METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of ...
18 downloads
1092 Views
30MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of Technology Pasadena, California Founding Editors
SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London NW1 7BY, UK First edition 2010 Copyright # 2010, Elsevier Inc. All Rights Reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@ elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made For information on all Academic Press publications visit our website at elsevierdirect.com ISBN: 978-0-12-380997-1 ISSN: 0076-6879 Printed and bound in United States of America 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Kaoru Akita Department of Molecular Biosciences, Kyoto Sangyo University, Kyoto, Japan Kiyohiko Angata Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Xingfeng Bao Sanford-Burnham Medical Research Institute, La Jolla, California, USA Kumaran Chandrasekharan Center for Gene Therapy, The Research Institute at Nationwide Children’s Hospital, Columbus, Ohio, USA Jesu´s Cruces Departamento de Bioquı´mica, Instituto de Investigaciones Biome´dicas CSIC-UAM, Universidad Auto´noma de Madrid, Madrid, Spain Richard D. Cummings Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, Atlanta, Georgia, USA Mitche dela Rosa The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Tamao Endo Molecular Glycobiology, Tokyo Metropolitan Institute of Gerontology, Itabashi-Ku, Tokyo, Japan Andreas Faissner Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany Minoru Fukuda Glycobiology Unit, Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA
xiii
xiv
Contributors
Prabhjit K. Grewal The Department of Molecular, Cellular, and Developmental Biology, University of California Santa Barbara, Santa Barbara, California, USA Jianxin Gu Key Laboratory of Glycoconjuates Research, Ministry of Public Health and Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Pascale Guicheney Ge´ne´tique, Pharmacologie et Physiopathologie des Maladies Cardiovasculaires, Groupe Hospitalier Pitie´-Salpeˆtrie`re, Paris, France Shingo Hatakeyama Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Jane E. Hewitt Institute of Genetics, School of Biology, Queen’s Medical Centre, University of Nottingham, Nottingham, United Kingdom Jun Hirabayashi Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Huaiyu Hu Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA Yuzuru Ikehara Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Jianhai Jiang Key Laboratory of Glycoconjuates Research, Ministry of Public Health and Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Tongzhong Ju Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, Atlanta, Georgia, USA Hiroto Kawashima Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, and PRESTO, Japan Science and Technology Agency, Kawaguchi, Japan
Contributors
xv
Motohiro Kobayashi Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Japan Yuko Kozono Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Atsushi Kuno Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Seung Ho Lee Glycobiology Unit, Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Xiaofeng Li Department of Neurology, Second Affiliated Hospital of Chongqin Medical University, Chongqin, People’s Republic of China Jianmin Liu Vicam, Watertown, Massachusetts, USA Mark Lommel Institut fu¨r Pflanzenwissenschaften (HIP), Ruprecht-Karls-Universita¨t Heidelberg, Heidelberg, Germany Hiroshi Manya Molecular Glycobiology, Tokyo Metropolitan Institute of Gerontology, Itabashi-Ku, Tokyo, Japan Paul T. Martin Center for Gene Therapy, The Research Institute at Nationwide Children’s Hospital, and Department of Pediatrics, Department of Physiology and Cell Biology, The Ohio State University College of Medicine, Columbus, Ohio, USA Junya Mitoma Division of Glyco-Signal Research, Institute of Molecular Biomembrane and Glycobiology, Tohoku Pharmaceutical University, Komatsushima, Aoba, Sendai, Japan Kelley W. Moremen The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA
xvi
Contributors
Alison V. Nairn The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Mohd Nazri Ismail Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Jun Nakayama Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Japan Hisashi Narimatsu Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Takashi Ohkura Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Kazuaki Ohtsubo Department of Disease Glycomics, The Institute of Scientific and Industrial Research, Osaka University, Ibaraki, Osaka, Japan Chikara Ohyama Department of Urology, School of Medicine, Hirosaki Graduate University, Hirosaki, Japan Yue Qi Department of Pathology, Upstate Medical University, New York, USA Robert Sackstein Department of Dermatology and Department of Medicine, Brigham and Women’s Hospital, and Department of Medical Oncology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts, USA Takashi Sato Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Nathalie Seta Laboratoire de Biochimie Me´tabolique et Cellulaire, AP-HP, Hopital Bichat, Paris, France
Contributors
xvii
Swetlana Sirko Department of Physiological Genomics, Ludwig-Maximilians-University Munich, Germany Erica L. Stone School of Medicine, Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, USA Sabine Strahl Institut fu¨r Pflanzenwissenschaften (HIP), Ruprecht-Karls-Universita¨t Heidelberg, Heidelberg, Germany Mari Tenno RIKEN Research Center for Allergy and Immunology, Tsurumi-ku, Yokohama City, Kanagawa, Japan Akira Togayachi Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Alexander Von Holst Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany Tobias Willer Department of Molecular Physiology and Biophysics, University of Iowa College of Medicine, Iowa, USA Lijun Xia Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, and Department of Biochemistry and Molecular Biology; Oklahoma Center for Medical Glycobiology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA Hayato Yamamoto Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Yuan Yang Department of Neurology, Tongji Medical College, Wuhan, Hubei Province, People’s Republic of China Peng Zhang Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA
PREFACE
In 2006, we published three volumes in the Methods in Enzymology dedicated to Glycobiology field as follows: Glycobiology (Volume 415), Glycomics (Volume 416), and Functional Glycomics (Volume 417). We have seen the tremendous progress in the field of glycobiology since then. In particular, the explosive progress was made in immunology, neuroglycobiology, glycomics, signal transduction, and many other disciplines, examining each unique system and employing new technology. The Academic Press kindly gave another opportunity to update the introduction of new methods to a large variety of readers who like to contribute to the advancement of Glycosciences. In the current series of Methods in Enzymology, Glycomics (Volume 478), Functional Glycomics (Volume 479), and Glycobiology (Volume 480), have been dedicated to disseminate information on the methods in determining the biological roles of carbohydrates, thanks to Academic Press Manager, particularly to Ms. Zoe Kruze and Ms. Dels Retchagar. The second volume (Volume 479), Functional Glycomics, covers new development in glycosciences, including functional studies of glycosylation in stem cells, functions revealed by gene knockout mouse, glycan defects in muscular dystrophy, and glycans in tumor formation. In the accompanying Glycomics book (Volume 478), glycomics revealed by mass spectrometric analysis, by carbohydrate-binding proteins, and chemical glycobiology are described. The latter include protein–carbohydrate interaction, synthetic carbohydrate chemistry, and identification of carbohydrate-binding protein by carbohydrate mimicry peptides. The third volume, Glycobiology (Volume 480), covers proteoglycan function, infection, immunity, and carbohydrate-binding proteins, including galectin, and new development, including O-glycosylation in Notch and related signaling. In these books, I tried to bring as new development as possible of these expanding fields, and I believe that we have a collection of outstanding contributors who have expertise in their respective fields. I believe that this book will be useful to a wide variety of readers from graduate students, researchers in academic, and industry, to those who would like to teach glycobiology and glycosciences at various levels. We hope that this book will contribute to further explosive progress in glycosciences and glycobiology. MINORU FUKUDA xix
METHODS IN ENZYMOLOGY
VOLUME I. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME II. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME III. Preparation and Assay of Substrates Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME IV. Special Techniques for the Enzymologist Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME V. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VI. Preparation and Assay of Enzymes (Continued) Preparation and Assay of Substrates Special Techniques Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VII. Cumulative Subject Index Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME IX. Carbohydrate Metabolism Edited by WILLIS A. WOOD VOLUME X. Oxidation and Phosphorylation Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME XI. Enzyme Structure Edited by C. H. W. HIRS VOLUME XII. Nucleic Acids (Parts A and B) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XIII. Citric Acid Cycle Edited by J. M. LOWENSTEIN VOLUME XIV. Lipids Edited by J. M. LOWENSTEIN VOLUME XV. Steroids and Terpenoids Edited by RAYMOND B. CLAYTON
xxi
xxii
Methods in Enzymology
VOLUME XVI. Fast Reactions Edited by KENNETH KUSTIN VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B) Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND VOLUME XX. Nucleic Acids and Protein Synthesis (Part C) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXI. Nucleic Acids (Part D) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXII. Enzyme Purification and Related Techniques Edited by WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis (Part A) Edited by ANTHONY SAN PIETRO VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B) Edited by ANTHONY SAN PIETRO VOLUME XXV. Enzyme Structure (Part B) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVI. Enzyme Structure (Part C) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVII. Enzyme Structure (Part D) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVIII. Complex Carbohydrates (Part B) Edited by VICTOR GINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXXI. Biomembranes (Part A) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXII. Biomembranes (Part B) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B) Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
Methods in Enzymology
VOLUME XXXV. Lipids (Part B) Edited by JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues, and Organ Systems) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XLI. Carbohydrate Metabolism (Part B) Edited by W. A. WOOD VOLUME XLII. Carbohydrate Metabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Edited by KLAUS MOSBACH VOLUME XLV. Proteolytic Enzymes (Part B) Edited by LASZLO LORAND VOLUME XLVI. Affinity Labeling Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure (Part E) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLVIII. Enzyme Structure (Part F) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLIX. Enzyme Structure (Part G) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME L. Complex Carbohydrates (Part C) Edited by VICTOR GINSBURG VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES VOLUME LII. Biomembranes (Part C: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER
xxiii
xxiv
Methods in Enzymology
VOLUME LIII. Biomembranes (Part D: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LIV. Biomembranes (Part E: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LV. Biomembranes (Part F: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVI. Biomembranes (Part G: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVII. Bioluminescence and Chemiluminescence Edited by MARLENE A. DELUCA VOLUME LVIII. Cell Culture Edited by WILLIAM B. JAKOBY AND IRA PASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME LX. Nucleic Acids and Protein Synthesis (Part H) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME 61. Enzyme Structure (Part H) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 62. Vitamins and Coenzymes (Part D) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and Inhibitor Methods) Edited by DANIEL L. PURICH VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes and Complex Enzyme Systems) Edited by DANIEL L. PURICH VOLUME 65. Nucleic Acids (Part I) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME 66. Vitamins and Coenzymes (Part E) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 67. Vitamins and Coenzymes (Part F) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 68. Recombinant DNA Edited by RAY WU VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C) Edited by ANTHONY SAN PIETRO VOLUME 70. Immunochemical Techniques (Part A) Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE
Methods in Enzymology
xxv
VOLUME 71. Lipids (Part C) Edited by JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Edited by JOHN M. LOWENSTEIN VOLUME 73. Immunochemical Techniques (Part B) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 74. Immunochemical Techniques (Part C) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE VOLUME 77. Detoxication and Drug Metabolism Edited by WILLIAM B. JAKOBY VOLUME 78. Interferons (Part A) Edited by SIDNEY PESTKA VOLUME 79. Interferons (Part B) Edited by SIDNEY PESTKA VOLUME 80. Proteolytic Enzymes (Part C) Edited by LASZLO LORAND VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I) Edited by LESTER PACKER VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN VOLUME 83. Complex Carbohydrates (Part D) Edited by VICTOR GINSBURG VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus and the Cytoskeleton) Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM VOLUME 86. Prostaglandins and Arachidonate Metabolites Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates, Stereo-chemistry, and Rate Studies) Edited by DANIEL L. PURICH VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II) Edited by LESTER PACKER
xxvi
Methods in Enzymology
VOLUME 89. Carbohydrate Metabolism (Part D) Edited by WILLIS A. WOOD VOLUME 90. Carbohydrate Metabolism (Part E) Edited by WILLIS A. WOOD VOLUME 91. Enzyme Structure (Part I) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc Receptors, and Cytotoxicity) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 94. Polyamines Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80 Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and Targeting (General Methods; Eukaryotes)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing and Recycling) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 99. Hormone Action (Part F: Protein Kinases) Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN VOLUME 100. Recombinant DNA (Part B) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 101. Recombinant DNA (Part C) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 102. Hormone Action (Part G: Calmodulin and Calcium-Binding Proteins) Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 104. Enzyme Purification and Related Techniques (Part C) Edited by WILLIAM B. JAKOBY
Methods in Enzymology
xxvii
VOLUME 105. Oxygen Radicals in Biological Systems Edited by LESTER PACKER VOLUME 106. Posttranslational Modifications (Part A) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 107. Posttranslational Modifications (Part B) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and Characterization of Lymphoid Cells) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 109. Hormone Action (Part I: Peptide Hormones) Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY VOLUME 110. Steroids and Isoprenoids (Part A) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 111. Steroids and Isoprenoids (Part B) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 112. Drug and Enzyme Targeting (Part A) Edited by KENNETH J. WIDDER AND RALPH GREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds Edited by ALTON MEISTER VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116. Immunochemical Techniques (Part H: Effectors and Mediators of Lymphoid Cell Functions) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117. Enzyme Structure (Part J) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 118. Plant Molecular Biology Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH VOLUME 119. Interferons (Part C) Edited by SIDNEY PESTKA VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101 VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 122. Vitamins and Coenzymes (Part G) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
xxviii
Methods in Enzymology
VOLUME 123. Vitamins and Coenzymes (Part H) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and Chloroplasts: General Approaches and Transport Systems) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and Chloroplasts: Protonmotive Force) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 127. Biomembranes (Part O: Protons and Water: Structure and Translocation) Edited by LESTER PACKER VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and Molecular Biology) Edited by JERE P. SEGREST AND JOHN J. ALBERS VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology, and Metabolism) Edited by JOHN J. ALBERS AND JERE P. SEGREST VOLUME 130. Enzyme Structure (Part K) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 131. Enzyme Structure (Part L) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and Cell-Mediated Cytotoxicity) Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE VOLUME 133. Bioluminescence and Chemiluminescence (Part B) Edited by MARLENE DELUCA AND WILLIAM D. MCELROY VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile Apparatus and the Cytoskeleton) Edited by RICHARD B. VALLEE VOLUME 135. Immobilized Enzymes and Cells (Part B) Edited by KLAUS MOSBACH VOLUME 136. Immobilized Enzymes and Cells (Part C) Edited by KLAUS MOSBACH VOLUME 137. Immobilized Enzymes and Cells (Part D) Edited by KLAUS MOSBACH VOLUME 138. Complex Carbohydrates (Part E) Edited by VICTOR GINSBURG
Methods in Enzymology
xxix
VOLUME 139. Cellular Regulators (Part A: Calcium- and Calmodulin-Binding Proteins) Edited by ANTHONY R. MEANS AND P. MICHAEL CONN VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134 VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids) Edited by P. MICHAEL CONN AND ANTHONY R. MEANS VOLUME 142. Metabolism of Aromatic Amino Acids and Amines Edited by SEYMOUR KAUFMAN VOLUME 143. Sulfur and Sulfur Amino Acids Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 146. Peptide Growth Factors (Part A) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147. Peptide Growth Factors (Part B) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 148. Plant Cell Membranes Edited by LESTER PACKER AND ROLAND DOUCE VOLUME 149. Drug and Enzyme Targeting (Part B) Edited by RALPH GREEN AND KENNETH J. WIDDER VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Edited by GIOVANNI DI SABATO VOLUME 151. Molecular Genetics of Mammalian Cells Edited by MICHAEL M. GOTTESMAN VOLUME 152. Guide to Molecular Cloning Techniques Edited by SHELBY L. BERGER AND ALAN R. KIMMEL VOLUME 153. Recombinant DNA (Part D) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 154. Recombinant DNA (Part E) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 155. Recombinant DNA (Part F) Edited by RAY WU VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport: The Na, K-Pump) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
xxx
Methods in Enzymology
VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport: Calcium, Proton, and Potassium Pumps) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 158. Metalloproteins (Part A) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 164. Ribosomes Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE VOLUME 165. Microbial Toxins: Tools for Enzymology Edited by SIDNEY HARSHMAN VOLUME 166. Branched-Chain Amino Acids Edited by ROBERT HARRIS AND JOHN R. SOKATCH VOLUME 167. Cyanobacteria Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A) Edited by JACEK HAWIGER VOLUME 170. Nucleosomes Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model Membranes) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation and Characterization) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
Methods in Enzymology
xxxi
VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167 VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and Dynamics) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 178. Antibodies, Antigens, and Molecular Mimicry Edited by JOHN J. LANGONE VOLUME 179. Complex Carbohydrates (Part F) Edited by VICTOR GINSBURG VOLUME 180. RNA Processing (Part A: General Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 181. RNA Processing (Part B: Specific Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 182. Guide to Protein Purification Edited by MURRAY P. DEUTSCHER VOLUME 183. Molecular Evolution: Computer Analysis of Protein and Nucleic Acid Sequences Edited by RUSSELL F. DOOLITTLE VOLUME 184. Avidin-Biotin Technology Edited by MEIR WILCHEK AND EDWARD A. BAYER VOLUME 185. Gene Expression Technology Edited by DAVID V. GOEDDEL VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and Antioxidants) Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 187. Arachidonate Related Lipid Mediators Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK VOLUME 188. Hydrocarbons and Methylotrophy Edited by MARY E. LIDSTROM VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects) Edited by LESTER PACKER
xxxii
Methods in Enzymology
VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications) Edited by LESTER PACKER VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 193. Mass Spectrometry Edited by JAMES A. MCCLOSKEY VOLUME 194. Guide to Yeast Genetics and Molecular Biology Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN VOLUME 196. Molecular Motors and the Cytoskeleton Edited by RICHARD B. VALLEE VOLUME 197. Phospholipases Edited by EDWARD A. DENNIS VOLUME 198. Peptide Growth Factors (Part C) Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194 VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays, Purification, Antibodies, Functional Analysis, Cloning, and Expression) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 202. Molecular Design and Modeling: Concepts and Applications (Part A: Proteins, Peptides, and Enzymes) Edited by JOHN J. LANGONE VOLUME 203. Molecular Design and Modeling: Concepts and Applications (Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs) Edited by JOHN J. LANGONE VOLUME 204. Bacterial Genetic Systems Edited by JEFFREY H. MILLER VOLUME 205. Metallobiochemistry (Part B: Metallothionein and Related Molecules) Edited by JAMES F. RIORDAN AND BERT L. VALLEE
Methods in Enzymology
xxxiii
VOLUME 206. Cytochrome P450 Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON VOLUME 207. Ion Channels Edited by BERNARDO RUDY AND LINDA E. IVERSON VOLUME 208. Protein–DNA Interactions Edited by ROBERT T. SAUER VOLUME 209. Phospholipid Biosynthesis Edited by EDWARD A. DENNIS AND DENNIS E. VANCE VOLUME 210. Numerical Computer Methods Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation, and Antioxidation) Edited by LESTER PACKER VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis) Edited by LESTER PACKER VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B) Edited by JACEK J. HAWIGER VOLUME 216. Recombinant DNA (Part G) Edited by RAY WU VOLUME 217. Recombinant DNA (Part H) Edited by RAY WU VOLUME 218. Recombinant DNA (Part I) Edited by RAY WU VOLUME 219. Reconstitution of Intracellular Transport Edited by JAMES E. ROTHMAN VOLUME 220. Membrane Fusion Techniques (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 221. Membrane Fusion Techniques (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors) Edited by LASZLO LORAND AND KENNETH G. MANN
xxxiv
Methods in Enzymology
VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian Blood Coagulation Factors) Edited by LASZLO LORAND AND KENNETH G. MANN VOLUME 224. Molecular Evolution: Producing the Biochemical Data Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN, AND ALLAN C. WILSON VOLUME 225. Guide to Techniques in Mouse Development Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods for Probing Metal Ion Environments in Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 228. Aqueous Two-Phase Systems Edited by HARRY WALTER AND GO¨TE JOHANSSON VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227 VOLUME 230. Guide to Techniques in Glycobiology Edited by WILLIAM J. LENNARZ AND GERALD W. HART VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 232. Hemoglobins (Part C: Biophysical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 233. Oxygen Radicals in Biological Systems (Part C) Edited by LESTER PACKER VOLUME 234. Oxygen Radicals in Biological Systems (Part D) Edited by LESTER PACKER VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria with Host Cells) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 237. Heterotrimeric G Proteins Edited by RAVI IYENGAR VOLUME 238. Heterotrimeric G-Protein Effectors Edited by RAVI IYENGAR
Methods in Enzymology
xxxv
VOLUME 239. Nuclear Magnetic Resonance (Part C) Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER VOLUME 240. Numerical Computer Methods (Part B) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 241. Retroviral Proteases Edited by LAWRENCE C. KUO AND JULES A. SHAFER VOLUME 242. Neoglycoconjugates (Part A) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 243. Inorganic Microbial Sulfur Metabolism Edited by HARRY D. PECK, JR., AND JEAN LEGALL VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases Edited by ALAN J. BARRETT VOLUME 245. Extracellular Matrix Components Edited by E. RUOSLAHTI AND E. ENGVALL VOLUME 246. Biochemical Spectroscopy Edited by KENNETH SAUER VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases Edited by ALAN J. BARRETT VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in Enzyme Dynamics) Edited by DANIEL L. PURICH VOLUME 250. Lipid Modifications of Proteins Edited by PATRICK J. CASEY AND JANICE E. BUSS VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and Thiyl Radicals) Edited by LESTER PACKER VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal Transduction and Gene Regulation) Edited by LESTER PACKER VOLUME 253. Adhesion of Microbial Pathogens Edited by RON J. DOYLE AND ITZHAK OFEK VOLUME 254. Oncogene Techniques Edited by PETER K. VOGT AND INDER M. VERMA VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
xxxvi
Methods in Enzymology
VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved in Transport) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 258. Redox-Active Amino Acids in Biology Edited by JUDITH P. KLINMAN VOLUME 259. Energetics of Biological Macromolecules Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids Edited by THOMAS L. JAMES VOLUME 262. DNA Replication Edited by JUDITH L. CAMPBELL VOLUME 263. Plasma Lipoproteins (Part C: Quantitation) Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 265. Cumulative Subject Index Volumes 228, 230–262 VOLUME 266. Computer Methods for Macromolecular Sequence Analysis Edited by RUSSELL F. DOOLITTLE VOLUME 267. Combinatorial Chemistry Edited by JOHN N. ABELSON VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase) Edited by LESTER PACKER VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes) Edited by LESTER PACKER VOLUME 270. High Resolution Separation and Analysis of Biological Macromolecules (Part A: Fundamentals) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 271. High Resolution Separation and Analysis of Biological Macromolecules (Part B: Applications) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 272. Cytochrome P450 (Part B) Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 273. RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA
Methods in Enzymology
xxxvii
VOLUME 274. RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA VOLUME 275. Viral Polymerases and Related Proteins Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL VOLUME 276. Macromolecular Crystallography (Part A) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 277. Macromolecular Crystallography (Part B) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 278. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 279. Vitamins and Coenzymes (Part I) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 280. Vitamins and Coenzymes (Part J) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 281. Vitamins and Coenzymes (Part K) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 282. Vitamins and Coenzymes (Part L) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 283. Cell Cycle Control Edited by WILLIAM G. DUNPHY VOLUME 284. Lipases (Part A: Biotechnology) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289 VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 287. Chemokines Edited by RICHARD HORUK VOLUME 288. Chemokine Receptors Edited by RICHARD HORUK VOLUME 289. Solid Phase Peptide Synthesis Edited by GREGG B. FIELDS VOLUME 290. Molecular Chaperones Edited by GEORGE H. LORIMER AND THOMAS BALDWIN VOLUME 291. Caged Compounds Edited by GERARD MARRIOTT VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN
xxxviii
Methods in Enzymology
VOLUME 293. Ion Channels (Part B) Edited by P. MICHAEL CONN VOLUME 294. Ion Channels (Part C) Edited by P. MICHAEL CONN VOLUME 295. Energetics of Biological Macromolecules (Part B) Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON VOLUME 296. Neurotransmitter Transporters Edited by SUSAN G. AMARA VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture Edited by LEE MCINTOSH VOLUME 298. Molecular Motors and the Cytoskeleton (Part B) Edited by RICHARD B. VALLEE VOLUME 299. Oxidants and Antioxidants (Part A) Edited by LESTER PACKER VOLUME 300. Oxidants and Antioxidants (Part B) Edited by LESTER PACKER VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C) Edited by LESTER PACKER VOLUME 302. Green Fluorescent Protein Edited by P. MICHAEL CONN VOLUME 303. cDNA Preparation and Display Edited by SHERMAN M. WEISSMAN VOLUME 304. Chromatin Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE VOLUME 305. Bioluminescence and Chemiluminescence (Part C) Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT VOLUME 307. Confocal Microscopy Edited by P. MICHAEL CONN VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of Enzyme Catalysis) Edited by DANIEL L. PURICH AND VERN L. SCHRAMM VOLUME 309. Amyloid, Prions, and Other Protein Aggregates Edited by RONALD WETZEL VOLUME 310. Biofilms Edited by RON J. DOYLE
Methods in Enzymology
xxxix
VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 313. Antisense Technology (Part A: General Methods, Methods of Delivery, and RNA Studies) Edited by M. IAN PHILLIPS VOLUME 314. Antisense Technology (Part B: Applications) Edited by M. IAN PHILLIPS VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A) Edited by KRZYSZTOF PALCZEWSKI VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B) Edited by KRZYSZTOF PALCZEWSKI VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 319. Singlet Oxygen, UV-A, and Ozone Edited by LESTER PACKER AND HELMUT SIES VOLUME 320. Cumulative Subject Index Volumes 290–319 VOLUME 321. Numerical Computer Methods (Part C) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 322. Apoptosis Edited by JOHN C. REED VOLUME 323. Energetics of Biological Macromolecules (Part C) Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 324. Branched-Chain Amino Acids (Part B) Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene Expression and Protein Purification) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell Biology and Physiology) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
xl
Methods in Enzymology
VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C: Protein–Protein Interactions and Genomics) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases Involved in Vesicular Traffic) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 330. Hyperthermophilic Enzymes (Part A) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 331. Hyperthermophilic Enzymes (Part B) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 334. Hyperthermophilic Enzymes (Part C) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 335. Flavonoids and Other Polyphenols Edited by LESTER PACKER VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and Molecular Biological Aspects) Edited by RON J. DOYLE VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and Physicochemical Aspects) Edited by RON J. DOYLE VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 340. Drug–Nucleic Acid Interactions Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING VOLUME 341. Ribonucleases (Part A) Edited by ALLEN W. NICHOLSON VOLUME 342. Ribonucleases (Part B) Edited by ALLEN W. NICHOLSON VOLUME 343. G Protein Pathways (Part A: Receptors) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
Methods in Enzymology
xli
VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 346. Gene Therapy Methods Edited by M. IAN PHILLIPS VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A: Selenoproteins and Thioredoxin) Edited by HELMUT SIES AND LESTER PACKER VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol Enzymes and Proteins) Edited by HELMUT SIES AND LESTER PACKER VOLUME 349. Superoxide Dismutase Edited by LESTER PACKER VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 352. Redox Cell Biology and Genetics (Part A) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 353. Redox Cell Biology and Genetics (Part B) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and Characterization of Enzyme Reaction Intermediates) Edited by DANIEL L. PURICH VOLUME 355. Cumulative Subject Index Volumes 321–354 VOLUME 356. Laser Capture Microscopy and Microdissection Edited by P. MICHAEL CONN VOLUME 357. Cytochrome P450, Part C Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and Function of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 359. Nitric Oxide (Part D) Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 360. Biophotonics (Part A) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 361. Biophotonics (Part B) Edited by GERARD MARRIOTT AND IAN PARKER
xlii
Methods in Enzymology
VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 364. Nuclear Receptors Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF VOLUME 365. Differentiation of Embryonic Stem Cells Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER VOLUME 366. Protein Phosphatases Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN VOLUME 367. Liposomes (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 368. Macromolecular Crystallography (Part C) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 369. Combinational Chemistry (Part B) Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN VOLUME 370. RNA Polymerases and Associated Factors (Part C) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 371. RNA Polymerases and Associated Factors (Part D) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 372. Liposomes (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 373. Liposomes (Part C) Edited by NEJAT DU¨ZGU¨NES VOLUME 374. Macromolecular Crystallography (Part D) Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A) Edited by C. DAVID ALLIS AND CARL WU VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B) Edited by C. DAVID ALLIS AND CARL WU VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C) Edited by C. DAVID ALLIS AND CARL WU VOLUME 378. Quinones and Quinone Enzymes (Part A) Edited by HELMUT SIES AND LESTER PACKER VOLUME 379. Energetics of Biological Macromolecules (Part D) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 380. Energetics of Biological Macromolecules (Part E) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS
Methods in Enzymology
xliii
VOLUME 381. Oxygen Sensing Edited by CHANDAN K. SEN AND GREGG L. SEMENZA VOLUME 382. Quinones and Quinone Enzymes (Part B) Edited by HELMUT SIES AND LESTER PACKER VOLUME 383. Numerical Computer Methods (Part D) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 384. Numerical Computer Methods (Part E) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 385. Imaging in Biological Research (Part A) Edited by P. MICHAEL CONN VOLUME 386. Imaging in Biological Research (Part B) Edited by P. MICHAEL CONN VOLUME 387. Liposomes (Part D) Edited by NEJAT DU¨ZGU¨NES VOLUME 388. Protein Engineering Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL VOLUME 389. Regulators of G-Protein Signaling (Part A) Edited by DAVID P. SIDEROVSKI VOLUME 390. Regulators of G-Protein Signaling (Part B) Edited by DAVID P. SIDEROVSKI VOLUME 391. Liposomes (Part E) Edited by NEJAT DU¨ZGU¨NES VOLUME 392. RNA Interference Edited by ENGELKE ROSSI VOLUME 393. Circadian Rhythms Edited by MICHAEL W. YOUNG VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C) Edited by THOMAS L. JAMES VOLUME 395. Producing the Biochemical Data (Part B) Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON VOLUME 396. Nitric Oxide (Part E) Edited by LESTER PACKER AND ENRIQUE CADENAS VOLUME 397. Environmental Microbiology Edited by JARED R. LEADBETTER VOLUME 398. Ubiquitin and Protein Degradation (Part A) Edited by RAYMOND J. DESHAIES VOLUME 399. Ubiquitin and Protein Degradation (Part B) Edited by RAYMOND J. DESHAIES
xliv
Methods in Enzymology
VOLUME 400. Phase II Conjugation Enzymes and Transport Systems Edited by HELMUT SIES AND LESTER PACKER VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases Edited by HELMUT SIES AND LESTER PACKER VOLUME 402. Biological Mass Spectrometry Edited by A. L. BURLINGAME VOLUME 403. GTPases Regulating Membrane Targeting and Fusion Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 404. GTPases Regulating Membrane Dynamics Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates Edited by A. L. BURLINGAME VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 408. DNA Repair (Part A) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 409. DNA Repair (Part B) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench Protocols) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 411. DNA Microarrays (Part B: Databases and Statistics) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 414. Measuring Biological Responses with Automated Microscopy Edited by JAMES INGLESE VOLUME 415. Glycobiology Edited by MINORU FUKUDA VOLUME 416. Glycomics Edited by MINORU FUKUDA VOLUME 417. Functional Glycomics Edited by MINORU FUKUDA
Methods in Enzymology
xlv
VOLUME 418. Embryonic Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 419. Adult Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 420. Stem Cell Tools and Other Experimental Protocols Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for Genomic Engineering Edited by KELLY T. HUGHES VOLUME 422. Two-Component Signaling Systems, Part A Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 423. Two-Component Signaling Systems, Part B Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 424. RNA Editing Edited by JONATHA M. GOTT VOLUME 425. RNA Modification Edited by JONATHA M. GOTT VOLUME 426. Integrins Edited by DAVID CHERESH VOLUME 427. MicroRNA Methods Edited by JOHN J. ROSSI VOLUME 428. Osmosensing and Osmosignaling Edited by HELMUT SIES AND DIETER HAUSSINGER VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics Edited by JON LORSCH VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical Methods Edited by JON LORSCH VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and Chemical-Based Approaches Edited by JON LORSCH VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid Analysis Edited by H. ALEX BROWN VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and Lipids in Disease Edited by H. ALEX BROWN
xlvi
Methods in Enzymology
VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling Edited by H. ALEX BROWN VOLUME 435. Oxygen Biology and Hypoxia Edited by HELMUT SIES AND BERNHARD BRU¨NE VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A) Edited by ROBERT K. POOLE VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B) Edited by ROBERT K. POOLE VOLUME 438. Small GTPases in Disease (Part A) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 439. Small GTPases in Disease (Part B) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 442. Programmed Cell Death, General Principles for Studying Cell Death (Part A) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 443. Angiogenesis: In Vitro Systems Edited by DAVID A. CHERESH VOLUME 444. Angiogenesis: In Vivo Systems (Part A) Edited by DAVID A. CHERESH VOLUME 445. Angiogenesis: In Vivo Systems (Part B) Edited by DAVID A. CHERESH VOLUME 446. Programmed Cell Death, The Biology and Therapeutic Implications of Cell Death (Part B) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA Decay Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN
Methods in Enzymology
xlvii
VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality Control RNA Decay Pathways Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 450. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A) Edited by DANIEL J. KLIONSKY VOLUME 452. Autophagy in Mammalian Systems (Part B) Edited by DANIEL J. KLIONSKY VOLUME 453. Autophagy in Disease and Clinical Applications (Part C) Edited by DANIEL J. KLIONSKY VOLUME 454. Computer Methods (Part A) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 455. Biothermodynamics (Part A) Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED) VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport Complexes and Reactive Oxygen Species Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases, Protein Phosphatases and Mitochondrial Diseases Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and Peptides Edited by DAVID A. HOPWOOD VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and Carbohydrates Edited by DAVID A. HOPWOOD VOLUME 460. Chemokines, Part A Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 461. Chemokines, Part B Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 462. Non-Natural Amino Acids Edited by TOM W. MUIR AND JOHN N. ABELSON VOLUME 463. Guide to Protein Purification, 2nd Edition Edited by RICHARD R. BURGESS AND MURRAY P. DEUTSCHER VOLUME 464. Liposomes, Part F Edited by NEJAT DU¨ZGU¨NES
xlviii
Methods in Enzymology
VOLUME 465. Liposomes, Part G Edited by NEJAT DU¨ZGU¨NES VOLUME 466. Biothermodynamics, Part B Edited by MICHAEL L. JOHNSON, GARY K. ACKERS, AND JO M. HOLT VOLUME 467. Computer Methods Part B Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 468. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part A Edited by DANIEL HERSCHLAG VOLUME 469. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part B Edited by DANIEL HERSCHLAG VOLUME 470. Guide to Yeast Genetics: Functional Genomics, Proteomics, and Other Systems Analysis, 2nd Edition Edited by GERALD FINK, JONATHAN WEISSMAN, AND CHRISTINE GUTHRIE VOLUME 471. Two-Component Signaling Systems, Part C Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 472. Single Molecule Tools, Part A: Fluorescence Based Approaches Edited by NILS WALTER VOLUME 473. Thiol Redox Transitions in Cell Signaling, Part A Chemistry and Biochemistry of Low Molecular Weight and Protein Thiols Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 474. Thiol Redox Transitions in Cell Signaling, Part B Cellular Localization and Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 475. Single Molecule Tools, Part B: Super-Resolution, Particle Tracking, Multiparameter, and Force Based Methods Edited by NILS G. WALTER VOLUME 476. Guide to Techniques in Mouse Development, Part A: Mice, Embryos, and Cells, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 477. Guide to Techniques in Mouse Development, Part B: Mouse Molecular Genetics, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 478. Glycomics, Part A Edited by MINORU FUKUDA VOLUME 479. Functional Glycomics Edited by MINORU FUKUDA
C H A P T E R
O N E
b1,4-Galactosyltransferase V: A Growth Regulator in Glioma Jianhai Jiang and Jianxin Gu Contents 1. Overview 2. Experimental 2.1. Cell culture and transfection 2.2. Lectin blot and lectin staining analysis 2.3. Invasion and migration analysis 2.4. Survival assay 2.5. Implantation of tumor cells in mice 2.6. Reverse transcriptase-polymerase chain reaction (RT-PCR) 2.7. Dual luciferase assay 2.8. Extract of nuclear protein 2.9. Gel shift assay 3. Results 3.1. Elevated expression of b1,4GalT V in glioma 3.2. Function and mechanism of b1,4GalT V in glioma process 3.3. Transcriptional regulation of b1,4GalT V 3.4. Recent research on b1,4GalT V in glioma-initiating cell 4. Conclusion and Future Direction Acknowledgments References
4 5 5 6 6 6 7 7 7 8 8 8 8 10 11 16 18 22 22
Abstract One of the most prominent transformation-associated changes in the sugar chains of glycoproteins is an increase in the large N-glycans of cell surface glycoprotein. b1,4-galactosyltransferase V (b1,4GalT V) could effectively galactosylate the GlcNAcb1!6 branch which is a marker of glioma. The expression of b1,4GalT V is increased in the process of glioma development. b1,4GalT V regulates the invasion, growth in vivo and in vitro of glioma cells. Downregulation of b1,4GalT V expression increases the sensitivity of malignant glioma cells to DNA damage drugs. Furthermore, b1,4GalT V regulates Ras and AKT signaling Key Laboratory of Glycoconjuates Research, Ministry of Public Health & Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79001-7
#
2010 Elsevier Inc. All rights reserved.
3
4
Jianhai Jiang and Jianxin Gu
involving in glioma behaviors. Meanwhile, Ras/MAPK and PI3K/AKT signaling pathways are involved in the transcription regulation of b1,4GalT V gene. E1AF transcription factor, a downstream target of Ras/MAPK and PI3K/AKT signaling pathways, regulates the transcription of b1,4GalT V in cooperation with Sp1 transcription factor. The contribution of b1,4GalT V in glioma development is further confirmed in glioma-initiation cells. b1,4GalT V regulates the selfrenewal of glioma-initiation cells. We now present evidence that b1,4GalT V functions as a positive growth regulator in glioma and might represent a novel target in glioma therapy.
1. Overview b1,4-galactosyltransferase (GalT) family are the enzymes responsible for the biosynthesis of N-acetyllactosamine on N-glycans by transferring UDP-galactose to the terminal N-acetylglusamine (N-GlcNAc) residues and this family consist of seven members, from b1,4GalTI to b1,4GalT VII (Guo et al., 2001; Sato et al., 2001). b1,4GalT V, a member of b1,4galactosyltransferase family, could effectively galactosylate the GlcNAcb1!6 branch (Sato et al., 1998). Human b1,4GalT V gene has been isolated by Furukawa et al. from human breast cancer cells in 1998 (Sato et al., 1998). When b1,4GalT V is expressed in Sf9 insect cells with N-linked oligosaccharides terminated predominantly with GlcNAc, the GlcNAc residues are galactosylated by b1,4GalT V as revealed by lectin blot analysis (Sato et al., 2001). The expression change of b1,4GalT V has been investigated using NIH3T3 and the highly malignant transformed cell line MTAg. Northern blot analysis has revealed that the transcript of b1,4GalT V gene increases by two to threefold in the transformed cells (Shirane et al., 1999). Similar results have been obtained in several human cancer cell lines (Sato et al., 2000). Our study has shown that the expression of b1,4GalT V is increased in the process of glioma development, with the highest level in grade IV glioma (Xu et al., 2001). Furthermore, decreasing the expression of b1,4GalT V in glioma cells inhibited the invasion and migration and the ability of growth in vitro and in vivo ( Jiang et al., 2006). To understand this phenomenon, it is necessary to understand the regulation of b1,4GalT V and to determine the functions of the target molecules. In 2004, Frukawa et al. firstly cloned the 50 -flanking region of the human b1,4GalT V gene and contributed to the research on the transcriptional regulation of b1,4GalT V (Sato and Furukawa, 2004). Sp1 transcription factor played an important role in the transcriptional regulation of b1,4GalT V. Sp1 binds to the GC box motif at nucleotide positions 81/69 of the b1,4GalT V promoter and play an essential role in promoter activity in cancer
The Role of b1,4GalTV in Glioma Development
5
cells (Sato and Furukawa, 2004). The Ets family transcription factors, which bind to GGA (A/T) sequences in the promoter and enhancer regions of a number of cellular and viral genes, regulate the expression of genes associated with tumor invasion, angiogenesis, cell adhesion, and organ development (Sharrocks, 2001). Ets-1, a member of Ets family, activates the expression of the b1,4GalT V through upregulating the transcription of Sp1 gene (Sato and Furukawa, 2007). Apart from this, another member of Ets family, E1AF, functions as a positive invasion regulator in glioma in cooperation with Sp1 via upregulation of b1,4GalT V ( Jiang et al., 2007). In addition, the activity of b1,4GalT V promoter could be induced by epidermal growth factor (EGF), dominant active Ras, ERK2, JNK1, and constitutively active AKT ( Jiang et al., 2006), indicating that Ras/MAPK and PI3K/AKT signaling pathways are involved in the transcription regulation of b1,4GalT V gene. Until now, most exact mechanisms and target proteins involved in b1,4GalT V functions in glioma remain unknown. We have found that there is a link between b1,4GalT V and cyclins or other proteins such as integrin, JNK, ERK, and AKT; however, there is no tangible evidence to prove that these proteins are the targets of b1,4GalT V. Taken together, b1,4GalT V functions as a positive growth regulator in glioma and might represent a novel target in glioma therapy.
2. Experimental 2.1. Cell culture and transfection Human glioma cell lines SHG44, U87, and U251 were cultured in RPMI medium 1640 or Dulbecco’s modified eagle medium (DMEM) containing 10% bovine calf serum, 100 units/ml penicillin, and 50 mg/ml streptomycin at 37 C in a humidified CO2 incubator (5% CO2, 95% air). Transformed astrocytes C8-D30 (American Type Culture Collection) were cultured in DMEM containing 10% fetal bovine serum, 1.5 g/l sodium bicarbonate, and 4.5 g/l glucose. Glioma-initiating cells (GICs) were obtained from glioma xenografts digested with collagenase (type Ia, Sigma) in DMEM at 37 C for 90 min and grown under nonadherent conditions in neural stem cell culture medium composed of DMEM and Ham’s F-12 media supplemented with B-27 (Invitrogen), 50 mM Hepes, 2 mg/ml heparin, 20 ng/ml EGF, and 20 ng/ml FGF-2. Cell transient transfection was performed with Lipofectamine (Invitrogen) according to the manufacturer’s instructions. Stable transfection cells were generated by transfection with indicated plasmid, followed by selection in G418. Individual clones were picked and analyzed.
6
Jianhai Jiang and Jianxin Gu
2.2. Lectin blot and lectin staining analysis Cells were harvested, rinsed with phosphate-buffered saline (PBS), and lysed with 1% Triton X-100 in PBS. Cell lysates containing 30 mg of protein were boiled in SDS sample buffer with b-mercaptoethanol, loaded on SDSPAGE, and then transferred onto a PVDF membrane. Then the membrane was treated with 25 mM H2SO4 at 80 C for 60 min to remove sialic acid residues. After being blocked with 5% bovine serum albumin (BSA), the membrane was incubated with HRP-lectin for 2 h at room temperature. The blots were washed and developed with the ECL detection system using X-ray film. Cells coated on the glass coverslips were fixed with 4% paraformaldehyde/PBS for 30 min. To eliminate terminal sialic acid moieties, we treated cells with sialidase (0.03 units/ml) for 5 h at 37 C. Endogenous peroxidase activity was blocked with 0.3% H2O2/methanol for 30 min. To minimize nonspecific binding reactions, we covered specimens for 30 min with 1% BSA in Tris-buffered saline (TBS). Following this, cells were incubated at 37 C for 2 h in the presence of HRP-conjugated lectin. After rinsing the cells thoroughly in PBS, they were stained by treating the coverslips with 3,30 -diaminobenzidinetetra hydrochloride (DAB) solution for 3 min. Finally, the samples were dehydrated, cleared, and mounted.
2.3. Invasion and migration analysis Polycarbonate filters with 8 mm pores were coated with 500 mg/ml of Matrigel (BD Biosciences). The coated filters were washed with serumfree medium and dried immediately. Then cells were added to the upper compartment of the chamber and 800 ml of medium (containing 0.1% BSA) was added into the lower chamber. Cells were incubated and allowed to migrate for 24 h. After removal of nonmigrated cells, cells that had migrated through the filter were counted under a microscope in five fields at a magnification of 400. Wound healing assays were performed as described: Subconfluent cells in 6-well plates were serum-starved overnight. Over 20 wounds were made on the cell monolayer by scratching with a 200-ml sterile tip. After rinsing with PBS three times, the medium was replaced with complete growth media. Cells were photographed at 0 and 24 h after scraping, and the wound-induced migration of cells was measured after 24 h.
2.4. Survival assay Cells were plated onto 6-well dishes. After 24 h, the medium was removed, cells were washed twice with Dulbecco’s phosphate-buffered saline (DPBS), and the serum-free medium was added. Cultures were visually
7
The Role of b1,4GalTV in Glioma Development
inspected everyday. Cell numbers were determined after trypan blue staining of viable cells in parallel plates.
2.5. Implantation of tumor cells in mice At confluence, the cells were harvested, centrifuged and then resuspended in a sterile solution of PBS at a final concentration of about 1.0 107 cells/ml. A 100-ml aliquot of resuspended cells (about 1.0 106 cells) was injected s.c. between the shoulder blade 3 cm from the tail. After 3 weeks, photographs were taken and tumors were harvested and individually weighed after mice anesthetized. Statistical analysis was performed by computer program software using the Student’s t test.
2.6. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA (1 mg) extracted was used as a template for cDNA synthesis, with a TaKaRa RNA PCR Kit and specific primers. Amplification was carried out for 22–27 cycles under saturation, each at 94 C, 45 s; 50–60 C, 45 s; 72 C, 1–5 min in a 50-ml reaction mixture containing 2 ml each cDNA, 0.2 mM each primer, 0.2 mM dNTP, and 2.5 units of Taq DNA polymerase. After amplification, 10 ml of each reaction mixture was analyzed by 1–2% agarose gel electrophoresis, and the bands were then visualized by ethidium bromide staining. b1,4GalT I b1,4GalT II b1,4GalT V b-Actin
Forward primer 50 -ATGAGGCTTCGG GAGCCGCTCCTG-30 0 5 -CGCTGGAGCGCG TCTGCAAGGC-30 0 5 -TGAGAACAATCG GTGCATCAG-30 0 5 -ATGGGTCAGAA GGATTCCTAT-30
Reverse primer 50 -CTAGCTCGGTG TCCCGATGTC-30 0 5 -ACAAGZCCAGG TGGCGAGTCA-30 0 5 -CTCAATCCGCC AAATAACTC-30 0 5 -GCGCTCGGTGA GGATCTTCAT-30
2.7. Dual luciferase assay Cells transiently transfected with pGL3-b1,4GalT V promoter and pRLCMV were washed and lysed in 100 ml of passive lysis buffer (Promega). Firefly luciferase and Renilla luciferase activities were measured with 5 ml of cells lysate using the Dual-Luciferase Reporter assay system (Promega) in a luminometer. ‘‘Relative activity’’ was defined as the ratio of firefly luciferase activity to Renilla luciferase activity and was calculated by dividing
8
Jianhai Jiang and Jianxin Gu
luminescence intensity obtained in the assay for firefly luciferase by that obtained for Renilla luciferase.
2.8. Extract of nuclear protein Cell pellets were resuspended in 400 ml buffer A (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF) on ice for 15 min, then 25 ml of 10% NP-40 was added. After centrifugation, the nuclear pellets were resuspended in 50 ml ice-cold buffer C (20 mM Hepes, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF) and the tubes were vortexed at 4 C for 15 min. After centrifugation, the supernatants were collected and protein concentration was determined using Lowry’s method.
2.9. Gel shift assay Gel mobility shift assay was carried out using Gel Shift Assay System (Promega) as follows. The double-stranded oligonucleotides were annealed, end-labeled with 32P using T4 polynucleotide kinase, and purified using Sephadex G-25 quick spin columns (Roche Molecular Biochemicals). Nuclear proteins were preincubated for 10 min with 9 ml of electrophoretic mobility shift assay (EMSA) buffer. Then the 32P-end-labeled duplex oligonucleotide (1 ml, 10 fmol) was added, and the reaction was incubated for 20 min on ice. For competition experiments, unlabeled DNA probes were included at 100-fold molar excess over the 32P-labeled DNA probe. For supershift experiments, 2 mg antibodies were added to the reaction mixtures and incubated for 30 min prior to addition of the 32P-labeled DNA probe. DNA–protein complexes were separated on 5% nondenaturing polyacrylamide gels in 0.5 Tris borate/EDTA (pH 8.4) at 4 C and 35 mA. The gels were dried, and the DNA–protein complexes were visualized by autoradiography.
3. Results 3.1. Elevated expression of b1,4GalT V in glioma Compared to other members of b1,4GalT family, b1,4GalT V has a closer relationship with glioma process. Although the mRNA level of b1,4GalT I, II, and V increased markedly in glioma tissue, further observations revealed that only the expression of b1,4GalT V has statistical discrepancy (p < 0.05) in glioma of grade II, III, and IV (Fig. 1.1A). Another result showed that the transcript of b1,4GalT V increased in proper order to the tissue of normal brain and glioma of grade I–IV (Fig. 1.1B). Because the Ricinus communis agglutinin-I (RCA-I) lectin could preferentially interact with oligosaccharides terminated
9
The Role of b1,4GalTV in Glioma Development
A
D II
III
E RCA-I
IV
GalT I GalT V GAPDH
400
4.75
PHA-L 320
221
4.75
281
111
GalT II
0 0 1 2 3 4 4 1 2 3 10 10 10 10 10 10 10 10 10
GAPDH
Fluorescence intensity SHG44 C
B
PHA-L
RCA-I Control AS-GalT V
Relative cell number
N
200 kDa 150 kDa 100 kDa 80 kDa 50 kDa
25 kDa
GAPDH
Con AS
Con AS
SHG44 CBB
RCA-I 97 kDa
GalT V 66 kDa
b-actin 43 kDa
N
I
II
III
IV
N N II III IV
N N II III IV
Figure 1.1 Elevated expression of b1,4-galactosyltransferase V in glioma (A, B) RTPCR analysis of b1,4-GalT I, II, and V gene expression in normal brain and multiple grade I–IV glioma. (C) RCA-1 lectin blot analysis of human normal brain and glioma glycoprotein. The membrane proteins were prepared from the tissues of normal brain and glioma and the blots were stained with CBB (left) or RCA-1(right). Reduction in the GalT V expression could reduce the expression of N-glycans in glioma cell line SHG44. (D) Both control and antisense-transfected SHG44 cells were incubated with biotinylated RCA-I or PHA-L followed by incubation with FITC-conjugated streptavidin. Analysis was performed using FACScan. The dotted lines represented fluorescence of the secondary antibody alone. The numbers on the left inside of the top panel gave the mean fluorescence intensity of the secondary antibody alone, whereas those in the right inside gave the mean fluorescence intensity of the indicated antibody staining done. (E) The cell extracts were separated by SDS-PAGE and the binding to RCA-I or PHA-L were analyzed by RCA-I-lectin (left panel) or PHA-L-lectin (right panel). The GAPDH Western blot served as a loading control.
with Galb14GlcNAc group, it is widely used to exam the galactosylation of endogenous glycoproteins (Sato and Furukawa, 2007). The total glycoproteins reacted to RCA-I are more extensively in glioma tissue compared with normal brain tissue, using an RCA-I lectin blot (Fig. 1.1C). Reduction of b1,4GalT V by an antisense cDNA decreased the binding with RCA-I and PHA-L on the cell surface (Fig. 1.1D), and a significant decrease of the binding of total glycoprotein with RCA-I or PHA-L was observed in glioma cell line SHG44 (Fig. 1.1E). The data showed that b1,4GalT family membranes, especially b1,4GalT V, should be responsible partly for aberrant galactosylation of proteins in glioma. The substrate proteins involved in these effects and their mechanisms of action remain to be determined.
10
Jianhai Jiang and Jianxin Gu
3.2. Function and mechanism of b1,4GalT V in glioma process Under normal conditions, the glioma cell line SHG44 showed invasive growth with spindle-shaped morphology and grew in an actinomorphic manner (Fig. 1.2A, left panel). When the expression of b1,4GalT V was knockdown by a stably transfection of an antisense cDNA construct, SHG44 cells exhibited a round morphology and grew in a ramble way (Fig. 1.2A, right panel). And, reduction in b1,4GalT V expression resulted in a significant decrease in cell migration in vitro and the ability to migrate, assayed by wound healing and Boyden chamber assays (Fig. 1.2B). Similar results were obtained A
Control
AS-GalT V
1.5
Fold induction (tumor weight/g)
D
Control B
Control
1.0
0.5
0
AS-GalT V
Control AS-GalT V
AS-GalT V C 300
0h Migrated cells
24 h
Leading edge of migration (mm)
75 50 25
0
0h
24 h
SHG44 Control
200
100
0
Control AS-GaIT V
AS-GalT V
Figure 1.2 Effects of reduction in the GalT V expression on glioma cell SHG44 invasiveness and growth. (A) Cell morphology of control or antisense-transfected SHG44 cells. When cells were grown to confluence in RPMI 1640 containing 10% FBS, photographs were taken. (B) Cell migration assay of control or antisense-transfected SHG44 cells. (C) Decreasing the GalT V expression in SHG44 cells inhibited the invasive ability assayed in a modified Boyden chamber ( p < 0.05, n ¼ 3). (D) Nude mice were injected with either control or antisense-transfected SHG44 cells. Three weeks later, photographs were taken (left panel). Tumors were removed and weighted. Results were shown as mean S.D. of tumor weights (right panel).
The Role of b1,4GalTV in Glioma Development
11
in agarose drop explant assay (data not shown). Moreover, reduction in the expression of b1,4GalT V resulted in a total suppression of tumor formation in nude mice, compared with the control (Fig. 1.2D). b1,4GalT V overexpression in glioma cells U87 and U251 and transformed astrocytes C8-D30 resulted in a striking increase of cell migration (Fig. 1.3A), an almost threefold increase in vitro invasiveness through a reconstituted Matrigel basement membrane (Fig. 1.3B), a great increase in colony number (data not shown) and greater numbers of viable cells in serum-free conditions relative to the control cells (Fig. 1.3C). Figure 1.3D showed that b1,4GalT V-transfected cells developed tumors with a markedly large size during the 3 weeks of observation compared with the control cells. Collectively, b1,4GalT V could promote glioma cell invasiveness and survival. The b1,4GalT V protein consists of a short NH2-terminal cytoplasmic domain, a stem region and a catalytic domain which contains two conserved residues (Y268/W294) which are important for the galactosylation activity of b1,4GalT V (Fig. 1.4A). RCA-I lectin blot showed that W294 was involved in the galactosyltransferase activity of b1,4GalT V (Fig. 1.4A). The point mutation (W294G) abolished the ability of GalT V to promote the migration ability and invasive potential of glioma cells (Fig. 1.4B and C), indicating that an intact catalytic domain might be essential for b1,4GalT V tumorigenic function in glioma. Furthermore, the mechanisms of b1,4GalT V involved in glioma process were investigated. Reduction in the expression of b1,4GalT V inhibited cell cycle progression and reduced the endogenous expression of cyclin D1, cyclin D3, and E2F1 (Fig. 1.5A), which are important regulators of cellular proliferation and highly expressed in glioma (Arato-Ohshima and Sawa, 1999; Bacon et al., 2002). Ras/MAPK and PI3K/AKT signaling pathways, which have shown to associate with glioma invasiveness (Fan et al., 2006; Kurose et al., 2001; Shi et al., 2004), have relationship with b1,4GalT V. Reduction in the expression of b1,4GalT V led to a reduction of the levels of phosphor-AKT (Ser473/T308) and phosphor-JNK1/2 (Thr183/ Tyr185) status (Fig. 1.5B). Interestingly, downregulation of b1,4GalT V strengthened the cell adhesion ability to FN by promoting integrin b1 maturation (Fig. 1.5C), subsequently changing the location of integrin b1 in cells and interaction between integrin b1 and a5 subunits (Fig. 1.5D). All the data showed that b1,4GalT V functioned as a positive growth regulator in glioma; however, most of the mechanism involved the process remained unknown and should be explored.
3.3. Transcriptional regulation of b1,4GalT V Sato and Furukawa firstly cloned the 2.3-kb 50 -flanking region of the human b1,4GalT V gene and identified the region 116/18 relative to the transcription start site as that having promoter activity (Sato and
12
Jianhai Jiang and Jianxin Gu
B
A
150
75 Migrated cells
Leading edge of migration (mm)
100
50
50
25
0
0 U87
U251
Control
C8-D30
U87 Control
HA-GalT V
U251
C8-D30
HA-GalT V
D
C 5
2.5
2.0 Tumor weight (g)
Fold induction (survival)
100
2.5
1.5
1.0
0.5
0
0 Control U87
HA-GalT V U251
C8-D30
U87 Control
U251 HA-GalT V
Figure 1.3 Effects of GalT V overexpression on glioma cells and transformed astrocytes invasiveness and survival control or HA-GalT V plasmid was stably transfected into U87, U251, and C8-D30 cells. (A) Cell migration assay of control or HA-GalT Vtransfected cells. (B) HA-GalT V-transfected cells were more invasive than the control cells assayed in a modified Boyden chamber (p < 0.05, n ¼ 3). (C) 100,000 cells were plated into individual wells of 6-well tissue culture plates in sextuplicate in same condition, grown overnight in DMEM with 10% FBS, and serum-starved for 10 days. Fixed and stained with toluidine blue O (0.1%) in 4% paraformaldehyde diluted in PBS, viable cells were counted. (D) The ectopic expression of GalT V promoted glioma growth in vivo. At 3 weeks after injection with the indicated cells, tumors were removed and weighted. Results were shown as mean S.D. of tumor weights.
13
The Role of b1,4GalTV in Glioma Development
A NH2
TM
Catalytic domain COOH
WT G Y268G
Y 268
G
W294G
W 294
200 kDa 100 kDa 80 kDa
RCA-I
50 kDa
4G
G
T
29 W
Y2
68
W
Co
nt
ro
l
25 kDa
U87 B
C 150
Migrated cells
Leading edge of migration (mm)
100
50
100
50
0 U87
U251 Control W294G
C8-D30 WT
0
U87
U251 Control
C8-D30 WT
W294G
Figure 1.4 GalT V acts as a catalytic enzyme in the promotion of its tumorigenic effects on glioma. (A) A schematic diagram of HA-tagged GalT V construct (WT) and its point mutation formats (Y268G/W294G) (upper panel). Proteins from U87 cells transfected with vector or full length of GalT V (WT) or point mutant constructs (Y268G/W294G) were separated by SDS-PAGE and the binding to RCA-I was
14
Jianhai Jiang and Jianxin Gu
Furukawa, 2004). Sp1, a well known DNA-binding nuclear protein, regulate the transcription of b1,4GalT V in lung carcinoma cells and glioma cells through binding to nucleotide positions 81/69 of the promoter region (Sato and Furukawa, 2004). Ets-1 and E1AF, two members of the Ets family of transcription factors characterized by an evolutionarily conserved DNAbinding domain regulate expression of b1,4GalT V in cooperation with Sp1 ( Jiang et al., 2007; Sato and Furukawa, 2007). Ets-1 enhanced expression of the b1,4GalT V gene through activating transcription of the Sp1 gene in cancer cells (Sato and Furukawa, 2007). E1AF might physically interact with Sp1 in a DNA-independent manner in glioma cells and glioma tissue (Fig. 1.6A). E1AF activated the b1,4GalT V promoter in cooperation with Sp1, and mutation of Sp1-binding site but not that of the Ets-binding site abolished the positive effect of E1AF on the activity of the b1,4GalT V promoter (Fig. 1.6B). The EMSA and DNA affinity precipitation assay confirmed that E1AF/Sp1 complex binds to the b1,4GalT V promoter in vitro and in vivo (Fig. 1.6C and D). Furthermore, E1AF overexpression increased the phosphorylation level and DNA-binding activity of Sp1 (Fig. 1.6E). b1,4GalT V, which is sensitive to the extracellular microenviroment, is regulated by many extracellular factors such as chemotherapeutic drugs and EGF. Etoposide (VP16), a common chemotherapy drugs used for the treatment of malignant glioma (Nagane et al., 1999), downregulated the expression level of b1,4GalT V mRNA through reducing the level of transcription factor Sp1 (Fig. 1.7A and D). The treatment of SHG44 cells with etoposide decreased the activity of GalT V promoter (Fig. 1.7B and E), and forced expression of b1,4GalT V could protect cells from apoptosis induced by etoposide (Fig. 1.7C). Arsenic trioxide (As2O3), another chemotherapeutic drug, could decrease the expression of b1,4GalT V protein without changing its mRNA level in SHG44 cells (Fig. 1.7F). However, molecular mechanism involved in this process remained unknown. EGF, a key growth factor regulating cell survival, could activate an extensive network of signal transduction pathways that include activation of the PI3K/AKT, RAS/ERK, and JAK/STAT pathways (Bergstrom et al., 2000; Zheng et al., 2001). In cancer, EGF signaling pathways are often dysfunctional and targeted therapies that block EGF signaling have been successful in treating cancers. The regulation of b1,4GalT V is known to be involved in RAS/ERK and PI3K/AKT signal pathways. Endogenous b1,4GalT V mRNA expression was markedly induced by EGF in SHG44 analyzed by RCA-I-lectin. The GAPDH Western blot served as a loading control (lower panel). (B) Migration assay of control, HA-GalT V- (WT) or W294G-transfected cells. (C) Matrigel invasion assay was performed with the cells stably transfected with control, HA-GalT V (WT) or W294G. Values were shown as mean S.D. of triplicates from two independent experiments.
15
The Role of b1,4GalTV in Glioma Development
A Cell number (%)
100
B Control AS-GalT V
Con AS pERK1 pERK2 ERK1 ERK2 pJNK1 pJNK2 JNK1 JNK2 GAPDH
75 50 25 0 G0-G1 S
G2-M
pAKT(S473) pAKT(T308)
Con AS Cyclin D1
AKT
Cyclin D2
GAPDH
Cyclin D3
p125 Integrin b1 p105
E2F1
GAPDH
GAPDH
Integrin b1
Golgi
Merge
AS
Con
C
E Con AS Integrin b1 Integrin a5
IP: a-integrin a5 pFAK FAK IP: a-FAK
Absorbance at 595 nm
D
0.8
Control GalT V-AS
0.6 0.4 0.2 0
1
3
10
30
FN (mg/ml)
Figure 1.5 The potential mechanisms of GalT V involved in glioma process. (A) Control or antisense-transfected SHG44 cells were harvested, and cell cycle parameters were determined by DNA content (upper panel). Equal amounts of proteins from control or antisense-transfected SHG44 cells were immunoblotted with the antibodies of cyclin D1, cyclin D2, cyclin D3, and E2F1 (lower panel). The GAPDH served as a loading control. (B) Equal amounts of proteins from control or antisense-transfected SHG44 cells were immunoblotted with the antibodies of pERK1, pERK2, ERK1, ERK2, pJNK1, pJNK2, JNK1, JNK2, pAKT, and AKT. The GAPDH served as a loading control. (C) Reduction in the GalT V expression affects the subcellular localization of integrin b1 subunit. After fixed and permeabilized, control (upper panel) or
16
Jianhai Jiang and Jianxin Gu
cells (Fig. 1.8A, upper panel), indicating the contribution of EGF in the transcription regulation of b1,4GalT V gene, and the promoter activity of b1,4GalT V gene was activated by EGF in a dose-dependent manner (Fig. 1.8A, lower panel). When Ras-DN (the dominant negative construct of Ras ) or Ras-DA (the constitutively active expression construct of Ras) was cotransfected with promoter reporter plasmid of b1,4GalT V into SHG44 cells, the Ras-DN decreased the b1,4GalT V promoter activity in a dose-dependent manner, whereas the Ras-DA caused a similarity dependent activation (Fig. 1.8B). Consistent with this, transient overexpression of ERK1 or JNK1 into SHG44 cells led to a significant increase in the b1,4GalT V promoter activity (Fig. 1.8C). The constitutively active AKT (Gag-AKT) construct could also increase the promoter activity of b1,4GalT V gene in a dose-dependent manner (Fig. 1.8D). The data showed that RAS/ERK and PI3K/AKT signal pathways contribute to the regulation of b1,4GalT V. Furthermore, the mutagenesis of Sp1-binding site in the b1,4GalT V promoter could abolish the effects of Ras-DA, Ras-DN, ERK1, JNK1, or Gag-AKT on the b1,4GalT V promoter activity (Fig. 1.8E).
3.4. Recent research on b1,4GalT V in glioma-initiating cell GICs play pivotal roles in glioma initiation, growth, and recurrence, and therefore, their elimination is an essential factor for the development of efficient therapeutic strategies (Chumsri and Burger, 2008; Park et al., 2009). The characterization of GICs has been on the basis of expression of neural stem cell markers like CD133 and Nestin (Das et al., 2008). Recent research revealed that knockdown of b1,4GalT V by RNA interference antisense-transfected SHG44 cells (lower panel) reacted with anti-integrin b1 mouse monoclonal antibody followed by incubation with rhodamine-conjugated goat antimouse IgG and C6-NBD, a special dye labeling Golgi apparatus. Images were captured and analyzed with a Zeiss confocal microscope (magnification 40). Integrin b1 is in red and the Golgi marker is in green. The yellow image is a red/green merge to show colocalization. In antisense-transfected SHG44 cells, the integrin b1 was localized near the cell surface and formed small intracellular clusters (red arrow). (D) Downregulation of GalT V strengthened the interaction between integrin b1 and a5 subunit. Immunoprecipitation was performed with monoclonal anti-integrin a5 antibody. Coimmunoprecipitation protein was probed with indicated antibodies. The tyrosine phosphorylation level of FAK was significantly enhanced in antisense-transfected SHG44 cells. After incubation on FN (15 lg/ml) for 30 min, the cell lysates were immunoprecipitated (IP) by monoclonal anti-FAK antibody. The level of FAK and phosphor-FAK was detected by indicated antibodies. (E) GalT V antisense-transfected SHG44 cells demonstrated more adhesion ability to fibronectin. Antisense-transfected SHG44 cells and control cells (3 104) were applied to 96-well plates coated with polylysine (100 mg/ml), 1% BSA or increasing concentrations (1, 3, 10, and 30 mg/ml) of FN, and incubated at 37 C for 30 min. Adherent cells were crystal violet and absorbance of each well was determined at 595 nm.
17
The Role of b1,4GalTV in Glioma Development
C
A Input IgG
IP
Sp1-concensus: CCTTGGTGGGGGCGGGGCCTAAGCTG Ets-mutation: CTGGCCCCGCCTAACGCGCGTGCGCC
a -Sp1
GalT V (-82/-57): CTGGCCCCGCCTCCCGCGCGTGCGCC Sp1-mutation: CTGGCCAAGCCTCCCGCGCGTGCGCC Sp1 Ets
E1AF Sp1 EtBr
-
IP Input IgG a-Sp1
Cold probe
Nuclear extract GalT V probe GalT V (-82/57) Sp1-mutation Ets-mutation Sp1-concensus
-
+ +
Nuclear extract GalT V probe Normal mouse IgG E1AF-antibody Normal rabbit IgG Sp1-antibody
a b c
N T N TN TN T E1AF
+ + + + + +
a b c
Sp1 EGFR Free probes
GAPDH
Free probes Lane 1 2 3 4 5
Lane 1 2 3 4 5 6 7 8 910
B
-200
Sp1
EBS
Sp1
EBS
LUC
M(Sp1) Sp1
EXS
LUC
M(EBS) 25 20 15
Input WT Sp1-mut
LUC
GalT V-Luc
Control E1AF Sp1 E1AF+Sp1 SHG44
10 5
V -L M uc (S p M 1) (E BS )
0
E1AF Sp1 PARP N T NT NT Input WT Sp1-mut Sp1 E1AF-myc E1AF PARP E1AF-myc - + - + - +
Con E1AF E1AF a -Sp1 p-ser IP p-Thr Sp1 EtBr - - + Con E1AF a-Sp1 IP
32p-Sp1
Sp1
G
al
T
Relative luciferase activity
E
D
Figure 1.6 E1AF and Sp1 regulate the transcription of GalT V in glioma. (A) In vivo association of E1AF with Sp1 determined using cells of the glioma SHG44 cell line and a coimmunoprecipitation assay. Lysates from SHG44 cells were immunoprecipitated (IP) with anti-Sp1 antibody (Ab) or control IgG in the absence or presence of EtBr (50, 200, or 400 mg/ml) and sequentially immunoblotted with anti-E1AF or anti-Sp1 antibody (upper panel). Sp1 IP of glioma tissue (T) and normal brain tissue (N) lysates in the absence or presence of EtBr (50 mg/ml) probed with anti-E1AF, anti-Sp1, anti-EGFR, or anti-GAPDH antibodies (lower panel). (B) PcDNA3.0 and/or E1AF and/or Sp1 expression vectors were transiently cotransfected into SHG44 cells with GalT V-Luc, M(Sp1), or M(EBS). The luciferase activity was determined as described before. (C) Oligonucleotides used in an electrophoretic mobility shift assay (upper). The putative Sp1 and Ets-binding sites are indicated with boxes. The mutated nucleotides are underlined. An electrophoretic mobility shift assay was performed using nuclear proteins of SHG44 cells and a human GalT V promoter sequence ( 82 to 57) double-stranded radiolabeled probe. Competition assays were carried out with a 10- to 20-fold excess of GalT V promoter sequence ( 82 to 57) oligonucleotides with or without the Etsbinding site or Sp1-binding site mutated or Sp1 consensus oligonucleotides. The DNA– protein complexes (arrows a–c) and free DNA are indicated (left panel). E1AF/Sp1 bound to a GC box site within a human GalT V promoter (right). Nuclear extracts from
18
Jianhai Jiang and Jianxin Gu
depleted CD133/Nestin-positive cells in glioma cell xenografts (Fig. 1.9A and C) and inhibited the self-renewal capacity and the tumorigenic potential of GICs isolated from glioma xenografts (Fig. 1.9B). The data provided new insights on the function and mechanism of b1,4GalT V in glioma process.
4. Conclusion and Future Direction Malignant gliomas are the most common primary brain tumor and one of the deadliest. Malignant gliomas exhibit a relentless malignant progression characterized by widespread invasion throughout the brain, resistance to traditional and newer targeted therapeutic approaches, destruction of normal brain tissue, and certain death (Fan et al., 2007; Fine, 2009; Giese and Westphal, 1996; Hambardzumyan et al., 2008; Stiles and Rowitch, 2008). Our results reveal that b1,4GalT V functioned as a positive growth regulator in glioma. Targeting b1,4GalT V expression or activity in glioma may be of clinical value. The characterization of b1,4GalT V as a novel target in glioma therapy is suggested by quantitative evidences. (a) The b1,4GalT V mRNA expression was correlated with glioma grade. (b) Reduction in the b1,4GalT V expression resulted in a decrease in colony number and glioma growth in vivo. (c) The suppression of b1,4GalT V expression inhibited cell cycle progression and reduced the expression of cyclin D1 and E2F1. (d) The impact of b1,4GalT V expression in glioma decreased the relative resistance SHG44 cells were incubated with 32P-labeled double-stranded oligonucleotides spanning the GC box and an Ets-binding site within the GalT V promoter in the presence or absence of control IgG or an antibody specific to Sp1 or E1AF. The unlabeled arrow indicates the DNA–protein antibody complex (right panel). (D) The same amounts of nuclear extracts from glioma tissues or normal brain tissues were incubated with biotinlabeled oligonucleotides as described before. Proteins bound to these nucleotides were isolated with streptavidin-agarose, and E1AF or Sp1 was detected by immunoblotting. PARP expression served as a loading control (upper panel). The same amounts of nuclear extracts from SHG44 cells transiently transfected with control or E1AF-myc plasmids incubated with biotin-labeled oligonucleotides. Proteins bound to these nucleotides were isolated with streptavidin-agarose, and E1AF, Sp1, or myc was detected using immunoblotting (lower panel). (E) (WCL panels) Whole-cell lysates from SHG44 cells transfected with control or E1AF expression vectors in the absence or presence of EtBr (50 mg/ml) were loaded onto an 8% denatured polyacrylamide gel, and E1AF and Sp1 protein levels were determined by Western blotting using anti-E1AF or anti-Sp1 antibody (Sp1-Ab). (IP panels) The results of Sp1 immunoprecipitation of the lysates of SHG44 cells transfected with control or E1AF expression vectors in the absence of EtBr or in the presence of EtBr (50 mg/ml) blotted with the indicated antibodies are shown (upper panel). Whole-cell lysates from SHG44 cells transfected with control or E1AF expression vectors labeled with 32PO4 for 2 h prior to harvesting and the levels of 32P labeling of Sp1 were determined (lower panel).
19
The Role of b1,4GalTV in Glioma Development
b-actin VP16
Relative luciferase activity
B
0.6 SHG44
60 40 20 0
0.4
E
80
Fold induction
C Apoptosis rate (%)
A GalT V
1.2
0.8
0.4
0 VP16 - +
Control HA-GalT V VP16 (200 µM)
WT
- + M(Sp1)
F 0.2
D E2F1 Sp1
0 VP16
GAPDH VP16
GnT V GalT V GAPDH GalT V b-actin As2O3
Figure 1.7 GalT V is regulated by chemotherapeutic drugs in glioma. (A) RT-PCR analysis of endogenous GalT V mRNA expression level in SHG44 cells in the absence or presence of VP16 for 4 h. The concentration of VP16 was 50, 100, or 200 mM. The levels of b-actin mRNA expression were assessed as loading controls. (B) SHG44 cells were transiently transfected with b1,4GalT V promoter construct pGL3 ( 200/þ120). At 24 h after transfection, cells were treated with vehicle or an increasing dose of VP16 for an additional 4 h. The luciferase activity values were standardized to those observed in nontreated samples. (C) Control or HA-GalT V-transfected SHG44 cells were treated with VP16 (200 mM) for 16 h. The apoptotic percentages were assayed by Hoechst 33258 staining. (D) SHG44 cells were treated for 4 h with indicated dose of VP16, and cell extracts were subjected to immunoblot analysis using an anti-Sp1 antibody. The anti-E2F1 antibody was used as a positive control. (E) SHG44 cells were transiently cotransfected with pGL3 ( 200/þ120) construct and control vector or Sp1-expressing vector. At 24 h after transfection, cells were treated with vehicle () or 100 mM VP16 (þ) for 4 h. Normalized luciferase activity was standardized to pGL3 ( 200/þ120) with control vector in untreated cells. (F) SHG44 cells were treated with As2O3 for 24 h and cell extracts were analyzed by Western blot with anti-GnT V, antiGalT V, and anti-GAPDH antibodies (upper panel). GalT V mRNA expression from SHG44 cells treated with the indicated concentrations of As2O3 for 24 h was analyzed by RT-PCR. The mRNA expression of b-actin served as loading controls (bottom panel).
to apoptosis induced by etoposide or X-ray. (e) Reduction in the b1,4GalT V expression decreased the AKT activity which has been inversely correlated with survival in patient glioma specimens. (f) Reduction in the b1,4GalT V expression impaired the self-renewal of GIC. These results indicate that decreasing the b1,4GalT V expression resulted in the changes in the intracellular prosurvival signaling pathways and decreased glioma cell
20
Jianhai Jiang and Jianxin Gu
A
C 5
GalT V
SHG44 pGL3(-200/+120)
EGF(ng/ml)
Fold induction
7.5
0
10
SHG44 pGL3(-200/+120)
5
Fold induction
b-actin
2.5
2.5 0 Control 0 Control
B
Lane
EGF D
5
0
3
JNK1 Gag-AKT 4
5
6
7
Control Ras DA Ras DN ERK1 JNK1 Gag-AKT
2.5
0 Control
2
SHG44
Fold induction
Fold induction
2.5
ERK1
5
Ras DA Ras DN SHG44 pGL3(-200/+120)
1
WT
M(Sp1)
Ras DA/Ras DN
Figure 1.8 The response of GalT V to EGF stimulation. (A) Serum-starved SHG44 cells were stimulated with the EGF (10 ng/ml) for 24 h. Relative GalT V mRNA expression levels were determined by RT-PCR analysis. Levels of b-actin mRNA expression were assessed as loading controls (upper panel). The GalT V promoter construct pGL3 (200/þ120) was transiently transfected into SHG44 cells. After transfection, cells were treated with the indicated concentration of EGF for 24 h. The luciferase activity was determined as described above. The values were presented as fold activation over those observed in 1% FBS-treated or nontreated samples (lower panel). (B) SHG44 cells were transiently cotransfected with pGL3 (200/þ120) and increasing amounts of plasmids expressing the constitutively active form of Ras (RasDA) or dominant negative form of Ras (Ras-DN) and the luciferase activity was determined as described above. (C) SHG44 cells were transiently cotransfected with pGL3 ( 200/þ120) and increasing amounts of ERK1, JNK1, or Gag-AKT constructs, and the luciferase activity was determined as described above. (D) The promoter constructs pGL3(200/þ120) (WT) or M (Sp1) were cotransfected into SHG44 cells with the plasmids expressing the constitutively active Ras (Ras-DA), dominant negative Ras (Ras-DN), ERK1, JNK1, or Gag-AKT. The luciferase activity was determined as described above.
21
The Role of b1,4GalTV in Glioma Development
A
B
Control
Control
GalT V shRNA
GalT V shRNA
CD133 100 CD133+ cell (%)
C
Nestin
0
8.6%
Control
0.21%
GalT V shRNA
Figure 1.9 Recent research on GalT V in glioma-initiating cell. (A) Sections from xenograft tissue formed by control- or GalT V shRNA-infected SHG44 were immunostained with anti-CD133 antibody (left panel) or anti-Nestin antibody (right panel). (B) Representative photographs of neurospheres formed by GICs from xenografts induced by control- or b1,4GalT V shRNA-infected SHG44 cells. (C) GICs from xenografts induced by control- or b1,4GalT V shRNA-infected SHG44 cells were incubated with anti-human CD133 antibody (AC133-1) followed by incubation with FITC-conjugated goat anti-mouse antibody. Analysis was performed using FACScan. The lines represented fluorescence of the secondary antibody alone. The mean fluorescence intensity of the indicated antibody staining done was given. Data are from representative experiments repeated at least three times.
invasion potential, suggesting that manipulating the expression of b1,4GalT V might have therapeutic potential for the treatment of glioma. Our findings also might provide some clinical significance in the killing of malignant glioma cells, as combined treatment with b1,4GalT V inhibitors and DNAdamaging agents will help to achieve more effective therapy with less toxicity by using a lower dose of cytotoxic drugs. In spite of that, the molecular mechanisms for b1,4GalT V-regulating glioma growth remain unknown. Our results indicate that an intact catalytic domain might be essential for b1,4GalT V tumorigenic function in glioma.
22
Jianhai Jiang and Jianxin Gu
The reduction in the expression level of the b1,4GalT V gene in SH-SY5Y cells resulted in the decreased galactosylation of highly branched N-glycans, indicating that b1,4GalT V might be involved in the galactosylation of highly branched N-glycans. However, the specific substrates of b1,4GalT V are not identified. This chapter has shown that b1,4GalT V performed a positive growth regulator in glioma and could represent a novel target in glioma therapy expand our understanding of the proteins involved in gliomagenesis. The molecular mechanism of b1,4GalT V-regulating glioma growth should be explored next.
ACKNOWLEDGMENTS This work was supported by Shanghai Rising-Star Program (08QA14013), Program for New Century Excellent Talents in University (NCET-08-0128), National Natural Scientific Foundation of China (30930025, 30900248, and 30870542), a Grant from the Development of Science and Technology of Shanghai (09ZR140340), Shanghai Educational Development Foundation (2007CG02), and Shanghai Leading Academic Discipline Project (B110).
REFERENCES Arato-Ohshima, T., and Sawa, H. (1999). Over-expression of cyclin D1 induces glioma invasion by increasing matrix metalloproteinase activity and cell motility. Int. J. Cancer 83, 387–392. Bacon, C. L., et al. (2002). Antiproliferative action of valproate is associated with aberrant expression and nuclear translocation of cyclin D3 during the C6 glioma G1 phase. J. Neurochem. 83, 12–19. Bergstrom, J. D., et al. (2000). Epidermal growth factor receptor signaling activates met in human anaplastic thyroid carcinoma cells. Exp. Cell Res. 259, 293–299. Chumsri, S., and Burger, A. M. (2008). Cancer stem cell targeted agents: Therapeutic approaches and consequences. Curr. Opin. Mol. Ther. 10, 323–333. Das, S., et al. (2008). Cancer stem cells and glioma. Nat. Clin. Pract. Neurol. 4, 427–435. Fan, Q. W., et al. (2006). A dual PI3 kinase/mTOR inhibitor reveals emergent efficacy in glioma. Cancer Cell 9, 341–349. Fan, X., et al. (2007). Glioma stem cells: Evidence and limitation. Semin. Cancer Biol. 17, 214–218. Fine, H. A. (2009). Glioma stem cells: Not all created equal. Cancer Cell 15, 247–249. Giese, A., and Westphal, M. (1996). Glioma invasion in the central nervous system. Neurosurgery 39, 235–250. (discussion 250–252). Guo, S., et al. (2001). Galactosylation of N-linked oligosaccharides by human beta-1, 4-galactosyltransferases I, II, III, IV, V, and VI expressed in Sf-9 cells. Glycobiology 11, 813–820. Hambardzumyan, D., et al. (2008). Glioma formation, cancer stem cells, and akt signaling. Stem Cell Rev. 4, 203–210. Jiang, J., et al. (2006). beta1, 4-galactosyltransferase V functions as a positive growth regulator in glioma. J. Biol. Chem. 281, 9482–9489.
The Role of b1,4GalTV in Glioma Development
23
Jiang, J., et al. (2007). Functional interaction of E1AF and Sp1 in glioma invasion. Mol. Cell. Biol. 27, 8770–8782. Kurose, K., et al. (2001). Frequent loss of PTEN expression is linked to elevated phosphorylated Akt levels, but not associated with p27 and cyclin D1 expression, in primary epithelial ovarian carcinomas. Am. J. Pathol. 158, 2097–2106. Nagane, M., et al. (1999). Expression pattern of chemoresistance-related genes in human malignant brain tumors: A working knowledge for proper selection of anticancer drugs. Jpn. J. Clin. Oncol. 29, 527–534. Park, C. Y., et al. (2009). Cancer stem cell-directed therapies: Recent data from the laboratory and clinic. Mol. Ther. 17, 219–230. Sato, T., and Furukawa, K. (2004). Transcriptional regulation of the human beta-1, 4-galactosyltransferase V gene in cancer cells: Essential role of transcription factor Sp1. J. Biol. Chem. 279, 39574–39583. Sato, T., and Furukawa, K. (2007). Sequential action of Ets-1 and Sp1 in the activation of the human beta-1, 4-galactosyltransferase V gene involved in abnormal glycosylation characteristic of cancer cells. J. Biol. Chem. 282, 27702–27712. Sato, T., et al. (1998). Molecular cloning of a human cDNA encoding beta-1, 4-galactosyltransferase with 37% identity to mammalian UDP-Gal:GlcNAc beta-1, 4-galactosyltransferase. Proc. Natl. Acad. Sci. USA 95, 472–477. Sato, T., et al. (2000). Correlated gene expression between beta-1, 4-galactosyltransferase V and N-acetylglucosaminyltransferase V in human cancer cell lines. Biochem. Biophys. Res. Commun. 276, 1019–1023. Sato, T., et al. (2001). Occurrence of poly-N-acetyllactosamine synthesis in Sf-9 cells upon transfection of individual human beta-1, 4-galactosyltransferase I, II, III, IV, V and VI cDNAs. Biochimie 83, 719–725. Sharrocks, A. D. (2001). The ETS-domain transcription factor family. Nat. Rev. Mol. Cell Biol. 2, 827–837. Shi, Q., et al. (2004). Secreted protein acidic, rich in cysteine (SPARC), mediates cellular survival of gliomas through AKT activation. J. Biol. Chem. 279, 52200–52209. Shirane, K., et al. (1999). Involvement of beta-1, 4-galactosyltransferase V in malignant transformation-associated changes in glycosylation. Biochem. Biophys. Res. Commun. 265, 434–438. Stiles, C. D., and Rowitch, D. H. (2008). Glioma stem cells: A midterm exam. Neuron 58, 832–846. Xu, S., et al. (2001). Over-expression of beta-1, 4-galactosyltransferase I, II, and V in human astrocytoma. J. Cancer Res. Clin. Oncol. 127, 502–506. Zheng, X. L., et al. (2001). Epidermal growth factor induction of apolipoprotein A-I is mediated by the Ras-MAP kinase cascade and Sp1. J. Biol. Chem. 276, 13822–13829.
C H A P T E R
T W O
Roles of Polysialic Acid in Migration and Differentiation of Neural Stem Cells Kiyohiko Angata and Minoru Fukuda Contents 26 27 28 28 29 30 33 34 34
1. Overview 1.1. Polysialic acid-deficient mice 1.2. Neurosphere cell culture 1.3. Method for preparation of neurosphere cells 1.4. In vitro migration assay 1.5. In vitro differentiation assay 1.6. Lentivirus generation Acknowledgments References
Abstract Polysialic acid, a homopolymer of a2,8-linked sialic acid, is one of the carbohydrates expressed on neural precursors in the embryonic and adult brain. Polysialic acid, synthesized by two polysialyltransferases (ST8SiaII and ST8SiaIV), mainly modulates functions of the neural cell adhesion molecule (NCAM). Polysialic acid-deficient mice demonstrated that polysialylated NCAM plays crucial roles in various steps of neural development, such as cell survival and cell migration of neural precursors, neuronal guidance, and synapse formation. However, the mechanisms of the diverse phenotypes and molecules affected by polysialic acid remain to be defined. To study the roles of polysialic acid on neural stem cells, analyses of neural stem cells from polysialic acid-deficient and NCAM-deficient mice are useful. Here, we describe how to prepare neural precursor cells from mouse brain and how to analyze migration and differentiation of neurosphere cells in vitro.
Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79002-9
#
2010 Elsevier Inc. All rights reserved.
25
26
Kiyohiko Angata and Minoru Fukuda
1. Overview New neurons are extensively generated in the embryonic brain, while they are born in limited areas of adult brains, mainly in the subventricular zone (SVZ) of the lateral ventricle and the subgranular zone (SGZ) in the hippocampus (Merkle and Alvarez-Buylla, 2006; Ming and Song, 2005; Zhao et al., 2008). Many carbohydrates are expressed on the neural stem cell surface and are involved in diverse functions such as cell–cell interaction and modification of cellular signaling (Angata and Fukuda, 2005; Kleene and Schachner, 2004; Matani et al., 2007; Yanagisawa and Yu, 2007). Among functional glycans, polysialic acid, a homopolymer of a2,8-linked sialic acid, is a unique posttranslational modification of the neural cell adhesion molecule (NCAM). Polysialylated NCAM (PSA-NCAM) is highly expressed in the brain during embryonic and neonatal stages, and its expression is significantly reduced in the adult brain (Bonfanti, 2006; Seki and Arai, 1993). In fact, newly generated migrating neurons express polysialic acid in the brain, thus its expression associated with neurogenesis is affected by alcohol, drug, learning, injury, and diseases (Bonfanti, 2006; Brennaman and Maness, 2010; Gascon et al., 2010; Kahn et al., 2005; Zharkovsky et al., 2003). On the other hand, aging results in decreased neuronal proliferation, and the number of polysialic acid-positive cells in dentate gyrus decreases during aging (Kuhn et al., 1996; Seki and Arai, 1995). Lack of polysialic acid in mice causes early postnatal death, which is different from the phenotypes of NCAM-deficient mice (Angata et al., 2007; Weinhold et al., 2005). Polysialic acid-deficient mice exhibited massive apoptotic neural cell death and disturbed radial and tangential neuron migration in vivo (Angata et al., 2007). Recent studies demonstrated that polysialic acid expression induced by virus infection can promote neural cell migration and increase the number of neurons in damaged brain and spinal cord (El Maarouf et al., 2006; Papastefanaki et al., 2007; Rutishauser, 2008; Zhang et al., 2007). Polysialic acid expression on embryonic stem cell-derived glial cells promoted directional migration towards guidance molecules in vitro and in vivo (Glaser et al., 2007). It has also been shown that polysialic acid delays or inhibits glial cell differentiation (Charles et al., 2000; Decker et al., 2002; Fewou et al., 2007; Franceschini et al., 2004). Indeed, loss of polysialic acid promotes glial differentiation in response to platelet-derived growth factor (PDGF; Angata et al., 2007). These results suggest that polysialic acid on the cell surface of neural precursors plays a critical role in the determination of the neural cell fate. To further investigate the function of polysialic acid on neural stem cells, in vitro analysis using neurosphere cells is useful since polysialic acid-deficient mice die in the early postnatal period (Angata et al., 2007). In this chapter, we first describe a method for in vitro culture of neurosphere cells, free-floating spherical clusters generated by neural stem cells. Then, we introduce in vitro migration assay and differentiation assay using neurosphere cells.
27
Polysialic Acid on Neural Stem Cells
A
I
B
C
II-III H
V VI
SVZ DG E
D
F
CC SVZ
LV LV
Figure 2.1 Expression of polysialic acid on neural precursors. (A) Polysialic acid (red) is expressed on neurons in the cortex. Cortical cell layers (I, II, III, V, and VI) are identified by Hoechst staining. (B) Neuroblasts in the neonatal brain highly express polysialic acid (red). (C) In the adult hippocampus, innermost granule cells and axons forming mossy fibers express polysialic acid (red). YFP (green) is expressed under the control of Thy1 promoter, and nuclei are shown by Hoechst staining (blue). (D–F) Neuroblasts in the adult SVZ (D and E) express polysialic acid (red) and move into the RMS (F). Migrating neuroblasts from SVZ to RMS are shown by arrows in (E). CC, corpus callosum; DG, dentate gyrus; H, hilus; LV, lateral ventricle. Scale bars, 0.1 mm. (Partly adapted from Angata et al., 2007)
1.1. Polysialic acid-deficient mice As shown in Fig. 2.1, polysialic acid is found in wide areas, including the striatum and cerebral cortex in early brain development. In adult hippocampus, polysialic acid is expressed on migrating granule cells and axons forming mossy fibers. Polysialic acid is also expressed on neuroblast cells migrating from the SVZ to the olfactory bulb, which is a part of the rostral migratory stream (RMS). Key molecules for polysialic acid expression in the brain are polysialyltransferases, ST8SiaII and ST8SiaIV, and NCAM (Angata and Fukuda, 2003; Hildebrandt et al., 2010). Polysialic acid-deficient mice, but expressing NCAM, are obtained by crossing ST8SiaII-knockout line and ST8SiaIV-knockout line (Angata et al., 2004, 2007; Eckhardt et al., 2000; Weinhold et al., 2005). On the other hand, NCAM-deficient mice also lack a majority of polysialic acid because NCAM is a primary acceptor of polysialic acid (Cremer et al., 1994; Tomasiewicz et al., 1993). NCAMdeficient mice are available from Jackson Laboratory. All animal usage must be in accordance with NIH guidelines and prior institutional approval is required.
28
Kiyohiko Angata and Minoru Fukuda
1.2. Neurosphere cell culture Neural stem cells are the self-renewing and multipotent cells that generate neurons and glial cells in the embryonic and adult brain. To study neural stem cells in vitro, a neurosphere cell culture system is convenient, suitable to compare the nature of neural stem cells obtained from knockout mice, and easy to apply screening for effectors or drugs (Ahmed, 2009; Gage et al., 1995; Geschwind et al., 2001; Reynolds and Weiss, 1992). To obtain neural stem cells, late embryonic to neonatal brains [embryonic day 14 (E14) to postnatal day 0 (P0)] are used because there are enriched neural stem cells with fewer contamination of fully differentiated neurons and glial cells in this developmental period.
1.3. Method for preparation of neurosphere cells 1. Heterozygous male and female mice are set up for timed-mating and mating plugs should be checked in the morning to determine the embryonic day and delivery date. When neurosphere cells are prepared from embryos, the pregnant mouse is deeply anesthetized with CO2 gas and embryos are taken out from the uterus to avoid contamination from the mother mouse. A tail biopsy from each embryo or pup is collected for genotyping by PCR. 2. Brain is removed and placed in cold L15 medium (Invitrogen). Under a dissecting microscope, the left and right semisphere of cerebral cortex is opened at midline to cut out striata (ganglionic eminences). Meninges and visible blood vessels are carefully removed from the section. The striata are mechanically dissociated by a polished Pasteur pipette. 3. The dissociated cells are incubated in a standing tube containing DME: F-12/B27 medium (Invitrogen) for 5 min to precipitate nondissociated cells. The single dissociated cells are cultured in DME:F-12/B27 medium (Invitrogen) supplemented with 20 ng/ml FGF2 and 20 ng/ml EGF (Sigma) as mitogens and antibiotics in a tissue culture flask. When the dissociated cells of each mouse are plated on the tissue culture slides or 24-well plate, cells can be stained with antibodies against polysialic acid to confirm genotypes as described (Angata et al., 2006). 4. The FGF2 and EGF are added into culture medium every other day. At the sixth or seventh day in vitro (DIV), the floating neurosphere cells are precipitated and dissociated by pipetting, as described above. This step is repeated until neurosphere cells are used for in vitro assays. As shown in Fig. 2.2, neurosphere cells grow as floating clusters of cells expressing nestin, an intermediate filament protein and one of the neural stem cell markers. Differentiated cells and other contaminated cells adhere to the bottom of the tissue culture flask so that collecting neurosphere cells is
29
Polysialic Acid on Neural Stem Cells
A
B
C
D
E
F LN
*
+PEI
* 200 400 Migration (mm/2 days)
Figure 2.2 Neurosphere cells prepared from mouse embryonic brain. Dissociated strata cells were cultured in DME:F-12/B27 medium with mitogens. Neurosphere cells present as nonadherent spherical clusters of cells. Neurospheres on the second day (A) and the fifth day (B) after passage are shown. (C) Neurosphere cells adhering on cover glasses coated with polyethylenimine (PEI) and laminin (LN) express a neural stem cell marker, nestin (green). Neurosphere cells were cultured for 2 days in 12-well plates coated with LN alone or plus PEI in Neurobasal/B27 medium without mitogens. After fixing, phase images (D) or Hoechst staining (E) of neurospheres were captured to measure the length of migration. The distance between edge of the clusters and migrated cells are measured as shown by lines in D and E. (F) Neurosphere cells from polysialic acid-deficient mice (black bars) migrated shorter than wild-type cells (white bars). Error bars, SEM; *, p < 0.001. Scale bars, 0.1 mm. (Partly adapted from Angata et al., 2007)
easy for following in vitro assays. Generally, when neurospheres grow too much, they lose neural stem cells and have more differentiated cells after passage. Thus, addition of mitogens and periodical passage are important for continuous neurosphere culture.
1.4. In vitro migration assay Neuroblast cells, which express polysialic acid, migrate from the SVZ to the olfactory bulb and form RMS as shown in Fig. 2.1. Since NCAM-deficient mice develop a smaller olfactory bulb and thicker RMS (Chazal et al., 2000; Cremer et al., 1994; Hu et al., 1996; Tomasiewicz et al., 1993), one of suggested roles of polysialic acid is to promote chain migration of neuronal precursors. To investigate if polysialic acid on neural precursors is important for neural cell migration, in vitro migration assay using neurosphere cells is useful because this system can avoid the effects of the microenvironment surrounding neuronal precursors.
30
Kiyohiko Angata and Minoru Fukuda
1. Twelve-well plates are coated with 0.01% polyethylenimine (PEI; Sigma) in 0.15 M sodium borate, pH 8.4, for 2 h. Wash the wells with DDW twice then once with PBS. The plates are also coated with mouse laminin 5 mg/ ml in PBS for 2 h at 37 C. Wash the wells with PBS four times. 2. Neurospheres on the second or third day after the passage are plated into the well containing 500 ml Neurobasal medium supplemented with B27 (Invitrogen), glutamine, and antibiotics. 3. After 48 h, cells are fixed by 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The distance between the migrated cell and the edge of aggregated neurosphere cells (500 cells, 25 cells from each of 20 neurospheres) is measured and the significance is analyzed statistically. When cells are stained with Hoechst or DAPI, the distance between nuclei of migrated cells and nuclei of original clusters can be measured (Fig. 2.2). Additional staining with neuronal or glial markers allows to compare cell type-specific migration. We prepared neurosphere cells from embryos of wild-type and polysialic acid-deficient mice for an in vitro migration assay. To reduce the effect of contamination, such as fibroblasts or endothelial cells, from the primary culture, the neurosphere cells after two passages were used for in vitro migration assay. Cells from polysialic acid-deficient mice migrated 8–15% shorter than those from wild-type mice when plated on laminin, demonstrating that polysialic acid itself promotes neural cell migration (Fig. 2.2).
1.5. In vitro differentiation assay One of the most important characteristics of neural stem cells is multipotency to differentiate into neurons or glial cells. Cultured neurosphere cells are able to differentiate into neuronal or glial lineages after removing mitogens such as FGF2 and EGF (Fig. 2.3). In polysialic acid-deficient mice, GFAP-positive astrocyte-like cells are not well spread but are often found as clusters near the SVZ compared to wild-type mice. This result suggested that polysialic acid is required for either migration or differentiation of glial cells. Thus, it is important to assess the role of polysialic acid in differentiation by in vitro differentiation assay using neurosphere cells. 1. Twelve-well plates or cover glasses are coated with 0.01% PEI and 5 mg/ ml laminin as described above. Cover glasses need to be lifted up and washed on both sides by soaking in PBS. 2. Neurospheres are cultured in the well containing Neurobasal/B27 medium without mitogens as described above. BDNF (40 ng/ml, Invitrogen), CNTF (50 ng/ml, Sigma), or PDGF-AA (10 ng/ml, ICN), known as inducer molecules for neurons, astrocytes, or oligodendrocytes, respectively, can be added to the medium to evaluate the effect of cell surface carbohydrates on differentiation.
31
Polysialic Acid on Neural Stem Cells
A
B
C
D
E
F
G
H
I
* * * Figure 2.3 Differentiation of neurosphere cells. Neurosphere cells were plated on cover glasses and cultured in Neurobasal/B27 medium without mitogens to induce differentiation. Neurosphere cells were stained with neural stem cell marker nestin (green) after 1 day (1 DIV, A), 3 days, (3 DIV, B) or 7 days (7 DIV, C). Polysialic acid (red) is expressed during differentiation of neurosphere cells on 1 DIV (D), 3 DIV (E), and 7 DIV (F). Oligodendrocytes (marked with asterisks) expressing CNPase (green) are in 7 DIV culture (G). Neurosphere cells mainly differentiate into neurons and astrocytes. Neurons expressing b-III tubulin (red) and astrocytes expressing GFAP (green) are found in 3 DIV (H) and 7 DIV (I). Nestin expression decreases, and polysialic acid expression also decreases while it remains in neurons. GFAP expression increases during maturation of astrocytes. Scale bar, 0.1 mm.
3. Cells are fixed at various days for in vitro culture and subjected to staining for neural cell markers. Fixed cells are treated with 0.25% Triton-X 100 for 10 min and blocked with 1% normal goat serum. Markers for neural stem cells (nestin), neurons (b-III tubulin), astrocytes (GFAP), and oligodendrocytes (CNPase) are used to judge differentiation (Fig. 2.3). As shown in Fig. 2.4, neurosphere cells highly express nestin when they start differentiation, while nestin expression decreases, and the morphology of nestin-positive cells changes during culture. Polysialic acid also decreases, but remains in neurons. On the other hand, the expression of neuron marker and astrocyte marker increases as neurons and astrocytes mature. Since oligodendrocyte marker-positive cells are fewer than neurons and astrocytes in early differentiation, neurons and astrocytes are used for comparative analysis.
32
Kiyohiko Angata and Minoru Fukuda
A
B
C
D
E
*
GFAP-positive cells (%)
50
**
Control +PDGF Control +PDGF WT
PSA-KO
NCAM-KO
Figure 2.4 Polysialic acid inhibits differentiation of glial cells. Differentiated neurosphere cells were fixed and stained for markers of astrocytes (GFAP, green in A and B) and neurons (b-III tubulin, red in C and D). An example of fewer glial cells from the same neurosphere (A and C), and another example of more glial cells from one neruosphere (B and D) are shown. (E) Neurosphere cells prepared from wild-type, polysialic acid-deficient mice and NCAM-deficient mice were subjected to in vitro differentiation. PDGF was added to culture to assess its effect on the differentiation of neurosphere cells without polysialic acid. The proportion of astrocytes in the total number of differentiated cells is shown (four each neurosphere clone for polysialic acid-deficient mice and two each clone for NCAM-deficient mice). Error bars, S.D.; *p < 0.005; **p < 0.01. Scale bar, 0.1 mm. Partly adapted from Angata et al. (2007).
When neurosphere cells derived from polysialic acid-deficient mice were differentiated, the ratio of GFAP-positive cells to totally differentiated cells was comparable to that of neurosphere cells from wild-type mice (Fig. 2.4). However, loss of polysialic acid significantly increased GFAPexpressing cells over b-III tubulin expressers in the presence of PDGF compared to wild-type neurosphere cells. PDGF-induced glial cell differentiation of neurosphere cells from NCAM-deficient mice, which also lack PSA-NCAM, was also increased in contrast to wild-type control. These results indicate that polysialic acid rather than NCAM inhibits glial cell differentiation.
33
Polysialic Acid on Neural Stem Cells
1.6. Lentivirus generation Expressing exogenous cDNA in neurosphere cells will be a useful technique in studying the functions of carbohydrates, in addition to using of neurosphere cells derived mutant mice as described above. However, transfection of floating neurosphere cells needs to be carried out. In this purpose, virus systems including adenovirus, adeno-associated virus, retrovirus, and lentivirus are used (Franceschini et al., 2004; Waehler et al., 2007). We use lentivirus generated from pGIPz transfer vector (OpenBiosystems; Fig. 2.5). Currently, the second generation and third generation systems, which require a different set of transfer vectors and packaging vectors, are used to generate lentivirus. Lentivirus is generated by cotransfection of vectors and concentrated to increase titer. Aliquots should be kept frozen in 80 C until use. The next day after dissociation, lentivirus is added into
A SIN18.hPGK-GFP LTR
RRE
pPGK
SIN18.hPGKLTR mCherry
RRE
pPGK mCherry WPRE LTR
pGIPz/PG LTR
pCMV
PST•GFP
B
C
D
E
GFP
WPRE LTR
IRES PuroR WPRE LTR
Figure 2.5 Generation of lentivirus to express polysialic acid. (A) Schemes of core structure of transfer vectors (SIN18.hPGK-GFP, SIN18.hPGK-mCherry, and pGIPz/ PG) are shown. GFP and mCherry are expressed under PGK promoter in SIN18 vectors, while cDNA encoding a GFP fusion with human ST8SiaIV (PSTGFP) is expressed under CMV promoter in pGIPz/PG transfer vector. PuroR, Puromycinresistant gene. Pink boxes are sequence elements required for expression by lentivirus. GFP labels whole COS-I cells (B), but PSTGFP is localized in Golgi of COS-I cells (C). Infection with lentivirus-PSTGFP induce polysialic acid expression (red) in (C). GFP is stably expressed in neurosphere cells (D) and differentiated cells of neurospheres (E) after infection with lentivirus-GFP. Scale bar, 0.1 mm.
34
Kiyohiko Angata and Minoru Fukuda
a culture medium overnight, and the medium is changed for further culture. Polybrene at 4 mg/ml (Millipore) can be added for infection into some cells to increase transduction efficiency. Puromycin is added to select stable neurosphere cells, which integrate lentivirus-derived sequences into its genomic DNA and are used for in vitro assays described above. Figure 2.5 shows neurosphere cells efficiently transfected by lentivirus expressing GFP. Neurosphere cells have been useful in vitro models of neural stem cells. Migrating neuroblasts and neurosphere cells express polysialic acid as shown, indicating that neurosphere cells derived from polysialic acid-deficient mice are suitable to study roles of polysialic acid on neural stem cells. In fact, the important roles of polysialic acid on migration and differentiation of neurons and glial cells were recapitulated by in vitro assays. Further studies using neurosphere cells will allow us to study mechanisms of polysialic aciddependent migration and/or differentiation. For instance, analyzing the effects of guidance molecules using in vitro migration assay will identify molecule(s) interacting polysialic acid or NCAM and reveal the molecular mechanism required for neural stem cell migration. Neurosphere cells prepared from glycosyltransferase knockout mice will be good resources to study the roles of carbohydrates on neural stem cells and to screen functional molecules, which affect cell fates of neural stem cells.
ACKNOWLEDGMENTS Authors thank generous supports and technical assistances from Dr. Terskikh’s laboratory, Animal Facility, and Lentiviral Core at Sanford-Burnham Medical Research Institute. This work was supported by NIH grant CA33895.
REFERENCES Ahmed, S. (2009). The culture of neural stem cells. J. Cell. Biochem. 106, 1–6. Angata, K., and Fukuda, M. (2003). Polysialyltransferases: Major players in polysialic acid synthesis on the neural cell adhesion molecule. Biochimie 85, 195–206. Angata, K., and Fukuda, M. (2005). Carbohydrates of neural cell glycoproteins: Structure, biosynthesis and function. In ‘‘Neuroglycobiology,’’ (M. Fukuda, U. Rutishauser, and R. L. Schnaar, eds.), pp. 1–38. Oxford Univ. Press, London. Angata, K., Long, J. M., Bukalo, O., Lee, W., Dityatev, A., Wynshaw-Boris, A., Schachner, M., Fukuda, M., and Marth, J. D. (2004). Sialyltransferase ST8Sia-II assembles a subset of polysialic acid that directs hippocampal axonal targeting and promotes fear behavior. J. Biol. Chem. 279, 32603–32613. Angata, K., Lee, W., Mitoma, J., Marth, J. D., and Fukuda, M. (2006). Cellular and molecular analysis of neural development of glycosyltransferase gene knockout mice. Methods Enzymol. 417, 25–37. Angata, K., Huckaby, V., Ranscht, B., Terskikh, A., Marth, J. D., and Fukuda, M. (2007). Polysialic acid-directed migration and differentiation of neural precursors are essential for mouse brain development. Mol. Cell. Biol. 27, 6659–6668.
Polysialic Acid on Neural Stem Cells
35
Bonfanti, L. (2006). PSA-NCAM in mammalian structural plasticity and neurogenesis. Prog. Neurobiol. 80, 129–164. Brennaman, L. H., and Maness, P. F. (2010). NCAM in neuropsychiatric and neurodegenerative disorders. Adv. Exp. Med. Biol. 663, 299–317. Charles, P., Hernandez, M. P., Stankoff, B., Aigrot, M. S., Colin, C., Rougon, G., Zalc, B., and Lubetzki, C. (2000). Negative regulation of central nervous system myelination by polysialylated-neural cell adhesion molecule. Proc. Natl. Acad. Sci. USA 97, 7585–7590. Chazal, G., Durbec, P., Jankovski, A., Rougon, G., and Cremer, H. (2000). Consequences of neural cell adhesion molecule deficiency on cell migration in the rostral migratory stream of the mouse. J. Neurosci. 20, 1446–1457. Cremer, H., Lange, R., Christoph, A., Plomann, M., Vopper, G., Roes, J., Brown, R., Baldwin, S., Kraemer, P., Scheff, S., Barthels, D., Rajewsky, K., et al. (1994). Inactivation of the N-CAM gene in mice results in size reduction of the olfactory bulb and deficits in spatial learning. Nature 367, 455–459. Decker, L., Durbec, P., Rougon, G., and Evercooren, A. B. (2002). Loss of polysialic residues accelerates CNS neural precursor differentiation in pathological conditions. Mol. Cell. Neurosci. 19, 225–238. Eckhardt, M., Bukalo, O., Chazal, G., Wang, L., Goridis, C., Schachner, M., GerardySchahn, R., Cremer, H., and Dityatev, A. (2000). Mice deficient in the polysialyltransferase ST8SiaIV/PST-1 allow discrimination of the roles of neural cell adhesion molecule protein and polysialic acid in neural development and synaptic plasticity. J. Neurosci. 20, 5234–5244. El Maarouf, A., Petridis, A. K., and Rutishauser, U. (2006). Use of polysialic acid in repair of the central nervous system. Proc. Natl. Acad. Sci. USA 103, 16989–16994. Fewou, S. N., Ramakrishnan, H., Bu¨ssow, H., Gieselmann, V., and Eckhardt, M. (2007). Down-regulation of polysialic acid is required for efficient myelin formation. J. Biol. Chem. 282, 16700–16711. Franceschini, I., Vitry, S., Padilla, F., Casanova, P., Tham, T. N., Fukuda, M., Rougon, G., Durbec, P., and Dubois-Dalcq, M. (2004). Migrating and myelinating potential of neural precursors engineered to overexpress PSA-NCAM. Mol. Cell. Neurosci. 27, 151–162. Gage, F. H., Coates, P. W., Palmer, T. D., Kuhn, H. G., Fisher, L. J., Suhonen, J. O., Peterson, D. A., Suhr, S. T., and Ray, J. (1995). Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc. Natl. Acad. Sci. USA 92, 11879–11883. Gascon, E., Vutskits, L., and Kiss, J. Z. (2010). The role of PSA-NCAM in adult neurogenesis. Adv. Exp. Med. Biol. 663, 127–136. Geschwind, D. H., Ou, J., Easterday, M. C., Dougherty, J. D., Jackson, R. L., Chen, Z., Antoine, H., Terskikh, A., Weissman, I. L., Nelson, S. F., and Kornblum, H. I. (2001). A genetic analysis of neural progenitor differentiation. Neuron 29, 325–339. Glaser, T., Brose, C., Franceschini, I., Hamann, K., Smorodchenko, A., Zipp, F., DuboisDalcq, M., and Bru¨stle, O. (2007). Neural cell adhesion molecule polysialylation enhances the sensitivity of embryonic stem cell-derived neural precursors to migration guidance cues. Stem Cells 25, 3016–3025. Hildebrandt, H., Mu¨hlenhoff, M., and Gerardy-Schahn, R. (2010). Polysialylation of NCAM. Adv. Exp. Med. Biol. 663, 95–109. Hu, H., Tomasiewicz, H., Magnuson, T., and Rutishauser, U. (1996). The role of polysialic acid in migration of olfactory bulb interneuron precursors in the subventricular zone. Neuron 16, 735–743. Kahn, L., Alonso, G., Normand, E., and Manzoni, O. J. (2005). Eur. J. Neurosci. 21, 493–500. Kleene, R., and Schachner, M. (2004). Glycans and neural cell interactions. Nat. Rev. Neurosci. 5, 195–208.
36
Kiyohiko Angata and Minoru Fukuda
Kuhn, H. G., Dickinson-Anson, H., and Gage, F. H. (1996). Neurogenesis in the dentate gyrus of the adult rat: Age-related decrease of neuronal progenitor proliferation. J. Neurosci. 16, 2027–2033. Matani, P., Sharrow, M., and Tiemeyer, M. (2007). Ligand, modulatory, and co-receptor functions of neural glycans. Front. Biosci. 12, 3852–3879. Merkle, F. T., and Alvarez-Buylla, A. (2006). Neural stem cells in mammalian development. Curr. Opin. Cell Biol. 18, 704–709. Ming, G. L., and Song, H. (2005). Adult neurogenesis in the mammalian central nervous system. Annu. Rev. Neurosci. 28, 223–250. Papastefanaki, F., Chen, J., Lavdas, A. A., Thomaidou, D., Schachner, M., and Matsas, R. (2007). Grafts of Schwann cells engineered to express PSA-NCAM promote functional recovery after spinal cord injury. Brain 130, 2159–2174. Reynolds, B. A., and Weiss, S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255, 1707–1710. Rutishauser, U. (2008). Polysialic acid in the plasticity of the developing and adult vertebrate nervous system. Nat. Rev. Neurosci. 9, 26–35. Seki, T., and Arai, Y. (1993). Distribution and possible roles of the highly polysialylated neural cell adhesion molecule (NCAM-H) in the developing and adult central nervous system. Neurosci. Res. 17, 265–290. Seki, T., and Arai, Y. (1995). Age-related production of new granule cells in the adult dentate gyrus. NeuroReport 6, 2479–2482. Tomasiewicz, H., Ono, K., Yee, D., Thompson, C., Goridis, C., Rutishauser, U., and Magnuson, T. (1993). Genetic deletion of a neural cell adhesion molecule variant (N-CAM-180) produces distinct defects in the central nervous system. Neuron 11, 1163–1174. Waehler, R., Russell, S. J., and Curiel, D. T. (2007). Engineering targeted viral vectors for gene therapy. Nat. Rev. Genet. 8, 573–587. Weinhold, B., Seidenfaden, R., Rockle, I., Muhlenhoff, M., Schertzinge, F., Conzelmann, S., Marth, J. D., Gerardy-Schahn, R., and Hildebrandt, H. (2005). Genetic ablation of polysialic acid causes severe neurodevelopmental defects rescued by deletion of the neural cell adhesion molecule. J. Biol. Chem. 280, 42971–42977. Yanagisawa, M., and Yu, R. K. (2007). The expression and functions of glycoconjugates in neural stem cells. Glycobiology 17, 57R–74R. Zhang, Y., Ghadiri-Sani, M., Zhang, X., Richardson, P. M., Yeh, J., and Bo, X. (2007). Induced expression of polysialic acid in the spinal cord promotes regeneration of sensory axons. Mol. Cell. Neurosci. 35, 109–119. Zhao, C., Deng, W., and Gage, F. H. (2008). Mechanisms and functional implications of adult neurogenesis. Cell 132, 645–660. Zharkovsky, T., Kaasik, A., Jaako, K., and Zharkovsky, A. (2003). Neurodegeneration and production of the new cells in the dentate gyrus of juvenile rat hippocampus after a single administration of ethanol. Brain Res. 978, 115–123.
C H A P T E R
T H R E E
Structural and Functional Analysis of Chondroitin Sulfate Proteoglycans in the Neural Stem Cell Niche Swetlana Sirko,* Kaoru Akita,† Alexander Von Holst,‡ and Andreas Faissner‡ Contents 1. Overview 2. Immunohistochemistry of Embryonic and Postnatal Mouse Brain Sections 3. Method to Stain Embryonic Sections for NSPC Markers 4. Analysis of the Adult Neurogenic Niche and SVZ-Derived Cells by Immunocytochemistry 4.1. Method to cultivate NSPCs from adult neurogenic niches 5. Immunocytochemistry of Acutely Dissociated Cells 5.1. Method for immuncytochemistry performed on neural cell monolayers 6. Isolation of NSPCs by Immunopanning or by Immunoisolation Using Paramagnetic Beads (EasySep) 6.1. Method for immunopanning of NSPCs with MAb 473HD 6.2. Method for preparing 473HD-positive cells applying magnetic beads 7. Neurosphere Cultures and Various Methods for Their Analysis 7.1. Method for cultivating NSPCs as neurospheres 7.2. Method to perform a differentiation assay with neurospheres 7.3. Method for the sectioning of neurospheres and immunohistochemistry 7.4. Method for immunoblot analysis of neurospheres for biochemical analysis 7.5. Method for the partial purification and identification of CSPGs from the conditioned neurosphere culture medium
39 42 43 44 44 46 46 47 48 49 49 50 50 52 52 53
* Department of Physiological Genomics, Ludwig-Maximilians-University Munich, Germany Department of Molecular Biosciences, Kyoto Sangyo University, Kyoto, Japan Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany
{ {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79003-0
#
2010 Elsevier Inc. All rights reserved.
37
38
Swetlana Sirko et al.
8. Disaccharide Analysis of CS/DS Chains from Embryonic Brain and Conditioned Neurosphere Culture Media and Effect of Sodium Chlorate Treatment on Neurosphere Formation at Clonal Cell Density 8.1. Method for the suppression of sulfation in NSPC cultures 9. Analysis of NSPC-Proliferation In Vitro and In Vivo 9.1. BrdU-pulse labeling of neurospheres in vitro 9.2. Method for the BrdU labeling of NSPCs in vivo 10. Analysis of CSPG Functions in NSPCs Using Chondroitinase ABC Treatment in Culture 10.1. Method for the treatment of neurosphere cultures with ChABC 11. Analysis of Chondroitin Sulfate Functions in the Neural Stem Cell Niche 11.1. Method for intracerebroventricular injections in utero 12. RT-PCR and Semiquantitative Analysis of the Synthetic Machinery for Glycosaminoglycans 12.1. Method for the amplification of distinct sulfotransferases using RT-PCR 13. In Situ Hybridization of Sulfotransferases in Tissue and Neurosphere Sections 13.1. Method for the in situ hybridization of sulfotransferase mRNA 14. Microscopy 15. Conclusion and Outlook Acknowlegments References
55 55 56 56 56 56 57 58 58 59 61 63 63 66 66 66 66
Abstract The stem cell niche plays an important role for the maintenance and differentiation of neural stem/progenitor cells (NSPCs). It is composed of distinct cell types that influence NSCPs by the release of paracrine factors, and a specialized extracellular matrix that structures the NSPC environment. During the past years, several components of the neural stem cell (NSC) niche could be deciphered on the molecular level. One prominent constituent is the tenascin-C (Tnc) glycoprotein and its isoforms that intervene in NSPC proliferation and differentiation. Distinct chondroitin sulfate proteoglycans (CSPGs) associate with Tnc in the niche territory and we could show that these have functional connotations in the stem cell compartment in their own rights. In this chapter, we give an account of the tools and methods we developed to unravel the structures and functions of CSPGs in the NSC niche.
CSPGs in the Neural Stem Cell Niche
39
Abbreviations ACSF BLBP C/D-STs ChABC Cor CNS CS-GAGs CSPGs CS/DS DIG Div ECM EGF ES-cells FGF-2 FACS FCS GE HBSS HSPGs ICVI GAGs NSC NSPCs PAPS RPTP RT SDS-PAGE SGZ SVZ
artificial cerebrospinal fluid brain lipid-binding protein chondroitin/dermatan sulfotransferases chondroitinase ABC cortex central nervous system chondroitin sulfate glycosaminoglycans chondroitin sulfate proteoglycans chondroitin sulfate/dermatan sulfate digoxigenin days in vitro extracellular matrix epidermal growth factor embryonic stem cells fibroblast growth factor 2 (basic FGF) fluorescence activated cell sorting fetal calf serum ganglionic eminence Hank’s basal salt solution heparan sulfate proteoglycans intracerebroventricular injection glycosaminoglycans neural stem cell neural stem/progenitor cells 30 -phosphoadenosine 50 -phosphosulfate receptor protein tyrosinephosphatase room temperature sodium dodecylsulfate polyacrylamide gel electrophoresis subgranular zone (of the hippocampus) subventricular zone (wall of the lateral ventricle)
1. Overview The development of the central nervous system (CNS) evolves in a sequence of defined and carefully orchestrated steps. With regard to the cellular origins, significant progress during the past years has led to a
40
Swetlana Sirko et al.
coherent and unified view of the cellular precursors of the CNS (Kriegstein and Alvarez-Buylla, 2009). During the early phase of forebrain development neuroepithelial (NE) cells expand by cycles of symmetric divisions (Temple, 2001) and can be considered authentic neural stem cells (NSCs) because they can generate the major neural lineages, namely neurons, astrocytes, and oligodendrocytes. Subsequently, these cells give rise to radial glia cells that divide asymmetrically during neurogenesis, producing a postmitotic neuronal precursor cell and a daughter cell that reenters the cell cycle (Temple, 2001; Wodarz and Huttner, 2003). Thereby radial glia cells, beyond their well-known function as substrate and guide for neuronal migration, do give rise to neurons in vitro (Hartfuss et al., 2001; Malatesta et al., 2000) and serve as NSCs, as evidenced by fate mapping studies in vivo (Anthony et al., 2004; Malatesta et al., 2003; Miyata et al., 2001; Noctor et al., 2001, 2002). Around birth, the radial glia cells transform into astrocytes. Remarkably, the specialized subpopulation of subventricular zone (SVZ) astrocytes has been identified as NSC in the adult brain (Doetsch et al., 1999). It has been hypothesized that NE cells, radial glia cells, and SVZ astrocytes constitute the NSC lineage (Alvarez-Buylla et al., 2001; Doetsch, 2003). Because the developmental potential of NSCs becomes progressively restricted, but the intermediate differentiation states cannot be distinguished by distinct sets of markers, we will refer to the complete population as neural stem/progenitors cells (NSPCs) for the purpose of this discussion. As has been pointed out, the transition from the symmetric to the asymmetric division mode is of crucial importance for the diversification of neural cell lineages (Kriegstein and Alvarez-Buylla, 2009). On theoretical grounds, this switch of division mode can either be caused by an asymmetric distribution of specific cellular determinants to only one of the daughters, which has, for example, paradigmatically been proven in the Drosophila nervous system (Gotz and Huttner, 2005; Wodarz and Huttner, 2003); alternatively, it could be caused by dispatching the daughters to distinct microenvironments that might differentially instruct their further fate (Scadden, 2006). During the past years, our laboratory has explored this second possibility further. In situ, NSPCs are located in a niche that consists of a restricted set of cell types and contains a specialized microenvironment composed of soluble factors, membrane bound molecules, and extracellular matrix (ECM) constituents (Alvarez-Buylla and Lim, 2004; Scadden, 2006). The ECM of the CNS is composed of glycoproteins and proteoglycans. With regard to glycoproteins, constituents of the tenascin gene family, in particular tenascin-C (Tnc), are specifically enriched in the environment of NSPCs at embryonic day E12–E13 in the mouse (von Holst et al., 2007). There, Tnc contributes to the maturation of NSPCs (Garcion et al., 2004), the proliferation and maintenance of oligodendrocyte precursors (Czopka
CSPGs in the Neural Stem Cell Niche
41
et al., 2009; Garcion et al., 2001; Garwood et al., 2004), and the regulation of target genes such as Sam68 that are involved in the regulation of NSPC proliferation (Moritz et al., 2008). The proteglycans of the nervous system comprise heparan sulfate proteoglycans (HSPGs) of the glypican and the syndecan type that are mostly membrane associated, and chondroitin sulfate proteoglycans (CSPGs), for example, members of the lectican family, such as brevican, neurocan, and versican, that are mostly released into the extracellular environment (Bandtlow and Zimmermann, 2000). HSPGs play an important role as accessory factors in signaling processes, for example, by exposing growth factors such as fibroblast growth factor 2 (FGF-2) to the FGFR. CSPGs have attracted considerable interest in the field of biomedicine because they are considered a major obstacle to axonal regeneration in the context of CNS lesions (Busch and Silver, 2007; Carulli et al., 2005; Fitch and Silver, 2008). Furthermore, CSPGs have been attributed important roles in the regulation of synaptic plasticity (Bradbury et al., 2002; Pizzorusso et al., 2002). One ECM component present in the postnatal and adult NSC niche is the DSD-1-proteoglycan, a CSPG that is selectively recognized by the monoclonal antibody 473HD (Faissner et al., 1994; Gates et al., 1995). We could subsequently show that DSD-1-PG is the mouse homologue of rat phosphacan (Garwood et al., 1999). The CSPG phosphacan represents a soluble, released splice variant of the receptor protein tyrosinephosphatase (RPTP)-bz gene. The large RPTP-bz receptor is expressed by NSCs and radial glia during development of the CNS and exposes the 473HD-structure (Garwood et al., 2001; von Holst et al., 2006). We could show that this particular GAG-epitope is itself functionally active and promotes neurite outgrowth of several types of CNS neurons (Faissner et al., 1994; Garwood et al., 1999). This motivated a more detailed structural analysis that showed that the 473HD (synonymous to DSD-1-)-epitope depends on sulfation, is enriched in the CS-D-type motif, and by itself sufficient to promote neurite outgrowth (Clement et al., 1998; Faissner et al., 1994; Hikino et al., 2003; Nadanaka et al., 1998). Expanding on the earlier results (Gates et al., 1995), we have recently shown that the unique CS-structure recognized by MAb 473HD is expressed in the germinal layers during mouse forebrain development and represents a novel surface marker of radial glia (von Holst et al., 2006). This observation paralleled a report that CSPGs are released by NSCPs growing as neurospheres (Ida et al., 2006). Neurospheres are a culture model of NSPCs and composed of neural stem and various progenitor cells that grow in suspension. Interestingly, also the neurospheres strongly express the 473HD epitope. Consistent with the expression of the 473HD epitope, various mono- and disulfated disaccharide units have been identified by the compositional analysis of chondroitin sulfate/dermatan sulfate (CS/DS)
42
Swetlana Sirko et al.
chains purified from the embryonic mammalian CNS (Bao et al., 2005; Ida et al., 2006; Properzi et al., 2005; Ueoka et al., 2000; Zou et al., 2003). Furthermore, the expression of some CS/DS-PG core proteins has been detected in the embryonic NSC niche and in neurospheres (Ida et al., 2006; Kabos et al., 2004). The expression of the 473HD epitope in neurogenic regions of the CNS prompted us to explore potential functional implications. Consistent with the hypothesis that chondroitin sulfate glycosaminoglycans (CS-GAGs) play a biological role, the addition of the MAb 473HD or the digestion of CS-GAGs on the surface of 473HD-positive NSPCs using chondroitinase ABC (ChABC) reduced the number of neurospheres and of proliferating NSPCs, as assessed by BrdU-incorporation (von Holst et al., 2006). Furthermore, the differentiation of NSPCs into neurons was reduced while the generation of astrocytes was enhanced, suggesting a role in lineage decisions (Sirko et al., 2007, 2010). Altogether, these data revealed that CS-GAGs are indeed partaking in the pathway of NSPC expansion and differentiation. In view of the importance of sulfation and the distribution of the sulfate groups on the CS-GAGs, we have also studied the biosynthetic machinery that generates distinct CS-GAGs. We could show that the critical enzymes required for the synthesis of CS-D and other CS-variants are expressed in neurogenic regions in the developing and in the adult CNS, and in neurospheres derived therefrom (Akita et al., 2008).
2. Immunohistochemistry of Embryonic and Postnatal Mouse Brain Sections Immunocytochemistry and -histochemistry are classical methods used to localize various components in a tissue and to characterize cell subpopulations with classic markers. For example, the immunocytochemical analysis of radial glia with the marker molecules RC2 (Chanas-Sacre et al., 2000), GLAST (Shibata et al., 1997), and brain lipid-binding protein (BLBP; Feng et al., 1994) has revealed several subpopulations that change dynamically during telencephalic development (Hartfuss et al., 2001). An impressive repertoire of antibodies is available to specifically label subpopulations of neural cells. The following monoclonal antibodies were used in our studies: 473HD that recognizes the DSD-1-epitope, a particular CS-GAG (rat IgM; Faissner et al., 1994); MAb 487 directed to the L5-epitope/LewisX (LeX) (rat IgM; Streit et al., 1996); RC2, a radial glia marker (mouse IgM; Developmental Studies Hybridoma Bank, University of Iowa, IA, USA); anti-E-cadherin, a cell adhesion molecule and polarity marker (mouse IgG, Santa Cruz); O4, a marker of immature oligodendrocytes (mouse IgM; Sommer and Schachner, 1981); PSA-NCAM, a marker of neuroblasts in
CSPGs in the Neural Stem Cell Niche
43
the hippocampus and the rostral migratory stream (Rougon et al., 1986); anti-Nestin, an intermediate filament expressed in NSPCs (mouse IgG, Chemicon); anti-bIII-tubulin, an early marker of CNS neurons (mouse IgG, Sigma); and anti-BrdU antibody that is used in cell proliferation studies (mouse IgG, Roche). Polyclonal antibodies included antibodies (all rabbit): against DSD-1-PG/phosphacan (referred to as pk-antiphosphacan, batch KAF13(4), which recognizes the core proteins of RPTP-b/z; Faissner et al., 1994); against GFAP, an intermediate filament protein expressed by astrocytes (Dako); against NG2, a marker of early oligodendrocytes (Chemicon); against BLBP, a marker of a subtype of neurogenic radial glia (BLBP, gift of Dr Heintz, Rockefeller University, New York; alternatively from Chemicon); against atypical-PKC, a polarity marker of radial glia (aPKC, BD Science); against GLAST, a glutamate transporter that is expressed in radial glia (gift of Dr Pow, University of Queensland, Australia or from the company Chemicon); against phosphohistone-3 (PH3), a marker of the M-phase of the cell cycle, and the ECM basal lamina component laminin-1 (from Chemicon). Secondary antibodies were subclass-specific biotinylated-, CY2-, or CY3-coupled anti-mouse, anti-rat, and anti-rabbit antibodies (all from Dianova). We used streptavidin-Alexa FluorÒ350 (Invitrogen) to reveal biotinylated reagents. In developmental neurobiology, most studies are carried out with embryonic or postnatal tissue that do not require fixation by perfusion.
3. Method to Stain Embryonic Sections for NSPC Markers 1. Pregnant animals are sacrificed by cervical dislocation. The embryos are removed and transferred to phosphate-buffered saline (PBS: 137 mM NaCl, 3 mM KCl, 6.5 mM Na2HPO42H2O, 1.5 mM KH2PO4; pH 7.4). Subsequently, the brains are prepared and immersion fixed overnight with 4% (w/v) paraformaldehyde (PFA) in PBS at 4 C. Thereafter, tissues are cryoprotected overnight with 30% (w/v) sucrose in H2O, embedded in tissue freezing medium (Jung) and frozen on dry ice. 2. Sections (12–14 mm) are cut on a cryostat (Leica). For immunohistochemistry on frontal sections, slides are rehydrated in PBS with 1.7% (w/v) NaCl and 10% (v/v) normal goat serum (Dianova) for 1 h at room temperature (RT) before incubation with the various primary antibodies at convenient dilutions, for example, MAb 473HD (1:500), MAb RC2 (1:500), MAb anti-Nestin (1:500), MAb anti-bIII-tubulin (1:300), antiBLBP (1:1000–2000), anti-NG2 (1:200), and anti-GLAST (1:1500). The sections are incubated with primary antibodies diluted in PBS/
44
Swetlana Sirko et al.
1.7% (w/v) NaCl/10% (v/v) normal goat serum/0.1% Triton-X-100 overnight at 4 C. Subsequently, the sections are washed three times for 5 min in PBS and incubated with adequate secondary antibodies diluted 1:500 in PBS/A (PBS containing 0.1% (w/v) bovine serum albumin (BSA, Sigma)) for 2 h at RT. During incubation with secondary antibodies, cell nuclei are labeled with bisbenzimide (diluted 1:105, Sigma) to aid cell counting. After three further washes in PBS, the sections are mounted in immumount (Thermo Science) and analyzed using fluorescence microscopy (Fig. 3.1A–C).
4. Analysis of the Adult Neurogenic Niche and SVZ-Derived Cells by Immunocytochemistry The SVZ of the lateral ventricle walls of the anterior horn and the subgranular zone (SGZ) of the hippocampus represent the neurogenic niches in the adult CNS. Best preservation of tissues for immunochemistry is achieved by transcardial perfusion of living anesthetized experimental animals with 4% PFA. For immunohistochemical analysis, 12 mm cryosections from adult mouse forebrain as well as from adult NSC-derived neurospheres grown for 7 days in vitro (div) are used. The sections are treated as described for embryonic cryosections.
4.1. Method to cultivate NSPCs from adult neurogenic niches 1. For NSC cultures, the brains of adult mice are removed from the skull, and 300-mm-thick horizontal vibratome sections are prepared for dissection of the SVZ around the lateral ventricle under a high-power stereomicroscope. The SVZ cells are acutely dissociated as described (Hartfuss et al., 2001) and plated onto polyornithine-coated dishes in neurosphere medium containing 1% fetal calf serum (FCS). After 2 h, adherent cells are fixed and immunocytochemically analyzed with the same antibodies as above. This approach yields a picture of the actual frequency of cell types and lineages in the tissue of origin. 2. Instead of being used for frequency counts immediately after dissociation, the cells can also be transferred into suspension culture in neurosphere medium (see 7.1, p.14). The generation of neurospheres from adult NSCs in the presence of 20 ng/ml epidermal growth factor (EGF) or 20 ng/ml FGF-2, or both growth factors combined is determined and quantified after 2 weeks in culture. Alternatively, cell subtypes can be enriched by immunopanning (see 6.1, p.12). The cell biological analysis can be performed as described for embryonic NSPCs.
45
CSPGs in the Neural Stem Cell Niche
A
B 473HD DAPI
C 473HD BrdU
473HD Nestin DAPI
E13
Cor
LV
LV
LV
GE LV D 1. Preincubation with secondary antibody
2. Preincubation with primary antibody
3. Addition of single cell suspension
4. Selective separation of cell fractions
Secondary antibody Primary antibody
E
Immunonegative cell Immunopositive cell
Selectively isolated 473HD + cells
473HD DAPI
Nonselected cortical cells
Figure 3.1 Expression of the 473HD epitope on embryonic forebrain cells in vivo and in vitro. (A) Fluorescence micrograph of frontal cryosection after immunolabeling with MAb 473HD demonstrates expression of the 473HD epitope in the mouse forebrain at embryonic day 13. (B) The radially oriented expression (white arrowheads) of the 473HD epitope is closely associated with BrdU incorporated cells in the telencephalic VZ. (C) Double immunostaining with MAb 473HD and antibodies against Nestin reveals that expression of the 473HD epitope is mainly attributed to Nestin-positive precursor cells in vivo (upper layer). In accordance with the situation in vivo, the surface expression of the 473HD epitope is observed on the Nestin-positive precursor derived from cortical tissue (lower layer). (D) The experimental layout of the immunopanning procedure to enrich for 473HD epitope-expressing cells is schematically represented. The sequential preparation of the immunopanning dishes begins with preincubation of petri dishes with biotin-conjugated secondary antibody (1), followed by the monoclonal primary
46
Swetlana Sirko et al.
5. Immunocytochemistry of Acutely Dissociated Cells The determination of cell numbers is difficult in neural tissues, due to the convoluted arrangement of cell layers in the CNS, the different cell sizes and complex morphologies, and processes of different sizes and lengths. Complex stereological procedures have been designed to optimize cell number counts in the CNS. As an alternative approach, we have favored to prepare acutely dissociated suspension of cells that were subsequently adhered to solid substrates. There, individual cell bodies can be distinguished and investigated with specific lineage markers.
5.1. Method for immuncytochemistry performed on neural cell monolayers 1. For immunocytochemical stainings, the acutely dissociated cells originating from forebrain tissues (Fig. 3.1C and E), from cortical and striatal neurospheres, or obtained by immunopanning using the MAb 473HD (von Holst et al., 2006; Fig. 3.1E) are plated in FCS-containing medium (1% (v/v), Seromed) at a density of 5.000 cells/well in 4-well dishes (Greiner) coated with 10 mg/ml polyornithine (Sigma). The cells are incubated in a humidified atmosphere with 6% (v/v) CO2 at 37 C for 1 h. 2. Embryos at E13 or E18 are removed as described elsewhere. Embryonic brains are dissected and transferred to minimal essential medium (MEM, Sigma). The meninges, hippocampi, and olfactory bulbs are removed and the cerebral cortices (Cor) and the ganglionic eminence (GE) are prepared. Tissues are enzymatically digested with 0.05% trypsin–EDTA in Hank’s basal salt solution (HBSS; Invitrogen) for 10 or 20 min at 37 C to obtain E13 and E18 embryonic cell suspensions, respectively. The enzyme activity is stopped by the addition of 1 ml ovomucoid (1 mg/ml soybean trypsin inhibitor, Sigma; 50 mg/ml BSA, 40 mg/ml DNase I, Worthington, in L-15 medium, Sigma). After centrifugation for 5 min at 1000 rpm (212 g) the cell pellets are resuspended in antibody (2). Afterward, a cell suspension can be transferred to the coated panning dish (3). After incubation for at least 1 h, the nonadherent cells are gently washed away from the panning dish until only adherent cells remains. The latter can be recovered by enzymatic digestion with trypsin–EDTA and collected for further analysis (4). (E) As determined by immunocytochemical analysis at 2 h after the immunopanning procedure, 473HD epitope-expressing cells from embryonic forebrain can be enriched to more than 90% in the immunoselected population. All cell nuclei are counterstained with bisbenzimide and are shown in blue (DAPI: 40 ,6-diamidino-2-phenylindole). Scale bar: 150 mm in (A), 25 mm in (B) and (C), 50 mm in (E).
CSPGs in the Neural Stem Cell Niche
3.
4.
5.
6.
47
neurosphere medium consisting of DMEM/F12 (1:1) that contains 0.2 mg/ml L-glutamine (all Sigma), 2% (v/v) B27, 100 U/ml penicillin, 100 mg/ml streptomycin (all Invitrogen). Four-well dishes (Greiner) are sequentially coated with 10 mg/ml polyornithine (Sigma) in H2O followed by 10 mg/ml laminin-1 (Tebu) in PBS for 1 h at 37 C each. After washing the dishes, the cells are plated at a density of 5.000 cells/well in neurosphere medium containing 1% (v/v) FCS (Seromed) and incubated in a humidified atmosphere with 6% (v/v) CO2 at 37 C. For immunocytochemical stainings, an established protocol is followed, as previously described (von Holst and Rohrer, 1998). All steps are performed at RT. Acutely dissociated cells, adherent after 2 h, are washed twice for 5 min in Krebs–Ringer–Hepes buffer (KRH/A: 125 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl22H2O, 1.2 mM MgSO47H2O, 1.2 mM KH2PO4, 5.6 mM D-glucose, 25 mM Hepes, and 0.1% (w/v) BSA) and then incubated for 20 min with the primary antibodies against cell-surface/extracellular epitopes, for example, MAb 473HD (1:250), a novel radial glia surface marker; MAb O4 (1:25); MAb 487/LeX (1:250); or anti-NG2 (1:200), all diluted in KRH/A. After washing twice for 5 min in KRH/A, the cells are fixed with 4% (w/v) PFA in PBS for 10 min, washed twice with PBT1 (PBS containing 1% (w/v) BSA and 0.1% (w/v) Triton-X-100), and incubated for 30 min with antibodies against the intracellular epitopes RC2 (1:500); Nestin (1:1000); bIII-tubulin (1:300); BLBP (1:1000); GLAST (1:2000) or GFAP (1:250), all diluted in PBT1. After three further washes with PBS/A, the cells are incubated for 30 min with specific fluorochrome-labeled secondary antibodies to detect the various primary antibodies. The last incubation step includes bisbenzimide (1:105) to label cell nuclei. After final washing in PBS, the preparations are mounted in PBS/glycerol (1:1) and viewed under an Axiophot II (Zeiss) using UV-epifluorescence. To assay differentiated cell types in cultures of acutely dissociated or selectively isolated cortical and striatal cells, the same immunostaining protocol is carried out after various time points.
6. Isolation of NSPCs by Immunopanning or by Immunoisolation Using Paramagnetic Beads (EasySep) Several reports have described the isolation of NSPCs from postnatal or adult forebrain (Belachew et al., 2003; Capela and Temple, 2002; Kim and Morshead, 2003; Rietze et al., 2001). These studies reported significant
48
Swetlana Sirko et al.
advances based on fluorescence activated cell sorter (FACS) techniques using a lectin-negative cell-surface marker exclusion protocol (Rietze et al., 2001), antibodies against LeX (Capela and Temple, 2002) or cells selected from the brain of CNP-GFP transgenic mice (Belachew et al., 2003). In vitro, the NSPC fraction was enriched from adult neurospheres using a dye exclusion paradigm or LeX (Capela and Temple, 2002; Kim and Morshead, 2003). Recently, a CD surface antigen code has been proposed that permits the isolation of neural stem from differentiating human ES-cells using FACS (Pruszak et al., 2009). Therefore, it seemed promising to investigate whether the 473HD epitope is present on NSPC surfaces. Indeed, it appeared that the 473HD epitope is expressed in the germinal layers of the telencephalon during development (Fig. 3.1A–C) and in the adult SVZ of the lateral ventricle wall and can be utilized for immunoisolation of 473HD-positive NSCPs (von Holst et al., 2006). The cell biological characterization suggested that the 473HD- (DSD-1)-epitope is a surface marker of a subpopulation of neurogenic radial glia with NSC properties.
6.1. Method for immunopanning of NSPCs with MAb 473HD 1. In order to obtain 473HD epitope expressing cortical and striatal cells an immunopanning protocol was established based on previous experience (von Holst and Rohrer, 1998). Four important steps can be distinguished in a flow diagram (Fig. 3.1D). Two petri dishes ( 100 mm, Falcon) are incubated overnight at 4 C with 10 ml of 50 mM Tris–HCl, pH 9.5, containing 50 mg/ml biotin-SP-conjugated, affinity-purified F(ab0 ) 2 goat anti-rat IgM antibody fragments (m-chain specific; Dianova). Afterward, the dishes are washed three times with PBS and incubated with the MAb 473HD (2.5 mg/ml) in PBS, 0.2% (w/v) BSA for at least 2 h. Then, the panning dishes are washed three further times with PBS. 2. After enzymatic digestion of cortical or GE tissue with 0.05% (w/v) trypsin–EDTA in HBSS, the dissociated cell suspensions are allowed to recover for 1 h at 37 C. Subsequently, 1.6 106 cells from the recovered cell suspensions are incubated per panning dish in 8 ml MEM, 0.2% (w/v) BSA for 1 h at RT. The nonadherent cells are gently washed away by at least five cycles of exposure to 8 ml MEM at RT. The successful removal of nonadherent cells is monitored on an inverted microscope (Leica). 3. Specifically adherent cells are subsequently recovered from the panning dish by incubation with 5 ml trypsin–EDTA in HBSS for 5 min at 37 C. The resulting suspension is transferred to 8 ml MEM, 10% (v/v) FCS, and centrifuged for 5 min at 1000 rpm at RT. The resulting pellet is resuspended in serum-free neurosphere medium (see above).
CSPGs in the Neural Stem Cell Niche
49
In general, between 30% and 50% of the 473HD-positive cells can be recovered, which corresponds to 3.2–5.4 104 cells at E18.
6.2. Method for preparing 473HD-positive cells applying magnetic beads 1. Alternatively, the 473HD-positive cells can be enriched with an immunoisolation procedure using paramagnetic beads (EasySep biotin selection kit), according to the manufacturer’s instructions. For this purpose, E13 forebrain single cell suspensions obtained as described above are incubated in 2 ml MEM/0.2% BSA for 60 min at RT, which is followed by immunolabeling of the cells in suspension. We propose the procedure outlined above for staining of acutely dissociated cells, with the difference that between each step of the protocol, the cell suspension is pelleted by centrifugation for 5 min at 1000 rpm. 2. In short, the cell suspension is washed for 10 min in KRH/A, incubated with the MAb 473HD (1:200 in KRH/A) for 20 min and washed again for 10 min in KRH/A. After incubation with the biotinylated anti-rat IgM (1:300 in KRH/A) for 20 min and a washing step in PBS/A, the cell pellet is resuspended in PBS/A and transferred to a 5-ml FACS tube (Falcon). 3. The EasySep biotin selection cocktail (100 ml/ml) is added for 15 min, followed by the addition of EasySep magnetic nanoparticles (50 ml/ml) for further 10 min of incubation. This suspension is placed into the EasySep magnet for 10 min. The supernatant containing the negative cell population is poured off and 2 ml PBS/A is added twice for gentle washing. Thereafter, the FACS tube is removed from the magnet and the 473HD-positive cell population is recovered by resuspending the cells in neurosphere medium. The purity and the degree of enrichment of the selectively isolated cell population is always determined by immunocytochemistry 2 h after immunoselection (Fig. 3.1E), as described above.
7. Neurosphere Cultures and Various Methods for Their Analysis Neurospheres are composite assemblies that contain various types of progenitors and differentiating cells (Marshall et al., 2007). In order to ascertain the presence of NSPCs, a valuable criterion is to test whether primary neurospheres derived from embryonic E13 cortex can be passaged
50
Swetlana Sirko et al.
over longer periods. The endogenous NSPCs may exhibit neurosphereinitiating capacity for more than nine passages and thus satisfy the key criterion of long-term self-renewal (Louis et al., 2008). A second criterion is to probe the resulting NSPCs for multipotency after several passages in that they generate neurons, astrocytes, and oligodendrocytes in a differentiation assay.
7.1. Method for cultivating NSPCs as neurospheres 1. Dissected tissues from the cerebral cortex and the GEs are acutely dissociated as described above. Embryonic NSCs or NSPCs selectively isolated by immunopanning are cultured at 37 C, 6% CO2 at a cell density of 105 cells/ml in T25 flasks (bulk culture; Fig. 3.2A). The medium is serum-free neurosphere medium (see above) containing EGF and basic FGF-2 at 20 ng/ml each (Preprotech). In general, FGF-2-containing cultures are supplemented with 0.5 U/ml heparin (Sigma). Alternatively, the various single cell suspensions are assayed for neurosphere formation in a clonal density assay as previously described (Garcion et al., 2004). 2. In order to test specific epitopes for functional properties, monoclonal antibodies can be added to the culture system. For this type of antibody perturbation experiments, the MAb 473HD and the IgM-isotype control MAb 487/LeX are added once at a final concentration of 2.5 mg/ml, when the cultures are initiated. The formation of neurospheres is monitored by inspection of the cultures on the stage of an inverted microscope (Leica) and quantified after 7 div by counting the entire dish area (clonal density assays) or 10 randomly selected visual fields (bulk cultures).
7.2. Method to perform a differentiation assay with neurospheres The demonstration of multipotency is important in order to demonstrate the ability of NSPCs to generate the major neural lineages. This is achieved by cultivating individual neurospheres in the absence of growth factors. For differentiation assays, individual neurospheres of 200–250 mm diameter are transferred onto polyornithine/laminin-1-coated wells (coating was done sequentially for 1 h at 37 C at a concentration of 10 mg/ml for both components) and incubated in neurosphere medium (see above) with 1% (v/v) FCS at 37 C, 6% (v/v) CO2 for 5 days. The differentiated cell types are identified by immunocytochemistry using antibody markers described in previous paragraphs (Fig. 3.2C).
A
1d
1h B
Phase
473HD Nestin
1h
bIII GFAP DAPI
3d
O4 Nestin DAPI
C
D
With ChABC
5d
473HD bIIItub
Control
5d
7d
473HD GFAP
473HD Tn-C
With ChABC
bIII tubulin GFAP
Control
E
3d
5d
Figure 3.2 The neurosphere assay as a model for the culture of NSPCs. (A) Starting with a single cell suspension from embryonic cerebral cortex, approximately 3% of total cortical cells are capable to generate multicellular neurospheres after 7 div. Phasecontrast images show examples of individual neurospheres that emerged after 1, 3, 5, and 7 days in growth factor containing medium. (B) Photomicrographs of cryosections of individual cortical-derived neurospheres double labeled with MAb 473HD and antibodies against Nestin revealed that most of the neurosphere cells are Nestinpositive precursors. Only a limited fraction of neurosphere cells differentiates within 7d in serum-free culture condition to the neuronal or astroglial cell lineage, as demonstrated by immunolabeling for bIII-tubulin and GFAP respectively. (C) When individual neurospheres were transferred to a laminin-substrate and allowed to differentiate in serum-containing medium for 3 days, massive cell migration is observed. Within 3d under adherent condition neurosphere cells differentiate to immature bIII-tubulinpositive neurons, to GFAP-positive astrocytes or to O4-positive oligodendrocytes. (D) Removal of CS-GAGs by treatment with ChABC causes a significant reduction of the neurosphere-forming capacity of NSCPs. (E) Continuous presence of ChABC in neurosphere-forming cultures engenders a shift towards astroglial differentiation. All cell nuclei were counterstained with bisbenzimide and are shown in blue (DAPI: 40 ,6diamidino-2-phenylindole). Scale bar: 100 mm in (A), (B), and (E), 150 mm in (C).
52
Swetlana Sirko et al.
7.3. Method for the sectioning of neurospheres and immunohistochemistry Neurospheres can comprise several hundred cells and reach a diameter of up to 300 mm within 7 days of cultivation (Fig. 3.2C). In order to investigate the composition and structural features, individual neurospheres can be sectioned and processed for immunohistochemistry. For cryosectioning, the neurospheres are allowed to settle in 15 ml Falcon tubes for 10 min. Thereafter, the culture medium is gently removed and replaced with 4% (w/v) PFA in PBS for 40 min at RT. After fixation, the neurospheres are cryoprotected with 30% (w/v) sucrose for 4 h at 4 C. Finally, neurospheres are embedded in tissue freezing medium ( Jung), sectioned at 14 mm on a Leica cryostat (Leica) and processed for immunohistochemistry using the same methods as described for embryonic brain sections (Fig. 3.2B).
7.4. Method for immunoblot analysis of neurospheres for biochemical analysis 1. The classical Western blot technique can be used to study protein expression in neurospheres. Neurospheres are homogenized in 150 mM NaCl, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1% Triton-X-100, 25 mM Tris–HCl, pH 7.5. After centrifugation at 12,000 rpm at 4 C for 10 min, the supernatant is collected and then subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE; 7% gel) under reducing condition. 2. For immunoprecipitation, 4 ml of polyclonal antiphosphacan (DSD1-PG, batch KAF13, 20 mg) antibodies is added to neurosphere detergent-lysates or conditioned neurosphere culture medium. After incubation at 4 C overnight, 10 ml of protein A-Sepharose is added and incubated at 4 C for 2 h. Thereafter, the beads are collected by centrifugation and washed three times in lysis buffer. 3. Immunoprecipitates are subjected to SDS-PAGE as described above. Separated proteins are transferred to polyvinylidene difluoride (PVDF) membranes using the TransBlot SD cell (Bio-Rad). After blocking with 5% (w/v) milk powder dissolved in 0.15 M NaCl and 25 mM Tris–HCl, pH 7.5 (blocking buffer), the membrane is sequentially incubated first with primary antibodies, for example, MAb 473HD (1:500) or anti-phosphacan antibodies (1:1500) in blocking buffer overnight at 4 C. 4. The next day, the membranes are washed in PBS containing 0.05% (w/v) Tween-20 and thereafter incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies dissolved in blocking buffer for
CSPGs in the Neural Stem Cell Niche
53
1–2 h at RT. We used the following dilutions: anti-rat IgM (1:7500) and anti-rabbit IgG (1:7500). Signals are detected with the chemiluminescence reagent Roti-Lumin (Roth) upon exposure to CL-X PosureTM film (Pierce).
7.5. Method for the partial purification and identification of CSPGs from the conditioned neurosphere culture medium 1. Figure 3.3A shows a scheme for the isolation of CSPGs from the conditioned neurosphere culture medium. NSPCs in E13 mouse forebrain are grown as neurospheres in the presence of FGF-2 and EGF as described above. The conditioned medium is centrifuged at 1500 rpm for 10 min to remove cell debris, and the supernatant is collected. Urea and Tris–HCl (1 M, pH 7.5) are added to the medium to a final concentration of 7 M and 30 mM, respectively. Thereafter, the medium is applied to a column of DEAE-Sepharose (1.5 cm 6 cm; GE Healthcare) equilibrated with 0.15 M NaCl, 7 M urea, 30 mM Tris– HCl, pH 7.5. 2. After washing with 50 ml of equilibration buffer, the bound proteins are eluted in a stepwise manner, with 50 ml of 0.3 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5; followed by 40 ml of 0.7 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5; and finally, 32 ml of 2 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5. Each fraction is monitored for absorbance at 280 nm. The prominent peaks are expected in the 0.3 and 0.7 M NaCl fractions (Fig. 3.3B). 3. Both fractions are individually pooled, and dialyzed against 0.15 M NaCl, 5 mM EDTA, 30 mM Tris–HCl, pH 7.5. Immunoblot analysis can be performed with various antibodies. For example, the MAb 473HD revealed that phosphacan/DSD-1-PG/6B4-PG, a major soluble CSPG in the developing mammalian CNS, is detected in the 0.7 M NaCl, but not in the 0.3 M NaCl fraction (Fig. 3.3C). 4. A total of up to 260 mg of proteins can be recovered in the 0.7 M NaCl fraction from 280 ml of conditioned medium. An aliquot of this fraction (10 mg of protein) is treated with or without ChABC (0.5 U/ml; Sigma) in 2 mM EDTA, 1 mM PMSF, 30 mM Tris–acetate, pH 8.0, for 2 h at 37 C, and analyzed by SDS-PAGE followed by Coomassie Brilliant Blue staining. Several core proteins of CSPGs are detected after ChABC digestion (Fig. 3.3D). MS/MS analyses of these core proteins reveal that neurosphere-forming cells express at least phosphacan/DSD-1PG/6B4-PG, neurocan, versican, brevican, and NG2 proteoglycan (also known as CSPG 4; K. Akita et al., unpublished observations).
A
Conditioned neurosphere culture medium Addition of urea to a final concentration of 7 M Anion exchange chromatography (stepwise elution with 0.3, 0.7, and 2 M NaCl) 0.7 M NaCl fraction (refered as PG fraction) Chondroitinase ABC digestion SDS-PAGE Mass spectrometric analysis
1.0
0
2M
0.5
0.7 M
0.3 M
Absorbance at 280 nm
B
5
10
15
Fraction number
250 150 100 75
0.
0.
kDa
7M
D 3M
C
PG fraction
+
+
−
Ch-ABC
−
+
+
kDa 250 150 100 75
* * * * * * * *
50
Figure 3.3 Partial purification of CSPGs from conditioned neurosphere culture medium. (A) A scheme for enrichment of CSPGs is shown. Totally, 260 mg of proteins were recovered as PG fraction from 280 ml of the conditioned neurosphere culture medium. (B) The conditioned neurosphere culture medium was applied to a DEAESepharose anion exchange column. After washing with 0.15 M NaCl, bound proteins were eluted in a stepwise manner; with 0.3, 0.7 M and then 2 M NaCl. Each fraction was collected and monitored for absorbance at 280 nm. (C) Aliquots of 0.3 and 0.7 M NaCl fractions were analyzed by immunoblotting using 473HD monoclonal antibody. Note that 473HD signals were only detected on 0.7 M NaCl fraction. (D) An aliquot of 0.7 M NaCl fraction was treated with or without chondroitinase ABC, and then subjected to SDS-PAGE, followed by Coomassie Brilliant Blue staining. Several core proteins of CS/DS-PGs were detected in the chondroitinase ABC-treated material (indicated by asterisk). Several molecular species could be discerned.
CSPGs in the Neural Stem Cell Niche
55
8. Disaccharide Analysis of CS/DS Chains from Embryonic Brain and Conditioned Neurosphere Culture Media and Effect of Sodium Chlorate Treatment on Neurosphere Formation at Clonal Cell Density Using the neurosphere culture system, Ida et al. (2006) have recently reported that particular sulfated structures on CS/DS chains such as CS-B, -D, and -E units possess the potential to promote FGF-2-mediated cell proliferation of rat embryonic NSPCs. These findings suggested that the sulfation profile on CS/DS chains is one of the crucial factors that regulate cell proliferation of NSPCs in the CNS. Interestingly, the 473HD epitope that depends on correct sulfation of GAGs also intervenes in NSPC proliferation. These results led to the general concept that a sulfation code may determine functional qualities of CS-GAGs. Following this hypothesis, one would expect distinct and particular CS-GAGs in the NSPC environment. Protocols have been published for disaccharide analysis of CS/DS chains from E13 mouse brain (Ueoka et al., 2000). Using these analytical methods, disaccharide compositions of CS/DS chains from conditioned neurosphere culture media were analyzed (Akita et al., 2008).
8.1. Method for the suppression of sulfation in NSPC cultures 1. Sulfate groups are transferred from 30 -phosphoadenosine 50 -phosphosulfate (PAPS) to the specific acceptor sites. A radical way to suppress any sulfation pattern consists in the competitive inhibition of the formation of PAPS by the addition of chlorate to the culture medium. This can be achieved as described in the following paragraphs (Akita et al., 2008). 2. Primary neurospheres from E13 mouse cerebral cortex are grown in the presence of FGF-2 and EGF as described above. After 5 days of cultivation, these are briefly treated with trypsin–EDTA, mechanically dissociated into single cells, and reseeded under the same culture conditions to generate secondary neurospheres. 3. Dissociated single cells from secondary neurospheres are assayed at clonal density (200 cells/cm2) for the formation of third-passage neurospheres, that is, for the self-renewal capacity of neurosphere-derived NSPCs, as previously described (Garcion et al., 2004). The standard neurosphere culture medium contains EGF, FGF-2 or EGF, and FGF-2. For suppression of sulfation, it is additionally supplemented with 5 or 30 mM sodium chlorate. 4. For rescue experiments, heparin (Sigma) is added at 5 U/ml in the continued presence of 30 mM sodium chlorate. After 5 days of
56
Swetlana Sirko et al.
cultivation, the total number of neurospheres under control and treatment conditions is counted under the phase contrast microscope. Using this approach, sulfation can be efficiently prevented without compromising the health and quality of the cell culture.
9. Analysis of NSPC-Proliferation In Vitro and In Vivo 9.1. BrdU-pulse labeling of neurospheres in vitro In vitro labeling of cycling Nsph cells is performed by addition of 10 mM BrdU (5-bromo-2-deoxyuridine, Sigma) for 15 h prior to enzymatic dissociation. In order to count the number of cells that incorporate BrdU, neurospheres are dissociated, the single cell suspension is plated, and individual cells are immunocytochemically stained 1 h later, essentially following the supplier’s protocol (BrdU Labeling and Detection Kit I; Roche).
9.2. Method for the BrdU labeling of NSPCs in vivo 1. For analysis of cell proliferation in vivo, the label is introduced by intraperitoneal injection of 10 mg BrdU (5-bromo-2-deoxyuridine, Sigma) per 100 g body weight 1 or 2 h prior to removal of the litter. The number of cells that incorporates BrdU is determined by immunocytochemical staining of acutely dissociated cells 2 h after plating, according to the supplier’s protocol (BrdU Labeling and Detection Kit I; Roche). 2. After cryoprotection of embryonic tissues cryosections are cut at 14–18 mm, boiled for 5 min in 0.01 M citrate buffer, pH 6.0, and washed twice in PBS prior to incubation with the anti-BrdU (1:20) at 4 C overnight. Primary antibodies are detected using adequate secondary antibodies. After three further washes in PBS the sections are mounted in immumount (Thermo Science) and analyzed using fluorescence microscope (Fig. 3.1B).
10. Analysis of CSPG Functions in NSPCs Using Chondroitinase ABC Treatment in Culture Recent studies have proposed that CSPGs play important roles in the adult CNS as inhibitors of synaptic plasticity and of axonal regeneration in glial scars. In the light of these findings, treatment strategies based on the application of ChABC, an enzyme that degrades the CS-GAG complement
CSPGs in the Neural Stem Cell Niche
57
of CSPGs, have been developed (Houle et al., 2006; Massey et al., 2008). On the other hand, evidence emerges that neural progenitor cells are recruited to various types of lesion in the adult, which raises the question whether ChABC-application may impact on NSC development in the lesioned tissue (Dobbertin et al., 2003; Sirko et al., 2009). We have, therefore, systematically addressed the question whether ChABC affects NSPC behavior. To this end, we have selectively eliminated CS-GAGs with ChABC both in vivo and in vitro. This treatment reduced NSPC proliferation and impeded the differentiation of radial glia to neurons, while it favored the maturation of the gliogenic subtype of radial glia, and the formation of astrocytes (Sirko et al., 2007; von Holst et al., 2006). These results imply a role of CS-GAGs in the regulation of growth and differentiation factors for NSCs. The methods used for the selective treatment of ECM in the NSPC compartment are quite versatile and applicable to other tools. A convenient approach is described below.
10.1. Method for the treatment of neurosphere cultures with ChABC 1. Embryonic NSPCs are cultured at 37 C, 6% CO2 at a cell density of 105 cells/ml in neurosphere medium in the presence of EGF and FGF-2, both at 20 ng/ml (Preprotech). In general, FGF-2-containing cultures are supplemented with 0.5 U/ml heparin (Sigma), which supports FGFdependent signaling. In parallel experiments, 50 mU/ml ChABC (EC 4.2.2.4; Sigma) or 50 mU/ml keratanase (Calbiochem) are added to neurosphere cultures once at the beginning of the experiment. The concentration of 50 mU/ml has been empirically determined as effective concentration using dose–response assays. However, it has to be kept in mind that ChABC-activity decreases with time in culture. Long-term incubations of more than 3 days therefore requires replenishment of the culture system with the enzyme. 2. The efficiency of the digestion of CS-GAGs is examined by immunocytochemical labeling with MAb 473HD, that detects an epitope sensitive to ChABC treatment (Faissner et al., 1994; von Holst et al., 2006). In parallel experiments, the addition of 50 mU/ml keratanase (Calbiochem) to the culture medium serves as control for the specificity of chondroitin sulfate (CS) deglycanation. Alternatively, the various single cell suspensions are assayed for neurosphere formation in clonal density assays, as described above (Garcion et al., 2004). 3. The formation of neurospheres is monitored by visual inspection with an inverted microscope (Leica) and quantified after 2, 5, and 7 div by counting the entire dish area (clonal density assays) or 10 randomly chosen visual fields (bulk cultures).
58
Swetlana Sirko et al.
Using this strategy, we demonstrated roles of CSPGs for the regulation of proliferation, self-renewal, and cell fate in neural stem and progenitor cells in vitro. Degradation of chondroitin sulfates (CS-GAGs) impaired neurosphere formation, self-renewal, and the generation of neuronal progeny (Fig. 3.2D and E). Analogous effects were observed upon removal of CS-GAGs in the developing cerebral cortex in vivo. Another important aspect that resulted from these studies was the implication of ECM components in cell adhesion processes. For example, CSPGs are considered antiadhesive for neural cell types and involved in inhibition of axon regeneration (Carulli et al., 2005). Neurospheres release large amounts of CSPGs into the culture medium (Akita et al., 2008; Ida et al., 2006) that may contribute to the inhibition of neurosphere attachment to the culture substrate. Thus, the settling and the outgrowth of ChABC-treated neurospheres observed in our studies may reflect a reduction of the antiadhesive properties of the substrate following digestion of CS-GAGs (Bradbury et al., 2002). Enhanced adhesion and outgrowth of neurospheres possibly involves the activation of integrins and downstream signaling that may interact with growth factor-related signal transduction mechanisms (Colognato et al., 2005; Leone et al., 2005). Also, cell adhesion molecules of the Ig-superfamily, for example, transfection with L1-CAM, enhance the survival and regeneration supporting potency of stem cells (Bernreuther et al., 2006; Chen et al., 2005). In conclusion, the impact of ChABC-activity on cell adhesion molecule gene families and downstream signal transduction in NSCPs represents a challenging topic for future studies.
11. Analysis of Chondroitin Sulfate Functions in the Neural Stem Cell Niche In order to replicate the results obtained in vitro in the more complex in vivo situation, CS-GAGs were directly digested in situ. To that end, the injection of ChABC directly into the lateral ventricle of the embryonic CNS proved an efficient approach. The application of ChABC in vivo was well tolerated by the recipient embryos. In particular, no deleterious effects on the cellular level could be observed (Sirko et al., 2007).
11.1. Method for intracerebroventricular injections in utero 1. All experimental procedures in vivo have to be performed in accordance with the Society for Neuroscience and European Union guidelines for animal experiments. We sought approval from the institutional animal care and utilization committees at the ‘‘Helmholtz Zentrum Mu¨nchen
CSPGs in the Neural Stem Cell Niche
59
(German Research Center for Environmental Health, Munich, Germany).’’ Intracerebroventricular injections (ICVI) into telencephalic ventricles of E13 embryos in utero can, for example, be performed with timed-pregnant C57/Bl6 mice. Be aware that the permit for experiments on living animals has to be granted by the regional institutions legally concerned. 2. Animals are anesthetized by intraperitoneal injection of 0.1 ml per 10 g body weight of a narcotic drug mixture (medetomidine 0.5 mg/kg, midazolam 5 mg/ml, Fentanyl Hexal 0.05 mg/kg). Uterine horns are exposed by mideline laparotomy and the ICVI is performed through the uterine wall at the anterior end of the embryonic forebrain using fine-pulled microcapillaries (borosilicate glass capillaries, 1.5 mm 0.86 mm; gc150F-10 Harvard apparatus). ChABC (10 mU/ml) is injected into the lateral ventricles of all embryos in one uterine horn. Keratanase (10 mU/ml) or artificial cerebrospinal fluid (ACSF) controls are injected into the lateral ventricles of the embryos in the second uterine horn. 3. Thereafter, the uterus is reinstated in its physiological site. The incisions of the abdominal muscle and the skin are closed by separate sutures. Finally, the anesthesia is reversed by intraperitoneal application of antisedate (2.5 mg/kg Antisedan, 0.5 mg/kg flumacenil, and 1.2 mg/kg naloxone), and animals are left to recover in a clean cage. 24 h after injection pregnant mice are sacrificed by cervical dislocation.
12. RT-PCR and Semiquantitative Analysis of the Synthetic Machinery for Glycosaminoglycans The hypothesis of the sulfation code posits that spatial patterns of sulfate groups attached to GAG-backbones code for specific protein recognition sites (Ito et al., 2005). Sulfate groups are transferred from PAPS to the specific acceptor sites in CS/DS chains by chondroitin/dermatan sulfotransferases (C/D-STs) that are located in the Golgi apparatus (Habuchi et al., 2000; Kusche-Gullberg and Kjellen, 2003; Silbert and Sugumaran, 2002). As illustrated (Fig. 3.4A), these enzymes can be classified into the following four groups: chondroitin/dermatan 4-O-sulfotransferase (C4ST/D4ST), chondroitin 6-O-sulfotransferase (C6ST), uronosyl 2-Osulfotransferase (UA2OST), and N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (GalNAc4S-6ST). Three C4ST genes (Hiraoka et al., 2000; Kang et al., 2002; Mikami et al., 2003; Yamauchi et al., 2000), two C6ST genes (Fukuta et al., 1995; Kitagawa et al., 2000), and one D4ST-1 (Evers et al., 2001), UA2OST (Kobayashi et al., 1999), and GalNAc4S-6ST (Ohtake et al., 2001) gene have been identified in mammals. It has been
60
Swetlana Sirko et al.
A
C6ST
~~
D4ST C4ST ~~
O
C4ST
~~
O
C unit UA2OST
GalNAc4S-6ST
~~
O
D unit
~~
O
B unit Sulfate group GlcUA
B
~~
A unit
UA2OST
~~
O
Culture conditions
O
~~
E unit GalNAc IdoUA
H EF FH E
EF
C-cortex
G-eminence
H
FH E
C4ST-1 C4ST-2 C4ST-3 D4ST-1 GalNAc4S-6ST C6ST-1 C6ST-2 UA2OST b-actin
Figure 3.4 RT-PCR analysis of chondroitin/dermatan sulfotransferase expression in neurospheres. (A) Schematic structure of sulfated disaccharides in the CS/DS chains. The repeating CS disaccharide units consisting of glucuronic acid (light grey hexagon, GlcUA) and N-acetylgalactosamine (white hexagon, GalNAc) are depicted. These CSdisaccharide units are modified by four different sulfotransferases: C4ST, C6ST, UA2OST, and GalNAc4S-6ST, as indicated in the scheme. The activity of the C-STs leads to the addition of sulfate groups at defined positions (black circles), which results in the generation of specified CS units as shown in the figure (underlined). In case GlcUA is converted to iduronic acid (dark grey hexagon, IdoUA) by its C-5
CSPGs in the Neural Stem Cell Niche
61
reported that gene expression levels of some enzymes correlate with the amount of sulfated products that corresponded to each enzymatic activity (Kitagawa et al., 1997; Properzi et al., 2005), which holds the promise that studies of gene expression of C/D-STs will yield more detailed insights about the sulfation profiles in mixed CS/DS chains. The expression of the critical enzymes can be detected using the following RT-PCR protocol.
12.1. Method for the amplification of distinct sulfotransferases using RT-PCR 1. Total RNA is prepared from E13 mouse tissues or neurospheres using the RNeasy Mini Kit (Qiagen). First-strand cDNA is synthesized with the help of the First Strand cDNA synthesis Kit (Fermentas). One microgram of total RNA and 1 ml of random hexamer primer (0.2 mg/ml) are mixed and adjusted to a total volume of 11 ml with autoclaved MilliQ water, and then heated to 70 C for 5 min. After cooling on ice, 4 ml of 5X reaction buffer, 1 ml of ribonuclease inhibitor (20 U/ml) and 2 ml of dNTP mixture (10 mM each) are added to the reaction mixture. Subsequent to incubation at 25 C for 5 min, 2 ml of M-MuLV reverse transcriptase (20 U/ml) are added to the reaction mixture and incubated at 25 C for 10 min and, finally, at 37 C for 60 min. The reaction is stopped by heating at 70 C for 10 min. The reaction mixture is cooled on ice, and then diluted with 20 ml of autoclaved MilliQ water. 2. PCR is carried out at 20–38 cycles in a total volume of 20 ml containing 0.8 ml of cDNA, 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 U of Taq-polymerase (Eppendorf), and 0.2 pmol of forward and reverse primers. The primer sequences and PCR conditions used for this study are described in detail in Table 3.1. The PCR products are ligated into the pCRII-TOPO vector using the TOPO-TA cloning kit (Invitrogen). After subcloning, the nucleotide sequences of the ligated fragments are confirmed by DNA sequencing using a commercial service (e.g., Macrogen Inc.).
epimerization, the enzyme D4ST preferentially adds a sulfate group at the C4 position of GalNAc, which is adjacent to IdoUA. (B) Neural stem cells in E13 cerebral cortex and ganglionic eminence were grown as neurospheres for 6 days in the presence of EGF, FGF-2, and heparin (EFH); FGF-2 plus heparin (FH); or EGF alone (E). cDNA was synthesized using total RNA purified from neurosphere-forming cells. PCR was performed in the linear range with 29–38 cycles. Detailed information on PCR analysis was shown in Table 3.1. The amplified PCR products are visualized by electrophoresis on a 1.5% agarose gel containing ethidium bromide.
Table 3.1 Primers and PCR conditions for respective genes Gene (Accession number)
Primer sequence (50 –30 )
Annealing temperature ( C)
PCR cycles
Product size (bp)
C4ST-1 (AB030378)
tgctggaagtgatgaggatg ggtggttgatctctgggatg cggctctcatgatccttttg tcatcactcgcttccagttg atgggaagacgctcctgttg gcacgaagagaaaggtcaggtag gctgatgttcgctgtaatcg tgccagaaacaccaagtcac ttgttggtatgaggagttctcg aggcatggatgaagtcttgg aggcagatacgtcttgttcctg agcacatacaggtcgcatagc gggcaagtatgagaactggaag agacatcccccactacgtga cttcttgtcccctctgtactgg gagcagatgaccttgttggtc gatgaagaagaagcagcagcag acctggagaagttgaggaagtg aaccccaggctgttttacatc ccatttttcgtcatcttgctc aggccagtaatagtagccatgag tctgttcttgtgcttgttgtctgg tatgccaacacagtgctgtctggtgg agaagcacttgcggtgcacgatgg
60
29
510a,b
60
32
519a
60
38
505a
60
32
445a,b
60
33
548a
60
31
528a
60
32
505b
60
32
527a,b
65
35
533a
60
34
475b
60
35
422b
60
23
247a
C4ST-2 (AJ289132) C4ST-3 (XM_355798) D4ST-1 (BC085479) GalNAc4S-6ST (AB187269) C6ST-1 (NM_016803) C6ST-1 (NM_016803) C6ST-2 (AB046929) UA2OST (NM_177387) UA2OST (NM_177387) RPTP-b (NM_001081306) b-actin (NM_007393) a b
These primers were used for the semiquantitative PCR analysis. These primers were used for the preparation of the in situ hybridization probes.
CSPGs in the Neural Stem Cell Niche
63
3. For semiquantitative analysis, PCR is carried out at various cycles as appropriate. After electrophoresis on a 1.5% (w/v) agarose gel containing ethidium bromide, the density of the amplified product is measured with the NIH image J program (Version 1.63), and calculated as the ratio versus the b-actin reference band. The mRNA expression of all presently known C/D-STs is detected in the dorsal and ventral telencephalon of the E13 mouse brain with the exception of C4ST-3 (Akita et al., 2008). Furthermore, these enzyme are also expressed in E13 cortical and striatal neurosphere-forming cells that are grown in the presence of EGF, FGF-2, and heparin; FGF-2 plus heparin; and EGF alone (Fig. 3.4B). Notably, the expression levels of some enzymes significantly differ between the tested growth conditions (Akita et al., 2008).
13. In Situ Hybridization of Sulfotransferases in Tissue and Neurosphere Sections In view of the expression of CSPGs and the particular MAb 473HDepitope in the NSC niche, we predicted the presence of specific sulfotransferases that are required to attach sulfate groups at distinct positions of the CS-GAG polymers. In order to prove the expression of the sulfotransferases and localize the expressing cell types, RT-PCR-based approaches proved adequate.
13.1. Method for the in situ hybridization of sulfotransferase mRNA 1. To prepare the hybridization probes for C4ST-1, D4ST, C6ST-1, -2, and UA2OST mRNA, defined fragments for each gene subcloned into pCRII-TOPO (Invitrogen) after RT-PCR as described above can be used. With the same strategy, cDNA corresponding to nucleotide 5160– 5581 including the transmembrane domain of RPTP-b/z (GeneBankÒ accession no. NM_001081306) was also obtained. Digoxigenin (DIG)labeled antisense and sense riboprobes are synthesized by T7 or SP6 RNA polymerase provided with the DIG RNA labeling Kit (Roche), following the manufacturer’s instructions. 2. E13 mouse capita are fixed with 4% (w/v) PFA in 0.1 M phosphate buffer, pH 7.3 (4% PFA/PB) at 4 C overnight, and cryoprotected with 20% (w/v) sucrose in PBS at 4 C for 4–6 h. Tissues are finally embedded in tissue freezing medium (Jung). Adult mouse brains are frozen immediately after dissection.
64
Swetlana Sirko et al.
3. For sectioning, neurospheres are allowed to settle in 15 ml Falcon tubes for 10–20 min, and finally collected in 1.5 ml tubes. Neurospheres are fixed with 4% (w/v) PFA/PB on ice for 2 h, subsequently cryoprotected and embedded as described previously. 4. Cryosections (14 mm) are cut on a cryostat (Leica), thaw-mounted on SuperFrostÒPlus glass slides (Menzel GmbH) and quickly air-dried. Fresh-frozen sections are postfixed with 4% PFA/PBS on ice for 15 min before acetylation. 5. All sections are acetylated with 0.25% (v/v) acetic anhydride in 0.1 M triethanolamine, pH 8.0, for 10 min, treated twice with 50 mM PB for 5 min, and subsequently prehybridized with hybridization buffer (50% (v/v) formamide, 10% (w/v) dextran sulfate, 1 Denhardt’s, 100 mg/ml yeast RNA, 0.2% (w/v) SDS, 2 standard saline citrate (SSC), 50 mM sodium phosphate, pH 7.0) at 50 C for 2 h. 6. Hybridization with riboprobes is carried out overnight at 50 C. After hybridization, sections are sequentially washed at 50 C using the following conditions: 4 SSC for 10 min, 2 SSC containing 50% (v/v) formamide for 20 min twice, 2 SSC for 10 min, 0.2 SSC for 20 min twice, and then treated with Tris–NaCl buffer (0.15 M NaCl, 0.1 M Tris–HCl, pH 7.5) for 10 min twice. 7. After blocking with Tris–NaCl buffer containing 1% (w/v) blocking reagent (Roche) for 30 min, sections are incubated with alkaline phosphatase-conjugated anti-DIG antibody (dilution 1/2000) overnight at 4 C. Sections are washed three times with Tris–NaCl buffer for 10 min, then rinsed with detection buffer (0.1 M NaCl, 50 mM MgCl2, 0.1 M Tris–HCl, pH 9.5), and developed with detection buffer containing 5% (w/v) polyvinyl alcohol, nitroblue tetrazolium (0.34 mg/ml), and 5-bromo-4-chloro-3-indolyl phosphate (0.18 mg/ml). Color development is stopped by the incubation with 1 mM EDTA, 10 mM Tris–HCl, pH 7.5, at various time points, depending on the degree of color development to obtain reasonable signal to noise ratios. A prominent expression of C4ST-1 mRNA is detected in the ventricular zones of E13 mouse dorsal and the ventral telencephalon. As documented (Fig. 3.5A and B), hybridization signals are observed colocalizing with cell bodies that are positioned adjacent to the ventricular surface. C4ST-1 mRNA signals are also observed on the cells residing in the SVZ around the anterior lateral ventricle wall of adult mouse brain (Fig. 3.5C and D). Furthermore, strong C4ST-1 mRNA signals are detected in the circumference of FGF-2-expanded neurospheres, whereas the core region displays lower or nondetectable level (Fig. 3.5E and F). Neurospheres represent a complex mixture of cells that display territorial preference, with actively cycling NSPC populations being localized to the more
65
CSPGs in the Neural Stem Cell Niche
C4ST-1 antisense B
E13 forebrain
A
C4ST-1 sense
CTX
LV C
D
Nsphs FGF-2 + heparin
Adult forebrain
SVZ
LV
E
F
Figure 3.5 In situ hybridization for C4ST-1 in the neural stem cell (NSC) niche. (A–D) Coronal cryosections of E13 (A and B) and adult (C and D) mouse forebrain were hybridized with DIG-labeled antisense (A and C) and sense (B and D) probes for C4ST-1. Note that mRNA signals were detected in the embryonic germinal layer (A) and the adult subventricular zone (C). (E and F) NSCs in E13 mouse cerebral cortex were grown for 6 days as neurospheres in medium supplemented with FGF-2 plus heparin. Cryosections were hybridized with DIG-labeled antisense (E) and sense (F) probes for C4ST-1. Note that mRNA signals were prominently detected in the outer area of neurosphere sections. Scale bars ¼ 50 mm. Abbreviations: CTX, cerebral cortex; LV, lateral ventricle; SVZ, subventricular zone.
superficial areas and the more differentiated, lineage-committed cell populations toward the core of the neurosphere (Sirko et al., 2007). C4ST-1 mRNA is also prominently expressed in cells settling in the outer layer of EGF-expanded neurospheres (Akita et al., 2008).
66
Swetlana Sirko et al.
14. Microscopy All immunofluorescence stainings are analyzed using a fluorescence microscope equipped with UV-epifluorescence (e.g., Axioplan 2 imaging, Zeiss). Images are captured with a digital camera and documented using the Axiovision 3.1 or 4.2 program (AxioCamHRc, Zeiss). In some cases, confocal laser scanning microscopy is applied (LSM510 meta, Zeiss). Standard phase contrast images of living cells are taken using a digital camera (DP10, Olympus) on an inverted CK40 microscope (Olympus).
15. Conclusion and Outlook In conclusion, our work so far suggests a role for CSPGs in stem cell biology. How CSPGs are integrated into the complex interplay of pericellular determinants of differentiation remains to be investigated in detail. However, the identification of functional contributions of CS-GAGs to the regulation of stem cell proliferation and neurogenesis constitutes an important step forward in identifying key factors of the local environment. For example, earlier transplantation experiments have highlighted a role of the local environment as determinant of adult neurogenesis. Thus, glial cells isolated from nonneurogenic regions of the adult CNS give rise to neurons when transplanted into a neurogenic environment (Shihabuddin et al., 2000), while neurogenic precursors isolated from the adult subependymal zone fail to generate neurons outside their niche (Lim et al., 2000). We are convinced that a better understanding of the NSC niche is of utter importance to harness NSCs for repair processes (Scadden, 2006). Our work demonstrated for the first time that complex CS-GAG carbohydrates play a pivotal role in the orchestration of the NSPC microenvironment.
ACKNOWLEGMENTS The work presented in this chapter was supported by the German Research Foundation (DFG), the Federal Ministry of Education and Research (BMBF), The German Academic Exchange Program (DAAD), and the Federal Country Northrhine-Westfalia (NRW, MIWFT).
REFERENCES Akita, K., von Holst, A., Furukawa, Y., Mikami, T., Sugahara, K., and Faissner, A. (2008). Expression of multiple chondroitin/dermatan sulfotransferases in the neurogenic regions of the embryonic and adult central nervous system implies that complex chondroitin sulfates have a role in neural stem cell maintenance. Stem Cells 26, 798–809.
CSPGs in the Neural Stem Cell Niche
67
Alvarez-Buylla, A., and Lim, D. A. (2004). For the long run: Maintaining germinal niches in the adult brain. Neuron 41, 683–686. Alvarez-Buylla, A., Garcia-Verdugo, J. M., and Tramontin, A. D. (2001). A unified hypothesis on the lineage of neural stem cells. Nat. Rev. Neurosci. 2, 287–293. Anthony, T. E., Klein, C., Fishell, G., and Heintz, N. (2004). Radial glia serve as neuronal progenitors in all regions of the central nervous system. Neuron 41, 881–890. Bandtlow, C. E., and Zimmermann, D. R. (2000). Proteoglycans in the developing brain: New conceptual insights for old proteins. Physiol. Rev. 80, 1267–1290. Bao, X., Mikami, T., Yamada, S., Faissner, A., Muramatsu, T., and Sugahara, K. (2005). Heparin-binding growth factor, pleiotrophin, mediates neuritogenic activity of embryonic pig brain-derived chondroitin sulfate/dermatan sulfate hybrid chains. J. Biol. Chem. 280, 9180–9191. Belachew, S., Chittajallu, R., Aguirre, A. A., Yuan, X., Kirby, M., Anderson, S., and Gallo, V. (2003). Postnatal NG2 proteoglycan-expressing progenitor cells are intrinsically multipotent and generate functional neurons. J. Cell Biol. 161, 169–186. Bernreuther, C., Dihne, M., Johann, V., Schiefer, J., Cui, Y., Hargus, G., Schmid, J. S., Xu, J., Kosinski, C. M., and Schachner, M. (2006). Neural cell adhesion molecule L1transfected embryonic stem cells promote functional recovery after excitotoxic lesion of the mouse striatum. J. Neurosci. 26, 11532–11539. Bradbury, E. J., Moon, L. D., Popat, R. J., King, V. R., Bennett, G. S., Patel, P. N., Fawcett, J. W., and McMahon, S. B. (2002). Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416, 636–640. Busch, S. A., and Silver, J. (2007). The role of extracellular matrix in CNS regeneration. Curr. Opin. Neurobiol. 17, 120–127. Capela, A., and Temple, S. (2002). LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35, 865–875. Carulli, D., Laabs, T., Geller, H. M., and Fawcett, J. W. (2005). Chondroitin sulfate proteoglycans in neural development and regeneration. Curr. Opin. Neurobiol. 15, 116–120. Chanas-Sacre, G., Thiry, M., Pirard, S., Rogister, B., Moonen, G., Mbebi, C., VerdiereSahuque, M., and Leprince, P. (2000). A 295-kDA intermediate filament-associated protein in radial glia and developing muscle cells in vivo and in vitro. Dev. Dyn. 219, 514–525. Chen, J., Bernreuther, C., Dihne, M., and Schachner, M. (2005). Cell adhesion molecule l1transfected embryonic stem cells with enhanced survival support regrowth of corticospinal tract axons in mice after spinal cord injury. J. Neurotrauma 22, 896–906. Clement, A. M., Nadanaka, S., Masayama, K., Mandl, C., Sugahara, K., and Faissner, A. (1998). The DSD-1 carbohydrate epitope depends on sulfation, correlates with chondroitin sulfate D motifs, and is sufficient to promote neurite outgrowth. J. Biol. Chem. 273, 28444–28453. Colognato, H., ffrench-Constant, C., and Feltri, M. L. (2005). Human diseases reveal novel roles for neural laminins. Trends Neurosci. 28, 480–486. Czopka, T., Von Holst, A., Schmidt, G., Ffrench-Constant, C., and Faissner, A. (2009). Tenascin C and tenascin R similarly prevent the formation of myelin membranes in a RhoA-dependent manner, but antagonistically regulate the expression of myelin basic protein via a separate pathway. Glia 57, 1790–1801. Dobbertin, A., Rhodes, K. E., Garwood, J., Properzi, F., Heck, N., Rogers, J. H., Fawcett, J. W., and Faissner, A. (2003). Regulation of RPTPbeta/phosphacan expression and glycosaminoglycan epitopes in injured brain and cytokine-treated glia. Mol. Cell. Neurosci. 24, 951–971. Doetsch, F. (2003). The glial identity of neural stem cells. Nat. Neurosci. 6, 1127–1134. Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M., and Alvarez-Buylla, A. (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703–716.
68
Swetlana Sirko et al.
Evers, M. R., Xia, G., Kang, H. G., Schachner, M., and Baenziger, J. U. (2001). Molecular cloning and characterization of a dermatan-specific N-acetylgalactosamine 4-O-sulfotransferase. J. Biol. Chem. 276, 36344–36353. Faissner, A., Clement, A., Lochter, A., Streit, A., Mandl, C., and Schachner, M. (1994). Isolation of a neural chondroitin sulfate proteoglycan with neurite outgrowth promoting properties. J. Cell Biol. 126, 783–799. Feng, L., Hatten, M. E., and Heintz, N. (1994). Brain lipid-binding protein (BLBP): A novel signaling system in the developing mammalian CNS. Neuron 12, 895–908. Fitch, M. T., and Silver, J. (2008). CNS injury, glial scars, and inflammation: Inhibitory extracellular matrices and regeneration failure. Exp. Neurol. 209, 294–301. Fukuta, M., Uchimura, K., Nakashima, K., Kato, M., Kimata, K., Shinomura, T., and Habuchi, O. (1995). Molecular cloning and expression of chick chondrocyte chondroitin 6-sulfotransferase. J. Biol. Chem. 270, 18575–18580. Garcion, E., Faissner, A., and ffrench-Constant, C. (2001). Knockout mice reveal a contribution of the extracellular matrix molecule tenascin-C to neural precursor proliferation and migration. Development 128, 2485–2496. Garcion, E., Halilagic, A., Faissner, A., and ffrench-Constant, C. (2004). Generation of an environmental niche for neural stem cell development by the extracellular matrix molecule tenascin C. Development 131, 3423–3432. Garwood, J., Schnadelbach, O., Clement, A., Schutte, K., Bach, A., and Faissner, A. (1999). DSD-1-proteoglycan is the mouse homolog of phosphacan and displays opposing effects on neurite outgrowth dependent on neuronal lineage. J. Neurosci. 19, 3888–3899. Garwood, J., Rigato, F., Heck, N., and Faissner, A. (2001). Tenascin glycoproteins and the complementary ligand DSD-1-PG/ phosphacan–structuring the neural extracellular matrix during development and repair. Restor. Neurol. Neurosci. 19, 51–64. Garwood, J., Garcion, E., Dobbertin, A., Heck, N., Calco, V., ffrench-Constant, C., and Faissner, A. (2004). The extracellular matrix glycoprotein Tenascin-C is expressed by oligodendrocyte precursor cells and required for the regulation of maturation rate, survival and responsiveness to platelet-derived growth factor. Eur. J. Neurosci. 20, 2524–2540. Gates, M. A., Thomas, L. B., Howard, E. M., Laywell, E. D., Sajin, B., Faissner, A., Gotz, B., Silver, J., and Steindler, D. A. (1995). Cell and molecular analysis of the developing and adult mouse subventricular zone of the cerebral hemispheres. J. Comp. Neurol. 361, 249–266. Gotz, M., and Huttner, W. B. (2005). The cell biology of neurogenesis. Nat. Rev. Mol. Cell Biol. 6, 777–788. Habuchi, H., Tanaka, M., Habuchi, O., Yoshida, K., Suzuki, H., Ban, K., and Kimata, K. (2000). The occurrence of three isoforms of heparan sulfate 6-O-sulfotransferase having different specificities for hexuronic acid adjacent to the targeted N-sulfoglucosamine. J. Biol. Chem. 275, 2859–2868. Hartfuss, E., Galli, R., Heins, N., and Gotz, M. (2001). Characterization of CNS precursor subtypes and radial glia. Dev. Biol. 229, 15–30. Hikino, M., Mikami, T., Faissner, A., Vilela-Silva, A. C., Pavao, M. S., and Sugahara, K. (2003). Oversulfated dermatan sulfate exhibits neurite outgrowth-promoting activity toward embryonic mouse hippocampal neurons: Implications of dermatan sulfate in neuritogenesis in the brain. J. Biol. Chem. 278, 43744–43754. Hiraoka, N., Nakagawa, H., Ong, E., Akama, T. O., Fukuda, M. N., and Fukuda, M. (2000). Molecular cloning and expression of two distinct human chondroitin 4-Osulfotransferases that belong to the HNK-1 sulfotransferase gene family. J. Biol. Chem. 275, 20188–20196. Houle, J. D., Tom, V. J., Mayes, D., Wagoner, G., Phillips, N., and Silver, J. (2006). Combining an autologous peripheral nervous system ‘‘bridge’’ and matrix modification
CSPGs in the Neural Stem Cell Niche
69
by chondroitinase allows robust, functional regeneration beyond a hemisection lesion of the adult rat spinal cord. J. Neurosci. 26, 7405–7415. Ida, M., Shuo, T., Hirano, K., Tokita, Y., Nakanishi, K., Matsui, F., Aono, S., Fujita, H., Fujiwara, Y., Kaji, T., and Oohira, A. (2006). Identification and functions of chondroitin sulfate in the milieu of neural stem cells. J. Biol. Chem. 281, 5982–5991. Ito, Y., Hikino, M., Yajima, Y., Mikami, T., Sirko, S., von Holst, A., Faissner, A., Fukui, S., and Sugahara, K. (2005). Structural characterization of the epitopes of the monoclonal antibodies 473HD, CS-56, and MO-225 specific for chondroitin sulfate D-type using the oligosaccharide library. Glycobiology 15, 593–603. Kabos, P., Matundan, H., Zandian, M., Bertolotto, C., Robinson, M. L., Davy, B. E., Yu, J. S., and Krueger, R. C., Jr. (2004). Neural precursors express multiple chondroitin sulfate proteoglycans, including the lectican family. Biochem. Biophys. Res. Commun. 318, 955–963. Kang, H. G., Evers, M. R., Xia, G., Baenziger, J. U., and Schachner, M. (2002). Molecular cloning and characterization of chondroitin-4-O-sulfotransferase-3. A novel member of the HNK-1 family of sulfotransferases. J. Biol. Chem. 277, 34766–34772. Kim, M., and Morshead, C. M. (2003). Distinct populations of forebrain neural stem and progenitor cells can be isolated using side-population analysis. J. Neurosci. 23, 10703–10709. Kitagawa, H., Tsutsumi, K., Tone, Y., and Sugahara, K. (1997). Developmental regulation of the sulfation profile of chondroitin sulfate chains in the chicken embryo brain. J. Biol. Chem. 272, 31377–31381. Kitagawa, H., Fujita, M., Ito, N., and Sugahara, K. (2000). Molecular cloning and expression of a novel chondroitin 6-O-sulfotransferase. J. Biol. Chem. 275, 21075–21080. Kobayashi, M., Sugumaran, G., Liu, J., Shworak, N. W., Silbert, J. E., and Rosenberg, R. D. (1999). Molecular cloning and characterization of a human uronyl 2-sulfotransferase that sulfates iduronyl and glucuronyl residues in dermatan/chondroitin sulfate. J. Biol. Chem. 274, 10474–10480. Kriegstein, A., and Alvarez-Buylla, A. (2009). The glial nature of embryonic and adult neural stem cells. Annu. Rev. Neurosci. 32, 149–184. Kusche-Gullberg, M., and Kjellen, L. (2003). Sulfotransferases in glycosaminoglycan biosynthesis. Curr. Opin. Struct. Biol. 13, 605–611. Leone, D. P., Relvas, J. B., Campos, L. S., Hemmi, S., Brakebusch, C., Fassler, R., ffrenchConstant, C., and Suter, U. (2005). Regulation of neural progenitor proliferation and survival by beta1 integrins. J. Cell Sci. 118, 2589–2599. Lim, D. A., Tramontin, A. D., Trevejo, J. M., Herrera, D. G., Garcia-Verdugo, J. M., and Alvarez-Buylla, A. (2000). Noggin antagonizes BMP signaling to create a niche for adult neurogenesis. Neuron 28, 713–726. Louis, S. A., Rietze, R. L., Deleyrolle, L., Wagey, R. E., Thomas, T. E., Eaves, A. C., and Reynolds, B. A. (2008). Enumeration of neural stem and progenitor cells in the neural colony-forming cell assay. Stem Cells 26, 988–996. Malatesta, P., Hartfuss, E., and Gotz, M. (2000). Isolation of radial glial cells by fluorescentactivated cell sorting reveals a neuronal lineage. Development 127, 5253–5263. Malatesta, P., Hack, M. A., Hartfuss, E., Kettenmann, H., Klinkert, W., Kirchhoff, F., and Gotz, M. (2003). Neuronal or glial progeny: Regional differences in radial glia fate. Neuron 37, 751–764. Marshall, 2nd, G. P., Reynolds, B. A., and Laywell, E. D. (2007). Using the neurosphere assay to quantify neural stem cells in vivo. Curr. Pharm. Biotechnol. 8, 141–145. Massey, J. M., Amps, J., Viapiano, M. S., Matthews, R. T., Wagoner, M. R., Whitaker, C. M., Alilain, W., Yonkof, A. L., Khalyfa, A., Cooper, N. G., Silver, J., and Onifer, S. M. (2008). Increased chondroitin sulfate proteoglycan expression in denervated
70
Swetlana Sirko et al.
brainstem targets following spinal cord injury creates a barrier to axonal regeneration overcome by chondroitinase ABC and neurotrophin-3. Exp. Neurol. 209, 426–445. Mikami, T., Mizumoto, S., Kago, N., Kitagawa, H., and Sugahara, K. (2003). Specificities of three distinct human chondroitin/dermatan N-acetylgalactosamine 4-O-sulfotransferases demonstrated using partially desulfated dermatan sulfate as an acceptor: Implication of differential roles in dermatan sulfate biosynthesis. J. Biol. Chem. 278, 36115–36127. Miyata, T., Kawaguchi, A., Okano, H., and Ogawa, M. (2001). Asymmetric inheritance of radial glial fibers by cortical neurons. Neuron 31, 727–741. Moritz, S., Lehmann, S., Faissner, A., and von Holst, A. (2008). An induction gene trap screen in neural stem cells reveals an instructive function of the niche and identifies the splicing regulator sam68 as a tenascin-C-regulated target gene. Stem Cells 26, 2321–2331. Nadanaka, S., Clement, A., Masayama, K., Faissner, A., and Sugahara, K. (1998). Characteristic hexasaccharide sequences in octasaccharides derived from shark cartilage chondroitin sulfate D with a neurite outgrowth promoting activity. J. Biol. Chem. 273, 3296–3307. Noctor, S. C., Flint, A. C., Weissman, T. A., Dammerman, R. S., and Kriegstein, A. R. (2001). Neurons derived from radial glial cells establish radial units in neocortex. Nature 409, 714–720. Noctor, S. C., Flint, A. C., Weissman, T. A., Wong, W. S., Clinton, B. K., and Kriegstein, A. R. (2002). Dividing precursor cells of the embryonic cortical ventricular zone have morphological and molecular characteristics of radial glia. J. Neurosci. 22, 3161–3173. Ohtake, S., Ito, Y., Fukuta, M., and Habuchi, O. (2001). Human N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase cDNA is related to human B cell recombination activating gene-associated gene. J. Biol. Chem. 276, 43894–43900. Pizzorusso, T., Medini, P., Berardi, N., Chierzi, S., Fawcett, J. W., and Maffei, L. (2002). Reactivation of ocular dominance plasticity in the adult visual cortex. Science 298, 1248–1251. Properzi, F., Carulli, D., Asher, R. A., Muir, E., Camargo, L. M., van Kuppevelt, T. H., ten Dam, G. B., Furukawa, Y., Mikami, T., Sugahara, K., Toida, T., Geller, H. M., et al. (2005). Chondroitin 6-sulphate synthesis is up-regulated in injured CNS, induced by injury-related cytokines and enhanced in axon-growth inhibitory glia. Eur. J. Neurosci. 21, 378–390. Pruszak, J., Ludwig, W., Blak, A., Alavian, K., and Isacson, O. (2009). CD15, CD24, and CD29 define a surface biomarker code for neural lineage differentiation of stem cells. Stem Cells 27, 2928–2940. Rietze, R. L., Valcanis, H., Brooker, G. F., Thomas, T., Voss, A. K., and Bartlett, P. F. (2001). Purification of a pluripotent neural stem cell from the adult mouse brain. Nature 412, 736–739. Rougon, G., Dubois, C., Buckley, N., Magnani, J. L., and Zollinger, W. (1986). A monoclonal antibody against meningococcus group B polysaccharides distinguishes embryonic from adult N-CAM. J. Cell Biol. 103, 2429–2437. Scadden, D. T. (2006). The stem-cell niche as an entity of action. Nature 441, 1075–1079. Shibata, T., Yamada, K., Watanabe, M., Ikenaka, K., Wada, K., Tanaka, K., and Inoue, Y. (1997). Glutamate transporter GLAST is expressed in the radial glia-astrocyte lineage of developing mouse spinal cord. J. Neurosci. 17, 9212–9219. Shihabuddin, L. S., Horner, P. J., Ray, J., and Gage, F. H. (2000). Adult spinal cord stem cells generate neurons after transplantation in the adult dentate gyrus. J. Neurosci. 20, 8727–8735. Silbert, J. E., and Sugumaran, G. (2002). Biosynthesis of chondroitin/dermatan sulfate. IUBMB Life 54, 177–186.
CSPGs in the Neural Stem Cell Niche
71
Sirko, S., von Holst, A., Wizenmann, A., Gotz, M., and Faissner, A. (2007). Chondroitin sulfate glycosaminoglycans control proliferation, radial glia cell differentiation and neurogenesis in neural stem/progenitor cells. Development 134, 2727–2738. Sirko, S., Neitz, A., Mittmann, T., Horvat-Brocker, A., von Holst, A., Eysel, U. T., and Faissner, A. (2009). Focal laser-lesions activate an endogenous population of neural stem/ progenitor cells in the adult visual cortex. Brain 132, 2252–2264. Sirko, S., von Holst, A., Weber, A., Wizenmann, A., Theocharidis, U., Gotz, M., and Faissner, A. (2010). Chondroitin sulfates are required for FGF-2-dependent proliferation and maintenance in neural stem cells and for EGF-dependent migration of their progeny. Stem Cells 28(4), 775–787. Sommer, I., and Schachner, M. (1981). Monoclonal antibodies (O1 to O4) to oligodendrocyte cell surfaces: An immunocytological study in the central nervous system. Dev. Biol. 83, 311–327. Streit, A., Yuen, C. T., Loveless, R. W., Lawson, A. M., Finne, J., Schmitz, B., Feizi, T., and Stern, C. D. (1996). The Le(x) carbohydrate sequence is recognized by antibody to L5, a functional antigen in early neural development. J. Neurochem. 66, 834–844. Temple, S. (2001). The development of neural stem cells. Nature 414, 112–117. Ueoka, C., Kaneda, N., Okazaki, I., Nadanaka, S., Muramatsu, T., and Sugahara, K. (2000). Neuronal cell adhesion, mediated by the heparin-binding neuroregulatory factor midkine, is specifically inhibited by chondroitin sulfate E. Structural ans functional implications of the over-sulfated chondroitin sulfate. J. Biol. Chem. 275, 37407–37413. von Holst, A., and Rohrer, H. (1998). Culture of avian sympathetic neurons. Curr. Top. Dev. Biol. 36, 161–182. von Holst, A., Sirko, S., and Faissner, A. (2006). The unique 473HD-chondroitinsulfate epitope is expressed by radial glia and involved in neural precursor cell proliferation. J. Neurosci. 26, 4082–4094. von Holst, A., Egbers, U., Prochiantz, A., and Faissner, A. (2007). Neural stem/progenitor cells express 20 tenascin C isoforms that are differentially regulated by Pax6. J. Biol. Chem. 282, 9172–9181. Wodarz, A., and Huttner, W. B. (2003). Asymmetric cell division during neurogenesis in Drosophila and vertebrates. Mech. Dev. 120, 1297–1309. Yamauchi, S., Mita, S., Matsubara, T., Fukuta, M., Habuchi, H., Kimata, K., and Habuchi, O. (2000). Molecular cloning and expression of chondroitin 4-sulfotransferase. J. Biol. Chem. 275, 8975–8981. Zou, P., Zou, K., Muramatsu, H., Ichihara-Tanaka, K., Habuchi, O., Ohtake, S., Ikematsu, S., Sakuma, S., and Muramatsu, T. (2003). Glycosaminoglycan structures required for strong binding to midkine, a heparin-binding growth factor. Glycobiology 13, 35–42.
C H A P T E R
F O U R
Transcript Analysis of Stem Cells Alison V. Nairn, Mitche dela Rosa, and Kelley W. Moremen Contents 1. Introduction 2. qRT-PCR as a Tool for Determining Transcript Analysis for Glycan-Related Gene Expression 2.1. Materials and equipment 2.2. Assembly of murine and human glycan-related gene lists 2.3. Primer design 2.4. Primer validation 2.5. RNA isolation 2.6. cDNA synthesis 2.7. Normalization gene selection 2.8. qRT-PCR data analysis 2.9. Statistical analysis 2.10. Display of qRT-PCR data 3. Examples of the Applications of qRT-PCR Transcript Analysis to Investigate Changes in Glycan-Related Gene Expression in Stem Cells 3.1. qRT-PCR analysis of glycosaminoglycan biosynthetic genes in pluripotent and differentiated murine embryonic stem cells 3.2. qRT-PCR analysis of sphingolipid biosynthetic genes in pluripotent and differentiated murine embryonic stem cells 3.3. Transcript analysis of genes involved in N- and O-linked glycan biosynthesis 3.4. Comparison transcript abundance of pluripotency and differentiation marker genes in human ES cells Acknowledgments References
74 75 75 76 76 77 79 80 80 80 81 81
83
84 85 85 86 88 88
The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79004-2
#
2010 Elsevier Inc. All rights reserved.
73
74
Alison V. Nairn et al.
Abstract Quantitative real-time polymerase chain reaction (qRT-PCR) is a flexible and scalable method for analyzing transcript abundance that can be used at a single gene or high-throughput (> 100 genes) level. Information obtained from this technique can be used as an indicator of potential regulation of glycosylation at the transcript level when combined with glycan structural or protein abundance data. This chapter describes detailed methods to design and perform qRT-PCR analyses and provides examples of information that can be obtained from the technique.
1. Introduction The significant and varied roles of carbohydrates in protein bioactivity, folding, localization, and immunogenicity have been investigated over the past several decades (Lowe, 2001; Lowe and Marth, 2003; Ohtsubo and Marth, 2006; Schachter, 2000; Varki, 1993). In addition, several reports have highlighted the roles of glycans in cellular differentiation and development (Cailleau-Thomas et al., 2000; Haltiwanger and Lowe, 2004; Muramatsu and Muramatsu, 2004; Schwarzkopf et al., 2002). Despite the vast body of literature on the genetic and biochemical roles of glycans, little is known about the global regulation of glycan synthesis and degradation. The addition and modification of glycan structures on lipid and protein acceptors is a nontemplate driven, posttranslational process, which makes determining modes of regulation difficult. Factors, such as accessibility to appropriate glycan-modifying enzymes, availability of sugar-nucleotide precursors, the abundance of protein, and lipid acceptor molecules, among others, can impact the efficiency and stability of individual glycan additions onto protein and lipid-linked acceptors. However, there is evidence that regulation of cellular glycosylation at the transcript level provides a considerable amount of global control (Comelli et al., 2006; Nairn et al., 2008). Differentiation of pluripotent stem cells provides a model system for analyzing changes that occur during mammalian embryogenesis and development. The addition of media components, such as cytokines and growth factors, allows researchers to produce defined, differentiated cell populations from pluripotent embryonic stem cells (ESCs; Jaenisch and Young, 2008). Recently, a process known as in vitro reprogramming was established to produce pluripotent stem cells from several adult cell types by ectopic expression of several transcription factors (Maherali et al., 2007; Okita et al., 2007; Takahashi and Yamanaka, 2006; Wernig et al., 2007; Yu et al., 2007). Both embryonic and induced pluripotent stem (iPS) cells have been differentiated into several germ layer-derived cell populations for biochemical and potentially therapeutic purposes. The ability to produce large numbers of homogeneous, defined populations of differentiated cells from pluripotent progenitors is an ideal model system to profile changes in gene expression and
Transcript Analysis of Stem Cells
75
biosynthetic pathway control during development. For studies relating to mammalian glycobiology, the ESC differentiation model system allows numerous avenues to profile the contributions of glycan structures during animal embryogenesis. As an initial step, we have been correlating transcript levels with glycan structural data during ESC differentiation to determine the scope of glycan structural changes and whether these alterations result from changes in expression of the biosynthetic machinery. In order to investigate changes in glycan-related gene expression that accompany stem cell differentiation, we performed a high-throughput transcript analysis of undifferentiated, pluripotent stem cells and several differentiated cell types. Several methods for analyzing gene expression are currently available, including hybridization-based techniques (i.e., microarray), sequence-based techniques (i.e., SAGE), and amplification-based techniques (i.e., RT-PCR), and each has potential advantages and drawbacks (Nairn and Moremen, 2009). Here, we present a quantitative real-time polymerase chain reaction (qRT-PCR) platform that can be used to analyze transcript levels of any number of glycan-related genes in cells and tissues. Several examples of the application of this technique to determine changes in transcript abundance in pluripotent and differentiated stem cells are also presented.
2. qRT-PCR as a Tool for Determining Transcript Analysis for Glycan-Related Gene Expression 2.1. Materials and equipment 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
Nuclease-free water Mouse or human genomic DNA (BioLine) iQTM SYBRÒ Green Supermix (Bio-Rad) Gene-specific primer pairs for glycan-related enzymes and proteins (500 nM) Housekeeping gene primer pairs (500 nM) Stem cell marker primer pairs (500 nM) iCycler or myIQ real-time detection system (Bio-Rad) or RealPlex2 MasterCycler (Eppendorf ) Nuclease-free Plasticware (pipet tips, microfuge tubes, etc.) 96-well PCR plates appropriate for cycler used Optical plate sealing film Thermoplate sealer (Eppendorf ) Centrifuge with microtiter plate attachment for swinging bucket rotor Optional: automated pipetting system (epMotion 5075, Eppendorf ) Trizol Reagent (Invitrogen) Phase Lock Gel (Eppendorf )
76
16. 17. 18. 19. 20.
Alison V. Nairn et al.
LiCl (2.5 M) RNeasy Plus Mini RNA isolation Kit (Qiagen) NanoDrop Spectrophotometer (Thermo Scientific) SuperScript III First Strand Synthesis Kit (Invitrogen, Carlsbad, CA) Flash-frozen stem cell pellets
2.2. Assembly of murine and human glycan-related gene lists As previously described for our murine glycan-related gene list (Nairn et al., 2008), several sources were used to assemble a comprehensive human glycanrelated gene list. These include the database of Carbohydrate Active Enzymes (www.cazy.org; Coutinho and Henrissat, 1999), a web-based genomic resource for animal lectins (www.imperial.ac.uk/research/animallectins/; Taylor and Drickamer, 2006) organized by Dr Kurt Drikamer, the Kyoto Encyclopedia of Genes and Genomes (www.genome.jp/kegg/; Kanehisa and Goto, 2000; Kanehisa et al., 2006, 2008), the gene list for the GLYCOv2 and GLYCOv3 gene chips from the Consortium for Functional Genomics (CFG; www.functionalglycomics.org; Bax et al., 2007; Comelli et al., 2006; Smith et al., 2005), the microarray gene list from the Glyco-Chain Expression Laboratory (Naito et al., 2007; Yamamoto et al., 2007), the Transport Classification Database (www.tcdb.org/; Saier et al., 2006), NCBI (www.ncbi.nlm.nih.gov; Wheeler et al., 2007) SOURCE (http://source.stanford.edu; Diehn et al., 2003), contributions from collaborating investigators, and extensive searches of the primary literature. Prevention of duplicate entries and the treatment of genes with high DNA sequence similarity or multifunctional genes (i.e., glycosyltransferase activity and carbohydrate binding domains) were performed as described previously (Nairn et al., 2008). The murine glycan-related gene list can be found as a supplemental file (Nairn et al., 2008) and the human glycanrelated gene list is unpublished, but is available on request. A list of stem cell pluripotency and differentiation markers was assembled and was included as a quality control check of sample status (Nairn et al., 2007).
2.3. Primer design A set of restrictive criteria was selected for all primers, so that one set of amplification conditions could be used for all genes being assayed. Coding region sequences for a specific gene were compared with the corresponding genomic sequence in the NCBI database via the BLAST search algorithm (Altschul et al., 1990) to determine intron/exon boundaries. A single coding exon (usually the largest coding exon) was submitted to the Primer3 webbased primer design program (Rozen and Skaletsky, 2000; frodo.wi.mit. edu/cgi-bin/primer3/primer3_www.cgi) with the following parameters: product size ranges 65–75 bp, primer size 19–21 bp, primer Tm 59–61 C
Transcript Analysis of Stem Cells
77
with a maximum Tm difference between primers for a given gene of 1 C, maximum self-complementarity of six bases, maximum 30 self-complementarity of five bases, and maximum repeat of a single base (poly-X) of five bases. All other settings were the default values. Primer pairs were designed for a number of housekeeping genes and stem cell pluripotency and differentiation markers, as well as the glycan-related genes (Nairn et al., 2007, 2008). Primers were synthesized by Eurofins MWG Operon (Huntsville, AL).
2.4. Primer validation Primer validation, which includes ensuring specificity of primer annealing and determining the efficiency of product amplification, is a critical element for successful transcript analysis. The total volume of amplification reactions was either 20 ml for Bio-Rad real-time PCR machines or 5 ml for Eppendorf machines. Reactions consisted of 25% diluted mouse or human genomic DNA (gDNA) template, 25% primer pair mix (500 nM each primer, 125 nM final concentration; Eurofins MWG Operon), and 50% iQTM SYBRÒ Green Supermix (Bio-Rad, Hercules, CA). For high-throughput applications, an automated pipetting system (i.e., Eppendorf’s epMotion 5075) is helpful for setting up a large number of reactions on multiple plates. Plates containing 5 ml volume reactions were sealed with a heat sealer to protect against evaporation. Plates containing 20 ml volume reactions were sealed with adhesive films. Sealed plates were centrifuged at 2000 rpm for 5 min to collect reaction components at the bottom of the 96-well plate. Amplifications were performed in a 96-well iCycler or myIQ RealTime Detection System (Bio-Rad) or a RealPlex2 MasterCycler (Eppendorf) with the following cycling conditions: 95 C for 3 min; followed by 40 cycles of 95 C for 10 s (denaturing), 65 C for 45 s (annealing), 78 C for 20 s (data collection); followed by a melt curve program (95 C for 1 min, 55 C for 1 min then increasing temperature of 0.5 C per cycle for 80 cycles of 10 s each). To ensure overall consistency of amplification, primer pairs were tested at a single DNA concentration in triplicate and the average of the cycle threshold (Ct) values was compared with that of a housekeeping gene. Primer pairs that yielded an average Ct within 2 units of the average Ct for the control gene were tested for efficiency and those outside the 2 Ct window were redesigned (Fig. 4.1A). A typical amplification curve from a gDNA dilution series is shown in Fig. 4.1B. The efficiency of amplification for each primer pair was determined in duplicate using serial dilutions of mouse gDNA as the template by the method of Liu and Saint (2002). The standard curve method (Livak and Schmittgen, 2001) was applied to the analysis of data from each primer set to generate plots of Ct versus log concentration of template and the slope was used to determine amplification efficiency, where efficiency (E) ¼ 10 1/slope 1 (Fig. 4.1C). For
78
Alison V. Nairn et al.
A 32 30
Average Ct
28 26 24 22
+2Ct
20
-2Ct
18 16 14 St3gal1 St3gal2 St3gal3 St3gal4 St3gal5 St3gal6 St6gahac1 St6gahac2 St6gahac3 St6gahac4 St6gahac5 St6gahac6 St6gal1 St6gal2 St8sia1 St8sia2 (STX) St8sia3 St8sia4 (PST) St8sia5 St8sia6 b3gnt1 b3gnt2 b3gnt3 b3gnt4 b3gnt5 b3gnt6 b3gnt7 b3gnt8 b3gnt8 b3gnt8
12
Gene-specific primer pairs
B
34
620
32
E = 100% E = 90%
540 30
460
Average Ct
Relative flourescence units (RFU)
C 700
380 300 220 NTC
60 -20
2
6
10 14
26 24
Threshold
140
E = 110%
28
18
22
26
30
34
22 20 -3
38 42
-2
D
E
170 150
0
50 40
130 110
d(RFU)/dT
d(RFU)/dT
-1
Log starting template quantity
Cycle number
90 70 50
NTC
30
30 20 NTC 10 0
10 -10 55
60
65
70
75
80
Temperature(°C)
85
-10 90
55
60
65
70
75
80
85
90
Temperature(°C)
Figure 4.1 Primer validation for qRT-PCR. Panel A: Primer pairs were analyzed by qRT-PCR using genomic DNA (gDNA) as template and Ct values were compared to Rpl4 as reference. Primer sets that generated Ct values with 2 Ct units of Rpl4 (shaded area) were considered acceptable for further validation. Primer pairs falling outside the acceptable range are indicated with an asterisk. Panel B: Typical amplification curve generated with gene-specific primers and mouse gDNA as template. The threshold for
Transcript Analysis of Stem Cells
79
validation purposes, we selected an acceptable range of 100 10% efficiency with gDNA as template (shown as dotted lines in Fig. 4.1C). Following the amplification and melt curve analysis, data was set to a common threshold and the efficiency of the primer pair was determined from the slope of the standard curve using software supplied with the qRTPCR instrumentation (Bio-Rad or Eppendorf ). Melt curves were analyzed for the presence of a single peak of d(RFU)/dT at 80–86 C indicating a single amplification product (Fig. 4.1D). An example of a melt curve analysis where a primer pair amplified more than one product is shown in Fig. 4.1E. Primers that failed any of the validation steps were redesigned and reanalyzed until a suitable primer pair was obtained.
2.5. RNA isolation Stem cell pellets were harvested and flash-frozen in liquid nitrogen and stored at 80 C until use. Since all primer sets are designed within a single exon, it is critical that no gDNA remains in the RNA preparation. A screen for gDNA in the isolated RNA is included in the cDNA synthesis protocol. We have used two different methods that produced RNA free of gDNA. Cell pellets were homogenized using a polytron, and RNA was isolated using Trizol Reagent (Invitrogen) and Phase Lock Gel (Eppendorf ) following manufacturer’s instructions. Total RNA was precipitated using LiCl (2.5 M final concentration), resuspended in RNase-free water and treated with RNase-free DNase (Ambion) to remove gDNA. Samples were reextracted with Trizol then reprecipitated with LiCl and resuspended in RNase-free water and used for cDNA synthesis. Alternatively, the RNeasy Plus Mini RNA isolation kit (Qiagen) can be used, which contains a column to remove gDNA. The second option is preferred for its ease of use and faster isolation protocol. Samples were quantitated and checked for purity using a NanoDrop spectrophotometer.
determining Ct values is indicated by the dotted line. The baseline fluorescence trace expected from a ‘‘no template control’’ (NTC) is also indicated on the graph. Panel C: Typical standard curve generated by qRT-PCR of a given primer pair to determine amplification efficiency using a dilution series of mouse gDNA as template. The solid line indicates the linear regression for the data points at each template concentration. The dashed and dotted lines indicate the lower (90%) and upper (110%) efficiency limits, respectively, for primer validation. Panel D: Melt curve analysis of qRT-PCR amplimers generated following the standard curve reactions in shown in Panel C indicating a single sharp peak (single product) formed during the amplification. Panel E: Melt curve analysis of standard curve reactions for primers that failed our quality control validation illustrating the presence of multiple products (peaks) in an amplification reaction. This research was originally published as a supplementary figure in Nairn et al. (2008)#. The American Society of Biochemistry and Molecular Biology.
80
Alison V. Nairn et al.
2.6. cDNA synthesis The SuperScript III First Strand Synthesis kit (Invitrogen) was used to synthesize cDNA from 1 mg total RNA according to the manufacturer’s instructions except that both oligo(dT) and random-primers (1:1) were included in the cDNA synthesis reactions. A control reaction lacking reverse transcriptase (‘‘No-RT’’) was prepared and analyzed to detect the presence of contaminating gDNA. For qRT-PCR reactions, cDNA reaction products (20 ml) were diluted 1:20 in water and used as template in triplicate reactions for each primer pair assayed.
2.7. Normalization gene selection Several housekeeping genes were analyzed to determine which gene had the most stable expression over the range of samples for a given study. qRT-PCR reactions with cDNA templates from stem cell samples were assayed using several housekeeping genes to determine the variability of expression across all cell types. The gene with the lowest variation across all tissues was selected as the normalization gene for all samples. Alternatively, several software programs (i.e., GeNorm and Normfinder; Andersen et al., 2004; Vandesompele et al., 2002) are available for selection of normalization gene(s).
2.8. qRT-PCR data analysis A 96-well plate format was used for qRT-PCR reactions using the same amplification conditions described above for primer validation where gDNA was used as a template. The ‘‘No-RT’’ control cDNA template was tested with several primer pairs to confirm that the sample was free of contaminating gDNA prior to analysis of the reverse transcribed template. Samples from each stem cell stage were analyzed using primer pairs for pluripotency and differentiation markers to ensure the status of the cells prior to glycan-related gene expression analysis. Each primer pair was analyzed in triplicate for each cDNA sample. Following each amplification, the threshold was set to a common value to maintain consistency between runs and data for each primer pair were averaged and the standard deviation was determined. We chose an arbitrary cutoff of 0.5 Ct for the standard deviation (Bustin, 2004). Triplicate values with a standard deviation >0.5 Ct were reassayed. The raw fluorescence data from the PCR machines were also analyzed using LinRegPCR (Ramakers et al., 2003) to determine the amplification efficiency of the individual reactions and a cutoff of < 5% was set as acceptable variability. Averaged Ct data were transformed to linear amplimer abundance values (2 Ct) and normalized to the housekeeping gene.
Transcript Analysis of Stem Cells
81
To determine the relative transcript levels for the glycan-related genes in a given cDNA sample, we utilized the DDCt method (Livak and Schmittgen, 2001). This analysis method requires the assumption that the amplification efficiencies of all reactions are approximately equal. A test for equal efficiencies is to plot DCt (Ctgene Ctcontrol) versus template concentration for a dilutions series and ensure that the slope of the generated line is <0.1. Modeling conditions within these restrictions translates into an acceptable difference in amplification efficiency of 100 5%. Primer efficiency values from all samples tested were below the 5% cutoff (generally <3%). The normalization gene, Rpl4, was included as a triplicate set of qRT-PCR reaction in all 96-well plates to control for interplate and machine variations.
2.9. Statistical analysis A limitation on the acceptable variability between technical replicates (0.5 Ct units, described above) was included in our original analysis, which controls for the amount of variation (i.e., pipetting error) between replicates. The average and standard deviation of triplicate analyses is calculated and used to plot the data as histograms of ‘‘Relative Transcript Abundance.’’ We have chosen to expand our analyses to include four separate biological replicates in addition to technical replicates. This expansion of the analysis allows us to determine the statistical significance in changes in transcript abundance between biological states relative to the biological variation of transcript levels within a given state. Currently, we are analyzing the data using the nonparametric Mann–Whitney test to generate significance p < 0.5 for comparisons of transcript abundance values between pluripotent and differentiated samples for a given gene. The ability to perform robust statistical analysis on replicate biological samples is commonly limited by the availability of independent samples and restrictions of cost for the reagents and supplies for the replicate analysis.
2.10. Display of qRT-PCR data Linear, amplimer abundance data normalized to a control gene, referred to as ‘‘Relative Transcript Abundance,’’ were plotted in histogram form on a log10 scale due to the wide dynamic range of the technique. In order to provide a framework for interpretation of the expression data, we chose to pair the data with biosynthetic pathways (Fig. 4.2). The biosynthetic pathway steps for each class of mammalian glycoconjugate were assigned to individual or sets of gene products based on several criteria. The pathways were assembled based on enzyme specificities determined in the primary literature, several texts in the field (Taniguchi et al., 2002; Varki et al., 1999), and glycan biosynthetic pathway information from the KEGG database (Kanehisa and Goto, 2000; Kanehisa et al., 2006, 2008). A complete set of biosynthetic pathways were
Globo-series
Ganglio-series
a4
SO3H 3
SO3H 3
2
2 a4
b4
a3
Lacto-series
a3
b3
3
3
8
1
b1
1
Isoglobo-series
a3
4
Gala-series
5
7
b1
6
10
b3
b4
b4
9
Ceramide
GlcNAc
Galactose
Neu5Ac
GalNAc
Glucose
11
Neolacto-series ExE/ES
54
−2 −4 −6 −8 −10 ES
EB
*
*
*
ExE
*
*
B4galt5
B4galt4
B4galt3
B4galt2
B4galt1
B3galt5
8
B3galt2
7
B3galt1
6
B3gnt5
5
B4galnt1
4
A3galt2
3
B4galt6
2
Ugcg
1
Ugt8a
St3gal5
* Gal3st1
1 ´ 100 1 ´ 10-1 1 ´ 10-2 1 ´ 10-3 1 ´ 10-4 1 ´ 10-5 1 ´ 10-6
A4galt
Relative transcript abundence (normalized to RPL4)
Fold change (EB or ExE/ES)
EB/ES 10 8 6 4 2
9 10
11
* = p < .05
Transcript Analysis of Stem Cells
83
assigned and diagrams were generated for use in profiling glycan-related gene transcript abundance in mouse tissues (Nairn et al., 2008). In recent analyses, we have included statistical analysis of the biological replicates for relative transcript abundance data to indicate statistically significant changes (p < 0.05) and also provided a separate presentation of the fold-changes in transcript abundance as a separate histogram (Fig. 4.2).
3. Examples of the Applications of qRT-PCR Transcript Analysis to Investigate Changes in Glycan-Related Gene Expression in Stem Cells As an example of the use of glycan-related transcript profiling paired with glycan compositional and structural data in ESC differentiation, we have previously focused on glycosaminoglycans (GAGs) and glycolipids for our initial studies. An overview of these projects utilizing mouse ESCs is provided as an example of the information obtained with the qRT-PCR platform. Subsequent work, that is just being completed, has focused on transcripts and structures on N- and O-glycans in mouse and human ESC differentiation. Our preliminary analysis of human stem cell lines revealed differences in transcript abundances for several pluripotency and differentiation markers between different human ESC lines.
Figure 4.2 An example of the display of transcript analysis data with biosynthetic pathways. A schematic representation of the biosynthesis of various classes of glycolipids is shown in the upper panel (including a key for glycan components in the pathway). Linkages are shown for each step of the biosynthetic pathway and the numbers in the ovals designate the pathway steps in the upper panel that link to the transcript abundance data in the corresponding numbered step in the lower panel (plotted as a histogram on a log10 scale). Relative transcript abundances for undifferentiated mES and differentiated EB or ExE cell types are presented as a clustered set of histograms above the corresponding pathway step number (numbered oval) and gene names. Multiple genes for a given pathway step are listed in cases where multiple distinct subunits contribute to catalysis or where several genes within a common family encode enzymes capable of creating the specified linkage. Error bars represent one standard deviation from the mean for four independent biological replicates. Asterisks identify instances where changes in transcript abundance between mES and EB or ExE were statistically significant (p < 0.05) using a Mann–Whitney test. The center panel represents fold change in transcript abundance relative to undifferentiated mES. The center horizontal black bar represents no change between samples and positive values indicate an increase in transcript abundance in differentiated cells while negative values indicate a decrease.
84
Alison V. Nairn et al.
3.1. qRT-PCR analysis of glycosaminoglycan biosynthetic genes in pluripotent and differentiated murine embryonic stem cells The extracellular environment and glycocalyx of animal cells is rich in GAGs (Linhardt and Toida, 2004). Several of the enzymes involved in the biosynthesis of these anionic, linear polysaccharides have been cloned and expressed, but the specificity and regulation of these enzymes in not understood (Gama and Hsieh-Wilson, 2005; Habuchi et al., 2002; Raman et al., 2005). The determination GAG biosynthetic pathways revealed that there are several isoforms for many of the enzymes involved (Gama and HsiehWilson, 2005; Habuchi et al., 2002). The expression of these isoforms varies by cell type and stage of development implying a role for GAG in cellular differentiation (Hacker et al., 2005; Lin, 2004). GAGs have also been shown to play roles in the binding and activation of growth factors producing a signaling cascade essential for cellular development (Linhardt and Toida, 2004; Thisse and Thisse, 2005). In a novel glycomic approach, mouse ESCs were used as an in vitro model of early embryonic development to examine changes in GAG content and structures to compare them with transcript abundance for genes involved in their synthesis during stem cell differentiation (Nairn et al., 2007). The study analyzed pluripotent mouse embryonic stem cells (mESCs) and two different differentiated cell populations, embryoid bodies (EB) and extraembryonic endoderm (ExE). EBs are a heterogeneous mixture of the three germ layers, endoderm, ectoderm, and mesoderm (MESO), while ExE is a homogeneous population resulting from the treatment of mESCs with retinoic acid. A list of genes was assembled for this study that included genes involved in the production of precursors important for the biosynthesis of uronic acid-containing GAGs, hyaluronan biosynthesis and catabolism, GAG core proteins, biosynthesis of chondroitin sulfate (CS)/dermatan sulfates (DS) and heparan sulfate (HS) core structures, and modification of HS and CS/ DS repeating units (Nairn et al., 2007). As the discovery of new GAG biosynthetic and modifying genes, or identification of new GAG core protein encoding genes continues, they can easily be added to the gene list for primer design. This study revealed several correlations between transcript abundance for GAG biosynthetic genes and GAG structural and abundance data. Increases in the yield of hyaluronan from differentiated cell populations could be the result of increased transcript abundance of hyaluronan synthase-2 (Has2). Transition of mESCs to EB or ExE was accompanied by increases in CS/DS and HS, but these changes were not accompanied by changes in transcript abundances for genes involved in the synthesis of early precursors, suggesting regulation at another level. Changes in transcript
Transcript Analysis of Stem Cells
85
abundance for genes encoding several of the sulfotransferase isoforms producing alterations in the fine structure of CD/DS and HS were also observed. By combining transcript analysis with structural analysis in a glycomic approach, a better understanding of the role of GAGs in stem cell differentiation can be obtained.
3.2. qRT-PCR analysis of sphingolipid biosynthetic genes in pluripotent and differentiated murine embryonic stem cells Glycolipids have been shown to play roles in development and embryogenesis (Fenderson et al., 1990; Muramatsu, 2000). Two subclasses of glycolipids, glycosphingolipids (GSLs) and sphingolipids (SLs), contain ceramide as a common structural unit. During embryogenesis, a change in ceramide levels in GSLs and SLs occurs and may play a role in developmental signaling (Bieberich, 2004; Bieberich et al., 2001, 2003, 2004; Fenderson et al., 1990; Krishnamurthy et al., 2007; Ngamukote et al., 2007). Murine embryonic stem cells (mESCs) and EBs were used as a developmental system to investigate changes in transcript abundance for genes involved in ceramide metabolism and this data was used to compare with the structures of isolated ceramide subspecies (Park et al., 2010). The list of genes assembled for this study included genes involved in SL biosynthesis and fatty acyl-CoA elongase genes that are involved in the production of cosubstrates for the ceramide synthases (CerSs). The ability to add primer pairs for newly characterized genes in a complementary biosynthetic pathway to the core gene list of glycan-related genes for qRT-PCR analysis was particularly beneficial to this study because the genes in the CerS family were only recently characterized (Pewzner-Jung et al., 2006). Transcript profiling of genes involved in ceramide biosynthesis in mESC differentiation provided novel information about GSL synthesis during embryogenesis. Transcripts for several of the CerS genes increased during differentiation of mESCs to EBs and the structural analysis revealed that the specific molecular species generated by these genes also increased (Park et al., 2010). Transcript analysis of fatty acyl-CoA elongase genes (Elovls) showed an increase in transcripts for Elovl6 in EBs compared to mESCs, which correlated with an increase in steroyl and oleoyl-CoAs.
3.3. Transcript analysis of genes involved in N- and O-linked glycan biosynthesis Transcript analysis of pluripotent mESCs and differentiated populations (EB and ExE) were analyzed to investigate potential changes in transcripts for genes involved in N- and O-linked glycosylation during differentiation.
86
Alison V. Nairn et al.
Differences in transcript abundances for several genes involved in these biosynthetic pathways were observed when comparing pluripotent and differentiated cell types. We are in the process of pairing the transcript data with structural data to determine which changes in transcript abundance correlate with changes in N- and O-glycan structures from the mESC populations. This data will provide insight into which structures may be regulated at the transcriptional level.
3.4. Comparison transcript abundance of pluripotency and differentiation marker genes in human ES cells A glycan-related gene list was created for the human versions of the glycanrelated genes found in the mouse list with the additional inclusion of housekeeping genes and human stem cell pluripotency and differentiation markers. Biochemical pathway diagrams with the equivalent human genes were also generated for pairing with transcript data. It is important to note that in some instances, a gene may be expressed in one genome but not in another. For example, glycoprotein a-1,3 galactosyltransferase (Ggta) is normally expressed in the mouse genome, but an equivalent, nonpseudogene is not present in the human genome, as this is a human tumor rejection antigen. Initial experiments on human ESCs focused on investigating differences in transcript abundances between four different cell lines (BG01, BG02, H7, and H9) using a panel of stem cell marker genes. If the transcript analysis from different cell lines gave highly similar results, the need to assay more than one cell line might be eliminated for future experiments encompassing a large number of genes. Transcript analysis of different human cell lines revealed that genes involved in maintaining pluripotency in human ESCs (OCT4, NANOG, SOX2) showed elevated transcript levels relative to differentiation markers, with the exception of the neural ectoderm (NE) marker, NESTIN (Fig. 4.3). There were variations among transcript abundance levels for pluripotency genes between the four different human ESC lines. BG01 and BG02 lines expressed NANOG at 5–10-fold higher levels than either the H7 or H9 lines. Greater variation in transcript abundance between cell lines could be observed with the panel of differentiation markers for mesoendoderm (ME), MESO, definitive endoderm (DE), NE, and ExE. In some cases, the differences were as great as 50-fold, for example, the differences in NKX2.5 expression for BG01 and BG02 lines. This analysis highlights the necessity of comparing gene expression levels between the various available human ESC lines.
87
1 ´ 100 1 ´ 10-1 1 ´ 10-2 1 ´ 10-3 1 ´ 10-4
Mesoderm
Definitive endoderm
Mesoendoderm BG01
BG02
H7
AFP
SOX1 PAX6 NESTIN
FOXA2 CXCR4 GOOSECOID
Pluripotency
TBX20 ISLETI NKX2.5
1 ´ 10-6
WNT3A BRACHYURY EOMES
1 ´ 10-5 OCT4 NANOG SOX2
Relative transcript abundance (normalized to GAPDH)
Transcript Analysis of Stem Cells
Extraembryonic endoderm
Neural ectoderm
H9
Figure 4.3 Relative transcript abundance for stem cell marker genes in four different human embryonic stem cell lines (BG01, BG02, H7, and H9). Relative transcript abundance for stem cell pluripotency and differentiation marker genes (noted by brackets) is plotted on a log10 scale. Cells were harvested, flash-frozen and isolated RNA was converted into cDNA to use as template for qRT-PCR analysis with genespecific primers. Error bars represent one standard deviation from the mean for triplicate reactions.
Next, we analyzed transcripts from human ESC samples harvested at different time points during differentiation of pluripotent cells toward a MESO lineage (Fig. 4.4). The addition of specific cytokines and growth factors to pluripotent BG01 ESCs produced a population of cells with increased transcript levels of MESO-specific marker genes and reduced transcript levels of pluripotency marker genes over the 144-h time course. Also, at intermediate time points (48–96 h), transcript levels for the ME marker genes increased and then decreased during the transition from pluripotent cell types (0 h) to the differentiated MESO lineage (144 h). Experiments that combine transcript and structural data on several differentiated human ESC populations are currently underway. The analysis of both pluripotent and differentiated human ESC lines with our panel of glycan-related genes, may provide insight into cell-line specific and general changes in transcript abundance involved in cellular development. Determination of glycan biomarkers for cellular differentiation could aid in sorting cell populations for potential therapeutic approaches.
88
Alison V. Nairn et al.
1 ´ 10-1 1 ´ 10-2 1 ´ 10-3 1 ´ 10-4
Pluripotency
NKX2.5
ISLET1
TBX20
EOMES
BRACHYURY
WNT3A
SOX2
1 ´ 10-6
NANOG
1 ´ 10-5 OCT4
Relative transcript abundance (normalized to GAPDH)
1 ´ 100
Mesoderm
Mesoendoderm 0h
24 h
48 h
72 h
96 h
144 h
Figure 4.4 Relative transcript abundance for stem cell marker genes in BG01 human ESCs during a time course differentiation into a mesoderm lineage. Relative transcript abundance for stem cell pluripotency, ME and mesoderm marker genes (noted by brackets) is plotted on a log10 scale. Pluripotent BG01 line human ESCs were treated with specific cytokines and growth factors (Dr Steve Dalton, personal communication) to induce differentiation toward a mesoderm lineage. Cells were harvested at various time points, flash-frozen and isolated RNA was converted into cDNA to use as template for qRT-PCR analysis with gene-specific primers. Error bars represent one standard deviation from the mean for triplicate reactions.
ACKNOWLEDGMENTS This research was supported by NIH grant RR018502. The authors thank Dr Stephen Dalton and his laboratory for providing stem cells used in this work. The authors also wish to thank and acknowledge Shanranya Raghunath for her assistance with the human stem cell analysis.
REFERENCES Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Andersen, C. L., Jensen, J. L., and Orntoft, T. F. (2004). Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250.
Transcript Analysis of Stem Cells
89
Bax, M., Garcia-Vallejo, J. J., Jang-Lee, J., North, S. J., Gilmartin, T. J., Hernandez, G., Crocker, P. R., Leffler, H., Head, S. R., Haslam, S. M., Dell, A., and van Kooyk, Y. (2007). Dendritic cell maturation results in pronounced changes in glycan expression affecting recognition by siglecs and galectins. J. Immunol. 179, 8216–8224. Bieberich, E. (2004). Integration of glycosphingolipid metabolism and cell-fate decisions in cancer and stem cells: Review and hypothesis. Glycoconj. J. 21, 315–327. Bieberich, E., MacKinnon, S., Silva, J., and Yu, R. K. (2001). Regulation of apoptosis during neuronal differentiation by ceramide and b-series complex gangliosides. J. Biol. Chem. 276, 44396–44404. Bieberich, E., MacKinnon, S., Silva, J., Noggle, S., and Condie, B. G. (2003). Regulation of cell death in mitotic neural progenitor cells by asymmetric distribution of prostate apoptosis response 4 (PAR-4) and simultaneous elevation of endogenous ceramide. J. Cell Biol. 162, 469–479. Bieberich, E., Silva, J., Wang, G., Krishnamurthy, K., and Condie, B. G. (2004). Selective apoptosis of pluripotent mouse and human stem cells by novel ceramide analogues prevents teratoma formation and enriches for neural precursors in ES cell-derived neural transplants. J. Cell Biol. 167, 723–734. Bustin, S. A. (2004). A–Z of Quantitative PCR. International University Line, La Jolla. Cailleau-Thomas, A., Coullin, P., Candelier, J. J., Balanzino, L., Mennesson, B., Oriol, R., and Mollicone, R. (2000). FUT4 and FUT9 genes are expressed early in human embryogenesis. Glycobiology 10, 789–802. Comelli, E. M., Head, S. R., Gilmartin, T., Whisenant, T., Haslam, S. M., North, S. J., Wong, N. K., Kudo, T., Narimatsu, H., Esko, J. D., Drickamer, K., Dell, A., et al. (2006). A focused microarray approach to functional glycomics: Transcriptional regulation of the glycome. Glycobiology 16, 117–131. Coutinho, P. M., and Henrissat, B. (1999). Carbohydrate-active enzymes: An integrated database approach. In ‘‘Recent Advances in Carbohydrate Bioengineering,’’ (H. J. Gilbert, G. Davies, B. Henrissat, and B. Svensson, eds.), pp. 3–12. The Royal Society of Chemistry, Cambridge. Diehn, M., Sherlock, G., Binkley, G., Jin, H., Matese, J. C., Hernandez-Boussard, T., Rees, C. A., Cherry, J. M., Botstein, D., Brown, P. O., and Alizadeh, A. A. (2003). SOURCE: A unified genomic resource of functional annotations, ontologies, and gene expression data. Nucleic Acids Res. 31, 219–223. Fenderson, B. A., Eddy, E. M., and Hakomori, S. (1990). Glycoconjugate expression during embryogenesis and its biological significance. Bioessays 12, 173–179. Gama, C. I., and Hsieh-Wilson, L. C. (2005). Chemical approaches to deciphering the glycosaminoglycan code. Curr. Opin. Chem. Biol. 9, 609–619. Habuchi, O., Moroi, R., and Ohtake, S. (2002). Enzymatic synthesis of chondroitin sulfate E by N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase purified from squid cartilage. Anal. Biochem. 310, 129–136. Hacker, U., Nybakken, K., and Perrimon, N. (2005). Heparan sulphate proteoglycans: The sweet side of development. Nat. Rev. Mol. Cell Biol. 6, 530–541. Haltiwanger, R. S., and Lowe, J. B. (2004). Role of glycosylation in development. Annu. Rev. Biochem. 73, 491–537. Jaenisch, R., and Young, R. (2008). Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132, 567–582. Kanehisa, M., and Goto, S. (2000). KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K. F., Itoh, M., Kawashima, S., Katayama, T., Araki, M., and Hirakawa, M. (2006). From genomics to chemical genomics: New developments in KEGG. Nucleic Acids Res. 34, D354–D357.
90
Alison V. Nairn et al.
Kanehisa, M., Araki, M., Goto, S., Hattori, M., Hirakawa, M., Itoh, M., Katayama, T., Kawashima, S., Okuda, S., Tokimatsu, T., and Yamanishi, Y. (2008). KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36, D480–D484. Krishnamurthy, K., Wang, G., Silva, J., Condie, B. G., and Bieberich, E. (2007). Ceramide regulates atypical PKCzeta/lambda-mediated cell polarity in primitive ectoderm cells. A novel function of sphingolipids in morphogenesis. J. Biol. Chem. 282, 3379–3390. Lin, X. (2004). Functions of heparan sulfate proteoglycans in cell signaling during development. Development 131, 6009–6021. Linhardt, R. J., and Toida, T. (2004). Role of glycosaminoglycans in cellular communication. Acc. Chem. Res. 37, 431–438. Liu, W., and Saint, D. A. (2002). A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal. Biochem. 302, 52–59. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Lowe, J. B. (2001). Glycosylation, immunity, and autoimmunity. Cell 104, 809–812. Lowe, J. B., and Marth, J. D. (2003). A genetic approach to Mammalian glycan function. Annu. Rev. Biochem. 72, 643–691. Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., Plath, K., and Hochedlinger, K. (2007). Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1, 55–70. Muramatsu, T. (2000). Essential roles of carbohydrate signals in development, immune response and tissue functions, as revealed by gene targeting. J. Biochem. 127, 171–176. Muramatsu, T., and Muramatsu, H. (2004). Carbohydrate antigens expressed on stem cells and early embryonic cells. Glycoconj. J. 21, 41–45. Nairn, A., and Moremen, K. (2009). Glycotranscriptomics. In ‘‘Handbook of Glycomics,’’ (R. D. Cummings and J. M. Pierce, eds.), pp. 95–135. Academic Press, San Diego, CA. Nairn, A. V., Kinoshita-Toyoda, A., Toyoda, H., Xie, J., Harris, K., Dalton, S., Kulik, M., Pierce, J. M., Toida, T., Moremen, K. W., and Linhardt, R. J. (2007). Glycomics of proteoglycan biosynthesis in murine embryonic stem cell differentiation. J. Proteome Res. 6, 4374–4387. Nairn, A. V., York, W. S., Harris, K., Hall, E. M., Pierce, J. M., and Moremen, K. W. (2008). Regulation of glycan structures in animal tissues: Transcript profiling of glycanrelated genes. J. Biol. Chem. 283, 17298–17313. Naito, Y., Takematsu, H., Koyama, S., Miyake, S., Yamamoto, H., Fujinawa, R., Sugai, M., Okuno, Y., Tsujimoto, G., Yamaji, T., Hashimoto, Y., Itohara, S., et al. (2007). Germinal center marker GL7 probes activation-dependent repression of Nglycolylneuraminic acid, a sialic acid species involved in the negative modulation of Bcell activation. Mol. Cell. Biol. 27, 3008–3022. Ngamukote, S., Yanagisawa, M., Ariga, T., Ando, S., and Yu, R. K. (2007). Developmental changes of glycosphingolipids and expression of glycogenes in mouse brains. J. Neurochem. 103, 2327–2341. Ohtsubo, K., and Marth, J. D. (2006). Glycosylation in cellular mechanisms of health and disease. Cell 126, 855–867. Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-competent induced pluripotent stem cells. Nature 448, 313–317. Park, H., Haynes, C. A., Nairn, A. V., Kulik, M., Dalton, S., Moremen, K., and Merrill, A. H., Jr. (2010). Transcript profiling and lipidomic analysis of ceramide subspecies in mouse embryonic stem cells and embryoid bodies. J. Lipid Res. 51, 480–489. Pewzner-Jung, Y., Ben-Dor, S., and Futerman, A. H. (2006). When do Lasses (longevity assurance genes) become CerS (ceramide synthases)?: Insights into the regulation of ceramide synthesis. J. Biol. Chem. 281, 25001–25005.
Transcript Analysis of Stem Cells
91
Ramakers, C., Ruijter, J. M., Deprez, R. H., and Moorman, A. F. (2003). Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 62–66. Raman, R., Sasisekharan, V., and Sasisekharan, R. (2005). Structural insights into biological roles of protein–glycosaminoglycan interactions. Chem. Biol. 12, 267–277. Rozen, S., and Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. In ‘‘Bioinformatics Methods and Protocols: Methods in Molecular Biology,’’ (S. Krawetz and S. Misener, eds.), pp. 365–386. Humana Press, Totowa, NJ. Saier, M. H., Jr., Tran, C. V., and Barabote, R. D. (2006). TCDB: The Transporter Classification Database for membrane transport protein analyses and information. Nucleic Acids Res. 34, D181–D186. Schachter, H. (2000). The joys of HexNAc. The synthesis and function of N- and O-glycan branches. Glycoconj. J. 17, 465–483. Schwarzkopf, M., Knobeloch, K. P., Rohde, E., Hinderlich, S., Wiechens, N., Lucka, L., Horak, I., Reutter, W., and Horstkorte, R. (2002). Sialylation is essential for early development in mice. Proc. Natl. Acad. Sci. USA 99, 5267–5270. Smith, F. I., Qu, Q., Hong, S. J., Kim, K. S., Gilmartin, T. J., and Head, S. R. (2005). Gene expression profiling of mouse postnatal cerebellar development using oligonucleotide microarrays designed to detect differences in glycoconjugate expression. Gene Expr. Patterns 5, 740–749. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. Taniguchi, N., Honke, K., and Fukuda, M. (eds.), (2002). Handbook of Glycosyltransferases and Related Genes, pp. 1–670. Springer-Verlag, Tokyo. Taylor, M. E., and Drickamer, K. (2006). Introduction to Glycobiology. 2nd edn. Oxford University Press, Oxford. Thisse, B., and Thisse, C. (2005). Functions and regulations of fibroblast growth factor signaling during embryonic development. Dev. Biol. 287, 390–402. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., and Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, 1–12. Varki, A. (1993). Biological roles of oligosaccharides: All of the theories are correct. Glycobiology 3, 97–130. Varki, A., Cummings, R., Esko, J., Freeze, H., Hart, G., and Marth, J. (1999). Essentials of Glycobiology. Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY. Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B. E., and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448, 318–324. Wheeler, D. L., Barrett, T., Benson, D. A., Bryant, S. H., Canese, K., Chetvernin, V., Church, D. M., DiCuccio, M., Edgar, R., Federhen, S., Geer, L. Y., Kapustin, Y., et al. (2007). Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 35, D5–D12. Yamamoto, H., Takematsu, H., Fujinawa, R., Naito, Y., Okuno, Y., Tsujimoto, G., Suzuki, A., and Kozutsumi, Y. (2007). Correlation Index-Based Responsible-Enzyme Gene Screening (CIRES), a Novel DNA Microarray-Based Method for Enzyme Gene Involved in Glycan Biosynthesis. PLoS ONE 2, e1232. Yu, J., Vodyanik, M. A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J. L., Tian, S., Nie, J., Jonsdottir, G. A., Ruotti, V., Stewart, R., Slukvin, I. I., and Thomson, J. A. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917–1920.
C H A P T E R
F I V E
Directing Stem Cell Trafficking via GPS Robert Sackstein*,† Contents 1. 2. 3. 4. 5. 6.
Overview Rationale for GPS Guiding Principles and Method for GPS Method of a(1,3)-Fucosylation of Cell Surface Using FTVI Detection of E-Selectin Ligand Expression Following GPS Testing for E-Selectin Ligand Activity Using E-Selectin-Ig Chimera (Three-Step Method for Flow Cytometry) 7. Summary Acknowledgments References
94 95 97 99 100 101 102 103 103
Abstract The success of stem-cell-based regenerative therapeutics critically hinges on delivering relevant stem/progenitor cells to sites of tissue injury. To achieve adequate parenchymal infiltration following intravascular administration, it is first necessary that circulating cells bind to target tissue endothelium with sufficient strength to overcome the prevailing forces of hemodynamic shear. The principal mediators of these shear-resistant binding interactions consist of a family of C-type lectins known as ‘‘selectins’’ that bind discrete sialofucosylated glycans on their respective ligands. One member of this family, E-selectin, is an endothelial molecule that is inducibly expressed on postcapillary venules at all sites of tissue injury, but is also constitutively expressed on the luminal surface of bone marrow and dermal microvascular endothelium. Most stem/ progenitor cells express high levels of CD44, and, in particular, human hematopoietic stem cells express a specialized sialofucosylated glycoform of CD44
* Department of Dermatology and Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA Department of Medical Oncology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts, USA
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79005-4
#
2010 Elsevier Inc. All rights reserved.
93
94
Robert Sackstein
known as ‘‘hematopoietic cell E-/L-selectin ligand’’ (HCELL) that functions as a potent E-selectin ligand. This chapter describes a method called ‘‘glycosyltransferase-programmed stereosubstitution’’ (GPS) for custom-modifying CD44 glycans to create HCELL on the surface of living cells that natively lack HCELL. Ex vivo glycan engineering of HCELL via GPS licenses trafficking of infused cells to endothelial beds that express E-selectin, thereby enabling efficient vascular delivery of stem/progenitor cells to sites where they are needed.
1. Overview The successful clinical implementation of stem-cell-based regenerative therapeutics depends on the ability to deliver stem cells to requisite sites of tissue damage. To this end, two approaches can be employed: direct intralesional injection or intravascular administration. The former has limited applicability for a number of reasons: (1) it is only useful for tissues with strict anatomic boundaries (e.g., the heart); (2) it is invasive, and therefore can itself be associated with procedure-related morbidity; and (3) by introducing cells in (typical) crystalloid suspension under hydrostatic pressure, intralesional injection could further alter/disrupt the local tissue microenvironment, abrogating incipient repair process(es) and/or exacerbating the inflammatory process in situ. Most importantly, many degenerative and inflammatory diseases are multifocal in nature (e.g., osteoporosis, multiple sclerosis, Duchene’s muscular dystrophy, inflammatory bowel disease, etc.), and, as such, local injection is not practical. Intravascular delivery is indicated for these and all ‘‘systemic’’ disorders, for wide-spread tissue injury (e.g., extensive burns), and for tissues with problematic access (e.g., central nervous system) and/or with anatomy unfavorable to injection (e.g., lung). Thus, an immediate, essential prerequisite to fulfilling the enormous promise of applied regenerative medicine is to develop methodologies to optimize the expression/activity of molecular effector(s) mediating physiologic trafficking of vascularly administered stem/progenitor cells. The migration of cells from vascular to extravascular compartments involves a sequential series of events occurring under the fluid shear forces of blood flow. Typically, circulating cells exit the vasculature at postcapillary venules and sinusoids, where shear stress ranges from 1 to 4 dynes/cm2 (Sackstein, 2005). The ‘‘multistep’’ paradigm of cellular trafficking holds that cells in flow must first make contact along the endothelial surface with adhesive interactions of sufficient strength to overcome these hemodynamic shear forces (Step 1). During this initial stage, blood-borne cells are exposed to chemical signals (chemokines, cytokines, and other proinflammatory mediators) in the local milieu (Step 2), resulting in G-protein-mediated
Directing Stem Cell Trafficking via GPS
95
upregulation of integrin adhesive capabilities resulting in firm arrest (Step 3). Firm arrest is then followed by transmigration (Step 4). Methods to enhance cell migration into pertinent tissue(s) have focused primarily on introducing chemokine receptors by genetic means (Cheng et al., 2008; Kahn et al., 2004; Zhang et al., 2008) or by upregulating chemokine receptor expression by manipulating cells in vitro (Forster et al., 1998; Kollet et al., 2002; Peled et al., 1999). However, for every tissue target, the proximate hurdle to achieving cell recruitment is, literally, upstream of Step 2 events, as no circulating cell can extravasate without the primary engagement of molecular effectors operationally specialized to cause braking/slowing-down (‘‘tethering’’) of the flowing cells onto the vascular lumen followed by organized sustained contact (‘‘rolling’’) of these cells against the endothelial surface. Thus, strategies to at least maintain or, as needed, enhance or create expression of Step 1 effectors on cell surfaces are essential to realize delivery of pertinent cells to target tissues. To address this need, we created glycosyltransferase-programmed stereosubstitution (GPS).
2. Rationale for GPS The selectins are comprised of a family of three integral membrane glycoproteins, all of which are Ca2þ-dependent lectins: E-selectin (CD62E, expressed on endothelium), P-selectin (CD62P, expressed on platelets and on endothelium), and L-selectin (CD62L, expressed on leukocytes and on hematopoietic stem cells) (Sackstein, 2005). E- and P-selectin are typically referred to as the ‘‘vascular selectins’’ because of their expression on endothelium, whereas L-selectin is called the ‘‘leukocyte selectin.’’ These selectins are the most effective mediators of Step 1 interactions, and all three bind to sialofucosylated glycans bearing a specific terminal sialic acid (also known as neuraminic acid; ‘‘NeuAc’’) in a(2,3)-linkage to galactose (Gal) and a fucose (Fuc) in a(1,3)-linkage to N-acetylglucosamine (GlcNAc), prototypically displayed as the tetrasaccharide structure known as ‘‘sialylated Lewis X’’ (sLex; also known as CD15s): NeuAc a 2-3Gal b1-4[Fuc a 1-3]GlcNAc b1-R. The core lactosamine of sLex is known as a ‘‘Type 2’’ unit, Galb1-4GlcNAc b1-R. The isomeric ‘‘Type 1’’ lactosamine unit, Galb1-3GlcNAcb1-R, can also be modified with a(2,3)-linked-sialic acid on galactose, and when this structure contains a fucose substitution in a(1,4)-linkage to N-acetylglucosamine, it is known as ‘‘sialylated Lewis a’’ (sLea): NeuAc a 2-3Gal b1-3[Fuc a 1-4]GlcNAc b1-R. Hematopoietic cells (of both human and mouse) and all normal stem cells (both adult and embryonic) described to date characteristically express type 2 lactosamine units; thus, wherever found on such cells, the pertinent selectin ligand(s) will display sLex-type sialofucosylated lactosamines. Importantly, though all
96
Robert Sackstein
selectins can bind to both sLex and sLea (Berg et al., 1991, 1992; Handa et al., 1991), these structures are not expressed on many cells, and some cells that express these structures do not bind to selectins. For L- and P-selectin, additional posttranslational modifications of their respective ligand(s), typically consisting of sulfation of sLex (for L-selectin adherence) or of tyrosines localized within the binding domain (for P-selectin and L-selectin adherence, for example, in the ligand known as P-selectin glycoprotein ligand-1 (PSGL-1, see below)), are required for optimal attachment. In contrast, no additional structural modifications have been found to date that definitively enhance E-selectin binding to sLex or sLea (Kanamori et al., 2002), but E-selectin binds more avidly to sLex than to sLea (Tyrrell et al., 1991). As noted above, E- and P-selectin are expressed on vascular endothelial cells. Serving as the primary Step 1 ‘‘anchors’’ for cells in hemodynamic flow, the endothelial expression of these molecules—and of their respective ligand (s) on circulating cells—has enormous implications for cell migration patterns. It is well recognized that permanent expression of P-selectin (in mice) and of E-selectin (in mice and humans) in bone and skin microvessels supports steady-state trafficking of circulating cells to these sites (reviewed in Sackstein, 2004). Both E-selectin and P-selectin are induced on endothelial cells by inflammatory cytokines such as TNF-a and IL-1, and in all microvessels (including those of skin and marrow), upregulated expression of these vascular selectins is a critical feature of all inflammatory responses, driving extravasation of cells bearing requisite counter-receptors. However, there is an important distinction between mice and primates regarding E-selectin and P-selectin: the cytokine TNF-a induces both E- and P-selectin expression in murine endothelial cells, but only induces E-selectin on human and nonhuman primate endothelial cells (Burns et al., 1995; Pan et al., 1998; Yao et al., 1999). This difference in transcriptional control is secondary to species-specific differences in the P-selectin promoter (Pan et al., 1998). Thus, under inflammatory conditions, cell migration patterns in humans may depend on the contribution of E-selectin to a much greater extent than that predicted on the basis of mouse studies. These findings have profound implications for all adoptive cell therapies in humans beings (e.g., for stem-cell-based treatments), indicating that optimizing expression/activity of E-selectin ligands on requisite cells would be critical to most effectively enhance tissue delivery for clinical indications. A variety of molecules, both glycoproteins and glycolipids, can serve as E-selectin ligands on the surface of human cells. In general, compared to glycoprotein ligands, glycolipids expressed natively on cell membranes have limited potency in binding E-selectin under hemodynamic shear conditions because their glycans do not protrude beyond the glycocalyx. Several glycoprotein E-selectin ligands have been identified, including cutaneous lymphocyte antigen (CLA), CD43, and hematopoietic cell E-/L-selectin ligand (HCELL) (Dimitroff et al., 2001; Fuhlbrigge et al., 1997, 2006;
Directing Stem Cell Trafficking via GPS
97
Matsumoto et al., 2005). CLA and HCELL are specialized sialofucosylated glycoforms of PSGL-1 and CD44, respectively, which are recognized by a mAb known as HECA452 that binds to sLex and sLea structures. PSGL-1 is a ligand for P-selectin and L-selectin, but when modified by HECA452reactive glycans (i.e., ‘‘CLA’’), it also serves as an E-selectin ligand. HCELL is the most potent E-selectin and L-selectin ligand expressed in human cells, but it is not expressed on native (i.e., wild-type) mouse cells. In human cells, expression of HCELL is characteristically limited to early hematopoietic progenitor cells, leukemic blasts, and certain adenocarcinoma cells (e.g., in colon cancer). In contrast to PSGL-1 and CD43, each of which has a limited cell distribution, CD44 is a rather ubiquitously expressed integral membrane protein. The wide distribution of CD44, the critical contribution of E-selectin in recruitment of human cells to sites of tissue injury, coupled with the fact that a rather simple tetrasaccharide, sLex, is the primary binding determinant for E-selectin, prompted us to develop strategies to enforce sLex expression on CD44 (thus rendering HCELL). This ex vivo glycan engineering technology, expressly developed to custom-modify glycosylation(s) of cell membrane molecules, is known as GPS. The key attribute of GPS is that all requisite glycosyltransferases, buffers, and reaction conditions, are especially formulated to be nontoxic to living cells. Ideally, application of GPS yields the targeted phenotypic change (e.g., enforced sLex expression, with resultant improved tissue migration), without otherwise affecting cellular properties critical to desired biologic effect(s) (e.g., pluripotency or multipotency of a stem cell).
3. Guiding Principles and Method for GPS There are several guiding principles for the application of GPS in custom engineering of cell surface glycans: (1) identification of a relevant target glycoconjugate ‘‘acceptor’’ on cells of interest (this can be accomplished using specific mAb or lectins that recognize requisite (precursor) structures for enzymatic modification(s)); (2) use of relevant enzymatic reagents and conditions to perform stereospecific carbohydrate substitution without affecting cell viability or generating unwanted phenotypic effects; and (3) confirmation of target modification, as evidenced by appropriate biochemical and functional assays, including in vivo demonstration of the desired phenotypic effect. Our first application of GPS was to enforce expression of HCELL on human mesenchymal stem cells (hMSCs). The rationale and results of our studies are only briefly presented here, as all relevant details, including development of requisite reagents and methods to enable GPS of hMSCs,
98
Robert Sackstein
have been published recently (Sackstein et al., 2008). MSCs are precursors of osteoblasts, which create bone: our goal was to utilize GPS to enable systemic delivery of MSCs to bone, as a curative-intent therapy for generalized skeletal diseases such as osteoporosis and osteogenesis imperfecta. Notably, hMSCs are conspicuously devoid of molecular effectors of Step 1 interactions, including E-selectin ligands. Using a panel of mAb raised in our lab against HCELL antigen together structural biology studies, we found that CD44 on hMSC carries terminal a(2,3)sialyllactosamines on antenna of N-linked glycans. Accordingly, we performed a(1,3)fucosylation of these structures using the enzyme fucosyltransferase VI (FTVI), specifically formulated to be nontoxic to cells. The enzymatic reaction was optimized at pH 7.0–7.2 to promote high-efficiency fucosylation in the absence of input divalent cations that were previously thought to be essential for FTVI activity (Sackstein et al., 2008). Notably, divalent cations, particularly manganese, activate integrins with attendant profound effects on cell trafficking patterns, and worse yet, induce apoptotic cell death (Sackstein et al., 2008). Following enzymatic treatment, enforced HCELL expression was confirmed by biochemical studies (e.g., western blot of HECA452-reactive CD44) and E-selectin-based adhesion assays performed under hemodynamic shear conditions; conspicuously, following exofucosylation, protease treatments showed that there was minimal contribution of glycolipids to enforced E-selectin ligand activity, and western blot demonstrated that the only protein that expressed HECA452-reactive glycans was CD44, that is, no other membrane protein natively displayed acceptor type 2 sialyllactosamine(s). Following ex vivo glycan engineering, real-time intravital microscopy showed migration of intravenously administered HCELLþhMSCs into bone marrow of immunocompromised mice. Upon extravasation into the marrow parenchyma, the hMSCs localized to endosteal surfaces, differentiated into osteoblasts, and created human osteoid. The methods below will specifically address the use of FTVI for GPS, with intention to program E-selectin ligand expression on a target cell. As stated above, the FTVI enzyme and reaction conditions we utilize were developed to catalyze a(1,3)-exofucosylation efficiently at near-physiologic pH in the absence of divalent cations. For purposes of GPS, any glycosyltransferase can be used to stereospecifically modify a target membrane glycan, as long as the enzyme storage buffer, the reaction buffer, and the reaction conditions are optimized to maintain cell viability and avoid phenotypic effects on cell(s). Notably, several classes of glycosyltransferases require divalent cation as a cofactor, most effectively manganese, for elaboration of catalytic activity (Lairson et al., 2008). Indeed, for creation of the sLex determinant, the only glycosyltransferase-dependent linkage not requiring divalent cation activation is a(2,3)-sialylation of Gal, that is, divalent cations are required for enzymatic catalysis of a(1,3)-fucosylation
Directing Stem Cell Trafficking via GPS
99
of N-GlcNAc, b(1,4)galactosylation of N-GlcNAc, and b(1,3)-N-acetylglucosaminylation of Gal (Murray et al., 1996; Palma et al., 2004; Ramakrishnan et al., 2004; Shinoda et al., 1998; Stults and Macher, 1993; Witsell et al., 1990). Accordingly, in absence of divalent cations, terminal sialylation of lactosamines can be readily performed, followed by a(1,3)fucosylation using FTVI reaction using conditions described below, to enforce sLex expression on a type 2 lactosamine acceptor.
4. Method of a(1,3)-Fucosylation of Cell Surface Using FTVI 1. Harvest cells of interest either from primary tissues sources (e.g., hematopoietic stem cells from marrow) or from tissue culture (e.g., cultureexpanded mesenchymal stem cells) and centrifuge/wash 3 with calcium/magnesium-free phosphate buffered saline (PBS). If using adherent cells from culture, it is best to limit exposure to proteases if such reagents are used to lift cells. Use of proteases could alter the expression of relevant protein scaffolds, so alternative lifting procedures (e.g., chelation-based solutions) should be considered as needed. 2. FTVI is capable of fucosylating either a sialylated or a nonsialylated type 2 lactosamine acceptor, rendering sLex or Lex, respectively. Antibodies useful for assessing expression of these determinants include KM93 and HECA452 (each to detect sLex), and 80H5 (for Lex). Vendors are: KM93, EMD; HECA 452, BD Biosciences; 80H5, Beckman Coulter. Notably, it is well recognized that commercially available anti-sLex mAb (including HECA452) do not stain for sLex on murine cells (Mitoma et al., 2009); we utilize E-selectin-Ig staining as the alternative reporter of sLex expression on mouse cells (see below). 3. Regardless of which test cell types are used, validation of the efficacy of the enzymatic reaction should be performed. For this purpose, it is recommended to use human hematopoietic cell lines as control(s), such as HL60 or RPMI8402, each of which natively display type 2 lactosamines and have reproducible and robust increases in sLex expression following FTVI treatment. These cell lines available from ATCC. 4. For FTVI reaction, suspend test and control cells at concentration of 50 106 cells/ml in Hank’s Balanced Salt Solution (Invitrogen)/0.1% (w/v) Human Serum Albumin (Sigma-Aldrich)/1 mM GDP-Fucose (Sigma-Aldrich)/10 mM HEPES (Invitrogen) (final pH 7.0–7.2). The control for the FTVI reaction is buffer alone (containing GDP-fucose, but no input FTVI). 5. Add FTVI enzyme at concentration 60 mU/ml.
100
Robert Sackstein
6. Incubate cells in a 37 C water bath for 1 h (gently resuspend settled cells every 15 min to ensure surface exposure). 7. Centrifuge cells at 700 RCF for 2 min. 8. Resuspend cell pellet in HBSS, and centrifuge/wash 2. 9. Perform flow cytometry on an aliquot of FTVI-treated and buffertreated cells to assess expression of sLex and Lex determinants.
5. Detection of E-Selectin Ligand Expression Following GPS It is widely accepted that HECA452 recognizes sLex/sLea structures on human cells (but not on mouse cells, which express an N-glycolyl form of sLex; Mitoma et al., 2009), making this mAb a useful reagent for probing for expression of human E-selectin ligands. Conversion of a HECA452 cell into a HECA452þ cell following GPS is consistent with induced expression of E-selectin ligand(s). However, human cell lines have been described that possess significant sialylation-dependent E-selectin ligand activity in shear-based assays but lack any detectable HECA452 reactivity (Wagers et al., 1996, 1998). As such, absence of staining with HECA452 mAb (or any other sLex-specific mAb) does not provide evidence of lack of E-selectin ligand expression. Notably, we and others (Knibbs et al., 1998) have repeatedly observed that HECA452 mAb (and other anti-sLex mAb, for that matter) does not block E-selectin binding in any dynamic (flowbased) assay system. We have also determined that HECA-452 reactivity itself does not predict E-selectin ligand activity, as determined from studies using a technique known as the ‘‘blot rolling assay’’ (Sackstein and Fuhlbrigge, 2006). In this assay, membranes are isolated from a cell type of interest, detergent solubilized, and the component proteins are resolved by gel electrophoresis and then transferred onto a support PVDF sheet (e.g., by western blot). The sheet is rendered translucent, then placed within a parallel plate flow chamber and mounted on the stage of an inverted microscope. Particles or cells bearing known adhesion molecules of interest (e.g., Chinese hamster ovary cells stably transfected to express human E-selectin) are then introduced into the chamber under controlled flow conditions, and the presence of tethering and rolling interactions on discrete bands can be observed by video microscopy. Our numerous studies over the past decade using the blot rolling assay have clearly shown that HECA-452 reactivity does not directly correlate with E-selectin ligand activity, as several HECA452-reactive bands identified by western blot do not support E-selectin-dependent rolling interactions under the hemodynamic shear conditions employed (e.g., see Dimitroff et al., 2001). For these reasons, we distinguish between structures that possess features that may support
Directing Stem Cell Trafficking via GPS
101
E-selectin binding (e.g., glycan motifs recognizable by relevant mAb) and structures that can support E-selectin binding. A clear distinction must also be drawn between structure(s) that can support selectin binding in certain in vitro assays versus structures that operationally support selectin binding in vivo. It is important to recognize that clustering of a given molecule within a defined region in space (i.e., on a microbead) could itself induce binding properties that would not exist on the cell membrane, as the native surface structure(s) would certainly have different site density(ies) on a given scaffold (protein or lipid), copy number, orientation, and topographic display. For instance, clustering of sLex or sLea alone on a microbead surface results in rolling on immobilized E-selectin under physiologic flow, which varies dramatically as a function of the relative site densities of the glycans on the beads and site densities of the substrate E-selectin (Brunk and Hammer, 1997; Brunk et al., 1996). Thus, though enforced expression of sLex may be achieved by GPS, it is important to establish whether the target cell possesses authentic E-selectin ligand activity. Related to this fact, we prefer to test for such ligand activity by shear-based assays using parallel plate flow chambers that mimic in vivo hemodynamic conditions. We then confirm the biologic impact of the engineered E-selectin ligand(s) by performing intravital microscopy in murine models, using immunocompromised mouse hosts for testing human cells. However, it is clear that this approach requires specialized equipment and reagents, coupled with technical expertise, all of which are not readily available. Thus, an alternative screen, described in detail here, is to use E-selectin-Ig chimera as a probe for E-selectin ligand activity. One can use this reagent in either flow cytometry or in western blot. In each case, it is necessary to perform staining in the presence of input calcium, as E-selectin-Ig retains functional Ca2þ-dependency characteristic of selectin receptor/ligand binding interactions. We find that E-selectin-Ig staining by either flow cytometry or western blot predicts E-selectin ligand activity in vivo, but shear-based assays provide far more specific information regarding the efficacy of ligand activity in vivo.
6. Testing for E-Selectin Ligand Activity Using E-Selectin-Ig Chimera (Three-Step Method for Flow Cytometry)
Chimera Buffer: HBSS/5 mM HEPES/2 mM CaCl2/5% FBS Control Buffer: HBSS/5 mM HEPES/5% FBS Recombinant mouse E-selectin/human Fc chimera (R&D Systems, 575-ES-100) – Mouse E-selectin fused with human IgG
102
Robert Sackstein
– Stock ¼ 1 mg/ml – Working ¼ 1 mg/ml final concentration in either Chimera Buffer or Control Buffer Biotinylated anti-human IgG antibody (Southern Biotech, 6140-08) – Working ¼ 1:200 dilution in Chimera Buffer or in Control Buffer Streptavidin-FITC or Streptavidin-PE (Southern Biotech, 7100-02 or 7100-09) – Working ¼ 1:500 dilution in Chimera Buffer or in Control Buffer Note: For testing E-selectin ligand activity, it is necessary to have divalent cations (i.e., Ca2þ) in the system; calcium is required for selectin binding to ligands. The Control Buffer (i.e., equivalent to ‘‘isotype control’’) consists of calcium-free Chimera Buffer. 1. Harvest cells after FTVI reaction and wash 2 in Chimera Buffer or in Control Buffer. 2. Resuspend cells at 10 106 cells/ml. 3. For analysis, use minimum of 200,000 cells suspended in microfuge tube. 4. Centrifuge cells at 400 RCF in microfuge for 2 min to obtain a cell pellet. 5. Resuspend cell pellets in 100 ml of E-selectin Fc Chimera in either Chimera Buffer (working) or Control Buffer. 6. Incubate on ice for 30 min. 7. Wash 2 with appropriate Buffer (Chimera Buffer or Control Buffer). 8. Resuspend cells in 100 ml of Biotinylated anti-human IgG at working concentration in either Chimera Buffer or Control Buffer. 9. Incubate on ice for 20 min. 10. Wash 2 with Chimera Buffer (at this point, may use Chimera Buffer for all subsequent suspensions/washes). 11. Resuspend cells in 100 ml of Streptavidin-FITC or Streptavidin-PE at working concentration in either Chimera Buffer or Control Buffer. 12. Incubate on ice for 20 min. 13. Wash 2 with appropriate Buffer. 14. Resuspend cell pellets in Chimera Buffer for flow cytometry.
7. Summary We describe here methods by which a(1,3)-exofucosylation of cell surface glycans can be achieved by using a technique we developed called GPS. This ex vivo biocatalytic technology was inspired by the express desire to enable stem cell therapeutics by directing migration of systemically administered cells to sites of tissue injury/repair. From the standpoint of
Directing Stem Cell Trafficking via GPS
103
glycoengineering, our work with MSC provides a striking example of how a linkage-specific substitution of a single monosaccharide on a target membrane glycoprotein (CD44) can endow a totally new biology on the target protein and the target cell(s). By extension, through creation of requisite reagents and reaction conditions, the relevant sugars displayed by essentially any selected membrane structure, protein or lipid, may be altered so that it expresses a completely new function. A set of principles are described here for use of GPS that should serve to guide application of this technology to any cell type. Beyond enabling migration of any cell to a predetermined anatomic site, GPS offers the opportunity to modify the ‘‘glycan signature’’ of any target cell, with profound implications for all cell-based adoptive therapies. In this regard, for example, GPS-mediated hypersialylation of the cell surface could improve survival of administered cells in vivo by limiting clearance through asialoglycoprotein receptors. In the application(s) discussed here and in every application imaginable, the success of GPS critically depends on performing the requisite glycoengineering of the cell surface without detriment to the physiology of the cell, and certainly without impairing cell viability. It is anticipated that our increasing understanding of the structural biology of membrane glycans and of glycosyltransferases will yield even greater opportunities for exploiting GPS to enable the paradigm-shifting cell therapeutics of the future.
ACKNOWLEDGMENTS I take this opportunity to sincerely thank the many technicians, postdocs, students, and colleagues—both inside and outside of my laboratories—who have contributed significantly to our knowledge of selectin ligands and to our understanding of how glycosyltransferases work. This work was supported by National Institutes of Health grants RO1 HL60528, RO1 CA84156, RO1 HL073714, and RO1 CA 121335.
REFERENCES Berg, E. L., Robinson, M. K., Mansson, O., Butcher, E. C., and Magnani, J. L. (1991). A carbohydrate domain common to both sialyl Le(a) and sialyl Le(X) is recognized by the endothelial cell leukocyte adhesion molecule ELAM-1. J. Biol. Chem. 266, 14869–14872. Berg, E. L., Magnani, J., Warnock, R. A., Robinson, M. K., and Butcher, E. C. (1992). Comparison of L-selectin and E-selectin ligand specificities: The L-selectin can bind the E-selectin ligands sialyl Le(x) and sialyl Le(a). Biochem. Biophys. Res. Commun. 184, 1048–1055. Brunk, D. K., and Hammer, D. A. (1997). Quantifying rolling adhesion with a cell-free assay: E-selectin and its carbohydrate ligands. Biophys. J. 72, 2820–2833. Brunk, D. K., Goetz, D. J., and Hammer, D. A. (1996). Sialyl Lewis(x)/E-selectin-mediated rolling in a cell-free system. Biophys. J. 71, 2902–2907.
104
Robert Sackstein
Burns, S. A., DeGuzman, B. J., Newburger, J. W., Mayer, J. E., Jr., Neufeld, E. J., and Briscoe, D. M. (1995). P-selectin expression in myocardium of children undergoing cardiopulmonary bypass. J. Thorac. Cardiovasc. Surg. 110, 924–933. Cheng, Z., Ou, L., Zhou, X., Li, F., Jia, X., Zhang, Y., Liu, X., Li, Y., Ward, C. A., Melo, L. G., and Kong, D. (2008). Targeted migration of mesenchymal stem cells modified with CXCR4 gene to infarcted myocardium improves cardiac performance. Mol. Ther. 16, 571–579. Dimitroff, C. J., Lee, J. Y., Rafii, S., Fuhlbrigge, R. C., and Sackstein, R. (2001). CD44 is a major E-selectin ligand on human hematopoietic progenitor cells. J. Cell Biol. 153, 1277–1286. Forster, R., Kremmer, E., Schubel, A., Breitfeld, D., Kleinschmidt, A., Nerl, C., Bernhardt, G., and Lipp, M. (1998). Intracellular and surface expression of the HIV-1 coreceptor CXCR4/fusin on various leukocyte subsets: Rapid internalization and recycling upon activation. J. Immunol. 160, 1522–1531. Fuhlbrigge, R. C., Kieffer, J. D., Armerding, D., and Kupper, T. S. (1997). Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells. Nature 389, 978–981. Fuhlbrigge, R. C., King, S. L., Sackstein, R., and Kupper, T. S. (2006). CD43 is a ligand for E-selectin on CLAþhuman T cells. Blood 107, 1421–1426. Handa, K., Nudelman, E. D., Stroud, M. R., Shiozawa, T., and Hakomori, S. (1991). Selectin GMP-140 (CD62; PADGEM) binds to sialosyl-Le(a) and sialosyl-Le(x), and sulfated glycans modulate this binding. Biochem. Biophys. Res. Commun. 181, 1223–1230. Kahn, J., Byk, T., Jansson-Sjostrand, L., Petit, I., Shivtiel, S., Nagler, A., Hardan, I., Deutsch, V., Gazit, Z., Gazit, D., Karlsson, S., and Lapidot, T. (2004). Overexpression of CXCR4 on human CD34þ progenitors increases their proliferation, migration, and NOD/SCID repopulation. Blood 103, 2942–2949. Kanamori, A., Kojima, N., Uchimura, K., Muramatsu, T., Tamatani, T., Berndt, M. C., Kansas, G. S., and Kannagi, R. (2002). Distinct sulfation requirements of selectins disclosed using cells that support rolling mediated by all three selectins under shear flow. L-selectin prefers carbohydrate 6-sulfation totyrosine sulfation, whereas p-selectin does not. J. Biol. Chem. 277, 32578–32586. Knibbs, R. N., Craig, R. A., Maly, P., Smith, P. L., Wolber, F. M., Faulkner, N. E., Lowe, J. B., and Stoolman, L. M. (1998). Alpha(1, 3)-fucosyltransferase VII-dependent synthesis of P- and E-selectin ligands on cultured T lymphoblasts. J. Immunol. 161, 6305–6315. Kollet, O., Petit, I., Kahn, J., Samira, S., Dar, A., Peled, A., Deutsch, V., Gunetti, M., Piacibello, W., Nagler, A., and Lapidot, T. (2002). Human CD34(þ)CXCR4(-) sorted cells harbor intracellular CXCR4, which can be functionally expressed and provide NOD/SCID repopulation. Blood 100, 2778–2786. Lairson, L. L., Henrissat, B., Davies, G. J., and Withers, S. G. (2008). Glycosyltransferases: Structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521–555. Matsumoto, M., Atarashi, K., Umemoto, E., Furukawa, Y., Shigeta, A., Miyasaka, M., and Hirata, T. (2005). CD43 functions as a ligand for E-selectin on activated T cells. J. Immunol. 175, 8042–8050. Mitoma, J., Miyazaki, T., Sutton-Smith, M., Suzuki, M., Saito, H., Yeh, J. C., Kawano, T., Hindsgaul, O., Seeberger, P. H., Panico, M., Haslam, S. M., Morris, H. R., et al. (2009). The N-glycolyl form of mouse sialyl Lewis X is recognized by selectins but not by HECA-452 and FH6 antibodies that were raised against human cells. Glycoconj. J. 26, 511–523. Murray, B. W., Takayama, S., Schultz, J., and Wong, C. H. (1996). Mechanism and specificity of human alpha-1, 3-fucosyltransferase V. Biochemistry 35, 11183–11195.
Directing Stem Cell Trafficking via GPS
105
Palma, A. S., Morais, V. A., Coelho, A. V., and Costa, J. (2004). Effect of the manganese ion on human alpha3/4 fucosyltransferase III activity. Biometals 17, 35–43. Pan, J., Xia, L., and McEver, R. P. (1998). Comparison of promoters for the murine and human P-selectin genes suggests species-specific and conserved mechanisms for transcriptional regulation in endothelial cells. J. Biol. Chem. 273, 10058–10067. Peled, A., Petit, I., Kollet, O., Magid, M., Ponomaryov, T., Byk, T., Nagler, A., BenHur, H., Many, A., Shultz, L., Lider, O., Alon, R., et al. (1999). Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283, 845–848. Ramakrishnan, B., Boeggeman, E., Ramasamy, V., and Qasba, P. K. (2004). Structure and catalytic cycle of beta-1, 4-galactosyltransferase. Curr. Opin. Struct. Biol. 14, 593–600. Sackstein, R. (2004). The bone marrow is akin to skin: HCELL and the biology of hematopoietic stem cell homing. J. Invest. Dermatol. 122, 1061–1069. Sackstein, R. (2005). The lymphocyte homing receptors: Gatekeepers of the multistep paradigm. Curr. Opin. Hematol. 12, 444–450. Sackstein, R., and Fuhlbrigge, R. (2006). The blot rolling assay: A method for identifying adhesion molecules mediating binding under shear conditions. Methods Mol. Biol. 341, 217–226. Sackstein, R., Merzaban, J. S., Cain, D. W., Dagia, N. M., Spencer, J. A., Lin, C. P., and Wohlgemuth, R. (2008). Ex vivo glycan engineering of CD44 programs human multipotent mesenchymal stromal cell trafficking to bone. Nat. Med. 14, 181–187. Shinoda, K., Tanahashi, E., Fukunaga, K., Ishida, H., and Kiso, M. (1998). Detailed acceptor specificities of human alpha1, 3-fucosyltransferases, Fuc-TVII and Fuc-TVI. Glycoconj. J. 15, 969–974. Stults, C. L., and Macher, B. A. (1993). Beta 1-3-N-acetylglucosaminyltransferase in human leukocytes: Properties and role in regulating neolacto glycosphingolipid biosynthesis. Arch. Biochem. Biophys. 303, 125–133. Tyrrell, D., James, P., Rao, N., Foxall, C., Abbas, S., Dasgupta, F., Nashed, M., Hasegawa, A., Kiso, M., Asa, D., et al. (1991). Structural requirements for the carbohydrate ligand of E-selectin. Proc. Natl. Acad. Sci. USA 88, 10372–10376. Wagers, A. J., Lowe, J. B., and Kansas, G. S. (1996). An important role for the alpha 1, 3 fucosyltransferase, FucT-VII, in leukocyte adhesion to E-selectin. Blood 88, 2125–2132. Wagers, A. J., Stoolman, L. M., Craig, R., Knibbs, R. N., and Kansas, G. S. (1998). An sLex-deficient variant of HL60 cells exhibits high levels of adhesion to vascular selectins: Further evidence that HECA-452 and CSLEX1 monoclonal antibody epitopes are not essential for high avidity binding to vascular selectins. J. Immunol. 160, 5122–5129. Witsell, D. L., Casey, C. E., and Neville, M. C. (1990). Divalent cation activation of galactosyltransferase in native mammary Golgi vesicles. J. Biol. Chem. 265, 15731–15737. Yao, L., Setiadi, H., Xia, L., Laszik, Z., Taylor, F. B., and McEver, R. P. (1999). Divergent inducible expression of P-selectin and E-selectin in mice and primates. Blood 94, 3820–3828. Zhang, D., Fan, G. C., Zhou, X., Zhao, T., Pasha, Z., Xu, M., Zhu, Y., Ashraf, M., and Wang, Y. (2008). Over-expression of CXCR4 on mesenchymal stem cells augments myoangiogenesis in the infarcted myocardium. J. Mol. Cell. Cardiol. 44, 281–292.
C H A P T E R
S I X
Functional Assays for the Molecular Chaperone Cosmc Tongzhong Ju and Richard D. Cummings Contents 1. Overview 2. T-Synthase and Cosmc 3. T-Synthase Activity Assay 3.1. Materials 3.2. Cell Lines and Preparation of Cell Extracts 3.3. Assay Procedure for T-Synthase and Calculation of Total Product 4. Assay Activity for Function of Cosmc 4.1. Generating an Expression Construct for Cosmc 4.2. Analyzing the Activity of Cosmc in the Baculovirus System 4.3. Analyzing Cosmc Activity in Mammalian Cells 5. Conclusion and Future Directions Acknowledgments References
108 110 113 114 114 115 116 116 117 118 119 120 120
Abstract Mucin type O-glycosylation involves sequential actions of several glycosyltransferases in the Golgi apparatus. Among those enzymes, a single gene product termed core 1 b3-galactosyltransferase (T-synthase) in vertebrates is the key enzyme that converts the precursor Tn antigen GalNAca1-Ser/Thr to the core 1 structure, Galb1-3GalNAca1-Ser/Thr, also known as T antigen. This represents the most common structure within typical O-glycans of membrane and secreted glycoproteins. Formation of the active T-synthase requires that it interacts with Core 1 b3Gal-T Specific Molecular Chaperone (Cosmc), which is a specific molecular chaperone in the endoplasmic reticulum (ER). T-synthase activity is commonly measured by its ability to transfer [3H]Gal from UDP-[3H]Gal to an artificial acceptor GalNAca-1-O-phenyl to form [3H]Galb1-3GalNAca-1-O-phenyl, which can then be isolated and quantified. Because the primary function of Cosmc is to form active T-synthase, the activity of Cosmc is assessed indirectly Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, Atlanta, Georgia, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79006-6
#
2010 Elsevier Inc. All rights reserved.
107
108
Tongzhong Ju and Richard D. Cummings
by its ability to promote formation of active T-synthase when it is coexpressed with T-synthase in cells lacking functional Cosmc. Such cells include insect cells, which constitutively lack Cosmc, and Cosmc-deficient mammalian cell lines. Cosmc is encoded by the X-linked Cosmc gene (Xq24 in human, Xc3 in mice), thus, acquired mutations in Cosmc, which have been observed in several human diseases, such as Tn syndrome and cancers, cause a loss of T-synthase, and expression of the Tn antigen. The methods described here allow the functional activities of such mutated Cosmc (mCosmc) to be measured and compared to wild-type (wtCosmc).
1. Overview Mucin type O-glycosylation is characterized by the a-glycosidic linkage of N-acetylgalactosamine (GalNAc) to serine or threonine residues in glycoproteins. This modification occurs in a wide range of membrane and secreted glycoproteins, including mucins, which are glycoproteins with repetitive peptide motifs rich in Ser/Thr/Pro. O-Glycans on glycoproteins play important functions in many biological processes, such as cell adhesion, signal transduction, glycoprotein stability, etc. (An et al., 2009; Chen and Varki, 2010; Cummings, 2009; Ghazarian et al., 2010; Jafar-Nejad et al., 2010; Kiessling and Splain, 2010; Lepenies et al., 2010; Li and Richards, 2010; van Die and Cummings, 2010). In particular, the mucin type O-glycans play critical roles in leukocyte recruitment, angiogenesis, lymphangiogenesis, and T cell differentiation ( Ju and Cummings, 2005; Wang et al., 2010; Xia and McEver, 2006; Xia et al., 2004; Yago et al., 2010). Moreover, many human diseases, including both inheritable and spontaneous, are associated with defects in O-glycosylation (Berninsone, 2006; Hennet, 2009; Ungar, 2009; Wopereis et al., 2006). The biosynthesis of mucin type O-glycans (or O-linked oligosaccharides) takes place in the Golgi apparatus by sequential actions of membranebound and soluble glycosyltransferases. The initial step is the glycosylation of polypeptides by polypeptide:a-N-acetylgalactosaminyltransferases (ppGalNAcTs) that transfer GalNAc from UDP-GalNAc to Ser/Thr in a polypeptide to form GalNAc-a-Ser/Thr, also called Tn antigen (Fig. 6.1; Tarp and Clausen, 2008; Ten Hagen et al., 2003). The Tn antigen can be further modified largely by three pathways depending on the cell type (Brockhausen, 1999; Schachter and Brockhausen, 1989; Wopereis et al., 2006). The most common pathway is modification by the core 1 b3 galactosyltransferase (core 1 b3GalT, T-synthase), which transfers Gal from UDP-Gal to the a-GalNAc linked to Ser/Thr to form Galb1-3GalNAc-a-R, the core 1 structure, also called T antigen ( Ju et al., 2002a,b). This core 1 structure is usually further modified by sialyltransferases, or extended by core 2 GnT,
109
Functional Assays of Cosmc Chaperone
Core 1 O-glycan (T antigen)
Sialyl-Tn antigen a6
b3
Protein in golgi
UDP
UDP
CMP
Cosmc a1 Ser/Thr Tn antigen
a3
a1 Ser/Thr Core 3 O-glycan
a3 CMP
b3
UDP
b3
b6
a1 Ser/Thr
UDP
T-synthase
Family of ppGalNAcTs
Ser/Thr
b3
a1 Ser/Thr
a1 Ser/Thr CMP
Extended core 2 Extended core 1 O-glycan O-glycan Core 2 O-glycan
b3
a1 Ser/Thr
Extended core 3 O-glycan
a6
a1 Ser/Thr
Extended core 4 O-glycan UDP
b3
b6
a1 Ser/Thr
Core 4 O-glycan
GalNAc
GlcNAc
Gal
NeuAc
Figure 6.1 Role of T-synthase and Cosmc in biosynthesis of O-glycans. The T-synthase utilizes the Tn antigen as the acceptor, which is synthesized in the Golgi apparatus through the actions of ppGalNAcT enzymes that act to add GalNAc from UDP-GalNAc donor to Ser/Thr residues on glycoproteins. The T-synthase, which requires the endoplasmic reticulum (ER) molecular chaperone Cosmc for its correct folding and eventual movement to the Golgi (Fig. 6.2), then adds Gal to the Tn antigen using the donor UDP-Gal. The major pathway of core 1 O-glycan formation is shown in the blue-boxed area. The subsequent core 1 disaccharide is a potential acceptor for other enzymes that may add sialic acid (NeuAc), Fuc, GlcNAc, or other sugars.
or other enzymes to make extended core 1 and core 2 O-glycans (Fig. 6.1). In the gastrointestinal tract, there is another coexisting pathway for synthesizing core 3 (An et al., 2007; Iwai et al., 2002, 2005) and core 4 O-glycans by sequential action of specific N-acetylglucosaminyltransferases. In some cells, and especially in cells lacking the T-synthase, CMP-Neu5Ac:GalNAc a2,6-sialyltransferase (ST6GalNAc-I) may inefficiently convert Tn antigen to Sialyl-Tn antigen (Cazet et al., 2010; Hakomori, 2001; Julien et al., 2006; Sewell et al., 2006).
110
Tongzhong Ju and Richard D. Cummings
2. T-Synthase and Cosmc The key enzyme in core 1 O-glycan biosynthesis is the T-synthase, a Golgi enzyme that requires a unique molecular chaperone termed Core 1 b3Gal-T Specific Molecular Chaperone (Cosmc) in the endoplasmic reticulum (ER) for activity (Ju and Cummings, 2002; Ju et al., 2008a; Wang et al., 2010). The T-synthase is a unique glycosyltransferase with little similarity to the b3GalT family, which has seven members in mammals. The T-synthase is encoded by a single gene composed of three exons located on chromosome 7p14-p13 (Ju et al., 2002a). The enzyme exists as a disulfide-bonded homodimeric protein, 84–86 kDa with type-II transmembrane topology (Ju et al., 2002b). Furthermore, T-synthase lacks potential N-glycosylation sites, which are present in most other glycosyltransferases. Disruption of the T-synthase in mice results in complete loss of T-synthase activity in embryos, global expression of the truncated O-glycan Tn antigen, and an embryonic lethal phenotype due to impaired angiogenesis (Xia et al., 2004). Disruption of T-synthase specifically in endothelial and hematopoietic cells leads to defective lymphatic vessel development leading to blood/lymphatic misconnections and consequent fatty liver disease (Fu et al., 2008). Defects in T-synthase activity have been seen in human diseases such as Tn syndrome (Crew et al., 2008; Ju and Cummings, 2005), and tumor cells such as Jurkat (Ju and Cummings, 2002; Ju et al., 2008b; Piller et al., 1990), but these defects are not associated with mutations or alterations in expression of the T-synthase transcripts, rather are a result of loss-of-function mutations in the X-linked gene Cosmc, which encodes a molecular chaperone termed Cosmc, required for T-synthase activity. Cosmc was discovered during studies on human tumor cell lines, such as the T-lymphoblastoid cell line Jurkat, that are deficient in T-synthase activity and express the Tn and Sialyl-Tn antigens ( Ju and Cummings, 2002; Ju et al., 2008b; Piller et al., 1990). In an attempt to understand the factors causing repression of T-synthase activity, we explored T-synthase expression in Jurkat cells. We initially assumed that the lack of T-synthase activity might be due to either a mutation in the T-synthase gene or transcriptional regulation of T-synthase expression; however, subsequent studies showed no defect in the coding sequence or transcript level for T-synthase in Jurkat cells. A clue to a potentially important factor required for T-synthase activity arose serendipitously from our earlier studies of partially purified T-synthase from rat liver. N-terminal sequencing of this material identified two proteins; one was the murine T-synthase, but the other sequence was derived from an unknown protein, which we subsequently designated Cosmc ( Ju and Cummings, 2002). Subsequently, we found that Cosmc in Jurkat cells is mutated, and that introduction of wtCosmc
111
Functional Assays of Cosmc Chaperone
into Jurkat cells not only restores the T-synthase activity, but also corrects the O-glycan structures and eliminates expression of the Tn antigen. Cosmc is encoded by a single exon gene at human Xq24, and is composed of 318 amino acids ( Ju and Cummings, 2002). Interestingly, Cosmc, like the T-synthase, is also a predicted type-II membrane protein. Comprehensive biochemical studies have shown that Cosmc is a resident ER protein that acts as a molecular chaperone to prevent the aggregation and subsequent proteasomal degradation of T-synthase ( Ju and Cummings, 2002; Ju et al., 2008a,b; Narimatsu et al., 2008; Fig. 6.2). Dysfunctional Cosmc in a cell causes loss of activity of T-synthase, and can lead to expression of Tn/STn antigens. Cell lines identified to have a mutated Cosmc and deficiency in T-synthase include Jurkat cells and several human tumor cells, such as LSC colon carcinoma and melanoma LOX cells (Ju and Cummings, 2002; Ju et al., 2008b), as well as mouse fibrosarcoma and neuroblastoma Neuro2a cells (Schietinger et al., 2006). Introducing wtCosmc into these cells restores T-synthase activity and T antigen expression. Furthermore, in a rare autoimmune blood disorder called Tn syndrome, which is characterized by Tn/STn antigen expression in a subpopulation of blood cells of all lineages, five patients with Tn syndrome examined to date all carry somatic mutation in Cosmc (Crew et al., 2008; A Normal with Cosmc Newly synthesized T-synthase
Golgi
Endoplasmic reticulum Chaperone cycle
Active dimers
Exit to golgi
Functional T-synthase dimers
Cosmc
B Without Cosmc
Endoplasmic reticulum
Key Cosmc
Inactive T-synthase oligomers
T-synthase does not exit ER
Ubiquitination, targeting to the 26S proteasome, degradation Degradation
Inactive T-synthase Active T-synthase Ubiquitin
Figure 6.2 Model of Cosmc function as a chaperone in the ER to assist in the folding of T-synthase, and the consequences on T-synthase biosynthesis and degradation in the absence of functional Cosmc. Mutations in Cosmc, an X-linked gene, may lead to partial activity of Cosmc or complete loss-of-function. The indirect measurement of Cosmc function in cells is determined by the activity of the T-synthase with or without expression of wild-type Cosmc (Fig. 6.3).
112
Tongzhong Ju and Richard D. Cummings
Ju and Cummings, 2005). Most recently, we reported that deletion of Cosmc in mice results in a total loss of T-synthase activity and expression of the Tn antigen in vivo in all observable cells, along with embryonic lethality due to failure of angiogenesis and hemorrhage (Wang et al., 2010). Since the primary function of Cosmc in the ER lumen is to assist the folding of T-synthase, the methods to assess the functionality of Cosmc rely on measuring the activity of T-synthase that results from the chaperone activity of Cosmc. The method employs available cell lines deficient in Cosmc, which includes insect cell lines constitutively lacking Cosmc, and human and animal cell lines in which Cosmc is mutated, and hence the cells are deficient in T-synthase activity, but express normal transcripts for T-synthase. Thus, the assay for Cosmc is a type of complementation assay, in which functional Cosmc and T-synthase must be present together in order to acquire T-synthase activity (Fig. 6.3A–C).
A
B Sf-9 or Hi-5 insect cells
Harvest baculovirus containing wtT-synthase
Cotransfection
Baculovirus DNA
Cotransfection
pVL1393 vector containing cDNA for wtT-synthase
Sf-9 or Hi-5 insect cells
Jurkat cell line or other cell lines lacking normal Cosmc (e. g. LSC or LOX cells)
pVL1393 vector containing cDNA for either wtCosmc or mCosmc
Expression vector pcDNA3.1(+) containing either wtCosmc or mCosmc
Baculovirus DNA
Harvest baculovirus containing either wtCosmc or mCosmc
At 72 h posttransfection, harvest Jurkat cells, and prepare cell extracts for assaying T-synthase activity
C
Coinfection
At 4–5 days postinfection, harvest cells, and prepare cell extracts for assaying T-synthase activity
Activity of T-synthase(nmol/h-ml) in Sf-9 cell extracts
100.0 75.0 5.0 2.5
c syn t h +C as osm e c
Co sm
T-
ase nth
Co
Tsy
ntr
ol
0
Figure 6.3 Preparation of vectors and assays for functional Cosmc using expression in (A) insect cells and (B) mammalian cell lines. (C) Example of T-synthase activity in Sf-9 cell extracts infected with either human wtT-synthase, wtCosmc, or wtT-synthase plus wtCosmc. Cell extracts were assayed for T-synthase activity by the method described (Fig. 6.4) using UDP-[3H]Gal as the donor and GalNAca-1-O-phenyl as the acceptor.
113
Functional Assays of Cosmc Chaperone
3. T-Synthase Activity Assay The activity of T-synthase is represented by the amount of product Galb1-3GalNAca1-R synthesized in a defined period of time under optimal conditions of temperature, metal ions, acceptor (GalNAca1-R), and donor (UDP-Gal). Typical assays for T-synthase employ UDP-[3H]Gal as the donor, giving rise to a radiolabeled disaccharide product [3H]Galb13GalNAca1-R (Fig. 6.4). Measurement of the product requires separation of the radiolabeled product from the radiolabeled donor substrate. Typical assays for the T-synthase utilize GalNAca-1-O-phenyl, a hydrophobic acceptor that binds well to C18 Cartridges, whereas UDP-Gal donor does not bind. Thus, the radiolabeled product (and unlabeled acceptor) are bound by C18 and eluted with organic solvent directly into scintillation vials or receptacles for measuring radioactivity. GalNAca-1-O-phenyl (acceptor) Folded, active T-synthase
UDP-[3H]Gal (donor) Mn2+ UDP
[3H]Galb1-3GalNAca-1-O-phenyl (product) + GalNAca-1-O-phenyl + UDP-[3H]Gal Load onto C18 cartridge
Wash
Bound
Unbound UDP-[3H]Gal + UDP + Mn2+ + buffers, etc
[3H]Galb1-3GalNAca-1-O-phenyl + GalNAca-1-O-phenyl
Elute +scintillation cocktail Activity
cpm
Count
Figure 6.4 The assay procedure for T-synthase using GalNAca-1-O-phenyl as the acceptor and UDP-[3H]Gal as the donor.
114
Tongzhong Ju and Richard D. Cummings
There are some alternative assays available for T-synthase, including glycopeptides with the Tn antigen (Ju et al., 2002a). In this case, the reaction can be conducted with either unlabeled UDP-Gal or UDP-[3H]Gal, and the product glycopeptide may be separated and quantified by HPLC. Another variation of this is to use desialylated bovine submaxillary mucin (asialoBSM) as the acceptor, since BSM is a mucin with high amounts of Sialyl-Tn antigen. The radiolabeled product using UDP-[3H]Gal as the donor can be quantified after separation of donor and product by either adsorption of the radiolabeled glycoprotein product on nitrocellullose filters (Do et al., 1994) and subsequent counting of radioactivity on the filters, or capture of the radiolabeled glycoprotein product by a plant lectin, such as peanut agglutinin (PNA), that binds to the product glycan Galb1-3GalNAca1-R (Novogrodsky et al., 1975). Verification of the radiolabeled product can be performed using the endo-a-N-acetylgalactosaminidase from Diplococcus pneumoniae (Endo and Kobata, 1976), which cleaves the core 1 O-glycan, or O-glycosidase (New England Biolabs), a recombinant endo-a-N-acetylgalactosaminidase that cleaves both core 1 and core 3 O-glycan disaccharides in O-glycosidic linkages to an aglycone to release free disaccharides (Koutsioulis et al., 2008). The released disaccharide can be analyzed by mass spectrometry or by HPLC and compared to standards ( Ju et al., 2002a, 2006).
3.1. Materials The acceptor GalNAca-1-O-phenyl (Sigma-Aldrich, St. Louis, MO) is dissolved in 0.5 M MES–NaOH (pH 6.8) to give a 10-mM stock solution and stored at 4 C for short term, and at 20 C for long term. UDP-Gal (Sigma-Aldrich) is dissolved in H2O to a final concentration of 10 mM, and stored in aliquots stably at 20 C. MnCl2 is prepared at 1 M in water as a stock solution. ATP is dissolved in water at 100 mM and adjusted pH to 7.0 with 0.5 N NaOH. UDP-[6-3H]-Gal (40–60 Ci/mmol, 0.1 mCi/ml in 50% ethanol; American Radiolabeled Chemicals, Inc., St. Louis, MO) is stored at 20 C. Sep-Pak C18 (50 mg) Cartridges (Waters Corporation, Milford, MA) are stored at room temperature. Proteinase inhibitor cocktail are obtained from Boehringer-Mannheim (Germany).
3.2. Cell Lines and Preparation of Cell Extracts Human Jurkat cells (clone E6-1), and insect Sf-9 and Hi-5 cells are available from American Type Culture Collection (ATCC). The human colorectal carcinoma LSC cells were kindly provided by Dr. Steven Itzkowitz of Mount Sinai School of Medicine at New York and human melanoma LOX was a gift from the group of Dr. Oystein Fodstad of Norwegian Radium Hospital Research Foundation ( Ju et al., 2008b).
Functional Assays of Cosmc Chaperone
115
Both Jurkat and LOX cells are cultured in RPMI1640 plus 10% FCS, at 37 C supplied with 5% CO2. LSC cells are cultured in DMEM media plus 10% FCS. mRNA purification kit and cDNA synthesis kit are purchased from Invitrogen. PhusionTM High Fidelity PCR system is purchased from New England Biolabs (Ipswich, MA). Insect cells, SF-9 cells are cultured in Sf-900II media with 10% FCS, and Hi-5 cells with EX-CELL 405 at 27 C. Cells are harvested at appropriate times, resuspended in an appropriate volume of 25 mM Tris–HCl buffer (pH 7.5) containing 150 mM NaCl and Proteinase Inhibitor Cocktail (Boehringer-Mannheim; 1 tablet for 10 ml total solution volume), and homogenized by sonication in an icebath four times for 5 s each. The postnuclear supernatants are obtained by centrifugation of homogenate at 1000g for 10 min, and the extracts are obtained by adding 0.5% Triton X-100 (final concentration) to the supernatant and solubilizing on ice for 30 min. The solubilized material is centrifuged at 3000g and the supernatant containing the cell extract is saved.
3.3. Assay Procedure for T-Synthase and Calculation of Total Product Step 1: Prepare a master reaction mixture (for 20 reactions) by combining H2O (420 ml), 10 mM UDP-Gal (40 ml), 100 mM ATP (20 ml), and 1.0 M MnCl2 (20 ml) for a mixture volume of 500 ml (Fig. 6.4). To this reaction mixture add 0.1 mCi UDP-[3H]Gal (1 ml) directly from the source. This solution is briefly mixed and stored on ice. Step 2: To each experimental assay tube (1.5 ml Eppendorf tube) add 10 mM acceptor GalNAca1-O-phenyl (5 ml), master reaction mixture (25 ml), and sample containing potential T-synthase (20 ml). The final reaction is a total volume of 50 ml and contains 50 mM MES (pH 6.8), 1 mM GalNAca1-O-phenyl, 0.4 mM UDP-[3H]-Gal (50,000– 60,000 cpm/nmol), 0.1% Triton X-100 (for membrane extracts), 20 mM MnCl2, 2 mM ATP, and enzyme. Typical assays are done in duplicate or triplicate. [Note: Two control blank reactions are conducted. One is a blank in which the donor GalNAca1-O-phenyl is replaced by 50 mM MES buffer, and the other blank lacks the enzyme source and is replaced by the solubilization buffer, or whatever buffer in which the enzyme source is prepared.] Step 3: Incubate the reaction tubes at 37 C for 30–60 min with brief shaking by hand every 10–15 min. The reaction is stopped by addition of ice-cold water (450 ml) to give a final diluted reaction volume of 500 ml. This is kept on ice until ready for isolation of product in Step 4. Step 4: To isolate the [3H]-product, each reaction tube content is loaded onto separate 50 mg Sep-Pak C18 Cartridges, previously activated with
116
Tongzhong Ju and Richard D. Cummings
1 ml methanol and equilibrated with 6 ml water (1 ml each, six times; Fig. 6.4). Following application of the 500 ml reaction mixture, the columns are washed with 8 ml of water, and product is eluted with 1 ml of isopropanol or 1-butanol. The eluted radioactive product is measured by liquid scintillation counting in 6 ml of Scintiverse-BD. A unit of activity is defined as that amount of enzyme transferring 1 nmol of Gal from UDP-Gal to the acceptor GalNAca1-O-phenyl per hour at 37 C. To calculate the T-synthase activity, several pieces of information are needed, which include: (i) the total counts (cpm) of UDP-[3H]-Gal added in one reaction system; (ii) the total amount (pmol) of UDP-Gal in the reaction; (iii) the counts (cpm) measured in the reaction product from the eluent a reaction; (iv) the volume of the enzyme source or cell extract in the reaction; (v) the reaction time in hours; and (vi) total protein concentration (mg/ml) if necessary. From this information, it is possible to calculate the specific radioactivity of the donor UDP-[3H]-Gal by dividing the total cpm in the assay by the total pmol of UDP-Gal in assay (both labeled and unlabeled) to obtain cpm/pmol UDP-[3H]-Gal. The ‘‘product cpm minus background’’ is determined by subtracting the number of cpm in the control blank lacking enzyme or acceptor (both should give similar low-level background cpm) from the total cpm observed in the reaction assay. The product cpm minus background is then divided by the cpm/pmol UDP-[3H]-Gal to obtain the total pmol of product generated. This number of pmol can then be divided by hours of reaction and/or mg total protein to derive pmol/h product and/or pmol/mg/h product, respectively.
4. Assay Activity for Function of Cosmc The function or activity of Cosmc is assessed by means of complementation assay, either by cotransfection and introduction of Cosmc along with human T-synthase into insect cells, such as Sf-9 or Hi-5 cells, which lack the ortholog for human Cosmc (Fig. 6.3A), or in mammalian cells such as Jurkat, LSC, or LOX cells, which lack functional Cosmc (Fig. 6.3B). These require a molecular construct containing the cDNA for wtCosmc and/ or mCosmc.
4.1. Generating an Expression Construct for Cosmc To construct a plasmid encoding wtCosmc, the open reading frame (ORF) of human Cosmc cDNA is amplified by RT-PCR using mRNA of cells, tissues, or blood leukocytes. The primers are forward
Functional Assays of Cosmc Chaperone
117
50 -CGTGAGAGGAAACCCGTG-30 ; reverse 50 -TGTGTGGTTATACCAGTGCC-30 . The PCR products are then digested with appropriate restriction enzymes and cloned into expression vector pcDNA3.1(þ) for transfection of mammalian cells. The PCR product can be cloned into vector pVL1393 for insect cell transfection. In the insect cell expression system, an expression vector for human T-synthase is also required, and may be prepared as a soluble construct with an epitope tag as described ( Ju and Cummings, 2002). To construct expression vectors for mutated Cosmc (mCosmc), several strategies are available depending on the type of mutation. For mutations in the ORF of Cosmc, QuickChangeTM is used as the expression plasmid containing wtCosmc as a template, and the two complementary DNA oligonucleotides (45–50 nt) containing the desired mutation are set up in a PCRlike reaction to amplify the entire plasmid. The parental DNA template is then digested with DpnI endonuclease to select for synthesized DNA harboring mutations. The new mutated plasmid containing staggered nicks is then transformed into XL1-Blue supercompetent cells, which can repair the nick before amplification. The final plasmid should be resequenced for confirmation. The QuickChangeTM II Site-Directed Mutagenesis Kit from STRATAGENE works very well in our hands for those small mutations following the protocol for point mutations, including conversion, 1–3 bp insertion, and 1–3 bp deletion. Compared to PCR-directed mutagenesis, QuickChange is simple, requires shorter experiment manipulation, and has higher efficiency. The DNA fragment replacement strategy is suitable for all kinds of alterations, including point mutations, large DNA fragment insertion into the ORF, and deletions. Both plasmids for expression of wtCosmc and the RT-PCR product containing mCosmc are digested with the same restriction enzymes, respectively. The expression vector piece (missing a DNA fragment) and the DNA fragment covering the mutation are purified and can be ligated to form a new expression plasmid encoding the mutated version of mCosmc.
4.2. Analyzing the Activity of Cosmc in the Baculovirus System Although invertebrates have T-synthase orthologs, Cosmc is unique to vertebrates, and the invertebrate T-synthases do not require Cosmc. Therefore invertebrate cells such as insect cells are the ideal system to assay the chaperone activity of Cosmc, since most mammalian cells, except for those cell lines noted above in which Cosmc is mutated, have endogenous wtCosmc. Cosmc is specific for vertebrate T-synthase, and thus, in the insect cell system, human T-synthase must be coexpressed to assess Cosmc function. We have used the Baculovirus system for Cosmc activity assays (Fig. 6.3A and C).
118
Tongzhong Ju and Richard D. Cummings
4.2.1. Preparation of Baculovirus Sf-9 insect cells are cultured in 5 ml of Sf-900II SFM with 10% FBS at 27 C in a T25 flask and cotransfected with pVL1393 vector and linearized Baculovirus DNA using the BaculoGoldTM Transfection Kit (BD BioScience) following the manufacturer’s protocol. The media containing the Baculovirus is harvested 4 days posttransfection. For large-scale preparation of Baculovirus, Sf-9 cells cultured in 25 ml of media are infected with 0.25 ml of Baculovirus obtained above. The Baculovirus (media) is collected 4 days postinfection and used for expression of human T-synthase and Cosmc. 4.2.2. Infection of Hi-5 Insect Cells Hi-5 cells are cultured in EX-CELL 405 media at 27 C. For infection or coinfection of human wtCosmc, mCosmc, and T-synthase, 0.75 ml of Baculovirus is used. At 3–4 days postinfection, the cells are harvested and extracts are prepared for assaying T-synthase activity, as above. The protein levels of both Cosmc and T-synthase may be determined by Western blot, using appropriate antibodies to the proteins or epitope-tagged proteins ( Ju and Cummings, 2002, 2005; Wang et al., 2010).
4.3. Analyzing Cosmc Activity in Mammalian Cells Mammalian cells normally constitutively express endogenous functional Cosmc and its client T-synthase. Thus, typical mammalian cells lines are not appropriate for measuring the function of mCosmc, since the cells have a high background of endogenous Cosmc and in most cells, endogenous Cosmc is more than enough to fold endogenous T-synthase. Fortunately, several human cell lines, including Jurkat, colorectal carcinoma LSC, and melanoma LOX, have dysfunctional Cosmc due to point mutations in the ORF of Cosmc or changes in the promoter sequences for Cosmc, yet contain normal T-synthase ( Ju and Cummings, 2002, 2005; Ju et al., 2008b). This allows the performance of complementation experiments in which only wtCosmc or mCosmc is introduced into those cells to test its ability to form active Tsynthase from the endogenous enzyme (Fig. 6.3B). All studies on mCosmc function should have controls in which wtCosmc is separately expressed. Thus, the activity of mCosmc is compared to wtCosmc in terms of promoting T-synthase activity (Fig. 6.3C). Jurkat cells may be transiently transfected with an expression vector encoding Cosmc using the GENEPORTER transfection reagent and Booster (Gene Therapy Systems, San Diego, CA) or Fugene 6 (Roche Diagnostics Corp., Indianapolis, IN) following the manufacturer’s protocol. LOX and LSC cells can also be used in a similar fashion. Cells are harvested at 72 h posttransfection, and a cell extract is prepared and assayed for T-synthase activity. Using these transfection protocols, stably transfected
Functional Assays of Cosmc Chaperone
119
cells can also be established by selection with 400–600 mg/ml of G418 in the culturing media for 4–6 weeks. The O-glycans on the cell surface of Jurkat cells (or LOX or LSC cells) before or after transfection can also be analyzed by flow cytometry, microscopy, or by Western blot analysis, using reagents that detect O-glycan structures. When Cosmc is functional, the activity of T-synthase in these cells is restored, which leads to core 1 O-glycan (or T antigen) that may be further modified by core 2 GnT, extended core 1 GnT, and sialyltransferases (Fig. 6.1). For Jurkat and LOX cells, wtCosmc-transfected cells mainly synthesize the sialylated core 1 structure, which can be detected or semiquantified by fluorescent-PNA after desialylation. For example, mock-transfected Jurkat cells or Jurkat cells stably transfected with wtCosmc (3–5 105 cells) are washed with PBS and resuspended in 250 ml of RPMI1640 complete media and either treated or not treated with 50 mU of Neuraminidase (from Arthrobacter ureafaciens, Sigma-Aldrich) at 37 C for 1 h. The cells are washed twice with PBS and incubated with 5 mg/ml of Alexa488-labeled PNA for 1 h at room temperature. The cells are washed with PBS twice and a portion of the cells are then transferred to an 8-well chambered slide and visualized under either a phase contrast, fluorescent, or confocal microscope. Alternatively, the cells can be stained with 0.1–0.2 mg/ml of Alexa488-labeled PNA and analyzed on a flow cytometer, as described ( Ju et al., 2008b).
5. Conclusion and Future Directions Mucin type O-glycans play important roles in many aspects of biological processes. The systematic activity assays for the key enzyme T-synthase and its regulator Cosmc as described here aid in our understanding of these processes and ultimately their contributions to human biology and diseases, such as Tn syndrome, IgA nephropathy, and human tumors. As more information on the structure of Cosmc and T-synthase become available, the activity assay, especially for Cosmc, may be supplemented by bioinformatics approaches, using known mutant sequences of mCosmc to predict function. In addition, we recently developed an in vitro method using recombinant forms of wtCosmc and mCosmc (with point mutations that do not affect synthesis of the total protein), to also measure the direct chaperone activity of Cosmc toward denatured T-synthase (Aryal et al., 2010). While that method is useful with larger quantities of recombinant Cosmc, the methods described here using transfection and complementation methods, are reliable and highly sensitive, and less time consuming. As more sensitive and nonradioactive assays for T-synthase become available they may be used to substitute for the radioactivity-based assay shown in Fig. 6.4.
120
Tongzhong Ju and Richard D. Cummings
ACKNOWLEDGMENTS The authors thank Dr. Jamie Heimburg-Molinaro for help in editing the manuscript. The studies here were supported by National Institutes of Health Grant RO1 GM068559 (to R. D. C) and Grant RO1DK80876 (to T. J.).
REFERENCES An, G., Wei, B., Xia, B., McDaniel, J. M., Ju, T., Cummings, R. D., Braun, J., and Xia, L. (2007). Increased susceptibility to colitis and colorectal tumors in mice lacking core 3-derived O-glycans. J. Exp. Med. 204, 1417–1429. An, H. J., Kronewitter, S. R., de Leoz, M. L., and Lebrilla, C. B. (2009). Glycomics and disease markers. Curr. Opin. Chem. Biol. 13, 601–607. Aryal, R. P., Ju, T., and Cummings, R. D. (2010). The endoplasmic reticulum chaperone Cosmc directly promotes in vitro folding of T-synthase. J. Biol. Chem. 285, 2456–2462. Berninsone, P. M. (2006). Carbohydrates and glycosylation. WormBook 18, 1–22. Brockhausen, I. (1999). Pathways of O-glycan biosynthesis in cancer cells. Biochim. Biophys. Acta 1473, 67–95. Cazet, A., Julien, S., Bobowski, M., Krzewinski-Recchi, M. A., Harduin-Lepers, A., Groux-Degroote, S., and Delannoy, P. (2010). Consequences of the expression of sialylated antigens in breast cancer. Carbohydr. Res. Epub ahead of print. Chen, X., and Varki, A. (2010). Advances in the biology and chemistry of sialic acids. ACS Chem. Biol. 5, 163–176. Crew, V. K., Singleton, B. K., Green, C., Parsons, S. F., Daniels, G., and Anstee, D. J. (2008). New mutations in C1GALT1C1 in individuals with Tn positive phenotype. Br. J. Haematol. 142, 657–667. Cummings, R. D. (2009). The repertoire of glycan determinants in the human glycome. Mol. Biosyst. 5, 1087–1104. Do, K. Y., Fregien, N., Pierce, M., and Cummings, R. D. (1994). Modification of glycoproteins by N-acetylglucosaminyltransferase V is greatly influenced by accessibility of the enzyme to oligosaccharide acceptors. J. Biol. Chem. 269, 23456–23464. Endo, Y., and Kobata, A. (1976). Partial purification and characterization of an endo-alphaN-acetylgalactosaminidase from the culture of medium of Diplococcus pneumoniae. J. Biochem. 80, 1–8. Fu, J., Gerhardt, H., McDaniel, J. M., Xia, B., Liu, X., Ivanciu, L., Ny, A., Hermans, K., Silasi-Mansat, R., McGee, S., Nye, E., Ju, T., et al. (2008). Endothelial cell O-glycan deficiency causes blood/lymphatic misconnections and consequent fatty liver disease in mice. J. Clin. Invest. 118, 3725–3737. Ghazarian, H., Idoni, B., and Oppenheimer, S. B. (2010). A glycobiology review: Carbohydrates, lectins and implications in cancer therapeutics. Acta Histochem. Epub ahead of print. Hakomori, S. (2001). Tumor-associated carbohydrate antigens defining tumor malignancy: Basis for development of anti-cancer vaccines. Adv. Exp. Med. Biol. 491, 369–402. Hennet, T. (2009). From glycosylation disorders back to glycosylation: What have we learned? Biochim. Biophys. Acta 1792, 921–924. Iwai, T., Inaba, N., Naundorf, A., Zhang, Y., Gotoh, M., Iwasaki, H., Kudo, T., Togayachi, A., Ishizuka, Y., Nakanishi, H., and Narimatsu, H. (2002). Molecular cloning and characterization of a novel UDP-GlcNAc:GalNAc-peptide beta1, 3-Nacetylglucosaminyltransferase (beta 3Gn-T6), an enzyme synthesizing the core 3 structure of O-glycans. J. Biol. Chem. 277, 12802–12809.
Functional Assays of Cosmc Chaperone
121
Iwai, T., Kudo, T., Kawamoto, R., Kubota, T., Togayachi, A., Hiruma, T., Okada, T., Kawamoto, T., Morozumi, K., and Narimatsu, H. (2005). Core 3 synthase is downregulated in colon carcinoma and profoundly suppresses the metastatic potential of carcinoma cells. Proc. Natl. Acad. Sci. USA 102, 4572–4577. Jafar-Nejad, H., Leonardi, J., and Fernandez-Valdivia, R. (2010). Role of glycans and glycosyltransferases in the regulation of notch signaling. Glycobiology Epub ahead of print. Ju, T., and Cummings, R. D. (2002). A unique molecular chaperone Cosmc required for activity of the mammalian core 1 beta 3-galactosyltransferase. Proc. Natl. Acad. Sci. USA 99, 16613–16618. Ju, T., and Cummings, R. D. (2005). Protein glycosylation: Chaperone mutation in Tn syndrome. Nature 437, 1252. Ju, T., Brewer, K., D’Souza, A., Cummings, R. D., and Canfield, W. M. (2002a). Cloning and expression of human core 1 beta1, 3-galactosyltransferase. J. Biol. Chem. 277, 178–186. Ju, T., Cummings, R. D., and Canfield, W. M. (2002b). Purification, characterization, and subunit structure of rat core 1 Beta1, 3-galactosyltransferase. J. Biol. Chem. 277, 169–177. Ju, T., Zheng, Q., and Cummings, R. D. (2006). Identification of core 1 O-glycan T-synthase from Caenorhabditis elegans. Glycobiology 16, 947–958. Ju, T., Aryal, R. P., Stowell, C. J., and Cummings, R. D. (2008a). Regulation of protein O-glycosylation by the endoplasmic reticulum-localized molecular chaperone Cosmc. J. Cell Biol. 182, 531–542. Ju, T., Lanneau, G. S., Gautam, T., Wang, Y., Xia, B., Stowell, S. R., Willard, M. T., Wang, W., Xia, J. Y., Zuna, R. E., Laszik, Z., Benbrook, D. M., et al. (2008b). Human tumor antigens Tn and sialyl Tn arise from mutations in Cosmc. Cancer Res. 68, 1636–1646. Julien, S., Adriaenssens, E., Ottenberg, K., Furlan, A., Courtand, G., VercoutterEdouart, A. S., Hanisch, F. G., Delannoy, P., and Le Bourhis, X. (2006). ST6GalNAc I expression in MDA-MB-231 breast cancer cells greatly modifies their O-glycosylation pattern and enhances their tumourigenicity. Glycobiology 16, 54–64. Kiessling, L. L., and Splain, R. A. (2010). Chemical approaches to glycobiology. Annu. Rev. Biochem. 79, 619–653. Koutsioulis, D., Landry, D., and Guthrie, E. P. (2008). Novel endo-alpha-N-acetylgalactosaminidases with broader substrate specificity. Glycobiology 18, 799–805. Lepenies, B., Yin, J., and Seeberger, P. H. (2010). Applications of synthetic carbohydrates to chemical biology. Curr. Opin. Chem. Biol. 14, 404–411. Li, J., and Richards, J. C. (2010). Functional glycomics and glycobiology: An overview. Methods Mol. Biol. 600, 1–8. Narimatsu, Y., Ikehara, Y., Iwasaki, H., Nonomura, C., Sato, T., Nakanishi, H., and Narimatsu, H. (2008). Immunocytochemical analysis for intracellular dynamics of C1GalT associated with molecular chaperone, Cosmc. Biochem. Biophys. Res. Commun. 366, 199–205. Novogrodsky, A., Lotan, R., Ravid, A., and Sharon, N. (1975). Peanut agglutinin, a new mitogen that binds to galactosyl sites exposed after neuraminidase treatment. J. Immunol. 115, 1243–1248. Piller, V., Piller, F., and Fukuda, M. (1990). Biosynthesis of truncated O-glycans in the T cell line Jurkat. Localization of O-glycan initiation. J. Biol. Chem. 265, 9264–9271. Schachter, H., and Brockhausen, I. (1989). The biosynthesis of branched O-glycans. Symp. Soc. Exp. Biol. 43, 1–26. Schietinger, A., Philip, M., Yoshida, B. A., Azadi, P., Liu, H., Meredith, S. C., and Schreiber, H. (2006). A mutant chaperone converts a wild-type protein into a tumorspecific antigen. Science 314, 304–308.
122
Tongzhong Ju and Richard D. Cummings
Sewell, R., Backstrom, M., Dalziel, M., Gschmeissner, S., Karlsson, H., Noll, T., Gatgens, J., Clausen, H., Hansson, G. C., Burchell, J., and Taylor-Papadimitriou, J. (2006). The ST6GalNAc-I sialyltransferase localizes throughout the Golgi and is responsible for the synthesis of the tumor-associated sialyl-Tn O-glycan in human breast cancer. J. Biol. Chem. 281, 3586–3594. Tarp, M. A., and Clausen, H. (2008). Mucin-type O-glycosylation and its potential use in drug and vaccine development. Biochim. Biophys. Acta 1780, 546–563. Ten Hagen, K. G., Fritz, T. A., and Tabak, L. A. (2003). All in the family: The UDPGalNAc:polypeptide N-acetylgalactosaminyltransferases. Glycobiology 13, 1R–16R. Ungar, D. (2009). Golgi linked protein glycosylation and associated diseases. Semin. Cell Dev. Biol. 20, 762–769. van Die, I., and Cummings, R. D. (2010). Glycan gimmickry by parasitic helminths: A strategy for modulating the host immune response? Glycobiology 20, 2–12. Wang, Y., Ju, T., Ding, X., Xia, B., Wang, W., Xia, L., He, M., and Cummings, R. D. (2010). Cosmc is an essential chaperone for correct protein O-glycosylation. Proc. Natl. Acad. Sci. USA 107, 9228–9233. Wopereis, S., Lefeber, D. J., Morava, E., and Wevers, R. A. (2006). Mechanisms in protein O-glycan biosynthesis and clinical and molecular aspects of protein O-glycan biosynthesis defects: A review. Clin. Chem. 52, 574–600. Xia, L., and McEver, R. P. (2006). Targeted disruption of the gene encoding core 1 beta1-3-galactosyltransferase (T-synthase) causes embryonic lethality and defective angiogenesis in mice. Methods Enzymol. 416, 314–331. Xia, L., Ju, T., Westmuckett, A., An, G., Ivanciu, L., McDaniel, J. M., Lupu, F., Cummings, R. D., and McEver, R. P. (2004). Defective angiogenesis and fatal embryonic hemorrhage in mice lacking core 1-derived O-glycans. J. Cell Biol. 164, 451–459. Yago, T., Fu, J., McDaniel, J. M., Miner, J. J., McEver, R. P., and Xia, L. (2010). Core 1-derived O-glycans are essential E-selectin ligands on neutrophils. Proc. Natl. Acad. Sci. USA 107, 9204–9209.
C H A P T E R
S E V E N
Core 3-Derived O-Glycans Are Essential for Intestinal Mucus Barrier Function Lijun Xia*,†,‡ Contents 1. Introduction 2. Generation of C3GnT –/– Mice 2.1. Methods 2.2. Results and discussion 3. Disruption of the C3GnT Gene Eliminates Core 3-Derived O-Glycans and Exposes the Tn Antigen in Murine Colon 3.1. Methods 3.2. Results and analysis 4. Deficiency of C3GnT Results in Reduced Muc2 Expression in Colon and Impaired Mucosal Integrity 4.1. Methods 4.2. Results and analysis 5. C3GnT –/– Mice are Highly Susceptible to Dextran Sodium Sulfate-Induced Colitis 5.1. Methods 5.2. Results and analysis 6. Conclusion and Future Direction Acknowledgments References
124 126 126 128 128 128 129 131 131 133 133 133 136 138 140 140
Abstract O-Glycans are primary components of the intestinal mucins that form the mucus gel layer overlying the gut epithelium. Core 3-derived O-glycans, which are one of the major types of O-glycans, are primarily expressed in colon. To investigate * Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma, USA Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA { Oklahoma Center for Medical Glycobiology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79007-8
#
2010 Elsevier Inc. All rights reserved.
123
124
Lijun Xia
the biological function of core 3-derived O-glycans, we engineered mice lacking core 3 b1,3-N-acetylglucosaminyltransferase (C3GnT), an enzyme predicted to be important in synthesis of core 3-derived O-glycans. Disruption of the C3GnT gene eliminated core 3-derived O-glycans. C3GnT-deficient mice displayed a discrete, colon-specific reduction in Muc2 protein and increased permeability of the intestinal barrier. Moreover, these mice were highly susceptible to experimental triggers of colitis. These data reveal a requirement for core 3-derived O-glycans in colon mucus barrier function.
1. Introduction Intestinal mucus is primarily composed of mucins, a family of high molecular weight molecules widely expressed in epithelial tissues. Mucins are characterized by tandem repeat peptide sequences that are rich in serine, threonine, and proline. These amino acid residues can carry large numbers of O-linked oligosaccharides (O-glycans), which account for up to 80% of the mass of the mucin molecules and which are responsible for many of the properties of mucins. The intestinal mucus layer and epithelial cells comprise an intestinal barrier that protects epithelial and intestinal mucosal immune cells from potentially harmful luminal microflora and food components (Corfield et al., 2001; Podolsky and Isselbacher, 1984; Rhodes, 1996, 1997), and participates in bacterial colonization (Macfarlane et al., 2005). The role of intestinal epithelial cells in maintaining barrier function and in the pathogenesis of a number of common intestinal diseases, such as inflammatory bowel disease (IBD), has been well studied (Clayburgh et al., 2005; Elson et al., 2003; Kabashima et al., 2002; Macdonald and Monteleone, 2005; Morteau et al., 2000; Ponda and Mayer, 2005; Rakoff-Nahoum et al., 2004; Resta-Lenert et al., 2005). However, the physiological and pathological significance of the mucus layer has been less explored. O-Glycans containing GalNAc in a-linkage to serine or threonine residues occur on many membrane and secreted proteins, particularly mucins. O-Glycans have two main core structures referred to as core 1- and core 3-derived O-glycans (Fig. 7.1A). The biosynthesis of these cores is controlled by specific glycosyltransferases. Core 3 b1,3-N-acetylglucosaminyltransferase activity is enriched in mucin-secreting epithelial tissues such as gastrointestinal tract, as measured by enzymatic activity assays in tissue lysates (Brockhausen and Kuhns, 1997; Iwai et al., 2002, 2005). The enzyme transfers GlcNAc from UDP-GlcNAc to GalNAca1-Ser/Thr (Tn antigen) to form the core 3 O-glycan (GlcNAcb1,3GalNAca1-Ser/Thr), which can be further modified to form more complex structures such as core 4 O-glycans (Fig. 7.1A). Recently, human core 3 b1,3-N-acetylglucosaminyltransferase (C3GnT, also known as b3Gn-T6 or core 3 synthase) was identified (Iwai et al., 2002, 2005). In vitro biochemical analysis suggests that C3GnT is the only enzyme responsible for the biosynthesis of core 3 O-glycans (Iwai et al., 2002, 2005).
A Core 1-derived O-glycans Core 3-derived O-glycans
Core 2 O-glycan
Core 4 O-glycan
S Serine
Core 1 O-glycan, T antigen
T Threonine GalNAc
C3GnT
Core 3 O-glycan
Gal
Tn T antigen
GlcNAc
Sialyl-Tn antigen
Sialic acid Fucose B
T
Wild-type C3GnT allele
ATG
Exon 1
Exon 2
Ev Targeted C3GnT allele
Exon 1
Lac Z
Probe Ev
C Genotype: kb 6.3
+/+
+/−
C3GnT activity (nmol/h mg)
1 kb
Ev = EcoR V
Ev Truncated Neo Exon 2
Ev D
−/−
Ileum Colon Ileum Colon Genotype:
3.8 E
S
+/+
+/+
−/−
−/−
C3GnT
kb 1.05
GAPDH
0.56
F
0.6
Lumen
C3GnT +/+ C3GnT−/−
0.4 0.2 0 Colon
Ileum
C3GnT +/+
C3GnT−/−
Figure 7.1 Generation of C3GnT –/– mice. (A) The scheme shows the two major O-glycan branching pathways. C3GnT refers to core 3 b1,3-N-acetylglucosamingtransferase. Arrowheads show the possible pathways for further branching, elongation, fucosylation, sialylation, and sulfation. (B, C) Strategy to generate mice lacking core 3-derived O-glycans by targeting the C3GnT gene, and Southern blot genotyping using EcoRV restriction enzyme digestion. (D) RT-PCR confirmed the deletion of the C3GnT gene product. GAPDH was used as an amplification control. (E) C3GnT enzymatic activity in C3GnT þ/þ and C3GnT –/– tissues (mean S.D., n ¼ 3). (F) LacZ staining of C3GnT þ/þ and C3GnT –/– colonic tissues. Bar: 100 mm. (Partly adapted from An et al., 2007. Originally published in J. Exp. Med. doi:10.1084/jem.20061929.)
126
Lijun Xia
We hypothesized that core 3-derived O-glycans are a key constituent of the intestinal mucus layer and are important for intestinal mucus barrier function, and that the alteration of core 3-derived O-glycan expression plays a role in the pathogenesis of common intestinal diseases, such as colitis. To test these hypotheses, we created mice lacking core 3-derived O-glycans by targeted deletion of the C3GnT gene (C3GnT –/–). We found that deletion of the C3GnT gene eliminated core 3-derived O-glycans and significantly reduced total intestinal glycans. Furthermore, C3GnT –/– mice exhibited an increased susceptibility to experimental colitis. The results presented here indicate that core 3-derived O-glycans are key components of intestinal mucin and that defects in their expression may be associated with the pathogenesis of colonic disease.
2. Generation of C3GnT –/– Mice 2.1. Methods 2.1.1. C3GnT gene targeting To study the biological function of C3GnT, we generated mice lacking the C3GnT gene (C3GnT –/–) by targeted homologous recombination in murine CJ7 embryonic stem cells (129/SvlmJ origin). In the gene-targeting construct, a neomycin selection marker was used to replace the major part of the coding exon 2 of C3GnT gene (Fig. 7.1B). Because there is no available antibody or other molecular probe to C3GnT or core 3 O-glycans, a lacZ reporter was genetically integrated immediately after the endogenous C3GnT promoter region to characterize the expression pattern of C3GnT (Fig. 7.1B). After G418 selection, the surviving clones were screened by polymerase chain reaction (PCR), and clones with correct homologous recombination were conformed by Southern blot hybridization. After confirming a normal karyotype, ES cells from one of the targeted clones were microinjected into C57BL/6J blastocysts, and the blastocysts were implanted into pseudopregnant mice. Three chimeras were produced among the offspring. The chimeras were tested for germline transmission by breeding with C57BL/6J mice. The agouti-colored offspring were characterized by both PCR and Southern blot analyses of tail genomic DNA (Fig. 7.1C). Heterozygous were interbred to generate homozygous C3GnT-deficient mice of mixed C56BL/6J and 129/SvlmJ background. 2.1.2. Reverse transcription (RT)-PCR analysis of C3GnT transcripts Total RNA from different tissues was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. For application the C3GnT gene, the forward primer was 50 -GGCCAGATTCTCCTCTCTCAAACG-30 , and the reverse primer was 50 -AGTGCTCCGCTGTCCAGTCCA-30 . PCR conditions were as follows: 94 C for 5 min, 25 cycles of 94 C for 20 s, 58 C for 45 s, 72 C for 1 min, and 10 min at 72 C.
Core 3 O-Glycans are Critical for Colon Mucus Barrier
127
2.1.3. Glycosyltransferase assays C3GnT activity from murine tissue extracts was measured to verify the C3GnT deletion and to examine whether C3GnT is the sole gene encoding C3GnT. Different tissues from C3GnTþ/þ and C3GnT –/– mice were homogenized in a 1.5-ml tube containing 200 ml tissue lysis buffer (1 mM PMSF, 5 mM benzamidine, and 5 mg/ml leupeptin), respectively. The homogenates were centrifuged at 20,000 g for 30 min at 4 C. The supernatants were collected, and the protein concentration in different samples was adjusted to a same level with the BCA assay (Pierce, Rockford, IL). C3Gn-T activity was measured using GalNAca1-O-phenyl (Sigma-Aldrich, St. Louis, MO) as an acceptor. UDP-[3H]GlcNAc (20–45 Ci/mmol) was obtained from PerkinElmer Life Sciences, Inc. (Boston, MA). In a total volume of 50 ml containing 0.1 M MES (pH 6.5), 20 mM MnCl2, 0.1% Triton X-100, 10 mM ATP, 2 mM GalNAc-a 1-O-phenyl, 1 mM UDP-[3H]GlcNAc, and 100 mg of protein from small intestine or colon extracts. The reactions were incubated at 37 C for 2 h and stopped by adding 950 ml H2O. The mixtures were loaded onto 500-mg SepPak C18 cartridges (Waters Corporation, Milford, MA), previously activated with 2 ml of ethanol and equilibrated with 10 ml of water. Following application of the diluted reaction mixture, the columns were washed with 15 ml of water, eluted with 2 ml of 1-butanol, and radioactivity determined by liquid scintillation counting in 10 ml of Scintiverse-BD. A unit of activity is defined as that amount of enzyme transferring 1 pmol of GlcNAc from UDP-GlcNAc to the acceptor GalNAca1-O-phenyl per hour at 37 C. Protein concentration was detected by Micro BCA Protein Assay kit (Pierce) according to the manufacturer’s protocol using bovine serum albumin as a standard. 2.1.4. LacZ staining Colon tissue was fixed in 2% paraformaldehyde and 0.2% glutaraldehyde in PBS for 30 min on ice. After fixation and cryoprotected in 15% sucrose in PBS for 1 h at 4 C, and in 30% sucrose in PBS overnight at 4 C. Then sections were embedment in OCT over dry ice. Blocks were cryosectioned at 5 mm, and dried for 1 h. Prior to staining, slides were refixed in cold PBS containing 0.2% glutaraldehyde for 10 min. Sections were washed three times in LacZ wash buffer (2 mM MgCl2, 0.01% sodium deoxycholate, 0.025 Nonidet-P40 in PBS). Staining was carried out in 0.5 mg/ml X-gal, 5 mM potassium ferrocyanide, and 5 mM potassium ferricyanide in LacZ wash buffer at 37 C overnight with protection light. When the staining was complete, slides were rinsed in PBS and counterstaining with nuclear fast red before dehydration through a graded ethanol series and mounting of coverslips. 2.1.5. PCR genotyping Genotypes of mice were initially verified by Southern blotting and then routinely determined by PCR of genomic DNA from tail biopsies (2–4 mm long). The tissues were incubated in 50 ml lysis buffer (50 mM
128
Lijun Xia
Tris–HCl, pH 7.5, 20 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.5% Tween 20, 0.5% NP-40, 200 mg/ml proteinase K) overnight at 55 C. The tissue lysates were boiled for 10 min and then centrifuged at 12,000 rpm for 5 min. Supernatants were used as crude DNA samples for PCR. Two microliters of supernatant was used for a 25-ml PCR. PCR primers include primers for C3GnT wild-type allele (primers 50 -agcctgagccaccctatccagtt-30 and 50 -caagagtcccacgacactggct-30 ), and primers for C3GnT/ allele (primers 50 -agcctgagccaccctatccagtt-30 and 50 tcttcctgaggccgatactgtcgtc-30 ). Following PCR condition was used: denaturing at 94 C for 30 s, annealing at 53 C for 30 s, and extension at 72 C for 30 s. 30 amplification cycles were used.
2.2. Results and discussion RT-PCR and enzymatic assays confirmed that C3GnT mRNA and C3GnT enzyme activity in tissue extracts were eliminated in C3GnT –/– mice (Fig. 7.1D and E). LacZ staining of different C3GnT –/– tissues confirmed that expression of C3GnT was restricted to colonic tissues (Fig. 7.1F, and data not shown). Although RT-PCR detected lower levels of endogenous C3GnT mRNA in the small intestine and salivary glands, lacZ staining was not detected in these tissues (data not shown), which likely reflected sensitivity differences between the two assays. C3GnT –/– mice developed normally, and both sexes were fertile in a specific pathogen-free barrier facility. Intercrosses between heterozygotes yielded normal-sized litters with Mendelian inheritance. C3GnT –/– mice had normal peripheral blood counts (data not shown). Gross morphology and histological examinations of 6–20-week-old mice revealed no observable differences between wild-type littermates (C3GnTþ/þ) and C3GnT –/– mice in major organs, including heart, liver, salivary glands, stomach, jejunum, ileum, colon, spleen, thymus, and lymph nodes (data not shown).
3. Disruption of the C3GnT Gene Eliminates Core 3-Derived O-Glycans and Exposes the Tn Antigen in Murine Colon 3.1. Methods 3.1.1. Intestinal glycan structure analysis The analysis was performed following our published protocol (Xia et al., 2005). Briefly, intestinal mucus, including the epithelial cell layer, was collected by gently scraping the luminal surface of intestines from C3GnTþ/þ and C3GnT –/– mice. Samples were dried and glycans were released by ammonia-based b-elimination. The glycans were labeled with
Core 3 O-Glycans are Critical for Colon Mucus Barrier
129
2-aminobenzamide (2-AB) and separated by a phase column (Zorbax NH2, 4.6 250 mm, Agilent Technologies, Palo Alto, CA) using HPLC equipped with a fluorescence detector (Ex 330 nm and Em 420 nm). O-Glycans labeled with 2-AB were collected from the HPLC and analyzed for structure composition using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS, Applied Biosystem, Framingham, MA) in a linear positive mode. All acquired spectra were smoothed by applying a 19-point Savitzky-Golay smoothing routine. The matrix used for the positive mode was 10 mg/ml 2,5-dihydroxybenzoic acid prepared in 50% acetonitrile and 0.1% trifluoroacetic acid. 3.1.2. Periodic acid-Schiff and Alcian blue staining Periodic acid-Schiff (PAS) reagent (Sigma-Aldrich) and Alcian blue at pH 2.5 (Newcomer Supply, WI, USA) were used to evaluate general carbohydrate moieties in C3GnTþ/þ and C3GnT –/– colonic tissues according to the manufactures’ instructions. 3.1.3. Anti-Tn immunohistochemical staining For Tn antigen staining, deparaffinized sections were incubated with or without 0.5 U/ml sialidase from Arthrobacter ureafaciens (Roche, Indianapolis, IN) at 37 C for 3 h. Sections were incubated for 30 min with biotinylated mAb against the Tn antigen (mouse IgG) or with isotypematched control mouse IgG (Xia et al., 2004). Bound antibodies were detected with horseradish peroxidase (HRP)-conjugated streptavidin (Vector Laboratories, Burlingame, CA).
3.2. Results and analysis Our study revealed that both core 1-derived O-glycans and core 3-derived O-glycans (core 3 O-glycans, fucosylated core 3 O-glycans and core 4 O-glycans) were dominant structures expressed in the C3GnTþ/þ colon (Fig. 7.2A) (Brockhausen and Kuhns, 1997; Iwai et al., 2002, 2005; Xia et al., 2004). Structural analysis revealed that C3GnT –/– colonic tissue did not express core 3-derived O-glycans (Fig. 7.2A). These results confirmed the deletion of the C3GnT gene, and provide definitive evidence that the C3GnT gene encodes the predominant C3GnT activity. C3GnT catalyzes the formation of core 3-derived O-glycans by adding GlcNAc to its substrate GalNAc-a-Ser/Thr (Tn antigen), which is normally modified with one or more other monosaccharides (Fig. 7.1A) (Iwai et al., 2002). We expected that the deletion of the C3GnT gene would expose Tn antigen in C3GnT –/– intestinal tissues. As predicted, immunochemical staining with anti-Tn mAb did not label C3GnTþ/þ intestinal tissue. By contrast, anti-Tn mAb labeled C3GnT –/– intestinal epithelial cells but not other cell types (Fig. 7.2B). Enzymatic desialylation of tissue
Figure 7.2 Disruption of the C3GnT gene eliminates core 3-derived O-glycans and exposes the Tn antigen in murine colons. (A) Annotated spectra of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analyses of 2-AB-labeled O-glycans of C3GnTþ/þ and C3GnT–/– colons in a linear positive mode. Each annotated molecular mass of O-glycan includes masses of a 2-AB and a Na. Asterisks represent positions of core 3-derived O-glycans that are missing in C3GnT–/– mice. Data are representatives of three experiments. (B) Immunohistochemical staining of mouse colon tissue sections with a mAb to the Tn antigen. The sections were pretreated with or without sialidase. Brown reaction products mark sites of antibody binding. Data are representatives of at least three experiments. Bar: 50 mm. (C) C3GnTþ/þ and C3GnT–/– colonic tissues stained with PAS (pink color) and Alcian blue (blue color). Bar: 100 mm. (D) Pixels of PAS and Alcina blue staining areas were quantified by Photoshop software based on six sections of three independent mice from each group (mean S.D.). (Partly adapted from An et al., 2007. Originally published in J. Exp. Med. doi:10.1084/jem.20061929.)
Core 3 O-Glycans are Critical for Colon Mucus Barrier
131
sections did not enhance binding of anti-Tn to C3GnT –/– tissues, suggesting that sialic acid does not appreciably modify the exposed Tn antigen to form the sialyl-Tn antigen (see Fig. 7.1A) in C3GnT –/– colonic tissue. However, enzymatic desialylation revealed the Tn antigen in C3GnTþ/þ colonic tissue, indicating that the sialyl-Tn antigen is normally expressed in wild-type mouse colon (Fig. 7.2B). We then used PAS and Alcian blue to determine if the deficiency of core 3-derived O-glycans affects the expression of intestinal glycans. PAS stains neutral carbohydrates, while Alcian blue recognizes acidic carbohydrates that may represent sialylated, fucosylated, or sulfated sugars. Both PAS staining and Alcian blue staining were significantly reduced in the colons of C3GnT –/– mice compared to those of C3GnTþ/þ mice (Fig. 7.2C and D). Consistent with the RT-PCR and lacZ staining data, this result demonstrates that core 3-derived O-glycans are predominantly expressed in mouse colon.
4. Deficiency of C3GnT Results in Reduced Muc2 Expression in Colon and Impaired Mucosal Integrity 4.1. Methods 4.1.1. Immunohistochemical staining for intestinal Muc2 To investigate if a deficiency of core 3 O-glycosylation affects the expression of intestinal mucins, we measured the expression of Muc2, which is the predominant component of the intestinal mucous layer, in C3GnT –/– colonic tissue. For detection of Muc2 deparaffinized sections were boiled for 20 min in 0.01 M citrate buffer at pH 6.0 for epitope retrieval. The sections were then blocked for 20 min using a protein blocking kit (DAKO Corporation, Corpinteria, CA) for nonspecific antibody binding. Endogenous avidin-binding proteins were blocked using avidin/biotin blocking reagents (Vector Laboratories). Sections were incubated overnight at 4 C with rabbit anti-Muc2 antibody (1:200 dilution, Santa Cruz Biotechnologies, Santa Cruz, CA), which is a glycosylation-independent polyclonal antibody, with goat anti-intestinal trefoil factor (ITF) antibody (1:200, Santa Cruz Biotechnologies), or with isotype-matched control IgG, respectively. ITF is a marker of intestinal goblet cells. The sections were subsequently incubated with biotinylated antirabbit, or antigoat IgG antibodies (Vector Laboratories) for 45 min followed by a 20-min incubation with 0.6% H2O2 in methanol to inhibit endogenous peroxidase activity. The sections were finally incubated with HRP-streptavidin (Vector Laboratories) for 30 min, and developed with a diaminobenzidine substrate and counterstained with hemotoxylin.
132
Lijun Xia
4.1.2. In vivo intestinal permeability To investigate if the loss of core 3-derived O-glycans affects mucosal integrity, we fed C3GnTþ/þ and C3GnT –/– mice with FITC-dextran by gavage, and 4 h later measured their serum levels of FITC-dextran to evaluate intestinal permeability. C3GnTþ/þ and C3GnT –/– mice were administered 200 ml of FITC-dextran (600 mg/kg body weight, 4 kDa, Sigma-Aldrich) by gavage. Blood was collected 4 h later by retro-orbital bleeding. The serum concentration of the FITC-dextran was determined using a fluorimeter (PerkinElmer Life Sciences, Wellesley, MA) with an excitation wavelength at 490 nm and an emission wavelength of 530 nm. Serial diluted FITC-dextran was used to generate a standard curve. After blood collection, mice were treated with FITC-dextran as described above, and cryosections of the small intestines and colons were prepared for fluorescence microscopy. 4.1.3. Examine bacterial translocation in colonic mucosa by real-time PCR We reasoned that the deficiency of core 3 O-glycans and the impairment in mucosal integrity might result in an alteration of mucosa-associated bacteria in C3GnT –/– mice. We used 16S bacterial ribosomal DNA (rDNA)-based real-time PCR analysis to address this question. Two sets of universal primers specific for the conserved regions of the bacterial 16S rDNA gene were used (Corless et al., 2000; Nadkarni et al., 2002; Ott et al., 2004). These included 16S1 (forward, 50 -CCATGAAGTCGGAATCGCTAG-30 ; reverse, 50 -ACTCCCATGGTGTGACGG-30 ) and 16S2 (forward, 50 -TCCTACGGGAGGCAGCAGT-30 ; reverse, 50 -GGACTACCAGGGTATCTAATCCTGTT-30 ). DNA extracted from colonic tissues and colonic fecal materials were used as a template. Colonic tissues were washed carefully before extraction of DNA to remove residual feces. For the quantification of fecal bacterial 16S rDNA, DNA from each mouse fecal sample was quantified, and 2.5 pg DNA was used as a template in each PCR reaction. For the quantification of 16S rDNA in colonic tissues, a pair of primers specific to the mouse P-selectin gene (forward, 50 -ATGATTAGCAAATTCTAGCTCCTGTTT-30 ; reverse, 500 -TAGGTCTCTTAGGATCTCCCTTCAAT-30 ) was used in a separate reaction as the endogenous control to normalize the DNA loading between samples. Real-time PCR was performed on an ABI Prism 7000 spectrofluorometric thermal cycler (Applied Biosystems, Foster City, CA) using SYBR-green as a double-strand DNA specific binding dye. The relative amount of 16S rDNA in each sample was estimated using the DDCT method according to manufacturer’s protocol. Each sample was assayed in duplicate.
Core 3 O-Glycans are Critical for Colon Mucus Barrier
133
4.2. Results and analysis Our experiments showed that C3GnT –/– colon had a significant reduction of Muc2 protein (Fig. 7.3A and B). We questioned whether the decreased expression of Muc2 was due to a reduced numbers of goblet cells. However, immunohistochemistry of C3GnTþ/þ and C3GnT –/– colon tissues revealed similar expression of ITF, a nonmucin protein and product of fully differentiated goblet cells (Fig. 7.3A and B). Thus, goblet cells are preserved in the C3GnT –/– colon, but goblet cell production of Muc2 is reduced. C3GnT –/– mice fed with FITC-dextran had a higher serum level of FITC-dextran than that of C3GnTþ/þ mice (Fig. 7.3C). Fluorescent microscopic analysis of the C3GnTþ/þ and C3GnT –/– intestinal cryosections revealed a higher level of fluorescent intensity in C3GnT –/– colonic tissues compared with that in C3GnTþ/þ tissues (Fig. 7.3D). Taken together, these data indicate that colonic mucosal integrity is impaired in C3GnT –/– mice. Two sets of universal 16S rDNA primers (16S1 and 16S2) reproducibly detected a significant increase in 16S rDNA in C3GnT –/– colonic tissues in comparison to that in C3GnTþ/þ colonic tissues (Fig. 7.3E). The increase is not likely caused by variations in luminal bacterial flora because the amount of 16S rDNA in C3GnTþ/þ and C3GnT –/– fecal material was similar (Fig. 7.3E). Mesenteric nodes had weak yet detectable 16S rDNA signal, but there was no difference between C3GnTþ/þ and C3GnT –/– groups (data not shown). Mesenteric bacterial translocation is associated with trafficking of bacteria-bearing dendritic cells from the mucosa, typically after Toll-like receptor sensing or other immune activation (Macpherson and Smith, 2006; Turnbull et al., 2005). Thus, no detectable increase in bacterial translocation in C3GnT –/– mesenteric nodes is consistent with the lack of spontaneous colonic inflammation in C3GnT –/– mice.
5. C3GnT –/– Mice are Highly Susceptible to Dextran Sodium Sulfate-Induced Colitis 5.1. Methods 5.1.1. Dextran sodium sulfate-induced colitis model Dextran sodium sulfate (DSS) is a chemical commonly used to induce experimental colitis (Stevceva et al., 2001). To determine the lethality of DSS, mice were fed with 2.5% DSS (40 kDa, MP Biomedicals Inc., Solon, OH) in drinking water for 14 days. To induce colitis, C3GnTþ/þ and C3GnT –/– males were treated with 2% DSS dissolved in drinking water for 7 days followed by 4 days of regular water. Mice were then sacrificed for histological analysis.
134
Lijun Xia
Muc2
B
ITF
C3GnT +/+
A
C3GnT –/–
Staining area (×103 pixels/crypt)
3
* 2
1
*
0
*P < 0.05
D
*
0.4
0.2
8
C3GnT−/−
C3GnT +/+
C3GnT +/+ C3GnT−/− E 10 16S rDNA (fold changes)
0
ITF
Ileum
0.6
Muc2
Colon
Serum FITC-dextran ( mg/ml)
C
C3GnT+/+ C3GnT−/− P < 0.05
* *
6
C3GnT +/+
4
C3GnT−/− P < 0.05
*
2 0 Primers:
Feces Colon 16S1
Feces
Colon 16S2
Figure 7.3 C3GnT–/– colon has reduced expression of Muc2 and impaired mucosal integrity. (A) Immuohistochemical staining of C3GnTþ/þ and C3GnT–/– colonic tissues with an antimurine Muc2 peptide antibody and with an antibody to ITF, a marker of fully differentiated goblet cells. Brown color indicates specific antibody binding. Bar: 100 mm. (B) Pixels of positive staining area per each crypt were quantified using Photoshop. Six sections of three independent mice from each group were quantified (mean S.D.). (C) Serum concentration of the FITC-dextran of
Core 3 O-Glycans are Critical for Colon Mucus Barrier
135
Body weight, the presence of occult or gross blood per rectum, stool consistency, and mortality were monitored daily during the courses of treatments. Briefly, no weight loss was registered as 0, weight loss of 1–5% from baseline was assigned 1 point, 6–10% 2 points, 11–20% 3 points, and more 20% 4 points. For stool consistency, 0 points were assigned for well-formed pellets, 2 points for pasty and semiformed stools that did not adhere to the anus, and 4 points for liquid stools that did adhere anus. For bleeding, 0 was assigned for no blood by using hemoccult (Beckman Coulter, Fullerton, CA), 2 points for positive hemoccult, and 4 points for gross bleeding. These scores were added together and divided by three, resulting in a disease activity index (DAI) from 0 (healthy) to 4 (maximal activity of colitis). Histology was performed on distal colon of C3GnT –/– and wild-type mice. The colon was removed, emptied of fecal material by gently washing the lumenal contents with PBS, fixed overnight in 10% formalin, dehydrated in graded ethanol solutions, embedded in paraffin, sectioned at 5 mm thickness, and stained with hematoxylin and eosin. Histological scoring was performed in a blinded fashion as a combined score of inflammatory cell infiltration (score 0–3) and tissue damage (score 0–3). The presence of occasional inflammatory cells in the lamina propria was scored as 0, increased numbers of inflammatory cells in the lamina propria was scored as 1, confluence of inflammatory cells extending into the submucosa was scored as 2, and transmural extension of the infiltrate was scored as 3. For tissue damage, no mucosal damage was scored as 0, lymphoepithelial lesions were scored as 1, surface mucosal erosion or focal ulceration was scored as 2, and extensive mucosal damage and extension into deeper structures of the bowel wall was scored as 3. The combined histological score ranged from 0 (no changes) to 6 (extensive cell infiltration and tissue damage) (Araki et al., 2005). 5.1.2. Immunohistochemistry To characterize intestinal inflammatory cell infiltrates, cryosections of colons from C3GnT –/–and C3GnTþ/þ mice were first incubated with a hamster polyclonal antibody to the lymphocyte marker, CD3 (1:50 dilution, BD Biosciences, San Diego, CA) or a rat mAb to the macrophage marker, F4/80
C3GnTþ/þ and C3GnT–/– mice were measured 4 h after oral administration of FITCdextran (mean S.D., n ¼ 6). (D) Representative images of fluorescent microscopic analysis of C3GnTþ/þ and C3GnT–/– intestinal cryosections 4 h after oral administration of FITC-dextran (three sections from each mouse, and four mice in each group). Bars: 50 mm. (E) Relative amount of 16S rDNA detected by real-time PCR using two independent sets of 16S universal primers. Data are expressed as an n-fold difference between C3GnTþ/þ and C3GnT–/– mice (mean S.D., n ¼ 6 mice in each group). The average 16S rDNA value of C3GnTþ/þ mice was expressed as 1. (Partly adapted from An et al., 2007. Originally published in J. Exp. Med. doi:10.1084/jem.20061929.)
136
Lijun Xia
(1:200 dilution, Accurate Chemical and Scientific Co., Westbury, NY) for 1 h at room temperature. The sections were then incubated for 30 min with biotin-conjugated antihamster or rat IgG, and subsequently incubated for 30 min with fluorescein isothiocyanate-conjugated avidin D or Texas Red avidin D (Vector Laboratories), respectively. The sections were mounted with Vectashield mouting medium (Vector Laboratories), and analyzed by a Nikon ECLIPSE E600 fluorescent microscope. 5.1.3. Intracellular cytokine staining Intracellular cytokine staining was performed to assess the level of cytokines produced by the lymphocytes from the spleens of DSS-treated C3GnTþ/þ and C3GnT –/– mice, as well as intestinal mucosal lymphocytes from C3GnTþ/þ and C3GnT –/– mice without DSS treatment. Briefly, splenocytes were isolated from DSS-treated C3GnTþ/þ and C3GnT –/– mice after lysis of erythrocytes with ACK lysis buffer (Cambrex Bio Science, Walkersville, MD). Intestinal intraepithelial lymphocytes (IEL) and lamina propria lymphocytes (LPL) were isolated from the large intestines of C3GnTþ/þ and C3GnT –/– males (129/SvlmJ background), as previously described with minor modifications (Van der Heijden and Stok, 1987). For intracellular cytokine staining, isolated lymphocytes were activated with Leukocytes Activation Cocktail containing BD GolgiPlug (BD Biosciences) at 5 105–1 106 cells/well in 96-well plates and cultured for 4–5 h in 5% CO2 at 37 C. Activated cells were harvested for surface and intracellular cytokine staining. Surface staining of the cells was performed by incubating with FITC-, and PerCP-conjugated monoclonal antibodies specific to CD3, CD4, and CD19 for 30 min on ice. After surface staining, the cells were fixed and permeabilized for 20 min at room temperature using BD Cytofix/Cytoperm buffer (BD Biosciences) and washed twice with the BD Perm/Wash buffer. Intracellular cytokine staining was then performed by incubating with the PE-conjugate antibodies against murine IL-2, IL-6, IL-10, IL-12, IL-17, TNF-a, and IFN-g on ice for 15 min. The cells were washed three times with BD Perm/Wash buffer and analyzed with a FACSCalibur flow cytometer (BD Biosciences).
5.2. Results and analysis We examined the pathological consequence of the deficiency of core 3 O-glycosylation using this model. We first challenged 6-week-old C3GnTþ/þ and C3GnT –/– males with 2.5% DSS in drinking water for 14 days to determine its lethality rate. We found that 9/10 C3GnTþ/þ mice survived the treatment, while all C3GnT –/– mice died at the end of the 14-day treatment (Fig. 7.4A). We then treated 6-week-old C3GnTþ/þ and C3GnT –/– males with 2% DSS in drinking water for 7 days, followed by 4 days of water without DSS. These experimental conditions induced
137
Core 3 O-Glycans are Critical for Colon Mucus Barrier
A
B 80
% Body weight change
Survival rate (%)
100 C3GnT +/+ C3GnT −/−
60 40 20 0 0
2
4
6
8
10 12 14
10 0 C3GnT +/+ C3GnT −/− * P < 0.05
−10 −20 −30
0
2
2.5% DSS (days)
Diarrhea score
4
*
C3GnT +/+ C3GnT −/− * P < 0.05
3
* * *
6
8
10
*
12
2% DSS (days)
* * * *
D * Fecal blood score
C
4
*
*
2 1
* *
C3GnT +/+ C3GnT −/− * P < 0.05
4 3
*
2 1 0
0 0
2
4
6
8
10
12
0
2
2% DSS (days) E 2% DSS: −
4
6
8
10
12
2% DSS (days) + F
C3GnT −/−
Histological score
C3GnT +/+
5
* P < 0.05
*
4 3 2 1 0 C3GnT +/+
C3GnT −/−
Figure 7.4 C3GnT mice have more severe DSS-induced colitis. (A) Survival rate of a cohort of 10 age-matched C3GnTþ/þ and C3GnT–/– males after a 14-day 2.5% DSS treatment. (B–D) Percent body weight changes compared with baseline, diarrhea score, and fecal blood score in 6-week-old C3GnTþ/þ and C3GnT–/– males after a 7-day, 2% DSS treatment. Each point represents the mean S.E.M. (n ¼ 10). (E) H&E-stained colonic tissues of C3GnTþ/þ and C3GnT–/– mice with or without 2% DSS treatment. Bar: 100 mm. (F) Histopathological scores of C3GnTþ/þ and C3GnT–/– mice 7 days after 2% DSS treatment based on degrees of inflammatory cell infiltration and epithelial injury. Error bars indicate mean S.E.M. (n ¼ 12). (Partly adapted from An et al., 2007. Originally published in J. Exp. Med. doi:10.1084/jem.20061929.) –/–
138
Lijun Xia
colitis in both C3GnTþ/þ and C3GnT –/– mice. However, the colitis in the C3GnT –/– mice was markedly more severe, with greater weight loss, diarrhea, fecal bleeding, and shortened colon length (Fig. 7.4B–D). The inflammation was restricted to the colon, especially in the distal colonic region, while the small intestine was not significantly affected. Histological examination showed that both C3GnTþ/þ and C3GnT –/– colonic tissues appeared normal before DSS treatment. However, after 2% DSS treatment, C3GnT –/– mice had more severe crypt destruction, larger areas of epithelial ulceration, erosions, and massive inflammatory cell infiltration into the mucosal tissue (Fig. 7.4E and F). To characterize the infiltrating inflammatory cells associated with DSSinduced colitis, we probed C3GnTþ/þ and C3GnT –/– colonic tissues with anti-CD3 antibody to identify T lymphocytes and anti-F4/80 antibody to identify monocytes/macrophages. Compared to C3GnTþ/þ mice, there was a dramatic increase of both T cells and monocytes/macrophages in the lamina propria of C3GnT –/– mice (Fig. 7.5A and B). To further understand the immunological features of DSS-induced colitis in C3GnT –/– mice, we evaluated intracellular production of the cytokines IL-2, IL-17, IFN-g, and TNF-a in splenocytes (Wei et al., 2005). Compared with DSS-treated C3GnTþ/þ mice, splenic CD4 T cells from DSS-treated C3GnT –/– mice exhibited modestly elevated levels of IL-2, IFN-g, and TNF-a, suggesting that effector activation of CD4þ-T cells associated with DSS-induced mucosal inflammation is greater in C3GnT –/– mice (Fig. 7.5C). C3GnT –/– mice are highly susceptible to DSS-induced colitis. We speculated that C3GnT –/– intestinal mucosal lymphocytes might be activated due to an impaired mucosal barrier function even in the absence of DSS challenge. We thus examined TNF-a, IFN-g, IL-17, and IL-6 expression in IELs and LPLs from colons of C3GnTþ/þ and C3GnT –/– mice without DSS treatment. Notably, the expression of the proinflammatory cytokines TNF-a, IFN-g, and IL-17 by CD3þ IELs and LPLs was significantly increased in C3GnT –/– mice as compared with C3GnTþ/þ mice (Fig. 7.5C). This suggests an inflammation-prone status in intestines of C3GnT –/– mice.
6. Conclusion and Future Direction In summary, we have discovered that C3GnT-deficient mice lack core 3-derived O-glycans, exhibit impaired Muc2 expression primarily in colonic tissues, and are highly susceptible to chemical-induced colitis. These data underscore an important in vivo role of core 3-derived O-glycans in intestinal function. The C3GnT –/– mice should be useful to dissect how
Anti-CD3
B
Anti-F4/80
24
C3GnT −/−
Positive staining area (× 102 pixels/field)
C3GnT +/+
A
CD3
IEL
D
C3GnT +/+
C3GnT −/−
7.4
13
17
24
4
3.5
10
2.1
1.7
3.6
11
0.9
1
28
2.4
4.8
IFN-g
C3GnT −/−
22
2
0.5
0.7
1.4
6.2
11
0.8
CD4
LPL
C3GnT +/+
IL-17
TNF-a
C3GnT −/−
IL-6
TNF-a IFN-g
F4/80
C3GnT +/+ C3GnT −/− * P < 0.05
C3GnT +/+
IL-17
8
0
C
IL-2
*
*
16
CD3
Figure 7.5 C3GnT colon has increased infiltration of T lymphocytes and monocytes/macrophages, and C3GnT–/– CD4 T cells have increased intracellular expression of IL-2, IFN-g, and TNF-a after 2% DSS treatment. (A) CD3-positive lymphocyte (green) or F4/80-positive monocyte/macrophage (red) infiltrates in C3GnTþ/þ and C3GnT–/– colon after 2% DSS treatment. Bar: 50 mm. (B) Positive staining areas were quantified as pixels per high-power microscopic field (20) using Photoshop based on six sections from three independent mice from each group. Error bars indicate mean S.D. (C) Flow cytometric analysis of intracellular cytokine expression in splenic CD4þ T cells isolated from either C3GnTþ/þ or C3GnT–/– mice after 2% DSS treatment. The plots were gated on CD3þ population. The number in each panel indicates the percentages of CD4þ T cells. This result is representative of data of three experiments (three C3GnTþ/þ and three C3GnT–/– mice in each experiment). (D) Flow cytometric analysis of intracellular cytokine expression in CD3þ intraepithelial lymphocytes (IEL) and lamina propria lymphocytes (LPL) isolated from the colon of C3GnTþ/þ or C3GnT–/– mice without DSS treatment. The number in each panel indicates the percentages of cytokine-expressing CD3þ cells. This result is representative of data of age-matched males in the 129/SvlmJ background (three C3GnTþ/þ and four C3GnT–/– mice). (Partly adapted from An et al., 2007. Originally published in J. Exp. Med. doi:10.1084/jem.20061929.) –/–
140
Lijun Xia
mucus layer integrity can be manipulated to promote or prevent chronic colitis. Since core 1-derived O-glycans are also a major component of intestinal mucus, generation of mice specifically lacking intestinal core 1-derived O-glycans and mice lacking both core 1- and core 3-derived O-glycans will be valuable to evaluate the overall contribution of O-glycans to intestinal function and to pathogenesis of common intestinal diseases.
ACKNOWLEDGMENTS I thank Guangyu An, Bo Wei, Baoyun Xia, J. Michael McDaniel,Tongzhong Ju, Richard D. Cummings, Jonathan Braun for their collaborations. This work was supported by National Institutes of Health grant RR018758 and by Senior Research Awards from the Crohn’s and Colitis Foundation of America.
REFERENCES Araki, A., Kanai, T., Ishikura, T., Makita, S., Uraushihara, K., Iiyama, R., Totsuka, T., Takeda, K., Akira, S., and Watanabe, M. (2005). MyD88-deficient mice develop severe intestinal inflammation in dextran sodium sulfate colitis. J. Gastroenterol. 40, 16–23. Brockhausen, I., and Kuhns, W. (1997). Glycoproteins and Human Disease. R. G. Landes Company, Austin, TX. Clayburgh, D. R., Barrett, T. A., Tang, Y., Meddings, J. B., Van Eldik, L. J., Watterson, D. M., Clarke, L. L., Mrsny, R. J., and Turner, J. R. (2005). Epithelial myosin light chain kinase-dependent barrier dysfunction mediates T cell activationinduced diarrhea in vivo. J. Clin. Invest. 115, 2702–2715. Corfield, A. P., Carroll, D., Myerscough, N., and Probert, C. S. (2001). Mucins in the gastrointestinal tract in health and disease. Front. Biosci. 6, D1321–D1357. Corless, C. E., Guiver, M., Borrow, R., Edwards-Jones, V., Kaczmarski, E. B., and Fox, A. J. (2000). Contamination and sensitivity issues with a real-time universal 16 S rRNA PCR. J. Clin. Microbiol. 38, 1747–1752. Elson, C. O., Sartor, R. B., Targan, S. R., and Sandborn, W. J. (2003). Challenges in IBD Research: Updating the scientific agendas. Inflamm. Bowel Dis. 9, 137–153. Iwai, T., Inaba, N., Naundorf, A., Zhang, Y., Gotoh, M., Iwasaki, H., Kudo, T., Togayachi, A., Ishizuka, Y., Nakanishi, H., et al. (2002). Molecular cloning and characterization of a novel UDP-GlcNAc:GalNAc-peptide beta1, 3-N-acetylglucosaminyltransferase (beta 3Gn-T6), an enzyme synthesizing the core 3 structure of O-glycans. J. Biol. Chem. 277, 12802–12809. Iwai, T., Kudo, T., Kawamoto, R., Kubota, T., Togayachi, A., Hiruma, T., Okada, T., Kawamoto, T., Morozumi, K., and Narimatsu, H. (2005). Core 3 synthase is downregulated in colon carcinoma and profoundly suppresses the metastatic potential of carcinoma cells. Proc. Natl. Acad. Sci. USA 102, 4572–4577. Kabashima, K., Saji, T., Murata, T., Nagamachi, M., Matsuoka, T., Segi, E., Tsuboi, K., Sugimoto, Y., Kobayashi, T., Miyachi, Y., et al. (2002). The prostaglandin receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. J. Clin. Invest. 109, 883–893. Macdonald, T. T., and Monteleone, G. (2005). Immunity, inflammation, and allergy in the gut. Science 307, 1920–1925.
Core 3 O-Glycans are Critical for Colon Mucus Barrier
141
Macfarlane, S., Woodmansey, E. J., and Macfarlane, G. T. (2005). Colonization of mucin by human intestinal bacteria and establishment of biofilm communities in a two-stage continuous culture system. Appl. Environ. Microbiol. 71, 7483–7492. Macpherson, A. J., and Smith, K. (2006). Mesenteric lymph nodes at the center of immune anatomy. J. Exp. Med. 203, 497–500. Morteau, O., Morham, S. G., Sellon, R., Dieleman, L. A., Langenbach, R., Smithies, O., and Sartor, R. B. (2000). Impaired mucosal defense to acute colonic injury in mice lacking cyclooxygenase-1 or cyclooxygenase-2. J. Clin. Invest. 105, 469–478. Nadkarni, M. A., Martin, F. E., Jacques, N. A., and Hunter, N. (2002). Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology (Reading, England) 148, 257–266. Ott, S. J., Musfeldt, M., Ullmann, U., Hampe, J., and Schreiber, S. (2004). Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora. J. Clin. Microbiol. 42, 2566–2572. Podolsky, D. K., and Isselbacher, K. J. (1984). Glycoprotein composition of colonic mucosa. Specific alterations in ulcerative colitis. Gastroenterology 87, 991–998. Ponda, P. P., and Mayer, L. (2005). Mucosal epithelium in health and disease. Curr. Mol. Med. 5, 549–556. Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S., and Medzhitov, R. (2004). Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118, 229–241. Resta-Lenert, S., Smitham, J., and Barrett, K. E. (2005). Epithelial dysfunction associated with the development of colitis in conventionally housed mdr1a–/– mice. Am. J. Physiol. Gastrointest. Liver Physiol. 289, G153–G162. Rhodes, J. M. (1996). Unifying hypothesis for inflammatory bowel disease and associated colon cancer: Sticking the pieces together with sugar. Lancet 347, 40–44. Rhodes, J. M. (1997). Colonic mucus and ulcerative colitis. Gut 40, 807–808. Stevceva, L., Pavli, P., Husband, A. J., and Doe, W. F. (2001). The inflammatory infiltrate in the acute stage of the dextran sulphate sodium induced colitis: B cell response differs depending on the percentage of DSS used to induce it. BMC Clin. Pathol. 1, 3. Turnbull, E. L., Yrlid, U., Jenkins, C. D., and Macpherson, G. G. (2005). Intestinal dendritic cell subsets: Differential effects of systemic TLR4 stimulation on migratory fate and activation in vivo. J. Immunol. 174, 1374–1384. Van der Heijden, P. J., and Stok, W. (1987). Improved procedure for the isolation of functionally active lymphoid cells from the murine intestine. J. Immunol. Methods 103, 161–167. Wei, B., Velazquez, P., Turovskaya, O., Spricher, K., Aranda, R., Kronenberg, M., Birnbaumer, L., and Braun, J. (2005). Mesenteric B cells centrally inhibit CD4þ T cell colitis through interaction with regulatory T cell subsets. Proc. Natl. Acad. Sci. USA 102, 2010–2015. Xia, B., Royall, J. A., Damera, G., Sachdev, G. P., and Cummings, R. D. (2005). Altered O-glycosylation and sulfation of airway mucins associated with cystic fibrosis. Glycobiology 15, 747–775. Xia, L., Ju, T., Westmuckett, A., An, G., Ivanciu, L., McDaniel, J. M., Lupu, F., Cummings, R. D., and McEver, R. P. (2004). Defective angiogenesis and fatal embryonic hemorrhage in mice lacking core 1-derived O-glycans. J. Cell Biol. 164, 451–459.
C H A P T E R
E I G H T
Core3 Glycan as Tumor Suppressor Seung Ho Lee and Minoru Fukuda Contents 144 145 146 146 146 147
1. Overview 2. Generating Core3 Glycan Expressing Cell Lines 3. Detection Methods of Core3 Expression 3.1. Semiquantitative RT-PCR 3.2. FACS analysis 4. Migration Assay Using Attractant 5. Determination of Major Integrin Using Functional Blocking Antibodies 6. Tumor Formation Assay 6.1. Orthotopic tumor cell injection 6.2. Subcutaneous injection 7. Western Blotting and Lectin Blotting 7.1. Western blotting for a2 and b1 detection 7.2. Lectin blotting 8. Heterodimerization Assay 9. FAK Signaling References
147 149 149 150 150 150 151 151 152 153
Abstract Recent studies demonstrated that mucin type O-glycans have important roles in tumorigenesis. Although several papers have been reported that increased core2 O-glycan is detected with several cancer progression (Dalziel, et al., 2001; Machida, et al., 2001), very little is known about the function of core3 O-glycan in tumorigenesis. Core3 O-glycan is synthesized by b1, 3-N-acetylglucosamintraseferase 6 (core3 synthase). To understand the function of core3 O-glycan in cancer, ectopic expression of core3 synthase to prostate cancer cells were used for tumor formation assay. Since core3 expressing prostate cancer cells show decreased tumor formation and metastasis to lymph node through attenuating the maturation and heterodimerization of integrin a2b1,
Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79008-X
#
2010 Elsevier Inc. All rights reserved.
143
144
Seung Ho Lee and Minoru Fukuda
those findings indicate that core3 structure acts as tumor suppressor through regulating the integrin functions. In this chapter, we discuss methods used to reveal the mechanisms how core3 glycan act as tumor suppressor.
1. Overview Mucin type O-glycans have been implicated to have important role in tumorigenesis. There are four different major mucin type O-glycans. Initially, both core1 and core3 structure are synthesized from Tn-antigen (GalNac-Ser/ Thr) by b3 galactose transferase and b3 N-acetylglucosamintransferase 6, respectively. Core4 structure is made by single enzyme, core2 N-acetylglucosamintranseferase 2 from core3 structure, but three different enzymes, core2 Nacetylglucosamintransferase 1, 2, and 3 exist in synthesizing core2 structure based on core1 structure. Each core structure is expressed differentially in conjunction with the differentiation and malignant transformation of various cells and tissues (Brockhausen, 1999; Piller et al., 1988; Yang et al., 1994; Yousefi et al., 1991). Analyzing the each function of cell surface glycans is critical for evaluating of physiological roles of carbohydrate in cell migration and invasion, which is important for cancer therapy. Core3 synthase which is a unique glycosyltransferase for core3 structure, GlcNacb1,3-GalNaca-Ser/Thr, was cloned through EST screening and reported to have restricted distribution, mainly to the stomach, colon, and small intestine (Iwai et al., 2002). Core3 structure was reported that it is very important cell surface glycan structure for gastric track disease such as colitis, and elimination of core3 structure on colon results in reduced expression of Muc2 protein with increased permeability of the intestinal barrier (An et al., 2007). Interestingly, core3 and core4 O-glycans are synthesized in normal cells but apparently downregulated in gastric and colorectal carcinoma (Vavasseur et al., 1994, 1995). Iwai et al. showed forced expression core3 synthase into human fibrosarcoma HT1080 FT-10 cell results in reduced tumor formation. To explain the molecular mechanisms how increased core3 structure modulate the tumorigenesis, Lee et al. (2009) analyzed the effect of core3 structure on a2b1 integrin, which is an important molecule in cell migration and signaling. Integrins are well-known heterodimeric molecules which have many roles in proliferation, growth, migration, and signaling (Assoian and Klein, 2008; Guo and Giancotti, 2004; Han et al., 2006; Vellon et al., 2005). 18 a and 8 b subunits are known to assemble into 24 integrins (Alam et al., 2007; Takagi, 2007) and it is well known that a specific glycan structure on integrin could differently affect the function of it. b1,6 GlucNAc branch on a5b1 integrin promote the cell migration toward fibronectin (Guo et al.,
145
Core3 Glycan Attenuate the Function of a2b1 Integrin
2002). However, increased bisecting GlcNAc structures on integrin a5b1 attenuate cell migration (Isaji et al., 2004), and decreased core-fucosylation on a3b1 integrin inhibited cell migration (Zhao et al., 2006). We described that increased core3 structure on a2b1 integrin, leads to decreased tumorigenic effect in vitro and in vivo through attenuating its maturation, heterodimerization, and phosphorylation of focal adhesion kinase (FAK; Fig. 8.1). In this chapter, we describe the methods used to reveal the molecular mechanisms how core3 glycan regulate the integrin function specifically on a2b1 integrin, which is a major integrin in prostate cancer cell lines.
2. Generating Core3 Glycan Expressing Cell Lines To determine the function of core3 structure on prostate cancer progression, we generated the core3 glycan expressing prostate cancer cell lines. PC3 and LNCaP cells were transfected with pcDNA 3.1(N) (Mitoma et al., 2003) harboring core3-synthase cDNA and pcDNA 3 harboring the neomycin resistance gene using Lipofectamine. Transfected cells were selected first in 200 mg/ml Geneticin (Invitrogen) and maintained in 100 mg/ml Geneticin. a2
a2
b1
FAK P
P
P
b1
FAK
P
Migration/ invasion
Migration/ invasion
Tumor formation/metastasis in prostate cancer
Figure 8.1 Core3 structure plays an important role in a2b1 mediated tumorigenesis. Increased core3 structure on a2b1 integrin lead to decreased heterodimerization and FAK phosphorylation results in reduced migration and invasiveness of prostate cancer tumorigenesis. (□, N-acetylgalactosamin; ■, N-acetylglucosamin; P, phorsporylation; a, a integrin; b, b integrin).
146
Seung Ho Lee and Minoru Fukuda
3. Detection Methods of Core3 Expression 3.1. Semiquantitative RT-PCR For detection core3 synthase in transcription level, semiquantitative RTPCR method was used. Total RNA was isolated from PC3 and LNCaP cells using TRIzol (Invitrogen) according to the manufacturer’s protocols. First strand cDNA is synthesized using a reverse transcriptase, SuperScript II (Invitrogen), and an oligo(dT) primer (Invitrogen) in the presence of RNase inhibitor (Promega). Single-stranded cDNAs are mixed with 10 pmol of 50 and 30 -primers and AmpliTag DNA polymerase (Applied Biosystems) in a 20-ml reaction. RT-PCR of core3 synthase (b3GnT-6) was undertaken with following PCR primers: 50 -agcactgcagcagtggttc-30 (50 -primer) and 50 -gaggaaggtgtccgcgaag-30 (30 -primer); and glyceraldehyde-3-phosphate dehydrogenase, 50 -cctggccaaggtcatccatgaca-30 (50 -primer), and 50 -atgaggtccaccaccctgttgct-30 (30 -primer). The PCR was carried out at 94 C for 5 min followed by 35 cycles of 94 C for 30 s, 56 C for 30 s, and 72 C for 30 s and by a single incubation at 72 C for 5 min. PCR products were separated by electrophoresis on 1% agarose gels. Expression levels were normalized by glyceraldehyde-3-phosphate dehydrogenase expression.
3.2. FACS analysis Since it was reported that decreased expression of core1 structure was detected in core3 transfectant (Iwai et al., 2005), measuring the amount of core1 structure could be an indirect way of confirming the expression of core3 structure. To check the expression of core3 structure, cell surface core1 structure was measured by using fluorescein isothiocyanate-conjugated peanut agglutinin (PNA) lectin, which recognize core1 structure, Galb12GalNAca-Ser/Thr (Lotan et al., 1975). For this assay, mock- and core3 expressing cells were pretreated with five units of neuraminidase (Sigma) in serum-free RPMI during overnight. After washing two times with serumfree RPMI, cells were harvested using enzyme-free dissociation solution (Hanks’ balanced saline solution-based) purchased from Cell and Molecular Technologies. Dissociated cells were incubated with fluorescein isothiocyanate-conjugated PNA lectin (1:200, EY Laboratories) for 2 h on ice and washed two times with ice-cold PBS. PNA recognized cell were separated as single cell by cell strainer (40 mm pore, BD Biosciences) and subjected to fluorescence-activated cell sorting analysis using FACScan flow cytometry (BD Biosciences) as described previously (Mitoma et al., 2003).
Core3 Glycan Attenuate the Function of a2b1 Integrin
147
4. Migration Assay Using Attractant Cell migration is important step in cancer progression. Integrins are well-known molecules that directly bind components of the extracellular matrix (ECM; Desgrosellier and Cheresh, 2010). To evaluate the effect of core3 structure on cell migration, several matrix proteins were used as attractant in migration assay. Materials and methods 1. Matrix proteins and chamber: Human laminin mixture (Chemicon), rat laminin-5 (Chemicon), collagen I, or fibronectin (Sigma), and 3 mmpore size Transwell Permeable Supports (Corning) were used for migration assay. 2. Membrane coating with matrix proteins: Membrane were dipped into matrix solution (0.5 mg/ml matrix protein dissolved in serum-free RPMI) and incubated overnight at 4 C. Membranes are air dried in clean hood (15 min) before loading the cells. 3. Cells were washed with PBS three times and then harvested with enzyme-free EDTA solution. After centrifuging the cell, 5 104 cells (100 ml of serum-free RPMI) were added to the upper chamber. After 6 h later at 37 C in a CO2 incubator, nonmigrated cells in the upper chamber were removed by cotton tips. Cells reaching the bottom layer were stained with 0.5% crystal violet (1 h) and washed three times with water. The number of migrated cells was counted under a microscope.
5. Determination of Major Integrin Using Functional Blocking Antibodies Core3 expressing PC3 and LNCaP cells showed decreased invasiveness. To determine the major integrin for core3 structure in prostate cancer cell, several functional blocking antibodies against integrins were used in invasion assay. Figure 8.2 showed that invaded cell number is significantly reduced when a2 and b1 inhibitory antibodies were used. With this data, a2b1 integrin is determined as a major target for core3 glycan in PC3 cell. 2.8 105 cells for PC3 and 5 105 cells for LNCaP were used in the invasion assay. After washing with serum-free RPMI two times, cells were harvested using enzyme-free EDTA solution. Cells were concentrated by centrifuging (2000 rpm 3 min), and then washed two times with serum-free
148
A
Seung Ho Lee and Minoru Fukuda
Mock
Core3
B
IgG
* *
a1
a2
a6
* Cell numbers per field
b1
450 400 350 300 250 200 150 100 50 0
IgG
b1
a1 a2 Blocking Ab Mock
a6
Core 3
Figure 8.2 Core3 synthase inhibits prostate cancer cell invasion. (A) Mock-transfected and core3-expressing PC3 cells were seeded in the upper part of the transmembrane. Either control mouse IgG (10 mg/ml) or each functional blocking antibodies were added with cell. Invasive activity of mock and core3 transfectants was inhibited by a2 and b1 integrin functional blocking antibody significantly. (B) Results obtained by calculating four different fields are shown and repeated two times. Error bars represent S.D. of the mean. *p < 0.01; scale bar: 0.2 mm. Reproduced from Lee et al. (2009), with permission.
RPMI and then, loaded in upper chamber of ECM Invasion Chamber (Chemicon) and incubated at 37 C in CO2 incubator for 24 h (100 ml serum-free RPMI). Cells reaching the bottom layer were visualized by 0.5% crystal violet and counted. To determine the contribution of different integrins to invasion, several functional inhibitory antibodies were used. Cells were preincubated with antibodies (10 mg/ml) for 10 min at room temperature and then loaded on the upper chamber. Antibodies used in this experiment are below. In the control well, cells were incubated with control mouse IgG (10 mg/ml). a1 integrin: mouse anti-human integrin a1 I domain monoclonal antibody (Chemicon). a2 integrin: mouse anti-human a2 integrin monoclonal antibody (Chemicon). a6 integrin: rat anti-human monoclonal antibody GoH3 (BD Pharmingen). b1 integrin: mouse monoclonal 4B4 anti-b1 integrin neutralizing antibody (Beckman Coulter).
149
Core3 Glycan Attenuate the Function of a2b1 Integrin
6. Tumor Formation Assay To determine the effect of core3 structure in tumor formation and metastasis, we injected both control and core3 expressing cell into nude mice by two different methods. Orthotopic injection to mouse prostate was used for detecting the differences of tumor formation and metastasis in PC3 cells (Fig. 8.3), and subcutaneous injection is tested for LNCaP cells.
6.1. Orthotopic tumor cell injection Material and method 1. Mice: BALBc nude (nude/nude) mice (6–8-week-old males) obtained from Taconic were used. 2. Scissors (FineScience), Autoclip 9 mm (Clay Adams #7631 Becton Dickinson), 50 ml syringe (Hamilton #80530), 30-gauge custom needle 200
Mock
100 50 0
Core3
Mock
Weight of lymph node (mg)
Lymph node
70 60 50 40 30 20 10 0
Core3
Core3
*
150
Normal
Weight of prostate (mg)
Normal
Mock
Prostate
*
Core3
Mock
Figure 8.3 Core3 synthase suppresses tumor formation and metastasis. PC3-core3 and mock-transfected PC3 cells were orthotopically inoculated into the prostate of nude mice. Reduced size of tumor produced by inoculation of core3 expressing PC3 cells. Four representative prostate and lymph nodes with tumors are shown (left panel). Wet weight of eight prostate and lymph nodes is shown (right panel). PC3 cells expressing core3 O-glycans formed almost no prostate tumors and no metastasis to the draining lymph node. Error bars represent S.D. of the mean. *p < .05 compared with mocktransfectants using Mann–Whitney U test. Bar, 0.5 cm. Reproduced from Lee et al. (2009), with permission.
150
Seung Ho Lee and Minoru Fukuda
(Hamilton #7803-07), and 1,25% avertin, 3–5 ml syringe for IP injection of avertin were used for laparotomy. 3. Mice were anesthetized with avertin (1.25%, 500 ml/mouse), and laparotomy was performed (detailed method is described in Chapter 22). Cells were harvested using enzyme-free EDTA solution and washed three times with serum-free RPMI. 2 106 PC3-core3 and mocktransfected PC3 cells were suspended in 20 ml of serum-free RPMI 1640 medium and inoculated into the posterior lobe of the prostate by using the 50-ml syringe and 30-guage custom needle. The wound was then closed with 9 mm autoclips. Eight weeks later, mice were sacrificed, prostates and surrounding lymph nodes were removed, and organs were weighted. Specimens were preserved by fixation in neutral buffered formalin. Core3 expressing PC3 cell showed decreased tumor formation and metastasis into lymph node (Fig. 8.3).
6.2. Subcutaneous injection Nude mice (BALBc nude 8-week-old males) obtained from Taconic were used. After anesthetizing the mice with avertin (1.25%, 500 ml/mouse), 5 107 number of mock-transfected and core3-expressing LNCaP cells were subcutaneously injected with Matrigel (50:50, v/v), and the weight of tumors was measured after 3 months. Core3 expressing LNCaP cells showed decreased tumor formation.
7. Western Blotting and Lectin Blotting Glycosylation is one of the important factors which regulate the expression and maturation of integrin (Guo et al., 2005; isaji et al., 2006). Interestingly, core3 expressing cell showed reduced levels of mature form of b1 integrin without changing the a2 integrin. To detect the core3 structure on integrin a2b1, we used Griffonia simplifolia lectin II (GS-II) lectin (EY Laboratories), which can recognize terminal N-acetylglucosamine structure (Lyer et al., 1976). Interestingly, GS-II signal is increased in a2b1 and b1 only in core3 expressing PC3 and LNCaP respectively. Those results suggested that increased core3 structure could affect maturation of a2b1 integrin in prostate cancer cells.
7.1. Western blotting for a2 and b1 detection Cells were washed two times with PBS, and harvested with the lysis buffer composed of 20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1% (w/v) Nonidet P-40, 5 mM sodium pyrophosphate, 10 mM NaF, 1 mM
Core3 Glycan Attenuate the Function of a2b1 Integrin
151
sodium orthovanadate, 10 mM b-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride, and a protease inhibitor mixture (Sigma). After incubation on ice during 1 h, cell lyastes were centrifuged 15,000 rpm for 10 min, supernatants were separated. Twenty-five micrograms of total cell lysate was loaded 8% SDS page gel and then transferred to PVDF membrane (Millipore). Polyclonal anti-b1 integrin antibody (Ab1952, Chemicon) and rabbit anti-a2 integrin antibody (Ab1936, Chemicon; 1:2000) were incubated in 5% skim milk in Tris-buffered saline (pH 7.6) containing 0.1% Tween20 (TBS-T) solution at 4 C overnight. After washing three times with TBST, membranes were incubated with second antibody (peroxidase conjugated goat anti-rabbit, 1:3000) for 40 min at room temperature. ECL kit (Amersham Biosciences) was used for visualizing the positive signals.
7.2. Lectin blotting Immunoprecipitates of b1 and a2 were eluted using 1 SDS loading buffer. After blocking with 5% BSA–TBS-T buffer at room temperature for 1 h, biotynlated GS-II lectin was added into blocking buffer (1:3000). After overnight incubation at 4 C, membrane was washed out three times with TBS-T and then incubated with avidin–steptavidin solution (vectarstain) at room temperature for 1 h. GS-II signal was visualized with ECL kit.
8. Heterodimerization Assay Integrin is a heterodimeric protein, and abnormal association between two subunits could affect the activation of integrin such as its signaling. Since a2b1 integrin was determined as a major target for core3 structure through invasion assay, heterodimerization efficiency of a2b1 integrin were measured. Core3 expressing PC3 cells showed decreased heterodimerization rate (Fig. 8.4). For those experiments, 1 mg total lysate was used for immunoprecipitation. It was incubated with 4 ml antibody and 20 ml of protein A bead at 4 C during overnight. Immunoprecipitants were washed with lysis buffer and twice more with ice-cold PBS, and then eluted by boiling with 1 SDS loading buffer during 10 min. Samples were analyzed in 6% SDS-PAGE and transferred into PVDF membrane. After incubation, 5% skim milk solution in TBS-T during 1 h at room temperature, first antibody (1:1000) was reacted at 4 C during overnight. After washing three times with PBS-T, second antibody (1:3000 dilution) was incubated in 5% skim milk PBS-T during 30 min. Positive signal was visualized using ECL kit. The same membrane was used for detection of counterpart integrin. After reproving by 1 N NaOH solution during 1–2 min at room temperature
152
Seung Ho Lee and Minoru Fukuda
b1
a2
IP:
b1
a2
a2
b1 Mock
Core3
Mock 5
Heterodimerization rate (a2/b1)
Heterodimerization rate (b1/a2)
1 0.8 0.6 0.4 0.2 0
Core3
Mock
Core3
4 3 2 1 0
Mock
Core3
Figure 8.4 Association of a2b1 integrin is impaired in core3 synthase expressing cells. a2 integrin was immunoprecipitated (IP) with rabbit anti-a2 integrin antibody, and the blot was incubated with mouse monoclonal anti-b1 integrin antibody. After reproving this membrane with using 1N NaOH, a2 integrin was detected by anti-a2 integrin antibody. In parallel, b1 integrin was first immunoprecipitated by polyclonal anti-b1 integrin antibody, and the immunoprecipitates were sequentially incubated with anti-a2 antibody and anti-b1 antibody. The experiments were repeated three times, and a representative result is shown. Heterodimerization rate (a2/b1 or b1/a2) was estimated by scanning the gel and is tabulated in the lower panel. Reproduced from Lee et al. (2009), with permission.
and then washed three times with PBS-T. This membrane incubated with blocking buffer (5% skim milk in TBS-T) again and then reacted with antibody of counterpart integrin. Heterodimerization ratio was calculated as coprecipitated amount of integrin a or b/immunoprecipitated amount of integrin b or a. Intensity of the band was calculated using Image J program.
9. FAK Signaling To determine whether increased core3 structure could affect integrinmediated intracellular signaling, we checked phophorylation of FAK. Decreased activation of FAK signaling was showed in core3 expressing PC3 cells. For this experiment, cells were harvested with typsin–EDTA solution and inactivated with trypsin neutralizing solution (Clontics). Cells were
Core3 Glycan Attenuate the Function of a2b1 Integrin
153
washed two times with 0.1% BSA-RPMI 1640 media and 5 105 cell/ well were seed on collagen-coated 6-well plate. After incubating at 37 C, cells were harvested according to indicated time. Twenty micrograms of cell lysates were loaded into SDS-PAGE and transferred to PVDF membrane. This membrane was used for detection of phosphorylated FAK using rabbit anti-FAK (Tyr(P)397) phosphospecific antibody (1:1000; Biosource). The membrane was reproved using 1 N NaOH solution, used for detection total FAK detection again using anti-mouse FAK antibody (1:1000; BD Biosciences). Activated FAK ratio is calculated as phospho-FAK divided by total FAK (pFAK/tFAK).
REFERENCES Alam, N., Goel, H. L., Zarif, M. J., Butterfield, J. E., Perkins, H. M., Sansoucy, B. G., Sawyer, T. K., and Languino, L. R. (2007). The integrin-growth factor receptor duet. J. Cell. Physiol. 213, 649–653. An, G., Wei, B., Xia, B., McDaniel, J. M., Ju, T., Cummings, R. D., Braun, J., and Xia, L. (2007). Increased susceptibility to colitis and colorectal tumors in mice lacking core 3-derived O-glycans. J. Exp. Med. 204, 1417–1429. Assoian, R. K., and Klein, E. A. (2008). Growth control by intracellular tension and extracellular stiffness. Trends Cell Biol. 18, 347–352. Brockhausen, I. (1999). Pathways of O-glycan biosynthesis in cancer cells. Biochim. Biophys. Acta 1473, 67–95. Dalziel, M., Whitehouse, C., McFarlane, I., Brockhausen, I., Gschmeissner, S., Schwientek, T., Clausen, H., Burchell, J. M., and Taylor-Papadimitriou, J. (2001). The relative activities of the C2GnT1 and ST3Gal-I glycosyltransferases determine O-glycan structure and expression of a tumor-associated epitope on MUC1. J. Biol. Chem. 276, 11007–11015. Desgrosellier, J. S., and Cheresh, D. A. (2010). Integrins in cancer: Biological implications and therapeutic opportunities. Nat. Rev. Cancer 10, 9–22. Guo, W., and Giancotti, F. G. (2004). Integrin signalling during tumour progression. Nat. Rev. Mol. Cell Biol. 5, 816–826. Guo, H. B., Lee, I., Kamar, M., Akiyama, S. K., and Pierce, M. (2002). Aberrant N-glycosylation of beta1 integrin causes reduced alpha5beta1 integrin clustering and stimulates cell migration. Cancer Res. 62, 6837–6845. Guo, H. B., Lee, I., Bryan, B. T., and Pierce, M. (2005). Deletion of mouse embryo fibroblast N-acetylglucosaminyltransferase V stimulates alpha5beta1 integrin expression mediated by the protein kinase C signaling pathway. J. Biol. Chem. 280, 8332–8342. Han, S., Khuri, F. R., and Roman, J. (2006). Fibronectin stimulates non-small cell lung carcinoma cell growth through activation of Akt/mammalian target of rapamycin/S6 kinase and inactivation of LKB1/AMP activated protein kinase signal pathways. Cancer Res. 66, 315–323. Isaji, T., Gu, J., Nishiuchi, R., Zhao, Y., Takahashi, M., Miyoshi, E., Honke, K., Sekiguchi, K., and Taniguchi, N. (2004). Introduction of bisecting GlcNAc into integrin alpha5beta1 reduces ligand binding and down-regulates cell adhesion and cell migration. J. Biol. Chem. 279, 19747–19754. Isaji, T., Sato, Y., Zhao, Y., Miyoshi, E., Wada, Y., Taniguchi, N., and Gu, J. (2006). N-glycosylation of the beta-propeller domain of the integrin alpha5 subunit is essential
154
Seung Ho Lee and Minoru Fukuda
for alpha5beta1 heterodimerization, expression on the cell surface, and its biological function. J. Biol. Chem. 281, 33258–33267. Iwai, T., Inaba, N., Naundorf, A., Zhang, Y., Gotoh, M., Iwasaki, H., Kudo, T., Togayachi, A., Ishizuka, Y., Nakanishi, H., and Narimatsu, H. (2002). Molecular cloning and characterization of a novel UDP-GlcNAc:GalNAc-peptide beta1, 3-Nacetylglucosaminyltransferase, an enzyme synthesizing the core 3 structure of O-glycans. J. Biol. Chem. 277, 12802–12809. Iwai, T., Kudo, T., Kawamoto, R., Kubota, T., Togayachi, A., Hiruma, T., Okada, T., Kawamoto, T., Morozumi, K., and Narimatsu, H. (2005). Core 3 synthase is downregulated in colon carcinoma and profoundly suppresses the metastatic potential of carcinoma cells. Proc. Natl. Acad. Sci. USA 102, 4572–4577. Lee, S. H., Hatakeyama, S., Yu, S. Y., Bao, X., Ohyama, C., Khoo, K. H., Fukuda, M. N., and Fukuda, M. (2009). Core3 O-glycan synthase suppresses tumor formation and metastasis of prostate carcinoma PC3 and LNCaP cells through down-regulation of alpha2beta1 integrin complex. J. Biol. Chem. 284, 17157–17169. Lotan, R., Skutelsky, E., Danon, D., and Sharon, N. (1975). The purification, composition, and specificity of the anti-T lectin from peanut (Arachis hypogaea). J. Biol. Chem. 250, 8518–8523. Lyer, P. N., Wilkinson, K. D., and Goldstein, L. J. (1976). An -N-acetyl-D-glycosamine binding lectin from Bandeiraea simplicifolia seeds. Arch. Biochem. Biophys. 177, 330–333. Machida, E., Nakayama, J., Amano, J., and Fukuda, M. (2001). Clinicopathological significance of core 2 beta1, 6-N-acetylglucosaminyltransferase messenger RNA expressed in the pulmonary adenocarcinoma determined by in situ hybridization. Cancer Res. 61, 2226–2231. Mitoma, J., Petryniak, B., Hiraoka, N., Yeh, J. C., Lowe, J. B., and Fukuda, M. (2003). Extended core 1 and core 2 branched O-glycans differentially modulate sialyl Lewis X-type L-selectin ligand activity. J. Biol. Chem. 278, 9953–9961. Piller, F., Piller, V., Fox, R. I., and Fukuda, M. (1988). Human T-lymphocyte activation is associated with changes in O-glycan biosynthesis. J. Biol. Chem. 263, 15146–15150. Takagi, J. (2007). Structural basis for ligand recognition by integrins. Curr. Opin. Cell Biol. 19, 557–564. Vavasseur, F., Dole, K., Yang, J., Matta, K. L., Myerscough, N., Corfield, A., Paraskeva, C., and Brockhausen, I. (1994). O-glycan biosynthesis in human colorectal adenoma cells during progression to cancer. Eur. J. Biochem. 222, 415–424. Vavasseur, F., Yang, J. M., Dole, K., Paulsen, H., and Brockhausen, I. (1995). Synthesis of O-glycan core 3: Characterization of UDP-GlcNAc: GalNAc-R beta 3-N-acetyl-glucosaminyltransferase activity from colonic mucosal tissues and lack of the activity in human cancer cell lines. Glycobiology 5, 351–357. Vellon, L., Menendez, J. A., and Lupu, R. (2005). aVb3 integrin regulates heregulin (HRG)-induced cell proliferation and survival in breast cancer. Oncogene 24, 3759–3773. Yang, J. M., Byrd, J. C., Siddiki, B. B., Chung, Y. S., Okuno, M., Sowa, M., Kim, Y. S., Matta, K. L., and Brockhausen, I. (1994). Alterations of O-glycan biosynthesis in human colon cancer tissues. Glycobiology 4, 873–884. Yousefi, S., Higgins, E., Daoling, Z., Pollex-Kruger, A., Hindsgaul, O., and Dennis, J. W. (1991). Increased UDP-GlcNAc:Gal beta 1-3GaLNAc-R (GlcNAc to GaLNAc) beta-1, 6-N-acetylglucosaminyltransferase activity in metastatic murine tumor cell lines. Control of polylactosamine synthesis. J. Biol. Chem. 266, 1772–1782. Zhao, Y., Itoh, S., Wang, X., Isaji, T., Miyoshi, E., Kariya, Y., Miyazaki, K., Kawasaki, N., Taniguchi, N., and Gu, J. (2006). Deletion of core fucosylation on alpha3beta1 integrin down-regulates its functions. J. Biol. Chem. 281, 38343–38350.
C H A P T E R
N I N E
Characterization of Mice with Targeted Deletion of the Gene Encoding Core 2 b1,6-NAcetylglucosaminyltransferase-2 Erica L. Stone,* Seung Ho Lee,† Mohd Nazri Ismail,‡ and Minoru Fukuda† Contents 1. Introduction 2. Generation and Genotyping of C2GnT2 KO Mice 2.1. Generation of C2GnT2 KO mice 2.2. PCR genotyping of Gcnt3f/f and Gcnt3D/D mice 3. Mice Lacking C2GnT2 Have Reduced Core 2 and no Core 4 Enzyme Activity and Altered Glycosylation 3.1. Core 2 and Core 4 enzyme assays 3.2. Mass spectrometry 4. Phenotyping C2GnT2 KO Mice 4.1. Mice lacking C2GnT2 are viable 4.2. C2GnT2 KO mice have reduced mucosal barrier function 4.3. C2GnT2 KO mice have reduced levels of circulating Ig in naı¨ve mice 4.4. C2GnT2 KO mice developed exaggerated pathogenesis in the DSS-induced colitis model 4.5. C2GnT2 KO mice do not have altered levels of Muc2 5. Conclusions and Future Directions Acknowledgments References
156 157 157 157 159 159 160 161 161 161 162 165 166 168 170 170
* School of Medicine, Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, USA Glycobiology Unit, Tumor Microenvironment Program, Cancer Center, Sanford-Burnham Institute for Medical Research, La Jolla, California, USA { Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79009-1
#
2010 Elsevier Inc. All rights reserved.
155
156
Erica L. Stone et al.
Abstract The three glycosyltransferases of the Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT) family, C2GnT1, C2GnT2, and C2GnT3, are able to initiate the Core 2 branch of O-glycans. However, C2GnT2, which is highly expressed in the digestive tract, has a broader acceptor substrate specificity that allows it to also generate Core 4 O-glycans and I branches. We discovered that C2GnT2 KO mice have decreased mucosal barrier function in the digestive tract, reduced levels of circulating IgGs and fecal IgA, and increased susceptibility to experimental colitis. Mass spectrometric analyses also revealed that C2GnT2 KO mice had a reduction in Core 2 O-glycans in the digestive tract with a corresponding increase in elongated Core 1 O-glycans. Unexpectedly, we saw that the loss of C2GnT2 and especially the loss of all three C2GnTs resulted in the expression of elongated O-mannose structures in the stomach, suggesting that the elongation of these structures is controlled by competition for UDP-GlcNAc [Stone, E. L., Ismail, M. N., Lee, S. H., Luu, Y., Ramirez, K., Haslam, S. M., Ho, S. B., Dell, A., Fukuda, M. and Marth, J. D. (2009). Glycosyltransferase function in Core 2-type protein O-glycosylation. Mol. Cell. Biol. 29, 3370–3782].
1. Introduction Core 2 b1,6-N-acetylglucosaminyltransferase-2 (C2GnT2), which is highly expressed in the digestive tract, is one of three glycosyltransferases able to initiate the Core 2 branch of O-glycans (Bierhuizen and Fukuda, 1992; Schwientek et al., 1999; Schwientek et al., 2000; Stone et al., 2009; Yeh et al., 1999). As C2GnT2 has a broader acceptor substrate specificity than C2GnT1 or C2GnT3, it is also able to initiate the Core 4 branch of O-glycans and, like I b1,6-N-acetylglucosaminyltransferase (IGnT), is able to generate branched polylactosamine repeats (I-branches) from linear polylactosamine repeats (i-branches) (Bierhuizen et al., 1993; Yeh et al., 1999). Specifically, in vitro C2GnT2 has been shown to preferentially transfer GlcNAc to the predistal galactose, rather than the central or internal galactose of polylactosamine repeats, and thus is said to have dIbranching activity, while IGnT has greater cI-branching activity (Bierhuizen et al., 1993; Yeh et al., 1999). Regardless of acceptor substrate, C2GnT2 always transfers a GlcNAc from the donor substrate UDP-GlcNAc in a b1,6-linkage. Core 2 O-glycans are highly abundant (Schachter and Brockhausen, 1989) and generation of Core 2 O-glycans likely requires a large energy investment by cells. It thus can be hypothesized that Core 2 O-glycans are physiologically important. C2GnT1 KO mice have been shown to have reduced expression of selectin ligands leading to neutrophilia, diminished recruitment of neutrophils to some sites of inflammation, reduced numbers of B-cells in peripheral lymph nodes, and decreased ability of thymic progenitors to home to the thymus (Ellies et al., 1998; Gauguet et al., 2004; Hiraoka et al., 2004; Rossi et al., 2005; Sperandio et al., 2001).
Characterization of Mice Lacking C2GnT2
157
While functions for C2GnT1 and the glycans it generates have been well described (Hagisawa et al., 2005; Koya et al.,1999; Shimodaira et al., 1997; Tarp and Clausen, 2008; Tsuboi and Fukuda, 1998; Tsuboi and Fukuda, 2001), the roles of C2GnT2 remained unknown. Because Core 2 O-glycans are highly expressed in the digestive tract and because of the high frequency in which mucins are decorated with O-glycans (Brockhausen, 2004), Core 2 O-glycans have been hypothesized to be required for proper mucin function (Ellies et al., 1998). Additionally, C3GnT has been shown to be required mucosal Muc2 levels, and consequentially mucosal barrier function and to prevent increased pathology following induction of colitis with dextran sodium sulfate (DSS) (An et al., 2007). As C2GnT2 is highly expressed in the digestive tract, it was the most likely of the three C2GnTs to be required for proper homeostasis of the digestive tract (Stone et al., 2009; Yeh et al., 1999). To better understand the functions of C2GnT2 derived O-glycans, especially in the digestive tract where a high amount of energy is invested in generating not only a large number of O-glycans but also specifically C2GnT2-derived O-glycans, we generated mice with a targeted deletion of the gene encoding C2GnT2 (Stone et al., 2009). We further describe here the methods used to analyze the phenotypes resulting from loss of C2GnT2.
2. Generation and Genotyping of C2GnT2 KO Mice 2.1. Generation of C2GnT2 KO mice To begin to study the biology of C2GnT2 and the glycans it generates, the single coding exon of Gcnt3 was targeted by homologous recombination with a pflox targeting vector in mouse R1 embryonic stem cells. Embryonic stem cells encoding a floxed allele of Gcnt3 were injected into C57BL/ 6NHsd blastocytes to generate chimeric mice. Gcnt3f/þ mice were bred to Zp3-cre mice, expressing Cre-recombinase in the female germ line (Shafi et al., 2000), to generate a strain of mice encoding Gcnt3D. The use of a pflox targeting vector allows the ability to generate mice with conditional deletion of the gene of interest. Conditional knockouts have proven to be very valuable if a gene proves to be required for embryonic development or to further dissect a phenotype to determine the cell types involved.
2.2. PCR genotyping of Gcnt3f/f and Gcnt3D/D mice Purified tail DNA was used for genotyping animals. Genotyping protocol 1. One to 2 mm of tail DNA was digested and DNA purified using the Gentra Purgene kit according to manufacturer’s instructions for mouse tail tissue.
158
Erica L. Stone et al.
2. One microliter of purified DNA was used for a 25 ml PCR reaction using Takara EX taq. 3. PCR primers: Common primer (AGA GCT CAG CTT CTG TTT TCA TA) Wild-type primer (GCC ATT CCT TCT TCC ATT TGT TA) Deletion primer (CCA ACC AAA CTA AGC TCC AGT A) Note: Primer concentrations differ to compensate for primer preference for the Gcnt3D product, which from here on will be referred to as C2GnT2 KO for simplicity. 0.5 ml of 20 mM common primer, 1.0 ml of 20 mM wildtype primer, and 0.25 ml of 20 mM deletion primer were used for each 25 ml reaction. 4. PCR conditions: 94 C for 5 min 94 C for 30 s 52 C for 30 s 40 cycles 72 C for 45 s 72 C for 7 min 5. PCR products were separated on a 2% NuSieve agarose gel. This genotyping strategy allowed us to differentiate between all three possible alleles of Gcnt3 with the same reaction. The common and wildtype primers were used to amplify both the wild-type allele product and the slightly larger floxed allele product. The common primer and deletion primers allowed amplification of the knockout allele. All three possible products were then visualized using a 2% agarose gel to allow for good separation of the wild-type and floxed allele products (Fig. 9.1).
C2GnT2 genotyping
1000
KO
WT 500
Figure 9.1 PCR genotyping of C2GnT2 KO mice. Figure shows reaction products from C2GnT2 genotyping PCR run out of 2% NuSieve gel. Genotypes displayed are C2GnT2þ/D, C2GnT2þ/þ, and C2GnT2D/D.
Characterization of Mice Lacking C2GnT2
159
3. Mice Lacking C2GnT2 Have Reduced Core 2 and no Core 4 Enzyme Activity and Altered Glycosylation 3.1. Core 2 and Core 4 enzyme assays Core 2 and Core 4 enzyme activity was determined by measuring the amount of 3H-GlcNAc incorporation in the presence of wild-type or C2GnT2 KO tissue lysate and Galb1-3GalNAca-p-nitrophenyl (Core 1-PNP) or GlcNAcb1-3GalNAca-p-nitrophenyl (Core 3-PNP). Tissue homogenization 1. Four hundred milligrams of tissue were homogenized in 2 ml lysis buffer (10 mM tris–HCL pH 8.0, 0.1 mM EDTA, 1 mM DTT, 0.25 M sucrose, and 1% triton X-100). 2. Homogenized tissue is then incubated on ice for 1 h. 3. Samples were then centrifuged at 14,000 rpm for 15 min and the supernatant (lysate) was isolated. 4. Ten microliters of lysate was used as enzyme source in one reaction (total 20 ml reaction). Enzyme assay procedure 1. One microliter 10 mM of UDP-GlcNAc and 5 ml of UDP-3H-GlcNAc were dried using a speed vac. 2. One microliter of 0.5 M HEPES–NaOH pH 7.0, 0.5 ml of 100 mM DTT, 1 ml of 1 M GlcNAc (Sigma), 0.5 ml of 1 M D-galactonolactone (Sigma), 0.2 ml of 0.5 M EDTA pH 8.0, 5.6 ml of H2O, and 10 ml of the enzyme (cell lysate) plus 1 ml of 10 mM Core 1-PNP or Core 3-PNP (Toronto Research Chemicals) were then added to each tube containing dried UDP-GlcNAc. 3. The reaction mixtures were then incubated at 37 C for 2 h. 4. The reaction was stopped by adding 1 ml of ice-cold H2O per reaction. 5. This reaction mixture was then purified using a Sep-Pak C18 column (Alltech). Purifying the enzyme assay reaction mixture 1. A Sep-Pak C18 column was washed with 2 ml methanol and 10 ml H2O. 2. The sample was then added to the column. 3. The column was washed with 10 ml of H2O.
160
Erica L. Stone et al.
C2GnT activity in C2GnT2Δ/Δ tissues (% of WT)
A 500 400 300 200 100 0
*** Colon
C4GnT activity in C2GnT2Δ/Δ tissues (% of WT)
B 125 100 75 50 25 0
*** Colon
Small intestine
Stomach
*** Small intestine
*** Stomach
Figure 9.2 C2GnT2 KO mice have reduced Core 2 activity in the colon and no remaining Core 4 activity. (A) The amount of Core 2 activity in tissues from C2GnT2 KO mice relative to wild-type tissue is shown. (B) The relative amount of Core 4 activity in tissues from C2GnT2 KO mice is shown. Modified from Stone et al. (2009).
4. Two milliliters of methanol was used to elute the purified sample from the column. 5. A scintillation counter was used to count the radioactivity of the eluate. 6. The amount (in pmol) of 3H-labeled UDP-GlcNAc was calculated by comparing the standard curve obtained from aliquots of UDP-3Hlabeled GlcNAc. The results showed that there was significantly reduced Core 2 activity in colon tissue from C2GnT2 KO mice. The remaining Core 2 activity is not surprising as the three C2GnTs have overlapping but distinct expression profiles. There was no detectable Core 4 enzyme activity in any of the C2GnT2 KO tissues tested further indicating that C2GnT2 is the only glycosyltransferase able to generate Core 4 O-glycans (Fig. 9.2; Stone et al., 2009).
3.2. Mass spectrometry Tissues from C2GnT2 KO mice were prepared for mass spectrometric analyses and O-glycan structures were analyzed as described in Chapter Two of this volume.
Characterization of Mice Lacking C2GnT2
161
As expected, the results indicated that C2GnT2 KO mice had a general reduction in Core 2 O-glycans in the digestive tract. Furthermore, there was a decrease in I-branches in the stomach and colon of C2GnT2 KO mice (Stone et al., 2009; and Ismail et al., submitted). The loss of C2GnT2 also resulted in increased and novel expression of elongated Core 1 O-glycan structures (Stone et al., 2009; and Ismail et al., submitted). This increase is unlikely due to reduced competition for acceptor substrates as it has been previously shown that the initiation of the Core 2 branch does not decrease the efficiency of Core 1 extension b1,3-Nacetylglucosaminyltransferase (Core1-b3GlcNAcT) (Yeh et al., 2001). We hypothesize that loss of C2GnT2 activity may lead to an increased abundance of UDP-GlcNAc donor substrate, which is also utilized by Core1-b 3GlcNAcT, resulting in increased Core 1 elongation. Stomach tissue from C2GnT2 KO mice unexpectedly expressed elongated O-mannose structures and this expression of elongated O-mannose structures was greatly increased in mice lacking all three C2GnTs. (Stone et al., 2009; and Ismail et al., submitted). Reduced competition for UDP-GlcNAc may also explain this surprising induction of elongated O-mannose structures in C2GnT2 KO and Triple C2GnT KO stomach tissue, as UDP-GlcNAc is also the donor substrate for protein-O-mannose-b1,2-N-acetylglucosaminyltransferase 1 (POMGnT1) (Lengeler et al., 2008; Yoshida et al., 2001; Zhang et al., 2002).
4. Phenotyping C2GnT2 KO Mice 4.1. Mice lacking C2GnT2 are viable C2GnT2 KO mice were born at normal Mendelian ratios from heterozygous breeders showing that there is no decrease in viability in the absence of C2GnT2 and that C2GnT2 is not required for early development. Furthermore, mice lacking C2GnT2 were overtly normal throughout development and both male and female C2GnT2 KO mice were fertile (Stone et al., 2009).
4.2. C2GnT2 KO mice have reduced mucosal barrier function C2GnT2 is highly expressed in mucin-producing tissues, including the stomach, small intestine, and colon, and the mice deficient for the glycosyltransferase that generates Core 3 O-glycans were shown to have increased intestinal permeability (An et al., 2007). Thus, we determined if C2GnT2 KO mice had reduced intestinal barrier function using the dextran conjugted to Fluorescein isothiocyanate (FITC) in vivo intestinal permeability assay (An et al., 2007; Furuta et al., 2001).
162
Erica L. Stone et al.
In vivo intestinal permeability assay 1. A 75 mg/ml solution of dextran–FITC (Sigma) was made up in sterile PBS. 2. Mice were weighed prior to treatment with dextran–FITC. 3. 600 mg/kg of dextran–FITC was administered via oral gavage. 4. Four hours after administration of dextran–FTIC, blood was collected via retro-orbital bleed into Microtainer serum separator tubes and stored in the dark for 30 min to allow blood to clot. 5. Samples were spun at full speed for 3 min in a microcentrifuge and sera, which were on top of the gel separator after centrifugation, were transferred to microfuge tubes. 6. Sera were diluted 1:1 with dI to allow for enough volume to measure each sample in duplicate. 7. The relative amount of FITC was determined using a Spectra Max Gemini EM fluorescent plate reader set for 490 nm excitation and 530 nm emission wavelengths. The results indicated that more dextran–FITC is in the blood of C2GnT2 KO mice 4 h after oral administration (Fig. 9.3A; Stone et al., 2009). This showed that the permeability of the digestive tract is increased in these animals, which is indicative of reduced barrier function. Additional studies to determine if this increased permeability of the digestive tract leads to increased trafficking of commensal or pathogenic bacteria from the intestines to the mesenteric lymph node and spleen are warranted (Vaishnava et al., 2008).
4.3. C2GnT2 KO mice have reduced levels of circulating Ig in naı¨ve mice The digestive tract is home to a large and varied community of commensal microbes. Proper barrier function along the digestive tract is required to prevent translocation of otherwise commensal microbes of the microbiota (Garrett et al., 2010). Thus, we sought to determine if the immune system was perturbed in C2GnT2 KO mice. 4.3.1. Quantification of immunoglobulin isotypes in sera Sera collection from naı¨ve mice 1. Mice were bled by retro-orbital bleeding and blood was collected into serum separator tubes (Microtainer). 2. Blood was allowed to clot for 30 min at room temperature (RT).
163
Characterization of Mice Lacking C2GnT2
B
Dextran-FITC (mg/ml)
600
*
400 200 0
Fecal IgA (mg/ml)
A
WT C2GnT2Δ/Δ
1.5 1.0 0.5 0
* WT C2GnT2Δ/Δ
C 300 IgG1 (mg/ml)
IgM (mg/ml)
100 75 50 25 0
0
10
* 5
WT C2GnT2Δ/Δ
500
*
250 WT C2GnT2Δ/Δ
150 IgA (mg/ml)
IgG3 (mg/ml)
750
0
WT C2GnT2Δ/Δ
60 40 20 0
*
1000 IgG2b (mg/ml)
IgG2a (mg/ml)
100
WT C2GnT2Δ/Δ
15
0
200
WT C2GnT2Δ/Δ
100 50 0
WT C2GnT2Δ/Δ
Figure 9.3 Decreased barrier function and immunoglobulin levels in C2GnT2 KO mice. (A) The amount of dextran–FITC in sera 4 h after administration by gavage is shown. (B) Mean fecal IgA levels in wild-type and C2GnT2 KO mice are shown. (C) Levels of IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA isotypes in wild-type and C2GnT2 KO mice are shown. All values are means S.E.M. Modified from Stone et al. (2009).
3. Blood was spun down at full speed and serum was transferred to a microfuge tube. 4. Sera were stored at 20 C until assayed. Immunoglobulin isotype ELISAs 1. 96-well Maxisorp plates were coated with 100 ml/well of 5 mg/ml antimouse isotype-specific antibodies (BD Biosciences, San Jose, CA) in
164
2. 3. 4.
5. 6. 7.
8. 9. 10.
Erica L. Stone et al.
PBS overnight at 4 C. Separate plates were coated for quantification of IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA. Plates were washed with 200 ml/well of dI and plates were tapped on paper towels to remove residual liquid from wells. Plates were then blocked for 2 h at RT with 200 ml/well of PBS plus 2% IgG-free BSA (Jackson Immuno-research). Sera samples were diluted with PBS plus 2% IgG-free BSA so that each Ig-isotype concentration would be within the linear range of each isotype ELISA. a. Sera were diluted 1/2000 for IgG1, IgG2a, and IgA quantifications. b. Sera were diluted 1/10,000 for IgG2b, IgG3, and IgM quantifications. 100 ml/well of diluted sera samples were added in triplicate to plates coated for the respective isotype. Samples were allowed to bind at RT for 2 h or overnight (O/N) at 4 C. Plates were washed at least six times with 200 ml/well of PBS plus 0.05% Tween 20 (PBST) and tapped on paper towels to remove residual liquid from wells. The plates were then incubated with 100 ml of diluted alkaline phosphatase (AP)-labeled isotype-specific antibodies at RT for 1 h or overnight at 4 C. a. AP-conjugated antibodies to mouse IgG1, IgG2a, IgG2b, and IgG3 (BD Biosciences) were diluted 1/500 in PBS plus 2% IgG-free BSA. b. AP-conjugated anti-mouse IgM (Sigma) was diluted 1/4000. c. AP-conjugated anti-mouse IgA (Sigma) was diluted 1/1000. Plates were then washed at least six times with 200 ml/well of PBST and tapped on paper towels to remove residual PBST in wells. Plates were then incubated at RT with 100 ml/well of the AP-substrate para-nitrophenyl phosphate (Sigma, St. Louis, MO), which had previously been warmed to RT. Plates were observed for obvious color change and then signals were read at 405 nm using a Versa Max plate reader.
4.3.2. Quantification of IgA in fecal samples Feces collection 1. Microfuge tubes were weighed and the weight of each tube was recorded. 2. Each mouse for which feces were to be collected was put into a clean, empty, bedding-free cage without food and water for 1 h. 3. At the end of the hour, feces were collected with a sterile pipette and stored in preweighed microfuge tube. 4. Microfuge tubes with feces were reweighed and the weight of the feces was calculated. 5. Feces were stored at 80 C until needed.
Characterization of Mice Lacking C2GnT2
165
Solubilization of feces 1. 2. 3. 4. 5. 6. 7.
Feces were diluted 20-fold weight to volume with PBS. Feces were allowed to incubate in PBS for 15 min at RT. PBS plus feces were then vortexed for at least 30 s. Steps 2 and 3 were repeated until no fecal chunks remained. Samples were centrifuged to pellet solids. Supernatant was transferred to fresh tubes. Fecal solutions were stored at 80 C until needed. Determination of IgA levels in fecal solutions
1. IgA ELISAs were done as described above. 2. Fecal solutions were diluted 1/100 in PBS plus 2% IgG-free BSA. Surprisingly, results showed that C2GnT2 KO mice had reduced levels of mucosal IgA and circulating IgG1, IgG2b, and IgG2b (Fig. 9.3B and C). There was also a trend toward decreased levels of IgG3 and sera IgA (Stone et al., 2009). The reduced immunoglobulin levels are not likely due simply to a defect in isotype switching, as a corresponding increase in IgM level was not seen (Fig. 9.3C). Additional studies are necessary to determine how an enzyme expressed primarily in mucin-producing tissues results in a systemic reduction of antibodies.
4.4. C2GnT2 KO mice developed exaggerated pathogenesis in the DSS-induced colitis model Reduced barrier function and immunodeficiencies, including reduced mucosal Ig levels, have previously been associated with increased susceptibility to colitis (An et al., 2007; Garrett et al., 2010; MacDonald and Monteleone, 2005; Murthy et al., 2006). Untreated C2GnT2 KO mice were observed for symptoms of colitis, including weight loss, stool consistency, and overt or occult blood in stool. No signs of spontaneous colitis were observed in C2GnT2 KO mice or littermate controls (Stone et al., 2009). We then induced colitis with DSS in C2GnT2 KO mice and wildtype controls to determine if loss of C2GnT2 results in increased susceptibility to experimentally induced colitis (Ho et al., 2006). DSS-induced colitis model 1. Mice are weighed prior to the initiation of treatment. 2. Prior to the initiation of treatment, stool consistency is observed. 3. Initial overt or occult blood in stool was assessed using Hemoccult II cards (Beckman-coulter). 4. Mice were administered drinking water containing 5% DSS (40,000– 50,000 molecular weight) for 5–6 days, ad libitum. The amount of water
166
5. 6. 7. 8. 9.
10. 11.
Erica L. Stone et al.
consumed was recorded. Mice that did not drink enough water to exceed a DSS load of 30 mg/day were excluded from the study. After DSS treatment, mice were returned to normal drinking water for the duration of the study. Over the course of the study, mice weight, stool consistency, overt or occult blood in stool, and mouse activity level were recorded daily. Daily parameters were used to determine daily disease activity index as previously described (Ho et al., 2006; Murthy et al., 1993). Colons of mice surviving to the end of the study were fixed and stained with hematoxylin and eosin (H&E). H&E-stained colon sections were blindly scored as follows: a. Normal tissue was determined to be grade 0. b. Alterations of the bottom 1/3 of glands were recorded as grade I. c. Loss of bottom 2/3 to all glands was recorded as grade II d. Destruction of all glands and loss of surface epithelium were scored as grade III. Grade III was equivalent to complete ulceration. Total length of complete ulceration was determined by counting the number of fields of view exhibiting grade III damage at 10 magnification. Total crypt damage score was determined by calculating the average score of all fields of view of a specimen over a given length of the colon at 10 magnification.
The results showed that C2GnT2 KO mice had increased pathogenesis when colitis was induced with DSS. C2GnT2 KO mice showed a trend toward increased weight loss and had an increased disease activity score on at least 1 day over the course of the experiment. Furthermore, colon damage was increased in C2GnT2 KO mice treated with DSS. The length of complete ulceration and total crypt damage score were both increased in C2GnT2 KO mice (Fig. 9.4; Stone et al., 2009).
4.5. C2GnT2 KO mice do not have altered levels of Muc2 C3GnT KO mice were found to have reduced levels of Muc2 in the colon (An et al., 2007), and mice with reduced Muc2 levels were found to have increased susceptibility to DSS-induced colitis (Van der Sluis et al., 2006). We, thus, determined if C2GnT2 KO mice had altered Muc2 levels in the digestive tract. Determining relative fecal Muc2 levels 1. Fecal samples were collected and solubilized as described above. 2. 96-well Maxisorp plates were coated O/N at 4 C with 100 ml of solubilized fecal samples diluted 10 with PBS.
167
Characterization of Mice Lacking C2GnT2
B 5 0 −5 −10 −15 −20 −25 −30 −35
1
2
Time (days) 3 4 5 6
5% DSS administered
7
8
Disease activity score
Mean weight loss (%)
A
4
5% DSS administered
*
3 2 1 0 0
1
2
3 4 5 6 Time (days)
D 12 9
*
6 3 0
WT C2GnT2Δ/Δ
Crypt damage score
Grade III ulceration (number fields per specimen)
8
C2GnT2Δ/Δ
WT C
7
2.5 2
*
1.5 1 0.5 0
WT C2GnT2Δ/Δ
Figure 9.4 C2GnT2 KO mice have increased susceptibility to DSS-induced colitis. (A) The average percent weight change following DSS-administration as compared to d ¼ 0 of wild-type (filled squares) and C2GnT2 KO (open squares) is shown. (B) Daily disease activity index of wild-type and C2GnT2 KO mice treated with 5% DSS is shown. (C) The length of total ulceration (grade III damage) in colon sections of DSS-treated wild-type and C2GnT2 KO mice is shown. (D) The average crypt damage score from colon sections of wild-type and C2GnT2 KO mice following induction of colitis with DSS is shown. All values are means S.E.M. Modified from Stone et al. (2009).
3. Plates were washed at least three times with 200 ml/well of PBS. 4. Plates were blocked for 1 h at RT with PBS plus 2% IgG-free BSA. 5. Plates were washed at least three times with 200 ml/well PBST and tapped on a paper towel to remove residual liquid. 6. Muc2 bound to plates was detected with anti-Muc2 (H-300) (Santa Cruz Biotechnology). One hundred microliters of 0.2 mg/ml antiMuc2 (H-300) diluted in blocking buffer was allowed to bind O/N at 4 C. 7. Plates were washed as described in Step 5. 8. Plates were then coated with anti-rabbit-HRP (Vector Laboratories) diluted 1/1000 in blocking buffer. 9. HRP substrate tetramethylbenzidine (TMB) was allowed to warm to RT. 10. Plates were washed at least six times with PBST and tapped on a paper towel to remove residual liquid.
168
Erica L. Stone et al.
11. 100 ml/well of TMB substrate was added to the plate. Plates were protected from light. 12. Signals were then determined at 650 nm using a VersaMax plate reader following visual color change. Any alterations in colon Muc2 expression or half-life would be expected to result in altered levels of fecal Muc2. However, fecal Muc2 levels in C2GnT2 KO mice were unaltered (Stone et al., 2009; Fig. 9.5). Thus, decreased barrier function along the digestive tract and increased susceptibility to DSS-induced colitis in C2GnT2 KO mice were not due to altered Muc2 levels.
5. Conclusions and Future Directions Loss of C2GnT2 resulted in decreased barrier function and increased susceptibility to experimentally induced colitis. These results are reminiscent of phenotypes seen in C3GnT KO mice, which lack the glycosyltransferase required to generate the Core 3 branch of O-glycans. However, it is unlikely that these defects in intestinal integrity result from the same mechanism. C3GnT KO mice were found to have decreased levels of Muc2 likely resulting in the decreased barrier function and increased susceptibility to DSS-induced colitis seen in these mice (An et al., 2007), as decreased Muc2 levels have been shown to result in increased susceptibility to DSSinduced colitis (Van der Sluis et al., 2006). However, no difference was seen in fecal Muc2 levels in C2GnT2 KO mice (Stone et al., 2009). Instead, reduced levels of circulating IgGs and mucosal IgA were seen in C2GnT2 KO mice. This immunoglobulin reduction may be indicative of an immunodeficiency in C2GnT2 KO mice that leads to increased mucosal
Fecal Muc2 (OD650 nm)
1.2 0.9 0.6 0.3 0 WT
C2GnT2Δ/Δ
Figure 9.5 Relative fecal Muc2 levels from wild-type and C2GnT2 KO mice are shown. Modified from Stone et al. (2009).
Characterization of Mice Lacking C2GnT2
169
permeability. Do reduced mucosal IgA levels lead to increased permeability of digestive tracts in other models? Interesting still, is the question of how an enzyme expressed primarily in mucin-producing tissues leads to decreased systemic IgG levels in naı¨ve mice. It is also unknown if the Ig reduction seen in C2GnT2 KO mice is due to reduced Core 2 O-glycans or increased elongated Core 1 O-glycans. Altered availability of donor substrate has previously shown to regulate N-glycan branching (Dennis et al., 2009; Grigorian et al., 2007). Stone et al. (2009) further showed that limiting the use of UDP-GlcNAc for the generation of Core 2 O-glycans resulted in an increase in elongated Core 1 O-glycans and elongated O-mannosylation. Further evidence of this is that the combined loss of all three C2GnTs leads to a greater increase in elongated Core 1 and O-mannose structures Stone et al., 2009. The implication is that decreasing competition for UDP-GlcNAc leads to increased elongated Core 1 O-glycans and elongated O-mannosylation, suggesting that the available concentration of donor substrate not only controls generation of specific branched N-glycans but also likely plays an important role in controlling the biosynthesis of all glycans. Altered glycosylation has been shown to affect a large range of physiological functions (Marth and Grewal, 2008; Ohtsubo and Marth, 2006). Glucosamine supplements are widely used with sales of glucosamine– chondroitin over $700 million annually (Clegg et al., 2006). Additionally, the typical Western diet involves the consumption of larger quantities of energy and monosaccharides. Do these altered nutrient levels result in altered concentrations of donor substrates in cells in the body and thus altered glycan structures? Another important implication from Stone et al. (2009) is that reduced competition for UDP-GlcNAc, the donor substrate for both C2GnT2 and POMGnT1, may also result in increased elongated O-mannose structures (Lengeler et al., 2008; Yoshida et al., 2001; Zhang et al., 2002). Mutations leading to decreased POMGnT1 activity result in a rare limb-girdle muscular dystrophy (Clement et al., 2008; Guglieri et al., 2008). Increasing glycosylation of alpha-dystroglycan (aDG) has shown potential as a therapy for dystroglycanopathies (Brockington and Muntoni, 2005; Martin, 2007). Our research suggests that it may be possible to increase glycosylation of aDG in pathologies caused by decreased POMGnT1 activity if C2GnT activity could be inhibited. However, additional studies would be necessary to determine if reduced Core 2 O-glycosylation would have undesirable side effects. Further studies should also be done to determine if increasing UDP-GlcNAc concentration in relevant cell types would lead to increased elongated O-mannose structures generated by mutations resulting in reduced but not abolished POMGnT1 activity.
170
Erica L. Stone et al.
ACKNOWLEDGMENTS We thank Ying Luu, Stuart Haslam, Samuel Ho, and Anne Dell for collaborations. We greatly appreciate critical reading of this chapter by Simeon D. Hernandez.
REFERENCES An, G., Wei, B., Xia, B., McDaniel, J. M., Ju, T., Cummings, R. D., Braun, J., and Xia, L. (2007). Increased susceptibility to colitis and colorectal tumors in mice lacking core 3-derived O-glycans. J. Exp. Med. 204, 1417–1429. Bierhuizen, M. F., and Fukuda, M. (1992). Expression cloning of a cDNA encoding UDPGlcNAc:Gal beta 1–3-GalNAc-R (GlcNAc to GalNAc) beta 1–6GlcNAc transferase by gene transfer into CHO cells expressing polyoma largetumor antigen. Proc. Natl. Acad. Sci. USA 89, 9326–9330. Bierhuizen, M. F. A., Mattei, M.-G., and Fukuda, M. (1993). Expression of the developmental I antigen by a cloned human cDNA encoding a member of a ß-1, 6-Nacetylglucosaminyltransferase gene family. Genes. Dev. 7, 468–478. Brockhausen, I. (2004). Intestinal candyfloss. Biochem. J. 384, 3–5. Brockington, M., and Muntoni, F. (2005). The modulation of skeletal muscle glycosylation as a potential therapeutic intervention in muscular dystrophies. Acta. Myol. 24, 217–221. Clegg, D. O., Reda, D. J., Harris, C. L., Klein, M. A., O’Dell, J. R., Hooper, M. M., Bradley, J. D., Bingham, C. O., Weisman, W. H., Jackson, C. G., Lane, N. E., Cush, J. J., et al. (2006). Glucosamine, chondroitin sulfate, and the two in combination for painful knee osteoarthritis. N. Engl. J. Med. 354, 795–808. Clement, E. M., Godfrey, C., Tan, J., Brockington, M., Torelli, S., Feng, L., Brown, S. C., Jimenez-Mallebrera, C., Sewry, C. A., Longman, C., Mein, R., Abbs, S., et al. (2008). Mild POMGnT1 mutations underlie a novel limb-girdle muscular dystrophy variant. Arch. Neurol. 65, 137–141. Dennis, J. W., Nabi, I. R., and Demetriou, M. (2009). Metabolism, cell surface organization, and disease. Cell 139, 1229–1241. Ellies, L. G., Tsuboi, S., Petryniak, B., Lowe, J. B., Fukuda, M., and Marth, J. D. (1998). Core 2 oligosaccharide biosynthesis distinguishes between selectin ligands essential for leukocyte homing and inflammation. Immunity 9, 881–890. Furuta, G. T., Turner, J. R., Taylor, C. T., Hershberg, R. M., Comerford, K., Narravula, S., Podolsky, D. K., and Colgan, S. P. (2001). Hypoxia-inducible factor 1-dependent induction of intestinal trefoil factor protects barrier function during hypoxia. J. Exp. Med. 193, 1027–1034. Garrett, W. S., Gordon, J. I., and Glimcher, L. H. (2010). Homeostasis and inflammation in the intestine. Cell 140, 859–870. Gauguet, J. M., Rosen, S. D., Marth, J. D., and von Andrian, U. H. (2004). Core 2 branching b1,6-N-acetylglucosaminyltransferase and high endothelial cell N-acetylglucosamine6-sulfotransferase exert differential control over B- and T lymphocyte homing to peripheral lymph nodes. Blood 104, 4104–4112. Grigorian, A., Lee, S. U., Tian, W., Chen, I. J., Gao, G., Mendelsohn, R., Dennis, J. W., and Demetriou, M. (2007). Control of T cell-mediated autoimmunity by metabolite flux to N-glycan biosynthesis. J. Biol. Chem. 282, 20027–20035. Guglieri, M., Straub, V., Bushby, K., and Lochmuller, H. (2008). Limb-girdle muscular dystrophies. Curr. Opin. Neurol. 21, 576–584.
Characterization of Mice Lacking C2GnT2
171
Hagisawa, S., Ohyama, C., Takahashi, T., Endoh, M., Moriya, T., Nakayama, J., Arai, Y., and Fukuda, M. (2005). Expression of core 2 beta1, 6-N-acetylglucosaminyltransferase facilitates prostate cancer progression. Glycobiology 15, 1016–1024. Hiraoka, N., Kawashima, H., Petryniak, B., Nakayama, J., Mitoma, J., Marth, J. D., Lowe, J. B., and Fukuda, M. (2004). Core 2 branching b1, 6-N-acetylglucosaminyltransferase and high endothelial venule-restricted sulfotransferase collaboratively control lymphocyte homing. J. Biol. Chem. 279, 3058–3067. Ho, S. B., Dvorak, L. A., Moor, R. E., Jacobson, A. C., Frey, M. R., Corredor, J., Polk, D. B., and Shekels, L. L. (2006). Cysteine-rich domains of Muc3 intestinal mucin promote cell migration, inhibit apoptosis, and accelerate wound healing. Gastroenterology 131, 1501–1517. Koya, D., Dennis, J. W., Warren, C. E., Takahara, N., Schoen, F. J., Nishio, Y., Nakajima, T., Lipes, M. A., and King, G. L. (1999). Overexpression of core 2-Nacetylglycosaminyltransferase enhances cytokine actions and induces hypertrophic myocardium in transgenic mice. FASEB J. 13, 2329–2337. Lengeler, K. B., Tielker, D., and Ernst, J. F. (2008). Protein-O-mannosyltransferases in virulence and development. Cell Mol. Life Sci. 65, 528–544. MacDonald, T. T., and Monteleone, G. (2005). Immunity, inflammation, and allergy in the gut. Science 307, 1920–1925. Marth, J. D., and Grewal, P. K. (2008). Mammalian glycosylation in immunity. Nat. Rev. Immunol. 8, 874–887. Martin, P. T. (2007). Congenital muscular dystrophies involving the O-mannose pathway. Curr. Mol. Med. 7, 417–425. Murthy, S. N. S., Cooper, H. S., Shim, H., Shah, R. S., Ibrahim, S. A., and Sedergran, D. J. (1993). Treatment of dextran sulfate sodium-induced murine colitis by intracolonic cyclosporin. Dig. Dis. Sci. 38, 1722–1734. Murthy, A. K., Dubose, C. N., Banas, J. A., Coalson, J. J., and Arulanandam, B. P. (2006). Contribution of polymeric immunoglobulin receptor to regulation of intestinal inflammation in dextran sulfate sodium-induced colitis. Gastroenterology 26, 1372–1380. Ohtsubo, K., and Marth, J. D. (2006). Glycosylation in cellular mechanisms of health and disease. Cell 126, 1–13. Rossi, F. M. V., Corbel, S. Y., Merzaban, J. S., Carlow, D. A., Gossens, K., Duenas, J., So, L., Yi, L., and Ziltener, H. J. (2005). Recruitment of adult thymic progenitors is regulated by P-selectin and its ligand PSGL-1. Nat. Immunol. 6, 626–634. Schachter, H., and Brockhausen, I. (1989). The biosynthesis of branched O-glycans. Symp. Soc. Exp. Biol. 43, 1–26. Schwientek, T., Nomoto, M., Levery, S. B., Merkx, G., van Kessel, A. G., Bennett, E. P., Hollingsworth, M. A., and Clausen, H. (1999). Control of O-glycan branch formation. Molecular cloning of human cDNA encoding a novel beta1, 6-N-acetylglucosaminyltransferase forming core 2 and core 4. J. Biol. Chem. 274, 4504–4512. Schwientek, T., Yeh, J. C., Levery, S. B., Keck, B., Merkx, G., van Kessel, A. G., Fukuda, M., and Clausen, H. (2000). Control of O-glycan branch formation: Molecular cloning and characterization of a novel thymus-associated Core 2 b1, 6-N-acteylglucosaminyltransferase. J. Biol. Chem. 275, 11106–11113. Shafi, R., Iyer, S. P., Ellies, L. G., O’Donnell, N., Marek, K. W., Chui, D., Hart, G. W., and Marth, J. D. (2000). The O-GlcNAc transferase gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. Proc. Natl. Acad. Sci. USA 97, 5735–5739. Shimodaira, K., Nakayama, J., Nakamura, N., Hasebe, O., Katsuyama, T., and Fukuda, M. (1997). Carcinoma-associated expression of core 2 beta-1, 6-N-acetylglucosaminyltransferase gene in human colorectal cancer: A role of O-glycans in tumor progression. Cancer Res. 57, 5201–5206.
172
Erica L. Stone et al.
Sperandio, M., Forlow, S. B., Thatte, J., Ellies, L. G., Marth, J. D., and Ley, K. (2001). Differential requirements for core 2 glucosaminyltransferase for endothelial L-selectin ligand function in vivo. J. Immunol. 167, 2268–2274. Stone, E. L., Ismail, M. N., Lee, S. H., Luu, Y., Ramirez, K., Haslam, S. M., Ho, S. B., Dell, A., Fukuda, M., and Marth, J. D. (2009). Glycosyltransferase function in Core 2-type protein O-glycosylation. Mol. Cell. Biol. 29, 3370–3782. Tarp, M. A., and Clausen, H. (2008). Mucin-type O-glycosylation and its potential use in drug and vaccine development. Biochim. Biophys. Acta 1780, 546–563. Tsuboi, S., and Fukuda, M. (1998). Overexpression of branched O-linked oligosaccharides on T cell surface glycoproteins impairs humoral immune responses in transgenic mice. J. Biol. Chem. 273, 30680–30687. Tsuboi, S., and Fukuda, M. (2001). Roles of O-linked oligosaccharides in immune responses. Bioessays 23, 46–53. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., and Hooper, L. V. (2008). Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host– microbial interface. Proc. Natl. Acad. Sci. USA 105, 20858–20863. van der Sluis, M., de Koning, B. A. E., de Bruijn, A. C. J. M., Velcich, A., Meijerink, J. P. P., van Goudoever, J. B., Buller, H. A., and Einerhand, A. W. C. (2006). Muc2-deficient mice spontaneously develop colitis, indicating that Muc2 is critical for colonic protection. Gastroenterology 131, 117–129. Yeh, J. C., Ong, E., and Fukuda, M. (1999). Molecular cloning and expression of a novel b-1, 6-N-acetylglucosaminyltransferase that forms Core 2, Core 4, and I branches. J. Biol. Chem. 274, 3215–3222. Yeh, J. C., Hiraoka, N., Petryniak, B., Nakayama, J., Ellies, L. G., Rabuka, D., Hindsgaul, O., Marth, J. D., Lowe, J. B., and Fukuda, M. (2001). Novel sulfated lymphocyte homing receptors and their control by a Core 1 extension beta 1,3,-Nacetylglucosaminyltransferase. Cell 105, 957–969. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell 1, 717–724. Zhang, W., Betel, D., and Schachter, H. (2002). Cloning and expression of a novel UDPGlcNAc:a-3-D-mannoside b1, 2-N-acetylglucosaminyltransferase I. Biochem. J. 361, 153–162.
C H A P T E R
T E N
Analyzing Physiological Function of Polypeptide GalNAcT-1-Deficient Mice in Humoral Immunity Mari Tenno Contents 174 174 175 177
1. 2. 3. 4. 5.
Overview Assay for In Vitro B Lymphocyte Activation Assay for In Vivo Antibody Production Immunohistochemical Staining of Frozen Sections Apoptosis Detection Using Antibody Against Caspase 3 Active Form 6. Apoptosis Detection by TUNEL System Acknowledgment References
179 182 183 183
Abstract A family of polypeptide GalNAc transferases (ppGalNAcTs) initiates protein O-glycosylation. The ppGalNAcT gene family is large; at least 15 ppGalNAcT isozymes have been cloned so far and each of them may have important and distinctive physiologic functions. ppGalNAcT-1, which is highly expressed in many tissues and cell types, is the first member of the ppGalNAcT family to be cloned. In order to understand the physiologic role of ppGalNAcT-1, we generated and characterized mice lacking this isozyme. We found that ppGalNAcT-1 plays key roles in germinal center (GC) B lymphocyte apoptosis in the modulation of humoral immune response. In this chapter, in vitro and in vivo systems to assess the B lymphocyte function of ppGalNAcT-1-deficient mice are discussed. In addition, detailed information on the immunohistochemistry of GC is also described.
RIKEN Research Center for Allergy and Immunology, Tsurumi-ku, Yokohama City, Kanagawa, Japan Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79010-8
#
2010 Elsevier Inc. All rights reserved.
173
174
Mari Tenno
1. Overview Oligosaccharides having GalNAc in the a1 linkage to serine and threonine residues are commonly found in mucins as well as in other secretory and membrane glycoproteins (Elhammer and Kornfeld, 1986; McGuire and Roseman, 1967; Ohtsubo and Marth, 2006; Van den Steen et al., 1998; Wang et al., 1992). The initial step in the biosynthesis of these structures is catalyzed by a group of enzymes known as polypeptide GalNAc transferases (ppGalNAcTs; Brockhausen, 2000; Hagen et al., 1993; Homa et al., 1993; Schachter and Brockhausen, 1989). These enzymes transfer GalNAc from the nucleotide-sugar donor, UDP-GalNAc, to certain serine and threonine residues on acceptor proteins. The ppGalNAcT gene family is large. At least 15 ppGalNAcT isozymes have been cloned so far (Cheng et al., 2004; Ten Hagen et al., 2003), and individual members of this glycosyltransferase family may have important and distinctive physiologic roles (Barbieri et al., 2007; Hennet et al., 1995; Ichikawa et al., 2005, 2009; Kato et al., 2006; Ten Hagen et al., 2003; Topaz et al., 2004; Zhang et al., 2003). ppGalNAcT-1, which is highly expressed in many tissues and cell types, is the first member of the ppGalNAcT family to be identified and characterized (Hagen et al., 1993; Homa et al., 1993; Kingsley et al., 2000; Young et al., 2003). In order to understand the roles of ppGalNAcT-1 in mammalian development and physiology, we have generated and characterized mice lacking this isozyme (Tenno et al., 2007). Although ppGalNAcT-1 deficiency does not cause infertility, substantial defects occur in the formation of selectin ligands, resulting in altered innate and adaptive immune cell trafficking (Tenno et al., 2007). Methods to analyze selectin ligands are described in Chapter 15 by Mitoma and Fukuda. In addition, ppGalNAcT-1-deficient mice show increased germinal center (GC) B cell apoptosis, which leads to reductions in plasma B cell number and IgG level (Tenno et al., 2007). In this chapter, in vitro and in vivo systems to assess B lymphocyte function in ppGalNAcT-1-deficient mice are discussed. In addition, immunohistochemical methods for GC architecture and apoptotic cell detection are also described.
2. Assay for In Vitro B Lymphocyte Activation The following protocol describes B lymphocyte proliferation in vitro induced by two commonly used stimulants, anti-IgM and lipopolysaccharide (LPS), which is determined by measuring the incorporation of 3 H-thymidine into dividing cells.
ppGalNAcT1-Function in Humoral Immunity
175
One of the critical points for the proliferation assay is the purity and viability of the cells used for culture. In the following method, B lymphocytes are isolated by negative selection using a Dynal magnetic system (Dynal Biotech) or a MACS system (Miltenyi Biotec). Non-B lymphocytes that are magnetically labeled are depleted by the magnetic field of a separator, while unlabeled B lymphocytes pass through the column. The purity of the enriched B lymphocytes can be evaluated by flow cytometry using B lymphocyte markers, B220 or CD19. By using these systems, more than 95% of the recovered cells are viable B lymphocytes. In addition, the cell density in the culture well can affect the extent of cell proliferation. At low cell density, proliferation may be decreased. In healthy, proliferating cell cultures, large cells and cell clumps can be observed at least 16 h poststimulation. In contrast, small cells can be observed in unhealthy, dying cell cultures. 1. B lymphocytes are purified from splenocytes using the Dynal magnet system (Dynal Biotech) or the MACS system (Miltenyi Biotec) according to the manufacturer’s instructions. Purity is checked by flow cytometry using B lymphocyte markers, B220 or CD19 (Pharmingen). 2. Equivalent numbers of B cells of each genotype (1 105) are cultured in complete RPMI 1640 medium containing 0.1 mM b-mercaptoethanol, 10% FCS, and L-glutamine with a range of concentrations of goat F (ab0 )2 anti-mouse IgM antiserum (0–20 g/ml) ( Jackson) or LPS (0–50 g/ml) (Sigma). Triplicate wells of a 96-well plate are prepared for each dilution to validate the results. 3. The plate is placed in a humidified 37 C, 5% CO2 incubator for 16–72 h. 4. During the last 16 h of the 72-h assay, 2.5 Ci of 3H-thymidine is added to each well. The plate is returned to the 37 C incubator and incubated for 16 h. 5. The cells are harvested onto glass-fiber discs using a cell harvester. The discs are added to vials containing 1.5 ml of scintillation fluid and cpm is measured with a scintillation counter. Proliferative capacity is determined by measuring the incorporation of 3H-thymidine into cells.
3. Assay for In Vivo Antibody Production This section describes a method for assessing antibody production in vivo by immunization with antigens and the subsequent measurement of antigen-specific antibody secreted in sera by the enzyme-linked immunosorbent assay (ELISA). Mice are intraperitoneally injected with either dinitrophenyl (DNP)-keyhole limpet hemocyanin (KLH), a T-dependent stimulant, or DNP-Ficoll,
176
Mari Tenno
a T-independent stimulant. These antigens should be prepared shortly before immunization and immediately injected into mice. Do not save extra antigens for future assays. At various time points, collect sera and store them at 20 C until ELISA to determine anti-DNP titers. Avoid repeated freeze–thaw cycles. If sera are clotted or hemolyzed during storage, perform centrifugation prior to dilution for ELISA, and make a note and interpret the results with caution. Dilution should be made shortly before application and immediately applied to the wells. Do not save extra diluted sera for future assays. It is also important to collect data from the serum dilution in the linear range for OD405. Therefore, various dilutions of sera should be tested to determine the optimal dilution. In order to reduce background signals, minimize the lag time between washing steps to keep wells wet during ELISA. 1. Blood from unimmunized mice is collected into serum separator tubes (BD Microtainer), incubated for 10 min at room temperature, and centrifuged at 14,000 rpm for 2 min at room temperature. The upper layer is collected as preimmune serum and stored at 20 C. 2a. For T-dependent response, DNP-KLH (Calbiochem) in PBS is emulsified with complete Freund’s adjuvant (Calbiochem). Mice are immunized by intraperitoneally injecting 100 g of DNP-KLH emulsified in complete Freund’s adjuvant at day 0. Mice are boosted with 100 g of DNP-KLH emulsified in incomplete Freund’s adjuvant (Calbiochem) at day 28. 2b. For T-independent response, mice are inoculated with 10 g of DNPFicoll (Biosearch) in PBS at day 0. 3. Sera are collected from the immunized mice at the indicated times (days 0, 7, 14, 21, 28, 32, and 36) and anti-DNP titers are determined by ELISA. 4. DNP-BSA is diluted to 2 g/ml with PBS and 100 l is added to each well of a Maxisorb plate (Nunc). The plate is incubated for 1 h at 37 C and washed three times with PBS containing 0.05% Tween 20. 5. The plate is blocked with 10% BSA in PBS for 30 min at 37 C and washed three times with 0.05% Tween 20 in PBS. 6. Sera are diluted with 10% BSA in PBS to various concentrations and added to each well. Triplicate wells are prepared for each dilution to validate the results and one column is left as blank wells. The plate is incubated for 3 h at 37 C and washed three times with PBS containing 0.05% Tween 20. 7. Anti-mouse isotype-specific antibodies conjugated to alkaline phosphatase (for IgM and IgA, Sigma; for IgG1, IgG2a, IgG2b, and IgG3, Pharmingen) are diluted to 2 g/ml with 10% BSA in PBS and 100 l is added to each well. The plate is incubated for 1 h at 37 C and washed four times with PBS containing 0.05% Tween 20.
ppGalNAcT1-Function in Humoral Immunity
177
8. Fifty microliters of alkaline phosphatase substrate (Sigma) is added to each well. The plate is incubated for 10 min at room temperature and the color reaction is stopped by adding 50 l of 0.1 M EDTA to each well. The plate is evaluated within 30 min of stopping the reaction. 9. OD405 values are obtained with a microplate reader (Molecular Devices). Figure 10.1 shows the results of evaluation of B lymphocyte function in vitro and in vivo as obtained by the preceding methods. The reduction of IgG level in the sera of ppGalNAcT-1-deficient mice did not seem to be due to impaired B cell proliferation, as B cell proliferation responses to LPS or antibody-mediated IgM cross-linking were similar in wild-type and ppGalNAcT-1 mice (Fig. 10.1). However, upon immunization with both T-independent and T-dependent antigens, ppGalNAcT-1-deficient mice failed to induce a significant IgG antibody titer in the presence of normal IgM and IgA titer increases (Fig. 10.1). The development of B cells that can express IgG isotypes takes place within GCs of follicles within peripheral lymphoid tissues in response to antigen exposure. In the next section, a method for immunohistochemical staining and useful markers for GC architecture are discussed.
4. Immunohistochemical Staining of Frozen Sections The following is a protocol for the immunohistochemistry of freshly isolated frozen tissues. The method relies on the proper fixation of tissues to retain specific antigens and preserve cellular morphology. The following method uses acetone for fixation. However, acetone sometimes distorts the morphology depending on the tissue analyzed. If tissue morphology is critical, 4% paraformaldehyde in PBS for 15 min at room temperature can be used as an alternate fixation protocol. After fixation, the tissues are exposed to the primary antibody against the target protein. The bound primary antibody is labeled by incubation with a fluorescently tagged secondary antibody against the primary antibody host species. Alternatively, a biotinylated primary antibody can be detected by a fluorescently tagged streptavidin or a fluorescently tagged anti-biotin secondary antibody. It is always necessary to optimize the working concentration depending on the specificity of the primary antibody. To check background staining, a slide without the first antibodies can be prepared as a negative control. In the following method, all staining steps are performed at room temperature. If the target antigen is not stable, these staining steps can be performed at 4 C. Once a staining condition for a specific antibody is determined, double or triple labeling with more than one antibody can be tested.
A
B
C IgM
0.8
WT Δ/Δ
0.6 125
0.2
75
0
50
0
7
14
21
28
0.6
WT Δ/Δ
0.3 0 7
14
21
28
0
35
7
14
21
28
IgA
0.5 0.4 0.3 0.2 0.1 0
0.9
0
35
IgM
1.2
0
35
7
14
21
28
35
28
35
28
35
25 0
1
5
10
20
IgM (mg/ml)
0.8
IgG1
0.6
0.6
2.0
IgG2a OD405
0.8
0
OD405
H3-thymidine incorporation (cpm, × 10−3)
0.4
WT Δ/Δ
100
IgA
0.5 0.4 0.3 0.2 0.1 0
1.2
IgG1
1.5
0.9
0.4
0.4
1.0
0.6
50
0.2
0.2
0.5
0.3
40
0
0
0
0
30
7
14
21
28
0
35
7
14
21
28
0 0
35
IgG2a
7
14
21
28
0
35
7
14
21
20 10 0 0.0
0.1
1.0 10.0 50.0
LPS (mg/ml)
1.0 0.8 0.6 0.4 0.2 0
1.0 0.8 0.6 0.4 0.2 0
IgG2b
0
7
14
21
28
35
0.8
IgG3
2.0
IgG2b
0.6
1.5
0.4
1.0
0.2
0.5 0
0 0
Time (days)
7
14
21
28
35
IgG3
0
7
14
21
28
35
0
7
14
21
Time (days)
Figure 10.1 In vitro and in vivo B lymphocyte function analyses. (A) B lymphocytes were isolated and stimulated by antibody to anti-IgM or LPS. The proliferation response was determined by measuring 3H-thymidine incorporation. Data are presented as means SEM of three mice of the indicated genotype. (B) Anti-DNP antibody levels produced in response to immunization with 10 g of T-independent antigen DNP-Ficoll measured at indicated times. (C) Anti-DNP antibody levels measured before and subsequent to a secondary immunization (arrow) using 100 g of the T-dependent antigen DNP-KLH. Data are presented as means SEM of eight mice of the indicated genotypes. Partly taken from Tenno et al. (2007).
ppGalNAcT1-Function in Humoral Immunity
179
1. The lymph nodes or spleen is freshly isolated from wild-type and ppGalNAcT-1-deficient mice and frozen in OCT compound (Sakura Finetek) placed on a dry ice bath. The tissue blocks are stored at 80 C. 2. Frozen tissues are cut into 5-m-thick sections using a cryostat, collected on glass slides, and air-dried. 3. The slides are fixed in a Coplin jar containing acetone at 20 C for 15 min and washed with PBS three times for 10 min each at room temperature. 4. The slides are placed in a staining chamber to maintain a moist environment, blocked with 5% BSA in PBS for 30 min, and incubated with biotinylated anti-CD4, biotinylated anti-CD8, and anti-CD45R/B220 (Pharmingen) in 5% BSA in PBS for 1 h at room temperature. To check background staining, a slide with no first antibodies is prepared as a negative control. 5. After three washes with PBS for 10 min each, the sections are incubated with streptavidin–FITC and goat anti-rat rhodamine-conjugated secondary antibody in 5% BSA in PBS for 1 h at room temperature. 6. The slides are washed three times with PBS for 10 min each at room temperature. Then, an antifade mounting solution is mounted onto the tissues to prevent rapid quenching and a glass cover slip is placed over the slides. The slides are air-dried for 1 h at room temperature before analysis under a fluorescence microscope. Figure 10.2 shows the architecture of the GC in the spleen of wild-type and ppGalNAcT-1-deficient mice following immunization with DNP-KLH. In order to check the localization of B and T cells in follicles, B lymphocyte marker B220 and T lymphocyte marker CD3 can be used (Fig. 10.2). For GC B lymphocyte markers, the antibody GL7 and the PNA lectin (Kraal et al., 1982), which binds to the unsialylated core 1 O-glycan (Sastry et al., 1986), are often used. The FDCM-1 antibody is also useful for GC analysis as it detects mature follicular dendritic cells that trap and retain antigens for stimulation of GC B cell proliferation and differentiation. In addition, CD68 is also a useful marker as it identifies tingible-body macrophages (TMBs), which are specifically localized in GCs and clear apoptotic cells by phagocytosis. Both size and frequency of CD68-positive TMBs in ppGalNAcT-1 GCs were increased (Fig. 10.3), suggesting increased GC B cell apoptosis. Methods for apoptosis detection are described in the following section.
5. Apoptosis Detection Using Antibody Against Caspase 3 Active Form One of the biochemical features of apoptotic cells is an increased caspase 3 active form. Caspase 3 ubiquitously exists in the inactive form in cells and is activated by proteolysis in cells that are undergoing apoptosis.
180
Mari Tenno
WT
Δ/Δ
WT
Δ/Δ
Δ/Δ
WT
Δ/Δ
FDCM1 B220 Merged
GL7
Merged
B220 Merged PNA Merged
GL7
B
WT GL7
CD3
A
Figure 10.2 Histological analyses of germinal center in spleen. (A) GC B cells in the spleen were analyzed in situ 14 days postimmunization with DNP-KLH. T (CD3þ) and B (B220þ) cell zones remained intact and follicular dendritic cells (FDCM1þ) were present at normal levels. (B) GC markers included GL7 antibody binding among B220þ B cells, while PNA binding to GC O-glycans was decreased by ppGalNAcT-1 deficiency. Images are magnified 400. The results shown are representative of data obtained from the analyses of 3–6 littermates of the indicated genotypes. Partly taken from Tenno et al. (2007).
The activated caspase 3 cleaves downstream targets and irreversibly commits cells to their apoptotic fate. Therefore, the antibody against cleaved caspase 3 specifically stains apoptotic cells without staining nonapoptotic cells. 1. The sections are prepared as described previously and fixed in 4% paraformaldehyde in PBS for 15 min. 2. After three washes with PBS, the slides are permeabilized with 0.1% Triton X-100 in PBS for 10 min at room temperature and washed with PBS three times for 10 min each. 3. The slides are blocked with 5% BSA in PBS for 30 min and stained with anti-caspase 3 active form (Pharmingen), biotinylated anti-CD68 (Serotec), and FITC-conjugated anti-GL7 (Pharmingen) in 5% BSA in PBS for 1 h at room temperature.
A CD68
GL7
caspase3
CD68/caspase3
CD68/GL7
GL7/caspase3
CD68
GL7
TUNEL
CD68/TUNEL
CD68/GL7
GL7/TUNEL
Δ/Δ
WT
CD68/GL7/caspase3
B
Δ/Δ
WT
CD68/GL7/TUNEL
Figure 10.3 Detection of germinal center B lymphocyte apoptosis. Increased apoptosis of GC B lymphocytes occurs in ppGalNAcT-1 deficiency as shown using activated caspase 3 antibody (A) and TUNEL assay (B) accomplished 14 days postimmunization with DNP-KLH. CD68 in GCs identifies TMBs that have increased in size due to phagocytosis of GL7-positive GC B cells that are undergoing apoptosis. The results shown are representative of data obtained from the analyses of 3–6 littermates of the indicated genotypes. Partly taken from Tenno et al. (2007).
182
Mari Tenno
4. The sections are washed with PBS three times for 10 min each and incubated with streptavidin–Cy5 and goat anti-rabbit rhodamineconjugated secondary antibody in 5% BSA in PBS for 1 h at room temperature. 5. After three washes with PBS for 10 min each, a drop of antifade mounting solution is added to the tissue and a glass cover slip is placed over the slides. The slides are air-dried for 1 h at room temperature and analyzed under a fluorescence microscope.
6. Apoptosis Detection by TUNEL System Sometimes, more than one method is required to confirm cell death by apoptosis. This section describes the TUNEL system in which fluorescein-12-dUTP is incorporated into DNA strand breaks in the nucleus of an apoptotic cell by dTd enzyme. One of the critical points of the TUNEL system is the permeabilization step to ensure the access of dTd enzyme to the nucleus. In the following method, a short proteinase K digestion at 37 C is used. However, as some tissues are sensitive to the proteinase K digestion, this procedure may sometimes abrogate tissue morphology. Therefore, the optimal proteinase K concentration and incubation time should be determined for each sample. If the target tissues are sensitive to the proteinase K digestion, more diluted proteinase K or 0.1% Triton X-100 in PBS can be used as an alternate. As negative control, a control incubation buffer without dTd enzyme can be prepared. In order to confirm nuclear-specific fluorescein-12-dUTP labeling and unwanted background staining, DAPI or Hoechst 33342 can be used for counterstaining. 1. The sections are prepared as described previously and fixed in 4% paraformaldehyde in PBS for 15 min at room temperature. 2. After three washes with PBS for 10 min each, the slides are permeabilized with 20 g/ml proteinase K solution in PBS for 10 min at 37 C and washed three times with PBS for 10 min each at room temperature. 3. The permeabilized slides are re-fixed in 4% paraformaldehyde in PBS for 5 min and washed three times with PBS for 10 min each at room temperature. 4. The slides are pre-equilibrated with commercial equilibration buffer (Promega) for 10 min at room temperature. Then, the slides are incubated in a TdT reaction mixture (Promega) to label DNA strand breaks with fluorescein-12-dUTP for 60 min at 37 C in a humid chamber in the dark. 5. To stop the reaction, the slides are immersed in 2 SSC for 15 min and washed three times with PBS for 5 min each at room temperature.
ppGalNAcT1-Function in Humoral Immunity
183
6. The slides are blocked with 5% BSA in PBS for 30 min and stained with anti-CD68 (Serotec) and anti-GL7 (Pharmingen) in 5% BSA in PBS for 1 h at room temperature. 7. The slides are washed with PBS three times and an antifade mounting solution is mounted. The slides are analyzed under a fluorescence microscope. Figure 10.3 shows GC apoptosis of wild-type and ppGalNAcT-1deficient mice using the preceding method. The ppGalNAcT-1-deficient mice showed increased GC B cell apoptosis 14 days postimmunization with DNP-KLH. In addition, both size and frequency of CD68-positive TMBs in ppGalNAcT-1 GCs were increased due to phagocytosis of the GL7positive apoptotic cells. The increased GC B cell apoptosis in ppGalNAcT1-deficient mice leads to reductions in plasma B cell number and IgG level (Tenno et al., 2007). The analysis of ppGalNAcT-1-deficient mice enables us to understand the roles of this enzyme in humoral immune response.
ACKNOWLEDGMENT This work was supported by the Kurata Memorial Hitachi Science and Technology Foundation Grant.
REFERENCES Barbieri, A. M., et al. (2007). Two novel nonsense mutations in GALNT3 gene are responsible for familial tumoral calcinosis. J. Hum. Genet. 52, 464–468. Brockhausen, I. (2000). O-Linked chain glycosyltransferases. Methods Mol. Biol. 125, 273–293. Cheng, L., et al. (2004). Characterization of a novel human UDP-GalNAc transferase, pp-GalNAc-T15. FEBS Lett. 566, 17–24. Elhammer, A., and Kornfeld, S. (1986). Purification and characterization of UDP-N-acetylgalactosamine: Polypeptide N-acetylgalactosaminyltransferase from bovine colostrum and murine lymphoma BW5147 cells. J. Biol. Chem. 261, 5249–5255. Hagen, F. K., et al. (1993). Purification, cloning, and expression of a bovine UDP-GalNAc: Polypeptide N-acetyl-galactosaminyltransferase. J. Biol. Chem. 268, 18960–18965. Hennet, T., et al. (1995). T-cell-specific deletion of a polypeptide N-acetylgalactosaminyltransferase gene by site-directed recombination. Proc. Natl. Acad. Sci. USA 92, 12070–12074. Homa, F. L., et al. (1993). Isolation and expression of a cDNA clone encoding a bovine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem. 268, 12609–12616. Ichikawa, S., et al. (2005). A novel GALNT3 mutation in a pseudoautosomal dominant form of tumoral calcinosis: Evidence that the disorder is autosomal recessive. J. Clin. Endocrinol. Metab. 90, 2420–2423.
184
Mari Tenno
Ichikawa, S., et al. (2009). Ablation of the Galnt3 gene leads to low-circulating intact fibroblast growth factor 23 (Fgf23) concentrations and hyperphosphatemia despite increased Fgf23 expression. Endocrinology 150, 2543–2550. Kato, K., et al. (2006). Polypeptide GalNAc-transferase T3 and familial tumoral calcinosis. Secretion of fibroblast growth factor 23 requires O-glycosylation. J. Biol. Chem. 281, 18370–18377. Kingsley, P. D., et al. (2000). Diverse spatial expression patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyl-transferase family member mRNAs during mouse development. Glycobiology 10, 1317–1323. Kraal, G., et al. (1982). Germinal centre B cells: Antigen specificity and changes in heavy chain class expression. Nature 298, 377–379. McGuire, E. J., and Roseman, S. (1967). Enzymatic synthesis of the protein-hexosamine linkage in sheep submaxillary mucin. J. Biol. Chem. 242, 3745–3747. Ohtsubo, K., and Marth, J. D. (2006). Glycosylation in cellular mechanisms of health and disease. Cell 126, 855–867. Sastry, M. V., et al. (1986). Analysis of saccharide binding to Artocarpus integrifolia lectin reveals specific recognition of T-antigen (beta-D-Gal(1–3)D-GalNAc). J. Biol. Chem. 261, 11726–11733. Schachter, H., and Brockhausen, I. (1989). The biosynthesis of branched O-glycans. Symp. Soc. Exp. Biol. 43, 1–26. Ten Hagen, K. G., et al. (2003). All in the family: The UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases. Glycobiology 13, 1R–16R. Tenno, M., et al. (2007). Initiation of protein O-glycosylation by the polypeptide GalNAcT1 in vascular biology and humoral immunity. Mol. Cell. Biol. 27, 8783–8796. Topaz, O., et al. (2004). Mutations in GALNT3, encoding a protein involved in O-linked glycosylation, cause familial tumoral calcinosis. Nat. Genet. 36, 579–581. Van den Steen, P., et al. (1998). Concepts and principles of O-linked glycosylation. Crit. Rev. Biochem. Mol. Biol. 33, 151–208. Wang, Y., et al. (1992). Purification and characterization of a UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase specific for glycosylation of threonine residues. J. Biol. Chem. 267, 12709–12716. Young, W. W., Jr., et al. (2003). Expression of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase isoforms in murine tissues determined by real-time PCR: A new view of a large family. Glycobiology 13, 549–557. Zhang, Y., et al. (2003). Cloning and characterization of a new human UDP-N-acetyl-alpha-Dgalactosamine:polypeptide N-acetylgalactosaminyltransferase, designated pp-GalNAc-T13, that is specifically expressed in neurons and synthesizes GalNAc alpha-serine/threonine antigen. J. Biol. Chem. 278, 573–584.
C H A P T E R
E L E V E N
b3GnT2 (B3GNT2), a Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice Akira Togayachi, Yuko Kozono, Atsushi Kuno, Takashi Ohkura, Takashi Sato, Jun Hirabayashi, Yuzuru Ikehara, and Hisashi Narimatsu Contents 1. Overview 2. Glycogenes for Polylactosamine Synthesis (i.e., b1,3-N-Acetylglucosaminyltransferase Genes) 3. N-Glycan Polylactosamine is Greatly Reduced in B3gnt2/ Mice 4. Phenotype of B3gnt2/ Lymphocytes Lacking Polylactosamine on N-Glycans 5. Protocols 5.1. Generation of B3gnt2/ mice 5.2. Genotyping of B3gnt2-deficient (B3gnt2/) mice 5.3. b3GnT In vitro assays 5.4. LEL Lectin-blot analysis 5.5. Metabolic labeling of costimulated T cells 5.6. Flow cytometric analysis 5.7. Immunoprecipitation and lectin microarray analysis of immunoprecipitated glycoproteins 5.8. Calcium flux analysis 5.9. Lymphocyte isolation and proliferation assays Acknowledgments References
186 186 187 193 197 197 197 198 199 200 200 200 201 201 202 202
Abstract The polylactosamine structure is a fundamental structure of carbohydrate chains and carries a lot of biofunctional carbohydrate epitopes. To investigate the biological function of polylactosamine chains, here we generated and analyzed knockout mice lacking the gene B3gnt2, which encodes a major polylactosamine Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79011-X
#
2010 Elsevier Inc. All rights reserved.
185
186
Akira Togayachi et al.
synthase. In b1,3-N-acetylglucosaminyltransferase (B3gnt2) B3gnt2-deficient (B3gnt2/) mice, the number of polylactosamine structures was markedly lower than in wild-type mice. Flow cytometry, LEL lectin-blotting, and glycan analysis by metabolic labeling demonstrated that the amount of polylactosamine chains on N-glycans was greatly reduced in the tissues of B3gnt2/ mice. We examined whether immunological abnormalities were present in B3gnt2/ mice. We screened polylactosamine-carrying molecules of wild-type mice by lectin microarray analysis and found that polylactosamine was present on CD28 and CD19, two established immune co-stimulatory molecules. Polylactosamine levels on these molecules were lower in B3gnt2/ mice than in wild-type mice. B3gnt2/ T cells were more sensitive to the induction of intracellular Ca2þ flux on stimulation with anti-CD3e/CD28 antibodies and proliferated more strongly than wild-type T cells. B3gnt2/ B cells also showed hyperproliferation on BCR stimulation. These results showed that hyperactivation of lymphocytes occurred due to a lack of polylactosamine on receptor molecules in B3gnt2/ mice. This finding indicates that polylactosamine has an important role in immunological biofunctions. We can therefore attempt to identify the in vivo biological function of glycans using glycogene-deficient mice.
1. Overview Some carbohydrate structures are known to participate in vital processes, such as carbohydrates on molecules responsible for cell–cell, receptor–ligand, and carbohydrate–carbohydrate interactions. Polylactosamine is carried on N- and O-glycans and glycolipids. Polylactosamine structures are considered to be integral components serving as backbones for the carbohydrate structures. Polylactosamine contains repeats of the N-acetyllactosamine (LacNAc) unit (Gal[galactose]b1-4GlcNAc[N-acetylglucosamine]b1–3)n structure. Polylactosamine chains are further modified by the addition of different carbohydrate antigens such as blood group antigens (e.g., Lewis blood group antigens including sialyl Lewis X antigen, and I/i-type blood group antigen). Selectin ligands are known to consist of a combination of sialyl and fucosyl residues with a polylactosamine backbone on core 2 O-glycans (Fukuda et al., 1999; Lowe et al., 1990). It is thought that polylactosamine has an important role in biological functions.
2. Glycogenes for Polylactosamine Synthesis (i.e., b1,3-N-Acetylglucosaminyltransferase Genes) Polylactosamine is coordinately synthesized by the alternate actions of a b1,4-galactosyltransferase (b4GalT) and a b1,3-N-acetylglucosaminyltransferase (b3GnT). The first b3GnT, iGnT, was isolated by an expression
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
187
cloning method (Sasaki et al., 1997). Seven additional b3GnTs, b3GnT2 to b3GnT8, have been subsequently identified on the basis of structural similarity to the b1,3-glycosyltransferase conserved motif (Fig. 11.1) (Hiruma et al., 2004; Ishida et al., 2005; Isshiki et al., 1999; Iwai et al., 2002; Iwai et al., 2005; Narimatsu, 2004; Seko and Yamashita, 2004; Shiraishi et al., 2001; Togayachi et al., 2001; Zhou et al., 1999). In addition, iGnT is also referred to as b3GnT or b3GnT1. Therefore, the official nomenclature is used for this gene in the present study, namely B3GNT2 (B3gnt2 in mouse). Each b3GnT synthesizes a different glycan structure, as shown in Fig. 11.2. b3GnT2 to b3GnT5 can catalyze the initiation and elongation of polylactosamine chains (Fig. 11.3). They exhibit different substrate specificity depending on the length of the polylactosamine chain. b3GnT2 possesses the strongest polylactosamine synthesis activity on oligosaccharide substrates in vitro, whereas b3GnT3 to b3GnT8 (except b3GnT6) show very weak activity (Ishida et al., 2005; Seko and Yamashita, 2004; Shiraishi et al., 2001; Togayachi et al., 2001). b3GnT2 has been found to have strong activity in vitro toward oligosaccharide substrates with polylactosamine structures. In addition, b3GnT2 also exhibits strong activity toward tetraantennary N-glycans. These in vitro assay results suggest that b3GnT2 is the main polylactosamine synthase. Thus, we considered that b3GnT2 is the most probable main candidate for the in vivo synthesis of polylactosamine in the body. It is still unclear how the multiple b3GnTs differentially function in polylactosamine synthesis in vivo. In addition, the length of polylactosamine chains on N-glycans and O-glycans in mouse hematocytes is not known in detail. In order to clarify the role and biological functions of polylactosamine chains on immunologically relevant sites, here we generated and analyzed B3gnt2 gene-deficient (B3gnt2/) mice, which lack the most active polylactosamine synthase (Fig. 11.4) (Togayachi et al., 2007).
3. N-Glycan Polylactosamine is Greatly Reduced in B3gnt2/ Mice The lectin Lycopersicon esculentum (tomato) agglutinin (LEL) is known to bind to polylactosamines with at least three repeated lactosamine units (Leppanen et al., 2005; Nachbar et al., 1980). We therefore examined the expression of polylactosamine on the cell surface of splenic lymphocytes in B3gnt2/ mice using LEL (Fig. 11.5A and B). We found that the amount of polylactosamine chains on the cell surface of splenocytes and thymocytes was decreased in B3gnt2/ mice. LEL-blots of splenocytes of wild-type (WT) mice showed strongly stained, smeared bands, indicating that these cells contain many different glycoproteins bearing polylactosamine chains (Fig. 11.5C). In contrast, the intensity of LEL-reactive bands in B3gnt2/
188
Akira Togayachi et al.
A b 3GT motif
Transmembrane domain
Motif 1
Motif 2
(I/L)R××WG
B
Motif 3
(E/D)D(A/V)(Y/F)×G×C/S (F/Y)(V/L/M)×××DXD
Genes
Reaction products
MFNG RFNG
O-Fucose of EGF repeat
LFNG b 3GlcT
O-Fucose of TSR1
C1GalT1
Core1 O-glycan
ChSy CSS3 CSGlcAT
Chondroitin sulfate (CS) synthesis
CSS2/ChPF b 3GalT6 ▲ b 3GalNAcT2 b3GalT4 b 3GnT5 ▲ b3GalNAcT1
GAG linkage GalNAcb1-3GlcNAc-R GD1b/GM1/GA1 Lc3Cer Globoside(Gb4)
b 3GalT5
CA19-9/SSEA3
b 3GalT1
Type I chain
b 3GalT2
Type I chain
b 3GnT4
Polylactosamine
b 3GnT2
Polylactosamine
b 3GnT7
Keratan sulfate
b 3GnT3
Core1 O-glycan elongation
b 3GnT6
Core3 O-glycan
b 3GnT8
Polylactosamine
Figure 11.1 Phylogenetic tree of glycosyltransferases transferring sugars with a b1,3-linkage and their substrate specificities. (A) Glycosyltransferase genes of the b1,3-glycosyltransferase (b3GT) family contain three conserved b3GT motifs in their amino acid sequence. (B) A phylogenetic tree of human b3GTs was constructed with ClustalW on the basis of amino acid sequence. The reaction products of each enzyme are shown on the right. Symbols are: circle, b1,3-galactosyltransferase family; closed circle, b1,3-N-acetlglucosaminyltransferase family; closed triangle, b1,3-N-acetlgalactominyltransferase family; square, b1,3-glucosyltransferase family; closed square, chondroitin sulfate synthase family.
mice was dramatically reduced in all three preparations, indicating that the polylactosamine chains on glycoproteins must be synthesized mainly by b3GnT2 in these cells. After digesting N-glycans with N-glycanase
Glycoprotein (N-glycan) (b 3GnT8) b4
b3 b4
b3 b4
b3 b4
b4
b3 b4
b3 b4
b3 b4
b 3GnT2
b4 b4
LEL epitope
Tetraantennary N-glycan
b6 b2 a6 b4 b4 a3
b4
b
Asn
b4 b3 b4 b3 b4 b3 b4
i antigen (polylactosamine)
b4 b3 b4 b3 b4 b3 b4 b6
b2
b6
b6
I antigen (branched) IGnTs
Glycoprotein (O-glycan) b 3GnT3
b4 b3 b4 b3 b4
b3 b3
a
b3
a
b3 b4
b3 b4
b
b3 b4
b3 b4
b
b 3GnT6
b4 b3 b4 b3 b4
Ser/Thr
Ser/Thr
b6 b3 a
Core 1 O-glycan Core 3 O-glycan
b 3GnT1? b 3GnT2? b 3GnT4?
Ser/Thr
Core 2 O-glycan
Glycolipid b 3GnT5
b4 b3 b4
Ceramide Lacto/neolacto-series glycolipids
Glycosaminoglycan b 3GnT7 Glc
Fuc
b4 b3 b4
S Man
Gal
S
R Keratan sulfate
S GalNAc
GlcNAc
GlcNAc transferred by each b 3GnT
NeuAc S sulfate
Figure 11.2 Glycan structures synthesized by each b3GnT. Representative glycan structures are synthesized by each b3GnT. Predicted carbohydrate structures (LEL epitope) that are possibly lacking in B3gnt2/ mice are indicated by rectangles (gray). The LEL (tomato lectin)binding epitope consists of more than three repeated lactosamine units.
190
Akira Togayachi et al.
Relative activity (%) Substrate (2AB-sugar) b 3GnT2 b 3GnT3 b 3GnT4 b 3GnT5 100.0
1.2
ND
26.9
3LN
95.9
1.9
ND
32.7
4LN
96.5
1.1
ND
4.1
5LN
90.5
2.7
ND
5.1
2LN
Polylactosamine (poly-N-acetyllactosamine, i antigen)
Substrate (PA-sugar)
Relative activity (%) b 3GnT2 b 3GnT8 79.5
ND
90.2
ND
100
14.7
73.2
ND
88.4
ND
99.1
8.9
ND
ND
LN (lactosamine units) 2AB 4LN 5LN
3LN
2LN
ND: Not detected
Figure 11.3 In vitro assays for b3GnT activities toward oligosaccharides with related polylactosamine structures and N-glycan structures. Shown are the relative activities of four recombinant human b3GnTs, which were produced as truncated forms of a fusion protein with the FLAG peptide in a baculovirus expression system, toward oligosaccharides (Ishida et al., 2005; Shiraishi et al., 2001; Togayachi et al., 2001). Recombinant b3GnT2 was again the strongest among all combinations of enzyme and substrate; as a result, its activity is taken to be 100%, and the activities of the other combinations are expressed relative to this value in the Table. Polylactosamine is a unique glycan with Nacetyllactosamine (LN) repeats. b3GnT2 to b3GnT5 can catalyze the initiation and elongation of polylactosamine chains. They exhibit different substrate specificity depending on the length of the polylactosamine chain. b3GnT2 is found to have strongest activity in vitro against oligosaccharide substrates with polylactosamine structures (left-hand Table). b3GnT2 also exhibits strong activity toward tetraantennary N-glycans (right-hand Table). Various oligosccharides were fluorescently labeled with 2-aminobenzamide (2AB) or pyridylaminated (PA) and used for acceptors.
F (PNGase F), the LEL-positive bands in the tissues of WT mice almost completely disappeared, which strongly suggests that polylactosamine chains with more than three repeating units are attached mainly to N-glycans. In order to examine the N-glycan structures in B3gnt2/ mice, splenic T cells stimulated with immobilized anti-CD3e antibody and costimulated with anti-CD28 antibody were metabolically labeled with [3H]-glucosamine. N-Glycans were then analyzed by Bio-Gel P-4 gel permeation chromatography. In Fig. 11.5D, standard tetraantennary N-glycan is eluted,
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
A
19888885
19888821
19888785
B3gnt2 promoter Exon 1
191
Mouse Chr.11 (NW_000035.1)
19888762 19881402 WT-F3
B3gnt2 ORF 19865340 19864099 Exon 2
19880914 WT-R3
pA
Gene trapping vector LTR
SA IRES b-geo pA
PGK
puro
SD LTR
Stop
Marker fusion transcript
KO-LTR
Knock out fusion transcript X Stop codon
Exon ORF B3gnt2 promoter Poly A signal Long terminal repeat Splice acceptor sequence X Stop codon
Splice donor sequence Internal rebosome entry site b-geo; galactosidase/neomycin phosphotransferase fusion protein Phosphoglycerate kinase-1 promoter Puromycin
−/
t2 gn B3
gn B3
W
T
t2
+/
−
−
B
401 bp 241 bp
Figure 11.4 Genomic localization of gene trapping vector in B3gnt2/ mice. (A) Schematic representation of the B3gnt2 targeting strategy. The gene-trapping vector, which is inserted 15,574-bps upstream from exon 2, provides a marker fusion transcript that contains the B3gnt2 exon 1–IRES b-geo fusion gene, and the OST fusion transcript that contains the puro–B3gnt2 exon 2 fusion gene. (B) Wild-type allele for the B3gnt2 gene amplified as a 401-bp fragment by genotyping PCR, and targeted allele for the B3gnt2 gene amplified as a 241-bp fragment. WT, wild-type; B3gnt2þ/–, heterozygous; B3gnt2/, homozygous null.
as indicated, in fraction S4. N-Glycans with higher molecular weights than standard tetraantennary N-glycan, which eluted in the range indicated as ‘‘R’’, were markedly reduced in the sample from B3gnt2/ mice. These higher molecular weight fractions contained N-glycans with polylactosamine, whereas those corresponding to tri- and tetraantennary
192
Akira Togayachi et al.
B
−
100 80 60 40 20 0 100 101 102 103 104 LEL
24 22 20 18 1716 1514 13 12 11 10 9
W T B3 gn t2 W T B3 gn t2
−/
D
Splenic B cells
−
PNGase F digestion
C
B3gnt2 −/− WT Control
% of max
Splenic T cells 100 80 60 40 20 0 100 101 102 103 104 LEL
−/
% of max
A
S4
S3
S2 M9M8M7 M6 M5
100
*
75
*
50
Radioactivity
250 160
35 R
(kDa)
WT B3gnt2 −/−
LEL LEL
PNGase F
40
(peptide N-glycanase F)
50
80 60 70 Elution volume (ml)
90
100
Asn
Figure 11.5 Decreased numbers of polylactosamine repeating units on B3gnt2/ N-glycan oligosaccharides. Flow cytometric analysis of splenic T cells (A) and splenic B cells (B) demonstrated a decrease in polylactosamine expression on the cell surface. Isolated splenic T cells and B cells were stained with FITC-LEL. (C) Decreased numbers of polylactosamine repeating units on B3gnt2/ N-glycan oligosaccharides. Lysates of splenocytes were incubated in the absence or presence of N-glycanase F (PNGase F) overnight and subjected to SDS-PAGE. LEL-blots for polylactosamine are shown. Biotinylated LEL was used as a probe. *Nonspecific bands stained by avidinHRP as the secondary probe. WT, wild-type; B3gnt2/, homozygous null, (D) BioGel P-4 column chromatography of desialylated N-glycans derived from stimulated T cells of wild-type (bold line) and B3gnt2/ mice (solid line). Arrows numbered 9–24 indicate the elution positions of glucose oligomers; the numbers indicate glucose units. Arrows labeled M5-9 and S2-4 indicate the elution positions of the standard oligosaccharides, Man5-9 GlcNAcGlcNAcOT and (GalGlcNAc)2-4Man3 GlcNAcGlcNAcOT, respectively. Arrows labeled R indicate the elution range of oligosaccharides speculated to bear polylactosamine repeating units. WT, wild-type; B3gnt2/, homozygous null.
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
193
complex N-glycans without polylactosamine, as indicated by S3 and S4, were relatively increased in B3gnt2/ mice.
4. Phenotype of B3gnt2/ Lymphocytes Lacking Polylactosamine on N-Glycans WT mouse T cells and B cells express B3gnt2 transcripts at high levels. First, to investigate whether there was aberrant distribution of cell subpopulations or aberrant cell development of immunocytes in B3gnt2/ mice, we analyzed the cell surface expression of CD antigens such as CD3e, CD4, CD8a, CD11a, CD11b, CD11c, CD19, CD45, CD45R/B220, CD62L, TER-119, Gr-1 (Ly-6C/G) and F4/80 by flow cytometry. No significant disturbance in the ratios of cell populations, such as T cells, B cells, monocytes, or granulocytes, was observed in peripheral blood between WT and B3gnt2/ mice. In addition, there was also no difference in the distribution of T and B cell subpopulations in splenocytes or thymocytes. Thus, B3gnt2 deficiency did not influence thymocyte development, and thus reduced polylactosamine does not affect T or B cell development. Next, we predicted that these cells lack polylactosamine chains on N-glycans on their cell surface glycoproteins. We tried to identify cell surface proteins carrying polylactosamine by using lectin microarray analysis (Fig. 11.6). The lectin microarray has been developed (see Chapter by Kuno et al.). In this system, 42 lectins are bound on the lectin microarray (Kuno et al., 2005), and we can profile a carbohydrate structure by the intensity pattern of a fluorescently labeled sample. Polylactosamine is identified by LEL signals. For example, we can obtain LEL signals for polylactosaminecarrying proteins derived from WT mice; however, we cannot get signals for those derived from B3gnt2/ mice, because of the loss of polylactosamine chains (Fig. 11.6). Thus, we examined which cell surface molecules are the polylactosamine-carrier protein by using immunoprecipitation and lectin microarray analysis. We profiled the carbohydrate structure of many CD antigens on the lymphocyte cell surface. In these results (Fig. 11.7), we found that WT CD28 and CD19 molecules have LEL-reactive polylactosamine chains on their N-glycans, and CD28 and CD19 are present on the cell surface of T cells and B cells, respectively. Both proteins have potential N-glycosylation sites. Immunoprecipitates of B3gnt2/ CD28 or CD19 molecules exhibited a loss of LEL signals on the lectin microarray (Fig. 11.7). However, DSA signals showed no difference between WT and B3gnt2/ proteins. DSA recognizes the N-glycan core structure, as shown in Fig. 11.7. The mobility of CD28 and CD19 on SDS-PAGE differed between WT and B3gnt2/ cells. From these results, we concluded that CD28 and CD19
194
Akira Togayachi et al.
Wild-type proteins
B3gnt2-/- proteins
Polylactosamine
Lectin array (layout) Polylactosamine
LEL RCA/DSA Lectin
LEL RCA/DSA Lectin
1. LTL
29. Jacalin
2. PSA
17. NPA
30. PNA
3. LCA
18. ConA
31. WFA
4. UEA I
19. GNA
32. ACA
5. AOL
20. HHL
33. MPA
6. AAL
34. HPA
7. MAL
Biotin Streptavidin-Cy3
Antibody recognizing core protein (IP)
Immunoprecipitation of target protein Lectin microarray
LEL blotting
Western brotting
35. VVA
8. SNA
21. BPL
36. DBA
9. SSA
22. TJA-II
37. SBA
10. TJA-I
23. EEL
38. GSL I
11. PHA(L)
24. ABA
39. PTL I
12. ECA
25. LEL
40. MAH
13. RCA120 26. STL
41. WGA
14. PHA(E)
27. UDA
42. GSL I A4
15. DSA
28. PWM
Polylactosamine signal
Figure 11.6 Analysis of cell surface proteins. Cell surface immunoprecipitated proteins were analyzed using lectin microarrays. Surface proteins of isolated T or B cells were labeled with biotin, and target proteins were immunoprecipitated with antibody. To visualize the native glycans on cell surface proteins, interactions of the target protein with the lectins immobilized on glass slides were analyzed. Briefly, immunoprecipitated protein was released and then applied to a lectin array containing triplicate spots of 42 lectins. The glass slide was scanned by an evanescent-field fluorescence scanner, SCProfiler (GP Biosciences Ltd., Yokohama, Japan). Polylactosamine was identified by LEL signals. Glycoproteins derived from wild-type mice give LEL signals for polylactosamine-carrying proteins. By contrast, there were no LEL signals on glycoproteins from B3gnt2/ mice, indicating a loss of polylactosamine chains. WT, wild-type; B3gnt2/, homozygous null.
molecules carry LEL-detectable polylactosamine. These findings indicate that the N-glycan core is unaltered and only polylactosamine chains on Nglycans are decreased in B3gnt2/ mice. Furthermore, we concluded that b3GnT2 is involved in polylactosamine synthesis. CD28 and CD19 molecules are known as co-stimulatory molecules in T cells and B cells, respectively. CD28 and CD19 both regulate major immune system signaling, such as T cell receptor and B cell receptor signaling. We think that many proteins, in addition to CD28 and CD19, carry LEL-reactive polylactosamine chains. Moreover, immunoprecipitation with LEL demonstrated that the amount of immunoprecipitated CD28 or CD19 molecules was significantly smaller in B3gnt2/ than in WT lymphocytes. We considered that this reduction was caused by a lack of polylactosmaine chains on B3gnt2/ molecules. Nevertheless, it is noteworthy that polylactosamine was found on two co-stimulatory accessory molecules that have similar functions.
195
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
CD28
CD19
Lectin microarray analsysis
Lectin microarray analsysis WT B3gnt2−/−
B3gnt2−/−
WT LEL
LEL
DSA
DSA
Western blotting
Western blotting
LEL t2 − / gn B3
T
T
B3
W
160
50 Blot: CD19
Blot: CD28
gn
t2 − /
−
−
−
t2 − / gn
T W
B3
t2 − / gn
T
B3
W
IP: CD19
LEL
W
CD28 −
IP:
35 (kDa)
105 (kDa)
Polylactosamine LEL binding Asn
DSA binding
Figure 11.7 Polylactosamine on N-glycans of CD28 and CD19 molecules in B3gnt2/ lymphocytes is diminished. The immunoprecipitates of wild-type CD28 and CD19 molecules were found to have LEL-reactive polylactosamine chains on their N-glycans; however, the immunoprecipitates of B3gnt2/ CD28 or CD19 molecules exhibited a loss of LEL signals on the lectin microarray. By contrast, DSA signals showed no difference between wild-type and B3gnt2/ mice. DSA recognizes the N-glycan core structure. For Western blotting, immunoprecipitation was carried out with anti-CD28 monoclonal antibody (left-hand panel) or LEL-agarose (right-hand panel). The same volume of each extract from wild-type and B3gnt2/ cells was subjected to Western blot analysis. The mobility of immunoprecipitated CD28 and CD19 on SDS-PAGE differed between wild-type and B3gnt2/ cells. In addition, these molecules were only marginally detected in LEL-agarose immunoprecipitates from B3gnt2/ mice. These results indicate that the N-glycan core shows no alteration and only the amount of polylactosamine chains on the N-glycans is decreased in B3gnt2/ mice. WT, wild-type; B3gnt2/, homozygous null.
Because polylactosamine chains on these signaling molecules were decreased, we next analyzed the phenotypes of B3gnt2/ T cells and B cells. First, in splenic T cells, we observed an initial transient peak of calcium influx within a few minutes of TCR and CD28 cross-linking (Fig. 11.8A). This response was essentially identical in WT and B3gnt2/ T cells. Thereafter, it decreased more slowly to basal levels in B3gnt2/ T cells than in WT cells. This observation suggests that the reduction in
196
Akira Togayachi et al.
Calcium influx analysis (T cells)
0.5
Stimulation
B3gnt2−/−
0.4 0.3
WT
0.2 0
100
[3H]-TdR uptake (×104 cpm)
B TCR stimulation (T cell proliferation) 5
Day 2
4
2 0
+/+ WT 0
EGTA 400
500
C BCR stimulation (B cell proliferation) 14
-/-−/− B3gnt2
3 1
200 300 Time (s)
0.5 1 1.5 2 2.5 Anti-CD3e (mg/ml) + Anti-CD28 (750 ng/ml)
[3H]-TdR uptake (×103 cpm)
Calcium influx (Fluo-3/Fura Red ratio)
A
B3gnt2−/−
10 6
WT
2 0
0
Day 2 6 2 4 Anti-IgM (mg/ml)
Figure 11.8 Lymphocytes from B3gnt2/ mice are hypersensitive to stimulation via TCR/CD28 or BCR. (A) Intracellular calcium assays were used to compare the response of wild-type and B3gnt2/ T cells to anti-CD3/anti-CD28 stimulation. As shown in (A), after stimulation, calcium levels returned more slowly to the basal level in B3gnt2/ than in wild-type splenic T cells. (B) Investigation of CD3/CD28induced T cell proliferation. [3H]-thymidine uptake was measurable at day 2 in an antiCD3e antibody and anti-CD28 antibody dose-dependent manner in B3gnt2/ splenic T cells but not in wild-type T cells, which proliferated later. (C) Effect of polylactosamine-deficiency on B cell proliferation. Resting B cells were stimulated with anti-IgM and proliferation was assessed after 2 days. A greater proliferation of B3gnt2/ splenic cells than wild-type splenic B cells was observed with low concentrations of anti-IgM. WT, wild-type; B3gnt2/, homozygous null.
polylactosamine maintained prolonged calcium influx after TCR stimulation. As it is known that cell proliferation occurs after TCR stimulation, T cells were co-stimulated with anti-CD3 and anti-CD28 antibodies (Fig. 11.8B). WT T cells proliferated strongly at nearly day 3 after stimulation. However, the proliferation of B3gnt2/ T cells could be already observed at day 2 after stimulation. Thus, B3gnt2/ T cells showed proliferative hyper-responsiveness to T cell receptor signaling. B3gnt2/ B cells also exhibited hyperactivation (Fig. 11.8C). In summary, our studies show that lack of polylactosamine chains on N-glycans results in enhanced initiation of immune responses by T cells and
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
197
B cells. Thus, polylactosamine chains on glycoproteins are the important factors determining thresholds for immunocyte activation in vitro. These results indicate that polylactosamine on N-glycans is a putative immune regulatory factor.
5. Protocols 5.1. Generation of B3gnt2/ mice The official HGNC nomenclature for the gene that encodes the strongest polylactosamine synthase in the present study is B3GNT2 (B3gnt2). We generated B3gnt2/ mice by using the OmnibankTM (Lexicon Genetics Inc., The Woodlands, TX; Togayachi et al., 2007). The knockout mice were created using a random mutagenesis method based on gene trapping with the retroviral vector VICTR20 (Fig. 11.4). The sequence of the mouse B3gnt2 gene was used as a query to interrogate the OmnibankTM database. We found ES cells with the mutated B3gnt2 gene, tagged with the OST237555 nucleotide sequence, in OmnibankTM. The B3gnt2 gene is located on chromosome 11 (see accession number NW_000035.1) and the open reading frame starts in exon 2. The VICTR20 gene trapping vector, which is inserted into the intron region 15,574-bps upstream from exon 2, provides a marker fusion transcript that contains the B3gnt2 exon 1–IRES bgeo fusion gene, and the OST fusion transcript that contains the puro–B3gnt2 exon 2 fusion gene (Fig. 11.4).
5.2. Genotyping of B3gnt2-deficient (B3gnt2/) mice To confirm the generation of a null mutation at the B3gnt2/ locus, vector insertion in the B3gnt2/ gene was analyzed by PCR. For our experiment, B3gnt2þ/ mice were backcrossed onto C57BL/6N mice. Crossbreeding of the heterozygous mice resulted in the production of B3gnt2/ mice. For genotyping of B3gnt2/ mutant mice using tail biopsies, we extracted genomic DNA using a DNeasy Tissue KitTM (QIAGEN). Genotyping of mice or ES cells was performed by PCR with the following three primers: WT-F3 (50 -GTAGTGGAAAATTCAACCAAAGATGG-30 ) WT-R3 (50 -ACAGAAGACCCAACAGAACCTTGAGA-30 ) KO-LTR (50 -AAATGGCGTTACTTAAGCTAGCTTGC-30 ) We performed by PCR with LA-TaqTM (Takara Bio Inc.) or Go TaqTM (Promega).
198
Akira Togayachi et al.
PCR cycles 1 cycle
Temperature ( C) 95
Time 2 min.
45 cycles
95 60 72 72
30 sec. 1 min. 1.5 min. 5 min.
1 cycle
PCR step Preheating before PCR cycling For DNA denaturing For primer annealing For extension Extension for post-PCR cycling
WT-F3 and WT-R3 primers were expected to produce a 401-bp DNA fragment from the WT allele. The KO-LTR primer and WT-R3 primer were predicted to amplify a smaller 241-bp band from the knockout allele (Fig. 11.4).
5.3. b3GnT In vitro assays The b3GnT activity of recombinant b3GnT2 toward LNnT-PA was strongest among all combinations of the enzyme and the substrate (Ishida et al., 2005; Shiraishi et al., 2001; Togayachi et al., 2001). Oligosaccharide substrates with the polylactosamine structures, that is, repeats of units of lactosamine (Galb1-4GlcNAc; LN), were labeled with 2-aminobenzamide (2AB) and used as acceptor substrates (Togayachi et al., 2001). The 2LN, 3LN, 4LN, and 5LN labels in Fig. 11.3 indicate that each oligosaccharide had 2-, 3-, 4-, or 5-repeating lactosamine (LN) units, respectively. Recombinant b3GnT2 transferred a GlcNAc with almost the same level of activity to all polylactosamine substrates, regardless of the number of LN units. Recombinant b3GnT3 exhibited low, but apparently positive activity for all lengths of polylactosamine substrate. Recombinant b3GnT4 activity was hardly detected with the amount of recombinant protein used in the present study. Interestingly, recombinant b3GnT5 preferred shorter substrates, that is, 2LN-2AB and 3LN-2AB. The activity of b3GnT5 toward longer polylactosamine chains, 4LN-2AB and 5LN-2AB, was almost one-tenth of those toward shorter chains. Regarding the cell lysates used for in vitro assays of polylactosamine synthase, it is thought that the cell lysate (membrane fraction) as an enzyme source contains some of these b3GnTs, and endogenous b1,4-galactosyltransferases and fucosyltransferases. Detailed information on the assay of recombinant b3GnT activity was previously documented (Togayachi et al., 2006). 1. Substrates (a) For the b3GnT (polylactosamine synthase) assay including b3GnT2 activity, UDP-N-acetylglucosamine (UDP-GlcNAc) is used as a donor acceptor in the experiment. The donor substrates
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
199
UDP-GlcNAc were purchased from Sigma, Calbiochem, GE Healthcare Biosciences, or American Radiolabeled Chemicals, Inc. (b) For acceptor substrates, a carbohydrate structure including terminal Gal residues on the nonreducing end is used. For the major polylactosamine synthase, that is, b3GnT2 activity, a longer acceptor substrate such as a polylactosamine structure with at least more than two-repeated lactosamine structures (although a better substrate for polylactosamine synthase, b3GnT2, is a threerepeated lactosamine structure) is recommended, because the results of the in vitro assays in Fig. 11.3 show their enzymatic specificities. The various acceptor substrates, such as monosaccharides, oligosaccharides, glycolipids, glycopeptides, and glycoproteins, were purchased from Calbiochem (Merck, La Jolla, CA), Toronto Research Chemicals, Inc. (Ontario, Canada), Seikagaku Kogyo (Tokyo, Japan), Takara (Okaka, Japan), Glycotech (MD, USA), or Sigma. Oligosaccharides are fluorescently labeled with 2-aminobenzamide (2AB) or pyridylaminogroup (PA) and used as good acceptors for analysis using radioisotope (Scintillation counter), HPLC, and MS. Oligosaccharides are fluorescently labeled with nitrophenol (para-Np, ortho-Np) or benzene (Bz) and used as good acceptors for analysis using a radioisotope (Scintillation counter) and MS.
5.4. LEL Lectin-blot analysis 1. Splenocytes and thymocytes are solubilized with 20 mM HEPES buffer (pH 7.2), containing 2% Triton X-100, 150 mM NaCl2, and complete protease inhibitor cocktail (Roche), by brief sonication. 2. N-Glycan oligosaccharides are digested by peptide N-glycanase F, (PNGase F, Takara Bio Inc.), according to the supplier’s instruction manual. Polylactosamine chains synthesized by b3GnT2 are present mainly on N-glycans of glycoproteins. 3. Usually, 10 mg of cell (tissue)-homogenized proteins is sufficient for detection of polylactosamine on cell lysates. Proteins are separated by 10% SDS-PAGE and transferred to Immobilon P (Millipore). 4. The membrane is incubated with biotinylated tomato lectin (LEL, Vector laboratories) at room temperature for 1 h. 5. The membrane is then washed and incubated with streptavidin-HRP (Amersham) at room temperature for 1 h. 6. The membrane is washed, and then a chemical reagent such as ECL (GE Lifescience) or Wester Lightning (Perkin Elmer) is used to visualize LEL-bound proteins.
200
Akira Togayachi et al.
5.5. Metabolic labeling of costimulated T cells 1. Isolated T cells (2 106 cells/ml) are cultured with immobilized antiCD3e (1 mg/ml) and 750 ng/ml of anti-CD28 in multiple wells of 24-well plates for 66 h. 2. Next, the supernatant is replaced with RPMI1640 medium containing one-fifth of glucose with [3H]-glucosamine (1 Mbq/ml, American Radiolabeled Chemicals, Inc., St. Louis) and 5% of dialyzed FBS in 5% CO2. 3. Costimulated T cells are further cultured overnight and then harvested. After the cells are washed, cell homogenates are completely dried and subjected to hydrazinolysis at 100 C for 8 h as described (Takasaki et al., 1982). 4. After N-acetylation and Arthrobacter sialidase (Nacalai) digestion, oligosaccharides are analyzed with Bio-Gel P-4 column chromatography (<45 mm, 1.5 cm i.d. 100 cm long, Bio-Rad Laboratory) as described (Yamashita et al., 1982). Standard oligosaccharides, Gal2-4GlcNAc2-4 Man3 GlcNAc GlcNAcOT and Man9-5 GlcNAcGlcNAcOT are prepared from a1-acid glycoprotein and thyroglobulin, respectively, by hydrazinolysis followed by reduction with NaB3H4 and sialidase, and fucosidase digestion as described (Ito et al., 1977; Yoshima et al., 1981). 5. Radioactivity is determined with an Aloka LSC-6101 liquid scintillation spectrometer.
5.6. Flow cytometric analysis 1. Single-cell suspensions of splenocytes are prepared after erythrocyte lysis with PharM LyseTM (BD Pharmingen). 2. Splenocytes, thymocytes, and PEC are stained in 1% BSA, 0.1% NaN3PBS. The antibodies used for staining included CD19 (1D3), CD3e (145-2C11), CD4 (RM4-5), CD8a (53-6.7), CD14 (Sa2-8), CD11a (2D7), CD11b (M1/70), CD11c (HL3), CD45 (Ly-5: 30-F11), CD45R/B220 (RA3-6B2), CD62L (MEL-14), TER-119 (Ly-76: TER-119), Gr-1 (Ly-6C/G: RB6-8C5), F4/80 (BM8), and Rat IgG isotype control (purchased from either BD Pharmingen, eBioscience, or BioLegend). FITC-LEL was purchased from Vector laboratories. 3. Data are acquired using a FACS, such as FACSCalibur (Beckton Dickinson), and analyzed by either FlowJo Software (Tree Star, Inc.) or Cell Quest (Beckton Dickinson).
5.7. Immunoprecipitation and lectin microarray analysis of immunoprecipitated glycoproteins Cell surface immunoprecipitated proteins were analyzed using lectin microarrays. Lectin microarray analysis was performed in accordance with Kuno et al. (2005). To identify cell surface molecule carrying polylactosamine,
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
201
we screened molecules such as CD4, CD8a, and CD28 from WT T cells by lectin microarray analysis and found that the LEL-signal was decreased on immunoprecipitated CD28 in b3GnT2/ mice as compared to WT mice (Fig. 11.7). Similarly, it was found that the LEL signal was decreased on immunoprecipitated CD19. 1. (Optional) Surface proteins of isolated T or B cells are labeled with sulfoNHS-LC-biotin (Pierce Chemical Co.). The target protein is immunoprecipitated with antibody by a standard method. To confirm purification of the target protein, verification by Western blotting and protein staining (Coomassie Brilliant Blue staining or silver staining) is recommended. On lectin microarray analysis, other contaminated glycoproteins compete with target protein. 2. Immunoprecipitated protein is released and then applied to a lectin array containing triplicate spots of 42 lectins (Kuno et al., 2005). 3. In the case of a biotinylated protein, to visualize the glycans that are native to cell surface proteins, interactions of the biotinylated target protein with lectins immobilized on glass slides are detected by the Cy3-streptavidin method. In the case of nonbiotinylated immunoprecipitates, a fluorescently labeled antibody (probe) can also be used for detection. 4. The glass slide is scanned by an evanescent-field fluorescence scanner, such as GlycoStationTM (GP Biosciences Ltd., Yokohama, Japan).
5.8. Calcium flux analysis Intracellular calcium signaling was analyzed by the ratiometric Fluo-3/Fura Red combination method (Novak and Rabinovitch, 1994) as follows: 1. Cells are loaded with 4 mg/ml Fluo-3-AM and 10 mg/ml Fura-Red-AM (Invitrogen), in the presence of pluronic F127 detergent (Invitrogen, final concentration 0.02%) and 1 mM probenecid, for 30 min at 37 C. 2. The biotinylated anti-CD3e and anti-CD28 are incubated for 15 min on ice. Cells are warmed to 37 C for 10 min prior to use. 3. Calcium flux is measured using a FACSCalibur flow cytometer. After measuring the baseline calcium level for 55 s, streptavidin is added to cross-link the antibodies. The mean ratio of Fluo-3/Fura Red fluorescence is measured during the acquisition time course and expressed graphically by FlowJo software.
5.9. Lymphocyte isolation and proliferation assays 1. (Splenic) T cell isolation (a) Splenic erythrocytes are lysed with Guey’s solution. Single-cell suspensions are prepared from splenocytes and cells from inguinal, axillary, and mesenteric lymph nodes.
202
Akira Togayachi et al.
(b) T cells are isolated with a MACS Pan T cell Isolation kit (Miltenvi Biotec) at a purity of 93–98% CD3eþ cells. (c) T cells (2 106 cells/ml) are stimulated with immobilized antiCD3e (2C11) and soluble anti-CD28 (37.51) antibodies in complete RPMI-1640 medium supplemented with 10% FBS, 50 mM 2-mercaptoethanol, nonessential amino acids, HEPES, Na-pyruvate, and 1 mM L-glutamine, in 96-well flat-bottomed plates for 42–86 h. 2. Resting B cell isolation (a) Resting B cells (r ¼ 1.079) are isolated by a MACS B cell isolation kit, followed by a discontinuous Percoll (Pharmacia) gradient centrifugation. The purity of the population obtained is 95–98% B220þ cells. (b) Resting B cells (2 106 ml 1) are cultured with goat F(ab0 )2 anti-IgM (Southern Biotech) in the absence or presence of rIL-4 (>0.5 units/ng, PeproTech) for 42 h. 3. Cell proliferation assay (a) Cultures in triplicate are pulsed for the final 6–8 h with [3H]thymidine (0.25 mCi/well, American Radiolabeled Chemicals, Inc., St Louis) (b) Cell are harvested using a 96-well plate harvester. (c) The incorporated radioactivity is measured using a microplate beta 1450 counter (Wallac).
ACKNOWLEDGMENTS This work was performed as part of the R&D Project of the Industrial Science and Technology Frontier Program supported by the New Energy and Industrial Technology Development Organization (NEDO).
REFERENCES Fukuda, M., Hiraoka, N., and Yeh, J. C. (1999). C-type lectins and sialyl Lewis X oligosaccharides. Versatile roles in cell-cell interaction. J. Cell Biol. 147, 467–470. Hiruma, T., Togayachi, A., Okamura, K., Sato, T., Kikuchi, N., Kwon, Y. D., Nakamura, A., Fujimura, K., Gotoh, M., Tachibana, K., et al. (2004). A novel human b1, 3-N-acetylgalactosaminyltransferase that synthesizes a unique carbohydrate structure, GalNAcb1–3GlcNAc. J. Biol. Chem. 279, 14087–14095. Ishida, H., Togayachi, A., Sakai, T., Iwai, T., Hiruma, T., Sato, T., Okubo, R., Inaba, N., Kudo, T., Gotoh, M., et al. (2005). A novel b1, 3-N-acetylglucosaminyltransferase (b3Gn-T8), which synthesizes poly-N-acetyllactosamine, is dramatically upregulated in colon cancer. FEBS Lett. 579, 71–78. Isshiki, S., Togayachi, A., Kudo, T., Nishihara, S., Watanabe, M., Kubota, T., Kitajima, M., Shiraishi, N., Sasaki, K., Andoh, T., et al. (1999). Cloning, expression, and characterization of a novel UDP-galactose:b-N-acetylglucosamine b1, 3-galactosyltransferase
b3GnT2 (B3GNT2), A Major Polylactosamine Synthase: Analysis of B3gnt2-Deficient Mice
203
(b3Gal-T5) responsible for synthesis of type 1 chain in colorectal and pancreatic epithelia and tumor cells derived therefrom. J. Biol. Chem. 274, 12499–12507. Ito, S., Yamashita, K., Spiro, R. G., and Kobata, A. (1977). Structure of a carbohydrate moiety of a unit A glycopeptide of calf thyroglobulin. J. Biochem. (Tokyo) 81, 1621–1631. Iwai, T., Inaba, N., Naundorf, A., Zhang, Y., Gotoh, M., Iwasaki, H., Kudo, T., Togayachi, A., Ishizuka, Y., Nakanishi, H., et al. (2002). Molecular cloning and characterization of a novel UDP-GlcNAc: GalNAc-peptide b1, 3-N-acetylglucosaminyltransferase (b 3Gn-T6), an enzyme synthesizing the core 3 structure of O-glycans. J. Biol. Chem. 277, 12802–12809. Iwai, T., Kudo, T., Kawamoto, R., Kubota, T., Togayachi, A., Hiruma, T., Okada, T., Kawamoto, T., Morozumi, K., and Narimatsu, H. (2005). Core 3 synthase is downregulated in colon carcinoma and profoundly suppresses the metastatic potential of carcinoma cells. Proc. Natl Acad. Sci. USA 102, 4572–4577. Kuno, A., Uchiyama, N., Koseki-Kuno, S., Ebe, Y., Takashima, S., Yamada, M., and Hirabayashi, J. (2005). Evanescent-field fluorescence-assisted lectin microarray: A new strategy for glycan profiling. Nat. Methods 2, 851–856. Leppanen, A., Stowell, S., Blixt, O., and Cummings, R. D. (2005). Dimeric galectin-1 binds with high affinity to a2, 3-sialylated and non-sialylated terminal N-acetyllactosamine units on surface-bound extended glycans. J. Biol. Chem. 280, 5549–5562. Lowe, J. B., Stoolman, L. M., Nair, R. P., Larsen, R. D., Berhend, T. L., and Marks, R. M. (1990). ELAM-1-dependent cell adhesion to vascular endothelium determined by a transfected human fucosyltransferase cDNA. Cell 63, 475–484. Nachbar, M. S., Oppenheim, J. D., and Thomas, J. O. (1980). Lectins in the U.S. Diet. Isolation and characterization of a lectin from the tomato (Lycopersicon esculentum). J. Biol. Chem. 255, 2056–2061. Narimatsu, H. (2004). Construction of a human glycogene library and comprehensive functional analysis. Glycoconj. J. 21, 17–24. Novak, E. J., and Rabinovitch, P. S. (1994). Improved sensitivity in flow cytometric intracellular ionized calcium measurement using Fluo-3/Fura Red fluorescence ratios. Cytometry 17, 135–141. Sasaki, K., Kurata-Miura, K., Ujita, M., Angata, K., Nakagawa, S., Sekine, S., Nishi, T., and Fukuda, M. (1997). Expression cloning of cDNA encoding a human b-1, 3-N-acetylglucosaminyltransferase that is essential for poly-N-acetyllactosamine synthesis. Proc. Natl. Acad. Sci. USA 94, 14294–14299. Seko, A., and Yamashita, K. (2004). b1, 3-N-Acetylglucosaminyltransferase-7 (b3Gn-T7) acts efficiently on keratan sulfate-related glycans. FEBS Lett. 556, 216–220. Shiraishi, N., Natsume, A., Togayachi, A., Endo, T., Akashima, T., Yamada, Y., Imai, N., Nakagawa, S., Koizumi, S., Sekine, S., et al. (2001). Identification and characterization of three novel b1, 3-N-acetylglucosaminyltransferases structurally related to the b1, 3-galactosyltransferase family. J. Biol. Chem. 276, 3498–3507. Takasaki, S., Mizuochi, T., and Kobata, A. (1982). Hydrazinolysis of asparagine-linked sugar chains to produce free oligosaccharides. Methods Enzymol. 83, 263–268. Togayachi, A., Akashima, T., Ookubo, R., Kudo, T., Nishihara, S., Iwasaki, H., Natsume, A., Mio, H., Inokuchi, J., Irimura, T., et al. (2001). Molecular cloning and characterization of UDP-GlcNAc: lactosylceramide b1, 3-N-acetylglucosaminyltransferase (b3Gn-T5), an essential enzyme for the expression of HNK-1 and Lewis X epitopes on glycolipids. J. Biol. Chem. 276, 22032–22040. Togayachi, A., Sato, T., and Narimatsu, H. (2006). Comprehensive enzymatic characterization of glycosyltransferases with a b3GT or b4GT motif. Methods Enzymol. 416, 91–102. Togayachi, A., Kozono, Y., Ishida, H., Abe, S., Suzuki, N., Tsunoda, Y., Hagiwara, K., Kuno, A., Ohkura, T., Sato, N., et al. (2007). Polylactosamine on glycoproteins
204
Akira Togayachi et al.
influences basal levels of lymphocyte and macrophage activation. Proc. Natl. Acad. Sci. USA 104, 15829–15834. Yamashita, K., Mizuochi, T., and Kobata, A. (1982). Analysis of oligosaccharides by gel filtration. Methods Enzymol. 83, 105–126. Yoshima, H., Matsumoto, A., Mizuochi, T., Kawasaki, T., and Kobata, A. (1981). Comparative study of the carbohydrate moieties of rat and human plasma a 1-acid glycoproteins. J. Biol. Chem. 256, 8476–8484. Zhou, D., Dinter, A., Gutierrez Gallego, R., Kamerling, J. P., Vliegenthart, J. F., Berger, E. G., and Hennet, T. (1999). A b-1, 3-N-acetylglucosaminyltransferase with poly-N-acetyllactosamine synthase activity is structurally related to b-1, 3-galactosyltransferases. Proc. Natl. Acad. Sci. USA 96, 406–411.
WEBSITES Glycogene Database (GGDB): http://riodb.ibase.aist.go.jp/rcmg/ggdb/ Japan Consortium of Glycobiology and Glycotechnology Database ( JCGGDB): http:// jcggdb.jp/
C H A P T E R
T W E LV E
Targeted Genetic Inactivation of N-Acetylglucosaminyltransferase-IVa Impairs Insulin Secretion from Pancreatic b Cells and Evokes Type 2 Diabetes Kazuaki Ohtsubo Contents 206 207 209 210 211 214 215 216 217 218 220 220
1. Overview 2. Engineering GnT-IVa-Deficient Mice 3. GnT-IV Enzymology 4. Glucose and Insulin Homeostasis 5. Immunohistochemical Analysis 6. Islet Cell Preparation and Culture 7. Pulse-Chase Labeling 8. Cell Surface Half-Life Time of GLUT2 9. GLUT2 Glycan Analysis by Lectin Blot 10. Cell-Surface Protein Cross-Linking Acknowledgment References
Abstract The biological significance of protein N-glycosylation has been elucidated using a mouse model bearing a genetic mutation of N-acetylglucosaminyltransferases (GnTs), which initiate the formation of specific branch structures on the mannose core of N-glycans. These glycosylation defects evoked a variety of abnormalities and disorders in specific cell types, tissues, and the whole body, reflecting functional requirements. N-Acetylglucosaminyltransferase-IVa (GnT-IVa) initiates the GlcNAcb1-4 branch synthesis on the Mana1-3 arm of the N-glycan core thereby increasing N-glycan branch complexity. To investigate the physiological function of GnT-IVa, we engineered and characterized GnT-IVa-deficient mice. GnT-IVa-deficient mice showed a metabolic disorder subsequently diagnosed as Department of Disease Glycomics, The Institute of Scientific and Industrial Research, Osaka University, Ibaraki, Osaka, Japan Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79012-1
#
2010 Elsevier Inc. All rights reserved.
205
206
Kazuaki Ohtsubo
type 2 diabetes. In this chapter, methods for characterizing GnT-IVa-deficient mice by physiological analyses to detect metabolic alterations and biochemical analyses using primary isolated pancreatic b cells are summarized and discussed.
1. Overview The organization of the plasma membrane structure is determinant in the modulation of cellular responses to microenvironmental signals. Cellsurface proteins are compartmentalized or clustered, and the clusters are embedded in the plasma membrane by lipid–lipid, protein–protein, and lipid–protein interactions, resulting in the assembly of functional domains for appropriate cellular responses. Most plasmalemmal proteins undergo glycosylation in the Golgi apparatus to obtain a highly complex structural repertoire, which is indispensable for the precise regulation of protein functions and for the fine-tuning of cellular responses (Haltiwanger and Lowe, 2004; Ohtsubo and Marth, 2006; Taniguchi, 2009). Recent extensive studies have revealed the molecular mechanisms for how N-glycan structures control protein functions, and demonstrated that protein N-glycosylation controls the cell-surface residency of glycoproteins via the formation of multivalent binding epitopes for endogenous lectins, for example, galectins (Garner and Baum, 2008; Kornfeld and Kornfeld, 1985; Taylor and Kurt Drickamer, 2007). The endogenous lectin binding avidity depends on the number of and the antennary arrangement of N-glycans on the protein. The number of N-glycosylation sites is an intrinsic characteristic encoded in the primary sequence of each protein, while the antennary arrangement of N-glycans reflects the portfolio of expressed N-glycan processing enzymes, and the dynamic metabolic supply for substrate synthesis (Lau et al., 2007). Over the past decade, a variety of N-glycan processing enzyme deficient mice have been engineered and characterized, in attempts to elucidate the in vivo functions of protein N-glycosylation (Bhattacharyya et al., 2002; Demetriou et al., 2001; Granovsky et al., 2000; Ioffe and Stanley, 1994; Metzler et al., 1994; Ohtsubo et al., 2005; Priatel et al., 1997; Soleimani et al., 2008; Wang et al., 2001; Yang et al., 2003). N-Acetylglucosaminyltransferase-IVa (GnT-IVa) and -V (GnT-V) are N-glycan branching enzymes that are responsible for the formation of multiantennary complex type N-glycan structures. GnT-IVa-deficient mice and GnT-V-deficient mice demonstrate abnormalities that can be attributed to the diminished cellsurface residency of plasmalemmal glycoproteins, due to impaired molecular interactions between N-glycan antennae and endogenous lectins, galectins, on the cell surface, which eventually leads to cellular dysfunctions (Demetriou et al., 2001; Ohtsubo et al., 2005; Partridge et al., 2004).
GLUT2 N-Glycosylation Determines Insulin Secretion
207
These have demonstrated that the formation of proper antennal complexity on N-glycans is crucial for maintaining biological processes in normal contexts. Pancreatic b cells express glucose transporters (GLUTs) as the glucose sensor on cell surfaces, and can secrete appropriate amounts of insulin in response to fluctuating blood glucose levels. A loss of pancreatic b cell GLUT expression in humans and rodents is associated with hyperglycemia and diminished glucose-stimulated insulin secretion, which are early markers of the pathogenesis of diabetes and precede the development of insulin resistance (Guerra et al., 2005; Johnson et al., 1990; Orci et al., 1990; Thorens et al., 1990; Unger, 1991). A genetic mutation at the N-glycosylation site of GLUT1 results in a severe reduction of cell-surface expression, accompanied by intracellular accumulation (Asano et al., 1993). As the structure is highly conserved among the GLUT family, these results highlight the importance of N-glycosylation on cell-surface residency of GLUT family. The Mgat4a-encoded GnT-IVa is abundantly expressed in pancreatic b cells. The chromosomal position of the human Mgat4a gene is the susceptible loci to the type 2 diabetes, as evidenced by genetic linkage analyses of human type 2 diabetes patients and their families (McCarthy, 2003; Van Tilburg et al., 2003). The level of Mgat4a expression in pancreatic b cells of human type 2 diabetes patients is significantly reduced (Gunton et al., 2005). These findings suggest that GnT-IVa-dependent GLUT N-glycosylation is involved in the pathogenesis of type 2 diabetes. In the following paragraphs, protocols for the physiological and biochemical characterization of GnT-IVa-deficient mice are described.
2. Engineering GnT-IVa-Deficient Mice To generate mice that are deficient in GnT-IVa, the Mgat4a gene was disrupted in embryonic stem (ES) cells by the deletion of exon 7, which induces a translational frame-shift and generates a termination codon right after the junction of exon 6 and 8, resulting in the truncation of GnT-IVa to give the enzyme lacking a catalytic domain (Fig. 12.1A; Minowa et al., 1998; Ohtsubo et al., 2005). ES cells bearing the conditional (F, type 2) Mgat4a mutation were injected into blastocyst stage embryo obtained from C57BL/6 mice. Germline transmitted mice were maintained by breeding with C57BL/6 mice. Mice bearing the Mgat4aF allele were bred with ZP3Cre transgenic mice (Shafi et al., 2000), and the resulting female mice, bearing a germline Mgat4aF allele and the ZP3-Cre transgene, were bred with male C57BL/6 mice to produce offspring bearing the Mgat4aD allele. The Mgat4aF and Mgat4D alleles were bred into the C57BL/6 background at least six generations prior to producing mice for studies. All experiments involving rodents conformed to National and Institutional regulations.
A 1 kb
Mgat4a wild-type allele 1 2 3
TM Stalk E1
E2
4&5
E4&5
E6 E7 E8
E9
4&5
TM Stalk E2
7
8
Catalytic region
E3
Δ Mgat4a allele 1 2 3
E1
6
E10
E11 E12 E13 E14 E15
6
8
Catalytic region
E3
E4&5
E6 8
Stop Exon 6
Exon 8
AGA GTG AGC TTG AAG ACG ATA TTA TTG TCA AAC AAA ACT ATT TTA ATA CCA TAA AGA R V S L K T I L L S N K T I L I P *
B
Sh K Se Sh Se
Exon 7
WT 129/SvJ
tk
F[tkneo] Sh K Se
Se B: BamHI H: Hind III K: KpnI S: SalI Se: SpeI Sh: SphI
B H
neo
IoxP probe
1 kb Sh Se
tk Genomic probe Mgat4aΔ Sh K
Sh
Sh Se
S pflox vector
Sh
Se
Sh
Se
neo +Cre recombinase +Ganciclovir
Se
Sh
Se Type 1 deletion
Mgat4aF Sh K
Se
Se
Sh
Se Type 2 deletion
Figure 12.1 Genetic organization of the Mgat4a gene and gene targeting strategy. (A) The top portion indicates exon–intron arrangement of the Mgat4a gene in which exons are depicted as boxes. Exon 7 is depicted as a black box, which corresponds to the catalytic region of GnT-IVa, which is to be targeted. The bottom portion indicates the sequence at the junction of exon 6 and 8 of Mgat4aD mutant transcripts. The newly generated translational termination codon is indicated. (B) Mouse genomic clone of Mgat4a bearing exon 6, 7, and 8 used for constructing the targeting vector with the pflox plasmid as indicated. Homologous recombination produces the Mgat4a F[tk neo] allele. Following Cre recombination and selection, embryonic stem (ES) cell clones are isolated containing the type 1 (D, deleted) and the type 2 (F, floxed) alleles. Partly adapted from Ohtsubo et al. (2005).
GLUT2 N-Glycosylation Determines Insulin Secretion
209
3. GnT-IV Enzymology The enzymatic activity of GnT-IV is assayed based on the reaction to the fluorescent acceptor substrate, a pyridylaminated sugar chain, Gn2(20 ,2)corePA [GlcNAcb1-2 Mana1-6(GlcNAcb1-2Mana1-3) Manb1-4GlcNAcb14GlcNAc-PA], according to the method described by Nishikawa et al. (1990) with minor modifications. The fluorescent sugar chain reaction products can be detected with high sensitivity and conventionally separated by reverse-phase HPLC, owing to the hydrophobicity of the pyridylamino group. Method for tissue GnT-IV enzyme assay 1. To determine GnT-IV enzymatic activity in mouse tissues, freshly harvested tissue is homogenized in 4 vols of 10 mM Tris–HCl (pH 7.4) containing 0.25 M sucrose, followed by centrifugation at 900g for 10 min at 4 C. The supernatants are collected and used as the GnT-IV enzyme assay samples. 2. The enzyme solution (15 ml) is incubated at 37 C for 4 h with 125 mM MOPS buffer (pH 7.3) containing 0.8 mM Gn2(20 ,2)core-PA substrate, 20 mM UDP-GlcNAc, 7.5 mM MnCl2, 200 mM GlcNAc, 0.5% (w/v) Triton X-100, 10% glycerol, and 5 mg/ml BSA in a total volume of 50 ml. 3. After the incubation, 50 ml of H2O is added and the enzyme reaction is terminated by boiling for 2 min, followed by filtration through a Millipore filter (0.22 mm). 4. The product of the enzyme reaction (5 ml) is loaded on a TSK ODS80TM column (4.6 mm 150 mm, Tosoh). Reverse phase chromatography was performed at 50 C with a 50 mM ammonium acetate buffer (pH 4.0), containing 0.15% 1-butanol at a flow rate of 1.2 ml/min. 5. Fluorescence is monitored using excitation and emission wavelengths of 320 and 400 nm, respectively. Under these conditions, the product of GnT-IV elutes at 12 min. Specific activity is expressed as moles of product per hour of incubation per milligram of protein. Figure 12.2 shows the GnT-IV enzymatic activity among tissues of the mice genotyped as Mgat4aD homozygote, heterozygote, and wild type. Among the tissues surveyed, GnT-IV enzymatic activity was found to be high in the pancreas of wild-type mice. In most of the tissues, GnT-IV enzymatic activities were correlated with the number of intact Mgat4a alleles, that is, most of the Mgat4aD heterozygote tissues exhibited approximately 50% of wild-type GnT-IV enzymatic activity, while homozygote tissues retained 2–20%. The residual GnT-IV activity can be attributed to the activity of a GnT-IVb isoenzyme (Yoshida et al., 1998).
210
Kazuaki Ohtsubo
pmol/h(mg)
300 Mgat4a WT/WT Mgat4a WT/Δ Mgat4a Δ/Δ
250 200 150 100 50 0 Brain Heart
Stomach Thymus Lung Testis Liver Muscle Uterus Spleen Kidney Pancreas Bone marrow
Figure 12.2 GnT-IVa enzyme activity among the genotypes and tissues surveyed. Results are expressed as mean S.D. (n ¼ 3). Partly adapted from Ohtsubo et al. (2005).
4. Glucose and Insulin Homeostasis Evaluating the glucose homeostasis by a glucose tolerance test is a part of a panel tests used to diagnose diabetes. Glucose tolerance test involves the administration of glucose, followed by monitoring how rapidly it is cleared from the blood and the simultaneous determination of the glucose-stimulated insulin secretion function of pancreatic b cells. To eliminate fluctuations in blood glucose levels by food intake, the mice must be fasted prior to the administration of glucose. Method for glucose tolerance test 1. For administrating glucose at 1.5 g/kg body weight, the glucose solution should be prepared in PBS at a concentration of 300 mg/ml, equivalent to an injection of 100 ml for 20 g of body weight. 2. GnT-IVa mice and their littermate control mice are fasted for 16 h. 3. The mouse is quickly anesthetized by inhalation of mehoxyflurane to collect blood from the orbital sinus using a hematocrit capillary, followed by an intraperitoneal injection of glucose using an insulin syringe with a 28-gauge needle. Blood glucose levels can be readily measured by using a glucometer (One Touch Ultra), in conjunction with a timer, to determine the time from injection. In recently published guidelines for mouse protocols in many institutions, blood collection from the orbital sinus is prohibited. 4. At 30, 60, 120, and 240 min after the glucose injection, blood samples are collected in serum separator tubes (BD Microtainer) and blood glucose levels are measured at each time point, by the above procedure. After the blood becomes clotted at room temperature for 2 h, serum is separated by centrifugation at 3000g for 5 min. 5. Insulin levels in serum samples are determined using a mouse insulin ELISA kit (Crystal Chem).
211
GLUT2 N-Glycosylation Determines Insulin Secretion
Glucose (mg/dl)
800 700 *** 600 500 *** 400 300 200 *** 100 0 0 60
*** ***
120 180 Time (min)
240
Serum insulin (ng/ml)
B
A
4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0
*** ***
0
60
120 180 Time (min)
240
Figure 12.3 Glucose tolerance test. Glucose solution is injected into fasted mice at time point 0 and blood samples are collected at the indicated intervals after injection. (A) Blood glucose levels in wild-type (white circles) and Mgat4a null (black circles) littermates (n ¼ 10; ***p < 0.0001). (B) Serum insulin levels measured during the glucose tolerance test (n ¼ 10; ***p < 0.0001). Partly adapted from Ohtsubo et al. (2005).
GnT-IVa-deficient mice exhibit an abnormal response in a glucose tolerance test, yielding blood glucose levels that are substantially and persistently elevated, which is consistent with the absence of insulin secretion responses upon a glucose challenge (Fig. 12.3). This suggests that GnT-IVadeficient mice have a defect in the insulin secretion machinery in pancreatic b cells.
5. Immunohistochemical Analysis The plasmalemmal and sequestered intracellular distribution of glucose transporter-2 (GLUT2) can be visualized and analyzed by multicolor immunostaining with combination of specific antibodies against specific organelles. The tissue must be properly fixed for maintaining tissue finestructure and for capturing intense signal deposition. To prepare histological mouse tissue sections, the whole mouse body is perfused intracardially with PBS followed by 4% paraformaldehyde/PBS before tissue harvesting. Method for pancreatic GLUT2 staining 1. Either a GnT-IVa-deficient mouse or its littermate wild-type mouse is deeply anesthetized by inhalation of mehoxyflurane prior to setting up the perfusion experiment. The depth of anesthesia can be verified by a lack of reflection to a toe pinch. 2. The mouse is preperfused with PBS for 15 min from the left ventricle through a winged needle connected to a peristaltic pump at a flow rate
212
3.
4. 5. 6. 7.
8.
9. 10.
Kazuaki Ohtsubo
of 1 ml/min. Following PBS flushing, 4% paraformaldehyde/PBS is delivered to the mouse at the same flow rate for 15 min. The pancreas is harvested and further fixed in the same fixative at 4 C with agitation for 8 h. Following the postfixation, the fixative is replaced with 20% sucrose/PBS for cryoprotection, followed by incubation at 4 C for 16 h, with agitation. The organs are wiped with a paper towel and embedded in O.C.T. compound (Tissue-Tek), placed in a 2-methylbutane/dry ice bath and allowed to freeze evenly. Pancreatic tissue block is sliced at thicknesses of 3 mm and a cryosection is attached to a slide grass followed by air drying at room temperature for 1 h. For immunofluorescence analyses, pancreatic tissue sections are washed with PBS for 10 min and then blocked with 4% BSA/PBS at room temperature for 1 h. Sections are incubated with the GLUT2 antibody (Chemicon) combined with an antibody against either Insulin (Linco), PDI (Stressgen), Calnuc (a generous gift from M. G. Farquhar, University of California, San Diego, CA, USA), adaptin g (BD Transduction Laboratories), EEA1 (BD Transduction Laboratories), or LAMP2 (Santa Cruz Biotechnology) at a 1:200 dilution in 4% BSA/PBS for 1 h. After three 15 min washes in PBS, the sections are incubated with secondary antibodies, FITC-conjugated sheep anti-rabbit IgG for GLUT2 (ICN Biomedicals); Rhodamine-conjugated goat anti-guinea pig IgG for Insulin (ICN Biomedicals); Rhodamine-conjugated sheep anti-mouse IgG for PDI, adaptin g, and EEA1 (ICN Biomedicals); Rhodamine-conjugated goat anti-chicken IgY for Calnuc (Molecular Probes); Rhodamine-conjugated goat anti-rat IgG (ICN Biomedicals), at a 1:200 dilution in 4% BSA/PBS for 30 min. Nucleus is counterstained with DAPI (Molecular Probes). After three washes in PBS, the sections are rinsed with H2O and mounted with Gel Mount (Biomedia Corp.). Images are analyzed by deconvolution using a Delta Vision Restoration microscope (Applied Precision, Inc.) and Delta Vision SoftWork software (version 2.50). Colocalization is quantified by object-based analysis at multiple exclusion thresholds spanning the linear range of fluorescent signals using MetaMorph algorithms (Universal Imaging Corporation).
Figure 12.4 shows the intracellular distribution of GLUT2 in pancreatic b cells of GnT-IVa-deficient mice and their littermates. The intracellular distribution of GLUT2 is profoundly altered in the case of a GnT-IVa deficiency. Wild-type pancreatic b cells abundantly express GLUT2 on the cell surface, while the cell-surface expression of GLUT2 is significantly reduced and accumulates intracellularly in GnT-IVa-deficient
213
GLUT2 N-Glycosylation Determines Insulin Secretion
A
B
D
C
6.98 ± 0.92 E
F
G
7.74 ± 1.24 H
3.73 ± 1.10 I
J
K
6.15 ± 0.93 L
3.65 ± 1.05 M
N
O
5.95 ± 0.39 P
2.01 ± 0.96 Q
R
S
T
4.83 ± 0.34 U
V
4.24 ± 0.74
W
53.60 ± 4.62 X
1.71 ± 0.29
18.66 ± 3.85
Figure 12.4 In situ localization of GLUT2 in wild-type and Mgat4a null pancreatic b cells. Pancreatic islet sections of 12-week-old wild-type mice (A, C, E, G, I, K, M, O, Q, S, U, W) and Mgat4a null littermates (B, D, F, H, J, L, N, P, R, T, V, X) are analyzed by fluorescent deconvolution microscopy for b cells GLUT2 (green) and various intracellular compartments (red) including secretory vesicular insulin (A–D), endoplasmic reticulum protein disulfide isomerase (E–H), cis-Golgi Calnuc (I–L), transGolgi adaptin g (M–P), early endosome antigen EEA-1 (Q–T), and lysosome LAMP2 (U–X). The colocalization (yellow) of GLUT2 with each of these markers is depicted in separate panels (C, D, G, H, K, L, O, P, S, T, W, X). DNA is stained with DAPI (blue). Inset boxes have been enlarged to enhance the visualization of early endosome or lysosome signals. The percentage of GLUT2 colocalization with the relevant cellular marker is indicated in white lettering. Partly adapted from Ohtsubo et al. (2005).
214
Kazuaki Ohtsubo
pancreatic b cells. Colocalization analyses of organelles indicate substantial GLUT2 deposition in early endosomes and lysosomes.
6. Islet Cell Preparation and Culture For biochemical and physiological analyses of pancreatic b cells, primary islet cells need to be isolated and cultured. For culturing primary isolated islet cells, maintaining asepsis conditions during surgery is very important and can be achieved by reducing surgical time, minimizing handling flow, sterilizing equipments by autoclave prior to surgery, and scrubbing the mouse skin with a disinfectant (70% ethanol). Method for preparing mouse pancreas islet cells 1. To access the pancreas, the mouse is euthanized by inhaling a carbon dioxide and disinfected with mist of 70% ethanol. The mouse is placed on a styrofoam plate with the abdominal side facing up and the upper abdominal skin is incised along the midline followed by holding skin with push pins on the plate and opening the peritoneum to expose the liver and intestines. 2. Mouse is placed under a stereomicroscope with sufficient, cool light. The pancreatic duct is ligated distally and injected with 1 ml of a collagenase solution [3 mg/ml collagenase (Sigma), 5 g/ml DNase (Sigma) and 5.6 mM glucose in Hank’s balanced salt solution (HBSS)]. 3. The pancreas is removed and incubated with 2 ml of the collagenase solution for 14 min at 37 C with shaking (200 strokes/min). The resulting tissue suspension is passed through a 16-gauge needle, and centrifuged at 200g for 5 min and the resulting pellet is suspended in 3 ml of 25% Ficoll/HBSS and placed in the bottom. The layer of discontinuous Ficoll gradients (3 ml of 23% Ficoll/HBSS, 2 ml of 20% Ficoll/HBSS, and 2 ml of 11% Ficoll/HBSS) is overlaid onto the 25% Ficoll cell suspension. After 15 min of centrifugation at 800g at room temperature, islets are recovered from the top two interfaces of the gradients and washed in HBSS, followed by hand picking the islets under a stereomicroscope. The islets are dark brown in color. 4. Islets are gently dispersed after three consecutive washes with HBSS, then incubated with 0.5 U/ml of dispase (Calbiochem) in HBSS for 3 min. This is followed by gentle repetitive pipeting and a final wash with HBSS. The surfaces of tubes and tips should be siliconized, to avoid losing islet cells by adsorption. 5. The cells are cultured in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, 0.1 mM 2-mercaptoethanol, and 11 mM glucose.
GLUT2 N-Glycosylation Determines Insulin Secretion
215
7. Pulse-Chase Labeling The intracellular trafficking of GLUT2 can be monitored by pulsechase labeling of islet cells with [35S]-methionine, in conjunction with sequential purifications of biotinylated cell-surface proteins and GLUT2. To prepare sufficient islet cells for pulse-chase labeling, at least 15 mice are required for each time point. Method for pulse-chase labeling of pancreatic islet cells 1. Islet cells are washed twice with HBSS, then incubated with PRMI 1640 medium depleted of methionine (Sigma) supplemented with 10% dialyzed FCS (GIBCO/Invitrogen) for 2 h at 37 C. 2. Pulse labeling is performed with 400 mCi/ml [35S]-methionine for 10 min at 37 C, and cells are then washed twice in ice-cold HBSS. Cells are lysed in lysis buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1.2% Triton X-100, 0.05% SDS, and 1 proteinase inhibitor cocktail (Roche) for the pulse sample or returned to the culture with RPMI 1640 medium containing 2 mM methionine, and 10% FCS for 10, 20, 30, 40, 50, or 60 min. 3. At each time point, the cells used in chase samples are washed twice with ice-cold PBS and incubated with 1 mg/ml of sulfo-NHS-LC-biotin (Pierce Chemical) at 4 C for 30 min to biotinylate cell-surface proteins. 4. Biotinylation is terminated by three washes with 15 mM glycine in icecold PBS. The cells are homogenized in lysis buffer, and the biotinylated proteins are purified using a column of 1 ml of immobilized monomeric avidin gel (Pierce Chemical). After sequentially washing with 1 ml of lysis buffer and 1 ml of PBS, biotinylated proteins are eluted in 1 ml of PBS containing 2 mM D-biotin (Pierce Chemical). 5. The eluates are incubated with 1 mg/ml of anti-GLUT2 C-terminal antibody (Santa Cruz Biotechnology) at 4 C for 1 h, followed by incubation with 20 ml of protein A sepharose beads (Pharmacia). 6. The immunoprecipitates are washed three times with 1 ml of lysis buffer, and boiled in 20 ml of 2 sample buffer for 5 min. The samples are then subjected to 7.5% SDS-PAGE. The gel is then prepared for fluorography by treatment with 20% (w/v) 2,5-diphenyloxazol in glacial acetic acid for 20 min, washed in water for 20 min, dried, and exposed to a BioMAX X-ray film (Kodak) at 70 C for 3–7 days. Figure 12.5 indicates the kinetics of GLUT2 synthesis and cell-surface appearance among pancreatic islet cells from wild-type and GnT-IVadeficient mice using metabolic labeling coupled with cell-surface biotinylation. The trafficking of the newly synthesized GLUT2 protein to the cell
216
Kazuaki Ohtsubo
Chase (min) Pulse
0
10
20
30
40
50
60
WT
Cell surface GLUT2 (% of pulse value)
Δ/Δ 100 80 60 40
WT Δ/Δ
20 0 0
10
30 20 40 Chase (min)
50
60
Figure 12.5 Production and trafficking of newly synthesized GLUT2 in pancreatic islet cells are normal in GnT-IVa deficiency. The rate of cell-surface transport of GLUT2 at each chase time point is plotted as the % of pulse value. Partly adapted from Ohtsubo et al. (2005).
surface requires 50–60 min in wild-type pancreatic islet cells and the time is not altered in the case of GnT-IVa deficiency.
8. Cell Surface Half-Life Time of GLUT2 The cell surface labeling technique, employing sulfo-NHS-LC-biotin, is applicable to investigations of GLUT2 half-life time to determine its stability on the pancreatic b cell surface. Method for cell-surface GLUT2 biotinylation and detection 1. Islet cells are washed twice with ice-cold PBS, and biotinylated by incubation with sulfo-NHS-LC-biotin (Pierce Chemical), as described above. 2. The cells are further cultured for 3, 6, 12, or 24 h, then homogenized in lysis buffer. 3. GLUT2 protein is immunoprecipitated using the anti-GLUT2 C-terminal antibody, as described above. 4. The immunoprecipitates are washed three times with 1 ml of lysis buffer, and boiled in 20 ml of 2 sample buffer for 5 min. The samples are subjected to 7.5% SDS-PAGE, and transferred to a PVDF membrane (Amersham). 5. Biotinylated GLUT2 immunoprecipitates are visualized with HRPconjugated streptavidin (BD Pharmingen) and enhanced chemiluminescence (Amersham).
217
GLUT2 N-Glycosylation Determines Insulin Secretion
0
3
6
12
24 (h)
WT Δ/Δ
Biotinylated GLUT2 (% of time 0 value)
100
t1/2 = 11.44 (h)
10 WT Δ/Δ
1
t1/2 = 2.69 (h)
0.1 0
3
6
9
12 15 18 21 24 Time (h)
Figure 12.6 GLUT2 cell-surface half-life on intact islet cells is measured following cell-surface biotinylation then graphed as a percentage of biotinylated GLUT2 present immediately after biotinylation. Data are represented as the means S.D. for three separate experiments. Partly adapted from Ohtsubo et al. (2005).
6. Band intensity is quantified by measuring the absolute integrated optical density (IOD) using the Labworks software program (UVP Bioimaging system). Figure 12.6 indicates the decay of cell-surface biotinylated GLUT2 in wild-type or GnT-IVa-deficient b cells with time. The calculation of the relative amount of biotinylated GLUT2 remaining after any time interval (i.e., biotinylated GLUT2 (t ¼ n)/biotinylated GLUT2 (t ¼ 0)) gives a decay curve and a half-life time that permit a comparison of the stability of GLUT2 protein on the cell surface. In the case of GnT-IVa deficiency, the GLUT2 half-time is decreased by more than fourfold.
9. GLUT2 Glycan Analysis by Lectin Blot Characterizing glycan structures from limited amounts of cellular materials is essential for elucidating the functions of glycans in biological processes. Lectins have a high affinity and narrow specificity for wide range of defined glycan epitopes. The blotting of glycoprotein samples with a panel of lectins, the binding specificities of which are well-defined, can provide considerable information related to deducing glycan structures on proteins (reviewed in Cummings, 1999).
218
Kazuaki Ohtsubo
Method for determining GLUT2 N-glycan structures 1. Isolated islets from either GnT-IVa-deficient mice or their littermate control mice are suspended in lysis buffer and sonicated. Solubilized proteins are recovered in supernatants following centrifugation at 800g for 15 min at 4 C. 2. 200 mg of total protein is subjected to immunoprecipitation with an antibody against the C-terminal region of GLUT2 (Santa Cruz Biotechnology) as described in Method for pulse-chase labeling of pancreatic islet cells. 3. The precipitates are analyzed by blotting with an antibody against the N-terminal region of GLUT2 (Chemicon) or biotinylated lectins DSL, L-PHA, LEA, ECA, RCA-1, SNA, or MAH (Vector Laboratories). In using DSL, and L-PHA, the blots are rinsed with TBS and incubated with 20 mU/ml of neuraminidase (from Vibrio choleae, Sigma) in 50 mM sodium acetate buffer (pH 5.5) at 37 C for 16 h, then treated with 125 mU/ml of endo-b-galacotosidase (from Escherichia freundii, Calbiochem) under the same buffer conditions. After washing with T-TBS (0.05% Tween 20 in TBS), the blots are blocked with 4% BSA in T-TBS for a minimum of 1 h followed by 2 mg/ml of either DSL or L-PHA in T-TBS with 1% BSA. After incubation with HRPstreptavidin (BD Pharmingen), the blots are washed and developed by enhanced chemiluminescence (Amersham). 4. The signals are quantified, as described in Method for cell-surface GLUT2 biotinylation and detection. Figure 12.7 indicates the altered lectin reactivity of GLUT2 N-glycan in the absence of GnT-IVa-dependent glycosylation. In the case of a GnT-IVa deficiency, total GLUT2 protein levels are significantly reduced that is coincident with the severe reduction in the extent of binding of the DSL lectin to the remaining GLUT2, consistent with the loss of the N-glycan branch formed by the action of GnT-IV. Additional results with the absence of reactivities against LEA, SNA, and MAH lectins and the presence of the reactivities against RCA and ECA imply the absence of a polylactosamine structure and terminal sialic acids and the presence of the terminal LacNAc (Galb1-4GlcNAc) in GLUT2 N-glycan structures in wild-type and GnTIVa deficiency.
10. Cell-Surface Protein Cross-Linking Lectins that specifically and preferentially bind to nonsialylated LacNAc structure encompass the galectin family (Cooper and Barondes, 1999). The cell-surface protein cross-linking technique is a useful research
219
GLUT2 N-Glycosylation Determines Insulin Secretion
WT D/D
WT Δ/Δ GLUT2
ECA
DSL
RCA I
L-PHA
SNA
LEA
MAH
WT
Mgat4aΔ/Δ
Asn
Asn
Figure 12.7 Pancreatic islet GLUT2 abundance and lectin binding analysis of GLUT2 N-glycan structure in wild-type and Mgat4a null littermates. Deduced GLUT2 Nglycan structures in wild-type and Mgat4a null are represented. Black square, open circle, and black circle represent GlcNAc, mannose, and galactose, respectively. Partly adapted from Ohtsubo et al. (2005).
tool that can be used to determine molecular interactions that is applicable to exploring galectin binding to GLUT2 through its N-glycan on pancreatic b cells. A chemical compound, DTSSP (dithiobis-sulfosuccinimidyl propionate), is a water-soluble, membrane impermeable, and reversible (thiol-cleavable) protein cross-linker, which is suitable for use in this analysis. Pancreatic b cells express abundant levels of galectin-9, which can be detected by immunoblotting using an antibody (Santa Cruz Biotechnology). Method for b cell-surface protein cross-linking and detection 1. Islet cells are washed twice with HBSS and then incubated in RPMI 1640 medium in the presence or absence of 20 mM synthetic glycans for 2 h at 4 C. 2. The cells are washed twice with ice-cold PBS, then incubated with 2 mM DTSSP in PBS for 2 h on ice. 3. Cross-linking is terminated by the addition of 1 M Tris–HCl (pH 7.5) to a final concentration of 10 mM. 4. The cells are then homogenized in lysis buffer, and GLUT2 or galectin9 is precipitated using antibodies to the C-terminal residues of GLUT2 or galectin-9. 5. The co-immunoprecipitated GLUT2 and galectin-9 can be detected by immunoblotting. Cell-surface protein cross-linking and subsequent coprecipitation indicate that GLUT2 and galectin-9 are normally in close proximity on the b cell surface. Furthermore, the addition of nonsialylated LacNAc, but not sucrose, substantially diminishes GLUT2–galectin-9 cross-linking (Fig. 12.8). Collectively, these findings suggest that GnT-IVa produces N-glycan epitopes on GLUT2 that bind to endogenous lectins, including galectin-9, leading to a reduction in the rate of GLUT2 endocytosis and thereby maintaining glucose sensor function for glucose-stimulated insulin secretion.
220
Kazuaki Ohtsubo
10 mM sucrose 10 mM LacNAc
-
WT + - +
-
D/D + - +
IP: GLUT2 Blot: Galectin-9 Blot: Galectin-9 IP: Galectin-9 Blot: GLUT2 Blot: GLUT2
Figure 12.8 GLUT2 association with galectin-9 at the pancreatic islet cell surface, as assayed by protein cross-linking. Incubation of islet cells at 4 C in the presence of 10 mM of LacNAc (Galb1-4GlcNAc), but not sucrose, diminished GLUT2 crosslinking to galectin-9. Partly adapted from Ohtsubo et al. (2005).
ACKNOWLEDGMENT I thank Dr. Jamey D. Marth for helpful discussions and critical comments. This research was funded by HIH grant DK48247 and an Investigator award from the Howard Hughes Medical Institute ( J.D.M.).
REFERENCES Asano, T., Takata, K., Katagiri, H., Ishihara, H., Inukai, K., Anai, M., Hirano, H., Yazaki, Y., and Oka, Y. (1993). The role of N-glycosylation in the targeting and stability of GLUT1 glucose transporter. FEBS Lett. 324, 258–261. Bhattacharyya, R., Bhaumik, M., Raju, T. S., and Stanley, P. (2002). Truncated, inactive N-acetylglucosaminyltransferase III (GlcNAc-TIII) induces neurological and other traits absent in mice that lack GlcNAc-TIII. J. Biol. Chem. 277, 26300–26309. Cooper, D. N., and Barondes, S. H. (1999). God must love galectins; he made so many of them. Glycobiology 9, 979–984. Cummings, R. D. (1999). Plant Lectins. In ‘‘Essentials of Glycobiology,’’ (A. Varki, J. Esko, H. Freeze, G. Hart, J. Marth, and R. Cummings, eds.), pp. 455–467. Cold Spring Harbor Laboratory Press, New York. Demetriou, M., Granovsky, M., Quaggin, S., and Dennis, J. (2001). Negative regulation of T-cell activation and autoimmunity by Mgat5 N-glycosylation. Nature 409, 733–739. Garner, O. B., and Baum, L. G. (2008). Galectin-glycan lattices regulate cell-surface glycoprotein organization and signaling. Biochem. Soc. Trans. 36, 1472–1477. Granovsky, M., Fata, J., Pawling, J., Muller, W. J., Khokha, R., and Dennis, J. W. (2000). Suppression of tumor growth and metastasis in Mgat5-deficient mice. Nat. Med. 6, 306–312. Guerra, S. D., Lupi, R., Marselli, L., Masini, M., Bugliani, M., Sbrana, S., Torri, S., Pollera, M., Boggi, U., Mosca, F., et al. (2005). Functional and molecular defects of pancreatic islets in human type 2 diabetes. Diabetes 54, 727–735. Gunton, J. E., Kulkarni, R. N., Yim, S. H., Okada, T., Hawthorne, W. J., Tseng, Y.-H., Roberson, R. S., Ricordi, C., O’Connell, P. J., and Gonzalez, F. (2005). Loss of ARNT/HIF1b Mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes. Cell 122, 337–349.
GLUT2 N-Glycosylation Determines Insulin Secretion
221
Haltiwanger, R. S., and Lowe, J. B. (2004). Role of glycosylation in development. Annu. Rev. Biochem. 73, 491–537. Ioffe, E., and Stanley, P. (1994). Mice lacking N-acetylglucosaminyltransferase I activity die at mid-gestation, revealing an essential role for complex or hybrid N-linked carbohydrates. Proc. Natl. Acad. Sci. USA 91, 728–732. Johnson, J. H., Ogawa, A., Chen, L., Orci, L., Newgard, C. B., Alam, T., and Unger, R. H. (1990). Underexpression of beta cell high Km glucose transporters in noninsulin-dependent diabetes. Science 250, 546–549. Kornfeld, R., and Kornfeld, S. (1985). Assembly of asparagine-linked oligosaccharides. Ann. Rev. Biochem. 54, 631–664. Lau, K. S., Partridge, E. A., Grigorian, A., Silvescu, C. I., Reinhold, V. N., Demetriou, M., and Dennis, J. W. (2007). Complex N-glycan number and degree of branching cooperate to regulate cell proliferation and differentiation. Cell 129, 123–134. McCarthy, M. I. (2003). Growing evidence for diabetes susceptibility genes from genome scan data. Curr. Diab. Rep. 3, 159–167. Metzler, M., Gertz, A., Sarkar, M., Schachter, H., Schrader, J. W., and Marth, J. D. (1994). Complex asparagine-linked oligosaccharides are required for morphogenic events during post-implantation development. EMBO J. 13, 2056–2065. Minowa, M. T., Oguri, S., Yoshida, A., Hara, T., Iwamatsu, A., Ikenaga, H., and Takeuchi, M. (1998). cDNA cloning and expression of bovine UDP-N-acetylglucosamine: a1, 3-D-mannoside b1, 4-N-acetylglucosaminyltransferase IV. J. Biol. Chem. 273, 11556–11562. Nishikawa, A., Gu, J., Fujii, S., and Taniguchi, N. (1990). Determination of N-acetylglucosaminyltransferase III, IV, V in normal and hepatoma tissues of rats. Biochem. Biophys. Acta 1035, 313–318. Ohtsubo, K., and Marth, J. D. (2006). Glycosylation in cellular mechanisms of health and disease. Cell 126, 855–867. Ohtsubo, K., Takamatsu, S., Minowa, M. T., Yoshida, A., Takeuchi, M., and Marth, J. D. (2005). Dietary and genetic control of glucose transporter 2 glycosylation promotes insulin secretion in suppressing diabetes. Cell 123, 1307–1321. Orci, L., Ravazzola, M., Baetens, D., Inman, L., Amherdt, M., Peterson, R. G., Newgard, C. B., Johnson, J. H., and Unger, R. H. (1990). Evidence that downregulation of b-cell glucose transporters in non-insulin-dependent diabetes may be the cause of diabetic hyperglycemia. Proc. Natl. Acad. Sci. USA 87, 9953–9957. Partridge, E. A., Le Roy, C., Di Guglielmo, G. M., Pawling, J., Cheung, P., Granovsky, M., Nabi, I. R., Wrana, J. L., and Dennis, J. W. (2004). Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis. Science 306, 120–124. Priatel, J. J., Sarkar, M., Schachter, H., and Marth, J. D. (1997). Isolation, characterization and inactivation of the mouse Mgat3 gene: The bisecting N-acetylglucosamine in asparagines-linked oligosaccharides appears dispensable for viability and reproduction. Glycobiology 7, 45–56. Shafi, R., Iyer, S. P. N., Ellies, L. G., O’Donnell, N., Marek, K. W., Chui, D., Hart, G. W., and Marth, J. D. (2000). The O-GlcNAc transferase gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. Proc. Natl. Acad. Sci. USA 97, 5735–5739. Soleimani, L., Roder, J. C., Dennis, J. W., and Lipina, T. (2008). Beta N-acetylglucosaminyltransferase V (Mgat5) deficiency reduces the depression-like phenotype in mice. Genes Brain Behav. 7, 334–343. Taniguchi, N. (2009). From the g-glutamyl cycle to the glycan cycle: A road with many turns and pleasant surprises. J. Biol. Chem. 284, 34469–34478. Taylor, M. E., and Kurt Drickamer, K. (2007). Paradigms for glycan-binding receptors in cell adhesion. Curr. Opin. Cell Biol. 19, 572–577.
222
Kazuaki Ohtsubo
Thorens, B., Weir, G., Leahy, J. L., Lodish, H. F., and Bonner-Weir, S. (1990). Reduced expression of the liver/beta-cell glucose transporter isoform in glucose-insensitive pancreatic beta cells of diabetic rats. Proc. Natl. Acad. Sci. USA 87, 6492–6496. Unger, R. H. (1991). Diabetic hyperglycemia: Link to impaired glucose transport in pancreatic beta cells. Science 251, 1200–1205. Van Tilburg, J. H. O., Sandkuijl, L. A., Strengman, E., Van Someren, H., Rigters-Aria, C. A. E., Pearson, P. L., Haeften, T. W., and Wijmenga, C. (2003). A genome-wide scan in type 2 diabetes mellitus provides independent replication of a susceptibility locus on 18p11 and suggests the existence of novel loci on 2q12 and 19q13. J. Clin. Endocrinol. Metab. 88, 2223–2230. Wang, Y., Tan, J., Sutton-Smith, M., Ditto, D., Panico, M., Campbell, R. M., Varki, N. M., Long, J. M., Jaeken, J., Levinson, S. R., Wynshaw-Boris, A., Morris, H. R., et al. (2001). Modeling human congenital disorder of glycosylation type IIa in the mouse: Conservation of asparagines-linked glycan-dependent functions in mammalian physiology and insights into disease pathogenesis. Glycobiology 11, 1051–1070. Yang, X., Tang, J., Rogler, C. E., and Stanley, P. (2003). Reduced hepatocyte proliferation is the basis of retarded liver tumor progression and liver regeneration in mice lacking N-acetylglucosaminyltransferase III. Cancer Res. 63, 7753–7759. Yoshida, A., Minowa, M. T., Takamatsu, S., Hara, T., Ikenaga, H., and Takeuchi, M. (1998). A novel second isozyme of the human UDP-N-acetylglucosamine:a1, 3-Dmannoside b1, 4-N-acetylglucosaminyltransferase family: cDNA cloning, expression, and chromosomal assignment. Glycoconj. J. 15, 1115–1123.
C H A P T E R
T H I R T E E N
The Ashwell–Morell Receptor Prabhjit K. Grewal Contents 1. 2. 3. 4. 5.
Overview Endogenous Ligands of the AMR Hepatocytes in Molecular Clearance Mechanisms of the Liver Genotyping HL-1- or HL-2-Deficient Mice Hematology and Coagulation Analyses Methods (Partly Adapted from Ellies et al., 2002; Grewal et al., 2008; Wang et al., 2001) 5.1. Method for measuring platelet levels and glycosylation by lectin binding 5.2. Methods for determining clotting times 5.3. Methods for measuring coagulation factor activity or antigen levels 5.4. Method for detecting glycosylation of VWF by lectin binding Acknowledgments References
224 227 228 229 230 230 231 231 235 236 236
Abstract The Ashwell–Morell receptor (AMR) of hepatocytes, originally termed the hepatic asialoglycoprotein receptor, was the first cellular receptor to be identified and isolated and the first lectin to be detected in mammals. It is one of the multiple lectins of the C-type lectin family involved in recognition, binding, and clearance of asialoglycoproteins. We recently identified endogenous ligands of the AMR as desialylated prothrombotic components, including platelets and von Willebrand Factor [Ellies L. G., Ditto D., Levy G. G., Wahrenbrock M., Ginsburg D., Varki A., Le D. T., and Marth J. D. (2002). Sialyltransferase ST3GalIV operates as a dominant modifier of hemostasis by concealing asialoglycoprotein receptor ligands. Proc. Natl. Acad. Sci. USA 99: pp. 10042–10047; Grewal, P. K. Uchiyama, S., Ditto, D., Varki, N., Le, D. T., Nizet, V., Marth, J. D. (2008). The Ashwell receptor mitigates the lethal coagulopathy of sepsis. Nat. Medicine 14, pp. 648–655]. Among these components, clearance by the liver’s AMR is enhanced by exposure of terminal galactose on the glycan chains. A physiological role for engaging the AMR in rapid clearance was identified as The Department of Molecular, Cellular, and Developmental Biology, University of California Santa Barbara, Santa Barbara, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79013-3
#
2010 Elsevier Inc. All rights reserved.
223
224
Prabhjit K. Grewal
mitigating disseminating intravascular coagulopathy in sepsis to promote survival. This chapter overviews the endogenous ligands of the AMR as components of the coagulatory system, describes clearance mechanisms of the liver, and details hematology and coagulation assays used in mouse coagulation studies.
1. Overview The liver controls the removal of exogenously administered glycoproteins from circulation (Ashwell and Morell, 1974; Hudgin et al., 1974; Morell et al., 1971; van den Hamer et al., 1970). These classical investigations identified the first vertebrate lectin as a hepatic receptor for glycoproteins bearing glycan chains that lack sialic acid, thereby termed asialoglycoproteins (Ashwell and Harford, 1982; Ashwell and Kawasaki, 1978). Today, the Ashwell–Morell receptor (AMR), or hepatic lectin (HL), is one of multiple lectins of the C-type lectin family that binds asialoglycoproteins, and its activity remains a fundamental consideration in the design of clinical treatments to provide therapeutic levels of glycoproteins in circulation (Drickamer, 1999; Stockert, 1995). Mammalian asialoglycoprotein receptors (ASGPRs) mediate the capture and endocytosis of a wide range of exogenously administered glycoproteins that carry galactose (Gal) or N-acetylgalactosamine (GalNAc) residues at the termini of their glycan chains. Other lectins with asialoglycoprotein-binding activity include the Kupffer cell receptor, the macrophage galactose receptor, and the galectins. More recent findings have indicated that some sialylated glycans are also ligands for the ASGPR-mediated clearance (Park et al., 2005). The AMR is composed of transmembrane glycoproteins termed hepatic lectin-1 or asialoglycoprotein-1 (HL-1 or asgr-1) and hepatic lectin-2 or asialoglycoprotein-2 (HL-2 or asgr-2) encoded by distinct but closely linked genes, with variation in HL-2 structure due to RNA splicing (Drickamer et al., 1984; Halberg et al., 1987; Paietta et al., 1992). They both are type2 single-pass transmembrane proteins with a 40-amino acid N-terminal cytoplasmic domain, a 80-amino acid extracellular stalk, and an 130amino acid C-terminal carbohydrate recognition domain. The stalk region consisting of heptad repeats characteristic of a-helical coiled-coil structure mediates protein–protein interaction (Bider et al., 1996). Although HL-1 and HL-2 are detectable in some extrahepatic tissues, they are predominantly expressed in the liver and are often used as markers of hepatocytes (Monroe and Huber 1994; Park et al., 2006). Furthermore, receptor expression in hepatocytes is induced rapidly upon birth; the fetus lacks the mechanism of removing circulating glycoproteins (Zalik, 1991). Localized to the vascular face of the hepatocyte cell surface, the AMR is positioned to remove and
Hepatic Lectins and Asialoglycoprotein Clearance
225
degrade potentially deleterious circulating glycoproteins (Ashwell and Harford, 1982; Wahrenbrock and Varki, 2006; Weigel, 1994). Both HL-1 and HL-2 are highly conserved among mammalian species and may have originated from a single ancestral gene (Hong et al., 1988; Spiess and Lodish, 1985; Takezawa et al., 1993). The human and mouse genes share over 85% amino acid sequence identity between the two subunits. However, despite high percentages of identical amino acids in their sequences, the AMRs portray distinct carbohydrate ligand specificities throughout evolution; this could represent a phylogenic adaptation by the receptor to reflect rapidly changing requirements for recognition (Park and Baenziger, 2004; Rice et al., 2003). The chicken genome, for example, has a single HL receptor gene and this single chain lectin binds glycoproteins with clusters of terminal N-acetylglucosamine (GlcNAc) residues (Burrows et al., 1997; Kawasaki and Ashwell, 1977; Kuhlenschmidt and Lee, 1984; Loeb and Drickamer, 1987). In contrast, the mammalian orthologues consist of the two chains of the AMR and has highest affinity for terminal galactose. The chicken HL undergoes trimer oligomerization to form a stable functional chicken receptor (Loeb and Drickamer, 1987; Verrey and Drickamer, 1993). Homo- and heterooligomerization of the mammalian HL-1 and HL-2 glycoproteins to form functional variants of the AMR has been observed in various cellular contexts (Fig. 13.1). The ASGPR system of variability in subunit combinations to form functional complexes plays a key role in mediating a two-state pathway of receptor-mediated endocytosis (Hardy et al., 1985; Weigel and Yik, 2002). In vitro studies of ASGPR complexes typically involve competitive blocking with an excess of asialoglycoproteins to identify potential ligands and determine carbohydrate structure specificities. The AMR was first determined as a galactose-binding receptor using preparations of asialo-ceruloplasmin, free of sialic acid with exposed terminal galactose (Morell et al., 1971; van den Hamer et al., 1970). Asialofetuin is a high-affinity natural ligand for the ASGPR system; its glycan pool is made up of about two-thirds triantennary and one-third biantennary structures on three sites (Morelle et al., 2009; Yet et al., 1988). Asialo-orosomucoid (ASOR), a glycoprotein with tri- and tetra-antennary N-linked glycans, also binds specific oligomers of the receptor (Baenziger and Fiete, 1979; Bider et al., 1995; Yik et al., 2002). The use of such blocking agents in competitive binding studies have identified changes in the activities or half-lives of Factor IX, Factor X, fibrinogen (FI), von Willebrand factor (VWF), fibronectin, plasminogen activator, prothrombin, and antithrombin (Ellies et al., 2002; Rotundo et al., 1998; Smedsrod and Einarsson, 1990; Vostal and McCauley, 1991). Besides glycoproteins in the blood coagulation cascade, half-lives of alkaline phosphatase, g-glutamyltransferase and immunoglobulins are also modulated by ASGPR activity (Blom et al., 1998; Mortensen and Huseby, 1997; Thornburg et al., 1980; Tomana et al., 1985; Rifai et al., 2000). Specificities of the receptors and their relative binding affinities are also dependent upon ligand size and the precise spatial arrangement and clustering of the
226
Prabhjit K. Grewal
A 21
L-
12
L-
H
22
L-
12
13
L-
L-
H
H
12
L-
H
:H
22
L-
13
L-
H
:H
NH2
B b4
:H
b3
b4
b2
b2 a6
b4 b4
a3
b4
b4
b2
b4 b4
b2 a6
a3
b4
b4 b2
b2 a6
b4
b4
b4
b4
b4
b4
Asn
Asn
a3
Asn
Figure 13.1 Oligomerization of HL-1 and HL-2 glycoproteins to form functional variants of the AMR with multiantennary ligand specificities. (A) The receptor complexes are comprised of subunits of specialized cell surface type-2 membrane proteins that can combine as homo- and hetero-oligomers to form an array of receptor conformations, perhaps thereby altering substrate selectivity, binding affinities, and rates of endocytosis (reviewed in Weigel and Yik, 2002). The HL-12HL-21 trimer core is the most abundant conformation with highest affinity; others identified include HL12 and HL13, HL12–HL22, HL13–HL22 (Bider et al., 1995,1996; Braiterman et al., 1989; Hardy et al., 1985; Henis et al., 1990; Ruiz and Drickamer, 1996; Saxena et al., 2002). Binding avidity depends on glycan recognition and on ligand size and stoichiometry and intermolecular distances of the subunits (Baenziger and Fiete, 1980). (B) Increased binding avidity occurs in the presence of multiple terminal linkages and can reflect the presence of multiantennary galactose-terminated structures (Rice and Lee, 1990); Nlinked glycan ligands are shown. Asialofetuin, a high-affinity ligand of AMR, carries triantennary and biantennary N-glycan structures. AMR can also bind O-glycans, not shown (Coombs et al., 2006). Key to symbols: open circles, galactose; black filled squares, N-acetylglucosamine; grey filled circles, mannose.
glycan chains (Rensen et al., 2001; Van der Smissen et al., 1993; Weisz and Schnaar, 1991), although binding specificities can be altered by cooperation and competition for glycans (Lee et al., 1983; Wahrenbrock and Varki, 2006).
Hepatic Lectins and Asialoglycoprotein Clearance
227
2. Endogenous Ligands of the AMR Since the discovery of the AMR over 35 years ago, endogenous ligands have been difficult to identify. Mice lacking either of the two AMR subunits appear overtly normal and do not accumulate asialoglycoproteins in their blood (Braun et al., 1996; Ishibashi et al., 1994; Tozawa et al., 2001). Chronic assault from various toxins revealed changes in the expression, distribution, and function of the receptor and cell survival, suggesting a potential role in liver injury and regeneration (Dalton et al., 2003a,b; Dini et al., 1993; McVicker et al., 2002; Sugahara et al., 2003). A recent report indicates increases in acute inflammation markers, including haptoglobin, serum amyloid protein (SAP), and carboxylesterase in HL-2/ mice (Steirer et al., 2009). As a2,3-linked sialic acid can mask underlying ASGPR ligands on glycoproteins, we suspected that reducing the expression of these sialic acid linkages in vivo among endogenous glycoproteins might unmask ligand identity and thereby facilitate investigations of AMR function in biology and disease. Our lab previously reported that when the ST3Gal-IV sialyltransferase is limiting or absent, such ligands appear on a subset of regulatory and prothrombotic components of the mammalian blood coagulation system, including VWF and platelets (Ellies et al., 2002). In continued studies, we revealed that endogenous ASGPR activity is poised to cause rapid hemostatic modulation in response to a reduced sialylation state of platelets, VWF, and possibly other blood components. We recently showed that VWF and platelets were indeed endogenous ligands of the AMR system and that they are subject to clearance during pathologic conditions of rapid desialylation, such as bloodstream infection with a microbe expressing sialidase (neuraminidase) activity, namely Streptococcus pneumoniae (Grewal et al., 2008). Furthermore, our findings indicate that the marked thrombocytopenia closely associated with S. pneumoniae sepsis is neither mediated by the pathogen per se nor due to platelet consumption in Disseminated Intravascular Coagulopathy (DIC). Instead, thrombocytopenia is the result of an adaptive response by the AMR in the clearance of platelets that are first desialylated by the NanA sialidase of the pathogen. Host glycoprotein remodeling by S. pneumoniae NanA retards the onset of severe hematologic changes that are indicative of acute DIC. Consequently, a subset of wild-type mice can survive challenge with limiting doses of S. pneumoniae that are lethal to littermates deficient in AMR receptor function (Grewal et al., 2008). Could moderating DIC and inflammation in sepsis by engaging the AMR mitigate coagulopathy and enhance survival? Our recent novel studies on the AMR and its ligands may provide new opportunities to explore the biology of coagulation and inflammation in sepsis-induced DIC and evaluate clearance mechanisms mediated through the action of the AMR, a liver receptor with demonstrated high-capacity, rapid clearance capabilities.
228
Prabhjit K. Grewal
3. Hepatocytes in Molecular Clearance Mechanisms of the Liver The reticuloendothelial system, including the macrophages of spleen and liver, is main route for phagocytic removal of unwanted circulatory components. A two-compartment exponential clearance involving both the spleen and liver exists for the clearance of damaged platelets with rapid velocity of clearance correlating with hepatic platelet localization (Kaplan et al., 1984). As the largest gland in the body, the liver is a major anatomic site of normal platelet clearance; Kupffer cells, the resident macrophages localized within sinusoids representing 15% of the liver, are the main contributors to this clearance activity through the action of scavenger receptors (Stratton et al., 1989). The localization of Kupffer cells within the blood flowing sinusoids of the liver ensure they are positioned to encounter and snare material ‘‘marked’’ for removal from the circulatory system. Liver sinusoidal endothelial cells mediate clearance via hyaluronan-receptor- or mannosereceptor-mediated endocytosis (Elvevold et al., 2008; Zhou et al., 2000). The hepatocytes comprise 60% of the liver cells and are physically separated from the porous sinusoids by an endothelial cell barrier (Malarkey et al., 2005; Wisse et al., 1985). However, fenestrations in the sinusoidal endothelial cells can allow for interaction via hepatocyte microvilli protrusions into the lumen (Warren et al., 2006). Zonal heterogeneity, number and diameter size of sinusoidal fenestrae and gap formation vary in response to stimuli from hormones, drugs, toxins, diseases, and aging (Braet and Wisse, 2002; Cogger et al., 2004; Ito et al., 2006; Malarkey et al., 2005). Hepatocytes are not generally considered to have a significant role in clearance though they are capable of internalizing particles ranging in sizes from a few nanometers up to 1.5 m (Soji et al., 1992). However, this uptake is not uniformly distributed throughout the liver; there is zonal heterogeneity of hepatocytic uptake of exogenous particles within and between liver lobules (Hardonk et al., 1985; Soji et al., 1992). Gradient differences in cell and matrix composition and hence activities of hepatocytes and proximity to active Kupffer cells highlight different functional properties between periportal and centrilobular hepatocyte cells (Gebhardt, 1992; Lindros et al., 1997). In addition, cross-talk and cooperation between liver cells allows hepatocytes to become more phagocytic when quantity of exogenous material exceeds capacity of the activated Kupffer cells (Kmiec´, 2001; Malarkey et al., 2005). Platelets, 1–3 m, have been observed to translocate to hepatocytes in response to IL-1 or TNF cytokine signals from Kupffer cells (Nakamura et al., 1998). Furthermore, studies of platelet binding and internalization and our recent findings report the ability of hepatocytes to ingest glycoproteins bearing terminal galactose structures (Grewal et al., 2008; Rumjantseva et al., 2009; Srensen et al., 2009). Furthermore, we showed this to be an AMR-dependent mechanism with
229
Hepatic Lectins and Asialoglycoprotein Clearance
175
***
300
Plasma activity (% WT)
250 200 150 100 50
150
***
125 100 75 50 25
HL-1–/–
FX I FX II
II FI X
FV I
FX I FX II
–/–
-2 HL
-1 –/– HL
II FI X
0
0
FV I
Plasma VWF (% WT)
350
HL-2 –/–
Figure 13.2 Coagulation factor levels in AMR-deficient mice. Plasma VWF and FVIII levels are increased in HL-1-deficient mice compared to WT littermates and to HL-2-deficient mice (figure reproduced from Grewal et al., 2008). Horizontal bars indicate median VWF abundance, and vertical bars denote the interquartile range (left). Coagulation factor measurements in mice lacking either HL-1 or HL-2 compared with WT littermates (right). ***P < 0.001.
both HL-1 and HL-2 subunits being necessary for platelet clearance, while only HL-1 operates to remove VWF from circulation. Furthermore, HL-1deficient mice bear a unique defect that includes increased levels of VWF in circulation (Fig. 13.2; Grewal et al., 2008).
4. Genotyping HL-1- or HL-2-Deficient Mice DNA for genotyping PCR prepared from of a single mouse toe is placed in 20 l digestion buffer (50 mM Tris, pH 8.0, 20 mM NaCl, 1 mM EDTA, pH 8.0, 1% SDS) with 0.2 l of 5 mg/ml proteinase K solution and incubated at 55 C for a minimum of 2 h to overnight. Following digestion treatment, 500 l dH2O is added to each sample and incubated on 100 C heat-block for 10 min to inactivate the proteinase K. Following centrifugation at 13,000g for 30 s, 0.5 l DNA is used per 20 l genotyping diagnostic PCR reaction. Primers used in the analysis are as follows: HL-1f: 50 -CAG GCT TGG GAG CAG ATA GG-30 HL-1r: 50 -CAG TAG GCC CCA CAC CTT-30 HL-1r2: 50 -CGC CTT CTA TCG CCT TCT TG-30 HL-2f: 50 -TGG AGG GAA GGC TGC AGA GC-30 HL-2r: 50 -CCT GCC CTG TGT GAG TTC CTG-30 HL-2r2: 50 -GAT TGG GAA GAC AAT AGC AGG CAT GC-30
230
Prabhjit K. Grewal
HL-1 bp 1400 1000 750 500
M
+/+
+/-
-/-
N
750 bp 500 bp HL-2
bp 750 500 400 300
M
+/+
+/-
-/-
N 550 bp 360 bp
200
Figure 13.3 PCR genotyping. The PCR products for HL-1 and HL-2 genotyping are resolved on 1% and 3% agarose gels, respectively, stained with ethidium bromide. The expected sizes of PCR products for wt and null alleles are 500 and 750 bp with HL-1f/ HL-1r/HL-1r2 and 550 and 360 bp with HL-2f/HL-2r/HL-2r2 (indicated by arrowheads).
PCR is carried out using rTaq (Takara) with the following conditions: 95 C 2 min (1 cycle); 95 C 30 s, 63 C 30 s, 72 C 60 s (35 cycles); 72 C 2 min (1 cycle) for HL-1 PCR genotyping, or 95 C 2 min (1 cycle); 95 C 30 s, 60 C 30 s, 72 C 30 s (35 cycles); 72 C 2 min (1 cycle) for HL-2 PCR genotyping. A multiplexed PCR with three primers for each genotype clearly distinguishes wild-type, homozygous-null, and heterozygous DNA (Fig. 13.3).
5. Hematology and Coagulation Analyses Methods (Partly Adapted from Ellies et al., 2002; Grewal et al., 2008; Wang et al., 2001) 5.1. Method for measuring platelet levels and glycosylation by lectin binding Platelet count is performed on whole blood collected in citrate or heparinor EDTA-Vacutainer tubes (Becton Dickinson) in duplicate on a Hemavet 850FS Multi Species Hematology System (Drew Scientific, CT) programmed with mouse hematology settings. A whole blood smear is simultaneously prepared from each sample and Wright stained for manual viewing.
Hepatic Lectins and Asialoglycoprotein Clearance
231
Whole blood with anticoagulant is diluted 1:30 in Tyrode’s platelet buffer (150 mM NaCl, 5 mM KCl, 1 mM MgSO4, 10 mM HEPES, pH 7.4) prior to staining for cytometric analyses to determine platelet surface glycosylation alterations such as galactose exposure. Hundred microliters of diluted blood is incubated with 0.5 l of PE-conjugated platelet-specific antibodies (antiCD41, platelet-specific antibody; anti-CD61, activation-independent platelet antibody; CD62P, activation-dependent platelet antibody) or isotype controls and 0.5–5 g/ml fluorescein isothiocyanate (FITC)-conjugated lectins (Erythrina cristagalli (ECA), Peanut agglutinin (PNA), or Sambucus nigra (SNA) at 3– 5 g/ml; Ricinus communis I (RCA) at 0.5–2 g/ml, Vector Laboratories). Samples are gently mixed before incubation for 15 min at room temperature in the dark. Cells are pelleted by centrifugation at 800g for 3 min, supernatant removed and cells resuspended in 300 l platelet buffer. Data from 10,000 inactivated platelet events determined by platelet-specific antibody binding as well as forward- and side-scatter are analyzed on a FACScan flow cytometer by using CELLQUEST software (Becton Dickinson).
5.2. Methods for determining clotting times 5.2.1. Prothrombin time (PT) Clotting times are determined in duplicate with an ST4 semiautomated mechanical coagulation instrument (Diagnostica Stago, NJ). Thirty microliters of citrated plasma is preincubated at 37 C for 3 min, before the addition of 60 l of thromboplastin reagent (Thromboplastin C Plus, Dade Behring, Germany) prewarmed to 37 C to initiate clotting. Time until clot formation is measured in seconds and samples are tested in duplicate. 5.2.2. Activated partial thromboplastin time Clotting times are determined in duplicate with an ST4 semiautomated mechanical coagulation instrument (Diagnostica Stago, NJ). Thirty microliters of citrated plasma is preincubated with 30 l of activated partial thromboplastin time (APTT) reagent (Automated APTT, Trinity Biotech, NJ) at 37 C for 5 min before the addition of 30 l of 25 mM 37 C CaCl2 to initiate clotting. Time until clot formation is measured in seconds and samples are tested in duplicate.
5.3. Methods for measuring coagulation factor activity or antigen levels 5.3.1. Antithrombin activity assay Forty microliters of citrated plasma samples diluted 1:40 and 1:80 in 25 mM HEPES, pH 7.5, 150 mM NaCl, and 0.1% BSA (HN/BSA) are incubated in microtiter plate wells with 40 l factor Xa/heparin reagent (0.4 g/ml
232
Prabhjit K. Grewal
factor Xa (Enzyme Research Labs, IN) and 10 U/ml unfractionated heparin) for 3 min at 37 C. Then 40 l of 1.25 mg/ml chromogenic substrate specific for factor Xa (S-2765, DiaPharma, West Chester, OH) is added to each well and the color developed is read at 405 nm. Samples are tested in duplicate, and absorbances are converted to percent normal reference mouse citrated plasma (NMP) antithrombin from a standard curve established from a serial dilution of NMP (1:20–1:640) simultaneously prepared and assayed as described for samples. 5.3.2. Protein C activity assay Protein C activity is measured by chromogenic substrate specific for Activated Protein C (APC) in diluted citrated plasma samples incubated with protein C activator using 96-well plates read by a Versa Max microtiter plate reader (Molecular Devices, CA). Ten microliters of sample citrated plasma dilution [1/10 in TBS (25 mM Tris, 150 mM NaCl, pH 7.5) with 100 mM CsCl] is incubated at 37 C for 15 min with 25 ml of protein C activator (2 U/ml) isolated from copperhead snake venom (Protac, American Diagnostica, Inc., Greenwich, CT). Twenty-five microliters of 2.5 mM chromogenic substrate specific for APC (S-2366, DiaPharma, West Chester, OH) is added, and plate is covered and incubated at 37 C for 2–3 h. Twenty-five microliters of 20% acetic acid is added, and absorbance at 405 nm is measured. Samples are tested in duplicate and absorbances are converted to percent NMP protein C from a standard curve made from a serial dilution of NMP (1/4–1/64) simultaneously prepared and assayed as described for samples. 5.3.3. Protein S antigen assay ELISA-based assay: A 96-well microtiter plate is incubated overnight at 5 C with 100 l of 10 g/ml rabbit anti-human Protein S polyclonal antibody (Dako, Denmark) prepared in 50 mM Na2CO3, pH 9.6. The wells are then blocked with 200 l 25 mM Tris, pH 7.5, 150 mM NaCl (TBS) containing 3% BSA for 3–5 h at 37 C or overnight at 5 C. After washing with TBS containing 1% BSA (TBS/1%BSA), 100 l of plasma samples, diluted 1/200 in TBS/1%BSA, are incubated in the wells overnight at 5 C followed by washing five times with TBS containing 0.05% Tween 20 (TBS/Tween). The wells are then incubated with 100 l of horseradish peroxidase-conjugated rabbit anti-human Protein S polyclonal antibodies (Dako) diluted 1/ 1000 in TBS/1%BSA overnight at 5 C. After a further five washes with TBS/Tween, the color is developed using a TMB peroxidase substrate (Bio-Rad, CA) according to the manufacturer’s instruction. After 4 h, 100 ml of 1 N H2SO4 is added to the wells to stop color development. Absorbance at 450 nm is measured using a Versa Max microplate reader (Molecular Devices, CA) as an endpoint assay. Samples are tested in duplicate and absorbances are converted to percent NMP protein S from a
Hepatic Lectins and Asialoglycoprotein Clearance
233
standard curve made from a serial dilution of NMP (1/25–1/800) simultaneously prepared and assayed as described for samples. 5.3.4. Plasminogen activity assay Urokinase activated plasminogen is measured by chromogenic substrate specific for plasmin and urokinase activated plasminogen in diluted citrated plasma samples using 96-well plates read by a Versa Max microplate reader (Molecular Devices, CA). Sixty microliters of plasma sample dilution (1/50 in 100 mM Tris pH 8.5 with 8.3 mM EACA; Calbiochem, La Jolla, CA) is incubated at 37 C for 90 s. Twenty microliters of 2500 Ploug u/ml urokinase (Calbiochem, La Jolla, CA) is added to each sample in well and incubated 60 s. Hundred microliters of 1.2 mM chromogenic substrate specific for plasmin and urokinase activated plasminogen (S-2403, DiaPharma, West Chester, OH) in 25 mM HEPES, 150 mM NaCl, pH 7.4 (HN buffer) are added. After 10 min, 100 ml of 20% acetic acid is added to the wells to stop color development. Absorbance at 405 nm is measured. Samples are tested in duplicate and absorbances are converted to percent NMP plasminogen from a standard curve made from a serial dilution of NMP (1/10–1/320) simultaneously prepared and assayed as described for samples. 5.3.5. Alpha-2 antiplasmin assay Inactivation of plasmin by alpha-2 antiplasmin is measured by chromogenic substrate specific for plasmin in diluted citrated plasma samples with added plasmin using 96-well plates read by a Versa Max microplate reader (Molecular Devices, CA). Fifty microliters of plasma sample dilution (1/40 in TBS with 120 mM methylamine) is incubated at 37 C for 10 min. Fifty microliters of 10 mg/ml plasmin (Calbiochem, La Jolla, CA) is added to each sample per well and incubated for 90 s. Fifty microliters of 3 mM chromogenic substrate specific for plasmin (S-2403, DiaPharma, West Chester, OH) is added. After 10 min, 50 ml of 20% acetic acid is added to the wells to stop color development. Residual plasmin is measured by reading absorbance at 405 nm. Samples are tested in duplicate and absorbances are converted to percent NMP alpha-2 antiplasmin from a standard curve made from a serial dilution of NMP (1:10–1:320) simultaneously prepared and assayed as described for samples. 5.3.6. Fibrinogen activity assay FI activity is measured by thrombin clotting time of diluted citrated test plasma. Forty-five microliters of sample citrated plasma dilution (1/15 in 1 Owren’s Veronal Buffer) is incubated for 3 min at 37 C. 22.5 ml of bovine thrombin reagent (Dade Data-Fi thrombin reagent, Baxter, Miami, FL) is added to activate formation of the fibrin clot. Clotting times are converted to FI concentration from a log–log standard curve prepared with dilutions
234
Prabhjit K. Grewal
(1/5, 1/10, 1/20, 1/30, 1/40; in Owren’s Veronal Buffer) of standardized plasma of calibrated FI concentration (Dade Data-Fi Fibrinogen Calibration Reference). Samples are tested in duplicate and converted using standard curves prepared the same day. 5.3.7. Factor VII activity assay Clotting times are determined in duplicate with an ST4 semiautomated mechanical coagulation instrument (Diagnostica Stago, NJ). Thirty microliters of sample citrated plasma diluted 1/50 in Owren’s Veronal Buffer is incubated with 30 l of citrated plasma deficient of factor VII at 37 C for 3 min, followed by the addition of 60 l of thromboplastin reagent (Thromboplastin C Plus, Dade Behring, Germany) prewarmed to 37 C to initiate clotting. Time until clot formation is measured and interpolated on a standard curve of a serial dilution of NMP tested as described to give reported result in %NMP factor VII. 5.3.8. Factor VIII activity assay Clotting times are determined in duplicate with an ST4 semiautomated mechanical coagulation instrument (Diagnostica Stago, NJ). Thirty microliters of sample citrated plasma diluted 1/20 in HN/BSA buffer is incubated with 30 l of APTT reagent (Automated APTT, Trinity Biotech, NJ) and 30 l of citrated plasma deficient of factor VIII at 37 C for 5 min, followed by the addition of 30 l of 25 mM 37 C CaCl2 to initiate clotting. Time until clot formation is measured and interpolated on a standard curve of a serial dilution of NMP tested as described to give reported result in %NMP factor VIII. 5.3.9. Factor IX, factor XI, and factor XII activity assays Same as factor VIII method, with plasma deficient of the specific factor being measured in place of factor VIII-deficient plasma. 5.3.10. Factor II, factor V, and factor X activity assays Same as factor VII or factor VIII method, with plasma deficient of the specific factor being measured in place of factor VII- or factor VIII-deficient plasma. In either assay factor II is diluted 1/20, factors V and X are diluted 1/50. 5.3.11. Factor X antigen assay ELISA-based assay using antimouse FX polyclonal antibodies PAMFXSIA, 100 g and PAMFX-SIA-HRP, 200 g (Hematologic Technologies Inc., VT, USA). A 96-well microtiter plate is incubated overnight at 5 C with 100 l of 10 g/ml sheep anti-mouse FX polyclonal antibody (Hematologic Technologies, Inc., VT, USA) prepared in 50 mM Na2CO3, pH 9.6. The wells are then blocked with 200 l 25 mM Tris, pH 7.5, 150 mM NaCl (TBS) containing 3% BSA 3–5 h at 37 C or overnight at 5 C. After washing with TBS containing 1% BSA (TBS/1%BSA), 100 l of plasma
Hepatic Lectins and Asialoglycoprotein Clearance
235
samples, diluted 1/500 in TBS/1%BSA, are incubated in the wells overnight at 5 C followed by washing five times with TBS containing 0.05% Tween 20 (TBS/Tween). The wells are then incubated with 100 l of horseradish peroxidase-conjugated sheep anti-mouse FX polyclonal antibodies (Hematologic Technologies, Inc., VT, USA) diluted 1/250 (2.1 g/ ml) in TBS/1%BSA overnight at 5 C. After washing again five times with TBS/Tween, the color is developed using a TMB peroxidase substrate (Bio-Rad, CA) according to the manufacturer’s instruction and read at 655 nm using a Versa Max microplate reader (Molecular Devices, CA). Samples are tested in duplicate and absorbances are converted to percent NMP FX from a standard curve made from a serial dilution of NMP (1/ 100–1/16400) simultaneously prepared and assayed as described for samples. 5.3.12. Von Willebrand Factor antigen assay ELISA-based assay: A 96-well microtiter plate is incubated overnight at 5 C with 100 l of 10 g/ml rabbit anti-human VWF polyclonal antibody (Dako, Denmark) prepared in 50 mM Na2CO3, pH 9.6. The wells are then blocked with 200 l 25 mM Tris, pH 7.5, 150 mM NaCl (TBS) containing 3% BSA 3–5 h at 37 C or overnight at 5 C. After washing with TBS containing 1% BSA (TBS/1%BSA), 100 l of citrated plasma samples, diluted 1/200 in TBS/1%BSA, are incubated in the wells overnight at 5 C followed by washing five times with TBS containing 0.05% Tween 20 (TBS/Tween). The wells are then incubated with 100 l of horseradish peroxidase-conjugated rabbit anti-human VWF polyclonal antibodies (Dako) diluted 1/2000 in TBS/1%BSA overnight at 5 C. After washing again five times with TBS/Tween, the color is developed using a TMB peroxidase substrate (Bio-Rad, CA) according to the manufacturer’s instruction and read at 655 nm using a Versa Max microplate reader (Molecular Devices, CA). Samples are tested in duplicate and absorbances are converted to percent NMP VWF from a standard curve made from a serial dilution of NMP (1/25–1/1600) simultaneously prepared and assayed as described for samples.
5.4. Method for detecting glycosylation of VWF by lectin binding 5.4.1. Von Willebrand factor lectin-binding assay Sandwich ELISA-based assay: A 96-well microtiter plate is incubated overnight at 5 C with 100 l of 1 g/ml rabbit antihuman VWF polyclonal antibody (Dako, Denmark) prepared in 50 mM Na2CO3, pH 9.6. The wells are then blocked with 200 l 25 mM Tris, pH 7.5, 150 mM NaCl (TBS) containing 3% BSA for 3–5 h at 37 C or overnight at 5 C. After washing with TBS containing 1% BSA (TBS/1%BSA), 100 l of plasma samples, diluted 1/100 in TBS/1%BSA, are incubated in the wells overnight at 5 C
236
Prabhjit K. Grewal
followed by washing five times with TBS containing 0.05% Tween 20 (TBS/Tween). The wells are then incubated with with 100 ml of 1.0 mg/ml biotinylated lectin in TBS/1%BSA for 45 min at room temperature. The plate is washed five times with TBS/Tween. Wells are incubated with 100 ml of PBS containing a complex of avidin and biotinylated horseradish peroxidase (Vectastain Elite ABC Kit, Vector Laboratories, CA) for 30 min at room temperature. After washing again five times with TBS/Tween, the color is developed using a TMB peroxidase substrate (Bio-Rad, CA) according to the manufacturer’s instruction and read at 655 nm using a Versa Max microplate reader (Molecular Devices, CA). Samples are tested in duplicate, and absorbances are converted to percent NMP VWF lectinbinding from a standard curve made from a serial dilution of NMP (1/25–1/ 1600) simultaneously prepared and assayed as described for samples.
ACKNOWLEDGMENTS This work was supported by NIH grant HL-57345 (Jamey D. Marth and Dzung T Le). David Ditto and Dzung T. Le, of the Murine Hematology and Coagulation Laboratory, University of California, San Diego are gratefully acknowledged for technical support and expertise.
REFERENCES Ashwell, G., and Harford, J. (1982). Carbohydrate-specific receptors of the liver. Ann. Rev. Biochem. 51, 531–534. Ashwell, G., and Kawasaki, T. (1978). A protein from mammalian liver that specifically binds galactose-terminated glycoproteins. Methods Enzymol. 50, 287–288. Ashwell, G., and Morell, A. (1974). The role of surface carbohydrates in the hepatic recognition and transport of circulating glycoproteins. Adv. Enzymol. Rel. Areas Mol. Biol. 41, 99–128. Baenziger, J. U., and Fiete, D. (1979). Structure of the complex oligosaccharides of fetuin. J. Biol. Chem. 254, 789–795. Baenziger, J. U., and Fiete, D. (1980). Galactose and N-acetylgalactosamine-specific endocytosis of glycopeptides by isolated rat hepatocytes. Cell 254, 789–795. Bider, M. D., Cescato, R., Jeno, P., and Speiss, M. (1995). High-affinity ligand binding to subunit H1 of the asialoglycoprotein receptor in the absence of subunit H2. Eur. J. Biochem. 230, 207–212. Bider, M. D., Wahlberg, J. M., Kammerer, R. A., and Spiess, M. (1996). The oligomerization domain of the asialoglycoprotein receptor preferentially forms 2:2 heterotetramers in vitro. J. Biol. Chem. 271, 31996–32001. Blom, E., Ali, M., Mortensen, B., and Huseby, N. (1998). Elimination of alkaline phosphatases from circulation by the galactose receptor. Different isoforms are cleared at various rates. Clin. Chim. Acta 270, 125–137. Braet, F., and Wisse, E. (2002). Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: A review. Comp. Hepatol. 23, 1–17.
Hepatic Lectins and Asialoglycoprotein Clearance
237
Braiterman, L. T., Chance, S. C., Porter, W. R., Lee, Y. C., Townsend, R. R., and Hubbard, A. L. (1989). The major subunit of the rat asialoglycoprotein receptor can function alone as a receptor. J. Biol. Chem. 264, 1682–1688. Braun, J. R., Willnow, T. E., Ishibashi, S., Ashwell, G., and Herz, J. (1996). The major subunit of the asialoglycoprotein receptor is expressed on the hepatocellular surface in mice lacking the minor receptor subunit. J. Biol. Chem. 271, 21160–21166. Burrows, L., Iobst, S. T., and Drickamer, K. (1997). Selective binding of N-acetylglucosamine to the chicken hepatic lectin. Biochem. J. 324, 673–680. Cogger, V., Muller, M., Fraser, R., McLean, A., Khan, J., and Le Couteur, D. (2004). The effects of oxidative stress on the liver sieve. J. Hepatol. 41, 370–376. Coombs, P. J., Taylor, M. E., and Drickamer, K. (2006). Two categories of mammalian galactose-binding receptors distinguished by glycan array profiling. Glycobiology 16, 1C–7C. Dalton, S., Wiegert, R., Baldwin, C., Kassel, K., and Casey, C. (2003a). Impaired receptormediated endocytosis by the asialoglycoprotein receptor in ethanol-fed mice: Implications for studying the role of this receptor in alcoholic apoptosis. Biochem. Pharmacol. 65, 535–543. Dalton, S., Wiegert, R., and Casey, C. (2003b). Receptor-mediated endocytosis by the asialoglycoprotein receptor: Effect of ethanol administration on endosomal distribution of receptor and ligand. Liver Int. 23, 484–491. Dini, L., Falasca, L., Lentini, A., Mattioli, P., Piacentini, M., Piredda, L., and Autuori, F. (1993). Galactose-specific receptor modulation related to the onset of apoptosis in rat liver. Eur. J. Cell Biol. 61, 329–337. Drickamer, K. (1999). C-type lectin-like domains. Curr. Opin. Struct. Biol. 9, 585–590. Drickamer, K., Mamon, J. F., Binns, G., and Leung, J. O. (1984). Primary structure of the rat liver asialoglycoprotein receptor. Structural evidence for multiple polypeptide species. J. Biol. Chem. 259, 770–778. Ellies, L. G., Ditto, D., Levy, G. G., Wahrenbrock, M., Ginsburg, D., Varki, A., Le, D. T., and Marth, J. D. (2002). Sialyltransferase ST3Gal-IV operates as a dominant modifier of hemostasis by concealing asialoglycoprotein receptor ligands. Proc. Natl. Acad. Sci. USA 99, 10042–10047. Elvevold, K., Simon-Santamaria, J., Hasvold, H., McCourt, P., Smedsrd, B., and Srensen, K. (2008). Liver sinusoidal endothelial cells depend on mannose receptormediated recruitment of lysosomal enzymes for normal degradation capacity. Hepatology 48, 2007–2015. Gebhardt, R. (1992). Cell–cell interactions: Clues to hepatocyte heterogeneity and beyond? Hepatology 16, 843–845. Grewal, P. K., Uchiyama, S., Ditto, D., Varki, N., Le, D. T., Nizet, V., and Marth, J. D. (2008). The Ashwell receptor mitigates the lethal coagulopathy of sepsis. Nat. Med. 14, 648–655. Halberg, D. F., Wager, R. E., Farrell, D. C., Hildreth, J.t., Quesenberry, M. S., Loeb, J. A., Holland, E. C., and Drickamer, K. (1987). Major and minor forms of the rat liver asialoglycoprotein receptor are independent galactose-binding proteins. Primary structure and glycosylation heterogeneity of minor receptor forms. J. Biol. Chem. 262, 9828–9838. Hardonk, M., Harms, G., and Koudstaal, J. (1985). Zonal heterogeneity of rat hepatocytes in the in vivo uptake of 17 nm colloidal gold granules. Histochem. Cell Biol. 83, 473–477. Hardy, M., Townsend, R., Parkhurst, S., and Lee, Y. (1985). Different modes of ligand binding to the hepatic galactose/N-acetylgalactosamine lectin on the surface of rabbit hepatocytes. Biochemistry 1, 22–28. Henis, Y. I., Katzir, Z., Shia, M. A., and Lodish, H. F. (1990). Oligomeric structure of the human asialoglycoprotein receptor: Nature and stoichiometry of mutual complexes containing H1 and H2 polypeptides assessed by fluorescence photobleaching recovery. J. Cell Biol. 111, 1409–1418.
238
Prabhjit K. Grewal
Hong, W., Le, A. V., and Doyle, D. (1988). Identification and characterization of a murine receptor for galactose-terminated glycoproteins. Hepatology 8, 553–558. Hudgin, R. L., Pricer, W. E., Jr., Ashwell, G., Stockert, R. J., and Morell, A. G. (1974). The isolation and properties of a rabbit liver binding protein specific for asialoglycoproteins. J. Biol. Chem. 249, 5536–5543. Ishibashi, S., Hammer, R. E., and Herz, J. (1994). Asialoglycoprotein receptor deficiency in mice lacking the minor receptor subunit. J. Biol. Chem. 269, 27803–27806. Ito, Y., Abril, E., Bethea, N., McCuskey, M., Cover, C., Jaeschke, H., and McCuskey, R. (2006). Mechanisms and pathophysiological implications of sinusoidal endothelial cell gap formation following treatment with galactosamine/endotoxin in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 291, 211–218. Kaplan, J., Moon, D., Minnear, F., and Saba, T. (1984). Depressed reticuloendothelial clearance of platelets in rats after trauma. Am. J. Physiol. 246, 180–188. Kawasaki, T., and Ashwell, G. (1977). Isolation and characterization of an avian hepatic binding protein specific for N-acetylglucosamine-terminated glycoproteins. J. Biol. Chem. 252, 6536–6543. Kmiec´, Z. (2001). Cooperation of liver cells in health and disease. Adv. Anat. Embryol. Cell Biol. 161, 1–51. Kuhlenschmidt, T., and Lee, Y. (1984). Specificity of chicken liver carbohydrate binding protein. Biochemistry 23, 3569–3575. Lee, Y. C., Townsend, R. R., Hardy, M. R., Lonngren, J., Arnarp, J., Haraldsson, M., and Lonn, H. (1983). Binding of synthetic oligosaccharides to the hepatic Gal/GalNAc lectin. Dependence on fine structural features. J. Biol. Chem. 258, 199–202. Lindros, K., Oinonen, T., Issakainen, J., Nagy, P., and Thorgeirsson, S. (1997). Zonal distribution of transcripts of four hepatic transcription factors in the mature rat liver. Cell Biol. Toxicol. 13, 257–262. Loeb, J., and Drickamer, K. (1987). The chicken receptor for endocytosis of glycoproteins contains a cluster of N-acetylglucosamine-binding sites. J. Biol. Chem. 262, 3022–3029. Malarkey, D., Johnson, K., Ryan, L., Boorman, G., and Maronpot, R. (2005). New insights into functional aspects of liver morphology. Toxicol. Pathol. 33, 27–34. McVicker, B., Tuma, D., Kubik, J., Hindemith, A., Baldwin, C., and Casey, C. (2002). The effect of ethanol on asialoglycoprotein receptor-mediated phagocytosis of apoptotic cells by rat hepatocytes. Hepatology 36, 1478–1487. Monroe, R. S., and Huber, B. E. (1994). The major form of the murine asialoglycoprotein receptor: cDNA sequence and expression in liver, testis and epididymis. Gene 148, 237–244. Morell, A. G., Gregoriadis, G., Scheinberg, I. H., Hickman, J., and Ashwell, G. (1971). The role of sialic acid in determining the survival of glycoproteins in the circulation. J. Biol. Chem. 246, 1461–1467. Morelle, W., Faid, V., Chirat, F., and Michalski, J. (2009). Analysis of N- and O-linked glycans from glycoproteins using MALDI-TOF mass spectrometry. Methods Mol. Biol. 534, 5–21. Mortensen, B., and Huseby, N.-E. (1997). Clearance of circulating g-glutamyltransferase by the asialoglycoprotein receptor. Enzyme forms with different sialic acid content are eliminated at different clearance rates and without apparent desialylation. Clinica Chimica Acta 258, 47–58. Nakamura, M., Shibazaki, M., Nitta, Y., and Endo, Y. (1998). Translocation of platelets into Disse spaces and their entry into hepatocytes in response to lipopolysaccharides, interleukin-1 and tumour necrosis factor: The role of Kupffer cells. J. Hepatol. 28, 991–999. Paietta, E., Stockert, R. J., and Racevskis, J. (1992). Alternatively spliced variants of the human hepatic asialoglycoprotein receptor, H2, differ in cellular trafficking and regulation of phosphorylation. J. Biol. Chem. 267, 11078–11084.
Hepatic Lectins and Asialoglycoprotein Clearance
239
Park, E. I., and Baenziger, J. U. (2004). Closely related mammals have distinct asialoglycoprotein receptor carbohydrate specificities. J. Biol. Chem. 279, 40954–40959. Park, E. I., Mi, Y., Unverzagt, C., Gabius, H.-J., and Baenziger, J. U. (2005). The asialoglycoprotein receptor clears glycoconjugates terminating with sialic acid{alpha}2, 6GalNAc. Proc. Natl. Acad. Sci. USA 102, 17125–17129. Park, J.-H., Kim, K., and Cho, E.-W. (2006). Detection of surface asialoglycoprotein receptor expression in hepatic and extra-hepatic cells using a novel monoclonal antibody. Biotech. Lett. 28, 1061. Rensen, P. C. N., Sliedregt, L. A. J. M., Ferns, M., Kieviet, E., van Rossenberg, S. M. W., van Leeuwen, S. H., van Berkel, T. J. C., and Biessen, E. A. L. (2001). Determination of the upper size limit for uptake and processing of ligands by the asialoglycoprotein receptor on hepatocytes in vitro and in vivo. J. Biol. Chem. 276, 37577–37584. Rice, K. G., and Lee, Y. C. (1990). Modification of triantennary glycopeptide into probes for the asialoglycoprotein receptor of hepatocytes. J. Biol. Chem. 265, 18423–18428. Rice, K., Thomas, V., and Yang, Y. (2003). Probing the binding specificity of C-type lectins in vivo. Methods Enzymol. 363, 90–104. Rifai, A., Fadden, K., Morrison, S., and Chintalacharuvu, K. (2000). The N-glycans determine the differential blood clearance and hepatic uptake of human immunoglobulin (Ig)A1 and IgA2 isotypes. J. Exp. Med. 191, 2171–2182. Rotundo, R., Rebres, R., Mckeown-Longo, P., Blumenstock, F., and Saba, T. (1998). Circulating cellular fibronectin may be a natural ligand for the hepatic asialoglycoprotein receptor: Possible pathway for fibronectin deposition and turnover in the rat liver. Hepatology 28, 475–485. Ruiz, N. I., and Drickamer, K. (1996). Differential ligand binding by two subunits of the rat liver asialoglycoprotein receptor. Glycobiology 6, 551–559. Rumjantseva, V., Grewal, P. K., Wandall, H. H., Josefsson, E., Srensen, A. L., Larso, G., Marth, J. D., Hartwig, J. H., and Hoffmeister, K. M. (2009). Dual roles for hepatic lectin receptors in the clearance of chilled platelets. Nat. Med. 15, 1273–1280. Saxena, A., Yik, J. H. N., and Weigel, P. H. (2002). H2, the minor subunit of the human asialoglycoprotein receptor, trafficks intracellularly and forms homo-oligomers, but does not bind asialo-orosomucoid. J. Biol. Chem. 277, 35297–35304. Smedsrod, B., and Einarsson, M. (1990). Clearance of tissue plasminogen activator by mannose and galactose receptors in the liver. Thromb. Haemost. 63, 60–66. Soji, T., Murata, Y., Ohira, A., Nishizono, H., Tanaka, M., and Herbert, D. (1992). Evidence that hepatocytes can phagocytize exogenous substances. Anat. Rec. 233, 543–546. Srensen, A. L., Rumjantseva, V., Nayeb-Hashemi, S., Clausen, H., Hartwig, J. H., Wandall, H. H., and Hoffmeister, K. M. (2009). Clearance of platelets from the circulation by asialoglycoprotein receptor-expressing liver macrophages and hepatocytes. Blood 114, 1645–1654. Spiess, M., and Lodish, H. F. (1985). Sequence of a second human asialoglycoprotein receptor: Conservation of two receptor genes during evolution. Proc. Natl. Acad. Sci. USA 82, 6465–6469. Steirer, L. M., Park, E. I., Townsend, R. R., and Baenziger, J. U. (2009). The asialoglycoprotein receptor regulates levels of plasma glycoproteins terminating with sialic Acid {alpha}2, 6-galactose. J. Biol. Chem. 284, 3777. Stockert, R. J. (1995). The asialoglycoprotein receptor: Relationships between structure, function, and expression. Physiol. Rev. 75, 591–609. Stratton, J., Ballem, P., Gernsheimer, T., Cerqueira, M., and Slichter, S. (1989). Platelet destruction in autoimmune thrombocytopenic purpura: Kinetics and clearance of indium-111-labeled autologous platelets. J. Nucl. Med. 30, 629–637.
240
Prabhjit K. Grewal
Sugahara, K., Togashi, H., Takahashi, K., Onodera, Y., Sanjo, M., Misawa, K., Suzuki, A., Adachi, T., Ito, J., Okumoto, K., Hattori, E., Takeda, T., et al. (2003). Separate analysis of asialoglycoprotein receptors in the right and left hepatic lobes using Tc-GSA SPECT. Hepatology 38, 1401–1409. Takezawa, R., Shinzawa, K., Watanabe, Y., and Akaike, T. (1993). Determination of mouse major asialoglycoprotein receptor cDNA sequence. Biochim. Biophys. Acta 1171, 220–222. Thornburg, R., Day, J., Baynes, J., and Thorpe, S. (1980). Carbohydrate-mediated clearance of immune complexes from the circulation. A role for galactose residues in the hepatic uptake of IgG-antigen complexes. J. Biol. Chem 255, 6820–6825. Tomana, M., Phillips, J., Kulhavy, R., and Mestecky, J. (1985). Carbohydrate-mediated clearance of secretory IgA from the circulation. Mol. Immunol. 22, 887–892. Tozawa, R.-I., Ishibashi, S., Osuga, J.-I., Yamamoto, K., Yagyu, H., Ohashi, K., Tamura, Y., Yahagi, N., Iizuka, Y., Okazaki, H., Harada, K., Gotoda, T., et al. (2001). Asialoglycoprotein receptor deficiency in mice lacking the major receptor subunit. Its obligate requirement for the stable expression of oligomeric receptor. J. Biol. Chem. 276, 12624–12628. van den Hamer, C. J. A., Morell, A. G., Scheinberg, I. H., Hickman, J., and Ashwell, G. (1970). Physical and chemical studies on ceruloplasmin. The role of galactosyl residues in the clearance of ceruloplasmin from the circulation. J. Biol. Chem. 245, 4397–4402. van der Smissen, P., Vael, T., Courtoy, P., and Baudhuin, P. (1993). Ligand-induced clustering of asialoglycoprotein receptors on rat hepatocytes at 4 degrees C. Eur. J. Cell Biol. 60, 122–130. Verrey, F., and Drickamer, K. (1993). Determinants of oligomeric structure in the chicken liver glycoprotein receptor. Biochem. J. 292, 149–155. Vostal, J., and McCauley, R. (1991). Prothrombin plasma clearance is not mediated by hepatic asialoglycoprotein receptors. Thromb. Res. 63, 299–309. Wahrenbrock, M. G., and Varki, A. (2006). Multiple hepatic receptors cooperate to eliminate secretory mucins aberrantly entering the bloodstream: Are circulating cancer mucins the ‘‘tip of the iceberg’’? Cancer Res. 66, 2433–2441. Wang, Y., Tan, J., Sutton-Smith, M., Ditto, D., Panico, M., Campbell, R. M., Varki, N. M., Long, J. M., Jaeken, J., Levinson, S. R., Wynshaw-Boris, A., Morris, H. R., et al. (2001). Modeling human congenital disorder of glycosylation type IIa in the mouse: Conservation of asparagine-linked glycan-dependent functions in mammalian physiology and insights into disease pathogenesis. Glycobiology 11, 1051–1070. Warren, A., Le Couteur, D., Fraser, R., Bowen, D., McCaughan, G., and Bertolino, P. (2006). T lymphocytes interact with hepatocytes through fenestrations in murine liver sinusoidal endothelial cells. Hepatology 44, 1182–1190. Weigel, P. H. (1994). Galactosyl and N-acetylgalactosaminyl homeostasis: A function for mammalian asialoglycoprotein receptors. Bioessays 16, 519–524. Weigel, P. H., and Yik, J. H. N. (2002). Glycans as endocytosis signals: The cases of the asialoglycoprotein and hyaluronan/chondroitin sulfate receptors. Biochim. Biophys. Acta 1572, 341–363. Weisz, O., and Schnaar, R. (1991). Hepatocyte adhesion to carbohydrate-derivatized surfaces. II. Regulation of cytoskeletal organization and cell morphology. J. Cell Biol. 115, 495–504. Wisse, E., De Zanger, R., Charels, K., Van Der Smissen, P., and McCuskey, R. (1985). The liver sieve: Considerations concerning the structure and function of endothelial fenestrae, the sinusoidal wall and the space of Disse. Hepatology 5, 683–692. Yet, M.-G., Chin, C. C. Q., and Wold, F. (1988). The covalent structure of individual Nlinked glycopeptides from ovomucoid and asialofetuin. J. Biol. Chem. 263, 111–117.
Hepatic Lectins and Asialoglycoprotein Clearance
241
Yik, J. H. N., Saxena, A., and Weigel, P. H. (2002). The minor subunit splice variants, H2b and H2c, of the human asialoglycoprotein receptor are present with the major subunit H1 in different hetero-oligomeric receptor complexes. J. Biol. Chem. 277, 23076–23083. Zalik, S. (1991). On the possible role of endogenous lectins in early animal development. Anat. Embryol. 183, 521–536. Zhou, B., Weigel, J., Fauss, L., and Weigel, P. (2000). Identification of the hyaluronan receptor for endocytosis (HARE). J. Biol. Chem. 275, 37733–37741.
C H A P T E R
F O U R T E E N
Roles of GlcNAc-6-OSulfotransferases in Lymphoid and Nonlymphoid Tissues Hiroto Kawashima*,† Contents 244
1. Overview 2. Establishment of a Mouse Colon Adherent Cell Line and Cell Culture 3. Treatment of CAdC1 Cells with SCFAs 4. RT-PCR 5. Histology and Immunostaining 6. Preparation of Colonic-Mucin-Enriched Fraction 7. Carbohydrate Structural Analysis 8. Induction of Colitis by Dextran Sulfate Sodium Acknowledgments References
246 247 247 248 249 250 254 255 255
Abstract Recent studies using sulfotransferase-deficient mice have revealed various physiological functions of sulfated glycans. Studies using gene-targeted mice deficient in both N-acetylglucosamine-6-O-sulfotransferase (GlcNAc6ST)-1 and GlcNAc6ST-2 showed that these sulfotransferases play critical roles in lymphocyte homing. Recent studies indicated that GlcNAc6ST-2 is expressed not only in lymph node high endothelial venules but also in the colonic epithelial cells in mice, and that this sulfotransferase plays a critical role in GlcNAc-6-O-sulfation of the colonic-mucins, as revealed by liquid chromatography coupled to electrospray ionization tandem mass spectrometry of the colonic-mucin O-glycans from wild-type (WT) and GlcNAc6ST-2-deficient mice. After induction of colitis by dextran sulfate sodium, significantly more leukocyte infiltration was observed in the colon of GlcNAc6ST-2-deficient mice than in that of WT mice. These studies demonstrate that GlcNAc-6-O-sulfotransferases play important * Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan PRESTO, Japan Science and Technology Agency, Kawaguchi, Japan
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79014-5
#
2010 Elsevier Inc. All rights reserved.
243
244
Hiroto Kawashima
roles not only in lymphoid tissues but also in nonlymphoid tissues. This chapter describes experimental procedures for assessing the functions of GlcNAc-6-Osulfotransferases using gene-targeted mice.
1. Overview The addition of sulfate groups to carbohydrate chains is catalyzed by sulfotransferases, which transfer a sulfate group from the sulfate donor, 30 -phosphoadenosine 50 -phosphosulfate, to a specific position on the acceptor oligosaccharide. N-Acetylglucosamine-6-O-sulfotransferases (GlcNAc6STs) catalyze the 6-O-sulfation of N-acetylglucosamine (GlcNAc) on the acceptor oligosaccharide. So far, five GlcNAc6STs in humans and four in mice have been identified (Fukuda et al., 2001; Hemmerich and Rosen, 2000). One of the GlcNAc6STs, GlcNAc6ST-2 (also called HEC-GlcNAc6ST or L-selectin ligand sulfotransferase, LSST), has been known to be specifically expressed in lymph node high endothelial venules (HEVs), where L-selectin-mediated lymphocyte recruitment to the lymph node primarily occurs. L-selectin is a C-type lectin on the surface of lymphocytes which specifically binds to sulfated glycans on HEVs. Another member of this sulfotransferase family, GlcNAc6ST-1, is also expressed in HEVs. Previously, our group (Kawashima et al., 2005) and others (Uchimura et al., 2005) generated gene-targeted mice deficient in GlcNAc6ST-1 and/or GlcNAc6ST-2 to determine whether GlcNAc6ST-1 and GlcNAc6ST2 had complementary roles in L-selectin ligand biosysnthesis in HEV. While GlcNAc6ST-1 and GlcNAc6ST-2 single-deficient mice showed an approximately 20% and 50% reduction in lymphocyte homing, respectively, GlcNAc6ST-1 and GlcNAc6ST-2 double-deficient mice showed an approximately 75% reduction in lymphocyte homing. The contact hypersensitivity (CHS) responses were also significantly diminished in the double-deficient mice, due to a reduction in lymphocyte trafficking to the draining lymph nodes. Immunofluorescence studies revealed that the binding of the MECA-79 antibody, which recognizes GlcNAc-6-O-sulfated extended core 1 structure (Yeh et al., 2001), to the lymph node HEV of the double-deficient mice was completely abrogated, indicating that GlcNAc6-O-sulfation in the extended core 1 branch of O-glycans in HEV was absent in the double-deficient mice. These results demonstrate that both GlcNAc6ST-1 and GlcNAc6ST-2 play essential roles in L-selectin ligand biosynthesis in HEV and immune surveillance. Detailed carbohydrate structural analysis of GlyCAM-1, a mucin-like glycoprotein expressed in HEV, was subsequently carried out (Kawashima et al., 2005). Lymph nodes from wild-type (WT) and knockout mice were radiolabeled with [3H]-galactose in organ culture, and then the O-glycans on
245
GlcNAc-6-O-Sulfotransferase Knockouts
WT(%) GlcNAc6ST-1−/−(%) GlcNAc6ST-2−/−(%) DKO(%)
±
±
R
2.3
2.8
5.1
16.8
R
30.0
24.5
9.5
0.6
S
Sialic acid Galactose
GlcNAc Fucose S SO-3
Figure 14.1 Structures of the O-glycans attached to GlyCAM-1. The percentages of O-glycans attached to GlyCAM-1 containing unsulfated sialyl Lewis X and 6-sulfo sialyl Lewis X are shown. Total O-glycans attached to GlyCAM-1 ¼ 100%.
GlyCAM-1 were released and subjected to structural analysis. As shown in Fig. 14.1, the 6-sulfo sialyl Lewis X structure on GlyCAM-1 was almost completely abrogated, whereas unsulfated sialyl Lewis X was overexpressed in the double-deficient (DKO) mice. Although both GlcNAc6ST-1 and GlcNAc6ST-2 are involved in the GlcNAc-6-O-sulfation of L-selectin ligands, GlcNAc6ST-2 appears to be the major GlcNAc-6-O-sulfotransferase in PLN and mesenteric lymph nodes (MLN), because the production of 6-sulfo sialyl Lewis X-containing O-glycans was more diminished in the GlcNAc6ST-2deficient mice than in the GlcNAc6ST-1-deficient mice (Fig. 14.1). During the course of generating a transgenic mouse line expressing Cre recombinase under the transcriptional regulatory elements for the gene encoding GlcNAc6ST-2, it was found that GlcNAc6ST-2 is strongly expressed not only in lymphoid tissues but also in the colon (Kawashima et al., 2009). Further analysis indicated that the cells expressing GlcNAc6ST-2 were reactive with an antibody against Muc2, a major intestinal mucin produced by the goblet cells in the colon, suggesting that GlcNAc6ST-2 catalyzes the sulfation of not only the L-selectin ligands in HEVs but also the colonic-mucins in mice. The mucus layer of the intestinal tract functions as a barrier against pathogens and inflammatory stimuli. Spontaneous colitis, the frequent development of adenomas in the small intestine, and rectal tumors were found in Muc2-deficient mice, indicating the importance of Muc2 as a mucosal barrier (Van der Sluis et al., 2006). However, only a few reports have shown the consequences of structural changes in the carbohyrdate moiety of Muc2. Core 3 b1,3-N-acetylglucosaminyltransferase (C3GnT)deficient mice were highly susceptible to experimental triggers of colitis, which was attributed to a colon-specific reduction in Muc2 protein (An et al., 2007). Core 2 b1,6-N-acetylglucosaminyltransferase-2 (C2GnT2)deficient mice also showed an increased susceptibility to colitis without a reduction in Muc2 core proteins, indicating that the core 2-branched
246
Hiroto Kawashima
O-glycans are required to protect the animal against colitis (Stone et al., 2009). Recently, it was reported that mice lacking a sulfate transporter, NaS1, showed a decrease in mucin sulfation, accompanied by an enhanced susceptibility to experimental colitis (Dawson et al., 2009). However, the NaS1-null mice showed only a partial reduction in mucin sulfation, and no structural data for the O-glycans attached to the colonic-mucins were reported. However, it was unclear which sulfotransferases are responsible for the sulfation of Muc2, or whether the sulfation of Muc2 by those sulfotransferases affects the protective function of Muc2 against colitis. Our recent studies using sulfotransferase-deficient mice revealed that GlcNAc6ST-2 plays a critical role in the biosynthesis of sulfated mucins in the mouse colon, and that the sulfation of colonic-mucins by GlcNAc6ST2 in mice has a protective function against leukocyte infiltration in experimental colitis (Tobisawa et al., 2010). Using a newly established colonic epithelial cell line, we also found that a short chain fatty acid (SCFA), butyrate, induces GlcNAc6ST-2 expression. In this chapter, experimental methods for assessing these functions of sulfotransferases and the related protocols are described.
2. Establishment of a Mouse Colon Adherent Cell Line and Cell Culture Cells from p53-deficient mice (Tsukada et al., 1993) become immortal at a high rate, and are useful to examine various cellular functions including regulatory mechanisms of gene expression in response to certain stimuli. In the following example, immortalized colonic epithelial cell line, termed CAdC1, was established from the colon of p53-deficient mice, and the effects of SCFAs on the expression of GlcNAc6ST-2 were examined by RT-PCR. 1. Generate p53-deficient mice by crossing C57BL-p53þ/ mice (BRC No. 01361) available from RIKEN BRC. 2. Remove the colon from p53-deficient mice and place it into sterile tubes containing the digestion buffer (RPMI 1640 containing 1 mg/ml collagenase A, 0.5 mg/ml dispase I, and 20 U/ml DNase I) at 37 C for 1 h. 3. Incubate the dissociated colonic cells in PBS containing 0.1% trypsin and 0.02% EDTA at 37 C for 5 min, and pass the cell suspension through a 70-mm cell strainer (BD Falcon). 4. After centrifugation, suspend the cell pellet in Dulbecco’s modified Eagle’s medium (Sigma) supplemented with 10% fetal bovine serum and 10 ng/ml recombinant human epidermal growth factor (EGF; Invitrogen), and plate the cell suspension in a 100-mm cell culture dish at 37 C in a humidified 5% CO2 atmosphere. The adherent cell line thus obtained is named CAdC1.
247
GlcNAc-6-O-Sulfotransferase Knockouts
3. Treatment of CAdC1 Cells with SCFAs 1. Treat CAdC1 cells with 4 mM each of sodium acetate (Kanto Chemicals Co., Inc.), sodium propionate (Wako Pure Chemicals Industries, Ltd.), or sodium butyrate (Sigma) in the cell culture medium in a 12-well plate for 24 h in the presence of 10 ng/ml EGF. 2. In some experiments, treat CAdC1 cells with 0.5 mM trichostatin A (TSA; Calbiochem) in the presence of 10 ng/ml EGF. 3. The cells are subjected to RT-PCR analysis as described below.
4. RT-PCR 1. Purify the total RNA from CAdC1 cells by RNAqueous-4PCR DNAfree RNA isolation kit (Ambion, Cat #AM1914), and use it for RT-PCR. The primers used are 50 -TCCATACTAACGCCAGGAACG-30 and 50 -TGGTGACTAAGGCTGGAACC-30 for mouse GlcNAc6ST-2, and 50 -TGGAATCCTGTGGCATCCATGAAAC-30 and 50 -TAAAACGCAGCTCAGTAACAGTCCG-30 for mouse b-actin. 2. Repeat the PCR cycle (94 C, 30 s; 62 C 30 s; 72 C 30 s) 32 times. In this experiment, the CAdC1 cells were treated with or without the sodium salt of one of the three major SCFAs: acetate, propionate, or butyrate in the presence EGF. Only sodium butyrate strongly induced the expression of GlcNAc6ST-2, as revealed by RT-PCR analysis (Fig. 14.2). Since sodium butyrate has an inhibitory effect on histone deacetylases (HDACs), the effect of TSA, an HDAC-specific inhibitor, on the expression of GlcNAc6ST-2 in CAdC1 cells was also examined. TSA also clearly induced GlcNAc6ST2 mRNA (data not shown), indicating that the inhibition of HDACs in the Control −
+
Acetate −
+
Propionate −
+
Butyrate −
+
RT
GlcNAc6ST-2 b-actin
Figure 14.2 Induction of GlcNAc6ST-2 mRNA by sodium butyrate. CAdC1 cells were treated with or without (Control) 4 mM sodium acetate, sodium propionate, or sodium butyrate in the presence of 10 ng/ml EGF, and subjected to RT-PCR analysis using primer pairs for GlcNAc6ST-2 and b-actin. For PCR, single-stranded cDNAs prepared in the presence (þ RT) or absence ( RT) of reverse transcriptase were used as templates.
248
Hiroto Kawashima
presence EGF induces GlcNAc6ST-2 expression. These examples show that immortalized cell line established from p53-deficient mice is useful to examine regulatory mechanisms of sulfotransferase expression.
5. Histology and Immunostaining Immunohistochemical staining with Alcian blue is a convenient method to determine the extent of sulfation of mucins in tissues. For this purpose, the Alcian blue staining should be performed at pH 1.0, because it selectively binds to sulfated carbohydrates under this condition (Spicer et al., 1981). In the following example, serial sections of the colon from WT and GlcNAc6ST-2-deficient (KO) mice are stained with Alcian blue and an antibody against Muc2, a major intestinal mucin, to assess the sulfation of colonic-mucins. 1. For Alcian blue staining, frozen sections (7 mm thick) of the colon from WT and KO mice are fixed with 10% formaldehyde in PBS for 30 min. 2. Incubate the fixed sections with 1% Alcian blue 8GX (Sigma) in 0.1 N HCl (pH 1.0) for 2 h, and counterstain the sections with Nuclear Fast Red solution (Sigma). 3. For immunohistochemical analyses, fix freshly prepared frozen sections (7 mm thick) with 0.5% glutaraldehyde in PBS for 10 min, and block the nonspecific binding sites by incubating with 3% BSA in PBS for 30 min. 4. Incubate the sections with 4 mg/ml rabbit anti-Mucin 2 pAb (sc-15334, Santa Cruz Biotechnology, Inc.) for 2 h. 5. After washing with PBS containing 0.1% BSA, incubate the sections with 0.03% hydrogen peroxide in PBS containing 0.1% BSA to inactivate the endogenous peroxidase. 6. After washing, incubate the sections with horseradish peroxidaseconjugated goat anti-rabbit IgG (H þ L) (Zymed, diluted 1:400) for 2 h. 7. After washing, develop the colored reaction product using a metalenhanced DAB substrate kit (Pierce Biotehnology, Inc.), and counterstain the sections with Nuclear Fast Red solution. In WT mice, both Alcian blue and the anti-Muc2 antibody clearly stained colonic epithelial cells, indicating that the colonic-mucins are highly sulfated. In the KO mice, the Alcian blue staining of the colon was significantly diminished, while the staining intensity with the anti-Muc2 antibody did not differ from that observed in the WT mice (Fig. 14.3). No obvious further reduction of the staining intensity with Alcian blue was found in the GlcNAc6ST-1 and GlcNAc6ST-2 double-null mice (data not shown). These results indicate that the sulfation of colonic-mucins is largely mediated by GlcNAc6ST-2.
249
GlcNAc-6-O-Sulfotransferase Knockouts
WT Alcian blue
KO Muc2
Alcian blue
Muc2
Proximal colon
Medial colon
Distal colon
Figure 14.3 Expression of sulfated carbohydrates and Muc2 in the colon of WT and KO mice. Frozen sections from WT and KO mice were stained with Alcian blue (pH 1.0), or anti-Muc2 pAb. Bar, 50 mm.
6. Preparation of Colonic-Mucin-Enriched Fraction Liquid chromatography coupled to electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) is a powerful tool to elucidate structural changes of carbohydrate structures in gene-targeted mice. Shown below are the protocols for purification of colonic-mucins from WT and KO mice, and their carbohydrate structural analyses using LC-ESI-MS/MS. 1. Prepare a colonic-mucin-enriched fraction from WT and KO mice according to a previously described method (Herrmann et al., 1999) with some modifications. At first, collect mucus from the colon from the epithelial surface of the mouse colon by mechanical scraping. 2. Solubilize the mucus fraction thus obtained by 6 M guanidinium chloride. 3. After centrifugation at 12,500g for 60 min at 4 C, decant the supernatant and reextract the gel-like pellet twice, as above. 4. Suspend the gel-like pellet in deionized water. Finally, dialyze the sample against deionized water and lyophilize it.
250
Hiroto Kawashima
7. Carbohydrate Structural Analysis 1. Dissolve the lyophilized colonic-mucin-enriched fraction (2 mg) in 100 ml of water. 2. To this add 100 ml of 0.1 M KOH and 2.0 M NaBH4, and incubate the mixture at 50 C for 15 h. 3. After cooling, add 100 ml of 4.0 M acetic acid to the reaction mixture, and apply the sample to a 1-ml column of AG50W-X8 resin (Hþ form; Bio-Rad Laboratories). 4. Elute the oligosaccharides from the column with 5 ml of water. 5. Evaporate the solvent, and dissolve the sample in 200 ml of methanol with 20 ml of acetic acid, and evaporate the solvent. 6. Repeat the last step three times, and store the sample in a desiccator at room temperature. 7. Dissolve the oligosaccharides thus obtained in water and separate them on a Hypercarb column (150 0.32 mm, 5-mm particles; Thermo Fisher Scientific) at a flow rate of 15 ml/min, with a 10-mM ammonium bicarbonate–acetonitrile gradient (0–40% acetonitrile) over 40 min. The column is coupled to a quadrupole orthogonal acceleration time-offlight mass spectrometer (Q-TOF; Agilent Technologies), operated in negative or positive ion mode. 8. For LC-ESI-MS/MS operated in the negative ion mode, the electrospray voltage applied is 4.5 kV, and [M H] ions are collided with argon as the collision gas, with a collision energy from 5 to 90 eV for m/z 200–2000. 9. For LC-ESI-MS/MS operated in the positive ion mode, the electrospray voltage applied is þ 3.5 kV, and [M þ H]þ ions are collided with a collision energy from 5 to 15 eV for m/z 200–2000. As shown in Fig. 14.4A, 15 types of oligosaccharides from the colonicmucin-enriched fraction of WT mice were detected as their [M H] ions in the LC-ESI-MS analysis. Oligosaccharides containing GlcNAc-6-O-sulfate were found on core 2-branched oligosaccharides from WT mice at m/z 667, 813, 975a, and 1121. In contrast, these sulfated oligosaccharides were completely absent from the oligosaccharide fraction obtained from the KO mice (Fig. 14.4B). The structures of these sulfated oligosaccharides were characterized by analyzing the daughter ion spectra obtained by the LCESI-MS/MS analysis (Fig. 14.5). Two isomeric sulfated oligosaccharides at m/z 975, namely 975a and 975b, were found in the LC-ESI-MS/MS analysis. The former, containing GlcNAc-6-O-sulfate, was completely absent in the oligosaccharide fraction from the KO mice, whereas the latter, containing Gal-3- or Gal-6-O-sulfate, was present in the KO mice at a comparable level as in the WT mice. The neutral oligosaccharides were analyzed by
251
GlcNAc-6-O-Sulfotransferase Knockouts
S A
Intensity
530 813 733b ×102 S S 1 1041a 0.9 S 1121, 975b 895d 0.8 0.7 975a 733a 0.6 1041b 0.5 895a 895b 0.4 587 S 0.3 895c 0.2 667 0.1 0 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Time (min)
Intensity
B
S ×102 530 733b 1 0.9 975b 895d 0.8 1041b 0.7 1041a 0.6 733a 0.5 895a 895b 0.4 0.3 587 0.2 895c 0.1 0 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Time (min) GalNAc
GlcNAc
Gal
Fuc S SO−3
Figure 14.4 LC-ESI-MS analysis of the oligosaccharides on colonic-mucins. LC-ESIMS total ion chromatogram of the oligosaccharides in the mucin-enriched fraction from the colon of WT (A) and KO (B) mice. LC-ESI-MS was operated in the negative ion mode. The annotations correspond to the [M H] ions listed in Table 14.1.
LC-ESI-MS/MS operated at the positive ion mode (data not shown), since the daughter ions of neutral oligosaccharides were less stable in LC-ESI-MS/ MS operated at the negative ion mode. Table 14.1 summarizes the carbohydrate structural analysis of the O-glycans of the colonic-mucins from WT and KO mice. These results indicate that GlcNAc-6-O-sulfation is the predominant sulfate modification of the mouse colonic-mucins, and that GlcNAc6ST2 is essential for this carbohydrate modification.
s
505
100
200
300
400
Mass (m/z)
0
100
Intensity
s
s
444
282 200
1.2 0.8
300
600
400
505
s
[M-H]− 975
813
590 500
600
0
100
200
300
700
800
900
1000 1100 1200
3 2
s
1
241
0
s
HSO−4 97
4
0
100
200
Intensity
1.2 1 0.8 0.6 0.4 0.2 0
667
s s
s 282
139 0
100
200
300
505
444 400
500
s s 813
s 590 600
700
600
700
s
800
[M-H]− 975
829
667
s s 444 387 300
400
500
600
700
800
900
1000
1100
Mass (m/z)
s s
HSO−4 m/z = 1121 S 97
500
m/z = 975b S
Mass (m/z) ×103
400
Mass (m/z) 5
s 829 s
0
700
×102
s
0.6 139
[M-H]− 813
1.6
D
667
1
E
500
s s
0.8
0.2
667
505
0.4
HSO−4 m/z = 975a S 97
0.4
s
s
282
97
2
139
×103
0
[M-H]− 667
s
282
0
m/z = 813 s HSO−4 S
×102
Intensity
C
1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
B
HSO−4 m/z = 667 97 S
Intensity
×103
Intensity
A
800
s
s
GalNAc
s
GlcNAc
Gal
Fuc S SO−3
975 829 [M-H] 1121
−
900 1000 1100 1200
Mass (m/z)
Figure 14.5 LC-ESI-MS/MS analysis of the sulfated oligosaccharides on colonic-mucins. ESI tandem mass spectra of the [M H] ions at m/z 667 (A), m/z 813 (B), m/z 975a (C), m/z 975b (D), and m/z 1121 (E). The collision energies applied were: for m/z 667, 50 eV; for m/z 813, 60 eV; for m/z 975a, 80 eV; for m/z 975b, 70 eV; and for m/z 1121, 90 eV. LC-ESI-MS/MS was operated in the negative ion mode. Note the presence of m/z 97 (HSO4) in all the ESI tandem mass spectra.
Table 14.1 Structural characterization and relative abundance of the O-glycans on the colonic-mucins from WT and KO mice Relative abundance (%)b
a
b c
Molecular ion [M H]
Proposed sequence/compositiona
WT
KO
587 530 733a 733b 895a, 895b, 895d 895c 1041a 1041b 667 813 975a 975b 1121
Gal-3(GlcNAc-6)GalNAcol Fuc-Gal-3GalNAcol Fuc-Gal-GlcNAc-GalNAcol Fuc-Gal-3(GlcNAc-6)GalNAcol Fuc, 2Gal, GlcNAc, GalNAcol Gal-3(Gal-(Fuc-)GlcNAc-6)GalNAcol 2Fuc, 2Gal, GlcNAc, GalNAcol Fuc-Gal-3(Fuc-Gal-GlcNAc-6)GalNAcol Gal-3(SO3-6GlcNAc-6)GalNAcol Fuc-Gal-3(SO3-6GlcNAc-6)GalNAcol Gal-3(Fuc-Gal-(SO3-6)GlcNAc-6)GalNAcol Gal-3(Fuc-(SO3-3/6)Gal-GlcNAc-6)GalNAcol Fuc-Gal-3(Fuc-Gal-(SO3-6)GlcNAc-6)GalNAcol
9.89 30.43 2.14 18.08 3.58 3.68 2.41 10.27 2.05 9.13 2.13 0.99 5.21
8.39 30.50 1.30 34.98 2.46 3.41 1.70 16.16 –c – – 1.10 –
For structural characterization, the following assumptions were made based on the reported structures of O-glycans: The hexose and deoxyhexose are Gal and fucose, respectively, the N-acetylhexosamine residue linked to N-acetylhexosamininitol is GlcNAc linked to GalNAcol, and the core 2 branch is formed after the core 1 structure is formed (Fukuda, 2002). The relative abundance was calculated by dividing the area of each peak by the total area of the peaks annotated in Fig. 14.4A and B. Peaks of impurities, which did not produce secondary ions of oligosaccharide fragments in the MS/MS analysis, were excluded from the calculation. Not detected.
254
Hiroto Kawashima
8. Induction of Colitis by Dextran Sulfate Sodium Dextran sulfate sodium (DSS)-induced colitis is a widely used experimental inflammation model to assess the functions of various molecules in the colon. By the following protocol, the extent of leukocyte infiltration in DSS-induced experimental colitis in WT and KO mice is examined. 1. Induce colitis in mice by adding 5% DSS (MW ¼ 36,000–50,000, MP Biomedicals) to their drinking water. 2. The animals are allowed free access to the DSS-containing water for 7 days, then they are sacrificed and their colon is dissected out, mounted in OCT compound, and stored at 80 C until use. 3. Incubate frozen sections (7 mm thick) of the colons with 5 mg/ml AlexaFluor 647-labeled anti-mouse CD45 monoclonal antibody (mAb; BioLegend), or AlexaFluor 647-labeled anti-mouse F4/80 mAb (BioLegend) together with 0.1 mg/ml DAPI. B
A ** 3.5
F4/80+ area/total area (%)
3.0 CD45+ cells (´103)/mm2
2.5
NS
2.5 2.0 1.5
*
1.0 0.5 0
***
2.0 1.5 1.0 0.5 0
Proximal
Medial WT
Distal
Proximal
KO
Figure 14.6 Accelerated leukocyte infiltration in KO mice after DSS treatment. WT and KO mice were given drinking water containing 5% DSS for 7 days. (A) Number of CD45þ leukocytes per one mm2 in the colon after DSS treatment. Frozen sections of the proximal, medial, and distal colon were stained with AlexaFluor 647-labeled antiCD45 mAb. (B) Percentage of the total area that was F4/80þ in the proximal colon. Frozen sections of the proximal colon were stained with AlexaFluor 647-labeled antiF4/80 mAb. Each bar represents the mean standard deviation of triplicate determinations. n ¼ 3. *P ¼ 0.015, **P ¼ 0.054, ***P ¼ 0.006, and NS, not significant. Student0 s t-test was used for statistical analysis.
GlcNAc-6-O-Sulfotransferase Knockouts
255
4. Deteremine the CD45þ leukocyte infiltration by counting the number of cells in a defined area using a BZ-9000 fluorescence microscope (Keyence, Co., Osaka, Japan). 5. Determine the F4/80þ macrophage infiltration by measuring the pixel area positively stained for F4/80 and dividing it by the total pixel area in the colon using a BZ-9000 fluorescence microscope. Seven days after 5% DSS was administered to WT and KO mice in their drinking water, a significant increase in the CD45þ leukocyte infiltration into the colon was observed in the KO mice compared with the WT mice (Fig. 14.6A). Staining of the sections with an anti-F4/80 mAb, which is specific for macrophages, showed that significantly more macrophages infiltrated the proximal colon of the KO mice than that of the WT mice (Fig. 14.6B). These results suggest that the sulfation of colonic-mucins by GlcNAc6ST-2 has a protective function against leukocyte infiltration in experimental colitis in mice.
ACKNOWLEDGMENTS I thank Drs. Yuki Tobisawa, Yasuyuki Imai, and Minoru Fukuda for their collaborations. This work was supported in part by Grants-in-Aid for Scientific Research, Category (B) and Grants-in-Aid for Scientific Research on Priority Areas, Dynamics of Extracellular Environments, from the Ministry of Education, Culture, Sports, Science and Technology, Japan (21390023 and 20057022, respectively), and Takeda Science Foundation.
REFERENCES An, G., Wei, B., Xia, B., McDaniel, J. M., Ju, T., Cummings, R. D., Braun, J., and Xia, L. (2007). Increased susceptibility to colitis and colorectal tumors in mice lacking core 3-derived O-glycans. J. Exp. Med. 204, 1417–1429. Dawson, P. A., Huxley, S., Gardiner, B., Tran, T., McAuley, J. L., Grimmond, S., McGuckin, M. A., and Markovich, D. (2009). Reduced mucin sulfonation and impaired intestinal barrier function in the hyposulfataemic NaS1 null mouse. Gut 58, 910–919. Fukuda, M. (2002). Roles of mucin-type O-glycans in cell adhesion. Biochim. Biophys. Acta 1573, 394–405. Fukuda, M., Hiraoka, N., Akama, T. O., and Fukuda, M. N. (2001). Carbohydratemodifying sulfotransferases: Structure, function, and pathophysiology. J. Biol. Chem. 276, 47747–47750. Hemmerich, S., and Rosen, S. D. (2000). Carbohydrate sulfotransferases in lymphocyte homing. Glycobiology 10, 849–856. Herrmann, A., Davies, J. R., Lindell, G., Martensson, S., Packer, N. H., Swallow, D. M., and Carlstedt, I. (1999). Studies on the ‘‘insoluble’’ glycoprotein complex from human colon. Identification of reduction-insensitive MUC2 oligomers and C-terminal cleavage. J. Biol. Chem. 274, 15828–15836. Kawashima, H., Petryniak, B., Hiraoka, N., Mitoma, J., Huckaby, V., Nakayama, J., Uchimura, K., Kadomatsu, K., Muramatsu, T., Lowe, J. B., and Fukuda, M. (2005).
256
Hiroto Kawashima
N-acetylglucosamine-6-O-sulfotransferases 1 and 2 cooperatively control lymphocyte homing through L-selectin ligand biosynthesis in high endothelial venules. Nat. Immunol. 6, 1096–1104. Kawashima, H., Hirakawa, J., Tobisawa, Y., Fukuda, M., and Saga, Y. (2009). Conditional gene targeting in mouse high endothelial venules. J. Immunol. 182, 5461–5468. Spicer, S. S., Baron, D. A., Sato, A., and Schulte, B. A. (1981). Variability of cell surface glycoconjugates-relation to differences in cell function. J. Histochem. Cytochem. 29, 994–1002. Stone, E. L., Ismail, M. N., Lee, S. H., Luu, Y., Ramirez, K., Haslam, S. M., Ho, S. B., Dell, A., Fukuda, M., and Marth, J. D. (2009). Glycosyltransferase function in core 2-type protein O glycosylation. Mol. Cell. Biol. 29, 3770–3782. Tobisawa, Y., Imai, Y., Fukuda, M., and Kawashima, H. (2010). Sulfation of colonic mucins by N-acetylglucosamine 6-O-sulfotransferase-2 and its protective function in experimental colitis in mice. J. Biol. Chem. 285, 6750–6760. Tsukada, T., Tomooka, Y., Takai, S., Ueda, Y., Nishikawa, S., Yagi, T., Tokunaga, T., Takeda, N., Suda, Y., Abe, S., et al. (1993). Enhanced proliferative potential in culture of cells from p53-deficient mice. Oncogene 8, 3313–3322. Uchimura, K., Gauguet, J. M., Singer, M. S., Tsay, D., Kannagi, R., Muramatsu, T., von Andrian, U. H., and Rosen, S. D. (2005). A major class of L-selectin ligands is eliminated in mice deficient in two sulfotransferases expressed in high endothelial venules. Nat. Immunol. 6, 1105–1113. Van der Sluis, M., De Koning, B. A., De Bruijn, A. C., Velcich, A., Meijerink, J. P., Van Goudoever, J. B., Buller, H. A., Dekker, J., Van Seuningen, I., Renes, I. B., and Einerhand, A. W. (2006). Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 131, 117–129. Yeh, J. C., Hiraoka, N., Petryniak, B., Nakayama, J., Ellies, L. G., Rabuka, D., Hindsgaul, O., Marth, J. D., Lowe, J. B., and Fukuda, M. (2001). Novel sulfated lymphocyte homing receptors and their control by a Core1 extension b1,3-N-acetylglucosaminyltransferase. Cell 105, 957–969.
C H A P T E R
F I F T E E N
Core O-Glycans Required for Lymphocyte Homing: Gene Knockout Mice of Core 1 b1,3-NAcetylglucosaminyltransferase and Core 2 N-Acetylglucosaminyltransferase Junya Mitoma* and Minoru Fukuda† Contents 1. Introduction 2. Lymphocyte Homing Assay 2.1. Materials and equipment 2.2. Preparation of fluorescence-labeled lymphocytes 2.3. Intravenous injection 3. Staining of Lymph Nodes by L- and E-Selectin-IgM Chimeric Proteins after Glycosidase Treatment 3.1. Materials 3.2. Preparation of L- and E-selectin-IgM chimeric proteins 3.3. Preparation and fixation of frozen sections 3.4. Staining with L- and E-selectin-IgM chimeric proteins 4. Probing of L-Selectin Ligands on Membrane Filters with L- and E-selectin-IgM Chimeric Proteins 4.1. Materials 4.2. Treatment of glycoproteins on PVDF membrane with E- and L-selectin-IgM 5. Conclusions Acknowledgments References
258 260 261 261 262 263 263 264 264 265 265 266 267 267 269 269
* Division of Glyco-Signal Research, Institute of Molecular Biomembrane and Glycobiology, Tohoku Pharmaceutical University, Komatsushima, Aoba, Sendai, Japan Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute La Jolla, CA, USA
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79015-7
#
2010 Elsevier Inc. All rights reserved.
257
258
Junya Mitoma and Minoru Fukuda
Abstract Mucin-type O-glycans are synthesized by sequential reaction of glycosyltransferases that have different substrate specificities. To know the significance of specific O-glycan structures, many researchers have been making mice deficient in corresponding enzymes for the synthesis of the O-glycan structures. Here we describe the analysis of gene knockout mice of core 2 branching enzyme (core 2 N-acetylglucosaminyltransferase, Core2GlcNAcT) and core 1 extension enzyme (core 1 b1,3-N-acetylglucosaminyltransferase, Core1-b3GlcNAcT). Because mucintype O-glycans present sialyl Lewis X (sLeX) and sulfated version of the glycans, which are L-selectin ligands, at the reducing end, the amounts of the ligands of these knockout mice would be reduced. The methods described here are to analyze the interaction between L-selectin and its ligand 6-sulfo sLeX such as lymphocyte homing assay, staining of frozen section, and blotting using L- and E-selectin-IgM chimeric proteins.
1. Introduction Lymphocyte homing to the secondary lymphoid organs is a wellknown process initiated by the rolling of lymphocytes on high endothelial venules (HEV) of lymph nodes (Rosen, 2004). This process is followed by chemokine expression in high endothelial cells, tight biding of lymphocytes to high endothelial cells via integrins, and extravasation into cortex of the lymph nodes. The first step is triggered by protein–carbohydrate interaction, that is, L-selectin expressed on lymphocytes recognizes its ligand, 6-sulfo sialyl Lewis X (6-sulfo sLeX; sialic acida2 ! 3Galb1 ! 4[Fuca1 ! 3(sulfo ! 6)]GlcNAc; Fig. 15.1) on core O-glycans of scaffolding proteins such as GlyCAM-1 (Hemmerich et al., 1995) and CD34 (Baumheter et al., 1993). These ‘‘sialomucins’’ are expressed on various tissues, but differs in the glycan structures. The specificity of the glycan structures resulted from the specific expression of corresponding glycosyltransferases.
6-sulfo sLeX SO-3 MECA-79 antigen a a3 b4 b3 b3 S/T a3
Figure 15.1 Structure of L-selectin ligand 6-sulfo sLeX on extended core 1 O-glycans. 6-Sulfo sLeX and MECA-79 antigen are boxed with black and grey solid lines, respectively. r, sialic acid; ○, galactose; △, fucose; j, GlcNAc; □, GalNAc.
259
Core O-Glycans Required for Lymphocyte Homing
The significance of the peripheral structure 6-sulfo sLeX as an L-selectin ligand has been demonstrated by mice deficient in fucosyltransferases (Homeister et al., 2001) and GlcNAc 6-sulfotransferases (Kawashima et al., 2005; Uchimura et al., 2005), for fucose and sulfate groups, respectively. There are more than eight types of core structures of mucin-type O-glycans (Fig. 15.2; Varki, 2009). Among them, core 2 and extended core 1 O-glycan structures consist of three monosaccharides, GalNAc, Gal, and GlcNAc, but they differ in linkage between each monosaccharide (Fig. 15.2). Core 2 O-glycans, which are major carrier of sLeX among O-glycans, are formed when core 1 structure is modified by core 2 branching enzyme, or core 2 b1,6-N-acetylglucosaminyltransferase (Core2GlcNAcT). On the other hand, if core 1 structure is modified by core 1 extension enzyme, or core 1 b1,3-N-acetylglucosaminyltransferase (Core1-b3GlcNAcT), the extended core 1 structure is formed. The detailed analysis of O-glycan structures of GlyCAM-1 from lymph nodes revealed that these two core O-glycans can be modified by L-selectin ligand 6-sulfo. (Hemmerich et al., 1995; Hiraoka et al., 2004). 6-sulfo sLeX on extended core 1 is essentially HEV specific and this unique structure is recognized by MECA-79, one of monoclonal
a
b3
b3
a
S/T Extended core 1
(1)
b3
S/T
a
(2)
S/T Core 1
b3
a
S/T Core 3
a3
b6 a b3
S/T Core 2
b3
b6
a
S/T Core 4
a
S/T Core 5 a
b6
S/T Core 6
a6
a3
a S/T Core 7 a S/T Core 8
Figure 15.2 Biosynthesis of core O-glycans. The sugar symbols are shown in the legend to Fig. 15.1.
260
Junya Mitoma and Minoru Fukuda
antibodies raised by Butcher’s group and specifically stains HEV, and block the binding of lymphocyte to HEV (Berg et al., 1991) and lymphocyte homing (Streeter et al., 1988). Minimal epitope for MECA-79 is 6-sulfo Nacetyllactosamine on extended core 1 structure as shown in Fig. 15.1, but fucose and sialic acid do not interfere with the antigen–antibody reaction. There are several methods to detect the interaction between L-selectin and its ligand, such as Stamper–Woodruff assay (Stamper and Woodruff, 1976), lymphocyte rolling assay (Puri et al., 1997), lymphocyte homing assay using fluorescence-labeled lymphocytes (Rosen et al., 1989; Streeter et al., 1988), intravital microscopy (Ley and Gaehtgens, 1991; von Andrian, 1996; Weninger et al., 2000), staining of HEV section with L-selectin-IgG (or IgM) chimeric proteins (Smith et al., 1996; Watson et al., 1990), and blotting with the chimeric proteins (Mitoma et al., 2007). Among them, the rolling assay and the intravital microscopy are excellent methods to evaluate the L-selectin ligand activity, but we need specialized equipments and proficient skills. Here, we would like to provide methods for which we need only basic techniques of biochemistry and cell biology. To investigate the role of core O-glycans on lymphocyte homing, pretreatment of specimen and/or use of lectins are also useful. We provide these methods in addition to the assays for L-selectin ligand activity. Using these techniques, we found that not only sLeX on O-glycans but also that on N-glycan works as L-selectin ligand in vivo (Mitoma et al., 2007).
2. Lymphocyte Homing Assay Lymphocyte homing assay consists of three steps: labeling of lymphocyte with fluorescent dye; intravenous injection of the cells; and counting the labeled cells recruited into secondary lymphoid organs, such as peripheral lymph nodes, mesenteric lymph nodes, and Peyer’s patches. To assess the roles of glycans on lymphocyte homing, preinjection of antibodies or lectins against specific glycans are useful. Introduction of monoclonal antibody MECA-79, which specifically recognizes HEV, almost completely inhibit lymphocyte homing into peripheral lymph nodes (Mitoma et al., 2007). Use of antibodies against sLeX for the inhibition of lymphocyte homing may be difficult because monoclonal antibody HECA-452 but not CSLEX-1 (Mitsuoka et al., 1997) binds to sLeX with 6-sulfation, whereas HECA-452 and FH6 do not bind to sLeX with N-glycolylneuraminic acid but do bind to sLeX with N-acetylneuraminic acid (Mitoma et al., 2009). Erythroagglutinating phytohemagglutinin (E-PHA), Concanavalin A (Con A), and Tomato lectin (LEA) recognize biantennary N-glycans, high mannose-type N-glycans, and poly-N-acetyllactosamine, respectively. They can be used to analyze whether and which type of N-glycans participate in lymphocyte homing.
Core O-Glycans Required for Lymphocyte Homing
261
2.1. Materials and equipment 5-Chloromethylfluorescein diacetate (CMFDA; Invitrogen) 5-(and-6)-(((4-Chloromethyl)benzoyl)amino)tetramethylrhodamine (CMRA; Invitrogen) MECA-79 antibody (PNAd; BD Bioscience) Erythroagglutinating phytohemagglutinin (E-PHA; EY Laboratories) Tomato lectin (LEA; EY Laboratories) Concanavalin A (Con A; EY Laboratories) Cell strainers, 40 or 70 mm (BD Biosciences) 0.2%, 0.9%, and 1.6% (w/v) NaCl Dulbecco’s phosphate-buffered saline (PBS), Mg2þ Ca2þ free RPMI-1640 (Invitrogen) Fetal bovine serum (FBS) Syringe with a 30-gauge needle (BD Bioscience) 6-Well multiwell plate (BD Bioscience) Full-frosted microscope glass slides (Fisher Scientific) Flow cytometer (FACSort, FACSCalibur or equivalent, BD Bioscience)
2.2. Preparation of fluorescence-labeled lymphocytes Remove mesenteric lymph nodes and spleen from sacrificed wild-type mice, strip off the fat by rolling over the lymphoid organs on paper towel, and place them into wells of 6-well plate containing 2 ml of ice-cold PBS in each well. As the residual fat may dissolve lymphoid organs in higher temperature, it is very important to remove the adipose tissue completely as possible and to keep them cold. Squeeze these lymph nodes and spleen between two full-frosted glass slides and lymphocytes are put into the same 6-well plate containing icecold PBS. After passing through 70 mm mesh, the cells are collected by centrifugation at 1000 rpm for 5 min at 4 C. For spleen, the cells are resuspended in ice-cold 0.2% NaCl, a hypotonic solution for the lysis of abundant erythrocytes. After 30 s in the hypotonic solution, immediately add the same volume of ice-cold 1.6% NaCl solution to bring the solution to isotonic. Combine the cells from spleen and mesenteric lymph nodes, and recover the cells by centrifugation. Resuspend the cells in 10 ml of serum-free RPMI-1640 containing 1 mM CMFDA for green fluorescent labeling or CMRA for orange fluorescent labeling, and incubate the cells in 37 C in 5% CO2 for 30 min. CMRA is useful when you use GFP knockin mice such as Core1b3GlcNAcT/ mice which we established (Mitoma et al., 2007), because the mice express GFP, which has same excitation/emission wavelength as CMFDA, in certain cell types including lymphocytes. The labeled cells are recovered by centrifugation, resuspended in 10 ml of prewarmed RPMI-1640 containing 10% FBS and incubate for another 30 min to fully
262
Junya Mitoma and Minoru Fukuda
convert nonfluorescent CMFDA or CMRA to fluorescent compounds by intracellular esterases. Cells are washed with RPMI-1640 with 10% FBS twice and cell suspension is passed through 70 mm mesh, reconstituted in 0.9% NaCl to obtain 2.5 105 cells per 100 ml, and kept on ice.
2.3. Intravenous injection When inhibiting lymphocyte homing by lectins, E-PHA (150–400 mg), LEA (150–300 mg), or Con A (150 mg) dissolved in 150 ml of PBS is intravenously injected through a tail vein prior to the injection of labeled lymphocytes. Overdose injection of lectins would result in the death of the recipient mice. Optimal dose should be determined for each lectin used in the experiments. The preinjection of MECA-79 antibody (100–200 mg) can inhibit lymphocyte homing into peripheral lymph nodes and mesenteric lymph nodes. One hour after the injection of the lectin or the antibody, 200 ml of fluorescence-labeled lymphocytes (5 106 cells) are injected. For the short-term homing assay, which evaluates the initial recruitment of lymph nodes into secondary lymphoid organs, the lymph nodes should be collected 1–3 h after the injection of labeled lymphocytes. To analyze longterm homing, which represents steady-state circulation of lymphocyte, the lymph nodes should be removed 24 h after injection. The mice are sacrificed and the peripheral (cervical and lateral axillary) lymph nodes, mesenteric lymph nodes, Peyer’s patches, spleen, and thymus are collected into 6-well plates containing 2 ml ice-cold PBS after the removal of adipose tissue. Lymphocytes are squeezed out with two frosted glass slides as described above, and the debris is removed by passing through 70 mm mesh. In the case of spleen, the hypotonic treatment should be performed to remove red blood cells as described above. The cell suspension is then analyzed by flow cytometry. The number of fluorescent cells is compared to the number of total cells. Control experiments are carried out by injecting only PBS. The ratio of control and lectin-inhibited or antibody-inhibited experiments is compared. Using this approach, we have demonstrated that 6-sulfo sLeX on N-glycans would contribute, at least partially, to lymphocyte homing into peripheral and mesenteric lymph nodes in addition to that on core 2 and extended core 1 O-glycans (Mitoma et al., 2007). In that work, we have established Core2GlcNAcT//Core1-b3GlcNAcT/ mice to eliminate almost all O-glycans in lymph nodes. Although the mice lack entire extended core 1 and core 2 O-glycans on which the most of L-selectin ligand 6-sulfo sLeX resides, the lymphocyte homing into peripheral lymph nodes remained at 40% of wild-type mice. The preinjection of Con A have a minimum effect on lymphocyte homing since L-selectin ligands are not present on Con A-reactive N-glycans. E-PHA and LEA have a significant inhibitory effect on wild-type mice and almost completely inhibit lymphocyte homing in Core2GlcNAcT//Core1-b3GlcNAcT/ mice
263
Core O-Glycans Required for Lymphocyte Homing
120
ConA
Lymphocyte homing (% of PBS)
LEA E-PHA 80 * 40
*
**
** * **
0
PLN
MLN
PP
Figure 15.3 Lymphocyte homing inhibited by lectins for complex type N-glycans. One hour after intravenous injection of LEA (300 mg), E-PHA (200 mg) or ConA (200 mg) into Core2GlcNAcT//Core-1b3GlcNAcT/ mice, CMRA-labeled lymphocytes were injected. Peripheral lymph nodes, mesenteric lymph nodes, and Peyer’s patches were recovered 1 h later and the cells were subjected to flow cytometric analysis. *, P < 0.05; **, P < 0.01; ***, P < 0.001, compared to PBS control. (Reprinted with permission from Mitoma and Fukuda, 2007).
(Fig. 15.3). The inhibitory effect of the lectins is highest in lymphocyte homing to peripheral lymph nodes, moderate to mesenteric lymph nodes and very moderate to Peyer’s patches.
3. Staining of Lymph Nodes by L- and E-SelectinIgM Chimeric Proteins after Glycosidase Treatment To analyze the function of specific glycans, digestion with glycosidases is one of the easiest options. However, the enzyme treatment on tissue sections is not always successful, as the condition optimal for particular enzyme may destroy the tissue sections or the enzyme may not digest fixed tissues. For example, N-glycosidase F treatment usually needs denaturing condition such as SDS and 2-mercaptoethanol at high temperature. We found this harsh condition can be substituted with acetone treatment and successfully demonstrated the elimination of N-glycans on lymph node frozen section by N-glycosidase F. Here we describe about treatment of frozen section with heparitinases and O-sialoglycoprotein endopeptidase in addition to N-glycosidase F.
3.1. Materials Plasmids containing L- and E-selectin-IgM chimeric proteins (Kobayashi et al., 2004) COS cells (COS-1 or COS-7 cells)
264
Junya Mitoma and Minoru Fukuda
Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) Fetal bovine serum (FBS) Lipofectamine reagent and PLUS reagent (Invitrogen) Centriprep-30 (Millipore) Optimal cutting temperature (OCT) compound embedding medium (Sakura Finetek Japan) N-Glycosidase F (Merck) O-Sialoglycoprotein endopeptidase (Accurate Chemical and Scientific Corporation) Heparitinases I and II, and heparinase (Seikagaku) Complete Protease Inhibitor Cocktail (Roche) Alexa Fluor 488- or 594-labeled anti-human IgM (Invitrogen)
3.2. Preparation of L- and E-selectin-IgM chimeric proteins This procedure includes expression of the chimeric proteins with COS cells and concentration of the secreted proteins by ultrafiltration. COS cells in three cell culture dishes ( 10 cm) with 30–50% confluency are transfected with 4 mg of pcDNA1.1–L-selectin-IgM or pcDNA1.1–E-selectin-IgM using Lipofectamine and PLUS reagent as per manufacturer’s standard protocol. Three hours after the incubation with plasmid–liposome complex, the culture media are replaced with DMEM containing 10% FBS and the cells are cultured in a cell culture incubator with 5% CO2 at 37 C for 3 days. The conditioned medium containing secreted IgM chimeric proteins is then concentrated to 10–50-fold with Centriprep-30 ultrafiltration units. The resultant concentrated medium can be used directly or diluted for immunohistochemistry or blotting without further purification. The optimum dilution of the conditioned medium should be determined for each preparation.
3.3. Preparation and fixation of frozen sections Remove peripheral lymph nodes, mesenteric lymph nodes, and Peyer’s patch from the mice, strip off the fat around the tissues, embed them in OCT compound, and freeze immediately on a dry ice block. The frozen tissues are cut into 3–5 mm thick and put onto microscope glass slides. Fix lymph node sections with acetone for 15 min at room temperature, wash the sections three times with PBS and treat them with the following enzymes. Alternatively, fix the section with 4% paraformaldehyde in PBS at room temperature for 15 min, denature proteins with 2% SDS and 5% 2-mercaptoethanol at 65 C for 10 min, and wash with PBS. This procedure results in the perfect elimination of N-glycans and no destruction of tissue sections.
Core O-Glycans Required for Lymphocyte Homing
265
3.3.1. N-Glycosidase F Incubate the fixed lymph node frozen sections with 100 mU/ml N-glycosidase F in 10 mM HEPES–NaOH (pH 7.4) containing 0.1% Triton X-100, 0.1 M 2-mercaptoethanol and Complete protease inhibitor cocktail at 37 C for 2 h. 3.3.2. O-Sialoprotein endopeptidase Incubate the sections with 0.1–1 mg/ml O-sialoglycoprotein endopeptidase in 10 mM HEPES–NaOH (pH 7.4) at 37 C for 2 h. 3.3.3. Heparitinases Incubate the sections with 25 mU/ml each of heparitinases I, II, and heparinase in PBS containing 1 mg/ml BSA, 1 mM CaCl2 and the protease inhibitor at 37 C for 2 h.
3.4. Staining with L- and E-selectin-IgM chimeric proteins The enzyme-digested sections were washed with PBS containing 0.1 mg/ml BSA three times and subjected to further treatment. Apply 100–200 ml of the concentrated conditioned medium containing L- or E-selectin-IgM and incubate for 2 h–overnight at 4 C. The specimens are washed three times with ice-cold DMEM containing 25 mM HEPES and 0.1 mg/ml BSA (DMEM/ HEPES/BSA) and treated with Alexa Flour 488- or 594-labeled anti-human IgM at 200-fold dilution in DMEM/HEPES/BSA. After the incubation for 2 h at 4 C, the sections are washed with ice-cold DMEM/HEPES/BSA for three times, mounted, and observed with a fluorescence microscope. N-Glycosidase F treatment removes all L- and E-selectin-IgM binding in Core2GlcNAcT//Core-1b3GlcNAcT/ mice (Fig. 15.4). O-sialoglycoprotein endopeptidase digestion partially cleaves O-glycans but not always complete. Digestion with heparitinases I and II with heparinase eliminates all heparan sulfate as judged by staining with 10E4, a monoclonal antibody against heparan sulfate (Mitoma et al., 2007).
4. Probing of L-Selectin Ligands on Membrane Filters with L- and E-selectin-IgM Chimeric Proteins L- and E-selectin-IgM chimeric proteins described above are relatively common method for the detection of L- and E-selectin ligands on tissue sections or cultured cells. It is much less common to detect the ligands blotted on membrane filters. Here we describe about the blotting using L- and E-selectin-IgM. E-selectin-IgM staining is useful because it can bind
266
Junya Mitoma and Minoru Fukuda
L-sel-IgM
HS (10E4)
N-Glycosidase F
|
E-sel-IgM
+ 10.0 mm
Figure 15.4 N-Glycosidase F removes L-selectin ligand on peripheral lymph nodes of mice lacking mucin-type O-glycans. The frozen sections of peripheral lymph nodes from Core2GlcNAcT//Core-1b3GlcNAcT/ mice were treated with or without N-glycosidase F, and stained with E-selectin-IgM (E-sel-IgM), L-selectin-IgM (L-sel-IgM) and anti-heparan sulfate antibody (HS (10E4)). The double-knockout mice retain some L- and E-selectin-IgM reacting substances (upper panels), which were completely removed by the treatment with N-glycosidase F, whereas heparan sulfate was unchanged. (Reproduced with permission from Mitoma and Fukuda, 2007).
sLeX regardless of sulfation and type of sialic acids, which are N-actetylneuraminic acid and N-glycolylneuraminic acid (Mitoma et al., 2009; Uchimura et al., 2005). The binding of L-selectin and its ligand is not very strong and they would dissociate at higher temperatures. All the following steps should be done at colder temperature than room temperature. However, 4 C or on ice would be too cold for the interaction between the ligand and the receptor, and also for effective washing. Thus, we are using a styrofoam cold chamber which contains ice at the bottom, and put a washing container directly on ice. This ice chamber should be used in room temperature with a lid so that the slides would be kept at optimum temperature for staining. We routinely use a styloform box which life science manufacturers use for sending cold materials ( 30 20 20 cm).
4.1. Materials Full-frosted microscope glass slides (Fisher Scientific) E- and L-selectin-IgM conditioned medium. (Section 3.2)
Core O-Glycans Required for Lymphocyte Homing
267
HRP-conjugated anti-human IgM (Pierce) Immobilon-P PVDF membrane filter (Millipore) Western Lightning Ultra (PerkinElmer) Washing buffer: 10 mM HEPES–NaOH pH 7.4, 130 mM NaCl, 1.5 mM CaCl2, and 0.05% Tween 20. To remove precipitates from the buffer, filtrate the solution through 0.22 mm filter after stirring for at least 20 min.
4.2. Treatment of glycoproteins on PVDF membrane with E- and L-selectin-IgM Peripheral and mesenteric lymph nodes are removed from sacrificed mice, and squeezed off lymphocytes with full-frosted glass slides. The whole homogenates without purification can be used for SDS polyacrylamide electrophoresis. Otherwise, the homogenates are put into 70 mm mesh, and the debris, a stromal fraction which contains HEV, can be used as a sample for the electrophoresis. The homogenates or stromal fraction is next incubated with 1% Triton X-100 in 10 mM Tris–HCl (pH 8.0) for 1–4 h at 4 C with gentle agitation and occasional pipetting, to solubilize scaffold proteins which present L-selectin ligand glycans. The lysates are centrifuged at 15,000 rpm for 5 min, the supernatants are subjected to SDS polyacrylamide gel electrophoresis and proteins are transferred onto Immobilon-P PVDF membrane by standard procedure. The blot is blocked by 10 mg/ml bovine serum albumin in washing buffer for 30 min. Incubate the membrane filter with the concentrated culture supernatant containing L- or E-selectin-IgM without dilution for 1 h at 4 C. Wash the membrane for 20 min three times with washing buffer in the ice chamber with gentle agitation. Incubate the blot with 10,000 diluted HRPanti-human IgM for 1 h at 4 C. Wash three times as above, and detect with chemiluminescent HRP substrate Western Lightning Ultra. As shown in Fig. 15.5, a strong signal of CD34 around 90–100 kDa was detected when lymph node lysate was used as a source of L- and E-selectin ligands. Other minor signals around >200, 70, and 50 kDa can also be detected. E-selectin-IgM blotting is much easier than L-selectin-IgM blotting probably because of the higher affinity of E-selectin and its ligand. When performing L-selectin-IgM staining, you may need to concentrate the lymph node lysates by immunoprecipitation.
5. Conclusions For a long time, L-selectin ligand 6-sulfo sLeX has been thought to reside only on O-glycans, as the scaffolding proteins CD34 and GlyCAM-1 have dozens of serine and threonine residues modified by core 2 and extended core 1 O-glycans. However, significant lymphocyte homing
268
Junya Mitoma and Minoru Fukuda
E-sel-IgM WT N-Glycosidase F
-
L-sel-IgM
DKO +
-
WT -
+
kDa
kDa
182
200
DKO +
-
+
116 115 82 96 64
49
37 52
Figure 15.5 L-selectin ligands on PVDF membrane are probed with L- and E-selectinIgM. Left, Binding of E-selectin-IgM to lymph node stroma with (–) or without (þ) N-glycosidase F treatment. Right, blotting of CD34 immunoprecipitated from wildtype and Core2GlcNAcT//Core-1b3GlcNAcT/ mice, left untreated () or treated (þ) with N-glycosidase F, and analyzed with L-selectin-IgM. (Reprinted with permission from Mitoma and Fukuda, 2007).
activity remained in Core2GlcNAcT//Core-1b3GlcNAcT/ mice, which lacks essentially all O-glycan-borne L-selectin ligands as judged by the disappearance of sulfation on GlyCAM-1, a scaffolding protein lacking N-glycosylation site (Mitoma et al., 2007). The critical step to discover the L-selectin ligand on non-O-glycans was the N-glycosidase F treatment on the frozen section of Core2GlcNAcT//Core-1b3GlcNAcT/ mice, whose peripheral lymph node HEV still have slight reactivity with L-selectin-IgM. The treatment removes all the remaining L-selectin-IgM binding molecules, indicating that N-glycans would present L-selectin ligands. Probing the membrane blot with L-selectin-IgM in combination with immunoprecipitation by anti-CD34 antibody revealed that this sialomucin has N-glycan-borne L-selectin ligand. The lymphocyte homing assay with preinjection of N-glycan-specific lectins proved that 6-sulfo
Core O-Glycans Required for Lymphocyte Homing
269
sLeX on N-glycans work as L-selectin ligands not only in Core2GlcNAcT//Core-1b3GlcNAcT/ mice but also in wild-type mice. O-Glycans have usually shorter saccharide chains than N-glycans although the O-glycosylation sites are more abundant than N-glycosylation sites on a CD34 molecule. This may explain the nearly complete inhibition of lymphocyte homing by MECA-79 whose binding to the antigen on O-glycans may sterically hinder the L-selectin ligand on N-glycans. Thus, in lymphocyte homing, both O-glycans and N-glycans may contribute to present L-selectin ligand in HEV.
ACKNOWLEDGMENTS The authors thank Dr. Misa Suzuki for critical reading of the manuscript. The work was supported by the National Institutes of Health (NIH) grants CA33000, CA33895, CA48737 and CA71932 (to M.F.), and in part by Grants-in-Aid for Scientific Research C-20570140 (to J.M.).
REFERENCES Baumheter, S., Singer, M. S., Henzel, W., Hemmerich, S., Renz, M., Rosen, S. D., and Lasky, L. A. (1993). Binding of L-selectin to the vascular sialomucin CD34. Science 262, 436–438. Berg, E. L., Robinson, M. K., Warnock, R. A., and Butcher, E. C. (1991). The human peripheral lymph node vascular addressin is a ligand for LECAM-1, the peripheral lymph node homing receptor. J. Cell Biol. 114, 343–349. Hemmerich, S., Leffler, H., and Rosen, S. D. (1995). Structure of the O-glycans in GlyCAM1, an endothelial-derived ligand for L-selectin. J. Biol. Chem. 270, 12035–12047. Hiraoka, N., Kawashima, H., Petryniak, B., Nakayama, J., Mitoma, J., Marth, J. D., Lowe, J. B., and Fukuda, M. (2004). Core 2 branching beta1,6-N-acetylglucosaminyltransferase and high endothelial venule-restricted sulfotransferase collaboratively control lymphocyte homing. J. Biol. Chem. 279, 3058–3067. Homeister, J. W., Thall, A. D., Petryniak, B., Maly, P., Rogers, C. E., Smith, P. L., Kelly, R. J., Gersten, K. M., Askari, S. W., Cheng, G., Smithson, G., Marks, R. M., et al. (2001). The alpha(1,3)fucosyltransferases FucT-IV and FucT-VII exert collaborative control over selectin-dependent leukocyte recruitment and lymphocyte homing. Immunity 15, 115–126. Kawashima, H., Petryniak, B., Hiraoka, N., Mitoma, J., Huckaby, V., Nakayama, J., Uchimura, K., Kadomatsu, K., Muramatsu, T., Lowe, J. B., and Fukuda, M. (2005). N-Acetylglucosamine-6-O-sulfotransferases 1 and 2 cooperatively control lymphocyte homing through L-selectin ligand biosynthesis in high endothelial venules. Nat. Immunol. 6, 1096–1104. Kobayashi, M., Mitoma, J., Nakamura, N., Katsuyama, T., Nakayama, J., and Fukuda, M. (2004). Induction of peripheral lymph node addressin in human gastric mucosa infected by Helicobacter pylori. Proc. Natl. Acad. Sci. USA 101, 17807–17812. Ley, K., and Gaehtgens, P. (1991). Endothelial, not hemodynamic, differences are responsible for preferential leukocyte rolling in rat mesenteric venules. Circ. Res. 69, 1034–1041. Mitoma, J., Bao, X., Petryanik, B., Schaerli, P., Gauguet, J. M., Yu, S. Y., Kawashima, H., Saito, H., Ohtsubo, K., Marth, J. D., Khoo, K. H., von Andrian, U. H., et al. (2007).
270
Junya Mitoma and Minoru Fukuda
Critical functions of N-glycans in L-selectin-mediated lymphocyte homing and recruitment. Nat. Immunol. 8, 409–418. Mitoma, J., Miyazaki, T., Sutton-Smith, M., Suzuki, M., Saito, H., Yeh, J. C., Kawano, T., Hindsgaul, O., Seeberger, P. H., Panico, M., Haslam, S. M., Morris, H. R., et al. (2009). The N-glycolyl form of mouse sialyl Lewis X is recognized by selectins but not by HECA-452 and FH6 antibodies that were raised against human cells. Glycoconj. J. 26, 511–523. Mitsuoka, C., Kawakami-Kimura, N., Kasugai-Sawada, M., Hiraiwa, N., Toda, K., Ishida, H., Kiso, M., Hasegawa, A., and Kannagi, R. (1997). Sulfated sialyl Lewis X, the putative L-selectin ligand, detected on endothelial cells of high endothelial venules by a distinct set of anti-sialyl Lewis X antibodies. Biochem. Biophys. Res. Commun. 230, 546–551. Puri, K. D., Finger, E. B., and Springer, T. A. (1997). The faster kinetics of L-selectin than of E-selectin and P-selectin rolling at comparable binding strength. J. Immunol. 158, 405–413. Rosen, S. D. (2004). Ligands for L-selectin: Homing, inflammation, and beyond. Annu. Rev. Immunol. 22, 129–156. Rosen, S. D., Chi, S. I., True, D. D., Singer, M. S., and Yednock, T. A. (1989). Intravenously injected sialidase inactivates attachment sites for lymphocytes on high endothelial venules. J. Immunol. 142, 1895–1902. Smith, P. L., Gersten, K. M., Petryniak, B., Kelly, R. J., Rogers, C., Natsuka, Y., Alford, 3rd, J. A., Scheidegger, E. P., Natsuka, S., and Lowe, J. B. (1996). Expression of the alpha (1,3)fucosyltransferase Fuc-TVII in lymphoid aggregate high endothelial venules correlates with expression of L-selectin ligands. J. Biol. Chem. 271, 8250–8259. Stamper, H. B., Jr., and Woodruff, J. J. (1976). Lymphocyte homing into lymph nodes: in vitro demonstration of the selective affinity of recirculating lymphocytes for highendothelial venules. J. Exp. Med. 144, 828–833. Streeter, P. R., Rouse, B. T., and Butcher, E. C. (1988). Immunohistologic and functional characterization of a vascular addressin involved in lymphocyte homing into peripheral lymph nodes. J. Cell Biol. 107, 1853–1862. Uchimura, K., Gauguet, J. M., Singer, M. S., Tsay, D., Kannagi, R., Muramatsu, T., von Andrian, U. H., and Rosen, S. D. (2005). A major class of L-selectin ligands is eliminated in mice deficient in two sulfotransferases expressed in high endothelial venules. Nat. Immunol. 6, 1105–1113. Varki, A. (2009). National Center for Biotechnology Information (U.S) and National Institutes of Health (U.S). Essentials of Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. von Andrian, U. H. (1996). Intravital microscopy of the peripheral lymph node microcirculation in mice. Microcirculation 3, 287–300. Watson, S. R., Imai, Y., Fennie, C., Geoffroy, J. S., Rosen, S. D., and Lasky, L. A. (1990). A homing receptor-IgG chimera as a probe for adhesive ligands of lymph node high endothelial venules. J. Cell Biol. 110, 2221–2229. Weninger, W., Ulfman, L. H., Cheng, G., Souchkova, N., Quackenbush, E. J., Lowe, J. B., and von Andrian, U. H. (2000). Specialized contributions by alpha(1,3)-fucosyltransferase-IV and FucT-VII during leukocyte rolling in dermal microvessels. Immunity 12, 665–676.
C H A P T E R
S I X T E E N
Immunohistochemical Analysis of Carbohydrate Antigens in Chronic Inflammatory Gastrointestinal Diseases Motohiro Kobayashi and Jun Nakayama Contents 1. Overview 2. Immunohistochemical Analysis Using Conventional Immunostaining 2.1. Materials 2.2. Methods 2.3. Quantification of HEV-like vessels 3. Immunohistochemical Analysis Using Multiple Immunostaining 3.1. Materials 3.2. Methods 3.3. Quantification of subsets of lymphocytes attached to HEV-like vessels 4. Immunohistochemical Analysis Using L-SelectinIgM Chimera Binding 4.1. Preparation of the L-selectinIgM chimera 4.2. L-selectinIgM chimera in situ binding assay Acknowledgments References
272 274 275 275 276 279 280 281 283 283 284 285 287 287
Abstract Over the last four decades, immunohistochemistry (IHC) has become an invaluable technique to detect antigens in tissue sections. Compared to Western blotting analysis, IHC is advantageous in determining histological distribution and localization of the antigen. Another advantage, if one can access human formalin-fixed paraffin-embedded (FFPE) blocks of disease tissues, is that IHC makes it possible to analyze diseases retrospectively from archived pathological tissue specimens. Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Japan Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79016-9
#
2010 Elsevier Inc. All rights reserved.
271
272
Motohiro Kobayashi and Jun Nakayama
In this chapter, we describe protocols used for both conventional and multiple immunostainings using FFPE tissue sections, which have been used for quantitative analysis of high endothelial venule (HEV)-like vessels and lymphocyte subsets attached to HEV-like vessels in our studies of chronic inflammatory gastrointestinal diseases. We also describe in detail a protocol using an L-selectinIgM chimera in situ binding assay on FFPE tissue sections for functional detection of L-selectin ligand carbohydrates expressed on HEV-like vessels. After presenting each protocol, we provide practical examples for its use obtained from our studies.
1. Overview Circulating lymphocytes enter secondary lymphoid organs such as lymph nodes and Peyer’s patches where they encounter foreign antigens by interacting with antigen-presenting cells (von Andrian and Mempel, 2003). This lymphocyte homing is mediated by a cascade of adhesive interactions between circulating lymphocytes and specialized venules called ‘‘high endothelial venules (HEVs)’’ (Butcher and Picker, 1996). HEVs are composed of endothelial cells exhibiting a characteristic cuboidal morphology and a prominent Golgi complex where unique sulfated O-glycans are synthesized (Kawashima, 2006). Sulfated O-glycans, collectively called peripheral lymph node addressins (PNAd; Rosen, 2004), interact with L-selectin expressed on lymphocytes, contributing to ‘‘tethering and rolling,’’ the initial step of lymphocyte homing, which is further elaborated by chemokine-dependent activation, integrin-mediated firm attachment to the endothelium, and transmigration of lymphocytes across blood vessels (Butcher and Picker, 1996). PNAd has been detected using the monoclonal antibody MECA-79 (Streeter et al., 1988), whose epitope has been shown to be 6-sulfo N-acetyllactosamine attached to extended core 1 O-glycans, Galb1 ! 4 (sulfo ! 6)GlcNAcb1 ! 3Galb1 ! 3GalNAca1 ! Ser/Thr (Fig. 16.1; Yeh et al., 2001). Furthermore, MECA-79 can also react with its sialylated and fucosylated forms, 6-sulfo sialyl Lewis X attached to extended core 1 O-glycans, sialic acida2 ! 3Galb1 ! 4[Fuca1 ! 3(sulfo ! 6)]GlcNAcb1 ! 3Galb1 ! 3GalNAca1 ! Ser/Thr (Fig. 16.1; Yeh et al., 2001). Structural studies also show that 6-sulfo sialyl Lewis X on core 2-branched O-glycans, sialic acida2 ! 3Galb1 ! 4[Fuca1 ! 3(sulfo ! 6)]GlcNAcb1 ! 6(Galb1 ! 3)GalNAca1 ! Ser/Thr (Fig. 16.1) is present as a major L-selectin ligand on HEVs (Hemmerich et al., 1995; Yeh et al., 2001). PNAd is absent in nonlymphoid tissues under normal conditions, but in chronic inflammatory states, it is induced on HEV-like vessels (Fig. 16.2;
273
Immunohistochemistry for Carbohydrate Antigens
SO−3 6
GlcNAc6ST-1 GlcNAc6ST-2
b4
a3
a3
b6
SO−3 a3
6
b4
b3
b3
a
Ser/Thr
a3 Core 1-b3GlcNAcT
SA
Fuc
Gal
MECA-79 epitope
GlcNAc
GalNAc
HECA-452 epitope
Figure 16.1 Carbohydrate structure of PNAd. Core 1 O-glycans are extended by core 1 extending b1,3-N-acetylglucosaminyltransferase (Core1-b3GlcNAcT) and sulfated by N-acetylglucosamine-6-O-sulfotransferase 1 (GlcNAc6ST-1) and/or GlcNAc6ST2 to form 6-sulfo sialyl Lewis X attached to extended core 1 O-glycans. GlcNAc6ST-1 and/or GlcNAc6ST-2 also sulfate at the C6-position of GlcNAc residues on core 2-branched O-glycans. 6-Sulfo sialyl Lewis X attached to extended core 1 and/or core 2-branched O-glycans functions as an L-selectin ligand. Epitopes for MECA-79 and HECA-452 monoclonal antibodies are shown in the indicated boxes. SA, sialic acid; Fuc, fucose; Gal, galactose; GlcNAc, N-acetylglucosamine; GalNAc, N-acetylgalactosamine. Adapted from Suzawa et al., (2007).
Aloisi and Pujol-Borrell, 2006; Renkonen et al., 2002; Rosen, 2004). Such HEV-like vessels have been observed in various chronic inflammatory diseases, including rheumatoid arthritis (van Dinther-Janssen et al., 1990), lymphocytic thyroiditis (Kabel et al., 1989), chronic Helicobacter pylori gastritis (Dogan et al., 1997; Kobayashi et al., 2004), and inflammatory bowel disease (IBD; Kobayashi et al., 2009; Salmi et al., 1994; Suzawa et al., 2007). In all such diseases, HEV-like vessels are implicated in lymphocyte recruitment. HEV-like vessels were also observed in an animal model of chronic Helicobacter gastritis (Kobayashi et al., 2007). As a method, IHC method is particularly useful in determining localization of a particular antigen. In the case of pathological specimens, it can also be used to probe archived formalin-fixed paraffin-embedded (FFPE) tissue blocks. In this chapter, we describe protocols for conventional and multiple immunostainings using FFPE tissue sections, which we have used for quantitative analysis of HEV-like vessels and subsets of lymphocytes attached to HEV-like vessels in our studies of chronic inflammatory gastrointestinal diseases. We also provide a detailed protocol describing an L-selectinIgM chimera in situ binding assay employing FFPE tissue sections
274
Motohiro Kobayashi and Jun Nakayama
A
B
C
D
Figure 16.2 HEV-like vessels observed in ulcerative colitis. (A, B) Colonic mucosa with ulcerative colitis in the active phase. HEV-like vessels are observed in the area of active lymphoplasmacytic infiltrate in the lamina propria (arrows). (C) HEV-like vessels morphologically identical to HEVs in secondary lymphoid organs; several lymphocytes are attached to their luminal surface (arrows). (D) HEV-like vessels closely associated with neutrophils (arrows). Bar: 250 mm for A and B, 50 mm for C and D. Adapted from Suzawa et al. (2007).
for functional detection of L-selectin ligand carbohydrates expressed on HEV-like vessels. After presentation of each protocol, we show practical examples obtained from our studies.
2. Immunohistochemical Analysis Using Conventional Immunostaining Several immunostaining methods using FFPE tissue sections are wellestablished and can be used to detect carbohydrate antigens involved in chronic inflammatory gastrointestinal diseases. Here, we describe an indirect method (Nakane, 1975), since the method is simple and applicable to most circumstances. When using antibodies that recognize carbohydrate moieties, such as MECA-79 and HECA-452, antigen retrieval is usually not necessary. However, if the epitope includes protein moieties, such as CD34 and MAdCAM-1, antigen retrieval may be required to obtain adequate signals. There are two major antigen retrieval methods: enzyme digestion (Huang, 1975) and heat treatment (Shi et al., 1991). For enzyme digestion, the most popular proteolytic enzymes used are trypsin, pepsin, and pronase (Bolton and Mesnard, 1982; Huang, 1975). In the case of heat treatment,
Immunohistochemistry for Carbohydrate Antigens
275
tissue sections are routinely boiled in either 10 mM citrate buffer (pH 6.0) or in 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA (Pileri et al., 1997; Yamashita, 2007). One needs to determine which method to utilize depending on the antibody used; however, in our experience, heat treatment with 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA works in most cases.
2.1. Materials Adhesive-coated slides (e.g., MAS-coated Superfrost, Matsunami Glass, Osaka, Japan) Xylene Ethanol Methanol 30% hydrogen peroxide solution 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA Bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO) Tris-buffered saline (TBS; pH 7.6) Primary antibodies: QBEND10 recognizing human CD34 (mouse IgG; Immunotech, Luminy, France), 17F5 recognizing human MAdCAM-1 (mouse IgG; Abcam, Cambridge, UK), MECA-79 recognizing 6-sulfo N-acetyllactosamine attached to extended core 1 O-glycans (rat IgM; BD Pharmingen, San Diego, CA; Streeter et al., 1988; Yeh et al., 2001), and HECA-452 recognizing sialyl Lewis X regardless of GlcNAc-6-Osulfation (rat IgM; BD Pharmingen; Berg et al., 1991; Duijvestijn et al., 1988; Mitoma et al., 2009). All antibodies are appropriately diluted with 1% BSA in TBS. Alternatively, for MECA-79 and HECA-452, culture supernatants of hybridoma cells producing MECA-79 (ATCC HB-9479) and HECA-452 (ATCC HB-11485) can be used without purification (Mitoma et al., 2009). Horseradish peroxidase (HRP)-conjugated and species-matched secondary antibodies (Dako, Kyoto, Japan) 3,30 -Diaminobenzidine (DAB; Dojindo, Kumamoto, Japan) Hematoxylin solution Malinol mounting medium (Muto Pure Chemicals, Tokyo, Japan)
2.2. Methods 1. FFPE tissue blocks are sectioned at 3-mm thickness and placed on adhesive-coated slides. 2. Sections are deparaffinized by immersion in xylene for 5 min, three times (or more).
276
Motohiro Kobayashi and Jun Nakayama
3. Sections are rehydrated by immersion in ethanol for 5 min, three times (or more), followed by rinsing in tap water for 5 min. 4. Endogenous tissue peroxidase activity is quenched by soaking sections in methanol containing 0.3% hydrogen peroxide for 30 min. 5. Sections are rinsed in tap water for 1 min. 6. In the case of CD34 and MAdCAM-1 stainings, antigens are retrieved by boiling sections in 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA for 20 min in a microwave (see Note 1) and then allowed to cool down to room temperature. 7. Sections are rinsed in tap water for 1 min. 8. Possible nonspecific protein binding is blocked by soaking sections in 1% BSA in TBS for 15 min. 9. Sections are incubated with primary antibodies (see Note 2) for 60 min (or 4 C overnight; see Note 3). 10. Sections are washed in TBS for 5 min, three times. 11. Sections are incubated with HRP-conjugated and species-matched secondary antibodies diluted 1:100 with 1% BSA in TBS for 60 min (see Note 3). 12. Sections are washed in TBS for 5 min, three times. 13. The color reaction is developed by soaking sections in TBS containing 0.2% (w/v) DAB and 0.02% hydrogen peroxide for 7 min. 14. Sections are washed in tap water for 1 min. 15. Sections are counterstained with hematoxylin solution for 1 min. 16. Sections are washed in tap water for 5 min. 17. Bluish-purple color of counterstaining is changed to more attractive blue color by soaking sections in TBS for 5 min. 18. Sections are dehydrated by immersion in ethanol for 5 min, three times (or more). 19. Sections are cleared by immersion in xylene for 5 min, three times (or more). 20. Sections are mounted with Malinol mounting medium.
2.3. Quantification of HEV-like vessels For each specimen, the numbers of CD34þ, MAdCAM-1þ, MECA-79þ, and HECA-452þ vessels in five high-power fields of view using 400 magnification are counted under a light microscope. The numbers of MECA-79þ, HECA-452þ, and MAdCAM-1þ vessels each are divided by the number of CD34þ vessels, yielding percentages of MECA-79þ, HECA-452þ, and MAdCAM-1þ vessels, respectively, as described (Kobayashi et al., 2004; Renkonen et al., 2002). In a similar fashion, percentages of MECA-79þ and HECA-452þ vessels among MAdCAM1þ vessels are calculated (Kobayashi et al., 2009).
277
Immunohistochemistry for Carbohydrate Antigens
2.3.1. Practical example 1 Quantitative analysis of immunostained sections of gastric mucosa made up of normal (n ¼ 11), mild (n ¼ 42), moderate (n ¼ 67), and marked (n ¼ 23) chronic inflammation ranked using the updated Sydney system (Dixon et al., 1996) was undertaken. Analysis showed that in the marked stage of chronic inflammation, recruitment of mononuclear cells obscures proper glands in the gastric mucosa (Fig. 16.3A, lower panels), which contrasts with visible glands present in the mucosa at the mild stage (Fig. 16.3A, upper panels; Kobayashi et al., 2004). This observation demonstrates that lymphocyte infiltration is more prominent when HEV-like vessels are more abundant. After examining over 140 human biopsy specimens, we found that the number of HEV-like vessels, as detected by MECA-79 and HECA-452, correlates positively with the progression of chronic inflammation (Fig. 16.3B), and that more patients display HEV-like vessels as inflammation progresses (Fig. 16.3C). A
B HECA-452
% of positive vessels/mm2
12
MECA-79
10
MECA-79 HECA-452
***
8 6 **
4
** NS
2
NS NS
0 Normal
MECA-79
HECA-452
C
100
% of patients
80
Mild Moderate Marked
MECA-79 HECA-452
60
***
**
40
** *
20
NS
NS
0 Normal
Mild Moderate Marked
Figure 16.3 Gastric mucosa of different degrees of chronic inflammation and association of HEV-like vessels with progression of inflammation. (A) Upper panels: Gastric mucosa at a mild stage barely expresses HEV-like vessels with minimum recruitment of lymphocytes. Lower panels: Gastric mucosa at a marked stage expresses a significant number of recruited lymphocytes (arrowheads) around HEV-like vessels. (B) The number of MECA-79þ and HECA-452þ vessels is positively correlated with progression of chronic inflammation. Each group consists of 11 (normal), 42 (mild), 67 (moderate), and 23 (marked) patients. (C) The number of patients exhibiting greater than 1% MECA-79þ and HECA-452þ vessels is highly correlated with progression of chronic inflammation. Bar, 50 mm (all panels); *, p < 0.05; **, p < 0.01; ***, p < 0.001; NS, not significant. Adapted from Kobayashi et al. (2004). Copyright 2004 National Academy of Science, USA.
278
Motohiro Kobayashi and Jun Nakayama
2.3.2. Practical example 2 Quantitative analysis of immunostained sections of ulcerative colitis made up of active (n ¼ 32) and remission (n ¼ 12) phases based on the Ulcerative Colitis Disease Activity Index (UCDAI; Bibiloni et al., 2005; Schroeder et al., 1987) showed that the percentage of MECA-79þ HEV-like vessels in the active phase was greater than that seen in remission phase samples with statistical significance (Fig. 16.4; Suzawa et al., 2007). On the other hand, the percentage of HECA-452þ HEV-like vessels did not differ between these two phases. These results suggest that preferential induction of the MECA-79 epitope on HEV-like vessels is associated with lymphocyte recruitment to the colonic mucosa in the active phase of ulcerative colitis. 2.3.3. Practical example 3 To quantitate changes in MAdCAM-1 expression associated with ulcerative colitis, we performed IHC for CD34, MAdCAM-1, and MECA-79 and evaluated proportions of MAdCAM-1þ vessels in colonic mucosa with ulcerative colitis in active and remission phases as well as in normal colonic mucosa (Kobayashi et al., 2009). In normal mucosa, MAdCAM-1 was expressed sporadically on the luminal surface of venular endothelial cells in the lamina propria, while MAdCAM-1þ vessels were frequently observed in colonic mucosa with ulcerative colitis, regardless of disease activity (Fig. 16.5). The percentage of MAdCAM-1þ vessels in both active and remission ulcerative colitis phases was greater than that seen in normal 7
% of positive vessels
6
**
Active Remission
5 4
NS
3 2 1 0
MECA-79
HECA-452
Figure 16.4 Quantitative analysis of HEV-like vessels in different phases of ulcerative colitis. The percentage of MECA-79þ HEV-like vessels in the active phase is significantly higher than that seen in the remission phase. On the other hand, percentages of HECA-452þ HEV-like vessels in active and remission phases do not differ significantly. Data are presented as means (n ¼ 32 in the active phase, n ¼ 12 in the remission phase) SEM. **, p < 0.01; NS, not significant. Adapted from Suzawa et al. (2007).
279
Immunohistochemistry for Carbohydrate Antigens
HE
CD34
MAdCAM-1
MECA-79
Active
Remission
Figure 16.5 Immunohistochemical profile of HEV-like vessels induced in ulcerative colitis. Serial tissue sections obtained from active (upper panels) and remission (lower panels) phases of ulcerative colitis were immunostained for CD34 (as a marker of vascular endothelial cells), MAdCAM-1, and MECA-79. A fraction of CD34þ vessels in the colonic lamina propria is also MAdCAM-1-positive, regardless of ulcerative colitis disease activity. In the active phase, MAdCAM-1þ vessels are largely MECA79-positive. HE, hematoxylin and eosin; bar, 50 mm (all panels). Adapted from Kobayashi et al. (2009).
colonic mucosa, with high statistical significance, while differences between the two ulcerative colitis phases did not differ significantly (Fig. 16.6, left). This finding suggests that the number of MAdCAM-1þ vessels increases with the onset of active ulcerative colitis but does not decrease significantly with clinical remission. We next evaluated the percentage of MECA-79þ vessels among MAdCAM-1þ vessels. MECA-79þ vessels were not detected in normal colonic mucosa, while they were frequently observed in ulcerative colitis, particularly in the active phase (Fig. 16.5). The percentage of MECA-79þ vessels among MAdCAM-1þ vessels in active phase was greater than that seen in remission phase, with high statistical significance (Fig. 16.6, right). Overall, these results indicate that the number of MECA-79þ vessels, but not MAdCAM-1þ vessels, increases in the active phase of ulcerative colitis compared to the remission phase, suggesting that ulcerative colitis disease activity is not facilitated by expression of MAdCAM-1 protein but instead by L-selectin ligand carbohydrates displayed on that protein.
3. Immunohistochemical Analysis Using Multiple Immunostaining Many methods have been devised for staining multiple molecules in the same tissue sections. Provided that primary antibodies from different species are available, they can be directly used for double or multiple
280
Motohiro Kobayashi and Jun Nakayama
100
Active Remission Normal
% of positive vessels
80
*** NS **
60
40 *** ** NS
20
0 MAdCAM-1/CD34 MECA-79/MAdCAM-1
Figure 16.6 Percentages of MAdCAM-1þ/CD34þ and MECA-79þ/MAdCAM-1þ vessels in active and remission phases of ulcerative colitis and normal colonic mucosa. The percentage of MAdCAM-1þ/CD34þ vessels in ulcerative colitis in both phases is significantly higher than that seen in normal colonic mucosa, while percentages between the two phases do not differ significantly (left). The percentage of MECA79þ/MAdCAM-1þ vessels in active phase is significantly higher than that seen in remission phase or in normal colonic mucosa (right). Data are presented as means (n ¼ 32 in active phase, n ¼ 12 in remission phase, and n ¼ 10 in normal colonic mucosa) SEM. **, p < 0.01; ***, p < 0.001; NS, not significant. Adapted from Kobayashi et al. (2009).
staining in combination with differentially labeled species-specific secondary antibodies (Campbell and Bhatnagar, 1976). However, quite often the primary antibodies of interest are raised from the same species so that the appropriate antibody combination is not available. Thus, most protocols described to date have serious limitations. Lan et al. (1995) reported that boiling sections in a microwave oven between the first and second staining cycles enables double-indirect immunostaining when the antibodies used are raised from the same species. The mechanism underlying microwave treatment was subsequently revealed by Tornehave et al. (2000), who proposed that microwaving optimized the protocol via both elution and denaturation of the bound antibodies. Here we describe a triple immunostaining protocol based on a combination of the EnVision system (Sabattini et al., 1998) and the labeled streptavidin–biotin (LSAB) method (Giorno, 1984) used in our studies.
3.1. Materials Adhesive-coated slides Xylene Ethanol
Immunohistochemistry for Carbohydrate Antigens
281
Methanol 30% hydrogen peroxide solution 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA BSA TBS Primary antibodies other than those described above in Section 2: rabbit anti-human CD3 polyclonal antibody (Dako), L26 recognizing human CD20 (mouse IgG2a, k; Dako), JCB117 recognizing human CD79a (mouse IgG1, k; Dako), NCL-CD4-1F6 recognizing human CD4 (mouse IgG1; Novocastra, Newcastle, UK), C8/144B recognizing human CD8 (mouse IgG1, k; Dako), 1C6/CXCR3 recognizing human CXCR3 expressed on Th1 cells (mouse IgG1, k; BD Pharmingen; Jones et al., 2000; Tsuchiya et al., 2004), and HB12 recognizing human ST2L expressed on Th2 cells (mouse IgG1; MBL, Tokyo, Japan; Lohning et al., 1998; Tsuchiya et al., 2004). Alkaline phosphatase (AP)-conjugated EnVision (Dako) Nitroblue tetrazolium chloride (NBT; Roche, Basel, Switzerland) 5-Bromo-4-chloro-3-indolyl phosphate, 4-toluidine salt (BCIP; Roche) Levamisole (Dako) 1 M Tris/HCl (pH 9.5) 1 M NaCl 1 M MgCl2 NBT/BCIP substrate solution: Add 4.5 ml NBT, 3.5 ml BCIP, and one drop of Levamisole into 1 ml of Tris buffer [100 mM Tris/HCl (pH 9.5), 100 mM NaCl, and 50 mM MgCl2], and mix well 10 mM citrate buffer (pH 6.0) Fuchsine substrate-chromogen (Dako) Biotin-conjugated anti-rat immunoglobulins (Dako) HRP-conjugated streptavidin (Dako) DAB Hematoxylin solution Glycergel mounting medium (Dako)
3.2. Methods 1. FFPE tissue blocks are sectioned at 3-mm thickness and placed on adhesive-coated slides. 2. Sections are deparaffinized by immersion in xylene for 5 min, three times (or more). 3. Sections are rehydrated by immersion in ethanol for 5 min, three times (or more), followed by rinsing in tap water for 5 min. 4. Endogenous tissue peroxidase activity is quenched by soaking sections in methanol containing 0.3% hydrogen peroxide for 30 min.
282
Motohiro Kobayashi and Jun Nakayama
5. Sections are rinsed in tap water for 1 min. 6. Antigens are retrieved by boiling sections in 10 mM Tris/HCl buffer (pH 8.0) containing 1 mM EDTA for 20 min in a microwave (see Note 1) and allowed to cool down to room temperature. 7. Sections are rinsed in tap water for 1 min. 8. Possible nonspecific protein binding is blocked by soaking sections in 1% BSA in TBS for 15 min. 9. Sections are incubated with the first primary antibody (either antihuman CD3 polyclonal antibody, NCL-CD4-1F6, or 1C6/CXCR3; see Notes 2 and 4) for 60 min (or at 4 C overnight; see Note 3). 10. Sections are washed in TBS for 5 min, three times. 11. Sections are incubated with AP-conjugated EnVision for 30 min following the manufacturer’s instruction (see Note 3). 12. Sections are washed with TBS for 5 min, three times. 13. NBT/BCIP substrate solution is prepared as described in Section 3.1. 14. Sections are incubated with NBT/BCIP substrate solution for 5 min. 15. Sections are washed in tap water for 1 min. 16. Dissociate bound antibodies from sections by boiling sections in 10 mM citrate buffer (pH 6.0) for 10 min in a microwave (see Note 1). 17. Sections are incubated with the second primary antibody (either a cocktail of L26 and JCB117 at 1:1 ratio for B cells, C8/144B, or HB12; see Notes 2 and 4) for 60 min (or at 4 C overnight; see Note 3). 18. Sections are washed in TBS for 5 min, three times. 19. Sections are incubated with AP-conjugated EnVision for 30 min following the manufacturer’s instruction (see Note 3). 20. Sections are washed with TBS for 5 min, three times. 21. Fuchsine substrate-chromogen is prepared according to the manufacturer’s instruction. 22. Sections are incubated with Fuchsine substrate-chromogen for 5 min. 23. Sections are washed in tap water for 1 min. 24. Dissociate bound antibodies from sections by boiling sections in 10 mM citrate buffer (pH 6.0) for 10 min in a microwave (see Note 1). 25. Sections are incubated with third primary antibody (MECA-79; see Notes 2 and 4) for 60 min (or 4 C overnight; see Note 3). 26. Sections are washed in TBS for 5 min, three times. 27. Sections are incubated with biotin-conjugated anti-rat immunoglobulins diluted 1:500 with 1% BSA in TBS for 60 min (see Note 3). 28. Sections are washed with TBS for 5 min, three times. 29. Sections are incubated with HRP-conjugated streptavidin for 60 min (see Note 3). 30. Sections are washed with TBS for 5 min, three times. 31. The color reaction is developed by soaking sections in TBS containing 0.2% (w/v) DAB and 0.02% hydrogen peroxide for 7 min. 32. Sections are washed in tap water for 1 min.
Immunohistochemistry for Carbohydrate Antigens
283
33. Sections are counterstained with hematoxylin solution for 10 s. 34. Sections are washed in tap water for 5 min. 35. Bluish-purple color of counterstaining is changed to more attractive blue color by soaking sections in TBS for 5 min. 36. Sections are rinsed in tap water for 1 min. 37. Sections are mounted with Glycergel mounting medium.
3.3. Quantification of subsets of lymphocytes attached to HEV-like vessels The number of CD3þ T and CD20/CD79aþ B cells each in the lumen attached to the luminal surface of each MECA-79þ HEV-like vessel is determined by counting under a microscope. Similarly, the number of CD4þ and CD8þ T cells each, and CXCR3þ Th1 and ST2Lþ Th2 cells each is determined. 3.3.1. Practical example To determine which lymphocyte population closely associates with HEVlike vessels in ulcerative colitis, we undertook triple immunostaining to observe HEV-like vessels and a specific pair of lymphocyte subsets simultaneously (Fig. 16.7A–C; Suzawa et al., 2007). The number of respective CD3þ T and CD20/CD79aþ B cells each, CD4þ and CD8þ T cells each, and CXCR3þ Th1 and ST2Lþ Th2 cells each in the lumen attached to the luminal surface of MECA-79þ HEV-like vessels was determined. As shown in Fig. 16.7D, the number of T cells was significantly greater than that of B cells, and among T cell subsets, the number of CD4þ T cells was significantly greater than CD8þ T cells (Fig. 16.7E). The number of Th1 and Th2 cells did not differ significantly (Fig. 16.7F). These results suggest that T cell populations, particularly CD4þ T cells, are preferentially recruited via HEV-like vessels formed in the colonic mucosa with ulcerative colitis.
4. Immunohistochemical Analysis Using L-SelectinIgM Chimera Binding Before the identification of L-selectin (Gallatin et al., 1983), Stamper and Woodruff (1976) observed highly specific adherence of exogenous lymphocytes to HEVs by overlaying viable lymphocytes onto cryostat-cut sections of lymph node, in what we call ‘‘the Stamper–Woodruff in vitro adhesion assay.’’ Subsequent cloning and sequencing of cDNA encoding L-selectin revealed that this adhesion molecule is a transmembrane protein with a calcium-dependent lectin domain at the amino terminus (Drickamer, 1988). During a search for its cognate ligands on HEVs, Watson et al. (1990)
284
Motohiro Kobayashi and Jun Nakayama
B
F
E
D
1
0
T cells B cells
2 ***
Number of cells
2 Number of cells
C
1
0
CD4+ cells CD8+ cells **
2 Number of cells
A
1
Th1 cells Th2 cells NS
0
Figure 16.7 Lymphocyte subsets preferentially attach to the luminal surface of HEVlike vessels. (A) Triple immunostaining for MECA-79, CD3, and CD20/CD79a. Both CD3þ T cells and CD20/CD79aþ B cells are associated with MECA-79þ HEV-like vessels. (B) Triple immunostaining for MECA-79, CD4, and CD8. (C) Triple immunostaining for MECA-79, CXCR3, and ST2L. Bar, 20 mm. (D) The average number of CD3þ T cells in the lumen attached to the luminal surface per MECA-79þ HEV-like vessel is greater than CD20/CD79aþ B cells with high statistical significance. (E) The number of CD4þ T cells is significantly greater than CD8þ T cells. (F) The numbers of CXCR3þ Th1 cells and ST2Lþ Th2 cells do not differ significantly. Data are presented as means SEM. **, p < 0.01; ***, p < 0.001; NS, not significant. Adapted from Suzawa et al. (2007).
employed an immunoglobulin chimera of L-selectin as a soluble receptor analogue. This antibody-like molecule can serve as an immunohistochemical reagent to stain HEVs. Here we provide a detailed protocol describing an L-selectinIgM chimera in vitro binding assay using FFPE tissue sections.
4.1. Preparation of the L-selectinIgM chimera 1. cDNA encoding the Fc region of human IgM is amplified using the primer pair, 50 -CGGGATCCTGTGATTGCTGAGCTGCCTCCCA-30 and 50 -GCTCTAGATCAGTAGCAGGTGCCAGCTGTGT-30 . The template pcDNA1/P-selectinIgM (Maly et al., 1996) is amplified and the product subcloned into the BamHI/XbaI site of pcDNA1.1, resulting in pcDNA1.1/IgM. To construct pcDNA1.1/L-selectinIgM, the 50 end of L-selectin is excised from pCDM8/L-selectinIgG by EcoRI digestion and blunted with Klenow fragment (Roche). After digestion of the 30 end with BamHI, the excised cDNA is subcloned into the blunted HindIII site and an intact BamHI site of pcDNA1.1/IgM, to form pcDNA1.1/ L-selectinIgM.
Immunohistochemistry for Carbohydrate Antigens
285
2. To obtain the L-selectinIgM chimera, HEK293T cells (or COS-1 cells) are transiently transfected with pcDNA1.1/L-selectinIgM using Lipofectamine Plus (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. 3. Transfected cells are cultured for 4 days in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; HyClone, South Logan, UT). 4. The culture supernatant is collected and concentrated approximately 10fold using Centriprep YM-30 (Millipore, Billerica, MA), according to the manufacturer’s instruction. 5. The concentrated L-selectinIgM chimera is stored at 80 C until use.
4.2. L-selectinIgM chimera in situ binding assay 1. FFPE tissue blocks are sectioned at 3-mm thickness and placed on adhesive-coated slides. 2. Sections are deparaffinized by immersion in xylene for 5 min, three times (or more). 3. Sections are rehydrated by immersion in ethanol for 5 min, three times (or more), followed by rinsing in tap water for 5 min. 4. Endogenous tissue peroxidase activity is quenched by soaking sections in methanol containing 0.3% hydrogen peroxide for 30 min. 5. Sections are rinsed in tap water for 1 min. 6. Possible nonspecific protein binding is blocked by soaking sections in 1% BSA in TBS for 15 min. 7. Sections are rinsed with DMEM (see Note 5). 8. Sections are incubated with concentrated L-selectinIgM for 30 min (or 4 C overnight; see Note 3). 9. Sections are washed with DMEM, three times. 10. Sections are incubated with HRP-conjugated goat anti-human IgM antibody (Pierce Biotechnology, Rockford, IL) diluted 1:100 with DMEM supplemented with 10% FBS for 30 min. 11. Sections are washed with DMEM, three times. 12. The color reaction is developed by soaking sections in TBS containing 0.2% (w/v) DAB and 0.02% hydrogen peroxide for 7 min. 13. Sections are washed in tap water for 1 min. 14. Sections are counterstained with hematoxylin solution for 1 min. 15. Sections are washed in tap water for 5 min. 16. Bluish-purple color of counterstaining is changed to more attractive blue color by soaking sections in TBS for 5 min. 17. Sections are dehydrated by immersion in ethanol for 5 min, three times (or more).
286
Motohiro Kobayashi and Jun Nakayama
18. Sections are cleared by immersion in xylene for 5 min, three times (or more). 19. Sections are mounted using Malinol mounting medium.
4.2.1. Practical example To determine whether carbohydrate antigens expressed on HEV-like vessels formed in ulcerative colitis function as L-selectin ligands, an in vitro binding assay using L-selectinIgM chimera was carried out (Suzawa et al., 2007). In parallel, an E-selectinIgM chimera was used as a probe for 6-sulfated or nonsulfated sialyl Lewis X (Uchimura et al., 2005). As shown in Fig. 16.8, both L- and E-selectinIgM chimeras bound the same HEV-like vessels in the presence of calcium, and binding was completely abrogated in the presence of EDTA. These results indicate that L- and E-selectinIgM chimeras bind HEV-like vessels formed in ulcerative colitis in a calcium-dependent manner and suggest that such vessels can potentially recruit L-selectin-expressing lymphocytes. Notes 1. Slides should be placed in a plastic basket in this step. Microwave irradiation of a metal basket may cause spark discharge. 2. Negative controls are obtained by replacing primary antibodies with species- and class-matched immunoglobulins. 3. A moisture chamber should be used for the incubation. Without EDTA
With EDTA
L-sel•IgM
E-sel•IgM
Figure 16.8 L- and E-selectinIgM chimeric proteins in vitro binding assay. HEV-like vessels induced in ulcerative colitis are bound by both L- and E-selectinIgM chimeric proteins (L-selIgM and E-selIgM, respectively) in the presence of calcium (without EDTA; left panels). Binding is completely abolished in the presence of EDTA (right panels). Bar, 50 mm. Adapted from Suzawa et al. (2007).
Immunohistochemistry for Carbohydrate Antigens
287
4. The order of primary antibodies used in a multiple immunostaining protocol should be considered carefully. Generally, the first immunostaining should be for a membrane protein such as CD4 or CXCR3, since these antigens might be difficult to detect after sequential boiling in a microwave. Immunostaining for carbohydrate antigens is performed last, since these antigens are usually resistant to such treatment. 5. Because L-selectin binding is calcium-dependent, negative controls are obtained by replacing DMEM with DMEM supplemented with 1 mM EDTA throughout the procedure.
ACKNOWLEDGMENTS We thank Dr. Minoru Fukuda for providing us with the opportunity to write this chapter and Dr. Elise Lamar for critical reading of the manuscript.
REFERENCES Aloisi, F., and Pujol-Borrell, R. (2006). Lymphoid neogenesis in chronic inflammatory diseases. Nat. Rev. Immunol. 6, 205–217. Berg, E. L., Robinson, M. K., Mansson, O., Butcher, E. C., and Magnani, J. L. (1991). A carbohydrate domain common to both sialyla and sialyl LeX is recognized by the endothelial cell leukocyte adhesion molecule ELAM-1. J. Biol. Chem. 266, 14869–14872. Bibiloni, R., Fedorak, R. N., Tannock, G. W., Madsen, K. L., Gionchetti, P., Campieri, M., De Simone, C., and Sartor, R. B. (2005). VSL#3 probiotic-mixture induces remission in patients with active ulcerative colitis. Am. J. Gastroenterol. 100, 1539–1546. Bolton, W. K., and Mesnard, R. M. (1982). New technique of kidney tissue processing for immunofluorescence microscopy: Formol sucrose/gum sucrose/paraffin. Lab. Invest. 47, 206–213. Butcher, E. C., and Picker, L. J. (1996). Lymphocyte homing and homeostasis. Science 272, 60–66. Campbell, G. T., and Bhatnagar, A. S. (1976). Simultaneous visualization by light microscopy of two pituitary hormones in a single tissue section using a combination of indirect immunohistochemical methods. J. Histochem. Cytochem. 24, 448–452. Dixon, M. F., Genta, R. M., Yardley, J. H., and Correa, P. (1996). Classification and grading of gastritis: The updated Sydney system. Am. J. Surg. Pathol. 20, 1161–1181. Dogan, A., Du, M., Koulis, A., Briskin, M. J., and Isaacson, P. G. (1997). Expression of lymphocyte homing receptors and vascular addressins in low-grade gastric B-cell lymphomas of mucosa-associated lymphoid tissue. Am. J. Pathol. 151, 1361–1369. Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal lectins. J. Biol. Chem. 263, 9557–9560. Duijvestijn, A. M., Horst, E., Pals, S. T., Rouse, B. N., Steere, A. C., Picker, L. J., Meijer, C. J., and Butcher, E. C. (1988). High endothelial differentiation in human lymphoid and inflammatory tissues defined by monoclonal antibody HECA-452. Am. J. Pathol. 130, 147–155. Gallatin, W. M., Weissman, I. L., and Butcher, E. C. (1983). A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature 304, 30–34.
288
Motohiro Kobayashi and Jun Nakayama
Giorno, R. (1984). A comparison of two immunoperoxidase staining methods based on the avidin-biotin interaction. Diagn. Immunol. 2, 161–166. Hemmerich, S., Leffler, H., and Rosen, S. D. (1995). Structure of the O-glycans in GlyCAM-1, an endothelial-derived ligand for L-selectin. J. Biol. Chem. 270, 12035–12047. Huang, S. N. (1975). Immunohistochemical demonstration of hepatitis B core and surface antigens in paraffin sections. Lab. Invest. 33, 88–95. Jones, D., O’Hara, C., Kraus, M. D., Perez-Atayde, A. R., Shahsafaei, A., Wu, L., and Dorfman, D. M. (2000). Expression pattern of T-cell-associated chemokine receptors and their chemokines correlates with specific subtypes of T-cell non-Hodgkin lymphoma. Blood 96, 685–690. Kabel, P. J., Voorbij, H. A., de Haan-Meulman, M., Pals, S. T., and Drexhage, H. A. (1989). High endothelial venules present in lymphoid cell accumulations in thyroids affected by autoimmune disease: A study in men and BB rats of functional activity and development. J. Clin. Endocrinol. Metab. 68, 744–751. Kawashima, H. (2006). Roles of sulfated glycans in lymphocyte homing. Biol. Pharm. Bull. 29, 2343–2349. Kobayashi, M., Mitoma, J., Nakamura, N., Katsuyama, T., Nakayama, J., and Fukuda, M. (2004). Induction of peripheral lymph node addressin in human gastric mucosa infected by Helicobacter pylori. Proc. Natl. Acad. Sci. USA 101, 17807–17812. Kobayashi, M., Lee, H., Gilmartin, T. J., Schaffer, L., Head, S. R., Takaishi, S., Wang, T. C., Nakayama, J., and Fukuda, M. (2007). A distinctive set of genes is upregulated during the inflammation-carcinoma sequence in mouse stomach infected by Helicobacter felis. J. Histochem. Cytochem. 55, 263–274. Kobayashi, M., Hoshino, H., Masumoto, J., Fukushima, M., Suzawa, K., Kageyama, S., Suzuki, M., Ohtani, H., Fukuda, M., and Nakayama, J. (2009). GlcNAc6ST-1-mediated decoration of MAdCAM-1 protein with L-selectin ligand carbohydrates directs disease activity of ulcerative colitis. Inflamm. Bowel Dis. 15, 697–706. Lan, H. Y., Mu, W., Nikolic-Paterson, D. J., and Atkins, R. C. (1995). A novel, simple, reliable, and sensitive method for multiple immunoenzyme staining: Use of microwave oven heating to block antibody crossreactivity and retrieve antigens. J. Histochem. Cytochem. 43, 97–102. Lohning, M., Stroehmann, A., Coyle, A. J., Grogan, J. L., Lin, S., Gutierrez-Ramos, J. C., Levinson, D., Radbruch, A., and Kamradt, T. (1998). T1/ST2 is preferentially expressed on murine Th2 cells, independent of interleukin 4, interleukin 5, and interleukin 10, and important for Th2 effector function. Proc. Natl. Acad. Sci. USA 95, 6930–6935. Maly, P., Thall, A., Petryniak, B., Rogers, C. E., Smith, P. L., Marks, R. M., Kelly, R. J., Gersten, K. M., Cheng, G., Saunders, T. L., Camper, S. A., Camphausen, R. T., et al. (1996). The a(1,3)fucosyltransferase Fuc-TVII controls leukocyte trafficking through and essential role in L-, E-, and P-selectin ligand biosynthesis. Cell 86, 643–653. Mitoma, J., Miyazaki, T., Sutton-Smith, M., Suzuki, M., Saito, H., Yeh, J. C., Kawano, T., Hindsgaul, O., Seeberger, P. H., Panico, M., Haslam, S. M., Morris, H. R., et al. (2009). The N-glycolyl form of mouse sialyl Lewis X is recognized by selectins but not by HECA452 and FH6 antibodies that were raised against human cells. Glycoconj. J. 26, 511–523. Nakane, P. K. (1975). Recent progress in the peroxidase-labeled antibody method. Ann. NY Acad. Sci. 254, 203–211. Pileri, S. A., Roncador, G., Ceccarelli, C., Piccioli, M., Briskomatis, A., Sabattini, E., Ascani, S., Santini, D., Piccaluga, P. P., Leone, O., Damiani, S., Ercolessi, C., et al. (1997). Antigen retrieval techniques in immunohistochemistry: Comparison of different methods. J. Pathol. 183, 116–123. Renkonen, J., Tynninen, O., Hayry, P., Paavonen, T., and Renkonen, R. (2002). Glycosylation might provide endothelial zip codes for organ-specific leukocyte traffic into inflammatory sites. Am. J. Pathol. 161, 543–550.
Immunohistochemistry for Carbohydrate Antigens
289
Rosen, S. D. (2004). Ligands for L-selectin: Homing, inflammation, and beyond. Annu. Rev. Immunol. 22, 129–156. Sabattini, E., Bisgaard, K., Ascani, S., Poggi, S., Piccioli, M., Ceccarelli, C., Pieri, F., Fraternali-Orcioni, G., and Pileri, S. A. (1998). The EnVisionTMþ system: A new immunohistochemical method for diagnostics and research. Critical comparison with the APAAP, ChemMateTM, CSA, LSBC, and SABC techniques. J. Clin. Pathol. 51, 506–511. Salmi, M., Granfors, K., MacDermott, R., and Jalkanen, S. (1994). Aberrant binding of lamina propria lymphocytes to vascular endothelium in inflammatory bowel diseases. Gastroenterology 106, 596–605. Schroeder, K. W., Tremaine, W. J., and Ilstrup, D. M. (1987). Coated oral 5-aminosalicylic acid therapy for mildly to moderately active ulcerative colitis. A randomized study. N. Engl. J. Med. 317, 1625–1629. Shi, S. R., Key, M. E., and Kalra, K. L. (1991). Antigen retrieval in formalin-fixed, paraffinembedded tissues: An enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J. Histochem. Cytochem. 39, 741–748. Stamper, H. B., and Woodruff, J. J. (1976). Lymphocyte homing into lymph nodes: In vitro demonstration of the selective affinity of recirculating lymphocytes for high-endothelial venules. J. Exp. Med. 144, 828–833. Streeter, P. R., Rouse, B. T., and Butcher, E. C. (1988). Immunohistologic and functional characterization of a vascular addressin involved in lymphocyte homing into peripheral lymph nodes. J. Cell. Biol. 107, 1853–1862. Suzawa, K., Kobayashi, M., Sakai, Y., Hoshino, H., Watanabe, M., Harada, O., Ohtani, H., Fukuda, M., and Nakayama, J. (2007). Preferential induction of peripheral lymph node addressin on high endothelial venule-like vessels in the active phase of ulcerative colitis. Am. J. Gastroenterol. 102, 1499–1509. Tornehave, D., Hougaard, D. M., and Larsson, L. (2000). Microwaving for double indirect immunofluorescence with primary antibodies from the same species and for staining of mouse tissues with mouse monoclonal antibodies. Histochem. Cell Biol. 113, 19–23. Tsuchiya, T., Ohshima, K., Karube, K., Yamaguchi, T., Suefuji, H., Hamasaki, M., Kawasaki, C., Suzumiya, J., Tomonaga, M., and Kikuchi, M. (2004). Th1, Th2, and activated T-cell marker and clinical prognosis in peripheral T-cell lymphoma, unspecified: Comparison with AILD, ALCL, lymphoblastic lymphoma, and ATLL. Blood 103, 236–241. Uchimura, K., Gauguet, J. M., Singer, M. S., Tsay, D., Kannagi, R., Muramatsu, T., von Andrian, U. H., and Rosen, S. D. (2005). A major class of L-selectin ligands is eliminated in mice deficient in two sulfotransferases expressed in high endothelial venules. Nat. Immunol. 6, 1105–1113. van Dinther-Janssen, A. C., Pals, S. T., Scheper, R., Breedveld, F., and Meijer, C. J. (1990). Dendritic cells and high endothelial venules in the rheumatoid synovial membrane. J. Rheumatol. 17, 11–17. von Andrian, U. H., and Mempel, T. R. (2003). Homing and cellular traffic in lymph nodes. Nat. Rev. Immunol. 3, 867–878. Watson, S. R., Imai, Y., Fennie, C., Geoffroy, J. S., Rosen, S. D., and Lasky, L. A. (1990). A homing receptor-IgG chimera as a probe for adhesive ligands of lymph node high endothelial venules. J. Cell. Biol. 110, 2221–2229. Yamashita, S. (2007). Heat-induced antigen retrieval: Mechanisms and application to histochemistry. Prog. Histochem. Cytochem. 41, 141–200. Yeh, J. C., Hiraoka, N., Petryniak, B., Nakayama, J., Ellies, L. G., Rabuka, D., Hindsgaul, O., Marth, J. D., Lowe, J. B., and Fukuda, M. (2001). Novel sulfated lymphocyte homing receptors and their control by a core1 extension b1,3-N-acetylglucosaminyltransferase. Cell 105, 957–969.
C H A P T E R
S E V E N T E E N
Genetic Defects in Muscular Dystrophy Kumaran Chandrasekharan* and Paul T. Martin*,† Contents 292 294
1. Overview 2. Mouse Models of Muscular Dystrophy 3. Approach to Phenotype Analysis in Mouse Muscular Dystrophy Models 4. Summary Acknowledgments References
306 312 312 312
Abstract The muscular dystrophies are a group of neuromuscular disorders associated with muscle weakness and wasting, which in many forms can lead to loss of ambulation and premature death. A number of muscular dystrophies are associated with loss of proteins required for the maintenance of muscle membrane integrity, in particular with proteins that comprise the dystrophin-associated glycoprotein (DAG) complex. Proper glycosylation of O-linked mannose chains on a-dystroglycan, a DAG member, is required for the binding of the extracellular matrix to dystroglycan and for proper DAG function. A number of congenital disorders of glycosylation have now been described where a-dystroglycan glycosylation is altered and where muscular dystrophy is a predominant phenotype. Glycosylation is also increasingly being appreciated as a genetic modifier of disease phenotypes in many forms of muscular dystrophy and as a target for the development of new therapies. Here we will review the mouse models available for the study of this group of diseases and outline the methodologies required to describe disease phenotypes.
* Center for Gene Therapy, The Research Institute at Nationwide Children’s Hospital, Columbus, Ohio, USA Department of Pediatrics, Department of Physiology and Cell Biology, The Ohio State University College of Medicine, Columbus, Ohio, USA
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79017-0
#
2010 Elsevier Inc. All rights reserved.
291
292
Kumaran Chandrasekharan and Paul T. Martin
1. Overview The muscular dystrophies are a group of genetic disorders characterized by the wasting of skeletal muscle, ultimately leading to muscle weakness and sometimes to premature death. Most of these disorders involve loss of function mutations or deletions in genes that encode proteins involved in maintaining the structural integrity of the cardiac and/or skeletal muscle sarcolemmal membrane. Presentation of clinical symptoms varies widely, ranging from birth (congenital muscular dystrophies) to adulthood (as in certain limb-girdle muscular dystrophies). Still other forms, such as Duchenne muscular dystrophy (DMD), are usually diagnosed shortly after children learn to walk. While the list of genes known to cause this class of diseases is relatively large, disease forms still exist where all currently known disease genes are normal. Thus, it is likely that new muscular dystrophy genes are still yet to be discovered. The glycobiology of muscular dystrophies is highly focused on dystroglycan, a densely glycosylated membrane component of the dystrophinassociated glycoprotein (DAG) complex (Fig. 17.1). Dystroglycan is a major cell surface receptor for extracellular matrix (ECM) proteins, including laminins, agrin, and perlecan (Martin, 2003a). Dystroglycan is posttranslationally cleaved into two polypeptide chains, a- and b-dystroglycan, that are tightly bound together via noncovalent bonds (Ervasti and Campbell, 1991). b-Dystroglycan is a transmembrane glycoprotein, while a-dystroglycan is a membrane-associated extracellular protein (Ervasti and Campbell, 1991; Ohlendieck et al., 1991). a-Dystroglycan contains a mucin-like region in the middle third of its protein coding sequence that has about 55 serines and threonines that could receive O-linked glycosylation (Martin, 2003a). Glycan sequencing of the O-linked chains on a-dystroglycan, both by Dell, Smalheiser, and colleagues (from sheep brain, Smalheiser et al., 1998) and by Endo and colleagues (from bovine peripheral nerve (Chiba et al., 1997)and rabbit skeletal muscle (Sasaki et al., 1998)) revealed a mixture of relatively common core 1 glycans (Galb1,3GalNAca-O-Ser/Thr or T antigen) and far rarer O-linked mannose tetrasaccharides (Neu5Ac (or Neu5Gc)a 2,3Galb1,4GlcNAcb1,2Mana-O-Ser/Thr). Smalheiser and Dell also identified O-mannosyl-linked Lewis X (Galb1,4[Fuca1,3]GlcNAcb1,2ManaO) in sheep brain (Smalheiser et al., 1998). Campbell, Wells, and colleagues (Yoshida-Moriguchi et al., 2010) have also recently reported an unusual phosphorylated O-linked mannose trisaccharide on recombinant a-dystroglycan. The glycosylation of a-dystroglycan by genes involved in the synthesis of its O-linked mannosyl glycans is necessary for ECM binding (Martin, 2006). Consistent with an essential role for these carbohydrate structures, loss of function mutations in genes affecting O-linked mannose biosynthesis give rise to forms of congenital and limb-girdle muscular
293
Genetic Models of Muscular Dystrophy
Collagen VI Laminin a 2
Extracellular matrix
a
Dystroglycan complex
b
a
Golgi complex
Sspn
Sarcoglycan complex
d
Integrin a7 b1
b a g
Membrane Integrin-associated proteins
b1
Syntrophins POMGnT1
Cytoplasm Dystrophin F-actin
FKRP Fukutin
POMT1/2
POMGnT1 POM1/2
NeuAca2,3Galb1,GlcNAcb1,2Mana-O-S/T-dystroglycan ? Fukutin FKRP LARGE
F-actin
Figure 17.1 The dystrophin-associated glycoprotein (DAG) complex. Mutations or deletions that result in loss of expression of members of the dystrophin-associated glycoprotein complex result in muscular dystrophy. The DAG complex serves to link the basal lamina of extracellular matrix (ECM) that surrounds each skeletal myofiber with the filamentous actin cytoskeleton inside the cell. O-linked mannose glycan chains are concentrated in the mucin-like region of a-dystroglycan and these glycans are required for ECM protein binding to a-dystroglycan in the membrane. A series of genes regulate the glycosylation of the O-mannose-linked glycan chains, including Fukutin, FKRP, POMT1, POMT2, POMGnT1, and LARGE. All of these proteins are expressed in the endoplasmic reticulum or in the Golgi apparatus and their loss of function also results in muscular dystrophy. Abbreviations used: FKRP, Fukutinrelated protein; POMT1/2, Protein O-mannosyl-transferase 1/2; POMGnT1, Protein O-linked-mannose b-1,2-N-acetylglucosaminyltransferase 1; Sspn, Sarcospan.
dystrophies, and these can be mimicked by tissue-specific loss of dystroglycan in affected tissues (Barresi and Campbell, 2006; Martin, 2006). Dystroglycan associates with a large number of extracellular and intracellular proteins as an essential member of transmembrane protein complexes (Fig. 17.1). The composition of these complexes differs depending on the cell type and its subcellular localization (Martin, 2003a, b). In the sarcolemmal membrane of skeletal myofibers, dystroglycan is a central component of the DAG complex. Here, dystroglycan binds to the principal extrasynaptic muscle laminin (laminin-211, a2,b1,g1 laminin in the older nomenclature) and this binding requires the O-mannosyl-linked glycans
294
Kumaran Chandrasekharan and Paul T. Martin
present in its mucin-like domain (Ervasti and Campbell, 1993; Michele et al., 2002). a/b-Dystroglycan interacts within the membrane with sarcoglycans, which are a four protein complex (ad sarcoglycan) in skeletal muscle, and via the cytoplasmic domain of b-dystroglycan with dystrophin, which ultimately links the complex to filamentous actin and other structural and signaling components, including syntrophins. While the DAG complex parallels the function of other membrane protein complexes, in particular the integrins, DAG function is essential for the maintenance of normal sarcolemmal membrane integrity. Mutations affecting expression of almost all DAGs cause forms of muscular dystrophy, strongly demonstrating a functional role for these protein associations (Martin, 2006). Loss of dystrophin causes DMD (Hoffman et al., 1987; Koenig et al., 1987), a severe X-linked myopathy, while partial loss of dystrophin causes Becker muscular dystrophy, which typically has a milder clinical progression than DMD (Blake et al., 2002; Love et al., 1989). Similarly, loss of any of the four muscle sarcoglycans (ad) causes limbgirdle muscular dystrophy (LGMD2D, 2E, 2C, and 2F, respectively) (Angelini, 2004; Rezniczek et al., 2007; Vainzof et al., 1996), and loss of laminin a2 causes congenital muscular dystrophy 1A (Tome et al., 1994; Xu et al., 1994a). Complete loss of dystroglycan is lethal in mice from an early embryonic stage (Williamson et al., 1997), and this may explain why human DAG1 mutations have not been identified as causing muscular dystrophy. However, loss of proteins that glycosylate a-dystroglycan to create the Omannose-linked tetrasaccharide (Fig. 17.1) causes forms of congenital or limb-girdle muscular dystrophies by disrupting laminin binding (JimenezMallebrera et al., 2005). The weakened interaction of the muscle basal lamina with the cell membrane leads to muscle damage, intramuscular inflammatory infiltrates, and ultimately the replacement of muscle tissue with connective tissue or fat (muscle wasting).
2. Mouse Models of Muscular Dystrophy Many mouse models of human muscular dystrophies have been created that provide glycobiologists with a wealth of reagents to explore the role of glycans in these diseases. Most of these are loss of function models that mimic, albeit to varying degrees, aspects of the human disease (Table 17.1), while others provide evidence for roles of genes as secondary modifiers of disease progression or as inhibitors of disease phenotypes (Table 17.2). Because of the wealth of mouse models, we have focused on models for which there are known human diseases. The most studied genetic muscular dystrophy model in this regard is the mdx mouse. mdx mice contain a point mutation in exon 23 of the dystrophin gene (Dmd),
Table 17.1 Mouse models of muscular dystrophy Mouse Model
Protein
Cytoplasmic proteins mdx Dystrophin (Dp427) mdx2cv
Gene
Gene locus
Human disease
References
Dmd
X 32.0 cM
Duchenne/Becker MD
Sicinski et al. (1989), Bulfield et al. (1984) Im et al. (1996)
Actg1/
Dystrophin Dp260 Dystrophin Dp71 Dp116 Dp140 Dp260 Dystrophin Dp140 Dp260 Dystrophin Dystrophin Dp140 Dp260 Dp71 Dystrophin lacking the actin-binding domain g-Actin
Capn3/ Capn3TG Chkb/
Calpain, large polypeptide L3 Capn3 Calpain-3 Capn3 Choline kinase b Chkb
mdx3cv
mdx4cv mdx5cv mdx52 Dp71/ DmdTG
Im et al. (1996)
Im et al. (1996)
Im et al. (1996) Araki et al. (1997)
Sarig et al. (1999) Corrado et al. (1996) Actg1
11 E2
Deafness
2 67.2 cM 2 67.2 cM 15 B3
LGMD2A NR NR
Belyantseva et al. (2009), Sonnemann et al. (2006) Richard et al. (2000) Spencer and Mellgren (2002) Wu et al. (2010), Sher et al. (2006) (continued)
Table 17.1 (continued) Mouse Model
Protein
Gene
Gene locus
Human disease
References
MLC2v-Cre Ldb3loxP MHCa-Cre Ldb3loxP Desmin/
LIM domain containing 3 (Cypher)
Ldb3
14 B
Familial and sporadic DCM INLVM
Zheng et al. (2009) Zhou et al. (2001)
Desmin
Des
1 41.1 cM
Li et al. (1997), Milner et al. (1996)
Adbn/
a-Dystrobrevin
Dtna
GneV572L GneD176V
Gne
4 B1
Mbnl2
14 E4
DM
Hao et al. (2008)
Myotilin T57ITG
UDP-N-acetylglucosamine2-epimerase/ N-acetylmannosamine kinase Muscleblind-like 2 RNA binding protein Myotilin
Desmin-related myopathy DCM HCM Left ventricular noncompaction with no MD Hereditary inclusion body Myopathy II HIBM
Myot
18 B3
Garvey et al. (2006)
Myotilin/
Myotilin
Myot
18 B3
Obscn/ p94:C129STG
Obscurin Inactive mutant of calpain 3
Obscn Capn3
11 B1.3 2 67.2 cM
LGMD1A MFM LGMD1A Spheroid body Myopathy HCM LGMD2A
Mbnl2/
Grady et al. (1999)
Malicdan et al. (2007a,b)
Moza et al. (2007)
Lange et al. (2009) Tagawa et al. (2000)
PEVK/ TTNN2AD83
proline-glutamate-valinelysine region of Titin N2A domain of titin
Ttn
2 44.0 cM
Tibial MD Early-onset myopathy Familial cardiomyopathy LGMD2J MDM
Plectin/
Plectin 1
Plec1
15 44.0 cM
SspnTG mSpnTG Syncoilin/
Sarcospan Sspn Microspan (sarcospan isoform) Sspn Syncoilin Sync
4 60.0 cM
Epidermolysis bullosa simplex with MD NR NR NR
Trim32/
E3 Ubiquitin ligase tripartitie Trim32 motif-containing 32 Tropomyosin Tpm1
4 22.0 cM
LGMD2H
Gramlich et al. (2009), Ottenheijm et al. (2009), Granzier et al. (2009), Peng et al. (2007), Radke et al. (2007), Weinert et al. (2006), Peng et al. (2005) Huebsch et al. (2005), Garvey et al. (2002) Ackerl et al. (2007), Andra et al. (1997) Peter et al. (2007) Miller et al. (2006) McCullagh et al. (2008), Zhang et al. (2008) Kudryashova et al. (2009)
9 40.0 cM
Nemaline myopathy
Joya et al. (2004)
TpmM9RTG Membrane proteins Cav-3/
Caveolin-3
Cav3
6 48.3 cM
LGMD1C
Cav3Pro104LeuTG Cav-3TG
Mutant caveolin-4
Cav-3
6 48.3 cM
LGMD1C
Caveolin-3
Cav3
6 48.3 cM
NR
Dag1/ Chimeric Dag1/ MCK-Cre Dag1loxP
Skeletal and cardiac dystroglycan Dystroglycan Skeletal muscle-specific dystroglycan
Dag1
9 60.0 cM
NR
Galbiati et al. (2001), Hagiwara et al. (2000) Ohsawa et al. (2004), Sunada et al. (2001) Aravamudan et al. (2003), Galbiati et al. (2000) Cote et al. (1999)
Dag1 Dag1
9 60.0 cM 9 60.0 cM
NR NR
Williamson et al. (1997) Cohn et al. (2002) (continued)
Table 17.1
(continued)
Mouse Model
Protein
Gene
Gene locus
Human disease
References
GFAP-Cre Dag1loxP Nesin-Cre Dag1loxP Mox2-Cre Dag1loxP MLC2v-Cre Dag1loxP Pax3-Cre Dag1loxP Dag1S654A TG
Brain-specific Dystroglycan
Dag1
9 60.0 cM
NR
Moore et al. (2002)
Neuron-specific Dag1 Dystroglycan Epiblast-specific dystroglycan Dag1
9 60.0 cM
NR
Satz et al. (2009)
9 60.0 cM
NR
Satz et al. (2008)
Cardiac-specific dystroglycan Dag1
9 60.0 cM
NR
Michele et al. (2009)
Dag1
9 60.0 cM
NR
Jarad and Miner (2009)
Dag1
9 60.0 cM
NR
Jayasinha et al. (2003)
Dysferlin/ Integrin a7/
Rostrocaudal gradient expression of dystroglycan Cleavage-resistant dystroglycan Dysferlin Integrin a7
Dysf Itga7
6 35.85 cM 10 72.0 cM
ScgaH77C Sgca/ Sgcb/
a-Sarcoglycan a-Sarcoglycan b-Sarcoglycan
Sgca Sgca Sgcb
11 C 11 C 5 C3.3
LGMD2B Integrin-deficient CMD LGMD2D LGMD2D LGMD2E
Sgcd/ Sgcg/ SgcgTG
d-Sarcoglycan g-Sarcoglycan g-Sarcoglycan
Sgcd Sgcg Sgcg
11 B1.2 14 D1 14 D1
LGMD2F LGMD2C NR
Bansal et al. (2003) Flintoff-Dye et al. (2005), Mayer et al. (1997) Kobuke et al. (2008) Duclos et al. (1998) Durbeej et al. (2000), Araishi et al. (1999) Coral-Vazquez et al. (1999) Hack et al. (1998) Zhu et al. (2001)
Col6a1
10 41.1 cM
Ullrich CMD Bethlem myopathy
Extracellular matrix proteins Col6a1/
Collagen VI
Bonaldo et al. (1998)
dy
Laminin a2
NR
10 20.0 cM
MDC1A
dy2J dy3K dyW
Laminin a2 Laminin a2 Laminin a2
Lama2 Lama2 Lama2
10 20.0 cM 10 20.0 cM 10 20.0 cM
MDC1A MDC1A MDC1A
8 34.0 cM
LGMD2I MEB Disease WWS LGMD2L Fukuyama CMD MEB disease WWS MDC1D
4 C7
MEB disease
2B
LGMD2K WWS
Willer et al. (2004)
X 29.81 cM 1 97.3 cM
EDMD1 Pelger–Huet anomaly HEM or Greenberg skeletal dysplasia
Melcon et al. (2006) Cohen et al. (2008), Shultz et al. (2003)
Sunada et al. (1994), Xu et al. (1994b), Michelson et al. (1955) Xu et al. (1994a) Miyagoe et al. (1997) Kuang et al. (1998a)
Dystroglycan Glycosylation FKRPTyr307Asn
Fukutin-related protein
Fkrp
7 A2
Fukutin/ Fukutin Hn/ FukutinHp/
Fukutin
Fktn
4 22.0 cM
Largemyd
Like-glycosyl Large transferase Pomgnt1 Protein-O-linked mannose b1,2-N-acetylglucosaminyl transferase Protein O-mannosyl Pomt1 transferase 1
Pomgnt1/ Pomt1/ Nuclear Proteins Emd/ icJ, LbrGT/GT
Emerin Lamin B receptor
Emd Lbr
Ackroyd et al. (2009)
Kanagawa et al. (2009), Kurahashi et al. (2005), Takeda et al. (2003) Michele et al. (2002), Grewal et al. (2001) Miyagoe-Suzuki et al. (2009), Li et al. (2008)
(continued)
Table 17.1 (continued) Mouse Model
Protein
Gene
Gene locus
Human disease
References
Lmna LmnaH222P/H222P Lmna195-N195K LmnaM371K
Lamin A/C
Lmna
3 42.6 cM
LGMD1B EDMD2 EDMD3 LMNA-related CMD DCM-CD1
Lmnb/ Nesprin-1/ NesprinD/DKASH
Lamin B1 Lmnb1 Nesprin-1 Syne1 (Synaptic Nuclear Envelope 1)
18 29.0 cM 10 A1
NR EDMD Cardiomyopathy
Quijano-Roy et al. (2008), Wang et al. (2006), Arimura et al. (2005), Mounkes et al. (2005), Nikolova et al. (2004), Lammerding et al. (2004), Sullivan et al. (1999) Vergnes et al. (2004) Puckelwartz et al. (2009), Puckelwartz et al. (2010), Zhang et al. (2009) Lei et al. (2009)
/
Sun1/ SUN domain containing proteins Sun2/ Sun1/ Sun2/ DUX Double homeobox FRG1TG FSHD region 1
Sun1 Sun2
6 G1 15 E1
NR
Dux Frg1
10 8 22.6 cM
FSHD NR
hPABPN1TG
Pabpn1
14 19.5 cM
OPMD
Zmpste/
Poly(A)-binding protein, nuclear 1 Zinc metalloproteinase
Zmpste24 4 D2.2
Restrictive dermopathy HGPS Mandibuloacral Dysplasia
Bosnakovski et al. (2009) D’Antona et al. (2007), Gabellini et al. (2006) Hino et al. (2004) Pendas et al. (2002)
NR, not reported; Hn, Human normal; Hp, Human patient; TG, Transgenic. Muscular dystrophy-related genes and their protein products are listed. MD, Muscular dystrophy; LGMD, Limb-girdle muscular dystrophy; CMD, Congenital muscular dystrophy; WWS, Walker–Warburg syndrome; MEB, Muscle eye brain; EDMD, Emery–Dreifuss muscular dystrophy; DCM-CD1, Dilated cardiomyopathy with conduction system disease or conduction defects; HGPS, Hutchinson–Gilford Progeria Syndrome; HEM, Hydrops-Ectopic calcification-"Moth-Eaten"; MDM, Myopathy with myositis; DCM, Dilated cardiomyopathy; INLVM, Isolated noncompaction of the left ventricular myocardium; HCM, Hypertrophic cardiomyopathy; DM, Myotonic dystrophy; MFM, Myofibrillar Myopathy; HIBM, Hereditary inclusion body myopathy; FSHD, Facioscapulohumeral muscular dystrophy; OPMD, Oculopharyngeal muscular dystrophy.
Table 17.2 Genetic modifiers of muscular dystrophy Mouse Model
Protein
Gene
References
Forced gene expression that inhibits muscular dystrophy ADAM12TG mdx A disintegrin and metallopeptidase domain 12 Thymoma viral proto-oncogene1 AktTG mdx CnA*TG mdx Calcineurin CSTG mdx Calpastatin Dp427TG mdx Dystrophin
Adam12
Kronqvist et al. (2002)
Akt1 Ppp2ca Cast Dmd
Dp260TG mdx FS I-ITG mdx Galgt2TG mdx IGF-1TG mdx
Dp260 Follistatin-derived myostatin inhibitor CT GalNAc Transferase Insulin-like growth factor-1
Dmd Fstn Galgt2 Igf1
Itga7BX2TG Utrn/ mdx JazzTG mdx MiniHuman DmdTG mdx nNOSTG mdx
Integrin a7 Artificial zinc finger transcription factors Mutated human dystrophin Neuronal nitric oxide synthase
Itga7
PGC1aTG mdx T-DmdTG mdx dnTRPV2E604KTG mdx
Ppargc1a Dmd Trpv2
UtrnTG mdx
PGC1a Truncated dystrophin Dominant negative transient receptor potential cation channelE604K Utrophin
Peter et al. (2009) Stupka et al. (2006), Chakkalakal et al. (2004) Spencer and Mellgren (2002) Cox et al. (1993), Matsumura et al. (1993), Lee et al. (1993) Warner et al. (2002) Nakatani et al. (2008), Benabdallah et al. (2008) Nguyen et al. (2002) Ridgley et al. (2009), Shavlakadze et al. (2004), Barton et al. (2002) Burkin et al. (2005), Burkin et al. (2001) Di Certo et al. (2010) Wells et al. (1992) Tidball and Wehling-Henricks (2004), Shiao et al. (2004), Wehling et al. (2001) Handschin et al. (2007) Rafael et al. (1994) Iwata et al. (2009)
UtrnTG mdx Utrn/ BCL2TG dyW
Utrophin B-Cell leukemia/lymphoma 2
Utrn Bcl2
Dmd Nos1
Utrn
Squire et al. (2002), Tinsley et al. (1998), Deconinck et al. (1997b), Tinsley et al. (1996) Rafael et al. (1998) Dominov et al. (2005) (continued)
Table 17.2 (continued) Mouse Model TG
W
Galgt2 dy LNa1TG dyW Mini-AgrinTG dy3K Galgt2TG Scga/ SgceTG Scga/ Cav3P104LTG/MsntProTG Galgt2TG DGS654ATG NPC1TG Dtna/
Protein
Gene
References
CT GalNAc transferase Laminin a1 Miniaturized form of agrin CT GalNAc transferase e-Sarcoglycan Caveolin-3P104L Myostatin prodomain CT GalNAc transferase Cleavage-resistant dystroglycanS654A Niemann-pick C1
Galgt2 Lama1 Agrn Galgt2 Sgce Cav-3 Mstn Galgt2 Dag1 Npc1
Xu et al. (2007b) Hager et al. (2005), Gawlik et al. (2004) Meinen et al. (2007), Bentzinger et al. (2005) Xu et al. (2009) Imamura et al. (2005) Ohsawa et al. (2006)
Bcl2 Dag1 Dmd Itga7
Dominov et al. (2005) Hoyte et al. (2004) Cox et al. (1994), Greenberg et al. (1994) Milner and Kaufman (2007)
Cabp
Chakkalakal et al. (2006)
Mstn Mstn
Wagner et al. (2002) Parsons et al. (2006)
Jayasinha et al. (2003) Steen et al. (2009)
Forced gene expression with no effect on muscular dystrophy BCL2TG mdx Dag1TG mdx Dp71TG mdx Intga7BX2TG Scgd/
B-Cell leukemia/lymphoma 2 Dystroglycan Dp71 Integrin a7
Forced gene expression with severe muscular dystrophy CaMBPTG mdx
Calmodulin Binding Protein
Secondary Gene Loss Inhibiting Muscular Dystrophy Mstn/ mdx Mstn/ Scgd/
Myostatin Myostatin
Secondary gene loss and severe muscular dystrophy Adbn/ mdx dyWMstn/ Itga7/ mdx Mnf / mdx MyoD/ mdx nNOS/ mdx PV/ mdx Utrn/ mdx Abbreviations are listed in Table 17.1.
a-Dystrobrevin Laminin a2 Integrin a7 Myocyte nuclear factor Myogenic differentiation factor D Neuronal nitric oxide synthase Parvalbumin Utrophin
Dtna Lama2 Itga7 Mnf MyoD Nos1 Pvalb Utrn
Grady et al. (1999) Li et al. (2005) Guo et al. (2006), Rooney et al. (2006) Garry et al. (2000) Megeney et al. (1999) Crosbie et al. (1998) Raymackers et al. (2003) Grady et al. (1997a), Deconinck et al. (1997a)
304
Kumaran Chandrasekharan and Paul T. Martin
leading to a loss of expression of full-length (427 kDa) dystrophin protein in most skeletal and cardiac myofibers (Sicinski et al., 1989). As such, it is an excellent genetic model for DMD, which is caused by mutations or deletions in the human dystrophin gene (Hoffman et al., 1987; Koenig et al., 1987). There are at least four different transcripts of dystrophin (driven from four different promoters) that give rise to unique dystrophin protein species (427, 260, 140, and 71 kDa). Additional models lacking these specific components, as well as genomic deletions (e.g., mdx2-5cv), have been created (Table 17.1). Dystrophin is also expressed in neurons within the retina and the brain, where some of the shorter dystrophin protein forms remain even in mdx animals (Gorecki et al., 1994; Koulen et al., 1998; Montanaro et al., 1995). In as far as these models eliminate native 427 kDa dystrophin protein from muscle cells, the protein form required for normal muscle function, they are all very similar with regard to disease phenotypes (Willmann et al., 2009). Likewise, a number of models of laminin a2-deficiency have been created, ranging from genomic deletions that eliminate all protein expression (dy3K) to mutants that express partial laminin protein forms that are unable to polymerize into the ECM (dyW, dy2J) (Table 17.1). Again, the disease phenotypes of these various models are more similar than they are different, though they should never be used interchangeably within the same groups of experiments, as important phenotypic differences do exist between strains. What can be appreciated from this rather large list is that a wealth of tools is available to analyze specific protein functions in the ECM, membrane, cytoplasm, and nucleus, with regard to muscular dystrophy. One needs to keep in mind, however, that many of these proteins associate with one another. For example, expression of dystroglycan and sarcoglycan proteins is reduced in the membranes of mdx mice (Matsumura et al., 1992). Similarly, compensatory upregulation of homologues or orthologues in mouse gene deletion models can complicate the understanding of phenotype. For example, laminin a2-deficient mice show significant upregulation of laminin a4 in skeletal muscle ECM (Patton et al., 1999). Last, some genes, for example dystroglycan (Dag1), are lethal when deleted in the whole animal (Williamson et al., 1997). These data suggest that models affecting the glycosylation of a-dystroglycan, where expression of the dystroglycan polypeptide along the sarcolemmal membrane is maintained (Michele et al., 2002), may only reflect a partial loss of function. Campbell and colleagues have made a series of tissue-specific dystroglycan (Dag1) deletion mice to remove the protein specifically from heart, skeletal muscle, neurons, or the epiblast (Table 17.1). These studies demonstrate that tissue-specific loss of dystroglycan largely phenocopies the human glycosylation mutations. While these models are extremely important for assessing dystroglycan function in specific tissues, several caveats should be noted. First, use of skeletal muscle-specific promoters (such as MCK) does not delete
Genetic Models of Muscular Dystrophy
305
dystroglycan in satellite cells, a regenerative pool of myoblasts in skeletal muscle (or in myofiber nuclei present at the neuromuscular junction) (Cohn et al., 2002). As such, this model continuously reexpresses dystroglycan in newly made regenerating muscles, which are derived in large part from dividing satellite cells. A cleaner model would seem to be the Pax3(P3)-Cre Dag1loxP mouse, where dystroglycan is deleted in all hindlimb skeletal muscle cells due to a rostral–caudal gradient of Cre transgene expression ( Jarad and Miner, 2009). Here, one can use the same animal to assess muscles with dystroglycan (e.g., forelimbs) and without dystroglycan (e.g., hindlimbs). Models assessing genes that control dystroglycan glycosylation (Largemyd, FKRP, Fukutin, POMT1, and POMGnT1) are described in subsequent chapters of this book series. A number of models for muscular dystrophies involving nuclear or nuclear membrane proteins also exist (e.g., Lamins A–C, FSHD genes). It remains largely to be investigated how these protein defects relate to diseases involving the DAG complex. Last, several mouse models for hereditary inclusion body myopathy type II have been made (Table 17.1). HIBM II is a myopathy with great interest to glycobiologists, as this disease can be caused by mutations in GNE (UPD-GlcNAc-2epimerase/ManNAc kinase), the enzyme that controls the committed step in sialic acid biosynthesis (Eisenberg et al., 2001). In the search for therapies to treat muscular dystrophies, a number of investigators have identified genes that ameliorate muscle pathology when they are overexpressed in skeletal muscles (Table 17.2). For mdx mice, this list includes serum trophic factors (Igf1 and follistatin), membrane ECM receptors (integrin a7), calcium-binding proteins or channels (calcineurin, calpastatin, and TRPV2), kinases (Akt1), redox mediators (nNOS), dystrophin orthologues (utrophin), synthetic or natural transcription factors (PGC1a and Jazz), and glycosyltransferases (Galgt2). For laminin a2-deficiency, therapeutic genes have focused on ECM replacement and inhibiting apoptosis (laminin a1, agrin, and Bcl2). Galgt2 is the glycosyltransferase that creates the CT carbohydrate on a-dystroglycan (Xia et al., 2002; Yoon et al., 2009). The presence of this carbohydrate, which is normally only present at the neuromuscular synapse in skeletal muscle (Martin et al., 1999), on adystroglycan increases ECM binding affinity (Yoon et al., 2009) and improves muscle membrane resistance to injury (Martin et al., 2009). Galgt2 overexpression in skeletal muscles has been shown to be therapeutic in three different models of muscular dystrophy, mdx (Nguyen et al., 2002; Xu et al., 2007a), dyW (Xu et al., 2007b), and Sgca/ (Xu et al., 2009). Some other transgenes have also been compared in more than one disease model, but have been shown to be effective in one and ineffective in another. For example, Bcl2 overexpression alters disease in dyW mice but not in mdx animals (Dominov et al., 2005). Likewise, overexpression of integrin a7 ameliorates disease phenotypes in mdxUtrn/ mice (Burkin et al., 2001) but not in g-sarcoglycan-deficient mice (Sgcd/) animals (Milner and
306
Kumaran Chandrasekharan and Paul T. Martin
Kaufman, 2007). Secondary gene deletions also alter disease phenotype in muscular dystrophy models. Deletion of myostatin, an inhibitor of muscle growth, ameliorates disease and builds muscle mass and strength in mdx animals (Wagner et al., 2002), while deletion of a number of genes (adystrobrevin, MyoD, nNOS, parvalbumin, and utrophin) in mdx mice makes the disease worse (Table 17.2).
3. Approach to Phenotype Analysis in Mouse Muscular Dystrophy Models The description of the dystrophic phenotype in mouse models requires a multifaceted approach that touches on muscle function at multiple levels, from whole animal and ex vivo muscle function studies down to experiments on the cellular and molecular levels (Fig. 17.2). Of particular importance is the integration of whole animal and cellular measures with histopathology indices. Many studies of animal models of muscular dystrophy fail to go beyond a description of muscle pathology and the relative improvement or decrement resulting from a particular genetic manipulation. While such measures are important, they are difficult to extrapolate to changes in whole muscle and animal functions in the absence of higher order measures. The parameters most relevant to human disease are life span, ambulation, weakened cardiac and diaphragm muscle forces, and muscle wasting. Boys with DMD (an X-linked disease), for example, typically show muscle wasting (replacement of muscle tissue with connective tissue or fat) by 3–4 years of age, become wheelchair bound as teenagers, and perish from the disease in their early twenties. Death in DMD is most often caused by complications related to cardiac or respiratory failure. Therefore, these are the aspects of human disease that are most significant with regard to morbidity and mortality. Children with congenital muscular dystrophies involving glycosylation defects in a-dystroglycan additionally can have type II-like lissencephaly (cobblestone cortex), which is evident on MRI, and significant eye pathology (e.g., retinal detachment), which may include blindness (Martin, 2006). These neurological manifestations, which are relatively unique to the dystroglycan-dependent muscular dystrophies, should be a special focus for the glycosylation disorders. Those methods, which are summarized in the relevant references in Table 17.1 and in subsequent chapters of this book, will not be elaborated on further here. Mouse measures most relevant to a Duchenne-like presentation of muscular dystrophy would be survival curve (life span), treadmill (ambulation), diaphragm force measures (respiratory failure), cardiac trabeculae force (cardiac failure), fractional shortening/maximal cardiac output (cardiac failure), trichrome staining, oil red O staining, and hematoxylin and
307
Genetic Models of Muscular Dystrophy
ble
sgenic
logy
ho opat
kno
cko u
t
Mouse models of muscular dystrophy
Tran
Hist
Skeletal muscle and heart: H and E stain Trichrome stain Necrotic foci Fibrotic area Myofiber area Myofiber diameter Central nuclei Fiber type Membrane integrity by EBD uptake
fu
nc Sp tio o n mu nta n tat eo ion us s
Transgenic/knockout
Dou
M
g tin t ge ou ar ock t ne kn Ge ene G
cle
Molecular analysis Serum: Creatine kinase activity Troponin I levels
tion
o
ot
us
func
rf
M
diac
n
tio
c un
Extensor digitorium longus: Eccentric contractions Tetanic force Diaphragm: Force development Cardiac trabeculae: Force development
Car
Lifespan: Mobidity and mortality Survival curve Motor function: Rotarod Grip strength Treadmill
Echocardiography: Cardiac output Stroke volume Fractional shortening LVEDD LVESD Electrocardiography: Q wave amplitude QT interval (QTc) RR interval PR interval QRS duration Cardiomyopathy index
DNA: Carbohydrates: Genotyping Enzyme staining/blotting/activity RNA: Lectin and antibody staining qRT-PCR Lectin and anti-glycan western analysis Glycan profile of a-dystroglycan Microarray Glycan binding to ECM Proteins: Immune response: Immunohistology Quantitation of T and B cells Western blot analysis Macrophages and monocytes Total collagen estimation Anti-glycan antibodies ECM binding to a-dystroglygan Activated complement Proteomics of muscle and DAG complex
Figure 17.2 Model for phenotype workup of mouse muscular dystrophy models. Mouse muscular dystrophy models include spontaneous mutant models and models made by gene deletion or gene insertion. Analysis of muscular dystrophy phenotype involves assessments of overall motor function, cardiac function at both ex vivo dissected muscle and whole heart level, dissected ex vivo muscle physiology measures, assessments of cellular histopathology, and molecular changes.
eosin staining (skeletal muscle wasting) (Fig. 17.2). With regard to muscle function, ex vivo muscle measures of physiology are essential; however, it is imperative to match stimulation measures to the physiology of the muscle in
308
Kumaran Chandrasekharan and Paul T. Martin
question. For example, the resting mouse heart, unlike the human heart, beats at about 600 beats per minute and can be stimulated (e.g., with b agonists) to about 800 beats per minute (Pacher et al., 2008). Thus, stimulation frequencies of 10–12 Hz are most relevant to force measures for isolated cardiac trabeculae. Likewise, eccentric contraction paradigms, while appropriate for an isolated limb muscle such as the extensor digitorum longus (EDL), are not appropriate for the diaphragm, which never experiences such forces in vivo. Force drop during repeated eccentric contractions is a particularly robust measure of muscle damage. Histological measures of dye uptake (e.g., procion orange) can be coupled with eccentric contraction measures in such experiments to assess membrane damage as well (Martin et al., 2009). For mdx muscles, force drop during eccentric contractions in the EDL muscle is greater than for age-matched muscles from wild-type mice. These differences, while statistically significant, are not especially profound. In other mouse muscular dystrophy models, for example sarcoglycan-deficient or laminin a2-deficient mice, force drop using the same paradigm is unchanged from wild-type muscles (Hack et al., 1999; Head et al., 2004). Thus, it is imperative that one match physiology measures to the models where they are most relevant. In mdx mice, there is also typically an overall drop in maximal specific force of isolated skeletal muscles with age. Again, these deficits are fairly subtle when normalized to muscle weight (Martin et al., 2009). Importantly, transgenes that improve muscle histopathology often also improve muscle membrane resistance to injury. For example, overexpression of Galgt2 in skeletal muscles prevents force drop during eccentric contractions to a very significant degree, both in mdx muscles and in wild-type muscles (Martin et al., 2009), and arrests the development of muscle histopathology (Nguyen et al., 2002). Isolated cardiac trabeculae from the mdx heart also show force deficits with age relative to wild-type animals, and models containing additional gene deletions (e.g., utrophin-deficient mdx mice) show significantly worsened contractile dysfunction (Janssen et al., 2005). While isolated ex vivo measurements of muscle function can be highly controlled and elegant, experiments that assess motor function in whole limbs, such as grip strength, or in the whole animal, such as accelerating or constant speed rotarod or treadmill, are also highly valuable as these assess the function of entire groups of muscles to pull force. While these measures may be the last ones to significantly change during the disease process, such changes are likely to be the most profound with regard to their impact on the human disease. While some animals lose the ability to walk altogether (e.g., dyW mice), others show deficits in walking that are only apparent on constant treadmill assays. For example, we have found that aged a-sarcoglycan-deficient mice show greater than a 90% decrease in walking on a 5-min constant speed treadmill test, and overexpression of Galgt2 in these animals rescues 90% of this deficit (Xu et al., 2009). Similarly, we have
Genetic Models of Muscular Dystrophy
309
found that 2-month-old mdx animals show a decrease of about 25% in normalized forelimb grip strength (Martin et al., 2009). Here, we have shown that delivery of a gene therapy to boost muscle growth, such as follistatin, can increase overall grip strength in mdx animals by as much as 50% (Haidet et al., 2008). For some muscular dystrophy mouse models, measures of overall life span are not significantly different; mdx animals, for example, show only about a 2-month change in overall life span compared to wild type (Chamberlain et al., 2007). Other models, such as utrophindeficient mdx animals, show far shorter life spans, with all mice dying by 3 months of age (Deconinck et al., 1997a; Grady et al., 1997b). dyW animals show a more variability in life span, though very reduced compared to wild type (Kuang et al., 1998b). The increased variability in these animals may be due to their small size, which can affect eating habits and cage dynamics with littermates. Many patients with muscular dystrophy experience cardiomyopathy, and about a third of DMD patients succumb to this disease because of cardiac failure. Therefore, measures of whole heart function are important to describe the dystrophic phenotype. mdx mice start showing signs of cardiac necrosis and fibrosis at the age of 20 weeks or older, and this can be significantly worsened by secondary gene deletions (e.g., MyoD) (Bridges, 1986; Megeney et al., 1999). Echocardiographic studies in mdx mice older than 10 months have shown increased left ventricular mass, altered systolic and diastolic left ventricular dimensions, and decreased in heart rate and fractional shortening, all indicators of cardiomyopathy (Chu et al., 2002; Quinlan et al., 2004). Old mdx mice can also show decreased PR interval and increased QRS duration, QT interval, and Q wave (Quinlan et al., 2004). These changes denote an impairment in ventricular conduction similar to that observed in patients with muscular dystrophy. Though functional changes in mdx hearts are subtle, several studies have investigated the effects of therapeutic strategies aimed at gene replacement in the mdx heart. For example, partial correction of electrocardiogram (ECG) profiles was observed in old mdx hearts overexpressing a (mini) dystrophin gene (Bostick et al., 2009). Yue et al. (2004) have shown that expression of full-length (427 kDa) dystrophin in the heart can ameliorate isoproterenol-induced cardiomyopathy in mdx animals. Studies of mdx mice with loss of myostatin, which has a profound effect on skeletal muscle growth, show that myostatin does not regulate cardiac hypertrophy or fibrosis (Cohn et al., 2007). Invasive cardiac hemodynamic studies (e.g., pressure–volume loops) can also be useful in assessing cardiac dysfunction in muscular dystrophy models (Pacher et al., 2008). Perhaps the most extensive arsenal of methods regarding assessment of muscular dystrophy phenotype relate to skeletal muscle and heart histopathology. Almost all mouse models of muscular dystrophy demonstrate muscle damage which is coincident with regeneration of newly formed
310
Kumaran Chandrasekharan and Paul T. Martin
skeletal myofibers and the presence of inflammatory infiltrates within the muscle proper (De la Porte et al., 1999). Muscle damage is most often evident as necrotic myofibers, which are evident in hematoxylin and eosin-stained sections and can be verified by immunostaining with antimouse IgG antibodies to show antibody uptake into damaged myofibers from the serum. Acute muscle damage can also be measured by injecting animals with Evans blue dye. This dye is taken up by damaged myofibers and can be visualized using a rhodamine filter using an epifluorescence microscope. As exercise increases such damage, animals undergoing dye uptake measures usually are normalized for activity by walking on a treadmill for period of time after the dye is given. We typically require animals to walk for 30 min in such experiments (Xu et al., 2009). Another robust hallmark of muscle damage is the presence of centrally located nuclei within skeletal myofibers. After muscles are damaged and removed by immune cells, regenerating myoblasts, primarily derived from satellite cells present within the basal lamina of the damaged myofiber, divide and fuse to form a new myofiber. In dystrophic rodents, for reasons no one really has really ever explained, the nuclei within these regenerating myofibers remain largely in the center of the myotube, while in normal muscles such nuclei migrate out to the near sarcolemmal membrane as the muscle matures. As such, these central nuclei delineate regenerating muscles in muscular dystrophy models, providing an essentially indelible marker of cycles of muscle degeneration and regeneration. In the mdx mouse, we have found that a host of skeletal muscles (gastrocnemius, quadriceps, diaphragm, tibialis anterior, trapezius, triceps, and gluteus maximus) all show about 80% central nuclei by 6 months of age (Nguyen et al., 2002). Most show very significant central nuclei by 6 weeks, with the exception of the diaphragm, where this measure increases more slowly. In wild-type muscles, by contrast, the number of myofibers with central nuclei does not exceed 5%, with most muscles showing 1–2%. Similarly, measures of changes in myofiber diameter also reflect ongoing regeneration, coupled with muscle hypertrophy. Thus, the variance in myofiber diameter, at both ends of the size spectrum, is increased relative to wild type (Nguyen et al., 2002). Measures that pertain to muscle wasting are also essential to understanding dystrophic pathology. Trichrome stain, where collagen in the ECM is stained blue, can be used to demonstrate fibrosis (replacement of muscle tissue with ECM) and Oil Red O staining can demonstrate replacement of muscle tissue with fat. Many mouse models of muscular dystrophy show little or no muscle wasting, and this is a very significant deficit in many disease models. For example, the only muscle in the mdx mouse to show significant fibrosis is the diaphragm, and this is usually not significantly present until 6 months of age (Stedman et al., 1991). Measurement of the release of intracellular proteins from skeletal (creatine kinase) or cardiac (troponin I) muscle into the serum is also an excellent probe of acute muscle
Genetic Models of Muscular Dystrophy
311
damage in the whole animal. Indeed, serum creatine kinase activity is usually the first measure applied for diagnosis in muscular dystrophy patients. As with patients, it is important to note, however, that these serum measures may be elevated by damage not caused by muscular dystrophy (e.g., muscle infection or cardiac infarction). A histological assessment of muscle fiber type is also essential. Such assays are necessary to understand ex vivo muscle physiology changes, as those measures can be changed by altered fiber type composition. Some therapies, for example overexpression of activated calcineurin, can change fiber type composition in ways that alter muscular dystrophy measures (Stupka et al., 2006). Other unwanted features, for example denervation of the muscle, can also be seen by stereotyped changes in fiber type patterning. As to molecular changes, almost all muscular dystrophies have immune components that respond to the induction of muscle damage (and sometimes cause it). As such, understanding the extent and behavior of T cells and macrophages/monocytes as well as the innate immune system at sites of injury is very important. Because these immune responses are localized to muscle, analysis of intramuscular expression of immune cells is critical, as overall T or B cell burden in the blood may not be significantly altered. This is typically done either by immunostaining of skeletal muscles with antibodies to CD4 (helper T cells), CD8 (cytotoxic T cells), CD68 (macrophages/monocytes), MAC (macrophages), and B220 (B cells) or by FACS analysis of cells from isolated muscles using the same antibodies. The presence of activated C5b-9 complement, which is also present in some human dystrophic muscles (Engel and Biesecker, 1982), is also important. In mice lacking particular glycan structures, an assessment of serum autoantibody to the deleted carbohydrate structures is also warranted. Two other molecular aspects of clear importance are gene and protein expressions for DAG complex members. Altered expression of DAG proteins such as utrophin and a-dystrobrevin is known to alter disease outcome (Table 17.2). Therefore, changed expression of these and other proteins (e. g., integrin a7, Galgt2, Bcl2) would have obvious consequences for disease severity. The expression of these molecules can be assessed by a combination of Western blotting of whole muscle SDS cell lysates, to assess changes in total protein level, and immunostaining, which is needed to demonstrate changed expression in heart or skeletal muscle cells directly. Changes in mRNA levels, assessed by qRT-PCR, can also be useful here. We typically perform mRNA expression profiling on cardiac and skeletal muscle samples from new genotypes of dystrophic mice to assess global changes in transcription (using Affymetrix arrays), though such studies are complicated by the complex cellular composition of dystrophic muscle tissue. Because dystroglycan is so important to mediating ECM–membrane interactions, we also routinely assess biochemical changes in ECM binding to a-dystroglycan and ECM binding to polyacrylamide-linked glycans. This is particularly important to do in mice where
312
Kumaran Chandrasekharan and Paul T. Martin
a-dystroglycan glycosylation is altered, as for example in Galgt2 transgenic mdx mice (Nguyen et al., 2002). One can use glycan-specific lectins to assess changed dystroglycan glycosylation in nonionic detergent extracts of whole muscle, but it is far better to purify dystroglycan using a combination of lectin binding and affinity chromatography (usually involving epitope tags) to assess binding of purified recombinant ECM components to purified a-dystroglycan glycoforms more directly (Yoon et al., 2009). While the protocols listed in Fig. 17.2 are too great in number to put in detail here, we have described almost all of these previously (Chandraskeharan and Martin, 2009; Haidet et al., 2008; Hoyte et al., 2002; Martin et al., 2009; Nguyen et al., 2002; Xia and Martin, 2002; Xia et al., 2002; Xu et al., 2007a, b, 2009; Yoon et al., 2009).
4. Summary A large number of mouse models now exist that are available for studying aspects of muscular dystrophy, including models of human disorders of glycosylation. A thorough understanding of phenotype requires a multifaceted experimental approach that should include measures most relevant to morbidity and mortality in the human condition. We have outlined here the approach we routinely take to understanding mouse models of muscular dystrophy. This approach focuses on cardiac and skeletal muscle dysfunction and pathology, which are common to most forms of the disease. Choice of methods for phenotype analysis, however, must be tailored to the issues most relevant to the particular human disorder and the mouse model being studied.
ACKNOWLEDGMENTS Our work has been funded by NIH grants from NIAMS (R01 AR050202 and R01 AR049722) and NINDS (U54 NS055958 and R21 NS055780), and a grant from Charley’s Fund.
REFERENCES Ackerl, R., et al. (2007). Conditional targeting of plectin in prenatal and adult mouse stratified epithelia causes keratinocyte fragility and lesional epidermal barrier defects. J. Cell Sci. 120, 2435–2443. Ackroyd, M. R., et al. (2009). Reduced expression of fukutin related protein in mice results in a model for fukutin related protein associated muscular dystrophies. Brain 132, 439–451.
Genetic Models of Muscular Dystrophy
313
Andra, K., et al. (1997). Targeted inactivation of plectin reveals essential function in maintaining the integrity of skin, muscle, and heart cytoarchitecture. Genes Dev. 11, 3143–3156. Angelini, C. (2004). Limb-girdle muscular dystrophies: Heterogeneity of clinical phenotypes and pathogenetic mechanisms. Acta Myol. 23, 130–136. Araishi, K., et al. (1999). Loss of the sarcoglycan complex and sarcospan leads to muscular dystrophy in beta-sarcoglycan-deficient mice. Hum. Mol. Genet. 8, 1589–1598. Araki, E., et al. (1997). Targeted disruption of exon 52 in the mouse dystrophin gene induced muscle degeneration similar to that observed in Duchenne muscular dystrophy. Biochem. Biophys. Res. Commun. 238, 492–497. Aravamudan, B., et al. (2003). Transgenic overexpression of caveolin-3 in the heart induces a cardiomyopathic phenotype. Hum. Mol. Genet. 12, 2777–2788. Arimura, T., et al. (2005). Mouse model carrying H222P-Lmna mutation develops muscular dystrophy and dilated cardiomyopathy similar to human striated muscle laminopathies. Hum. Mol. Genet. 14, 155–169. Bansal, D., et al. (2003). Defective membrane repair in dysferlin-deficient muscular dystrophy. Nature 423, 168–172. Barresi, R., and Campbell, K. P. (2006). Dystroglycan: From biosynthesis to pathogenesis of human disease. J. Cell Sci. 119, 199–207. Barton, E. R., et al. (2002). Muscle-specific expression of insulin-like growth factor I counters muscle decline in mdx mice. J. Cell Biol. 157, 137–148. Belyantseva, I. A., et al. (2009). Gamma-actin is required for cytoskeletal maintenance but not development. Proc. Natl. Acad. Sci. USA 106, 9703–9708. Benabdallah, B. F., et al. (2008). Inhibiting myostatin with follistatin improves the success of myoblast transplantation in dystrophic mice. Cell Transplant. 17, 337–350. Bentzinger, C. F., et al. (2005). Overexpression of mini-agrin in skeletal muscle increases muscle integrity and regenerative capacity in laminin-alpha2-deficient mice. FASEB J. 19, 934–942. Blake, D. J., et al. (2002). Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol. Rev. 82, 291–329. Bonaldo, P., et al. (1998). Collagen VI deficiency induces early onset myopathy in the mouse: An animal model for Bethlem myopathy. Hum. Mol. Genet. 7, 2135–2140. Bosnakovski, D., et al. (2009). Biphasic myopathic phenotype of mouse DUX, an ORF within conserved FSHD-related repeats. PLoS ONE 4, e7003. Bostick, B., et al. (2009). Cardiac expression of a mini-dystrophin that normalizes skeletal muscle force only partially restores heart function in aged Mdx mice. Mol. Ther. 17, 253–261. Bridges, L. R. (1986). The association of cardiac muscle necrosis and inflammation with the degenerative and persistent myopathy of MDX mice. J. Neurol. Sci. 72, 147–157. Bulfield, G., et al. (1984). X chromosome-linked muscular dystrophy (mdx) in the mouse. Proc. Natl. Acad. Sci. USA 81, 1189–1192. Burkin, D. J., et al. (2001). Enhanced expression of the alpha 7 beta 1 integrin reduces muscular dystrophy and restores viability in dystrophic mice. J. Cell Biol. 152, 1207–1218. Burkin, D. J., et al. (2005). Transgenic expression of {alpha}7{beta}1 integrin maintains muscle integrity, increases regenerative capacity, promotes hypertrophy, and reduces cardiomyopathy in dystrophic mice. Am. J. Pathol. 166, 253–263. Chakkalakal, J. V., et al. (2004). Stimulation of calcineurin signaling attenuates the dystrophic pathology in mdx mice. Hum. Mol. Genet. 13, 379–388. Chakkalakal, J. V., et al. (2006). Targeted inhibition of Ca2þ /calmodulin signaling exacerbates the dystrophic phenotype in mdx mouse muscle. Hum. Mol. Genet. 15, 1423–1435. Chamberlain, J. S., et al. (2007). Dystrophin-deficient mdx mice display a reduced life span and are susceptible to spontaneous rhabdomyosarcoma. FASEB J. 21, 2195–2204.
314
Kumaran Chandrasekharan and Paul T. Martin
Chandraskeharan, K., and Martin, P. T. (2009). Embryonic overexpression of Galgt2 inhibits skeletal muscle growth via activation of myostatin signaling. Muscle Nerve 39, 25–41. Chiba, A., et al. (1997). Structures of sialylated O-linked oligosaccharides of bovine peripheral nerve alpha-dystroglycan. The role of a novel O-mannosyl-type oligosaccharide in the binding of alpha-dystroglycan with laminin. J. Biol. Chem. 272, 2156–2162. Chu, V., et al. (2002). Electrocardiographic findings in mdx mice: A cardiac phenotype of Duchenne muscular dystrophy. Muscle Nerve 26, 513–519. Cohen, T. V., et al. (2008). The lamin B receptor under transcriptional control of C/EBPepsilon is required for morphological but not functional maturation of neutrophils. Hum. Mol. Genet. 17, 2921–2933. Cohn, R. D., et al. (2002). Disruption of DAG1 in differentiated skeletal muscle reveals a role for dystroglycan in muscle regeneration. Cell 110, 639–648. Cohn, R. D., et al. (2007). Myostatin does not regulate cardiac hypertrophy or fibrosis. Neuromuscul. Disord. 17, 290–296. Coral-Vazquez, R., et al. (1999). Disruption of the sarcoglycan-sarcospan complex in vascular smooth muscle: A novel mechanism for cardiomyopathy and muscular dystrophy. Cell 98, 465–474. Corrado, K., et al. (1996). Transgenic mdx mice expressing dystrophin with a deletion in the actin-binding domain display a "mild Becker" phenotype. J. Cell Biol. 134, 873–884. Cote, P. D., et al. (1999). Chimaeric mice deficient in dystroglycans develop muscular dystrophy and have disrupted myoneural synapses. Nat. Genet. 23, 338–342. Cox, G. A., et al. (1993). Overexpression of dystrophin in transgenic mdx mice eliminates dystrophic symptoms without toxicity. Nature 364, 725–729. Cox, G. A., et al. (1994). Dp71 can restore the dystrophin-associated glycoprotein complex in muscle but fails to prevent dystrophy. Nat. Genet. 8, 333–339. Crosbie, R. H., et al. (1998). mdx muscle pathology is independent of nNOS perturbation. Hum. Mol. Genet. 7, 823–829. D’Antona, G., et al. (2007). Structural and functional alterations of muscle fibres in the novel mouse model of facioscapulohumeral muscular dystrophy. J. Physiol. 584, 997–1009. De la Porte, S., et al. (1999). Characteristics of skeletal muscle in mdx mutant mice. Int. Rev. Cytol. 191, 99–148. Deconinck, A. E., et al. (1997a). Utrophin-dystrophin-deficient mice as a model for Duchenne muscular dystrophy. Cell 90, 717–727. Deconinck, N., et al. (1997b). Expression of truncated utrophin leads to major functional improvements in dystrophin-deficient muscles of mice. Nat. Med. 3, 1216–1221. Di Certo, M. G., et al. (2010). The artificial gene Jazz, a transcriptional regulator of Utrophin, corrects the dystrophic pathology in mdx mice. Hum. Mol. Genet. 19, 752–760. Dominov, J. A., et al. (2005). Muscle-specific BCL2 expression ameliorates muscle disease in laminin {alpha}2-deficient, but not in dystrophin-deficient, mice. Hum. Mol. Genet. 14, 1029–1040. Duclos, F., et al. (1998). Progressive muscular dystrophy in alpha-sarcoglycan-deficient mice. J. Cell Biol. 142, 1461–1471. Durbeej, M., et al. (2000). Disruption of the beta-sarcoglycan gene reveals pathogenetic complexity of limb-girdle muscular dystrophy type 2E. Mol. Cell 5, 141–151. Eisenberg, I., et al. (2001). The UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase gene is mutated in recessive hereditary inclusion body myopathy. Nat. Genet. 29, 83–87. Engel, A. G., and Biesecker, G. (1982). Complement activation in muscle fiber necrosis: Demonstration of the membrane attack complex of complement in necrotic fibers. Ann. Neurol. 12, 289–296.
Genetic Models of Muscular Dystrophy
315
Ervasti, J. M., and Campbell, K. P. (1991). Membrane organization of the dystrophinglycoprotein complex. Cell 66, 1121–1131. Ervasti, J. M., and Campbell, K. P. (1993). A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J. Cell Biol. 122, 809–823. Flintoff-Dye, N. L., et al. (2005). Role for the alpha7beta1 integrin in vascular development and integrity. Dev. Dyn. 234, 11–21. Gabellini, D., et al. (2006). Facioscapulohumeral muscular dystrophy in mice overexpressing FRG1. Nature 439, 973–977. Galbiati, F., et al. (2000). Transgenic overexpression of caveolin-3 in skeletal muscle fibers induces a Duchenne-like muscular dystrophy phenotype. Proc. Natl. Acad. Sci. USA 97, 9689–9694. Galbiati, F., et al. (2001). Caveolin-3 null mice show a loss of caveolae, changes in the microdomain distribution of the dystrophin-glycoprotein complex, and t-tubule abnormalities. J. Biol. Chem. 276, 21425–21433. Garry, D. J., et al. (2000). Myogenic stem cell function is impaired in mice lacking the forkhead/winged helix protein MNF. Proc. Natl. Acad. Sci. USA 97, 5416–5421. Garvey, S. M., et al. (2002). The muscular dystrophy with myositis (mdm) mouse mutation disrupts a skeletal muscle-specific domain of titin. Genomics 79, 146–149. Garvey, S. M., et al. (2006). Transgenic mice expressing the myotilin T57I mutation unite the pathology associated with LGMD1A and MFM. Hum. Mol. Genet. 15, 2348–2362. Gawlik, K., et al. (2004). Laminin alpha1 chain reduces muscular dystrophy in laminin alpha2 chain deficient mice. Hum. Mol. Genet. 13, 1775–1784. Gorecki, D. C., et al. (1994). Dystroglycan: Brain localisation and chromosome mapping in the mouse. Hum. Mol. Genet. 3, 1589–1597. Grady, R. M., et al. (1997a). Subtle neuromuscular defects in utrophin-deficient mice. J. Cell Biol. 136, 871–882. Grady, R. M., et al. (1997b). Skeletal and cardiac myopathies in mice lacking utrophin and dystrophin: A model for Duchenne muscular dystrophy. Cell 90, 729–738. Grady, R. M., et al. (1999). Role for alpha-dystrobrevin in the pathogenesis of dystrophindependent muscular dystrophies. Nat. Cell. Biol. 1, 215–220. Gramlich, M., et al. (2009). Stress-induced dilated cardiomyopathy in a knock-in mouse model mimicking human titin-based disease. J. Mol. Cell. Cardiol. 47, 352–358. Granzier, H. L., et al. (2009). Truncation of titin’s elastic PEVK region leads to cardiomyopathy with diastolic dysfunction. Circ. Res. 105, 557–564. Greenberg, D. S., et al. (1994). Exogenous Dp71 restores the levels of dystrophin associated proteins but does not alleviate muscle damage in mdx mice. Nat. Genet. 8, 340–344. Grewal, P. K., et al. (2001). Mutant glycosyltransferase and altered glycosylation of alphadystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Guo, C., et al. (2006). Absence of alpha 7 integrin in dystrophin-deficient mice causes a myopathy similar to Duchenne muscular dystrophy. Hum. Mol. Genet. 15, 989–998. Hack, A. A., et al. (1998). Gamma-sarcoglycan deficiency leads to muscle membrane defects and apoptosis independent of dystrophin. J. Cell Biol. 142, 1279–1287. Hack, A. A., et al. (1999). Muscle degeneration without mechanical injury in sarcoglycan deficiency. Proc. Natl. Acad. Sci. USA 96, 10723–10728. Hager, M., et al. (2005). Laminin {alpha}1 chain corrects male infertility caused by absence of laminin {alpha}2 chain. Am. J. Pathol. 167, 823–833. Hagiwara, Y., et al. (2000). Caveolin-3 deficiency causes muscle degeneration in mice. Hum. Mol. Genet. 9, 3047–3054. Haidet, A. M., et al. (2008). Long-term enhancement of skeletal muscle mass and strength by single gene administration of myostatin inhibitors. Proc. Natl. Acad. Sci. USA 105, 4318–4322.
316
Kumaran Chandrasekharan and Paul T. Martin
Handschin, C., et al. (2007). PGC-1alpha regulates the neuromuscular junction program and ameliorates Duchenne muscular dystrophy. Genes Dev. 21, 770–783. Hao, M., et al. (2008). Muscleblind-like 2 (Mbnl2) -deficient mice as a model for myotonic dystrophy. Dev. Dyn. 237, 403–410. Head, S. I., et al. (2004). EDL and soleus muscles of the C57BL6J/dy2j laminin-alpha 2deficient dystrophic mouse are not vulnerable to eccentric contractions. Exp. Physiol. 89, 531–539. Hino, H., et al. (2004). Myopathy phenotype in transgenic mice expressing mutated PABPN1 as a model of oculopharyngeal muscular dystrophy. Hum. Mol. Genet. 13, 181–190. Hoffman, E. P., et al. (1987). Dystrophin: The protein product of the Duchenne muscular dystrophy locus. Cell 51, 919–928. Hoyte, K., et al. (2002). Definition of pre- and postsynaptic forms of the CT carbohydrate antigen at the neuromuscular junction: Ubiquitous expression of the CT antigens and the CT GalNAc transferase in mouse tissues. Brain Res. Mol. Brain Res. 109, 146–160. Hoyte, K., et al. (2004). Transgenic overexpression of dystroglycan does not inhibit muscular dystrophy in mdx mice. Am. J. Pathol. 164, 711–718. Huebsch, K. A., et al. (2005). mdm muscular dystrophy: Interactions with calpain 3 and a novel functional role for titin’s N2A domain. Hum. Mol. Genet. 14, 2801–2811. Im, W. B., et al. (1996). Differential expression of dystrophin isoforms in strains of mdx mice with different mutations. Hum. Mol. Genet. 5, 1149–1153. Imamura, M., et al. (2005). Epsilon-sarcoglycan compensates for lack of alpha-sarcoglycan in a mouse model of limb-girdle muscular dystrophy. Hum. Mol. Genet. 14, 775–783. Iwata, Y., et al. (2009). Dominant-negative inhibition of Ca2þ influx via TRPV2 ameliorates muscular dystrophy in animal models. Hum. Mol. Genet. 18, 824–834. Janssen, P. M., et al. (2005). Utrophin deficiency worsens cardiac contractile dysfunction present in dystrophin-deficient mdx mice. Am. J. Physiol. Heart Circ. Physiol. 289, H2373–H2378. Jarad, G., and Miner, J. H. (2009). The Pax3-Cre transgene exhibits a rostrocaudal gradient of expression in the skeletal muscle lineage. Genesis 47, 1–6. Jayasinha, V., et al. (2003). Inhibition of dystroglycan cleavage causes muscular dystrophy in transgenic mice. Neuromuscul. Disord. 13, 365–375. Jimenez-Mallebrera, C., et al. (2005). Congenital muscular dystrophy: Molecular and cellular aspects. Cell Mol. Life Sci. 62, 809–823. Joya, J. E., et al. (2004). Muscle weakness in a mouse model of nemaline myopathy can be reversed with exercise and reveals a novel myofiber repair mechanism. Hum. Mol. Genet. 13, 2633–2645. Kanagawa, M., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631. Kobuke, K., et al. (2008). A common disease-associated missense mutation in alpha-sarcoglycan fails to cause muscular dystrophy in mice. Hum. Mol. Genet. 17, 1201–1213. Koenig, M., et al. (1987). Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50, 509–517. Koulen, P., et al. (1998). Differential distribution of beta-dystroglycan in rabbit and rat retina. J. Neurosci. Res. 51, 735–747. Kronqvist, P., et al. (2002). ADAM12 alleviates the skeletal muscle pathology in mdx dystrophic mice. Am. J. Pathol. 161, 1535–1540. Kuang, W., et al. (1998a). Disruption of the lama2 gene in embryonic stem cells: Laminin alpha 2 is necessary for sustenance of mature muscle cells. Exp. Cell Res. 241, 117–125.
Genetic Models of Muscular Dystrophy
317
Kuang, W., et al. (1998b). Merosin-deficient congenital muscular dystrophy. Partial genetic correction in two mouse models. J. Clin. Invest. 102, 844–852. Kudryashova, E., et al. (2009). Deficiency of the E3 ubiquitin ligase TRIM32 in mice leads to a myopathy with a neurogenic component. Hum. Mol. Genet. 18, 1353–1367. Kurahashi, H., et al. (2005). Basement membrane fragility underlies embryonic lethality in fukutin-null mice. Neurobiol. Dis. 19, 208–217. Lammerding, J., et al. (2004). Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J. Clin. Invest. 113, 370–378. Lange, S., et al. (2009). Obscurin determines the architecture of the longitudinal sarcoplasmic reticulum. J. Cell Sci. 122, 2640–2650. Lee, C. C., et al. (1993). Mdx transgenic mouse: Restoration of recombinant dystrophin to the dystrophic muscle. Hum. Gene Ther. 4, 273–281. Lei, K., et al. (2009). SUN1 and SUN2 play critical but partially redundant roles in anchoring nuclei in skeletal muscle cells in mice. Proc. Natl. Acad. Sci. USA 106, 10207–10212. Li, Z., et al. (1997). Desmin is essential for the tensile strength and integrity of myofibrils but not for myogenic commitment, differentiation, and fusion of skeletal muscle. J. Cell Biol. 139, 129–144. Li, Z. F., et al. (2005). Elimination of myostatin does not combat muscular dystrophy in dy mice but increases postnatal lethality. Am. J. Pathol. 166, 491–497. Li, X., et al. (2008). Differentiation and developmental origin of cerebellar granule neuron ectopia in protein O-mannose UDP-N-acetylglucosaminyl transferase 1 knockout mice. Neuroscience 152, 391–406. Love, D. R., et al. (1989). Molecular analysis of Duchenne and Becker muscular dystrophies. Br. Med. Bull. 45, 659–680. Malicdan, M. C., et al. (2007a). A Gne knockout mouse expressing human GNE D176V mutation develops features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. Hum. Mol. Genet. 16, 2669–2682. Malicdan, M. C., et al. (2007b). A Gne knockout mouse expressing human V572L mutation develops features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. Hum. Mol. Genet. 16, 115–128. Martin, P. T. (2003a). Dystroglycan glycosylation and its role in matrix binding in skeletal muscle. Glycobiology 13, 55R–66R. Martin, P. T. (2003b). Glycobiology of the neuromuscular junction. J. Neurocytol. 32, 915–929. Martin, P. T. (2006). Mechanisms of Disease: Congenital muscular dystrophies-glycosylation takes center stage. Nat. Clin. Pract. Neurol. 2, 222–230. Martin, P. T., et al. (1999). Distinct structures and functions of related pre- and postsynaptic carbohydrates at the mammalian neuromuscular junction. Mol. Cell Neurosci. 13, 105–118. Martin, P. T., et al. (2009). Overexpression of Galgt2 in skeletal muscle prevents injury resulting from eccentric contractions in both mdx and wild-type mice. Am. J. Physiol. Cell Physiol. 296, C476–C488. Matsumura, K., et al. (1992). Association of dystrophin-related protein with dystrophinassociated proteins in mdx mouse muscle. Nature 360, 588–591. Matsumura, K., et al. (1993). Restoration of dystrophin-associated proteins in skeletal muscle of mdx mice transgenic for dystrophin gene. FEBS Lett. 320, 276–280. Mayer, U., et al. (1997). Absence of integrin alpha 7 causes a novel form of muscular dystrophy. Nat. Genet. 17, 318–323. McCullagh, K. J., et al. (2008). Analysis of skeletal muscle function in the C57BL6/SV129 syncoilin knockout mouse. Mamm. Genome 19, 339–351. Megeney, L. A., et al. (1999). Severe cardiomyopathy in mice lacking dystrophin and MyoD. Proc. Natl. Acad. Sci. USA 96, 220–225.
318
Kumaran Chandrasekharan and Paul T. Martin
Meinen, S., et al. (2007). Linker molecules between laminins and dystroglycan ameliorate laminin-alpha2-deficient muscular dystrophy at all disease stages. J. Cell Biol. 176, 979–993. Melcon, G., et al. (2006). Loss of emerin at the nuclear envelope disrupts the Rb1/E2F and MyoD pathways during muscle regeneration. Hum. Mol. Genet. 15, 637–651. Michele, D. E., et al. (2002). Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Michele, D. E., et al. (2009). Dystroglycan matrix receptor function in cardiac myocytes is important for limiting activity-induced myocardial damage. Circ. Res. 105, 984–993. Michelson, A. M., et al. (1955). Dystrophia muscularis: A hereditary primary myopathy in the house mouse. Proc. Natl. Acad. Sci. USA 41, 1079–1084. Miller, G., et al. (2006). Over-expression of Microspan, a novel component of the sarcoplasmic reticulum, causes severe muscle pathology with triad abnormalities. J. Muscle Res. Cell Motil. 27, 545–558. Milner, D. J., and Kaufman, S. J. (2007). Alpha7beta1 integrin does not alleviate disease in a mouse model of limb girdle muscular dystrophy type 2F. Am. J. Pathol. 170, 609–619. Milner, D. J., et al. (1996). Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J. Cell Biol. 134, 1255–1270. Miyagoe, Y., et al. (1997). Laminin alpha2 chain-null mutant mice by targeted disruption of the Lama2 gene: A new model of merosin (laminin 2)-deficient congenital muscular dystrophy. FEBS Lett. 415, 33–39. Miyagoe-Suzuki, Y., et al. (2009). Reduced proliferative activity of primary POMGnT1null myoblasts in vitro. Mech. Dev. 126, 107–116. Montanaro, F., et al. (1995). Dystroglycan expression in the wild type and mdx mouse neural retina: Synaptic colocalization with dystrophin, dystrophin-related protein but not laminin. J. Neurosci. Res. 42, 528–538. Moore, S. A., et al. (2002). Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 418, 422–425. Mounkes, L. C., et al. (2005). Expression of an LMNA-N195K variant of A-type lamins results in cardiac conduction defects and death in mice. Hum. Mol. Genet. 14, 2167–2180. Moza, M., et al. (2007). Targeted deletion of the muscular dystrophy gene myotilin does not perturb muscle structure or function in mice. Mol. Cell Biol. 27, 244–252. Nakatani, M., et al. (2008). Transgenic expression of a myostatin inhibitor derived from follistatin increases skeletal muscle mass and ameliorates dystrophic pathology in mdx mice. FASEB J. 22, 477–487. Nguyen, H. H., et al. (2002). Overexpression of the cytotoxic T cell GalNAc transferase in skeletal muscle inhibits muscular dystrophy in mdx mice. Proc. Natl. Acad. Sci. USA 99, 5616–5621. Nikolova, V., et al. (2004). Defects in nuclear structure and function promote dilated cardiomyopathy in lamin A/C-deficient mice. J. Clin. Invest. 113, 357–369. Ohlendieck, K., et al. (1991). Dystrophin-related protein is localized to neuromuscular junctions of adult skeletal muscle. Neuron 7, 499–508. Ohsawa, Y., et al. (2004). Overexpression of P104L mutant caveolin-3 in mice develops hypertrophic cardiomyopathy with enhanced contractility in association with increased endothelial nitric oxide synthase activity. Hum. Mol. Genet. 13, 151–157. Ohsawa, Y., et al. (2006). Muscular atrophy of caveolin-3-deficient mice is rescued by myostatin inhibition. J. Clin. Invest. 116, 2924–2934. Ottenheijm, C. A., et al. (2009). Altered contractility of skeletal muscle in mice deficient in titin’s M-band region. J. Mol. Biol. 393, 10–26. Pacher, P., et al. (2008). Measurement of cardiac function using pressure-volume conductance catheter technique in mice and rats. Nat. Protoc. 3, 1422–1434.
Genetic Models of Muscular Dystrophy
319
Parsons, S. A., et al. (2006). Age-dependent effect of myostatin blockade on disease severity in a murine model of limb-girdle muscular dystrophy. Am. J. Pathol. 168, 1975–1985. Patton, B. L., et al. (1999). Distribution of ten laminin chains in dystrophic and regenerating muscles. Neuromuscul. Disord. 9, 423–433. Pendas, A. M., et al. (2002). Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinase-deficient mice. Nat. Genet. 31, 94–99. Peng, J., et al. (2005). Muscle atrophy in titin M-line deficient mice. J. Muscle Res. Cell Motil. 26, 381–388. Peng, J., et al. (2007). Cardiac hypertrophy and reduced contractility in hearts deficient in the titin kinase region. Circulation 115, 743–751. Peter, A. K., et al. (2007). Disrupted mechanical stability of the dystrophin-glycoprotein complex causes severe muscular dystrophy in sarcospan transgenic mice. J. Cell Sci. 120, 996–1008. Peter, A. K., et al. (2009). Myogenic Akt signaling upregulates the utrophin-glycoprotein complex and promotes sarcolemma stability in muscular dystrophy. Hum. Mol. Genet. 18, 318–327. Puckelwartz, M. J., et al. (2009). Disruption of nesprin-1 produces an Emery Dreifuss muscular dystrophy-like phenotype in mice. Hum. Mol. Genet. 18, 607–620. Puckelwartz, M. J., et al. (2010). Nesprin-1 mutations in human and murine cardiomyopathy. J. Mol. Cell Cardiol. 48, 600–608. Quijano-Roy, S., et al. (2008). De novo LMNA mutations cause a new form of congenital muscular dystrophy. Ann. Neurol. 64, 177–186. Quinlan, J. G., et al. (2004). Evolution of the mdx mouse cardiomyopathy: Physiological and morphological findings. Neuromuscul. Disord. 14, 491–496. Radke, M. H., et al. (2007). Targeted deletion of titin N2B region leads to diastolic dysfunction and cardiac atrophy. Proc. Natl. Acad. Sci. USA 104, 3444–3449. Rafael, J. A., et al. (1994). Prevention of dystrophic pathology in mdx mice by a truncated dystrophin isoform. Hum. Mol. Genet. 3, 1725–1733. Rafael, J. A., et al. (1998). Skeletal muscle-specific expression of a utrophin transgene rescues utrophin-dystrophin deficient mice. Nat. Genet. 19, 79–82. Raymackers, J. M., et al. (2003). Consequence of parvalbumin deficiency in the mdx mouse: Histological, biochemical and mechanical phenotype of a new double mutant. Neuromuscul. Disord. 13, 376–387. Rezniczek, G. A., et al. (2007). Plectin 1f scaffolding at the sarcolemma of dystrophic (mdx) muscle fibers through multiple interactions with beta-dystroglycan. J. Cell Biol. 176, 965–977. Richard, I., et al. (2000). Loss of calpain 3 proteolytic activity leads to muscular dystrophy and to apoptosis-associated IkappaBalpha/nuclear factor kappaB pathway perturbation in mice. J. Cell Biol. 151, 1583–1590. Ridgley, J. A., et al. (2009). The physiological effects of IGF-1 (class 1:Ea transgene) overexpression on exercise-induced damage and adaptation in dystrophic muscles of mdx mice. Pflugers Arch. 457, 1121–1132. Rooney, J. E., et al. (2006). Severe muscular dystrophy in mice that lack dystrophin and alpha7 integrin. J. Cell Sci. 119, 2185–2195. Sarig, R., et al. (1999). Targeted inactivation of Dp71, the major non-muscle product of the DMD gene: Differential activity of the Dp71 promoter during development. Hum. Mol. Genet. 8, 1–10. Sasaki, T., et al. (1998). Detection of O-mannosyl glycans in rabbit skeletal muscle alphadystroglycan. Biochim. Biophys. Acta 1425, 599–606. Satz, J. S., et al. (2008). Brain and eye malformations resembling Walker-Warburg syndrome are recapitulated in mice by dystroglycan deletion in the epiblast. J. Neurosci. 28, 10567–10575.
320
Kumaran Chandrasekharan and Paul T. Martin
Satz, J. S., et al. (2009). Visual impairment in the absence of dystroglycan. J. Neurosci. 29, 13136–13146. Shavlakadze, T., et al. (2004). Targeted expression of insulin-like growth factor-I reduces early myofiber necrosis in dystrophic mdx mice. Mol. Ther. 10, 829–843. Sher, R. B., et al. (2006). A rostrocaudal muscular dystrophy caused by a defect in choline kinase beta, the first enzyme in phosphatidylcholine biosynthesis. J. Biol. Chem. 281, 4938–4948. Shiao, T., et al. (2004). Defects in neuromuscular junction structure in dystrophic muscle are corrected by expression of a NOS transgene in dystrophin-deficient muscles, but not in muscles lacking alpha- and beta1-syntrophins. Hum. Mol. Genet. 13, 1873–1884. Shultz, L. D., et al. (2003). Mutations at the mouse ichthyosis locus are within the lamin B receptor gene: A single gene model for human Pelger–Huet anomaly. Hum. Mol. Genet. 12, 61–69. Sicinski, P., et al. (1989). The molecular basis of muscular dystrophy in the mdx mouse: A point mutation. Science 244, 1578–1580. Smalheiser, N. R., et al. (1998). Structural analysis of sequences O-linked to mannose reveals a novel Lewis X structure in cranin (dystroglycan) purified from sheep brain. J. Biol. Chem. 273, 23698–23703. Sonnemann, K. J., et al. (2006). Cytoplasmic gamma-actin is not required for skeletal muscle development but its absence leads to a progressive myopathy. Dev. Cell. 11, 387–397. Spencer, M. J., and Mellgren, R. L. (2002). Overexpression of a calpastatin transgene in mdx muscle reduces dystrophic pathology. Hum. Mol. Genet. 11, 2645–2655. Squire, S., et al. (2002). Prevention of pathology in mdx mice by expression of utrophin: Analysis using an inducible transgenic expression system. Hum. Mol. Genet. 11, 3333–3344. Stedman, H. H., et al. (1991). The mdx mouse diaphragm reproduces the degenerative changes of Duchenne muscular dystrophy. Nature 352, 536–539. Steen, M. S., et al. (2009). Amelioration of muscular dystrophy by transgenic expression of Niemann-Pick C1. Mol. Biol. Cell 20, 146–152. Stupka, N., et al. (2006). Activated calcineurin ameliorates contraction-induced injury to skeletal muscles of mdx dystrophic mice. J. Physiol. 575, 645–656. Sullivan, T., et al. (1999). Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147, 913–920. Sunada, Y., et al. (1994). Deficiency of merosin in dystrophic dy mice and genetic linkage of laminin M chain gene to dy locus. J. Biol. Chem. 269, 13729–13732. Sunada, Y., et al. (2001). Transgenic mice expressing mutant caveolin-3 show severe myopathy associated with increased nNOS activity. Hum. Mol. Genet. 10, 173–178. Tagawa, K., et al. (2000). Myopathy phenotype of transgenic mice expressing active sitemutated inactive p94 skeletal muscle-specific calpain, the gene product responsible for limb girdle muscular dystrophy type 2A. Hum. Mol. Genet. 9, 1393–1402. Takeda, S., et al. (2003). Fukutin is required for maintenance of muscle integrity, cortical histiogenesis and normal eye development. Hum. Mol. Genet. 12, 1449–1459. Tidball, J. G., and Wehling-Henricks, M. (2004). Expression of a NOS transgene in dystrophin-deficient muscle reduces muscle membrane damage without increasing the expression of membrane-associated cytoskeletal proteins. Mol Genet Metab. 82, 312–320. Tinsley, J. M., et al. (1996). Amelioration of the dystrophic phenotype of mdx mice using a truncated utrophin transgene. Nature 384, 349–353. Tinsley, J., et al. (1998). Expression of full-length utrophin prevents muscular dystrophy in mdx mice. Nat Med. 4, 1441–1444. Tome, F. M., et al. (1994). Congenital muscular dystrophy with merosin deficiency. C R Acad Sci III. 317, 351–357.
Genetic Models of Muscular Dystrophy
321
Vainzof, M., et al. (1996). The sarcoglycan complex in the six autosomal recessive limbgirdle muscular dystrophies. Hum. Mol. Genet. 5, 1963–1969. Vergnes, L., et al. (2004). Lamin B1 is required for mouse development and nuclear integrity. Proc. Natl. Acad. Sci. USA 101, 10428–10433. Wagner, K. R., et al. (2002). Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol. 52, 832–836. Wang, H., et al. (2006). Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect. Biochem Biophys Res Commun. 344, 17–24. Warner, L. E., et al. (2002). Expression of Dp260 in muscle tethers the actin cytoskeleton to the dystrophin-glycoprotein complex and partially prevents dystrophy. Hum. Mol. Genet. 11, 1095–1105. Wehling, M., et al. (2001). A nitric oxide synthase transgene ameliorates muscular dystrophy in mdx mice. J Cell Biol. 155, 123–131. Weinert, S., et al. (2006). M line-deficient titin causes cardiac lethality through impaired maturation of the sarcomere. J Cell Biol. 173, 559–570. Wells, D. J., et al. (1992). Human dystrophin expression corrects the myopathic phenotype in transgenic mdx mice. Hum. Mol. Genet. 1, 35–40. Willer, T., et al. (2004). Targeted disruption of the Walker-Warburg syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Williamson, R. A., et al. (1997). Dystroglycan is essential for early embryonic development: Disruption of Reichert’s membrane in Dag1-null mice. Hum. Mol. Genet. 6, 831–841. Willmann, R., et al. (2009). Mammalian animal models for Duchenne muscular dystrophy. Neuromuscul. Disord. 19, 241–249. Wu, G., et al. (2010). Differential expression of choline kinase isoforms in skeletal muscle explains the phenotypic variability in the rostrocaudal muscular dystrophy mouse. Biochim. Biophys. Acta 1801, 446–454. Xia, B., and Martin, P. T. (2002). Modulation of agrin binding and activity by the CT and related carbohydrate antigens. Mol. Cell Neurosci. 19, 539–551. Xia, B., et al. (2002). Overexpression of the CT GalNAc transferase in skeletal muscle alters myofiber growth, neuromuscular structure, and laminin expression. Dev. Biol. 242, 58–73. Xu, H., et al. (1994a). Defective muscle basement membrane and lack of M-laminin in the dystrophic dy/dy mouse. Proc. Natl. Acad. Sci. USA 91, 5572–5576. Xu, H., et al. (1994b). Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene. Nat. Genet. 8, 297–302. Xu, R., et al. (2007a). Postnatal overexpression of the CT GalNAc transferase inhibits muscular dystrophy in mdx mice without altering muscle growth or neuromuscular development: Evidence for a utrophin-independent mechanism. Neuromuscul. Disord. 17, 209–220. Xu, R., et al. (2007b). Overexpression of the cytotoxic T cell (CT) carbohydrate inhibits muscular dystrophy in the dyW mouse model of congenital muscular dystrophy 1A. Am. J. Pathol. 171, 181–199. Xu, R., et al. (2009). Overexpression of Galgt2 reduces dystrophic pathology in the skeletal muscles of alpha sarcoglycan-deficient mice. Am. J. Pathol. 175, 235–247. Yoon, J. H., et al. (2009). The synaptic CT carbohydrate modulates binding and expression of extracellular matrix proteins in skeletal muscle: Partial dependence on utrophin. Mol. Cell Neurosci. 41, 448–463. Yoshida-Moriguchi, T., et al. (2010). O-Mannosyl phosphorylation of alpha-dystroglycan is required for laminin binding. Science 327, 88–92. Yue, Y., et al. (2004). Full-length dystrophin expression in half of the heart cells ameliorates beta-isoproterenol-induced cardiomyopathy in mdx mice. Hum. Mol. Genet. 13, 1669–1675.
322
Kumaran Chandrasekharan and Paul T. Martin
Zhang, J., et al. (2008). Syncoilin is required for generating maximum isometric stress in skeletal muscle but dispensable for muscle cytoarchitecture. Am. J. Physiol. Cell Physiol. 294, C1175–C1182. Zhang, X., et al. (2009). SUN1/2 and Syne/Nesprin-1/2 complexes connect centrosome to the nucleus during neurogenesis and neuronal migration in mice. Neuron 64, 173–187. Zheng, M., et al. (2009). Cardiac-specific ablation of Cypher leads to a severe form of dilated cardiomyopathy with premature death. Hum. Mol. Genet. 18, 701–713. Zhou, Q., et al. (2001). Ablation of Cypher, a PDZ-LIM domain Z-line protein, causes a severe form of congenital myopathy. J. Cell Biol. 155, 605–612. Zhu, X., et al. (2001). Overexpression of gamma-sarcoglycan induces severe muscular dystrophy. Implications for the regulation of Sarcoglycan assembly. J. Biol. Chem. 276, 21785–21790.
C H A P T E R
E I G H T E E N
POMT1 is Essential for Protein O-Mannosylation in Mammals Mark Lommel,* Tobias Willer,† Jesu´s Cruces,‡ and Sabine Strahl* Contents 1. Overview 2. Experimental 2.1. Expression of Pomt1 in organs of adult mice 2.2. Expression of murine Pomt1 during embryo development 2.3. Generation and genotyping of knockout mice 2.4. Characterization of extracellular components in Pomt1/ embryos 3. Discussion/Conclusions Acknowledgments References
324 325 325 329 333 336 337 339 340
Abstract Over the past decade it has emerged that O-mannosyl glycans are not restricted to yeast and fungi but are also present in higher eukaryotes up to humans. In mammals, the protein O-mannosyltransferases POMT1 and POMT2 act as a heteromeric complex to initiate O-mannosylation in the endoplasmic reticulum. In humans, mutations in POMT1 and POMT2 result in hypoglycosylation of adystroglycan (a-DG) thereby abolishing its binding to extracellular matrix ligands such as laminin. As a consequence, POMT mutations cause a heterogeneous group of severe recessive congenital muscular dystrophies in humans. However, little is known about the function of O-mannosyl glycans in mammals apart from its crucial role for the ligand binding abilities of a-DG. In this chapter we discuss the methods used to analyze the expression of Pomt1 in adult mouse organs and during embryo development. Further, we describe the generation and immunohistochemical analysis of Pomt1 knockout mice.
* Institut fu¨r Pflanzenwissenschaften (HIP), Ruprecht-Karls-Universita¨t Heidelberg, Heidelberg, Germany Department of Molecular Physiology and Biophysics, University of Iowa College of Medicine, Iowa, USA Departamento de Bioquı´mica, Instituto de Investigaciones Biome´dicas CSIC-UAM, Universidad Auto´noma de Madrid, Madrid, Spain
{ {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79018-2
#
2010 Elsevier Inc. All rights reserved.
323
324
Mark Lommel et al.
1. Overview O-mannosylation is a conserved type of protein glycosylation in eukaryotes and some bacteria. A defect in the assembly of O-mannosyl glycans has fatal consequences in the affected organisms ranging from yeast to humans (Lehle et al., 2006). Biosynthesis of O-mannosyl glycans is initiated in the endoplasmic reticulum (ER) by the transfer of a single mannosyl moiety from dolichyl phosphate-activated mannose (Dol-P-Man) to the hydroxyl group of specific serine (Ser) or threonine (Thr) residues of membrane and secretory proteins (Willer et al., 2003). Further elongation of the glycan occurs in the Golgi apparatus by the successive transfer of additional sugar residues from nucleotide-activated sugar donors. The vast majority of O-mannosyl glycans in mammals represent variations of the tetrasaccharide Siaa2-3Galb14GlcNAcb1-2Mana1-Ser/Thr; these structures vary in length (e.g., asialo) and fucose content (Lommel and Strahl, 2009). Initiation of protein O-mannosylation in the ER is catalyzed by members of the PMT-family of dolichyl phosphate-D-mannose:protein O-mannosyltransferases that was first identified in yeast and is conserved throughout the animal kingdom with the exception of worms (Lommel and Strahl, 2009). Based on their phylogenetic relationship to Pmt1p, Pmt2p, or Pmt4p proteins of Saccharomyces cerevisiae, the PMT-family can be further subdivided into the PMT1, PMT2, and PMT4 subfamilies (Willer et al., 2003). In mammals, POMT1, a member of the PMT4 subfamily, and POMT2, a member of the PMT1 subfamily, have been identified ( Jurado et al., 1999; Willer et al., 2002) and O-mannosyltransferase activity has been confirmed (Manya et al., 2004). Among the few known substrates of POMT1 in metazoans the role of O-mannosyl glycans is best characterized for a-dystroglycan (a-DG). a-DG is an essential component of the dystrophin–glycoprotein complex (DGC) (Barresi and Campbell, 2006). Within the DGC, a-DG is noncovalently associated with b-dystrogycan (b-DG), a transmembrane protein that directly interacts with subsarcolemma proteins such as dystrophin. Besides b-DG, a-DG also associates with components of the extracellular matrix (ECM) such as laminin, providing a physical link between the intracellular actin cytoskeleton and extracellular basement membranes (Barresi and Campbell, 2006). It is assumed that the DGC confers structural integrity and stability to the sarcolemma during contractions (Petrof et al., 1993). Deficiencies within the DGC result in inherited forms of muscular dystrophy probably due to compromised membrane function induced by mechanical stress during contraction (Blake and Martin-Rendon, 2002; Deconinck and Dan, 2007; Han et al., 2009). Aside from its importance for sarcolemma stability, a general role of a-DG in the assembly of basement membranes has been proposed (Barresi and Campbell, 2006). This function is reflected in the mouse dystroglycan null mutant that is embryonic lethal at
Pomt1-knockout
325
day 6.5 of embryonic development due to defects in the formation of the Reichert’s membrane; one of the first basement membranes to from during rodent embryogenesis (Williamson et al., 1997). a-DG comprises two globular domains that are linked by a Ser/Thr-rich mucin-like stretch that is substantially O-mannosylated (Breloy et al., 2008; Chiba et al., 1997; Sasaki et al., 1998). Hypoglycosylated a-DG has a highly reduced ability to bind its ECM ligands such as laminin (Michele and Campbell, 2003; Michele et al., 2002). Thus, loss of O-mannosyl glycans reduces the association between DGC and the ECM. As a consequence mutations in either POMT1 or POMT2 lead to a heterogeneous group of autosomal recessive muscular dystrophies that are characterized by congenital muscular dystrophy with variable degrees of ocular abnormalities and brain malformations in humans, such as Walker–Warburg Syndrome (WWS) and Muscle Eye Brain disease (MEB) (Muntoni et al., 2004). Besides their crucial role for the ligand binding abilities of a-DG little is known about the function of O-mannosyl glycans in mammals. Here we describe the methods used to generate and analyze a mouse knockout model of the murine protein O-mannosyltransferase Pomt1.
2. Experimental 2.1. Expression of Pomt1 in organs of adult mice Information about the tissue-specific expression pattern of Pomt1 in mice can be obtained by analyzing the transcript levels in different tissues of adult animals or at different stages of embryonic development. These data help to determine the organs that presumably will be affected in the respective mutant thereby facilitating phenotypic analyses. Expression of Pomt1 transcripts was determined by Northern blot analysis and quantitative reverse transcription polymerase chain reaction (RT-qPCR). Apart from the quantification of transcript levels, expression of Pomt1 was also assessed by the determination of O-mannosyltransferase activity of microsomal membrane preparations of different tissues. 2.1.1. Northern blot analysis Since many organs can be dissected from adult mice and sufficient amounts of RNA can be extracted from these tissues, Northern blot analysis is a fast forward approach to determine Pomt1 transcription levels in mouse adult tissues. Additionally, premade Northern blots are available from several commercial sources. In order to determine the tissue-specific expression pattern of mouse Pomt1 a 559 bp DNA fragment spanning exon 19 and exon 20 was amplified by PCR from Pomt1 cDNA using primers mHOM.1
326
Mark Lommel et al.
(50 -GATGGAGAGGGTGCTCTTCCTC-30 ) and mHOM.2 (50 -CCTCCTGCCTTGGTGGTTCC-30 ). Two hundred nanograms of the resulting PCR product was used to generate an [a-32P]dCTP-labeled cDNA probe according to the method described by Feinberg and Vogelstein (1983) using the DecaLabelTM DNA labeling kit (Fermentas). Nonincorporated nucleotides were removed using mini Quick Spin DNA Columns (Roche). A mouse RNA Master blot (Clontech) containing spotted mRNA from 18 different mouse adult tissues was hybridized with this probe following manufacturer’s instructions. Subsequently, the blots were analyzed with a Cyclone Plus Storage Phosphor Scanner (PerkinElmer) and signals were quantified with OptiQuantTM software (PerkinElmer). Transcript levels were normalized against manufacturer-supplied mouse b-actin and mouse ubiquitin probes. 2.1.2. RT-qPCR Pomt1 transcript levels can be determined by RT-qPCR. Although more labor-intensive to set up than Northern analysis, this method provides a much higher sensitivity. Thus, transcript levels can also be quantified when RNA yields from the sample are low as encountered in microdissected material. Additionally, the high sensitivity of RT-qPCR allows the detection of relatively small differences in gene expression. A crucial step in setting up RT-qPCR experiments is the choice of primers to amplify the cDNA. The bioinformatics tools Primer Express 2.0 (Applied Biosystems) and Primer3 (http://frodo.wi.mit.edu/primer3/) were used to design primers specific for Pomt1 or hypoxanthine guanosine phosphoribosyl transferase (Hprt1) that span exon–exon borders to avoid and distinguish amplification of genomic DNA. Melting temperatures between 58 and 62 C were chosen with a limited GC content at the 30 end. The amplicon length varied between 160 and 170 bp. Specificity of the primers was confirmed by BLAST search of the respective mouse genome. To quantify Pomt1 expression in different mouse tissues, total RNA was extracted using Trizol reagent (Invitrogen) following manufacturer’s instructions. RNA concentrations were determined in an UV spectrophotometer at 260 nm and integrity of the RNA was confirmed by gel electrophoresis on a denaturating agarose gel. RNA samples were stored at 80 C. First strand cDNA was synthesized from 2 mg total RNA using the iScript cDNA synthesis kit (BioRad) and oligo-dT primers. PCR reactions were performed with the iCycler iQ real-time PCR detection system (BioRad) using iQ Sybergreen Supermix (BioRad) in a total volume of 20 ml. Each reaction contained cDNA derived from 20 ng RNA as a template and 100 nM of gene-specific primers. Pomt1 cDNA was amplified using the primer pair Pomt1fwd (5-CTACATCCCAGGACCAGTGCTCAGA-30 , Tm 61.0 C) and Pomt1rev (50 -AGCGGGACCAGGCATCCTCA-30 , Tm 61.4 C), resulting in a 160 bp
Pomt1-knockout
327
fragment (nucleotides þ1770 to þ1929; NCBI reference sequence NM_145145.1). In a second experiment, Hprt1, which was used as the endogenous reference gene, was amplified using primers Hprt1fwd (50 -AGCAGTACAGCCCCAAAATGGTTAA-30 , Tm 59.2 C) and Hprt1rev (50 -GACACAAACGTGATTCAAATCCCTG-30 , Tm 58.8 C) resulting in a 170 bp fragment (nucleotides þ598 to þ 767; NCBI reference sequence NM_013556.2). PCR reactions were carried out for 40 cycles at 94 C for 10 s, 60 C for 10 s, and 72 C for 15 s. Fluorescence in the reactions was monitored after each cycle. After each PCR run, a dissociation curve analysis of the PCR product was performed to rule out nonspecific amplification. Relative transcript levels were calculated from the Ct values obtained. The Ct value is defined as the number of PCR cycles that is needed for the fluorescence signal to exceed the detection threshold value which is fixed at 10 times the standard deviation of the fluorescence signal during the first 15 cycles. From the Ct values of Pomt1 and Hprt1, a DCt value was calculated (DCt ¼ CtPomt1 CtHprt1). From this DCt value, it is possible to obtain the normalized amount of Pomt1 expression that corresponds to 2 DCt (Livak and Schmittgen, 2001). 2.1.3. Protein O-mannosyltransferase activity Protein O-mannosyltransferase (POMT) activity was determined based on the amount of [3H]-mannose transferred from Dol-P-[3H]-Man to an a-DG– glutathione-S-transferase (GST) fusion protein basically following the method described by Endo and coworkers (Endo and Manya, 2006; Manya et al., 2004). 2.1.3.1. Preparation of the a-DG–GST fusion protein substrate The Ser/ Thr-rich mucin domain of a-DG (nucleotides þ1369 to þ1882 coding for amino acid 313–483; NCBI reference sequence NM_010017.2) was amplified by PCR on mouse brain cDNA using primers tw305 (50 -GGAAGATCTCACGCCACACCTACACCTG-30 , BglII restriction site in italics) and tw307 (50 -CCGGAATTCACACTGGTGGTAGTACGGATTCG-30 , EcoRI restriction site in italics). The resulting product was cut with BglII and EcoRI restriction endonucleases and ligated with the vector pGEX-2TK (GE Healthcare) cut with BamHI and EcoRI. The resulting plasmid contains an N-terminal fusion of the a-DG mucin domain with GST. The plasmid was transformed in OrigamiTM (DE 3) Escherichia coli cells (Novagen). Two hundred milliliters of cultures were grown to an OD600 of 0.5. Isopropyl-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM to induce expression at 37 C. After 4 h incubation, cells were harvested, washed once with ice-cold phosphatebuffered saline (PBS), and resuspended in 10 ml of PBS containing protease inhibitor (3 mg/ml pepstatin A, 1 mg/ml leupeptin, 1 mM benzamidine– HCl, and 1 mM PMSF). Cells were broken on ice with a Sonopuls GM70
328
Mark Lommel et al.
tip-type sonicator (Bandelin) for three times 3 min (40 pulses/min). After sonication, the supernatant was recovered by centrifugation at 40,000g for 1 h at 4 C, mixed with 1 ml of Glutathione SepharoseTM (GE Healthcare), and incubated at 4 C for 1 h on an end-over-end shaker. After three washes with 10 ml PBS containing protease inhibitors, protein was eluted with 5 ml PBS containing 10 mM reduced glutathione. The eluate was dialyzed over night at 4 C against 4.5 l of 20 mM Tris–HCl, pH 8.0 and 10 mM EDTA. Protein concentration was determined by bicinchonic acid (BCA) assay (BioRad) and the purity of the fusion protein was confirmed on SDS– polyacrylamide gels stained with Coomassie brilliant blue. The protein solution was concentrated to a final concentration of 2.5 mg/ml using a Vivaspin 6 concentrator (MWCO 10,000 Da; Satorius) and stored in aliquots at 20 C. Following this protocol, in average a total of 5 mg aDG–GST fusion protein was isolated. 2.1.3.2. Preparation of microsomal membrane fractions Mouse organs were minced with a scalpel and homogenized in 1 ml/g ice-cold membrane buffer (10 mM Tris–HCl, pH 7.4; 1 mM EDTA; 250 mM sucrose; and 1 mM dithiothreitol) containing protease inhibitors. For homogenization a Potter S homogenizer (30 strokes; B. Braun Biotech International) was used. After centrifugation at 900g for 10 min at 4 C, the supernatant was subjected to ultracentrifugation at 100,000g for 1 h at 4 C. The precipitate obtained was resuspended in buffer containing 20 mM Tris– HCl, pH 8.0 and 10 mM EDTA. Protein concentration was determined using the BCA assay. Protein concentration of this microsomal membrane fraction was adjusted to 16 mg/ml using the above buffer. 2.1.3.3. Assay for POMT activity O-Mannosyltransferase assays were carried out in 1.5 ml reaction tubes in a 20 ml reaction volume containing 20 mM Tris–HCl, pH 8.0, 100 nM Dol-P-[3H]-Man (125,000 dpm/pmol; American Radiolabeled Chemicals), 2 mM 2-mercaptoethanol, 10 mM EDTA, 0.5% n-octyl-b-D-thioglycoside (Sigma), and 10 mg a-DG–GST fusion protein. To set up the reactions, 250,000 dpm of Dol-P-[3H]-Man was dried to the bottom of each reaction tube under a stream of nitrogen. Four microliters of 5 reaction buffer (100 mM Tris–HCl, pH 8.0, 10 mM 2-mercaptoethanol, 50 mM EDTA, and 2.5% n-octyl-b-D-thioglycoside), 4 ml of a-DG–GST fusion protein, and 7 ml of water were added to the reactions and the incubated for 15 min at room temperature with occasional vortexing. After equilibration, reactions were started by the addition of 5 ml of the microsomal membrane fractions and vigorously vortexing for 20 s. After incubation for 1 h at 28 C in an eppendorf thermomixer at 500 rpm, reactions were terminated by adding 200 ml PBS/1% Triton X-100. Samples were clarified by centrifugation at 20,000g for 10 min. The supernatant was removed and mixed with 400 ml PBS/1% Triton X-100 containing 15 ml
Pomt1-knockout
329
glutathione sepharose and incubated for 45 min at 4 C with agitation. The sepharose matrix was washed three times with 1 ml of 20 mM Tris–HCl, pH 7.4 containing 0.5% Triton X-100. The sepharose matrix resuspended in 200 ml water, mixed with Ultima Gold LCS-cocktail (PerkinElmer), and radioactivity adsorbed was determined using a liquid scintillation counter. As shown in Fig. 18.1A, a broad spectrum of mouse adult tissues was analyzed by Northern blot. Variable levels of Pomt1 mRNA expression were detected in the different tissues with lowest levels in spleen and highest levels in testis. Expression profiling of Pomt1 mouse adult tissues by either Northern blot analysis or quantitative RT-qPCR produced similar results (Fig. 18.1A and B). With respect to the somatic tissues analyzed, POMT activity is in good correlation with the mRNA expression levels in these tissues. Highest enzymatic activity is observed in liver and kidney (Fig. 18.1C), where also high amounts of Pomt1 mRNA are present (Fig. 18.1A and C). However, only moderate transferase activity is found in testis tissue, which has the highest Pomt1 transcript levels. Similar to Pomt1 transcripts, Pomt2 mRNA levels are highly elevated in testis compared to somatic tissues (Lommel et al., 2008). This discrepancy between transcript levels and enzymatic activity might point to an alternate function of the POMT proteins in testis that is not related to mannosyltransferase activity (Lommel et al., 2008).
2.2. Expression of murine Pomt1 during embryo development In contrast to adult tissues, the amount of material available from mouse embryos is usually very small and expression of a gene may be restricted to a minority of cells. To overcome these problems, in situ hybridization in whole embryos is a suitable method to localize Pomt1 transcripts using antisense riboprobes highly specific for the Pomt1 mRNA. To confirm specific binding of the probe, hybridizations using a sense probe were performed in parallel. 1. Stage E6.5–E10.5 embryos from timed pregnancies were dissected under a dissection microscope in PBS and fixed overnight at 4 C in 4% paraformaldehyde/PBS. After fixation, embryos were dehydrated on ice in a graduated series of 25%, 50%, 75%, and 100% methanol in PBS for at least 10 min at each concentration. Embryos were stored in 100% methanol at 20 C. 2. For the preparation of sense and antisense riboprobes a 559 bp DNA fragment (nucleotides þ1991 to þ2550; NCBI reference sequence NM_145145.1) was amplified from Pomt1 cDNA using primers mHOM.1 (50 -GATGGAGAGGGTGCTCTTCCTC-30 ) and mHOM.2 (50 -CCTCCTGCCTTGGTGGTTCC-30 ). The resulting PCR product was cloned into pGEM-T easy to produce vectors containing the amplicon in both possible orientations with respect to the vector encoded T7-RNA-
330
Mark Lommel et al.
A
mRNA (relative intensity)
100%
80%
60%
40%
20%
Br
ai n Ey Li e ve Lu r K ng id Sk ne el y H e Sm tal ea r oo mu t th sc m le u Pa scl nc e Th reas Su T yro bm hy id ax mu .g s la n Sp d lee Te n st O is va P Ep ros ry id tat yd e im U us te ru s
0%
B
C POMT specific activity (pmol/g/h)
mRNA (relative expression)
100% 80% 60% 40% 20% 0%
r
n
i ra
B
L
le sc
y ne
e iv
id
K
S
lm
ta
le ke
u
is
T
t es
120 100 80 60 40 20 0 n
ai
Br
r
cle
y
ve
Li
ne
id
K
lm
us
is
st
Te
ta
le ke
S
Figure 18.1 Expression of mouse Pomt1 gene and O-mannosyltransferase activity in adult mouse tissues. (A) Northern blot analysis of various mouse tissues hybridized with a Pomt1 specific cDNA probe. Signals were quantified using a Cyclone Plus Storage Phosphor Scanner. Pomt1 signals were normalized to the hybridization signals of a b-actin and an ubiquitin control probe. mRNA levels in testis were arbitrarily set to 100%. (B) Quantitative RT-PCR analysis of Pomt1 transcript levels in different mouse tissues. Transcript levels were normalized to Hprt1. Expression level in testis was arbitrarily defined as 100%. (C) POMT activity in various mouse tissues based on the rate of mannose transfer from Dol-P-Man (125,000 dpm/pmol) to a GST–a-DG fusion protein.
Pomt1-knockout
331
polymerase promotor. The resulting plasmids were linearized with SpeI and purified with QIAquick spin columns (Qiagen). Digoxigenin-labeled riboprobes were in vitro transcribed from the T7 promoter using the SP6/ T7 Transcription Kit (Roche) and 3 mg of the linearized plasmids as a template. Finally, riboprobes were purified with Micro Bio-Spin columns (BioRad) following manufacturer’s instructions. 3. Pomt1 whole mount in situ hybridizations were carried out following the method described by Sporle et al. (1996). Unless noted otherwise all incubations were carried out in a 1 ml reaction volume. Embryos were rehydrated through a graduated series of methanol (75%, 50%, 25%) in PBS on ice for at least 10 min at each concentration. Subsequently, embryos were washed three times in PBS containing 0.1% Tween20 (PBT). Embryos were permeabilized for 10 min in RIPA-buffer (50 mM Tris–HCl, pH 8.0; 150 mM NaCl; 0.05% sodium dodecylsulphate; 1% Igepal CA630; 0.5 sodium desoxycholate; and 1 mM EDTA). After three washes in PBT, embryos were equilibrated in a 1:1 mixture of PBT and hybridization buffer (85 mM sodium citrate, pH 6.0; 750 mM NaCl; 50% deionized formamide; 0.1% Tween 20; and 50 mg/ml heparin) for 10 min and washed once in hybridization buffer. Embryos were prehybridized for 3 h at 65 C in hybridization buffer containing 100 mg/ml tRNA from bakers yeast (Sigma). Directly prior to hybridization, the riboprobe was denaturated for 3 min at 90 C and immediately cooled on ice. Embryos were hybridized with the riboprobes (250 ng/ml diluted in 250 ml hybridization buffer plus tRNA) overnight at 68 C. To remove unbound riboprobes, embryos were equilibrated in RNase solution (10 mM Tris–HCl, pH 7.5; 500 mM NaCl; and 0.1% Tween 20) and incubated in 250 ml RNase solution containing 100 mg/ ml RNaseA. Subsequently, embryos were washed for a total of 3 h at 65 C in 10 changes of 2 SSC (6 mM sodium citrate, pH 7.0 and 300 mM NaCl) containing 50% formamide and 0.1% Tween20. To detect digoxigenin-labeled riboprobes, embryos were equilibrated in a 1:1 mixture of 2 SSC containing 50% formamide and 0.1% Tween 20 and MABT buffer (100 mM maleic acid, pH 7.5; 150 mM NaCl; and 0.1% Tween20), followed by two 10 min washes in MABT. Embryos were incubated in blocking solution (10% blocking reagent (Roche) in MABT), and incubated overnight at 4 C with anti-digoxigenin antibodies coupled to alkaline phosphate (1:5000, Roche) diluted in blocking solution. To remove unbound antibodies, embryos were washed eight times with TBST (50 mM Tris–HCl, pH 7.4; 150 mM NaCl; and 0.1% Tween20) for a total of 8 h at room temperature. Phosphatase activity was visualized using the BM purple AP substrate (Roche) according to the manufacturer’s instructions. After staining, embryos were stored in PBS/ 4% paraformaldehyde at 4 C until visualization.
332
Mark Lommel et al.
A
B
C
E
F
H
I
E8.5 D
E9.0 G
E10.5
Figure 18.2 Expression of the Pomt1 gene in mouse embryos. Whole-mount in situ hybridizations (A, B, D, E, G, and H) and representative sections (C, F, and I) through the anterior neural tube at the level of the forelimb bud (indicated by a white line). At stage E8.5 (A–C) strongest expression of Pomt1 is observed along the neural tube (white arrow heads) and in the dorsal aspects of the neural fold (white arrows). Expression of Pomt1 is also found in the somites (black arrowheads). At E9.0 (D–F), strong expression is detected in the ventral part of the neural tube (white arrowheads), in the developing eye (white arrow), and in the gut endoderm (black arrowheads). At E10.5 (G–I), high levels of Pomt1 mRNA are observed in the somites (black arrowheads), limb buds (white arrowhead), and trigeminal ganglion (white arrow). Pronounced Pomt1 expression in the mantle layer of the dorsal neural tube (white arrowheads), as well as in the dermomyotome (black arrowheads), is verified in the E10.5 section (I). (Adapted from Willer et al., 2004, copyright (2004) National Academy of Sciences, USA.)
4. For further refinement stained embryos were sectioned after visualization. Embryos were cryoprotected overnight at 4 C in 1 ml PBS/30% sucrose, embedded in Cryoblock (Medite Medizintechnik), and cut (35 mm) at 25 C. Sections were mounted in Mowiol (Calbiochem) and cured overnight. In E8.5–E10.5 embryos, low Pomt1 expression can be ubiquitously detected throughout the embryo (Fig. 18.2). Higher levels of Pomt1 expression are observed in the neuronal tissues. Transcripts are found throughout the neural tube (Fig. 18.2A and C), the future midbrain region (Fig. 18.2B),
Pomt1-knockout
333
and the developing trigerminal ganglion (Fig. 18.2G and H). In addition, Pomt1 transcripts are predominantly detected in the somites (Fig. 18.2G–I), the limb-bud mesenchyme, and the developing eye (Fig. 18.2E). Sites of Pomt1 expression highly correlate with those in which disease manifestation is observed in WWS and MEB patients (Prados et al., 2007).
2.3. Generation and genotyping of knockout mice To generate Pomt1-deficient mice, the gene was disrupted by homologous recombination in embryonic stem cells. Pomt1 disruption was achieved by replacing exon 2, containing the start codon, with the neomycin phosphotransferase gene (Willer et al., 2004). For the cloning of the gene targeting vector, the plasmid pPNT (Tybulewicz et al., 1991) was used. A 4.5-kb XhoI fragment (containing intron 2 to intron 9) was isolated from a 15-kb region of the mouse Pomt1 gene (intron 2 to exon 20) of a 129/SvJ mouse genomic library (Mobi-Tec) and cloned in the XhoI site of pPNT as the long arm. A 2.3kb KpnI–XbaI fragment, from the intragenic sequence 50 upstream of Pomt1 intron 1, was amplified by PCR from 129/SvJ mouse genomic DNA using primer a (50 -GGGGTACCAGAATACCTTAGGGAGCG-30 ; KpnI-site in italics) and primer b (50 -GCTCTAGATTTGCTTGTGCCCCGAGC-30 ; XbaI-site in italics). This fragment was cloned as short arm into the KpnI– XbaI sites of pPTN between the neomycin phosphotransferase and herpes simplex virus thymidine kinase cassettes in an opposite orientation (Fig. 18.3A). The resulting targeting construct was linearized and introduced into E14.1 embryonic stem cells using standard methods (Nagy et al., 2003). ES cells were selected with neomycin and homologous recombinants were identified by PCR using primer 1 (50 -ACATGCTTTCTCAGGCTGTGTC-30 ) and primer 2 (50 -TCTCAGTATTGTTTTGCCAAGTTC-30 ; Fig. 18.3A and B) and verified by genomic Southern blot (Fig. 18.3A and C; Willer et al., 2004). Two independent embryonic stem cell clones were injected into BALB/c blastocysts to generate chimeric mice. Germline transmitting chimeras were backcrossed to BALB/c mice. Progeny from these crosses was PCR genotyped using the following primers (Fig. 18.3A): A forward primer, primer 3 (50 -GGGAGCCACTCTACGGGACT-30 ) that is derived from exon 1 to amplify both the wild-type and the targeted loci. A reverse primer, primer 4 (50 -GGCGTCACGATGAATTTACAG-30 ) was designed from intron 1 to specifically amplify the wild-type allele. A second reverse primer, primer 5 (50 -CAGCTCATTCCTCCCACTCAT-30 ) was derived from the neomycin phosphotransferase gene to specifically detect the targeted locus. Heterozygous male and female animals were identified. They did not show any overt phenotype and were fertile. Heterozygous animals were intercrossed and the offspring was genotyped by PCR as described above. No viable Pomt1/ mice were identified among 81 mice (Table 18.1), indicating embryonic lethality. To assess
334
Mark Lommel et al.
A
Stul
Stul E1 E2
E3 E4
E5
1 kb
E6 E7 E8E9 Pomt1 wt allele
3
1
Probe
4 ATG
Stul E1
Stul
TK
E3 E4
E5
E6 E7 E8E9
Targeting construct
NEO 2 5
Kpnl
Xbal
Xhol
Xhol 4.5 kb Homologous recombination
2.3 kb Stul
Stul E1
Stul E3E4
E5
E6 E7 E8 E9
NEO
Mutant allele 8172 bp wt 5521 bp wt
B
ES1
ES2
C
+/+
+/-
D +/+
8.2 kb 2.5 kb 5.5 kb
Southern blot Stul digest
+/-
-/-
563 bp 428 bp
Figure 18.3 Targeted disruption of the Pomt1 gene. (A) Schematic representation of the gene targeting strategy. The genomic locus, the targeting construct, and the resulting Pomt1 mutant allele after homologous recombination are shown. The short (2.3 kb) and long (4.5 kb) arms for homologous recombination are represented. Selectable markers: TK, herpes simplex virus thymidine kinase gene; NEO, neomycin phosphotransferase gene. Arrowheads indicate PCR primers used for screening of ES cells and genotyping of progeny from chimera and heterozygous matings. (B) Primers 1 and 2 were used to identify two targeted ES cell clones after homologous recombination. (C) Southern blot analysis of genomic DNA from mouse tail biopsies. The endogenous and targeted Pomt1 alleles are represented as 8.2 and 5.5 kb fragments after StuI-restriction endonuclease digest. (D) PCR genotyping of embryos from timed matings. Primers 3 and 4 identify the endogenous allele, whereas primers 3 and 5 identify the targeted allele. (Adapted from Willer et al., 2004, copyright (2004) National Academy of Sciences, USA.)
the consequences of the Pomt1 mutation for embryonic development, embryos of different developmental stages were analyzed. Timed matings were performed with heterozygous Pomt1þ/ mice. Every morning female breeders were checked for copulation plugs and when tested positive they were considered day 0.5 (E0.5) of gestation. For the analysis of pre- and postimplantation embryos pregnant female mice were sacrificed at different times of gestation. Blastocysts were flushed from dissected uteri of plugged females at day E3.5 and later stage embryos
335
Pomt1-knockout
Table 18.1 Genotypes of progeny from different Pomt1þ/ heterozygous intercrosses No. of progeny with genotype Stage
þ/þ
þ/
/
Total no. of progeny
Adult mouse Embryo E10.5 Embryo E9.5 Embryo E8.5 Embryo E7.5 Blastocyst E3.5
25 15 8 9 7 23
56 23 32 24 12 69
0 0 8 11 7 17
81 38 48 44 26 109
E7.5 +/+
E8.5 Pomt1 -/#1
+/+
#2
Figure 18.4 Targeted disruption of Pomt1 results in embryo lethality. Morphology of wild-type and Pomt1/ embryos. Representative littermates from an E8.5 heterozygous intercross are shown. Pomt1-deficient embryos show severe growth retardation presumably due to a block in embryo development E6-7. (Partially adapted from Willer et al., 2004, copyright (2004) National Academy of Sciences, USA)
were dissected free of maternal tissues, photographed, and placed in TBS. For the preparation of genomic DNA, embryos or their yolk sacs were denaturated for 10 min at 95 C. After denaturation, proteinase K was added to a final concentration of 1.5 mg/ml. Embryos were lysed for 4 h at 56 C. Proteinase K was heat inactivated at 95 C for 15 min. Five microliters of these lysates were used for PCR genotyping as described above. At days E3.5, E7.5, E8.5, and E9.5 homozygous mutant embryos were identified in the expected Mendelian ratio of 1:2:1 (Table 18.1). While homozygous mutant blastocysts (E3.5) were indistinguishable from wildtype and heterozygous littermates, Pomt1/ embryos of the latter stages displayed a variable degree of morphological abnormalities (Fig. 18.4).
336
Mark Lommel et al.
Mutant embryos were significantly smaller and became increasingly disorganized with age. Finally, at E10.5 no homozygous Pomt1/ embryos could be recovered.
2.4. Characterization of extracellular components in Pomt1/ embryos a-DG is a known protein substrate of POMT1 and O-mannosylation of aDG is a critical determinant for its ability to bind ECM ligands such as laminin (Michele and Campbell, 2003; Michele et al., 2002). In rodent embryos, a-DG and its ligand laminin are components of the Reichert’s membrane, one of the first basement membranes to develop during embryo development (Salamat et al., 1995; Williamson et al., 1997). In cross-sections, O-mannosylation of a-DG can be monitored by the use of two monoclonal antibodies that recognize a so far undefined, O-mannosidically linked a-DG glycoepitope. In order to assess the effect of the Pomt1 null mutation on a-DG O-mannosylation and on Reichert’s membrane formation, cross-sections of Pomt1/ embryos at day E7.5 were analyzed with a panel of a-DG glycoepitope specific and ECM marker antibodies. 1. Pregnant females from wild-type or heterozygous crosses were sacrificed at E6.5 or E7.5. Deciduae were fixed overnight in 4% paraformaldehyde in PBS at 4 C, dehydrated in a graduated series of ethanol, cleared in xylene, and embedded in paraffin using standard protocols. Single 7 mm sections were collected on glass slides. 2. One section of each embryo derived from heterozygous crosses was used for genotyping. Embryonic tissue was dissected from surrounding maternal tissue using a Zeiss Axiovert microscope equipped with a P.A.L.M. microbeam unit (P.A.L.M. Microlaser Technologies). Microdissected material was lysed for 3 h at 55 C in 50 ml catapult buffer containing 0.5 M EDTA, pH 8.0; 1 M Tris, pH 8.0; 0.5% Igepal CA-630; and 0.2 mg/ml Proteinase K. The lysate was heat inactivated for 15 min at 95 C and 5 ml were used as template for PCR genotyping (see above). 3. Prior to staining, paraffin was removed with xylene and sections were rehydrated in a graduated series of ethanol. Sections were equilibrated in PBS and blocked with mouse blocking solution in PBS (M.O.M. Basic Kit; Vector Laboratories). Primary rabbit anti-laminin (Sigma; 1:200), goat anti-a-DG (GT20ADG, 1:15, kindly provided by Kevin Campbell) and rabbit anti-b-DG (AP83, 1:100, kindly provided by Kevin Campbell) sera, and rat monoclonal entactin (ELM1; Abcam; 1:200), and monoclonal a-DG antibodies (VIA6-1, 1:100 and IIH6, 1:200, kindly provided by Kevin Campbell) were applied in mouse blocking solution/
Pomt1-knockout
337
PBS for 1 h at room temperature. After three 5-min washes with PBS, sections were treated with anti-rabbit-, anti-rat-Alexa488 (Invitrogen, 1:1000), anti-goat-Cy3 ( Jackson ImmunoResearch, 1:100), and antimouse-biotin (Vector Laboratories, 1:250) in mouse blocking solution/ PBS for 30 min at room temperature. Following three 5-min washes with PBS, sections were incubated with streptavidin-Cy3 conjugates ( Jackson ImmunoResearch, 1:1000) for 15 min to detect biotinylated secondary antibodies. 4. After three short washes with PBS, sections were counterstained with hematoxylin using a standard protocol and mounted with ProLong Antifade kit (Invitrogen) to prevent bleaching of the fluorophores. Stained sections were viewed with an epifluorescence Zeiss Axioskop microscope. As shown in Fig. 18.5, IIH6-positive functionally O-mannosylated a-DG is mainly detected in the Reichert’s membrane and in the maternal decidual cells in wild-type and heterozygous embryos (Fig. 18.5A(b) and B (b)). In contrast, no IIH6 and VIA-4 stainings were detected in the Reichert’s membrane from Pomt1/ embryos (Fig. 18.5A(f ) and B(f )). Detection of the protein core of a- and b-DG revealed a reduction of both proteins in the Reichert’s membrane of Pomt1 null mutants (Fig. 18.5A(c, g) and B(c, g)). Laminin as well as the laminin binding protein nidogen/ entactin was readily detected in the Reichert’s membrane of wild-type embryos (Fig. 18.5A(d) and B(d)). In Pomt1 null embryos, however, levels of both proteins were significantly reduced and distribution became discontinuous and patchy (Fig. 18.5A(h) and B(h)), indicating an impaired integrity of the basement membrane.
3. Discussion/Conclusions Defects in dystroglycan posttranslational processing result in a broad spectrum of severe muscular dystrophies (Hewitt, 2009). Collectively, these dystrophies are classified as dystroglycanopathies. Thus far, mutations in six genes are shown to result in a-DG-related disease: protein O-mannosyltransferase 1 (POMT1) (Beltran-Valero de Bernabe et al., 2002), protein O-mannosyltransferase 2 (POMT2) (van Reeuwijk et al., 2005), protein O-mannose b-1,2-N-acetylglucosaminyltransferase (POMGnT1) (Yoshida et al., 2001), fukutin-related protein (FKRP) (Brockington et al., 2001), fukutin (FKTN) (Kobayashi et al., 2001), and an acetylglucosaminyltransferase-like protein (LARGE ) (Longman et al., 2003). All proteins have either known or hypothetical roles as glycosyltransferases, as their defects reduce glycosylation of a-DG. Loss of proper a-DG glycosylation is followed by reduced binding of ECM receptor proteins, since the ligand binding
338
Mark Lommel et al.
A
a-DG VIA4-1
Hematoxylin a
b Rm
b-DG AP83 Rm
c
Laminin d Rm
+/+ dc eee e
f
dc
g
h
−/− Rm
a-DG IIH6
Hematoxylin
B a
Rm
a-DG GT20ADG
Entactin
b
c
d
Rm
Rm
Rm
g
h
+/+ dc
e
f
Rm
−/− dc
Figure 18.5 Immunohistological analysis of ECM components in Pomt1/ embryos. Sagittal sections of E7.5 and E6.5 embryos were stained with hematoxylin and analyzed with a-DG antibodies directed against an O-mannosidically linked glycoepitope (VIA4-1, IIH6) or the protein core (GT20ADG) and anti-b-DG (AP83), anti-laminin, and anti-entactin, as indicated. Wild-type (A and B a–d) and Pomt1/ mutants (A and B e–h) are shown. In Pomt1/ embryos, the glycoepitope is missing in embryo-derived structures, but is still detected in the decidual cells. Discontinuous (arrow) and patchy (arrowhead) laminin and entactin stainings in mutant embryos indicate a defect in Reichert’s membrane formation. Rm, Reichert´s membrane; eee, extraembryonic ectoderm; dc, maternal decidual cells. (Adapted from Willer et al., 2004, copyright (2004) National Academy of Sciences, USA.)
is mediated through the a-DG sugar moiety (Michele et al., 2002). It is hypothesized that all six key players are part of a glycosylation pathway specific for a-DG, since no other protein has been identified that is modified by all six candidate glycosyltransferases. The generation of proper dystroglycanopathy disease mouse models has been hampered by early embryonic lethality in null mouse models as demonstrated for Pomt1 (Willer et al., 2004) and Fukutin (Kurahashi et al., 2005) emphasizing the essential role of
Pomt1-knockout
339
proper a-DG functional glycosylation during development. This indicates that complete loss of function models may not adequately mimic the situation in a patient and that they may not be the most relevant disease models. In agreement, depending on the genetic lesion, most patients with dystroglycanopathies retain various levels of residual activity in the affected proteins, which explains the broad range of clinical severity for each dystroglycanopathy gene (Lommel et al., 2010). As an alternative route, mutant mouse models were generated with reduced gene function that better resemble the actual situation in dystroglycanopathy patients. Viable dystroglycanopathy mouse models could be generated for Large (Largemyd, spontaneous null mutant) (Grewal et al., 2001), Pomgnt1 (gene-trapped knockout, (Liu et al., 2006); targeted knockout (Miyagoe-Suzuki et al., 2009)), Fukutin (retrotransposon knock-in) (Kanagawa et al., 2009), and Fkrp (knock-in) (Ackroyd et al., 2009). As to why some null mutations are compatible with life and some are not is not fully understood, but it is possible that some enzymes which act early in the biosynthesis of O-mannosyl glycans (e.g., POMT1) are functionally more critical and/or loss of some a-DG modifying glycosyltransferases can be partially compensated by other redundant enzymes. Thus far, analysis of the various dystroglycanopathy mouse models has proven as invaluable tool in the study of muscular dystrophy and neuronal migration defects in the brain. Dystroglycan glycosylation defects are only poorly understood. Currently, only half of the dystroglycanopathy patients can be explained with the known six candidate genes (Mercuri et al., 2009), indicating that a majority of individuals with dystroglycan-glycosylation defects harbor mutations in unidentified new genes. Elucidation of new candidate genes along with new conditional and partial loss of function mouse models will allow to avoid early embryonic lethality, study dystroglycan modifier functions in various tissues, and better understand dystroglycan posttranslational processing. Generation of models for all the known dystroglycanopathy genes will yield important clues to individual contributions to pathology and the cross-compatibility of individual treatment strategies.
ACKNOWLEDGMENTS We thank all present and past members of the Cruces and Strahl labs and all our collaborators who contributed to the results reported in this chapter, especially B. Prados, I. RennerMu¨ller, and G. Przemeck. We thank W. Tanner and E. Wolf for generous support and many very helpful discussions. We are grateful to Kevin Campbell for generously providing antibodies. The work was supported by grants from the Fondo de Investigaciones Sanitarias (Grands PI06/0378 and PI09/00343), and the Deutsche Forschungsgemeinschaft (Grants SFB521 and STR 443). S. Strahl is a member of CellNetworks—Cluster of Excellence (EXC81).
340
Mark Lommel et al.
REFERENCES Ackroyd, M. R., Skordis, L., Kaluarachchi, M., Godwin, J., Prior, S., Fidanboylu, M., Piercy, R. J., Muntoni, F., and Brown, S. C. (2009). Reduced expression of fukutin related protein in mice results in a model for fukutin related protein associated muscular dystrophies. Brain 132, 439–451. Barresi, R., and Campbell, K. P. (2006). Dystroglycan: From biosynthesis to pathogenesis of human disease. J. Cell Sci. 119, 199–207. Beltran-Valero de Bernabe, D., Currier, S., Steinbrecher, A., Celli, J., van Beusekom, E., van der Zwaag, B., Kayserili, H., Merlini, L., Chitayat, D., Dobyns, W. B., Cormand, B., Lehesjoki, A. E., et al. (2002). Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker–Warburg syndrome. Am. J. Hum. Genet. 71, 1033–1043. Blake, D. J., and Martin-Rendon, E. (2002). Intermediate filaments and the function of the dystrophin–protein complex. Trends Cardiovasc. Med. 12, 224–228. Breloy, I., Schwientek, T., Gries, B., Razawi, H., Macht, M., Albers, C., and Hanisch, F. G. (2008). Initiation of mammalian O-mannosylation in vivo is independent of a consensus sequence and controlled by peptide regions within and upstream of the alpha-dystroglycan mucin domain. J. Biol. Chem. 283, 18832–18840. Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E., Voit, T., Sewry, C. A., et al. (2001). Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan. Am. J. Hum. Genet. 69, 1198–1209. Chiba, A., Matsumura, K., Yamada, H., Inazu, T., Shimizu, T., Kusunoki, S., Kanazawa, I., Kobata, A., and Endo, T. (1997). Structures of sialylated O-linked oligosaccharides of bovine peripheral nerve alpha-dystroglycan. The role of a novel O-mannosyl-type oligosaccharide in the binding of alpha-dystroglycan with laminin. J. Biol. Chem. 272, 2156–2162. Deconinck, N., and Dan, B. (2007). Pathophysiology of duchenne muscular dystrophy: Current hypotheses. Pediatr. Neurol. 36, 1–7. Endo, T., and Manya, H. (2006). O-Mannosylation in mammalian cells. Methods Mol. Biol. 347, 43–56. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6–13. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of alpha-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Han, R., Kanagawa, M., Yoshida-Moriguchi, T., Rader, E. P., Ng, R. A., Michele, D. E., Muirhead, D. E., Kunz, S., Moore, S. A., Iannaccone, S. T., Miyake, K., McNeil, P. L., et al. (2009). Basal lamina strengthens cell membrane integrity via the laminin G domainbinding motif of alpha-dystroglycan. Proc. Natl. Acad. Sci. USA 106, 12573–12579. Hewitt, J. E. (2009). Abnormal glycosylation of dystroglycan in human genetic disease. Biochim. Biophys. Acta 1792, 853–861. Jurado, L. A., Coloma, A., and Cruces, J. (1999). Identification of a human homolog of the Drosophila rotated abdomen gene (POMT1) encoding a putative protein O-mannosyltransferase, and assignment to human chromosome 9q34.1. Genomics 58, 171–180. Kanagawa, M., Nishimoto, A., Chiyonobu, T., Takeda, S., Miyagoe-Suzuki, Y., Wang, F., Fujikake, N., Taniguchi, M., Lu, Z., Tachikawa, M., Nagai, Y., Tashiro, F., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631.
Pomt1-knockout
341
Kobayashi, K., Sasaki, J., Kondo-Iida, E., Fukuda, Y., Kinoshita, M., Sunada, Y., Nakamura, Y., and Toda, T. (2001). Structural organization, complete genomic sequences and mutational analyses of the Fukuyama-type congenital muscular dystrophy gene, fukutin. FEBS Lett. 489, 192–196. Kurahashi, H., Taniguchi, M., Meno, C., Taniguchi, Y., Takeda, S., Horie, M., Otani, H., and Toda, T. (2005). Basement membrane fragility underlies embryonic lethality in fukutin-null mice. Neurobiol. Dis. 19, 208–217. Lehle, L., Strahl, S., and Tanner, W. (2006). Protein glycosylation, conserved from yeast to man: A model organism helps elucidate congenital human diseases. Angew. Chem. Int. Ed. Engl. 45, 6802–6818. Liu, J., Ball, S. L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Lommel, M., and Strahl, S. (2009). Protein O-mannosylation: Conserved from bacteria to humans. Glycobiology 19, 816–828. Lommel, M., Willer, T., and Strahl, S. (2008). POMT2, a key enzyme in Walker–Warburg syndrome: Somatic sPOMT2, but not testis-specific tPOMT2, is crucial for mannosyltransferase activity in vivo. Glycobiology 18, 615–625. Lommel, M., Cirak, S., Willer, T., Hermann, R., Uyanik, G., van Bokhoven, H., Korner, C., Voit, T., Baric, I., Hehr, U., and Strahl, S. (2010). Correlation of enzyme activity and clinical phenotype in POMT1-associated dystroglycanopathies. Neurology 74, 157–164. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., et al. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Manya, H., Chiba, A., Yoshida, A., Wang, X., Chiba, Y., Jigami, Y., Margolis, R. U., and Endo, T. (2004). Demonstration of mammalian protein O-mannosyltransferase activity: Coexpression of POMT1 and POMT2 required for enzymatic activity. Proc. Natl. Acad. Sci. USA 101, 500–505. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G. P., D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A., Boffi, P., Cassandrini, D., et al. (2009). Congenital muscular dystrophies with defective glycosylation of dystroglycan: A population study. Neurology 72, 1802–1809. Michele, D. E., and Campbell, K. P. (2003). Dystrophin-glycoprotein complex: Posttranslational processing and dystroglycan function. J. Biol. Chem. 278, 15457–15460. Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., et al. (2002). Posttranslational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009). Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Muntoni, F., Brockington, M., Torelli, S., and Brown, S. C. (2004). Defective glycosylation in congenital muscular dystrophies. Curr. Opin. Neurol. 17, 205–209. Nagy, A., Gertsenstein, M., Vintersten, K., and Behringer, R. (2003). Manipulating the Mouse Embryo. Cold Spring Habor aboratory Press, Cold Spring Habor, New York.
342
Mark Lommel et al.
Petrof, B. J., Shrager, J. B., Stedman, H. H., Kelly, A. M., and Sweeney, H. L. (1993). Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc. Natl. Acad. Sci. USA 90, 3710–3714. Prados, B., Pena, A., Cotarelo, R. P., Valero, M. C., and Cruces, J. (2007). Expression of the murine Pomt1 gene in both the developing brain and adult muscle tissues and its relationship with clinical aspects of Walker-Warburg syndrome. Am. J. Pathol. 170, 1659–1668. Salamat, M., Miosge, N., and Herken, R. (1995). Development of Reichert’s membrane in the early mouse embryo. Anat. Embryol. (Berl). 192, 275–281. Sasaki, T., Yamada, H., Matsumura, K., Shimizu, T., Kobata, A., and Endo, T. (1998). Detection of O-mannosyl glycans in rabbit skeletal muscle alpha-dystroglycan. Biochim. Biophys. Acta 1425, 599–606. Sporle, R., Gunther, T., Struwe, M., and Schughart, K. (1996). Severe defects in the formation of epaxial musculature in open brain (opb) mutant mouse embryos. Development 122, 79–86. Tybulewicz, V. L., Crawford, C. E., Jackson, P. K., Bronson, R. T., and Mulligan, R. C. (1991). Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65, 1153–1163. van Reeuwijk, J., Janssen, M., van den Elzen, C., Beltran-Valero de Bernabe, D., Sabatelli, P., Merlini, L., Boon, M., Scheffer, H., Brockington, M., Muntoni, F., Huynen, M. A., Verrips, A., et al. (2005). POMT2 mutations cause alpha-dystroglycan hypoglycosylation and Walker–Warburg syndrome. J. Med. Genet. 42, 907–912. Willer, T., Amselgruber, W., Deutzmann, R., and Strahl, S. (2002). Characterization of POMT2, a novel member of the PMT protein O-mannosyltransferase family specifically localized to the acrosome of mammalian spermatids. Glycobiology 12, 771–783. Willer, T., Valero, M. C., Tanner, W., Cruces, J., and Strahl, S. (2003). O-Mannosyl glycans: From yeast to novel associations with human disease. Curr. Opin. Struct. Biol. 13, 621–630. Willer, T., Prados, B., Falcon-Perez, J. M., Renner-Muller, I., Przemeck, G. K., Lommel, M., Coloma, A., Valero, M. C., de Angelis, M. H., Tanner, W., Wolf, E., Strahl, S., et al. (2004). Targeted disruption of the Walker–Warburg syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Williamson, R. A., Henry, M. D., Daniels, K. J., Hrstka, R. F., Lee, J. C., Sunada, Y., Ibraghimov-Beskrovnaya, O., and Campbell, K. P. (1997). Dystroglycan is essential for early embryonic development: Disruption of Reichert’s membrane in Dag1-null mice. Hum. Mol. Genet. 6, 831–841. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell. 1, 717–724.
C H A P T E R
N I N E T E E N
POMGnT1, POMT1, and POMT2 Mutations in Congenital Muscular Dystrophies Tamao Endo,* Hiroshi Manya,* Nathalie Seta,† and Pascale Guicheney‡ Contents 344 345
1. Overview 2. Methods 2.1. Cell Culture and Preparation of Microsomal Membrane Fraction 2.2. Assay for glycosyltransferase activity 2.3. GnT1 activity 2.4. POMGnT1 activity 2.5. POMT activity 2.6. Mutation analysis 3. Procedures for Enzymatic Activity and Mutation Search Acknowledgment References
345 346 346 347 347 348 348 350 350
Abstract a-Dystroglycanopathies are a group of rare inherited neuromuscular disorders characterized by reduced glycosylation of a-dystroglycan (a-DG). Mutations in six genes (POMT1, POMT2, POMGNT1, FKTN, FKRP, and LARGE) have been identified in patients with a-dystroglycanopathies. Due to an extremely broad clinical spectrum and relatively poor phenotype–genotype correlation, diagnosis of a-dystroglycanopathies is difficult and requires searching for mutations gene by gene. At present, of the six proteins involved on a-dystroglycanopathies, the function of the gene products is only known for POMT1, POMT2, and POMGnT1, all responsible for the O-mannosylglycan biosynthesis. This chapter describes the assay protocols to diagnose patients with a-dystroglycanopathy by measuring glycosyltransferase activity. * Molecular Glycobiology, Tokyo Metropolitan Institute of Gerontology, Itabashi-ku, Tokyo, Japan Laboratoire de Biochimie Me´tabolique et Cellulaire, AP-HP, Hopital Bichat, Paris, France Ge´ne´tique, Pharmacologie et Physiopathologie des Maladies Cardiovasculaires, Groupe Hospitalier Pitie´-Salpeˆtrie`re, Paris, France
{ {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79019-4
#
2010 Elsevier Inc. All rights reserved.
343
344
Tamao Endo et al.
1. Overview Recent studies indicate that O-mannosylation of a-dystroglycan (a-DG), a highly glycosylated surface membrane protein, plays an important role in muscle and brain development. Defects in glycosylation of a-DG cause several forms of autosomal recessive muscular dystrophy, also called adystroglycanopathies, that share common features such as high serum creatine kinase and muscle hypertrophy. Six genes (POMT1, POMT2, POMGNT1, FKTN, FKRP, and LARGE) are responsible for these diseases with overlapping phenotypes (Michele and Campbell, 2003; Muntoni et al., 2008). Muscle–eye–brain disease (MEB) is an autosomal recessive disorder characterized by congenital muscular dystrophy (CMD), ocular abnormalities, and brain malformation (type II or cobblestone lissencephaly). Mutations in the POMGNT1 gene were first identified in patients with MEB (Yoshida et al., 2001). A selective deficiency of glycosylated a-DG in MEB patient muscle biopsies was found, suggesting that hypoglycosylation of a-DG may be the pathomechanism of MEB. Walker–Warburg syndrome (WWS) is the most severe form characterized by CMD, major structural brain defects and eye malformations. The first mutations in POMT1 and POMT2 were reported in patients with WWS (Beltran-Valero De Bernabe et al., 2002; van Reeuwijk et al., 2005). The gene POMGNT1 encodes the protein O-linked mannose b1,2-N-acetylglucosaminyltransferase 1 (POMGnT1) which forms GlcNAcb1-2Man linkage of O-mannosyl glycans (Yoshida et al., 2001), and the protein products of POMT1 and POMT2, protein O-mannosyltransferase 1 and 2, are responsible for the catalysis of the first step in O-mannosyl glycan synthesis on a-DG (Manya et al., 2004). POMT1 and POMT2 are both required for protein O-mannosyltransferase activity (Akasaka-Manya et al., 2006; Manya et al., 2004). In WWS patients, as in MEB patients, the highly glycosylated a-DG was selectively deficient in skeletal muscle and brain. WWS and MEB are similar disorders, but the clinical spectrum associated with both diseases is broad (Biancheri et al., 2006; D’Amico et al., 2006). Other forms of muscular dystrophies have been suggested to be caused by abnormal glycosylation of a-DG, for example, Fukuyama-type congenital muscular dystrophy (FCMD), CMD type 1C (MDC1C), limb-girdle muscular dystrophy 2I (LGMD2I), and CMD type 1D (MDC1D), since highly glycosylated a-DG was also found to be selectively deficient in the skeletal muscle of these patients. These gene products are thus thought to have glycosyltransferase activity or be involved in glycan stability. FCMD is the second most common form of muscular dystrophy in Japan, and characterized by central nervous system involvement. Severe mental retardation and epilepsy are characteristic clinical features of FCMD, with brain showing polymicrogyria/pachygyria caused by altered neuronal migration. Kobayashi et al. (1998) identified the gene responsible for FCMD, which
Mutations in Muscular Dystrophy
345
encodes a protein named fukutin. Sequence analysis of fukutin predicts it to be an enzyme that could modify glycoconjugates. In addition, mutations in a homologue of fukutin, the fukutin-related protein (FKRP), were found in MDC1C patients (Brockington et al., 2001a). MDC1C is characterized by a rapidly progressive muscle disease leading to a complete loss of muscle function and lethal respiratory insufficiency during the second decade (Quijano-Roy et al., 2002). Mental retardation and cerebellar cysts have been observed in some patients. In contrast, allelic mutations in the FKRP gene cause a milder and more common form of myopathy, named LGMD2I, with a variable onset ranging from adolescence to adulthood (Brockington et al., 2001b). Patients with FKRP mutations have reduced expression of glycosylated a-DG, broadly correlating with disease severity (Brown et al., 2004). Finally, the gene LARGE encodes a putative glycosyltransferase (Grewal et al., 2001). However, its biochemical activity has not yet been confirmed. Mutations in the LARGE gene cause MDC1D, a novel form of CMD also with a variable degree of mental retardation and brain abnormalities (Longman et al., 2003; van Reeuwijk et al., 2007). Since multiple genes are known to cause a-dystroglycanopathies, with an extremely broad clinical spectrum and relatively poor phenotype–genotype correlation (Mercuri et al., 2009), at present molecular diagnosis of a-dystroglycanopathy patients is difficult and often requires the analysis of several genes, which is expensive and time consuming. At present, of the six known a-dystroglycanopathy genes, the functions of the protein products are clear only for POMT1, POMT2, and POMGnT1. To assess the pathogenicity of several mutations, we demonstrated by a specific enzymatic assay that mutations in POMGNT1 and POMT1 lead to defects in respective enzymatic activities using mutant constructs transfected into cell lines (Akasaka-Manya et al., 2004; Manya et al., 2003). Another group reported POMGnT1 enzymatic assay in lymphoblasts and muscle biopsies (Vajsar et al., 2006; Zhang et al., 2003). Recent established mouse models for a-dystroglycanopathy will help our understanding between glycosylation and pathophysiology of these diseases (Kanagawa et al., 2009; Liu et al., 2006; Miyagoe-Suzuki et al., 2009). This chapter describes the assay protocols to diagnose patients with a-dystroglycanopathy by measuring glycosyltransferase activity in lymphoblast microsomal preparations (Manya et al., 2008).
2. Methods 2.1. Cell Culture and Preparation of Microsomal Membrane Fraction Blood from five healthy subjects and seven patients with CMD, with mental retardation, or hypoglycosylation of a-DG, or both, was collected for B lymphoblasts immortalization and DNA extraction after informed consent
346
Tamao Endo et al.
Table 19.1 Summary of patients examined in the present study Clinical Patient diagnosis
Molecular diagnosis
1 2 3
MEB MEB CMD-MR
POMGNT1 POMGNT1 POMT1
4 5 6 7
LGMD-MR MEB CMD-MR MEB
POMT1 Uncharacterized Uncharacterized Uncharacterized
IVS17þ1G>A homozygous p.Arg442His homozygous p.Gly65Arg þ Trp582Cys heterozygous p.Ala200Pro homozygous
CMD, congenital muscular dystrophy; LGMD, limb-girdle muscular dystrophy; MR, mental retardation.
from the parents. Four patients had already been genetically characterized (patients 1 and 2 for POMGNT1 and patients 3 and 4 for POMT1; Table 19.1). Three other patients (patients 5–7) were genetically uncharacterized. B lymphoblasts were obtained after immortalization by Epstein–Barr virus and cultured in RPMI 1640 (Invitrogen, Carlsbad, CA) according to standard protocols to obtain 100 106 cells. After centrifugation at 800g for 5 min, the pellets were rinsed twice with 50 ml then with 12 ml of PBS buffer. The final pellets were frozen at –80 C. The cells (7.5 106 cells) were homogenized in 10 mM Tris–HCl, pH 7.4, 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol, with a protease inhibitor cocktail (3 mg/ml pepstatin A, 1 mg/ml leupeptin, 1 mM benzamidine–HCl, and 1 mM PMSF). After centrifugation at 900g for 10 min, the supernatant was subjected to ultracentrifugation at 100,000g for 1 h. The precipitate was used as the microsomal membrane fraction (enzyme source). Protein concentration was determined by BCA assay (PIERCE, Rockford, IL). About 40 mg proteins of microsomal membranes were obtained from 1 106 cells.
2.2. Assay for glycosyltransferase activity Since GnT1 (UDP-GlcNAc: a-3-D-mannoside b1,2-N-acetylglucosaminyltransferase 1, EC 2.4.1.101) is not involved in O-mannosylglycan biosynthesis, it is not affected in a-dystroglycanopathies and represents a suitable control to normalize samples for baseline microsomal activity.
2.3. GnT1 activity The GnT1 activity was performed in a total volume of 20 ml reaction mixture containing 100 mM MES buffer, 10 mM pyridylaminated Man5GlcNAc2 (M5-PA, Takara Bio, Inc., Otsu, Japan), 2 mM UDP-GlcNAc, 5 mM
Mutations in Muscular Dystrophy
347
AMP, 0.5% Triton X-100, 0.2% BSA, 20 mM MnCl2, and enzyme source (100 mg of microsomal membrane fraction) at 37 C for 2 h. The samples were then analyzed by reversed phase HPLC with a COSMOSIL 5C18AR-II column (4.6 250 mm, Nacalai Tesque, Kyoto, Japan). The solvent used was a 100 mM, pH 6.0, ammonium acetate buffer containing 0.15% 1-butanol, and the substrate and the product were isocratically separated. Fluorescence was detected with a fluorescence detector (RF-10AXL, Shimadzu Corp., Kyoto, Japan) at excitation and emission wavelengths of 320 and 400 nm, respectively. The GnT1 activity mean (standard deviation) of all samples was 0.53 (0.06) nmol/h/mg total proteins with high constancy.
2.4. POMGnT1 activity The POMGnT1 activity was based on the amount of [3H]GlcNAc transferred to a mannosylpeptide (Ac-Ala-Ala-Pro-Thr(Man)-Pro-Val-Ala-AlaPro-NH2) as described in a previous chapter of this series (Endo and Manya, 2006). The mannosylpeptide is not commercially available but it is possible to use Benzyl-Man, which is commercially available, as a substitute as described previously (Endo and Manya, 2006). Therefore, the procedures are described briefly here. The reaction buffer containing 140 mM MES buffer (pH 7.0), 1 mM UDP-[3H]GlcNAc (225,000 dpm/nmol) (PerkinElmer, Inc., Waltham, MA), 1 mM mannosyl nanopeptide, 10 mM MnCl2, 2% Triton X-100, 5 mM AMP, 200 mM GlcNAc, 10% glycerol, and enzyme source (100 mg of microsomal membrane fraction) in 20 ml total volume was incubated at 37 C for 4 h. After boiling for 3 min, the mixture was analyzed by reversed phase HPLC with a Wakopak 5C18-200 column (4.6 250 mm, Wako Pure Chemical Industries, Ltd., Osaka, Japan). Solvent A was 0.1% trifluoroacetic acid in distilled water and solvent B was 0.1% trifluoroacetic acid in acetonitrile. The peptide was eluted at a flow rate of 1 ml/min using a linear gradient of 1–25% solvent B. The peptide separation was monitored continuously at 214 nm, and the radioactivity of each fraction was measured using a liquid scintillation counter. The average POMGnT1 activity measured in lymphoblasts of control patients was 0.163 (0.042) nmol/h/mg total proteins.
2.5. POMT activity The POMT activity was based on the amount of [3H]-mannose transferred to a glutathione-S-transferase fusion a-DG (GST-aDG) as described also in a previous chapter of this series (Endo and Manya, 2006). Therefore, the procedures are described briefly here. The reaction mixture contained 20 mM Tris–HCl (pH 8.0), 100 nM of [3H]-mannosylphosphoryldolichol (Dol-P-Man, 125,000 dpm/pmol) (American Radiolabeled Chemical, Inc., St. Louis, MO), 2 mM 2-mercaptoethanol, 10 mM EDTA, 0.5% noctyl-b-D-thioglucoside (Dojindo Laboratories, Kumamoto, Japan), 10 mg
348
Tamao Endo et al.
GST-a-DG, and enzyme source (80 mg of microsomal membrane fraction) in 20 ml total volume. After 1 h incubation at 22 C, the reaction was stopped by adding 150 ml PBS containing 1% Triton X-100, and the reaction mixture was centrifuged at 10,000g for 10 min. The supernatant was removed, mixed with 400 ml of PBS containing 1% Triton X-100 and 10 ml of Glutathione Sepharose 4B beads (GE Healthcare Bio-Sciences Corp., NJ), rotated at 4 C for 1 h, and washed three times with 20 mM Tris–HCl (pH 7.4) containing 0.5% Triton X-100. The radioactivity adsorbed to the beads was measured using a liquid scintillation counter. The average POMT activity in lymphoblasts of control subjects was 0.041 ( 0.013) pmol/h/mg proteins.
2.6. Mutation analysis Genomic DNA was extracted from lymphoblasts using standard methods. Primer pairs were designed to amplify all coding exons and flanking intronic sequences of POMT1 (9q34.1), POMT2 (14q24), and POMGNT1 (1p34.1). The primer sequences and PCR conditions are available upon request. The generated amplicons were purified and directly sequenced with the BigDye terminator kit (PerkinElmer Applied Biosystems, Wellesley, MA). Sequences were analyzed on an ABI PRISM 31130 capillary sequencer (Applera, CA). For patient 7, to find the second mutation, total RNA extracts from lymphoblasts were reversed transcribed and POMT2 cDNA was amplified by nested PCR as previously reported (Yanagisawa et al., 2009).
3. Procedures for Enzymatic Activity and Mutation Search When we assessed the POMGnT1 activity in lymphoblasts from patients 1 and 2, enzymatic activity in these lymphoblasts was much lower than in the control subjects (Fig. 19.1). Those had previously been genetically confirmed with mutations in the POMGNT1 gene (Table 19.1). Patient 1 carried the mutation c.1539þ1 G>A in the homozygous state, and patient 2 harbored the mutation p.Arg442His, also in homozygous state. When we assessed POMT activity in lymphoblasts from the patients who were been previously genetically confirmed with mutations in the POMT1 gene (Table 19.1). Patient 3 was a compound heterozygous carrier of two missense mutations, p.Gly65Arg and p.Trp582Cys (van Reeuwijk et al., 2006). Patient 4 was homozygous for the missense mutation p.Ala200Pro (Balci et al., 2005). The enzyme activity in these patient lymphoblasts was extremely low.
349
Mutations in Muscular Dystrophy
Patients with a-dystroglycanopathies
0.5
-
0.4 0.3
-
0.2
-
0.1
-
0
-
C 1 2 3 4 5 6 7
Patient 5 (low POMGnT1 activity)
Screening POMGnT1 c. 458C > G, p.Ser153X c. 805_807delTGC, p. Cys269del
POMT/GnT1 (⫻10-3) activity
POMGnT1/GnT1 (⫻10-3) activity
Enzymatic assays 0.08 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0
C 1 2 3 4
5 6 7
Patients 6 and 7 (low POMT activity)
Screening POMT1 Patient 6
Patient 7
c. 2005G > A, p. Ala669Thr c. 2167insG, p. Gly722fs > 730X
No mutations
Screening POMT2 c. 1997A > G, p.Tyr666Cys c. 763del6602insCCTG p. Met112AlafsX16
Figure 19.1 Schematic illustration of procedures for enzymatic activity and mutation search. Enzymatic activities in lymphoblasts from uncharacterized patients with a-dystroglycanopathies were measured. If a patient showed low enzymatic activity, the potential responsible gene was screened. Patient 5 showed low POMGnT1 activity, and POMGNT1 was thus screened. Patients 6 and 7 showed low POMT activity, and thus patients 6 and 7 were screened for POMT1 at first. However, since no mutations were found in the POMT1 gene of patient 7, then the POMT2 gene was further studied.
Among the uncharacterized patients, patient 5 showed low POMGnT1 activity and was thus secondarily screened for POMGNT1. The DNA study of this patient revealed two heterozygous mutations: a nonsense mutation, p.Ser153X (c.458C>G), and a deletion of three nucleotides c.805807delTGC, which is expected to delete one amino acid, cysteine at position 269 (p.Cys269del), localized in the stem domain of the protein (Leu59-Leu300) (Manya et al., 2008).
350
Tamao Endo et al.
When we assessed POMT activity in the uncharacterized patients, we observed a markedly reduced activity in patient 6 and patient 7 (Fig. 19.1). Then patient 6 and patient 7 were secondarily screened for POMT1 at first. We found two heterozygous mutations, in POMT1 for patient 6: p.Ala669Thr (c.2005G>A), associated with c.2167insG which leads to a premature stop codon in amino acid 730 (Manya et al., 2008). However, no mutation was found in the POMT1 gene of patient 7. Then we screened POMT2 for mutations and finally found two heterozygous mutations: a missense mutation, p.Tyr666Cys, and a large deletion 763del6602insCCTG leading to a premature stop codon (Yanagisawa et al., 2009). In conclusion, the lymphoblast-based enzymatic assay is an accurate and extremely useful method to select the patients harboring POMT1, POMT2, and POMGNT1 mutations among those with suspected a-dystroglycanopathies. In other words, the enzymatic assay can be used as a first screening tool for narrowing the responsible gene in a-dystroglycanopathies. Interestingly, the same POMT assay was successfully used in skin fibroblasts from patients (Lommel et al., 2010). The combinatory study of enzyme activity and gene mutation screening will help surveying patients with a-dystroglycanopathies and better understanding the clinical spectrum of theses pathologies.
ACKNOWLEDGMENT This work was supported by Research Grants for Nervous and Mental Disorders (20B-13) and Research on Psychiatric and Neurological Diseases and Mental Health from the Ministry of Health, Labour and Welfare of Japan.
REFERENCES Akasaka-Manya, K., Manya, H., and Endo, T. (2004). Mutations of the POMT1 gene found in patients with Walker–Warburg syndrome lead to a defect of protein O-mannosylation. Biochem. Biophys. Res. Commun. 325, 75–79. Akasaka-Manya, K., Manya, H., Nakajima, A., Kawakita, M., and Endo, T. (2006). Physical and functional association of human protein O-mannosyltransferases 1 and 2. J. Biol. Chem. 281, 19339–19345. Balci, B., Uyanik, G., Dincer, P., Gross, C., Willer, T., Talim, B., Haliloglu, G., Kale, G., Hehr, U., Winkler, J., and Topaloglu, H. (2005). An autosomal recessive limb girdle muscular dystrophy (LGMD2) with mild mental retardation is allelic to Walker–Warburg syndrome (WWS) caused by a mutation in the POMT1 gene. Neuromuscul. Disord. 15, 271–275. Beltran-Valero De Bernabe, D., Currier, S., Steinbrecher, A., Celli, J., Van Beusekom, E., Van Der Zwaag, B., Kayserili, H., Merlini, L., Chitayat, D., Dobyns, W. B., Cormand, B., Lehesjoki, A. E., et al. (2002). Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker–Warburg syndrome. Am. J. Hum. Genet. 71, 1033–1043.
Mutations in Muscular Dystrophy
351
Biancheri, R., Bertini, E., Falace, A., Pedemonte, M., Rossi, A., D’Amico, A., Scapolan, S., Bergamino, L., Petrini, S., Cassandrini, D., Broda, P., Manfredi, M., et al. (2006). POMGnT1 mutations in congenital muscular dystrophy: Genotype–phenotype correlation and expanded clinical spectrum. Arch. Neurol. 63, 1491–1495. Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E., Voit, T., Sewry, C. A., et al. (2001a). Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin a2 deficiency and abnormal glycosylation of a-dystroglycan. Am. J. Hum. Genet. 69, 1198–1209. Brockington, M., Yuva, Y., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Herrmann, R., Anderson, L. V., Bashir, R., Burgunder, J. M., Fallet, S., Romero, N., et al. (2001b). Mutations in the fukutin-related protein gene (FKRP) identify limb girdle muscular dystrophy 2I as a milder allelic variant of congenital muscular dystrophy MDC1C. Hum. Mol. Genet. 10, 2851–2859. Brown, S. C., Torelli, S., Brockington, M., Yuva, Y., Jimenez, C., Feng, L., Anderson, L., Ugo, I., Kroger, S., Bushby, K., Voit, T., Sewry, C., et al. (2004). Abnormalities in adystroglycan expression in MDC1C and LGMD2I muscular dystrophies. Am. J. Pathol. 164, 727–737. D’Amico, A., Tessa, A., Bruno, C., Petrini, S., Biancheri, R., Pane, M., Pedemonte, M., Ricci, E., Falace, A., Rossi, A., Mercuri, E., Santorelli, F. M., et al. (2006). Expanding the clinical spectrum of POMT1 phenotype. Neurology 66, 1564–1567. Endo, T., and Manya, H. (2006). Defect in glycosylation that causes muscular dystrophy. Methods Enzymol. 417, 137–152. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of a-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Kanagawa, M., Nishimoto, A., Chiyonobu, T., Takeda, S., Miyagoe-Suzuki, Y., Wang, F., Fujikake, N., Taniguchi, M., Lu, Z., Tachikawa, M., Nagai, Y., Tashiro, F., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631. Kobayashi, K., Nakahori, Y., Miyake, M., Matsumura, K., Kondo-Iida, E., Nomura, Y., Segawa, M., Yoshioka, M., Saito, K., Osawa, M., Hamano, K., Sakakihara, Y., et al. (1998). An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 394, 388–392. Liu, J., Ball, S. L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Lommel, M., Cirak, S., Willer, T., Hermann, R., Uyanik, G., van Bokhoven, H., Korner, C., Voit, T., Baric, I., Hehr, U., and Strahl, S. (2010). Correlation of enzyme activity and clinical phenotype in POMT1-associated dystroglycanopathies. Neurology 74, 157–164. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., et al. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of a-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Manya, H., Sakai, K., Kobayashi, K., Taniguchi, K., Kawakita, M., Toda, T., and Endo, T. (2003). Loss-of-function of an N-acetylglucosaminyltransferase, POMGnT1, in muscleeye-brain disease. Biochem. Biophys. Res. Commun. 306, 93–97. Manya, H., Chiba, A., Yoshida, A., Wang, X., Chiba, Y., Jigami, Y., Margolis, R. U., and Endo, T. (2004). Demonstration of mammalian protein O-mannosyltransferase activity:
352
Tamao Endo et al.
Coexpression of POMT1 and POMT2 required for enzymatic activity. Proc. Natl. Acad. Sci. USA 101, 500–505. Manya, H., Bouchet, C., Yanagisawa, A., Vuillaumier-Barrot, S., Quijano-Roy, S., Suzuki, Y., Maugenre, S., Richard, P., Inazu, T., Merlini, L., Romero, N., Leturcq, F., et al. (2008). Protein O-mannosyltransferase activities in lymphoblasts from patients with a-dystroglycanopathies. Neuromuscul. Disord. 18, 45–51. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G. P., D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A., Boffi, P., Cassandrini, D., et al. (2009). Congenital muscular dystrophies with defective glycosylation of dystroglycan: A population study. Neurology 72, 1802–1809. Michele, D. E., and Campbell, K. P. (2003). Dystrophin-glycoprotein complex: Posttranslational processing and dystroglycan function. J. Biol. Chem. 278, 15457–15460. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009). Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Muntoni, F., Torelli, S., and Brockington, M. (2008). Muscular dystrophies due to glycosylation defects. Neurotherapeutics 5, 627–632. Quijano-Roy, S., Galan, L., Ferreiro, A., Cheliout-Heraut, F., Gray, F., Fardeau, M., Barois, A., Guicheney, P., Romero, N. B., and Estournet, B. (2002). Severe progressive form of congenital muscular dystrophy with calf pseudohypertrophy, macroglossia and respiratory insufficiency. Neuromuscul. Disord. 12, 466–475. Vajsar, J., Zhang, W., Dobyns, W. B., Biggar, D., Holden, K. R., Hawkins, C., Ray, P., Olney, A. H., Burson, C. M., Srivastava, A. K., and Schachter, H. (2006). Carriers and patients with muscle-eye-brain disease can be rapidly diagnosed by enzymatic analysis of fibroblasts and lymphoblasts. Neuromuscul. Disord. 16, 132–136. van Reeuwijk, J., Janssen, M., van den Elzen, C., Beltran-Valero de Bernabe, D., Sabatelli, P., Merlini, L., Boon, M., Scheffer, H., Brockington, M., Muntoni, F., Huynen, M. A., Verrips, A., et al. (2005). POMT2 mutations cause a-dystroglycan hypoglycosylation and Walker–Warburg syndrome. J. Med. Genet. 42, 907–912. van Reeuwijk, J., Maugenre, S., van den Elzen, C., Verrips, A., Bertini, E., Muntoni, F., Merlini, L., Scheffer, H., Brunner, H. G., Guicheney, P., and van Bokhoven, H. (2006). The expanding phenotype of POMT1 mutations: From Walker–Warburg syndrome to congenital muscular dystrophy, microcephaly, and mental retardation. Hum. Mutat. 27, 453–459. van Reeuwijk, J., Grewal, P. K., Salih, M. A., Beltran-Valero de Bernabe, D., McLaughlan, J. M., Michielse, C. B., Herrmann, R., Hewitt, J. E., Steinbrecher, A., Seidahmed, M. Z., Shaheed, M. M., Abomelha, A., et al. (2007). Intragenic deletion in the LARGE gene causes Walker–Warburg syndrome. Hum. Genet. 121, 685–690. Yanagisawa, A., Bouchet, C., Quijano-Roy, S., Vuillaumier-Barrot, S., Clarke, N., Odent, S., Rodriguez, D., Romero, N. B., Osawa, M., Endo, T., Taratuto, A. L., Seta, N., et al. (2009). POMT2 intragenic deletions and splicing abnormalities causing congenital muscular dystrophy with mental retardation. Eur. J. Med. Genet. 52, 201–206. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell. 1, 717–724. Zhang, W., Vajsar, J., Cao, P., Breningstall, G., Diesen, C., Dobyns, W., Herrmann, R., Lehesjoki, A. E., Steinbrecher, A., Talim, B., Toda, T., Topaloglu, H., et al. (2003). Enzymatic diagnostic test for muscle-eye-brain type congenital muscular dystrophy using commercially available reagents. Clin. Biochem. 36, 339–344.
C H A P T E R
T W E N T Y
Cellular and Molecular Characterization of Abnormal Brain Development in Protein O-Mannose N-Acetylglucosaminyltransferase 1 Knockout Mice Jianmin Liu,* Yuan Yang,† Xiaofeng Li,‡ Peng Zhang,§ Yue Qi,} and Huaiyu Hu§ Contents 1. Overview 2. Analysis of a-DG Glycosylation and Laminin Binding by Western Blot 3. Histological Analysis of POMGnT1 Knockout Brain 4. Lamination Defects in the Neocortex of POMGnT1 Knockout Mice 5. Analysis of the Pial Basement Membrane by Laminin Immunostaining 6. Analysis of the Pial Basement Membrane by Transmission Electron Microscopy 7. Analysis of the Glia Limitans by GFAP Immunofluorescence Staining Acknowledgments References
354 355 356 357 359 360 362 364 365
Abstract Protein O-mannose N-acetylglucosaminyltransferase 1 (POMGnT1) is an enzyme that catalyzes the transfer of N-acetylglucosamine to O-mannose of glycoproteins. It is involved in posttranslational modification of a-dystroglycan (a-DG). POMGnT1-null mice were generated by gene trapping with a retroviral vector inserted into exon 2 of the POMGnT1 gene. Expression of POMGnT1 was * Vicam, Watertown, Massachusetts, USA Department of Neurology, Tongji Medical College, Wuhan, Hubei Province, PR China Department of Neurology, Second Affiliated Hospital of Chongqin Medical University, Chongqin, PR China } Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA } Department of Pathology, Upstate Medical University, New York, USA { {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79020-0
#
2010 Elsevier Inc. All rights reserved.
353
354
Jianmin Liu et al.
completely disrupted as evidenced by absence of its mRNA expression. POMGnT1 knockout mice were viable but with reduced fertility and variable lifespan. The functional glycosylated form of a-DG was markedly reduced in POMGnT1 knockout mice along with impaired a-DG-laminin binding activity. Multiple developmental defects in muscle, brain, and eye were observed. In addition, the knockout mice exhibited extensive abnormalities in the neocortex, including changed neuron distribution, presence of ectopic fibroblasts, and GFAP-positive reactive astrocytes. Analysis of POMGnT1 knockout neocortex at several developmental stages revealed that these defects were secondary to disruptions of the pial basement membrane.
1. Overview Mutations in protein O-mannose b-1,2-N-acetylglucosaminyltransferase 1 (POMGnT1) cause congenital muscular dystrophies, including muscle–eye–brain disease (MEB) in human (Yoshida et al., 2001). POMGnT1 is an enzyme that catalyzes the transfer of N-acetylglucosamine to O-mannose of glycoproteins, including dystroglycan (Takahashi et al., 2001). O-Mannosyl glycosylation is essential for proper dystroglycan’s extracellular matrix binding function in brain, nerve, and skeletal muscle (Yoshida et al., 2001). More than 30 different human POMGnT1 mutations have been identified worldwide over the last decade (Biancheri et al., 2006; Oliveira et al., 2008). Mutations discovered so far in MEB patients are distributed along the entire gene. The type and position of the POMGnT1 mutations cannot predict the clinical severity (Hehr et al., 2007). The spectrum of disorders caused by POMGnT1 mutations is broad ranging from mild deficiency to life-threatening (Clement et al., 2008; Taniguchi et al., 2003). Recent studies in POMGnT1 knockout mice reveal multiple developmental defects in muscle, eye, and brain, similar to the phenotypes observed in human MEB disease (Hu et al., 2007; Liu et al., 2006; Miyagoe-Suzuki et al., 2009; Yang et al., 2007). The knockout muscle and brain tissues show aberrant glycosylation of a-dystroglycan (a-DG), and the laminin binding activity of a-DG is greatly reduced in POMGnT1 knockout mouse (Liu et al., 2006; Miyagoe-Suzuki et al., 2009). Reduced fertility, muscle mass, number of muscle fibers, and impaired muscle regeneration are also observed in these POMGnT1 knockouts (Liu et al., 2006; Miyagoe-Suzuki et al., 2009). In vitro study shows that muscle satellite cells derived from POMGnT1 knockout mice proliferated slowly, and transfer of a retrovirus vectormediated POMGnT1 gene into POMGnT1 null myoblasts could completely restore the glycosylation of a-DG (Miyagoe-Suzuki et al., 2009). This result opens up an avenue of gene therapy for severe human POMGnT1 originated muscular dystrophy.
Abnormal Brain Development in POMGnT1 Knockout Mice
355
a-DG is a high-affinity receptor for a variety of extracellular ligands such as laminin, agrin, neurexin, perlecan (Michele and Campbell, 2003; Montanaro and Carbonetto, 2003), and pikachurin (Sato et al., 2008). Correct posttranslational modification of a-DG is essential for the spatial linkage between the extracellular matrix and the cytoskeleton in muscle and nonmuscle tissues (Brancaccio, 2003; Campbell, 1995; Durbeej et al., 1998). POMGnT1 is one of the key enzymes involving in the synthesis of functional a-DG in human and mouse. To dissect the specific role of POMGnT1 in animal development, POMGnT1 knockout mice were generated by gene trapping (Liu et al., 2006). Here, we describe the methods and results from characterization of abnormal brain development in POMGnT1 knockout.
2. Analysis of a-DG Glycosylation and Laminin Binding by Western Blot Two monoclonal antibodies, IIH6C4 and Via4-1, which recognize different epitopes of a-DG have been widely used in previous studies (Ervasti and Campbell, 1993; Grewal et al., 2001) to evaluate glycosylation of a-DG. IIH6C4 reacts with the laminin binding site of a-DG (Ervasti and Campbell, 1993), and the VIA4-1 recognizes an unidentified glycosylated site of a-DG (Longman et al., 2003). Western blot has been used to examine the functional glycosylated a-DG in patients with FCMD, MEB, and WWS, and in mice with Largemyd disease (Michelele et al., 2002). The brain tissues (0.3 g) from wild-type and POMGnT1 knockout mice were homogenized by polytron in 3 ml of Tris-buffered saline (TBS, 50 mM Tris–HCl, 150 mM NaCl, pH 7.4) supplemented with a protease inhibitor cocktail (Roche Diagnostic). Then, Triton X-100 was added to the above homogenate at the final concentration of 1%, and homogenized tissues were incubated with gentle mixing at 4 C for 1 h and centrifuged at 14,000g for 37 min. The supernatant was collected. To enrich glycoproteins, affinity chromatography with wheat germ agglutinin (WGA) gel (EY Laboratories) was performed as previously described with minor changes (Michelele et al., 2002). The supernatant was incubated with 300 ml washed WGA gel at 4 C overnight. The gel was then washed three times with TBS containing 0.1% Triton X-100 and protease inhibitor cocktail, and resuspended in 1 ml TBS þ 0.1% Triton X-100 or 1 SDS-PAGE gel loading buffer, heated in boiling water for 5 min, and stored at –70 C until analysis. For Western blot analysis, 30 ml WGA-enriched glycoproteins were resolved with 4–20% SDS-PAGE and electrophoretically transferred onto polyvinylidene fluoride (PVDF) membrane. The membrane was blocked by 3% bovine serum albumin (BSA) in TBS, incubated with primary antibodies (IIH6C4, Santa Cruz Biotechnologies) for 2 h. After washing
356
Jianmin Liu et al.
with TBS, the membrane was incubated with secondary antibody conjugated with horseradish peroxidase (HRP, goat anti-mouse IgM). After washing with TBS, the results were visualized with an electrochemiluminescence (ECL) detection kit (Pierce). For the laminin overlay assay, the PVDF membrane was incubated with TBS (with 1 mM CaCl2, 1 mM MgCl2) containing 3% BSA for an hour to block nonspecific binding. The membrane was then incubated with 1.25 ng/ml laminin-1 (Invitrogen) in TBS (with 1 mM CaCl2, 1 mM MgCl2) overnight at 4 C. After washing with TBS (with 1 mM CaCl2, 1 mM MgCl2), bound laminin was detected with a rabbit antibody against mouse laminin-1 (Sigma) for 2 h. After washing, the membrane was incubated with goat anti-rabbit IgG conjugated with HRP for 45 min. The signal was then visualized with SuperSignal West Pico chemiluminescent substrate (Thermo Scientific, Rockford, IL). As expected, the monoclonal antibody IIH6C4 detected a 125 kDa signal in wild-type (þ/þ) mouse brain tissue while markedly reduced signals were found in POMGnT1 knockout tissues (Fig. 20.1), suggesting loss of expression of functional glycosylation of a-DG in the POMGnT1 knockout mice. Laminin binding activity was also detected in wild-type mouse brain tissue, but was markedly reduced in POMGnT1 knockout mouse, indicating reduced laminin binding by hypoglycosylated a-DG in the knockout. As a control, wild-type and knockout mice showed similar levels of b-DG.
3. Histological Analysis of POMGnT1 Knockout Brain Classical histological analysis such as H&E or cresyl violet staining is very useful to screen brain malformations in knockout models. The adult brains were embedded into Tissue-Tek OCTÒ (Optimal Cutting Temperature) compound, snap-frozen in 2-methylbutane/dry ice bath, and cryosectioned into 10 mm sections with a cryostat. The sections were mounted onto FisherBrand plus slides and fixed in 4% paraformaldehyde for 15 min. After rinsing with water, the slides were stained with 1% hematoxylin for 2 min and rinsed with running water. The slides were then stained with 2% eosin for 1 min, rinsed with water, dehydrated with an ascending ethanol series, and cover slipped with a xylene-based mounting medium. As shown in Fig. 20.2, the cerebral cortex of wild-type mice showed normal lamination with clear layer I and other discernible cortical layers (I–VI, Fig. 20.2A). By contrast, the POMGnT1 knockout did not show a clear layer I and the other layers could not be identified. In the cerebellum, the knockout often had ectopic granule cell clusters localized between the molecular layers of two folia (asterisks in Fig. 20.2D).
Abnormal Brain Development in POMGnT1 Knockout Mice
−/−
b-DG
Laminin overlay
IIH6C4
+/+
357
Figure 20.1 Western blot analysis of a-dystroglycan glycosylation. WGA-enriched glycoproteins were isolated from the brain and analyzed by Western blot and laminin overlay experiments. Note that the knockout exhibited markedly reduced IIH6C4 immunoreactivity and laminin binding activity. Abbreviations: þ/þ, wild type; /, POMGnT1 knockout.
4. Lamination Defects in the Neocortex of POMGnT1 Knockout Mice Reporter mice that express fluorescent proteins in specific neurons provide excellent tools to show tissue architecture. The transgenic mice, YFPH, express yellow fluorescent protein (YFP) in a subset of neurons in the layer V of the cerebral cortex (Feng et al., 2000). They were used to evaluate neuronal lamination in the cerebral cortex of POMGnT1 knockout mice.
358
Jianmin Liu et al.
-/-
+/+ A
I B II/III IV V VI
D
C ML
GCL
*
*
Figure 20.2 Histology of the cerebral and cerebellar cortex of POMGnT1 knockout mice. Coronal sections of the adult forebrain (A and B) and parasagittal sections of the adult cerebellum (C and D) were stained by H&E. (A and C) Wild type. (B and D) POMGnT1 knockout. Abbreviations: GCL, granule cell layer; ML, molecular layer.
YFPH mice were obtained from Jackson Laboratories. Hemizygous YFPH (þ) mice were crossed with heterozygous POMGnT1 knockout (þ/) mice to obtain POMGnT1 (þ/)/YFPH (þ) animals. These animals were crossed with POMGnT1 (þ/) animals to obtain POMGnT1 (/)/YFPH (þ) animals. Genotyping was carried out with specific primers to confirm identity. For YFPH transgene, the primers were forward AAGTTCATCTGCACCACC and reverse TCCTTGAAGAAGATGGTGCG. Genotyping of POMGnT1 alleles was conducted according to a previous publication (Liu et al., 2006). The adult brains were fixed by transcardial perfusion with 4% paraformaldehyde. The fixed brains were then dissected out and cut into 200 mm coronal sections with a vibratome (Ted Pella, Inc.). The sections were counterstained with propidium iodide or DAPI to visualize the nuclei. Fluorescence was visualized with a Zeiss LSM 510 confocal microscope. As shown in Fig. 20.3, YFP-labeled layer V neurons are located in a unique layer in the cerebral cortex of wild-type animals; the apical dendrites extend dorsally and the axons extend ventrally toward the corpus callosum (Fig. 20.3A). By contrast, YFP-labeled layer V neurons do not form a unique layer in the knockout. Instead, they were widely distributed throughout the neocortex. The orientation of dendrites is disorganized though their axons do extend ventrally into the corpus callosum (Fig. 20.3B). In the cerebellum of wild-type animals, YFP-labeled mossy fibers terminate within the granule cell layer (Fig. 20.3C), while, in the knockout, some
359
Abnormal Brain Development in POMGnT1 Knockout Mice
-/-
+/+ A
I
B
II/III IV
V
VI CC
CC Striatum
Striatum D
C
* ML GCL
GCL
ML *
ML
ML
Figure 20.3 YFPH reporter mice reveal lamination defect of POMGnT1 knockout. YFPH animals that were wild-type and knockout for POMGnT1 locus were perfused with 4% paraformaldehyde. The forebrains were cut into coronal sections (A and B) and the cerebella were cut into parasagittal sections (C and D). Note lamination defects for Layer V neurons in the knockout (B) and extension of mossy fiber beyond the molecular layer into the ectopic granule cell clusters (D).
mossy fibers pass the molecular layer and reach the ectopic granule cell clusters which were often found between the folia and cerebellar surface (Fig. 20.3D).
5. Analysis of the Pial Basement Membrane by Laminin Immunostaining The pial basement membrane serves as a boundary between the neural epithelium and the overlying pia-arachnoid space. Over migration of neurons into the meninges are expected to be caused by breaches in the pial basement membrane. Indeed, breaches in the pial basement membrane were found in patients with Fukuyama congenital muscular dystrophy
360
Jianmin Liu et al.
(Chiyonobu et al., 2005). Thus, the pial basement membrane of POMGnT1 knockout mice was analyzed by immunostaining with antibody against laminin, a major component of all basement membranes. E15.5 fetal heads and adult mouse brains of wild-type and POMGnT1 knockout were embedded in OCT medium and frozen in 2-methylbutane/ dry ice bath. Ten micrometers thick sections were cut in a cryostat and fixed with 4% paraformaldehyde in PBS. After rinsing in PBS, the sections were blocked with PBS containing 1% BSA, and then incubated with antilaminin antibody diluted in 1% BSA in PBS for 2 h. Sections were then rinsed in PBS, and incubated with FITC-conjugated secondary antibody. After 2-h incubation, sections were washed in PBS. Some sections were counterstained with DAPI to show nuclei. The sections were then covered in 1 mg/ml p-phenylenediamine/90% glycerol/0.1 PBS with cover slip and viewed with fluorescence microscopy. Results were shown in Fig. 20.4. In adult wild-type mice, strong laminin staining was observed at the cerebral cortical surface (pial basement membrane staining) and blood vessels. The pial basement membrane staining showed a continuous pattern without disruptions (arrows in Fig. 20.4A). However, in POMGnT1 knockout mice, the laminin staining pattern at the cerebral cortical surface was severely disrupted; showing a punctate pattern (Fig. 20.4B). Some punctate staining could also be observed in the upper half of the knockout neocortex. The blood vessel staining in the knockout appeared normal. Disruptions in the pial basement membrane were detected during development of the cerebral cortex. At E15.5, the pial basement membrane from wild type was continuous without disruptions at the cerebral cortical surface (arrows in Fig. 20.4C). However, the POMGnT1 knockout started to show the disrupted pial basement membrane staining at the cerebral cortical surface (arrowheads in Fig. 20.4D). Furthermore, the pial basement membrane was sandwiched between the diffuse cell zone (over migrated neurons in the pial arachnoid space) and the cortical plate. Similar disruptions of pial basement membrane also existed in the cerebellum of POMGnT1 knockout mice. While there are two pial basement membranes separating the cerebellar folia (arrows in Fig. 20.4E), one of the two pial basement membranes is absent in the example shown in Fig. 20.4F. In some locations, no pial basement membrane could be observed.
6. Analysis of the Pial Basement Membrane by Transmission Electron Microscopy While immunofluorescence staining with antibodies against components of the pial basement membrane strongly suggested disruptions of pial basement membrane in the knockout mice, the gold standard for basement
361
Abnormal Brain Development in POMGnT1 Knockout Mice
-/-
+/+ B
C
D
Adult
A
E15.5
DCZ CP
Cerebellum/P14
E
F
ML
ML ML
ML
Figure 20.4 Laminin immunostaining suggests disrupted pial basement membrane in POMGnT1 knockout. Coronal sections of adult neocortex (A and B), E15.5 neocortex (C and D), and parasagittal sections of P14 cerebella (E and F) were immunostained with anti-laminin. C, D, E, and F were counterstained with DAPI. (A, C, and E) Wild type. (B, D, and F) Knockout. Arrowheads in D indicate broken pial basement membrane. Abbreviations: CP, cortical plate; DCZ, diffuse cell zone; ML, molecular layer.
membrane identification is transmission electron microscopy (EM). Thus, EM analyses of the brain tissues were carried out. Tissue preparation: Newborn and adult brains were fixed by perfusion with 3.7% glutaraldehyde in PBS. After the brains were dissected, the regions of interest were postfixed in the same solution overnight. Fetal brains were fixed by immersion of the fetal heads or dissected brains in 3.7% glutaraldehyde overnight. Tissues were then trimmed to a size of 0.2 0.2 0.3 mm2 and washed three times with 0.1 M phosphate buffer. The tissues were then postfixed in 1% osmium tetroxide in phosphate buffer for 1 h at room temperature and washed three times with phosphate buffer.
362
Jianmin Liu et al.
The tissues were subsequently dehydrated in a series of ethanol (50, 70, 80, and 95% for 5 min each, and followed by absolute ethanol three times for 10 min each time). Afterwards, the tissues were then washed three times with propylene oxide, 10 min each, and then infiltrated with propylene oxide:Araldite 502 at a 1:1 ratio for 1 h in a shaker, followed by 1 h in 100% Araldite 502 in a vacuum before being embedded in a fresh change of Araldite and polymerized in a 60 ºC oven for 16–18 h. One micron thick sections were cut with a glass knife. The area of interest was located from the thick section under microscope. The plastic block was trimmed under an ultramicrotome. Thin sections of 80–100 nm were cut with a diamond knife using a Leica ultramicrotome and picked up on 200 mesh copper grids. The sections were then stained with 2.0% uranyl acetate for 8 min, and Reynold’s lead citrate (Polysciences) for 8 min. The samples were examined and photographed with a Tecnai T12 transmission electron microscope (FEI Company, Salem, MA). EM analysis showed no significant difference in the pial basement membrane at the cerebral cortical surface at earlier stages of development (E11.5) between the wild-type and the POMGnT1 knockout fetuses. However, starting at age of E13.5, the basement membrane in the knockout showed many breaches (Fig. 20.5B). While the pial basement membrane was continuous in the wild type (arrows in Fig. 20.5A), the POMGnT1 knockout showed many disruptions (arrowheads in Fig. 20.5B). As development proceeded, the pial basement membrane became covered by the over migrated neurons and located between the diffuse cell zone and the cortical plate. The broken pial basement membrane could be identified at E15.5 (arrowheads in Fig. 20.5D), E17.5, and newborn animals. However the pial basement membrane eventually disappeared before reaching adulthood as such pial basement membrane no longer existed at the surface of the neocortex in the adult (Fig. 20.5F). Only fragments of pial basement membrane could be observed. By contrast, the pial basement membranes in wild-type animals remained intact through all stages of development (arrows in Fig. 20.5A, C, and D).
7. Analysis of the Glia Limitans by GFAP Immunofluorescence Staining The pial basement membrane closely apposes the glia limitans at the surface of central nervous system. During the developmental period of the cerebral cortex, the glia limitans is composed of endfeet of radial glia. In the adult, the glia limitans is composed of astrocytes with high levels of glial fibrillary acidic protein (GFAP) expression. Thus, glia limitans in the adult mice can be identified by GFAP immunofluorescence staining.
363
Abnormal Brain Development in POMGnT1 Knockout Mice
−/−
E15.5
E13.5
+/+
itans
Adult
Glia lim
Pial fibroblast
500 nm
Figure 20.5 Transmission EM confirms disruptions in the pial basement membrane. Neocortical walls of E13.5 (A and B), 15.5 (C and D), and adult (E and F) were processed for transmission EM. (A, C, and E) Wild type. (B, D, and F) Knockout. Note the knockout pial basement membrane is discontinuous at E13.5 and 15.5 and absent in the adult section shown.
Brains of adult mice were embedded in OCT compound in cryomolds, quick-frozen in 2-methylbutane/dry ice bath, cryostat sectioned in the coronal plane at 10 mm, and mounted on SuperfrostPlus slides. The sections were blocked for 1 h with 1.0% BSA in PBS and then were incubated with rabbit anti-GFAP antibody (Sigma) overnight at 4 C. Sections were washed three times with PBS and incubated with 1:200 FITC-conjugated goat anti-rabbit IgG antibody for 2 h. After washing three times with PBS, the sections were counterstained with 0.10% DAPI (Sigma-Aldrich) for 10 min. Fluorescence staining was visualized and photographed with a Zeiss Axioskop upright fluorescence microscope.
364
Jianmin Liu et al.
-/-
+/+ A
B
C
D
Figure 20.6 GFAP immunostaining reveals defective glia limitans in POMGnT1 knockout. Coronal sections of adult neocortex (A and B) and parasagittal sections of P14 cerebella (C and D) were immunostained with anti-GFAP and counter stained with DAPI. (A and C) Wild type. (B and D) Knockout. Note absence of glia limitans at the neocortex and broken glia limitans in the cerebellum of knockout mice.
As shown in Fig. 20.6, GFAP staining showed a continuous line of bright staining at the cortical surface in the wild-type animals (arrows in Fig. 20.6A). In contrast, the GFAP staining at the cortical surface in knockout mice showed no continuity, indicating the absence of a glia limitans (Fig. 20.6B). Interestingly, the upper half of the POMGnT1 knockout cortex exhibited many GFAP-positive astrocytes, indicating the presence of reactive astrogliosis. Similar disruptions of the glia limitans were also observed in the cerebellum. Glia limitans of the cerebellum is composed of endfeet of Bergman glia. While there were two glia limitans separating the two cerebellar folia in the wild type (arrows in Fig. 20.6C), only one in the example is shown in Fig. 20.6D; the other was broken.
ACKNOWLEDGMENTS This work was supported by NIH grants NS066582 and HD060458 (H. H.), Natural Science Foundation of China grants 30870867(Y. Y.) and 30800346 (X. L.). The authors thank Mr. Noel Gray for reading the manuscript.
Abnormal Brain Development in POMGnT1 Knockout Mice
365
REFERENCES Biancheri, R., Bertini, E., Falace, A., Pedemonte, M., Rossi, A., D’Amico, A., Scapolan, S., Bergamino, L., Petrini, S., Cassandrini, D., Broda, P., Manfredi, M., et al. (2006). POMGnT1 mutations in congenital muscular dystrophy genotype–phenotype correlation and expanded clinical spectrum. Arch. Neurol. 63, 1491–1495. Brancaccio, A. (2003). An adhesion molecule involved in muscular dystrophies: structural and functional analysis of dystroglycan domains. Ital. J. Biochem. 52, 51–54. Campbell, K. P. (1995). Three muscular dystrophies: loss of cytoskeleton-extracellular matrix linkage. Cell 80, 675–679. Chiyonobu, T., Sasaki, J., Nagai, Y., Takeda, S., Funakoshi, H., Nakamura, T., Sugimoto, T., and Toda, T. (2005). Effects of fukutin deficiency in the developing mouse brain. Neuromuscul. Disord. 15, 416–426. Clement, E. M., Godfrey, C., Tan, J., Brockington, M., Torelli, S., Feng, L., Brown, S. C., Jimenez-Mallebrera, C., Sewry, C. A., Longman, C., Mein, R., Abbs, S., et al. (2008). Mild POMGnT1 mutations underlie a novel limb-girdle muscular dystrophy variant. Arch. Neurol. 65, 137–141. Durbeej, M., Henry, M. D., and Campbell, K. P. (1998). Dystroglycan in development and disease. Curr. Opin. Cell Biol. 10, 594–601. Ervasti, J. M., and Campbell, K. P. (1993). A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J. Cell Biol. 122, 809–823. Feng, G., Mellor, R. H., Bernstein, M., Keller-Peck, C., Nguyen, Q. T., Wallace, M., Nerbonne, J. M., Lichtman, J. W., and Sanes, J. R. (2000). Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron 28, 41–51. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of alpha-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Hehr, U., Uyanik, G., Gross, C., Walter, M. C., Bohring, A., Cohen, M., OehlJaschkowitz, B., Bird, L. M., Shamdeen, G. M., Bogdahn, U., Schuierer, G., Topaloglu, H., et al. (2007). Novel POMGnT1 mutations define broader phenotypic spectrum of muscle-eye-brain disease. Neurogenetics 8, 279–288. Hu, H., Yang, Y., Eade, A., Xiong, Y., and Qi, Y. (2007). Breaches of the pial basement membrane and disappearance of the glia limitans during development underlie the cortical lamination defect in the mouse model of muscle-eye-brain disease. J. Comp. Neurol. 502, 168–183. Liu, J., Ball, S. L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose beta1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., and Muntoni, F. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., Moore, S. A., and Campbell, K. P. (2002). Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Michele, D. E., and Campbell, K. P. (2003). Dystrophin-glycoprotein complex: posttranslational processing and dystroglycan function. J. Biol. Chem. 278, 15457–15460. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009).
366
Jianmin Liu et al.
Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Montanaro, F., and Carbonetto, S. (2003). Targeting dystroglycan in the brain. Neuron 37, 193–196. Oliveira, J., Soares-Silva, I., Fokkema, I., Gonc¸alves, A., Cabral, A., Diogo, L., Gala´n, L., Guimara˜es, A., Fineza, I., den Dunnen, J. T., and Santos, R. (2008). Novel synonymous substitution in POMGNT1 promotes exon skipping in a patient with congenital muscular dystrophy. J. Hum. Genet. 53, 565–572. Sato, S., Omori, Y., Katoh, K., Kondo, M., Kanagawa, M., Miyata, K., Funabiki, K., Koyasu, T., Kajimura, N., Miyoshi, T., Sawai, H., Kobayashi, K., et al. (2008). Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nat. Neurosci. 11, 923–931. Takahashi, S., Sasaki, T., Manya, H., Chiba, Y., Yoshida, A., Mizuno, M., Ishida, H., Ito, F., Inazu, T., Kotani, N., Takasaki, S., Takeuchi, M., et al. (2001). A new beta-1,2N-acetylglucosaminyltransferase that may play a role in the biosynthesis of mammalian O-mannosyl glycans. Glycobiology 11, 37–45. Taniguchi, K., Kobayashi, K., Saito, K., Yamanouchi, H., Ohnuma, A., Hayashi, Y. K., Manya, H., Jin, D. K., Lee, M., Parano, E., Falsaperla, R., Pavone, P., et al. (2003). Worldwide distribution and broader clinical spectrum of muscle-eye-brain disease. Hum. Mol. Genet. 12, 527–534. Yang, Y., Zhang, P., Xiong, Y., Li, X., Qi, Y., and Hu, H. (2007). Ectopia of meningeal fibroblasts and reactive gliosis in the cerebral cortex of the mouse model of muscle-eyebrain disease. J. Comp. Neurol. 505, 459–477. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell. 1, 717–724.
C H A P T E R
T W E N T Y- O N E
Investigating the Functions of LARGE: Lessons from Mutant Mice Jane E. Hewitt Contents 1. Overview 2. Human LARGE and Relevance to Disease 3. Identification of Mice Carrying Mutations in Large 3.1. Veils and enr—two additional mutant alleles of Large 4. Loss of Functional Large Protein Results in Hypoglycosylation of a-Dystroglycan 5. Phenotypes of Mice with Mutations in Large 5.1. Embryonic phenotypes 5.2. Muscle phenotype 5.3. Central nervous system 5.4. Peripheral nervous system 5.5. Ocular defects 6. Expression of LARGE Genes 6.1. Expression of Large in adult CNS by in situ hybridization 7. Does Large Encode a Functional Glycosyltransferase? 8. Largemyd Mice as a Model for Therapeutic Approaches to Dystroglycanopathy Acknowledgments References
368 369 370 372 373 374 374 375 376 377 377 378 378 379 381 381 381
Abstract The Large gene encodes a predicted glycosyltransferase of undefined biological activity. However, one important target of the protein is known, a-dystroglycan. This protein is a key component of the dystrophin-associated glycoprotein in skeletal muscle, which links cytoskeletal actin to the extracellular matrix (ECM), stabilizing the muscle sarcolemmal membrane. a-Dystroglycan binds to extracellular proteins such as laminin through a heavily glycosylated mucin-like domain. Functional Large protein is required for full glycosylation and ligandbinding activity of dystroglycan. The role of Large in this pathway was identified Institute of Genetics, School of Biology, Queen’s Medical Centre, University of Nottingham, Nottingham, United Kingdom Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79021-2
#
2010 Elsevier Inc. All rights reserved.
367
368
Jane E. Hewitt
by positional cloning of the mutation in the myodystrophy mouse, an animal model of muscular dystrophy that also has defects in the central and peripheral nervous system and retinal abnormalities. Mice deficient in Large are models for a group of human disorders that have defective a-dystroglycan glycosylation.
1. Overview Three different strains of mice carrying loss-of-function mutations in the Large gene are animal models for a group of congenital muscular dystrophies termed dystroglycanopathies. Dystroglycan is a core member of the dystrophin-associated glycoprotein complex (DGC), which links the muscle cell cytoskeleton to the extracellular matrix (ECM) via dystrophin and acts as a shock absorber protecting the muscle fiber from mechanical damage (Henry and Campbell, 1999). Essential for normal muscle function, dystroglycan also has important roles in a wide range of tissues, including the central and peripheral nervous systems, and in the assembly and maintenance of basement membrane and epithelial structures (Durbeej et al., 1998). Dystroglycan is synthesized as a precursor molecular that is posttranslationally cleaved into a- and b-subunits (Ibraghimov-Beskrovnaya et al., 1993). Within the DGC, the a-subunit is located outside the muscle membrane and binds ECM proteins such as laminin and agrin. a-Dystroglycan is extensively glycosylated, particularly in a central-mucin-like domain that is highly decorated with O-glycans that include unusual O-mannosyl structures. Correct glycosylation of a-dystroglycan is essential for normal function of the protein, in particular its ligand-binding activity, making this system an important paradigm for studying glycan function. The precise structure of the glycans involved in laminin binding is unclear, although O-mannosyl glycans are known to be required. Dissecting the pathways leading to functional glycosylation of a-dystroglycan is pertinent to understanding many human diseases. Recessive mutations in at least six genes (POMT1, POMT2, POMGnT1, Fukutin, FKRP, and LARGE), several of which are known to play a role in synthesis of O-linked mannose structures, result in the failure of dystroglycan to be properly glycosylated and cause genetic forms of muscular dystrophy (reviewed by Muntoni et al., 2004b). a-Dystroglycan also acts as a cellular receptor for several medically important viruses; intriguingly, both viral and ECM binding require the same glycan structures on the protein (Kunz et al., 2005). Finally, many cancers show loss of a-dystroglycan glycosylation, which may be correlated with tumor progression (Sgambato and Brancaccio, 2005). Here, I focus on mouse models that have null mutations, one of the genes that acts in this dystroglycan glycosylation pathway—LARGE. Mice
Mutant Mice for LARGE
369
lacking a functional Large gene do not glycosylate dystroglycan correctly, particularly in skeletal muscle and neuronal tissues, and many aspects of their phenotypes mimic clinical aspects of human dystroglycanopathies.
2. Human LARGE and Relevance to Disease The mouse Large mutants are animal models for a group of human disorders known collectively as dystroglycanopathies. These clinically important, autosomal recessive conditions are caused by mutations in genes that are required for dystroglycan to be functionally glycosylated (Muntoni et al., 2004b). The dystroglycanopathies show overlapping clinical phenotypes (in particular, muscular dystrophy, CNS abnormalities, and eye defects) that are presumed to be primarily due to this deficiency in dystroglycan glycosylation. Although no patients with mutations in dystroglycan have been reported, a patient with a heterozygous deletion of the gene showed CNS abnormalities similar to those seen in some of the dystroglycanopathies (Frost et al., 2010). Several conditional knockouts of dystroglycan have been generated and these recapitulate many tissuespecific aspects of the disorders (Cohn et al., 2002; Moore et al., 2002; Saito et al., 2003; Satz et al., 2008). Although LARGE is necessary for correct glycosylation of a-dystroglycan, compared to other genes in this pathway very few mutations in LARGE have been identified in human patients. While this may in part reflect the difficulty in screening the gene (it is 650 kb), it is probable that mutations in LARGE are rare. However, understanding the functions of LARGE will be relevant to all disorders within this group; first, the considerable overlap in phenotype points to common molecular pathways, and second, overexpression of LARGE is able to rescue defects in other dystroglycanopathy genes and therefore is a potential therapeutic target (Barresi et al., 2004). There are three well-documented cases of patients with causative mutations in LARGE. An individual with a homozygous intragenic, loss-offunction deletion in LARGE presented with Walker–Warburg syndrome, a severe form of dystroglycanopathy (van Reeuwijk et al., 2007). A less severely affected patient was found to be a compound heterozygote for a missense and a truncating mutation (Longman et al., 2003), the milder phenotype may be due to residual function of mutant protein. A third patient was reported to be homozygous for the missense mutation W495R (Mercuri et al., 2009), an evolutionarily invariant residue within one of the putative catalytic domains. Altered glycosylation of dystroglycan is likely to be relevant to other diseases in humans. a-Dystroglycan is a cellular receptor for several
370
Jane E. Hewitt
arenaviruses, including lymphocytic choriomeningitis virus and Lassa fever virus (Cao et al., 1998). LARGE is relevant here because virus binding and infectivity are dependent on the same LARGE-dependent glycan structures as laminin binding (Kunz et al., 2005). Population genetics studies provide strong evidence for positive selection of LARGE during human evolution and this is likely to be related to its role in viral infectivity (Fumagalli et al., 2010; Sabeti et al., 2007). LARGE has a role in development of the CNS and is one of a set of genes identified as candidates for autism by network analysis (van der Zwaag et al., 2009). Thus, it is likely that LARGE has been subjected to a number of selective pressures during evolution. The high population frequency of mutations in other genes in the a-dystroglycan pathway is suggestive of heterozygote advantage, this might be due to a link between reduced glycosylation and increased susceptibility to viral infection (Emery, 2008). The role of dystroglycan in basement membrane and epithelial assembly and its interaction with the ECM pointed toward a possible involvement in tumor progression (Sgambato and Brancaccio, 2005). A number of cancers of epithelial and neural origin show an association between loss of adystroglycan and tumor progression. Furthermore, initial interest in the human LARGE gene was due to its location within a region of chromosome 22 that is often deleted in meningioma (Dumanski et al., 1987; Peyrard et al., 1999). In some tumor cell lines, a-dystroglycan is expressed at normal levels but is not functionally glycosylated, and thus not able to function as an ECM receptor, due to silencing of LARGE (Beltran-Valero de Bernabe´ et al., 2009). Alternatively, decreased a-dystroglycan may be due to loss of other glycosyltransferases that cooperate with LARGE, such as b-3-N-acetylglucosaminyltransferase-1 (Bao et al., 2009).
3. Identification of Mice Carrying Mutations in Large Unlike the other engineered mouse models of dystroglycanopathy discussed in this issue, a loss-of-function mutation in Large was first described as a spontaneous mutation. The myodystrophy (myd ) mutation arose at the Jackson Laboratory in the mid 1970s (Lane et al., 1976). This mutant was initially reported as a model of human muscular dystrophy, the most apparent aspect of the phenotype being a classical progressive myopathy. Homozygous myd mice are unable to splay their high legs when held aloft by the tail, instead clasping them together, accounting for the alternative locus name of ‘‘froggy.’’ However, this is a common characteristic of mice affected by neuromuscular phenotypes and not specific to this particular mutant.
Mutant Mice for LARGE
371
The myd mutant started to attract interest in the late 1990s, because lowresolution synteny mapping data suggested it may be a naturally occurring mouse model of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD), the mutation for which maps to chromosome 4q35 (Mathews et al., 1995; Mills et al., 1995). However, more detailed mapping indicated that myd and FSHD were not due to mutations in homologous genes (Grewal et al., 1998). The high degree of similarity of genome organization between humans and mice enabled a bioinformatics-assisted approach using the near-completion human genome sequence to produce a detailed gene synteny map of the myd locus. Sequencing of candidate genes then identified a loss-of-function mutation within the gene Large (Grewal et al., 2001). As the human orthologue (LARGE) maps to chromosome 22q (Peyrard et al., 1999), this was also conclusive proof that the myd locus was not homologous to FSHD in humans (Grewal and Hewitt, 2002). LARGE (like-acetylglucosaminyltransferase) was so named by Peyrard et al. because of two properties of the gene, the presence of a predicted glycosyltransferase domain in the encoded protein and the size of LARGE at 650 kb. Indeed, it is the biggest gene on human chromosome 22. There are 16 exons with intron sizes ranging from 2 to over 150 kb (Peyrard et al., 1999), although the coding region is only 2 kb. The mouse Large gene is similar in size and structure to human, although there are only 15 exons (Grewal and Hewitt, 2002; Grewal et al., 2005). The myd deletion spans a region of approximately 100 kb and removes exons 4–6, which are equivalent to exons 5–7 in the human gene (Browning et al., 2005; Grewal et al., 2001). This produces a frameshift in the mutant mRNA and formation of a premature stop codon (Fig. 21.1). This mutation is now designated Largemyd. LARGE is highly conserved, with orthologues in almost all animal genomes, including sponges and cnidarians (Grewal et al., 2005). Drosophila is perhaps the most noteworthy exception, although other insects such as bees and wasps do have a LARGE gene (Grewal et al., 2005). Vertebrates have two paralogues, LARGE and LARGE2, that arose from a gene duplication event (Grewal et al., 2005). In mice, only Large is expressed at significant levels in neuronal and muscle tissues. The myd phenotype shows recessive inheritance and homozygous mutant mice have a much-reduced lifespan and reproductive fitness. Therefore, colonies are maintained by crossing heterozygotes. Due to the size of the causative deletion (100 kb), we developed a multiplex PCR assay for genotyping to facilitate identification of heterozygotes (Browning et al., 2005). This assay uses two pairs of primers: one product spans the deletion breakpoints and hence amplifies a product only from the mutant allele, while the other product is deleted in myd and only amplifies the wild-type allele. A typical genotyping result is shown in Fig. 21.2.
372
Jane E. Hewitt
A Wild-type locus B
1
2
3 4 5
6
7 8 9 10 11 12 13 14
15
myd
vls C
enr 160 kb
Figure 21.1 Genomic organization of mutant alleles of Large. A schematic (not to scale) showing the three different mouse mutations that result in loss of function of Large. The mouse gene has 15 exons (the human gene has 16, due to an additional 50 UTR exon) and spans approximately 550 kb. Coding regions are shaded gray; the exon encoding the coiled-coil domain is hatched. In the myd and the vls mutants, the deletions remove exons 4–6 or 3–5, respectively. In both cases, the remaining exons are spliced correctly but the deletion alters the reading frame and introduces a premature stop codon. In the enr mutation, a transgene insertion of many copies of a 1.3 kb segment of the myelin basic protein promoter approximately 160 kb downstream of the coding region (indicated by arrowheads) causes silencing of Large transcription.
3.1. Veils and enr—two additional mutant alleles of Large After the Largemyd mutation was identified, two additional mutant alleles of this gene were reported. Interestingly, both of these were originally investigated due to ocular or peripheral nervous system (PNS) abnormalities. These two tissues, along with skeletal muscle, mirror the main constellation of affected organs in human dystroglycanopathies (Muntoni et al., 2004b). The veils mutation (Largevls) also arose spontaneously. Genetic mapping of vls showed it to be allelic to myd (Lee et al., 2005). The genetic abnormality in the vls mutant is also a genomic deletion that introduces a premature stop codon into the resulting mRNA; in this case removing exons 3–5 (Fig. 21.1). It is possible that the size and genomic properties of the Large gene may predispose it to deletions, and it is noteworthy that one of the few mutations reported in the human LARGE gene is also an intragenic deletion (van Reeuwijk et al., 2007). In contrast to myd and vls, the enr mutation is engineered, arising from a nontargeted transgenic insertion screen using part of the myelin basic protein (MBP) promoter (Kelly et al., 1994). The enr mutant carries a tandem array of an estimated 120 copies of this 1.3 kb MBP promoter segment. Subsequently, this insertion was shown to be located approximately 160 kb downstream of the Large coding region (Levedakou et al., 2005). Mutant enr mice have a neuromuscular phenotype with impaired
373
Mutant Mice for LARGE
–
+/+
+/m
m/m
+/+
m/m
+/m
+/m
m/m
+/+
+/+ 421 bp 162 bp
Control PCRs
Littermates
Figure 21.2 Genotyping the Large mutation. Representative multiplexed PCR results from a set of controls of known genotypes and 1 l of four pups. Both sets of primers were used in the same PCR reaction using 50 ng DNA and an annealing temperature of 59 C. Products were separated on a 3% agarose gel. Primers GT4F and GT4R amplify a 162 bp product from the wild-type allele only, this region is deleted in the mutant. Primers MydF3 and MydR2 amplify a 421 bp product only from the mutant allele (on the wild-type chromosome these primers are separated by 100 kb). Primer sequences: GT4F 50 GGCCGTGTTCCATAAGTTCAA 30 , GT4R 50 GGCATACGCCTCTGTGAAAAC 30 , MydF3 50 ATCTCAGCTCCAAAGGGTGAAG 30 , MydR2 50 GCCAATGTAAAATGAGGGGAAA 30 . myd
peripheral nerve regeneration (Rath et al., 1995). The transgene appears to disrupt or interfere with essential regulatory regions, as expression of Large mRNA is significantly reduced in the mutant (Fig. 21.1). Of the genes in this region, only expression of Large is altered and the myd and enr mutations fail to complement in genetic crosses. Thus, the enr phenotype appears to be entirely due to this downregulation of Large (Levedakou et al., 2005). The similarity in tissue distribution of the phenotypes between all three mutants suggests that the suppression of Large expression is complete in Largeenr mice.
4. Loss of Functional Large Protein Results in Hypoglycosylation of a-Dystroglycan Large is predicted to encode a bifunctional glycosyltransferase, based on two putative catalytic domains with sequence similarity to separate families of glycosyltransferases (Grewal et al., 2001; Peyrard et al., 1999). The first clue to a biological target for the protein came from immunoblot analysis of the DGC, which links the muscle cell cytoskeleton to the ECM via dystrophin. Mutations in components of the DGC are important contributors to inherited muscular dystrophies (Durbeej and Campbell, 2002). In Largemyd mutants, we observed a loss of immunoreactivity of skeletal muscle with the a-dystroglycan monoclonal antibodies VIA41 and IIH6, while other components of the DGC including the b-subunit of dystroglycan appeared to be normal (Grewal et al., 2001). Both VIA41 and IIH6 recognize epitopes that are present only on the fully glycosylated form of the
374
Jane E. Hewitt
protein, suggesting that loss of Large results in aberrant posttranslational modification of a-dystroglycan (Grewal et al., 2001). This hypothesis was confirmed by the demonstration that a polyclonal antibody (GT-20) raised against a hypoglycosylated form of a-dystroglycan recognizes a reduced molecular weight form of the protein in Largemyd mice (Michele et al., 2002). Hypoglycosylation of dystroglycan is not confined to skeletal muscle of the mutant mice, but also seen in cardiac muscle and in both the central and the peripheral nervous systems (Grewal et al., 2001; Michele et al., 2002), tissues that express high levels of Large mRNA. Hypoglycosylation of adystroglycan is similarly observed in both the Largevls and Largeenr mutants (Lee et al., 2005; Levedakou et al., 2005). Hypoglycosylation of a-dystroglycan is also characteristic of dystroglycanopathy patients and is presumed to underlie many or most of the clinical symptoms (Muntoni et al., 2004b).
5. Phenotypes of Mice with Mutations in Large Although initial analyses focused on skeletal muscle, the myd phenotype has been shown to include abnormalities in other tissues, particularly the central nervous system (CNS). In this section I summarize phenotypic data for all three alleles of Large: Largemyd, Largevls, and Largeenr. As each of these have loss-of-function mutations, it is likely that observations in one strain are applicable to the other mutants. However, the severity and phenotypic expression of the mutations are likely to be modified by the genetic background of the particular allele examined.
5.1. Embryonic phenotypes Mice homozygous for Large null mutations are viable, although with a reduced lifespan. In contrast, null mutants of dystroglycan itself (Williamson et al., 1997) or of many of the other genes required for functional glycosylation show very early embryonic lethality (Takeda et al., 2003; Willer et al., 2004). This phenotype is thought to be due to a requirement of functionally glycosylated dystroglycan for basement membrane formation (Takeda et al., 2003; Willer et al., 2004). One possible reason for the viability of Large mutants is the paralogous gene Large2, which may function to glycosylate dystroglycan during early embryonic development (Grewal et al., 2005). Alternatively, glycosylation of dystroglycan by Large may only be essential after birth. During embryogenesis, in situ hybridization indicates that Large expression is confined to neuronal cell types with very little expression in developing muscle (unpublished data).
Mutant Mice for LARGE
375
Despite the apparent normal development of Largemyd mice, in our breeding colony we obtain significantly fewer homozygous mutants than expected (unpublished data). Observation of newborn litters shows that some mutant mice are notably runted, develop hypoxia, and die soon after birth. A similar perinatal phenotype has been described for Fkrp knockdown mice, although in this model no homozygous mutants survive more than 24 h (Ackroyd et al., 2009). At least one of the two engineered mouse mutants for the gene encoding O-linked mannose b1,2N-acetylglucosaminyltransferase-1 (Pomgnt1) also show perinatal lethality with more than 60% homozygotes reported as dying within 3 weeks of birth (Miyagoe-Suzuki et al., 2009). Thus, early postnatal lethality possibly accounts for the observed reduction in viable homozygous Largemyd mutants, although a more detailed analysis of embryonic phenotypes in this mutant is clearly warranted.
5.2. Muscle phenotype The myodystrophy mutant was initially described as a progressive myopathy affecting skeletal and cardiac muscles (Lane et al., 1976; Meier and MacPike, 1977). Largemyd mice show a progressive myopathy in limb and truck muscles, with abnormalities of muscle structure visible by 3 weeks of age. On histological examination, muscle fibers show necrosis and regeneration, with features typical of myopathy, including variation in fiber size and central nuclei (Mathews et al., 1995). There is no fiber-type specificity (Lee et al., 2005). The myopathy is associated with reduced muscle function as the extensor digitorum longus (EDL) muscle in 3–5-month-old Largemyd mice shows significant reductions in both maximum and specific force (Han et al., 2009). Loss of sarcolemmal membrane integrity was demonstrated in skeletal muscle and diaphragm by accumulation of Evans blue dye, which does not cross the normal skeletal muscle membrane (Holzfeind et al., 2002). Electron microscopy shows the basal lamina of muscle fibers to be thin or absent and generally disorganized and often detached from the underlying plasma membrane (Han et al., 2009; Holzfeind et al., 2002). However, in cardiac tissue, the dystrophic phenotype is milder with limited accumulation of Evans blue dye and few signs of muscle abnormalities before the mice are 2-month-old (Holzfeind et al., 2002). Immunohistochemistry, immunoblotting, and sucrose gradient fractionation assays of Largemyd muscle all show that the DGC is intact within the sarcolemmal membrane (Grewal et al., 2001; Han et al., 2009; Holzfeind et al., 2002). In many muscular dystrophies, mutation of one component often results in loss of the whole complex from the sarcolemmal membrane. However, in Large mutants, the DGC is intact but the hypoglycosylated a-dystroglycan produced in the skeletal muscle lacks laminin-binding
376
Jane E. Hewitt
activity. As a consequence, the anchorage between the basal lamina and the sarcolemma membrane is weak and the muscle is prone to damage. Largemyd and Largeenr mice have aberrant neuromuscular junctions (NMJs), with excessive nerve sprouting and an increase in the size of the endplate zone (Herbst et al., 2009; Levedakou and Popko, 2006; Levedakou et al., 2005), indicating that the interaction between a-dystroglycan and the ECM is also important at the NMJ. Electron microscopy showed fewer synaptic folds and abnormal nerve endings at the junctions in Largemyd (Taniguchi et al., 2006). Previous work has demonstrated a role for dystroglycan in maintenance and stability, rather than in establishment of the NMJ (Coˆte´ et al., 1999). Consistent with this model, NMJ abnormalities in Largemyd mice are minor at birth and become more pronounced with age (Herbst et al., 2009).
5.3. Central nervous system In the cortex and cerebellum, the presence of misplaced neurons in Largemyd mice is indicative of defects in the regulation of neuronal migration (Holzfeind et al., 2002; Michele et al., 2002). The glia limitans shows localized disruption as evidenced by discontinuities in laminin, perlecan, and agrin localizations, although these proteins show normal staining at vascular basement membranes (Michele et al., 2002; Rurak et al., 2007). However, there is a failure of targeting of the potassium channel Kir4.1 and the water permeable channel aquaporin 4 (AQP4) to both the glia limitans and the perivascular astrocyte endfeet within the CNS (Michele et al., 2002; Rurak et al., 2007), probably as a consequence of loss of syntrophins from the DGC (Rurak et al., 2007). The precise molecular mechanisms underlying the aberrant neuronal migration are unclear, but are thought likely to include disruption of the basal lamina and/or failure in neuronal–glia interactions (Michele et al., 2002; Qu and Smith, 2005; Qu et al., 2006). A similar pattern of defective neuronal migration is seen in the cortex and cerebellum of Pomgnt1-deficient mice, which also fail to glycosylate a-dystroglycan normally (Lui et al., 2006). Conditional deletion of dystroglycan in the mouse CNS results in a very similar neuronal migration phenotype to that seen in Large mutant mice, consistent with dystroglycan being the primary target for glycosylation by Large (Moore et al., 2002). Neuronal migration defects in these mutants are not confined to the cortex and cerebellum. In both Largemyd and Largevls mice, the basilar pons (a hindbrain nucleus involved in sensory-motor integration) is absent (Litwack et al., 2006; Qu et al., 2006). Instead, there are clusters of ectopic cells expressing markers typical of the pons, again indicating a failure in neuronal migration (Litwack et al., 2006). As pontine neurons do not
Mutant Mice for LARGE
377
associate with the radial glial scaffold, but undergo tangential migration, this suggests roles for Large in other migrational processes in the CNS.
5.4. Peripheral nervous system Early studies provided the first evidence for a defect in the PNS, with description of irregular and nonmyelinated axons in Largemyd mice (Rayburn and Peterson, 1978). Similar abnormalities are seen in Largeenr mice (Levedakou et al., 2005), along with reduced forelimb grip strength and a reduction in nerve conduction velocity. Nerve regeneration following crush injury is also defective in Largeenr mice (Rath et al., 1995). In both Largemyd and Largeenr, sciatic nerve showed reduced staining for both IIH6 and VIA41 monoclonal antibodies but not for core a-dystroglycan antibody (Levedakou et al., 2005). Glycosylation of a-dystroglycan is important for correct laminin interaction and organization of the myelin sheath (Court et al., 2009). Again, the link between the Large mutation and loss of functional a-dystroglycan is supported by the production of similar phenotypes by conditional depletion of the protein in Schwann cells (Saito et al., 2003). However, one difference is that the aberrant sodium channel distribution in the PNS seen in complete dystroglycan knockouts is not present in the Large mutants (Levedakou et al., 2005; Saito et al., 2003), consistent with the view that the b-subunit of dystroglycan is required for sodium channel localization.
5.5. Ocular defects Initial studies did not observe obvious morphological defects in the Largemyd eye (Holzfeind et al., 2002; Michele et al., 2002), although the mice display abnormalities in dark-adapted electroretinographic (ERG) analysis (Holzfeind et al., 2002). Similar ERG abnormalities were subsequently reported by Lee et al. (2005) in both Largemyd and Largevls mutants. Patients with a severe form of dystroglycanopathy (Muscle Eye Brain disease) also show b-wave attenuation (Santavuori et al., 1989). Formation of the photoribbon synapse depends on the interaction between functionally glycosylated a-dystroglycan and the ligand pikachurin (Sato et al., 2008). In contrast to earlier reports, Lee et al. also reported distinctive retinal morphological abnormalities in both Largemyd and Largevls mutants. Indeed, the vls mutant was named because of the presence of ‘‘veil-like’’ fibrous tissue in the vitreous body (Lee et al., 2005). Leakage of fluorescein was observed from retinal vasculature, although the blood vessel basal lamina appeared normal. Other abnormalities included disorganization of astrocytes and the ganglion cell layer (Lee et al., 2005). Within the retina, dystroglycan and other components of the DGC are known to reside in the vasculature, the inner limiting membrane (ILM), and
378
Jane E. Hewitt
the outer plexiform layer (OPL) (Dalloz et al., 2001; Montanaro et al., 1995), all of which show abnormalities in Largemyd and Largevls mutants (Lee et al., 2005). Within the retina, there appear to be differential requirements for glycosylated a-dystroglycan; in the OPL, as in skeletal muscle, the DGC appears to form correctly, but in the ILM the DGC fails to be assembled (Lee et al., 2005). Unlike in the CNS, targeting of the channel proteins Kir4.1 and AQP4 to perivascular astrocyte endfeet is not disrupted in the retina (Rurak et al., 2007). The use of mouse models can therefore highlight tissue-specific differences in dystroglycan function. In most tissues, there is a general similarity in the defects associated with complete loss of dystroglycan, as generated by conditional gene knockouts, and those seen in Large mutants (Cohn et al., 2002; Moore et al., 2002; Saito et al., 2003; Satz et al., 2008). However, there are some subtle differences. Some of these are probably due the fact that in the Large mutants the bdystroglycan subunit is intact and often appears to be targeted correctly while in the conditional mutants both subunits are usually lost. For example, b-dystroglycan rather than a-dystroglycan probably plays a key role in channel localization (Satz et al., 2009). However, it is possible that Large has additional targets for glycosylation, although none have yet been identified.
6. Expression of LARGE Genes By Northern blotting, LARGE is expressed in a wide range of human tissues, with highest levels in brain, skeletal muscle, and heart (Peyrard et al., 1999). Dot blot analysis on a wider selection of human tissue RNA showed a similar distribution (Grewal et al., 2005). Mice have a similar tissue distribution of Large expression to human. The expression of the paralogous gene Large2 is almost completely absent from neuronal tissues and skeletal muscle, but high in epithelial structures (Fujimura et al., 2005; Grewal et al., 2005; Rurak et al., 2007).
6.1. Expression of Large in adult CNS by in situ hybridization Large expression in the adult mouse cerebellum has previously been demonstrated by in situ hybridization, where it was reported to be present in both Purkinje and Bergmann glial cells (Qu and Smith, 2005). Large is also expressed in neurons in the developing hindbrain (Qu et al., 2006). We have also examined expression of Large and the paralogous gene Large2 by in situ hybridization using frozen or wax sections, as described in Rex and Scotting (1999). Briefly, probe templates were generated by PCR and cloned into pGEM T-EASY vector (Promega). Digoxigenin-labeled
Mutant Mice for LARGE
379
antisense probes were produced using a T7/Sp6 labeling kit (Roche). For Large, the probe corresponded to 125–1716 bp of GenBank Accession no. NM_010687. After hybridization overnight at 70 C, sections were washed and bound probe detected using alkaline-phosphatase anti-DIG Fab fragments (Roche), followed by incubation in NBT/BCIP color detection solution for 24–36 h. Control sense probes to the equivalent region gave no staining (not shown). In adult CNS, there is widespread staining for Large expression (Fig. 21.3), while we saw no evidence for Large2 expression, consistent with published RT-PCR data (Fujimura et al., 2005; Grewal et al., 2005; Rurak et al., 2007). In contrast to Qu and Smith (2005), in adult mouse cerebellum, we saw very strong staining for Large in Purkinje cells but no staining in the Bergmann glia. This distribution of Large mRNA in the CNS reflects the pattern of abnormalities seen in Largemyd mice; aberrant neuronal migration in the cortex, cerebellum, and hindbrain; and defects in the dentate gyrus (Holzfeind et al., 2002; Michele et al., 2002). The strong expression in the olfactory bulb, where dystroglycan is also expressed (Zaccaria et al., 2001), suggests that Largemyd mice may also have defects in the olfactory system.
7. Does Large Encode a Functional Glycosyltransferase? Since the discovery of the relationship between Large and functional glycosylation of a-dystroglycan, the biochemical activity of the encoded has been the subject of much interest. Sequence homology is strongly suggestive of an enzymatic function as overexpression of the protein in a wide range of cultured cells results in addition of the IIH6 epitope to dystroglycan (Barresi et al., 2004; Brockington et al., 2005; Fujimura et al., 2005; Grewal et al., 2005; Kanagawa et al., 2009; Patnaik and Stanley, 2005). Therefore, a direct role for the protein as a glycosyltransferase is highly likely, but not yet proven and no in vitro assay system has yet been developed. By using Chinese hamster ovary (CHO) cells that have mutations in specific glycan pathways, it appears that when overexpressed Large can modify either Olinked or N-linked glycans (Aguilan et al., 2009; Patnaik and Stanley, 2005), although the normal in vivo acceptors are generally believed to be Omannose glycans when overexpressed the enzyme is promiscuous in its choice of acceptor glycan. Coexpression of human LARGE and tagged a-dystroglycan constructs in cultured cells demonstrated that amino acids 313–408 within the mucin domain are also necessary (but not sufficient) for induction of the IIH6positive glycan and that this activity requires an interaction between
380
Jane E. Hewitt
A
B CA
DG
C
D
Figure 21.3 In situ hybridization of Large expression in mouse adult brain. Images of representative in situ experiments: Large expression is denoted by blue staining. Scale bar is 50 mm. (A) In the hippocampus Large transcripts were detected in both the granule cell layer of the dentate gyrus (DG) and the pyramidal cell layers of the cornu ammonis (CA), with staining reproducibly weaker in the CA3 region. Many, but not all cells in the cortex also showed Large expression. (B, C) Large expression was strong the Purkinje cell layer of the cerebellum but no staining was visible in granule or Bergmann glial cells. (D) Large expression was widespread in the olfactory bulb.
LARGE and the N-terminal domain of dystroglycan (Kanagawa et al., 2004). LARGE can also interact or cooperate with other glycosyltransferases such as b-3-N-acetylglucosaminyltransferase-1 (Bao et al., 2009). Recently, Yoshida-Moriguchi et al. (2010) in an elegant study showed that treating partially purified a-dystroglycan from mouse muscle with cold aqueous hydrofluoric acid (which cleaves phosphodiester linkages) resulted in a reduction in mass and loss of both the IIH6 epitope and lamininbinding activity. Significantly, similar treatment of a-dystroglycan from Largemyd mice did not result in a mass reduction. Mass spectroscopy and NMR analyses of purified a-dystroglycan produced using a HEK293 expression system identified a phosphorylated O-mannosyl trisaccharide structure (Yoshida-Moriguchi et al., 2010). In skeletal muscle from Largemyd mice, but not controls, a-dystroglycan could be captured by metal affinity chromatography, using beads that bind to monoester- but not diester-linked
Mutant Mice for LARGE
381
phosphorylated compounds. Taken together, this data indicate that Large acts downstream of the formation of this phosphorylated mannose glycan.
8. Largemyd Mice as a Model for Therapeutic Approaches to Dystroglycanopathy Mutants in Large will be useful in vivo systems for assessing therapeutic strategies for dystroglycanopathy. Overexpression of LARGE in vivo using viral vectors was shown to restore IIH6 immunoreactivity and lamininbinding activity to Largemyd skeletal muscle (Barresi et al., 2004). However, despite the demonstration that Large functions in glycosylation of O-mannosyl glycans in vivo (Yoshida-Moriguchi et al., 2010), overexpression of LARGE can also restore functional glycosylation of dystroglycan in cells that lack other glycosyltransferase components of this pathway such as POMT1 or POMGnT1 (Barresi et al., 2004; Kanagawa et al., 2009). Again, this indicates that the protein can act on alternative glycan targets. These proof of principle experiments indicate that increasing LARGE expression or activity, perhaps by small molecule strategies, might be a therapeutic route that is generally applicable to dystroglycanopathies (Muntoni et al., 2004a). There is still much to discover about this enigmatic and fascinating gene.
ACKNOWLEDGMENTS Thanks to Paul Scotting, Jenny McLaughlan, and Jannine Clapp for help with in situ hybridization analysis. Work in the author’s laboratory on the Largemyd mouse mutant has been supported by The Wellcome Trust, The Biotechnology and Biological Sciences Research Council, UK, and The Muscular Dystrophy Association, USA.
REFERENCES Ackroyd, M. R., Skordis, L., Kaluarachchi, M., Godwin, J., Prior, S., Fidanboylu, M., Piercy, R. J., Muntoni, F., and Brown, S. C. (2009). Reduced expression of fukutin related protein in mice results in a model for fukutin related protein associated muscular dystrophies. Brain 132, 439–451. Aguilan, J. T., Sundaram, S., Nieves, E., and Stanley, P. (2009). Mutational and functional analysis of Large in a novel CHO glycosylation mutant. Glycobiology 19, 971–986. Bao, X. F., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumour supressor function of laminin-binding a-dystroglycan requires a distinct 3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Barresi, R., Michele, D. E., Kanagawa, M., Harper, H. A., Dovico, S. A., Satz, J. S., Moore, S. A., Zhang, W., Schachter, H., Dumansk, J. P., Cohn, R. D., Nishino, I.,
382
Jane E. Hewitt
et al. (2004). LARGE can functionally bypass a-dystroglycan glycosylation defect in distinct congenital muscular dystrophy. Nat. Med. 10, 696–703. Beltran-Valero de Bernabe´, D., Inamori, K., Yoshida-Moriguchi, T., Weydert, C. J., Harper, H. A., Willer, T., Henry, M. D., and Campbell, K. P. (2009). Loss of adystroglycan laminin binding in epithelium-derived cancers is caused by silencing of LARGE. J. Biol. Chem. 284, 11279–11284. Brockington, M., Torelli, S., Prandini, P., Boito, C., Dolatshad, N. F., Longman, C., Brown, S. C., and Muntoni, F. (2005). Localization and functional analysis of the LARGE family of glycosyltransferases: significance for muscular dystrophy. Hum. Mol. Genet. 15, 657–665. Browning, C. A., Grewal, P. K., Moore, C. J., and Hewitt, J. E. (2005). A rapid PCR method for genotyping the Largemyd mouse, a model of glycosylation-deficient congenital muscular dystrophy. Neuromuscul. Dis. 15, 331–335. Cao, W., Henry, M. D., Borrow, P., Yamada, H., Elder, J. H., Ravkov, E. V., Nichol, S. T., Compans, R. W., Campbell, K. P., and Oldstone, M. B. A. (1998). Identification of a-dystroglycan as a receptor for lymphocytic choriomeningitis viris and Lassa fever virus. Science 282, 2079–2081. Cohn, R. D., Henry, M. D., Michele, D. E., Barresi, R., Saito, F., Moore, S. A., Flanagan, J. D., Skwarchuk, M. W., Robbins, M. E., Mendell, J. R., Williamson, R. A., and Campbell, K. P. (2002). Disruption of Dag1 in differentiated skeletal muscle reveals a role for dystroglycan in muscle regeneration. Cell 110, 639–648. Coˆte´, P. D., Moukhles, H., Lindebaum, M., and Carbonetto, S. (1999). Chimaeric mice deficient in dystroglycans develop muscular dystrophy and have disrupted myoneural synapses. Nat. Genet. 23, 338–342. Court, F. A., Hewitt, J. E., Davies, K., Patton, B. L., Uncini, A., Wrabetz, L., and Feltri, M. L. (2009). A laminin-2, dystroglycan, utrophin axis is required for compartmentalization and elongation of myelin segments. J. Neurosci. 29, 3908–3919. Dalloz, C., Claudepierre, T., Rodius, F., Mornet, D., Sahel, J., and Rendon, A. (2001). Differential distribution of the members of the dystrophin glycoprotein complex in mouse retina: Effect of the mdx(3Cv) mutation. Mol. Cell Neurosci. 17, 908–920. Dumanski, J. P., Carlbom, E., Collins, V. P., and Nordenskjold, M. (1987). Deletion mapping of a locus on human chromosome 22 involved in the oncogenesis of meningioma. Proc. Natl. Acad. Sci. USA 84, 9275–9279. Durbeej, M., and Campbell, K. P. (2002). Muscular dystrophies involving the dystrophinglycoprotein complex: an overview of current mouse models. Curr. Opion. Genet. Dev. 12, 349–361. Durbeej, M., Henry, M. D., and Campbell, K. P. (1998). Dystroglycan in development and disease. Curr. Opion. Cell Biol. 10, 594–601. Emery, A. E. H. (2008). Resistance to infection and the muscular dystrophies–Is there a molecular link? Neuromuscul. Dis. 18, 423–425. Frost, A. R., Bo¨hm, S. V., Sewduth, R. N., Josifova, D., Ogilvie, C. M., Izatt, L., and Robert, R. G. (2010). Heterozygous deletion of 2Mb region inlcuding the dystroglycan gene in a patient with mild myopathy, facial hypotonia, oral-motor dyspraxia and white matter abnormalies. Eur. J. Hum. Genet. 18, 852–855 Fujimura, K., Sawaki, H., Sakai, T., Hiruma, T., Nakanishi, N., Sato, T., Ohkura, T., and Narimatsu, H. (2005). LARGE2 facilitates the maturation of alpha-dystroglycan more effectively than LARGE. Biochem. Biophys. Res. Comm. 329, 1162–1171. Fumagalli, M., Pozzoli, U., Cagliani, R., Comi, G. P., Bresolin, N., Clerici, M., and Sironi, M. (2010). Genome-wide identification of susceptibility alleles for viral infections through a population genetics approach. PLoS Genet. 6, e1000849. Grewal, P. K., Bolland, D. J., Carim Todd, L., and Hewitt, J. E. (1998). High resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm. Genome. 9, 603–607.
Mutant Mice for LARGE
383
Grewal, P. K., and Hewitt, J. E. (2002). Mutation of Large, which encodes a putative glycosyltransferase, in an animal model of muscular dystrophy. Biochim. Biophys. Acta 1573, 216–224. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of a-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Grewal, P. K., McLaughlan, J. M., Moore, C. J., Browning, C. A., and Hewitt, J. E. (2005). Characterisation of the LARGE family of putative glycosyltransferases associated with dystroglycanopathies. Glycobiology 15, 912–923. Han, H., Kanagawa, M., Yoshida-Moriguchi, T., Rader, E. P., Ng, R. A., Michele, D. E., Muirhead, D. E., Kunz, S., Moore, S. A., Iannaccone, S. T., Miyake, K., McNeil, P. L., et al. (2009). Basal lamina strengthens cell membrane integrity via the laminin G domainbinding motif of a-dystroglycan. Proc. Natl. Acad. Sci. USA 106, 12573–12579. Henry, M. D., and Campbell, K. P. (1999). Dystroglycan inside and out. Curr. Opin. Cell Biol. 11, 602–607. Herbst, R., Iskratsch, T., Unger, E., and Bittner, R. E. (2009). Aberrant development of neuromuscular junctions in glycosylation-defective Large(myd) mice. Neuromuscul. Dis. 19, 366–378. Holzfeind, P. J., Grewal, P. K., Reitsamer, H. A., Kechvar, J., Lassmann, H., Hoeger, H., Hewitt, J. E., and Bittner, R. E. (2002). Skeletal, cardiac and tongue muscle pathology, defective retinal transmission, and neuronal migration defects in the Largemyd mouse defines a natural model for glycosylation-deficient muscle-eye-brain disorders. Hum. Mol. Genet. 11, 2673–2687. Ibraghimov-Beskrovnaya, O., Milatovich, A., Ozcelik, T., Yang, B., Koepnick, K., Francke, U., and Campbell, K. P. (1993). Human dystroglycan: skeletal muscle cDNA, genomic structure, origin of tissue-specific isoforms and chromosomal localization. Hum. Mol. Genet. 2, 1651–1657. Kanagawa, M., Nishimoto, A., Chiyonobu, T., Takeda, S., Miyagoe-Suzuki, Y., Wang, F., Fujikake, N., Taniguchi, M., Lu, Z. P., Tachikawa, M., Nagai, Y., Tashiro, F., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631. Kanagawa, M., Saito, F., Kunz, S., Yoshida-Moriguchi, T., Barresi, R., Kobayashi, Y. M., Muschler, J., Dumanski, J. P., Michele, D. E., Oldstone, M. B., and Campbell, K. P. (2004). Molecular recognition by LARGE is essential for expression of functional dystroglycan. Cell 117, 953–964. Kelly, D., Chancellor, K., Milatovich, A., Francke, U., Suzuki, K., and Popko, B. (1994). Autosomal recessive neuromuscular disorder in a transgenic line. J. Neurosci. 14, 198–207. Kunz, S., Rojek, J. M., Kanagawa, M., Spiropoulou, C. F., Barresi, R., Campbell, K. P., and Oldstone, M. B. (2005). Posttranslational modification of a-dystroglycan, the cellular receptor for arenaviruses, by the glycosyltransferase LARGE is critical for virus binding. J. Virol. 79, 14282–14296. Lane, P. W., Beamer, T. C., and Myers, D. D. (1976). Myodystrophy, a new myopathy on chromosome 8 of the mouse. J. Hered. 67, 135–138. Lee, Y., Kameya, S., Cox, G. A., Hsu, J., Hicks, W., Maddatu, T. R., Smith, R. S., Naggert, J. K., Peachey, N. S., and Nishina, P. M. (2005). Ocular abnormalities in Large(myd) and Large(vls) mice, spontaneous models for muscle, eye, and brain diseases. Mol. Cell Neurosci. 30, 160–172. Levedakou, E. N., Chen, X.-J., Soliven, B., and Popko, B. (2005). Disruption of the mouse Large gene in the enr and myd mutants results in nerve, muscle and neuromuscular defects. Mol. Cell Neurosci. 28, 757–769. Levedakou, E. N., and Popko, B. (2006). Rewiring enervated: Thinking LARGEr than myodystrophy. J. Neurosci. Res. 84, 237–243.
384
Jane E. Hewitt
Litwack, E. D., Lee, Y., and Mallott, J. M. (2006). Absence of the basilar pons in mice lacking a functional Large glycosyltransferase gene suggests a defect in pontine meuron migration. Brain Res. 1117, 12–17. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., et al. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Lui, J., Ball, S. L., Yang, Y., Mei, P. C., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Mathews, K. D., Rapisarda, D., Bailey, H. L., Murray, J. C., Schleper, R. L., and Smith, R. (1995). Phenotypic and pathological evaluation of the myd mouse, a candidate model for facioscapulohumeral dystrophy. J. Neuropath. Exp. Neurol. 54, 601–606. Meier, H., and MacPike, A. D. (1977). Myopathies caused by three mutations of the mouse. J. Hered. 68, 383–385. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G. P., D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A., Boffi, P., Cassandrini, D., et al. (2009). Congenital muscular dystrophies with defective glycosylation of dystroglycan. A population study. Neurology 72, 1802–1809. Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., et al. (2002). Posttranslational disruption of dystroglycan–ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Mills, K. A., Mathews, K. D., Scherpbier-Heddema, T., Schleper, R. L., Schmalzel, R., Bailey, H. L., Nadeau, J. H., Beutow, K. H., and Murray, J. C. (1995). Genetic mapping near the myd locus on mouse chromosome 8. Mamm. Genome 6, 278–280. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009). Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Montanaro, F., Carbonetto, S., Campbell, K. P., and Lindenbaum, M. (1995). Dystroglycan expression in the wild type amd mdx mouse neural retina: synaptic colocalisation with dystrophin, dystrophin-related protein but not with laminin. J. Neurosci. Res. 42, 528–538. Moore, S. A., Saito, F., Chen, J., Michele, D. E., Henry, M. D., Messing, A., Cohn, R. D., Ross-Barta, S. E., Westra, S., Williamson, R. A., Hoshi, T., and Campbell, K. P. (2002). Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 418, 422–425. Muntoni, F., Brockington, M., and Brown, S. C. (2004a). Glycosylation eases muscular dystrophy. Nat. Med. 10, 676–677. Muntoni, F., Brockington, M., Torelli, S., and Brown, S. C. (2004b). Defective glycosylation in congenital muscular dystrophies. Curr. Opin. Neurol. 17, 205–209. Patnaik, S. K., and Stanley, P. (2005). Mouse Large can modify complex N- and mucin Oglycans on a-dystroglycan to induce laminin binding. J. Biol. Chem. 280, 20851–20859. Peyrard, M., Seroussi, E., Sandberg-Nordqvist, A.-C., Xie, Y.-G., Han, F.-Y., Fransson, I., Collins, J., Dunham, I., Kost-Alimova, M., and Imreh, S. (1999). The human LARGE gene from 22q12.3-q13.1 is a new distinct member of the glycosyltransferase gene family. Proc. Natl. Acad. Sci. USA 96, 598–603. Qu, Q., and Smith, F. I. (2005). Neuronal migration defects in cerebellum of the Largemyd mouse are associated with disruption in Bergmann glia organization and delayed migration of granule neurons. Cerebellum 4, 261–270.
Mutant Mice for LARGE
385
Qu, Q., Crandall, J. E., Luo, T., McCaffery, P. J., and Smith, F. I. (2006). Defects in tangential neuronal migration of pontine nuclei neurons in the Largemyd mouse are sssociated with stalled migration in the ventrolateral hindbrain. Eur. J. Neurosci. 23, 2877–2886. Rath, E. M., Kelly, D., Bouldin, T. W., and Popko, B. (1995). Impaired peripheral nerve regeneration in a mutant strain of mice (enr) with a Schwann cell defect. J. Neurosci. 15, 7226–7237. Rayburn, H. B., and Peterson, A. C. (1978). Naked axons in myodystrophic mice. Brain Res. 146, 380–384. Rex, M., and Scotting, S. J. (1999). In situ hybridisation to sections (non-radioactive). In ‘‘Molecular embryology: Methods and Protocols,’’ (P. T. Sharpe and I. Mason, eds.), pp. 645–654, Humana Press. Rurak, J., Noel, G., Lui, L., Joshi, B., and Moukhles, H. (2007). Distribution of potassium ion and water permeable channels at perivascular glia in brain and retina of the Large (myd) mouse. J. Neurochem. 103, 1940–1953. Sabeti, P. C., Varilly, P., Fry, B., Lohmueller, J., Hostetter, E., Cotsapas, C., Xie, X. H., Byrne, E. H., McCarroll, S. A., Gaudet, R., Schaffner, S. F., and Lander, E. S. (2007). Genome-wide detection and characterization of positive selection in human populations. Nature 913–919. Saito, F., Moore, S. A., Barresi, R., Henry, M. D., Messing, A., Ross-Barta, S. E., Cohn, R. D., Williamson, R. A., Sluka, K. A., Sherman, D. L., Brophy, P. J., Schmelzer, J. D., et al. (2003). Unique role of dystroglycan in peripheral nerve myelination, nodal structure and sodium channel stabilization. Neuron 38, 747–758. Santavuori, P., Somer, H., Sainio, K., Rapola, J., Kruus, S., Nikitin, T., Ketonen, L., and Leisti, J. (1989). Muscle-eye-brain disease (MEB). Brain Dev. 11, 147–153. Sato, S., Omori, Y., Katoh, K., Kondo, M., Kanagawa, M., Miyata, K. K. F., Koyasu, T., Kajimura, N., Miyoshi, T., Sawai, H., Kobayashi, K., Tani, A., et al. (2008). Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nat. Neurosci 11, 923–931. Satz, J. S., Barresi, R., Durbeej, M., Willer, T., Turner, A., Moore, S. A., and Campbell, K. P. (2008). Brain and eye malformations resembling Walker-Warburg Syndrome are recapitulated in mice by dystroglycan deletion in the epiblast. J. Neurosci. 28, 10567–10575. Satz, J. S., Philp, A. R., Nguyen, H., Kusano, H., Lee, J., Turk, R., Riker, M. J., Herna´ndez, J., Weiss, R. M., Anderson, M. G., Mullins, R. F., Moore, S. A., et al. (2009). Visual impairment in the absence of dystroglycan. J. Neurosci. 29, 13136–13146. Sgambato, A., and Brancaccio, A. (2005). The dystroglycan complex: From biology to cancer. J. Cell Physiol. 205, 163–169. Takeda, S., Kondo, M., Sasaki, J., Kurahasi, H., Kano, H., Arai, K., Misaki, K., Fukui, T., Kobayashi, K., Tachikawa, M., Imamura, M., Nakamura, Y., et al. (2003). Fukutin is required for maintenance of muscle integrity, cortical histiogenesis and normal eye development. Hum. Mol. Genet. 12, 1449–1459. Taniguchi, M., Kurahashi, H., Noguchi, S., Fukudome, T., Okinaga, T., Tsukahara, T., Tajima, Y., Ozono, K., Nishino, I., Nonaka, I., and Toda, T. (2006). Aberrant neuromuscular junctions and delayed terminal muscle fiber maturation in a-dystroglycanopathies. Hum. Mol. Genet. 15, 1279–1289. van der Zwaag, B., Franke, L., Poot, M., Hochstenbach, R., Spierenburg, H. A., Vorstman, J. A. S., Daalen, E., de Jonge, M. V., Verbeek, N. E., Brilstra, E. H., van ’t Slot, R., Ophoff, R. A., et al. (2009). Gene-network analysis identifies susceptibility genes related to glycobiology in autism. PLoS ONE 4, e5324. van Reeuwijk, J., Grewal, P. K., Salih, M. A. M., de Bernabe, D. B. V., McLaughlan, J. M., Michielse, C. B., Herrmann, R., Hewitt, J. E., Steinbrecher, A., Seidahmed, M. Z.,
386
Jane E. Hewitt
Shaheed, M. M., Abomelha, A., et al. (2007). Intragenic deletion in the LARGE gene causes Walker–Warburg syndrome. Hum. Genet. 121, 685–690. Willer, T., Prados, B., Falco´n-Pe´rez, J. M., Renner-Mu¨ller, I., Przemeck, G. K. H., Lommel, M., Coloma, A., Valero, M. C., Hrabe´ de Angelis, M., Tanner, W., Wolf, E., Strahl, S., et al. (2004). Targeted disruption of the Walker–Warburg syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Williamson, R. A., Henry, M. D., Daniels, K. J., Hrstka, R. F., Lee, C. J., Sunada, Y., Ibraghimov-Beskrovnaya, O., and Campbell, K. P. (1997). Dystroglycan is essential for early embryonic development: disruption of Reichart’s membrane in Dag1-null mice. Hum. Mol. Genet. 6, 831–841. Yoshida-Moriguchi, T., Liping, Y., Stainaker, S. H., Davis, S., Kunz, S., Madson, M., Oldstone, M. B. A., Schachter, H., Wells, L., and Campbell, K. P. (2010). O-mannosyl phosphorylation of alpha-dystroglycan is required for laminin binding. Science 327, 88–92. Zaccaria, M. L., Di Tommaso, F., Brancaccio, A., Paggi, P., and Petrucci, T. C. (2001). Dystroglycan distribution in adult mouse brain: A light and electron microscopy study. Neuroscience 104, 311–324.
C H A P T E R
T W E N T Y- T W O
A Tumor Suppressor Function of Laminin-Binding a-Dystroglycan Xingfeng Bao and Minoru Fukuda Contents 388 389 389 390 392 393 394 395 395
1. Background 2. Methods 2.1. Cell sorting and flow cytometry 2.2. Laminin-binding assay 2.3. Colony formation assay 2.4. Tumor invasion assay 2.5. Orthotopic prostate tumor formation Acknowledgment References
Abstract Interaction of epithelial cells with basement membrane (BM) is mediated by celladhesion molecules, which regulate cell proliferation, motility, and differentiation by integrating signals from extracellular matrix and soluble factors. a-Dystroglycan (a-DG) is one of the most important adhesion molecules in epithelial cell–BM interaction. a-DG serves as the cell surface receptor for several major BM proteins, including laminin, perlecan, and agrin. The laminin G-like domain in all these proteins binds to a unique glycan structure, so-called laminin-binding glycan, attached to a-DG with high affinity. Formation of the laminin-binding glycan is required for the BM assembly, and loss or deficiency of the glycan causes muscular dystrophy. We studied the role of this a-DG-specific glycan modification in tumor development, and identified a tumor suppressor function of the laminin-binding a-DG. In this chapter, we describe methods used to isolate the cell populations from human prostate cancer cell line PC3 and characterize their potentials in tumor formation and metastasis in vitro and in vivo.
Sanford-Burnham Medical Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79022-4
#
2010 Elsevier Inc. All rights reserved.
387
388
Xingfeng Bao and Minoru Fukuda
1. Background Epithelial cells normally form a monolayer on a unique extracellular matrix called basement membrane (BM). The interaction between epithelial cells and the BM is often abnormal or disrupted in malignant tumor (Bhowmick et al., 2004; Taddei et al., 2008; White et al., 2004). BM is generally thought to form the physical barrier for the tumor development, but the mechanisms underlying this general phenomenon remain unclear. One of the most important epithelial cell–BM interactions is mediated by a-dystroglycan (a-DG), which functions a cell receptor for multiple BM proteins, including laminin, perlecan, and agrin (Barresi and Campbell, 2006). All these extracelluar proteins bind to a-DG through a unique glycan, so-called laminin-binding glycan. The glycan modification specifically modifies a-DG and has been shown to be required for the BM assembly in the early embryonic stage in mice (Willer et al., 2004). a-DG is highly glycosylated and contains both N-linked glycans and mucin type O-glycans. The mucin type O-glycans are clustered in a mucinlike domain at the N-terminal of mature a-DG, which include unique O-mannosyl glycans with or without phosphate modification (Chiba et al., 1997; Yoshida-Moriguchi et al., 2010). Defects in the O-mannosyl glycans have been shown to cause muscular dystrophy (Martin, 2007). Seven glycosyltranferase or glycosyltransferase-like genes, including POMT1, POMT2, POMGnT1, Fukutin, Fukutin-related protein, LARGE, and LAEGE2, have been shown to be involved in the formation or presentation of the laminin-binding glycan on a-DG since mutations of these genes lead to a group of congenital muscular dystrophy called dystroglycanopathy (Martin, 2007; Muntoni et al., 2008), which is characterized by a loss or reduction of the glycan presentation. Recently, we show that a unique b3N-acetylglucosaminyltransferase, b3GnT1, participate in the formation of the laminin-binding glycan through formation of a complex with LARGE or LARGE2, thus regulating the function of LARGE/LARGE2 (Bao et al., 2009). Transcripts of b3GnT1 positively correlates with the expression levels of laminin-binding glycan on a-DG in many human prostate and breast cancer cell lines. Despite a critical function of a-DG glycosylation in the muscular system, not much is known about cancer development. Recent reports have shown that defects of a-DG are associated with breast, colon, oral, and prostate carcinomas (Muschler et al., 2002; Jing et al., 2004; Sgambato et al., 2007). However, the mechanistic link between a-DG defects seen in various carcinomas and tumor progression is not known. By studying the tumor progression properties of two subpopulations of PC3 cells, we identified a tumor suppressor function of the unique laminin-binding a-DG. In this
a-Dystroglycan and Tumorigeneity
389
chapter, we describe methods used to isolate the cell populations from human prostate cancer cell line PC3 and characterize their potentials in tumor formation and metastasis in vitro and in vivo.
2. Methods 2.1. Cell sorting and flow cytometry Many cancer cell lines widely used for cancer research are known to be heterogeneous (Weiss, 2000). Cell sorting that is based on the specific antigen presentation is an efficient way to isolate subclones of the parent cancer cell line. While we were studying the laminin-binding glycan expression on various human prostate and breast cancer cell lines, we noticed that human prostate cancer cell line PC3 contain two populations which express different amounts of a-DG laminin-binding glycan, visualized by monoclonal antibody IIH6 (Upstate) staining. To separate the subpopulations of PC3 cells, cells were harvested using enzyme-free dissociation buffer (Invitrogen), and the monodispersed cells were incubated with mAb IIH6 diluted at 1:100 in PBS containing 1% bovine serum albumin (BSA) on ice for 1 h, followed by Alexa488-conjugated goat anti-mouse IgM m chain specific (Invitrogen) with a dilution of 1:100 in the same buffer. After 30 min incubation with the secondary antibody, the cells were sorted by FACSVantage sort, enhanced (BD) into IIH6 high expressor (PC3-H) and low expressor (PC3-L) as shown in Fig. 22.1. The resultant cells were propagated and subjected for further characterization. To characterize the sorted cells, both near confluent PC3-H and PC3-L cells were harvested as described above and incubated with antibodies that recognize the laminin-binding glycan moiety (VIA4-1 (Upstate) and IIH6 epitopes), the a-DG core protein 6C1 (Calbiochem), and PC3 cell surface markers CD44 (BD PharMingen) and CD16 (BD PharMingen) and a6 and b1 integrins (BD PharMingen), respectively. After 1 h incubation on ice, the cells were washed with PBS containing 0.1% BSA twice and further incubated with the FITC or Alexa488-conjugated secondary antibodies as described above. The stained cells were analyzed by FACSsort (BD) equipped with a Cellquest software (BD). For controls, the primary antibody was omitted. Figure 22.1 shows the FACS analysis results for the parent PC3 cells and the subpopulations (PC3-H and PC3-L). Notably, PC3-L and PC3-H differ specifically in the cell surface expression of laminin-binding glycan as visualized by mAbs VIA4-1 and IIH6. Both populations express equivalent amounts of a-DG core protein and PC3 cell markers CD44 and CD16, and the a6 and b1 integrin receptors. While using cell sorting approach to isolate the subpopulations of a certain cancer cell line, one needs to be cautious. Further careful characterization of
390
Xingfeng Bao and Minoru Fukuda
a-DG glycan IIH6
VIA4-1 PC3-L
PC3 100
IIH6
60
H L
40
PC3-H
Counts
80
20 0 100
101 102 103 104 Fluorescence intensity
Fluorescence intensity a-DG core
PC3 cell marker CD16
CD44
LN-111 receptor a 6-integrin
b1-integrin
PC3-H
PC3-L
6C1
Fluorescence intensity
Figure 22.1 Isolation and characterization of two cell populations with distinct lamininbinding glycan expression from PC3 cells. PC3 cells were sorted into to two fractions (donated as H and L) as indicated according to the IIH6 epitope expression. Flow cytometric analysis shows that the propagated PC3-H express high level of lamininbinding glycan, which is recognized by mAbs IIH6 and VIA4-1, while the PC3-L barely display these glycan epitopes at cell surface. Both PC3-H and PC3-L have equivalent expression for a-dystroglycan core (6C1), PC3 cell markers CD44 and CD16, and a6 and b1-integrins. (Partly adapted from Bao et al., 2009).
the isolated cell populations are required to confirm: (1) the isolated cells are not contaminated cells of the parent cell line and (2) the molecular phenotype does not change after many times passengers during cell culture. Only after these confirmations, the isolated cells will be useful for further study.
2.2. Laminin-binding assay Laminin is a group of proteins that are composed of a distinct composition of three laminin chains, a, b, and g (Larsen et al., 2006). They play critical roles in tissue organization, cell survival, proliferation, and migration during
391
a-Dystroglycan and Tumorigeneity
development. Laminin 111, which consists of each one a, b, and g chain, is a major protein of BM and the most abundant laminin isoform there. Epithelial cells secret laminin 111 that polymerizes at the cell surface and forms a network together with other extracellular proteins such as collagens and proteoglycans. Binding and extensive polymerization of soluble laminin 111 depends on the cell surface receptors, including a-DG (Barresi et al., 2004). Cells were cultured on glass coverslips in 6 cm dish with 10% FBScontaining RPMI-1640 at 37 C till confluency. The conditional medium was removed by aspiration and rinsed with PBS twice. Serum-free OPTIMEM I medium (Invitrogen) with or without mouse laminin 111 at a dose of 10 mg/ml was added to the cell culture. After additional 2-h culture, the medium was removed and the cells were fixed with 2% PFA for 30 min at room temperature. The fixed cells were then sequentially treated with 2% normal goat serum in PBS (blocking buffer) for 30 min, rabbit anti-pan-laminin antibody (Genetics) with a dilution of 1:100 for 60 min, biotinylated goat anti-rabbit IgG (Vector, 1:100) for 60 min, and Rhodamine-conjugated avidin (Vector, 1:100) for 30 min. Antibodies were all diluted in the blocking buffer for the incubation. The fluorescence-stained cells were finally incubated with Holchest (1:1000) for 5 min to stain the nucleus and analyzed with fluorescence microscopy. Figure 22.2 shows the immunofluorescence staining of the cell-bound laminin 111 on PC3-L and PC3-H. Soluble laminin 111 quickly bind to cell surface with a subsequent auto polymerization. This assay was designed to visualize the quick binding of laminin 111 from the culture medium, and a longer incubation time such as 12 h is required if an extensive polymerization is desired. Notably, the staining protocol does not distinguish the endogenous laminin from the exogenous one. Though the exogenously
PC3-L + Laminin 111
PC3-H No laminin 111
+ Laminin 111
Figure 22.2 Laminin-binding assay. Near confluent cells growing on glass coverslips were cultured with serum-free medium with or without 10 mg/ml mouse laminin 111 at 37 C for 2 h. Culture medium was then removed and the cells were fixed with 2% PFA and subjected to staining with rabbit anti-pan-laminin antibody followed by Alexa594-conjugared secondary antibody. Assay with omission of laminin 111 was run and shown here.
392
Xingfeng Bao and Minoru Fukuda
added laminin 111 is usually much more than the endogenous, caution is needed in this assay particularly when the cells of interest express high level of laminin 111.
2.3. Colony formation assay Colony formation assay is a method to evaluate the adhesion-independent cell proliferation of cancer cells. Single tumorigenic cell with a high proliferation rate forms colonies in the soft agar plate in a few weeks. To compare the cell growth of PC3 subpopulations in the adhesion-independent condition, colony formation assay was performed as below: 1. Melt 1% Agar (Difco Laboratories) in serum-free RPMI-1640 medium with microwave and cool to 40 C in a water bath. Warm RPMI-1640 medium containing 20% fetal bovine serum (FBS) to 40 C in the water bath. Allow at least 15 min for temperature to equilibrate. 2. Mix equal volumes of the two solutions to give 0.5% Agar þ 10% FBS in RPMI. 3. Add 1.5 ml of the mixture to 3.5 cm Petri dish and allow to set. The plates can be used immediately or stored at 4 C for up to 1 week. 4. Melt 0.8% Agar in serum-free RPMI-1640 in microwave and cool to 40 C in a water bath. (It is important not to exceed 40 C, otherwise cells may be killed.) Also, warm 20% FBS containing RPMI-1640 to the same temperature. 5. Trypsinze cells and count. Reconstitute cells with RPMI-1640 to make 100,000 cells/ml. 6. Add 100 ml of cell suspension, which contain 10,000 cells, to a 10 ml tube. 7. Add 3 ml of 0.8% Agar solution and 3 ml of 20% FBS containing RPMI-1640 to the tube and mix gently. Add 1.5 ml of the mixture to each replicate plate. Only handle one tube at a time so that agar does not set prematurely. 8. Incubate the plates at 37 C in humidified incubator for 2–3 weeks. It is wise to monitor the colony growth by looking at the plates every other day. 9. Stain plates by adding 0.5 ml of 0.005% of crystal violet (Sigma) at room temperature for over 1 h or 4 C for overnight. 10. The stained colonies were photographed under light microscopy and the pictures were analyzed by Adobe Photoshop (Adobe Systems). Figure 22.3 shows the stained colonies formed by PC3-H and PC3-L. In this protocol, no difference in the number and size was detected for the colonies formed by both cell populations. Since cells differ greatly in their growth, the optimal culture time for each cell line is different and should be determined experimentally. Notably, this assay model can also be used for assay the effectiveness of pharmaceutics in suppression or promotion of cancer cell growth under adhesion-independent manner.
393
a-Dystroglycan and Tumorigeneity
PC3-L
PC3-H
Figure 22.3 Coloney formation assay. Monodispersed cells (n ¼ 5000) were mixed with 0.4% agar in RPMI-1640 medium containing 10% (v/v) FBS and placed on the bottom gel containing 0.5% agar and medium in 35-mm dish. Cells were cultured for 2 weeks at 37 C and then stained with crystal violet overnight; bar, 1.0 mm.
2.4. Tumor invasion assay Cancer cell invasiveness is a characteristic of malignant tumor. The invasive carcinomas are able to break the surrounding BM and therefore further form metastasis to other organs. The in vitro invasion assay is to measure the ability of cancer cells to break the intact BM structure. To compare the invasion potential of PC3 cells and their subpopulations PC3-H and PC3-L cells, a Boyden transwell chamber (Calbiochem) was used. Each chamber includes a bottom well and an insert. The upper surface of the insert was precoated with reconstituted BM extracts, which include extracellular matrix proteins and various growth factors. 1. Bring the transwell plate to the cell culture hood and equilibrate to room temperature. Add 100 ml of serum-free RPMI-1640 medium to the insert. 2. Cells were harvested by enzyme-free cell dissociation buffer (Invitrogen) and reconstituted with serum-free RPMI-1640 to make a cell suspension of 8 105 cells/ml. 3. Remove the medium in the insert by drain on tissue, and add 300 ml of the cell suspension to the upper chamber of the insert. 4. Fill the bottom chamber with 300 ml serum-free RPMI-1640 medium and incubate the plate at 37 C for 24 h. 5. Remove the insert from the bottom well and wipe the upper surface of the insert with a cotton-topped stick. 6. Put the insert into a well containing 0.5% crystal violet in 20% ethanol and stain for 30 min. 7. Dip the stained insert into distilled water several times to wash out the free dyes on the membrane. 8. Dry the insert at room temperature, cut the membrane, and mount it on a glass slide for light microscopy analysis. The results in each well is the
394
Xingfeng Bao and Minoru Fukuda
PC3
PC3-H
PC3-L
Figure 22.4 Cell invasion assay. A suspension of monodispersed cells (n ¼ 2.4 105) in 300 ml of serum-free RPMI-1640 medium was seeded to the insert of a Boyden transwell chamber (Calbiochem). The bottom chamber was filled with serum-free medium too. After a 24 h culture at 37 C, the cells that migrated to bottom surface of the insert were stained with crystal violet and photographed under a light microscopy; bar, 500 mm.
mean cell number of 4–8 randomly selected high magnification fields from duplicate or triplicate experiments. Figure 22.4 shows the stained cells that migrated through the reconstituted BM precoated on a membrane with 8 mm pores. In this assay, PC3-L displayed a higher invasion potential than PC3-H and the parental PC3 cells. Since cells differ substantially in invasion potential, the optimal cell number and incubation time of specific cell lines are different and should be determined experimentally. Notably, cell dissociation by the enzyme-free buffer is preferred particularly in assaying the function of cell surface molecules in invasion against BM.
2.5. Orthotopic prostate tumor formation Orthotopic prostate tumor formation assay is to assess the in vivo activities of growth and metastasis of cancer cells in the prostates of immunocompromised mice. SCID mice were used in this assay because of the severe immunocompromised property. We describe the general procedure here and the detailed surgical protocols are described in Chapter 23. PC3 cells were harvested using enzyme-free cell dissociation buffer (Invitrogen) and suspended in serum-free RPMI-1640 medium. Two million cells at a volume of 20 ml were inoculated into the posterior lobe of the mouse prostate and the wound was closed with surgical clips. Four to seven weeks later, mice were killed, and prostates and prostate surrounding lymph nodes were dissected and weighted. Figure 22.5 shows the prostates (left panels) and their drain lymph nodes (right panels) of SCID mice, which were inoculated with parental PC3 cells and their subpopulations PC3-H and PC3-L. In this assay, PC3 exhibited a
395
a-Dystroglycan and Tumorigeneity
Prostate
Lymph nodes
PC3 PC3-H PC3-L
Figure 22.5 Orthotopic tumor formation assay. Two millions of monodispersed cells in 20 ml serum-free RPMI-1640 medium were inoculated into the posterior lobe of the prostates of immunocompromised SCID mice, and the wound was closed by surgical clips. Seven week later, mice were killed, and the prostate and the prostate drain lymph nodes were dissected and photographed; bar, 1.0 cm.
higher tumor growth and metastasis to lymph nodes. PC3 cells grow aggressively in vivo. Three weeks after cell inoculation, the tumors were already touchable in the lower abdomen, and 6–7 week later, mice are apparently sick because of the heavy tumor burden. Analysis of clones or subpopulations from a parent cell line with distinct expression of glycan structures allows us to evaluate the function of specific glycans in various biological systems. By studying the in vitro and in vivo tumor formation of the two PC3 cell subpopulations, PC3-L and PC3-H, we show here a negative correlation between the a-DG laminin-binding glycan expression and the cell invasion and tumor progression capability. Further analysis using genetic manipulation approach would allow a better define of the role of a-DG in tumor development.
ACKNOWLEDGMENT This work was supported by NIH grants CA48737 (M.F.) and CA71932 (M.F.).
REFERENCES Bao, X., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumor suppressor function of laminin-binding a-dystroglycan requires a distinct b3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Barresi, R., Michele, D. E., Kanagawa, M., Harper, H. A., Dovico, S. A., Satz, J. S., Moore, S. A., Zhang, W., Schachter, H., Dumanski, J. P., Cohn, R. D., Nishino, I., and Campbell, K. P. (2004). LARGE can functionally bypass alpha-dystroglycan glycosylation defects in distinct congenital muscular dystrophies. Nat. Med. 10, 696–703. Barresi, R., and Campbell, K. P. (2006). Dystroglycan: From biosynthesis to patjogenesis of human disease. J. Cell Sci. 119, 199–207.
396
Xingfeng Bao and Minoru Fukuda
Bhowmick, N. A., Neilson, E. G., and Morse, H. L. (2004). Stromal fibroblasts in cancer initiation and progression. Nature 432, 332–337. Chiba, A., Matsumura, K., Yamada, H., Inazu, T., Shimizu, T., Kusunoki, S., Kanazawa, I., Kobata, A., and Endo, T. (1997). Structures of sialylated O-linked oligosaccharides of bovine peripheral nerve alpha-dystroglycan. The role of a novel O-mannosyl-type oligosaccharide in the binding of alpha-dystroglycan with laminin. J. Biol. Chem. 272, 2156–2162. Jing, J., Lien, C. F., Sharma, S., Rice, J., Brennan, P. A., and Gorecki, D. C. (2004). Aberrant expression, processing and degradation of dystroglycan in squamous cell carcinomas. Eur. J. Cancer 40, 2143–2151. Larsen, M., Artym, V. V., Gree, J. A., and Yamada, K. M. (2006). The matrix reorganized: Extracellular matrix remodeling and integrin signaling. Curr. Opin. Cell Biol. 18, 463–471. Martin, P. T. (2007). Congenital muscular dystrophies involving the O-mannose pathway. Curr. Mol. Med. 7, 417–425. Muntoni, F., Torelli, S., and Brockington, M. (2008). Muscular dystrophies due to glycosylation defects in distinct congenital muscular dystrophies. Nat. Med. 10, 696–703. Muschler, J., Levy, D., Boudreau, R., Henry, M., Campbell, K., and Bissell, M. J. (2002). A role for dystroglycan in epithelial polarization: Loss of function in breast tumor cells. Cancer Res. 62, 7102–7109. Sgambato, A., de Paola, B., Migaldi, M., Di Salvatore, M., Rettino, A., Rossi, G., Faraglia, B., Boninsegna, A., Mariorana, A., and Cittadini, A. (2007). Dystroglycan expression is reduced during prostate tumorigenesis and is regulated by androgens in prostate cancer cells. J. Cell Physiol. 213, 528–539. Taddei, I., Deugnier, M. A., Faraldo, M. A., Petit, V., Bauvard, D., Medina, D., Fassler, R., Thiery, J. P., and Glukhova, M. A. (2008). Beta1 integrin deletion from the basal compartment of the mammary epithelium affects stem cells. Nat. Cell Biol. 10, 716–722. Weiss, L. (2000). Cancer cell heterogeneity. Cancer Metastasis Rev. 19, 345–350. White, D. E., Kurpios, N. A., Zuo, D., Hassell, J. A., Blaess, S., Mueller, U., and Muller, W. J. (2004). Targeted disruption of b1-integrin in a transgenic mouse model of human breast cancer reveals an essential role in mammary tumor induction. Cancer Cells 6, 159–170. Willer, T., Prados, B., Falcon-Perez, J. M., Renner-Muller, I., Przemeck, G. K., Lommel, M., Coloma, A., Valero, M. C., de Angelis, M. H., Tanner, W., Wolf, E., Straul, S., et al. (2004). Targeted disruption of the Walker–Warburg Syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Yoshida-Moriguchi, T., Yu, L., Stalnaker, S. H., Davis, S., Kunz, S., Madson, M., Oldstone, M. B., Schachter, H., Wells, L., and Campbell, K. P. (2010). O-Mannosyl phosphoryaltion of alpha-dystroglycan is required for laminin-binding. Science 327, 88–92.
C H A P T E R
T W E N T Y- T H R E E
Tumor Formation Assays Shingo Hatakeyama,* Hayato Yamamoto,* and Chikara Ohyama† Contents 398 399 399 399 401 401 403 405 407 408 408 411 411
1. Overview 2. Animal Care and Protocol Approval 3. Disinfection of Mice 4. Analgesia and Anesthesia in Mice 5. IP Injection 6. IV Injection into the Tail Vein 7. IV Tumor Formation Assay Using Immune-Deficiency Mice 8. SC Inoculation 9. FP Inoculation 10. Testicular Inoculation 11. Prostate Inoculation Acknowledgment References
Abstract Animal experiments are necessary to confirm and demonstrate the reliability of the results of in vitro assays and to reveal any unexpected effects in the living body. Tumor invasion and metastasis consist of multistep and complex cascades. Moreover, conflictive interactions between cancer cells and host immune system exist in the living body. Therefore, tumor formation assay is an essential technique in tumor biology. Methods used in tumor formation assay include injection and inoculation, and considerable skill is required to perform these basic techniques. Injections and inoculations are categorized according to the target site: intraperitoneal (IP), intravenous (IV), subcutaneous (SC), footpad (FP), and targeted organ inoculation. Tumor cell injections and inoculations are standard methods for the evaluation of the malignant potential of cancer cells. IP injection is a useful and uncomplicated method for drug administration, SC inoculation is used to evaluate tumor growth and size, FP inoculation to estimate lymph nodule metastasis, and IV injection into the tail vein to evaluate the metastatic potential for lung colonization. Using immune-deficiency mice,
* Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Department of Urology, School of Medicine, Hirosaki Graduate University, Hirosaki, Japan
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79023-6
#
2010 Elsevier Inc. All rights reserved.
397
398
Shingo Hatakeyama et al.
we can address possible roles of carbohydrate antigens against host immune system. In this chapter, we describe details of the materials and methods that can be used for injection (IP and IV) and inoculation (SC, FP, testis, and prostate) in mice.
1. Overview The most important aspects of animal experiments are handling and restraint. Because handling animals can be difficult, repeated practice is essential if reproducible results are to be obtained. The common methods for catching and picking up mice are grasping the animal near the base of tail and grasping the skin at the back of the neck. For additional restraint, the loose skin at the back of the neck is grasped and then the tail is held between the fourth and fifth fingers. If the skin is grasped too far from the head, the mouse will turn and bite the handler. The mouse must be held firmly but gently (Fig. 23.1A). Methods commonly used in studies on mice are injection and inoculation. Injections and inoculations are categorized according to the target site: intraperitoneal (IP), intravenous (IV), subcutaneous (SC), footpad (FP), and targeted organ inoculation.
Figure 23.1 Handling and restraint of mice. (A) Common methods of restraint when handling mice. The loose skin at the back of the neck is grasped and then the tail is held between the fourth and fifth fingers. If this is not done correctly the mouse will bite the handler. (B) Restraint devices suitable for IV tail vein injection and for holding mice for longer periods of time. Left, 28-gauge needle; middle, commercially available restraint device; Right, homemade restraint device for small mice.
Handling and Tumor Formation Assays in Mice
399
Tumor cell injections and inoculations are standard methods for evaluating the malignant potential of cancer cells. IP injection is a useful and uncomplicated method of drug administration (Minagawa et al., 2005), SC inoculation can be used to evaluate tumor growth and size (Lee et al., 2009; Watanabe et al., 2002), FP inoculation to estimate lymph nodule metastasis (Chen et al., 2005), and IV injection into the tail vein to evaluate the metastatic potential for lung colonization (Ohyama et al., 1999, 2002). Orthotopic and heterotopic inoculations into target organ are common methods of evaluating tumor size. Generally, orthotopic inoculation of tumor cells into the same organ as that from which the cells were derived will be acceptable when evaluating their malignant potential, but heterotopic inoculation is also acceptable if there are anatomical limitations of experiments or if there is technical difficulty. We have described orthotopic testicular inoculation (Hatakeyama et al., 2004) and prostate inoculation (Bao et al., 2009; Hagisawa et al., 2005; Inaba et al., 2003) for tumor formation in mice.
2. Animal Care and Protocol Approval Animal care and pain management using anesthesia and analgesia are crucial components in protocols for animal use. All experiments must conform to the Principles of Laboratory Animal Care and the Guide for Care and Use of Laboratory Animals. Animal experiment protocols should be approved by the institutional animal care and use committee.
3. Disinfection of Mice In order to prevent bacterial infection, all invasive procedures should be clean, especially when immunodeficient mice are being used. Before attempting to introduce any instrument or agent into an animal’s body, the injection or inoculation site should be cleaned and disinfected with 70% ethanol or an antiseptic agent.
4. Analgesia and Anesthesia in Mice Standard agents are described in Table 23.1 (Hawk et al., 2005). Injectable analgesics and anesthetics are appropriate for animal experiments. However, careful observation is necessary because there is variation in the depth and duration of the effects of agents among strains and individual animals.
400
Shingo Hatakeyama et al.
Table 23.1 Standard analgesic and anesthetic agents for mice
Anesthetics agent
Dosage of administration
Duration of anesthesia
Pentobarbital Tribromoethanol (Avertin) Metomidate/fentanyl Ketamine/xylazine Analgesics agent Buprenorphine Meloxicam Flunixin meglumine
50–75 mg/kg, IP 250 mg/kg, IP 60 mg/kg þ 0.06 mg/kg, SC 80–100 mg/kg þ 10 mg/kg, IP
20–40 min 15–30 min 20–30 min 20–30 min
0.05–0.1 mg/kg, SC 5–10 mg/kg, SC 2.5 mg/kg, SC
8–12 h 12–24 h 12–24 h
Analgesic agents are used in premedication to block pain and relieve fear and stress, and to reduce the total amount of general anesthetic required for the procedure. Pentobarbital, a barbiturate, is the most popular anesthetic agent for operations on animals. Its duration of action is enough for a 40-min operation, and there is a weaker effect lasting up to about 2–3 h after injection. With pentobarbital, animals do not feel pain in the surgical plane of anesthesia. Once stable anesthesia has been achieved, it will be longlasting than with most other agents. Fifty to 75 mg/kg is the standard dose for mice. Commercially available pentobarbital contains 50 mg/ml of the agent. Tenfold dilution of the original agent and IP injection of 300 ml will provide 75 mg/kg for a mouse weighing 20 g. Barbiturates are also the most commonly injected agents for euthanasia because they induce unconsciousness before respiratory depression and death. The disadvantage of barbiturates is their narrow margin of safety, associated with respiratory depression. The operator should consider the dosage according to the size of the animal and the purpose of the experiment. Tribromoethanol is the standard anesthetic agent used in mice. It produces short-term (15–30 min) surgical anesthesia with good muscle relaxation and moderate respiratory depression. It was once manufactured specifically for use as an anesthetic under the name AvertinÒ. However, this product is no longer commercially available. Investigators who wish to use tribromoethanol as an anesthetic must make their own solution. A stock solution of tribromoethanol is made by mixing equal amounts of tribromyl ethyl alcohol and tertiary amyl alcohol. This must be kept at 4 C in the dark and must not be stored for longer than 1 year. A working solution must be made each time it is needed by dilution of the stock solution to 1.25% in distilled water or saline, because this agent has toxic degradation products. Therefore, the operator should use only a freshly mixed solution or one that has been stored for no more than 1–2 weeks at
Handling and Tumor Formation Assays in Mice
401
4 C in the dark with a pH above 5. The IP injection of mice with 400– 500 ml of 1.25% working solution will provide adequate anesthesia for surgical experiments.
5. IP Injection To inject tumor cells or samples into the peritoneum, the operator must restrain the mouse properly. After grasping the mouse near the base of the tail, the loose skin at the back of neck is grasped and then the tail is held between the fourth and fifth fingers (Fig. 23.1A). Before attempting to enter the IP area, the injection site should be cleaned and disinfected. IP injection requires care in order to prevent penetration of various organs inside the abdominal cavity. The intestine usually reacts by moving away when it is touched with a sharp needle point. However, this is not the case with a full urinary bladder, the liver, and the stomach. For these reasons, IP injections are made in the lower quadrant of the abdomen. The injection site should be chosen to avoid these organs, and the injection should not be deep enough to puncture the kidney or the major vasculature of the abdomen. It is very important to pull back slightly on the plunger of the syringe prior to injection. The appearance of yellow fluid means the needle tip is in the urinary bladder, and green-brown fluid suggests it is in the intestine. IP injection of a-galactosylceramide (a-GalCer) has a strong prophylactic antibacterial effect and a marked antibacterial effect on preestablished urinary tract infections caused by Escherichia coli, Pseudomonas aeruginosa, and methicillin-resistant Staphylococcus aureus (MRSA) in mice. a-GalCer has an important role in host defense against a range of microbial infections because it is a specific ligand for CD1d-restricted variable-a14chain natural killer (NK) T cells. Minagawa et al. (2005) administered a-GalCer (2 mg/ 100 ml in phosphate-buffered saline) on alternate days.
6. IV Injection into the Tail Vein For tail vein injection, mice should be older than 6 weeks of age because at younger ages the vessel is not thick enough for injection. The injection site should be cleaned and disinfected before the operator attempts to enter the vessel. The most important part of the procedure is the method of holding the mouse because injection needs accurate manipulation of the needle. Several restraint devices are available and these are useful for holding mice for longer periods of time (Fig. 23.1B).
402
Shingo Hatakeyama et al.
Three vessels are visible on the back of the mouse’s tail: a central artery with a vein on each side. You can easily distinguish an artery from a vein by the branch vessels. Branch vessels extend from the artery to the veins (Fig. 23.2A, B). Avascularization using a soft tube (Fig. 23.2C) or soaking the tail in warm water will raise the vein and make injection easier. Once the mouse is safely held in the restrainer, the tail is pulled to straighten it. The mouse is monitored during the procedure by observing its respiratory rate and checking whether restraint is causing the animal any distress. The best syringe for tail vein injection is the one for insulin injection with a 28-gauge needle. The needle is bent at an angle of 30– 50 . The total volume recommended for an IV injection is 100 ml. The needle is placed on the surface almost parallel to the vein and inserted carefully (Fig. 23.3A–C). A common reason for misinjection is penetration caused by excessively deep insertion, because the vessel wall is located just beneath the skin surface. Once the needle tip is under the skin, it is very important to pull back the syringe slightly during insertion to confirm the blood will flow back (Fig. 23.3D), and then start the injection without moving the needle tip. The procedure for IV injection into the tail vein requires careful handling of the mouse and needle. Repeated practice is essential for success with this technique. A
B
C
Artery Vein
Branch
FVB/N
BALB/c nude
BALB/c nude
Figure 23.2 Tail vessels of the mouse. (A) Scheme of tail vasculature. Branch vessels extend from the artery to the veins. Red arrows, artery; blue arrows, vein; green arrows, branch vessels. (B) Careful injection is necessary in BALB/c nude (nu/nu) mice because their vessels are thin and leaky. (C) Avascularization (black arrow) or soaking the tail in warm water will make injection easier. Red, blue, and green arrows are arteries, veins, and branch vessels, respectively.
Handling and Tumor Formation Assays in Mice
403
Figure 23.3 Procedure for tail vein injection. (A) Proper handling of the syringe is essential for successful injection. The outer tube is grasped by the first and second fingers. The third finger is placed under the inner cylinder. Place the needle on the surface of the tail in parallel (B) and insert it carefully (C). Once the needle tip is under the skin, pull back the syringe slightly during insertion to confirm that blood will flow back (D, arrow).
In the lung colonization assay, tumor cells (1 105 to 5 106 cells) in 100 ml serum-free medium are injected through the tail vein. The number of cells injected will depend on the malignant potential of the cell line. Numbers of cells commonly used for IV injections are summarized in Table 23.2. Ohyama et al. (1999) injected mouse melanoma B16F1 cells stably transfected with a1,3-fucosyltransferase III (FTIII) to express sialyl Lewis X structures into the tail vein and evaluated lung tumor nodules 2–3 weeks later (Fig. 23.4). When injected to C57BL/6 mice, cells expressing moderate amounts of sialyl Lewis X (B16-FTIII-M) produced a significantly greater number of lung tumor foci than sialyl Lewis X-negative B16 cells (B16-FTIII-N). In contrast, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci. These results may seem to be paradoxical, because it has been postulated based on the in vitro experiments that sialyl Lewis X expression correlates with metastatic potential due to its high affinity to E-selectin.
7. IV Tumor Formation Assay Using ImmuneDeficiency Mice Nude mice do not have T cells. Severe combined immune-deficiency (SCID) mice are lack in both T and B cells. Beige mice do not have NK cells. Moreover, NK cells can be depleted by its specific monoclonal
404
Shingo Hatakeyama et al.
Table 23.2 Standard numbers of cells for injection or inoculation in mice Cell line
Methods
Cells/ml
Periods
B16F1 MeWo JKT-1 JKT-1 PC3 LNCaP MBT-2 LNCaP
IV injection IV injection IV injection Testicular inoculation Prostate inoculation Prostate inoculation SC inoculation SC inoculation
2–3 weeks 2–3 weeks 4 weeks 3–4 weeks 4–7 weeks 4 weeks 10 days 12 weeks
MDA-MB231 B16F10 B16F1
MFP inoculation
10 /100 ml 106/100 ml 106/100 ml 106/50–100 ml 106/20 ml 106/20 ml 105/100 ml 106/100 ml (with matrigel) 1 106/100 ml
FP inoculation FP inoculation
2 106/20 ml 4 105/20 ml
10 days 18–21 days
1 5 2 2 2 2 2 5
C57BL/6 mice
5
30–35 days
NK cell depleted
B16-FTIII-N: sLex negative (–)
B16-FTIII-M: sLex moderately (+)
B16-FTIII-H: sLex highly (+)
Figure 23.4 Tumor formation in the lung. Mouse melanoma B16F1 cells were stably transfected with a1,3-fucosyltransferase III (FTIII) to express sialyl Lewis X structures. Transfected B16F1 cells (B16-FTIII cells) were separated by cell sorting into three groups based on the expression level of sialyl Lewis X (sLeX negative, moderately positive, and highly positive). When transfected cells (1 105/100 ml) were injected to C57BL/6 mice, cells expressing moderate amounts of sialyl Lewis X (B16-FTIII-M) produced a significantly greater number of lung tumor foci than sialyl Lewis X-negative B16 cells (B16-FTIII-N). In contrast, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci. When injected to C57BL/6 mice that had been depleted of NK cells using anti-asialo-GM1 antibody, B16-FTIII-H cells that were highly positive for sialyl Lewis X produced large numbers of lung tumor nodules.
Handling and Tumor Formation Assays in Mice
405
antibody: NK1.1 or anti-asialoGM1 antibody. Taking advantage of these immune-deficient mice, important roles of cancer-associated carbohydrate antigens against host immune system can be addressed. When B16 cells were injected into mice tail vein, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci in C57BL/6 mice but were highly tumorigenic in NK cell depleted mice, which have defective NK cells (Fig. 23.4). These results suggest that B16FTIII-H cells are much more sensitive to NK cell-mediated cytotoxicity than are B16-FTIII-M cells (Ohyama et al., 1999, 2002).
8. SC Inoculation SC inoculation is a simple and basic way to evaluate tumor growth and size. However the technician must be careful to inject to the correct depth because the skin has a layered structure. To prevent unexpected movement of the mouse, it is important to hold the animal’s tail and the back of its neck firmly and with care, or the mouse can be anesthetized by IP injection of tribromoethanol (Avertin, 0.5 ml for a mouse weighing 25 g). Before attempting to inoculate, the injection site should be cleaned and disinfected. Major vessels must be avoided when selecting an inoculation point. Because the SC connective tissue stretches, raising a tent of back skin exposes a large space for injection (Fig. 23.5). The technician must be careful not enter the underlying muscle. If the tumor cells are injected into muscle, tumor growth is much greater than SC inoculation. The number of cells injected depends on the cell line. In general, 2 105 to 2 106 cells in 100 ml are inoculated in serum-free medium. Numbers of cells commonly used for SC inoculation are summarized in Table 23.2.
Tent of skin
Figure 23.5 Subcutaneous injection in mice. To prevent unexpected movement of the mouse, it is important to hold the animal’s tail and the back of its neck. Making a tent of skin will create a space for injection.
406
Shingo Hatakeyama et al.
If the cell line being used does not readily form a solid tumor, mixing the cells with MatrigelÒ will help tumor formation. In a study using core 3 Oglycan, Lee et al. (2009) described a tumor formation assay in which LNCaP prostate cancer cells were inoculated SC with MatrigelÒ. Briefly, mocktransfectant and core 3-O-glycan expressing LNCaP cells (5 106/100 ml) were inoculated subcutaneously together with 50 ml of MatrigelÒ and 50 ml of serum-free RPMI medium (50:50, v/v) into BALB/c nude (nu/nu) mice (6–8-week-old males), and the animals were killed 3 months later. Details are given in Chapter 8. Mammary fat pad (MFP) inoculation of breast cancer cells is a modified method of SC inoculation. The MFP lies directly beneath the skin, above the SC layer. Mice generally have five nipples on each side, three in the pectoral area and another two in the inguinal area (Fig. 23.6A). The second nipple from the top toward the head is a suitable site for MFP inoculation. Slow and careful inoculation will make appropriate swelling of MFP (Fig. 23.6B). Inoculation of 1 106 MDA-MB-231 cells in 100 ml medium into the MFP produced a solid tumor in 6–8-week-old female SCID mice (Sossey-Alaoui et al., 2007). In our trial, inoculation of 2 106 MDA-MD-231 cells in 50 ml with 50 ml of Matrigel (50:50, v/v) into 6–8-week-old female SCID mice made tumor growth easier and faster to evaluate after 4 weeks (Fig. 23.6C).
A
B
C
Pectoral
Inguinal
Figure 23.6 Mammary fat pad (MFP) inoculation in female mice. The mouse should be a female more than 6–8 weeks old. (A) The mouse has five nipples on each side, three in the pectoral area and two in the inguinal area. (B) The MFP lies just beneath the skin, above the subcutaneous layer. (C) Inoculation of 50 ml of MatrigelÒ with 2 106 of MDA-MD-231 cells per 50 ml (50:50 v/v) into 6–8-week-old female SCID mice made tumor growth easier and faster to evaluate after 4 weeks (arrow).
Handling and Tumor Formation Assays in Mice
407
9. FP Inoculation FP inoculation of tumor cells can be used to evaluate the lymph node or lung metastatic potential of cells as well as the tumor growth in the inoculated site. Handling is important for successful FP inoculation. The operator must hold the base of the mouse’s tail between the second and third fingers and then grasp the foot by the first and fourth fingers. The corner of the cage provides a suitable space for holding the mouse. For FP inoculation, place the needle on the surface of the FP and insert carefully. Once the needle is under the skin, pull back the syringe slightly to confirm that the needle tip is not in a vessel (Fig. 23.7). Lymph node or lung metastasis can be evaluated 3 weeks after inoculating 4 105/20 ml of B16F1 cells (Murakami et al., 2002; Wiley et al., 2001). If 2 106/20 ml B16F10 cells are inoculated, the interval before evaluation will be shortened (Chen et al., 2005). Standard numbers of cells for FP inoculation are summarized in Table 23.2.
Figure 23.7 Footpad inoculation of tumor cells. (A) Place the needle on the surface of the footpad and insert carefully. Once the needle is under the skin, pull back the syringe slightly to confirm that the needle tip is not in a vessel. (B) B16F10 cells (2 105/20 ml) were inoculated into the right footpad of C57BL/6 mice and metastasis was evaluated 3 weeks after inoculation. Scale bar ¼ 1 cm.
408
Shingo Hatakeyama et al.
Figure 23.8 Testicular inoculation of tumor cells. (A) After anesthetizing the mouse, hold the testis firmly to prevent leakage of cells into the peritoneal cavity, and slowly inject the testis with a suspension of 2 106 tumor cells in 50–100 ml serum-free medium. Tumor size and distant metastasis can be evaluated 3–4 weeks later. (B) Testis inoculated with JKT-1 tumor cells 3 weeks previously (arrowhead) and normal control (arrow). Scale bar ¼ 1 cm.
10. Testicular Inoculation Testicular orthotopic inoculation of tumor cells can be used to evaluate local tumor formation and the distant metastatic potential of testicular cancer cell lines. For this method, the mouse should be anesthetized by IP injection of tribromoethanol. When the mouse has calmed down, the technician should hold the testis firmly with forceps to prevent leakage of cells into the IP area (Fig. 23.8A). A suspension of 2 106 tumor cells in 50–100 ml is then injected slowly into the testis. Tumor size and distant metastasis can be evaluated 3–4 weeks later (Fig. 23.8B) (Hatakeyama et al., 2004).
11. Prostate Inoculation Like testicular inoculation, this method can be used to evaluate local tumor formation and the distant metastasis potential of prostate cancer cell lines. Sterilization or disinfection of all materials by autoclaving is necessary for this operation in order to prevent bacterial infection (Fig. 23.9). Anatomy of the mouse prostate is described in Fig. 23.10. After anesthetizing the mouse by IP injection of tribromoethanol, disinfect the lower
409
Handling and Tumor Formation Assays in Mice
1
2
3
4
5
6
7
8
Figure 23.9 Implements for inoculation into prostate. Syringe and needles 1 and 2 should be disinfected with an antiseptic agent. Surgical implements 3–8 should be sterilized by autoclaving. (1) 50-ml syringe (Hamilton #80530 705RN 50 ml SYR) þ syringe guide. (2) 30 gauge custom needle (Hamilton #7803-07 RN NDL 6/PK (30/ 0.500 /4)s, angle12 ). (3) Surgical scissors (FineScience #14105-12). (4) 9-mm AutoclipÒ (Clay Adams #7631, Becton Dickinson). (5) Several types of mosquito forceps (6–8).
Urinary bladder
Prostate (posterior)
Prostate (posterior)
SV
SV
SV
Seminal vesicles (SV)
Figure 23.10 Anatomy of mouse prostate. It is easy to find the seminal vesicles (SV), which appear as whitish cords in the lower peritoneal cavity. Withdrawing the seminal vesicles from the peritoneal cavity will reveal the prostate, which is located at the base of the seminal vesicles.
410
A
Shingo Hatakeyama et al.
Peritoneum
B
C Prostate SV
D
E
F
Figure 23.11 Procedure for prostate inoculation. (A) After disinfecting the lower abdomen, cut the skin and peritoneum with scissors. When cutting the peritoneum, raising a tent of peritoneum will create a space that makes it easier to avoid cutting the intestine or other organs. (B) After entering the peritoneal cavity, the two seminal vesicles (whitish convoluted cords) will appear. (C) Withdrawing the seminal vesicles from the peritoneal cavity will reveal the prostate. (D) The syringe must be located in parallel with the prostate to enable the tumor cells to be inoculated precisely in a small area. (E) The skin is closed with a 9-mm AutoclipÒ, together with the peritoneum. (F) Tumors should reach a large size within 4–7 weeks. Scale bar ¼ 1 cm
abdomen of the animal with 70% ethanol or an antiseptic. Cut the skin with scissors to expose the peritoneum (Fig. 23.11A). Raising a tent of peritoneum will create a space that enables avoiding cutting the intestine or other organs. After entering the IP area, the two seminal vesicles (visible as whitish convoluted cords) can be found (Figs. 23.10 and 23.11B). Withdrawing the seminal vesicles from the peritoneum will reveal the location of the prostate gland (Figs. 23.10 and 23.11C). A syringe containing tumor cells (2 106/ 20 ml) should be located in parallel with the prostate so that a small area can be inoculated precisely (Fig. 23.11D). The skin is closed with a 9-mm AutoclipÒ. The peritoneum is closed together with the skin (Fig. 23.11E). The operator has to be careful not to catch the underlying intestine in the clip. If this occurs during wound closure, the mouse will die. Tumors will reach a large size within 4–7 weeks. Tumors can be detected by touching the surface of the lower abdominal area. Prostate cancer cell lines PC3 and LNCaP are standard cell lines for tumor formation in the mouse prostate (Bao et al., 2009; Hagisawa et al., 2005; Inaba et al., 2003).
Handling and Tumor Formation Assays in Mice
411
ACKNOWLEDGMENT This work was supported by the Japan Society for the Promotion of Science, Grant 21791483 and CREST and the Japan Science and Technology Agency, Grant 2310080004.
REFERENCES Bao, X., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumor suppressor function of laminin-binding alpha-dystroglycan requires a distinct beta3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Chen, S., Kawashima, H., Lowe, J. B., Lanier, L. L., and Fukuda, M. (2005). Suppression of tumor formation in lymph nodes by L-selectin-mediated natural killer cell recruitment. J. Exp. Med. 202, 1679–1689. Hagisawa, S., Ohyama, C., Takahashi, T., Endoh, M., Moriya, T., Nakayama, J., Arai, Y., and Fukuda, M. (2005). Expression of core 2 beta1, 6-N-acetylglucosaminyltransferase facilitates prostate cancer progression. Glycobiology 15, 1016–1024. Hatakeyama, S., Ohyama, C., Minagawa, S., Inoue, T., Kakinuma, H., Kyan, A., Arai, Y., Suga, T., Nakayama, J., Kato, T., Habuchi, T., and Fukuda, M. N. (2004). Functional correlation of trophinin expression with the malignancy of testicular germ cell tumor. Cancer Res. 64, 4257–4262. Hawk, C. T., Leary, S., and Morris, T. (2005). Formulary for Laboratory Animals 3rd edn Blackwell Publishing, Ames, Iowa, USA. Inaba, Y., Ohyama, C., Kato, T., Satoh, M., Saito, H., Hagisawa, S., Takahashi, T., Endoh, M., Fukuda, M. N., Arai, Y., and Fukuda, M. (2003). Gene transfer of alpha1, 3-fucosyltransferase increases tumor growth of the PC-3 human prostate cancer cell line through enhanced adhesion to prostatic stromal cells. Int. J. Cancer 107, 949–957. Lee, S. H., Hatakeyama, S., Yu, S. Y., Bao, X., Ohyama, C., Khoo, K. H., Fukuda, M. N., and Fukuda, M. (2009). Core3 O-glycan synthase suppresses tumor formation and metastasis of prostate carcinoma PC3 and LNCaP cells through down-regulation of alpha2beta1 integrin complex. J. Biol. Chem. 284, 17157–17169. Minagawa, S., Ohyama, C., Hatakeyama, S., Tsuchiya, N., Kato, T., and Habuchi, T. (2005). Activation of natural killer T cells by alpha-galactosylceramide mediates clearance of bacteria in murine urinary tract infection. J. Urol. 173, 2171–2174. Murakami, T., Maki, W., Cardones, A. R., Fang, H., Tun Kyi, A., Nestle, F. O., and Hwang, S. T. (2002). Expression of CXC chemokine receptor-4 enhances the pulmonary metastatic potential of murine B16 melanoma cells. Cancer Res. 62, 7328–7334. Ohyama, C., Tsuboi, S., and Fukuda, M. (1999). Dual roles of sialyl Lewis X oligosaccharides in tumor metastasis and rejection by natural killer cells. EMBO J. 18, 1516–1525. Ohyama, C., Kanto, S., Kato, K., Nakano, O., Arai, Y., Kato, T., Chen, S., Fukuda, M. N., and Fukuda, M. (2002). Natural killer cells attack tumor cells expressing high levels of sialyl Lewis X oligosaccharides. Proc. Natl. Acad. Sci. USA 99, 13789–13794. Sossey-Alaoui, K., Safina, A., Li, X., Vaughan, M. M., Hicks, D. G., Bakin, A. V., and Cowell, J. K. (2007). Down-regulation of WAVE3, a metastasis promoter gene, inhibits invasion and metastasis of breast cancer cells. Am. J. Pathol. 170, 2112–2121. Watanabe, R., Ohyama, C., Aoki, H., Takahashi, T., Satoh, M., Saito, S., Hoshi, S., Ishii, A., Saito, M., and Arai, Y. (2002). Ganglioside G(M3) overexpression induces apoptosis and reduces malignant potential in murine bladder cancer. Cancer Res. 62, 3850–3854. Wiley, H. E., Gonzalez, E. B., Maki, W., Wu, M. T., and Hwang, S. T. (2001). Expression of CC chemokine receptor-7 and regional lymph node metastasis of B16 murine melanoma. J. Natl. Cancer Inst. 93, 1638–1643.
Author Index
A Abbas, S., 96 Abbs, S., 169, 354 Abe, S., 187, 197, 246 Abomelha, A., 345, 369, 372 Abril, E., 228 Ackerl, R., 297 Ackroyd, M. R., 299, 339, 375 Adachi, T., 227 Adriaenssens, E., 109 Aguilan, J. T., 379 Aguirre, A. A., 47, 48 Ahmed, S., 28 Aiello, C., 339, 345, 369 Aigrot, M. S., 26 Akaike, T., 225 Akama, T. O., 59, 244 Akasaka-Manya, K., 344, 345 Akashima, T., 187, 190, 198 Akira, S., 135 Akita, K., 42, 53, 55, 58, 63, 65 Akiyama, S. K., 144–145 Alam, N., 144 Alam, T., 207 Alavian, K., 48 Albers, C., 325 Alford, 3rd, J. A., 260 Alilain, W., 57 Ali, M., 225 Alizadeh, A. A., 76 Aloisi, F., 273 Alon, R., 95 Alonso, G., 26 Altschul, S. F., 76 Alvarez-Buylla, A., 26, 40, 66 Amano, J., 143 Amherdt, M., 207 Amps, J., 57 Amselgruber, W., 324 Anai, M., 207 Andersen, C. L., 80 Anderson, L. V., 345 Anderson, M. G., 378 Anderson, S., 47, 48 Andoh, T., 187 Ando, S., 85 Andra, K., 297
An, G., 108–110, 129, 144, 157, 161, 165, 166, 168, 245 Angata, K., 26–29, 187, 370, 380, 399, 410 Angelini, C., 294 An, H. J., 108 Anstee, D. J., 110, 111 Anthony, T. E., 40 Antoine, H., 28 Antosiewicz-Bourget, J., 74 Aoki, H., 399 Aoki-Kinoshita, K. F., 76, 81 Aono, S., 41, 42, 52, 55, 58 Arai, K., 374 Araishi, K., 298 Arai, Y., 26, 399, 405, 408, 410 Araki, A., 135 Araki, E., 295 Araki, M., 76, 81 Aranda, R., 138 Arato-Ohshima, T., 11 Aravamudan, B., 297 Ariga, T., 85 Arimura, T., 300 Armerding, D., 96 Arnarp, J., 226 Arnold, K., 74 Artym, V. V., 390 Arulanandam, B. P., 165 Aryal, R. P., 110, 111, 119 Asa, D., 96 Asano, T., 207 Ascani, S., 275, 280 Asher, R. A., 42, 61 Ashraf, M., 95 Ashwell, G., 224, 225, 227 Askari, S. W., 259 Assoian, R. K., 144 Atarashi, K., 97 Atkins, R. C., 280 Autuori, F., 227 Azadi, P., 111 B Bach, A., 41 Backstrom, M., 109 Bacon, C. L., 11 Baenziger, J. U., 59, 224–227 Baetens, D., 207
413
414 Bailey, H. L., 371, 375 Bakin, A. V., 406 Balanzino, L., 74 Balci, B., 348 Baldwin, C., 227 Baldwin, S., 27, 29 Ballem, P., 228 Ball, S. L., 339, 345, 354, 358, 376 Banas, J. A., 165 Bandtlow, C. E., 41 Ban, K., 59 Bansal, D., 298 Bao, X. F., 42, 144, 148, 149, 152, 260–262, 265, 268, 370, 380, 387, 399, 406, 410 Barabote, R. D., 76 Barbieri, A. M., 174 Baric, I., 339, 350 Barois, A., 345 Baron, D. A., 248 Barondes, S. H., 218 Barresi, R., 293, 324, 325, 336, 338, 355, 368–370, 374, 376–381, 388, 391 Barrett, K. E., 124 Barrett, T. A., 76, 124 Barthels, D., 27, 29 Bartlett, P. F., 47, 48 Barton, E. R., 301 Bashir, R., 345 Baudhuin, P., 226 Baumheter, S., 258 Baum, L. G., 206 Bauvard, D., 388 Bax, M., 76 Baynes, J., 225 Beamer, T. C., 370, 375 Behrendt, C. L., 162 Behringer, R., 333 Belachew, S., 47, 48 Beltran-Valero De Bernabe´, D., 337, 344, 345, 370 Belyantseva, I. A., 295 Benabdallah, B. F., 301 Benbrook, D. M., 110, 111, 114, 118, 119 Ben-Dor, S., 85 Ben-Hur, H., 95 Bennett, E. P., Bennett, G. S., 41, 58 Benson, D. A., 76 Benson, M. A., 337, 345 Bentzinger, C. F., 302 Berardi, N., 41 Berardinelli, A., 339, 345, 369 Bergamino, L., 344, 354 Berg, E. L., 96, 260, 275 Berger, E. G., 187 Bergstrom, J. D., 14 Berhend, T. L., 186 Berndt, M. C., 96
Author Index
Bernhardt, G., 95 Berninsone, P. M., 108 Bernreuther, C., 58 Bernstein, B. E., 74 Bernstein, M., 357 Bertini, E., 344, 348, 354 Bertolino, P., 228 Bertolotto, C., 42 Betel, D., 161, 169 Bethea, N., 228 Beutow, K. H., 371 Bhatnagar, A. S., 280 Bhattacharyya, R., 206 Bhaumik, M., 206 Bhowmick, N. A., 388 Biancheri, R., 339, 344, 345, 354, 369 Bibiloni, R., 278 Bider, M. D., 224–226 Bieberich, E., 85 Bierhuizen, M. F., Biesecker, G., 311 Biessen, E. A. L., 226 Biggar, D., 345 Bingham, C. O., 169 Binkley, G., 76 Binns, G., 224 Bird, L. M., 354 Birnbaumer, L., 138 Bisgaard, K., 280 Bissell, M. J., 388 Bittner, R. E., 339, 345, 355, 371, 373–377, 379 Blaess, S., 388 Blak, A., 48 Blake, D. J., 294, 324, 337, 345 Blixt, O., 187 Blom, E., 225 Blumenstock, F., 225 Bobowski, M., 109 Boeggeman, E., 99 Boffi, P., 339, 345, 369 Bogdahn, U., 354 Boggi, U., 207 Bo¨hm, S. V., 369 Bohring, A., 354 Boito, C., 379 Bolland, D. J., 371 Bolton, W. K., 274 Bonaldo, P., 298 Bonfanti, L., 26 Boninsegna, A., 388 Bonner-Weir, S., 207 Boon, M., 337, 344 Boorman, G., 228 Borrow, P., 370 Borrow, R., 132 Bosnakovski, D., 300 Bostick, B., 309 Botstein, D., 76
415
Author Index
Bouchet, C., 345, 348–350 Boudreau, R., 388 Bouldin, T. W., 373, 377 Bowen, D., 228 Bo, X., 26 Bradbury, E. J., 41, 58 Bradley, J. D., 169 Braet, F., 228 Braiterman, L. T., 226 Brakebusch, C., 58 Brambrink, T., 74 Brancaccio, A., 355, 368, 370, 379 Braun, J. R., 109, 138, 144, 157, 161, 165, 166, 168, 227, 245 Breedveld, F., 273 Breitfeld, D., 95 Breloy, I., 325 Breningstall, G., 345 Brennaman, L. H., 26 Brennan, P. A., 388 Bresolin, N., 370 Brewer, K., 108, 110, 114 Bridges, L. R., 309 Brilstra, E. H., 370 Briscoe, D. M., 96 Briskin, M. J., 273 Briskomatis, A., 275 Brockhausen, I., 108, 124, 129, 143, 144, 156, 157, 174 Brockington, M., 169, 325, 337, 344, 345, 354, 355, 368, 369, 372, 374, 379, 381, 388 Broda, P., 344, 354 Bronson, R. T., 333 Brooker, G. F., 47, 48 Brophy, P. J., 369, 377, 378 Brose, C., 26 Browning, C. A., 371, 375, 378, 379 Brown, P. O., 76 Brown, R., 27, 29 Brown, S. C., 169, 325, 337, 339, 345, 354, 355, 368, 369, 372, 374, 375, 379, 381 Brunk, D. K., 101 Brunner, H. G., 348 Bruno, C., 339, 344, 345, 369 Bru¨stle, O., 26 Bryan, B. T., 150 Bryant, S. H., 76 Bryson, S., Buckley, N., 43 Bugliani, M., 207 Bukalo, O., 27 Bulfield, G., 295 Buller, H. A., 166, 168, 245 Burchell, J. M., 109, 143 Burger, A. M., 16 Burgunder, J. M., 345 Burkin, D. J., 301, 305 Burns, S. A., 96
Burrows, L., 225 Burson, C. M., 345 Busch, S. A., 41 Bushby, K., 169, 345 Bu¨ssow, H., 26 Bustin, S. A., 80 Butcher, E. C., 96, 260, 272, 275, 283 Butterfield, J. E., 144 Byk, T., 95 Byrd, J. C., 144 Byrne, E. H., 370 C Cabral, A., 354 Cagliani, R., 370 Cailleau-Thomas, A., 74 Caille, I., 40 Cain, D. W., 98 Calco, V., 41 Camargo, L. M., 42, 61 Campbell, G. T., 280 Campbell, K. P., 293, 324, 325, 336, 344, 355, 368–370, 373, 374, 376, 378, 380, 381, 388, 391 Campbell, R. M., 206, 230 Camper, S. A., 284 Camphausen, R. T., 284 Campieri, M., 278 Campos, L. S., 58 Candelier, J. J., 74 Canese, K., 76 Canfield, W. M., 108, 110, 114 Cao, P., 345 Cao, W., 370 Capela, A., 47, 48 Carbonetto, S., 355, 376, 378 Cardones, A. R., 407 Carim Todd, L., 371 Carlbom, E., 370 Carlow, D. A., 156 Carlstedt, I., 249 Carroll, D., 124 Carulli, D., 41, 42, 58, 61 Casanova, P., 26, 33 Casey, C. E., 99, 227 Cassandrini, D., 339, 344, 345, 354, 369 Cazet, A., 109 Ceccarelli, C., 275, 280 Celli, J., 337, 344 Cerqueira, M., 228 Cescato, R., 225, 226 Chakkalakal, J. V., 301, 302 Chamberlain, J. S., 309 Chanas-Sacre, G., 42 Chancellor, K., 372 Chance, S. C., 226 Chandrasekharan, K., 291, 312
416 Chang, X., Charels, K., 228 Charles, P., 26 Chazal, G., 27, 29 Cheliout-Heraut, F., 345 Cheng, G., 259, 260, 284 Cheng, L., 174 Cheng, Z., 95 Chen, I. J., 169 Chen, J., 26, 58, 369, 376, 378 Chen, L., 207 Chen, S., 399, 405, 407 Chen, X.-J., 108, 372–374, 376, 377 Chen, Z., 28 Cheresh, D. A., 147 Cherry, J. M., 76 Chetvernin, V., 76 Cheung, P., 206 Chiba, A., 292, 324, 325, 327, 344, 388 Chiba, Y., 324, 327, 344, 354 Chierzi, S., 41 Chin, C. C. Q., 225 Chintalacharuvu, K., 225 Chirat, F., 225 Chi, S. I., 260 Chitayat, D., 337, 344 Chittajallu, R., 47, 48 Chiyonobu, T., 339, 345, 360, 379, 381 Cho, E.-W., 224 Christoph, A., 27, 29 Chui, D., 157, 207 Chumsri, S., 16 Chung, Y. S., 144 Church, D. M., 76 Chu, V., 309 Cirak, S., 339, 350 Cittadini, A., 388 Clarke, L. L., 124 Clarke, N., 348, 350 Claudepierre, T., 378 Clausen, H., 108, 109, 143, 228 Clayburgh, D. R., 124 Clegg, D. O., 169 Clement, A. M., 41–43, 57 Clement, E. M., 169, 354 Clerici, M., 370 Clinton, B. K., 40 Coalson, J. J., 165 Coates, P. W., 28 Coelho, A. V., 99 Cogger, V., 228 Cohen, M., 354 Cohen, T. V., 299 Cohn, R. D., 297, 305, 309, 325, 336, 338, 355, 369, 374, 376–379, 381, 391 Colgan, S. P., 161 Colin, C., 26 Collins, J., 370, 371, 373, 378
Author Index
Collins, V. P., 370 Colognato, H., 58 Coloma, A., 324, 332–335, 338, 374, 388 Comelli, E. M., 74, 76 Comerford, K., 161 Comi, G. P., 339, 345, 369, 370 Compans, R. W., 370 Condie, B. G., 85 Conzelmann, S., 17, 26 Coombs, P. J., 226 Cooper, D. N., 218 Cooper, H. S., 166 Cooper, N. G., 57 Coral-Vazquez, R., 298 Corbel, S. Y., 156 Corfield, A. P., 124, 144 Corless, C. E., 132 Cormand, B., 337, 344 Corrado, K., 295 Correa, P., 277 Corredor, J., 165, 166 Costa, J., 99 Cotarelo, R. P., 333 Coˆte´, P. D., 297, 376 Cotsapas, C., 370 Coullin, P., 74 Courtand, G., 109 Court, F. A., 377 Coutinho, P. M., 76 Cover, C., 228 Cowell, J. K., 406 Cox, G. A., 301, 302, 372, 374, 375, 377, 378 Coyle, A. J., 281 Craig, R. A., 100 Crandall, J. E., 376, 378 Crawford, C. E., 333 Cremer, H., 27, 29 Crew, V. K., 110, 111 Crocker, P. R., 76 Crosbie, R. H., 303 Cruces, J., 323, 324, 333 Cui, Y., 58 Cummings, R. D., 81, 107–112, 114, 117–119, 128, 129, 144, 157, 161, 165, 166, 168, 187, 217, 245 Curiel, D. T., 33 Currier, S., 337, 344 Cush, J. J., 169 Czopka, T., 40 D Daalen, E., 370 Dagia, N. M., 98 Dalloz, C., 378 Dalton, S., 76, 77, 84, 85, 227 Dalziel, M., 109, 143 Damera, G., 128
417
Author Index
Damiani, S., 275 D’Amico, A., 339, 344, 345, 354, 369 Dammerman, R. S., 40 Dan, B., 324 Daniels, G., 110, 111 Daniels, K. J., 325, 336, 374 Danon, D., 146 D’Antona, G., 300 Daoling, Z., 144 Dar, A., 95 Dasgupta, F., 96 Das, S., 16 Datti, A., Davies, G. J., 98 Davies, J. R., 249 Davies, K., 377 Davis, S., 380, 381, 388 Davy, B. E., 42 Dawson, P. A., 246 Day, J., 225 de Angelis, M. H., 332–335, 338, 388 de Bernabe, D. B. V., 369, 372 De Bruijn, A. C. J. M., 166, 168, 245 Decker, L., 26 Deconinck, A. E., 303, 309 Deconinck, N., 301, 324 DeGuzman, B. J., 96 de Haan-Meulman, M., 273 de Jonge, M. V., 370 Dekker, J., 245 De Koning, B. A. E., 166, 168, 245 Delannoy, P., 109 De la Porte, S., 310 de Leoz, M. L., 108 Deleyrolle, L., 50 Dell, A., 74, 76, 156, 157, 160–163, 165–169, 246 Demetriou, M., 169, 206 den Dunnen, J. T., 354 Deng, W., 26 Dennis, J., 206 Dennis, J. W., 144, 169, 206 De Paepe, A., 80 de Paola, B., 388 De Preter, K., 80 Deprez, R. H., 80 Desgrosellier, J. S., 147 De Simone, C., 278 Deugnier, M. A., 388 Deutsch, V., 95 Deutzmann, R., 324 De Zanger, R., 228 Di Certo, M. G., 301 Dickinson-Anson, H., 26 DiCuccio, M., 76 Diehn, M., 76 Dieleman, L. A., 124 Diesen, C., 345 Di Guglielmo, G. M., 206
Dihne, M., 58 Dimitroff, C. J., 96, 100 Dincer, P., 348 Ding, X., 108, 110, 112, 118 Dini, L., 227 Dinter, A., 187 Diogo, L., 354 Di Salvatore, M., 388 Di Tommaso, F., 379 Ditto, D., 206, 223, 225, 227–230 Dityatev, A., 27 Dixon, M. F., 277 Dobbertin, A., 41, 57 Dobyns, W. B., 337, 344, 345 Doetsch, F., 40 Doe, W. F., 133 Dogan, A., 273 Do, K. Y., 114 Dolatshad, N. F., 379 Dole, K., 144 Dollar, J., 325, 336, 338, 355, 374, 376, 377, 379 Dominov, J. A., 301, 302, 305 Dorfman, D. M., 281 Dougherty, J. D., 28 Dovico, S. A., 369, 379, 381, 391 Doyle, D., 225 Drexhage, H. A., 273 Drickamer, K., 74, 76, 224–226, 283 D’Souza, A., 108, 110, 114 Dubois, C., 43 Dubois-Dalcq, M., 26, 33 Dubose, C. N., 165 Duclos, F., 298 Duenas, J., 156 Duijvestijn, A. M., 275 Du, M., 273 Dumanski, J. P., 369, 379–381, 391 Dunham, I., 370, 371, 373, 378 Durbec, P., 26, 29, 33 Durbeej, M., 298, 355, 368, 369, 373, 378 Dvorak, L. A., 165, 166 E Eade, A., 354 Easterday, M. C., 28 Eaves, A. C., 50 Ebe, Y., 193, 200, 201 Eckhardt, M., 26, 27 Eckmann, L., 162 Edberg, S., 124 Eddy, E. M., 85 Edgar, R., 76 Edwards-Jones, V., 132 Egbers, U., 40 Einarsson, M., 225 Einerhand, A. W. C., 166, 168, 245 Eisenberg, I., 305
418
Author Index
Elder, J. H., 370 Elhammer, A., 174 Ellies, L. G., 156, 157, 161, 207, 223, 225, 227, 230, 244, 272, 275 El Maarouf, A., 26 Elson, C. O., 124 Elvevold, K., 228 Emery, A. E. H., 370 Eminli, S., 74 Endoh, M., 399, 410 Endo, T., 187, 190, 198, 324, 325, 327, 339, 343–345, 347, 348, 350, 354, 375, 388 Endo, Y., 114, 228 Engel, A. G., 311 Ercolessi, C., 275 Ernst, J. F., 161, 169 Ervasti, J. M., 355 Esko, J. D., 74, 76, 81 Eslami-Varzaneh, F., 124 Estournet, B., 337, 345 Evercooren, A. B., 26 Evers, M. R., 59 Eysel, U. T., 57 F Fadden, K., 225 Faid, V., 225 Faissner, A., 40–43, 46, 48, 50, 53, 55, 57–59, 63, 65 Falace, A., 344, 354 Falasca, L., 227 Falco´n-Pe´rez, J. M., 332–335, 338, 374, 388 Fallet, S., 345 Falsaperla, R., 354 Fan, G. C., 95 Fang, H., 407 Fan, Q. W., 11 Fan, X., 18 Faraglia, B., 388 Faraldo, M. A., 388 Fardeau, M., 345 Farrell, D. C., 224 Fassler, R., 58, 388 Fata, J., 206 Faulkner, N. E., 100 Fauss, L., 228 Fawcett, J. W., 41, 57, 58 Federhen, S., 76 Fedorak, R. N., 278 Feinberg, A. P., 326 Feizi, T., 42 Feltri, M. L., 58, 377 Fenderson, B. A., 85 Feng, G., 357 Feng, L., 42, 169, 337, 345, 354, 355, 369 Fennie, C., 260, 283 Fernandez-Valdivia, R., 108
Ferns, M., 226 Ferreiro, A., 345 Fewou, S. N., 26 Ffrench-Constant, C., 40, 41, 50, 55, 57, 58 Fidanboylu, M., 339, 375 Fiete, D., 225, 226 Fine, H. A., 18 Fineza, I., 354 Finger, E. B., 260 Finne, J., 42 Fishell, G., 40 Fisher, L. J., 28 Fitch, M. T., 41 Flanagan, J. D., 369, 378 Flint, A. C., 40 Fokkema, I., 354 Foreman, R., 74 Forlow, S. B., 156 Forster, R., 95 Fox, A. J., 132 Foxall, C., 96 Fox, R. I., 144 Franceschini, I., 26, 33 Francke, U., 368, 372 Frane, J. L., 74 Franke, L., 370 Fransson, I., 370, 371, 373, 378 Fraser, R., 228 Fraternali-Orcioni, G., 280 Freeze, H., 81 Fregien, N., 114 Frey, M. R., 165, 166 Fritz, T. A., 108 Frost, A. R., 369 Fry, B., 370 Fuhlbrigge, R. C., 96, 100 Fu, J., 108, 110 Fujii, S., 209 Fujikake, N., 339, 345, 379, 381 Fujimura, K., 187, 378, 379 Fujinawa, R., 76 Fujita, H., 41, 42, 52, 55, 58 Fujita, M., 59 Fujiwara, Y., 41, 42, 52, 55, 58 Fukuda, M., 26–29, 33, 59, 81, 110, 143–146, 148, 149, 152, 155–157, 160–161, 163, 165–169, 186, 187, 244–246, 253, 257, 259, 263, 272–280, 283, 284, 286, 370, 380, 387, 399, 403, 405–407, 410 Fukuda, M. N., 59, 144, 148, 149, 152, 244, 370, 380, 399, 405, 406, 408, 410 Fukuda, Y., 337 Fukudome, T., 376 Fukui, S., 59 Fukui, T., 374 Fukunaga, K., 99 Fukushima, M., 273, 276, 279, 280 Fukuta, M., 59
419
Author Index
Fumagalli, M., 370 Funabiki, K., 355 Funakoshi, H., 360 Furlan, A., 109 Furukawa, K., 4, 5, 9, 11, 14 Furukawa, Y., 42, 53, 55, 58, 61, 63, 65, 97 Furuta, G. T., 161 Futerman, A. H., 85 G Gabius, H.-J., 224 Gaehtgens, P., 260 Gage, F. H., 26, 28, 66 Gala´n, L., 345, 354 Gallatin, W. M., 283 Galli, R., 40, 42, 44 Gallo, V., 47, 48 Gama, C. I., 84 Gao, G., 169 Garcia-Vallejo, J. J., 76 Garcia-Verdugo, J. M., 40, 66 Garcion, E., 40, 41, 50, 55, 57 Gardiner, B., 246 Garner, O. B., 206 Garrett, W. S., 162, 165 Garwood, J., 41, 57 Gascon, E., 26 Gates, M. A., 41 Gatgens, J., 109 Gaudet, R., 370 Gauguet, J. M., 156, 244, 259–262, 265, 266, 268, 286 Gautam, T., 110, 111, 114, 118, 119 Gazit, D., 95 Gazit, Z., 95 Gebhardt, R., 228 Geer, L. Y., 76 Geller, H. M., 41, 42, 58, 61 Genta, R. M., 277 Geoffroy, J. S., 260, 283 Gerardy-Schahn, R., 17, 26, 27 Gerhardt, H., 110 Gernsheimer, T., 228 Gersten, K. M., 259, 260, 284 Gertsenstein, M., 333 Gertz, A., 206 Geschwind, D. H., 28 Ghadiri-Sani, M., 26 Ghazarian, H., 108 Giancotti, F. G., 144 Giese, A., 18 Gieselmann, V., 26 Gilmartin, T. J., 74, 76, 273 Ginsburg, D., 223, 225, 227, 230 Gionchetti, P., 278 Giorno, R., 280 Gish, W., 76
Glaser, T., 26 Glimcher, L. H., 162, 165 Glukhova, M. A., 388 Godfrey, C., 169, 354 Godwin, J., 339, 375 Goel, H. L., 144 Goetz, D. J., 101 Goldstein, L. J., 150 Gonc¸alves, A., 354 Gonzalez, E. B., 407 Gonzalez, F., 207 Gordon, J. I., 162, 165 Gorecki, D. C., 388 Goridis, C., 27, 29 Gossens, K., 156 Gotoda, T., 227 Gotoh, M., 109, 124, 129, 144, 187, 190, 198 Goto, S., 76, 81 Gotz, B., 41 Gotz, M., 40, 42, 44, 57, 58, 65 Granfors, K., 273 Granovsky, M., 206 Gray, F., 345 Gree, J. A., 390 Green, C., 110, 111 Gregoriadis, G., 224, 225 Grewal, P. K., 169, 223, 227–230, 339, 345, 355, 369, 371–379 Gries, B., 325 Grigorian, A., 169, 206 Grimmond, S., 246 Grogan, J. L., 281 Gross, C., 348, 354 Groux-Degroote, S., 109 Gschmeissner, S., 109, 143 Guerra, S. D., 207 Guglieri, M., 169 Guicheney, P., 343, 345, 348 Guimara˜es, A., 354 Guiver, M., 132 Gu, J., 3, 145, 150, 209 Gullberg, D., 370, 380, 399, 410 Gunetti, M., 95 Gunther, T., 331 Gunton, J. E., 207 Guo, H. B., 144–145, 150 Guo, S., 4 Guo, W., 144 Guthrie, E. P., 114 Gutierrez Gallego, R., 187 Gutierrez-Ramos, J. C., 281 H Habuchi, H., 59 Habuchi, O., 42, 59, 84 Habuchi, T., 399, 401, 408 Hacker, U., 84
420 Hack, M. A., 40 Haeften, T. W., 207 Hagen, F. K., 174 Hagisawa, S., 399, 410 Hagiwara, K., 187, 197 Hakomori, S., 85, 96, 109 Halberg, D. F., 224 Halilagic, A., 40, 50, 55, 57 Haliloglu, G., 348 Hall, E. M., 74, 76, 77, 79, 81 Haltiwanger, R. S., 74, 206 Hamann, K., 26 Hamano, K., 344 Hamasaki, M., 281 Hambardzumyan, D., 18 Hammer, D. A., 101 Hammer, R. E., 227 Hampe, J., 132 Handa, K., 96 Han, F.-Y., 370, 371, 373, 378 Han, H., 375 Hanisch, F. G., 109, 325 Han, R., 324 Han, S., 144 Hansson, G. C., 109 Harada, K., 227 Harada, O., 273, 274, 278, 283, 284, 286 Haraldsson, M., 226 Hara, T., 207, 209 Hardan, I., 95 Hardonk, M., 228 Harduin-Lepers, A., 109 Hardy, M. R., 225, 226 Harford, J., 224, 225 Hargus, G., 58 Harms, G., 228 Harper, H. A., 369, 370, 379, 381, 391 Harris, C. L., 169 Harris, K., 74, 76, 77, 79, 81, 84 Hartfuss, E., 40, 42, 44 Hart, G. W., 81, 157, 207 Hartwig, J. H., 228 Hasebe, O., Hasegawa, A., 96, 260 Hashimoto, Y., 76 Haslam, S. M., 74, 76, 99, 100, 156, 157, 160–163, 165–169, 246, 260, 266, 275 Hassell, J. A., 388 Hasvold, H., 228 Hatakeyama, S., 144, 148, 149, 152, 370, 380, 397, 399, 401, 406, 408, 410 Hatten, M. E., 42 Hattori, E., 227 Hattori, M., 76, 81 Hawk, C. T., 399 Hawkins, C., 345 Hawthorne, W. J., 207 Hayashi, Y. K., 354
Author Index
Haynes, C. A., 85 Hayry, P., 273, 276 Head, S. R., 74, 76, 273 Heck, N., 41, 57 Hehr, U., 339, 348, 350, 354 Heins, N., 40, 42, 44 Heintz, N., 40, 42 He, M., 108, 110, 112, 118 Hemmerich, S., 244, 258, 259, 272 Hemmi, S., 58 Henis, Y. I., 226 Hennet, T., 108, 174, 187 Henrissat, B., 76, 98 Henry, M. D., 325, 336, 355, 368–370, 374, 376–378, 388 Henzel, W., 258 Herbert, D., 228 Herbst, R., 376 Herken, R., 336 Hermann, R., 339, 350 Hermans, K., 110 Hernandez-Boussard, T., 76 Hernandez, G., 76 Herna´ndez, J., 378 Hernandez, M. P., 26 Herrera, D. G., 66 Herrmann, A., 249 Herrmann, R., 161, 169, 337, 344, 345, 354, 369, 372 Hershberg, R. M., 161 Herz, J., 227 Hewitt, J. E., 337, 339, 345, 355, 367, 369, 371–379 Hickman, J., 224, 225 Hicks, D. G., 406 Hicks, W., 372, 374, 375, 377, 378 Higgins, E., 144 Hikino, M., 41, 59 Hildebrandt, H., 17, 26, 27 Hildreth, J.t., 224 Hindemith, A., 227 Hinderlich, S., 74 Hindsgaul, O., 99, 100, 144, 161, 244, 260, 266, 272, 275 Hirabayashi, J., 185, 193, 200, 201 Hiraiwa, N., 260 Hirakawa, J., 245 Hirakawa, M., 76, 81 Hirano, H., 207 Hirano, K., 41, 42, 52, 55, 58 Hiraoka, N., 59, 145, 146, 156, 161, 186, 244, 259, 272, 275 Hirata, T., 97 Hiruma, T., 109, 124, 129, 146, 187, 190, 198, 378, 379 Hochedlinger, K., 74 Hochstenbach, R., 370 Hoeger, H., 375–377, 379
421
Author Index
Hoffmeister, K. M., 228 Holden, K. R., 345 Holland, E. C., 224 Hollingsworth, M. A., Holzfeind, P. J., 339, 345, 355, 371, 373–377, 379 Homa, F. L., 174 Homeister, J. W., 259 Hong, S. J., 76 Hong, W., 225 Honke, K., 81, 145 Hooper, L. V., 162 Hooper, M. M., 169 Horak, I., 74 Horie, M., 338 Horner, P. J., 66 Horst, E., 275 Horstkorte, R., 74 Horvat-Brocker, A., 57 Ho, S. B., 156, 157, 160–163, 165–169, 246 Hoshino, H., 273, 274, 276, 278, 280, 283, 284, 286 Hoshi, S., 399 Hoshi, T., 369, 376, 378 Hostetter, E., 370 Hougaard, D. M., 280 Houle, J. D., 57 Howard, E. M., 41 Hrabe´ de Angelis, M., 374 Hrstka, R. F., 325, 336, 374 Hsieh-Wilson, L. C., 84 Hsu, J., 372, 374, 375, 377, 378 Huang, S. N., 274 Hubbard, A. L., 226 Huber, B. E., 224 Huckaby, V., 26, 27, 29, 244, 259 Hudgin, R. L., 224 Hu, H., 29, 339, 345, 353, 354, 358, 376 Hunter, N., 132 Husband, A. J., 133 Huseby, N.-E., 225 Huttner, W. B., 40 Huxley, S., 246 Huynen, M. A., 337, 344 Hwang, S. T., 407 I Iannaccone, S. T., 324, 375 Ibraghimov-Beskrovnaya, O., 325, 336, 368, 374 Ibrahim, S. A., 166 Ichihara-Tanaka, K., 42 Ichikawa, S., 174 Ichisaka, T., 74 Ida, M., 41, 42, 52, 55, 58 Idoni, B., 108 Iiyama, R., 135 Iizuka, Y., 227 Ikehara, Y., 111, 185
Ikematsu, S., 42 Ikenaga, H., 207, 209 Ikenaka, K., 42 Ilstrup, D. M., 278 Imai, N., 187, 190, 198 Imai, Y., 246, 260, 283 Imamura, M., 374 Imreh, S., 370, 371, 373, 378 Inaba, N., 109, 124, 129, 144, 187, 190, 198 Inaba, Y., 399, 410 Inamori, K., 370 Inazu, T., 161, 169, 325, 337, 344, 345, 349, 350, 354, 388 Inman, L., 207 Inokuchi, J., 187, 190, 198 Inoue, T., 399, 408 Inoue, Y., 42 Inukai, K., 207 Iobst, S. T., 225 Ioffe, E., 206 Irimura, T., 187, 190, 198 Isaacson, P. G., 273 Isacson, O., 48 Isaji, T., 145, 150 Ishibashi, S., 227 Ishida, H., 99, 187, 190, 197, 198, 260, 354 Ishihara, H., 207 Ishii, A., 399 Ishikura, T., 135 Ishizuka, Y., 109, 124, 129, 144, 187 Iskratsch, T., 376 Ismail, A. S., 162 Ismail, M. N., 155–157, 160–163, 165–169, 246 Issakainen, J., 228 Isselbacher, K. J., 124 Isshiki, S., 187 Ito, F., 354 Itohara, S., 76 Itoh, M., 76, 81 Itoh, S., 145 Ito, J., 227 Ito, N., 59 Ito, S., 200 Ito, Y., 59, 228 Ivanciu, L., 108, 110, 129 Iwai, T., 109, 124, 129, 144, 146, 187, 190, 198 Iwamatsu, A., 207 Iwasaki, H., 109, 111, 124, 129, 144, 187, 190, 198 Iyer, S. P. N., 157, 207 Izatt, L., 369 J Jaako, K., 26 Jackson, C. G., 169 Jackson, P. K., 333 Jackson, R. L., 28
422
Author Index
Jacobson, A. C., 165, 166 Jacques, N. A., 132 Jaeken, J., 206, 230 Jaenisch, R., 74 Jaeschke, H., 228 Jafar-Nejad, H., 108 Jalkanen, S., 273 James, P., 96 Jang-Lee, J., 76 Jankovski, A., 29 Janssen, M., 337, 344 Jansson-Sjostrand, L., 95 Jenkins, C. D., 133 Jeno, P., 225, 226 Jensen, J. L., 80 Jiang, J., 3–5, 14 Jia, X., 95 Jigami, Y., 324, 327, 344 Jimenez, C., 345 Jimenez-Mallebrera, C., 169, 337, 345, 354, 355, 369 Jin, D. K., 354 Jing, J., 388 Jin, H., 76 Johann, V., 58 Johnson, J. H., 207 Johnson, K., 228 Jones, D., 281 Jonsdottir, G. A., 74 Josefsson, E., 228 Joshi, B., 376, 378, 379 Josifova, D., 369 Joziasse, D., Julien, S., 109 Jurado, L. A., 324 Ju, T., 107–112, 114, 117–119, 129, 144, 157, 161, 165, 166, 168, 245 K Kaasik, A., 26 Kabashima, K., 124 Kabel, P. J., 273 Kabos, P., 42 Kaczmarski, E. B., 132 Kadomatsu, K., 244, 259 Kageyama, S., 273, 276, 279, 280 Kago, N., 59 Kahn, J., 95 Kahn, L., 26 Kajimura, N., 355, 377 Kaji, T., 41, 42, 52, 55, 58 Kakinuma, H., 399, 408 Kale, G., 348 Kalra, K. L., 274 Kaluarachchi, M., 339, 375 Kamar, M., 144–145 Kamerling, J. P., 187
Kameya, S., 372, 374, 375, 377, 378 Kaminski, H. J., 339, 345, 354, 358, 376 Kammerer, R. A., 224 Kamradt, T., 281 Kanagawa, M., 324, 325, 336, 338, 339, 345, 355, 368–370, 374–377, 379–381, 391 Kanai, T., 135 Kanamori, A., 96 Kanazawa, I., 325, 388 Kaneda, N., 42, 55 Kanehisa, M., 76, 81 Kanesaki, H., 339, 345, 354, 375 Kang, H. G., 59 Kannagi, R., 96, 244, 259, 260, 266, 286 Kano, H., 161, 169, 337, 344, 354, 374 Kansas, G. S., 96, 100 Kanto, S., 399, 405 Kaplan, J., 228 Kapustin, Y., 76 Kariya, Y., 145 Karlsson, H., 109 Karlsson, S., 95 Karube, K., 281 Kassel, K., 227 Kasugai-Sawada, M., 260 Katagiri, H., 207 Katayama, T., 76, 81 Katoh, K., 355, 377 Kato, K., 174, 399, 405 Kato, M., 59 Kato, T., 399, 401, 405, 408, 410 Katsuyama, T., 263, 273, 276, 277 Katzir, Z., 226 Kaufman, S. J., 302, 305–306 Kawaguchi, A., 40 Kawakami-Kimura, N., 260 Kawakita, M., 343, 344 Kawamoto, R., 109, 124, 129, 146, 187 Kawamoto, T., 109, 124, 129, 146, 187 Kawano, T., 99, 100, 260, 266, 275 Kawasaki, C., 281 Kawasaki, N., 145 Kawasaki, T., 200, 224, 225 Kawashima, H., 156, 243–246, 259–262, 265, 268, 272, 399, 407 Kawashima, S., 76, 81 Kayserili, H., 337, 344 Kechvar, J., 375–377, 379 Keck, B., Keller-Peck, C., 357 Kelley, R. I., 325, 336, 338, 355, 374, 376, 377, 379 Kelly, A. M., 324 Kelly, D., 372, 373, 377 Kelly, R. J., 259, 260, 284 Kennedy, C., 337, 345, 355, 369 Ketonen, L., 377 Kettenmann, H., 40
423
Author Index
Key, M. E., 274 Khalil, N., 337, 345, 355, 369 Khalyfa, A., 57 Khan, J., 228 Khokha, R., 206 Khoo, K. H., 144, 148, 149, 152, 260–262, 265, 268, 399, 406 Khuri, F. R., 144 Kieffer, J. D., 96 Kiessling, L. L., 108 Kieviet, E., 226 Kikuchi, M., 281 Kikuchi, N., 187 Kimata, K., 59 Kim, K. S., 76, 224 Kim, M., 47, 48 Kim, Y. S., 144 King, G. L., King, S. L., 96, 100 Kingsley, P. D., 174 King, V. R., 41, 58 Kinoshita, M., 337 Kinoshita-Toyoda, A., 76, 77, 84 Kirby, M., 47, 48 Kirchhoff, F., 40 Kiso, M., 96, 99, 260 Kiss, J. Z., 26 Kitagawa, H., 59, 61 Kitajima, M., 187 Kjellen, L., 59 Kleene, R., 26 Klein, C., 40 Klein, E. A., 144 Klein, M. A., 169 Kleinschmidt, A., 95 Klinkert, W., 40 Kmiec´, Z., 228 Knibbs, R. N., 100 Knobeloch, K. P., 74 Kobata, A., 114, 200, 325, 388 Kobayashi, K., 161, 169, 337, 343, 344, 354, 355, 374, 377 Kobayashi, M., 59, 263, 271, 273, 274, 276–280, 283, 284, 286, 370, 380, 399, 410 Kobayashi, T., 124 Kobayashi, Y. M., 380 Koepnick, K., 368 Koizumi, S., 187, 190, 198 Kojima, N., 96 Kollet, O., 95 Kondo-Iida, E., 337, 344 Kondo, M., 355, 374, 377 Kong, D., 95 Kornblum, H. I., 28 Korner, C., 339, 350 Kornfeld, R., 206 Kornfeld, S., 174, 206
Koseki-Kuno, S., 193, 200, 201 Kosinski, C. M., 58 Kost-Alimova, M., 370, 371, 373, 378 Kotani, N., 354 Koudstaal, J., 228 Koulis, A., 273 Koutsioulis, D., 114 Koya, D., Koyama, S., 76 Koyasu, T., 355, 377 Kozono, Y., 185, 187, 197 Kozutsumi, Y., 74, 76 Kraal, G., 179 Kraemer, P., 27, 29 Kraus, M. D., 281 Kremmer, E., 95 Kriegstein, A. R., 40 Krishnamurthy, K., 85 Kroger, S., 345 Kronenberg, M., 138 Kronewitter, S. R., 108 Krueger, R. C., Jr., 42 Kruus, S., 377 Krzewinski-Recchi, M. A., 109 Kuang, W., 299, 309 Kubik, J., 227 Kubota, T., 109, 124, 129, 146, 187 Kudo, A., 339, 345, 354, 375 Kudo, T., 74, 76, 109, 124, 129, 144, 146, 187, 190, 198 Kudryashova, E., 297 Kuhlenschmidt, T., 225 Kuhn, H. G., 26, 28 Kuhns, W., 124, 129 Kulhavy, R., 225 Kulik, M., 76, 77, 84, 85 Kulkarni, R. N., 207 Ku, M., 74 Kuno, A., 185, 187, 193, 197, 200, 201 Kunz, S., 324, 368, 370, 375, 380, 381, 388 Kupper, T. S., 96, 100 Kurahashi, H., 299, 338, 374, 376 Kurata-Miura, K., 187 Kurose, K., 11 Kurpios, N. A., 388 Kurt Drickamer, K., 206 Kusano, H., 378 Kusche-Gullberg, M., 59 Kusunoki, S., 325, 388 Kwon, Y. D., 187 Kyan, A., 399, 408 L Laabs, T., 41, 58 Lairson, L. L., 98 Lammerding, J., 300 Lander, E. S., 370
424 Landry, D., 114 Lane, N. E., 169 Lane, P. W., 370, 375 Langenbach, R., 124 Lange, R., 27, 29 Lange, S., 296 Languino, L. R., 144 Lan, H. Y., 280 Lanier, L. L., 399, 407 Lanneau, G. S., 110, 111, 114, 118, 119 Lapidot, T., 95 Larsen, M., 390 Larsen, R. D., 186 Larso, G., 228 Larsson, L., 280 Lasky, L. A., 258, 260, 283 Lassmann, H., 375–377, 379 Laszik, Z., 96, 110, 111, 114, 118, 119 Lau, K. S., 206 Lavdas, A. A., 26 Lawson, A. M., 42 Laywell, E. D., 41, 49 Leahy, J. L., 207 Le, A. V., 225 Le Bourhis, X., 109 Lebrilla, C. B., 108 Le Couteur, D., 228 Le, D. T., 223, 225, 227–230 Lee, C. C., 301 Lee, C. J., 374 Lee, H., 273 Lee, I., 144–145, 150 Lee, J. C., 325, 336, 378 Lee, J. Y., 96, 100 Lee, M., 354 Lee, S. H., 143, 144, 148, 149, 152, 155–157, 160–163, 165–169, 246, 399, 406 Lee, S. U., 169 Lee, W., 27, 28 Lee, Y. C., 225, 226, 372, 374–378 Lefeber, D. J., 108 Leffler, H., 76, 258, 259, 272 Lehesjoki, A. E., 337, 344, 345 Lehle, L., 324 Lehmann, S., 41 Lei, K., 300 Leisti, J., 377 Lemmon, V. P., 339, 345, 354, 358, 376 Lengeler, K. B., 161, 169 Lentini, A., 227 Leonardi, J., 108 Leone, D. P., 58 Leone, O., 275 Lepenies, B., 108 Leppanen, A., 187 Leprince, P., 42 Le Roy, C., 206 Leung, J. O., 224
Author Index
Levedakou, E. N., 372–374, 376, 377 Levery, S. B., Levinson, D., 281 Levinson, S. R., 206, 230 Levy, D., 388 Levy, G. G., 223, 225, 227, 230 Lew, A. M., Ley, K., 156, 260 Lichtman, J. W., 357 Lider, O., 95 Lien, C. F., 388 Li, F., 95 Li, J., 108 Lim, D. A., 40, 66 Lin, C. P., 98 Lindebaum, M., 376 Lindell, G., 249 Lindenbaum, M., 378 Lindros, K., 228 Linhardt, R. J., 76, 77, 83, 84 Lin, S., 281 Lin, X., 84 Lipes, M. A., Lipina, T., 206 Liping, Y., 380, 381 Lipman, D. J., 76 Lipp, M., 95 Litwack, E. D., 376 Liu, H., 111 Liu, J., 59, 339, 345, 353, 354, 358 Liu, W., 77 Liu, X., 95, 110 Livak, K. J., 77, 80, 327 Li, X., 299, 353, 354, 406 Li, Y., 95 Li, Z. F., 296, 303 Lochmuller, H., 169 Lochter, A., 41–43, 57 Lodish, H. F., 207, 225, 226 Loeb, J. A., 224, 225 Lohmueller, J., 370 Lohning, M., 281 Lommel, M., 323, 324, 329, 332–335, 338, 339, 350, 374, 388 Long, J. M., 27, 206, 230 Longman, C., 169, 337, 345, 354, 355, 369, 379 Lonngren, J., 226 Lonn, H., 226 Lotan, R., 114, 146 Louis, S. A., 50 Love, D. R., 294 Loveless, R. W., 42 Lowe, J. B., 74, 100, 145, 146, 156, 157, 161, 186, 206, 244, 259, 260, 272, 275, 399, 407 Lubetzki, C., 26 Lucka, L., 74 Ludwig, W., 48 Lui, J., 376
425
Author Index
Lui, L., 376, 378, 379 Luo, T., 376, 378 Lupi, R., 207 Lupu, F., 108, 110, 129 Lupu, R., 144 Luu, Y., 156, 157, 160–163, 165–169, 246 Lu, Z. P., 339, 345, 379, 381 Lyer, P. N., 150 M MacDermott, R., 273 MacDonald, T. T., 124, 165 Macfarlane, G. T., 124 Macfarlane, S., 124 Macher, B. A., 99 Machida, E., 143 Macht, M., 325 MacKinnon, S., 85 Macpherson, A. J., 133 Macpherson, G. G., 133 MacPike, A. D., 375 Maddatu, T. R., 372, 374, 375, 377, 378 Madsen, K. L., 278 Madson, M., 380, 381, 388 Maffei, L., 41 Magid, M., 95 Magnani, J. L., 43, 96, 275 Magnuson, T., 27, 29 Maherali, N., 74 Makita, S., 135 Maki, W., 407 Malarkey, D., 228 Malatesta, P., 40 Malicdan, M. C., 296 Mallott, J. M., 376 Maly, P., 100, 259, 284 Mamon, J. F., 224 Mandl, C., 41–43, 57 Maness, P. F., 26 Manfredi, M., 344, 354 Mansson, O., 96, 275 Many, A., 95 Manya, H., 161, 169, 324, 327, 337, 339, 343–345, 347, 349, 350, 354, 375 Manzoni, O. J., 26 Marek, K. W., 157, 207 Margolis, R. U., 324, 327, 344 Mariorana, A., 388 Markovich, D., 246 Marks, R. M., 186, 259, 284 Maronpot, R., 228 Marselli, L., 207 Marshall, 2nd, G. P., 49 Martensson, S., 249 Marth, J., 81 Marth, J. D., 17, 26–29, 74, 156, 157, 160–163, 165–169, 174, 206–208, 210, 211, 213, 216,
217, 219, 220, 223, 225, 227–230, 244, 246, 259–262, 265, 268, 272, 275 Martin, F. E., 132 Martin, P. T., 169, 291–294, 305, 306, 308, 309, 312, 388 Martin-Rendon, E., 324 Masayama, K., 41 Masini, M., 207 Massey, J. M., 57 Masubuchi, N., 339, 345, 354, 375 Masumoto, J., 273, 276, 279, 280 Matani, P., 26 Matese, J. C., 76 Mathews, K. D., 325, 336, 338, 355, 371, 374–377, 379 Matsas, R., 26 Matsubara, T., 59 Matsui, F., 41, 42, 52, 55, 58 Matsumoto, A., 200 Matsumoto, M., 97 Matsumura, K., 301, 304, 325, 339, 344, 345, 354, 375, 388 Matsuoka, T., 124 Matta, K. L., 144 Matthews, R. T., 57 Mattioli, P., 227 Matundan, H., 42 Maugenre, S., 345, 348–350 Mayer, J. E., Jr., 96 Mayer, L., 124 Mayer, U., 298 Mayes, D., 57 Mbebi, C., 42 McAuley, J. L., 246 McCaffery, P. J., 376, 378 McCarroll, S. A., 370 McCarthy, M. I., 207 McCaughan, G., 228 McCourt, P., 228 McCullagh, K. J., 297 McCuskey, M., 228 McCuskey, R., 228 McDaniel, J. M., 108–110, 129, 144, 157, 161, 165, 166, 168, 245 McEver, R. P., 96, 108, 110, 129 McFarlane, I., 143 McGee, S., 110 McGuckin, M. A., 246 McGuire, E. J., 174 Mckeown-Longo, P., 225 McLaughlan, J. M., 345, 369, 371, 372, 375, 378, 379 McLean, A., 228 McMahon, S. B., 41, 58 McNeil, P. L., 324, 375 McVicker, B., 227 Meddings, J. B., 124 Medina, D., 388
426 Medini, P., 41 Medzhitov, R., 124 Megeney, L. A., 303, 309 Meier, H., 375 Meijer, C. J., 273, 275 Meijerink, J. P. P., 166, 168, 245 Meinen, S., 302 Mein, R., 169, 354 Mei, P. C., 339, 345, 354, 358, 376 Meissner, A., 74 Melcon, G., 299 Mellgren, R. L., 295, 301 Mellor, R. H., 357 Melo, L. G., 95 Mempel, T. R., 272 Mendell, J. R., 369, 378 Mendelsohn, R., 169 Menendez, J. A., 144 Mennesson, B., 74 Meno, C., 338 Mercuri, E., 337, 339, 344, 345, 369 Meredith, S. C., 111 Merkle, F. T., 26 Merkx, G., Merlini, L., 337, 344, 345, 348–350, 355, 369 Merrill, A. H., Jr., 85 Merzaban, J. S., 98, 156 Mesnard, R. M., 274 Messina, S., 339, 345, 369 Messing, A., 369, 376–378 Mestecky, J., 225 Metzler, M., 206 Michalski, J., 225 Michele, D. E., 294, 298, 299, 304, 324, 325, 336, 338, 344, 355, 369, 374–381, 391 Michelson, A. M., 299 Michielse, C. B., 345, 369, 372 Migaldi, M., 388 Mikami, T., 41, 42, 53, 55, 58, 59, 61, 63, 65 Milatovich, A., 368, 372 Miller, G., 297 Miller, W., 76 Mills, K. A., 371 Milner, D. J., 296, 302, 305–306 Minagawa, S., 399, 401, 408 Miner, J. J., 108 Ming, G. L., 26 Minnear, F., 228 Minowa, M. T., 206–211, 213, 216, 217, 219, 220 Mio, H., 187, 190, 198 Miosge, N., 336 Misaki, K., 374 Misawa, K., 227 Mita, S., 59 Mitoma, J., 28, 99, 100, 145, 146, 156, 244, 257, 259–263, 265, 266, 268, 273, 275–277 Mitsuhashi, H., 161, 169, 337, 344, 354
Author Index
Mitsuoka, C., 260 Mittmann, T., 57 Mi, Y., 224 Miyachi, Y., 124 Miyagoe-Suzuki, Y., 299, 339, 345, 354, 375, 379, 381 Miyagoe, Y., 299 Miyake, K., 324, 375 Miyake, M., 344 Miyake, S., 76 Miyamoto, K., 339, 345, 354, 375 Miyasaka, M., 97 Miyata, K. K. F., 355, 377 Miyata, T., 40 Miyazaki, K., 145 Miyazaki, T., 99, 100, 260, 266, 275 Miyoshi, E., 145, 150 Miyoshi, T., 355, 377 Mizumoto, S., 59 Mizuno, M., 161, 169, 337, 344, 354 Mizuochi, T., 200 Mollicone, R., 74 Monroe, R. S., 224 Montanaro, F., 304, 355, 378 Monteleone, G., 124, 165 Moon, D., 228 Moonen, G., 42 Moon, L. D., 41, 58 Moore, C. J., 371, 375, 378, 379 Moore, S. A., 298, 324, 355, 369, 375–379, 381, 391 Moorman, A. F., 80 Moor, R. E., 165, 166 Morais, V. A., 99 Mora, M., 339, 345, 369 Morava, E., 108 Morell, A. G., 224, 225 Morelle, W., 225 Moremen, K. W., 73–77, 79, 81, 84, 85 Morham, S. G., 124 Moritz, S., 41 Moriya, T., 399, 410 Mornet, D., 378 Moroi, R., 84 Morozumi, K., 109, 124, 129, 146, 187 Morris, H. R., 99, 100, 206, 230, 260, 266, 275 Morrison, S., 225 Morris, T., 399 Morse, H. L., 388 Morshead, C. M., 47, 48 Morteau, O., 124 Mortensen, B., 225 Mosca, F., 207 Moukhles, H., 376, 378, 379 Mounkes, L. C., 300 Moza, M., 296 Mrsny, R. J., 124 Mueller, U., 388
427
Author Index
Mu¨hlenhoff, M., 26, 27 Muir, E., 42, 61 Muirhead, D. E., 324, 375 Muller, M., 228 Muller, W. J., 206, 388 Mulligan, R. C., 333 Mullins, R. F., 378 Muntoni, F., 169, 325, 337, 339, 344, 348, 355, 368, 369, 372, 374, 375, 379, 381, 388 Murakami, T., 407 Muramatsu, H., 42, 74 Muramatsu, T., 42, 55, 74, 85, 96, 244, 259, 266, 286 Murata, T., 124 Murata, Y., 228 Murray, B. W., 99 Murray, J. C., 371, 375 Murthy, A. K., 165 Murthy, S. N. S., 166 Muschler, J., 380, 388 Musfeldt, M., 132 Mu, W., 280 Myerscough, N., 124, 144 Myers, D. D., 370, 375 Myers, E. W., 76 N Nabi, I. R., 169, 206 Nachbar, M. S., 187 Nadanaka, S., 41, 42, 55 Nadeau, J. H., 371 Nadkarni, M. A., 132 Nagai, Y., 339, 345, 360, 379, 381 Nagamachi, M., 124 Nagane, M., 14 Naggert, J. K., 372, 374, 375, 377, 378 Nagler, A., 95 Nagy, A., 333 Nagy, P., 228 Nairn, A. V., 73–77, 79, 81, 84, 85 Nair, R. P., 186 Naito, Y., 74, 76 Nakagawa, H., 59 Nakagawa, S., 187, 190, 198 Nakahori, Y., 344 Nakajima, A., 344 Nakajima, T., Nakamura, A., 187 Nakamura, M., 228 Nakamura, N., 263, 273, 276, 277 Nakamura, T., 360 Nakamura, Y., 337, 374 Nakane, P. K., 274 Nakanishi, H., 109, 111, 124, 129, 144, 187 Nakanishi, K., 41, 42, 52, 55, 58 Nakanishi, N., 378, 379 Nakano, O., 399, 405
Nakashima, K., 59 Nakatani, M., 301 Nakayama, J., 143, 156, 161, 244, 259, 263, 271–280, 283, 284, 286, 370, 380, 399, 408, 410 Narimatsu, H., 74, 76, 109, 111, 124, 129, 144, 146, 185, 187, 198, 378, 379 Narimatsu, Y., 111 Narravula, S., 161 Nashed, M., 96 Natsuka, S., 260 Natsuka, Y., 260 Natsume, A., 187, 190, 198 Naundorf, A., 109, 124, 129, 144, 187 Nayeb-Hashemi, S., 228 Neilson, E. G., 388 Neitz, A., 57 Nelson, S. F., 28 Nerbonne, J. M., 357 Nerl, C., 95 Nestle, F. O., 407 Neufeld, E. J., 96 Neville, M. C., 99 Newburger, J. W., 96 Newgard, C. B., 207 Ngamukote, S., 85 Ng, R. A., 324, 375 Nguyen, H. H., 301, 305, 308, 310, 312, 378 Nguyen, Q. T., 357 Nichol, S. T., 370 Nie, J., 74 Nieves, E., 379 Nikitin, T., 377 Nikolic-Paterson, D. J., 280 Nikolova, V., 300 Nishihara, S., 187, 190, 198 Nishikawa, A., 209 Nishikawa, S., 246 Nishimoto, A., 339, 345, 379, 381 Nishina, P. M., 372, 374, 375, 377, 378 Nishino, I., 325, 336, 338, 355, 369, 374, 376, 377, 379, 381, 391 Nishio, Y., Nishi, T., 187 Nishiuchi, R., 145 Nishizono, H., 228 Nitta, Y., 228 Nizet, V., 223, 227–230 Noctor, S. C., 40 Noel, G., 376, 378, 379 Noggle, S., 85 Noguchi, S., 376 Noll, T., 109 Nomoto, M., Nomura, Y., 344 Nonaka, I., 376 Nonomura, C., 111 Nordenskjold, M., 370
428
Author Index
Normand, E., 26 North, S. J., 74, 76 Novak, E. J., 201 Novogrodsky, A., 114 Nudelman, E. D., 96 Ny, A., 110 Nybakken, K., 84 Nye, E., 110 O O’Dell, J. R., 169 Odent, S., 348, 350 O’Donnell, N., 157 Oehl-Jaschkowitz, B., 354 Ogawa, A., 207 Ogawa, M., 40 Ogilvie, C. M., 369 Oguri, S., 207 O’Hara, C., 281 Ohashi, K., 227 Ohira, A., 228 Ohkura, T., 185, 187, 197, 378, 379 Ohlendieck, K., 292 Ohnuma, A., 354 Ohsawa, Y., 297, 302 Ohshima, K., 281 Ohtake, S., 42, 59, 84 Ohtani, H., 273, 274, 276, 278–280, 283, 284, 286 Ohtsubo, K., 74, 169, 174, 205–208, 210, 211, 213, 216, 217, 219, 220, 260–262, 265, 268 Ohyama, C., 144, 148, 149, 152, 397, 399, 401, 403, 405, 406, 408, 410 Oinonen, T., 228 OjConnell, P. J., 207 OjDonnell, N., 207 Okada, T., 109, 124, 129, 146, 187, 207 Okamura, K., 187 Okano, H., 40 Oka, Y., 207 Okazaki, H., 227 Okazaki, I., 42, 55 Okinaga, T., 376 Okita, K., 74 Okubo, R., 187, 190, 198 Okuda, S., 76, 81 Okumoto, K., 227 Okuno, M., 144 Okuno, Y., 74, 76 Oldstone, M. B. A., 368, 370, 380, 381, 388 Oliveira, J., 354 Olney, A. H., 345 Omori, Y., 355, 377 Ong, E., 59, 156, 157 Onifer, S.M., 57 Onodera, Y., 227 Ono, K., 27, 29
Oohira, A., 41, 42, 52, 55, 58 Ookubo, R., 187, 190, 198 Ophoff, R. A., 370 Oppenheimer, S. B., 108 Oppenheim, J. D., 187 Orci, L., 207 Oriol, R., 74 Orntoft, T. F., 80 Osawa, M., 344, 348, 350 Osuga, J.-I., 227 Otani, H., 338 Ottenberg, K., 109 Ottenheijm, C. A., 297 Ott, S. J., 132 Ou, J., 28 Ou, L., 95 Ozcelik, T., 368 Ozono, K., 376 P Paavonen, T., 273, 276 Pacher, P., 308, 309 Packer, N. H., 249 Padilla, F., 26, 33 Paggi, P., 379 Paglino, J., 124 Paietta, E., 224 Palma, A. S., 99 Palmer, T. D., 28 Pals, S. T., 273, 275 Pane, M., 344 Panico, M., 99, 100, 206, 230, 260, 266, 275 Pan, J., 96 Papastefanaki, F., 26 Parano, E., 354 Paraskeva, C., 144 Park, C. Y., 16 Park, E. I., 224, 225, 227 Park, H., 85 Parkhurst, S., 225, 226 Park, J.-H., 224 Parsons, S. A., 302 Parsons, S. F., 110, 111 Partridge, E. A., 206 Pasha, Z., 95 Patel, P. N., 41, 58 Patnaik, S. K., 379 Patton, B. L., 304, 377 Pattyn, F., 80 Paulsen, H., 144 Pavao, M. S., 41 Pavli, P., 133 Pavone, P., 354 Pawling, J., 206 Peachey, N. S., 372, 374, 375, 377, 378 Pearson, P. L., 207 Pedemonte, M., 344, 354
429
Author Index
Pegoraro, E., 339, 345, 369 Peled, A., 95 Pena, A., 333 Pendas, A. M., 300 Peng, J., 297 Perez-Atayde, A. R., 281 Perkins, H. M., 144 Perrimon, N., 84 Peter, A. K., 297, 301 Peterson, A. C., 377 Peterson, D. A., 28 Peterson, R. G., 207 Petit, I., 95 Petit, V., 388 Petridis, A. K., 26 Petrini, S., 344, 354 Petrof, B. J., 324 Petrucci, T. C., 379 Petryniak, B., 145, 146, 156, 157, 161, 244, 259, 260, 260–262, 265, 268, 272, 275, 284 Pewzner-Jung, Y., 85 Peyrard, M., 370, 371, 373, 378 Philip, M., 111 Phillips, J., 225 Phillips, N., 57 Philp, A. R., 378 Piacentini, M., 227 Piacibello, W., 95 Piccaluga, P. P., 275 Piccioli, M., 275, 280 Picker, L. J., 272, 275 Pierce, J. M., 74, 76, 77, 79, 81, 84 Pierce, M., 114, 144–145, 150 Piercy, R. J., 339, 375 Pieri, F., 280 Pileri, S. A., 275, 280 Piller, F., 110, 144 Piller, V., 110, 144 Pirard, S., 42 Piredda, L., 227 Pizzorusso, T., 41 Plath, K., 74 Plomann, M., 27, 29 Podolsky, D. K., 124, 161 Poggi, S., 280 Polk, D. B., 165, 166 Pollera, M., 207 Pollex-Kruger, A., 144 Ponda, P. P., 124 Ponomaryov, T., 95 Ponting, C. P., 337, 345 Poot, M., 370 Popat, R. J., 41, 58 Popko, B., 372–374, 376, 377 Poppe, B., 80 Porter, W. R., 226 Pozzoli, U., 370 Prados, B., 332–335, 338, 374, 388
Prandini, P., 337, 345, 379 Priatel, J. J., 206 Pricer, W. E., Jr., 224 Prior, S., 339, 375 Probert, C. S., 124 Prochiantz, A., 40 Properzi, F., 42, 57, 61 Pruszak, J., 48 Przemeck, G. K. H., 332–335, 338, 374, 388 Puckelwartz, M. J., 300 Pujol-Borrell, R., 273 Puri, K. D., 260 Q Qasba, P. K., 99 Qi, Y., 353, 354 Quackenbush, E. J., 260 Quaggin, S., 206 Quesenberry, M. S., 224 Quijano-Roy, S., 300, 345, 348–350 Quinlan, J. G., 309 Qu, Q., 76, 376, 378, 379 R Rabinovitch, P. S., 201 Rabuka, D., 161, 244, 272, 275 Racevskis, J., 224 Radbruch, A., 281 Rader, E. P., 324, 375 Radke, M. H., 297 Rafael, J. A., 301 Rafii, S., 96, 100 Rajewsky, K., 27, 29 Raju, T. S., 206 Rakoff-Nahoum, S., 124 Ramakers, C., 80 Ramakrishnan, B., 99 Ramakrishnan, H., 26 Raman, R., 84 Ramasamy, V., 99 Ramirez, K., 156, 157, 160–163, 165–169, 246 Ranscht, B., 26, 27, 29 Rao, N., 96 Rapisarda, D., 371, 375 Rapola, J., 377 Rath, E. M., 373, 377 Ravazzola, M., 207 Ravid, A., 114 Ravkov, E. V., 370 Rayburn, H. B., 377 Ray, J., 28, 66 Raymackers, J. M., 303 Ray, P., 345 Razawi, H., 325 Rebres, R., 225 Reck, F.,
430 Reda, D. J., 169 Rees, C. A., 76 Reinhold, V. N., 206 Reitsamer, H. A., 375–377, 379 Relvas, J. B., 58 Rendon, A., 378 Renes, I. B., 245 Renkonen, J., 273, 276 Renkonen, R., 273, 276 Renner-Mu¨ller, I., 332–335, 338, 374, 388 Rensen, P. C. N., 226 Renz, M., 258 Resta-Lenert, S., 124 Rettino, A., 388 Reutter, W., 74 Rex, M., 378 Reynolds, B. A., 28, 49, 50 Rezniczek, G. A., 294 Rhodes, J. M., 124 Rhodes, K. E., 57 Ricci, E., 344 Rice, J., 388 Rice, K. G., 225, 226 Richard, I., 295 Richard, P., 345, 349, 350 Richards, J. C., 108 Richardson, P. M., 26 Ricordi, C., 207 Ridgley, J. A., 301 Rietze, R. L., 47, 48, 50 Rifai, A., 225 Rigato, F., 41 Rigters-Aria, C. A. E., 207 Riker, M. J., 378 Robbins, M. E., 369, 378 Roberson, R. S., 207 Robert, R. G., 369 Robinson, M. K., 96, 260, 275 Robinson, M. L., 42 Rockle, I., 26, 27 Roder, J. C., 206 Rodius, F., 378 Rodriguez, D., 348, 350 Roes, J., 27, 29 Rogers, C. E., 259, 260, 284 Rogers, J. H., 57 Rogister, B., 42 Rogler, C. E., 206 Rohde, E., 74 Rohrer, H., 47, 48 Rojek, J. M., 368, 370 Roman, J., 144 Romero, N. B., 337, 345, 348–350 Roncador, G., 275 Rooney, J. E., 303 Rosa, Mitche dela, 73 Roseman, S., 174 Rosenberg, R. D., 59
Author Index
Rosen, S. D., 156, 244, 258–260, 266, 272, 273, 283, 286 Ross-Barta, S. E., 369, 376–378 Rossi, A., 344, 354 Rossi, F. M. V., 156 Rossi, G., 388 Rotundo, R., 225 Rougon, G., 26, 29, 33, 43 Rouse, B. N., 275 Rouse, B. T., 260, 272, 275 Rowitch, D. H., 18 Royall, J. A., 128 Rozen, S., 76 Ruijter, J. M., 80 Ruiz, N. I., 226 Rumjantseva, V., 228 Ruotti, V., 74 Rurak, J., 376, 378, 379 Russell, S. J., 33 Rutishauser, U., 26, 27, 29 Ryan, L., 228 S Saba, T., 225, 228 Sabatelli, P., 337, 344 Sabattini, E., 275, 280 Sabeti, P. C., 370 Sachdev, G. P., 128 Sackstein, R., 93–96, 98, 100 Safina, A., 406 Saga, Y., 245 Sahel, J., 378 Saier, M. H., Jr., 76 Sainio, K., 377 Saint, D. A., 77 Saito, F., 325, 336, 338, 339, 345, 354, 355, 369, 374–380 Saito, H., 99, 100, 260–262, 265, 266, 268, 275, 399, 410 Saito, K., 344, 354 Saito, M., 399 Saito, S., 399 Sajin, B., 41 Saji, T., 124 Sakai, K., 343 Sakai, T., 187, 190, 198, 378, 379 Sakai, Y., 273, 274, 278, 283, 284, 286 Sakakihara, Y., 344 Sakuma, S., 42 Salamat, M., 336 Salih, M. A. M., 345, 369, 372 Salmi, M., 273 Samira, S., 95 Sandberg-Nordqvist, A.-C., 370, 371, 373, 378 Sandborn, W. J., 124 Sandkuijl, L. A., 207 Sanes, J. R., 357
Author Index
Sanjo, M., 227 Sansoucy, B. G., 144 Santavuori, P., 377 Santini, D., 275 Santorelli, F. M., 344 Santos, R., 354 Saran, R. K., 337, 345, 355, 369 Sarig, R., 295 Sarkar, M., 206 Sartor, R. B., 124, 278 Sasaki, J., 337, 360, 374 Sasaki, K., 187 Sasaki, T., 292, 325, 354 Sasisekharan, R., 84 Sasisekharan, V., 84 Sastry, M. V., 179 Sato, A., 248 Satoh, M., 399, 410 Sato, N., 187, 197 Sato, S., 355, 377 Sato, T., 4, 5, 9, 11, 14, 111, 185, 187, 190, 198, 378, 379 Sato, Y., 150 Satz, J. S., 298, 325, 336, 338, 355, 369, 374, 376–379, 381, 391 Saunders, T. L., 284 Sawa, H., 11 Sawai, H., 355, 377 Sawaki, H., 378, 379 Sawyer, T. K., 144 Saxena, A., 225, 226 Sbrana, S., 207 Scadden, D.T., 40, 66 Scapolan, S., 344, 354 Schachner, M., 26, 27, 41–43, 57–59 Schachter, H., 74, 108, 156, 161, 169, 174, 206, 345, 369, 379–381, 388, 391 Schachter, M., Schaerli, P., 260–262, 265, 268 Schaffer, L., 273 Schaffner, S. F., 370 Scheffer, H., 337, 344, 348 Scheff, S., 27, 29 Scheidegger, E. P., 260 Scheinberg, I. H., 224, 225 Scheper, R., 273 Scherpbier-Heddema, T., 371 Schertzinge, F., 26, 27 Schiefer, J., 58 Schietinger, A., 111 Schleper, R. L., 371, 375 Schmalzel, R., 371 Schmelzer, J. D., 369, 377, 378 Schmid, J. S., 58 Schmidt, G., 40 Schmittgen, T. D., 77, 80, 327 Schmitz, B., 42 Schnaar, R., 226
431 Schnadelbach, O., 41 Schoen, F. J., Schrader, J. W., 206 Schreiber, H., 111 Schreiber, S., 132 Schroeder, K. W., 278 Schubel, A., 95 Schughart, K., 331 Schuierer, G., 354 Schulte, B. A., 248 Schultz, J., 99 Schutte, K., 41 Schwarzkopf, M., 74 Schwientek, T., 143, 325 Scotting, S. J., 378 Sedergran, D. J., 166 Seeberger, P. H., 99, 100, 108, 260, 266, 275 Segawa, M., 344 Segi, E., 124 Seidahmed, M. Z., 345, 369, 372 Seidenfaden, R., 26, 27 Sekiguchi, K., 145 Sekine, S., 187, 190, 198 Seki, T., 26 Seko, A., 187 Sellon, R., 124 Seroussi, E., 370, 371, 373, 378 Seta, N., 343, 348, 350 Setiadi, H., 96 Sewduth, R. N., 369 Sewell, R., 109 Sewry, C., 345 Sewry, C. A., 169, 337, 345, 354, 355, 369 Sgambato, A., 368, 370, 388 Shafi, R., 157, 207 Shaheed, M. M., 345, 369, 372 Shah, R. S., 166 Shahsafaei, A., 281 Shamdeen, G. M., 354 Sharma, S., 388 Sharon, N., 114, 146 Sharrocks, A. D., 5 Sharrow, M., 26 Shavlakadze, T., 301 Shekels, L. L., 165, 166 Sherlock, G., 76 Sherman, D. L., 369, 377, 378 Sher, R. B., 295 Shia, M. A., 226 Shiao, T., 301 Shibata, T., 42 Shibazaki, M., 228 Shigeta, A., 97 Shi, H., 339, 345, 354, 358, 376 Shihabuddin, L. S., 66 Shim, H., 166 Shimizu, T., 325, 388 Shimodaira, K.,
432 Shinoda, K., 99 Shinomura, T., 59 Shinzawa, K., 225 Shiozawa, T., 96 Shi, Q., 4, 11 Shiraishi, N., 187, 190, 198 Shirane, K., 4 Shi, S. R., 274 Shivtiel, S., 95 Shrager, J. B., 324 Shultz, L. D., 95, 299 Shuo, T., 41, 42, 52, 55, 58 Shworak, N. W., 59 Sicinski, P., 295, 304 Siddiki, B. B., 144 Silasi-Mansat, R., 110 Silbert, J. E., 59 Silva, J., 85 Silver, J., 41, 57 Silvescu, C. I., 206 Simon-Santamaria, J., 228 Singer, M. S., 244, 258–260, 266, 286 Singleton, B. K., 110, 111 Sirko, S., 41, 42, 46, 48, 57–59, 65 Sironi, M., 370 Skaletsky, H., 76 Skordis, L., 339, 375 Skutelsky, E., 146 Skwarchuk, M. W., 369, 378 Slichter, S., 228 Sliedregt, L. A. J. M., 226 Sluka, K. A., 369, 377, 378 Slukvin, I. I., 74 Smalheiser, N. R., 292 Smedsrd, B., 225, 228 Smitham, J., 124 Smith, F. I., 76, 376, 378, 379 Smithies, O., 124 Smith, K., 133 Smith, P. L., 100, 259, 260, 284 Smith, R. S., 371, 372, 374, 375, 377, 378 Smithson, G., 259 Smorodchenko, A., 26 Smuga-Otto, K., 74 Soares-Silva, I., 354 Soji, T., 228 So, L., 156 Soleimani, L., 206 Soliven, B., 372–374, 376, 377 Somer, H., 325, 336, 338, 355, 374, 376, 377, 379 Sommer, I., 42 Song, H., 26 Sonnemann, K. J., 295 Srensen, A. L., 228 Srensen, K., 228 Sossey-Alaoui, K., 406 Souchkova, N., 260 Sowa, M., 144
Author Index
Speiss, M., 225, 226 Speleman, F., 80 Spencer, J. A., 98 Spencer, M. J., 295, 301 Sperandio, M., 156 Spicer, S. S., 248 Spierenburg, H. A., 370 Spiess, M., 224, 225 Spiropoulou, C. F., 368, 370 Spiro, R. G., 200 Splain, R. A., 108 Sporle, R., 331 Spricher, K., 138 Springer, T. A., 260 Squire, S., 301 Sridharan, R., 74 Srivastava, A. K., 345 Stadtfeld, M., 74 Stalnaker, S. H., 380, 381, 388 Stamper, H. B. Jr., 260, 283 Stankoff, B., 26 Stanley, P., 206, 379 Stedman, H. H., 310, 324 Steen, M. S., 302 Steere, A. C., 275 Steinbrecher, A., 337, 344, 369, 372 Steindler, D. A., 41 Steirer, L. M., 227 Stern, C. D., 42 Stevceva, L., 133 Stewart, R., 74 Stiles, C. D., 18 Stockert, R. J., 224 Stok, W., 136 Stone, E. L., 155–157, 160–163, 165–169, 246 Stoolman, L. M., 100, 186 Stowell, C. J., 110, 111 Stowell, S. R., 110, 111, 114, 118, 119, 187 Strahl, S., 323, 324, 329, 332–335, 338, 339, 350, 374 Stratton, J., 228 Straub, V., 161, 169, 325, 336–338, 354, 355, 374, 376, 377, 379 Straul, S., 388 Streeter, P. R., 260, 272, 275 Streit, A., 41–43, 57 Strengman, E., 207 Stroehmann, A., 281 Stroud, M. R., 96 Struwe, M., 331 Stults, C. L., 99 Stupka, N., 301, 311 Suda, Y., 246 Suefuji, H., 281 Sugahara, K., 41, 42, 53, 55, 58, 59, 61, 63, 65, 227 Sugai, M., 76 Suga, T., 399, 408
433
Author Index
Sugimoto, T., 360 Sugimoto, Y., 124 Sugumaran, G., 59 Suhonen, J. O., 28 Suhr, S. T., 28 Sullivan, T., 300 Sunada, Y., 297, 299, 325, 336, 337, 374 Sundaram, S., 379 Suter, U., 58 Sutton-Smith, M., 99, 100, 206, 230, 260, 266, 275 Suzawa, K., 273, 274, 276, 278–280, 283, 284, 286 Suzuki, A., 76, 227 Suzuki, H., 59 Suzuki, K., 372 Suzuki, M., 99, 100, 260, 266, 273, 275, 276, 279, 280 Suzuki, N., 187, 197 Suzuki, Y., 345, 349, 350 Suzumiya, J., 281 Swallow, D. M., 249 Sweeney, H. L., 324 T Tabak, L. A., 108 Tachibana, K., 187 Tachikawa, M., 339, 345, 374, 379, 381 Taddei, I., 388 Tagawa, K., 296 Tajima, Y., 376 Takagi, J., 144 Takahara, N., Takahashi, K., 74, 227 Takahashi, M., 145 Takahashi, S., 161, 169, 337, 344, 354 Takahashi, T., 399, 410 Takai, S., 246 Takaishi, S., 273 Takamatsu, S., 206–211, 213, 216, 217, 219, 220 Takasaki, S., 200, 354 Takashima, S., 193, 200, 201 Takata, K., 207 Takayama, S., 99 Takeda, K., 135 Takeda, N., 246 Takeda, S., 299, 338, 339, 345, 354, 360, 374, 375, 379, 381 Takeda, T., 227 Takematsu, H., 76 Takeshita, S., Takeuchi, M., 161, 169, 206–211, 213, 216, 217, 219, 220, 337, 344, 354 Takezawa, R., 225 Talim, B., 345, 348 Tamatani, T., 96 Tamura, Y., 227
Tanahashi, E., 99 Tanaka, K., 42 Tanaka, M., 59, 228 Tang, J., 206 Tang, Y., 124 Tani, A., 377 Taniguchi, K., 161, 169, 337, 343, 344, 354 Taniguchi, M., 338, 339, 345, 376, 379, 381 Taniguchi, N., 81, 145, 150, 206, 209 Taniguchi, Y., 338 Tan, J., 169, 206, 230, 354 Tanner, W., 324, 332–335, 338, 374, 388 Tannock, G. W., 278 Taratuto, A. L., 348, 350 Targan, S. R., 124 Tarp, M. A., 108 Tashiro, F., 339, 345, 379, 381 Taylor, C. T., 161 Taylor, F. B., 96 Taylor, M. E., 76, 206, 226 Taylor-Papadimitriou, J., 109, 143 Tchieu, J., 74 Temple, S., 40, 47, 48 ten Dam, G. B., 42, 61 Ten Hagen, K. G., 108, 174 Tenno, M., 173, 174, 178, 180, 181, 183 Terskikh, A., 26–29 Tessa, A., 344 Thall, A. D., 259, 284 Tham, T. N., 26, 33 Thatte, J., 156 Theocharidis, U., 42 Thiery, J. P., 388 Thiry, M., 42 Thisse, B., 84 Thisse, C., 84 Thomaidou, D., 26 Thomas, J. O., 187 Thomas, L. B., 41 Thomas, T. E., 47, 48, 50 Thomas, V., 225 Thompson, C., 27, 29 Thomson, J. A., 74 Thorens, B., 207 Thorgeirsson, S., 228 Thornburg, R., 225 Thorpe, S., 225 Tian, S., 74 Tian, W., 169 Tidball, J. G., 301 Tielker, D., 161, 169 Tiemeyer, M., 26 Tinsley, J. M., 301 Tobisawa, Y., 245, 246 Toda, K., 260 Toda, T., 337, 338, 343, 345, 360, 376 Togashi, H., 227
434 Togayachi, A., 109, 124, 129, 144, 146, 185, 187, 190, 197, 198 Toida, T., 42, 61, 76, 77, 83, 84 Toki, D., Tokimatsu, T., 76, 81 Tokita, Y., 41, 42, 52, 55, 58 Tokunaga, T., 246 Tomana, M., 225 Tomasiewicz, H., 27, 29 Tome, F. M., 294 Tomonaga, M., 281 Tomooka, Y., 246 Tom, V. J., 57 Tone, Y., 61 Topaloglu, H., 345, 348, 354 Topaz, O., 174 Torelli, S., 169, 325, 337, 344, 345, 354, 355, 368, 369, 372, 374, 379, 388 Tornehave, D., 280 Torri, S., 207 Totsuka, T., 135 Townsend, R. R., 225–227 Toyoda, H., 76, 77, 84 Tozawa, R.-I., 227 Tramontin, A. D., 40, 66 Tran, C. V., 76 Tran, T., 246 Tremaine, W. J., 278 Trevejo, J. M., 66 True, D. D., 260 Tsay, D., 244, 259, 266, 286 Tseng, Y.-H., 207 Tse, R., Tsuboi, K., 124 Tsuboi, S., 156, 157, 399, 403, 405 Tsuchiya, N., 399, 401 Tsuchiya, T., 281 Tsujimoto, G., 74, 76 Tsukada, T., 246 Tsukahara, T., 376 Tsunoda, Y., 187, 197 Tsutsumi, K., 61 Tuma, D., 227 Tun Kyi, A., 407 Turk, R., 378 Turnbull, E. L., 133 Turner, A., 369, 378 Turner, J. R., 124, 161 Turovskaya, O., 138 Tvaroska, I., Tybulewicz, V. L., 333 Tynninen, O., 273, 276 Tyrrell, D., 96 U Uchimura, K., 59, 96, 244, 259, 266, 286 Uchiyama, N., 193, 200, 201
Author Index
Uchiyama, S., 223, 227–230 Ueda, Y., 246 Ueoka, C., 42, 55 Ugo, I., 345 Ujita, M., 187 Ulfman, L. H., 260 Ullmann, U., 132 Umemoto, E., 97 Uncini, A., 377 Ungar, D., 108 Unger, E., 376 Unger, R. H., 207 Unverzagt, C., 224 Uraushihara, K., 135 Utikal, J., 74 Uyanik, G., 339, 348, 350, 354 V Vael, T. Courtoy, P., 226 Vainzof, M., 294 Vaishnava, S., 162 Vajsar, J., 345 Valcanis, H., 47, 48 Valero, M. C., 324, 332–335, 338, 374, 388 van Berkel, T. J. C., 226 Van Beusekom, E., 337, 344 van Bokhoven, H., 339, 348, 350 van den Elzen, C., 337, 344, 348 van den Hamer, C. J. A., 224, 225 Van den Steen, P., 174 Van der Heijden, P. J., 136 Van der Sluis, M., 166, 168, 245 Van Der Smissen, P., 226, 228 Van Der Zwaag, B., 337, 344, 370 Vandesompele, J., 80 van Die, I., 108 van Dinther-Janssen, A. C., 273 Van Eldik, L. J., 124 Van Goudoever, J. B., 166, 168, 245 van Kessel, A. G., van Kooyk, Y., 76 van Kuppevelt, T. H., 42, 61 van Leeuwen, S. H., 226 van Reeuwijk, J., 337, 344, 345, 348, 369, 372 van Rossenberg, S. M. W., 226 Van Roy, N., 80 Van Seuningen, I., 245 Van Someren, H., 207 Van Tilburg, J. H. O., 207 van’t Slot, R., 370 Varilly, P., 370 Varki, A., 74, 81, 108, 223, 225–227, 230, 259 Varki, N. M., 206, 223, 227–230 Vaughan, M. M., 406 Vavasseur, F., 144 Velazquez, P., 138
435
Author Index
Velcich, A., 166, 168, 245 Vellon, L., 144 Verbeek, N. E., 370 Vercoutter-Edouart, A. S., 109 Verdiere-Sahuque, M., 42 Vergnes, L., 300 Verrey, F., 225 Verrips, A., 337, 344, 348 Viapiano, M. S., 57 Vilela-Silva, A. C., 41 Vintersten, K., 333 Vitry, S., 26, 33 Vliegenthart, J. F., 187 Vodyanik, M. A., 74 Vogelstein, B., 326 Voit, T., 337, 339, 345, 350, 355, 369 von Andrian, U. H., 156, 244, 259–262, 265, 266, 268, 272, 286 Von Holst, A., 40–42, 46–48, 53, 55, 57–59, 63, 65 Voorbij, H. A., 273 Vopper, G., 27, 29 Vorstman, J. A. S., 370 Voss, A. K., 47, 48 Vuillaumier-Barrot, S., 345, 348–350 Vutskits, L., 26 W Wada, K., 42 Wada, M. R., 339, 345, 354, 375 Wada, Y., 150 Waehler, R., 33 Wager, R. E., 224 Wagers, A. J., 100 Wagey, R. E., 50 Wagner, K. R., 302, 306 Wagoner, G., 57 Wagoner, M. R., 57 Wahlberg, J. M., 224 Wahrenbrock, M. G., 223, 225–227, 230 Wallace, M., 357 Walter, M. C., 354 Wandall, H. H., 228 Wang, F., 339, 345, 379, 381 Wang, G., 85 Wang, H., 300 Wang, L., 27 Wang, T. C., 273 Wang, W., 108, 110–112, 114, 118, 119 Wang, X., 145, 324, 327, 344 Wang, Y., 95, 108, 110–112, 114, 118, 119, 174, 206, 230 Ward, C. A., 95 Warner, L. E., 301 Warnock, R. A., 96, 260 Warren, A., 228 Warren, C. E.,
Watanabe, M., 42, 135, 187, 273, 274, 278, 283, 284, 286 Watanabe, R., 399 Watanabe, Y., 225 Watson, S. R., 260, 283 Watterson, D. M., 124 Weber, A., 42 Wehling-Henricks, M., 301 Wehling, M., 301 Wei, B., 109, 138, 144, 157, 161, 165, 166, 168, 245 Weigel, J., 228 Weigel, P. H., 225, 226, 228 Weinert, S., 297 Weinhold, B., 26, 27 Weir, G., 207 Weisman, W. H., 169 Weiss, L., 389 Weissman, I. L., 28, 283 Weissman, T. A., 40 Weiss, R. M., 378 Weiss, S., 28 Weisz, O., 226 Wells, D. J., 301 Wells, L., 380, 381, 388 Weninger, W., 260 Wernig, M., 74 Westmuckett, A., 108, 110, 129 Westphal, M., 18 Westra, S., 369, 376, 378 Wevers, R. A., 108 Weydert, C. J., 370 Wheeler, D. L., 76 Whisenant, T., 74, 76 Whitaker, C. M., 57 White, D. E., 388 Whitehouse, C., 143 Wiechens, N., 74 Wiegert, R., 227 Wijmenga, C., 207 Wiley, H. E., 407 Wilkinson, K. D., 150 Willard, M. T., 110, 111, 114, 118, 119 Willer, T., 299, 323, 324, 329, 332–335, 338, 339, 348, 350, 369, 370, 374, 378, 388 Williamson, R. A., 294, 297, 304, 325, 336, 369, 374, 376–378 Willmann, R., 304 Willnow, T. E., 227 Winkler, J., 348 Wisse, E., 228 Withers, S. G., 98 Witsell, D. L., 99 Wizenmann, A., 42, 57, 58, 65 Wodarz, A., 40 Wohlgemuth, R., 98 Wolber, F. M., 100 Wold, F., 225
436
Author Index
Wolf, E., 332–335, 338, 374, 388 Wong, C. H., 99 Wong, N. K., 74, 76 Wong, W. S., 40 Woodmansey, E. J., 124 Woodruff, J. J., 260, 283 Wopereis, S., 108 Wrabetz, L., 377 Wrana, J. L., 206 Wu, G., 295 Wu, L., 281 Wu, M. T., 407 Wynshaw-Boris, A., 27, 206, 230 X Xia, B., 108–112, 114, 118, 119, 128, 144, 157, 161, 165, 166, 168, 245, 305, 312 Xia, G., 59 Xia, J. Y., 110, 111, 114, 118, 119 Xia, L., 96, 108–110, 112, 118, 123, 129, 144, 157, 161, 165, 166, 168, 245 Xie, J., 76, 77, 84 Xie, W., 74 Xie, X. H., 370 Xie, Y.-G., 370, 371, 373, 378 Xiong, Y., 354 Xu, H., 294, 299 Xu, J., 58 Xu, M., 95 Xu, R., 302, 305, 308, 310, 312 Xu, S., 4 Y Yachechko, R., 74 Yagi, T., 246 Yago, T., 108 Yagyu, H., 227 Yahagi, N., 227 Yajima, Y., 59 Yamada, H., 325, 370, 388 Yamada, K. M., 42, 390 Yamada, M., 193, 200, 201 Yamada, S., 42 Yamada, Y., 187, 190, 198 Yamaguchi, T., 281 Yamaji, T., 76 Yamamoto, H., 76, 397 Yamamoto, K., 227 Yamanishi, Y., 76, 81 Yamanouchi, H., 354 Yamashita, K., 187, 200 Yamashita, S., 275 Yamauchi, S., 59 Yanagisawa, A., 345, 348–350 Yanagisawa, M., 26, 85 Yang, B., 368 Yang, J. M., 144
Yang, X., 206 Yang, Y., 225, 339, 345, 353, 354, 358, 376 Yao, L., 96 Yardley, J. H., 277 Yazaki, Y., 207 Yednock, T. A., 260 Yee, D., 27, 29 Yeh, J., 26 Yeh, J. C., 99, 100, 145, 146, 156, 157, 161, 186, 244, 260, 266, 272, 275 Yen, T. Y., Yet, M.-G., 225 Yik, J. H. N., 225, 226 Yi, L., 156 Yim, S. H., 207 Yin, J., 108 Yip, B., Yonkof, A. L., 57 Yoon, J. H., 305, 312 York, W. S., 74, 76, 77, 79, 81 Yoshida, A., 161, 169, 206–211, 213, 216, 217, 219, 220, 324, 327, 337, 344, 354 Yoshida, B. A., 111 Yoshida, K., 59 Yoshida-Moriguchi, T., 292, 324, 370, 375, 380, 381, 388 Yoshima, H., 200 Yoshioka, M., 344 Young, R., 74 Young, W. W., Jr., 174 Yousefi, S., 144 Yrlid, U., 133 Yuan, X., 47, 48 Yuasa, S., 339, 345, 354, 375 Yuen, C. T., 42 Yue, Y., 309 Yu, J. S., 42, 74 Yu, L., 388 Yu, R. K., 26, 85 Yu, S. Y., 144, 148, 149, 152, 260–262, 265, 268, 399, 406 Yuva, Y., 345
Z Zaccaria, M. L., 379 Zalc, B., 26 Zalik, S., 224 Zandian, M., 42 Zarif, M. J., 144 Zhang, D., 95 Zhang, J., 297 Zhang, L., 339, 345, 354, 358, 376 Zhang, P., 353, 354 Zhang, W., 161, 169, 345, 369, 379, 381, 391 Zhang, X., 26, 300 Zhang, Y., 26, 95, 109, 124, 129, 144, 174, 187
437
Author Index
Zhao, C., 26 Zhao, T., 95 Zhao, Y., 145, 150 Zharkovsky, A., 26 Zharkovsky, T., 26 Zheng, M., 296 Zheng, Q., 114 Zheng, X. L., 14 Zhou, B., 228 Zhou, D., 187 Zhou, Q., 296
Zhou, X., 95 Zhu, X., 298 Zhu, Y., 95 Ziltener, H. J., 156 Zimmermann, D. R., 41 Zipp, F., 26 Zollinger, W., 43 Zou, K., 42 Zou, P., 42 Zuna, R. E., 110, 111, 114, 118, 119 Zuo, D., 388
Subject Index
A Activated partial thromboplastin time (APTT), 231 Alpha-2 antiplasmin assay, 233 AMR. See Ashwell–Morell receptor Analgesia and anesthesia, tumor formation assays pentobarbital, 400 tribromoethanol, 400–401 Antibody production assay, ppGalNAcT-1 antigens for, 175–176 evaluation of, 177 process, 176–177 sera collection, 176 Antithrombin activity assay, 231–232 Apoptosis detection, ppGalNAcT-1 caspase 3 active form, using antibody, 179–182 TUNEL system, 182–183 Ashwell–Morell receptor (AMR) asialoglycoprotein receptors (ASGPRs), 225 endogenous ligands of, 227 hematology and coagulation analyses methods activated partial thromboplastin time, 231 alpha-2 antiplasmin assay, 233 antithrombin activity assay, 231–232 factor VII activity assay, 234 factor VIII activity assay, 234 factor X antigen assay, 234–235 fibrinogen activity assay, 233–234 plasminogen activity assay, 233 platelet levels and glycosylation, lectin binding, 230–231 protein C activity assay, 232 protein S antigen assay, 232–233 prothrombin time (PT), 231 Von Willebrand factor antigen assay, 235 hepatic lectin-1 and 2 (HL-1 and 2), 224–226 HL-1/ HL-2-deficient mice, genotyping, 229–230 lectin binding, VWF glycosylation detection, 235–236 molecular clearance mechanisms, hepatocytes in, 228–229 Asialoglycoprotein receptors (ASGPRs), 225 Ò Avertin , 400–401 B Baculovirus, 117–118 Basement membrane (BM), 388 b3GnT2 (B3GNT2) polylactosamine synthase
B3gnt2-/-lymphocytes, phenotype of CD28 and CD19 molecules, 193, 195 cell surface proteins analysis, 193–194 hypersensitive, TCR/CD28, 196 glycogenes for gene trapping vector, genomic localization of, 191 glycan structures, 189 glycosyltransferases, phylogenetic tree of, 188 in vitro assays for, 190 N-glycan polylactosamine reduction, B3gnt2-/-mice LEL, 187 repeating units, decreased numbers of, 192 protocols B3gnt2-/-mice generation of, 197 calcium flux analysis, 201 costimulated T cells, metabolic labeling of, 200 flow cytometric analysis, 200 genotyping of, 197–198 immunoprecipitation and lectin microarray analysis of, 200–201 in vitro assays, 198–199 LEL lectin-blot analysis, 199 lymphocyte isolation and proliferation assays, 201–202 B lymphocyte activation assay, ppGalNAcT-1, 174–175 C CAdC1 cells, treatment with SCFAs, 247 Calcium flux analysis, 201 Carbohydrate antigens, immunohistochemical analysis conventional immunostaining antigen retrieval methods, 274–275 HEV-like vessels quantification, 276–279 materials, 275 methods, 275–276 percentage of MECA-79þ vessels, 280 L-selectin.IgM chimera binding in situ binding assay, 285–287 preparation, 284–285 multiple immunostaining lymphocytes quantification, subsets, 283–284 materials, 280–281 methods, 281–283
439
440 Carbohydrate structural analysis, 250–253 Caspase 3 active form, apoptosis detection, 179–182 CD28 and CD19 molecules, B3gnt2-/-lymphocytes phenotype, 193, 195 Cell culture and transfection, b1,4GalT V, 5 Cell migration assay, attractant method, 147 Cell sorting and flow cytometry, a-dystroglycan, 389–390 Cell surface half-life time, GLUT2, 216–217 Cell-surface protein cross-linking, GnT-IVa galectin-9, 219–220 method for, 219 Cell surface proteins analysis, B3gnt2-/-lymphocytes, 193–194 Central nervous system (CNS) CSPGs and, 39–40 Large gene mutations, 376–377 expression of, in situ hybridization, 378–380 C2GnT2. See Core 2 b1,6-Nacetylglucosaminyltransferase-2 Chondroitin sulfate proteoglycans (CSPGs), in NSC niche CNS development, 39–40 functional analysis, in NSPCs chondroitinase ABC treatment, 57–58 intracerebroventricular injections in utero, 58–59 glycosaminoglycans chondroitin/dermatan sulfotransferases (C/D-STs), 59 primers and PCR conditions, 62 RT-PCR, 61–63 immunocytochemistry acutely dissociated cells, 46–47 adult neurogenic niche and SVZ-derived cells, 44 markers of, 42–43 microscopy, 66 monoclonal antibody 473HD (MAb 473HD), 41–42, 45 neurospheres cell CS/DS chains and sodium chlorate, 55–56 culturing methods, 50 differentiation assay, 50 immunoblot analysis, for biochemical analysis, 52–53 in situ hybridization of sulfotransferases, 63–65 model for, 51 purification and identification, of CSPGs, 53–54 sectioning and immunohistochemistry, 52 Coagulation factor levels, AMR-deficient mice, 229 Colonic-mucins, GlcNAc6STs, 249–252 Colony formation assay, a-dystroglycan, 392–393
Subject Index
Congenital muscular dystrophy (CMD), 344. See also a-Dystroglycanopathy Conventional immunostaining antigen retrieval methods, 274–275 HEV-like vessels quantification, 276–279 materials, 275 methods, 275–276 Core 2 b1,6-N-acetylglucosaminyltransferase-2 (C2GnT2) and core4 enzyme assays, 159–160 KO mice generation, 157 mass spectrometry, 160–161 PCR genotyping, of Gcnt3f/f and Gcnt3r/r mice, 157–158 phenotyping KO mice DSS-induced colitis model, 165–167 immunoglobulin level, naı¨ve mice, 162–165 Muc2 levels, 166–168 mucosal barrier function, 161–162 viability in, 161 UDP-GlcNAc concentration, 169 Core 3-derived O-glycans, intestinal mucins C3GnT-/-mice generation, 125 gene targeting, 126 glycosyltransferase assays, 127 LacZ staining, 127 PCR genotyping, 127–128 results and, 128 transcripts, RT-PCR analysis, 126 DSS-induced colitis immunohistochemistry, 135–136 intracellular cytokine staining, 136 model, 133, 135 results and analysis, 136–139 epithelial cells role, 124 Muc2 expression, C3GnT deficiency bacterial translocation, real-time PCR, 132 immunohistochemical staining for, 131 in vivo intestinal permeability, 132 results and analysis, 133–134 Tn antigen, C3GnT gene disruption anti-Tn immunohistochemical staining, 129 intestinal glycan structure analysis, 128–129 periodic acid-Schiff and Alcian blue staining, 129 results and analysis, 129–131 Core 4 enzyme activity and glycosylation, C2GnT2-deficient mice enzyme assay procedure, 159 reaction mixture purification, 159–160 tissue homogenization, 159 mass spectrometry, 160–161 Core O-glycans, biosynthesis, 259. See also Lymphocyte homing, core O-glycans Core 3 O-glycans, tumor suppressor a2b1 mediated tumorigenesis, 145 cell line generation, 145–146
441
Subject Index
core3 synthase, 144 detection methods of FACS analysis, 146–147 semiquantitative RT-PCR, 146 FAK signaling, 152–153 functional blocking antibodies, for intergrins determination, 147–148 heterodimerization assay, 151–152 lectin blotting, 151 migration assay, attractant role, 147 tumor formation assay orthotopic tumor cell injection, 149–150 subcutaneous injection, 150 western blotting, for a2 and b1 detection, 150–151 Costimulated T cells, b3GnT2 metabolic labeling, 200 CSPGs. See Chondroitin sulfate proteoglycans (CSPGs), in NSC niche Cytokine staining, intracellular, 136 D Dextran sodium sulfate (DSS)-induced colitis, 254–255 C2GnT2, 165–167 immunohistochemistry, 135–136 intracellular cytokine staining, 136 model, 133, 135 results and analysis, 136–139 Dual luciferase assay, b1,4GalTV analysis, 7–8 a-Dystroglycan (a-DG), 292, 368 glycosylation and laminin binding, Western blot, 355–356 hypoglycosylation, 373–374 tumor suppressor function cell sorting and flow cytometry, 389–390 colony formation assay, 392–393 laminin-binding assay, 390–392 orthotopic prostate tumor formation, 394–395 tumor invasion assay, 393–394 a-Dystroglycanopathy enzymatic activity and mutation search, 346, 348–350 microsomal membrane fraction glycosyltransferase activity, assay for, 346 GnT1 activity, 346–347 mutation analysis, 348 patients examined, 346 POMGnT1 activity, 347 POMT activity, 347–348 therapeutic approaches, 381 Dystrophin-associated glycoprotein (DAG) complex, 292–294, 311 Dystrophin-glycoprotein complex (DGC), 324–325
E Embryonic phenotype, in Large mutations, 374–375 Embryonic stem cells (ESCs) pluripotency and differentiation marker genes, 86–88 qRT-PCR analysis glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 Endogenous ligands, of AMR, 227 Enzymatic activity and mutation search, 346, 348–350 Enzyme-linked immunosorbent assay (ELISA) immunoglobulin isotypes quantification, 163–164 protein S antigen assay, 232–233 VWF lectin binding, 235–236 Epidermal growth factor (EGF), 14, 20 E-selectin GPS activity test, 101–102 ligand expression detection, 100–101 IgM chimeric proteins, lymph nodes staining frozen sections, preparation and fixation, 264–265 materials and equipment, 263–264 preparation of, 264 staining with, 265–266 F FACS. See Fluorescence activated cell sorter Factor VII activity assay, 234 Factor VIII activity assay, 234 Factor X antigen assay, 234–235 Fibrinogen activity assay, 233–234 Flow cytometry b3GnT2, 200 E-selectin ligand activity test, 101–102 Fluorescence activated cell sorter (FACS) core 3 O-glycan, 146–147 NSCPs isolation, 48 Focal adhesion kinase (FAK) signaling, core 3 O-glycan, 152–153 Footpad (FP) inoculation, 404, 407 Formalin-fixed paraffin-embedded (FFPE), 273 FTVI. See Fucosyltransferase VI a(1,3)-Fucosylation method, of cell surface, 99–100 Fucosyltransferase VI (FTVI), 98–100 Fukutin-related protein (FKRP), 345 Fukuyama-type congenital muscular dystrophy (FCMD), 344–345 Functional blocking antibodies, for intergrins determination, 147–148
442
Subject Index G
b1,4-Galactosyltransferase V (b1,4GalT V), glioma growth regulator catalytic enzyme, 11, 13 characterization, 18–19 chemotherapeutic drugs, 19 EGF stimulation, 21 experimental cell culture and transfection, 5 dual luciferase assay, 7–8 gel shift assay, 8 invasion and migration analysis, 6 lectin blot and staining analysis, 6 nuclear protein, extract of, 8 RT-PCR, 7 survival assay, 6–7 tumor cells implantation, in mice, 7 expression analysis, 4, 8–9 GICs, 16–18, 22 mechanisms, 11 overexpression effects, 11–12 reduction effects, expression, 10–11 Sp1 and Ets transcription factors, 4–5 transcriptional regulation chemotherapy drugs, 14 EGF, 14–16 nuclear protein, 14 Galectin-9, GLUT2 association, 219–220 Gel shift assay, b1,4GalT V analysis, 8 Gene trapping vector, glycogenes, 191 Genotyping b3GnT2, 197–198 HL-1/ HL-2-deficient mice, 229–230 Germinal center (GC) detection of, B lymphocyte apoptosis, 181 in spleen, histological analyses of, 180 GICs. See Glioma-initiating cells GlcNAc6STs. See N-Acetylglucosamine6-O-sulfotransferases Glial cells differentiation inhibition, polysialic acid, 32 Glial fibrillary acidic protein (GFAP) staining, glia limitans analysis, 362–364 Glia limitans analysis, GFAP staining, 362–364 Glioma growth regulator. See b1, 4-Galactosyltransferase V (b1,4GalT V), glioma growth regulator Glioma-initiating cells (GICs), 16–18, 22 Glucose tolerance test, 210–211 Glucose transporter-2 (GLUT2) cell surface half-life time of, 216–217 galectin-9, 219–220 glycan analysis, lectin blot, 217–219 immunohistochemical analysis in situ localization of, 213 method for, 211–212 production and trafficking of, 216
Glutathione-S-transferase (GST), 327–328 Glycan analysis, lectin blot, 217–219 Glycan-related gene expression, qRT-PCR, 75–82 Glycogenes, b3GnT2 (B3GNT2) polylactosamine synthase gene trapping vector, genomic localization of, 191 glycan structures, 189 glycosyltransferases, phylogenetic tree of, 188 in vitro assays for, 190 Glycosaminoglycans biosynthetic genes, qRT-PCR analysis, 83–84 chondroitin/dermatan sulfotransferases (C/D-STs), 59 primers and PCR conditions, 62 RT-PCR and semiquantitative analysis, 59–63 Glycosyltransferase assays, C3GnT -/-mice generation, 125 Large gene, 379–381 phylogenetic tree of, 188 Glycosyltransferase-programmed stereosubstitution (GPS), stem cell trafficking approaches, 94 cell migration, 94–95 E-selectin ligand expression detection, 100–101 testing for, 101–102 a(1,3)-fucosylation, FTVI, 99–100 fucosyltransferase VI (FTVI), 98–99 guiding principles, 97 human mesenchymal stem cells (hMSCs), 97–98 rationale for, 95–97 GnT1 activity, a-dystroglycanopathy, 346–347 GPS. See Glycosyltransferase-programmed stereosubstitution, stem cell trafficking H HCELL. See Hematopoietic cell E-/L-selectin ligand Hematology and coagulation analyses methods, AMR. See also Ashwell-Morell receptor (AMR) antigen levels, 231–235 clotting times, 231 lectin binding platelet levels and glycosylation, 230–231 VWF, 235–236 Hematopoietic cell E-/L-selectin ligand (HCELL), 96–97 Heparan sulfate proteoglycans (HSPGs), 41 Hepatic lectin (HL), 224–226 Hepatocytes, in molecular clearance mechanisms, 228–229
443
Subject Index
Heterodimerization assay, core 3 O-glycan, 151–152 High endothelial venules (HEVs) GlcNAc6ST-2, 244 immunohistochemical analysis, 272–273 lymphocyte subsets, 284 profile, 279 quantification, practical examples, 276–279 in ulcerative colitis, 274, 279 lymphocyte homing, 272 HSPGs. See Heparan sulfate proteoglycans Human mesenchymal stem cells (hMSCs), 97–98 Humoral immunity, ppGalNAcT-1. See Polypeptide GalNAc transferase-1 (ppGalNAcT-1) Hypoglycosylation, dystroglycan, 373–374 I Immunoblot analysis, of neurosphere cells, 52–53 Immunocytochemistry, CSPGs acutely dissociated cells, 46–47 adult neurogenic niche and SVZ-derived cells, 44 markers of, 42–43 Immunoglobulin level, C2GnT2-deficient mice IgA quantification, in fecal samples, 164–165 isotypes quantification, in sera collection, 162–163 ELISAs, 163–164 Immunohistochemical analysis carbohydrate antigens (see Carbohydrate antigens, immunohistochemical analysis) DSS-induced colitis, 135–136 GLUT2 in situ localization of, 213 method for, 211–212 Immunohistochemical staining GlcNAc6STs, 248–249 for intestinal Muc2, 131 ppGalNAcT-1, 177–179 Immunoprecipitation and lectin microarray analysis, b3GnT2, 200–201 Insulin homeostasis, GnT-IVa, 210–211 Intestinal mucus barrier function. See Core 3-derived O-glycans, intestinal mucins Intraperitoneal (IP) injection, 398, 401 Intravenous (IV) injection, tumor formation assays tail vein in lung, 404 procedure for, 403 standard numbers of cells for, 404 tumor formation assays, 403–405 In vitro assays, b3GnT2, 198–199
J Jurkat cells, T-synthase, 110–111 L LacZ staining, C3GnT -/-mice generation, 125 Laminin-binding assay, a-dystroglycan, 390–392 Laminin immunostaining, 359–361 Large gene, dystroglycan glycosylation pathway dystroglycanopathy, therapeutic approaches, 381 expression of, 378–380 glycosyltransferase, 379–381 humans, diseases in, 369 hypoglycosylation of, 373–374 identification of, mutated mice alleles, genomic organization, 371–372 genotyping, Largemyd mutation, 373 myd mutant, 370–371 veils and enr alleles, 372–373 mice phenotypes, mutations in central nervous system (CNS), 376–377 embryonic, 374–375 muscle, 375–376 ocular defects in, 377–378 peripheral nervous system (PNS), 377 Lectin binding platelet levels and glycosylation, 230–231 VWF glycosylation detection, 235–236 Lectin blot analysis core 3 O-glycan, 151 GLUT2 glycan analysis, 217–219 and staining, b1,4GalTV, 6 Lentivirus generation neurosphere cells model, 34 preparation method, 33–34 Leukocyte infiltration, DSS treatment, 254 Liver, in molecular clearance mechanisms, 228–229 L-selectin and E-selectin, lymph nodes staining, 263–265 IgM chimera binding in situ binding assay, 285–287 preparation, 284–285 probing glycoproteins treatment, PVDF membrane, 267–268 materials, 266–267 6-sulfo sLeX, structure of, 258 Lycopersicon esculentum (tomato) agglutinin (LEL), 187 lectin-blot analysis, 199 Lymph nodes staining, L-and E-selectin-IgM chimeric proteins frozen sections, preparation and fixation, 264–265
444
Subject Index
Lymph nodes staining, L-and E-selectin-IgM chimeric proteins (cont.) materials and equipment, 263–264 N-glycosidase F treatment, 266 preparation of, 264 staining with, 265 Lymphocyte homing, core O-glycans assay for fluorescence-labeled lymphocytes preparation, 261–262 inhibition of, lectins, 262–626 intravenous injection, 262–626 materials and equipment for, 261 steps in, 260 biosynthesis of, 259 L-selectin ligands probing glycoproteins treatment, on PVDF membrane, 266–268 materials, 266–267 lymph nodes staining, L-and E-selectin-IgM chimeric proteins frozen sections, preparation and fixation, 264–265 materials and equipment, 263–264 N-glycosidase F treatment, 266 preparation of, 264 staining with, 265–266 Lymphocyte isolation and proliferation assays, b3GnT2, 201–202 M Mammary fat pad (MFP) inoculation, 406 Mass spectrometry, C2GnT2, 160–161 Mgat4a gene, 207–208 Microsomal membrane fraction a-dystroglycanopathy glycosyltransferase activity, assay for, 346 GnT1 activity, 346–347 mutation analysis, 348 patients examined, 346 POMGnT1 activity, 347 POMT activity, 347–348 POMT1 gene, 328 Migration assay, core 3 O-glycan, 147 Molecular chaperone cosmc activity assay baculovirus system, 117–118 expression vector construction, 116–117 in mammalian cell, 118–119 T-synthase activity assay, 113–114 assay procedure and total product calculation, 115–116 cell lines and extracts preparation, 114–115 disruption of, 110 endoplasmic reticulum (ER) model, 111 Jurkat cells, 110–111
materials, 114 mucin type O-glycans biosynthesis, 108–109 vectors preparation and assays for, 112 Muc2 levels, C2GnT2 phenotyping KO mice, 166–168 protein expression, C3GnT deficiency bacterial translocation, real-time PCR, 132 immunohistochemical staining for, 131 in vivo intestinal permeability, 132 results and analysis, 133–134 Mucosal barrier function, C2GnT2 phenotyping KO mice, 161–162 Multiple immunostaining lymphocytes quantification, subsets, 283–284 materials, 280–281 methods, 281–283 Muscle–eye–brain disease (MEB), 344 Muscle phenotype, in Large mutations, 375–376 Muscular dystrophy, genetic defects dystroglycan, 292, 304–305 dystrophin-associated glycoprotein (DAG) complex, 293 Galgt2, 305 genetic modifiers of, 301–303 mouse models for, 294–300 mutation effects, 294 phenotype analysis assessment of, 309–310 central nuclei, 310 DAG proteins expression, 311 force drop, eccentric contractions, 308 immune components, 311 mdx mice, echocardiographic studies, 309 model for, 306–307 therapeutic genes, 305 Myodystrophy (myd ) mutation, 370–371 N N-Acetylglucosamine-6-O-sulfotransferases (GlcNAc6STs) CAdC1 cells, treatment with SCFAs, 247 carbohydrate structural analysis colonic-mucins from WT and KO mice, 253 LC-ESI-MS, 251 LC-ESI-MS/MS, 252 oligosaccharides, colonic-mucins, 250–252 colonic-mucin-enriched fraction, preparation, 249 DSS-induced colitis, 254–255 GlyCAM-1, 244–245 high endothelial venules (HEVs), 244 histology and immunostaining, 248–249 leukocyte infiltration, 254 mouse colon adherent cell line and culture, establishment, 246
445
Subject Index
real-time PCR (RT-PCR), 247–248 N-Acetylglucosaminyltransferase-IVa (GnT-IVa) cell-surface protein cross-linking galectin-9, GLUT2 association, 219–220 method for, 219 enzymology, 209–210 glucose and insulin homeostasis, 210–211 GLUT2 cell surface half-life time of, 216–217 glycan analysis, lectin blot, 217–219 immunohistochemical analysis, 211–214 islet cell preparation and culture, 214 Mgat4a gene and gene targeting strategy, organization of, 207–208 pulse-chase labeling of, 215–216 N- and O-linked glycan biosynthesis, transcript analysis, 85–86 Neocortex, lamination defects, 357–359 Neural stem cells. See Polysialic acid, neural stem cells Neural stem/progenitor cells (NSPCs). See also Chondroitin sulfate proteoglycans (CSPGs), in NSC niche embryonic sections staining method, 43–44 in vitro and in vivo proliferation analysis, 56 isolation of FACS, 48 immunopanning, with MAb 473HD, 48–49 magnetic beads, 49 Neurosphere cells CSPGs biochemical analysis, 52–53 CS/DS chains and sodium chlorate, 55–56 culturing methods, 50 differentiation assay, 50 in situ hybridization of sulfotransferases, 63–65 model for, 51 purification and identification, of CSPGs, 53–54 sectioning and immunohistochemistry, 52 differentiation of, 31 preparation of, 28–29 N-glycan polylactosamine reduction, B3gnt2-/-mice LEL, 187 repeating units, decreased numbers of, 192 Northern blot analysis, POMT1 gene, 325–326 Nuclear protein extraction, b1,4GalT V, 8 O Ocular defects, Large gene mutations, 377–378 O-glycans, 124, 245, 253. See also Core 3-derived O-glycans, intestinal mucins T-synthase and Cosmc, 109 Oligosaccharides, colonic-mucins, 250–252
O-mannosylation, 324. See also Protein O-mannosyltransferase-1 (POMT1) gene OmnibankTM, 197 Orthotopic prostate tumor formation, a-dystroglycan, 394–395 P Pancreatic islet cells preparation and culture of, 214 pulse-chase labeling of, 215–216 Pentobarbital, 400 Peripheral lymph node addressins (PNAd), 272–273 Peripheral nervous system (PNS), Large gene mutations, 377 Phenotype KO mice, C2GnT2 DSS-induced colitis model, 165–167 immunoglobulin level, naı¨ve mice, 162–165 Muc2 levels, 166–168 mucosal barrier function, 161–162 muscular dystrophy, genetic defects assessment of, 309–310 central nuclei, 310 DAG proteins expression, 311 force drop, eccentric contractions, 308 immune components, 311 mdx mice, echocardiographic studies, 309 model for, 307 Pial basement membrane analysis, POMGnT1 laminin immunostaining, 359–361 transmission electron microscopy (TEM), 360–363 Plasminogen activity assay, 233 Platelet levels and glycosylation, lectin binding, 230–231 Polylactosamine synthase. See b3GnT2 (B3GNT2) polylactosamine synthase Polymerasechainreaction(PCR)genotyping,230 of C2GnT2 KO mice, 157–158 C3GnT -/-mice generation, 127–128 Polypeptide GalNAc transferase-1 (ppGalNAcT-1) apoptosis detection caspase 3 active form, using antibody, 179–182 TUNEL system, 182–183 functions, 174 immunohistochemical staining, of frozen sections, 177, 179–180 in vitro B lymphocyte activation assay, 174–175 in vivo antibody production assay antigens for, 175–176 evaluation of, 177 process, 176–177 sera collection, 176 Polysialic acid, neural stem cells deficient mice, 27
446
Subject Index
Polysialic acid, neural stem cells (cont.) expression of, 27 glial cells differentiation inhibition, 32 in vitro assay differentiation, 30–32 migration, 29–30 lack of, 26 lentivirus generation, 33–34 neurons generation, 26 neurosphere cell culture, 28 ppGalNAcT-1. See Polypeptide GalNAc transferase-1 Prostate cancer cell invasion, core3 synthase inhibition Prostate inoculation implements for, 408–409 procedure, 410 Protein C activity assay, 232 Protein O-mannose Nacetylglucosaminyltransferase 1 (POMGnT1) a-dystroglycanopathy, 347 glia limitans analysis, GFAP staining, 362–364 histological analysis of, 356, 358 mutations of, 354 neocortex, lamination defects in, 357–359 pial basement membrane analysis laminin immunostaining, 359–361 transmission electron microscopy (TEM), 360–363 role of, 354 Protein O-mannosyltransferase-1 (POMT1) gene activity determination assay for, 328–330 a-DG-GST fusion protein substrate preparation, 327–328 microsomal membrane fractions preparation, 328 knockout mice, generation and genotyping of progeny, Pomt1þ/-heterozygous intercrosses, 335 targeted disruption, 333–335 murine embryo development, expression in, 329, 331–333 Pomt1-/-embryos, extracellular components characterization, 336–338 transcription level determination Northern blot analysis, 325–326 real-time quantitative PCR (RT-qPCR), 326–327 Protein S antigen assay, 232–233 Prothrombin time (PT), 231 Pulse-chase labeling, pancreatic islet cells, 215–216 Q Quantitative real-time polymerase chain reaction (qRT-PCR), transcript analysis
glycan-related gene expression applications, 83 biosynthetic pathway, 81–82 cDNA synthesis, 79–80 data analysis, 80–81 materials and equipment, 75 murine and human glycan-related gene assembly, 76 normalization gene selection, 80 primer design, 76–77 RNA isolation, 79 statistical analysis, 81 validation, 77–79 glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 R Real-time PCR bacterial translocation, colonic mucosa, 132 GlcNAc-6-O-sulfotransferases, 247–248 Real-time quantitative PCR (RT-qPCR), POMT1 gene, 326–327 Reverse transcription PCR (RT-PCR) b1,4GalTV analysis, 7 of C3GnT transcripts, 126 sulfotransferases amplification method, 61–63 S Sandwich ELISA-based assay, VWF lectin binding, 235–236 Sarcoglycan, 294 Selectin. See also E-selectin; L-selectin glycoproteins and glycolipids, 96–97 sialylated Lewis x and Lewis a, 95–96 types, 95 vascular endothelial cells, 96 Semiquantitative RT-PCR, core 3 expression, 146 Sphingolipid biosynthetic genes, qRT-PCR analysis, 85 Stem cells. See Transcript analysis, stem cells Stem cell trafficking. See Glycosyltransferaseprogrammed stereosubstitution (GPS), stem cell trafficking Subcutaneous (SC) inoculation, tumor formation assays, 405–406 Subentricular zone (SVZ), 44 Sulfotransferases amplification method, 61–63 in situ hybridization, 61–63 T Tail vessels, of mice, 402 Testicular inoculation, tumor formation assays, 408 Tn antigen, C3GnT gene disruption anti-Tn immunohistochemical staining, 129
447
Subject Index
intestinal glycan structure analysis, 128–129 periodic acid-Schiff and Alcian blue staining, 129 results and analysis, 129–131 Transcript analysis, stem cells N-and O-linked glycan biosynthesis, 85–86 pluripotency and differentiation marker genes cell lines, 86 MESO lineage, 87 transcript abundance for, 86–88 qRT-PCR glycan-related gene expression, 75–82 glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 Transcriptional regulation, b1,4GalT V chemotherapy drugs, 14 EGF, 14–16 nuclear protein, 14 Transmission electron microscopy (TEM), pial basement membrane, 360–363 Tribromoethanol, 400–401 T-synthase activity assay, 113–114 assay procedure and total product calculation, 115–116 cell lines and extracts preparation, 114–115 Cosmc biochemical studies and function, 111–112 endoplasmic reticulum (ER) model, 111 Jurkat cells, 110–111 materials, 114 vectors preparation and assays for, 112 Tumor formation assays analgesia and anesthesia, 399–401 animal care and protocol approval, 399 cell injection and inoculation, 398–399 core 3 O-glycan orthotopic tumor cell injection, 149–150
subcutaneous injection, 150 disinfection of, 399 footpad (FP) inoculation, 404, 407 handling and restraint, 398 intraperitoneal (IP) injection, 398, 401 intravenous (IV) injection, tail vein, 398, 401–404 tumor formation assays, 403–405 for lungs, 404 prostate anatomy of, 408–409 inoculation, implements for, 408–409 procedure, for inoculation, 410 subcutaneous (SC) inoculation, 405–406 testicular inoculation, 408 Tumor invasion assay, a-dystroglycan, 393–394 Tumor suppressor function. See a-Dystroglycan, tumor suppressor function TUNEL system, apoptosis detection, 182–183 U Ulcerative colitis, HEV-like vessels, 274, 279 V Veils and enr, Large gene mutant alleles, 372–373 Von Willebrand factor antigen assay, 235 lectin binding, glycosylation detection, 235–236 W Walker–Warburg syndrome (WWS), 344 Western blot analysis core 3 O-glycan, 150–151 a-dystroglycan, 355–356