOH, pH 7.4, containing 150 mM NaCl and 1 mM EDTA BSA-containing HBS (HBSB): HBS containing 0.1% NaN3 and 0.1% bovine serum albumin U bottom 96-well plate (Millipore) Propidium iodide (PI) FACSCalibur Flow Cytometer (BD Biosciences) Monosaccharides and oligosaccharides for inhibition
5.2. Methods Cultured mammalian cells were harvested, washed with HBS, and suspended in HBSB at a concentration of 2 107 cells/ml. Ten microliters of the cells were incubated with 10–100 mg/ml PE-labeled soluble lectin tetramer in HBSB at 25 C for 30 min in a 96-well plate. After washing twice with HBS, cells were suspended in 200 ml of HBS containing 1 mg/ml PI. The fluorescence of stained cells was measured using flow cytometry. The cell-surface fluorescence at 575 nm associated with PE was then recorded (Fig. 11.3). In total, 104 live cells gated by forward and side scattering and PI exclusion were acquired for analysis. To determine the divalent cation dependency of the tetramer binding, 1 mM of metal ions was added to HBSB instead of 1 mM EDTA. To test the effect of exogenous mono- and oligosaccharides on the binding of PE-labeled soluble lectin tetramer to the cells, tetramer was preincubated with various concentrations of mono- or oligosaccharides at 25 C for 30 min before being added to the cells.
239
Detection of Weak Lectin Activity
KIF
KIF/endo H
Cell number
None
100
101
102
103
104
100 101 102 103 104 100 Fluorescence intensity
101
102
103
104
Figure 11.3 Soluble VIP36 tetramer bound to high molecular weight high mannosetype glycans on the cell surfaces. HeLaS3 cells (none), cells treated with 2 mg/ml kifunensine for 24 h (KIF), or kifunensine-treated cells subjected to endo H digestion (KIF/endo H) were incubated with 10 mg/ml PE-labeled soluble VIP36 tetramer (filled histogram) or PE-SA as a control (thin line) in the presence of 1 mM CaCl2, and then analyzed by flow cytometry.
6. Cells with Altered Glycans or Modification of Cell-Surface Glycans 6.1. Materials Cultured cell lines (CHO, Lec1, Lec2, Lec4, Lec8, pgsA-745, pgsB-618, pgsC-605, BHK, RicR14, RicR15, and RicR21) (American Type Culture Collection) Castanospermine (CST) (Sigma-Aldrich) Deoxynojirimycin (DNJ) (Sigma-Aldrich) Deoxymannojirimycin (DMJ) (Sigma-Aldrich) Kifunensine (KIF) (Calbiochem) Swainsonine (SW) (Calbiochem) Endo-b-N-acetylglucosaminidase H (endo H, New England Biolabs)
6.2. Methods Several kinds of cells with defects in sugar chain processing have been established. Lec1, Lec2, Lec4, and Lec8 cells are lectin-resistant CHO mutants defective in GlcNAc-TI, CMP-sialic acid transporter, GlcNAcTV, and UDP-Gal transporter, respectively. The pgsA-745, pgsB-618, and pgsC-605 mutants of CHO cells have defects in xylosyltransferase I, galactosyltransferase I, and the sulfate transporter involved in galactosaminoglycan synthesis, respectively. The RicR14, RicR15, and RicR21 mutants of BHK cells are defective in GlcNAc-TI, a-mannosidase II, and GlcNAc-TII,
240
Kazuo Yamamoto and Norihito Kawasaki
respectively. These are useful target cells to measure binding and to determine the sugar-binding specificity of lectin. To modify cell-surface N-glycans, cells were treated for 24 h with 1 mM CST, 1 mM DNJ, 1 mM DMJ, 2 mg/ml KIF, or 10 mg/ml SW (Fig. 11.3). To remove high mannose-type N-glycans from the cell surface, endo-b-Nacetylglucosaminidase H (endo H, 5.0 103 U) was added to 2 106 cells suspended in 500 ml of HBSB and incubated at 37 C for 3 h (Fig. 11.3). Alternatively, cells expressing specific sugar chains are available by transfection with cDNA encoding carbohydrate-modifying enzyme (Mitoma and Fukuda, 2006). Using these kinds of cells, it is possible to determine the sugar-binding specificity of the lectin.
REFERENCES Hu, D., Kamiya, Y., Totani, K., Kamiya, D., Kawasaki, N., Yamaguchi, D., Matsuo, I., Matsumoto, N., Ito, Y., Kato, K., and Yamamoto, K. (2009). Sugar-binding activity of the MRH domain in ER-glucosidase II b subunit is important for efficient glucose trimming. Glycobiology 19, 1127–1135. Kawasaki, N., Matsuo, I., Totani, K., Nawa, D., Suzuki, N., Yamaguchi, D., Matsumoto, N., Ito, Y., and Yamamoto, K. (2007). Detection of weak sugar binding activity of VIP36 using VIP36–streptavidin complex and membrane-based sugar chains. J. Biochem. 141, 221–229. Kawasaki, N., Ichikawa, Y., Matsuo, I., Totani, K., Matsumoto, N., Ito, Y., and Yamamoto, K. (2008). The sugar-binding ability of ERGIC-53 is enhanced by its interaction with MCFD2. Blood 111, 1972–1979. Knibbs, R. N., Takagaki, M., Blake, D. A., and Goldstein, I. J. (1998). The role of valence on the high-affinity binding of Griffonia simplicifolia isolectins to type A human erythrocytes. Biochemistry 37, 16952–16957. Mikami, K., Yamaguchi, D., Tateno, H., Hu, D., Qin, S., Kawasaki, N., Yamada, M., Matsumoto, N., Hirabayashi, J., Ito, Y., and Yamamoto, K. (2010). The sugar-binding ability of human OS-9 and its involvement in ER-associated degradation. Glycobiology 20, 310–321. Mitoma, J., and Fukuda, M. (2006). Expression of specific carbohydrates by transfection with carbohydrate modifying enzymes. Methods Enzymol. 416, 293–304. Wada, H., Matsumoto, N., Maenaka, K., Suzuki, K., and Yamamoto, K. (2004). The inhibitory NK cell receptor CD94/NKG2A and the activating receptor CD94/ NKG2C bind the top of HLA-E through mostly shared but partly distinct sets of HLA-E residues. Eur. J. Immunol. 34, 81–90. Yamaguchi, D., Kawasaki, N., Matsuo, I., Totani, K., Tozawa, H., Matsumoto, N., Ito, Y., and Yamamoto, K. (2007). VIPL has sugar-binding activity specific for high-mannnosetype N-glycans, and glucosylation of the a1, 2 mannotriosyl branch blocks its binding. Glycobiology 17, 1061–1069. Yamaguchi, D., Hu, D., Matsumoto, N., and Yamamoto, K. (2010). Human XTP3-B binds to a1-antitrypsin variant null Hong Kong via the C-terminal MRH domain in a glycan-dependent manner. Glycobiology 20, 348–355.
C H A P T E R
T W E LV E
Fluorescence-Based Solid-Phase Assays to Study Glycan-Binding Protein Interactions with Glycoconjugates ¨nen* and Richard D. Cummings† Anne Leppa Contents 1. Overview 2. Biotinylation of Glycopeptides, Oligosaccharides, and Cells 2.1. Biotinylation of glycopeptides through cysteine residues 2.2. Biotinylation of glycopeptides through primary amines 2.3. Biotinylation of oligosaccharides 2.4. Biotinylation and fixation of HL-60 cells 3. Fluorescence Labeling of GBPs and Cells 3.1. Labeling of Gal-1 through primary amines 3.2. Labeling of Gal-1 through cysteines 3.3. Labeling of tomato (LEA) lectin through carbohydrates 3.4. Labeling of human T lymphocytes 4. P- and L-Selectin Binding to Immobilized Glycosulfopeptides and Determination of Apparent Binding Affinity 4.1. An assay with recombinant P- and L-selectin 4.2. Determination of apparent binding affinity for L-selectin 4.3. An assay with T lymphocytes 5. Galectin-1 Binding to Immobilized Glycopeptides and Glycans and Determination of Apparent Binding Affinity 5.1. An assay with recombinant galectin-1 5.2. Determination of apparent binding affinity 6. Galectin-1 Binding to Immobilized HL-60 Cells and Determination of Apparent Binding Affinity 6.1. An assay with recombinant galectin-1 6.2. Determination of apparent binding affinity Acknowledgments References
242 244 245 245 245 247 247 247 248 248 248 249 249 250 252 254 255 257 257 257 259 262 262
* Department of Biosciences, Division of Biochemistry, University of Helsinki, Viikinkaari, Helsinki, Finland Department of Biochemistry, Emory University School of Medicine, Atlanta, Georgia, USA
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78012-5
#
2010 Elsevier Inc. All rights reserved.
241
242
¨nen and Richard D. Cummings Anne Leppa
Abstract Development of glycan microarray technologies have recently revealed many new features in the binding specificities of glycan-binding proteins (GBPs) including animal and plant lectins, antibodies, toxins, and pathogens, including viruses and bacteria. Printed glycan microarrays are very sensitive, robust, and require very small quantities of glycans and GBPs. However, glycan arrays have been limited mostly to chemoenzymatically synthesized oligosaccharides and Nglycans isolated from natural glycoproteins. O-Glycans and more complex glycoconjugates, such as glycopeptides or whole cells, are generally lacking from most types of glycan microarrays. Certain GBPs such as selectins, that have more complex binding specificity, require peptide components besides the glycan structure for high-affinity binding to the ligand. GBP binding assays on glycan microarrays will provide only partial information about the specificity and high-affinity ligands for those GBPs. Therefore, more ‘‘natural’’ glycoconjugate arrays are required to study more complex GBP–glycoconjugate interactions. We have utilized a simple fluorescence-based solid-phase assay on a microplate format to study GBP–glycoconjugate interactions. The method utilizes commercial streptavidin-coated microplates, where various biotinylated ligands, such as glycopeptides, oligosaccharides, and whole cells, can be immobilized at a defined density. The binding of GBPs to immobilized ligands can be studied using fluorescently labeled GBPs or cells, or bound GBPs can be detected using fluorescently labeled anti-GBP antibodies. Our approach utilizing biotinylated and fixed cells in a solid-phase assay is a versatile method to study binding of GBPs to natural cell-surface glycoconjugates. Not only mammalian cells, but also microorganisms can be biotinylated and fixed, and adhesion of fluorescently labeled GBPs and antibodies to immobilized cells can be studied using standard streptavidin-coated microplates. Here, we present examples of fluorescence-based solid-phase assays to study P- and L-selectin and galectin-1 binding to immobilized glycopeptides, oligosaccharides, and cells. It should be noted that with the availability of complex glycoconjugates containing available primary amine groups, such as semisynthetic glycopeptides described here, that these could also be printed on covalent microarrays for interrogation by GBPs.
1. Overview Glycan microarray technologies have developed rapidly within recent years and at the same time knowledge on the binding specificity of GBPs has increased enormously (Blixt et al., 2004; de Boer et al., 2007; Song et al., 2008, 2009b,c; Xia et al., 2005). Glycan microarray binding data has revealed many new features on the binding specificity of mammalian GBPs such as galectins (Song et al., 2009d), siglecs (Blixt et al., 2008) and P-type lectins (Song et al., 2009a) and helped to identify novel GBPs, such as malectin (Schallus et al.,
Fluorescence-Based Solid Phase Assays
243
2008), and novel biological activities of GBPs, such as the ability of some tandem-repeat galectins (galectin-4 and -8) to bind blood group antigens on bacteria and directly kill them (Stowell et al., 2010). Printed glycan microarrays provide a high-throughput method to study GBP–glycan interactions with very small quantities of materials. However, glycan microarrays have been limited mostly to chemoenzymatically synthesized oligosaccharides containing relatively small sizes and often simple structures with only the most terminal monosaccharide residues of natural ligands, and thus lacking the backbone and core structures (Blixt et al., 2004). Because GBPs often recognize glycan backbone components besides terminal residues, the binding data on relatively simple glycan microarrays may not reveal the specificity and nature of highaffinity ligands. Therefore, there is a need for more natural glycan microarrays representing the display of glycans in a more relevant presentation, such as glycopeptides and glycolipids. Recently, first ‘‘natural’’ glycan arrays have been developed to contain N-glycans isolated from natural glycoproteins (de Boer et al., 2007; Song et al., 2009a,b,c,d), or natural glycolipids (de Boer et al., 2007; Liu et al., 2009). Natural glycan arrays have, for example, revealed differences in the specificity of galectins for complex N-glycans (Song et al., 2009d). However, O-glycans are often lacking from typical glycan microarrays, likely because O-glycans cannot be released from glycoproteins enzymatically and chemical methods are required for cleavage. Moreover, only those methods that release O-glycans in reducing form are applicable because the reducing monosaccharide unit must preserve the intact ring structure for coupling purposes. Some GBPs, such as selectins, recognize O-glycan structures on their glycoprotein ligands. For example, P-selectin has a very complex binding mechanism and requires peptide components besides a specific O-glycan at the extreme N-terminus of P-selectin glycoprotein ligand-1 (PSGL-1) for high-affinity binding (Leppa¨nen et al., 2000; Somers et al., 2000). We have utilized a simple fluorescence-based solid-phase assay on a microplate format to study more complex GBP–glycoconjugate interactions. Synthetic biotinylated glycopeptides, oligosaccharides, and cells were immobilized onto the streptavidin-coated microplates and probed with fluorescently labeled GBPs, and in some cases with fluorescently labeled cells. For example, a panel of biotinylated synthetic glyco(sulfo)peptides (GSPs) modeled after N-terminus of PSGL-1 was utilized to study the role of O-glycosylation and tyrosine sulfation for binding to P- and L-selectin (see below and Fig. 12.1A). As another example, the role and the mode of presentation of poly-N-acetyllactosamine (poly-LN) structures for galectin-1 binding were studied using biotinylated O-glycopeptides, oligosaccharide, and cells (see below and Fig. 12.1B). Examples of basic protocols, including methods to biotinylate glycopeptides, oligosaccharides, and cells, and methods to label GBPs and cells with fluorescent probes will be presented first. Please also read Chapter 19 in Volume 480 of this series, ‘‘Use of glycan microarrays to explore specificity of glycan-binding proteins’’ by David Smith, Xuezheng Song, and Richard Cummings.
244
¨nen and Richard D. Cummings Anne Leppa
A
L-/P-selectin binding to immobilized glycosulfopeptides Fluorescently-labeled anti-human IgG L-/P-selectin-Ig
Fluor. labeled T cell
L-selectin
Biotin with spacer Immobilized glycosulfopeptides B
Immobilized glycosulfopeptides
Galectin-1 binding to immobilized oligosaccharides and cells Fluorescently-labeled galectin-1 Fluorescently-labeled galectin-1
Biotin with spacer Immobilized oligosaccharides
HL-60 cell
Immobilized HL-60 cells
Figure 12.1 Examples of fluorescence-based solid-phase assays to study GBP– glycoconjugate interactions on streptavidin-coated microplates. (A) L-/P-selectin binding to immobilized glycosulfopeptides; (B) Galectin-1 binding to immobilized glycans and cells.
2. Biotinylation of Glycopeptides, Oligosaccharides, and Cells Various types of glycoconjugates can be biotinylated quantitatively using different types of coupling chemistries. For example, glycopeptides can be biotinylated through primary amine groups present at the amino terminus of each peptide chain and on lysine side chains. Glycopeptides can also be biotinylated through reduced cysteine residues, or carboxyl groups present at the carboxy termini of each peptide chain and on aspartate and glutamate residues. Reducing glycans can be biotinylated by reductive amination through reactive aldehyde at the reducing end under conditions
Fluorescence-Based Solid Phase Assays
245
that favor opening of the reducing end monosaccharide residue. Cellsurface proteins of intact cells are usually biotinylated through primary amines. Examples of biotinylation protocols for each type of glycoconjugate will be given below.
2.1. Biotinylation of glycopeptides through cysteine residues Synthetic GSPs modeled after N-terminus of human PSGL-1 were biotinylated through C-terminal cysteine residue (Fig. 12.2) (Leppa¨nen et al., 2002). Reduced GSPs were biotinylated by incubating peptides with a 2–20-fold molar excess of EZ-Link Biotin-HPDP (Pierce) in 100 ml of PBS containing 1 mM EDTA for 1–2 h at room temperature or overnight at þ4 C. The completeness of the reaction was confirmed by HPLC in an analytical reversed-phase C-18 column under eluent conditions that clearly separated biotinylated peptide product from nonbiotinylated peptide and free Biotin-HPDP. Biotinylated peptides were separated from excess Biotin-HPDP by HPLC and dried in vacuo. Biotinylated GSPs were dissolved in physiological buffer and the concentration of each peptide solution was determined by UV absorbance at 215 nm of a sample subjected to HPLC.
2.2. Biotinylation of glycopeptides through primary amines Poly-LN O-glycopeptides modeled after N-terminus of human PSGL-1 were biotinylated through the N-terminal primary amine group (Fig. 12.2) (Leppa¨nen et al., 2005). Glycopeptides were dissolved in PBS and incubated with a 10-fold molar excess of EZ-Link NHS-LC-LC-Biotin (Pierce) overnight at room temperature. Biotinylated glycopeptides were purified by reversed-phase HPLC as described above.
2.3. Biotinylation of oligosaccharides Reducing glycans can be biotinylated through their reducing terminus by reductive amination. Oligosaccharides (final concentration 1 mM) were incubated with 12.5 mM EZ-Link Biotin-LC-hydrazide (Pierce) and 0.25 M sodium cyanoborohydride in acetic acid/DMSO (3:7, v/v) overnight at þ60 C. Biotinylated oligosaccharides were purified by reversedphase HPLC under eluent conditions that clearly separated biotinylated oligosaccharide products from free Biotin-LC-hydrazide. Glycans in Fig. 12.2 were biotinylated using 2-azidoethyl glycoside derivatives of oligosaccharides as described (Leppa¨nen et al., 2005).
246
¨nen and Richard D. Cummings Anne Leppa
PSGL-1 O-glyco(sulfo)peptides
Poly-LN oligosaccharides b4
a3 – – – SO3 SO3 SO3
GSP-6
b3 a1
b6
E Y E Y L D Y D F L P E T E P P E C
46 48
51
57
b3 b4
b4 b3 b4
b3 b4
LN3
a3 b4 b3 b4
b3 b4
S3LN3
b4
a3
GSP(46)-6
Biotin b4
LN2 -Biotin
a3
SO–3
b3 a1
b6
E Y E Y L D Y D F L P E T E P P E C
46
LNnT
GSP(48)-6
E Y E Y L D Y D F L P E T E P P E C
48
-Biotin
57 b4
SO–3
GSP(51)-6
b3 a1
b6
E Y E Y L D Y D F L P E T E P P E C
51
GSP(46,48)-6
46 48
57
SO–3
E Y E Y L D Y D F L P E T E P P E M
b3 b4
-Biotin
E Y E Y L D Y D F L P E T E P P E C
b4 b3
-Biotin
b4
57
b3 b4
a3 a3
SO–3
GSP(48,51)-6
SO–3
b3 a1
E Y E Y L D Y D F L P E T E P P E C
48
51
GP-4 Biotin
E Y E Y L D Y D F L P E T E P P E M
-Biotin
b4
57
b3
a3 a3
b4 b3
b4 b3 a1
b6
GP-6
E Y E Y L D Y D F L P E T E P P E C
b4 b3
-Biotin
b4
57 b4 b6
GP-4
b6 b3 a1
E Y E Y L D Y D F L P E T E P P E C
GP-4 Biotin
a1
E Y E Y L D Y D F L P E T E P P E C
57
b3 a1
E Y E Y L D Y D F L P E T E P P E M
-Biotin Key
57
GP-1
b3 a1
b6
b4 b6
a1
E Y E Y L D Y D F L P E T E P P E M
b4 b3 a1
b3
b6
GP-4 Biotin
b6
51
b3 a1
b6
GP-4 Biotin
a3
46
b4
b4 b3 a1
a3
GSP(46,51)-6
Biotin
b4 b6
E Y E Y L D Y D F L P E T E P P E C
SO–3
Biotin b3 b4
Poly-LN O-glycopeptides
a3
SO–3
NGLN3
-Biotin
57 a3
SO–3
Biotin
b3 b4 b3 b4
NGLNnT
a3 a3
Biotin
b3 b4
NGLN2 b3 a1
Biotin
Degalactosylated poly-LN oligosaccharides
b4 b6
Biotin
-Biotin
57 a3
Biotin
b4 b3 b4
a3 – SO3
b4
LN
a3
-Biotin
GalNAc
Gal
GlcNAc
Glc
NeuNAc
Man
Fuc SO3
Sulfate
Figure 12.2 Structures of biotinylated glyco(sulfo)peptides (GSPs) and oligosaccharides. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2003, 2005). # The American Society for Biochemistry and Molecular Biology.
Fluorescence-Based Solid Phase Assays
247
2.4. Biotinylation and fixation of HL-60 cells Cell-surface proteins of HL-60 cells were biotinylated using EZ-Link Sulfo-NHS-LC-Biotin (Pierce) according to manufacturer’s instructions. After biotinylation, the cells were fixed for 30 min with 2% paraformaldehyde in PBS at room temperature, and fixed cells were washed three times with PBS and counted. A portion of biotinylated and fixed HL-60 cells were treated with glycosidases as described in Leppa¨nen et al. (2005), before immobilization on streptavidin-coated microtiter plates.
3. Fluorescence Labeling of GBPs and Cells GBPs can be labeled using a variety of fluorescent probes that react with different functional groups of a protein. Fluorescent probes can be covalently attached in a variety of ways, including via primary amines, reduced cysteine residues, or oxidized carbohydrate residues. The fluorescent probe should be selected carefully, because covalent derivatization of amino acid residues involved in ligand binding may result in inactivation of the GBP. Therefore, it is important to test the activity of the labeled GBP before using it in an assay. As an example, labeling of galectin-1 through cysteine residues preserves the activity of the protein better than labeling through primary amines. Selectin binding to the ligand utilizes certain lysine residues at the carbohydrate-binding domain and therefore, selectins should not be derivatized through primary amines. If a monoclonal antibody is available to a GBP under study, an antibody can be fluorescently labeled and used to detect the bound GBP in the assay. Alternatively, if a recombinant GBP has been produced as an IgG or IgM fusion protein, commercial fluorescently labeled anti-IgG (or IgM) monoclonal antibodies can be used for detection. Glycoproteins can also be labeled through oxidized carbohydrate residues with hydrazide compounds, if carbohydrates are not required for biological activity. Live cells can be labeled with fluorescent compounds that are taken up by cells. For example, nonfluorescent Calcein-AM is membrane permeable and after taken up by live cells it is hydrolyzed to fluorescent compound (calcein) by intracellular esterases. Membrane permeable compounds do not react with cell surface macromolecules and thus do not change adhesive properties of cells. Examples of protocols on fluorescence labeling of GBPs and cells will be presented below.
3.1. Labeling of Gal-1 through primary amines Human recombinant dimeric galectin-1 (Gal-1) was labeled through primary amines by incubating 1–2 mg of Gal-1 with Alexa Fluor 488 carboxylic acid succinimidyl ester (Molecular Probes, Inc.) in PBS containing
248
¨nen and Richard D. Cummings Anne Leppa
0.1 M lactose for 1 h at room temperature, and incubation was continued overnight at þ4 C under stirring. Free dye and lactose were removed from the labeled Gal-1 using a PD-10 column (Amersham Biosciences) in PBS containing 14 mM b-mercaptoethanol (2-mercaptoethanol). Labeled Gal-1 was chromatographed on a small lactosyl-agarose column (1–2 ml volume) in PBS to separate functionally inactive and active proteins. Bound (active) Gal-1 was eluted with 0.1 M lactose in PBS. Before each experiment, lactose was removed using a PD-10 column in PBS containing 14 mM b-mercaptoethanol.
3.2. Labeling of Gal-1 through cysteines Human recombinant Gal-1 was labeled through cysteines by incubating 1– 1.5 mg of Gal-1 with 10-fold molar excess of thiol reactive Alexa Fluor 488 C5-maleimide (Molecular Probes, Inc.) in PBS containing 0.1 M lactose overnight at þ4 C under stirring. Free dye and lactose were removed from the labeled Gal-1 using a PD-10 column in PBS containing 14 mM b-mercaptoethanol. Labeled Gal-1 was chromatographed on a small lactosyl-agarose column in PBS and bound Gal-1 was eluted with 0.1 M lactose in PBS. Before each experiment, lactose was removed using a PD-10 column in PBS containing 14 mM b-mercaptoethanol. Gal-1 labeled with Alexa Fluor 488 C5-maleimide was more stable during long-term storage than Gal-1 labeled with Alexa Fluor 488 carboxylic acid succinimidyl ester.
3.3. Labeling of tomato (LEA) lectin through carbohydrates Lycopersicon esculentum (tomato) agglutinin (LEA) (Vector Laboratories) (4 mg/ml in PBS) was first treated with 100 mM sodium m-periodate for 30 min at room temperature in the dark to oxidize cis-diols of carbohydrates to aldehydes. Sodium m-periodate was removed using a PD-10 gel filtration column in PBS. Oxidized LEA was incubated with Alexa Fluor 488 hydrazide (100 mg/mg lectin) (Molecular Probes, Inc.) for 1.5–2 h at room temperature under stirring. Free dye was removed using a PD-10 column in PBS. The degree of labeling of LEA was significantly higher using labeling through carbohydrates than in commercial fluorescently labeled LEA.
3.4. Labeling of human T lymphocytes Purified human T lymphocytes (5–10 106 cells/ml) were labeled with 1 mM Calcein-AM (acetoxymethyl) (Molecular Probes, Inc.) in PBS at 37 C for 30 min. Labeled cells were washed three times with PBS and suspended into Hank’s balanced salt solution (HBSS, with 1.3 mM Ca2þ and 0.9 mM Mg2þ) containing 1% BSA, and counted before being used in the assay.
Fluorescence-Based Solid Phase Assays
249
4. P- and L-Selectin Binding to Immobilized Glycosulfopeptides and Determination of Apparent Binding Affinity Selectins are a family of C-type lectins that are involved in leukocyte trafficking to inflamed tissues and lymphoid organs (McEver, 2002). P- and E-selectin are expressed on activated endothelial cells, P-selectin is also expressed on activated platelets, and L-selectin is expressed on leukocytes. All selectins bind to PSGL-1 expressed on leukocytes and in some cases on endothelial cells (Carlow et al., 2009; McEver and Cummings, 1997). Pand L-selectin bind to the extreme N-terminus of PSGL-1 specifically recognizing at least one of three tyrosine sulfate residues (Y46, Y48, Y51) and a nearby core 2-based O-glycan containing a sialyl Lewis x epitope (C2SLex) at T57 (Leppa¨nen et al., 1999, 2000, 2003; Somers et al., 2000). We have studied the site-specific role of each tyrosine sulfate residue (Tyr-SO3) and the role of O-glycan for binding to P- and L-selectin utilizing synthetic glycosulfopeptides (GSPs) modeled after the N-terminal sequence of mature PSGL-1 (Leppa¨nen et al., 2003). We have used different methods to compare binding affinity of P- and L-selectin to different GSPs. The methods include affinity chromatography, equilibrium gel filtration, and fluorescence-based solid-phase assay. Quantitative equilibrium binding data obtained from equilibrium gel filtration matched the binding data obtained from affinity chromatography and fluorescence-based solid-phase assay. Therefore, affinity chromatography and fluorescence-based solid-phase assay can be used as semiquantitative methods to determine relative binding affinity of a GBP to various immobilized ligands. Here, we present examples of fluorescence-based solid-phase assay to study the binding specificity of P- and L-selectin to immobilized GSPs.
4.1. An assay with recombinant P- and L-selectin Synthetic GSPs modeled after N-terminus of human PSGL-1 were biotinylated through C-terminal cysteine as described above (see Fig. 12.2 for structures). Reacti-BindTM streptavidin high binding capacity coated black 96-well plates (Pierce) were washed three times with 200 ml of 20 mM MOPS, pH 7.5, 150 mM NaCl, 2 mM CaCl2, 2 mM MgCl2, 0.02% NaN3 (buffer A) or 20 mM MOPS, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.02% NaN3 (buffer B). Equimolar amount of each biotinylated GSP (1 pmol/well with P-sel-Ig and 10 pmol/well with L-sel-Ig) was captured on the plate for 1.5 h in 50 ml of buffer A or B. After washing, the wells were incubated for 1 h with 50 ml of recombinant P-selectin IgG chimera (P-sel-Ig, 1 mg/ml) or L-selectin IgG chimera (L-sel-Ig, 10 mg/ml) in buffer A or B containing
250
¨nen and Richard D. Cummings Anne Leppa
1% BSA and 0.05% Tween-20. The wells were washed and subsequently incubated for 1 h with 50 ml of Alexa FluorTM 488 goat antihuman IgG (HþL) (Molecular Probes) (10 mg/ml) in buffer A or B containing 1% BSA and 0.05% Tween-20. All incubations were performed at room temperature, and the wells were washed three times with 300 ml of buffer A or B containing 0.05% Tween-20 between incubations. After final washing, 100 ml of buffer A or B was added to each well and the fluorescence was measured using a microtiter plate reader with excitation wavelength at 485 nm and emission wavelength at 535 nm. Background fluorescence reading without immobilized peptide was subtracted from each sample. The results show that both P- and L-sel-Ig bound with high affinity to GSP-6 containing three tyrosine sulfate residues and C2-SLex O-glycan at Thr57 (Fig. 12.3A and B). P- and L-sel-Ig bound very weakly to nonsulfated GP-6, but showed better binding to monosulfated and disulfated GSPs, with stronger binding to disulfated GSPs than to monosulfated GSPs. P-sel-Ig preferred to bind to GSPs containing tyrosine sulfate at position 48, but L-sel-Ig did not show clear preferential binding to any isomer of the mono- or disulfated GSPs, except for GSP(48,51)-6. Binding of P- and L-sel-Ig to all GSPs was strictly Ca2þ-dependent and quantitatively inhibited by including EDTA. The binding experiments with Pselectin and GSPs have also been carried out using equilibrium gel filtration and results from fluorescence-based solid-phase assay are in good agreement with equilibrium gel filtration data (Leppa¨nen et al., 2000).
4.2. Determination of apparent binding affinity for L-selectin Experiments shown in Fig. 12.3 were carried out using a single concentration of GBP. To identify high-affinity and low-affinity ligands, different concentrations of GBPs should be used in the binding assays. For example, a wide range of GBP concentrations is used to determine an apparent dissociation constant (Kd) for GBP binding to an immobilized ligand. We measured an apparent Kd for L-selectin and relative binding to immobilized GSP-6 and GP-6. Reduced salt concentration (50 mM NaCl) was used because it increases the binding affinity of selectins to ligands and therefore increases the sensitivity of binding (Koenig et al., 1997; Leppa¨nen et al., 2000, 2003). Various concentrations of L-sel-Ig were incubated with the immobilized peptides (10 pmol/well) in low salt buffer (50 ml/well in 20 mM MOPS, pH 7.5, 50 mM NaCl, 2 mM CaCl2, 2 mM MgCl2, 0.02% NaN3 containing 1% BSA and 0.05% Tween-20). The wells were subsequently incubated for 1 h with 50 ml of Alexa FluorTM 488 goat antihuman IgG (HþL) (Molecular Probes) in buffer (40 mg/ml). All incubations were performed at room temperature, and the wells were washed with buffer (without BSA) between incubations. Binding isotherms were obtained and apparent dissociation constants were derived from the binding
251
Fluorescence-Based Solid Phase Assays
A
25,000
P-sel-Ig binding Ca2+
20,000
5 mM EDTA
RFU
15,000
10,000
5000
P4 G
P6
51 8, (4
G
)-6
)-6 51 SP
SP
G
G
G
SP
(4
6, (4
SP G
6,
48
)-6
1) -6 (5
8) -6 (4 SP
G
G
SP
G
(4
SP
6) -6
-6
0
B
L-sel-Ig binding 15,000
Ca2+
RFU
5 mM EDTA
10,000
5000
P4 G
P6 G
)-6
G
SP (4
8,
51
)-6 51 6,
SP (4 G
SP (4
6,
48
)-6
-6 G
G SP (5
1)
-6
G SP (4
8)
-6 6)
G SP (4
G
SP -6
0
Figure 12.3 Binding of P-sel-Ig and L-sel-Ig to immobilized glyco(sulfo)peptides (GSPs). Biotinylated GSPs were immobilized on streptavidin-coated microtiter well (A, 1 pmol/well; B, 10 pmol/well). P-sel-Ig (A, 1 mg/ml) or L-sel-Ig (B, 10 mg/ml) was incubated with the immobilized GSPs in Ca2þ-containing buffer A (light gray bars) or in EDTA-containing buffer B (dark gray bars). Fluorescently labeled antihuman IgG was used for detection. All assays were performed in triplicate and the results represent the mean SD of three determinations. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2003). # The American Society for Biochemistry and Molecular Biology.
252
¨nen and Richard D. Cummings Anne Leppa
curves using nonlinear curve fitting with one site saturation equation. The apparent Kds were 20.4 nM for GSP-6 and 233 nM for GP-6, which indicates that L-sel-Ig binds to fully sulfated GSP-6 with a 12-fold higher affinity than to nonsulfated GP-6 (Fig. 12.4A and B). The data is consistent with the results obtained by fluorescence-based solid-phase assay using a single concentration of L-sel-Ig under physiologic and low salt conditions (not shown).
4.3. An assay with T lymphocytes To compare the binding specificity of recombinant L-sel-Ig and natural L-selectin present at the surface of resting human T lymphocytes, we used fluorescently labeled human T lymphocytes in solid-phase assay. The specificity of binding was controlled using EDTA and a function blocking mAb to L-selectin. Biotinylated GSP-6, GP-6, and GP-1 were immobilized onto streptavidin-coated microtiter plates at density of 5 pmol/well. Labeled cells (100,000 cells/well) were incubated with immobilized GSPs in physiologic Hank’s balanced salt solution (HBSS, with 1.3 mM Ca2þ and 0.9 mM Mg2þ) containing 1% BSA (50 ml/well) at room temperature for 30 min. Microtiter wells were washed four times with HBSS containing 1% BSA and bound fluorescence was measured using a microtiter plate reader. Parallel control experiments with EDTA and a monoclonal anti-L-selectin antibody DREG-56 (Pharmingen) were performed by preincubating cells for 15 min with 5 mM EDTA or DREG-56 (20 mg/ml), respectively, before incubating the cells with the immobilized ligands. Control wells with EDTA were washed four times with HBSS containing 1% BSA and 5 mM EDTA, and control wells with DREG-56 were washed four times with HBSS containing 1% BSA. T lymphocytes showed high-affinity binding to fully sulfated GSP-6, weak binding to nonsulfated GP-6, and no detectable binding to nonsulfated GP-1 containing only an a-linked GalNAc unit at Thr57 (Fig. 12.5). T lymphocyte binding to GSP-6 and GP-6 was completely inhibited by EDTA and DREG-56 showing that interaction was strictly dependent on Ca2þ and L-selectin. These results are in good agreement with the results obtained using recombinant L-sel-Ig (Figs. 12.3B and 12.4), indicating that natural L-selectin on T lymphocytes and recombinant L-sel-Ig have the same binding specificity to immobilized GSPs. Other types of leukocytes, such as acute promyelocytic HL-60 cells and acute monocytic leukemia THP-1 cells, did not show any detectable binding to immobilized GSP-6 (not shown). The results were consistent with cell-surface expression of L-selectin as verified using an anti-L-selectin monoclonal antibody in flow cytometry. Binding of fluorescently labeled cells to immobilized glycans/glycoconjugates can provide new information on the specificity of cell-surface GBPs
253
Fluorescence-Based Solid Phase Assays
A 140,000 GSP-6 120,000
RFU
100,000 80,000 60,000 40,000 App. Kd = 20.4 +/–2.4 nM 20,000 0 0 B
20
40
60
80 100 L-Ig (nM)
120
140
160
60,000 GP-6 50,000
RFU
40,000 30,000 20,000 App. Kd = 233 +/–30 nM
10,000 0 0
500
1000
1500 L-Ig (nM)
2000
2500
3000
Figure 12.4 Equilibrium binding affinity of L-sel-Ig for immobilized GSP-6 and GP-6 at low salt buffer. Biotinylated GSPs were immobilized on streptavidin-coated microtiter wells (10 pmol/well). Various concentrations of L-sel-Ig were incubated with the immobilized (A) GSP-6 and (B) GP-6 in low salt buffer (20 mM MOPS, pH 7.5, 50 mM NaCl, 2 mM CaCl2, 2 mM MgCl2, 1% BSA, 0.05% Tween 20, 0.02% NaN3). Fluorescently labeled antihuman IgG (40 mg/ml) was used to detect the bound L-sel-Ig. Assays were performed in triplicate and the results represent the mean standard error of the mean. Experiments shown are representative of three independent experiments. Modified, with permission, from Glycobiology Online (http://glycob.oxfordjournals.org/) (Lepp€anen et al., 2010). Copyright Oxford University Press.
254
¨nen and Richard D. Cummings Anne Leppa
80,000 T lymphocyte binding No inhibitor DREG-56 5 mM EDTA
RFU
60,000
40,000
20,000
0
GSP-6
GP-6
GP-1
Figure 12.5 Binding of human T lymphocytes to immobilized glyco(sulfo)peptides at physiologic buffer. Biotinylated GSPs were immobilized on streptavidin-coated microtiter wells (10 pmol/well). Purified, fluorescently labeled human T lymphocytes ( 100,000 cells/well) were incubated with the immobilized ligands in Hank’s balanced salt solution (with Ca2þ and Mg2þ) containing 1% BSA (light gray bars). In control experiments a function blocking mAb to L-selectin, DREG-56 (20 mg/ml) (medium gray bars), or 5 mM EDTA (dark gray bars) were preincubated with the cells in HBSS before adding to the wells. All assays were performed in triplicate, and the results represent the mean SD of three determinations. Modified, with permission, from Glycobiology Online (http://glycob.oxfordjournals.org/) (Lepp€anen et al., 2010). Copyright Oxford University Press.
or reveal the presence of novel GBPs. GBPs in their natural environment at the cell surface likely provides more ‘‘biologically’’ relevant information on their binding specificity than recombinant forms of the GBP, because GBP density and presentation is optimal at the cell surface.
5. Galectin-1 Binding to Immobilized Glycopeptides and Glycans and Determination of Apparent Binding Affinity Galectins are a family of soluble b-galactoside-binding GBPs and many members require reducing free thiols for activity (Leffler et al., 2004). Galectin-1 (Gal-1) is widely expressed in animals and has immunoregulatory functions (Rabinovich and Ilarregui, 2009). Gal-1 recognizes a2-3-sialylated and nonsialylated extended poly-N-acetyllactosamine
Fluorescence-Based Solid Phase Assays
255
(poly-LN) containing glycoconjugates (Leppa¨nen et al., 2005; Stowell et al., 2004, 2008). Our recent results indicated that Gal-1 recognizes terminal LN units on poly-LN structures and on other extended carbohydrate backbones, and binding depends on their mode of presentation (Leppa¨nen et al., 2005). In solid-phase assays, where glycans were immobilized on the surface of microtiter wells or at the cell surface, Gal-1 preferred to bind to extended poly-LN-type structures. However, in solution, Gal-1 bound to nonextended single LN unit similarly than to extended poly-LN structures (Ahmad et al., 2004; Hirabayashi et al., 2002; Leppa¨nen et al., 2005; Stowell et al., 2008). Here, we present some of the data on Gal-1 binding to immobilized glycopeptides, oligosaccharides, and cells, as another example of fluorescence-based solid-phase assay to study GBP–glycoconjugate interactions. The fluorescently labeled plant lectins Ricinus communis agglutinin I (RCA-I) and tomato lectin (LEA) were used as controls.
5.1. An assay with recombinant galectin-1 The contribution of the length of the poly-LN chain for binding to recombinant human dimeric Gal-1 was studied using immobilized synthetic glycopeptides and oligosaccharides. A series of glycopeptides (GP-4, GP-40 , GP-400 , GP-4000 ) modeled after N-terminus of PSGL-1 were synthesized to contain an extended core-2-based O-glycan at Thr57 (Fig. 12.2). Biotinylated glycopeptides and oligosaccharides were immobilized on streptavidincoated microtiter wells (50 pmol/well) in 50 ml of PBS for 1.5 h at room temperature. The wells were washed three times with 200 ml of PBS containing 0.05% Tween-20 and successively incubated for 1 h at room temperature with fluorescently labeled Gal-1 (40 mg/ml), RCA-I (120 mg/ ml, Vector laboratories), and LEA (50 mg/ml) in PBS containing 0.05% Tween-20 and 1% BSA. Bound Gal-1 and RCA-I were removed using 0.2 M lactose in PBS and 0.05% Tween-20 before incubating with the next lectin. After incubating with the lectins, wells were washed four times with 300 ml of PBS containing 0.05% Tween-20 and 100 ml of PBS was added to each well and fluorescence was measured using a microtiter plate reader with excitation and emission wavelengths at 485 and 535 nm, respectively. The background fluorescence reading after lactose washing was measured between incubations and subtracted from each sample. The results show that Gal-1 shows preferential binding to extended poly-LN structures on O-glycopeptides (GP-40 , GP-400 , and GP-4000 ) and on peptide-free glycans (LN2, LN3, and LNnT) (Fig. 12.6A). The degree of binding increased as the number of LN repeats increased. Gal-1 did not show detectable binding to degalactosylated NGLN2, NGLN3, and NGLNnT indicating that terminal galactose is highly important for binding. Bound Gal-1 was removed by washing with lactose and the wells were incubated with fluorescently labeled RCA-I that recognizes terminal
256
¨nen and Richard D. Cummings Anne Leppa
A
Gal-1 4000
RFU
3000
2000
1000
LN LN 2 LN LN 3 N nT G N LN G 2 N LN G LN 3 nT
G PG 4 P4 G PG 4 P4
0
B 150,000
RCA-I
RFU
100,000
50,000
LN LN 2 LN LN 3 N nT G N LN G 2 N LN G LN 3 nT
P4 G PG 4 P4
G
G
P-
4
0
C
LEA 80,000
RFU
60,000
40,000
20,000
LN 2 LN 3 LN N nT G L N N2 G N LN G 3 LN nT
G PG 4 P4 G P4 G P4 LN
0
Figure 12.6 Binding of human Gal-1, RCA-I, and LEA to immobilized glycopeptides and glycans. Biotinylated glycopeptides and glycans were immobilized on streptavidincoated microtiter wells (50 pmol/well). Fluorescently labeled (A) Gal-1 (40 mg/ml), (B) RCA-I (120 mg/ml), and (C) LEA (50 mg/ml) were successively incubated with the immobilized ligands. The data are representative of two independent experiments. All assays were performed in triplicate and the results are the mean SD of three determinations. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2005). # The American Society for Biochemistry and Molecular Biology.
Fluorescence-Based Solid Phase Assays
257
galactose residues (Baenziger and Fiete, 1979). RCA-I showed comparable binding to all ligands containing terminal Gal residues, indicating that the ligands were equivalently immobilized on the plate and were equally accessible for lectin binding (Fig. 12.6B). After removal of bound RCA-I, the wells were incubated with fluorescently labeled tomato lectin (LEA) that binds to long PL chains (Merkle and Cummings, 1987). LEA showed increased binding to ligands with increasing amount of LN repeats, including degalactosylated ligands (Fig. 12.6C). Control experiments with RCA-I and LEA verified that all ligands were equivalently immobilized and accessible for lectin binding. Our experiments also show that the same immobilized ligands on microtiter wells can be reused several times, if bound GBPs can be removed quantitatively by washing with a hapten sugar. This is helpful in conducting parallel experiments with different concentrations of the same GBP or probing with other GBPs.
5.2. Determination of apparent binding affinity The contribution of a2,3-sialic acid on S3LN3 for Gal-1 binding was examined by determination of apparent Kd for Gal-1 binding to immobilized S3LN3 and LN3. Various concentrations of fluorescently labeled Gal1 were incubated with immobilized LN3 and S3LN3 as described above. The apparent Kd derived from the binding curves were 3.5 mM for LN3 and 4.3 mM for S3LN3 indicating that Gal-1 binds to a2,3-sialylated and nonsialylated poly-LN structures with similar affinity (Fig. 12.7A and B). The result obtained with a single concentration of Gal-1 (40 mg/ml) was in good agreement with the apparent Kd values (Fig. 12.7A, the inset).
6. Galectin-1 Binding to Immobilized HL-60 Cells and Determination of Apparent Binding Affinity 6.1. An assay with recombinant galectin-1 The possibility that Gal-1 recognizes cell-surface poly-LN structures with higher affinity than immobilized monomeric poly-LN structures due to either differential presentation of poly-LN structures at the cell surface and/ or presence of higher affinity ligands at the cell surface was explored using immobilized cells in solid-phase assay. Human promyelocytic HL-60 cells expressing sialylated and nonsialylated cell-surface poly-LN glycans were biotinylated and fixed, and a portion of cells were treated with Arthrobacter ureafaciens neuraminidase. Untreated and neuraminidase-treated HL-60 cells were then digested with Escherichia freundii endo-b-galactosidase to cleave poly-LN structures, or alternatively jack bean b-galactosidase to digest
258
¨nen and Richard D. Cummings Anne Leppa
A 20,000
LN3 8000
15,000
RFU
10,000
4000 2000
Kd = 3.5 ± 0.8 mM 0
0
4
8
12
0 LN 3 LN 3
5000
S3
RFU
6000
16
20
16
20
B 10,000 S3LN3
RFU
8000 6000 4000 2000 Kd = 4.3 ± 0.7 mM 0 0
4
8 12 Gal-1 (mM)
Figure 12.7 Binding affinity of Gal-1 for immobilized LN3 and S3LN3. Biotinylated LN3 (A) and S3LN3 (B) were immobilized on streptavidin-coated microtiter wells (50 pmol/well). Various concentrations of fluorescently labeled Gal-1 were incubated with immobilized ligands. Assays were performed in duplicate and the results are the average of two determinations. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2005). # The American Society for Biochemistry and Molecular Biology.
terminal b-galactosyl residues. Parallel binding experiments were performed with tomato lectin (LEA) and Griffonia simplicifolia lectin II (GS-II) to control the effect of endo-b-galactosidase and b-galactosidase on HL-60 cells. Glycosidase digested and nondigested HL-60 cells were immobilized on streptavidin-coated microtiter wells at equivalent densities (100,000 cells/well) in 50 ml of PBS for 1.5 h at room temperature. The wells were washed three times with 200 ml of PBS containing 1% BSA and incubated with 50 ml of fluorescently labeled Gal-1 (40 mg/ml), LEA (100 mg/ml), or GS-II (100 mg/ml, EY Laboratories, Inc.) in PBS
Fluorescence-Based Solid Phase Assays
259
containing 1% BSA for 1 h at room temperature. The wells were washed four times with PBS containing 1% BSA and 100 ml of PBS was added to each well and the fluorescence was measured. Gal-1 bound to nontreated and neuraminidase-treated HL-60 cells but binding to nontreated cells was twofold less suggesting that a2-6-sialic acid residues on HL-60 cells may inhibit Gal-1 binding (Fig. 12.8A). Endo-bgalactosidase and b-galactosidase treatments of desialylated HL-60 cells reduced Gal-1 binding by 50% indicating that poly-LN structures and terminal galactose residues are important for Gal-1 binding. Endo-b-galactosidase and b-galactosidase treatments of parent sialylated HL-60 cells also reduced Gal-1 binding, but the effect of b-galactosidase treatment was less significant suggesting that most of the glycan structures on HL-60 cells are sialylated and unable to cleave with b-galactosidase. Bound Gal-1 was removed by incubating cells with 0.2 M lactose indicating the specificity of Gal-1 binding to HL-60 cells (not shown). Parallel binding experiment with LEA showed that endo-b-galactosidase treatment of parent sialylated and desialylated HL-60 reduced LEA binding by 50% indicating that 50% of poly-LN structures were removed by endo-b-galactosidase (Fig. 12.8B). By contrast, b-galactosidase treatment did not have a significant effect on LEA binding indicating that terminal b-galactosyl residues are not important for LEA binding, consistent with results obtained using immobilized glycans. GS-II recognizes terminal b-GlcNAc residues (Lyer et al., 1976) that are exposed when glycans are cleaved with b-galactosidase and endo-b-galactosidase. Endo-b-galactosidase treatment of parent sialylated and desialylated HL-60 cells significantly increased GS-II binding indicating that enzyme treatment was successful (Fig. 12.8C). b-Galactosidase treatment had a significant increase on GS-II binding only with desialylated HL-60 cells, but not with parent HL-60 cells indicating that most of the terminal b-galactosyl residues are penultimate to sialic acid in HL-60 cells and that sialidase treatment was successful.
6.2. Determination of apparent binding affinity The binding affinity of Gal-1 for neuraminidase-treated and nontreated immobilized HL-60 cells was determined by incubating various concentrations of fluorescently labeled Gal-1 with immobilized cells in the presence or absence of 20 mM lactose. The apparent Kds derived from the binding curves were 2.6 mM for desialylated HL-60 cells and 5.9 mM for nontreated HL-60 cells (Fig. 12.9A and B). Lactose concentration of 20 mM inhibited >70% of the binding in both cases. The data is consistent with results obtained by using a single concentration of Gal-1 (Fig. 12.8A). In conclusion, Gal-1 bound cell-surface poly-LN structures and immobilized synthetic poly-LN glycans (S3LN3 and LN3) with comparable affinity
260
¨nen and Richard D. Cummings Anne Leppa
A
40,000
Gal-1 No treatment
30,000
Endo-b-galactosidase
RFU
b-galactosidase 20,000
10,000
B
0 LEA
RFU
200,000
150,000
100,000
50,000
C
0 GS-II 100,000
RFU
80,000 60,000 40,000 20,000 0 Desialylated HL-60 cells
HL-60 cells
Figure 12.8 Binding of Gal-1, LEA, and GS-II to immobilized desialylated and nontreated HL-60 cells. A Portion of biotinylated and fixed HL-60 cells first were desialylated. Nontreated and desialylated HL-60 cells were treated with endo-b-galactosidase or b-galactosidase, and immobilized on streptavidin-coated microtiter wells (100,000 cells/well). Fluorescently labeled (A) Gal-1 (40 mg/ml), (B) LEA (100 mg/ ml), and (C) GS-II (100 mg/ml) were incubated with the immobilized cells. All assays were performed in triplicate and the results are the mean SD of three determinations. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2005). # The American Society for Biochemistry and Molecular Biology.
261
Fluorescence-Based Solid Phase Assays
A
40,000 Desialylated HL-60 cells
30,000
RFU
– Lactose + Lactose
20,000
Kd = 2.6 ± 0.3 mM
10,000
0 0
B
15,000
4
8 12 Gal-1 (mM)
16
20
HL-60 cells
– Lactose + Lactose
RFU
10,000
Kd = 5.9 ± 0.7 mM
5000
0 0
4
8 12 Gal-1 (mM)
16
20
Figure 12.9 Binding affinity of Gal-1 for immobilized desialylated and nontreated HL-60 cells. Biotinylated, fixed, desialylated HL-60 cells (A) and biotinylated, fixed, nontreated HL-60 cells (B) were immobilized on streptavidin-coated microtiter wells (100,000 cells/well). Various concentrations of Gal-1 were incubated with the immobilized cells in buffer with or without 20 mM lactose. All assays were performed in duplicate and the results are the average of two determinations. This research was originally published in the Journal of Biological Chemistry (Lepp€anen et al., 2005). # The American Society for Biochemistry and Molecular Biology.
262
¨nen and Richard D. Cummings Anne Leppa
indicating that the presentation of poly-LN structures at the cell surface does not improve the binding affinity. Our results indicate that fluorescence-based solid-phase assay is a versatile method to study binding of purified or recombinant GBPs to cellsurface glycoconjugates. Not only mammalian cells, but also microorganisms can be biotinylated and fixed, and adhesion of fluorescently labeled GBPs and antibodies can be studied using standard streptavidin-coated microplates. Additional binding experiments with plant lectins can provide valuable structural information of cell-surface glycoconjugates, because the specificity of many plant lectins has been well defined. If combined with highly specific glycosidase digestions, the binding assays can provide more structural information on cell-surface glycoconjugates. In the present experiments, we treated biotinylated and fixed cells with glycosidases before capturing cells on streptavidin plates. We did not observe significant differences in the binding assays, if glycosidase treatments were performed on the plate after capturing biotinylated and fixed cells (not shown). GBP binding assays with immobilized cells may reveal new high-affinity ligands for a given GBP. It is likely that GBPs may recognize natural ligands present at the cell surface differently than individual isolated glycans. The approaches we have described here allow researchers to prepare glycans from target cells and to produce natural glycan microarrays that reflect glycan presentations on natural glycoconjugates.
ACKNOWLEDGMENTS This work was supported by grants from the Academy of Finland (no. 106908 and 118469 [to A. L.]), from Magnus Ehrnrooth Foundation (Helsinki, Finland [to A. L.]), and from the National Institutes of Health, USA (no. HL085607 [to R. D. C.]).
REFERENCES Ahmad, N., Gabius, H., Sabesan, S., Oscarson, S., and Brewer, C. F. (2004). Thermodynamic binding studies of bivalent oligosaccharides to galectin-1, galectin-3, and the carbohydrate recognition domain of galectin-3. Glycobiology 14, 817–825. Baenziger, J. U., and Fiete, D. (1979). Structural determinants of Ricinus communis agglutinin and toxin specificity for oligosaccharides. J. Biol. Chem. 254, 9795–9799. Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., et al. (2004). Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc. Natl. Acad. Sci. USA 101, 17033–17038. Blixt, O., Han, S., Liao, L., Zeng, Y., Hoffmann, J., Futakawa, S., and Paulson, J. C. (2008). Sialoside analogue array for rapid identification of high affinity siglec ligands. J. Am. Chem. Soc. 130, 6680–6681. Carlow, D. A., Gossens, K., Naus, S., Veerman, K. M., Seo, W., and Ziltener, H. J. (2009). PSGL-1 function in immunity and steady state homeostasis. Immunol. Rev. 230, 75–96.
Fluorescence-Based Solid Phase Assays
263
de Boer, A. R., Hokke, C. H., Deelder, A. M., and Wuhrer, M. (2007). General microarray technique for immobilization and screening of natural glycans. Anal. Chem. 79, 8107–8113. Hirabayashi, J., Hashidate, T., Arata, Y., Nishi, N., Nakamura, T., Hirashima, M., Urashima, T., Oka, T., Futai, M., Muller, W. E. G., Yagi, F., and Kasai, K. (2002). Oligosaccharide specificity of galectins: A search by frontal affinity chromatography. Biochim. Biophys. Acta 1572, 232–254. Koenig, A., Jain, R., Vig, R., Norgard-Sumnicht, K. E., Matta, K. L., and Varki, A. (1997). Selectin inhibition: Synthesis and evaluation of novel sialylated, sulfated and fucosylated oligosaccharides, including the major capping group of GlyCAM-1. Glycobiology 7, 79–93. Leffler, H., Carlsson, S., Hedlund, M., Qian, Y., and Poirier, F. (2004). Introduction to galectins. Glycoconj. J. 19, 433–440. Leppa¨nen, A., Mehta, P., Ouyang, Y. B., Ju, T., Helin, J., Moore, K. L., van Die, I., Canfield, W. M., McEver, R. P., and Cummings, R. D. (1999). A novel glycosulfopeptide binds to P-selectin and inhibits leukocyte adhesion to P-selectin. J. Biol. Chem. 274, 24838–24848. Leppa¨nen, A., White, S. P., Helin, J., McEver, R. P., and Cummings, R. D. (2000). Binding of glycosulfopeptides to P-selectin requires stereospecific contributions of individual tyrosine sulfate and sugar residues. J. Biol. Chem. 275, 39569–39578. Leppa¨nen, A., Penttila¨, L., Renkonen, O., McEver, R. P., and Cummings, R. D. (2002). Glycosulfopeptides with O-glycans containing sialylated and polyfucosylated polylactosamine bind with low affinity to P-selectin. J. Biol. Chem. 277, 39749–39759. Leppa¨nen, A., Yago, T., Otto, V. I., McEver, R. P., and Cummings, R. D. (2003). Model glycosulfopeptides from P-selectin glycoprotein ligand-1 require tyrosine sulfation and a core 2-branched O-glycan to bind to L-selectin. J. Biol. Chem. 278, 26391–26400. Leppa¨nen, A., Stowell, S., Blixt, O., and Cummings, R. D. (2005). Dimeric galectin-1 binds with high affinity to a2, 3-sialylated and non-sialylated terminal N-acetyllactosamine units on surface-bound extended glycans. J. Biol. Chem. 280, 5549–5562. Leppa¨nen, A., Parviainen, V., Ahola-Iivarinen, E., Kalkkinen, N., and Cummings, R. D. (2010). Human L-selectin preferentially binds synthetic glycosulfopeptides modeled after endoglycan and containing tyrosine sulfate residues and sialyl Lewis x in core 2 O-glycans. Glycobiology doi: 10.1093/glycob/cwq083. Liu, Y., Palma, A. S., and Feizi, T. (2009). Carbohydrate microarrays: Key developments in glycobiology. Biol. Chem. 390, 647–656. Lyer, P. N., Wilkinson, K. D., and Goldstein, I. J. (1976). An N-acetyl-D-glucosamine binding lectin from Bandeirea simplicifolia seeds. Arch. Biochem. Biophys. 177, 330–333. McEver, R. P. (2002). Selectins: Lectins that initiate cell adhesion under flow. Curr. Opin. Cell. Biol. 14, 581–586. McEver, R. P., and Cummings, R. D. (1997). Perspectives series: Cell adhesion in vascular biology. Role of PSGL-1 binding to selectins in leukocyte recruitment. J. Clin. Invest. 100, 485–491. Merkle, R. K., and Cummings, R. D. (1987). Relationship of the terminal sequences to the length of poly-N-acetyllactosamine chains in asparagine-linked oligosaccharides from the mouse lymphoma cell line BW5147: Immobilized tomato lectin interacts with high affinity with glycopeptides containing long poly-N-acetyllactosamine chains. J. Biol. Chem. 262, 8179–8189. Rabinovich, G. A., and Ilarregui, J. M. (2009). Conveying glycan information into T-cell homeostatic programs: A challenging role for galectin-1. Immunol. Rev. 230, 144–159. Schallus, T., Jaeckh, C., Feher, K., Palma, A. S., Liu, Y., Simpson, J. C., Meckeen, M., Stier, G., Gibson, T. J., Feizi, T., Pieler, T., and Muhle-Goll, C. (2008). Malectin: A
264
¨nen and Richard D. Cummings Anne Leppa
novel carbohydrate-binding protein of the endoplasmic reticulum and a candidate player in the early steps of protein N-glycosylation. Mol. Biol. Cell 19, 3404–3414. Somers, W. S., Tang, J., Shaw, G. D., and Camphausen, R. T. (2000). Insights into the molecular basis of leukocyte tethering and rolling revealed by structures of P- and E-selectin bound to SLex and PSGL-1. Cell 103, 467–479. Song, X., Xia, B., Lasanajak, Y., Smith, D. F., and Cummings, R. D. (2008). Quantifiable fluorescent glycan microarrays. Glycoconj. J. 25, 15–25. Song, X., Lasanajak, Y., Olson, L. J., Boonen, M., Dahms, N. M., Kornfeld, S., Cummings, R. D., and Smith, D. F. (2009a). Glycan microarray analysis of P-type lectins reveals distinct phosphomannose glycan recognition. J. Biol. Chem. 284, 35201–35214. Song, X., Lasanajak, Y., Rivera-Marrero, C., Luyai, A., Willard, M., Smith, D. F., and Cummings, R. D. (2009b). Generation of a natural glycan microarray using 9-fluorenylmethyl chloroformate (FmocCl) as a cleavable fluorescent tag. Anal. Biochem. 395, 151–160. Song, X., Lasanajak, Y., Xia, B., Smith, D. F., and Cummings, R. D. (2009c). Fluorescent glycosylamines produced by microscale derivatization of free glycans for natural glycan microarrays. ACS Chem. Biol. 4, 741–750. Song, X., Xia, B., Stowell, S. R., Lasanajak, Y., Smith, D. F., and Cummings, R. D. (2009d). Novel fluorescent glycan microarray strategy reveals ligands for galectins. Chem. Biol. 16, 36–47. Stowell, S. R., Dias-Baruffi, M., Penttila¨, L., Renkonen, O., Nyame, A. K., and Cummings, R. D. (2004). Human galectin-1 recognition of poly-N-acetyllactosamine and chimeric polysaccharides. Glycobiology 14, 157–167. Stowell, S. R., Arthur, C. M., Mehta, P., Slanina, K. A., Blixt, O., Leffler, H., Smith, D. F., and Cummings, R. D. (2008). Galectin-1, -2, and -3 exhibit differential recognition of sialylated glycans and blood group antigens. J. Biol. Chem. 283, 10109–10123. Stowell, S. R., Arthur, C. M., Dias-Baruffi, M., Rodrigues, L. C., Gourdine, J. P., Heimburg-Molinaro, J., Ju, T., Molinaro, R. J., Rivera-Marrero, C., Xia, B., Smith, D. F., and Cummings, R. D. (2010). Innate immune lectins kill bacteria expressing blood group antigen. Nat. Med. 16, 295–301. Xia, B., Kawar, Z. S., Ju, T., Alvarez, R. A., Sachdev, G. P., and Cummings, R. D. (2005). Versatile fluorescent derivatization of glycans for glycomic analysis. Nat. Methods 2, 845–850.
C H A P T E R
T H I R T E E N
Multifaceted Approaches Including Neoglycolipid Oligosaccharide Microarrays to Ligand Discovery for Malectin Angelina S. Palma,*,1 Yan Liu,* Claudia Muhle-Goll,†,2 Terry D. Butters,‡ Yibing Zhang,* Robert Childs,* Wengang Chai,* and Ten Feizi* Contents 266 268 268
1. Overview 2. Preparation of Recombinant Soluble Human Malectin 2.1. Materials and equipment 2.2. Generation of plasmids containing the His6-tagged malectin globular domain 2.3. Expression and purification of His6-tagged malectin for microarray analysis 3. Preparation of Glucan Oligosaccharides 3.1. Materials and equipment 3.2. Glucan oligosaccharides di- to heptasaccharides 4. Preparation of Glucosylated High-Mannose N-Glycans 4.1. Triglucosylated high-mannose N-glycans 4.2. Diglucosylated high-mannose N-glycans 5. Preparation of NGL Probes 5.1. Materials and equipment 5.2. Preparation of AO-NGLs of glucan oligosaccharides 5.3. Preparation of AO-NGLs of the glucosylated N-glycans
269 270 271 271 272 274 274 276 278 279 279 279
* Glycosciences Laboratory, Faculty of Medicine, Imperial College London, Northwick Park Hospital Campus, Harrow, Middlesex, United Kingdom { European Molecular Biology Laboratory, Heidelberg, Germany { Department of Biochemistry, Oxford Glycobiology Institute, University of Oxford, Oxford, United Kingdom 1 Present address: REQUIMTE, Departamento de Quı´mica, Centro de Quı´mica Fina e Biotecnologia, Faculdade de Cieˆncias e Tecnologia, Universidade Nova de Lisboa, Caparica, Portugal 2 Present address: Karlsruhe Institute of Technology (KIT), Institut fu¨r Biologische Grenzfla¨chen (IGB-2), Karlsruhe, Germany Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78013-7
#
2010 Elsevier Inc. All rights reserved.
265
266
Angelina S. Palma et al.
6. Carbohydrate Microarray Analysis of Human Malectin 6.1. Materials and equipment 6.2. Microarray printing 6.3. Probing the microarrays 7. Conclusions Acknowledgments References
281 281 282 283 284 284 284
Abstract In this chapter, we describe the key procedures for isolation of the oligosaccharides and the preparation of neoglycolipid probes together with expression of malectin that have enabled the discovery of the highly selective binding of this newly described protein in the endoplasmic reticulum (ER) to a diglucosyl high-mannose N-glycan. This is the first indication of a bioactivity for a diglucosyl high-mannose N-glycan of the type that occurs in the ER of eukaryotic cells and which is an intermediate in the early steps of the N-glycosylation pathway of nascent proteins. The malectin story is an example of a powerful convergence of disciplines in biological sciences: (i) developmental biology, (ii) bioinformatics, (iii) recombinant protein expression, (iv) protein structural studies, (v) glucan biochemistry, and (vi) drug-assisted engineering of oligosaccharide biosynthesis, culminating in (vii) oligosaccharide ‘‘designer’’ microarrays, to clinch the remarkable selectivity of the binding of this newly discovered ER protein. Thus, the way is open to the identification of the role of malectin in the N-glycosylation pathway.
1. Overview The malectin protein gene was originally identified in Xenopus laevis in the search for proteins that are developmentally regulated in the pancreas. However, it was soon found to be broadly expressed in embryonic and adult X. laevis, and moreover detected in all tissues examined (Schallus et al., 2008). Although possibly disappointing initially that this was not a pancreatic developmental marker, bioinformatic studies with the deduced amino acid sequence revealed malectin as a highly conserved protein in the animal kingdom (Fig. 13.1) pointing to an important biological function. A clue for possible ligands for malectin came from its three-dimensional structure resolved by NMR, which showed that the highest hits for fold homologues were microbial carbohydrate-binding modules (CBMs) that recognize glucan polysaccharides (Schallus et al., 2008). Armed with this knowledge, we performed NMR-based ligand-screening studies, using glucose containing oligosaccharides. Maltose was the first disaccharide that was observed to be bound by the xenopus protein, hence its designation ‘‘malectin.’’ The glucan binding property of the xenopus malectin was further
267
Carbohydrate Microarrays and Ligands for Malectin
SP 1
60
77
70
Expression construct start 27
20
10
90
110
100
50
40
120
130
140
Expression construct stop 150
170
160
180
190
210 213
200
TM 220
230
240
250
270
Figure 13.1 Sequence alignment of malectin protein in animals. The beginning and the end of the expression construct are indicated. The secondary structure elements of the globular domain are shown on top of the amino acid sequence, and the four aromatic residues (Y67, Y89, Y116, and F117) and D186 mediating the carbohydrate interaction are marked by crosses. SP, signal peptide; TM, C-terminal transmembrane helix; Xen, Xenopus laevis; Hum, Homo sapiens; Mou, Mus musculus; Hen, Gallus gallus; Fly, Drosophila melanogaster; Aed, Aedes aegyptii; Cae, Caenorhabditis elegans; Sch, Schistosoma japonicum; Nem, Nematostella vectensis. (The figure was reprinted with kind permission from MBC (Schallus et al., 2008).)
corroborated using microarrays of glucan oligosaccharide probes (Schallus et al., 2008). With the finding soon, thereafter, that malectin is localized in the endoplasmic reticulum (ER) of mammalian cells, we populated our neoglycolipid (NGL)-based oligosaccharide microarrays with the glucosylated high-mannose N-glycans of the type that occur in the ER, having one, two, or three terminal glucosyl residues at the D1 mannosyl branch. These experiments revealed a high selectivity of malectin for a high-mannose N-glycan with two terminal glucose residues (Schallus et al., 2008).
268
Angelina S. Palma et al.
The NGL technology and the NGL-based microarray system that have come to play in this study have been the subject of chapters in previous volumes of this series (Chai et al., 2003; Feizi and Childs, 1994; Feizi et al., 1994; Liu et al., 2006). Major advantages of the NGL approach are: its inherent flexibility, generation of multivalent probes with increased sensitivity of detection, and the ability to rapidly prepare and populate the arrays with probes containing novel oligosaccharide sequences, especially those of oligosaccharides isolated from biological sources and available only in minute amounts. In this chapter, we dwell in some detail on the multifaceted technical procedures that have been essential to carbohydrate ligand discovery for malectin. These include the procedures for generation of recombinant His-tagged malectin, focusing on how to prepare the human malectin homologue; the preparation of glucan oligosaccharides and glucosylated N-glycans from polysaccharides and drug-treated mammalian cell cultures, respectively; the microscale conjugation of these oligosaccharides to lipid for preparation of NGL probes, followed by NGL-based microarray analysis of recombinant human malectin. Please also read Chapter 19 in Volume 480 of this series, ‘‘Use of glycan microarrays to explore specificity of glycan-binding proteins’’ by David Smith, Xuezheng Song, and Richard Cumming.
2. Preparation of Recombinant Soluble Human Malectin Malectin contains a single highly conserved globular domain (Fig. 13.1; Homo sapiens AAs 42–228; Schallus et al., 2008). Protein domain databases such as SMART (Letunic et al., 2006) and Pfam (Finn et al., 2006) predict an Nterminal signal peptide (H. sapiens: AAs 1–28) and a C-terminal transmembrane helix (H. sapiens: 271–290). Between the globular domain and the C-terminal membrane anchor, a highly charged sequence segment is found, that extends over eight contiguous glutamate residues, for example, in human malectin. The lectin function resides in the globular domain of malectin, which was used for microarray screening of putative ligands. It was cloned into the pET M10 vector of the M-series generated by Gunter Stier, EMBL (Bogomolovas et al., 2009). This vector contains an N-terminal hexahistidine (His6)-sequence that is used as a tag for affinity purification and enables detection of the malectin construct using an anti-His antibody. Further information on the vector can be found at http://www.embl.de/ pepcore/pepcore_services/strains_vectors/index.html.
2.1. Materials and equipment 1. Taq DNA polymerase supplied with appropriate buffer (e.g., AmpliTaq DNA Polymerase, Applied Biosystems)
Carbohydrate Microarrays and Ligands for Malectin
269
2. Sense and reverse primers 3. PCR Nucleotide mix (dATP, dGTP, dCTP, and dTTP; Roche Applied Science) 4. Genomic DNA (e.g., Qiagen) 5. Deionized and sterilized H2O 6. Restriction enzymes (NcoI, Acc65I, supplied with respective buffers; Fermentas) 7. T4 DNA Ligase, supplied with respective buffer (Fermentas) 8. Kits for PCR fragment extraction or plasmid purification (Qiagen) 9. Expression vector (recommended pET system) 10. Escherichia coli BL21[DE3] DH5a (New England Biolabs) for cloning 11. E. coli BL21[DE3] cells (New England Biolabs) for expression 12. LB-medium (10 g/l bactotryptone, 5 g/l yeast extract, 10 g/l NaCl, pH 7.4, supplemented with appropriate antibiotic (e.g., 50 mM kanamycin) and 200 mM isopropylthio-b-galactoside (IPTG) for induction) 13. Lysis buffer (20 mM Tris–HCl, pH 8.0,150 mM NaCl,10 mM Imidazole, 2 mM b-mercaptoethanol, protease inhibitors, for example, Complete Protease Inhibitor Cocktail, Roche) 14. Lysozyme (Sigma) (300 mg/ml) 15. DNase I (Roche Applied Science, 1 mg/ml) þ MgCl2 16. High salt wash buffer (lysis buffer containing 1 M NaCl) 17. Elution buffer (lysis buffer þ 250 mM Imidazole, pH 8.0) 18. Ni NTA resin (Qiagen) 19. Millipore Amicon Ultra-4 centrifugal filter units, 10 kDa cutoff 20. Gel filtration buffer (20 mM Tris–HCl, pH 7.2, 150 mM NaCl, 2 mM 1,4 dithiothreitol (DTT), 1% (w/v) maltose (Sigma) 21. Gel filtration column, for example, Superdex 200 HiLoad 16/60 (GE Healthcare) 22. Dialysis buffer (20 mM Tris–HCl, pH 7.2, 150 mM NaCl, 2 mM DTT) 23. Desalting columns PD10 (Amersham Biosciences) 24. Sonicator (e.g., Sonopuls HD 2070, Bandelin (Berlin)) 25. Ultracentrifuge, for example, Beckmann OptimaTM L-90 26. Spectrophotometer, nanodrop ND-1000, PEQLAB
2.2. Generation of plasmids containing the His6-tagged malectin globular domain The coding sequence for the human malectin globular domain was amplified by PCR from a plasmid carrying the human genomic sequence using the following primers: sense primer MalHsen TTG CCA TGG CCGGG CTG CCCGAGAG and reverse primer MalHrev TTGCGGTACCTT ACTCCAATCCCGGATGAGGCTG.
270
Angelina S. Palma et al.
The sense primer carries the restriction site for NcoI (CCAGGT). The reverse primer is designed with a stop codon UAA before the Acc65I restriction site (GGTACC). The xenopus malectin domain can, in principle, be amplified using the homologous primers, but an internal NcoI site within the first 40 amino acids of the globular domain should be mutated prior to PCR amplification to avoid internal cleavage. Five PCR cycles were performed at lower annealing temperature of 57 C, which were followed by 20 cycles at 62 C, and the elongation was done at 72 C for 1 min. When the PCR reaction is performed with genomic DNA as a template, 25 cycles at 62 C are recommended to generate enough of the PCR product. The PCR product was cloned using the 30 -Acc65I and 50 -NcoI restriction sites into the pET M10 vector referred above. Plasmids were amplified in E. coli BL21[DE3] DH5a and the kanamycin resistance conferred by the plasmid was used for clone selection. Plasmid purification was achieved using the standard protocols and kits of the Qiagen plamid purification kit. DNA sequencing using T7 sense and reverse primers was used to verify the sequence. The plasmids were transformed into E. coli BL21[DE3] cells for expression.
2.3. Expression and purification of His6-tagged malectin for microarray analysis Five milliliters of an overnight culture of E. coli BL21[DE3] cells with the plasmid containing the gene for the globular segment of human His6malectin gene were diluted in 1 l LB medium containing 50 mg/ml kanamycin. The cells were grown at 37 C to an OD600 of 0.6 (approximately 6–8 h). Expression was induced by adding 0.2 mM isopropyl-b-D-thiogalactopyranoside overnight at 18 C. The cells were harvested by centrifugation (3–5 g/l). At this point, the cell pellet could be stored at 20 C, a step that also facilitated cell rupture. For protein extraction, the cell pellet was resuspended in lysis buffer (10 ml/g wet cell pellet), chilled to 4 C, complemented with lysozyme, and incubated on ice until cell rupture became visible. To digest genomic DNA, DNase I and 5 mM MgCl2 were added and the cell suspension was incubated at ambient temperature for another 10 min. A sonication step (30–50 short pulses of 5–10 s with pauses 10–20 s) was employed to complete cell rupture. Following ultracentrifugation at 125,000g for 25 min at 4 C (e.g., 40,000 RPM using a Beckmann 45TI rotor), the supernatant was applied onto a Ni-NTA agarose column at ambient temperature (2 ml Ni-NTA resin /1 l cell culture were used). The column was washed with 10–20 column volumes of lysis buffer, followed by 10 column volumes of high salt wash buffer and with 10 volumes of lysis buffer. The His6-tagged proteins were eluted with 5–7 volumes of elution buffer.
Carbohydrate Microarrays and Ligands for Malectin
271
Purity after this step was already high as judged by SDS-PAGE analysis. Nevertheless, a size exclusion purification step on a gel filtration column (Superdex 200) was added to remove spurious copurified proteins that bind nonspecifically to the Ni-NTA column, and might be present at concentrations below the detection limit of SDS-PAGE analysis. On one occasion, we noticed an unidentified glycosidase activity in a protein preparation purified only with Ni-NTA chromatography. This was detected by a change in the color of the protein solution to yellow upon addition of the nitrophenylmaltoside compound, indicating that the nitrophenyl group was cleaved off. The size exclusion matrix material is composed of polymers of dextran. We observed that malectin binds tightly to the column and could not be readily eluted off using standard elution buffers. The inclusion of 1% (w/v) maltose in the gel filtration buffer was sufficient to overcome this problem and the protein eluted as the predicted molecular mass of 18 kDa, which was confirmed by NMR 1H-T2 measurements and dynamic light scattering. Finally, a buffer exchange step was performed by applying the protein to a small size exclusion, desalting column (e.g., PD10) or by dialysis against maltose-free Tris buffer. Up to 20 mg of malectin could be produced from 1 l of bacterial culture following this protocol. Protein concentration was measured by UV measurements at 280 nm using an extinction coefficient of 20,400 M 1 cm 1. The protein was stable under these conditions at 4 C for several weeks at concentrations below 4 mg/ml (20 mM), in the presence of 0.02% sodium azide. The recombinant malectin is soluble up to 20 mg/ml, but on storage tends to partially precipitate at concentrations higher than 10 mg/ml. For long-term storage, the protein can be lyophilized in suitable aliquots with retention of carbohydrate-binding activity and specificity.
3. Preparation of Glucan Oligosaccharides A series of glucan oligosaccharides, in the range of di- to heptasaccharides, with a1,4-, a1,6-, b1,3-, b1,4-, b1,6-linkages and the disaccharides with a1,2- and a1,3-linkages, were either from commercial sources or prepared from polysaccharides after partial depolymerization by chemical means, as described below.
3.1. Materials and equipment 1. Disaccharides nigerose (a1,3-linked) from Wako Chemicals, cellobiose (b1,4-linked) and kojibiose (a1,2-linked) from Sigma 2. Laminarin (b1,3-linked) di-, tri-, and tetrasaccharides from Dextra, penta- and hexasaccharides from Megazyme, and heptasaccharide from Seikagaku America
272
Angelina S. Palma et al.
3. Malto-di- to heptasaccharides (a1, 4 linked) from Sigma 4. Cello-oligosaccharide (b1,4-linked) mixture obtained by acid hydrolysis of cellulose from Megazyme 5. Glucan polysaccharides pustulan from Umbilicaria papullosa (b1,6linked) (de la et al., 1995) from Calbiochem and dextran (MW 500 kDa, a1,6-linked with 5% a1,3-branches) (de Belder, 1993) from Amersham Biosciences 6. Deionised water 7. HCl and NaOH solutions (0.1 M and 0.2 M) 8. Solvent n-propanol:water (8:3, v/v) 9. Gel filtration columns: Sephadex G10 (1.630 cm, Amersham Biosciences) and Bio-Gel P4 (1.690 cm, Bio-Rad), with an on-line refractive index detector and auto sample collector 10. Silica gel high-performance (HP) TLC plates with aluminium-backing (Merck) 11. Orcinol staining reagent (Chai et al., 2003) 12. MALDI-TOF mass spectrometer, Tof Spec-2E (Waters)
3.2. Glucan oligosaccharides di- to heptasaccharides Partial depolymerization of dextran and pustulan were carried out by acid hydrolysis. Dextran (100 mg) was treated with 0.1 M HCl, at a concentration of 20 mg polysaccharide/ml, at 100 C for 4 h. Pustulan (100 mg) was treated with 0.2 M HCl at a concentration of 10 mg polysaccharide/ml at 100 C for 8 h. The reaction was stopped by neutralization with aqueous NaOH solution. Acid hydrolysis was selected as the depolymerization procedure for pustulan upon our observation that the b-linked oligosaccharide series prepared by acetolysis of the parent polysaccharide contained a percentage of a-anomers. The dextran and pustulan hydrolysates were desalted using a short column (1.630 cm) of Sephadex G10 eluted with deionized water at a flow rate of 20 ml/h monitored on-line by a refractive index detector. The oligosaccharide fraction was collected at the void volume and lyophilized. Oligosaccharide fractions of dextran, pustulan, and cellulose were obtained from gel filtration chromatography on a column (1.690 cm) of Bio-Gel P4. The Bio-Gel P4 column was first equilibrated with deionized water and calibrated with an analytical mixture of dextran hydrolysate by eluting with deionized water at a flow rate of 15 ml/h. The desalted oligosaccharide mixtures (typically 1–2 ml of clear solution, the concentration applied varied according to solubility) were applied to the column and eluted under the same conditions. The eluate was monitored on-line by refractive index and the respective di- to heptasaccharide peaks were pooled according to their predominant glucose units (Fig. 13.2A) and lyophilized.
273
Carbohydrate Microarrays and Ligands for Malectin
A
Refractive index
1 Origin 1 2 3 4 5 6 7 8
5
6 V0 13 12
3
4
5
6
11 10
9
8
7 8 Time (h)
3
4
2
7
9
10
11
12
B 1175 Glc7Na+
%
100
Glc6Na+ 1013
Glc8Na+ 1337
0 600 650 700 750 800 850 900 950 1000 1050 1100 1150 1200 1250 1300 1350 1400 1450
m/z
Figure 13.2 (A) Gel filtration chromatography of the dextran hydrolysate on a column of Bio-Gel P4; the column was loaded with 4 mg hexose of the hydrolysate mixture in 1 ml deionized water (the dextran polysaccharide, 0.1 mg hexose, was added to the mixture to mark exclusion volume, Vo; the glucose units are indicated for each peak); the inset shows the HPTLC analysis of the isolated dextran oligosaccharide fractions (mono- to heptasaccharide, lanes 1–7, 2 mg hexose per lane) and of the hydrolyzed dextran mixture (total 40 mg hexose) before fractionation (lane 8); (B) MALDI-MS analysis of dextran heptasaccharide fraction. The molecular masses of the sodiated molecules are indicated (major component is the heptasaccharide).
Quantitation of the oligosaccharide fractions, after their reconstitution with deionized water, was carried out by TLC-based orcinol assay using glucose (0.05–1 mg/ml in deionized water) as standard, as described (Chai et al., 1997). Stock solutions were then prepared typically at 5 mg/ml.
274
Angelina S. Palma et al.
Overall, the solubility in water of fractions up to heptasaccharides is good with the exception of the cello-oligosaccharides with degree of polymerization five or higher, for which the stock solutions were prepared at 1 mg/ml. Aliquots of each fraction (2 mg hexose) were analyzed by HPTLC on silica gel plates, using a solvent system of n-propanol/water, 8:3 (by volume), and stained with orcinol reagent (inset Fig. 13.2A). The molecular masses of the main components of oligosaccharide fractions from gel filtration were corroborated by MALDI-MS (Fig. 13.2B). For MALDI-MS, oligosaccharides solutions were diluted in methanol, at an estimated concentration of 10–20 pmol/ml, and 0.5 ml was deposited on the sample target together with a matrix of 2-(4-hydroxyphenylazo)benzoic acid. The linkage of the oligosaccharide fractions was corroborated by methylation analysis or 1H NMR.
4. Preparation of Glucosylated High-Mannose N-Glycans The monoglucosylated high-mannose N-glycan, Glc1Man9GlcNAc2, was isolated from hen egg yolk IgY using a similar procedure to that previously reported by Ohta et al. (1991). The triglucosylated N-glycan, Glc3Man7(D1) GlcNAc2, was isolated from the recombinant-expressed glycoprotein HIVIIIB gp120, secreted by cells that were treated with an ER-a-glucosidase inhibitor (Petrescu et al., 1997). The diglucosylated N-glycan, Glc2Man7(D1) GlcNAc2, was derived from this Glc3 analogue by digestion with ER-aglucosidase I (Alonzi et al., 2008). The general methodologies for preparation of the tri- and diglucosylated N-glycans are described below and the reader is advised to refer to primary papers cited.
4.1. Triglucosylated high-mannose N-glycans Triglucosylated N-glycans can be obtained from two major sources using tissue cultured cells treated with an ER-a-glucosidase inhibitor: (i) release of the oligosaccharides from secreted glycoproteins; (ii) isolation of free glucosylated oligosaccharides from the cells. 4.1.1. Materials and equipment 1. Chinese hamster ovary (CHO) cell line (Petrescu et al., 1997) stably transfected with highly glycosylated glycoproteins, eg., HIV gp 120 2. a-Glucosidase inhibitor N-butyl-deoxynojirimycin (NB-DNJ) (2–5mM, Toronto Research Chemicals, Inc.) 3. Concanavalin A-Sepharose beads (Sigma) 4. a-Methyl-mannoside (Sigma) 5. Hydrazine reagent (Ludger)
Carbohydrate Microarrays and Ligands for Malectin
275
6. Bacterial peptide N-glycosidase F (PNGase) from NEB or Ludger 7. High-performance anion-exchange chromatography (HPAEC, Dionex) 8. Normal-phase high-performance liquid chromatography NP-HPLC (Anachem) 9. Bio-Gel P4 columns (Bio-Rad) 10. In-line electrochemical detector (Dionex) 4.1.2. Isolation of glycoproteins Tissue cultured cells are grown in the presence of a suitable a-glucosidase inhibitor, such as castanospermine, deoxynojirimycin (DNJ), or NB-DNJ. These are available commercially and DNJ can be conveniently chemically synthesized from inexpensive starting materials such as D-glucuronolactone (Best et al., 2010). N-butylation of DNJ by reductive amination using sodium cyanoborohydride (Mellor et al., 2002) increases the a-glucosidase inhibitory efficacy in cells significantly (Alonzi et al., 2009). CHO cells are grown for 3–4 days in medium containing 2–5 mM sterile filtered NB-DNJ. The choice of CHO is critical for maximizing the synthesis of glucosylated products as it lacks an endomannosidase-mediated salvage pathway that deglucosylates proteins destined for secretion (Spiro, 2004). CHO cells stably transfected with highly glycosylated glycoproteins, for example, HIV gp 120, allow easy isolation of the highly expressed protein by antibody affinity column chromatography, for isolation of glycans. The abundance of glucosylated glycan is increased using lectin-resistant cells that are deficient in complex glycan biosynthesis (Butters et al., 1999). Culture medium that is rich in glucosylated glycoprotein is also used as a convenient source of oligosaccharide. Oligomannosidic glycoproteins can be bound to Concanavalin A-Sepharose beads and subsequently eluted with a-methyl-mannoside (0.5 mM in water). Following dialysis against water (or 0.1% TFA to reduce precipitation) to remove the methyl-mannoside, the glycoprotein-rich extract is lyophilized and subjected to glycan release (Petrescu et al., 1997). 4.1.3. Release and purification of triglucosylated N-glycans from glycoproteins Anhydrous hydrazine is used to cleave the glycan between the terminal nonreducing N-acetylglucosamine residue and the asparagine amino acid. This method is relatively quantitative and preserves the glycan intact. At least 1 mg of protein can be treated with commercially available kit forms of the hydrazine reagent (available from Ludger, UK see http://www.ludger.com/). An alternative method for release is to use bacterial PNGase. For this, the protein is denatured in SDS and disulphide reducing agent to allow enzyme access to all N-glycosylation sites, before dilution and addition of Triton X-100 to preserve PNGase enzymatic activity and incubation at 37 C overnight. For large
276
Angelina S. Palma et al.
amounts of protein (> 1 mg), the sequential addition of small amounts of enzyme assists hydrolysis. The released oligosaccharides are analyzed by a suitable method to determine structure, such as mass spectrometry and HPAEC for unlabeled glycans, or NP-HPLC using fluorescently labeled glycans (Butters and Neville, 2008). For large-scale purification, Biogel P4 columns are used but smaller amounts are readily isolated using standard HPLC columns where either in-line electrochemical detection or postcolumn labeling and analysis are used to identify and isolate glucosylated glycans (Petrescu et al., 1997). The biosynthesis of glucosylated glycans in CHO cells in the presence of NB-DNJ favors the Glc3Man7(D1)GlcNAc2 oligosaccharide (Petrescu et al., 1997). Smaller amounts of Glc3Man8GlcNAc2 and Glc3Man9GlcNAc2 are also generated. 4.1.4. Triglucosylated N-glycans production and isolation from free glycans As an alternative to using proteins as a source of glucosylated oligosaccharide, treatment of cells with NB-DNJ results in the synthesis of free glycans as a product of glycoprotein degradation following misfolding. The glycan material can be harvested in cell-free extracts from MDBK cells where nonproteasomal hydrolysis in the ER produces Glc3Man7GlcNAc2 in high abundance (Butters and Alonzi, unpublished data). This material does not require chemical or enzyme-mediated release, and can be isolated using HPLC methods described above.
4.2. Diglucosylated high-mannose N-glycans The diglucosylated N-glycan was prepared by enzymatic digestion of Glc3Man7(D1)GlcNAc2 oligosaccharide (10–100 mg), prepared from glucosidase inhibitor treated CHO cells described above, using purified preparations of ER-a1,2-glucosidase I. The enzyme is purified in a single ligand affinity step from detergent extracts of porcine or rat liver, using DNJ linked to chromatography beads. The preparation of the affinity column and general procedures in the affinity chromatography are described below and the reader is advised to refer to primary papers cited. 4.2.1. Materials and equipment 1. N-Carboxypentyl-DNJ (CPDNJ) from Toronto Chemicals, Inc. or chemically synthesized as described below 2. Affi-Gel 102 (Bio-Rad) 3. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) (Sigma) 4. Porcine or rat liver 5. Ultraturrax homogenizer (Janke & Kunkle)
Carbohydrate Microarrays and Ligands for Malectin
277
6. Homogenisation buffer: 50 mM Tris/HCl buffer, pH 7.2, containing 0.25 M sucrose, 5 mM leupeptin, 15 mM pepstatin A, 0.5 mM PMSF, and 1 mM 6-aminohexanoic acid 7. Buffer A (0.1 M sodium phosphate buffer, pH 7.0, containing 0.8% Lubrol PX) described above. 8. Sep-Pak C18 cartridge (1 cc, Waters) 9. NP-HPLC (Anachem) 4.2.2. Preparation of a-glucosidase I affinity ligand Coupling DNJ to chromatography beads provides a suitable ligand affinity support. CPDNJ is available from Toronto Chemicals, Inc., Ontario, Canada or can be synthesized by reacting DNJ with an excess of 6-bromohexanoic acid (Kaushal and Elbein, 1994). An amino-derivatized support such as Affi-Gel 102 allows simple coupling using EDC according to the following protocol. Aqueous solutions of CPDNJ (250 mmol) are adjusted to pH 4.8 with 1 M HCl and added to 5 ml of washed, packed Bio-Rad Affi-Gel 102. The gel is resuspended, adjusted to 9 ml with water, and 1 ml of 100 mM EDC is added. After maintaining the pH at 4.8 for 30 min at room temperature by the addition of 1 M HCl, the coupling reaction is allowed to proceed with gentle mixing for 16 h at 4 C. The gel is filtered using a sintered glass funnel and the filtrate is retained for the estimation of unbound ligand. The derivatized gel is washed sequentially with 100 ml of 50 mM NaOAc buffer, pH 4.5, containing 0.5 M NaCl and with 50 mM Tris/HCl buffer, pH 8.0, containing 0.5 M NaCl. This wash cycle is repeated twice before equilibrating the gel in an appropriate running buffer. The gel can be stored at 4 C in the presence of 0.02% azide and reused several times. To measure the concentration of coupled ligand, a sample of the gel filtrate containing alkylated imino-sugar is taken before and after coupling and subjected to HPAEC using an eluant of 150 mM NaOH/30 mM NaOAc (Dionex BioLC) and a CarboPac column. Alternatively, a Dionex CS10 column eluted with 50 mM sodium sulfate containing 5% (v/v) acetonitrile and in-line micromembrane suppression and electrochemical detection (Mellor et al., 2000) can be used. Typically, values of 20–25 mmol of ligand/ml of gel are obtained. 4.2.3. Isolation of a-glucosidase I The following procedures for extraction and purification of a-glucosidase I are performed at 4 C. Freshly obtained porcine or rat liver (300 g) is homogenized for 2–3 min (Ultraturrax homogenizer) with 0.8 l of 50 mM Tris/HCl buffer, pH 7.2, containing 0.25 M sucrose, 5 mM leupeptin, 15 mM pepstatin A, 0.5 mM PMSF, and 1 mM 6-aminohexanoic acid. The homogenate is filtered through cheesecloth and the filtrate is centrifuged at 15,000g for 30 min. The supernatant is recovered and centrifuged at 150,000g for 60 min
278
Angelina S. Palma et al.
and the pelleted material is washed with 120 ml of homogenization buffer. The pellet is recovered by centrifugation and resuspended in 75 ml of 10 mM sodium phosphate buffer, pH 6.8, containing 0.5% v/v Triton X-100. The suspension is stirred for 30 min and the membrane fraction is recovered by centrifugation at 150,000g for 30 min. The Triton-extracted pellet is suspended in 120 ml of 0.2 M sodium phosphate buffer, pH 6.8, containing 0.8% Lubrol PX and stirred for 60 min. A glucosidase I-enriched supernatant is recovered by centrifugation at 150,000g for 90 min. 4.2.4. Affinity chromatography of a-glucosidase I For affinity chromatography of a-glucosidase I, the Lubrol PX-extract is mixed with 5 ml of CPDNJ-Affi-Gel (25 mmol ligand/ml gel), prepared as described above, for 18 h and the gel is recovered by low-speed centrifugation. The gel is washed with 250 ml of 0.1 M sodium phosphate buffer, pH 7.0, containing 0.8% Lubrol PX (buffer A) and then eluted with 25 ml of buffer A containing 100 mM NB-DNJ. The column eluate is pooled and the enzyme is stored at 4 C. Before use, an aliquot is dialyzed against 41 l of buffer A to remove NB-DNJ. Enzyme activity and purity is assessed using [14C-Glc]radiolabeled Glc3Man9GlcNAc2 as described (Jacob and Scudder, 1994) or using NP-HPLC with fluorescently labeled substrates (Alonzi et al., 2008). 4.2.5. Hydrolysis of Glc3Man7GlcNAc2 and isolation of Glc2Man7GlcNAc2 Purified Glc3Man7(D1)GlcNAc2 oligosaccharide (10–100 mg) was dried under vacuum and resuspended in 20 ml of a-glucosidase I in buffer A (25 U) and incubated at 37 C for 16 h. An aliquot (1 ml) was taken, labeled with anthranilic acid, 2-AA (Neville et al., 2004) and analyzed by NPHPLC to determine reaction completion. When all the substrate was hydrolyzed to Glc2Man7(D1)GlcNAc2 the enzyme and detergent was removed using a Sep-Pak C18 cartridge and the nonbound eluate containing diglucosylated oligosaccharide was used for further derivatization.
5. Preparation of NGL Probes The glucan oligosaccharides and the glucosylated high-mannose N-glycans prepared above were converted into oxime-linked NGLs (AONGLs) for recognition studies in microarrays. The step by step procedures for the preparation, purification, and quantitation of the AO-NGLs are essentially as described previously (Liu et al., 2006, 2007).
Carbohydrate Microarrays and Ligands for Malectin
279
5.1. Materials and equipment 1. Reducing glucan oligosaccharides and glucosylated high-mannose N-glycans 2. Aminooxy-functionalized 1,2-dihexadecyl-sn-glycero-3-phosphoethanolamine (AOPE), step by step synthesis procedure described in Liu et al. (2006) 3. Glass microvials with Teflon-lined caps (Chromacol) 4. Aluminium-backed HPTLC plates (Merck) 5. Silica cartridges (Waters or Phenomenex) 6. Primulin and orcinol staining reagents (Chai et al., 2003) 7. Solvents and solutions: methanol and chloroform are of HPLC grade; ammonium acetate solution (0.2 M in deionized water); chloroform/ methanol/water (C/M/W).
5.2. Preparation of AO-NGLs of glucan oligosaccharides In brief, 100 nmol of each glucan oligosaccharide or oligosaccharide fraction (di- to heptasaccharide) was used for conjugation in the presence of 200 nmol of N-aminooxyacetyl-DHPE (AOPE) in 50 ml C/M/W (10:10:1, by volume). After incubation at ambient temperature 16 h, the reaction mixtures were evaporated slowly to dryness at 60 C and reconstituted in 100 ml of C/M/W (25:25:8). The reaction completion was determined by HPTLC analysis (1 ml of the solution applied; developed with C/M/W (60:35:8)) using primulin and then orcinol staining (Chai et al., 2003). The conjugation yields were greater than 80%. AO-NGLs of disaccharides and trisaccharides were purified by semipreparative HPTLC, and those of tetra to heptasaccharides were purified using silica cartridges (stepwise procedures were described in Liu et al. (2006)). Purified AO-NGLs are dissolved in C/M/W (25:25:8) to give an approximate concentration of 100 pmol/ml for HPTLC and MALDI-MS analyses, quantitation (Liu et al., 2006), and for storage (at 20 C). HPTLC analysis of purified AO-NGLs of disaccharides nigerose and kojibiose, and of dextran oligosaccharide fractions is shown in Fig. 13.3.
5.3. Preparation of AO-NGLs of the glucosylated N-glycans The procedures for preparing AO-NGLs of the three glucosylated N-glycans (Fig. 13.4) are similar to those described above, except that a smaller amount, 10 nmol of each N-glycan, was used for conjugation and 200 nmol AOPE was applied. The incubation time was prolonged to 24 h. Aliquots of the reaction mixtures (1/50) were analyzed by HPTLC (developed with C/M/W (55:45:10)) using primulin and orcinol staining.
Origin 1
2
3
4
5
6
7
8
1
2
3
4
5
6
7
8
Figure 13.3 HPTLC analysis of purified AO-NGLs of kojibiose (lane 1), nigerose (lane 2), and dextran oligosaccharide fractions di- to heptasaccharide (lanes 3–8). The left panel shows primulin staining, and the right panel orcinol staining. For each NGL, 500 pmol was applied.
A 100
2762 [M−H]
Mana 2Mana 6 Mana 3
%
Mana 2Mana
−
6 Manb 4GlcNAcb 4GlcNAc AO
3
Glca 3Mana 2Mana 2Mana
0 1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 m/z
B 100
2559 [M−H]−
Mana 6 Mana 3
%
Mana
6 Manb 4GlcNAc AO 3
Glca 2Glca 3Glca 3Mana 2Mana 2Mana
2762 0 1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 m/z
C 100
2397 [M−H]−
Mana 6 Mana 3
%
Mana
6 Manb 4GlcNAc AO 3
Glca 3Glca 3Mana 2Mana 2Mana
2600 2559 0 1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 m/z
Figure 13.4 Sequences and negative-ion MALDI mass spectra of the three glucosylated high-mannose N-glycan AO-NGLs, Glc1Man9GlcNAc2 (A), Glc3Man7(D1) GlcNAc (B), and Glc2Man7(D1)GlcNAc (C). The [MH] ions observed are in accord with their expected values.
Carbohydrate Microarrays and Ligands for Malectin
281
The AO-NGL products were purified by 1 cc silica cartridges (Liu et al., 2006). The purified NGLs can be analyzed by MALDI-MS. For this, the NGLs are dissolved in chloroform/methanol/water (25:25:8) at a concentration of 10 pmol/ml; 1 ml is deposited on the sample target together with a matrix of 2-(4-hydroxyphenylazo)benzoic acid. Negative-ion MALDI spectra of the AO-NGLs of Glc1Man9GlcNAc2, Glc3Man7(D1)GlcNAc, and Glc2Man7(D1)GlcNAc are shown in Fig. 13.4. It should be noted here that the lack of a GlcNAc residue at the chitobiose core in the AO-NGLs of tri- and diglucosylated oligosaccharides (Fig. 13.4B and C) was from the original oligosaccharide materials. The triglucosylated N-glycan material for NGL preparation was recovered from a NMR sample of Glc3Man7(D1) GlcNAc2 which contained filamentous bacteriophages. The loss of the GlcNAc residue was attributed (Schallus et al., 2008) to residual endoglycosidase activity present in the bacteriophages. As the diglucosylated N-glycan Glc2Man7(D1)GlcNAc was prepared from the triglucosylated analogue by enzymatic digestion, it also lacks the core GlcNAc residue.
6. Carbohydrate Microarray Analysis of Human Malectin The microarray used for studies of human malectin encompassed the AO-NGLs of the glucose oligosaccharide sequences and those from the tri-, di-, and monoglucosyl-high-mannose N-glycans (Fig. 13.5). In addition, the microarray included a diverse range of mammalian-type sequences, all lipid-linked: N-glycans of high-mannose and of neutral and sialylated complex-type; O-glycans, blood group-related sequences (A, B, H, Lewisa, Lewisb, Lewisx, and Lewisy) on linear or branched backbones and their sialylated and/or sulfated analogues, gangliosides, and oligosaccharide fragments of glycosaminoglycans and polysialic acid. Also included were homo-oligomers of other monosaccharides.
6.1. Materials and equipment 1. 16 pad nitrocellulose-coated glass slides (Whatman FAST slides, available from Sigma) 2. Noncontact arrayer (Piezorray, Perkin-Elmer LAS) 3. Cy3 mono NHS ester (Amersham Biosciences) 4. Mouse monoclonal anti-polyhistidine (Ab1) (Sigma) 5. Biotinylated antimouse IgG antibody (Ab2) (Sigma) 6. Saline buffer, for example, HBS (5 mM Hepes, pH 7.4, 150 mM NaCl) 7. Blocking solution: HBS containing 3% (w/v) bovine serum albumin (Sigma) and 5 mM CaCl2 8. Alexa Fluor-647-labeled streptavidin (Molecular Probes)
282
Angelina S. Palma et al.
Mana-6 Mana-6 Mana-3
35,000
Manb-4GlcNAc-AO
Glca-3Glca-3Mana-2Mana-2Mana-3
Fluorescence intensity
45,000 40,000 35,000
Fluorescence intensity
Glc2-N-glycan
30,000
Glc2-N-glycan
30,000
25,000
20,000
15,000
10,000
Glucose oligomers 5000
0
25,000
1
21 41 61 81 101 121 141 161 181 201 221 241 261 281 301 321 341 361 381 401 421 441 461
Mammalian-type 20,000
Homo- Misc. oligomers
15,000 10,000 5000
,3
a1
a1
,2
2 2 2 3 4 5 6 7 2 3 4 5 6 7 2 3 4 5 6 7 2 3 4 5 6 7 2 3 4 5 6 7
a1,4
G
lu
co N syl -g at ly ed ca ns
G 3N G 2N G 1N
0
a1,6
b1,3
b1,4
b1,6
Oligosaccharide probes (dp)
Figure 13.5 Microarray analyses of the interactions of malectin using Glc3-, Glc2-, and Glc1-high-mannose N-glycans and glucan oligosaccharide probes in the context of a full microarray containing more than 370 mammalian-type sequences and homo-oligomers of other monosaccharides (inset). The asterisk indicates that the binding signal for the Glc2-N-glycan probe was too high to be accurately quantified, using the imaging conditions selected to highlight the binding of malectin to the glucan oligosaccharide sequences. Abbreviations G3N, G2N, and G1N designate Glc3Man7(D1)GlcNAc, Glc2Man7(D1)GlcNAc, and Glc1Man9GlcNAc2 N-glycan probes, respectively; dp, degree of polymerization of the glucan oligosaccharides. The probes and their sequences were described in the Supplementary Table 6 of the publication describing the xenopus malectin (Schallus et al., 2008).
9. Fast frame multislide plate and silicone incubation chambers (16 wells) (Whatman) 10. Fluorescence microarray slide scanner (ProScanArray) and ScanArrayExpress software (Perkin-Elmer LAS)
6.2. Microarray printing The lipid-linked oligosaccharide probes were robotically printed on 16 pad nitrocellulose-coated glass slides using a noncontact arrayer with a spot delivery volume of approximately 330 pl (Palma et al., 2006); further details
Carbohydrate Microarrays and Ligands for Malectin
283
to be described elsewhere. Each probe was printed in duplicate at two levels, 2 and 5 fmol/spot. The Cy3 dye was included in the probe array solution for quality control of sample delivery while arraying and spot visualization while performing the quantitation analysis.
6.3. Probing the microarrays The microarray analysis with his-tagged malectin was performed with the protein precomplexed with mouse monoclonal anti-polyhistidine (Ab1) and biotinylated antimouse IgG antibodies (Ab2) in a ratio of 1:3:3 (by weight). The malectin–antibody complexes were prepared by preincubating Ab1 with Ab2 for 15 min at ambient temperature, followed by addition of malectin and incubation for a further 15 min. The arrayed slides were prewetted with water and blocked for 1 h with blocking solution, rinsed with HBS, and overlaid for 1.5 h with malectin–antibody complexes diluted in the blocking solution, to give a final malectin concentration of 5 mg/ml. Although calcium is not required for binding, we observed an enhancement of the binding signals elicited in the presence of the cation, especially toward the relative low avidity binders, for example, the glucan oligomers. The precomplexation of malectin with the detection antibodies, in order to increase the valency of the interaction, also resulted in enhancement of the binding signals elicited. Binding was detected using Alexa Fluor-647-labeled streptavidin for 45 min at 1 mg/ml in blocking solution. After each overlay step, slides were rinsed with HBS and an additional rinse with water was performed at the end of the binding experiment. The slides were dried and kept in the dark before scanning. The slides were scanned for Alexa Fluor-647 using a fluorescence microarray slide scanner and the spot fluorescence was quantified after background subtraction using the ScanArrayExpress software. Data analysis after quantitation and presentation was performed with a dedicated software developed by Mark S. Stoll of the Glycosciences Laboratory (Stoll and Feizi, 2009). The microarray results presented in Fig. 13.5 are the means of fluorescence intensities of duplicate spots, printed at 5 fmol. The error bars represent half of the difference between the two values. Human malectin, like its xenopus homologue (Schallus et al., 2008), has the property to bind glucan oligosaccharides, predominantly with a1,3-, a1,4-, and a1,6-linked glucose sequences, and shows an intense and highly selective binding to a diglucosylated high-mannose N-glycan (Fig. 13.5), among a diverse range of mammalian-type sequences that were included in the microarray (highlighted in the inset of Fig. 13.5).
284
Angelina S. Palma et al.
7. Conclusions In conclusion, we illustrate here the flexibility of NGL-based microarrays for generating oligosaccharide probes from desired sources, polysaccharides, and ER N-glycans in this instance. The preparation of native glucosylated glycans from cells offers a number of advantages for the experimentalist. The use of selective metabolic inhibitors for glucosidase and mannosidase enzymes in the ER (e.g., kifunensine) increases the yield of glycoforms that would otherwise be difficult to isolate in amounts sufficient for analyses of bioactivities in recognition systems involved in glycan processing and recognition. Among the oligosaccharide probe sequences analyzed, the high-selective malectin binding is to a diglucosyl high-mannose N-glycan, which is an intermediate oligosaccharide in the N-glycosylation pathway in the ER. This now opens the way to investigations of the possible sites of action of malectin in the ER. In our investigations of the xenopus and human malectin, until now, we have used the truncated diglucosyl N-glycan with seven mannose residues (Man7). This is because the Glc3Man7(D1) GlcNAc2 is the most abundant analogue which accumulates on the glycoproteins of the drug-treated cells (Petrescu et al., 1997). Work is under way to determine which Glc2-high-mannose analogues, Man9, Man8 (two isoforms), Man7, Man4, give the highest binding signals with malectin. These upcoming studies on the size of the determinant may shed light on where the malectin acts in the N-glycosylation pathway.
ACKNOWLEDGMENTS We gratefully acknowledge contributions of our colleagues in the Glycosciences Laboratory: Maria Campanero-Rhodes, Mark Stoll, Alex Lawson, and Colin Hebert; and Thomas Schallus from the EMBL Heidelberg. The Glycosciences Laboratory acknowledges with gratitude the collaborators with whom our microarray probes were studied over the years. For grant support, we acknowledge the U.K. Medical Research Council, the U.K. Research Councils Basic Technology Grant (GR/S79268, ‘‘Glycoarrays’’), Engineering and Physical Research Councils Translational Grant EP/G037604/1, and the NCI Alliance of Glycobiologists for Detection of Cancer and Cancer Risk (U01 CA128416). A. S. P. is a fellow of the Fundac¸a˜o para a Cieˆncia e Tecnologia (SFRH/BPD/26515/2006, Portugal).
REFERENCES Alonzi, D. S., Neville, D. C., Lachmann, R. H., Dwek, R. A., and Butters, T. D. (2008). Glucosylated free oligosaccharides are biomarkers of endoplasmic-reticulum alphaglucosidase inhibition. Biochem. J. 409, 571–580.
Carbohydrate Microarrays and Ligands for Malectin
285
Alonzi, D. S., Dwek, R. A., and Butters, T. D. (2009). Improved cellular inhibitors for glycoprotein processing alpha-glucosidases: Biological characterisation of alkyl- and arylalkyl-N-substituted deoxynojirimycins. Tetrahedron Asymmetry 20, 897–901. Best, D., Wang, C., Weymouth-Wilson, A. C., Clarkson, R. A., Wilson, F. X., Nash, R. J., Miyauchi, S., Kato, A., and Fleet, G. W. J. (2010). Looking glass inhibitors: Scalable syntheses of DNJ, DMDP, and (3R)-3-hydroxy-l-bulgecinine from D-glucuronolactone and of l-DNJ, l-DMDP, and (3S)-3-hydroxy-d-bulgecinine from l-glucuronolactone. DMDP inhibits b-glucosidases and b-galactosidases whereas l-DMDP is a potent and specific inhibitor of a-glucosidases. Tetrahedron Asymmetry 21, 311–319. Bogomolovas, J., Simon, B., Sattler, M., and Stier, G. (2009). Screening of fusion partners for high yield expression and purification of bioactive viscotoxins. Protein Expr. Purif. 64, 16–23. Butters, T. D., and Neville, D. C. A. (2008). In ‘‘Molecular Biomethods Handbook,’’ (J. M. Walker and R. Rapley, eds.), p. 495. Humana Press, Totowa, NJ. Butters, T. D., Sparks, L. M., Harlos, K., Ikemizu, S., Stuart, D. I., Jones, E. Y., and Davis, S. J. (1999). Effects of N-butyldeoxynojirimycin and the Lec3.2.8.1 mutant phenotype on N-glycan processing in Chinese hamster ovary cells: Application to glycoprotein crystallization. Protein Sci. 8, 1696–1701. Chai, W., Feizi, T., Yuen, C.-T., and Lawson, A. M. (1997). Nonreductive release of O-linked oligosaccharides from mucin glycoproteins for structure/function assignments as neoglycolipids: Application in the detection of novel ligands for E-selectin. Glycobiology 7, 861–872. Chai, W., Stoll, M. S., Galustian, C., Lawson, A. M., and Feizi, T. (2003). Neoglycolipid technology—Deciphering information content of glycome. Methods Enzymol. 362, 160–195. de Belder, A. N. (1993). Dextran. In ‘‘Industrial Gums,’’ (R. L. Whistler and J. BeMiller, eds.), pp. 399–426. Academic Press, New York. de la, C. J., Pintor-Toro, J. A., Benitez, T., and Llobell, A. (1995). Purification and characterization of an endo-beta-1,6-glucanase from Trichoderma harzianum that is related to its mycoparasitism. J. Bacteriol. 177, 1864–1871. Feizi, T., and Childs, R. A. (1994). Neoglycolipids: Probes in structure/function assignments to oligosaccharides. Methods Enzymol. 242, 205–217. Feizi, T., Stoll, M. S., Yuen, C.-T., Chai, W., and Lawson, A. M. (1994). Neoglycolipids: Probes of oligosaccharide structure, antigenicity and function. Methods Enzymol. 230, 484–519. Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R., Eddy, S. R., Sonnhammer, E. L., and Bateman, A. (2006). Pfam: Clans, web tools and services. Nucleic Acids Res. 34, D247–D251. Jacob, G. S., and Scudder, P. (1994). In ‘‘Methods Enzymology,’’ (W. J. Lennarz and G. W. Hart, eds.), p. 280. Academic Press, San Diego. Kaushal, G. P., and Elbein, A. D. (1994). In ‘‘Methods Enzymology,’’ (W. J. Lennarz and G. W. Hart, eds.), p. 316. Academic Press, San Diego. Letunic, I., Copley, R. R., Pils, B., Pinkert, S., Schultz, J., and Bork, P. (2006). SMART 5: Domains in the context of genomes and networks. Nucleic Acids Res. 34, D257–D260. Liu, Y., Chai, W., Childs, R. A., and Feizi, T. (2006). Preparation of neoglycolipids with ring-closed cores via chemoselective oxime-ligation for microarray analysis of carbohydrate–protein interactions. Methods Enzymol. 415C, 326–340. Liu, Y., Feizi, T., Campanero-Rhodes, M. A., Childs, R. A., Zhang, Y., Mulloy, B., Evans, P. G., Osborn, H. M., Otto, D., Crocker, P. R., and Chai, W. (2007). Neoglycolipid probes prepared via oxime ligation for microarray analysis of oligosaccharide– protein interactions. Chem. Biol. 14, 847–859.
286
Angelina S. Palma et al.
Mellor, H. R., Adam, A., Platt, F. M., Dwek, R. A., and Butters, T. D. (2000). Highperformance cation-exchange chromatography and pulsed amperometric detection for the separation, detection, and quantitation of N-alkylated imino sugars in biological samples. Anal. Biochem. 284, 136–142. Mellor, H. R., Nolan, J., Pickering, L., Wormald, M. R., Platt, F. M., Dwek, R. A., Fleet, G. W., and Butters, T. D. (2002). Preparation, biochemical characterization and biological properties of radiolabelled N-alkylated deoxynojirimycins. Biochem. J. 366, 225–233. Neville, D. C., Coquard, V., Priestman, D. A., te Vruchte, D. J., Sillence, D. J., Dwek, R. A., Platt, F. M., and Butters, T. D. (2004). Analysis of fluorescently labeled glycosphingolipid-derived oligosaccharides following ceramide glycanase digestion and anthranilic acid labeling. Anal. Biochem. 331, 275–282. Ohta, M., Hamako, J., Yamamoto, S., Hatta, H., Kim, M., Yamamoto, T., Oka, S., Mizuochi, T., and Matsuura, F. (1991). Structures of asparagine-linked oligosaccharides from hen egg-yolk antibody (IgY). Occurrence of unusual glucosylated oligo-mannose type oligosaccharides in a mature glycoprotein. Glycoconj. J. 8, 400–413. Palma, A. S., Feizi, T., Zhang, Y., Stoll, M. S., Lawson, A. M., Diaz-Rodrı´guez, E., Campanero-Rhodes, A. S., Costa, J., Brown, G. D., and Chai, W. (2006). Ligands for the beta-glucan receptor, Dectin-1, assigned using ‘designer’ microarrays of oligosaccharide probes (neoglycolipids) generated from glucan polysaccharides. J. Biol. Chem. 281, 5771–5779. Petrescu, A. J., Butters, T. D., Reinkensmeier, G., Petrescu, S., Platt, F. M., Dwek, R. A., and Wormald, M. R. (1997). The solution NMR structure of glucosylated N-glycans involved in the early stages of glycoprotein biosynthesis and folding. EMBO J. 16, 4302–4310. Schallus, T., Jaeckh, C., Feher, K., Palma, A. S., Liu, Y., Simpson, J. C., Mackeen, M., Stier, G., Gibson, T. J., Feizi, T., Pieler, T., and Muhle-Goll, C. (2008). Malectin—A novel carbohydrate-binding protein of the endoplasmic reticulum and a candidate player in the early steps of protein N-glycosylation. Mol. Biol. Cell 19, 3404–3414. Spiro, R. G. (2004). Role of N-linked polymannose oligosaccharides in targeting glycoproteins for endoplasmic reticulum-associated degradation. Cell. Mol. Life Sci. 61, 1025–1041. Stoll, M. S., and Feizi, T. (2009). Software tools for storing, processing and displaying carbohydrate microarray data. (C. Kettner, ed.). Proceeding of the Beilstein Symposium on Glyco-Bioinformatics, 4–8 October, 2009, Potsdam, Germany, Beilstein Institute for the Advancement of Chemical Sciences, Frankfurt, Germany.
C H A P T E R
F O U R T E E N
Imaging Mass Spectrometry of Glycolipids Naoko Goto-Inoue, Takahiro Hayasaka, and Mitsutoshi Setou Contents 288 289 289 290 291 292 293 294 296 297 299 299
1. Overview 2. Preparation of Tissue Sections 2.1. Methods for preparing the cryosections 3. Matrix Selection and Applying Matrix 3.1. Methods for applying matrix 4. Measurements by Imaging Mass Spectrometry 5. Data Analyses 6. Identification of Molecules 7. Application of IMS 7.1. Methods for TLC-Blot-MALDI-IMS Acknowledgments References
Abstract Mass spectrometry (MS) is an analytical technique that separates ionized molecules using differences in their mass, and can be used to determine the structure of the molecules. Matrix-assisted laser desorption/ionization (MALDI) is one of the most commonly used ionization methods for this procedure. A new technical method, imaging mass spectrometry (IMS), which is a two-dimensional MS, enables molecular imaging of tissue sections by the use of the MALDI-MS method. In this chapter, we briefly discuss available methods for analyzing glycolipids by IMS. We describe sample detection strategies, and also introduce a representative example of its research application.
Department of Molecular Anatomy, Hamamatsu University School of Medicine, Handayama, Higashi-ku, Hamamatsu, Shizuoka, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78014-9
#
2010 Elsevier Inc. All rights reserved.
287
288
Naoko Goto-Inoue et al.
1. Overview Mass spectrometry (MS) is an analytical technique that separates ionized molecules by using differences in the ratios of their mass to charge (mass/charge; m/z), and can also be used to determine the structure of the molecules. Matrix-assisted laser desorption/ionization (MALDI) is one of the ionization methods most widely used with MS (Karas and Hillenkamp, 1988). MALDI allows the analysis of large numbers of biomolecules ranging from small metabolite molecules (m/z < 1000) (Harvey, 2008; Schiller et al., 2004) to much larger proteins with molecular weights of 100,000 daltons (Da) (Yates, 1998). In the procedure, molecules are covered with a matrix and ionized using a pulse laser beam. Owing to the widespread applicability of this method, MALDI is commonly used in various fields, such as proteomics (Li, 2009), lipidomics ( Jackson et al., 2007; Schiller et al., 2007), metabolomics (Szpunar, 2005), and glycomics (An and Lebrilla, 2010; Morelle and Michalski, 2007; Wada et al., 2007). Imaging mass spectrometry (IMS) is a two-dimensional mass spectrometry to visualize the spatial distribution of biomolecules (McDonnell and Heeren, 2007). There are several kinds of detection methods using IMS; the combination of MALDI and IMS is one of the best established (Cornett et al., 2007; Zaima et al., 2009a). MALDI-IMS does not require separation or purification of the target molecules, and enables researchers not only to identify unknown molecules but also to localize numerous molecules simultaneously in cells and tissue sections. Furthermore, tandem mass spectrometry in tissue, which is referred to as MSn, enables the structural analysis of a molecule detected by the first step of IMS (Hayasaka et al., 2009; Shimma et al., 2008). Because of such versatility, the optimization of experimental protocols for sample preparation and of conditions for MS measurements, and the choice of a data analysis method are important issues to consider. IMS was initially used for studying proteins or peptides (Chaurand et al., 2002; Kaletas et al., 2009; Lemaire et al., 2006b). At present, targets of IMS research have expanded to small endogenous metabolites such as phospholipids (Hayasaka et al., 2008; Sugiura et al., 2009), neutral lipids (Hayasaka et al., 2009), glycolipids (Ageta et al., 2009; Goto-Inoue et al., 2009b; Sugiura et al., 2008), and other endogenous metabolites (Khatib-Shahidi et al., 2006). Notably, the number of reports regarding IMS of small compounds has gradually increased. In this chapter, we briefly introduce strategies for the analysis of glycolipids that are currently possible by IMS, and describe the major sample detection strategy using IMS in more detail. We also introduce a representative example of its research application.
Imaging Mass Spectrometry of Glycolipids
289
2. Preparation of Tissue Sections This section is devoted to the preparation of tissue sections subjected to IMS measurements. Fresh frozen tissue sections should be prepared as usual, beginning with the freezing of tissue using powdered dry ice, liquid nitrogen, 2-methylbuthane, etc. In choosing the method, it is important to ensure that the shape of the tissue be well maintained. The process of preparing sections of the frozen tissue for IMS measurement is essentially similar to that used in the preparation of frozen sections for immunostaining or dye-staining. The direct subjection of sections to MS measurement in this method introduces a complication, however. Embedding with an optimal cutting temperature (OCT) compound usually allows samples to retain their shape and facilitates the cutting process, but in the preparation of tissue sections for IMS measurements, the use of embedding agents such as OCT compound must be avoided because the attachment and penetration of such polymer molecules in tissues causes serious inhibition of biomolecule ionization (Schwartz et al., 2003). Such polymer-like resin compounds generally have high ionization efficiency; this leads to a decrease in the detection sensitivity of other molecules. For this reason, when preparing sections for IMS measurement, an OCT compound should be used only for ‘‘supporting’’ the tissue blocks so that it does not directly attach to the tissue sections being analyzed. Unfortunately, without this embedding process, difficulties may be encountered in cutting certain tissues into thin sections. In such cases, Stoeckli et al. (2006) used a precooled semiliquid gel of 2% sodium carboxymethylcellulose (CMC) as an alternative embedding compound that does not interfere with the detection sensitivity of biomolecules by MS analysis. It is also important to regulate the thickness of the sections because ionization efficiency is partly dependent on the thickness of tissue sections (Sugiura et al., 2006). In general, 5- to 15-mm-thick slices are appropriate for IMS.
2.1. Methods for preparing the cryosections The frozen sections are sliced at an appropriate thickness with a cryostat; we use the Leica CM 1950 (Leica, Wetzlar, Germany). Frozen sections are then thaw-mounted on indium-tin oxide (ITO)-coated glass slides (Bruker Daltonics). The following steps are necessary in preparing frozen tissue sections: 1. The blade should be wiped with ethanol and attached to the cryostat beforehand. 2. Tissue, forceps, and brushes must be precooled to the temperature inside the cryostat.
290
Naoko Goto-Inoue et al.
3. Optimal conditions for thin sectioning should be determined: that is, the angle of the tissue, temperature, and thickness (5–15 mm). 4. As thin sectioning is performed, sections must be held with forceps or brushes. 5. Each slice should be immediately mounted on a glass slide. The glass slide must be electrically conductive to be analyzed by MS. ITO-coated glass slides are commercially available for IMS and are commonly used. 6. The section should be dried by a dryer or by transferring the section to a vacuum container, and then stored in a sealed case at 20 C until use. 7. When the sections are to be analyzed, they should be removed from the case and dried immediately. 8. The dried slide can then be subjected to the next process.
3. Matrix Selection and Applying Matrix In MALDI-MS analyses, choosing the appropriate matrix is the most important step. General recommendations for each type of biomolecule have been established in traditional MALDI-MS. These recommendations apply also to MALDI-IMS. Sinapic acid (SA) is frequently used as a suitable matrix for large protein measurement. On the other hand, 2,5-dihydroxybenzoic acid (DHB) is generally used as a suitable matrix for glycolipids (An and Lebrilla, 2010). In IMS, analytes must be extracted from tissue by the solvent and cocrystallized with matrices to be ionized. Therefore, the solvent condition is very important to the extraction. To enhance the protein/peptide extraction, the addition of detergents to the matrix solution is expected to increase analyte ion signals (Lemaire et al., 2006a). Nevertheless, a preliminary test for the optimization of matrix conditions, such as the concentration of matrix, amount of matrix, and composition of solution, is recommended for successful analyte detection. Additionally, there are various methods for the coating of the matrix to the section, such as spraying and deposition. The method of matrix application also influences analyte extraction efficiency. Compared to spraying, the deposition of matrix solution increases the signal sensitivity (Aerni et al., 2006), but decreases the spatial resolution. Spraying is one of the most frequently used methods in IMS (Agar et al., 2007). By the use of this method, an entire tissue section can be coated with relatively small crystals homogeneously in a short time without special equipment. For this operation, several instruments including TLC sprayers and artistic airbrushes are available; we use a metal airbrush with a 0.2-mm nozzle because of its simple and easy-to-handle design. Although this method seems to present few technical challenges, it nonetheless requires skillful operation because of the numerous parameters of the hand-operation of the airbrush.
Imaging Mass Spectrometry of Glycolipids
291
If there is an excess of matrix solution on the tissue, an inhomogeneous crystal can be formed with analytes that have migrated from their original location; on the other hand, if not enough matrix solution is sprayed and it evaporates without sufficiently moisturizing the tissue section, analytes cannot be adequately extracted from the tissue section. The operation should be performed at a constant room temperature and humidity. Beginners are recommended to practice spraying until homogeneous matrix spraying can be achieved reproducibly. One of the critical limitations of the spatial resolution of MALDI-IMS is the size of the organic matrix crystal and the analyte migration during the matrix application process. To overcome these problems, our group reported nanoparticle-assisted laser desorption/ionization-based IMS of glycolipids (Ageta et al., 2009). Some of these nanoparticles could have selective ionization efficiency for glycolipids. In the future, we expect to develop a new highly effective matrix for glycolipids.
3.1. Methods for applying matrix All solvents used for MS were of HPLC grade. We used DHB (Bruker Daltonics, Leipzig, Germany) as the matrix, and an airbrush with a 0.2-mm caliber nozzle (Procon Boy FWA Platinum; Mr. Hobby, Tokyo, Japan) for the sprayer. To apply the matrix solution by the spraying method, the following procedure should be used: 1. For the detection of glycolipids, prepare 1 ml of matrix solution (50 mg/ml DHB in 70% methanol) in a 1.5-ml tube. 2. Matrix solution must be entirely dissolved by vortexing or brief sonication. 3. The prepared matrix solution should be transferred into the bottle of an airbrush. 4. The size of the droplet, the amount of mist, the angles, and distances between the nozzle (approximately 15 cm is best) and the sample should be optimized beforehand. 5. Approximately 0.5–1.0 ml of matrix solution should be sprayed on each glass slide, with the flow rate of approximately 0.1 ml/min. To dry the surface, it is possible to simply spray air onto the section. 6. After spraying, the sample must be dried in a cooling dryer. 7. The IMS measurement should be performed as soon as possible to minimize the progression of sample damage. Figure 14.1A shows good conditions for matrix spraying, and Fig. 14.1B shows examples of good and unfavorable results from spraying DHB matrix solution (50 mg/ml, 70% methanol) to a 1 1 cm area. In this case, approximately 0.5 ml of matrix solution was the best condition.
292
Naoko Goto-Inoue et al.
A
Angle Distance
Air brush • Mist size • Air pressure • Movement • Flow rate
Tissue ITO-slide glass
B
HE staining image
0 mL
Optical image
0.1 mL
1 mm
0.5 mL
0.1 mm
1 mL
0.1 mm
0.1 mm
Figure 14.1 (A) A schematic image of the matrix application. We had to carefully control the condition of mist size, air pressure, movement, and flow rate, which were optimized manually by an air brush. (B) Optical images of sprayed sections with various amounts (0, 0.1, 0.5, and 1 ml) of DHB solution applied to a 1 1 cm area. Small rectangles in the left lane show the localization of enlarged images (right lane). We found that 0.1 ml of matrix is insufficient but 1 ml is too much. Finally, we determined that 0.5 ml of matrix for spraying is the best condition for the sample.
4. Measurements by Imaging Mass Spectrometry IMS measurements should be performed as soon as possible after matrix application, regardless of the coating method. To obtain a good spectrum in IMS measurements, the procedure is almost the same as in traditional MALDI-MS measurements, so we have to optimize the mass range, detector gain, and laser power. From the mechanical setting perspective, there are two differences between MALDI-MS and MALDI-IMS.
Imaging Mass Spectrometry of Glycolipids
293
One difference is that in IMS measurement, a two-dimensional region must be selected for analysis. In addition, the scan pitch, which decides the spatial resolution of the image, must be fixed because MALDI-IMS can ionize the molecules by laser pulse. The scan pitch, which means the distance between scans, depends on the laser size and mechanical movement control. At this moment, the commercially available instrument can analyze with a laser of approximately 25 mm (Goto-Inoue et al., 2009b). Moreover, we have developed a new instrument, which can move the sample stage by 1 mm, and the finest laser size is approximately 10 mm (Harada et al., 2009). This machine achieves the finest images obtainable by MALDI-IMS. However, these results are not sufficiently fine to detect cell-specific localization of molecules. When even finer images are needed for analysis, another ionization method, such as time-of-flight secondary ion mass spectrometry (TOF-SIMS), which is able to visualize with nm-order imaging, can be adapted to IMS. TOF-SIMS is a technique by which the target is directly submitted to a focused ion beam without matrix application. However, this technique is only applicable for the analysis of small molecules (<1000 Da) because the high energy of SIMS causes the fragmentation of larger molecules (Yang et al., 2010). MALDI-MS and TOF-SIMS have their advantages in terms of sample preparation, sensitivity, ultimate spatial resolution, and structural analyses. So, users should be careful to choose the method based on their samples and analytical needs. The scan time depends on the number of spots, the frequency of the laser, the number of shots per spot, and the time required to move the stage. However, the most relevant factor is the frequency of the laser. Almost all of the new MALDI instruments are equipped with 1000-Hz lasers. For example, when you select the region of interest (ROI) as a 1 1 cm area with 10-mm scan pitch, there are approximately 10,000 points to be analyzed. Using a 1000Hz laser with common parameters, this will take only 1 h. It is not as time-consuming as other surface analysis methods.
5. Data Analyses When the localization of the target molecule is identified, the m/z value of the peak can be filtered to within 0.2 Da by software. The software is supplied with almost every mass spectrometer that is capable of IMS. In addition, free software (BioMap) to create the mass filter for image reconstruction, and a data converter to generate a BioMap readable data file are also available from Novartis (Basel, Switzerland). We created the mass filter manually, and it is very time-consuming work. IMS visualizes the distribution of the target molecule in the tissue section by extracting the peak of the target from thousands of peaks obtained from MS analysis.
294
Naoko Goto-Inoue et al.
Since the number of mass spectra with positional information is over 10,000 per sample, it is essential to develop software to analyze enormous spectra rapidly and efficiently. Additionally, ionization conditions would be different in the various regions of tissue sections because the ionization efficiency changes due to the substance’s background or matrix conditions. To improve the inequality of the samples, data mining software to normalize each spectrum has been developed. By using such data mining software, it is now possible to compare plural samples, find differences of detected peaks among the samples, and also perform semiquantitative analyses. Meanwhile, various statistical analyses methods, for example, principle component analysis (PCA), can be applied to the data analyses of IMS by selecting the ROI on the samples being analyzed (Yao et al., 2008; Zaima et al., 2009b). We believe that ongoing improvements to experimental protocols will further expand the capabilities of this emerging technique. Then, the ion image of a mass could be obtained in the tissue section. Figure 14.2A shows ion images of seminolipid molecules which could be detected on mouse testes. We could construct ion images at m/z 795, 767, 809, 821, and 823 (Goto-Inoue et al., 2009b). We observed a major seminolipid, m/z 795, throughout the tubules in both 2- and 8-week-old samples. We also investigated the localization of a minor seminolipid. We found that m/z 767 localized at the edge of tubules, where spermatogonia and spermatocytes exist. On the other hand, m/z 809 was expressed in the inner lumen of tubules of 8-week-old testes and was not clearly detected in 2-week-old testes. The molecules at m/z 821 and m/z 823 existed throughout the tubules though their peak intensities were low; the intensities were weaker in samples from 2-week-old mice than in those from 8-week-old mice. We could identify that these molecules were testis-specific glycolipids—namely, seminolipids—by tandem MS analyses (details in next chapter). Finally, it seems that various seminolipid molecular species appear according to testicular maturation.
6. Identification of Molecules By utilizing tandem MS analyses, the detailed structures of molecules can be identified on tissues in MALDI-IMS (Garrett et al., 2007; Shimma et al., 2008). Figure 14.2 shows tandem MS analytic results of molecules detected on mouse testes. In this figure, we also show the fragmentation scheme (Fig. 14.2B). Using this scheme, we were able to identify alkyl and acyl chains in fragment ions detected on subsequent MS/MS analyses. As shown in these spectra, the detected molecules, m/z 795 (Fig. 14.2C), 767 (Fig. 14.2D), 809 (Fig. 14.2E), 821 (Fig. 14.2F), and 823 (Fig. 14.2G), were
A m/z 795
H & E staining
m/z 767
m/z 809
m/z 821
m/z 823
100 %
2 weeks
8 weeks 0%
B
(a) 539
C 300 (a) (c) O O
OH
Intensity, counts
OH HO3SO
m/z 795
(b)
OH
O O O (d)
200 (d) (b) 241 255 100
* (c) 299
0 100 (a) 539
D
30 20 10
100
(a⬘) 511
(d) (b⬘) 241 255 (b) * 227 (c/c⬘) 299 200
300
767
400
500 600 m/z
700
800
200
300
20
400
800
809
200
300
400
500 600 m/z (a) 567
700
800
900
m/z 823 Intensity, counts
700
900
*
100
10
(a⬘) 539
500 600 m/z
800
m/z 809
* (b/d) 255 (c) 299
G
821 (b) (d⬘) 255 241 (d) 267 (c/c⬘) 299
700
30
900
m/z 821
(a) 565
20 Intensity, counts
500 600 m/z (a) 553
10
*
25
0 100
400
E
F
10
300
m/z 767 Intensity, counts
Intensity, counts
40
200
795
900
5
*
(d⬘) 241 (c/c⬘) (b) *299 255 *
823
(a⬘) 539
100
200
300
400
500 600 m/z
700
800
900
Figure 14.2 (A) The ion images of seminolipid molecules in the mouse testes. An optical image of the sample stained with H&E staining, and ion images at m/z 795, 767, 809, 821, and 823 obtained from 2- and 8-week-old mouse testes are shown. Bar: 400 mm. (B) A fragmentation scheme of seminolipids and MS/MS spectra of seminolipid molecules. MS/MS spectra obtained with the precursor ions at m/z 795 (C), 767 (D), 809 (E), 821 (F), and 823 (G) are shown. Asterisks show unidentified ions. As a result, we could identify that these molecules are seminolipids. (Modified, with permission, from Goto-Inoue et al., 2009b.)
296
Naoko Goto-Inoue et al.
fragmented based on the scheme so that we could identify that these molecules were seminolipid molecules, namely; (C16:0-alkyl-C16:0acyl), (C16:0-alkyl-C14:0-acyl), (C17:0-alkyl-C16:0-acyl), (C18:1-alkyl or C18:0-alkenyl-C16:0-acyl), and (C18:0-alkyl-C16:0-acyl), respectively. Moreover, in IMS measurement, another approach adopted for small molecular applications is to obtain an image by scanning the tissue by tandem MS (Garrett et al., 2007; Khatib-Shahidi et al., 2006; Trim et al., 2008). This approach provides structural information regarding parent ions of interest throughout the tissue, thus resulting in highly specific information on a target molecule. For example, this method could separate isomers that have roughly the same m/z value; Garrett et al. (2007) demonstrated that a peak at m/z 828 in rat brain tissue contained three kinds of ions—phosphatidylcholine (diacyl-C16:0/C22:6), phosphatidylserine (diacylC16:0/C18:1), and a DHB cluster—by performing tandem MS scanning in a positive ion detection mode. Finally, by utilizing IMS and tandem MS analyses, we could simultaneously identify the localization of molecules as well as their molecular structures. Molecular species which differ in their ceramide moieties cannot be distinguished by conventional immunohistochemistry using antibodies because these antibodies only recognize sugar moieties. IMS could detect the molecules by their molecular weight. Thus, we could distinguish these molecules by the use of IMS. This is very useful for analyzing glycolipids because glycolipids have plural molecular species with various ceramide and sugar moieties.
7. Application of IMS Although IMS is suitable for the analysis of major components in tissue sections, it is difficult to detect minor constituents or molecules that are not easy to ionize because numerous molecules exist in the crude mixture of tissue samples. When crude samples are subjected to MS, numerous molecular species compete for ionization; eventually, molecules that are easily ionized preferentially reach the detector while suppressing the ionization of other molecules (Annesley, 2003; Gellermann et al., 2006). To detect minor components, we might conduct other separation methods. Many different methods for glycolipid analysis have been established, including chromatographic (HPLC or high-performance thin-layer chromatography (HPTLC)), spectroscopic (e.g., NMR), and mass spectrometric methods (Peterson and Cummings, 2006). Thin-layer chromatography (TLC) is a well-established, inexpensive, and convenient technique for glycolipid separation (Muthing, 1996; van Echten-Deckert, 2000; Yu and Ariga, 2000). However, even under optimized conditions, TLC does not yield unambiguous structural
Imaging Mass Spectrometry of Glycolipids
297
information about individual glycolipids. The TLC profile visualized by chemical staining such as orcinol for glycolipids informs us of the separation based on hydrophilic moieties. However, there are plural molecular species in glycolipids, and depending on the differences in the chains of fatty acids and sphingoids in ceramides, it is impossible to differentiate and detect all of these species by TLC. We succeeded in highly sensitive detection and detailed structural analysis of glycolipids by using TLC-Blot-MALDI-IMS (Goto-Inoue et al., 2008, 2009a). In our methods, biomolecules on TLC plates were transferred to a polyvinylidene difluoride (PVDF) membrane and the membrane was analyzed by MALDI-IMS. Not only could we analyze the membrane to obtain the relative-to-front (Rf) value of each molecular species, but we could also perform structural analyses of the oligosaccharide chain and identification of molecular species of ceramides by conducting tandem MS analyses. Because the detection limit of glycolipids depends on the MS sensitivity in this case, the sensitivity is expected to be increased compared to the detection using the conventional staining method (Fig. 14.3A). As a result, we demonstrated that as little as about 1 pmol ganglioside (GM1) is detectable, which has not been the case thus far (Fig. 14.3B). By combining the MS information with the imaging technology, we are now able to visualize analytes, obtain the Rf values of even unknown molecules, and distinguish glycolipids with different ceramide moieties that have been impossible to discriminate with the previous detection methods (Fig. 14.3C). This procedure is very easy to conduct; no specific equipment or specific antibodies are required to discriminate and detect analytes. Generally, only one-time TLC, transference to a PVDF membrane, and IMS make it possible to separate, visualize, and identify glycolipids at a low picomole level. We believe that this system will be useful in fully analyzing glycolipid compositions including minor components.
7.1. Methods for TLC-Blot-MALDI-IMS All solvents used for MS were of HPLC grade. We used a thermal blotter (ATTO, AC-5970, Tokyo) for blotting, but an iron could also be used. 1. The HPTLC plates were developed with appropriate developing solvent to separate molecules. Glycolipid bands were visualized under UV light at 366 nm. The visualized bands were marked with soft red pencil under UV light. 2. The developed HPTLC plates were dipped in blotting solvents (2-propanol/ 0.2% aqueous CaCl2/methanol, 40/20/7, v/v/v) for 10 s. 3. The HPTLC plates were immediately placed on the flat glass plate. First, a PVDF membrane, a Teflon membrane, and then a glass fiber filter
A
2
1nmol 100
1nmol
50 500
1500
1000
1500
1000
1500
2000
2500
2000
2500
2000
2500
1572 10 pmol
500
1544
100
8
1pmol
1544
500
50 0
7
1572
Relative intensity (%)
50
100
6
10 pmol
1000
100 100 pmol
0
5
1544
0
4
1572
B
3
100 pmol
1544
1
1pmol
1300 1500 1700
50 0 500
C
1000
Primuline staining
GM1(d18:1 / C18:0)
1500 2000 2500 Mass / charge GM1(d20:1 / C18:0)
Merged
Figure 14.3 (A) Thin-layer chromatogram stained with primuline. Lanes 1–8 contain bovine brain GM1: (lanes 1–2) 1 nmol, (lanes 3–4) 100 pmol, (lanes 5–6) 10 pmol, and (lanes 7–8) 1 pmol. The plate was developed with chloroform/methanol/0.2% aqueous CaCl2, (55/45/10, v/v/v). (B) Each GM1 was directly analyzed by TLCBlot-MALDI-MS. The detection limit of GM1 was estimated at 1 pmol. (C) An optical image of GM1 on thin-layer chromatogram stained with primuline and ion images obtained from GM1s of different ceramide moieties, m/z 1572 and 1544, respectively. Ion images were merged with m/z 1572 shown in red and m/z 1544 in green. (Modified, with permission, from Goto-Inoue et al., 2008.)
Imaging Mass Spectrometry of Glycolipids
299
sheet were placed over the plate. The assembly was pressed evenly for 60 s with a thermal blotter or an iron. 4. The PVDF membranes, removed from the HPTLC plates, were then air-dried. Pencil marks were transferred to the PVDF membrane facing the HPTLC plate, but lipids were exclusively located on the reverse side. 5. Then, the transferred membranes were subjected to IMS.
ACKNOWLEDGMENTS We thank Dr. Nobuhiro Zaima for valuable comments and collaboration. This work was supported by Young scientists B (21780110) to N. G-I.
REFERENCES Aerni, H. R., Cornett, D. S., and Caprioli, R. M. (2006). Automated acoustic matrix deposition for MALDI sample preparation. Anal. Chem. 78, 827–834. Agar, N. Y., Yang, H. W., Carroll, R. S., Black, P. M., and Agar, J. N. (2007). Matrix solution fixation: Histology-compatible tissue preparation for MALDI mass spectrometry imaging. Anal. Chem. 79, 7416–7423. Ageta, H., Asai, S., Sugiura, Y., Goto-Inoue, N., Zaima, N., and Setou, M. (2009). Layerspecific sulfatide localization in rat hippocampus middle molecular layer is revealed by nanoparticle-assisted laser desorption/ionization imaging mass spectrometry. Med. Mol. Morphol. 42, 16–23. An, H. J., and Lebrilla, C. B. (2010). A glycomics approach to the discovery of potential cancer biomarkers. Methods Mol. Biol. 600, 199–213. Annesley, T. M. (2003). Ion suppression in mass spectrometry. Clin. Chem. 49, 1041–1044. Chaurand, P., Schwartz, S. A., and Caprioli, R. M. (2002). Imaging mass spectrometry: A new tool to investigate the spatial organization of peptides and proteins in mammalian tissue sections. Curr. Opin. Chem. Biol. 6, 676–681. Cornett, D. S., Reyzer, M. L., Chaurand, P., and Caprioli, R. M. (2007). MALDI imaging mass spectrometry: Molecular snapshots of biochemical systems. Nat. Methods 4, 828–833. Garrett, T. J., Prieto-Conaway, M. C., Kovtoun, V., Bui, H., Izgarian, N., Stafford, G., and Yost, R. A. (2007). Imaging of small molecules in tissue sections with a new intermediatepressure MALDI linear ion trap mass spectrometer. Int. J. Mass Spectrom. 260, 166–176. Gellermann, G. P., Appel, T. R., Davies, P., and Diekmann, S. (2006). Paired helical filaments contain small amounts of cholesterol, phosphatidylcholine and sphingolipids. Biol. Chem. 387, 1267–1274. Goto-Inoue, N., Hayasaka, T., Sugiura, Y., Taki, T., Li, Y. T., Matsumoto, M., and Setou, M. (2008). High-sensitivity analysis of glycosphingolipids by matrix-assisted laser desorption/ionization quadrupole ion trap time-of-flight imaging mass spectrometry on transfer membranes. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 870, 74–83. Goto-Inoue, N., Hayasaka, T., Taki, T., Gonzalez, T. V., and Setou, M. (2009a). A new lipidomics approach by thin-layer chromatography-blot-matrix-assisted laser desorption/ ionization imaging mass spectrometry for analyzing detailed patterns of phospholipid molecular species. J. Chromatogr. A 1216, 7096–7101.
300
Naoko Goto-Inoue et al.
Goto-Inoue, N., Hayasaka, T., Zaima, N., and Setou, M. (2009b). The specific localization of seminolipid molecular species on mouse testis during testicular maturation revealed by imaging mass spectrometry. Glycobiology 19, 950–957. Harada, T., Yuba-Kubo, A., Sugiura, Y., Zaima, N., Hayasaka, T., Goto-Inoue, N., Wakui, M., Suematsu, M., Takeshita, K., Ogawa, K., Yoshida, Y., and Setou, M. (2009). Visualization of volatile substances in different organelles with an atmosphericpressure mass microscope. Anal. Chem. 81, 9153–9157. Harvey, D. J. (2008). Analysis of carbohydrates and glycoconjugates by matrix-assisted laser desorption/ionization mass spectrometry: An update covering the period 2001–2002. Mass Spectrom. Rev. 27, 125–201. Hayasaka, T., Goto-Inoue, N., Sugiura, Y., Zaima, N., Nakanishi, H., Ohishi, K., Nakanishi, S., Naito, T., Taguchi, R., and Setou, M. (2008). Matrix-assisted laser desorption/ionization quadrupole ion trap time-of-flight (MALDI-QIT-TOF)-based imaging mass spectrometry reveals a layered distribution of phospholipid molecular species in the mouse retina. Rapid Commun. Mass Spectrom. 22, 3415–3426. Hayasaka, T., Goto-Inoue, N., Zaima, N., Kimura, Y., and Setou, M. (2009). Organspecific distributions of lysophosphatidylcholine and triacylglycerol in mouse embryo. Lipids 44, 837–848. Jackson, S. N., Wang, H. Y., and Woods, A. S. (2007). In situ structural characterization of glycerophospholipids and sulfatides in brain tissue using MALDI-MS/MS. J. Am. Soc. Mass Spectrom. 18, 17–26. Kaletas, B. K., van der Wiel, I. M., Stauber, J., Guzel, C., Kros, J. M., Luider, T. M., and Heeren, R. M. (2009). Sample preparation issues for tissue imaging by imaging MS. Proteomics 9, 2622–2633. Karas, M., and Hillenkamp, F. (1988). Laser desorption ionization of proteins with molecular masses exceeding 10, 000 daltons. Anal. Chem. 60, 2299–2301. Khatib-Shahidi, S., Andersson, M., Herman, J. L., Gillespie, T. A., and Caprioli, R. M. (2006). Direct molecular analysis of whole-body animal tissue sections by imaging MALDI mass spectrometry. Anal. Chem. 78, 6448–6456. Lemaire, R., Tabet, J. C., Ducoroy, P., Hendra, J. B., Salzet, M., and Fournier, I. (2006a). Solid ionic matrixes for direct tissue analysis and MALDI imaging. Anal. Chem. 78, 809–819. Lemaire, R., Wisztorski, M., Desmons, A., Tabet, J. C., Day, R., Salzet, M., and Fournier, I. (2006b). MALDI-MS direct tissue analysis of proteins: Improving signal sensitivity using organic treatments. Anal. Chem. 78, 7145–7153. Li, Q. (2009). Advances in protein turnover analysis at the global level and biological insights. Mass Spectrom. Rev. Sep 15 [Epub ahead of print]. McDonnell, L. A., and Heeren, R. M. (2007). Imaging mass spectrometry. Mass Spectrom. Rev. 26, 606–643. Morelle, W., and Michalski, J. C. (2007). Analysis of protein glycosylation by mass spectrometry. Nat. Protoc. 2, 1585–1602. Muthing, J. (1996). High-resolution thin-layer chromatography of gangliosides. J. Chromatogr. A 720, 3–25. Peterson, B. L., and Cummings, B. S. (2006). A review of chromatographic methods for the assessment of phospholipids in biological samples. Biomed. Chromatogr. 20, 227–243. Schiller, J., Suss, R., Arnhold, J., Fuchs, B., Lessig, J., Muller, M., Petkovic, M., Spalteholz, H., Zschornig, O., and Arnold, K. (2004). Matrix-assisted laser desorption and ionization time-of-flight (MALDI-TOF) mass spectrometry in lipid and phospholipid research. Prog. Lipid Res. 43, 449–488. Schiller, J., Suss, R., Fuchs, B., Muller, M., Zschornig, O., and Arnold, K. (2007). MALDITOF MS in lipidomics. Front. Biosci. 12, 2568–2579.
Imaging Mass Spectrometry of Glycolipids
301
Schwartz, S. A., Reyzer, M. L., and Caprioli, R. M. (2003). Direct tissue analysis using matrix-assisted laser desorption/ionization mass spectrometry: practical aspects of sample preparation. J. Mass Spectrom. 38, 699–708. Shimma, S., Sugiura, Y., Hayasaka, T., Zaima, N., Matsumoto, M., and Setou, M. (2008). Mass imaging and identification of biomolecules with MALDI-QIT-TOF-based system. Anal. Chem. 80, 878–885. Stoeckli, M., Staab, D., and Schweizer, A. (2006). Compound and metabolite distribution measured by MALDI mass spectrometric imaging in whole-body tissue sections. Int. J. Mass Spectrom. 260, 195–202. Sugiura, Y., Shimma, S., and Setou, M. (2006). Two-step matrix application technique to improve ionization efficiency for matrix-assisted laser desorption/ionization in imaging mass spectrometry. Anal. Chem. 78, 8227–8235. Sugiura, Y., Shimma, S., Konishi, Y., Yamada, M. K., and Setou, M. (2008). Imaging mass spectrometry technology and application on ganglioside study; visualization of age-dependent accumulation of C20-ganglioside molecular species in the mouse hippocampus. PLoS ONE 3, e3232. Sugiura, Y., Konishi, Y., Zaima, N., Kajihara, S., Nakanishi, H., Taguchi, R., and Setou, M. (2009). Visualization of the cell-selective distribution of PUFA-containing phosphatidylcholines in mouse brain by imaging mass spectrometry. J. Lipid Res. 50, 1776–1788. Szpunar, J. (2005). Advances in analytical methodology for bioinorganic speciation analysis: metallomics, metalloproteomics and heteroatom-tagged proteomics and metabolomics. Analyst 130, 442–465. Trim, P. J., Henson, C. M., Avery, J. L., McEwen, A., Snel, M. F., Claude, E., Marshall, P. S., West, A., Princivalle, A. P., and Clench, M. R. (2008). Matrix-assisted laser desorption/ionization-ion mobility separation-mass spectrometry imaging of vinblastine in whole body tissue sections. Anal. Chem. 80, 8628–8634. van Echten-Deckert, G. (2000). Sphingolipid extraction and analysis by thin-layer chromatography. Methods Enzymol. 312, 64–79. Wada, Y., Azadi, P., Costello, C. E., Dell, A., Dwek, R. A., Geyer, H., Geyer, R., Kakehi, K., Karlsson, N. G., Kato, K., Kawasaki, N., Khoo, K. H., et al. (2007). Comparison of the methods for profiling glycoprotein glycans–HUPO Human Disease Glycomics/Proteome Initiative multi-institutional study. Glycobiology 17, 411–422. Yang, H. J., Ishizaki, I., Sanada, N., Zaima, N., Sugiura, Y., Yao, I., Ikegami, K., and Setou, M. (2010). Detection of characteristic distributions of phospholipid head groups and fatty acids on neurite surface by time of flight-secondary ion mass spectrometry. Med. Mol. Morphol. (in press). Yao, I., Sugiura, Y., Matsumoto, M., and Setou, M. (2008). In situ proteomics with imaging mass spectrometry and principal component analysis in the Scrapper-knockout mouse brain. Proteomics 8, 3692–3701. Yates, J. R., III. (1998). Mass spectrometry and the age of the proteome. J. Mass Spectrom. 33, 1–19. Yu, R. K., and Ariga, T. (2000). Ganglioside analysis by high-performance thin-layer chromatography. Methods Enzymol. 312, 115–134. Zaima, N., Hayasaka, T., Goto-Inoue, N., and Setou, M. (2009a). Imaging of metabolites by MALDI mass spectrometry. J. Oleo Sci. 58, 415–419. Zaima, N., Matsuyama, Y., and Setou, M. (2009b). Principal component analysis of direct matrix-assisted laser desorption/ionization mass spectrometric data related to metabolites of fatty liver. J. Oleo Sci. 58, 267–273.
C H A P T E R
F I F T E E N
Dynamics and Interactions of Glycoconjugates Probed by StableIsotope-Assisted NMR Spectroscopy Yoshiki Yamaguchi* and Koichi Kato†,‡,§ Contents 1. Introduction 2. Assignments of NMR Signals Derived from Glycoprotein Glycan 2.1. Preparation of selectively labeled IgG-Fc for NMR study 3. Dynamics of Glycoprotein Glycans 3.1. Determination of amide exchange rates from saturation-transfer experiments 4. Identification of Binding Surfaces in Glycoprotein/Ligand Complexes 4.1. Uniform 13C/15N-labeling for NMR assignments of the polypeptide backbone of glycoproteins 5. NMR-Based Screening of Glycopeptides Reactive with Lectin 5.1. Preparation of glycopeptides for NMR study 6. NOE Analyses of Lectin–Ligand Interactions 7. Perspective Acknowledgments References
306 306 307 309 312 313 313 315 316 318 318 319 319
Abstract Unique advantages offered by nuclear magnetic resonance (NMR) spectroscopy provide high-resolution information not only on structures but also on dynamics and interactions of glycoconjugates in solution. These benefits are further enhanced by applying stable-isotope-labeling techniques, which we have
* Structural Glycobiology Team, Systems Glycobiology Research Group, Chemical Biology Department, RIKEN, Advanced Science Institute, Hirosawa, Wako, Japan Institute for Molecular Science and Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, Higashiyama, Myodaiji, Okazaki, Aichi, Japan { Department of Structural Biology and Biomolecular Engineering, Graduate School of Pharmaceutical Sciences, Nagoya City University, Tanabe-dori, Mizuho-ku, Nagoya, Japan } The Glycoscience Institute, Ochanomizu University, Ohtsuka, Bunkyo-ku, Tokyo, Japan {
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78015-0
#
2010 Elsevier Inc. All rights reserved.
305
306
Yoshiki Yamaguchi and Koichi Kato
developed. Our stable-isotope-assisted NMR analyses of immunoglobulin G-Fc glycoproteins and the glycopeptides derived therefrom are here presented in terms of the dynamics and interactions of glycoconjugates.
1. Introduction Nuclear magnetic resonance (NMR) spectroscopy and recombinant techniques have developed apace to provide unprecedented information on structures, dynamics, and interactions of proteins. NMR is unique in that it is the only method that yields high-resolution structural information, that is, three-dimensional structure at atomic resolution of proteins in solution. This is particularly applicable to proteins that cannot be crystallized. Historically, NMR spectroscopy of proteins was limited by the low inherent sensitivity and by the complexity of the resultant NMR spectra. The former limitation has been alleviated by the development of more sensitive NMR spectrometers (Felli and Brutscher, 2009) and by advances in sophisticated protein expression systems (Yokoyama, 2003). Technical progress in the incorporation of NMR active, stable isotopes such as 13C and 15N into proteins have allowed remarkable advances in multidimensional NMR methods (Foster et al., 2007). In consequence, the maximum size of proteins amenable to complete structural investigation has increased to 20–30 kDa using 13C and 15N heteronuclear NMR spectroscopy. Techniques to incorporate 13C and 15N into glycoconjugates are especially important for their structural analysis because the 1H NMR chemical shifts of glycan and aglycan signals overlap considerably. We have been developing methodology for stable isotope labeling of glycoconjugates through a variety of synthetic and biochemical techniques (Kato et al., 2010; Yamaguchi, 2009; Yamaguchi and Kato, 2007). Herein, we illustrate several examples of the utility of stable-isotope-assisted NMR approaches for analyses of dynamics and interactions of glycoproteins and glycopeptides.
2. Assignments of NMR Signals Derived from Glycoprotein Glycan In the development of stable isotope labeling techniques, our model molecule was IgG, which is a glycoprotein with a molecular mass of 150 kDa, functioning as a major class of antibodies in the immune system (Nezlin, 1998; Yamaguchi et al., 2007b). The Fab portion possesses a specific antigen-binding site while the Fc portion activates a wide range of effector functions through interaction with complements or Fcg receptors (FcgRs). The Fc portions of all IgG subclasses possess one conserved
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
307
glycosylation site at Asn297 in each of the CH2 domains. It is well established that the N-glycans are essential for the promotion of effector functions. Fc fragment, with a molecular mass of 56 kDa, is prepared by proteolytic fragmentation of IgG for NMR study (Yamaguchi et al., 1995).
2.1. Preparation of selectively labeled IgG-Fc for NMR study 1. Prepare a modified Nissui NYSF 404 serum-free medium (Table 15.1). For example, in order to produce IgG labeled with 13C at the carbohydrate carbons, unlabeled D-glucose in the medium is replaced with 2.0 g/L of D-[13C6]glucose. 2. Adapt IgG-producing cells to the medium and cultivate in tissue culture flasks (Corning) lying still at 37 C in a humidified atmosphere of 5% CO2/95% air. 3. After cell growth for 2 weeks, concentrate the culture supernatant and apply to an Affi-Gel protein A column (Bio-Rad). Elute IgG from the column with 50 mM Glycine–NaOH buffer, pH 2.8 containing 150 mM NaCl. 4. Incubate the IgG (5–10 mg/mL) with papain at 37 C for 8–12 h, in 75 mM sodium phosphate buffer, pH 7.0, containing 75 mM NaCl and 2 mM EDTA. Use an enzyme/substrate ratio (w/w) of 1:50 for human IgG1 and 1:500 for mouse IgG2b. Terminate the reaction by addition of 33 mM N-ethylmaleimide. 5. Purify the Fc fragment by Affi-Gel protein A column (Bio-Rad) (vide supra) and subsequently by Superose 12 size-exclusion column (GE Healthcare, 1.0 30 cm) equilibrated with phosphate-buffered saline, pH 7.3, at a flow rate of 0.4 mL/min. 6. Concentrate the purified Fc solutions using Amicon Ultra filtration (Millipore) to a final volume of 0.5 mL yielding a protein concentration of 0.1–1.0 mM in 5 mM sodium phosphate buffer, pH 6.0 (90% H2O/10% D2O) or 7.3 (100% D2O) containing 200 mM NaCl and 3 mM NaN3. With the aid of selective/uniform 13C labeling of the glycan attached to protein, carbohydrate signals are assigned through 1H-detected experiments using 1H–13C HSQC, 1H–13C HSQC-NOESY, and 2D/3D HCCHCOSY/TOCSY pulse sequences (Kato and Yamaguchi, 2008; Kato et al., 2010; Yamaguchi and Kato, 2007). In large glycoproteins such as IgG-Fc, however, the detrimental fast 1H transverse relaxation renders NMR experiments difficult. Recently developed 13C direct detection potentially offers a valuable alternative to 1H detection to overcome the fast T2 relaxation issue by virtue of the small magnetic moment of the 13C nucleus (Arnesano et al., 2005; Bertini et al., 2005). The 13C-detected experiments have several advantages for the spectral assignments of the carbohydrate peaks of glycoproteins (Yamaguchi et al., 2009). One of the important
308
Yoshiki Yamaguchi and Koichi Kato
Table 15.1 Composition of the serum-free medium used for metabolic labeling of IgG glycoproteins
NaCl KCl CaCl2 (unhyd) Ca(NO3)2 (unhyd) MgSO4 Na2HPO4 (unhyd) NaH2PO4 (unhyd) Glucose Sodium succinate Succinic acid D-Biotin D-Calcium pantothenate Choline chloride Folic acid i-Inositol Nicotinamide p-Aminobenzoic acid PyridoxalHCl PyridoxineHCl Riboflavin ThiaminHCl Vitamin B12 Glutathione (red) Choline bitartrate Putrescine2H2O Sodium pyruvate Thymidine Hypoxanthine Sodium selenite Penicillin G Streptomycin Phenol Red
mg/L 6208 388 97 33.7 69 388.5 55.8 2000 50 37.5 0.11 0.61 26.5 0.97 18 0.97 0.485 0.485 0.485 0.146 0.97 0.0037 0.485 0.873 0.0125 110 0.0125 0.025 0.0017 63.29 100 5
Human transferrin Bovine insulin HEPES Sodium bicarbonate L-ArginineHCl L-Arginine L-AsparagineH2O L-Aspartic acid L-Cystine2H2O L-CysteineHClH2O L-Glutamic acid L-Glutamine L-Histidine L-HistidineHClH2O L-Hydroxyproline L-Isoleucine L-Leucine L-LysineHCl L-Methionine L-Proline L-Serine L-Threonine L-Valine L-Phenylalanine L-Tryptophan L-Tyrosine Glycine
mg/L 10 10 3570 1400 76.1 97 42.5 9.7 31.5 15.2 9.7 450 7.3 20.4 9.7 49.5 49.5 54.8 14.6 14.7 29.6 48 47 22.8 7.3 27.2 9.9
features of these experiments is the wider chemical-shift range (50– 110 ppm) as compared with the narrow range of 1H (mostly 3–4 ppm). Figure 15.1A shows a 2D 13C–13C NOESY spectrum of the 13C-labeled Fc fragment of mouse IgG2b. Inspection of the intraresidue 13C–13C connectivity patterns easily classifies the peaks into monosaccharide types with specific linkage configurations. We also conducted 13C–13C TOCSY experiments to identify intraresidue correlations by use of 1JCC scalar coupling (Fig. 15.1B). It is of note that the 13C–13C TOCSY spectrum
309
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
A
B
ppm 55 60
GN2 C1-C2 GN5¢ C1-C2 GN5 C1-C2
GN1 C1-C2
Man3 C3-C4
65 70 75 13
C 80
Man3 C1-C2 Man4 C1-C2
Fuc C1-C2
Man4 C2-C3
GN5 C5-C6 Man4 C4-C5
GN1 / 2 C2-C3 GN5 C2-C3 GN5 C2-C3 Fuc C4-C5
GN5 C2-C3
GN5 C2-C5
GN5 C1-C2
GN5 C2-C4
GN5 C1-C6
Man3 C2-C3 GN1 / 2 C3-C4
Man4¢ C1-C2
GN1 / 2 C4-C5
85 90 95 100 105 110 110 105 100
95
90
85
80
75
70
65
60
55 ppm
105 100
95
13
90
85
80
75
70
65
60
55 ppm
13
C
C
Fuca1 5¢ GlcNAcb1
4¢ 2Mana1
GlcNAcb1 5
2Mana1 4
6 Manb1 3 3
4GlcNAcb1
6 4GlcNAcb1
2
Asn
1
Figure 15.1 Assignments of NMR signals derived from the carbohydrate chains of IgG-Fc. (A) The carbohydrate region of the two-dimensional 13C–13C NOESY spectrum of 13C-labeled mouse IgG2b-Fc. The data were acquired on a CH dual cryogenic probe at the 13C observation frequency of 125 MHz. The mixing time was 600 ms, and the total experimental time was 48 h. (B) 13C–13C TOCSY spectrum of 13C-labeled IgG-Fc obtained in 19 h. The magnetization transfer was performed with the FLOPSY pulse sequence with a mixing time of 1.2 s. (Partially adapted from Yamaguchi et al., 2009.)
exhibited extensive intraresidue connectivities starting from C1 of GlcNAc-5, but barely gave the corresponding peaks for GlcNAc-50 . Thus, 13C–13C NOESY experiments are proving useful for spectral assignment of the glycans of large glycoproteins and are complementary to those of 13C–13C-TOCSY and 1H-detection. These data also demonstrate the heterogeneous nature of IgG-Fc glycan mobility. We deal with this issue in more detail in the next section.
3. Dynamics of Glycoprotein Glycans Experimentally determined NMR parameters, T1, T2, and NOE, are widely used for characterizing the dynamic behavior of biological macromolecules at different timescales, and can be useful for measuring the dynamics of glycoconjugates. An example is to use the linewidth of the
310 13
Yoshiki Yamaguchi and Koichi Kato
C anomeric peak, which is inversely proportional to T2, for an analysis of the mobility of the IgG-Fc glycans. Our 13C NMR spectral data of the Fc glycoprotein show that two galactose peaks exhibit extremely different line widths, indicating that these sugar residues have significantly different mobilities in Fc glycans (Kato et al., 2010; Yamaguchi et al., 1998). This result is quite consistent with crystallographic data (Deisenhofer, 1981; Matsumiya et al., 2007), which indicate that the galactose residue at the terminus of the Mana1-6 branch contacts the inner surface of the CH2 domain, whereas the Mana1-3 branch gives no interpretable electron density of the terminal galactose residue, suggesting that this part of the sugar chain protrudes into the space between the CH2 domains. The dynamics of the IgG-Fc glycans can also be characterized by inspection of the 15N relaxation parameters of the N-acetylglucosamine (GlcNAc) residues (Kato et al., 2010; Yamaguchi, 2009). For this purpose, the acetamide groups of the GlcNAc residues of IgG-Fc were selectively labeled using [15N]glucosamine as a metabolic precursor (Fig. 15.2A). The amide signals derived from GlcNAc-2, -5, and -50 were observed but GlcNAc-1 did not give an observable signal due to line broadening caused by some chemical exchange process. 15N T1 and T2 of the GlcNAc residues were measured by using a series of heteronuclear HSQC-type experiments including relaxation periods, whereas 1H–15N heteronuclear NOE experiments require two spectra, one with saturation of the 1H spins and the other without saturation during the recycle delay (NOE ¼ Isat/Iunsat, Isat and Iunsat represent the measured intensities of resonance in the presence and absence of proton saturation, respectively). Figure 15.2B shows the 15N T1, T2 and (Bundle et al., 1994) 15N NOE of the GlcNAc residues of IgG-Fc. These data suggest that the acetamide group of GlcNAc-5 is highly flexible in comparison with the other GlcNAc residues, that is, GlcNAc-2 and GlcNAc-50 . Solvent accessibility/hydrogen bonding interactions of the GlcNAc side chains in Fc can be investigated by amide exchange experiments (Kato et al., 2010; Yamaguchi, 2009). Slow rates of amide proton exchange are associated with shielding from solvent, usually through hydrogen bonding interaction. Amide exchange rates are measured in one of two ways depending on the exchange rates. When the rate is comparable to or faster than the spin-lattice relaxation rate (kex > 0.1 s 1), the rate constant is most easily determined from a saturation-transfer experiment (Spera et al., 1991). For slower rates (kex < 0.01 s 1), exchange is measured by rapidly transferring the protein from H2O into D2O solution, and repeatedly acquiring 1 H–15N HSQC spectra to observe the exponential decrease in intensities with time (Fairbrother et al., 1991). Initial attempts to monitor the exchange of amide protons by transferring Fc into D2O solution failed because of their rapid exchange with the D2O solvent. Hence, the GlcNAc amide exchange rates were determined from saturation-transfer-type experiments
311
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
A
118 120
GlcNAc-5¢ GlcNAc-5
15N
122
GlcNAc-2
(ppm)
124
9.0
8.0 1H (ppm)
7.0
126
B 15N
T1 (ms)
1000
15N
T2 (ms)
200
800
150
600
cN lc
lc G
G
{1H}-15N NOE
A
cA N
N lc
lc G
5¢
2 A
A N
A N lc G
c-
c-
5¢ c-
cA N lc G
G
0
5
50
0
2
200
5
100
400
kex(s–1)
1.0
5.0
0.5
4.0 3.0
0.0
2.0
–0.5
1.0
–1.0
c5 N lc G
A N lc G
A
c5¢
2 G
lc N
A
c-
5 A clc N G
lc N G
G
lc
N
A
A c-
5¢
c2
0.0
Figure 15.2 Dynamics and solvent accessibility of Fc glycan obtained from 15N NMR parameters and amide exchange rates of GlcNAc amide groups. (A) 1H–15N HSQC spectrum of mouse IgG2b-Fc labeled with 15N at the acetamide groups of GlcNAc residues (Kato and Yamaguchi, 2008; Kato et al., 2010). The HSQC peak of GlcNAc-1 was barely detectable due to severe line broadening. (Partially adapted from Kato and Yamaguchi, 2008.) (B) 15N relaxation and NOE parameters (15N T1, T2 and {1H}–15N NOE) and amide proton exchange rates (kex) of GlcNAc residues on IgG-Fc are shown (Yamaguchi, 2009). The kex values were obtained by a comparison of the 1H–15N HSQC peak intensities between the spectra measured with and without presaturation of the water resonance.
312
Yoshiki Yamaguchi and Koichi Kato
(Yamaguchi, 2009). The intensities of the GlcNAc amide signals, with and without saturation of the water signal, were measured to calculate exchange rates (Fig. 15.2B).
3.1. Determination of amide exchange rates from saturation-transfer experiments 1. Culture the IgG-producing cells in a modified medium (Table 15.1) in which 0.2 g/L of D-[15N]GlcNHCl and 200 mg/L of L-Ala were added and D-glucose content was reduced by half whereas contents of sodium succinate, succinic acid, and sodium pyruvate were increased twice. 2. Prepare Fc fragment by proteolytic fragmentation of the 15N-labeled IgG (ut supra). 3. Measure the 1H–15N HSQC spectra of this Fc sample with and without presaturation of the water signal. 4. Perform the experiment at different pH conditions to distinguish resonance attenuation caused by hydrogen exchange from attenuation caused by cross relaxation. 5. Estimate the T1 of amide 1H. 6. Amide exchange rate constant kex (s 1) is calculated as: kex ðpH1 Þ ¼ ½M0 =Mps ðpH2 Þ M0 =Mps ðpH1 Þ=½ð10ðpH2 pH1 Þ 1Þ T1 in which kex (pH1) is the amide hydrogen exchange rate constant at pH1, T1 is the longitudinal relaxation time of the amide proton, M0 is the resonance intensity without presaturation, and Mps is resonance intensity with presaturation. Solvent exchange data show that the GlcNAc-2 acetamide proton is relatively shielded from the solvent as compared with those of GlcNAc-5 and -50 , again consistent with the crystal structure of IgG-Fc (Kolenko et al., 2009). Deuterium-induced isotope shifts of 13C resonances also offer useful information on proton exchange rates at adjacent sites (Kainosho et al., 1987; Takeda et al., 2009, 2010). For example, the carbonyl 13C resonance originating from the GlcNAc acetamide group in 50% 1H2O/50% D2O is observed as either a coalescent singlet or as a doublet with a chemical shift difference of 0.1 ppm in regimes of extremely fast and slow exchange rates of the acetamide proton, respectively. The results obtained using IgG-Fc are thus consistent with what was concluded from saturationtransfer data (Kato et al., 2010). Similar experiments can be designed for estimating the exchange rates of hydroxyl protons of carbohydrates (Christofides and Davies, 1983; Kato et al., 2008). This line of study will
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
313
be important for characterizing accessibility and hydrogen bonding of carbohydrate moieties, these being rich in hydroxyl groups.
4. Identification of Binding Surfaces in Glycoprotein/Ligand Complexes Once assignments have been made, NMR peaks provide valuable information on the interactions of glycoconjugates with their cognate ligands. Stable-isotope-assisted NMR spectroscopy has assisted in investigating IgG-Fc glycoprotein–ligand interactions for FcgR and bacterial IgGbinding proteins such as protein A and protein G (Kato et al., 1993, 1995, 2000). A more recent example is the identification of the binding site of an RNA aptamer on human IgG-Fc (Miyakawa et al., 2008). Aptamers are short, folded DNA or RNA molecules that can be selected in vitro on the basis of their high affinity for a target molecule. An optimized 23-nucleotide aptamer, Apt8-2, binds to the Fc region of human IgG with high affinity, but not to other IgGs. Apt8-2 competes with protein A, but not with the Fcg receptor, for binding to IgG (Fig. 15.3).
4.1. Uniform 13C/15N-labeling for NMR assignments of the polypeptide backbone of glycoproteins 1. Prepare a modified Nissui NYSF 404 medium in which glucose, sodium pyruvate, succinic acid, and amino acids are replaced by 2 g/L D-[13C6] glucose, 110 mg/L [13C3]pyruvic acid sodium salt, 59 mg/L [13C4] succinic acid, and 1 g/L [15N/13C]algal amino acid mixture supplemented with 149 mg/L L-[13C6,15N4]ArgHCl, 42.5 mg/L L-[13C4,15N2] AsnH2O, 24 mg/L L-[13C3,15N]Cys, 450 mg/L L-[13C5,15N2]Gln, 17 mg/L L-[13C6,15N3]HisHClH2O, 27 mg/L L-[13C9,15N]Tyr, and 7 mg/L L-[13C11,15N2]Trp. 2. Cultivate CHO cells producing human IgG1 in the Nissui NYSF 404 medium supplemented with 2% dialyzed fetal bovine serum. 3. After cell growth, concentrate the supernatant with a Millipore Pelicon ultrafiltration system and then purify using Affi-gel protein A column (ut supra). 4. Digest the IgG with papain and purify its Fc fragment. The assignments of the 1H–15N HSQC peaks originating from the Fc backbone are carried out using uniformly 13C/15N-labeled human IgG1Fc. By use of triple resonance experiments and a selective 13C–15N double labeling method (Kainosho and Tsuji, 1982; Kato et al., 1989, 1991a,b), 131 amide peaks can be assigned, which correspond to 66% of the amino acid
A 100 T250
105
G402
110 115
15N
(ppm)
S400
L432 L251
F404
120
V264
125 A339
130 135 11.0
10.0
9.0 8.0 1H(ppm)
B
7.0
6.0
C 327 328 234 329 235 330 236 331 237 332 238 239
264
269 268 237 297 267 238 266 298 265 299 239
281
CH2
338 339 340 246 397
403 404 400 402 372 344 405 406 371
316 314 250 251 431 432
309 310 315 311 254 251 253 430 436 252 314
435 432 433 434
CH3
Human IgG1-Fc
Figure 15.3 Determination of an aptamer-binding interface on IgG-Fc. (A) Superposition of the 1H–15N HSQC spectra of the 15N-G, I, L, K, T, V, A, M, C, H, W, Y, F, S-labeled Fc fragment (black) and that of the aptamer-bound Fc fragment (red). Relevant amino acid positions are assigned. (B) Spatial localization of amino acids perturbed upon addition of the aptamer. Amino acid residues that showed NMR chemical shifts upon binding to the aptamer are indicated in red for large shifts, orange for medium shifts, and purple for residues that were perturbed but not quantitatively assigned due to overlap or line broadening of the signals. The assigned residues are marked only on one chain of the CH2 and CH3 domains for clarity. (C) Amino acids responsible for binding FcgR and protein A are shown in cyan and green, respectively (Deisenhofer, 1981; Kato et al., 2000; Sondermann et al., 2000). These figures are adapted from Miyakawa et al., 2008.
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
315
residues except for prolines and the N-terminal residue, and are used as spectroscopic probes (Yamaguchi et al., 2006). To identify the aptamer-binding site on the Fc fragment, we performed HSQC titration experiments using human IgG1-Fc labeled with 15N at selected amino acid residues (Miyakawa et al., 2008). Several chemical-shift changes are observed upon titration with an Apt8-2 derivative (Fig. 15.2A). For example, the Thr250 resonance completely disappears from its original position and appears at another position in the spectrum when a two molar equivalent of aptamer is added to Fc, suggesting a 1:2 (Fc:aptamer) stoichiometric interaction. The observed chemical-shift changes were quantified for each residue according to the equation [((DdHN)2 þ (DdN/5)2)/2]1/2, where DdHN and DdN represent the difference in proton and nitrogen chemical-shift changes between the free and the aptamer-bound forms, respectively (Pellecchia et al., 1999). The NMR chemical-shift analyses successfully localize the aptamer-binding sites on the Fc fragment (Fig. 15.2B), which partially overlaps the protein A-binding site but not the Fcg receptorbinding site (Fig. 15.2C), in line with the binding property of this aptamer. The amino acid residues constituting the recognition sites thus identified on human IgG-Fc are not conserved in IgG from other species; this, in part, accounts for the high specificity of the selected aptamer. Interestingly, an extensive portion of the surface of the CH3 domain is involved in aptamer binding and this mode of interaction has never before been shown with natural ligands of IgGs.
5. NMR-Based Screening of Glycopeptides Reactive with Lectin Isotope-assisted NMR analyses are also applicable to glycopeptide/ lectin complexes. This is exemplified by our analyses of the ligand binding of Fbs1. Fbs1 is a cytosolic lectin putatively operating as a chaperone as well as a substrate-recognition subunit of the SCFFbs1 ubiquitin ligase complex (Yoshida et al., 2002, 2007). Previous X-ray crystallographic and stableisotope-assisted NMR studies using chitobiose and Man3GlcNAc2 as ligands show that the sugar-binding domain (SBD) of Fbs1 is composed of a 10-stranded b-sandwich fold with two a-helices, and interacts with the Man3GlcNAc2 portion of oligosaccharides through the loops connecting the b-strands (Mizushima et al., 2004). To provide a structural and a functional basis for the preferential binding of Fbs1 to malfolded glycoproteins as targets of the ubiquitin/proteasome-mediated protein degradation system, we examined possible interactions of Fbs1 with glycopeptides derived from isotopically labeled IgG-Fc (Yamaguchi, 2009).
316
Yoshiki Yamaguchi and Koichi Kato
5.1. Preparation of glycopeptides for NMR study 1. Dissolve isotopically labeled Fc in 0.5 M Tris–HCl buffer, pH 8.5, containing 6 M guanidium chroride, 16 mM dithiothreitol, and 2 mM EDTA. 2. After addition of 32 mM iodoacetic acid, dialyze the reaction mixture against 50 mM NH4HCO3, pH 7.9. 3. Incubate the reduced and alkylated Fc sample with V8 protease at an enzyme/substrate molar ratio of 1:30 at 37 C for 12–24 h. 4. Load the reaction mixture onto an ODS reverse-phase column and fractionate the peptides. 5. Identify isolated glycopeptides by MALDI-TOF-MS. Systematically modify glycoforms by use of appropriate glycosidases, b-galactosidase, N-acetylhexosaminidase, and a-fucosidase. Dissolve glycopeptide in 0.1 M citrate-phosphate buffer, pH 4.5, at a concentration of 1 mg/ mL and incubate in the presence or absence of jack bean b-galactosidase (0.5 U/mL), N-acetylhexosaminidase (0.5 U/mL), and bovine kidney a-L-fucosidase (0.5 U/mL) at 16 C for 12 h. 6. Perform further trypsin digestion to trim the peptide portion. Dissolve the isolated glycopeptide in 50 mM NH4HCO3 (pH 7.9) at a concentration of 0.2 mg/mL and incubate with trypsin (25 mg/mL). 7. Isolate glycopeptides by the ODS column. To characterize the ligand-binding specificity of Fbs1 by NMR spectroscopy, a series of 13C-labeled glycopeptides is prepared (Fig. 15.4A). Upon addition of Fbs1-SBD, HSQC peaks were significantly perturbed for A
4¢ M
M-GN-GN 3 2 1
M 4
4¢ M M 4
F
F
M-GN-GN 3 2 1
F 5¢ 4¢ GN-M
M-GN-GN 3 2 1
GN-M 4 5
5 ¢ 4¢ GN-M
F
M-GN-GN 3 2 1
GN-M 4 5
75
1
80
1
1
1
4¢
4¢ F
85 13
C (ppm)
90 95
4¢ 100 105 6.0
4 5.0 1
3
4¢ F 3 2 4
2 4.0
H(ppm)
3.0 6.0
5.0 1
4 4.0
H(ppm)
3.0 6.0
3
5, 5¢
5.0 1
4
3
2 4.0
H(ppm)
Figure 15.4 (Continued)
3.0 6.0
5.0 1
5, 5¢
2 4.0
H(ppm)
3.0
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
B 4⬘ Mana 1 Mana 1 4
317
6 Manb1 - 4GlcNAcb1 - 4GlcNAcb1 3 2 1 3 Asp1-Tyr2-Asn3-Ser4-Thr5-Ile6-Arg7 ppm GlcNAc-1 Ac
0 1 2
Asn3 Hb
3 4 F1 (1H) 5
GlcNAc-1 H1
6 Tyr279 He
7 8
≠
9
Asn3 Hd
10 8.4
8.2
ppm
F3 (1H)
Figure 15.4 NMR analyses of glycopeptides/Fbs1-SBD interactions. (A) Binding ability of Fbs1 with a variety of 13C-labeled glycopeptides. 1H–13C HSQC spectra of glycopeptides in the presence (red) and absence (black) of the sugar-binding domain of Fbs1. Each glycan structure is shown with the corresponding NMR spectrum. (Adapted from Yamaguchi, 2009.) (B) NMR analysis of glycopeptides/Fbs1-SBD complex by observing intermolecular NOEs. Part of 15N-edited NOESY spectrum of the 15Nlabeled glycopeptide bound to Fbs1-SBD with a molecular mass of 20 kDa (F2(15N) ¼ 129.6 ppm corresponding to the Asn3 Nd of the glycopeptide). (Partially adapted from Yamaguchi et al., 2007a).
318
Yoshiki Yamaguchi and Koichi Kato
peptides carrying Man3GlcNAc2, Man3GlcNAc2Fuc1, and Man3GlcNAc4. Interestingly, the glycopeptide carrying a fucosylated complex type oligosaccharide exhibits little spectral change.
6. NOE Analyses of Lectin–Ligand Interactions For weakly binding sugar ligands, two NMR techniques are widely employed, that is, saturation-transfer difference-NMR and transferred NOE (Angulo et al., 2006; Hanashima et al., 2010) to characterize the interactions with the cognate lectins. For medium to strong binding, glycan–lectin intermolecular NOE connectivities are crucial for obtaining the structure of a sugar–lectin complex at atomic resolution. Stable isotope labeling facilitates distinguishing between intermolecular and intramolecular NOEs. Figure 15.4B shows the 3D 15N-edited NOESY spectrum of the 15N-labeled glycopeptides interacting with unlabeled Fbs1-SBD (Yamaguchi et al., 2007a). The resonances originating from the glycopeptide bound to Fbs1-SBD are assigned using 3D HNCA, HN(CO)CA, HN (CA)NNH, and 15N-edited NOESY spectra. In addition to inter-residue NOE connectivities within glycopeptides, there are intermolecular NOE connectivities between the asparagines–GlcNAc junction part and the aromatic ring of Tyr279 of Fbs1-SBD (Fig. 15.4B). Fbs1 interacts with sugar–polypeptide junctions; these are usually shielded in native proteins, but accessible in malfolded glycoproteins. In fact, surface plasmon resonance data show that the binding constants of Fbs1-SBD are higher for the peptide-linked Man3GlcNAc2 than for the pentasaccharide alone suggesting that the peptide moiety of the substrate contributes to the affinity for Fbs1SBD (Yamaguchi et al., 2007a).
7. Perspective In this chapter, we describe applications of stable-isotope-assisted NMR to characterize the dynamics and interactions of glycoconjugates mainly based on the conventional data of chemical shift, NOE, and relaxation. These approaches can be extended to more quantitative and in-depth analyses of glycoconjugate structures by sophisticated experimental designs. For example, by introducing lanthanide probes into carbohydrates and their complexes with proteins, paramagnetic relaxation enhancement (PRE) and pseudocontact shift can be utilized as sources of long-distance geometric information (Clore et al., 2007; Shapira and Prestegard, 2010). Spin-labeling techniques can be applied to observe PREs for characterization of carbohydrate–lectin (Zhuang et al., 2008) and peptide–glycolipid interactions (Yagi-Utsumi et al., 2010).
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
319
Use of residual dipolar coupling is also a promising approach for detailed analyses of conformations and dynamics of glycoconjugates (Bax, 2003; Lange et al., 2008). In addition, trans-hydrogen bond scalar coupling constants can be used for the unambiguous identification of the acceptor group in hydrogen bonds, something not possible with amide exchange measurements (Wang et al., 1999). In most cases, the biological functions of glycoconjugates are expressed through clustering of their glycans. Therefore, it is also envisioned that techniques will be developed to enable us to design glycan assemblies for stable-isotope-assisted NMR purposes. These include the preparation of desired glycoforms of glycoproteins by using bacterial glycoprotein expression systems combined with in vitro chemoenzymatic synthesis (Schwarz et al., 2010), segmental isotope labeling methods (Skrisovska et al., 2010), and construction of physicochemically controllable glycan clusters (Santos et al., 2009). Concomitant developments in stable-isotope-assisted NMR spectroscopy and chemical, biochemical, and molecular biology methodology will lead to a new level of understanding of structure–function relationships in glycoconjugates.
ACKNOWLEDGMENTS We thank Dr. Mitsuo Sato and Dr. Kenya Shitara (Kyowa Hakko Kirin Co., Ltd.) for providing CHO cells producing the human IgG1 antibody used in these studies, and Dr. Markus Wa¨lchli (Bruker Biospin) for help in NMR measurements. Work on the Fc-binding RNA aptamer is a collaborative effort, and we thank Dr. Shin Miyakawa (Ribomic, Inc.), Dr. Taiichi Sakamoto (Chiba Institute of Technology), Dr. Yusuke Nomura (Chiba Institute of Technology), and Prof. Yoshikazu Nakamura (The University of Tokyo). We thank Dr. Keiji Tanaka and Dr. Yukoko Yoshida (Tokyo Metropolitan Institute of Medical Science) with whom we collaborate on the Fbs1–glycopeptide interactions. This work was supported by Grants-in-Aid for Scientific Research and the Nanotechnology Network Project from the Ministry of Education, Culture, Sports, Science and Technology, Japan, by the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation (NIBIO) and by Core Research for Evolution Science and Technology (CREST) from the Japan Science and Technology Agency.
REFERENCES Angulo, J., et al. (2006). NMR analysis of carbohydrate–protein interactions. Methods Enzymol. 416, 12–30. Arnesano, F., et al. (2005). NMR structures of paramagnetic metalloproteins. Q. Rev. Biophys. 38, 167–219. Bax, A. (2003). Weak alignment offers new NMR opportunities to study protein structure and dynamics. Protein Sci. 12, 1–16. Bertini, I., et al. (2005). NMR spectroscopy of paramagnetic metalloproteins. Chembiochem 6, 1536–1549. Bundle, D. R., et al. (1994). Solution structure of a trisaccharide–antibody complex: Comparison of NMR measurements with a crystal structure. Biochemistry 33, 5183–5192.
320
Yoshiki Yamaguchi and Koichi Kato
Christofides, J. C., and Davies, D. B. (1983). Secondary isotope multiplet NMR spectroscopy of partially labeled entities. Carbon-13 SIMPLE NMR of carbohydrates. J. Am. Chem. Soc. 105, 5099–5105. Clore, G. M., et al. (2007). Elucidating transient macromolecular interactions using paramagnetic relaxation enhancement. Curr. Opin. Struct. Biol. 17, 603–616. Deisenhofer, J. (1981). Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-A˚ resolution. Biochemistry 20, 2361–2370. Fairbrother, W. J., et al. (1991). Polypeptide backbone resonance assignments and secondary structure of Bacillus subtilis enzyme IIIglc determined by two-dimensional and threedimensional heteronuclear NMR spectroscopy. Biochemistry 30, 6896–6907. Felli, I. C., and Brutscher, B. (2009). Recent advances in solution NMR: Fast methods and heteronuclear direct detection. Chemphyschem 10, 1356–1368. Foster, M. P., et al. (2007). Solution NMR of large molecules and assemblies. Biochemistry 46, 331–340. Hanashima, S., et al. (2010). Synthesis and binding analysis of unique AG2 pentasaccharide to human Siglec-2 using NMR techniques. Bioorg. Med. Chem. 18, 3720–3725. Kainosho, M., and Tsuji, T. (1982). Assignment of the three methionyl carbonyl carbon resonances in Streptomyces subtilisin inhibitor by a carbon-13 and nitrogen-15 doublelabeling technique. A new strategy for structural studies of proteins in solution. Biochemistry 21, 6273–6279. Kainosho, M., et al. (1987). Local structural features around the C-terminal segment of Streptomyces subtilisin inhibitor studied by carbonyl carbon nuclear magnetic resonances three phenylalanyl residues. Biochemistry 26, 1068–1075. Kato, K., and Yamaguchi, Y. (2008). Structural analyses of glycoconjugates by NMR. Experimental Glycoscience Glycochemistry Springer, Japan, pp. 45–50. Kato, K., et al. (1989). Application of 13C nuclear magnetic resonance spectroscopy to molecular structural analyses of antibody molecules. J. Biochem. 105, 867–869. Kato, K., et al. (1991a). Complete assignment of the methionyl carbonyl carbon resonances in switch variant anti-dansyl antibodies labeled with [1-13C]methionine. Biochemistry 30, 270–278. Kato, K., et al. (1991b). Carbon-13 NMR study of switch variant anti-dansyl antibodies: Antigen binding and domain–domain interactions. Biochemistry 30, 6604–6610. Kato, K., et al. (1993). 13C NMR study of the mode of interaction in solution of the B fragment of staphylococcal protein A and the Fc fragments of mouse immunoglobulin G. FEBS Lett. 328, 49–54. Kato, K., et al. (1995). Model for the complex between protein G and an antibody Fc fragment in solution. Structure 3, 79–85. Kato, K., et al. (2000). Structural basis of the interaction between IgG and Fcg receptors. J. Mol. Biol. 295, 213–224. Kato, K., et al. (2008). 920 MHz ultra-high field NMR approaches to structural glycobiology. Biochim. Biophys. Acta 1780, 619–625. Kato, K., et al. (2010). Stable-isotope-assisted NMR approaches to glycoproteins using immunogloblin G as a model system. Prog. Nucl. Magn. Reson. Spectrosc. 56, 346–359. Kolenko, P., et al. (2009). New insights into intra- and intermolecular interactions of immunoglobulins: Crystal structure of mouse IgG2b-Fc at 2.1-A˚ resolution. Immunology 126, 378–385. Lange, O. F., et al. (2008). Recognition dynamics up to microseconds revealed from an RDC-derived ubiquitin ensemble in solution. Science 320, 1471–1475. Matsumiya, S., et al. (2007). Structural comparison of fucosylated and nonfucosylated Fc fragments of human immunoglobulin G1. J. Mol. Biol. 368, 767–779.
Stable Isotope-Assisted NMR Analyses of Glycoconjugates
321
Miyakawa, S., et al. (2008). Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G. RNA 14, 1154–1163. Mizushima, T., et al. (2004). Structural basis of sugar-recognizing ubiquitin ligase. Nat. Struct. Mol. Biol. 11, 365–370. Nezlin, R. S. (1998). The Immunoglobulins: Structure and Function. Academic Press, USA. Pellecchia, M., et al. (1999). Pilus chaperone FimC–adhesin FimH interactions mapped by TROSY-NMR. Nat. Struct. Biol. 6, 336–339. Santos, J. I., et al. (2009). Assessing carbohydrate–carbohydrate interactions by NMR spectroscopy: The trisaccharide epitope from the marine sponge Microciona prolifera. Chembiochem 10, 511–519. Schwarz, F., et al. (2010). A combined method for producing homogeneous glycoproteins with eukaryotic N-glycosylation. Nat. Chem. Biol. 6, 264–266. Shapira, B., and Prestegard, J. H. (2010). Electron–nuclear interactions as probes of domain motion in proteins. J. Chem. Phys. 132, 115102. Skrisovska, L., et al. (2010). Recent advances in segmental isotope labeling of proteins: NMR applications to large proteins and glycoproteins. J. Biomol. NMR 46, 51–65. Sondermann, P., et al. (2000). The 3.2-A˚ crystal structure of the human IgG1 Fc fragment– FcgRIII complex. Nature 406, 267–273. Spera, S., et al. (1991). Measurement of the exchange rates of rapidly exchanging amide protons: Application to the study of calmodulin and its complex with a myosin light chain kinase fragment. J. Biomol. NMR 1, 155–165. Takeda, M., et al. (2009). Hydrogen exchange rate of tyrosine hydroxyl groups in proteins as studied by the deuterium isotope effect on Cz chemical shifts. J. Am. Chem. Soc. 131, 18556–18562. Takeda, M., et al. (2010). Detection of the sulfhydryl groups in proteins with slow hydrogen exchange rates and determination of their proton/deuteron fractionation factors using the deuterium-induced effects on the 13Cb NMR signals. J. Am. Chem. Soc. 132, 6254–6260. Wang, Y. X., et al. (1999). Measurement of 3hJNC’ connectivities across hydrogen bonds in a 30 kDa protein. J. Biomol. NMR 14, 181–184. Yagi-Utsumi, M., et al. (2010). NMR characterization of the interactions between lysoGM1 aqueous micelles and amyloid b. FEBS Lett. 584, 831–836. Yamaguchi, Y. (2009). Development and applications of stable-isotope-labeling methods oriented to strucutral glycobiology. Trends Glycosci. Glycotechnol. 20, 117–130. Yamaguchi, Y., and Kato, K. (2007). Structural glycobiology by stable-isotope-assisted NMR spectroscopy. (G. A. Webb, ed.), Vol. 1, pp. 219–225. Springer-Verlag, The Netherlands. Yamaguchi, Y., et al. (1995). Proteolytic fragmentation with high specificity of mouse immunoglobulin G. Mapping of proteolytic cleavage sites in the hinge region. J. Immunol. Methods 181, 259–267. Yamaguchi, Y., et al. (1998). Dynamics of the carbohydrate chains attached to the Fc portion of immunoglobulin G as studied by NMR spectroscopy assisted by selective 13C labeling of the glycans. J. Biomol. NMR 12, 385–394. Yamaguchi, Y., et al. (2006). Glycoform-dependent conformational alteration of the Fc region of human immunoglobulin G1 as revealed by NMR spectroscopy. Biochim. Biophys. Acta 1760, 693–700. Yamaguchi, Y., et al. (2007a). Fbs1 protects the malfolded glycoproteins from the attack of peptide:N-glycanase. Biochem. Biophys. Res. Commun. 362, 712–716. Yamaguchi, Y., et al. (2007b). Molecular interactions: Antibody structures and functions. ( J. P. Kamerling, ed.), Vol. 3, pp. 745–763. Elsevier, Oxford. Yamaguchi, Y., et al. (2009). A 13C-detection NMR approach for large glycoproteins. Carbohydr. Res. 344, 535–538.
322
Yoshiki Yamaguchi and Koichi Kato
Yokoyama, S. (2003). Protein expression systems for structural genomics and proteomics. Curr. Opin. Chem. Biol. 7, 39–43. Yoshida, Y., et al. (2002). E3 ubiquitin ligase that recognizes sugar chains. Nature 418, 438–442. Yoshida, Y., et al. (2007). A neural-specific F-box protein Fbs1 functions as a chaperone suppressing glycoprotein aggregation. J. Biol. Chem. 282, 7137–7144. Zhuang, T., et al. (2008). Structure determination of a Galectin-3-carbohydrate complex using paramagnetism-based NMR constraints. Protein Sci. 17, 1220–1231.
C H A P T E R
S I X T E E N
Self and Nonself Recognition with Bacterial and Animal Glycans, Surveys by Synthetic Chemistry Yukari Fujimoto, Katsunori Tanaka, Atsushi Shimoyama, and Koichi Fukase Contents 1. Overview 2. Bacterial Glycoconjugates for Nonself Recognition—Lipopolysaccharide (LPS) 3. Synthesis of H. pylori Kdo–Lipid A Backbone 4. Glycosylation with Kdo Donor 11 5. Cytokine (IL-6) Induction in Human Peripheral Whole-Blood Cell Cultures 6. Bacterial Glycoconjugates for Nonself Recognition—Peptidoglycan (PGN) 7. Synthesis of Disaccharide Moiety 15 in Tracheal Cytotoxin with b-Selective Glycosylation 8. Synthesis of Tracheal Cytotoxin 20 and Its Fragment 21 9. Immunostimulatory Activities of DAP Containing PGN Fragments 10. Visualizing the In Vivo Dynamics of Animal N-Glycans 11. PET Imaging of Glycoproteins 12. Method for 68Ga-DOTA Labeling and MicroPET Imaging in Rabbit 13. PET Imaging of Glycoclusters 14. Method for Preparation of N-Glycan Clusters and PET Imaging in Mouse Acknowledgments References
324 325 327 327 328 329 331 332 333 333 334 335 337 338 339 340
Abstract In this chapter, we describe synthetic studies on partial structures of lipopolysaccharide (LPS) and peptidoglycan (PGN), which work as tags for nonself recognition in innate immune system. Our previous studies demonstrated that Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78016-2
#
2010 Elsevier Inc. All rights reserved.
323
324
Yukari Fujimoto et al.
lipid A is the endotoxic principle of LPS. The synthetic homogeneous preparations have enabled not only precise structure–activity relationships, but also recognition mechanisms of LPS with innate immune receptor complexes, including the TLR4/MD-2 complex, to be studied. Synthetic studies of lipid A and Kdo–lipid A from parasitic Helicobacter pylori revealed their low inflammatory activities, suggesting the molecular evolution to escape from the host immune system. A synthetic study of the partial structures of PGN has also contributed to the understanding of the innate immune mechanism. The biological activities of the synthetic fragments have revealed that the intracellular receptor Nod2 recognizes partial structures containing the muramyl dipeptide (MDP) moiety. The PGN of Gram-negative bacteria and some Gram-positive bacteria contain meso-diaminopimelic acid (meso-DAP), and recent studies have revealed that the intracellular receptor Nod1 recognizes DAP-containing peptides. We have synthesized DAP-containing PGN fragments, including the first chemical synthesis of tracheal cytotoxin (TCT). The ability of these fragments to stimulate human Nod1 as well as differences in Nod1 recognition for various synthesized ligand structures was elucidated. Cell-surface glycans such as N-glycans and O-glycans on glycoproteins and glycoconjugates work as signaling molecules for self-recognition and control immune system. Our new strategy using glycan-imaging in whole-body system is expected to unveil the dynamics of glycans in the body. Positron emission tomography (PET) is a noninvasive method that visualizes the locations and levels of radiotracer accumulation. We developed the facile labeling of peptides and proteins for PET imaging. The labeled glycoproteins and glycoclusters were then subjected to PET imaging in order to examine their in vivo dynamics, visualizing the differences in the circulatory residence of glycoproteins and glycoclusters in the presence or absence of sialic acid residues.
1. Overview Self and nonself recognition is a fundamental function to maintain the life of a multicellular organism with preventing the invasion of microorganisms, components from other species/individuals, or problematic materials. In order to distinguish the difference between self and nonself, glycan structures or glycoconjugates on the cell surface are often used as the signal motifs. One of significant roles in nonself recognition is to recognize microorganism including bacteria, which has recently been exhibited to have close relationships with the innate immunity activation. On the other hand, the cell/cell and cell/protein interactions mediated by the N-glycans, for example, stimulating the immunosuppressive signals through Siglec families, constitute the significant roles in self-recognition process. In this chapter, we show key chemical synthesis methods to build a compound library of bacterial glycoconjugates, and the immunostimulating functions.
Self and Non-Self Recognition with Glycans
325
In addition, the methods for visualizing the in vivo dynamics of N-glycans and glycoproteins, by means of the noninvasive molecular imaging as the new tool for investigating the oligosaccharides functions, will be described.
2. Bacterial Glycoconjugates for Nonself Recognition—Lipopolysaccharide (LPS) LPS of Gram-negative bacteria is one of major signaling motifs for the recognition of bacteria invading to the host organism. The compound is also known as endotoxin due to its potent immunostimulation and the toxicity. LPS is recognized with Toll-like receptor 4 (TLR4)/MD-2 complex on cell surface to produce mediators, for example, cytokines, prostagrandins, the platelet activating factor, oxygen-free radicals, and NO, which all activate and modulate the immune system (Kusumoto and Fukase, 2006; Raetz and Whitfield, 2002). LPS consists of a glycolipid component named lipid A, which is covalently connected to the polysaccharide part. Lipid As from various bacteria have common structural features, that is, GlcNAcb(1-6)GlcNAc possessing phosphono groups at the reducing end and 4-positon of the nonreducing glucosamine, and long-chain acyl groups at 2, 20 , 3, and 30 positions. The total synthesis of Escherichia coli lipid A 1 (synthetic 1 is termed 506) confirmed that lipid A is the chemical entity responsible for the innate immunostimulatory activity of LPS (Fig. 16.1) (Kusumoto and Fukase, 2006). Various lipid A structures are known such as compound 2, 3, 4, and 5 (Fig. 16.1) (Kusumoto et al., 1999, 2009; Takada and Kotani, 1992), and we have synthesized various natural or designed lipid A structures to investigate the structure–activity relationships and analyze the action mechanisms (Fujimoto et al., 2005). One of the characteristic groups of lipid As are the compounds from parasitic bacteria such as Helicobacter pylori and Porphyromonas gingivalis. H. pylori is one of Gram-negative bacteria and an etiological agent of gastroduodenal diseases, including chronic gastritis, gastroduodenal ulcers, and gastric cancer. H. pylori LPS shows a lower endotoxic activity compared to other enterobacterial preparations such as E. coli LPS, but it is considered to have relationships to the chronic inflammation. H. pylori LPS has characteristic lipid A structures; namely it has fewer but longer acyl groups, and does not have the 40 -phosphate group, and the glycosyl phosphate often has an ethanolamine group (8b; Fig. 16.1). H. pylori LPS has one Kdo as a linkage between lipid A and the polysaccharide part. We have synthesized triacyl type H. pylori lipid A with or without ethanolamine (8a, 8b) (Fujimoto et al., 2007; Sakai et al., 2000), and also H. pylori lipid A connecting to one Kdo residue (9) (Fujimoto et al., 2007), in order to elucidate their biological activities.
326
Yukari Fujimoto et al.
OH O
O (HO)2P O O O O
O HO O
NH O O O
O
O O NH O P(OH)2 OH O OH
(C14)
(C14) (C14) (C14) (C14) (C12)
O
O O NH O P(OH) 2 OH O OH
O
O NH O OH O
O O NHO P(OH) 2 OH O O
O
(C10)
(C14)
NH O O OH O
Antagonistic O
O O NH O P(OH) 2 OH O O
O
(C10)
(C14) 5 : E5564 OH
O
HO O
NH O OH O
(C10)
(C12)
OH
O O
O
O HNO P OH 1 OR O
HO HO
OH
O HN O
O HO HO
O
(C18) (C18)
O O HNO P OH OH O OH
(C18) (C18) (C18)
Figure 16.1
(C12)
Helicobacter pylori lipid A and Kdo-lipidA
R1 = –H, R2 = –H: 8a antagonistic R2 = –H: 8b immunostimulative
(C10)
CO2H
O
O
R1 = –CH2CH2–NH2,
O
OH Kdo
HO O
O
O
CO2H
7 : Ru. gelatinosus CM-analog immunostimulative (Limulus activity +)
HO
HN
O
(C12)
(C12)
O HO R2O
O NH O OH O
(C10)
(C10)
6 : Ru. gelatinosus lipid A antagonistic (Limulus activity ++)
O
O
HO O
O
(C10)
OH
O
O
(HO)2P O O
O
(C10) (C10)
HO HO
O O NHO P(OH) 2 O O
(C18)
O
O
O HO O
(C10)
(C14) 4 : RSLA Antagonistic OH
(C16)
3
(C10)
(C14)
O
O O O NH O P(OH)2 OH O O O
Salmonella typhimurium lipid A immunostimulative
NH OMe O
(C10)
NH O O O
(C14) (C14) (C14) (C12) (C14)
OMe O
O (HO)2P O O
O HO O
O HO O
(C14) (C14)
Escherichia coli biosynthetic precursor lipid IVa antagonistic
OH O
(HO)2P O O
O O
2
1 Escherichia coli lipid A strongly immunostimulative
O
(HO)2P O O
(C14)
(C14)
OH O
O
O HO O
O NH O OH OH
(C14)
O (HO)2P O O
OH O
O (HO)2P O O
O
(C18)
9 Antagonistic
Structures of various lipid A and LPS partial structures.
327
Self and Non-Self Recognition with Glycans
BnO TBSO R5O BnO R3 O
O O
NH 2
R
O BnO R4O
BnO TBSO
O O
NH OAllyl
+
R1
10 (R3 = Bn, R4 = Bn, R5 = TES)
F
CO2Bn
TBSO CO2Bn
TBSO 11
O
OBn O
OBn
O BnO R3O
O O
NH R2
O BnO R4O 12
O O
NH OAllyl 1
R
BnO H. pylori Kdo-lipid A 9
R1 = CH3(CH2)14 O R2 = CH3(CH2)16 O CH3(CH2)14
Figure 16.2 Synthesis of Helicobacter pylori Kdo–lipid A backbone.
3. Synthesis of H. pylori Kdo–Lipid A Backbone For the synthesis of Kdo–lipid A, the lipid A backbone (10) was first prepared, and connected with Kdo (11) with an a-selective glycosylation (Fig. 16.2) (Fujimoto et al., 2007; Yoshizaki et al., 2001). The molecular sieve 5A (MS5A) was found to be more effective for this reaction than MS4A, presumably because MS5A contains calcium, which traps fluoride anions and promotes glycosylation. The stereochemistry at the anomeric position was determined with the chemical shift of the protons at the 30 -position from 1H NMR in comparison with the previously reported data (Fujimoto et al., 2007; Yoshizaki et al., 2001).
4. Glycosylation with Kdo Donor 11 1. To a mixture of 10 (48.8 mg, 0.0275 mmol), Kdo-fluoride 11 (52.7 mg, 0.0713 mmol) and MS5A˚ in dry CHCl3 (2 mL) is added BF3OEt2 (0.052 ml, 0.288 mmol) at –20 C and the mixture is stirred at –20 C for 1.5 h. 2. After addition of saturated NaHCO3, the mixture is extracted with CHCl3. The organic layer is washed with saturated NaHCO3 and brine, dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. 3. The residue is purified by column chromatography (silica gel 50 g, CHCl3/acetone ¼ 30/1) to give 12 as a white solid (55.3 mg, 85%). Rf (CHCl3/acetone ¼ 30/1) ¼ 0.25; ESI-MS (positive) m/z 2402.51 [(MþNa)þ]; 1H NMR (600 MHz, CDCl3) d ¼ 7.35–7.20 (m, 40H, PhCH2 8), 6.24 (d, J ¼ 9.0 Hz, 1H, NH), 5.96 (d, J ¼ 7.2 Hz, 1H, NH0 ), 5.68 (m, 1H, OCH2CH¼CH2), 5.17 (d, J ¼ 10.8 Hz, 1H,
328
Yukari Fujimoto et al.
PhCH2OCO), 5.15–5.13 (m, 1H, OCH2CH¼CH2), 5.12–5.07 (m, 1H, OCH2CH¼CH2), 5.04 (d, J ¼ 10.8 Hz, 1H, PhCH2OCO), 5.01 (d, J ¼ 6.0 Hz, 1H, b-CH of acyloxyacyl), 4.97 (d, J ¼ 7.8 Hz, 1H, H10 ), 4.77 (d, J ¼ 10.8 Hz, 1H, PhCH2), 4.74–4.72 (m, 1H, PhCH2), 4.70 (d, J ¼ 3.7 Hz, 1H, H1), 4.69–4.67 (m, 1H, PhCH2), 4.63 (d, J ¼ 10.8 Hz, 1H, PhCH2), 4.61 (d, J ¼ 10.8 Hz, 1H, PhCH2), 4.57 (d, J ¼ 11.4 Hz, 1H, PhCH2), 4.55 (d, J ¼ 11.4 Hz, 2H, PhCH2), 4.53 (d, J ¼ 12.0 Hz, 1H, PhCH2), 4.52 (d, J ¼ 10.8 Hz, 1H, PhCH2), 4.50 (d, J ¼ 11.4 Hz, 1H, PhCH2), 4.48 (d, J ¼ 10.8 Hz, 1H, PhCH2), 4.46 (d, J ¼ 11.4 Hz, 1H, PhCH2), 4.39 (d, J ¼ 12.0 Hz, 1H, PhCH2), 4.31–4.28 (m, 1H, H2), 4.24 (t, J ¼ 8.5 Hz, 1H, H30 ), 4.13–4.07 (m, 4H, H400 , H500 , H600 , OCH2CH¼CH2), 3.99–3.94 (m, 2H, H4, H700 ), 3.89–3.87 (m, 2H, H60 , H800 ), 3.83 (d, J ¼ 9.0 Hz, 1H, H5), 3.80–3.77 (m, 1H, b-CH of acyl), 3.73–3.63 (m, 6H, H3, H6 2, H60 , H800 , OCH2-CH¼CH2), 3.59–3.56 (m, 1H, H50 ), 3.39 (t, J ¼ 8.5 Hz, 1H, H40 ), 3.25 (q, J ¼ 9.0 Hz, 1H, H20 ), 2.34 (dd, J ¼ 15.6, 7.2 Hz, 2H, a-CH2 of acyloxyacyl, a-CH2 of acyl), 2.25 (dd, J ¼ 15.0, 7.8 Hz, 1H, a-CH2 of acyl), 2.18 (dd, J ¼ 15.6, 4.8 Hz, 1H, a-CH2 of acyloxyacyl), 2.13–2.07 (m, 3H, OCOCH2 of acyloxyacyl 2, H300 ), 1.96 (dd, J ¼ 12.0, 3.6 Hz, 1H, H300 ), 1.58–1.53 (m, 1H, g-CH2 of acyl), 1.48–1.45 (m, 2H, g-CH2 of acyl, OCOCH2CH2 of acyloxyacyl), 1.38 (q, J ¼ 6.6 Hz, 1H, g-CH2 of acyloxyacyl), 1.31–1.04 (m, 82 H, CH2 of acyl 82), 0.92–0.82 (m, 27H, CH3 of acyl 9, t-BuSi 2), 0.11–0.01 (m, 12H, CH3Si 12). For obtaining the final compound, the anomeric position of trisaccharide was changed to the phosphate, and all the protecting groups were cleaved by hydrogenation (Fujimoto et al., 2007).
5. Cytokine (IL-6) Induction in Human Peripheral Whole-Blood Cell Cultures 1. The synthetic samples (lipid A 8a and Kdo–lipid A 9 with noted concentrations in 25 mL of saline) and heparinized human peripheral whole-blood (HWBC) (25 mL) collected from an adult volunteer in RPM1 1640 medium (75 mL; Flow Laboratories, Irvine, Scotland, UK) are incubated in triplicate in a 96-well plastic plate at 37 C in 5% CO2. An LPS specimen prepared by Westphal method from E. coli O111:B4 (Sigma Chemicals Co.) is used as a positive control at the concentration of 0.5 ng/mL. 2. After 24 h of the incubation, the plate is centrifuged at 300g for 2 min and cytokines in the supernatant are assayed (Suda et al., 1995). 3. The levels of IL-6 induced by stimulating HWBC cultures with test samples are measured by means of an enzyme-linked immunosorbent assay (ELISA) using Human IL-6 ELISA kit (eBioscience, San Diego, CA, USA).
329
Self and Non-Self Recognition with Glycans
1.4
Fold (vs. LPS)
1.2
50 ng / ml 500 ng / ml
1
5000 ng / ml 0.8 0.6 0.4 0.2 0
9
9 LPS (E.coli ) + LPS (E.coli )
8a
8a LPS (E.coli ) + LPS (E.coli )
Figure 16.3 IL-6 induction and inhibition by Helicobacter pylori Kdo–lipid A 9 and lipid A 8a with heparinized human peripheral whole-blood (HWBC). E. coli (O111:B4) LPS is used as a positive control at the concentration of 0.5 ng/mL.
Data represent averages of three repeated assays with standard deviations from individual experiments. H. pylori Kdo–lipid A 9 and lipid A 8a inhibited IL-6 induction by E. coli LPS. Kdo–lipid A 9 showed more potent antagonistic activity than 8a (Fig. 16.3) (Fujimoto et al., 2007). On the other hand, Lipid A 8b having ethanolamine induced low levels of cytokines such as IL-18 and TNF-a via TLR4/MD-2 complex (Ogawa et al., 2003). These results demonstrated that the number of anionic charges influences the biological activity of lipid A and LPS. Similar charge effects to biological activities were also observed in our studies of Ru. gelatinosus lipid A and lipid A analogs containing acidic amino acid residues (Fujimoto et al., 2005). Immunostimulating or antagonistic activity can be controlled by the anionic charges in these analogs and H. pylori lipid A. The present study also explains why some strains of H. pylori LPS show weak immunostimulating activity, while others show antagonistic activity. Weak immunostimulating activity may be correlated with the ability of H. pylori to induce chronic inflammation, whereas the antagonistic activity should be important for suppressing the innate immune response and survival as a parasite.
6. Bacterial Glycoconjugates for Nonself Recognition—Peptidoglycan (PGN) PGN is a component of bacterial cell walls, and has conserved structural characteristics, which makes PGN fragment structures to be good motifs for nonself recognition. PGN has polysaccharide chains linked to
330
Yukari Fujimoto et al.
MurNAc
GlcNAc
O
CH3
HO
HO
HO
O
O
O
CH3
O
O
O
NHAc
NHAc D C L-Ala-D-Glu-(NH2)n g O
HO
O
O
O HO
O
HO NHAc
D C O
NHAc
L-Ala-D-Glu-(NH2)n g AA-D-Ala-(peptide)
AA-D-Ala-(peptide) D-Ala HO O
HO
O
O O
HO NHAc CH3
HO O
O
HO NHAc
D C O
O O
AA-D-Ala-(peptide)
L CH CO2H CH2
NHAc
L-Ala-D-Glu-(NH2)n g
D-Ala
H2N
CH2 CH2 H2N
CH CO2H D meso-Diaminopimelic acid (meso-DAP)
Lys-type peptidoglycan of Staphylococcus aureus: n = 1, AA: L-Lys, peptide: (L-Gly)5 DAP-type peptidoglycan of Escherichia coli: n = 0 or 1, AA: meso-DAP, peptide: D-Ala
Figure 16.4 Schematic structures of bacterial cell wall peptidoglycan; Lys-type peptidoglycan of Staphylococcus aureus, and DAP-type peptidoglycan of Escherichia coli.
peptides, and the polysaccharide is composed of alternating b(1!4) linked N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc) glycan. At the branched position of the peptide, there is a diaminocarboxylic acid such as L-Lys (in many of Gram-positive bacteria) or mesodiaminopimelic acid (meso-DAP, in Gram-negative bacteria and some Gram-positive bacteria) as shown in Fig. 16.4. The structure of the dipeptide (L-Ala-D-Glu) linked MurNAc (MDP) is highly conserved in bacterial species (Schleifer and Kandler, 1972). PGN has been known as a potent immunostimulator and an immune adjuvant, but the mechanism of the immune stimulation had not been unveiled until the recent findings of the receptors. In 2003, two groups independently found that the intracellular protein Nod1, which is the founding member of the NLR protein family, is a receptor of PGN fragments (Chamaillard et al., 2003; Girardin et al., 2003a). Philpott and coworkers reported that Nod1 senses DAP containing muropeptides, such as GlcNAc-MurNAc-L-Ala-g-D-Glu-meso-DAP (Girardin et al., 2003a), whereas Inohara and coworkers found a DAP-containing smaller peptide, iE-DAP (g-D-glutamyl diaminopimelic acid), activates Nod1 using PGN synthetic peptide fragments (Chamaillard et al., 2003). It was also shown
331
Self and Non-Self Recognition with Glycans
HO O HO OH HO AcNH CH CHCO L-Ala-D-isoGln 3 MDP
HO HO O
HO HO O
O OH AcNH CH CHCO peptide 3
HO HO HO
HO HO HO
HO HO HO
O HO O AcNH O
O HO O AcNH HO CH CHCO peptide 3
O HO O AcNH O
O HO O AcNH HO
O HO O AcNH O
HO O O O m AcNH OR' NHAc CH 3 C L-Ala-D-isoGln L-Lys(R)-D-ALa O Peptides: L-Ala-D-isoGln HO HO L-Ala-D-isoGln-L-Lys O O HO L-Ala-D-isoGln-L-Lys(Ac) O O HO L-Ala-D-isoGln-L-Lys-D-Ala m AcNH NHAc OR' L-Ala-D-isoGln-L-Lys(Ac)-D-Ala CH3 C L-Ala-D-isoGln L-Lys L-Ala-D-isoGln-L-Lys-D-Ala-D-Ala O L-Ala-D-isoGln-L-Lys(Ac)-D-Ala-D-Ala
O HO O AcNH O
O OR AcNH CH3CHCO peptide
HO HO HO
O
OR AcNH CH CHCO peptide 3
O HO O AcNH O
O HO O HO O O HO O HO O HO O O AcNH AcNH O O CH3CHCO-L-Ala-D-isoGln AcNHHO OR CH3CHCO-L-Ala-D-isoGln AcNH O AcNH CH3CHCO-L-Ala-D-isoGln CH3CHCO-L-Ala-D-isoGln HO O O O Repeating unit of DAP-type PGN OH n O (n = 1, R = D-Ala): DS-4PDAP NHAc NHAc CH L-Ala-D-Glu H3C HO HN CH CO R (n = 1, R = OH) : DS-3PDAP O (CH2)3 (n = 0, R = D-Ala): MS-4PDAP HO HO H2N CH CO H (n = 0, R = OH) : MS-3PDAP 2 DAP
O
Linked structures
O H3C O O O AcNH n
O
L-Ala-D-Glu O HN CH CO R Tracheal cytotoxin (TCT) (CH2)3 (n = 1, R = D-Ala): DS(anh)-4PDAP H2N CH CO H (n = 1, R = OH) : DS(anh)-3PDAP 2 NHAc DAP (n = 0, R = D-Ala) : MS(anh)-4P DAP (n = 0, R = OH) : MS(anh)-3PDAP
Figure 16.5 Chemically synthesized PGN fragment library (Inamura et al., 2001, 2006; Kawasaki et al., 2008; Kusumoto et al., 2009).
that the MDP is a ligand of Nod2, which is another NLR family of intracellular proteins (Girardin et al., 2003b; Inohara et al., 2003). We constructed the PGN fragments library (Fig. 16.5), which included Lys-type linear and linked fragments, and also DAP-type fragments such as a repeating unit of the PGN fragment (GlcNac(b1-4)MurNAc-L-Ala-g-DGlu-meso-DAP-D-Ala), tracheal cytotoxin (TCT; GlcNac(b1-4)MurNAc (anh)-L-Ala-g-D-Glu-meso-DAP-D-Ala), and their fragments (Kawasaki et al., 2008). The synthesis of TCT is shown in Fig. 16.6, and the one of the key reactions is the b-selective glycosylation as used to prepare 15 from glycosyl donor 13 and glycosyl acceptor 14.
7. Synthesis of Disaccharide Moiety 15 in Tracheal Cytotoxin with b-Selective Glycosylation 1. TMSOTf (5 ml, 0.030 mmol) is added to the solution of glucosamine imidate 13 (200 mg, 0.296 mmol), 14 (193.6 mg, 0.443 mmol), and MS4A˚ in dry CH2Cl2 (3 mL) at 17 C, and the mixture is stirred for 30 min under Ar atmosphere. 2. The reaction is quenched with saturated aqueous NaHCO3. 3. The organic layer is washed with brine, dried over Na2SO4 and concentrated in vacuo. 4. The residue is purified by silica-gel flash column chromatography (toluene/AcOEt ¼ 7/1) to give 15 (182 mg, 65%).
332
Yukari Fujimoto et al.
(R) CH3 CH COOEt O O O OH
13
NHTroc
Ph
O
O
O BnO
O CCl3 NHTroc
14
Ph
WSCD HCl, HOBt, Et3N, DMF
HO HO HO
O
O
O
81%
NHTroc
NHTroc
15
(R) CH3 CH CO L-Ala-D-Glu-OBn L (S) O O HN CH COR1 O (CH2)3 O
NHAc
ZHN CH COOBn D (R)
1 18 92%: R = D-Ala-OBn HCl H-L-Ala-D-Glu-OBn 19 85%: R1= OBn L H2N CH COOBn (CH2)3 L-Ala-D-Glu-OH
O NHAc
O
O BnO
O O BnO
Zn-Cu AcOH / THF / Ac2O = 1/1/1
O
O
NHAc
(R) CH3 CH CO O O O
Pd(OH)2, H2 (20 kg / cm2) THF
Ph
TMSOTf, MS4A, CH2Cl2, –15°C, 65%
Tripeptide 16 LiOH or THF / 1, 4-dioxane / tetrapeptide 17 H2O = 4 / 2 / 1 Quant.
(R) CH3 CH COOEt O O
NH
NHAc
L (S)
2 HN CH COR (CH2)3
ZHN CH COOBn D
16 HCl H-L-Ala-D-Glu-OBn
H2N CH COOH D (R)
2 20 Quant. (from 18), R = D-Ala; Tracheal cytotoxin (TCT) 21 Quant. (from 19), R2 = H
L
HN CH CO D-Ala-OBn
(CH2)3 ZHN CH COOBn D
17
Figure 16.6 Synthesis of Tracheal cytotoxin (TCT) and its fragments. Abbreviations: Bn, benzyl; Tf, trifluoromethanesulfonyl; Troc, 2,2,2-trichloroethoxycarbonyl; TMS, trimethylsilyl; WSCDHCl, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride; HOBt, 1-hydroxybenzotriazole; Z, benzyloxycarbonyl.
ESI-TOF-MS (positive) m/z 949.17 [MþH]þ; 1H NMR (500 MHz, CDCl3) d ¼ 7.52–7.18 (10H, m, ArH 2), 5.60 (1H, s, Ph-CH¼ O2), 5.33 (1H, s, Hanh-1), 5.03 (1H, d, J ¼ 7.7 Hz, NH), 4.91 (1H, d, J ¼ 12 Hz, -O-CH2-Ph), 4.82 (1H, d, J ¼ 8 Hz, H-1), 4.76 (2H, dd, J ¼ 12 Hz, 20 Hz, -CH2-CCl3), 4.7 (1H, d, J ¼ 12 Hz, -O-CH2-Ph), 4.60 (1H, d, J ¼ 12 Hz, NH), 4.49 (1H, d, J ¼ 5.7 Hz, Hanh-5), 4.33 (1H, dd, J ¼ 5 Hz, 10 Hz, H-6), 4.22 (1H, q, J ¼ 3.6 Hz, Lac-aH), 4.20–4.14 (3H, m, -CH2CH3, Hanh-60 ), 3.95 (1H, d, J ¼ 9.8 Hz, Hanh-2), 3.86– 3.76 (3H, m, H-3, H-6, H-4), 3.74–3.72 (2H, m, Hanh-60 , Hanh-4), 3.58 (1H, brs, Hanh-3), 3.52–3.42 (2H, m, H-2, H-5). Found: C, 47.02; H, 4.42; N, 2.96%. Calcd for C37H42Cl6N2O14: C, 46.71; H, 4.45; N, 2.94%.
8. Synthesis of Tracheal Cytotoxin 20 and Its Fragment 21 After preparation of the disaccharide 15, 2,2,2-trichloroethoxycarbonyl (Troc) groups were changed to acetyl groups via cleavage of Troc group using Zn–Cu in the presence of acetic anhydride. The ethyl ester was cleaved
Self and Non-Self Recognition with Glycans
333
with LiOH, and then the liberated carboxyl group was connected to the DAP-containing peptides 16 or 17 by using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (WSCD; water-soluble carbodiimide), 1-hydroxybenzotriazole (HOBt), and triethylamine (Et3N) in DMF. After the coupling, all benzyl and benzyloxycarbonyl groups of 18 and 19 were removed by catalytic hydrogenation with Pd(OH)2 and H2 to give 20 (TCT) and 21 (Kawasaki et al., 2008).
9. Immunostimulatory Activities of DAP Containing PGN Fragments The human Nod1 stimulating activity of the DAP-type synthetic PGN fragments have been evaluated by HEK293T bioassay expressed human Nod1 as previously described (Chamaillard et al., 2003). In these compounds, 20 (TCT) shows only very weak human-Nod1 stimulatory activity, whereas 21 (DS(anh)-3PDAP) shows approximately 10-fold higher activity than that of known ligand A-iE-DAP (Kawasaki et al., 2008). These results are consistent with a report using TCT from a natural source (Magalhaes et al., 2005), and demonstrate that a free carboxyl group at the 2-position of DAP is favorable for the human Nod1 recognition. In case of human Nod1, TCT is a only weak stimulant, but it plays a fundamental role in innate immune systems of other species such as Drosophila with the activation of PGRP-LC (Kaneko et al., 2004; Stenbak et al., 2004). It has also been reported that recognition of DAP-type PGN by PGRP-LE in Drosophila is crucial for the induction of autophagy, which prevents intracellular growth of Listeria monocytogenes and promotes host survival after an infection (Yano et al., 2008). The structurally defined synthesized PGN fragments have been fundamental to understand the activation mechanism of innate immune system.
10. Visualizing the In Vivo Dynamics of Animal N-Glycans Among the various types of oligosaccharide structures, asparagine-linked oligosaccharides (N-glycans) are the most prominent in terms of diversity and complexity. In particular, N-glycans containing sialic acid residues are involved in a variety of important physiological events, including cell–cell recognition, adhesion, signal transduction, and quality control (Kamerling et al., 2007). Moreover, it has long been known that the sialic acids in N-glycans on soluble proteins or peptides enhance circulatory residence (Morell et al., 1968), that is, N-glycan-engineered erythropoietin (EPO) (Elliott et al., 2003) or insulin
334
Yukari Fujimoto et al.
(Sato et al., 2004) exhibits a remarkably higher stability in serum, which effects the prolonged bioactivity. Antibody-dependent cellular cytotoxicity (ADCC) and/or complement-dependent cytotoxicity (CDC) has also been proposed to be modulated by the sialic acids of N-glycans in immunoglobulin (IgG) through Siglec interactions by glycosylating or removing the sialic acids (Kaneko et al., 2006). However, these important findings and previous efforts in investigating N-glycan functions have been mostly based on in vitro experiments using isolated lectins, cultured cells, and dissected tissues. Recently, interest has shifted to the dynamics of these glycoproteins and/or glycans in vivo, that is, how the function and/or interaction of the individual N-glycan works synergistically through dynamic processes in the body to eventually exhibit biological phenomena. Molecular imaging (Tanaka and Fukase, 2008) is the most promising tool to visualize the ‘‘on-time’’ N-glycan dynamics in vivo. Although fluorescence imaging is the method of choice due to the convenient experimental and detection procedures at the small animal levels, magnetic resonance (MR), and more preferably, the positron emission tomography (PET) imaging, which have technologically improved sensitivity and resolution, are well suited for diagnostic applications. Nevertheless, molecular imaging of glycans has not been thoroughly examined, except for the 18F-FDG tracer (technically a monosaccharide) and the very limited examples of liposome-conjugated oligosaccharides (Chen et al., 2008; Hirai et al., 2007). This is due to the lack of the efficient labeling methods of glycoproteins, and the bioactivity of the oligosaccharides is affected by the multivalency and/or heterogeneous environment, that is, on cell surfaces that are composed of oligosaccharide clusters along with other biomolecules. A single molecule of the N-glycan, either obtained from a natural or synthetic source, is readily excreted from the body (Vyas et al., 2001). Thus, efficiently labeling and mimicking such a N-glycan-involved bioenvironment, for example, by conjugating the N-glycans, to the liposomes, or to the clusters, may provide information on the ‘‘in vivo dynamics’’ of N-glycans. Below we discuss the methods for microPET imaging of (1) glycoproteins and (2) dendrimertype glycoclusters by making much use of the multivalency effects of 16 molecules of N-glycans.
11. PET Imaging of Glycoproteins In order to investigate the effects of N-glycans, especially the sialic acid residue at the nonreducing end of the glycans, on the metabolic stability of the proteins, a microPET of glycoproteins, orosomucoid, and asialoorosomucoid could be investigated (Tanaka et al., 2008). Based on the recently developed ‘‘azaelectrocyclization protocol’’ (Fig. 16.7A), glycoproteins available in only small amounts (62 mg of orosomucoid and
335
Self and Non-Self Recognition with Glycans
A
HO2C
N-glycan chain NH2
N N
HO2C
NH2
CO2Et O
H N
N N
NH2
Orosomucoid
CO2H
CHO
N H
O
2 Molecules of DOTA
+
22 (STELLA kit) NH2
1) 24 °C, 30 min 0.1 M phosphate buffer (pH 7.4)
NH2 NH2
Asialoorosomucoid –6 62 mg, 4.5×10 M
HO
2)
OH OH
:
CO2
O
AcHN
68
O
HO
Sialic acid
GaCl3
3 Molecules of DOTA
:
HO2C
OH OH O O
OH
:
O
HO C 2
Galactose
B
CO H 2 N N O 68Ga3+ NH N N HN O N EtO C 2
0 –10 min
20–30 min
60 –80 min
180 –240 min
Liver
Lung Liver Gall bladder Spleen Kidney
Figure 16.7 (A) Labeling of glycoproteins by DOTA by STELLAþ kit (B) Dynamic microPET images of [68Ga]DOTA-glycoproteins in rabbits. Time course of accumulation of [68Ga]DOTA-orosomucoid (upper) and [68Ga]DOTA-asialoorosomucoid (lower) in some peripheral organs (axial views). These PET images were fused to anatomical images obtained by using CT.
asialoorosomucoid) were labeled with the incorporation of 2–3 units of DOTA (1,4,7,10-tetraazacyclodecane-1,4,7,10-tetraacetic acid) by incubating the respective protein with aldehyde probe 22 (STELLAþ, a kit available from Kishida, Co., Ltd.) for 30 min (Tanaka et al., 2010). The DOTA-labeled glycoproteins were subsequently radiometallated with 68Ga and their in vivo kinetics were analyzed in rabbit by means of microPET.
12. Method for 68Ga-DOTA Labeling and MicroPET Imaging in Rabbit 1. PBS solutions of orosomucoid and asialoorosomucoid (62 mg, 1.4 nmol, 295 mL, pH ¼ 7.4) are reacted with a DMF solution of probe 22 (STELLAþ kit, 14 nmol, 1.5 mL) at room temperature for 30 min
336
2. 3. 4. 5.
6. 7.
8.
9.
Yukari Fujimoto et al.
(reaction concentrations: 4.5 10 6 M for orosomucoid, 4.5 10 5 M for 22). DOTA-labeled proteins are purified by centrifugal filtration using MicroconÒ (Millipore, 30,000 cut). DOTA-proteins prepared above (10 mg) are incubated with 68GaCl3 solution (pH ¼ 7.0, 1.68 mCi, 500 mL) obtained from 68Ge/68Ga radionuclide generator, at 40 C for 10 min. A solution of DOTA (1.0 mmol, 10 mM in H2O) is added in order to chelate and excrete the excess 68Ga from the body during the PET study. 68 Ga-DOTA-glycoproteins at a dose of 15.8–16.1 MBq in 2.2 mL are injected via an ear vein of female Japanese white rabbits weighing 2.1–2.2 kg at 13 weeks of age (Japan SLC, Inc., Hamamatsu, Japan) under a general anesthesia with ketamine (60 mg/kg, KetalarÒ, Sankyo, Tokyo, Japan) and xylazine (6 mg/kg, SelactarÒ, Bayer Yakuhin, Tokyo, Japan). During the imaging experiments, the rabbits are sedated continuously with intravenously administered a mixture of ketamine (60 mg/kg/h) and xylazine (6 mg/kg/hr). PET images are obtained by using a small animal PET scanner, the microPET P4 system (Siemens Medical Solutions Inc., Knoxville, TN, USA), and the emission data is collected for 240 min postinjection as 12 frames (6 400 s, 3 1000 s, 2 1600 s, and 1 3400 s), and is acquired with an energy window of 400–650 keV and a coincidence timing window of 6 ns. The images are reconstructed from 120 to 240 min after injection of 68Ga-DOTA-orosomucoid or asialoorosomucoid by an ordered subset expectation maximization (OSEM) algorithm with attenuation correction using CT data or no scatter correction, and are smoothed by using a Gaussian kernel with an FWHM of 3 mm in the all directions. Quantitative analysis is performed using ASIPro VM version 6.3.3.0 software (Siemens Medical Solutions, Inc., Knoxville, TN, USA). Regions of interest (ROIs) are placed on the tissue region.
MicroPET images of 68Ga-DOTA-orosomucoid and asialoorosomucoid in Fig. 16.7B detected the asialo-glycoprotein being cleared throughkidney faster than orosomucoid through the well-known asialoglycoprotein receptor (Morell et al., 1968), thus achieving the visualization of sialic acid-dependent circulatory residence of glycoproteins. PET images also detected another clearance pathway of asialo-glycoprotein through the gallbladder, that is, intestinal excretion pathway, as well the accumulation to the lung and spleen. These promising PET images of glycoproteins suggest future uses for the glycoproteins in pharmacological and/or clinical applications.
337
Self and Non-Self Recognition with Glycans
13. PET Imaging of Glycoclusters In order to image the ‘‘in vivo dynamics’’ of glycans, it is necessary to mimic the ‘‘glycan-cluster environment,’’ as well as to make advantage of the glycan multivalency effects for the stronger interaction with lectins. The polylysine-based dendrimer-type glycoclusters 23a-c with 16 molecules of glycans (Fig. 16.8) were developed as the excellent templates for investigating the N-glycan dynamics in vivo (Tanaka et al., unpublished results); thus, the dendrimer core 23 with the N-benzyl histidine and the terminal acetylene embodied in the propargyl glycine residue (Fig. 16.8A) could be smoothly reacted with the 16 molecules of the azide-containing N-glycans with large and complex structures, that is, many hydroxyls and molecular weight of ca. 1500, based on the ‘‘self-activating’’ Huisgen 1,3-dipolar
N im-Bn-His
A
1)
Acetylene
N3 20 eq CuSO4 (16 eq), Na ascorbate (48 eq), DIPEA (16 eq), DMF, Ar, 40 min then, DOTA (32 eq), 40 min O
2)
OEt
O
Y
N H
23
N H
H
O
23a
H2O, rt, 30 min +
(STELLA kit)
Y=
O
O
a
NeuNAca2,6Galb1,4GlcNAcb1,2Mana1,6
HO O
Manb1,4GlcNAcb1,4GlcNAcbAsp-linker NeuNAca2,6Galb1,4GlcNAcb1,2Mana1,3
B
SO2H
O
30 min
1h
2h
O 68 Ga-DOTA
H
O
O O
Cy5
GB
K B
B Galb1,4GlcNAcb1,2Mana1,6
Manb1,4GlcNAcb1,4GlcNAcbAsp-linker Galb1,4GlcNAcb1,2Mana1,3
30 min
1h
2h
4h
L
NeuNAca2,3Galb1,4GlcNAcb1,2Mana1,6
c
Manb1,4GlcNAcb1,4GlcNAcbAsp-linker NeuNAca2,3Galb1,4GlcNAcb1,2Mana1,3
30 min
1h
2h
4h
L H
H K B
O N
O
4h L
b
N
N N 68Ga N N
K B
B
Figure 16.8 (A) Preparation of glycoclusters. (B) Dynamic PET imaging of glycoclusters 23a-c in normal BALB/c nude mice. 68Ga-DOTA-Labeled glycoclusters (10 MBq) were administered from the tail vein of the mice (n ¼ 3, 500 pmol, 100 mL/mouse) and the whole body was scanned by a small animal PET scanner, microPET Focus 220 (Siemens Medical Solutions, Inc., Knoxville, TN, USA), over 0–4 h after injection; H, heart; K, kidney; L, liver; B, urinary bladder; GB, gallbladder. (a) glycocluster 23a, (b) glycocluster 23b, (c) glycocluster 23c.
338
Yukari Fujimoto et al.
cycloaddition.’’ The clusters were designed to have a terminal lysine e-amino group so that they could be efficiently labeled by 68Ga-DOTA as the PET radiolabel, and if required, fluorescent groups, in the presence of numerous hydroxyls by labeling kit ‘‘STELLAþ’’ under mild conditions (Tanaka et al., unpublished results).
14. Method for Preparation of N-Glycan Clusters and PET Imaging in Mouse 1. Acetylene-containing polylysine 23 (16-mer, 158 mg, 2.0 10 5 mmol) is reacted with azide-containing N-glycans (1.0 mg, 4.0 10 4 mmol) in DMF (50 mL) and H2O (50 mL) at room temperature in the presence of CuSO4 (64 mg, 3.2 10 4 mmol), sodium L-ascorbate (238 mg, 1.2 10 3 mmol), and diisopropylethylamine (74 nL). 2. Excess copper ion is removed by chelating with DOTA (647 mg, 1.56 10 3 mmol) for 40 min at room temperature, and low-molecular weight compounds are filtered off using the centrifugal filtration by MicroconÒ (10,000 cut, Millipore). 3. Lyophilization of the aqueous solution and the purification by reversephase HPLC provide the desired glycoclusters. 4. Labeling by DOTA and 68Ga, and MicroPET imaging were performed as described above, except using BALB/c mice for imaging (see Fig. 16.8 Caption). Figure 16.8B shows the microPET in mice of the N-glycoclusters (Y ¼ 68Ga-DOTA) with the glycan structure of bis-Neua(2-6)Gal glycan 23a, asialo-glycan 23b, and bis-Neua(2-3)Gal glycan 23c. 68Ga-radioactivity derived from 23a was retained after 4 h in the liver (Fig. 16.8B (a)), and was excreted slowly from the kidney/urinary bladder and from the gallbladder (intestinal excretion pathway). On the other hand, asialoglycan cluster 23b rapidly cleared through the kidney to the bladder (Fig. 16.8B(b)), although some accumulation was observed in the liver because the asialoglycoproten receptors are highly expressed in this organ (Morell et al., 1968). The results are consistent with the PET analyses of glycoproteins discussed above (Tanaka et al., 2008), where the asialocongener is more rapidly excreted than orosomucoid through the kidney. However, the a-linking to the 3-OH of galactose in glycocluster 23c, which also contains sialic acid, was readily excreted through the kidney/ urinary bladder as shown in Fig. 16.8B(c). These PET results on the 16mer glycoclusters 23a-c suggest that the specific sialoside linkage to galactose, that is, Neua(2-6)Gal linkage, in N-glycan structures plays an important role in the circulatory residence of N-glycans, which in turn
Self and Non-Self Recognition with Glycans
339
results in uptake of 23a in the liver. In addition, this specific sialoside linkage markedly differentiates the excretion mechanism from those of the asialo- and Neua(2-3)Gal cases, which proceed via a biofiltration pathway through the kidney. The notable difference in the serum stability due to the sialoside bond linkages to the galactose, that is, the a(2-6)- versus a(2-3)-linkages, is an intriguing observation. These dynamic PET images suggest a new receptor-mediated excretion mechanism for Neua(2-3)Gal-containing glycans. Namely, Neua(2-3)Gal-cluster 23c, which usually cannot be found in serum, is probably recognized as an invader and smoothly excreted by the vascular endothelial cells, erythrocytes, leucocytes, and via the phagocytosis by a macrophage; the smaller sized degradation products may be filtered in the kidney. Alternatively, the ‘‘excretion-escaping’’ mechanism by stimulating the immunosuppressive signals through the ITIM (immunoreceptor tyrosine-based inhibitory motif) molecules via Siglec families (Varki and Angata, 2006), may account for the higher stability of Neua(26)Gal-glycan. It is reported that the Neua(2-6)Gal-containing BSA reduces but does not prevent binding to the asialoglycoprotein receptor, while the Neua(2-3)Gal-congener abolishes the binding (Park et al., 2005). Therefore, the prolonged half-life coupled to uptake by the asialoglycoprotein receptor account for the high accumulation of 23a in the liver (Fig. 16.8B(a)). Biantennary Neua(2-6)Gal-chains especially reduce binding in comparison with tri- and tetraantennary glycans (Lee et al., 1983), nevertheless, the combination of high valency and long circulatory half life (reduced clearance) likely leads to the uptake of 23a by hepatocytes via the Gal/GalNAc lectin receptor. Note that the slow clearance of bis-Neua(2-6)Gal cluster 23a through the gallbladder may be due to the ‘‘polar transport mechanism’’ (Nakagawa et al., 2006), which ‘‘tags’’ the fucose to specific N-glycans in the liver. Elucidation of a detailed mechanism will be the subject of future investigations.
ACKNOWLEDGMENTS This work was supported in part by Grants-in Aid for Scientific research (No. 19310144, 19681024, 19651095, and 20241053) from Japan Society for the Promotion of Science, by grants from the Institute for Fermentation, Osaka (IFO), Collaborative Development of Innovative Seeds from Japan Science and Technology Agency ( JST), New Energy and Industrial Technology Development Organization (NEDO, project ID: 07A01014a), Research Grants from Yamada Science Foundation as well as Molecular Imaging Research Program, Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.
340
Yukari Fujimoto et al.
REFERENCES Chamaillard, M., Hashimoto, M., Horie, Y., Masumoto, J., Qiu, S., Saab, L., Ogura, Y., Kawasaki, A., Fukase, K., Kusumoto, S., Valvano, M. A., Foster, S. J., et al. (2003). An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat. Immunol. 4, 702–707. Chen, W. C., Completo, G. C., and Paulson, J. C. (2008). Targeting of human B lymphoma with cytotoxic liposomes containing glycan ligands of CD22. Glycobiology 18, 963. Elliott, S., Lorenzini, T., Asher, S., Aoki, K., Brankow, D., Buck, L., Busse, L., Chang, D., Fuller, J., Grant, J., Hernday, N., Hokum, M., et al. (2003). Enhancement of therapeutic protein in vivo activities through glycoengineering. Nat. Biotechnol. 21, 414–421. Fujimoto, Y., Adachi, Y., Akamatsu, M., Fukase, Y., Kataoka, M., Suda, Y., Fukase, K., and Kusumoto, S. (2005). Synthesis of lipid A and its analogues for investigation of the structural basis for their bioactivity. J. Endotoxin Res. 11, 341–347. Fujimoto, Y., Iwata, M., Imakita, N., Shimoyama, A., Suda, Y., Kusumoto, S., and Fukase, K. (2007). Synthesis of immunoregulatory Helicobacter pylori lipopolysaccharide partial structures. Tetrahedron Lett. 48, 6577–6581. Girardin, S. E., Boneca, I. G., Carneiro, L. A., Antignac, A., Jehanno, M., Viala, J., Tedin, K., Taha, M. K., Labigne, A., Zahringer, U., Coyle, A. J., DiStefano, P. S., et al. (2003a). Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science 300, 1584–1587. Girardin, S. E., Boneca, I. G., Viala, J., Chamaillard, M., Labigne, A., Thomas, G., Philpott, D. J., and Sansonetti, P. J. (2003b). Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278, 8869–8872. Hirai, M., Minematsu, H., Kondo, N., Oie, K., Igarashi, K., and Yamazaki, N. (2007). Accumulation of liposome with Sialyl Lewis X to inflammation and tumor region: Application to in vivo bio-imaging. Biochem. Biophys. Res. Commun. 353, 553–558. Inamura, S., Fukase, K., and Kusumoto, S. (2001). Synthetic study of peptidoglycan partial structures. Synthesis of tetrasaccharide and octasaccharide fragments. Tetrahedron Lett. 42, 7613–7616. Inamura, S., Fujimoto, Y., Kawasaki, A., Shiokawa, Z., Woelk, E., Heine, H., Lindner, B., Inohara, N., Kusumoto, S., and Fukase, K. (2006). Synthesis of peptidoglycan fragments and evaluation of their biological activity. Org. Biomol. Chem. 4, 232–242. Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Crespo, J., Fukase, K., Inamura, S., Kusumoto, S., Hashimoto, M., Foster, S. J., Moran, A. P., et al. (2003). Host recognition of bacterial muramyl dipeptide mediated through NOD2. Implications for Crohn’s disease. J. Biol. Chem. 278, 5509–5512. Kamerling, J. P., Boons, G. J., Lee, Y. C., Suzuki, A., Taniguchi, N., and Voragen, A. G. J. (2007). Analysis of glycans, polysaccharide functional properties & biochemistry of glycoconjugate glycans, carbohydrate-mediated interactions. Comprehensive Glycoscience, From Chemistry to Systems Biology, Vol II & III , Elsevier, UK. Kaneko, T., Goldman, W. E., Mellroth, P., Steiner, H., Fukase, K., Kusumoto, S., Harley, W., Fox, A., Golenbock, D., and Silverman, N. (2004). Monomeric and polymeric gram-negative peptidoglycan but not purified LPS stimulate the Drosophila IMD pathway. Immunity 20, 637–649. Kaneko, Y., Nimmerjahn, F., and Ravetch, J. V. (2006). Anti-inflammatory activity of immunoglobulin G resulting from Fc sialylation. Science 313, 670–673. Kawasaki, A., Karasudani, Y., Otsuka, Y., Hasegawa, M., Inohara, N., Fujimoto, Y., and Fukase, K. (2008). Synthesis of diaminopimelic acid-containing peptidoglycan fragments and tracheal cytotoxin (TCT) for investigation of their biological functions. Chem. Eur. J. 14, 10318–10330.
Self and Non-Self Recognition with Glycans
341
Kusumoto, S., and Fukase, K. (2006). Synthesis of endotoxic principle of bacterial lipopolysaccharide and its recognition by the innate immune systems of hosts. Chem. Rec. 6, 333–343. Kusumoto, S., Fukase, K., and Oikawa, M. (1999). The chemical synthesis of lipid A. Endotoxin Health Dis. 243–256. Kusumoto, S., Fukase, K., and Fujimoto, Y. (2009). Chemical synthesis of bacterial lipid A. Microb. Glycobiol.: Struct. Relevance Appl. 415–427. Lee, Y. C., Townsend, R. R., Hardy, M. R., Lonngren, J., Arnarp, J., Haraldsson, M., and Lonn, H. (1983). Binding of synthetic oligosaccharides to the hepatic Gal/GalNAc lectin. Dependence on fine structural features. J. Biol. Chem. 258, 199–202. Magalhaes, J. G., Philpott, D. J., Nahori, M. A., Jehanno, M., Fritz, J., Le Bourhis, L., Viala, J., Hugot, J. P., Giovannini, M., Bertin, J., Lepoivre, M., Mengin-Lecreulx, D., et al. (2005). Murine Nod1 but not its human orthologue mediates innate immune detection of tracheal cytotoxin. EMBO Rep. 6, 1201–1207. Morell, A. G., Irvine, R. A., Sternlieb, I., Scheinberg, I. H., and Ashwell, G. (1968). Physical and chemical studies on ceruloplasmin V. Metabolic studies on sialic acid-free ceruloplasmin in vivo. J. Biol. Chem. 243, 155–159. Nakagawa, T., Uozumi, N., Nakano, M., Mizuno-Horikawa, Y., Okuyama, N., Taguchi, T., Gu, J., Kondo, A., Taniguchi, N., and Miyoshi, E. (2006). Fucosylation of N-glycans regulates the secretion of hepatic glycoproteins into bile ducts. J. Biol. Chem. 281, 29797–29806. Ogawa, T., Asai, Y., Sakai, Y., Oikawa, M., Fukase, K., Suda, Y., Kusumoto, S., and Tamura, T. (2003). Endotoxic and immunobiological activities of a chemically synthesized lipid A of Helicobacter pylori strain 206-1. FEMS Immunol. Med. Microbiol. 36, 1–7. Park, E. I., Mi, Y., Unverzagt, C., Gabius, H. J., and Baenziger, J. U. (2005). The asialoglycoprotein receptor clears glycoconjugates terminating with sialic acid alpha 2, 6GalNAc. Proc. Natl. Acad. Sci. USA 102, 17125–17129. Raetz, C. R., and Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71, 635–700. Sakai, Y., Oikawa, M., Yoshizaki, H., Ogawa, T., Suda, Y., Fukase, K., and Kusumoto, S. (2000). Synthesis of Helicobacter pylori lipid A and its analogue using p-(trifluoromethyl) benzyl protecting group. Tetrahedron Lett. 41, 6843–6847. Sato, M., Furuike, T., Sadamoto, R., Fujitani, N., Nakahara, T., Niikura, K., Monde, K., Kondo, H., and Nishimura, S. (2004). Glycoinsulins: Dendritic sialyloligosaccharidedisplaying insulins showing a prolonged blood-sugar-lowering activity. J. Am. Chem. Soc. 126, 14013–14022. Schleifer, K. H., and Kandler, O. (1972). Peptidoglycan types of bacterial cell walls and their taxonomic implications. Bacteriol. Rev. 36, 407–477. Stenbak, C. R., Ryu, J. H., Leulier, F., Pili-Floury, S., Parquet, C., Herve, M., Chaput, C., Boneca, I. G., Lee, W. J., Lemaitre, B., and Mengin-Lecreulx, D. (2004). Peptidoglycan molecular requirements allowing detection by the Drosophila immune deficiency pathway. J. Immunol. 173, 7339–7348. Suda, Y., Tochio, H., Kawano, K., Takada, H., Yoshida, T., Kotani, S., and Kusumoto, S. (1995). Cytokine-inducing glycolipids in the lipoteichoic acid fraction from Enterococcus hirae ATCC 9790. FEMS Immunol. Med. Microbiol. 12, 97–112. Takada, H., and Kotani, S. (1992). Vol: I Molecular Biochemistry and Cellular Biology. CRC Press, Boca Raton. Tanaka, K., and Fukase, K. (2008). PET (positron emission tomography) imaging of biomolecules using metal-DOTA complexes: A new collaborative challenge by chemists, biologists, and physicians for future diagnostics and exploration of in vivo dynamics. Org. Biomol. Chem. 6, 815–828.
342
Yukari Fujimoto et al.
Tanaka, K., Masuyama, T., Hasegawa, K., Tahara, T., Mizuma, H., Wada, Y., Watanabe, Y., and Fukase, K. (2008). A submicrogram-scale protocol for biomoleculebased PET imaging by rapid 6P-azaelectrocyclization: visualization of sialic acid dependent circulatory residence of glycoproteins. Angew. Chem. Int. Ed. 47, 102–105. Tanaka, K., Minami, K., Tahara, T., Fujii, Y., Siwu, E. R. O., Nozaki, S., Onoe, H., Yokoi, S., Koyama, K., Watanabe, Y., Fukase, K. (2010). Electrocyclization-based labeling allows efficient in vivo imaging of cellular trafficking. ChemMedChem. 5, 841–845. Varki, A., and Angata, T. (2006). Siglecs—The major subfamily of I-type lectins. Glycobiology 16, 1R–27R. Vyas, S. P., Singh, A., and Sihorkar, V. (2001). Ligand-receptor-mediated drug delivery: An emerging paradigm in cellular drug targeting. Crit. Rev. Ther. Drug Carrier Syst. 18, 1–76. Yano, T., Mita, S., Ohmori, H., Oshima, Y., Fujimoto, Y., Ueda, R., Takada, H., Goldman, W. E., Fukase, K., Silverman, N., Yoshimori, T., and Kurata, S. (2008). Autophagic control of listeria through intracellular innate immune recognition in Drosophila. Nat. Immunol. 9, 908–916. Yoshizaki, H., Fukuda, N., Sato, K., Oikawa, M., Fukase, K., Suda, Y., and Kusumoto, S. (2001). First total synthesis of the Re-type lipopolysaccharide. Angew. Chem. Int. Ed. Engl. 40, 1475–1480.
C H A P T E R
S E V E N T E E N
Multivalent Ligands for Siglecs Mary K. O’Reilly and James C. Paulson Contents 1. Introduction 1.1. Sialic acid-binding immunoglobulin-like lectins (Siglecs) 1.2. Glycan-binding specificity and cell-type expression 1.3. Cis- and trans-ligand binding 1.4. Multivalent scaffolds for siglec ligands 2. Materials and Methods 2.1. Reagents and cells 2.2. Preparation of siglec-expressing cells 2.3. PAA probe to siglec-expressing cells 2.4. PAA probes to siglec-Fc beads 2.5. Siglec-Fc to PAA probe beads 2.6. Siglec-Fc to biotinylated free saccharide-coated beads 2.7. CHO-Siglec cells to PAA probe beads 3. Conclusions and Future Directions Acknowledgments References
344 344 347 348 349 350 350 351 352 355 356 358 359 359 360 361
Abstract Siglecs have emerged as an important family of immunomodulatory glycanbinding proteins that can bind sialoside ligands both on the same cell surface, in cis, and on other cells, in trans. Expression of siglecs varies among a variety of immune cells, and tools to probe siglecs on these cells are crucial to understanding their function. In designing synthetic ligands, competition by cis ligands requires the use of multivalency to achieve sufficient avidity to stably bind siglecs on native cells. This chapter describes the use of multivalent ligands to probe cell surfaces, as well as to investigate ligand binding to recombinant siglecs.
Departments of Chemical Physiology and Molecular Biology, The Scripps Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78017-4
#
2010 Elsevier Inc. All rights reserved.
343
344
Mary K. O’Reilly and James C. Paulson
Abbreviations NeuAc BPC BPA Gal GlcNAc HBSS BSA FBS CHO PAA FITC Ig PBS DTAF
N-Acetyl neuraminic acid Biphenylcarbonyl Biphenylacetyl Galactose N-Acetylglucosamine Hank’s balanced salt solution Bovine serum albumin Fetal bovine serum Chinese hamster ovary Polyacrylamide Fluorescein isothiocyanate Immunoglobulin Phosphate-buffered saline Dichlorotriazinylaminofluorescein
1. Introduction 1.1. Sialic acid-binding immunoglobulin-like lectins (Siglecs) Many glycan-binding proteins are involved in the regulation of the immune system, through both activating and inhibitory mechanisms, as well as cell– cell adhesion, homing of immune cells, and pathogen recognition. The sialic acid-binding immunoglobulin-like lectin, or Siglec, family comprises glycan-binding proteins believed to be involved in all of these functions (Crocker et al., 2007). Sharing a common sialic acid-binding function via the terminal V-set Ig domain and variable numbers of C2-set Ig-like domains, these receptors nevertheless have overlapping but distinct celltype distribution and specificity for the underlying glycan (Table 17.1). Many contain intracellular signaling motifs, such as the immunoreceptor tyrosine inhibitory motif (ITIM), immunoreceptor tyrosine activatory motif (ITAM), or Grb-binding domain (Crocker et al., 2007). Four of the siglecs are highly conserved among species, including Sialoadhesin (Siglec1), CD22 (Siglec-2), CD33 (Siglec-3), and MAG (Siglec-4), while the remaining, known as CD33-like siglecs, are rapidly evolving, presumably due to adaptive pressures from viruses and microorganisms that have gained the ability to incorporate sialic acid (Angata, 2006; Severi et al., 2007). The expression of siglecs predominantly on immune cells and the presence of
Table 17.1 Glycan-binding specificity and cellular distribution of siglecs
Siglec (other names)
Murine ortholog or paralog
Sialoadhesin (SAD, Sn, Siglec-1)
Sialoadhesin (mSiglec-1, mSn)
CD22 (Siglec-2)
mCD22 (mSiglec-2)
CD33 (Siglec-3)
mCD33 (mSiglec-3)
MAG (Siglec-4)
mMAG (mSiglec-4)
Siglec-5
–
Sialoside preferencea
Cell-type expressionb
a3 b4
a6 a4
Tissue macrophages (activated monocytes) 6S
a6
b4
a3
b3
Monocytes, basophils, CD34þ cells, dendritic cells, macrophages, mast cells, neutrophils (granulocytes, myeloid progenitors) Oligodendrocytes, Schwann cells
a8
Neutrophils, monocytes, basophils, CD34þ cells, macrophages, mast cells (B cells)
a6
Siglec-6
–
a6
Siglec-7
–
a8
Siglec-8
Siglec-9
Siglec-F
–
Basophils, mast cells, placental trophoblasts (B cells) a3
b4
6S a3 b4 a3
a3
B cells
b4
NK cells, dendritic cells, monocytes, CD8þ T cells (monocytes) Eosinophils, mast cells (basophils)
6S a3
Monocytes, neutrophils, dendritic cells, CD34þ cells, CD8þ T cells (NK cells) (continued)
Table 17.1 (continued) Siglec (other names)
Murine ortholog or paralog
Siglec-10
Siglec-G
Sialoside preferencea a6 a6
Siglec-11
–
a8
Siglec-14
–
a8
Cell-type expressionb
b4
B cells, CD34þ cells, dendritic cells, monocytes, NK cells (eosinophils)
b4
Monocytes, macrophages, brain microglia Not determined, but expected to be similar to Siglec-5 based on sequence homology
a6
Siglec-15
mSiglec-15
a6
Macrophages, monocytes, dendritic cells
Siglec-16
–
a8
Macrophages (brain microglia)
–
Siglec-E
–
Siglec-H
a3
Key: a
b
NeuAc
NeuGc
Gal
GalNAc
b3 a6
– GlcNAc
Neutrophils, monocytes, dendritic cells Plasmatoid dendritic cells (macrophages)
Fuc
S
Sulfate
Sialoside preferences are taken from recent reviews (Crocker et al., 2007; O’Reilly and Paulson, 2009; von Gunten and Bochner, 2008), data from the Consortium for Functional Glycomics http://www.functionalglycomics.org, or inferred from the binding preferences of highly homologous siglecs. Carbohydrate sequences shown refer to preferences of the human counterparts, with the exception of Siglec-E. Compiled from recent reviews (Crocker et al., 2007; O’Reilly and Paulson, 2009; von Gunten and Bochner, 2008).
Multivalent Ligands for Siglecs
347
intracellular signaling motifs suggest a role in immunomodulation for siglecs, which has been validated for many, though the role of glycan binding is still poorly understood (Crocker and Redelinghuys, 2008).
1.2. Glycan-binding specificity and cell-type expression Synthetic sialoside ligands of siglecs have been developed to probe their function and glycan-binding specificity, and to detect siglecs on different cell types. This chapter will address the detection of siglecs on cells using ligand-based probes, which requires consideration of both cell-type expression and glycan-binding specificity. As shown in Table 17.1, siglecs are expressed on a variety of cells, most of which are immune cells (Crocker et al., 2007; O’Reilly and Paulson, 2009; von Gunten and Bochner, 2008). Certain siglecs, such as CD22 and Siglec-8, are expressed predominantly on one cell type, B cells and eosinophils, respectively. Others can be expressed on several cell types, such as Siglec-9 on monocytes, dendritic cells, and neutrophils. Table 17.1 also shows the preferred glycan(s) for each siglec that has been shown to bind sialic acid. Similar to cellular distribution, some siglecs have strict specificity, while others can bind several different glycan structures. Specificity can be considered from the perspective of the siglec and of the carbohydrate ligand, which may also have one or more cognate binding partners. CD22 is highly specific for sialosides with the a-2,6 linkage, but other more promiscuous siglecs can bind this sialoside as well, precluding specific targeting of this sequence to CD22. The discovery that the preferred ligand of human CD22 includes a sulfate group on the 6-position of GlcNAc may improve the ability to achieve more selective binding (Blixt et al., 2004; Kimura et al., 2007). Siglec-7 exhibits a clear preference for glycans with the NeuAca2,8-NeuAca2,3-Galb1,4-GlcNAc sequence, but also bind NeuAca2,3-Galb1,4-GlcNAc and NeuAca2,6Galb1,4-GlcNAc (O’Reilly and Paulson, unpublished results). Siglec-8, expressed on eosinophils, binds preferentially to 60 -sulfo-sialyl LewisX. As an example of specificity from the perspective of the ligand, a polyacrylamide (PAA) polymer of 60 -sulfo-sialyl LewisX binds selectively to only eosinophils among leukocytes in a sample of whole blood (Hudson et al., 2009). Several labs have explored the use of sialic acid analogs to achieve enhanced binding and selectivity for one siglec over others (Blixt et al., 2008; Chokhawala et al., 2008). A biphenyl substitution at the 9-position of sialic acid was able to enhance the affinity of CD22 for the ligand, NeuAca2,6-Galb1,4-GlcNAc, by 100-fold, for example (Kelm et al., 2002). The use of glycan arrays is greatly accelerating the structure–activity relationship for siglec ligands, although more work is needed before the goal of a specific ligand for each siglec can be achieved.
348
Mary K. O’Reilly and James C. Paulson
1.3. Cis- and trans-ligand binding In nature, siglecs can bind glycans terminating in sialic acid both on the same cell (in cis) or on other cells, glycoproteins, viruses, etc. (in trans). The masking effect of cis ligands on siglecs (Fig. 17.1) has been known since the demonstration that binding of a synthetic multivalent CD22 ligand to CD22 on B cells could be enabled or enhanced by removal of sialic acids from the cell surface or destruction of the sialic acid glycerol side chain, a key binding determinant (Razi and Varki, 1998). While the highest affinities exhibited by siglecs for their preferred ligands is micromolar (Kd) (Bakker et al., 2002), the concentration of sialic acids on the cell is estimated to be in the millimolar range (e.g., 25 mM in the glycocalyx of B-cells (Collins et al., 2004). The endogenous ligands have not been identified for all siglecs, but CD22 has been shown to predominantly bind to the glycans of other molecules of CD22 in cis (Han et al., 2005), and to the B cell receptor, IgM, in trans with other B cells (Ramya et al., 2010). The ability of CD22 to bind glycans on other cells in trans was demonstrated by using fluorescence microscopy to visualize the colocalization of CD22 at the site of cell–cell contact between two B cells (Collins et al., 2004). Importantly, this localization was dependent on the expression of a2,6 sialosides on the trans cell. Binding to glycans in trans on pathogenic organisms has been documented for several siglecs, including HIV-1 to sialoadhesin, Campylobacter jejuni to Siglec-7, Group B Streptococcus to Siglec-9, and Neisseria meningitidis to Siglec-F (Avril et al., 2006; Carlin et al., 2009a,b; Jones
Sialic acid (NeuAc) Man or Gal GlcNAc or GalNAc
PAA probe
Figure 17.1 Schematic of competition between trans ligands and cis ligands of siglecs. Using CD22 as an example, cis ligand binding leads to masking of the ligand-binding site. Only with sufficient avidity (or removal of sialic acids) can trans ligands compete with cis ligands to achieve stable binding at the cell surface.
Multivalent Ligands for Siglecs
349
et al., 2003; Rempel et al., 2008; Severi et al., 2007; van der Kuyl et al., 2007). Presumably, these interactions are influenced by the degree of cis ligand masking, making the composition of cis ligands on the cell surface a possible determinant for recognition of pathogens and the immune response. This scenario highlights the need for ligand-based methods of siglec detection. While specific antibodies can be used to probe cell types for siglec expression, only multivalent ligand-based probes can define the functional availability of siglecs. Many factors are involved in modulation of masking, including expression levels of sialyltransferases and sialidases, as well as enzymes regulating the biosynthesis of underlying glycan structures. An additional level of regulation is achieved by postglycosylational modifications, including sulfation, acetylation, and sialic acid cyclization, which are regulated by other enzymes (Cariappa et al., 2009; Yu and Chen, 2007).
1.4. Multivalent scaffolds for siglec ligands Due to the low affinity of siglec–ligand interactions and competition from cis ligands, multivalency is needed to achieve the avidity required of synthetic ligands (Fig. 17.1). Polymers have provided a convenient scaffold for siglec ligands with defined lengths and substitution densities. Ruthenium-catalyzed olefin metathesis polymerization (ROMP) has been used to prepare polymers of the CD22 ligand to study CD22 function (Courtney et al., 2009; Yang et al., 2002). The study of siglecs and other glycan-binding proteins has drawn heavily on the use of PAA constructed with pendant carbohydrate ligands and biotin groups (Chinarev et al., 2010; Rapoport et al., 2006). This chapter will focus primarily on PAA polymer-based siglec ligands with a brief section on univalent biotinylated ligands because the reagents needed for these methods are readily available, and no further synthesis is required. Other multivalent scaffolds for siglec ligands have been developed more recently, which have the benefit of being more rigid and structurally defined. Viral capsids (e.g., cowpea mosaic virus and bacteriophage Qb) have been chemoenzymatically decorated with a high-affinity CD22 ligand with remarkable control over spacing and valency (Kaltgrad et al., 2008). These were able to bind to CD22 on native B cells. Another system proved that with the proper spacing and geometry, valency becomes less important. A heterobifunctional CD22 ligand bearing a hapten is able to drive the self-assembly of CD22–IgM complexes at the surface of native B cells (O’Reilly et al., 2008). The maximum valency of this complex is 10, and in fact the same ligand was able to mediate stable complex formation between CD22 and the lower valency antibodies, IgA and IgG. For purposes of in vivo drug delivery to specific cell types, liposomes decorated with CD22 ligand and loaded with doxorubicin have been shown to bind and kill native B cells, to prolong life in a murine model of disseminated B cell lymphoma, and to kill malignant B cells in samples taken from lymphoma patients (Chen et al., 2010). Liposomes, viral capsids, and heterobifunctional ligands may also be used to
350
Mary K. O’Reilly and James C. Paulson
probe immune cells as described herein, but given the labor-intensive preparation of these alternate platforms, it is more practical to use the available PAA or biotinylated probes. Finally, glycan arrays are commonly used to probe the binding specificity of glycan-binding proteins such as siglecs (Blixt et al., 2004, 2008; Bochner et al., 2005). The analogous experiment described in this chapter would be soluble siglec-Fc binding to PAA probes immobilized on magnetic beads. The glycan array may be preferred for a broad screening due to the highthroughput nature and the relatively miniscule amounts of glycan required. However, the array has not yet been optimized for screening of siglec-expressing cells, and it is often desirable to investigate siglecs in a more native-like environment, considering such effects as lateral mobility and masking by cis ligands.
2. Materials and Methods 2.1. Reagents and cells Siglec-expressing cells can be primary cells from human or murine origin, cell lines that natively express siglecs, or cells transfected with siglecs, most commonly CHO cells. Some commonly used B cell lines used to probe CD22 include BJAB, Daudi, and Raji, all of which are maintained in RPMI media containing 10% fetal bovine serum (FBS). The BJAB (K20) cell line is of particular interest due to a mutation in an epimerase that is required to synthesize sialic acid (Hinderlich et al., 2001). Growing BJAB (K20) cells in serum-free media results in asialo cells that thus lack cis ligands of CD22. To wean BJAB (K20) cells off of serum, cells are initially grown in RPMI containing 10% FBS and 50 mM 2-mercaptoethanol, and then switched to half of the previous media and half serum-free HYQ-SFM medium for 2 days, replacing with fresh media every day, and then replacing with 100% serumfree HYQ-SFM. Cells become semiadherent, and 2 mM EDTA can be used to dislodge cells. At this point media is changed daily. Many of the siglecs have also been cloned and stably transfected into CHO cells as a convenient and comparable model for studying in situ siglec function (Khatua et al., 2010; Munday et al., 2001; Tateno et al., 2007). These are grown in 1:1 DMEM:F12, 10% FBS, and, if cloned as previously described, 250 mg/mL Hygromycin B (Roche Diagnostics). As this is an adherent cell line, Trypsin/EDTA should be used to dislodge the cells for passaging, but only 2 mM EDTA should be used to harvest cells for experiments, as trypsin will degrade cell-surface proteins. It should be noted that CHO cells do not express appreciable amounts of a2-6 sialosides. CD22 on CHO cells is therefore unmasked and removal of cis ligands is unnecessary. Siglec-Fc chimerae are also a common source of siglecs, and represent truncated fusions of the siglecs that comprise part of the extracellular portion of the siglec, including the entire N-terminal V-set carbohydrate-binding domain, and an IgG constant fragment (Fc) at the C-terminus.
Multivalent Ligands for Siglecs
351
The Fc domain dimerizes, which provides bivalency to the siglec, while it also enables detection, complexation, and/or immobilization of the siglec by using anti-IgG antibodies. These constructs can be expressed in COS cells as previously described (Nath et al., 1995; van der Merwe et al., 1996; Vinson et al., 1996). Alternatively, many siglec-Fc fusions are commercially available from R&D Systems. Both biotinylated PAA probes and biotinylated univalent ligands are commercially available from Glycotech (Gaithersburg, MD) or can be requested by participating investigators from the Consortium for Functional Glycomics (http://www.functionalglycomics.edu). PAA probes are water soluble and can be stored in solution for months to years at 4 C or below. Extended storage can lead to precipitation, in which case the probe can be coaxed back into solution with gentle mixing and/or warming. PAA probes obtained from the Consortium for Functional Glycomics are substituted with 20 mol% carbohydrate ligands and 5 mol% biotin. Many are available as either a low molecular weight version (30 kDa) or a high molecular weight version (1500 kDa). Glycotech probes are provided as 30-kDa polymers in which typically every 5th amide is substituted with biotin in a 4:1 ratio. In principle, PAA probes could be precomplexed with streptavidin prior to the binding. On one hand, this may greatly increase valency if multiple polymer chains are cross-linked by the tetravalent streptavidin. On the other hand, precomplexation may greatly restrict the degrees of freedom available to the polymer backbone. The diminished flexibility of the chain may dampen the ability to bind its cognate siglec. This effect may be particularly important if the siglec does not have lateral mobility, such as recombinant siglec immobilized on beads, or even on cells at 4 C. Another consideration of precomplexation of the probe is that it is likely that if PAA probes can be sufficiently cross-linked with streptavidin, the complex may be too large to be internalized by CD22 via clathrin-dependent endocytosis, enabling binding assays at 37 C without the complication of internalization.
2.2. Preparation of siglec-expressing cells Due to the high concentration of sialosides at the cell surface, siglecs are constitutively bound by neighboring ligands residing on the same cell surface (cis ligands). One notable exception to this is sialoadhesin, which, because of 17 extracellular Ig-domains, extends beyond the cellular glycocalyx and is thought to be the only unmasked siglec. Synthetic multivalent ligands have been designed that can compete with these cis ligands to achieve stable binding to siglecs on the cell surface, but for purposes of siglec detection, removal of these ligands may in some cases be desirable or necessary. Two simple methods are available to achieve this purpose, and include removal of sialic acid with neuraminidases, and destruction of the glycerol side chain of sialic acid by periodate oxidation.
352
Mary K. O’Reilly and James C. Paulson
A commonly used neuraminidase for the purpose of removing cis ligands is the Arthrobacter ureafaciens sialidase (AUS), which is available from Roche. Cells are suspended in Hank’s Balanced Salt Solution (Gibco) containing 5 mg/mL bovine serum albumin (Sigma) (HBSS/BSA) at a density of 0.2–1 107 cells/mL. AUS is then added to a final concentration of 200 mU/mL and the cells are incubated at 37 C for 30 min. After washing twice with cold HBSS/BSA, cells are ready for probing with the exogenous ligand. Periodate oxidation is another convenient method to destroy cis ligands. Cells are resuspended in 1 106/mL, and 1 mM sodium periodate (SigmaAldrich, cat. no. 311448) is added from a 200 mM stock solution in water. Cells are incubated at 4 C for 10 min before quenching the reaction by adding equimolar glycerol. After washing the cells twice in cold HBSS/ BSA, they are ready for analysis. An important consideration for subsequent use of periodate-oxidized cells is that this treatment only addresses glycans that are located on the cell surface at the time of treatment, since periodate is cell-impermeable at 4 C. Due to the rapid turnover of the cell surface, there is a constant replenishment of glycoproteins and glycolipids from de novo biosynthesis and recycling from intracellular compartments. Even a brief warming of the cells to 37 C could lead to a significant repopulation of cis ligands at the cell surface. While this effect may be less of a concern after sialidase treatment, which is done at 37 C and could address rapidly recycling factors as they reach the cell surface, it is still a consideration for newly emerging glycans.
2.3. PAA probe to siglec-expressing cells When staining siglec-expressing cells with ligand-conjugated PAA probes, there are several considerations. If the lower molecular weight polymer is being used, then cells will most likely need to be treated with sialidase or periodate, unless the cells are devoid of cis ligands, as is the case of CD22 expressed on CHO cells. For example, eosinophils and Siglec-F expressing CHO cells had to be pretreated with sialidase to achieve binding of a 30kDa polymer of 60 -sulfo-sialyl LewisX, while the high-molecular-weight polymer could bind both treated and untreated cells (Fig. 17.2). Another consideration is the intrinsic affinity of the ligand. For example, NeuGcLacNAc-PAA that is not substituted with the affinity-enhancing BPA group at the 9 position does not bind to CD22 on native B cells even if it is incorporated into a high molecular weight polymer (Fig. 17.3). These data also show that the binding of the native ligands is much more sensitive to the masking effect of cis ligands compared to the high-affinity versions. While modest binding of the NeuGc probe to native murine B cells has since been observed, the BPA-substituted version is a much more robust binding partner (Duong et al., 2010). In the latter example, a lower
353
Multivalent Ligands for Siglecs
300
SigF-CHO 30 kDa
0
0
30 kDa
102
103
104
100
101
300
101
300
100
1000 kDa
102
103
104
1000 kDa
0
0
Cell number
300
Eosinophils
100 Key:
101
102 Control
103
104
100 101 x 6′-Sulfo-sLe -PAA Native cells
102
103
104
Asialo cells
Figure 17.2 PAA probe binding to siglec-expressing cells reveals importance of valency. 60 -sulfo-sialyl-Lewisx-PAA of low molecular weight (30 kDa, approximately 15-mer) or high molecular weight (1000 kDa, approximately 500-mer) was incubated with eosinophils, which express Siglec-F, or CHO cells transfected with Siglec-F. Asialo cells were prepared by pretreatment of native cells with sialidase (Tateno et al., 2007). Reproduced with permission from the American Society of Microbiology.
concentration of probe was used (1.25 mg/mL). Thus, some optimization may be advantageous for each siglec-probe combination. 1. Check that no precipitation of the polymer has occurred, and if it has, pipet the solution up and down to redissolve the polymer. 2. Wash and resuspend cells at a density of 2 106 mL 1 in 100 mL of HBSS/BSA. 3. Add 0.1–1 mg of polymer for a final probe concentration of 1–10 mg/mL. 4. Incubate at 4 C for 1 h with end-over-end rotation or occasional mixing. 5. Pellet cells by centrifugation in an Eppendorf centrifuge (5415D or similar model) at 2000 rpm for 5 min at 4 C. 6. Wash cells with 1 mL ice-cold HBSS/BSA twice, pelleting after each wash as in step 5. 7. Resuspend in 100 mL of HBSS/BSA. 8. Add 1 mL of DTAF-Streptavidin ( Jackson Laboratories, catalog # 016010-084) and incubate at 4 C for 30 min. 9. Wash away unbound streptavidin with HBSS/BSA as above.
354
Mary K. O’Reilly and James C. Paulson
A
B 80
Murine B cells
100
103
0
70 140 210 280
101 102 NeuAc-PAA
100
101
102
103
Cell number 0 10 20 30 40 50 60 70 80 0 20
40
60
Cell number 0 70 140 210 280
BJAB
101 102 BPA-NeuGc-PAA
BPC-NeuAc-PAA Key:
Background
101 102 NeuGc-PAA
Native
103
103
Asialo
Figure 17.3 High-affinity PAA probe binding to siglec-expressing cells shows the importance of intrinsic affinity in overcoming cis ligands. A human BJAB B cell line (A) or murine B cells (B) were probed with native (NeuAc(Gc)a2,6-LacNAc-) or high-affinity BPC(BPA) NeuAc(Gc)a2,6-LacNAc- ligands appended to PAA (Collins et al., 2006). Reproduced with permission from the Journal of Immunology.
10. Resuspend cells in 200 mL HBSS/BSA. 11. Analyze by flow cytometry (10,000 cells/sample). It is important that these experiments be carried out at 4 C to prevent endocytosis, which would cause internalization of the probe and thus an underestimation of binding. Alternatively, if performing the experiment at 37 C is desired, maintaining the cells in hypertonic media will prevent endocytosis by preventing the formation of clathrin-coated pits (Heuser and Anderson, 1989). We should note, however, that this method only affects siglecs that undergo clathrin-dependent internalization. Siglec-F, for example, is endocytosed by a clathrin-independent mechanism (Tateno et al., 2007), and the mechanism for many others is not yet known. Cells are first incubated for 45 min at 37 C in media or buffer containing 0.45 M sucrose, then washed twice with the same sucrose-containing media at 4 C. Since this inhibitory effect is reversible, cells must be kept in this high concentration of sucrose throughout the experiment. We have shown that this
Multivalent Ligands for Siglecs
355
environment does not affect CD22 binding to synthetic multivalent ligands (O’Reilly and Paulson, unpublished observations).
2.4. PAA probes to siglec-Fc beads While there are certain advantages to testing the binding of glycans to siglecs in their native environment, it can also be useful to examine specificity by using recombinant siglec-Fc fusion proteins, which enables a quantitative measure without the complexity of the cellular environment. This section will discuss immobilized siglec-Fc, while Section 2.5 will describe its use in the soluble form. Commercially available magnetic beads conjugated to Protein A (DynabeadsÒ Protein A for Immunoprecipitation, Cat. No. 100-01, Invitrogen) are used for immobilization through the Fc portion. These beads have a capacity of approximately 8 mg human IgG per milligram of beads, and are supplied as 30 mg/mL. Either purified siglec-Fc or culture supernatant from siglec-Fc expressing COS cells is applied to Protein A beads for immobilization as previously described (O’Reilly et al., 2008). One advantage of this method is that a siglec-Fc purification step is built in. In fact, it may be preferable to use culture media from siglec-Fc expressing cells to load the beads if these are available because the conditions used to purify the fusion protein can lead to loss of binding activity. This direct method negates the harsh elution step. These beads can then be probed with the carbohydrate-conjugated PAA probes as described for siglec-expressing cells in Section 2.3, except that instead of using centrifugation for the washing steps, beads are isolated using a magnetic tube rack (MagneSphereÒ Technology Magnetic Separation Stand (12-position), catalog # Z5342, Promega). Using beads as a model for siglec-expressing cells has the benefit of removing complications due to both cis ligands and siglec endocytosis at elevated temperatures. Therefore, binding can be examined at a variety of temperatures. This was done using hCD22-coated beads and BPCNeuAcLacNAc-PAA, revealing that at least for these interacting partners, binding may be improved at elevated temperatures (Fig. 17.4). Using beads therefore may be a way to achieve binding where binding to cells at 4 C is not observed. Because PAA probes are not very structurally well defined, increased temperatures may help the polymer to overcome any secondary structure and increase the opportunity for favorable binding. Another advantage of using beads is that very long incubations are possible to ensure that binding has reached equilibrium. Long incubations may compromise the integrity of cells or cause other unknown changes. Disadvantages include lack of lateral mobility of siglecs. When analyzing the binding of probes to beads by flow cytometry, we have noticed that the predominant population by dot plot (forward scatter vs. side scatter) is accompanied by a series of less abundant populations with
356
Mary K. O’Reilly and James C. Paulson
100
% of max
80 60 40 20 0 100
101 102 103 Streptavidin (DTAF)
104
LacNAc-PAA, 4 ⬚C BPCNeuAc-LacNAc-PAA,
4 ⬚C
LacNAc-PAA, 37 ⬚C BPCNeuAc-LacNAc-PAA,
37 ⬚C
Figure 17.4 Siglec-Fc beads enable binding at elevated temperature without endocytosis to reveal improved binding. Human CD22–Fc beads were probed with high molecular weight LacNAc-PAA or BPCNeuAca2,6-LacNAc-PAA at 4 or 37 C for 16 h.
increasing forward and side scatter. The abundance of each population decreases with increasing scattering properties, and the degree to which this effect occurs seems to correlate with the amount of ligand bound. It is possible that the multivalent ligands can cross-link beads to change their light scattering properties, though this effect has not been further investigated.
2.5. Siglec-Fc to PAA probe beads As opposed to immobilizing the siglec, the reverse experiment can be carried out by immobilizing the PAA probe. With this method, it is important to realize that despite the bivalency of the siglec-Fc, we do not observe any binding unless the siglec-Fc is precomplexed with the secondary antibody, FITC-anti-human IgG. Figure 17.5 gives the example of Siglec-7 binding to beads coated with NeuAca2,8-NeuAca2,3-LacNAcPAA, but this principle applies to each siglec-Fc that we have tested. Precomplexation leads to greater valency due to crosslinking of at least two, but possibly many more, siglec chimera dimers, depending on the isotype of the secondary antibody. In practice, precomplexation is not performed as a separate step, but rather by adding the secondary antibody and siglec-Fc simultaneously to PAA beads.
357
Multivalent Ligands for Siglecs
Control PAA beads
100
Ligand-PAA beads
80 60 40
2-Step, no precomplexed % of max
20 0 100 80 60 1-Step, precomplexed
40 20 0 100
101
102 103 Siglec-7-Fc
104
Figure 17.5 Precomplexation of Siglec-Fc is key to engaging with ligand–PAA-coated beads. Siglec-7-Fc from culture supernatant was incubated with streptavidin beads coated with unsubstituted PAA or NeuAca2,8-NeuAca2,3-Galb1,4-GlcNAc-PAA, either in the absence (top, 2-step) or presence (botton, 1-step) of the detection antibody, FITC-antihuman IgG. For the 2-step method (top), unbound probe was washed away prior to adding the detection antibody.
1. Remove a 5-mL aliquot (3–3.5 106 beads) of streptavidin-coated Dynal microbeads (DynabeadsÒ M-280 Streptavidin Cat. No. 112-05D, Invitrogen) and wash with HBSS/BSA. 2. Add 6 mg of PAA probe in 0.5 mL HBSS/BSA and incubate at 25 C for 1 h. 3. Wash beads twice using magnetic stand with 1 mL HBSS/BSA and resuspend in 50 mL. 4. Combine 2 mL of beads with 50 mL of culture supernatant from siglec-Fc expressing cells and 1 mL of FITC-antihuman IgG (Jackson Immunoresearch, cat. no. 109-095-098). 5. Incubate at 4 C with end-over-end rotation for 30 min. 6. Isolate beads using a magnetic stand and wash twice with 1 mL HBSS/BSA. 7. Resuspend beads with 200 mL HBSS/BSA and analyze bead fluorescence by flow cytometry (10,000 beads/sample).
358
Mary K. O’Reilly and James C. Paulson
2.6. Siglec-Fc to biotinylated free saccharide-coated beads Similar to immobilizing the PAA probe to streptavidin beads, free ligands conjugated to biotin can also be used to load streptavidin beads, and these reagents are available both commercially and from the Consortium for Functional Glycomics. Like the PAA-loaded beads, this platform provides high valency. It differs from PAA-loaded beads in certain ways that may be desirable for some applications. For instance, titrating in free biotin can govern the loading of the bead, and thus the avidity (Fig. 17.6). PAA probes, on the other hand, are not as easy to control in terms of valency. Because of the effectively irreversible binding of biotin to streptavidin, the polymers may become trapped in conformations with unknown numbers of ligands being accessible for siglec binding. For competition assays with free inhibitor, lower avidity may be desired, whereas higher avidity may be needed in other circumstances to achieve measurable binding. Also, biotinylated free ligands are easier to access synthetically, so candidate ligands could be tested without having to synthesize the entire polymer. The procedure used to analyze siglec binding in the experiment shown in Fig. 17.6 is as follows, and can be modified to use different ligands, siglecs, and loading densities. 1. Retrieve a 20-mL aliquot of Dynamax beads (Invitrogen). 2. Wash twice with 1 mL of PBS, using the magnetic eppendorf rack to collect the beads. 100
% of max
80 60 40 20 0 100
101
102 103 Siglec-E-Fc
104
Control
15 pmol biotin
No biotin
50 pmol biotin
Figure 17.6 Tuning the density of biotinylated ligand-coated beads to modulate avidity of siglec-Fc binding. Streptavidin beads were coated with biotinylated NeuAca2,8NeuAca2,3-Galb1,4-GlcNAc after pretreatment of beads with varying concentrations of free biotin to adjust the density of carbohydrate ligands. Beads were then probed with siglec-E-Fc from culture supernatant in the presence of the detection antibody, FITCantihuman IgG. Control beads had neither biotin nor ligand.
Multivalent Ligands for Siglecs
359
3. Resuspend in 0.4 mL of PBS and remove four 100-mL aliquots. 4. Add 0, 5, 15, or 50 pmol, respectively, of 5-(biotinamido)pentylamine from a 50 mM stock in PBS. 5. Incubate for 1 h at 25 C with end-over-end rotation. 6. Wash each sample twice with 1 mL HBSS/BSA. 7. Resuspend each in 50 mL HBSS/BSA. 8. Add 1 mL of biotinylated ligand (from 55 mM stock) and incubate for 1 h at 25 C with end-over-end rotation. 9. Wash each sample twice with 1 mL HBSS/BSA. 10. Resuspend each in 50 mL HBSS/BSA. 11. Add 5-mL aliquots of beads to 200-mL aliquots of culture supernatant from siglec-Fc-expressing cells. 12. Immediately add 4 mL of FITC-antihuman-IgG and incubate at 4 C for 30 min with end-over-end rotation. 13. Wash each sample twice with HBSS/BSA. 14. Resuspend beads in 200-mL aliquots of HBSS/BSA and analyze by flow cytometry (10,000 beads/sample).
2.7. CHO-Siglec cells to PAA probe beads Higher ligand valency may be achieved by coating synthetic beads with the PAA probe of interest. Combining these beads with cells may prove a better model for cell–cell adhesion than soluble probes. This method has the advantage of providing very high valency for both ligand and siglec. Microscopy can then be used to visualize the cell–bead interactions. This method may also be of interest for experiments done at elevated temperatures. At 37 C, most siglecs will undergo clathrin-dependent or independent endocytosis, transporting the ligand inside the cell. We have observed that with a sufficiently large ligand scaffold, such as a highly cross-linked anti-NP IgM, internalization is precluded (O’Reilly and Paulson, unpublished observations). The procedure for PAA bead–cell adhesion has been published previously, and was used to demonstrate bead-bound BPANeuGc-PAA binding to murine B cells (Fig. 17.7) (Collins et al., 2006). These results are consistent with the free probe-binding results shown in Fig. 17.3. Therefore, as an alternative, the PAA probe can be bound to the cells first, followed by washing and then exposure to the streptavidin-coated magnetic beads. This procedure has also been described (Collins et al., 2006).
3. Conclusions and Future Directions Discovery of ligand analogs with enhanced affinity and selectivity will improve the precision with which siglecs can be studied. Substituents at various positions, most commonly the 5 and 9 positions of sialic acid,
360
Mary K. O’Reilly and James C. Paulson
30 kDa
1000 kDa
NeuGc-PAA
BPA-NeuGc-PAA
Figure 17.7 High-affinity ligand is required for adhesion between PAA-coated beads and CD22-expressing cells. Streptavidin beads coated with 30 or 1000 kDa versions of NeuGca2,6-LacNAc-PAA or BPANeuGca2,6-LacNAc-PAA were exposed to primary murine B cells (Collins et al., 2006). Reproduced with permission from the Journal of Immunology.
have been shown to enhance or diminish siglec affinity, thus setting the stage to develop ligands with a high degree of selectivity for specific siglecs (Blixt et al., 2008; Chokhawala et al., 2008). These tools will enable improved detection and targeting of siglecs in complex biological systems. Depending on the application, different permutations of carbohydrate probe and siglec immobilization will serve different needs for the detection and analysis of siglecs in their native environment. Siglecs are already considered targets for immunotherapy of cancers, autoimmunity, and other inflammatory disorders (O’Reilly and Paulson, 2009). With the continued development of selective probes will come improved methods for assessing changes in the availability of siglec binding sites on different cells and under different conditions (i.e., transformed cells, microenvironments of inflammation, etc.). This can in turn lead to enhanced targeting strategies using glycan-based drug delivery vehicles. These probes will also be useful for investigating the innate functions of siglecs and the contribution of glycan binding.
ACKNOWLEDGMENTS The authors wish to thank Anna Tran-Crie for her assistance in preparation of the manuscript, and Cory Rillahan, Dr. Hua Tian, and Dr. Christoph Rademacher for careful reading of the manuscript and helpful suggestions. This work was supported by NIH R01AI050143 & R01GM60938 to J. C. P., and an American Cancer Society postdoctoral fellowship to M. K. O.
Multivalent Ligands for Siglecs
361
REFERENCES Angata, T. (2006). Molecular diversity and evolution of the Siglec family of cell-surface lectins. Mol. Divers. 10, 555–566. Avril, T., Wagner, E. R., Willison, H. J., and Crocker, P. R. (2006). Sialic acid-binding immunoglobulin-like lectin 7 mediates selective recognition of sialylated glycans expressed on Campylobacter jejuni lipooligosaccharides. Infect. Immun. 74, 4133–4141. Bakker, T. R., Piperi, C., Davies, E. A., and Merwe, P. A. (2002). Comparison of CD22 binding to native CD45 and synthetic oligosaccharide. Eur. J. Immunol. 32, 1924–1932. Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., et al. (2004). Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc. Natl. Acad. Sci. USA 101, 17033–17038. Blixt, O., Han, S., Liao, L., Zeng, Y., Hoffmann, J., Futakawa, S., and Paulson, J. C. (2008). Sialoside analogue arrays for rapid identification of high affinity siglec ligands. J. Am. Chem. Soc. 130, 6680–6681. Bochner, B. S., Alvarez, R. A., Mehta, P., Bovin, N. V., Blixt, O., White, J. R., and Schnaar, R. L. (2005). Glycan array screening reveals a candidate ligand for Siglec-8. J. Biol. Chem. 280, 4307–4312. Cariappa, A., Takematsu, H., Liu, H., Diaz, S., Haider, K., Boboila, C., Kalloo, G., Connole, M., Shi, H. N., Varki, N., Varki, A., and Pillai, S. (2009). B Cell antigen receptor signal strength and peripheral B cell development are regulated by a 9-O-acetyl sialic acid esterase. J. Exp. Med. 206, 125–138. Carlin, A. F., Chang, Y. C., Areschoug, T., Lindahl, G., Hurtado-Ziola, N., King, C. C., Varki, A., and Nizet, V. (2009a). Group B Streptococcus suppression of phagocyte functions by protein-mediated engagement of human Siglec-5. J. Exp. Med. 206, 1691–1699. Carlin, A. F., Uchiyama, S., Chang, Y. C., Lewis, A. L., Nizet, V., and Varki, A. (2009b). Molecular mimicry of host sialylated glycans allows a bacterial pathogen to engage neutrophil Siglec-9 and dampen the innate immune response. Blood 113, 3333–3336. Chen, W. C., Completo, G. C., Sigal, D. S., Crocker, P. R., Saven, A., and Paulson, J. C. (2010). In vivo targeting of B-cell lymphoma with glycan ligands of CD22. Blood 115, 4778–4786. Chinarev, A. A., Galanina, O. E., and Bovin, N. V. (2010). Biotinylated multivalent glycoconjugates for surface coating. Methods Mol. Biol. 600, 67–78. Chokhawala, H. A., Huang, S., Lau, K., Yu, H., Cheng, J., Thon, V., Hurtado-Ziola, N., Guerrero, J. A., Varki, A., and Chen, X. (2008). Combinatorial chemoenzymatic synthesis and high-throughput screening of sialosides. ACS Chem. Biol. 3, 567–576. Collins, B. E., Blixt, O., DeSieno, A. R., Bovin, N., Marth, J. D., and Paulson, J. C. (2004). Masking of CD22 by cis ligands does not prevent redistribution of CD22 to sites of cell contact. Proc. Natl. Acad. Sci. USA 101, 6104–6109. Collins, B. E., Blixt, O., Han, S., Duong, B., Li, H., Nathan, J. K., Bovin, N., and Paulson, J. C. (2006). High-affinity ligand probes of CD22 overcome the threshold set by cis ligands to allow for binding, endocytosis, and killing of B cells. J. Immunol. 177, 2994–3003. Courtney, A. H., Puffer, E. B., Pontrello, J. K., Yang, Z. Q., and Kiessling, L. L. (2009). Sialylated multivalent antigens engage CD22 in trans and inhibit B cell activation. Proc. Natl. Acad. Sci. USA 106, 2500–2505. Crocker, P. R., and Redelinghuys, P. (2008). Siglecs as positive and negative regulators of the immune system. Biochem. Soc. Trans. 36, 1467–1471. Crocker, P. R., Paulson, J. C., and Varki, A. (2007). Siglecs their roles in the immune system. Nat. Rev. Immunol. 7, 255–266.
362
Mary K. O’Reilly and James C. Paulson
Duong, B. H., Tian, H., Ota, T., Completo, G., Han, S., Vela, J. L., Ota, M., Kubitz, M., Bovin, N., Paulson, J., and Nemazee, D. (2010). Decoration of T-independent antigen with ligands for CD22 and Siglec-G can suppress immunity and induce B cell tolerance in vivo. J. Exp. Med. 207, 173–187S1–S4. Han, S., Collins, B. E., Bengtson, P., and Paulson, J. C. (2005). Homomultimeric complexes of CD22 in B cells revealed by protein-glycan cross-linking. Nat. Chem. Biol. 1, 93–97. Heuser, J. E., and Anderson, R. G. (1989). Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J. Cell Biol. 108, 389–400. Hinderlich, S., Berger, M., Keppler, O. T., Pawlita, M., and Reutter, W. (2001). Biosynthesis of N-acetylneuraminic acid in cells lacking UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. Biol. Chem. 382, 291–297. Hudson, S. A., Bovin, N. V., Schnaar, R. L., Crocker, P. R., and Bochner, B. S. (2009). Eosinophil-selective binding and proapoptotic effect in vitro of a synthetic Siglec-8 ligand, polymeric 6’-sulfated sialyl Lewis x. J. Pharmacol. Exp. Ther. 330, 608–612. Jones, C., Virji, M., and Crocker, P. R. (2003). Recognition of sialylated meningococcal lipopolysaccharide by siglecs expressed on myeloid cells leads to enhanced bacterial uptake. Mol. Microbiol. 49, 1213–1225. Kaltgrad, E., O’Reilly, M. K., Liao, L., Han, S., Paulson, J. C., and Finn, M. G. (2008). On-virus construction of polyvalent glycan ligands for cell-surface receptors. J. Am. Chem. Soc. 130, 4578–4579. Kelm, S., Gerlach, J., Brossmer, R., Danzer, C. P., and Nitschke, L. (2002). The ligandbinding domain of CD22 is needed for inhibition of the B cell receptor signal, as demonstrated by a novel human CD22-specific inhibitor compound. J. Exp. Med. 195, 1207–1213. Khatua, B., Ghoshal, A., Bhattacharya, K., Mandal, C., Saha, B., and Crocker, P. R. (2010). Sialic acids acquired by Pseudomonas aeruginosa are involved in reduced complement deposition and siglec mediated host-cell recognition. FEBS Lett. 584, 555–561. Kimura, N., Ohmori, K., Miyazaki, K., Izawa, M., Matsuzaki, Y., Yasuda, Y., Takematsu, H., Kozutsumi, Y., Moriyama, A., and Kannagi, R. (2007). Human B-lymphocytes express alpha2–6-sialylated 6-sulfo-N-acetyllactosamine serving as a preferred ligand for CD22/ Siglec-2. J. Biol. Chem. 282, 32200–32207. Munday, J., Kerr, S., Ni, J., Cornish, A. L., Zhang, J. Q., Nicoll, G., Floyd, H., Mattei, M. G., Moore, P., Liu, D., and Crocker, P. R. (2001). Identification, characterization and leucocyte expression of Siglec-10, a novel human sialic acid-binding receptor. Biochem. J. 355, 489–497. Nath, D., van der Merwe, P. A., Kelm, S., Bradfield, P., and Crocker, P. R. (1995). The amino-terminal immunoglobulin-like domain of sialoadhesin contains the sialic acid binding site. Comparison with CD22. J. Biol. Chem. 270, 26184–26191. O’Reilly, M. K., Collins, B. E., Han, S., Liao, L., Rillahan, C., Kitov, P. I., Bundle, D. R., and Paulson, J. C. (2008). Bifunctional CD22 ligands use multimeric immunoglobulins as protein scaffolds in assembly of immune complexes on B cells. J. Am. Chem. Soc. 130, 7736–7745. O’Reilly, M. K., and Paulson, J. C. (2009). Siglecs as targets for therapy in immune-cellmediated disease. Trends Pharmacol. Sci. 30, 240–248. Ramya, T. N., Weerapana, E., Liao, L., Zeng, Y., Tateno, H., Yates, J. R., III, Cravatt, B. F., and Paulson, J. C. (2010). In situ trans ligands of CD22 identified by glycan-protein photocross-linking-enabled proteomics. Mol. Cell Proteomics 9, 1339–1351. Rapoport, E. M., Pazynina, G. V., Sablina, M. A., Crocker, P. R., and Bovin, N. V. (2006). Probing sialic acid binding Ig-like lectins (siglecs) with sulfated oligosaccharides. Biochemistry (Mosc) 71, 496–504. Razi, N., and Varki, A. (1998). Masking and unmasking of the sialic acid-binding lectin activity of CD22 (Siglec-2) on B lymphocytes. Proc. Natl. Acad. Sci. USA 95, 7469–7474.
Multivalent Ligands for Siglecs
363
Rempel, H., Calosing, C., Sun, B., and Pulliam, L. (2008). Sialoadhesin expressed on IFNinduced monocytes binds HIV-1 and enhances infectivity. PLoS One 3, e1967. Severi, E., Hood, D. W., and Thomas, G. H. (2007). Sialic acid utilization by bacterial pathogens. Microbiology 153, 2817–2822. Tateno, H., Li, H., Schur, M. J., Bovin, N., Crocker, P. R., Wakarchuk, W. W., and Paulson, J. C. (2007). Distinct endocytic mechanisms of CD22 (Siglec-2) and Siglec-F reflect roles in cell signaling and innate immunity. Mol. Cell Biol. 27, 5699–5710. van der Kuyl, A. C., van den Burg, R., Zorgdrager, F., Groot, F., Berkhout, B., and Cornelissen, M. (2007). Sialoadhesin (CD169) expression in CD14+ cells is upregulated early after HIV-1 infection and increases during disease progression. PLoS One 2, e257. van der Merwe, P. A., Crocker, P. R., Vinson, M., Barclay, A. N., Schauer, R., and Kelm, S. (1996). Localization of the putative sialic acid-binding site on the immunoglobulin superfamily cell-surface molecule CD22. J. Biol. Chem. 271, 9273–9280. Vinson, M., van der Merwe, P. A., Kelm, S., May, A., Jones, E. Y., and Crocker, P. R. (1996). Characterization of the sialic acid-binding site in sialoadhesin by site-directed mutagenesis. J. Biol. Chem. 271, 9267–9272. von Gunten, S., and Bochner, B. S. (2008). Basic and clinical immunology of Siglecs. Ann. NY. Acad. Sci. 1143, 61–82. Yang, Z. Q., Puffer, E. B., Pontrello, J. K., and Kiessling, L. L. (2002). Synthesis of a multivalent display of a CD22-binding trisaccharide. Carbohydr. Res. 337, 1605–1613. Yu, H., and Chen, X. (2007). Carbohydrate post-glycosylational modifications. Org. Biomol. Chem. 5, 865–872.
C H A P T E R
E I G H T E E N
Intramolecular Glycan–Protein Interactions in Glycoproteins Adam W. Barb,* Andrew J. Borgert,† Mian Liu,* George Barany,‡ and David Live* Contents 365 367 374 382 382
1. Introduction 2. O-Linked Glycoproteins 3. N-Linked Glycoproteins Acknowledgments References
Abstract Glycoproteins are a major class of glycoconjugates displaying a variety of mutual interactions between glycan and protein moieties that ultimately affect molecular organization. Modulation of the pendant glycan structures is important in tuning the functions of glycoproteins. Here we discuss structural aspects and some of the challenges to studying intramolecular interactions between carbohydrate and protein elements in several forms of O-linked as well as Nlinked glycoproteins. These illustrate the importance of the relationship of context to function in protein glycosylation.
1. Introduction The challenges of glycomics are formidable, considering the diversity of oligosaccharides that arise from the large number of constituent determinants (Cummings, 2009). In addition, carbohydrates are often found in combination with other molecular structures, further elaborating the complexity (van Kooyk and Rabinovich, 2008). Glycoproteins may represent the most diverse category of glycoconjugates, particularly in light of the estimate that over half of all mammalian proteins carry glycans (Apweiler * Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA Center for Magnetic Resonance Research, University of Minnesota, Minneapolis, Minnesota, USA Department of Chemistry, University of Minnesota, Minneapolis, Minnesota, USA
{ {
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78018-6
#
2010 Elsevier Inc. All rights reserved.
365
366
Adam W. Barb et al.
et al., 1999). Further, the glycans associated with a specific protein may vary over time with physiological states of cells and tissues (Ohtsubo and Marth, 2006). The intricate processes of posttranslational glycosylation in both assembly and remodeling of the glycans also introduce a degree of microheterogeneity in natural mature glycoproteins even when these are isolated from a single source (Rich and Withers, 2009). The complex mixtures obtained from natural sources have presented difficulties in studies of glycoproteins and in understanding the intramolecular relationships between carbohydrate and protein moieties in glycoproteins. Such associations do, however, have an impact on the distinct properties and functions of a glycoprotein, particularly their recognition, and therefore on functional glycomics. In this chapter, we address aspects of these intramolecular relationships. The increasing interest in conformational aspects of glycopeptides and glycoproteins is reflected in a recent review on the subject (Meyer and Moller, 2007). For the most part, the glycosylation modifications of proteins fall into two classes, N-linked, where the glycan is joined to the protein through the side chain amide of an Asn residue, or O-linked, using the hydroxyl of a Ser or Thr residue (Varki et al., 2009). The N-linked glycosylation occurs cotranslationally through the transfer of a preassembled common oligosaccharide core to the side chain Asn nitrogen, in the consensus sequence Asn-Xaa-Ser/Thr (where Xaa is any residue except Pro) on the growing polypeptide chain, connected through a b-GlcNAc residue. Thus, the residues closest to the linkage site are constant, even though the more distal residues can vary. O-linked glycans are assembled in a stepwise manner on the protein, and are more varied in protein sequence context, in linking glycan, and in glycan composition. Mucin glycosylation is initiated with an a-O-GalNAc (Ten Hagen et al., 2003), although the importance of Oglycans based on other linkages, such as a-O-Man (Barresi and Campbell, 2006; Chai et al., 1999) and modifications of a single b-O-GlcNAc (Whelan and Hart, 2006), has been recognized recently. Proteoglycans are also a significant class of O-linked glycoproteins, characterized by long carbohydrate chains linked to the protein backbone through a xylose, with the proportion of long carbohydrate polymers overwhelming the protein. Due to the absence of significant three-dimensional structural data for this latter class, this will not be discussed here. The significant chemical structural differences of the two major types of linkages impact the intramolecular interactions between glycan and protein components. For N-linked glycans, the point of linkage is three bonds removed from the polypeptide backbone. Additionally, the b stereochemistry of the glycosidic linkage directs the glycan away from the backbone, decreasing the contact between glycan and protein components in the immediate vicinity of the modification. Sites of N-linked glycosylation tend to be widely dispersed. In contrast, the linkage point for O-linked
Intramolecular Interactions
367
glycans is closer to the backbone, only two bonds removed, and for those with a-glycosidic linkages, the initiating residue lies proximal to the peptide backbone, facilitating intimate interactions. Additionally, for mucin-like Olinked glycosylation there are often numerous and neighboring sites of modification, which can amplify the effects of the glycan–polypeptide intramolecular backbone interactions. The recognized high-resolution structure determination techniques for identifying intramolecular interactions are crystallography and nuclear magnetic resonance (NMR). Generally, glycoyslation is considered detrimental to protein crystallization (Lee et al., 2009), and often efforts are made to remove or remodel glycans to either eliminate this concern, or, particularly in the case of N-linked structures, to minimize the heterogeneity by trimming back the glycans (Lee et al., 2009; Rich and Withers, 2009). For mucins, the high density of glycosylation would only further compound this, and may explain the lack of crystallographic data on these molecules. Solution state NMR, though, has proven to be an effective tool in examining carbohydrate structures on glycoproteins (Meyer and Moller, 2007). The method also offers a distinct advantage in directly accessing the dynamics of the structures which reflect both the intramolecular and intermolecular interactions of glycoproteins.
2. O-Linked Glycoproteins The significance of intramolecular interactions in affecting the properties of native mucin O-linked glycoproteins at a global scale was realized early on from a variety of biophysical studies. Extended structures were visualized in electron micrographs of glycosylated mucin domains (Rose et al., 1984). Comparison of glycosylated and deglycosylated mucins using NMR (Gerken and Jentoft, 1987; Gerken et al., 1989) and light scattering techniques (Shogren et al., 1989) demonstrated the organizational consequences of the a-O-GalNAc modification, insofar as an extended and more rigid organization was observed. While the structural properties of mucin domains differ from those of globular proteins, they do present ordered structures that dictate the dispositions of their glycans. Intramolecular interactions are responsible for this organization, with significant implications for recognition of their glycans. This affects cellular signaling through cellsurface glycoproteins, with CD43 and CD45 being two examples (Garner and Baum, 2008). Studies on natural material have provided insights into the larger scale conformational aspects of mucins. However, the intrinsic natural high molecular weight and microheterogeneity render such material problematic for high-resolution structural analysis that would enable elucidation of the detailed intramolecular interactions giving rise to the conformational features. An exception to this is the highly regular fish antifreeze
368
Adam W. Barb et al.
mucin glycoprotein (AFGP), which has a repeating triad of amino acids, predominantly AAT with some PAT, and with the T residues glycosylated. It has been possible to isolate a fraction of modest molecular weight from natural AFGP preparations, making its study tractable (Bush and Feeney, 1986; Lane et al., 1998). Given the general complications associated with accessing a broader range of structures from natural material, peptide synthesis methodology has emerged as an attractive and important alternative (Buskas et al., 2006). This has permitted the preparation of glycopeptides, particularly those bearing short glycans, with a wide variety of defined amino acid sequences and patterns of glycosylation. The extension of conventional peptide synthesis methodology to O-linked glycopeptides requires additional considerations in preparing glycosylated building blocks before assembly (Buskas et al., 2006), and in the deprotection of the sugar hydroxyls at the final stages of synthesis. These considerations have been successfully addressed (e.g., Liu et al., 2005, 2008), and recent advances employing microwave-assisted solid-phase peptide synthesis techniques are further enhancing glycopeptide synthesis efficiency (Matsushita et al., 2006). With the findings that the initial S- or T-linked GalNAc residues dominate the intramolecular interactions organizing mucin glycopeptides (Coltart et al., 2002), as discussed below, this synthetically most accessible and simplest mucin form is an effective model for investigating the intramolecular interactions and the core glycopeptide scaffold. While the minimal S/T-a-O-GalNAc element, or Tn antigen, is not normally revealed in humans, it is found on cell surfaces of tumor cells associated with aberrantly glycosylated mucins, and is correlated with a poor clinical prognosis. This has generated interest in the Tn glycopeptides (Springer, 1997). Mucin structures with more complex glycans have been successfully prepared using chemical and/or enzymatic approaches for elaborating the carbohydrates (Matsushita et al., 2006; Tarp et al., 2007). Although many conformational questions regarding mucin motifs can be addressed with modest sized fragments, application of native chemical ligation (NCL) methods has offered significant advances for exploring larger segments (Kan and Danishefsky, 2009; Payne and Wong, 2010). In considering a glycopeptide-based strategy for studying mucin glycoproteins, the potential absence of native tertiary interactions in studying short segments is a concern. Mucins, however, adopt extended conformations which preclude long-range tertiary interactions with sequentially remote regions in the native glycoprotein. Therefore, the same local interactions dominate the conformations of the motifs, both as parts of the native structures and as isolated short segments of these glycoproteins. Thus, mucin glycopeptides are expected to provide realistic structural models for components of the native glycoprotein. As elaborated below, these short segments display the features that are consistent with
Intramolecular Interactions
369
those of the global arrangement of glycosylated mucins. Thus, glycopeptides are valuable tools for studying O-linked structures. NMR studies on AFGP provided interatomic distance information from a number of nuclear Overhauser effect (NOE) interactions and bond angles based on proton J couplings. These, along with conformational energy calculations, provided a model for the glycosylated AT*AA sequence in the AFGP, revealing an extended and stabilized structure for the motif consistent with the larger organization of mucins (Lane et al., 1998). The AFGP studies also provided evidence for the existence of a hydrogen bond between the GalNAc amide and the carbonyl of the Thr residue to which it is attached (Mimura et al., 1992). Extension to examples with clusters of immediately adjacent sites of glycosylation, based on synthetic segments of mucins from glycophorin (Schuster et al., 1999) and MUC7 (Naganagowda et al., 1999), have also been reported. In these latter cases, a twisted extended structure of the backbone for the glycosylated forms was found, with an indication that the peptide backbone structure showed characteristics of a polyproline II helix. Combined synthetic and NMR efforts facilitated a systematic analysis of a series of glycopeptide constructs based on an Nterminal motif from the cell surface glycoprotein CD43, S*T*T*AV, where the asterisks denote glycosylation (Coltart et al., 2002). Three constructs were prepared with conventional mucin a-linked glycans of increasing complexity, GalNAca (Tn), Galb1-3GalNAca (T), and Galb1-3 (Neu5Aca2,6)GalNAca (ST). The ST glycan has been associated with CD43 in acute myelogenous leukemia (Fukuda et al., 1986). For the glycopeptide core, consisting of the GalNAc residues and the peptide, numerous NMR NOE contacts, including between the proximal sugar and peptide, were observed. These provided internuclear distance relationships (Coltart et al., 2002). The distances, along with J coupling parameters that relate to bond torsion angle, provided an extensive set of constraints for structure calculations. Key features, largely invariant with the size of the attached glycan, are immediately evident from these parameters. The HN to Ha 3J couplings are large, supporting an extended backbone structure. The numerous NOE interactions between the proximal GalNAc and the peptide backbone show interactions for this sugar, while there are a lack of NOE interactions between the peripheral sugar residues and the core glycopeptide, indicating that they are not in intimate contact with the peptide. Using the NMR constraints, structural refinement calculations were carried out with the Xplor program (Schwieters et al., 2006), and resulting coordinates for structures fitting the experimental constraints are available from the Protein Data Bank database (http://www.rcsb.org/pdb) entry 1kyj. The tightly clustered family of accepted structures is consistent with an extended, stable, and well-ordered structure. An important feature of Thr residues with a-O-GalNAc attached is the small 3J coupling between the Thr Ha and Hb. This limits the range of allowed torsion angles between
370
Adam W. Barb et al.
these C–H bonds to values either close to 90 or 270 , with the former confirmed by NOEs. The structures showed a spacial relationship for the Nacetyl amide of the three glycosylated residues with both the glycosidic and carbonyl oxygens of their respective amino acid residues that indicate hydrogen bonding interactions. The existence of such an interaction is independently supported by the slow exchange rates for the N-acetyl amide protons (Coltart et al., 2002), also seen by others (Lane et al., 1998). The structure also reveals hydrophobic interactions between the N-acetyl methyl groups and side chain methyl groups on the iþ2 reside that would aid in promoting and propagating the extended structure down the polypeptide chain. In the absence of glycosylation, NMR results for the naked peptide itself suggest considerable conformational flexibility, typical of short peptides in general. NMR relaxation parameters, NOE, T1, T1r, and T2, are linked directly to molecular dynamics (Cavanaugh et al., 2007; Ishima and Torchia, 2000), and these have been used to verify the conclusions above by 13C relaxation measurements of the tri-Tn-S*T*T*AV glycopeptide listed in Table 18.1 (D. Live, unpublished results). The S2-order parameters extracted from these measurements were derived with the extended model free analysis using the program Modelfree (Mandel et al., 1995). S2 has a maximum value of 1 when there is no local motion, and values of 0.6 can be related to angular variations of only 30 (Ishima and Torchia, 2000), indicating that at most there is only a limited range of segmental motion for this glycopeptide core, in keeping with a well-defined conformation. Such effects have been observed in mucin glycopeptides by others (Grinstead et al., 2002). These data provide direct evidence that the glycosylated core, comprising the three glycosylated amino acids and their attached GalNAcs, largely behave as a single conformational entity. The existence of well-defined structure has important implications, since this establishes the relative orientations of the glycans: a feature which is relevant to recognition of mucin motifs on specific glycoproteins. Table 18.1 13C NMR relaxation parameters, T1 (s), T2 (s), and NOE measured at natural abundance using proton detected 2D 1H-13C experiments (Cavanaugh et al., 2007), and the derived order parameter S2 for sites in the (Tn)3 S*T*T*AV moleculea
T1 T2 NOE S2 a
S1a
T2a
T3a
A4a
T2b
T3b
S1GC1
T2GC1
T3GC1
0.41 0.25 1.53 0.69
0.36 0.20 1.35 0.83
0.37 0.21 1.36 0.81
0.43 0.27 1.56 0.61
0.37 0.16 1.29 0.88
0.36 0.19 1.32 0.90
0.41 0.26 1.54 0.67
0.40 0.21 1.39 0.76
0.41 0.24 1.43 0.71
S1GC1, T2GC1, and T3GC1 refer to the anomeric carbon sites on the GalNAc residues associated with the respective amino acid residues. Measured at 18.8 T, 800 MHz 1H frequency.
371
Intramolecular Interactions
Additionally, NMR residual dipolar couplings (RDCs) (de Alba and Tjandra, 2002) for this construct have been determined (D. Live and A. Borgert, unpublished results) in a weakly aligning cetylpyridinium bromide (CPBr)/hexanol/sodium bromide liquid crystalline medium (Barrientos et al., 2000). These provided additional structural constraints, independent of the earlier data, and were consistent with the original structure. Further refinement of the structure with these values resulted in only minor structural adjustments (Fig. 18.1). The consistency of these data with the earlier structure, and the sensitivity of the RDCs to motion over a broad range of frequencies, further support the contention that this glycopeptide does not undergo major conformational fluctuations. The effects of variation in local density of glycosylation on conformation have been explored in a MUC2-derived sequence, PTTTPLK, which is known to be a substrate for polypeptide GalNAc transferases (Takeuchi et al., 2002). Constructs were synthesized (Liu et al., 2005) with all permutations of the pattern of glycosylation by a-O-GalNAc on the threonine residues, and NMR studies were carried out. The structures of these molecules were computed from NOE and J coupling NMR experimental restraints (A. Borgert, M. Liu, G. Barany, and D. Live, unpublished results). For those with two or three substitutions, RDC values in didodecyl/ dihexyl-phosphatidylcholine media (Ottiger and Bax, 1999) were determined and used as well. In this triplet motif, the organization around the respective individually glycosylated Thr residues are largely unchanged relative to the peptide backbone, as neighboring sites are glycosylated (Fig. 18.2). With this increasing density of glycosylation, the extent of segmental motion becomes more restricted, reflecting the increased carbohydrate–peptide interactions. Interestingly, the core structure with all three Thr residues glycosylated overlays the analogous glycosylated S*T*T* segment of the earlier construct quite well, with preservation of the associated interactions, suggesting a consistent triplet structural motif and the relative lack of sensitivity to Ser versus Thr residue at the N-terminal position. T3
S1 T2
Figure 18.1 Overlay of the closest to the average of the families of structures of the S*T*T* segment of (Tn)3 S*T*T*AV determined without RDC constraints, sticks, and with RDC constraints included, lines.
372
Adam W. Barb et al.
PT*TTPLK
PT*TPLK
PTTT*PLK
PT*T*T*PLK
Figure 18.2 The closest to the average for the family of structures for each of the three PTTTPLK constructs with a single site of a-O-GalNAc glycosylation, and the one with all three sites glycosylated.
There have been several structural studies on peptides and mucin glycopeptides from the tandem repeat of MUC1 (Dziadek et al., 2006; Grinstead et al., 2002; Kirnarsky et al., 2000). This glycoprotein has been the focus of attention since it is overexpressed with aberrant glycosylation, particularly the Tn epitope, in tumor cells (Dziadek et al., 2006). The most detailed study is an NMR analysis of a glycosylated form of the full tandem repeat element GSTAPPAHGVTSAPDTRPAP with a single ST epitope at Thr11, as recently reported (Dziadek et al., 2006). The NOE contacts and 3J coupling parameters, as well as structural features in the vicinity of the single glycoyslation site, are quite consistent with those previously published findings for glycosylated amino acids in the clustered S*T*T*AV structure (Coltart et al., 2002). These include contacts between the N-acetyl methyl group and the iþ2 Ala Me, and a 2.5 A˚ distance between the N-acetyl N and the Thr11 carbonyl oxygen, supporting a direct intramolecular interaction through a hydrogen bond. A number of mucin structures reported are consistent with direct hydrogen bonding between a GalNAc amide and the peptide backbone, for example, AFGP (Mimura et al., 1992), MUC1 glycopeptide (Dziadek et al., 2006), MUC2 glycopeptides, and S*T*T*AV (Coltart et al., 2002) glycopeptide. However, on the basis of NMR and molecular dynamics simulations of isolated C- and N-capped a-O-GalNAc-Ser and Thr amino acids and dipeptides composed of Ser and Thr residues, questions have been raised about their existence in other contexts (Corzana et al., 2006b, 2007,
Intramolecular Interactions
373
2009). In these instances, solvent-mediated hydrogen bonds have been proposed. The orientations and interatomic distances of the hydrogen bonding functional groups found in the larger glycopeptides would seem to preclude insertion of a water molecule, as do the reduced amide exchange rates observed in the larger systems. While direct hydrogen bonding may not be the case in all instances of larger glycopeptides, it would appear that the amino acid residues immediately adjacent to the glycosylation sites can play important roles both in restricting the local conformation and on local solvation. Thus, very small models may be of too limited size to accurately reflect all of the interactions between carbohydrate and peptide components in more native-like mucin systems. The differential response to a versus b stereochemistry at GalNAc glycosidic linkages to the amino acid can be deduced directly from comparison of the (a-T)3 S*T*T*AV and the (b-T)3 S*T*T*AV constructs (Coltart et al., 2002), and provides further evidence for the role of specific interactions on the mechanism of structural stabilization. The reduced number of glycan to peptide NOEs, the 3J coupling values, and poorer dispersion of the peptide amide chemical shifts in the case of the b-linkage relative to the a-linkage, as well as reduced amide proton exchange lifetimes, suggest diminished interactions between the carbohydrate and peptide components. These parameters are further consistent with dynamic averaging of multiple conformational states. The increased conformational lability is consistent with the fact that the b-linkage redirects the GalNAc residue away from the peptide, largely disrupting the interactions among functional groups of the two moieties found in the a-linked forms. While only the a-linkage occurs in conventional mucins, an analogous b-O-linked GlcNAc modification occurs naturally as a sparsely distributed transient regulatory modification on some cytosolic proteins (Whelan and Hart, 2006). Investigation of N- and C-terminal capped Ser/Thr-b-O-GlcNAc models are consistent with the sugar residue being oriented away from the backbone, and with increased flexibility (Corzana et al., 2006a). This modification has also been studied on a synthetic b-O-GlcNAc glycopeptide from RNA polymerase II, where a site of b-O-GlcNAc attachment has been identified (Simanek et al., 1998). NOE interactions with the peptide backbone are lacking here, consistent with the GlcNAc projecting away from the peptide portion. However, it was found that glycosylation did induce a propensity for a turn in the backbone. Analysis showed clustering into one of two major families. Together, these are consistent with greater molecular flexibility and a more exposed carbohydrate. This GlcNAc modification on two related peptide sequences has been examined in complex with an MHC molecule by crystallography (Glithero et al., 1999). In support of glycopeptide flexibility, the crystal structure for one of the glycopeptides in the complex shows evidence that two different rotamers in the GlcNAc glycosidic linkage can occur. Thus, whereas the
374
Adam W. Barb et al.
a-linkage positions functional groups to promote conformational and chemical stability of mucin glycopeptides, nature has employed the less constrained b-linkage in a more labile regulatory application that can modulate phosphorylation. Another O-linked modification for which glycan–polypeptide interactions have ramifications is that of a-O-mannose-linked glycans. Recently, this has been identified in mammalian glycoproteins, with a-dystroglycan being the only well-characterized example (Barresi and Campbell, 2006). There is evidence for other glycoproteins modified in this way as well (Chai et al., 1999). This modification has taken on considerable importance, since aberrations in the O-Man-linked glycan have been related to forms of muscular dystrophy. Electron micrographs show the central mucin-like region of this glycoprotein is extended (Brancaccio et al., 1995), as in conventional mucins with a-O-GalNAcs. This posed the question of whether an a-O-Man modification can support an extended arrangement, and if so, through what mechanism. To investigate this, a-O-Man glycopeptides based on a-dystroglycan sequences were synthesized and studied by NMR (Liu et al., 2008). The resulting structures show considerable disorder, relative to the same sequence with a-O-GalNAc, particularly in the arrangement of the pendant sugars (A. Borgert, M. Liu, G. Barany, and D. Live, unpublished results). This can be rationalized in the context of the earlier findings that specific sugar functional groups, notably the N-acetyl modification, and their location are important for interactions that stabilize extended structures. In their absence, glycosylation should not lead to the extended arrangement. While emphasis has been placed on the presence of the a-O-Man-linked glycans because of their identification with biological function, investigations of the central mucin-like region of a-dystroglycan (Sasaki et al., 1998) have noted that there are also a number of coexisting a-OGalNAc-linked glycans in this region. From the inability of the a-O-Man modifications to stabilize the observed extended structure, it appears that the intramolecular interactions involving these a-O-GalNAc-linked glycans are important in imparting the structural stability to the extended arrangement. This would be important for its mechanical function in tissue organization, as well as for the appropriate presentation of the O-Man glycans to receptors.
3. N-Linked Glycoproteins Implicit in one of the functions of N-linked glycans, the participation in protein folding quality control (Varki et al., 2009), is intramolecular interaction between the glycan component and the polypeptide chain. As with O-linked species, N-linked glycoproteins display microheterogeneity, a feature that similarly complicates their study. In view of the significance of
Intramolecular Interactions
375
tertiary interactions in globular glycoproteins with N-linked glycosylation, the rationale for studying isolated glycopeptide segments as models in these latter cases is less well founded. Rather, to accurately describe conformational properties, there is the more demanding requirement for the full glycoprotein, and particularly, for homogeneous glycoprotein samples. This has been approached by both chemical and biological strategies. From a purely chemical perspective, NCL strategies have been extended to the assembly of defined synthetic fragments, both peptide and glycopeptide, into full glycoproteins. This has shown impressive results and considerable promise (Kan and Danishefsky, 2009; Payne and Wong, 2010; Yamamoto et al., 2008). A variation on this theme involves bacterial expression of a protein segment that is then linked, using NCL, to a synthetic glycopeptide, completing the glycoprotein (Piontek et al., 2009). Chemoenzymatic synthesis has been used as well (Wang, 2008). Biological approaches have used wild-type cells, or those with modifications in the glycosylation machinery, often combined with in vitro enzymatic remodeling of the product glycoproteins (Chang et al., 2007; Lee et al., 2009; Li et al., 2001; Lustbader et al., 1996; Rich and Withers, 2009; Schwarz et al., 2010; Slynko et al., 2009), to achieve the final preparations. In the biosynthetic approach, it is necessary to consider that the pendant glycans installed can be organism specific, which can affect the detailed characteristics of the product, as well as choice of expression system. An additional factor in the prospects for success of the various approaches is that, in the absence of some or all of the attached glycoforms, the underlying protein, or even the partially glycosylated form, may not properly fold or may aggregate (Lee et al., 2009). For Chinese hamster ovary (CHO) cells, there are a variety of available glycosylation mutants (North et al., 2010) that can aid in producing more homogeneous glycoproteins on their own, or provide material that is more readily remodeled. Human embryonic kidney (HEK) cells offer promise in expressing glycoproteins bearing human glycoforms (Lee et al., 2009). The relative ease in working with yeast cultures has made them, and in particular Pichia pastoris, popular organisms for producing glycoproteins (Rich and Withers, 2009). The high mannose glycans it installs can be trimmed to the level of the first N-acetylglucosamine residue by treatment with endoglycosidase H; the GlcNAc-Asn site then serves as a site for enzymatically reattaching a desired glycoform using methods recently reported (Rich and Withers, 2009; Wang, 2008). For glycoproteins isolated directly from their natural sources, complex-type glycans may also be trimmed in a similar manner with endoglycosidase D or S (Allhorn et al., 2008; Yamaguchi et al., 2006). Exposed complex-type glycans may sometimes be completely removed from native glycoproteins using PNGase F (Plummer and Tarentino, 1991). Heterogeneity of mature glycoproteins may be dramatically reduced by sequentially trimming the glycan termini using a host of
376
Adam W. Barb et al.
obligate exoglycosidases, including a neuraminidase (Clostridium perfringens), a b1-4-galactosidase (Bacteroides fragilis), an N-acetylglucosaminidase (Xanthomonas manihotis), and an a1-3-mannosidase (X. manihotis; New England Biolabs). Following digestion with a1-3 mannosidase, an a1-6 mannosidase (X. manihotis) will remove the a1-6-linked mannose residue. It is important to note that this enzyme does not act on branched substrates; therefore, the a1-3-linked mannose residue must be removed first (New England Biolabs; A.W. Barb and J.H. Prestegard, unpublished data). Glycosidases are commonly inhibited by steric interactions with the polypeptide. This is particularly so with endoglycosidases which are often ineffective towards glycans buried or confined by protein tertiary structure (Blanchard et al., 2008). Steric effects appear to be less of an obstacle for exoglycosidase-catalyzed digestions. Incomplete or heterogeneous glycan termini may be remodeled using glycosyltransferases and their corresponding sugar nucleotide substrates. This strategy has been employed to incorporate NMR-active isotopes into mammalian-expressed glycoproteins (Barb et al., 2009; Macnaughtan et al., 2008; Yamaguchi et al., 1998). Commonly used enzymes are the human a2-3 and a2-6 sialyl-transferases and the bovine b1-4 galactosyltransferase (Chung et al., 2006; Krapp et al., 2003; Raju et al., 2001; Scallon et al., 2007). In most cases, these reactions may be run to completion with each glycan terminus modified. There have been reports of incomplete sialylation of the occluded N-glycans of the IgG Fc fragment discussed below (Barb et al., 2009; Kobata, 2008; Raju et al., 2001); some of this effect is attributable to the slow sialylation of the a1-6Man-linked branch by the human a2-6 sialyl-transferase (Barb et al., 2009). Glycans on intact glycoproteins (Fig. 18.3A), whether as originally isolated or after remodeling, can be characterized by matrix-assisted laser desorption ionization (MALDI)-MS or electrospray ionization (ESI)-MS methods (Gong et al., 2009). However, minor glycoforms may be poorly resolved by MS. For proteins with multiple glycosylation sites, deconvoluting the contributions from different glycans and peak overlap can be challenging. As an alternative approach, liberated, permethylated glycans can be analyzed with MALDI-MS (Anumula and Taylor, 1992). These techniques do not perform well in distinguishing configurational isomers, which generally require releasing glycans followed by derivatization and HPLC-based coelution (Holland et al., 2002; Rice, 2000; Takahashi et al., 1995). A 1D NMR-based approach has been described that can quickly differentiate isomers, but this is limited with heterogeneous samples and is fundamentally insensitive (Vliegenthart et al., 1983). Because of the dynamic features of N-glycans, even when crystallography of glycoproteins with extended oligosaccharides is successful, the electron density for portions of the carbohydrate may be unresolved. Furthermore, even if their electron density is observed, identification of
377
Intramolecular Interactions
A
a1-2 a1-2
a1-2
a1-3
B
a1-3
b1-4
a1-6
a1-2
a1-6 b1-4
a1-6
a2-3 b1-4
b1-2
a1-3
a1-3 b1-4 a1-6
High mannose
a1-6 b1-4
b – GlcNAc
Hybrid
a1-6
a2-3 b1-4
OH H4 H6 O HO
a1-3
NAc
Asn H1
a1-6
b1-4
a1-6
b–GlcNAc
N H3
b1-2
H6′ O H2 H5
b1-4
Complex
Figure 18.3 Panel (A): Types of carbohydrate structures and common linkages that are N-linked to glycoproteins. Note the a1-6 and a1-3-linked mannose residues which also specify the terminal branches of the complex-type biantennary glycan. Gray squares represent N-acetylglucosamine (GlcNAc), dark gray circles mannose, open triangles fucose, open circles galactose, and black diamonds N-acetylneuraminic acid residues. Panel (B): Structure of a core b-GlcNAc residue depicted as the first residue of an N-glycan with a linkage to the asparagine residue and a linkage to the second bGlcNAc residue of the chitobiose core. Note the hydrophobic surface of this residue formed by the H1, H3, H5, H6, and H60 protons.
the actual sugars represented by a particular region of electron density may be uncertain (Chen et al., 2005). Unlike for amino acids, information from other sources may be insufficient to unequivocally know the glycan sequence. It has been noted that, historically, there are a number of errors in the carbohydrate portion of X-ray determined glycoprotein structures deposited in the PDB, although efforts are being made to correct these (Lutteke, 2009). The dynamics of the N-linked glycans puts NMR at a significant advantage in monitoring the characteristics of oligosaccharide chain conformation and interactions, not only because it is better suited for describing dynamics, but also because the experiments are done in solution. Hence, effects of crystal packing on the glycans, which largely extend from the protein surface, do not bias the results. NMR also provides explicit assignment of each sugar residue for which shift assignments can be made. While the addition of carbohydrate adds complexity to the molecules, crosspeaks from the carbohydrate components in 2D or 3D 1H–13C maps fall in regions where they can readily be resolved from those of the protein component (de Beer et al., 1994). NMR studies of these generally large glycoprotein systems can benefit from the incorporation of 13C and 15N labeling that has proven so valuable in protein structural studies. The labeling can be done either uniformly, segmentally, or on a residue (either amino acid or sugar) specific basis, using P. pastoris, CHO (Lustbader et al., 1996), HEK (Liu et al., 2007), and bacterial expression systems.
378
Adam W. Barb et al.
A survey of glycoprotein structures has found that N-linked glycans occur in a wide variety of protein secondary structural elements and surface geometries (Petrescu et al., 2006). Linked Asn residues have been observed in several topologies, ranging from the bottoms of deeply recessed concave surfaces to steeply convex surfaces (Petrescu et al., 2004). These observations argue against the presence of a dominant single strong and specific interaction between proximal residues and the proteins, and are consistent with the initial sugar residues being oriented largely out of the way of the protein backbone and interacting comparatively weakly with it. The most frequently observed contacts of the N-glycan with the polypeptide are to the first N-acetylglucosamine residue, and are variable. This residue is often found near a hydrophobic surface or pocket with the H1– H3–H5 face of the residue (Fig. 18.3B) lying against it. The N-acetyl methyl can also make hydrophobic contacts with the surface by occupying a shallow pocket. Indeed, aromatic and proline residues are enriched around N-X-T/S sequons (Petrescu et al., 2004), and are most likely to interact with the GlcNAc, as observed by X-ray crystallography. The N78 glycan of the a-subunit of human chorionic gonadotropin (pdb 1hd4) typifies this arrangement, where the H1–H3–H5 face is against proline and valine residues, and the methyl is in a pocket formed by valine, isoleucine, and alanine residues (Erbel et al., 2000). Hydrogen bonds to the carbonyl oxygen of the N-acetyl are also observed, as in the Epstein-Barr virus major envelope glycoprotein gp350 (pdb 2h6o) at N195 where the oxygen atom is in position to form a hydrogen bond with a backbone NH of G289 (Szakonyi et al., 2006). In many cases, however, there are no clear contacts between the first residue and the polypeptide. Similar interactions are observed, though less frequently, for the second N-acetylglucosamine residue in the glycan. In theory, polar contacts with any sugar hydrogen bond donor or acceptor may occur, although most observed interactions involve the C6 OH and the N-acetyl carbonyl oxygen atom. For example, the O6 from the second N-acetylglucosamine residue of the IgA Fc N263 glycan (pdb 1ow0) is in position to form a hydrogen bond to the side chain oxygens from D255 (Herr et al., 2003). Sugar ring proton hydrophobic contacts are likewise observed, including N-acetyl methyl–hydrophobic interactions as exemplified by the human FcaRI structure (pdb 1ow0) with the methyl from the second N-acetylglucosamine on the N58 glycan packed between side chains from Glu and Tyr residues (Herr et al., 2003). The dearth of coordinates beyond the first two GlcNAc residues indicates that there are few stable interactions between the distal carbohydrate residues and the polypeptide. There are notable exceptions with extensive glycan coordinates in the Protein Data Bank, although it is important to note that even when glycans are observed in X-ray crystallography, structures may be influenced by crystal packing (Chen et al., 2005), and may not
Intramolecular Interactions
379
represent the ensemble of solution conformations available to the N-glycan. Where coordinates are available, glycans do not typically interact tightly with the polypeptide. Unlike high affinity interactions, N-glycan–polypeptide interactions lack a high degree of surface complementarity, buried hydrophobic surfaces, and extensive hydrogen bonding. NMR studies on some N-linked glycosylation sites show NOE contacts between the proximal sugars and the Asn side chain (Erbel et al., 2000; Slynko et al., 2009; Wyss et al., 1995), as well as those of neighboring side chains, indicating proximity of this sugar residue to the amino acid side chains. This can vary even among sites in a single glycoprotein. For human chorionic gonadotropin, glycan–protein NOEs for the glycan at the N52 site are largely lacking, but are present at the N78 site (Erbel et al., 2000; Weller et al., 1996). It is also noted in these glycoproteins that the mobility of the GlcNAc is more restricted than the peripheral sugar residues, implying interactions of some nature. In CD2, even the first GlcNAc has several NOE contacts with the K61 side chain, four residues removed from the glycosylation site, and has a stabilizing effect on protein attributed to defusing the locally high concentration of positive charges on the protein surface (Hanson et al., 2009; Wyss et al., 1995) particularly associated with K61. Nonetheless, using wild-type and K61A mutants of CD2, it has been shown that, independent of surface charge, the presence of the first sugar is an important contributor to protein folding and stability (Hanson et al., 2009). Indeed, trimming the N-glycan to the first N-acetylglucosamine residue is a strategy used for structural biology applications that often maintains protein stability, while substantively reducing conformational and configurational heterogeneity (Chang et al., 2007). Although both hydrophobic and polar distal residue–polypeptide interactions are observed, hydrophobic interactions probably dominate the stabilizing and enhanced folding benefits of N-glycans. It is notable that many carbohydrate residues have defined hydrophobic faces, as mentioned above. b-Galactose and b-mannose residues are examples where the H1– H3–H4–H5–H6–H60 (Fig. 18.3) and H1–H2–H3–H5–H6–H60 faces, respectively, are markedly hydrophobic in nature. It is likely that these faces cover hydrophobic polypeptide surfaces, although these may not always be obvious due to the highly dynamic nature of the distal portion of N-glycans. This is demonstrated in erythropoietin (EPO), a glycosylated peptidic growth factor, where glycosylation shields hydrophobic patches that are otherwise accessible to promote aggregation (Cheetham et al., 1998; Narhi et al., 1991; Toyoda et al., 2000, 2002). In a structure of the human Zn-a2-glycoprotein (pdb 1zag), the hydrophobic face of the b-mannose residue is proximal to a Tyr side chain (Sanchez et al., 1999). The H3ax–H4– H6 face of N-acetylneuraminic acid has also been observed in contact with hydrophobic residues, and was observed packed against a Trp side chain in the structure of fibrinogen (pdb 3ghg). These results are unusual for
380
Adam W. Barb et al.
resolving coordinates for a large glycan with seemingly few conformationstabilizing contacts (Kollman et al., 2009). The Fc fragment of immunoglobulin G (IgG) has extensive distal glycan–polypeptide interactions which affect Fc receptor binding and directly impact human disease. IgG is a 150 kDa protein with two antigen binding Fab fragments and one Fc fragment (Fig. 18.4). The Fc fragment mediates interactions between IgG and immune system components, including the Fcg receptors, and the C1q component of complement, among others (Roitt et al., 2001). Even separated from the Fab fragments, the Fc fragment maintains its full strength in these interactions. The heavy chain of IgG has one conserved N-glycosylation site at N297, with a complex-type, biantennary glycan that generally varies in the amount of terminal galactose when purified from the serum of healthy individuals (Arnold et al., 2007). In rheumatoid arthritis patients, the amount of terminal galactose is inversely proportional to the severity of the disease (Parekh et al., 1985). X-ray diffraction-derived structural models of the Fc fragment are unusual in that nearly the entirety of the glycan is resolved and occupies the space between the two Cg2 domains (pdb 1fc1; Deisenhofer, 1981). The position of these glycans in the polypeptide interstitial region likely accounts for the observed regular structure. The residues on the a1-6Manlinked branch of the glycan are stabilized through hydrophobic and polar interactions with the surface of the Cg2 domain. The H1–H3–H5 face of the first GlcNAc residue makes some hydrophobic contacts with V264, and the N-acetyl carbonyl oxygen atom hydrogen bonds to the D265 side chain. H4, H6, and H60 of the second residue make hydrophobic contacts, and the
Fab
Fab Light chain
Heavy chain Asn 297
Hinge Cg2
Cg2
Fc Cg3
Cg3
Figure 18.4 Schematic of IgG showing the Fc fragment, the position of the conserved N-glycan, and the relative orientations of the Cg2 and Cg3 domains.
Intramolecular Interactions
381
N-acetyl carbonyl oxygen atom is in position to hydrogen bond with the R301 side chain NH. As is commonly observed for N-glycans with a core fucose residue, no contacts between the fucose and the protein surface are observed in these crystal structures. The b-mannose residue makes extensive contacts with its H1–H2–H3–H5 face to F241. From this point, the a1-3Man branch of the glycan extends into the dimer interface, away from the polypeptide surface, and the a1-6Man branch follows the contour of the Cg2 domain. The a1-6Man N-acetylglucosamine residue makes extensive contacts through its H1–H3–H5 face to F243. The K246 amine is in position to bind O4 of GlcNAc and the anomeric oxygen of galactose on the a1-6Man branch. An NMR study of the Fc-conjugated glycan revealed a broader 13C line width for the anomeric carbon of galactose on the a1-6Man-linked branch, when compared to the same carbon on the a1-3Man-linked branch (Yamaguchi et al., 1998). This offers evidence in support of the hypothesis that the line widths from the a1-6Man-linked branch are broadened due to a more intimate interaction with the protein surface, restricting its motion relative to the a1-3Man-linked branch. Mutating residues along this binding interface, including F241, F243, V264, D265, and R301, dramatically increased the amount of galactose and sialic acid containing termini (Lund et al., 1996) and indicated a greater accessibility of the glycan termini to the galactosyl- and sialyl-transferases in the Golgi. The a1-3Man-linked branch residues interact with each other across the dimer interface primarily through hydrophobic interactions (Deisenhofer, 1981). The composition of the N-glycans is intimately linked to Fc structure and function. The distance between the two Cg2 domains decreases upon truncation of the glycan (Krapp et al., 2003), and backbone amide chemical shift changes at the Cg2/Cg3 interface indicate a structural rearrangement consistent with this type of movement (Yamaguchi et al., 2006). Based on the position of the glycans, it is likely that the size of the Fc glycan is a principle determinant in the spacing of the two Cg2 domains. The IgG Fc glycan composition also affects binding to the C1q component of complement (Leatherbarrow et al., 1985) and the low affinity (low mM) Fc receptors, FcgRII and FcgRIII, in contrast to the Fca receptor–IgA Fc interaction which is insensitive to glycan composition or absence of sugar (Gomes et al., 2008). Deglycosylated IgG Fc shows no measurable affinity towards either FcgRIIb or FcgRIII (Mimura et al., 2001; Yamaguchi et al., 2006). Fc with the glycans truncated to the mannose residues shows restored binding affinity for both receptors, when compared to deglycosylated forms. The GlcNAc and galactose residues slightly affect these interactions, though differently for FcgRII and FcgRIII. It is interesting to note that sialylation decreased the strength of the Fc–FcgRIIb/FcgRIII interaction roughly 10fold (Kaneko et al., 2006). One explanation is that the Fc glycans, residing between the heavy chain monomers, tune the interaction with the FcgRs
382
Adam W. Barb et al.
through bulk effects alone. Based on the structure of the Fc–FcgRIII complex, the glycans do not bind to the receptor directly (Radaev et al., 2001). However, one can speculate that specific a1-6Man-branch–Fc polypeptide interactions, rather than bulk effects, are critical for proper IgG Fc structure, dynamics, and function.
ACKNOWLEDGMENTS This work was supported by grants from the National Institutes of General Medical Science GM066148 (D.L.) and the National Institutes of Arthritis and Musculoskeletal Diseases AR056055 (D.L.), and a fellowship from the National Institutes of Arthritis and Musculoskeletal Diseases F32AR058084 (A.B.).
REFERENCES Allhorn, M., Olin, A. I., Nimmerjahn, F., and Collin, M. (2008). Human IgG/Fc gamma R interactions are modulated by streptococcal IgG glycan hydrolysis. PLoS ONE 3, e1413. Anumula, K. R., and Taylor, P. B. (1992). A comprehensive procedure for preparation of partially methylated alditol acetates from glycoprotein carbohydrates. Anal. Biochem. 203, 101–108. Apweiler, R., Hermjakob, H., and Sharon, N. (1999). On the frequency of protein glycosylation, as deduced from analysis of the SWISS-PROT database. Biochim. Biophys. Acta Gen. Subj. 1473, 4–8. Arnold, J. N., Wormald, M. R., Sim, R. B., Rudd, P. M., and Dwek, R. A. (2007). The impact of glycosylation on the biological function and structure of human immunoglobulins. Annu. Rev. Immunol. 25, 21–50. Barb, A. W., Brady, E. K., and Prestegard, J. H. (2009). Branch-specific sialylation of IgG-Fc glycans by ST6Gal 1. Biochemistry 48, 9705–9707. Barresi, R., and Campbell, K. P. (2006). Dystroglycan: From biosynthesis to pathogenesis of human disease. J. Cell Sci. 119, 199–207. Barrientos, L. G., Dolan, C., and Gronenborn, A. M. (2000). Characterization of surfactant liquid crystal phases suitable for molecular alignment and measurement of dipolar couplings. J. Biomol. NMR 16, 329–337. Blanchard, V., Frank, M., Leeflang, B. R., Boelens, R., and Kamerling, J. P. (2008). The structural basis of the difference in sensitivity for PNGase F in the de-N-glycosylation of the native bovine pancreatic ribonucleases B and BS. Biochemistry 47, 3435–3446. Brancaccio, A., Schulthess, T., Gesemann, M., and Engel, J. (1995). Electron-microscopic evidence for a mucin-like region in chick muscle alpha-dystroglycan. FEBS Lett. 368, 139–142. Bush, C. A., and Feeney, R. E. (1986). Conformation of the glycotripeptide repeating unit of antifreeze glycoprotein of polar fish as determined from the fully assigned proton NMR-spectrum. Int. J. Pept. Protein Res. 28, 386–397. Buskas, T., Ingale, S., and Boons, G. J. (2006). Glycopeptides as versatile tools for glycobiology. Glycobiology 16, 113R–136R. Cavanaugh, J., Fairbrother, W. J., Palmer, A. G., and Skelton, N. J. (2007). Protein NMR Spectroscopy. Elsevier Academic Press, Amsterdam. Chai, W. G., Yuen, C. T., Kogelberg, H., Carruthers, R. A., Margolis, R. U., Feizi, T., and Lawson, A. M. (1999). High prevalence of 2-mono- and 2, 6-di-substituted manol-
Intramolecular Interactions
383
terminating sequences among O-glycans released from brain glycopeptides by reductive alkaline hydrolysis. Eur. J. Biochem. 263, 879–888. Chang, V. T., Crispin, M., Aricescu, A. R., Harvey, D. J., Nettleship, J. E., Fennelly, J. A., Yu, C., Boles, K. S., Evans, E. J., Stuart, D. I., Dwek, R. A., Jones, E. Y., et al. (2007). Glycoprotein structural genomics: Solving the glycosylation problem. Structure 15, 267–273. Cheetham, J. C., Smith, D. M., Aoki, K. H., Stevenson, J. L., Hoeffel, T. J., Syed, R. S., Egrie, J., and Harvey, T. S. (1998). NMR structure of human erythropoietin and a comparison with its receptor bound conformation. Nat. Struct. Biol. 5, 861–866. Chen, B., Vogan, E. M., Gong, H. Y., Skehel, J. J., Wiley, D. C., and Harrison, S. C. (2005). Determining the structure of an unliganded and fully glycosylated SIV gp120 envelope glycoprotein. Structure 13, 197–211. Chung, S., Joo, H., Jang, K., Lee, H., Lee, S., and Kim, B. (2006). Galactosylation and sialylation of terminal glycan residues of human immunoglobulin G using bacterial glycosyltransferases with in situ regeneration of sugar-nucleotides. Enzyme Microb. Technol. 39, 60–66. Coltart, D. M., Royyuru, A. K., Williams, L. J., Glunz, P. W., Sames, D., Kuduk, S. D., Schwarz, J. B., Chen, X. T., Danishefsky, S. J., and Live, D. H. (2002). Principles of mucin architecture: Structural studies on synthetic glycopeptides bearing clustered mono-, di-, tri-, and hexasaccharide glycodomains. J. Am. Chem. Soc. 124, 9833–9844. Corzana, F., Busto, J. H., Engelsen, S. B., Jimenez-Barbero, J., Asensio, J. L., Peregrina, J. M., and Avenoza, A. (2006a). Effect of beta-O-glucosylation on L-ser and L-thr diamides: A bias toward alpha-helical conformations. Chem. Eur. J. 12, 7864–7871. Corzana, F., Busto, J. H., Jimenez-Oses, G., Asensio, J. L., Jimenez-Barbero, J., Peregrina, J. M., and Avenoza, A. (2006b). New insights into alpha-GalNAc-ser motif: Influence of hydrogen bonding versus solvent interactions on the preferred conformation. J. Am. Chem. Soc. 128, 14640–14648. Corzana, F., Busto, J. H., Jimenez-Oses, G., de Luis, M. G., Asensio, J. L., JimenezBarbero, J., Peregrina, J. M., and Avenoza, A. (2007). Serine versus threonine glycosylation: The methyl group causes a drastic alteration on the carbohydrate orientation and on the surrounding water shell. J. Am. Chem. Soc. 129, 9458–9467. Corzana, F., Busto, J. H., de Luis, M. G., Jimenez-Barbero, J., Avenoza, A., and Peregrina, J. M. (2009). The nature and sequence of the amino acid aglycone strongly modulates the conformation and dynamics effects of Tn antigen’s clusters. Chem. Eur. J. 15, 3863–3874. Cummings, R. D. (2009). The repertoire of glycan determinants in the human glycome. Mol. Biosyst. 5, 1087–1104. de Alba, E., and Tjandra, N. (2002). NMR dipolar couplings for the structure determination of biopolymers in solution. Prog. Nucl. Magn. Reson. Spectrosc. 40, 175–197. de Beer, T., van Zuylen, C. E. M., Hard, K., Boelens, R., Kaptein, R., Kamerling, J. P., and Vliegenthart, J. F. G. (1994). Rapid and simple approach for the NMR resonance assignment of the carbohydrate chains of an intact glycoprotein—application of gradientenhanced natural-abundance H-1-C-13 HSQC and HSQC-TOCSY to the alpha-subunit of human chorionic-gonadotropin. FEBS Lett. 348, 1–6. Deisenhofer, J. (1981). Crystallographic refinement and atomic models of a human fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-A˚ resolution. Biochemistry 20, 2361–2370. Dziadek, S., Griesinger, C., Kunz, H., and Reinscheid, U. M. (2006). Synthesis and structural model of an alpha(2, 6)-sialyl-T glycosylated MUC1 eicosapeptide under physiological conditions. Chem. Eur. J. 12, 4981–4993. Erbel, P. J. A., Karimi-Nejad, Y., van Kuik, J. A., Boelens, R., Kamerling, J. P., and Vliegenthart, J. F. G. (2000). Effects of the N-linked glycans on the 3D structure of the free alpha-subunit of human chorionic gonadotropin. Biochemistry 39, 6012–6021.
384
Adam W. Barb et al.
Fukuda, M., Carlsson, S. R., Klock, J. C., and Dell, A. (1986). Structures of O-linked oligosaccharides isolated from normal granulocytes, chronic myelogenous leukemiacells, and acute myelogenous leukemia-cells. J. Biol. Chem. 261, 2796–2806. Garner, O. B., and Baum, L. G. (2008). Galectin-glycan lattices regulate cell-surface glycoprotein organization and signaling. Biochem. Soc. Trans. 36, 1472–1477. Gerken, T. A., and Jentoft, N. (1987). Structure and dynamics of porcine submaxillary mucin as determined by natural abundance C-13 NMR-spectroscopy. Biochemistry 26, 4689–4699. Gerken, T. A., Butenhof, K. J., and Shogren, R. (1989). Effects of glycosylation on the conformation and dynamics of O-linked glycoproteins—C-13 NMR-studies of ovine submaxillary mucin. Biochemistry 28, 5536–5543. Glithero, A., Tormo, J., Haurum, J. S., Arsequell, G., Valencia, G., Edwards, J., Springer, S., Townsend, A., Pao, Y. L., Wormald, M., Dwek, R. A., Jones, E. Y., et al. (1999). Crystal structures of two H-2D(b)/glycopeptide complexes suggest a molecular basis for CTL cross-reactivity. Immunity 10, 63–74. Gomes, M. M., Wall, S. B., Takahashi, K., Novak, J., Renfrow, M. B., and Herr, A. B. (2008). Analysis of IgA1 N-glycosylation and its contribution to Fc alpha RI binding. Biochemistry 47, 11285–11299. Gong, B., Cukan, M., Fisher, R., Li, H., Stadheim, T. A., and Gerngross, T. (2009). Characterization of N-linked glycosylation on recombinant glycoproteins produced in Pichia pastoris using ESI-MS and MALDI-TOF. Meth. Mol. Biol. 534, 213–223. Grinstead, J. S., Koganty, R. R., Krantz, M. J., Longenecker, B. M., and Campbell, A. P. (2002). Effect of glycosylation on muc1 humoral immune recognition: NMR studies of MUC1 glycopeptide-antibody interactions. Biochemistry 41, 9946–9961. Hanson, S. R., Culyba, E. K., Hsu, T. L., Wong, C. H., Kelly, J. W., and Powers, E. T. (2009). The core trisaccharide of an N-linked glycoprotein intrinsically accelerates folding and enhances stability. Proc. Natl. Acad. Sci. USA 106, 3131–3136. Herr, A. B., Ballister, E. R., and Bjorkman, P. J. (2003). Insights into IgA-mediated immune responses from the crystal structures of human Fc alpha RI and its complex with IgA1-Fc. Nature 423, 614–620. Holland, M., Takada, K., Okumoto, T., Takahashi, N., Kato, K., Adu, D., Ben-Smith, A., Harper, L., Savage, C. O., and Jefferis, R. (2002). Hypogalactosylation of serum IgG in patients with ANCA-associated systemic vasculitis. Clin. Exp. Immunol. 129, 183–190. Ishima, R., and Torchia, D. A. (2000). Protein dynamics from NMR. Nat. Struct. Biol. 7, 740–743. Kan, C., and Danishefsky, S. J. (2009). Recent departures in the synthesis of peptides and glycopeptides. Tetrahedron 65, 9047–9065. Kaneko, Y., Nimmerjahn, F., and Ravetch, J. V. (2006). Anti-inflammatory activity of immunoglobulin G resulting from Fc sialylation. Science 313, 670–673. Kirnarsky, L., Prakash, O., Vogen, S. M., Nomoto, M., Hollingsworth, M. A., and Sherman, S. (2000). Structural effects of O-glycosylation on a 15-residue peptide from the mucin (MUC1) core protein. Biochemistry 39, 12076–12082. Kobata, A. (2008). The N-linked sugar chains of human immunoglobulin G: Their unique pattern, and their functional roles. Biochim. Biophys. Acta Gen. Subj. 1780, 472–478. Kollman, J. M., Pandi, L., Sawaya, M. R., Riley, M., and Doolittle, R. F. (2009). Crystal structure of human fibrinogen. Biochemistry 48, 3877–3886. Krapp, S., Mimura, Y., Jefferis, R., Huber, R., and Sondermann, P. (2003). Structural analysis of human IgG-Fc glycoforms reveals a correlation between glycosylation and structural integrity. J. Mol. Biol. 325, 979–989. Lane, A. N., Hays, L. M., Feeney, R. E., Crowe, L. M., and Crowe, J. H. (1998). Conformational and dynamic properties of a 14 residue antifreeze glycopeptide from antarctic cod. Protein Sci. 7, 1555–1563.
Intramolecular Interactions
385
Leatherbarrow, R. J., Rademacher, T. W., Dwek, R. A., Woof, J. M., Clark, A., Burton, D. R., Richardson, N., and Feinstein, A. (1985). Effector functions of a monoclonal aglycosylated mouse IgG2a: Binding and activation of complement component C1 and interaction with human monocyte Fc receptor. Mol. Immunol. 22, 407–415. Lee, J. E., Fusco, M. L., and Saphire, E. O. (2009). An efficient platform for screening expression and crystallization of glycoproteins produced in human cells. Nat. Protoc. 4, 592–604. Li, P. Z., Go, X. G., Arellano, R. O., and Renugopalakrishnan, V. (2001). Glycosylated and phosphorylated proteins—expression in yeast and oocytes of xenopus: Prospects and challenges—relevance to expression of thermostable proteins. Protein Expr. Purif. 22, 369–380. Liu, M., Barany, G., and Live, D. (2005). Parallel solid-phase synthesis of mucin-like glycopeptides. Carbohydr. Res. 340, 2111–2122. Liu, S., Venot, A., Meng, L., Tian, F., Moremen, K. W., Boons, G. J., and Prestegard, J. H. (2007). Spin-labeled analogs of CMP-NeuAc as NMR probes of the alpha-2, 6-sialyltransferase ST6Gal 1. Chem. Biol. 14, 409–418. Liu, M., Borgert, A., Barany, G., and Live, D. (2008). Conformational consequences of protein glycosylation: Preparation of O-mannosyl serine and threonine building blocks, and their incorporation into glycopeptide sequences derived from alpha-dystroglycan. Biopolymers 90, 358–368. Lund, J., Takahashi, N., Pound, J. D., Goodall, M., and Jefferis, R. (1996). Multiple interactions of IgG with its core oligosaccharide can modulate recognition by complement and human Fc gamma receptor i and influence the synthesis of its oligosaccharide chains. J. Immunol. 157, 4963–4969. Lustbader, J. W., Birken, S., Pollak, S., Pound, A., Chait, B. T., Mirza, U. A., Ramnarain, S., Canfield, R. E., and Brown, J. M. (1996). Expression of human chorionic gonadotropin uniformly labeled with NMR isotopes in Chinese hamster ovary cells: An advance toward rapid determination of glycoprotein structures. J. Biomol. NMR 7, 295–304. Lutteke, T. (2009). Analysis and validation of carbohydrate three-dimensional structures. Acta Crystallogr. D Biol. Crystallogr. 65, 156–168. Macnaughtan, M. A., Tian, F., Liu, S., Meng, L., Park, S., Azadi, P., Moremen, K. W., and Prestegard, J. H. (2008). C-13-sialic acid labeling of glycans on glycoproteins using ST6Gal 1. J. Am. Chem. Soc. 130, 11864–11865. Mandel, A. M., Akke, M., and Palmer, A. G. (1995). Backbone dynamics of Escherichia-coli ribonuclease H1—correlations with structure and function in an active enzyme. J. Mol. Biol. 246, 144–163. Matsushita, T., Hinou, H., Fumoto, M., Kurogochi, M., Fujitani, N., Shimizu, H., and Nishimura, S. I. (2006). Construction of highly glycosylated mucin-type glycopeptides based on microwave-assisted solid-phase syntheses and enzymatic modifications. J. Org. Chem. 71, 3051–3063. Meyer, B., and Moller, H. (2007). Conformation of glycopeptides and glycoproteins. Top. Curr. Chem. 267, 187–251. Mimura, Y., Yamamoto, Y., Inoue, Y., and Chujo, R. (1992). NMR-study of interaction between sugar and peptide moieties in mucin-type model glycopeptides. Int. J. Biol. Macromol. 14, 242–248. Mimura, Y., Sondermann, P., Ghirlando, R., Lund, J., Young, S. P., Goodall, M., and Jefferis, R. (2001). Role of oligosaccharide residues of IgG1-Fc in Fc gamma RIIb binding. J. Biol. Chem. 276, 45539–45547. Naganagowda, G. A., Gururaja, T. L., Satyanarayana, J., and Levine, M. J. (1999). NMR analysis of human salivary mucin (MUC7) derived O-linked model glycopeptides: Comparison of structural features and carbohydrate-peptide interactions. J. Pept. Res. 54, 290–310.
386
Adam W. Barb et al.
Narhi, L. O., Arakawa, T., Aoki, K. H., Elmore, R., Rohde, M. F., Boone, T., and Strickland, T. W. (1991). The effect of carbohydrate on the structure and stability of erythropoietin. J. Biol. Chem. 266, 23022–23026. North, S. J., Huang, H. H., Sundaram, S., Jang-Lee, J., Etienne, A. T., Trollope, A., Chalabi, S., Dell, A., Stanley, P., and Haslam, S. M. (2010). Glycomics profiling of Chinese hamster ovary cell glycosylation mutants reveals N-glycans of a novel size and complexity. J. Biol. Chem. 285, 5759–5775. Ohtsubo, K., and Marth, J. D. (2006). Glycosylation in cellular mechanisms of health and disease. Cell 126, 855–867. Ottiger, M., and Bax, A. (1999). Bicelle-based liquid crystals for NMR-measurement of dipolar couplings at acidic and basic pH values. J. Biomol. NMR 13, 187–191. Parekh, R. B., Dwek, R. A., Sutton, B. J., Fernandes, D. L., Leung, A., Stanworth, D., Rademacher, T. W., Mizuochi, T., Taniguchi, T., Matsuta, K., et al. (1985). Association of rheumatoid arthritis and primary osteoarthritis with changes in the glycosylation pattern of total serum IgG. Nature 316, 452–457. Payne, R. J., and Wong, C. H. (2010). Advances in chemical ligation strategies for the synthesis of glycopeptides and glycoproteins. Chem. Commun. 46, 21–43. Petrescu, A. J., Milac, A. L., Petrescu, S. M., Dwek, R. A., and Wormald, M. R. (2004). Statistical analysis of the protein environment of N-glycosylation sites: Implications for occupancy, structure, and folding. Glycobiology 14, 103–114. Petrescu, A. J., Wormald, M. R., and Dwek, R. A. (2006). Structural aspects of glycomes with a focus on N-glycosylation and glycoprotein folding. Curr. Opin. Struct. Biol. 16, 600–607. Piontek, C., Silva, D. V., Heinlein, C., Pohner, C., Mezzato, S., Ring, P., Martin, A., Schmid, F. X., and Unverzagt, C. (2009). Semisynthesis of a homogeneous glycoprotein enzyme: Ribonuclease C: Part 2. Angew. Chem. Int. Ed. 48, 1941–1945. Plummer, T. H., Jr., and Tarentino, A. L. (1991). Purification of the oligosaccharidecleaving enzymes of Flavobacterium meningosepticum. Glycobiology 1, 257–263. Radaev, S., Motyka, S., Fridman, W. H., Sautes-Fridman, C., and Sun, P. D. (2001). The structure of a human type III Fc gamma receptor in complex with Fc. J. Biol. Chem. 276, 16469–16477. Raju, T. S., Briggs, J. B., Chamow, S. M., Winkler, M. E., and Jones, A. J. (2001). Glycoengineering of therapeutic glycoproteins: In vitro galactosylation and sialylation of glycoproteins with terminal N-acetylglucosamine and galactose residues. Biochemistry 40, 8868–8876. Rice, K. G. (2000). Derivatization strategies for preparing N-glycan probes. Anal. Biochem. 283, 10–16. Rich, J. R., and Withers, S. G. (2009). Emerging methods for the production of homogeneous human glycoproteins. Nat. Chem. Biol. 5, 206–215. Roitt, I. M., Brostoff, J., and Male, D. K. (2001). Immunology Mosby, Edinburgh. Rose, M. C., Voter, W. A., Sage, H., Brown, C. F., and Kaufman, B. (1984). Effects of deglycosylation on the architecture of ovine submaxillary mucin glycoprotein. J. Biol. Chem. 259, 3167–3172. Sanchez, L. M., Chirino, A. J., and Bjorkman, P. (1999). Crystal structure of human ZAG, a fat-depleting factor related to MHC molecules. Science 283, 1914–1919. Sasaki, T., Yamada, H., Matsumura, K., Shimizu, T., Kobata, A., and Endo, T. (1998). Detection of O-mannosyl glycans in rabbit skeletal muscle alpha-dystroglycan. Biochim. Biophys. Acta Gen. Subj. 1425, 599–606. Scallon, B. J., Tam, S. H., McCarthy, S. G., Cai, A. N., and Raju, T. S. (2007). Higher levels of sialylated Fc glycans in immunoglobulin G molecules can adversely impact functionality. Mol. Immunol. 44, 1524–1534.
Intramolecular Interactions
387
Schuster, O., Klich, G., Sinnwell, V., Kranz, H., Paulsen, H., and Meyer, B. (1999). ’Wavetype’ structure of a synthetic hexaglycosylated decapeptide: A part of the extracellular domain of human glycophorin A. J. Biomol. NMR 14, 33–45. Schwarz, F., Huang, W., Li, C. S., Schulz, B. L., Lizak, C., Palumbo, A., Numao, S., Neri, D., Aebi, M., and Wang, L. X. (2010). A combined method for producing homogeneous glycoproteins with eukaryotic N-glycosylation. Nat. Chem. Biol. 6, 264–266. Schwieters, C. D., Kuszewski, J. J., and Clore, G. M. (2006). Using Xplor-NIH for NMR molecular structure determination. Prog. Nucl. Magn. Reson. Spectrosc. 48, 47–62. Shogren, R., Gerken, T. A., and Jentoft, N. (1989). Role of glycosylation on the conformation and chain dimensions of O-linked glycoproteins—light-scattering-studies of ovine submaxillary mucin. Biochemistry 28, 5525–5536. Simanek, E. E., Huang, D. H., Pasternack, L., Machajewski, T. D., Seitz, O., Millar, D. S., Dyson, H. J., and Wong, C. H. (1998). Glycosylation of threonine of the repeating unit of RNA polymerase II with beta-linked N-acetylglucosame leads to a turnlike structure. J. Am. Chem. Soc. 120, 11567–11575. Slynko, V., Schubert, M., Numao, S., Kowarik, M., Aebi, M., and Allain, F. H. T. (2009). NMR structure determination of a segmentally labeled glycoprotein using in vitro glycosylation. J. Am. Chem. Soc. 131, 1274–1281. Springer, G. F. (1997). Immunoreactive T and Tn epitopes in cancer diagnosis, prognosis, and immunotherapy. J. Mol. Med. 75, 594–602. Szakonyi, G., Klein, M. G., Hannan, J. P., Young, K. A., Ma, R. L. Z., Asokan, R., Holers, V. M., and Chen, X. J. S. (2006). Structure of the Epstein-Barr virus major envelope glycoprotein. Nat. Struct. Mol. Biol. 13, 996–1001. Takahashi, N., Nakagawa, H., Fujikawa, K., Kawamura, Y., and Tomiya, N. (1995). Threedimensional elution mapping of pyridylaminated N-linked neutral and sialyl oligosaccharides. Anal. Biochem. 226, 139–146. Takeuchi, H., Kato, K., Hassan, H., Clausen, H., and Irimura, T. (2002). O-GalNAc incorporation into a cluster acceptor site of three consecutive threonines—distinct specificity of GalNAc-transferase isoforms. Eur. J. Biochem. 269, 6173–6183. Tarp, M. A., Sorensen, A. L., Mandel, U., Paulsen, H., Burchell, J., TaylorPapadimitriou, J., and Clausen, H. (2007). Identification of a novel cancer-specific immunodominant glycopeptide epitope in the MUC1 tandem repeat. Glycobiology 17, 197–209. Ten Hagen, K. G., Fritz, T. A., and Tabak, L. A. (2003). All in the family: The UDPGalNAc: Polypeptide N-acetylgalactosaminyltransferases. Glycobiology 13, 1R–16R. Toyoda, T., Itai, T., Arakawa, T., Aoki, K. H., and Yamaguchi, H. (2000). Stabilization of human recombinant erythropoietin through interactions with the highly branched Nglycans. J. Biochem. 128, 731–737. Toyoda, T., Arakawa, T., and Yamaguchi, H. (2002). N-glycans stabilize human erythropoietin through hydrophobic interactions with the hydrophobic protein surface: Studies by surface plasmon resonance analysis. J. Biochem. 131, 511–515. van Kooyk, Y., and Rabinovich, G. A. (2008). Protein-glycan interactions in the control of innate and adaptive immune responses. Nat. Immunol. 9, 593–601. Varki, A., Cummings, R. D., Esko, J. D., Freeze, H. H., Stanley, P., Bertozzi, C. R., Hart, G. W., and Mee, E. (2009). Essentials of Glycobiology Cold Spring Harbor Press, Cold Spring Harbor, New York. Vliegenthart, J. F. G., Dorland, L., and Van Halbeek, H. (1983). 1H-nuclear magnetic resonance spectroscopy as a tool in the structural analysis of carbohydrates related to glycoproteins. Adv. Carbohydr. Chem. Biochem. 41, 209–374. Wang, L. X. (2008). Chemoenzymatic synthesis of glycopeptides and glycoproteins through endoglycosidase-catalyzed transglycosylation. Carbohydr. Res. 343, 1509–1522.
388
Adam W. Barb et al.
Weller, C. T., Lustbader, J., Seshadri, K., Brown, J. M., Chadwick, C. A., Kolthoff, C. E., Ramnarain, S., Pollak, S., Canfield, R., and Homans, S. W. (1996). Structural and conformational analysis of glycan moieties in situ on isotopically C-13, N-15-enriched recombinant human chorionic gonadotropin. Biochemistry 35, 8815–8823. Whelan, S. A., and Hart, G. W. (2006). Identification of O-GlcNAc sites on proteins. In ‘‘Methods in Enzymology,’’ (M. Fukuda, ed.)., Vol. 415, pp.113–133. Wyss, D. F., Choi, J. S., Li, J., Knoppers, M. H., Willis, K. J., Arulanandam, A. R. N., Smolyar, A., Reinherz, E. L., and Wagner, G. (1995). Conformation and function of the N-linked glycan in the adhesion domain of human CD2. Science 269, 1273–1278. Yamaguchi, Y., Kato, K., Shindo, M., Aoki, S., Furusho, K., Koga, K., Takahashi, N., Arata, Y., and Shimada, I. (1998). Dynamics of the carbohydrate chains attached to the Fc portion of immunoglobulin G as studied by NMR spectroscopy assisted by selective C-13 labeling of the glycans. J. Biomol. NMR 12, 385–394. Yamaguchi, Y., Nishimura, M., Nagano, M., Yagi, H., Sasakawa, H., Uchida, K., Shitara, K., and Kato, K. (2006). Glycoform-dependent conformational alteration of the Fc region of human immunoglobulin G1 as revealed by NMR spectroscopy. Biochim. Biophys. Acta Gen. Subj. 1760, 693–700. Yamamoto, N., Tanabe, Y., Okamoto, R., Dawson, P. E., and Kajihara, Y. (2008). Chemical synthesis of a glycoprotein having an intact human complex-type sialyloligosaccharide under the Boc and Fmoc synthetic strategies. J. Am. Chem. Soc. 130, 501–510.
C H A P T E R
N I N E T E E N
Methods to Study the Biosynthesis of Bacterial Furanosides Myles B. Poulin and Todd L. Lowary Contents 1. Introduction 2. Chemoenzymatic Preparation of Furanose Nucleotides 2.1. Discussion 2.2. Procedure 3. Pyranose–Furanose Mutases Involved in Furanose Nucleotide Biosynthesis 3.1. Discussion 3.2. HPLC assays for UGM activity 4. Galactofuranosyltransferases Involved in Galactofuranoside Biosynthesis 4.1. Discussion 4.2. Enzyme-coupled spectrophotometric assay for GlfT2 activity Acknowledgments References
390 393 393 394 398 398 399 402 402 403 407 407
Abstract Carbohydrates in the thermodynamically disfavored furanose ring conformation are not present in mammalian glycoconjugates, but are widespread in the glycans produced by many bacterial pathogens. In bacteria, these furanose sugars are often found in cell surface glycoconjugates, and are essential for the viability or virulence of the organisms. As a result, the enzymes involved in the biosynthesis of bacterial furanosides are attractive targets as potential selective antimicrobial chemotherapeutics. However, before such chemotherapeutics can be designed, synthesized, and evaluated, more information about the activity and specificity of these enzymes is required. This chapter describes assays that have been used to study enzymes involved in the biosynthesis of one of the most abundant naturally occurring furanose residues, galactofuranose (Galf ). In particular, the focus is on UDP-galactopyranose mutase and galactofuranosyltransferases. The assays described in this chapter require The Alberta Ingenuity Centre for Carbohydrate Science, Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78019-8
#
2010 Elsevier Inc. All rights reserved.
389
390
Myles B. Poulin and Todd L. Lowary
UDP-galactofuranose (UDP-Galf); therefore, a procedure for the preparation of UDP-Galf, as well as various UDP-Galf derivatives, using a three-enzyme chemoenzymatic procedure, is also described.
1. Introduction In addition to thermodynamically favored pyranose sugars, bacteria also produce polysaccharides and glycoconjugates containing saccharides in the five-membered furanose ring conformation. These thermodynamically disfavored furanose sugars are absent in mammalian glycoconjugates, but are widespread in other domains of life ranging from bacteria and archaebacteria, to protozoa, fungi, and plants (Peltier et al., 2008a; Richards and Lowary, 2009). In many pathogenic bacteria, these furanose sugars are found in key cell surface glycoconjugates, including the lipopolysaccharide (LPS) O antigens of Escherichia coli (Stevenson et al., 1994), Klebsiella pneumoniae (Ko¨plin et al., 1997), and Samonella typhimurium (Berst et al., 1969), the capsular polysaccharide (CPS) of Campylobacter jejuni (Hanniffy et al., 1999; McNally et al., 2005; St. Michael et al., 2002), and the mycolyl arabinogalactan (mAG) complex and lipoarabinomannan (LAM) of mycobacteria (Bhamidi et al., 2008; Brennan and Nikaido, 1995), among others. In many of these organisms, the furanose residues in these glycans have been demonstrated to be essential for cell viability, or play a critical role in cell physiology (Lee et al., 1997; Pan et al., 2001). Because these furanosides are absent from mammalian glycoconjugates, there has been a surge of interest in developing inhibitors of furanose biosynthesis as potential selective chemotherapeutics to treat these pathogenic microorganisms (Lowary, 2003; Pedersen and Turco, 2003; Umesiri et al., 2010). The hexofuranose D-galactofuranose (Galf ), the pentofuranose D-arabinofuranose (Araf ), and the hexulose D-fructofuranose (Fruf ), represent three of the most common furanose sugars found in bacterial glycans, and each of these three furanose sugars employ a different type of activated furanoside donor in their biosynthesis. Microbial fructans are polymers of 20–10,000 Fruf units containing repeating b-(2!1) (inulins), b-(2!6) (levans), or a combination of b-(2!1) and b–(2!6) (mixed levans) glycosidic linkages, which are attached to the Fruf residue of D-sucrose (Velazquez-Hernandez et al., 2009). The fructosyltransferases (FruT) involved in the biosynthesis of microbial fructans are members of the glycoside hydrolase family 68, and catalyze the transglycosylation of Fruf using D-sucrose as the furanose donor (van Hijum et al., 2006) as shown (Fig. 19.1). Fruf residues have also been identified in other microbial glycoconjugates, such as the CPS of C. jejuni HS:1 (McNally et al., 2005); however, it is unclear whether these Fucf residues are also incorporated from D-sucrose.
391
Biosynthesis of Bacterial Furanosides
HO OH HO HO
O
O
O
O
O
HO
OH
HO HO
OH
HO
OH O
HO
O
O O
OH 6-Ketose
OH OH
Levan
OH
OH
HO +
HO HO
OH
HO HO
OH
HO
OH
HO OH O O
FruT O
HO O
OH
OH HO D-sucrose
OH
O OH
OH HO HO
O HO
OH HO HO
O
OH OH OH O
OH O
Inulin OH
OH HO 1-Ketose
Figure 19.1 Biosynthetic scheme for microbial fructan biosynthesis. Fructosyltransferase (FruT) enzymes catalyze the transglycosylation of Fruf from D-sucrose in the synthesis of levan and inulin polysaccharides.
The only known pathway for the biosynthesis of Araf residues present in the mAG complex and LAM of mycobacterial species utilize the lipid donor decaprenyl-phospho-arabinose (DPA) as the sole Araf source (Wolucka, 2008; Wolucka and Dehoffmann, 1995). A water soluble uridine diphosphate (UDP) derivative of Araf has also been reported in Mycobacterium smegmatis (Singh and Hogan, 1994); however, there have been no subsequent reports to demonstrate a possible biosynthetic role for UDP-Araf. Isotope labeling experiments where M. smegmatis cells were incubated with 14C- and 13C-labeled glucose elegantly show that neither the pentose phosphate pathway, which would result in the loss of C1 of glucose, or the uronic acid pathway, which would result in the loss of C6 of glucose, are involved in the biosynthesis of Araf (Klutts et al., 2002). Instead, a nonoxidative pentose phosphate pathway is utilized. Other isotope labeling experiments with 14C-labeled 5-phosphoribose-1-pyrophosphate (5-PRib-1-PP) implicate this species as an intermediate in the biosynthesis of DPA as well as decaprenyl-phospho-ribose (DPR) (Scherman et al., 1996). The subsequent identification of the mycobacterial DPR 50 -phosphate synthetase (Huang et al., 2005), and decaprenyl-phospho-ribose 20 -epimerase (DPRE) (Mikusˇova´ et al., 2005) led to the proposed pathway (Fig. 19.2) for the biosynthesis of Araf in mycobacteria. Six arabinofuranosyltransferase (Aft) enzymes involved in the biosynthesis of mycobacterial cell wall arabinan have been identified (Berg et al., 2007; Tam and Lowary, 2009); however, the exact role of many of these proteins in mAG and LAM assembly remain to be determined, and it is likely that other arabinofuranosyltransferases exist. It should be noted that while (myco)bacterial species use lipid linked donors to incorporate D-arabinofuranose residues into their glycoconjugates, plants, which produce large amounts of L-arabinofuranose-containing glycans, do
392
Glc-6-P
Myles B. Poulin and Todd L. Lowary
Non-oxidative pentose phosphate Pathway
Rib-5-P
i.
Rib-1-PP-5-P
ii.
Decaprenyl-P-Rib-5-P iii.
Araf containing glycocongugates
v.
Decaprenyl-PAraf
iv.
Decaprenyl-P-Ara-5-P
Figure 19.2 Biosynthetic scheme for Araf-containing glycocongugates in mycobacteria using decaprenyl-P-Araf donor. (i) Phosphoribosylpyrophosphate synthetase (PRPP); (ii) decaprenyl-phospho-ribose 50 -phosphate synthetase; (iii) phosphatase; (iv) decaprenyl-phospho-ribose 20 -epimerase; (v) arabinofuranosyltransferase (Aft).
Glc-1-P
GalU
UDP-Glc
GalE
Galactose salvage pathway b –Galp
GMR
a–Galp
GK
UDP-Galp
UGM
UDP-Galf
GIfT
Galf-containing glycocongugates
GalPUT Galp-1-P
Figure 19.3 Biosynthetic scheme for galactofuranose-containing glycoconjugates. The UDP-Galf donor utilized for Galf incorporation by galactofuranosyltransferases (GlfTs) is synthesized from UDP-Galp by UDP-galactopyranose mutases (UGMs). Two pathways for the biosynthesis of UDP-Galp are shown, the de novo pathway for UDP-Galp biosynthesis as well as galactose salvage pathway. GalU ¼ UDP-glucosepyrophosphatase; GalE ¼ glucose-4-epimerase; GMR ¼ galactose mutarotase; GK ¼ galactokinase; GalPUT ¼ galactose-1-phosphate–uridylyltransferase.
so via enzymes that recognize the sugar nucleotide UDP-L-Araf as the donor species (Konishi et al., 2007; Reiter and Vanzin, 2001). Galf residues are incorporated into bacterial glycans using nucleotideactivated sugar donors (Fig. 19.3). Early studies established that the Galf in S. typhimurium is synthesized from a derivative of galactopyranose and that the ring contraction does not occur at the level of either free galactose or galactose-1-phosphate (Nikaido and Sarvas, 1971; Sarvas and Nikaido, 1971). The enzyme uridine 50 -diphospho-galactopyranose mutase (UGM), which was first identified in E. coli (Nassau et al., 1996) and subsequently in K. pneumonia (Ko¨plin et al., 1997), Mycobacterium tuberculosis (Weston et al., 1998), and Deinococcus radiodurans (Partha et al., 2009b), was found to carry out the ring contraction of uridine 50 -diphospho-D-galactopyranose (UDP-Galp) to uridine 50 -diphospho-D-galactofuranose (UDPGalf), the biosynthetic precursor of bacterial Galf residues. The UDP-Galp originates either from glucopyranose-1-phosphate by de novo biosynthesis, or from free galactose via the galactose salvage pathway (Thibodeaux et al., 2008). Enzymes known as galactofuranosyltransferases (GlfTs) catalyze the final coupling of UDP-Galf to the appropriate Galf-containing glycans.
Biosynthesis of Bacterial Furanosides
393
In this chapter, we describe assays used to study the enzymes involved in the biosynthesis of Galf-containing bacterial glycoconjugates; specifically, the UGM and GlfT proteins. We also provide a procedure for the chemoenzymatic preparation of UDP-Galf (and derivatives of UDP-Galf ) that takes advantage of the reduced substrate specificity of enzymes from the galactose salvage pathway.
2. Chemoenzymatic Preparation of Furanose Nucleotides 2.1. Discussion The assays described in this chapter are used to study the biosynthesis of Galf-containing glycoconjugates; as a result, these assays require the use of the nucleotide-activated galactofuranose donor, UDP-Galf. Multiple chemical syntheses of this activated Galf donor have been reported using standard pyrophosphate bond formation reactions between galactofuranose-1-phosphate (Galf-1-P) and UMP-morpholidate (Zhang and Liu, 2000), UMP-Nmethylimidazolide (Marlow and Kiessling, 2001), or N,N-carbonyldiimidazole (CDI) activated UMP (Tsvetkov and Nikolaev, 2000). Direct glycosylation of 1-thio-a-D-galactofuranosides with UDP (Peltier et al., 2007) has also been employed for the chemical synthesis of UDP-Galf. In addition, an enzymatic method for the production of UDP-Galf from UDP-Galp utilizing E. coli UGM was reported (Lee et al., 1996); however, at equilibrium only 10% of the desired UDP-Galf is produced. The low yields of these chemical and enzymatic syntheses make them impractical for the production of sufficient quantities of the UDP-Galf donor required to carry out detailed studies of galactofuranose biosynthesis. This procedure, originally developed by Field and coworkers (Errey et al., 2004), details the chemoenzymatic preparation of UDP-Galf (2) and UDP-Galf derivatives from the corresponding Galf-1-P (1) or Galf-1-P derivatives, UTP, and uridine-50 -diphospho-D-glucose (UDP-Glc) using three enzymes (Scheme 19.1). Galf-1-P (or derivatives thereof) and UDPGlc react to form UDP-Galf and glucose-1-phosphate (Glc-1-P) catalyzed by immobilized galactose-1-phosphate uridyltransferase (GalPUT, EC 2.7.7.12) (Liu et al., 2002). The UTP reacts with Glc-1-P to regenerate UDP-Glc catalyzed by UDP-glucose pyrophosphorylase (GalU, EC 2.7.7.9) and the inorganic pyrophosphate (PPi) produced is cleaved to inorganic phosphate by inorganic pyrophosphatase (IPP, EC 3.6.1.1). This procedure takes advantage of the reduced substrate specificity of the GalPUT enzyme of the galactose salvage pathway, which allows it to tolerate various Galp-1-P and Galf-1-P derivatives as substrates (Errey et al., 2004; Peltier et al., 2008b).
394
A
Myles B. Poulin and Todd L. Lowary
HO O HO HO
1
B O O P O– – OH O
HO O HO
3
UDP-Glc
PPi
IPP
HO O
2Pi HO
GalPUT
GalU Glc-1-P
HO
2
O O P O– – OH O
HO O
UTP HO
HO O HO
5
OUDP OH
F
7 HO O
HO
9
O O P O– – OH O
O O P O– – OH O
HO O HO
4 HO O HO
6
OUDP OH
HO O HO F
O O P O– – OH O
OUDP OH
8
OUDP OH
HO O
HO
OUDP OH
10
Scheme 19.1 (A) Generation of UDP-Galf (2) from Galf-1-P using three-enzyme chemoenzymatic reaction. (B) Other Galf-1-P derivitive used to synthesize UDP-Galf derivatives using three-enzyme chemoenzymatic reaction. UDP-Fucf (4), UDP-Araf (6), UDP-6F-Galf (8), and UDP-5d-Galf (10).
2.2. Procedure 2.2.1. Materials and methods Soluble GalU (EC 2.7.7.9, E. coli) was prepared by the method of Wang and coworkers (Liu et al., 2002) with minor modifications. Briefly, the galU gene of E. coli K-12 substrain MG 1655 was cloned and inserted into a pET15b vector using XhoI and BamHI restriction sites. Soluble GalU was expressed in E. coli BL-21 Origami cells and purified using a nickel– nitrilotriacetic (Ni–NTA) column. Alternatively GalU may be purchased from Sigma. Uridine 50 -diphosphoglucose disodium salt (UDP-Glc), uridine 50 -triphosphate trisodium salt (UTP), and IPP were obtained from Sigma-Aldrich (St. Louis, MO). The chemical synthesis of galactose-1phosphate di-triethylammonium salt (1) was achieved as previously reported (de Lederkremer et al., 1994; Tsvetkov and Nikolaev, 2000) and will not be discussed here. All other chemicals and biochemicals were reagent grade and utilized without further purification. 2.2.2. Immobilization of GalPUT The procedures of Wang and coworkers (Li et al., 2004; Liu et al., 2002) and Field and coworkers (Errey et al., 2004) for the cloning and immobilization GalPUT were followed (with minor modifications) as described below. The galPUT gene was cloned from E. coli K-12 sub-strain MG 1655 (ATCC #47076) as described by Wang and coworkers (Liu et al., 2002), and inserted into pET15b expression vector (Novagen) using Nde1 and BamH1
Biosynthesis of Bacterial Furanosides
395
restriction sites. E. coli DH5-a cloning strain then E. coli BL-21 Origami (Novagen) expression strain were then transformed with the pET15b-GalPUT vector. The expression strain BL-21 Origami was grown in 100 mL of Luria–Bertani (LB) broth containing 100 mg/mL of ampicillin overnight at 37 C in a shaker–incubator, then 50 mL was transferred into fresh LB broth (1 L) with ampicillin and grown for an additional 2 h at 37 C until and optical density at 600 nm of 0.6–0.8 was observed. Expression of GalPUT containing a C-terminal His-tag was induced using 1 mM isopropyl 1-thio-b-D-galactopyranoside (IPTG) and the culture was incubated for an additional 5 h in a shaker–incubator at 30 C. Cells were harvested by centrifugation (Beckman centrifuge, 11,325g, 15 min, 4 C) and the cell paste was stored at –20 C. It is important to note that storage of the cell paste longer than 3 months results in a significant decrease in enzyme activity. Cell paste from 2 L of culture was resuspended in 100 mL (1/20th the culture volume) of resuspension buffer (300 mM NaCl, 10 mM imidazole, and 50 mM sodium phosphate, pH 8.0, supplemented with protease inhibitors) and lysed using a benchtop cell disruptor (Constant Systems Inc., NC) set to 20 Kpsi. The insoluble cellular debris was removed by centrifugation (Beckman Ultracentrifuge, 105,000g, 1H, 4 C). The supernatant was applied to a 10 mL column of Ni–NTA agarose resin (Qiagen), equilibrated with 3 column volumes of resuspension buffer at 4 C, with a flow rate of 1 mL/min and the absorbance of the flow through was monitored at 280 nm. The resin was washed with 4–5 column volumes of wash buffer (300 mM NaCl, 20 mM imidazole, 50 mM sodium phosphate, pH 8.0) until the elution profile returned to baseline. At this stage GalPUT remained immobilized on the resin. The immobilized GalPUT was equilibrated with 4 column volumes of GalPUT reaction buffer (5 mM KCl, 10 mM MgCl2, 50 mM HEPES, pH 8.0). The resin containing immobilized GalPUT was used directly for the generation of UDP-Galf. The immobilized enzyme should be used within 3–4 days of generation or, for best results, immediately after production. 2.2.3. Generation of UDP-galactofuranose (2) The chemoenzymatic reaction was carried out in 1 dram plastic vials. UTP (24.4 mg, 40 mmol) was added to a solution of Galf-1-P (20.4 mg, 44 mmol) prepared in 204 mL of MilliQ water. To this solution was added 2 GalPUT reaction buffer (234 mL, equal to the volume of water for a final concentration of 1 GalPUT reaction buffer). The enzymes GalU (15 mL, 20 U/ 15 mL), IPP (15 mL, 0.25 U/mL), and immobilized GalPUT (0.8 mL of resin containing 20 U of enzyme) were added to the reaction solution. The reaction was initiated by the addition of UDP-Glc (3 mL, 50 mM ) solution, flushed with nitrogen or argon gas, and incubated at room temperature with gentle rotation for 16 h. The reaction was monitored by HPLC (Varian Microsorb 100-5 C18, 4.6 250 mm; Fig. 19.4). A small aliquot from the reaction mixture (5 mL)
396
Myles B. Poulin and Todd L. Lowary
2.0 UDP-Galf
1.8
Absorbance at 262 nm
1.6 1.4 1.2 1.0 0.8 0.6 UDP 0.4
20 H
0.2 0.0 0.0
18 H
UTP Uridine UMP 5.0
10.0
16 H 15.0
20.0 25.0 30.0 Time (min)
35.0
40.0
45.0
50.0
Figure 19.4 Analytical HPLC profile for three-enzyme chemoenzymatic generation of UDP-Galf. Peaks corresponding to the UDP-Galf product (14.5 min), the UTP starting material (26.0 min), and the degradation products uridine (6.0 min), UMP (9.7 min), and UDP (16.5 min) are labeled. Depletion of the UTP peak is observed between 16 and 20 h.
was diluted with 30 mL of water and centrifuged (Eppendorf centrifuge, 16,000g, 10 min) at room temperature using AmiconÒ Ultra-0.5 Ultracel10 centrifugal filters (Millipore) to remove the protein and resin before HPLC injection. The sample was separated using the elution conditions shown (Table 19.1) and detected by the absorbance of uridine at 262 nm. Under these conditions the retention time for uridine, UMP, UDP-Galf, UDP, and UTP were 6.0, 9.7, 14.5, 16.5, and 26.0 min, respectively. Completion of the reaction was indicated by the presence of the peak for UDP-Galf and depletion of the UTP peak. If the reaction did not reach completion after 16 h, additional Galf-1-P (10 mL, 100 mg/mL), GalU (10 mL, 19 mg/mL), IPP (10 mL, 0.25 U/m L), and immobilized GalPUT (1 mL) were added and the reaction monitored hourly until complete consumption of the UTP was observed. Purification of the resulting UDP-Galf was achieved following the procedure of Rose et al. (2008) with few modifications. The immobilized GalPUT was removed by transferring the reaction mixture to a 10 mL BD column cartridge and washed with 3–5 mL of cold water (4 C). The flow through was transferred to an AmiconÒ Ultra-15 Ultracel-10 centrifugal filter (Millipore) and centrifuged to remove the IPP and GalU proteins. An additional
397
Biosynthesis of Bacterial Furanosides
Table 19.1 Analytical HPLC elution conditions
a b
Time (min)
Flow rate (mL/min)
% Buffer Aa
% Buffer Bb
0 10 25 35 36 45
0.8 0.8 0.8 0.8 0.8 0.8
96 96 0 0 96 96
4 4 100 100 4 4
200 mM triethylammonium acetate, pH 6.6. 200 mM triethylammonium acetate, pH 6.6, with 1.5% acetonitrile.
Table 19.2 Semipreparative HPLC elution conditions
a
Time (min)
Flow rate (mL/min)
% Buffera
% Water
0 10 18 19 25
6.0 6.0 6.0 6.0 6.0
100 0 0 100 100
0 100 100 0 0
5 mM sodium phosphate buffer, pH 6.80.
3 mL of cold water was added and the mixture was centrifuged for an additional 15 min. This can be repeated a second time as long as the flow through volume does not exceed 15 mL. Salts were removed by gel filtration (Sephadex G-15, 25 1100 mm, 0.5 mL/min) eluting with cold water (4 C). Elution of the product was detected by absorbance at 262 nm and typically elutes after 180–240 mL in a volume of approximately 50–60 mL. The volume was reduced by evaporation of the water under reduced pressure, ensuring the temperature remained under 25 C, to a final volume of 5–10 mL. The sample was purified by semipreparative HPLC (Varian Microsorb 300-5 C18, 21.4 250 mm) using the elution conditions shown (Table 19.2) and detected by the nucleotide absorbance at 262 nm. Injection volumes of 3 mL were used and under these conditions the desired fraction typically elutes at 17.5 min. Salts were again removed by gel filtration (see above). This step was essential to prevent the decomposition of UDP-Galf observed when stored under high salt concentration. The samples were then lyophilized and the resulting solid was stored under desiccation at –20 C. Under these conditions, UDP-Galf was stable for >4 months. This procedure typically yields between 18 and 22 mg (67–82%) of UDPGalf disodium salt (610.27 g/mol). The purity of these samples can be assessed by 1H NMR spectroscopy and ESI mass spectrometry (Rose et al., 2008).
398
Myles B. Poulin and Todd L. Lowary
2.2.4. Generation of UDP-galactofuranose derivatives The three-enzyme chemoenzymatic reaction described above has also been used for the preparation of UDP-Galf derivatives such as uridine-50 -diphospho6-deoxy-D-galactofuranose (UDP-fucofuranose, UDP-Fucf ) (4), uridine-50 diphospho-L-arabinofuranose (UDP-Araf ) (6), and uridine-50 -diphospho-5deoxy-D-galactofuranose (UDP-5d-Galf ) (10) (Scheme 19.1B). The preparation of these derivatives typically required longer reaction times to reach completion (30–40 h); however, reactions should not be left for greater than 48 h. Otherwise, significant decomposition of the reactants and products to form UMP and uridine was observed. The retention times for (4), (6), and (10) were found to be 21.5, 15.5, and 19.0 min, respectively, using the analytical HPLC conditions (Table 19.1). Typical yields for these compounds vary from 35% to 50%. A three-enzyme chemoenzymatic reaction employing soluble GalPUT has also been described and used to synthesize (2), (4), (6), and additionally uridine-50 -diphospho-6-deoxy-6-fluoro-D-galactofuranose (UDP-6F-Galf ) (8) but will not be discussed here. For more information on this method see the work of Ferrie`res and coworkers (Peltier et al., 2008b).
3. Pyranose–Furanose Mutases Involved in Furanose Nucleotide Biosynthesis 3.1. Discussion Pyranose–furanose mutase enzymes are flavoproteins that catalyze the ring contraction involved in the biosynthesis of furanose sugar nucleotides from the corresponding pyranose sugar nucleotides (Scheme 19.2) using a unique catalytic mechanism (Sanders et al., 2001; Soltero-Higgin et al., 2004a). The pyranose–furanose interconversion favors the pyranose ring conformation in a ratio of approximately 9:1 (Richards and Lowary, 2009); as a result, assays are typically run in the reverse direction using a NDP-furanose as the substrate. In addition, pyranose–furanose mutases
HO ~90%
HO
OH O HO OUDP 11
UGM
HO O HO HO
OUDP ~10% OH 2
Scheme 19.2 UGM catalyzed ring contraction of UDP-Galp (11) to UDP-Galf (2). The reaction favors the pyranose ring conformation in a ratio of 9:1.
Biosynthesis of Bacterial Furanosides
399
are only active when the flavin adenine dinucleotide (FAD) cofactor is in the reduced state (Sanders et al., 2001); therefore, freshly prepared sodium dithionite (20 mM ) is included in the reaction mixture. The most commonly used assay for the enzyme is the HPLC method described below; however, other assays involving radiochemical detection and fluorescence polarization have also been reported (Carlson et al., 2006; Scherman et al., 2003; Soltero-Higgin et al., 2004b).
3.2. HPLC assays for UGM activity 3.2.1. Principle The assays described here are used to measure the activity and kinetics of UGM proteins (as well as other pyranose–furanose mutase enzymes) based on the formation of NDP-pyranose from the corresponding NDP-furanose catalyzed by the enzyme (Scheme 19.2). The two ring forms can be separated using reversed phase C18 (Zhang and Liu, 2000) or anion exchange (Lee et al., 1996) HPLC, and detected using the absorbance of the nucleotide at 262 nm. The procedure described below is based on the C18 HPLC method (with minor modifications), which is applied to the measurement of the activity of E. coli UGM (EC 5.4.99.9) using UDP-Galf as the substrate. 3.2.2. Materials and methods Uridine 50 -diphosphate (UDP) disodium salt and sodium dithionite were obtained from Sigma-Aldrich and J. T. Baker Chemicals, respectively. UDP-Galf disodium salt was prepared using the three-enzyme chemoenzymatic reaction described above. All other chemicals and biochemicals were reagent grade and used without further purification. E. coli UGM was prepared as described previously (Poulin et al., 2010) and will not be discussed in detail here. In brief, the glf gene was cloned from E. coli K-1 strain VW187 (Marolda et al., 1990) and inserted into a pET22b expression vector (Novagen) using NdeI and XhoI restriction sites. Expression of soluble UGM containing C-terminal His-Tag in E. coli BL21 was observed after induction with 0.5 mM IPTG and growth from 2 h at room temperature (22 C). Best results were obtained when expression was induced at an OD600 of 0.6 and the broth was cooled on ice (20 min) prior to the addition of IPTG. The protein was purified using Ni–NTA agarose as previously published (Poulin et al., 2010) and typically yields 5–7 mg of protein per liter of culture in greater than 90% purity. Assay reagents UGM reaction buffer, 100 mM potassium phosphate, pH 7.4 UDP-Galf, 2.0 mM in UGM reaction buffer Sodium dithionite, 60 mM in UGM reaction buffer E. coli UGM, 1.1 mM in UGM reaction buffer
400
Myles B. Poulin and Todd L. Lowary
The 2.0 mM stock solution of UDP-Galf was prepared by dissolving UDP-Galf (1.22 mg/mL) in UGM reaction buffer. The exact concentration was calibrated by HPLC (Varian Microsorb 100-5 C18, 4.6 250 mm) by coinjection with a known concentration of UDP. Separation was achieved using an isocratic elution of 50 mM triethylammonium acetate (TEAA), pH 6.6, containing 1.5% acetonitrile (0.6 mL/min) and the products were detected by the absorbance of UDP at 262 nm. All other UDP-Galf stock solutions (1000, 500, 200, 100, 50, 25, and 20 mM) were prepared by serial dilution of the 2.0 mM stock solution. 3.2.3. Assay procedure An enzymatic reaction containing 183 nM UGM (10 mL of 1.1 mM solution), 20 mM freshly prepared sodium dithionite (20 mL of 60 mM solution), and 1.0 mM UDP-Galf (30 mL of 2.0 mM solution) was prepared to a final volume of 60 mL UGM reaction buffer. The reaction was incubated at 37 C for 5 min then quenched by heating at 90 C for 5 min. The denatured protein was removed and the sample was filtered by centrifugation (Eppendorf centrifuge, 16,000g, 30 min, 4 C) using AmiconÒ Ultra-0.5 Ultracel-10-centrifugal filters (Millipore) before being injected into the HPLC (Varian Microsorb 100-5 C18, 4.6 250 mm). HPLC separation of the reaction mixture was achieved using an isocratic elution of 50 mM TEAA, pH 6.6, containing 1.5% acetonitrile (0.6 mL/min) and the products were detected by the absorbance of uridine at 262 nm (Fig. 19.5). The appearance of a new product peak corresponding to UDP-Galp and depletion of the UDP-Galf peak signifies UGM activity. Standard samples of UDP-Galp and UDP-Galf were also run under identical HPLC conditions to confirm the identity of the observed peaks. Under these conditions, UDP-Galp and UDP-Galf eluted at approximately 10.5 and 13.2 min, respectively. The exact retention times may vary from day to day depending on the exact concentration and pH of the TEAA buffer and amount of acetonitrile used in the mobile phase; therefore, UDP-Galf and UDP-Galp standards were also run. 3.2.4. Kinetic assay Reactions were prepared containing 4.8 nM UGM (5 mL of 28.2 nM solution), 20 mM sodium dithionite (10 mL of 60 mM solution), and UDP-Galf (500, 250, 100, 50, 25, 12.5, and 10 mM; 15 mL of 1000, 500, 200, 100, 50, 25, and 20 mM solutions, respectively) in a final volume of 30 mL UGM reaction buffer. The reactions were incubated for 2.0 min at 37 C, and then quenched by heating at 90 C for 5 min. The denatured protein was removed by centrifugation (Eppendorf centrifuge, 16,000g, 30 min, 4 C) using AmiconÒ Ultra-0.5 Ultracel-10-centrifugal filters (Millipore). Each reaction was analyzed by HPLC as described above. The amount of UDP-Galp produced per minute was calculated from the
401
Biosynthesis of Bacterial Furanosides
0.8 UDP-Galf 0.7
UDP-Galp
Absorbance at 262 nm
0.6 0.5 0.4 0.3 0.2 i. 0.1
ii.
0.0 iii. 0.0
2.0
4.0
6.0
8.0
10.0 12.0 14.0 Time (min)
16.
0
18.0 20.0 22.0
Figure 19.5 UGM activity assay HPLC profile for E. coli UGM reacting with UDPGalf. The peaks for UDP-Galp (10.5 min) and UDP-Galf (13.2 min) are labeled. (i) Control containing 1.0 mM UDP-Galf; (ii) reaction of E. coli UGM with 1.0 mM UDPGalf, depletion of the UDP-Galf peak and formation of a UDP-Galp peak can be clearly seen; (iii) control containing 1.0 mM UDP-Galp.
ratio of product to substrate peaks, and the kinetic parameters were deduced by fitting the data to the Michaelis–Menten equation using the GraphPad Prism software. The exact concentration of UGM used in the kinetics assay can vary; however, the concentration was controlled so that 30% conversion of UDP-Galf was observed. The assays described here have also been used to study bacterial pyranose–furanose mutase proteins from other sources. Assays with preparations of UGM from K. pneumoniae, M. tuberculosis, and D. radiodurans (Beis et al., 2005; Partha et al., 2009a), as well as E. coli K-12 (Sanders et al., 2001; Zhang and Liu, 2000), have been previously reported. These assays have also been adapted to study pyranose–furanose mutase enzymes involved in the biosynthesis of thymidine 50 -diphospho-D-fucofuranose (TDP-Fucf ) (Wang et al., 2008) and uridine 50 -diphopho-2-acetamido-2deoxy-D-galactofuranose (UDP-GalfNAc) (Poulin et al., 2010). Also, studies of UGM activity with various fluorinated UDP-galactose derivatives have been useful for understanding the mechanism and substrate binding of these bacterial enzymes (Burton et al., 1997; Eppe et al., 2009; Errey et al., 2009; Zhang and Liu, 2001).
402
Myles B. Poulin and Todd L. Lowary
4. Galactofuranosyltransferases Involved in Galactofuranoside Biosynthesis 4.1. Discussion GlfTs are the final enzymes involved in the biosynthesis of Galf-containing glycoconjugates. These enzymes catalyze glycosidic bond formation between the activated UDP-Galf donor and an acceptor species, typically a glycan. Two bifunctional GlfTs, encoded by the Rv3808c and Rv3782 genes, from M. tuberculosis are reported to be required for the biosynthesis of the galactan portion of the mycobacterial mAG complex (Belanova et al., 2008; Mikusˇova´ et al., 2000, 2006). The first, GlfT1, encoded by Rv3782, add the first two Galf residues during the biosynthesis of the mAG complex, indicating that this enzyme has both b-(1!5)and b-(1!6)-transferase activity (Alderwick et al., 2008). The second bifunctional transferase, GlfT2, which is encoded by Rv3808c, adds the remaining Galf residues to the mAG complex with repeating b-(1!5)and b-(1!6)-glycosidic linkages (Rose et al., 2006). The latter enzyme has been shown to possess a single active site that is responsible for both b-(1!5)- and b-(1!6)-transferase activity (Szczepina et al., 2009). Milligram scale reactions with trisaccharides bearing either linkage have yielded oligosaccharides approaching physiological length (Lowary, unpublished observations). In addition, work from the Kiessling lab has also reported processive polymerization by GlfT2 using alternate acceptor substrates (May et al., 2009). Few other GlfT enzymes are reported in the literature, possibly due to the difficulties associated with purifying and studying these GlfT proteins, and problems in accessing substrates for these enzymes. Examples, include the WbbO protein from K. pneumoniae, which has been demonstrated to catalyze the transfer of both Galp and Galf residues to synthesize the galactan I portion of the K. pneumoniae O-antigen (Guan et al., 2001). In addition, in vitro assays with purified Wbbl from E. coli K-12 demonstrate that this enzyme catalyzes the transfer of Galf to an octyl a-glucopyranoside acceptor (Wing et al., 2006). This section describes the procedure for a continuous enzyme-coupled spectrophotometric assay developed to characterize the activity of the GlfT2 enzyme of M. tuberculosis (Rose et al., 2008). The use of this assay to determine both the donor and acceptor kinetics and screen for potential inhibitors is also discussed. Although this assay was developed to study the activity of GlfT2 from M. tuberculosis, it could be modified to study other GlfTs by changing the nature of the carbohydrate acceptor; however, no reports on the use of this assay to study the activity of other GlfT proteins have been reported to date.
403
Biosynthesis of Bacterial Furanosides
4.2. Enzyme-coupled spectrophotometric assay for GlfT2 activity 4.2.1. Principle The assay described here uses a known coupled spectrophotometric glycosyltransferase assay (Gosselin et al., 1994), which has been modified to measure the activity of GlfT2. One molecule of UDP is produced as a side product for every molecule of UDP-Galf consumed in the GlfT2 enzymatic reaction (Scheme 19.3). The UDP then reacts with phosphoenolpyruvic acid (PEP) to produce pyruvate and UTP, a reaction catalyzed by pyruvate kinase (PK, EC 2.7.1.40). Pyruvate then serves as a substrate for lactate dehydrogenase (LDH, EC 1.1.1.27) to produce lactate. In the process, one molecule of reduced b-nicotinamide adenine dinucleotide (NADH) is oxidized for every molecule of pyruvate reduced. The assay measures the decrease in the absorbance of NADH at 340 nm. Because PK and LDH are present in large excess, this measure is directly proportional to GlfT2 activity. 4.2.2. Materials and methods BioUltraPure grade 3-(N-morpholino)propanesulfonic acid (MOPS) was obtained from BioShop (Burlington, ON) and magnesium chloride hexahydrate(MgCl2) was obtained from EMD Biosciences (La Jolla, CA). PEP monocyclohexylamine salt, potassium chloride (KCl), PK (type III, GlfT2
(11) + UDP-Galf
(12) +
PK
UDP
PEP HO
O
UTP
NADH HO
O(CH2)7CH3
HO HO HO
O
HO
HO
O HO
O OH OH
HO
O
O(CH2)7CH3
HO
O
O
HO HO
OH O
O
O OH OH
HO
OH
11
O
NAD
Lactate +
HO OH
O
LDH
Pyruvate
OH
12
OH
Scheme 19.3 Reaction scheme for an enzyme-coupled spectrophotometric assay of GlfT2. The activity of GlfT2 is measured based on the decrease in the Abs340 of NADH as it is converted to NADþ. A b-D-Galf-(1!5)-b-D-Galf-(1!6)-b-D-GalfOOct acceptor (11) is shown as well as the resulting b-D-Galf-(1!6)-b-D-Galf-(1!5)b-D-Galf-(1!6)-b-D-Galf-OOct product (12).
404
Myles B. Poulin and Todd L. Lowary
lyophilized powder, rabbit muscle), LDH (type XI, salt free, rabbit muscle), and reduced b-NADH disodium salt were obtained from Sigma-Aldrich. All other chemicals and biochemicals were of reagent grade and were used without further purification. The acceptor substrate (11) was chemically synthesized as previously described (Completo and Lowary, 2008). 4.2.3. Preparation of GlfT2 protein Various methods have been developed to clone and purify recombinant GlfT2 (Alderwick et al., 2008; Rose et al., 2006, 2008) and they will not be discussed here in detail. Briefly, the Rv3808c gene of M. tuberculosis was cloned and inserted into a pET-15b vector (Rose et al., 2006). Optimal yields of soluble, full-length N-terminal His-tagged GlfT2 were obtained when the pET-15b/Rv3808c vector was expressed in E. coli RosettaTM (DE3) QuartersTM competent cells and purified using Ni–NTA agarose as described previously (Rose et al., 2008), followed by concentration and buffer exchange by ultrafiltration using AmiconÒ Ultra-15 Ultracel-10 centrifugal filters (Millipore) (Sephacryl S-100-HR gel filtration, which was reported in the initial paper describing the assay (Rose et al., 2008) is no longer used). This typically yields 40 mg of GlfT2 per liter of culture volume with a specific activity of 4.3 U/mg GlfT2. The protein can be stored in 10% glycerol at –80 C for 6 months with no significant decrease in activity. Reagent stock solutions MOPS buffer, 1 M, pH 7.6 KCl, 2 M in MilliQ water MgCl2, 1 M in MilliQ water NADH, 15 mM in 100 mM MOPS buffer, pH 7.6 PEP, 100 mM in 250 mM MOPS buffer, pH 7.6 PK, 5.0 U/mL in 100 mM MOPS buffer, pH 7.6 LDH, 16.8 U/mL in 100 mM MOPS buffer, pH 7.6 UDP-Galf, 40 mM in 100 mM MOPS buffer, pH 7.6 Acceptor (11), 40 mM in MilliQ water Inhibitor, 32 mM in MilliQ water GlfT2, 0.75 mg/10 mL in 100 mM MOPS, pH 7.6 4.2.4. General assay procedure The procedures of Rose et al. (2008) were used with minor modifications. The spectrophotometric assays were performed in flat-bottomed 384-well microtiter plates (Corning, NY) that contain 100 mM MOPS, pH 7.6, 50 mM KCl, 20 mM MgCl2, 1.1 mM NADH, 3.5 mM PEP, 3.75 U PK, and 8.4 U LDH per well in a 40 mL final volume. The absorbance values at 340 nm (Abs340) were continuously monitored every 15 s for 5 min at
405
Biosynthesis of Bacterial Furanosides
37 C using a Spectra Max 340PC microplate reader employing SOFTmaxÒ PRO software (Molecular Devices, Sunnyvale, CA). The optimum amount of GlfT2 per well was previously determined to be 0.75 mg when using the acceptor trisaccharide (11); however, this amount will vary depending on the nature of the acceptor used. The amount of GlfT2 used in the assay should be such that the initial velocity is linear for at least 2–3 min. Buffer, KCl, MgCl2, and acceptor stocks were stored at 4 C for up to 3 months and other stock solutions listed above were prepared fresh on the day the assay was run. The exact concentration of UDP-Galf and acceptor (11) used for enzyme activity, donor kinetics, acceptor kinetics, and inhibitor screening assays will vary. Table 19.3 details the reagent volumes per well for each type of assay. 4.2.5. Measuring GlfT2 activity The activity of GlfT2 was measured under conditions where the concentrations of both substrates were saturating. Two wells (one test and one no acceptor blank) were prepared in triplicate as described in Table 19.3, and the temperature was raised to 37 C. The reaction was initiated by adding GlfT2 (0.75 mg in 10 mL of 100 mM MOPS, pH 7.6) to all wells and then measured as described above. The blank reactions were essential to correct for any GlfT2-independent absorbance decrease and should be performed in parallel with all GlfT2 assays described here. Table 19.3 Reagent volumes used for GlfT2 assays Reagent volume used per well (mL)
a
Reagent stock concentration
GlfT2 activity
Donor kinetics
Acceptor kinetics
Inhibitor screen
MOPS buffer, 1 M, pH 7.6 KCl, 2 M MgCl2, 1 M NADH, 15 mM PEP, 100 mM PK, 5.0 U/mL LDH, 16.8 U/mL UDP-Galf, 40 mM Acceptor (X), 40 mM Inhibitor, 32 mM MilliQ water Final volume
1.48
1.48
1.48
1.48
1.00 0.80 2.94 1.40 1.50 1.00 3.00 2.00 – 15.88 30
1.00 0.80 2.94 1.40 1.50 1.00 –a 2.00 – 12.88 25
1.00 0.80 2.94 1.40 1.50 1.00 3.00 –a – 11.88 25
1.00 0.80 2.94 1.40 1.50 1.00 –a –a 5.00 –a 30
See text.
406
Myles B. Poulin and Todd L. Lowary
4.2.6. Donor kinetics assay Ten wells were used to measure donor kinetics. First, 5 mL serial dilutions of the UDP-Galf stock solution were prepared in MilliQ water so that the final concentrations of UDP-Galf in each well (based on 40 mL final volume) was 4000, 2000, 1000, 750, 500, 375, 250, 125, 62.5, and 0 mM, respectively. Twenty-five microliters of the reaction mixture described in Table 19.3 was added, and the temperature was raised to 37 C. Reactions were initiated by the addition of GlfT2 (0.75 mg in 10 mL of 100 mM MOPS, pH 7.6) and measured as described above. Reaction velocities in the 0 mM donor wells were used to correct for GlfT2-independent background rates. 4.2.7. Acceptor kinetics assay Nine wells were used to measure acceptor kinetics. First, 5 mL serial dilutions of the acceptor (11) stock were prepared in MilliQ water so that the final concentration of acceptor in each well (based on 40 mL final volume) was 8000, 6000, 4000, 2000, 1000, 500, 250, 125, and 0 mM, respectively. Twenty-five microliters of the reaction mixture described in Table 19.3 was added, and the temperature was raised to 37 C. The reactions were again initiated by the addition of GlfT2 enzyme (0.75 mg in 10 mL of 100 mM MOPS, pH 7.6) and measured as described above. Reaction velocities in the 0 mM acceptor wells were used to correct for GlfT2-independent background rates. 4.2.8. Acceptor inhibitor screen One well (in triplicate) was required for each inhibitor being screened and was prepared as outlined in Table 19.3 for a final inhibitor concentration of 4.0 mM. A positive control well was also prepared (in triplicate), as described for acceptor kinetics assay in Table 19.3, which contains 2.0 mM acceptor (11). All wells contain 3.0 mM UDP-Galf. The reactions were initiated by the addition of GlfT2 (0.5 mg in 10 mL of 100 mM MOPS, pH 7.6) and measured as described above. The percentage of inhibition was assessed by comparing the reaction velocities of the inhibitor wells to that of the positive controls. A slower rate indicates inhibition, whereas a faster rate indicates that the inhibitor may function as a substrate for the GlfT2 enzyme. 4.2.9. Donor inhibitor screen These assays were performed as above but UDP-Galf was present at 0.375 mM and acceptor (11) was at 2.0 mM. It should be appreciated that donor analogs can contain free UDP, as a result of hydrolysis during synthesis or storage. It was therefore helpful to perform donor analog checks in the absence of both UDP-Galf and GlfT2. Contaminating UDP will be seen as a rapid drop of absorbance at 340 nm, or as a much lower initial absorbance value.
Biosynthesis of Bacterial Furanosides
407
ACKNOWLEDGMENTS This work was supported by the Alberta Ingenuity Centre for Carbohydrate Science and the Natural Sciences and Engineering Research Council of Canada. M.B.P. is supported by a Ph.D. studentship from Alberta Innovates–Technology Futures.
REFERENCES Alderwick, L. J., Dover, L. G., Veerapen, N., Gurcha, S. S., Kremer, L., Roper, D. L., Pathak, A. K., Reynolds, R. C., and Besra, G. S. (2008). Expression, purification and characterisation of soluble GlfT and the identification of a novel galactofuranosyltransferase Rv3782 involved in priming GlfT-mediated galactan polymerisation in Mycobacterium tuberculosis. Protein Expr. Purif. 58, 332–341. Beis, K., Srikannathasan, V., Liu, H., Fullerton, S. W. B., Bamford, V. A., Sanders, D. A. R., Whitfield, C., McNeil, M. R., and Naismith, J. H. (2005). Crystal structures of Mycobacteria tuberculosis and Klebsiella pneumoniae UDP-galactopyranose mutase in the oxidised state and Klebsiella pneumoniae UDP-galactopyranose mutase in the (Active) reduced state. J. Mol. Biol. 348, 971–982. Belanova, M., Dianiskova, P., Brennan, P. J., Completo, G. C., Rose, N. L., Lowary, T. L., and Mikusova, K. (2008). Galactosyl transferases in mycobacterial cell wall synthesis. J. Bacteriol. 190, 1141–1145. Berg, S., Kaur, D., Jackson, M., and Brennan, P. J. (2007). The glycosyltransferases of Mycobacterium tuberculosis—Roles in the synthesis of arabinogalactan, lipoarabinomannan, and other glycoconjugates. Glycobiology 17, 35R–56R. Berst, M., Hellerqvist, C. G., Lindberg, B., Lu¨deritz, O., Svensson, S., and Westphal, O. (1969). Structural investigations on T1 lipopolysaccharides. Eur. J. Biochem. 11, 353–359. Bhamidi, S., Scherman, M. S., Rithner, C. D., Prenni, J. E., Chatterjee, D., Khoo, K. H., and McNeil, M. R. (2008). The identification and location of succinyl residues and the characterization of the interior arabinan region allow for a model of the complete primary structure of Mycobacterium tuberculosis mycolyl arabinogalactan. J. Biol. Chem. 283, 12992–13000. Brennan, P. J., and Nikaido, H. (1995). The envelope of mycobacteria. Annu. Rev. Biochem. 64, 29–63. Burton, A., Wyatt, P., and Boons, G. J. (1997). Preparation of fluorinated galactosyl nucleoside diphosphates to study the mechanism of the enzyme galactopyranose mutase. J. Chem. Soc. Perkin Trans. 1, 2375–2382. Carlson, E. E., May, J. F., and Kiessling, L. L. (2006). Chemical probes of UDP-galactopyranose mutase. Chem. Biol. 13, 825–837. Completo, G. C., and Lowary, T. L. (2008). Synthesis of galactofuranose-containing acceptor substrates for mycobacterial galactofuranosyltransferases. J. Org. Chem. 73, 4513–4525. de Lederkremer, R. M., Nahmad, V. B., and Varela, O. (1994). Synthesis of a-D-galactofuranosyl phosphate. J. Org. Chem. 59, 690–692. Eppe, G., Peltier, P., Daniellou, R., Nugier-Chauvin, C., Ferrie`res, V., and Vincent, S. P. (2009). Probing UDP-galactopyranose mutase binding pocket: A dramatic effect on substitution of the 6-position of UDP-galactofuranose. Bioorg. Med. Chem. Lett. 19, 814–816. Errey, J. C., Mukhopadhyay, B., Kartha, K. P. R., and Field, R. A. (2004). Flexible enzymatic and chemo-enzymatic approaches to a broad range of uridine-diphosphosugars. Chem. Commun. 7, 2706–2707.
408
Myles B. Poulin and Todd L. Lowary
Errey, J. C., Mann, M. C., Fairhurst, S. A., Hill, L., McNeil, M. R., Naismith, J. H., Percy, J. M., Whitfield, C., and Field, R. A. (2009). Sugar nucleotide recognition by Klebsiella pneumoniae UDP-D-galactopyranose mutase: Fluorinated substrates, kinetics and equilibria. Org. Biomol. Chem. 7, 1009–1016. Gosselin, S., Alhussaini, M., Streiff, M. B., Takabayashi, K., and Palcic, M. M. (1994). A continuous spectrophotometric assay for glycosyltransferases. Anal. Biochem. 220, 92–97. Guan, S., Clarke, A. J., and Whitfield, C. (2001). Functional analysis of the galactosyltransferases required for biosynthesis of D-galactan I, a component of the lipopolysaccharide O1 antigen of Klebsiella pneumoniae. J. Bacteriol. 183, 3318–3327. Hanniffy, O. M., Shashkov, A. S., Moran, A. P., Prendergast, M. M., Senchenkova, S. N., Knirel, Y. A., and Savage, A. V. (1999). Chemical structure of a polysaccharide from Campylobacter jejuni 176.83 (serotype O:41) containing only furanose sugars. Carbohydr. Res. 319, 124–132. Huang, H. R., Scherman, M. S., D’Haeze, W., Vereecke, D., Holsters, M., Crick, D. C., and McNeil, M. R. (2005). Identification and active expression of the Mycobacterium tuberculosis gene encoding 5-phospho-a-D-ribose-1-diphosphate: Decaprenyl-phosphate 5-phosphoribosyltransferase, the first enzyme committed to decaprenylphosphoryl-Darabinose synthesis. J. Biol. Chem. 280, 24539–24543. Klutts, J. S., Hatanaka, K., Pan, Y. T., and Elbein, A. D. (2002). Biosynthesis of D-arabinose in Mycobacterium smegmatis: Specific labeling from D-glucose. Arch. Biochem. Biophys. 398, 229–239. Konishi, T., Takeda, T., Miyazaki, Y., Ohnishi-Kameyama, M., Hayashi, T., O’Neill, M. A., and Ishii, T. (2007). A plant mutase that interconverts UDP-arabinofuranose and UDP-arabinopyranose. Glycobiology 17, 345–354. Ko¨plin, R., Brisson, J. R., and Whitfield, C. (1997). UDP-galactofuranose precursor required for formation of the lipopolysaccharide O antigen of Klebsiella pneumoniae serotype O1 is synthesized by the product of the rfbD(KP01) gene. J. Biol. Chem. 272, 4121–4128. Lee, R., Monsey, D., Weston, A., Duncan, J. K., Rithner, C., and McNeil, M. (1996). Enzymatic synthesis of UDP-galactofuranose and an assay for UDP-galactopyranose mutase based on high-performance liquid chromatography. Anal. Biochem. 242, 1–7. Lee, R. E., Smith, M. D., Nash, R. J., Griffiths, R. C., McNeil, M., Grewal, R. K., Yan, W. X., Besra, G. S., Brennan, P. J., and Fleet, G. W. J. (1997). Inhibition of UDPGal mutase and mycobacterial galactan biosynthesis by pyrrolidine analogues of galactofuranose. Tetrahedron Lett. 38, 6733–6736. Li, M., Shao, J., Xiao, M., and Wang, P. G. (2004). Synthesis of glycoconjugates through biosynthesis pathway engineering. Synthesis of Carbohydrates Through Biotechnology American Chemical Society, Washington, DC. pp. 165–181. Liu, Z. Y., Zhang, J. B., Chen, X., and Wang, P. G. (2002). Combined biosynthetic pathway for de novo production of UDP-galactose: Catalysis with multiple enzymes immobilized on agarose beads. Chembiochem 3, 348–355. Lowary, T. L. (2003). Recent progress towards the identification of inhibitors of mycobacterial cell wall polysaccharide biosynthesis. Mini Rev. Med. Chem. 3, 694–707. Marlow, A. L., and Kiessling, L. L. (2001). Improved chemical synthesis of UDP-galactofuranose. Org. Lett. 3, 2517–2519. Marolda, C. L., Welsh, J., Dafoe, L., and Valvano, M. A. (1990). Genetic analysis of the O7polysaccharide biosynthesis region from the Escherichia coli O7:K1 strain VW187. J. Bacteriol. 172, 3590–3599. May, J. F., Splain, R. A., Brotschi, C., and Kiessling, L. L. (2009). A tethering mechanism for length control in a processive carbohydrate polymerization. Proc. Natl. Acad. Sci. USA 106, 11851–11856. McNally, D. J., Jarrell, H. C., Li, J., Khieu, N. H., Vinogradov, E., Szymanski, C. M., and Brisson, J. R. (2005). The HS:1 serostrain of Campylobacter jejuni has a complex teichoic
Biosynthesis of Bacterial Furanosides
409
acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and Omethyl phosphoramidate groups. FEBS J. 272, 4407–4422. Mikusˇova´, K., Yagi, T., Stern, R., McNeil, M. R., Besra, G. S., Crick, D. C., and Brennan, P. J. (2000). Biosynthesis of the galactan component of the mycobacterial cell wall. J. Biol. Chem. 275, 33890–33897. Mikusˇova´, K., Huang, H. R., Yagi, T., Holsters, M., Vereecke, D., D’Haeze, W., Scherman, M. S., Brennan, P. J., McNeil, M. R., and Crick, D. C. (2005). Decaprenylphosphoryl arabinofuranose, the donor of the D-arabinofuranosyl residues of mycobacterial arabinan, is formed via a two-step epimerization of decaprenylphosphoryl ribose. J. Bacteriol. 187, 8020–8025. Mikusˇova´, K., Belanova, M., Kordulakova, J., Honda, K., McNeil, M. R., Mahapatra, S., Crick, D. C., and Brennan, P. J. (2006). Identification of a novel galactosyl transferase involved in biosynthesis of the mycobacterial cell wall. J. Bacteriol. 188, 6592–6598. Nassau, P. M., Martin, S. L., Brown, R. E., Weston, A., Monsey, D., McNeil, M. R., and Duncan, K. (1996). Galactofuranose biosynthesis in Escherichia coli K-12: Identification and cloning of UDP-galactopyranose mutase. J. Bacteriol. 178, 1047–1052. Nikaido, H., and Sarvas, M. (1971). Biosynthesis of T1 antigen in Salmonella; biosynthesis in a cell-free system. J. Bacteriol. 105, 1073–1082. Pan, F., Jackson, M., Ma, Y. F., and McNeil, M. (2001). Cell wall core galactofuran synthesis is essential for growth of mycobacteria. J. Bacteriol. 183, 3991–3998. Partha, S. K., Bonderoff, S. A., van Straaten, K. E., and Sanders, D. A. R. (2009a). Expression, purification and preliminary X-ray crystallographic analysis of UDP-galactopyranose mutase from Deinococcus radiodurans. Acta Crystallogr. F Struct. Biol. Cryst. Commun. 65, 843–845. Partha, S. K., van Straaten, K. E., and Sanders, D. A. R. (2009b). Structural basis of substrate binding to UDP-galactopyranose mutase: Crystal structures in the reduced and oxidized state complexed with UDP-galactopyranose and UDP. J. Mol. Biol. 394, 864–877. Pedersen, L. L., and Turco, S. J. (2003). Galactofuranose metabolism: A potential target for antimicrobial chemotherapy. Cell. Mol. Life Sci. 60, 259–266. Peltier, P., Daniellou, R., Nugier-Chauvin, C., and Ferrie`res, V. (2007). Versatile synthesis of rare nucleotide furanoses. Org. Lett. 9, 5227–5230. Peltier, P., Euzen, R., Daniellou, R., Nugier-Chauvin, C., and Ferrie`res, V. (2008a). Recent knowledge and innovations related to hexofuranosides: Structure, synthesis and applications. Carbohydr. Res. 343, 1897–1923. Peltier, P., Guegan, J. P., Daniellou, R., Nugier-Chauvin, C., and Ferrie`res, V. (2008b). Stereoselective chemoenzymatic synthesis of UDP-1,2-cis-furanoses from a, b-furanosyl 1-phosphates. Eur. J. Org. Chem. 2008, 5988–5994. Poulin, M. B., Nothaft, H., Hug, I., Feldman, M. F., Szymanski, C. M., and Lowary, T. L. (2010). Characterization of a bifunctional pyranose-furanose mutase from Campylobacter jejuni 11168. J. Biol. Chem. 285, 493–501. Reiter, W. D., and Vanzin, G. F. (2001). Molecular genetics of nucleotide sugar interconversion pathways in plants. Plant Mol. Biol. 47, 95–113. Richards, M. R., and Lowary, T. L. (2009). Chemistry and biology of galactofuranosecontaining polysaccharides. Chembiochem 10, 1920–1938. Rose, N. L., Completo, G. C., Lin, S. J., McNeil, M., Palcic, M. M., and Lowary, T. L. (2006). Expression, purification, and characterization of a galactofuranosyltransferase involved in Mycobacterium tuberculosis arabinogalactan biosynthesis. J. Am. Chem. Soc. 128, 6721–6729. Rose, N. L., Zheng, R. B., Pearcey, J., Zhou, R., Completo, G. C., and Lowary, T. L. (2008). Development of a coupled spectrophotometric assay for GlfT2, a bifunctional mycobacterial galactofuranosyltransferase. Carbohydr. Res. 343, 2130–2139.
410
Myles B. Poulin and Todd L. Lowary
Sanders, D. A. R., Staines, A. G., McMahon, S. A., McNeil, M. R., Whitfield, C., and Naismith, J. H. (2001). UDP-galactopyranose mutase has a novel structure and mechanism. Nat. Struct. Biol. 8, 858–863. Sarvas, M., and Nikaido, H. (1971). Biosynthesis of T1 antigen in Salmonella; origin of D-galactofuranose and D-ribofuranose residues. J. Bacteriol. 105, 1063–1072. Scherman, M. S., KalbeBournonville, L., Bush, D., Deng, L. Y., and McNeil, M. (1996). Polyprenylphosphate-pentoses in mycobacteria are synthesized from 5-phosphoribose pyrophosphate. J. Biol. Chem. 271, 29652–29658. Scherman, M. S., Winans, K. A., Stern, R. J., Jones, V., Bertozzi, C. R., and McNeil, M. R. (2003). Drug targeting Mycobacterium tuberculosis cell wall synthesis: Development of a microtiter plate-based screen for UDP-galactopyranose mutase and identification of an inhibitor from a uridine-based library. Antimicrob. Agents Chemother. 47, 378–382. Singh, S., and Hogan, S. E. (1994). Isolation and characterization of sugar nucleotides from Mycobacterium smegmatis. Microbios 77, 217–222. Soltero-Higgin, M., Carlson, E. E., Gruber, T. D., and Kiessling, L. L. (2004a). A unique catalytic mechanism for UDP-galactopyranose mutase. Nat. Struct. Mol. Biol. 11, 539–543. Soltero-Higgin, M., Carlson, E. E., Phillips, J. H., and Kiessling, L. L. (2004b). Identification of inhibitors for UDP-galactopyranose mutase. J. Am. Chem. Soc. 126, 10532–10533. St. Michael, F., Szymanski, C. M., Li, J. J., Chan, K. H., Khieu, N. H., Larocque, S., Wakarchuk, W. W., Brisson, J. R., and Monteiro, M. A. (2002). The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168. Eur. J. Biochem. 269, 5119–5136. Stevenson, G., Neal, B., Liu, D., Hobbs, M., Packer, N. H., Batley, M., Redmond, J. W., Lindquist, L., and Reeves, P. (1994). Structure of the O antigen of Escherichia coli K-12 and the sequence of its rfb gene cluster. J. Bacteriol. 176, 4144–4156. Szczepina, M. G., Zheng, R. B., Completo, G. C., Lowary, T. L., and Pinto, B. M. (2009). STD-NMR studies suggest that two acceptor substrates for GlfT2, a bifunctional galactofuranosyltransferase required for the biosynthesis of Mycobacterium tuberculosis arabinogalactan, compete for the same binding site. Chembiochem 10, 2052–2059. Tam, P. H., and Lowary, T. L. (2009). Recent advances in mycobacterial cell wall glycan biosynthesis. Curr. Opin. Chem. Biol. 13, 618–625. Thibodeaux, C. J., Melancon, C. E., and Liu, H. W. (2008). Natural-product sugar biosynthesis and enzymatic glycodiversification. Angew. Chem. Int. Ed. 47, 9814–9859. Tsvetkov, Y. E., and Nikolaev, A. V. (2000). The first chemical synthesis of UDP-a-Dgalactofuranose. J. Chem. Soc. Perkin Trans. 1, 889–891. Umesiri, F. E., Sanki, A. K., Boucau, J., Ronning, D. R., and Sucheck, S. J. (2010). Recent advances toward the inhibition of mAG and LAM synthesis in Mycobacterium tuberculosis. Med. Res. Rev. 30, 290–326. van Hijum, S., Kralj, S., Ozimek, L. K., Dijkhuizen, L., and van Geel-Schutten, I. G. H. (2006). Structure–function relationships of glucansucrase and fructansucrase enzymes from lactic acid bacteria. Microbiol. Mol. Biol. Rev. 70, 157–176. Velazquez-Hernandez, M. L., Baizabal-Aguirre, V. M., Bravo-Patino, A., CajeroJuarez, M., Chavez-Moctezuma, M. P., and Valdez-Alarcon, J. J. (2009). Microbial fructosyltransferases and the role of fructans. J. Appl. Microbiol. 106, 1763–1778. Wang, Q., Ding, P., Perepelov, A. V., Xu, Y. L., Wang, Y., Knirel, Y. A., Wang, L., and Feng, L. (2008). Characterization of the dTDP-D-fucofuranose biosynthetic pathway in Escherichia coli O52. Mol. Microbiol. 70, 1358–1367. Weston, A., Stern, R. J., Lee, R. E., Nassau, P. M., Monsey, D., Martin, S. L., Scherman, M. S., Besra, G. S., Duncan, K., and McNeil, M. R. (1998). Biosynthetic origin of mycobacterial cell wall galactofuranosyl residues. Tuber. Lung Dis. 78, 123–131. Wing, C., Errey, J. C., Mukhopadhyay, B., Blanchard, J. S., and Field, R. A. (2006). Expression and initial characterization of WbbI, a putative D-Galf: a-D-Glc b-1, 6-galactofuranosyltransferase from Escherichia coli K-12. Org. Biomol. Chem. 4, 3945–3950.
Biosynthesis of Bacterial Furanosides
411
Wolucka, B. A. (2008). Biosynthesis of D-arabinose in mycobacteria—a novel bacterial pathway with implications for antimycobacterial therapy. FEBS J. 275, 2691–2711. Wolucka, B. A., and Dehoffmann, E. (1995). The presence of b-D-ribosyl-1-monphosphodecaprenol in mycobacteria. J. Biol. Chem. 270, 20151–20155. Zhang, Q. B., and Liu, H. W. (2000). Studies of UDP-galactopyranose mutase from Escherichia coli: An unusual role of reduced FAD in its catalysis. J. Am. Chem. Soc. 122, 9065–9070. Zhang, Q. B., and Liu, H. W. (2001). Mechanistic investigation of UDP-galactopyranose mutase from Escherichia coli using 2-and 3-fluorinated UDP-galactofuranose as probes. J. Am. Chem. Soc. 123, 6756–6766.
C H A P T E R
T W E N T Y
The Synthesis of 1,2-cis-Amino Containing Oligosaccharides Toward Biological Investigation Shino Manabe Abstract 1,2-cis-Aminoglycoside structure is frequently found in bioactive oligosaccharide. In this chapter, the recent development of 1,2-cis-aminoglycoside preparation is described. The interface investigations between biology and chemistry with using synthetic oligosaccharides are also described.
A major obstacle in glycobiology and glycomedicine is the lack of pure and structurally defined glycoconjugates. These compounds are difficult to isolate from natural resources because they are typically found in low concentrations and in microheterogeneous forms. At the present time, oligosaccharides and glycoconjugates with rigorously defined structures can be obtained only through synthetic chemistry. It is clear that increasing the supply of oligosaccharides will make a significant impact on glycoscience (Boltje et al., 2009; Bongat and Demchenko, 2007; Stallforth et al., 2009; Zhu and Schmidt, 2009). The 1,2-cis-aminoglycoside structure is frequently found in bioactive oligosaccharides. Representative examples of oligosaccharides are glycosylphosphatidylinositol anchor 1, the aminoglycoside antibiotic neomycin 2, and glycosaminoglycan, including hemostat heparin 3. Recently, a multiple cis-aminoglycoside having an oligosaccharide 4 was found in Campylobacter jejuni as an N-linked oligosaccharide (Fig. 20.1). The stereoselective introduction of the glycosidic linkage is the key issue in oligosaccharide synthesis. 1,2-trans-Glycosides can be easily prepared with the anchimeric assistance of a neighboring participant (Schemes 20.1 and 20.2). Once a C-2 acyl or carbamate group carrying donor 5 is activated, the acyl or carbamate group participates in the resulting oxocarbenium ion to form cis-fused five-membered ring 7. Next, the acceptor RIKEN Advanced Science Institute, Saitama, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78020-4
#
2010 Elsevier Inc. All rights reserved.
413
414
Shino Manabe
H3N
HO HO O HO
OH O
O P O O HO HO HO HO HO
O O
NH2 O
HO HO
H2N HO
O O
O
H2N O
OH
O O
OH O
O HO HO
O HO
OH O
H2N
O
H2N O O O P O O O O O
O
OH O
NH2
NH2 OH
OH R1 OH OH OH
2 Neomycin B
R2 R3
O 1 Glycosylphosphatidylinositol (GPI) anchor OSO3– O O – HO O2C AcHN O HO
O
HO OH O HO AcHN O HO AcHN O
OSO3– O
O OH HO AcHN O O O HO – O3SO 3 CO2– Heparin anticoagulant drug
HO HO HO
OH
O
OH O O OH AcHN O HO AcHN O
O
O
OH
OH O
HO Me AcHN AcHN O
O
O
H N NHAc
ONH
4 N-linked oligosaccharide of campyrobacter jejuni
Figure 20.1 1,2-cis-aminoglycosides containing oligosaccharides.
attacks the cation from the opposite side of the five-membered ring to give the 1,2-trans-glycoside 8. Although 1,2-cis-glycosides are thermodynamically more stable due to the anomeric effect, a reliable methodology for 1,2-cis-glycoside preparation is still lacking. Furthermore, recent rapid oligosaccharide synthesis based on solid-phase and polymer-supported technology requires a more strictly stereocontrolled glycosylation reaction, since
415
1,2-cis-aminoglycosides
R O
X
PO
O
O
O
O
O
O
O
5
OR
PO
O
O
R
O
PO
PO
O
O H
R
R
R
6
7
8 1, 2-trans glycoside
Scheme 20.1 The 1,2-trans-glycosylation reaction with C-2 acyl donor. The 2-acyl group is represented.
O
O
PO O PO
PO
X
9
O PO
OR
10 1, 2-trans glycoside
X
O X
PO OR 11 1, 2-cis glycoside
Scheme 20.2 The 1,2-cis-glycosylation reaction.
purification of stereoisomers after cleavage is rather difficult (Ito and Manabe, 2007; Seeberger, 2008). Preparation of 1,2-cis-amino sugars has remained essentially unchanged since the 1970s. Lemieux and Paulsen reported that 2-azido-2-deoxy glycosides 12 are good glycosyl donors for 1,2-cis-glycosylation to afford aminoglycosides and these are still the first choice for 1,2-cis-aminoglycoside preparation (Lemieux and Ratcliffe, 1979; Paulsen et al., 1978). Unfortunately, a major problem of the 2-azido donor 12 is its moderate cisselectivity in the glycosylation reactions, which, in some cases, can be improved with the aid of solvent effects (Demchenko et al., 1997; Hashimoto et al., 1984). Furthermore, the preparation of such 2-azido glycosyl donors remains problematic because the reaction from glucal 13 using NaN3 and ceric ammonium nitrate in CH3CN lacks stereoselectivity while generating many by-products, hence purification by silica gel column chromatography is necessary (Fig. 20.2). An alternative preparation of 2-azido sugars from 2-amino sugar 14 requires the potentially explosive TfN3 (Alper et al., 1996; Titz et al., 2006; Vasella et al., 1991). Furthermore, a multistep synthetic sequence is required for the preparation of 2-azido sugars from mannose 15 via 2-triflate (Pozsgay, 2001).
416
Shino Manabe
O
PO
X
NH2 14
PO
TfN3, DMAP, CH3CN or, TfN3, K2CO3, CuSO4, H2O
CAN NaN3 O CH3CN PO 13
O N3 12
X
1) Tf2O, base, CH2Cl2 PO 2) NaN3, DMF
OH O
X
15
X = leaving group SR, SAr, imidate, F, Cl etc.
Figure 20.2
Preparation of 2-azide carrying glycosyl donor.
In order to achieve a high yielding and 1,2-cis-selective glycosylation reaction, several demands must be fulfilled: (1) stable under various reaction conditions, including basic conditions, that are necessary for preparation of the sugar unit; (2) stable under Lewis acidic glycosylation reaction conditions; and (3) readily and selectively removable after glycosylation reaction. Additionally, interaction from 2-position with the oxocarbenium ion intermediate should be suppressed in order to enhance 1,2-cis-stereoselective glycosylation. Despite the progress made in synthetic organic chemistry, the lack of any candidates that can fulfill all of the above criteria, other than the azido group, has prevented the development of alternate protecting groups for 1,2-cis-glycosylation reactions. In this chapter, recent progress in the 1,2-cis-glycosylation reaction of amino sugars and the preparation of 1,2-cis-amino sugars containing oligosaccharides and their biological importance is surveyed. The imine-protecting group has not been a major glycosyl donor because it is not stable under many conditions, especially under acidic conditions. The p-methoxybenzylidene protected glycosyl trichloroacetimidate donor 16 exhibits high a-selectivity by using Ni(4-FPhCN)4(OTf)2 as a catalyst to give disaccharide 18 in favor of the a-product (Scheme 20.3) (Mensah and Nguyen, 2009). The choice of the mediator is important. Hence, the use of AgOTf as a mediator gave b-selective glycosylation, while HgCN did not exhibit any selectivity. FeCl3 mediates the a-glycosylation of N-acetyl glucosamine pentaacetate in a 100 g-scale reaction in refluxing ClCH2CH2Cl (Wei et al., 2008). During the reaction, anomerization from the b-direction to the a-direction may occur under acidic conditions (vide infra). The cis-GalNAc-Ser/Thr motif is found in O-linked glycoproteins. Gin constructed the a-selective GalNAc-Ser/Thr motif under basic conditions (Scheme 20.4) (Ryan and Gin, 2008). The p-nosyl protected aziridine 20
417
1,2-cis-aminoglycosides
OAc O
AcO AcO
N O
+ CCl3
Ni(4-F-PhCN)4(OTf)2 CH2Cl2, 25 °C, 12 h
HO O BnO BnO BnO OMe
NH MeO
17
77% a:b = 20:1
O BnO
18
OBn O
+ p-Ns N OH NHAc
19
NHBn
BnO
OBn O
O NHAc
O
20 Base KH NaH
OMe
The a-selective glycosylation reaction. BnO
BnO
N O BnO BnO
MeO
16
Scheme 20.3
BnO
OAc O
AcO AcO
Solvent DMF THF
21 21a:22b 10:1 1:20
HN p-Ns
NHBn O
Yield(%) 73 77
Scheme 20.4 Preparation of the a-Gal-Ser/Thr motif via aziridine opening under basic conditions.
reacts with 2-acetamide GalNAc hemiacetal 19 under basic conditions. Interestingly, the selectivity was influenced by the choice of base and solvent. Namely, by using NaH in THF, b-selectivity was observed, whereas a-selectivity was observed when KH and DMF were used. Schmidt prepared the cis-glycosyl linkage from 2-nitroglycal by conjugate addition (Scheme 20.5; Winterfeld and Schmidt, 2001). The nitroglycal 23 was prepared from galactal 21 by addition of acetyl nitrate and subsequent elimination of acetic acid in a one-pot operation. The Michael addition between Ser or Thr derivative and nitroglycal was carried out in the presence of 0.1 equivalent of t-BuOK in toluene. The bulky protecting TBDPS group at the 6-position of compound 22 enhances the reactivity and steroselectivity. After removal of the TBDPS group, sialic acid derivative 26 was introduced in EtCN. The nitro group was reduced by Raney Ni, then protecting group manipulation gave the building block 28 suitable for glycopeptide synthesis. Hashimoto reported that 2-azido carrying glycosyl diphenyl phosphate 29 showed high a-selectivity with HClO4 in dioxane-Et2O. By using this methodology, protected galactosyl serine and threonine were prepared at room temperature with high a-selectivity (Scheme 20.6; Koshiba et al., 2008).
418
Shino Manabe
NHBoc BnO
OTBDPS O
BnO
(1) HNO3, Ac2O (2) Et3N, CH2Cl2
BnO
OTBDPS O
BnO
O2N
O 25
CO2Me
AcHN AcO AcO BnO
O
O
CO2Me
O2N
OAc 26
AcO
O
BnO
O
AcHN AcO
OAc
AcO
(2) TESOTf, EtCN 47% OAc AcO OP(OEt)2
O
KO Bu Toluene 97%
NO2
(1) TBAF, AcOH THF NHBoc OtBu
O
t
23
OTBDPS O
24
BnO
84% 22
BnO
OtBu
HO
O
NHBoc OtBu
27
O
OAc CO2Me
O (1) Raney-Ni AcHN AcO AcO H2, EtOH BnO (2) Ac2O, pyridine
O
O
75%
BnO
NHBoc
AcHN
OtBu
O
28
O
Scheme 20.5 Preparation of O-linked oligosaccharide via nitroglycal methodology.
AcO AcO
OAc O N3 29
O
P(OPh)2 O
HClO4 5AMS dioxane, Et2O 82% a :b 91:9
AcO AcO
OAc O N3
O
FmocHN
CO2Bn
30
Scheme 20.6 a-Selective glycosylation with phosphate donor.
Demchenko demonstrated that 2-azido-2-deoxy glucopyranosyl thiocyanate 31 was a useful a-glycosylation donor, although the number of examples was limited (Scheme 20.7; Kochetkov et al., 1993). Ando and Kiso reported the 4,6-silylene group is effective for a-selective glycosylation due to steric hindrance of the protecting group. Even with the
419
1,2-cis-aminoglycosides
Troc group, which can be expected for neighboring group assistance at the C2 position, high a-selectivity was observed (Scheme 20.8; Imamura et al., 2003, 2008). Boons reported sulfides are good external additives for cis-glycosylation involving azido donor glycosylation (Park et al., 2007). During the activation of imidate donor 37 in the presence of various sulfides, the a-selectivity was increased (Scheme 20.9). They speculated that sulfides coordinate to the oxocarbenium ion 38 from the b-side to give glycosyl sulfonium ion 39
AcO AcO AcO
TrO S C N + AcO AcO
O N3
O
Si
O O
AcO
+ O
AcO AcO
SPh NHTroc
34
N3
O O AcO AcO AcO 33 OMe
OMe
32
Scheme 20.7
O
81%
AcO
31
AcO AcO AcO
TrClO4 CH2Cl2
The a-glycosylation with thiocyanate donor. NIS TfOH MS4A CH2Cl2
OH O
O
96%
OAc
35
Si
O O
O AcO TrocHN O AcO AcO 36
O
O
OAc
Scheme 20.8 The a-glycosylation with 4,6-silylene protecting group.
AcO AcO
OAc O N3
O
CCl3
TMSOTf
AcO AcO AcO
O
NH
37
38
40
OMe
OAc O
AcO AcO
N3
N3
OBz O
HO BzO BzO
Sulfide
AcO AcO
39 OAc O
O N3BzO BzO
OBz O
41
OMe
Sulfide
Yield (%)
41a / b ratio
Non PhSEt
85
10 / 1 14 / 1
Thiophene
92 95
18 / 1
Scheme 20.9 The glycosylation reaction in the presence of sulfide.
SR2
420
Shino Manabe
based on 1H NMR analyses and density functional theory calculations, and the alcohol attacks the sulfonium ion from the a-side. The electrochemistry is very useful methodology for observation of the reactive species involved in the glycosylation reaction (Nokami et al., 2007, 2009). The thioglycoside 42 was quantitatively converted to the corresponding triflate 43 by electrolysis. The a- and b-glycosyl sulfonium ions 44 were also quantitatively prepared by addition of sulfide to the resulting glycosyl triflate 43. When Me2S was employed as an additive sulfide, both a- and b-glycosyl sulfonium ions 44 were observed at low temperature. After addition of MeOH, it was clearly demonstrating that the reactivity of the a-glycosyl sulfonium ion was higher than that of the b-glycosyl sulfonium ion (Scheme 20.10). In 2001, a novel trans-carbamate glycosyl donor 46 that exhibits high 1,2-cis-selectivity in glycosylation reactions (Scheme 20.11) was reported (Benakli et al., 2001; Boysen et al., 2005). Subsequent reports, however, described the drawbacks of such trans-carbamate donors, including significant side reactions such as sulfenylation from PhSOTf and glycosylation at the nitrogen atom (Kerns et al., 2003; Wei and Kerns, 2005a,b). To avoid such side reactions, the nitrogen atom was protected as an acetimide. Unfortunately, the stereoselectivity was significantly reduced and, in some cases, the reaction generated undesired b-glycoside as a major isomer. In addition, selective cleavage of an acetyl group from an imide is rather difficult (Scheme 20.12). Manabe showed that N-benzyl-2,3-trans-carbamate glycosyl donors 53 possess high cis-selectivity in glycosylation reactions (Manabe et al., 2006). Employing the secondary hydroxy group as a glycosyl acceptor, high
AcO AcO AcO
O
AcO AcO AcO
S
N3
O
Me2S
AcO AcO AcO
N3 OTf 43
O 44
SMe2
AcO MeOH AcO AcO
O
OMe
N3
N3
45
OTf
Scheme 20.10 Preparation of glycosyl sulfonium ion from thioglycoside via triflate by electrolysis.
AcO
OAc O O
NH
SPh +
OAll O
HO BnO BnO
90% OMe
O 46
PhSOTf CH2Cl2
47
AcO
OAc O O O
NH O BnO BnO 48
OAll O OMe
Scheme 20.11 The a-glycosylation reaction using 2,3-trans-carbamate having donor.
421
1,2-cis-aminoglycosides
MeO2C AcO AcO
O
O
OAc
MeO2C AcO AcO
O
X +
OAc
HO O
OBn O
OBn O O
STol
NH
O 51 4 0 – 60% STol
NH
O
X = Br or imidate 49
50
MeO2C AcO AcO
O OAc
O
OBn O
STol N AcO
O O
O
52 2 0–30%
OAc OAc CO2Me
Scheme 20.12 Disadvantage of 2,3-trans-carbamate donor.
BnO ClAcO O
O
O 53
N Bn
SPh
+
MeO2C
OBn O
OH
O 54
O
AgOTf PhSCl DTBMP toluene dioxane 71%
MeO2C
BnO
O
OBn O
O NBn
O
O
O O OAcCl 55
Scheme 20.13 The cis-glycosylation reaction with benzylated 2,3-trans-carbamate donor.
a-selectivity was observed near room temperature (Scheme 20.13). When a primary acceptor was employed as a glycosyl acceptor, a-selectivity was achieved with the aid of a solvent effect (toluene–dioxane). As shown in Scheme 20.14, the a component of the immune system stimulating O-polysaccharide from Proteus mirabilis O48 was synthesized by successive 1,2-cis-glycosylations using a one-pot methodology. The bromide 56 was selectively activated in the presence of thioglycoside 57, then the disaccharide 58 was activated by addition of a further amount of AgOTf and PhSCl to give the trisaccharide 60. This was the first example showing the preparation of two cis-glycoside bonds in a one-pot operation. Ye reported the N-acetyl 2,3-oxazolidinone-protected thioglycoside can be activated by a benzensulfinyl morpholine–Tf2O combination at 73 C (Yiqun et al., 2008a,b). Interestingly, in the presence of 2,4,6-tritert-butylpyrimidine as a base, complete b-selectivity was observed, while in the absence of 2,4,6-tri-tert-butylpyrimidine, complete a-selectivity was
422
Shino Manabe
observed. This a-selectivity may be due to anomerization via endocyclic cleavage under acidic conditions. Since the glycosides are symmetric acetals, there are two possibilities for cleavage of the acetal. The common mode of cleavage of glycosides is exocyclic cleavage where the bond between the anomeric carbon and the exocyclic oxygen breaks to give the cyclic oxacarbonium ion (Scheme 20.15, path A). This type of cleavage is a well-accepted mechanism whose importance has been clearly seen in the great success of oligosaccharide synthesis. The second is endocyclic cleavage, where the bond between the anomeric carbon and the pyranose ring oxygen breaks (Scheme 20.15, path B). Post and Karplus hypothesized a mechanism for the endo-mode hydrolysis of oligosaccharides based on molecular dynamics calculations on lysozyme where the conformation of the N-acetylglucopyranoside was restricted to the chair form (Post and Karplus, 1986). Since then, several studies have reported on endocyclic cleavage of pyranosides.
HO
OBn O
ClAcO O
+ N Br Bn
O
OBn O
O
ClAcO O
SPh
O
N Bn
O
56
AgOTf DTBMP toluene dioxane
OBn O N O Bn
OBn O
O
57
SPh
N Bn
O 58
ClAcO O O
AgOTf PhSCl OBn 81% O N O Bn O O
OBn O
AcO HO
OMP NPhth
59
OBn O N AcO O Bn
OBn O
OMP NPhth
60
Scheme 20.14 The two cis-glycosyl bond formation in a one-pot reaction.
O
Exocyclic cleavage H+ Path A
62
Path B O OR Path A
61
Endcyclic cleavage
OH
H+ Path B
63
Scheme 20.15 Endocyclic and exocyclic cleavages.
OR
423
1,2-cis-aminoglycosides
Crich (Crich and Jayalath, 2005), Oscarson (Boysen et al., 2005; Olsson et al., 2008), and Manabe (Manabe et al., 2006) independently showed that pyranosides with 2,3-trans-carbamate carrying pyranosides are easily anomerized from the b- to the a-direction under weak acidic conditions. Manabe showed clear evidence that this anomerization is caused via endocyclic cleavage and recyclization (Manabe et al., 2009). In the presence of reducing reagent Et3SiH, the reduced alcohol 68 was obtained as well as the starting material b-glycoside 64 and anomerized a-glycoside 67 (Scheme 20.16). The cations generated by endocyclic cleavage of 65 and 66 were reduced by Et3SiH to give the reduced product 68. In addition, the cation 65 generated via endocyclic cleavage could be trapped by intra- and intermolecular Friedel–Crafts reactions. The feasibility of endocyclic cleavage reaction with 2,3-trans-carbamate group was supported by density functional theory calculations (Satoh et al., 2009). Synthesis of bioactive oligosaccharides using the 2,3-trans-carbamate donor would be interesting. It was reported that oligosaccharide 71 (Fig. 20.3) exhibits anti-Helicobacter pylori activity. The gram-negative bacterium H. pylori infects the stomachs of nearly half the human population. Since the first demonstration of the potential pathogenic character of H. pylori, accumulated evidence strongly suggests that H. pylori causes gastric ulcers, carcinoma, and cancer (Warren and Marshall, 1983). The antiH. Pylori oligosaccharide 71 has a core-2 branched-type oligosaccharide with a characteristic a-N-acetyl glucosamine at the nonreducing end. It is
PO
PO PO O
OP SPh
PO
SR O
O
O O
OH
N 69
70 Toluene
PO O
OP O YR
H+
PO PO O
OH X
X O
64 b -anomer X = O, or NBn Y = O, S
PO PO O
YR
O
OH X
O
65
PO PO O
66
YR
PO PO O
O
X YR 67 a -anomer
O
Et3SiH OH YR X
O 68 Reduced product
Scheme 20.16 The capture of cations generated by endocyclic cleavage reaction.
424
Shino Manabe
believed that the nonreducing terminal a-1,4-GlcNAc is essential for growth inhibition of H. pylori and that the antibiotic activity is due to biosynthetic inhibition of cholesteryl-a-D-glucoside, an important component of the H. pylori cell membrane (Fig. 20.4). At that time, an antiH. Pylori oligosaccharide was available only as a recombinant glycoprotein (CD43) form, synthesized using a-1,4-N-acetyl glucosamine transferases in Chinese hamster ovary cells.
HO HO HO
O AcHN O HO O HO OH HO
OH O
HO O HO
OH O NHAc
O
HO
OH O
HO
O
AcNH O O
OH
AcHN
OMe
71
Figure 20.3 Anti-Helicobacter pylori oligosaccharide. Cholesterol
HO
HO HO HO
O AcHN
O
OH O
HO O OH HO
HO O
H. pylori
O NHAc
HO HO HO OH
HO HO HO
O O AcNH OH HO O O O AcHN O OH
Protein
O OH
Cholesteryl-a-D-glucoside
Figure 20.4 Mechanism of Helicobacer pylori growth inhibition
425
1,2-cis-aminoglycosides
The synthesis of the anti-H. pylori oligosaccharide was achieved using 2,3-trans-carbamate carrying glycosyl donor (Scheme 20.17) (Manabe et al., 2007). The donor 72 reacts with the acceptor 73 with complete cis-stereoselectivity in quantitative yield. The upper trisaccharide and lower trisaccharide portions were prepared from the common disaccharide 74. The thio-disaccharide 74 was directly activated to give the upper and lower trisaccharides 75 and 76. After transformation to the trisaccharides to acceptor and donor, the two trisaccharides were coupled to give the hexasaccharide in high yield. After sequential deprotection and selective N-acetylation, the hexasaccharide 71 was afforded in an efficient manner. Seeberger’s group also synthesized a pentasaccharide having a 1,2-cisGlcNAc moiety by using a 2-azido group (Wang et al., 2007). The cholesterol a-glucosyltransferase was expressed and enzyme activity inhibition was tested by using the chemically synthesized 1,2-a-GlcNAc having a pentasaccharide (IC50 0.47 mM) (Lee et al., 2006). Furthermore, the a1,4-GlcNAc capped mucin-type O-glycan more efficiently inhibits a-glucosyltransferase than a-glucosyl cholesterol (Kobayashi et al., 2009; Lee et al., 2008). Recently, the gram-negative bacterium C. jejuni was found to contain a unique N-linked protein glycosylation system (Szymanski et al., 1999; Wildt and Gerngross, 2005). The N-glycans 4 of C. jejuni plays an important role in host adherence, invasion, and colonization, although the
HO
OBn O
ClAcO O
+ N
O
AgOTf, DTBMP MS4A dioxane / toluene
Me
OBn O
S
AcO
N
92%
OAc
Br
O
Me
Bn
OBn O
ClAcO O
73
72
74 HO HO HO
OBn O
ClAcO O
N
O
O Bn AcO
Glycosylation and OR deprotetion NPhth
OBn O
O BnO
75
N O
O Bn
O O
AcO OAc
Me
OH O OH
HO HO OH
O O
S
OAc
HO
Ph OBn O
Me
O
O
OBn O
OBn O
AcHN O
OBn O OAc
ClAcO O
O
Bn AcO
O NHAc
HO O HO
O O AcNH
OH O
HO O O
HO OH
AcHN
OMe
71
N3 OMe
76
Scheme 20.17 The synthesis of anti-Helicobacter pylori oligosaccharide using 2,3-transcarbamate donor.
426
Shino Manabe
mechanism is not known (Karlyshev et al., 2004). The key structural feature of the oligosaccharide is a five cis-linked galactosamine motif with bacillosamine (Bac; 2,4-diacetamido-2,4,6-trideoxyglucopyranose) at the end, that is, GalNAc-a1,4-GalNAc-a1,4-[Glc-b1,3-]GalNAc-a1,4-GalNAc-a 1,4-GlaNAc-a1,3-Bac-b1,N-Asn (Young et al., 2002). The glycan is attached to the asparagine amido side chain at the Asn-X-Ser/Thr motif where X can be any amino acid except proline, similar to the eukaryotes system. The N-glycans 4 is encoded by 12 genes that are organized into a protein glycosylation locus, pgl. The heptasaccharide glycan is synthesized in a stepwise manner on an Und-PP carrier (Scheme 20.18). First, PglA adds a GalNAc residue to undecaprenyl phosphate bacillosamine 78 Bac, to yield a disaccharide undecaprenyl phosphate 80. PglA shows relaxed substrate specificity. 6-Hydroxybacillosamine is also transferred to PglA, as well as bacillosamine, but not GlcNAc, in vitro. Next, PglJ adds a second GalNAc residue to form the trisaccharide undecaprenyl phosphate 81. PglH then transfers three more GalNAc residues. Finally, PglI attaches the sidebranched glucose to give the complete heptasaccharide undecaprenyl phosphate 83. Imperiali’s group overexpressed the enzymes involving C. jejuni N-glycan biosynthesis, PglA, PglJ, PglH, and PlgI (Glover et al., 2005a,b). By using the overexpressed enzymes, the C. jejuni N-glycan was synthesized in vitro. N-linked oligosaccharides are usually transferred to amido residues of proteins by oligosaccharyl transferases. The biosynthesis of the N-linked oligosaccharide shows homology to the eukaryotic pathway (Szymanski et al., 2003; Weerapana and Imperiali, 2006). The oligosaccharyl transferase complex of mammals, yeast, and bacteria is a supermolecular machinery system and it transfers the dolicholyl-phosphate-linked oligosaccharide to the nascent polypeptide. Supermolecular complex formation is crucial for oligosaccharyl transferring activity in the case of yeast and mammalian transferases. In contrast to the mammalian and yeast transferases, the oligosaccharyl transferase in C. jejuni was reported to be a single unit, PglB, an 82 kDa integral membrane protein that catalyzes the transfer reaction. Imperiali’s group prepared a membrane fraction from E. coli in which PglB has been overexpressed. Using the PglB together with chemoenzymatically synthesized undecaprenyl-linked GalNAc-bacillosamine disaccharide (Weerapana et al., 2005), several glycopeptides were prepared (Glover, 2005; Chen et al., 2007). While PglB accepts the unnatural 6hydroxybacillosamine and GlcNAc analogs, the bacillosamine substrate is the most effective substrate. Even though the substrate specificity of PglB is relaxed, chitobiose was not transferred to the peptide. Aebi showed that PglB required an acetamido group of the donor for efficient glycan transfer to the protein (Wacker et al., 2006). Using an in vitro N-glycosylation strategy using PglB, a suitable quantity of the 13C/15N-labeled glycoprotein was obtained for NMR structural
427
1,2-cis-aminoglycosides
HO UDP-GlcNAc 77
HO
PgIFED
UDP-Bac 2, 4diNAc UMP Me 78 O AcHN Und-P HO PglA PglC AcHN O–PP-Und Und-PP-Bac2,4-diNAc 79
O
NHAc Me
O
OH O
UDPHO GalNAc UDP AcHN
AcHN O
O
NHAc Me
AcHN
PglJ
O
O
O
PP-Und
PP-Und Und-PP-Bac2,4-diNAc-GalNAc Und-PP-Bac2,4-diNAc-(GalNAc)2 80 81
HO OH O HO AcHN O
3UDPGalNAc
HO AcHN
OH O
HO UDPGalNAc UDP AcHN
OH O
OH O HO AcHN O
OH O HO AcHN O OH UDP O HO AcHN O
3UDP
PglH
OH O HO AcHN ONHAc Me AcHN O O
HO OH O HO AcHN O
OH O HO AcHN O
HO HO HO UDP-Glc UDP
PgII
PP-Und Und-PP-Bac2,4-diNAc-(GalNAc)5 82
OH O O OH AcHN O
O
OH O HO AcHN O
OH O
HO AcHN
O
3
NHAc
Und-P
7
OPO3–
Me AcHN O O PP-Und Und-PP-Bac2,4-diNAc-(GalNAc)2-(GalNAc)Glc-(GalNAc)2 83
Scheme 20.18
Biosynthetic pathway of N-glycan in Campylobacter jejuni.
investigations (Slynko et al., 2009). NMR analysis revealed that the heptasaccharide forms a well-defined rod-like structure, in contrast to the general belief that glycans adapt flexible conformations. Recently, homogeneous eukaryotic N-glycoprotein was prepared by using C. jejuni glycosylation machinery (Schwarz et al., 2010). The glycoprotein with C. jejuni glycan
428
Shino Manabe
was prepared in E. coli. After trimming of the glycan by a-N-acetylgalactosamidase, eukaryotic glycan was transferred with the key GlcNAc-Asn structure by endo-b-N-acetylglucosiminidase using Man3GlcNAc oxazoline as a donor substrate (Li et al., 2005). The chemical synthesis of the oligosaccharide portion of C. jejuni Nglycan was achieved by Ito using an azido donor (Scheme 20.19) (Amin et al., 2007; Ishiwata et al., 2006). From the common precursor 84, the galactosamine donor 85 and Bac derivative 86 were prepared. A pentafluoropropionyl ester as a protecting group was introduced at the 4-position in order to enhance the a-stereoselectivity in glycosylation reaction (Scheme 20.20). The expected a-selectivity was obtained due to the strong
HO
HO AcHN O HO AcHN O
PFPO
85 O
HO
OBn O
BnO
Ph O O
F HO HO N3 HO
OTBDPS
N3 84
O O
O
HO
OH
OH O
O AcHN HO AcHN O
OH
O N3 Me
OH O
O
N3
F
N3
OH
OH O
4
86
OBn O
87
HO Me AcHN AcHN O
OTBDPS
OBn PFPO O O OBn
BnO BnO
O
O
H N NHAc
O
NH
PFP = pentafluoropropionyl
Scheme 20.19 Synthetic analysis of N-glycan in Campylobacter jejuni.
PFPO BnO
OBn O N3
RO BnO
OBn O N3
85 R = PFP 88 R = Ac
RO F
BnO
OBn O
R = PFP
RO BnO
N3 R = Ac R = PFP
BnO
O O OBn O N3 R = Ac
Scheme 20.20 The mechanism of a-selective glycosylation.
OBn O N3 OR'
89 R = PFP 90 R = Ac
1,2-cis-aminoglycosides
429
electron-withdrawing nature of the pentafluoropropionyl group in the axial orientation to neutralize the dipole moment in the transition state. In the case of galactoside glycosylation, Boons reported the axial 4-position protecting group affects the stereoselectivity by a remote neighboring effect (Demchenko et al., 1999). Glycosaminoglycans including heparin and heparin sulfate are heavily Nand O-sulfated linear oligosaccharides. Heparin and heparin sulfate consist of 1,4-disaccharide units of a-L-iduronic or b-D-glucuronic acid and either Nacetyl- or N-sulfo-a-D-glucosamine (Esko and Selleck, 2002). To date, more than 100 heparin sulfate-binding proteins have been identified (Ori et al., 2008). Heparin has been used as an anticoagulant drug isolated from porcine mucosal tissue. Heparin binds to plasma protein antithrombin III causing a conformational change. The activated antithrombin III then inactivates thrombin and other proteases involved in blood clotting. The pentasaccharide, Fondaparinax, is now on the market (Petitou and van Boeckel, 2004). It has been proposed that the spatial organization of negative charge clusters in heparin sulfate is important for binding and biological activity. To investigate the biological activities related to the heparin sulfate-binding protein, the structures of well-defined oligosaccharides are required. However, the availability of glycosaminoglycans is rather scarce due to their complex structure and diversity. Synthetic and chemoenzymatic approaches have the potential to provide sufficient amounts of well-defined oligosaccharides. For the above reason, several excellent synthetic approaches for heparin are reported (Petitou et al., 2001; Lubineau et al., 2004; de Paz and Martin-Lomas, 2005; Zhou et al., 2006; Chen et al., 2008; Noti et al., 2006). Hung reported the efficient synthesis of heparin oligosaccharides (Lee et al., 2004). The disaccharide-repeating unit was prepared from a 2-azido donor 91 and a properly protected L-iduronic acid 92 (Scheme 20.21). The 1,6-idose anhydride 92 was prepared from diacetoneglucose in a few steps. The glycosylation reaction using 2-azido donor 91 gave both a- and b-disaccharides 93a and 93b. After acetolysis of the 1,6-anhydride, 93a was achieved in the presence of a catalytic amount of Cu(OTf)2, the disaccharide 94 was converted to the trichloroacetimidate donor. After elongation of the glycosyl chain, the 6-hydroxy group was oxidized under TEMPO oxidation conditions. After deprotection and sulfation, several heparins of different lengths were obtained. Boons prepared a library of 12 oligosaccharides using properly protected disaccharides (Arungundram et al., 2009). The structure–activity relationship for inhibition of aspartyl protease b-site amyloid precursor proteincleaving enzyme I (BACE-1) was determined using chemically synthesized oligosaccharides. BACE-1 generates a membrane-bound protein, which is further processed by the g-secretase enzyme complex to generate the neurotoxic amyloid b-peptide. The inhibition of BACE-1 would be potentially useful for treatment of Alzheimer’s disease (Asai et al., 2006).
430
Shino Manabe
The last example of interesting activity from a-1,2-cis-amino oligosaccharide is lipoteichoic acid (LTA) of Streptococcus pneumoniae (Fig. 20.5). Recently, Schmidt reported the synthesis of LTA of S. pneumoniae 97 (Pedersen et al., 2010). The pneumococcal LTA is recognized by the innate immune system (Hoebe et al., 2005). Activation is supposed to occur through the Toll-like receptor 2 with CD14 as a coreceptor. (Schlo¨der et al., 2003) However, it is known that Toll-like receptor 2 recognizes a
BzO NAPO BnO
O
CCl3
O
N3
NH
91
BzO NAPO BnO
AcO
BzO NAPO BnO TMSOTf
O
O
O O BnO BzO
92
93a a 61% 93b b 11% BzO NAPO BnO
O N3
O
OAc
AcO
94
O OBn
–
O2C
O
O
OBz
n O BnO
O N3
95 –O SO 3 O HO HO –O SHN 3
O
(1) Deprotection (2) Oxidation (3) Sulfation
OBz
OBz O OBn
Cu(OTf)2 Ac2O
N3
O
(1) Deprotection (2) Donor transformation (3) Elongation
O N3
+
HO BnO BzO
OMe
OSO3– O OH
96
n
OSO3–
O O HO – O3SHN OMe
Scheme 20.21 The heparin synthesis.
H3N
H3N HO HO HO
O OH
H3N Me O
O
O
O P
AcHN O HO
O
O
O HO
O NHAc
O
O P
O
O
OH OH
O O NHAc
OH
97
O O P O O HO HO
O OH
H3N Me O AcHN
O HO O
OH O
O O
HO
O
C13H27 O C13H27 O
Figure 20.5 The structure of lipoteichoic acid of Streptococcus pneumoniae.
1,2-cis-aminoglycosides
431
broad range of structurally different bacterial compounds, and specific stimulation of the immune system though a TLR-2-LTA interaction has been questioned (Hashimoto et al., 2006; Tawaratsumida et al., 2009). The oligosaccharide 97 was synthesized in 88 steps assembled from nine building blocks. The 1,2-cis-aminoglycosides were introduced by using a 2-azide carrying a glycosyl donor. By using the synthetic oligosaccharide 97, it is clearly revealed that neither TLR2 nor TLR4 were the receptors for the oligosaccharide, although 97 shows immunological activity resulting in cytokine release by an unknown mechanism. As described in this chapter, 1,2-cis-aminoglycoside preparation methodology is developing rapidly and complex oligosaccharide synthesis is now possible. Further progress in investigating biological events using the chemically synthesized oligosaccharides is promised.
REFERENCES Alper, P. B., Hung, S.-C., and Wong, C.-H. (1996). Metal catalyzed diazo transfer for the synthesis of azides from amines. Tetrahedron Lett. 37, 6029–6032. Amin, M. N., Ishiwata, A., and Ito, Y. (2007). Synthesis of N-linked glycan derived from Gram-negative bacterium, Campylobacter jejuni. Tetrahedron 63, 8181–8198. Arungundram, S., Al-Mafraji, K., Asong, J., Leach, F. E., 3rd, Amster, I. J., Venot, A., Turnbull, J. E., and Boons, G.-J. (2009). Modular synthesis of heparan sulfate oligosaccharides for structure-activity relationship studies. J. Am. Chem. Soc. 131, 17394–17405. Asai, M., Hattori, C., Iwata, N., Saido, T. C., Sasagawa, N., Szabo´, B., Hashimoto, Y., Maruyama, K., Tanuma, S., Kiso, Y., and Ishiura, S. (2006). The novel b-secretase inhibitor KMI-429 reduces amyloid b peptide production in amyloid precursor protein transgenic and wild-type mice. J. Neurochem. 96, 533–540. Benakli, K., Zha, C., and Kerns, R. J. (2001). Oxazolidinone protected 2-amino-2-deoxyD-glucose derivatives as versatile intermediates in stereoselective oligosaccharide synthesis and the formation of a-linked glycosides. J. Am. Chem. Soc. 123, 9461–9462. Boltje, T. J., Buskus, T., and Boons, G.-J. (2009). Opportunities and challenges in synthetic oligosaccharide and glycoconjugate research. Nat. Chem. 1, 611–622. Bongat, A. F. G., and Demchenko, A. V. (2007). Recent trends in the synthesis of O-glycosides of 2-amino-2-deoxysugars. Carbohydr. Res. 342, 374–406. Boysen, M., Gemma, E., Lahmann, M., and Oscarson, S. (2005). Ethyl 2-acetamido-4, 6-diO-benzyl-2, 3-N, O-carbonyl-2-deoxy-1-thio-a-D-glycopyranoside as a versatile GlcNAc donor. Chem. Commun. 3044–3046. Chen, M. M., Glover, K. J., and Imperiali, B. (2007). From peptide to protein: Comparative analysis of the substrate specificity of N-linked glycosylation in C. jejuni. Biochemistry 46, 5579–5585. Chen, J. F., Zhou, Y., Chen, C., Xu, W. C., and Yu, B. (2008). Synthesis of a tetrasaccharide substrate of heparanase. Carbohydr. Res. 343, 2853–2862. Crich, D., and Jayalath, P. (2005). Stereocontrolled formation of b-glucosides and related linkages in the absence of neighboring group participation: Influence of a trans-fused 2, 3-O-carbonate group. J. Org. Chem. 70, 7252–7259. de Paz, J. L., and Martin-Lomas, M. (2005). Synthesis and biological evaluation of a heparinlike hexasaccharide with the structural motifs for binding to FGF and FGFR. Eur. J. Org. Chem. 1849–1858.
432
Shino Manabe
Demchenko, A., Stauch, T., and Boons, G.-J. (1997). Solvent and other effects on the stereoselectivity of thioglycoside glycosidations. Synlett 818–820. Demchenko, A. V., Rousson, E., and Boons, G.-J. (1999). Stereoselective 1, 2-cis-galactosylation assisted by remote neighboring group participation and solvent effects. Tetrahedron Lett. 40, 6523–6526. Esko, J. D., and Selleck, S. B. (2002). Order out of chaos: Assembly of ligand binding sites in heparan sulfate. Annu. Rev. Biochem. 71, 435–471. Glover, K. J., Weerapana, E., and Imperiali, B. (2005a). In vitro assembly of the undecaprenylpyrophosphate linked heptasaccharide for prokaryotic N-linked glycosylarion. Proc. Natl. Acad. Sci. USA 102, 14255–14259. Glover, K. J., Weerapana, E., Numao, S., and Imperiali, B. (2005b). Chemoenzymatic synthesis of glycopeptides with PglB, a bacterial oligosaccharyl transferase from Campylobacter jejuni. Chem. Biol. 12, 1311–1316. Hashimoto, S., Hayashi, M., and Noyori, R. (1984). Glycosylation using glucopyranosyl fluorides and silicon-based catalysis. Solvent dependency of the stereoselection. Tetrahedron Lett. 25, 1379–1382. Hashimoto, M., Tawaratsumida, K., Kariya, H., Kiyohara, A., Suda, Y., Kirikae, F., Kirikae, T., and Go¨tz, F. (2006). Not lipoteichoic acid but lipoproteins appear to be the dominant immunobiologically active compounds in Staphylococcus aureus. J. Immunol. 177, 3162–3169. Hoebe, K., Georgel, P., Rutshchmann, S., Du, X., Mudd, S., Crozat, K., Sovath, S., Shamel, S., Hartung, T., Za¨hringer, U., and Beutle, B. (2005). CD36 is a sensor of diacylglycerides. Nature 433, 523–527. Imamura, A., Ando, H., Korogi, S., Tanabe, G., Muraoka, O., Ishida, H., and Kiso, M. (2003). Di-tert-butylsilylene (DTBS) group-directed a-selective galactosylation unaffected by C-2 participating functionalities. Tetrahedron Lett. 44, 6725–6728. Imamura, A., Ando, H., Ishida, H., and Kiso, M. (2008). DTBS EFFECT: The unique sterically driven director for a-galactosylation. Heterocycles 76, 883–908. Ishiwata, A., Ohta, S., and Ito, Y. (2006). A stereoselective 1, 2-cis glycosylation toward the synthesis of a novel N-linked glycan from the Gram-negative bacterium, Campylobacter jejuni. Carbohydr. Res. 341, 1557–1573. Ito, Y., and Manabe, S. (2007). Polymer supported oligosaccharide synthesis and related technologies. ( J. P. Karmerling, G.-J. Boons, Y. C. Lee, A. Suzuki, N. Taniguchi, and A. G. J. Voragen, eds.), Vol. I, pp. 335–378. Elsevier, Amsterdam. Karlyshev, A. V., Everest, P., Linton, D., Cawthrw, S., Newell, D. G., and Wren, B. W. (2004). The Campylobacter jejuni general glycosylation system is important for attachment to human epithelial cells and in the colonization of chicks. Microbiology 150, 1957–1964. Kerns, R. J., Zha, C., Benakli, K., and Liang, Y.-Z. (2003). Extended applications and potential limitations of ring-fused 2, 3-oxazolidinone thioglycosides in glycoconjugate synthesis. Tetrahedron Lett. 44, 8069–8072. Kobayashi, M., Lee, H., Nakayama, J., and Fukuda, M. (2009). Roles of gastric mucin-type O-glycans in the pathogenesis of Helicobacter pylori infection. Glycobiology 10, 453–461. Kochetkov, N. K., Klimov, E. M., Malysheva, N. N., and Demchenko, A. V. (1993). Stereospecific synthesis of 1, 2-cis glycosides of 2-amino sugars. Carbohydr. Res. 242, C7–C10. Koshiba, M., Suzuki, N., Arihara, R., Tsuda, T., Nambu, H., Nakamura, S., and Hashimoto, S. (2008). Catalytic stereoselective glycosidation with glycosyl diphenyl phosphates: Rapid construction of 1, 2-cis-a-glycosidic linkages. Chem. Asian J. 3, 1664–1677. Lee, J.-C., Lu, X.-A., Kulkan, S. S., Wen, Y.-S., and Hung, S.-C. (2004). Synthesis of heparin oligosaccharide. J. Am. Chem. Soc. 126, 476–477.
1,2-cis-aminoglycosides
433
Lee, H., Kobayashi, M., Wang, P., Nakayama, J., Seeberger, P. H., and Fukuda, M. (2006). Expression cloning of cholesterol a-glucosyltransferase, a unique enzyme that can be inhibited by natural antibiotic gastric mucin O-glycans, from Helicobacter pylori. Biochem. Biophys. Res. Commun. 349, 1235–1241. Lee, H., Wang, P., Hoshino, H., Ito, Y., Kobayashi, M., Nakayama, J., Seberger, P. H., and Fukuda, M. (2008). a1, 4GlcNAc-capped mucin-type O-glycan inhibits cholesterol aglucosyltransferase from Helicobacter pylori and suppresses H. pylori growth. Glycobiology 18, 549–558. Lemieux, R. U., and Ratcliffe, R. M. (1979). The azidonitration of tri-O-acetyl-D-galactal. Can. J. Chem. 57, 1244–1251. Li, B., Zeng, Y., Hauser, S., Song, H., and Wang, L.-X. (2005). Highly efficient endoglycosidase-catalyzed synthesis of glycopeptides using oligosaccharide oxazolines as donor substrates. J. Am. Chem. Soc. 127, 9692–9693. Lubineau, A., Lortat-Jacob, H., Gavaed, O., Sarrazin, S., and Bonnaffe, D. (2004). Synthesis of tailor-made glycoconjugate mimetics of heparan sulfate that bind IFN-g in the nanomolar range. Chem. Eur. J. 10, 4265–4282. Manabe, S., Ishii, K., and Ito, Y. (2006). N-Benzyl-2, 3-oxazolidinone as a glycosyl donor for Selective a-glycosylation and one-pot oligosaccharide synthesis involving 1, 2-cisglycosylation. J. Am. Chem. Soc. 128, 10666–10667. Manabe, S., Ishii, K., and Ito, Y. (2007). Synthesis of a natural oligosaccharide antibiotic active against Helicobacter pylori. J. Org. Chem. 72, 6107–6115. Manabe, S., Ishii, K., Hashizume, D., Koshino, H., and Ito, Y. (2009). Evidence for endocyclic cleavage of conformationally restricted glycopyranosides. Chem. Eur. J. 15, 6894–6901. Mensah, E. A., and Nguyen, H. M. (2009). Nickel-catalyzed stereoselective formation of a2-deoxy-2-amino glycosides. J. Am. Chem. Soc. 131, 8778–8780. Nokami, T., Shibuya, A., Tsuyama, H., Suga, S., Bowers, A. A., Crich, D., and Yoshida, J.-I. (2007). Electrochemical generation of glycosyl triflate pools. J. Am. Chem. Soc. 129, 10922–10928. Nokami, T., Shibuya, A., Manabe, S., Ito, Y., and Yoshida, J.-I. (2009). a- and b-glycosyl sulfonium ions: Generation and reactivity. Chem. Eur. J. 15, 2252–2255. Noti, C., dePaz, J. L., Polito, L., and Seeberger, P. H. (2006b). Preparation and use of microarrays containing synthetic heparin oligosaccharides for the rapid analysis of heparin-protein interactions. Chem. Eur. J. 12, 8664–8686. Olsson, J. D. M., Eriksson, L., Lahmann, M., and Oscarson, S. (2008). Investigations of glycosylation reactions with 2-N-acetyl-2N, 3O-oxazolidinone-protected glucosamine donors. J. Org. Chem. 73, 7181–7188. Ori, A., Wilkinson, M. C., and Femrnig, D. G. (2008). The heparanome and regulation of cell function: Structures, functions and challenges. Front. Biosci. 13, 4309–4338. Park, J., Kawatkar, S., Kim, J.-H., and Boons, G.-J. (2007). Stereoselective glycosylations of 2azido-2-deoxy-glucosides using intermediate sulfonium ions. Org. Lett. 9, 1959–1962. Paulsen, H., Kalar, C., and Stenzel, W. (1978). Building units for oligosaccharides, XI. Synthesis of a-glycosidically linked di- and oligosaccharides of 2-amino-2-deoxy-Dgalactopyranose. Chem. Ber. 111, 2358–2369. Pedersen, C. M., Figueroa-Perez, I., Lindner, B., Ulmer, A. J., Zahringer, U., and Schmidt, R. R. (2010). Total synthesis of lipoteichoic acid of Streptococcus pneumoniae. Angew. Chem. Int. Ed. 49, 2585–2590. Petitou, M., Imberty, A., Duchaussoy, P., Driguez, P. A., Ceccato, M. L., Gourvenec, F., Sizun, P., Herault, J. P., Perez, S., and Herbert, J. M. (2001). Experimental proof for the structure of a thrombin-inhibiting heparin molecule. Chem. Eur. J. 7, 858–873. Petitou, M., and van Boeckel, C. A. A. (2004). A synthetic antithrombin III binding pentasaccharide is now a drug! What comes next? Angew. Chem. Int. Ed. 32, 3118–3133.
434
Shino Manabe
Post, C. B., and Karplus, M. (1986). Does lysozyme follow the lysozyme pathway? An alternative based on dynamic, structural, and stereoelectronic considerations. J. Am. Chem. Soc. 108, 1317–1319. Pozsgay, V. (2001). Large scale synthesis of 2-azidodeoxy glucosyl donors. J. Carbohydr. Chem. 21, 659–665. Ryan, D. A., and Gin, D. Y. (2008). Ring-Opening of azididine-2-carboxamides with carbohydrate C1-O-nucleophiles. Stereoselective preparation of a- and b-O-glycosyl serine conjugates. J. Am. Chem. Soc. 130, 15228–15229. Satoh, H., Hutter, J., Luthi, H. P., Manabe, S., Ishii, K., and Ito, Y. (2009). Low-barrier pathway for endo-cleavage induced anomerization of pyranosides with N-benzyl-2, 3-trans-oxazolidinone groups. Eur. J. Org. Chem. 2009, 1127–1131. Schlo¨der, N. W., Morath, S., Alexander, C., Hamann, L., Hartung, T., Zahringer, U., Gobel, U. B., Weber, J. R., and Schumann, R. R. (2003). Lipoteichoic acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide-binding protein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved. J. Biol. Chem. 278, 15587–15594. Schwarz, F., Huang, W., Li, C., Schulz, B. L., Lizak, C., Palumbo, A., Numao, S., Neri, D., Aebi, M., and Wang, L.-X. (2010). A combined method for producing homogeneous glycoproteins with eukaryotic N-glycosylation. Nat. Chem. Biol. 5, 264–266. Seeberger, P. H. (2008). Automated oligosaccharide synthesis. Chem. Soc. Rev. 37, 19–28. Slynko, V., Schubert, M., Numao, S., Kowarik, M., Aebi, M., and Allain, F. H. T. (2009). NMR structure determination of a segmentally labeled glycoprotein using in vitro glycosylation. J. Am. Chem. Soc. 13, 1274–1281. Stallforth, P., Lepenies, B., Adibekian, A., and Seeberger, P. H. (2009). Carbohydrates: A frontier in medicinal chemistry. J. Med. Chem. 52, 5561–5577. Szymanski, C. M., Yao, R., Ewing, C. P., Trust, T. J., and Guerry, P. (1999). Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol. Microbiol. 32, 1022–1030. Szymanski, C. M., Logan, S. M., Linton, D., and Wren, B. W. (2003). Campylobacter—A tale of two protein glycosylation systems. Trends Microbiol. 11, 233–238. Tawaratsumida, K., Furuyashiki, Katsuimoto, M., Fujimoto, Y., Fukase, K., Suda, Y., and Hashimoto, M. (2009). Characterization of N-terminal structure of TLR2-activating lipoprotein in Staphylococcus aureus. J. Biol. Chem. 284, 9147–9152. Titz, A., Radic, Z., Schwardt, O., and Ernst, B. (2006). A safe and convenient method for the preparation of triflyl azide, and its use in diazo transfer reactions to primary amines. Tetrahedron Lett. 47, 2383–2385. Vasella, A., Witzig, C., Chiara, J. L., and Martin-Lomas, M. (1991). Convenient synthesis of 2-azido-2-deoxy-aldoses by diazo transfer. Helv. Chem. Acta 74, 2073–2077. Wacker, M., Feldman, M. F., Callewaert, N., Kowarik, M., Clarke, B. R., Phol, N. L., Hernandez, M., Vines, E. D., Valvano, M. A., Whitfield, C., and Aebi, M. (2006). Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proc. Natl. Acad. Sci. USA 103, 7088–7093. Wang, P., Lee, H., Fukuda, M., and Seeberger, P. H. (2007). One-pot synthesis of a pentasaccharide with antibiotic activity against Helicobacter pylori. Chem. Commun. 19, 1963–1965. Warren, J. R., and Marshall, B. J. (1983). Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 321, 1273–1275. Weerapana, E., and Imperiali, B. (2006). Aspargin-linked protein glycosylation: From eukaryotic to prokaryotic systems. Glycobiology 16, 91R–101R. Weerapana, E., Glover, K. J., Chen, M. M., and Imperiali, B. (2005). Investigating bacterial N-linked glycosylation: Synthesis and glycosyl acceptor activity of the undecaprenyl pyrophosphate-linked bacillosamine. J. Am. Chem. Soc. 127, 13766–13767.
1,2-cis-aminoglycosides
435
Wei, P., and Kerns, R. J. (2005a). Factors affecting stereocontrol during glycosidation of 2, 3-oxazolidinone-protected 1-tolylthio-N-acetyl-D-glucosamine. J. Org. Chem. 70, 4195–4198. Wei, P., and Kerns, R. J. (2005b). Chemoselective deprotection and functional group interconversion of ring-fused 2N, 3O-oxazolidinones of N-acetyl-D-glucosamine. Tetrahedron Lett. 46, 6901–6905. Wei, G., Lv, X., and Du, Y. (2008). FeCl3-catalyzed a-glycosidation of glucosamine pentaacetates. Carbohydr. Res. 343, 3096–3099. Wildt, S., and Gerngross, T. U. (2005). The humanization of N-glycosylation pathways in yeast. Nat. Rev. Microbiol. 3, 119–128. Winterfeld, G. A., and Schmidt, R. R. (2001). Nitroglycal concatenation: A broadly applicable and efficient approach to the synthesis of complex O-glycans. Angew. Chem. Int. Ed. 40, 2654–2657. Yiqun, G., Zhang, L.-H., and Ye, X. S. (2008a). Pre-activation protocol leading to highly seteroselectivity-conrallable glycosylations of oxazolidinone protected glucosamines. Chem. Commun. 597–599. Yiqun, G., Zhang, L.-H., and Ye, X.-S. (2008b). Stereoselectivity investigation on glycosylation of oxazolidinone protected 2-amino-2-deoxy-D-glucose donors based on preactivation protocol. Tetrahedron 64, 4949–4958. Young, N. M., Brisson, J.-R., Kelly, J., Watson, D. C., Tessier, L., Lanthier, P. H., Jarrell, H. C., Cadotte, N., St. Michael, F., Aberg, E., and Szmanski, C. M. (2002). Structure of the N-linked glycan present on multiple glycoproteins in the gram-negative bacterium, Campylobacter jejuni. J. Biol. Chem. 277, 42530–42539. Zhou, Y., Lin, F., Chen, J. F., and Yu, B. (2006). Toward synthesis of the regular sequence of heparin: Synthesis of two tetrasaccharide precursors. Carbohydr. Res. 341, 1619–1629. Zhu, X., and Schmidt, R. R. (2009). New principles for glycoside-bond formation. Angew. Chem. Int. Ed. 48, 1900–1934.
C H A P T E R
T W E N T Y- O N E
Aminoglycosides: Redesign Strategies for Improved Antibiotics and Compounds for Treatment of Human Genetic Diseases Varvara Pokrovskaya, Igor Nudelman, Jeyakumar Kandasamy, and Timor Baasov Contents 1. Introduction 2. Aminoglycoside Antibiotics: Their Mode of Action and Major Drawbacks 3. Strategies Toward Development of Improved Antibiotics 3.1. Alteration of neomycin B at C500 position to prevent APH(30 ) resistance 3.2. Dual activity of C500 -modified neomycin B derivatives against Bacillus anthracis 3.3. 30 ,40 -Methylidene protected aminoglycosides: A strategy to reduce toxicity and overcome resistance enzymes 3.4. Neomycin B-based hybrid antibiotics: A strategy to delay resistance development 4. Aminoglycosides as Readthrough Inducers for the Treatment of Genetic Diseases 4.1. Development of new variants of aminoglycosides with improved readthrough activity and reduced toxicity 5. Concluding Remarks and Future Perspectives Acknowledgments References
438 440 443 444 447 449 450 454 455 458 458 459
Abstract Aminoglycosides are highly potent, broad-spectrum antibiotics that kill bacteria by binding to the ribosomal decoding site and reducing the fidelity of protein synthesis. The emergence of bacterial strains resistant to these drugs, as well The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion—Israel Institute of Technology, Haifa, Israel Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78021-6
#
2010 Elsevier Inc. All rights reserved.
437
438
Varvara Pokrovskaya et al.
as their relative toxicity, have inspired extensive searches toward the goal of obtaining novel molecular designs with improved antibacterial activity and reduced toxicity. In recent years, a new therapeutic approach that employs the ability of certain aminoglycosides to induce mammalian ribosomes to readthrough premature stop codon mutations has emerged. This new and challenging task has introduced fresh research avenues in the field of aminoglycosides research. In this chapter, our recent observations and current challenges in the design of aminoglycosides with improved antibacterial activity and the treatment of human genetic diseases are discussed.
1. Introduction The discovery of streptomycin by Selman Waksman in 1944 was a landmark not just in antibiotic history but also in a revolutionary recognition of complex carbohydrates as an important class of natural products (Schatz et al., 1944). Streptomycin was the first aminoglycoside to be isolated from a bacterial source and the first effective antibiotic against Mycobacterium tuberculosis. In the following decades, several milestone aminoglycoside drugs (Fig. 21.1), such as neomycin, kanamycin, tobramycin, and others, were isolated from soil bacteria by intense search for natural products with antibacterial activity (Umezawa and Hooper, 1982). However, the rapid spread of antibiotic resistance to this family of antibacterial agents in pathogenic bacteria (Vakulenko and Mobashery, 2003), along with their relative toxicity to mammals, have stimulated medicinal chemistry approaches toward the development of improved antibiotics. Earlier studies on direct chemical modification of existing aminoglycoside drugs, with the aim of circumventing the resistance mechanisms, have yielded several semisynthetic drugs such as amikacin, dibekacin, netilmicin, and isepamicin that were introduced into clinical use in the 1970s and 1980s (Kondo and Hotta, 1999). More recent advancements in studies of resistance mechanisms (Wright, 2008), high-resolution structures of aminoglycosides in complex with their ribosomal RNA (rRNA) target (Francois et al., 2005; Ogle and Ramakrishnan, 2005), along with the identification and characterization of biosynthetic enzymes for certain aminoglycosides (Llewellyn and Spencer, 2006), have stimulated the development of innovative chemical (Li and Chang, 2006; Silva and Carvalho, 2007) and chemoenzymatic strategies (Llewellyn and Spencer, 2008; Nudelman et al., 2008) toward improved aminoglycoside derivatives and mimetics (Chittapragada et al., 2009; Hermann, 2007). Although the prokaryotic selectivity of action is critical to the therapeutic utility of aminoglycosides as antibiotics, they are not entirely selective to bacterial ribosome; they also bind to the eukaryotic rRNA (Bottger et al., 2001)
4, 5-Disubstituted
4, 6-Disubstituted
6' R1 I R1 6' R2 O R3 HO O 1' HO R4 1' II NH 4 2 H2N H2N O 4 NH2 O 1 NHR2 NH2 O HO HO 5 OH 6O 5'' O Neamine O Me paromamine III OH NH2 HO NH OH O OH O Me HN Ribostamycin OH IV butirosin B R1 Neamine Ribostamycin Neomycin B Paromomycin Paromamine Butirosin B
NH2 NH2 NH2 OH OH NH2
R1
R2 H H H H H AHB
Gentamicin C1 Gentamicin C1a Gentamicin C2 Gentamicin C2a Gentamicin C2b Geneticin (G418)
NHCH3 H NH2 CH3 NHCH3 CH3
R2 CH3 NH2 CH3 NH2 H OH
R1 R2
6' NH2 O 1' R3 O 4 HO
NH2 1
6O
NHR4 OH OH
O HO H2N
Kanamycin A Kanamycin B Amikacin Tobramycin Debekacin Arbekacin
R 1 R2
R3
R4
OH OH OH OH OH OH OH H H H H H OH
OH NH2 OH NH2 NH2 N2H
H H AHB H H AHB
AHB = NH2
Neomycin family
Gentamicin family
O Kanamycin family
Figure 21.1 Chemical structures of 4,5- and 4,6-disubtituted 2-DOS containing natural and synthetic aminoglycosides.
440
Varvara Pokrovskaya et al.
and promote mistranslation (Eustice and Wilhelm, 1984). The use of this disadvantage of aminoglycoside antibiotics for the possible treatment of human genetic diseases caused by premature nonsense mutations is extremely challenging (Zingman et al., 2007). There are more than 1800 inherited human diseases caused by nonsense mutations, that is, alterations in the genetic code that prematurely stop the translation of proteins. Aminoglycosides have emerged as vanguard pharmacogenetic agents in treating such genetic disorders due to their unique ability to induce mammalian ribosomes to readthrough premature stop codon mutations. In numerous preclinical and pilot clinical studies, this new therapeutic approach shows promise in phenotype correction by promoting otherwise defective protein synthesis (Kellermayer et al., 2006). However, severe side effects of existing aminoglycoside drugs, including high toxicity to mammals and the reduced readthrough efficiency at subtoxic doses, have inspired extensive searches toward the goal of obtaining novel molecular designs with improved readthrough activity and reduced toxicity (Hainrichson et al., 2008; Hermann, 2007). During the past few years, several comprehensive review articles that cover traditional areas of aminoglycoside use as antibiotics, including development of novel semisynthetic aminoglycoside derivatives (Chittapragada et al., 2009; Zhou et al., 2007), molecular mechanism of action, mechanisms of resistance (Wright, 2008), and toxicity (Guthrie, 2008), have been published. In addition, the book titled ‘‘Aminoglycoside Antibiotics: From Chemical Biology to Drug Discovery’’ was published in 2007 by John Wiley & Sons, Inc., providing an excellent overview of recent advances in the field (Arya, 2007). Therefore, in this chapter we focus mostly on our recent efforts to develop new designs with improved activity against resistant and pathogenic bacteria, new designs that are active against drug-resistant bacteria and exhibit reduced potential for generating new bacterial resistance, and new designs with improved premature stop codon suppression activity and reduced toxicity.
2. Aminoglycoside Antibiotics: Their Mode of Action and Major Drawbacks The majority of aminoglycosides consist of a central aminocyclitol ring, usually 2-deoxystreptamine (2-DOS) linked to one or more amino sugars by glycosidic bonds. Depending on the substitution pattern on the 2-DOS ring, aminoglycosides can be divided into two major classes: 4,5and 4,6-disubstituted 2-DOS aminoglycosides (Fig. 21.1). The nomenclature usually refers to ring I as primed and corresponds to the amino sugar
Designer Aminoglycosides
441
linked at position 4. Ring II is unprimed and corresponds to the central 2-DOS ring. Ring III is referred to as the doubly primed and corresponds to the substituent in position 5 or 6 of the 2-DOS. Rings with sequential numbers (IV, V) are usually attached to ring III (Fig. 21.1). Neomycin B, a representative of 4,5-disubstituted 2-DOS subclass, is used topically in the form of creams and lotions for the treatment of bacterial infections caused from skin burns, wounds, and dermatitis ( Jana and Deb, 2006). Paromomycin, another representative of 4,5-disubstituted 2-DOS, is used therapeutically against intestinal parasites ( Jana and Deb, 2006) and in the treatment of a variety of tropical diseases, including leishmaniasis and certain types of fungal infection (Sundar and Chakravarty, 2008). On the other hand, the 4,6-disubstituted 2-DOS subclass antibiotics, including gentamicin, amikacin, and tobramycin, have important clinical applications in the treatment of serious Gram-negative bacterial infections, especially in cases of opportunistic bacteria accompanying cystic fibrosis (CF), AIDS, and cancer. Both the 4,5- and 4,6-disubstituted subclasses of aminoglycosides exert their antibacterial activity by targeting the phylogenetically conserved decoding site (A-site) of bacterial 16S rRNA in the 30S ribosomal subunit (Moazed and Noller, 1987) and interfering with decoding and global translation processes. During the recent years, several studies on NMR and crystal structures of aminoglycosides bound to bacterial A-site oligonucleotide models (Fourmy et al., 1998; Francois et al., 2005), along with crystal structures of the bacterial 30S and 70S ribosomal particles (Carter et al., 2000; Selmer et al., 2006) with and without the bound aminoglycoside, have provided fascinating insights into our understanding of the decoding mechanism in prokaryote cells and of how 2-DOS aminoglycosides induce the deleterious misreading of the genetic code. These structures revealed that upon binding to the 30S subunit, aminoglycosides displace the two noncomplementary adenines, A1492 and A1493, at the A-site of the ribosome and lock them into so-called ‘‘on’’ state orientation, similar to that observed during mRNA decoding. As a result, during the codon–anticodon interaction and the proofreading process not only the cognate tRNA is stabilized, but near-cognate tRNA is stabilized as well which causes the misreading process, the accumulation of truncated and nonfunctional proteins and eventually leading to bacterial cell death. While this mechanism of action is now well accepted for the majority of 2-DOS aminoglycosides, the recent crystallographic investigation of a series of aminoglycosides bound to the A-site oligonucleotide models (Francois et al., 2005; Vicens and Westhof, 2003) suggest that the actual molecular mechanism of this ‘‘molecular switch’’ system is more complex and that additional thermodynamic and kinetic factors are likely to govern the impact of aminoglycosides on prokaryotic translation (Ogle and Ramakrishnan, 2005). Indeed, recent
442
Varvara Pokrovskaya et al.
study to characterize the energetics and dynamics associated with the aminoglycoside–rRNA interaction demonstrated that the aminoglycosideinduced reduction in the mobility of the A1492 residue is an important determinant of antibacterial activity (Kaul et al., 2006). Resistance to the aminoglycosides occurs by three methods: (1) decrease of intracellular drug concentration (import and efflux), (2) modification of the target rRNA and ribosomal proteins, and (3) enzymatic drug modification (Wright, 2008). The latter is the most prevalent mechanism in clinical isolates of resistant bacteria. Three distinct classes of aminoglycoside-modifying enzymes are known: the aminoglycoside phosphotransferases (APHs), the aminoglycoside-acetyltransferases (AACs), and the aminoglycoside-adenyltransferases (ANTs; Fig. 21.2). These modifications reduce the binding affinity of aminoglycosides to the A-site and thus significantly decrease their antibacterial potential. Members of each of these classes of enzymes are widespread in both Gram-negative and Gram-positive bacteria, and 3D crystal structures of representative proteins from each class have recently been solved (Magnet and Blanchard, 2005; Wright, 2008). Among these three enzyme classes, aminoglycoside 30 -phosphotransferases [APH (30 )s], of which seven isozymes are known, are most widely represented. These enzymes catalyze transfer of g-phosphoryl group of ATP to the 30 -hydroxyl of many aminoglycosides, rendering them inactive. Although the enzymes of all three classes are typically monofunctional enzymes, the recent emergence of genes encoding bifunctional aminoglycoside-modifying enzymes, for example, the bifunctional AAC(60 )/APH(200 ) enzyme, is another level of sophistication relevant to the clinical use of aminoglycosides (Zhang et al., 2009). AAC(6′)–APH(2′′)
ANT(4′) 4′
APH(3′)
H2N AAC(6′)–APH(2′′)
AAC(3)
6′ NH2
O HO HO 3′ H2N O O HO 5′′ O OH NH2 3′′′ O O OH
AAC(1) 3 NH2 1 NH 2 OH
OH
Neomycin B
Figure 21.2 Aminoglycoside-modifying enzymes and their modification sites are highlighted on the structure of neomycin B.
443
Designer Aminoglycosides
Another main drawback of aminoglycoside antibiotics is their relatively high toxicity to humans. The aminoglycosides-induced toxic effects include nephrotoxicity, ototoxicity (vestibular and auditory), and, rarely, neuromuscular blockade and hypersensitivity reactions (Nagai and Takano, 2004; Talaska and Schacht, 2007). The first two types of toxicities were suggested to result from a combination of several mechanisms, such as inhibition of phospholipases, interaction with phospholipids, as well as formation of free radicals (Forge and Schacht, 2000). Nephrotoxicity receives the most attention, perhaps because of easier documentation of reduced renal function, but it is usually reversible. Ototoxicity is usually irreversible and it is believed to result from aminoglycoside binding to phospholipids and from disrupting mitochondrial protein synthesis due to accumulation of drug in the inner ear (Hobbie et al., 2008a,b). Numerous studies suggested that the interference between aminoglycosides and some steps of calciummediated acetylcholine release at the level of presynaptic structures is the main cause of the neuromuscular blockage induced by aminoglycosides (Albiero et al., 1978).
3. Strategies Toward Development of Improved Antibiotics The problems of bacterial resistance and inherent toxicity of aminoglycosides have inspired continuous attempts for the development of improved aminoglycoside variants by using series of diverse approaches (Fig. 21.3). In general, these approaches can be divided into two different categories: (1) the ‘‘modifications of existing drugs’’ and (2) the design of ‘‘aminoglycosides mimetics.’’ The first category includes either the direct
Design strategies for aminoglycoside antibiotics improvement
Modifications of the existing drugs
Direct modifications
Glycosylation strategies
Aminoglycoside mimetics
Total-synthetic mimetics
Semisynthetic mimetics
Figure 21.3 Design strategies employed for development of improved aminoglycoside antibiotics.
444
Varvara Pokrovskaya et al.
modification of the intact aminoglycoside by attachment of various appendages at different locations, or glycosylation of the selected aminoglycoside scaffolds, usually the pseudodisaccharides-like neamine and paromamine, with various natural or unnatural sugars, or a combination of both. The second category considers the generation of aminoglycoside mimetics either by further minimization of the original aminoglycoside entity to one ring, usually rings I or II, to which different appendages are attached at different locations, or rational design of the completely new entities. Using these strategies, many semisynthetic analogs of natural aminoglycosides (Chittapragada et al., 2009; Li and Chang, 2006; Wang and Chang, 2007; Zhou et al., 2007) and aminoglycoside mimetics (Chittapragada et al., 2009; Hermann, 2007) have been reported during recent years. Some of these designs were found to be effective against aminoglycoside-resistant bacterial strains. Little progress, however, has been made toward the discovery of new aminoglycoside derivatives with diminished toxicity (Shitara et al., 1995), which indeed is one of the remaining and perhaps the most challenging task. In addition, the latest semisynthetic aminoglycoside introduced into human therapy was two decades ago (arbekacin, Fig. 21.1, a kanamycin B derivative used in Japan since 1990; Kondo and Hotta, 1999), while the resistance to all the currently available aminoglycosides is increasing in prevalence. Clearly, a novel aminoglycoside derivative(s) with reduced toxicity demonstrated efficiency against the current generation of resistant pathogens, and preferably with reduced potential for generating bacterial resistance should be an important addition for the treatment of infectious diseases. To address the need of such designs, the following sections summarize our recent efforts to develop new aminoglycoside antibiotics by using four different strategies (Fig. 21.4): (1) the designs which in addition to targeting rRNA also resist to aminoglycoside-modifying enzyme(s); (2) the designs that target both the toxigenic bacterium and its lethal toxin; (3) the designs which in addition to resisting to aminoglycoside-modifying enzyme(s) and targeting rRNA, also exhibit reduced toxicity; (4) the designs of hybrid antibiotics which in addition to resisting to existing aminoglycoside-modifying enzymes and targeting rRNA, also delay the development of new resistance.
3.1. Alteration of neomycin B at C500 position to prevent APH(30 ) resistance In the presence of APH(30 ) enzymes the majority of aminoglycoside drugs undergo phosphorylation at C30 -OH, but neomycin B (NeoB) undergoes phosphorylation at two distinct positions: C30 -OH and C500 -OH (Fig. 21.2). We hypothesized that by attaching an extra rigid sugar ring at C500 -OH of NeoB, in addition to blocking this position from initial phosphorylation may also inhibit the formation of a precise ternary complex
4⬘
NH2
NH2 O
O O O 3⬘H2N O HO HO
HN
HO HO H2N O O HO 5⬘⬘ O
Toxicity reduction
NH2 NH2 O
Overcoming APH(3⬘)
O OH
H2N
3⬘, 4⬘-Methylidene protected pseudotrisaccharide NH2
HO
OH NH2 O O OH
Overcoming APH(3⬘) resistance
NH2 NH2
HO
NH2 O NH2 O
O
OH
O
Neomycin B Delay in resistance development
H2N
NH2
OH
5′′ O HO O n(NH2) H 2N O OH HO
OH
B. anthracis inhibition
HO HO O H2N O
OH
Pseudopentasaccharides
OH O HO HO
NH2 NH2 O HO O HO H2N O O 5⬘⬘S HO S O O 5⬘⬘ O H 2N O NH2 H 2N OH OH O O OH H2N H2N OH O HO NeoB dimer H2N
F
NH2 NH2 OH
HO HO
O N
N X
HOOC N H2N
N N N
NH2 O H2N
NH2 OO
Y 5⬘⬘ O
OH NH2 O O OH
NH2
OH
OH
NeoB–Ciprofloxacin hybrids
Figure 21.4 Redesign of neomycin B (NeoB) for improved antibacterial performance by using four different strategies.
446
Varvara Pokrovskaya et al.
1, R = O
HO
11, R =
O
O
O OH
H2N
OH
O
O
HO HO
R 5''
HO
O
OH O
O
OH
OH
4, R = HO HO
NH2 O
H2N
NH2
O
OH
O
O NH2
O
MIC = 40 (kcat / Km) = 12
OH
OH
5, R =
R = OH; neomycin B
MIC = 40 (kcat / Km) = 3.0
O
OH
MIC = 128 (kcat / Km) = 9.7
NH2 O
O
HO H2N
NH2
OH
H2N
OH
3, R =
MIC = 512 (kcat / Km) = 13 9, R =
O
MIC = 40 (kcat / Km)=5.1
MIC = >512 (kcat / Km) = 8.3
H2N HO
O OH
S
O
OH
H2N HO
OH
MIC = 64 (kcat / Km) = 6.7 10, R =
2, R = O
NH2
OH H2N
OH HO HO
MIC = 64 (kcat / Km) = 28
NH2
H2N HO
O
O
OH 8, R =
HO
O
O
7, R = H2N
HO
OH
MIC = 64 (kcat / Km) = 5.4
6, R =
OH O NH2 OH
MIC = 128 (kcat / Km) = 12
O
NH2
HO HO
O
O
MIC = 32 (kcat / Km) = 2.5
NH2 MIC = 32 (kcat / Km) = 6.7
Figure 21.5 Comparative antibacterial activity against P. aeruinosa and specificity constants (kcat/Km values in 104 M 1s 1) with APH(30 )-IIIa enzyme of NeoB and its 500 -modified derivatives 1–11. Minimal inhibitory concentration (MIC) values are given in mg/mL.
required for the phosphorylation of the C30 -OH by APH(30 )s, while the affinity of the resulting derivative to the target rRNA would not change or even increase. Using this strategy, a series of branched derivatives of NeoB, compounds 1–11 (Fig. 21.5), were synthesized. All these compounds were assembled by employing the general synthetic approach shown in Scheme 21.1. Initially, the NeoB was converted into the common acceptors, to which various donors were attached, followed by a two-step deprotection to yield the target C500 -branched derivatives. All new structures keep the whole antibiotic constitution intact as a recognition element to the rRNA, while the extended sugar rings (ring V in structure 1–10, and rings V and VI in 11) of each structure was designed in a manner that incorporates the potential functionalities directed for the recognition of the phosphodiester bond of RNA. The designed structures (compounds 1–11) exhibited similar or better antibacterial activities to that of the parent NeoB against selected bacterial
447
Designer Aminoglycosides
NH2
N3 O
AcO AcO
N3 O HX O 5⬘⬘ O
Neomycin B
N3
n(NH2)
N3 OAc
O
Donor Coupling step
O Deprotection steps
OH
N3
O
OAc H2N
OAc X = O, S
Common NeoB acceptor
H2N X 5⬘⬘
n(NH2)
OAc N3 O
O
HO HO
LG
X = O, S
NH2 O
NH2
O
OH
O
NH2 O
O
OH
OH Pseudopentasaccharides
Scheme 21.1 General synthetic strategy for the assembly of C500 -derivatives of NeoB (LG ¼ leaving group).
strains, including pathogenic and resistant strains, and especially good activities were observed against Pseudomonas aeruginosa (Fridman et al., 2003; Hainrichson et al., 2005; Fig. 21.5). The specificity constant values (kcat/ Km) of 1–11 with APH(30 )-IIIa enzyme were lower than that of NeoB, implying that these derivatives are poorer substrates of the enzyme than the parent NeoB. Since the strains of P. aeruginosa harbor a chromosomal APH (30 )-IIb-encoding gene (Hainrichson et al., 2007), the observed superior activity of new derivatives to that of NeoB in this bacterium could be ascribed because their inferior substrate activity for the APH(30 )-IIb resistance enzyme.
3.2. Dual activity of C500 -modified neomycin B derivatives against Bacillus anthracis Anthrax is an infectious disease caused by toxigenic strains of the Grampositive bacterium B. anthracis. It has been well established that the anthrax toxins (protective antigen, PA, edema factor, EF, and lethal factor, LF) play a major role from the very beginning of infection to death of the host. Among them, LF is considered the dominant virulence factor of anthrax and therefore an intensive search for specific inhibitors of LF has been performed during the last decade (Forino et al., 2005; Shoop et al., 2005). Unlike this strategy, we anticipated that it would be highly beneficial if the developed material were bifunctional, with the ability to inactivate the released LF toxin and, in parallel, to function as an antibiotic. Indeed, in the earlier experiments, Wong and coworkers (Numa et al., 2005) tested a library of approximately 3000 compounds, over 60 of which were synthetic and commercial aminoglycosides, and have demonstrated that NeoB is the most potent inhibitor of LF with the apparent Ki value in the low nanomolar concentration range. To improve the inhibitory effect of NeoB derivatives and in parallel to address the need of such dual activity designs, in collaboration with Wong’s
448
Varvara Pokrovskaya et al.
laboratory, initially we tested the C500 -modified NeoB derivatives 1, 2, 4–11 (Fig. 21.5) as inhibitors of LF along with against B. anthracis (Sterne strain) (Fridman et al., 2005). Most of the compounds exhibited significant antibacterial activity against B. anthracis and displayed activity levels comparable to that of NeoB. At low ionic strength assay conditions, the compounds 5, 6, and 9 exhibited the Ki values in the range of 0.2–1.3 nM, indicating them as predominantly better inhibitors of LF than the NeoB (Ki ¼ 37 nM). However, an increase in the ionic strength from 0 to 150 mM KCl (best resembles the physiological ionic strength in many cell types) drastically shifted the measured Ki values of all the tested compounds by a factor of 1500–53,000 towards higher concentrations, indicating that the predominant interaction between LF protein and the aminoglycosides is electrostatic in origin. Since at these conditions several C500 -derivatives were only two- to fivefold better inhibitors than NeoB, we attempted to further increase this gap and developed the disulfide dimer than NeoB, compound 12 (Fig. 21.6). At both low and high salt concentrations (150 mM KCl), compound 12 showed 53-fold higher affinity to LF relative to that of NeoB, indicating that twice the number of charged groups in 12 is probably responsible for the increased affinity. Compound 12 also displayed significant antibacterial activity against B. anthracis. Thus, the design strategy employed in this particular study provided a new direction for the development of novel antibiotics that target both the toxigenic bacterium and its released lethal toxin. NH2 OH O HO
NH2
HO NH2 O
HO HO
H2N HO
O
O
O
H2N
NH2 NH2 OH
OH NH2 O OH O OH NeoB Ki = 37 nM Ki (150 mM KCl) = 59 mM
HO H2N H2N
O
O
HO HO H2N
O
5''
O
S NH2
O H2N
S
NH2 O O O O
5''
OH OH O H2N HO
12
O
NH2 NH2 OH
OH OH
H2N
Ki = 0.7 nM Ki (150 mM KCl) = 1.1 mM
Figure 21.6 Comparative apparent inhibition constants (Ki values) of NeoB and its disulfide dimer 12 against anthrax lethal factor (LF) toxin activity at low and high salt conditions.
449
Designer Aminoglycosides
3.3. 30 ,40 -Methylidene protected aminoglycosides: A strategy to reduce toxicity and overcome resistance enzymes It is highly noteworthy that, although a new synthetic variant may exhibit favorable antibacterial activity, high toxicity can prevent its clinical application. Therefore, the design of novel variants of aminoglycosides, which in addition to resisting to aminoglycoside-modifying enzymes and targeting rRNA, will also exhibit reduced toxicity is of high urgency. To address the need of such designs, a new pseudodisaccharide 13 with a 30 ,40 -protection was designed and its properties were evaluated in comparison to other two structurally related pseudodisaccharides, compounds 14 and 15 (Fig. 21.7; Chen et al., 2008). We anticipated that (1) the preservation of 30 ,40 -oxygens in 13 should keep the lower basicity of the 20 -NH2 group and subsequently the lower toxicity than those of the 30 ,40 -dideoxy analog 15; (2) the methylidene group should also protect 13 from the action of various APH(30 ) and ANT(40 ) resistance enzymes; (3) the 30 ,40 -methylidene protection is supposed to be substantially stable under both acid and base conditions usually used in carbohydrate chemistry, and should easily be constructed from the corresponding 30 ,40 -diol. The observed data in this study demonstrated a relationship between the basicity of the 20 -amine group and the estimated LD50 values in mice: the increase in the basicity of the 20 -amino functionality is associated with the acute toxicity increase of an aminoglycoside (Fig. 21.7), with 13 being least toxic. Similar results have been obtained by replacement of the 5-OH with 5-fluorine in kanamycin B and its several clinical derivatives (Shitara et al., 1995). The toxicities of the resulting fluoro analogs were significantly lower than the parent compounds and this phenomenon again was attributed to basicity reduction of the 3-NH2 group induced by the strongly electronwithdrawing 5-fluorine. Thus, significantly high acute toxicity of the clinical drugs such as tobramycin (30 -deoxy), gentamicin (30 ,40 -dideoxy), dibekacin (30 ,40 -dideoxy), and arbekacin (30 ,40 -dideoxy) could be ascribed to the increased basicity of 20 -NH2 group (ring I) in these drugs caused
O O
NH2 O NH2
O HO
NH2
NH2 OH
13 LD50 = 303 2'-N pKa = 6.0
HO HO <
NH2 O
NH2 O NH2 NH2 OH 14: Neamine LD50 = 161 2'-N pKa = 7.2
NH2
O HO
<
NH2
O HO
NH2
NH2
OH 15: Gentamine C1A LD50 = 104 2'-N pKa = 8.4
Figure 21.7 Correlation between basicity change of 20 -amine group (pKa values) and toxicity (estimated LD50 values (mg/kg) in mice) change in compounds 13, 14, and 15.
450
Bacterial strain B. subtilis ATCC 6633 E. coli ATCC 25922 P. aeruginosa ATCC 27853
Varvara Pokrovskaya et al.
Genta 16 C1A MIC (mg / ml) 12 6 96
48
12
24
P. aeruginosa 584 / 5
48
24
Acute toxicity, LD50 (mg/kg)
70
226
NH2
NH2
O
O O H2N O HO
NH2
NH2
O O
HO HN 16
OH
4⬘ O 3⬘ H2N O HO HO
NH2
NH2
O O HN OH
Gentamicin C1A
Figure 21.8 Comparative acute toxicity (in mice) and antibacterial activity data between gentamicin C1A (Genta C1A) and compound 16.
mainly because of the lack of 30 -hydroxyl or 30 ,40 -hydroxyl groups, respectively. Compounds 13–15 were also evaluated for their substrate/inhibitory activities against APH(30 )-IIb enzyme encoded in P. aeruginosa. As per design, while the compound 14 functioned as a substrate (Km ¼ 10.3 0.5 mM and kcat ¼ 1.7 0.1 s 1), the compounds 13 and 15 exhibited no substrate activity and demonstrated only poor inhibitory activities with the estimated apparent Ki values of 642 52 mM and 650 62 mM, respectively. Based on the data obtained with the model structures 13–15, the new pseudotrisaccharide 16 (also called NB45) was constructed, and its properties were evaluated in comparison with the structurally closer analog gentamicin C1A (Fig. 21.8; Chen et al., 2008). It was found that both compound 16 and gentamicin C1A display very similar spectrum of antibacterial activity against Gram-negative and Gram-positive bacteria, including resistant and pathogenic strains, and exhibit similar antitranslational activities on prokaryotic protein synthesis (IC50 values of 38 nM and 59 nM, respectively). Kinetic analysis of compound 16 with APH(30 )-IIb enzyme confirmed the lack of substrate activity and only poor inhibitory activity. Most importantly, compound 16 exhibited significantly lower acute toxicity in mice (LD50 ¼ 226 mg/kg) than gentamicin C1A (LD50 ¼ 70 mg/kg), indicating that the 30 ,40 -methylidene protection in 16 not just provokes its low toxicity and protects it from the deactivation by APH(30 ) enzymes, but it also does not perturb its interaction with the ribosomal target or its penetration through the bacterial membrane that could influence its antibacterial activity.
3.4. Neomycin B-based hybrid antibiotics: A strategy to delay resistance development A series of distinct examples in the previous sections highlight that particular drawback of aminoglycosides, such as bacterial resistance caused by individual type of enzymatic modification, toxicity, and combination of both, can be
451
Designer Aminoglycosides
managed/overcome by reasonably designed semisynthetic aminoglycosides. However, unfortunately, as it happened to the previously introduced semisynthetic aminoglycosides, such as amikacin, dibekacin, and arbekacin (Davis et al., 2010; Ishino et al., 2004), there is a high probability that some new resistance will also emerge soon after the introduction of new design to the clinic. Therefore, more advance redesign strategy capable of producing new derivatives, that are active against known and spreading resistance mechanisms, should be highly beneficial. One such strategy that has been pursued in recent years employs a combination of two different drugs in one molecule (Bremner et al., 2007). With this strategy, each drug moiety is designed to bind independently to two different biological targets and synchronously accumulate at both target sites. Such dual action drugs, or hybrid drugs, offer the possibility to overcome the current resistance and in addition to reduce the appearance of new resistant strains (Long and Marquess, 2009). The underlying hypothesis is that treatments that inhibit multiple targets in the bacterial cell might delay and decrease the pathogen’s ability to accumulate simultaneous mutations that affect the multiple targets. Several successful applications of hybrid drugs approach have been reported (Barbachyn, 2008; Bremner et al., 2007). To address the need of such designs, a series of 17 new hybrid structures (compounds 19a–q, Scheme 21.2) containing fluoroquinolone ciprofloxacin
NH2 O HO HO H2N O
F O N
N
SPACER 2
7
HOOC
N3
+
SPACER 1
N H2N
Ciprofloxacin azido derivatives 17a–i
SPACER 1
,
O
OH
Cu(I) MW, 40 s
O
N
N
SPACER 1
N N N
O , N H
,
NH2 O HO HO H2N O
F O
SPACER 2
7
HOOC
NH2 NH2
OH 5'' O NH OH 2 O OH O OH NeoB alkyne derivatives 18a–c
SPACER 2
–(CH2)n–, n = 2 – 6,
O
N H2N 19a–q NeoB-Cipro hybrid compounds
5H' OH NH2 O O OH
O
O
O N H
NH2 NH2 OH
OH
Scheme 21.2 General synthetic strategy for the synthesis of NeoB-Cipro hybrids (19a–q).
452
Varvara Pokrovskaya et al.
(Cipro) and aminoglycoside (NeoB) antibiotics linked via 1,2,3-triazole moiety were designed, synthesized, and their antibacterial activities were determined against both Gram-negative and Gram-positive bacteria, including resistant strains (Pokrovskaya et al., 2009). The spacers X and Y were selected to vary both the length and chemical nature of the linkage between the two pharmakophores Cipro and NeoB. The key coupling reaction between NeoB-alkyne derivatives (compounds 18a–c) and Cipro-azide derivatives (compounds 17a–i) was performed under microwave irradiation (40 s) in the presence of organic base (7% Et3N in water) and the Cu(I) catalyst to ensure the production of a single (anti)stereoisomer at the triazole moiety with almost quantitative yield. The majority of hybrids was significantly more potent than the parent NeoB, and overcome most prevalent types of resistance [including APH (30 )-Ia, APH(30 )-IIIa, and AAC(60 )/APH(200 ) enzymes] associated with aminoglycosides. For example, one of the leads, the hybrid 19i (Fig. 21.9), was 10-fold more potent than NeoB against several susceptible Escherichia coli strains, 128-fold more potent against E. coli AG100B and E. coli AG100A strains expressing APH(30 )-I aminoglycoside-resistant enzyme, and over 100-fold better against methicillin-resistant Staphylococcus aureus (MRSA; ATCC 43300). In addition, selected hybrids inhibited bacterial protein synthesis with the potencies similar to or better than that of NeoB, and were up to 32-fold more potent inhibitors than ciprofloxacin for the fluoroquinolone targets, DNA gyrase, and toposiomerase IV, indicating a balanced dual mode of action. While the approach of hybrid antibiotics shares many of the possible advantages of a coformulation combination, like a cocktail of two different
N N N
N N
N
HOOC
HO
F O 19i
H2N
Antibacterial activity MIC (mg/ml) E.coli E.coli E.coli R477-100 ATCC 25922 AG100B NeoB
24
48
384
19i
1.5
3
3
NH2 O HO HO H2N H O OO N O NH2 O
O OH
NH2 NH2 OH
OH
Dual mode of action on both targets E.coli MRSA AG100A ATCC 43300 96 0.75
384 3
IC50 (mM) DNA gyrase Cipro = 1.3 19i = 0.085
TopoIV Cipro = 10.8 19i = 0.55
Protein synthesis NeoB = 10.5 19i = 16.7
Figure 21.9 Structure of hybrid 19i and its biological evaluation data in comparison to NeoB and Cipro.
453
Designer Aminoglycosides
100
Resistance Resistance to B to A Drug
75
Drug
A
B A+B
50 25 0
Bacterial growth inhibition (%)
drugs, it is apparent that antagonistic/suppressive activity of the hybrid relative to the sum of its components appears to be a key element for the delay of resistance development. Indeed, recent studies on various physical combinations of antibiotics of different classes have demonstrated that, while synergistic combinations of antibiotics resulted in an increase in the selection of drug-resistant mutants, suppressive combinations greatly slowed the rate of accumulation of drug-resistant mutants (Chait et al., 2007; Palmer et al., 2010; Yeh et al., 2009). The possible explanation in the latter situation is that when the combination of two drugs (AþB) is less inhibitory to the bacterial growth than each drug A and B separately (suppressive combination, Fig. 21.10), it is not beneficial for the bacteria to develop resistance against either A or B because in each situation the resistant strain will face a more deleterious condition than in the case of AþB; the strain that acquires resistance to one drug (either against A or B) in the cocktail loses in competition with the sensitive strains because second drug is a stronger antibiotic alone than in combination. Consequently, a large delay in resistance development can occur. The observed low frequency of 19i-resistant mutations development in both Gram-negative (E. coli) and Gram-positive (B. subtilis) (Table 21.1), relative to that of each drug separately or their 1:1 mixture, is consistent to the above discussed observations with the cocktails (Fig. 21.10). To our knowledge, this study provided the first demonstration of the ability of hybrid aminoglycoside-based conjugate to delay the emergence of resistance development in both Gram-positive and Gram-negative bacteria. In sum, this class of aminoglycoside-based hybrids provides a promising new pharmacophore with an unusual dual mechanism of action, potent activity against aminoglycosides-resistant pathogens, and most importantly, reduced potential for generating bacterial resistance.
Figure 21.10 Bacterial growth inhibition by drugs A, B, and their suppressive combination AþB. Dashed arrows illustrate that each single-drug resistance steps are unfavorable.
454
Varvara Pokrovskaya et al.
Table 21.1 Comparative study on the emergence of resistance in E. coli and B. subtilis after 15 serial passages in the presence of Cipro, NeoB, Cipro þ NeoB mixture (1:1 molar ratio) and hybrid structure 19i MIC (mg/mL) B. subtilis ATCC 6633
a
E. coli ATCC 35218
Ratioa
15th Passage
1st Passage
Ratioa
15th Passage
1st Passage
Compound
37.5 7.6 8 1
0.75 0.38 6 3
0.02 0.05 0.75 3
75 20 4 1
0.75 0.2 48 3
0.01 0.01 12 3
Cipro Cipro þ NeoB NeoB 19i
The ratio was calculated by dividing the MIC after 15th passage to the initial MIC value.
4. Aminoglycosides as Readthrough Inducers for the Treatment of Genetic Diseases Compelling evidence is now available that certain aminoglycoside structures can induce mammalian ribosomes to readthrough premature stop codon mutations and generate full-length functional proteins. However, the major concern that arises with the potential use of aminoglycosides for ‘‘translational therapy’’ is their toxicity to the organism, preventing their repeated long-term administration required for the treatment of genetic diseases (Hainrichson et al., 2008). To make things even more complicated, (1) to date there is still no clear answer to the question why some aminoglycosides induce termination suppression while others do not, and (2) the identity of the stop codon and the sequence context surrounding it influence the readthrough activity differently among the various aminoglycosides that do have this activity (Howard et al., 2000; Manuvakhova et al., 2000). Despite its high toxicity, the clinical drug gentamicin was/is frequently used for proof-of-concept experiments in various disease models and in clinical trials, and no systematic study has been performed to tune aminoglycosides structures for better readthrough activity and lower toxicity. In addition, while the recent X-ray crystal structures of the bacterial ribosome in complex with aminoglycosides shed light on the mechanism of aminoglycosides action as antibiotics (Carter et al., 2000; Selmer et al., 2006), no crystal structure of human ribosome is presently available and the mechanism of aminoglycoside-induced readthrough is still obscure (Hainrichson et al., 2008; Kondo et al., 2007). Clearly, the challenges in
455
Designer Aminoglycosides
6'
OH O
HO HO H2N
O HO
Paromamine
6'
OH
HO HO H2N H2N 5''
HO
O O 5 O
NH2 OH
H2N
O O 5 O
H2N
OH
20 (NB30) • • • • •
O
HO HO
NH2
In vitro (CF, USH, DMD, HS) Cell culture (CF, USH, DMD, HS) Cell toxicity Acute toxicity (mice) Ototoxicity (cochlear explants)
1 NH2 5 6 OH
OH
6'
O
NH2
HO
NH2
OH
H 1 N
OH
O
AHB
NH2
OH
21 (NB54) • • • • •
In vitro (CF, USH, DMD, HS) Cell culture (CF, USH, DMD, HS) Cell toxicity Acute toxicity (mice) Ototoxicity (cochlear explants)
Me HO 6' O HO HO NH2 H2N O 1 NHR O H 2N 5 OH O
HO
OH
22 R = H (NB74) 23 R = AHB (NB84) • In vitro (CF, USH, DMD, HS) • Cell culture (CF, USH, DMD, HS) • Cell toxicity
Figure 21.11 Structures and list of the performed biological tests for the new developed lead compounds 20–23. Important structural elements for readthrough activity including 60 -OH, AHB, and (R)-60 -Me groups are highlighted.
this emerging field should be at the development of new design strategies to meet novel molecular designs with improved suppression activity and reduced toxicity. To address the need of such designs, recently we hypothesized that by separating the structural elements of aminoglycosides that induce readthrough from those that affect toxicity, we might reach potent derivatives with improved readthrough activity and reduced toxicity (Hainrichson et al., 2008; Nudelman et al., 2006, 2009). Using this strategy, we have systematically developed the lead compounds 20 (Nudelman et al., 2006), 21 (Nudelman et al., 2009), 22, and 24 (Nudelman et al., 2010; also named NB30, NB54, NB74, and NB84, respectively, Fig. 21.11), which are discussed in the following section.
4.1. Development of new variants of aminoglycosides with improved readthrough activity and reduced toxicity Following key factors/observations guided us for the development of new designs. First, earlier in vitro studies on suppression activity in mammalian system have shown that aminoglycosides with a 60 -OH group on ring I (such as G418 and paromomycin, Fig. 21.1) are generally more effective than those with an amine at the same position (Howard et al., 2004;
456
Varvara Pokrovskaya et al.
Manuvakhova et al., 2000). Therefore, as a key structural element for the ‘‘improvement’’ of readthrough activity of a new variant, we selected the presence of 60 -OH group on ring I (Fig. 21.11). Second, although the molecular basis for aminoglycosides-induced toxicity is still controversial, several lines of evidence point to the inhibition of mitochondrial protein synthesis machinery as the Achilles heel of aminoglycosides toxicity; (1) aminoglycosides were shown to inhibit translation and induce miscoding in chicken embryo mitochondria (Kurtz, 1974), and (2) by replacing a 34-nucleotide portion of bacterial 16S rRNA helix 44 with its mitochondrial homolog, it has been demonstrated that there is a correlation between the aminoglycoside-induced antitranslational activity and its demonstrated ototoxicity (Hobbie et al., 2008a,b). Therefore, as a key element/sign for the reduced toxicity of a new design, we selected the lack of its antibacterial activity; since the bacterial protein synthesis machinery is in many aspects very close to that of mitochondrial machinery, the reduced impact of a drug on bacterial ribosome is likely to be associated with its reduced action on mitoribosome and subsequently with its diminished toxicity. Using this strategy, initially, we have identified the pseudo-disaccharide paromamine as a minimal core structure (consists of only two rings I and II of the natural antibiotic paromomycin) exhibiting significant readthrough activity, and by attaching 5-amino ribose as a ring III have spotted compound 20 as the first lead structure (Nudelman et al., 2006). Compound 20 exhibited significantly reduced cell, cochlear, and acute toxicities in comparison to gentamicin and paromomycin (Nudelman et al., 2006, 2009), and promoted dose-dependent suppression of nonsense mutations of the PCDH15 gene, one of the underlying causes of type 1 Usher syndrome (USH1) (Rebibo-Sabbah et al., 2007). Compound 20 displayed no significant antibacterial activity and was about 10-fold poorer inhibitor of prokaryotic translation than paromomycin and gentamicin, in agreement with the toxicity results and with the design hypothesis. However, its binding affinity to the eukaryotic A-site model oligonucleotide (Kondo et al., 2007) along with its suppression potency was significantly lower relative to that of the parent drug paromomycin and gentamicin (Nudelman et al., 2006, 2009). In attempts to further improve the suppression efficiency and reduce the toxicity of 20, we ‘‘borrowed’’ the known pharmacophore, (S)-4-amino-2hydroxybutanoic acid (AHB) moiety from the butirosin/amikacin and by installing it on 20 have developed the compound 21 as a second-generation lead structure (Fig. 21.11; Nudelman et al., 2009). Compound 21 exhibited significantly reduced cell, cochlear, and acute toxicities, and has substantially higher stop codon readthrough potency in both in vitro and ex vivo studies than those of gentamicin and paromomycin (Nudelman et al., 2009). The superior in vitro readthrough efficiency of 21 to that of compound 20, gentamicin, and paromomycin was demonstrated in seven different
Designer Aminoglycosides
457
nonsense DNA-constructs underlying the genetic diseases CF, Duchenne muscular dystrophy (DMD), USH1, and Hurler syndrome (HS). Importantly, compound 21 (as well as compound 20) lacks significant antibacterial activity and exhibited substantially reduced prokaryotic antitranslational activity in comparison to gentamicin and paromomycin. In continuation to the systematic fine-tuning of the developed leads, most recently, we have discovered a new pharmacophore, (R)-60 -methyl group, which we ‘‘borrowed’’ from the natural aminoglycoside G418 (Fig. 21.1), and by installing it on 20 and 21 we spotted the third-generation lead structures 22 and 23, respectively (Fig. 21.11; Nudelman et al., 2010). Both leads (22 and 23) exhibited significantly reduced cell toxicity and superior readthrough efficiency than those of gentamicin. The evidence for the superior readthrough efficiency of 22 and 23 over that of gentamicin was demonstrated in vitro on six different DNA fragments derived from the mutant PCDH15, CFTR, Dystrophin, and IDUA genes carrying nonsense mutations and representing the underlying causes for the genetic diseases USH1, CF, DMD, and HS, respectively, and ex vivo in cultured cell lines on three different DNA fragments that model the genetic diseases USH1, CF, and HS. Furthermore, compound 23 also exhibited several-fold higher suppression activity than that of 21, while both (23 and 21) displayed similar cytotoxicity. Essentially, the same trend was also observed in comparative study between the compounds 22 and 20, suggesting that the installation of (R)-60 -methyl group on aminoglycoside structure to yield the (R)-60 -secondary alcohol on ring I, significantly increases suppression activity while has no significant influence on the cell toxicity of the resulted derivative. In summary of this part, the above-described results validate our design strategy that by separating the structural elements of aminoglycosides that induce readthrough from those that affect toxicity, we can reach potent derivatives with improved readthrough activity and reduced toxicity. Thus, although the strict consideration of ‘‘lack of antibacterial activity’’ as a key parameter for the initial sign of reduced toxicity potential is rather a ‘‘naive’’ parameter of the design, it could be used as a quick test for the initial selection of the hits. The accompanied in vitro protein translation inhibition tests, in both bacterial and eukaryotic cytoplasmic systems, by using luciferase reporter system can validate the antibacterial data. It will be highly informative to add to these tests also the mitochondrial protein translation inhibition test. However, unfortunately, an in vitro system for the quantitative assessment of mitochondrial protein translation inhibition, analogous to the bacterial and cytoplasmic systems, is not available to date, and the offered tests employing selective radiolabeling of the mitochondrial proteins (e.g., see McKee et al., 2006) is not easily accessible for the majority of chemists dealing with the design and synthesis. Nevertheless, the observed continued inability of the new designs, 20, 21, 22, and 23, to show significant antibacterial activity in conjunction with their decreased
458
Varvara Pokrovskaya et al.
prokaryotic ribosome specificity is striking and remain to be further investigated. Of greatest concern is whether these data are truly linked or not to the observed relatively reduced cell toxicity of 20, 21, 22, and 23. Clearly, further structural and biochemical studies are needed to understand this issue satisfactorily.
5. Concluding Remarks and Future Perspectives To date, the majority of strategies to redesign aminoglycosides for improved antibacterial performance have been driven by the goal of finding new designs active against resistant or recalcitrant bacterial pathogens, and relatively little effort has been put into attempts to redesign aminoglycoside structure to reduce toxic responses or to delay a potential for generating bacterial resistance. Selected examples detailed here within the antibiotic field of aminoglycosides highlight our recent attempts to address those issues. Aminoglycosides that target unique bacterial rRNA A-site with high selectivity and specificity in comparison to that of human cytoplasmic and mitochondrial A-sites should guide the rational for the development of new designs with strong antibacterial activity and low toxicity. The data on aminoglycoside hybrids holds significant promise and opens an additional avenue for future research towards novel designs with reduced potential for generating new bacterial resistance. As to the redesign of aminoglycosides for the treatment of genetic diseases, although the discovery of an ‘‘ideal readthrough inducer’’ is still a challenging task, the redesign strategy and the data detailed here illustrate that this may be an achievable goal. In this avenue of research, the human toxicity of aminoglycosides should be placed as a central problem. As a potential solution to this problem, the therapeutic window between the cytoplasmic and mitochondrial decoding sites can be exploited for the development of new designs; those structures exhibiting extensive specificity and selectivity for the cytoplasmic rRNA A-site can decrease the functional dosing ranges and subsequently decrease the anticipated toxicity, making them potential drugs for the treatments of human genetic disorders.
ACKNOWLEDGMENTS We thank the US–Israel Binational Science Foundation (grant no. 2006/301), the Israel Science Foundation founded by the Israel Academy of Sciences and Humanities (grant no. 515/07), and the Mitchel Fund (grant no. 2012386) for their generous support of our research work.
Designer Aminoglycosides
459
REFERENCES Albiero, L., Bamonte, F., Ongini, E., and Parravicini, L. (1978). Comparison of neuromuscular effects and acute toxicity of some aminoglycoside antibiotics. Arch. Int. Pharmacodyn. The´r. 233, 343–350. Arya, D. P. (ed.) (2007). Aminoglycoside Antibiotics: From Chemical Biology to Drug Discovery, Wiley, Hoboken, New Jersey. Barbachyn, M. R. (2008). Recent advances in the discovery of hybrid antibacterial agents. Annu. Rep. Med. Chem. 43, 281–290. Bottger, E. C., Springer, B., Prammananan, T., Kidan, Y., and Sander, P. (2001). Structural basis for selectivity and toxicity of ribosomal antibiotics. EMBO Rep. 2, 318–323. Bremner, J. B., Ambrus, J. I., and Samosorn, S. (2007). Dual action-based approaches to antibacterial agents. Curr. Med. Chem. 14, 1459–1477. Carter, A. P., Clemons, W. M., Brodersen, D. E., Morgan-Warren, R. J., Wimberly, B. T., and Ramakrishnan, V. (2000). Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature 407, 340–348. Chait, R., Craney, A., and Kishony, R. (2007). Antibiotic interactions that select against resistance. Nature 446, 668–671. Chen, L., Hainrichson, M., Bourdetsky, D., Mor, A., Yaron, S., and Baasov, T. (2008). Structure-toxicity relationship of aminoglycosides: Correlation of 20 -amine basicity with acute toxicity in pseudo-disaccharide scaffolds. Bioorg. Med. Chem. 16, 8940–8951. Chittapragada, M., Roberts, S., and Ham, Y. W. (2009). Aminoglycosides: Molecular insights on the recognition of RNA and aminoglycoside mimics. Perspect. Med. Chem. 3, 21–37. Davis, M. A., Baker, K. N., Orfe, L. H., Shah, D., Besser, T. E., and Call, D. R. (2010). Discovery of a gene conferring multiple aminoglycoside resistance in Escherichia coli. Antimicrob. Agents Chemother. 54(6), 2666–2669. Eustice, D. C., and Wilhelm, J. M. (1984). Fidelity of the eukaryotic codon-anticodon interaction: Interference by aminoglycoside antibiotics. Biochemistry 23, 1462–1467. Forge, A., and Schacht, J. (2000). Aminoglycoside antibiotics. Audiol. Neurootol. 5, 3–22. Forino, M., Johnson, S., Wong, T. Y., Rozanov, D. V., Savinov, A. Y., Li, W., Fattorusso, R., Becattini, B., Orry, A. J., Jung, D., Abagyan, R. A., Smith, J. W., et al. (2005). Efficient synthetic inhibitors of anthrax lethal factor. Proc. Natl. Acad. Sci. USA 102, 9499–9504. Fourmy, D., Yoshizawa, S., and Puglisi, J. D. (1998). Paromomycin binding induces a local conformational change in the A-site of 16 S rRNA. J. Mol. Biol. 277, 333–345. Francois, B., Russell, R. J., Murray, J. B., Aboul-ela, F., Masquida, B., Vicens, Q., and Westhof, E. (2005). Crystal structures of complexes between aminoglycosides and decoding A site oligonucleotides: Role of the number of rings and positive charges in the specific binding leading to miscoding. Nucleic Acids Res. 33, 5677–5690. Fridman, M., Belakhov, V., Yaron, S., and Baasov, T. (2003). A new class of branched aminoglycosides: Pseudo-pentasaccharide derivatives of neomycin B. Org. Lett. 5, 3575–3578. Fridman, M., Belakhov, V., Lee, L. V., Liang, F. S., Wong, C. H., and Baasov, T. (2005). Dual effect of synthetic aminoglycosides: Antibacterial activity against Bacillus anthracis and inhibition of anthrax lethal factor. Angew. Chem. Int. Ed. Engl. 44, 447–452. Guthrie, O. W. (2008). Aminoglycoside induced ototoxicity. Toxicology 249, 91–96. Hainrichson, M., Pokrovskaya, V., Shallom-Shezifi, D., Fridman, M., Belakhov, V., Shachar, D., Yaron, S., and Baasov, T. (2005). Branched aminoglycosides: Biochemical studies and antibacterial activity of neomycin B derivatives. Bioorg. Med. Chem. 13, 5797–5807.
460
Varvara Pokrovskaya et al.
Hainrichson, M., Yaniv, O., Cherniavsky, M., Nudelman, I., Shallom-Shezifi, D., Yaron, S., and Baasov, T. (2007). Overexpression and initial characterization of the chromosomal aminoglycoside 30 -O-phosphotransferase APH(30 )-IIb from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 51, 774–776. Hainrichson, M., Nudelman, I., and Baasov, T. (2008). Designer aminoglycosides: The race to develop improved antibiotics and compounds for the treatment of human genetic diseases. Org. Biomol. Chem. 6, 227–239. Hermann, T. (2007). Aminoglycoside antibiotics: Old drugs and new therapeutic approaches. Cell. Mol. Life Sci. 64, 1841–1852. Hobbie, S. N., Akshay, S., Kalapala, S. K., Bruell, C. M., Shcherbakov, D., and Bottger, E. C. (2008a). Genetic analysis of interactions with eukaryotic rRNA identify the mitoribosome as target in aminoglycoside ototoxicity. Proc. Natl. Acad. Sci. USA 105, 20888–20893. Hobbie, S. N., Bruell, C. M., Akshay, S., Kalapala, S. K., Shcherbakov, D., and Bottger, E. C. (2008b). Mitochondrial deafness alleles confer misreading of the genetic code. Proc. Natl. Acad. Sci. USA 105, 3244–3249. Howard, M. T., Shirts, B. H., Petros, L. M., Flanigan, K. M., Gesteland, R. F., and Atkins, J. F. (2000). Sequence specificity of aminoglycoside-induced stop condon readthrough: Potential implications for treatment of Duchenne muscular dystrophy. Ann. Neurol. 48, 164–169. Howard, M. T., Anderson, C. B., Fass, U., Khatri, S., Gesteland, R. F., Atkins, J. F., and Flanigan, K. M. (2004). Readthrough of dystrophin stop codon mutations induced by aminoglycosides. Ann. Neurol. 55, 422–426. Ishino, K., Ishikawa, J., Ikeda, Y., and Hotta, K. (2004). Characterization of a bifunctional aminoglycoside-modifying enzyme with novel substrate specificity and its gene from a clinical isolate of methicillin-resistant Staphylococcus aureus with high arbekacin resistance. J. Antibiot. 57, 679–686. Jana, S., and Deb, J. K. (2006). Molecular understanding of aminoglycoside action and resistance. Appl. Microbiol. Biotechnol. 70, 140–150. Kaul, M., Barbieri, C. M., and Pilch, D. S. (2006). Aminoglycoside-induced reduction in nucleotide mobility at the ribosomal RNA A-site as a potentially key determinant of antibacterial activity. J. Am. Chem. Soc. 128, 1261–1271. Kellermayer, R., Szigeti, R., Keeling, K. M., Bedekovics, T., and Bedwell, D. M. (2006). Aminoglycosides as potential pharmacogenetic agents in the treatment of Hailey-Hailey disease. J. Invest. Dermatol. 126, 229–231. Kondo, S., and Hotta, K. (1999). Semisynthetic aminoglycoside antibiotics: Development and enzymatic modifications. J. Infect. Chemother. 5, 1–9. Kondo, J., Hainrichson, M., Nudelman, I., Shallom-Shezifi, D., Barbieri, C. M., Pilch, D. S., Westhof, E., and Baasov, T. (2007). Differential selectivity of natural and synthetic aminoglycosides towards the eukaryotic and prokaryotic decoding A sites. Chembiochem 8, 1700–1709. Kurtz, D. I. (1974). Fidelity of protein synthesis with chicken embryo mitochondrial and cytoplasmic ribosomes. Biochemistry 13, 572–577. Li, J., and Chang, C. W. (2006). Recent developments in the synthesis of novel aminoglycoside antibiotics. Anti-infective Agents Med. Chem. 5, 255–271. Llewellyn, N. M., and Spencer, J. B. (2006). Biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics. Nat. Prod. Rep. 23, 864–874. Llewellyn, N. M., and Spencer, J. B. (2008). Chemoenzymatic acylation of aminoglycoside antibiotics. Chem. Commun. (32), 3786–3788. Long, D. D., and Marquess, D. G. (2009). Novel heterodimer antibiotics: A review of recent patent literature. Future Med. Chem. 1(6), 1037–1050.
Designer Aminoglycosides
461
Magnet, S., and Blanchard, J. S. (2005). Molecular insights into aminoglycoside action and resistance. Chem. Rev. 105, 477–498. Manuvakhova, M., Keeling, K., and Bedwell, D. M. (2000). Aminoglycoside antibiotics mediate context-dependent suppression of termination codons in a mammalian translation system. RNA 6, 1044–1055. McKee, E. E., Ferguson, M., Bentley, A. T., and Marks, T. A. (2006). Inhibition of mammalian mitochondrial protein synthesis by oxazolidinones. Antimicrob. Agents Chemother. 50, 2042–2049. Moazed, D., and Noller, H. F. (1987). Interaction of antibiotics with functional sites in 16S ribosomal RNA. Nature 327, 389–394. Nagai, J., and Takano, M. (2004). Molecular aspects of renal handling of aminoglycosides and strategies for preventing the nephrotoxicity. Drug Metab. Pharmacokinet. 19, 159–170. Nudelman, I., Rebibo-Sabbah, A., Shallom-Shezifi, D., Hainrichson, M., Stahl, I., BenYosef, T., and Baasov, T. (2006). Redesign of aminoglycosides for treatment of human genetic diseases caused by premature stop mutations. Bioorg. Med. Chem. Lett. 16, 6310–6315. Nudelman, I., Chen, L., Llewellyn, N. M., Sahraoui, E. H., Cherniavsky, M., Spencer, J. B., and Baasov, T. (2008). Combined chemical-enzymatic assembly of aminoglycoside derivatives with N-1-AHB side chain. Adv. Synth. Catal. 350, 1682–1688. Nudelman, I., Rebibo-Sabbah, A., Cherniavsky, M., Belakhov, V., Hainrichson, M., Chen, F., Schacht, J., Pilch, D. S., Ben-Yosef, T., and Baasov, T. (2009). Development of novel aminoglycoside (NB54) with reduced toxicity and enhanced suppression of disease-causing premature stop mutations. J. Med. Chem. 52, 2836–2845. Nudelman, I., Glikin, D., Smolkin, B., Hainrichson, M., Belakhov, V., and Baasov, T. (2010). Repairing faulty genes by aminoglycosides: Development of new derivatives of geneticin (G418) with enhanced suppression of diseases-causing nonsense mutations. Bioorg. Med. Chem. 18(11), 3735–3746. Numa, M. M., Lee, L. V., Hsu, C. C., Bower, K. E., and Wong, C. H. (2005). Identification of novel anthrax lethal factor inhibitors generated by combinatorial Pictet-Spengler reaction followed by screening in situ. Chembiochem 6, 1002–1006. Ogle, J. M., and Ramakrishnan, V. (2005). Structural insights into translational fidelity. Annu. Rev. Biochem. 74, 129–177. Palmer, A. C., Angelino, E., and Kishony, R. (2010). Chemical decay of an antibiotic inverts selection for resistance. Nat. Chem. Biol. 6, 105–107. Pokrovskaya, V., Belakhov, V., Hainrichson, M., Yaron, S., and Baasov, T. (2009). Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics. J. Med. Chem. 52, 2243–2254. Rebibo-Sabbah, A., Nudelman, I., Ahmed, Z. M., Baasov, T., and Ben-Yosef, T. (2007). In vitro and ex vivo suppression by aminoglycosides of PCDH15 nonsense mutations underlying type 1 Usher syndrome. Hum. Genet. 122, 373–381. Schatz, A., Bugie, E., and Waksman, S. A. (1944). Streptomycin, a substance exhibiting antibiotic activity against gram-positive and gram-negative bacteria. Proc. Soc. Exp. Biol. Med. 55, 66–69. Selmer, M., Dunham, C. M., Murphy, F. V., 4th, Weixlbaumer, A., Petry, S., Kelley, A. C., Weir, J. R., and Ramakrishnan, V. (2006). Structure of the 70S ribosome complexed with mRNA and tRNA. Science 313, 1935–1942. Shitara, T., Umemura, E., Tsuchiya, T., and Matsuno, T. (1995). Synthesis of 5-deoxy-5epifluoro derivatives of arbekacin, amikacin, and 1-N-[(S)-4-amino-2-hydroxybutanoyl] tobramycin (study on structure-toxicity relationships). Carbohydr. Res. 276, 75–89. Shoop, W. L., Xiong, Y., Wiltsie, J., Woods, A., Guo, J., Pivnichny, J. V., Felcetto, T., Michael, B. F., Bansal, A., Cummings, R. T., Cunningham, B. R., Friedlander, A. M., et al. (2005). Anthrax lethal factor inhibition. Proc. Natl. Acad. Sci. USA 102, 7958–7963.
462
Varvara Pokrovskaya et al.
Silva, J. G., and Carvalho, I. (2007). New insights into aminoglycoside antibiotics and derivatives. Curr. Med. Chem. 14, 1101–1119. Sundar, S., and Chakravarty, J. (2008). Paromomycin in the treatment of leishmaniasis. Expet. Opin. Investig. Drugs 17, 787–794. Talaska, A. E., and Schacht, J. (2007). Adverse effects of aminoglycoside therapy. In ‘‘Aminoglycoside antibiotics: from chemical biology to drug discovery,’’ (D. P. Arya, ed.), pp. 255–266. Wiley, Hoboken, New Jersey. Umezawa, H., and Hooper, I. R. (eds.), (1982). Aminoglycoside Antibiotics, Springer, New York, Heidelberg. Vakulenko, S. B., and Mobashery, S. (2003). Versatility of aminoglycosides and prospects for their future. Clin. Microbiol. Rev. 16, 430–450. Vicens, Q., and Westhof, E. (2003). Molecular recognition of aminoglycoside antibiotics by ribosomal RNA and resistance enzymes: An analysis of x-ray crystal structures. Biopolymers 70, 42–57. Wang, J., and Chang, C. W. T. (2007). Design, chemical synthesis, and antibacterial activity of kanamycin and neomycin class aminoglycoside antibiotics. In ‘‘Aminoglycoside Antibiotics: From Chemical Biology to Drug Discovery,’’ (D. P. Arya, ed.), 2nd edn. pp. 141–180. Wiley, Hoboken, New Jersey. Wright, G. D. (2008). Mechanisms of aminoglycoside antibiotic resistance. In ‘‘Bacterial Resistance to Antimicrobials,’’ (K. Lewis, A. A. Salyers, H. W. Taber, and R. G. Wax, eds.), 2nd edn. pp. 71–101. CRC press, Taylor & Francis group, Boca Raton, FL. Yeh, P. J., Hegreness, M. J., Aiden, A. P., and Kishony, R. (2009). Drug interactions and the evolution of antibiotic resistance. Nat. Rev. 7, 460–466. Zhang, W. L., Fisher, J. F., and Mobashery, S. (2009). The bifunctional enzymes of antibiotic resistance. Curr. Opin. Microbiol. 12, 505–511. Zhou, J., Wang, G., Zhang, L. H., and Ye, X. S. (2007). Modifications of aminoglycoside antibiotics targeting RNA. Med. Res. Rev. 27, 279–316. Zingman, L. V., Park, S., Olson, T. M., Alekseev, A. E., and Terzic, A. (2007). Aminoglycosideinduced translational read-through in disease: Overcoming nonsense mutations by pharmacogenetic therapy. Clin. Pharmacol. Ther. 81, 99–103.
C H A P T E R
T W E N T Y- T W O
Solid Phase Synthesis of Oligosaccharides Markus Weishaupt,*,† Steffen Eller,*,† and Peter H. Seeberger*,† Contents 1. Introduction 2. Solid Phase Techniques and Strategies 3. Solid Phase Synthesis of Carbohydrates 4. Automated Solid Phase Synthesis of Carbohydrates 5. Conclusions and Outlook 6. Experimental Data for the Synthesis of Protected Globo-H 47 Acknowledgments References
464 465 468 472 476 479 481 481
Abstract Oligosaccharides are involved in many fundamental biological processes. However, relatively little is known about the precise molecular mechanism of action of these macromolecules, because the complexity of these structures impeded their synthesis by chemical methods analogous to those employed to create oligonucleotides and peptides. Herein, we describe recently developed techniques for solid-supported oligosaccharide synthesis. Several key aspects of solid phase synthesis are highlighted and examined, including the choice of resin and the challenge of real-time reaction monitoring. Recent examples of manual and automated solid-supported syntheses of complex oligosaccharides are given and the automated solid phase synthesis of the tumor-associated carbohydrate antigen Globo-H is highlighted.
* Department of Biomolecular Systems, Max Planck Institute of Colloids and Interfaces, Research Campus Potsdam-Golm, Potsdam, Germany Department of Biology, Chemistry and Pharmacy, Institute of Chemistry and Biochemistry, Free University Berlin, Berlin, Germany
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78022-8
#
2010 Elsevier Inc. All rights reserved.
463
464
Markus Weishaupt et al.
1. Introduction Oligosaccharides are an important class of biomolecules, and are involved in many biochemical processes (Apweiler et al., 1999; Paulson, 1989, Varki et al., 1999). In higher organisms, certain proteins are posttranslationally modified by linking various oligosaccharides to amino acid side chains to form glycoproteins. N-Glycans are linked to the side chain of asparagine via an N-glycosidic linkage, and are present in 90% of all glycoproteins. O-Glycans, on the other hand, are attached to the side chains of threonine or serine. Glycosylation can influence the physicochemical properties of a protein, such as folding, solubility, charge, and half-life. Central to the diverse biological functions of these macromolecules is the role played by oligosaccharides in protein–protein recognition, and in mediating cell–cell communication. Carbohydrates also modify proteins to form proteoglycans, another class of biologically important macromolecules. Proteoglycans are found in the extracellular matrix. These structures consist of a protein core connected to multiple linear sugar chains, known as glycosaminoglycans (GAGs). Well-known examples of GAGs are keratan sulfate, chondroitin sulfate, or heparan sulfate that interact with various enzymes, growth factors, morphogens, cytokines, and cell adhesion molecules and thus play a central role in cell signaling (Capila and Linhardt, 2002; Noti and Seeberger, 2005; Raman et al., 2005). Cell-surface glycolipids participate in cell–cell communication. Glycosylphosphatidylinositol (GPI) anchors, however, are connected to the C-terminus of a peptide chain and serve to attach proteins to the cell surface. These glycolipids are characterized by a conserved 6-O(ethanolaminePO4)-Man-a(1,2)-Man-a(1,6)-Man-a(1,4)-GlcNH2-a(1-6)-myo-inositol1-PO4 core structure and can be found in eukaryotic cells and protozoan parasites (Gowda and Davidson, 1999). GPI anchors play a role in Plasmodium falciparum infections that cause malaria. Despite the importance of these complex carbohydrates, their function is poorly understood. This is in part due to the difficulty of obtaining pure oligosaccharides or glycoproteins from natural sources for biological studies. Cultivating eukaryotic cells for oligosaccharide isolation is tedious, expensive, and generally low-yielding. Often many glycoforms of one glycoprotein (microheterogeneity) are difficult to separate. To obtain sufficient amounts of pure oligosaccharides for biological evaluation, chemical synthesis is often the only option. However, classical solution phase synthesis of oligosaccharides is a time-consuming task and typically requires a different synthetic strategy for each molecule. This synthetic challenge is owed to the fact that, unlike oligonucleotides or peptides that form linear chains, the monomers within one oligosaccharide chain can be linked in many different ways. The anomeric center of one sugar can be linked with one of up to four
Solid Phase Synthesis of Oligosaccharides
465
different hydroxyl groups from another sugar molecule to form a glycosidic linkage. Each new glycosidic linkage represents a new stereocenter that has to be controlled. Formation of the desired anomeric configuration can be influenced by the nature of the leaving group and the C2 protecting group of the glycosylating agent. To distinguish between the different nucleophiles present on the acceptor, orthogonal protecting groups are used. Methods to quickly access diverse, orthogonally protected building blocks are needed. To accelerate time-consuming conventional solution phase oligosaccharide synthesis, solid phase approaches have been developed.
2. Solid Phase Techniques and Strategies Solid phase synthesis was first established for oligopeptides and provided the basis for automated peptide synthesis (Merrifield, 1985). Solid phase synthesis was later extended to the synthesis of oligonucleotides (Caruthers, 1985; Matteucci and Caruthers, 1981). Oligosaccharide assembly relies on the union of glycosylating agents (donors) with nucleophiles (acceptors; Scheme 22.1). Usually, orthogonal permanent and temporary protecting groups are used to facilitate the elongation of oligosaccharides at specific hydroxyl groups. By using different orthogonal temporary protecting groups on one building block, it is possible to create branched oligosaccharides. After each glycosylation, a temporary protecting group is removed to unveil a new nucleophile. The glycosylation–deprotection cycle is repeated until the final compound is synthesized. Typically, each reaction step requires product isolation, purification, and characterization. New methods for the rapid synthesis of oligosaccharides have been developed. One-pot glycosylations circumvent tedious isolation and purification steps (Fraser-Reid et al., 1992; Geurtsen et al., 1997; Green et al., 1998; Grice et al., 1997; Ley and Priepke, 1994; Raghavan and Kahne, 1993; Yamada et al., 1994; Yu et al., 2005; Zhang et al., 1999). The inherent necessity to fine-tune the reactivity of each oligosaccharide building block poses high demands on their design and synthesis. Solid-supported oligosaccharide synthesis quickly and easily generates complex oligosaccharides. This method requires all reactions to be performed on a solid support (resin) that is functionalized with an appropriate linker (Scheme 22.1). This linker must be chemically inert during oligosaccharide synthesis, but is readily cleaved from the resin at the end of the reaction sequence. Ideally, the linker should have an additional function, and be used to directly immobilize the synthesized carbohydrates to a glycoarray chip (Feizi et al., 2003; Love and Seeberger, 2002; Mammen et al., 1998; Shin et al., 2005), or to macromolecules for the synthesis of glycoconjugates (Hecht et al., 2009).
466
Markus Weishaupt et al.
Conventional solution phase synthesis: tPG1
pPG O
pPG O
LG
HO
tPG2 Donor building block
Solid phase synthesis:
pPG
pPG O HO
tPG1
O tPG2
pPG
pPG O O
tPG2
1
pPG O
tPG
tPG1
1. Cleavage 2. Deprotection 3. Purification OH
1. Glycosylation 2. Product isolation 3. Purification
tPG1
O tPG2
O tPG2
tPG2
OH
O
O
O
O
O
R
OH
OH OH
OH OH O
pPG O
O
O
OH
OH
OH O
HO
HO pPG O
O
pPG
tPG2 pPG O
pPG O tPG2
tPG2
LG
Glycosylation
Deprotection
1. Deprotection 2. Product isolation 3. Purification pPG O
O
tPG2
tPG2
HO
LG
Linker + solid support Donor building blocks
1. Glycosylation 2. Product isolation 3. Purification pPG O
pPG O tPG2
tPG2 Acceptor building block
pPG O
tPG1
HO
O O
O
OH
pPG LG tPG pPG R
= leaving group = temporary protecting group = permanent protecting group = functional group for immobilization on glycoarrays or for synthesis of glycoconjugates
Scheme 22.1 Conventional solution phase oligosaccharide synthesis versus solid phase oligosaccharide synthesis.
Solid phase synthesis starts with the coupling of the first building block to the linker, followed by removal of a temporary protecting group. After this event, the next glycosylation reaction can occur. Reagents and building blocks are used in excess to drive reactions to completion and to avoid partial or incomplete sequences. After each reaction, the reagents and the remaining building blocks are easily removed by washing. Orthogonal temporary protecting groups also facilitate the synthesis of branched oligosaccharides. The cycle is repeated to obtain the desired protected oligosaccharide structures which are then cleaved from the resin and globally deprotected. In this way, the number of purification steps is dramatically decreased in comparison to conventional solution phase synthesis. In principle, different strategies can be employed for the elongation of oligosaccharide chains on solid support (Scheme 22.2). There are two basic approaches to solid phase oligosaccharide synthesis, which are distinguished by the activation state of the molecule bound to the solid support. For the donorbound strategy, the building block attached to the resin carries a leaving group, which can be activated for a glycosylation reaction with an acceptor in solution (Danishefsky and Bilodeau, 1996; Guthrie et al., 1971, 1973). The nucleophile
467
Solid Phase Synthesis of Oligosaccharides
Acceptor bound to solid support: O PG
LG
O HO
O
Donor bound to solid support: O O PG
LG O HO
R
Mixture of both strategies:
O PG
2. Deprotection 3. Glycosylation O O LG PG
LG O HO
PG
1. Glycosylation LG = leaving group PG = protecting group R = temporary PG or orthogonal LG
Scheme 22.2
Different strategies for solid phase oligosaccharide synthesis.
is equipped with an orthogonal anomeric leaving group or with a temporary anomeric protecting group that can be exchanged for a leaving group. Disadvantages to this strategy are that decomposition of the resin-bound glycosylating agent leads to lower yields, and that the glycosylating agent cannot be used in excess since it is bound to the resin. In contrast, the acceptor-bound method is more advantageous. Here, the resin carries the molecule with a free hydroxyl group, which is glycosylated by dissolved building blocks. Excess glycosylating agent helps to complete glycosylation of the resinbound acceptor. Both strategies may be combined as well. The solid support plays a crucial role for the success of solid phase oligosaccharide synthesis, and new polymers are continually being developed. For the use in carbohydrate chemistry, resins have to meet a number of requirements. The solid support must withstand mechanical strain, acids, and bases, swell sufficiently in various solvents, and allow for good diffusion of deprotecting and activating agents. For the application of enzymes to oligosaccharide synthesis, the solid support also has to allow
468
Markus Weishaupt et al.
these large biocatalysts access to the reactive sites. A hybrid method between solution and solid phase synthesis of oligosaccharides involves the use of soluble supports (Guthrie et al., 1973). Here, the reactions are performed in solution, and the support is precipitated between reaction steps to wash out excess reagents and building blocks. A modification of this method is the use of fluorous supports (Goto et al., 2004), where the glycosylations are also performed in solution. The growing oligosaccharide is connected to a fluorous support such as hexakisfluorous butanoyl (Hfb). Excess reagents are removed after each reaction by washing the fluorous material with organic solvents. Solid phase synthesis limits the choice of solvents to those that swell the resin. Porous carrier resins such as controlled-pore glass (CPG; Adinolfi et al., 1998; Heckel et al., 1998) or Synbeads (Basso et al., 2004) do not require swelling as large internal surfaces allow for diffusion. The most commonly used solid support is Merrifield resin, which is a pure polystyrene (PS) polymer, cross-linked with 1–2% of divinylbenzene. Due to its low cost, high-loading properties, and chemical inertness, it is often used for solid phase synthesis of oligosaccharides. JandaJel (Toy and Janda, 1999) is a PS-based resin with a polytetrahydrofuran (PTHF) crosslinker. PS resins have good swelling properties in organic solvents such as benzene, dichloromethane, dioxane, THF, and DMF. Another class of solid supports are the polyethylene glycol–polystyrene (PEG–PS) resins (Kates et al., 1998) that have good swelling properties in conventional solvents such as DMF, THF, dichloromethane, methanol, and water. A polymer widely used as solid support is PEG (Miranda et al., 2002; Garcı´a-Martı´n et al., 2006). PEG resins swell in organic solvents as well as in aqueous solutions, and thus allow a wide range of possible reaction conditions. Additionally, PEGA resins (Meldal, 1992), which are PEG polymers cross-linked with acrylamide, have good swelling properties in aqueous buffers. They were developed and successfully used for enzymatic glycosylation. Compared to Merrifield resin (Merrifield, 1985), this solid support has the disadvantage that PEG acts as a Lewis base and thus might negatively influence some reactions. In summary, the many resins available enable a large variety of reactions to be conducted on solid support, but necessitate choosing the most appropriate solid support when performing oligosaccharide synthesis.
3. Solid Phase Synthesis of Carbohydrates In 2002, a solid-supported synthesis of the blood cell antigen sialyl LewisX 5 on TentaGel was reported (Kanemitsu et al., 2002). This approach applied the safety catch linker method, and thioglycosides 2–4 were used as
469
Solid Phase Synthesis of Oligosaccharides
Donor building blocks:
OBn O
AcO O H3C
O
OBn BnO
BnO BnO O
SPh AcO NPht
OAc SMe OAc CO2Me O AcHN AcO
AcO SPh
BnO
OBn
3
4
2
Solid phase synthesis:
HO
O O N H
O S H N 1
O
O
N H TentaGel
1. 2, a 2. b 3. c 4. 3, d 5. b 6. c 7. 4, d 8. e
BnO OBn HO2C BnO O OH O O O O O O AcHN BnO NPht HO O H3C OBn OBn BnO 5
HO
OH
O OH
Scheme 22.3 Solid phase synthesis of the protected sialyl LewisX molecule 5. Reactions and conditions: (a) 2 equiv donor, 8 equiv DMTST, CH2Cl2, 24 h, 30 C, ˚ (two times); (b) TBSCl, imidazole, CH2Cl2, 24 h; (c) NaOMe, molecular sieves 3 A MeOH, DMF, 24 h; (d) 2 equiv donor, 8 equiv DMTST, CH3CN, 12 h, 0 C, ˚ (two times); (e) 1. TMS-diazomethane, CH2Cl2, 12 h; 2. molecular sieves 3 A NaOH, 24 h.
building blocks (Scheme 22.3). Building blocks 2–4 were activated by DMTST and coupled to hydroxyl groups that were temporarily protected as acetate esters. To overcome the problem of reaction monitoring often associated with solid phase chemistry, the authors used 13C-labels for the inverse gated decoupling method 13C-NMR (Kanemitsu et al., 1998). As an internal standard, 13C-tagged glycine was incorporated into the linker. To quantitate the coupling efficiency, 13C-tagged temporary acetyl
470
Markus Weishaupt et al.
protecting groups were used in building blocks 2 and 3 and 13C-labeled methyl ester for building block 4. The 13C-NMR intensities of those protecting groups were compared to the intensity of the internal standard, allowing for calculation of coupling yields on the solid support. Solid-supported chemistry usually precludes real-time monitoring of reactions like thin layer chromatography or mass spectrometry. Therefore, 13C-tagging is a convenient method for monitoring reactions on solid support. In addition to this method, other approaches like high-resolution magic angle spinning NMR (Seeberger et al., 1997), diffuse reflectance Fourier transform infrared (DRIFT; Debena et al., 1998), or Fourier transform infrared (FTIR) and Raman microspectrometry (Rahman et al., 1998) have been employed to monitor the progress of synthetic reactions. Additionally, it is possible to stain free hydroxyl groups on the solid support (Komba et al., 2007; Kuisle et al., 1999) using a method similar to Kaiser’s test (Kaiser et al., 1970) in solid phase peptide synthesis. One of the major advantages of solid phase oligosaccharide synthesis is the possibility to quickly construct libraries of oligosaccharides, as demonstrated by Schmidt and coworkers ( Jonke et al., 2006). Different substructures of N-glycans, including 11, were obtained on spacer-linked Merrifield resin 6 using trichloroacetimidates 7–10 (Scheme 22.4). For the introduction of the challenging b-mannosidic bond, disaccharide building block 8 was used and temporary protecting groups, O-fluorenylmethoxycarbonyl (Fmoc) and O-phenoxyacetyl (PA), were employed. The outcome of the glycosylation reactions appeared to depend on the type of protecting groups present on the building blocks. To protect the amino group on the glucosamine building blocks, the phthalimido group was used. However, the phthalimido glucosamine building blocks showed low acceptor reactivity for glycosylation reactions occurring at position 4. Interactions between the phenyl groups of the Merrifield resin and the planar aromatic phthalimido protecting groups of the resin-bound glucosamine may decrease the accessibility of the 4-hydroxyl group. To test this hypothesis, the glycosylation was carried out in solution in a mixture of dichloromethane and toluene mimicking the phenyl groups of the resin. Again, low acceptor reactivity of the phthalimido-protected glucosamine building blocks was observed. Replacing the planar phthalimido groups with nonaromatic dimethylmaleimido (DMM) protecting groups substantially increased the acceptor reactivity. Recently, a sialic acid-containing complex type N-glycan was obtained for the first time by solid-supported synthesis (Tanaka et al., 2009). Octasaccharide 17 was obtained on JandaJel using N-phenyltrifluoroacetimidates 13–16 and Fmoc as a temporary protecting group (Scheme 22.5). The b-mannoside was introduced through disaccharide 14. Building block 14 used an azidochlorobenzyl protecting group at position 3 as an orthogonal
471
Solid Phase Synthesis of Oligosaccharides
Donor building blocks: OBn O
FmocO BnO
O NDMM
CCl3
OFmoc NH OBn DMMN O BnO CCl3 O O O
BnO PAO
NH
OBn
7
8
BnO OFmoc O BnO BnO O 9
BnO
OAc O
AcO OAc
CCl3
O
CCl3 NH
10
NH O
Solid phase synthesis:
O HO
6
BnO AcO
OAc O
O BnO OAc
OBn O BnO BnO NDMM BnO BnO
OBn O O O OBn OAc O BnO O
Merrifield resin 1. 7, a 2. b 3. 8, a 4. b 5. 9, a 6. b 7. 7, a 8. b 9. 10, a 10. c 11. 9, a 12. d OBn
OBn O BnO O
NDMM O O BnO
O
OAc
O NDMM
OBn 11
Scheme 22.4 Solid phase synthesis of protected N-glycan heptasaccharide 11. Reactions and conditions: (a) 3 equiv donor, cat. TMSOTf, CH2Cl2, 30 min, different temperatures; (b) NEt3, CH2Cl2, 120 min; (c) 0.5 equiv NaOMe, MeOH, CH2Cl2, 20 min; (d) 1. 5 equiv NaOMe, MeOH, CH2Cl2, 60 min (three times); 2. Ac2O, pyridine (11: 22% over 13 steps).
protecting group for the installation of the a-1,3-arm at the end of the synthesis. The sialic acid was introduced in the a-1,6-arm using disaccharide 16. Glycosylations using 16 relied on nonafluorobutyl ethyl ether as solvent additive to increase the efficiency of the glycosylation. After cleavage from the resin and deprotection of the esters, the benzylated octamer was isolated after gel filtration and HPLC in 27% yield.
472
Markus Weishaupt et al.
Donor building blocks: OBn FmocO BnO
O
N3
O
CF3
TrocHN
13
AcO
O
Cl
PhN
OFmoc OBn TrocHN O BnO O O O PhN OBn
CF3
AcO BnO
15
14
O
Solid phase synthesis:
HO
OH O HO
OH
CO2H OH
OH AcHN
12
O HO
O OH
O HO
O HO HO NHAc
HO HO
O
OAc OAc O
AcHN
CF3
CO2Me OAc O BzO
AcO
PhN O
CF3
O
BzO
PhN
16
JandaJel
1. 13, a 2. b 3. 14, a 4. b 5. 15, a 6. b 7. 16, c 8. d 9. 15, c 10. e 11. f OH O O O OH OH O O
17
AcO
H N
O HO
OBn OFmoc O O
OH HO
OH O
HO O
NHAc O HO
O
O
OH NHAc
OH
Scheme 22.5 Solid phase synthesis of sialylated N-glycan octasaccharide 17. Reactions and conditions: (a) 2.5 equiv donor, 0.5 equiv TMSOTf, CH2Cl2, 60 min, ˚ ; (b) NEt3, CH2Cl2, 4 h; (c) 2.5 equiv donor, 0.5 equiv TMSOTf, molecular sieves 4 A ˚ ; (d) 1. PBu3, CH2Cl2, 60 min; 2. CH2Cl2, C4F9OEt, 60 min, molecular sieves 4 A DDQ, AcOH, H2O, THF, 120 min; (e) 1. NaOBn, BnOH, THF, 180 min; 2. NaOH, 12 h; (f) Pd(OH)2/C, H2, Ac2O, MeOH, 9 h.
4. Automated Solid Phase Synthesis of Carbohydrates An advantage of solid-supported oligosaccharide synthesis is the ability to automate washing, deprotection, and glycosylation steps to reduce labor. The most time-consuming part then becomes the synthesis of orthogonally protected building blocks for the automated synthesis of biologically relevant structures. However, bioinformatics studies showed that only 36 building blocks are necessary to synthesize about 75% of the mammalian glycome (Werz et al., 2007b). Those building blocks can be obtained from cheap monosaccharide starting materials, while rare bacterial sugars can be produced from cheap linear precursors by de novo synthesis (Adibekian et al., 2008; Gillingham et al., 2010; Pragani et al., 2010; Stallforth et al., 2008; Timmer et al., 2005). Another promising approach for building block synthesis is the introduction of protecting groups on solid support (Branderhorst et al., 2007). The first automated synthesis was reported in 2001 (Plante et al., 2001) and performed on a modified ABI 431A peptide synthesizer with a custommade double-jacketed glass reaction vessel, which enabled control of the
Solid Phase Synthesis of Oligosaccharides
473
reaction temperature by circulation of a cryogenic fluid. The temperature was adjusted manually. The synthesizer delivered solvents and reagents via electromagnetic valves (solenoid valves; all wetted parts made from PTFE) by applying argon pressure. Every storage vessel was connected to an input for argon pressure and an outlet leading to the reaction vessel, and each was controlled by a solenoid valve. The first valve was opened to apply pressure to the storage vessel. When argon pressure build-up was completed, the second valve was opened, allowing for the reactants to be delivered to the reaction vessel. The resin and the solutions in the reaction vessel were mixed by vortexing. Washing solvents and reaction mixtures were removed from the vessel by pressure via the opening of a solenoid valve and subsequent opening of another solenoid valve at the reaction vessel outlet. A shuttle valve connected to the outlet of the reaction vessel enabled either the disposal or the manual collection of the reagent mixtures. The synthesizer was controlled by computer and corresponding software. The different operations were divided into separate modules that can be arranged into a synthesis pattern to prepare the target oligosaccharides. With this synthesizer, the dodecameric phytoalexin elicitor b-glucan 21 was constructed from phosphate building blocks 19 and 20 and was cleaved from the resin by olefin cross metathesis (Scheme 22.6; Plante et al., 2001). In its native form, this carbohydrate triggers the release of antibiotic phytoalexins in soybean plants as a defense mechanism against fungi. Glycosylphosphatidyinositol glycan 28 that is currently in preclinical evaluation as an antimalaria toxin vaccine candidate was synthesized in a semiautomated manner (Scheme 22.7; Hewitt et al., 2002). Malaria claims more than two million lives each year in developing countries (Schofield et al., 1993) and infects currently 5% of the world’s population. The tetrasaccharide substructure of the vaccine candidate was synthesized in an automated fashion and coupled to pseudodisaccharide 26. After deprotection and modification, pseudohexasaccharide 28 was conjugated to a carrier protein in order to investigate the antigenic potential of the vaccine candidate. The core pentasaccharide of N-linked glycans was obtained by automated synthesis (Ratner et al., 2003) using trichloroacetimidate building blocks 29–31 on an octenediol linker coupled to Merrifield resin (Scheme 22.8). The challenging b-mannosidic linkage was introduced in solution leading to disaccharide building block 30. Recently, the formation of the b-mannosidic linkage was also demonstrated using automated solid phase technology (Code´e et al., 2008). Mannose 31 bore an acetate protecting group on position 2 to allow for the elongation of pentasaccharide 32 for the synthesis of biantennary N-glycans of the complex type. The automated synthesizer has been used to provide protected tumorassociated antigen and blood group determinant oligosaccharides 39–41 (Scheme 22.9; Love and Seeberger, 2004). The octenediol linker was coupled via an ester linkage to Merrifield resin and precluded use of
474
Markus Weishaupt et al.
Donor building blocks: OLev BnO BnO
OLev
OBn O OP(OBu)2
O PivO
BnO BnO
O
O BnO O BnO
PivO
O OP(OBu)2
20
19
Automated solid phase synthesis: HO O Merrifield 18 resin
OLev
OBn BnO BnO
O
O BnO O BnO
PivO BnO BnO BnO
BnO BnO
O
O
O O
O
PivO BnO
O
PivO BnO BnO BnO
BnO
BnO BnO
O BnO
O
O O
1. 19, a 2. b 3. 20, a 4. b 5. 19, a 6. b 7. 20, a 8. b 9. 19, a 10. b 11. 20, a 12. b 13. 19, a 14. b 15. 20, a 16. c O
PivO BnO
O
PivO BnO BnO BnO O
BnO BnO
BnO 21
O
O O PivO BnO
O O PivO BnO BnO
O O
O
PivO
Scheme 22.6 Automated solid phase synthesis of protected dodecameric phytoalexin elicitor 21. Reactions and conditions: (a) 5 equiv donor, 5 equiv TMSOTf, CH2Cl2, 15 min, 15 C (two times); (b) hydrazine, pyridine, AcOH, 15 min, 15 C (two times); (c) Grubbs’ catalyst (1st generation), ethylene, CH2Cl2, 36 h.
temporary acetyl protecting groups but was cleaved fast from the resin under Zemple´n conditions. Installation of the challenging branching patterns made an orthogonal temporary protecting group pattern on the building blocks necessary using levulinoyl (Lev) and O-fluorenylmethoxycarbonyl (Fmoc) protecting groups for central building block 36. The Lev ester was selectively cleaved by hydrazine in the presence of other ester protecting groups. The base-labile Fmoc group was removed by amines under mild conditions and
475
Solid Phase Synthesis of Oligosaccharides
Building blocks:
BnO BnO
OAc OBn O
BnO BnO
O 22
CCl3
OBn OAc O O
23
NH
BnO BnO CCl3 NH
OTIPS OAc O
OBn HO BnO
O N3 OO
BnO BnO
O 24
N
OBn OBn O
CCl3
25
NH
HN
CCl3
NHCbz
O P
CN
O
O OBn
OBn OBn
27
26 OH OH O
Semiautomated solid phase synthesis: 1. 22, a 2. b 3. 23, a 4. b 5. 24, a 6. b 7. 25, a 8. c 9. d 10. e 11. 26, f 12. g 13. h 14. 27, i 15. j
HO O Merrifield resin
H3N
HO O HO O P O O HO HO
O O
HO HO
HO O O
HO HO
O OH O O HO
OH O H3N
18 28
O OH
OH OH
OO O
P O
Scheme 22.7 Semiautomated solid phase synthesis of malarial glycosylphosphatidylinositol glycan 28. Reactions and conditions: (a) 5 equiv donor, 0.5 equiv TMSOTf, CH2Cl2, 20 min (two times); (b) NaOMe, MeOH, CH2Cl2, 30 min (two times); (c) Grubbs’ catalyst (1st generation), ethylene, CH2Cl2, 36 h; (d) NBS, CH3CN, H2O (67%); (e) Cl3CCN, DBU, CH2Cl2 (75%); (f) 0.1 equiv TMSOTf, CH2Cl2, molecular ˚ (32%); (g) 1. HCl, MeOH; 2. TBSCl, imidazole, CH2Cl2 (84% over two sieves 4 A steps); (h) 1. Cl2P(O)OMe, pyridine, HCl; 2. TBAF, THF (70% over two steps); (i) 1. 27, 1H-tetrazole, CH3CN, CH2Cl2; 2. tBuOOH, CH3CN, CH2Cl2 (84% over two steps); (j) 1. DBU, CH2Cl2; 2. Na, NH3, 78 C (75% over two steps).
the resulting dibenzofulvene was used to assess the efficiency of the glycosylation step due to its distinct UV absorption profile. This example proved that branched oligosaccharide structures could be assembled by the use of monosaccharide donor building blocks by automated solid phase synthesis. Protected tumor-associated carbohydrate antigen 47, containing a difficult a-galactosidic linkage, was prepared by solid phase synthesis (Werz et al., 2007a). For this synthesis, two different types of anomeric leaving groups were applied (Scheme 22.10) since the intermediate tetrasaccharide
476
Markus Weishaupt et al.
Donor building blocks: OBn O AcO BnO TCAHN O 29
BnO AcO CCl3
OAc OBn TCAHN O BnO O O O OBn
Automated solid phase synthesis:
O 31
18
1. 2. 3. 4. 5. 6.
OBn OAc O O OBn OAc O BnO O
CCl3
HN
HO O Merrifield resin
BnO BnO
HN
30
HN
BnO BnO
BnO BnO
CCl3
OBn OAc O
29, a (two times) b 30, a (three times) b 31, a (two times) c OBn
OBn TCAHN O BnO O O O BnO
O
O
TCAHN
OBn 32
Scheme 22.8 Automated solid phase synthesis of protected N-glycan pentasaccharide core 32. Reactions and conditions: (a) 3.5 equiv donor, 0.5 equiv TMSOTf, CH2Cl2, 21 min; (b) 10 equiv NaOMe, MeOH, CH2Cl2, 33 min (two times); (c) Grubbs’ catalyst (1st generation), ethylene, CH2Cl2, 24 h.
degraded when exposed to stoichiometric TMSOTf for the glycosyl phosphate activation. The tetrasaccharide was stable when catalytic amounts of TMSOTf were used to activate trichloroacetimidates 45 and 46. For the formation of the a-galactosidic bond, the use of the b-anomer of 43 led to better stereoselectivities compared to the a-anomer. This selectivity was further enhanced by the addition of diethyl ether to the solution and by lowering the temperature (50 C).
5. Conclusions and Outlook Automated solid-supported synthesis enables access to complex carbohydrate structures considerably faster than conventional solution phase synthesis. Complex carbohydrate structures have served as challenges to refine and improve the methods for solid phase oligosaccharide synthesis. By using appropriate linker systems, the resulting oligosaccharides may be immobilized directly on glycoarrays for high throughput functional
477
Solid Phase Synthesis of Oligosaccharides
Donor building blocks: OBn FmocO BnO
BnO
O
O OPiv 34
OBn O
O
FmocO
OP(OBu)2
BnO
OBn
OPiv 35
LevO FmocO
OP(OBu)2
O
O
O
OP(OBu)2 OFmoc 37
H3C
O
OPiv PivO
OP(OBu)2 OBn
38
Automated solid phase synthesis: a a c a a
40 1. 34, a 2. b 3. 35, a 4. b 5. 36, c 6. b 7. 38, a 8. d 9. 35, a 10. b 11.38, a 12. e
HO O
41 1. 34, a 2. b 3. 35, a 4. b 5. 36, c 6. b 7. 38, a 8. d 9. 35, a 10. b 11. 36, c 12. b 13. 38, a 14. d 15. 37, a 16. b 17. 38, a 18. e
Merrifield O resin 33
BnO
OBn O
BnO PivO
BnO BnO
OBn O
OBn
BnO
O O O O OBn NHTCA OPiv O H3C OPiv
OBn
BnO
O
O O O O OBn NHTCA OPiv H3C O OBn O OPiv H3C PivO OPiv
BnO
OBn O
BnO O
OBn
BnO
O
O O
O NHTCA
OBn
H3C
O
OPiv PivO
OBn
OP(OBu)2 NHTCA 36
OBn
BnO
39 1. 34, 2. b 3. 35, 4. b 5. 36, 6. b 7. 38, 8. d 9. 37, 10. e
O
O
O
OPiv
H3C OPiv
OBn O
OBn
BnO
O O O OPiv O NHTCA OBn OPiv O H3C OPiv
OBn
OBn
O
O OPiv BnO
39
OBn
HO O OPiv O
OBn
O
O OPiv BnO
HO O OPiv O
40
OBn
OBn
O
O OPiv BnO
HO O OPiv O
41
Scheme 22.9 Automated solid phase syntheses of protected tumor-associated antigen and blood group determinant oligosaccharides 39–41. Reactions and conditions: (a) 5 equiv donor, 5 equiv TMSOTf, CH2Cl2, 15 min (two times); (b) 20% piperidine in DMF, 10 min (three times); (c) 3.5 equiv donor, 5 equiv TMSOTf, CH2Cl2, 15 min (three times); (d) 10% hydrazine in DMF, 15 min (five times); (e) 10 equiv NaOMe, MeOH, CH2Cl2, 90 min (four times).
478
Markus Weishaupt et al.
Donor building blocks: OBn O
FmocO BnO
OPiv 34 BnO
FmocO
O
BnO
OP(OBu)2
O OPiv 42
OBn
BnO
O
O
OBn
FmocO OP(OBu)2 TCAHN 44
BnO
Automated solid phase synthesis:
BnO
O OP(OBu)2
FmocO
OBn O
O OBn 43
OBn
OP(OBu)2
PhN
O
H3C
NPh O OFmoc CF 3 45
O OBn
O
OPiv PivO
CF3
46
HO O 18
Merrifield resin
1. 34, a 2. b 3. 42, a 4. b 5. 43, c 6. b 7. 44, d 9. b 10. 45, e 11. b 12. 46, e 15. f BnO
OBn O
BnO
BnO
O O
O
H3C
O
OBn
OBn
TCAHN
BnO O
OBn O BnO
O
BnO
OPiv PivO
OBn O
O OPiv BnO
OBn O
O
OPiv
47
Scheme 22.10 Automated solid phase synthesis of protected tumor-associated carbohydrate antigen Globo-H 47. Reactions and conditions: (a) 5 equiv donor, 5 equiv TMSOTf, CH2Cl2, 15 C, 45 min (two times); (b) 20% piperidine in DMF, 5 min (three times); (c) 5 equiv donor, 5 equiv TMSOTf, Et2O, CH2Cl2, 50 C, 180 min two times); (d) 3 equiv donor, 3.3 equiv TMSOTf, CH2Cl2, 15 C, 25 min (three times); (e) 5 equiv donor, 0.5 equiv TMSOTf, CH2Cl2, 10 C, 25 min (two times); (f) Grubbs’ catalyst (1st generation), ethylene, CH2Cl2, overnight.
screening. Currently, access to large quantities of monosaccharide building blocks to be used on the synthesizer is the bottleneck of oligosaccharide assembly. The automation of solid phase oligosaccharide synthesis holds great promise for the future, and is expected to simplify the synthesis of biologically relevant sugar structures to such a degree that complex carbohydrate synthesis can be performed by nonchemists. But first, additional
Solid Phase Synthesis of Oligosaccharides
479
developments are necessary to improve certain functions of the synthesizer itself, such as temperature regulation and the precise addition of reagents. Furthermore, easy and scalable protocols for synthesizing versatile building blocks must be developed. Advances in the field of automated solid-supported oligosaccharide synthesis should establish this method as a routine way to prepare complex oligosaccharides in a manner similar to automated oligopeptide and oligonucleotide synthesis.
6. Experimental Data for the Synthesis of Protected Globo-H 47 General information: All chemicals used were reagent grade and used as supplied except where noted. CH2Cl2 and THF were purified by a CycleTainer Solvent Delivery System. Flash column chromatography was carried out using forced flow of the indicated solvent on Fluka Kieselgel 60 (230– 400 mesh). Preparative HPLC was performed using a Waters 1525 pump and Waters 2487 detector on a Waters Sunfire prep C8 reversed-phase column (10 150 mm). All reactions were performed at room temperature unless otherwise noted. The automated synthesis of hexasaccharide 47 was performed on Merrifield resin and divided into the following modules: Module A: The resin was washed six times with THF for 15 s each. Module B: The resin was washed six times with CH2Cl2 for 15 s each. Module D: The building block (5 equiv, 0.125 mmol in 1.5 mL CH2Cl2) was delivered to the reaction vessel containing the resin. The mixture was allowed to cool for 3 min (with vortexing for 30 s followed by standing for 30 s). TMSOTf (5 equiv, 0.125 mmol, in 1.0 mL CH2Cl2) was added to the reaction vessel, with vortexing, in two portions, with a 2 min interval. The reaction mixture was then left for 45 min (with vortexing for 30 s followed by standing for 30 s). After that time, the solution was drained and the resin was washed once with CH2Cl2. Module E: The resin was washed six times with DMF for 15 s each. Module F: The resin was submitted to piperidine (20% v/v in DMF, 2 mL) for 5 min (with vortexing for 30 s, followed by standing for 30 s). After that time, the solution was drained and the resin was submitted to the same conditions for two more times. Module G: The resin was washed six times with acetic acid (0.2 M in THF) for 15 s each. Module I: The resin was washed with CH2Cl2 for 15 s followed by hexanes. Repeated six times. Module J: The building block (5 equiv, 0.125 mmol in 2 mL Et2O) was delivered to the reaction vessel containing the resin. The mixture was
480
Markus Weishaupt et al.
allowed to cool for 3 min (with vortexing for 30 s, followed by standing for 30 s). TMSOTf (5 equiv, 0.125 mmol, in 1.0 mL CH2Cl2) was added to the reaction vessel with vortexing in two portions, with a 2 min interval. The reaction mixture was then left for 3 h (with vortexing for 30 s, followed by standing for 30 s). After that time, the solution was drained and the resin washed once with CH2Cl2. Module K: The building block (3.3 equiv, 0.083 mmol in 1.0 mL CH2Cl2) was delivered to the reaction vessel containing the resin. The mixture was allowed to cool for 1 min (with vortexing for 30 s, followed by standing for 30 s). TMSOTf (3.3 equiv, 0.083 mmol in 0.5 mL CH2Cl2) was added to the reaction vessel, with vortexing, in one portion. The reaction mixture was then left for 25 min (with vortexing for 30 s, followed by standing for 30 s). After that time, the solution was drained and the resin washed once with CH2Cl2. Module L: The building block (5 equiv, in 1.0 mL CH2Cl2) was delivered to the reaction vessel containing the resin. The mixture was allowed to cool for 1 min (with vortexing for 30 s, followed by standing for 30 s). TMSOTf (0.25 equiv, in 0.25 mL CH2Cl2) was added to the reaction vessel with vortexing in one portion. The reaction mixture was then left for 25 min (with vortexing for 30 s, followed by standing for 30 s). After that time, the solution was drained and the resin washed once with CH2Cl2. n-Pentenyl 2-O-benzyl-3,4-di-O-pivaloyl-a-L-fucopyranosyl-(1!2)-3,4,6-tri-Obenzyl-b-D-galactopyranosyl-(1!3)-4,6-di-O-benzyl-2-deoxy-2-N-trichloroacetamido-b-D-galactopyranosyl-(1!3)-2,4,6-tri-O-benzyl-a-D-galactopyranosyl-(1!4)-3,6-di-O-benzyl-2-O-pivaloyl–b-D-galactopyranosyl-(1!4)3,6-di-O-benzyl-2-O-pivaloyl-b-D-glucopyranoside 47 Functionalized Merrifield resin 18 (0.26 mmol/g, 92 mg, 0.024 mmol) was loaded in the reaction vessel of the synthesizer. Modules A, I, B were performed, and then the temperature was changed to 15 C. Modules D, B, D, B were performed using building block 34. The temperature was raised to 20 C and modules A, E, F, E, G, A, I, B, A, I, B were performed. The temperature was changed to 15 C and modules D, B, D, B were performed using building block 42. The temperature was raised to 20 C and modules A, E, F, E, G, A, I, B, A, I, B were performed. The temperature was changed to 50 C and modules J, B, J, B were performed using building block 43. The temperature was raised to 20 C and modules A, E, F, E, G, A, I, B, A, I, B were performed. The temperature was changed to 15 C and modules K, K, K, A were performed using building block 44. The temperature was raised to 20 C and modules B, A, E, F, E, G, A, I, B were performed to afford a resin-bound tetrasaccharide (data not shown here, for detailed information see Werz et al., 2007a). The resin was dried under high vacuum. Half of the resin (12 mmol) was reloaded into the
Solid Phase Synthesis of Oligosaccharides
481
reaction vessel. Modules A, I, B were performed, the temperature was then changed to 10 C and module L, L, A were performed using building block 45. The temperature was raised to 20 C and modules A, E, F, E, G, A, I, B, A, I, B were performed. The temperature was changed to 10 C and modules L, L, A were performed using building block 46. The temperature was raised to 20 C and modules A, B, A, I, B were performed to afford the resin-bound hexasaccharide. The resin was dried under high vacuum for 2 h. The resin was swelled with 2 mL DCM under Ar atmosphere. Grubbs’ catalyst (1st generation, 2 mg) was then added and the reaction was stirred overnight under an ethylene atmosphere. The resin was then washed eight times with CH2Cl2. The combined washes were filtered over silica gel, eluting with ethyl acetate. The eluted solution was concentrated under vacuum. The crude residue was then purified by column chromatography (hexanes/ethyl acetate), yielding 9.6 mg of Globo-H 47 (3.6 mmol, 30% yield from resin 18; for characterization data, see Werz et al., 2007a).
ACKNOWLEDGMENTS We gratefully thank the Max Planck Society and the European Research Council (ERC Advanced Grant to PHS) for financial support. We thank all present and past members of the Seeberger group and our collaborators who contributed to the results reported in this chapter. We also would like to thank Rajan Pragani, Pierre Stallforth, and Oliviana Calin for proofreading this manuscript.
REFERENCES Adibekian, A., Timmer, M. S. M., Stallforth, P., van Rijn, J., Werz, D. B., and Seeberger, P. H. (2008). Stereocontrolled synthesis of fully functionalized D-glucosamine monosaccharides via a domino nitro-Michael/Henry reaction. Chem. Commun. 3549–3551. Adinolfi, M., Barone, G., De Napoli, L., Iadonisi, A., and Piccialli, G. (1998). Use of controlled pore glass in solid phase oligosaccharide synthesis. Application to the semiautomated synthesis of a glyconucleotide conjugate. Tetrahedron Lett. 39, 1953–1956. Apweiler, R., Hermjakob, H., and Sharon, N. (1999). On the frequency of protein glycosylation, as deduced from analysis of the SWISS-PROT database. Biochim. Biophys. Acta Gen. Subj. 1473, 4–8. Basso, A., Braiuca, P., De Martin, L., Ebert, C., Gardossi, L., Linda, P., Verdelli, S., and Tam, A. (2004). Nonswelling macroporous Synbeads for improved efficiency of solidphase biotransformations. Chem. Eur. J. 10, 1007–1013. Branderhorst, H. M., Liskamp, R. M. J., and Pieters, R. J. (2007). Solid-phase carbohydrate synthesis via on-bead protecting group chemistry. Tetrahedron 63, 4290–4296. Capila, I., and Linhardt, R. J. (2002). Heparin–protein interactions. Angew. Chem. Int. Ed. 41, 391–412. Caruthers, M. H. (1985). Gene synthesis machines: DNA chemistry and its uses. Science 230, 281–285.
482
Markus Weishaupt et al.
Code´e, J. D. C., Kro¨ck, L., Castagner, B., and Seeberger, P. H. (2008). Automated solidphase synthesis of protected oligosaccharides containing b-mannosidic linkages. Chem. Eur. J. 14, 3987–3994. Danishefsky, S. J., and Bilodeau, M. T. (1996). Glycals in organic synthesis: The evolution of comprehensive strategies for the assembly of oligosaccharides and glycoconjugates of biological consequence. Angew. Chem. Int. Ed. Engl. 35, 1380–1419. Debena, I., Goordena, J., van Doornuma, E., Ovaab, H., and Kellenbach, E. (1998). MicroDRIFT: Rapid and efficient IR analysis of solid phase organic chemistry reactions. Eur. J. Org. Chem. 697–700. Feizi, T., Fazio, F., Chai, W. C., and Wong, C. H. (2003). Carbohydrate microarrays—A new set of technologies at the frontiers of glycomics. Curr. Opin. Struct. Biol. 13, 637–645. Fraser-Reid, B., Udodong, U. E., Wu, Z., Ottosson, H., Merritt, J. R., Rao, C. S., and Roberts, C. (1992). N-Pentenyl glycosides in organic chemistry—A contemporary example of serendipity. Synlett 927–947. Garcı´a-Martı´n, F., Quintanar-Audelo, M., Garcı´a-Ramos, Y., Cruz, L. J., Gravel, C., Furic, R., Coˆte´, S., Tulla-Puche, J., and Albericio, F. (2006). ChemMatrix, a poly (ethylene glycol)-based support for the solid-phase synthesis of complex peptides. J. Comb. Chem. 8, 213–220. Geurtsen, R., Holmes, D. S., and Boons, G.-J. (1997). Chemoselective glycosylations. 2. Differences in size of anomeric leaving groups can be exploited in chemoselective glycosylations. J. Org. Chem. 62, 8145–8154. Gillingham, D. G., Stallforth, P., Adibekian, A., Seeberger, P. H., and Hilvert, D. (2010). Chemoenzymatic synthesis of differentially protected 3-deoxysugars. Nat. Chem. 2, 102–105. Goto, K., Miura, T., Hosaka, D., Matsumoto, H., Mizuno, M., Ishida, H., and Inazu, T. (2004). Rapid oligosaccharide synthesis on a fluorous support. Tetrahedron 60, 8845–8854. Gowda, D. C., and Davidson, E. A. (1999). Protein glycosylation in the malaria parasite. Parasitol. Today 15, 147–152. Green, L., Hinzen, B., Ince, S. J., Langer, P., Ley, S. V., and Warriner, S. L. (1998). One-pot synthesis of penta- and hepta-saccharides from monomeric mannose building blocks using the principles of orthogonality and reactivity tuning. Synlett 440–442. Grice, P., Ley, S. V., Pietruszka, J., Osborn, M. I., Henning, W. M., Priepke, H. W. M., and Warriner, S. L. (1997). A new strategy for oligosaccharide assembly exploiting cyclohexane-1, 2-diacetal methodology: An efficient synthesis of a high mannose type nonasaccharide. Chem. Eur. J. 3, 431–440. Guthrie, R. D., Jenkins, A. D., and Stehlı´cek, J. (1971). Synthesis of oligosaccharides on polymer supports. Part I. 6-O-(p-Vinylbenzoyl) derivatives of glucopyranose and their copolymers with styrene. J. Chem. Soc. (C) 2690–2696. Guthrie, R. D., Jenkins, A. D., and Roberts, G. A. F. (1973). Synthesis of oligosaccharides on polymer supports. 2. Synthesis of beta-D-gentiobiose derivatives on soluble support copolymers of styrene and 6-O-(p-vinylbenzoyl) or 6-O-(p- vinylphenylsulfonyl) derivatives of D-glucopyranose. J. Chem. Soc. Perkin Trans. 1, 2414–2417. Hecht, M. L., Stallforth, P., Silva, D. V., Adibekian, A., and Seeberger, P. H. (2009). Recent advances in carbohydrate-based vaccines. Curr. Opin. Chem. Biol. 13, 354–359. Heckel, A., Mross, E., Jung, K.-H., Rademann, J., and Schmidt, R. R. (1998). Oligosaccharide synthesis on controlled-pore glass as solid phase material. Synlett 171–173. Hewitt, M. C., Snyder, D. A., and Seeberger, P. H. (2002). Rapid synthesis of a glycosylphosphatidylinositol-based malaria vaccine using automated solid-phase oligosaccharide synthesis. J. Am. Chem. Soc. 124, 13434–13436.
Solid Phase Synthesis of Oligosaccharides
483
Jonke, S., Liu, K.-g., and Schmidt, R. R. (2006). Solid-phase oligosaccharide synthesis of a small library of N-glycans. Chem. Eur. J. 12, 1274–1290. Kaiser, E., Colescott, R. L., Bossinger, C. D., and Cook, P. I. (1970). Color test for detection of free terminal amino groups in the solid-phase synthesis of peptides. Anal. Biochem. 34, 595–598. Kanemitsu, T., Kanie, O., and Wong, C.-H. (1998). Quantitative monitoring of solid-phase synthesis using gated decoupling 13C NMR spectroscopy with a 13C-enriched protecting group and an internal standard in the synthesis of sialyl LewisX tetrasaccharide. Angew. Chem. Int. Ed. 37, 3415–3418. Kanemitsu, T., Wong, C.-H., and Kanie, O. (2002). Solid-phase synthesis of oligosaccharides and on-resin quantitative monitoring using gated decoupling 13C NMR. J. Am. Chem. Soc. 124, 3591–3599. Kates, S. A., McGuinness, B. F., Blackburn, C., Griffin, G. W., Sole´, N. A., Barany, G., and Albericio, F. (1998). ‘‘High-load’’ polyethylene glycol–polystyrene (PEG–PS) graft supports for solid-phase synthesis. Biopolymers (Peptide Science) 47, 365–380. Komba, S., Sasaki, S., and Machida, S. (2007). A new colorimetric test for detection of hydroxyl groups in solid-phase synthesis. Tetrahedron Lett. 48, 2075–2078. Kuisle, O., Lolo, M., Quin˜oa´, E., and Riguera, R. (1999). Monitoring the solid-phase synthesis of depsides and depsipeptides. A color test for hydroxyl groups linked to a resin. Tetrahedron 55, 14807–14812. Ley, S. V., and Priepke, H. W. M. (1994). A facile one-pot synthesis of a trisaccharide unit from the common polysaccharide antigen of group B Streptococci using cyclohexane-1, 2-diacetal (CDA) protected rhamnosides. Angew. Chem. Int. Ed. Engl. 33, 2292–2294. Love, K. R., and Seeberger, P. H. (2002). Carbohydrate arrays as tools for glycomics. Angew. Chem. Int. Ed. 41, 3583–3586. Love, K. R., and Seeberger, P. H. (2004). Automated solid-phase synthesis of protected tumor-associated antigen and blood group determinant oligosaccharides. Angew. Chem. Int. Ed. 43, 602–605. Mammen, M., Choi, S. K., and Whitesides, G. M. (1998). Polyvalent interactions in biological systems: Implications for design and use of multivalent ligands and inhibitors. Angew. Chem. Int. Ed. 37, 2755–2794. Matteucci, M. D., and Caruthers, M. H. (1981). Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103, 3185–3191. Meldal, M. (1992). PEGA: A flow stable polyethylene glycol dimethyl acrylamide copolymer for solid phase synthesis. Tetrahedron Lett. 33, 3077–3080. Merrifield, B. (1985). Solid phase synthesis (Nobel lecture). Angew. Chem. Int. Ed. Engl. 24, 799–810. Miranda, L. P., Lubell, W. D., Halkes, K. M., Groth, T., Grtli, M., Rademann, J., Gotfredsen, C. H., and Meldal, M. (2002). SPOCC-194, a new high functional group density PEG-based resin for solid-phase organic synthesis. J. Comb. Chem. 4, 523–529. Noti, C., and Seeberger, P. H. (2005). Chemical approaches to define the structure-activity relationship of heparin-like glycosaminoglycans. Chem. Biol. 12, 731–756. Paulson, J. C. (1989). Glycoproteins—What are the sugar chains for? Trends Biochem. Sci. 14, 272–276. Plante, O. J., Palmacci, E. R., and Seeberger, P. H. (2001). Automated solid-phase synthesis of oligosaccharides. Science 291, 1523–1527. Pragani, R., Stallforth, P., and Seeberger, P. H. (2010). De novo synthesis of a 2-acetamido4-amino-2, 4, 6-trideoxy-d-galactose (AAT) building block for the preparation of a Bacteroides fragilis A1 polysaccharide fragment. Org. Lett. 10.1021/ol1003912, published online. Raghavan, S., and Kahne, D. (1993). A one step synthesis of the ciclamycin trisaccharide. J. Am. Chem. Soc. 115, 1580–1581.
484
Markus Weishaupt et al.
Rahman, S. S., Busby, D. J., and Lee, D. C. (1998). Infrared and Raman spectra of a single resin bead for analysis of solid-phase reactions and use in encoding combinatorial libraries. J. Org. Chem. 63, 6196–6199. Raman, R., Sasisekharan, V., and Sasisekharan, R. (2005). Structural insights into biological roles of protein-glycosaminoglycan interactions. Chem. Biol. 12, 267–277. Ratner, D. M., Swanson, E. R., and Seeberger, P. H. (2003). Automated synthesis of a protected N-linked glycoprotein core pentasaccharide. Org. Lett. 5, 4717–4720. Schofield, L., Vivas, L., Hackett, F., Gerold, P., Schwarz, R. T., and Tachado, S. (1993). Neutralizing monoclonal-antibodies to glycosylphosphatidylinositol, the dominant TNF-alpha-inducing toxin of Plasmodium falciparum—Prospects for the immunotherapy of severe malaria. Annu. Trop. Med. Parasitol. 87, 617–626. Seeberger, P. H., Beebe, X., Sukenick, G. D., Pochapsky, S., and Danishefsky, S. J. (1997). Monitoring the progress of solid-phase oligosaccharide synthesis by high-resolution magic angle spinning NMR: Observations of enhanced selectivity for b-glycoside formation from a-1, 2-anhydrosugar donors in solid-phase couplings. Angew. Chem. Int. Ed. 36, 491–493. Shin, I., Park, S., and Lee, M. R. (2005). Carbohydrate microarrays: An advanced technology for functional studies of glycans. Chem. Eur. J. 11, 2894–2901. Stallforth, P., Adibekian, A., and Seeberger, P. H. (2008). De novo synthesis of a D-galacturonic acid thioglycoside as key to the total synthesis of a glycosphingolipid from Sphingomonas yanoikuyae. Org. Lett. 10, 1573–1576. Tanaka, K., Fujii, Y., Tokimoto, H., Mori, Y., Tanaka, S.-i., Bao, G.-m., Siwu, E. R. O., Nakayabu, A., and Fukase, K. (2009). Synthesis of a sialic acid containing complex-type N-glycan on a solid support. Chem. Asian J. 4, 574–580. Timmer, M. S. M., Adibekian, A., and Seeberger, P. H. (2005). Short de novo synthesis of fully functionalized uronic acid monosaccharides. Angew. Chem. Int. Ed. 44, 7605–7607. Toy, P. H., and Janda, K. D. (1999). New supports for solid-phase organic synthesis: Development of polystyrene resins containing tetrahydrofuran derived cross-linkers. Tetrahedron Lett. 40, 6329–6332. Varki, A., Cummings, R. D., Esko, J. D., Freeze, H. H., Stanley, P., Bertozzi, C. R., Hart, G. W., and Etzler, M. E. (eds.), (1999). Essentials of Glycobiology, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Werz, D. B., Castagner, B., and Seeberger, P. H. (2007a). Automated synthesis of the tumorassociated carbohydrate antigens Gb-3 and Globo-H: Incorporation of a-galactosidic linkages. J. Am. Chem. Soc. 129, 2770–2771. Werz, D. B., Ranzinger, R., Herget, S., Adibekian, A., von der Lieth, C.-W., and Seeberger, P. H. (2007b). Exploring the structural diversity of mammalian carbohydrates (‘‘glycospace’’) by statistical databank analysis. ACS Chem. Biol. 2, 685–691. Yamada, H., Harada, T., and Takahashi, T. (1994). Synthesis of an elicitor-active hexaglucoside analog by a one-pot, two-step glycosidation procedure. J. Am. Chem. Soc. 116, 7919–7920. Yu, B., Yang, Z., and Cao, H. (2005). One-pot glycosylation (OPG) for the chemical synthesis of oligosaccharides. Curr. Org. Chem. 9, 179–194. Zhang, Z., Ollmann, I. R., Ye, X.-S., Wischnat, R., Baasov, T., and Wong, C.-H. (1999). Programmable one-pot oligosaccharide synthesis. J. Am. Chem. Soc. 121, 734–753.
C H A P T E R
T W E N T Y- T H R E E
Novel Synthesis of Functional Mucin Glycopeptides Containing Both N- and O-Glycans Takahiko Matsushita and Shin-Ichiro Nishimura Contents 1. Overview 2. Design of MUC1-Related Neoglycoprotein 3. Solid-Phase Glycopeptide Synthesis Using Microwave-Assisted Protocol 3.1. Materials and equipments 3.2. Procedures 4. Production and Purification of SrtA 4.1. Materials and equipments 4.2. Procedures 5. SrtA-Mediated Ligation 5.1. Materials and equipments 5.2. Procedures for 3 (Fig. 23.2) 5.3. Procedures for 7 and 8 (Fig. 23.4) 5.4. Procedures for 12 (Fig. 23.5) 6. Endo-M-Mediated Transglycosylation 6.1. Materials and equipments 6.2. Procedures for analytical scale for 5 (Fig. 23.3) 6.3. Procedures for preparative scale for 5 (Figs. 23.4 and 23.5) 6.4. Procedures for 8 (Fig. 23.4) 7. One-Pot Enzymatic Sugar Elongation Catalyzed by Glycosyltransferases 7.1. Materials and equipments 7.2. Procedures for 6 (Fig. 23.4) 7.3. Procedures for 11 (Fig. 23.5) 8. Chemoselective Polymer Blotting 8.1. Materials and equipments 8.2. Procedures
486 487 488 489 489 490 491 491 491 492 492 493 493 494 494 495 496 496 496 497 498 498 499 499 499
Graduate School of Advanced Life Science and Frontier Research Center for Post-Genome Science and Technology, Hokkaido University, Sapporo, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78023-X
#
2010 Elsevier Inc. All rights reserved.
485
486
Takahiko Matsushita and Shin-Ichiro Nishimura
9. BLase-Catalyzed Cleavage from Supporting Polymer 9.1. Materials and equipments 9.2. Procedures 10. Compound Characterization by Mass Spectrometry and Amino Acid Analysis 10.1. Materials and equipments 10.2. Characterization data References
499 500 500 500 500 500 501
Abstract Progress of synthetic methods using ligation makes it possible to access larger and multifunctionalized biomolecules. Recently, sortase-mediated ligation was used as a new and complementary technique for construction of peptide and protein to other ligation methods. Staphylococcus aureus Sortase A (SrtA) is a transpeptidase that recognizes C-terminal LPXTG motif of proteins to cleave between T and G, and subsequently transfers the acyl component to a nucleophile containing N-terminal oligo-glycines. Toward development of multi- and heteroglycosylated protein synthesis, we utilized SrtA-mediated ligation technique for preparation of MUC1-related glycopeptide analogs having both N- and O-glycans as model compounds. To further improve this synthetic strategy, we also demonstrated the merits of SrtA-mediated ligation by means of a polymersupported protocol. The present strategy will facilitate rapid and large-scale synthesis of multiply functionalized neoglycoprotein as new types of convenient models for the investigation of structure–function relationship.
1. Overview Protein glycosylation is one of the most important processes in the posttranslational modifications, and carbohydrates covalently attached to proteins have been shown to play significant functional roles in protein folding, cellular differentiation, aging, cancers, and basic immunological systems (Dwek, 1996). In general, N- and O-glycans are known as two major groups and widely substituted at the potential glycosylation sites such as Asn of the Asn-Xaa-Ser(Thr) consensus sequence in common glycoproteins or Ser/Thr residues highly distributed in mucin-type glycoproteins. Mammalian glycoproteins often display both N- and O-glycans on a single polypeptide chain, and clustering of multiple N-glycans or O-glycans on a single polypeptide appears to be a unique mechanism to exert some beneficial characteristics such as enhancement of solubility, stability against proteolytic enzymes, and the strength of affinity in the molecular recognition (Lee and Lee, 1995 Lundquist and Toone, 2002; Mammen et al., 1998). Recent progress in the construction of glycans and glycoproteins by chemical synthesis, native ligation-based synthesis, and site-directed glycosylation
487
Synthesis of Mucin Glycopeptides
R1–Leu–Pro–Xaa–Thr–Gly–R2 + H–(Gly)n–R3
Sortase A
R1–Leu–Pro–Xaa–Thr–(Gly)n–R3 + H–Gly–R2
Figure 23.1 Sortase A-mediated transpeptidation. Xaa ¼ any amino acid, n 1.
by cotranslational strategy had greatly expanded the repertoire in the molecular design of synthetic glycoproteins as well as recombinant glycosyltransferase-based synthesis (Gamblin et al., 2009). However, there are little suited model compounds feasible for investigating the detail of their functions at the molecular level due to the difficulty in rapid and large-scale synthesis of highly complicated macromolecular glycopeptides. Therefore, advent of a facile and versatile protocol for the construction of such complex neoglycoproteins is now strongly required. To overcome this problem, we recently developed the synthetic method of neoglycoproteins by utilizing Sortase A (SrtA)-mediated ligation technique (Matsushita et al., 2009). Staphylococcus aureus sortase (Sortase A, SrtA) is a bacterial transpeptidase responsible for the covalent attachment of specific proteins to the peptidoglycan cross-bridge of the cell wall of Gram-positive bacteria (Mazmanian et al., 2001). Proteins that become substrates of SrtA need to have Lys-Pro-X-Thr-Gly (LPXTG) motif (X ¼ any amino acid) at the C-terminus. SrtA can cut an amide bond between T and G at LPXTG and form a new amide bond linking between the carboxyl group of threonine to an amino group of the glycine oligomer at the N-terminus in an acceptor substrate (Fig. 23.1). Recently, SrtA was applied for the production of a wide range of nonnatural polypeptides bearing different biological functions (Proft, 2010). Merit of this promising method is evident because the peptide-bond formation catalyzed by the transpeptidases gives structurally defined and stereochemically pure linkages between two different peptide components. In this chapter, we introduce the new method for synthesis of neoglycoprotein having both N- and O-glycans by combined use of SrtA-mediated ligation method and chemoenzymatic approaches that we have developed such as microwave-assisted solid-phase synthesis, one-pot enzymatic sugar elongation with glycosyltransferases, Endo-M-mediated transglycosylation for construction of complex type N-glycan on peptide, and a protocol of polymer-supported enzymatic synthesis using aminooxy-functionalized polyacrylamide for preparative efficiency.
2. Design of MUC1-Related Neoglycoprotein We designed MUC1-related neoglycoproteins 3 (Fig. 23.2), 7 (Fig. 23.4), and 8 (Figs. 23.4 and 23.5) as synthetic models which have N- and O-glycans. They are composed of two characteristic segments, a
488
Takahiko Matsushita and Shin-Ichiro Nishimura
A
B 100 b3
b6 a1 VTSAPDTRPALPKTGLR 1
Sortase A
80 70 Yield %
b1 GGPVHNVTSA 2
90
60 50 40 30
1 mM 10 mM
20 b3
b6
b1 a1 VTSAPDTRPALPKTGGPVHNVTSA 3
10 0
0
1
2 3 4 Reaction time (h)
17
18
Figure 23.2 Enzymatic synthesis of the peptide carrying both O-glycan (core 2 trisaccharide) and N-glycan (GlcNAc monosaccharide) (3) by means of Sortase A-mediated ligation. (A) Synthetic scheme. (B) Time courses of the generation of 3 in Sortase A reaction using 1 and 10 mM acceptor (2) with 1 mM donor (1). The yields were estimated by RP-HPLC analyses.
cancer-relevant O-glycosylation site in the tandem repeating sequence of MUC1 glycoprotein [VTSAPDT(O-glycan)RPA] and a partial structure involving the N-glycosylation site in the C-terminal region [953PVHN (N-glycan)VTSA961] of MUC1 (from OGlycBase v6.00), and these segments are joined by –LPXTGG–, resulting sequence of SrtA-mediated ligation between a donor carrying LPXTG at C-terminus and an acceptor carrying GG at N-terminus.
3. Solid-Phase Glycopeptide Synthesis Using Microwave-Assisted Protocol Compounds 1, 2, and 9 were synthesized by Fmoc-based solid-phase peptide synthetic strategy employing HBTU/HOBt/DIPEA and an offline microwave-assisted coupling protocol (Matsushita et al., 2005) on a TentaGel resin functionalized with Rinkamide linker. At the final step of the synthesis of 9, Fmoc-Glu(OtBu)-OH, Fmoc-Phe-OH, and 5-oxohexanoic acid were introduced to the N-terminus in order to function as a molecular shuttle carrying a heterobifunctional linker. Cleavage from the resin with 90% aqueous TFA and followed hydrolysis of the acetyl protecting groups under alkaline condition afford 1 (23%), 2 (62%), and 9. No purification was performed by 9.
Synthesis of Mucin Glycopeptides
489
3.1. Materials and equipments 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.
TentaGel S RAM resin (Rapp Polymer GmbH) Fmoc-amino acids (Novabiochem) Fmoc-Thr(Ac7core2)-OH (Matsushita et al., 2006; for the synthesis of 1) Fmoc-Asn(Ac3AcNH-b-Glc)-OH (Novabiochem; for the synthesis of 2) 5-Oxohexanoic acid (Tokyo Kasei Kogyo Co., Ltd.; for the synthesis of 9) 2-2-(1H-Benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU; Peptide Institute, Inc.) 1-Hydroxy-1H-benzotriazole (HOBt; Peptide Institute, Inc.) N,N-Diisopropylethylamine (DIPEA; Wako Pure Chemical Industries, Ltd.) DMF (Wako Pure Chemical Industries, Ltd.) NMP (Wako Pure Chemical Industries, Ltd.) Piperidine (Wako Pure Chemical Industries, Ltd.) Acetic anhydride (Wako Pure Chemical Industries, Ltd.) TFA (Wako Pure Chemical Industries, Ltd.) tert-Butylmethyl ether Polypropylene tube equipped with a filter, LibraTube (Hipep Laboratories) Single mode microwave reactor GreenMotif I (IDX Corp.), which has a customized reaction cavity for installation of LibraTube, is mounted on a vortex mixer for mechanical shaking. Preparative RP-HPLC column; Inertsil ODS-3 (250 20 mm ID, GL Sciences Inc.) 50 mM sodium acetate buffer (pH 5.5)
3.2. Procedures 1. Swelling: shake TentaGel S RAM resin (0.26 mmol/g) (192 mg, 50 mmol for 1 and 9, 385 mg, 100 mmol for 2) with DMF for 30 min in a LibraTube, and then filter the resin. 2. Fmoc-removal: add 20% piperidine/DMF (2 ml for 1 and 9, 4 ml for 2) to the resin and shake the mixture under microwave irradiation at 50 C for 3 min. 3. Washing: filter and wash the resin with DMF (4 ml for 1 and 9, 10 ml for 2, five times). 4. Coupling reaction of standard Fmoc-amino acids: add the mixture of appropriate Fmoc-amino acid (3.0 equiv), HBTU (3.0 equiv), HOBt (3.0 equiv), and DIPEA (6 equiv) in DMF (1.5 ml for 1 and 9, 3 ml for 2) to the resin and shake under microwave irradiation at 50 C for 10 min. 5. Coupling reaction of the Fmoc-glycosylated amino acid: add the mixture of Fmoc-Thr(Ac7core2)-OH (1.5 equiv for 1 and 9) or Fmoc-Asn (Ac3AcNH-b-Glc)-OH (1.5 equiv for 2), HBTU (1.5 equiv), HOBt
490
6. 7. 8. 9. 10.
11. 12. 13. 14. 15. 16. 17. 18. 19.
Takahiko Matsushita and Shin-Ichiro Nishimura
(1.5 equiv), and DIPEA (3 equiv) in DMF(1.5 ml) to the resin and shake under microwave irradiation at 50 C for 20 min. Washing: filter and wash the resin with DMF (4 ml for 1 and 9, 10 ml for 2, five times). Capping: for acetylation of unreacted amino groups, add the mixture of Ac2O (4.75%, v/v), DIPEA (2.25%, v/v), and HOBt (13 mM) in NMP (8 ml) and shake at ambient temperature for 5 min. Washing: filter and wash the resin with DMF (4 ml for 1 and 9, 10 ml for 2, five times). Repeat Fmoc-removal, coupling, and capping (procedure 2–8). Introduction of a heterobifunctional linker: in the case of the synthesis of 9, at the final step of glycopeptide elongation, incorporate extra FmocGlu(OtBu)-OH, Fmoc-Phe-OH, and 5-oxohexanoic acid to N-terminus of the peptide on the resin as same manner described in procedure 4. Cleavage: after completion of the synthesis, add 90% aqueous TFA (2 ml for 1 and 9, 4 ml for 2) to the resin and shake at room temperature for 2 h, and then remove the resin by filtration. Wash the resin with 90% aqueous TFA (2 ml for 1 and 9, 4 ml for 2) twice and combine the solution to concentrate until 0.5–1.0 ml by streaming of nitrogen gas. Add cold tert-butylmethyl ether in an ice bath to the solution until precipitation. Remove the supernatant after centrifugation and wash the residue with tert-butylmethyl ether twice, and dry the resulting residue by streaming of nitrogen gas. In the case of 1 and 2, crude glycopeptides with acetyl protection were purified by a preparative RP-HPLC. Add methanol (12 ml) to the residue of acetylated glycopeptide, adjust, and keep the solution to pH 12.4 (pH meter) with 1 N sodium hydroxide at ambient temperature for 2–5 h. Neutralize the solution with 1 N acetic acid and evaporate in vacuo. In the case of 1 and 2, crude glycopeptides were purified by preparative RP-HPLC to give 1 (23%) and 2 (58%). In the case of 9, the residue was dissolved in 50 mM sodium acetate buffer (pH 5.5) (5 ml) as the 10 mM stock solution of 9 (theoretical concentration based on starting TentaGel resin)
4. Production and Purification of SrtA SrtA is produced in Escherichia coli (E. coli) transfected with the plasmid carrying the SrtA gene. Preparation of the enzyme is performed according to the previously reported procedure (Mao et al., 2004) with some modifications.
Synthesis of Mucin Glycopeptides
491
4.1. Materials and equipments 1. 2 YT medium containing 50 mg/L ampicillin 2. IPTG 3. 25 mM Tris–HCl (pH 7.5) containing 0.5 M NaCl, 20 mM imidazole, and 10% (w/v) glycerol 4. Ni-Sepharose 6 Fast Flow (Amersham Biosciences, Uppsala, Sweden) 5. Cetriprep YM-10 (Millipore Co., Bedford, MA) 6. Ultrafree-MC (Millipore Co.)
4.2. Procedures 1. Inoculate the transformed cells in 2 YT medium containing 50 mg/L ampicillin at 37 C 2. Add IPTG (1 mM, final concentration) and cultivate the culture at 20 C for 20 h. 3. Harvest and freeze the cells. 4. After thawing, suspend the cells in 25 mM Tris–HCl (pH 7.5) containing 0.5 M NaCl, 20 mM imidazole, and 10% (w/v) glycerol and lyse them by sonication. 5. Remove the cell debris by centrifugation at 10,000 g for 10 min. 6. Apply the supernatant to affinity chromatography using Ni-Sepharose 6 Fast Flow. 7. Wash the column with sonication buffer. 8. Elute the protein with 25 mM Tris–HCl (pH 7.5) containing 0.5 M NaCl, 0.5 M imidazole, and 10% (w/v) glycerol. 9. Concentrate the purified SrtA by Cetriprep YM-10 (Millipore Co.) and Ultrafree-MC (Millipore Co.), until 16 mg/ml of protein concentration.
5. SrtA-Mediated Ligation We performed the synthesis of 3 as a preliminary experiment of SrtAmediated ligation (Fig. 23.2A). One millilmolar of donor 1 (O-glycopeptide carrying core 2 trisaccharide) was conjugated with 1 or 10 mM acceptor 2 (N-glycopeptide carrying GlcNAc monosaccharide) for investigating effect of acceptor concentration. Figure 23.2B shows the reaction using 10 mM acceptor proceeds to reach higher yield since after 2 h than the reaction using 1 mM acceptor. After 18 h, 10 mM condition is 78%, while 1 mM condition is 54%. As a result, higher concentration of acceptor is more favorable to the yield in SrtA-mediated ligation.
492
Takahiko Matsushita and Shin-Ichiro Nishimura
Next, we synthesized 7 and 8 for investigating steric hindrance effects of the glycans attached to peptide substrates (Fig. 23.4). One millilmolar of the peptide carrying disialylated core 2-based hexasaccharide (6) as a donor having larger O-glycan moiety than 1 was ligated by SrtA with 10 mM of the peptide carrying GlcNAc monosaccharide (2) and disialylated biantennary undecasaccharide (7) as acceptors for 18 h. The yields of 7 (72%) and 8 (62%) are lower than that of 3 (78%, under 10 mM acceptor condition), which shows an increase in steric hindrance of carbohydrate moieties of a donor and an acceptor leads to a reduction in the accessibility of SrtA to a donor and of SrtA–donor complex to an acceptor, respectively.
5.1. Materials and equipments 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
500 mM Tris–HCl buffer (pH 7.5) 1.5 M NaCl in Milli-Q water 100 mM CaCl2 in Milli-Q water 20 mM 2-mercaptoethanol in Milli-Q water 10 mM donor (1) in Milli-Q water (for the synthesis of 3 in Fig. 23.2) 10 mM donor (6) in Milli-Q water (for the synthesis of 7 and 8 in Fig. 23.4) 10 mM donor (11) in 25 mM ammonium acetate buffer (pH 6.5; for the synthesis of 12 in Fig. 23.5) 50 mM acceptor (2) in Milli-Q water (for the synthesis of 3 and 7) 50 mM acceptor (5) in Milli-Q water (for the synthesis of 8) Acceptor (5), lyophilized (for the synthesis of 12) 1 mM SrtA Milli-Q water Analytical RP-HPLC column: Mightysil RP-18 (150 4.6 mm ID, 5 mm, Kanto Chemical Co., Inc.) Analytical RP-HPLC column: Inertsil ODS-3 (250 4.6 mm ID, 5 mm, GL Sciences) 10 K Apollo 20 ml, high-performance centrifugal concentrator (Orbital Biosciences, LLC; for the ultrafiltration of 12) 25 mM ammonium acetate buffer (pH 6.5)
5.2. Procedures for 3 (Fig. 23.2) 1. Add 10 mM donor (1) (10 ml) and 50 mM acceptor (2) (2 ml for 1 mM or 20 ml for 10 mM) to the mixture of 500 mM Tris–HCl buffer (pH 7.5, 10 ml), 1.5 M NaCl (10 ml), 100 mM CaCl2 (5 ml), 20 mM 2-mercaptoethanol (10 ml), and Milli-Q water (43 ml for 1 mM or 25 ml for 10 mM).
Synthesis of Mucin Glycopeptides
493
2. Add 1 mM SrtA (10 ml) and incubate at 37 C for 18 h. Final concentration of the solution (100 ml) is as follows: 1 mM donor (1), 1 or 10 mM acceptor (2), 50 mM Tris–HCl, 150 mM NaCl, 5 mM CaCl2, 2 mM 2-mercaptoethanol, and 0.1 mM SrtA. 3. Analyze 10 ml of each reaction solution at 0, 0.5, 1, 2, 4, and 18 h by analytical RP-HPLC. Figure 23.2B indicates the summary of the yield of 3 estimated by peak area. RP-HPLC condition is as follows: column, Mightysil RP-18, eluent A, 25 mM ammonium acetate, pH 5.8; eluent B, acetonitrile containing 10% eluent A. Employ eluent (A/B ¼ 98/2) and then increase the ratio of eluent B lineally from 2% to 30% over 20 min with a flow rate of 1.0 ml/min and detect at 220 nm UV.
5.3. Procedures for 7 and 8 (Fig. 23.4) 1. Add 10 mM donor (6) (10 ml) and 50 mM acceptor (2) (20 ml, for 7) or 50 mM acceptor (5) (20 ml, for 8) to the mixture of 500 mM Tris–HCl buffer (pH 7.5, 10 ml), 1.5 M NaCl (10 ml), 100 mM CaCl2 (5 ml), 20 mM 2-mercaptoethanol (10 ml), and Milli-Q water (25 ml). 2. Add 1 mM SrtA (10 ml) and incubate at 37 C for 18 h. Final concentration of the solution (100 ml) is as follows: 1 mM donor (6), 10 mM acceptor (2 or 5), 50 mM Tris–HCl buffer, 150 mM NaCl, 5 mM CaCl2, 2 mM 2-mercaptoethanol, and 0.1 mM SrtA. 3. Analyze and purify the crude materials by an analytical RP-HPLC. The yields were estimated by peak area of product to give 7 (72%) and 8 (62%). RP-HPLC condition is as follows: column, Inertsil ODS-3, eluent A, 25 mM ammonium acetate, pH 5.8; eluent B, acetonitrile containing 10% eluent A. Employ eluent (A/B ¼ 90/10) and then increase the ratio of eluent B lineally from 10% to 30% (for 7) and 10% to 23% (for 8) over 45 min with a flow rate of 1.0 ml/min and detect at 220 nm UV.
5.4. Procedures for 12 (Fig. 23.5) 1. Add acceptor (5) (18.8 mmol) to the mixture of 500 mM Tris–HCl buffer (pH 7.5, 125 ml), 1.5 M NaCl (250 ml), 100 mM CaCl2 (125 ml), 20 mM 2-mercaptoethanol (250 ml), 10 mM donor (11) (1250 ml), and Milli-Q water (240 ml). 2. Add 1 mM SrtA (260 ml) and incubate at 37 C for 2 h. Final concentration of the solution (2500 ml) is as follows: 5 mM donor (11), 7.5 mM acceptor (5), 25 mM Tris–HCl buffer, 150 mM NaCl, 5 mM CaCl2, 2 mM 2-mercaptoethanol, and 0.1 mM SrtA. 3. Pass the reaction mixture through a centrifugal ultrafiltration unit. Wash the retentate with 25 mM Tris–HCl buffer (pH 7.0) thrice and
494
Takahiko Matsushita and Shin-Ichiro Nishimura
subsequently wash with 25 mM ammonium acetate buffer (pH 6.5) thrice to exchange a buffer. Adjust the volume of the retentate to 1.56 ml with 25 mM ammonium acetate (pH 6.5) as the stock solution of polymer 12 (8 mM, theoretical concentration based on the starting TentaGel resin).
6. Endo-M-Mediated Transglycosylation We performed the synthesis of 5 by means of Endo-M-mediated transglycosylation (Fig. 23.3A). To assess the effect of donor concentration, 25 and 75 mM of sialoglycopeptide (4) was used to Endo-M reaction with 10 mM acceptor (2). Figure 23.3B shows the reaction using 75 mM donor resulted in higher yield than the reaction using 25 mM donor. Both reactions reached highest yield in 0.5–1 h, however, since then, the yields continued to decrease to 2% in 24 h. It is because that Endo-M-catalyzed hydrolysis of product has precedence over transglycosylation. As a result, higher concentration of donor and short reaction time are more favorable to the yield in Endo-M catalyzed transglycosylation. In the case of Endo-M reaction between 7 and 4, transglycosylation dose not proceed to generate 8 (Fig. 23.4), which is thought to be caused by the steric hindrance effect of larger O-glycan moiety of 7.
6.1. Materials and equipments 1. 600 mM potassium phosphate buffer (pH 6.3) 2. 50 mM acceptor (2) in Milli-Q water A
B a6
b4
b4
b2
b2
a3
a6 b4 b4
b1 GGPVHNVTSA 2
b1 KVANKS 4 Endo-M
25mM
70 a6
a6
60
b4
b4
50
b2
b2 a6 b4
a3
b4 b1 GGPVHNVTSA 5
Yield (%)
a6
75mM
40 30 20 10 0 0
1
2 23 Reaction time (h)
24
Figure 23.3 Enzymatic synthesis of the peptide carrying disialylated biantennary N-glycan (5) by means of Endo-M-mediated transglycosylation. (A) Synthetic scheme. (B) Time courses of the generation of 5 in Endo-M reaction using 25 and 75 mM donor (4) for 10 mM acceptor (2). The yields were estimated by RP-HPLC analyses.
495
Synthesis of Mucin Glycopeptides
a3
a3 b4
a3 b3
b1, 4-GaiT a 2, 3-N-SiaT a 2, 3-O-SiaT
b6
a1 VTSAPDTRPALPKTGLR
a3 b1 GGPVHNVTSA 2
b6
a1 VTSAPDTRPALPKTGLR 1 a3 b 1, 4-GaiT a 2, 3-N-SiaT a 2, 3-O-SiaT
b4
b4
b2
b2
a3
a3
b4
b6 a1 VTSAPDTRPALPKTGLR 6 b3
b1
Endo-M (No reactin)
a6
a6 b3
b6 a1
VTSAPDTRPALPKTGGPVHNVTSA 7
sortase A
6
b3
b4
a6 a3
b4 b4 b1 GGPVHNVTSA 5 Sortase A
b4
a3 b3
b6
a6
a6
b4
b4 b2
b2 a3
a6 b4 b4
a1
b1 VTSAPDTRPALPKTGGPVHNVTSA 8
Figure 23.4 Synthetic strategy for generation of the peptide carrying both disialylated core 2-type O-glycan and disialylated biantennary N-glycan (8).
3. 150 mM sialoglycopeptide (4) as N-glycan donor prepared from hen’s egg yolk (Seko et al., 1997) in Milli-Q water 4. 1 U/ml Endo-M (Tokyo Kasei Kogyo Co., Ltd.) 5. Milli-Q water 6. Analytical RP-HPLC column: Mightysil RP-18 (150 4.6 mm ID, 5 mm; Kanto Chemical Co., Inc.) 7. Preparative RP-HPLC column: Inertsil ODS-3 (250 20 mm ID; GL Sciences Inc.)
6.2. Procedures for analytical scale for 5 (Fig. 23.3) 1. Add 50 mM acceptor (2) (2 ml) to the mixture of 600 mM potassium phosphate buffer (pH 6.3, 1 ml), 150 mM sialoglycopeptide (4) (1.7 ml for 25 mM of final conc. or 5 ml for 75 mM of final conc.) and Milli-Q water (3.3 ml for 25 mM of final conc. of 4 or 0 ml for 75 mM of final conc. of 4). 2. Add 1 U/ml Endo-M (2 ml) and incubate at 37 C for 24 h. The final concentration of the mixture (10 ml) is as follows: 10 mM acceptor (2), 25 or 75 mM sialoglycopeptide (4), 60 mM potassium phosphate buffer, and Endo-M (200 mU/ml). 3. Add the mixture of 6 M guanidine–HCl (20 ml) and water (3.5 ml) to 1.5 ml of each reaction solution sampled at 0, 0.5, 1, 1.5, 2, and 24 h
496
Takahiko Matsushita and Shin-Ichiro Nishimura
4. Analyze 20 ml of the each prepared solution (25 ml) by an analytical RPHPLC. RP-HPLC condition is as follows: eluent A, 25 mM ammonium acetate, pH 5.8; eluent B, acetonitrile containing 10% eluent A. Employ eluent (A/B ¼ 98/2) and then increase the ratio of eluent B lineally from 2% to 35% over 35 min with a flow rate of 1.0 ml/min and detect at 220 nm UV. Figure 23.3B indicates the summary of the yield of 5 estimated by peak area.
6.3. Procedures for preparative scale for 5 (Figs. 23.4 and 23.5) 1. Add 50 mM acceptor (2) (440 ml) to the solution of 150 mM sialoglycopeptide (4) (1.1 ml) and lyophilize the mixture. 2. Dissolve the residue in the mixture of 600 mM potassium phosphate buffer (pH 6.3, 220 ml), 1 U/ml Endo-M (396 ml) and Milli-Q water (1584 ml), and incubate at 37 C for 1 h. The final concentration of the mixture (2200 ml) is as follows: 10 mM acceptor (2), 75 mM sialoglycopeptide (4), 60 mM potassium phosphate buffer, and Endo-M (180 mU/ml). 3. Purify the crude material by a preparative RP-HPLC to give 5 (44%).
6.4. Procedures for 8 (Fig. 23.4) 1. Add 50 mM acceptor (7) (10 ml) to 150 mM sialoglycopeptide (4) (25 ml) and lyophilize the mixture. 2. Dissolve the residue in the mixture of 600 mM potassium phosphate buffer (pH 6.3, 5 ml), 1 U/ml Endo-M (10 ml) and Milli-Q water (35 ml), and incubate at 37 C for 4 h. The final concentration of the mixture (50 ml) is as follows: 10 mM acceptor (7), 75 mM sialoglycopeptide (4), 60 mM potassium phosphate buffer, and Endo-M (200 mU/ml). 3. Monitor the reaction by analytical RP-HPLC at 0, 0.5, 1, 2, and 4 h (however the generation of 8 was not detected).
7. One-Pot Enzymatic Sugar Elongation Catalyzed by Glycosyltransferases One-pot syntheses of 6 from 1 (free acceptor) and of 11 from 10 (polymer-supported acceptor) were carried out according to the condition described in our previous papers (Fumoto et al., 2005a,b) using b1,4-GalT, a2,3-N-SiaT, and a2,3-O-SiaT in the presence of sugar nucleotides UDPGal and CMP-Neu5Ac as glycosyl donor substrates (Figs. 23.4 and 23.5,
497
Synthesis of Mucin Glycopeptides
b3
b6 a1
FEVTAPDTRPALPKTGLR
O
O
a6
a6
b4
b4
b2
9
a3 b4
a3 Aminooxy-functionalized polyacrylamide
a3
b3
b2 a6 b4 b4
b6 a1
b1
VTSAPDTRPALPKTGGPVHNVTSA
b3
b6 a1
8
FEVTAPDTRPALPKTGLR
R ON
O
10
b1, 4-GaIT a2, 3-N-SiaT a2, 3-O-SiaT
a3 b4
b3
b6 a1
FEVTSAPDTRPALPKTGLR
O
a6
b4
b4
b2
b2
a3
a3
R ON
a6
11
BLase
a6 b4
a3
b4 b1
b3
GGPVHNVTSA 5 Sortase A
b4
a3
b6 a1
a6
a6
b4
b4
b2
b2
a3
a6 b4 b4 b1
FEVTSAPDTRPALPKTGGPVHNVTSA
R ON
O
12
Figure 23.5 The polymer-supported approach using Sortase A-mediated ligation. A heterobifunctional liner, 5-oxohexanoyl-Phe-Glu, is introduced at N-terminus of (9) due to immobilization on aminooxy-functionalized polyacrylamide by oxime bond formation and to cleavage a resulting glycopeptide from supporting polymer by BLase, a glutamic acid-specific protease isolated originally from Bacillus licheniformis. R0 ¼ (CH2)6-polyacrylamide.
respectively). Both reactions proceeded quantitatively as determined 6 by HPLC analysis (11 was pretreated with BLase to release 6 from supporting polymer before analysis).
7.1. Materials and equipments 1. 2. 3. 4. 5. 6. 7. 8. 9.
500 mM HEPES buffer (pH 7.0) 100 mM MnCl2 in Milli-Q water 2 wt% bovine serum albumin (BSA) in Milli-Q water 100 mM UDP-Gal (Yamasa Co.) in Milli-Q water 100 mM CMP-Neu5Ac (Yamasa Co.) in Milli-Q water 4 U/ml b1,4-GalT (Toyobo, Ltd.) 875 mU/ml a2,3-O-SiaT (Calbiochem) 3.7 U/ml a2,3-N-SiaT (Calbiochem) 50 mM acceptor (1) in Milli-Q water (for the synthesis of 6)
498
Takahiko Matsushita and Shin-Ichiro Nishimura
10. 20 mM acceptor polymer (10) in 25 mM HEPES buffer (pH 7.0; for the synthesis of 11) 11. Milli-Q water 12. Preparative RP-HPLC column; Inertsil ODS-3 (250 20 mm ID, GL Sciences Inc.; used for the purification of 6) 13. 10 K Apollo 20 ml, high-performance centrifugal concentrator (Orbital Biosciences, LLC; for the ultrafiltration of 11) 14. 25 mM Tris–HCl buffer (pH 7.5)
7.2. Procedures for 6 (Fig. 23.4) 1. Add 50 mM acceptor (1) (240 ml) to the mixture of 500 mM HEPES buffer (pH 7.0, 600 ml), 100 mM MnCl2 (600 ml), 2 wt% BSA (300 ml), 100 mM UDP-Gal (600 ml), 100 mM CMP-Neu5Ac (600 ml), and Milli-Q water (2610 ml). 2. Add 4 U/ml b1,4-GalT (150 ml), 875 mU/ml a2,3-O-SiaT (240 ml), and 3.7 U/ml a2,3-N-SiaT (60 ml) to the mixture and incubate at 25 C for 24 h. Final concentration of the mixture (6 ml) is as follows: 2 mM donor (1), 50 mM HEPES buffer, 10 mM MnCl2, 0.1 wt% BSA, 10 mM UDP-Gal, 10 mM CMP-Neu5Ac, 100 mU/ml b1,4-GalT, 35 mU/ml a2,3-O-SiaT, and 37 mU/ml a2,3-N-SiaT. 3. Apply the solution directly to a RP-HPLC column to obtain 6.
7.3. Procedures for 11 (Fig. 23.5) 1. Add 20 mM acceptor (10) (1250 ml) to the mixture of 500 mM HEPES buffer (pH 7.0, 188 ml), 100 mM MnCl2 (500 ml), 2 wt% BSA (250 ml), 100 mM UDP-Gal (500 ml), 100 mM CMP-Neu5Ac (500 ml), and Milli-Q water (1438 ml). 2. Add 4 U/ml b1,4-GalT (125 ml), 875 mU/ml a2,3-O-SiaT (200 ml), and 3.7 U/ml a2,3-N-SiaT (50 ml) to the mixture and incubate at 25 C for 24 h. Final concentration of the mixture (5 ml) is as follows: 2 mM donor (10), 25 mM HEPES buffer, 10 mM MnCl2, 0.1 wt% BSA, 10 mM UDP-Gal, 10 mM CMP-Neu5Ac, 100 mU/ml b1,4-GalT, 35 mU/ml a2,3-O-SiaT, and 37 mU/ml a2,3-N-SiaT. 3. Pass the reaction mixture through a centrifugal ultrafiltration unit. Wash the retentate with 25 mM HEPES buffer (pH 7.0) thrice and subsequently wash with 25 mM Tris–HCl buffer (pH 7.5) thrice to exchange a buffer. Adjust the volume of the retentate to 2.5 ml with 25 mM Tris–HCl buffer (pH 7.5) as the stock solution of polymer 11 (10 mM, theoretical concentration based on the starting TentaGel resin).
Synthesis of Mucin Glycopeptides
499
8. Chemoselective Polymer Blotting O-Glycopeptide (9) was chemoselectively blotted onto aminooxyfunctionalized polyacrylamide (Fumoto et al., 2005a,b), which was achieved by oxime bond formation between keto group of 9 and aminooxy group of polymer. This reaction proceeded spontaneously in a weak acidic aqueous buffer to give 11 in quantitative yield. Other materials except for 11 contained in the solution were easily removed by ultrafiltration without any tedious chromatographic procedure.
8.1. Materials and equipments 1. 10 mM O-glycopeptide (9) in 50 mM sodium acetate buffer (pH 5.5) 2. 10 mM aminooxy-functionalized polyacrylamide in Milli-Q water 3. Analytical RP-HPLC: Inertsil ODS-3 (250 4.6 mm ID, 5 mm) (GL sciences) 4. 10 K Apollo 20 ml, high-performance centrifugal concentrator (Orbital Biosciences, LLC) (for the ultrafiltration of 10) 5. 25 mM HEPES buffer (pH 7.0)
8.2. Procedures 1. Add 10 mM O-glycopeptide (9) (4.98 ml) to 10 mM aminooxy-functionalized polyacrylamide (60 mmol for aminooxy group) in Milli-Q water (5 ml). 2. Agitate the mixture at ambient temperature for 7 h and conform the completion of the reaction by RP-HPLC analysis. 3. Pass the reaction mixture through a centrifugal ultrafiltration unit. Wash the retentate with 25 mM HEPES buffer (pH 7.0) thrice and adjust the volume to 2.5 ml with 25 mM HEPES buffer (pH 7.0) as the stock solution of polymer 10 (20 mM theoretical concentration based on the starting TentaGel resin).
9. BLase-Catalyzed Cleavage from Supporting Polymer The Phe-Glu moiety of 12 is a good substrate for BLase, therefore the product (8) was efficiently cleaved from supporting polymer of 12. The released 8 was easily separated from polymer by ultrafiltration.
500
Takahiko Matsushita and Shin-Ichiro Nishimura
9.1. Materials and equipments 1. 8 mM stock solution of polymer (12) in 25 mM ammonium acetate buffer (pH 6.5) 2. 1.74 mg/ml BLase (Kakudo et al., 1992) 3. 25 mM ammonium acetate buffer (pH 6.5) 4. 10 K Apollo 20 ml, high-performance centrifugal concentrator (Orbital Biosciences, LLC) (for the ultrafiltration of 9) 5. Semipreparative RP-HPLC: Inertsil ODS-3 (250 10 mm) (GL sciences)
9.2. Procedures 1. Add 1.74 mg/ml BLase solution (8 ml) to 8 mM stock solution of polymer (12) (1.56 ml) and incubate at 25 C for 2 h. 2. Pass the reaction mixture through a centrifugal ultrafiltration unit. Wash the retentate with 25 mM ammonium acetate buffer (pH 6.5) twice and lyophilize the combined permeates. 3. Purify the crude material by semipreparative RP-HPLC to give 9 (4.4% overall yield calculated from the starting TentaGel resin).
10. Compound Characterization by Mass Spectrometry and Amino Acid Analysis 10.1. Materials and equipments 1. 2. 3. 4. 5. 6.
Compounds 1–12 Bruker REFLEX III (for MALDI-TOF MS) Bruker AUTOFLEX II (for MALDI-TOF MS) 2,5-dihydroxybenzoic acid (DHB) as a matrix (for MALDI-TOF MS) JEOL JMS-700TZ (ESI-MS) Applied biosystems Procise491 cLC (for amino acid analysis)
10.2. Characterization data 1. Compound 1: ESI-HRMS: C99H172N27O38 [M þ H]þ calcd (m/z) 2347.2351, found (m/z) 2347.2380. 2. Compound 2: ESI-HRMS: C47H78N15O18 [M þ H]þ calcd (m/z) 1140.5644, found (m/z) 1140.5645. Amino acid ratios (numbers in parentheses are theoretical values): Ala(1) 1.0, Asx(1) 1.0,Gly(2) 2.0, His(1) 1.0, Pro(1) 1.0, Ser(1) 0.9, Thr(1) 0.9, Val(2) 1.9.
Synthesis of Mucin Glycopeptides
501
3. Compound 3: MALDI-TOFMS: C132H220N35O53 [M þ H]þ calcd (m/z) 3143.6, found (m/z) 3143.7. 4. Compound 4: MALDI-TOFMS: C112H190N15O70 [M þ H]þ calcd (m/z) 2865.2, found (m/z) 2865.5. 5. Compound 5: ESI-HRMS: C123H204N20O74 [M þ 4H]4þ calcd (m/z) 1048.0907, found (m/z) 1048.0903. Amino acid ratios (numbers in parentheses are theoretical values): Ala(1) 1.0, Asx(1) 1.0, Gly(2) 1.8, His(1) 0.9, Pro(1) 1.0, Ser(1) 0.8, Thr(1) 0.9, Val(2) 1.8. 6. Compound 6: ESI-HRMS: C99H172N27O38 [M þ H]þ calcd (m/z) 3091.4788, found (m/z) 3091.4778. 7. Compound 7: MALDI-TOFMS: C160H264N37O74 [M þ H]þ calcd (m/z) 3887.8, found (m/z) 3887.7. 8. Compound 8: ESI-HRMS: C236H383N42O130 [M 3H]3 calcd (m/z) 1961.8217, found (m/z) 1961.8214. 9. Compound 9: ESI-HRMS: C119H198N29O44 [M þ 3H]3þ calcd (m/z) 912.4716, found (m/z) 912.4710.
REFERENCES Dwek, R. A. (1996). Glycobiology: Toward understanding the function of sugars. Chem. Rev. 96, 683–720. Fumoto, M., Hinou, H., Matsushita, T., Kurogochi, M., Ohta, T., Ito, T., Yamada, K., Takimoto, A., Kondo, H., Inazu, T., and Nishimura, S.-I. (2005a). Molecular transporter between polymer platforms: Highly efficient chemoenzymatic glycopeptide synthesis by the combined use of solid-phase and water-soluble polymer supports. Angew. Chem. Int. Ed. 44, 2534–2537. Fumoto, M., Hinou, H., Ohta, T., Ito, T., Yamada, K., Takimoto, A., Kondo, H., Shimizu, H., Inazu, T., Nakahara, Y., and Nishimura, S.-I. (2005b). Combinatorial synthesis of MUC1 glycopeptides: Polymer blotting facilitates chemical and enzymatic synthesis of highly complicated mucin glycopeptides. J. Am. Chem. Soc. 127, 11804–11818. Gamblin, D. P., Scanlan, E. M., and Davis, B. G. (2009). Glycoprotein synthesis: An update. Chem. Rev. 109, 131–163. Kakudo, S., Kikuchi, N., Kitadokoro, K., Fujiwara, T., Nakamura, E., Okamoto, H., Shin, M., Tamaki, M., Teraoka, H., Tsuzuki, H., and Yoshida, N. (1992). Purification, characterization, cloning, and expression of a glutamic acid-specific protease from Bacillus licheniformis ATCC 14580. J. Biol. Chem. 267, 23782–23788. Lee, Y. C., and Lee, R. T. (1995). Carbohydrate-protein interactions: Basis of glycobiology. Acc. Chem. Res. 28, 321–327. Lundquist, J. J., and Toone, E. J. (2002). The cluster glycoside effect. Chem. Rev. 102, 555–578. Mammen, M., Choi, S.-K., and Whitesides, G. M. (1998). Polyvalent interactions in biological systems: Implications for design and use of multivalent ligands and inhibitors. Angew. Chem. Int. Ed. 37, 2754–2794. Mao, H., Hart, S. A., Schink, A., and Pollok, B. A. (2004). Sortase-mediated protein ligation: A new method for protein engineering. J. Am. Chem. Soc. 126, 2670–2671.
502
Takahiko Matsushita and Shin-Ichiro Nishimura
Matsushita, T., Hinou, H., Kurogochi, M., Shimizu, H., and Nishimura, S.-I. (2005). Rapid microwave-assisted solid-phase glycopeptide synthesis. Org. Lett. 7, 877–880. Matsushita, T., Hinou, H., Fumoto, M., Kurogochi, M., Fujitani, N., Shimizu, H., and Nishimura, S.-I. (2006). Construction of highly glycosylated mucin-type glycopeptides based on microwave-assisted solid-phase syntheses and enzymatic modifications. J. Org. Chem. 71, 3051–3063. Matsushita, T., Sadamoto, R., Ohyabu, N., Nakata, H., Fumoto, M., Fujitani, N., Takegawa, Y., Sakamoto, T., Kurogochi, M., Hinou, H., Shimizu, H., Ito, T., et al. (2009). Functional neoglycopeptides: Synthesis and characterization of a new class of MUC1 glycoprotein models having core 2-based O-glycan and complex-type N-glycan chains. Biochemistry 48, 11117–11133. Mazmanian, S. K., Ton-That, H., and Schneewind, O. (2001). Sortase-catalysed anchoring of surface proteins to the cell wall of Staphylococcus aureus. Mol. Microbiol. 40, 1049–1057. Proft, T. (2010). Sortase-mediated protein ligation: An emerging biotechnology tool for protein modification and immobilization. Biotechnol. Lett. 32, 1–10. Seko, A., Koketsu, M., Nishizono, M., Enoki, Y., Ibrahim, H. R., Juneja, L. R., Kim, M., and Yamamoto, T. (1997). Occurence of a sialylglycopeptide and free sialylglycans in hen’s egg yolk. Biochim. Biophys. Acta 1335, 23–32.
C H A P T E R
T W E N T Y- F O U R
Synthesis of Glycopeptides Yasuhiro Kajihara, Ryo Okamoto, Naoki Yamamoto, and Masayuki Izumi Contents 1. Introduction 2. Preparation of N-Linked Complex Type Oligosaccharides 2.1. Materials and methods 3. Synthesis of Large Glycopeptides by Use of Efficient Peptide Coupling Method 4. Native Chemical Ligation of Glycopeptide 4.1. Native chemical ligation of sialylglycopeptide-thioester 10 and sialylglycopeptide 11 5. Expanding Scope of Native Chemical Ligation 5.1. Synthesis of 15 (native chemical ligation of sialylglycopeptidethioester 13 and sialylglycopeptide 14) 5.2. Synthesis of 16 (S-methylation of MUC1 repeated glycopeptide 15) 5.3. Synthesis of 17 (CNBr conversion reaction of sialylglycopeptide 16) 5.4. Synthesis of 18 (O to N intramolecular acyl shift and removing methyl ester of sialyl-Tn moiety) 6. Conclusion References
504 504 506 511 511 513 513 516 516 516 517 517 517
Abstract Oligosaccharides in protein play important roles in several biological events. In order to investigate the functions of oligosaccharides of protein, glycoproteins having homogeneous oligosaccharides should be prepared. For this purpose, preparation methods of diverse complex-type oligosaccharides as well as synthetic methods of glycopeptides are essential. This report describes the recent progress in the synthesis of glycopeptides having homogeneous complex-type sialyloligosaccharides. Department of Chemistry, Graduate School of Science, Osaka University, Machikaneyama, Toyonaka, Osaka, Japan Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78024-1
#
2010 Elsevier Inc. All rights reserved.
503
504
Yasuhiro Kajihara et al.
1. Introduction Oligosaccharides linked to proteins as well as peptides are concerned with a number of biological events (Helenius and Aebi, 2001; Varki, 1993). Therefore, much attention is being paid to research on the investigation of the function of these oligosaccharides. In terms of posttranslational modification, attaching of oligosaccharides to the proteins is thought to have a large effect on the protein function. Oligosaccharides of glycoprotein are roughly divided into two groups, O-linked and N-linked types. In the case of the O-linked type, small oligosaccharide attaches to the alcohol of serine or threonine by an N-acetyl-a-D-galactosaminyl linkage (Varki et al., 2008). On the other hand, the N-linked type exhibits large and branched structures, which are further divided into three types: complex, hybrid, and high-mannose types, and all oligosaccharides are linked to the asparagine side chain by an N-glycosyl linkage (Varki et al., 2008). In order to investigate the function of these oligosaccharides, synthetic glycopeptides have been used for biological experiments. Therefore, a convenient synthetic method for N-glycan and its glycopeptide should be developed. Individual synthetic techniques in the synthesis of N-linked glycopeptides and proteins are divided into four categories: synthesis of oligosaccharides, attaching of oligosaccharide with asparagine, solid-phase glycopeptide synthesis, and coupling of two glycopeptides for glycopeptide as well as glycoprotein synthesis. In terms of the preparation of oligosaccharides, several reviews have introduced commendable synthetic methodologies. In this report, we would introduce our recent progress in the synthesis of glycopeptides having homogeneous complex-type oligosaccharides.
2. Preparation of N-Linked Complex Type Oligosaccharides For the synthesis of glycopeptides having complex type oligosaccharide, appropriate amount of oligosaccharide is essential. Ito (Dan et al., 1998) and Unverzagt (Weiss and Unverzagt, 2003) groups have developed highly efficient synthetic methods of these oligosaccharides. However, synthesis of these oligosaccharides is time consuming. It is known that sialylglycopeptide 1 is available in multigram quantities from eggs (Kajihara et al., 2004; Seko et al., 1997). If the sialyloligosaccharide of 1 could be used for solid-phase chemical synthesis of sialylglycopeptides, the synthesis of sialylglycopeptides, which is essential for the synthesis of large glycopeptides through native chemical ligation (NCL; vide infra), would be advanced. The sialylglycopeptide 1 can be converted into asparaginyl-
505
Glycopeptide Synthesis
sialyloligosaccharide 2 followed by protection with 9-fluorenylmethyloxycarbonyl (Fmoc) group to obtain 3 (Kajihara et al., 2004). However, this Asn-linked oligosaccharide 3 contains three carboxyl acid groups. Therefore, selective protection of the sialic acid carboxyl group would be essential to avoid undesired amide condensations during solid-phase glycopeptide synthesis. Fortunately, benzyl esterification afforded desired Fmocasparaginyl-oligosaccharide 4 (Scheme 24.1; Kajihara et al., 2004). This Fmoc-asparaginyl-oligosaccharide 4 can be used for the synthesis of glycopeptides 5 and 6 (Scheme 24.2; Yamamoto et al., 2007) as well as for glycopeptide-athioester 9 (Scheme 24.3; Kajihara et al., 2006). In terms of glycopeptide-athioester 9, side chain protected glycopeptide was obtained by use of acid labile 4-(hydroxymethyl-3-methoxyphenoxy)butylic acid linker (HMPB) and then the C-terminal carboxylic acid was converted into thioester under the condition using benzotriazol-1-yl-oxy-trispyrrolidinophosphonium hexafluorophosphate (PyBOP), N,N-diisopropylethylamine (DIPEA), and benzyl mercaptan (BnSH) at –20 C. This condition successfully afforded glycopeptide-athioester 9 (Kajihara et al., 2006).
R⬘
O C
HO
HO
HO HO AcHN HO
O HO
O
O
HO O OH HO
NHAc
HO HO O HO HO HO AcHN
R⬘ C
O HO
O HO
HO O HO OH
O O OH O O
O HO
O
HO
HO
O
O HO HO HO
HO O
OH O
O HO NHAc
OH O
R
NHAc
O
O
NHAc
1 = OH, R⬘ = K-V-A-N(oligosaccharide)-K-T 2 = OH, R⬘ = Asn 3 = OH, R⬘ = Fmoc-Asn 4 = OBn, R⬘ = Fmoc-Asn
Scheme 24.1 Preparation of N-linked complex-type oligosaccharide. Fmoc-OSu, 9-fluorenylmethyl-N-succinimidyl carbonate; BnBr, benzyl bromide.
506
HMPA
Yasuhiro Kajihara et al.
PEGA resin
(1) Fmoc-AA-OH, MSNT, N-methylimidazole (2) 20% piperidine (1) Fmoc-AA-OH, DIC, HOBt (2) 20% piperidine (1) 4, DEPBT, DIPEA (2) 20% piperidine (1) Fmoc-AA-OH, DIC, HOBt (2) 20% piperidine
R-O HO
GP-120 (106–114)
OH O
O
N H NHAc
Asn-Asp-Thr-Asn-Thr-Asn-Ser-Ser-Ser
5 R-O HO
GP-120 (102–110)
O
OH O
N H NHAc
Thr-Asn-Leu-Lys-Asn-Asp-Thr-Asn-Thr
6 R=
95% TFA, 2.5% TIPS, 2.5% H2O
OH O C HO HO HO O O HO HO AcHN HO
O HO O OH HO
50 mM NaOH aq, pH 11 RP-HPLC purification HO
Sialylglycopeptide 5 and 6
O HO
C
HO
HO AcHN
O HO
OH HO O HO
NHAc O HO HO HO HO O
O HO HO O O
HO O O HO OH
O O O OH O O HO
OH O NHAc
NHAc
Scheme 24.2 Synthesis of sialylglycopeptides. HMPA, 4-hydroxymethyl-3-methoxyphenylacetic acid; MSNT, 1-mesitylenesulfonyl-3-nitro-1,2,4-triazole; DIC, N,N0 diisopropylcarbodiimide; HOBt, 1-hydroxybenzotriazole; DEPBT, 3-(diethoxyphosphoryloxy)-1,2,3-benzotriazin-4(3H)-one; DIPEA, N,N-diisopropylethylamine; TFA, trifluoroacetic acid; TIPS, triisopropylsilane.
2.1. Materials and methods Actinase-E was purchased from Kaken Pharmaceutical Co. Ltd. (Osaka, Japan). 4-Hydorxymethyl-3-methoxyphenoxyacetic acid–poly[acryloyl-bis (aminpropyl)-polyethylene glycol] (HMPA–PEGA) resin and Fmoc-AAOH was purchased from Merck (USA). 2.1.1. Synthesis of asparagines-linked sialyloligosaccharide 2 To a solution of pure sialylglycopeptide 1 (60 mg) and NaN3 in Tris–HCl buffer (50 mM, 10 mM CaCl2, pH 7.5, 3 mL) was added Actinase-E (9 mg), and this mixture was incubated for 7 days at 37 C. During incubation, pH of the solution was kept at 7.5. The reaction was monitored by TLC (1 M NH4OAc:2-propanol ¼ 1:1). After completion of this reaction, the mixture was lyophilized and purification of the residue by gel permeation chromatography (Sephadex-G-25, F 20 200 mm, H2O) afforded asparagine-linked sialyloligosaccharide 2 (42 mg, 86%); 1H NMR (400 MHz, 30 C in D2O, HOD ¼ d 4.81) d 5.21 (s, 1H, Man4-H-1), 5.15 (d, 1H, J ¼ 9.5 Hz, GlcNAc1-H-1), 4.03 (s, 1H, Man40 -H-1), 4.86 (s, 1H, Man3H-1), 4.70 (m, 3H, GlcNAc2,5,50 -H-1), 4.53 (d, 2H, J ¼ 8.0 Hz, Gal6,60 H-1), 4.34 (bs, 1H, Man3-H-2), 4.28 (bd, 1H, Man4-H-2), 4.20 (bd, 1H,
507
Glycopeptide Synthesis
OMe HO
H N
HMPB–PEGA resin O (1) Fmoc-Ser(tBu)-OH, MSNT, N-Methylimidazole (2) 20% Piperidine O
(1) Fmoc-AA-OH, DIC, HOBt AA = Thr(tBu), Glu(tBu), Thr(tBu), Asn (2) 20% Piperidine (1) 4, DEPBT, DIPEA (2) 20% Piperidine (1) Fmoc-AA-OH, DIC, HOBt AA = Ser(tBu), Gly, Glu(tBu), Thr(tBu) (2) 20% Piperidine HOAc, trifluoroethanol (1:1) R
7: R = OH 8: R = SBn
O
PyBOP, DIPEA, BnSH MS4A, DMF
O-t-Bu
HN t-Bu-O
O NH
O-t-Bu
O HO HO
O
COOBn HO HO O O AcHN O HO HO HO O OH HO
HN t-Bu-O
NHAc
O
O O HO O
HO HO
COOBn
HO
HO AcHN
O HO
HO O HO
OH O
O HO
O
HO HO O
HO O O HO OH
O NH O
O
O HO HO HO
OH O
O HO NHAc
NH2
HN
OH H O N
O NH
NHAc O O
O-t-Bu
HN
O
O
NHAc
O-t-Bu
NH O
O
HN
t-Bu-O
O NH-Boc
95% TFA, 2.5% TIPS, 2.5% H2O
SBn O
OH
HN HO
O NH
OH
O O
HO HO
COOBn HO HO O O AcHN O HO HO HO O OH HO
HN
O HO HO HO
NH O
O
HO O
HO COOBn
HO
HO AcHN
O HO
HO O HO
OH O
O HO
HO O
OH O
O HO
NHAc
O
HO HO O O HO OH
O
O O
HO
O
HO NHAc
NHAc
NH2
HN
OH H O N
O NH OO
OH
HN
O
O
NHAc
NH
9
OH
O O
HN HO
O NH2
Scheme 24.3 Synthesis of glycopeptide-athioester. HMPB, 4-(4-hydroxymethyl-3methoxyphenoxy)butylic acid; tBu, tert-butyl; PyBOP, benzotriazol-1-yl-oxy-trispyrrolidinophosphonium hexafluorophosphate; BnSH, benzyl mercaptan.
508
Yasuhiro Kajihara et al.
Man40 -H-2), 3.03 (dd, 1H, J ¼ 4.4 Hz, 17.2 Hz, Asn-bCH2), 2.95 (dd, 1H, J ¼ 7.0 Hz, 17.2 Hz, Asn-bCH2), 2.76 (bdd, 2H, J ¼ 4.6 Hz, 12.4 Hz, NeuAc7,70 -H-3eq), 2.16 (s, 3H, Ac), 2.15 (s, 6H, Ac 2), 2.28 (s, 6H, Ac 2), 2.10 (s, 3H, Ac), 1.80 (dd, 2H, J ¼ 12.4 Hz, 12.4 Hz, NeuAc7,70 -H-3ax). 2.1.2. Synthesis of Fmoc-sialyloligosaccharide 3 To a solution of asparagine-linked sialyloligosaccharide 2 (80 mg, 0.034 mmol) and NaHCO3 (11.5 mg, 0.137 mmol) in H2O–acetone (2.7– 4.1 mL) was added a solution of 9-fluorenylmethyl-N-succinimidyl carbonate (34.7 mg, 0.103 mmol) in acetone (4.1 mL) and the mixture was stirred at room temperature. After 2 h, the mixture was evaporated to remove acetone and purification of the remained solution containing sialyloligosaccharide by ODS-column (F 16 140 mm, H2O to 20% MeOH) afforded Fmocsialyloligosaccharide 3 (60.1 mg, 68%); 1H NMR (400 MHz, 30 C in D2O, HOD ¼ d 4.81) d 8.01 (d, 2H, J ¼ 7.5 Hz, Fmoc), 7.80(d, 2H, J ¼ 7.5 Hz, Fmoc ), 7.60 (dd, 2H, J ¼ 7.5 Hz, Fmoc), 7.53 (dd, 2H, J ¼ 7.5 Hz, Fmoc), 5.22 (s, 1H, Man4-H-1), 5.09 (d, 1H, J ¼ 9.4 Hz, GlcNAc1-H-1), 5.03 (s, 1H, Man40 -H-1), 4.86 (s, 1H, Man3-H-1), 4.69 (m, GlcNAc2,5,50 -H-1), 4.53 (d, 2H, J ¼ 7.8 Hz, Gal6, 60 -H-1), 4.44 (1H, Fmoc), 4.34 (bd, 1H, Man3-H-2), 4.29 (bd, 1H, Man4-H-2), 4.20 (bd, 1H, Man40 -H-2), 2.83–2.72 (m, 3H, Asn-bCH2, NeuAc7,70 -H-3eq), 2.61 (bdd, 1H, Asn-bCH2), 2.15 (s, 9H, Ac 3), 2.12 (s, 6H, Ac 2), 1.98 (s, 3H, Ac), 1.80 (dd, 2H, J ¼ 12.1 Hz, 12.1 Hz, NeuAc7,70 -H-3ax); HRMS calcd for C103H154N8NaO66 [M þ Naþ] 2581.8838; found 2581.8821. 2.1.3. Synthesis of dibenzyl-sialyloligosaccharide 4 A solution of Fmoc-disialyloligosaccharide 3(20 mg)in cold H2O (2 mL, 4 C) was passed through a column (F 5 50 mm) of Dowex-50WX8 (Hþ form). The eluant was pooled and lyophilized. A solution of the residue in H2O was neutralized by addition of a solution of aq. Cs2CO3 (2.5 mg/ 1 mL), and the solution was adjusted to pH 6 and lyophilized. To a solution of the residue in dry DMF (1.3 mL) was added BnBr (5.1 mL) and the mixture was stirred at room temperature under argon atmosphere. After 45 h, diethyl ether (10 mL) was added to the solution and precipitate was collected. Purification of the residue by ODS-column (F 16 140 mm, H2O to 40% MeOH) afforded dibenzyl-sialyloligosaccharide 4 (18.2 mg, 85%); 1H NMR (400 MHz, 30 C in D2O, HOD ¼ d 4.81) d 8.00 (d, 2H, Fmoc), 7.80 (d, 2H, Fmoc), 7.65–7.50 (m, 12H, Ph, Fmoc), 5.46 (d, 2H, J ¼ 11.6 Hz, PhCH2), 5.40 (d, 2H, J ¼ 11.6 Hz, PhCH2), 5.21 (s, 1H, Man4-H-1), 5.08 (d, 1H, J ¼ 9.3 Hz, GlcNAc1-H-1), 5.02 (s, 1H, Man40 H-1), 4.86 (s, 1H, Man3-H-1), 4.67 (m, 3H, GlcNAc2,5,50 -H-1), 4.41 (bd, 3H, Gal6, 60 -H-1, Fmoc), 4.33 (bd, 1H, Man3- H-2), 4.27 (bd, 1H, Man40 -H-2), 4.20 (d, 1H, Man4- H-2), 2.79 (bd, 3H, Asn-bCH2,
Glycopeptide Synthesis
509
NeuAc7, 70 -H3eq), 2.61 (bdd, 1H, Asn-bCH2), 2.15 (s, 3H, Ac), 2.12 (s, 6H, Ac 2), 2.10 (s, 6H, Ac 2), 1.98 (s, 3H, Ac), 1.93 (2H, dd, J ¼ 12.2, 12.2 Hz, NeuAc7,70 -H-3ax); HRMS calcd for C117H165 N8Na2O66[M þ Naþ] 2783.9597; found 2783.9501. 2.1.4. NDTNTN(sialyloligosaccharide)SSS 5 The synthesis was performed by manual Fmoc procedure using a polypropylene column (Tokyo Rika, No. 183470) and HMPA–PEGA resin (10 mmol scale). The first amino acid, Fmoc-Ser(tBu)-OH (12 mg, 30 mmol), was attached quantitatively to the resin using 1-mesitylenesulfonyl-3-nitro-1,2,4-triazole (MSNT) (9.0 mg, 30 mmol) and N-methylimidazole (2.0 mg, 28 mmol) in CH2Cl2 (120 mL). The resin was washed with DMF and was treated with 20% piperidine in DMF for removal of Fmoc group. Peptide elongation (S, S) was performed with N,N0 -diisopropylcarbodiimide (DIC: 6.5 mg, 50 mmol), 1-hydroxybenzotriazole (HOBt: 6.0 mg, 50 mmol) in DMF (125 mL) for 1.0 h. A part of this resin (SSS– HMPA–PEGA) was used for the introduction of Fmoc-Asn(sialyloligosaccharide)-OH 4. To the resin corresponding to 1 mmol scale, Fmoc-Asn (sialyloligosaccharide)-OH 4 (5.4 mg, 2.0 mmol) was introduced using 3-(diethoxy-phosphoryloxy)-1,2,3-benzotriazin-4(3H)-one (DEPBT: 0.9 mg, 3.0 mmol) and DIPEA (0.26 mg, 2.0 mmol) in DMF (60 mL) for 24 h. Further peptide elongation was performed with DIC (0.65 mg, 5.0 mmol), HOBt (0.6 mg, 5.0 mmol) in DMF (125 mL) for 1.0 h. Deprotection of Fmoc group on each amino acid elongation was performed with 20% piperidine in DMF for 20 min. Final cleavage/deprotection step to obtain a desired glycopeptide was performed by a solution containing 95% trifluoroacetic acid (TFA), 2.5% triisopropylsilane (TIPS), and 2.5% H2O for 2 h. The filtrate from the cleavage reaction was evaporated in vacuo. After lyophilization of this residue, saponification of benzyl esters by 50 mM NaOH solution (500 mL, pH 11) afforded crude sialylglycopeptide 5. This saponification was performed in a NMR tube and monitored by 1H NMR. After neutralization of this mixture by acetic acid, the mixture was lyophilized. Purification of the residue by RP-HPLC with Mightysil RP-18 (F 10 250 mm, linear gradient of 4.5% ! 67.5% CH3CN in 0.1% TFA aq. over 30 min) at a flow rate of 2.0 mL/min afforded the desired sialylglycopeptide 5 (1.0 mg, 32% yield based on the first serine attached); 1 H NMR (400 MHz, 296 K in D2O) d 5.14 (bs, 1H, Man4-H-1), 5.05 (d, 1H, GlcNAc1-H-1), 4.96 (s, 1H, Man40 -H-1), 4.884.81 (m, 3H, Asn-a H 2, Asp-aH), 4.62 (m, 3H, GlcNAc2, 5, 50 -H-1), 4.57 (m, 2H, Ser-a H), 4.50 (dd, 1H, Ser-aH), 4.46 (bd, 2H, Gal6, 60 -H-1), 4.394.34 (m, 3H, Thr-aH 2, Asn-aH), 4.294.25 (m, 3H, Thr-bH 2, Man3-H2), 4.21 (bs, 1H, Man4-H-2), 4.13 (bs, 1H, Man40 -H-2), 3.072.78 (m, 8H, Asn-bH 3, Asp-bH), 2.66 (m, 2H, NeuAc7, 70 -H-3 eq), 2.10 (s, 3H, Ac), 2.09 (s, 3H, Ac), 2.07 (s, 3H, Ac), 2.04 (s, 6H, Ac 2), 2.01
510
Yasuhiro Kajihara et al.
(s, 3H, Ac), 1.81 (m, 2H, NeuAc7, 70 -H-3ax), 1.241.18 (m, 6H, Thr-g CH32); ESI-MS: m/z calcd for [M þ 2H]2þ 1573.4, [M þ 3H]3þ 1049.3; found 1573.9, 1049.3. 2.1.5. TDNKN(sialyloligosaccharide)DTNT 6 The synthesis was performed by the same procedure in the preparation of 5. The desired sialylglycopeptide 6 (1.5 mg, 46% yield based on first threonine attached) was obtained; 1H NMR (400 MHz, 296 K in D2O) d 5.14 (s, 1H, Man4-H-1), 5.04 (d, 1H, GlcNAc1-H-1), 4.96 (s, 1H, Man40 -H-1), 4.834.65 (m, 4H, Asn-aH 3, Asp-aH), 4.61 (bd, 3H, GlcNAc2,5,50 H-1), 4.45 (bd, 2H, Gal6,60 -H-1), 4.344.25 (m, 4H, Thr-aH 2, Thr-b H, Lys-aH, Man3-H2), 4.21 (bs, 1H, Man4-H2), 4.17413 (m, 3H, Thr-a H, Thr-bH, Man40 -H2), 3.01 (dd, 2H, Lys-eCH2), 2.922.56 (m, 10H, Asp-bCH2 2, Asn-bCH2 2, NeuAc7,70 -H-3 eq), 2.082.02 (18H, Ac 6), 1.891.59 (m, 6H, Lys-bCH2, Lys-dCH2, NeuAc7, 70 -H-3ax), 1.43 (m, 2H, Lys-gCH2), 1.32, 1.22, 1.17 (each d, each 3H, Thr-bCH2), 0.95, 0.89 (each d, each 3H, Leu-bCH3); ESI-MS: m/z calcd for [M þ 2 H]2þ 1614.5, [M þ 3H]3þ 1076.7; found 1614.2, 1076.2. 2.1.6. Solid-phase synthesis of sialylglycopeptide-thioester 9 Each synthesis of the sialylglycopeptide having protecting groups on amino acid side chain was performed by a manual Fmoc procedure using a polypropylene column (Tokyo Rika, No. 183470) and HMPB–PEGA resin (1 mmol scale). The first amino acid (3 equiv) was attached to the resin using MSNT (3.0 equiv) and N-methylimidazole (2.75 equiv) in CH2Cl2 (250 mM). Peptide elongation was performed with DIC (5.0 equiv), HOBt (5.0 equiv) in DMF (0.4 M) for 1.0 h until attaching 4 to the peptide-resin. Fmoc-Asn (sialyloligosaccharide)-OH 4 (2.0 equiv) was coupled with peptide-resin employing 3-(diethoxy-phosphoryloxy)-1,2,3benzotriazin-4(3H)-one (DEPBT: 3.0 equiv) and DIPEA (2.0 equiv) in DMF (30 mM). After introduction of 4 to the peptide-resin, the peptide was elongated using DIC and HOBt. For this elongation, the concentration of each Fmoc-amino acid was arranged to be 0.04 M in DMF in order to avoid unexpected esterification toward hydroxyl groups on the oligosaccharide. Deprotection of Fmoc group was performed with 20% piperidine in DMF for 20 min. After construction of glycopeptide, a glycopeptide 7 in which peptide side chains were protected was released from the resin by use of acetic acid:trifluoroethanol (1:1, 2.0 mL) and this treatment was repeated twice. The trifluoroethanol solution was concentrated in vacuo. The residue containing a crude glycopeptide 7 was dissolved in DMF and then concentrated by coevaporation three times. To a solution of this crude glycopeptide 7 in DMF (0.1 mL, 4 mM) was added molecular sieves 4 A˚ (10 mg) and BnSH (30 equiv), and then the mixture was stirred at 20 C. After 1 h, PyBOP (5 equiv) and DIPEA (5 equiv) were added to the mixture and
Glycopeptide Synthesis
511
the mixture was stirred at 20 C. After 4 h, the solution was filtered and ether (3.0 mL) was added to the filtrate to give a precipitate of glycopeptidethioester 8. The precipitate was collected by centrifugation. To the precipitate was added a solution containing 95% TFA, 2.5% TIPS, and 2.5% H2O to remove protecting groups for 2 h, and the solution was concentrated in vacuo. Purification of the residue by RP-HPLC afforded the desired sialylglycopeptide-thioester 9 (0.3 mg, 22%).
3. Synthesis of Large Glycopeptides by Use of Efficient Peptide Coupling Method In order to develop glycopeptide synthetic methods for large glycopeptides, synthetic methods for protein should be combined. In the synthesis of protein, Dawson and Kent established NCL (Dawson et al., 1994). This coupling reaction occurs between a-thioester at the C-terminal in peptide segment-A and the cysteine residue at the N-terminal of another peptide segment-B to afford native amide linkage through thioester exchange reaction. This reaction was applied to the synthesis of glycopeptide having two complex-type sialyloligosaccharides (Yamamoto et al., 2007). The CTLA-4 fragment (113–150) 12 (Scheme 24.4), which originally has two oligosaccharides at Asn-113 and Asn-145, was selected as a target compound. The sequence of the target fragment CTLA-4 (113–150) 12 was divided into two segments, 10 and 11, at Ile-128/Cys-129, which was chosen as a ligation site. However, it had been known that NCL reaction between Ile and Cys does not proceed effectively. Therefore, in this case, an isoleucine (Ile-128) was substituted with an alanine. The synthetic plan was to synthesize sialylglycopeptides 10 and 11, by a manual Fmoc solid-phase synthetic method employing our established conditions, and then to ligate both sialylglycopeptides by NCL reaction. The solid-phase synthesis of the CTLA-4 fragment (129–150) 11 was performed on the HMPA–PEGA resin (2.0 mmol scale) using the Fmoc method, as mentioned in Scheme 24.2. Fmoc method was also employed for the synthesis of peptide-athioester 10. As far as extensive studies, synthesis of glycopeptide-athioester was optimized by use of the condition described in Scheme 24.3 (Yamamoto et al., 2007).
4. Native Chemical Ligation of Glycopeptide The synthesized sialylglycopeptides, 10 and 11, thus obtained were then applied to NCL reaction (Scheme 24.4). The sialylglycopeptide 11 and the sialylglycopeptide-athioester 10 were dissolved in 0.1 M phosphate
512
OH
OH OH
HO
O
O
OH
HO Ac HN
OH
HO Ac HN HO
Yasuhiro Kajihara et al.
O
O
HN
OBn HO O
OH O
OB n
HO O
O
OH
OH
HO
O
NH
Ac HN
O HO O O
O
HO O O O HO
Ac HN
HO HO
O
HO AcHN
O
OBn
NH2
C
HN
HO O HO
HO
O NHAc
O HO O OH HO
O
HO O
O
O HO HO HO
O OH O
O
OH
HO O
HO
O
HO Ac HN
OH
O
HO
HO
O
OBn C HO O HO
O HO
O
HO O
HO O HO
OH O
NHAc
O NH O O
O
HN O
NHAc
OH
NH
O
O OH H2 N
NH O
HO O
H N
H N
N H
H2 N
O
O
HN
HO
O
O
O
O
O
H N
N H
NH
HN
OH H O N
O HO NHAc
O HO
O
HO
HO O
Ac HN
O
O
O
O HO OH OH O HO HO HO OH OH HO O NHAc
HO
H N
N H
O
O
O
O
OH H N
O
H N
N H
N H
S
O N H
O
OH
O
H N O
O
H N N H
HN
O
O O
HN H2 N
NH
O HO
S CH2 CH2 CONH2
NH
OH
O
NH
N
HO O
HS
O
O
H N
N H
H 2N
10
O
H N
O
N
O
H N
N H
O
N
N H
O
O
11
S
OH
NH 2
1) 6M Gn/HCl, 0.1 M phosphate buffer (pH7.6), PhSH, BnSH 2) Purification 50 mM NaOH
H2 N HO O
O H N
H2N
H N
N H
N H
O
O HN
O
H N O
O
H N
N H
O
O
H N
N H
OH H N
O N H
O
O
O
H N
N H
O
OH
H N
N H
O
HO OH O
O
O O OH O O OH O
O
OH O OH OH OH OH O
Ac HN
HO
OH
O HO
O OH HO O O
OH
NHAc
OH O OH OH O
HO
O OH
O O
OH
HO O
OH O
HO
HO
HO HO HO
OH HO OH
O
O
N
O
NHAc
N O
O HO O HO O O O
N HO O
OH O
NHAc OH
HN O
O HO
HO
OH Ac HN
CTLA-4 (113−150) 12
HOO
HN O
O HO
H N
N H
N H
O O
O OH O
O
O
OH
NH
H N
OH
NH
O
Ac HN
O
O
O O
Ac HN
S
NH
O OH HO
O HO
O
HN
HO
OH
HO O
NHAc OH
HO
O
OH OH
OH O OH HO O OH O HO
OH
HO
NH OH
O
HO HO Ac HN
O
O
OH OH
Ac HN
O
NH
O
H2 N
NHAc
HO
O
NH
OOH O
NH O
HN H2 N
HO
O HS N H
O
S
HN
NHAc
HO O
HO
O
O
NH
NH
H N O
N H
H N O
O
O HO
O
HO
Scheme 24.4 Synthesis of large glycopeptide by native chemical ligation. Gn, guanidine; PhSH, thiophenol.
Glycopeptide Synthesis
513
buffer (pH 7.6) containing 6 M guanidineHCl, 1% (v/v) BnSH, and 1% (v/v) thiophenol (PhSH). The final concentrations of sialylglycopeptides 10 and 11 were 1 and 2 mM, respectively. The reaction was performed at 37 C and this ligation reaction afforded a ligated product. Purification of the mixture by RP-HPLC afforded the pure ligation product, and the product was subsequently treated with 50 mM NaOH to remove the benzyl groups of NeuAcs. As a result, the desired product, CTLA-4 fragment (113–150) 12, was obtained in excellent purity.
4.1. Native chemical ligation of sialylglycopeptide-thioester 10 and sialylglycopeptide 11 Sialylglycopeptide 11 (0.2 mg, 40 nmol) and sialylglycopeptide-thioester 10 (0.34 mg, 80 nmol) were dissolved in 0.1 M phosphate buffer (pH 7.6) containing 6 M guanidineHCl (50 mL). To the solution, 1% (v/v) BnSH and 1% (v/v) PhSH were added to start the NCL reaction. The reaction was performed at 37 C for 25 h. Direct purification of the reaction mixture by RP-HPLC with Cadenza CD-18 (F 4.6 75 mm, linear gradient of 18% ! 72% CH3CN containing 0.09% TFA in 0.1% TFA aq. over 30 min) at a flow rate of 1.0 mL/min afforded the desired product in good purity. Then, this compound was treated with 50 mM NaOH (50 mL) for 15 min at room temperature. After neutralization of the reaction mixture by 50 mM acetic acid (50 mL), purification of the mixture by RPHPLC with Cadenza CD-18 (F 4.6 75 mm, linear gradient of 18% ! 72% CH3CN containing 0.09% TFA in 0.1% TFA aq. over 30 min) afforded sialylglycopeptide 12 (ca 20%) in high purity. The yield (20%) was estimated by the peak area corresponding to 12 on HPLC profile; ESI-MS: m/z calcd for [M þ 3H]3þ 2883.2, [M þ 4H]4þ 2162.7; found 2883.2, 2162.7. MALDI-MS: m/z calcd for [M þ H]þ 8652.85; found 8654.76.
5. Expanding Scope of Native Chemical Ligation NCL using cysteine residues has been successfully used for the synthesis of large glycopeptides. However, occasionally the cysteine residue is not properly located or does not exist in the target proteins. In order to overcome this potential difficulty, a reduction method, which changes the sulfhydryl group of cysteine to hydrogen atom after NCL and the utilization of an auxiliary group having sulfhydryl group, has been developed (Botti and Tchertchian, 2006; Brik et al., 2006; Canne et al., 1996; Chen et al., 2006; Crich and Banerjee, 2007; Kawakami et al., 2001; Low et al., 2001; Macmillan and Anderson, 2004; Offer et al., 2002; Pentelute and Kent,
514
Yasuhiro Kajihara et al.
2007; Wan and Danishefsky, 2007; Yan and Dawson, 2001). In addition to these improved NCL, we found a new strategy in which a serine site was used for the ligation position. Serine residues are frequently found in the peptide backbone as well as in the consensus sequence (NXS), where an asparagine residue is generally incorporated along with the N-linked oligosaccharides. In order to use the serine site for NCL, a new ligation concept employing the conversion of a cysteine residue to a serine residue after NCL was developed. During extensive studies we fortunately found suitable conditions employing the CNBr activation toward methyl cysteine site, which was obtained by specific cysteine methylation (Gross and Morell, 1974). The strategy is shown in Fig. 24.1. After NCL between peptidethioester and peptide having cysteine at the N-terminal (A), the conversion of the cysteine to serine was performed by a series of reactions, S-methylation of the cysteine with methyl 4-nitrobenzenesulfonate (B), and intramolecular rearrangement by CNBr activation in TFA solution (C), and an O- to N-acyl shift (D). Activation of the S-methyl group by CNBr resulted in the intramolecular attack of the neighboring carbonyl oxygen to the b-carbon of the methyl cysteine residue and an O-ester peptide intermediate was generated (C). This intermediate was converted into the desired peptide through spontaneous O- to N-acyl shift under a slightly basic condition (pH 7–8) (Okamoto and Kajihara, 2008). This newly developed ligation method was applied to several peptide sequences as well as an N-linked glycopeptide. In Scheme 24.5, synthesis of repetitive glycopeptide form having two sialyl-Tn antigens is shown (Okamoto et al., 2009).
A H2N
Peptide 1
SR'
+
R
H2N
Peptide 1
OH
Peptide 1
S R
O
H2N
OH
Peptide 2
N H
R
H2N
O
H N
SH
O
H N
B
HS
O
H N
H2N
Peptide 1
N H
R
C
SMe
O
H N
O
O
Peptide 2
OH
O
D CN +
O
H N
N H
R
H2N
Peptide 1
SMe
NH R H O H
O
O+ N H
NH O R O N+ H H2
O
O
O
H N
O R H2N
Peptide 2
OH
H2N
Peptide 1
OH
O
H N R
N H
Peptide 2 O
O
Figure 24.1 Expanding scope of native chemical ligation (NCL).
OH
515
Glycopeptide Synthesis
HO OH COOR' HO O AcHN HO OH O
O N N O HN
HO OH COOR′ HO O AcHN HO OH O
HN O
N N H
O
O HO NH O HN H2N O NH HO O O N O O AcHN HN + N NH O HN BnS O O O O N H O N HN H HO NH N NH O O O O H2N OH HN COOH O HN OH H O O O O N N N N N H O H HO N
13
HN H2N C NH
HN
O
NH O O HN O
O N
N
NH H2N C NH 14
HO OH COOR' HO O AcHN HO OH O
O HN
HN O
O
N O
HO NH O
HO
NH O
N H
HN
O
O
HOOC
AcHN
NH O O O HN O
HN NH O HO O R N O O AcHN O HN O N NH HN O O O O N HN O H HN HO NH NH O O N O O OH H2N HN COOH HN O O OH H O O O N N N N N H O H HO
Sequence of 18 (STAPPAHGVT(Sialyl-Tn)SAPDTRPAPG)2
N O HN O
COOH O H O N N H N O H HO
NH O HN OH O
N
O
HOOC N H
6 M Gn / HCl, 0.2M phosphate buffer, 20 mM TCEP, MPAA (1% v / v) (pH 7.2)
N
N
O
O
AcHN
SH
O
HO OH COOR' HO O AcHN HO OH O
HO
NH O
O
NH O HN OH O
O N
N H
COOH O H O N N H N O HO H
N O HN O N
NH H2N C NH
HN H2N C NH SH Tris buffer (pH 8.6), CHCN3, methyl 4-nitrobenzenesulfonate
R′ = Me
15: R = HN SMe
16: R =
R′ = Me
HN CNBr, TFA (2% v / v), 40% CH3CN/ H2O
R′ = Me
17: R = H2N
Dilute NaOH
18: R =
O OH
R′ = H
HN
Scheme 24.5 Synthesis of Sialyl-Tn glycopeptide. TCEP, tris(2-carboxyethyl)phosphine; MPAA, 4-mercaptophenylacetic acid.
516
Yasuhiro Kajihara et al.
5.1. Synthesis of 15 (native chemical ligation of sialylglycopeptide-thioester 13 and sialylglycopeptide 14) Sialylglycopeptide-athioester 13 (5.0 mg, 2.0 mmol) and sialylglycopeptide 14 (4.8 mg, 2.0 mmol) were dissolved in 0.2 M sodium phosphate buffer (pH 7.2, 1.0 mL) containing 6 M guanidineHCl, 20 mM tris(2-carboxylethyl) phosphine and 1.0% (v/v) 4-mercaptophenylacetic acid. The mixture was stirred for 12 h. Purification of the mixture by RP-HPLC (C8 column, 5 mm, F 10 250 mm, linear gradient of 9 ! 36% CH3CN containing 0.1% TFA in 0.1% TFA aq. over 30 min at a flow rate of 4.0 mL/min) afforded MUC1 glycopeptide having two sialyl-Tn 15 (7.6 mg, 81%). ESIMS: calcd for C200H317N54O80S [M þ 3H]3þ 1597.3, [M þ 4H]4þ 1198.3, [M þ 5H]5þ 958.8; found 1597.3, 1198.1, 958.7.
5.2. Synthesis of 16 (S-methylation of MUC1 repeated glycopeptide 15) Compound 15 (6 mg, 1.25 mmol) was dissolved in 0.25 M Tris buffer (pH 8.6, 1.25 mL) containing 6 M guanidineHCl, 3.3 mM EDTA-2Na. To the mixture was added a solution of methyl 4-nitrobenzenesulfonate (8.1 mg, 67.5 mmol) in CH3CN (416 mL) and the solution was stirred for 40 min. The mixture was neutralized by 10% TFA solution (0.10 mL) and the solution was concentrated in vacuo to remove organic solvent. Purification of the residue to remove excess amount of salts by RP-HPLC (C18 column, 5 mm, F 4.5 250 mm, isocratic flow of 0.1% TFA aq. for 10 min then linear gradient of 9 ! 36% CH3CN containing 0.1% TFA in 0.1% TFA aq. over 30 min at a flow rate of 1.0 mL/min) afforded the desired product 16 (5.5 mg, 90% isolated yield). This material was used in the next step without further purification. ESI-MS: calcd for C201H319N54O80S [M þ 3H]3þ 1602.0, [M þ 4H]4þ 1201.8, [Mþ5H]5þ 961.6; found: 1601.5, 1201.6, 961.6.
5.3. Synthesis of 17 (CNBr conversion reaction of sialylglycopeptide 16) Glycopeptide 16 (5.8 mg) was dissolved in 40% CH3CN solution (600 mL) containing 2% (v/v) TFA (12 mL). To this solution was added CNBr (64 mg) and stirred for 30.5 h under the dark at room temperature. Then the mixture was added to H2O (1.0 mL) and lyophilized. Subsequently, the residue was treated as in the following condition to reduce oxidized starting material. The residue was dissolved in cooled (at 10 C) TFA (2.9 mL). To this solution was added NH4I (7.8 mg) and dimethyl sulfide (2.6 mL) at 10 C. The mixture was stirred for 30 min at room temperature and
Glycopeptide Synthesis
517
was then added ice-cooled H2O (1.2 mL). This mixture was washed by icecooled CCl4. The water phase was concentrated in vacuo at 10 C. Purification of the residue by RP-HPLC (C18 column, linear gradient of 4.5% ! 36% CH3CN containing 0.1% TFA in 0.1% TFA aq. solution over 30 min at a flow rate of 1.2 mL/min) afforded MUC1 repeated sialylglycopeptide 17 (2.2 mg, 38% isolated yield). ESI-MS: calcd for C200H317N54O81 [M þ 3H]3þ 1592.0, [M þ 4H]4þ 1194.2, [M þ 5H]5þ 955.6; found: 1592.0, 1194.4, 955.8.
5.4. Synthesis of 18 (O to N intramolecular acyl shift and removing methyl ester of sialyl-Tn moiety) Sialylglycopeptide 17 (2.0 mg, 0.42 mmol) was dissolved in 5 mM NaOH (1.67 mL) at 0 C and stirred for 25 min. To the mixture was added 50 mM NaOH solution (1.3 mL) and the reaction mixture was allowed to gradually warm up to room temperature and stirred for 28 h. Then, the solution was neutralized by AcOH (6 mL). Purification of the mixture by RP-HPLC (C18 column, 5 mm, F 4.5 250 mm, linear gradient of 9 ! 27% CH3CN in 50 mM NH4OAc solution over 60 min at a flow rate of 1.0 mL/min) afforded MUC1 repeated segment 18 (ca. 1.0 mg, ca. 50% isolated yield, 70% yield estimated by HPLC peak area intensity). ESI-MS: calcd for C198H313N54O81 [M þ 3H]3þ 1582.6, [M þ 4H]4þ 1187.2, [M þ 5H]5þ 950.0; found: 1582.8, 1187.5, 950.2.
6. Conclusion In order to examine an efficient synthesis of a complex-type sialylglycopeptide, synthetic methods for appropriate amounts of oligosaccharide, sialylglycopeptide, and its thioester should be essential. Described here demonstrates such synthesis of complex glycopeptide forms. We could exhibit synthetic methods, which have been already proved to be applicable to a glycoprotein synthesis, and these results are now sustaining the synthesis of glycoproteins. These methods will support the studies for investigation of oligosaccharides.
REFERENCES Botti, P., and Tchertchian, S. (2006). Preparation of peptides by side-chain extended ligation. WO2006133962. Brik, A., Ficht, S., Yang, Y. Y., Bennett, C. S., and Wong, C. H. (2006). Sugar-assisted ligation of N-linked glycopeptides with broad sequence tolerance at the ligation junction. J. Am. Chem. Soc. 128, 15026–15033.
518
Yasuhiro Kajihara et al.
Canne, L. E., Bark, S. J., and Kent, S. B. H. (1996). Extending the applicability of native chemical ligation. J. Am. Chem. Soc. 118, 5891–5896. Chen, G., Warren, J. D., Chen, J. H., Wu, B., Wan, Q., and Danishefsky, S. J. (2006). Studies related to the relative thermodynamic stability of C-terminal peptidyl esters of O-hydroxy thiophenol: Emergence of a doable strategy for non-cysteine ligation applicable to the chemical synthesis of glycopeptides. J. Am. Chem. Soc. 128, 7460–7462. Crich, D., and Banerjee, A. (2007). Native chemical ligation at phenylalanine. J. Am. Chem. Soc. 129, 10064–10065. Dan, A., Lergenmuller, M., Amano, M., Nakahara, Y., Ogawa, T., and Ito, Y. (1998). p-Methoxybenzylidene-tethered b-mannosylation for stereoselective synthesis of asparagine-linked glycan chains. Chem. Eur. J. 4, 2182–2190. Dawson, P. E., Muir, T. W., Clark-Lewis, I., and Kent, S. B. H. (1994). Synthesis of proteins by native chemical ligation. Science 266, 776–779. Gross, E., and Morell, J. L. (1974). Reaction of cyanogen-bromide with S-methylcysteine— Fragmentation of peptide 14-29 of bovine pancreatic ribonuclease-A. Biochem. Biophys. Res. Commun. 59, 1145–1150. Helenius, A., and Aebi, M. (2001). Intracellular functions of N-linked glycans. Science 291, 2364–2369. Kajihara, Y., Suzuki, Y., Yamamoto, N., Sasaki, K., Sakakibara, T., and Juneja, L. R. (2004). Prompt chemoenzymatic synthesis of diverse complex-type oligosaccharides and its application to the solid-phase synthesis of a glycopeptide with asn-linked sialyl-undecaand asialo-nonasaccharides. Chem. Eur. J. 10, 971–985. Kajihara, Y., Yoshihara, A., Hirano, K., and Yamamoto, N. (2006). Convenient synthesis of a sialylglycopeptide-thioester having an intact and homogeneous complex-type disialyloligosaccharide. Carbohydr. Res. 341, 1333–1340. Kawakami, T., Akaji, K., and Aimoto, S. (2001). Peptide bond formation mediated by 4, 5-dimethoxy-2-mercaptobenzylamine after periodate oxidation of the N-terminal serine residue. Org. Lett. 3, 1403–1405. Low, D. W., Hill, M. G., Carrasco, M. R., Kent, S. B. H., and Botti, P. (2001). Total synthesis of cytochrome b562 by native chemical ligation using a removable auxiliary. Proc. Natl. Acad. Sci. USA 98, 6554–6559. Macmillan, D., and Anderson, D. W. (2004). Rapid synthesis of acyl transfer auxiliaries for cysteine-free native glycopeptide ligation. Org. Lett. 6, 4659–4662. Offer, J., Boddy, C. N. C., and Dawson, P. E. (2002). Extending synthetic access to proteins with a removable acyl transfer auxiliary. J. Am. Chem. Soc. 124, 4642–4646. Okamoto, R., and Kajihara, Y. (2008). Uncovering a latent ligation site for glycopeptide synthesis. Angew. Chem. Int. Ed. 47, 5402–5406. Okamoto, R., Souma, S., and Kajihara, Y. (2009). Efficient substitution reaction from cysteine to the serine residue of glycosylated polypeptide: Repetitive peptide segment ligation strategy and the synthesis of glycosylated tetracontapeptide having acid labile sialyl-Tn antigens. J. Org. Chem. 74, 2494–2501. Pentelute, B. L., and Kent, S. B. H. (2007). Selective desulfurization of cysteine in the presence of Cys(Acm) in polypeptides obtained by native chemical ligation. Org. Lett. 9, 687–690. Seko, A., Koketsu, M., Nishizono, M., Enoki, Y., Ibrahim, H. R., Juneja, L. R., Kim, M., and Yamamoto, T. (1997). Occurrence of a sialylglycopeptide and free sialylglycans in hen’s egg yolk. Biochim. Biophys. Acta 1335, 23–32. Varki, A. (1993). Biological roles of oligosaccharides—All of the theories are correct. Glycobiology 3, 97–130. Varki, A., Cummings, R. D., Esko, J. D., Freeze, H. H., Stanley, P., Bertozzi, C. R., Hart, G. W., and Etzler, M. E. (2008). Essentials of Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Glycopeptide Synthesis
519
Wan, Q., and Danishefsky, S. J. (2007). Free-radical-based, specific desulfurization of cysteine: A powerful advance in the synthesis of polypeptides and glycopolypeptides. Angew. Chem. Int. Ed. 46, 9248–9252. Weiss, H., and Unverzagt, C. (2003). Highly branched oligosaccharides: A general strategy for the synthesis of multi-antennary N-glycans with a bisected motif. Angew. Chem. Int. Ed. 42, 4261–4263. Yamamoto, N., Takayanagi, Y., Yoshino, A., Sakakibara, T., and Kajihara, Y. (2007). An approach for a synthesis of asparagine-linked sialylglycopeptides having intact and homogeneous complex-type undecadisialyloligosaccharides. Chem. Eur. J. 13, 613–625. Yan, L. Z., and Dawson, P. E. (2001). Synthesis of peptides and proteins without cysteine residues by native chemical ligation combined with desulfurization. J. Am. Chem. Soc. 123, 526–533.
C H A P T E R
T W E N T Y- F I V E
Renewed Synthetic Approach to Gangliosides Exploiting Versatile and Powerful Synthetic Units Hiromune Ando,*,† Hideharu Ishida,* and Makoto Kiso*,† Contents 1. Background 2. Design of a Systematic Strategy Toward Gangliosides Found in Mammals 3. Renewal of the Synthesis of Sialyl Galactose Unit 4. Sialyl Galactose Unit for Ganglio-Series Ganglioside Synthesis 5. Cassette Approach to Glycolipid Synthesis 6. Synthesis of Echinoderm Ganglioside 7. Experimental Procedure 7.1. Synthesis of N-Troc sialyl donor 7.2. Synthesis of N-Troc sialyl galactose 7.3. Synthesis of GM2 core sequence References
522 523 525 528 529 531 534 534 535 537 539
Abstract It is well known that gangliosides, sialic acid-containing glycosphingolipids, play important roles in diverse biological processes associated with cell development, immune response, cancer metastasis, infection, and signal transduction. Synthetic chemistry of ganglioside has been promoting the elucidation of the ganglioside functions at the molecular level by the supply of homogenous gangliosides and their functional probes. For advancing further glycobiology, synthetic chemistry of ganglioside must be elaborated to be capable of producing a large supply of gangliosides. Recent innovation of sialic acid chemistry allowed to access to sialic acid-containing oligosaccharides. This chapter will focus on new approaches toward the efficient total synthesis of gangliosides.
* Department of Applied Bioorganic Chemistry, Faculty of Applied Biological Sciences, Gifu University, Yanagido, Gifu, Japan Institute for Integrated Cell-Material Sciences (iCeMS), Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto, Japan
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78025-3
#
2010 Elsevier Inc. All rights reserved.
521
522
Hiromune Ando et al.
1. Background The sialic acids are structurally distinguished from other monosaccharides by the C-1 carboxy group and the glycerol chain extending from C6, being defined as a diverse family of monosaccharides derived from 3-deoxynon-2-ulosonic acid. The three major sialic acids found in nature are N-acetyl (Neu5Ac; 1) and N-glycolyl (Neu5Gc; 2) derivatives of neuraminic acid (5-amino-3,5-dideoxy-D-glycero-D-galacto-non-2-ulosonic acid) and KDN (3-deoxy-D-glycero-D-galacto-non-2-ulosonic acid; 3; Fig. 25.1). They are sometime further modified at their hydroxyl groups by acetylation, sulfonylation, methylation, and so on, being converted into over 50 congeners. Within glycan chains conjugated with lipid or protein scaffolds in the outer leaflet of the cell membrane, sialic acids typically occupy the distal end of glycan chains through a(2,6) and/or a(2,3)-linkage with galactose, Nacetyl-galactosamine, glucose, or N-acetyl-glucosamine, and through a(2,8), a(2,9) or a(2,4)-linkage with another neuraminic acid residue, facing extracellular milieu. Therefore, the sialic acids are also biologically distinguishable from other saccharides by participating at the front in carbohydrate–protein interactions that mediate cell adhesion, cellular immune response, fertilization, bacterial and virus entry, and signal transduction (Angata and Varki, 2002). However, the sialic acid-containing glycans and their conjugates with lipid and protein are heterogeneous, and the quantities that can be obtained from biological sources are rather small. That has prevented molecular glycobiology from advancing rapidly. In this context, a large supply of homogenous sialo-glycans and their conjugates has been a critical subject. Many chemistry groups have been making continuous efforts to establish the truly powerful method for the synthesis of sialo-glycoconjugates (Boons and Demchenko, 2000). In our group, this challenge is mainly focused on gangliosides, sialic acid-containing glycosphingolipids. In this chapter, we will highlight our recent progress in the synthesis of complex gangliosides.
CO2H OH HO O OH AcHN HO HO Neu5Ac (a) 1
HO HO
CO2H
OH O
HN HO OH O Neu5Gc (a) 2
HO
OH
Figure 25.1 Structure of typical sialic acids.
OH
CO2H O
HO HO OH
KDN (a) 3
OH
Renewed Synthetic Approach to Gangliosides
523
The major difficulty of sialoside synthesis will be the stereoselective formation of a-glycoside of sialic acid, in which no neighboring effect to direct a-glycoside formation is inherently available. If a glycosidation of sialyl donor is unstereoselective and affords an anomeric mixture, the complete separation of the anomeric isomers will also be troublesome and time-consuming. Furthermore, in the approach to highly sialylated glycans, such as those having an a(2,8) or a(2,4)-linked disialic acid, the sialylation of the less reactive C-8 or C-4 hydroxyl group of sialic acid will be more difficult. In addition to such difficulties in the synthesis of glycan parts, the conjugation of glycan part and lipid part called as ceramide is also challenging mainly due to the bulkiness of both of glycan and ceramide. Furthermore, the structural diversity of sialic acid and ceramide should be considered for the synthesis of natural gangliosides. There are a number of examples of ganglioside syntheses available in spite of the presence of such difficulties. However, the general method that enables to provide a large supply of gangliosides, which is sufficient to promote the biological and biomedical studies, is yet available. Our efforts over around a decade, therefore, have been addressing to the development of powerful and general strategy to generate a diverse family of gangliosides found in nature.
2. Design of a Systematic Strategy Toward Gangliosides Found in Mammals Surveying a variety of ganglioside structures found in mammals, which are classified into subclasses including hemato-, ganglio-, lacto-, neolacto-, globo-, and isoglobo-series, one can notice that a sialyl-a(2,3)galactose disaccharide residue is a common substructure among gangliosides (Fig. 25.2). Besides ganglio-series, the glycans of gangliosides have the disaccharide sequence at the termini. On the contrary, the ganglio-series glycans have a sialic acid branch which stems from the inner galactose residue, and the branch is sometime extended by the addition of another sialic acid. In addition, the main chain of ganglio-series glycans is often terminated with sialic acid, thus presenting the most considerable complexity among ganglioside glycans. Synthetic analysis which has been commonly employed toward the synthesis of ganglioside included the disconnection of the linkage between glycan and ceramide, and then the resulting glycan was further compartmentalized into a common lactose residue and other sequences. The assembly of linear glycans unlike those of ganglio-series usually commenced with the coupling of the lactose and the characteristic middle saccharide unit, which was then followed by the termination of the extended glycan with
524
Hiromune Ando et al.
4 3
Hemato-series
3
Ganglio-series
4
4
Cer
Neua (2-3)Galb(1-4)Glcb(1-1)Cer
Galb(1-3)GalNAcb (1-4)Galb (1-4)Glcb (1-1)Cer
Cer
3 Neua(2-3) 4 Lacto-series
Cer
Neua(2-3)Galb (1-3)GlcNAcb (1-3)Galb(1-4)Glcb(1-1)Cer
Cer
Neua(2-3)Gab (1-4)GlcNAcb (1-3)Galb (1-4)Glcb (1-1)Cer
Cer
Neua(2-3)Galb (1-3)GalNAcb (1-3)Gala (1-4)Galb (1-4)Glcb (1-1)Cer
Cer
Neua(2-3)Galb (1-3)GalNAcb (1-3)Gala (1-3)Galb (1-4)Glcb (1-1)Cer
3
3 3
4 3
4
Neolacto-series
3
4 Globo-series
3
3
4
3 4
Isogobo-series
3
3
3 3
Neu
Gal
GalNac
Glc
GlcNAc
Figure 25.2 Subfamilies of gangliosides and their structures.
sialyl galactose unit. On the other hand, the assembly of the branched glycans of the ganglio-series was obliged to include the coupling reaction of the lactose and sialic acid at the first stage because it was demonstrated that sialic acid was hardly glycosidated with C3-hydroxyl group within trisaccharide comprising of lactose and galactosamine, so-called ganglio-triose. Next, the resulting sialyl lactose was further extended by the addition of the terminal saccharide units such as galactosamine, galactose, and sialyl galactose. This limited approach toward ganglio-series glycans required considerable effort and expertise. Because the sialylation of lactose were not completely stereoselective nor highly yielding, it was necessary to repeat the chromatographic separation in several times for obtaining homogenous a-sialylated products, by which the large-scale and short-time synthesis of ganglio-series has been prevented. In contrast, other series without inner sialyl branch, especially neolacto-series, could be produced on large scale and the synthesized molecules have been successfully utilized for the molecular biological studies. Eventually, the difference in the synthetic difficulty between ganglio-series and others clearly reflected on the progress of glycobiology on each subfamily. For example, the first total synthesis of sialyl Lewis X (sLeX) was achieved in 1990 (Kameyama et al., 1991); then by using the synthesized glycans, the elucidation of the interaction between sLeX and selectins was launched at the molecular level (Tyrrell et al., 1991). On the other hand, it was the late 1990s when the synthesized ganglio-series glycans
Renewed Synthetic Approach to Gangliosides
525
were utilized to clarify the structural requirement in the glycan-MAG recognition (Yang et al., 1996). The biological function of ganglio-series gangliosides were considered to be more diverse rather than that of other classes. Ganglio-series gangliosides are commonly found in mammal brain, some of which are thought to play key roles in the neuronal network formation, such as myelination, axon guidance, and so on (Baumann and Pham-Dinh, 2001, Vyas et al., 2002). Furthermore, it is known that some ganglio-series gangliosides function as receptors to bacterial toxins such as cholera toxin, botulinum toxin, and tetanus toxin. GM1 and GM3 are known as major glycosphingolipids, which participate in lipid raft (Lingwood and Simons, 2010). Pathologically, anti-ganglio-series ganglioside antibodies are involved in some form of Guillain–Barre´ syndrome (GBS), which is the most common form of paralytic disease worldwide. It was revealed that the serums from GBS patients reacted with complex ganglio-series gangliosides (Kaida et al., 2008; Koga et al., 1998). To advance the molecular glycobiology of gangliosides, systematic and large supply of homogeneous gangliosides employing chemical method is necessitated. Therefore, we have aimed at the establishment of a synthetic strategy toward all classes of gangliosides, which capitalizes common building units as possible. Taking a look again at the structures of gangliosides as depicted in Fig. 25.2, the Glc-Cer turns out to be conserved substructure as well as the terminal and internal sialyl galactose residue, thereby envisaging the use of Glc-Cer acceptor as a common unit. In addition, both of the external and internal sialyl galactose units are expected to be accessible from a common precursor.
3. Renewal of the Synthesis of Sialyl Galactose Unit Sialyl galactosyl unit was originally developed by our group, which was employed in the first total synthesis of sialyl Lewis X (Kameyama et al., 1991). It was then incorporated into a variety of sialyl oligosaccharide syntheses. The glycosidation of methyl or phenylthio-sialyl donor 4 with galactosyl acceptor 5, in which the number of protection groups was kept to minimum, provided the sialyl galactoside 6 with high regioselectivity and efficiency (Scheme 25.1). Compound 6 then underwent the manipulations of functional groups to be converted into the corresponding thioglycoside donor. Although the utility of sialyl galactose unit was exemplified by a number of glycan syntheses, it has several disadvantages in application to the large-scale
526
Hiromune Ando et al.
OAc CO2Me AcO O SR AcHN AcO OAc 4
HO
OBz O
HO
NIS−TfOH / MeCN 61% OSE
R = Me or Ph
NIS−TfOH / EtCN−CH2Cl2 HO OBn 23% O HO OSE
OH
OBn 7
5
AcO
OAc MeO2C AcHN AcO
HO
O
O
OAc
OBz O OH
6
Scheme 25.1
AcO OSE
OAc MeO2C AcHN AcO
HO
O
O
OAc
OBn O
OSE
OBn 8
Conventional approach to sialyl galactose units.
synthesis. First, the introduction of 2-(trimethylsilyl)ethyl group (SE), which is introduced to make the high polar triol galactosyl moiety soluble in organic solvents, is not efficient. Additionally, 2-(trimethylsilyl)ethanol is much expensive. In addition, the C-6 benzoate group will alleviate the reactivity of the axial C-4 hydroxyl group, which is already hindered by C-3 sialyl moiety, by its steric and electronic influence. Thus, it is probably hard for compound 6 to accept a galactosamine moiety at C-4 to establish a common branch structure among ganglio-series gangliosides. In this synthetic context, the 2,6-benzylated derivative of 7 would fulfill the stringent requirement for the assembly of the branch structure of ganglio-series glycan. However, based on the results we obtained, the sialylation of the C-3 hydroxyl group was unsuccessful in regard to total efficiency; thus, the yield of 8 was low (23%) and the isolation of the pure desired product required silica gel column chromatography in several times. It was assumed that the improvement of the reactivity of sialyl donor was necessary to surmount these synthetic issues. For this purpose, the C-5 substituent effect on the reactivity of sialyl donor, which was first revealed by Boon’s group, could be utilized (De Meo et al., 2001; Demchenko and Boons, 1998). Similar to N,N-diacetyl (9) and N-trifluoroacetyl (10) derivatives, N-Troc (2,2,2-trichroloethoxycarbonyl)-sialyl donor 11 turned out to posses high potential (Adachi et al., 2004; Ando et al., 2003; Scheme 25.2), which was then utilized in the coupling reaction with galactosyl acceptor carrying two benzyl groups at C-4 and C-6 positions.
527
Renewed Synthetic Approach to Gangliosides
This coupling provided a higher yield of a-sialyl product than the case of N-Ac derivative (Scheme 25.3). Furthermore, the compound 13 was easily separable from the anomeric mixture by recrystallization, which was probably due to strong p–p stacking ability of methoxyphenyl group at the anomeric position. In addition, unlike SEOH, p-methoxyphenol is cheap and can be glycosylated with galactosyl donor almost quantitatively. Thus, the first issue in the synthesis of sialyl galactose unit has been resolved. It was also demonstrated that this procedure could be successfully applied for the production of 13 in a large quantity ( kg). The sialyl galactose 13 could be readily converted into sialyl galactose donor 14 in high yield (Imamura et al., 2008). OAc
HO
CO2Me
AcO Ac2N
O
AcO
OAc
SMe
+
HO
OAc MeO2C
OBz O
NIS−TfOH OSE
MeCN – 40 ºC
OH
Ac2N AcO
O OAc
9
OAc AcO TFAcHN AcO
CO2Me SPh + BnO BnO
O
OH O BnO
OAc
OAc AcO TFAcHN
NIS−TfOH
OMe
10
MeCN – 35 ºC
HO
AcO
O
OSE
OH 72% (a only)
CO2Me O OAc
O O
OBn OBn
92% (a : b = only) OAc AcO TrocHN AcO
SPh CO2Me + BnO BnO
O
OH O BnO
OAc
NIS−TfOH
OMe
MeCN – 35 ºC
OBz O
AcO
OAc AcO TrocHN AcO
BnO OMe
CO2Me O OAc
11
O O
OBn OBn
91% (a : b = 89 : 11)
BnO OMe
Scheme 25.2 Glycosidations of C5-modified sialyl donors.
HO 11 (a)
+
HO
OBn O OBn 12
OMP
NIS−TfOH EtCN –50 ºC
OAc MeO2C HO AcO O O TrocHN AcO OAc
OBn O OBn
13 54% (a : b = 5 : 1)
(1) Zn−Cu, AcOH / 1, 2-DCE, 4 ºC OAc MeO2C AcO (2) A2O, Pyr OBz AcO (3) H2, Pd(OH)2 / EtOH O O O AcHN AcO (4) Bz2O, Pyr OAc BzOO CCI3 (5) CAN / MeCN-PhMe-H2O 14 (6) CCI3CN, DBU, CH2CI2, 0 ºC NH 66% (6 steps)
Scheme 25.3 Synthesis of new sialyl galactose units 13 and 14.
OMP
528
Hiromune Ando et al.
4. Sialyl Galactose Unit for Ganglio-Series Ganglioside Synthesis The sialyl galactose unit 13 was proven to be a good coupling partner to N-Troc-galactosaminyl (GalNTroc) donor 15 and Gal-GalNTroc disaccharyl donor 16 (Fuse et al., 2006; Yoshikawa et al., 2008). These condensation reactions yielded the GM2 and GM1 core sequence in high yields (Scheme 25.4). Then, a couple of Troc groups were cleaved selectively to be replaced with acetyl groups. This approach has been successfully integrated in the synthesis of diverse ganglioside glycans. In addition, the disialyl analog of 17 also accepted GalNTroc donor 18 in high yields, thereby enabling to systematically access to the complex glycans of b-series gangliosides such as GT1b and GQ1b (Imamura et al., 2009; Scheme 25.5). This approach could produce GQ1b in a large quantity AcO AcO
OAc O
AcO SPh
OAc AcO O O
AcO
NHTroc
OAc O
SPh
NHTroc
OAc 16
15 97% (NIS−TfOH / CH2Cl2, – 40 ºC)
89% (NIS−TfOH / CH2Cl2, 0 ºC)
OAc
AcO TrocHN AcO AcO
HO O
O
OBn O
OMP
OBn
MeO2C 13
Scheme 25.4 Glyosylations of sialyl galacostyl acceptor 13 with glycosyl donors 15 and 16 to make the branch structure of ganglio-series gangliosides. Ph O 18
O O
TrocHN HO AcO
AcO AcO AcHN AcO
AcO AcHN O O O
O
CO2Me
O 17
OAc
O
OBn O
Ph
TrocO
O
F
O
Cp2ZrCl2–AgOTf OSE
OBn
CH2Cl2 –20 ºC
AcO AcO AcHN
TrocO
AcO AcHN O O O
OAc
O
AcO
O
O TrocHN
OBn O
O
O
CO2Me
OSE
OBn
19 85%
AcO
Scheme 25.5 Successful glycosylation of disialyl galactosyl acceptor 17 with galactosaminyl donor 18, which allowed to approach to the b-series gangliosides.
529
Renewed Synthetic Approach to Gangliosides
(70 mg). It is of note that in case of the coupling reaction of disialyl galactose, fluorinated galactosaminyl donor 18 provided highest yield among other donors.
5. Cassette Approach to Glycolipid Synthesis As mentioned in earlier part of this chapter, another major problem which prevents large-scale synthesis of gangliosides from being possible is the low efficiency in the conjugation of glycan part with ceramide part. Based on the reported results, the yields of the coupling reactions of the full-length glycan and 2-azido-sphingosine ranges from 25% to 92%, and in case of branched ceramide, the yields were lower than that of the azidosphingosine. Examples are shown in Scheme 25.6 (Endo et al., 1995; Kameyama et al, 1991). Therefore, it seems reasonable to incorporate ceramide part into glucose rather than grown glycan part. Obviously, this approach using a glycosyl ceramide cassette is advantageous over the conventional approach because the reactivity of C-4 hydroxyl group can be enhanced by the electronic effects of protecting groups mounted on adjacent hydroxyl groups in order to accept oligosaccharyl donor with high efficiency.
OAc R2O AcO
O OAc O
NHAc O O
O OAc
O AcO
OAc O O AcO OAc
OAc O
CCl3
OAc
AcO OAc
20 R1 = Ac, R2 = Protected Neu5Ac 21 R1 = Piv, R2 = Lev 21 35% (BF3OEt2 / CHCl3)
20 44% (TMSOTf / CH2Cl2)
OBz
OBz HO
C13H27 N3
NH
O
OR1
HO
C13H27 HN
C17H35 O
Scheme 25.6 Examples of the conjugation of lipid parts with grown glycan parts using azido-sphingosine and ceramide acceptors.
530
Hiromune Ando et al.
This approach exploiting Glc-Cer acceptor as a key common cassette was first utilized in the total synthesis of GQ1b (Imamura et al., 2009). Interestingly, it was demonstrated that p-methoxybenzyl (MBn) groups at C-3 and C-6 hydroxyl groups within 23 bestowed the C-4 hydroxyl group with higher reactivity. The use of MBn group also had a merit in its deprotection under acidic condition, which did not affect any other functional groups and glycosides within the intricate molecule (Scheme 25.7). Although the Glc-Cer 23 served as an excellent coupling partner even to complex glycan donors, the low yield of the glycosidation of glucose donor with ceramide acceptor extremely diminished the total yield of ganglioside synthesis. Presumably, the low yield is attributable to the attenuated likelihood of the attack of the C-1 hydroxyl group within ceramide to glucosyl oxocarbenium ion owing to self-aggregation of ceramide. Based on this hypothesis, the tethering of glucose and ceramide was expected to ameliorate the inherent property of ceramide and increase the chance of the attack of C-1 hydroxyl group to the anomeric center. Furthermore, the generated cyclic Glc-Cer acceptor was expected to have a highly reactive hydroxyl group at C4 because the C6–O6 bond may not
BzO OBz O O OBz O O O BzO AcO AcHN O CO2Me AcO O O AcHN BzOO NH CO2Me O AcO O AcO O CCl3 O AcHN BzO
AcO AcO AcHN AcO
AcO AcO AcHN O O O O
OAc
AcO
OBz O
OAc
22
TMSOTf CH2Cl2 0ºC
O HO MPMO
OMPM HN O O OBz 23
C17H35 C13H27 OBz
Coupling yield: 48% BzO OBz O AcO O OBz O O AcO O BzO AcO AcHN O AcHN O CO2Me AcO O O AcO O MPMO O AcHN BzO AcO O CO2Me O O AcHN AcO O AcO O OAc 24 O AcHN AcO BzO
AcO
OAc
OBz O
O OMPM HN O O OBz
C17H35 C13H27 OBz
91%
Scheme 25.7 Highly yielding conjugation of Glc-Cer acceptor 23 with GQ1b-core unit 22 to produce GQ1b framework.
531
Renewed Synthetic Approach to Gangliosides
adopt a gauche/trans configuration due to ring strain. Thus, with protection system similar to 23, the glucose donor 28 was tethered with ceramide through a succinoyl ester, which was then glycosidated to yield a cyclic GlcCer 31 in high yield (Fujikawa et al., 2010; Scheme 25.8). As shown in Scheme 25.9, it was demonstrated that the reactivity of the cyclic Glc-Cer acceptor exhibited high reactivity comparable to 23. Thus, in the coupling reactions with oligosaccharide donors, 32, 33, and 34, the cyclic Glc-Cer acceptor 31 provided high yields (85%, 73%, and 60%, respectively). The acceptor 31 was successfully utilized in the first total synthesis of GalNAc-GD1a.
6. Synthesis of Echinoderm Ganglioside In addition to the enhancing effect on sialyl donor, the selective cleavability of Troc group could expand the application range of the N-Troc sialyl donor 11 in ganglioside synthesis. Upon cleavage of Troc group under elaborated conditions, the N-Troc intermediate could be selectively converted into 5-amino or 5-acetamido-8-hydroxy derivative. Thus, the treatment of N-Troc sialy galactose 35 with zinc in acetic acid produced 5-amino intermediate, which could be successively acylated with acyl halide, such as actoxyglycolyl chloride, to afford N-Gc derivative 36. On the other hand, the treatment with zinc under mild acidic condition could afford the corresponding 8-hydroxy-N-acetyl derivative 37, which resulted from the regiospecific O to N migration of acetyl group (Ando et al., 2003; Scheme 25.10). O
OH RO HN A (80%)
C13H27 C17H35
O 25 R = H 26 R = TBDMS O
O
B O Quant TBDMSO HN
D (88%)
C13H27 C17H35
C (93%)
27 O O
O O
O SPh RO HN OBz
O
29 R = TBDMS 30 R = H
SPh
28 OBz
O HO MPMO
OH O
HO MPMO
HO
C13H27 C17H35 O
DMTST CH2Cl2 MS4 Å 0 °C
HO MPMO
O O OBz
O O
C13H27 C17H35
HN 31
O
92%
Scheme 25.8 Synthesis of cyclic Glc-Cer acceptor 31 via intramolecular glycosylation. Reagents and conditions: (A) TBDMSCl, DMAP, Et3N/CH2Cl2, rt, 80%; (B) succinic anhydride, DMAP/pyr, 40 C, quant; (C) 4, EDCHCl, DMAP/CH2Cl2, rt, 93%; (D) TBAF, AcOH/THF, rt, 88%.
532
Hiromune Ando et al.
AcO AcO AcO AcHN O AcO AcO
OAc
BzO
COOMe BzOO
CCl3
NH 32 85% (TMSOTf / CHCl3, 0 °C) AcO
AcO O
OAc O
O OBz NHAc AcO O AcHN O O AcO CCl3 COOMe BzOO OAc AcO NH 33 73% (TMSOTf / CHCl3, 0 °C)
OBz O
O
OAc O
OAc O
O AcO AcO NHAc AcHN O O AcO COOMe OAc AcO
OBz AcO OAc O O O O OBz OBz AcO NHAc O AcHN O O AcO COOMe BzOO CCl3 OAc AcO NH 34 60% (TMSOTf / CHCl3, r.t.)
Scheme 25.9 Coupling yields of coupling reactions of Glc-Cer acceptor 31 and sialyl glycan units 32, 33, and 34.
AcO
OAc
TrocHN AcO
COOMe O
OAc AcO (1) Zn / AcOH, r.t. (2) AcGcCl, Et3N / THF, r.t. AcGcHN AcO
88%
OR
OAc 35
AcO OBn O OMP R= OBn
Zn/10% AcOH in 1, 4-diox., r.t. AcO 78%
COOMe O OAc 36 COOMe
OH
AcHN AcO
OR
O
OR
OAc 37
Scheme 25.10 Divergence of N-Troc sialyl intermediate 35 into the corresponding 5amido derivative 36 and 8-hydroxy-5-acetamido derivative 37.
Recently, these conversions were successfully utilized in the synthesis of the complex ganglioside glycans found in echinoderms such as HLG-2 and Hp-s6 (Ando et al., 2005; Iwayama et al., 2009). HLG-2, which is present in Holothuria leucospilota, has a characteristic glycan sequence, NeuGca(2,4)
533
Renewed Synthetic Approach to Gangliosides
Neu5Aca(2,6)Glc. Hp-s6, which is present in sea urchin, has 8-O-SO3Neu5Aca(2,8)Neu5Aca(2,6)Glc sequence. As illustrated in Scheme 25.11, each tandem of sialic acid could be assembled by utilizing 1,5-lactam sialyl
H O N
OH H O N
OH
O
BzO
OH
HO
O BnO BnO
O
TrocHN
38
AcO
AcO AcO AcO O BnGcHN AcO
OH O
O
HO
O BnO BnO
O CO2Me
OAc
O
84% (a : b = 66 : 18)
OMP
OBn
O CO2Me 39
OAc
O
O HO HO
H O N
OH
OMP
O
OSE
OH
Glycan part of HLG-2
COOH
OH
11 NIS−TfOH
SPh
O
BnO
O
COOH
HO AcHN HO HO HO HN O
O
BzO
74%
HO
O OBn
H O N
OA
De-Troc and N-benzylglycolylation
HO
AcO AcO
EtCN –40 °C
OMP OBn
O BnO BnO
O
BzO
11 NIS−TfOH
AcO TrocHN AcO
EtCN –80 °C
AcO OAc 40
CO2Me
OAc O OAc
H OBn N
O
O O AcO
SPh
OAc
49% (a only)
De-Troc and [8-O to 5-N] Ac migration
OH AcO
O
O
AcHN AcO
94%
H O CO2Me OBn N
BnO BnO SPh
OH O
OSE
OBn
O
OAc
AcO
OAc
41
HO
OSO3HNEt3 COOH
AcHN HO
O OH
O AcHN HO
OH
COOH O
OH
O HO HO
O
Glycan part of Hp-s6 OSE
OH
Scheme 25.11 Synthesis of glycan parts of echinodermal gangliosides, which contain partially modified disialic acid.
534
Hiromune Ando et al.
acceptors, 38 and 40, and the N-Troc sialyl donor 11. Then, the outer sialic acid residues were converted into N-Gc and N-Ac-8-hydroxy form 39 and 41, respectively.
7. Experimental Procedure 7.1. Synthesis of N-Troc sialyl donor OAc
CO2Me
CO2Me
OAc AcO
AcO AcHN AcO
O OAc 42
SPh
TrocHN AcO
O
SPh
OAc 11
7.1.1. Note and special precautions This reaction gives N-Troc sialyl phenylthioglycoside 11 in high yield ( 95%). Both TrocCl and TrocOSu can be used for the introduction of Troc into amino group. However, TrocOSu (solid) is more easily handled rather than TrocCl (liquid), and TrocOSu is advantageous in regard to the shelf life in refrigerator.
7.1.2. Materials 1. Phenylthioglycoside of 4,7,8,9-tetraacetyl-Neu5Ac (42; 20.0 g, 34.3 mmol) 2. Methanesulfonic acid (6.7 mL, 102.9 mmol) 3. TrocOSu (19.9 g, 68.6 mmol) 4. 1 M NaHCO3 (103 mL) 5. Acetic anhydride (26.0 mL, 274 mmol) 6. 4-Dimethylaminopyridine (42 mg, 0.343 mmol) 7. Dry methanol (343 mL) 8. 1,4-Dioxane (103 mL) 9. Dry pyridine (343 mL) 10. Toluene 11. Ethyl acetate (2000 mL) 12. 2 M HCl 13. Sat. NaHCO3, aqueous solution 14. Brine 15. Sodium sulfate
535
Renewed Synthetic Approach to Gangliosides
7.1.3. Special precautions Do not alkalize the reaction mixture of deacetylation at the workup to prevent the formation of 4,5-oxazolidinone derivative. It is of note that the resulting SuOH could be extracted with water from the reaction mixture to circumvent the chromatographic separation of SuOAc after the acetylation. Add dry methanol (343 mL) to a flask containing phenylthioglycoside of 4,7,8,9-tetraacetyl-Neu5Ac (42; 20.0 g, 34.3 mmol), and then add methanesulfonic acid (6.7 mL, 102.9 mmol). Leave the solution refluxing for 21 h. The reaction progress can be monitored by t.l.c. analysis (CHCl3:MeOH ¼ 3:1). Concentration of the reaction mixture gives the syrupy residue, and expose it to vacuum for 12 h. After carefully adding 1 M NaHCO3 (103 mL) to the crude residue in an ice water bath (Caution: exothermic due to neutralization), add a solution of TrocOSu (19.9 g, 68.6 mmol) in 1,4-dioxane (103 mL), and leave the mixture stirring for 1 h at ambient temperature. Then, remove the solvents by coevaporation with ethanol, and expose the obtained crude residue to vacuum to dryness. Add dry pyridine (343 mL) to the dried residue and cool the mixture in ice water bath. Drop acetic anhydride (26.0 mL, 274 mmol) to the mixture over 30 min, and add 4-dimethylaminopyridine (42 mg, 0.343 mmol). Leave the mixture stirring at ambient temperature for 12 h. The reaction can be monitored by t.l.c. analysis (CHCl3:MeOH ¼ 30:1). Then to quench the reaction, add methanol to the reaction mixture in ice water bath. Coevaporate with toluene, dilute the resulting residue with ethyl acetate, and wash with 2 M HCl. The aqueous layer should be washed at least twice with ethyl acetate. Then wash the combined organic layer with sat. NaHCO3 aq. and brine, and dry over Na2SO4. Filtration and evaporation gives the crude material. Chromatographic purification can be conducted on silica gel (AcOEt:Hex ¼ 1:4) to afford the pure title compound 11.
7.2. Synthesis of N-Troc sialyl galactose HO 11
+
HO
OBn O OBn 12
AcO OMP
OAc MeO2C O
TrocHN AcO OAc
HO O 13
OBn O
OMP
OBn
7.2.1. Note This reaction produces N-Troc sialyl galactose 13, which can serve as a key common intermediate for the synthesis of gangliosides. Namely, the objective product in this reaction can function as a good coupling partner to galactosaminyl donor and galactosyl galactosaminyl donor, thus producing
536
Hiromune Ando et al.
GM2 core and GM1 core sequences, respectively. By going through the manipulations of the protecting groups including debenzylation, benzoylation, de-O-methoxyphenylation, and the formation of trichroloacetimidate at the anomeric position, the product 13 can be converted into the corresponding donor, which has been widely utilized as a terminal sialyl galactose unit in the syntheses of gangliosides. The strong merit of this reaction is that the a-isomer can be crystallized from the mixture of anomeric mixture, thereby facilitating the large-scale production of this unit. 7.2.2. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.
Neu5Troc donor (11; 4.0 g, 5.58 mmol) Galactosyl acceptor (12; 1.74 g, 3.72 mmol) N-Iodosuccinimide (NIS) (1.88 g, 8.37 mmol) Trifluoromethanesulfonic acid (TfOH) (74 mL, 0.84 mmol) Dry EtCN (47 mL) ˚ Molecular sieves (1.8 g) 3A Sat. NaHCO3, aqueous solution Sat. Na2SO4, aqueous solution Ethyl acetate (1000 mL) Brine Sodium sulfate CeliteÒ
7.2.3. Special precautions ˚ molecular sieves All glassware must be dried in an oven prior to use. 3 A must be preactivated by heating at 300 C for 3 h. Add dry EtCN (47 mL) to a flask containing Neu5Troc donor (11; 4.0 g, 5.58 mmol) and galactosyl acceptor (12; 1.74 g, 3.72 mmol) under Ar ˚ molecular sieves (1.8 g), and stir the mixture for 1 h at atmosphere, add 3 A ambient temperature. Then, cool the mixture down to 50 C. To the stirring mixture, add NIS (1.88 g, 8.37 mmol) and TfOH (74 mL, 0.84 mmol) (Caution: add the solution of TfOH in EtCN dropwise in case of large-scale reaction (>1.0 g) because it is exothermic) at 50 C, and leave for 30 min. The reaction progress can be monitored by t.l.c. analysis (AcOEt:PhMe ¼ 1:3). Then, add excess sat. NaHCO3 aq. to the reaction mixture at 0 C and stir the suspension vigorously, filter through Celite, washing with AcOEt thoroughly, and combine the filtrate and washings. Wash the combined solution with sat. Na2SO4 (Caution: add until the yellow or wine red organic phase turns to colorless) and brine, and dry over Na2SO4. Filtration and evaporation gives the crude material. The crude a,b-mixture of NeuTroc(2,3)Gal, which is prepurified by
537
Renewed Synthetic Approach to Gangliosides
chromatography on short silica gel pad (AcOEt:PhMe ¼ 1:4), can be crystallized from AcOEt–Hex to afford pure a-isomer 13 (2.0 g, 52%) as crystal.
7.3. Synthesis of GM2 core sequence The above-mentioned sialyl galactose can be converted into GM2 and GM1 core sequence unit with high efficiency. The following reaction sequence gives GM2 core-trisaccharide intermediate, which can be further converted into the corresponding glycosyl donor via debenzylation, benzoylation, demethoxyphenylation, and the formation of trichloroacetimidate at the anomeric center. 1. Coupling of sialyl galactose acceptor and galactosaminyl donor (modified method reported by Fuse et al., 2006). AcO AcO 13
+
AcO
OAc O
AcO SPh
NHTroc 15
OAc O
O
OBn TrocHN O OAc O OMP AcO O OBn TrocHN CO2Me AcO
OAc
43
7.3.1. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.
Galactosaminyl donor (15; 800 mg, 1.40 mmol) Sialyl galactose acceptor (13; 1.0 g, 0.933 mmol) N-Iodosuccinimide (630 mg, 2.80 mmol) Trifluoromethanesulfonic acid (24.6 mL, 0.28 mmol) Dry CH2Cl2 (23.3 mL) ˚ Molecular sieves (2.5 g) 4A Sat. Na2CO3, aqueous solution Sat. Na2SO4, aqueous solution CHCl3 (500 mL) Brine Sodium sulfate CeliteÒ
7.3.2. Special precautions ˚ molecular sieves All glassware must be dried in an oven prior to use. 4 A must be preactivated by heating at 300 C for 3 h. Add dry CH2Cl2 (23.3 mL) to a flask containing galactosaminyl donor (15; 800 mg, 1.40 mmol) and sialyl galactose acceptor (13; 1.0 g,
538
Hiromune Ando et al.
0.933 mmol) under Ar atmosphere, add 4 A˚ molecular sieves (2.5 g), and stir the mixture for 1 h at ambient temperature. Then, cool down to 0 C. To the stirring mixture, add NIS (630 mg, 2.80 mmol) and TfOH (24.6 mL, 0.28 mmol) (Caution: add the solution of TfOH in MeCN dropwise in case of large-scale reaction (>1.0 g) because it is exothermic) at 0 C, and leave for 45 min. The reaction progress can be monitored by t.l.c. analysis (AcOEt:Hex ¼ 2:3, develop twice). Then, filter through Celite, washing with CHCl3 thoroughly, and combine the filtrate and washings. Wash the combined solution with sat. Na2CO3 aq., sat. Na2SO4 aq. (Caution: add until the yellow or wine red organic phase turns to colorless) and brine, and dry over Na2SO4. Filtration and evaporation gives the crude material, which then can be chromatographed on silica gel (AcOEt:Hex ¼ 1:2) to afford the title compound 43 (1.43 g, quant.). 2. Replacement of the Troc groups with acetyl group (modified method reported by Fuse et al., 2006). AcO AcO
AcO
OAc O
O
OBn TrocHN O OAc O OMP AcO O OBn TrocHN CO Me 2
AcO
OAc
43
AcO
O
OBn AcHN O OAc O OMP AcO O OBn AcHN CO2Me AcO
OAc
7.3.3. Materials 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
OAc O
GM2 trisaccharide (43; 100 mg, 65.3 mmol) Zn–Cu couple (500 mg, excess) Acetic acid (3.3 mL) MeOH (3.3 mL) Acetic anhydride (24.7 mL, 261 mmol) 4-Dimethylaminopyridine (0.79 mg, 6.53 mmol) Pyridine (1.3 mL, excess) Toluene Ethyl acetate (100 mL) 2 M HCl Sat. NaHCO3, aqueous solution Brine Sodium sulfate CeliteÒ
44
Renewed Synthetic Approach to Gangliosides
539
7.3.4. Note and special precautions It is recommended to use freshly prepared Zn–Cu couple, although commercially available. Zn–Cu can be prepared by following the procedure reported by LeGoff (1964). Zn–Cu deteriorates in moist air and should be stored under nitrogen. Because de-Troc reaction is conducted in heterogeneous mixture, the reaction mixture should be stirred vigorously to mix the insoluble catalyst and the solution. Dissolve GM2 trisaccharide (43; 100 mg, 65.3 mmol) in MeOH (3.3 mL) and acetic acid (3.3 mL) under Ar atmosphere. Then, add Zn–Cu couple (500 mg) and stir the mixture for 40 min at ambient temperature. The reaction progress can be monitored by t.l.c. analysis (CHCl3:MeOH ¼ 15:1). Then, filter through Celite, washing with MeOH thoroughly, combine the filtrate and washings, and coevaporate with toluene. Dilute the concentrated syrup, wash with water, sat. Na2CO3 aq. and brine, and dry over Na2SO4. Filtration and evaporation gives the crude material, which is exposed to vacuum to dryness. Add dry pyridine (1.3 mL) to the dried residue and cool the mixture in ice water bath. Add acetic anhydride (24.7 mL, 261 mmol) and 4-dimethylaminopyridine (0.79 mg, 6.53 mmol). Leave the mixture stirring at ambient temperature for 3 h. The reaction can be monitored by t.l.c. analysis (CHCl3:MeOH ¼ 20:1). Then to quench the reaction, add methanol to the reaction mixture in ice water bath. Coevaporate with toluene, dilute the resulting residue with ethyl acetate, and wash with 2 M HCl. Then, wash the combined organic layer with sat. NaHCO3 aq. and brine, and dry over Na2SO4. Filtration and evaporation give the crude material. Chromatographic purification can be conducted on silica gel (CHCl3:MeOH ¼ 60:1 to 40:1) to afford the pure title compound 44 (66.9 mg, 81%).
REFERENCES Adachi, M., Tanaka, H., and Takahashi, T. (2004). An effective sialylation method using NTroc- and N-Fmoc-protected b-thiophenyl sialosides and application to the one-pot two-step synthesis of 2, 6-sialyl-T antigen. Synlett. 609–614. Ando, H., Koike, Y., Ishida, H., and Kiso, M. (2003). Extending the possibility of an N-Troc-protected sialic acid donor toward variant sialo-glycoside synthesis. Tetrahedron Lett. 44, 6883–6886. Ando, H., Koike, Y., Koizumi, S., Ishida, H., and Kiso, M. (2005). 1, 5-lactamized sialyl acceptors for various disialoside syntheses: Novel method for the synthesis of glycan portions of Hp-s6 and HLG-2 gangliosides. Angew. Chem. Int. Ed. 44, 6759–6763. Angata, T., and Varki, A. (2002). Chemical diversity in the sialic acids and related a-keto acids: An evolutionary perpective. Chem. Rev. 102, 439–469. Baumann, N., and Pham-Dinh, D. (2001). Biology of oligodendrocyte and myelin in the mammalian central nervous system. Physiol. Rev. 81, 871–927. Boons, G.-J., and Demchenko, A. V. (2000). Recent advance in O-sialylation. Chem. Rev. 100, 4539–4565.
540
Hiromune Ando et al.
De Meo, C., Demchenko, A. V., and Boons, G.-J. (2001). A stereoselective approach for the synthesis of a-sialosides. J. Org. Chem. 66, 5490–5497. Demchenko, A. V., and Boons, G.-J. (1998). A novel and versatile glycosyl donor for the preparation of glycosides of N-acetylneuraminic acid. Tetrahedron Lett. 39, 3065–3068. Endo, A., Iida, M., Fujita, S., Numata, M., Sugimoto, M., and Nunomura, S. (1995). Total synthesis of sulfated Lea pentaosyl ceramide. Carbohydr. Res. 270, C9–C13. Fujikawa, K., Nohara, T., Imamura, A., Ando, H., Ishida, H., and Kiso, M. (2010). A cyclic glucosyl ceramide acceptor as a versatile building block for complex ganglioside synthesis. Tetrahedron Lett. 51, 1126–1130. Fuse, T., Ando, H., Imamura, A., Sawada, N., Ishida, H., Kiso, M., Ando, T., Li, S.-C., and Li, Y.-T. (2006). Synthesis and enzymatic susceptibility of a series of novel GM2 analogs. Glycoconj. J. 23, 329–343. Imamura, A., Ando, H., Ishida, H., and Kiso, M. (2009). Ganglioside GQ1b: Efficient total synthesis and the expansion to synthetic derivatives to elucidate its biological roles. J. Org. Chem. 74, 3009–3023. Imamura, A., Yoshikawa, T., Komori, T., Ando, M., Ando, H., Wakao, M., Suda, Y., Ishida, H., and Kiso, M. (2008). Design and synthesis of versatile ganglioside probes for carbohydrate microarrays. Glycoconj. J. 25, 269–278. Iwayama, Y., Ando, H., Ishida, H., and Kiso, M. (2009). A first synthesis of ganglioside HLG-2. Chem. Eur. J. 15, 4637–4648. Kaida, K., Sonoo, M., Ogawa, G., Kamakura, K., Ueda-Sada, M., Arita, M., Motoyoshi, K., and Kusunoki, K. (2008). GM1/GalNAc-GD1a complex: A target for pure motor Guillain-Barre´ syndrome. Neurology 71, 1683–1690. Kameyama, A., Ishida, H., Kiso, M., and Hasegawa, A. (1991). Synthetic studies on sialylglycoconjugates. 13. Stereoselective synthesis of sialyl-lactotetraosylceramide and sialylneolactotetraosylceramide. Carbohydr. Res. 200, 269–285. Koga, M., Yuki, N., Ariga, T., Morimatsu, M., and Hirata, K. (1998). Is IgG anti-GT1a antibody associated with pharyngeal-brachial weakness or oropharyngeal palsy in Guillan-Barre´ syndrome? J. Neuroimmunol. 86, 74–79. LeGoff, E. (1964). Cyclopropanes from an easily prepared, highly active zinc–copper couple, dibromomethane, and olefins. J. Org. Chem. 29, 2048–2050. Lingwood, D., and Simons, K. (2010). Lipid rafts as a membrane-organizing principle. Science 327, 46–50. Tyrrell, D., James, P., Rao, N., Foxall, C., Abbas, S., Dasgupta, F., Nashed, M., Hasegawa, A., Kiso, M., Asa, D., Kidd, J., and Brandley, B. K. (1991). Structural requirements for the carbohydrate ligand of E-selectin. Proc. Natl Acad. Sci. USA 88, 10372–10376. Vyas, A. A., Patel, H. V., Fromholt, S. E., Heffer-Lauc, M., Vyas, K. A., Dang, J., Schachner, M., and Schnaar, R. L. (2002). Gangliosides are functional nerve cell ligands for myelin-associated glycoprotein (MAG), an inhibitor of nerve regeneration. Proc. Natl Acad. Sci. USA 99, 8412–8417. Yang, L. J.-S., Zeller, C. B., Shaper, N. L., Kiso, M., Hasegawa, A., Shapiro, R. E., and Schnaar, R. L. (1996). Gangliosides are neuronal ligands for myelin-associated glycoprotein. Proc. Natl Acad. Sci. USA 93, 814–818. Yoshikawa, T., Kato, Y., Yuki, N., Yabe, T., Ishida, H., and Kiso, M. (2008). A highly efficient construction of GM1 epitope tetrasaccharide and its conjugation with KLH. Glycoconj. J. 25, 545–553.
C H A P T E R
T W E N T Y- S I X
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars Seok-Ho Yu,* Michelle R. Bond,*,† Chad M. Whitman,*,† and Jennifer J. Kohler* Contents 542 545 545
1. Introduction 2. Synthesis of Photocrosslinking Sugars 2.1. Materials 3. Metabolic Incorporation of Photocrosslinkers into Glycans in Cell Culture 4. Analysis of CMP-Sialic Acids in Cell Lysates by HPAEC 5. Cell Surface Display of SiaDAz in Sialic Acid-Deficient Cells 5.1. Detection of total cell surface sialic acid 5.2. Detection of a2-3 and a2-6 cell surface sialic acid 6. Characterization of SiaDAz-Containing Gangliosides 7. Covalent Capture of Glycan-Mediated Interactions Using Photocrosslinking Sialic Acid 8. Conclusion Acknowledgments References
548 550 552 554 554 555 557 559 559 560
Abstract Protein–carbohydrate interactions play essential roles in a variety of biological processes. This class of interactions is particularly important in development, immunology, infection, and carcinogenesis. However, the transient nature of glycan-dependent interactions hampers efforts to detect and characterize these complexes. Photocrosslinking is emerging as a powerful tool to discover and study glycan-dependent complexes. Through the use of photocrosslinking groups, UV irradiation can be employed to introduce a covalent bond between two transiently interacting molecules. Here we describe the use of metabolic * Division of Translational Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, USA Department of Chemistry, Stanford University, Stanford, California, USA
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)47826-5
#
2010 Elsevier Inc. All rights reserved.
541
542
Seok-Ho Yu et al.
oligosaccharide engineering to incorporate a photocrosslinkable sugar into cellular glycoconjugates and the use of this photocrosslinker to covalently capture glycan-mediated interactions.
1. Introduction Glycan-mediated interactions constitute the underlying molecular basis for a wide variety of biological processes. In some cases, the participants in these binding events have been clearly identified. For example, the recruitment of white blood cells to inflamed tissue is dependent on the interaction of glycan-binding selectins with a glycosylated form of P-selectin glycoprotein ligand-1 (PSGL-1) (McEver and Cummings, 1997; Somers et al., 2000). The exact structure of the glycan attached to PSGL-1 dictates the affinity of this interaction (Li et al., 1996). Glycan-mediated binding events are also critical to infectious diseases: many host–bacteria recognition events depend on glycans, as does most host–virus recognition (Imberty and Varrot, 2008). The invasion of host cells by secreted toxins of bacteria can also depend on glycan-mediated interactions: for example, Vibrio cholerae toxin binds to GM1 ganglioside displayed on the surface of the host’s intestinal epithelium, allowing the toxin to enter epithelial cells (Merrit et al., 1994; Wernick et al., 2010). Notwithstanding these important examples, detailed knowledge of glycan-mediated interactions is rare. In some cases, a protein is known to have glycan-binding activity, but its natural ligand is not known. For example, the siglecs (sialic acid-binding Ig-like lectins) are a family of proteins that bind sialylated glycoconjugates. Information about siglecs’ glycan-binding preferences can be gleaned from in vitro experiments (Blixt et al., 2003), but it remains challenging to identify the ‘‘carrier’’ proteins or lipids to which those glycans are attached in siglecs’ natural ligands (Varki, 2009). Conversely, there are numerous cases where a particular biological activity is attributed to a specific glycoconjugate, but unambiguously determining the existence and identity of a glycoconjugate’s binding partner remains a challenge. For example, it was only 2 years ago that DC-SIGN (dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin) was identified as a receptor that specifically binds to Fc fragments that are modified with glycans terminating in a2-6-linked sialic acids (Anthony et al., 2008a,b). This binding event is proposed to mediate the anti-inflammatory activity of sialylated, intravenous IgG. Difficulties in identifying the players in glycan-mediated binding events can be attributed to a number of factors. First, many techniques that are commonly used to identify protein–protein interaction partners (yeast twohybrid assays, phage display, use of recombinant proteins for affinity
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
543
purification) fail to add essential glycans to the proteins undergoing analysis. Second, glycan-dependent interactions typically have low affinity, with high micromolar or even millimolar equilibrium dissociation constants. For example, the commonly used lectin wheat germ agglutinin (WGA) binds the ligand N-acetylglucosamine (GlcNAc) with a Kd of 2.4 mM (Bains et al., 1992). For more complex glycoprotein ligands, affinities can be somewhat stronger: monomeric L-selectin binds a glycosylated GlyCAM-1 (glycosylation-dependent cell adhesion molecule 1) ligand with a Kd of 108 mM (Nicholson et al., 1998). Multivalent display enables these low affinity interactions to be relevant in a physiological environment. But when complexes are removed from the cellular context, multivalent presentation is lost. As a result, glycan-dependent complexes generally dissociate rapidly and do not survive the purification steps that are typically necessary for analysis. To surmount the challenges associated with characterizing glycanmediated binding events, we have begun employing a photocrosslinking strategy to introduce covalent bonds between glycosylated binding partners while these complexes are still in their native context (Bond et al., 2009; Tanaka and Kohler, 2008; Bond et al., 2010). Cells or tissue containing crosslinked complexes can be lysed and analyzed to identify the components of the complex. By covalently capturing the low affinity glycan-mediated complexes in their native context, one can obtain important information about ephemeral, yet essential, binding events. To introduce photocrosslinking groups into cellular glycoconjugates, we take advantage of the metabolic oligosaccharide engineering approach that has been used to incorporate a variety of unnatural functional groups into cell surface sialosides (sialic acid-containing glycoconjugates). In a 1992 report, Reutter and coworkers demonstrated that N-acyl-substituted mannosamines can be metabolized to cell surface sialosides in a living rat (Kayser et al., 1992). Further work established that cellular sialic acid engineering can be accomplished either by the use of sialic acid analogs, which the cell converts to their CMP-sialic acid counterparts before transferring the sialic acids to glycoconjugates, or by intercepting the sialic acid biosynthetic pathway through the use of N-acetylmannosamine (ManNAc) analogs, which are first metabolized to sialic acid analogs in three enzymatic steps (Fig. 26.1). (For reviews of sialic acid metabolic engineering see Du et al. (2009), Dube and Bertozzi (2003), and Keppler et al. (2001).) To incorporate photocrosslinking groups into sialosides, we have prepared both ManNAc and sialic acid analogs containing the diazirine crosslinker (Tanaka and Kohler, 2008; Tanaka et al., 2008), while others have introduced aryl azides into both ManNAc and sialic acid analogs (Han et al., 2005; Luchansky et al., 2004). These compounds can be metabolized to photocrosslinking glycoproteins and glycolipids in a native cellular environment. Upon UV irradiation, the photocrosslinking glycoconjugates are crosslinked to neighboring molecules, in effect providing a ‘‘snapshot’’
544
Seok-Ho Yu et al.
OAc OAc
ManNAc: R = CH3
AcO
ManNDAz: R =
R
O
HN
R CO2Me OAc
AcO O
N N
Protected sialic acid analogs O AcO AcO AcO
HN O
R OAc
Nonspecific esterases
Protected ManNAc analogs OH
OH
HO
O
HN
Nonspecific esterases
HN O
OH
CMP-Neu5Ac synthase
HO O
NeuAc-9-P-phosphatase NeuAc-9-P-synthase ManNAc-6-kinase
O HO HO HO
R
–
CO2
OH O
HN
R
UDP-GlcNAc 2-epimerase OH
OH HO R
UDP-GlcNAc
O-CMP CO2–
HO O
Figure 26.1 Metabolism of photocrosslinking sugars to photocrosslinking sialosides. Metabolic oligosaccharide engineering takes advantage of the endogenous pathway responsible for the conversion of ManNAc to sialosides, such as the protein bearing an N-linked glycan depicted here. Cells are cultured with ManNAc analogs whose hydroxyl groups are protected as acetate esters. These protecting groups facilitate passive transport across the plasma membrane and are removed by nonspecific esterases once the molecule enters the cell. Alternatively, cells can be cultured with peracetylated, methyl-esterified sialic acid analogs that are processed in a similar manner. In either case, the analogs are converted to CMP-sialic acid analogs that serve as substrates for sialyltransferases, which transfer the sialic acid analogs to glycoproteins and glycolipids.
of glycan-mediated interactions. A variety of analytical methods can be used to identify the components of crosslinked complexes. This chapter describes a method to prepare a diazirine-containing ManNAc analog (ManNDAz) in a membrane-permeable form (Ac4-ManNDAz). It also describes the use of high-performance anion exchange chromatography (HPAEC) to monitor the metabolism of Ac4-ManNDAz to diazirine-containing CMP-sialic acid (CMP-SiaDAz) and the utility of flow cytometry to detect the appearance of photocrosslinking sialic acids on the cell surface. In addition, we present methods to detect the incorporation of diazirine-containing sialic acid into cellular glycolipids. The analytical protocols provided here can easily be adapted to study the metabolism of other ManNAc analogs, a wide variety of which have been reported (Du et al., 2009). Finally, we describe how to use the photocrosslinking compounds by providing a protocol to conduct cellular crosslinking experiments with them.
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
545
2. Synthesis of Photocrosslinking Sugars We typically use peracetylated monosaccharides for metabolic incorporation experiments. Others have demonstrated that peracetylated ManNAc analogs are metabolized to sialosides up to 900-fold more efficiently than unprotected ManNAc analogs ( Jones et al., 2004). This gain in incorporation efficiency has been attributed to increased ability of less polar molecules to diffuse across the plasma membrane. Once the protected compounds enter a cell, the acetyl groups are removed, presumably by nonspecific esterases (Fig. 26.1; Sarkar et al., 1995). The compounds described here contain the diazirine crosslinker. We choose to use this particular crosslinker because of its small size, which is expected to minimize interference with the compounds’ metabolism and the ability of the modified sialosides to engage in their normal binding interactions. Along with the potential to sterically interfere with binding interactions, modifications to sialic acid could also prevent the formation of normal sialic acid modifications, such as O-acetylation, O-phosphorylation, and O-lactylation (Yu and Chen, 2007). In the compounds described here, the crosslinker is attached to the N-acyl side chain of the monosaccharide. Modification at the N-acyl position is compatible with 9-O-acetylation, a modification that is known to regulate sialic acid-dependent binding events (Cariappa et al., 2009), but precludes hydroxylation of the N-acetyl group, a variation that is abundant in many species (Varki, 2001). For this reason, there are cases where it would be more appropriate to use analogs that introduce the crosslinker at the C9 position of sialic acid (Han et al., 2005). The syntheses of both N-acyl diazirine-modified ManNAc (ManNDAz) and sialic acid (SiaDAz) are described below (Fig. 26.2), with the ManNDAz compound being simpler to prepare. In most cases, the ManNAc analog can be used, relying on the cellular machinery to convert it to the sialic acid counterpart, but SiaDAz may lead to more efficient incorporation (Luchansky et al., 2004; Oetke et al., 2002), so in some cases the additional synthetic steps may be warranted.
2.1. Materials All chemicals were obtained from Sigma-Aldrich, unless otherwise noted. 2.1.1. Ac4-ManNDAz (6) Synthesis of diazirine-derivatized mannosamine (ManNDAz) was performed by coupling a diazirine-containing carboxylic acid (3) with mannosamine hydrochloride (4) (Bond et al., 2009). Briefly, levulinic acid (1, 7.36 g, 65.7 mmol) was mixed with 7 N ammonia in methanol (MeOH, 70 mL) for 3 h at 0 C, followed by dropwise addition of hydroxylamine-O-sulfonic
546
Seok-Ho Yu et al.
O HO O
1
HO HO HO
7N NH3 / MeOH H2NOSO3H 0ºC-RT
O HO
HN
HO
MeOH 0ºC
NH
2
N
N
3
O
O
NH3+CI– O
3 HO WSC, HOBt, HO HO OH TEA MeOH
4
O
I2, TEA
HN O
5
Ac2O N
N
AcO
Pyridine
OH
AcO AcO
HN O
6
N
N
OAc
Sodium pyruvate NeuAc aldolase NaN3, pH7.2 37ºC, 16-20h OH
N
N
OH
HO HN
O HO
O
7
CO2– OH
OAc OAc 1) TFA / MeOH 2) Ac2O, pyridine N
N
AcO HN
O
CO2Me OAc
AcO O
8
Figure 26.2 Synthesis of Ac4-ManNDAz and Ac5-methyl-SiaDAz. Synthesis of the diazirine side chain begins from levulinic acid (1), which is converted to a diaziridine acid (2) and, subsequently, to a diazirine acid (3). The diazirine acid (3) is coupled to mannosamine (4) to form ManNDAz (5), which is converted to a cell permeable form, Ac4-ManNDAz (6), by peracetylation. The control molecule Ac4-GlcNDAz can be prepared by using glucosamine in place of mannosamine (4). Use of the diazirinemodified sialic acid, rather than the ManNAc analog, can improve incorporation efficiency. SiaDAz (7) is prepared from ManNDAz (5) by an aldol reaction with pyruvate that is catalyzed by NeuAc aldolase. SiaDAz is protected by methyl esterification and peracetylation to yield Ac5-methyl-SiaDAz (8).
acid (8.55 g, in 100 mL MeOH). Further stirring at room temperature overnight provides the diaziridine carboxylic acid (2). After filtration, the resulting solution was concentrated by evaporation. To the crude mixture of diaziridine 2 and triethylamine (TEA) (20 mL) in MeOH (40 mL), iodine (12.3 g, 48.6 mmol) was added in portions, until the solution remained consistently deep brown. This reaction produced the diazirine carboxylic acid (3) as oil (5.25 g, 60% over two steps). The coupling of diazirine carboxylic acid (3, 1.05 equiv) with mannosamine hydrochloride (4, 1.0 equiv) was performed with N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDCHCl, 2.0 equiv), 1-hydroxy-benzotriazole hydrate (HOBt, 1.0 equiv), and TEA (2.0 equiv) in MeOH (4 mL/mmol of mannosamine hydrochloride). The resulting mixture was partially purified by flash silica gel chromatography (MeOH:CH2Cl2 ¼ 1:8) to give a crude ManNDAz (5) and subsequent acetylation was performed. After stirring crude 5 in acetic anhydride (Ac2O) and pyridine overnight, the resulting
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
547
mixture was partitioned between 1 N HCl and ethyl acetate. The organic phase was washed with aqueous sodium bicarbonate, dried with sodium sulfate, and then concentrated in vacuo to provide crude Ac4-ManNDAz (6). Purification of the crude Ac4-ManNDAz by flash silica gel chromatography (35–50% ethyl acetate/hexanes gradient) gave pure Ac4-ManNDAz (6, 28– 65% yield over two steps). 1H NMR (400 MHz, CDCl3, major anomer): d 1.06 (s, 3H), 1.73–1.85 (m, 2H), 2.00–2.16 (m, 2H), 2.02 (s, 3H), 2.07 (s, 3H), 2.11 (s, 3H), 2.19 (s, 3H), 4.03–4.08 (m, 2H), 4.29 (dd, J ¼ 5.6, 12.8 Hz, 1H), 4.65 (ddd, J ¼ 1.2, 4.4, 9.2 Hz, 1H), 5.20 (t, J ¼ 10.0 Hz, 1H), 5.34 (dd, J ¼ 4.4, 10.4 Hz, 1H), 5.95 (d, J ¼ 9.2 Hz, 1H), 6.03 (d, J ¼ 2.0 Hz, 1H). 13 C NMR (100 MHz, CDCl3, major anomer): d 19.9, 20.6, 20.7, 20.7, 20.8, 25.3, 29.7, 30.4, 49.2, 62.0, 65.3, 68.8, 70.1, 91.5, 168.1, 169.6, 170.0, 170.6, and 171.5. ESI-MS: C19O10N3H27 m/z calcd 457.16, found 457.18 (Bond et al., 2009). 2.1.2. Ac5-methyl-SiaDAz (8) Ac5-methyl-SiaDAz (8) was synthesized from the crude ManNDAz (5) by an enzymatic reaction with N-acetylneuraminic acid (NeuAc) aldolase (Tanaka and Kohler, 2008). Briefly, to a solution of ManNDAz (100 mM), sodium pyruvate ( 1.0 M ) in potassium phosphate buffer (pH 7.2), sodium azide (0.05%) and NeuAc aldolase (3.7 U/mL) were added. After overnight incubation at 37 C, the reaction mixture was partly purified by anion exchange column (Dowex 1 2, Cl form) to afford colorless oil. This colorless oil was dissolved in MeOH (3 mL), trifluoroacetic acid (TFA) was added (2 drops in 3 mL), and the mixture was stirred overnight at room temperature. After removal of the solvent in vacuo, the residue was purified by flash column chromatography (CH2Cl2:MeOH ¼ 1:0, 10:1, 4:1 gradient) to afford methyl-5-SiaDAz (25% in 2 steps) as a white solid. Subsequent acetylation in Ac2O and pyridine followed by flash silica gel chromatography (ethyl acetate) provided Ac5-methyl-SiaDAz (8). 1H NMR (400 MHz, CDCl3, major anomer): d 1.02 (s, 3H), 1.63–1.83 (m, 4H), 1.90–2.00 (m, 1H), 2.04 (s, 3H), 2.05 (s, 3H), 2.06 (s, 3H), 2.14 (s, 3H), 2.16 (s, 3H), 2.56 (dd, J ¼ 4.8, 13.6 Hz, 1H), 3.79 (s, 3H), 4.03–4.18 (m, 3H), 4.48 (dd, J ¼ 2.8, 12.4 Hz, 1H), 5.05–5.09 (m, 1H), 5.24–5.30 (m, 1H), 5.33–5.38 (m, 2H). 13C NMR (100 MHz, CDCl3, major anomer): d 19.9, 20.7, 20.8, 20.8, 20.9, 20.9, 25.4, 29.2, 30.5, 35.9, 49.2, 53.2, 62.0, 67.7, 68.0, 71.2, 72.7, 97.4, 166.3, 168.2, 170.2, 170.2, 170.6, 171.0, and 171.4. HRMS MS (ES-TOF): C25H34N3O14Na [M þ Na]þ, calcd 624.2017, found 624.2016. 2.1.3. Ac4-GlcNDAz Ac4-GlcNDAz was synthesized by coupling of diazirine-containing carboxylic acid (3) with glucosamine hydrochloride by a similar procedure used for the synthesis of Ac4-ManNDAz (5) except that the purification was modified due to GlcNDAz’s poor solubility. Briefly, after the coupling reaction
548
Seok-Ho Yu et al.
of glucosamine hydrochloride with 3, the crude-coupled product GlcNDAz was obtained by simple filtration instead of silica gel chromatography (59%). After drying in vacuo, GlcNDAz was acetylated in a mixture of Ac2O and pyridine by stirring overnight. After concentration of the reaction mixture, recrystallization (from ethyl acetate and hexanes) gave Ac4GlcNDAz (37%, mixture of anomers) after filtration. Further purification of the filtrate by silica gel chromatography provided additional Ac4-GlcNDAz (58%, mixture of anomers). 1H NMR (400 MHz, CDCl3, a anomer): d 1.01 (s, 3H), 1.74–1.79 (m, 2H), 1.83–1.93 (m, 2H), 2.05 (s, 3H), 2.07 (s, 3H), 2.10 (s, 3H), 2.20 (s, 3H), 3.98–4.02 (m, 1H), 4.07 (dd, J ¼ 2.4, 12.4 Hz, 1H), 4.25–4.30 (m, 2H), 5.19–5.28 (m, 2H), 5.59 (d, J ¼ 8.8 Hz, 1H), 6.19 (d, J ¼ 3.6 Hz, 1H). 13C NMR (100 MHz, CDCl3, a anomer): d 20.0, 20.5, 20.7, 20.8, 20.9, 25.3, 29.2, 30.3, 51.1, 61.5, 67.4, 69.6, 70.5, 90.4, 168.6, 169.1, 171.2, 171.2, and 171.8. HRMS MS (ES-TOF): C19H27N3O10Na [M þ Na]þ, calcd 480.1594; found 480.1597.
3. Metabolic Incorporation of Photocrosslinkers into Glycans in Cell Culture To perform metabolic oligosaccharide labeling, cells are cultured with the peracetylated, photocrosslinking ManNAc analog (Ac4-ManNDAz). The protocol below describes conditions suitable for BJAB and Jurkat cells, but the ideal culturing conditions will vary slightly for different cell types. We also include several control molecules in this protocol. Ac4ManNAc is the peracetylated form of the natural ManNAc metabolite. The use of this molecule allows us to identify any effects that are due to increased flux through the sialic acid biosynthetic pathway or the liberated acetyl protecting groups, but are not diazirine-dependent. We also often use a peracetylated, azide-containing ManNAc analog, Ac4-ManNAz (Laughlin and Bertozzi, 2007; Luchansky et al., 2003a), as a positive control for sialoside incorporation. Ac4-ManNAz is efficiently metabolized to azide-containing sialic acid (SiaNAz), which is incorporated into cellular glycoconjugates (Saxon and Bertozzi, 2000). Further, SiaNAz incorporation can be monitored readily through the use of chemoselective reactions ( Jewett et al., 2010; Saxon and Bertozzi, 2000; Vsevolod et al., 2002). Finally, we use Ac4-GlcNDAz to provide additional information about the pathway or pathways through which Ac4-ManNDAz is metabolized. When we detect crosslinking in experiments conducted with Ac4-ManNDAz, but not those conducted with Ac4-GlcNDAz, we conclude that the crosslinking results from diazirine-modified sialosides and not from other metabolites derived from GlcNDAz (Luchansky et al., 2003b).
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
549
Cultured cells that harbor mutations in glycosylation pathways provide a valuable tool for studying the metabolism of unnatural sugars. In particular, the K20 subclone of the human BJAB Burkitt-like lymphoma cell line and the Chinese hamster ovary (CHO) cell mutant Lec3 both fail to produce sialosides when cultured in the absence of serum. In both cases, the sialylation defect can be attributed to a deficiency in UDP-GlcNAc 2-epimerase activity (Hong and Stanley, 2003; Keppler et al., 1999). Cells that lack this activity are unable to convert UDP-GlcNAc to ManNAc, which is the first committed precursor in sialoside synthesis (Fig. 26.1). However, these cells maintain the ability to convert ManNAc to sialosides. As a result, culturing the cells with ManNAc or with sialic acid restores cell surface sialylation. Similarly, when the cells are cultured with ManNAc or sialic acid analogs, sialylation can also be restored. The sialosides that appear on the surface of the cells are assumed to be derived from the exogenous precursors and their presence signifies that all of the enzymes in the metabolic pathway tolerated the modifications that were present in the analogs. Unless otherwise noted, cells were maintained in a water-saturated atmosphere at 37 C and 5% CO2. BJAB K88 and K20 (Keppler et al., 1999) cells were cultivated in RPMI 1640 media containing 2 mM L-glutamine and supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 mg/mL streptomycin. Typically, cell densities were maintained between 2.5 105 and 2.0 106 cells/mL. To generate BJAB cells in serum-free conditions, the cells were grown in RPMI 1640 media with 2 mM L-glutamine containing 1 Nutridoma SP (Roche, #11011375001), 50 U/mL penicillin, and 50 mg/mL streptomycin. Cells were cultured for two passages at 2.5 105 cells/mL in media for 72 h prior to supplementation with monosaccharides. Jurkat cells were grown and maintained in RPMI 1640 with 2 mM L-glutamine containing 10% heat-inactivated FBS (fetal bovine serum). Cells were maintained between 2.0 105 and 2.0 106 cells/mL in media and grown for 48 h between passages. Prior to the addition of cells to a tissue culture dish, ethanol or a monosaccharide (Ac4-ManNAc, Ac4-ManNDAz, or Ac4-GlcNDAz) in ethanol was added to achieve a final concentration of 100 mM in the media. The ethanol was allowed to evaporate prior to adding cells. Cells were then seeded at a density of 3.0 105 cells/mL (BJAB) or 2.5 105 cells/mL ( Jurkat) and cultured for 72 h with the compounds. After growth in the presence of the appropriate monosaccharides, cells were harvested and their viability assessed using Trypan blue dye staining with the Countess Automated Cell Counter (Invitrogen). After culturing cells with monosaccharides, metabolism of the added sugars can be examined by a variety of methods. Cell lysates can be interrogated by HPAEC to identify CMP-sialic acids, cell surfaces can be probed by flow cytometry to observe cell surface sialosides, and lipid extracts can be analyzed by mass spectrometry to detect gangliosides.
550
Seok-Ho Yu et al.
4. Analysis of CMP-Sialic Acids in Cell Lysates by HPAEC HPAEC performed with a CarboPac PA1 column (Dionex) is an effective tool for analysis of cellular nucleotides and nucleotide sugars (Tomiya et al., 2001). After culturing cells with peracetylated monosaccharides, metabolic conversion of ManNAc, ManNDAz, and ManNAz to their CMP-sialic acid counterparts can be analyzed by HPAEC. HPAEC with CarboPac PA1 can be performed using either a standard HPLC system (Dynamax SD-200) with UV detection (Dynamax, UV-C), suitable for the analysis of nucleotide sugars, or a Dionex HPAEC system (Dionex, ICS3000) with electrochemical detection (Dionex), which enables the analysis of molecules, such as monosaccharides, that lack strong UV absorbance. By using HPAEC with an optimized elution method, the abundant CMP-sialic acid, CMP-Neu5Ac, can be identified, along with CMP-SiaDAz, CMPSiaNAz, and other metabolites, which are separated sufficiently to allow both qualitative and quantitative analysis. Preparation of cell lysates for HPAEC analysis was performed as follows. After 72 h of cultivation with a monosaccharide, the cells were harvested by centrifugation at 200g and washed two times with 1 DPBS (Dulbecco’s phosphate-buffered saline, Invitrogen). After removing the supernatant, the resulting cell pellet was lysed in 75% ethanol (200–500 mL for 2 106– 10106 cells) by sonication (three times for 5 s each) (VirSonic 100, VirTis, Gardiner, NY). The resulting suspension was centrifuged at 20,000 g for 10 min at 4 C. The supernatant was collected in a microcentrifuge tube and concentrated by rotary evaporation in a Savant SpeedVac in the dark without heating (2–3 h). The concentrated residue was resuspended in 40 mM sodium phosphate buffer (pH 7.0, 20 mL/million cells) and then filtered through an Amicon Ultra centrifugal filter unit (Millipore, 10,000 MWCO) at 16,000 g for 30 min. Typically, HPAEC analysis was performed by injecting 20 mL of lysate ( 1 106 cells) into a 20 mL sample loading loop before the sample enters a guard column (Dionex, 4 50 mm) and then an analytical column (Dionex, 4 250 mm). The eluents used were 1.0 mM NaOH (E1) and 1.0 M NaOAc and 1.0 mM NaOH (E2). Low-carbonate NaOH (50% in water) was obtained from Fisher Scientific (SS254-1) and NaOAc was from Calbiochem (567418). Unless otherwise noted, HPAEC was run with a flow rate ¼ 1 mL/min and the following gradient elution was performed: T0 min ¼ 2% E2, T2 ¼ 2% E2, T30 ¼ 30% E2, T40 ¼ 30% E2, T41 ¼ 55% E2, T60 ¼ 55% E2, T63 ¼ 100% E2, T72 ¼ 100% E2, T75 ¼ 2% E2, T81 ¼ 2% E2. Injection of standard compounds demonstrated retention times of 22.3 min for CMP and 23.0 min for CMP-Neu5Ac.
551
CDP UMP UDP-GaINAc UDP-GlcNAc
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
AMP
20
mV
15
10
5
mV
CMP
15
10
40
50
min
AMP
20
30
CMP-Neu5Ac
20
CMP-SiaDAz CMP-SiaNAz
10
Ac4-ManNAc Ac4-ManNAz Ac4-ManNDAz
5
Ac4-GlcNDAz Ethanol
1 20
25
30
35
min
Figure 26.3 HPAEC analysis of metabolic incorporation of unnatural sugars in Jurkat cells. Jurkat cells were cultured with Ac4-ManNAc, Ac4-ManNAz, Ac4-ManNDAz, Ac4-GlcNDAz, or no compound. The cell lysates were prepared and analyzed by HPAEC with UV detection (260 nm) to identify nucleotide sugars. The entire HPAEC trace is shown at the top and the region where CMP-sialic acids elute is magnified at the bottom. Culturing cells with Ac4-ManNAc leads to a dramatic increase in CMP-Neu5Ac, while cells cultured with Ac4-ManNAz and Ac4-ManNDAz produce new species that are assigned as CMP-SiaNAz and CMP-SiaDAz. No detectable CMPSiaDAz is observed for cells cultured with Ac4-GlcNDAz.
Also, the retention times of other nucleotides such as AMP, CDP, UMP, UDP-sugars were determined, as shown in Fig. 26.3. Jurkat cells cultured with 100 mM Ac4-ManNAc showed a dramatic increase in CMP-Neu5Ac production, as detected by UV absorbance at 260 nm (Fig. 26.3). When Jurkat cells were cultured with the azide-containing ManNAc analog, Ac4-ManNAz, a new peak appeared at 25.7 min. We interpret this new peak to correspond to CMP-SiaNAz formed from the metabolism of ManNAz. When Jurkat cells were cultured with Ac4-ManNDAz, a peak believed to be CMP-SiaDAz was observed at 25.5 min. When Jurkat cells were cultured with Ac4-GlcNDAz, no CMP-SiaDAz was detected, suggesting
552
Seok-Ho Yu et al.
that GlcNDAz is not metabolized to ManNDAz through UDP-GlcNDAz. Interestingly, a minor peak was detected at 24.3 min in both Ac4-ManNAc- and Ac4-GlcNDAz-treated Jurkat cell lysates. Although we have not definitively identified this peak, its retention time is similar to that of CMP-Neu5Gc (CMP-N-glycolylneuraminic acid). For BJAB K20 cells, similar results were obtained, although the observations are less dramatic (Fig. 26.4). Because BJAB K20 cells lack UDPGlcNAc 2-epimerase activity, they do not normally make sialic acids, but culturing the cells with Ac4-ManNAc readily leads to detectable levels of CMP-Neu5Ac (Fig. 26.4A). As a positive control, we also analyzed the BJAB K88 cell line, which does have UDP-GlcNAc 2-epimerase activity (Keppler et al., 1999), and were able to detect CMP-Neu5Ac, as expected. The production of CMP-SiaDAz in K20 cells treated with Ac4-ManDAz can also be visualized by HPAEC but is unfortunately obscured by an unidentified component of K20 cells that has a similar retention time. However, we were able to verify CMP-SiaDAz production in K20 cells by UV irradiation followed by HPAEC analysis with electrochemical detection. UV irradiation with 365 nm light activates the diazirine to a carbene, which is converted to an alcohol (by OH-insertion) or an olefin (by elimination) in aqueous solution. Likewise, UV irradiation of cell lysate containing CMP-SiaDAz leads to the disappearance of the CMP-SiaDAz peak and the appearance of a new group of peaks that uniquely identify CMP-SiaDAz (like a fingerprint) (Fig. 26.4B). Analysis of lysates from both the Jurkat and K20 cells cultured with Ac4-ManNDAz shows the same pattern of UV-induced peaks, along with the disappearance of the CMPSiaDAz peak, confirming that the same diazirine-containing molecule is produced in both cell types. Individual peaks from HPAEC can be collected and analyzed by mass spectrometry. Typically, the sample containing NaOAc and NaOH is passed through a cation exchange column (Dowex 50WX8-100, ammonium form) and then ammonium acetate is removed from the eluted analyte by lyophilization. MALDI-TOF MS (matrix-assisted laser desorption/ionization-time of flight mass spectrometry) analysis with THAP (2,4,6-trihydroxyacetophenone) as matrix provides good results for nucleotide sugars.
5. Cell Surface Display of SiaDAz in Sialic AcidDeficient Cells The azide-containing sialic acid analog, SiaNAz, engages in chemoselective reactions that enable detection of its appearance on the cell surface. In contrast, cell surface display of diazirine-containing SiaDAz cannot be easily monitored. To track the metabolism of Ac4-ManNDAz to diazirine-
553
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
CMP
mV
5.0 4.5 4.0
CMP-SiaDAz
5.5
Unkonwn
6.0
CMP-Neu5Ac
A
Jurkat-Ac4-ManNDAz K20-Ac4-ManNDAz K20-Ac4-ManNAc K20-Ethanol
3.5
K88-Ethanol
1.0
nC
10 8 6 4 2 0 –2 –4 –6 –8 –10 –12
27.5
30.0
CMP-SiaDAz
25.0
B
32.5
min
27
min
Jurkat-Ac4-ManNDAz Jurkat-Ac4-ManNDAz + UV K20-Ac4-ManNDAz K20-Ac4-ManNDAz + UV
15
16
17
18
19
20
21
22
23
24
25
26
Figure 26.4 Comparison of Ac4-ManNDAz metabolism on Jurkat cells and BJAB cells. BJAB K20 cells were cultivated with Ac4-ManNDAz, Ac4-ManNAc, or no compound. (A) The cell lysates were prepared and analyzed by HPAEC with UV detection (260 nm) to identify nucleotide sugars. Culturing cells with Ac4-ManNAc leads to the appearance of CMP-Neu5Ac, which is also observed in the sialylation-competent BJAB K88 subclone. Cells cultured with Ac4-ManNDAz produce a new species with the retention time of CMP-SiaDAz, but another metabolite obscures this signal. HPAEC was performed by the following elution gradient: T0 min ¼ 2% E2, T2 ¼ 2% E2, T40 ¼ 30% E2, T41 ¼ 55% E2, T60 ¼ 55% E2, T63 ¼ 100% E2, T72 ¼ 100% E2, T75 ¼ 2% E2, T81 ¼ 2% E2. (B) To confirm the identity of CMP-SiaDAz, cell lysates were UV irradiated prior to HPAEC analysis with electrochemical detection. UV irradiation results in the disappearance of the putative CMP-SiaDAz peak (#) and the appearance of a new set of peaks (*) identical to those observed for the Jurkat sample.
containing sialosides, we make use of the BJAB K20 cell line, which displays a diminished ability to produce sialosides (Keppler et al., 1999). When BJAB K20 cells are cultured with ManNAc or ManNAc analogs, they are capable of metabolizing these molecules to sialosides. Therefore, when BJAB K20
554
Seok-Ho Yu et al.
cells are cultured with Ac4-ManNDAz under serum-free conditions (where they cannot scavenge sialic acid from the media), we can measure an increase in cell surface sialic acid, which is interpreted to be SiaDAz. Sialylated cell surface glycoconjugates can be detected by flow cytometry using lectins specific for different sialosides (Bond et al., 2009). We use Sambucus nigra agglutinin (SNA), which recognizes a2-6-linked sialic acid (Shibuya et al., 1987), and Maackia amurensis agglutinin (MAA), which recognizes a2-3-linked sialic acid (Wang and Cummings, 1988). Alternatively, total cell surface sialic acid can be measured using the periodate oxidation and aniline-catalyzed oxime ligation (PAL) method recently reported by the Paulson group (Zeng et al., 2009).
5.1. Detection of total cell surface sialic acid The following protocol follows the recently reported PAL method, with slight modifications (Zeng et al., 2009). After culturing with monosaccharides, cells were resuspended in PBS (phosphate-buffered saline, pH ¼ 7.4) and aliquoted in a Costar v-bottom 96-well plate (Corning, #3897) with approximately 4.0105 cells per well. Cells were pelleted by centrifugation (650g for 4 min at 4 C) and the supernatant removed by inverting the plate over a sink. Cells were washed a total of three times in the same manner with PBS (pH ¼ 7.4). Next, cells were resuspended in 200 mL of 1 mM NaIO4 in PBS (pH ¼ 7.4) and incubated for 30 min on ice. To the sodium periodate solution, 50 mL of 5 mM glycerol in PBS (pH ¼ 7.4) was added and incubated for 10 min on ice to quench the oxidation reaction. Cells were pelleted by centrifugation (650g for 4 min at 4 C) and washed twice with 5% FBS in PBS (pH ¼ 6.7). Cells were then resuspended in 200 mL of 0.1 mM aminooxy-biotin (Invitrogen, A-10550), 10 mM aniline, 5% FBS in PBS (pH ¼ 6.7) and incubated for 90 min on ice. Following three washes with 5% FBS in PBS (pH ¼ 6.7), cells were resuspended in 200 mL of 3.2 mg/mL DTAF (dichlorotriazinyl amino fluorescein)streptavidin ( Jackson Immunoresearch, 016-010-084), 5% FBS in PBS for 30 min on ice. Finally, cells were washed three more times with 5% FBS in PBS (pH ¼ 6.7) and resuspended in 400 mL of 5% FBS in PBS (pH ¼ 6.7). Cells were analyzed with analysis on a FACSCalibur Flow Cytometer (BD Biosciences). Live cells (10,000 cells/sample) were identified by their forward scatter versus side scatter plot and DTAF fluorescence was measured on the FL-1 channel of the instrument.
5.2. Detection of a2-3 and a2-6 cell surface sialic acid After culturing with monosaccharides, cells were resuspended in 0.1% BSA (bovine serum albumin, fraction V) in DPBS and aliquoted in a v-bottom 96-well plate to approximately 4.0 105 cells per well. Cells were pelleted
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
555
by centrifugation (650g for 4 min at 4 C) and the supernatant removed by inverting the plate over the sink. Cells were washed a total of three times in the same manner with DPBS. To detect a2-6-linked cell surface sialic acid, BJAB cells were incubated with 150 mL of 10 mg/mL SNA-FITC (fluorescein isothiocyanate) (EY Labs, #F-6802-1), 0.1% BSA in DPBS for 30 min on ice. After being washed twice with 0.1% BSA in DPBS, the cells were resuspended in 400 mL of 0.1% BSA in DPBS. To distinguish the difference between live and dead cells, propidium iodide (PI, Invitrogen) was added at 272 mg/mL into each tube before analysis. Using a FACSCalibur Flow Cytometer, the cells were analyzed and live cells (10,000 cells/sample) were first identified by their forward scatter versus side scatter plot. All PI positive cells (dead cells) were excluded from analysis. FITC fluorescence was measured on the FL-1 channel of the instrument and PI was measured on the FL-2 channel of the instrument. To detect a2-3-linked cell surface sialic acid, BJAB cells were incubated with 150 mL of 10 mg/mL MAA-biotin (Vector Labs, #B-1265), 0.1% BSA in PBS for 30 min on ice. Note that it is essential to use the MAL-II (also known as MAH) form of the MAA lectin (Brinkman-Van der Linden et al., 2002). Many products contain mixtures of MAA lectins including the MAL-I form, which recognizes galactose-b1-4-N-acetylglucosamine, a core glycan structure. Cells were then washed twice with 0.1% BSA in PBS and incubated with 20 mg/mL of streptavidin-FITC (CalTag Labs, SA1001) for 30 min on ice. Cells were washed two times with 0.1% BSA in PBS and resuspended in 400 mL of 0.1% BSA in PBS for flow cytometry analysis. Cells were treated with PI and analyzed as described above for SNA-FITC binding. The results of flow cytometry experiments demonstrate much lower cell surface sialoside expression in BJAB K20 cells compared to BJAB K88 cells, consistent with K20’s known deficiency in UDP-GlcNAc 2-epimerase activity (Fig. 26.5) (Keppler et al., 1999). However, when K20 cells are supplied with Ac4-ManNAc or Ac4-ManDAz, the cell surface sialoside levels are restored. This result suggests that the unnatural CMP-SiaDAz is used efficiently to make cell surface sialosides. At the concentrations of ManNAc and ManNAc analogs used here, we observe that SiaDAz is displayed on the cell surface at the same (Fig. 26.5A and B) or nearly the same (Fig. 26.5C) levels as Neu5Ac.
6. Characterization of SiaDAz-Containing Gangliosides While flow cytometry measures the total amount of SiaDAz displayed on the cell surface, it is also desirable to obtain information about the specific glycoconjugates that contain SiaDAz. Toward that end, we have
556
Seok-Ho Yu et al.
A Mean fluorescence intensity
Number of cells (Fraction of maximum)
100 80 60 40 20 0 100
B
Mean fluorescence intensity
Number of cells (Fraction of maximum)
40 20
2000 1500 1000
nol Etha K88 cells
Az nol nNAc anND Etha Ac4-Ma Ac4-M
nol Etha K88 cells
Az NAc nol anND Etha Ac4-Man Ac4-M
nol Etha K88 cells
Az nol nNAc anND Etha Ac4-Ma Ac4-M
K20 cells
1400 1200 1000 800 600 400 200 0
101 102 103 104 Fluorescence intensity (a2-6 cell surface sialic acid)
Mean fluorescence intensity
100 Number of cells (Fraction of maximum)
2500
104
60
80 60 40 20 0 0 10
3000
0 101 102 103 Fluorescence intensity (total cell surface sialic acid)
80
C
3500
500
100
0 0 10
4000
80 60 40 20 0
101 102 103 Fluorescence intensity (a2-3 cell surface sialic acid)
104
K20 cells
K20 cells
Figure 26.5 Cell surface display of SiaDAz detected by PAL method and lectin binding. BJAB K20 cells were grown in the presence of Ac4-ManNAc or Ac4-ManNDAz, then analyzed by flow cytometry using the PAL method or lectins to label cell surface sialic acid. (A) Total cell surface sialic acid was determined by periodate oxidate and aniline-catalyzed oxime ligation (PAL) (Zeng et al., 2009). (B) The presence of a26-linked cell surface sialic acid was assayed by the binding of FITC-conjugated SNA. (C) The presence of a2-3-linked cell surface sialic acid was assayed by the binding of biotin-conjugated MAA followed by streptavidin-FITC. Culturing BJAB K20 cells with either Ac4-ManNAc or Ac4-ManNDAz restores cell surface sialic acid to levels at or near those of the sialylation-competent BJAB K88 subclone. Error bars represent the standard deviation of duplicate samples.
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
557
recently begun analyzing the ganglioside composition of cells that have been cultured with Ac4-ManNDAz or other monosaccharides. Gangliosides are extracted from cells using a procedure adapted from a previous volume in this series (Schnaar, 1994). Note that all steps are performed with glassware, rather than plastics, to minimize loss of hydrophobic lipids. Once extracted, the gangliosides can be analyzed by high performance thin layer chromatography (HPTLC) (Schnaar and Needham, 1994) or mass spectrometry. After culturing with Ac4-ManNAc or Ac4-ManNDAz, cells (for BJAB cells, 5 107) were resuspended in 300 mL of cold ddH2O and dounced 50–100 times with a glass homogenizer (Kontes Tissue Grind Tube, size 20). The suspension was transferred to a 4 mL glass vial containing 800 mL MeOH and stirred. Chloroform (400 mL) was added and stirring continued for 2 h. The mixture was transferred to a 13 100 mm glass culture tube, then centrifuged at 2800g for 10 min at 30 C. The resulting supernatant was transferred to a 4 mL vial and the solvent was removed by evaporation under nitrogen. The sample was resuspended in 1.2 mL of diisopropyl ether and 0.8 mL of butanol, then sonicated using a bath sonicator for 10 min. After transferring the sample to a 13 100 mm glass culture tube, 1 mL of aqueous sodium chloride (50 mM) was added, the sample was mixed by pipetting, then centrifuged at 2800g for 10 min at 30 C. The upper (organic) layer was removed, 1.2 mL of diisopropyl ether and 0.8 mL of butanol were added to the remaining aqueous layer. The sample was mixed by pipetting, then centrifuged at 2800g for 10 min at 30 C. The upper (organic) layer was removed, and the extraction was repeated once more. The remaining lower (aqueous) layer was transferred to a 4 mL vial, concentrated under nitrogen, and analyzed by MALDI-TOF MS analysis. MALDI-TOF MS analysis of gangliosides produced by BJAB K20 cells cultured with Ac4-ManNAc or Ac4-ManNDAz was performed at the Complex Carbohydrate Research Center (University of Georgia). THAP was used as the matrix. As shown in Fig. 26.6, BJAB K20 cells cultured with Ac4-ManNAc produce three forms of GM3, each having different fatty acid chain lengths. When cells were cultured with Ac4-ManNDAz, we observed incorporation of SiaDAz into each of these forms. While much of the diazirine appears to be intact, we also detect species whose masses are consistent with the loss of N2 from the diazirine. This loss is believed to occur during the ionization step of the mass spectrometry analysis.
7. Covalent Capture of Glycan-Mediated Interactions Using Photocrosslinking Sialic Acid Once photocrosslinking sugars are incorporated into cellular glycoconjugates, they can be used to covalently capture glycan-mediated complexes. We have used this method to photocrosslink oligomers of the
558
20
0 1125
1175
1225 1275 Mass (m/z)
GM3-SiaDAz***
GM3-SiaDAz* or GM3-SiaDAz***-N2
GM3-Neu5Ac**
40
GM3-SiaDAz*
60
GM3-SiaDAz*-N2
Intensity (%)
80
GM3-Neu5Ac*
100
GM3-SiaDAz*-N2
GM3-Neu5Ac***
Seok-Ho Yu et al.
1325
1375
Figure 26.6 Detection of SiaDAz-modified gangliosides by MALDI-TOF MS. Ganglioside extracts from BJAB K20 cells cultured with Ac4-ManNAc or Ac4-ManNDAz were crystallized with THAP and analyzed by MALDI-TOF MS. When the cells were cultured with Ac4-ManNAc (gray trace), they produced three Neu5Ac-containing GM3 species (GM3-Neu5Ac* ¼ GM3 (d18:1/16:0), GM3-Neu5Ac** ¼ GM3 (d18:1/22:0), and GM3-Neu5Ac*** ¼ GM3 (d18:1/24:0)) with fatty acid chain lengths of 16, 22, and 24. When the cells were cultured with Ac4-ManNDAz, the observed molecular weights increased by 68 Da (black trace), consistent with GM3 molecules that contain SiaDAz in place of Neu5Ac. We also observed small peaks whose masses are 28 Da less than the SiaDAz-containing GM3 molecules. These peaks are believed to be caused by ionization-induced loss of N2 from the diazirine. The MS peak for GM3-SiaDAz*** (d18:1/24:0)N2 is not distinguishable from GM3SiaDAz** (d18:1/22:0) due to their similar m/z values.
sialylated protein CD22 (Bond et al., 2009; Tanaka and Kohler, 2008) as well as the complex between the GM1 ganglioside and cholera toxin (Bond et al., 2010). A general protocol for photocrosslinking is provided; modifications may be required for distinct applications. After culturing with Ac4-ManNDAz or other monosaccharides, harvested and pelleted cells are resuspended in DPBS or media to a final density of 1.0 106–5.0 106 cells/mL. Between 200 mL and 1 mL of cell suspension is transferred to a 24- or 12-well plate. UV irradiation is performed by placing the plate under a UV light source (360 nm, Black Ray lamp, Model XX-20BLB) with 2–5 cm distance between the lamp and sample. We typically irradiate for 10 min on ice, but distance and irradiation
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
559
time can be optimized to suit individual samples. To confirm that crosslinking is UV-dependent, control samples are prepared in which the same number of cells for each sample are kept at 4 C in the dark. The irradiated cells and the control cells are each transferred to microcentrifuge tubes and centrifuged at 650 g for 5 min at room temperature. After removing the supernatant, the resulting cell pellet is lysed. Typically, about 15 mL of the lysate is combined with 15 mL of 2 SDS-PAGE loading buffer (Laemmli buffer) containing dithiothreitol (DTT), boiled for 5–10 min, and then loaded on an SDS–polyacrylamide gel of appropriate percentage. After separating the proteins by SDS-PAGE and transferring them to a nitrocellulose membrane or PVDF (polyvinylidene fluoride) membrane, crosslinked products can be detected by Western blot with specific antibodies.
8. Conclusion While recent methods have dramatically improved our ability to catalog the glycoconjugates that contain sialic acid (Nilsson et al., 2009) and to track their location within cells and even organisms (Laughlin et al., 2008), deciphering the function of these molecules remains a significant challenge. As one approach to understanding sialoside function, we exploit metabolic oligosaccharide engineering approaches (Du et al., 2009) to incorporate the diazirine photocrosslinking group into sialosides in their cellular environment. Our results indicate that diazirine-modified sialic acid is readily incorporated into both glycoproteins and glycolipids. Upon UV irradiation, the diazirine can form a covalent bond between the sialoside and neighboring molecules. Further analytical steps can be employed to identify the components of these crosslinked complexes. We hypothesize that identifying the molecules that surround sialosides will provide crucial information about sialoside function. Moreover, because the diazirine is activated with light, it offers the opportunity to covalently capture these complexes with temporal and spatial precision.
ACKNOWLEDGMENTS We thank Michael Pawlita and James Paulson for sharing the BJAB subclones and Pamela Stanley for sharing the Lec3 CHO cells. Financial support was provided by the University of Texas Southwestern Medical Center, the March of Dimes (5-FY06-913), the Welch Foundation (I-1686), and the National Institutes of Health (GM090271). M. R. B. thanks the NSF for a graduate fellowship. M. R. B. and C. M. W. acknowledge the support of Stanford University. This research was supported in part by the National Institutes of Health (NIH/NCRR)-funded grant entitled ‘‘Integrated Technology Resource for Biomedical Glycomics’’ (1 P41 RR018502-01) to the Complex Carbohydrate Research Center
560
Seok-Ho Yu et al.
(Athens, GA). This content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of General Medical Sciences or the National Institutes of Health. J. J. K. is an Alfred P. Sloan Research Fellow.
REFERENCES Anthony, R. M., Nimmerjahn, F., Ashline, D. J., Reinhold, V. N., Paulson, J. C., and Ravetch, J. V. (2008a). Recapitulation of IVIG anti-inflammatory activity with a recombinant IgG Fc. Science 320, 373–376. Anthony, R. M., Wermeling, F., Karlsson, M. C. I., and Ravetch, J. V. (2008b). Identification of a receptor required for the anti-inflammatory activity of IVIG. Proc. Natl. Acad. Sci. USA 105, 19571–19578. Bains, G., Lee, R. T., Lee, Y. C., and Freire, E. (1992). Microcalorimetric study of wheat germ agglutinin binding to N-acetylglucosamine and its oligomers. Biochemistry 31, 12624–12628. Blixt, O., Collins, B. E., van den Nieuwenhof, I. M., Crocker, P. R., and Paulson, J. C. (2003). Sialoside specificity of the Siglec family assessed using novel multivalent probes. J. Biol. Chem. 278, 31007–31019. Bond, M. R., Zhang, H., Vu, P. D., and Kohler, J. J. (2009). Photocrosslinking of glycoconjugates using metabolically incorporated diazirine-containing sugars. Nat. Prot. 4, 1044–1063. Bond, M. R., Whitman, C. M., and Kohler, J. J. (2010). Metabolically incorporated photocrosslinking sialic acid covalently captures the GM1-cholera toxin subunit B complex. Mol. Biosyst. DOI:10.1039/C0MB00069H. Brinkman-Van der Linden, E. C. M., Sonnenburg, J. L., and Varki, A. (2002). Effects of sialic acid substitutions on recognition by Sambucus nigra agglutinin and Maackia amurensis hemagglutinin. Anal. Biochem. 303, 98–104. Cariappa, A., Takematsu, H., Liu, H., Diaz, S., Haider, K., Boboila, C., Kalloo, G., Connole, M., Shi, H. N., Varki, N., Varki, A., and Pillai, S. (2009). B cell antigen receptor signal strength and peripheral B cell development are regulated by a 9-O-acetyl sialic acid esterase. J. Exp. Med. 206, 125–138. Du, J., Meledeo, M. A., Wang, Z., Khanna, H. S., Paruchuri, V. D. P., and Yarema, K. J. (2009). Metabolic glycoengineering: Sialic acid and beyond. Glycobiology 19, 1382–1401. Dube, D. H., and Bertozzi, C. R. (2003). Metabolic oligosaccharide engineering as a tool for glycobiology. Curr. Opin. Chem. Biol. 7, 616–625. Han, S., Collins, B. E., Bengtson, P., and Paulson, J. C. (2005). Homomultimeric complexes of CD22 in B cells revealed by protein-glycan cross-linking. Nat. Chem. Biol. 1, 93–97. Hong, Y., and Stanley, P. (2003). Lec3 Chinese hamster ovary mutants lack UDP-Nacetylglucosamine 2-epimerase activity because of mutations in the epimerase domain of the GNE gene. J. Biol. Chem. 278, 53045–53054. Imberty, A., and Varrot, A. (2008). Microbial recognition of human cell surface glycoconjugates. Curr. Opin. Struct. Biol. 18, 567–576. Jewett, J. C., Sletten, E. M., and Bertozzi, C. R. (2010). Rapid Cu-free click chemistry with readily synthesized biarylazacyclooctynones. J. Am. Chem. Soc. 132, 3688–3690. Jones, M. B., Teng, H., Rhee, J. K., Lahar, N., Baskaran, G., and Yarema, K. J. (2004). Characterization of the cellular uptake and metabolic conversion of acetylated N-acetylmannosamine (ManNAc) analogues to sialic acids. Biotechnol. Bioeng. 85, 394–405. Kayser, H., Zeitler, R., Kannicht, C., Grunow, D., Nuck, R., and Reutter, W. (1992). Biosynthesis of a nonphysiological sialic acid in different rat organs, using N-propanoylD-hexosamines as precursors. J. Biol. Chem. 267, 16934–16938.
Metabolic Labeling of Glycoconjugates with Photocrosslinking Sugars
561
Keppler, O. T., Hinderlich, S., Langner, J., Schwartz-Albiez, R., Reutter, W., and Pawlita, M. (1999). UDP-GlcNAc 2-epimerase: A regulator of cell surface sialylation. Science 284, 1372–1376. Keppler, O. T., Horstkorte, R., Pawlita, M., Schmidts, C., and Reutter, W. (2001). Biochemical engineering of the N-acyl side chain of sialic acid: Biological implications. Glycobiology 11, 11R–18R. Laughlin, S. T., and Bertozzi, C. R. (2007). Metabolic labeling of glycans with azido sugars and subsequent glycan-profiling and visualization via Staudinger ligation. Nat. Prot. 2, 2930–2944. Laughlin, S. T., Baskin, J. M., Amacher, S. L., and Bertozzi, C. R. (2008). In vivo imaging of membrane-associated glycans in developing zebrafish. Science 320, 664–667. Li, F., Wilkins, P. P., Crawley, S., Weinstein, J., Cummings, R. D., and McEver, R. P. (1996). Post-translational modifications of recombinant P-selectin glycoprotein ligand-1 required for binding to P- and E-selectin. J. Biol. Chem. 271, 3255–3264. Luchansky, S. J., Hang, H. C., Saxon, E., Grunwell, J. R., Yu, C., Dube, D. H., and Bertozzi, C. R. (2003a). Constructing azide-labeled cell surfaces using polysaccharide biosynthetic pathways. Methods Enzymol. 362, 249–272. Luchansky, S. J., Yarema, K. J., Takahashi, S., and Bertozzi, C. R. (2003b). GlcNAc 2epimerase can serve a catabolic role in sialic acid metabolism. J. Biol. Chem. 278, 8035–8042. Luchansky, S. J., Goon, S., and Bertozzi, C. R. (2004). Expanding the diversity of unnatural cell-surface sialic acids. Chembiochem 5, 371–374. McEver, R. P., and Cummings, R. D. (1997). Role of PSGL-1 binding to selectins in leukocyte recruitment. J. Clin. Invest. 100, S97–S103. Merrit, E. A., Sarfaty, S., van den Akker, F., L’Hoir, C., Martial, J. A., and Hol, W. G. J. (1994). Crystal structure of cholera toxin B-pentamer bound to receptor GM1 pentasaccharide. Protein Sci. 3, 166–175. Nicholson, M. W., Barclay, A. N., Singer, M. S., Rosen, S. D., and van der Merwe, P. A. (1998). Affinity and kinetic analysis of L-selectin (CD62L) binding to glycosylationdependent cell-adhesion molecule-1. J. Biol. Chem. 273, 763–770. Nilsson, J., Ruetschi, U., Halim, A., Hesse, C., Carlsohn, E., Brinkmalm, G., and Larson, G. (2009). Enrichment of glycopeptides for glycan structure and attachment site identification. Nat. Methods 6, 809–811. Oetke, C., Brossmer, R., Mantey, L. R., Hinderlich, S., Isecke, R., Reutter, W., Keppler, O. T., and Pawlita, M. (2002). Versatile biosynthetic engineering of sialic acid in living cells using synthetic sialic acid analogues. J. Biol. Chem. 277, 6688–6695. Sarkar, A. K., Fritz, T. A., Taylor, W. H., and Esko, J. D. (1995). Disaccharide uptake and priming in animal cells: Inhibition of sialyl Lewis X by acetylated Galb1- > 4GlcNAcbO-naphthalenemethanol. Proc. Natl. Acad. Sci. USA 92, 3323–3327. Saxon, E., and Bertozzi, C. R. (2000). Cell surface engineering by a modified Staudinger reaction. Science 287, 2007–2010. Schnaar, R. L. (1994). Isolation of glycosphingolipids. Methods Enzymol. 230, 348–370. Schnaar, R. L., and Needham, L. K. (1994). Thin-layer chromatography of glycosphingolipids. Methods Enzymol. 230, 371–389. Shibuya, N., Goldstein, I. J., Broekaert, W. F., Nsimba-Lubaki, M., Peeters, B., and Peumans, W. J. (1987). The elderberry (Sambucus nigra L.) bark lectin recognizes the Neu5Ac(a2-6)Gal/GalNAc sequence. J. Biol. Chem. 262, 1596–1601. Somers, W. S., Tang, J., Shaw, G. D., and Camphausen, R. T. (2000). Insights into the molecular basis of leukocyte tethering and rolling revealed by structures of P- and Eselectin bound to sLeX and PSGL-1. Cell 103, 467–479. Tanaka, Y., and Kohler, J. J. (2008). Photoactivatable crosslinking sugars for capturing glycoprotein interactions. J. Am. Chem. Soc. 130, 3278–3279.
562
Seok-Ho Yu et al.
Tanaka, Y., Bond, M. R., and Kohler, J. J. (2008). Photocrosslinkers illuminate interactions in living cells. Mol. Biosyst. 4, 473–480. Tomiya, N., Ailor, E., Lawrence, S. M., Betenbaugh, M. J., and Lee, Y. C. (2001). Determination of nucleotides and sugar nucleotides involved in protein glycosylation by high-performance anion-exchange chromatography: Sugar nucleotide contents in cultured insect cells and mammalian cells. Anal. Biochem. 293, 129–137. Varki, A. (2001). Loss of N-glycolylneuraminic acid in humans: Mechanisms, consequences, and implications for hominid evolution. Am. J. Phys. Anthropol. 116, 54–69. Varki, A. (2009). Natural ligands for CD33-related Siglecs? Glycobiology 19, 810–812. Vsevolod, V. R., Luke, G. G., Valery, V. F., and Sharpless, K. B. (2002). A stepwise Huisgen cycloaddition process: Copper(I)-catalyzed regioselective ‘‘Ligation’’ of azides and terminal alkynes. Angew. Chem. Int. Ed. 41, 2596–2599. Wang, W. C., and Cummings, R. D. (1988). The immobilized leukoagglutinin from the seeds of Maackia amurensis binds with high affinity to complex-type Asn-linked oligosaccharides containing terminal sialic acid-linked alpha-2, 3 to penultimate galactose residues. J. Biol. Chem. 263, 4576–4585. Wernick, N. L. B., Chinnapen, D. J.-F., Cho, J. A., and Lencer, W. I. (2010). Cholera toxin: An intracellular journey into the cytosol by way of the endoplasmic reticulum. Toxins 2, 310–325. Yu, H., and Chen, X. (2007). Carbohydrate post-glycosylational modifications. Org. Biomol. Chem. 5, 865–872. Zeng, Y., Ramya, T. N. C., Dirksen, A., Dawson, P. E., and Paulson, J. C. (2009). Highefficiency labeling of sialylated glycoproteins on living cells. Nat. Methods 6, 207–209.
C H A P T E R
T W E N T Y- S E V E N
Identification of CarbohydrateBinding Proteins by Carbohydrate Mimicry Peptides Michiko N. Fukuda* and Tohru Yoneyama† Contents 1. 2. 3. 4. 5.
Overview Materials Preparation of an Affinity Ligand Agarose Column Visualization of Carbohydrate-Binding Proteins Peptide Affinity Chromatography 5.1. Procedures for peptide affinity chromatography 5.2. Protein identification 5.3. Carbohydrate-binding activity of identified proteins 6. Use of Carbohydrate Mimicry Peptides as a Research Reagent Acknowledgments References
564 564 565 565 567 567 569 569 570 570 571
Abstract Peptide-displaying phage technology has numerous applications. Using a specificity-defined monoclonal anticarbohydrate antibody, we can identify a series of short peptides that mimic the binding specificity of a specific carbohydrate. Identified peptides constitute alternatives to the use of carbohydrate ligands in affinity chromatography to isolate a carbohydrate-binding protein. In this chapter, we introduce methods for carbohydrate mimicry peptide affinity chromatographies and discuss their potential use in identifying yet undiscovered carbohydrate-binding proteins in normal and pathological conditions.
* Glycobiology Unit, Tumor Microenvironment Program, Cancer Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Department of Urology, Hirosaki University of Medicine, Hirosaki, Japan
{
Methods in Enzymology, Volume 478 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)78027-7
#
2010 Elsevier Inc. All rights reserved.
563
564
Michiko N. Fukuda and Tohru Yoneyama
1. Overview Peptide-displaying phage technologies provide a method to identify short peptide sequences specific to a target. This technology may also provide a means to identify peptide sequences mimicking specific carbohydrate epitopes, each specifically recognized by an anticarbohydrate antibody, a carbohydrate-binding protein or a lectin. Because chemical synthesis of complex carbohydrates is still not automated, a specific peptide that functions in carbohydrate mimicry provides us with a practical tool for glycobiology. Short peptide sequences representing carbohydrate mimicries have been identified. These sequences have served as reagents to inhibit interactions between carbohydrate-binding proteins and their ligands (Fukuda et al., 2000; Hatakeyama et al., 2009; Molenaar et al., 2002; Zhang et al., 2002) or as immunogens to raise anticarbohydrate antibodies (Heimburg-Molinaro et al., 2009; Kieber-Emmons et al., 1999; Lou and Pastan, 1999; Moe and Granoff, 2001; Pincus et al., 1998). In this chapter, we introduce a method useful to isolate novel carbohydrate-binding protein using peptide affinity column chromatography.
2. Materials Synthetic peptides are used as affinity ligands. Several companies are capable of synthesizing peptides of up to 100 amino acid residues as a custom peptide synthesis service. The peptide sequence identified by fd phage library should not have modification at N-terminus, while the C-terminus can be modified for conjugation with a variety of compounds, including multivalent antigenic peptides (MAPS) (Fig. 27.1). If the peptide of interest does not IELLQAR K IELLQAR IELLQAR
K K
IELLQAR K
IELLQAR K IELLQAR
K
IELLQAR K IELLQAR
Figure 27.1 Structure of multivalent antigenic peptides (MAPS) made by lysine (K) residues. Eight-branched multivalent I-peptide is shown.
Identification of Carbohydrate-Binding Proteins by Carbohydrate Mimicry Peptides
565
contain a cystein residue, it can be synthesized to contain an additional cystein at the C-terminus—namely, Xn-C—so that the sulfhydryl residue can be used for maleimide conjugation. For example, FITC-maleimide can be used to construct a fluorescent peptide, or maleimide-activated agarose beads can be employed to immobilize a peptide. If the X-mer synthetic peptide is too hydrophobic and insoluble in water, 1–3 arginine residues can be added Cterminal to the additional C, as in Xn-C-R1–3. On the other hand, if the carbohydrate mimicry peptide has been identified from T7-phage library, the synthetic peptide should be C-terminal-free and cystein for conjugation should be added at the N-terminus, as in C-Xn.
3. Preparation of an Affinity Ligand Agarose Column Add 1 ml sulfo-link agarose beads (Pierce) to a 15 ml tube and wash beads three times with 0.1 M Tris–HCl, pH8.5, containing 1 mM EDTA. Dissolve 1 mg synthetic peptide, Xn-C or C-Xn, in 1 ml 0.1 M Tris–HCl buffer, pH 8.5, and add to sulfo-link gel. Rotate beads in a 15 ml tube at room temperature for 2 h or at 4 C for 20 h. Wash peptide-conjugated beads three times with 0.1 M Tris–HCl buffer, pH 7.4, containing 0.15 M NaCl (TBS), and store beads at 4 C until use.
4. Visualization of Carbohydrate-Binding Proteins Prior to peptide affinity chromatography for proteomics, it is highly recommended that one visualize the protein of interest. Two protocols, one for the mouse lung endothelial cell surface and another for a cell surface membrane protein in cultured cells, are described below. Cell surface proteins expressed on mouse lung endothelial cells can be visualized by in vivo biotinylation, as described previously (De La Fuente et al., 1997; Hatakeyama et al., 2009; Rajotte and Ruoslahti, 1999). Inject 100 ml PBS containing 0.5 mg/ml sulfo-NHS-LC-biotin (Pierce) intravenously through the tail vein. Ten minutes later, anesthetize the mouse by peritoneal injection with Avertin and slowly perfuse the heart for 10–15 min with approximately 15 ml of PBS. If a carbohydrate mimicry peptide-displaying phage is available, inject phage in 1 ml PBS through the heart, and perfuse again with 15 ml PBS. Collect well-perfused lungs or control tissues such as liver, and incubate them on ice for 20 min. To disrupt tissue, first mince and then homogenize it with a homogenizer in a minimal volume (2.5 ml/g of tissue) of cold PBS containing 50 mM N-octyl-beta-D-glucopyranoside,
566
Michiko N. Fukuda and Tohru Yoneyama
kDa 188
1
2
3
4
5
6
98 62 49 35 25 14
Figure 27.2 Visualization of mouse lung endothelial cell surface proteins by in vivo biotinylation. Mice were injected intravenously either by PBS (lane 1) or a biotinylation reagent (lanes 2–6), followed by intravenous injection of I-peptide displaying phage (lanes 3 and 4), or control phage (lanes 5 and 6). After perfusion with PBS, lungs were isolated and phage was immunoprecipitated with rabbit antiphage antibody (lanes 4 and 6) or rabbit IgG (lanes 3 and 5). Biotinylated proteins were resolved by SDS-PAGE and detected by a peroxidase-avidin blot. An arrow shows the major band that binds to I-peptide displaying phage (3).
1 mM PMSF, 20 mg/ml aprotinin, and 1 mg/ml leupeptin (PBS/octyl glucoside). After incubating homogenized tissue on ice for 2 h, centrifuge at 12,000g for 30 min to remove cell debris. To the supernatant, add protein A/G beads (10 ml) precoated with antiphage antibody (rabbit antiphage fd antibody, Sigma). After incubation at 4 C for 1 h, wash beads with PBS, boil them for 3 min in SDS-sample buffer, centrifuge, and apply supernatant to SDS-PAGE followed by peroxidase-avidin blotting. Biotinylated proteins on a nitrocellulose filter can be visualized using the chemiluminescent peroxidase substrate ECL by exposure to X-ray film (Hatakeyama et al., 2009) (Fig. 27.2). To visualize proteins expressed on the surface of adherent cultured cells from a particular tissue, proteins expressed on cells grown in a monolayer are labeled by surface biotinylation. Wash monolayer three times with PBS and then incubate with PBS containing 0.5 mg/ml sulfo-NHS-LC-biotin at room temperature for 10 min. After PBS washing, quench excess biotinylation reagent with tissue culture medium containing 10% fetal bovine serum. Collect cells by scraping with a rubber policeman followed by centrifugation. Solubilize cells with PBS/octyl glucoside and centrifuge at 12,000g for 30 min. To identify the protein of interest, incubate lysate with 100 ml of 50% suspension of sulfo-link agarose beads (Pierce) conjugated with the synthetic peptide with a terminal cystein residue at 4 C for 30 min. After washing beads three times with PBS/octyl-glucose, bound materials are eluted with 50 ml PBS containing the peptide (1 mg/ml) using a spin filter
Identification of Carbohydrate-Binding Proteins by Carbohydrate Mimicry Peptides
567
microcentrifuge tube. Boil beads with SDS-sample buffer for 3 min, and analyze biotinylated proteins in each fraction by peroxidase–avidin blot. Many carbohydrate-binding proteins require calcium for ligand binding. Thus, in experiments above that require Tris buffer, buffer should be supplemented with 1 mM CaCl2. However, PBS buffer used in experiments with crude cell lysates does not require CaCl2 supplementation, because cell lysates provide sufficient levels of calcium ions.
5. Peptide Affinity Chromatography Peptide affinity chromatographies were performed according to principles established by Pytela et al. for the isolation of integrins by RGD peptide chromatography (Pytela et al., 1985, 1987). All steps should be performed at 4 C. The protocol described below uses rat lung tissue as starting material. However, much smaller sample sizes can be successfully used for proteomic analysis, as the sensitivity of these assays has significantly improved in recent years. Most proteomics facilities are capable of identifying proteins using silver-staining protocols. The protocol below was used for chromatography of a carbohydrate mimicry I-peptide, which is IELLQAR (Hatakeyama et al., 2009).
5.1. Procedures for peptide affinity chromatography 1. Homogenize fresh frozen rat lungs (60 pairs, 90 g, from Pel-Freeze) in glass blender in cold TBS (500 ml) containing 1 mM PMSF. 2. Dissolve 3 g octyl-thio-glucoside (OTG) in 50 ml TBS. 3. Add OTG solution to homogenate (final concentration: 2 mM) and stir at 4 C for 30 min. 4. Centrifuge homogenate at 6000g rpm at 4 C for 20 min. 5. Add unconjugated Sepharose 4B (50 ml) to supernatant and stir at 4 C for 30 min. 6. Filter Sepharose 4B through glass funnel filter. 7. To filtered sample, add CaCl2 to 1 mM and 1 ml IELLQAR-C-agarose beads. 8. Stir at 4 C for 1 h. 9. Collect beads by centrifugation at 600g for 5 min. 10. Transfer beads to a 15 ml tube and wash with cold TBS containing 1 mM CaCl2 (TBSC). 11. Elute bead-bound proteins with 10 ml TBS containing 2 mM EDTA. Alternatively, bound materials can be eluted with 0.2 M glycine–HCl buffer, pH 2.4, and immediately neutralized with 1/5 volume of 1 M Tris–HCl, pH7.4.
568
Michiko N. Fukuda and Tohru Yoneyama
12. To sample obtained in step 11, add CaCl2 and OTG to a final concentration of 2 mM each. 13. Mix sample solution with new IELLQAR-C beads (1 ml). 14. Incubate and wash beads as in the same manner described in steps 7–11. 15. Elute affinity-bound materials with 1 ml each of TBS containing ligand peptide (1 mg/ml) or elute affinity-bound materials with 0.2 M glycine–HCl buffer, pH 2.4. 16. Concentrate eluted proteins using Microcon 10 or 30 (Millipore). 17. Boil concentrated sample with SDS-PAGE sample buffer and apply to SDS-PAGE. 18. Stain gel with Coomassie or silver. 19. Cut out specific bands identified as a specific protein in the biotinylation experiment. 20. Determine peptide sequence by proteomics. It is possible that only one affinity chromatography will be required to purify the protein of interest. Two affinity chromatographies, with distinct elution strategies, may significantly increase the purity of specific proteins (Fig. 27.3). However, if peptide affinity chromatography fails, the peptide may have low affinity for a carbohydrate-binding protein. The affinity of the protein of interest to the peptide ligand may be increased by use of a linear repeating peptide, such as X7-X7-X7-C, or multivalent octameric peptides (MAPS) (Fig. 27.1), as we have demonstrated in previous studies (Fukuda, 2006; Fukuda et al., 2000; Zhang et al., 2002). Octameric C-MAPS can be kDa 62 49 35 25
14
1
2
Figure 27.3 SDS-PAGE of affinity-purified I-peptide binding proteins visualized by Coomassie blue staining. Microsomal membrane proteins from rat lung were bound to I-peptide agarose beads in the presence of 1 mM CaCl2. Bound materials were eluted in 1 mM EDTA (lane 1), which was further purified by the second I-peptide affinity chromatography (lane 2). The major band shown by an arrow was identified as premRNA splicing factor (Sfrs gene product) by proteomics.
Identification of Carbohydrate-Binding Proteins by Carbohydrate Mimicry Peptides
569
obtained from GenScript, and the N-terminus of Xn can be conjugated to CMAPS using an amine-sulfhydryl cross-linker, such as SMPB (succinimidyl 4-[p-maleimidophenyl]butyrate, Pierce). The Xn C-terminus can be conjugated to four-branched cystein-MAPS using a carboxyl-sulfhydryl crosslinker, N-(p-maleimidophenyl) isocyanate PMPI (Pierce).
5.2. Protein identification After protein bands are cut from the gel, gel fragments are subjected to trypsinization. Tryptic fragments are then analyzed by MALDI-TOF (matrix-assisted laser desorption time-of-flight) mass spectrometry at a proteomics facility. Trained personnel at such facilities should perform the procedures after silver staining. Peptide sequences resulting from this analysis will be searched against databases to identify the proteins. As proteomics is not the subject of this chapter, details are not described here.
5.3. Carbohydrate-binding activity of identified proteins Once a protein and corresponding gene are identified it is possible that it may have already been found to be a carbohydrate-binding protein. However, if the identified protein is novel, carbohydrate-binding activity of identified protein should be tested by an appropriate method. Here, we describe a plate assay using polymeric synthetic carbohydrate. Additional methods should also be employed to strengthen or confirm results obtained by the plate assay. cDNA encoding the identified protein can be obtained commercially. For example, Invitrogen carries most human and mouse cDNAs in mammalian expression vectors, which can be searched online at http://clones.invitrogen. com. However, if a particular cDNA clone encoding the entire open reading frame of a transcript is not available commercially, one can construct a mammalian expression vector; that is, pcDNA3, by inserting cDNA from a collection of EST clones, which should be commercially available. Expression and localization of the carbohydrate-binding protein in a mammalian cell can be determined by immunocytochemistry using specific antibody for the protein. However, if appropriate antibody is not available, the proteins should be expressed as epitope-tagged fusion protein and detect the fusion protein by antibody for the tag. Fluorescent peptide can be synthesized by conjugation of C-Xn or Xn-C peptide with maleimide Alexa 488 (Molecular probe), through a sulfhydryl residue. The labeled peptide, that is, A488-CX8, is then added to COS cells that have been transfected with the mammalian expression vector. Binding of A488-labeled peptide to the epitope-tagged carbohydrate-binding protein expressed in a mammalian cell can be determined by colocalization of A488-peptide and antitag antibody in double immunofluorescence microscopy.
570
Michiko N. Fukuda and Tohru Yoneyama
6. Use of Carbohydrate Mimicry Peptides as a Research Reagent The fact that groups of peptides bind to anticarbohydrate antibodies and lectins strongly suggests that those peptides are carbohydrate mimetics or that they behave like carbohydrates. Nonetheless, the observation that peptides can bind to an antibody-binding site or lectin in a manner similar to a carbohydrate ligand does not necessarily mean that the peptide is a structural mimic of the carbohydrate. Harris et al. addressed this issue and identified a series of peptides using closely related monoclonal antibodies directed against the cell wall polysaccharide of group A Streptococcus (Harris et al., 1997). All the identified peptides bound at or near the carbohydrate-binding site. They showed that each monoclonal antibody binds a specific consensus peptide sequence, but interestingly they found no common peptide sequence among those selected by multiple monoclonal antibodies. We screened a phage library using three monoclonal antibodies directed to Lewis X antigen and found that each monoclonal antibody selected a distinct consensus peptide sequence (Fukuda, 2006). However, Taki et al. identified a consensus 9-mer peptide recognized by two monoclonal antibodies directed to lactotetraosylceramide and neolactotetraosylceramide (Matsumoto et al., 1997), indicating that the 9-mer peptides are sufficient to mimic the galactosyl epitope structure. These studies suggest that peptides function in carbohydrate mimicry by interacting with carbohydrate-binding proteins at their epitope recognition site. Overall, all of these studies indicate that an identified peptide may not necessarily constitute the structural mimic of a carbohydrate, particularly when an epitope is part of a complex structure. Nonetheless, the peptide can be used as a useful reagent to study carbohydrate-binding proteins, as exemplified by I-peptide, which inhibits cancer metastasis in vivo in the mouse (Akama et al., 2000) and is a powerful tool for studying carbohydrate-mediated metastasis (Fukuda et al., 2000; Zhang et al., 2002). Similarly, the peptide identified as a mimic of ganglioside GD1a inhibits adhesion of mouse lymphoma cells and hepatic endothelial cells (Ishikawa et al., 1998; Takikawa et al., 2000), indicating a role for GD1a in metastasis. The availability of unlimited amounts of peptide-displaying phage and readily available synthetic peptides should enable us to further analyze the role of carbohydrates in cancer.
ACKNOWLEDGMENTS The authors thank Dr. Erkki Ruoslahti for helpful suggestions and offering his peptidedisplaying phage libraries for our studies of carbohydrate-dependent cancer metastasis. The authors thank Dr. Elise Lamar for her assistance in editing the manuscript. This study has been supported by NIH CA71932.
Identification of Carbohydrate-Binding Proteins by Carbohydrate Mimicry Peptides
571
REFERENCES Akama, T. O., Nishida, K., Nakayama, J., Watanabe, H., Ozaki, K., Nakamura, T., Dota, A., Kawasaki, S., Inoue, Y., Maeda, N., Yamamoto, S., Fujiwara, T., et al. (2000). Macular corneal dystrophy type I and type II are caused by distinct mutations in a new sulphotransferase gene. Nat. Genet. 26(2), 237–241. De La Fuente, E. K., Dawson, C. A., Nelin, L. D., Bongard, R. D., McAuliffe, T. L., and Merker, M. P. (1997). Biotinylation of membrane proteins accessible via the pulmonary circulation in normal and hyperoxic rats. Am. J. Physiol. 272(3 Pt 1), L461–L470. Fukuda, M. N. (2006). Screening of peptide-displaying phage libraries to identify short peptides mimicking carbohydrates. Methods Enzymol. 416, 51–60. Fukuda, M. N., Ohyama, C., Lowitz, K., Matsuo, O., Pasqualini, R., Ruoslahti, E., and Fukuda, M. (2000). A peptide mimic of E-selectin ligand inhibits sialyl Lewis Xdependent lung colonization of tumor cells. Cancer Res. 60(2), 450–456. Harris, S. L., Craig, L., Mehroke, J. S., Rashed, M., Zwick, M. B., Kenar, K., Toone, E. J., Greenspan, N., Auzanneau, F. I., Marino-Albernas, J. R., Pinto, B. M., and Scott, J. K. (1997). Exploring the basis of peptide-carbohydrate crossreactivity: Evidence for discrimination by peptides between closely related anti-carbohydrate antibodies. Proc. Natl. Acad. Sci. USA 94(6), 2454–2459. Hatakeyama, S., Sugihara, K., Nakayama, J., Akama, T. O., Wong, S. M., Kawashima, H., Zhang, J., Smith, D. F., Ohyama, C., Fukuda, M., and Fukuda, M. N. (2009). Identification of mRNA splicing factors as the endothelial receptor for carbohydrate-dependent lung colonization of cancer cells. Proc. Natl. Acad. Sci. USA 106(9), 3095–3100. Heimburg-Molinaro, J., Almogren, A., Morey, S., Glinskii, O. V., Roy, R., Wilding, G. E., Cheng, R. P., Glinsky, V. V., and Rittenhouse-Olson, K. (2009). Development, characterization, and immunotherapeutic use of peptide mimics of the Thomsen-Friedenreich carbohydrate antigen. Neoplasia 11(8), 780–792. Ishikawa, D., Kikkawa, H., Ogino, K., Hirabayashi, Y., Oku, N., and Taki, T. (1998). GD1alpha-replica peptides functionally mimic GD1alpha, an adhesion molecule of metastatic tumor cells, and suppress the tumor metastasis. FEBS Lett. 441(1), 20–24. Kieber-Emmons, T., Luo, P., Qiu, J., Chang, T. Y., Insung, O., Blaszczyk-Thurin, M., and Steplewski, Z. (1999). Vaccination with carbohydrate peptide mimotopes promotes antitumor responses. Nat. Biotechnol. 17(7), 660–665. Lou, Q., and Pastan, I. (1999). A Lewis(y) epitope mimicking peptide induces anti-Lewis(y) immune responses in rabbits and mice. J. Pept. Res. 53(3), 252–260. Matsumoto, Y., Handa, S., and Taki, T. (1997). gp49B1, an inhibitory signaling receptor gene of hematopoietic cells, is induced by leukemia inhibitory factor in the uterine endometrium just before implantation. Dev. Growth Differ. 39(5), 591–597. Moe, G. R., and Granoff, D. M. (2001). Molecular mimetics of Neisseria meningitidis serogroup B polysaccharide. Int. Rev. Immunol. 20(2), 201–220. Molenaar, T. J., Appeldoorn, C. C., de Haas, S. A., Michon, I. N., Bonnefoy, A., Hoylaerts, M. F., Pannekoek, H., van Berkel, T. J., Kuiper, J., and Biessen, E. A. (2002). Specific inhibition of P-selectin-mediated cell adhesion by phage display-derived peptide antagonists. Blood 100(10), 3570–3577. Pincus, S. H., Smith, M. J., Jennings, H. J., Burritt, J. B., and Glee, P. M. (1998). Peptides that mimic the group B streptococcal type III capsular polysaccharide antigen. J. Immunol. 160(1), 293–298. Pytela, R., Pierschbacher, M. D., and Ruoslahti, E. (1985). Identification and isolation of a 140 kd cell surface glycoprotein with properties expected of a fibronectin receptor. Cell 40, 191–198. Pytela, R., Pierschbacher, M. D., Argraves, S., and Ruoslahti, E. (1987). Arginine-glycineasparatic acid adhesion receptors. Methods Enzymol. 144, 475–489.
572
Michiko N. Fukuda and Tohru Yoneyama
Rajotte, D., and Ruoslahti, E. (1999). Membrane dipeptidase is the receptor for a lungtargeting peptide identified by in vivo phage display. J. Biol. Chem. 274(17), 11593–11598. Takikawa, M., Kikkawa, H., Asai, T., Yamaguchi, N., Ishikawa, D., Tanaka, M., Ogino, K., Taki, T., and Oku, N. (2000). Suppression of GD1alpha gangliosidemediated tumor metastasis by liposomalized WHW-peptide. FEBS Lett. 466(2–3), 381–384. Zhang, J., Nakayama, J., Ohyama, C., Suzuki, M., Suzuki, A., Fukuda, M., and Fukuda, M. N. (2002). Sialyl Lewis X-dependent lung colonization of B16 melanoma cells through a selectin-like endothelial receptor distinct from E- or P-selectin. Cancer Res. 62(15), 4194–4198.
Author Index
A Abagyan, R. A., 447 Abbas, S., 524 Abe, M., 122–123 Aberg, E., 426 Aboul-ela, F., 438, 441 Adachi, M., 526 Adachi, Y., 325, 329 Adam, A., 277 Adams, E. W., 200 Addison, R. S., 207 Adibekian, A., 201, 413, 465, 472 Adinolfi, M., 468 Adu, D., 376 Aebi, M., 375, 379, 426–427, 504 Aerni, H. R., 290 Agar, J. N., 290 Agar, N. Y., 290 Ageta, H., 288, 291 Ahmad, N., 255 Ahmed, Z. M., 456 Ahola-Iivarinen, E., 253–254 Aiden, A. P., 453 Ailor, E., 550 Aimoto, S., 513 Akaji, K., 513 Akama, T. O., 28, 564, 567, 570 Akamatsu, M., 325, 329 Akira, S., 158 Akke, M., 370 Akshay, S., 443, 456 Al Bataineh, M. M., 110 Albericio, F., 468 Albersheim, P., 56 Albiero, L., 443 Al-Chalabi, A., 527 Alderwick, L. J., 402, 404 Alekseev, A. E., 440 Alexander, C., 430 Al-Hilli, S., 227 Alhussaini, M., 403 Allain, F. H. T., 375, 379, 427 Allhorn, M., 375 Allison, D. C., 159 Al-Mafraji, K., 201, 429 Almogren, A., 564 Alonzi, D. S., 274–275, 278 Alper, P. B., 415
Alvarez, R. A., 204, 242–243, 350 Amacher, S. L., 559 Amano, K., 129, 136, 138, 141, 176 Amano, M., 109, 111, 114, 121, 123, 504 Ambrus, J. I., 451 Amin, M. N., 428 Amster, I. J., 79, 82, 93, 99–100, 102, 104, 201, 429 Ancrile, B., 159 Anderson, C. B., 455 Anderson, D. W., 513 Anderson, M. A., 161 Anderson, R. G., 354 Andersson, M., 288, 296 Ando, H., 419, 517, 522–523, 527–528, 530, 533–534 Ando, M., 523 Ando, T., 528, 533–534 Andritzky, B., 166 Angata, K., 220 Angata, T., 339, 344, 518 Angel, A. S., 46 Angelino, E., 453 Ang, I. L., 161 Angulo, J., 318 An, H. J., 288, 290 Annesley, T. M., 296 Anthony, R. M., 542 Antignac, A., 330 Antonopoulos, A., 27 Anumula, K. R., 376 Aoki, K. H., 23, 333, 379 Aoki-Kinoshita, K. F., 57 Aoki, S., 376, 381 Aoshima, M., 123 Appeldoorn, C. C., 564 Appel, T. R., 296 Apweiler, R., 365–366, 464 Arai, Y., 161 Arakawa, T., 379 Araki, K., 70 Arano, A., 207 Arata, Y., 221, 255, 376, 381 Arellano, R. O., 375 Areschoug, T., 348 Argraves, S., 567 Aricescu, A. R., 375, 379 Ariga, T., 296, 521 Arihara, R., 417
573
574
Author Index
Arita, M., 521 Arnarp, J., 339 Arnesano, F., 307 Arnold, J. N., 288, 380 Arnold, K., 288 Arsequell, G., 373 Arthur, C. M., 243, 255 Arulanandam, A. R. N., 379 Arungundram, S., 201, 429 Arya, D. P., 440 Asa, D., 520 Asahi, M., 158–160, 162 Asai, M., 429 Asai, S., 288, 291 Asai, T., 570 Asai, Y., 329 Asensio, J. L., 372–373 Asher, S., 333 Ashline, D. J., 542 Ashwell, G., 333, 336, 338 Asokan, R., 378 Asong, J., 201, 429 Atkins, J. F., 454–455 Auzanneau, F. I., 570 Avenoza, A., 372–373 Avery, J. L., 296 Avril, T., 348 Azadi, P., 288, 376 B Baasov, T., 437–438, 440, 447–450, 452, 454–457, 465 Babu, P., 9, 53, 71–73 Baenziger, J. U., 257, 339 Bains, G., 543 Baizabal-Aguirre, V. M., 390 Baker, A. G., 15 Baker, K. N., 451 Bakker, T. R., 348 Baleux, F., 200 Ballister, E. R., 378 Ballou, C. E., 29, 51 Bamford, V. A., 401 Bamonte, F., 443 Banerjee, A., 513 Bansal, A., 447 Bao, G.-m., 470 Bao, X., 6, 22 Barany, G., 365, 368, 371, 374, 468 Baratin, M., 213 Barbachyn, M. R., 451 Barb, A. W., 365, 376 Barbieri, C. M., 442, 454, 456 Barclay, A. N., 351, 543 Bark, S. J., 513 Barlund, M., 168 Barone, G., 468
Barresi, R., 366, 374 Barrientos, L. G., 371 Barr-Zarse, G., 207 Bartolozzi, A., 200–201 Baskaran, G., 545 Baskin, J. M., 559 Basso, A., 468 Bateman, A., 268 Batley, M., 390 Baumann, H., 155 Baumann, N., 521 Baum, L. G., 367 Bax, A., 319, 371 Bax, M., 29 Becattini, B., 447 Bedekovics, T., 440 Bedwell, D. M., 440, 454, 456 Beebe, X., 470 Beis, K., 401 Belakhov, V., 447–448, 452, 455–457 Belanova, M., 402 Benakli, K., 420 Bengtson, P., 348, 543, 545 Benitez, R., 166 Benitez, T., 272 Bennett, C. S., 513 Bennett, E. P., 136, 138–139 Ben-Smith, A., 376 Bentley, A. T., 457 Ben-Yosef, T., 455–456 Bergefall, M., 207 Berger, M., 350 Berg, S., 391 Berkhout, B., 349 Berst, M., 390 Bertini, I., 307 Bertin, J., 333 Bertozzi, C. R., 199–200, 366, 374, 399, 464, 504, 543, 545, 548, 559 Besra, G. S., 390, 392, 402, 404 Besser, T. E., 451 Best, D., 275 Betenbaugh, M. J., 550 Beutle, B., 430 Bhamidi, S., 390 Bhattacharya, K., 350 Bhaumik, M., 28 Biassoni, R., 213 Bielik, A. M., 81 Biessen, E. A., 564 Bigge, J. C., 130 Bilodeau, M. T., 466 Bindschaedler, P., 201 Birken, S., 375, 377 Bjorkman, P. J., 378–379 Blackburn, C., 468 Black, P. M., 290 Blake, D. A., 237
575
Author Index
Blanchard, J. S., 200, 402, 442 Blanchard, V., 376 Blaszczyk-Thurin, M., 564 Blixta, O., 204 Blixt, O., 242–243, 245–247, 255–256, 258, 260–261, 347–348, 350, 354, 359–360, 542 Blonski, K., 166 Bobbitt, J. M., 46 Boboila, C., 349, 545 Bochner, B. S., 346–347, 350 Boddy, C. N. C., 513 Boelens, R., 376–379 Bogomolovas, J., 268 Bo¨hm, F., 200, 207, 209–210 Bokemeyer, C., 166 Bokesch, H. R., 200 Boldon, S., 154 Boles, K. S., 375, 379 Boltje, T. J., 413 Bonderoff, S. A., 401 Bonding, N., 138–139 Bond, M. R., 541, 543, 545, 547, 554, 558 Boneca, I. G., 330–331, 333 Bonfanti, L., 220 Bongard, R. D., 565 Bongat, A. F. G., 413 Bonnaffe, D., 429 Bonnefoy, A., 564 Boonen, M., 242–243 Boone, T., 379 Boons, G. J., 333, 368, 377, 401 Boons, G.-J., 201, 413, 415, 419, 429, 518, 522 Borgert, A. J., 365, 368, 374 Bork, P., 268 Bose, K. K., 159 Bos, J. L., 159 Bossinger, C. D., 470 Bottger, E. C., 438, 443, 456 Bottino, C., 213 Botti, P., 513 Boucau, J., 390 Bourdetsky, D., 449–450 Bovin, N. V., 347–350, 352–354, 359–360 Bower, K. E., 447 Bowers, A. A., 420 Bowman, M. J., 81 Boysen, M., 420, 423 Bradfield, P., 351 Brady, E. K., 376 Braiuca, P., 468 Brancaccio, A., 374 Branderhorst, H. M., 472 Brandley, B. K., 520 Brankow, D., 333 Bravo-Patino, A., 390 Breborowicz, J., 155 Bremner, J. B., 451 Brennan, P. J., 390–391, 402
Brewer, C. F., 199, 255 Briggs, J. B., 376 Brik, A., 513 Brinkmalm, G., 559 Brinkman-Van der Linden, E. C. M., 555 Brisson, J. R., 387, 390, 392, 426 Brodersen, D. E., 441, 454 Broekaert, W. F., 554 Brookes, P. N., 200 Brooks, S. A., 166 Brossmer, R., 347, 545 Brostoff, J., 380 Brotschi, C., 402 Brown, C. F., 367 Brown, G. D., 282 Brown, J. M., 375, 377, 379 Brown, R. E., 392 Bruce, J. A., 130 Bruckner, P., 81–82 Bruell, C. M., 443, 456 Brutscher, B., 306 Bryan, M. C., 204, 242–243 Bubendorf, L., 168 Buck, L., 333 Budnik, B. A., 82 Bugie, E., 438 Bui, H., 294, 296 Bundle, D. R., 310, 349, 355 Burchell, J., 368 Burkholder, I., 166 Burritt, J. B., 564 Burton, A., 401 Burton, D. R., 381 Busby, D. J., 470 Busch, A. M., 82, 99 Bush, C. A., 368 Bush, D., 391 Buskas, T., 368 Buskus, T., 413 Busse, L., 333 Busto, J. H., 372–373 Butenhof, K. J., 367 Butters, T. D., 265, 274–278, 284 Buttle, D. J., 200 C Cadotte, N., 426 Cai, A. N., 376 Cain, S. A., 200 Cajero-Juarez, M., 390 Calarese, D., 204, 242–243, 347, 350 Call, D. R., 451 Callewaert, N., 426 Calosing, C., 349 Cameron, J. L., 159 Campanero-Rhodes, A. S., 282 Campanero-Rhodes, M. A., 278
576 Campbell, A. P., 370, 372 Campbell, J. M., 53 Campbell, K. P., 366, 374 Camphausen, R. T., 243, 249, 542 Canfield, R. E., 375, 377, 379 Canfield, W. M., 249 Canis, K., 27 Canne, L. E., 513 Cantoni, C., 213 Cantu, R., 23 Cao, H., 465 Capila, I., 199, 464 Capon, C., 5, 93 Caprioli, R. M., 288–290, 296 Cariappa, A., 349, 545 Carlin, A. F., 348 Carlow, D. A., 249 Carlsohn, E., 559 Carlson, E. E., 398–399 Carlsson, S. R., 254, 369 Carlstedt, I., 5 Carneiro, L. A., 330 Carrasco, M. R., 513 Carroll, R. S., 290 Carruthers, R. A., 366, 374 Carter, A. P., 441, 454 Caruthers, M. H., 465 Carvalho, I., 438 Castagner, B., 473, 475, 480–481 Cavanaugh, J., 370 Cawthrw, S., 426 Ceccato, M. L., 429 Ceroni, A., 59, 82, 105 Chadwick, C. A., 379 Chaikof, E. L., 207 Chait, B. T., 375, 377 Chait, R., 453 Chai, W., 199, 265, 268, 272–273, 278–279, 281–282 Chai, W. C., 465 Chai, W. G., 366, 374 Chakravarty, J., 441 Chalabi, S., 9, 375 Chamaillard, M., 330–331, 333 Chamow, S. M., 376 Chan, A. T., 161 Chan, E. M., 111 Chang, C. W. T., 438, 444 Chang, D., 333 Chang, L. Y., 8 Chang, T. Y., 564 Chang, V. T., 375, 379 Chang, Y. C., 348 Chan, K. H., 387 Chaput, C., 333 Charles, S. M., 130 Chatterjee, D., 390 Chaurand, P., 288
Author Index
Chavez-Moctezuma, M. P., 390 Cheetham, J. C., 379 Chen, B., 377–378 Chen, C., 429 Chen, F., 455–456 Chen, G., 513 Cheng, F., 93, 100 Cheng, J., 347, 360 Cheng, R. P., 564 Chen, J. F., 429 Chen, J. H., 513 Chen, L., 438, 449–450 Chen, M., 201 Chen, M. M., 426 Chen, P., 15 Chen, W. C., 334, 349 Chen, X., 49, 347, 349, 360, 393–394, 545 Chen, X. J. S., 378 Chen, X. T., 368–370, 372–373 Cherniavsky, M., 438, 447, 455–456 Chiara, J. L., 415 Chiba, Y., 127, 129, 136, 138, 141, 176 Chi, L., 82, 93, 100, 102 Childs, R. A., 265, 268, 278–279, 281 Chinarev, A. A., 349 Chinnapen, D. J.-F., 542 Chirino, A. J., 379 Chittapragada, M., 438, 440, 444 Choi, J. S., 379 Choi, S. K., 465, 486 Cho, J. A., 542 Chokhawala, H. A., 347, 360 Christofides, J. C., 312 Chui, D., 28 Chujo, R., 369, 372 Chung, S., 376 Ciucanu, I., 6 Clark, A., 381 Clarke, A. J., 402 Clarke, B. R., 426 Clark-Lewis, I., 511 Clark, S. J., 200 Clarkson, R. A., 275 Claude, E., 296 Clausen, H., 136, 138–139, 368, 371 Clemons, W. M., 441, 454 Clench, M. R., 296 Clore, G. M., 318, 369 Cochran, S., 207 Code´e, J. D. C., 473 Colescott, R. L., 470 Collin, M., 375 Collins, B. E., 348–349, 354–355, 359–360, 542–543, 545 Collinson, L. J., 200 Coltart, D. M., 368–370, 372–373 Comelli, E. M., 29, 71–73 Completo, G. C., 334, 349, 352, 396–397, 402, 404
577
Author Index
Connole, M., 349, 545 Cook, P. I., 470 Coombe, D. R., 207 Copley, R. R., 268 Coppi, A., 81 Coquard, V., 278 Corfield, A. P., 48 Cornelissen, M., 349 Cornett, D. S., 288, 290 Cornish, A. L., 350 Corzana, F., 201, 372–373 Costa, J., 282 Costello, C. E., 21, 52, 81–82, 288 Coˆte´, S., 468 Counter, C. M., 159 Courtney, A. H., 349 Coyle, A. J., 330 Craig, L., 570 Craney, A., 453 Cravatt, B. F., 348 Crawley, S., 542 Crespo, J., 331 Crich, D., 420, 423, 513 Crick, D. C., 391, 402 Crispin, M., 375, 379 Crocker, P. R., 278, 344, 346–351, 353–354, 542 Crowe, J. H., 368–370 Crowe, L. M., 368–370 Crozat, K., 430 Cruz, L. J., 468 Cui, W. X., 207 Cukan, M., 376 Culyba, E. K., 379 Cummings, B. S., 296 Cummings, R. D., 5, 8–9, 200, 241–243, 245, 249–251, 253–261, 365–366, 374, 464, 504, 542, 554 Cummings, R. T., 447 Cunningham, B. R., 447 D Dafoe, L., 399 Dahms, N. M., 242–243 Daigo, Y., 161 Daley, G. Q., 111 Dalton, S., 81 Dam, T. K., 199 Dan, A., 504 Dang, J., 521 Daniellou, R., 390, 393, 398, 401 Danishefsky, S. J., 368–370, 372–373, 375, 466, 470, 513–514 Danzer, C. P., 347 Dasgupta, F., 520 Davidson, E. A., 464 Davies, D. B., 312 Davies, E. A., 348
Davies, P., 296 Davis, B. G., 487 Davis, M. A., 451 Davis, S. J., 275 Dawson, C. A., 565 Dawson, P. E., 375, 511, 513–514, 554, 556 Day, R., 288 De Alba, E., 371 de Beer, T., 377 de Belder, A. N., 272 Debena, I., 470 Deb, J. K., 441 de Boer, A. R., 242–243 Deelder, A. M., 242–243 Deguchi, K., 110–111 de Haas, S. A., 564 Dehoffmann, E., 391 Deisenhofer, J., 310, 314, 380–381 de Koning, L. J., 104 de la, C. J., 272 De La Fuente, E. K., 565 de Lederkremer, R. M., 394 Dell, A., 4–5, 7–9, 19, 27, 29, 49, 51–52, 57, 82, 105, 161, 288, 369, 375 de Luis, M. G., 372–373 De Martin, L., 468 Demchenko, A. V., 413, 415, 429, 518, 522 De Meo, C., 522 De Napoli, L., 468 Deng, L. Y., 391 De Paz, J. L., 199–201, 204, 206–207, 209–214 de Paz, J. L., 429 dePaz, J. L., 429 DeSieno, A. R., 348 Desmons, A., 288 D’Haeze, W., 391 Dianiskova, P., 402 Dias-Baruffi, M., 243, 255 Diaz-Rodrı´guez, E., 282 Diaz, S., 349, 545 Diekmann, S., 296 Dierks, T., 83 Dijkhuizen, L., 390 Dinca, N., 81–82 Ding, P., 401 Dirksen, A., 554, 556 Disney, M. D., 200 DiStefano, P. S., 330 Dobrolecki, L. E., 110 Doi, R., 154 Dolan, C., 371 Domon, B., 21, 52 Domowicz, M., 221 Doolittle, R. F., 380 Dordick, J. S., 92, 199 Dorland, L., 376 Dota, A., 570 Dover, L. G., 402, 404
578
Author Index
Driguez, P. A., 429 Dube, D. H., 543, 548 Duchaussoy, P., 429 Ducoroy, P., 290 Du, J., 543–544, 559 Duncan, J. K., 393, 399 Duncan, K., 392 Dunham, C. M., 441, 454 Duong, B. H., 352, 354, 359–360 Durbin, R., 268 Du, X., 430 Du, Y., 416 Dwek, R. A., 274–278, 284, 288, 373, 375, 378–381, 486 Dyson, H. J., 373 Dziadek, S., 372 E Ebert, C., 468 Ebe, Y., 167, 170, 185, 221 Eddy, S. R., 268 Edler, L., 166 Edwards, J., 373 Egrie, J., 379 Eguchi, H., 155–158 Elbein, A. D., 277, 391 Eller, S., 463 Ellies, L. G., 28, 70 Elliott, S., 333 Elmore, R., 379 Endo, A., 525 Endo, T., 374 Engel, J., 374 Engelsen, S. B., 373 Enghild, J. J., 93, 100 Enke, C. G., 51 Enoki, Y., 495, 504 Eppe, G., 401 Erbel, P. J. A., 378–379 Eriksson, L., 423 Ernst, B., 415 Errey, J. C., 393–394, 401–402 Esko, J. D., 200, 207, 366, 374, 429, 464, 504, 545 Etienne, A. T., 27, 375 Etzler, M. E., 200, 464, 504 Eustice, D. C., 440 Euzen, R., 390 Evans, D. B., 162 Evans, E. J., 375, 379 Evans, P. G., 278 Everest, P., 426 Ewing, C. P., 425 Eyler, J. R., 82 F Fairbrother, W. J., 310, 370 Fairhurst, S. A., 401
Fairweather, J. K., 207 Fass, U., 455 Fattorusso, R., 447 Fazio, F., 199, 204, 242–243, 347, 350, 465 Feeney, R. E., 368–370 Feher, K., 242–243, 266–268, 281–283 Feinstein, A., 381 Feizi, T., 199, 242–243, 265–268, 272–273, 278–279, 281–283, 366, 374, 465 Felcetto, T., 447 Feldman, M. F., 399, 401, 426 Felli, I. C., 306 Femrnig, D. G., 429 Feng, L., 401 Fennelly, J. A., 375, 379 Fenn, J. B., 51 Ferguson, M., 457 Ferguson, M. A., 45 Fernandes, D. L., 380 Fernig, D. G., 204 Ferrie`res, V., 390, 393, 398, 401 Ferro, V., 207 Ficht, S., 513 Fielder, H. L., 200 Field, R. A., 393–394, 401–402 Fiete, D., 257 Figueroa-Perez, I., 430 Finn, M. G., 349 Finn, R. D., 268 Fisher, J. F., 442 Fisher, R., 376 Flangea, C., 81–82 Flanigan, K. M., 454–455 Fleet, G. W. J., 275, 390 Floyd, H., 350 Flynn, G. C., 49 Fontalba, A., 331 Forge, A., 443 Forino, M., 447 Foster, M. P., 306 Foster, S. J., 330–331, 333 Fourmy, D., 441 Fournier, I., 288, 290 Fox, A., 333 Foxall, C., 520 Francois, B., 438, 441 Frank, M., 376 Fransson, L. A., 93, 100 Fraser-Reid, B., 465 Freeze, H. H., 200, 366, 374, 464, 504 Freire, E., 543 Fridman, M., 447–448 Fridman, W. H., 382 Friedlander, A. M., 447 Fries, E., 93 Fritz, J., 333 Fritz, T. A., 136, 366, 545 Fromholt, S. E., 521
579
Author Index
Fuchs, B., 288 Fujii, Y., 335, 470 Fujikawa, K., 376, 527 Fujimoto, Y., 323, 325, 327–329, 331, 333, 431 Fujimura, T., 161 Fujitani, N., 334, 368, 485, 487, 489 Fujita, S., 525 Fujiwara, T., 500, 570 Fukase, K., 323, 325, 327–331, 333–335, 338, 431, 470 Fukase, Y., 325, 329 Fukuda, M., 29, 51, 128–129, 166, 220, 240, 369, 425 Fukuda, M. N., 563–568, 570 Fukuda, N., 327 Fukui, Y., 207 Fuller, J., 333 Fullerton, S. W. B., 401 Fumoto, M., 111, 114, 123, 368, 485, 487, 489, 496, 499 Furic, R., 468 Furuike, T., 334 Furukawa, J.-i., 111, 113, 115–117, 120–123 Furusho, K., 376, 381 Fu, S., 166 Fusco, M. L., 367, 375 Fuse, T., 528, 533–534 Futai, M., 255 Futakawa, S., 242, 347, 350, 360 Fu, Y., 15 G Gabius, H. J., 255, 339 Gage, F. H., 121 Gagneux, P., 182 Gala´n, A., 111 Galanina, O. E., 349 Gallagher, J. T., 82 Galustian, C., 268, 272, 279 Gama, C. I., 199 Gamblin, D. P., 487 Gandhi, N. S., 199 Garcı´a-Martı´n, F., 468 Garcı´a-Ramos, Y., 468 Gardossi, L., 468 Garner, O. B., 367 Garozzo, D., 20–21 Garrett, T. J., 294, 296 Gauguet, J. M., 6, 22 Gavaed, O., 429 Gellermann, G. P., 296 Gemma, E., 420, 423 Georgel, P., 430 Gerken, T. A., 367 Gerlach, J., 347 Gerngross, T., 376 Gerngross, T. U., 425
Gerold, P., 473 Gesemann, M., 374 Gesteland, R. F., 454–455 Geurtsen, R., 465 Geyer, H., 4, 105, 288 Geyer, R., 4, 105, 288 Ghirlando, R., 381 Ghoshal, A., 350 Gibson, T. J., 242–243, 266–268, 281–283 Gillespie, T. A., 288, 296 Gillingham, D. G., 472 Gin, D. Y., 416 Giovannini, M., 333 Girardin, S. E., 330–331 Glee, P. M., 564 Glikin, D., 455, 457 Glinskii, O. V., 564 Glinsky, V. V., 564 Glithero, A., 373 Glover, K. J., 426 Glueckmann, M., 20–21 Glunz, P. W., 368–370, 372–373 Gnanou, Y., 207 Gobel, U. B., 430 Goern, M., 166 Goetz, R., 202 Goldberg, D., 7, 9, 59 Goldman, W. E., 333 Goldstein, I. J., 237, 259, 554 Golenbock, D., 333 Gomes, M. M., 381 Gong, B., 376 Gong, H. Y., 377–378 Gonzalez, T. V., 297 Goodall, M., 381 Goodman, S. N., 159 Goon, S., 543, 545 Goordena, J., 470 Go¨otz, F., 431 Gosselin, S., 403 Gossens, K., 249 Gotfredsen, C. H., 468 Goto-Inoue, N., 287–288, 291, 293–295, 297–298 Goto, K., 468 Goulding, P. N., 130 Gourdine, J. P., 243 Gourvenec, F., 429 Gowda, D. C., 464 Go, X. G., 375 Granoff, D. M., 564 Grant, J., 333 Grassi, P., 527 Gravel, C., 468 Greenberg, W. A., 199 Green, L., 465 Greenlee, R. T., 154 Greenspan, N., 570
580
Author Index
Grewal, R. K., 390 Grice, P., 465 Griesinger, C., 372 Griffin, G. W., 468 Griffiths-Jones, S., 268 Griffiths, R. C., 390 Grinstead, J. S., 370, 372 Gronenborn, A. M., 371 Groot, F., 349 Gross, E., 514 Groth, T., 468 Grtli, M., 468 Gruber, T. D., 398 Grunow, D., 543 Grunwell, J. R., 548 Guan, S., 402 Guan, S. H., 104 Guegan, J. P., 393, 398 Guerardel, Y., 8 Guerrero, J. A., 347, 360 Guerry, P., 425 Guimond, S. E., 83 Gu, J., 339 Gunay, N. S., 81 Guo, B., 15 Guo, J., 447 Gurcha, S. S., 402, 404 Gururaja, T. L., 369 Guthrie, O. W., 440 Guthrie, R. D., 466, 468 Gutierrez, O., 331 Guzel, C., 288 H Haag, R., 207 Hackett, F., 473 Haider, K., 349, 545 Hainrichson, M., 440, 447, 449–450, 452, 454–457 Hakomori, S. I., 155, 161 Halim, A., 559 Halkes, K. M., 468 Hamako, J., 274 Hamann, L., 430 Hammond, E., 207 Ham, Y. W., 438, 440, 444 Hanashima, S., 318 Handa, S., 570 Hang, H. C., 548 Hannan, J. P., 378 Hanniffy, O. M., 390 Han, S., 242, 347–350, 352, 354–355, 359–360, 543, 545 Hanson, S. R., 379 Harada, T., 293, 465 Haraldsson, M., 339 Hard, K., 377
Hardy, M. R., 339 Harley, W., 333 Harlos, K., 275 Harper, L., 376 Harris, K., 81 Harrison, R., 27 Harrison, S. C., 377–378 Harris, S. L., 570 Hart, G. W., 200, 366, 373–374, 464, 504 Hart, S. A., 490 Hartung, O., 111 Hartung, T., 430 Harvey, D. J., 21, 49, 288, 375, 379 Harvey, T. S., 379 Hasegawa, A., 520–521, 525 Hasegawa, K., 334, 338 Hasegawa, M., 331, 333 Haselmann, K. F., 82 Hase, S., 49, 130 Hashidate, T., 255 Hashimoto, M., 330–331, 333, 431 Hashimoto, S., 415, 417 Hashimoto, Y., 71, 429 Hashizume, D., 423 Haslam, S. M., 4–5, 7–9, 27, 45, 57, 82, 105, 375 Hassan, H., 371 Hatakeyama, S., 564–567 Hatanaka, K., 391 Hato, M., 110, 113, 116–117, 120, 122 Hatta, H., 274 Hattori, C., 429 Haurum, J. S., 373 Hauser, S., 428 Hayasaka, T., 287–288, 293–295, 297–298 Hayashi, M., 415 Hayashi, T., 392 Hays, L. M., 368–370 Head, S., 204, 242–243 Hecht, M. L., 465 Hecht, M.-L., 200, 213–214 Heckel, A., 468 Hedlund, M., 254 Heeren, R. M., 288 Heffer-Lauc, M., 521 Hefta, S. A., 93 Hegreness, M. J., 453 Heimburg-Molinaro, J., 243, 564 Heine, H., 331 Heinlein, C., 375 He, J., 166 Helenius, A., 504 Helin, J., 5, 8, 243, 249–250 Hellerqvist, C. G., 390 Hendra, J. B., 290 Henning, W. M., 465 Henson, C. M., 296 Herault, J. P., 429 Herbert, J. M., 429
581
Author Index
Herget, S., 472 Herman, J. L., 288, 296 Hermann, T., 438, 440, 444 Hermjakob, H., 365–366, 464 Hernandez, M., 426 Hernandez Mir, G., 5, 8 Hernday, N., 333 Herp, A., 20 Herr, A. B., 207, 378, 381 Herrmann, A., 5 Hershkovitz, O., 200, 213–214 Herve, M., 333 Herwichowska, K., 155 Hesse, C., 559 Heuser, J. E., 354 Hewitt, M. C., 473 Hickey, R. J., 110 Higgs, D., 166 Hijioka, T., 157–158, 162 Hillenkamp, F., 288 Hill, L., 401 Hill, M. G., 513 Hill, R. L., 136 Hilvert, D., 472 Hinderer, R., 161 Hinderlich, S., 350, 545, 549, 552–553, 555 Hindsgaul, O., 221 Hinou, H., 111, 123, 368, 485, 487–489, 496, 499 Hinzen, B., 465 Hirabayashi, J., 129, 136, 138, 141, 165, 167–168, 170–171, 176, 181, 221, 234, 255 Hirabayashi, Y., 570 Hirai, M., 334 Hirano, K., 505 Hirano, T., 157–158 Hirashima, M., 255 Hirata, K., 521 Hirohashi, S., 166 Hitchcock, A. M., 81 Hitchen, P. G., 4 Hobbie, S. N., 443, 456 Hobbs, M., 390 Hoebe, K., 430 Hoeffel, T. J., 379 Hoegermeier, J. A., 201 Hoffmann, J., 242, 347, 350, 360 Hogan, S. E., 391 Hokke, C. H., 242–243 Hokum, M., 333 Holers, V. M., 378 Holland, M., 376 Hollich, V., 268 Hollingsworth, M. A., 136, 372 Holsters, M., 391 Hol, W. G. J., 542 Homans, S. W., 379 Homeister, J. W., 70
Honda, K., 402 Hong, Y., 549 Honke, K., 5, 128–129 Hood, D. W., 344, 349 Hooper, I. R., 438 Horie, Y., 330, 333 Horio, K., 170 Horlacher, T., 199–200, 213–214 Horstkorte, R., 543 Hosaka, D., 468 Hoshino, H., 425 Hosotani, R., 154 Hosoyama, S., 81 Hotta, K., 438, 444, 451 Hou, S. J., 207 Howard, M. T., 454–455 Hoylaerts, M. F., 564 Hruban, R. H., 159, 162 Hsiao, H. H., 6–8, 22 Hsieh-Wilson, L. C., 199–200 Hsu, C. C., 447 Hsu, K. L., 194 Hsu, T. L., 379 Huang, C. J., 8 Huang, D. H., 373 Huang, H. H., 375 Huang, H. R., 391 Huang, S., 347, 360 Huang, W., 375, 427 Huber, R., 376, 381 Hu, D., 234, 237 Hudson, S. A., 347 Huflejt, M. E., 204, 242–243 Hug, I., 399, 401 Hugot, J. P., 333 Hui, A. Y., 161 Hung, S.-C., 415, 429 Hunt, D. K., 201 Huo, H., 111 Hurtado-Ziola, N., 347–348, 360 Hutter, J., 423 I Iadonisi, A., 468 Ibrahim, H. R., 495, 504 Ichikawa, Y., 234 Ichisaka, T., 111 Ide, Y., 155–158 Igarashi, K., 334 Ihara, Y., 166 Iida, M., 525 Ikeda, Y., 166, 451 Ikegami, K., 293 Ikehara, Y., 165–167 Ikemizu, S., 275 Ilarregui, J. M., 254 Imakita, N., 325, 327–329
582
Author Index
Imamura, A., 419, 523, 527–528, 530, 533–534 Imamura, M., 154 Imaoka, S., 167 Imberty, A., 429, 542 Impallomeni, G., 20–21 Imperiali, B., 426 Inamura, S., 331 Inazu, T., 468, 496, 499 Ince, S. J., 465 Ince, T. A., 111 Ingale, S., 368 Inohara, N., 331, 333 Inoue, Y., 369, 372, 570 Insung, O., 564 Ioffe, E., 28 Iozzo, R. V., 83 Irie, S., 161 Irimura, T., 167, 371 Irvine, R. A., 333, 336, 338 Isecke, R., 545 Ishida, H., 167–168, 419, 468, 517, 520–523, 527–528, 529, 533–534 Ishida, H.-K., 129–130 Ishida, N., 138–139 Ishii, K., 420, 423, 425 Ishii, S., 221 Ishii, T., 392 Ishikawa, D., 570 Ishikawa, J., 451 Ishikawa, O., 155–158 Ishima, R., 370 Ishino, K., 451 Ishiura, S., 429 Ishiwata, A., 428 Ishizaki, I., 293 Ishizuka, I., 81 Ismail, M. N., 27 Itai, T., 379 Itakura, Y., 171, 181, 187 Ito, H., 9, 110, 127, 129–131, 136, 138, 141–142, 147, 166, 176 Ito, T., 155–158, 162, 487, 496, 499 Ito, Y., 234, 237, 415, 420, 423, 425, 428, 504 Iwasaki, N., 110–111, 121 Iwata, M., 325, 327–329 Iwata, N., 429 Iwayama, Y., 528 Izawa, M., 4, 347 Izgarian, N., 294, 296 Izumi, M., 503 J Jackson, M., 390–391 Jackson, S. N., 288 Jacob, G. S., 278 Jaeckh, C., 242–243, 266–268, 281–283 Jain, R., 250
James, P., 520 Jana, S., 441 Janda, K. D., 468 Jang, K., 376 Jang-Lee, J., 7, 9, 27, 29, 49, 59, 375 Jarrell, H. C., 390, 426 Jayalath, P., 423 Jefferis, R., 376, 381 Jehanno, M., 330, 333 Jenkins, A. D., 466, 468 Jennings, H. J., 564 Jentoft, N., 367 Jewett, J. C., 548 Jigami, Y., 129, 136, 138, 141 Jimenez-Barbero, J., 201, 372–373 Jimenez-Oses, G., 372 Johnson, P. J., 161 Johnson, S., 447 Jones, A. J., 15, 376 Jones, C., 348–349 Jones, E. Y., 275, 351, 373, 375, 379 Jones, M. B., 545 Jones, V., 399 Jonke, S., 470 Joo, H., 376 Juneja, L. R., 495, 504–505 Jung, D., 447 Jung, K.-H., 468 Ju, T., 242–243, 249 K Kaczmarczyk, A., 93 Kahne, D., 465 Kaida, K., 521 Kainosho, M., 312–313 Kaiser, E., 470 Kaji, H., 166 Kajihara, S., 288 Kajihara, Y., 375, 503–505, 511, 514 Kakehi, K., 288 Kakeji, Y., 166 Kakudo, S., 500 Kalapala, S. K., 443, 456 Kalar, C., 415 KalbeBournonville, L., 391 Kaletas, B. K., 288 Kalkkinen, N., 253–254 Kallioniemi, A., 168 Kallioniemi, O.-P., 168 Kalloo, G., 349, 545 Kaltgrad, E., 349 Kalus, I., 83 Kamakura, K., 521 Kamerling, J. P., 333, 376–379 Kameyama, A., 9, 127, 129–131, 141–142, 147, 221, 520–521, 525 Kamitani, R., 111
Author Index
Kamiya, D., 234 Kamiya, Y., 234 Kanato, Y., 220–221, 229–230 Kan, C., 368, 375 Kandasamy, J., 437 Kandler, O., 330 Kaneko, M. K., 129, 136, 138, 141, 176 Kaneko, T., 333 Kaneko, Y., 334, 381 Kanemitsu, T., 468–469 Kang, P., 115 Kanie, O., 468–469 Kanke, F., 160–162 Kannagi, R., 4, 10, 347 Kannicht, C., 543 Kaptein, R., 377 Karamata, D., 138–139 Karas, M., 288 Karasudani, Y., 331, 333 Karimi-Nejad, Y., 378–379 Kariya, H., 431 Karlsson, M. C. I., 542 Karlsson, N. G., 5, 288 Karlyshev, A. V., 426 Karoli, T., 207 Karplus, M., 422 Kartha, K. P. R., 393–394 Kasahara, A., 157–158, 162 Kasahara, Y., 129, 136, 138, 141 Kasai, K., 221, 255 Katagiri, T., 161 Kataoka, M., 325, 329 Kates, S. A., 468 Kato, A., 275 Kato, K., 234, 288, 305–307, 310–314, 317–318, 371, 375–376, 381 Kato, Y., 129, 136, 138, 141, 176, 528 Katsuimoto, M., 431 Kaufman, B., 367 Kaul, M., 442 Kaur, D., 391 Kaushal, G. P., 277 Kawakami, T., 513 Kawakita, M., 138–139 Kawamoto, S., 158–162 Kawamoto, T., 167–168 Kawamura, Y., 376 Kawano, K., 328 Kawar, Z. S., 242 Kawasaki, A., 330–331, 333 Kawasaki, N., 233–234, 237, 288 Kawasaki, S., 570 Kawashima, H., 4, 6, 22, 564–567 Kawatkar, S., 419 Kayser, H., 543 Kellenbach, E., 470 Kellermayer, R., 440 Kelley, A. C., 441, 454
583 Kelly, J., 426 Kelly, J. W., 379 Kelm, S., 347, 351 Kemp, M. M., 81 Kenar, K., 570 Kensler, T. W., 159 Kent, S. B. H., 511, 513 Keppler, O. T., 350, 543, 545, 549, 552–553, 555 Kerek, F., 6 Kerns, R. J., 420 Kerr, S., 350 Kett, W. C., 207 Khanna, A., 268 Khanna, H. S., 543–544, 559 Khatib-Shahidi, S., 288, 296 Khatri, S., 455 Khatua, B., 350 Khieu, N. H., 387, 390 Khoo, K. H., 3, 6–8, 10, 19–22, 288, 390 Kidan, Y., 438 Kidd, J., 520 Kieber-Emmons, T., 564 Kielty, C. M., 200 Kiessling, L. L., 349, 393, 398–399, 402 Kikkawa, H., 570 Kikuchi, N., 142, 147, 500 Kileen, K., 81 Kim, B., 376 Kim, J.-H., 419 Kim, M., 274, 495, 504 Kimura, N., 4 Kimura,N., 347 Kimura, Y., 288, 294 King, C. C., 348 Kinoshita-Toyoda, A., 81 Kirikae, F., 431 Kirikae, T., 431 Kirnarsky, L., 372 Kishimoto, T., 157–158 Kishony, R., 453 Kiso, M., 419, 517, 520–523, 527–530, 533–534 Kiso, Y., 429 Kitada, T., 157–158, 162 Kitadokoro, K., 500 Kitajima, K., 219–221, 229–230 Kita, Y., 111, 123 Kitov, P. I., 349, 355 Kiyohara, A., 431 Kiyohara, K., 131 Kjellen, L., 200 Klein, M. G., 378 Klich, G., 369 Klock, J. C., 369 Klouckova, I., 115 Klutts, J. S., 391 Knibbs, R. N., 237 Knirel, Y. A., 390, 401 Knoppers, M. H., 379
584 Kobata, A., 47–48, 65, 374, 376 Kobayashi, K., 129, 136, 138, 141 Kobayashi, M., 425 Koenig, A., 250 Koga, K., 376, 381 Koga, M., 521 Koganty, R. R., 370, 372 Kogelberg, H., 366, 374 Kohler, J. J., 541, 543, 545, 547, 554, 558 Koike, Y., 522, 527–528 Koizumi, S., 528 Ko, J. H., 166 Koketsu, M., 495, 504 Kolenko, P., 312 Kollman, J. M., 380 Kolthoff, C. E., 379 Komba, S., 470 Komori, T., 523 Kondo, A., 339 Kondo, H., 111, 114, 123, 334, 496, 499 Kondo, J., 454, 456 Kondo, N., 334 Kondo, S., 438, 444 Kondo, T., 166 Konishi, T., 392 Konishi, Y., 288 Kononen, J., 168 Ko¨plin, R., 390, 392 Kordulakova, J., 402 Korekane, H., 5, 167 Kornfeld, S., 242–243 Korogi, S., 419 Kosaka, K., 155 Koseki-Kuno, S., 167, 170, 221 Koshiba, M., 417 Koshida, S., 207 Koshino, H., 423 Kosuge, T., 154 Kotani, S., 325, 328 Kovtoun, V., 294, 296 Kowarik, M., 375, 379, 426–427 Koyama, K., 335 Koyama, N., 158–160, 162 Kozutsumi, Y., 4, 347 Kraiczek, K., 81 Kralj, S., 390 Krantz, M. J., 370, 372 Kranz, H., 369 Krapp, S., 376, 381 Kratz, F., 207 Kremer, L., 402, 404 Kresse, H., 81–82 Kro¨ck, L., 473 Kros, J. M., 288 Kubitz, M., 352 Kubo, Y., 170 Kuduk, S. D., 368–370, 372–373 Kugler, C., 166
Author Index
Kuiper, J., 564 Kuisle, O., 470 Kui Wong, N., 55, 57 Kulik, M., 81 Kulkan, S. S., 429 Kumada, T., 160–162 Kuno, A., 129, 136, 138, 141, 165–168, 170–171, 176, 181, 183, 185–188, 221 Kunz, H., 372 Kuramoto, H., 111, 113, 116–117, 120, 122–123 Kurata, S., 333 Kuraya, N., 49 Kurogochi, M., 111, 113–114, 116–117, 120, 122–123, 161, 368, 485, 487–489, 496, 499 Kurosawa, N., 70 Kurtz, D. I., 456 Kusumoto, S., 207, 325, 327–331, 333 Kusunoki, K., 521 Kuszewski, J. J., 369 Kuwamoto, K., 158–162 Kyselova, Z., 110 L Laack, E., 166 Labigne, A., 330–331 Lachmann, R. H., 274, 278 Lahar, N., 545 Lahmann, M., 420, 423 Lai, P. B., 161 Lanctot, P. M., 121 Lane, A. N., 368–370 Lange, O. F., 319 Langer, P., 465 Langner, J., 549, 552–553, 555 Lanthier, P. H., 426 Laremore, T. N., 79, 82, 92–93, 97, 99–100, 102, 104, 199 Larocque, S., 387 Larson, G., 559 Lasanajak, Y., 242–243 Lassmann, T., 268 Laughlin, S. T., 199, 548, 559 Lau, J. M., 81 Lau, K., 347, 360 Laukien, F. H., 104 Lawrence, S. M., 550 Lawson, A. M., 268, 272–273, 279, 282, 366, 374 Lazarevic, V., 138–139 Leach, F. E., 79, 104, 429 Leach, III, F. E., 201 Leary, J. A., 82 Leathem, A. J., 166 Leatherbarrow, R. J., 381 Le Bourhis, L., 333 Lebrilla, C. B., 288, 290 Ledger, V., 8 Lee, D. C., 470
Author Index
Leeflang, B. R., 376 Lee, H., 376, 425 Lee, J.-C., 429 Lee, J. E., 367, 375 Lee, L. V., 447–448 Lee, M., 199 Lee, M. R., 465 Lee, R. E., 390, 392–393, 399 Lee, R. T., 486, 543 Lee, S., 376 Lee, W., 220 Lee, W. J., 333 Lee, Y. C., 333, 339, 486, 543, 550 Leffler, H., 254–255 LeGoff, E., 535 Leighton, S., 168 Lei, M., 6 Lemaire, R., 288, 290 Lemaitre, B., 333 Lemieux, R. U., 415 Lemoine, J., 93 Lencer, W. I., 542 Lepenies, B., 413 Lepoivre, M., 333 Leppa¨nen, A., 5, 8, 241, 243, 245–247, 249–251, 253–256, 258, 260–261 Lergenmuller, M., 504 Lessig, J., 288 Letunic, I., 268 Leulier, F., 333 Leung, A., 380 Levine, M. J., 369 Lewis, A. L., 348 Leymarie, N., 81 Ley, S. V., 465 L’Hoir, C., 542 Liang, F. S., 448 Liang, P. H., 199 Liang, Y.-Z., 420 Liao, L., 242, 347–350, 355, 360 Li, B., 428 Li, C., 166, 427 Li, C. P., 207 Li, C. S., 375 Liedberg, B., 227 Li, F., 542 Li, H., 350, 353–354, 359–360, 376 Li, J., 379, 390, 438, 444 Li, J. J., 387 Li, J.-P., 199 Li, M., 394 Lim, J. M., 23 Lim, K. H., 159 Lindahl, G., 348 Lindahl, U., 199–200 Linda, P., 468 Lindberg, B., 390 Lindner, B., 331, 430
585 Lindquist, L., 390 Lin, F., 429 Lingwood, D., 521 Linhardt, R. J., 79, 81–82, 84, 88, 92–93, 97, 99–100, 102, 104, 199, 201, 464 Lin, S. J., 402, 404 Linton, D., 426 Li, P. Z., 375 Li, Q., 288 Li, S.-C., 528, 533–534 Lis, H., 199 Liskamp, R. M. J., 472 Litjens, R., 200–201 Liu, D., 350, 390 Liu, H., 81, 349, 401, 545 Liu, H. W., 392–393, 399, 401 Liu, J., 81, 199, 201 Liu, K.-g., 470 Liu, L. G., 207 Liu, M., 365, 368, 371, 374 Liu, S., 376–377 Liu, Y., 166, 242–243, 265–268, 278–279, 281–283 Liu, Z. Y., 393–394 Livache, T., 200 Live, D. H., 365, 368–374 Li, W., 447 Li, X., 15 Li, Y. T., 297–298, 528, 533–534 Lizak, C., 375, 427 Llewellyn, N. M., 438 Llobell, A., 272 Logan, S. M., 426 Lohman, G. J. S., 201 Loh, Y.-H., 111 Loizidou, M., 166 Lolo, M., 470 Long, D. D., 451 Longenecker, B. M., 370, 372 Lonngren, J., 339 Lonn, H., 339 Lorenzini, T., 333 Lortat-Jacob, H., 200, 429 Lou, Q., 564 Love, K. R., 199, 465, 473 Lowary, T. L., 389–391, 396–399, 401–402, 404 Low, D. W., 513 Lowitz, K., 564, 568, 570 Lubell, W. D., 468 Lubineau, A., 429 Lubman, D. M, 166 Lubman, D. M., 161 Luchansky, S. J., 543, 545, 548 Lu¨deritz, O., 390 Luider, T. M., 288 Luke, G. G., 548 Lundblad, A., 47 Lund, J., 381
586
Author Index
Lundquist, J. J., 486 Lundstro¨m, I., 227 Luo, P., 564 Lustbader, J. W., 375, 377, 379 Luthi, H. P., 423 Lutteke, T., 377 Lu, X.-A., 429 Luyai, A., 242 Lv, X., 416 Lyer, P. N., 259 Ly, M., 92, 97, 99–100 M Maass, K., 105 Machajewski, T. D., 373 Machida, S., 470 Mackeen, M., 266–268, 281–283 Mackerness, K., 9 Macmillan, D., 513 Macnaughtan, M. A., 376 Maeda, N., 570 Maehara, Y., 166 Maenaka, K., 235 Maes, E., 5, 8 Magalhaes, J. G., 333 Magent, S., 200 Magnet, S., 442 Mahapatra, S., 402 Maillart, E., 200 Makitie, A., 5, 8 Male, D. K., 380 Maly, P., 70 Mammen, M., 465, 486 Manabe, S., 413, 415, 420, 423, 425 Mancera, R. L., 199 Mandal, C., 350 Mandel, A. M., 370 Mandel, U., 368 Mann, M. C., 401 Manos, P. D., 111 Mantey, L. R., 545 Manuvakhova, M., 454, 456 Mao, H., 490 Margolis, R. U., 366, 374 Marino-Albernas, J. R., 570 Markowska, J., 155 Marks, T. A., 457 Marlow, A. L., 393 Ma, R. L. Z., 378 Marolda, C. L., 399 Marquess, D. G., 451 Marrero, J., 166 Marshall, A. G., 104 Marshall, B. J., 423 Marshall, M., 268 Marshall, P. S., 296 Marson, A., 200
Marth, J. D., 6, 22, 220, 348, 366 Martial, J. A., 542 Martin, A., 375 Martin-Lomas, M., 415, 429 Martin, S. L., 392 Maruyama, K., 429 Mason, K. E., 49 Masquida, B., 438, 441 Masumoto, J., 330, 333 Masuyama, T., 334, 338 Matsuda, A., 165, 167–168, 176 Matsumiya, S., 310 Matsumoto, H., 153, 158–162, 468 Matsumoto, M., 288, 294, 297–298 Matsumoto, N., 234–235, 237 Matsumoto, Y., 570 Matsumura, K., 187, 374 Matsuno, T., 444, 449 Matsuno, Y. K., 9 Matsuo, I., 234, 237 Matsuo, O., 564, 568, 570 Matsushita, T., 111, 123, 368, 485, 487–489, 496, 499 Matsuta, K., 380 Matsuura, F., 274 Matsuyama, Y., 154, 294 Matsuzaki, H., 167 Matsuzaki, Y., 4, 347 Matta, K. L., 250 Mattei, M. G., 350 Matteucci, M. D., 465 May, A., 351 Ma, Y. F., 390 May, J. F., 399, 402 Mazmanian, S. K., 487 McArthur, S., 200 McAuliffe, T. L., 565 McCallum, S. A., 201 McCarthy, S. G., 376 McDonald, F. M., 111 McDonnell, L. A., 288 McDowell, R. A., 7, 19 McEver, R. P., 243, 245–246, 249–251, 542 McEwen, A., 296 McGuinness, B. F., 468 McKee, E. E., 457 McKeen, L., 81 McMahon, J. B., 200 McMahon, S. A., 398–399, 401 McNally, D. J., 390 McNeil, M. R., 390–393, 398–399, 401–402, 404 Mechref, Y., 6, 110, 115 Meckeen, M., 242–243 Mee, E., 366, 374 Mega, T., 187 Mehroke, J. S., 570 Mehta, P., 249, 255, 350 Melancon, C. E., 392
587
Author Index
Meldal, M., 468 Meledeo, M. A., 543–544, 559 Mellor, H. R., 275, 277 Mellroth, P., 333 Mengin-Lecreulx, D., 333 Meng, L., 376–377 Mensah, E. A., 416 Mercey, E., 200 Merker, M. P., 565 Merkle, R. K., 257 Merrifield, B., 465, 468 Merrit, E. A., 542 Merritt, J. R., 465 Merwe, P. A., 348 Metzler, M., 28 Meyer, B., 366–367, 369 Mezzato, S., 375 Michael, B. F., 447 Michalski, J. C., 5, 288 Michon, I. N., 564 Mihatsch, M. J., 168 Mikami, K., 234 Mikusˇova´, K., 391, 402 Milac, A. L., 378 Millar, D. S., 373 Miller, C., 81 Miller, J. D., 111 Mimura, Y., 369, 372, 376, 381 Minami, A., 110–111, 121 Minami, K., 335 Minematsu, H., 334 Mingari, M. C., 213 Miranda, L. P., 468 Mirza, U. A., 375, 377 Misek, D. E., 161 Misonou, Y., 5, 167 Mistry, J., 268 Mita, S., 333 Mitoma, J., 6, 22, 220, 240 Miura, N., 111 Miura, T., 468 Miura, Y., 111, 113, 115–117, 120–123 Mi, Y., 339 Miyakawa, S., 313–315 Miyamoto, Y., 5, 167 Miyatake, T., 47 Miyauchi, S., 275 Miyazaki, K., 4, 347 Miyazaki, Y., 392 Miyoshi, E., 153, 157–162, 166, 339 Mizon, C., 93 Mizon, J., 93 Mizuma, H., 334, 338 Mizuno-Horikawa, Y., 339 Mizuno, M., 170, 468 Mizuochi, T., 274, 380 Mizushima, T., 315 Moazed, D., 441
Mobashery, S., 438, 442 Moe, G. R., 564 Mohammadi, M., 202 Molenaar, T. J., 564 Molinaro, R. J., 243 Moller, H., 366–367 Mondala, T., 204, 242–243 Monde, K., 111, 334 Monsey, D., 392–393, 399 Monteiro, M. A., 387 Montpetit, M. L., 29 Moody, A. M., 28, 55 Moore, K. L., 249 Moore, P., 350 Mor, A., 449–450 Moran, A. P., 331, 390 Morath, S., 430 Morell, A. G., 333, 336, 338 Morelle, W., 288 Morell, J. L., 514 Moremen, K. W., 81, 376–377 Moretta, A., 213 Moretta, L., 213 Morey, S., 564 Morgan-Warren, R. J., 441, 454 Mori, M., 166 Morimatsu, M., 521 Moriwaki, K., 153, 155–162 Mori, Y., 470 Moriyama, A., 4, 347 Morris, H. R., 7–9, 19, 55, 82 Moseman, E. A., 211–213 Motoyoshi, K., 521 Motyka, S., 382 Moxon, S., 268 Mross, E., 468 Mudd, S., 430 Muhle-Goll, C., 242–243, 265–268, 281–283 Muir, T. W., 511 Mukhopadhyay, B., 393–394, 402 Muller, M., 288 Muller, W. E. G., 255 Mulloy, B., 200, 278 Munday, J., 350 Munoz, E., 81 Muraoka, O., 419 Murata, K., 155–158, 167 Murayama, K., 161 Murphy, F. V., 4th., 441, 454 Murray, J. B., 438, 441 Murray, T., 154 Murrey, H. E., 199 Muthing, J., 296 N Nagahori, N., 115, 122–123 Nagai, J., 443
588 Naganagowda, G. A., 369 Nagano, M., 375, 381 Nahmad, V. B., 394 Nahori, M. A., 333 Naimy, H., 81 Nairn, A. V., 81 Naismith, J. H., 398–399, 401 Naito, T., 288 Nakagawa, H., 110–111, 376 Nakagawa, T., 153, 155–160, 162, 339 Nakahara, T., 334 Nakahara, Y., 129–131, 496, 499, 504 Nakamura, E., 500 Nakamura, S., 417 Nakamura, T., 255, 570 Nakamura-Tsuruta, S., 188, 221 Nakamura, Y., 161 Nakanishi, H., 288 Nakanishi, K., 113, 116–117, 120, 122 Nakanishi, S., 288 Nakano, M., 111, 113, 116, 155–158, 162, 339 Nakanuma, Y., 167 Nakata, H., 487 Nakayabu, A., 470 Nakayama, J., 425, 564–568, 570 Nakaya, S., 142, 147 Nambu, H., 417 Narhi, L. O., 379 Narimatsu, H., 9, 127–131, 136, 138, 141–142, 147, 165–166, 176 Narisada, M., 158–162 Narita, M., 111 Nashed, M., 520 Nash, R. J., 275, 390 Nassau, P. M., 392 Nathan, J. K., 354, 359–360 Nath, D., 351 Naus, S., 249 Nawa, D., 234, 237 Neal, B., 390 Needham, L. K., 557 Nelin, L. D., 565 Nemazee, D., 352 Neri, D., 375, 427 Nettleship, J. E., 375, 379 Neville, D. C., 274, 276, 278 Neville, D. C. A., 276 Newell, D. G., 426 Nezlin, R. S., 306 Ngai, S. M., 161 Ng, E., 221 Nguyen, H. M., 416 Nibbering, N. M. M., 104 Nicholson, M. W., 543 Nicoll, G., 350 Nieto, L., 201 Niikura, K., 111, 334
Author Index
Ni, J., 350 Nikaido, H., 390, 392 Nikolaev, A. V., 393–394 Nilsson, B., 46 Nilsson, J., 559 Nilsson, M., 207 Nimmerjahn, F., 334, 375, 381, 542 Nishida, K., 570 Nishikata, M., 221 Nishimura, M., 375, 381 Nishimura, S.-I., 109–111, 113–117, 120–123, 161, 334, 368, 485, 488–489, 496, 499 Nishimura, T., 207 Nishi, N., 255 Nishizono, M., 495, 504 Nitschke, L., 347 Nizet, V., 348 Noguchi, M., 170 Nohara, T., 527 Nokami, T., 420 Nolan, J., 275 Noller, H. F., 441 Nomoto, M., 372 Norgard-Sumnicht, K. E., 250 North, S. J., 4–5, 7, 9, 27–28, 31, 51, 53, 55, 57, 71–73, 187, 189, 375 Nothaft, H., 399, 401 Noti, C., 199–202, 204, 206–207, 209–214, 429, 464 Noura, S., 5, 167 Novak, J., 381 Novotny, M. V., 6, 15, 110, 115 Noyori, R., 415 Nozaki, S., 335 Nsimba-Lubaki, M., 554 Nuck, R., 543 Nudelman, E., 155 Nudelman, I., 437–438, 440, 447, 454–457 Nugier-Chauvin, C., 390, 393, 398, 401 Numa, M. M., 447 Numao, S., 375, 379, 426–427 Numata, M., 525 Nunomura, S., 525 Nyame, A. K., 243, 249 Nylander, C., 227 O Oda, Y., 221 Oetke, C., 545 Offerhaus, G. J., 159 Offer, J., 513 Ogawa, G., 521 Ogawa, K., 293 Ogawa, T., 325, 329, 504 Ogino, K., 570 Ogle, J. M., 438, 441
589
Author Index
Ogura, Y., 330–331, 333 Ohigashi, H., 155–158 Ohishi, K., 288 Ohkohchi, N., 167 Ohmori, H., 333 Ohmori, K., 4, 347 Ohnishi-Kameyama, M., 392 Ohno, M., 111 Ohnuki, M., 111 Ohta, M., 274 Ohta, S., 428 Ohta, T., 496, 499 Ohtsubo, K., 6, 22, 62, 73, 366 Ohue, M., 5, 167 Ohyabu, N., 487 Ohyama, C., 564–568, 570 Oie, K., 334 Oikawa, M., 325, 327, 329 O’Reilly, M. K., 343, 346–347, 349, 355 Okamoto, H., 500 Okamoto, R., 375, 503, 514 Oka, S., 274 Oka, T., 255 O’Keefe, B. R., 200 Okumoto, T., 376 Oku, N., 570 Okuyama, N., 155–158, 339 Olin, A. I., 375 Ollmann, I. R., 465 Olsen, S. K., 202 Olson, L. J., 242–243 Olson, T.M., 440 Olsson, J. D. M., 423 O’Neill, M. A., 392 Ongini, E., 443 Onoe, H., 335 Ono, S., 229–230 Orfe, L. H., 451 Orgueira, H. A., 200–201 Ori, A., 429 Ornitz, D. M., 207 Orry, A. J., 447 Osborn, H. M., 278 Osborn, M. I., 465 Oscarson, S., 255, 420, 423 Oshima, Y., 333 Ota, M., 352 Ota, T., 352 Otsuka, Y., 331, 333 Ottiger, M., 371 Otto, D., 278 Ottosson, H., 465 Otto, V. I., 246, 249–251 Ouyang, Y. B., 249 Ovaab, H., 470 Ozaki, K., 570 Ozaki, M., 113, 116–117, 120, 122 Ozimek, L. K., 390
P Packer, N. H., 390 Page-McCaw, P., 81 Palcic, M., 221 Palcic, M. M., 402–404 Palma, A. S., 242–243, 265–268, 281–283 Palmacci, E. R., 200–201, 472–473 Palmer, A. C., 453 Palmer, A. G., 370 Palumbo, A., 375, 427 Pan, C., 15 Pandi, L., 380 Pan, F., 390 Pang, P. C., 27, 53, 161 Panico, M., 7, 9, 19 Pannekoek, H., 564 Pan, Y. T., 391 Pao, Y. L., 373 Papac, D. I., 15 Parekh, R. B., 130, 380 Park, E. I., 339 Park, I.-H., 111 Park, J., 419 Park, S., 199, 376, 440, 465 Parquet, C., 333 Parravicini, L., 443 Parry, S., 8, 29 Partha, S. K., 392, 401 Paruchuri, V. D. P., 543–544, 559 Parviainen, V., 253–254 Pasqualini, R., 564, 568, 570 Pastan, I., 564 Pasternack, L., 373 Patel, H. V., 521 Patel, T. P., 130 Pathak, A. K., 402, 404 Patwa, T. H., 161 Paulsen, H., 368–369, 415 Paulson, J. C., 242, 334, 343–344, 346–350, 352–355, 359–360, 464, 542–543, 545, 554, 556 Pawlita, M., 350, 543, 545, 549, 552–553, 555 Payne, R. J., 368, 375 Pazynina, G. V., 349 Pearcey, J., 396–397, 402, 404 Pedersen, C. M., 430 Pedersen, L. L., 390 Peeters, B., 554 Pellecchia, M., 315 Pellegrini, L., 204, 206 Peltier, P., 390, 393, 398, 401 Pende, D., 213 Pentelute, B. L., 513 Penttila¨, L., 245, 255 Percy, J. M., 401 Perdivara, I., 51 Peregrina, J. M., 372–373
590 Perepelov, A. V., 401 Perez, S., 429 Perez-Vilar, J., 136 Perlman, M., 23 Peter-Katalinic, J., 81–82 Peterson, B. L., 296 Petitou, M., 429 Petkovic, M., 288 Petrescu, A. J., 274–276, 284, 378 Petrescu, S. M., 274–276, 284, 378 Petros, L. M., 454 Petryanik, B., 6, 22 Petry, S., 441, 454 Peumans, W. J., 554 Pham-Dinh, D., 521 Phillips, J. H., 399 Philpott, D. J., 331, 333 Phol, N. L., 426 Piccialli, G., 468 Pickering, L., 275 Pickering, R., 166 Pieler, T., 242–243, 266–268, 281–283 Pierce, J. M., 81 Pierschbacher, M. D., 567 Pieters, R. J., 472 Pietruszka, J., 465 Pilch, D. S., 442, 454–456 Pili-Floury, S., 333 Pillai, S., 349, 545 Pils, B., 268 Pincus, S. H., 564 Pinkert, S., 268 Pinto, B. M., 402, 570 Pintor-Toro, J. A., 272 Piontek, C., 375 Piperi, C., 348 Pivnichny, J. V., 447 Pizzo, S. V., 93 Plante, O. J., 472–473 Platt, F. M., 274–278, 284 Plummer, T. H., Jr., 37, 375 Pochapsky, S., 470 Pohner, C., 375 Poirier, F., 254 Pokrovskaya, V., 437, 447, 452 Polat, T., 201 Polito, L., 200–201, 204, 206, 211–214, 429 Pollak, S., 375, 377, 379 Pollok, B. A., 490 Ponder, B. A., 70 Pons, F., 331 Pontrello, J. K., 349 Poon, T. C., 161 Porgador, A., 200, 213–214 Post, C. B., 422 Poulin, M. B., 389, 399, 401 Pound, A., 375, 377 Pound, J. D., 381
Author Index
Powell, A. K., 82, 204 Powers, E. T., 379 Pozsgay, V., 415 Pragani, R., 472 Prakash, O., 372 Prammananan, T., 438 Prendergast, M. M., 390 Prenni, J. E., 390 Prestegard, J. H., 318, 376–377 Priatel, J. J., 70 Priepke, H. W. M., 465 Priestman, D. A., 278 Prieto-Conaway, M. C., 294, 296 Princivalle, A. P., 296 Proft, T., 487 Przybylski, M., 81 Pu, D., 92 Puffer, E. B., 349 Puglisi, J. D., 441 Pulliam, L., 349 Puvirajesinghe, T. M., 83 Pytela, R., 567 Q Qian, Y., 254 Qin, S., 234 Qiu, J., 564 Qiu, S., 330, 333 Qiu, W., 161 Quin˜oa´, E., 470 Quintanar-Audelo, M., 468 R Rabinovich, G. A., 254, 365 Radaev, S., 382 Rademacher, T. W., 380–381 Rademann, J., 468 Radic, Z., 415 Raetz, C. R., 325 Raghavan, S., 465 Rahbek-Nielsen, H., 93, 100 Rahman, S. S., 470 Rajotte, D., 565 Raju, T. S., 376 Ramakrishnan, V., 438, 441, 454 Raman, R., 464 Ramnarain, S., 375, 377, 379 Ramya, T. N., 348 Ramya, T. N. C., 554, 556 Rankin, S., 9 Ranzinger, R., 472 Rao, C. S., 465 Rao, N., 520 Rapoport, E. M., 349 Rashed, M., 570 Ratanasirintrawoot, S., 111 Ratcliffe, R. M., 415
591
Author Index
Ratner, D. M., 200, 473 Ravetch, J. V., 334, 381, 542 Razi, N., 204, 242–243, 347–348, 350 Reason, A. J., 7, 19 Rebibo-Sabbah, A., 455–456 Redelinghuys, P., 347 Redmond, J. W., 390 Reeves, P., 390 Reinherz, E. L., 379 Reinhold, V. N., 542 Reinkensmeier, G., 274–276, 284 Reinscheid, U. M., 372 Reiter, W. D., 392 Rele, S. M., 207 Rempel, H., 349 Renfrow, M. B., 381 Renkonen, O., 243, 245, 249 Renkonen, R., 5, 8 Renugopalakrishnan, V., 375 Restaino, O. F., 82, 93, 100, 102 Reutter, W., 350, 543, 545, 549, 552–553, 555 Reynolds, R. C., 402, 404 Reyzer, M. L., 288–289 Rhee, J. K., 545 Rho, J., 111 Rice, K. G., 376 Richards, M. R., 390, 398 Richardson, N., 381 Rich, J. R., 366–367, 375 Riguera, R., 470 Riley, M., 380 Rillahan, C., 349, 355 Ring, P., 375 Rithner, C. D., 390, 393, 399 Rittenhouse-Olson, K., 564 Rivera-Marrero, C., 242–243 Robbe-Masselot, C., 5 Roberts, C., 465 Roberts, G. A. F., 466, 468 Roberts, S., 438, 440, 444 Robinson, B., 112 Robinson, D. E., 200 Rodie-Talbere, P., 93 Rodrigues, L. C., 243 Roepstorff, P., 93, 100 Roget, A., 200 Rohde, M. F., 379 Roitt, I. M., 380 Romeo, D., 20–21 Ronning, D. R., 390 Roper, D. L., 402, 404 Rose, M. C., 367 Rose, N. L., 396–397, 402, 404 Rosen, S. D., 4, 543 Rosental, B., 200, 213–214 Rot, A., 211 Rousson, E., 429 Roy, R., 564
Royyuru, A. K., 368–370, 372–373 Rozanov, D. V., 447 Rudd, P. M., 380 Ruetschi, U., 559 Ruoslahti, E., 564–565, 567–568, 570 Russell, R. J., 438, 441 Rutherfurd, S., 93 Rutishauser, U., 220 Rutshchmann, S., 430 Ryan, D. A., 416 Ryu, J. H., 333 S Saab, L., 330, 333 Saad, O. M., 82 Sabesan, S., 255 Sablina, M. A., 349 Sachdev, G. P., 242 Sadamoto, R., 334, 487 Sadilek, M., 161 Sadir, R., 200 Sage, H., 367 Saha, B., 350 Sahraoui, E. H., 438 Saido, T. C., 429 Saito, H., 6, 22 Saito, S., 161 Sakai, Y., 325, 329 Sakakibara, T., 504–505, 511 Sakamoto, T., 487 Sakurada, K., 111 Salvesen, G., 93 Salzet, M., 288, 290 Sames, D., 368–370, 372–373 Samosorn, S., 451 Sanada, N., 293 Sanchez, L. M., 379 Sander, P., 438 Sanders, D. A. R., 392, 398–399, 401 Sanki, A. K., 390 Sansonetti, P. J., 331 Santos, J. I., 319 Saphire, E. O., 367, 375 Sarfaty, S., 542 Sarkar, A. K., 545 Sarrazin, S., 429 Sarvas, M., 392 Sasagawa, N., 429 Sasakawa, H., 375, 381 Sasaki, K., 504–505 Sasaki, S., 470 Sasaki, T., 374 Sasaki, Y., 167 Sasisekharan, R., 464 Sasisekharan, V., 464 Sato, C., 219–221, 229–230 Satoh, H., 423
592 Sato, K., 327 Sato, M., 334 Satomura, S., 160–162 Sato, T. A., 112, 127, 129–131, 142, 147, 161 Sattler, M., 268 Satyanarayana, J., 369 Sauter, G., 168 Sautes-Fridman, C., 382 Savage, A. V., 390 Savage, C. O., 376 Saven, A., 349 Savinov, A. Y., 447 Sawada, N., 528, 533–534 Sawaki, H., 166 Sawaya, M. R., 380 Saxon, E., 548 Scallon, B. J., 376 Scanlan, C., 204, 242–243 Scanlan, E. M., 487 Schachner, M., 521 Schacht, J., 443, 455–456 Schaerli, P., 6, 22 Schallus, T., 242–243, 266–268, 281–283 Schatz, A., 438 Schauer, R., 351 Schauer, S., 200, 213–214 Scheinberg, I. H., 333, 336, 338 Schell, P. H., 200–201 Scherman, M. S., 390–392, 399 Schiller, J., 288 Schink, A., 490 Schiopu, C., 81 Schiraldi, C., 82, 93, 100, 102 Schlaeger, T. M., 111 Schleifer, K. H., 330 Schlo¨der, N. W., 430 Schmid, F. X., 375 Schmid, K., 112 Schmidt, R. R., 413, 417, 430, 468, 470 Schmidts, C., 543 Schnaar, R. L., 347, 350, 521, 557 Schneewind, O., 487 Schneider, P., 45 Schofield, L., 473 Schonherr, E., 81–82 Schraml, P., 168 Schriemer, D., 221 Schubert, M., 375, 379, 427 Schuetzenmeister, N., 201 Schulthess, T., 374 Schult-Kronefeld, O., 166 Schultz, J., 268 Schulz, B. L., 375, 427 Schumacher, U., 166 Schumann, R. R., 430 Schur, M. J., 350, 353–354 Schuster-Bockler, B., 268 Schuster, O., 369
Author Index
Schwardt, O., 415 Schwartz-Albiez, R., 549, 552–553, 555 Schwartz, N., 221 Schwartz, S. A., 288–289 Schwarz, F., 319, 375, 427 Schwarz, J. B., 368–370, 372–373 Schwarz, R. T., 473 Schweizer, A., 289 Schwieters, C. D., 369 Scotti, C., 138–139 Scott, J., 8 Scott, J. K., 570 Scudder, P., 48, 278 Seeberger, P. H., 197, 199–202, 204, 206–207, 209–214, 413, 425, 429, 463–465, 470, 472–473, 475, 480–481 Segawa, H., 138–139 Seidler, D. G., 81–82 Seitz, O., 373 Seki, Y., 5, 167 Sekiya, S., 115 Seko, A., 495, 504 Selleck, S. B., 429 Selmer, M., 441, 454 Senchenkova, S. N., 390 Seo, W., 249 Serb, A. F., 81–82 Seshadri, K., 379 Setou, M., 287–291, 293–295, 297–298 Severi, E., 344, 349 Shachar, D., 447 Shah, D., 451 Shallom-Shezifi, D., 447, 454–456 Shamel, S., 430 Shao, J., 394 Shaper, N. L., 521 Shapira, B., 318 Shapiro, R. E., 521 Sharon, N., 199, 365–366, 464 Sharpless, K. B., 548 Shashkov, A. S., 390 Shaw, G. D., 243, 249, 542 Shcherbakov, D., 443, 456 Shedden, K., 161 Sherman, S., 372 Shibuya, A., 420 Shibuya, N., 554 Shida, K., 5, 167 Shi, H. N., 349, 545 Shikanai, T., 142, 147 Shimada, F., 111 Shimada, I., 376, 381 Shimada, T., 161 Shimaoka, H., 111, 113, 116–117, 120, 122–123 Shimizu, H., 368, 485, 487–489, 496, 499 Shimizu, T., 374 Shimma, S., 288–289, 294 Shimoyama, A., 323, 325, 327–329
Author Index
Shindo, M., 376, 381 Shin, I., 465 Shin, L., 199 Shin, M., 500 Shinohara, Y., 111, 113, 115–117, 120–123, 161 Shinzaki, S., 153, 160–162 Shiokawa, Z., 331 Shipp, E. L., 200 Shirts, B. H., 454 Shitara, K., 375, 381 Shitara, T., 444, 449 Shi, X., 81 Shoda, J.-I., 167–168 Shogren, R., 367 Shoop, W. L., 447 Sigal, D. S., 349 Sihlbom, C., 51 Sihorkar, V., 334 Sillence, D. J., 278 Silva, D. V., 375, 465 Silva, J. G., 438 Silverman, N., 333 Simanek, E. E., 373 Simeone, D. M., 161 Simm, S., 155 Simon, B., 268 Simo´n, C., 111 Simons, K., 521 Simpson, J. C., 242–243, 266–268, 281–283 Sim, R. B., 380 Singer, M. S., 543 Singh, A., 334 Singh, S., 391 Sinnis, P., 81 Sinnwell, V., 369 Sisu, E., 81–82 Siwu, E. R. O., 335, 470 Sizun, P., 429 Skarp, K. P., 5, 8 Skehel, J. J., 377–378 Skelton, N. J., 370 Skidmore, M. A., 83 Skrisovska, L., 319 Slanina, K. A., 255 Sletten, E. M., 548 Slynko, V., 375, 379, 427 Smith, D. F., 242–243, 255, 564–567 Smith, D. M., 379 Smith, J. W., 447 Smith, M. D., 390 Smith, M. J., 564 Smolkin, B., 455, 457 Smolyar, A., 379 Snel, M. F., 296 Snyder, D. A., 473 Sobel, M., 207 Solakyildirim, K., 79, 92, 97, 99–100 Soldo, B., 138–139
593 Sole´, N. A., 468 Soltero-Higgin, M., 398–399 Somers, W. S., 243, 249, 542 Sondermann, P., 314, 376, 381 Song, H., 428 Song, X., 242–243 Sonnenburg, J. L., 555 Sonnhammer, E. L., 268 Sonoo, M., 521 Sorensen, A. L., 368 Srensen, T., 138–139 Souma, S., 514 Sovath, S., 430 Spalteholz, H., 288 Sparks, L. M., 275 Spencer, J. B., 438 Spera, S., 310 Spillmannb, D., 200 Spina, E., 20–21 Spiro, R. G., 275 Splain, R. A., 402 Springer, B., 438 Springer, G. F., 368 Springer, S., 373 Srikannathasan, V., 401 Staab, D., 289 Stadheim, T. A., 376 Stafford, G., 294, 296 Stahl, I., 455–456 Staines, A. G., 398–399, 401 Stallforth, P., 413, 465, 472 Stanley, P., 28, 200, 366, 374–375, 464, 504, 549 Stanworth, D., 380 Staples, G. O., 81 Stauber, J., 288 Stauch, T., 415 Stehlı´cek, J., 466 Steiner, H., 333 Stenbak, C. R., 333 Stenzel, W., 415 Steplewski, Z., 564 Sternlieb, I., 333, 336, 338 Stern, R. J., 392, 399, 402 Stevens, D. J., 204, 242–243, 347, 350 Stevens, J., 204, 242–243, 347, 350 Stevenson, G., 390 Stevenson, J. L., 379 Stier, G., 242–243, 266–268, 281–283 St. Michael, F., 387, 426 Stoeckli, M., 289 Stoll, M. S., 46, 268, 272, 279, 282–283 Stone, E. L., 53 Stowell, S., 245–247, 255–256, 258, 260–261 Stowell, S. R., 9, 242–243, 255 Streiff, M. B., 403 Strickland, T. W., 379 Stuart, D. I., 275, 375, 379 Sturiale, L., 20–21
594
Author Index
Sucheck, S. J., 390 Suda, Y., 207, 325, 327–329, 431, 523 Suematsu, M., 293 Suga, S., 420 Sugihara, K., 564–567 Sugimachi, K., 166 Sugimoto, M., 525 Sugiura, Y., 288–289, 291, 293–294, 297–298 Sukegawa, M., 129–130 Sukenick, G. D., 470 Sun, B., 349 Sundaram, S., 375 Sundar, S., 441 Sung, J. J., 161 Sun, P., 81 Sun, P. D., 382 Suss, R., 288 Sutton, B. J., 380 Sutton-Smith, M., 7, 9, 29 Suzuki, A., 333, 564, 568, 570 Suzuki, K., 47, 235 Suzuki, M., 564, 568, 570 Suzuki, N., 234, 237, 417 Suzuki, Y., 504–505 Svahn, C. M., 207 Svensson, S., 390 Swanson, B. J., 136 Swanson, E. R., 473 Sweeney, C. J., 110 Syed, R. S., 379 Szabo´, B., 429 Szakonyi, G., 378 Szczepina, M. G., 402 Szigeti, R., 440 Szpunar, J., 288 Szymanski, C. M., 387, 390, 399, 401, 425–426 T Tabak, L. A., 136, 366 Tabet, J. C., 288, 290 Tachado, S., 473 Tachibana, K., 188 Tada, M., 113, 116–117, 120, 122 Tadano-Aritomi, K., 81 Taga, T., 158 Taguchi, R., 288 Taguchi, T., 339 Taha, M. K., 330 Tahara, T., 334–335, 338 Tajiri, M., 157–158, 162 Takabayashi, K., 403 Takada, H., 325, 328, 333 Takada, K., 376 Takagaki, M., 237 Takahashi, K., 111, 147, 381 Takahashi, N., 376, 381 Takahashi, S., 548
Takahashi, T., 465, 522 Takahashi, Y., 142, 147, 171 Takahata, M., 110 Takamatsu, S., 62, 74 Takano, M., 443 Takashima, S., 167, 221 Takayanagi, Y., 505, 511 Takeda, M., 312 Takeda, T., 392 Takegawa, Y., 110–111, 121, 487 Takematsu, H., 4, 347, 349, 545 Takeshita, K., 293 Taketa, K., 155 Takeuchi, H., 371 Takikawa, M., 570 Takimoto, A., 111, 114, 123, 496, 499 Takio, K., 138–139 Taki, T., 297–298, 570 Talaska, A. E., 443 Tam, A., 468 Tamaki, M., 500 Tam, P. H., 391 Tam, S. H., 376 Tamura, T., 329 Tanabe, G., 419 Tanabe, K., 111 Tanabe, Y., 375 Tanaka, H., 522 Tanaka, K., 115, 323, 334–335, 338, 470 Tanaka, M., 570 Tanaka, S.-i., 470 Tanaka, Y., 543, 547, 558 Tang, J., 243, 249, 542 Taniguchi, N., 128–129, 157–158, 162, 166, 333, 339 Taniguchi, T., 380 Tanuma, S., 429 Tarentino, A. L., 37, 375 Tarp, M. A., 136, 368 Tateno, H., 170, 181, 185, 187, 221, 234, 348, 350, 353–354 Tatton, D., 207 Tawaratsumida, K., 431 Taylor, I., 166 Taylor-Papadimitriou, J., 368 Taylor, P. B., 376 Taylor, W. H., 545 Tchertchian, S., 513 Tedin, K., 330 Teng, H., 545 Ten Hagen, K. G., 136, 366 Teraoka, H., 500 Terashima, M., 111, 121 Terzic, A., 440 Tessier, L., 426 te Vruchte, D. J., 278 Thibodeaux, C. J., 392 Thistle, R., 81
595
Author Index
Thogersen, I. B., 93, 100 Thomas, G. H., 331, 344, 349 Tho¨m, I., 166 Thomsson, K. A., 5 Thon, V., 347, 360 Tian, F., 376–377 Tian, H., 352 Tiemeyer, M., 23 Timmer, M. S. M., 201, 472 Tissot, B., 8, 82, 161 Titz, A., 415 Tjandra, N., 371 Tochio, H., 328 Todo, S., 113, 116–117, 120, 122 Toida, T., 81–82, 93, 100, 102 Tokimoto, H., 470 Tomasello, E., 213 Tomaszkiewicz, T., 155 Tomiya, N., 376, 550 Tomoda, K., 111 Ton-That, H., 487 Toone, E. J., 486, 570 Torchia, D. A., 370 Torhorst, J., 168 Tormo, J., 373 Totani, K., 234, 237 Townsend, A., 373 Townsend, R. R., 339 Toyoda, H., 81 Toyoda, M., 9, 171 Toyoda, T., 379 Toy, P. H., 468 Tozawa, H., 234 Tretter, V., 37 Trim, P. J., 296 Trollope, A., 27, 375 Troy, F. A. II., 220 Trust, T. J., 425 Trybala, E., 207 Tsuchiya, T., 444, 449 Tsuda, T., 417 Tsuji, T., 313 Tsujitani, S., 166 Tsuyama, H., 420 Tsuzuki, H., 500 Tsvetkov, Y. E., 393–394 Tulla-Puche, J., 468 Turco, S. J., 390 Turnbull, J. E., 82–83, 201, 204, 429 Turner, G. A., 157 Tyrrell, D., 520 U Uchida, K., 375, 381 Uchida, Y., 48 Uchiyama, N., 167, 170, 183, 221 Uchiyama, S., 348
Udodong, U. E., 465 Ueda, K., 161 Ueda, R., 333 Ueda-Sada, M., 521 Uematsu, R., 111 Ueno, H., 154 Ugolini, S., 213 Ulmer, A. J., 430 Umemura, E., 444, 449 Umesiri, F. E., 390 Umezawa, A., 171 Umezawa, H., 438 Unverzagt, C., 339, 375, 504 Uozumi, N., 339 Urashima, T., 255 V Vakulenko, S. B., 438 Valdez-Alarcon, J. J., 390 Valencia, G., 373 Valery, V. F., 548 Valvano, M. A., 330, 333, 399, 426 van Berkel, T. J., 564 van Boeckel, C. A. A., 429 Van Damme, E. J., 187 van den Akker, F., 542 van den Burg, R., 349 van den Nieuwenhof, I. M., 542 van der Kuyl, A. C., 349 van der Merwe, P. A., 351, 543 van der Wiel, I. M., 288 van Die, I., 249 van Doornuma, E., 470 van Echten-Deckert, G., 296 van Geel-Schutten, I. G. H., 390 Van Halbeek, H., 376 van Hijum, S., 390 van Kooyk, Y., 365 van Kuik, J. A., 378–379 van Mansfeld, A. D., 159 van Orden, S. L., 104 van Rijn, J., 472 van Straaten, K. E., 392, 401 van Weering, D. H., 159 Vanzin, G. F., 392 van Zuylen, C. E. M., 377 Varela, O., 394 Varki, A. P., 59–60, 121, 182, 200, 250, 339, 344, 346–349, 360, 366, 374, 464, 504, 518, 542, 545, 555 Varki, N., 349, 545 Varki, N. M., 121 Varrot, A., 542 Vasella, A., 415 Veerapen, N., 402, 404 Veerman, K. M., 249 Vela, J. L., 352
596
Author Index
Velazquez-Hernandez, M. L., 390 Venot, A., 201, 377, 429 Verdelli, S., 468 Vereecke, D., 391 Vestal, M. L., 53 Viala, J., 330–331, 333 Vicens, Q., 438, 441 Vig, R., 250 Vincent, S. P., 401 Vines, E. D., 426 Vinogradov, E., 390 Vinson, J., 110 Vinson, M., 351 Virji, M., 348–349 Vitale, M., 213 Vivas, L., 473 Vivier, E., 213 Vliegenthart, J. F. G., 376–379 Vogan, E. M., 377–378 Vogen, S. M., 372 von Andrian, U. H., 6, 22, 211–213 von der Lieth, C. W., 57 von der Lieth, C.-W., 472 von Gunten, S., 346–347 Von Hoff, D. D., 162 Voragen, A. G. J., 333 Voter, W. A., 367 Vsevolod, V. R., 548 Vu, P. D., 543, 545, 547, 554, 558 Vyas, A. A., 521 Vyas, K. A., 521 Vyas, S. P., 334 W Wacker, M., 426 Wada, H., 235 Wada, Y., 29, 115, 157–158, 162, 288, 334, 338 Wagner, E. R., 348 Wagner, G., 379 Waidelich, D., 20–21 Wakao, M., 207, 523 Wakarchuk, W. W., 350, 353–354, 387 Waksman, G., 207 Waksman, S. A., 438 Wakui, M., 293 Wall, S. B., 381 Walzer, T., 213 Wang, C., 275 Wang, G., 440, 444 Wang, H. Y., 288 Wang, J., 444 Wang, L., 401 Wang, L. C., 207 Wang, L. X., 375 Wang, L.-X., 427–428 Wang, P. G., 393–394, 425 Wang, Q., 401
Wang, W. C., 554 Wang, Y., 51, 401 Wang, Y. X., 319 Wang, Z., 92, 543–544, 559 Wan, Q., 513–514 Warda, M., 81 Warren, J. D., 513 Warren, J. R., 423 Warriner, S. L., 465 Wassell, J., 157 Watanabe, A., 155 Watanabe, H., 570 Watanabe, K., 155 Watanabe, Y., 334–335, 338 Watkins, W. M., 10 Watson, C. H., 82 Watson, D. C., 426 Weber, J. R., 430 Weerapana, E., 348, 426 Wei, G., 416 Weinstein, J., 542 Wei, P., 420 Weir, J. R., 441, 454 Weishaupt, M., 463 Weiss, H., 504 Weixlbaumer, A., 441, 454 Weller, C. T., 379 Wells, L., 23 Welsh, J., 399 Wen, Y.-S., 429 Wermeling, F., 542 Werner, S., 200, 207, 209–210 Wernick, N. L. B., 542 Werz, D. B., 199, 472, 475, 480–481 West, A., 296 Westhof, E., 438, 441, 454, 456 Westman, J., 207 Weston, A., 392–393, 399 Westphal, O., 390 Weymouth-Wilson, A. C., 275 Whelan, S. A., 366, 373 White, J. R., 350 Whitesides, G. M., 465, 486 White, S. P., 243, 249–250 White, T., 138–139 Whitfield, C., 325, 390, 392, 398–399, 401–402, 426 Whitman, C. M., 541, 543, 558 Wilding, G. E., 564 Wildt, S., 425 Wiles, M., 200 Wiley, D. C., 377–378 Wilhelm, J. M., 440 Wilkinson, K. D., 259 Wilkinson, M. C., 429 Wilkins, P. P., 542 Willander, M., 227 Willard, M., 242
597
Author Index
Williams, L. J., 368–370, 372–373 Willis, K. J., 379 Willison, H. J., 348 Wilson, F. X., 275 Wiltsie, J., 447 Wimberly, B. T., 441, 454 Winans, K. A., 399 Wing, C., 402 Wingo, P. A., 154 Winkler, M. E., 376 Winterfeld, G. A., 417 Wischnat, R., 465 Wisztorski, M., 288 Withers, S. G., 366–367, 375 Witzig, C., 415 Woelk, E., 331 Wolff, J. J., 82, 93, 99–100, 102, 104 Wolucka, B. A., 391 Wong, A., 15 Wong, C. H., 199, 201, 368, 373, 375, 379, 415, 447–448, 465, 468–469, 513 Wong, S. M., 564–567 Wong, T. Y., 447 Woods, A., 447 Woods, A. S., 288 Woof, J. M., 381 Wormald, M. R., 274–276, 284, 373, 378, 380 Wren, B. W., 426 Wright, G. D., 438, 440, 442 Wu, A. M., 10, 20 Wu, B., 513 Wu, C. Y., 199 Wuhrer, M., 242–243 Wu, S. W., 6–8, 10, 20–22 Wu, Z., 465 Wyatt, P., 401 Wyss, D. F., 379 X Xia, B., 242–243 Xiao, M., 394 Xie, J., 81–82, 93, 100, 102, 201 Xiong, Y., 447 Xu, D., 15 Xu, S., 15 Xu, W. C., 429 Xu, Y. L., 401 Y Yabe, R., 187 Yabe, T., 528 Yagi, F., 255 Yagi, H., 375, 381 Yagi, T., 391, 402 Yagi-Utsumi, M., 318 Yago, T., 246, 249–251 Yamada, H., 374, 465
Yamada, K., 496, 499 Yamada, M., 170–171, 221, 234 Yamada, M. K., 288 Yamada, Y., 167 Yamaguchi, D., 234, 237 Yamaguchi, H., 379 Yamaguchi, M., 111, 121 Yamaguchi, N., 570 Yamaguchi, Y., 305–307, 309–312, 315, 317–318, 375–376, 381 Yamakawa, N., 219 Yamamoto, K., 233–235, 237 Yamamoto, M., 167 Yamamoto, N., 375, 503–505, 511 Yamamoto, S., 274, 570 Yamamoto, T., 274, 495, 504 Yamamoto, Y., 369, 372 Yamanaka, K., 155–158 Yamanaka, S., 111 Yamashita, T., 111, 121 Yamazaki, N., 334 Yang, F., 221 Yang, H. J., 293 Yang, H. W., 290 Yang, L. J.-S., 521 Yang, Y. Y., 513 Yang, Z. G., 10, 20, 465 Yang, Z. Q., 349 Yaniv, O., 447 Yan, L. Z., 514 Yano, T., 333 Yan, W. X., 390 Yao, I., 293–294 Yao, R., 425 Yarema, K. J., 543–545, 548, 559 Yaron, S., 447, 449–450, 452 Yasuda, Y., 4, 347 Yates, E. A., 82–83, 204 Yates, J. R., III., 288, 348 Yeh, P. J., 453 Ye, M., 15 Ye, X. S., 421, 440, 444, 465 Yin, H., 81 Yin, J., 197 Yiqun, G., 421 Yokoi, S., 335 Yokoyama, S., 155–158, 306 Yoneyama, T., 563 York, W. S., 58 Yoshida, J.-I., 420 Yoshida, N., 500 Yoshida, T., 328 Yoshida, Y., 293, 315 Yoshihara, A., 505 Yoshikawa, T., 523, 528 Yoshimori, T., 333 Yoshino, A., 505, 511 Yoshizaki, H., 325, 327
598
Author Index
Yoshizawa, S., 441 Yosizawa, Z., 112 Yost, R. A., 51, 294, 296 Young, K. A., 378 Young, N. M., 426 Young, S. P., 381 Yu, B., 429, 465 Yuba-Kubo, A., 293 Yu, C., 375, 379, 548 Yuen, C. T., 268, 273, 366, 374 Yu, H., 347, 349, 360, 545 Yuki, N., 521, 528 Yu, R. K., 296 Yu, S.-H., 541 Yu, S. Y., 3, 6–8, 10, 20–22, 51 Z Zagorevski, D. V., 92, 97, 99–100 Zahringer, U., 330, 430 Za¨hringer, U., 430 Zaia, J., 5, 51, 81–82 Zaima, N., 288, 291, 293–295 Zamfir, A. D., 81–82 Zeitler, R., 543 Zeller, C. B., 521 Zeng, Y., 242, 347–348, 350, 360, 428, 554, 556 Zen, Y., 167
Zha, C., 420 Zhang, F., 81, 92, 199 Zhang, H., 543, 545, 547, 554, 558 Zhang, J. B., 393–394, 564–568, 570 Zhang, J. Q., 350 Zhang, L. H., 440, 444 Zhang, L.-H., 421 Zhang, Q. B., 393, 399, 401 Zhang, W. L., 442 Zhang, Y., 265, 278, 282 Zhang, Z., 81, 201, 465 Zhao, J., 161 Zheng, R. B., 396–397, 402, 404 Zhong, W., 92 Zhou, J., 440, 444 Zhou, R., 396–397, 402, 404 Zhou, Y., 429 Zhuang, T., 318 Zhu, X., 413 Ziltener, H. J., 249 Zimmerman, J. A., 82 Zingman, L. V., 440 Zorgdrager, F., 349 Zou, H., 15 Zschornig, O., 288 Zubarev, R. A., 82 Zwick, M. B., 570
Subject Index
A ABI 431A peptide synthesizer, 472–473 Affinity ligand agarose column, 565 a-glucosidase I affinity chromatography, 278 enzymatic digestion, 65–66 isolation of, 277–278 preparation of, 277 Aleuria aurantia lectin (AAL), 155–156 Aminoglycosides action mode, 440–441 4,5-and 4,6-disubtituted 2-DOS, 438–439 drawbacks, 443 inducers, treatment of lead compounds, structure, 455 translational therapy, 454 variants, 455–458 modifying enzymes and modification sites, 442 NeoB, development of at C5” position, 444–447 dual activity, C5” modified, 447–448 hybrid antibiotics, 450–454 30 ,40 -methylidene protected, 449–450 resistance to, 442 streptomycin, 438 2-Aminopyridine (PA)-labeled N-linked glycan library, 133–134 Animal glycans. See Bacterial and animal glycans Antifreeze mucin glycoprotein (AFGP), 367–368 Anti-Helicobacter pylori oligosaccharide structure, 423–424 synthesis, 425 a-selective glycosylation reaction glycosyl trichloroacetimidate donor, 416–417 phosphate donor, 417–418 4,6-silylene protecting group, 419 sulfide catalyst, 419 thiocyanate donor, 418–419 2,3-trans-carbamate, 420 B Bacterial and animal glycans b-selective glycosylation, 331–332 cytokine (IL-6) induction, 328–329 68 Ga-DOTA labeling and microPET imaging, rabbit, 335–336 glycoconjugates, nonself recognition lipopolysaccharide (LPS), 325–327
peptidoglycan (PGN), 329–331 Helicobacter pylori Kdo–lipid A backbone, synthesis, 327 immunostimulatory activity, DAP, 333 in vivo dynamics, animal N-glycans, 333–334 Kdo donor 11, glycosylation, 327–328 PET imaging glycoclusters, 337–338 glycoproteins, 334–335 N-glycan clusters, mouse, 338–339 tracheal cytotoxin 20, synthesis, 332–333 Bacterial furanosides biosynthesis Araf-containing glycoconjugates, mycobacteria, 391–392 galactofuranose-containing glycoconjugates, 392 microbial fructan biosynthesis, 390–391 furanose nucleotides, chemoenzymatic preparation, 393–394 GalPUT immobilization, 394–395 materials and methods, 394 UDP-galactofuranose (UDP-Galf), 395–398 galactofuranosyltransferases bifunctional genes, 402 enzyme-coupled spectrophotometric assay, GlfT2 activity, 403–406 pyranose–furanose mutases ring contraction, UDP-Galp, 398–399 UGM activity, HPLC assays, 399–401 Bacterial glycoconjugates, nonself recognition lipopolysaccharide (LPS), 325–327 peptidoglycan (PGN), 329–331 Bikunin GAGs b-elimination, 93–94 ESI FTMS analysis, 99–100 gel-eluted GAG fractions purification, 97–99 preparative CE PAGE separation, 95–97 BioMap software, 293 Biotinylation glycopeptides, 245 HL-60 cells, 247 oligosaccharides, 245–246 BLase-catalyzed cleavage, 499–500 BlotGlyco beads glycan-related cancer biomarker BlotGlyco ABC vs. BlotGlyco H, 116–117
599
600
Subject Index
BlotGlyco beads (cont.) Box-plot expression and ROC curve, 117, 119–120 human serum derived N-glycans, 116, 118–119 SweetBlot, 117, 119 glycans, enrichment of, 113–115 mouse ES cell differentiation, 121–122 N-glycans, pretreatment and release, 112–113 O-glycomics and glycosphingolipidomics, 122–123 oligosaccharides, recovery of, 115–116 reverse glycoblotting and GFRG, 123 sialic acids, on-bead derivatization, 115 Brain-derived neurotrophic factor (BDNF), 229–230 b-selective glycosylation, 331–332 b-site amyloid precursor protein cleaving enzyme (BACE-1), 429 C Campylobacter jejuni, N-glycan biosynthetic pathway, 426–427 synthetic analysis, 428 Carbohydrate-binding proteins affinity ligand agarose column preparation, 565 carbohydrate mimicry peptide, 570 multivalent antigenic peptides (MAPS) structure, 564 peptide affinity chromatography binding activity, 569 procedures, 567–569 protein identification, 569 visualization in vivo biotinylation, 565–566 mouse lung endothelial cell surface protein, 566 Carbohydrate microarray, human malectin materials and equipment, 281–282 microarray printing, 282–283 microarray probing, 283 Carbohydrate mimicry peptide. See Carbohydrate-binding proteins Carbohydrate synthesis advantages, 470 automated method ABI 431A peptide synthesizer, 472–473 dodecameric phytoalexin elicitor, 473–474 malarial glycosylphosphatidylinositol glycan, 473, 475 N-glycan pentasaccharide core, 473, 476 tumor-associated carbohydrate antigen Globo-H, 473, 477 N-glycan heptasaccharide, 470–471 N-glycan octasaccharide, 470, 472 sialyl LewisX molecule, 469
Cartoonist, 58–59 cDNA encoding, 235 Cell-surface glycans, 239–240 Cellular glycomics. See Lectin microarray Chemokines binding affinities of, 212–213 fabrication of, 212 materials and equipment, 211–212 Chemoselective polymer blotting, 499 CHO cells glycan profiles, 186–188 vs. Lec1, 192–193 principal component analysis., 190 Chondroitin sulfate/dermatan sulfate (CS/DS) disaccharide ESI IP RP LC MS analysis materials, 85–86 method, 87–88 solutions, 86 preparation of materials and solutions, 84–85 method, 85 CID. See Collision-induced dissociation 1,2-cis-aminoglycoside synthesis a-Gal-Ser–Thr motif preparation, 416–417 a-selective glycosylation reaction with glycosyl trichloroacetimidate donor, 416–417 phosphate donor, 417–418 4,6-silylene protecting group, 419 sulfide catalyst, 419 thiocyanate donor, 418–419 2,3-trans-carbamate, 420–421 anti-Helicobacter pylori oligosaccharide structure, 423–424 synthesis, 425 2-azido sugar preparation, 415–416 b-site amyloid precursor protein cleaving enzyme (BACE-1), 429 Campylobacter jejuni, N-glycan biosynthetic pathway, 426–427 synthetic analysis, 428 1,2-cis-glycosylation reaction, 413, 415, 421–422 endocyclic and exocyclic cleavages, 422–423 glycosyl sulfonium ion preparation, 420 Helicobacer pylori growth inhibition, mechanism, 423–424 heparin synthesis, 429–430 lipoteichoic acid (LTA) structure, 430 O-linked oligosaccharide preparation, 417–418 1,2-trans-glycosylation reaction, 413, 415 Cis-and trans-ligand binding ligand-based methods, 349 masking effect, 348 CMP-sialic acid cell lysate preparation, 550
601
Subject Index
HPAEC analysis, 550–551 Jurkat cells and BJAB K20 cells, 552–553 Collision-induced dissociation (CID), 6, 82, 141 Continuous-elution polyacrylamide gel electrophoresis (CE PAGE), 92–93, 98 Cy3-labeled glycoprotein, 168–170 Cysteines, 248 Cytokine (IL-6) induction, 328–329 D DABP. See 3,4-Diaminobenzophenone Data normalization, lectin microarray, 185–186 Dendrimers binding affinities of, 211 fabrication, 210 glycodendrimers and aminefunctionalized 5 kDa heparin, 209–210 heparin oligosaccharide dendrimers (HOD), structure, 207–208 incubation with, 210–211 materials and equipment, 207, 209 Deparaffinization, 168 3,4-Diaminobenzophenone (DABP), 15–17 Differential glycan profiling antibody-assisted lectin profiling, 176–177 cancer lesions and normal regions, dissection, 174–176 Helix pomatia agglutinin (HPA), 166 lectin microarray system, 167 tissue microarray Cy3-labeled glycoprotein preparation, 168–170 extraction, one-dot tissue section, 168, 170 lectin microarray analysis and data processing, 170–172 lectin probe selection, 172–174 Wisteria floribunda agglutinin (WFA), 167 Diglucosylated high-mannose N-glycans a-glucosidase I affinity chromatography, 278 isolation of, 277–278 preparation of, 277 Glc2Man7GlcNAc2, 278 materials and equipment, 276–277 Direct infusion ESI FTMS analysis, preparative CE PAGE, 92–93 Disaccharide profiling, IP RP HPLC, 84 Discriminant analysis, lectin microarray, 191–192 E Echinoderm ganglioside ganglioside glycans, 532–533 N-Troc sialyl intermediate divergence, 531–532 Electrospray ionization mass spectrometry (ESI MS). See Glycosaminoglycans (GAGs)
Electrospray tandem mass spectrometry (ES-MS/MS), 55 Endocyclic and exocyclic cleavages, 422–423 Endo-M-mediated transglycosylation materials and equipment, 494–495 procedures, 495–496 Enzyme-coupled spectrophotometric assay, GlfT2 activity acceptor and donor inhibitor screen, 406 acceptor and donor kinetics assay, 406 general assay procedure, 404–405 GlfT2 protein, preparation of, 404 materials and methods, 403–404 measurement, 405 principle, 403 ESI FT-ICR MS analysis, bikunin GAG mixture, 101–102 ES-MS/MS. See Electrospray tandem mass spectrometry F FAC. See Frontal affinity chromatography FGFs. See Fibroblast growth factors Fibroblast growth factors (FGFs), 200–201 binding affinities, 206–207 fabrication of, 204, 206 incubation with, 206 materials and equipment, 204 sulfation patterns, 204–205 Flow cytometry, 193–194, 238–239 Fluorescence-based solid-phase assays biotinylation glycopeptides, 245 HL-60 cells, fixation and, 247 oligosaccharides, 245–246 galectin-1 (Gal-1) binding binding affinity, 257, 259–260 cysteines, 248 primary amines, 247–248 recombinant assay, 255–259 human T lymphocytes, 248 Lycopersicon esculentum agglutinin (LEA) lectin, 248 P-and L-selectin binding binding affinity, 250–252 recombinant assay, 249–250 T lymphocytes assay, 252–254 Fourier transform mass spectrometer (FTMS). See also Glycosaminoglycans (GAGs) data interpretation, 100–101 direct infusion ESI FTMS analysis, preparative CE PAGE, 92–93 ESI FTMS analysis, 99–100 Frontal affinity chromatography (FAC) materials and equipment, 224 operation of, 225–226 polySia and neurotransmitter interaction, 226
602
Subject Index
Frontal affinity chromatography (FAC) (cont.) preparation of affinity adsorbents, 224–225 neurotransmitters, 225 principle, 221–224 FTMS. See Fourier transform mass spectrometer Fucosylated haptoglobin discovery of, 155–156 fucosylation, description, 155 inducible factor characteristics, haptoglobin, 157 lectin–antibody ELISA system, 159–160 production of, 157, 159 lectin–antibody ELISA AAL blotting, 162 pancreatic cancer vs. chronic pancreatitis, 161 receiver operating characteristics (ROC) curve, 160–161 mass spectrometry analysis, 156–157 pancreatic cancer, 154 Furanose nucleotides, chemoenzymatic preparation, 393–394 GalPUT immobilization, 394–395 materials and methods, 394 pyranose–furanose mutases ring contraction, UDP-Galp, 398–399 UGM activity, HPLC assays, 399–401 UDP-galactofuranose (UDP-Galf) analytical HPLC, 395–397 derivatives, 398 semipreparative HPLC elution conditions, 397 Furanosides. See Bacterial furanosides G 68
Ga-DOTA labeling and microPET imaging, rabbit, 335–336 GAGs. See Glycosaminoglycans Galactofuranoside biosynthesis. See Galactofuranosyltransferases Galactofuranosyltransferases bifunctional genes, 402 enzyme-coupled spectrophotometric assay, GlfT2 activity acceptor and donor inhibitor screen, 406 acceptor and donor kinetics assay, 406 general assay procedure, 404–405 GlfT2 protein, preparation of, 404 materials and methods, 403–404 measurement, 405 principle, 403 Galectin-1 (Gal-1) binding affinity glycopeptides and glycans, 257 HL-60, 257, 259–261 cysteines, 248
primary amines, 247–248 recombinant assay glycopeptides and glycans, 255–257 HL-60, 257–259 Ganglioside synthesis a-glycoside formation, 523 echinoderm ganglioside ganglioside glycans, 532–533 N-Troc sialyl intermediate divergence, 531–532 glycolipid conjugation, azido-sphingosine and ceramide, 529–530 coupling reactions, 531–532 cyclic Glc-Cer acceptor, 531 Glc-Cer acceptor, 530 GM2 core sequence materials, 537–538 precautions, 537–539 mammals, design ganglio-series glycans, 523–524 GM1 and GM3, 525 subfamilies and structures, 523–524 N-Troc sialyl donor materials, 534 precautions, 534–535 N-Troc sialyl galactose materials, 536 precautions, 536–537 sialic acid structure, 522 sialyl galactose unit conventional approach, 525–526 ganglio-series ganglioside, 528 glycosidations, C5-modified sialyl donors, 526–527 N-Ac derivative, 527 Gas-chromatography-mass spectrometry (GC–MS), 57 GC–MS. See Gas-chromatography-mass spectrometry GFRG. See Glycoformed-focused reverse genetics GlcNAc amide signals, 311–312 15 N relaxation parameters, 310 GlfT2 activity. See Enzyme-coupled spectrophotometric assay, GlfT2 activity Globo-H synthesis, 479–481 Glucan oligosaccharides disaccharides to hepta saccharides, 272–274 materials and equipment, 271–272 Glucosylated high-mannose N-glycans diglucosylated a-glucosidase I affinity ligand, 277–278 Glc2Man7GlcNAc2, 278 materials and equipment, 276–277 triglucosylated glycoprotein isolation, 275
Subject Index
materials and equipment, 274–275 production and isolation of, 276 release and purification of, 275–276 Glycan-based interactions FAC affinity adsorbents, preparation of, 224–225 materials and equipment, 224 neurotransmitters, preparation of, 225 operation of, 225–226 polySia and neurotransmitter interaction, 226 principle, 221–224 neural cell adhesion molecules (NCAMs), 220 SPR BDNF, immobilization of, 229 biacore analysis, 229–230 biotinylated glycans, immobilization of, 228 biotinylated glycans, preparation of, 228 materials and equipment, 227–228 principle of, 227 Glycan-binding protein (GBP)–glycoconjugates interactions. See Fluorescence-based solidphase assays Glycan mass spectral database (GMDB) CID spectra acquisition, 143 navigator system for, 146–148 search result window, 143–146 Glycan-related cancer biomarker BlotGlyco ABC vs. BlotGlyco H, 116–117 Box-plot expression and ROC curve, 117, 119–120 human serum derived N-glycans, 116, 118–119 SweetBlot, 117, 119 Glycans FAC affinity adsorbents, preparation of, 224–225 materials and equipment, 224 neurotransmitters, preparation of, 225 operation of, 225–226 polySia and neurotransmitter interaction, 226 principle, 221–224 GMDB CID spectra acquisition, 143 navigator system for, 146–148 search result window, 143–146 neural cell adhesion molecules (NCAMs), 220 preparation of glycopeptide purification, 36–37 N-glycan purification, 37–38 N-glycan release, 37 O-glycan purification, 39–40 O-glycan release, 38–39 proteolytic digestion, 35–36 release samples cell lysis, 33–34 homogenization, 32–33 tissue excision/isolation, 31–32
603 SPR BDNF, immobilization of, 229 biacore analysis, 229–230 biotinylated glycans, immobilization of, 228 biotinylated glycans, preparation of, 228 materials and equipment, 227–228 principle of, 227 S–S bridges cleavage and Cys protection, 34–35 Glycobioinformatics Cartoonist, 58–59 GlycoWorkBench, 59 PARC mass spectrometry viewer (PMSV), 58 Glycoblotting BlotGlyco beads glycan-related cancer biomarker, 116–121 glycans, enrichment of, 113–115 mouse ES cell differentiation, 121–122 N-glycans, pretreatment and release, 112–113 O-glycomics and glycosphingolipidomics, 122–123 oligosaccharides, recovery of, 115–116 reverse glycoblotting and GFRG, 123 sialic acids, on-bead derivatization, 115 embryonic stem (ES) and induced pluripotent stem (iPS) cells, 111 Glycoconjugates, dynamics and interactions binding surface identification aptamer-binding interface, 313–314 chemical-shift changes, 311, 315 13 C/15N-labeling, 313, 315 glycoprotein glycans amide exchange rates, 312–313 GlcNAc amide signals, 311–312 15 N relaxation parameters, GlcNAc, 310 IgG-Fc selectively labeled 13 C-13C TOCSY spectrum, 308–309 2D 13C–13C NOESY spectrum, 308–309 Fab and Fc fragments, 306–307 serum-free medium composition, 307–308 lectin–ligand interactions, NOE analyses, 318 NMR-based screening Fbs1 lectin, 315 glycopeptides, preparation of, 316–318 paramagnetic relaxation enhancement (PRE), 319 Glycoconjugates, metabolic labeling CMP-sialic acid cell lysate preparation, 550 HPAEC analysis, 550–551 Jurkat cells and BJAB K20 cells, 552–553 glycan-mediated interactions, 557–559 metabolic photocrosslinker incorporation Ac4-ManNAz, 548 BJAB and Jurkat cells, 548–549 N-acetylmannosamine (ManNAc), 543–544 photocrosslinking sugar synthesis
604 Glycoconjugates, metabolic labeling (cont.) Ac4-GlcNDAz, 547–548 Ac4-ManNDAz, 545–546 Ac5-methyl-SiaDAz, 545–547 metabolism, 543–544 P-selectin glycoprotein ligand-1 (PSGL-1), 542 SiaNAz, cell surface display a2–3 and a2–6 cell surface sialic acid detection, 554–555 MALDI-TOF MS, 557 PAL method, 555–556 total cell surface sialic acid detection, 554 Glycoformed-focused reverse genetics (GFRG), 123 Glycolipids. See also Imaging mass spectrometry (IMS), glycolipids conjugation, azido-sphingosine and ceramide, 529–530 coupling reactions, 531–532 cyclic Glc-Cer acceptor, 531 extraction cell lysis, 41–42 homogenization, 40–41 Glc-Cer acceptor, 530 preparation nonpolar glycolipid recovery, 44 oligosaccharide purification, 44–45 oligosaccharide release, 44 partitioning, 43 polar glycolipid recovery, 44 Glycopeptide synthesis native chemical ligation (NCL), 511–513 cysteine methylation, 514 intramolecular acyl shift, 517 MUC1 S-methylation repeated glycopeptide, 516 sialylglycopeptide, CNBr conversion reaction, 516–517 sialylglycopeptide-thioester and sialylglycopeptide, 513, 516 sialyl-Tn glycopeptide, 514–515 N-linked complex type oligosaccharides asparagines-linked sialyloligosaccharide, 506–508 dibenzyl-sialyloligosaccharide, 508–509 Fmoc-sialyloligosaccharide, 508 glycopeptide-athioester, 505, 507 NDTNTN(sialyloligosaccharide)SSS, 509–510 sialylglycopeptide-thioester, 510–511 TDNKN(sialyloligosaccharide)DTNT, 510 peptide coupling method, 511 Glycoprotein glycans amide exchange rates, 312–313 GlcNAc amide signals, 311–312 15 N relaxation parameters, GlcNAc, 310
Subject Index
preparation of Cy3 labeling, 170 deparaffinization, 168 protein extraction, 169 tissue scratching, 168–169 Glycoprotein/ligand complexes. See Glycoconjugates, dynamics and interactions Glycosaminoglycans (GAGs), 464 bikunin GAG b-elimination, 93–94 ESI FTMS analysis, 99–100 gel-eluted GAG fractions purification, 97–99 preparative CE PAGE separation, 95–97 CS/DS disaccharide ESI IP RP LC MS analysis, 85–88 materials and solutions, 84–85 method, 85 direct infusion ESI FTMS analysis, preparative CE PAGE, 92–93 disaccharide profiling, IP RP HPLC, 84 ESI FT-ICR MS analysis, bikunin GAG mixture, 101–102 FTMS data interpretation, 100–101 HS disaccharide ESI IP RP LC MS analysis, 90–92 materials and solutions, 88–89 method, 89–90 preparation of, 83–84 structural characterization, tandem MS, 102–105 Glycosphingolipidomics, 122–123 Glycosylation-defective mutants, Lec1/Lec2/ Lec8, 188–189 Glycosylphosphatidylinositol (GPI), 464 Glycosyltransferases, 497–498 GlycoWorkBench, 59 GMDB. See Glycan mass spectral database H Haptoglobin fucosylated discovery of, 155–156 lectin–antibody ELISA, 160–162 inducible factor, production of, 157–160 oligosaccharide structure of, 156–157 Helicobacter pylori growth inhibition, mechanism, 423–424 Kdo-lipid A backbone, 327 Helix pomatia agglutinin (HPA), 166 Heparan sulfate (HS) disaccharide ESI IP RP LC MS analysis materials, 90 method, 91–92 solutions, 91 preparation of materials and solutions, 88–89 method, 89–90
605
Subject Index
Heparin and heparan sulfate (HS) carbohydrate microarrays, 199 cell membrane, 198 chemokines binding affinities of, 212–213 fabrication of, 212 materials and equipment, 211–212 dendrimers binding affinities of, 211 fabrication, 210 glycodendrimers and aminefunctionalized 5 kDa heparin, 209–210 heparin oligosaccharide dendrimers (HOD), structure, 207–208 incubation with, 210–211 materials and equipment, 207, 209 fibroblast growth factors (FGFs), 200–201 major and minor disaccharide repeating units, 199–200 microarray analysis, FGF binding binding affinities, 206–207 fabrication of, 204, 206 incubation with, 206 materials and equipment, 204 sulfation patterns, 204–205 NCRs binding affinities of, 214 fabrication of, 214 materials and equipment, 213–214 preparation of, 201–202 Heparin oligosaccharide dendrimers (HOD), 207–208 Heparin synthesis, 429–430 High-performance anion-exchange chromatography (HPAEC), 550–552 His6-tagged malectin expression and purification, 270–271 plasmids generation, 269–270 HL-60 cells, 247 Human peripheral whole-blood cell cultures. See Cytokine (IL-6) induction I IgG-Fc, selectively labeled 13 C-13C TOCSY spectrum, 308–309 2D 13C–13C NOESY spectrum, 308–309 Fab and Fc fragments, 306–307 serum-free medium composition, 307–308 Imaging mass spectrometry (IMS), glycolipids applications, 296–297 cryosections, preparation of, 289–290 data analyses BioMap software, 293 ion images, seminolipid molecules, 294–295 MALDI, 288 matrix application, 291–292 selection, 290
measurements MALDI-MS vs. MALDI-IMS, 292–293 TOF-SIMS, 293 molecules, identification, 294–296 TLC-Blot-MALDI-IMS, 297–299 Inducers, aminoglycosides lead compounds, structure, 455 translational therapy, 454 variants, 455–458 Intramolecular glycan–protein interactions glycosylation modifications, 366 N-linked glycoproteins endoglycosidase, 375–376 Fc-conjugated glycan, 381 immunoglobulin G (IgG), 380 (MALDI)-MS/(ESI)-MS method, 376 N-acetylglucosamine, 378 NCL, 375 NMR, 377 NOE, 379 O-linked glycoproteins a-O-GalNAc glycosylation, 371–372 a-O-Man-linked glycans, 374 a vs. b stereochemistry, differential response, 373–374 antifreeze mucin glycoprotein (AFGP), 367–368 13 C NMR relaxation parameters, 370 mucins, 368 NOE interactions, 369 residual dipolar couplings (RDCs), 371 proteoglycans, 366 solution state NMR, 367 In vitro enzymatic syntheses, N-and O-linked glycan libraries materials and equipment, 130–131 O-linked glycopeptide library construction of, 134–135 O-linked glycan library, conversion to, 135 PA-labeled N-linked glycan library, preparation and purification of, 133–134 recombinant human enzymes, preparation of, 131–132 sialylated N-and O-linked glycans, esterification of, 136 In vivo biotinylation, 565–566 In vivo production, mammalian-type O-linked glycopeptides materials and equipment, 136–137 MUC1a-6xHis peptide, expression and purification of, 139–141 yeast transformation, 137–139 Ion-pairing reverse-phase (IP RP) HPLC, 9, 84 K Ka values, lectin–sugar interactions, 234 Kdo donor 11, glycosylation, 327–328
606
Subject Index L
Lectin–antibody ELISA AAL blotting, 162 pancreatic cancer vs. chronic pancreatitis, 161 receiver operating characteristics (ROC) curve, 160–161 Lectin–Fc fusion protein, 237–238 Lectin hybridization, 185 Lectin–ligand interactions, NOE analyses, 318 Lectin microarray cell discrimination procedures, 182–183 CHO vs. Lec1, 192–193 data normalization, 185–186 discriminant analysis, 191–192 glycan profiles CHO cells, 186–188 glycosylation-defective mutants, Lec1/Lec2/Lec8, 188–189 normalization procedures, 186–187 production of, 183–184 red queen effect, 182 sample preparation and hybridization, 185 significance difference test, 190–191 unsupervised clustering and principal component analysis, 189–190 validation, 193 Linkage analysis, GC–MS, 67–68, 70 Lipopolysaccharide (LPS), 325–327 Lipoteichoic acid (LTA), 430 LPS. See Lipopolysaccharide L-selectin binding binding affinity, 250–252 recombinant assay, 249–250 T lymphocytes assay, 252–254 Lycopersicon esculentum agglutinin (LEA) lectin, 248 M MALDI-TOF. See Matrix-assisted laser desorption ionization time of flight MALDI-TOF-TOF tandem mass spectrometry, 53–54 Malectin, human carbohydrate microarray materials and equipment, 281–282 microarray printing, 282–283 microarray probing, 283 His6-tagged expression and purification, 270–271 plasmids generation, 269–270 recombinant soluble His6-tagged malectin, expression and purification, 270–271 materials and equipment, 268–269 plasmids generation, 269–270 sequence alignment, 266–267
Mammalian-type O-linked glycopeptides. See In vivo production, mammalian-type O-linked glycopeptides Mann–Whitney U-test, 192, 194 Mass spectrometric analysis, mutant mice chemical digestion, released glycans acid hydrolysis, 45–46 enzymatic digestion, 47–49 mild periodate oxidation, 46–47 derivatization and analysis electrospray tandem mass spectrometry (ES-MS/MS), 55 gas-chromatography–mass spectrometry (GC–MS), 57 MALDI-TOF MS, 52–53 MALDI-TOF-TOF tandem mass spectrometry, 53–54 partially methylated alditol acetates, 56–57 permethylated glycan purification, 50–52 released glycan pools, permethylation of, 49–50 glycan release samples, preparation of cell lysis, 33–34 homogenization, 32–33 tissue excision/isolation, 31–32 glycans, preparation of glycopeptide purification, 36–37 N-glycan purification, 37–38 N-glycan release, 37 O-glycan purification, 39–40 O-glycan release, 38–39 proteolytic digestion, 35–36 S–S bridges cleavage and Cys protection, 34–35 glycan structural observations, 69 glycobioinformatics Cartoonist, 58–59 GlycoWorkBench, 59 PARC mass spectrometry viewer (PMSV), 58 glycolipid extraction cell lysis, 41–42 homogenization, 40–41 glycolipid preparation nonpolar glycolipid recovery, 44 oligosaccharide purification, 44–45 oligosaccharide release, 44 partitioning, 43 polar glycolipid recovery, 44 glycomic data, interpretation of, 59–61 structures N-glycan, 71 O-glycan, 72 wild-type and Mgat4a knockout mice enzymatic digestion—a-galactosidase, 65–66 linkage analysis, GC–MS, 67–68, 70 MALDI-TOF MS mass fingerprinting, 62 MALDI-TOF/TOF MS sequencing, 62–65
607
Subject Index
Mass spectrometric database. See N-glycans and O-glycans Matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry (MS), 52–53 MS mass fingerprinting, 62 TOF MS sequencing, 62–65 TOF tandem mass spectrometry, 53–54 Membrane-based carbohydrates. See Weakbinding sugar activity, detection Metabolic photocrosslinker incorporation Ac4-ManNAz, 548 BJAB and Jurkat cells, 548–549 30 ,40 -Methylidene, 449–450 Microarray carbohydrate, human malectin printing, 282–283 probing, 283 FGF binding analysis binding affinities, 206–207 fabrication of, 204, 206 incubation with, 206 materials and equipment, 204 sulfation patterns, 204–205 lectin cell discrimination procedures, 182–183 CHO vs. Lec1, 192–193 data normalization, 185–186 discriminant analysis, 191–192 glycan profiles, 186–189 production of, 183–184 red queen effect, 182 sample preparation and hybridization, 185 significance difference test, 190–191 unsupervised clustering and principal component analysis, 189–190 validation, 193 neoglycolipid oligosaccharide advantages, NGL, 268 carbohydrate microarray analysis, human malectin, 281–283 glucan oligosaccharides, 271–274 glucosylated high-mannose N-glycans, 274–276 NGL probes, 278–279 recombinant soluble human malectin, 268–269 sequence alignment, malectin, 266–267 tissue, differential glycan profiling Cy3-labeled glycoprotein preparation, 168–170 extraction, one-dot tissue section, 168, 170 lectin microarray analysis and data processing, 170–172 lectin probe selection, 172–174 MUC1a-6xHis peptide, 139–141 Mucin glycopeptide synthesis BLase-catalyzed cleavage, 499–500
chemoselective polymer blotting, 499 compound characterization and amino acid analysis, 500–501 endo-M-mediated transglycosylation materials and equipment, 494–495 procedures, 495–496 microwave-assisted protocol materials and equipments, 489 procedures, 489–490 MUC1-related neoglycoprotein design, 487–488 one-pot enzymatic sugar elongation materials and equipments, 497–498 procedures, 498 SrtA mediated ligation, 491–494 mediated transpeptidation, 487 production and purification, 490–491 MUC1-related neoglycoprotein, 487–488 Multifaceted approaches. See Neoglycolipid oligosaccharide microarrays Multivalent antigenic peptides (MAPS), 564 Multivalent ligands, siglecs. See Sialic acid-binding immunoglobulin-like lectins N N-acetylmannosamine (ManNAc), 543–544 Native chemical ligation (NCL), 511–513 cysteine methylation, 514 intramolecular acyl shift, 517 MUC1 S-methylation repeated glycopeptide, 516 sialylglycopeptide, CNBr conversion reaction, 516–517 sialylglycopeptide-thioester and sialylglycopeptide, 516 sialyl-Tn glycopeptide, 514–515 Natural cytotoxicity receptors (NCRs) binding affinities of, 214 fabrication of, 214 materials and equipment, 213–214 NCRs. See Natural cytotoxicity receptors Neoglycolipid oligosaccharide microarrays advantages, NGL, 268 carbohydrate microarray analysis, human malectin, 281–283 preparation of glucan oligosaccharides, 271–272 glucosylated high-mannose N-glycans, 274–276 NGL probes, 278–279 recombinant soluble human malectin, 268–269 sequence alignment, malectin, 266–267 Neoglycolipid (NGL) probes advantages, 268 AO-NGLs, preparation of
608 Neoglycolipid (NGL) probes (cont.) glucan oligosaccharides, 279 glucosylated N-glycans, 279–281 materials and equipment, 279 Neomycin B (NeoB) development of at C5” position, 444–447 dual activity, C5” modified, 447–448 hybrid antibiotics, 450–454 30 ,40 -methylidene protected, 449–450 Neural cell adhesion molecules (NCAMs), 220 N-glycans pretreatment and release, 112–113 purification, 37–38 release, 37 structures, 71 N-glycans and O-glycans. See also Mucin glycopeptide synthesis glycan analysis, GMDB CID spectra acquisition, 143 navigator system for, 146–148 search result window, 143–146 in vitro enzymatic syntheses materials and equipment, 130–131 O-linked glycopeptide library, construction of, 134–135 O-linked glycopeptide library!glycan library, 135 PA-labeled N-linked glycan library, preparation and purification of, 133–134 recombinant human enzymes, preparation of, 131–132 sialylated N-and O-linked glycans, esterification of, 136 in vivo production, mammalian-type O-linked glycopeptides materials and equipment, 136–137 MUC1a-6xHis peptide, expression and purification of, 139–141 yeast transformation, 137–139 tandem mass spectral database, construction of, 142 Nitroglycal method, 417–418 N-linked complex type oligosaccharides asparagines-linked sialyloligosaccharide, 506–508 dibenzyl-sialyloligosaccharide, 508–509 Fmoc-sialyloligosaccharide, 508 glycopeptide-athioester, 505, 507 NDTNTN(sialyloligosaccharide)SSS, 509–510 sialylglycopeptide-thioester, 510–511 TDNKN(sialyloligosaccharide)DTNT, 510 N-linked glycoproteins endoglycosidase, 375–376 Fc-conjugated glycan, 381 immunoglobulin G (IgG), 380
Subject Index
(MALDI)-MS/(ESI)-MS method, 376 N-acetylglucosamine, 378 NCL, 375 NMR, 377 NOE, 379 NMR-based screening Fbs1 lectin, 315 glycopeptides, preparation of, 316–318 Nonself recognition. See Bacterial glycoconjugates, nonself recognition N-Troc sialyl donor materials, 534 precautions, 534–535 N-Troc sialyl galactose materials, 536 precautions, 536–537 O O-glycan purification, 39–40 release, 38–39 structures, 72 Oligosaccharide synthesis automated method ABI 431A peptide synthesizer, 472–473 dodecameric phytoalexin elicitor, 473–474 malarial glycosylphosphatidylinositol glycan, 473, 475 N-glycan pentasaccharide core, 473, 476 tumor-associated carbohydrate antigen Globo-H, 473, 477 carbohydrates advantages , 470 N-glycan heptasaccharide, 470–471 N-glycan octasaccharide, 470, 472 sialyl LewisX molecule, 469 Globo-H, 479–481 glycosaminoglycans (GAGs), 464 glycosylphosphatidylinositol (GPI), 464 solid phase techniques acceptor and donor bound method, 466–467 vs. conventional solution phase, 465–466 one-pot glycosylation, 465 solvents and solid support, 468 O-linked glycoproteins a-O-GalNAc glycosylation, 371–372 a-O-Man-linked glycans, 374 a vs. b stereochemistry, differential response, 373–374 antifreeze mucin glycoprotein (AFGP), 367–368 13 C NMR relaxation parameters, 370 mucins, 368 NOE interactions, 369 residual dipolar couplings (RDCs), 371 One-pot enzymatic sugar elongation
609
Subject Index
materials and equipments, 497–498 procedures, 498 Optimal cutting temperature (OCT), 289 P Pancreatic cancer, marker. See Fucosylated haptoglobin Paramagnetic relaxation enhancement (PRE), 319 PARC mass spectrometry viewer (PMSV), 58 Peptide affinity chromatography binding activity, 569 procedures, 567–569 protein identification, 569 Peptide coupling method, 511 Peptidoglycan (PGN) bacterial cell wall, 330 chemically synthesized fragment library, 331 tracheal cytotoxin (TCT) synthesis, 331–332 Periodate oxidation, 46–47 Periodate oxidation and aniline-catalyzed oxime ligation (PAL), 555–556 PET imaging glycoclusters, 337–338 glycoproteins, 334–335 N-glycan clusters, mouse, 338–339 PGN. See Peptidoglycan Photocrosslinking sugar metabolism, 543–544 synthesis Ac4-GlcNDAz, 547–548 Ac4-ManNDAz, 545–546 Ac5-methyl-SiaDAz, 545–547 R-Phycoerythrin (PE)-labeled lectin tetramer, binding assay, 238–239 PMSV. See PARC mass spectrometry viewer Polyacrylamide (PAA) probes siglec-expressing cells clathrin-dependent internalization, 354 60 –sulfo–sialyl LewisX polymer, 352–353 siglec-Fc beads advantages, 355 binding enablement, elevated temperature, 355–356 PolySia biacore analysis, 229–230 characteristics, 220 immobilized beads, 225 neurotransmitter, interaction, 226 types of, 224 Porous graphitized carbon (PGC), 5 Proteoglycans (PGs), 83, 198 P-selectin binding binding affinity, 250–252 recombinant assay, 249–250 T lymphocytes assay, 252–254 P-selectin glycoprotein ligand-1 (PSGL-1), 542
Pyranose-furanose mutases ring contraction, UDP-Galp, 398–399 UGM activity, HPLC assays assay procedure, 400 kinetic assay, 400–401 materials and methods, 399–400 principle, 399 R Recombinant human glycosyltransferases materials and equipment, 130–131 O-linked glycopeptide library, construction of, 134–135 O-linked glycopeptide library!glycan library, 135 PA-labeled N-linked glycan library, preparation and purification of, 133–134 preparation of, 131–132 sialylated N-and O-linked glycans, esterification of, 136 Recombinant soluble human malectin His6-tagged malectin, expression and purification, 270–271 materials and equipment, 268–269 plasmids generation, 269–270 Red queen effect, 182 Residual dipolar couplings (RDCs), 371 Reverse glycoblotting, 123 S Self and nonself recognition. See Bacterial and animal glycans Sialic acid-binding immunoglobulin-like lectins (Siglecs) CHO-siglec cells to PAA probe beads, 359 cis-and trans-ligand binding, 348–349 glycan-binding specificity and cell-type expression, 347 multivalent scaffolds, ligands, 349–350 PAA probe to siglec-expressing cells, 352–355 siglec-Fc beads, 355–356 reagents and cells, 350–351 siglec-Fc to biotinylated free saccharide-coated beads, 358–359 PAA probe beads, 356–357 Sialic acids, on-bead derivatization, 115 Sialylated N-and O-linked glycans, 136 Sialyl galactose unit conventional approach, 525–526 ganglio-series ganglioside, 528 glycosidations, C5-modified sialyl donors, 526–527 N-Ac derivative, 527 SiaNAz, cell surface display
610 SiaNAz, cell surface display (cont.) a2–3 and a2–6 cell surface sialic acid detection, 554–555 gangliosides characterization, 555, 557 MALDI-TOF MS, 557 PAL method, 555–556 total cell surface sialic acid detection, 554 Siglec-expressing cells PAA probe to, 352–355 preparation of, 351–352 Siglec-Fc biotinylated free saccharide-coated beads, 358–359 PAA probe beads, 356–357 Significance difference test, 190–191 Sinapic acid (SA), 290 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), 236–237 Solid phase synthesis, oligosaccharides. See Oligosaccharide synthesis SPR. See Surface plasmon resonance SrtA. See Staphylococcus aureus sortase A Stable-isotope-assisted NMR spectroscopy. See Glycoconjugates, dynamics and interactions Staphylococcus aureus sortase A (SrtA) mediated ligation materials and equipments, 492 procedures, 492–494 mediated transpeptidation, 487 production and purification, 490–491 Streptomycin, 438 Sulfated N-and O-glycans CD34, 5 MALDI-based MS and MS/MS analysis, 14–17 MALDI-MS mapping, 6 Orbitrap measurement, 23 permethylated sulfated glycans CID MS/MS, 20–22 MALDI-MS profile interpretation, 17–20 sample preparation biological sources to glycoprotein extracts, 7–9 glycoproteins to released N-and O-glycans, 9–10 permethylation and microscale fractionation, 10–13 sulfoglycomic analysis workflow, 7–8 sulfated glycotopes, 4 60 -Sulfo-sialyl LewisX polymer, 352–353 Surface plasmon resonance (SPR) biacore analysis, 229–230 biotinylated glycans, preparation of, 228 immobilization of BDNF, 229 biotinylated glycans, 228 materials and equipment, 227–228 principle of, 227
Subject Index
SweetBlot, glycan-related cancer biomarker, 117, 119 T Tandem mass spectral database, 141–142 Tandem mass spectrometry (MS), 296 Thin-layer chromatography (TLC). See TLCBlot-MALDI-IMS Time-of-flight secondary ion mass spectrometry (TOF-SIMS), 293 Tissue microarray glycoprotein preparation Cy3-labeled glycoprotein preparation, 170 deparaffinization, 168 protein extraction, 169 tissue scratching, 168–169 lectin microarray analysis data processing, 171–172 sample injection and binding reaction, 170 scanning, 171 lectin probe selection colon normal control and adenocarcinoma tissue, 172–174 statistical analysis and lectin staining, 172 TLC-Blot-MALDI-IMS, 297–299 Tracheal cytotoxin 20, synthesis, 332–333 Tracheal cytotoxin (TCT) synthesis, 331–332 Triglucosylated high-mannose N-glycans glycoproteins, isolation, 275 materials and equipment, 274–275 production and isolation, 276 release and purification, 275–276 2,4,6-Trihydroxyacetophenone (THAP), 15, 552, 557–558 U UDP-galactofuranose (UDP-Galf), 395–398 analytical HPLC, 395–397 derivatives, 398 semipreparative HPLC elution conditions, 397 Unsupervised clustering, lectin microarray, 189–190 W Weak-binding sugar activity, detection binding assay, PE-labeled lectin tetramer, 238–239 biotinylated soluble lectins, preparation of, 236–237 cell-surface glycans, modification, 239–240 lectin-Fc fusion protein, purification, 237–238 PE-labeled lectin tetramer, preparation of, 236–237 plasmids construction biotinylated soluble lectins, 234–235
611
Subject Index
Fc-fusion protein, 237–238 Wheat germ agglutinin (WGA), 543 Wild-type and Mgat4a knockout mice enzymatic digestion—a-galactosidase, 65–66 linkage analysis, GC–MS, 67–68, 70 MALDI-TOF MS mass fingerprinting, 62
MALDI-TOF/TOF MS sequencing, 62–65 Wisteria floribunda agglutinin (WFA), 167 Y Yeast transformation, 137–139