Stem Cells and Their Potential for Clinical Application (NATO Science for Peace and Security Series NATO Science for Peace and Security Series A: Chemistry and Biology)

Stem Cells and their Potential for Clinical Application

NATO Science for Peace and Security Series This Series presents the results of scientific meetings supported under the NATO Programme: Science for Peace and Security (SPS). The NATO SPS Programme supports meetings in the following Key Priority areas: (1) Defence Against Terrorism; (2) Countering other Threats to Security and (3) NATO, Partner and Mediterranean Dialogue Country Priorities. The types of meeting supported are generally "Advanced Study Institutes" and "Advanced Research Workshops". The NATO SPS Series collects together the results of these meetings. The meetings are coorganized by scientists from NATO countries and scientists from NATO's "Partner" or "Mediterranean Dialogue" countries. The observations and recommendations made at the meetings, as well as the contents of the volumes in the Series, reflect those of participants and contributors only; they should not necessarily be regarded as reflecting NATO views or policy. Advanced Study Institutes (ASI) are high-level tutorial courses intended to convey the latest developments in a subject to an advanced-level audience Advanced Research Workshops (ARW) are expert meetings where an intense but informal exchange of views at the frontiers of a subject aims at identifying directions for future action Following a transformation of the programme in 2006 the Series has been re-named and re-organised. Recent volumes on topics not related to security, which result from meetings supported under the programme earlier, may be found in the NATO Science Series. The Series is published by IOS Press, Amsterdam, and Springer, Dordrecht, in conjunction with the NATO Public Diplomacy Division. Sub-Series A. B. C. D. E.

Chemistry and Biology Physics and Biophysics Environmental Security Information and Communication Security Human and Societal Dynamics

http://www.nato.int/science http://www.springer.com http://www.iospress.nl

Series A: Chemistry and Biology

Springer Springer Springer IOS Press IOS Press

Stem Cells and their Potential for Clinical Application

edited by

Nadja M. Bilko National University “Kyiv-Mohyla Academy”, Kyiv, Ukraine

Boris Fehse University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Wolfram Ostertag Medical School Hannover, Germany

Carol Stocking Heinrich-Pette-Institute for Experimental Virology and Immunology, Hamburg, Germany and

Axel R. Zander University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Published in cooperation with NATO Public Diplomacy Division

Proceedings of the NATO Advanced Research Workshop on Stem Cells and their Potential for Clinical Application Kiev and Simeiz, Ukraine August 23– 31, 2006

A C.I.P. Catalogue record for this book is available from the Library of Congress.

ISBN 978-1-4020-6468- 5 (PB) ISBN 978-1-4020-6467-8 (HB) ISBN 978-1-4020-6469-2 (e-book)

Published by Springer, P.O. Box 17, 3300 AA Dordrecht, The Netherlands. www.springer.com

Printed on acid-free paper

All Rights Reserved © 2008 Springer No part of this work may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording or otherwise, without written permission from the Publisher, with the exception of any material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.

TABLE OF CONTENTS Preface ..................................................................................................... ix Acknowledgement ................................................................................... xi List of Participants................................................................................. xiii I HAEMATOPOIETIC STEM CELLS AND HAEMATOPOIESIS Clonal Dominance after Reconstitution of the Haematopoietic System with Bone Marrow Cells Retrovirally Transduced with Murine CD34 Variants Gottfried von Keudell, Kerstin Cornils, Anita Badbaran, Claudia Lange, Boris Fehse ..................................................................... 1 Function of the Membrane-Bound Isoform Ligands of the Receptor Tyrosine Kinase Subclass III in Inducing Self-Renewal of Early Hematopoietic Progenitor Cells Jutta Friel, Christoph Heberlein, Maren Geldmacher, Wolfram Ostertag ................................................................................... 17 Functional and Phenotypic Heterogeneity of the Human Hematopoietic Stem Cell (HSC) Compartment Olga I. Gan, Joby L. Mckenzie, Monica Doedens, John E. Dick ........... 45 Alterations of Frequency of Hematopoietic Precursors in Mice Subjected to Multiple Courses of Low-Dose G-CSF Injections Irina N. Nifontova, Daria A. Svinareva, Joseph L. Chertkov, Valerii G. Savchenko, Nina J. Drize ...................................................... 55

v

vi

TABLE OF CONTENTS

Regulation of Hematopoiesis by Growth Factors E. Richard Stanley .................................................................................. 63 II BIOLOGY OF NON-HAEMATOPOIETIC STEM CELLS Stem Cell Technologies in Gerontological Research Gennadij M. Butenko.............................................................................. 77 Osteopetrotic Models for Identifying Genes that Control Bone Resorption Wieslaw Wiktor-Jedrzejczak .................................................................. 83 Non-Hematopoietic Bone Marrow Cells for Regenerative Medicine Claudia Lange, Florian Tögel, Kai Jaquet, Harald Ittrich, Christoph Westenfelder, Axel Zander .................................................. 105 Epithelial Plasticity of Hepatocytes During Liver Tumor Progression Mario Mikula, Christian Lahsnig, Alexandra N. M. Fischer, Verena Proell, Heidemarie Huber, Eva Fuchs, Andreas Eger, Hartmut Beug, Wolfgang Mikulits ....................................................... 123 Blood Vessels as a Source of Progenitor Cells in Human Embryonic and Adult Life Mihaela Crisan, Bo Zheng, Elias T. Zambidis, Solomon Yap, Manuela Tavian, Bin Sun, Jean-Paul Giacobino, Louis Casteilla, Johnny Huard, Bruno Péault .............................................................. 137

TABLE OF CONTENTS

vii

III STEM CELLS AND MALIGNANCY Stem Cells and Leukaemia Volodymyr Bebeshko, Dimitry Bazyka ................................................. 149 Telomere and Stem Cell Biology in Chronic Myeloid Leukemia Stefan Balabanov, Ute Brassat, Mirja Bernhard, Viola Kob, Artur Gontarewicz, Tim H. Brümmendorf............................................ 163 Potential Immune Escape Mechanisms of Tumors: MHC Class I Molecules – Enemies or Friends Barbara Seliger .................................................................................... 171 The RUNX1 Transcription Factor: A Gatekeeper in Acute Leukemia Carol Stocking, Birte Niebuhr, Meike Fischer, Maike Täger, Jörg Cammenga.................................................................................... 183 IV CELL PROCESSING, EXPANSION AND GENETIC MODIFICATION Novel Methodological Approaches in Assessment and Enrichment of Stem Cell Population Nadja M. Bilko, Dennis I. Bilko ........................................................... 201 Animal Hybrids and Stem Cells: Their Use in Biotechnology and Clinical Practice Lev P. Djakonov ................................................................................... 211

viii

TABLE OF CONTENTS

Cryopreservation of Stem Cells Valentin I. Grischenko, Lubov A. Babiychik, Alexander Yu. Petrenko ........................................................................ 223 The M813 Retrovirus belongs to a Unique Interference Group and is Highly Fusogenic Vladimir Prassolov, Sibyll Hein, Dmitry Ivanov, Jürgen Löhler, Pavel Spirin, Carol Stocking ................................................................ 233 Reconstructing an Anti-Tumor Immune Repertoire for Targeted AML Therapy Matthias Theobald ............................................................................... 245 V CLINICAL HAEMATOPOIETIC STEM CELL TRANSPLANTATION Experience of Kyiv Center of Stem Cell Transplantation Viktor I. Khomenko............................................................................... 252 Anti Thymocyte Globuline Allows for Successful Transplantation from HLA Mismatched Unrelated Donors Axel R Zander, Tatjana Zabelina, Francis Ayuk, Christine Wolschke, Olga Waschke, Gitta Amtsfeld, Thomas Eiermann, Hartmut Kabisch, Boris Fehse, Jürgen Berger, Rudolf Erttmann, Nicolaus M Kröger.... 263

PREFACE This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting “Stem Cells and their potential for clinical application” which took place from August 23 – 25, 2006 in Kyiv and from August 26 – 31, 2006 in Simeiz, Ukraine. The meeting was devoted to “hot topics” in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference’s main topics, the book is divided into five chapters - “Haematopoietic stem cells and haematopoiesis”, “Biology of nonhaematopoietic stem cells”, “Stem cells and malignancy”, “Cell processing; expansion and genetic modification” and “Clinical haematopoietic stem cell transplantation”. In the first part, various aspects of the regulation of haematopoiesis and haematopoietic stem cells (HSC) are described by such pioneers in the field as John Dick, Wolfram Ostertag and Richard Stanley. Olga Gan, John Dick and co-workers give an excellent overview on the heterogeneity of human HSC compartments. Jutta Friel et al. (from Wolfram Ostertag’s laboratory) deal with the role of membrane-bound isoform ligands in inducing HSC self-renewal and Richard Stanley reviews the role of growth factors in haematopoiesis. The effects of multiple injections of one particular growth factor, G-CSF, are described in a research article by Irina Nifontova, Nina Drize and colleagues, whereas Gottfried von Keudell, Boris Fehse and co-workers report their data on the impact of retroviral insertions on the clonal behaviour in murine HSC transplantation models. The second chapter of the book starts with a contribution of Gennadij Butenko on the use of stem cell technologies in gerontological research. Wieslav Wiktor-Jedrzejczak describes an interesting approach for the identification of genes involved in bone resorption control. An overview on the use of nonhaematopoietic bone marrow-derived stem cells for regenerative medicine is given by Claudia Lange, Axel Zander and co-workers. The topic of “plasticity” is covered by two groups: Mario Mikula, Wolfgang Mikulits and colleagues have investigated epithelial plasticity of hepatocytes during liver tumour ix

x

PREFACE

progression and Mihaela Crisan et al. from Bruno Peault’s lab introduce an innovative concept utilising blood vessels as a source of progenitor cells. The third chapter is mainly devoted to leukaemia research. Volodymyr Bebeshko and Dimitry Bazyka present an important insight into the changes of HSC due to irradiation after the Chernobyl accident. An outstanding review on the (stem cell) biology of chronic myeloid leukaemia with particular focus on the role of telomers is given by Stefan Balabanov, Tim Brümmendorf and colleagues. Barbara Seliger focuses on immune escape mechanisms of tumours, while Carol Stocking and her group present their data on the important role of RUNX1in the pathogenesis of acute leukaemia. Chapter 4 contains several contributions in the areas of cell processing, expansion and genetic modification. Nadja Bilko and Dennis Bilko propose novel methodological approaches to assess and enrich stem cells. L.P. Djakonov discusses the possibility of using animal hybrids in biotechnology. Valentin Grischenko, Lubov Babiychik and Alexander Petrenko have thorougly analysed the impact of various cryopreservation regimens on different HSC – a highly relevant question in transplantation medicine. During their search for novel gene analysis and therapy tools Vladimir Prassolov, Carol Stocking et al. have identified a novel retrovirus M813 which is described in their report. Concluding this chapter, Matthias Theobald presents his efforts on reprogramming T cells for targeted AML therapy. The final chapter comprises two reports on clinical haematopoietic stem cell transplantation (HSCT). Viktor Khomenko shares the experience of the Kiev center for stem cell transplantation. The final article in this book by Axel Zander and colleagues summarises data with the use of Antithymocyte globuline (ATG) in (HLA-mismatched) allogeneic transplantation, an approach which was promoted in the Hamburg Clinic for HSCT. The editors hope that this book reflects the spirited interaction and interesting scientific discussions which characterised the NATO-ASI meeting “Stem Cells and their potential for clinical application”. As the conference the book is not only intended to provide state-of-the-art articles in this field, but also to give insights into some of the highly interesting projects ongoing in Clinical Haematology and Stem cell research in Eastern Europe. Hamburg, Kyiv, St. Petersburg. Nadja N. Bilko, Boris Fehse, Wolfram Ostertag, Carol Stocking, Axel Zander.

ACKNOWLEDGEMENT The organisers as well as the participants of the “Stem Cells and their potential for clinical application”-meeting are most grateful to the NATO-Advanced Study Institute for the generous support which made this conference possible. Thanks are also due to the Ukrainian Ministry for Education and Science, the Ministry of Public Health and the National University “Kyiv-Mohyla Academy” for their support in executing the meeting. Special thanks go to the local teams for the excellent organisation at both locations. Finally, the editors are indebted to the team at Springer for the support during compilation of this book. Hamburg, Kyiv, St. Petersburg. Nadja N. Bilko, Boris Fehse, Wolfram Ostertag, Carol Stocking, Axel Zander.

xi

LIST OF PARTICIPANTS Prof. Dr. Dimitry Bazyka Dept. of Clinical Immunology Research Centre for Radiation Medicine Melnikova 53 Kyiv, 04050 Ukraine [email protected]

Prof. Dr. John E. Dick Div. of Cell and Molecular Biology University Health Network Toronto Medical Discovery Tower, Rm 8-301 101 College Street Toronto, ON, M5G 1L7, Canada [email protected]

Prof. Dr. Nadija Bilko National University “Kiev-MohylaAcademy” Centre of molecular and cell investigations 2, Skovoroda Kiev 04070 / Ukraine [email protected]

Prof. L. P. Djakonov All-Russian scientific research institute of veterinary medicine Russian academy of agricultural sciences Moscow, Russia [email protected]

PD Dr. Tim H. Brümmendorf Dept. of Hematology and Oncology with Sections BMT and Pneumology University Medical Center HamburgEppendorf Martinistraße 52 20246 Hamburg, Germany [email protected]

PD Dr. Boris Fehse Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Martinistr. 52 20251 Hamburg, Germany [email protected]

Prof. Dr. Gennadij M. Butenko Institute of Gerontology AMS of Ukraine Vyshgorodskaya st. 67 Kyiv04114, Ukraine [email protected]

Prof. Dr. Valentin I. Grischenko Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine 23 Pereyaslavskaya Str. 61015, Kharkov, Ukraine [email protected]

xiii

xiv

LIST OF PARTICIPANTS

Prof. Dr. Wiesław Wiktor-Jędrzejczak Department of Hematology, Oncology, and Internal Diseases Medical University of Warsaw Banacha 1a 02-097 Warsaw, Poland, [email protected] Viktor I. Khomenko Kiev City BMT Center BMT Department Pobeda Str. 119-121 Kiev, Ukraine Dr. Claudia Lange Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Martinistr. 52 20251 Hamburg, Germany [email protected] Prof. Dr. Wolfgang Mikulits Department of Medicine I, Institute of Cancer Research Medical University of Vienna Borschke-Gasse 8° 1090 Vienna, Austria [email protected] Dr. Irina Nifontova National Hematology Research Center Russian Academy of Medical Sciences Novozykovsky 4a 125167 Moscow, Russia [email protected]

Prof. Dr. Wolfram Ostertag Hannover Medical School Carl-Neuberg-Str. 1 D-30625 Hannover, Germany [email protected] Prof. Bruno Péault, Ph.D. Children’s Hospital of Pittsburgh Rangos Research Center Pittsburgh, USA [email protected] Prof. Dr. Vladimir Prassolov Engelhardt Institute of Molecular Biology Russian Academy of Science Vavilov Str. 32 Moscow 117984 / Russia [email protected] Prof. Dr. Barbara Seliger Martin Luther University HalleWittenberg Institute of Medical Immunology Magdeburger Straße 2 06112 Halle, Germany [email protected] Prof. Dr. E. Richard Stanley Albert Einstein College of Medicine 1300 Morris Park Avenue, Bronx New York 10461, USA [email protected]

LIST OF PARTICIPANTS

Dr. Carol Stocking Heinrich-Pette-Institut Martinistr. 52 20251 Hamburg / Germany e-mail: [email protected] Prof. Dr. Matthias Theobald Johannes Gutenberg-University Department of Hematology & Oncology Langenbeckstrasse 1 55101 Mainz, Germany [email protected]

Prof. Dr. Dr. h.c. Axel R Zander Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Direktor Martinistr. 52 20251 Hamburg [email protected]

xv

I HAEMATOPOIETIC STEM CELLS AND HAEMATOPOIESIS

CLONAL DOMINANCE AFTER RECONSTITUTION OF THE HAEMATOPOIETIC SYSTEM WITH BONE MARROW CELLS RETROVIRALLY TRANSDUCED WITH MURINE CD34 VARIANTS GOTTFRIED VON KEUDELL, KERSTIN CORNILS, ANITA BADBARAN, CLAUDIA LANGE, BORIS FEHSE* Clinic for Stem Cell Transplantation, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Keywords: CD34; bone marrow transplantation; retroviral vector; insertional mutagenesis

Abstract. Using a long-term serial bone marrow transplantation assay we have recently observed that retroviral gene marking may result in both benign clonal dominance as well as malignant transformation of single cell clones. The growth advantage of dominant clones has been attributed to insertional mutagenesis, i.e. transcriptional dys-regulation of key growth-regulatory genes due to near-by vector insertions. In order to investigate the physiological role of the CD34 antigen we have of recent performed an analogous serial bone marrow transplantation assay with retroviral vectors encoding murine fulllength or truncated CD34 or, as control, eGFP followed by BM transplantation with long-term follow-up. Therefore, 6 animals were serially transplanted for each of the three transgene groups according to our previously published protocol. Similarly to our earlier results, in long-term repopulating bone marrow stem cells we found insertions into genes shown to be involved in cell cycle regulation and stem cell self-renewal such as a Core-binding factor α group member (Cbfα2t3h), runt-related Runx3, Ras p21 protein activator 4 (RasA4), Hematopoietically expressed homeobox (Hhex) or FBJ Osteosarcoma Oncogene B (Fosb). We detected common insertion sites (CIS) within the three groups, but also within the much larger insertional dominance database (IDDb). However, despite the small group size some differences in insertion site

______ * To whom correspondence should be addressed. PD Dr. Boris Fehse, Clinic for Stem Cell Transplantation, University Medical Centre Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany, E-mail: [email protected]

1 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 1–15. © 2008 Springer.

2

G. VON KEUDELL ET AL.

patterns were noted for the different transgenes requiring further investigation. It is therefore tempting to speculate that common features as well as differences in insertion pattern of retroviral vectors expressing different transgenes may allow investigating the mutual influence of retroviral vector insertion sites (RVIS), transgenes and host factors during insertional mutagenesis. 1. Introduction Stable integration into the host genome is an important feature of retroviral (RV) vectors making them an interesting tool for gene transfer experiments as well as gene therapy applications which require long-term transgene expression. Integration of RV vectors occurs, as earlier shown for their replicationcompetent ancestors in a semi-random fashion, preferentially in the vicinity of transcribed genes.1-4 Importantly, any integration into (or in the neighbourhood of) a gene locus represents a genetic lesion and may impact (e.g. disrupt, activate) the expression of the respective “targeted” gene thus fulfilling the criteria of “insertional mutagenesis”. In a more restricted sense, only those events which lead to changes in a cell’s phenotype are referred to as insertional mutagenesis. Those alterations may become particularly significant, if the retroviral (vector) insertion leads to the up-regulation of cellular protooncogenes (POG) or the disruption of tumour suppressor genes.5-9 In a worst-case-scenario, insertional mutagenesis may thus lead to oncogenic transformation of normal cells.5-9 Malignant transformation as a consequence of retroviral vector-mediated gene transfer has therefore always represented a safety concern in the development of human gene therapy, although earlier theoretical considerations estimated this risk to be very low.10 In line, initial gene therapy trials did not reveal major consequences of random vector insertions.10,11 However, in 2002 we first reported acute myeloid leukaemia (AML) development in a murine marking study with a γ-retroviral vector expressing the marker gene ∆LNGFR (truncated low-affinity nerve growth factor receptor).5 Molecular analysis of the leukaemic clone revealed that an insertion of the RV vector in front (5’) of the second exon of the Evi1 protooncogene had led to a strong (more than 1000 fold) transcriptional upregulation of this gene.5,12 Several lines of evidence indicated that the used transgene, a signalling molecule, played a supportive role during leukaemia establishment.5 Unfortunately, only a few months later one of the boys treated for X-linked severe combined immune-deficiency (SCID-X1) in the worldwide very first successful gene therapy trial developed a lymphoproliferative disease.6 Subsequently, another two out of the meanwhile 10 patients in that

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

3

trial have developed similar diseases resembling acute lymphoid leukaemia (ALL).6 In all those cases, insertion into one and the same proto-oncogene, LMO-2, has apparently played a crucial role.5 Moreover, in striking similarity with our murine study there is evidence12, although conflicting13, suggesting a leukaemia-promoting role of the therapeutic transgene, the common γ-chain of the IL-2 (IL-2R γc) and other interleukin receptors. In fact, in a parallel gene therapy study with the same transgene there has not been any sign of lymphoproliferative disease so far, although both studies differ only very slightly.14 Therefore, the subsequent events promoting leukaemia development after LMO-2 activation still remain to be elucidated. Recently we have shown that insertional mutagenesis may not only result in malignant transformation, but also lead to benign clonal dominance.15 We found that benign clonal dominance represents one possible consequence of the transcriptional dysregulation of various genes, in particular proto-oncogenes in the absence of additional tumour-promoting events. This data has been confirmed in various in vitro studies and in a non-human primate model.16-18 Eventually, very similar observations were again made in a clinical gene therapy study, this time on the treatment of Chronic granulomatous disease (CGD). In that study, RV vector-mediated insertional mutagenesis led to the dominance of haematopoietic clones almost all bearing vector insertion sites in one of the three gene loci MDS1-EVI1, PRDM16 or SETBP1.19 Since transcription of the respective targeted gene was strongly up-regulated in each (analysed) case and the distribution of insertion sites immediately after transduction was, as expected, semirandom without any preference for one of the three genes, it is safe to suggest that insertional mutagenesis was critical for the establishment of clonal dominance. Moreover the authors even concluded that the significant clinical benefit seen in their study was augmented by insertional activation of the three genes.19 Taken together the above data indicates that RV vector-mediated insertional mutagenesis is an efficient tool to identify genes involved in (benign as well as malignant) clonal dominance. Those genes obviously play a crucial role in the regulation of (stem cell) self renewal as well as proliferation and are therefore of great interest for a better understanding of stem cell biology. Moreover, potential stem cell growth factors identified by this approach may be of great interest for the expansion of stem cells, e.g. in the frame of cell therapy strategies. At the same time efficient (even large scale) identification of vector insertion sites in mixed samples has become possible based on sensitive new technologies20-21 and the completion of the murine and human genome projects22. Therefore we have aimed at the establishment of a database that contains retroviral vector insertion sites (RVIS) in long-term reconstituting

4

G. VON KEUDELL ET AL.

haematopoietic stem and progenitor cells (Insertional dominance database, IDDb)23. The present work summarises our efforts to identify insertion sites in clones which have reconstituted murine haematopoiesis after retroviral gene transfer. We transduced bone marrow (stem) cells with retroviral vectors expressing one of the following three different transgenes: murine full-length CD34, murine (naturally occurring) truncated CD34 and enhanced Green fluorescent protein (eGFP). Gene-modified BM cells were transplanted into lethally irradiated recipient mice which were followed up for more than 6 months before their BM was serially transplanted into secondary recipients.24 RVIS in long-term repopulating cells of both primary and secondary cohorts were identified by LM-PCR. 2. Material and Methods 2.1. MURINE STUDY

Design of the mouse experiments has been described elsewhere in detail.24,25 In short, a sex-mismatched (male into female) diallelic (CD45.2/Ly5.2 into CD45.1/Ly5.1) C56Bl/6J mouse model was used. After 48 and 72 hours prestimulation of bone marrow stem cells in cytokine-containing medium,24 two rounds of retroviral transduction were carried with spleen focus-forming virus (SFFV)-derived vectors24,26 in Retronectin®-coated (Takara Shuzo, Otsu, Japan) vector-preloaded plates.25,27

Figure 1. Experimental Set-up. Irradiated female mice were transplanted with retrovirally transduced BM cells from male donors (6 mice per vector). After 6 months of monitoring a secondary BMT took place. Spleen cells were used for the analysis of retroviral vector insertion sites (RVIS) by means of Ligation-Mediated PCR (LM-PCR)20,21. After another 6 months followup spleen cells of the secondary recipients were again analysed for RVIS via LM-PCR.

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

5

Three vector groups (murine full-length CD34, mfCD34; murine truncated CD34, mtCD34; enhanced Green fluorescent protein, eGFP) and one control group were included. Transduced cells (1 x 106) were transplanted into lethally (10 Gy) irradiated recipient mice (6 per group). After six months, mice were humanely killed and haematopoietic organs were isolated. Serial BMT was performed into 6 (per group) lethally (10 Gy) irradiated recipient mice. An overview of the experimental design is given in Fig. 1. 2.2. ISOLATION OF DNA

DNA was isolated from 5 x 106 spleen cells using QIAamp spin columns (QIAGEN Blood Mini Kit, Hilden, Germany) according to the manufacturer’s instructions. DNA concentrations were determined on a spectrophotometer. 2.3. LIGATION-MEDIATED PCR (LM-PCR) AND SPECIFIC PCR

LM-PCR was performed as described to retrieve sequences adjacent to the 5’ LTR of the SF91 vector.7,15,21 In short, genomic DNA obtained from spleen cells of transplanted animals was digested with 5 U of the Tsp509 I restriction enzyme (New England BioLabs, UK) per 200ng DNA for 15 minutes at 37° and subsequently for 2h at 65° C. For primer extension (PE) (95° for 5 min; 64° for 30 min; 72° for 15 min) 0.25 pmol/µl of biotinylated retroviral primer A1RV (5’ Biotin CTGGGGACCATCTGTTCTTGGCCTC 3’) was used. The PE product was purified using QIAquick PCR kit (QIAGEN) and enriched with streptavidin-labeled Dynabeads. An asymmetric polylinker cassette (linker oligo 1: 5‘-GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGG3‘; linker oligo 2: 5‘-CCTAACTGCTGTGCCACTGAATTCAGATCTCCCG3‘) was attached to those fragments by blunt-end ligation to allow directed PCR amplification. Both first and nested PCR (94°C for 2 min; 94°C for 15 sec, 60°C for 30 sec, 68°C for 2 min for 30 cycles; 68°C for 10 min) were performed using Extensor Hi-Fidelity PCR Master Mix (ABgene, Hamburg, Germany) with LTR-specific primers A2RV (5’ GCCCTTGATCTGAACTTCTC 3’), A3RV (5’ CCATGCCTTGCAAAATGGC 3’) and linker-specific primers OC1 (5’ GACCCGGGAGATCTGAATTC 3’) and OC2 (5’ AGTGGCACAGCAGTTAGG 3’), respectively.15,21 PCR products were isolated after gel electrophoresis using QIAquick Gel Extraction Kit (QIAGEN) and subjected to directly sequencing using the primer RAseq (5’ CTTGCAAAATGGC 3’) and Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City , CA, USA). A detailed description of all LMPCR procedures is given in Kustikova et al.21

6

G. VON KEUDELL ET AL.

Correct identification of insertion sites was proven by specific PCR reactions. Therefore, locus-specific primers were designed based on sequences obtained as described above. PCR was carried out using the LTR-specific primers A2RV and the respective locus-specific primer using Extensor HiFidelity PCR Master Mix and the same conditions as described above. 2.4. INSERTION SITE ANALYSIS

Sequences recovered as detailed above were screened using the NCBI mouse genome database (http://www.ncbi.nlm.nih.gov/BLAST). In case of unclear results (such as hits in BAC clones), the UCSC database was used (http://www.ensembl.org). Gene classification followed database records and PubMed literature. Further analysis of verified insertion sites was per formed by screening the Retrovirus tagged cancer gene databases (RTCGD) at http://rtcgd.ncifcrf.gov and the Stem cell database (SCDb) at http://stemcell.princeton.edu. 3. Results 3.1. RETRIEVAL OF RV INSERTION SITES

In this study we analysed haematopoietic cells from 13 primary (3 eGFP [11,13,14], 5 mfCD34 [22-26], 5 mtCD34 [27,28,30-32]) and 18 secondary (6 for each group) transplanted animals. Numbers of primary animals were lower because a few mice died or showed low haematopoietic chimaerism and were therefore excluded from secondary BMT. DNA probes isolated from spleen cells from all those animals underwent LM-PCR. Dominant PCR signals representing abundant clones21 were isolated from the agarose gel and directly sequenced (Fig. 2). In total, 238 distinct signals were analysed. To identify unequivocal RV insertion sites the presence of LTR (and LM-PCR polylinker) sequences was always required. If LTR sequences could not be found in the sequence, a PCR with insertion-specific primers (one located in the LTR and one in the putative integration site) was performed to verify the exact RV vector LTR/genome transition point. For 166 (70%) of the isolated PCR fragments, the obtained sequences could be unambiguously located on the mouse genome. For the other PCR signals, sequences were either too short to be assigned to a given locus or integration had occurred in a repetitive sequence. Some isolated PCR fragments did not allow sequencing, probably due to high GC content and/or low DNA quantity. Unexpectedly, some sequences were not locatable despite high

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

7

Figure 2. Typical LM-PCR gel showing RVIS after secondary transplantation. Common RVIS in different animals are indicated by stars (e.g.: *1: RasA4; *2: Cbfa2t3h; *4: Hic; compare Table 1).

quality. The latter observation obviously reflects remaining gaps of the mouse genome project. In many cases, identical insertions were found in more than one animal of the same group (Fig. 2). Since pooled bone marrow was used in each case for transplantation (Fig. 1), those identical insertions reflect the dominant growth features of the identified clone. Overall, a total of 43 different insertion sites from all three groups were identified in the first cohort, 34 in the second cohort. 3.2. RV VECTOR INSERTIONS IN RECONSTITUTING CELLS ARE PREDOMINANTLY LOCATED IN LOCI OF SIGNALLING GENES AND PROTO-ONCOGENES

As reported previously, insertion sites of RV vectors in reconstituting cells showed a non-random distribution. In fact, if considering a locus of ±100kb susceptible to transcriptional dysregulation28, already insertions in the first cohorts of mice showed a clear preference for proto-oncogene (>20%) and signalling gene (>50%) loci (Fig. 3). The obvious selective advantage of clones with insertions in those genes resulted in even higher proto-oncogene insertion prevalence (almost 40%) in secondary BMT recipients. Together, more than 80% of all insertions retrieved from secondary recipients had occurred in loci containing signalling genes or proto-oncogenes. The list of insertions contains a number of genes which had been initially detected by insertional mutagenesis or are listed as common insertion sites (CIS) in the Retrovirus Tagged Cancer

G. VON KEUDELL ET AL.

8

Gene Database (RTCGD)29, a database summarising insertion sites obtained with replication-competent retroviruses (RCR). In addition, several genes were also detected in various recent studies using RV vector gene transfer thus representing common retroviral vector insertion sites (CRVIS) in the Insertional Dominance Database (IDDb).23 All RVIS identified in our study and their putative functions are summarised in Table 1. 3.3. DIFFERENCES WITH DIFFERENT TRANSGENE

Rel. numbers of insertions into… [%]

Although the groups used in this study were relatively small, we subsequently analysed distribution of insertion sites for the three different transgene groups. Combining all integration data from primary and secondary recipients we thus compared 18 RVIS for the eGFP vector, 30 RVIS for mtCD34 and 35 RVIS for mfCD34. As could be seen from Fig. 3, no significant differences were seen with regard to the distribution of RVIS in different types of genes, although the tCD34 vector revealed less insertions into gene loci of groups 1 and 2 (protooncogenes and signalling genes) and more insertions into gene groups 3 and 4 (other and unknown genes). 60 Oncogenes Signalling Other Unknown

50 40 30 20 10 0 First Cohort (n=43)

Second Cohort (n=34)

Figure 3. Distribution of RVIS in different types of genes in repopulating hematopoietic cells of 1st and 2nd cohort animals. RVIS were classified as in Table 1. Note the strong overrepresentation of RVIS into oncogenes already in the first cohort, which even further increases after serial transplantation.

4. Discussion Retroviral insertional mutagenesis has been used for more than 2 decades to identify proto-oncogenes. More recently, a causal role of retroviral

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

9

vector-mediated insertional mutagenesis in the development of clonal dominance in long-term haematopoiesis has been established in preclinical models and clinical trials.5-9,15-18 In those studies it has been shown that RV vector insertions into gene loci of key regulatory factors may increase self-renewal and/or initiate malignant transformation. Following this path we here used a gene marking/bone marrow transplantation model established in our laboratory to assess possible side effects of retroviral gene transfer.5,15,25 In particular we were interested in a possible role of different transgenes on insertion site distribution in long-term reconstituting haematopoietic cell clones. Therefore we comparatively analysed the impact of three retroviral vectors expressing different transgenes (murine full-length CD34, mfCD34; murine truncated CD34, mtCD34; eGFP) from identical viral backbones (SF91)26. We have recently described physiological consequences of ectopic expression of the two murine CD34 variants in murine haematopoietic cells.24 In this report we have focussed on the analysis of a possible impact of RV vector insertion sites on long-term haematopoiesis. In cell clones reconstituting long-term hematopoiesis we found a strong overrepresentation of RVIS in proto-oncogenes and signalling genes. After primary BMT, more than 70% of all insertions were detected in gene loci of proto-oncogenes (>20%) or signalling genes (>50%). This frequency was even higher (>80%, almost 40% in POG) in secondary recipients. This data is in full agreement with our previous findings obtained with other RV vectors.15 Moreover, our results have contributed to a large Insertional Dominance Database (IDDb) comprising at the time being 280 insertion sites retrieved from long-term reconstituting hematopoietic cell clones.23 Establishment of the latter has been the result of common efforts of different laboratories in Europe and the US. The use of different transgenes and retroviral vectors by the contributing laboratories mainly excludes effects attributable to certain vector or gene types. In fact, a thorough analysis of the IDDb showed no effect of vector backbone or transgene type on insertion site distribution so far. We therefore concluded that in the majority of cases the retroviral vector insertion site in dominant (stem cell) clones has had directly affected the cells’ phenotype leading to clonal dominance.23 Based thereon, the IDDb may become an important tool for the identification of genes encoding key regulators of the stem cell phenotype (self renewal, unlimited proliferation), so-called stemness genes.30 It is not surprising that many of the genes found in our study as well as in the IDDb represent well-known proto-oncogenes involved in the regulation of cell proliferation. However, there is a number of other genes which so far were not known as regulators of stem cell growth (Table 1). Those genes may be very interesting novel candidate stemness genes, in particular if the insertions

G. VON KEUDELL ET AL.

10

represent common insertion sites (CIS) in the RTCGD29 or CRVIS within the IDDb23. From the given study, a number of genes may be added to the list of putative stemness genes, as for example: (i) known proto-oncogenes (Fosb, Hhex, Hic1, Rhof), (ii) transcription factors (Cbfα2t3h , Runx3, Utf1), (iii) genes involved in apoptosis signalling (FasL, Tnfsf10), (iv) receptor molecules (Edg1, Ly78) or (v) other signalling genes (Dirc, Rab3gap2, RasA4, Sesn2, Tbc1d5, Terf2) most of them being listed in the RTCGD or IDDb as CIS or CRVIS. TABLE 1. Summary of RVIS detected in repopulating haematopoietic cells of primary and secondary mice. Mouse numbers (second cohort mice are labelled with II) and transgenes (t = mtCD34, f = mfCD34, g = eGFP) are indicated. Gene classes are defined as follows: class 1 = common insertion sites, proto-oncogenes and self-renewal genes, class 2 = signalling genes and classes 3&4 = other and unknown genes.23 Mice Locus

From/to TSS Chromo- Hits in Name, (proposed ) function RTCGD Orientation some /IDDb

11GI Akt2

+3 kb (i2)

13g

Class

Akt1: 3/2

Thymoma viral oncogene homolog 1 2, kinase

+100 kb(i11) 17A3.3 R

0

Ankyrin Repeat and SAM Domain 2 Containing 1 (Odin)

27t Arid1b II.1t

+330 kb (i15) 17A1 F

0

AT Rich Interactive Domain 1B (Swi1 like)

3

II.2,3f Atf7ip

-46 kb R

6G1

2/1

Activating TF 7 interacting protein, transcription co-repressor activity

1

8E1

7/1

Core-binding factor, runt domain, a subunit 2, translocated 2, 3 1 homolog

+19 kb R

15E1

0

Cdc42 Effector Protein 1, Rho GTPase binding

2 3

Anks1

31t Cbfα2t3h -15kb F II.2t 13g

Cdc42ep1

7A3

24

Dhrs3

+56 kb F

4E1

0

Dehydrogenase reductase SDR Family3

26f

Dirc2

+13 kb (3.I) F

16B3

0

Disrupted in renal cell carcinoma 2 2, peptidase activity

23f 31t

Edg1 (Dph5)

-100 kb F -102 kb F

3G1

0/2

Endothelial differentiation, sphingolipid G-protein-coupled receptor 1, endothelial differentiation

1

32t

FasL

-8.5 kb R

1H2.1

0/2

Fas ligand (TNF superfamily, member 6), apoptosis induction

1

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION Mice Locus

From/to TSS Chromo- Hits in Name, (proposed ) function RTCGD Orientation some /IDDb

11 Class

11 II.1

Fosb

-24 kb F

7A2

0/1 (Fos: 5/0)

FBJ osteosarcoma oncogene B, DNA binding

1

II.1f II.6f

Frmd6

+62 kb (6.I) R

12C2

0

FERM domain containing 6, function: protein-binding?

2

II.2f

Ggta1

-45kb R

2B

0

GlycoproteinGalactosyltransferase alpha 1.3

2

28t

Gtf2i

+28 kb (i9)

5G2

0/2

General Transcription Factor 2, transcriptional activation of growth- 2 regulated genes

25f

H3f3a

+36 kb F

1H4

0

H3 histone, family 3A, DNA binding

3

II.6t

Hhex

+2.5 kb (i2) R

19C1

26/1

Hematopoietically expressed homeobox gene, T-cell oncogene

1

24f

Hic1

-39 kb R +86 kb F

11B5

3/3

Hypermethylated in cancer 1, 1 transcription factor, Wnt antagonism

32t

Insm1

-8,5 kb R

2G2

0

13g

LOC

+45kb R

2E4

0

LOC 624373, hypothetical protein

4

24f

LOC

-4 kb R

7E3

0

LOC 626307, hypothetical protein

4

24

LOC

+28kb R

3F2.2

0

14g

LOC

>350 kb(I?) F 10D1

0

II.4f

LOC

-9 kb F

8B3.3

0

15D1

0/2

28t 30t

Lrrc6

-2.8 kb R +23 kb (i3) R

Insulinoma associated 1, nucleic acid binding

LOC195514, similar to glyceraldehyde3-phosphate dehydrogenase LOC629040, similar To Neuron Navigator 2 LOC621377, similar to Adenine phosphoribosyltransferase (APRT) Leucin repeat containing 6

3

4 4 4 1

Latent transforming growth factor 23f

Ltbp1

+33 kb (2.I) F 17E

0

binding protein 1,TGF-β receptor

2

pathway II.5g

Ly78

-26 kb R

13D1

0/2

31t

Nr1d1

-11kb R

11D

0

Odc1

-151 kb R

12A1.1

0

II.1, 5,6f

lymphocyte antigen 78 (CD180), receptor, signalling Nuclear Receptor Subunit1 group D member 1 Ornithin-Decarboxylase 1, checkpoint that guards against tumourogenesis

1 2 2

G. VON KEUDELL ET AL.

12

Mice Locus

Hits in From/to TSS ChromoRTCGD Name, (proposed ) function Orientation some /IDDb

22f

Ogfr11

+10 kb (1.I) F

28t

Pef1

+0.5 kb (1.I) 4D2.2 F

Phlpp

+103 kb (i1) 1E2.1 R

Ppfia4

+33 kb (i26) 1E4 F

II.2f

30t

1A4

Class

0

Opioid growth factor receptor like 2 1, receptor activity

0

Penta EF-hand domain containing 2 1, signalling, apoptosis

0

PH domain and leucin rich repeat protein phosphatase, dephos2 phorylates Akt, promotes apoptosis, and suppresses tumour growth

0

Protein Tyrosine Phosphatase, Receptor Type, f polypeptide (PTPRF) interacting protein (liprin), alpha 4

2

14g, Rab3ga -37 kb F II.4g p2

1H5

0

similar to Rab3 GTPase activating protein, regulation of GTPase 2 activity

27t

Rapgef2 -34 kb F

3E3

0

Rap guanine nucleotide exchange 2 factor 2, intracellular signalling

28t

Rapgef3 +40 kb R

15F1

0

Rap guanine nucleotide exchange 2 factor 3, intracellular signalling

27t, II.1t

RasA4

+8,5 kb (i3) F

5G2

0

RAS p21 protein activator 4, intracellular signalling

II.3g Rhof

-4.4 kb R

5F

4/1

Ras homolog gene family member, 1 small GTPase mediated signalling

27t II.1t

Rik

+15 kb (i2) R 4D1

0

RIKEN cDNA 4931406I20 gene, ubiquitin cycle

4

30t

Rnpc1

+19 kb R

2H3

0

RNA-binding Region (RNP1, RRM) containing 1 (Seb4)

3

II.2f

Runx3

-80 kb F

4D2.3

5/1

Runt related 3, myeloid development

1

24f II.2f

Sesn2

+6 kb (i1) F

4D2.3

0/3

Sestrin 2, induction in response to DNA damage

1

28t

Synj2

+30,5 kb (6.I) F

17A1

0

Synaptojanin 2, IP signalling

2

22f/ II.3f

Tbc1d5

+150 kb(i3) F

17C

1/1

TBC domain family member 5, GTPase activator activity

1

+47 kb F

8D3

0

Telomeric Repeat binding factor 2, telomere length regulation

2

25f Terf2 II.2,4f

2

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

Mice Locus

Hits in From/to TSS ChromoRTCGD Name, (proposed ) function Orientation some /IDDb

Class

19C1

0

Transmembran Protein 23, kinase2 transferase activity

+13 kb (3.I) II.6g Tnfsf10 F 32t +200 kb F

3A3

2/2

Tumour necrosis factor (ligand) superfamily, member 10, apoptosis induction

1

25f Terf2 II.2,4f

+47 kb F

8D3

0

Telomeric Repeat binding factor 2, telomere length regulation

2

II.1t

Treml2 +24 kb F

17C

0

Triggering receptor expressed on 2 myeloid cells like 2, signalling

11g

Trp53i1 -25 kb R 1

2E1

0

Trp53 inducible Protein 11, Tumour-Protein p53 inducible

2

II.3f II.4f

Utf1

+29 kb F

7F4

0

Undifferentiated embryonic cell transcription factor 1, ES-cell oncogene

1

22f

Usp36

+43 kb (3') F 11E2

3/1

Ubiquitin specific peptidase 36; guanyl-nucleotide release factor activity/ tumour suppressor gene?

1

14f

Tmem2 +19 kb R 3

13

We also assessed a possible influence of the expressed transgene on the RVIS distribution. In our relatively small study, some tendency towards decreased frequencies of RVIS in POG and signalling gene loci might be seen for the mtCD34 vector. However, within the much larger IDDb23 there was no difference in the distribution of insertion sites between vectors encoding fluorescent vs. cell surface marker genes. In conclusion the present report confirms the significant impact of γretroviral vector insertion sites on the establishment of clonal dominance in hematopoiesis after (serial) bone marrow transplantation. The identification of a number of putative stemness genes may contribute not only to a better understanding of stem cell biology but, in the long run also to the development of novel approaches for stem cell based therapeutic regimens, e.g. in regenerative medicine. Acknowledgements

This work was kindly supported by the Deutsche Forschungsgemeinschaft (FE568/5-2) and the Erich und Gertrud Roggenbuck-Stiftung.

14

G. VON KEUDELL ET AL.

References 1. Rohdewohld H., Weiher H., Reik W., Jaenisch R. and Breindl M. (1987) Retrovirus integration and chromatin structure: Moloney murine leukemia proviral integration sites map near DNase I-hypersensitive sites. Journal of Virology 61, 336-343. 2. Mooslehner K., Karls U. and Harbers K. (1990) Retroviral integration sites in transgenic Mov mice frequently map in the vicinity of transcribed DNA regions. Journal of Virology 64, 3056-3058. 3. Wu X., Li Y., Crise B. and Burgess S.M. (2003) Transcription start regions in the human genome are favored targets for MLV integration. Science 300, 1749-1751. 4. Mitchell R.S., Beitzel B.F., Schroder A.R., Shinn P., Chen H., Berry C.C., Ecker J.R. and Bushman F.D. (2004) Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. Aug; 2(8):E234. 5. Li Z., Düllmann J., Schiedlmeier B., Schmidt M., von Kalle C., Meyer J., Forster M., Stocking C., Wahlers A., Frank O., Ostertag W., Kühlcke K., Eckert H.-G., Fehse B. and Baum C. (2002) Murine Leukemia Induced by Retroviral Gene Marking. Science 296, 497. 6. Hacein-Bey-Abina S., von Kalle C., Schmidt M., McCormack M.P., Wulffraat N., Leboulch P., Lim A., Osborne C.S., Pawliuk R., Morillon E., Sorensen R., Forster A., Fraser P., Cohen J.I., de Saint-Basile G., Alexander I., Wintergerst U., Frebourg T., Aurias A., Stoppa-Lyonnet D., Romana S., Radford-Weiss I., Gross F., Valensi F., Delabesse E., Macintyre E. et al. (2003) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-419. 7. Modlich U., Kustikova O.S., Schmidt M., Rudolph C., Meyer J., Li Z., Kamino K., von Neuhoff N., Schlegelberger B., Kuehlcke K., Bunting K.D., Schmidt S., Deichmann A., von Kalle C., Fehse B., Baum C. (2005) Leukemias following retroviral transfer of multidrug resistance 1 (MDR1) are driven by combinatorial insertional mutagenesis. Blood 105, 42354246. 8. Du Y., Spence S.E., Jenkins N.A. and Copeland N.G. (2005) Cooperating cancer-gene identification through oncogenic-retrovirus-induced insertional mutagenesis. Blood 106, 2498-2505. 9. Seggewiss R., Pittaluga S., Adler R.L., Guenaga F.J., Ferguson C., Pilz I.H., Ryu B., Sorrentino B.P., Young W.S. 3rd, Donahue R.E., von Kalle C., Nienhuis A.W. and Dunbar C.E. (2006) Acute myeloid leukemia associated with retroviral gene transfer to hematopoietic progenitor cells of a rhesus macaque. Blood 107, 3865-3867. 10. Cornetta K., Morgan R.A. and Anderson W.F. (1991) Safety issues related to retroviralmediated gene transfer in humans. Human Gene Therapy 2, 5-14. 11. Anderson W.F. (2000) Gene therapy. The best of times, the worst of times. Science 288, 627629. 12. Woods N.B., Bottero V., Schmidt M., von Kalle C., Verma I.M. (2006) Gene therapy: therapeutic gene causing lymphoma. Nature 440, 1123. 13. Thrasher A.J., Gaspar H.B., Baum C., Modlich U., Schambach A., Candotti F., Otsu M., Sorrentino B., Scobie L., Cameron E., Blyth K., Neil J., Abina S.H., Cavazzana-Calvo M. and Fischer A. (2006) Gene therapy: X-SCID transgene leukaemogenicity. Nature 443, 7109. 14. Gaspar H.B., Parsley K.L., Howe S., King D., Gilmour K.C., Sinclair J., Brouns G., Schmidt M., von Kalle C., Barington T., Jakobsen M.A., Christensen H.O., Al Ghonaium A., White H.N., Smith J.L., Levinsky R.J., Ali R.R., Kinnon C. and Thrasher A.J. (2004) Gene therapy of X-linked severe combined immunodeficiency by use of a pseudotyped gammaretroviral vector. Lancet 364, 2181-2187.

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

15

15. Kustikova O., Fehse B., Modlich U., Yang M., Düllmann J., Kamino K., von Neuhoff N., Schlegelberger B., Li Z. and Baum C. (2005) Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science 308, 1171-1174. 16. Du Y., Jenkins N.A. and Copeland N.G. (2005) Insertional mutagenesis identifies genes that promote the immortalization of primary bone marrow progenitor cells. Blood 106, 39323939. 17. Modlich U., Bohne J., Schmidt M., von Kalle C., Knöss S., Schambach A. and Baum C. (2006) Cell culture assays reveal the importance of retroviral vector design for insertional genotoxicity. Blood 108, 2545-2553. 18. Calmels B., Ferguson C., Laukkanen M.O., Adler R., Faulhaber M., Kim H.-J., Sellers S., Hematti P., Schmidt M., von Kalle C., Akagi K., Donahue R.E. and Dunbar C.E. (2005) Recurrent retroviral vector integration at the Mds1/Evi1 locus in nonhuman primate hematopoietic cells. Blood 106, 2530-2533. 19. Ott M.G., Schmidt M., Schwarzwaelder K., Stein S., Siler U., Koehl U., Glimm H., Kühlcke K., Schilz A., Kunkel H., Naundorf S., Brinkmann A., Deichmann A., Fischer M., Ball C., Pilz I., Dunbar C., Du Y., Jenkins N.A., Copeland N.G., Luthi U., Hassan M., Thrasher A.J., Hoelzer D., von Kalle C., Seger R. and Grez M. (2006) Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nature Medicine 12, 401-409. 20. Schmidt M., Hoffmann G., Wissler M., Lemke N., Mussig A., Glimm H., Williams D.A., Ragg S., Hesemann C.U. and von Kalle C. (2001) Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples. Human Gene Therapy 12, 743-749. 21. Kustikova O.S., Baum C. and Fehse B. (2007) Retroviral integration site analysis in hematopoietic stem cells. Methods in Molecular Medicine, in press 22. Mouse Genome Sequencing Consortium; Waterston RH, et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520-562. 23. Kustikova O., Geiger H., Li Z., Brugman M.H., Chambers S.M., Shaw C.A., Pike-Overzet K., de Ridder D., Staal F.J..T, von Keudell G., Cornils K., Nattamai K.J., Modlich U., Wagemaker G., Goodell M.A.., Fehse B. and Baum C. (2006) Retroviral vector insertion sites associated with dominant hematopoietic clones mark “stemness” pathways. Blood, in press 24. Lange C., Li Z., Fang L., Baum C. and Fehse B. (2007) CD34 modulates the trafficking behavior of hematopoietic cells in vivo. Stem cells and Development, in press 25. Li Z., Fehse B., Schiedlmeier B., Düllmann J., Frank O., Zander A.R., Ostertag W. and Baum C. (2002) Persisting multilineage transgene expression in the clonal progeny of a hematopoietic stem cell. Leukemia 16, 1655-1663. 26. Hildinger M., Abel K.L., Ostertag W., and Baum C. (1999) Design of 5' untranslated sequences in retroviral vectors developed for medical use. Journal of Virology 73, 4083-4089. 27. Kühlcke K., Fehse B., Schilz A., Loges S., Lindemann C., Ayuk F., Lehmann F., Stute N., Fauser A.A., Zander A.R. and Eckert H.-G. (2002) Highly efficient retroviral gene transfer based on centrifugation-mediated vector pre-loading of tissue culture vessels. Molecular Therapy 5, 473-478. 28. Bartholomew C. and Ihle J.N. (1991) Retroviral insertions 90 kilobases proximal to the Evi-1 myeloid transforming gene activate transcription from the normal promoter. Molecular and Cellular Biology 11, 1820-1828. 29. Akagi K., Suzuki T., Stephens R.M., Jenkins N.A. and Copeland N.G. (2004) RTCGD: retroviral tagged cancer gene database. Nucleic Acids Research 32, D523-527. 30. Ivanova N.B., Dimos J..T, Schaniel C., Hackney J.A., Moore K.A. and Lemischka I.R. (2002) A stem cell molecular signature. Science 298, 601-604.

FUNCTION OF THE MEMBRANE-BOUND ISOFORM LIGANDS OF THE RECEPTOR TYROSINE KINASE SUBCLASS III IN INDUCING SELF-RENEWAL OF EARLY HEMATOPOIETIC PROGENITOR CELLS

JUTTA FRIEL1 , CHRISTOPH HEBERLEIN 2, MAREN * GELDMACHER 3 AND WOLFRAM OSTERTAG 3 1Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg, Hamburg, Germany 2CellTec GmbH, Hamburg, Germany 3Hannover Medical School, Hannover, Germany

Keywords: Stroma-hematopietic cell interaction; Stroma-encoded membrane-bound and soluble ligands; Stroma-independent mutants

Abstract. Maintenance and differentiation of hematopoietic stem and progenitor cells are controlled by complex interactions with the stroma microenvironment. Stroma-cell interactions can be supported by locally expressed membranespanning cell-surface growth factors. Ligands of the tyrosine receptor kinases subclass III like SCF or CSF-1 are expressed by stroma as soluble glycoproteins, proteoglycans or membrane-bound glycoproteins. SCF synergizes with other growth factors in enhancing growth of early progenitor cells whereas CSF-1 is known to regulate the survival, proliferation and differentiation of mononuclear phagocytes. Whereas the biological role of the soluble isoforms of SCF and CSF1 are well characterized, the function of the membrane-bound ligands remain unclear. To analyze the biological significance of membrane-bound SCF and -CSF-1 in vitro we used an epithelial cell line to ectopically express the different isoforms. In cocultures of SCF- or CSF-1 transduced epithelial cells with primary early hematopoietic progenitor cells we examined whether interaction between

______ * To whom correspondence should be addressed. Wolfram Ostertag, Hannover Medical School, CarlNeuberg-Str. 1, D-30625 Hannover, Germany

17 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 17–44. © 2008 Springer.

18

J. FRIEL ET AL.

the membrane-bound isoforms of SCF and CSF-1 and their receptors mediate cell proliferation, self-renewal or differentiation. We show here that the membranebound isoforms of SCF and CSF-1 both have functions in inducing self-renewal of early hematopoietic cells. In contrast, soluble SCF and CSF-1 exert specific functions: SCF by itself causes clonal extinction whereas CSF-1 is involved in the macrophage differentiation. In context with the stroma-hematopoietic cell interaction we also show that CSF-1 can sustain the self-renewal of a murine stem cell line Myl-D7. 1. Introduction Hematopoietic stem cell development is governed by a complex interplay between signals from stem cells and those emanating from the bone marrow stroma. In stroma, stem cells must periodically activate to produce progenitoror transient amplifying cells that are committed to produce mature hematopoietic lineages. Stromal cells form a hematopoietic microenvironment by expressing growth factors, adhesion molecules and matrix proteins, all of which regulate the homing, growth, survival and differentiation of stem cells. Growth factors produced by stroma include cytokines such as IL-1 and IL6, ligands of receptor tyrosine kinase like SCF, CSF-1 and Flt-3 ligand; Notch ligands, bone morphogenetic protein 4 and sonic hedgehog. Hematopoietic stem cells interact with their microenvironment differently, involving cellcell interactions, association to extracellular matrix proteins and binding to membrane-bound- and soluble growth factors. Growth factors, which are produced both as soluble and membrane-bound isotype proteins include members of the receptor tyrosine kinase subclass III, such as stem cell factor (SCF) (Anderson et al., 1990; Huang et al., 1990), colony stimulating factor-1 (CSF-1, M-CSF) (Ladner et al., 1988; Ceretti et al., 1988) and Flt 3 ligand (Hannum et al., 1994; McClanahan et al., 1996). SCF is encoded by the mouse Steel (Sl) loci (Zsebo et al., 1990). The SlDickie allele of mutant mice (Sld) encodes a smaller protein due to deletions of the transmembrane and intracellular domains. Sld cells exclusively express a secreted form of SCF (Flanagan et al., 1991). Another mutation of the Steel locus, Sl/Sl, results in complete loss of SCF production (Zsebo et al., 1990). Mutations of both the Steel and Sld loci result in similar phenotypic disorders of hematopoiesis characterized by reduction in stem cell numbers, anemia, mast cell- and repair deficiencies (Nocka et al., 1989; McCulloch et al., 1965). Phenotypes of Sld mice show that the membrane inserted SCF must have an

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

19

essential function that differs from that of soluble SCF (Dexter and Moore, 1977; Fujita et al., 1988). The kit receptor is expressed on hematopoietic stem cells implying a function of SCF in the regulation of self renewal and/or adhesion of cells to stroma (Ogawa et al., 1991; Ikuta and Weissman,1992; Kodoma et al., 1994). Soluble SCF synergizes with early and late acting cytokines including the Flt3 ligand, Thrombopoietin (TPO), IL-3, GM-CSF and erythropoietin (Epo) to enhance the growth of primitive cells (McNiece et al., 1991; Lemoli et al., 1993; Ramsfjell et al., 1997). Other studies indicate that hematopoiesis, controlled by stroma cell interaction, also functions with stroma deficient in the synthesis of SCF (Ikuta and Weissman, 1992; Sutherland et al., 1993; Itoh et al., 1989). CSF-1 and SCF are evolutionary related and show genetic and structural homologies: the gene structure, the sequence of the extracellular domains, the proteolytic maturation and the tertiary folds of the proteins are very similar. Additionally, the receptors for CSF-1 and SCF appear to have diverged from an ancestor molecule of the PDGF receptor (Yarden et al., 1986,1987). The CSF-1 receptor (c-fms) is expressed on primitive multipotent hematopoietic cells (Bartelmez and Stanley, 1985), phagocyte progenitor cells (Tushinski et al., 1982), monoblasts, promonocytes, monocytes (Byrne et al., 1981) and tissue macrophages (Stanley et al., 1983). Several studies suggest that the CSF-1 receptor could be also involved in the regulation of more early cells: primitive hematopoietic cells express the CSF-1 receptor and CSF-1 synergize with IL-1, IL-3, IL-6, G-CSF and GM-CSF to induce the formation of multipotential colonies (Broxmeyer et al., 1988; Bartelmez et al., 1989; Friel et al., 2005). Furthermore, the progenitor activity of day 12 spleen colony-forming cells can be blocked by neutralizing antibodies against the CSF-1 receptor (Gilmore and Shadduck, 1995). Whatever the nature of the receptor tyrosine kinase subclass III ligand isoforms involved, it is presently unclear whether they induce different signaling effects in early hematopoietic cells upon binding to its receptor. To determine the function of the SCF/CSF-1 isoforms we used an embryonic epithelial cell line to express ectopically each membrane-bound and soluble ligand. In cocultures with human and murine early progenitor cells we determined their proliferative and developmental responses. The murine hematopoietic stem cell line Myl-D7 spontaneously differentiate along the lymphoid, myeloid and erythroid lineages. Myl-7 cells shows a strict stromal dependence for growth of self-renewing stem cells and express high levels of CSF-1 receptor (Itoh et al., 1996). We used this cell line to analyze the function of CSF-1 in maintaining multipotent cells. In an other attempt to characterize unknown factors that could sustain stem cells we

J. FRIEL ET AL.

20

generated stroma-independent Myl-D7 mutants. The autostimulatory activity of these mutants was examined. 2. Results To verify the different functions of the isoforms of SCF and CSF-1 in promoting stroma-dependent growth a non-stromal cell system was used to express the soluble and membrane-bound cDNA isoforms. TABLE 1. Cell lines used and expression of SCF/CSF-1 ligands Feeder cell cDNA used for line transduction

-

MS5 MMCE MMCE MMCE

Sld m2 SCF

UNC Sl/Sl

-

SCF expression

CSF-1 expression

membranebound

soluble

membranebound

soluble

+

+

+

+

+

+

-

-

+

-

-

-

-

UNC Sl/Sl Sld

-

+

+

+

UNC Sl/Sl m2 SCF

+

-

-

+ +

+ + +

+ + +

MS Sl-2 MS Sl-2

m2 SCF

+

+

Described as

MS5 MMCE MMCE MMCE Sl/Sl stroma Sl/Sl stroma Sl/Sl stroma Sld stroma Sld stroma

To exclude synergistic effects between stroma encoded factors and the ectopically expressed SCF/CSF-1 isoforms we used as a coculture system the murine embryonic epithelial cell line MMCE (Rapp et al., 1979). MMCE does not produce any isoform of SCF or CSF-1 and does not express genes for those growth factors like IL-1α, IL-6, IL-11, Flt 3 ligand, G-CSF, Epo or TPO that are known to synergize with SCF or CSF-1 in augmenting growth of hematopoietic cells (McNiece et al., 1991; Lemoli et al., 1993: Ramsfjell et al., 1997). MMCE cells also do not express genes for MIP-1α or TGF-β that could inhibit the maintentance of hematopoietic progenitors on stroma (Mayami et al.,

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

21

1995). The only growth factor mRNA detected of the large number tested was PDGF-A (data not shown, Friel et al., 2002). Untransduced MMCE cells failed to support short or long term proliferation of hematopoietic progenitors. The untransduced murine stromal cell line MS5 (Itoh et al., 1989) expressing wildtype SCF and CSF-1 was used as a control. For SCF/CSF-1 expression of different cell lines used see Table 1. 2.1. MEMBRANE-BOUND SCF ON ITS OWN IS BIOLOGICALLY ACTIVE AND INDUCES LONG TERM GROWTH OF TF1 CELLS IN COCULTURE ON EPITHELIAL CELLS

To determine the function of the SCF isoforms in inducing long-term growth of hematopoietic cells we used the human CD34+ progenitor cell line TF1 (Kitamura et al., 1989). Ectopic secretion of soluble Sld SCF by MMCE could not stimulate long term proliferation of TF1 in coculture. Conditioned medium of MMCE cells synthesizing soluble Sld SCF stimulated only a short term response of TF1 cells (Fig. 1).

Figure 1. Long term growth of TF1 induced by epithelial MMCE cells expressing membranebound SCF. Long term growth of TF1 cells was determined by serial clone transfer experiments. 48 clones from several independent experiments with cell numbers >5·10² cells were transferred on new feeders during the first and second transfer. Each point represents the mean (±SD) of five independent experiments. The results are calculated as % of TF1/Sl+ MS5 control cocultures. C.E.s at the first clonal transfer of TF1 cells were set to 100%. t MMCE transduced with cDNA for mb SCF, s MMCE transduced with cDNA for soluble Sld SCF, C parental MMCE, I Sl+MS5.

22

J. FRIEL ET AL.

Ectopic expression of membrane-bound (mb) SCF, however, confered stroma like growth promoting activity to epithelial MMCE cells (Fig. 1). The initial cloning efficiency of TF1 on transduced MMCE expressing mb SCF was about one third compared to cocultures on murine Sl+MS5 stroma. On repeated serial transfer the proliferation of TF1 clones on MMCE ectopically expressing mb SCF was as high as that on Sl+MS5 stroma (data not shown). This reflects the selection of adapted TF1 clones in coculture on transduced competent MMCE cells. Thus, mb SCF on its own can mediate long term growth promoting signals to hematopoietic precursor cells. MMCE cells express PDGF-A which is not a specific hematopoietic cytokine but shows potential mitogenic effects on hematopoietic cells in presence of other primary factors (Michalevicz et al., 1986; Delwiche et al., 1985). Its effects are presumably indirectly mediated, for example by upregulation of IL-1 (Yan et al., 1993) in stromal macrophages, CSF-1 or IL-6 from mesenchymal cells (Hall et al., 1989). From our RT-PCR analysis no upregulation of any one of the tested factors could be observed in MMCE cells expressing the PDGF-A gene, regardless whether transduced with SCF encoding retroviral vectors or not (Friel et al., 2002). However, we cannot exclude some synergistic action between membrane-bound SCF and PDGF in cocultures on modified MMCE. Certainly, parental MMCE could not support proliferation of TF1 (cf. Fig. 1). 2.2. EXOGENOUSLY ADDED SOLUBLE SCF CAN NOT IMPAIR OR MIMIC THE EFFECT OF MEMBRANE-BOUND SCF

Two reasons could explain the failure of soluble Sld SCF to induce long term growth of hematopoietic cells on stroma. One might be the production of inadequate levels of protein by Sld stroma and by Sl/Sl and MMCE cells ectopically expressing Sld SCF. The other could be an antagonistic function of the mutated Sld SCF compared to the membrane-bound isoform. To test for these possibilities we added recombinant soluble SCF, that is produced as a cleavage product of mb SCF, to TF1 feeder cocultures. Addition of exogenous recombinant SCF even in excess of 100ng/ml to TF1 on Sl+MS5 cells had little or no effect on cloning efficiencies (Fig. 2a). In contrast, supplementation of Sld stroma cocultures with recombinant SCF further reduced the growth promoting potential about 2.5-fold (Fig. 2b). Functional neutralization of the added recombinant SCF by anti SCF antibodies surprisingly increased the cloning efficiency 2-fold beyond that seen without adding recombinant SCF. In contrast, addition of recombinant SCF to Sld stroma cocultures ectopically expressing mb SCF did not influence the proliferation rate of TF1 (Fig. 2b). Addition of recombinant SCF to cocultures of TF1 on Sl/Sl

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

23

stroma not expressing any isoform of SCF showed an even more dramatic effect. The growth promoting potential is reduced 4-fold. Neutralization of the exogenously supplied SCF by anti SCF antibodies restored the original growth inducing activity of the parental Sl/Sl stroma (Fig. 2c). Supplementation of recombinant SCF to cocultures of TF1 on Sl/Sl stroma already ectopically expressing soluble Sld SCF showed only a slight effect. This most likely is caused by the already synthesized SCF. Again, addition of recombinant SCF to Sl/Sl cocultures ectopically expressing mb SCF did not impair the proliferation rate of TF1 (Fig. 2c).

Figure 2. Soluble SCF reduces the cloning efficiency of TF1 cells. TF1 cells were cultured on feeders in presence of various amounts of reombinant mouse SCF. Neutralizing anti-SCF antibody was added as indicated from day 10 to day 16. Viable clones were counted following the second transfer. Each column represents the mean±SD of four independent experiments calculated as % of CEs of control cocultures. Titration of recombinant SCF on: a) Sl+MS5 cocultures expressing wildtype SCF. C.E. of control coculture on Sl+MS5 without addition of recombinant SCF was set to 100%. b) Stroma cocultures producing Sld or Sld plus mb SCF. C.E.s of control cocultures without addition of recombinant SCF on Sld stroma (white columns), or Sld stroma transduced to express mb SCF (dark grey) were set to 100%. c) Sl/Sl cocultures expressing no SCF, soluble Sld SCF or mb SCF. C.E.s of control cocultures without addition of recombinant SCF on Sl/Sl UNC (white columns), or Sl/Sl UNC transduced to express Sld SCF (grey columns) or mb SCF (dark grey) were set to 100%. d) MMCE cocultures producing mb SCF. C.E. of control coculture on MMCE transduced to express mb SCF without addition of recombinant SCF was set to 100%. Dark grey columns: cell lines presenting mb SCF.

24

J. FRIEL ET AL.

Not unexpectedly, addition of large quantities of recombinant SCF to TF1 cocultures on parental MMCE synthesizing no SCF or transduced Sld SCF did not increase the cloning efficiencies of TF1 cells. Addition of recombinant SCF, even in excess of 100 ng/ml to cocultures of TF1 on MMCE cells transduced to present mb SCF could not impair the growth promoting potential of these feeder cells (Fig. 2d). Taken together, supplementation of stromal or epithelial cocultures with recombinant SCF in absence of membrane-bound SCF suppresses the cloning efficiency of TF1 cells. Neutralization of the effect of soluble SCF by anti-bodies abolishes the negative effect and restored the original growth promoting activity of the stroma. Thus, soluble SCF, either as recombinant protein or as mutated Sld SCF, on its own induces the growth abrogating effect in TF1 feeder cocultures. Even high concentrations (100 ng/ml) of recombinant SCF can not mimic the effect of membrane SCF in providing growth support for TF1. 2.3. NEUTRALIZATION OF THE SCF/C-KIT INTERACTION CAN INCREASE OR INHIBIT PROLIFERATION OF TF1 ON FEEDER CELLS

To verify that the SCF c-kit interaction plays the essential role in stimulating TF1 in our coculture system, neutralization experiments were set up using the anti c-kit monoclonal antibody YB5.B8 (Lerner et al., 1991). Data presented in Fig. 3a show that addition of α-c-kit drastically inhibited growth of TF1 on wildtype Sl+MS5 stroma in a concentration dependent manner. Application of α-c-kit to cocultures of TF1 on parental Sld stroma confirmed the importance of the SCF/c-kit interaction (Fig. 3b). Preventing binding of SCF to c-kit by adding α-c-kit antibodies increased the cloning efficiency of TF1 on Sld stroma up to 2-fold (Fig. 3b). Thus, addition of SCF antibodies (cf. Fig. 2b) as well as α-c-kit antibodies to cocultures results in a beneficial effect on the growth promoting potential of Sld cells. Hence, Sld stroma can promote long term growth of TF1 cells only by mechanisms independent of the SCF-c-kit complex when the effect of soluble SCF is neutralized. Addition of α-c-kit to cocultures of TF1 on transduced Sld stroma producing mbSCF reduced the cloning efficiency about 2-fold. Even high amounts of antibodies (5.6 µg/ml) could not completely inhibit the proliferation of TF1 cells (Fig. 3b). One explanation could be that addition of neutralizing α-c-kit prevented the interaction of Sld SCF with c-kit, thereby promoting an SCF/c-kit independent growth stimulatory pathway. α-c-kit antibodies if added to cocultures of TF1 on transduced MMCE expressing mbSCF causes complete inhibition of growth as expected (Fig. 3d). These inhibition experiments thus confirmed the essential role of the SCF/c-kit interaction in supporting long term stroma dependent growth of TF1.

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

25

Figure 3. Neutralizing anti c-kit moAb inhibits proliferation of TF1 on feeder cells expressing membrane-bound SCF. TF1 cells were cocultured in presence of serial dilutions of YB5.B8 moAb on stromal or epithelial cell lines expressing either endogenous and/or transduced SCF genes. Viable clones were counted after the second serial transfer. Data are mean±SD values of three to five independent experiments calculated as % of control Sl+MS5 cocultures which was not supplemented with α-c-kit Ab. Neutralizing anti-c-kit antibody was added as indicated from day 10 to day 16. Potential nonspecific inhibiting effects of the antibody preparation were excluded by culturing TF1 cells in suspension with 100 U/mL rGM-CSF in presence of various amounts of YB5.B8 moAb and counting proliferating cells after 72 hours. Addition of α-c-kit Ab to: a) P Sl+MS5 cocultures expressing wild type SCF; ! TF1 cells grown in suspension with 100 U/ml r GM-CSF. b) P Sld cocultures producing Sld or I Sld and ectopically mb SCF. c) 1 Sl/Sl cocultures producing no SCF, ectopically p soluble Sld SCF or i mb SCF. d) s epithelial MMCE cocultures expressing transduced mb SCF.

2.4. MEMBRANE-BOUND SCF IS SUPERIOR TO SOLUBLE SLD SCF IN SUPPORTING GROWTH OF PRIMARY HEMOPOIETIC CELL GROWTH

A number of reports have shown that CD34+ cells obtained from umbilical cord blood (CB) are quiescent (Mayani and Lansdorp, 1998). We therefore extended our system for SCF induced proliferation to the CB CD34+

26

J. FRIEL ET AL.

population to evaluate which isoform of SCF could more efficient induce proliferation. CD34+ cells were cocultured on MMCE cells expressing mb or soluble Sld SCF and as controls on untransduced MMCE and on Sl+MS5 stroma.

Figure 4. Membrane-bound SCF stimulates clonogenic CD34+ CB progenitors stronger than soluble SCF. Cord blood CD34+ cells were seeded on feeders. Each point represents the mean ±SD of six independent experiments. A) net increase of total cord blood cells; B) Colony forming units (CFU) are calculated as CFU per 100 cells plated in methylcellulose. Cloning efficiencies were recorded after coculturing for 7, 14, 21, and 28 days. Data are mean(±SD) of several independent experiments as indicated. p CD34+ cells cocultured on Sl+ MS5 stroma; P CD34+ cells cocultured on untransduced MMCE cells; i CD34+ cells cocultured on MMCE cells expressing membrane-bound SCF; I CD34+ cells cocultured on MMCE cells expressing soluble Sld SCF.

Within one week the total number of hematopoietic cells increased on stimulation with Sl+MS5 stroma 5-fold (Fig. 4a). Membrane-bound SCF was slightly more effective (3.5-fold) than soluble Sld SCF (2.8-fold) in enhancing the total number of hematopoietic cells at this time point. A proliferating cell population was also initially detected in coculture with untransduced epithelial cells, although the proliferation capacity declined within two weeks (Fig. 4a). After four weeks in coculture the proliferation potential of Sld SCF induced CB cells was 6-fold decreased, that of mb SCF stimulated cells 1.5-fold. Thus, proliferating cells were maintained significantly longer in cultures supported by membrane-bound SCF than by Sld SCF. To investigate the cloning efficiency of the progenitor cells in these cocultures we analyzed their colony formation ability in methylcellulose supplemented with recombinant growth factors. The results indicate that within the first two weeks mb SCF as well as Sld SCF or Sl+MS5 stroma induced

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

27

comparable cloning efficiencies of primary hematopoietic cells (Fig. 4b). After four weeks the cloning efficiency of soluble Sld SCF stimulated hematopoietic progenitors declined 3-fold as opposed to cells driven by mb SCF. MMCE feeder by itself was unable to stimulate progenitors longer than one week (Fig. 4b). These results clearly show that membrane-bound SCF was superior to soluble Sld SCF in stimulating clonogenic progenitors throughout the culture period of four weeks. Furthermore, membrane-bound SCF induces comparable proliferation rates of clonogenic precursors as Sl+MS5 stroma. The conditioning of the CD34+ cells as analyzed by colony assays in methylcellulose revealed that membrane-bound SCF mainly supports the maintenance of multipotent and bipotent progenitors. The number of CFU-GM and CFU-GEMM constituted 32% of total colony-forming cells after one week and 52% after two weeks in coculture. In contrast, the proportion of multipotent progenitors in cocultures induced by Sld SCF are 4-fold lower after three weeks in culture (Table 2), but the contents of erythroid colonies (BFU-e’s) increased 1.5-fold at the same time point. The results indicate that soluble Sld SCF promotes more committed cells than membrane-bound SCF. Mature myeloid colonies increased about 1.5-fold in contrast to CFU-C derived from membrane-bound SCF expressing cultures (Friel et al., 2002). The effect of soluble Sld SCF on the stimulation of erythroid precursors is at the first glance unexpected, since Sld mice bear erythroid deficiencies (McCulloch et al., 1965). The simplest explanation is, that the increased appearance of BFU-e’s is correlated with the increased number of macrophage colonies. It is known that macrophage colonies in vitro cultures have supporting effects on erythroid colonies, perhaps by secreting Epo. Nevertheless, we could not exclude that due to a synergistic effect of an uncharacterized factor produced by epithelial MMCE cells the number of erythroid progenitors in Sld conditioned hematopoietic cells is promoted. TABLE 2. Membrane-bound isoforms of SCF and CSF-1 show comparabel effects in inducing proliferation of primary CD34+ cells but membrane-bound SCF has a stronger effect on the selfrenewing potential. 250 cord blood cells cocultured on MMCE feeders expressing different CSF-1 isoforms were weekly plated in methylcellulose supplemented with hematopoietic growth factors. On day 14 colonies were examined. CFU-values were calculated as % of total CFU. Data are mean±SD of five experiments. *) After three weeks in coculture 500 cells were plated in methylcellulose. a) Cloning efficieny of CD34+ cells stimulated by different SCF- or CSF-1 isoforms as indicated. **) mb CSF-1 and soluble SCF yielded significant differences (P<.02). ***) mb CSF-1 significantly enhanced the outcome of clonogenic cells compared to soluble CSF-1 (P<.02). b) Distribution of clonogenic CD34+ progenitors stimulated by SCF- or CSF-1 isoforms to myeloid lineages. Stastic calculations refer to mean values after 3 weeks in coculture. Induction of G+M colonies: a) mb SCF and soluble SCF showed comparable effects (P>.05); b)

28

J. FRIEL ET AL.

soluble CSF-1 stimulated significant more lineage-specific cells than mb CSF-1 (P<.05). Induction of GM colonies: c) mb SCF was more efficient than soluble SCF (P<.05); d) difference between mb CSF-1 and soluble CSF-1 was not apparent (P>.05). Induction of BFU-e colonies: e) a higher production of colonies was achieved by mb SCF as compared to soluble SCF (P<.01); f) mb CSF-1 increased the output of erythroid progenitors when compared to soluble CSF-1 (P<.01). Induction of GEMM colonies: g) mb SCF enhanced the frequency of multipotential cells in contrast to soluble SCF (P<.02); h) mb CSF-1 induced higher expansion of multipotential cells than soluble CSF-1 (P<.05).

MMCE untransduced cells support mainly the survival of committed myeloid (CFU-G and CFU-M) and erythroid (BFU-e) progenitors for at least up to two weeks. The cocultivation experiments using CB CD34+ cells thus confirmed our results obtained with the cell line TF1: ectopic expression of membrane-bound SCF can substitute for stroma functions like long term maintenance and expansion of multipotent progenitors. 2.5. MEMBRANE-BOUND CSF-1, BUT NOT SECRETED CSF-1 GLYCOPROTEIN STIMULATES SELF-RENEWAL OF PRIMARY CD34+ CELLS

Up to 5% of unstimulated CB mononuclear cells are CSF-1-receptor positive as measured by flow cytometry (data not shown). In the first week of coculture on transduced MMCE cells all CSF-1 isoforms promoted proliferation of CB CD34+ cells with comparable rates (Fig. 5a). However, within four weeks the stimulatory activity of wildtype CSF-1 declined dramatically. Obviously, the soluble isoform provided only a limited expansion of CB CD34+ cells.

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

b)

CD34 expression of CB cell stimulated by wildtype CSF-1

10

10

1

10

2

PE

10

3

10

4

10

Counts

69.6%

0

10

1

10

2

PE

10

3

10

4

M1

10

20 40 60 80 100

Counts

M1

20 40 60 80 100

49.5%

17.03% M1

0

0

M1 0

soluble CSF-1

membrane-bound CSF-1

0

Counts

74.3%

0 20 40 60 80 100

40 80 120 160 200

MS5 stroma

Counts

29

0

10

1

10

2

PE

10

3

10

4

10

0

10

1

10

2

103 104

PE

CD34 PE

Figure 5. A) Membrane-bound CSF-1 stimulates amplification of CD34+ progenitors. 2·104 cord blood CD34+ cells were cocultivated on feeders in 24-well plates. Increase of total cells was weekly determined and cells were transferred to new feeders. The results are calculated as % of CD34+/MS5 control cocultures. Amplification rates of CB CD34+ cells on MS5 stroma were set to 100% at each time point. Each point represents the mean±SD of five independent experiments. Membrane-bound isoforms of SCF or CSF-1 induced longer-lasting self-renewal of primary CD34+ cells. a) After 3 weeks in coculture a highly significant difference between populations supported by mb SCF and soluble SCF was found (P<.01); b) Growth rate of population sustained by mb CSF-1 was significantly different from cells stimulated by soluble CSF-1 (P<.002). B) Membrane-bound CSF-1 induces self-renewal of CD34+ progenitors. Expression of the CD34 antigen of cord blood cells cocultured for 14 days on MMCE cells expressing ectopically the different CSF-1 isoforms. Cells were stained with PE-conjugated anti-human CD34 anibodies. High expression of the CD34 antigen reflects the self-renewing potential of CB cells stimulated by mb CSF-1.

30

J. FRIEL ET AL.

Membrane-bound CSF-1 (mb CSF-1) in contrast induced high amplifications of CB CD34+ cells even on day 28 (Fig. 5a). Remarkably, the proliferation inducing signals of mb CSF-1 remained constant and were similar throughout the culture (Fig. 5a). The self-renewal inducing activity of the mb CSF-1 isoform and the differentiation promoting effect of the soluble form was indicated by CD34 antigene expression of the cocultured cells. Cultures induced by mb CSF-1 showed no decrease in the pool size of CD34+ progenitors compared to CD34+/MS5 stroma control cultures (Fig. 5b). In contrast, stimulation by soluble CSF-1 resulted in a marked (4-fold) reduction of CD34+ progenitors (Fig. 5b). These results suggest that mb CSF-1 can sustain self-renewal of early progenitors whereas soluble CSF-1 induces differentiation of stimulated cells. The phenotype of clonogenic precursors was assessed by colony assays to compare the differentiation-inducing effects of either mb- or soluble CSF-1. Membrane-bound CSF-1 sustained early cell subpopulations stronger than wildtype- or soluble CSF-1 (4- to 6-fold, respectively; Table 2) as evidenced by the higher proportion of colonies derived from early progenitor cells (BFU-e, CFU-GEMM). Stimulation of CB CD34+ cells by soluble CSF-1 thus may lead to myeloid differentiation of committed progenitors. The mb isoform of SCF stimulated a higher proportion of CFU-GEMM than the corresponding CSF-1 isoform. This may be a consequence of the higher potential of SCF in supporting self renewal of early progenitors (Table 2; Friel et al., 2005). 2.6. MEMBRANE-BOUND- AND SOLUBLE CSF-1 OVEREXPRESSED BY MMCE CELLS CAUSE DIFFERENTIAL RESPONSES OF MYL-D7 CELLS IN COCULTURES

We next analyzed the effects of the CSF-1 isoforms on the development of Myl-D7, a strictly stroma-dependent stem cell line (Itoh et al., 1996). At least 51% of Myl-D7 cells express among other multilineage markers high levels of CSF-1 receptors (data not shown). A strong proliferation response of Myl-D7 cells was only obtained on MMCE feeders expressing mb CSF-1 as is clearly shown in Fig. 6. Although the proliferation stimulated by mb CSF-1 declined slightly during the cultivation period it was still 4-fold stronger than that of wildtype- or soluble CSF-1 at 3 weeks of culture (Fig. 6).

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

31

Figure 6. Proliferation of the murine Myl-D7 stem cell line is stimulated efficiently only by membrane-bound CSF-1. 2·103 Myl-D7 cells were cultured on MMCE cells expressing the different CSF-1 isoforms in 48-well plates. Cloning efficiencies were determined weekly and Myl-D7 clones (>102 cells) were transferred onto new MMCE cells. Values of Myl-D7/MS5 cocultures were set to 100% at each time point (data not shown). Results are expresses as percentage of control Myl-D7/MS5 cultures and are mean values ±SD (four experiments). After 3 weeks in coculture a) no difference was found in the proliferation rates of cells stimulated by either wildtype- or soluble CSF-1 (P>.05); b) mean values for populations stimulated by membrane-bound- or soluble CSF-1 were significantly different (P<.001).

To characterize the development of Myl-D7 cells induced by soluble- or mb CSF-1 we examined the surface-marker phenotype of cocultured Myl-D7 cells by FACS analyses. Cells stimulated by mb CSF-1 showed only a slight trend towards differentiation into the macrophage lineage. Only a small subfraction of cells expressed the mononuclear-phagocyte-specific marker F4-80 (Hume et al., 1984). In contrast, cells induced by wildtype- or soluble CSF-1 expressed 12-fold and 23-fold higher amounts of the F4-80 antigen. The multipotential phenotype of Myl-D7 cells, as indicated by the unchanged expression of the CD90 (Thy-1) and F4-80 antigens, was thus maintained in cocultures sustained by mb CSF-1. Soluble CSF-1, as expected, induced an apparent shift toward differentiation into the macrophage-lineage (data not shown; Friel et al., 2005).

32

J. FRIEL ET AL.

2.7. A STRONG SUSTAINED MITOGENIC SIGNAL IS INDUCED BY MEMBRANE-BOUND CSF-1 IN SCA-1+ LIN- PRIMITIVE QUIESCENT STEM CELLS

We next tried to determine whether membrane-bound CSF-1 could stimulate a subpopulation of very primitive cells. Lineage marker negative mouse Lin-Sca1+ cells were cocultured on MMCE cells expressing either the cDNA for wildtype, soluble or membrane-bound CSF-1. Untransduced CSF-1+MS5 stroma was used as a control. From two weeks on a continuous decrease in the proliferation of hematopoietic cells supported by wildtype- or soluble CSF-1 was seen. The better growth response of cells exposed to mb CSF-1 was again seen by higher (3-fold and 10-fold) levels of proliferating cells over four weeks of cocultivation (Fig. 7).

Figure 7. Membrane-bound CSF-1 on its own induces high self-renewal response of primitive Lin-Sca+ cells. Membrane-bound CSF-1 can stimulate very early cells. Lin-Sca-1+ cells were cocultivated on MMCE cells ectopically expressing different CSF-1 isoforms as indicated. Increase of Lin-Sca-1+ cells on MS5 stromal cells was set to 100% at each time point. Proliferation of Lin-Sca-1+ cells on MMCE feeders was shown as % of Lin-Sca-1+/MS5 controls. Each point represents the mean±SD (three separate experiments). After 3 weeks in coculture a) growth rate of cells stimulated by soluble CSF-1 was profoundly lower than that of cells stimulated by membrane-bound CSF-1 (P<.05).

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

33

The number of colonies obtained in the CFC assay of Lin-Sca-1+ cells that had been stimulated with each of the CSF-1 isoforms corresponded to the resultant amplification (Fig. 7). The cloning potential of cells after three weeks in culture maintained by mb CSF-1 was about 4-fold higher than in cultures stimulated by soluble- or wildtype CSF-1. The qualitative differences between these CSF-1 forms in sustaining primitive hematopoietic progenitors were again obvious. The number of colonies produced by early progenitors (CFU-GEMM) in the population stimulated by mb CSF-1 was 4-fold higher as in the parallel culture promoted by wildtype CSF-1 and even 13-fold higher than in cultures sustained by soluble CSF-1. Conversely, soluble CSF-1 apparently induced differentiation into mature cells. Following two weeks coculturing, 87% of all colonies were derived from macrophage precursors, whereas only 30% of the colonies induced by mb CSF-1 was of that type (Table 2). 2.8. FRACTIONATION AND ANALYSIS OF MS5 SUPERNATANT IDENTIFIES CSF-1 AS A MAJOR GROWTH FACTOR COMPONENT FOR MYL-D7 STEM CELLS

The stem cell line Myl-D7 not only expresses differentiation markers of all lineages but is dependent for growth on self-renewing stem cells within the Myl-D7 clone which spontaneously differentiates along the lymphoid, myeloid, or erythroid direction (Itoh et al., 1996). Supernatant of MS5 induces short term growth of Myl-D7 cells. This may indicate that at least soluble stem cell growth factors are secreted by MS5 cells. MS5 conditioned medium (CM) was fractionated using a Q sepharose column. Twenty-nine fractions were pooled into 2-3 fraction pools which were bioassayed for activity on lineage negative Myl-D7 cells, activity on cells of the CSF-1 responsive BAC1.2F5 macophage cell line (Morgan et al., 1987), and tested for the presence of CSF-1 by SDS-PAGE and Western blotting. The majority of bioactivity on lineage negative Myl-D7 cells was present in fractions 13-24 of the Q Sepharose column (Fig. 8a). Bioactivity on BAC1.2F5 cells, which are specifically responsive to CSF-1 or GM-CSF, was detected in column fractions 10-21 in an overlapping region (Fig. 8b). Finally, by Western blotting, CSF-1 was detected as a 24Kd reduced and deglycosylated monomer in overlapping column fractions 13-21 (Fig. 8c).

34

J. FRIEL ET AL.

Figure 8. CSF-1 supports for a limited period the proliferation of Myl-D7 stem cells. a) Fractions that contain a growth promoting activity can be separated by HiTrap Q sepharose column fractionation of MS5 CM. Short-term growth assay of lineage negative Myl-D7 cells stimulated with total MS5 CM as a control or pools of fractions (FXN) from a HiTrap Q sepharose column (3-11). 10% v/v of each pool was used per sample. Results for the following pools are shown: 4, FXN 4-6; 5, FXN 7-9; 6, FXN 10-12; 7, FXN 13-15; 8, FXN 16-18; 9, FXN 19-21; 10, FXN 2224; 11, FXN 26-29. The positions of the flow through fractions as well as NaCl gradient are also shown. b) Growth stimulation of BAC1.2F5 cells by HiTrap Q sepharose column fractions is consistent with the presence of CSF-1. BAC1.2F5 cell growth assay to determine units of CSF-1 in MS5 CM and fractions (FXN) from the HiTrap Q sepharose column. Units are defined arbitray (personal communication Dr. Medlock). (3-11): Fraction pools 3, FXN 3-5; 4, FXN 6+7; 5, FXN 8+9; 6, FXN 10+11; 7, FXN 12+13; 8, FXN 14+15; 9, FXN 16+17; 10, FXN 18+19; 11, FXN 20+21. MS5 CM was generated from cells grown in 10% FBS. The positions of the flow through fractions as well as NaCl gradient are also shown. c) Identification of CSF-1 protein in pools of fractions with short-term Myl-D7 growth stimulating activity. Western blot analysis of pools of fractions from the HiTrap Q sepharose column: 1, FXN 1-3; 2, FXN 4-6; 3, FXN 7-9; 4, FXN 1012; 5, FXN 13-15; 6, FXN 16-18; 7, FXN 19-21; 8, FXN 22-24; 9, FXN 26-29; 10, FXN 30-33; 11, FXN 34+35. High molecular weight bands probably result from incomplete deglycosylation of CSF-1 in some fractions.

We could also inhibit the bioactivity in fractions 13-24 using the neutralizing anti-CSF-1 antibody, demonstrating that CSF-1 in these fractions

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

35

was involved in stimulating Myl-D7 proliferation (data not shown; Heberlein et al., 2006). CSF-1 is thus one major bioactive factor released by MS5 cells which can stimulate Myl-D7. However, it should be noted that stimulation of lineage negative Myl-D7 cells by E.coli-derived recombinant-CSF-1 at equivalent CSF-1 concentrations was by far less efficient than CM from MS5 cells. Furthermore, the stimulation of lineage negative cells by MS5 supernatants was far better than that of L929 supernatants having similar concentrations of CSF-1 (data not shown). Thus it is likely that MS5 stromal cells produce additional factors that are required for Myl-D7 cell maintenance. 2.9. STROMA-INDEPENDENT MUTANTS CAN BE ISOLATED FROM MYL-D7

For the isolation of stroma-independent mutants, Myl-D7 cells were separated from MS5 and plated in 24-well or 96-well plates (105cells/well) without stroma. The overall frequency of stroma-independent mutants was very low (1.6x10-8). 89 stroma-independent mutants were obtained. The stroma-independent mutants belong to two different classes: secretors and non secretors. The supernatants of the 89 mutants were tested for their ability to support stroma-independent growth of Myl-D7. Myl-D7 cells were plated at two concentrations (2.0x105 cells/mL and 5x105 cells/mL) in triplicate in 24-well plates containing CM from confluent mutant cultures. For most of the supernatants tested the number of wild type Myl-D7 indicator cells decreased rapidly to less than 10% within the first 10 days. These mutants were classified as non secretors. Only 26 of the total 89 mutants secreted an activity stimulating the survival/proliferation of Myl-D7 for at least two weeks. Furthermore, only ten of these secretor mutants (e.g. #6i-4, #6i-22) stimulated the growth of Myl-D7 for longer than 6 weeks (data not shown; Heberlein et al., 2006). 2.10. CSF-1 IS ECTOPICALLY EXPRESSED IN SOME STROMA-INDEPENDENT MUTANTS

Ectopic expression of growth factors and autostimulation are often responsible for factor independence. As shown above, CSF-1 secreted by MS5 cells may be a potent stimulator of at least short-term proliferation of Myl-D7 cells. We therefore compared the steady-state CSF-1 mRNA levels of uncloned Myl-D7 cells, of several stroma-dependent clones and of many stroma-independent clones by Northern analysis (Fig. 9), to analyze if CSF-1 is expressed in stroma-independent Myl-D7 mutants.

36

J. FRIEL ET AL.

Figure 9. Some factor secreting mutants expresses CSF-1 transcripts. Northern blot analysis. 12mg of total RNA/lane were analyzed. The major transcript was a 4.0 kb CSF-1 message. Results for parental Myl-D7 cells, stroma-dependent subclones derived and stroma-independent mutants are shown: 1, #3i-1; 2, #5i-1; 3, #6i-4; 4, #6i-5; 5, #3i-2; 6, #4i-1; 7, #5i-3; 8, #6i-2; 9, #6i-3; 10, #6i-17; 11, #6i-18; 12, #6i-19; 13, #6i-20; 14, #6i-21; 15, #6i-22; 16, #6i-23; 17, #6i26. Those stroma-independent mutants that are secretors are also indicated. Although additional CSF-1 specific splice variants could be detected at low levels in MS-5 and Myl-D7 mutants with high CSF-1 expression, no mutant/cell line specific splice product could be shown. However, the size of the splice product detected depended on the probe that was used for hybridization. Two additional messages (3.2 kb and 2.3 kb) were detected by hybridization with a full length CSF-1 cDNA and only one additional message (2.3kb) was detected by hybridization with a 3’ fragment of the cDNA.

Low expression of a 4kb transcript was detected in uncloned cells of MylD7 and in all stroma-dependent subclones. Two types of secreting mutants were identified. About half of the secretors (7/16), expresses ectopically high levels of CSF-1 transcripts (e.g. #5i-1, #5i-3, #6i-2, #6i-3, #6i-4). The remainder of the secretors expressed low levels of CSF-1 transcripts, comparable to the very low level of CSF-1 message in wild type Myl-D7 (e.g. #6i-5, #6i-21, #6i-22, #6i-26). Interestingly, highly elevated CSF-1 mRNA levels were also found in some of the non-secreting mutants (e.g. #4i-2, #5i-2) (Fig. 9). In these mutants, CSF-1 may be acting internally within the CSF-1 receptor expressing cells as previously shown in rat myoblasts (Borycki et al., 1995). This specific form of

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

37

factor/receptor interaction has also been described for IL-3 (Dührsen et al., 1988; Dunbar et al., 1989). In summary, we show that the secretory mutants can be divided into two types, mutants expressing ectopically high levels of CSF-1 mRNA that probably secrete CSF-1 and other mutants that express low levels of CSF-1 mRNA that may not release CSF-1 but instead other factors that stimulate MylD7 proliferation (Heberlein et al., 2006). 3. Discussion Stromal cells not only mediate the homing of primitive cells but also produce stimulatory and inhibitory acting molecules that control maintenance of stem cells in the hematopoietic microenvironment. A shift in the balance between such opposing factors may determine the proliferation of hematopoietic cells on stroma (Dorshkind, 1990; Kim and Broxmeyer, 1998; Eaves et al., 1991). An important stromal derived growth factor, SCF, appears to play a major role in mechanisms like this. SCF can be expressed as a membrane-bound molecule that can be subsequently cleaved to soluble protein. The physiological functions of these isoforms are not well known. The deficiencies in mature eythroid precursors and in pluripotent hematopoietic stem cells in Sld mutant mice (McCulloch et al., 1965) indicated that the membrane-bound SCF isoform has an essential function in hematopoiesis. Our study using TF1 cells strongly suggest that the membrane presentation of SCF induces significantly higher proliferation signals compared to soluble Sld SCF. In contrast, soluble Sld SCF stimulates short term proliferation only and prevents long term growth of TF1. This was shown both by Sld SCF stroma or by adding recombinant SCF to cocultures (Fig. 2) The importance of the interaction between mb SCF and c-kit is also demonstrated by the finding that SCF deficient Sl/Sl stroma is less efficient than stroma expressing wildtype + + SCF Sl MS5 in inducing long term growth of CD34 hematopoietic cells. This deficiency could be rescued by ectopic expression of membrane-bound SCF resulting in significant higher proliferation of cocultured TF1 cells. Conversely, expression of soluble Sld SCF in transduced Sl/Sl stroma leads to growth abrogation of TF1. Blocking the c-kit receptor by neutralizing antibodies to avoid binding of mb SCF resulted in reduced clonability of TF1 cells on stroma. Preventing binding of secreted SCF to the c-kit receptor resulted in significantly higher growth rates of TF1 on Sld stroma. These results indicate that the membrane-bound SCF/c-kit receptor complex is responsible for inducing long term proliferation of hematopoietic cells on stroma. Furthermore, the two isoforms of SCF have antagonistic functions in promoting growth of

38

J. FRIEL ET AL.

hematopoietic precursors. Soluble Sld SCF is “recessive” to its membrane counterpart but epistatic to other stroma derived factor-receptor interactions. We have evaluated this assumption by utilizing CB CD34+ cells in coculture experiments with epithelial cells expressing either membrane-bound or Sld SCF. Cycling of primary stem cells have been reported to be correlated with a sequential loss of the proliferation capacity. Our results have shown that the reduction of proliferation is less when membrane-bound SCF stimulates the CD34+ cells as opposed to soluble Sld SCF (Fig. 4). Consequently, membranebound SCF stimulated CB cells show higher proliferation potential than cells stimulated by soluble SCF. Thus, the overall effect of the SCF isoforms is similar on primary as well as on immortalized TF1 cells. Membrane-bound SCF supports the survival and proliferation of hematopoietic colony forming cells with a predominantly bi- or multipotent character, whereas soluble Sld SCF promotes mainly the maintenance of unipotent precursors. Furthermore, the phenotype of CFC induced by membrane-bound SCF resembles that of cells supported by Sl+MS5 stroma. Thus, membranebound SCF ectopically expressed in epithelial MMCE cells can function as a surrogate stroma system for CD34+ cells. Our data could possibly suggest that the antagonism of the SCF isoforms may be simply caused by different kinetics of c-kit activation. Inefficient c-kit activation by soluble SCF could thus be the consequence of suboptimal amounts of Sld SCF produced either by parental Sld stromal cells or by the transduced retroviral vectors. High concentrations of soluble SCF should then be able to imitate the effect of the membrane-bound isoform or to compete with membrane-bound SCF for c-kit activation. However, in our test system recombinant SCF even when exogenously applied in high concentrations (100 ng/mL) is neither able to replace the membrane-bound SCF/c-kit interaction nor to increase the growth rate of CD34+ TF1 on stroma or epithelial cells secreting Sld SCF (Fig. 2). These data clearly argue against the possibility that different levels of expression of the SCF isoforms simply induced the observed antagonistic effects (Friel et al., 2002). The difference between the interaction of soluble and membrane-bound SCF with the c-kit receptor seems to be qualitative and not quantitative. Kapur et al. have demonstrated qualitatively different functions of both SCF isoforms in vivo. They have shown that transgene expression of membrane-bound SCF but not of soluble SCF in Sld mice significantly compensates SCF related hematological deficiencies (Kapur et al., 1998). Although structurally related, CSF-1 was first shown to be a proliferation factor in early hematopoiesis almost 20 years ago (Bartelmez and Stanley, 1985; Stanley et al., 1986; Bartelmez et al., 1989) by the group that first defined CSF-1 (Stanley and Heard, 1977). These studies indicated that CSF-1 acted on

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

39

primitive cells by synergizing with other growth factors. Furthermore, CSF-1 was also active in an in vitro clonogenic assay for stem cells (CFU-S) (Pragnell et al., 1988). However, subsequent work has mainly focused on its role in regulating the proliferation, differentiation and function of macrophages (reviewed in Pixley and Stanley, 2004). The data presented here indicate the dual potential of the CSF-1 isoforms in inducing proliferation and development. Binding of the membrane-bound isoform to the CSF-1 receptor induces long-term high proliferation rates of early human and murine progenitor cells. In contrast, activation of the soluble CSF-1/CSF-1 receptor complex resulted in short-term proliferation. Activation of the CSF-1 receptor by membrane-bound CSF-1 resulted in maintenance of progenitors characterized by the unaltered expression of either the CD34 antigen in human- or the B220-, CD34- and Thy-1 markers in murine Myl-D7 cells. BFU-e- and CFU-GEMM levels were substantially higher in membranebound CSF-1 stimulated cultures compared to those cultured with soluble- or wildtype CSF-1. The growth inducing effects of the membrane-bound forms of CSF-1 and SCF were comparable. However, aspects of the phenotype of stimulated cells show qualitative differences. Membrane-bound SCF stimulated more the primitive colony-forming precursors (BFU-e, CFU-GEMM) of human CD34+ cells than the corresponding isoform of CSF-1, demonstrating the stronger effect of membrane-bound SCF in inducing self-renewal of early progenitors (Table 2). The results suggest that the cell-surface isoform of CSF-1 can replace the membrane-bound isoform of SCF in supporting long-term proliferation but not for stimulation of self-renewal (Friel et al., 2005). Growth abrogation of human- and murine hematopoietic cells caused by soluble- or wildtype CSF-1 could be, in contrast to the effects of membranebound CSF-1, a consequence of the induction of differentiation into the monocytic lineage. The lack in supporting progenitor subpopulations was not unexpected since macrophage precursors are known to be the major targets of soluble CSF-1 (Stanley et al., 1983). Soluble SCF is active only in cooperation with other cytokines (Lemoli et al., 1993; Ramsfjell et al., 1997). Therefore growth abrogation induced by soluble SCF was not accompanied by significant differentiation of stimulated cells. Instead SCF leads to clonal extinction (Itoh et al., 1997; Friel et al., 2002). Differential effects of the isoforms of a particular factor could be the consequence of receptor-mediated signaling. Proliferation leading to selfrenewal could depend on the signaling intensity through the factor/receptor complex (Zandstra et al., 2000). In this context, membrane-bound factors mediating cell-cell interactions may substitute for high local concentrations of a soluble factor resulting in delayed internalization of the factor/receptor complex

40

J. FRIEL ET AL.

that normally takes place immediately after soluble factor/receptor interaction. Indeed, it was reported, that membrane-bound SCF is more persistent in inducing phosphorylation of the SCF receptor than soluble SCF (Miyazawa et al., 1995). The molecular mechanisms by which the CSF-1/CSF-1 receptor complex causes different biological effects are not known. We infer that membrane-bound CSF-1 in analogy to SCF may induce a strong receptor activation thereby favoring self-renewal of early cells whereas soluble CSF-1 provides only a short receptor activation resulting in monocytic differentiation of CSF-1 receptor presenting cells. We used the stroma dependent Myl-D7 cell line to define unknown stem cell factors secreted by MS5 stromal cells. CSF-1 was identified as a major growth factor component of the MS5 supernatant by biochemical analysis. Recombinant CSF-1 induced short-term growth (3 days) of Myl-D7 to a similar extent as MS5 CM. Furthermore, growth of the parental Myl-D7 clone in MS5 CM could be inhibited by addition of an α-CSF-1 antibody, indicating that at least one of the active molecules is CSF-1. Thus we conclude that CSF-1 is a potent stimulator of the limited proliferation of the Myl-D7 stem cell line (Heberlein et al., 2006). In an another approach to identify unknown stroma-mediated functions we screened stroma-independent mutants of the multipotent stem cell line Myl-D7 in order to isolate mutants that secrete a factor maintaining wild type cells. At least two different components stimulating the survival/proliferation of the parental Myl-D7 clone were detected in the CM of different secreting mutants. Consistent with the results obtained with the biochemical approach, one of these activities was CSF-1. Factor secreting mutants express CSF-1 with a high incidence (Fig. 9). Interestingly, uncloned Myl-D7 and all stroma-dependent subclones also express very low levels of CSF-1. This result is not unexpected. The murine FDC-Pmix stem cells also had been shown by us to express low levels of CSF-1 upon differentiation (Just et al., 1993). Others suggest that CSF-1 is expressed at early stages (CFU-GEMM) during the development of myeloid progenitors to osteoclasts (Lacey et al., 1998). An other growthinducing factor is secreted by one stroma-independent Myl-D7 mutant. This has been so far not characterized by our group. This growth factor can stimulate alone or in combination with CSF-1 self-renewal of parental Myl-D7 stem cells. In contrast to MS5 stromal cells or MS5 CM, recombinant CSF-1 did not stimulate long-term survival/proliferation of Myl-D7. This may reflect the requirement of other growth factors expressed by MS5 cells that synergize with CSF-1 as indicated by early studies (Bartelmez and Stanley, 1985; Bartelmez et al., 1989). Consistent with early observations we show here that CSF-1 can replace SCF as a stem cell factor in sustaining early cells and that CSF-1 is involved in

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

41

the induction of proliferation of a stem cell line (Friel et al., 2005; Heberlein et al., 2006).

References Anderson DM, Lyman SD, Bird A, Wignall JM, Eisenman J, March CJ, Boswell HS, Gimpel SD, Cosman D, Williams DA, 1990. Molecular cloning of mast cell growth factor, that is active in both membrane bound and soluble forms. Cell 63: 235 Bartelmez SH, Stanley ER, 1985. Synergism between hemopoietic growth factors (HGFs) detected by their effects on cells bearing receptors for a lineage-specific HGF: assay of hemopietin-1. J Cell Physiol 122: 370 Bartelmez SH, Bradley TR, Bertoncello I, Mochizuki DY, Tushinski RJ, Stanley ER, Hapel AJ, Young IG, Kriegler AB, Hodgson GS, 1989. Interleukin-1 plus interleukin-3 plus colony stimulating factor-1 are essential for clonal proliferation of primitive myeloid bone marrow cells. Exp Hematol 17: 240 Borycki A-G, Smadja F, Stanley ER, Leibovitch SA, 1995. Colony-Stimulating Factor 1 (CSF-1) is involved in an autocrine growth control of rat myogenic cells. Exp Cell Res 218: 213 Broxmeyer HE, Williams DE, Cooper S, Hangoc G, Ralph P, 1988. Recombinant human granulocyte colony-stimulating factor and recombinant human macrophage colonystimulating factor synergize in vivo to enhance proliferation of granulocyte-macrophage, erythroid, and multipotential progenitor cells in mice. J Cell Biochem 38: 127 Byrne PV, Guilbert LJ, Stanley ER, 1981. Distribution of cells bearing receptors for a colonystimulating factor (CSF-1) in murine tissues. J Cell Biol 91: 848 Ceretti DP, Wignall J, Anderson D, Tushinski RJ, Gallis BM, Stya M, Gillis S, Urdal DL, Cosman D, 1988. Human macrophage-colony stimulating factor: alternative RNA and protein processing from a single gene. Mol Immunol 25: 761 Delwiche F, Raines E, Powell J, Ross R, Adamson J, 1985. Platelet-derived growth factor enhances in vitro erythropoiesis via stimulation of mesenchymal cells. J Clin Invest 76: 137 Dexter TM, Moore MAS, 1977. In vitro duplication and cure of hematopoietic defects in genetically anemic mice. Nature 269: 412 Dorshkind K, 1990. Regulation of hemopoiesis by bone marrow stromal cells and their products. Ann Rev Immunol 8: 111 Dührsen U, 1988. In vitro growth patterns and autocrine production of hemopoietic colony stimulating factors: analysis of leukemic populations arising in irradiated mice from cells of an injected factor-dependent continous cell line. Leukemia 2: 334 Dunbar CE, Browder TM, Abrams JS, Nienhuis AW, 1989. COOH-terminal modified interleukin-3 is retained intracellularly and stimulates autocrine growth. Science 245: 1493 Eaves CJ, Cashman JD, Kay RT, Dougherty GJ, Otsuka T, Gaboury LA, Hogge DE, Lansdorp PM, Eaves AE, Humphries RK, 1991. Mechanisms that regulate the cell cycle status of very primitive hematopoietic cells in long-term human marrow cultures. II. Analysis of positive and negative regulators produced by stromal cells within the adherent layer. Blood 78: 110 Flanagan JG, Chan DC, Leder P, 1991. Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sld mutant. Cell 64: 1025 Friel J, Itoh K, Bergholz U, Jücker M, Stocking C, Harrison P, Ostertag W, 2002. Hierarchy of stroma-derived factors in supporting growth of stroma-dependent hemopoietic cells:

42

J. FRIEL ET AL.

membrane-bound SCF is sufficient to confer stroma competence to epithelial cells. Growth Factors 20: 35 Friel J, Heberlein C, Geldmacher M, Ostertag W, 2005. Diverse isoforms of colony-stimulating factor-1 have different effects on the development of stroma-dependent hematopoietic cells. J Cell Physiol 204: 247 Fujita J, Onoue H, Nakamaya H, Kanakura Y, 1988. In vitro duplication and in vivo cure of mastcell deficiency of Sl/Sld mutant mice by cloned 3T3 fibroblasts. Proc Natl Acad Sci USA 86: 2888 Gilmore GL, Shadduck RK, 1995. Inhibition of day-12 spleen colony-forming units by a monoclonal antibody to the murine macrophage/monocyte colony-stimulating factor receptor. Blood 85: 2731 Hall DJ, Jones SD, Kaplan DR, Whitman M, Rollins BJ, Stiles CD, 1989. Evidence for a novel signal transduction pathway activated by platelet-derived growth factor and by doublestranded RNA. Mol Cell Biol 9: 1705 Hannum C, Culpepper J, Campbell D, McClanahan T, Zurawski S, Bazan JF, Kastelein R, Hudak S, Wagner J, Mattson J, Luh J, Duda G, Martina N, Peterson D, Menon S, Shanafelt A, Muench M, Kelner G, Namikawa R, Rennick D, Roncarolo MG, Zlotnick A, Rosnet O, Dubreuil P, Birnbaum D, Lee F, 1994. Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of hemopoietic stem cells and is encoded by variants RNAs. Nature 368: 643 Heberlein C, Friel J, Itoh K, Medlock E, Li L, Nakayama N, Stocking C, Geldmacher M, Ostertag W, 2006. Involvement of CSF-1 in generating a stroma-independent hematopoietic stem cell line. J Cell Physiol: 206: 556 Huang E, Nocka K, Beier DR, Chu T-Y, Buck J, Lahm H-W, Wellner D, Leder P, Besmer P, 1990. The hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of ckit receptor, the gene product of the W locus. Cell 63: 225 Kim CH, Broxmeyer HE, 1998. In vitro behavior of hematopoietic progenitor cells under the influence of chemoattractants: stromal cell-derived factor-1, Steel factor, and the bone marrow environment. Blood 91: 100 Ladner MB, Martin GA, Noble JA, Wittman VP, Warren MP, McGrogan M, Stanley ER, 1988. cDNA cloning and expression of murine macrophage colony-stimulating factor from L929 cells. Proc Natl Sci USA 85: 6706 Lerner NB, Nocka KH, Cole SR, Qiu F, Strife A, Ashman LK, Besmer P, 1991. Monoclonal antibody YB5.B8 identifies the human c-kit protein product. Blood 77: 1876 Ikuta K, Weissman IL, 1992. Evidence that hematopoietic stem cells express mouse c-kit but do not depend on Steel factor for their generation. Proc Natl Acad Sci USA 89: 1502 Itoh K, Tezuka H, Sakoda H, Konno M, Nagata K, Uchiyama T, Uchino H, Mori KJ, 1989. Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow. Exp Hematol 17: 145 Itoh K, Friel J, Kluge N, Kina T, Kondo-Takaori A, Kawamata S, Uchiyama T, Ostertag W, 1996. A novel hemopoietic multi-lineage clone, Myl-D-7, is stromal cell dependent and supported by an alternative mechanism(s) independent of stem cell factor/c-kit interaction. Blood 87: 3218 Itoh K, Friel J, Laker C, Zeller W, Just U, Bittner S, Nibbs RJ, Harrison P, Nishikawa S-I, Mori KJ, Ostertag W, 1997. The role of soluble growth factors and of stroma cells in inducing transient growth and clonal extinction of stroma cell dependent erythroblastic leukemia cells. Leukemia 11: 1753

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

43

Just U, Friel J, Heberlein C, Tamura T, Baccarini M, Tessmer U, Klingler K, Ostertag W, 1993. Upregulation of lineage specific receptors and ligands in multipotential progenitor cells is part of an endogenous program of differentiation. Growth Factors 9: 291 Kapur R, Majumdar M, Xiao X, McAndrews-Hill M, Schindler K, Williams DA, 1998. Signaling through the interaction of membrane-restricted stem cell factor and c-kit receptor tyrosine kinase: genetic evidence for a differential role in erythropoiesis. Blood 91: 879 Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao YF, Miyazono K, Urabe A, Takaku F, 1989. Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or Erythropoietin. J Cell Physiol 140: 323 Lacey DL, Timms E, Tan H-L, Kelley MJ, Dunstan CR, Burgess T, Elliot R, Colombero A, Elliot G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E, Capparelli C, Eli A, Qian Y-X, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ, 1998. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93: 165 Lemoli RM, Fogli M, Fortuna A, Motta MR, Rizzi S, Benini C, Tura S, 1993. Interleukin-11 stimulates the proliferation of human hematopoietic CD34+CD33-DR- cells and synergizes with stem cell factor, interleukin-3 and granulocyte-macrophage colony-stimulating factor. Exp Hematol 21: 1668 Mayami H, Little M-T, Dragowska W, Thornbury G, Lansdorp PM, 1995. Differential effects of the hematopoietic inhibitors MIP-1α, TGF-β, and TNF-α on cytokine-induced proliferation of subpopulations of CD34+ cells purified from cord blood and fetal liver. Exp Hematol 23: 422 Mayani H, Lansdorp PM, 1998. Biology of human umbilical cord blood-derived hematopoietic stem/progenitor cells. Stem Cells 16: 153 McClanahan T, Culpepper J, Campbell D, Wagner J, Franz-Bacon K, Mattson J, Tsai S, Luh J, Guimaraes MJ, Mattei MG, Rosnet O, Birnbaum D, Hannum CH, 1996. Biochemical and genetic characterization of multiple splice variants of the Flt3 ligand. Blood 88: 3371 McCulloch EA, Siminovitch L, Till JE, Russel ES, Bernstein SE, 1965. The cellular basis of the genetically determined hemopoietic defect in anemia mice of genotype Sl/Sld. Blood 26: 399 McNiece IK, Langley KE, Zsebo KM, 1991. Recombinant human stem cell factor synergizes with GM-CSF, G-CSF, IL-3 and Epo to stimulate human progenitor cells of the myeloid and the eythroid lineages. Exp Hematol 19: 226 Michalevicz R, Katz F, Stroobant P, Janossy G, Tindle RW, Hoffbrand AV, 1986. Plateletderived growth factor stimulates growth of highly enriched multipotent haematopoietic progenitors. Br J Haematol 63: 591 Miyazawa K, Williams DA, Gotoh A, Nuishimaki J, Broxmeyer HE, Toyama. K, 1995. Membrane-bound steel factor induces more persistent tyrosine kinase activation and longer life span of c-kit gene-encoded protein than its soluble form. Blood 85: 641 Morgan CJ, Pollard JW, Stanley ER, 1987. Isolation and characterization of a cloned growth factor dependent macrophage cell line, BAC12F5. J Cell Physiol 130:420-427 Nocka K, Majumder S, Chabot B, Ray P, Cervone M, Bernstein A, Besmer P. 1989. Expression of c-kit gene products in known cellular targets of W mutations in normal and W mutant mice - evidence for an impaired c-kit kinase in mutant mice. Genes and Dev 3: 816 Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi S, Kunisada T, Sudo T, Kina T, Nakauchi H, Nishikawa S, 1991. Expression and function of c-kit in hemopoietic progenitor cells. J Exp Med 174: 63 Pixley FJ, Stanley ER, 2004. Regulation of Macrophages by CSF-1. Trends in Cell Biol 14: 628 Ramsfjell V, Borge OJ, Cui L, Jacobson SEW, 1997. Thrombopoietin directly and potently stimulates multilineage growth and progenitor cell expansion from primitive (CD34+CD38-)

44

J. FRIEL ET AL.

human bone marrow progenitor cells: Distinct and key interactions with the ligands for c-kit and flt 3, and inhibitory effects of TGF-β and TNF-α. J Immunol 158: 5169 Rapp UR, Jorma K-O, Heine UI, 1979. Establishment and characterization of the epithelial mouse embryo cell line MMC-E. Cancer Res 39: 4111 Stanley ER, Heard PM, 1977. Factors regulating macrophage production and growth. Purification and some properties of the colony stimulating factor from medium conditioned by mouse L cells. J Biol Chem 252: 4305 Stanley ER, Guilbert LJ, Tushinski RJ, Bartelmez SH, 1983. CSF-1: a mononuclear phagocyte lineage-specific growth factor. J Cell Biochem 21: 151-159 Stanley ER, Bartocci A, Patinkin D, Rosendaal M, Bradley TR, 1986. Regulation of very primitive, multipotent, hemopoietic cells by hemopoietin-1. Cell 45: 667 Sutherland HJ, Hogge DE, Cook D, Eaves CJ, 1993. Alternative mechanisms with and without steel factor support primitive human hematopoiesis. Blood 81: 1465 Tushinski RJ, Oliver IT, Guilbert LJ, Tynan PW, Warner JR, Stanley ER, 1982. Survival of mononuclear phagocytes depends on a lineage-specific growth factor that the differentiated cells selectively destroy. Cell 28: 71 Yan XQ, Brady G, Iscove NN, 1993. Platelet-derived growth factor (PDGF) activates primitive hematopoietic precursors (pre-CFCmulti) by upregulating IL-1 in PDGF receptor-expressing macrophages. J Immunol 150: 1 Yarden, Y, Escobedo JA, Knang WJ, Yang-Feng TL, Daniel TO, Tremble PM, Chen EY, Ando ME, Harkins RN, Francke U, Fried VA, Ullrich A, Williams LT, 1986. Structure of the receptor for platelet-derived growth factor helps define a familiy of closely related growth factor receptors. Nature 323: 226 Yarden Y, Kuang W-J, Yang-Feng T, Coussens L, Munemitsu S, Dull TJ, Chen E, Schlessinger J, Francke U, Ullrich A, 1987. Human proto-oncogene c-kit: A new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J 6: 3341 Zandstra PW, Lauffenburger DA, Eaves CJ, 2000. A ligand-receptor signaling threshold model of stem cell differentiation control: a biologically conserved mechanism applicable to hematopoiesis. Blood 96: 1215 Zsebo KM, Williams DA, Geissler EN, Broudy VC, Martin FH, Atkins HL, Hsu R-Y, Birkett NC, Okino KH, Murdock DC, Jacobsen FW, Langley KE, Smith KA, Takeishi T, Cattanach BM, Galli SJ, Suggs SV, 1990. Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell 63: 213

FUNCTIONAL AND PHENOTYPIC HETEROGENEITY OF THE HUMAN HEMATOPOIETIC STEM CELL (HSC) COMPARTMENT OLGA I. GAN, JOBY L. McKENZIE, MONICA DOEDENS, JOHN E. DICK* Division of Cell and Molecular Biology, University Health Network; Department of Molecular and Medical Genetics, University of Toronto, Toronto, Canada

1. Introduction The hematopoietic system in mammals is comprised of a heterogeneous population of cells which range in function from mature cells of different lineages with limited proliferative potential to multipotent stem cells with extensive proliferative, differentiative and self-renewal capacities. Over a lifetime, the human body produces a trillion blood cells per day. To sustain that enormous cell output, functionally mature cells are generated from highly proliferative, but short-lived progenitors, which in turn arise from a rare population of quiescent hematopoietic stem cells (HSC) that sustain the entire hematopoietic hierarchy. Understanding the composition of HSC compartment is critical for clinical applications such as gene therapy or ex vivo expansion of small hematopoietic samples, for example umbilical cord blood (CB). The only conclusive method to assay stem cells is to follow their ability to repopulate conditioned recipients. Remarkable progress had been achieved in transplantation studies of murine HSC. It was shown that the murine HSC compartment is sustained by long-term repopulating cells that are phenotypically distinct from short-term repopulating cells and multi- and oligolineage progenitors1,2. In order to study the human HSC compartment, we and others have developed in vivo models of human hematopoiesis by transplanting immune-deficient mice with human cells3. Initially, severe combined immunedeficient (SCID) mice were used as recipients for studying human

______ * To whom correspondence should be addressed. John E. Dick, Division of Cell and Molecular Biology, University Health Network, Toronto Medical Discovery Tower, Rm 8-301, 101 College Street, Toronto, ON, M5G 1L7, Canada; email: [email protected]

45 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 45–53. © 2008 Springer.

46

O.I. GAN ET AL.

hematopoiesis, however, later it was shown that non-obese diabetic (NOD)SCID mice provided improved engraftment by human cells of different cell lineages4. The primitive hematopoietic cells able to repopulate immunedeficient mice were operationally defined as SCID-repopulating cells (SRC). A detailed view of the developmental, proliferative, differentiation and selfrenewal potentials requires long-term analysis of uniquely marked SRC, as purification of homogeneous populations of human HSC is not yet possible. To carry out such a detailed clonal analysis, we employed retroviral transduction where SRC are uniquely marked based on semi-random integration of the virus into the genome. Thus, each SRC and its progeny have a unique tag that is used to retrospectively follow the clones after transplantation5,6. 2. Functional Heterogeneity of Human SRC Several years ago we used an optimized Moloney-based retroviral gene transfer protocol for the detailed examination of the clonal composition of the transduced cells that comprised the human graft in NOD/SCID recipients7. The key feature of this assay was the sequential bone marrow aspirations that allowed temporal changes in the clonal make-up of the graft to be evaluated. These studies enabled identification of SRC with differing potentials for repopulation. Kinetic analysis of repopulation showed significant variability in the proportion of gene-marked cells. Analysis of the fate of individual SRC and their progeny demonstrated that some clones appeared early and were lost, whereas other new clones appeared later. Some of the clones supported hematopoiesis over the entire time of analysis. These data clearly identify shortterm repopulating cells but the designation of long-term SRC was limited by the relatively brief duration of observation permitted by the NOD/SCID model (the life span of NOD/SCID mouse is short due to the development of endogenous lymphomas). The cardinal property of HSC is its ability to self-renew. However, in order to strictly satisfy self-renewal requirements, a clone must be present in both the primary and secondary recipients and this was not evaluated in these series of experiments due to low levels of engraftment in secondary recipients. Although this study provided insight into the clonal composition of human HSC hierarchy, it was unknown if the ex vivo manipulations required for retroviral marking had quantitative or qualitative effects on SRC fates. The developments in lentivector transduction protocols enabled efficient transduction of SRC in the absence of cytokine and serum stimulation8. Using minimal ex vivo manipulation to mark hematopoietic cells with lentiviral integration, the fates of SRC were evaluated9. As reported previously using retroviral-marking, lentivector transduced short-term SRC contributed rapidly

HETEROGENEITY OF HUMAN HSC

47

to the graft, but disappeared at later time points. By contrast, cells designated as long-term SRC either appeared at the end of the experiment or persisted over the entire duration of analysis. Therefore, the human HSC pool is functionally heterogeneous and comprised of individual stem cells with differing life spans and proliferative potentials. 3. Improved Xenotransplantation Models and Phenotypic Heterogeneity of Human SRC Aforementioned studies were based on the repopulation capacities of hematopoietic cells following intravenous (IV) injection. IV injection requires effective homing of stem cells to the bone marrow. This requirement might exclude classes of cells with defective homing and/or repopulating cells that are more sensitive to the residual immunity of immune-deficient mice. In order to investigate this possibility, we developed a novel transplant assay in which human cells were injected into the bone marrow cavity of NOD/SCID mice10. By direct intra-femoral (IF) transplantation we showed that there was rapid and substantial human engraftment following 2-3 weeks after IF transplantation which differed from routine IV graft kinetics. We showed that cells responsible for this rapid engraftment belonged to the lineage-negative (Lin ) + +/low + subpopulation, whereas cells expressing high CD38 did not CD34 CD38 engraft. Of note, previous IV transplantation studies demonstrated that almost + all SRC belong to Lin CD34 subpopulation; with only minimal SRC activity + found in the Lin CD34 population11. Among CD34 cells, cells belonging + to CD34 CD38 subpopulation were solely responsible for the engraftment upon IV transplantation in NOD/SCID mice12. However, using improved xenotransplantation models, such as NOD/SCID/β2microglobulin-deficient mice or NOD/SCID mice depleted of CD122-positive cells (i.e., cells expressing IL2Rβ - natural killers and macrophages), it was shown that the + + CD34 CD38 subpopulation also contains repopulating cells13,14. We demonstrated that IF injection and eradication of CD122-positive cells + +/low SRC15. represents the most sensitive assay for CD34 CD38 Previously, using limiting dilution analysis, Bhatia et al.12 showed that the + frequency of SRC (upon IV injection) in the CD34 CD38 subpopulation was 1 in 617 cells. Using the novel IF model and limiting dilution approach we showed that this frequency was 1 in 121 cells (McKenzie et al, Blood in press). To further purify this subpopulation we exploited rhodamine (Rho), a fluorescent dye that binds to active mitochondria in cells, thus reflecting the metabolic state of the cell16,17,18. Rho efflux is mediated by P-glycoprotein, encoded by multidrug resistance gene-119. Murine long-term HSC were + enriched based on low retention of Rho1. We sorted Lin CD34 CD38 cells into

48

O.I. GAN ET AL.

two subpopulations: 20% of cells with the lowest Rho retention and 20% with the highest (McKenzie et al., Blood in press) and injected equivalent numbers + of cells into recipient mice. At seven weeks post-transplantation, CD34 CD38 + Rholow cells established significantly higher grafts than CD34 CD38 Rhohigh + cells (75 ± 11% versus 24 ± 12%, respectively), suggesting that CD34 CD38 Rholow phenotype may enrich for HSC. Limiting dilution analysis was performed to quantify SRC enrichment. The frequency of SRC was estimated at + 1 in 30 CD34 CD38 Rholow cells, which represents a 4-fold enrichment in + comparison to the CD34 CD38 population. Therefore, this improved protocol is a step towards achieving a homogeneous population of HSC. Interestingly, despite the big differences in frequencies of SRC in + + CD34 CD38+/low and in CD34 CD38 subpopulations (namely 1 in 500010 and 1 in 121, respectively), the overall content of repopulating cells in both populations is comparable because the former represents about 40% of all Lin + CD34 cells, and the latter is about 2-5%. However, the question regarding + + +/low cells in comparison to CD34 CD38 cells longevity of CD34 CD38 remained unanswered. 4. Self-Renewal Properties of Human HSC Self-renewal, the distinguishing property of HSC, was previously not evaluated due to the limitation of engraftment in secondary recipients7. To circumvent this limitation, we employed the new NOD/SCID model (IF injection combined with anti-CD122 treatment) coupled with lentiviral marking to address possible differences in longevity and self-renewal between the different populations of + + Lin CD34 cord blood cells. Upon injection of CD34 CD38+/low cells, as previously shown, a substantial myelo-erythroid engraftment was observed at 3 weeks following transplantation. These cells were also able to provide lymphomyeloid repopulation at 12 weeks post-transplantation15,20. Therefore, this cell subpopulation fulfilled both the long-term and multilineage requirement of stem cells. However, their self-renewal ability was not known. Thus, + CD34 CD38+/low cells were sorted, transduced with lentiviral vector and injected IF into pre-conditioned recipients20. Several weeks following transplantation, the primary recipients were sacrificed and cells from the injected femur as well as the cells from other bones (designated here as the remaining bone marrow [BM]) were analyzed for the presence of human cells, and an aliquot of cells were stored for Southern blot analysis. The remaining cells were injected into secondary recipients (cells from the right femur of the primary mouse were injected into one secondary recipient and cells from the BM of the primary mouse were injected into a separate secondary recipient) and sacrificed several weeks later. Two secondary recipients were transplanted from one

HETEROGENEITY OF HUMAN HSC

49

primary recipient in order to determine if there was a difference in the selfrenewing fate of daughter cells that remained at the site of injection versus those that migrated to other hematopoietic sites. Surprisingly, a robust human multilineage graft was observed in the secondary recipients of primary injected right femur cells as well as BM cells, establishing that CD34+CD38+/low population contains SRC with self-renewal potential. Southern blot analysis of the clonal composition of the grafts showed that self-renewal of SRC was highly heterogeneous. Thus, some SRC made major contributions to all hematopoietic territories of secondary mice, whereas others did not engraft secondary recipients. Interestingly, in some cases, clones that were undetected in primary recipients were now detected only in secondary mice, suggesting that upon transplantation into primary mice, SRC were in a (semi)-quiescent state and secondary transplantation provided a stimulus for their activation. Heterogeneity in self-renewal properties of SRC could be attributed to the nature of their cell source; indeed, it is possible that in a more + pure SRC subpopulation (namely Lin CD34 CD38 ) the self-renewal behavior may be more homogeneous and predictable. To test the repopulation properties of a more highly purified cell population, + we used IF injection of CD34 CD38 cells into pre-conditioned mice. This also resulted in rapid (2-3-weeks) erythromyeloid engraftment. The overall engraftment level increased over time and by 12 weeks post-transplantation the majority of the graft was comprised of human lymphoid cells. Similar to the + +/low cells, the injected right femur and BM experimental design of CD34 CD38 + cells from the primary recipient of CD34 CD38 cells were transplanted into separate secondary recipients. Both cells sources established significant human grafts in secondary recipients. The clonal composition of the grafts was similar + +//low cells. There were many SRC detected to that described for CD34 CD38 only in primary recipients that extinguished in secondary recipients. There were also clones that were activated upon secondary transplantation from a quiescent state in primary recipients. Finally, in recipients of both injected femur and the rest of the BM there were self-renewing SRC. Therefore, both + +/low + and CD34 CD38 subpopulations contains SRC with heteroCD34 CD38 geneous self-renewal potential. To assess the clonal behavior of SRC in the entire human HSC compartment, we used Lin CB cells transduced with a lentiviral vector encoding EGFP. Recently, concerns have been raised regarding clonal selection following retroviral marking21. In our lentiviral marking experiments there was no significant increase in the proportion of marked EGFP-positive cells in 72 mice analyzed over 30 weeks, a finding consistent with the absence of clonal dominance of marked human HSC with a third-generation lentiviral vector20. To study the clonal dynamics of SRC we monitored more than 400 clones in 44

50

O.I. GAN ET AL.

primary and secondary recipients over 7 months and found the same three basic patterns of self-renewal seen after transplantation of purified cells: some clones were present only in primary recipients; some were activated in secondary mice; and some self-renewed. The long-term analysis of the clonal composition of primary and secondary mice provided insight into HSC dynamics following transplantation. In the field of hematopoiesis, two general ideas exist about the fate of HSC following transplantation and during steady-state hematopoiesis 22. The first model, clonal succession, postulates that a small subset of stem cells provides blood reconstitution after irradiation, with consequent exhaustion due to differentiation and subsequent replacement by other activated stem cells23,24. However, several studies in mice, cats and nonhuman primates were incompatible with the clonal succession model5,25,26. According to the second model, clonal maintenance, there is a period of clonal instability during early reconstitution followed by maintenance of the blood production by a subset of cells. Our clonal studies over 7 months following blood reconstitution were inconsistent with the clonal succession model and supported the clonal maintenance model, in which long-term hematopoiesis in maintained by stable clones after an initial period of clonal flux20. The extensive analysis of the fate of many clones in primary and secondary recipients allowed us to approach another long-standing question in the field of HSC biology. More than 40 years ago Till et al27 proposed that the selfrenewing fate of individual murine spleen colony-forming cells (CFU-S) is governed by stochastic processes; although the fate of any single CFU-S is uncertain, the population of HSC would appear to have predictable and ordered fates. Later, studies on cats demonstrated that the highly variable repopulation kinetics could also be replicated by computer simulation according to the stochastic model28. The alternative model of HSC control proposes that fate choices of any individual HSC are deterministic and can be predicted. In support of this hypothesis were studies in which long-term and short-term HCS were physically separated from progenitor cells based on their phenotypic profiles, indicating that an ordered developmental program is established in the downstream progeny of long-term HSC29-32. However, after the injection of single HSC there was broad heterogeneity in percent engraftment and wide variation in self-renewal potential1,33, suggesting the existence of stochastic elements in HSC fate. Our analysis of the fate of SRC clones provides several lines of evidence favoring the stochastic model of stem cell self-renewal mechanisms. The localized cell delivery through IF injection provided a unique opportunity to evaluate repopulation, and more important, self-renewal capacities of SRC daughter cells. For example, we observed cases where one daughter SRC resided in the injected femur of the primary mouse in a quiescent

HETEROGENEITY OF HUMAN HSC

51

or slowly dividing state, and thus was not detected. However, in the secondary recipient, this daughter SRC was activated to proliferate and produced a substantial clone of lympho-myeloid progeny. In contrast, the other daughter cell remained active in both the primary and secondary recipients, generating a large clone in both mice. Our data, taken together with the murine HSC purification experiments, allowed us to propose an integrated model20 in which regulation of self-renewal versus differentiation decisions of HSC is mostly stochastic, however, once a decision to commit to differentiation is made, immediate downstream progeny are funneled into a more rigid developmental program. In conclusion, the SRC assay provided us a unique opportunity to gain insights into the developmental program of human HSC biology. We revealed + phenotypic heterogeneity of human HSC where CD34 CD38 and + CD34 CD38+/low subpopulations extensively differ in the frequency of SRC, but possess the same ability for short- and long-term repopulation. We also showed the functional heterogeneity of all SRC as short-term and long-term repopulating cells, and their wide heterogeneity in self-renewal potential.

References 1. Benveniste P, Cantin C, Hyam D, Iscove NN. Hematopoietic stem cells engraft in mice with absolute efficiency. Nat Immunol. 2003;4:708-713. 2. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005;121:1109-1121. 3. Dick JE, Guenechea G, Gan OI, Dorrell C. In vivo dynamics of human stem cell repopulation in NOD/SCID mice. Ann N Y Acad Sci. 2001;938:184-190. 4. Larochelle A, Vormoor J, Hanenberg H, et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nat Med. 1996;2:1329-1337. 5. Jordan CT, Lemischka IR. Clonal and systemic analysis of long-term hematopoiesis in the mouse. Genes Dev. 1990;4:220-232. 6. Lemischka IR, Raulet DH, Mulligan RC. Developmental potential and dynamic behavior of hematopoietic stem cells. Cell. 1986;45:917-927. 7. Guenechea G, Gan OI, Dorrell C, Dick JE. Distinct classes of human stem cells that differ in proliferative and self-renewal potential. Nat Immunol. 2001;2:75-82. 8. Guenechea G, Gan OI, Inamitsu T, et al. Transduction of human CD34+ CD38- bone marrow and cord blood-derived SCID-repopulating cells with third-generation lentiviral vectors. Mol Ther. 2000;1:566-573. 9. Mazurier F, Gan O, McKenzie J, Doedens M, Dick J. Lentivector-mediated clonal tracking reveals intrinsic heterogeneity in the human hematopoietic stem cell compartment and culture-induced stem cell impairment. Blood. 2004;103:545-552.

52

O.I. GAN ET AL.

10. Mazurier F, Doedens M, Gan OI, Dick JE. Rapid myeloerythroid repopulation after intrafemoral transplantation of NOD-SCID mice reveals a new class of human stem cells. Nat Med. 2003;9:959-963. 11. Bhatia M, Bonnet D, Murdoch B, Gan OI, Dick JE. A newly discovered class of human hematopoietic cells with SCID- repopulating activity. Nat Med. 1998;4:1038-1045. 12. Bhatia M, Wang JCY, Kapp U, Bonnet D, Dick JE. Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci USA. 1997;94:5320-5325. 13. Glimm H, Eisterer W, Lee K, et al. Previously undetected human hematopoietic cell populations with short-term repopulating activity selectively engraft NOD/SCID-beta2 microglobulin-null mice. J Clin Invest. 2001;107:199-206. 14. Hogan CJ, Shpall EJ, Keller G. Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Natl Acad Sci U S A. 2002;99:413-418. 15. McKenzie JL, Gan OI, Doedens M, Dick JE. Human short-term repopulating stem cells are efficiently detected following intrafemoral transplantation into NOD/SCID recipients depleted of CD122+ cells. Blood. 2005;106:1259-1261. 16. Johnson LV, Walsh ML, Chen LB. Localization of mitochondria in living cells with rhodamine 123. Proc Natl Acad Sci U S A. 1980;77:990-994. 17. Zijlmans JM, Visser JW, Kleiverda K, Kluin PM, Willemze R, Fibbe WE. Modification of rhodamine staining allows identification of hematopoietic stem cells with preferential shortterm or long-term bone marrow-repopulating ability. Proc Natl Acad Sci U S A. 1995;92:8901-8905. 18. Kim M, Cooper DD, Hayes SF, Spangrude GJ. Rhodamine-123 staining in hematopoietic stem cells of young mice indicates mitochondrial activation rather than dye efflux. Blood. 1998;91:4106-4117. 19. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell. 1991;66:85-94. 20. McKenzie JL, Gan OI, Doedens M, Wang JC, Dick JE. Individual stem cells with highly variable proliferation and self-renewal properties comprise the human hematopoietic stem cell compartment. Nat Immunol. 2006;7:1225-1233. 21. Kustikova O, Fehse B, Modlich U, et al. Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science. 2005;308:1171-1174. 22. Crooks GM, Weinberg K. The unpredictable stem cell. Nat Immunol. 2006;7:1129-1130. 23. Kay HEM. How many cell-generations? (Hypothesis). Lancet. 1965;1:418-419. 24. Drize NJ, Keller JR, Chertkov JL. Local clonal analysis of the hematopoietic system shows that multiple small short-living clones maintain life-long hematopoiesis in reconstituted mice. Blood. 1996;88:2927-2938. 25. Abkowitz JL, Persik MT, Shelton GH, et al. Behavior of hematopoietic stem cells in a large animal. Proc Natl Acad Sci U S A. 1995;92:2031-2035. 26. Schmidt M, Zickler P, Hoffmann G, et al. Polyclonal long-term repopulating stem cell clones in a primate model. Blood. 2002;100:2737-2743. 27. Till JE, McCulloch EA, Siminovitch L. A Stochastic Model of Stem Cell Proliferation Based on the Growth of Spleen Colony-Forming Cells. Proc Natl Acad Sci USA. 1964;51:29-36. 28. Abkowitz JL, Catlin SN, Guttorp P. Evidence that hematopoiesis may be a stochastic process in vivo. Nat Med. 1996;2:190-197. 29. Jones R, Wagner J, Celano P, Zicha M, Sharkis S. Separation of pluripotent haematopoietic stem cells from spleen colony-forming cells. Nature. 1990;347:188-189.

HETEROGENEITY OF HUMAN HSC

53

30. Trevisan M, Iscove NN. Phenotypic analysis of murine long-term hemopoietic reconstituting cells quantitated competitively in vivo and comparison with more advanced colony-forming progeny. J Exp Med. 1995;181:93-103. 31. Christensen JL, Weissman IL. Flk-2 is a marker in hematopoietic stem cell differentiation: a simple method to isolate long-term stem cells. Proc Natl Acad Sci U S A. 2001;98:1454114546. 32. Morrison SJ, Weissman IL. The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity. 1994;1:661-673. 33. Ema H, Sudo K, Seita J, et al. Quantification of self-renewal capacity in single hematopoietic stem cells from normal and Lnk-deficient mice. Dev Cell. 2005;8:907-914.

ALTERATIONS OF FREQUENCY OF HEMATOPOIETIC PRECURSORS IN MICE SUBJECTED TO MULTIPLE COURSES OF LOW-DOSE G-CSF INJECTIONS I.N. NIFONTOVA* , D.A. SVINAREVA, J.L. CHERTKOV, V.G. SAVCHENKO, N.J. DRIZE National Hematology Research Centre, Moscow, Russian Federation

Keywords: granulocyte colony-stimulating factor (G-CSF); LTC-IC; CFU-C; granulocytes

Abstract. G-CSF is a major extracellular regulator of hematopoiesis and the most used cytokine in clinical practice. Coherently with and for a long time after the repeated injections of low doses of G-CSF the study of alterations in hematopoietic precursor cells concentration in the bone marrow of mice was undertaken. G-CSF treatment did not affect the number of granulocytes and oligopotent precursor cells (CFU-C). However, frequency of early multipotent stem cells (LTC-IC) decreased one month after the last (7th) course of G-CSF injections, moreover it halved during the following year. The exhaustion of LTC-IC after G-CSF treatment is discussed.

1. Introduction Mobilised peripheral blood stem cells are used as the source of stem cells for transplantation, moreover most allogeneic transplants now utilize peripheral blood rather than bone marrow1. A variety of mobilisation regimes are used but granulocyte colony-stimulating factor (G-CSF) is the most frequently employed2,3. In some cases G-CSF treatment of volunteers is involved in experimental researches4,5,6. The main therapeutic G-CSF application is

______ * To whom correspondence should be addressed. Irina N. Nifontova, National Hematology Research Centre, Russian Academy of Medical Science, Novozikovskiy pr. 4a, Moscow 125167, Russian Federation. E-mail: [email protected]

55 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 55–62. © 2008 Springer.

56

I.N. NIFONTOVA ET AL.

correction of neutropenia of various ethyology7,8,9. The remote consequences of G-CSF injections are not studied enough. Mobilization and homing of hematopoietic precursors are the mirror processes sharing the same mediators and analogous signaling pathways10,11. Despite increasing application of mobilized hematopoietic stem cells (HSC) the mechanism of their motion in and out of the bone marrow is not completely understood yet. The involvement of such adhesion molecules as integrins β1, β2 interacting with VLA-4, VLA-5, LFA-1, as well as L-selectin, stroma derived factor SDF-1 with it's receptor CXCR4 and some of the metalloproteases was previously shown12. The exact mechanism G-SCF influences target cells is not yet understood fully. Efficiency of HSC mobilization depends on longevity of G-SCF injections and the dosage used. In humans for supporting treatment after the chemotherapy as well as for the HSC mobilization 5-10 µg/kg for 7-14 days is used13. In some cases patients receive multiple repeated G-SCF courses. The mobilizing dose for murine HSC is considerably higher than for human ones: usually from 200 up to 300 µg/kg is injected for 5-17 days leading to more then 10-fold increase of the number of different hematopoietic precursors in the peripheral blood14,15. When 10 times lower dose is used CFU-S number in the peripheral blood experienced a 4-fold increase (versus 32-fold increase in case the mobilizing concentration is used) while in the bone marrow HSC frequency almost was halved 15. During the mobilization HSC are loosing the connection with the niche cells, though returning to their “places” later. Such a disturbance may cause an accelerating turnover of HSC. The alterations of concentration of hematopoietic precursors of different stages of maturation in the bone marrow of mice subjected to multiple G-CSF treatment were studied in the presented work. 2. Materials and Methods (CBA x C57Bl6)F1 3 months-old female mice were obtained from Stolbovaya Animal Centre, Moscow Region, Russian Federation. Weight in the beginning of the G-CSF courses varied between 24 and 26 grams. Granulocyte colony-stimulating factor (G-CSF) (Neupogen 48 Mio U, F.Hoffmann-La Roche, Switzerland) was dissolved in 0,85% NaCl with 0,1% bovine serum albumin (Sigma) and was injected subcutaneously (25 µg/kg in 0,2 ml of 0,85% NaCl) once a day for 4 days. White blood cells (WBC) count and the hemogram of the peripheral blood were analyzed before and one day after each course. Seven courses were performed during half-year. Concentration of early hematopoietic precursors was estimated through long-term culture initiating cells (LTC-IC) frequency. A day prior to the test the MS-5 cell line16 was seeded in 60 wells of 96-well cultivation plate. From 3 to 5

EFFECTS OF MULTIPLE G-CSF INJECTIONS IN MICE

57

thousands of MS-5 cells were seeded into each well. All of the margin wells were filled with 0,1M NaOH to prevent plate from drying. Bone marrow (BM) cells were taken from the femur of live mice under the light anesthesia through the knee joint. BM cells were suspended in the Fisher medium and plated onto MS-5 containing wells in four consecutive dilutions. Usually 60, 20, 6,7 and 2,25×103 cells were plated per well in each dilution. Cells were cultivated in nutrient medium adapted for long-term bone marrow cultures17 in 33°C humidified atmosphere with 5% CO2. A half of the medium was renewed once a week. After 6 weeks of cultivation the medium was replaced with semisolid medium containing methylcellulose 1,1% in αMEM, 30% fetal bovine serum, 2u/ml erythropoetin, and 10% conditioned medium (mixture of WEHI 3B18 2 parts and L92919 1 part) as a source of G-CSF, M-CSF, GM-CSF and Il-3. Two weeks later the wells with colonies formed were counted under the inverted microscope. LTC-IC frequency was calculated using Puasson’s statistics20. More mature hematopoietic progenitors (CFU-C) frequency was estimated using standard CFU-C assay 21. 3. Results Prolonged low-dose G-CSF treatment doesn’t lead to any significant alterations of WBC count in peripheral blood (Fig. 1).

Figure 1. WBC count of the periferal blood of the mice during and after the G-CSF courses.

58

I.N. NIFONTOVA ET AL.

Frequency of hematopoietic precursors of different stages of maturation (CFU-C and LTC-IC) was estimated during 2nd , 3rd and 5th course and 1, 4 and 12 months since the last G-CSF course. Cells, capable to generate colonies in the semisolid medium (CFU-C), differ by their maturation status, the earliest ones producing the detectable colonies after 21 days of cultivation22. The most mature progenitors, generating the colony after 7 days in culture, do not respond to G-CSF injections neither during the courses themselves (Fig. 2a), nor after the injections are done (Fig. 3а). The absence of effect is confirmed by unaffected hemogram of peripheral blood of treated animals (data not shown). Less differentiated precursors, capable to generate colonies in semisolid medium after 21 days of cultivation, do not respond to G-CSF injection either (Fig. 2b, Fig. 3b).

Figure 2. (A) CFU-C 7 frequency in bone marrow of mice during low-dose G-CSF treatment. (B) CFU-C 21 frequency in bone marrow of mice during low-dose G-CSF treatment. (C) LTC-IC frequency in bone marrow of mice during low-dose G-CSF treatment.

EFFECTS OF MULTIPLE G-CSF INJECTIONS IN MICE

59

Figure 3. (A) CFU-C 7 frequency in bone marrow of mice after low-dose G-CSF treatment. (B) CFU-C 21 frequency in bone marrow of mice after low-dose G-CSF treatment. (C) LTC-IC frequency in bone marrow of mice after low-dose G-CSF treatment.

It was previously shown that six-day course of both 25 and 250 µg/kg of GCSF injections had halved the concentration of preHSC (an early hematopoietic precursor detected like LTC-IC in culture after 5 weeks)23 but it normalized again during the following month15,24. In the set of experiments described above involving a non-mobilizing 10-fold lower dose course repeating seven times per half-year the significant (p< 0.01) increase of LTC-IC frequency was observed after the 4th course (Fig. 2с). One month since the last course LTC-IC frequency has been, on the contrary, 2-fold lower then the normal amount (p< 0.01) (Fig 3с). So unlike single course of high doses of G-CSF, repeated low-dose treatment leads to decrease in of early hematopoietic precursor frequency. During the following year it halved, decreasing even further. The data shows that the more mature progenitors are the least sensitive to repeated G-CSF injections. They generate normal amounts of mature granulocytes during the whole set of courses. The frequency of the early

60

I.N. NIFONTOVA ET AL.

hematopoietic precursors significantly decreases after long-term G-CSF treatment. 4. Discussion Multiple courses of low doses of G-CSF lead to decrease in frequency of early hematopoietic precursors (LTC-IC) in the bone marrow. The concentration of more differentiated progenitors CFU-C-7 and CFU-C-21 as well as mature granulocytes does not react to the dose of factor used in the described experiments. G-CSF is known to stimulate proliferation of early multipotent HCS in vitro (multipotential blast cell colonies)25. One might expect a continuous course of injections (even low-dose) should lead to the increase of concentration of HSC of various sets of hematopoietic hierarchy. However CFU-C frequency was not affected which could be explained by stable local regulation of these types of precursor by cells of endothelial niche where they are localized26. Less differentiated precursors are regulated by osteoblastic niche27 and are localized on the endosteal surface of the bone. G-CSF even in low doses activates osteoclasts that lead to osteopenia and decrease in the bone mass28,29. Activated osteoclasts not only take part in the mobilization of HSC process but change the endostal surface itself 30. Moreover G-CSF activates the secretion of metalloproteases by bone marrow cells and this is a key factor of dissociation of HSC from stromal cells during the mobilization process31. The whole data explains the decrease in early HSC frequency observed in the bone marrow of treated mice. Apparently, osteoclasts and G-CSF mobilize hematopoietic precursors from theirs niches, on the other hand, homing and adhesion of mobilized precursors are impaired by the same factors. So these precursors could irreversibly differentiate, begin to proliferate or undergo apoptosis. Therefore multiple treatments with G-CSF might exhaust HSC pool in the bone marrow. G-CSF application to the healthy donors should be performed with the most precaution possible, as its remote consequences are not scrutinized and need a further investigation.

References 1. Gratwohl A, Baldomero H, Schmid O et al. Change in stem cell source for hematopoietic stem cell transplantation (HSCT) in Europe: a report of the EBMT activity survey 2003. Bone Marrow Transplant. 2005;36:575-590. 2. Remberger M, Ringden O, Blau IW et al. No difference in graft-versus-host disease, relapse, and survival comparing peripheral stem cells to bone marrow using unrelated donors. Blood. 2001;98:1739-1745.

EFFECTS OF MULTIPLE G-CSF INJECTIONS IN MICE

61

3. Korbling M, Anderlini P, Hematology TA. Peripheral blood stem cell versus bone marrow allotransplantation: does the source of hematopoietic stem cells matter? Blood. 2001;98:29002908. 4. Angelopoulou M, Novelli E, Grove JE et al. Cotransplantation of human mesenchymal stem cells enhances human myelopoiesis and megakaryocytopoiesis in NOD/SCID mice. Exp Hematol. 2003;31:413-420. 5. Brenner S, Whiting-Theobald N, Kawai T et al. CXCR4-transgene expression significantly improves marrow engraftment of cultured hematopoietic stem cells. Stem Cells. 2004;22:1128-1133. 6. Selleri C, Montuori N, Ricci P et al. Involvement of the urokinase-type plasminogen activator receptor in hematopoietic stem cell mobilization. Blood. 2005;105:2198-2205. 7. Crawford J, Ozer H, Stoller R et al. Reduction by granulocyte colony-stimulating factor of fever and neutropenia induced by chemotherapy in patients with small-cell lung cancer. N Engl J Med. 1991;325:164-170. 8. Trillet-Lenoir V, Green J, Manegold C et al. Recombinant granulocyte colony stimulating factor reduces the infectious complications of cytotoxic chemotherapy. Eur J Cancer. 1993;29A:319-324. 9. Blackwell S, Crawford J. Filgrastim (r-metHuG-CSF) in the chemotherapy setting. In: Morstyn G, Dexter TM, eds. Filgrastim (r-metHuG-CSF) in Clinical Practice.1994; New York: Marcel Dekker. 10. Kronenwett R, Graf T, Nedbal W et al. Inhibition of angiogenesis in vitro by alphav integrindirected antisense oligonucleotides. Cancer Gene Ther. 2002;9:587-596. 11. Cutler C, Antin JH. Peripheral blood stem cells for allogeneic transplantation: a review. Stem Cells. 2001;19:108-117. 12. Lapidot T, Petit I. Current understanding of stem cell mobilization: the roles of chemokines, proteolytic enzymes, adhesion molecules, cytokines, and stromal cells. Exp Hematol. 2002;30:973-981. 13. Schwab G, Hecht T. Recombinant methionyl granulocyte colony-stimulating factor (filgrastim): a new dimension in immunotherapy. Ann Hematol. 1994;69:1-9. 14. Molineux G, Pojda Z, Hampson IN et al. Transplantation potential of peripheral blood stem cells induced by granulocyte colony-stimulating factor. Blood. 1990;76:2153-2158. 15. Drize N, Gan O, Zander A. Effect of recombinant human granulocyte colony-stimulating factor treatment of mice on spleen colony-forming unit number and self-renewal capacity. Exp Hematol. 1993;21:1289-1293. 16. Kobari L, Dubart A, Le Pesteur F et al. Hematopoietic-promoting activity of the murine stromal cell line MS-5 is not related to the expression of the major hematopoietic cytokines. J Cell Physiol. 1995;163:295-304. 17. Dexter TM, Allen TD, Lajtha LG. Conditions controlling the proliferation of haemopoietic stem cells in vitro. J Cell Physiol. 1977;91:335-344. 18. Prestidge RL, Watson JD, Urdal DL et al. Biochemical comparison of murine colonystimulating factors secreted by a T cell lymphoma and a myelomonocytic leukemia. J Immunol. 1984;133:293-298. 19. Mayer P. The growth of swine bone marrow cells in the presence of heterologous colony stimulating factor: characterization of the developing cell population. Comp Immunol Microbiol Infect Dis. 1983;6:171-187. 20. Nifontova IN, Ershler MA, Drize NI. Dynamics of precursor cell composition in bone marrow culture derived from mice deficient by tumor necrosis factor. Bull Exp Biol Med. 2003;135:285-288.

62

I.N. NIFONTOVA ET AL.

21. Drize NI, Drutskaya MS, Gerasimova LP et al. Changes in the hemopoietic system of mice deficient for tumor necrosis factor or lymphotoxin-alpha. Bull Exp Biol Med. 2000;130:676678. 22. Ogawa M. Differentiation and proliferation of hematopoietic stem cells. Blood. 1993;81:2844-2853. 23. Deriugina EI, Drize NI, Olovnikova NI et al. [The precursor hematopoietic cell: its origin in ontogeny, proliferative activity and proliferative potential]. Ontogenez. 1991;22:125-132. 24. Drize N, Chertkov J, Samoilina N et al. Effect of cytokine treatment (granulocyte colonystimulating factor and stem cell factor) on hematopoiesis and the circulating pool of hematopoietic stem cells in mice. Exp Hematol. 1996;24:816-822. 25. Ikebuchi K, Clark SC, Ihle JN et al. Granulocyte colony-stimulating factor enhances interleukin 3-dependent proliferation of multipotential hemopoietic progenitors. Proc Natl Acad Sci U S A. 1988;85:3445-3449. 26. Yin T, Li L. The stem cell niches in bone. J Clin Invest. 2006;116:1195-1201. 27. Taichman RS. Blood and bone: two tissues whose fates are intertwined to create the hematopoietic stem-cell niche. Blood. 2005;105:2631-2639. 28. Takamatsu Y, Simmons PJ, Moore RJ et al. Osteoclast-mediated bone resorption is stimulated during short-term administration of granulocyte colony-stimulating factor but is not responsible for hematopoietic progenitor cell mobilization. Blood. 1998;92:3465-3473. 29. Kokai Y, Wada T, Oda T et al. Overexpression of granulocyte colony-stimulating factor induces severe osteopenia in developing mice that is partially prevented by a diet containing vitamin K2 (menatetrenone). Bone. 2002;30:880-885. 30. Kollet O, Dar A, Shivtiel S et al. Osteoclasts degrade endosteal components and promote mobilization of hematopoietic progenitor cells. Nat Med. 2006;12:657-664. 31. Roberts AW. G-CSF: a key regulator of neutrophil production, but that’s not all! Growth Factors. 2005;23:33-41.

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

E. RICHARD STANLEY* Albert Einstein College of Medicine, Bronx, New York, USA

Keywords: blood cells, macrophages, osteoclasts, review, CSF-1

Abstract. The history of the role of hematopoietic growth factors (HGFs) in the regulation of hematopoiesis is briefly reviewed, commencing with the studies that defined the hematopoietic stem cell and led to the development of in vitro assays for HGFs. The nature of HGF synergism and the underlying mechanisms, as well as the “permissive” versus “instructive” models of HGF action, are also discussed. In addition, work on one of the HGFs, colony stimulating factor-1 (CSF-1), is reviewed, including its function in development as revealed by studies of mouse mutants and its role in innate immunity, inflammatory disease and cancer. 1. Introduction Under the control of several cytokines, the proliferating and differentiating hematopoietic stem cell (HSC) gives rise to common myeloid and common lymphoid progenitor cells which, as they proliferate and differentiate, progressively develop a more restricted capacity for differentiation, eventually giving rise to progenitor cells that are capable of forming only one mature blood or lymphoid cell type. This process is regulated by hematopoietic growth factors (HGFs). The majority of HGFs were identified through the development of semisolid culture methods for bone marrow in which progenitor cells proliferate and differentiate to form macroscopic colonies of mature differentiated blood cells. Here the history of the development of our understanding of the HSC, the discovery of the HGFs and

______ *

To whom correspondence should be addressed. E. Richard Stanley, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461, USA

63 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 63–75. © 2008 Springer.

64

E. RICHARD STANLEY

the mechanisms by which they regulate HSC differentiation are briefly reviewed and followed by an outline of our own studies on the role of one HGF, colony stimulating factor-1 (CSF-1) in development and disease. 2. Hematopoietic Growth Factors 2.1. HEMATOPOIETIC STEM CELLS

The development of the spleen colony forming unit (CFU-s) assay of Till and McCulloch1 in which lethally irradiated mice intravenously injected with a single cell suspension of hematopoietic cells develop colonies containing red cells, granulocytes, macrophages and megakaryocytes in their spleens, paved the way to our current understanding of the pluripotent stem cell. Indeed, in subsequent studies this group presented criteria that defined stem cells as cells with the capacity to: a) self-replicate, b) proliferate extensively and c) to differentiate to all the mature blood and lymphoid cell types. While they showed that some CFU-s appeared to possess these characteristics, these workers were careful not to use the term “hematopoietic stem cell” to describe the entities in hematopoietic cell suspensions that gave rise to spleen colonies2. The heterogeneity of cell types within CFU-s colonies suggested that at best only some CFU-s were HSC. Subsequently, several experiments clearly established that the CFU-s assay does not measure HSC. First, most spleen colonies did not contain all the mature blood cell types. Second, colonies arising 7-10 days after cell transplantation were comprised of erythroid cells only and developed from different cells than 14-day colonies, which mostly contained cells of multiple lineage3. Third, the observed decline in CFU-s numbers upon repeated serial transplantation in lethally irradiated recipient mice was not expected of stem cells with the capacity to self-replicate4. Finally, in elegant experiments, it was shown that CFU-s content was not correlated with hematopoietic repopulating ability, by showing that bone marrow cells from mice treated previously with 5-fluorouracil were largely depleted of CFU-s, but strikingly enriched for hematopoietic repopulating activity5. These studies coupled with additional cell fractionation and transplantation studies have led to the following generally agreed upon characteristics of mouse hematopoietic cells: a) They are capable of long-term (> 6 months) repopulation of both myeloid and lymphoid systems, b) they represent 10-5 of the total bone marrow cells (by contrast, the frequency of CFU-s is 1 in 2,500) and c) they are not cycling or are very slowly cycling in the normal steady-state in vivo5,6.

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

65

2.2. HGFS AND THEIR ACTIVITIES

Only one HGF, the red cell regulator, erythropoietin, had been discovered at the time the CFU-s assay was described7. The description of the CFU-s assay influenced the development of in vitro approaches to the culture of hematopoietic cells. The independent development, in 1966, of the semi-solid culture techniques for granulocyte/macrophage colony formation by hematopoietic cells by Pluznik and Sachs8 and Bradley and Metcalf 9, heralded a new era in which these and other in vitro culture systems were used to assay both the colony forming cells (CFU-c) giving rise to colonies and the colony stimulating factors (CSFs) regulating their development. Among the HGFs identified and/or studied using these approaches were “lineage-restricted” or “late-acting” HGFs that, in the absence of other cytokines, regulate primarily one cell lineage. 2.3. SYNERGISM BETWEEN HGFS

2.3.1. HGF Receptor Signaling HGF action on target cells is mediated by high affinity cell-surface receptors. These receptors transduce the binding of their cognate ligands to signals for survival, proliferation and differentiation. Binding of the HGF to their receptors, or to ligand binding subunits, results in extracellular cross-linking. This in turn leads to dimerization of the signaling subunit and tyrosine phosphorylation of its intracellular domain. This tyrosine phosphorylation may be mediated, in the case of receptor tyrosine kinases, by the intrinsic tyrosine kinase of the receptor itself or, in the case of other receptors, by tyrosine kinases they are pre-associated with. The receptor intracellular domain tyrosine residues so phosphorylated create binding sites for signaling molecules possessing phosphotyrosine binding domains. Aspects of the intracellular signaling pathways downstream of different receptors can be similar, because different activated receptor cytoplasmic domains often bind a common signaling molecule or family of signaling molecules10. 2.3.2. Requirement of Multiple HGFs for the Proliferation and Differentiation of Multipotent Cells Late-acting HGFs, like CSF-1 or EPO, are sufficient for the proliferation and differentiation of cells that are committed to the lineage they regulate and which selectively express their receptors. However, immature multipotent hematopoietic cells have been shown to coexpress different lineage-specific as well as

66

E. RICHARD STANLEY

multilineage HGF receptors at low levels11 and the in vitro proliferation and differentiation of these cells requires a combination of HGFs (e.g. SCF, IL-1, IL-3, IL-6, GM-CSF and CSF-1)12,13. As these cells differentiate, they lose the receptors for some HGFs (e.g. SCF or IL-3), while retaining receptors for particular lateacting HGFs (e.g. CSF-1 or EPO). Eventually they reach the stage of a committed progenitor cell, where their further proliferation and differentiation along one particular lineage is primarily regulated by one late-acting HGF. Commitment to a lineage is associated with increased expression of the lineage specific receptor14,15. 2.3.3. Mechanisms of HGF Synergism The synergism between late-acting, lineage-restricted HGFs, such as CSF-1 and EPO, with HGFs like SCF and IL-3, provides a mechanism for coupling the changes in levels of the late-acting HGF, which are tightly regulated by primary stimuli (e.g. hypoxia in the case of EPO), to the channeling of multipotent cells into a lineage to satisfy the demand for differentiated cells. Possible mechanisms underlying synergism include regulation of expression of the receptor of the synergizing HGF or synergism at the level of post-receptor signaling pathways. There is no strong evidence for direct HGF regulation of increased expression of the receptor for the synergizing HGF15. In contrast, synergism has been reported at the level of receptor signaling. The synergism between SCF and EPO in erythropoiesis appears to be regulated by direct association of the SCF receptor (SCFR) with the EPO receptor (EPOR). In this situation, the activation of the SCFR and its association with the EPOR apparently results in tyrosine phosphorylation of the EPOR at sites that differ from those phosphorylated as a result of EPO-induced EPOR dimerization16,17. Clearly, post-receptor synergism may also occur due to synergism between signaling pathways activated independently by the synergizing growth factors. 2.4. PERMISSIVE VERSUS INSTRUCTIVE MODELS OF HGF ACTION

HGFs regulate survival and proliferation of their target cells. A pertinent question, therefore, is whether their regulation of differentiation is “instructive” or “permissive”. In the permissive model, the growth factor does not have a role in multipotent progenitor commitment, but simply allows the survival and proliferation of committed cells. Support for this model has been provided by hybrid receptor experiments in which in which the mouse TPO receptor (TPOR) gene was replaced with gene encoding a chimeric receptor consisting of the extracellular domain and

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

67

transmembrane domain of the TPOR and the cytoplasmic domain of the G-CSFR. The resulting mice had a normal platelet count, indicating that the cytoplasmic domain of the G-CSFR can functionally replace that of the TPOR to support normal megakaryocytopoiesis and platelet formation18. This implies that the cytoplasmic domain of the TPOR does not have an instructive role, or that if it does, it must be shared with the instructive function of the G-CSFR cytoplasmic domain. Indeed, these two very similar receptors quite possibly share a common instructive signaling pathway, as their functions can be largely separated by a) their different patterns of expression on hematopoietic cells and b) in cells in which their expression overlaps, by the differential regulation of their cytokines, TPO being constitutively present in the circulation and G-CSF induced. In support of the instructive model, it has been shown that the common lymphoid progenitor cell can be redirected to the myeloid lineage by stimulation through exogenously expressed IL-2 and GM-CSF receptors and that the granulocyte and monocyte differentiation signals are regulated by different cytoplasmic domains of the IL-2 receptor19. It is therefore likely that both instructive and permissive mechanisms are utilized, their use depending on the receptors and commitment steps involved. 2.5. REMAINING QUESTIONS

While much has been achieved in the last 50 years of intensive research in the area of hematopoiesis, important questions remain unanswered. One question that is not yet clear is whether all the HGFs are known. Interestingly, there appears to be at least one novel HGF for a known receptor. The existence of this HGF, predicted from molecular genetic studies in mice, was recently revealed using a high throughput screening approach (section 3.2). In another important area, we are largely ignorant of the signaling mechanisms underlying cell commitment and HGF synergism. Similarly, we have very little information about HGF expression and function in the stem cell niche. Much remains to be learned. 3. Role of Colony Stimulating Factor-1 in Development and Disease 3.1. CSF-1 AND THE CSF-1 RECEPTOR

CSF-1 (also known as macrophage CSF or M-CSF) locally and humorally regulates the survival, proliferation, differentiation and function of mononuclear phagocytic cells (committed progenitor, monoblast, promonocyte, monocyte, tissue

68

E. RICHARD STANLEY

macrophage), Langerhans cells and osteoclasts, as well as cells of the female reproductive tract20-23. CSF-1 is synthesized in the endoplasmic reticulum to yield a disulfide-linked, homodimeric, membrane-spanning precursor that contains 522 amino acids. In secretory vesicles, the mature forms of CSF-1, either glycoprotein (~100-kDa) or proteoglycan (~120-160-kDa)24, are cleaved from this precursor and secreted. However, a smaller CSF-1 precursor (224 amino acids), encoded by an mRNA in which the proteolytic cleavage sites have been spliced out, is stably expressed on the cell surface when the secretory vesicle fuses with the plasma membrane. All these isoforms contain the amino terminal 150 amino acids of CSF1 that are sufficient for in vitro biological activity and that possess a 4 α-helical bundle/anti-parallel ß-ribbon structure25. The CSF-1R is a tyrosine kinase that is identical to the c-fms proto oncogene product from which the v-fms oncogene is derived26. The mature protein includes an immunoglobulin-like extracellular domain, a single hydrophobic transmembrane domain and an intracellular tyrosine kinase domain that is interrupted by an unrelated sequence of 72 amino acids27. The receptor is expressed on mononuclear phagocytes, osteoclasts, Langerhans cells, as well as cells of the female reproductive tract23. Extracellular ligand binding by the CSF-1R results in the formation or stabilization of a receptor dimer that leads to receptor activation and receptor tyrosine phosphorylation and the consequent tyrosine phosphorylation of many other proteins, some of which have been shown to have an important role in transducing the responses to CSF-1 binding28,29. After activation and signaling, the majority of the receptor-ligand complexes are internalized and destroyed intralysosomally30,31. However, signaling through the down-regulated, cell-surface CSF-1R is maintained as CSF-1 must be present for the 10-12h lag phase following CSF-1 addition for entry of cells of into S phase32. 3.2. CSF-1/CSF-1 RECEPTOR MUTATIONS REVEAL NOVEL ROLES FOR CSF-1 IN DEVELOPMENT

CSF-1 is synthesized by many different cell types including fibroblasts, endothelial cells, bone marrow stromal cells, osteoblasts, keratinocytes, astrocytes, myoblasts and, during pregnancy, under the control of estrogen and progesterone, by uterine epithelial cells24. Circulating CSF-1 (t1/2 = ~10 min) is synthesized by endothelial cells and smooth muscle cells. It is primarily cleared by CSF-1R-mediated internalization and destruction by Kupffer cells. Thus the number of sinusoidally located macrophages actually determines the concentration of the cytokine

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

69

responsible for their production, a simple feedback control33. Circulating CSF-1 is elevated in response to bacterial endotoxin and to bacterial, viral and parasitic infections24,34-36. Repeated injections of recombinant CSF-1 in mice elevates the circulating monocyte count ~10-fold and increases macrophage numbers in certain areas of the periphery37. The role of CSF-1 in development has been studied in the osteopetrotic (op/op) mutant mouse38. This mouse possesses an inactivating mutation in the CSF-1 gene and fails to produce CSF-139,40. Compared with control mice, op/op mice exhibit impaired bone resorption associated with a paucity of osteoclasts, have no incisors, poor fertility, a lower body weight, a shorter average life span and deficiencies in macrophages in certain tissues23,41,42. Restoration of circulating CSF-1 in newborn op/op mice by injection cured their osteopetrosis and monocytopenia and some, but not all, of the tissue macrophage populations23,41. These and other studies a) showed that CSF-1 is the primary, but not the only regulator of macrophage and osteoclast production, b) indicated that it regulates both humorally and locally and c) suggested that macrophages and osteoclasts not only have scavenger roles but also play trophic roles that are critical for the development and maintenance of the tissues in which they reside. CSF-1 is expressed as a secreted glycoprotein, a secreted proteoglycan and a membrane-spanning, cell-surface glycoprotein20. Transgenic mice exclusively expressing each isoform or their precursors in a normal tissue-specific and developmental pattern exhibit distinct phenotypic differences, indicating differential effects of each CSF-1 isoform43-45. Evidence indicates that the cell surface form of CSF-1 is involved in local regulation that involves cell-cell interaction44. Compared with either the cell surface or secreted glycoprotein isoforms, the proteoglycan form of CSF-1 most effectively corrects the CSF-1-deficient phenotype, particularly the osteopetrosis, indicating that it is either differentially localized to specific extracellular matrices or signals differently in some cell types45. A recent study indicates that there are opposing roles of CSF-1 isoforms in the regulation of hematopoietic cells. When primary, primitive hematopoietic progenitor cells were cocultured with epithelial cells transduced with genes encoding either secreted- or cellsurface- CSF-1, the cells expressing cell-surface CSF-1 stimulated long-term proliferation and self-renewal, whereas those expressing secreted CSF-1 did not support long-term proliferation of the primitive cells and instead promoted their differentiation to macrophages46. Differential effects of these isoforms have also been observed in inflammation and cancer21.

70

E. RICHARD STANLEY

Targeted inactivation of the CSF-1 receptor (CSF-1R) revealed that the CSF1R-deficient mice possessed all of the defects of the CSF-1-deficient mice47,48. Thus all of the effects of CSF-1 are mediated by the CSF-1R encoded by the c-fms protooncogene. However, the phenotype of the CSF-1R-deficient mice is more severe than the phenotype of the CSF-1-deficient mice, indicating that there are CSF-1-independent effects of the CSF-1R. This raised the possibility that either a) there was another, as yet undiscovered, ligand, b) there was CSF-1-independent trans-receptor signaling by another receptor/ligand pair as reported for the EPOR16,17, or that another kind of ligand-independent signaling was possible in some cell types. A recent report indicates that a second ligand for the CSF-1R does exist49 and our current studies are aimed at determining whether regulation by this ligand and CSF-1 is sufficient to account for the CSF-1R deficient phenotype. Detailed analysis of the CSF-1/CSF-1R-deficient phenotypes is far from complete. Apart from the recent description of their involvement in the generation of Langerhans cells47,50, current studies indicate additional roles in the gut and brain. 3.3. CSF-1 IN DISEASE

Studies on the role of CSF-1 in development demonstrate that there is a variable requirement for CSF-1 in the development of individual mononuclear phagocyte populations, the development of macrophages in some tissues being independent of CSF-141. However, these macrophages uniformly express the CSF-1 receptor, and their morphology, phagocytosis and responsiveness to infectious and non-infectious stimuli is regulated by CSF-1. CSF-1 plays important roles in innate immunity and inflammatory diseases, including systemic lupus erythematosus, arthritis, atherosclerosis and obesity. In several inflammatory conditions, activation of macrophages involves a CSF-1 autocrine loop. The reader is referred to a recent review21 where these roles of CSF-1 have been discussed. CSF-1 also plays an important role in cancer. Earlier studies in tumors of the female reproductive tract demonstrated elevated circulating CSF-1, a high incidence of tumor expression of both CSF-1 and the CSF-1R and high levels of tumor-associated macrophages in patients with a poor survival24,51-53. In addition, mouse mammary tumor virus-driven polyoma middle-T transgenic tumors developing in CSF-1-deficient mice display decreased recruitment of macrophages, slowed tumor progression and almost complete suppression of metastasis54. In mice bearing human malignant tumor xenografts, 14 days of mouse CSF-1 blockade with

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

71

antisense oligonucleotides, siRNA or anti-CSF-1 antibody suppressed tumor growth, decreased the expression of matrix metalloproteinase-2 and angiogenic factors, reduced tumor vascularity, reversed the chemo-resistance and improved survival of mice55-57. These studies indicate that host CSF-1 production plays an important role in the late stages of tumor growth, metastasis and angiogenesis and that CSF-1 blockade could be efficacious in treatment. In investigations of the interaction between CSF-1 regulated macrophages and tumor cells, it was shown that both mammary carcinoma cells and macrophages comigrate and depend upon each other to be invasive in vivo and in vitro58,59. Macrophages express EGF, which promotes both carcinoma cell invasion and carcinoma cell production of CSF-1, which in turn promotes the expression of EGF by macrophages. Disruption of this loop by blockade of either EGF receptor or CSF-1 receptor signaling is sufficient to inhibit both macrophage and tumor cell migration and invasion. These studies emphasize the importance of interactions between tumor cells and the tumor microenvironment in tumor progression and metastasis. The involvement of CSF-1 in innate immunity, cancer and a variety of inflammatory diseases renders CSF-1 signaling as an attractive therapeutic target. In specific disease situations, such as cancer and atherosclerosis21, individual isoforms of CSF-1 might have opposing effects and studies with mice that exclusively express each CSF-1 isoform43-45 will be useful in dissecting their roles in immunity and disease. Autocrine regulation by CSF-1 is also relevant and has been shown in mononuclear phagocyte activation leading to immunity (e.g. microglia or allograft rejection) or disease (e.g. LC histiocytosis) 21. Disease model studies involving CSF-1- and CSF-1R-deficient mice that have defects in both mononuclear phagocyte development and function complicate our understanding of regulation by CSF-1 in the adult. An accurate understanding of regulation by CSF1 in disease will depend upon the use of conditional ablation of CSF-1 and CSF-1R genes or antibodies to CSF-1 and the CSF-1R, or CSF-1R inhibitors, in fully developed adult mice. Acknowledgements

This work was supported by National Institutes of Health grants, CA32551, CA26504 and P01 100324.

72

E. RICHARD STANLEY

References 1. J. E. Till and E. A. McCulloch, A direct measurement of the radiation sensitivity of normal mouse bone marrow cells, Radiat.Res. 14, 213-222 (1961). 2. A. M. Wu, J. E. Till, L. Siminovitch, and E. A. McCulloch, A cytological study of the capacity for differentiation of normal hematopoietic colony-forming cells, J.Cell.Physiol. 69, 177-184 (1967). 3. M. C. Magli, N. N. Iscove, and N. Odartchenko, Transient nature of early haematopoietic spleen colonies, Nature 295(5849), 527-529 (1982). 4. E. A. Ross, N. Anderson, and H. S. Micklem, Serial depletion and regeneration of the murine hematopoietic system. Implications for hematopoietic organization and the study of cellular aging, J.Exp.Med. 155(2), 432-444 (1982). 5. G. S. Hodgson and T. R. Bradley, Properties of haematopoietic stem cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S cell?, Nature 281(5730), 381-382 (1979). 6. D. E. Harrison, C. M. Astle, and C. Lerner, Number and continuous proliferative pattern of transplanted primitive immunohematopoietic stem cells, Proc.Natl.Acad.Sci.USA 85, 822-826 (1988). 7. P. Carnot and C. Deflandre, Sur l’activite hematopoietique des serum au cours de la regeneration du sang, Acad. Sci. 3, 384 (1906). 8. D. H. Pluznik and L. Sachs, The cloning of normal “mast” cells in tissue culture, J.Cell.Comp.Physiol. 66, 319-324 (1965). 9. T. R. Bradley and D. Metcalf, The growth of mouse bone marrow cells in vitro, Australian Journal of Experimental Biology and Medical Science 44, 287-299 (1966). 10. E. R. Stanley, in: Samter’s Immunological Diseases, edited by K. F. Austen, M. M. Frank, J. P. Atkinson, H. Cantor (Lippincott Williams and Wilkins, Philadelphia, 2001), pp. 175-193. 11. M. A. Cross and T. Enver, The lineage commitment of haemopoietic progenitor cells, Current Opinion in Genetics and Development 7, 609-613 (1997). 12. T. R. Bradley and G. S. Hodgson, Detection of primitive macrophage progenitor cells in mouse bone marrow, Blood 54, 1446-1450 (1979). 13. E. R. Stanley, A. Bartocci, D. Patinkin, M. Rosendaal, and T. R. Bradley, Regulation of very primitive multipotent hematopoietic cells by hemopoietin-1, Cell 45, 667-674 (1986). 14. R. J. Tushinski, I. T.Oliver, L. J. Guilbert, P. W. Tynan, J. R. Warner, and E. R. Stanley, Survival of mononuclear phagocytes depends on a lineage-specific growth factor that the differentiated cells selectively destroy, Cell 28, 71-81 (1982). 15. S. H. Bartelmez and E. R. Stanley, Synergism between hemopoietic growth factors (HGFs) detected by their effects on cells bearing receptors for a lineage specific HGF: assay of hemopoietin-1, J.Cell.Physiol. 122, 370-378 (1985). 16. H. Wu, U. Klingmüller, P. Besmer, and H. F. Lodish, Interaction of the erythropoietin and stemcell-factor receptors, Nature 377, 242-246 (1995). 17. H. Wu, U. Klingmüller, A. Acurio, J. G. Hsiao, and H. F. Lodish, Functional interaction of erythropoietin and stem cell factor receptors is essential for erythroid colony formation, Proc.Natl.Acad.Sci.USA 94, 1806-1810 (1997). 18. R. Stoffel, S. Ziegler, N. Ghilardi, B. Ledermann, F. J. de Suvage, and R. C. Skoda, Permissive role of thrombopoeitin and granulocyte colony-stimulating factor receptors in hematopoietic cell fate decisions in vivo, Proc.Natl.Acad.Sci.USA 96, 698-702 (1999).

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

73

19. M. Kondo, D. C. Scherer, T. Miyamoto, A. G. King, K. Akashi, K. Sugamura, and I. L. Weissman, Cell-fate conversion of lymphoid-committed progenitors by instructive actions of cytokines, Nature 407, 383-386 (2000). 20. F. J. Pixley and E. R. Stanley, CSF-1 regulation of the wandering macrophage: complexity in action, Trends Cell. Biol. 14(11), 628-638 (2004). 21. V. Chitu and E. R. Stanley, Colony-stimulating factor-1 in immunity and inflammation, Curr. Opin. Immunol. 18(1), 39-48 (2006). 22. P. E. Cohen, K. Nishimura, L. Zhu, and J. W. Pollard, Macrophages: important accessory cells for reproductive function, J. Leuk. Biol. 66(5), 765-772 (1999). 23. J. W. Pollard and E. R. Stanley, Pleiotropic roles for CSF-1 in development defined by the mouse mutation osteopetrotic, Advances in Developmental Biochemistry 4, 153-193 (1996). 24. E. R. Stanley, in: Cytokine Reference: A compendium of cytokines and other mediators of host defence, edited by J. J. Oppenheim, M. Feldmann (Academic Press, London, 2000), pp. 911-934. 25. J. Pandit, A. Bohm, J. Jancarik, R. Halenbeck, K. Koths, and S. H. Kim, Three-dimensional structure of dimeric human recombinant macrophage colony-stimulating factor, Science 258, 1358-1362 (1992). 26. C. J. Sherr, C. W. Rettenmier, R. Sacca, M. F. Roussel, A. T. Look, and E.R. Stanley, The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-1, Cell 41, 665-676 (1985). 27. L. Coussens, C. Van Beveren, D. Smith, E. Chen, R. L. Mitchell, C. M. Isacke, I. M. Verma, and A. Ullrich, Structural alteration of viral homologue of receptor proto-oncogene fms at carboxyterminus, Nature 32, 277-280 (1986). 28. Y. G. Yeung, Y. Wang, D. B. Einstein, P. S. W. Lee, and E. R. Stanley, Colony-stimulating factor-1 stimulates the formation of multimeric cytosolic complexes of signaling proteins and cytoskeletal components in macrophages, J.Biol.Chem. 273, 17128-17137 (1998). 29. Y. G. Yeung and E. R. Stanley, Proteomic approaches to the analysis of early events in CSF-1 signal transduction, Mol. Cell. Proteomics 2, 1143-1155 (2003). 30. L. J. Guilbert and E. R. Stanley, The interaction of 125I-colony stimulating factor-1 with bone marrow-derived macrophages, J.Biol.Chem. 261, 4024-4032 (1986). 31. P. S. W. Lee, Y. Yang, M. G. Dominguez, Y. G. Yeung, M. A. Murphy, D. D. Bowtell, and E.R. Stanley, The Cbl protooncoprotein stimulates CSF-1 receptor multiubiquitination and endocytosis, and attenuates macrophage proliferation, EMBO J. 18, 3616-3628 (1999). 32. R. J. Tushinski and E. R. Stanley, The regulation of mononuclear phagocyte entry into S phase by the colony stimulating factor CSF-1, J.Cell.Physiol. 122, 221-228 (1985). 33. A. Bartocci, D. S. Mastrogiannis, G. Migliorati, R. J. Stockert, A. W. Wolkoff, and E. R. Stanley, Macrophages specifically regulate the concentration of their own growth factor in the circulation, Proc.Natl.Acad.Sci.USA 84, 6179-6183 (1987). 34. P. Roth and E. R. Stanley, The biology of CSF-1 and its receptor, Curr.Top.Microbiol.Immunol. 181, 141-167 (1992). 35. E. R. Stanley, K. L Berg, D. B.Einstein, P. S. W. Lee, F. J. Pixley, Y. Wang, and Y. G.Yeung, Biology and Action of CSF-1, Molecular Reproduction and Development 46, 4-10 (1997). 36. E. R. Stanley, in: The Cytokine Handbook, edited by A. W. Thomson (Academic Press, San Diego, 1994), pp. 387-418.

74

E. RICHARD STANLEY

37. D. A. Hume, P. Pavli, R. E. Donahue, and I. J. Fidler, The effect of human recombinant macrophage colony-stimulating factor (CSF-1) on the murine mononuclear phagocyte system in vivo, J.Immunol. 141, 3405-3409 (1988). 38. S. C. Marks, Jr. and P. W. Lane, Osteopetrosis, a new recessive skeletal mutation on chromosome 12 of the mouse., J.Hered. 67, 11-18 (1976). 39. H. Yoshida, S-I. Hayashi, T. Kunisada, M. Ogawa, S. Nishikawa, H. Okamura, T. Sudo, L. D. Shultz and S-I. Nishikawa, The murine mutation “osteopetrosis” (op) is a mutation in the coding region of the macrophage colony stimulating factor (Csfm) gene, Nature 345, 442-444 (1990). 40. W. Wiktor-Jedrzejczak, A. Bartocci, A. W. Ferrante, Jr., A. Ahmed-Ansari, K. W. Sell, J. W. Pollard, and E.R. Stanley, Total absence of colony-stimulating factor 1 in the macrophagedeficient osteopetrotic (op/op) mouse, Proc.Natl.Acad.Sci.USA 87, 4828-4832 (1990). 41. M. G. Cecchini, M. G. Dominguez, S. Mocci, A. Wetterwald, R. Felix, H. Fleisch, O. Chisholm, W. Hoffstetter, J. W. Pollard, and E. R. Stanley, Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse, Development 120, 1357-1372 (1994). 42. R. Felix, W. Hofstetter, A. Wetterwald, M. G. Cecchini, and H. Fleisch, Role of colonystimulating factor-1 in bone metabolism, J.Cell.Biochem. 55, 340-349 (1994). 43. G. R. Ryan, X. M. Dai, M. G. Dominguez, W. Tong, F. Chaun, O. Chisholm, R. G. Russell, J. Pollard, and E. R. Stanley, Rescue of the colony-stimulating factor 1 (CSF-1)-nullizygous mouse (Csf1(op)/Csf1(op)) phenotype with a CSF-1 transgene and identification of sites of local CSF-1 synthesis, Blood 98(1), 74-84 (2001). 44. X. M. Dai, X. H. Zong, V. Sylvestre, and E. R. Stanley, Incomplete restoration of colonystimulating factor 1 (CSF-1) function in CSF-1-deficient Csf1op/Csf1op mice by transgenic expression of cell surface CSF-1, Blood 103(3), 1114-1123 (2004). 45. S. Nandi, M. P. Akhter, M. F. Seifert, X. M. Dai, and E. R. Stanley, Developmental and functional significance of the CSF-1 proteoglycan chondroitin sulfate chain, Blood 107(2), 786-795 (2006). 46. J. Friel, C. Heberlein, M. Geldmacher, and W. Ostertag, Diverse isoforms of colony-stimulating factor-1 have different effects on the development of stroma-dependent hematopoietic cells, J.Cell.Physiol. 204(1), 247-259 (2005). 47. X. M. Dai, G. R. Ryan, A. J. Hapel, M. G. Dominguez, R. G. Russell, S. Kapp, V. Sylvestre, and E. R. Stanley, Targeted disruption of the mouse colony-stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects, Blood 99(1), 111-120 (2002). 48. X. M. Dai, X. H. Zong, M. P. Akhter, and E. R. Stanley, Osteoclast deficiency results in disorganized matrix, reduced mineralization, and abnormal osteoblast behavior in developing bone, J. Bone Miner. Res 19(9), 1441-1451 (2004). 49. H. Lin, M. M. Huang, C. Leo, M. Ji, G. Wu, A. Zhou, R. Halenbeck, M. Qin, T. Linnemann, D. Behrens, S. Giese, E. Bosch, K. Justin, A. Pham, E. Lee, K. Hestir, H. Zhang, J. Wong, Y. Wang, K. Chu, S. Doberstein, L. T. Williams, and D. Hollenbaugh, A novel cytokine, FTP025, regulates myeloid growth and differentiation via the M-CSF receptor, Blood 108, 191a (2006). 50. F. Ginhoux, F. Thacke, V. Angeli, M. Bogunovic, M. Loubeau, X. M. Dai, E. R. Stanley, G. J. Randolph, and M. Merad, Langerhans cells arise from monocytes in vivo, Nat. Immunol. 7(3), 265-273 (2006).

REGULATION OF HEMATOPOIESIS BY GROWTH FACTORS

75

51. B. M. Kacinski, CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract, Mol. Reprod. Dev. 46(1), 71-74 (1997). 52. S. M. Scholl, C. Pallud, F. Beuvon, K. Hacene, E. R. Stanley, L. Rohrschneider, R. Tang, P. Pouillart, and R. Lidereau, Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis, J.Natl. Cancer Inst. 86(2), 120-126 (1994). 53. L. Bingle, N. J. Brown, and C. E. Lewis, The role of tumour-associated macrophages in tumour progression: implications for new anticancer therapies, J.Pathol. 196(3), 254-265 (2002). 54. E. Y. Lin, A. V. Nguyen, R. G. Russell, and J. W. Pollard, Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy, J.Exp.Med. 193(6), 727-740 (2001). 55. S. Aharinejad, D. Abraham, P. Paulus, H. Abri, M. Hoffmann, K. Grossschmidt, R. Schaefer, E. R. Stanley, and R. Hofbauer, Colony-stimulating factor-1 antisense treatment suppresses growth of human tumor xenografts in mice, Cancer Res. 62(18), 5317-5324 (2002). 56. S. Aharinejad, P. Paulus, M. Sioud, M. Hoffmann, K. Zins, R. Schaefer, E. R. Stanley, and D. Abraham, Colony-stimulating factor-1 blockade by antisense oligonucleotides and small interfering RNAs suppresses growth of human mammary tumor xenografts in mice, Cancer Res. 64(15), 5378-5384 (2004). 57. P. Paulus, E. R. Stanley, R. Schafer, D. Abraham, and S. Aharinejad, Colony-stimulating factor-1 antibody reverses chemoresistance in human MCF-7 breast cancer xenografts, Cancer Res. 66(8), 4349-4356 (2006). 58. J. Wyckoff, W. Wang, E. Y. Lin, Y. Wang, F. Pixley, E. R. Stanley, T. Graf, J. W. Pollard, J. Segall, and J. Condeelis, A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors, Cancer Res. 64(19), 7022-7029 (2004). 59. S. Goswami, E. Sahai, J. B. Wyckoff, M. Cammer, D. Cox, F. J. Pixley, E. R. Stanley, J. E. Segall, and J. S. Condeelis, Macrophages promote the invasion of breast carcinoma cells via a colonystimulating factor-1/epidermal growth factor paracrine loop. Cancer Res. 65(12), 5278-5283 (2005).

II BIOLOGY OF NON-HAEMATOPOIETIC STEM CELLS

STEM CELL TECHNOLOGIES IN GERONTOLOGICAL RESEARCH G.M. BUTENKO* Institute of Gerontology AMS of Ukraine, Kyiv, Ukraine

Keywords: stem cells; aging, gerontology

Abstract. When getting old, a lot of unpleasant events are developing in our organism. Here, we should mention the decline or gradual loss of function and potential and, ultimately, death of cells of different types. Many data exist about age-dependent deterioration of nervous and muscle cells as well as about many proliferating cell populations, such as epithelial, osteogenic, hemopoietic and others. These changes manifest themselves in a number of old age diseases like the Alzheimer’s disease, Parkinsonism, heart and brain infarction, osteoporosis, diabetes, immune deficiency, malignancies and others. So, it takes to elaborate some technologies and methods for improving the situation by stimulation or replacement of the impaired organs and tissues. The dream is to launch a medical revolution, in which failing organs and tissues might be repaired not with crude mechanical devices like insulin pumps or titanium joints, but with the living homegrown replacement. And great promises here make now the use of stem cell technologies. 1. Introduction An emerging body of evidence suggests that many tissues retain minor population of tissue- specific stem cells capable of replenishing cells that are lost through wear and tear, aging, injury and disease. Data exist indicating that even in the adult organism it is possible to restore many terminally differentiated postmitotic effector cells, such as hepatocytes, muscle cells, glial and nerve cells, and even so specialized as the Purkinje cells, by means of hemopoietic stem cells (HSC) (Bjorklund, Svendsen, 1999; Cossu, Mavilio,

______ *

To whom correspondence should be addressed. G.M. Butenko, Institute of Gerontology AMS of

Ukraine, Kyiv, Ukraine; Email: [email protected]

77 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 77–82. © 2008 Springer.

78

G.M. BUTENKO

2001; Weimann et al., 2003). Hence, it is reasonable to argue that the sole function of adult stem cells is to rejuvenate the aging tissues. This idea fueled enthusiasm for use of stem cells in strategies aimed at repairing or replacing the damaged, diseased or aged tissues and organs. However, one of the greatest challenges in stem cell work is to harness and direct cell differentiation. Complex combination of intrinsinc factors, microenvironmental and systemic signals drive the process, which researchers are only beginning to pin down. From this viewpoint the hemopoietic stem cells, having been experimentally and clinically studied for more than 50 years, attract the attention of investigators as thoroughly characterized tissue specific stem cell model to estimate its potential application in regenerative medicine. Moreover, a large number of reports have entertained the idea that HSCs have the potential to transdifferentiate into a range of non-hematopoietic cell types, including hepatocytes, skeletal muscle fibers, cardiomyocytes, neuronal and epithelial cells (Wagers, Weissman, 2004; Grove et al., 2004). An important function of HSCs is the maintenance of the body defense mechanisms. In the same time the significant signs of aging process is the decline of organism’s defense capacities. So far as the adaptive immune system is concerned, the principal occurring during life span in the experimental animals and the human being are very similar. They manifest themselves in the specific dynamics of immune response to foreign antigens, namely: an increase of immune reactions at the time of development followed by a gradual decrease after or close to the period of puberty until very low values, often less than one per cent of maximal level in ultimate ages. In parallel, the immune reactivity to self-antigens (immune tolerance) has the opposite dynamics. This is accompanied with changes in the phenotypical characteristics of the immunocompetent cells, a shift of the T- and B- lymphocytes subpopulations, with accumulation of the cells having memory-cell surface markers, with decreased proliferative and functional activity, significant disturbances in regulatory network. On the other hand, the increased susceptibility to myeloand lymphoproliferative diseases is observed. These changes are mirrored in the very typical dynamic of age-dependent curves of population survival/mortality (Makinodan, 1978). In the attempt to explain the events observed, it was supposed that the reason for above has been the exhaustion of proliferative potential of hemopoietic stem cells, so called the Hayflick’s limit, observed previously for the cells, proliferating in vitro (Hayflick and Moorhead, 1961; Hayflick, 1965). However, approximately at the same time it was shown, that due to successive transfers of bone marrow stem cells to lethally irradiated young recipients (mice) the proper life span of bone marrow derived stem cells exceeds at least 3 to 4 times the maximal life span of their hosts. It seems that extinction of these

STEM CELL TECHNOLOGIES IN GERONTOLOGICAL RESEARCH

79

cells did not result from the exhaustion of proliferative capacity, but rather occurred because of cell damages or dilution by transfer procedure (Harrison, 1979; Harrison, Astle, Stone, 1989; Micklem, Ross, 1978). As we now know, the Hayflick’s limit depends on the loss of telomeres which accompanies each chromosome replication , and is observed at cell division in cell cultures or in the terminally differentiated cell population in vivo. The stem cells escape the clonal exhaustion , they differ from above cells by special enzyme, telomerase, which restores the loss of chromosome ends, thus making stem cells practically immortal (Hornsby, 2001). The above-said suggests that there may exists some other cause(s) of age-dependent immune decline. There arises the question whether the above mentioned age specific properties belong to the whole hematopoietic cell line of old body, from stem cells and early precursors to mature lymphocytes, or whether they are acquired at a certain stage of lymphoid cell differentiation. For this purpose, we grafted the bone marrow cells of young and old CBA mice reciprocally to lethally irradiated syngeneic animals of opposite ages: young to old and vice versa. The results obtained was shown out that the young recipients, which had received the young or old bone marrow stem cells, demonstrate that the CD4+ lymphocytes, judging by their phenotypic markers, are very similar to those in young intact animals, irrespective of the age of bone marrow cell donor. On the other hand, the lymphocytes from old recipients, grafted both by young or old donor’s bone marrow cells, demonstrated the features, which are akin to the cells from intact old animals. While comparing the primary immune response to standard T- dependent antigen, SRBC, we may notice that immune reactivity in such long-term (3 months) heterochronic bone marrow chimeras is determined not by the proper age of the cells, involved in the immune response, but by the properties of the environment, both micro- or macro-environment, in which these cells underwent the morphogenesis. Given that the grafted cells were preliminary depleted from mature T cells and under effects of three-month stay in the recipient’s organism we assumed that all other mature immunocompetent cells disappeared in the natural manner. Following from this assumption, we showed, that these cells were progenies of hemopoietic stem cells, which matured in the organism of appropriate age and obtained the specific characteristics of the given age (Butenko, Andrianova, 1985). They maintained these properties even in the artificial conditions in vitro. So, considering the above mentioned facts, we may conclude that the main regulatory and morphogenetic signals originate from micro- environment, into which the stem cells were placed, or/and that they are systemic. In other words, the potential extrinsic modulation of a stem cell senescence program is an exiting field of research, warranting further study.

80

G.M. BUTENKO

We began this work with elaborating the experimental models, called heterochronic chimeras. That is the construction of living systems consisting of elements of opposite ages. One of such models is the heterochronic parabiosis. For this purpose we had sewn together, surgically, two CBA female mice 2-3 (young) and 22-23 (old) months according the method of Bunster and Meyer (1933). The common circulation of fluids had formed as early as 18 hours after joint operation. Two months later, the cross-circulation between partners was determined as 1% of the total blood content of one animal per minute with halflife blood exchange in about 140 min. The mutual population in bone marrow, thymus and spleen by partner’s cells, using T6T6 chromosome markers was observed. It was seen, that repopulation of old bone marrow (homing) with young-derived cells is remarkably less, than in young animal. That has been confirmed recently (Wright et al., 2001; Liang et al., 2005). The primary immune response in old separate mice is considerably lower as compared with young adults. The operation by itself did not influence either the serum antibody level or the antibody producing cells (so called plaque forming cells – PFC) number in the spleen in young and in old mice. But in the young adult mouse stitched with an old animal, the number of PFC in spleen as well as the serum antibody level were considerably lower, approaching to the level of old animal. At the same time, the spleen PFC in old animal was affected very little. A direct correlation was established between the immune response of old animals and the immune response of their young partners (r=0,82, p< 0,001). It means that old animals in the heterochronic pairs determined the immune reactivity of their young partners. We suppose that active inhibition of the immune response in the young parabionts by some factors of the old organism’s underlies the events observed. This inhibitory activity could be mediated by humoral or/and cellular factors and extend on many other cells apart from lymphoid cells, for instance, on the stromal cells of lymphoid organs. Having in mind the intensive cellular exchange between both partners, we could not exclude the short-distance effects of intercellular interactions. That is why, in the new series of the experiments we have irradiated the old parabiotic partner by the bone marrow lethal dose (9Gy) 4 days after joint operation, because since the fourth day cell exchange taking place. Two months later we could observe an essential elevation of the immune response in old partners and its relatively small decrease in young animals. These facts may suggest that irradiation removed at least some part of this unknown inhibitory mechanism. When both of the partners in parabiosis were young, the pair survived 2 years or more. If one mouse was 3 months old and the second was 22 months old, their joint life span was restricted maximum to 9 months. The death of one animal, as a rule old one, led inevitably to the death of a second partner. When the parabiotic pairs were separated from each other after 3 month of joint life,

STEM CELL TECHNOLOGIES IN GERONTOLOGICAL RESEARCH

81

the young mice, which had been in parabiosis with old partners before separation, revealed the high rate of mortality and their life-span did not exceed the life-span of their former old partners. Whereas the young animals which had been in parabiosis with young partners and then separated, survived the normal murine life-span. No doubt, the immune system provides very much for the organism survival. It was shown that the immune response of the young partners that dropped during parabiosis with the old ones did not recover during 7 months of the following independent life (Butenko, 1986). The changes in young parabiotic partners were not restricted by the immune system alone. We observed the pronounced changes in structure and function of ovaries of young animals connected with the old, in particular, in the blood progesterone level, which were accompanied with permanent estrus in young animals and anestrus in old partners. Further, there are evidences shown that with advancing age one can observe an increase in the collagen glycation. In our experiments made on heterochronically parabiosed mice and rats (in collaboration with prof. Z. Deyl) we demonstrated that both, aortal and skin collagen of young animals was rapidly non-enzymatically glycosilated and the proportion of incorporated glucose approached in the young counterparts to the level found in old individuals (Deyl et al., 1990). H. Tauchi and coworkers (1977, 1995) described the changes in the hepatic cells in young heterochronically parabiosed rats similar to those observed in old animals, although the liver cells of old partners had no signs of rejuvenation. Recently the article of Conboy et al. (2005) was published, where the authors have shown that hepatic and muscle stem cells in heterochronically parabiosed mice reveald some signs of rejuvenation, but only after 5 weeks of parabiosis. It is interesting whether that effect will be long-lasting. Based on our own data and the literature data we can rather draw the conclusion that in long-term heterochronic systems the mature elements, originated from the old organism, dominate and their influences were found to be active. But even in old organism, the stem cells do preserve their restorative potential and become capable of generating cells with young characteristics under appropriate conditions. And the question about reverse impacts of stem cells on old organism (so called rejuvenation effect) remains uncertain and till now unresolved and needs further research.

82

G.M. BUTENKO

References Bjorklund A., Svendsen C. (1999). Breaking the brain-blood barrier, Nature, 397, 569-570. Bunster I., Meyer R. K. (1933). Improved method of parabiosis,Anat. Res., 57, 339. Butenko G. M. (1986). Ageing of the immune system and diseases, In: Age-related factors in cancerogenesis. IARC scientific publication No 58, Lyon, 71-83. Butenko G. M., Andrianova L. F. (1985). Functional properties of hemopoietic stem cells in aging, Arch. Biol. (Bruxelles), 96, 246-251. Conboy I. M., Conboy M. J., Wagers A. J. et al. (2005). Rejuvenation of aged progenitor cells by exposure to a young systemic environment, Nature, 433, 760-764. Cossu G., Mavilio F. (2001). Bone marrow-derived myogenic stem cells: a therapeutic alternative for muscular dystrophy? In: Pluripotent stem cells. Eds B. Dodet, M. Vicari. John Libbey Eurotext, 39-44. Deyl Z., Butenko G.M., Hausmann J. et al. (1990). Increased glycation and pigmentation of collagen in aged and young parabiotic rats and mice, Mech. Ageing Dev., 55, 39-47. Grove J. E., Bruscia E., Krause D. S. (2004). Plasticity of bone marrow-derived stem cells, Stem Cells, 22, 487-500. Harrison D. E. (1979). Mouse erythropoietic stem cell lines function normally 100 months: loss related to number of transplantations, Mech. Ageing Dev., 9, 427-433. Harrison D. E., Astle C. M., Stone M. (1989). Numbers and functions of transplantable primitive immunohemopoietic stem cells. Effects of age, J. Immunol., 142, 3833-3840. Hayflick L., Moorhead P. S. (1961). The cerial cultivation of human diploid cell strains, Exp. Cell Res., 25, 582-621. Hayflick L. (1965) .The limited in vitro lifetime of human diploid cell strains, Exp. Cell Res., 37, 614-636. Hornsby P. J. (2001). Cell proliferation in mammalian aging, Handbook of the biology of aging. Eds. E. G. Masoro, S. N. Austad, Acad. Press, NY, 207-245. Ito Y., Sato T., Tauchi H. (1995). On the hepatocytes in parabiosis between young and old mice, Abstr. 6 th Congr.Internatl. Assoc. Biomed. Gerontology, Tokyo, part 1, 51. Makinodan T. (1978). Mechanism of senescence of immune response. Federation Proc., 37, 1239-1240. Liang Y., Van Zant G., Szilvassy S. J. (2005). Effect of aging on the homing and engraftment of murine hematopoietic stem and progenitor cells, Blood, 106, 1479-1487. Micklem H. S., Ross E. (1978). Heterogenity and ageing of haematopoietic stem cells, Ann.Immunol. (Inst. Pasteur), 129C, 367-376. Tauchi H., Hasegawa K. (1977). Change of the hepatic cells in parabiosis between old and young rats, Mech. Ageing Dev., 6, 333-339. Wagers A. J., Wessman I. L. (2004). Plasticity of adult stem cells. Cell, 116, 639-648. Weimann J. M., Charlton C. A., Brazelton T. R. et al. (2003). Contribution of transplanted bone marrow cells to Purkinje neurons in human adult brain, PNAS, 100, 2088-2093. Wright D. E., Wagers A. J., Gulati A. P. et al. (2001) Physiological migration of hematopoietic stem and progenitor cells, Science, 294, 1933-1936.

OSTEOPETROTIC MODELS FOR IDENTIFYING GENES THAT CONTROL BONE RESORPTION WIESLAW WIKTOR-JEDRZEJCZAK* Department of Hematology, Oncology, and Internal Diseases, Medical University of Warsaw, Warsaw, Poland

Keywords: osteopetrosis; osteoclast; bone resorption

Abstract. Hematopoietic system in vertebrates hinges on the development of novel organ not present in other organisms and called bone marrow that is located within bones. In order for this organ to develop, first bones have to develop that occurs in bony fish and then cellular mechanism of creating the space inside them. This cellular mechanism is dependent on a single new type of cell called the osteoclast that is resorbing bone. Identification of genes whose products are critical for that process should be helped by the analysis of a disorder that is due to its disturbance. Such disorder called marble bone disease or osteopetrosis was first discovered in man about one hundred years ago and since then identified in many vertebrate species. It is rare and sometimes fatal disease that is due to smaller or absent bone marrow cavities and disturbed development of bone marrow, In extreme cases, there is no bone marrow. Therefore, it is of crucial importance from the point of view of understanding vertebrate hematopoiesis to investigate which genes when intercepted produce osteopetrosis because these would be the genes that are controlling the process of formation of bone marrow as an organ,. These genes through their products have to affect osteoclasts directly or indirectly either abrogating their formation or function. While for many other cell classes within hematopoiesis, there are only one or two known genetic defects that lead to their inherited deficiency, there is a plethora of osteopetroses with similar final clinical picture but different exact cellular problem and different genetic origin. Some of them have occurred spontaneously, and gene mutations causing them have been later identified, others have been unexpected products of gene targeting. While osteopetroses produced by gene targeting such as c-src, c-fos knockouts from

______ * To whom correspondence should be addressed. Department of Hematology, Oncology, and Internal Diseases, Medical University of Warsaw, Warsaw, Poland, Email: [email protected]

83 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 83–104. © 2008 Springer.

84

W. WIKTOR-JEDRZEJCZAK

the beginning possessed known responsible gene, whose interception was producing given defect, naturally occurred osteopetroses still have unresolved affected gene identity in some cases. In resolved cases, the genes whose mutations produce osteopetrosis have very different functions from coding growth factors, and their receptors, transcription factors, and genes coding enzymes critical to bone resorbing function of osteoclasts. The fact, that mutations of so many different genes may produce osteopetrosis is probably due to the relative evolutionary novelty of this cell lineage what did not allow time for the development of alternative regulatory pathways active for other “older” types of cells.Such alternative pathways can take over function of blocked main pathway and assure for continuation of production of given cell type preventing the clinical disease. 1. Introduction Hematopoietic tissue is unique in vertebrate organism in these terms that it does not develop originally in its final location i.e. in the bone marrow. In early vertebrates, that is in cartilaginous fish there are even no bones. First hematopoietic stem cells for definitive hematopoiesis appear in mammals in AGM (aortha, gonads, mesonephros) region and later they colonize liver and spleen, where they function in fetal life, and finally they settle in the bone marrow. In adult mammals there is no hematopoiesis in the liver, but in smaller mammals spleen remains as hematopoietic organ for the lifespan in addition to the bone marrow. Development of the bone marrow has to occur after development of bones and development of mechanism that would create space within bone. Development of bones originally takes place in the so called bony fish, whose bones are acellular and kidneys are the main hematopietic organ in adult animals. It has been found many years ago that bony fish (in contrast to cartilaginous fish such as sharks), while having acellular bone already have mechanism to create space within bones. It has been shown, that when bony fish are implanted with exogenous bone particles they colonize these particles with cells possessing ruffled border overlying the areas of bone matrix that undergoes dissolution, cells that closely resembled osteoclasts (Glowacki et al., 1986). Later it was found that osteoclasts are really present in zebrafish and assist there in tooth eruption (Witten et al., 2001). On the other hand, frogs already have fully developed bone marrow. Therefore, this development has to occur somewhere between bony fish and frogs. This development has to hinge on the appearance in the vertebrates of a new cell type called the osteoclast. There are many lines of evidence that suggest

OSTEOPETROSIS

85

that this cell belongs to monocyte/macrophage lineage but it is quite unusual within this lineage because it is exerting its primary activity i.e. bone resorption through acidic and enzymatic bone dissolution and not through the main mechanism of action of macrophages that is phagocytosis (Figure 1).

Figure 1. Schematic representation of osteoclast function in bone resorption.

The osteoclast is a polarized multinucleated cell attached to the bone surface that has at its bone approaching side the so called ruffled border termed so because of characteristic ruffled appearance. Ruffled border is approaching resorption lacunae lying between osteoclast cell surface and bone surface. Resorption lacunae is the space where bone dissolution takes place. Bone dissolution products are transported out of the resorption lacunae through the osteoclast cytoplasm and are released to the ouside on the other side of the osteoclast called basolateral membrane. Osteoclast is attached to the bone on the borders of resorption lacunae with a region of cytoplasm called clear zone and devoid of organelles. It is sealed in this region to the bone with the aid of αvβ3 integrin interacting with vitronectin. Bone dissolution is composed of two major processes: mineral dissolution and protein degradation. Bone mineral is hydroxyapatite i.e. (Ca3(PO4)2)3 x Ca(OH)2. It is dissolved into Ca2+, HPO42-, and H2O with the help of hydrochloric acid. For this, independently protons (H+) and chloride (Cl-) are

86

W. WIKTOR-JEDRZEJCZAK

released from the ruffled border into clear zone. Protons are originally generated in the cytoplasm by dissociation of carbonic acid made by carbonic anhydrase II. Protons are then transported and released into clear zone by enzyme H+ATPase, while bicarbonate is exchanged for chloride at the basolateral membrane with the help of Cl-/HCO2- exchanger. Chloride is then transported and released into clear zone by chloride channel 7 (Clcn7). The main bone protein is collagen I and it is originally degraded by the enzyme cathepsin K released through ruffled border into the resorption lacunae. Protein degradation products are then endocytosed by ruffled border and transported via cytoplasm to basolateral membrane. On their way they are further degraded by free radicals produced by tartrate-resistant acid phosphatase, which is an osteoclast specific enzyme. From this description it is clear that this new cell is a highly specialized feature and this rises an interesting question of what was the primary reason for development of such a cell in the fish, where bones are not resorbed and colonized by the hematopoiesis. There is no experimental answer to this question yet, but speculation on that subject should concentrate on other requirements for bone resorption that would be of an immediate necessity for the fish. Such other requirement is tooth eruption. Without teeth fish would be unable to eat most of the food available, and to defend itself, so their eruption is of critical importance for survival. With emergence of calcification of bones during their development teeth had it increasingly more difficult to erupt and this required development of mechanism to assist in this process. So the hypothesis based on this speculation is, that the osteoclasts emerged primarily to assist tooth eruption. Bone resorption and remodelling of other bones became important when first amphibians started to leave water, which has essentially changed mechanical requirements for the bones. Bones have to become much more resistant to fractures and also lighter in air conditions than in the water. It is known that the resistance to fractures is not so much dependent of width of the bone as on the number of surfaces that have to be broken. In other words, solid stick (having two surfaces on both sides) is more vulnerable to fracture than tube of the same diameter (having altogether four surfaces). Mouse bones are in fact simple tubes, while bones of larger mammals are composed of many parallel tubes and this makes them capable to resist heavy mechanical stress. It was probably so, that in the first animals leaving water, some osteoclasts began to accidentally appear and act in other bones than the jaws and this made such bones mechanically more resistant. Such animals then gained the evolutionary advantage, because their bones became more resistant to fractures and lighter. Subsequently, hematopoietic stem cells circulating in the peripheral blood

OSTEOPETROSIS

87

discovered new opportunity and begin to settle there creating bone marrow. This way the bone marrow might have developed as an organ. The classical experimental approach to study the mechanisms that govern the development of such a system is to explore naturally occurring disorders, the so called “experiments of nature”, in which there was an interception of such development. In the case of the particular subject of this chapter these would be the disorders in which there was either no formation of the bone marrow cavities and consequently bone marrow or this process was significantly impaired. This has brought me a quarter of century ago to osteopetrosis (Wiktor-Jedrzejczak et al., 1981). At that time already several genes whose mutations produced osteopetrosis have been provisionally identified both in the mouse and the rat as well as in man. At this moment it is necessary to make two important cautions. First, both naturally occurring and artificially produced gene knockouts do not identify the entire spectrum of physiological activity of missed gene product but only those parts of that spectrum that are not duplicated by activity of products of other genes. Secondly, only such naturally occurring knockouts could be identified that are not lethal early in development. In other words, these mutations must affect genes whose knockout is not lethal or such mutations have to only partially abrogate gene function. Osteopetrosis is a disease first described in man in 1904 by German radiologist H. Albers-Schoenberg and called after him Albers-Schoenberg disease (Figure 2). Because of characteristic radiologic appearance it is also called marble bone disease. It is a disease in which bone formation exceeds bone resorption. In vast majority of situations it is the bone resorption that fails but it has to be remembered that the disease could also be produced by overactivity of osteoblasts i.e. bone producing cells. The disease was later identified also in animals including mice and rats and this has allowed various experimental approaches. Four natural mutants originally identified in mice were: microphthalmic or mi/mi, grey-lethal or gl/gl, osteopetrotic or op/op, and osteosclerotic or oc/oc. Four natural mutants identified in rat included again microphthalmic or mib/mib, osteopetrotic or op/op (this is different disease than in the op/op mouse), toothless or tl/tl, and incisor-absent or ia/ia (WiktorJedrzejczak et al., 1981).

88

W. WIKTOR-JEDRZEJCZAK

Figure 2. X-ray of osteopetrotic bone (left) in man.

The most remarkable experiment crucial to the understanding of the disease and of the osteoclast as such was published in 1972 by Donald Walker who has found that osteopetrosis in one of the mouse mutants with that disease: microphthalmic could be cured by parabiosis with normal littermate. Later he has also found that this disease as well as disease in another mouse mutant grey-lethal could be cured by transplantation of hematopoietic cells from normal littermate and transferred to such littermate by transplantation of hematopoietic cells from mutant animals (Walker, 1975a,b). This finding was soon confirmed (Loutit and Sansom, 1976) and has led to the successful application of this treatment modality to human patients (Coccia et al., 1980). From scientific point of view, it has established that the bone resorption is carried out by the progeny of the hematopoietic stem cells, and therefore, that the osteoclast is the progeny of the hematopoietic stem cell. Approach taken to further understanding osteopetrosis was based on knowledge concerning two phenotypically similar murine mutants with macrocytic anemia (Wiktor-Jedrzejczak et al., 1981). These two anemias: one secondary to mutation of the W locus (now known as c-kit) and the other secondary to the mutation of Steel locus (now known as gene for Kit Ligand or Steel Factor) are reciprocally sensitive/resistant to bone marrow transplantation

OSTEOPETROSIS

89

(Russell and Bernstein, 1966). W mutant mice could be cured by transfusion of even single hematopoietic stem cell (Wiktor-Jedrzejczak et al., 1979), while Steel mutant mice are resistant to transplantation of hematopoietic stem cells (McCulloch et al., 1965). Hence, the disease in W mutant mice has served as paradigm of stem cell disorder (McCulloch et al., 1964, Russell and Bernstein, 1968), while the disease in Steel mutant mice has served as paradigm of disorder of hematopoietic microenvironment. Consequently, it has been postulated that osteopetroses could be similarly divided (Wiktor-Jedrzejczak et al., 1981) into those in which the defect is intrinsic to the affected lineage and therefore curable by the infusion of stem cells for that lineage. This would include aforementioned osteopetroses in microphthalmic and grey-lethal mice. Another type would represent osteopetroses in which defect is extrinsic to the affected lineage and resistant to such transplantation. Such osteopetrosis was soon identified in the tl/tl rat (Marks, 1977) and in the op/op mouse (Wiktor-Jedrzejczak et al., 1982). Another possible classification of osteopetroses would include those due to deficient production of osteoclasts related to either intrinsic or extrinsic mechanisms and those, where osteoclasts formed are functionally deficient. According to this classification the osteopetrosis in the op/op mouse would belong to the first category as bones of these mice are devoid of osteoclasts, while osteopetroses in mi/mi and gl/gl mice would belong to the second category as these mice possess osteoclasts that, however, are functionally deficient. From these considerations the osteopetrosis has emerged as extremely interesting model disease. Below, naturally occurring (Table 1) and produced by gene targeting (Table 2) diseases with the common denominator of osteopetrosis would be reviewed in view of their contribution to the understanding the physiology of bone resorption. TABLE 1. Naturally occurring osteopetroses and their genetic background Gene

Protein

Lesion

Rodent disease

Human disease

Other features

Csf1

CSF-1

op allele in the mouse, tl allele in the rat

Osteopetrosis with osteoclast deficiency, failure of tooth eruption,

None known

macrophage deficiencies, fertility defect

Mitf

Microphthalmiaassociated transcription

Mi allele in the

Osteopetrosis with inactive osteoclasts,

Waardenburg syndrome, type 2a, Tietz

microphthalmia albino

W. WIKTOR-JEDRZEJCZAK

90 factor

mouse, Mib allele in the rat

failure of tooth eruption,

syndrome

Ostm 1

Osteopetrosisassociated transmembrane protein 1

gl allele in the mouse,

Osteopetrosis with inactive osteoclasts, failure of tooth eruption

infantile malignant osteopetrosis – rare cases

Chondrodysplasia, abnormal coat color in the mouse, thymic atrophy

Tcirg1 (ATP6i)

A3 subunit of the vacuolar proton ATPase

oc allele in the mouse

Osteopetrosis with increased number of inactive osteoclasts, failure of tooth eruption

Majority of cases of malignant infantile osteopetrosis

Chondrodysplasia, small size, premature death

Tnfrsf11

RANK

Deletion in exon 8

Osteopetrosis without osteoclasts

unknown

Deficiency of lymph nodes, T and B cell deficiency

No osteopetrosis in the mouse Osteopetrosis, failure of tooth eruption

Osteopetrosis

Renal tubular acidosis

Ia allele in the rat Car2

Carbonic anhydrase 2

Clcn7

Chloride channel 7

LDL RP5 gene

LDL RP5

No osteopetrosis in the mouse

Autosomal dominant type 2 osteopetrosis, autosomal recessive osteopetrosis Autosomal dominant type 1 osteopetrosis

OSTEOPETROSIS

91

TABLE 2. Targeted disruption of genes in the mouse producing osteopetrosis Gene

Protein

Bone phenotype

Other features

PU.1

PU.1 transcription factor

Osteopetrosis without osteoclasts

Macrophage deficiency

Csf1r

M-CSF receptor

Osteopetrosis without osteoclasts

Macrophage deficiency, fertility defect

Tnfsf11

RANKL

Osteopetrosis without osteoclasts

Deficiency of lymph nodes, T and B cell deficiency

Tnfrsf11

RANK

Osteopetrosis without osteoclasts

Deficiency of lymph nodes, T and B cell deficiency

Transgene of osteoprotegerin gene

Overexpressed Osteoprotegerin

Osteopetrosis without osteoclasts

Deficiency of lymph nodes, T and B cell deficiency

Traf6

TNF-receptorassociated factor 6

Osteopetrosis with reduced osteoclasts

c-jun

JunB

Osteopetrosis when JunB inactivated selectively in macrophage lineage

Deficiency of lymph nodes, Hipohidrotic ectodermal dysplasia Osteopenia and chronic myeloid leukemia-like disease in totally JunB inactivated mouse

c-fos

c-fos transcription factor

Osteopetrosis with absent osteoclasts

Disturbed B lymphopoiesis

NF-κB 1 and 2 c-src

Src tyrosine kinase

Osteopetrosis Osteopetrosis with defective osteoclasts

β3

β3 integrin

Osteopetrosis developing in adult animals

Disturbed Peyer’s patches Abnormal mammary gland, uterine and ovarian development Glanzmann’s thrombasthenia

Clcn7

Clcn7 chloride channel

Osteopetrosis with impaired osteoclast function

Lysosomal starage disease and neurodegeneration

Cathepsin K

Cathepsin K

Osteopetrosis with morphologically normal osteoclasts that fail to degrade matrix

Abnormal joint morphology

TRAP gene

TRAP

Mild osteopetrosis with dysfunctional osteoclasts

Deficient macrophage function

W. WIKTOR-JEDRZEJCZAK

92 Dap12 gene

DAP12

Mild osteopetrosis with dysfunctional osteoclasts developing in elderly mouse More severe osteopetrosis with earlier development than in DAP12 knockout mouse, tooth eruption

Dap 12 and FcRγ-chain genes

DAP12 and FcRγchain

DC-STAMP

DC-STAMP

Osteopetrosis with inactive mononuclear osteoclasts

LTBP-3

LTBP-3

Osteopetrosis with inactive osteoclasts

Rab3D

Rab3D

Osteopetrosis with inactive osteoclasts

Thalamic hypomyelinosis with synaptic degeneration and immune deficiencies Not characterized

Failure of foreign body giant cell formation

2. Naturally Occurred Osteopetroses and their Genetic Background The elaboration of the sequence of the first gene causing osteopetrosis was made possible after finding that the op/op mouse (Marks and Lane, 1976) has a total deficiency of macrophage growth factor, subsequently identified as CSF-1 or M-CSF (Wiktor-Jedrzejczak et al., 1982, 1990). Then simple sequencing of the CSF-1 gene revealed that in the op/op mouse there is a point mutation shifting the reading frame and producing stop codon further downstream (Yoshida et al., 1990). Since it was found that in the rat toothless mutation produces extremely similar phenotype to the op/op mouse, the tl/tl rat was treated with exogenous CSF-1 and responded extremely well (Marks et al., 1992) similarly as the op/op mouse (Wiktor-Jedrzejczak et al., 1991) it was speculated that it has also a mutation of CSF-1 gene later renamed as Csfm gene. It was later confirmed and it was found that in this rat there is an insertion in the gene also shifting reading frame and producing stop codon (Dobbins et al., 2002, VanWesenbeeck et al., 2002). In both cases, the result of mutation is production of truncated functionally inactive protein product. The hunt for the gene of microphthalmic mouse ended unexpectedly, when the mutant phenotype appeared during experiments concerning vasopressin promoter in transgenic mice (Hodgkinson et al., 1993). Sequencing of the

OSTEOPETROSIS

93

interrupted gene has revealed that it is coding for novel earlier unknown transcription factor helix-loop-helix zipper protein later renamed Mitf (Weilbaecher et al., 2001). Obviously, mutation of the same gene is responsible for osteopetrosis in mib/mib rat (Wojtowicz et al., 1990), although to the best knowledge no sequence of mutated gene for this particular allele was published. The approach to osteosclerotic (Dicke, 1967) mutation was yet different. The location of the gene was originally mapped to chromosome 19 (Marks et al., 1985) and later to a region on that chromosome called pericentromeric region or MMU19. Subsequently, starting from that information it was possible to define the smallest candidate region in area between D19\mit32 and 93 using crosses with Mus spretus. Then a sequence-ready bacterial artificial chromosome contig map of that region was constructed, and best BAC was selected using FISH. Later on, the chosen BAC of the candidate region of the oc/oc was sequenced, and it was found that sequences correspond to the known human osteoclast-specific enzyme. This has allowed to identify 1.6 kb deletion at the translation start site in the gene coding vacuolar proton ATPase subunit. Subsequently, the absence of the enzyme in the apical membranes of osteoclasts, which prevented their bone resorbing function was proven in the oc/oc mouse (Scimeca et al., 2000). The equivalent mutations were at the same time identified in some human cases of osteopetrosis (Frattini et al., 2000, Kornak et al., 2000). This gene (also called TCIRG1 from T-cell immuneregulator-1, OC116 and ATP6i) was later found to be responsible for about 50% of cases of osteopetrosis in man (Balemans et al., 2005). The fourth naturally occurring murine osteopetrosis in grey-lethal mouse (Gruneberg, 1938) was also elaborated using BAC technology (Chalhoub et al., 2003) and it was found that it is produced by a deletion in a gene for newly described 338-amino acid protein named osteopetrosis associated transmembrane protein 1 (Ostm1). Mutations in the same gene have been also identified in some cases of human osteopetrosis (Ramirez et al., 2004, Quarello et al., 2004, Pangrazio et al., 2006). Recently, it was found that Ostm1 serves as a beta-subunit for ClC-7 chloride channel (Lange et al., 2006). Chloride channel itself was earlier found to be necessary for bone resorption and in fact mutations of ClC-7 gene have been found to be responsible for some human cases of osteopetrosis (Kornak et al., 2001, Cleiren et al., 2001). At this time there are still two rodent naturally occurring osteopetroses without defined gene: the one termed ostepetrotic or op/op that is distinct from the mouse op/op, associated with premature thymic atrophy and curable by bone marrow transplantation (Milhaud et al., 1977) and the one produced by mutation of incisor-absent gene also curable by bone marrow transplantation (Marks, 1976). The latter was, however, was recently mapped to chromosome 10q32.1 (VanWesenbeeck et al., 2004), which should help its identification. On

94

W. WIKTOR-JEDRZEJCZAK

the other hand, the op/op rat is in some respect similar to the gl/gl mouse that also develops premature thymic atrophy (Wiktor-Jedrzejczak et al., 1983). Moreover, recently also a natural mutation concerning RANK was identified (Kapur et al., 2004) and was associated with similar phenotype as earlier described osteopetrosis produced by targeted RANK disruption (Li et al., 2000) and discussed later. In man, naturally occurring osteopetroses are classified based on severity and presence of other abnormalities (Balemans et al., 2005). Osteopetroses associated with other severe abnormalities include osteopetrosis associated with renal tubular acidosis which is due to the mutation of gene for carbonic anhydrase type II (Sly et al., 1991), osteopetrosis with infantile neuroaxonal dystrophy, gene for which was not yet identified (Ambler et al., 1983), and osteopetrosis associated with anhydrotic actodermal dysplasia, immunodeficiency and lymphedema, which is secondary to NEMO gene mutation (Smashi et al., 2002, Dupuis-Girod et al., 2002). Osteopetroses being dominant or sole abnormality are classified based on their severity into malignant (lethal in childhood), intermediate, and benign. Malignant osteopetrosis is inherited with at least four different mutant autosomal genes, and it is termed autosomal recessive osteopetrosis or ARO. Three genes have been identified and they include ClC7, OSTM1 and TCIRG1 (Balemans et al., 2005) as already mentioned. In intermediate type osteopetrosis, which is not lethal but associated with spontaneous fractures and short stature a mutation of ClC7 was implicated (Campos-Xavier et al., 2003). This is different mutation that the one causing ARO. Finally, there are at least three types of benign osteopetrosis in man. These disorders are frequently asymptomatic, diagnosed by X-ray performed because of other reasons and are inherited with dominant mutations of autosomal genes. Two such genes have been so far identified. One is again ClC7 (Cleiren et al., 2001), the other being LRP5 (Little et al., 2002). This latter disease is a completely different disease of all others as it is not a disease of osteoclast but rather disease of hyperactive osteoblast. Moreover, the mutation is not producing loss of function as majority of previously mentioned mutations but it is gain of function mutation (VanWesenbeck et al., 2003). However, more recent studies (Glass et al., 2005) may suggest that this overexpressed molecule may promote ability of differentiated osteoblasts to inhibit osteoclast differentiation, inducing osteopetrosis primarily not by stimulating bone formation by inhibiting bone resorption. 3. Osteopetroses Induced by Gene Targeting The first gene whose targeted disruption unexpectedly produced osteopetrosis was c-src (Soriano et al., 1991). c-src codes for cytoplasmic tyrosine kinase

OSTEOPETROSIS

95

important in signal transduction from cell surface to the nucleus. The next one was c-fos (Grigoriadis et al., 1994). c-fos codes for transcription factor implicated in transcription of many genes controlling cell proliferation. Moreover, there is another transcription factor closely related to c-fos, namely c-jun. Targeted disruption of that factor gene leads to osteopetrosis only, when it is limited to the macrophage lineage (Clausen et al., 1999). Mice with c-jun knockout in germ line (and subsequently in other derived lineages) die in utero and cannot be evaluated for osteopetrosis. Other transcription factor genes whose disruption resulted in osteopetrosis included PU.1 and NF-κB 1 and 2 (Tondravi et al., 1997, Iotsova et al., 1997). As mentioned in the introduction disruption of c-kit (or Steel Factor receptor) in W mutant mouse and disruption of gene for Steel Factor in Steel mutant mouse produce very similar phenotype of macrocytic anemia. Since in the op/op mouse the osteopetrosis is due to the naturally occurring disruption of a gene for CSF-1 one would speculate that targeted disruption of the receptor for CSF-1 i.e. c-fms would also produce osteopetrosis. This in fact is the case (Dai et al., 2003, Li et al., 2006). Spontaneous knockouts of CSF-1 gene, Mitf gene and targeted disruption of PU.1 and CSF-1R genes could be grouped together as they most probably affect the same regulatory pathway of osteoclasts i.e. the CSF-1 pathway. This pathway begins with CSF-1 and goes through its receptor and then through both PU.1 and Mitf transcription factors (Weilbaecher et al., 2001). Another cytokine pathways besides CSF-1 seem also to control the osteoclast development. This is receptor activating NF-κB (RANK) and its ligand RANKL. In that axis there is also another receptor called osteoprotegerin, which is a soluble decoy receptor that competes with RANK for RANKL (Kong et al., 2003). Both targeted disruption of RANK and RANKL produce osteopetrosis (Li et al., 2000, Ongren et al., 2003). With osteoprotegerin the situation is different. It is not the gene knockout but overexpression due to transgene that produces osteopetrosis (Simonet et al., 1997). This is because overexpressed osteoprotegerin binds RANKL and prevents its binding to RANK. The RANKL/RANK axis transduces its signal through tumor necrosis associated factor 6 or TRAF-6 and knockout of this gene as expected is producing osteopetrosis (Naito et al., 1999). TRAF-6 is an adapter protein and intermediates between several cytokine receptors and transcription factors. These transcription factors include AP-1 transcription factors such as c-fos and c-jun and both NF-κB subunits. As it was already mentioned, knockouts of these genes produce osteopetrosis (Grigoriadis et al., 1994, Iotsova et al., 1997). However, it is important to mention that disruption of a single NF-κB subunit is not sufficient to induce ostepetrosis and in other words it is not sufficient to critically compromise the osteoclast formation. For this effect simultaneous

96

W. WIKTOR-JEDRZEJCZAK

knockout of both subunits is required (Iotsova et al., 1997). Furthermore, c-src product is a protein downstream of TRAF-6 in the same pathway. The fact that both interception of AP-1 factors and NF-κB factors produces osteopetrosis suggests that they control transcription of different genes critical for bone resorption.. Moreover, there is a possibility, that formation of osteoclasts is regulated by yet another cytokine axis. There was a suggestion that adapter protein DAP12 may affect osteoclast differentiation (Paloneva et al., 2000). DAP12 is adapter protein playing a role in immunoreceptor tyrosine-based activation motif (ITAM) mediated signaling. But DAP12 knockout mice develop mild osteopetrosis only when becoming older and possess normal number of osteoclasts with reduced function (Kaifu et al., 2003). There is one more adapter protein playing similar role: Fc receptor γ-chain (FcRγ). Mice that have double knockout DAP12 and FcRγ are osteopetrotic and are devoid of multinucleated osteoclasts (Mocsai et al., 2004). Interestingly, these mice demonstrate tooth eruption in contrast to majority of other osteopetrotic mutants. There are also some clues regarding the intermediary of DAP12/FcRγ regulation. They seem to act through Syk tyrosine kinase and later on by modulating integrin expression (Mocsai et al., 2004). For the formation of osteoclast from precursor circulating in the peripheral blood it is necessary to attach to the bone, and then to fuse with other similarly attached precursors to form multinucleated cell. As it has been mentioned, the primary adhesion molecule of osteoclasts is αvβ3 integrin. In confirmation of that concept, the interception of a gene for β3 integrin leads to osteopetrosis (McHugh et al., 2000). Then molecule was identified by DNA subtraction screen between multinuclear osteoclasts and mononuclear macrophages. This molecule was called dendritic cell specific transmembrane protein (DCSTAMP) appeared to control formation of multinuclear cells. Again, DCSTAMP deficient mice have completely abrogated osteoclast cell fusion and develop osteopetrosis (Yagi et al., 2005) . Moreover, as expected disruption of genes coding for enzymes critical to the function of osteoclast such as tartrate-resistant acid phosphatase (Hayman et al., 1996) and cathepsin K (Gowen et al., 1999) also produced osteopetrosis. This complements earlier discussed spontaneous osteopetrotic phenotypes produced by interception of pathways generating either protons or chloride necessary for mineral dissolution. Consequently, it is possible to draw on the basis of analysis of osteopetrotic models mentioned so far a scheme of genetic regulation of osteoclast formation, activation, and final function (Figure 3). Still relatively less is known how various intercepted genes interact with each other, in other words, how CSF-1 pathway interacts with RANKL pathway and with regulation of

OSTEOPETROSIS

97

osteoclast function. However, PU.1 regulates transcription of both CSF-1R and RANK (Kwon et al., 2005). Another example of such approach is a study showing that CSF-1 induce osteoclast spreading through αvβ3 integrin and c-src product (Teti et al., 1998). RANK RANKL NF-κB TRAF-6 c-fos

CSF-1 CSF-1R PU.1

Macrophage and osteoclast progenitor

Osteoclast precursor

CAII TCIRG1 CLCN7 OSTM1 c-src

Osteoclast

Bone resorption

Figure 3. Location of action of some genes that when intercepted cause osteopetrosis.

While the role of each of these aforementioned genes appears so important that disruption is producing osteopetrotic phenotype it is also necessary to mention that in majority of situations the defect is not complete and some function is present. This could either happen because the particular mutation only partially abrogates the function of given gene or because its function could be substituted for by some other gene product. While osteopetrotic phenotype is present because the alternative mechanism even if present is not efficient enough it has to be mentioned that these alternative mechanisms seem to develop and are present. Moreover, they may have practical usefulness as their upregulation through therapeutic intervention may reduce severity of osteopetrotic disease. However, there are osteopetrotic phenotypes produced by targeted disrupttion of genes that are yet not completely understood in terms of what is the physiological role of missed gene product in osteoclast function. Moreover, these genes could not be yet easily incorporated into the scheme of osteoclast formation and function. They include disease produced by knockout of latent TGF-beta binding protein (LTBP) 3 in mice (Dabovic et al., 2005). LTBPs are proteins of extracellular matrix that are responsible for binding latent TGF-beta and modulate tissue levels of this cytokine. LTBP 3 knockout mice possess normal numbers of osteoclasts, so this defect affect rather function than formation of this cells. Another novel osteopetrotic phenotype is the one produced by targeted disruption of Rab3 gene (Pavlos et al., 2005). Rab3 proteins belong to the family of GTPases, participating in exocytosis and Rab3D is expressed in osteoclasts. Finding that Rab3D knockout produces osteopetrosis suggests that formation of lysosomal vesicles is also critical in

98

W. WIKTOR-JEDRZEJCZAK

bone resorption. Furthermore, knockout of RAGE (receptor for advanced glycation end products), which is a member of immunoglobulin family also produces osteopetrosis by compromising osteoclast function (Zhou et al., 2006). The physiological role for RAGE is still obscure, so it is impossible to associate this defect with earlier identified function. Completely different mechanism has osteopetrosis induced by neonatal injection of some viruses belonging to murine leukemia virus category. One such virus termed SL3-3 of the Akv family is carrying transcriptional enhancer of sites for nuclear factor 1 and this virus has strong osteopetrosis inducing capacity in addition to ability to induce lymphoma (Ethelberg et al., 1999). This osteopetrosis is thought to be due to increased activity of osteoblasts, but in fact the original publication does not include evaluation of osteoclasts in infected mice. Therefore, it is possible that it also affects these latter cells. 4. Concluding Remarks

Studies of osteopetrotic models have helped so far to identify more than 30 genes that are so important for bone resorption that their disruption produces diseased phenotype. This makes the genetic regulation of osteoclast formation and function probably the best understood of all hematopoietic lineages. Furthermore, there are genes whose knockout produce phenotype lethal in fetal life, but which may also compromise the osteoclast and bone resorption. Moreover, to these genes probably some other could be added including genes that code for proteins used in some therapeutic approaches. The products of these genes clearly influence the bone resorption even if their abrogation does not produce osteopetrosis. Acknowledgements

This work was supported by a grant from Foundation for Polish Medicine and Pharmacy to W. W-J.

References Ambler, M.W., Trice, J., Grauerholz, J., and O’Shea, P.A. (1983) The Association of Infantile Osteopetrosis and Neuronal Storage Disease. Neurology 33, 437-441. Balemans, W., Van Wesenbeeck, L., and VanHul, W. (2005) A Clinical and Molecular Overview of the Human Osteopetroses. Calcified Tissue International 77, 263-274. Campos-Xavier, A.B., Saraiva, J.M., Ribeiro, L.M., Munnich, A., and Cormier-Daire, V. (2003) Chloride Channel 7 (ClCN7) Gene Mutations in Intermediate Autosomal Recessive Osteopetrosis. Human Genetics 112, 186-189.

OSTEOPETROSIS

99

Chalhoub, N., Benachenhou, N., Rajapurohitam, V., Pata, M., Ferron, M., Frattini, A., Villa, A., and Vacher, J. (2003) Grey-lethal Mutation Induces Severe Malignant Autosomal Recessive Osteopetrosis in Mouse and Human. Nature Medicine 9, 399-406. Cleiren, E., Benichou, O., VanHul, E., Gram, J., Bollerslev, J., Singer, F.R., Beaverson, K., Aledo, A., Whyte, M.P., Yoneyama, T., deVernejoul, M.C., and VanHul, W. (2001) AlbersSchonberg Disease (Autosomal Dominant Osteopetrosis type II) Results from Mutations in the ClCN7 Chloride Channel Gene. Human and Molecular Genetics 10, 2861-2867. Clausen, B.E., Burkhardt, C., Reith, W., Renkawitz, R., and Forster, I. (1999) Conditional Gene Targeting in Macrophages and Granulocytes using LysMcre Mice. Transgenic Research 8, 265-277. Coccia, P.F., Krivit, W., Cervenka, J., Clawson, C., Kersey, J.H., Kim, T.H., Nesbit, M.E., Ramsay, N.K., Warkentin, P.I., Teitelbaum, S.L., Kahn, A.J., and Brown, D.M. (1980) Successful Bone Marrow Transplantation for Infantile Malignant Osteopetrosis. New England Journal of Medicine 302, 701-8. Dabovic, B., Levasseur, R., Zambuto, L., Chen, Y., Karsenty, G., and Rifkin, D.B. (2005) Osteopetrosis-like Phenotype in Latent TGF-beta Binding Protein 3 Deficient Mice. Bone 37, 25-31. Dai, X.M., Ryan, G.R., Hapel, A.J., Dominguez, M.G., Russell, R.G., Kapp, S., Sylvestre, V., and Stanley, E.R. (2002) Targeted Disruption of the Mouse Colony-Stimulating Factor 1 Receptor Gene Results in Osteopetrosis, Mononuclear Phagocyte Deficiency, Increased Primitive Progenitor Cell Frequencies, and Reproductive Defects. Blood 99, 111-20. Dicke, M.M. (1967) Mouse News Letter 36, 39. Dobbins, D.E., Sood, R., Hashiramoto, A., Hansen, C.T., Wilder, R.L., and Remmers E.F. (2002) Mutation of Macrophage Colony Stimulating Factor (Csf1) Causes Osteopetrosis in the tl Rat. Biochemical Biophysical Research Communications 294, 1114-20. Dupuis-Girod, S., Corradini, N., Hadj-Rabia, S., Fournet, J.C., Faivre, L., LeDeist, F., Durnad, P., Doffinger, R., Snahi, A., Israel, A., Courtois, G., Brousse, N., Blanche, S., Munnich, A., Fischer, A., Casanova, J.L., and Bodemer, C. (2002) Osteopetrosis, Lymphedema, Anhidrotic Dysplasia and Immunodeficiency in a Boy and Incontinentia Pigmenti in his Mother. Pediatrics 109: e97. Ethelberg, S., Tzchaschel, B.D., Luz, A., Diaz-Cano, S.J., Pedersen, F.S., and Schmidt, J. (1999) Increased Induction of Osteopetrosis, but Unaltered Lymphomagenicity, by Murine Leukemia Virus SL3-3 after Mutation of a Nuclear Factor 1 Site in the Enhancer. Journal of Virology 73, 10406-10415. Frattini, A., Orchard, P.J., Sobacchi, C., Giliani, S., Abinun, M., Mattsson, J.P., Keeling, D.J., Andrsson, A.K., Wallbrandt, P., Zecca, L., Notarangelo, L.D., Vezzoni, P., and Villa, A. (2000) Defects of TCIRG1 Subunit of the Vacuolar Proton Pump are Responsible for a Subset of Human Autosomal Recessive Osteopetrosis. Nature Genetics 25, 343-346. Glass, D.A. 2nd, Bialek, P., Ahn, J.D., Starbuck, M., Patel, M.S., Clevers, H., Taketo, M.M., Long, F., McMahon, A.P., Lang, R.A., and Karsenty, G. (2005) Canonical Wnt Signaling in Differentiated Osteoblasts Controls Osteoclast Differentiation. Development and Cell 8, 751764. Glowacki, J., Cox, K.A., O’Sullivan, J., Wilkie, D., and Deftos, L.J. (1986) Osteoclasts can be Induced in Fish Having an Acellular Bony Skeleton. Proceedings of the National Academy of Sciences of the USA 83, 4104-4107. Gowen, M., Lazner, F., Dodds, R., Kapadia, R., Felid, J., Tavaria, M., Bertoncello, I., Drake, F., Zavarselk, S., Tillis, I., Hertzog, P., Debouck, C., and Kola, I. (1999) Cathepsin K Knockout Mice Develop Osteopetrosis Due to a Deficit in Matrix Degradation but not Demineralization. Journal of Bone and Mineral Research 14, 1654-63.

100

W. WIKTOR-JEDRZEJCZAK

Gruneberg, H. (1938) Some new data on the grey-lethal mouse. Journal of Genetics 36, 153-173. Hayman, A.R., and Cox, T.M. (2003) Tartrate-Resistant Acid Phosphatase Knockout Mice. Journal of Bone and Mineral Research 18, 1905-1907. Hodgkinson, C.A., Moore, K.J., Nakayama, A., Steingrimsson, E., Copeland, N.G., Jenkins, N.A., and Arnheiter, H. (1993) Mutations at the Mouse Microphthalmia Locus Are Associated with Defects in a Gene Encoding a Novel Basic-Helix-Loop-Helix-Zipper Protein. Cell 74, 395-404. Iotsova, V., Caamano, J., Loy, J., Yang, Y., Lewin, A., and Bravo, R. (1997) Osteopetrosis in Mice Lacking NF-kappaB1 and NF-kappaB2. Nature Medicine 3, 1285-9. Kaifu, T., Nakahara, J., Inui, M., Mishima, K., Momiyama, T., Kaji, M., Sugahara, A., Koito, H., Ujike-Asai, A., Nakamura, A., Kanazawa, K., Tan-Takeuchi, K., Iwaszki, K., Yokoyama, W.M., Kudo, A., Fujiwara, M., Asou, H., and Takai, T. (2003) Osteopetrosis and Thalamic Hypomyelinosis with Synaptic Degeneration in DAP12-Deficient Mice. Journal of Clinical Investigation 111, 323-332. Kapur, R.P., Yao, Z., Iida, M.H., Clarke, C.M., Doggett, B., Xing, L., and Boyce, B.F. (2004) Malignant Autosomal Recessive Osteopetrosis Caused by Spontaneous Mutation of Murine Rank. Journal of Bone and Mineral Research 19, 1689-97. Kasper, D., Planells-Cases, R., Fuhrmann, J.C., Scheel, O., Zeitz, O., Ruether, K., Schmitt, A., Poet, M., Steinfeld, R., Schweizer, M., Kornak, U., and Jentsch, T.J. (2005) Loss of the Cloride Channel ClC-7 Leads to Lysosomal Storage Disease and Neurodegeneration. EMBO Journal 24, 1079-1091. Kenner, L., Hoebertz, A., Beil, T., Keon, N., Karreth, F., Eferl, R., Scheuch, H., Szremska, A., Amling, M., Schorpp-Kistner, M., Angel, P., and Wagner, E.F. (2004) Mice Lacking JunB Are Osteopenic Due to Cell-Autonomous Osteoblast and Osteoclast Defects. Journal of Cell Biology 164, 613-623. Kim, N., Odgren, P.R., Kim, D-K., Marks, S.C. Jr, and Choi, Y. (2000) Diverse Roles of the Tumor Necrosis Factor Family Member TRANCE in Skeletal Physiology Revealed by TRANCE Deficiency and Partial Rescue by a Lymphocyte-Expressed TRANCE Transgene. Proceedings of the National Academy of Sciences of the USA 97, 10905-10910. Kong, Y.Y., Yoshida, H., Sarosi, I., Tan, H.L., Timms, E., Capparelli, C., Morony, S., Oliveirados-Santos, A.J., Van, G., Itie, A., Khoo, W., Wakeham, A., Dunstan, C.R., Lacey, D.L., Mak, T.W., Boyle, W.J., and Penninger, J.M. (1999) OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397, 315-323. Kornak, U., Kasper, D., Bosl, M.R., Kaiser, E., Schweizer, M., Schulz, A., Friedrich, W., Delling, G., and Jentsch, T.J. (2001) Loss of the ClC-7 Chloride Channel Leads to Osteopetrosis in Mice and Man. Cell 104, 205-215. Kwon, O.H., Lee, C.K., Lee, Y.I., Paik, S.G., and Lee, H.J. (2005) The Hematopietic Transcription Factor PU.1 Regulates RANK Gene Expression in Myeloid Progenitors. Biochememical and Biophysical Research Communications 335, 437-446. Lange, P.F., Wartosch, L., Jentsch, T.J., and Fuhrmann, J.C. (2006) ClC-7 Requires Ostm1 as a β-Subunit to Support Bone Resorption and Lysosomal Function. Nature 440, 220-223. Li, J., Chen, K., Zhu, L., and Pollard, J.W. (2006) Conditional Deletion of the Colony Stimulating Factor-1 Receptor (c-fms Protooncogene) in Mice. Genesis 44, 328-335. Li, J., Sarosi, I., Yan, X.Q., Morony, S., Capparelli, C., Tan, H.L., McCabe, S., Elliott, R., Scully, S., Van, G., Kaufman, S., Juan, S.C., Sun, Y., Tarpley, J., Martin, L., Christensen, K., McCabe, J., Kostenuik, P., Hsu, H., Fletcher, F., Dunstan, C.R., Lacey, D.L., and Boyle, W.J. (2000) RANK is the Intrinsic Hematopoietic Cell Surface Receptor that Controls

OSTEOPETROSIS

101

Osteoclastogenesis and Regulation of Bone Mass and Calcium Metabolism. Proceedings of the National Academy of Sciences of the USA 97, 1566-71. Little, R.D., Carulli, J.P., DelMastro, R.G., Dupuis, J., Osborne, M., Folz, C., Manning, S.P., Swain, P.M., Zhao, S.C., Eustace, B., Lappe, M.M., Spitzer, L., Zweier, S., Braunschweiger, K., Benchekroun, Y., Hu, X., Adair, R., Chee, L., Fitzgerald, M.G., Tulig, C., Caruso, A., Tzellas, N., Bawa, A., Frankin, B., McGuire, S., Nogues, X., Gong, G., Allen, K.M., Anisowicz, A., Morales, A.J., Lomedico, P.T., Recker, S.M., VanEerdewegh, P., Recker, R.R., and Johnson, M.L. (2002) A Mutation in the LDL Receptor-Related Protein 5 Gene Results in the Autosomal Dominant High-Bone-Mass Trait. American Journal of Human Genetics 70, 11-19. Loutit, J.F., and Sansom, J.M. (1976) Osteopetrosis in microphthalmic mice. A defect of the hematopoietic stem cell. Calcified Tissue Research 20, 251-259. Marks, S.C. Jr. (1976) Osteopetrosis in the ia rat cured by spleen cells from a normal littermate. American Journal of Anatomy 146, 331-338 Marks, S.C. Jr. (1977) Osteopetrosis in the toothless (tl) rat: Presence of osteoclasts but failure to respond to parathyroid extract or to be cured by infusion of spleen or bone marrow cells from normal littermates. American Journal of Anatomy 149, 289-297. Marks S.C. Jr., and Lane, P.W. (1976) Osteopetrosis, a new recessive skeletal mutation on chromosome 12 in the mouse. Journal of Heredity 67, 11-18. Marks, S.C. Jr., Wojtowicz, A., Szperl, M., Urbanowska, E., Mackay, C.A., Wiktor-Jedrzejczak, W., Stanley, E.R., and Aukerman, S.L.: (1992) Administration of Colony Stimulating Factor1 Corrects Some Macrophage, Dental, and Skeletal Defects in an Osteopetrotic Mutation (toothless, tl) in the Rat. Bone 13, 89-93. Marks, S.C. Jr., Seifert, M.F., and Lane, P.W. (1985) Osteosclerosis, a Recessive Skeletal Mutation on Chromosome 19 in the Mouse. Journal of Heredity 76, 171-176. McCulloch, E.A., Siminovitch, L., and Till, J.E. (1964) Spleen-colony formation in anemic mice of genotype W/Wv. Science 144, 844-846. McCulloch, E.A., Siminovitch, L., Till, J.E., Russell, E.S., and Bernstein, S.E. (1965) The cellular basis of the genetically determined Hemopoietic defect in anemic mice of genotype Sl/Sld. Blood 26, 399-410. McHugh, K.P., Hodivala-Dilke, K., Zheng, M-H., Namba, N., Lam, J., Novack, D., Feng, X., Ross, F.P., Hynes, R.O., and Teitelbaum, S.L. (2000) Mice Lacking β3 Integrins Are Osteosclerotic because of Dysfunctional Osteoclasts. Journal of Clinical Investigation 105, 433-440. Milhaud, G., Labat, N.L., Parant, M., Damais, C., and Chedid, L. (1977) Immunological defect and its correction in the osteopetrotic mutant rat. Proceedings of the National Academy of Sciences of the USA 74, 339-342. Mocsai, A., Humphrey, M.B., VanZiffle, J.A.G., Hu, Y., Burghardt, A., Spusta, S.C., Majudmar, S., Lanier, L.L., Lowell, C.A., and Nakamura, M.C. (2004) The Immunomodulatory Adapter Proteins DAP12 and Fc Receptor γ-Chain (FcRγ) Regulate Development of Functional Osteoclasts through the Syk Tyrosine Kinase. Proceedings of the National Academy of Sciences of the USA 101, 6158-6163. Naito, A., Azuma, S., Tanaka, S., Miyazaki, T., Takaki, S., Takatsu, K., Nakao, K., Nakamura, K., Katsuki, M., Yamamoto, T., and Inoue, J. (1999) Severe Osteopetrosis, Defective Interleukin-1 Signalling and Lymph Node Organogenesis in TRAF6-Deficient Mice. Genes and Cells 4, 353-362. Naito, A., Yoshida, H., Nishioka, E., Satoh, M., Azuma, S., Yamamoto, T., Nishikawa, S-I., and Inoue, J-I. (2002) TRAF6-Deficient Mice Display Hypohidrotic Ectodermal Dysplasia. Proceedings of the National Academy of Sciences of the USA 99, 8766-8771.

102

W. WIKTOR-JEDRZEJCZAK

Odgren, P.R., Kim, N., McKay, C.A., Mason-Savas, A., Choi, Y., Marks, S.C. Jr. (2003) The Role of RANKL (TRANCE/TNFSF11), a Tumor Necrosis Factor Family Member, in Skeletal Development: Effects of Gene Knockout and Transgenic Rescue. Connective Tissue Research 44 Suppl 1, 264-271. Paloneva, J., Kestila, M., Wu, J., Salminen, A., Bohling, T., Ruotsalainen, V., Hakola, P., Bakker, A.B., Phillips, J.H., Pekkarinen, P., Lanier, L.L., Timonen, T., and Peltonen, L. (2000) Lossof-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts. Nature Genetics 25, 357-361. Pangrazio, A., Poliani, P.L., Megarbane, A., Lefranc, G., Lanino, E., DiRocco, M., Rucci, F., Lucchini, F., Ravanini, M., Facchetti, F., Abinum, M., Vezzoni, P., Villa, A., and Frattini, A. (2006) Mutations in OSTM1 (grey-lethal) Define a Particularly Severe Form of Autosomal Recessive Osteopetrosis with Neural Involvement. Journal of Bone and Mineral Research 21, 1098-1105. Pavlov, N.J., Xu, J., Riedel, D., Yeoh, J.S., Teitelbaum, S.L., Papadimitriou, J.M., Jahn, R., Ross, F.P., and Zheng, M.H. (2005) Rab3D Regulates a Novel Vesicular Trafficking Pathway That Is Required for Osteoclastic Bone Resorption. Molecular Cell Biology 25, 5253-5269. Quarello, P., Forni, M., Barberis, L., Defilippi, C., Campagnolo, M.F., Silvestro, L., Frattini, A., Chalhoub, N., Vacher, J., and Ramenghi, U. (2004) Severe Malignant Osteopetrosis Caused by a GL Gene Mutation. Journal of Bone and Mineral Research 14, 2107-2117. Ramirez, A., Faupel, J., Goebel, I., Stiller, A., Beyer, S., Stockle, C., Hasan, C., Bode, U., Kornak, U., and Kubisch, C. (2004) Identification of a Novel Mutation in the Coding Region of the Grey-Lethal Gene OSTM1 in Human Malignant Infantile Osteopetrosis. Human Mutations 23, 471-476. Scimeca, J.C., Franchi, A., Trojani, C., Parrinello, H., Grosgeorge, J., Robert, C., Jaillon, O., Poirier, C., Gaudray, P., and Carle, G.F. (2000) The Gene Encoding the Mouse Homologue of the Specific 116-kDa V-ATPase Subunit Bears a Deletion in Osteosclerotic (oc/oc) Mutants. Bone 26, 207-13. Simonet, W.S., Lacey, D.I., Dunstan, C.R., Kelley, M., Chang, M.S., Luthy, R., Nguyen, H.Q., Wooden, S., Bennett, L., Boone, T., Shimamoto, G., DeRose, M., Elliott, R., Colombero, A., Tan, H.L., Sullivan, J., Davy, E., Bucay, N., Renshaw-Gegg, L., Hughes, T.M., Hill, D., Pattison, W., Cambell, P., Sander, S., Van, G., Tarpley, J., Derby, P., Lee, R., and Boyle, W.J. (1997) Osteoprotegerin: a Novel Secreted Protein Involved in the Regulation of Bone Density. Cell 89, 309-319. Sly, W.S., Sato, S., and Zhu, X.L. (1991) Evaluation of Carbonic Anhydrase Isoenzymes in Disorders Involving Osteopetrosis and/or Renal Tubular Acidosis. Clinical Biochemistry 24, 311-318. Smashi, A., Courtois, G., Rabia, S.H., Doffinger, R., Bodemer, C., Munnich, A., Casanova, J.L., and Israel, A. (2002) The NF-kappaB Signaling Pathway in Human Diseases: from Incontinentia Pigmenti to Ectodermal Dysplasias and Immune-Deficiency Syndromes. Human and Molecular Genetics 11, 2371-2375. Soriano, P., Montgomery, C., Geske, R., and Bradley, A. (1991) Targeted Disruption of the s-src Proto-Oncogene Produces Osteopetrosis in Mice. Cell 64, 693-702. Teti, A., Taranta, A., Migliaccio, S., Degiorgi, A., Santandrea, E., Vilanova, I., Faraggiana, T., Chellaiah M., and Hruska, K.A. (1998) Colony Stimulating Factor-1-Induced Osteoclast Spreading Depends on Substrate and Requires the Vitronectin Receptor and the c-src ProtoOncogene. Journal of Bone and Mineral Research 13, 50-58. Tondravi, M.M., McKercher, S.R., Anderson, K., Erdmann, J.M., Quiroz, M., Maki, R., and Teitelbaum, S.L. (1997) Osteopetrosis in Mice Lacking Haematopoietic Transcription Factor PU.1. Nature 386, 81-4.

OSTEOPETROSIS

103

VanWesenbeeck, L., Cleiren, E., Gram, J., Beals, R.K., Benichou, O., Scopelliti, D., Key, L., Renton, T., Bartels, C., Gong, Y., Warman, M.L., DeVernejoul, M-C., Bollerslev, J., and VanHul, W. (2003) Six Novel Missense Mutations in the LDL Receptor-Related Protein 5 (LRP5) Gene in Different Conditions with an Increased Bone Density. American Journal of Human Genetics 72, 763-771. VanWesenbeeck, L., Odgren, P.R., MacKay, C.A., D’Angelo, M., Safadi, F.F., Popoff, S.N., VanHul, W., and Marks, S.C. Jr (2002) The Osteopetrotic Mutation Toothless (tl) is a Lossof-Function Frameshift Mutation in the Rat Csf1 Gene: Evidence for Crucial Role for CSF-1 in Osteoclastogenesis and Endochondral Ossification. Proceedings of the National Academy of Sciences of the USA 99, 14303-14308. VanWesenbeeck, L., Odgren, P.R., MacKay, C.A., and VanHul, W. (2004) Localization of the Gene Causing the Osteopetrotic Phenotype in the Incisors Absent (ia) Rat on Chromosome 10q32.1. Journal of Bone and Mineral Research 19, 183-189. Walker, D.G. (1972) Congenital Osteopetrosis in Mice Cured by Parabiotic Union with Normal Siblings. Endocrinology 91, 916-20. Walker, D.G. (1975) Bone Resorption Restored in Osteopetrotic Mice by Transplants of Normal Bone Marrow and Spleen Cells. Science 190, 784-785. Walker, D.G. (1975) Spleen Cells Transmit Osteopetrosis in Mice. Science 190, 785-7. Wiktor-Jedrzejczak, W., Ahmed, A., Szczylik, C., and Skelly R.R. (1982) Hematological Characterization of Congenital Osteopetrosis in op/op Mouse. Possible Mechanism for Abnormal Macrophage Differentiation. Journal of Experimental Medicine 156, 1516-1527. Wiktor-Jedrzejczak, W., Bartocci, A., Ferrante, A.W. Jr, Ahmed-Ansari, A., Sell, K.W., Pollard, J.W., Stanley, E.R. (1990) Total Absence of Colony Stimulating Factor-1 in the MacrophageDeficient Osteopetrotic (op/op) Mouse. Proceedings of the National Academy of Sciences of the USA 87, 4828-4832. Wiktor-Jedrzejczak, W., Grzybowski, J., Ahmed, A., and Kaczmarek, L. (1983) Osteopetrosis associated with premature thymic involution in grey-lethal mice. In vitro studies of thymic microenvironment. Clinical Experimental Immunology 52, 465-471. Wiktor-Jedrzejczak, W., Skelly, R.R., and Ahmed, A. (1981) Hematopoietic Stem Cell Differentiation and Its Role in Osteopetrosis. Immunologic Implications. In M.E. Gershwin and B. Merchant (eds.), Immunologic Defects in Laboratory Animals. Plenum Press, New York, vol. 1, pp. 51-77. Wiktor-Jedrzejczak, W., Szczylik, C., Gornas, P., Sharkis, S.J., Ahmed, A. (1979) Different Marrow Cell Numbers Requirements for the Haematopoietic Colony Formation and the Cure of the W/Wv Anemia. Experientia 35, 546-547. Wiktor-Jedrzejczak, W., Urbanowska, E., Aukerman, S.L., Pollard, J.W., Stanley, E.R., Ralph, P., Ansari, A.A., Sell, K.W., and Szperl, M. (1991): Correction by CSF-1 of Defects in the Osteopetrotic op/op Mouse Suggests Local, Developmental, and Humoral Requirements for this Growth Factor. Experimental Hematology 19, 1049-1054. Witten, P.E., Hansen, A., Hall, B.K. (2001) Features of Mono- and Multinucleated Bone Resorbing Cells of the Zebrafish Danio Rerio and Their Contribution to Skeletal Development, Remodeling and Growth. Journal of Morhology 250, 197-207. Wojtowicz, A., Moutier, R., Grzesik, W., Dziedzic-Gocławska, A., Lamendin, H., Ostrowski, K. (1990) Early and Transient Osteopetrosis in Microphthalmic MIB-Rats. Archivio Italiano di Anatomia e di Embriologia 95, 209-221. Yagi, M., Miyamoto, T., Sawatani, Y., Iwamoto, K., Hosogane, N., Fujita, N., Morita, K., Ninomiya, K., Suzuki, T., Miyamoto, K., Oike, Y., Takeya, M., Toyama, Y., and Suda, T. (2005) DC-STAMP is Essential for Cell-Cell Fusion in Osteoclasts and Foreign Body Giant Cells. Journal of Experimental Medicine 202, 345-351.

104

W. WIKTOR-JEDRZEJCZAK

Yoshida, H., Hayashi, S., Kunisada, T., Ogawa, M., Nishikawa, S., Okamura, H., Sudo, T., Schultz, L.D., and Nishikawa, S., (1990) The Murine Mutation Osteopetrosis is in the Coding Region of the Macrophage Colony Stimulating Factor Gene. Nature 345, 442-4. Zhou, Z., Immel, D., Xi, C.X., Bierhaus, A., Feng, X., Mei, L., Nawroth, P., Stern, D.M., and Xiong, W.C. (2006) Regulation of Osteoclast Function and Bone Mass by RAGE. Journal of Experimental Medicine 203, 1067-1080.

NON-HEMATOPOIETIC BONE MARROW CELLS FOR REGENERATIVE MEDICINE CLAUDIA LANGE1*, FLORIAN TÖGEL2, KAI JAQUET3, HARALD ITTRICH4, CHRISTOPH WESTENFELDER2, AXEL ZANDER1 1 University Hospital Hamburg-Eppendorf, Department of Bone Marrow Transplantation, Hamburg, Germany 2 University of Utah, Department of Medicine, Division of Nephrology, Salt Lake City, Utah, USA 3 St. Georg Hospital Hamburg, Department of Cardiology/Cell Biology, Hamburg, Germany 4 University Hospital Hamburg-Eppendorf, Department of Radiology, Germany Keywords: myocardial infarction; acute kidney injury; cell therapy; adult stem cells

Abstract. Novel therapies for the treatment of heart and kidney diseases are urgently needed. Because bone marrow derived cells have shown tremendous promise we utilized common animal models for myocardial infarction (MI) and acute kidney injury (AKI) to test the potential of mesenchymal stem cells (MSC) as a tool for organ regeneration. Cell tracking was accomplished in vivo with MRI after iron loading of MSC and postmortem by EGFP or Y-PCR. MSC did ameliorate tissue injury and enhance recovery in both models. MSC treated rats with MI showed a decreased infarct area and thickened myocardium compared to controls, however, no significant amounts of cells could be found in hearts of treated animals after 10 weeks of observation. Rats with AKI had improved recovery of renal function as determined by serum creatinine. Initially, MSC could be located in the renal cortex, however numbers declined progressively and MSC could not be shown to differentiate into tubular cells, thereby excluding replacement of injured kidney cells as mechanism of action. Notably, MSC treated kidneys had higher proliferative and lower apoptotic indices. Expression of proinflammatory cytokines IL-1β, TNF-α, IFN-γ, and

______ *

To whom correspondence should be addressed. Claudia Lange, University Hospital Hamburg-Eppendorf, Department of Bone Marrow Transplantation, Hamburg, Germany

105 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 105–121. © 2008 Springer.

106

C. LANGE ET AL.

inducible nitric oxide synthase were significantly reduced while antiinflammatory IL-10 and growth factors like bFGF, TGF-α, and anti-apoptotic Bcl-2 were highly upregulated in treated kidneys. These results point towards a paracrine action of MSCs as main mechanism of organ protection. Based on these data we show that MSC can be used as a therapeutic vehicle for regenerative medicine in heart and kidney diseases. 1. Introduction Despite the advances in pharmacological therapy, cardiovascular surgery and cardiology, more than half of the patients with clinically evident heart failure die within 5 years of the initial diagnosis. The myocardial injury is usually irreversible because “healing pathways” are only expressed for a short time (Penn et al., 2004). Ischemic acute renal failure (ARF), characterized by a sharp decline of glomerular filtration rate, is a very common complication in hospitalized patients and particularly in patients with multiorgan failure. Although it develops most frequently in multimorbid patients, its occurrence per se increases the risk of death by 10- to 15-fold (Chertow et al., 1998). This unacceptable situation in both diseases warrants the urgent development of new treatment modalities. Bone marrow–derived stem cells have been discovered to transdifferentiate into cells of different germ layers (Krause et al., 2001). Physiologically, mesenchymal stem cells give rise to osteocytes, chondrocytes, and adipocytes, but were recently found to differentiate into endothelial, myocardial (Nagays et al., 2004), liver (Shu et al., 2004), renal (Morigi et al., 2004) and pulmonary epithelial cells (Oritz et al., 2003). Mesenchymal stem cells have also been shown to have immunomodulatory capabilities (Frank and Sayegh, 2004), and express growth factors known to be renoprotective in experimental AKI (Deans and Moseley, 2000). It has been shown that administered stem cells are functionally intact, circulate and readily can reach myocardial and intrarenal sites of injury via the circulation. There, they can react physiologically to different local stimuli, for example, hypoxia or ischemia, in turn leading to the release of vasoactive factors, growth factors, immunomodulatory cytokines, and chemokines. Although transdifferentiation of adult stem cells is a recognized phenomenon, controversy still exists regarding its actual existence and frequency. In some injury models fusion of transplanted cells with resident cells was detected instead of actual transdifferentiation.

MSC FOR REGENERATIVE MEDICINE

107

Based on this background, the objective of our studies was to test the therapeutic potential of mesenchymal stem cells, administered to rats following induction of MI or AKI by ischemia/reperfusion (I/R), and to monitor their physical presence in the injured organ using magnetic resonance imaging (MRI) and histology. 2. Methods 2.1. CELL PREPARATIONS

Rat mesenchymal stem cells were generated from the bone marrow of adult Sprague-Dawley or Wistar rats by standard procedures (Jaquet et al., 2005; Lange et al., 2005a). Phenotype was confirmed by exclusion of contaminating CD45-positive cells and expression of MSC markers by flow cytometric analysis. Multipotency was tested by the ability to differentiate into adipo-, chondro- and osteogenic lineages. For transduction with GFP, supernatant of ecotropic retroviral SFa11-EGFP vector particles was added to the cells, centrifuged for 1 hour at 20°C with 1000g and incubated overnight. For cloning, the cells were detached and 0.3 cells were seeded per well in a 96-well plate. The plates were incubated until single clones could be detected in the wells. One clone was choosen for all MI experiments. For MRI or histological tracking of MSC in vivo, cultured mesenchymal stem cells were prelabeled for 24 hours with carboxy-dextran-coated iron oxide nanoparticles (Resovist, Schering, Berlin, Germany) (Ittrich et al., 2005; Lange et al., 2005b). 2.2. MYOCARDIAL CRYOINFARCTION AND CELL TRANSPLANTATION

Rats (280–350g bodyweight) were randomly divided into two groups of 10 individuals. The cell therapy group received GFP-MSCs whereas the control group received cell culture medium only. Sedated and anaesthetized rats received a lateral (mini-) thoracotomy and a pistil (3x6mm; chilled to –193°C) was advanced through the hole in the chest and pressed onto the surface of the heart for 30 sec. The procedure was repeated 10 times in order to generate a cryolesion of reproducible size. GFP-transduced mesenchymal stem cells were directly injected into the borderzone of the developing ischemia (2x left lateral, 2x right lateral, 1x apical). Each injection contained 8x105 mesenchymal stem cells in a volume of 30 µl (Jaquet et al., 2005).

108

C. LANGE ET AL.

2.3. ACUTE KIDNEY INJURY AND CELL TRANSPLANTATION

I/R AKI was induced in anesthetized adult rats, weighing 300 to 350g (mesenchymal stem cell–treated group, n = 7; control group, n = 6) by clamping both renal pedicles for 40 minutes. After reflow, 1.5x106 mesenchymal stem cells in 1 ml were infused into the thoracic aorta via a carotid artery, controls received vehicle only (Lange et al., 2005b; Tögel et al., 2005). 2.4. INVESTIGATION OF MI ANIMALS

After a 10 week follow-up the animals were anaesthetized and hearts excised. Hearts were fixed in 3.5% formaldehyde solution for 24h. The organs were cut into 2 sections and it was verified that the cutting line was exactly horizontal to the heart axis. Histological analysis on the 3µm paraffin sections was done using hematoxilin eosin and van Giesons stain. An inverted-phase contrast microscope (Olympus IX71) was used equipped with the analySIS software version 3.2 (Soft Imaging System GmbH, Muenster, Germany). This procedure allowed a blinded and therefore objective evaluation of a minimum of 5 (up to 18) different sections located in the center of the region of interest by using a computer-assisted system for accurate measurements. From each section 5 randomly chosen high-power fields were used for evaluation. Immunohistochemical analyses were performed using antibodies recognizing smooth muscle actin (SMA), troponin-T (Trop-T), troponin T-C (Trop T-C), myosin heavy chain (MHC), muscle actin (MA), α-actinin, α-SR-1, desmin, connexin-43, fibroblasts (all antibodies from Dako, Denmark). For fluorescent immunohistochemistry the AlexaFluor 594 goat anti mouse secondary antibody (Molecular Probes, Leiden, The Netherlands) was used. In addition, cell nuclei were stained using DAPI. 2.5. INVESTIGATION OF AKI ANIMALS

Renal function was monitored by measurement of serum creatinine and blood urea nitrogen (BUN), using an autoanalyzer. At 72 hours after AKI, animals in both groups were studied by MRI for in vivo tracking of administered mesenchymal stem cells, then sacrificed to obtain kidney injury scores and for localization of administered mesenchymal stem cells. Sequential kidney sections were stained with hematoxylin and eosin for injury scoring, with Prussian blue for tracking of iron-loaded mesenchymal stem cells, and doublestained for CD68 (immunohistochemistry) and Prussian blue to identify infiltrating macrophages that may be iron-positive. The kidneys were formalinfixed and paraffin-embedded and 4 µm thick periodic acid-Schiff (PAS)–stained

MSC FOR REGENERATIVE MEDICINE

109

sections were scored by a standard method, and additionally examined for disruption or loss of the tubular brush border as a measure of tubular injury. 2.6. REAL-TIME PCR

RNA for real-time PCR was extracted with an RNeasy kit (Qiagen, Valencia, CA), including a DNase-digestion step to exclude contaminating DNA. Reverse transcription was performed using Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen, Carlsbad, CA) for 60 min at 42°C. Real-time PCR with relative quantification of target gene copy numbers in relation to β-actin transcripts was carried out using the primers for VEGF-A, VEGF-B, VEGF-C, VEGF-D, HGF, EGF, BMP-7, bFGF, IGF-1, HB-EGF, IL-1β, TNF-α, IFN-γ, IL-10, TGF-α and the rat Y chromosome (DNA was used instead of RNA) and conditions as described (Tögel et al., 2005). 2.7. CYTOKINE ARRAYS

Decapsulated kidney tissues were minced, sonicated, lysed and protein was quantified by BCA protein assay (Pierce, Rockford, IL). The cytokine arrays were performed by RayBiotech according to their protocols for the RayBio Rat Cytokine Antibody Array I (R0608001A, RayBiotech, Norcross, GA). Relative intensities of obtained spots were measured by densitometry and corrected by background subtraction. Results of duplicate readings were averaged. 2.8. STATISTICS

Data are expressed as mean ± SD. Differences between data means were analyzed by Student t test. P value of less than 0.05 was considered significant. 3. Results 3.1. INTRAMYOCARDIAL CELL THERAPY

Caused by the considerable ischemic area that was generated via cryolesion (3x6mm) in all 20 experimental animals some rats died before reaching the end of the experiment: five rats from the control group and two rats from the “transplanted” group. The survival rates in both groups already demonstrated an advantage for animals receiving MSC therapy. GFP-MSCs could be identified via their green fluorescence within the target area even 10 weeks after the injection. They were viable and morphologically closely integrated within the

110

C. LANGE ET AL.

heart tissue (not shown) although the number was extremely low after this time period. Therefore, rat MSCs containing superparamagnetic iron oxide nanoparticles (Resovist) were used. It could be shown that the cells migrated into the injured myocardium (Figure 1).

Figure 1. MSC accumulate within the scar area. MSC fed with superparamagnetic iron oxide nanoparticles and injected into the border zone of infarcted myocardium migrate into the infracted area.

The size of the myocardial scar area was remarkably different in the transplanted animals compared to the control group. In treated rats (n=8) the myocardial scar area was 237 ±94µm compared to 390 ±164µm in the depth in the control group (n=5) and 5246 ±1557µm compared to 7634 ±1826µm in the width, respectively (Figure 2). Rats that received the cell therapy exhibited considerable smaller myocardial scars. The reduction of the width of the myocardial scar area was statistically significant (p=0.028) whereas the reduction of the depth (p=0,053) was not. The measurement of the myocardial diameter was done in the area of the greatest linear expansion of the scar area (anterior LV wall). The results were 2269 ±439µm in transplanted animals compared to 1869 ±289µm in controls. The myocardium of transplanted rats was considerably thicker than in the controls, however this difference was nonsignificant.

MSC FOR REGENERATIVE MEDICINE

111

Figure 2. Decreased scar size in cell transplanted animals. The results of the myocardial scar measurements are shown as means and corresponding 95% confidence intervals. Two-tailed pvalues were calculated for equal variances and considered significant when p<0.05.

Interestingly, counting of the microvessels revealed no difference between MSC-transplanted animals and cell culture medium-injected controls (p>0.05, not shown). However, the amount of vessels in both groups was about twice as high in the area of injection compared to normal non-ischemic myocardium (p<0,001) of the same animal pointing towards an influence of the injection procedure in neovascularization events. 3.2. CELL THERAPY IN AKI

Forty minutes of ischemia led to severe renal damage in control AKI animals, causing significant increases in serum creatinine levels (Figure 3) from a common baseline for both groups of 0.48 ±0.13 mg/dL to 2.3 ±0.3 mg/dL, 4.0 ±1.1 mg/dL, and 2.7 ±1.0 mg/dL at days 1, 2, and 3, respectively. Animals with AKI who received mesenchymal stem cells immediately post-reflow had a significantly better renal function on days 2 and 3 after AKI. Serum creatinine on day 1 was 2.4 ±0.3 mg/dL, on day 2, 2.2 ±1.1 mg/dL, and on day 3, 1.3 ±0.7 mg/dL.

112

C. LANGE ET AL.

Figure 3. Improved renal function in rats with AKI after MSC treatment. Serum creatinine (mean ± SD) at baseline and days 1, 2 and 3 after acute kidney injury (AKI) in control animals (n=6, white bars) and in mesenchymal stem cell treated animals (n=7, black bars). Mesenchymal stem cell treatment led to a significant improvement in renal function on days two and three after AKI, as determined by t test.

Iron-dextran incubation of MSC resulted in effective labeling of mesenchymal stem cells. MRI 30 to 120 minutes after reflow showed loss of outer renocortical signal, consistent with the presence of iron-labeled mesenchymal stem cells in the kidney (Figure 4). This pattern persisted in all mesenchymal stem cells–treated rats until day 3, together suggesting the continued intrarenal presence of injected mesenchymal stem cells during this observation period. At no time point did infusion of free iron-dextran particles after ARF result in changes in kidney signal intensity (not shown), thereby excluding significant intrarenal accumulation of free iron-dextran.

MSC FOR REGENERATIVE MEDICINE

113

Figure 4. Accumulation of iron-labeled MSC in the renal cortex. Animals were anesthetized and coronal T2-weighted gradient echo in vivo magnetic resonance images (MRI) were obtained before (A) and immediately (B) or 3 days (C) after injection of magnetically labeled (irondextran) syngeneic mesenchymal stem cells.

Histologically, on day 3, iron-labeled mesenchymal stem cells of characteristic phenotype were found predominantly in glomerular capillaries at a frequency of 2 to 32 (average 17.6 cells per section) or approximately 30,000 cells per kidney, as calculated by volume, together corresponding well with the signal extinction observed on MRI (not shown). Renal injury was scored and mesenchymal stem cell treated animals had a significantly lower (p = 0.03) injury score of 23 ±4 compared to that of 88 ±46 in controls (not shown). To exclude the possibility that the signal in the kidneys is derived from infiltrating monocytes that have phagocytozed contrast material double-staining of kidneys for CD68 and with Prussian blue was carried out (not shown) failing to detect any iron-loaded macrophages. To further confirm the data, we performed Y chromosome PCR. The sensitivity of this method was 10–3 or 1000 cells detected in a total of 106 cells that were screened. Organs of female rats infused with male MSC were harvested at 24 h and at day 3 after infusion. Real-time quantitative PCR with Y chromosome-specific primers showed amplification only in the lungs at 24 h after cell infusion (Figure 5), whereas kidney, liver, spleen, and bone marrow were negative, thereby further corroborating our results about a clearance of MSC from kidneys long-term.

114

C. LANGE ET AL.

Figure 5. Detection of male MSC by Y-PCR. Y chromosome PCR at 24 h after MSC infusion from a male donor into female recipients with AKI. The only organ positive for Y chromosome DNA was the lung (lane 2). Kidney cortex and medulla as well as liver and spleen from 2 animals were negative (lanes 3–11). Lane designation: A-female DNA; B-male DNA; 2-lung; 3-kidney cortex; 4-kidney medulla; 5-liver; 6-spleen; 7-wound scar; 8-lung; 9-bone marrow; 10-liver; 11spleen.

Because MSC are known to secrete growth factors and have immunomodulatory properties, we screened kidneys, by real-time quantitative RT-PCR, for changes in the expression of growth factor-, inflammatory-, apoptosis-related and nitric oxide synthase (NOS) genes (Figure 6). Kidneys of animals treated with MSC showed at 24 h post cell administration a highly significant reduction in the expression of genes encoding the proinflammatory cytokines IL-1β, TNF-α, and IFN-γ (Figure 6A), as well as inducible NOS (iNOS) (Figure 6C), whereas the anti-inflammatory cytokine IL-10 was robustly expressed in MSC-treated and not in vehicle-infused animals (Figure 6A). The renal expression of VEGF-A, -B, -C, and -D, EGF, HB-EGF. IGF-I, and BMP-7 was essentially comparable in MSC- and vehicle-treated animals (Figure 6A). On the other hand, MSC-treated animals showed a 10-fold reduction in HGF expression, whereas that of bFGF increased 2.8-fold and that of TGF-α 8-fold (Figure 6B). The antiapoptotic Bcl-2 gene was only expressed in MSC-treated but not in control animals (Figure 6C), whereas there was no significant difference in Bcl-XL, Bcl-XS, NF-κB, and endothelial NOS expression between MSC- and vehicle-treated animals.

MSC FOR REGENERATIVE MEDICINE

115

Figure 6. Comparative gene expression ratios in ARF kidneys of MSC- and vehicle-treated animals. Data were generated by referencing each gene to β-actin as internal control. A: MSC treatment caused significant (P < 0.05) suppression (>10-fold) of proinflammatory IL-1β, TNF-α, and IFN-γ (above bars: actual values). Anti-inflammatory IL-10 was robustly expressed in MSCand not in vehicle-treated animals. Filled bars on all panels depict gene expression ratio of 1, i.e., a value obtained when gene expression ratios between MSC- and vehicle-treated animals are “equal.” B: MSC treatment caused increased gene expression of bFGF and TGF-α, whereas that of HGF was suppressed. C: antiapoptotic Bcl-2 expression was robustly induced, whereas that of inducible nitric oxide synthase (iNOS) was suppressed in MSC- vs. vehicle-treated animals. eNOS, endothelial NOS.

116

C. LANGE ET AL.

4. Discussion A growing number of investigators have implicated adult bone marrow in the process of tissue regeneration, suggesting that marrow serves as a reservoir for tissue precursor cells. When peripheral blood or bone marrow derived stem cells are implanted close to the ischemic lesion they are supposed to have the potential to stop the remodeling process into scar tissue and organ function. There is an ongoing discussion whether they do so by transdifferentiating into a tissue resident cell or angiogenic pathway or both. As far as the hematopoietic lineage of the bone marrow is concerned, these cells are described to transdifferentiate into e.g. cardiomyocytes as well as endothelial cells (Nagays et al., 2004; Kocher et al., 2001; Jackson et al., 2001; Shintani et al., 2001; Orlic et al., 2002; Orlic, 2003). In contrast, other data suggest that even in the microenvironment of the injured heart long-term reconstituting hematopoietic stem cells adopt only traditional hematopoietic fates (Murry et al., 2004; Balsam et al., 2004; Wagers et al., 2002). A comparable controversy exists in connection with MSC which are derived from the non-hematopoietic population of the bone marrow (Wagers et al., 2002; Makino et al., 1999; Kawada et al., 2004). In in vitro experiments, MSC developed an early myogenic phenotype (Jaquet et al., 2005), however we did not succeed in generating self-contracting or even twitching (cardio-) myocytes (not shown). Our results reveal that MSC are able to survive at least 10 weeks within the rat myocardium. When paramagnetic iron oxide nanoparticles were incorporated into rMSC prior to transplantation, cells within the myocardial scar area could be detected in our study. This could be some evidence that rMSC are able to migrate into the scar from the site of injection. When the width and depth of the myocardial scars of the transplanted animals were compared with the control animals, we found the ischemic area to be remarkably reduced in the cell therapy animals compared to the control rats. Although not all data were statistically significant in our model, there is a trend indicating that the implantation of MSC might be the trigger for the reduction of the myocardial scar size. Another observation documenting an improvement of cardiac performance was that only two rats of the “cell therapy” group died during the follow-up. In contrast, half of the control animals (5 of 10 animals) died before the end of the study. Only small groups of cells showing a myogenic phenotype could be detected within the transplantation area. Nevertheless, the vast majority of injected cells show the effort to migrate into the scar area at least short-term, which was combined with a reduced remodeling. These findings are in

MSC FOR REGENERATIVE MEDICINE

117

accordance with other data describing that MSC cardiomyoplasty is associated with a number of significant functional improvements in the postinfarcted heart. Additionally, we could neither find any evidence that MSCs are able to differentiate into vascular endothelial cells nor did we find more vessels within the transplantation areas as compared to the control group. But, in contrast to normal myocardium the amount of vessels was twice as high in the injection areas. This might indicate that the injury (puncture) of the myocardium caused by the syringe needle alone can be an adequate stimulus for the induction of angiogenesis. Therefore, rather the paracrine effects of implanted MSCs than the incorporation of these cells into the vessel walls may be required for vascular growth in the adult (Kinnaird et al., 2004). In a model of acute kidney injury we provide the clear evidence that therapy with MSC affords significant renoprotection in rats with I/R ARF. Animals infused with MSC after reperfusion had significantly better renal function, lower renal injury and apoptotic scores, and higher mitogenic indices than vehicle-treated animals ((Lange et al., 2005b; Tögel et al., 2005). Using in vivo and in vitro techniques, infused MSC were detected in the kidney only early after administration and were predominantly in glomeruli and attached in peritubular capillaries (Lange et al., 2005b; Tögel et al., 2005). After 24 h, only exceptionally scarce numbers of MSCs were found in the kidney, a pattern that essentially rules out the possibility that significant numbers of infused MSC are retained in the kidney where they could physically replace lost kidney cells by transdifferentiation. From this, we deduce that the mechanisms that mediate the protective effects of MSC must be primarily paracrine, as implied by their expression of several growth factors such as HGF, VEGF, and IGF-I, all known to improve renal function in AKI, mediated by their antiapoptotic, mitogenic and other cytokine actions (Tögel et al., 2005; Neuss et al., 2004; Zhang et al., 1993). Collectively, these as yet incompletely defined paracrine actions of MSC result in the renal downregulation of proinflammatory cytokines IL-1β, TNF-α, and IFN-γ, as well as iNOS, and upregulation of anti-inflammatory and organ-protective IL-10, as well as bFGF, TGF-β, and Bcl-2. The current studies were conducted in rodents with I/R ARF, an extensively investigated, albeit imperfect model of the most common and the most treatment-resistant type of clinical AKI. Morigi et al. (Morigi et al., 2004), using rodents with cisplatinum-induced ARF, showed that administration of MSC improved renal function, and MSC appeared to directly contribute to the reconstitution of renal epithelium by transdifferentiation. However, these investigators did not demonstrate that the observed transdifferentiation of MSC is the actual mechanism of renoprotection, and they presented no data regarding the actual numbers of donor cells that undertook the tubular repair. It may be

118

C. LANGE ET AL.

important, in this context, that the kinetics of the cisplatinum model are fundamentally different from those of the I/R model. Specifically, in this nephrotoxic model maximal injury occurs on day 7 after cisplatinum application, which, at least in theory, provides the earlier infused MSC significantly more time to transdifferentiate into renal target cells. In contrast, we obtained significant functional improvement in severe AKI as early as 24 h following reflow and infusion of MSC, i.e., at a time point that would be too early for tubular replacement to occur via transdifferentiation of administered stem cells. Having documented in the present study the rather early therapeutic efficiency of MSC in AKI, which makes direct, physical replacement of damaged resident cells by donor cells unlikely, we next investigated alternative, differentiation-independent mediator mechanisms that could explain the renoprotective effects of these cells. MSC are known to have incompletely understood immunomodulatory properties that result in the inhibition or modulation of the T cell response, and they secrete various growth factors and cytokines (Deans and Moseley, 2000; Aggarwal and Pittenger, 2005). T cell responses are likely involved in the pathogenesis of AKI, and their modulation by MSC might be a possible mechanism of protection. We observed significant differences in cytokine and growth factor expression in MSC-treated kidneys, likely the direct or secondary result, via primary improvement of kidney injury, of this therapy. Expression of proinflammatory cytokines IL-1β, TNF-α, IFN-γ as well as iNOS was reduced, whereas anti-inflammatory IL-10 was upregulated. Expression of known renoprotective growth factors bFGF, TGF-β, and antiapoptotic Bcl-2 was increased in MSC-treated kidneys, whereas HGF, highly expressed in MSC, was surprisingly downregulated. The tracking of administered MSC in the kidney is critical to the interpretation of our experimental results. We found that there was complete agreement in the data obtained with either approach, indicating that combining different labeling techniques and molecular assays achieves maximal sensitivity and highest possible specificity for tracking of MSC in the kidney. Although we did not detect transdifferentiation events during the 72-h period of observation, it is possible that cell transdifferentiation and integration may be important at later stages of organ repair. Additional studies are needed to further validate the individual or combined importance of paracrine and transdifferentiation mechanisms in ARF. The primary advantage of MSC for utilization in cell therapy is the ease with which they can be harvested from the bone marrow, isolated by plastic adherence, expanded in culture, genetically engineered, differentiated, and handled in vitro. The ease with which mesenchymal stem cells can be irondextran labeled (Ittrich et al., 2005; Arab et al., 2004) and monitored by MRI

MSC FOR REGENERATIVE MEDICINE

119

in vivo (Kraitchman et al., 2003) provides a useful and safe tool to monitor the presence of administered mesenchymal stem cells and allows for the in vivo correlation of obtained organ protection with the quality and duration of signal extinction by a given number of administered mesenchymal stem cells. There are currently no reports showing adverse effects of adult stem cells used in cell therapy. Although this suggests a great advantage over embryonic stem cells, which have been documented to give rise to teratomas, long-term studies will have to be conducted to prove that no adverse effects occur after in vivo administration of adult MSC. In summary, our present studies clearly demonstrate that administration of MSC to animals with myocardial infarction or I/R AKI is highly protective and that these beneficial effects are predominantly mediated, as our data suggest, by paracrine rather than transdifferentiation-dependent mechanisms. Our observations are furthermore compatible with the notion that the potentially unique mix of growth factors elaborated by MSC may explain their significant protective activity. It is surprising that the very transient presence of MSC in the injured kidney, as we document, is sufficient to greatly ameliorate the course of I/R AKI. Protective and repair mechanisms that are activated by MSC resemble those that can be induced by individual growth factors in experimental ARF. We documented antiapoptotic, mitogenic, and anti-inflammatory responses, evidenced by both improved tissue scores and changes in the expression of mechanism-specific genes. Whether the protective effects of MSC are primary actions that are humorally elicited by these cells or whether they result from the improvement of tissue injury by as yet unknown factors released by them remains to be determined. Future studies will also have to define the possible contribution to organ protection made by the immunomodulatory effects of MSC. In conclusion, we have shown that successful treatment of MI and I/R AKI with MSC holds substantial promise for the development of novel, MSC-based interventions that can improve the treatment of severe, and still largely therapyresistant, clinical ischemic myocardial infarction as well as ARF that results from I/R injury. Pluripotent MSC, because of their versatility and the ease with which they can be harvested from the bone marrow, culture expanded, and engineered, appear to be a particularly well-suited stem cell type for these clinical indications. Acknowledgements

Parts of this work were supported by grants from the Werner-Otto-Stiftung and the Peter Cremer Foundation, Hamburg, Germany, by the Office of Research and Development, Medical Research Service, Department of Veterans Affairs (Merit Review Program), Washington, DC, the American Heat Association,

120

C. LANGE ET AL.

Western States Affiliate, the Dialysis Research Foundation, Ogden, UT, the National Kidney Foundation (UT), the Western Institute for Biomedical Research, and the Heart, Lung and Blood Institute of the National Institutes of Health.

References Aggarwal, S. and Pittenger, M.F. (2005) Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105, 1815-1822. Arab, A.S., Yocum, G.T., Kalish, H. et al (2004) Efficient magnetic cell labeling with protamine sulfate complexed to ferumoxides for cellular MRI. Blood 104, 1217-1223. Balsam, L.B., Wagers A.J., Christensen, J.L., Kofidis, T., Weissman, I.L. and Robbins R.C. (2004) Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 428, 668-673. Chertow, G.M., Levy, E.M., Hammermeister, K.E., et al (1998) Independent association between acute renal failure and mortality following cardiac surgery. Am J Med 104, 343-348. Deans, R.J. and Moseley, A.B. (2000) Mesenchymal stem cells: Biology and potential clinical uses. Exp Hematol 28, 875–884. Frank, M.H. and Sayegh, M.H. (2004) Immunomodulatory functions of mesenchymal stem cells. Lancet 363, 1411-1412. Ittrich, H., Lange, C., Dahnke, H., Zander, A.R., Adam, G. and Nolte-Ernsting, C. (2005) Labeling of mesenchymal stem cells with different superparamagnetic particles of iron oxide and detectability with MRI at 3T. Rofo 177, 1151-63. Jackson, K.A., Majka, S.M., Wang, H., Pocius, J., Hartley, C.J., Majesky, M.W., Entman, M.L., Michael, L.H., Hirschi, K.K. and Goodell, M.A. (2001) Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J Clin Invest 107, 1395-1402. Jaquet, K., Krause, K.T., Denschel, J., Faessler, P., Nauerz, M., Geidel, S., Boczor, S., Lange, C., Stute, N., Zander, A. and Kuck, K.H. (2005) Reduction of myocardial scar size after implantation of mesenchymal stem cells in rats: what is the mechanism? Stem Cells Dev. 14, 299-309. Kawada, H., Fujita, J., Kinjo, K., Matsuzaki, Y., Tsuma, M., Miyatake, H, Muguruma, Y., Tsuboi, K., Itabashi, Y., Ikeda, Y., Ogawa, S., Okano, H., Hotta, T., Ando, K. and Fukuda, K. (2004) Nonhematopoietic mesenchymal stem cells can be mobilized and differentiate into cardiomyocytes after myocardial infarction. Blood 104, 3581-3587. Kinnaird, T., Stabile, E., Burnett, M.S., et al (2004) Marrow-derived stromal cells express genes encoding a broad spectrum of arteriogenic cytokines and promote in vitro and in vivo arteriogenesis through paracrine mechanisms. Circ Res 94, 678-685. Kocher, A.A., Schuster, M.D., Szabolcs, M.J., Takuma, S., Burkhoff, D., Wang, J., Homma, S., Edwards, N.M. and Itescu, S. (2001). Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med 7, 430-446. Kraitchman, D.L., Heldman, A.W., Atalar, E., et al (2003) In vivo magnetic resonance imaging of mesenchymal stem cells in myocardial infarction. Circulation 107, 2290-2293. Krause, D.S., Theise, N.D., Collector, M.I., et al (2001) Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105, 369-377.

MSC FOR REGENERATIVE MEDICINE

121

Lange, C., Bassler, P., Lioznov, M.V., Bruns, H., Kluth, D., Zander, A.R. and Fiegel, H.C. (2005a) Liver-specific gene expression in mesenchymal stem cells is induced by liver cells. World J Gastroenterol 11, 4497-4504. Lange, C., Tögel, F., Ittrich, H., Clayton, F., Nolte-Ernsting, C., Zander, A.R. and Westenfelder, C. (2005b) Administered mesenchymal stem cells are renoprotective in ischemia/reperfusion acute renal failures in rats. Kidney Int. 68, 1613-1617. Makino, S., Fukuda, K., Miyoshi, S., Konishi, F., Kodama, H., Pan, J., Sano, M., Takahashi, T., Hori, S., Abe, H., Hata, J., Umezawa, A. and Ogawa, S. (1999) Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 103, 697-705. Morigi, M., Imberti, B., Zoja, C., et al (2004) Mesenchymal stem cells are renotropic, helping to repair the kidney and improve function in acute renal failure. J Am Soc Nephrol 15, 17941804. Murry, C.E., Soonpaa, M.H., Reinecke, H., Nakajima, H., Nakajima, H.O., Rubart, M., Pasumarthi, K.B., Virag, J.I., Bartelmez, S.H., Poppa, V., Bradford, G., Dowell, J.D., Williams, D.A. and Field, L.J. (2004) Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 428, 664-668. Nagays, N., Fujii, T., Iwase, T., et al (2004) Intravenous administration of mesenchymal stem cells improves cardiac function in rats with acute myocardial infarction through angiogenesis and myogenesis. Am J Physiol Heart Circ Physiol 287, H2670-H2676. Neuss, S., Becher, E., Woltje, M., Tietze, L. and Jahnen-Dechent, W. (2004) Functional expression of HGF and HGF receptor/c-met in adult human mesenchymal stem cells suggests a role in cell mobilization, tissue repair, and wound healing. Stem Cells 22, 405-414. Oritz, L.A., Gambelli, F., McBride, C., et al (2003) Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci USA 100, 8407-8411. Orlic, D. (2003). Adult bone marrow stem cells regenerate myocardium in ischemic heart disease. Ann N Y Acad Sci. 996, 152-157. Orlic, D., Hill, J.M. and Arai, A.E. (2002) Stem cells for myocardial regeneration. Circ Res 91, 1092-1102. Penn, M.S., Zhang, M., Deglurkar, I. and Topol, E.J. (2004) Role of stem cell homing in myocardial regeneration. Int J Cardiol. 95, 23-25. Shintani, S., Murohara, T., Ikeda, H., Ueno, T., Sasaki, K, Duan, J. and Imaizumi, T. (2001) Augmentation of postnatal neovascularization with autologous bone marrow transplantation. Circulation 103, 897-903. Shu, S.N., Wei, L., Wang, J.H., et al (2004) Hepatic differentiation capability of rat bone marrow-derived mesenchymal stem cells and hematopoietic stem cells. World J Gastroenterol 10, 2818-2822. Tögel, F., Hu, Z., Weiss, K., Isaac, J., Lange, C. and Westenfelder, C. (2005) Administered mesenchymal stem cells protect against ischemic acute renal failure through differentiationindependent mechanisms. Am J Physiol Renal Physiol. 289, F31-42. Wagers, A.J., Sherwood, R.I., Christensen, J.L. and Weissman, I.L. (2002) Little evidence for developmental plasticity of adult hematopoietic stem cells. Science 297, 2256-2259 Zhang, G., Ichimura, T., Maier, J.A., Maciag, T. and Stevens, J.L. (1993) A role for fibroblast growth factor type-1 in nephrogenic repair. Autocrine expression in rat kidney proximal tubule epithelial cells in vitro and in the regenerating epithelium following nephrotoxic damage by S-(1,1,2,2-tetrafluoroethyl)-L-cysteine in vivo. J Biol Chem 268, 11542-11547.

EPITHELIAL PLASTICITY OF HEPATOCYTES DURING LIVER TUMOR PROGRESSION MARIO MIKULA1, CHRISTIAN LAHSNIG1, ALEXANDRA N. M. FISCHER1, VERENA PROELL 1, HEIDEMARIE HUBER 1, EVA FUCHS1, ANDREAS EGER2, HARTMUT BEUG3 AND WOLFGANG MIKULITS1* 1 Department of Medicine I, Division: Institute of Cancer Research, Medical University of Vienna 2 Max F. Perutz Laboratories, Vienna Biocenter, Department of Medical Biochemistry, Medical University Vienna, and 3 Research Institute of Molecular Pathology, Vienna, Austria

Keywords: Hepatocyte; liver progenitor cell; TGF-β; β-catenin; cancer stem cell

Abstract. Hepatocellular carcinoma (HCC) correlates with poor survival of patients due to delayed diagnosis and frequent recurrence after adjuvant treatment. The majority of malignant hepatic lesions shows a tremendous heterogeneity in differentiation patterns and molecular signatures which challenges efficient therapeutic intervention. Here we discuss aspects on which route hepatocytes progress towards epithelial lineage commitment during liver repopulation and further resume configurations of hepatocyte differentiation during liver tumorigenesis. We particularly focus on the epithelial to mesenchymal transition (EMT) of hepatocytes and its consequences upon the progression of HCC which depends on the synergy of transforming growth factor (TGF)-β signaling and the hyperactivation of Ras-subeffectors. Recent insights into the epithelial plasticity of malignant hepatocytes revealed that activation of platelet-derived growth factor (PDGF) links TGF-β signaling to nuclear β-catenin accumulation upon EMT. PDGF-dependent activation of βcatenin reduces cellular turnover and provides protection of malignant

______ * To whom correspondence should be adressed. Wolfgang Mikulits, Department of Medicine I, Division: Institute of Cancer Research, Medical University of Vienna, Borschke-Gasse 8a, 1090 Vienna, Austria; Tel: +43 1 4277 65250; Fax: +43 1 4277 65239; E-mail: [email protected]

123 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 123–135. © 2008 Springer.

124

M. MIKULA ET AL.

hepatocytes against anoikis, the latter known as a prerequisite for dissemination of carcinoma and a feature of metastatic cancer stem cells. Finally, we discuss the cancer cell fate determination by integrating the repertoire of hepatocellular differentiation in a novel concept of liver carcinoma progression. Abbreviations: AFP, α-fetoprotein; CK, cytokeratin; ECM, extracellular matrix; EMT, epithelial to mesenchymal transition; HCC, hepatocellular carcinoma; HNF, hepatocyte nuclear factor, HSC, hepatic stellate cell; MFB, myofibroblast; M2-PK, M2-pyruvate kinase; PDGF, platelet-derived growth factor; TGF, transforming growth factor. 1. Stem Cell Activity in the Adult Liver The liver belongs to a typical low turnover tissue which shows an enormous regenerative potential in response to resection or acute chemical injury (Michalopoulos and DeFrances, 1997). The hepatocyte represents the most abundant and versatile cell type of the liver, and is the cellular origin of HCC. Although hepatocytes are highly differentiated and quiescent under healthy conditions, they possess an astonishing proliferative capacity and are the major source for hepatocyte replacement upon liver repopulation (Fausto, 2004). Besides the regenerative potential of hepatocytes, oval cells provide a liver stem cell repository with the ability to differentiate into both hepatocytes and bile duct epithelial cells (cholangiocytes), thus representing bipotent progenitor cells (Roskams, 2006; Shafritz and Dabeva, 2002; Thorgeirsson and Grisham, 2003). In addition, bone marrow-derived hematopoietic stem cells have been proven to undergo metaplasia into cells with hepatic epithelial cell lineage capability (Lagasse et al., 2000; Petersen et al., 1999) which is caused to a certain extent by the fusion with hepatocytes (Vassilopoulos et al., 2003; Wang et al., 2003). For all different liver stem cell compartments involved in tissue homeostasis and organ repair, corresponding ex vivo cultures have been essential for the study of underlying molecular mechanisms and the subsequent treatment of liver diseases (Forbes et al., 2002; Sell, 2001). 2. Immortalized Hepatocytes Yield Liver Progenitor Cells Capable to Restore the Damaged Liver The access to hepatocytes with liver reconstituting activity is hindered by multiple obstacles, among them the very limited potential to expand hepatocytes in culture. Innate surveillance mechanisms linked to tumor suppressor

EPITHELIAL PLASTICITY OF HCC

125

activities are responsible for blocking cell cycle and for rapidly evoking senescence of hepatocytes ex vivo (Sell, 2001). Inactivation of the p19ARF/MDM2/p53 pathway therefore offers an unique opportunity to obtain limitless lifespan by the ablation of both cell cycle arrest and senescence (Lowe and Sherr, 2003; Sherr, 2001). On the one hand, loss of p19ARF (p14ARF in human) decreases the growth-suppressive functions of p53, while maintaining the Arf-independent activities of this protein. On the other hand, disruption of p19ARF function is sufficient to circumvent senescence without losing genetic stability. In a recent study, we showed that immortalized hepatocytes from p19ARF null mice display a high degree of epithelial organization as detected by the expression of the polarity marker ZO-1, and the adherens junctions and desmosomal marker proteins such as E-cadherin, β-catenin, p120-catenin and desmoplakin at cell-to-cell contacts (Gotzmann et al., 2006; Mikula et al., 2004). Importantly, these p19ARF null hepatocytes, referred to as MIM cells, exhibit functional differentiation by expressing hepatic markers such as e.g. albumin, α-fetoprotein (AFP), hepatocyte nuclear factor (HNF)-1α, HNF-4α, phenylalanine hydroxylase, ApoAI and ApoAII. Typical for hepatocytes, MIM cells are sensitive to Fas-mediated apoptosis induced by the Fas antibody Jo-2, and exogenous expression of either anti-apoptotic Bcl-2 or Bcl-XL efficiently reduces cell death events (Mikula et al., 2004). To affirm that MIM cells represent functional hepatocytes, MIM cells expressing green fluorescent protein (GFP) were orthotopically transplanted into SCID mice after Fas-dependent apoptotic liver damage. MIM-GFP donor hepatocytes contribute to liver restoration, thus being able to reconstitute the liver in vivo (Mikula et al., 2004). Transplanted MIM-GFP cells are organized in ductular structures comparable to canals of Hering, whereas a lower portion of these hepatocytes localizes in small-sized clusters as well as in isolated cells scattered throughout the entire liver. The emergence of such small-sized clusters of transplanted MIM-GFP hepatocytes might be an effect caused by the Jo-2 mediated destruction of the liver architecture. Intriguingly, donor cells organized in canals display a hepatocyte-like morphology with a high cytoplasm to nucleus ratio as well as a cholangiocyte-like phenotype with poor cytoplasmic portions (Shafritz and Dabeva, 2002). Transplantation of apoptosis-protected MIM-GFP-Bcl-XL hepatocytes and successive Fas-mediated injury enhances donor-derived liver restoration, providing strong evidence that p19ARF null hepatocytes are able to generate liver progenitor cells. As observed with MIM-GFP hepatocytes, most of MIM-GFPBcl-XL donors localize in ductular structures, suggesting the potential of MIM hepatocytes to generate progenitor cells after successive liver regeneration. To determine whether MIM-Bcl-XL donors represent hepatic precursor cells,

126

M. MIKULA ET AL.

markers characteristic for the various liver cell types were used for colocalization with the transplantation marker GFP (Vessey and De La Hall, 2001). (i) AFP and albumin for oval cells and fetal hepatocytes, (ii) M2pyruvate kinase (M2-PK) for oval cells, fetal hepatocytes and cholangiocytes, and (iii) cytokeratin (CK) 19 for cholangiocytes. This analysis showed that engrafted MIM-GFP-Bcl-XL donor cells stain positive for AFP, M2-PK, albumin and CK19, which led to the conclusion that immortalized hepatocytes are capable to form bile ducts and to express markers specific for both oval cells and embryonic hepatocytes after transplantation in vivo (Mikula et al., 2004). In the context of the liver in vivo, the majority of MIM hepatocytes reside in ductular structures comparable with canals of Hering, and display characteristics of oval cells which differentiate via alternative routes into different epithelial lineages. This observation indicates that hepatocytes are not narrowed down to generate unipotent progenies, but are still equipped to shift into a bipotential precursor compartment. These data thus point to a broader plasticity of hepatocytic cell fate determination as expected. Studies on the reversibility of hepatoblast-derived differentiation into cholangiocytes and hepatocytes in vitro and in vivo support this hypothesis (Fougere-Deschatrette et al., 2006; Notenboom et al., 2003). Hence, the accessibility of the hepatic MIM model to genetic manipulation may provide novel insights into the differentiation repertoire of hepatocytes and specification of liver progenitor cells. Furthermore, knowledge about the molecular and cellular mechanisms of malignant MIM hepatocytes is both conceptually important and relevant for the understanding of hepatocellular tumorigenesis. 3. Etiology and Epidemiology of Liver Cancer Hepatocellular carcinoma (HCC) accounts for more than five percent of all cancer cases and is the fifth leading cause of cancer mortality worldwide (Kensler et al., 2003). Major risk factors well define the etiology of HCC and include viral infection with hepatitis B or C, dietary exposure to the fungal toxin aflatoxin or alcohol intoxication. While hepatitis B and aflatoxin interaction are the predominant reason for HCC in Asia and Africa, hepatitis C and alcohol abuses are the most frequent causative events in Western countries. Independent of the carcinogenic insult, chronic hepatitis and cirrhosis resulting from inflammation and fibrosis are present in almost eighty percent of HCC cases worldwide (Friedman, 2004). Thus, aetiological factors which generate fibrosis and cirrhosis with a lower frequency such non-alcoholic fatty liver disorders and non-alcoholic steatohepatitits have also a potential role in the development of HCC (Farazi and DePinho, 2006). The cirrhotic lesions that

EPITHELIAL PLASTICITY OF HCC

127

commonly proceed dysplastic HCC-like foci and nodules already display genomic alterations which further accumulate during hepatocarcinogenesis (Lee and Thorgeirsson, 2005). Due to the lack of symptoms in the early phase of tumorigenesis and the rapid cancer progression, HCC are most frequently recognized at advanced stages. 4. Molecular Mechanisms of HCC In the healthy adult liver, quiescent hepatic stellate cells (HSC) represent the major site for vitamin A storage in cytoplasmic lipid droplets. During liver injury due to e.g. viral infection, HSC get activated to myofibroblasts (MFB) and show cellular remodeling required for tissue repair and fibrogenesis (Friedman et al., 2000). These changes in cell fate vastly contribute to the establishment of liver fibrosis and subsequent cirrhosis, which frequently lead to formation of HCC. Importantly, MFB surround the malignant parenchyme intra- and peritumorally upon progression of HCC, indicating their important role during cancer progression. The most frequent molecular alterations in human HCC include the overexpression and secretion of cytokines such as transforming growth factor (TGF)-β (Breuhahn et al., 2006; Rossmanith and Schulte-Hermann, 2001), the loss of tumor suppressors such as retinoblastoma, p53, p16INK4A and p14ARF (p19ARF in mouse, (Levy et al., 2002; Tannapfel et al., 2001)), the loss of the cell adhesion component E-cadherin (Osada et al., 1996), the induction of the Wnt signaling pathway through stabilization of nuclear β-catenin (Lee et al., 2006a), and the constitutive activation of Stat3 (Signal Transducer and Activator of Transcription; (Levy and Darnell, 2002)). We previously established a murine hepatocellular model of tumor progression based on MMH (Met murine, (Amicone et al., 1997)) and MIM hepatocytes which reflects changes leading to a metastatic phenotype through an epithelial to mesenchymal transition (EMT, (Eger and Mikulits, 2005; Fischer et al., 2005; Gotzmann et al., 2002; Gotzmann et al., 2004)). Such changes in epithelial plasticity during liver tumor progression have also been reported in human HCC cell lines and patients (Giannelli et al., 2005; Lee et al., 2006b; Lee et al., 2006c). In our cellular models employing MMH hepatocytes expressing the cytoplasmic domain of the Met receptor or MIM hepatocytes lacking p19ARF, EMT is caused by the collaboration of hyperactive Ras and TGF-β. The gain in malignancy provided by EMT associates with loss of E-cadherin, nuclear localization of β-catenin as well as secretion of TGF-β1 which represent hallmarks of human HCC progression (Fig. 1). Fibroblastoid hepatocytes that have undergone EMT display upregulation of platelet-derived growth factor (PDGF)-A ligand and both PDGF receptor subunits along with autocrine PDGF secretion (Gotzmann et al., 2006). In accordance with these

128

M. MIKULA ET AL.

data, the analysis of human HCCs showed enhanced expression of PDGF receptors in cancerous liver tissue compared to the adjacent parenchyme indicating a functional implication of PDGF activation in human HCC (Chen et al., 2002; Murakami et al., 2005; Tsou et al., 1998; Xu et al., 2001). Loss-offunction of PDGF signaling upon EMT by the expression of the dominant negative (dn) PDGF receptor α causes a strong suppression of tumor formation (Gotzmann et al., 2006). Intriguingly, this TGF-β-induced PDGF signaling is essentially involved in the activation and nuclear localization of β-catenin in hepatocellular EMT since interference with PDGF receptor signaling abolishes nuclear β-catenin accumulation in vivo (Fischer et al., 2006). This finding is of particular relevance since about 50% of human HCC display nuclear accumulation of β-catenin (Buendia, 2000; de La Coste et al., 1998).

Figure 1. Linear view on the differentiation patterns of neoplastic hepatocytes and the heterogeneity of HCCs. Malignant hepatocytes at the tumor center show features of epithelial differentiation which is progressively lost towards the tumor-host border. Activated myofibroblasts (MFB) mainly presenting the tumor microenvironment provide TGF-β in a paracrine mode of regulation. A gradient in the amount of available TGF-β induces changes in the epithelial plasticity of neoplastic hepatocytes. Malignant hepatocytes close to the tumor-host interface are exposed to bulk TGF-β and undergo an EMT which is associated with an autocrine regulation and secretion of TGF-β and PDGF. The stroma compartment is boxed in light gray (upper panel), whereas tumor cells are trapezoidly boxed in darker gray (lower panel). The dashed line marks the tumor-host boundary.

EPITHELIAL PLASTICITY OF HCC

129

5. Heterogeneity and Stemness of Hepatocellular Carcinoma Unexpectedly, functional validation of active β-catenin by the constitutive expression of a indestructible version of β-catenin revealed suppression of tumor growth and inhibition of proliferation in vivo, whereas intervention with β-catenin by the expression of its negative regulator Axin causes larger tumor formation (Fischer et al., 2006). Although well known target genes of β-catenin such as c-myc and cyclin D1 are expressed, the presence of the cell cycle inhibitor p16INK4A is suggested to be responsible for growth arrest. Comparable to our findings, nuclear β-catenin accumulation and concomitant expression of cyclin D1 and p16INK4A has been observed at the invasive fronts of colorectal adenocarcinomas (Bae et al., 2001). Furthermore, active β-catenin protects malignant hepatocytes from anoikis which confers the capability to survive in suspension (Fischer et al., 2006). This mechanism represents an important prerequisite for the survival of spreading cells after intravasation into the vasculature. Activation of β-catenin in hepatocytes that have undergone TGF-β-mediated EMT therefore provides characteristics of cell cycle arrested and moreover anoikis-resistant cancer cells. The protection against detachment-induced apoptosis point to the presence of a cancer stem cell phenotype capable to disseminate which is stabilized by β-catenin. Thus, we propose that invasive cancer stem cells result from preceding EMT and acquired stemness, both regulated by developmental pathways such as TGF-β, PDGF and β-catenin signaling. The route on which hepatocytes progress in malignancy is of particular importance for the understanding of HCC. Recent concepts on the tumor stem cell have been provided in breast cancer, glioblastoma and acute myeloid leukaemia, which suggest that the potential to disseminate are features of cancer stem cells rather than of differentiated tumor cells (Pardal et al., 2003). A conceptual extension is provided by recent studies which point to the presence of “migrating cancer stem cells” (Brabletz et al., 2005). These cells localizing at the invasive front of colorectal carcinoma have undergone EMT, a transient and reversible hallmark of disseminating tumor cells. They show growth arrest with a concomitant accumulation of the Wnt signaling component β-catenin, indicating reactivation of developmental programes. With respect to the liver, it is still a matter of debate whether hepatic cancer stem cells exist. We hypothesize that different patterns of nuclear β-catenin occur, depending on the localization of neoplastic cells in the tumor and correlating with variations in the differentiation state of malignant hepatocyte subpopulations. At the inner area of the cancerous tissue, neoplastic hepatocytes might have low or are even devoid of nuclear β-catenin and exhibit proliferation. In contrast, malignant hepatocytes that have undergone EMT at the invasive front might

130

M. MIKULA ET AL.

harbor high amounts of nuclear β-catenin expression accompanied by growth arrest. We therefore propose a broad differentiation repertoire of neoplastic hepatocytes through changes in epithelial plasticity (Fig. 1). The fate of this liver tumor stem cell repository might be controlled by the tumor microenvironment which on the one hand directs dissemination of liver carcinoma cells at the tumor-host interface, and on the other hand induces differentiation of malignant cells at the inner area of the tumor. So far, genetic profiling of HCCs and respective animal models are promising to molecularly unravel this enigma (Lee and Thorgeirsson, 2005; Thorgeirsson and Grisham, 2002). Within this context, a subpopulation of HCC cells has been identified to show upregulation of particular “stemness genes” in cancer cells (Chiba et al., 2006). 6. Tumor Microenvironment and HCC Progression We recently investigated the interaction between malignant hepatocytes and activated HSC or MFB, the latter representing the main constituents of the tumor-associated connective tissue (Pinzani et al., 2005). In addition to MIM hepatocytes, we established p19ARF deficient immortalized HSC which show proper expression of characteristic marker proteins of activated HSC such as αsmooth muscle actin, glial fibrillary acidic protein, pro-collagen I and desmin (Proell et al., 2005). Most notably, these non-tumorigenic p19ARF null HSC undergo a further transition to MFB in vitro upon treatment with TGF-β, and thus provide a suitable cellular tool to analyze the molecular and cellular mechanisms involved in liver fibrogenesis. By simultaneous xenografting of these well characterized hepatic cellular models in vivo, we showed that paracrine feedback mechanisms governed by activated HSC and MFB strongly affect the malignant progression of neoplastic hepatocytes through (i) induction of active TGF-β signaling, (ii) nuclear accumulation of β-catenin, and (iii) abrogation of E-cadherin mediated cell-tocell contacts (Mikula et al., 2006). Genetic intervention with TGF-β signaling leading to loss of paracrine TGF-β regulation in neoplastic hepatocytes confirmed this finding. Hence, these data indicate that the tumor-progressive TGF-β signaling is induced by paracrine regulation in hepatocytes, and molecularly linked to activation of β-catenin. Extrapolation of these findings with recent data supports clarification of the scenario, how paracrine and autocrine TGF-β regulation of hepatocytes and non-parenchymal liver cells are executed (Fig. 2). Tumor-associated macrophages (TAM) comparable to activated Kupffer cells produce TGF-β which stimulates activated HSC to complete the transition to MFB. TAM, activated HSC and MFB each on its own secrete TGF-β, and positively regulate the progression of neoplastic

EPITHELIAL PLASTICITY OF HCC

131

hepatocytes in a paracrine fashion. Hepatocytes proceeding in tumorigenesis and displaying an EMT-like, invasive signature produce TGF-β themselves in an autocrine fashion (Gotzmann et al., 2002). Since HCC develops from chronically injured liver involving stimulation of Kupffer cells and activation of HSC to MFB, these non-parenchymal cells are the major source of TGF-β, and thus being predominantly responsible for the progression of initiated tumor nodes. Future studies will focus on the determination of paracrine regulatory loops between cancerous cells and the host in order to unravel the molecular framework of the tumor-host crosstalk in the liver.

Figure 2. The involvement of TGF-β in hepatocellular tumor-stroma interaction. The liver tumor microenvironment mainly consists of tumor-associated macrophages (TAM), activated hepatic stellate cells (HSC) and myofibroblasts (MFB). TAM secrete TGF-β which stimulates HSC to transdifferentiate in MFB. TGF-β produced by TAM and MFB induces the malignant progression of hepatocytes by changes in epithelial plasticity. Molecular and cellular events corresponding to the non-parenchymal tumor-stroma compartment are boxed in light gray (upper panel). Neoplastic hepatocytes undergo an EMT in response to TGF-β and are finally endowed with autocrine TGF-β signaling (trapezoidly boxed in darker gray, lower panel). Red arrows, paracrine TGF-β regulation; winded red arrows, autocrine TGF-β secretion; green to orange shaded arrows; activation of HSC to MFB; blue to purple shaded arrows, malignant progression of hepatocytes by EMT. The dashed line marks the tumor-host boundary.

132

M. MIKULA ET AL.

7. Conclusion Activation of β-catenin in hepatocytes that have undergone TGF-β mediated EMT confers characteristics of cell cycle arrested and anoikis-resistant cancer cells. These features point to the presence of a dormant cancer stem cell phenotype in HCC which is stabilized by β-catenin and is involved in proximal and distal colonization. The quiescence of a subpopulation of liver tumor cells might render them more resistant to standard chemotherapy that targets proliferating cells and could therefore be responsible for post-operative disease recurrence, as often observed in HCC. These aspects implicate important consequences for therapeutic intervention of aggressive HCCs, suggesting TGF-β and PDGF as promising targets for anti-cancer drug development. Acknowledgment

This work was supported by grants from the “Jubiläumsfonds der Oesterreichischen Nationalbank”, OENB 10171, and by the Austrian Science Fund (FWF), projects FWF P15435 and SFB F28, Austria.

References Amicone L, Spagnoli FM, Spath G, Giordano S, Tommasini C, Bernardini S et al (1997). Transgenic expression in the liver of truncated Met blocks apoptosis and permits immortalization of hepatocytes. EMBO J 16: 495-503. Bae SH, Jung ES, Park YM, Kim BS, Kim BK, Kim DG et al (2001). Expression of cyclooxygenase-2 (COX-2) in hepatocellular carcinoma and growth inhibition of hepatoma cell lines by a COX-2 inhibitor, NS-398. Clin Cancer Res 7: 1410-1418. Brabletz T, Jung A, Spaderna S, Hlubek F, Kirchner T (2005). Opinion: migrating cancer stem cells - an integrated concept of malignant tumour progression. Nat Rev Cancer 5: 744-749. Breuhahn K, Longerich T, Schirmacher P (2006). Dysregulation of growth factor signaling in human hepatocellular carcinoma. Oncogene 25: 3787-3800. Buendia MA (2000). Genetics of hepatocellular carcinoma. Semin Cancer Biol 10: 185-200. Chen X, Cheung ST, So S, Fan ST, Barry C, Higgins J et al (2002). Gene expression patterns in human liver cancers. Mol Biol Cell 13: 1929-1939. Chiba T, Kita K, Zheng YW, Yokosuka O, Saisho H, Iwama A et al (2006). Side population purified from hepatocellular carcinoma cells harbors cancer stem cell-like properties. Hepatology 44: 240-251. de La Coste A, Romagnolo B, Billuart P, Renard CA, Buendia MA, Soubrane O et al (1998). Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc Natl Acad Sci U S A 95: 8847-8851. Eger A, Mikulits W (2005). Models of epithelial to mesenchymal transition. Drug Discovery Today: Disease Models 2: 57-63.

EPITHELIAL PLASTICITY OF HCC

133

Farazi PA, DePinho RA (2006). Hepatocellular carcinoma pathogenesis: from genes to environment. Nat Rev Cancer 6: 674-687. Fausto N (2004). Liver regeneration and repair: hepatocytes, progenitor cells, and stem cells. Hepatology 39: 1477-1487. Fischer AN, Fuchs E, Mikula M, Huber H, Beug H, Mikulits W (2006). PDGF essentially links TGF-beta signaling to nuclear beta-catenin accumulation in hepatocellular carcinoma progression. Oncogene [Epub ahead of print]. Fischer AN, Herrera B, Mikula M, Proell V, Fuchs E, Gotzmann J et al (2005). Integration of Ras subeffector signaling in TGF-{beta} mediated late stage hepatocarcinogenesis. Carcinogenesis: 931-942. Forbes S, Vig P, Poulsom R, Thomas H, Alison M (2002). Hepatic stem cells. J Pathol 197: 510518. Fougere-Deschatrette C, Imaizumi-Scherrer T, Strick-Marchand H, Morosan S, Charneau P, Kremsdorf D et al (2006). Plasticity of hepatic cell differentiation: bipotential adult mouse liver clonal cell lines competent to differentiate in vitro and in vivo. Stem Cells 24: 20982109. Friedman SL (2004). Mechanisms of disease: Mechanisms of hepatic fibrosis and therapeutic implications. Nat Clin Pract Gastroenterol Hepatol 1: 98-105. Friedman SL, Maher JJ, Bissell DM (2000). Mechanisms and therapy of hepatic fibrosis: report of the AASLD Single Topic Basic Research Conference. Hepatology 32: 1403-1408. Giannelli G, Bergamini C, Fransvea E, Sgarra C, Antonaci S (2005). Laminin-5 with transforming growth factor-beta1 induces epithelial to mesenchymal transition in hepatocellular carcinoma. Gastroenterology 129: 1375-1383. Gotzmann J, Fischer AN, Zojer M, Mikula M, Proell V, Huber H et al (2006). A crucial function of PDGF in TGF-beta-mediated cancer progression of hepatocytes. Oncogene 25: 3170-3185. Gotzmann J, Huber H, Thallinger C, Wolschek M, Jansen B, Schulte-Hermann R et al (2002). Hepatocytes convert to a fibroblastoid phenotype through the cooperation of TGF-beta1 and Ha-Ras: steps towards invasiveness. J Cell Sci 115: 1189-1202. Gotzmann J, Mikula M, Eger A, Schulte-Hermann R, Foisner R, Beug H et al (2004). Molecular aspects of epithelial cell plasticity: implications for local tumor invasion and metastasis. Mutat Res 566: 9-20. Kensler TW, Qian GS, Chen JG, Groopman JD (2003). Translational strategies for cancer prevention in liver. Nat Rev Cancer 3: 321-329. Lagasse E, Connors H, Al-Dhalimy M, Reitsma M, Dohse M, Osborne L et al (2000). Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 6: 1229-1234. Lee HC, Kim M, Wands JR (2006a). Wnt/Frizzled signaling in hepatocellular carcinoma. Front Biosci 11: 1901-1915. Lee JS, Thorgeirsson SS (2005). Genetic profiling of human hepatocellular carcinoma. Semin Liver Dis 25: 125-132. Lee TK, Man K, Poon RT, Lo CM, Yuen AP, Ng IO et al (2006b). Signal transducers and activators of transcription 5b activation enhances hepatocellular carcinoma aggressiveness through induction of epithelial-mesenchymal transition. Cancer Res 66: 9948-9956. Lee TK, Poon RT, Yuen AP, Ling MT, Kwok WK, Wang XH et al (2006c). Twist overexpression correlates with hepatocellular carcinoma metastasis through induction of epithelial-mesenchymal transition. Clin Cancer Res 12: 5369- 5376. Levy DE, Darnell JE, Jr. (2002). Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3: 651-662. Levy L, Renard CA, Wei Y, Buendia MA (2002). Genetic alterations and oncogenic pathways in hepatocellular carcinoma. Ann N Y Acad Sci 963: 21-36.

134

M. MIKULA ET AL.

Lowe SW, Sherr CJ (2003). Tumor suppression by Ink4a-Arf: progress and puzzles. Curr Opin Genet Dev 13: 77-83. Michalopoulos GK, DeFrances MC (1997). Liver regeneration. Science 276: 60-66. Mikula M, Fuchs E, Huber H, Beug H, Schulte-Hermann R, Mikulits W (2004). Immortalized p19ARF null hepatocytes restore liver injury and generate hepatic progenitors after transplantation. Hepatology 39: 628-634. Mikula M, Proell V, Fischer AN, Mikulits W (2006). Activated hepatic stellate cells induce tumor progression of neoplastic hepatocytes in a TGF-beta dependent fashion. J Cell Physiol 209: 560-567. Murakami Y, Saigo K, Takashima H, Minami M, Okanoue T, Brechot C et al (2005). Large scaled analysis of hepatitis B virus (HBV) DNA integration in HBV related hepatocellular carcinomas. Gut 54: 1162-1168. Notenboom RG, van den Berg Weerman MA, Dingemans KP, Vermeulen JL, van den Eijnde S, Reutelingsperger CP et al (2003). Timing and sequence of differentiation of embryonic rat hepatocytes along the biliary epithelial lineage. Hepatology 38: 683-691. Osada T, Sakamoto M, Ino Y, Iwamatsu A, Matsuno Y, Muto T et al (1996). E-cadherin is involved in the intrahepatic metastasis of hepatocellular carcinoma. Hepatology 24: 14601467. Pardal R, Clarke MF, Morrison SJ (2003). Applying the principles of stem-cell biology to cancer. Nat Rev Cancer 3: 895-902. Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N et al (1999). Bone marrow as a potential source of hepatic oval cells. Science 284: 1168-1170. Pinzani M, Rombouts K, Colagrande S (2005). Fibrosis in chronic liver diseases: diagnosis and management. J Hepatol 42 Suppl: S22-36. Proell V, Mikula M, Fuchs E, Mikulits W (2005). The plasticity of p19 ARF null hepatic stellate cells and the dynamics of activation. Biochim Biophys Acta 1744: 76-87. Roskams T (2006). Liver stem cells and their implication in hepatocellular and cholangiocarcinoma. Oncogene 25: 3818-3822. Rossmanith W, Schulte-Hermann R (2001). Biology of transforming growth factor beta in hepatocarcinogenesis. Microsc Res Tech 52: 430-436. Sell S (2001). Heterogeneity and plasticity of hepatocyte lineage cells. Hepatology 33: 738-750. Shafritz DA, Dabeva MD (2002). Liver stem cells and model systems for liver repopulation. J Hepatol 36: 552-564. Sherr CJ (2001). The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2: 731737. Tannapfel A, Busse C, Weinans L, Benicke M, Katalinic A, Geissler F et al (2001). INK4a-ARF alterations and p53 mutations in hepatocellular carcinomas. Oncogene 20: 7104-7109. Thorgeirsson SS, Grisham JW (2002). Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet 31: 339-346. Thorgeirsson SS, Grisham JW (2003). Overview of recent experimental studies on liver stem cells. Semin Liver Dis 23: 303-312. Tsou AP, Wu KM, Tsen TY, Chi CW, Chiu JH, Lui WY et al (1998). Parallel hybridization analysis of multiple protein kinase genes: identification of gene expression patterns characteristic of human hepatocellular carcinoma. Genomics 50: 331-340. Vassilopoulos G, Wang PR, Russel DW (2003). Transplanted bone marrow regenerates liver by cell fusion. Nature 422: 901-904. Vessey CJ, De La Hall PM (2001). Hepatic stem cells: a review. Pathology 33: 130-141. Wang X, Willenbring H, Akkari Y, Torimaru Y, Foster M, Al-Dhalimy M et al (2003). Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 422: 897-901.

EPITHELIAL PLASTICITY OF HCC

135

Xu XR, Huang J, Xu ZG, Qian BZ, Zhu ZD, Yan Q et al (2001). Insight into hepatocellular carcinogenesis at transcriptome level by comparing gene expression profiles of hepatocellular carcinoma with those of corresponding noncancerous liver. Proc Natl Acad Sci U S A 98: 15089-15094.

BLOOD VESSELS AS A SOURCE OF PROGENITOR CELLS IN HUMAN EMBRYONIC AND ADULT LIFE M. CRISAN1,5, B. ZHENG5,6, E. ZAMBIDIS4, S. YAP1,2,5, M. TAVIAN3, B. SUN1,5, J.P. GIACOBINO 1,5, L. CASTEILLA1,5,7, J. HUARD5,6 AND B. PÉAULT1,5,8* 1 Department of Pediatrics, Children’s Hospital of UPMC, Pittsburgh, PA, USA 2 Department of Human Genetics, University of Pittsburgh, Pittsburgh, PA, USA 3 INSERM U506, Hopital Paul Brousse, Villejuif, France 4 Divisions of Immunology and Hematopoiesis, Pediatric Oncology, Johns Hopkins University, Baltimore, MD, USA 5 Stem Cell Research Center, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA, USA 6 Department of Orthopaedic Surgery and Molecular Genetics and Biochemistry, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA, USA 7 University of Toulouse, Toulouse, France 8 McGowan Institute of Regenerative Medicine

Keywords: Endothelial cell; pericyte; stem cell; blood vessel; skeletal muscle

Abstract. Recent experimental results in culture and in vivo are summarized that show the existence of developmental relationships between cells that build up blood vessel walls and some previously unrelated tissues and organs. It was formerly demonstrated, in lower vertebrates as well as mammals, including humans, that discrete subsets of blood-forming endothelial cells play a key role in the emergence of the definitive hematopoietic system. We have also documented the existence in human skeletal muscle of endothelium-borne, extremely potent myogenic progenitor cells. Finally, we have characterized and purified perivascular cells – or pericytes – from human tissues and

______ * To whom correspondence should be addressed. Bruno Péault, Ph.D., Stem Cell Research Center, Children’s Hospital of Pittsburgh, Rangos Research Center, Pittsburgh, USA, e-mail: [email protected]

137 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 137–147. © 2008 Springer.

138

M. CRISAN ET AL.

demonstrated their ability to give rise to mesodermal differentiated derivatives, principally skeletal muscle. 1. Introduction The first adult-type tissues that emerge in embryonic life are blood and, simultaneously and necessarily, blood vessels. The chronologic and anatomic coincidence that exists in the emergence of hematopoietic and endothelial cells was long recognized by embryology pioneers (Sabin 1920), but only in recent years was this coincidence demonstrated to reflect a direct developmental affiliation between these two cell lineages (reviewed in Zambidis et al., 2006). Does the blood vessel wall play similar roles in organ development/repair/ regeneration at later stages and in post-natal life? Besides early embryonic multipotent stem cells and adult-type tissue-committed progenitors, multilineage stem cells diversely designated as MSC, MAPC or MDSC have also been extracted from numerous adult tissues such as brain, bone marrow, muscle and even fat (Beresford et al., 1992; Prockop, 1997; Pittenger et al., 1999; Toma et al., 2002, Qu-Petersen et al., 2002; Zuk et al., 2001). The primary culture methods used to grow these cells selectively from their tissues of origin has precluded their anatomic localization, consequently the ontogenic history and identity of these adult multipotent stem cells remain obscure. Related stem cells have, however, been derived from avian and mouse embryonic and postnatal blood vessel walls and named mesoangioblasts (Cossu and Bianco, 2003). It was hypothesized that blood vessels, through their ubiquitous distribution in the organism, could act as stem cell carriers and disseminate regenerative potential. We have explored the existence of such blood vessel-associated progenitors in human embryonic, fetal and adult tissues. We herein summarize recent experimental results showing that, in addition to embryonic hematopoiesis, both human endothelial cells and vascular pericytes are endowed with the potential to generate various mesodermal derivatives, including primarily skeletal muscle.

STEM CELLS FROM HUMAN BLOOD VESSELS

139

2. Blood-Forming Endothelium in the Embryo 2.1. HEMATOPOIETIC STEM CELLS ALWAYS EMERGE AT THE CONTACT OF ENDOTHELIAL CELLS, BOTH IN THE YOLK SAC AND THEN IN EMBRYO PROPER

In mammalian development, hematopoiesis takes place initially in the extraembryonic yolk sac, then proceeds transiently in the embryonic and fetal liver prior to being stabilized in the bone marrow. In the yolk sac, hematopoietic and endothelial cells emerge simultaneously within blood islands, which led embryologists to hypothesize that common mesodermal stem cells, or hemangioblasts, generate both cell lineages (Sabin 1920). Between yolk sac and hepatic hematopoieses, an additional intraembryonic phase of hematopoietic stem cell (HSC) production has also been characterized (reviewed in Godin and Cumano 2005, Dzierzak 2003). These embryo-derived HSC arise at the surface of endothelial cells in the dorsal aorta and vitelline artery. Lineage-marking experiments (Jaffredo et al., 1998, Nishikawa et al., 1998, North et al., 2002) have indeed suggested that discrete vascular endothelial cells transiently exhibit blood-forming potential during vertebrate development, as originally suggested by Sabin (1920) 2.2. MULTI-LINEAGE BLOOD STEM CELLS EMERGE IN THE FIRST MONTH FROM THE HUMAN EMBRYONIC AORTA

Developmental studies making use of human embryonic and fetal tissues have similarly demonstrated the origin of human definitive hematopoietic stem cells from endothelial cells with hematogenous potential. The hematopoietic cells clustered in the dorsal aorta and vitelline artery between 27 and 40 days of development are primitive hematopoietic progenitors (CD45+, CD34+, CD31+, CD38-, lin-, GATA-2+, GATA-3+, c-myb+, SCL/Tal1+, c-kit+, flk-1/KDR+) that can initiate long-term hematopoietic cultures, and yield a mixed progeny of myeloid and lymphoid cells, whereas the pre-circulation yolk sac can only produce myeloid cells (Tavian et al., 1996, 1999, 2001; Labastie et al., 1998). These results suggest that the human yolk sac only generates progenitors with limited developmental ability; the first and only stem cells endowed with multiple lympho-myeloid potentials emerge independently, as a second autonomous wave, in the aorta. These intra-embryonic HSCs are likely to colonize the liver rudiment, and eventually give rise to definitive adult blood cells (reviewed in Tavian and Péault, 2005). Hematopoietic potential in culture was detected in the caudal splanchnopleura, an endo-mesodermal layer that includes the two aortic rudiments, as early

140

M. CRISAN ET AL.

as day 19 (i.e., eight days before the appearance of recognizable HSC). This demonstrates that the potential to form blood is intrinsic to this intraembyonic territory, and that HSC do not merely migrate from the yolk sac into the dorsal aorta. 2.3. HEMOGENIC ENDOTHELIUM IN THE HUMAN EMBRYO

Intraembryonic HSC emerge as scattered CD34+CD45+ cells firmly attached to the endothelium of the aorta, and intimate contact between both cell types was confirmed by semi-thin section histology (Tavian et al., 1999). This further suggested that blood cell progenitors arise from an endothelium-like ancestor cell, or hemogenic endothelium. To investigate the role of embryonic endothelium as a forerunner of blood cells, vascular endothelial (CD34+ CD31+ CD45-) cells were stringently purified by flow cytometry from the human yolk sac, dorsal aorta, embryonic liver and fetal bone marrow, and their potential to give rise to blood cells was tested in co-culture with the MS-5 mouse stromal cell line, which supports the multilineage, long-term development of human hematopoietic stem cells. Endothelial cells sorted from human yolk sac and embryonic aorta, but also, less expectedly, from the embryonic liver and fetal bone marrow established long-term hematopoietic cultures, which suggested that endothelium-borne hematopoietic cells are not restricted to the embryonic aorta (Oberlin et al., 2002). The frequency of blood-forming endothelial cells in hematopoietic organs was observed to be closely correlated with developmental stages. It was highest, for instance, in the dorsal aorta region at days 27-28, marking the onset of HSC production in this territory. Importantly, no hematopoietic potential was ever detected among endothelial cells purified from fetal thymus, spleen, or other non-hematopoietic tissues such as the heart, fetal aorta, pancreas, lung or umbilical cord (Oberlin et al., 2002). 2.4. EMBRYONIC ORIGIN OF BLOOD-FORMING ENDOTHELIAL CELLS IN THE HUMAN EMBRYONIC AORTA

Aortic endothelial cells have no hematopoietic potential prior to the emergence of HSC clusters at day 27 of development (Oberlin et al., 2002 and unpublished observations). At earlier stages, blood cell potential in the para-aortic region of the embryo is confined within non-endothelial cells. We assumed that the aorta is colonized, shortly before day 27, by hemangioblastic progenitors of which we are currently evaluating candidate markers (reviewed in Tavian et al., 2005). One of these markers, the receptor 2 for VEGF, flk-1, aka KDR in the human species, is detected in splanchnopleural non-endothelial, CD34-negative cells as early as day 21 of development. These cells later migrate dorsally toward the

STEM CELLS FROM HUMAN BLOOD VESSELS

141

aorta and flk-1/KDR is later detected in both aortic endothelial cells and associated HSC (Cortes et al., 1999). 2.5. HUMAN EMBRYONIC STEM CELLS CAN MODEL EMERGING ANGIO-HEMATOPOIESIS

We have recently described methods for generating human hematopoietic cells in vitro from human embryonic stem cells (hHES) through distinct hematoendothelial, primitive, and definitive stages in a manner that appears to recapitulate human yolk sac and, possibly, aorta development (Zambidis et al., 2005). Undifferentiated (day 0) hESC expressed CD117, CD133 and KDR/flk1, but not CD34 and CD31. CD34 and CD31 protein expression peaked at ~12-15 days of embryoid body (hEB) development. CD45 was expressed on 1-3% of hEB cells, and not until ~15-30 days. Expression of hematopoietic transcriptional regulators (SCL/TAL1, CDX4, GATA1, GATA2, EKLF and PU.1) coincided, after one week, with a similar increase in CD31, CD34, and flk1/KDR. Thus, hESC differentiate into embryoid body precursors expressing hemato-endothelial surface markers and regulatory genes in a sequence similar to that described during normal human development. Interestingly, hEB cells grown in serum-free semi-solid medium gave rise to novel mesodermalhemato-endothelial (MHE) colonies detected as adherent clusters of endothelium-like cells with an affinity for acetylated LDL (a hallmark of endothelial cells) from which erythroblast colonies rapidly budded. Large numbers of CD45+ hematopoietic cells were subsequently produced from MHE colonies. Our assay conditions revealed two distinct waves of primitive, then definitive hEB-derived hematopoiesis through the MHE intermediate stage. We confirmed that embryonic endothelial cells (CD45-CD31+CD34+) sorted from day 9-10 hEB can give rise in vitro to CD45+ erythro-myeloid cells, as well as CD56+ NK cells. In summary, this hESC differentiation system provides an in vitro model for human embryonic angio-hematopoiesis, with sequential expression of early hematopoietic genes and a resemblance to human yolk sac, and possibly aorta development (Zambidis et al., 2005, 2006). 3. Mesodermal Stem Cells in the Walls of Human Blood Vessels Several types of multipotent cells have been described in adult human and mouse organs. MSC (mesenchymal stem cell, or marrow stromal cell) can differentiate into mesodermal cells (Beresford et al., 1992; Prockop, 1997; Pittenger et al., 1999; Toma et al., 2002) and a rare subset of multipotent adult progenitor cells (MAPC), initially identified in adult bone marrow, can give rise to derivatives of all three germ layers (Jiang et al., 2002). Cells resembling

142

M. CRISAN ET AL.

MSC and MAPC are present in mouse brain (Jiang et al., 2002), pancreas (Seaberg et al., 2004), dermis (Toma et al., 2001) and skeletal muscle (QuPetersen et al., 2002) as well as in human skin (Shih et al., 2005) and fat tissue (Zuk et al., 2001; Rodriguez et al., 2005). These multi-lineage cells have all been isolated retrospectively from cultured tissues. Therefore, the identity and localization of these stem cells within organs are unknown. The walls of blood vessels appeared as a possible repository for such pan-organ stem cells since almost all tissues are vascularized. The existence of blood vessel-associated stem cells has already been supported by the description and characterization of mesoangioblasts (Cossu et al., 2003). We have therefore explored the possibility that cells that build up blood vessel walls include multi-lineage progenitor cells. 3.1. A NOVEL SUBSET OF MYOGENIC CELLS AFFILIATED WITH VASCULAR ENDOTHELIUM IN HUMAN SKELETAL MUSCLE

We have used multi-color section immunostaining and confocal microscopy analysis, as well as flow cytometry, to demonstrate the existence in human skeletal muscle of a novel subset of satellite cells that also express endothelial cell markers. We have named these cells, which represent less than 0.5% of the total skeletal muscle population, myo-endothelial cells. Indeed, these cells can be typified as CD56+ CD34+ CD144+ CD45- and sorted accordingly. Myoendothelial cells and, in parallel, genuine CD56+ CD34- CD144- CD45myogenic cells and CD34+ CD144+ CD56- CD45- endothelial cells were sorted and injected into cardiotoxin injured SCID mouse skeletal muscles. In this setting, both muscle endothelial cells and myo-endothelial cells, in addition to regular myogenic cells, generated human muscle fibers but myo-endothelial cells were nearly 10 times more efficient, quantitatively, than the two other cell subsets (Zheng et al., 2007). Moreover, myogenic potential is maintained in long-term cultured human muscle endothelial, myo-endothelial and myogenic cells, and cultured myo-endothelial cells still exhibited stronger myogenic potential than cultured endothelial cells and myogenic cells. This is of significance in the perspective of a clinical utilization of these novel progenitor cells (Zheng et al., 2007). In further support of the idea that a developmental relationship exists between vascular cells and myogenic cells, total muscle cells or sorted professional myogenic progenitors cultured in endothelial cell growth medium gave rise to numerous cells co-expressing myogenic and endothelial cell markers (Zheng et al., 2007). Finally, vascular endothelial cells purified from adult human pancreas and adipose tissue can also support myofiber regeneration (Crisan et al., and Yap et al., under revision).

STEM CELLS FROM HUMAN BLOOD VESSELS

143

3.2. DEVELOPMENTAL POTENTIAL OF HUMAN VASCULAR PERICYTES

Pericytes closely surround endothelial cells in capillaries, veinules and arterioles (Andreeva et al., 1998) and regulate microvessel contractility (reviewed in Betscholtz et al., 2005). Pericytes have also been suggested to have the potential to differentiate into chondrocytes, adipocytes, osteocytes and odontoblasts (Farrington-Rock et al., 2004; Collett et al., 2005; Alliot-Licht et al., 2005), although this was only demonstrated on pericyte-enriched cultures, and never on purified pericytes. As a prerequisite to human pericyte purification, we have characterized by immunohistochemistry a combination of markers for this elusive cell population. We observed that coexpression of CD146 and NG2 marks pericytes in all human tissues analyzed. In contrast, pericytes do not express endothelial cell antigens such as CD144, von Willebrand factor (vWF), CD34, CD31 and the Ulex europaeus lectin receptor (UEA-1R). CD146+ CD34- CD45- CD56- CD144- UEA-R- pericytes were sorted by FACS from human skeletal muscle and cultured in myocyte proliferation medium, then fusion medium. In these conditions, skeletal musclederived pericytes formed multinucleated myotubes expressing myosin heavy chain. Sorted pericytes were then injected into SCID-NOD mouse cardiotoxininjured skeletal muscles where they differentiated into human myotubes. Pericytes (CD146+ CD45- CD34- CD144- CD56-), myoblasts (CD146- CD45CD34- CD144- CD56+) and unseparated muscle cells generated, respectively, 20.1 ± 11.9, 13.3 ± 5.7 and 3.0 ± 2.5 myofibers per 103 cells injected. Muscle derived pericytes could be also cultured for at least 5 months while retaining their ability to differentiate into myofibers in culture and in vivo (Crisan et al., under revision). Importantly, pericytes sorted from adult fat tissue or pancreas exhibited the same myogenic potential as skeletal muscle pericytes (Yap et al., under revision). Pericytes have next been sorted by flow cytometry, using the same combination of cell surface marker antigens, from a broader variety of human tissues including placenta, lung and bone marrow. Preliminary experiments addressing the multi-lineage developmental potential of pericytes indicate that these cells, regardless of their organ of origin, can also differentiate into bone, cartilage and fat cells. 4. Conclusion We have, in the studies summarized in this chapter, explored some of the contributions that cells building up human blood vessel walls can provide to embryonic development and post-natal tissue repair. Sabin (1920) first proposed that blood cells sprout from embryonic vascular endothelium but it is only at the end of the century that investigators employed cell marking, cell sorting,

144

M. CRISAN ET AL.

and transgenesis techniques to demonstrate the existence of blood-forming endothelial cells in avian and mammalian embryos (Jaffredo et al., 1998, Nishikawa et al., 1998, North et al., 2002, Oberlin et al., 2002, Bollerot et al., 2005). This mechanism of blood cell generation was conserved along phylogeny since similar hematogenous embryonic aortic cells have been evidenced in amphibians and fish (Ciau-Uitz et al., 2000, Gering and Patient 2005). Recent availability of human embryos to experimentation, as well as the development of laboratory assays for human angiogenesis and hematopoiesis, have provided insight into human developmental hematology. The multipotent HSC that found definitive human hematopoiesis emerge in the truncal arteries and not in the extraembryonic yolk sac as previously assumed (Tavian et al., 1996, 1999, 2001). We have further demonstrated that these human HSC arise from hematogenous endothelial cells (Oberlin et al., 2002), as is the case in all vertebrate animals investigated so far. Whether hematogenous endothelial cells persist in the adult bone marrow has not yet been definitively determined. Expression by endothelial cells of chronic myeloid leukemia patients of the bcr-abl mutation may indirectly suggest such an affiliation between adult endothelial and hematopoietic cells (Gunsilius et al., 2000). Our own preliminary data indicate that a rare subset of endothelial cells from human adult bone marrow can generate hematopoietic cells in culture (unpublished results). It is also of major significance that we have mimicked a developmental transition between endothelial cells and blood cells in the model of human embryonic stem cells. We have demonstrated yolk sac-type hematopoiesis from hESCderived hematogenous endothelial cells and are now trying to produce definitive HSC similar to those derived from large intraembryonic blood vessels. The derivation and culture of hemangioblasts, or blood-forming endothelial cells, from human ES cells may offer an unlimited source of both HSC and endothelial cell progenitors for human tissue engineering. Besides hematopoiesis, some of the results reported above show the existence of a myogenic potential within the walls of blood vessels, i.e. endothelial cells and pericytes. In addition, a novel subset of muscle-derived myo-endothelial cells exhibit a robust myogenic potential and may represent a developmental intermediate between endothelial cells and myogenic cells. A normal role for vascular cells in the development and/or regeneration of human muscle remains to be demonstrated, though, notably because a similar myogenic potential is present within pericytes and endothelial cells purified from pancreas, fat and other tissues. In addition to myogenesis, we have detected in pericytes purified from human tissues a broader ability to differentiate into bone, cartilage and adipocytes (Zheng et al., 2007), in agreement with published preliminary results (Farrington-Rock et al., 2004;

STEM CELLS FROM HUMAN BLOOD VESSELS

145

Collett et al., 2005; Alliot-Licht et al., 2005). This suggests the dissemination throughout organs of multi-lineage stem cells, which may be at the origin of MSC, MAPC, MDSC and other adult stem cells identified retrospectively in culture. Blood vessel walls thus may harbor a dormant reserve of multi-lineage stem cells that could be recruited in emergency situations, when professional tissue specific progenitors have been exhausted. The blood vessel-derived novel myogenic progenitors we have described can be sorted, by flow cytometry, from muscle and even more accessible sources such as fat tissue and bone marrow; cells can then be cultured extensively, with no significant loss of developmental potential. The transplantation of autologous blood vessel-related progenitors could, therefore, be envisioned as a therapy for human muscle diseases.

References Alliot-Licht B, Bluteau G, Magne D, Lopex-Cazaux S, Lieubeau B, Daculsi G and Guicheux J (2005). Dexamethasone stimulates differentiation of odontoblast-like cells in human dental pulp cultures. Cell Tissue Sep;321(3):391-400. Andreeva ER, Pugach IM, Gordon D and Orekhov AN (1998). Continuous subendothelial network formed by pericyte-like cells in human vascular bed. Tissue Cell 30:127-135. Beresford JN, Bennett JH, Devlin C, Leboy PS and Owen ME (1992). Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J Cell Sci 102 (Pt 2):341-351. Betsholtz C, Lindblom P and Gerhardt H (2005). Role of pericytes in vascular morphogenesis. EXS 2005:115-125. Bollerot K., Sugiyama D, Escriou D, et al: (2005). Widespread lipoplex-mediated gene transfer to vascular endothelial cells and hemangioblasts in the vertebrate embryo. Dev. Dyn (in press). Ciau-Uitz A, Walmsley M and Patient R: (2000). Distinct origins of adult and embryonic blood in Xenopus. Cell 102:787-796. Collett GD and Canfield AE (2005). Angiogenesis and pericytes in the initiation of ectopic calcification. Circ Res 96:930-938. Cortes F, Debacker C, Péault B, Labastie MC: (1999). Differential expression of KDR/VEGFR-2 and CD34 during mesoderm development of the early human embryo. Mech. Dev. 83:161164. Cossu, G. and Bianco, P. (2003). Mesoangioblasts–vascular progenitors for extravascular mesodermal tissues. Curr Opin Genet Dev. 13:537-542 Dzierzak E: (2003). Ontogenic emergence of definitive hematopoietic stem cells. Curr. Opin. Hematol. 10:229. Farrington-Rock C, Crofts NJ, Doherty MJ, Ashton BA, Griffin-Jones C and Canfield AE (2004). Chondrogenic and adipogenic potential of microvascular pericytes. Circulation 110:22262232.

146

M. CRISAN ET AL.

Gering M and Patient R: (2005). Hedgehog signaling is required for adult blood stem cell formation in zebrafish embryos. Developmental Cell 8:389-400. Godin I and Cumano A: (2005). Of birds and mice: hematopoietic stem cell development. Int. J. Dev. Biol. 49:251-257. Gunsilius E, Duba HC, Petzer AL, et al: (2000). Evidence from a leukaemia model for maintenance of vascular endothelium by bone-marrow-derived endothelial cells. Lancet 355:1688-1691. Jaffredo T, Gautier R, Eichmann A, Dieterlen-Lievre F: (1998). Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny. Development 125:4575-4583. Jiang Y, Vaessen B, Lenvik T, Blackstad M, Reyes M and Verfaillie CM (2002). Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle, and brain. Exp Hematol 30:896-904. Labastie MC, Cortés F, Roméo PH, Dulac C and Péault B: (1998). Molecular identity of hematopoietic precursor cells emerging in the human embryo. Blood 92:3624-3635. Nishikawa SI, Nishikawa S and Kawamoto H, et al: (1998). In vitro generation of lymphohematopoietic cells from endothelial cells purified from murine embryos. Immunity 8:761-769. North TE, de Bruijn MF and Stacy T, et al: (2002). Runx1 expression marks long-term repopulating hematopoietic stem cells in the midgestation mouse embryo. Immunity 16(5):661-72. Oberlin E, Tavian M, Blazsek I and Péault B (2002). Blood-forming potential of vascular endothelium in the human embryo. Development. 129(17):4147-57. Pittenger MF, MacKay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S and Marshak DR (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284:143-147. Prockop DJ (1997). Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 276:71-74. Qu-Petersen Z, Deasy BM, Jankowski R, Ikezawa M, Cummins J, Pruchnic R, Cao B, Mytinger J, Gates C, Wernig A and Huard J (2002). Identification of a novel population of muscle stem cells in mice: potential for muscle regeneration. J Cell Biol 157:851-864. Rodriguez AM, Pisani D, Dechesne CA, Turc-Carel C, Kurzenne JY, Wdziekonski B, Villageois A, Bagnis C, Breittmayer JP, Groux H, Ailhaud G. and Dani C (2005). Transplantation of a multipotent cell population from human adipose tissue induces dystrophin expression in the immunocompetent mdx mouse. J Exp Med. May 2;201(9):1397-405. Sabin, FR: (1920). Studies on the origin of blood vessels and of red blood corpuscles as seen in the living blastoderm of checks during the second day of incubation. Carnegie Inst. Wash. Pub. n°272, Contrib. Embryol. 9:214. Seaberg RM, Smukler SR, Kieffer TJ, Enikolopov G, Asghar Z, Wheeler MB, Korbutt G and van der Kooy D (2004). Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nat Biotechnol 22:1115-1124. Shih DT, Lee DC, Chen SC, Tsai RY, Huang CT, Tsai CC, Shen EY and Chiu WT (2005). Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue. Stem Cells 23:1012-1020. Tavian M, Coulombel L, Luton D, Clemente HS, Dieterlen-Lievre F and Peault B: (1996). Aortaassociated CD34+ hematopoietic cells in the early human embryo. Blood 87:67-72. Tavian M, Hallais MF, Péault B: (1999). Emergence of intraembryonic hematopoietic precursors in the pre-liver human embryo. Development 126:793-803. Tavian M, Robin C, Coulombel L and Péault B: (2001). The human embryo, but not its yolk sac, generates lympho-myeloid stem cells. mapping multipotent hematopoietic cell fate in intraembryonic mesoderm. Immunity 15:487-495.

STEM CELLS FROM HUMAN BLOOD VESSELS

147

Tavian M and Péault B: (2005). Embryonic development of the human hematopoietic system. Int J Dev Biol. 49:243-50. Toma JG, Akhavan M, Fernandes KJ, Barnabe-Heider F, Sadikot A, Kaplan DR and Miller FD (2001). Isolation of multipotent adult stem cells from the dermis mammalian skin. Nat Cell Biol 3:778-784. Toma C, Pittenger MF, Cahill KS, Byrne BJ and Kessler PD (2002). Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105:93-98. Zambidis ET, Péault B, Park TS, Bunz F and Civin CI: (2005). Hematopoietic differentiation of human embryonic stem cells progresses through sequential hemato-endothelial, primitive, and definitive stages resembling human yolk sac development. Blood 106:860-870. Zambidis E, Oberlin E, Tavian M and Peault B (2006). Blood-forming endothelium in human ontogeny: lessons from in utero development and embryonic stem cell culture. Trends in Cardiovascular Medicine 16(3):95-101. Zheng B, Cao B, Crisan M, Sun B, Li G, Logar A, Yap S, Pollet JB, Drowley L, Cassino T, Gharabei B, Deasy BM, Huard J and Peault B (2007). Prospective identification of myogenic endothelial cells in human skeletal muscle. Nat Biotechnol, in press. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP and Hedrick MH (2001). Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7:211-228.

III STEM CELLS AND MALIGNANCY

STEM CELLS AND LEUKEMIA VOLODYMYR BEBESHKO, DIMITRY BAZYKA* Research Centre for Radiation Medicine,, Kyiv, Ukraine

Keywords: stem cells; radiation; leukemia; Chernobyl

Abstract. Studies performed at RCRM have shown that hematopoietic and immune systems’ reconstitution after irradiation depends greatly on the functional abilities of the stem cells. Subset analysis and expression of CD34+ antigens on bone marrow and peripheral blood cells were studied in Chernobyl accident clean-up workers including patients with leukemia and myelodysplasia and patients exposed to the natural levels of irradiation. In myelodysplasia the elevation of early CD34+ cells was detected in bone marrow and peripheral blood. In leukemia the CD34+117+38- primitive progenitor cell counts were elevated mainly in patients with proliferation of poorly differentiated cells while in ALL’s the CD34+ counts were smaller. Circulating HSC and progenitors after radiation exposure in a wide range of doses have are preserved in a number and with proliferation potencies sufficient for the onset of clonal proliferation. In AML FLT3 mutations are the most abundant single-gene mutations. There is no difference in prevalence of FLT3 mutations in groups of radiation-associated and spontaneous AML cases. LOH/deletions at 5q and/or 7q and 7р tend to be more frequent in radiation-associated AML cases. Bone marrow and bone tissue microenvironment plays a key role in normal and neoplastic HSC changes. Differentiation to B-lineage isn’t changed and is associated with B-cell compartment growth. 1. Introduction The main property of hematopoietic stem cells (HSCs) is the ability to balance self-renewal versus differentiation cell fate decisions to provide sufficient

______ * To whom correspondence should be addressed. Dimitry Bazyka, Dept. of Clinical Immunology, Research Centre for Radiation Medicine, Melnikova 53, Kyiv, 04050 Ukraine, e-mail: [email protected]

149 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 149–161. © 2008 Springer.

150

V. BEBESHKO AND D. BAZYKA

primitive cells to sustain hematopoiesis by the asymmetric cell division (Ho, 2005). The target of cell-transforming mutations is still unknown. Because normal stem cells and leukemic stem cells (LSC) share the ability to self-renew, as well as various developmental pathways, it has been postulated that LSCs are HSCs that have become leukemic as the result of accumulated mutations. LSCs could derive from more committed progenitors or even a differentiated mature cell, which would have first to reacquire the self-renewal capacity before accumulating additional mutations (D. Bonnet, 2005). Several questions appear to be addressed: are there any specific SC in leukemia and what makes HSC leukemic; what is the specificity of these SC and can we distinguish them from normal cells; could SC in leukemia in differentiate to normal hemopoietic progenitors; could leukemic HSC or their progeny de-differentiate to nonhemopoietic neoplastic clones; what is the place of ionizing radiation in this process? Leukemia holds a special place in the study of radiation-related cancer because bone marrow is one of the tissues most sensitive to the carcinogenic effect of ionizing radiation, radiogenic leukemia has the shortest latent period among radiation-induced cancers, and its appearance suggests that solid tumors may follow. A retrospective case-control study of ionizing radiation and leukemia that was conducted in a cohort of 110,645 male Ukrainian radiation workers involved in cleanup work following the accident at the Chernobyl nuclear power plant in northern Ukraine which occurred on April 26, 1986 has demonstrated the excess of leukemia radiation risks at doses higher that 100 mSv (Romanenko et al., 2006) 8-14 years after the radiation exposure. Similar data was obtained in Russia (Ivanov et al., 1997). At high dose level leukemia rates are increased. The aim of this study was to explore if the HSC and progenitor cells after radiation exposure at different levels have the self-renewal capacity needed for leukemia induction and do HSC undergo subsequent mutation process? 2. Patients and Methods The study was performed in patients exposed to ionizing radiation after Chernobyl accident. Comparison groups included patients and healthy individuals exposed to the natural radiation levels. Control group included healthy volunteers who resided in Kyiv since Chernobyl accident Distribution by diagnosis is presented at table 1. Investigated persons were at the age of 4372 (mean+SD for the exposed group: 52,3 + 10,1 yrs; for control group- 46,3 + 11,3 yrs). All studied persons participated by informed consent. Peripheral blood and bone marrow samples were obtained by a standard procedure (National. Committee for Clinical Laboratory Standards, 1991). Flow

STEM CELLS AND LEUKEMIA

151

cytometry was performed on FACScan flow cytometer according to the standard recommendations (National. Committee for Clinical Laboratory Standards, 1992). Interphase FISH was performed using the dual-color probes (Vysis, Downers Grove, USA) according to the manufacturer’s instructions. AMLI/ETO fusion gene detection by RT-PCR. Genomic DNA was extracted from bone marrow or peripheral blood samples preserved frozen at –70°C using the QIAamp DNA extraction kit (Quiagen, Hilden, Germany). Irradiation doses for exposed at high dose levels were obtained by chromosome aberration assay performed at the RCRM laboratory of Cytogenetics (head- prof. M.Pilinska), for other groups of accident recovery workers doses were obtained from the State Chernobyl registry of Ukraine. For nuclear workers doses were provided by the RCRM department of dosimetry (head- prof. I.Likhtarev). TABLE 1. Groups of patients Patient groups by diagnosis

Number of patients

Radiation-exposed: Post-irradiation myelodepression

7

Hypoplastic anemia

8

Osteomyelofibrosis

9

Myelodysplastic syndrome (MDS)

14

Leukemia

53

Comparison groups exposed at natural radiation levels: Non-exposed control

23

Nuclear workers

37

Leukemia and MDS

70

2.1. CD34+ CELL SUBSETS IN RADIATION-INDUCED LEUKEMIA AND MYELODYSPLASIA

Studies performed at RCRM have shown that hematopoietic and immune systems’ reconstitution after irradiation depends greatly on the functional abilities of the stem cells. Subset analysis and expression of CD34+ antigens on bone marrow and peripheral blood cells were studied in Chernobyl accident clean-up workers including patients with leukemia and myelodysplasia and patients exposed to the natural levels of irradiation (table 2).

152

V. BEBESHKO AND D. BAZYKA

TABLE 2. CD34+38- cell counts in bone marrow and peripheral blood in patients exposed to ionizing radiation during cleanup works at Chernobyl Patient groups by diagnosis

Number of patients

CD34+38- cell percent Bone marrow

Peripheral blood

Mean

Mean

+SE

+SE

Post-irradiation myelodepression

7

0,81

0,05

0,03

0,01

Hypoplastic anemia

8

2,02

0,13

0,52

0,31

Myelodysplastic syndrome

14

6,34*

0,27

9,11*

1,3

Osteomyelofibrosis

9

1,21

0,11

0,12

0,02

Non-exposed control

23

0,99

0,03

0,09

0,01

* - difference is significant by Student test, p < 0,05.

Stable myelodepression 10-17 years after the acute hematologic syndrome in emergency workers exposed at the first hours of the accident exhibited tendencies of decrease of CD34+ progenitor counts mainly in peripheral blood but not in bone marrow. Low numbers of early primitive CD34+38- progenitors correlated with myelodepression and were shown predominantly in patients exposed to the total body gamma-irradiation at doses exceeding 2 Gy. These cases demonstrate stable combined immune deficiency. However the CD34 fluorescence intensity (FI) representing antigen expression wasn’t significantly changed (mean + SE correspondingly 542,2+35,7 in myelodepression; 499,8+41,2 in non-exposed control). In hypoplastic anemia СD34+38- progenitor cell count was increased as comparing to control with normal FI (529,8+47,4). Counts of lineage-committed lymphoid CD34+HLADR+ and CD34+19+ progenitor cells were not changed; CD34+33+ myelo-monocyte lineage progenitor cell counts were decreased. In myelodysplasia the prominent elevation of early CD34+ cells was detected in bone marrow and peripheral blood. In 6 cases of MDS with refractory anemia with the excess of blasts (RAEB) the abnormally localized immature precursors were demonstrated morphologically. In leukemia the CD34+117+38- primitive progenitor cell counts were elevated mainly in patients with proliferation of poorly differentiated cells while in ALL’s the CD34+ counts were smaller (M=0,820, SD=0,185). Number of progenitors of the next stage of differentiation (CD34+33-) were increased in exposed with acute leukemia, myelodysplasia. and acute myelogenous monoblastic leukemia (AMML) indicating the presence of more differentiated cells. In acute lymphoblastic leukemia numbers were significantly lesser. Onset of the ALL was not associated with an increase of B-lineage CD34+ progenitors (fig. 1). To the contrary the clonal proliferation of myelo-monoblastic cells was associated with increased numbers of lymphoid progenitors. This was demonstrated also in CML. In 1/3 of CML cases including the radiation-induced, elevated expression of early B-lineage antigens is shown – Tdt, CD10, HLADR,

STEM CELLS AND LEUKEMIA

153

1.2

1

0.8

0.6

0.4

0.2

+ −Std. Dev. + −Std. Err.

0 Control

MDS

ALL

Mean

Figure 1. Percentage of CD34+33-19+ cells in acute lymphoblastic leukemia and myelodysplasia.

CD19, CD20 as well as immunoglobulin gene rearrangement, that induces speculations about the concept of lineage specificity. In myelogenous leukemia the highest CD34+33+ cell counts were detected in FAB M4 and M5 subtypes. In ALL CD34+33+ progenitors weren’t detected except of 1 case. In FAB М0-М1 blast cells co-expressed low density CD34 together with high density HLADR and also CD33 and CD38. Myeloid progenitor cell number in myelodysplasia was significantly higher (fig. 2). 24 x 10−1 20 16 12 8 4 + −Std. Dev. + −Std. Err.

0 −4 Control

MDS

AML

Mean

Figure 2. Percentage of CD34+33+117+ cells in acute myelogenous leukemia and myelodysplasia.

154

V. BEBESHKO AND D. BAZYKA

These changes could represent the preservation of the compensatory abilities of early progenitors at the late period after radiation exposure. Differences could be explained by the changes of homeostatic conditions of bone-marrow microenvironment and the immune control including the decreased production of GM-CSF possessing marked differentiating and radioprotective effects and possibly other factors of lymphocytic origin. In our study G-CSF and erythropoietin in vitro induced the elevation of CD34 antigen expression as well as CD33 and HLADR on CD34+cells (p<0,05) but not CD38 FI changes. Effect was shown in control group as well as in radiationexposed patients with the increased PB or BM CD34+38- cell counts. CD34+33+HLADR+ eosinophil progenitors after G-CSF stimulation was decreased from 2,3 х 10-3 to 7,5 х 10-4 (p<0,02). Using a stroma-based culture system supplemented with early acting cytokines, existence of a very primitive human progenitor, the myeloid-lymphoid initiating cell (ML-IC), capable of generating multiple secondary progenitors that have the ability to reinitiate long-term multilineage haematopoiesis was shown (Theunissen & Verfaillie, 2005). Earlier studies of CD34+ cell genome have detected the presence of genes encoding clusters of differentiation of early differentiation and multilineage antigens CD43, CD44, CD53, CD69, CD71, CD82. At our study culture of CD34+117+ cells from 5 radiation exposed patients with myelodepression and 3 with radiation-induced AML using hTERT-bj1 cells as a base and SCF, a significant increase of CD33, 19, 71 antigen expression was registered after 72-96 hours of culture. Cells were characterized by high expression of bcl-2 and low of Fas- (CD95) antigens. Additional information about the influence of ionizing radiation and hematopoietic stem cell proliferation was obtained at a study of the nuclear workers at the professional levels of exposure. We have studied stem cells in 37 construction workers engaged at the stabilization works at the destroyed Chernobyl power station IV reactor (Shelter) during 2004-2005. Doses of gamma-exposure were in the limits of 2–15 mSv, alpha- less than 1 mSv. Duration of exposure was from 3 to 6 months. CD34+117+90+ early hematopoietic progenitor cell counts were significantly elevated in peripheral blood in comparison with control (mean + SE: 0,32 + 0,07). Elevated expression was shown for nuclear antigen PCNA, anti-apoptotic bcl-2 together with increased cell activation in Con A test and low p53 and CD95 cell fractions. This was associated with over-expression of tyrosine-kinases at different stages of T-cell differentiation (ZAP-70) that could promote cell activation changes. The signaling properties of Ab and Ag receptors are dependent upon immunoreceptor tyrosine-based activation motif (ITAM)

STEM CELLS AND LEUKEMIA

155

phosphorylation and activation of SH2-containing protein tyrosine kinases. The inhibition of protein-tyrosine kinase-dependent pathways by ITIM-bearing receptors is a general strategy of control of cell activation that is used inside and outside of the hematopoietic compartment. Correlation analysis was performed to study relationships between progenitor cells at various stages of differentiation. In ALL a negative correlation was shown between CD10+ progenitors and stem cell numbers (Spearman r = –0,44). In AML high CD34+33-cell counts were associated with elevated CD34+33+ progenitor counts (Spearman r = 0,62), indicating the absence of differentiation block (fig. 3).

Figure 3. Scatterplot of dependency of CD34+33+ myeloid progenitor cell counts (Y axis, cells per 10-3) from CD34+33- cell number (axis X, cells per 10-3).

Our data indicate the existence of effects at least at several levels of CD34+cells – from primitive CD34+33-38-cells to myeloid CD34+HLADR+33+ and lymphoid CD34+HLADR+19+10+/- progenitors. Comparative analysis of bone marrow and peripheral blood CD34+ cells showed the delayed maturation of the last group. Mechanisms by which ionizing radiation induces leukemia are of fundamental importance. Secondary myelodysplastic syndrome (MDS) is referred as one of stochastic late radiation effects and a stage for leukemia development. CD34+ cell counts were elevated both in BM and PB and significantly higher than in non-exposed. Blasts were identified as

156

V. BEBESHKO AND D. BAZYKA

CD34+CD38+HLADR+CD13+CD33+71(low) with lower HLADR expression. CD34+38- cell counts were elevated both in BM and PB and significantly higher than in non-exposed. And a presence of abnormally localized immature precursors was demonstrated. Stem cell number in exposed with MDS was lower than in acute leukemia but higher than in non-exposed control. 2.2. BONE TISSUE AND BONE MARROW MICROENVIRONMENT

Stem cell ability to repopulate bone marrow after irradiation or myeloablative treatment regimens greatly depends on the status of microenvironment. A study was performed on the influence of bone marrow microenvironment, persistent viral infection and vitamin D3 deficiency on the functional abilities of stem cells in healthy adults, leukemia and myelodysplasia patients after low-dose radiation exposure. It was found that hemopoietic microenvironment disorders play a provocative role and induce the transformation of dishemopoietic changes into acute and chronic leukemia in radiation-exposed. Instability of stroma cells membrane, changes of in vitro proliferative activity of stromal hemopoietic progenitor cells and forming of a pathologic clone are the signs of disintegration of the microenvironment cellular elements and destructive processes of extracellular matrix structure which were demonstrated in the exposed patients with acute and chronic leukemia. Myelofibrosis with myeloid dysplasia were shown in bone marrow with prevalence of stroma component above myeloid tissue, nodular and diffuse reticular cells with the forming of the fibrous structure, reticular fibrosis of different grade (fig. 4).

STEM CELLS AND LEUKEMIA

157

Figure 4. Patient N., 57 years, dose of exposure -370 mSv. Staining - azure- II-eosin, х 400. Bone marrow fibrosis with myeloid dysplasia.

Excretion of Ca++ phosphates is significantly higher in leukemia patients in comparison with healthy controls. Vitamin D3 levels in patients with leukemia are significantly lower (18.8+0.5 vs 32.1+2.0). In acute leukemia changes are revealed in bone tissue collagen with an increase of oxyproline and asparaginic acid concentrations (fig. 5).

V. BEBESHKO AND D. BAZYKA

158

%

50 40 30 20 10 0 −10 −20 −30

Lysine

Oxyproline

Proline

Glycine

Asparagine acide

Figure 5. Changes of bone collagen amino acids concentrations in acute leukemia.

2.3. REGULATION OF APOPTOSIS

HSC and progenitor cells after radiation exposure have the self-renewal capacity needed for leukemia induction. This was shown at low, intermediate and high dose intervals. Cells in patients as compared to controls more often expressed anti-apoptotic protein Bcl-2 and less often demonstrated expression of Fas receptor (fig. 6-7). Cells in patients with low CD8+ counts were simultaneously Fas negative and Bcl-2 positive in 4 out of 19 studied patients. We assume that cells over-expressing anti-apoptotic protein Bcl-2 and demonstrating low Fas expression could lack apoptotic response to environmental factors.

STEM CELLS AND LEUKEMIA

Figure 6. Expression of pro-apoptotic regulator molecules in acute myeloid leukemia.

Figure 7. Expression of anti-apoptotic regulator molecules in acute myeloid leukemia.

159

160

V. BEBESHKO AND D. BAZYKA

2.4. MUTATION PROCESS

In a lifetime, every single gene is likely to have undergone mutation on about 1010 separate occasions in any individual human being. Radiogenic mutation rates encounter for GPA: 12,3+4,8 х 10-6 and for TCR: 1,9 - 6,8 х 10-4. FLT3 mutations are the most abundant single-gene mutations in AML. There is no difference in prevalence of FLT3 mutations in groups of radiation-associated and spontaneous AML cases. Copy number changes/allelic imbalances could be crucial in the leukemogenesis of AML in patients with the history of radiation exposure due to the Chernobyl accident. LOH/deletions at 5q and/or 7q and 7р tend to be more frequent in radiation-associated AML cases. Genetic studies of last period have initiated the question of the dependency between specific gene changes and leukemia onset. It seems reasonable that despite the relative rare occurrence of the specific mutations, most of the genes participate in leukemia induction via expression changes which are necessary for expression and preservation of cell leukemic phenotype together with increased prtoliferative activity, cell survival elongation and metabolic changes. The role of genetic polymorphism in the leukemia progression could be illustrated by the presence of aberrant phenotype with simultaneous expression of myeloid and lymphoid markers. Such phenotype was revealed in 17 patients (10 exposed and 7 non-exposed). No associations were revealed between aberrant phenotype and radiogenic mutations (chromosome aberrations, variant TCR-CD4+ T-cells). Comparative analysis showed no significant differences nor between variant cell number in AML and post-radiation myelodepression nor any correlation between radiogenic mutation rates and CD34+ stem cell number or functional activity in a clonogenic assay. In ALL patients exposed to ionizing radiation higher mutation rates were demonstrated (3,43+0,55x10-4 in exposed, 2.46+0.49x10-4 in non-exposed ALL patients, 1,74+0,33x10-4 in control). The onset and progression of myelogenous leukemia seems not to change the rates of the TCR locus radiogenic mutations. As for ALL some additional studies are needed as well as investigation of the influence of the leukemic process on the proliferation of non-tumor CD34 clones. 3. Conclusion Several conclusions could be made: Circulating HSC and progenitors after radiation exposure in a wide range of doses have are preserved in a number and with proliferation potencies sufficient for the onset of clonal proliferation. In AML FLT3 mutations are the most abundant single-gene mutations. There is no difference in prevalence of FLT3 mutations in groups of radiation-

STEM CELLS AND LEUKEMIA

161

associated and spontaneous AML cases. LOH/deletions at 5q and/or 7q and 7р tend to be more frequent in radiation-associated AML cases. Bone marrow and bone tissue microenvironment plays a key role in normal and neoplastic HSC changes. Differentiation to B-lineage isn’t changed and is associated with B-cell compartment growth. Acknowledgements

N.Belyaeva, S. Klymenko, T. Lubarets, I. Dyagil, I. Ilyenko, N. Bilko, J. Minchenko, E.Bruslova, L. Lyashenko, L. Darchuk (Research Centre for Radiation Medicine, Kyiv, Ukraine).

References Ho, A.D. (2005) Kinetics and symmetry divisions of hematopoietic stem cells. Experimental Hematology, 33, 1–8. Bonnet, D. (2005) Normal and leukaemic stem cells. British Journal of Haematology, 130, 469– 479 Romanenko, A., Bebeshko, V., Bazyka, D. (2006) Leukemia in Ukrainian clean-up workers of the Chornobyl accident: Epidemiologic and hematologic aspects Ivanov, V. K., Tsyb, A. F., Gorsky, A. I., Maksyutov, M. A., Rastopchin, E. M., Konogorov, A. P., Korelo, A. M., Biryukov, A. P. and Matyash, V. A. (1997) Leukaemia and thyroid cancer in emergency workers of the Chernobyl accident: estimation of radiation risks (1986-1995). Radiat. Environ. Biophys. 36, 9–16. National Committee for Clinical Laboratory Standards. Procedures for the collection of diagnostic blood specimen by venipuncture (H3-A3). Vanova, PA: The National. Committee for Clinical Laboratory Standards;1991. National Committee for Clinical Laboratory Standards. Clinical applications of flow cytometry: Quality assurance and immunophenotyping of peripheral blood lymphocytes; tentative guidline (H42-T). Vanova, PA: The National. Committee for Clinical Laboratory Standards;1992. Theunissen, K. & Verfaillie, C.M. (2005) A multifactorial analysis of umbilical cord blood, adult bone marrow and mobilized peripheral blood progenitors using the improved ML-IC assay. Experimental Hematology, 33, 165–172.

TELOMERE AND STEM CELL BIOLOGY IN CHRONIC MYELOID LEUKEMIA

STEFAN BALABANOV, UTE BRASSAT, MIRJA BERNHARD, VIOLA KOB, ARTUR GONTAREWICZ AND TIM H. BRÜMMENDORF* Dept. of Oncology and Hematology, University Medical Center Eppendorf, Hamburg, Germany

Keywords: Telomere; Telomerase; stem cell; chronic myeloid leukemia

Abstract. The measurement of telomere length in peripheral blood cells can give an insight into the replicative history of their respective precursor cells, the hematopoietic stem cells (HSC). Much of the observed telomere loss occurs at the stem and progenitor cell level even though these populations express the enzyme telomerase. Investigations in normal steady state hematopoiesis provided the basis for follow up studies in model disorders with increased turnover rates of HSC either due malignant transformation or due to depletion of the stem cell compartment like in defined bone marrow failure syndromes or as a consequence of reduced bone marrow reserve e.g. due to chemotherapy-induced hematological toxicity. In model scenarios like in Chronic myelogeneous leukemia (CML), the degree of telomere shortening can be correlated both with disease duration, disease stage and severity as well as with response to disease-modifying treatment strategies. Whether alterations in telomere biology are secondary phenomena or play a causal role for replicative senescence and/or the induction of genetic instability linked to disease progression in these acquired HSC disorders is under investigation.

______ * To whom correspondence should be addressed. Tim H. Brümmendorf, Dept. of Hematology and Oncology with Sections BMT and Pneumology, University Hospital Hamburg-Eppendorf, Martinistraße 52, 20246 Hamburg, Germany; Phone: ++49-40-42803-3552; Fax: ++49-40-42803-3563; E-mail: [email protected]

163 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 163–169. © 2008 Springer.

164

S. BALABANOV ET AL.

1. Telomeres and Telomerase Telomeres are located at the ends of chromosomes and consist of non-coding TTAGGG repeats and telomere-binding proteins. Telomeres protect the chromosomal ends from degradation, aberrant recombination and end-to-end fusion (capping function). Replication of the 3' end of the lagging strand is incomplete resulting in a loss of roughly 20 bp to 200 bp of telomeric DNA with each cell division. Due to this “end replication problem”, telomeres shorten with each round of replication in vitro and in vivo, eventually leading to genetic instability and cellular senescence. These observations lead to the proposition of the “model of a mitotic clock” in which telomere length both reflects the mitotic history of normal somatic cells and predicts their remaining replicative capacity (reviewed in 1). In contrast to normal somatic cells, germline and cancer cells have been shown to circumvent telomere-mediated cell senescence by maintenance or elongation of telomeres, resulting in an unlimited replicative capacity. The majority of tumor cells investigated so far present with short telomeres and express high levels of telomerase activity, an enzyme capable of adding telomere repeats onto the end of the chromosomes2. In humans, this ribonucleoprotein enzyme was shown to contain the 560 bp RNA-matrix (hTR, human telomerase RNA) which is complementary to the human telomere sequence and a reverse transcriptase (hTERT, human telomerase reverse transcriptase) which represents the catalytic subunit of the enzyme. In contrast to the ubiquitous expression of hTR, hTERT expression is mostly restricted to the germline and malignant cells as well as to stem cells. The telomerasecomplex also contains a number of associated proteins which are required for the assembly and activity of the enzyme. Although telomerase is the most prevalent mechanism used for maintenance of telomeric DNA, about 10% of tumors have been described which lack telomerase activity. These cancer cells seem to utilize the so called Alternative Lengthening of Telomeres (ALT) mechanism to circumvent the telomeric checkpoint 3. It has been postulated that the process of immortalization typically requires the reactivation of telomerase for telomere stabilization and maintenance in tumor cells. Telomere maintenance (+/- telomerase activity) is believed to be an important factor for aging and tumorigenesis as well as for the regulation of the replicative life span of cells4. Clinically, both telomere length as well as telomerase activity have been demonstrated to be of prognostic value in a variety of human malignancies. Even more importantly, pharmacological inhibition of telomerase activity might represent an attractive new therapeutic target in both solid tumors and hematological malignancies5.

TELOMERE BIOLOGY IN CML

165

2. Telomere Length Dynamics in the Hematopoietic Stem Cells In the hematopoietic system in vivo, telomere length in nucleated peripheral blood (PB) cells indirectly reflects the mitotic history of their precursor cells in the bone marrow, the hematopoietic stem cells (HSC). We previously used fluorescence in situ hybridization and flow cytometry (flow-FISH) to show that immature subpopulations of CD34+38- human HSC can be identified prospectively in vitro based on growth kinetics6 and telomere length7. In addition, we have utilized flow-FISH to characterize the age-related turnover of HSC in healthy human (including frequent blood donors)8;9 and feline10 individuals in vivo. Strikingly, we found substantially (up to 100-fold) increased turnover rates in the human hematopoietic stem cell compartment in the first year of life compared to later ages. Furthermore, these investigations in normal steady state hematopoiesis provided the basis for follow-up studies in model disorders with increased turnover rates of HSC either due to auto-immune mediated stem cell damage (e.g. Aplastic Anemia,AA and other bone marrow failure syndromes)11-13 or post-allogeneic transplantation (including analysis of long-term survivors after allogeneic bone marrow transplantation)14-16 or due to malignant transformation17;18. 3. Telomere Biology in Chronic Myelogeneous Leukemia (CML) Chronic myeloid leukemia (CML) is a malignant disorder which originates in a pluripotent hematopoietic stem cell19 that acquires a Philadelphia (Ph) chromosome20;21 encoding the BCR-ABL oncogenic fusion protein22;23. Clinically, the disease is characterized by a relatively stable chronic phase (CP) that can last for years but is ultimately followed by an acceleration after a yet unpredictable period of time. The accelerated phase (AP) of the disease followed by blast crisis (BC) is associated with increased genetic instability and with the acquisition of additional cytogenetic abnormalities and mutations that are responsible for the altered and more aggressive growth pattern of the malignant clone. In CP, increased numbers of Ph+ myeloid, erythroid and megakaryocytic progenitor cells are found both in the hyperplastic bone marrow and in the peripheral blood of patients with highly elevated white blood cell counts. Although increasing evidence suggests the existence of a quiescent subpopulation of cells within the Ph+ stem cell compartment24;25 in chronic phase CML, the turnover of the majority of Ph+ stem and progenitor cells has been shown to be substantially increased26;27. While the Ph chromosome is commonly the only cytogenetic abnormality detected in CP patients, cells with additional chromosomal abnormalities are usually present once the disease

166

S. BALABANOV ET AL.

progresses to AP or BC. It has been suggested that development of AP/BC depends on the cooperation of Bcr-Abl with genes deregulated during disease progression (reviewed in28). Whereas p53, Rb or both are typically required for increased proliferation, a deregulation of genes typically responsible for a differentiation-arrest (such as e.g. C/EBPα) can be expected. To date neither the mechanisms by which these changes are facilitated nor have the changes themselves been very well characterized. Furthermore, Bcr-Abl itself modulates the responses to DNA damage, rendering cells resistant to genotoxic therapies and causing genomic instability29. One such mechanism might be the increased generation of reactive oxygen species (ROS), which themselves causes oxidative DNA damage potentially resulting in stable genetic alterations (including kinase domain mutations)30. Interestingly, a link between acquired oxidative damage and progressive telomere shortening has been demonstrated in fibroblasts in vitro31. To investigate potential differences in telomere biology between normal and malignant HSC in this disease, we comparatively analyzed telomere length in (Ph+) peripheral blood leukocytes (PBL) and Ph- T-lymphocytes, respectively. We found that telomeres in malignant cells were indeed significantly shorter than in ex vivo expanded Ph- T-lymphocytes17. Furthermore, age-adjusted telomere shortening was found to be correlated both with disease stage, remaining duration of CP before onset of BC17;32, and Hasford risk score33. Cytogenetic and molecular response after imatinib therapy, a novel and highly effective tyrosine kinase inhibitor34 is correlated with an increase in mean telomere length35;36. This observation reflects a steadily increasing fraction of Ph- cells (with normal or only slightly reduced telomere length) contributing to the peripheral blood cell pool in treated patients37. One might speculate that upregulation of telomerase in CML38;39 (although controversially discussed40;41) confers a selective growth advantage to the respective malignant subclone by preventing it from further replicationdependent telomere shortening and as a consequence from cellular senescence or crisis. In line with these findings, specific inhibition of telomerase activity by a small molecule inhibitor (BIBR1532)42;43 was shown to lead to replicationdependent telomere shortening in treated as opposed to untreated Ph+ leukemic cells (Brassat et al., unpublished data). It will need to be elucidated in ongoing studies whether treatment of leukemic cells with telomerase inhibitors and or progressive telomere shortening (by itself) will impact on genetic instability and/or altered imatinib sensitivity as well as development of resistance. In summary, it will need to be demonstrated whether accelerated telomere shortening indeed represent the “chronic phase clock” reflecting both increased replicative aging of Ph+ HSC due to increased cell cycle activity as well as

TELOMERE BIOLOGY IN CML

167

accumulation of genetic instability due to replication-independent mechanisms thereby increasing the probability for the acquisition of secondary genetic changes (reviewed in 44). Nevertheless, based on the considerations outlined above, CML remains the model disorder to study the role of telomere biology for disease progression in malignant hematopoiesis in the future. These studies might be potentially rewarding since not only prognostic but also therapeutic implications (e.g. treatment of CP CML with telomerase inhibitors) might arise from the results.

References 1. Harley CB. Human ageing and telomeres. Ciba Found.Symp. 1997;211129-39; discussion 139-44 *LHM: 2. Greider CW. Telomerase activation. One step on the road to cancer? Trends Genet. 1999;15:109-112. 3. Bryan TM, Englezou A, la-Pozza L, Dunham MA, Reddel RR. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat.Med. 1997;3:1271-1274. 4. Blasco MA, Hahn WC. Evolving views of telomerase and cancer. Trends Cell Biol. 2003;13:289-294. 5. Keith WN, Bilsland A, Evans TR, Glasspool RM. Telomerase-directed molecular therapeutics. Expert.Rev.Mol.Med. 2002;2002:1-25. 6. Brummendorf TH, Dragowska W, Zijlmans JMJM, Thornbury G, Lansdorp PM. Asymmetric cell divisions sustain long-term hematopoiesis from single-sorted human fetal liver cells. J.Exp.Med. 1998;188:1117-1124. 7. Bartolovic K, Balabanov S, Berner B et al. Clonal heterogeneity in growth kinetics of CD34+. Stem Cells 2005;23:946-957. 8. Rufer N, Brummendorf TH, Kolvraa S et al. Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J.Exp.Med. 1999;190:157-167. 9. Scheding S, Ersoez I, Hartmann U et al. Peripheral blood telomere length measurements indicate that hematopoietic stem cell turnover is not significantly increased in whole blood and apheresis platelets donors. Transfusion 2003;43:1089-1095. 10. Brummendorf TH, Mak J, Sabo KM et al. Longitudinal studies of telomere length in feline blood cells: implications for hematopoietic stem cell turnover in vivo. Exp.Hematol. 2002;30:1147-1152. 11. Brummendorf TH, Maciejewski JP, Mak J, Young NS, Lansdorp PM. Telomere length in leukocyte subpopulations of patients with aplastic anemia. Blood 2001;97:895-900. 12. Melenhorst JJ, Brummendorf TH, Kirby M, Lansdorp PM, Barrett AJ. CD8+ T cells in large granular lymphocyte leukemia are not defective in activation- and replication-related apoptosis. Leuk.Res. 2001;25:699-708. 13. Beier F, Balabanov S, Buckley T et al. Accelerated telomere shortening in glycosylphosphatidylinositol (GPI)-negative compared with GPI-positive granulocytes from patients with

168

14.

15.

16.

17.

18.

19. 20. 21.

22. 23. 24. 25.

26.

27.

28. 29. 30. 31.

32.

S. BALABANOV ET AL.

paroxysmal nocturnal hemoglobinuria (PNH) detected by proaerolysin flow-FISH. Blood 2005;106:531-533. Mathioudakis G, Storb R, McSweeney PA et al. Polyclonal hematopoiesis with variable telomere shortening in human long-term allogeneic marrow graft recipients. Blood 2000;96:3991-3994. Rufer N, Brummendorf TH, Chapuis B et al. Accelerated telomere shortening in hematological lineages is limited to the first year following stem cell transplantation. Blood 2001;97:575-577. Brummendorf TH, Rufer N, Baerlocher GM, Roosnek E, Lansdorp PM. Limited telomere shortening in hematopoietic stem cells after transplantation. Ann.N.Y.Acad.Sci. 2001;938: 1-7. Brummendorf TH, Holyoake TL, Rufer N et al. Prognostic implications of differences in telomere length between normal and malignant cells from patients with chronic myeloid leukemia measured by flow cytometry. Blood 2000;95:1883-1890. Hartmann U, Brummendorf TH, Balabanov S et al. Telomere length and hTERT expression in patients with acute myeloid leukemia correlates with chromosomal abnormalities. Haematologica 2005;90:307-316. Raskind WH, Fialkow PJ. The use of cell markers in the study of human hematopoietic neoplasia. Adv.Cancer Res. 1987;49127-67 *LHM: Nowell PC, Hungerford DA. Chromosome studies on normal and leukemic human leukocytes. J.Natl.Cancer Inst. 1960;25:85-109. Rowley JD. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 1973;243: 290-293. Groffen J, Stephenson JR, Heisterkamp N et al. Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell 1984;36:93-99. Shtivelman E, Lifshitz B, Gale RP, Canaani E. Fused transcript of abl and bcr genes in chronic myelogenous leukaemia. Nature 1985;315:550-554. Holyoake T, Jiang X, Eaves C, Eaves A. Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia. Blood 1999;94:2056-2064. Holyoake TL, Jiang X, Jorgensen HG et al. Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3. Blood 2001;97:720-728. Eaves AC, Barnett MJ, Ponchio L et al. Differences between normal and CML stem cells: potential targets for clinical exploitation. Stem Cells 1998;16 Suppl 177-83; discussion 89 *LHM: Traycoff CM, Halstead B, Rice S et al. Chronic myelogenous leukaemia CD34+ cells exit G0/G1 phases of cell cycle more rapidly than normal marrow CD34+ cells. Br.J.Haematol. 1998;102:759-767. Calabretta B, Perrotti D. The biology of CML blast crisis. Blood 2004;103:4010-4022. Skorski T. BCR/ABL regulates response to DNA damage: the role in resistance to genotoxic treatment and in genomic instability. Oncogene 2002;21:8591-8604. Koptyra M, Falinski R, Nowicki MO et al. BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance. Blood 2006;108:319-327. von Zglinicki T, Saretzki G, Docke W, Lotze C. Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence? Exp.Cell Res. 1995;220: 186-193. Boultwood J, Peniket A, Watkins F et al. Telomere length shortening in chronic myelogenous leukemia is associated with reduced time to accelerated phase. Blood 2000;96:358-361.

TELOMERE BIOLOGY IN CML

169

33. Drummond M, Lennard A, Brummendorf T, Holyoake T. Telomere shortening correlates with prognostic score at diagnosis and proceeds rapidly during progression of chronic myeloid leukemia. Leuk.Lymphoma 2004;45:1775-1781. 34. Buchdunger E, Zimmermann J, Mett H et al. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res. 1996;56:100-104. 35. Bartolovic K, Balabanov S, Hartmann U et al. Inhibitory effect of imatinib on normal progenitor cells in vitro. Blood 2004;103:523-529. 36. Balabanov S, Bartolovic K, Komor M et al. Gene expression profiling of normal hematopoietic progenitor cells under treatment with imatinib in vitro. Leukemia 2005;19:1483-1485. 37. Hartmann U, Balabanov S, Ziegler P et al. Telomere length and telomerase activity in the BCR-ABL-transformed murine Pro-B cell line BaF3 is unaffected by treatment with imatinib. Exp.Hematol. 2005;33:542-549. 38. Engelhardt M, Mackenzie K, Drullinsky P, Silver RT, Moore MA. Telomerase activity and telomere length in acute and chronic leukemia, pre- and post-ex vivo culture. Cancer Res. 2000;60:610-617. 39. Rasoul NA, Elhalawani N, Nafae MH, Elkaffash DM, Mourad ZI. Telomerase activity in Philadelphia positive chronic myeloid leukaemia. Egypt.J.Immunol. 2004;11:1-8. 40. Drummond MW, Hoare SF, Monaghan A et al. Dysregulated expression of the major telomerase components in leukaemic stem cells. Leukemia 2005;19:381-389. 41. Campbell LJ, Fidler C, Eagleton H et al. hTERT, the catalytic component of telomerase, is downregulated in the haematopoietic stem cells of patients with chronic myeloid leukaemia. Leukemia 2006;20:671-679. 42. Damm K, Hemmann U, Garin-Chesa P et al. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J. 2001;20:6958-6968. 43. Pascolo E, Wenz C, Lingner J et al. Mechanism of human telomerase inhibition by BIBR1532, a synthetic, non- nucleosidic drug candidate. J.Biol.Chem. 2002;277:1556615572. 44. Brummendorf TH, Balabanov S. Telomere length dynamics in normal hematopoiesis and in disease states characterized by increased stem cell turnover. Leukemia 2006;20:1706-1716.

POTENTIAL IMMUNE ESCAPE MECHANISMS OF TUMORS: MHC CLASS I MOLECULES – ENEMIES OR FRIENDS PROF. DR. BARBARA SELIGER* Martin Luther University Halle-Wittenberg, Institute of Medical Immunology, Halle, Germany

Keywords: tumor immunology, escape mechanisms, MHC class I, CTL, NK

Abstract. It is generally accepted that tumor development is a multifactorial process which is caused by a sequential accumulation of different genetic alterations leading to aberrant cell cycle control, instability of genomic integrity as well as decrased recognition by the immune system. During the last decade, the tumor-host interaction has been well defined. It has been demonstrated that professional antigen presenting cells (APC), macrophages, natural killer (NK) cells, NKT cells and in particular T-lymphocytes play a key role in anti-tumor immunity. In general, immune cells monitor MHC class I-presented antigenic peptides. Presentation of self peptides by MHC class I molecules results in the generation of tolerance. In contrast, presentation of viral or tumor-derived foreign antigens leads to the induction of lysis by CD8+ cytotoxic T lymphocytes (CTL). Loss or downregulation of MHC class I surface antigen expression on tumor cells results in an impaired CTL-mediated recognition and is often associated with disease progression, whereas the HLA class I-negative cells are susceptible to NK cell-mediated elimination. The MHC class I abnormalities could be due to distinct molecular mechanisms like structural alterations, epigenetic control and dysregulation. The knowledge about the strategies essential for proper MHC class I surface expression has an important impact on the mode of immunotherapies implemented for the treatment of tumor patients. So far there exists four major lines of evidence of cancer immunosurveillance: (i) the higher incidence of nonviral tumors in immunosuppressed and/or transplanted patients, (ii) the presence of lymphocytes within the tumor, (iii) the development of spontaneous tumor

______ * Martin Luther University Halle-Wittenberg, Institute of Medical Immunology, Magdeburger Straße 2, 06112 Halle, Germany, Phone: +49 345 5 57 40 54; Fax: +49 345 5 57 40 55; E-mail: [email protected]

171 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 171–181. © 2008 Springer.

172

B. SELIGER

regressions as well as (iv) the correlation of the type and composition of the tumor immune cell infiltrates with the clinical outcome. In particular CD4+ and CD8+ T lymphocytes are important for monitoring an effective anti-tumor response which could be further modulated by stroma cells and the tumor microenvironment. HLA class I abnormalities have been frequently found in various human tumors of distinct origin which range from total loss or downregulation of MHC class I surface expression (Marincola et al., 2000; Garcia-Lora et al., 2003; Seliger et al., 2002, 2006). The underlying molecular mechanisms of such MHC class I abnormalities are diverse and can occur at each step of the antigen processing pathway (Seliger et al., 2006). This review will concentrate on (i) the description of the antigen processing and presentation pathway which allow tumor antigens to be recognised by CD8+ T lymphocytes, (ii) the MHC class I altered profiles in tumors and (iii) the underlying molecular mechanisms of impaired MHC class I surface expression leading in T cellmediated immune escape. Abbreviations: β2-m, β2-microglobulin; APC, antigen presenting cell; APM, antigen processing machinery; BLH, bleomycin hydrolase; CTL, cytotoxic T lymphocyte; DC, dendritic cell; ER, endoplasmic reticulum; ERAP, ERresident aminopeptidase; HC, heavy chain; IFN-γ, interferon γ; LAP, leucyl aminopeptidase; LMP, low molecular weight proteins; LOH, loss of heterozygosity; mAb, monoclonal antibody; MHC, major histocompatibility complex; NK, natural killer cells; PDI, protein disulfide isomerase; PLC, peptide loading complex; RCC, renal cell carcinoma; TAP, transporter associated with antigen processing; tpn, tapasin; TPPII, tripeptidylpeptidase II; wt, wild type 1. The Complex MHC Class I Antigen Processing Pathway During the last decade the MHC class I antigen processing machinery (APM) has been well defined and appears to be more complex than initially expected. It consists of four major steps: (i) peptide generation and peptide trimming, (ii) peptide transport, (iii) MHC class I assembly and (iv) presentation of the trimeric MHC class I heavy chain/β2-m/peptide complex on the cell surface (Figure 1).

IMMUNE ESCAPE OF TUMORS

MHC class I heavy chain

173

APN β2-microglobulin calnexin PDI

calreticulin iC

TR

ER60

TAP

ERAAP

ER

Golgi

peptides proteasome tapasin

cytosol

aminopeptidases

protein

Figure 1. Overview of the MHC class I antigen processing pathway. Endogenously synthesized proteins are degraded by the multicatalytic proteasome complex to peptides. These peptides are further trimmed by cytosolic aminopeptidases and then transported from the cytosol to the ER, transporter associated with antigen processing (TAP). In the ER MHC class I complex is generated and the assembly is assisted by the various chaperones. The peptide loading complex consisting of TAP1, tpn, MHC class I HC, β2-m, calreticulin and ERp57 is dissociated upon peptide loading and the MHC class I HC/ β2-m peptide complexes are then exported to the cell membrane for surveillance by T lymphocytes. I.

Peptide generation/trimming

II.

Peptide transport

III.

MHC assembly

IV.

Antigen presentation

Briefly, endogenously synthesized proteins were ubiquitinated and then directed to the proteasome where they were degraded into polypeptides. The proteasome is mainly generating the proper carboxy terminus of the peptides (van Endert, 1999; Rock and Goldberg, 1999), whereas the N-terminus is trimmed by various aminopeptidases either located in the cytosol or in the endoplasmic reticulum (ER). These include for example tripeptidylpeptidase (TPP)II, leucyl aminopeptidase (LAP)3 and bleomycin hydrolase (BLH) in the cytosol as well as the ER-resident aminopeptidases (ERAP)1 and ERAP2 (Reits et al., 2004; York et al., 2003; Serwold et al., 2001). The peptides are then transported from the cytosol into the ER by the heterodimeric transporterassociated with antigen processing (TAP) complex consisting of the TAP1 and TAP2 subunits (Abele and Tampé, 2004). In the ER the MHC class I complex is assembled. This assembly is assisted by various chaperones such as calnexin, calreticulin, ERp57, protein disulfide isomerase (PDI) as well as tapasin (tpn). The latter facilitate the peptide loading onto MHC class I molecules. The

174

B. SELIGER

multimeric peptide loading complex (PLC) consisting of TAP, tpn, ERp57, calreticulin as well as the MHC class I heavy chain (HC) and β2-microglobulin (β2-m) is formed. Upon peptide loading this complex is dissociated and the trimeric β2-m/HC/peptide complex is then exported via the trans Golgi to the cell surface for presentation to CD8+ cytotoxic T lymphocytes (CTL). The correct functioning of the MHC class I APM results in cells with normal surface expression of MHC class I molecules. Any defect in these components will lead to loss or impaired MHC class I antigen expression (Pamer and Cresswell, 1998). 2. Impaired MHC Class I Expression and Immune Selection The loss of MHC class I molecules as a frequent process in experimental and spontaneous tumors to escape recognition and destruction by CTLs (Seliger et al., 2000; Marincola et al., 2003). Total or selective losses of HLA class I antigens and APM components have been reported and different human and murine tumor samples which were associated with evasion of immune surveillance and increased tumorgenicity (Seliger et al., 2000; Johnsen et al., 1999; Qin et al., 2002, 2003; Meidenbauer et al., 2004). Despite an active and normal immune response in healthy immune system, tumor cells grow, invade and form metastases in the host. It has been demonstrated that total or partial MHC class I loss as a mechanisms used by tumor cells to evade the immune system. This is in many instances due to highly sophisticated selection of MHC class I-deficient tumor escape variants which is widely used by tumor cells, thereby loosing their potential as a target for immune effectors. The major force contributing to the appearance of the MHC class I-negative tumor clones is immune selection by T cells recognising tumor antigens presented by MHC class I molecules, thereby performing effective immunosurveillance. Since HLA class I-defective tumor cells could not be eliminated by T cells, these tumor cell clones require growth advantage which overgrow the other clonal tumor populations. The hypothesis of immune selection was strengthened by recent experimental and clinical evidence. Tumors can produce both MHC class I-negative or -positive metastatic colonies depending on the immune status of the host. A coordinated suppression of multiple components of the MHC class I APM which could be reverted by interferon (IFN)-γ treatment transcriptionally inducing the expression of the major APM component was found. Furthermore, the MHC phenotype of metastatic tumors appears to be influenced by the T cell repertoire. It might be predicted that tumors arising in immunodeficient patients such as kidney transplant recipient, bone narrow transplanted individuals as well as HIV-infected patients receiving long-term treatment with immunosuppressive drugs need not the production of

IMMUNE ESCAPE OF TUMORS

175

HLA-deficient clones to escape T cell responses since T cell function is already immunosuppressed. 3. Categorization of HLA Class I Abnormalities in Different HLA Class I Phenotypes in Tumors So far eight major altered HLA class I phenotypes have been defined in different tissues (Garcia-Lora et al., 2003). The first (phenotype I) involves total HLA class I loss resulting the absence of any HLA class I antigen expression in tumor cells and has been found to occur at a different frequency in tumors of distinct origin. Phenotype II involves the HLA haplotype loss. Tumors can partially or totally loose one of the two HLA haplotypes present in the tumor cell (Jimenez et al., 1999, Maleno et al., 2004). Phenotype III is characterized by a HLA-A, -B, -C locus downregulation which has been also documented in different tumor types, whereas phenotype IV is characterized by a HLA allelic loss. For diagnosis of this phenotype, anti-HLA class I monoclonal antibodies (mAb) identifying individual HLA class I alleles are required (Stam et al., 1986). Phenotype V represents a combined phenotype of at least two different alterations such as HLA haplotype loss or HLA-A, -B, -C locus downregulation. Phenotype VI involves impaired signal transduction pathways. This include the unresponsiveness to IFN demonstrating low levels of constitutive HLA class I antigen expression in tumor cells which could not be upregulated in response to various cytokines such as IFN-α and γ (Dovhey et al., 2000). Furthermore, mutations in JAK1 result in impaired TAP1 and LMP2 inducibility by IFN-γ (Hayashi et al., 2006). Phenotype VII is defined by a downregulation of the classical HLA-A, -B, -C molecules and an induction of the non-classical HLA antigens, HLA-E and/or –G molecules (Bukur and Seliger, 2003; Bukur et al., 2003). Recently, a novel phenotype (VIII) has been defined which is associated with loss or downregulated expression of aminopeptidases in tumors (Fruci et al., 2006) which affect MHC class I surface expression and the T cell repertoire. These MHC class I alterations have been evaluated by the analysis of the panel of tumor samples with immunohistochemistry or flow cytometry in disrupted tumor cell suspensions as well as established tumor cell lines using a series of mAbs directed against HLA class I monomorphic, HLA-A or –B locus-specific, HLA-allelic epitopes or against various APM components including TAP1, TAP2, tpn and the different LMP subunits. The results demonstrated that rates of HLA class I and APM component losses in tumor cell lines strongly varied between the different tumor types analyzed. During the last year we have analyzed a large series of renal cell carcinoma (RCC) lesions for the expression of various MHC class I APM components

176

B. SELIGER

(Atkins et al., 2004). Our results could demonstrate a subtype-specific downregulation of the various APM components, in particular of TAP and tapasin as well as the LMP subunits, whereas β2-m and the MHC class I HC expression were not affected in this tumor type. Based on these results, the characterization of the underlying molecular mechanisms of MHC class I deficiencies of tumor cell is mandatory. 4. Molecular Mechanisms Leading to MHC Class I Abnormalities Different mechanisms can lead to total or partial loss of HLA class I antigen expression. This could occur at any step of the MHC class I processing machinery and involves structural alterations, epigenetic mechanisms and dysregulation of various APM components. 5. Structural Abnormalities of MHC Class I APM Components A number of structural alterations in various APM components have been identified. In particular mutations, deletions, rearrangement and/or loss of heterozygosity (LOH) have been described in the β2-m gene in melanoma and colon carcinoma resulting in total loss of MHC class I surface expression (Marincola et al., 2000). In contrast, β2-m alterations have not been found in some other tumor types like renal cell carcinoma (RCC) (Seliger et al., 2003; Atkins et al., 2004; Matsui et al., 2002). Furthermore, point mutations in the MHC class I heavy chain (HC) were found in tumors causing an allele-specific loss of the respective HLA class I antigen. As already demonstrated for β2-m, the structural alterations of the MHC class I HC also appear to be tissuespecific since they have been detected at a high frequency in cervical cancer, colon carcinoma as well as melanoma, but not or at a low frequency in other tumor entities. Alterations of the MHC class I APM components appear to be a rare event. So far only two distinct mutations were identified in the TAP1 subunit: one occurred in a small lung carcinoma cell line (Chen et al., 1996), whereas the other was found in two different melanoma cell lines (Seliger et al., 2001). In addition, one melanoma cell line exhibiting a TAP1 mutation also had a mutation in the HLA-A2 gene (Seliger et al., 2001). However, Fowler and Frazer (2004) reported a high frequency of TAP mutations in cervical carcinoma lesions. In tumor cells with structural alterations in β2-m, HC and TAP MHC class I surface expression could be restored by the respective gene transfer, but not by cytokine treatment (Seliger et al., 2000; Lou et al., 2005). However, due to the low frequency of alterations in different MHC class I APM components, the

IMMUNE ESCAPE OF TUMORS

177

knowledge of immune escape mechanisms upon viral infections and the fact that IFN-γ often upregulates MHC class I surface expression dysregulatory mechanisms might be the major cause of MHC class I abnormalities. 6. Dysregulation of MHC Class I APM Components In tumors with lack of structural alterations of MHC class I APM components MHC class I abnormalities could be due to transcriptional, epigenetic or posttranscriptional dysregulation. In order to determine the level of dysregulation, different approaches were employed. For determination of transcriptional regulation, the various APM promoters were cloned and hooked to the luciferase gene before these constructs were transiently transfected into tumor cells of distinct origin. Using this experimental strategy the promoter activity which is directly associated with the luciferase activity will give a hint whether a specific APM component is transcriptionally or posttranscriptionally downregulated in the tumor cell lines tested. A heterogeneous regulation pattern was observed that depend on the cell line analysed. Beside the transcriptional downregulation of APM components which could be often induced by IFN-γ treatment, high levels of promoter activity were found in some tumor cell lines despite low protein expression of APM components. These results suggest a posttranscriptional regulation of defined molecules of the antigen processing which might be associated with a high proteasomal degradation rate. This is in line with recent reports demonstrating that aberrant genes or complexes exhibit a high turnover and proteasomal degradation rate (Yang et al., 2003). The unresponsiveness to IFNs appear to be a result of the downregulation of transcription factor binding to IFN-γ responsive sequence elements (Dovhey et al., 2000; Hayashi et al., 2006). Indeed, an altered TAP1 and LMP2 expression has been associated to a defective IFN-γ signaling pathway in a RCC cell line and in leiomyosarcomas. Furthermore, low HLA class I expression could be associated with aberrant expression of the non-classical HLA class I genes. There exists an inverse correlation between HLA-A, -B and -C and HLA-G and –E antigens (Bukur et al., 2003). These molecules produce a strong NK inhibitory capacity after interacting with the respective NK inhibitory receptors. Tumor cells in the first metastasis escaped immune recognition due to selective loss of HLA haplotype, but maintain the expression of HLA-A2 antigen. In contrast, in the second metastasis immune escape from immune dominant antigen-specific T cell responses were mediated by HLA class I downregulation which results in the impaired presentation of this epitope, whereas another tumor antigen-specific epitope was presented. This resulted in the shift of the dominant T cell response to a subdominant targeted response.

178

B. SELIGER

These data suggest that in response to immunoediting of tumor cells patients antigen-specific T cell responses can be adapted and gain the ability to recognize and eliminate edited tumor targets. Thus, the reactivity of the immune system is able to counteract the escape mechanisms developed by tumor cells and have important potential for active immunization as a tool to increase the magnitude of non-immunodominant T cell responses and to broad the tumor antigen-specific repertoire (Yamshchikov et al., 2005). 7. Clinical Relevance of MHC Class I APM Component Abnormalities The comparison of the APM expression profiling between primary and metastatic lesions demonstrated a higher frequency of aberrant APM component expression in metastasis suggesting that deficient APM component expression is associated with poor disease outcome (Marincola et al., 2000; Vitale et al., 2005). Indeed, these data were further strengthened in a study of our group using head and neck squamous cell carcinoma, where patients with low levels of APM components, in particular TAP and tapasin as well as MHC class I HC had a shorter survival than patients with high expression levels of these various components (Meissner et al., 2005). 8. Conclusions It is noteworthy that MHC class I downregulation is not the only escape mechanism available for tumors to avoid T cell responses other mechanisms such as downregulation of the tumor antigens, alterations of the apoptosis program, expression of inhibitory molecules, lack of expression of costimulatory molecules leading to immunological tolerance have been also described. The identification of defined immune escape mechanisms in human or mouse tumors point to the existence of active immunosurveillance which is important for the implementation T cell-based immunotherapy protocols. This information will further help to select patients suitable for such therapies. Furthermore, restoration of the tumor MHC class I phenotype to a normal MHC phenotype may be an other strategy to restore an efficient immune response in cancer patients. All these approaches are still hypothetical and no clinical procedures have been tested so far.

References Abele, R., and Tampé, R., 2004, The ABCs of immunology: structure and function of TAP, the transporter associated with antigen processing, Physiology (Bethesda) 19:216-224.

IMMUNE ESCAPE OF TUMORS

179

Atkins, D., Ferrone, S., Schmahl, G. E., Storkel, S., and Seliger, B., 2004, Down-regulation of HLA class I antigen processing molecules: an immune escape mechanism of renal cell carcinoma, J. Urol. 171:885-889. Bukur, J., and Seliger, B., 2003, The role of HLA-G for protection of human renal cell-carcinoma cells from immune-mediated lysis: implications for immunotherapies, Semin. Cancer Biol. 13:353-359. Bukur, J., Malenica, B., Huber, C., and Seliger, B., 2003, Altered expression of nonclassical HLA class Ib antigens in human renal cell carcinoma and its association with impaired immune response, Hum. Immunol. 64:1081-1092. Chen, H. L., Gabrilovich, D., Tampé, R., Girgis, K. R., Nadaf, S., and Carbone, D. P., 1996, A functionally defective allele of TAP1 results in loss of MHC class I antigen presentation in a human lung cancer, Nat. Genet. 13:210-213. Dovhey, S. E., Ghosh, N. S., and Wright, K. L., 2000, Loss of interferon-γ inducibility of TAP1 and LMP2 in a renal cell carcinoma cell line, Cancer Res. 60:5789-5796. Fowler, N. L., and Frazer, I. H., 2004, Mutations in TAP genes are common in cervical carcinomas, Gynecol. Oncol. 92:914-921. Fruci, D., Ferracuti, S., Limongi, M. Z., Consolo, V., Giorda, E., Fra ioli, R., Sibilio, L., Carroll, O., Hattori, A., van Endert P. M., and Giacomini, P., 2006, Expression of endoplasmic reticulum aminopeptidases in EBV-B cell lines from healthy donors and in leucemia/lymphoma, carcinoma, and melanoma cell lines, J. of Immunol. 176:4869-4879. Garcia-Lora, A., Algarra, I., and Garrido, F., 2003, MHC class I antigens, immune surveillance, and tumor immune escape, J. of Cell. Physiol. 195:346-355. Hayashi, T., Kobayashi, Y., Kohsaka, S., and Sano, K., 2006, The mutation in the ATP-binding region of JAK1, identified in human uterine leiomyosarcomas, results in defective interferongamma inducibility of TAP1 and LMP2, Oncogene 25:4016-4026. Jimenez, P., Canton, J., Collado, A., Cabrera, T., Serrano, A., Real, L. M., Garcia, A., RuizCabello, F., and Garrido, F., 1999, Chromosome loss is the most frequent mechanism contributing to HLA haplotype loss in human tumors, Int. J. Cancer 83:91-77. Johnsen, A., Templeton, D. J., Sy, M. S., and Harding, C. V., 1999, Deficiency of transporter for antigen presentation (TAP) in tumor cells allows evasion of immune surveillance and increases tumorigenesis, J. Immunol. 163:4224-4231. Lou, Y., Vitalis, T. Z., Basha, G., Cai, B., Chen, S. S., Choi, K. B., Jeffries, A. P., Elliott, W. M., Atkins, D., Seliger, B., and Jefferies, W. A., 2005, Restoration of the expression of transporters associated with antigen processing in lung carcinoma increases tumor-specific immune responses and survival, Cancer Res. 65:7926-7933. Maleno, I., Lopez Nevot, M. A., Seliger, B., and Garrido, F., 2004, Low frequency of HLA haplotype loss associated with loss of heterozygocity in chromosome region 6p21 in clear renal cell carcinomas, Int. J. Cancer 109:636-638. Marincola, F. M., Wang, E., Herlyn, M., Seliger, B., and Ferrone, S., 2003, Tumors as elusive targets of T-cell-based active immunotherapy, Trends Immunol. 24:335-342. Marincola, M. F. M., Jaffe, E. M., Hicklin, D. J., and Ferrone, S., 2000, Escape of human solid tumors from T-cell recognition: Molecular mechanisms and functional significance, Adv. Immunol. 74:181-273. Matsui, M., Machida, S., Itani-Yohda, T., and Akatsuka, T., 2002, Downregulation of the proteasome subunits, transporter, and antigen presentation in hepatocellular carcinoma, and their restoration by interferon-gamma, J. Gastroenterol. Hepatol. 17:897-907. Meidenbauer, N., Zippelius, A., Pittet, M. J., Laumer, M., Vogl, S., Heymann, J., Rehli, M., Seliger, B., Schwarz, S., Le Gal, F. A., Dietrich, P. Y., Andreesen, R., Romero, P., and

180

B. SELIGER

Mackensen, A., 2004, High frequency of functionally active Melan-a-specific T cells in a patient with progressive immunoproteasome-deficient melanoma, Cancer Res. 64:6319-6326. Meissner, M., Reichert, T. E., Kunkel, M., Gooding, W., Whiteside, T. L., Ferrone, S., and Seliger, B., 2005, Defects in the human leukocyte antigen class I antigen processing machinery in head and neck squamous cell carcinoma: association with clinical outcome, Clin. Cancer Res. 11:2552-2560. Pamer, E., and Cresswell, P., Mechanisms of MHC class I-restricted antigen processing, 1998, Annu. Rev. Immunol. 16:323-358. Qin, Z., Harders, C., Cao, X., Huber, C., Blankenstein, T., and Seliger, B., 2002, Increased tumorigenicity, but unchanged immunogenicity, of transporter for antigen presentation 1deficient tumors, Cancer Res. 62:2856-2860. Qin, Z., Schwartzkopff, J., Pradera, F., Kammertoens, T., Seliger, B., Pircher, H., and Blankenstein, T., 2003, A critical requirement of interferon gamma-mediated angiostasis for tumor rejection by CD8+ T cells, Cancer Res. 63:4095-4100. Reits, E. J., Neijssen, C., Herberts, C., Benckhuijsen, W., Janssen, L., Drijfhout, W., and Neefjes, J., 2004, A major role for TPPII in trimming proteasomal degradation products for MHC class I antigen presentation, Immunity 20:495-506. Rock, K. L., and Goldberg, A. L., 1999, Degradation of cell proteins and the generation of MHC class I-presented peptides, Annu. Rev. Immunol. 17:739-779. Seliger, B., Atkins, D., Bock, M., Ritz, U., Ferrone, S., Huber, C., and Storkel, S., 2003, Characterization of human lymphocyte antigen class I antigen-processing machinery defects in renal cell carcinoma lesions with special emphasis on transporter-associated with antigenprocessing down-regulation, Clin. Cancer Res. 9:1721-1727. Seliger, B., Cabrera, T., Garrido, F., and Ferrone, S., 2002, HLA class I abnormalities and immune escape by malignant cells, Semin. Cancer Biol. 12:3-13. Seliger, B., Maeurer, M. J., and Ferrone, S., 2000, Antigen-processing machinery breakdown and tumor growth, Immunol. Today 21:455-464. Seliger, B., Ritz, U., Abele, R., Bock, M., Tampé, R., Sutter, G., Drexler, I., Huber, C., and Ferrone, S., 2001, Immune escape of melanoma: First evidence of structural alterations in two distinct components of the MHC class I antigen processing pathway, Cancer Res. 61:86478650. Seliger, B., Ritz, U., and Ferrone, S., 2006, Molecular mechanisms of HLA class I antigen abnormalities following viral transformation, Int. J. Cancer 118:129-138. Serwold, T., Gaw, S., and Shastri, N., 2001, ER aminopeptidases generate a unique pool of peptides for MHC class I molecules, Nat. Immunol. 2:644-651. Stam, N. J., Spits, H., and Ploegh, H. L., 1986, Monocloncal antibodies raised against denatured HLA-B locus heavy chains permit biochemical characterization of certain HLA-C locus products, J Immunol. 137:2299-2306. Van Endert, P., 1999, Genes regulating MHC class I processing of antigen, Curr. Opin. Immunol. 11:82-88. Vitale, M., Pelusi, G., Taroni, B., Gobbi, G., Micheloni, C., Rezzani, R., Donato, F., Wang, X., and Ferrone, S., 2005, HLA class I antigen down-regulation in primary ovary carcinoma lesions: association with disease stage, Clin. Cancer Res. 11:67-72. Yamshchikov, G. V., Mullins, D. W., Chang, C. C., Ogino, T., Thompson, L., Presley, J., Galavotti, H., Aquila, W., Deacon, D., Ross, W., Patterson, J. W., Engelhard, V. H., Ferrone, S,. and Slingluff, C. L. Jr., 2005, Sequential immune escape and shifting of T cell responses in a long-term survivor of melanoma, J. Immunol. 174:6863-6871.

IMMUNE ESCAPE OF TUMORS

181

Yang, T., McNally, B. A., Ferrone, S., Liu, Y., and Zheng, P., 2003, A single-nucleotide deletion leads to rapid degradation of TAP-1 mRNA in a melanoma cell line, J. Biol. Chem. 278:15291-15296. York, I. A., Mo, A. X., Lemerise, K., Zeng, W., Shen, Y., Abraham, C. R., Saric, T., Goldberg, A. L., and Rock, K. L., 2003, The cytosolic endopeptidase, thimet oligopeptidase, destroys antigenic peptides and limits the extent of MHC class I antigen presentation, Immunity 18:429-440.

THE RUNX1 TRANSCRIPTION FACTOR: A GATEKEEPER IN ACUTE LEUKEMIA CAROL STOCKING1*, BIRTE NIEBUHR1, MEIKE FISCHER1, MAIKE TÄGER1, JÖRG CAMMENGA2 1 Heinrich-Pette-Institut for Experimental Virology and Immunology, Hamburg, Germany 2 Molecular Medicine and Gene Therapy, Institute of Laboratory Medicine, Lund University Hospital, Lund, Sweden

Key words: leukemic stem cell, core-binding factor, differentiation, self-renewal

Abstract. The RUNX1 gene, which encodes a transcription factor, is a common target of genetic mutations in acute leukemia. We propose that RUNX1 is a gatekeeper gene, the disruption of which leads to the exodus of a subset of selfrenewing “stem” cells from the normal environmental controls of homeostasis. This pool of “escaped” cells is the target of secondary mutations, accumulating over time to induce the aggressive manifestation of acute leukemia. Evidence from patient and animal studies support the concept that RUNX1 mutations are the initiating event in different leukemia subtypes, but also suggests that diverse mechanisms are used to subvert RUNX1 function. One common result is the inhibition of differentiation – but its effect impinges on different lineages and stages of differentiation, depending on the mutation. A number of different approaches have led to the identification of a few secondary events that lead to the overt acute phase, however, the majority are unknown. Finally, the concept of the “leukemic stem cell” and its therapeutic importance is discussed in light of the RUNX1 gatekeeper function.

______ *

To whom correspondence should be addressed. Carol Stocking, Heinrich-Pette-Institut for Experimental Virology and Immunology, Martinistr. 52, D-20251 Hamburg, Germany

183 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 183–199. © 2008 Springer.

184

C. STOCKING ET AL.

1. Introduction 1.1. CONCEPTS OF GATEKEEPER AND LEUKEMIC STEM CELL

It is now well established that cancers, including leukemia, develop through the accumulation of genetic and epigenetic alterations that act in concert to confer malignant phenotypes – and indeed, many of the genes and signal pathways targeted in this process have been identified (Vogelstein and Kinzler, 2004). Early studies lead to the observation that the initiating event in solid tumors involves mutation of a specific signalling pathway for a particular tumor type, leading to the concept of “gatekeepers” (Kinzler and Vogelstein, 1997). It is generally postulated that gatekeeper pathways are responsible for maintaining a constant cell number in a renewing cell population and for ensuring that cells respond appropriately to situations that require increased cell growth. Inactivating mutations in this pathway are necessary to allow the full impact of mutations that perturb cell growth, leading to a selective advantage or clonal outgrowth of mutated cells. Examples of gatekeeper pathways in solid tumors include the WNT/β-catenin, hedgehog, and TGFβ/BMP pathways in colon, kidney, and skin tumors, respectively. Recently, we have postulated that a gatekeeper function in acute myeloid leukemia (AML) is provided by transcription factors that promote differentiation, which are also frequent targets of mutations in leukemogenesis (Cammenga, 2005; Rosenbauer et al., 2005; Tenen, 2003). In this review we will expound on this hypothesis, providing evidence for a gatekeeping function of the RUNX1 transcription factor. In addition, we will extend this theory to discuss the impact of the gatekeeper on the identity of the leukemic (or cancer) stem cell (LSC). The existence of “cancer stem cells” was first postulated to explain the heterogenity of cancer cells in their proliferation and cloning capacity (Hamburger and Salmon, 1977; Huntly and Gilliland, 2005). The striking degree of similarity noted between somatic stem cells and cancer cells, including the fundamental abilities to self-renew and differentiate, has added fuel to a cancer stem-cell hypothesis, in which the continued growth and propagation of the whole tumor depends on a small subpopulation of selfrenewing cancer cells. A cancer or (leukemia)-initiating stem cell was first demonstrated conclusively for myeloid leukemia using xenograft mouse models, but has more recently also been identified in breast and brain tumors (Al-Hajj et al., 2003; Bonnet and Dick, 1997; Hemmati et al., 2003; Singh et al., 2004). Nevertheless, the frequency of the cancer stem cell within the tumor – as well as its origin remain controversial. Whereas many lines of evidence support the concept that an early hematopoietic stem cell or progenitor (HSC/P) is the first normal cell that becomes subverted in the leukemogenic

RUNX1: A GATEKEEPER IN LEUKEMIA

185

process (Warner et al., 2004), more committed progenitor cells or even mature cells may acquire mutations imparting stem-like functions in other cancers, or even certain types of leukemia (Jaiswal et al., 2003; Li et al., 2007; Somervaille and Cleary, 2006; Vexcovi et al., 2006). The wide variation in the putative number of cancer stem cells in a given tumor may reflect the origin of the cancer stem cell, the assay systems used to numerate them, or the point during cancer progression at which it is measured. In other words are we measuring the cancer initiating stem cell, or a fully-transformed cancer stem cell population? We propose that mutations affecting the gatekeeper pathway define the cancer initiating stem cell – but will not give rise to a tumor without the accumulation of secondary mutations. The function of a gatekeeper gene will be discussed using the example of the RUNX1 transcription factor – an important regulator of the HSC and a frequent target of mutations in leukemia. 1.2. RUNX1: A TRANSCRIPTIONAL REGULATOR OF HEMATOPOIESIS

RUNX1/AML1 encodes a DNA-binding subunit that, together with the nonDNA-binding β subunit, forms a heterodimeric transcription factor, termed the core-binding factor (CBF) (Figure 1). The conserved Runt homology domain (RHD) at the N-terminus of RUNX1 is required for binding to DNA and to its cofactor CBFβ, whereas the C-terminus contains transcriptional activation and repressor domains. Binding to CBFβ confers both increased DNA-binding affinity and stability to RUNX1 (Ogawa et al., 1993; Wang et al., 1993) and is essential for many of its known functions (Miller et al., 2002; Wang et al., 1996). CBF regulates transcription of a number of genes relevant to both myeloid and lymphoid development by associating with transcriptional cofactors, repressors, and other DNA-binding transcription factors in a promoter contextdependent fashion (Durst and Hiebert, 2004; Licht, 2001). The importance of RUNX1 in establishing and maintaining the HSC compartment in adult (murine) hematopoiesis, as well as regulating T-cell and megakaryocyte differentiation has been established by the analysis of conditional nock-outs (Growney et al., 2005; Ichikawa et al., 2004; Miller et al., 2002; Putz et al., 2005; Sun and Downing, 2004).

C. STOCKING ET AL.

186

RHD

HD

TAD

CBF β

CBF α Ets C/EBP Pax

β

Runx1 Runx2 Runx3

CBF

α

Figure 1. The hetero-dimeric Core Binding Factor (CBF) transcription factor is comprised of one of three RUNX family proteins (a-subunit) and a b-subunit, which is encoded by a single gene. The RUNX proteins contain two conserved and functional domains: the runt homology domain (RHD) and the transcription activation domain (TAD). Interactions between the RHD and the hetero-dimerization domain (HD) of CBFb are essential for most of the known activities of CBF. Synerigistic activity with a number of different transcription factors is well established.

1.2.1. Target of Genetic Aberrations in Leukemia In accord with its important regulatory function in hematopoiesis, disruption of the RUNX1 gene is one of the most common aberrations found in acute leukemia (Blyth et al., 2005; Speck and Gilliland, 2002) (Figure 2). Most frequently, the RUNX1 gene is disrupted by chromosomal translocations, which are associated with distinct acute leukemias. These include the translocation t(8;21), generating the RUNX1/CBFA2T1 fusion gene (also known as AML1/ETO), associated with 40% of acute myeloid leukemia (AML) with an immature phenotype (FAB-M2), and the t(12;21), generating the ETV6/RUNX1 fusion gene (also known as TEL/AML1), associated with 20% of pediatric proB-cell acute lymphoid leukemias (ALL). Significantly, the gene encoding CBFβ is also the target of chromosome aberrations [e.g. inv(16) and t(16;16)] in AML with a myelomonocytic phenotype with an eosinophil component (FAB-M4). The fusion proteins are thought to mediate their oncogenic activity in part by dominantly repressing RUNX1-target genes (Hiebert et al., 2001; Peterson and Zhang, 2004; Zelent et al., 2004).

RUNX1: A GATEKEEPER IN LEUKEMIA

187

Figure 2. The RUNX1 gene is a frequent target of genetic disruption in acute leukemia. Specific chromosomal translocations or point mutations involving the RUNX1 gene are found in acute myeloid or lymphoid leukemias with a distinctive phenotype. Depicted is the lineage and differentiation stage in which the bulk of the leukemic cells with a characteristic genetic mutation accumulate. The genetic mutations result in either fusion or mutated RUNX1 proteins, as depicted.

In addition to translocations, inactivating or dominant-negative mutations in the RUNX1 gene have been identified in 15 to 25% of the relatively rare, minimally differentiated FAB-M0 AMLs, up to 25% of myelodysplastic syndromes associated with AML development, and in pedigrees of familial platelet disorder with a propensity to develop AML (Osato, 2004; Roumier et al., 2003b). RUNX1 mutations found in AML1-M0 and FDP-AML fall into two basic categories: 1) null mutations, in which probably no protein is generated, due to either large deletions or to the introduction of premature stop

188

C. STOCKING ET AL.

codons, which would be predicted to activate nonsense-mediated mRNA decay; and 2) Runt DNA-binding (RDB) mutations, which generate RUNX1 proteins with impaired DNA-binding, but which can still bind CBFβ β (Osato, 2004). 1.2.2. Initiating Event Several lines of evidence support the hypothesis that RUNX1 translocations or mutations are the initiating event in the hematopoietic malignancies in which they are found; establishing a preleukemic clone, but requiring secondary events for disease penetration (Figure 3). The best support has come from patient studies, including data demonstrating the prolonged and variable latency of ALL induction in identical twin pairs, which share the initiating clone carrying the t(12;21) from birth (Ford et al., 1998; Wiemels et al., 1999), and studies linking RUNX1 mutations to hereditary FDP-AML syndrome (Song et al., 1999). The hypothesis is further supported by studies demonstrating that cells carrying the t(12;21) may be present at cell frequencies of 10-3 in umbilical cord blood, verifying a selective expansion of a putative leukemic clone (Mori et al., 2002), but also showing that the overall incidence in the blood samples is 100 times higher than the incidence of overt t(12;21) ALL, underlining the necessity of secondary events. The AML-associated t(8;21) and inv(16) have also been found at a relative high frequency in cord blood samples, suggesting a similar initiating mechanism (McHale et al., 2003; Mori et al., 2002).

Figure 3. Mutations in the RUNX1 gene precede the onset of a clinical symptoms of acute leukemia. Strikingly, the translocation or point mutations are detectably before birth in cases of pediatric acute leukemia, and at a incidence 100-fold that of the leukemia incidence. The accumulation of secondary mutations are probably necessary for the overt disease – but for the most part the critical mutations are unknown. Adapted from (Greaves et al., 2003).

RUNX1: A GATEKEEPER IN LEUKEMIA

189

2. Experimental Models to Study RUNX1 Function Although the high incidence in acute leukemia of translocations and mutations involving the RUNX1 gene, coupled with their early detection in a postulated “pre-leukemic” stage, is strong evidence that these are initiating events in leukemogenesis, data supporting the causal role is necessary. An important approach has been the use of animal models in which the altered RUNX1 protein is expressed. Several mouse models for CBF-associated AML have been generated using different molecular techniques. Interestingly, “knock-in” mice for RUNX1/ETO [t(8;21)] and CBFΒ-MYH11 [inv(16)] showed almost identical phenotypes to Runx1 knock-out mice, arguing for a dominant-negative function of the translocation proteins involving RUNX family members (Speck and Gilliland, 2002). However, as these mice were embryonic lethal, the effect on adult hematopoiesis and leukemia induction could not be evaluated. Strikingly, a retroviral-mediated expression of the fusion protein in bone marrow cells followed by transplantation in conditioned mice has proven to be a powerful approach to monitor the role of mutant RUNX1 forms in leukemia induction (de Guzman et al., 2002; Schwieger et al., 2002). This is due to two advantages that this approach has in contrast to conditional “knock-in” mouse strains (theoretically but not practically more attractive): 1) establishment of a chimeric system, in which normal and “abnormal” hematopoietic cells coexist (thus mimicking the situation in man); and 2) marking of the cell population expressing the fusion oncogene by coexpression of a fluorescent protein in the retroviral vector. This approach has also recently been expanded to human hematopoietic cells (Basecke et al., 2005; Mulloy et al., 2003). After transduction with the RUNX1 fusion protein, these cells are monitored either in vitro or transplanted in immunodeficient mice. These types of studies have lead to three main conclusions, which are summarized below. 2.1. PRELEUKEMIC CLONE

The foremost conclusion of studies designed to evaluate the effect of the three most common fusion proteins involving RUNX1 or its cofactor CBFβ is that these mutant RUNX1 forms establish a covert pre-leukemic cell population. This is evidence by the accumulation of early progenitors with abnormal differentiation capacity but not overt leukemia (e.g. < 30% blast in bone marrow; no blasts in blood). In the case of the gene products t(8;21) (RUNX1/ETO) and inv(16) (CBFβ-SMMHC), an accumulation of committed myeloid progenitors with impaired differentiation but increased self-renewal capacity was observed in the mouse model (Castilla et al., 1999; Higuchi et al., 2000; Okuda et al., 1998; Schwieger et al., 2002). However, in contrast to

190

C. STOCKING ET AL.

CBFβ-SMMHC, RUNX1/ETO expression also led to an increase in the number of HSC, suggesting distinct mechanisms and/or target cells (de Guzman et al., 2002; Higuchi et al., 2002; Kuo et al., 2006). Studies using human cells have confirmed the ability of both RUNX1/ETO and CBFβ-SMMHC to impart a selective advantage and increased long-term self-renewal capacity on early myeloid progenitors (Basecke et al., 2005; Mulloy et al., 2003; Tonks et al., 2003; Wunderlich et al., 2006). Although at least some of this activity can be attributed to inhibition of wild-type RUNX1 activity (Hiebert et al., 2001; Shigesada et al., 2004), other gain-of-function mechanisms must be in play. We have recently shown that a DNA-binding independent function of RUNX1 is important in conferring self-renewal capacity to early progenitors – underlining the importance of mutations found in AML that selectively target the DNAbinding domain (Cammenga et al., 2007). Possible mechanisms for the increased self-renewal capacity is the down-regulation of transcription factors that promote differentiation (e.g. PU.1 and C/EBPα) (Rosenbauer et al., 2005) or the upregulation of cytokine receptors (e.g. cKIT and TRKA) that maintain tight contact with the stroma cells, important regulators of self-renewal and proliferation in the HSC niche (Mulloy et al., 2005; Wang et al., 2005). Mouse models have also revealed an expansion of a preleukemic clone for the RUNX1 fusion protein associated with t(12;21) ALL, generating the ETV6RUNX1 fusion protein (Fischer et al., 2005; Tsuzuki et al., 2004). Interestingly, both an expansion of an early pro-B cell population, as well as a HSC-like fraction (KSL-) was observed. At present the importance of the KSL- population is unclear, as these cells were unable to differentiate into B-cell lineage (Fischer et al., 2005). In a xenotransplantation model, a striking increase in a pro-B cell population was also observed within the transduced cells of human origin (B. Niebuhr and C. Stocking, unpublished results). These cells carry the same markers (CD34+CD10+), as that observed in the leukemia, and support the hypothesis that ETV6-RUNX1 specifically imparts self-renewal capacity to cells of the early B-cell compartment. In support of this hypothesis, Williams and co-workers have demonstrated the striking ability of ETV6-RUNX1 to transform B-cells derived from fetal liver in vitro (Morrow et al., 2004). 2.2. LEUKEMIC PHENOTYPE

The second striking conclusion from mouse models of RUNX1/CBFβ fusion proteins is that the fusion protein itself is a strong determinant of the leukemic phenotype. Early work revealed the strong correlation between the leukemic phenotype (i.e. lineage and differentiation stage) and specific chromosomal

RUNX1: A GATEKEEPER IN LEUKEMIA

191

translocations, however, a long-standing debate has been whether this is due to the target cell of the translocation or inherent function of the fusion protein. Several studies have clearly demonstrated that the t(8;21) and inv(16) are present in an HSC/P compartment (McHale et al., 2003; Miyamoto et al., 2000), demonstrating that the fusion protein itself determines the leukemic phenotype. Strikingly, this has been underlined in mouse models, where the leukemia phenotype (after a long latency, reflecting the need for secondary mutations) mirrors the leukemic population in man with the same chromosome abnormality, i.e. a blastic leukemia for RUNX1-ETO (Schwieger et al., 2002) and a myelomonocytic leukemia for CBFβ-SMMHC (Castilla et al., 1999). The case for the t(12;21) associated with preB-cell ALL is less clear. A number of studies have obtained contradictory evidence as to whether the translocation occurs in the HSC or in cells committed to the B-cell lineage (Castor et al., 2005). The inability to detect the translocation in earlier cells or cells of different lineages may reflect the strong expansion pressure that the ETV6-RUNX1 fusion protein has on the B-cell compartment, coupled with an inhibitory effect on other lineages. In line with a negative effect of the translocation itself, analysis of AML patients carrying the t(8;21) seldom have Tcells carrying the translocation – although the translocation is present in B-cells and the HSC compartment (Miyamoto et al., 2000). Similarly, cells expressing either ETV6/RUNX1 or RUNX1/ETO in mouse models were almost never found in the T-cell compartment – most likely reflecting the importance of Runx1 in Tcell differentiation and proliferation (Fischer et al., 2005; Schwieger et al., 2002). Although present mouse models, in which a long-term HSC population is presumed responsible for repopulating the depeleted hematopoietic compartment, support the conclusion that ETV6/RUNX1 dictates the B-cell phenotype of the leukemia in man, further studies are warranted to rule out that a few, rare committed B-cells transduced by the ETV6/RUNX1-expressing retrovirus in these studies have acquired long-term repopulation capacity. 2.3. SECONDARY MUTATIONS

Finally, mouse studies have confirmed the hypothesis that RUNX1 mutations are initiating events – but require secondary mutations for acute leukemia induction. A major emphasis of current work is to determine what type of mutations collaborate with RUNX1 mutations to induce an acute leukemia. Screening of patient samples have underlined the importance of mutations in receptor tyrosine kinases (RTK) in these leukemia. Interestingly, mutations in the KIT receptor are relative rare in AML, but reach an incidence of circa 45% in AML with CBF mutations, perhaps reflecting high levels of KIT expression

192

C. STOCKING ET AL.

in these leukemia types (Wang et al., 2005). Mutations affecting the tryosine kinase domain are more often found in t(8;21) AML, whereas in inv(16) AML a high incidence of mutations in the extracellular domain surrounding the D419 have been described, and shown to be constituttively active (Beghini et al., 2004; Cammenga et al., 2005; Care et al., 2003). In contrast, FLT3 mutations are found at a rather lower incidence in CBF leukemia (ca 7%) as compared to the high incidence (up to 45%) of mutations in either acute promyelocytic leukemia (APL), associated with translocations involving the gene encoding retinoic acid receptor-alpha (Lo-Coco and Ammatuna, 2006), or in AML with a undifferentiated phenotype (FAB-M0) coupled with RUNX1 mutations (Matsuno et al., 2003; Roumier et al., 2003a). It is tempting to speculate that these distinctive patterns of RTK mutations reflect the importance of the specific kinase in the transformed cells – although a specific synergistic activity cannot be ruled out. Interestingly, mutations in RAS, a downstream signalling module of RTKs, occurs at incidence of circa 10% AMLs, but up to 38% in inv(16) AML (Boissel et al., 2006; Goemans et al., 2005). Direct mutations in the PI3K-pathway appear to be a rare event in AML (Martelli et al., 2006). Despite the overall high incidence of RAS and KIT mutations in RUNX1/CBFβ AML, secondary mutations in the majority of patients is not known. Similarly, the secondary mutations cooperating with t(12;21) preB-ALL have also remained elusive. Mutations in RTK occur rarely in t(12;21) ALL, and indeed deletion on chromosome 12p, including the non-translocated ETV6 allele, is the only consistent alteration in these patients observed to date (Armstrong and Look, 2005; Raynaud et al., 1996). Much promise has been made for gene expression analysis using large number of patient samples – and although this work has provided prognostic expression signatures, it has yet to provide much insight into causality. Several approaches have been taken to identify mutations that cooperate with RUNX1/CBFβ fusion proteins using mouse models. One approach has been to test cooperating mutations by retroviral co-expresssion or by taking advantage of transgenic or knock-out mouse lines, in which candidate genes are activated or inactivated (Grisolano et al., 2003; Higuchi et al., 2002; Schessl et al., 2005; Schwieger et al., 2002). Another recent approach is the use of retroviralinsertional mutagenesis in mouse models expressing the fusion protein. The power of this approach has been shown by the identification of the PLAG family as cooperating partners CBFβ/SMMHC transformation (Castilla et al., 2004; Landrette et al., 2005). Clearly, many questions remain unanswered with regard to the activating pathways that cooperate with RUNX1 alterations to induce acute leukemia. Is constitutive activation of KIT or FLT3 sufficient to induce a leukemia, as proposed by animal models? or are several independent genetic alterations

RUNX1: A GATEKEEPER IN LEUKEMIA

193

required, as suggested in colon carcinoma? Interestingly, recent evidence suggests that alternatively spliced forms of the fusion gene itself may generate more “oncogenic” proteins, contributing to the progression of the leukemic phenotype (Yan et al., 2006). Finally, it is important to ask: Do animal models duly reflect the situation in humans? 3. RUNX1, Leukemic Stem Cells, and Therapeutic Implications As summarized above, overwhelming evidence from patient samples and animal models support the concept that mutations affecting the RUNX1 gene are the initiating event in several different AMLs and ALLs. In all cases studied, these mutations lead to the accumulation of progenitor cells (either myeloid or lymphoid) with increased “self-renewal” capacity, the hallmarks of which are impaired differentiation and increased replication potential (as reflected in the frequency of immortalization in vitro.) We propose that these mutations provide the needed environment for the accumulation of secondary mutations, which inhibit apoptosis, maintain cell-cycle progression, and stimulate growth. Notably, without disruption of the RUNX1 specific “gatekeeper” functions, many, cells incurring such mutations would be lost through normal cell differentiation (Figure 4). RUNX1 is a scaffolding protein that integrates cells signals through the formation of gene promoter regulatory complexes, thus the disruption of normal RUNX1 activity can impinge on a wide spectrum of signalling pathways. Future studies are necessary to identify the mechanisms involved, which surely differ between lineages and differentiation status of the target cell.

194

C. STOCKING ET AL.

Figure 4. Model to demonstrate the importance of RUNX1 gatekeeper function, which allows the accumulation of early progenitors with increased self-renewal capacity.

The corollary to the statement that RUNX1 mutations initiate the leukemogenic process is that RUNX1 mutations define the leukemic initiating cell; but are these cells equivalent to the leukemic stem cells that sustain the leukemia? Analysis of patient samples have clearly shown the emergence of subclones carrying independent secondary mutations, i.e. FLT3 activation (Thiede et al., 2002). Are these subclones thus the leukemic stem cells that drive the leukemia – or will elimination of these cells be insufficient to eradicate the leukemia? Are the initiating RUNX1 mutations still required for the maintenance of the leukemia? – or have the accumulation of secondary mutations made them obsolete. Clearly inducible mouse models, such as described for MYC and BCR/ABL (Felsher, 2003), are important to answer these questions, in order to design therapeutic interventions that target pathways that are crucial for tumor survival. Acknowledgements

We thank all many members of the Stocking lab for creating a fruitful environment for work and discussion. We are also grateful for the continued support of the Deutsche Krebshilfe, the Deutsche José Carreras Leukämie Stiftung, and the Fritz-Thyssen Foundation. The Heinrich-Pette-Institut is supported by the Freie und Hansestadt Hamburg and the German Ministry of Health and Social Safety.

RUNX1: A GATEKEEPER IN LEUKEMIA

195

References Al-Hajj, M., Wicha, M.S., Benito-Hernandez, A., Morrison, S.J. and Clarke, M.F. (2003) Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 100, 3983-3988. Armstrong, S. and Look, A. (2005) Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol 23, 6306-6315. Basecke, J., Schwieger, M., Griesinger, F., Schiedlmeier, B., Wulf, G., Trumper, L. and Stocking, C. (2005) AML1/ETO promotes the maintenance of early hematopoietic progenitors in NOD/SCID mice but does not abrogate their lineage specific differentiation. Leuk Lymphoma 46, 265-272. Beghini, A., Ripamonti, C.B., Cairoli, R., Cazzaniga, G., Colapietro, P., Elice, F., Nadali, G., Grillo, G., Haas, O.A., Biondi, A., et al. (2004) KIT activating mutations: incidence in adult and pediatric acute myeloid leukemia, and identification of an internal tandem duplication. Haematologica 89, 920-925. Blyth, K., Cameron, E. and Neil, J. (2005) The Runx genes: Gain or loss of function in cancer. Nat Rev Cancer 5, 376-387. Boissel, N., Leroy, H., Brethon, B., Philippe, N., de Botton, S., Auvrignon, A., Raffoux, E., Leblanc, T., Thomas, X., Hermine, O., et al. (2006) Incidence and prognostic impact of c-Kit, FLT3, and Ras gene mutations in core binding factor acute myeloid leukemia (CBF-AML). Leukemia 20, 965-970. Bonnet, D. and Dick, J. (1997) Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Medicine 3, 730-737. Cammenga, J. (2005) Gatekeeper pathways and cellular background in the pathogenesis and therapy of AML. Leukemia 19, 1719-1728. Cammenga, J., Horn, S., Bergholz, U., Sommer, G., Besmer, P., Fiedler, W. and Stocking, C. (2005) Extracellular KIT receptor mutants, commonly found in core binding factor AML, are constitutively active and respond to imatinib mesylate. Blood 106, 3958-3961. Cammenga, J., Niebuhr, B., Horn, S., Bergholz, U., Putz, G., Buchholz, F., Lohler, J. and Stocking, C. (2007) RUNX1 DNA-binding mutants, associated with minimally differentiated acute myelogenous leukemia, disrupt myeloid differentiation. Cancer Res 67, 537-545. Care, R.S., Valk, P.J., Goodeve, A.C., Abu-Duhier, F.M., Geertsma-Kleinekoort, W.M., Wilson, G.A., Gari, M.A., Peake, I.R., Lowenberg, B. and Reilly, J.T. (2003) Incidence and prognosis of c-KIT and FLT3 mutations in core binding factor (CBF) acute myeloid leukaemias. Br J Haematol 121, 775-777. Castilla, L.H., Garrett, L., Adya, N., Orlic, D., Dutra, A., Anderson, S., Owens, J., Eckhaus, M., Bodine, D. and Liu, P.P. (1999) The fusion gene Cbfb-MYH11 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia. Nat Genet 23, 144-146. Castilla, L.H., Perrat, P., Martinez, N.J., Landrette, S.F., Keys, R., Oikemus, S., Flanegan, J., Heilman, S., Garrett, L., Dutra, A., et al. (2004) Identification of genes that synergize with Cbfb-MYH11 in the pathogenesis of acute myeloid leukemia. Proc. Natl. Acad. Sci. USA 101, 4924-4929. Castor, A., Nilsson, L., Astrand-Grundstrom, I., Buitenhuis, M., Ramirez, C., Anderson, K., Strombeck, B., Garwicz, S., Bekassy, A., Schmiegelow, K., et al. (2005) Distinct patterns of hematopoietic stem cell involvement in acute lymphoblastic leukemia. Nat Medicine 11, 630637. de Guzman, C., Warren, A., Zhang, Z., Gartland, L., Erickson, P., Drabkin, H., Hiebert, S. and Klug, C. (2002) Hematopoietic stem cell expansion and distinct myeloid developmental

196

C. STOCKING ET AL.

abnormalities in a murine model of the AML1-ETO translocation. Mol. Cell. Biol. 22, 55065517. Durst, K. and Hiebert, S. (2004) Role of RUNX family members in transcriptional repression and gene silencing. Oncogene 23, 4220-4224. Felsher, D. (2003) Cancer revoked: oncogenes as therapeutic targets. Nat Rev Cancer 3, 375-380. Fischer, M., Schwieger, M., Horn, S., Niebuhr, B., Ford, A., Roscher, S., Bergholz, U., Greaves, M., Lohler, J. and Stocking, C. (2005) Defining the oncogenic function of the TEL/AML1 (ETV6/RUNX1) fusion protein in a mouse model. Oncogene 24, 7579-7591. Ford, A., Bennet, C., Price, C., Bruin, M., Van Wering, E. and Greaves, M. (1998) Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia. Proc. Natl. Acad. Sci. USA 95, 4584-4588. Goemans, B., Zwaan, C., Miller, M., Zimmermann, M., Harlow, A., Meshinchi, S., Loonen, A., Hahlen, K., Reinhardt, D., Creutzig, U., et al. (2005) Mutations in KIT and RAS are frequent events in pediatric core-binding factor acute myeloid leukemia. Leukemia 19, 1536-1542. Greaves, M., Maia, A., Wiemals, J. and Ford, A. (2003) Leukemia in twins: lessons in natural history. Blood 102, 2321-2333. Grisolano, J., O'Neal, J., Cain, J. and Tomasson, M. (2003) An activated receptor tyrosine kinase, TEL/PDGFbetaR, cooperates with AML1/ETO to induce acute myeloid leukemia in mice. Proc. Natl. Acad. Sci. USA 100, 9506-9511. Growney, J., Shigematsu, H., Li, Z., Lee, B., Adelsperger, J., Rowan, R., Curley, D., Kutok, J., Akashi, K., Williams, I., et al. (2005) Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106, 494-504. Hamburger, A. and Salmon, S. (1977) Primary bioassay of human tumor stem cells. Science 197, 461-463. Hemmati, H., Nakano, I., Lazareff, J., Masterman-Smith, M., Geschwind, D., Bronner-Fraser, M. and Kornblum, H. (2003) Cancerous stem cells aris from pediatric brain tumors. Proc. Natl. Acad. Sci. USA 100, 15178-15183. Hiebert, S., Lutterbach, B. and Amann, J. (2001) Role of co-repressors in transcriptional repression mediated by the t(8;21), t(16;21), t(12;21), and inv(16) fusion proteins. Curr Opin Hematol. 8, 197-200. Higuchi, M., O´Brien, D., Kumaravelu, P., Lenny, N., Yeoh, E.-J. and Downing, J. (2002) Expression of a conditional AML1-ETO oncogene bypasses embryonic lethality and establishes a murine model of human t(8;21) acute myeloid leukemia. Cancer Cell 1, 63-74. Higuchi, M., O´Brien, D., Lenny, N., Yang, S., Cai, Z. and Downing, J. (2000) Expression of AML1-ETO immortalizes myleloid progenitors and cooperates with secondary mutations to induce granulocytic sarcoma / acute myeloid leukemia. Blood 1, 63-74. Huntly, B. and Gilliland, D. (2005) Leukaemia stem cells and the evolution of cancer-stem-cell research. Nat Rev Cancer 5, 311-321. Ichikawa, M., Asai, T., Saito, T., Yamamoto, G., Seo, S., Yamazaki, I., Yamagata, T., Mitani, K., Chiba, S., Hirai, H., et al. (2004) AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cell in adult hematopoiesis. Nature Med 10, 299-304. Jaiswal, S., Traver, D., Miyamoto, T., Akashi, K., Lagasse, E. and Weissman, I.L. (2003) Expression of BCR/ABL and BCL-2 in myeloid progenitors leads to myeloid leukemias. Proc. Natl. Acad. Sci. USA 100, 100002-110007. Kinzler, K.W. and Vogelstein, B. (1997) Cancer-susceptibility genes. Gatekeepers and caretakers. Nature 386, 761, 763.

RUNX1: A GATEKEEPER IN LEUKEMIA

197

Kuo, Y., Landrette, S., Heilman, S., Perrat, P., Garrett, L., Liu, P., Beau, M.L., Kogan, S. and Castilla, L. (2006) Cbfβ-SMMHC induces distinct abnormal myeloid progenitors able to develop acute myeloid leukemia. Cancer Cell 9, 57-68. Landrette, S., Kuo, Y., Hensen, K., Barjesteh van Waalwijk van Doorn-Khosrovani, S., Perrat, P., Van de Ven, W., Delwel, R. and Castilla, L. (2005) Plag1 and Plagl2 are oncogenes that induce acute myeloid leukemia in cooperation with Cbfb-MYH11. Blood 105, 2900-2907. Li, F., Tiede, B., Massagué, J. and Kang, Y. (2007) Beyond tumorigenesis: cancer stem cells in metastasis. Cell Research 17, 3-14. Licht, J. (2001) AML1 and the AML1-ETO fusion protein in the pathogenesis of t(8;21) AML. Oncogene 20, 5660-5679. Lo-Coco, F. and Ammatuna, E. (2006) The biology of acute promyelocytic leukemia and its impact on diagnosis and treatment. Hematology Am Soc Hematol Educ Prog 29006, 162-168. Martelli, A., Nyakern, M., Tabellini, G., Bortul, R., Tazzari, P., Evangelisti, C. and Cocco, L. (2006) Phosphoinositide 3-kinase/Akt signaling pathway and its therapeutical implications for human acute myeloid leukemia. Leukemia 20, 911-928. Matsuno, N., Osato, M., Yamashita, N., Yanagida, M., Nanri, T., Fukushima, T., Motoji, T., Kusumoto, S., Towatari, M., Suzuki, R., et al. (2003) Dual mutations in the AML1 and FLT3 genes are associated with leukemogenesis in acute myeloblastic leukemia of the M0 subtype. Leukemia 17, 2492-2499. McHale, C., Wiemels, J., Zhang, L., Ma, X., Buffler, P., Feusner, J., Matthay, K., Dahl, G. and Smith, M. (2003) Prenatal origin of childhood acute myeloid leukemias harboring chromosomal rearrangements t(15;17) and inv(16). Blood 101, 4640-4641. Miller, J., Horner, A., Stacy, T., Lowrey, C., Lian, J., Stein, G., Nuckolls, G. and Speck, N. (2002) The core-binding factor beta subunit is required for bone formation and hematopoietic maturation. Nat Genet 32, 645-649. Miyamoto, T., Weissman, I. and Akashi, K. (2000) AML1/ETO-expressing nonleukemic stem cells in acute myelogenous leukemia with 8;21 chromosomal translocation. Proc. Natl. Acad. Sci. USA 97, 7521-7526. Mori, H., Colman, S., Xiao, Z., Ford, A., Healy, L., Donaldson, C., Hows, J., Navarrete, C. and Greaves, M. (2002) Chromosome translocations and covert leukemic clones are generated during normal fetal development. Proc. Natl. Acad. Sci. USA 99, 8242-8247. Morrow, M., Horton, S., Kioussis, D., Brady, H. and Williams, O. (2004) TEL-AML1 promotes development of specific hematopoietic lineages consistent with pre-leukemic activity. Blood 103, 3890-3896. Mulloy, J., Cammenga, J., Berguido, F., Wu, K., Zhou, P., Comenzo, R., Jhanwar, S., Moore, M. and Nimer, S. (2003) Maintaining the self-renewal and differentiation potential of human CD34+ hematopoietic cells using a single genetic element. Blood 102, 4369-4376. Mulloy, J., Jankovic, V., Wunderlich, M., Delwel, R., Cammenga, J., Krejci, O., Zhao, H., Valk, P., Lowenberg, B. and Nimer, S. (2005) AML1-ETO fusion protein up-regulates TRKA mRNA expression in human CD34+ cells, allowing nerve growth factor-induced expansion. Proc. Natl. Acad. Sci. USA 102, 4016-4021. Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K. and Ito, Y. (1993) PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc. Natl. Acad. Sci. USA 90, 6859-6863. Okuda, T., Cai, Z., Yang, S., Lenny, N., Lyu, C., van Deursen, J., Harada, H. and Downing, J. (1998) Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood 91, 3134-3143.

198

C. STOCKING ET AL.

Osato, M. (2004) Point mutations in the RUNX1/AML1 gene: another actor in RUNX1 leukemia. Oncogene 23, 4284-4296. Peterson, L. and Zhang, D. (2004) The 8;21 translocation in leukemogenesis. Oncogene 23, 42554262. Putz, G., Rosner, A., Nuesslein, I., Schmitz, N. and Buchholz, F. (2005) AML1 deletion in adult mice causes splenomegaly and lymphomas. Oncogene 25, 929-939. Raynaud, S., Cave, H., Baens, M., Bastard, C., Cacheux, V., Grosgeroge, J. and al, e. (1996) The 12;21 translocation involkving TEL and deletion of the other TEL allele: two frequently associated alterations found in childhood acute lymphoblastic leukemia. Blood 87, 28912899. Rosenbauer, F., Koschmieder, S., Steidl, U. and Tenen, D.G. (2005) Effect of transcription-factor concentrations on leukemic stem cells. Blood 106, 1519-1524. Roumier, C., Eclache, V., Imbert, M., Davi, F., MacIntyre, E., Garand, R., Talmant, P., Lepelley, P., Lai, J., Casasnova, O., et al. (2003a) M0 AML, clinical and biologic features of the disease, including AML1 gene mutations: a report of 59 cases b the Groupe Francais d'Hématologie Cellulaire (GFHC) and the Groupe Francais de Cytogénétique Hématologique (GFCH). Blood 101, 1277-1283. Roumier, C., Fenaux, P., Lafage, M., Imbert, M., Eclache, V. and Preudhomme, C. (2003b) New mechanisms of AML1 gene alteration in hematological malignancies. Leukemia 17, 9-16. Schessl, C., Rawat, V., Cusan, M., Deshpande, A., Kohl, T., Rosten, P., Spiekermann, K., Humphries, R., Schnittger, S., Kern, W., et al. (2005) The AML1-ETO fusion gene and the FLT3 length mutation collaborate in inducing acute leukemia in mice. J Clin Invest 115, 2159-2168. Schwieger, M., Löhler, J., Friel, J., Scheller, M., Horak, I. and Stocking, C. (2002) AML1-ETO inhibits maturation of multiple lymphohematopoietic lineages in induces myeloblast transformation in synergy with ICSBP deficiency. J. Exp. Med. 196, 1227-1240. Shigesada, K., van de Sluis, B. and Liu, P. (2004) Mechanism of leukemogenesis by the inv(16) chimeric gene CBFB/PEBP2B-MHY11. Oncogene 23, 4297-4307. Singh, S., Hawkins, C., Clarke, I.D., Squire, J.A., Bayani, J., Hide, T., Henkelman, R.M., Cusimano, M.D. and Dirks, P.B. (2004) Identification of human brain tumour initiating cells. Nature 432, 396-401. Somervaille, T. and Cleary, M. (2006) Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia. Cancer Cell 10, 257-268. Song, W., Sullivan, M., Legare, R., Hutchings, S., Tan, X., Kufrin, D., Ratajczak, J., Resende, I., Haworth, C., Hock, R., et al. (1999) Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukemia. Nat Genet 23, 166-175. Speck, N. and Gilliland, D. (2002) Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer 2, 502-513. Sun, W. and Downing, J. (2004) Haploinsufficiency of AML1 results in a decrease in the number of LTR-HSCs while simultaneously inducing an increase in more mature progenitors. Blood 104, 3565-3572. Tenen, D.G. (2003) Disruption of differentiation in human cancer: AML shows the way. Nat Rev Cancer 3, 89-101. Thiede, C., Steudel, C., Mohr, B., Schaich, M., Schakel, U., Platzbecker, U., Wermke, M., Bornhauser, M., Ritter, M., Neubauer, A., et al. (2002) Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtypes and identification of subgroups with poor prognosis. Blood 99, 4326-4335.

RUNX1: A GATEKEEPER IN LEUKEMIA

199

Tonks, A., Pearn, L., Tonks, A., Pearce, L., Hoy, T., Phillips, S., Fisher, J., Downing, J., Burnett, A. and Darley, R. (2003) The AML1-ETO fusion gene promotes extensive self-renewal of human primary erythroid cells. Blood 101, 624-632. Tsuzuki, S., Seto, M., Greaves, M. and Enver, T. (2004) Modeling first-hit functions of the t(12;21) TEL-AML1 translocation in mice. Proc. Natl. Acad. Sci. USA 101, 8443-8448. Vexcovi, A., Galli, R. and Reynolds, B. (2006) Brain tumor stem cells. Nat Rev Cancer 6, 425436. Vogelstein, B. and Kinzler, K. (2004) Cancer genes and the pathways they control. Nat Medicine 10, 789-799. Wang, Q., Stacy, T., Miller, J., Lewis, A., Gu, T., Huang, X., Bushweller, J., Bories, J., Alt, F., Ryan, G., et al. (1996) The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87, 697-708. Wang, S., Wang, Q., Crute, B., Melnikova, I., Keller, S. and Speck, N. (1993) Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer corebinding factor. Mol Cell Biol 13, 3324-3339. Wang, Y., Zhou, G., Yin, T., Chen, B., Shi, J., Liang, W., Jin, X., You, J., Yang, G., Shen, Z., et al. (2005) AML1-ETO and C-KIT mutation/overexpression in t(8;21) leukemia: implication in stepwise leukemogenesis and response to Gleevec. Proc. Natl. Acad. Sci. USA 102, 1104-1109. Warner, J., Wang, J., Hope, K., Jin, L. and Dick, J. (2004) Concepts of human leukemic development. Oncogene 23, 7164-7177. Wiemels, J., Cazzaniga, G., Daniotti, M., Eden, O., Addison, G., Masera, G., Saha, V., Biondi, A. and Greaves, M. (1999) Prenatal origin of acute lymphoblastic leukaemia in children. Lancet 354, 1499-1503. Wunderlich, M., Krejci, O., Wei, J. and Mulloy, J. (2006) Human CD34+ cells expressing the inv(16) fusion protein exhibit a myelomonocytic phenotype with greatly enhanced proliferative ability. Blood 108, 1690-1697. Yan, M., Kanbe, E., Peterson, L., Boyapati, A., Miao, Y., Wang, Y., Chen, I., Chen, Z., Rowley, J., Willman, C., et al. (2006) A previously unidentified alternatively spliced isoform of t(8;21) transcript promotes leukemogenesis. Nat Medicine 12, 945-949. Zelent, A., Greaves, M. and Enver, T. (2004) Role of the TEL-AML1 fusion gene in the molecular pathogenesis of childhood acute lymphoblastic leukaemia. Oncogene 23, 42754283.

IV CELL PROCESSING, EXPANSION AND GENETIC MODIFICATION

NOVEL METHODOLOGICAL APPROACHES IN ASSESSMENT AND ENRICHMENT OF STEM CELL POPULATION N.M. BILKO1*, D.I. BILKO2 National University “Kyiv-Mohyla Academy”, Kiev, Ukraine 2 University of Hull, Department of biological sciences, United Kingdom 1

Keywords: stem cell expansion; stem cell culture in vitro; diffusion chambers

Abstract. Development of the long-term models of hematopoietic stem cells (HSCs) cultures and investigation of cell interactions are the important tasks in modern biotechnology. Strategies of hematopoietic progenitor cell expansion in the past decades have made considerable progress. Successful ex vivo expansion of hematopoietic and progenitor cells could be implemented for a variety of clinical applications. Increasing cells numbers of HSC is of a great benefit for transplantation purposes or genetic modification. However, ex vivo HSC expansion for clinical applications encounters many difficulties. It is suggested, that stromal presence is important for hematopoiesis alongside with cytokines in vitro and in vivo, but the question remains: whether diffusible factors produced by stromal cells are sufficient for the regeneration of primitive hematopoietic cells, or whether direct cell-to-cell contacts would be required. During present studies, influence of feeder layer and feeder layer condition media on AC133+ cells derived from human umbilical cord blood was investigated and their proliferative, differentiative and clonogenic activity was studied. In attempt to solve some of the problems associated with long-term hematopoietic stem cell cultures, original model of gel diffusion capsules (DC) was developed and patented. Diffusion Capsule is a new and totally original system that allows the cultivation of various cell types both in vitro and in vivo. Cells cultured in the capsule are separated from the outside media, from feeder layers or from the immune system of the host, allowing studies where exclusion of contaminating cell types is essential. Our data suggests that hematopoiesis can be sustained for prolonged periods of time in the presence of feeder layer

______ * To whom correspondence should be addressed. Bilko Nadja, Nikolaeva 3V, flat 8, Kiev 02225 Ukraine; email: [email protected]

201 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 201–210. © 2008 Springer.

202

N.M BILKO AND D.I. BILKO

cells or condition media supported culture models. Prolonged support of primitive hematopoietic cells (undifferentiated cells such as promyelocytes, myelocytes and metamyelocytes) and their clonogenic capacity and functional characteristics in feeder layer positive cultures, indicates that diffusible factors are sufficient for hematopoiesis and that direct cell-to-cell contacts may not be exclusively required for successful long term in vitro hematopoiesis.

1. Introduction Development of the long-term culture of haemopoietic stem cells (HSCs) with progenitor cell expansion is a great benefit for transplantation or genetic modification. However, ex vivo HSC expansion for clinical applications encounters many difficulties. Ideal long term culture would include reproduction of all stages of blood formation from the most primitive cell types to functional cells. The cultures maintain a “steady-state” of cell production for several months with continued renewal of the stem cells balanced by loss of cells through differentiation and development (Gluckman et al. 2000; Devine et al. 2003). 1.1. THE PATH TO PRESENT. PIONEERING INVESTIGATIONS

In 1887 Il’ya Mechnikoff needed a method which would separate phagocytic cells from humoral factors. He invented the prototype of diffusion chamber that consisted of a thin-walled cylinders of reed marrow (Phragmites communis). A few years later similar techniques were developed for microbes. The microbes were suspended in nutrient media, introduced into bags made from porous materials like collodion, and placed into experimental animals. Rezzesi (1932) was the first to culture tissue fragments from various organs in vivo. Next stage was introduced by Algire and co-workers (1954) who used Millipore filter membranes with determined pore sizes, made from nitrocellulose or cellulose esters. Such filters could be glued to plastic rings to make a chamber. Berman and Kaplan (1960) cultured hematopoietic cells in the abdominal cavities of mice (Paul 1959). In the 1980s several advances were made, which suggested that the ability of HSC to proliferate without loss of self-renewal might be harnessed ex vivo. Expansion of immature hematopoietic and progenitor cells, sufficient for clinical application, now seemed within reach. Potential applications ex vivo hematopoietic expansion are abrogating or shortening the period of profound pancytopenia following high dose

NOVEL APPROACHES IN STEM CELL ENRICHEMENT

203

chemotherapy; accelerate hematologic recovery after hematopoietic stem cell transplantation; stem cell use for directed tissue repair and hematopoietic stem cell gene therapy Hundreds of laboratories worldwide following in the heels of the pioneering investigations attempted to maximize the efficiency of purified human progenitor cell cultures (CD34+, CD34+lin-) populations, adding different cytokines. However, these studies were rarely accompanied by assays of true stem cell repopulating cell numbers, because of the difficulty of manipulating the human-to-NOD/SCID or SCID/hu transplant assays (Larochelle., 1996; Koller et al. 1998). Studies in murine stem cell transplants indicated that SCF, FLT-3 ligand, and trombopoietin (TPO) were the most important cytokines for promoting true stem cell expansion (Lapidot 1992, Weissman, 2000). Clinical trials began using ex vivo expanded hematopoietic cells to replace standard autografts, and later allografts. 1.2. ASSESSMENT OF FUNCTIONAL PROPERTIES OF CULTIVATED STEM CELLS AND PROGENITOR CELLS

1.2.1. Spleen Colony Forming Units CFU-S It was determined that hemapoietic recovery (at least in mice) could be predicted by the appearance of spleenic nodules the significance of which was recognized by Till and McCulloch (1961). Authors describe the difficulty of manipulating the human-to- NOD/SCID or SCID/hu transplant assays (Spooncer et al., 1986; Williams et al., 1996; Koller et al., 1998). 1.2.2. Colony-Forming Cells CFC In vitro in Semisolid Media The first experiments describing the clonal growth of hemopoietic progenitor cells immobilized in a soft gel matrix in vitro were reported by Bradley and Metcalf (1966) and Pluznick and Sachs (1965). Clonogenic cells are plated in the presence of various of feeder cells, medium conditioned by the growth of different tissues or cell lines in cultures (for example, 5637 bladder carcinoma conditioned media) and colony stimulating factors such as GM-CSF, G-CSF, M-CSF, Epo, interleukins. 1.2.3. Cell-to-Cell Interactions in Expansion Culture In vitro and in vivo studies have shown that stromal cells provide a rich environment of signals (cytokines, extracellular matrix, adhesion molecules etc.) that control proliferation, survival and differentiation of hematopoietic progenitor cells (Chailakhian, 1978; Verfaillie, 2002). Recently investigators incorporated stromal components into the expansion cultures (Kawano et al.

204

N.M BILKO AND D.I. BILKO

2006). Results suggested that following a myeloablative conditioning regiment, hematopoietic cells cultured under stroma-free conditions may be insufficient to support the maintain both short- and long-term engraftment capacities. The cells were expanded in static culture for 10 days in Teflon bags (American Fluoroseal, USA). Koller et al. (1998) successfully expanded umbilical cord blood cells in a novel automated perfusion culture system. 1.3. APPROACHES FOR CULTURE OF PRIMITIVE HUMAN HEMATOPOIETIC PROGENITORS •

“stroma-contact” originally described by Dexter (1982).

•

“stroma-free” cultures supplemented with repeatedly added cytokines GMCSF, G-CSF, M-CSF, Epo, LIF, bFGF, interleukins (Mayani et al. 1993);

•

“stroma-non-contact” cultures in which progenitors are cultured separately from a stromal feeder by microporous membrane (Verfaillie, 1994). Before that a collagen gel with fibroblasts and filter insert was introduced by Fusenig, (1983). Koller et al. (1998) successfully expanded umbilical cord blood cells in a novel automated perfusion culture system. Then a novel gel diffusion capsule inserted in the flask with feeder layers was introduced by Bilko N., Bilko D., 2006 (in press).

1.3.1. Stromal Contact Cultures Support Hematopoiesis The most immature cells remain in the adherent layer that is described as “cobblestone” areas, and are released to the growth media upon division and maturation. Major cell types in the cellular environment are macrophages, adipocytes cells and blanket cells. From the “cobblestone” areas hematopoietic cells are released into the growth media until the cultures begin to decline (8 weeks or later). Sign that the hematopoietic activity is declining is predominance of macrophages in the non-adherent cell population and decline of hematopoietic cell foci in the adherent layer (Dexter 1982). 1.3.2. Stroma-Free Cultures Long term stroma-free cultures can also be established from primitive hematopoietic progenitors in the absence of adherent stromal layer if cytokines are added (GM-CSF, G-CSF, M-CSF, Epo, interleukins). Although primitive progenitors can be induced to differentiate in these cultures, maintenance and extensive proliferation of long-term culture initiating cells (LTC-IC) are poor. It was suggested that, hematopoietic cells cultured under stroma-free conditions may loose the ability to support short- and long-term engraftment (Bhatia et al. 1997).

NOVEL APPROACHES IN STEM CELL ENRICHEMENT

205

1.3.3. Stroma-Non Contact Cultures Third type of culture is “stroma-non contact”. In this system primitive progenitor cells are sustained when cells are co-cultured with irradiated allogeneic stroma but separated from it by the 0,4 micron membrane in transwell inserts (Costar, Cambridge, MA). These cultures are maintained by daily supplementation of stromal feeder conditioned media (Koller et al. 1998, Verfaillie, 2001) successfully expanded umbilical cord blood cells in a novel automated perfusion culture system. Development these approaches followed in the studies of investigators who incorporated the stromal components into the expansion culture. Recently published trials by McNiece et al. 2000 are more encouraging where cells were expanded in static culture for 10 days in Teflon bags (American Fluoroseal, USA). 2. Materials and Methods 2.1. ADC- ASSAY WITH HUMAN STEM CELL IN VITRO

The molecule AC133 has been shown to be marker of more primitive hematopoietic progenitors. Isolation of AC133+ cells is a convenient method for enriching stem cells and progenitor populations prior to assessment in culture assays and allows the study of their abilities in the absence of many cytokine producing cells e.g. monocytes. (Wobus 2001) Isolation of the AC133+ was performed with antigen specific monoclonal antibody immunoselection columns (Gallaher et al. 2000; Wynter et al. 2001). AC133+(Lin-) from human umbilical cord blood were treated by PKH26 fluorescent dye. Original model of gel diffusion chambers (DC) culture system was implemented. Purified cells in concentration 5×103 were injected in to the inner cavity of the DC in Dulbecco modified Eagle medium (DMEM; Gibco-BRL) with 15% FCS and placed in to 6-well plates (Nunc) with 7ml of DMEM per well, 15% FCS, 1000u/ml penicillin, 100u/ml streptomycin, L-glutamine, 0.1mM β - mercaptoethanol in absolute humidity at 37°C, and 5% CO2 and cultivated for the duration of two weeks (Bilko 1997. Bilko et al. 2005). Feeder layers from fetal liver of 8-10 days mouse embryos were maintained at 37oC in DMEM supplemented with 20% FCS and 50 µmol/L 2-mercaptoethanol. Cells were subcultured in 6- well plates (Nunc), grown to confluency and then treated by Mytomycin-C (Djakonov and Sit’kov 2000). Cultures were incubated in a humidified atmosphere at 37°C and 5% CO2 and evaluated after 14 days. Cultured material was inspected in situ under inverted microscope on daily basis and the culture medium was changed every 48 hours.

206

N.M BILKO AND D.I. BILKO

The first batch of cells consisted of AC 133+ cells cultivated in the diffusion chambers submerged on top of the feeder (feeder -AC133 cells /Fl-C). The second batch consisted of human embryonic liver cell suspension directly cocultured with AC133+ cells at equal initial quantities (5×103) in the diffusion chambers submerged in the 6-well plates without additional feeder layer (FCC). Third batch of experiments represented AC133+ cells cultured in the DC surrounded by FL condition media (condition media-AC133+ cells/CM-C). In the control group cells were cultivated in the same condition without any additions and without feeder layers. Cytospin samples were prepared and cells were stained with Gimza stain according to the standard protocol (Punzel 1999). Morphological, cytochemical and cytological characteristics were then studied and quantified. For CFC (colony forming cells) enumeration cultivated cells from diffusion chambers were plated in 0.33% agar Difco containing IMDM supplemented with 30% FCS, 3 IU erythropoietin and 10ng/ml IL-3 (Lewis et al. 2001). Material from the DC was subcultured at a concentration of 3×104 cells per well in vitro. Analysis of clonogenic activity of subcultured cells indicated, that initial cultures indeed produced functional progenitors that consisted from maturing or mature members of the myeloid and erythroid origin. 3. Results LONG TERM EX VIVO MAINTENANCE OF HUMAN HEMOPOIETIC STEM CELLS

Long term ex vivo maintenance of human hematopoietic stem cells requires growth promoting cytokines;. factors that inhibit proliferation of clonogenic cells (such as MIP-1α); stroma-derived growth factors and direct contact with stroma. The need for direct cell-to-stroma contact is still a matter of many scientific debates and its resolution depends on the development of new scientific approaches. We currently established cultural system (amphycultural diffusion capsules) that allowed for conditions favorable for stem cell expansion in vitro. Many cell types and culture protocols and their combination with cytokines, growth factors, feeder layers can be implemented with ADC. Capsules are characterized by high perfusion rates that ensure that allow dilution of inhibitory autocrine factors and support long-term cell expansion. We have shown that ADC in vitro provides optimal cellular microenvironment that supports long term hematopoiesis (Bilko et al. 2005). The mechanisms of cell to cell interactions are difficult to study under in vivo conditions because of the many variables involved and the lack of

NOVEL APPROACHES IN STEM CELL ENRICHEMENT

207

properly controlled experimental conditions. So ADC was specifically developed as a suitable in vitro controlled model for studying cell-to-cell interaction. ADC serves as a good model for the investigation of the non-contact interactions. Analysis of the cells grown in ADC cultures in vitro showed that cells in the control group cultured without feeder layer and without any additions could not sustain hematopoiesis and macrophage growth prevailed. Successful growth of cells was determined in group FC-C where direct contact between feeder cells and hematopoietic cells was provided. Because numbers of the maturing and mature cells were comparatively low, qualitative characteristics of the cultures compared relative number of the proliferating cells to the terminally differentiated macrophages. Term “proliferating cells” combined all blast cells, promyelocytes, myelocytes, metamyelocytes. Cytological analysis of the material cultured for two weeks has shown, that the relative numbers of proliferating cells was significantly higher in comparison to macrophages in culture with feeder layer (FL-C) (80% and 20% respectively) but was significantly lower in cultures without feeder layer but with added condition medium CM-C (60% and 40% respectively (P<0,001). Intriguingly, the use of the stromal condition media during the cultivation of AC133+ cells had a similar pronounced effect on stimulation of the proliferation as with feeder layers. Our data suggests that hematopoiesis can be sustained for prolong cultivation periods in the presence of feeder layer cells or condition media supported culture models. Prolonged support of primitive hematopoietic cells (undifferentiated cells such as promyelocytes, myelocytes and metamyelocytes) and their clonogenic capacity and functional characteristics in feeder layer positive cultures, indicates that diffusible factors are sufficient and that direct cell-to-cell contacts may not be exclusively required for successful long term in vitro hematopoiesis. Obtained results suggest that stromal cells play important role in long term maintenance of hematopoiesis ex vivo. They induce proliferation and partially inhibit terminal differentiation and prolong hematopoiesis in long term in vitro cultures. Feeder layer derived from human embryos was adequate model for AC133+ cultures and had stimulating effect on the proliferation of the progenitor cells in vitro. 4. Discussion Detailed analysis of the cultured cells indicated, that direct cell-to-cell contact of the stromal and hematopoietic cells are not necessary for hematopoiesis, and that diffusible factors produced by feeder layers are sufficient. Prevailing proliferation in AC133+ cultures with feeder layers, the ability of cells to form

208

N.M BILKO AND D.I. BILKO

colonies of the progenitor cells in the semisolid culture conditions indicate that hematopoiesis can be sustained in cultures in vitro and that proliferation of the hematopoietic stem cells can be achieved ex vivo (Bilko et al. 2005). The developed conditions and the use of the original ADC culture model reduce the risk of contamination of the cultured material with feeder layer cells that can be of a great importance if this method is to be implicated in the field of cell therapy. The effects of stromal condition media on hematopoiesis during this studies are comparative to our previous studies and the work of E. Verfaillie (1990, 1994), that postulated that indirect effects of soluble growth factors produced by mouse embryonic feeder layers have better results on the progenitors than direct cell-to-cell contacts in a different culture model. Scrupulous analysis of the feeder layer condition media may shed some light on the types of factors that are necessary and sufficient for the successful in vitro progenitor cells expansion. It would be of a great importance to study and understand the role of these factors in the regulation of the self renewal processes and long-term maintenance of the hematopoietic progenitor cells.

References Bhatia R., McGlave P. and Miller J. (1997) A clinically suitable ex vivo expansion culture system for LTC-IC and CFC using stroma-conditioned medium, Exp Hematol 25, 980-991. Bilko N. (1997) Culture of erythroid precursor cells of individuals exposed to ionizing radiation, Cytology and Genetics. Allerton Press, inc.New York 31, 5, 54-59. Bilko N., Votyakova I., Vasylovska S. and Bilko D. (2005) Characterization of the interactions between stromal and haematopoietic progenitor cells in expansion cell culture models, Cell Biology International 29, 83-86. Bilko N., Bilko D., Newton C., Newbold C., Chapman T. (2006) Gel for stem cell culture. UK Patent pending. Chailakhian R, Gerasimov Y, Fridenstein A. (1978) Bone marrow microenvironment transfer by clones of stromal mechanocytes Bjull Eksp. Biol. Med., 86(12); 705-707. Chertkov I., Derjugina E., Drize N. (1990) Primitive hematopoietic stem cell, Vestnik of academy of medical sciences 9, 35-37. Devine S., Lazarus H. and Emerson S. (2003) Clinical application of hematopoietic progenitor cells expansion: current status and future prospects, Bone marrow transplantation 31, 241252. Dexter, T., Allen, T. and Lajtha, L. (1977) Conditions controlling the proliferation of haemopoietic cells in vitro, J Cell Physiol 91, 335-344. Dexter T. (1982). Stromal cell associated haemopoiesis, J. Cellular Physiology (suppl.) 1, 87-94. D’jakonov L.P., Sit’kov V.I. Animal cell in culture (2000) Methods and application in biotechnology 400. Fusenig N., Breitkreutz D., Dzarlieva R., Boucamp P., Bohnert A., Tilgen W (1983) Growth and differentiation charachteristics of transformed keratinocytes from mouse and human skin in vitro and in vivo, J. Invest. Dermatol. 81, 168-175.

NOVEL APPROACHES IN STEM CELL ENRICHEMENT

209

Gallaher L., Murdoch B., Wu D., Karanu F., Keeney M., Bhatia M. (2000) Isolation and characterization of human C34(-)Lin(-) and C34(+)Lin(-) hematopoietic stem cells using cell surface markers AC133 and CD7, Blood 95, 2913-2820. Gluckman E. (2000) Current status of umbilical cord blood hematopoietic stem cell transplantation, Exp Hematol 28, 1197-1205. Kawano Y., Kobune M., Chiba H., Nakamura K., Takimoto R., Takada K., Ito Y., Kato J., Hamada H. and Niitsu Y. (2006) Ex vivo expansion of G-CSF-mobilized peripheral blood CD133+ progenitor cells on coculture with human stromal cells, Exp Hematol 34(2), 150158. Koller M., Manchel I., Maher R., Goltry K., Armstrong R., Smith A. (1998) Clinical scale human umbilical cord blood cell expansion in a novel automated perfusion culture system,. Bone marrow transplant. 21(7), 653-665. Lapidot, T., Pflumio, F., Doedens, M., Murdoch, B., Williams, D. and Dick J. (1992) Cytokine stimulation of multi lineage hematopoiesis from immature human cells engrafted in SCID mice, Science 255, 1137-1141. Lewis I., Almeida-Porada G., Du J., Lemischka I., Moore K., Zanjani E. and Verfaillie C. (2001) Umbilical cord blood cells capable of engrafting in primary, secondary, and tertiary xenogeneic hosts are preserved after ex vivo culture in noncontact system, Blood 97, 34413449. Mayani H., Dragowska W., Lansdorp P. (1993) Cytokines-induced selective expansion and maturation of erythroid versus myeloid pregenitors from purified cord blood precursor cells, Blood 81(12), 3252-3258. Paul J. (1959) Cell and tissue culture. First edition. Livingstone press 261. Pluznik D., Sack L. (1965) The cloning of normal “mast” cells in tissue culture, J. of Cellular Physiology 66, 319-324. Punzel, M., Wissink, S., Miller, J., Moore, K., Lemishka, I. and Verfaillie, C. (1999) The myeloid-lymphoid initiating cell (ML-IC) assay assesses the fate of multipotent human progenitors in vitro, Blood 93, 3750-3756. Verfaillie, C. (1990) Direct contact between human primitive hematopoietic progenitors and marrow stroma is not required for long-term in vitro hematopoiesis, Blood 79, 2821-2826. Verfaillie, C. (1994) Can human hematopoietic stem cells be cultured ex vivo? Stem cells 12, 466476. Verfaillie C. (2001) Umbilical cord blood cells capable of engrafting in primary, secondary, and tertiary xenogeneic hosts are preserved after ex vivo culture in noncontact system, Blood 97, 3441-3449. Verfaillie C. (2002) Hematopoietic stem cells for transplantation, Nat Immunol 3, 314-317. Wang J., Doedens M. and Dick J. (1997) Primitive human hematopoietic cells are enriched in cord blood compared with adult marrow or mobilized peripheral blood as measured by the quantitative in vivo SCID-repopulating cell assay, Blood 89, 3919-3924. Weissman I. (2000) Translating stem and progenitor cell biology to the clinic: barriers and opportunites, Science 287, 1442-1446. Wobus A. (2001) Potential of embryonic stem cells, Molecular Aspects of Medicine 22, 149-164. Wynter, E. and Ploemacher, R. (2001) Assays for the assessment of human hematopoietic stem cells, J Biol Regul Homeost Agents 15, 23-27. Wynter E. and Testa N. (2001) Interest of cord blood, Blood 15, 97(8), 2286-2292. Larochelle A., Vormoor J., Hanenberg H., Wang J., Bhatia M., Lapidot T., Moritz T., Murdoch B., Xiao X., Kato I., Williams D., Dick J. Identification of primitive human hematopoetic

210

N.M BILKO AND D.I. BILKO

cells capable of repopulating NOD/SCID mouse bone marrow: implication for gene therapy. 1996 Nat.Med. 2(12) 1329-37 McNiece I., Jones R., Bearman S., Cagnoni P., Nieto Y., Franklin W., Ryder J., Steele A., Stoltz J., Russell P., McDermitt J., Hogan C., Murphy J., Shpall E. (2000) Ex vivo expanded peripheral blood progenitor cells provide rapid neutrophil recovery after high dose chemotherapy in patients with breast cancer 96 (9) 3001-3007.

ANIMAL HYBRIDS AND STEM CELLS: THEIR USE IN BIOTECHNOLOGY AND CLINICAL PRACTICE

L.P. DJAKONOV * All-russian scientific research institute of veterinary medicine of the Russian academy of agricultural sciences Moscow

Keywords: Stem cells; hybridoma; biotechnology

Abstract. The hybrid cell lines, which we have obtained, can be widely used in veterinary virology and biotechnology for preparing vaccines, test-systems for viruses. Any strains of hybrid cells are producing the biological active proteins (enzymes and others). We have obtained hybrid cell lines (PО-ТКхCО, PОТКхHО), which are sensitive to prion protein, and also hybrid culture with β-cells of the pancreas of rabbit.

1. The Stem Cells are Perspective Cell-Models for Biotechnology and Clinical Utilization (use) in Medicine and Veterinary Medicine Modern biotechnology develops basing on fundamental scientific achievements of cytology, genetics, cell cultivating, cell and genetic engineering. Cell engineering, partly the hybridization of animal and human cells, allows creating cell systems (cell cultures), which have the unique possibilities. Several perspective trends for development of the research concerning domestic animals cells hybridization and obtaining cell systems for biotechnology, human and veterinary medicine can be determined. They are creating hybrids with macrophages, hepatocytes, neurocytes, nucleated and

______ * To whom correspondence should be addressed. Djakonov L. P., All-russian scientific research institute of veterinary medicine of the Russian academy of agricultural sciences, Moscow, Email: [email protected]

211 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 211–222. © 2008 Springer.

212

L.P. DJAKONOV

enucleated erythrocytes of animals; hybrids producing the viral antigens, partly retroviral and other slow and latent viruses, prions; hybrids in vitro producing animal immunoglobulins; investigating the steadiness of hybrid cultures genome and using them for gene mapping in animal chromosomes, and besides, the interaction between viruses and cell, cytopathologies and sensitivity of the cell cultures to viruses, prions and other pathogens, for their wide usage in virology, producing viral antigens and working out the systems of broad hybrid cultures cultivating. The method of hybridization was firstly used after obtaining the first hybridomas producing monoclonal antibodies (Köhler and Milstein, 1975). Nowadays thousands of mouse hybridomas producing monoclonal antibodies were obtained, which are applied in scientific research and diagnostics of different diseases. The hybridomas between two species were also obtained, for example, between mouse and human etc. The hybridomic technology has become the integral part of cell biotechnology (Fig. 1). The new trend of hybridization is the obtaining of hybrid cell cultures of domestic animals, which develops since the beginning of 1980-ies in the laboratory of cell biotechnology at the Institute of experimental veterinary (L. P. Djakonov, A. A. Kusch, T. M. Tugizov, 1985; E. V. Maydzhy, 1987). The assignment of obtaining of cell mutant cultures of domestic animals appears to be one of the hybridization problems. The cultures grown at different time are preserved in Animal Cells Collection and in the cryobank of the Institute of experimental veterinary, and the selection of TK- or GPRTdefective cells needed the answering of several questions. The attempts to obtain the mutant clones from recently received constant cell lines (PT-80 etc.) or from diploid cultures appeared to be unsuccessful. The timidinkinase- (SPEV-TK-) and hypoxantine-guanine-phosphorhybozyltransferaze- (TR and GPRT-) defective (mutant) сеlls were successfully selected using the method of selective pressure by 5-brome-2-desoxyuridine (BDU) or 8azoguanine (8-AG) in increasing concentrations from 1-4 to 40-200 mcg/ml and then the populations of cultures, steady to BDU or 8-AG were obtained (Djakonov L. P., Kusch A. A., Tugizov S. M., 1985). Consequently, it was ascertained that in long-term cultivated (5-10 and more years) cultures of cells, obtained from non-malignant tissues, the spontaneous mutations appear, and TKor GPRT-defective cells are present in the population of such cells, which can be selected under the selective pressure of antimetabolites. From the permanent line of bud cells of the sheep PO-2 the mutant culture PO-TK- is obtained (Kulikova I. L., Simonova A. S., Djakonov L. P., 2001).

ANIMAL HYBRIDS & STEM CELLS: THEIR USE IN BIOTECHNOLOGY 213

Antigen

Animal

B-Lymphocytes (Spleen, Lymphnodes)

Fusion (PEG, Elektroshock, others)

Myeloma

Hybridoma Selection in HAT-Medium Testing (RIA, IFA, others)

Cloning (2 - 3 times)

Cryoconservation

Cultivation

Mass culture of hybridoma for large scale antibody production

Antibody production by injection of hybridoma into mice

Figure 1. General scheme of hybridoma obtaining (after K. I. Galaktionov and I. V. Frinlyanskaya, 1986).

The level of mutagen process in the non-malignant cultures of cells, either induced or spontaneous, is very low. Thus, only from the long-term cultivated cells it is possible to select TK- or GPRT-defective cells suitable for hybridization in the selective system (Table 1).

L.P. DJAKONOV

214

TABLE 1. Mutant human and mammalian cells with TK and GPRT gene defects (after S. M. Tugizov, 1996) Cell name

Phenotype sign

Reverse frequency

1-3х10-6

TK defect

1-2х10-7

-6

1-3х10

TK defect

1-2х10-7

8-AG

5-6х10-5

GPRT defect 2-3х10-7

PLC/PRF/5-A7-1-13-2-GPRT- MNNG

8-AG

5-6х10-5

GPRT defect 1-2х10-7

U373MG-6- ТК-

EMS

5-BDU

7-8х10-5

TK defect

Not used

5-BDU

Not studied TK defect

PLC/PRF/5-A7-4-TKPLC/PRF/5-A7-14-ТК

-

PLC/PRF/5-A7-1-3-GPRT-

SЕМ-4- ТК

-

SPEV-D5-ТК

-

SPEV-А4- ТК CV-17-TK

Mutagens

Selective Mutating agents frequency

Not used

5-BDU

Not used

5-BDU

EMS

Not used -

Not used

-

ТР-АG-9- GPRT-

ТР-АG-13-GPRT

5-BDU 5-BDU

0,9-1,5 х10-7 Not studied

-4

TK defect

1-2х10-8

-4

TK defect

3-5х10-8

-5

3-4х10-7

5-6х10 5-6х10

Not used

5-BDU

1-2х10

TK defect

5-BDU

8-AG

5-6х10-6

GPRT defect 4-6х10-7

8-AG

-6

GPRT defect 1-3х10-7

5-BDU

5-6х10

Mutant сеll cultures gave the possibility to obtain intraspecific and interspecific hybrid cultures of cells with lymphocytes, enterocytes and other not growing or badly growing in vitro cells (Table 2). TABLE 2. Intraspecific and interspecific hybrid cells of agricultural animals, obtained in the laboratory of biotechnology (1982-2004) No 1.

Mutant cells SPEV-ТК

-

Conjunction partner

Hybrid culture

Authors

Blood lymphocytes (BL)

SPEV-ТК- х BL Interspecific hybrid culture

Tugizov S. M., Djakonov L. P. et al., 1985

-

2.

SPEV-ТК-

Splenocytes of pig’s embryo (SPE)

SPEV-ТК х SPE (А4хС) Intraspecific hybrid culture

3.

SPEV-ТК-

Enterocytes of cow embryo (ECE)

SPEV-ТК-х ECE Interspecific hybrid culture

4.

SPEV-ТК-

Lymphocytes of horse (LH)

SPEV-ТК-хLH (А4хЛ) Interspecific hybrid culture

5.

ТR-GPRT-

Lymphocytes of cow (LC)

ТR-GPRT-хLC Intraspecific hybrid culture

Maidzhy E. V., Dudar L. N., Djakonov L. P. et al., 1989 Maidzhy E. V., 1987 Maidzhy E. V., Djakonov L. P. et al., 1987 Tugizov S. M., Djakonov L. P. et al., 1985

ANIMAL HYBRIDS & STEM CELLS: THEIR USE IN BIOTECHNOLOGY 215

6.

7.

8.

9.

10.

PО-ТК-

Lymphocytes of sheep (LS)

PО-ТК- хLS Intraspecific hybrid culture

Kulikova I. L., Simonova A. S., Djakonov L. P., 2001

PО-ТК-

Splenocytes of sheep (SS)

PО-ТК-хSS Intraspecific hybrid culture

Kulikova I. L., Simonova A. S., Djakonov L. P., 2001

PО-ТК-

Lymphocytes of rabbit (LR)

-

PО-ТК хLR Interspecific hybrid culture

-

PО-ТК-

Splenocytes of rabbit (SR)

PО-ТК хSR Interspecific hybrid culture

-

β-cells of pancreas of rabbit(βR)

PО-ТК-х βR Interspecific hybrid culture – producent of insulin

PО-ТК

Savenko N. B., Simonova A. S., Djakonov L. P., 2003 Galnbek T. V., Djakonov L. P., Skaletskij N. N. et al., 2004 Kulikova I. L., Djakonov L. P., Feoktistova T. A., 1989

11.

Sp2/0

Splenocytes of mouse immuned by membrane antigen of mycoplasma

12.

Sp2/0

Splenocytes of mouse immuned by insulin

Sp2/0 х IN hybridoma – producent of McAb to insulin

Musienko M. I.,1992

Sp2/0

Lymphocytes of rabbit immuned by prion peptide

Sp2/0 х LR interspecific hybridoma – producent of McAb to prions

Savenko N. B., Simonova A. S., Djakonov L. P., 2003

Sp2/0

Splenocytes of mouse immuned by prion peptide

Sp2/0 х SM hybridoma – producent of McAb to prions

Savenko N. B., Simonova A. S., Djakonov L. P., 2004

13.

14.

Sp2/0 х МАМ –hybridoma –producent of McAb to Ag M. arginini

Savenko N. B., Simonova A. S., Djakonov L. P., 2002

The presence of two types of cells in the population, lymphocyte-like and epithelium-like, is the characteristic feature of hybrid cultures of cells with lymphocytes of domestic animals. Correlation of these two types of cells is different, however by the method of the directed selection it is possible to increase the population of lymphocyte-like cells to 60-80% and more, because even at stationary cultivation lymphocyte-like cells “go” away into suspension;

216

L.P. DJAKONOV

in addition, they form the clusters of cells on the surface of epithelium-like cells. Association of two types of cells is the most characteristic feature. The modal class of chromosomes of intraspecific hybrid cultures is alike to such of the partners of confluence, and two peaks of modal class appear in interspecific hybrids (dispersion of chromosomes from 29-35 to 72-89). As a rule, the hybrid cultures of cells save the sensitiveness to the viruses. The sensitiveness of some cultures to the viruses was higher, than of initial mutant partner. So, the sensitiveness of the culture А4хH (pig х horse) to the virus of horse rhynopneumony (herpes-virus of 1st type) was 10-1000 times higher, than to the SPEV culture. Hybrid pig х pig (А4хP) appeared to be highly sensitive to the virus of pigs’ classic hog cholera with the CPD manifestation and is suitable for the selection of CHCP virus isolates (Djakonov L. P., Maydzhy Е. А., Gerasimov V. N., 1994). Hybrid cultures with lymphocytes and splenocytes of sheep are sensible to the agent scrappy (PrPSc). From 1 to 20 passages after the single bringing PrPSc (homogenate of sheep cerebrum with the scrappy) the concentration of prion increased, which was determined by immunocytochemical methods. The method of prions PrPc/PrPSc detecting in the cultures of cells is developed by immunocytochemical method with the use of primary monoclonal antibodies to prion peptide and second antispecific antibodies marked by alkaline phosphatase or horse-radish peroxidase (Djakonov L. P., Kulikova I. L., Simonova A. S., Dagdanova A. V. et al., 2002). The polyclonal rabbit antibodies also appeared to be effective for immunocytochemical determination of prions in cells. (Savenko N. B., Simonova A. S., Djakonov L. P., 2004). Hybrid cultures as well as other permanent lines of cells maintain the deep freezing (–196ºС) and are saved this way. One of the problems of hybrid cultures maintenance and cultivation, especially interspecific, is the segregation of chromosomes. Therefore, the control of desirable correlation saving between hybridization partners’ chromosomes is obligatory. Possibilities of method of hybrid cultures obtaining which are used in biotechnology, for scientific and diagnostic researches are unlimited. The obtaining of hybrids with hepatocytes, enterocytes, keratinocytes and other cells, not growing or badly growing in vitro, is very perspective. 1.1. CONCLUSION

The methods of selection of mutant TK and HGPRT-defective cells from the permanent cellular lines of domestic animals are developed (SPEV, TR, and PO-2). It was ascertained that spontaneous mutations in the long-term cultivated permanent lines of cells of domestic animals are present; as a result, TK- and

ANIMAL HYBRIDS & STEM CELLS: THEIR USE IN BIOTECHNOLOGY 217

GPRT- defective cells appear in population. Using the method of the selective pressure by 5-BDU and 8-Ag, the mutant cultures of cells, defective by the indicated enzymes, are obtained. The intraspecific and interspecific hybrid cultures of cells are firstly obtained in the laboratory of the cellular biotechnology, A4H (SPEV TK- х lymphocytes of horse) and others. Hybrid cultures possess the unique properties. They are the ability to grow in the monolayer and in suspension, the high sensitiveness to the viruses. Hybrid cultures PO-TK-KHLO, PO-TK-KHSO are sensible to the agent scrappy, what allows using them for the study of diseases, caused by prions. 2. Animal and Human Stem Cells Stem cells are those, which have the possibility to self-renewal during the whole life of animal or human. The process of regeneration and proliferation in the damaged area is implemented due to the pool of stem cells. Stem cells have the ability of the unlimited division and self-renewal, and also of determination, but not final differentiation. Firstly the HSC were described by the Russian scientist А. А. Maximov (1908), who offered the term «stem cell». In 70-ies of the past century А. Fridenstein proved that the depot of HSC was in marrow. The new stage of development of HSC researches was the works of Evans M. J. and Kaufman M. H. (1981) and Martin J. R. (1981), who firstly obtained the embryonic stem cells of mouse. Scientists of different countries have described 3 types of ESC: 1. Actually ESС, obtained from the embryoblast of pre-implantation embryos of mammals; 2. Cells of embryonic carcinoma (ECC); 3. Primordial gametes of embryos (PGCE) (I. P. Savchenkova, 2000). The ESC of hamsters, rabbits, sheep, pigs, cattle, and primates are obtained from three embryonic layers, these are ectoderm, endoderm and mesoderm. The lines of murine permanent ESC are known. J. A. Thompson et al. (1996-1998) obtained several lines of permanent ESC of human from internal cellular mass (ICM) of blastocyst.

218

L.P. DJAKONOV

3. For ESC the Following Properties are Determining 3.1. CAPACITY FOR SELF-RENEWAL

From each SC in the organism two daughter cells appear after mitosis, one of which is the complete copy of maternal and is able to self-renewal, and the second is initially determined and possesses the certain potency to differentiating. 3.2. MULTIPOTENTIAL (WIDE POTENTIAL TO DIFFERENTIATING)

According to the accepted definition SC, resulting in only one type of the differentiated cells, are named unipotential (or monopotential), two - bipotential. Those cells which give the beginning to a few types of different specialized cells are named pluripotential or multipotential. Totipotential is the ability of cell to differentiate in all the types of cells and tissues of organism (in any of 350 specialized lines derivative of ectoderm, mesoderm and endoderm). 3.3. PLASTICITY

While entering SC back in organism after cultivation they are able to get the phenotype of the tissue which they got in. For example, SC become cardiomiocytes when being introduced into the cardiac muscle, neurons or glia cells in the cerebrum, adipocytes when entering the adipose tissue. 4. Regional Stem Cells (RSC) The stem cells of adult organism or regional stem cells (RSC) are not differentiated cells, which have been discovered in specialized tissues. They have the possibility of self-reproducing into all the cell types of the tissue they are originating from. RSC are not numerous and are dispersed in the tissues. The origin of the SC from different tissues of adult organism is known not enough. While differentiating the adult SC form the cells of intermediate type firstly, they are called the precursors. These are partly differentiated cells, which divide and give the origin to differentiated ones. The adult SC are characterized as pluripotent cells, which is the main feature of all the SC, that means the most part of all RSC (except the monopotent SC of cornea) can give the origin to the

ANIMAL HYBRIDS & STEM CELLS: THEIR USE IN BIOTECHNOLOGY 219

cells of different types. For example, blood SC can differentiate into different cell elements of blood. Altman J. and Das G.D. (1965) have shown the presence of SC in two departments of rat cerebrum; those are the hippocampus and bulbus olfactorius, which can differentiate into three main cell types, astrocytes, oligodendrocytes, and neurons. Afterwards, analogous cells were obtained from subventricular and ventricular parts of cerebrum. After the RSC investigation lasting many years the endotheliocytes, the cells of skeleton and muscles, hepatocytes, neurocytes, the cells of skin, pancreas, and others were obtained, and their differentiation potential was studied. 5. Stem Cell Appliance The ways of SC appliance in veterinary are numerous, including the fundamental biology and applied veterinary. The ESC of different animal species are irreplaceable model for investigating the mammalian embryogenesis. Since the ESC are totipotent, they can be used as the convenient in vitro model for the investigating of cytodifferentiating processes in the mammalian development. The achievements of international and Russian cell engineering have shown the appearing of possibility to obtain the large number of genetically identical domestic animals with important productive features using the method of cloning. That gives the possibility to fasten the process of genetic improvement of herds, to create the herds with less changeability of productive features. Thus, the alternative and perspective approach is the usage of mammalian SC as the inexhaustible source of totipotential nucleuses when creating new cell types in the process of cloning. Mammalian SC can be also used as vector for recombinant DNA transfer into animal organism. After entering the embryo gonads the ESC can take part in forming all the organs and tissues of chimerical organism and thus, they appear to be the convenient material for performing the genome manipulation in mammalian organism. In practical veterinary the SC can be used in substitution therapy in case of different pathologies. The methods of making 3-D cell construction have been already invented and are applied for the substitution of large bone, skin, and cartilage defects. The transplantation of bone marrow stem cells is used in the case of animal oncology diseases. The methods of cell therapy with the usage of SC are approbated in the treatment of autoimmune and endocrine diseases of domestic animals.

220

L.P. DJAKONOV

One more very important aspect of SC usage is the preservation of genetic sources of rare and disappearing animal species. Recently the world associations and organizations which deal with the preservation of disappearing animals genetic sources have turned to establishing the cryological banks of DNA, which preserve the samples of cells and tissues of animals included in the International Red Book. This project is named “Frozen Ark” in Europe. The same project is now made in Russia. Thus, the SC of these animals represent the universal genetic material of all types of multicellular life, and the nucleuses of these cells contain the whole genetic information about the life on Earth. Mammalian stem cells appear to be the new instrument for solving the problems of biotechnology; their investigation is actual and perspective for cell and genetic engineering, which are basic for mammal biology of development and agricultural biotechnology.

References Савенко Н.Б., Симонова А.С., Белоусова Р.В., и др. Межвидовая гибридная культура ПОТК-хЛК (почка овцы х лимфоциты кролика). Журнал “Ветеринарная патология” № 1(5) материалы Международной научной конференции “Современные достижения и проблемы клеточной биотехнологии и иммунологии в ветеринарной медицине”15-16 мая 2003 года, с. 64-65. Дьяконов Л.П., Майджи Е.В., Гальнбек Т.В., Сафина А.Н., Шуляк А.Ф. Культуральноморфологические свойства и чувствительность к вирусам межвидовой гибридной культуры свинья х лошадь (СПЭВ ТК- х лимфоциты лошади). Журнал “Ветеринарная патология” № 1(5) материалы Международной научной конференции “Современные достижения и проблемы клеточной биотехнологии и иммунологии в ветеринарной медицине”15-16 мая 2003 года, с. 68-70. Методические рекомендации по выявлению прионов в культурах клеток с использованием моноклональных анти-PrPC/Sc антител. Дагданова А.В., Дьяконов Л.П., Симонова А.С., Гальнбек Т.В. и др. Москва, 2002. Дагданова А.В. Биологические свойства клеточного (PrPc) и инфекционного (PrPSc) прионового протеина in vitro и его иммуноцитохимическая детекция в культурах клеток. Дисс. докт. биол. наук., М. 2002. Симонова А.С. - Получение мутантных (ПО-ТК-) и внутривидовых гибридных культур клеток овцы (ПО-ТК-×ЛО и ПО-ТК-×СО), их культурально-морфологические и кариологические свойства, чувствительность к вирусам и агенту скрепи. Диссертация канд.биол.наук., М., 2002. Дьяконов Л.П., Ситьков В.И. “Животная клетка в культуре” М., 2000, 400 с. Куликова И.Л., Гальнбек Т.В., Дьяконов Л.П., Симонова А.С. “Цитоморфологическая характеристика новых мутантных культур клеток почки овцы и внутривидовых гибридных культур с лимфоцитами и спленоцитами” доклады РАСХН, №5, 2001, 39-41 с.

ANIMAL HYBRIDS & STEM CELLS: THEIR USE IN BIOTECHNOLOGY 221 Дьяконов Л.П., Гальнбек Т.В., Щекалева И.В., Антипова Т.А., Ярных Е.В. - Внутривидовая гибридная культура клеток СПЭВ ТК- х лимфоциты свиньи. Ж.С.х. биология, 1996. №2, с. 25-30. Дьяконов Л.П., Майджи Е.В., Герасимов В.Н. , Гальнбек Т.В. и др. Штамм внутривидовых гибридных клеток Suis domestica , используемый для выделения и культивирования вируса классической чумы свиней. Патент РФ № 2082758, приоритет 14.07.1994, Зарегистрировани в Гос. Реестр изобретений 27.06.1997. Майджи Е.В., Тугизов Ш.М., Дьяконов Л.П. - Количественный хромосомный анализ сублиний гибридных клеток некоторых сельскохозяйственных животных в связи с чувствительностью к различным вирусам. Ж.С.х. биология, № 6, 1990, с.52-57. Майджи Е.В., Ш.М. Тугизов, Л.П. Дьяконов и др. - Оптимизация условий гибридизации мутантных клеток свиньи и лимфоцитов лошади. С.х. биология, 1990, №2, с. 182-187. Методические рекомендации по получению мутантных штаммов перевиваемых линий клеток с/х животных, пригодных для гибридизации. М., 1984, 16 с. (Авторы: Л.П. Дьяконов, А.А. Кущ, Ш.М. Тугизов). Методические рекомендации по гибридизации соматических клеток с/х животных. М., 1988, (Авторы: Л.П. Дьяконов, А.А. Кущ, Ш.М. Тугизов, Е.В. Майджи, О.Ш. Расулев). Рингерц Н., Р. Сэвидж. - Гибридные клетки. М., Мир, 1979, 416 с. Тугизов Ш.М. Структурно-функциональный анализ мембранных белков вирусов в генетически трансформированных клетках. Автореф. дисс. докт. биол. наук, М., 1996. G.Köhler, C.Milstein, Continuous cultures of fuseg cells secreting antibody predefined specificity. Nature, 1975, 256,55, 17, 495-497. J.W. Littlefield. Selection of hybrids from mating of fibroblasts in vitro and their presumed recombinants. - Science, 1964, Vol. 41, p. 190-196. Y. Okada, F. Murayama. Fusion of cells by HVJ: Requirement of concentration of virus particles at the site of contact of two cells for fusion. -Exp, cell res., 1968, Vol. 52. p. 34-42. Абдрахманов И.К. Стволовые клетки животных. Ж. Вет. патология, № 1(12), 2005, с. 55-58. Селюгин М.А. Получение ППЗ – подобных клеток из эмбрионов кролика на стадии гаструляции и их культурально-морфологическая характеристика. Ж. Вет. патология, № 1(5), 2003, с. 57-61. Материалы научного совещания, посвященного 125-летию со дня рождения А.А. Максимова. - С-Петербург, 1999. Репин B.C. Эмбриональная стволовая клетка: от фундаментальных исследований в клинику. // Па-тол., физиол. и эксп. тер. 2001, № 2, с. 3-8. Приданцева Т.А., Савченкова И.П., Абдрахманов И.К. Выделение и культивирование примордиальных половых зародышевых клеток свиньи. // Ветеринарная патология, № 1(5), 2003. - С. 37-39. * 4. Савченкова И.П. Эмбриональные стволовые клетки в биологии: настоящее и будущее. - Дуб-ровицы, 1999. - 95 с. Савченкова И.П. Эмбриональные стволовые клетки в биологии: настоящее и будущее. Дубровицы, 1999. - 95 с. Сухих ГТ., Малайцев В.В. Нейральная стволовая клетка: биология и перспективы нейротрансплантации. // Бюллетень экспериментальной биологии и медицины, 2001,131, № 3, с. 244-255. Шумаков В.И., Онищенко Н.А., Крашенинников М.Е., Зайденов В.А., Потапов И.В., Башкина Л.В., Берсенев А.В. Костный мозг как источник получения мезенхимальных клеток для восстановительной терапии поврежденных органов. Вестник трансплантологии и искусственных органов 2002; 4:7-11 Altman J., Das G.D. Autoradiographic and histologic evidence of postnatal neurogenesis in rats. J. Comp. Neurol., 1965, 124, p. 319-335

222

L.P. DJAKONOV

Evans, M.J. & Kaufman, M. Establishment in culture of pluripotential stem cells from mouse embryos. Nature 292,151-156 (1981). Martin G. Isolation of pluripotent cell line from earlymouse embryos cultured in medium conditioned by teratocarcinoma stem cell. - Proc. Natl. Acad. Sci. USA, 1981, V78, p.7634. Maximow A. (1909). Der Lymphozyt als gemein-same Stammzelle der verschiedenen Blutelemen-te in der embryonalen Entwicklung und im postfe-talen Leben der Saugetiere. Folia Haematologica 8:1-9. Pridantseva Т., Savchenkova I., Abdrakhmanov I. Isolation of primordial germ cells from pig fetuses // Proceedings of the VHth International Congress of Andrology «Andrology in the 21st Century». -Montreal, Quebec, Canada. - 2001. - P. 143-148. Stice, S.L., Strelchenko, N.S., Keefer, C.L., and Mathews, L. (1996). Pluripotent bovine embryonic cell lines direct embryonic development following (nuclear transfer. Biol. Reprod. 54,100-110. Thomson JA, Itskovitz-Eldor J. Shapiro S.S., Waknitz M.A., Swiergiel J.J., Marshall V.S., et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145-7. Thomson, J.A. et al. Isolation of a primate embryonic stem cell line. Proc.Natl. Acad. Sci. USA 92, 7844-7844 (1995).

CRYOPRESERVATION OF STEM CELLS

VALENTIN I. GRISCHENKO* , LUBOV A. BABIYCHIK, ALEXANDER YU. PETRENKO Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine, Kharkov, Ukraine

Keywords: HSC; cryopreservation; viability

Abstract. Institutional achievements in research of low temperature preservation of stem cells derived from fetal and adult sources are presented in the report. Special attention is attended to cryopreservation of pretenders on hemopoietic stem cells from human cord blood and fetal liver. Examining of viability of cryopreserved with DMSO fetal liver cells of specific phenotype by parallel determining with vital dye has demonstrated that CD133+ and CD34+cell candidates occurred to be more sensitive to programmed cryopreservation in comparison with more differentiated erythroid precursors (glycophorin-A – positive cells). No differences in viabilities between CD 45-, CD 133- and CD 34- positive cells after cryopreservation of primary suspension of fetal liver cells was revealed. Cryopreservation of cord blood nucleated cells with PEO-1500 allowed to obtain higher viability of hemopoietic stem CD 34+-cells in respect of CD45+-cells. Presented data demonstrated that hemopoietic cells of human fetal liver and cord blood of various phenotypes were characterized with different sensitivity to cryopreservation. Candidates to stem hemopoietic cells, obtained from two different sources: human fetal liver and cord blood, demonstrate quite a high viability after cryopreservation with various methods using cryoprotectants with different mechanisms of action.

______ * To whom correspondence should be addressed: Valentin I.Grischenko, Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine, 23 Pereyaslavskaya Str., 61015, Kharkov, Ukraine. E-mail: [email protected]

223 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 223–231. © 2008 Springer.

224

V.I. GRISCHENKO

1. Introduction Within a recent decade stem cells (SCs) have been the objects of thorough attention of researches in cell biology, experimental and clinical medicine. The interest to SCs is stipulated by the ability of these cells for unlimited selfrenewal and formation of all types of differentiated cells in an organism. The prospects and hopes for breakthrough in treating oncological, hematological, neurological and other diseases are pinned on their therapeutic application. SCs use opens huge perspectives of transplantology up to the creation of new organs. More than 20 years the object of multiple studies of the collaborators of the Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine is stem cells derived from different sources: embryos, adult organism tissues, as well as fetal tissues, characterizing by a high content of multipotent stem cells. Medical and biological investigations are performed both in the fragments of organs and tissues and in the suspensions of isolated from them cells. These developments were embodied into prepared and published manuscripts, theses, articles and patents. As a result the collaborators of the Institute have accumulated a unique experience on isolation, low-temperature storage and clinical approbation of stem cells. Mandatory condition of effective clinical use of stem cells is the establishment of low-temperature banks for the material enriched by these cells. In this connection at the Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine within many years there have been carried out R&D works on studying various aspects of cooling effect on biological objects, including stem cells. Basing on numerous developments there have been revealed the metabolism peculiarities for tissues of early development term, different degree of differentiation after hypothermic storage and cryopreservation. Recently a special attention has been paid to cryopreservation of hemopoietic nucleated cells derived from the sources which are the alternatives to bone marrow, such as cord blood and fetal liver. This paper covers our recent results devoted to cryopreservation of hemopoietic stem cells from cord blood and human fetal liver. 2. Research Methods Fetal liver was collected after surgical termination of a pregnancy for “social” reason. The tissue was obtained under full Ethical Committee approval at the Institute for Problems of Cryobiology in Kharkov, Ukraine. Fetal liver was disrupted using vibration (Kravchenko et al., 2002). The single cell suspension thus formed was centrifuged at 1000 g for 10min and the cell pellet

CRYOPRESERVATION OF STEM CELLS

225

resuspended in freezing medium. A serum-free sucrose based medium (Petrenko et al., 1992) containing 5% DMSO as a penetrating cryoprotectant was used in the study. The two-stage freezing protocol was applied: the cells were cooled down to -40ºC with a low (-1ºC/min) rate, then down to -80ºC with high (-10ºC/min) rate, after which they were plunged into liquid nitrogen. The thawing was performed on 37ºC water bath. The viability of the cell preparation was determined using trypan blue (which also provided a “total cell count”). The biophysical parameters of hematopoietic stem cell candidates derived from human fetal liver were estimation by fluorescent microscopy. For providing the immobilization of the cells in the view of microscope, a diffusion chamber was developed and constructed. The osmotic studies were performed using Jenaval fluorescent microscope (Karl Zeiss, Jena, Germany). A 50 µl aliquot of the antibody-labeled cell suspension was incubated for 30 min in 0.3 osmol/L salt solution (which was taken to be isotonic) at +37ºC on a poly-Llysine precoated glass coverslip. The coverslip was placed inside the diffusion chamber so the cells became exposed to the diffusion space. At this point, the microscope was switched to scattered light mode and the objective was focused on a CD34+CD38- cell, as distinguished by specific FITC+PE- fluorescence; after which the experimental solution was introduced to the diffusion space. The microscope was switched to transferred light mode and the volume changes in the CD34+CD38- cell were registered by camcorder connected to a computer. The temperature of the apparatus was varied by cooling the microscope table with liquid nitrogen, which was controlled with the thermocouple. The 2D cell projections were analyzed using Qproduct-3.0 (Leica) and cell volume was calculated assuming spherical symmetry. In this way, the dependences cell volume (osmolarity of the medium) and cell volume (time of the exposure) were obtained. Colony forming ability of the fetal liver cells was determined in the medium comprised: 1.3% methylcellulose, 4.0 mM glutamine, 10 U/ml penicillin/streptomycin, 100 U/ml GM-CSF, 100 U/ml IL-3, 50 ng/ml stem cell factor and 10 U/ml erythropoietin in IMDM. An aliquot of 105 cells was transferred to a 35 mm sterile plastic Petri dish and incubated at 37ºC in a fully humidified atmosphere of 5% CO2 in air. The final colony count was performed on day 14 of culture, the colony types being defined by general morphological criteria. In the work we used human cord blood obtained from vein of pulsing umbilical cord, procured with traditional glucose-citrate solution. Cord blood was frozen on the day of blood procurement or after its storage at constant temperature (+4 ÷ +2ºC) for 48 hrs. Cord blood volume less than 60 ml was not used in the work.

226

V.I. GRISCHENKO

Isolation of nucleated stem cells from cord blood was performed using original two-step centrifugation of the whole blood at 200 g for 20 min with following fractionation and separation of nucleated stem cells layer. In some experiments nucleated stem cells were isolated by standard ficoll method (Denning-Kendall et al., 1996). As cryoprotectant there was used PEO-1500 prepared with physiological solution. Addition of cryoprotectant to cell suspension was performed on the “cold” treatment method. Samples treated at room temperature served as the control for comparison. Freezing was conducted down to -196ºC according to own specially designed two-step program. Thawing was performed at 42-44ºC on water thermostated bath at constant shaking. Content of CD34-, CD45-, CB133-, Gly-A-positive cells in primary suspendsion of human fetal liver and nucleated fraction of cord blood before and after cryopreservation was examined by flow cytofluorimeter with flow cytometer FACS Calibur (Becton Dickinson, USA) using Becton Dickinson reagents according to international ISHAGE protocol. Cell viability of mentioned of phenotype was found after additional staining with 7AAD. The data obtained was analyzed using SPSS-9.0 software. Any differences with a significance level p<0.05 were considered valid. To assess the validity of the differences and correlation, non-parametric tests were used as indicated (vide infra). The data are displayed as mean ± SE. 3. Results and Discussion Low temperature preservation is multi-stage and multi-factor process within which biological objects are affected by different physical and chemical factors stipulated by the changes of temperature, composition and state of system components. Leading tendency in cryobiology by now is dismissal from empirical principles, deep studying of the mechanisms of cryodamage as well as basing on this the development of necessary and essential conditions of efficient low temperature preservation of biological objects. TABLE 1. Biophysical characteristics of human fetal liver CD34+CD38- cells. Legends: Vo – cell volume in isoosmotic solutions, Vb – osmotically inactive volume, Lp – permeability coefficient of membranes for water, p – permeability coefficient of membranes for DMSO cryoprotectant, σ – reflection coefficient. Characteristic

Value

Samples (n)

V0 (µm3)

398,66±25,64

10

Vb/V0

0,48

10

Lp (µm min –1atm –1)

0,27±0,03

25

CRYOPRESERVATION OF STEM CELLS

PMe2SO cm min–1

2,09±0,85×10–4

25

σMe2SO

0,63±0,03

25

227

Table 1 shows main cryobiological characteristics (permeability coefficients for water and DMSO cryoprotectant) of hemopoietic stem cells (HSCs) of human fetal liver of CD34+, CD38- phenotype. Examining of these characteristics enabled the revealing of the fact that HSCs were characterized with higher values of osmotically inactive volume in comparison with differentiated cells. As a result they are more sensitive to post-hypertonic and hypotonic stress during cryopreservation. Introduction of certain corrections to the cryopreservation program was helpful in enhancing the viability of these stem cells. In general, human fetal liver of the 1st gestation trimester is of big interest for cryobiological studies. Firstly, primary fetal liver cell suspension presents heterogenic population of cells of three lines (hemopoietic, hepatic, mesenchymal) of different commitment degree. Thus, cryosensitivity of several cell types may be studied in one object. Secondly, the percentage of SCs and cell-precursors in fetal liver is much higher than in other sources. These cell types could be supposed as having various cryosensitivities, thirdly, all types of stem cells of fetal liver and cells-precursors possess high proliferative and differentiating potentials and may be successfully used to treat various diseases. We have shown that the major part of cells of fetal liver is hemopoetic cells of different maturation degree. Content of hemopoietic cells of various immune phenotypes in suspension of fetal liver cells was found with the method of flow cytometry. There was examined the content of the cells expressing CD34 (total marker of hemopoietic cells-precursors), CD133 (AC133, marker, more accurate in revealing hemopoietic stem cells), CD45 (expressed in lymphoid committed cells-precursors), Gly-A (glycophorin-A, marker of cells of erythroid row of various maturation degrees). Phenotypic and morphologic analysis of fetal liver cells has shown that main population is represented by cells-precursors of erythroid row of various degrees of commitment (glycophorin-A –positive cells). Cells of erythroid lineage make up to 90% of total number of hemopoietic cells. Content of CD34+ cells in total cell suspension of fetal liver made 1-2%, CD45+cells 2-4%, CD133+cells 0.4-0.7%. Examining of viability of cryopreserved cells of specific phenotype by parallel determining with vital dye and analysis with flow cytometer has demonstrated that CD133+ and CD34+cell candidates occurred to be more sensitive to programmed cryopreservation in comparison with more differentiated erythroid precursors (glycohporin-A –positive cells). Gly-A+ cells viability made 93.75±1.60%. CD 34+ cell viability was 79.57±4.13%,

228

V.I. GRISCHENKO

77.16±4.81% for CD 133+, and 84.93±4.93% for CD 45+. No significant difference in viabilities between CD 45-, CD 133- and CD 34 - positive cells was revealed. This may be related to a high co-expression of these antigens on a surface of the same cells. For examples, if in one series of experiments the content of CD 34+ cells made 0.89±0.09% and content of CD 45+cells – 2.33±0.25%, than the percent of CD 34-positive cells, co-expressing CD 45 (CD 34+ CD 45+cells) made 0.82±0.09%. Studying of functional properties of hemopoietic stem cells of human fetal liver after cryopreservation using their colony-forming activity in semi-solid media has shown that they are capable of forming all 6 types of hemopoietic colonies, including miscellaneous the earliest ones CFU-GEMM and granulocyte-macrophage colonies – CFU-GM. Thus, presented data demonstrated that hemopoietic cells of human fetal liver of various phenotypes were characterized with different sensitivity to cryopreservation. Along with this all of them were resistant and kept their functions after returning to physiological condition. Recently cord blood, comprising quite bigger part of non-committed hemopoietic cells than adult bone marrow is becoming the source of hemopoietic stem cells-precursors (CD 34+). Moreover hemopoietic stem cells-precursors derived from cord blood have higher potential of proliferation and expansion than their analogues from adult bone marrow. Extended cord blood use as a source of hemopoietic cells resulted in the necessity to establish cord blood banks where the samples could be stored in a frozen state at -196ºC for a long time with no loss of their biological properties. However taking into account the volume of cord-blood (in average, not more than 100 ml) of great importance are both procurement of maximum blood amount and especially a complete isolation of nucleated cells (NCs) (including hemopoietic) during separation with preserving the cell quality. All this stipulates the necessity to develop efficient methods of procurement, cryopreservation and storage of cord blood cells. Now in world practice the most wide-spread is the method of NCs isolation in ficoll density gradient (Rubinstein, et al., 1994). Separation in density gradient enables to obtain predominantly mononuclear cells, but leads to considerable losses of hemopoietic precursors (from 30 to 50%) (Broxmeyer, et al., 1989). To isolate NCs from cord blood we have developed the method of two-step centrifugation with following fractionation under sterile conditions and separation into erythrocytes and NCs concentrate in autoplasma, which afterwards were treated with cryoprotectant and following freezing.

CRYOPRESERVATION OF STEM CELLS

229

Developed method of two-step centrifugation of cells enables the isolating up to 95% of CD 45+ - cells and up to 97% of CD 34+-cells from cord blood (Fig. 1). It is worth of noting that ficoll causes the losses in the number of isolated cells (up to 55%). Therefore ficoll use to isolate cells is not absolutely positive.

Figure 1. Viability of nucleated (CD 45+) and stem hemopoietic (CD 34+) cells at isolation of various methods.

Thus application of original method of two-step centrifugation for obtaining cord blood components allow the preserving of quantitative and qualitative cell composition practically in a complete state, and, in particular stem (CD 34+) cells. These data are of importance for following cryopreservation stages, since it is known that cell state at the stage prior to cryopreservation mainly predetermines the results of freezing - thawing. Therefore a significant cell destabilization at isolation with ficoll will lead to the fact that already damaged cells will be undergone cryopreservation that may result in a decrease in their resistance at the stages of cryoprotectant adding and freeze-thawing. Nowadays the most widely-spread method to cryopreserve nucleated cells of cord blood is the method using DMSO cryoprotectant. However, application of DMSO, penetrating well into cells, stipulates the necessity of its removal after thawing. This significantly complicates the procedure of obtaining qualitative frozen-thawed cells and leads to the loss of some cells during washing-out. According to the data of different authors the preservation of hemopoietic stem cells during cryopreservation with DMSO and washing-out makes from 60 to 80% (Abrahamsen et al., 2002).

230

V.I. GRISCHENKO

Therefore now the most perspective for cryopreservation of cord blood NCs is the designing of freeze-thawing methods with no washing-out using cryoprotectants, non-penetrating into a cell. As a result of performed by us fundamental studies there was developed a new cryopreservation method with no washing-out for cord blood NCs, it is based on use of non-penetrating PEO-1500 cryoprotectant in combination with “cold” treatment of cells before freezing and special own two-step freezing program.

Figure 2. Viability of NCs (CD 45+) and hemopoietic stem (CD 34+) cells after cryopreservation. Legends: 1-concentrate, control; 2-concentrate, cryopreserved according to own special two-stem program with “cold” pre-treatment; 3-concentrate, cryopreserved according to own special twostep program after treatment at room temperature; 4-concentrate, frozen with a rapid plunging into liquid nitrogen after “cold” pre-treatment with PEO-1500; 5-concentrate, frozen by rapid plunging into liquid nitrogen after treatment with PEO-1500 at room temperature.

Developed method with no washing-out allows the preserving after thawing (Fig. 2) more than 75% of CD 45+ - cells and up to 85% CD 34+-cells. It should be emphasized that number of CD 34+ - cells is significantly higher of their absolute content in cell concentrate, obtained using ficoll and frozen with PEO-1500 under analogous condition, that also testifies to a considerably higher quality of NCs concentrate our method. One more positive consequence of cryopreservation method use with PEO1500 is noted by us higher survival after cryopreservation of hemopoietic stem CD 34+ - cells in respect of NCs CD 45+ - cells, that enable speaking about higher cryoresistance of the population of hemopoietic stem cells under these conditions. Thus, the results of present research testify to the fact that candidates to stem hemopoietic cells, obtained from two different sources: human fetal liver and cord blood, demonstrate quite a high viability after cryopreservation with various methods using cryoprotectants of different effect mechanisms. Revealed differences in cryosensitivity of CD 34+ cells in respect of CD 45+ cells may be explained by various ratios of cells, expressing these antigens. So, in fetal liver among nucleated CD 45+ - cells about 35% express CD 34+

CRYOPRESERVATION OF STEM CELLS

231

antigen. High degree of co-expression of these antigens does not allow the revealing of statistical and significant differences between viability of the cells carrying them. At the same time in cord blood 99% of CD 45+ cells do not express CD 34+ and thereby the difference in their cryosensitivity is more significant. Taking into account the peculiarities of each biological object at the Institute there have been developed technological processes of cryopreservation and long-term storage of wide spectrum of human cells and tissues of embryo fetoplacental origin. By now there has been established low-temperature bank where the samples with high indices of survival, tested to the absence of bacterial and viral contamination are under storage. This bank has the “National property” status.

References Abrahamsen, J.F., Bakken, A.M. and Bruserud Q. (2002) Cryopreserving human peripheral blood progenitor cells with 5-percent rather than 10-percent DMSO results in less apoptosis and necrosis in CD34+ cells, Transfusion 42:1573-1580. Broxmeyer, H.E., Gordon, G.W., Hangoc, G. et al. (1989) Human umbilical cord blood as a potential source of transplantable hematopoietic stem/ progenitor cells, Proc. Natl. Acad. Sci. US 86:3828-3832. Denning-Kendall, P., Donaldson, C., Nicol, A. et al. (1996) Optimal processing of human umbilical cord blood for clinical banking, Exp. Hematol.24:1394-1401. Kravchenko, L.P., Petrenko, A.Yu., Somov, A.Yu. and Fuller, B.J. (2002) A simple nonenzymatic method for the isolation of high yield of functional rat hepatocytes, Cell Biology International. 26:1003-1006. Petrenko, A.Yu., Grischuk, V.P., Roslyakov A.D. et al. (1992) Survival, metabolic activity and transport of potassium ions of rat hepatocytes after rapid freeze-thawing under protection of dimethylsulfoxide and separation in Percoll density gradient, Cryo-Letters. 13:87-98. Rubinstein, P., Taylor, P.E., Scaradavou, A. et al. (1994) Unrelated placental blood for bone marrow reconstitution: Organization of the placental blood program, Blood Cells 20:587-600.

THE M813 RETROVIRUS BELONGS TO A UNIQUE INTERFERENCE GROUP AND IS HIGHLY FUSOGENIC VLADIMIR PRASSOLOV1*, SIBYLL HEIN2, DMITRY IVANOV1, JÜRGEN LÖHLER2, PAVEL SPIRIN1, CAROL STOCKING2 1 Engelhardt Institute of Molecular Biology, Russian Academy of Science, Moscow, Russia 2 Heinrich-Pette-Institute of Experimental Virology and Immunology, Hamburg, Germany

Keywords: retroviruses, virus-cell interaction, cellular receptor, myo-inositol transporter, Mus cervicolor

Abstract. Retroviral vectors are powerful tools for genetic analysis of stem cells and their progenitors. They have been used both as gene vectors, to both up or down regulate gene expression – as well as mutagens, to identify genes modulating a specific phenotype. Furthermore, their importance in the clinic is currently being tested in several on-going gene therapy trials. Understanding the basic biology of retrovirus is tantamount to developing efficacious tools for the laboratory and the clinic. Here we summarize the characterization of a novel γ-retrovirus isolate from feral mice. The M813 isolate was shown to have a unique host range and belong to a novel interference group. Our analysis also revealed the highly fusogenic potential of this virus. Finally, we were able to identify the sodium myo-inositol transporter as its receptor. The unique characteristics of this viral isolate open several venues for the development of novel research tools.

______ * To whom correspondence should be addressed. Vladimir Prassolov, Engelhardt Institute of Molecular Biology, Russian Academy of Science, 119991 Moscow, Russia ([email protected])

233 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 233–244. © 2008 Springer.

234

V. PRASSOLOV ET AL.

1. Introduction Viral subgroups of the murine C-type viruses have been defined on the basis of host range, generally corresponding to distinct interference groups defined by receptor usage. Five distinct interference groups have been established for the well-studied isolates of Mus musculus, and the cellular receptors for these viruses have all been identified. Three families of receptors have been characterized for these viruses, all of which share multiple transmembrane-spanning topology and are implicated in transporter activity: (1) cationic amino acid transport for the cationic amino acid transporter CAT family (Kim et al., 1991; Wang et al., 1991), (2) inorganic phosphate transport for the Pit family (Kavanaugh et al., 1994), and (3) a presumed phosphate transport activity for the newly identified Sgy1 family (Tailor et al., 1999). Whereas some viruses, such as 10A1 murine leukemia virus (10A1 MuLV), recognize several members of the same transporter family (e.g. Pit1 and Pit2) as well as homologous receptors of different species (e.g. mouse, rat and human) (Miller and Miller, 1994), other viruses recognize only one or at most two members of a receptor family and are unable to recognize homologous receptors of other species (e.g., ecotropic MuLV recognizes only the rodent Cat1 and, with less affinity, the Cat3 receptor, but not the Cat2 receptor or Cat homologues of other species) (Kavanaugh et al., 1994; Masuda et al., 1999). In addition to being isolated from Mus musculus, type C retroviruses have also been isolated from Mus caroli (Lieber et al., 1975), Mus cervicolor (Benveniste et al., 1977) and Mus dunni (Bonham et al., 1997). With the exception of the latter, the interference groups of these viruses have not been well defined. Earlier studies showed that two classes of type C retroviruses could be isolated from Mus cervicolor. Type I has a classical xenotropic host range and, based on immunological and nucleic acid hybridization criteria, is closely related to the virus isolated from Mus caroli and antigenically related to type C viruses from woolly monkeys (SSV/SSAV) and gibbon apes (gibbon ape leukemia virus GALV) (Benveniste et al., 1977). The type II virus appears to be closely related to MuLV isolated from Mus musculus. However, despite a similar host range to the ecotropic MuLVs, genomic mapping studies showed that CII isolates use a distinct cellular receptor. We summarize here the characterization of the CII isolate, termed M813, from Mus cervicolor cells and the identification of its cellular receptor.

M813: A UNIQUE RETROVIRAL ISOLATE

235

2. Results and Discussion 2.1. THE HOST RANGE OF M813 MULV IS LIMITED TO MOUSE AND SHOWS NO INTERFERENCE WITH OTHER MULVS

Using a reverse transcriptase assay, it has been previously shown that type CII viruses from M cervicolor infect cells derived from M. musculus (e.g., SC1 and NIH 3T3 cells) but not cells derived from M. cervicolor or from other diverse species, including rat and human (Benveniste et al., 1977). To verify that the clone M813 belongs to this same virus type, we used a marker rescue assay to determine the virus titers on mouse, rat, hamster, rabbit, dog, monkey and human cells. For these studies, MPEVneo retroviral vectors pseudotyped with either M813 or as controls, Mo-MuLV or Mo-10A1V were used for infections of target cells. M813 was able to efficiently infect cells only of mouse origin. This is in contrast to Mo10A1V and Mo-MuLV, which could infect both mouse and rat cells and, in the case of Mo-10A1V, all used cells (data not shown). A few G418-resistant clones were observed after M813-pseudotype infections of rat cells, but this was at a frequency 4 orders of magnitude lower than that obtained with M813-infected murine cells or when either Mo-10A1V or Mo-MuLV was used to infect the same cultures This assay confirmed that M813 has the same host range as the previously described CII MuLVs. Furthermore, this host range is distinct from that of the other MuLVs isolated from M. musculus or M. dunni, all of which can infect rat and, with the exception of the ecotropic MuLVs, most human cells (Loiler et al., 1997; Miller and Chen, 1996; Sorge et al., 1984). Despite its different host range, it remains possible that M813 uses the same receptor for cell entry as other MuLVs. To test this, we performed interference assays using a neoR rescue assay. In the first set of experiment, M813 pseudotype titers was determined on SC-1 cells that either were uninfected or expressed virus of one of the four known interference group, i.e., Mo-MuLV (ecotropic); MoAmphoV (amhpotropic); 10A1 (10A1), and Mo-MCFV (polytropic). Xenotropic MuLV was not tested, as this virus do not infect all Mus musculus cells and use the same receptor as polytropic virus. As a control for infectivity of the cell lines, 10A1 pseudotype were carried out in parallel. As shown in Table 1, expression of M813 in SC1 cells inhibit infection of M813 by more than 4 orders in magnitude, but not or only slight interference (at most 4-fold) was observed in SC1 cells expressing any one of the other MuLVs.

V. PRASSOLOV ET AL.

236

TABLE 1. M813 infection is not blocked by MuLVs of the different interference groupsa Target cells

Titer (GTU/ml)b of MPEVneo pseudotyped with: M813

SC-1 SC-1 + M813 SC-1 + MoMuLV SC-1 + MoAmphoV SC-1 + Mo10A1V SC-1 + MoMCFV a

10A1 4

7.6 × 104 7.4 × 104 7.6 × 104 8.8 × 104 2 2.0 × 105

3.4 × 10 1.5 3.5 × 104 5.7 × 104 8.8 × 103 4.3 × 104

reprinted from (Prassolov et al., 2001a) with permission

b

average of two or more independent experiments

In the reciprocal experiment, where the infection frequency of all four MuLVs were compared between uninfected and M813-infected SC1 cells, no interference in infection frequency was observed, with the exception of the Mo-MuLV infection, where a reproducible 50-fold decrease was seen with M813-infected cells (Table 2). TABLE 2. M813 expression slightly interferences with ecotropic MuLV infection but not with other MuLVsa Pseudotypes of MPEVneo

Titer on target cclls (GTU/ml) a SC-1

M813 Mo-MuLV Mo-AmphoV 10°1 Mo-MCF

SC-1 M813 4

5.4 × 10 1.8 × 105 1.2 × 105 7.8 × 104 2.6 × 103

a

reprinted from (Prassolov et al., 2001a) with permission.

b

average of two or more independent experiments

0 5.1 × 103 1.2 × 105 8.2 × 104 3.0 × 103

Taken together, the data yield two conclusions. First of all, as the infection efficiency of M813 was not compromised on cells expressing any of the four MuLVs assayed, it must use a unique receptor for cell entry. However, as ecotropic MuLV infection is slightly inhibited in cells expressing M813, we cannot

M813: A UNIQUE RETROVIRAL ISOLATE

237

completely rule out the possibility that M813 can also use the mCAT1 protein as a receptor, albeit with a lower transfer frequency. 2.2. M813 MULV INDUCES SYNCITIUM FORMATION

In an experiment initially designed to generate M813(Ampho)-MuLV pseudotypes to infect human cells, PA317 amphotropic packaging cell lines were inoculated with supernatant from murine SC1 cells expressing M813. Within 1 h after exposure to retrovirus, clear signs of syncytium formation between PA317 cells were observed in the cultures. After 4 h, almost all cells in the culture were fused (Figures 2A and 2B), resulting in the death of the culture within 24 h. Although the addition of polybrene to the culture accelerated the fusion process, it was neither necessary nor singly able to induce fusion of PA317 cells (data not shown).

Figure 1. M813 infection induces fusogenicity in vitro (A) PA317 cells incubated with M813 for 4 h. (B) Uninfected PA317 cells. Giemsa staining. Magnification 150´. Reprinted from (Prassolov et al., 2001b) with permission from Elsevier.

To obtain a closer view of the cell fusion process, electron microscopic methods were employed. Cell culture monolayers were incubated in the cold with cell culture supernatants rich in M813 virus particles. Replicas prepared immediately after exposure of PA317 cells to virus-bearing supernatant demonstrated numerous cells with irregular contours and complex surface structures. The average length of the elongated cells that exhibited slightly folded cell membranes bearing numerous microvilli was circa 30 mm (Figure 2a). Adhering virus particles could be detected primarily at the glass surface, but were also seen attached to the microvilli (Figure 2a). After incubation of the virus-exposed cell cultures for more than 60 min at 37°C, a striking alteration of the cell morphology occurred: the cells became flattened and their processes gradually disappeared. Two hours after the temperature shift, only a few prominent short membrane ruffles and very few

238

V. PRASSOLOV ET AL.

microvilli were present (Figure 2b). Moreover, delimitation between individual cells at contact points became obscured due to partial membrane fusions, with the consequence that cell borders were more and more difficult to distinguish (Figures 2c and 2d). These kinetics indicate that fusion occurs from “with-out,” i.e., when a single virion simultaneously fuses with two cells, in contrast to the fusion observed when XC sarcoma cells are infected with Moloney MuLV (Mo-MuLV) (Klement et al., 1969), which occurs from “within”, i.e., when an infected cell expressing Env on its cell surface fuses with an adjacent cell (White et al., 1983).

Figure 2. Ultrastructural aspects of M813 virus-induced cell fusion as shown by replica preparation technique. (a) Cell surface replica of a PA317 fibroblast after incubation for 30 min at 4°C with medium containing M813 virus. Numerous microvilli extend from the slightly folded cell surface. The

M813: A UNIQUE RETROVIRAL ISOLATE

239

2.3. M813 SUSCEPTIBILITY IS A PREREQUISITE FOR FUSION INDUCTION

Human cells are not permissive for M813 infection, presumably because they lack the M813 receptor for cell entry. It would be expected that M813-induced fusion is mediated through interaction with its cell receptor. To test this, human cells were incubated with M813. To increase the likelihood that fusion would be observed, retroviral-packaging cell lines of human origin expressing Mo-MuLV Pol and Gag proteins, as well as the Env proteins of Mo-MuLV (TE-FLY-Mo), amphotropic 4070-MuLV (293-Phoenix-Ampho), or the gibbon ape leukemia virus (TE-FLYGALV), were tested. As shown in Table 3, M813 did not induce fusion of any of these cells. TABLE 3. In contrast to mouse cells, human cells expressing MuLVs do not form syncytia after M813 infection Target cells

TE671 TE-FLY-GALV TE-FLY-MO 293 293-Phoenix-Ampho PA317

Fusion Index (%)a uninfected

M813-inf

1.6 7.8 8.4 <10 <10 <5

4.2 6.5 6.8 <10 <10 78

a

Cultures were assessed for syncytium formation and the fusion index (FI) was determined using the formula (N – S)/T, where N is the number of nuclei in a syncytium, S is the number of syncytia, and T is the total number of nuclei. Over 500 nuclei were counted in each experiment to obtain the Fl value.

2.4. MAPPING AND IDENTIFICATION OF THE RECEPTOR GENE

The recent success of cloning the receptor for the mouse mammary tumor virus by screening a radiation hybrid (RH) panel (Ross et al., 2002), prompted us to use this approach to define the chromosomal localization of the M813 receptor. M813

arrow points to virus particles attached to microvilli. (b) Further incubation for 120 min of PA317 cell cultures at 37°C results in a flattened cell body and considerable reduction of microvilli. Note the prominent membrane ruffles. (c) This electron micrograph shows partially fused plasma membranes of two adjacent cells (extending from the arrow to the upper margin of the picture). (d) Higher magnification of the cell membrane fusion process indicated by the arrow in C. Magnification bar represents 1.0 mm. Reprinted from (Prassolov et al., 2001b) with permission Elsevier.

240

V. PRASSOLOV ET AL.

pseudotypes carrying the SFα11-eGFP vector were used to infect the RH panel cell lines. Positively infected clones were identified by detection of eGFP expression. The resulting analysis placed the receptor near expressed sequenced tag AA51763 (LOD score, 15.2) on the distal end of chromosome l6. A search of the Celera Mouse Genome Databank in the region flanking expressed sequence tag AA51763 revealed several potential candidate genes. Of these, the slc5a3 gene, located approximately 200 kb proximal to the identified marker, appeared to be the most promising. slc5a3 encodes mSMIT1, which belongs to the family of Na+/solute symporters (SSS family) and is a multiple membrane spanning protein (Jung, 2001). To determine if mSMIT mediates cell entry of M813, the slc5a3 cDNA expressed in a retroviral vector in human TE671 cells, which are resistant to infection with M813. Cells were infected with the SFαll-eGFP vector pseudotyped with M813, 10A1, or Mo-MuLV. As a further control, murine SC1 fibroblasts were also infected with the same pseudotypes. Significantly, M813 virus titers on TE671mSMIT1 cells were equivalent to or slightly higher than those calculated on murine SC1 fibroblasts (1.5×104 versus 3.2×104 FTU/ml, respectively). In contrast, mSMIT expression in TE671 did not mediate infectivity of the human TE671 cells by MoMuLV, although virus titers of 6.0×104 FTU/ml were observed on control SC1 cells. All cells were susceptible to infections with 10A1 pseudotypes with comparable efficiencies. These results clearly demonstrated that the mSMIT1 protein can mediate susceptibility to infection by M813. The identification of mSMITl as a receptor for MS13 MuLV adds another solute transporter to the growing list of retroviral receptors. Indeed, most if not all of the receptors characterized to date for γ-retroviruses (i.e., type C mammalian retroviruses) and the type D β-retroviruses (e.g., simian retroviruses) are multispanning transmembrane proteins that function as transporters for various small molecules, including amino acids and inorganic phosphate. All utilize a carrier-mediated (versus channel-mediated) process and generally couple transport with a secondary energy source (i.e., an ion electrochemical gradient) by co- or countertransporting Na and/or H (Reizer et al., 1994; Saier Jr., 2000). They range in size from 400 to 800 amino acid residues and contain from 6 to 14 transmembrane α-helical segments. This is in contrast to the receptors characterized for the alpharetroviruses (e.g., avian leukosis viruses), the B-type β-retroviruses (e.g., mouse mammary tumor virus), δ-retroviruses (e.g., bovine leukemia virus), and lentiviruses (e.g., human immunodeficiency virus), which are single transmembrane-spanning proteins (Overbaugh et al., 2001), or the Jaagsiekte sheep beta-retrovirus receptor, which is linked to the membrane by a glycosylphosphatidylinositol anchor (Rai et al., 2001). The fact that members of the

M813: A UNIQUE RETROVIRAL ISOLATE

241

same genera of retroviruses use cell molecules with similar structures and functions probably reflects constraints dictated by their related envelope proteins in recognizing and binding a membrane protein that triggers conformational changes necessary for fusion and cellular uptake. 2.5. M813 INFECTION OF HUMAN TE671 CELLS EXPRESSING MSMIT1 INDUCES MASSIVE SYNCYTIUM INDUCTION

In vitro, syncytium formation rapidly occurs after exposure to M813 but requires both the presence of a functional receptor and that the cells be preinfected with another MuLV. To test the role of mSMIT in fusion formation, human TE671 cells expressing mSMIT or the control vector were tested for fusogenicity directly after exposure to M813. As reported earlier, no syncytium formation was observed when TE671-neo cells were exposed to M813, regardless of whether they were previously infected with 10A1 MuLV or not (Figure 3A). In striking contrast, giant syncytia were observed in TE671-SMIT cells within 3 h after exposure to M813 (Figure 3B). M813-induced syncytium formation did not require preinfection with MuLV. Indeed, no significant increase in the levels of syncytium formation was observed in TE671-SMIT1 cells expressing 10A1 MuLV. Thus, we hypothesize that high expression levels of mSMIT in TE671-SMIT cells negate the requirement for other Env-receptor interactions that may facilitate fusion. Further studies are necessary to determine what levels of mSMIT are required for infection and fusion induction. Previous work has shown that high expression levels of the mCat1 or PiT2 receptors also induce syncytium formation in cells productively infected with ecotropic or amphotropic MuLVs, respectively (Siess et al., 1996)

Figure 3. Expression of mSMIT1 in human TE671cells imparts susceptibility to M813-unduced syncytium formation. Control TE671-neo cells (A) of TE671-mSMIT1 cells (B) were incubated with M814 for 4h and Giemsa stained. Magnification, 152´. Reprinted from (Hein et al., 2003) with permission.

242

V. PRASSOLOV ET AL.

It is important to note that the fusion observed with M813 occurs from without, i.e., when a virion simultaneously fuses with two cells, in contrast to that which has been observed when an MuLV receptor is overexpressed, which occurs from within, i.e., when an infected cell expressing Env on its surface fuses with an adjacent cell. This underlines the high fusogenic capacity of the M813 virus. Interestingly, recent work has shown that the HERV-W also induces syncytium formation upon interaction with its receptor (ASCT2 or ASCT1) (Blond et al., 2000; Lavillette et al., 2002). Indeed, it has been speculated that these endogenous retroviruses, specifically expressed in placenta cells, have evolved to facilitate syncytiotrofoblast differentiation by fusing the underlying cytotrofoblast cell layer (Lavillette et al., 2002; Mi et al., 2000). Identifying mSMIT1 as receptor for M813 will enable further studies to determine the critical Env-receptor interaction that regulate fusion. Acknowledgments

We are indebted to Wolfram Ostertag for stimulating discussion, to Gabriel Rutter, Yuanming Zhang and Susan R. Ross for fruitful collaboration. This work was supported by grants from Russian Foundation of Basic Researches (RFBR 02-0449103 to V.P. and D.I. and RFBR 05-04-49366 to V.P., D.I, and S.P.) and the Deutsche Forschungsgemeinschaft (Sto 224) (to C.S.)

References Benveniste, R., Callahan, R., Sherr, C., Chapman, V. and Todaro, G. (1977) Two distinct endogenous type C viruses isolated from the Asian rodent Mus cervicolor: Conservation of viral gene sequences in related rodent species. J Virol 21, 849-862. Blond, J.-L., Lavillette, D., Cheynet, V., Bouton, O., Oriol, G., Chapel-Fernandes, S., Mandrand, B., Mallet, F. and Cosset, F.-L. (2000) An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expresing the type-D mammalian retrovirus receptor. J Virol 74, 3321-3329. Bonham, L., Wolgamot, G. and Miller, A. (1997) Molecular cloning of Mus dunni endogenous virus: an unusual retrovirus in a new murine viral interference group with a wide host range. J Virol 71, 4663-4670.

M813: A UNIQUE RETROVIRAL ISOLATE

243

Hein, S., Prassolov, V., Zhang, Y., Ivanov, D., Lohler, J., Ross, S.R. and Stocking, C. (2003) Sodiumdependent myo-inositol transporter 1 is a cellular receptor for Mus cervicolor M813 murine leukemia virus. J Virol 77, 5926-5932. Jung, H. (2001) Towards the molecular mechanism of Na+/solute symport in prokaryotes. Biochim Biophys Acta 1505, 131-143. Kavanaugh, M., Wang, H., Zhang, Z., Thang, W., Wu, Y.-N., Dechant, E., North, R. and Kabat, D. (1994) Control of cationic amino acid transport and retroviral receptor functions in a membrane protein family. J. Biol. Chem. 269, 15445-15450. Kim, J., Closs, E., Albritton, L. and Cunningham, J. (1991) Transport of cationic amino acids by the mouse ecotropic retrovirus receptor. Nature 352, 725-728. Klement, V., Rowe, W., Hartley, J. and Pugh, W. (1969) Mixed culture cytopathogenicity: A new test for growth of murine leukemia viruses in tissue culture. Proc. Natl. Acad. Sci, USA 63, 753-758. Lavillette, D., Marin, M., Ruggierei, A., Mallet, F., Cosset, F.-L. and Kabat, D. (2002) The envelope glycoprotein of human endogenous retrovirus type W uses a divergent family of amino acid transporters / cell surface receptors. J Virol 76, 6442-6452. Lieber, M., Sherr, C., Todaro, G., Benveniste, R., Callahan, R. and Coon, H. (1975) Isolation from the Asian mouse Mus caroli of endogenous type C virus related to infectious primate type C viruses. Proc. Natl. Acad. Sci, USA 72, 2315-2319. Loiler, S., DiFronzo, N. and Holland, C. (1997) Gene transfer to human cells using retrovirus vectors produced by a new polytropic packaging cell line. J Virol 71, 4825-4828. Masuda, M., Kakushima, N., Wilt, S., Ruscetti, S., Hoffman, P., Iwamoto, A. and Masuda, M. (1999) Analysis of receptor usage by ecotropic murine retroviruses, using green fluorescent proteintagged cationic amino acid transporters. J Virol 73, 8623-8629. Mi, S., Lee, X., Li, X., Veldman, G., Finnerty, H., Racie, L., LaVallie, E., Tang, X., Eduard, P., Howes, S., Keith Jr., J. and McCoy, M. (2000) Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 403, 785-789. Miller, A. and Chen, F. (1996) Retrovirus packaging cells based on 10A1 murine leukemia virus for production of vectors that use multiple receptors for cell entry. J Virol 70, 5564-5571. Miller, D. and Miller, A. (1994) A family of retroviruses that utilize related phosphate transporters for cell entry. J Virol 68, 8270-8276. Overbaugh, J., Miller, A. and Eiden, M. (2001) Receptors and entry cofactors for retroviruses include single and multiple transmembrane-spanning proteins as well as newly described glycophosphatidylinositol-anchored and secreted proteins. Microbio. Mol. Biol. Reviews 65, 371389. Prassolov, V., Hein, S., Ziegler, M., Ivanov, D., Münk, C., Löhler, J. and Stocking, C. (2001a) The Mus cervicolor murine leukemia virus (MuLV) isolate M813 belongs to a unique receptor interference group. J Virol 75, 4490-4498. Prassolov, V., Ivanov, D., Hein, S., Rutter, G., Münk, C., Löhler, J. and Stocking, C. (2001b) The Mus cervicolor MuLV isolate M813 is highly fusogenic and induces a T-cell lymphoma associated with large multinucleated cells. Virology 290, 39-49. Rai, S., Duh, F., Vigdorovich, V., Danilkovitch-Miagkova, A., Lerman, M. and Miller, A. (2001) Candidate tumor suppressor HYAL2 is a glycosylphospha-tidylinositol (GPI)- anchored cellsurface receptor for jaagsietke sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc. Natl. Acad. Sci, USA 98, 4443-4448.

244

V. PRASSOLOV ET AL.

Reizer, J., Reizer, A. and Saier Jr., M. (1994) A functional superfamily of sodium / solute symporters. Biochim Biophys Acta 1197, 133-166. Ross, S., Schofield, J., Farr, C. and Bucan, M. (2002) Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc. Natl. Acad. Sci, USA 99, 12386-12390. Saier Jr., M. (2000) A functional-phylogenetic classification system for transmembrane solute transporters. Microbio. Mol. Biol. Reviews 64, 354-411. Siess, D., Kozak, S. and Kabat, D. (1996) Exceptional fusogenicity of chinese hamster ovary cells with murine retroviruses suggests roles for cellular factor(s) and receptor clusters in the membrane fusion process. J Virol 70, 3432-3439. Sorge, J., Wright, D., Erdman, V. and Cutting, A. (1984) Amphotropic retrovirus vector system for human cell gene transfer. Mol. Cell. Biol. 4, 1730-1737. Tailor, C., Nouri, A., Lee, C., Kozak, C. and Kabat, D. (1999) Cloning and characterization of a cell surface receptor for xenotropic and polytropic murine leukemia viruses. Proc. Natl. Acad. Sci, USA 96, 927-932. Wang, H., Kavanaugh, M., North, R. and Kabat, D. (1991) Cell-surface receptor for ecotropic murine retroviruses is a basic amino-acid transporter. Nature 352, 729-731. White, J., Kielian, M. and Helnius, A. (1983) Membrane fusion proteins of enveloped animal viruses. Q. Rev. Biophys. 16, 151-195.

RECONSTRUCTING AN ANTI-TUMOR IMMUNE REPERTOIRE FOR TARGETED AML THERAPY MATTHIAS THEOBALD* Johannes Gutenberg-University, Department of Hematology & Oncology, Mainz, Germany

Keywords: Cytotoxic T lymphocytes; T cell antigen receptor; allogeneic hemopoietic stem cell transplantation; acute myeloid leukemia

Abstract. Selectively shaping the T cell repertoire in hemopoietic stem cell transplantation and leukemia immunotherapy towards specific recognition and elimination of malignant and virus-infected cells represents a new therapeutic concept. This concept takes advantage of selectively tolerizing or depleting graft versus host disease (GvHD)-mediating T lymphocytes, while preserving or selecting cytotoxic T cell responses specific for malignant and viral disease. Two specific strategies have been extensively explored in preclinical models for this particular purpose. One strategy is to equip recipient-derived T lymphocytes with “off the shelve” available T cell antigen receptors (TCRs) specific for leukemia-associated as well as human cytomegalovirus (hCMV)specific antigenic epitopes in order to tackle leukemic relapse and hCMV infection. This strategy is obviously as attractive in immunotherapy of malignant disease by transferring specificity and affinity of TCRs for broadspectrum tumor- and leukemia-associated antigens into T lymphocytes of patients and thus breaking their state of cancer- and leukemia-specific T cell tolerance. Another strategy is to selectively deplete the donor stem cell graft of GvHD-mediating alloreactive T lymphocytes while preserving the integrity of a leukemia- and virus-reactive T cell repertoire within the stem cell inoculum. As these strategies have been successfully developed at the preclinical level, the opportunity of transferring them into clinical application represents a possible current challenge and endeavor.

______ *

To whom correspondence should be addressed. Johannes Gutenberg-University, Department of Hematology & Oncology, Mainz, Germany, E-Mail: [email protected] 245 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 245–251. © 2008 Springer.

M. THEOBALD

246

1. Introduction Progress in conventional and high-dose chemotherapy followed by autologous or allogeneic hemopoetic stem cell transplantation has improved the overall response rate and survival of patients suffering from acute leukemia. However, a substantial number of patients at defined molecular risk will ultimately relapse after such treatment. There is increasing clinical and experimental evidence that the immune system and particularly allogeneic cytotoxic T lymphocytes (CTLs) are able to respond to transformed cells. However, the effect of graft versus leukemia (GvL)-based allogeneic CTL responses to malignant disease is not specific to neoplastic targets, and is associated with significant toxicity. Obviously, new approaches to treatment are needed. Adoptively transferring CTLs into cancer-bearing hosts and hemopoetic stem cell graft recipients for the prevention and treatment of malignant and viral disease has been extensively explored in preclinical models and occasionally in man. Although the transfer of melanoma and hCMV-reactive CTLs into patients has been proven therapeutically effective, the widespread clinical routine application of this approach has been jeopardized by logistic and regulatory limitations, not to mention the extraordinary costs of such an entirely individualized cellular therapy. As opposed to inducing and generating CTLs with the desired antigen specificities ex vivo for each individual patient, the transfer by viral vector transduction of well defined and “off the shelve” available TCR gene constructs with high affinity for broad-spectrum leukemiaand cancer-associated antigens and hCMV into T-lymphocytes of stem cell transplant and non-transplant patients suffering from malignant disease represents a promising and more feasible tool for both, “state of the art” and large scale clinical application (Figure 1). Selective Transfer

Selective Depletion GvHD-Inducing T Cells

Non-GvHD-Inducing T Cells Potentially Virus-Reactive Potentially Leuk.-Reactive

Patient

TCRs Specific for Leukemia Antigens



TCRs Specific for hCMV Antigens

Hemopoietic Stem Cells

Figure 1. Shaping the T cell repertoire in hemopoetic stem cell transplantation and immunotherapy of malignant disease by T cell antigen receptor transfer.

REPROGRAMMING T CELLS

247

2. Conceptual Considerations CTL clones with defined MHC class I restriction pattern, TCR specificity, and functional avidity are an essential prerequisite for any TCR-based transfer strategy. As opposed to hCMV-specific CTLs that can be isolated from patients with viral infection, CTL clones of human origin and specific for defined broad-spectrum leukemia- and cancer-associated epitopes have only rarely been established [1-7]. HLA-A*0201 (A2.1) transgenic (Tg) mice models have therefore been developed in order to bypass a variety of limiting obstacles, such as mechanisms of self-tolerance as well as low avidity and long-term growth and maintenance of antigen-specific human CTLs generated primarily in vitro [8-10]. Peptides presented by class I MHC molecules and derived from normal selfproteins that are either constitutively expressed by defined cell lineages or displayed at elevated levels by cells from a variety of human malignancies provide potential target antigens for an universal, CTL-based immunotherapy of hematologic malignancies and cancer. However, as broad-spectrum leukemiaand tumor-associated self-proteins are often also expressed at low level in some types of normal tissues, such as thymus, spleen, and lymphohemopoetic cells, these self-class I MHC/self-peptide complexes are also likely to represent thymic and/or peripheral tolerogens, thereby preventing immune responses. This is particularly true for class I MHC-peptide complexes expressed by bone marrow-derived cells in the thymus, as such expression would cause negative selection of immature thymic T cells with high avidity for self-class I MHC/self-peptide complexes. The intrathymic deletion of potentially selfreactive T cells could result in a peripheral T cell repertoire purged of CTL precursors with sufficiently high avidity to recognize natural leukemia- and tumor-associated self-epitopes presented by class I MHC molecules on malignant cells. Different lines of A2.1 and human CD8 Tg mice provide the basis of an experimental strategy that exploits species differences between human and murine protein sequences in order to circumvent self-tolerance and obtain high-avidity A2.1-restricted CTLs specific for broad-spectrum epitopes derived from human self-proteins associated with cancer (p53, hdm2), leukemia (hdm2), and B cell malignancies (CD19) [8-13]. 3. Preclinical Results and Discussion Several antigenic peptides that are naturally processed and presented by A2.1 and corresponding to human wild-type (wt) p53, hdm2, and CD19 sequences have been identified in the laboratory. Tg mice-derived CTL lines specific for the identified wt p53 and hdm2 peptide epitopes were of sufficiently high

248

M. THEOBALD

avidity to specifically kill a broad range of A2.1-positive human tumor, leukemia, and myeloma targets provided that these cells displayed high-level p53 and hdm2 protein expression. In contrast, a variety of non-transformed human cells, such as peripheral blood mononuclear cells, resting T and B cells, antigen-activated T lymphocytes, dendritic cells, fibroblasts, and epithelial cells, all of them which did not express detectable amounts of p53 and hdm2 proteins, were not susceptible to lysis by these CTLs. Similar observations have been made for A2.1-restricted and CD19 peptide-specific CTLs. The anticipation that the self-A2.1-restricted human T cell repertoire is in fact devoid of such broad-spectrum and high-avidity leukemia and tumor-reactive CTLs has been confirmed in the laboratory by taking further advantage of a variety of experimental model systems including p53 -/- mice interbred with A2.1-transgenics [9, 12, 13]. In situations in which the host immune system is devoid of such highavidity tumor and leukemia-reactive CTLs, the murine genes for A2.1-restricted and p53, hdm2, or CD19 epitope-specific TCRs could be transferred into patient T cells. Full length high-affinity αβ TCRs obtained from tumor and leukemia-reactive Tg CTLs specific for A2.1-presented p53- and hdm2-derived epitopes have been cloned (p53, hdm2) and molecularly modified (hdm2) in the laboratory in order to transfer antigen specificity. Constant regions of human origin have been employed to partially humanize hdm2 peptide-specific TCRs, thereby allowing the prevention or impairment of potential immune responses directed against human T lymphocytes that express Tg mice-derived doublechain TCR molecules during putative therapeutic intervention in vivo. Each of the hdm2-specific murine wt and chimeric TCR α and β gene constructs was cloned into the pBullet retroviral vector and delivered along with vectors encoding for gag-pol (pHIT60) and env (pCOLT-GALV) into the 293T packaging line. Human peripheral blood lymphocytes were activated and transduced with wt and chimeric αβ TCRs upon coculture with transfected 293T cells. Staining of activated human T cells with a monoclonal antibody (mAb) recognizing the murine Vβ subfamily domains of hdm2- and p53specific TCRs revealed transduction efficiencies of about 30%. The nonselected bulk of TCR-transduced human CTLs was able to specifically kill peptide-pulsed T2 targets as well as hdm2 and p53-transfectants, albeit less efficiently. The peptide-specific lytic activity of human T cells derived from different donors and transduced with wt murine and humanized chimeric double-chain TCRs was inhibited in a dose dependent and specific fashion by anti-murine Vβ subfamily-reactive mAbs. Consistent with this finding, transduction of human T lymphocytes with either mock or TCR single-chains did not result in antigen-specific CTL responses. This indicated that only the pairing of transduced TCR αβ chains was able to transfer antigen specificity

REPROGRAMMING T CELLS

249

into recipient T cells. Bulk CTLs were enriched for the relevant murine Vβ subfamily-positive T lymphocytes in order to increase the quantity of antigenspecific effector cells. These TCR-transduced human CTLs were highly effective in their specific and selective killing of a wide variety of A2.1-positive malignant target cells (Figure 2). Consistent with the recognition of naturally presented A2.1/peptide complexes on leukemia and cancer targets was the observation that double-chain TCR-transduced human CTLs were at least as efficient as parental Tg mice-derived effector cells in their response to limited amounts of exogenous antigen pulsed onto T2 cells. Delivery of transgenic mice-derived T cell antigen receptors into human T lymphocytes.

% Specific Lysis

sc T CR 3

Mu ß 18

Mu dc T CR 8-18 100

100

100

50

50

50

0

0

0 E :T V ß6:T

30 18

10 6

3 1 2 0.6

0.3 0.2

30 17

10 6

3 1 2 0.6

0.3 0.2

30 23

10 8

3 1 3 0.9

0.3 0.3

Figure 2. Human T cells, transduced with hdm2 81-88 epitope-specific and CD8 x A2Kb Tg mice-derived double-chain (Mu dc TCR 8-18) and non-functional single-chain TCRs (Mu b 18 and sc TCR 3), were tested for cytolytic activity in response to (○) non-peptide o

In conclusion, these results demonstrate that affinity and specificity of A2.1restricted TCRs, selected in Tg mice by circumventing self-tolerance to universal hdm2- and wt p53-derived CTL epitopes, can be successfully delivered into human T lymphocytes. This, however, is precisely the molecular requirement to rescue the human T cell repertoire with high-affinity leukemia and tumor-reactive TCRs that have been lost due to the establishment of antigen-specific self-tolerance [13, 14]. Patients undergoing allogeneic hemopoetic stem cell transplantation are at risk for reactivating hCMV which is usually associated with profound morbidity and mortality resulting from hCMV mediated disease including life threatening penumonitis. A high frequency of hCMV reactivation has also been observed in hCMV seropositive patients enrolled in a clinical trial of autologous CD34 positively selected peripheral stem cell transplantation in combination with rituximab mAb for advanced stage B cell Non-Hodgkin lymphoma. Although the incidence of hCMV disease is certainly affected by prophylactic and preemptive treatment of patients at risk with ganciclovir,

250

M. THEOBALD

antiviral therapy is also accompanied by substantial side effects and all to often jeopardized by late onset of hCMV disease after discontinuation of ganciclovir while other patients at risk never develop disease or reactivate hCMV before sensitive laboratory screening tests become positive. Class I MHC-restricted CTLs specific for endogenously processed and hCMV derived natural peptide epitopes are particularly effective in limiting viral reactivation and disease [15, 16]. The hCMV internal matrix protein pp65 has been reported to provide immunodominant peptide antigens for recognition by hCMV-reactive CTLs. As compared to adoptive transfer strategies with hCMV-specific CTLs, the delivery by retroviral vector transduction of gene constructs encoding highaffinity hCMV pp65-specific TCRs into hemopoetic stem cell transplant patients at risk provides an attractive and innovative treatment option. Acknowledgements

This work was supported by grants from the Deutsche Forschungsgemeinschaft.

References 1. L. Gao, I. Bellantuono, A. Elsasser, S.B. Marley, M.Y. Gordon, J.M. Goldman, and H.J. Stauss, Selective elimination of leukemic CD34+ progenitor cells by cytotoxic T lymphocytes specific for WT1, Blood 95, 2198-2203 (2000). 2. B. Minev, J. Hipp, H. Firat, J.D. Schmidt, P. Langlade-Demoyen, and M. Zanetti, Cytotoxic T cell immunity against telomerase reverse transcriptase in humans, Proc. Natl. Acad. Sci. USA 97, 4796-4801(2000). 3. J. Molldrem, S. Dermime, K. Parker, Y.Z. Jiang, D. Mavroudis, N. Hensel, P. Fukushima, and A.J. Barrett, Targeted T-cell therapy for human leukemia: cytotoxic T lymphocytes specific for a peptide derived from proteinase 3 preferentially lyse human myeloid leukemia cells, Blood 88, 2450-2457 (1996). 4. J.J. Molldrem, P.P. Lee, C. Wang, K. Felio, H.M. Kantarjian, R.E. Champlin, and M.M. Davis, Evidence that specific T lymphocytes may participate in the elimination of chronic myelogenous leukemia, Nat. Med. 6, 1018-1023 (2000) . 5. Y. Oka, O.A. Elisseeva, A. Tsuboi, H. Ogawa, H. Tamaki, H. Li, Y. Oji, E.H. Kim, T. Soma, M. Asada, K. Ueda, E. Maruya, H. Saji, T. Kishimoto, K. Udaka, and H. Sugiyama, Human cytotoxic T-lymphocyte responses specific for peptides of the wild-type Wilms tumor gene (WT1) product, Immunogenetics 51, 99-107 (2000). 6. A. Trojan, J.L. Schultze, M. Witzens, R.H. Vonderheide, M. Ladetto, J.W. Donovan, and J.G. Gribben, Immunoglobulin framework-derived peptides function as cytotoxic T-cell epitopes commonly expressed in B-cell malignancies, Nat. Med. 6, 667-672 (2000). 7. R.H. Vonderheide, W.C. Hahn, J.L. Schultze, and L.M. Nadler, The telomerase catalytic subunit is a widely expressed tumor associated antigen recognized by cytotoxic T lymphocytes, Immunity 10, 673-679 (1999). 8. M. Theobald, J. Biggs, D. Dittmer, A.J. Levine, and L.A. Sherman, Targeting p53 as a general tumor antigen, Proc. Natl. Acad. Sci. USA 92, 11993-11997 (1995).

REPROGRAMMING T CELLS

251

9. M. Theobald, J. Biggs, J. Hernandez, J. Lustgarten, C. Labadie, and L.A. Sherman, Tolerance to p53 by A2.1-restricted cytotoxic T lymphocytes, J. Exp. Med. 185, 833-841 (1997). 10. M. Theobald, T. Ruppert, U. Kuckelkorn, J. Hernandez, A. Haussler, E.A. Ferreira, U. Liewer, J. Biggs, A.J. Levine, C. Huber, U.H. Koszinowski, P.M. Kloetzel, and L.A. Sherman, The sequence alteration associated with a mutational hotspot in p53 protects cells from lysis by cytotoxic T lymphocytes specific for a flanking peptide epitope, J. Exp. Med. 188, 1017-1028 (1998). 11. U. Kuckelkorn, E.A. Ferreira, I. Drung, U. Liewer, P.M. Kloetzel, and M. Theobald, The effect of the interferon-γ inducible processing machinery on the generation of a naturally tumor-associated human cytotoxic T lymphocyte epitope within a wild type and mutant p53 sequence context, Eur. J. Immunol., 1368-1375 (2002). 12. J. Kuball, M. Schuler, E. Antunes-Ferreira, W. Herr, M. Neumann, L. Obenauer-Kutner, L. Westreich, C. Huber, T. Wölfel, and M. Theobald, Generating p53-specific cytotoxic T lymphocytes by recombinant adenoviral vector based vaccination in mice but not man, Gene Therapy, 833-843 (2002). 13. T. Stanislawski, R.H. Voss, C. Lotz, E. Sadovnikova, R.A. Willemsen, J. Kuball, T. Ruppert, R.L. Bolhuis, C.J. Melief, C. Huber, H.J. Stauss, and M. Theobald, Circumventing tolerance to a human MDM2-derived tumor antigen by TCR gene transfer, Nature Immunol. 2, 962-970 (2001). 14. H.W. Kessels, M.C. Wolkers, M.D. van den Boom, M.A. van der Valk, and T.N. Schumacher, Immunotherapy through TCR gene transfer, Nature Immunol. 2, 957-961 (2001). 15. S.R. Riddell, K.S. Watanabe, J.M. Goodrich, C.R. Li, M.E. Agha, and P.D. Greenberg, Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones, Science 257, 238-241 (1992). 16. E.A. Walter, P.D. Greenberg, M.J. Gilbert, R.J. Finch, K.S. Watanabe, E.D. Thomas, and S.R. Riddell, Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor, N. Engl. J. Med. 333, 1038-1044 (1995).

V CLINICAL HAEMATOPOIETIC STEM CELL TRANSPLANTATION

EXPERIENCE OF KYIV CENTER OF STEM CELL TRANSPLANTATION Problems of practical appliance of HSC transplantation method in Ukraine basing on 5-year working experience of Kyiv center of bone marrow transplantation (2001-2005)

V.I. KHOMENKO* Kyiv center of bone marrow transplantation. Kiev, Ukraine

Keywords: allogeneic and autologous HSCT, Kyiv BMT center

Abstract. The given article gives a short overview about the development and the current structure of the bone marrow transplantation center in Kyiv. A summary on HSCT between 2001 and 2005 in relation to underlying diseases is provided. 1. Introduction The experience shows that HSC transplantation (peripheral blood, bone marrow, and cord blood) is the effective method of treatment of oncological and hematological diseases. The number of transplantation centers and HSC transplantations carried out in them increases every year. For example, the European Group of Blood and Bone Marrow Transplantation (EBMT) included 145 transplantation centers from 20 European countries in 1990, and the number increased to 592 centers functioning in 38 European and 5 nonEuropean countries in 2004. While 4234 autologous and allogeneic

______ * To whom correspondence should be addressed. V.I. Khomenko, Kyiv center of bone marrow transplantation. Kiev, Ukraine

253 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 253–261. © 2008 Springer.

254

V.I. KHOMENKO

transplantation were performed in Europe in 1990, the number increased to 22216 transplantations in 2004. In 2004 2/3 of all performed transplantations were autologous, and 1/3 were allogeneic ones. Nowadays the average number of HSC transplantations is over 20 per 1 million people in Europe, and in several leading European countries it exceeds 40-50 transplantations per 1 million people. At the moment of Ukraine becoming independent (1991) there were no high-specialized medical institutions in it, which could provide every stage of the process of HSC transplantation using modern technological basement, beginning from the moment of preparing the patient to transplantation, selection the histocompatible donor, collection and cryopreservation the HSC, performing the transplantation itself and carrying out the complex of treating measures during the post-transplantation period. In order to solve this problem Kyiv center of bone marrow transplantation was set up 01.02.2000 according to the Decree of the Head of Kyiv Municipal State Administration No 1960 (09.12.1999). The Center opened in April 2000. It was set up as the joint project of Kyiv Municipal State Administration and The Academy of medical science of Ukraine. Together with the specialists of the Kyiv central administration of public health this project was realized by the experts of Scientific center of radiation medicine of the Academy of medical science of Ukraine. Over 30 million UAH from Kyiv budget were spent on purchasing and assembling the necessary equipment, and also for the fulfillment of the building. The technology of “clean” rooms was firstly applied in Ukraine while building the department of bone marrow transplantation. Structural subdivisions of the Kyiv center of bone marrow transplantation are equipped with the modern equipment, which allows providing the high level of medical care during all the stages of medical treatment of the patient. Today it is the powerful center of bone marrow transplantation in Ukraine, which besides its own possibilities can use the powerful diagnostic and research base of the Scientific center of radiation medicine of Academy of medical Science of Ukraine, and also Kyiv medical prophylactic establishments. Kyiv center of bone marrow transplantation includes: •

Department of bone marrow transplantation for adults and children with 12 aseptic blocks and 100th class of air cleanness;

•

Oncohematology department of preparation transplantation with 20 places for adults;

•

Department of storing and cryopreservation of bone marrow and blood components;

for

bone

marrow

HSC TRANSPLANTATION IN KYIV •

Laboratory of tissue typing;

•

Clinical diagnostic laboratory.

255

2. Short Characteristic of Structural Subdivisions 2.1. THE DEPARTMENT OF BONE MARROW TRANSPLANTATION

The department of bone marrow transplantation is one of the most complex structure subdivisions of the Center. In this department 12 transplantation blocks are located with the 100th class of air cleanness, operating room with the same class of cleanness, sterilization room and other auxiliary rooms. High class of cleanness, necessary frequency of air exchange, programmed parameters of temperature and humidity of the air entering aseptic blocks is provided by round-the-clock work of the special climate technical equipment which is equipped by the cascade of air filters, including HEPA-filters. The promoted pressure of air is supported in aseptic blocks, which prevents the «clean» area from air entering from the contiguous rooms with the lower class of cleanness. Technology of “clean” rooms is the main instrument for prophylaxis of infectious complications when patients are characterized with the depression of the immune system during post-transplantation period. Otherwise to such methods of prophylaxis of infections as antibiotic therapy, moist cleaning up of the rooms with antiseptic and disinfection means, ultraviolet irradiation, this technology has one principle difference, that is the direction not on the elimination of microorganisms in the premises, but on prevention the “clean” rooms from their entering and on immediate withdrawing the microorganisms from the room by the laminar stream. The medical equipment of this subdivision enables providing the whole complex of measures necessary for implementation of autologous and allogeneic transplantations and correction of post-transplantation complications, including the reanimation and intensive therapy, and hemodialysis. 2.2. THE ONCOHEMATOLOGY DEPARTMENT OF PREPARATION TO BONE MARROW TRANSPLANTATION

The oncohematology department of preparation to bone marrow transplantation carries out the preparation of patients to transplantation, that includes the deep inspection and pre-transplantation medical treatment, which is directed on maximal reduction of tumor mass and achievement of remission. This

256

V.I. KHOMENKO

department in case of need provides also the medical treatment of patients during the remote post-transplantation period. Laboratory support is carried out by the clinical diagnostic laboratory and laboratory of tissue typing. The equipment of clinical diagnostic laboratory allows carrying out hematological, biochemical investigations for the structural subdivisions of the Center, coagulometry, analysis of the acid-alkali state, the electrolytes of blood and several other researches in the round-the-clock mode. The equipment of laboratory of tissue typing enables carrying out the tissue HLA-typing of the donors and recipients by serologic and molecular methods, isoserologic, cytogenetic, molecular genetic researches, and also providing of molecular, serologic and immunoferment diagnostics of infections. Part of laboratory researches is being carried out in the laboratories of the Scientific center of radiation medicine of Academy of medical science of Ukraine. 2.3. DEPARTMENT OF STORING AND CRYOPRESERVATION OF BONE MARROW AND BLOOD COMPONENTS

Department of storing and cryopreservation of bone marrow and blood components is equipped by the СОВЕ-Spectra separators of blood cells for obtaining HSC and modern equipment for cryopreservation and storage of these cells in liquid nitrogen. In addition, these cell separators allow carrying out the storage of donors’ tromboconcentrate for thrombocytopenia treatment, and also carrying out plasmafereses, limphocytofereses and erythrocytofereses. 3. Personnel Providing During the Period of 2001-2005 During the 5-year work the manning table of the Kyiv center of bone marrow transplantation is almost invariable and counts 152 regular units, that includes: •

doctors - 37,5

•

middle medical personnel - 59

•

junior medical personnel - 31,5

•

non-medical specialists - 19,5

•

other personnel - 4,5

It should be mentioned that 16 medical workers of the Center have passed the internship concerning different aspects of bone marrow transplantation in Brazil, Russia, Belorussia, Italy, Great Britain, and Japan during 2000-2005.

HSC TRANSPLANTATION IN KYIV

257

4. Transplantation Work 174 HSC transplantations of peripheral blood were carried out in the Kyiv center of bone marrow transplantation during 2001-2005. That includes: 2001 30 transplantations, 2002 - 46, 2003 - 36, 2004 - 32, and 2005 - 30. Most of the transplantations were autologous. One allogeneic transplantation from relative donors was successfully carried out each 2003, 2004 and 2005. TABLE 1. HSCT in Kyiv between 2001 and 2005 Distribution of transplantations

Pathology

General number

Percentage

2001

2002

2003

2004

2005

2001-2005

(%)

Lymphogranulom atosis

14

22

13

10

11+1*

71

40,7%

Malignant lymphoma Myeloma

2

1

2

4

2

11

6,3%

9

14

15

6

8

52

29,8%

Ewing sarcoma

1

2

-

1

-

4

2,3%

Testicular cancer

1

3

4

6

6

20

11,5%

Acute myeloid leukemia

-

2

1*

3

-

6

3,5%

Breast cancer

3

1

-

-

-

4

2,3%

Williams tumor

-

1

1

-

2

1,2%

Chronic myeloleukosis

1*

-

1

0,6%

Acute lymphoblast leukemia Neuroblastoma

-

-

-

1

-

1

0,6%

-

-

-

-

2

2

1,2%

Average number

30

46

36

32

30

174

100%

*- allogeneic transplantation

Over 70% of transplantations were carried out concerning lymphogranulematosis, lymphoma, and myeloma; others are connected with testicular cancer, acute myeloid leukemia, solid tumors and other oncological diseases. The lethality related with transplantation (100-days lethality among the transplanted patients) was 2,3% (died 4 patients) within 5 years. At the beginning of 2006 56% of all transplanted patients did not have the signs of basic disease progression. The HSC of peripheral blood were the source of hemopoiesis renewal for all the transplantations. 423 collections of peripheral blood HSC were carried out

258

V.I. KHOMENKO

from 176 patients for autologous transplantations and from 3 donors for alogenic transplantations during 5 years. In order to prepare the bone marrow alogenic transplantation the selection of histocompatible donor-recipient pair was carried out by HLA system in the laboratory of tissue typing. 136 recipients and 212 relative donors were inspected during 5 years of work. Besides transplantation work the Center is engaged in medical treatment of oncohematological patients. During 5 years the inspection and polychemotherapy of 1662 patients were carried out in the Center. Most of treated patients were the citizens of Kyiv, only 105 from them were from another cities, that makes 6,3% from the general number of treated patients during 5 years. 5. Collaboration Collaboration with other Kyiv medical establishments, which are engaged in diagnostics and medical treatment of oncological and oncohematologic diseases, is the important aspect of work of the Kyiv center of bone marrow transplantation, namely: the Scientific center of radiation medicine of Academy of medical science of Ukraine, Kyiv city oncological hospital, Kyiv city clinical hospital №9, Kyiv city diagnostic center, Kyiv city center of blood and others. Co-ordination of work with these establishments allowed creating the optimal approaches of the selection of patients to transplantation and the principles of their rational pre-transplantation preparation, taking into account clinical diagnostic and medical possibilities of all above-mentioned medical establishments. 6. Financing Financing of the Center is carried out exceptionally from the Kyiv budget. During 5 years the actual charges on the maintenance of the Center, wages of personnel, and providing of medical process by everything required made over 24 million UAH. In that number, actual charges on medicines, expense materials, and laboratory reagents for 5 years made over 13,5 million UAH. Over 96% of these charges are carried out due to existence of the special purpose program “Health of kyivers” in Kyiv. It should be mentioned that the average cost of charges on the medicines, expense materials and laboratory reagents for one autologous transplantation made 50 thousand of UAH, and for alogenic one it made 2-3 times more. Carrying out the similar transplantations abroad would cost much more

HSC TRANSPLANTATION IN KYIV

259

expensive – 55-75 thousand USD for one autologous transplantation and 150200 thousand USD for alogenic one. If all the transplantations carried out by the Kyiv center of bone marrow transplantation during 5 years were done in the countries of western Europe (for example, Germany), their cost for the state budget would make 13 million USD. Exchanging in UAH it would be over 66 million UAH; that exceeds the expenses on the building and equipment of the Center by the medical equipment, and the general charges on maintenance of the Center and medical providing beginning from April, 2000. This example, from our point of view, shows the financial viability of introduction and development of modern medical technologies in Ukraine. However, the existent financing is insufficient. It allowed taking advantage of the potential possibilities of the Center only near 30-40% from his planned possibilities. The Center can increase the amount of transplantations in 2-3 times with the proper increase of financing on the medicinal, laboratory, material and technical providing, in fact his planned power is counted on implementation of 90-100 autologous and alogenic bone marrow transplantations per year. Thus, from our point of view, there was a paradoxical situation. The minimal necessity of HSC transplantations, which is counted by the extrapolation of average amount of transplantations carried out in Europe per 1 million of European population, can make over 1000 autologous and alogenic transplantations per year in Ukraine. At the same time, the existent possibilities of transplantation centers are used only partly. 7. The Problems which Require Solving 7.1. INCREASING OF THE FINANCING OF TRANSPLANTATION WORK FROM THE STATE BUDGET

Due to the high cost of HSC transplantation technology the financing of the Center only from the Kyiv budget can not provide such medical treatment for all the patients which need it from the regions of Ukraine. In spite of the existence of the Government program of transplantation development during 2002-2005, the Kyiv center of bone marrow transplantation did not get the costs by this program, and the charges on maintenance of the Center and providing of treatment for patients from Kyiv were carried out only from city budget. Financing from the city budget, as it was previously said, allowed using only 30-40 % of the possibilities of the Center.

260

V.I. KHOMENKO

Realizing that the possibilities of the Kyiv center of bone marrow transplantation are used not completely, Kyiv city state administration and Kyiv central administration of health care and medical providing repeatedly applied to the Ministry of public health of Ukraine and the higher public servants of the state with the request to consider the question about possibility of the state providing of the program of bone marrow transplantation. But the opened question remains not decided till now. 7.2. INTRODUCTION OF NON-RELATED HSC ALOGENEIC TRANSPLANTATION

Performing of non-related HSC alogenic transplantation today in Ukraine is impossible due to several reasons: 1. There is no possibility to carry out the search of compatible donor-recipient pairs in Ukraine due to the absence of the register of voluntarily potential histotyped bone marrow donors in our country. The search of donor out of register does not have perspectives and is not economically advantageous due to the very small possibility to find compatible donor-recipient pair and due to the high cost of laboratory researches. The inspection of one person by the HLA-DNA-typing method costs over 1000 UAH. That is why in its practical works the Center is limited by only related donors typing, because the probability to find the HLA-identical donor is much higher. 2. The service for searching of the HLA-compatible non-related donors abroad in the international banks of bone marrow donors is not still created in Ukraine; therefore, the Ukrainian transplantation centers today do not have the possibility to carry out the search of donors abroad for performing bone marrow transplantations in Ukraine. 3. The question is still opened concerning the encouragement of Ukrainian citizens to HSC donation. Thus, the patients of our country, which need bone marrow transplantation from the unrelated donor, today do not have the chances to find the compatible donor material in Ukraine or to get it from the foreign banks of bone marrow donors. Carrying out of such transplantations abroad needs extraordinarily large expenses. The average cost of donor search in Germany makes 20 thousand euro. And carrying out of alogenic transplantation in this country will make 160-180 thousand euro. The charges on medicines, laboratory reagents and expense materials for such type of transplantation when carrying out in Ukraine would make 30-40 thousand euro. That would give the possibility to save considerable sum of money.

HSC TRANSPLANTATION IN KYIV

261

Therefore, from our point of view, it is necessary to create the National register of histotyped voluntarily HSC donors in Ukraine and organize the international cooperation with the similar structures of other countries concerning the exchange of donor material for the patients in situations threatening to their life, with the financial providing of this work from the state budget. 7.3. PERSONNEL TRAINING FOR THE CENTERS OF BONE MARROW TRANSPLANTATION

Today, one of the reasons preventing the development of HSC transplantation in Ukraine is the absence of transplantology teaching in medical educational establishments in Ukraine. Establishments which carry out the work related to the HSC transplantation must have the possibility to prepare skilled employees for realization of transplantation in Ukraine. 7.4. REGISTRATION OF LABORATORY REAGENTS AND EXPENSE MATERIALS NECESSARY FOR THE TRANSPLANTATION ON THE TERRITORY OF UKRAINE

Expense materials for tissue typing and cryopreservation of HSC are not certificated in Ukraine. The methods of tissue typing are not compatible, different sets are used; hence, creation of the united compatible register is impossible. Thus, the increasing of amount and quality of transplantations in Ukraine needs the complex decision of several medical, financial, and especially organizational questions which will give the possibility to use the available potential and create new possibilities for development of transplantology in Ukraine.

ANTI THYMOCYTE GLOBULINE ALLOWS FOR SUCESSFUL TRANSPLANTATION FROM HLA MISMATCHED UNRELATED DONORS AXEL R. ZANDER* , TATJANA ZABELINA, FRANCIS AYUK, THOMAS EIERMANN, HARTMUT KABISCH, CHRISTINE WOLSCHKE, OLGA WASCHKE, GITTA AMTSFELD, BORIS FEHSE, JÜRGEN BERGER, RUDOLF ERTTMANN, NICOLAUS M. KRÖGER Bone Marrow Transplantation, University Hospital HamburgEppendorf, Hamburg, Germany

Key words: Mismatched unrelated donor, anti-thymocyte-globuline, stem cell transplantation

Abstract. Allogeneic hemopoietic stem cell transplantation of matched unrelated donors carries an increased risk of graft versus host disease (GvHD) and transplant related mortality (TRM). We introduced ATG Fresenius at median dose of 90 mg/kg body weight as part of the conditioning regimen for prevention of serious GvHD. We compared 48 recipients of mismatched transplants with 170 recipients of an HLA-matched transplant. The mismatches involved one or two loci. The groups differed in age [HLA-matched: 33 years (0,9–61) HLA-mismatched: 21 years (0,9–51)] and graft source, bone marrow versus peripheral blood stem cell (matched 67% bone marrow, mismatched 83% bone marrow). They were comparable in diagnosis, stage of disease and conditioning. Results: There was no difference between graft failure and engraftment in the two groups, no significant difference in the incidence of grade II to IV acute GvHD, 43% versus 33% were no difference in chronic GvHD, 38% in both

______ * To whom correspondence should be addressed. Prof. Dr. med. Dr. h. c. Axel R Zander, Bone Marrow Transplantation, University Hospital Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany, Tel.: +49-40-42803/4851, Fax: +49-40-42803/3795, E-mail: [email protected]

263 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 263–274. © 2008 Springer.

264

A.R. ZANDER ET AL.

groups. Significant parameters for overall survival were: age older than 20 years, high risk disease and positive CMV-status of the patient as negative factors, CML as underlying disease compared with AML and MDS as a positive factor. Conclusion: Addition of ATG Fresenius permits HSCT from mismatched donors without excess transplant related mortality and GvHD. 1. Introduction Hematopoietic stem cell transplantation is an accepted treatment for a variety of hematological diseases, immunodeficiencies and metabolic disorders [1]. A suitable family donor is available for less than 30% of potential recipients [2-3]. The establishment of a network of registries including more than eight million donors has facilitated the identification of suitable donors. For two thirds of all patients, a suitable HLA-compatible unrelated donor can be identified within a few months. Finding a suitable donor is still a problem for one third of the patients. Alternative sources for stem cell transplant could be umbilical cord stem cells, and HLA-type haplo-identical donors like parents or unrelated mismatched donors [3,4]. The degree of histoincombatibility which can be tolerated still has to be defined. It has been reported that a mismatch within HLA-A, HLA-B, HLA-DRB1 and HLA-DQB1 loci increases the risk of graftversus-host disease, of graft failure and of transplant-related mortality [5,6]. The use of in vivo anti-T-lymphocyte globulin ATG (Fresenius, Gräfelfing, Germany) as part of a combined GvHD prophylaxis in patients receiving unrelated stem cell transplants has been reported [7,8]. In a retrospective comparative analysis, it could be shown in 333 CML patients, that the use of ATG decreased the incidence of acute GvHD, transplant-related mortality, and chronic GvHD, resulting in an increased overall survival in comparison to those who were treated without ATG [9]. In this setting, it further could be shown that mismatched patients treated with ATG had the same overall survival as patients receiving stem cells from matched donors. In the present paper, we extend our experience with 218 consecutive patients (170 recipients of matched grafts, 48 recipients of mismatched grafts) receiving ATG plus a combination of cyclosporine A and methotrexate as GvHD prophylaxis. Our data show that mismatched grafts can be given without an increase of transplant-related mortality if adequate GvHD prophylaxis is given.

MISMATCHED UNRELATED DONOR TRANSPLANTATION

265

2. Patients and Methods Between March 1992 and June 2003, 218 adult and pediatric patients with hematological malignancies and non-malignant diseases were treated with bone marrow or blood stem cell grafts from an unrelated donor. GvHD prophylaxis consisted of ATG, methotrexate and cyclosporine A [9]. The patients were treated with total body irradiation and alkylating therapy or a combined alkylating therapy. Patients’ characteristics are listed in Table 1. Patients with CML in first chronic phase, AML in first complete remission, ALL in first complete remission, MDS (RA and RARS) as well as non-malignant disease were classified as “standard risk”-patients. All other patients were classified as “high risks”. The characteristics of both groups were well matched with the exception of age, type of graft (bone marrow versus peripheral blood stem cells) and ATG-dose. TABLE 1. Patients’ and donors’ characteristics Characteristic

Patient age median Donor age median Patient sex male female Donor sex male female Graft source bone marrow peripheral blood Diagnosis CML ALL AML, sAML MDS, sMDS non-malignant other (MM, NHL)

HLA - match

HLA - mismatch

n=170

n=48

p-value (*)

0.006 33 (r: 0.9 - 61)

20 (r: 1 - 51) 0.8

34 (r: 19 - 58)

34 (r: 20 - 57)

100 (59%) 70 (41%)

24 (50%) 24 (50%)

113 (67%) 55 (33%)

26 (58%) 19 (42%)

114 (67%) 56 (33%)

40 (83%) 8 (17%)

72 (43%) 38 (22%) 28 (16%) 16 (9%) 15 (9%) 1 (1%)

17 (35%) 14 (29%) 7 (15%) 3 (6%) 6 (13%) 1 (2%)

0.3

0.2

0.03

0.7

A.R. ZANDER ET AL.

266 Characteristic

Risk standard risk high risk Time diagnosis -TX ≤ 1 year > 1 year CMV (patient) seropositive seronegative CMV (donor) seropositive seronegative AB0 identical non-identical CD 34+ cells x 106/kg median CD 34+ cells x 106/kg < 5.0 ≥ 5.0 Conditioning TBI non -TBI ATG dose mg/kg 20 - 30 45 60 90 - 120 ATG dose mg/kg < 90 ≥ = 90 Median dose of ATG

HLA - match

HLA - mismatch

n=170

n=48

98 (58%) 72 (42%)

29 (60%) 19 (40%)

87 (51%) 83 (49%)

24 (50%) 24 (50%)

p-value (*)

0.9

1.0

1.0 76 (45%) 94 (55%)

21 (44%) 27 (56%) 1.0

61 (36 %) 109 (64 %)

17 (35%) 31 (65%)

54 (35%) 100 (65%)

21 (45%) 26 (55%)

0.3

0.7 5.0 (r: 0.6 - 30.7)

5.4 (r: 0.35 - 17.5) 0. 7

78 (49%) 80 (51%)

21 (46%) 25 (54%)

69 (41%) 101 (59%)

20 (42%) 28 (58%)

17 (10%) 35 (21%) 27 (16%) 91 (53%)

1 (2%) 3 (6%) 0 (0%) 44 (92%)

1.0

< 0.001 80 (47 %) 90 (53 %)

4 (8%) 44 (92%)

(*) Chi-square test for categorial variables Mann-Whitney-U-test for ordinal or continuous variables

MISMATCHED UNRELATED DONOR TRANSPLANTATION

267

2.1. DONOR SELECTION AND HLA TYPING

The HLA-A and B loci were typed using the reverse SSO line blot assay and the HLA-DRB1 and DQB1 loci were typed using the reverse SSO dotblot method. Helmberg-Score software was used for allelic assignment in cooperation with the most recent nomenclature report and library [10-12]. Remaining ambiguities were resolved by sequencing of amplimers obtained after SSP with appropriate primers. HLA-A and B were resolved at the 2-digit level, whereas HLA-DRB1 and DQB1 were typed to the 4-digit allelic level. 170 patients received transplantations from HLA-A, HLA-B, HLA-DRB1 and HLA-DQB1 identical donors. 48 patients received grafts from a mismatched donor. Patient-donor HLA-disparities are listed in Table 2. TABLE 2. Patient – Donor HLA-Disparities Locus

Number of Patients

A B DRB1 DQB1 A + DQB1 B + DQB1 B + DRB1 DRB1 + DQB1

3 12 10 11 1 2 1 8

2.2. CONDITIONING REGIMENS

89 patients received conditioning with total body irradiation (12 Gy, divided into 2 Gy fractions on days -7 to -5), followed by etoposide (45 mg/kg BW on day -4) and cyclophosphamide (60 mg/kg BW on day -2 and -1). Patients with CML received busulfan (14–16 mg/kg BW p. o.) and cyclophosphamide (60 mg/kg BW) on days -2 and -1, or TBI and cyclophosphamide. Patients with AML and MDS received busulfan 14-16mg/kg/BW over 4 days, cyclophosphamide 60mg/kg/BW on 2 consecutive days and VP-16 (30–45 mg/kg BW). 2.3. GVHD PROPHYLAXIS

All patients received cyclosporine A (3 mg/kg i. v.), starting at day -1, and additional short-course methotrexate (10mg/m2) on day 1, 3 and 6 after transplantation. All patients received ATG (Fresenius, Gräfelfing, Germany) within the last 3 days prior to transplantation [9]. The initial dose was 30 mg/kg

268

A.R. ZANDER ET AL.

BW, a decrease of the ATG dose was carried out over the years in the matched group. 92% of patients in the mismatched group received the full dose of 90 mg/kg BW or more, 47% of patients in the matched group received less than 90 mg/kg. 2.4. GRADING OF GVHD

The grading of acute GvHD was performed acc. to standard criteria. The grades were assigned on the severity of acute GvHD of skin, liver and gastrointestinal tract [13]. Chronic GvHD was evaluated in patients alive beyond day +80 post transplant and characterized as “limited” or “extensive” [14]. 2.5. STATISTICAL CONSIDERATIONS

All data were evaluated and updated as of August 1, 2003. Endpoints of the analysis were transplant-related mortality (TRM), incidence and severity of acute GvHD, incidence and severity of chronic GvHD, incidence of relapse, disease-free survival (DFS) and overall survival (OS). Transplant-related mortality is defined from any cause other than recurrent malignancy. 3. Results As of August 1, 2003, the median follow-up for the HLA-matched recipients was 1281 (33-3422) days and for the HLA-mismatched recipients 448 (203814) days (see Table 3). 3.1. ENGRAFTMENT AND CLINICAL OUTCOME

Six patients in the matched group and one patient in the mismatched group died before engraftment. 164 patients in the matched group and 47 patients in the mismatched group were evaluable for engraftment. There was no difference in engraftment and graft-failure between both groups. The engraftment of leukocytes occurred after median of 16 days and the engraftment of platelets after median of 21 days. Primary graft failure occurred in 3 (1.8%) patients in the HLA-matched group and in 1 patient (2.1%) in HLA-mismatched group. Three of the 4 patients with graft failure died: 2 on days 51 and 60 from complications of pancytopenia, and 1 patient on day 328 from GvHD after second graft.

MISMATCHED UNRELATED DONOR TRANSPLANTATION

269

GVHD

One patient in the matched group, who died on the day after bone marrow transplantation, was excluded from the acute GvHD analysis. For chronic GvHD, 128 patients were evaluable in the matched and 37 patients in the mismatched group. TABLE 3. Clinical outcomes according to HLA-matching

Graft-failure Engraftment (day) median (range) Leukocytes >=1.0 x 109/l Platelets >=20x 109/l Acute GvHD grade I-IV grade II-IV Chronic GvHD limited extensive overall Follow-up, median days (range)

HLA - match

HLA - mismatch

n=170

n=48

3/164 (1.8%)

1/47 (2.1%)

1.0

16 (9-27) 21 (9-127)

16 (12-26) 21 (11-132)

0.4 0.9

95 (56%) 72 (43%)

31 (65%) 16 (33%)

0.3 0.3

22 (17%) 27 (21%) 49 (38%) 1281 (33-3422)

5 (14%) 9 (24%) 14 (38%) 448 (20-3814)

0.9

p-value

0.007

Acute GvHD grade II-IV was observed in 72 (43%) patients in the HLAmatched group and 16 (33%) patients in HLA-mismatched group (p=0.3). There was no difference in chronic GvHD (38% in both groups). The transplant-related mortality was 33% in the HLA-matched group and 21% in the HLA-mismatched group. Causes of death were comparable with a slight increase in GvHD and infections in the HLA-matched group and relapse in the HLA-mismatched group (Table 4). TABLE 4. Cause of death Cause of death Acute GvHD +/- fungal infection

HLA match

HLA mismatch

n=73

n=18

15 (21%)

0

Chronic GvHD +/- fungal infection

2 (3%)

1 (5.5%)

Graft-failure

2 (3%)

1 (5.5%)

Fungal infection

12 (16%)

5 (28%)

Virus +/-fungal infection

6 (8%)

1 (5.5%)

Sepsis

6 (8%)

0

Toxicity

9 (12%)

1 (5.5%)

270

A.R. ZANDER ET AL.

Relapse

19 (26%)

8 (44.5%)

Other

2 (3%)

1 (5.5%)

3.2. STATISTICAL ANALYSIS OF PROGNOSTIC FACTORS

The probability of overall survival, disease-free survival, TRM and relapse were calculated using the method of Kaplan-Meier. Comparison of curves was calculated using the log-rank test. The following factors were included in the analysis (only pre-transplant parameters): patients’ age, donors’ age, patients’ sex, donors’ sex, sex mismatch vs. matched, diagnosis, standard risk vs. high risk disease, CMV status of patient, CMV status of donor, stem cell source (bone marrow vs. peripheral blood stem cells), TBI vs. non-TBI conditioning, HLA-match vs. HLA-mismatch, ATG-dose (≥ 90 mg/kg BW vs. < 90 mg/kg BW), AB0-identical vs. AB0-mismatch, interval from first diagnosis to transplantation and CD34+-cells. The multivariate analysis was carried out by the Cox proportional hazard regression model. Only factors at <10% levels in the univariate analyses were introduced in the multivariate analyses. Overall survival (OS) Kaplan-Meier overall survival at 5 years was 52% (95% CI: 43-61%) for patients of HLA-matched group and 51% (95% CI: 33-69%) in HLAmismatched group.The following variables were associated with improved patient survival in univariate analysis: patient age <20 years (p=0.006), nonmalignant disease vs all others (p=0.01), AML (p=0.04), standard risk disease (p=0.0002), CMV seronegative patients (p=0.002). In multivariate analysis relative risks were determined as per Table 5. Disease-free survival (DFS) Kaplan-Meier disease-free survival at 5 years was 46% (95% CI: 38-54%) for patients of HLA-matched group and 52% (95% CI: 35-69%) in HLAmismatched group.The following variables were associated with improved patient survival in univariate analysis: patient age <20 years (p=0.002), nonmalignant disease vs all others (p=0.003), standard risk disease (p=0.0001), CMV seronegative patients (p=0.007). In multivariate analysis relative risks were determined as per Table 5. Treatment-related mortality (TRM) Overall TRM was 33% (95% CI: 25-41%) in HLA-matched group and 25% (95% CI: 11-39%) in HLA-mismatched group. Factors associated with TRM were older patient age (p=0.001), high risk disease (p=0.05) and CMV seropositive patients (p=0.01). In multivariate analysis relative risks were determined as per Table 5.

MISMATCHED UNRELATED DONOR TRANSPLANTATION

271

Relapse 5 years relapse rate was 31% (95% CI: 20-42%) for patients of HLAmatched group and 30% (95% CI: 12-48%) in HLA-mismatched group. Factors associated with relapse were high risk disease (p=0.0002) and treatment with TBI (p=0.002). In multivariate analysis relative risks were determined as per Table 5. Causes of death were comparable with a slight increase in GvHD and infections in the HLA-matched group and relapse in the HLA-mismatched group (Table 4). TABLE 5. Multivariate proportional hazard regression analysis of relative risk OVERALL SURVIVAL

Relative Risk* Confidence Intervall

p-value

(95 % CI) Age ≥ 20 years High risk disease Positive CMV-status of patient Underlying disease: CML Underlying disease: AML Underlying disease: MDS Underlying disease: Non-malignant DISEASE FREE SURVIVAL

2.16 1.57 1.70 0.50 1.06 0.98 0.38

1.24 – 3.74 0.97 – 2.55 1.10 – 2.63 0.28 – 0.88 0.59 – 1.93 0.45 – 2.17 0.11 – 1.37

0.0063 0.069 0.018 0.017 0.84 0.97 0.14

Age ≥ 20 years High risk disease Patient-CMV-seropositive TRANSPLANT RELATED MORTALITY

2.13 2.20 1.43

1.34 – 3.88 1.48 – 3.27 0.96 – 21.3

0.001 0.0001 0.080

Age ≥ 20 years High risk disease Patient CMV-seropositive Relapse

2.62 1.65 1.63

1.39 – 4.95 1.01 – 2.71 0.98 – 2.69

0.0029 0.047 0.058

High risk disease TBI conditioning

2.76 2.31

1.43 – 5.31 1.16 – 4.57

0.0025 0.017

* Relative risk > 1 indicates a positive course of the group mentioned in the left table column.

4. Discussion Previous studies have shown that mismatch of HLA-A, -B and DR leads to an increased incidence of acute and chronic GvHD, and transplant-related

272

A.R. ZANDER ET AL.

mortality [5,6]. HLA-mismatching at more than one locus has been shown to be a risk factor for graft failure [15]. Other factors have been associated with graft failure like low marrow cell dose, administration of T-cell depleted marrow and transplantation of marrow from a cross match positive donor. The administration of ATG prior to marrow transplantation has not led to an increased rate of engraftment failure [9]. HLA-DRB1 and DQB1 mismatching led to a significant increase in the incidence of grades II to IV in acute GvHD [15-20]. HLA-DPB1 incompatibility between donor and recipient might lead an increase acute GvHD in this setting. [15-20] This retrospective single-center analysis reports identical outcomes in patients who received HLA-matched (170 patients) and HLA-mismatched (48 patients) stem cell grafts, in terms of incidence of acute GvHD, chronic GvHD, transplant-related mortality, disease-free survival and overall survival. The use of ATG for prevention of acute GvHD showed even a decrease of GvHD in the mismatched group, which might be explained in part by favorable characteristics like lower mean age and in part by the use of a higher ATG dose. Finke et al. could show that the use of rabbit ATG (Fresenius) at a dose of 90 mg/kg BW in three-split doses decrease the risk of acute and chronic GvHD (p=0.06). Comparison of overall and disease-free survival of the matched and mismatched group was not shown in their analysis. In our present analysis, we could show that ATG (90 mg/kg BW) not only decreases acute and chronic GvHD and transplant-related mortality but also leads to an identical overall and disease-free survival in both groups. To investigate if an age difference in the mismatched and matched group with a median age of 20 vs. 33 years could have led to an improved outcome, we looked for an age-adjusted group of the HLA-matched group and found no difference in the incidence of acute GvHD, chronic GvHD and survival. The preference of marrow over peripheral blood stem cells in the HLA-mismatched group can be explained by a slightly increased fraction of pediatric patients and general preference of pediatric transplanters for the use bone marrow over peripheral blood cells. A difference in the median ATG-dose used in both groups can be explained by an attempt to reduce the dose in HLA-matched recipients, based on the theoretical concern and aimed to decrease the relapse rate and to hasten immunological recovery. The pre-transplant ATG-dose was not decreased in the mismatched group because of fear of increasing GvHD and transplant-related mortality. In conclusion, we could show that the GvHD prophylaxis with methotrexate, cyclosporine A and ATG (Fresenius) results in a low incidence of acute and chronic GvHD and transplant-related mortality. The expected excess of transplant-related mortality and increased GvHD incidence previously

MISMATCHED UNRELATED DONOR TRANSPLANTATION

273

reported with one and two antigen mismatches can be overcome and results in an identical overall and disease-free survival of recipients of HLA-matched and HLA-mismatched grafts. Acknowledgement

We thank the staff of the BMT unit for providing outstanding care of our patients and the medical technicians for their excellent work in the BMT laboratory.

References 1. Thomas E, Storb R, Clift RA, Fefer A, Johnson FL, Neiman PE, Lerner KG, Glucksberg H, Buckner CD. Bone marrow transplantation (first of two parts). N Engl J Med. 1975 Apr 17;292(16):832-43. 2. Goldman JM, Apperley JF, Jones L, Marcus R, Goolden AW, Batchelor R, Hale G, Waldmann H, Reid CD, Hows J. Bone marrow transplantation for patients with chronic myeloid leukemia. N Engl J Med. 1986 Jan 23;314(4):202-7. 3. Beatty PG, Clift RA, Mickelson EM, Nisperos BB, Flournoy N, Martin PJ, Sanders JE, Stewart P, Buckner CD, Storb R. Marrow transplantation from related donors other than HLA-identical siblings. N Engl J Med. 1985 Sep 26;313(13):765-71. 4. Ringden O, Remberger M, Carlens S, Hagglund H, Mattsson J, Aschan J, Lonnqvist B, Klaesson S, Winiarski J, Dalianis T, Olerup O, Sparrelid E, Elmhorn-Rosenborg A, Svahn BM, Ljungman P. Low incidence of acute graft-versus-host disease, using unrelated HLA-A-, HLA-B-, and HLA-DR-compatible donors and conditioning, including anti-T-cell antibodies. Transplantation. 1998 Sep 15;66(5):620-5. 5. Petersdorf EW, Anasetti C, Martin PJ, Hansen JA. Tissue typing in support of unrelated hematopoietic cell transplantation. Tissue Antigens. 2003 Jan;61(1):1-11. 6. Sierra J, Storer B, Hansen JA, Bjerke JW, Martin PJ, Petersdorf EW, Appelbaum FR, Bryant E, Chauncey TR, Sale G, Sanders JE, Storb R, Sullivan KM, Anasetti C. Transplantation of marrow cells from unrelated donors for treatment of high-risk acute leukemia: the effect of leukemic burden, donor HLA-matching, and marrow cell dose. Blood. 1997 Jun 1;89(11):4226-35. 7. Zander AR, Zabelina T, Kröger N, Renges H, Krüger W, Löliger C, Dürken M, Stockschläder M, de Wit M, Wacker-Bakchaus G, Bielack S, Jaburg N, Rüssmann B, Erttmann R, Kabisch H. Use of a five-agent GvHD prevention regimen in recipients of unrelated donor marrow. Bone Marrow Transplantation, 1999, 23, 889-893. 8. Finke J, Bertz H, Schmoor C, Veelken H, Behringer D, Wasch R, Kunzmann R, Heidecker L, Lang H, Meyer-Konig U, Mertelsmann R. Allogeneic bone marrow transplantation from unrelated donors using in vivo anti-T-cell globulin. Br J Haematol. 2000;111(1):303-313. 9. Zander AR, Kröger N, Schleuning M, Finke J, Zabelina T, Beelen D, Schwerdtfeger R, Baurmann H, Bornhäuser M, Ehninger G, Fauser AA, Kiehl M, Trenschel R, Ottinger HD, Bertz H, Berger J, Kolb H-J, Schaefer UW. Chronic Myeloid Leukaemia. ATG as a part of the conditioning regimen reduces transplant-related mortality (TRM) and improves overall

274

10.

11.

12.

13.

14.

15.

16.

17.

18.

19. 20.

A.R. ZANDER ET AL.

survival after unrelated stem cell transplantation in patients with chronic myelogenous leukemia (CML). Bone Marrow Transplantation, 2003, 32, 355-361. Helmberg W, Lanzer G, Zahn R, Weinmayr B, Wagner T, Albert E. Virtual DNA analysis – a new tool for combination and standardised evaluation of SSO, SSP and sequencing-based typing results. Tissue Antigens. 1998 June; 51 (6): 587-92. Marsh SG, Albert ED, Bodmer WF, Bontrop RE, Dupont B, Erlich HA, Geraghty DE, Hansen JA, Mach B, Mayr WR, Parham P, Petersdorf EW, Sasazuki T, Schreuder GM, Strominger JL, Svejgaard A, Terasaki PI. Nomenclature for factors of the HLA system, 2002. Tissue Antigens. 2002 Nov; 60 (5): 407-64. Robinson J, Walter MJ, Parham P, de Groot N, Bontrop R, Kennedy LJ, Stoehr P, Marsh SGE. IMGT/HLA and IMGT/MHC: sequence database for the study of the major histocompatibility complex. Nucleic Acids Research. 2003, 31:311-314. Glucksberg H, Storb R, Fefer A, Buckner CD, Neiman PE, Clift RA, Lerner KG, Thomas ED. Clinical manifestations of graft-versus-host disease in human recipients of marrow from HL-A-matched sibling donors. Transplantation. 1974;18(4):295-304. Shulman HM, Sullivan KM, Weiden PL, McDonald GB, Striker GE, Sale GE, Hackman R, Tsoi MS, Storb R, Thomas ED. Chronic graft-versus-host syndrome in man. A long-term clinicopathologic study of 20 Seattle patients. Am J Med. 1980;69(2):204-17. Petersdorf EW, Gooley TA, Anasetti C, Martin PJ, Smith AG, Mickelson EM, Woolfrey AE, Hansen JA. Optimizing outcome after unrelated marrow transplantation by comprehensive matching of HLA class I and II alleles in the donor and recipient. Blood. 1998 Nov 15;92(10):3515-20. Gajewski J, Gjertson D, Cecka M et al. The impact of T-cell depletion on the effects of HLADRB1 and DQB allele matching in HLA serologically identical unrelated donor bone marrow transplantation. Biol. Blood Marrow Transplant 1997; 3: 76-82 Przepiorka D, Petropoulos D, Mullen C et al. Tacrolismus for prevention of graft-versus-hostdisease after mismatched unrelated donor cord blood transplantation. Bone Marrow Transplantation 1999; 23: 1291-1295 Przepiorka D, Saliba R, Cleary K et al. Tacrolismus does not abrogate the increased risk of acute graft-versus-host disease after unrelated donor marrow transplantation with allelic mismatching at HLA-DRB1 and HLA-DQB1. Biol. Blood Marrow Transplant 2000; 6: 190197. Flomenberg N, Baxter-Lowe LA, Confer D et al. Impact of HLA-class I and class II high resolution matching on outcomes of unrelated donor BMT. Blood 2001; 98: 813 (Abstract). Petersdorf EW, Kollman C, Hurley CK, Dupont B, Nademanee A, Begovich AB, Weisdorf D, McGlave P. Effect of HLA class II gene disparity on clinical outcome in unrelated donor hematopoietic cell transplantation for chronic myeloid leukemia: the US National Marrow Donor Program Experience. Blood. 2001 Nov 15;98(10):2922-9.