SUMO Protocols
Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshir...
86 downloads
1341 Views
4MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
SUMO Protocols
Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK
For other titles published in this series, go to www.springer.com/series/7651
METHODS
IN
MOLECULAR BIOLOGY™
SUMO Protocols
Edited by
Helle D. Ulrich Cancer Research UK, London Research Institute, Clare Hall Laboratories, Blanche Lane, South Mimms Hertfordshire, United Kingdom
Editor Helle D. Ulrich Cancer Research UK London Research Institute Clare Hall Laboratories Blanche Lane South Mimms EN6 3LD Herts United Kingdom
ISBN: 978-1-934115-80-0 e-ISBN: 978-1-59745-566-4 ISSN: 1064-3745 e-ISSN: 1940-6029 DOI: 10.1007/978-1-59745-566-4 Library of Congress Control Number: 2008931471 © Humana Press 2009, a part of Springer Science+Business Media, LLC All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science + Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Cover illustration: Chapter 8, Figure 1: The SBMs of RanBP2 and PIAS-X-P bind SUMO-1 in opposite orientations. Printed on acid-free paper springer.com
Preface Post-translational protein modifications by members of the ubiquitin family are widely recognized as important regulatory control systems for a variety of biological pathways. Their influence on eukaryotic cellular metabolism is comparable to that of other modifications such as phosphorylation, acetylation and methylation. The small ubiquitin-related modifier SUMO uses a conjugation and de-conjugation system closely related to that of ubiquitin itself; yet, the functions of the SUMO system are highly diverse and largely independent of the ubiquitin system. SUMO modification controls the activity of transcription factors and can influence protein stability, but it also contributes to nucleo-cytoplasmic transport, chromosome segregation and DNA damage repair. As a consequence, the SUMO system pervades virtually all areas of basic molecular and cell biology, and scientists from different backgrounds, including medical researchers, are likely to encounter SUMO in the course of their studies. This volume, SUMO Protocols, therefore aims at presenting a collection of methods relevant to SUMO research in order to make these tools available to biochemists, molecular and cell biologists as well as research-oriented clinicians not yet familiar with the system. In contrast to the ubiquitin system, which has been the subject of several reviews and methods collections, no practical compendium entirely devoted to SUMO has been published. Although some of the protocols described here are related to analogous techniques pertaining to the ubiquitin system, SUMO Protocols is intended to highlight important features unique to the biochemistry of SUMO, necessitating a distinction from other ubiquitin-like modifiers. For example, conjugation and de-conjugation assays require different components, and some technology, such as the identification of target proteins by mass spectrometry, is more difficult with SUMO than with ubiquitin due to the structure and sequence of the modifier. On the other hand, the preparation of sumoylated substrates in vitro or even in bacterial systems is generally more straightforward than in the case of ubiquitin. This volume presents a collection of methods for the in vivo and in vitro manipulation of the SUMO system. Part I provides an introduction to the SUMO system for researchers new to the field, giving an overview of the most important components and regulatory concepts (Chap. 1). Part II describes several approaches for the identification and verification of SUMO substrates. Whereas Chaps. 2 and 3 review different mass spectrometrybased techniques for the isolation and identification of target proteins from total cell extracts, Chap. 4 presents an orthogonal approach based on the use of in vitro translated protein libraries and in vitro sumoylation reactions. This is followed by two chapters describing strategies that facilitate the detection of specific SUMO targets in vivo: Chap. 5 details a method to enhance native sumoylation by fusion of candidate substrates to the SUMO-conjugating enzyme Ubc9, and Chap. 6 gives a step-by-step account of isolating SUMO targets by affinity chromatography under denaturing conditions, a method that is often applied in conjunction with mass spectrometry, but is also useful for the verification and characterization of specific target proteins. Part III is devoted to the downstream effectors of the SUMO pathway, i.e. factors that interact with sumoylated target proteins
v
vi
Preface
via SUMO-interacting motifs. Two chapters describe methodology for the identification and characterization of SUMO interactors by means of two-hybrid analysis (Chap. 7) and NMR (Chap. 8). The functional consequences of SUMO modification are too manifold to be thoroughly covered in a protocols collection. After all, they will most likely be unique to the SUMO target in question and therefore require specialized methodology. Nevertheless, Part IV of this volume covers two generally applicable strategies useful for the functional analysis of sumoylation in vivo. Chap. 9 uses linear fusions of SUMO to a given target protein in order to mimic its sumoylation. Although it is presented in the context of transcriptional repression, thus reflecting the predominant influence of the SUMO system on this area of cell biology, the approach can easily be adapted to the study of other SUMO targets. Chap. 10 describes a tool to mimic reversible, ligand-induced sumoylation that allows an assessment of the consequences of the modification for a given target protein by comparing its properties in the modified and un-modified state. The second half of the book brings together essential methods for the study and manipulation of the enzymatic components of the SUMO system. Part V comprises methodology for the purification and kinetic characterization of the SUMO conjugation enzymes (Chaps. 11 and 12) as well as the preparation of quantitatively sumoylated proteins for biochemical analysis in vitro (Chap. 13) and in a bacterial expression system (Chap. 14). The reverse reaction, de-conjugation by dedicated SUMO-specific proteases, is covered in Part VI, which presents a protocol for the preparation and purification of the relevant enzymes (Chap. 15) and a range of alternative approaches for the kinetic analysis of de-conjugation (Chaps. 15–18), applicable to endogenous as well as synthetic test substrates and SUMO precursors and using detection systems based on gel mobility, fluorescence resonance energy transfer (FRET) and an enzymatic reporter system. Finally, Part VII reviews two strategies of how the SUMO system can be manipulated and exploited experimentally. Chap. 19 describes the viral protein Gam1 and its uses as an inhibitor of the SUMO conjugation machinery, and the application of SUMO as a tool to enhance the efficiency of recombinant protein production is detailed in Chap. 20. I am grateful to the authors who have contributed their expertise to make this book possible. I thank John Walker, the series editor, for his advice, and the colleagues at Humana Press for producing this book.
Helle D. Ulrich
Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
v ix
PART I: INTRODUCTION 1.
The SUMO System: An Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Helle D. Ulrich
3
PART II: IDENTIFICATION OF SUMO TARGETS 2.
3.
4.
5.
6.
Identification of SUMO Target Proteins by Quantitative Proteomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jens S. Andersen, Ivan Matic, and Alfred C.O. Vertegaal Identification of SUMO-Conjugated Proteins and their SUMO Attachment Sites Using Proteomic Mass Spectrometry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . James A. Wohlschlegel Identification of SUMO Targets Through In Vitro Expression Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Christian B. Gocke and Hongtao Yu Enhanced Detection of In Vivo SUMO Conjugation by Ubc9 Fusion-Dependent Sumoylation (UFDS). . . . . . . . . . . . . . . . . . . . . . . . Rainer Niedenthal In Vivo Detection and Characterization of Sumoylation Targets in Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . . . . . Helle D. Ulrich and Adelina A. Davies
19
33
51
63
81
PART III: IDENTIFICATION OF SUMO INTERACTORS 7.
8.
Identification of SUMO-Interacting Proteins by Yeast Two-Hybrid Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107 Mary B. Kroetz and Mark Hochstrasser Identification of SUMO-Binding Motifs by NMR . . . . . . . . . . . . . . . . . . . . . . . . 121 Candace S. Seu and Yuan Chen
PART IV: FUNCTIONAL ANALYSIS OF SUMOYLATION IN VIVO 9.
Regulation of Transcription Factor Activity by SUMO Modification . . . . . . . . . . 141 Jian Ouyang, Alvaro Valin, and Grace Gill 10. Characterization of the Effects and Functions of Sumoylation Through Rapamycin-Mediated Heterodimerization. . . . . . . . . . . 153 Shanshan Zhu and Michael J. Matunis
vii
viii
Contents
PART V: BIOCHEMICAL STUDIES OF SUMO CONJUGATION 11. Purification of SUMO Conjugating Enzymes and Kinetic Analysis of Substrate Conjugation . . . . . . . . . . . . . . . . . . . . . . . . . . . Ali A. Yunus and Christopher D. Lima 12. Performing In Vitro Sumoylation Reactions Using Recombinant Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andreas Werner, Marie-Christine Moutty, Ulrike Möller, and Frauke Melchior 13. Preparation of Sumoylated Substrates for Biochemical Analysis . . . . . . . . . . . . . Puck Knipscheer, Helene Klug, Titia K. Sixma, and Andrea Pichler 14. Strategies for the Expression of SUMO-Modified Target Proteins in Escherichia coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hisato Saitoh, Junsuke Uwada, and Azusa Kawasaki
167
187
201
211
PART VI: BIOCHEMICAL STUDIES OF SUMO DECONJUGATION 15. Preparation of SUMO Proteases and Kinetic Analysis Using Endogenous Substrates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . David Reverter and Christopher D. Lima 16. An In Vitro FRET-Based Assay for the Analysis of SUMO Conjugation and Isopeptidase Cleavage. . . . . . . . . . . . . . . . . . . . . . . Nicolas Stankovic-Valentin, Lukasz Kozaczkiewicz, Katja Curth, and Frauke Melchior 17. FRET-Based In Vitro Assays for the Analysis of SUMO Protease Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael H. Tatham and Ronald T. Hay 18. Detection and Characterization of SUMO Protease Activity Using a Sensitive Enzyme-Based Reporter Assay . . . . . . . . . . . . . . . . . . Craig A. Leach, Xufan Tian, Michael R. Mattern, and Benjamin Nicholson
225
241
253
269
PART VII: MANIPULATION AND ALTERNATIVE USES OF THE SUMO SYSTEM 19. Inhibition of the SUMO Pathway by Gam1. . . . . . . . . . . . . . . . . . . . . . . . . . . . Mariaelena Pozzebon, Chiara V. Segré, and Susanna Chiocca 20. SUMO Fusion Technology for Enhanced Protein Production in Prokaryotic and Eukaryotic Expression Systems. . . . . . . . . . . . . . Tadas Panavas, Carsten Sanders, and Tauseef R. Butt Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
285
303 319
Contributors JENS S. ANDERSEN • Center for Experimental Bioinformatics (CEBI), Department of Biochemistry and Molecular Biology, University of Southern Denmark, Odense, Denmark TAUSEEF BUTT • LifeSensors Inc., Malvern, PA, USA YUAN CHEN • Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, CA, USA SUSANNA CHIOCCA • Department of Experimental Oncology, European Institute of Oncology, Milan, Italy KATJA CURTH • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany ADELINA A. DAVIES • Cancer Research UK London Research Institute, Clare Hall Laboratories, South Mimms, United Kingdom GRACE GILL • Department of Anatomy and Cellular Biology, Tufts University School of Medicine, Boston, MA, USA CHRISTIAN B. GOCKE • Department of Pharmacology, The University of Texas Southwestern Medical Center, Dallas, TX, USA RONALD T. HAY • Wellcome Trust Centre for Gene Regulation and Expression, College of Life Sciences, University of Dundee, United Kingdom MARK HOCHSTRASSER • Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT, USA AZUSA KAWASAKI • Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kumamoto, Japan HELENE KLUG • Max F. Perutz Laboratories, Medical University of Vienna, Austria PUCK KNIPSCHEER • Department of Biological Chemisty and Molecular Pharmacology, Harvard Medical School, Boston, MA, USA LUKASZ KOZACZKIEWICZ • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany MARY B. KROETZ • Department of Cell Biology, Yale University, New Haven, CT, USA CRAIG A. LEACH, Progenra Inc., Malvern, PA, USA CHRISTOPHER D. LIMA • Structural Biology Program, Sloan-Kettering Institute, New York, NY, USA IVAN MATIC • Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, Martinsried, Germany MICHAEL R. MATTERN • Progenra Inc., Malvern, PA, USA MICHAEL J. MATUNIS • Department of Biochemistry and Molecular Biology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD, USA FRAUKE MELCHIOR • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany ULRIKE MÖLLER • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany MARIE-CHRISTINE MOUTTY • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany BENJAMIN NICHOLSON • Progenra Inc., Malvern, PA, USA RAINER NIEDENTHAL • Institute of Biochemistry/Physiological Chemistry, Medical School Hannover, Germany
ix
x
Contributors
JIAN OUYANG • Department of Anatomy and Cellular Biology, Tufts University School of Medicine, Boston, MA, USA TADAS PANAVAS • LifeSensors Inc., Malvern, PA, USA MARIAELENA POZZEBON • FIRC Institute of Molecular Oncology, European Institute of Oncology (IFOM-IEO), Milan, Italy DAVID REVERTER • Institut de Biotecnologia i de Biomedicina. Universitat Autonoma de Barcelona, Barcelona, Spain HISATO SAITOH • Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kumamoto, Japan CARSTEN SANDERS • LifeSensors Inc., Malvern, PA, USA CHIARA V. SEGRE • FIRC Institute of Molecular Oncology, European Institute of Oncology (IFOM-IEO), Milan, Italy CANDACE S. SEU • Department of Chemistry and Biochemistry, University of California, San Diego, CA, USA TITIA K. SIXMA • The Netherlands Cancer Institute and Center for Biomedical Genetics, Amsterdam, The Netherlands NICOLAS STANKOVIC-VALENTIN • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany MICHAEL H. TATHAM • Wellcome Trust Centre for Gene Regulation and Expression, College of Life Sciences, University of Dundee, United Kingdom XUFAN TIAN • Progenra Inc., Malvern, PA, USA HELLE D. ULRICH • Cancer Research UK London Research Institute, Clare Hall Laboratories, South Mimms, United Kingdom JUNSUKE UWADA • Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kumamoto, Japan ALVARO VALIN • Department of Anatomy and Cellular Biology, Tufts University School of Medicine, Boston, MA, USA ALFRED C.O. VERTEGAAL • Department of Molecular Cell Biology, Leiden University Medical Center, Leiden, The Netherlands ANDREAS WERNER • Department of Biochemistry I, Faculty of Medicine, Georg-August University of Göttingen, Germany JAMES A. WOHLSCHLEGEL • Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, CA, USA HONGTAO YU • Department of Pharmacology, The University of Texas Southwestern Medical Center, Dallas, TX, USA ALI A. YUNUS • Structural Biology Program, Sloan-Kettering Institute, New York, NY, USA SHANSHAN ZHU • Department of Biochemistry and Molecular Biology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD, USA
Chapter 1 The SUMO System: An Overview Helle D. Ulrich Abstract Post-translational modification by SUMO is now recognized as an important regulatory method employed by the cell to reversibly modulate the activity, stability, or localization of intracellular proteins. A dedicated enzymatic machinery is involved in the processing, attachment, and removal of the modifier with high selectivity. SUMO modification generally alters the properties of the modified target by influencing—either positively or negatively—its interactions with other cellular factors. As a consequence, the SUMO system contributes to the regulation of numerous biological pathways, ranging from nucleocytoplasmic transport to the repression of transcriptional activity and the maintenance of genome stability by its influence on DNA recombination and repair. This chapter gives a brief overview over the enzymes of the SUMO system, its regulation, and its functions. Key words: SUMO, SUMO-activating enzyme (E1), SUMO-conjugating enzyme (E2), SUMO ligase (E3), SUMO-specific isopeptidase (SENP), SUMO interaction motif (SIM), SUMO-binding motif (SBM).
1. Introduction The small ubiquitin-like modifier SUMO belongs to a family of structurally related proteins, of which ubiquitin is the most prominent member (1,2). These proteins operate according to a common principle, which involves their covalent attachment to other cellular factors. A dedicated enzymatic machinery is used to afford conjugation of the modifier by its conserved carboxy (C)terminal glycine residue to an amino group, usually of an internal lysine residue, on the target. In this way, ubiquitin-like proteins change the properties or interactions of the modified substrate and elicit a downstream response, often by the recognition of the modifier through specific interaction domains of an effector protein. Conjugation requires energy and is readily reversible, and an
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
3
4
Ulrich
ensemble of specialized enzymes conveys selectivity and dynamic regulation to both the forward and the reverse reactions. In this way, modification by the members of the ubiquitin family can be compared to any other post-translational protein modification, such as phosphorylation or acetylation. The functional implications of the modification are similarly manifold and complex. The biological functions of the SUMO system have been the subject of many excellent reviews (1–4). This chapter will only provide a brief overview of the SUMO pathway. Its intention is to give an account of the enzymes involved in SUMO conjugation and deconjugation, highlight the concepts of how sumoylation can affect its target proteins, and point out possible mechanisms of how the process is regulated in vivo. For further information, the reader will be referred to appropriate review articles that discuss each aspect of the SUMO system individually and in greater detail. Hence, this introductory chapter should serve as a starting point for an exploration of the SUMO system, providing a background for the more practical aspects of manipulating the pathway that will be discussed in the following chapters.
2. SUMO Isoforms SUMO has been identified in a variety of different contexts and has consequently received many alternative names, such as sentrin, Ubl1, Pic1, Gmp1, and Smt3 (3). Like ubiquitin, SUMO is produced as an immature precursor protein with a C-terminal appendage that needs to be processed in order to expose the mature C-terminal di-glycine motif for conjugation. Despite its overall structural similarity to ubiquitin, however, sequence and surface properties of SUMO are quite distinct, and the protein bears an unstructured amino (N)-terminal extension that is not shared by other ubiquitin-related modifiers. In addition, higher eukaryotes harbor several paralogs of SUMO, which differ significantly in sequence (Fig. 1.1). Whereas yeast cells express only one form of SUMO, encoded by the SMT3 gene, mammalian cells encode four isoforms, SUMO-1, -2, -3, and -4 (see Table 1.1). A unique proline residue at position 90 prevents the processing of SUMO-4, which makes it unlikely that the protein
Fig. 1.1. Sequence alignment of yeast and mammalian SUMO paralogs. Sumoylation consensus sequences in the N termini of Smt3, SUMO-2, and SUMO-3, involved in poly-SUMO chain formation, and proline 90, which prevents processing in SUMO-4, are highlighted in bold. The cleavable C-terminal extensions of Smt3 and SUMO-1, -2, and -3 are indicated in italics.
The SUMO System – An Overview
5
Table 1.1 Components of the SUMO pathway in mammals and yeasts
Modifier
Mammals
S. cerevisiae
S. pombe
SUMO-1
Smt3
Pmt3
SUMO-2 SUMO-3 [SUMO-4]a Activating enzyme (E1)
Sae1 (Aos1)/Sae2 (Uba2)
Aos1/Uba2
Rad31/Fub2
Conjugating enzyme (E2)
Ubc9
Ubc9
Hus5
Ligase (E3)—SP-RING:
PIAS1
Siz1 (Ull1)
Pli1
PIAS3
Siz2 (Nfi1)
Nse2
PIASxα (ARIP3)
Mms21
PIASxβ (Miz1)
Zip3
PIASy Mms21 (Nse2) Ligase (E3)—Others:
RanBP2 (Nup358) Pc2b HDAC4b RSUMEc
Protease (SENP)
SENP1 (SuPr-2)
Ulp1 (Nib1)
Ulp1
SENP2 (AXAM2, SMT3IP2)
Ulp2 (Smt4)
Ulp2
SENP3 (SSP3, SMT3IP1) SENP5 SENP6 (SUSP1, SSP1) SENP7 Alternative names of individual enzymes are given in parentheses. a This SUMO isoform does not appear to be conjugated in vivo. b These factors act as substrate-selective enhancers of sumoylation, although their categorization as classical E3 enzymes is still a matter of debate. c This factor acts as a general enhancer of SUMO conjugation and stimulates the modification of selected model substrates in vitro, but substrate-specific E3 activity remains to be confirmed.
is ever conjugated in vivo (5). Its biological relevance is still a matter of debate, but it may fulfill a specialized function by means of noncovalent interactions. SUMO-2 and -3 are nearly identical in sequence and appear to act in a redundant fashion, but they differ significantly from SUMO-1, sharing only 50% sequence identity. Functional differences between SUMO-1 and SUMO-2
6
Ulrich
or -3 are implicated by their respective intracellular distributions, distinct changes in expression and conjugation patterns in the cellular stress response, and differences in their interactions with downstream effector proteins and SUMO-specific isopeptidases (6,7). For the purpose of this volume, SUMO will therefore serve as a general term applicable to all mammalian isoforms as well as the yeast protein, and individual forms will only be specified where necessary. Like ubiquitin, SUMO can form polymeric chains in vitro and in vivo (8). In mammals, this is primarily due to SUMO-2 and -3, which—like yeast Smt3—bear sumoylation consensus motifs in their N-terminal extensions (see below). Despite the fact that poly-SUMO chains are detectable in yeast and mammals (9–12), their biological function remains unclear. In yeast, they may contribute to the structural integrity of the synaptonemal complex during meiosis (13).
3. SUMO Conjugation, Processing, and Deconjugation
In analogy to the ubiquitin system, attachment of SUMO to a target protein is mediated by a cascade of enzymes responsible for energy-dependent activation, transfer, and substrate-selective conjugation of the modifier (Fig. 1.2). In contrast, removal of SUMO is accomplished in a single step that does not require energy. Yet, the diversity of the SUMO-specific proteases is comparable to that of the ligases, suggesting similar levels of complexity in the regulation of SUMO conjugation and deconjugation.
3.1. SUMO-Activating Enzyme (E1)
The SUMO-activating enzyme (E1) functions mechanistically similar to the ubiquitin-specific E1, and the two proteins are related in structure and sequence (14,15). SUMO E1 is a heterodimer; its subunits Aos1 (also called Sae1) and Uba2 (also called Sae2) resemble the N- and C-terminal halves of the ubiquitin-specific E1, Uba1. Uba2 carries a conserved active-site cysteine essential for catalysis. SUMO is activated by E1 in a three-step reaction: in the first step, a SUMO-adenylate intermediate is formed by attack of the C-terminal carboxylate of SUMO on ATP and release of pyrophosphate. In the second step, AMP is released as the SUMO C terminus is transferred to the catalytic cysteine of Uba2, forming a high-energy thioester intermediate. Finally, the SUMO thioester is transferred to the SUMO-conjugating enzyme.
3.2. SUMOConjugating Enzyme (E2)
In contrast to the ubiquitin system, a single, essential conjugating enzyme Ubc9 is responsible for all SUMO conjugations in eukaryotic cells (16). The structure and sequence of Ubc9 is closely related to that of the ubiquitin-specific E2s (17), and like
The SUMO System – An Overview
7
Fig. 1.2. The SUMO pathway of processing, conjugation, and deconjugation. SUMO is depicted as a grey lollipop symbol. The high-energy thioester bond between the mature C terminus of SUMO and the E1 (Aos1/Uba2) or E2 (Ubc9) enzyme is represented by a wavy line (∼).
these it bears a conserved cysteine residue in its active site that receives the modifier as a thioester from the E1. Attack of the ε-amino group of a substrate lysine residue then results in the formation of an isopeptide linkage between the C terminus of SUMO and the target protein. In vitro, this reaction often proceeds with significant specificity in the absence of a ligase, because in contrast to most ubiquitin-specific E2s Ubc9 often directly participates in substrate recognition. Ubc9 recognizes and modifies a consensus sequence motif, ΨKX(E/D) (where Ψ represents a bulky aliphatic residue, usually isoleucine, leucine, or valine, and X represents any amino acid), specifically when this motif is present in an unstructured region or a loop (18,19). The consensus sequence is found in many physiological SUMO targets as well as the N-terminal extensions of SUMO-2/3 and yeast Smt3, where it is used for the formation of poly-SUMO chains. In some SUMO targets, this motif is extended by a serine residue, whose phosphorylation enhances sumoylation (ΨKXEXXpSP), or a series of negatively charged residues (20,21). However, it is important to note that not all physiological SUMO acceptor sites adhere to this consensus. In fact, even in cases where a primary acceptor lysine can be identified, mutation of this site may result
8
Ulrich
in modification at other lysines that are not normally used for conjugation. This effect must be considered when trying to identify sumoylation sites by means of site-directed mutagenesis. 3.3. SUMO Ligases (E3)
SUMO ligases (E3s) fall into several classes (see Table 1.1). Most of the E3s known today harbor a RING finger-like domain, a so-called SP-RING motif (22). Like the RING finger in ubiquitinspecific E3s, this domain is required for ligase activity, although it does not appear to contribute any catalytic residues important for SUMO transfer. It is more likely to act as a binding platform that coordinates the contact between the E2 and the substrate. Among the SP-RING proteins, the PIAS (protein inhibitor of activated STAT) family is most prominent, comprising five distinct forms in mammals, some of them generated by alternative splicing: PIAS1, PIAS3, PIASxα, PIASxβ, and PIASy (23,24). S. cerevisiae encodes two PIAS proteins: Siz1 (also called Ull1) and Siz2 (also called Nfi1) (25). Additional SP-RING E3s are budding yeast Zip3, which functions during meiosis (13), and Mms21 (also called Nse2), a component of the chromatin-associated Smc5–Smc6 complex conserved from yeast to mammals (26–28). Generally, the SP-RING E3s appear to convey substrate selectivity to the SUMO conjugation reaction; however, there is evidence for functional overlap between different PIAS proteins (9), and in vitro sumoylation reactions often tend to be somewhat promiscuous with respect to the ligase. The SUMO ligase RanBP2 does not resemble any ubiquitin-specific enzyme or in fact any other SUMO E3 (29). A short, largely unstructured domain of RanBP2 is able to catalyze sumoylation by folding around the E2 and positioning the SUMO thioester on the Ubc9 surface in a conformation favorable for attack by a substrate lysine (30). In this way, RanBP2 promotes SUMO conjugation in a substrate-independent manner. A nonspecific stimulation of the sumoylation reaction has also been reported in the case of RSUME, a small protein capable of enhancing Ubc9–SUMO interaction and thioester formation (31). Another category of SUMO E3s is represented by the polycomb group protein Pc2, which promotes the sumoylation of the transcriptional corepressor CtBP in vivo and in vitro (32). However, its stimulating activity on sumoylation in vitro is modest, and other ligases can also enhance CtBP modification. Hence, it remains unclear whether Pc2 can be considered a genuine SUMO E3 or rather an ancillary factor that promotes sumoylation of CtBP indirectly by stabilizing the target or promoting protein–protein interactions (33). Similarly, the histone deacetylase HDAC4, itself a sumoylation target, was shown to stimulate SUMO conjugation in some contexts, but again, it remains to be determined whether this activity fits the criteria of an E3 (34).
The SUMO System – An Overview
3.4. SUMO-Specific Proteases (SENPs)
4. Biological Functions of Sumoylation
9
Cleavage at the C terminus of SUMO serves two distinct purposes (Fig. 1.2): on one hand, the SUMO precursors need to be converted to mature SUMO by removal of the C-terminal extension; this obviously requires the cleavage of a linear peptide bond, which is also called C-terminal hydrolase activity. On the other hand, removal of SUMO from target proteins or the processing of poly-SUMO chains, i.e., the reversal of the conjugation reaction, requires the cleavage of an isopeptide bond, or isopeptidase activity. A single class of enzymes that is responsible for both types of activities (see Table 1.1) has been identified. In humans, there are six so-called “sentrin-specific proteases” (SENPs): SENP1-3 and SENP5-7 (6,35). The proteins exhibit distinct preferences in terms of their activities not only towards SUMO maturation versus deconjugation but also with respect to the different SUMO isoforms. Their intracellular localizations indicate nonoverlapping functions, and the consequences of deleting or silencing individual SENPs suggest that their contributions to the dynamic regulation of sumoylation may be at least as important as those of the E3s. In S. cerevisiae, the two SENPs Ulp1 and Ulp2 (also called Smt4) are also distinct in terms of their localization and function (36,37). Ulp1 is solely responsible for precursor cleavage and localizes to the nuclear pores. A ulp1∆ deletion is inviable and cannot fully be rescued by concomitant expression of the mature form of SMT3, indicating that a lack of precursor processing is not primarily responsible for the phenotype. Ulp2 localizes to the nucleus and is nonessential. Thus, the two isopeptidases appear to process distinct sets of substrates and cannot compensate for each other.
The SUMO system plays an essential role in most organisms. Deletion of mutants of either the modifier or the E1 or E2 is inviable in budding yeast and shows severe growth defects in fission yeast, and deletion of Ubc9 in mice causes early embryonic lethality (14,38–41). Yet, it is still unclear whether there is one single essential function of SUMO, and no common theme can be ascribed to the effects that the modifier exerts on its target proteins. Similar to other post-translational modifications, such as phosphorylation, the SUMO system is involved in the regulation of a variety of distinct biological pathways that have been the subject of several excellent reviews (42–48). Despite this functional variety, however, a few general concepts are beginning to emerge for the mechanism of action of the SUMO system. It has become apparent that SUMO most often acts by modulating the
10
Ulrich
interactions of its target proteins with other cellular factors. In many cases the SUMO moiety will provide an additional binding site for another protein, thus causing the recruitment of a downstream effector (see below) or the targeting of the substrate to a specific location within the cell (44,49). Alternatively, SUMO may prevent protein–protein interactions by blocking interaction sites. A sumoylation-induced conformational change by means of an intramolecular interaction with the SUMO moiety has also been reported (50). Finally, it is possible that sumoylation may interfere with other post-translational modifications, such as ubiquitylation on the same lysine or phosphorylation at a nearby site (45). As a consequence, SUMO modification can affect the intracellular localization of a target protein, its enzymatic activity, its stability, or its interactions with other proteins or DNA. Two aspects of SUMO function that have been studied in particular detail are briefly discussed below. 4.1. SUMO and the Regulation of Transcription
In mammalian cells, a regulatory effect on gene expression is perhaps the best-studied area of SUMO function, as many of the sumoylation targets identified in this system have turned out to be transcription factors. In many, but not all cases, sumoylation causes a repression of transcription, resulting in hyperactivation of transcription upon mutation of the sumoylation sites in the target proteins (42,51). In fact, a linear fusion of SUMO to the Gal4 DNA-binding domain was shown to exert a negative effect on transcription, provided that a cognate DNA sequence was present in the promoter region of the reporter gene (52). There are, however, several different mechanisms by which SUMO can repress transcription, apparently dependent on the respective target protein. Some transcription factors were found to be sequestered into nuclear PML bodies upon sumoylation, thus making them unavailable for transcriptional activation. In other cases, sumoylation was shown to recruit histone deacetylases (HDACs), thus causing transcriptional repression via chromatin modifications at the relevant promoters. In addition, sumoylation of HDAC proteins themselves was found to enhance their repressive activity. Likewise, the transcriptional corepressor Daxx, itself a sumoylation target, is recruited by sumoylation of several transcription factors, although the downstream events leading to repression are still unclear (53). Finally, the PIAS proteins themselves, by interaction with sumoylated transcription factors, may play a role in the repression of transcription independent of their E3 activity (23,24).
4.2. SUMO and the Maintenance of Genome Stability
Another area of metabolism that is heavily influenced by the SUMO system is the maintenance of genome stability (43,46,47). This aspect of SUMO function has been studied most extensively in lower eukaryotes. On one hand, the ease
The SUMO System – An Overview
11
of genetic manipulations in the yeast system has allowed the phenotypic analysis of yeast mutants deficient in components of the SUMO pathway, which has revealed the importance of the modifier for protection from genome instability: ubc9ts and mms21 mutants are sensitive to DNA-damaging agents and spontaneously accumulate abnormal recombination intermediates during DNA replication (26–28,54); ulp2 mutants are characterized by DNA damage sensitivity, plasmid loss, and chromosome segregation defects (36); and zip3 mutants exhibit abnormal synaptonemal complex architecture, thus implying a function of SUMO in meiosis (13). On the other hand, global analysis of SUMO conjugates by mass spectrometry (10,55–59) has identified many potential sumoylation targets relevant to DNA metabolism, such as helicases (Sgs1), topoisomerases, and recombination factors (Rad52). In some cases, modification of a particular target protein can be attributed to a specific phenomenon in vivo. For example, sumoylation of topoisomerase II has been linked to the fidelity of chromosome transmission (60–63), sumoylation of Rad52 was shown to regulate recombination events in the ribosomal DNA locus (64), and sumoylation of the replication clamp protein PCNA is known to inhibit the association of the recombination factor Rad51 with replication forks by means of recruiting the antirecombinogenic helicase Srs2 (65,66). More often, however, the relevance of sumoylation for a given target protein remains unclear, and the target proteins responsible for many of the effects of mutants in the SUMO conjugation or deconjugation factors have not been identified.
5. SUMOInteracting Proteins
SUMO has emerged as an interaction partner from numerous two-hybrid screens. In some cases, this has turned out to be due to covalent modification of the bait protein, but noncovalent interactors have likewise been identified, where—in contrast to the covalent situation—binding does not depend on the presence of the C-terminal glycines of SUMO (67). Accordingly, a loose consensus motif, now termed SUMO-binding or SUMOinteracting motif (SBM or SIM), has been identified in many of these noncovalent interaction partners, consisting of a short hydrophobic stretch that is preceeded or followed by acidic and hydrophilic (mostly serine) residues (49). The SBM interacts with SUMO by forming a β-strand that aligns with a β-sheet on the surface of the modifier. Interestingly, there are examples of both parallel and antiparallel orientations. SBMs are found in downstream effector proteins whose recruitment depends
12
Ulrich
on their preferential interaction with a sumoylated target, but also in some SUMO E3s, where the motif is actually required for catalytic activity. Many SUMO-binding proteins, such as Daxx and PML, are at the same time subject to sumoylation themselves, and this often requires an intact SBM. Finally, SBMs can apparently serve to target sumoylated proteins for other post-translational modifications, as exemplified by the identification of a ubiquitin ligase (RNF4 in mammals and a heterodimeric complex of Slx8 with Slx5 or Rfp1 in S. cerevisiae and S. pombe, respectively), which, by means of a series of SBMs, recognizes sumoylated proteins and linear SUMO fusions as ubiquitylation targets (68–71).
6. Regulation of SUMO Modification
Compared to the number of ubiquitin-specific E2s and E3s, the repertoire of the SUMO conjugation machinery is rather limited, raising the question of how substrate selectivity and spatiotemporal regulation are achieved in the SUMO pathway. Intriguingly, most SUMO targets are modified at a very low level at any given time, suggesting dynamic control of sumoylation. In analogy to the ubiquitin system, phosphorylation has emerged as an important means to control SUMO conjugation at the level of individual substrates. As mentioned above, sumoylation of some target proteins, such as the heat-shock factor HSF1, is enhanced by the phosphorylation of its extended sumoylation motif, YKXEXXpSP (20). In contrast, phosphorylation of the NFκB inhibitor IκBα inhibits sumoylation (72). However, control over sumoylation can also be exerted at the level of the conjugation factors. Hence, activation of several kinase-mediated signaling cascades results in changes in the expression levels and activities of PIAS proteins (73,74). At least in the case of Pc2, phosphorylation has been demonstrated to enhance its E3 activity (75). Alternatively, post-translational modifications may regulate the intracellular localization of E3s and thereby promote the modification in a site-selective manner. For example, budding yeast Siz1 resides in the nucleus during most of the cell cycle, but relocalizes to the bud neck in G2/M, where it then sumoylates the septins, which are proteins that contribute to yeast cytokinesis (25). Although there is no direct evidence yet, it is likely that post-translational modifications, such as phosphorylation, regulate this change in Siz1 localization. Regulation of sumoylation can also occur on a global level. A reduction in overall sumoylation is observed
The SUMO System – An Overview
13
upon infection with a chicken adenovirus, due to a virus-encoded protein, Gam1, which induces the loss of E1 and E2 proteins (76). The ensuing derepression of transcriptional activity is believed to promote viral propagation. Oxidative stress results in a loss of SUMO conjugates by means of a reversible oxidative crosslinking and inactivation of the SUMO-conjugating enzymes (77). Other cellular stresses, such as heat shock, cause a global increase in sumoylation (78).
7. Outlook Since the discovery of SUMO a decade ago, a wealth of information has been gathered about the properties and functions of this modifier. Advances in mass spectrometry technology have allowed the identification of hundreds of SUMO targets, and many more will undoubtedly emerge in the future. The mechanism of SUMO conjugation and deconjugation has been studied in detail with a number of representative model substrates, but important questions concerning substrate recognition and selectivity remain unanswered. In vivo analysis will need to be combined with biochemical approaches in order to gain insight into the dynamic regulation of the SUMO system by cellular and extracellular signals. Importantly, much more is to be learned about the ways in which SUMO and, in particular, poly-SUMO chains affect the properties of the modified targets. The identification of additional SUMOinteracting proteins and motifs is expected to reveal important downstream effectors of the SUMO pathway and may help to provide the missing links between individual SUMO substrates and cellular phenotypes associated with defects in SUMO conjugation. As new areas of SUMO function are still being revealed, it is certain that the SUMO pathway will eventually be recognized as an important and flexible regulatory system in most aspects of cellular metabolism.
Acknowledgments I apologize to those researchers whose work could not be cited directly in this review due to space constraints. Work in this laboratory is supported by Cancer Research UK.
14
Ulrich
References 1. Schwartz, D. C. and Hochstrasser, M. (2003) A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem. Sci. 28, 321–328. 2. Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006) Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 22, 159–180. 3. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 4. Geiss-Friedlander, R. and Melchior, F. (2007) Concepts in sumoylation: a decade on. Nat. Rev. Mol. Cell. Biol. 8, 947–956. 5. Owerbach, D., McKay, E. M., Yeh, E. T., Gabbay, K. H., and Bohren, K. M. (2005) A proline-90 residue unique to SUMO-4 prevents maturation and sumoylation. Biochem. Biophys. Res. Commun. 337, 517–520. 6. Mukhopadhyay, D. and Dasso, M. (2007) Modification in reverse: the SUMO proteases. Trends Biochem. Sci. 32, 286–295. 7. Saitoh, H. and Hinchey, J. (2000) Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J. Biol. Chem. 275, 6252–6258. 8. Vertegaal, A. C. (2007) Small ubiquitinrelated modifiers in chains. Biochem. Soc. Trans. 35, 1422–1423. 9. Bylebyl, G. R., Belichenko, I., and Johnson, E. S. (2003) The SUMO isopeptidase Ulp2 prevents accumulation of SUMO chains in yeast. J. Biol. Chem. 278, 44113–44120. 10. Matic, I., van Hagen, M., Schimmel, J., Macek, B., Ogg, S. C., Tatham, M. H., Hay, R. T., Lamond, A. I., Mann, M., and Vertegaal, A. C. (2008) In vivo identification of human small ubiquitin-like modifier polymerization sites by high accuracy mass spectrometry and an in vitro to in vivo strategy. Mol. Cell. Proteomics 7, 132–144. 11. Tatham, M. H., Jaffray, E., Vaughan, O. A., Desterro, J. M., Botting, C. H., Naismith, J. H., and Hay, R. T. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J. Biol. Chem. 276, 35368–35374. 12. Windecker, H. and Ulrich, H. D. (2008) Architecture and assembly of poly-SUMO chains on PCNA in Saccharomyces cerevisiae. J. Mol. Biol. 376, 221–231. 13. Cheng, C. H., Lo, Y. H., Liang, S. S., Ti, S. C., Lin, F. M., Yeh, C. H., Huang, H. Y., and Wang, T. F. (2006) SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae. Genes Dev. 20, 2067–2081.
14. Johnson, E. S., Schwienhorst, I., Dohmen, R. J., and Blobel, G. (1997) The ubiquitinlike protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16, 5509–5519. 15. Lois, L. M. and Lima, C. D. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24, 439–451. 16. Johnson, E. S. and Blobel, G. (1997) Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J. Biol. Chem. 272, 26799–26802. 17. Tong, H., Hateboer, G., Perrakis, A., Bernards, R., and Sixma, T. K. (1997) Crystal structure of murine/human Ubc9 provides insight into the variability of the ubiquitin-conjugating system. J. Biol. Chem. 272, 21381–21387. 18. Bernier-Villamor, V., Sampson, D. A., Matunis, M. J., and Lima, C. D. (2002) Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108, 345–356. 19. Johnson, E. S. and Blobel, G. (1999) Cell cycle-regulated attachment of the ubiquitinrelated protein SUMO to the yeast septins. J. Cell Biol. 147, 981–994. 20. Hietakangas, V., Anckar, J., Blomster, H. A., Fujimoto, M., Palvimo, J. J., Nakai, A., and Sistonen, L. (2006) PDSM, a motif for phosphorylation-dependent SUMO modification. Proc. Natl. Acad. Sci. USA 103, 45–50. 21. Yang, S. H., Galanis, A., Witty, J., and Sharrocks, A. D. (2006) An extended consensus motif enhances the specificity of substrate modification by SUMO. EMBO J. 25, 5083–5093. 22. Hochstrasser, M. (2001) SP-RING for SUMO: new functions bloom for a ubiquitin-like protein. Cell 107, 5–8. 23. Palvimo, J. J. (2007) PIAS proteins as regulators of small ubiquitin-related modifier (SUMO) modifications and transcription. Biochem. Soc. Trans. 35, 1405–1408. 24. Sharrocks, A. D. (2006) PIAS proteins and transcriptional regulation–more than just SUMO E3 ligases? Genes Dev. 20, 754–758. 25. Johnson, E. S. and Gupta, A. A. (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106, 735–744. 26. Andrews, E. A., Palecek, J., Sergeant, J., Taylor, E., Lehmann, A. R., and Watts, F. Z. (2005) Nse2, a component of the Smc5–6 complex, is a SUMO ligase required for the response to DNA damage. Mol. Cell. Biol. 25, 185–196.
The SUMO System – An Overview 27. Potts, P. R. and Yu, H. (2005) Human MMS21/NSE2 is a SUMO ligase required for DNA repair. Mol. Cell. Biol. 25, 7021–7032. 28. Zhao, X. and Blobel, G. (2005) A SUMO ligase is part of a nuclear multiprotein complex that affects DNA repair and chromosomal organization. Proc. Natl. Acad. Sci. USA 102, 4777–4782. 29. Pichler, A., Knipscheer, P., Saitoh, H., Sixma, T. K., and Melchior, F. (2004) The RanBP2 SUMO E3 ligase is neither HECT- nor RINGtype. Nat. Struct. Mol. Biol. 11, 984–991. 30. Reverter, D. and Lima, C. D. (2005) Insights into E3 ligase activity revealed by a SUMO-RanGAP1-Ubc9-Nup358 complex. Nature 435, 687–692. 31. Carbia-Nagashima, A., Gerez, J., Perez-Castro, C., Paez-Pereda, M., Silberstein, S., Stalla, G. K., Holsboer, F., and Arzt, E. (2007) RSUME, a small RWD-containing protein, enhances SUMO conjugation and stabilizes HIF-1alpha during hypoxia. Cell 131, 309–323. 32. Kagey, M. H., Melhuish, T. A., and Wotton, D. (2003) The polycomb protein Pc2 is a SUMO E3. Cell 113, 127–137. 33. Wotton, D. and Merrill, J. C. (2007) Pc2 and SUMOylation. Biochem. Soc. Trans. 35, 1401–1404. 34. Zhao, X., Sternsdorf, T., Bolger, T. A., Evans, R. M., and Yao, T. P. (2005) Regulation of MEF2 by histone deacetylase 4- and SIRT1 deacetylase-mediated lysine modifications. Mol. Cell. Biol. 25, 8456–8464. 35. Hay, R. T. (2007) SUMO-specific proteases: a twist in the tail. Trends Cell Biol. 17, 370–376. 36. Li, S. -J. and Hochstrasser, M. (2000) The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol. Cell. Biol. 20, 2367–2377. 37. Li, S. J. and Hochstrasser, M. (1999) A new protease required for cell-cycle progression in yeast. Nature 398, 246–251. 38. Hayashi, T., Seki, M., Maeda, D., Wang, W., Kawabe, Y., Seki, T., Saitoh, H., Fukagawa, T., Yagi, H., and Enomoto, T. (2002) Ubc9 is essential for viability of higher eukaryotic cells. Exp. Cell Res. 280, 212–221. 39. Nacerddine, K., Lehembre, F., Bhaumik, M., Artus, J., Cohen-Tannoudji, M., Babinet, C., Pandolfi, P. P., and Dejean, A. (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev. Cell 9, 769–779. 40. Seufert, W., Futcher, B., and Jentsch, S. (1995) Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature 373, 78–81.
15
41. Tanaka, K., Nishide, J., Okazaki, K., Kato, H., Niwa, O., Nakagawa, T., Matsuda, H., Kawamukai, M., and Murakami, Y. (1999) Characterization of a fission yeast SUMO-1 homologue, pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol. Cell. Biol. 19, 8660–8672. 42. Girdwood, D. W., Tatham, M. H., and Hay, R. T. (2004) SUMO and transcriptional regulation. Semin. Cell Dev. Biol. 15, 201–210. 43. Muller, S., Ledl, A., and Schmidt, D. (2004) SUMO: a regulator of gene expression and genome integrity. Oncogene 23, 1998–2008. 44. Melchior, F., Schergaut, M., and Pichler, A. (2003) SUMO: ligases, isopeptidases and nuclear pores. Trends Biochem. Sci. 28, 612–618. 45. Ulrich, H. D. (2005) Mutual interactions between the SUMO and ubiquitin systems: a plea of no contest. Trends Cell Biol. 15, 525–532. 46. Seeler, J. S., Bischof, O., Nacerddine, K., and Dejean, A. (2007) SUMO, the three Rs and cancer. Curr. Top. Microbiol. Immunol. 313, 49–71. 47. Watts, F. Z. (2007) The role of SUMO in chromosome segregation. Chromosoma 116, 15–20. 48. Gill, G. (2004) SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes Dev. 18, 2046–2059. 49. Kerscher, O. (2007) SUMO junction-what’s your function? New insights through SUMO-interacting motifs. EMBO Rep. 8, 550–555. 50. Steinacher, R. and Schar, P. (2005) Functionality of human thymine DNA glycosylase requires SUMO-regulated changes in protein conformation. Curr. Biol. 15, 616–623. 51. Gill, G. (2005) Something about SUMO inhibits transcription. Curr. Opin. Genet. Dev. 15, 536–541. 52. Ross, S., Best, J. L., Zon, L. I., and Gill, G. (2002) SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization. Mol. Cell 10, 831–842. 53. Lin, D. Y., Huang, Y. S., Jeng, J. C., Kuo, H. Y., Chang, C. C., Chao, T. T., Ho, C. C., Chen, Y. C., Lin, T. P., Fang, H. I. et al. (2006) Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol. Cell 24, 341–354. 54. Branzei, D. and Foiani, M. (2005) The DNA damage response during DNA replication. Curr. Opin. Cell Biol. 17, 568–575.
16
Ulrich
55. Denison, C., Rudner, A. D., Gerber, S. A., Bakalarski, C. E., Moazed, D., and Gygi, S. P. (2005) A proteomic strategy for gaining insights into protein sumoylation in yeast. Mol. Cell. Proteomics 4, 246–254. 56. Panse, V. G., Hardeland, U., Werner, T., Kuster, B., and Hurt, E. (2004) A proteome-wide approach identifies sumoylated substrate proteins in yeast. J. Biol. Chem. 279, 41346–41351. 57. Vertegaal, A. C., Ogg, S. C., Jaffray, E., Rodriguez, M. S., Hay, R. T., Andersen, J. S., Mann, M., and Lamond, A. I. (2004) A proteomic study of SUMO-2 target proteins. J. Biol. Chem. 279, 33791–33798. 58. Wohlschlegel, J. A., Johnson, E. S., Reed, S. I., and Yates, J. R. 3rd. (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J. Biol. Chem. 279, 45662–45668. 59. Zhou, W., Ryan, J. J., and Zhou, H. (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J. Biol. Chem. 279, 32262–32268. 60. Takahashi, Y., Yong-Gonzalez, V., Kikuchi, Y., and Strunnikov, A. (2006) SIZ1/SIZ2 control of chromosome transmission fidelity is mediated by the sumoylation of topoisomerase II. Genetics 172, 783–794. 61. Bachant, J., Alcasabas, A., Blat, Y., Kleckner, N., and Elledge, S. J. (2002) The SUMO-1 isopeptidase Smt4 is linked to centromeric cohesion through SUMO-1 modification of DNA topoisomerase II. Mol. Cell 9, 1169–1182. 62. Azuma, Y., Arnaoutov, A., and Dasso, M. (2003) SUMO-2/3 regulates topoisomerase II in mitosis. J. Cell Biol. 163, 477–487. 63. Liu, L. F., Desai, S. D., Li, T. K., Mao, Y., Sun, M., and Sim, S. P. (2000) Mechanism of action of camptothecin. Ann. N. Y. Acad. Sci. 922, 1–10. 64. Torres-Rosell, J., Sunjevaric, I., De Piccoli, G., Sacher, M., Eckert-Boulet, N., Reid, R., Jentsch, S., Rothstein, R., Aragon, L., and Lisby, M. (2007) The Smc5-Smc6 complex and SUMO modification of Rad52 regulates recombinational repair at the ribosomal gene locus. Nat. Cell Biol. 9, 923–931. 65. Papouli, E., Chen, S., Davies, A. A., Huttner, D., Krejci, L., Sung, P., and Ulrich, H. D. (2005) Crosstalk between SUMO and ubiquitin on PCNA is mediated by recruitment of the helicase Srs2p. Mol. Cell 19, 123–133. 66. Pfander, B., Moldovan, G. L., Sacher, M., Hoege, C., and Jentsch, S. (2005) SUMOmodified PCNA recruits Srs2 to prevent recombination during S phase. Nature 436, 428–433.
67. Hannich, J. T., Lewis, A., Kroetz, M. B., Li, S. J., Heide, H., Emili, A., and Hochstrasser, M. (2005) Defining the SUMOmodified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280, 4102–4110. 68. Prudden, J., Pebernard, S., Raffa, G., Slavin, D. A., Perry, J. J., Tainer, J. A., McGowan, C. H., and Boddy, M. N. (2007) SUMOtargeted ubiquitin ligases in genome stability. EMBO J. 26, 4089–4101. 69. Sun, H., Leverson, J. D., and Hunter, T. (2007) Conserved function of RNF4 family proteins in eukaryotes: targeting a ubiquitin ligase to SUMOylated proteins. EMBO J. 26, 4102–4112. 70. Uzunova, K., Gottsche, K., Miteva, M., Weisshaar, S. R., Glanemann, C., Schnellhardt, M., Niessen, M., Scheel, H., Hofmann, K., Johnson, E. S. et al. (2007) Ubiquitindependent proteolytic control of SUMO conjugates. J. Biol. Chem. 282, 34167–34175. 71. Xie, Y., Kerscher, O., Kroetz, M. B., McConchie, H. F., Sung, P., and Hochstrasser, M. (2007) The yeast HEX3-SLX8 heterodimer is a ubiquitin ligase stimulated by substrate sumoylation. J. Biol. Chem. 282, 34176–34184. 72. Desterro, J. M., Rodriguez, M. S., and Hay, R. T. (1998) SUMO-1 modification of IκBα inhibits NF-κB activation. Mol. Cell 2, 233–239. 73. Bossis, G. and Melchior, F. (2006) SUMO: regulating the regulator. Cell Div. 1, 13. 74. Guo, B., Yang, S. H., Witty, J., and Sharrocks, A. D. (2007) Signalling pathways and the regulation of SUMO modification. Biochem. Soc. Trans. 35, 1414–1418. 75. Roscic, A., Moller, A., Calzado, M. A., Renner, F., Wimmer, V. C., Gresko, E., Ludi, K. S., and Schmitz, M. L. (2006) Phosphorylation-dependent control of Pc2 SUMO E3 ligase activity by its substrate protein HIPK2. Mol. Cell 24, 77–89. 76. Boggio, R., Colombo, R., Hay, R. T., Draetta, G. F., and Chiocca, S. (2004) A mechanism for inhibiting the SUMO pathway. Mol. Cell 16, 549–561. 77. Bossis, G. and Melchior, F. (2006) Regulation of SUMOylation by reversible oxidation of SUMO conjugating enzymes. Mol. Cell 21, 349–357. 78. Kurepa, J., Walker, J. M., Smalle, J., Gosink, M. M., Davis, S. J., Durham, T. L., Sung, D. Y., and Vierstra, R. D. (2003) The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J. Biol. Chem. 278, 6862–6872.
Chapter 2 Identification of SUMO Target Proteins by Quantitative Proteomics Jens S. Andersen, Ivan Matic, and Alfred C.O. Vertegaal Abstract The identification of target proteins for small ubiquitin-like modifiers (SUMOs) is a critical step towards a detailed understanding of the cellular functions of SUMOs. Substrate protein identification for SUMOs is hampered by the low abundance of SUMO targets, the finding that only a small fraction of these target proteins is sumoylated, and the high activity of deconjugating enzymes. Quantitative proteomics is a powerful tool to overcome these challenges, because it allows discrimination between contaminating proteins in SUMO-enriched preparations and true target proteins. In this chapter, the methodological details of the application of stable isotope labeling of amino acids in cell culture (SILAC) for the identification of target proteins for SUMOs are described. In addition to steady state sumoylation, the sumoylated proteome undergoes dynamic rearrangements in response to a diverse array of stimuli. SILAC also allows the study of sumoylation dynamics in response to these stimuli. Key words: SUMO-1, SUMO-2, SUMO-3, SILAC, quantitative proteomics, mass spectrometry.
1. Introduction The ubiquitin family includes small ubiquitin-like modifiers (SUMOs) that regulate the activity of a wide variety of cellular target proteins via covalent modification of lysine residues on these targets (1). A diverse set of SUMO target proteins has been identified, including factors that regulate transcription, replication, DNA repair, RNA metabolism, translation, and transport (2). Sumoylation is a reversible process; SUMO proteases can remove SUMOs from target proteins. Currently, specific inhibitors of these proteases are unavailable. To block SUMO protease activity, the purification of SUMO conjugates is carried out in Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
19
20
Andersen, Matic, and Vertegaal
denaturing buffers (3,4). The use of denaturing buffers also prevents the copurification of noncovalent SUMO-interacting proteins. However, due to a limited choice of affinity tags that can be used under denaturing conditions, the purified fractions usually contain significant numbers of contaminating proteins (see Note 1). To discriminate between bona fide SUMO target proteins and contaminants, the use of quantitative proteomics is a prerequisite. Stable isotope labeling of amino acids in cell culture (SILAC) is a powerful quantitative proteomics method (5–7) (see Note 2). It is based on the labeling of proteins in populations of cells with normal and stable isotope variants of amino acids (Fig. 2.1) (see Notes 3 and 4). For example, after the purification of pro-
Fig. 2.1. A SILAC strategy to identify SUMO target proteins. Parental cells were labeled with Arg0 and Lys0, and cells stably expressing His6-SUMO-2 were labeled with Arg10 and Lys8. Equal amounts of cells from the two different populations were mixed and lysed and His6-SUMO-2 conjugates were purified by Immobilized Metal Affinity Chromatography. The SUMO-enriched fraction was digested in solution and analyzed by mass spectrometry. Peptide mass spectra of proteins were quantified to identify proteins potentially conjugated to SUMO-2.
Identification of SUMO Targets by SILAC
21
tein complexes or subcellular fractions, proteins are digested by trypsin into smaller peptides that are subsequently identified and quantified by mass spectrometry. The resulting data contain information about the identity of the purified proteins and their relative abundance in the different pools of cells (see Note 5). SILAC has been used to study the dynamics of the nucleolar proteome in response to metabolic inhibitors (8), to compare the related signaling pathways of epidermal growth factor and platelet-derived growth factor (9), and to identify PP1α- and –γ-binding proteins (10). Here, we describe how SILAC can be applied to investigate the sumoylated proteome. Since purified sumoylated proteins often contain contaminants, preparations of experiments are designed to contain a control cell population to eliminate false positives. Cells that express tagged SUMOs and control cells that lack exogenous SUMOs are used. After full incorporation of isotopic variants of amino acids, cells are lysed in a denaturing buffer to inactivate SUMO proteases, and tagged SUMOs are subsequently purified. After trypsin digestion and identification and quantification of peptides in the purified fraction by mass spectrometry, the ratio between the isotopic variants of these peptides is determined to distinguish between SUMO target proteins and copurified contaminating proteins (see Note 6). We have used SILAC previously to investigate the target protein preferences of the mammalian SUMO family members SUMO-1 and SUMO-2 (4). SUMO-1 and SUMO-2 were shown to function largely nonredundantly but were also conjugated to a common set of targets. In the past the SUMO field has largely focused on steadystate sumoylation. Interestingly, sumoylation can also occur in a stimulus-dependent manner (11). The SILAC method is suitable for studying stimulus-dependent sumoylation, because it can determine increases and decreases in sumoylation of target proteins in a quantitative manner. Nonquantitative methods are inherently less suitable for studying conditional sumoylation.
2. Materials 2.1. SILAC Medium and Cell Culture
1. Dulbecco’s modified eagle’s medium (DMEM) without arginine, lysine, and glutamine (available from SAFC Biosciences, Lenexa, Kansas; cat. no. 63190) (see Notes 7 and 8). 2. Dialysed fetal bovine serum (e.g., Invitrogen, cat. no. 26400–044) (see Note 9). 3.
L-Arginine-12C614N4
(Arg0; Sigma-Aldrich, cat. no. A6969).
22
Andersen, Matic, and Vertegaal
4.
L-Lysine-12C614N2
5.
L-Arginine-13C615N4
6.
L-Lysine-13C615N2
(Lys0; Sigma-Aldrich, cat. no. L8662). (Arg10; Sigma-Isotec, cat. no. 608033).
(Lys8; Sigma-Isotec, cat. no. 608041).
7. Amino acids: arginine (84 mg/ml) and lysine (146 mg/ml) are prepared as 3000x concentrated stocks in phosphatebuffered saline (PBS) for labeling HeLa cells. Solutions are filtered through a 0.22-µm filter and stored in aliquots at 4°C for up to 6 months. Add amino acids to DMEM shortly before use as required for the cell line of choice (see Note 10). 8. Antibiotics: Penicillin or Streptomycin stock solution (100x). 9.
L-Glutamine:
200 mM stock solution (100x).
10. 0.22 µm vacuum filter flasks. 11. Cell line of choice stably expressing His6-SUMO-1, -2, or -3. HeLa cells stably expressing His6-SUMO-1 or SUMO-2 have been described previously (4). 2.2. Cell Lysis
1. PBS: store at 4°C. 2. Cell scrapers. 3. Lysis buffer: 6 M Guanidinium-HCl, 100 mM NaH2PO4/ Na2HPO4, 10 mM Tris-HCl, pH 8.0. Shortly before use add β-mercaptoethanol to 10 mM and imidazole to 20 mM. 4. Sonicator.
2.3. Purification of SUMO Targets
1. Ni2+-NTA agarose beads (Qiagen). 2. Empty columns (BioSpin columns, Bio-Rad, or equivalent). 3. Wash buffer A: 6 M Guanidinium-HCl, 100 mM NaH2PO4/ Na2HPO4, 10 mM Tris-HCl, pH 8.0. Shortly before use add β-mercaptoethanol to 10 mM and Triton-X-100 to 0.2%. 4. Wash buffer B: 8 M urea, 100 mM NaH2PO4/Na2HPO4, 10 mM Tris-HCl, pH 8.0. Shortly before use add β-mercaptoethanol to 10 mM and Triton-X-100 to 0.2%. 5. Wash buffer C: 8 M urea, 100 mM NaH2PO4/Na2HPO4, 10 mM Tris-HCl, pH 6.3. Shortly before use add β-mercaptoethanol to 10 mM and Triton-X-100 to 0.2%. 6. Wash buffer D: 8 M urea, 100 mM NaH2PO4/Na2HPO4, 10 mM Tris-HCl, pH 6.3. Shortly before use add β-mercaptoethanol to 10 mM and Triton-X-100 to 0.1%. 7. Wash buffer E: 8 M urea, 100 mM NaH2PO4/Na2HPO4, 10 mM Tris-HCl, pH 7.0. 8. Elution buffer: 6.4 M urea, 80 mM NaH2PO4/Na2HPO4, 8 mM Tris-HCl, pH 7.0, 200 mM imidazole. 9. NuPAGE Novex 4–12% Bis-Tris gradient gels (Invitrogen).
Identification of SUMO Targets by SILAC
2.4. Protein Digestion and Mass Spectrometry
23
1. Ammonium bicarbonate (ABC buffer): 50 mM NH4HCO3, pH 8.0; store at room temperature. 2. Dithiothreitol (DTT): 10 mM DTT in 50 mM ABC buffer; store in small aliquots at −20°C. 3. Iodoacetamide: prepare 55 mM iodoacetamide in 50 mM ABC, store in small aliquots at −20°C, protected from light. 4. Trifluoroacetic acid (TFA). 5. Formic acid. 6. Acetonitrile. 7. Endopeptidase Lys-C (Wako Chemicals GMBH, cat. no. 129–02541): 0.5 µg/µl LysC in 50 mM ABC. Store in small aliquots at −20°C. 8. Sequencing grade modified trypsin for proteomics (Promega, cat. no. V5111): 0.5 µg/µl trypsin in 50 mM ABC. Store in small aliquots at −20°C. 9. Reprosil C18-AQ, 3 µm beads. 10. Material for C18 microcolumns (12). 11. Fused silica capillary with a 75 µm inner diameter and an 8-µm tip opening (New Objective, Woburn, MA) packed with Reprosil C18 beads (Dr. Maisch, Ammerbuch, Germany). 12. High accuracy mass spectrometer such as a linear ion trap (LTQ)-FT-ICR mass spectrometer or an Orbitrap (Thermo Fisher Scientific). 13. Nanoflow HPLC (Agilent Technologies or equivalent). 14. Buffer X: 0.5% acetic acid in H2O. 15. Buffer Y: 80% acetonitrile (toxic), 0.5% acetic acid in H2O.
2.5. Data Analysis and Confirmation
1. Software to identify proteins and peptide, such as Mascot (Matrix Science, London, U.K.). 2. Software to automatically quantify the identified peptides, such as MSQuant (available through http://msquant. sourceforge.net), SpectrumMill (available through Matrix Science), or other software capable of automatically quantifying SILAC data.
3. Methods The experiment described here is aimed at identifying target proteins for His6-SUMO-2 (Fig. 2.1). The same method can also be applied to identify target proteins for His6-SUMO-1 or His6-SUMO-3 (see Note 11). It is important to use a cell line
24
Andersen, Matic, and Vertegaal
stably expressing tagged SUMO and the parental cell line that lacks exogenous SUMOs as a negative control. After preparing the cell culture media containing either light or heavy amino acids, cell cultures are set up in these media. The parental cells are grown in medium containing light amino acids and the cells stably expressing His6-SUMO-2 are grown in medium containing heavy amino acids for at least five cell doublings. The cell line that we have used in this experiment is the widely used HeLa cell line. For this cell line it takes five cell doublings to fully replace proteins labeled with light amino acids with proteins labeled with heavy amino acids. This period of time should be experimentally verified (see Note 12). Cells are harvested and, after verifying that equal amounts of cells are used from the differently labeled populations, all cells are mixed and a single lysate is prepared. This minimizes errors introduced due to differential handling of the different populations—a unique advantage of the SILAC method. Sumoylated proteins are inherently labile due to the activity of intracellular SUMO proteases. It is therefore important to rapidly lyse the cells in denaturing lysis buffer. The resulting lysate is very viscous and needs to be sonicated to make it suitable for the purification of sumoylated proteins. After purification of the sumoylated proteome, proteins are digested in solution (see Note 13) with trypsin, which is a protease that cleaves proteins after lysines and arginines. Each resulting peptide will be labeled with either light or heavy lysine or arginine, except for the very C-terminal peptides of proteins (unless of course the C-terminal amino acid of a protein is a lysine or arginine). The resulting peptide mixture is subsequently bound to a column of reverse-phase material and eluted by a gradient buffer to fractionate the usually very complex mixture of peptides based on hydrophobicity. Parent ion masses of the eluted peptides are measured in the mass spectrometer, and peptides are further analyzed by collision-induced fragmentation to obtain fragment ion mass spectra. The corresponding proteins are subsequently identified by searching protein sequence databases using the obtained peptide data. Protein ratios are then calculated for each arginine- or lysine-containing peptide as the peak area of the heavy labeled peptide divided by the peak area of the light labeled peptide for each peptide. The peptide ratios are averaged for all peptides sequenced for each protein using available open source software. Significantly enriched proteins represent SUMO-2 target proteins (see Note 14). Examples of a SUMO-2 target protein and contaminating proteins are shown in Fig. 2.2. Novel SUMO target proteins can further be confirmed by immunoblotting. 3.1. SILAC Medium and Cell Culture
1. Cells that stably express His6-tagged SUMOs are established. In this experiment, we have used a CMV-driven His6-SUMO-2 expression construct that also renders cells
Identification of SUMO Targets by SILAC
25
Fig. 2.2. Examples of a SUMO-2 target protein, an endogenous contaminating protein, and an exogenous contaminating protein. These examples are depicted here to illustrate the different classes of proteins that are identified in SILAC experiments. (A) The peptide NTLETSSLNFK, which corresponds to the protein SAF-B2, was found preferentially in the Lys8-labeled form, indicating that this is a bona fide SUMO-2 target protein. (B) The peptide NMMAACDPR, which corresponds to β-tubulin, was found in the Arg0- and Arg10-labeled form in equal amounts, indicating that this is a copurified contaminating protein. (C) The peptide LGEHNIDVLEGNEQFINAAK, which corresponds to trypsin, was found exclusively in the Lys0-labeled form because it does not originate from the cells, but was introduced on purpose during sample handling.
26
Andersen, Matic, and Vertegaal
resistant to puromycin to enable the selection of stable transfectants. The expression level of exogenous SUMO is compared to the expression level of endogenous SUMO to minimize overexpression. HeLa cells stably expressing His6SUMO-1 or SUMO-2 have been described previously (4). 2. If needed, add common amino acids to light and heavy SILAC dropout medium. When labeling with arginine and lysine, add regular stable isotope versions of other amino acids not present in the dropout medium. 3. Divide SILAC dropout medium into two equal volumes. 4. Light and heavy arginine and lysine are added to the light and heavy media, respectively (see Note 10). 5. Dropout DMEM containing heavy or light amino acids is filter sterilized. 6. Add glutamine, 10% fetal bovine serum, and antibiotics to both bottles of medium. This medium can be stored for a maximum of 2 months at 4°C. 7. Parental cells are passaged in DMEM containing light amino acids, and cells stably expressing tagged-SUMOs are passaged in DMEM containing heavy amino acids for at least five cell doublings to ensure complete incorporation of the labels (see Notes 12 and 15). 3.2. Lysis
1. Wash cells three times with ice-cold PBS and scrape in icecold PBS. 2. Spin down the cells and determine the weight of the cell pellets of the different populations. Adjust precisely to a oneto-one ratio. 3. Confirm the one-to-one ratio by determining the protein concentration of equal small aliquots lysed in 8 M urea. 4. Combine all the cells in ice-cold PBS into 10 million cells a single sample and split this sample again into aliquots of 107 cells per 15 ml tube. 5. Spin down the cells, keep the aliquots on ice, and lyse them one by one as follows: 6. Remove PBS, vortex for 2 s at maximum setting, and immediately add 3 ml lysis buffer (room temperature) while vortexing. Mix vigorously for another 10 s. 7. Sonicate the samples on ice to reduce the viscosity. Avoid heating the samples during this procedure. 8. Spin the lysate at 15,000–20,000g for 10 min at room temperature. Use the supernatant for subsequent purification of SUMO targets.
Identification of SUMO Targets by SILAC
3.3. Purification of SUMO Targets
27
1. Combine the lysates into a single sample and incubate with 100 µl Ni-NTA-agarose beads for 1–2 h while mixing at room temperature. 2. Spin down the beads at 500 g for 1 min. 3. Resuspend the beads in 20 bead volumes of wash buffer A and load the mixture on an empty column. 4. Wash with 20 bead volumes of wash buffer B. 5. Wash with 20 bead volumes of wash buffer C. 6. Wash with 20 bead volumes of wash buffer D. 7. Wash five times with wash buffer E. 8. Elute the proteins in one bead volume of elution buffer for 5 min at room temperature. 9. Repeat Step 8 twice. 10. Determine the protein concentration and the total amount of purified material. Samples in urea buffer should not be heated. 11. Run a small aliquot on a 4–12% gradient-gel and check the conjugation status of the SUMOs by immunoblotting. Most of the immunoreactive material should be present in high molecular weight conjugates. For an example, see (4).
3.4. Protein Digestion and Mass Spectrometry
1. Add DTT to 1 mM to reduce the sample. Incubate for 30 min at room temperature. 2. Add iodoacetamide to 5 mM to alkylate the sample. Vortex and incubate for 20 min at room temperature in the dark. 3. Add ABC buffer to reduce the final concentration of urea to 3 M. 4. Add 0.2 µg endopeptidase Lys-C per 10 µg of protein present in the sample. 5. Incubate at 37°C for 2–3 h. 6. Dilute the sample 2-fold with 50 mM ammonium bicarbonate. 7. Add 0.2 µg of trypsin per 10 µg of protein present in the sample. 8. Incubate at 37°C overnight. 9. Add trifluoroacetic acid to 1% to stop digestion. 10. Purify the peptides using C18 microcolumns (12) according to the manufacturer’s protocol (New Objective). 11. Elute the peptides from the columns using 80% acetonitrile/0.1% formic acid. 12. Dry the samples in a vacuum centrifuge.
28
Andersen, Matic, and Vertegaal
13. Resuspend the peptides in 10 µl of 2.5% acetonitrile/1% trifluoroacetic acid. 14. Load the peptide mixture onto the silica capillary. Use approximately 2–5 µg of peptide as determined in Sect. 3.3, Step 10. 15. Elute peptides with a 140 min linear gradient of 95% buffer X to 50% buffer Y. 16. Acquire high resolution precursor ion spectra and tandem mass spectra. 3.5. Data Analysis and Confirmation
1. Search the peak list with high stringency in the International Protein Index (IPI) database (www.ebi.ac.uk/IPI/IPIhelp. html) using an appropriate program such as Mascot (Matrix Science, London, UK). 2. Calculate the peptide ratios for each arginine- or lysine-containing peptide and average the ratios of the sequenced peptides per proteins using suitable software such as MSQuant (http://msquant.sourceforge.net). 3. Plot the obtained ratios to determine an appropriate cut-off ratio. This ratio should not be smaller than 1.5-fold and ideally should be at least 2-fold. 4. Confirm the sumoylation status of a number of identified proteins by immunoblotting (see Note 16).
4. Notes 1. Due to the high activity of SUMO proteases in cells and in lysates, the use of denaturing buffers is essential, which severely limits the choice of the affinity tag that can be used. The His6-tag is compatible with buffers containing very large amounts of guanidinium or urea, but many proteins contain stretches of histidines, which results in their copurification in Immobilized Metal Affinity Chromatography procedures. 2. ICAT and iTRAQ are other quantitative proteomics method that are alternatives to SILAC (13,14). 3. It is important to note that these heavy amino acids are not radioactive. 4. The enzyme trypsin, which cleaves carboxy-terminal of lysines and arginines, is extensively used in proteomics. It is therefore particularly useful to label proteins in cells with isotopic variants of lysine and arginine. This results in the presence of a single labeled amino acid in each peptide, with
Identification of SUMO Targets by SILAC
29
the exception of the very carboxy-terminal tryptic peptide of a protein. Although it is desirable to label both arginines and lysines in proteins, it is possible to use only arginine encoding, or only lysine encoding, or encoding with other amino acids such as leucine (5). 5. An added advantage of the SILAC method is that exogenous contaminants such as keratins, which can be introduced during sample handling, are encoded by light amino acids only and are thus easily distinguishable from proteins labeled by heavy amino acids. 6. Other types of post-translational modifications such as phosphorylation and acetylation as well as amino acid methylation can directly be identified by mass spectrometry. It is also desirable to positively identify the sumoylated lysines in target proteins by mass spectrometry, although complex overlapping MS/MS spectra of SUMO-modified peptides makes this type of modification difficult to detect (15). Direct identification of modified lysines is easier for ubiquitin target proteins, because tryptic fragments of ubiquitylated lysines contain an indivisible diglycine signature (16). 7. As an alternative to buying individual components for preparing SILAC medium, kits are available from Invitrogen that contain all the required components. 8. If the cell line of choice requires another medium formulation, custom-synthesized medium without arginine and lysine should be used. 9. A small number of cell lines fail to thrive in medium containing commercially available dialyzed serum. Potentially, you can also dialyze a particular type of serum required in your own laboratory using a low molecular weight cut-off to avoid the loss of low-molecular-weight growth factors. 10. A potential problem that arises from the use of labeled arginine is the capacity of some cell types to metabolically convert arginines to prolines. This is especially the case when excessive concentrations of arginine are used. This challenge can be overcome by titrating the amount of arginine without reaching amino acid starvation levels. Note that the same amounts of arginine should be used for both light and heavy SILAC media. Conversion can be monitored in the cell lines of choice by MS analysis. If conversion occurs, prolinecontaining peptides will have heavier satellite clusters. 11. In the described protocol, two populations of cells are used: cells that stably express a tagged SUMO and parental cells that serve as a negative control. It is also possible to use three populations of cells and triply encode proteins (4), using intermediate L-Arg6 (13C614N4-Arginine, avail-
30
Andersen, Matic, and Vertegaal
able from Cambridge Isotope labs, Andover, MA; cat. no. CLM-2265) and L-Lys4 (2H412C614N2-Lysine, available from Sigma-Isotec, St. Louis, MO; cat no. 616192). This method is particularly useful to investigate stimulus-induced changes in the sumoylated proteome. 12. When applying the SILAC method for the first time, it is important to verify complete replacement of light amino acids with heavy amino acids in proteins by analyzing a small aliquot of total lysate prepared in 6 M urea/2 M thiourea after five cell doublings. Digest 25–50 µg protein in solution. 13. When analyzing complex samples containing more than 300 proteins, SUMO-enriched samples can also be separated on a one-dimensional gel, stained with Coomassie and sliced into small slices to reduce sample complexity. When gel slices corresponding to less than 14 KDa size differences are prepared, it is theoretically possible to separate sumoylated proteins from nonsumoylated contaminating counterparts. 14. Using the SILAC method, relative standard deviations are usually less than 20%. Therefore, quantitative changes of 1.5-fold can be significant, although a 2-fold change is a more conservative cut-off. 15. Depending on the sensitivity of the mass spectrometer that is used, a sample derived from 50 million cells of each SILAC population is optimal. 16. Gradient gels are particularly useful to assess the ratio of free to conjugated SUMOs in purified samples, because they allow the visualization of small and large proteins simultaneously. Note that the blotting time influences the amount of free SUMOs that are visualized, because a significant amount of small proteins can be lost upon prolonged blotting.
Acknowledgments The authors would like to thank Professor Matthias Mann for comments on the manuscript. This work was supported by the Netherlands Organisation for Scientific Research (NWO) to ACOV as part of the Innovational Research Incentives Scheme and by a generous grant from the Danish National Research Foundation to Matthias Mann and JSA.
Identification of SUMO Targets by SILAC
31
References 1. Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12. 2. Xu, P., and Peng, J. (2006) Dissecting the ubiquitin pathway by mass spectrometry. Biochim. Biophys. Acta 1764, 1940–1947. 3. Vertegaal, A. C., Ogg, S. C., Jaffray, E., Rodriguez, M. S., Hay, R. T., Andersen, J. S., Mann, M., and Lamond, A. I. (2004) A proteomic study of SUMO-2 target proteins. J. Biol. Chem. 279, 33791–33798. 4. Vertegaal, A. C., Andersen, J. S., Ogg, S. C., Hay, R. T., Mann, M., and Lamond, A. I. (2006) Distinct and overlapping sets of SUMO-1 and SUMO-2 target proteins revealed by quantitative proteomics. Mol. Cell Proteomics 5, 2298–2310. 5. Ong, S. E., Blagoev, B., Kratchmarova, I., Kristensen, D. B., Steen, H., Pandey, A., and Mann, M. (2002) Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol. Cell Proteomics 1, 376–386. 6. Ong, S. E., Kratchmarova, I., and Mann, M. (2003) Properties of 13C-substituted arginine in stable isotope labeling by amino acids in cell culture (SILAC). J. Proteome Res. 2, 173–181. 7. Ong, S. E., and Mann, M. (2006) A practical recipe for stable isotope labeling by amino acids in cell culture (SILAC). Nat. Protoc. 1, 2650–2660. 8. Andersen, J. S., Lam, Y. W., Leung, A. K., Ong, S. E., Lyon, C. E., Lamond, A. I., and Mann, M. (2005) Nucleolar proteome dynamics. Nature 433, 77–83. 9. Kratchmarova, I., Blagoev, B., HaackSorensen, M., Kassem, M., and Mann, M. (2005) Mechanism of divergent growth fac-
10.
11.
12.
13.
14.
15.
16.
tor effects in mesenchymal stem cell differentiation. Science 308, 1472–1477. Trinkle-Mulcahy, L., Andersen, J., Lam, Y. W., Moorhead, G., Mann, M., and Lamond, A. I. (2006) Repo-Man recruits PP1 gamma to chromatin and is essential for cell viability. J. Cell Biol. 172, 679–692. Saitoh, H., and Hinchey, J. (2000) Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J. Biol. Chem. 275, 6252–6258. Rappsilber, J., Ishihama, Y., and Mann, M. (2003) Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal. Chem. 75, 663–670. Gygi, S. P., Rist, B., Gerber, S. A., Turecek, F., Gelb, M. H., and Aebersold, R. (1999) Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17, 994–999. Mann, M. (2006) Functional and quantitative proteomics using SILAC. Nat. Rev. Mol. Cell Biol. 7, 952–958. Matic, I., van Hagen, M., Schimmel, J., Macek, B., Ogg, S. C., Tatham, M. H., Hay, R. T., Lamond, A. I., Mann, M., and Vertegaal, A. C. (2008) In vivo identification of human SUMO polymerization sites by high accuracy mass spectrometry and an in-vitro to in vivo strategy. Mol. Cell. Proteomics 7, 132–144. Peng, J., Schwartz, D., Elias, J. E., Thoreen, C. C., Cheng, D., Marsischky, G., Roelofs, J., Finley, D., and Gygi, S. P. (2003) A proteomics approach to understanding protein ubiquitination. Nat. Biotechnol. 21, 921–926.
Chapter 3 Identification of SUMO-Conjugated Proteins and their SUMO Attachment Sites Using Proteomic Mass Spectrometry James A. Wohlschlegel Abstract The covalent modification of cellular factors by the small ubiquitin-like modifier (SUMO) has emerged as a key regulatory pathway for many biological processes. One recent advance in the field of SUMO modification that has provided important insights into SUMO-mediated regulatory networks is the ability to use proteomic mass spectrometry to identify the substrates of SUMO modification as well as their sites of conjugation (1–10). In this chapter, we describe a global strategy for affinity purifying and identifying a broad spectrum of SUMO-conjugated proteins and a focused approach for purifying a selected SUMO target and mapping its SUMO attachment site(s). Although both methods were initially developed for use in S. cerevisiae, they can be readily adapted to study the SUMO pathway in higher eukaryotes. Key words: Mass spectrometry, proteomics, post-translational modifications, Smt3⋅SUMO.
1.Introduction The ability to identify the proteins that are post-translationally modified and the exact sites of those modifications is an important step in understanding the biological role of covalent modifications. Mass spectrometry has emerged as a powerful technology capable of performing these tasks and has been successfully applied to the study of a number of different post-translational modifications, including phosphorylation, acetylation, and ubiquitylation. In this chapter, we focus on proteomic methods for analyzing the covalent modification of proteins by SUMO—a member of the ubiquitin family of protein modifiers. The first Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
33
34
Wohlschlegel
method was successfully used in Wohlschlegel et al. (8) and is a global proteomic approach for purifying and characterizing the entire pool of SUMO-conjugated proteins isolated from the budding yeast S. cerevisiae with the primary goal of identifying all of the SUMO-modified components present in the sample. The second method is focused on the mapping of SUMO attachment sites in a selected target and involves the tandem affinity purification of the sumoylated fraction of a specific substrate and the identification of SUMO-modified lysines in the purified substrate by mass spectrometry. The general strategy for globally analyzing SUMO substrates is depicted in Fig. 3.1. Briefly, SUMO-conjugated proteins are purified under denaturing conditions using Ni-NTA affinity chromatography from a yeast strain expressing Smt3 (the yeast homologue of SUMO) fused to an octahistidine tag. The denaturing conditions of this purification are extremely important to limit the activity of SUMO deconjugation enzymes in the extract as well as to ensure that only factors covalently attached to SUMO, and not the associated proteins, are purified. The affinity-purified mixture is then digested by the sequential addition of Lys-C and trypsin proteases and loaded onto a triphasic microcapillary column consisting of strong cation exchange (SCX) resin flanked by segments of reverse-phase (RP) material. Peptides are fractionated using a multidimensional separation strategy and eluted directly into a mass spectrometer, where they are fragmented using collision-induced dissociation (CID), and the resulting MS/MS
Fig. 3.1. Flowchart of methods for identifying SUMO-modified proteins (left) and for mapping SUMO attachment sites (right).
SUMO and Mass Spectrometry
35
spectra are recorded (see Note 1). This online multidimensional fractionation and mass spectrometry approach is also known as MudPIT (Multidimensional Protein Identification Technology) or 2D-LC-MS/MS (11, 12). Finally, the data is analyzed using a series of algorithms to identify the proteins present in the sample. Proteins identified from the SUMO-purified sample are compared to proteins identified from a control sample purified from an untagged yeast strain to determine the factors that are likely to be bona fide SUMO substrates as opposed to nonspecific contaminants. In addition to identifying the proteins that are modified by SUMO, it is also sometimes necessary to map the exact residues in those substrates that are covalently linked to the SUMO protein. This mapping information can guide subsequent mutational analyses where nonmodifiable mutants of those substrates are generated and the ability of those mutants to perform their cellular duties is assessed. The strategy for mapping SUMO attachment sites is based on an approach first devised for mapping ubiquitylation sites and is shown in Fig. 3.2 (13–15). The tryptic digestion of a SUMO-modified protein results in the five C-terminal amino acids from Smt3 (EQIGG) remaining covalently attached to the modified lysine reside in the substrate. The presence of these additional amino acids leads to a mass shift of 484.2282 Daltons that can be measured using mass spectrometry. Although this approach is conceptually straightforward, the mapping of SUMO conjugation sites is still technically challenging. This is due mainly to the extremely low abundance of the majority of the sumoylated subtrates where the stoichiometry of the modification is typically less than 1% (see Note 2). To address this challenge, we perform a two-step purification method to specifically
Fig. 3.2. Strategy for mapping SUMO modification sites. While tryptic digestion of an unmodified protein yields only tryptic fragments (left), tryptic digestion of a sumoylated protein by trypsin results in the generation of modified peptide containing a skipped tryptic cleavage site and a diagnostic mass fragment (484.2822 Da) corresponding to the C-terminal EQIGG sequence from Smt3 that remains attached to the modified lysine after digestion (right ). This mass shift allows the modified peptide to be identified using mass spectrometry.
36
Wohlschlegel
enrich the sumoylated version of the substrate of interest, which is then analyzed by tandem mass spectrometry to identify the conjugation sites as described above. For this tandem purification method, we generate a yeast strain expressing both His8-Smt3 and the protein of interest fused to an in vivo biotinylation peptide. SUMO conjugates are first purified using Ni-NTA chromatography, and then the biotinylated SUMO-modified substrate of interest is further purified from this fraction using immobilized streptavidin. The sequential purification of the sumoylated target in this manner results in a high level of enrichment that greatly facilitates the modification site mapping by mass spectrometry. A protocol for this method is described in Sect. 3.5.
2. Materials 2.1. Affinity Purification of SUMO Conjugates
1. Yeast culture medium: YPD or selective media if required. 2. Yeast strain EJ337: yeast strain in which HIS8-SMT3 is integrated into its endogenous locus and expresses His8-Smt3 under the control of its endogenous promoter (strain available by request from the author). 3. Control untagged yeast strain. 4. Lysis buffer: 1.85 N NaOH, 1.85% β-mercaptoethanol. This buffer should be prepared freshly before use. 5. Trichloacetic acid: Prepare a 50% (w/v) solution in water and store at 4°C. 6. Ice-cold acetone. 7. Guanidine binding buffer: 6 M guanidine hydrochloride, 100 mM sodium phosphate, 10 mM Tris-HCl, pH 8.5. 8. Nickel-NTA agarose (Qiagen, Valencia, CA). 9. Poly-Prep chromatography column (Bio-Rad, Hercules, CA). 10. Urea washing buffer: 8 M urea, 100 mM sodium phosphate, 10 mM Tris-HCl, pH 6.3. 11. Urea elution buffer: 8 M urea, 100 mM sodium phosphate, 10 mM Tris-HCl, pH 4. 12. Urea binding buffer: 8 M urea, 100 mM sodium phosphate, 10 mM Tris-HCl, pH 8.0. 13. Rabbit α-His polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA).
2.2. Proteolytic Digest of SUMO Conjugates
1. Digestion buffer: 8 M urea, 100 mM Tris-HCl, pH 8.5. 2. Tris(2-Carboxyethyl) phosphine hydrochloride (TCEPHCl): dissolved in water at 200 mM and stored in aliquots at −20°C.
SUMO and Mass Spectrometry
37
3. Iodoacetamide: 500 mM stock solution dissolved in H2O, prepared immediately before use. Iodoacetamide is light sensitive and should be stored in the dark after preparation. 4. Sequencing-grade endoprotease Lys-C (Princeton Separations, Adelphia, NJ): dissolve in water at a concentration of 0.1 µg/µL and store in aliquots at −80°C 5. 100 mM Tris-HCl, pH 8.5. 6. 1 M CaCl2. 7. Sequencing-grade endoprotease trypsin (Promega, Madison, WI): dissolve in water at a concentration of 0.5 µg/µl and store in aliquots at −80°C. 2.3. Microcapillary Column Construction and Sample Loading
1. Fused silica capillary tubing with 100 µm inner diameter and 360 µm outer diameter (Polymicro Technologies, Phoenix AZ) (see Note 3). 2. Aqua C18 reverse phase resin: 5-µm-sized particles (Phenomenex, Torrance, CA). 3. Luna strong-cation exchange (SCX) resin: 5-µm-sized particles (Phenomenex, Torrance, CA). 4. Sutter P-2000 laser puller (Sutter Instruments, Novato, CA). 5. 100% ethanol. 6. 100% methanol. 7. Helium pressure loading cell (Brechbuhler, Houston, TX; alternatively, material transfer agreement for blueprints can be requested from John Yates, The Scripps Research Institute, La Jolla, CA).
2.4. Analysis of SUMOConjugated Proteins Using Mass Spectrometry
1. Agilent HP1200 quaternary HPLC (Agilent Technologies, Santa Clara, CA) (see Note 4). 2. Thermofisher Linear Ion Trap - Orbitrap hybrid mass spectrometer (LTQ-Orbitrap) equipped with a nano-ESI source (Thermofisher Scientific, Waltham, MA). 3. HPLC buffer A: 95% water, 5% acetonitrile, 0.1% formic acid. 4. HPLC buffer B: 20% water, 80% acetonitrile, 0.1% formic acid. 5. HPLC buffer C: 95% water, 5% acetonitrile, 0.1% formic acid, 500 mM ammonium acetate. 6. Database search algorithm such as SEQUEST (Thermofisher Scientific, Waltham, MA) and other algorithms including RawXtract, DTASelect2, and Contrast2 for data analysis (algorithms are available through software transfer agreement from John Yates at The Scripps Research Institute, La Jolla, CA).
38
Wohlschlegel
2.5. Modified Protocol for BiotinSteptavidin Purification of Selected Sumoylated Substrate
1. Yeast strain expressing His8-Smt3 and the substrate of interest fused to an in vivo biotinylation peptide. 2. Guanidine elution buffer: 6 M guanidine hydrochloride, 100 mM sodium phosphate, 10 mM Tris-HCl, 250 mM imidazole. 3. Streptavidin agarose. 4. Streptavidin-conjugated horseradish peroxidase (streptavidin-HRP) (Pierce Biotechnology, Rockford, IL).
3. Methods The procedures outlined in Sects. 3.1–3.4 are used to affinity purify the entire pool of SUMO-conjugated proteins from a yeast culture and identify the components of that mixture using mass spectrometry. Section 3.5 describes modifications to the original protocol that allow the selective purification of a single sumoylated protein of interest in order to map its modification sites. 3.1. Affinity Purification of SUMO Conjugates
1. Affinity purifications should be carried out independently from two different yeast strains: a yeast strain expressing His8-Smt3 and an untagged control strain. 2. Grow 6 l of either the yeast strain expressing His8-Smt3 or the untagged control strain in YPD medium to an A600 = 2.0 and collect cells by centrifugation (2000g, 3 min, 4°C). 3. Wash the cells with 0.025 volumes of water (25 ml water per liter of starting culture) and spin cells as before. 4. Store the cell pellet at −80°C or proceed with lysis (see Note 5). 5. Resuspend the cell pellet in 150 ml of lysis buffer (25 ml lysis buffer per liter of starting culture) and incubate on ice for 30 min (see Note 6). 6. Add 150 ml 50% TCA to the sample (final concentration of TCA = 25%) and incubate on ice for 30 min. 7. Centrifuge at 27000g for 15 min at 4°C to collect the precipitate. 8. Resuspend the precipitate in 200 ml ice-cold acetone and centrifuge as before. 9. Resuspend the precipitate in 100 ml of binding buffer and incubate at room temperature for 30 min on a shaking platform. 10. Centrifuge at 27,000g and distribute the supernatant to two 50 ml conical tubes.
SUMO and Mass Spectrometry
39
11. Adjust the pH of sample in each tube to ∼8 using pH indicator paper and a few drops of 10 N NaOH. 12. Add 2 ml of Ni-NTA resin (50% slurry, 1 ml bead volume) pre-equilibrated with guanidine binding buffer to each tube and rotate at room temperature for 2 h. 13. Centrifuge the tubes at 2000g for 2 min to pellet resin. 14. Remove the supernatant and resuspend the resin in a small volume of binding buffer. 15. Pool the slurries from the two conical tubes and pour into a Poly-Prep column. 16. Wash the beads with 20 ml of guanidine binding buffer. 17. Wash the beads with 20 ml of urea washing buffer (check the pH of washing buffer before use and adjust if necessary; see Note 7). 18. Elute bound material with 5 ml of urea elution buffer. 19. As described in Note 8, we find it helpful to perform a second round of Ni-NTA purification on this eluate to further concentrate the sample before proteolytic digestion. The steps for this second round of purification are described below. 20. Adjust the pH of the eluate to ∼8 using 4 N NaOH. 21. Add 100 µl of Ni-NTA agarose (50% slurry, 50 µl bead volume) equilibrated in urea binding buffer. 22. Rotate the sample at room temperature for 2 h. 23. Centrifuge the tube at 2000g for 2 min to pellet resin. 24. Remove the supernatant, resuspend the resin in 1 ml of urea binding buffer, and transfer to a 1.7 ml microcentrifuge tube. 25. Centrifuge the tube at 2000g rpm for 1 min in a microcentrifuge. 26. Remove the supernatant and resuspend the resin in 500 µl of urea binding buffer. 27. Wash the beads three more times (Steps 25–26) for a total of four washes (500 µl per wash) and then proceed to proteolytic digestion (see Note 9). 28. A small aliquot of beads may be analyzed at this stage by SDS-PAGE followed by immunoblotting with α-Smt3 or α-His6 to monitor the effectiveness of the purification. 3.2. Proteolytic Digest of SUMO Conjugates
1. Wash the beads twice (500 µl per wash) as described in Sect. 3.1, Steps 25–26, but using digestion buffer. 2. Remove the supernatant until the digestion buffer barely covers the beads. 3. Reduce the sample by adding 0.75 µl of 200 mM TCEP and agitating the beads at room temperature for 20 min (see Note 10).
40
Wohlschlegel
4. Add 1.1 µl of freshly prepared 500 mM iodoacetamide to the sample and incubate for 20 min at room temperature in the dark while agitating (see Note 11). 5. Add 1 µl of endoprotease lys-C and incubate the sample at 37°C for at least 4 h. Lys-C is normally added at an enzyme:substrate ratio of 1:100, but since the concentration of the sample is known to be very low and hard to measure while attached to the beads, we have empirically determined 1 µl to be an effective amount of enzyme to add to the reaction. Continue to agitate the beads to prevent them from settling in the tube. 6. Add 150 µl of 100 mM Tris-HCl, pH 8.5, to the sample to reduce the concentration of urea from 8 to 2 M. 7. Add 2 µl of 100 mM CaCl2 and 1 µl of sequencing-grade trypsin (0.5 µg/µl) to the sample and incubate at 37°C with agitation. We typically add trypsin to the reaction at an enzyme:substrate ratio of 1:20, but since the concentration of the sample is known to be very low and hard to measure while attached to the beads, we have empirically determined 1 µl to be an effective amount of trypsin to add to the reaction. This step is typically performed overnight but should be allowed to proceed for at least 4 h. 8. Centrifuge sample for 1 min at 2000g. 9. Carefully transfer the supernatant to a separate centrifuge tube, using a gel-loading pipette tip to avoid transferring any of the resin. 10. Add 12 µl of 88% formic acid to the supernatant (final concentration ∼5%). 11. Resuspend the resin in 100 µl of 5% formic acid and incubate at room temperature for 10 min with agitation. 12. Centrifuge the sample for 1 min at 2000g and pool the supernatant with the supernatant from Step 9. 13. Centrifuge the pooled supernatants for 2 min at 14,000g and transfer the resulting supernatant to a new microcentrifuge tube. 14. Repeat Step 13 until no resin is visible at the bottom of the tube after centrifugation. 15. The digested sample can be stored at −20°C until it is analyzed. 3.3. Microcapillary Column Construction and Sample Loading
1. Use an alcohol burner to blacken a 3–4 cm section in the center of a 50-cm piece of fused silica capillary tubing of 100 µm inner diameter and 360 µm outer diameter (see Note 3 and Fig. 3.3).
SUMO and Mass Spectrometry
41
2. Remove the blackened coating from the fused silica tubing by wiping with a kimwipe wetted with 100% ethanol until a clear section of the tubing remains. 3. Place the fused silica capillary tubing into a Sutter P-2000 laser puller with the clear section of the tubing centered in the optical pathway of the laser beam. 4. Operate the laser puller so that the 50-cm piece of fused silica capillary is pulled and separated into two 25-cm long columns with a tip containing 5 µm orifice on one end (see Note 12). 5. Place a 1.5 ml microcentrifuge tube containing the slurry of Luna C18 reverse-phase (RP) resin wetted in methanol into the pressure loading cell. 6. Insert the flat end of the pulled microcapillary column into the pressure loading cell through a Swagelok fitting containing a 0.4 mm teflon ferrule until the end of the column is submerged in the slurry. 7. Pressurize the pressure loading device to 800–1000 psi using helium gas to force the RP material into the column until the column contains ∼8 cm of packed RP material. 8. Repeat the packing procedure using the slurry of Luna SCX resin wetted in methanol to pack ∼3 cm of SCX material below the RP resin. 9. Repeat the packing procedure to pack an additional 3 cm of RP material below the SCX material. 10. Wash the packed column with HPLC Buffer A for at least 20 min to equilibrate the column. 11. Place the digested sample into the pressure loading cell and load the sample onto the packed and equilibrated microcapillary column. 12. After loading is completed, wash the column with HPLC Buffer A for at least 20 min. 3.4. Identification of SUMO-Conjugated Proteins Using Mass Spectrometry
1. Install the loaded and washed column into the nanoelectrospray stage so that the blunt end of the column is attached to the HPLC and the spray tip is 2–3 mm from the inlet of the mass spectrometer (see Note 4). 2. Operate the HPLC at a flow rate of 0.15 ml/min and use a 50 µm inner diameter waste line to split the flow and reduce the flow rate at the tip of the column to 200–300 nl/min (see Note 13). 3. Use the HPLC controlled by the Xcalibur instrument control software to deliver a series of seven chromatographic gradients to the column. The first step, whose purpose is to
42
Wohlschlegel
Fig. 3.3. Preparation of fused silica capillary columns. Electrospray tips with a 5-µm orifice are generated at one end of a capillary column using a Sutter P-2000 laser puller. The column is then packed with the appropriate chromatography resins using a pressure loading device, followed by loading of the proteolytically digested sample of interest onto the column, fractionation of the sample by liquid chromatography, and analysis of the peptides by tandem mass spectrometry.
desalt the column and move peptides from the RP segment at the back of the column to the SCX phase, consists of a 20 min linear gradient from 100% Buffer A to 100% Buffer B, followed by 5 min of 100% Buffer B, a 1 min linear gradient from 100% Buffer B to 100% Buffer A, and 4 min at 100% Buffer A. Gradients for Steps 2–7 consist of 5 min of 100% Buffer A, 3 min of x% Buffer C, a 90 min linear gradient from 100% Buffer A to 40% Buffer A/60% Buffer B, a 10 min linear gradient from 40% Buffer A/60% Buffer B to 100% Buffer B, 8 min at 100% Buffer B, a 1 min linear gradient to 100% Buffer A, and 3 min at 100% Buffer A (x = 10, 25, 40, 60, 80, and 100% Buffer C for Step 2–7, respectively). Steps 2–7 serve to move subpopulations of peptides from the SCX phase to the long RP segment and then resolve those peptides using a long gradient of increasing acetonitrile. 4. Peptides are eluted from the microcapillary column and electrosprayed directly into the mass spectrometer by the application of a 2.5 kV spray voltage. This can be accomplished by using a liquid-metal junction created by connecting the waste line to a microtee containing a gold wire that is attached the mass spectrometer’s high voltage source (see Note 13). 5. Data-dependent acquisition of peptide tandem mass spectra is controlled by the Xcalibur data system as peptides enter the mass spectrometer. This data collection strategy is based on a cycle in which the Orbitrap mass analyzer records a
SUMO and Mass Spectrometry
43
full MS scan (m/z range = 400–1600, resolution = 60000) consisting of all ions eluting into the mass spectrometer at a given point in time while the linear ion trap mass analyzer (LTQ) performs seven rounds of MS/MS analysis at 35% collision energy to collect peptide fragmentation spectra for the seven most abundant ions from the Orbitrap full MS scan. This cycle is repeated over the course of the entire chromatographic separation. 6. Spectra are initially collected and saved by Xcalibur data system in the RAW binary file format. The program RawXtract is used to convert the RAW files to ms2 files—a text-based format. SEQUEST is then used to search the ms2 files against a database that contains all S. cerevisiae protein sequences obtained from the Saccharomyces genome database (SGD) and is concatenated to a reversed database in which the primary sequence of each yeast protein is reversed. The false positive rate for a given scoring threshold is calculated by comparing the number of peptides matching the correct forward databases versus the reversed decoy database (16). The DTASelect2 algorithm is run on the dataset and uses a linear discriminant analysis to adjust the scoring cutoffs so that the false positive rate is less than 5%. 7. Mass spectrometric analysis should be carried out on both the Smt3 affinity purification and the control purification. The Contrast2 algorithm can be used to compare proteins identified from the Smt3 affinity purification and the control purification to identify proteins uniquely identified in the Smt3 sample. 3.5. Modified Protocol Used for Mapping SUMO Attachment Sites In a Specific Cellular Substrate
1. Purify SUMO conjugates using Ni-NTA chromatography as described in Sect. 3.1, Steps 1–16. 2. Elute the SUMO conjugates using 5 ml of guanidine elution buffer. 3. Add 100 µl of streptavidin agarose (50% slurry, 50 µl bead volume) equilibrated in guanidine binding buffer. 4. Rotate the sample at room temperature for 2 h. 5. Wash the beads as described in Sect. 3.1, Steps 23–27, using guanidine binding buffer, and then proceed to proteolytic digestion. 6. A small aliquot of beads may be analyzed at this stage by SDS-PAGE followed by Western blotting using streptavidin-HRP to monitor the effectiveness of the purification. It should be noted that the guanidine in the sample must be removed prior to analysis by SDS-PAGE in order to prevent the precipitation of SDS. This can be done by TCA or acetone precipitation.
44
Wohlschlegel
7. Protease digestion is performed as described in Sect. 3.2. 8. Microcapillary columns are fabricated as described in Sect. 3.3, except that the column is packed with a single, 10-cm segment of RP material instead of the three phases of packing material described previously (see Note 14). 9. The seven-step multidimensional separation described in Sect. 3.4, Step 3, is replaced by a single-step 120-min gradient consisting of 5 min of 100% Buffer A, a 90-min linear gradient from 100% Buffer A to 40% Buffer A/60% Buffer B, a 10-min linear gradient from 40% Buffer A/60% Buffer B to 100% Buffer B, 5 min at 100% Buffer B, a 5-min linear gradient to 100% Buffer A, and 5 min at 100% Buffer A. 10. The mass spectrometer settings are identical to those described in Sect. 3.4, Steps 4–5. 11. Data analysis is identical to that described in Sect. 3.4, Step 6, except that SEQUEST searches are modified to consider potential mass shifts of 484.2282 on lysine residues corresponding to a SUMO-modified peptide (see Note 15).
4. Notes 1. The approach described in this protocol utilizes an online multidimensional separation method to fractionate the peptide mixture on a triphasic column and elute the peptides directly into the mass spectrometer. We find that this strategy is extremely effective when attempting to analyze very low amounts of a complex mixture such as the sample of affinity-purified SUMO conjugates analyzed here. Alternative fractionation methods could also be employed including a GeLC-MS/MS approach in which the proteins are separated by SDS-PAGE; the entire lane corresponding to the sample is excised into a series of gel slices, and individual gel slices are digested with trypsin and analyzed using singledimension LC-MS/MS (17). 2. Although some modification sites can be identified directly from the complex mixture of SUMO-conjugated proteins, the high complexity and dynamic range of SUMO substrates in this purified sample severely limits the ability to identify SUMO attachment sites in all but the most abundant proteins in the mixture. In those cases where SUMO modification sites need to be determined for a single protein of interest, we specifically purify the sumoylated fraction of that protein away from all other SUMO conjugates using
SUMO and Mass Spectrometry
45
a tandem denaturing purification procedure similar to that originally described by Tagwerker et al. and then analyze the highly purified sample by mass spectrometry (18, 19). 3. This section describes a procedure for constructing and packing microcapillary columns that is cost-effective over the long term and offers flexibility in terms of column lengths and resin types. Prepacked columns are commercially available from New Objective, Inc. (Woburn, MA) and would also be suitable for the experiments described here. 4. Although the proteomic methods described in this section have been optimized for the instrumentation present in the author’s laboratory, the overall strategy is general in nature and could be adapted to other platforms. Any mass spectrometer capable of acquiring tandem mass spectra (Applied Biosystems Qstar, Waters Q-Tof, etc.) as well any algorithm able to perform differential modification searches (Pep_ probe, Mascot, etc.) can also be used. 5. Preserving the SUMO modification during the purification procedure by inhibition of the SUMO proteases is critical for the success of this approach. Although the use of denaturing buffers for lysis and purification is normally very effective at inhibiting protease activity, we have occasionally noted significant losses of SUMO conjugates during the course of the purification. If this is observed, the addition of N-ethylmaleimide (NEM) to the water washes in Sect. 3.1, Step 3, the lysis buffer, and the guanidine binding buffer can help to further preserve the modification. NEM is added to a final concentration of 10 mM from a 1 M stock prepared in DMSO. 6. The yeast cells can be lysed using a number of different methods. In addition to the chemical lysis procedure used here, bead beating, grinding the cells under liquid N2, or high-pressure homogenization are all effective means of cell disruption. The requirements for choosing a lysis method are that the lysate can be generated under denaturing conditions and that the conditions are compatible with Ni-NTA affinity chromatography. 7. Long-term storage of urea-containing buffers leads to the dissociation of the urea and alteration of the pH of the buffer. The pH of urea-containing buffers should be checked immediately before use and adjusted if necessary. 8. For unknown reasons, we and others have consistently observed that Ni-NTA agarose has a significantly lower than predicted binding capacity in yeast whole cell lysates, requiring a large amount of the resin to be used in initial binding reaction (20). Consequently, the bead and elution volumes
46
Wohlschlegel
from the initial purification are quite large, making further manipulations (tryptic digestion, etc.) more difficult. To concentrate the protein for digestion, we typically use a second round of Ni-NTA purification using a small amount of resin. The components present in the yeast whole cell lysate that diminish the binding capacity of the Ni-NTA are absent in the second round of purification, allowing a much smaller volume of Ni-NTA resin to be used. 9. The digestion of samples by trypsin and other proteases is greatly facilitated by having a high protein concentration in the sample, which is typically achieved by concentration of the sample as much as possible. Although protein concentration methods such as TCA precipitation can be used here, we have noticed a significant amount of sample loss when attempting to precipitate low amounts of protein. In this particular purification, we take advantage of the high concentration of the protein on the Ni-NTA resin or streptavidin-sepharose during the second round of purification and perform the tryptic digestion directly off the beads. 10. Samples should be agitated through the course of the digestion to prevent the beads from settling at the bottom of the tube. We use a thermomixer for this purpose (Eppendorf, Westbury, NY) where both the rate of agitation and the temperature can be accurately controlled. It is also possible to perform these digestions using a tube rotator placed in an appropriate incubator. 11. Iodoacetamide is light sensitive. It should be freshly prepared before use, and all incubations should be carried out in the dark (wrap tubes or thermomixer in foil). 12. The settings required for creating electrospray tips using the Sutter P-2000 laser puller vary from instrument to instrument and must be individually determined. More details regarding determining and optimizing the settings can be found in the manufacturer’s instructions. An example program that can serve as the starting point for optimization can be found in Florens et al. (21). 13. Many of the parameters described here for flow-splitting and the application of voltage are dependent on the type of HPLC and electrospray source used and must be adjusted accordingly. 14. The sequential purification of a sumoylated factor by NiNTA agarose and streptavidin agarose leads to a high degree of enrichment and the final sample typically has very few components (low complexity). For this reason, we typically fractionate this type of sample using a single-dimension reverse-phase separation instead of the multidimensional separation described previously.
SUMO and Mass Spectrometry
47
15. Mapping of SUMO attachments sites is technically difficult even when using the strategy described here. If no SUMO attachments sites are identified using this method, a number of alternative approaches may be employed to increase the chance of success. Overexpression of SUMO or the introduction of a temperature-sensitive allele of the SUMO protease Ulp1 into the yeast strain can increase the abundance of the sumoylated substrate and help facilitate the mapping studies (22). We have also found that different C-terminal SUMO mutants can improve mapping studies by generating sumoylated peptides that are more amenable to mass spectrometry as well as enabling the use of different protease digestion strategies to observe regions of the protein that may be difficult to identify using only trypsin (15, 23). An algorithm that uses a modified scoring scheme optimized for identifying sumoylated peptides has recently been described and may prove to be a useful addition to these basic strategies (24). Finally, in those cases where the amount of sumoylated substrate that can be purified is still extremely prohibitive, the sumoylated substrate can either be produced in vitro or in a heterologous system for generating sumoylated proteins and then used for the mapping procedures (15, 23). This alternative has the major drawback that any sites identified in vitro must be examined further in an in vivo system to confirm their biological authenticity. 16. Although the procedures described here focus on analyzing SUMO conjugation in S. cerevisiae, the strategies themselves can be adapted to study the SUMO pathway in higher eukaryotes. One important consideration for the mapping of SUMO attachment sites in higher eukaryotes is the choice of protease to be used in order to generate a SUMO-specific mass signature for the modified peptide. For example, human SUMO-1 does not possess a tryptic cleavage site near its C-terminus and the digestion of a protein modified by human SUMO-1 leaves a 19 amino acid residue fragment from the C-terminus of SUMO attached to the modified target lysine. Although peptides containing this large fragment have been successfully identified using a specialized algorithm, the identification of peptides in this manner remains extremely challenging (24). As an alternative approach for mapping modification sites in higher eukaryotes, it is also possible to use site-directed mutagenesis to introduce a tryptic cleavage site near the C-terminus of human SUMO or to use an alternate protease such as Glu-C that does contain a cleavage site near the SUMO C-terminus (15, 23). Either of these strategies can be used to generate modified peptides that possess a SUMO-specific mass signature that can be readily monitored using mass spectrometry.
48
Wohlschlegel
References 1. Denison, C., Kirkpatrick, D. S., and Gygi, S. P. (2005) Proteomic insights into ubiquitin and ubiquitin-like proteins. Curr. Opin. Chem. Biol. 9, 69–75. 2. Hannich, J. T., Lewis, A., Kroetz, M. B., Li, S. J., Heide, H., Emili, A., and Hochstrasser, M. (2005) Defining the SUMOmodified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280, 4102–4110. 3. Li, T., Evdokimov, E., Shen, R. F., Chao, C. C., Tekle, E., Wang, T., Stadtman, E. R., Yang, D. C., and Chock, P. B. (2004) Sumoylation of heterogeneous nuclear ribonucleoproteins, zinc finger proteins, and nuclear pore complex proteins: a proteomic analysis. Proc. Natl. Acad. Sci. USA 101, 8551–8556. 4. Manza, L. L., Codreanu, S. G., Stamer, S. L., Smith, D. L., Wells, K. S., Roberts, R. L., and Liebler, D. C. (2004) Global shifts in protein sumoylation in response to electrophile and oxidative stress. Chem. Res. Toxicol. 17, 1706–1715. 5. Panse, V. G., Hardeland, U., Werner, T., Kuster, B., and Hurt, E. (2004) A proteomewide approach identifies sumoylated substrate proteins in yeast. J. Biol. Chem. 279, 41346–41351. 6. Rosas-Acosta, G., Russell, W. K., Deyrieux, A., Russell, D. H., and Wilson, V. G. (2005) A universal strategy for proteomic studies of SUMO and other ubiquitin-like modifiers. Mol. Cell. Proteomics 4, 56–72. 7. Vertegaal, A. C., Ogg, S. C., Jaffray, E., Rodriguez, M. S., Hay, R. T., Andersen, J. S., Mann, M., and Lamond, A. I. (2004) A proteomic study of SUMO-2 target proteins. J. Biol. Chem. 279, 33791–33798. 8. Wohlschlegel, J. A., Johnson, E. S., Reed, S. I., and Yates, J. R., 3rd (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J. Biol. Chem. 279, 45662– 456628. 9. Zhao, Y., Kwon, S. W., Anselmo, A., Kaur, K., and White, M. A. (2004) Broad spectrum identification of cellular small ubiquitin-related modifier (SUMO) substrate proteins. J. Biol. Chem. 279, 20999–21002. 10. Zhou, W., Ryan, J. J., and Zhou, H. (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J. Biol. Chem. 279, 32262–32268. 11. Florens, L., and Washburn, M. P. (2006) Proteomic analysis by multidimensional
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
protein identification technology. Methods Mol. Biol. 328, 159–175. Washburn, M. P., Wolters, D., and Yates, J. R., 3rd (2001) Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat. Biotechnol. 19, 242–247. Denison, C., Rudner, A. D., Gerber, S. A., Bakalarski, C. E., Moazed, D., and Gygi, S. P. (2005) A proteomic strategy for gaining insights into protein sumoylation in yeast. Mol. Cell. Proteomics 4, 246–254. Peng, J., Schwartz, D., Elias, J. E., Thoreen, C. C., Cheng, D., Marsischky, G., Roelofs, J., Finley, D., and Gygi, S. P. (2003) A proteomics approach to understanding protein ubiquitination. Nat. Biotechnol. 21, 921–926. Wohlschlegel, J. A., Johnson, E. S., Reed, S. I., and Yates, J. R., 3rd (2006) Improved identification of SUMO attachment sites using C-terminal SUMO mutants and tailored protease digestion strategies. J. Proteome Res. 5, 761–770. Peng, J., Elias, J. E., Thoreen, C. C., Licklider, L. J., and Gygi, S. P. (2003) Evaluation of multidimensional chromatography coupled with tandem mass spectrometry (LC/LC-MS/ MS) for large-scale protein analysis: the yeast proteome. J. Proteome Res. 2, 43–50. Schirle, M., Heurtier, M. A., and Kuster, B. (2003) Profiling core proteomes of human cell lines by one-dimensional PAGE and liquid chromatography-tandem mass spectrometry. Mol. Cell. Proteomics 2, 1297–1305. Tagwerker, C., Flick, K., Cui, M., Guerrero, C., Dou, Y., Auer, B., Baldi, P., Huang, L., and Kaiser, P. (2006) A tandem affinity tag for two-step purification under fully denaturing conditions: application in ubiquitin profiling and protein complex identification combined with in vivo cross-linking. Mol. Cell. Proteomics 5, 737–748. Tagwerker, C., Zhang, H., Wang, X., Larsen, L. S., Lathrop, R. H., Hatfield, G. W., Auer, B., Huang, L., and Kaiser, P. (2006) HB tag modules for PCR-based gene tagging and tandem affinity purification in Saccharomyces cerevisiae. Yeast 23, 623–632. Kaiser, P., and Wohlschlegel, J. (2005) Identification of ubiquitination sites and determination of ubiquitin-chain architectures by mass spectrometry. Methods Enzymol. 399, 266–277. Florens, L., Carozza, M. J., Swanson, S. K., Fournier, M., Coleman, M. K., Workman,
SUMO and Mass Spectrometry J. L., and Washburn, M. P. (2006) Analyzing chromatin remodeling complexes using shotgun proteomics and normalized spectral abundance factors. Methods 40, 303–311. 22. Li, S. J., and Hochstrasser, M. (1999) A new protease required for cell-cycle progression in yeast. Nature 398, 246–251. 23. Knuesel, M., Cheung, H. T., Hamady, M., Barthel, K. K., and Liu, X. (2005) A method of mapping protein sumoylation
49
sites by mass spectrometry using a modified small ubiquitin-like modifier 1 (SUMO-1) and a computational program. Mol. Cell. Proteomics 4, 1626–1636. 24. Pedrioli, P. G., Raught, B., Zhang, X. D., Rogers, R., Aitchison, J., Matunis, M., and Aebersold, R. (2006) Automated identification of SUMOylation sites using mass spectrometry and SUMmOn pattern recognition software. Nat. Methods 3, 533–539.
Chapter 4 Identification of SUMO Targets Through In Vitro Expression Cloning Christian B. Gocke and Hongtao Yu Abstract Covalent modification of proteins by small ubiquitin-like modifier (SUMO) regulates diverse cellular processes. While many SUMO substrates are identified through individual efforts, affinity-based approaches followed by mass spectrometry are also used to identify in vivo SUMO substrates in yeast and in mammals. Because of low steady-state levels of sumoylation and biases towards abundant targets, identifying sumoylated proteins in vivo can be challenging. The in vitro expression cloning (IVEC) method for SUMO target identification circumvents these challenges and complements the affinity-based approaches. IVEC allows for immediate validation and analysis of substrates through in vitro reconstitution. Furthermore, this method can be easily adapted to identify substrates of specific SUMO ligases. Key words: In vitro expression cloning, SUMO, sumoylation, SUMO ligase, Ubc9.
1. Introduction The small ubiquitin-like modifier (SUMO) is conserved from yeast to man and regulates diverse cellular processes (1–4). Sumoylation refers to the covalent attachment of SUMO to the ε-amino group of a lysine residue in a substrate or target, forming an isopeptide bond. Sumoylation is catalyzed by a cascade of enzymes, including the E1 SUMO-activating enzyme (the Aos1– Uba2 heterodimer), the E2 SUMO-conjugating enzyme (Ubc9), the E3 SUMO ligases, and the SUMO isopeptidases and proteases (SENPs). Many SUMO substrates have been identified by candidate-based approaches (2, 4). Affinity-based approaches in conjunction with mass spectrometry have also been used to systematically identify in vivo SUMO substrates in yeast and
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
51
52
Gocke and Yu
mammals (5–10). These approaches have several shortcomings and challenges, including low steady-state levels of sumoylation in the cell and biases towards abundant proteins. Furthermore, once substrates are identified using mass spectrometry, validation of these putative SUMO substrates requires cloning of the corresponding genes or obtaining antibodies against them. The in vitro expression cloning (IVEC) method was developed by Kirschner and coworkers (11). In this method, small pools of cDNA plasmids are transcribed in vitro and translated in rabbit reticulocyte lysate in the presence of 35S-methionine. The mixture of radiolabeled proteins is subjected to posttranslational modifications, such as phosphorylation, ubiquitylation, sumoylation, or proteolysis, by purified recombinant enzymes. The modified proteins are analyzed by SDS-PAGE to identify pools that contain targets of these modifications. The pools of cDNAs are then divided to identify the genes encoding each target. The IVEC method is thus ideal for the identification of enzyme substrates. It has been successfully used to identify substrates of kinases (12), ubiquitin ligases (13), and caspases (14). We had previously adapted IVEC to identify SUMO substrates (15). IVEC avoids the biases and complications associated with affinity-based techniques discussed above. In our protocol, 35 S-labeled in vitro translated proteins from a pooled cDNA plasmid library are subjected to control or sumoylation reactions. SDS-PAGE and autoradiography are used to visualize changes in gel mobility consistent with sumoylation. The cDNAs encoding individual substrates are then isolated from the corresponding pools and sequenced. This technique is specific and sensitive in identifying in vitro SUMO substrates (15).
2. Materials 2.1. Purification of Recombinant Sumoylation Enzymes
1. Plasmids: pET28a-SUMO1, pET28a-SUMO2, pET11c-Aos1, pET28b-Uba2, pET28b-Ubc9, and pGEX-4T-Ulp1 (15). 2. Competent BL21(DE3) bacterial cells. 3. Isopropyl β-D-1-thiogalactopyranoside (IPTG): dissolve in water at a concentration of 1 M. 4. 1 l culture flasks and centrifuge bottles. 5. LB broth and agar supplemented with 100 µg/ml ampicillin or 30 µg/ml kanamycin. 6. Lysozyme: dissolve in Tris-buffered saline (TBS) at a concentration of 100 mg/ml. 7. 0.45 µm filters and syringes.
In Vitro Expression Cloning of SUMO Targets
53
8. Bradford protein detection reagent (Bio-Rad; Cat#: 5000006): dilute 1:5 with water before use. 9. Coomassie Blue staining solution: 2 g Coomassie Blue, 2 l methanol, 1.6 l water, 400 ml of glacial acetic acid. 10. Destaining solution: 200 ml glacial acetic acid, 400 ml methanol, 3.4 l water. 11. Chromatography columns (Bio-Rad, Econo-Pac columns, Cat#: 732-1010). 12. Glutathione Sepharose-4B (GE Healthcare). 13. Ni2+-NTA agarose beads (Qiagen). 14. Amicon Ultra −15 (10 kDa cut-off) concentrators. 15. Superdex 200 (HiLoad 16/60) gel-filtration column (GE Healthcare). 16. PD-10 desalting columns (GE Healthcare). 17. Branson Sonifier 450 or equivalent. 18. Lysis Buffer: 50 mM Tris-HCl (pH 7.7), 150 mM KCl, and 0.1% Triton X-100. Store at 4°C. Add 15 mM β-mercaptoethanol before use. 19. Wash Buffer: 50 mM Tris-HCl (pH 7.7), 300 mM KCl, and 0.1% Triton X-100. Store at 4°C. Add 15 mM β-mercaptoethanol before use. 20. Storage Buffer: 20 mM Tris-HCl (pH 7.7), 100 mM KCl, and 10% glycerol. Store at 4°C. Add 1 mM DTT before use. 2.2. In Vitro Expression Cloning of SUMO Substrates
1. ProteoLink Human Adult Brain cDNA library (Promega, Cat#: L6500) (see Note 1). 2. Gold TNT SP6 Express 96-well plate (Promega, Cat#: L6501). 3.
35
S-Methionine (GE Healthcare, Cat#: SJ1015, 1000 Ci/ mmol).
4. Energy Mix: 150 mM phosphocreatine, 20 mM ATP, 2 mM EGTA, and 20 mM MgCl2. Adjust to pH 7.7. Store at −80°C. 5. XB buffer: 10 mM HEPES (pH 7.7), 1 mM MgCl2, 0.1 mM CaCl2, 100 mM KCl, and 50 mM Sucrose. Store at −80°C. 6. 2X SDS Sample Buffer: 2.9 g SDS, 0.4 g Tris-base, 12 ml glycerol, 40 mg bromophenol blue, and 620 mg DTT. Add distilled water to 40 mL. Store at −20°C. 7. 1X SDS running buffer: 60 g Tris base, 144 g glycine, and 10 g SDS. Add distilled water to 10 l. 8. Gel dryer (Bio-Rad model 583 and HydroTech vacuum pump or equivalent). 9. DH5α competent cells. 10. Multichannel pipettes/tips.
54
Gocke and Yu
11. 96-well reaction plates (Rainin, Cat#: R96-OAPV-1CO or similar). 12. SealPlate adhesive (EXCEL Scientific; Cat#: 100-SEALPLT). 13. Criterion Precast gels and 4 Criterion cells (Bio-Rad). Use 26-well Tris-HCl gels, 1.0 mm thickness. 14. Fujifilm BAS cassette2 2040 and FLA-5100 image reader. 15. Flat-Bottom blocks. 96-well blocks with 2 ml wells plus lids (Qiagen, Cat#: 19579). Autoclave before use. 16. Mini-prep kits.
3. Methods The overall scheme for identifying SUMO substrates by IVEC and the results for the identification of a representative substrate are shown in Figs. 4.1 and 4.2. The two most important steps in preparing for IVEC are given as follows: (1) choosing the appropriate cDNA library, and (2) purification of high-quality SUMO enzymes for the biochemical assay. We used a commercial library that contained about 50 cDNAs in each pool. Alternatively, a homemade library could be used. It is important that there is broad representation of the genome and that repetitiveness based on mRNA abundance is minimized. Once the SUMO enzymes are purified, one should perform reactions on a known substrate for quality control. Reactions and techniques can be optimized at this time before starting the large-scale experiment. Unlike most ubiquitylation reactions, efficient in vitro sumoylation does not require a SUMO ligase (E3 ligase) because Ubc9 directly binds to the consensus motif ΨKXE (Ψ, a large hydrophobic residue; X, any amino acid) on the substrate (16). One could, however, modify this procedure and identify substrates of a given SUMO ligase by comparing samples with and without the SUMO ligase of interest. 3.1. Purification of Recombinant Sumoylation Enzymes
1. Transform the appropriate plasmids (see Sect. 2.1.1 or similar constructs) into BL21(DE3) bacteria. Cotransform the Uba2 and Aos1 plasmids and use different antibiotic resistances to ensure selection of cotransformants. 2. Seed a single colony in 100 ml of LB and the appropriate antibiotic(s) and shake at 37°C for 10–14 h at 250 rpm. 3. Dilute approximately 1:100 to 1:50 in fresh LB and antibiotics and shake at 250 rpm at 37°C until the OD600 is between 0.5 and 0.7. Add IPTG to a final concentration of 250 µM and
In Vitro Expression Cloning of SUMO Targets
55
Fig. 4.1. In vitro expression cloning of SUMO substrates: primary screen. A cDNA library with multiple cDNAs per well in a 96-well format is in vitro transcribed and translated in the presence of 35S-methionine. In vitro expressed proteins are then subjected to control (−) or sumoylation (+) reactions followed by SDS-PAGE and autoradiography. The gel of samples from row E in plate B is shown in the bottom panel. Well E12 displays new high molecular weight bands that appear after sumoylation (indicated by a bracket). A disappearing substrate band (indicated by an asterisk) was also observed, although this is often less clear unless sumoylation is very efficient.
incubate for another 4–6 h at room temperature. Harvest bacteria using centrifugation. Wash the pellet once with phosphate-buffered saline (PBS). Confirm protein expression by comparing samples with and without IPTG on SDS-PAGE followed by Coomassie Blue staining and destaining. 4. Store the bacterial pellet at −80°C (stable for several months). Alternatively, resuspend the pellet in lysis buffer and then freeze.
56
Gocke and Yu
Fig. 4.2. In vitro expression cloning of SUMO substrates: secondary screen and validation. (A) Once putative hits have been identified in the primary screen, cDNAs from that well are transformed into E. coli and single colonies are cultured in 96-well blocks. Bacteria culture from individual rows (R1–8) or columns (C1–12) are combined. After plasmid purification, cDNAs are tested for sumoylation as in Fig. 4.1. Substrates are identified by a matrix-assisted technique. The individual clone is isolated, confirmed for sumoylation, and sequenced. (B, C) Secondary screen to identify the substrate in E12 on plate B as shown in Fig. 4.1. The dashed boxes mark the same substrate (BRD8) found in C11 and R5, indicating the exact location of the positive clone in the 96-well culture block.
5. Resuspend the pellet in 5 pellet volumes of ice-cold lysis buffer by vortexing. Add lysozyme to a final concentration of 1 mg/mL. Incubate on ice for 20–30 min with intermittent mixing. 6. Transfer the lysate to a glass beaker. Sonicate the lysate in an ice-water bath for 2 min with a duty cycle of 50% and a power output of 5 (these settings apply to the Branson Sonifier 450 and may have to be adjusted when using other models). Repeat the procedure until the lysate is no longer viscous as determined by pipetting with a 1 ml microtip. 7. Spin the lysate at 30,000g at 4°C for 1 h. Filter the supernatant using a syringe attached to a 0.45 µm filter (see Note 2). 8. Depending on the specific protein to be purified, add 1 mL of Ni2+-NTA or glutathione Sepharose beads to the supernatant. Beads should be pre-equilibrated with 20 ml of lysis buffer. Incubate the supernatant with beads for 1 h at 4°C with constant but gentle mixing. Pour beads and supernatant into a 30 ml Econo-Pac column and allow the supernatant to drain.
In Vitro Expression Cloning of SUMO Targets
57
9. Wash the beads with 50 ml of wash buffer or until the washes are negative for proteins as determined by adding one drop of the wash solution into 200 µl of Bradford protein detection reagent solution. 10. Elute protein with wash buffer containing 10 mM glutathione for GST fusion proteins or 200 mM imidazole for Histagged proteins. Collect three fractions of 3 ml each. 11. Confirm size, purity, and quantity of the eluted proteins on SDSPAGE followed by Coomassie Blue staining and destaining. 12. Concentrate the eluate to approximately 2.5 ml using Centriprep concentrators. Apply the eluate to a PD-10 column pre-equilibrated with storage buffer. Elute protein with 3.5 ml of storage buffer. For the His6-Aos1–Uba2 complex, concentrate the eluate and directly apply to a Superdex 200 column pre-equilibrated with two column volumes of storage buffer. 13. Concentrate all enzymes to 1–2 mg/ml. Aliquot, flash freeze, and store at −80°C. 3.2. In Vitro Expression Cloning of SUMO Substrates
1. Test and optimize sumoylation reactions using a known substrate using procedures similar to that described below. This step is extremely important, because it determines the sensitivity and feasibility of the screen (see Note 3). 2. In vitro express cDNA libraries in 96-well plates (Fig. 4.1). Pipette 2 µl of each cDNA pool into a 96-well plate containing 20 µl of Gold TNT lysate supplemented with 2 µl of distilled water and 1 µL of 35S-Methionine in each well. Mix by gently vortexing. 3. Incubate at 30°C for 90 min. 4. Store at −80°C. Avoid multiple cycles of freezing and thawing. 5. Thaw in vitro expressed protein on ice. In a 96-well reaction plate, add 2 µl of in vitro expressed protein to 8 µl of control mix or sumoylation mix. The control mix contains XB buffer only. The sumoylation mix contains 2 µg of Aos1– Uba2, 0.5 µg of Ubc9, 1 µg of SUMO, 1 µl of energy mix, and is adjusted to 8 µl with XB buffer. Prepare these reactions on ice, and add the energy mix finally (see Note 4). It is prudent to run a test plate of sumoylation reactions for quality control before expression and sumoylation of the entire library. 6. Apply the adhesive film and mix 96-well plate reactions by gentle vortexing. 7. Incubate at 30°C for 2 h. 8. Stop the reactions by applying 10 µl of 2X-SDS sample buffer to each well. Denature the proteins by placing the 96-well plates on heat blocks at 100°C for 2–3 min.
58
Gocke and Yu
9. Load 10 µl of sample into wells of precast Bio-Rad gels (see Notes 5 and 6). 10. Run gels at 30 mA for approximately 2 h in 1 X SDS running buffer. 11. Stain with Coomassie Blue for 30 min and destain for approximately 1 h (see Note 7). 12. Dry gels at 80°C for 2 h (see Note 8). 13. Place the dried gels in a phosphorimager cassette. Label molecular weight markers by blotting 35S samples on the filter paper next to markers and expose overnight (see Note 9). 14. Analyze the images using a phosphorimager. Identify high molecular weight bands that appear in the sumoylation lane, but are absent in the control lane (Fig. 4.1, see bracket in lane E12). The band belonging to the unsumoylated substrate may not always be clear. However, bands that disappear specifically in the sumoylation lane are of interest, as detection of smears can sometimes be difficult. Set your own standards for characterizing “hits,” depending on the sensitivity and specificity of your particular assay (see Note 10). 15. Once positive hits are identified, transform the cDNA pools from these wells into DH5α so that approximately 500 colonies are obtained (Fig. 4.2A). 16. Pick colonies (see Note 11) using autoclaved microtips. Inoculate 1 ml of LB-ampicillin in each well of a 96-well block (Fig. 4.2A). Tips should be removed only after all colonies are inoculated to avoid inoculating the same well twice. Shake overnight at 37°C. 17. Combine 0.4 ml of culture from each well within a row or a column (R1-8 and C1-12) (see Note 12) so that only 20 mini-preps are necessary to identify the hit (Fig. 4.2A). Bacteria can be combined into a single tube simply by releasing cultures from a multichannel pipettor onto a clean spatula that feeds into a 15-ml culture tube. Store the rest of the bacterial culture in the 96-well culture block at 4°C while performing the secondary sumoylation screens. 18. Repeat steps 2–14 described in Section 3.2. but use 1 µl of each DNA miniprep, 0.5 µl of 35S-Methionine, and 10 µl of TNT lysate. Identify the specific well in the 96-well bacterial culture block (Fig. 4.2B, see C11, R5) that contains the substrate. 19. Repeat steps 2–14 described in Section 3.2. but with a single plasmid encoding the sumoylated substrate identified in Step 18. Use 1 µl of miniprep DNA, 0.5 µl of 35S-Methionine, and 10 µl of TNT lysate for in vitro translation. 20. Once sumoylation of the substrate is confirmed, sequence the plasmid.
In Vitro Expression Cloning of SUMO Targets
59
21. Validate at least some of the substrates by repeating the sumoylation reactions. Omit individual components of the sumoylation machinery from or add Ulp1 (a SENP) to the reactions to demonstrate specificity (see Note 13).
4. Notes 1. The cDNA library can be custom made or purchased. It is preferable that the library is normalized and pooled into approximately 100 cDNAs per well in a 96-well format. Expression of each cDNA can be driven by Sp6 or T7 promoters. While the quality of the library used in our screen was generally good, only 15–20 identifiable bands on average (instead of the about 100 proteins expected) were obtained after in vitro translation of each cDNA pool (Fig. 4.1). In addition, as this library is made from brain tissues that contain mostly terminally differentiated cells, substrates involved in the active cell division cycle may be underrepresented. 2. Filtration may be difficult, but will save time later because it removes particulate material that will clog your column. 3. The quality of the purified recombinant SUMO enzymes should be tested using a known substrate. MEF2C is a suitable substrate for this purpose. Do not use substrates that are too efficiently sumoylated in vitro, e.g., SUMO ligases, which are known to undergo efficient autosumoylation. The use of efficient SUMO substrates may provide false assurance of the quality of the recombinant enzymes. Sumoylation reactions should also be optimized by varying the quantity of enzymes and the length of the incubation. Finally, while we used SUMO1 in our screen, SUMO2 can be used instead to identify substrates that are conjugated to SUMO2. 4. The sumoylation reactions need to be prepared on ice, because autosumoylation of the sumoylation machinery at room temperature may deplete certain reactants before the addition of substrates. This is especially important if the screen is adapted to search for substrates of E3 ligases. We typically make a master reaction mix, aliquot it into 8 wells, and then distribute 8 µl per well in a 96-well plate using a multichannel pipettor. 5. It is important to load samples onto SDS-PAGE immediately after boiling. Freeze-thawing requires reboiling of samples prior to loading and decreases the quality of autoradiography. If samples are boiled for too long, water will evaporate and cause SDS to precipitate, making loading difficult and unreliable. 6. We used 10% gels in our screen. Higher percentage gels or gradient gels can also be used. However, in our experience, these gels tend to crack more easily during the drying process.
60
Gocke and Yu
7. Staining and destaining does not need to be complete before gel drying. This step simply washes away excess free 35S-methionine, fixes the gel, and allows visualization of bands to confirm equal loading and the quality of the sample. Bands should be sharp and equal across lanes. If running multiple gels, cut corners off to keep track of the gels. We recommend running a maximum of 8 gels at a time (enough to screen one 96-well plate). 8. To decrease cracking of gels during the drying process, submerge a sheet of filter paper underneath the gel in a large dish of water to capture the gel on top of the paper. Make sure that the gels are completely dry before releasing vacuum. 9. The benefit of analyzing data at various intensities and with a digital format using a phosphorimager outweighs the better resolution of film. 10. New substrates not seen in the primary screen may be identified during the secondary screens (Fig. 4.2B, lanes C8, R7). This could be due to crowding in the lanes during the primary screen or because of reduced competition among the expressed proteins (8 in the secondary screen versus 100 in the primary screen). The intensity ratio of the sumoylated and unsumoylated bands can be used to measure the sumoylation efficiency of a substrate. Hits identified in the primary screen are typically more efficient substrates. 11. If 96 colonies per positive pool are picked for the secondary screen, it is possible that the original substrate will not be identified. In this case, another 96 colonies should be picked and screened to identify the hit. 12. Although mini-prep kits in 96-well format are available, we still recommend the use of the matrix-assisted method to identify substrates described above. This method reduces the work load of the secondary screen by nearly 5-fold. 13. The specificities of isopeptidases should be kept in mind for such assays. For example, Ulp1 shows little activity toward the SUMO2-conjugated substrates, but is very active against SUMO1 (K. Orth, personal communication).
Acknowledgments We thank Dr. Jungseog Kang for assistance in developing the IVEC SUMO screen and Joshua Bembenek for the purification of SUMO enzymes. We also thank Frauke Melchior, Kim Orth, and Stefan Muller for providing expression constructs and purification protocols of SUMO enzymes.
In Vitro Expression Cloning of SUMO Targets
61
References 1. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 2. Seeler, J. S., and Dejean, A. (2003) Nuclear and unclear functions of SUMO. Nat. Rev. Mol. Cell Biol. 4, 690–699. 3. Melchior, F., Schergaut, M., and Pichler, A. (2003) SUMO: ligases, isopeptidases and nuclear pores. Trends Biochem. Sci. 28, 612–618. 4. Muller, S., Ledl, A., and Schmidt, D. (2004) SUMO: a regulator of gene expression and genome integrity. Oncogene 23, 1998–2008. 5. Li, T., Evdokimov, E., Shen, R. F., Chao, C. C., Tekle, E., Wang, T., Stadtman, E. R., Yang, D. C., and Chock, P. B. (2004) Sumoylation of heterogeneous nuclear ribonucleoproteins, zinc finger proteins, and nuclear pore complex proteins: A proteomic analysis. Proc. Natl. Acad. Sci. USA 101, 8551–8556. 6. Panse, V. G., Hardeland, U., Werner, T., Kuster, B., and Hurt, E. (2004) A Proteomewide Approach Identifies Sumoylated Substrate Proteins in Yeast. J. Biol. Chem. 279, 41346–41351. 7. Vertegaal, A. C., Ogg, S. C., Jaffray, E., Rodriguez, M. S., Hay, R. T., Andersen, J. S., Mann, M., and Lamond, A. I. (2004) A proteomic study of SUMO-2 target proteins. J. Biol. Chem. 279, 33791–33798. 8. Wohlschlegel, J. A., Johnson, E. S., Reed, S. I., and Yates, J. R., 3rd (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J. Biol. Chem. 279, 45662– 45668. 9. Zhao, Y., Kwon, S. W., Anselmo, A., Kaur, K., and White, M. A. (2004) Broad spectrum identification of cellular small ubiquitin-
10.
11.
12.
13.
14.
15.
16.
related modifier (SUMO) substrate proteins. J. Biol. Chem. 279, 20999–21002. Zhou, W., Ryan, J. J., and Zhou, H. (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J. Biol. Chem. 279, 32262–32268. Lustig, K. D., Stukenberg, P. T., McGarry, T. J., King, R. W., Cryns, V. L., Mead, P. E., Zon, L. I., Yuan, J., and Kirschner, M. W. (1997) Small pool expression screening: identification of genes involved in cell cycle control, apoptosis, and early development. Methods Enzymol. 283, 83–99. Stukenberg, P. T., Lustig, K. D., McGarry, T. J., King, R. W., Kuang, J., and Kirschner, M. W. (1997) Systematic identification of mitotic phosphoproteins. Curr. Biol. 7, 338–348. McGarry, T. J., and Kirschner, M. W. (1998) Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 1043–1053. Cryns, V. L., Byun, Y., Rana, A., Mellor, H., Lustig, K. D., Ghanem, L., Parker, P. J., Kirschner, M. W., and Yuan, J. (1997) Specific proteolysis of the kinase protein kinase C-related kinase 2 by caspase-3 during apoptosis. Identification by a novel, small pool expression cloning strategy. J. Biol. Chem. 272, 29449–29453. Gocke, C., Yu, H., and Kang, J. (2004) Systematic identification and analysis of mammalian small ubiquitin-like modifier substrates. J. Biol. Chem. 280, 5004–5012. Sampson, D. A., Wang, M., and Matunis, M. J. (2001) The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J. Biol. Chem. 276, 21664–21669.
Chapter 5 Enhanced Detection of In Vivo SUMO Conjugation by Ubc9 Fusion-Dependent Sumoylation (UFDS) Rainer Niedenthal Abstract The bottleneck in studying protein sumoylation—the conjugation of the small ubiquitin-like modifier (SUMO)—is the detection of the low level of in vivo sumoylated proteins. The Ubc9 fusion-directed sumoylation (UFDS) system strongly enhances the in vivo sumoylation of a substrate protein at its specific sumoylation site. UFDS utilizes an expression plasmid for the protein of interest fused to the SUMO-conjugating enzyme Ubc9. When expressed in HEK293, COS-7, HeLa, or CHO cells, the fused target protein is conjugated with endogenous or coexpressed SUMO at its native sumoylation sites. This sumoylation requires neither SUMO ligase nor any extracellular stimulation and is easily detectable by fusion protein- or Ubc9-specific Western blotting with commercially available antibodies. Key words: SUMO, Ubc9, sumoylation, Ubc9 fusion-directed sumoylation, UFDS, in vivo sumoylation.
1. Introduction Sumoylation is a protein conjugation process similar to ubiquitylation and conjugation of other ubiquitin-like proteins (Ubls). It is involved in the regulation of many different cellular processes, but, in contrast to ubiquitylation, it is most likely not involved in proteasomal protein degradation (1). Sumoylation first requires SUMO maturation, where one of five known SUMO-specific proteases cleaves the SUMO precursor protein (2). Subsequently, the SAE1–SAE2 complex (E1) activates SUMO (3–6) and transfers it to the SUMO-conjugating enzyme Ubc9 (E2) (7–8). SUMO-loaded Ubc9 in turn conjugates substrate proteins with SUMO directly (9) or is supported by SUMO ligases (10–13). Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
63
64
Niedenthal
Sumoylation can be reverted by SUMO-specific proteases (2). In contrast to other Ubl-conjugating processes, most SUMO ligases act mainly as adaptors between Ubc9 and the sumoylation substrates. Furthermore, they do not appear to be absolutely essential for most sumoylations as shown by efficient in vitro or E. coli sumoylation systems (14) that function without SUMO ligases. Depending on the small amount of a specific sumoylated protein in the cell, it is difficult to study sumoylation of a protein of interest in vivo. We therefore tested whether the SUMO ligase adaptor function can be replaced by the direct fusion of Ubc9 to the substrate proteins (Fig. 5.1A). To this end, we developed eukaryotic protein expression vectors allowing the fusion of Ubc9 to the N- or the C-terminus of a protein (Fig. 5.1B). The use of such expression vectors for Ubc9 fusion-directed sumoylation (UFDS, 15) is described in the following in detail. The expression vectors for Ubc9 fusion proteins are transfected
Fig. 5.1. The Ubc9 fusion-dependent sumoylation (UFDS) system. (A) Schematic representation of natural protein sumoylation (top) and Ubc9 fusion-directed sumoylation (bottom) (taken from Ref. (15) ). (B) The multicloning sites of pNU and pCU for fusion of Ubc9 to the protein of interest. Useful restriction sites are indicated. The Ubc9 reading frame is represented by a short translated part of the sequence.
Ubc9 Fusion-Dependent Sumoylation
65
to HEK293, COS-7, HeLa, or CHO cells alone or together with EGFP-SUMO1. The transfected cells are lysed in gel loading buffer, and the proteins are separated on SDS-PAGE and analyzed by Western blotting. Sumoylated Ubc9 fusion proteins can be detected with commercially available antibodies against the primary fusion protein or Ubc9 combined with HRP-conjugated secondary antibodies, a chemiluminescent reagent, and a detection system for the measurement of the chemiluminescent signal, such as Fuji LAS3000 (Fig. 5.2A–D). Using this simple method of UFDS, we have identified new SUMO substrate proteins and have analyzed the in vivo function of sumoylation of STAT1 (1, 16). Further study of the UFDS system shows that it is very helpful to verify whether a particular protein can be sumoylated in vivo, and to identify in vivo sumoylation sites by mutagenesis. In addition, UFDS can be applied to the study of protein–protein interactions (unpublished observations), and could possibly be improved using ligand-inducible protein–protein interaction between Ubc9 and the protein of interest (Zimnik et al., submitted and Chapter 10). Here we describe an analysis of the efficiency of UFDS, using STAT1-Ubc9 and p53-Ubc9 as model fusion proteins in COS-7, HeLa, and CHO cells in comparison to HEK293. In all four tested cell lines, UFDS induces sumoylation of the fusion proteins with specificity for the known sumoylation sites (Fig. 5.2). The Ubc9 fusion proteins are sumoylated with endogenous SUMO1 or with coexpressed EGFP-SUMO1 to a similar extent in HEK293 and COS-7 cells and with slightly reduced efficiency in HeLa cells. In CHO cells, sumoylation with endogenous SUMO appears weaker, possibly depending on a low amount of activated SUMO that is available in these cells, or possibly on a partial incombatibilty between mouse Ubc9 and Chinese hamster SUMO. In all cell lines, weak sumoylation at secondary sites is detected to varying degrees, dependent on the respective protein of interest. In addition, the strength of sumoylation by UFDS is sometimes influenced by unknown factors. While using UFDS, one should consider the restricted flexibility of a covalently fused Ubc9. Hence, not all natural sumoylation events will be possible even when both fusions to the N- and C-terminus have been tested. This will result in false negatives. On the other hand, weak sumoylations, probably without any function, are detectable as false positives, as is known for other modifications such as phosphorylation. Accordingly, the relevance of a newly identified sumoylation event will have to be confirmed by functional analysis. Overall, UFDS as a highly effective method in the in vivo sumoylation system can be very helpful in the analysis of the function of sumoylation in regulating other protein modifications, protein interactions, enzymatic function, protein stability, or cellular protein localization (15, 16). The contribution of
66
Niedenthal
Fig. 5.2. Sumoylation of p53-Ubc9 and STAT1-Ubc9 in HEK293 (A), in COS-7 (B), in HeLa (C), and in CHO (D) cells. The indicated Ubc9 fusion proteins were expressed alone or together with EGFP-SUMO-1. After 24 h, the protein extracts of the transfectants were analyzed by immunoblotting with antibodies specific for STAT1 or p53 and—after stripping—with anti-EGFP antibody. The protein-specific antibodies decorate the Ubc9 fusion protein, its conjugates to EGFP-SUMO-1
Ubc9 Fusion-Dependent Sumoylation
67
UFDS to both identifying sumoylation substrates and studying the function of protein sumoylation in vivo qualifies this method as a simple and valuable tool for analyzing protein sumoylation.
2. Materials 2.1. Cell Culture, Plasmids, and Cell Lysis
1. Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) for HEK293, COS-7, and HeLa cells. 2. Alpha-modified eagle’s medium (Alpha-MEM) supplemented with 10% fetal bovine serum (FBS) for CHO cells. 3. Solution of Penicillin and Streptomycin for supplementing growth media. 4. Polyethylenimine, 1 mg/ml (in H2O) solution, for transfection of HEK293, COS-7, and HeLa cells (see Note 1). 5. Lipofectamine Reagent and Plus Reagent (Invitrogen, Carlsbad, CA, USA). 6. Modified Laemmli (2 X) buffer for cell lysis: 160 mM TrisHCl, pH 6.8, 4% (w/v) sodium dodecyl sulphate (SDS), 20% (v/v) glycerol, 0.5% (v/v) β-mercaptoethanol, 0.008% (w/v) bromophenol blue. 7. Expression vectors: pcDNA3 (Invitrogen) for Ubc9 fusion proteins and pEGFP-C2 (Clontech Laboratories, Mountain View, CA, USA) for EGFP-SUMO-1.
2.2. SDSPolyacrylamide Gel Electrophoresis (SDS-PAGE)
1. Separating gel buffer: 1 M Tris-HCl, pH 8.8. Store at room temperature. 2. Stacking gel buffer: 1 M Tris-HCl, pH 6.8. Store at room temperature.
Fig. 5.2. (continued) and endogenous SUMO and—if detectable—the endogenous protein. The results in HEK293 (A) and COS-7 (B) cells are very similar: they show clear sumoylation both by endogenous SUMO (S-STAT1-Ubc9 and S-p53Ubc9) and coexpressed EGFP-SUMO-1 (E-S1-STAT1-Ubc9 and E-S1-p53-Ubc9). Sumoylation by endogenous SUMO is confirmed by a partial competition with coexpressed EGFP-SUMO-1 and the appearance of a new band of lower mobility (E-S1-STAT-Ubc9 and E-S1-p53-Ubc9). The results in HeLa (C) and CHO (D) cells are similar, but sumoylation with endogenous SUMO is weaker in HeLa cells and hardly detectable in CHO cells. In all cell lines, sumoylation is strongly reduced for the sumoylation site mutants STAT1(K703R) and p53(K386R). This shows that sumoylation in all cell lines takes place at the physiological sites. Nevertheless, in blots of the mutant proteins, there are weak signals of sumoylated proteins, which are stronger for p53 but also detectable for STAT1. While it is unclear why such bands are sometimes undetectable (STAT1, see Ref. (16 ) ) and sometimes clearly present, their presence does not prevent the identification of major sumoylation sites by UFDS. The second development of the blot with an EGFP or SUMO antibody is necessary to ensure that the same amount of EGFP-SUMO-1 was coexpressed with the wild type and mutant protein.
68
Niedenthal
3. Acrylamide solution: 30% (w/v) aqueous acrylamide/ bisacrylamide (37.5:1) in water. Acrylamid is a neurotoxin when unpolymerized and, hence, care should be taken to avoid exposure or incorporation. 4. N,N,N,N′-Tetramethyl-ethylenediamine (TEMED): store at 4°C. 5. Ammonium persulfate (APS): prepare a 10% (w/v) solution in water and immediately freeze and store in single-use aliquots (500 µl) at −20°C. 6. Water from a Millipore MQ system with a resistivity of 18.2 MΩ cm (see Note 2). 7. SDS solution: 20% (w/v) solution. Store at 30°C (see Note 3). 8. SDS-PAGE running buffer (10 X): 250 mM Tris, 1.9 M glycine, pH 8.8, 1% (w/v) SDS. Store at room temperature. 9. Molecular weight markers: MagicMarkXP Western Standard (Invitrogen, Carlsbad, CA, USA) or equivalent (see Note 4). 2.3. Detection of Ubc9 Fusion Proteins by Western Blotting
1. Transfer buffer: 48 mM Tris base (do not adjust pH), 39 mM glycine, 20% (v/v) methanol, 0.037% (w/v) SDS. Store at room temperature (see Note 5). 2. Supported PVDF membrane (see Note 6) and gel blotting paper (1.2 mm) (Carl Roth, Karlsruhe, Germany, or equivalent). 3. Tris-buffered saline with Tween 20 (TBS-T): Prepare a 10 X stock with 1.37 M NaCl, 200 mM Tris-HCl, pH 7.6. Dilute 100 ml with 900 ml water for use and add to 0.1% (v/v) Tween 20. 4. Blocking buffer: 5% (w/v) nonfat dry milk in TBS-T. 5. Primary antibody dilution buffer: Blocking buffer. 6. Primary antibodies: We recommend anti-STAT1, anti-p53, and anti-EGFP antibodies from Cell Signaling, but equally suitable antibodies are available from different suppliers (see Note 7). 7. Secondary antibody: HRP Goat Anti-Rabbit Igs. 8. Immobilon Western Chemiluminescent reagent (HRP substrate) (Millipore Corporation, Billerica, MA, USA) or equivalent. 9. LAS-3000 imaging system (Fuji Film, Düsseldorf, Germany) or equivalent.
2.4. Stripping and Reprobing Blots for Detection of Coexpressed EGFP-SUMO-1
1. Stripping buffer: 62 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 0.7% (v/v) β-mercaptoethanol. Store at room temperature. 2. Wash buffer: TBS-T. 3. Primary antibody: Anti-EGFP antibody (see Sect. 2.3, Item 6.)
Ubc9 Fusion-Dependent Sumoylation
69
3.Methods The following important points should be considered when studying sumoylation with Ubc9 fusion proteins: 1. Sumoylation of the protein of interest should be analyzed in both structural arrangements, with Ubc9 fused to the Nterminus and to the C-terminus. This is necessary because in some cases only one of the structural arrangements results in a protein sumoylation (e.g., for p53). 2. The transfection efficiency should be controlled to ensure a proper expression of the coexpressed proteins. Therefore, we always confirm the efficiency of transfection after 24 h by verifying the presence of cotransfected EGFP-SUMO-1 using fluorescence microscopy. 3. Because of the presence of SUMO-specific proteases, sumoylation in cells and cell extracts is often relatively unstable. Hence, it is necessary to inactivate the proteases as quickly and completely as possible during cell lysis. During preparation of crude cellular protein extracts, we minimize desumoylation by boiling the cells directly in SDS-gel loading buffer. Furthermore, we recommend loading the protein extracts directly onto a SDS-gel, as repeated thawing and refreezing might cause a loss of the modification. 4. Use of the correct blotting method for the protein to be analyzed is of considerable importance for successful detection of sumoylation (see Note 8). 3.1. Cloning the cDNA of Interest into Ubc9 Fusion Protein Expression Vectors
1. For the generation of the pcDNA-Ubc9-MCS vector (pNU) suited for fusions of Ubc9 to the N-terminus of proteins (Fig. 5.1B), the coding sequence of mouse Ubc9 containing the start but lacking the stop codon was inserted as a BamHI/EcoRI fragment into pcDNA3. When selecting the position in the multicloning site (MCS) for insertion of the cDNA of interest, it needs to be ensured that the coding sequence of the protein of interest is in frame with the Ubc9 coding sequence. We recommend adding a three glycine linker between the Ubc9 and the coding sequence of the protein of interest (Fig. 5.1B) (see Note 9). Furthermore, to reduce the possibility of an internal translation start, the start codon of the fused protein of interest should be absent. In contrast, the native stop codon should be present to prevent generation of an artificial sumoylation site by read-through of translation into the MCS. 2. For generation of the pcDNA-MCS-Ubc9 vector (pCU) suited for fusions of Ubc9 to the C-terminus of proteins (Fig. 5.1B), the coding sequence of mouse Ubc9, lacking
70
Niedenthal
the start but containing the stop codon, was inserted as an EcoRI/XbaI fragment into pcDNA3. When selecting the position in the MCS for insertion of the cDNA of interest, its coding sequence needs to be in frame with the Ubc9 coding sequence. It also has to carry the native start codon and a Kozak sequence, but must not contain a stop codon (see Note 9). 3.2. Transfection of HEK293, COS-7, HeLa, and CHO Cells 3.2.1. HEK293 and COS-7 Cells
Human embryonal kidney cells (HEK293) and African green monkey kidney cells (COS-7) are transfected using the following procedure to maximize the amounts of sumoylated protein: 1. Transfer a fresh confluent 10 cm plate of HEK293 (COS-7) cells to a 12-well plate. At this step, DMEM with or without antibiotics can be used. 2. Incubate for 12–24 h until the cells have reached about 70% confluence. 3. For each well, prepare the following transfection mixture: serum- and antibiotic-free α−MEM medium (∼45 µl) is mixed with 750 ng of the transfection-purity expression vector DNA in a 1.5 ml tube (total volume ∼45 µl) and vortexed. 4. Vortex the polyethylenimin stock solution (1 mg/ml), add 3 µl to the tube containing the DNA and DMEM medium, and mix by vortexing. 5. Incubate the mixture at room temperature for 10 min. 6. Add 450 µl fresh DMEM to the mixture and vortex. DMEM with or without antibiotics can be used. 7. Completely remove the medium covering the cells. 8. Immediately and carefully add the transfection mix (∼500 µl) to each well. 9. Carefully rock the 12-well plate to ensure proper distribution of the DNA–transfection reagent complex. 10. Incubate the cells for 24 h at a 37°C in a humidified CO2incubator (5% CO2) prior to lysis.
3.2.2. HeLa Cells
The transfection protocol for the human cervix carcinoma cells (HeLa) is very similar to the protocol for HEK293 and COS-7 cells but uses DMEM without antibiotics. To obtain satisfying transfection efficiencies with the PEI transfection reagent, use the following procedure: 1. Transfer a fresh confluent 10 cm plate of HeLa cells to a 12-well plate. Use DMEM without antibiotics. 2. Incubate for 12–24 h until the cells have reached about 70% confluence.
Ubc9 Fusion-Dependent Sumoylation
71
3. For each well, prepare the following transfection mixture: serum- and antibiotic-free DMEM medium (∼45 µl) is mixed with 1000 ng of the transfection-purity expression vector DNA in a 1.5 ml tube (total volume ∼47 µl) and vortexed. 4. Vortex the polyethylenimin stock solution (1 mg/ml), add 4 µl to the tube containing the DNA and DMEM medium, and mix by vortexing. 5. Incubate the mixture at room temperature for 10 min. 6. Add 450 µl fresh DMEM to the mixture and vortex. Use DMEM without antibiotics. 7. Completely remove the medium covering the cells. 8. Immediately and carefully add the transfection mix (∼500 µl) to each well. 9. Carefully rock the 12-well plate to ensure proper distribution of the DNA–transfection reagent complex. 10. Incubate the cells for 24 h at a 37°C in a humidified CO2incubator (5% CO2) prior to lysis. 3.2.3. CHO Cells
For the transfection of the Chinese hamster ovary cells (CHO), the Lipofectamine and the Plus reagent of Invitrogen is used according to the following protocol: 1. Transfer a fresh confluent 10 cm plate of CHO cells to a 12-well plate. Use Alpha-MEM without antibiotics. 2. Incubate for 12–24 h until the cells have reached about 70% confluence. 3. For each well, prepare the following transfection mixture: serum- and antibiotic-free Alpha-MEM medium (∼45 µl) is mixed with 750 ng of the transfection-purity expression vector DNA in a 1.5 ml tube (total volume ∼50 µl) and vortexed. 4. Vortex the Plus Reagent, add 8 µl to the tube containing the DNA and MEM medium, and mix by vortexing (mixture A). 5. Incubate this mixture A at room temperature for 15 min. 6. In a second 1.5 ml tube, mix serum- and antibiotic-free Alpha-MEM medium (48 µl) with 2 µl of Lipofectamine (mixture B). 7. Add mixture A to mixture B and mix by vortexing. 8. Incubate the combined transfection mixture (A+B) at room temperature for 15 min. 9. Completely remove the medium covering the cells. 10. Immediately add 400 µl fresh medium without antibiotics to each well.
72
Niedenthal
11. Carefully add the transfection mixture (∼100 µl) to each well. 12. Carefully rock the 12-well plate to ensure proper distribution of the DNA–transfection reagent complex. 13. Incubate the cells for 3 h at a 37°C in a humidified CO2incubator (5%). 14. Add 500 µl of medium with 20% serum to each well. 15. Incubate the cells for 24 h to 48 h at a 37°C in a humidified CO2-incubator (5% CO2) prior to lysis. 3.3. Cell Lysis and Preparation of Samples for Identifying in Vivo Sumoylated Proteins
1. The transfected cells in the 12-well plate are processed in groups of 4 wells. To this end, aspirate the medium from four wells each, add 1 mL of PBS (room temperature), and rock the plate briefly. 2. Aspirate PBS quantitatively from the wells, and immediately add 150 µl of gel loading buffer (room temperature) onto the cells in each of the four wells. Scrape the cells from the bottom of the wells with a cut yellow tip. 3. Transfer the viscous cell suspension to a 1.5 ml tube and briefly store on ice until all samples from the 12-well plate have been processed. 4. Heat the samples for 10 min at 96°C in a heat block. It is helpful to use safe lock reaction tubes to avoid unexpected opening of the tubes and potential loss of sample. 5. Cool the samples briefly on ice, vortex, and collect the solution at the bottom of the tube by a very short centrifugation. Samples are now ready for loading onto SDS-PAGE or can be stored at −20°C (see Note 10).
3.4. SDS-PAGE
1. The following instructions are specific for the use of the BioRad Mini-PROTEAN 3 gel system (BIO-RAD, Hercules, CA, USA), but other systems can be used according to the manufacturer’s instructions. First, clean the glass plates with a common detergent and then wash them extensively with deionised water. The clean glass plates are dried and stored until usage. Before assembling the plates for preparing the gels, clean them with 70–96% ethanol and air-dry. 2. Prepare six 7.5% separating gels (0.75 mm thick) by carefully mixing 7.5 ml acrylamide solution, 11.2 ml separating gel buffer, 13.7 ml water, 150 µl SDS solution, and 150 µl APS. Add 30 µl TEMED and mix again carefully. Pour the gel by filling the space between the glass plates up to 1.5 cm below the top of the smaller glass plate, leaving space for the stacking gel. Immediately overlay with water.
Ubc9 Fusion-Dependent Sumoylation
73
3. Once the gel is fully polymerized (after ∼30 min), the stacking gel can be prepared. Alternatively, the separating gel can be stored for up to 5 days in a closed plastic box and wrapped in moist paper to prevent drying (see Note 11). 4. Prepare six stacking gels (5%) by carefully mixing 1.7 ml acrylamide solution, 1.25 ml stacking gel buffer, 7.3 ml water, 50 µl SDS solution, and 50 µl APS. Pour off the water from the separating gel and remove residual water with blotting paper. Avoid touching the gel surface. Add 15 µl TEMED to the stacking gel solution and mix carefully. Pour the stacking gel up to the top of the smaller glass plate and insert the comb. 5. Once the gel is fully polymerized (after 30 min), it can be stored for 5 days in a closed plastic box and wrapped in moist paper to prevent drying (see Note 11). 6. Prepare the running buffer by diluting 500 ml of 10 X running buffer with 4500 ml of double distilled water and mix well. 7. Before placing the gel into the electrophoresis chamber or storage at 4°C, carefully remove the comb. 8. Assemble two gels, or one gel and a buffer dam, in the inner electrophoresis chamber and place this into the buffer tank. Fill the inner chamber completely with running buffer and ensure that the chamber is not leaky. Then fill the outer chamber such that the bottom of the gel is well immersed into the buffer. Wash away air bubbles that might be trapped in the outer chamber at the bottom of the gel using a syringe with a bent needle, filled with running buffer. 9. Before loading the samples use a 200 µl pipette to wash out the wells with running buffer, ensuring that the wells are not blocked by gel slices. 10. Load 15 µl of sample per well. Load the molecular weight marker to one well (see Note 4). 11. Carefully cover the gel chamber with its lid and connect it to the power supply. Run the gel at 100 V and stop the current when the blue dye front has reached the bottom of the gel. 3.5. Western Blot Analysis for Sumoylated Ubc9 Fusion Proteins
1. After separation by SDS-PAGE, proteins are electrophoretically transferred to a PVDF membrane by semi-dry blotting (see Note 12). To this end, a sheet of PVDF membrane slightly larger than the size of the separating gel (8.5 × 6 cm) is moistened by methanol for 2 min. Make sure that the membrane is completely submerged (see Note 13). Next, transfer the membrane into blotting buffer and briefly shake to completely wash away the methanol. Subsequently, immerse two sheets of gel blotting paper (1.2 mm thick) in blotting
74
Niedenthal
buffer. Disconnect the SDS-PAGE unit from the power supply, disassemble, and separate the glass plates. Remove the stacking gel and continue by processing the separating gel. 2. Place one sheet of gel blotting paper on the anode plate of the blotter and carefully rub with a glass pipette to remove air bubbles trapped between the anode and the blotting paper. Add 2 ml of blotting buffer onto the gel blotting paper, place the PVDF membrane into this buffer, and cover by a further 2 ml of blotting buffer. If the molecular weight marker was loaded asymmetrically, no further marking of the gel is necessary. Next, place the gel onto the PVDF membrane and cover with another 2 ml of blotting buffer. Place the second sheet of gel blotting paper, soaked with blotting buffer, on top of the gel, and complete the blotting stack by mounting the cathode plate (see Note 14). 3. Connect the blotting apparatus to a power supply and carry out the transfer for 90 min at 0.8 mA/cm2. 4. When the transfer is completed, switch off and disconnect the blotting apparatus from the power supply. Carefully disassemble the blotting stack, ensuring that the surface of the PVDF membrane is not damaged, which would cause artificial signals during development of the blot. Place the membrane in TBS-T to wash away the blotting buffer. Again, it is important that the membrane is completely submerged and is not allowed to dry out (see Note 13). The membrane is then placed into a 50 ml Falcon tube with 5 ml of blocking buffer. Ensure that there is no overlap between parts of the membrane. Incubate the blot for 30 min in a Falcon roller at room temperature. Then briefly wash the blot in the Falcon tube twice with 15 ml of TBS-T. 5. For incubation with the primary antibody, add 2 ml of blocking buffer and, subsequently, 1 µl of the respective antibody specific for the fusion protein into the Falcon tube containing the PVDF membrane. Incubate overnight in a Falcon roller at 4°C. The primary antibody solution can be stored and used for one to two additional blot developments. Wash the membrane in the Falcon roller three times for 5 min with 15 ml of TBS-T. 6. Dilute the secondary antibody 1:20,000 in 2 ml of blocking buffer, add to the blot membrane, and incubate for 1 h at room temperature. Wash the blot three times for 5 min with 15 ml of TBS-T buffer and store in TBS-T buffer until you are ready for development (see Note 15). 7. Development of the blot membrane is performed with 1 ml of freshly mixed development reagent warmed to room temperature. To this end, the reagents are removed from the
Ubc9 Fusion-Dependent Sumoylation
75
refrigerator 30 min prior to use. A total of 0.5 ml each of component A and component B are then mixed and stored in the dark until use. 8. Analysis of Western blot signals with the Fuji Film LAS3000 is performed as follows: Remove the blot from the TBS-T and allow the buffer to drain from the blot almost quantitatively, but do not allow the blot to dry up. Place the membrane into a tray with the gel side facing up, and distribute the developing reagent over the entire membrane by careful rocking (see Note 16). The chemiluminescence measurement by the LAS3000 is performed using the professional increment mode. This mode automatically stores blot pictures of increasing exposure times, which facilitates the selection of the most informative exposure (Fig. 5.2A–D). Furthermore, the digitized results can be used for a quantitative analysis of the blot. Alternatively, standard x-ray film exposure and development is possible. 3.6. Stripping and Reprobing the Blots for EGFP-SUMO1 Conjugation
1. Once a satisfactory result with the antibody specific for the fusion protein has been obtained, the membrane can be stripped of the signal and reprobed with an antibody that recognizes both free and conjugated EGFP-SUMO1 to verify the correct coexpression. 2. Warm the stripping buffer (50 ml per blot) to 50°C and add to the blot in a Falcon tube. Incubate the blot for 30 min in a Falcon roller at 50°C. 3. Wash the stripped blot three times with 30 ml of TBS-T for 5 min each and subsequently incubate another 30 min in blocking buffer at room temperature. Probe the membrane with an EGFP-specific antibody (1:2000 in TBS-T) as described in Sect. 3.5.
3.7. Interpretation of Ubc9- and EGFPWestern Blots
For the identification of sumoylation of the Ubc9 fusion protein, always compare the results obtained by the expression of the Ubc9 fusion protein alone with the results from its coexpression with EGFP-SUMO1. If the Ubc9 fusion protein is sumoylated, then one or several additional high molecular weight bands are detectable in the coexpression with EGFP-SUMO1 (Fig. 5.2A–D). These bands usually run more slowly than expected for the estimated combined molecular weight of the Ubc9 fusion protein and EGFP-SUMO1. Furthermore, the molecular weight shift induced by sumoylation appears to vary, depending on the localization of the sumoylation site within the fusion protein. Attachment of SUMO to the N- or C-terminus of the fusion protein generally induces a smaller shift than attachment to a central site. Consequently, the analysis of a protein of interest fused to Ubc9 at the N-terminus often gives a different band shift compared to the
76
Niedenthal
C-terminal fusion and provides a first hint about the localization of the sumoylation site. In addition, we often find that even without EGFP-SUMO1 coexpression there is a weaker band above the main band corresponding to the Ubc9 fusion protein. If this represents endogenous sumoylation of the Ubc9 fusion protein, the intensity of this band should be reduced due to competition when EGFP-SUMO1 is coexpressed. Whether the appearance of a band for the fusion protein conjugated by endogenous SUMO is indicative for a natural sumoylation is not yet clear. We also do not know whether the preference of some sumoylations sites for SUMO1 versus SUMO2 is valid in the UFDS system. Analysis of the sumoylation of the Ubc9 fusion proteins is possible with Ubc9 antibodies (15, 16) or with protein-specific antibodies (Fig. 5.2A–D), usually with identical results. Detection with the Ubc9 antibody allows a comparison of the sumoylation patterns of different Ubc9 fusion proteins on one blot. Using a protein-specific antibody allows a comparison of the expression level of the fusion protein with that of the endogenous protein. For further verification of a sumoylation event identified by UFDS, Ubc9 fusion proteins can be immunoprecipitated, and coprecipitated SUMO can be immunoblotted. It is also possible to use GST-SUMO for UFDS, which allows affinity purification of GST-SUMO and copurification of conjugated Ubc9 fusion proteins, thus demonstrating sumoylation of the respective fusion partner. Furthermore, site-directed mutagenesis can be performed on the Ubc9 fusion protein expression plasmids in order to identify sumoylation sites by UFDS. Finally, an advanced UFDS system will be available in the future (Zimnik et al., manuscript submitted), which renders sumoylation of a specific protein inducible to allow the kinetic analysis of the sumoylation reaction.
4. Notes 1. The polyethylenimine transfection reagent was used according to ref. (17). It is comparable in price to the calcium phosphate method, but simpler. Until now we have only used polyethylenimine from Sigma-Aldrich ( (# 408727) St. Louis, MO, USA), but equivalent products from different suppliers may also work. 2. While we use doubly distilled water for running and blotting buffer, all other solutions were prepared in water from a Millipore MQ system with a resistivity of 18.2 MΩ cm. 3. We store the 20% SDS stock solution at 30°C to prevent SDS precipitation.
Ubc9 Fusion-Dependent Sumoylation
77
4. This marker is very useful because it is detected along with the Ubc9 fusion proteins by immunoblotting. For use, the marker is diluted in the ratio 1:20 in SDS gel loading buffer, and 15 µl is loaded. Do not heat the stock solution or the diluted marker. 5. Transfer buffer is used only once. 6. The PVDF membrane of Carl Roth (Roti-PVDF) has properties very similar to Immobilon-P membrane (Millipore). We recommend the use of either of these two PVDF membranes. 7. These antibodies work well in our hands, but numerous comparable reagents are available from other commercial sources. 8. For the blotting of very large SUMO conjugates, a tank blotting system is preferable. However, we found that during tank blotting some proteins are quantitatively blotted through the membrane. This is avoided with semi-dry blotting. 9. The Ubc9 fusions cloned in pNU and pCU always contain a three-glycine linker between Ubc9 and the protein of interest, but we have never tested whether the presence or absence of the linker makes a difference in sumoylation. To construct a Ubc9-substrate fusion with a three-glycine linker in pNU, the coding sequence to be inserted has to include the sequence encoding the three glycines. In pCU, the sequence encoding the three glycines is present (Fig. 5.1B). 10. Although we have not analyzed this in detail, it appears from our experiments that the amount of sumoylated protein in the cell extract decreases with each cycle of freezing and thawing; the best results are obtained by loading the samples on a SDS-gel directly after heating at 96°C. Furthermore, storage of the proteins at room temperature is not recommended and could lead to loss of sumoylation. We have not analyzed the extent of decay of sumoylation in the samples frozen at −20°C. 11. Complete SDS gels with stacking gel can be stored up to 5 days at 4°C, but we recommend pouring fresh gels for highest quality. 12. We favor the use of a semi-dry blotting system, such as semidry blotter Z340502 (Sigma-Aldrich). 13. The moistened PVDF membrane should never be allowed to dry at any time during the blotting and developing procedure, as this can lead to artificial signals.
78
Niedenthal
14. One gel blotting paper (1.2 mm) on either side of the membrane works as well as three sheets of 3MM Whatmann paper. 15. After washing away surplus secondary antibody, the blot should be developed immediately. Storage of the washed blot in TBS-T reduces the signal strength. 16. The developing reagent should remain on the blot during the measurement. Do not discard the developing reagent until after the measurement is complete. If cloudy signals from the developing reagent disturb the exposure, remove the tray with the blot from the instrument for a careful rocking and restart the measurement.
Acknowledgements The author would like to thank Matthias Gaestel for critical reading of the manuscript, and Astrid Jakobs for preparing the figures shown for Ubc9 fusion-directed sumoylation. This work was supported by the Medical School Hannover, Institute of Physiological Chemistry.
References 1. Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12. 2. Melchior, F., Schergaut, M., and Pichler, A. (2003) SUMO: ligases, isopeptidases and nuclear pores. Trends Biochem. Sci. 28, 612–618. 3. Desterro, J. M., Rodriguez, M. S., Kemp, G. D., and Hay, R. T. (1999) Identification of the enzyme required for activation of the small ubiquitin-like protein SUMO-1. J. Biol. Chem. 274, 10618–10624. 4. Gong, L., Li, B., Millas, S., and Yeh, E. T. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448, 185–189. 5. Johnson, E. S., Schwienhorst, I., Dohmen, R. J., and Blobel, G. (1997a) The ubiquitinlike protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16, 5509–5519. 6. Okuma, T., Honda, R., Ichikawa, G., Tsumagari, N., and Yasuda, H. (1999) In vitro
7.
8.
9.
10.
11.
12.
SUMO-1 modification requires two enzymatic steps, E1 and E2. Biochem. Biophys. Res. Commun. 254, 693–698. Desterro, J. M., Thomson, J., and Hay, R. T. (1997) Ubch9 conjugates SUMO but not ubiquitin. FEBS Lett. 417, 297–300. Johnson, E. S., and Blobel, G. (1997b) Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J. Biol. Chem. 272, 26799–26802. Rodriguez, M. S., Dargemont, C., and Hay, R. T. (2001) SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J. Biol. Chem. 276, 12654–12659. Hochstrasser, M. (2001) SP-RING for SUMO: new functions bloom for a ubiquitin-like protein. Cell 107, 5–8. Kagey, M. H., Melhuish, T. A., and Wotton, D. (2003) The polycomb protein Pc2 is a SUMO E3. Cell 113, 127–137. Kirsh, O., Seeler, J. S., Pichler, A., Gast, A., Muller, S., Miska, E., Mathieu, M.,
Ubc9 Fusion-Dependent Sumoylation Harel-Bellan, A., Kouzarides, T. et al. (2002) The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase. EMBO J. 21, 2682–2691. 13. Pichler, A., Gast, A., Seeler, J. S., Dejean, A., and Melchior, F. (2002) The nucleoporin RanBP2 has SUMO-1 E3 ligase activity. Cell 108, 109–120. 14. Uchimura, Y., Nakao, M.,and Saitoh, H. (2004) Generation of SUMO1 modified proteins in E. coli: towards understanding the biochemistry/structural biology of the SUMO-1 pathway. FEBS Lett. 564, 85–90. 15. Jakobs, A., Koehnke, J., Himstedt, F., Funk, M., Korn, B., Gaestel, M., and Niedenthal, R. (2007) Ubc9 fusion-directed sumoylation (UFDS): a method to analyze function
79
of protein sumoylation. Nat. Methods 4, 245–250. 16. Jakobs, A., Himstedt, F., Funk, M.,
Korn, B., Gaestel, M., and Niedenthal, R. (2007) Ubc9 fusion-directed SUMOylation identifies constitutive and inducible SUMOylation. Nucleic Acids Res. 35(17):e109. Epub 2007 Aug 20. 17. Ehrhardt, C., Schmolke, M., Matzke, A., Knoblauch, A., Will, C., Wixler, V., and Ludwig, S. (2006) Polyethylenimine, a cost-effective transfection reagent. Signal Transduction 6, 179–184.
Chapter 6 In Vivo Detection and Characterization of Sumoylation Targets in Saccharomyces cerevisiae Helle D. Ulrich and Adelina A. Davies Abstract Ni-NTA affinity chromatography under denaturing conditions has proven to be a powerful method for the isolation of SUMO conjugates from total cell extracts, as it minimizes deconjugation and excludes noncovalent interactions. This chapter describes the use of both His-tagged SUMO and a His-tagged target protein for the characterization of the sumoylation process in the budding yeast Saccharomyces cerevisiae. Two well-studied model substrates, the septin Cdc3 and the replication clamp protein PCNA, are used as examples, but the protocol can easily be adapted to other targets and organisms. Key words: SUMO, PCNA, septins, Ni-NTA affinity chromatography, budding yeast.
1. Introduction The identification of target proteins remains one of the major challenges for SUMO research. In vitro sumoylation reactions are particularly helpful to study conjugation mechanisms or to demonstrate that a particular protein can in principle serve as a target; however, the validation of a protein as a physiologically relevant substrate of the SUMO conjugation pathway requires in vivo evidence, and regulatory control mechanisms that address the conditions under which a particular protein is modified are also best studied in the relevant organism. For this purpose, this chapter demonstrates the use of a strategy that is generally applicable for the detection of sumoylated proteins in vivo. The method is described for the budding yeast Saccharomyces cerevisiae because of the flexibility of this model system with regard to
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
81
82
Ulrich and Davies
the use of epitope tags and mutants, but can easily be applied to other organisms with a few modifications. Ni-NTA chromatography of His-tagged proteins has so far proven the most powerful approach for the identification of new SUMO targets (1–10). The method uses His-tagged SUMO, which can easily be expressed in yeast or mammalian cells. In contrast to most other epitopes, the His-tag allows the bulk purification of target proteins under completely denaturing conditions, which minimizes the problems of deconjugation during extract preparation and excludes noncovalent interactions. Novel targets can be identified in the eluate by mass spectrometry, but the presence of a particular conjugate can also be directly monitored with an appropriate antibody or by using a yeast strain in which the protein of interest is marked with an epitope tag for detection. If higher molecular weight species of a protein have been detected, the use of the His-tagged SUMO gives immediate confirmation of the modifier’s identity, because of the size difference between the untagged and the His-tagged SUMO. In case of large proteins, however, the identification of the modification by means of its size shift will be difficult. In this situation, NiNTA chromatography is again helpful to determine the presence of the modifier on the target protein. Likewise, the pull-down of conjugates may allow the detection of a modification in cases where the abundance of the modified form is too low to be visible in total extracts. Overexpression of the tagged SUMO might also enhance the modification beyond the level of that achieved by the endogenous SUMO, resulting in better detection. As an alternative to the His-tagged SUMO, Ni-NTA chromatography can also be used to detect rare conjugates of a protein of interest if that protein itself is fused to a His-tag. Here, the pull-down step simply serves to enrich the target protein, thus overcoming the problem of detecting low levels of modified forms against a background of total cellular protein. The identity of the modifier can then be determined with antibodies against SUMO. This chapter demonstrates the use of both methods, applying antibodies against the target proteins as well as the epitope tags and also against the modifier itself. While the method of cell lysis is optimized for yeast, the pull-down protocol itself can be applied to other organisms. 1.1. Sumoylation of the Yeast Septins
The very first SUMO targets identified in budding yeast were the septins, i.e., scaffold proteins that localize in a ring-shaped structure to the yeast bud neck and contribute to cytokinesis (11). Three of the five septin proteins are modified by the SUMO ligase Siz1 at multiple sumoylation consensus sequences, ΨKX(E/D) (where Ψ denotes a bulky aliphatic and X any amino acid), during the G2 phase of the cell cycle. Mutants unable to sumoylate the septins display very subtle phenotypes that mainly affect the
Detection of Sumoylation Targets in Yeast
83
morphology of the septin ring itself, without major effects on the cell cycle or cytokinesis. The physiological significance of this reaction is therefore still a matter of debate. However, septins are one of the few cytoplasmic SUMO targets. The E3-dependence and cell cycle regulation of the modification (12,13) makes them a useful model to study the in vivo sumoylation process in yeast. In this chapter, we will describe the use of an epitope-tagged version of the yeast septin Cdc3 and analyze its Siz1-dependent SUMO modification. 1.2. PCNA as a Target of SUMO Conjugation
Proliferating cell nuclear antigen (PCNA), encoded in yeast by the POL30 gene, is an essential processivity factor for replicative DNA polymerases, which encircles the DNA as a sliding clamp and serves as an interaction platform for a variety of proteins involved in several DNA repair pathways, chromatin assembly, and cell cycle regulation (14). In many eukaryotic species, PCNA undergoes mono- as well as polyubiquitylation in a damage-dependent manner, but PCNA from S. cerevisiae is also a target for modification by SUMO (15,16). The modification is detectable during S phase, and a conserved lysine K164 serves as the major attachment site. Notably, the sequence around this residue does not correspond to the consensus motif ΨKX(E/D) that is used for sumoylation in many other proteins. This motif is instead found at a second, minor modification site K127, which is less conserved in other species. Sumoylation of PCNA at replication forks recruits the helicase Srs2, which blocks access of the recombination machinery and thereby prevents the formation of spontaneous crossovers during DNA replication (17–19). The modification enhances the affinity of PCNA for Srs2 through a SUMO-interaction motif at the C terminus of the helicase, irrespective of whether SUMO is attached to K164 or to K127 of PCNA. The presence of multiple modifications on a single lysine of PCNA makes this molecule an interesting object for mechanistic studies of ubiquitylation and sumoylation (20). This chapter will demonstrate the detection and differentiation of the in vivo modified forms at the individual SUMO acceptor lysines.
2. Materials 2.1. Cultivation of Yeast Strains
1. YPD medium (liquid): 1% (w/v) Bacto-yeast extract, 2% (w/v) Bacto-peptone, 2% (w/v) glucose in water. Sterilize by autoclaving and store at room temperature.
84
Ulrich and Davies
2. YPD plates: YPD medium as above, containing 2% (w/v) Bacto-agar. 3. SC medium (liquid): synthetic complete medium lacking uracil, tryptophane, or leucine. Available from various suppliers (e.g., Sigma-Aldrich), but can also be prepared in the lab (21). 4. SC plates: SC medium as above, containing 2% (w/v) Bacto-agar. 5. CuSO4 stock solution: 100 mM in water. Filter-sterilize. 6. Disposable Petri dishes (90 mm). 7. Culture tubes and flasks in sizes of 15 and 125 ml. 8. Incubators for plates and shake flasks and tubes at 30°C. 2.2. Strain Constructions
1. Plasmids: pYM3, YEplac181, YEp181-CUP-His7-Smt3, pBL243, YIp128-P30-His6-POL30, and mutant vectors bearing pol30(K164R), pol30(K127R), and pol30(K127/164R), respectively (see Note 1). 2. Oligonucleotide primers: CDC3-tag-down, 5′-CCAATGTTAACCACTCCCCCGTCCCTACAAAGAAGAAGGGATTTTTACGTCGTACGCTGCAGGTCGAC-3′; CDC3-tag-up, 5′-TAATAATATTTAATAGTGTATGTTTGAAATTTTTATATGTCTTTATTTCGATCGATGAATTCGAGCTCG-3′ (see Note 2). 3. Reagents and equipment for polymerase chain reaction (PCR): thermostable polymerase (Vent polymerase, New England Biolabs or alternatives) and matching buffer, dNTPs, thermocycler, PCR tubes. 4. Reagents and equipment for agarose gel electrophoresis (see Note 3). 5. Sodium acetate solution: 3 M, pH 5.2. 6. Ethanol: absolute and 70% (v/v) in water. 7. LiT: 100 mM lithium acetate, 10 mM Tris-HCl, pH 7.4; sterilize by autoclaving. 8. PEG/LiT: dissolve 100 g polyethylene glycol 3350 (Sigma-Aldrich) in 100 ml LiT; sterilize by autoclaving (see Note 4). 9. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. 10. HT DNA: 10 mg/ml herring testes DNA (e.g., Sigma type XIV – see Note 5). 11. Rotating wheel for microfuge tubes, Vortex mixer. 12. Heat block or water bath at 42°C.
Detection of Sumoylation Targets in Yeast
2.3. SDS-PAGE and Western Blot Analysis
85
1. Electrophoresis system for small-scale vertical gels (e.g., BioRad Mini-Protean 3) with power supply and semi-dry blotting apparatus. 2. NuPAGE 4–12% Bis-Tris gradient gels (1.0 mm), matching electrophoresis apparatus, and MOPS SDS running buffer, 20X (Invitrogen). 3. Acrylamide solution: 30% solution of acrylamide/bisacrylamide (37.5:1), available from various suppliers (e.g., BioRad). Store at 4°C. 4. Separating buffer (4X): 1.5 M Tris-HCl, pH 8.8, 0.4% (w/v) sodium dodecyl sulfate (SDS). Store at room temperature. 5. Stacking buffer (4X): 0.5 M Tris-HCl, pH 6.8, 0.4% (w/v) SDS. Store at room temperature. 6. APS solution: 10% (w/v) ammonium peroxodisulfate in H2O. This solution can be stored in 1 ml aliquots at −20°C. Each aliquot is stable at 4°C for several weeks. 7. TEMED (N,N,N′,N′-Tetramethylethylenediamine): Store at 4°C. 8. SDS running buffer: 25 mM Tris-HCl, pH 8.8, 200 mM glycine, 0.1% (w/v) SDS. This buffer can be prepared as a 5X stock solution in large quantities and stored at room temperature. 9. Molecular weight marker: prestained, e.g., PeqGold Protein Marker IV (Peqlab). 10. Blotting buffer I: 300 mM Tris-HCl, pH 10.4, 15% (v/v) methanol. 11. Blotting buffer II: 30 mM Tris-HCl, pH 10.4, 15% (v/v) methanol. 12. Blotting buffer III: 25 mM Tris-HCl, pH 9.4, 40 mM 6-aminocaproic acid, 15% (v/v) methanol. 13. PVDF membrane (Millipore or equivalent). 14. Gel blotting paper: extra thick (1.2 mm), e.g., Whatman GB005. 15. TBS: 50 mM Tris-HCl, pH 7.5, 150 mM NaCl. 16. TBST0.1: TBS + 0.1% (v/v) Tween 20. 17. TBST0.1/milk: TBST0.1 + 3% (w/v) skimmed milk powder. This solution can be stored at 4°C for a few days. 18. Primary antibodies: 12CA5 (mouse monoclonal anti-HA), anti-His-tag (mouse monoclonal, available from Qiagen or other suppliers), anti-Smt3 (rabbit polyclonal), anti-Pol30 (rabbit polyclonal, affinity purified) (see Note 6). 19. Secondary antibodies: Goat anti-mouse and goat anti-rabbit horseradish peroxidase conjugates.
86
Ulrich and Davies
20. Chemiluminescence detection kit: ECL (GE Healthcare) or equivalent and autoradiography film (e.g., Amersham Hyperfilm ECL). 2.4. Preparation of Total Cell Extracts by TCA Lysis
1. NaOH/BME: 1.85 M NaOH, 7.5% (v/v) 2-mercaptoethanol. Prepare immediately before use from a 2 M NaOH stock solution by adding 2-mercaptoethanol to a final concentration of 7.5%. 2. TCA solution: 55% (w/v) trichloroacetic acid in H2O. 3. HU buffer: 8 M urea, 200 mM Tris-HCl, pH 6.8, 1 mM EDTA, 5% (w/v) SDS, 0.1% (w/v) bromophenol blue, 1.5% (w/v) dithiothreitol. This buffer should be stored in 1 ml aliquots at −20°C. 4. Neutralizing buffer: 1.5 M Tris-HCl, pH 8.8.
2.5. Denaturing Ni-NTA Affinity Chromatography
1. Buffer A: 6 M guanidine HCl, 100 mM sodium phosphate, pH 8.0, 10 mM Tris-HCl, pH 8.0. Store at 4°C. 2. Buffer C: 8 M urea, 100 mM sodium phosphate, pH 6.3, 10 mM Tris-HCl, pH 6.3. Store at 4°C. 3. Tween-20: 10% (w/v) stock solution in H2O. Store at room temperature. 4. Ni-NTA agarose: Qiagen or equivalent. 5. Imidazole: 1 M stock solution in H2O. Store at 4°C.
3. Methods 3.1. General Methods 3.1.1. Yeast Transformation
1. An exponentially growing yeast culture (see Note 7) in YPD medium is pelleted by centrifugation at 3,000g for 5 min. Aliquots of 10–15 ml per transformation are sufficient. Alternatively, 700 µl of a fresh overnight culture in YPD medium can be used (harvest in a microcentrifuge tube at 16,000g for 15 s). Transformation efficiencies will be somewhat higher with exponential cultures. 2. Completely remove the medium and resuspend the cells in 100 µl LiT solution per transformation. Mix the PCR product or plasmid DNA with 10 µl of HT DNA and add the mixture to the cell suspension. Vortex briefly. 3. Add 500 µl of PEG/LiT, vortex for several seconds, and incubate on a rotating wheel for 15–30 min at room temperature. 4. Add 50 µl of DMSO and incubate 15 min in a 42°C heat block. Shorter incubation times can be used for temperature-sensitive strains.
Detection of Sumoylation Targets in Yeast
87
5. Pellet the cells by centrifugation at 500g for 30 s, resuspend in 75 µl water, and spread onto a selective SC plate. Incubate the plate for 2–3 days at 30°C. 3.1.2. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
1. Prepare a separating gel solution of the desired acrylamide concentration by mixing appropriate volumes of 30% acrylamide solution with water, 1.25 ml separating buffer, and 50 µl APS solution to make a total volume of 5 ml. Add 5 µl of TEMED and immediately pour into a prepared set of plates. Leave space for the stacking gel. Carefully pipet a layer of water on top of the acrylamide layer and allow polymerization for a minimum of 20 min. 2. Pour off the layer of water from the separating gel. Prepare a 6% stacking gel solution by mixing 400 µl acrylamide solution, 500 µl stacking buffer, 20 µl APS, and 1.08 ml water. Add 2 µl of TEMED and immediately pour the solution on top of the separating gel to fill the space completely. Insert a comb and allow polymerization for at least 20 min. 3. Transfer the gel to the electrophoresis chamber and fill with SDS running buffer. Alternatively, omit Steps 1 and 2 and use precast NuPAGE 4–12% Bis-Tris gradient gels with MOPS SDS running buffer. 4. Load the denatured samples alongside an appropriate molecular weight marker (see Note 8) and run the gel at 150 V for 1 h or until the blue loading dye has reached the bottom of the gel.
3.1.3. Western Blot Analysis
1. Prepare a sheet of PVDF membrane in the size of your gel by soaking briefly in methanol, rinsing in water, and then incubating for several minutes in blotting buffer II (see Note 9). 2. Prepare six sheets of blotting paper per gel to fit the size of the gel. Soak two sheets in blotting buffer I and place onto the anode (+) of a semi-dry blotting apparatus. Soak one sheet in blotting buffer II and add to the stack. Add the PVDF membrane on top of this, and then carefully place the acrylamide gel onto the membrane, ensuring that its position does not change once it has touched the membrane (see Note 10). Soak three sheets of blotting paper in blotting buffer III and stack onto the gel. Roll over the surface of the stack with a glass pipette or test tube to remove any bubbles from between the layers. 3. Cover the gel stack with the cathode (−) of the blotting apparatus, set the maximum voltage to 25 V, and blot at 40 mA for 75 min (see Note 11). 4. Disassemble the blotting apparatus and block unspecific binding sites on the membrane by incubation on a rocking platform in TBST0.1/milk for 30 min at room temperature. 5. Incubate with primary antibody in TBST0.1/milk for a minimum of 1 h at room temperature or overnight at 4°C.
88
Ulrich and Davies
6. Wash the membrane three times for 10 min in TBST. 7. Incubate with secondary antibody in TBST0.1/milk for 1 h at room temperature. 8. Wash the membrane as done before, and then incubate for 5 min in TBS. 9. Detect the signals by chemiluminescence using the detection kit according to the manufacturer’s instructions. Obtain several different exposures of the membrane (see Note 12). 3.1.4. Small-Scale TCA Lysis
1. Harvest ca. 4 × 107 yeast cells (see Note 7) by centrifugation at 16,000g for 15 s. 2. Aspirate the supernatant and resuspend the pellet in 500 µl water. Place the tube on ice. 3. Add 75 µl of NaOH/BME, vortex, and incubate for 15 min on ice. 4. Add 75 µl of TCA solution, vortex, and incubate for 10 min on ice. 5. Centrifuge at 16,000g for 10 min at 4°C. 6. Aspirate the supernatant and centrifuge again briefly (30 s) in order to collect the residual buffer. Remove the last drops of liquid by aspiration. 7. Resuspend the pellet in 30 µl of HU buffer. If the pellets are not sufficiently dry, the suspension will turn green or yellow. In this case, add 1 µl of neutralizing buffer and make sure the resulting suspension turns blue. 8. Denature the sample at 60°C for 10 min. 9. Centrifuge briefly before analyzing by SDS-PAGE. Samples can be stored at −20°C, but it is important to completely solubilize the SDS, after thawing the samples, before loading on a gel.
3.1.5. Denaturing Ni-NTA Pull-Down
1. Harvest ca. 109 cells of the desired yeast culture (see Note 7) by centrifugation at 3,000g for 5 min (see Note 13). Remove the supernatant and place the tube on ice. Add 5 ml of icecold water, then 0.8 ml of NaOH/BME, resuspend the pellet by vortexing, and incubate on ice for 20 min. 2. Add 0.8 ml of TCA solution, vortex, and incubate on ice for 20 min. 3. Centrifuge at 8,000g for 20 min at 4°C. 4. Remove the supernatant and centrifuge again for 2 min in order to collect residual buffer. Remove the last drops of liquid by aspiration. 5. Resuspend the pellet in 1 ml of buffer A, transfer to a microcentrifuge tube, and incubate in a shaking heat block at room temperature for 1 h to solubilize the precipitate completely.
Detection of Sumoylation Targets in Yeast
89
6. Centrifuge at 16,000g for 10 min at 4°C and transfer the supernatant to a fresh tube. Discard the pellet (see Note 14). 7. Prepare a 20 µl aliquot of Ni-NTA agarose by washing three times with buffer A containing 0.05% Tween-20. When preparing several aliquots, these can be washed together and distributed into individual tubes at the last wash step (see Note 15). 8. Add the prepared cell extract to the tube containing the agarose. Then add 5 µl of 10% Tween-20 and 15 µl of imidazole solution (see Note 16). Incubate overnight at room temperature on a rotating wheel. 9. Centrifuge the agarose beads at 200g for 15 s and remove the supernatant. Wash the pellet twice with 1 ml of buffer A containing 0.05% Tween-20 and four times with 1 ml of buffer B containing 0.05% Tween-20. Remove the supernatant completely after the last wash. 10. Add 30 µl of HU buffer and denature the sample at 60°C for 10 min. Centrifuge briefly before analyzing by SDS-PAGE. Samples can be stored at −20°C, but need to be reheated before loading in this case. 3.2. Detection of Siz1-Dependent Cdc3HA Sumoylation via HisSmt3
Septin sumoylation will be analyzed by Ni-NTA chromatography from a strain carrying an episomal vector for expression of His7-tagged Smt3 and endogenously HA-tagged Cdc3 (11). Sumoylated Cdc3 will be detected by Western blot using an HA-specific antibody. Control extracts from strains lacking Histagged Smt3, expressing untagged Cdc3, or carrying a deletion of the SUMO ligase Siz1 will be examined in parallel. This section will describe the construction of an epitope-tagged CDC3 allele, the introduction of the expression vector for His-tagged Smt3, and the use of the resulting strains in pull-down experiments. The protocol can easily be adapted to the analysis of an alternative target.
3.2.1. Construction of Yeast Strains
In a wild-type (WT) and a siz1 (12,13) strain background, a sixfold HA epitope is appended to the CDC3 open reading frame in its native genomic context in order to allow the detection of the protein with a commercial antibody with minimal disturbance of expression or activity patterns (Fig. 6.1A). The resulting strains are called CDC3HA and CDC3HA siz1, respectively. An episomal expression vector YEp181-CUP-His7-Smt3 is then introduced for overexpression of His7-tagged Smt3 under control of a copper-inducible promoter (Fig. 6.1B). As a negative control, an “empty” vector YEplac181 (22) is transformed in parallel. Both vectors are also introduced into the untagged parent WT strain. When analyzing your gene of interest, adapt the gene-specific primer sequence to the relevant open reading frame (see Note 2).
90
Ulrich and Davies
Fig. 6.1. Construction of yeast strains for in vivo analysis of Cdc3HA sumoylation. (A) As a first step, a cassette bearing the epitope tag, followed by a transcriptional terminator (TT) and the TRP1 marker from Kluyveromyces lactis (klTRP1), is amplified from pYM3 by PCR with primers that incorporate 50 nt of homology to the carboxy terminus of CDC3 on either side (see Notes 1 and 2). WT yeast cells are transformed with the PCR product and transformants are selected by growth on medium lacking tryptophane. The regions of homology at the ends of the PCR product will direct the integration of the cassette into the genome by recombination (indicated by grey shading). This results in a strain with the 6HA-tag appended in-frame to the CDC3 gene. (B) Episomal vector for expression of His SMT3 under control of the CUP1 promoter (YEp181-CUP-His7-Smt3, see Note 1). The yeast 2µ replication origin is shown. All vectors shown here are shuttle vectors bearing an E. coli replication origin (ori) and the gene encoding β-lactamase for ampicillin resistance (Ampr).
Alternatively, if an antibody against the protein of interest is available, omit Steps 1–5 of this section. 1. Amplify the 6HA cassette including the klTRP1 marker from the plasmid pYM3 (23) in standard 100 µl PCR reactions using the primers CDC3-tag-down and CDC3-tag-up. Set
Detection of Sumoylation Targets in Yeast
91
up two reactions of 100 µl each and program the machine for 30 cycles, using an annealing temperature of 56°C, and an extension time sufficient for amplification of a 1.3 kbp fragment. 2. Combine the two reactions and analyze a 5 µl aliquot on a 0.8% agarose gel to verify the presence of a ∼1.5 kbp band. 3. Precipitate the PCR product by adding 20 µl of sodium acetate solution and 500 µl of absolute ethanol. Mix well and store at −20°C for 20 min. Recover the DNA by centrifugation at 16,000g for 10 min at 4°C. Aspirate the supernatant, add 750 µl of 70% ethanol, centrifuge again for 2 min, remove the supernatant completely, and dry the pellet at room temperature for 15 min. Resuspend the DNA in 20 µl of water. 4. Transform WT and siz1 yeast cells with 10 µl of the PCR product each (see Sect. 3.1.1). Spread the cells onto SC-Trp plates and incubate for 2–3 days at 30°C. 5. Inoculate several isolated colonies of the two transformations into 2 ml of liquid SC-Trp medium each, incubate with shaking overnight at 30°C, and examine the expression of epitope-tagged Cdc3 by small-scale TCA preparations, PAGE (8% gels), and anti-HA Western blot analysis (see Sects. 3.1.2–3.1.4). Use the untagged WT parent strain (grown in SC-complete medium) as a negative control. An example result is shown in Fig. 6.2A. Restreak one positive clone each, now designated as CDC3HA and CDC3HA siz1, onto a fresh SC-Trp plate, incubate at 30°C for 2–3 days, and select an isolated colony each for further experiments. 6. Use the plasmids YEplac181 and YEp181-CUP-His7-Smt3 (see Note 1) for transformation of WT, CDC3HA, and CDC3HA siz1. Spread the cells onto SC-Leu plates and incubate at 30°C for 2–3 days. 7. Grow 2 ml overnight cultures of isolated colonies in SC-Leu medium, supplemented with 100 µM CuSO4, at 30°C. Use one colony of the strain transformed with YEplac181 and 3–4 colonies each of the strains transformed with YEp181-CUPHis7-Smt3. Prepare small-scale TCA lysates as described above and analyze 5 µl aliquots by PAGE on 12% gels and Western blot, using antibodies against yeast Smt3 and the His-tag in order to confirm overexpression of tagged Smt3. Select clones that show good overexpression of the tagged construct (as shown in Fig. 6.2B) and restreak one colony each of the resulting strains on SC-Leu plates: - WT + YEplac181 - CDC3HA + YEplac181 - CDC3HA siz1 + YEplac181
92
Ulrich and Davies
Fig. 6.2. Analysis of Cdc3HA and HisSUMO by Western blot. (A) Anti-HA blot of total cell lysates showing expression of the 6HA-tagged CDC3 allele. An untagged WT strain is shown as a negative control. Note that the extent of sumoylation is too low to be detected on this blot. (B) Effect of HisSMT3 overexpression on the total cellular SUMO conjugates. The anti-Smt3 blot shows yeast SUMO conjugates in the strains used subsequently for Ni-NTA pull-downs, where “–” denotes the “empty” vector YEplac181. Note that HisSMT3 expression is observable even without addition of CuSO4, and the total level of conjugates does not increase significantly after induction of the CUP1 promoter, even though their size distribution changes (see Note 17). Reduced SUMO conjugate levels are found in the siz1 mutant.
Detection of Sumoylation Targets in Yeast
93
- WT + YEp181-CUP-His7-Smt3 - CDC3HA + YEp181-CUP-His7-Smt3 - CDC3HA siz1 + YEp181-CUP-His7-Smt3 3.2.2. Pull-down of HisSmt3 under Denaturing Conditions
1. Use the strains listed above to inoculate 5 ml cultures in SCLeu medium containing 100 µM CuSO4. Shake overnight at 30°C. 2. Use the overnight cultures to inoculate 50 ml cultures in the same medium at a starting cell density of OD600 ≈ 0.5. Shake at 30°C until the OD600 has just exceeded 1.0. At this stage the culture is actively growing in exponential phase. 3. Harvest 109 cells and perform denaturing Ni-NTA pulldowns as described in Sect. 3.1.5. 4. In parallel, prepare small-scale TCA lysates of each culture as described in Sect. 3.1.4. 1. Prepare 7.5% polyacrylamide gels for the analysis of the samples as described in Sect. 3.1.2.
3.2.3. Detection of SUMO Conjugates
2. Load the TCA lysates and the eluates from the pull-down onto both gels, run them as described in Sect. 3.1.2, and blot onto PVDF membranes as described in Sect. 3.1.3. 3. Use an anti-HA antibody to detect Cdc3HA in the TCA lysates and the pull-down samples. Fig. 6.3 shows a representative blot on which not only the mono-sumoylated form of Cdc3HA but also the longer poly-SUMO chains specific for Cdc3HA are visible in the positive sample. In this example the distinction between positive signals and background is evident, but care has to be taken in cases where the abundance of the relevant conjugates is low. As the total level of the HisSUMO conjugates depends on the expression level of the HisSMT3 gene (see Fig. 6.2B), the control strains have to be treated in parallel under identical conditions (see Note 17).
3.3. Detection of His PCNA Sumoylation by Endogenous Smt3
PCNA sumoylation will be detected using His-tagged POL30 alleles and endogenous yeast Smt3 (15–18). In this example, the Ni-NTA pull-downs serve to enrich the modified forms of PCNA against a background of nonspecific bands cross-reacting with the anti-PCNA antibody. This procedure significantly enhances the sensitivity of detecting low-abundance conjugates and allows the visualization of poly-SUMO chains on PCNA using an antiSmt3 antibody (20). We will detect the sumoylation pattern on WT PCNA as well as mutants in the two major SUMO acceptor sites, K127 and K164. A control strain, harboring untagged POL30, is processed in parallel to account for nonspecific signals from the antibodies.
94
Ulrich and Davies
Fig. 6.3. Analysis of Cdc3HA sumoylation by Ni-NTA pull-down in vivo. (A) Anti-HA Western blot of pull-down samples, indicating Cdc3HA-SUMO conjugates. A cross-reacting band is marked by an asterisk. (B) Anti-HA Western blot of total TCA lysates showing the presence of Cdc3HA in the relevant strains.
3.3.1. Construction of Yeast Strains
His-tagged versions of WT or mutant POL30 are first introduced into the LEU2 marker of WT yeast on integrative vectors bearing the tagged alleles under control of the POL30 promoter (16,17). Endogenous PCNA is then deleted using a plasmid knockout construct that replaces the open reading frame with the URA3 marker pBL243 (see Note 18). The strategy, along with possible alternative schemes, is outlined in Fig. 6.4. 1. Digest YIp128-P30-His6-POL30 and mutant versions (K127R, K164R, and K127/164R) (see Note 1) with AflII and use ca. 0.5 µg of digested DNA for transformation of WT yeast cells as described in Sect. 3.1.1. Spread the cells onto SC-Leu plates and incubate at 30°C for 2–3 days. 2. Inoculate several 2 ml cultures in liquid SC-Leu medium with isolated colonies, shake overnight at 30°C, and prepare TCA lysates for analysis by anti-PCNA Western blot (see Sects. 3.1.2–3.1.4). For each allele of POL30, select
Fig. 6.4. Strategies for the construction of His-tagged POL30 alleles for in vivo analysis of sumoylation (see also Notes 1 and 18). Recombination events are indicated by grey shading. (A) Transformation with an integrative plasmid bearing HisPOL30 (YIp128-P30-His6-POL30) into the LEU2 marker and subsequent deletion of endogenous POL30 by a hisG-URA3-hisG construct (pBL243). (B) Two-step replacement by integration of HisPOL30 into the POL30 locus and subsequent counterselection for loss of the URA3 marker and retention of the tagged allele. (C) One-step replacement by insertion of a cassette bearing HisPOL30 flanked by the selectable LEU2 marker.
Detection of Sumoylation Targets in Yeast 95
96
Ulrich and Davies
a colony that shows an additional band of equal intensity above endogenous PCNA, corresponding to the His-tagged protein (Fig. 6.5A, lane 2). Restreak these colonies onto a fresh SC-Leu plate and incubate at 30°C for 2–3 days. 3. For each of the POL30 alleles, inoculate an overnight culture in liquid YPD medium and use this for transformation with ca. 1 µg each of MluI/KpnI-digested pBL243 (24). Spread onto SC-Ura plates and incubate at 30°C for 2–3 days. 4. Inoculate several 2 ml cultures in liquid SC-Ura medium with isolated colonies, shake overnight at 30°C, and prepare TCA lysates for analysis by anti-PCNA Western blot as above. For each POL30 allele, select a clone that has lost the endogenous, untagged PCNA (Fig. 6.5A, lane 3). Restreak this clone onto a fresh SC-Ura plate and incubate at 30°C for 2–3 days.
Fig. 6.5. Construction and analysis of the strains used for detection of PCNA sumoylation in vivo. (A) Construction of a yeast strain bearing a His-tagged POL30 allele, followed by anti-PCNA Western blot analysis of TCA lysates. The blot shows extracts from yeast cells before introduction of the HisPOL30 allele, after insertion of HisPOL30, and after deletion of endogenous POL30. (B) Detection of SUMO (upper panel) and PCNA (lower panel) in total cell extracts of the strains used for the pull-down assays. Note that the SUMO conjugates at K164 in the POL30 (lower arrow) and HisPOL30 (upper arrow) strain are abundant enough to be detectable among the total SUMO conjugates. Their positions are marked by arrows.
Detection of Sumoylation Targets in Yeast 3.3.2. Pull-down of HisPCNA under Denaturing Conditions
97
1. Use the clones described above (Fig. 6.5A), together with an unmodified WT strain, for inoculation of 5 ml cultures in YPD and shake at 30°C overnight. 2. Use the overnight cultures to inoculate 50 ml cultures in the same medium at a starting cell density of OD600 ≈ 0.5. Shake at 30°C until the OD600 has just exceeded 1.0. 3. Harvest 109 cells and perform denaturing Ni-NTA pulldowns as described in Sect. 3.1.5. 4. In parallel, prepare small-scale lysates of each culture as described in Sect. 3.1.4.
3.3.3. Detection of SUMO Conjugates
1. Prepare two 10% polyacrylamide gels for the analysis of the samples as described in Sect. 3.1.2. Load 5 µl aliquots of the TCA preparations and the pull-down eluates onto each gel. Also assemble a NuPAGE 4–12% Bis-Tris gradient gel and load the pull-down samples twice, placing the molecular weight marker into the middle to separate the two sets of samples. Run the gels as described above and blot onto PVDF membranes. 2. Develop one of the membranes derived from the 10% gels with anti-PCNA and the other one with anti-Smt3 antibodies. Cut the membrane corresponding to the gradient gel samples along the marker lane and develop one half with anti-PCNA and the other half with anti-Smt3 antibodies. 3. The Western blots of the TCA lysates should result in a picture similar to that shown in Fig. 6.5B. As its abundance in vivo is quite high, PCNA sumoylated at K164 may be detectable as a distinct band even on anti-SUMO blots of total conjugates, recognizable by its absence in the Hispol30(K164R) and Hispol30(K127/164R) and a size shift between POL30 and HisPOL30. 4. The analysis of the pull-down samples by SDS-PAGE and Western blot exemplifies the sensitivity of the detection method (Fig. 6.6). The anti-SUMO blots allow detection of poly-SUMO conjugates of high molecular weight that are not visible on the PCNA-specific blots, because the antiSUMO antibody naturally favors higher order polymers of SUMO. The architecture of the conjugates shown here has been described and interpreted in detail elsewhere (20). 5. When images derived from 10% gels versus gradient gels are compared side-by-side, a characteristic complexity of the running behavior of SUMO conjugates on polyacrylamide gels is revealed (Fig. 6.6). Despite an identical molecular weight, attachment of SUMO to K164 of PCNA results in a species with a mobility different from that of a conjugate at K127, and the relative mobilities vary with the gel system
98
Ulrich and Davies
Fig. 6.6. Analysis of PCNA sumoylation in vivo. (A) Detection of SUMO (upper panels) and PCNA (lower panels) in the eluate from Ni-NTA beads. The Western blots represent samples separated on 10% polyacrylamide gels. (B) The same samples were separated on 4–12% Bis-Tris gradient gels. Positions of the major SUMO conjugates are labeled on both blots. The asterisks indicate the positions of PCNA di- and tri-sumoyated at K164.
used. As a rule, SUMO conjugates generally tend to exhibit lower mobilities than expected based on their molecular weights. This often allows detection of a size shift even in cases of high molecular weight conjugates.
4. Notes 1. pYM3 (23) encodes a 6HA-epitope flanked by a selectable marker (klTRP1) for preparing tagged alleles (Fig. 6.1A). Various other tags and markers are equally suitable (23,25). YEp181-CUP-His7-Smt3 is an episomal vector based on the yeast shuttle vector YEplac181 (22), carrying the LEU2 marker and His7-tagged SMT3 (in its processed form without the C-terminal extension) under the control of the cop-
Detection of Sumoylation Targets in Yeast
99
per-inducible CUP1 promoter (Fig. 6.1B). pBL243 (24) is useful for disruption of the POL30 gene by a hisG-URA3hisG marker that can be removed by counterselection on 5-fluoroorotic acid (Fig. 6.4). YIp128-P30-His6-POL30 and mutant derivatives (16,17) are integrative vectors carrying the LEU2 marker and His6-tagged POL30 under the control of its own promoter (Fig. 6.4). 2. The primer sequences given here are compatible with a series of widely used tagging and deletion cassettes (23,25). The underlined sequence is specific for the gene of interest, while the 3′ terminus of each primer is used to amplify the desired cassette. The gene-specific sequence should be at least 45 nt in length. We routinely use 50 nt for efficient in vivo recombination. 3. Reagents and equipment as well as protocols for agarose gel electrophosesis are not given here in detail, but can be found in general laboratory manuals for molecular biology and cloning (26). 4. It is important to use polyethylene glycol of the correct molecular weight range (PEG 3350). The solution is quite viscous and has to be pipetted slowly. It is sterilized by autoclaving. During this process, a white precipitate may form that will eventually settle at the bottom of the flask. This does not affect transformation efficiency. 5. This solution is commercially available (e.g., Sigma D7290), and can also be prepared in the lab. To prepare this solution, use Type XIV sodium salt (Sigma D6898) and dissolve in TE buffer at 10 mg/ml. Shear the DNA by pulling the solution repeatedly through a narrow-gauge needle and by sonication with ultrasound until it is no longer viscous. Extract three times with equal volumes of TE-equilibrated phenol, once with a 25:25:1 mixture of TE-equilibrated phenol:chloroform:isoamyl alcohol and once with a 25:1 mixture of chloroform:isoamyl alcohol. Precipitate the DNA with 0.1 volume of 3 M sodium acetate, pH 5.2, and 10 volumes of absolute ethanol at 4°C for 30 min. Centrifuge the precipitate at 8,000g for 10 min, remove the supernatant, wash the pellet with 70% ethanol, centrifuge again briefly, remove the supernatant, and dry the pellet at room temperature for several hours. Redissolve the DNA (incubation with shaking overnight might be required). Heat-denature at 95°C for 10 min before use. The preparation can be stored at −20°C, but should be reheated from time to time in order to maintain the denatured state. 6. While the HA- and His-specific antibodies are commercially available, the antibodies specific for yeast SUMO and
100
Ulrich and Davies
PCNA have been generated in our lab (17). Similar antibodies are available from a number of yeast labs. Antibodies raised against mammalian PCNA react poorly with the yeast protein and are not suitable for the detection of PCNA modifications. 7. The number of yeast cells in a culture can be roughly determined by the optical density at 600 nm (OD600). Although the ratio between OD600 and cell number depends on the size of the cells, an approximate calculation can be performed using the ratio: 1 0D600 ≈ 2 × 107 cells/ml. For accurate measurements of optical densities, yeast cultures should be diluted to a reading not exceeding OD600 = 0.3. Cultures grown in YPD remain exponential up to OD600 ≈ 2. In SC medium they should not exceed an OD600 of 1. 8. When loading samples in HU buffer, ensure that equal volumes of the buffer are loaded into empty wells in order to obtain a straight running pattern. If this is not done, the high concentration of urea in the HU buffer will promote a spreading of the corresponding lanes into adjacent urea-free regions of the gel. Samples in other loading buffers, such as the molecular weight markers, need to be mixed with HU buffer for loading in order to avoid being “squeezed” by adjacent urea-containing lanes during the run. 9. PVDF membranes are preferable to nitrocellulose membranes because of their better physical stability and the lower propensity of proteins to run through the membrane during blotting. These membranes need to be wetted with methanol due to their hydrophobicity. Once wet, they should never be allowed to dry during the blotting and detection process. 10. If the gel is moved after having touched the membrane, spurious signals are likely to appear on the film. This is particularly relevant for gels bearing pull-down samples, because some proteins are highly enriched by this procedure and may leave an imprint on the membrane on first contact. 11. We describe here a semi-dry blotting procedure. For very large proteins, tank blotting may be preferable. We use a discontinuous buffer system in order to minimize the loss of proteins from “run-through”. 12. The chemiluminescence signal can be quantified on an imager (e.g., Fuji LAS-3000), but it has to be borne in mind that the signal strength is usually not proportional to the amount of protein on the blot. Accurate quantification will require comparison to samples of known concentrations. 13. Depending on the abundance of the target protein and the extent of its modification, smaller amounts of cells can often be used for the pull-down. Isolation of tagged proteins from
Detection of Sumoylation Targets in Yeast
101
the lysates under the conditions described here is not quantitative, but the amount recovered in the eluate is roughly proportional to the number of cells used for preparing the lysate. 14. Incomplete removal of the supernatant of this step will result in lower pull-down efficiencies because of an inappropriately low pH due to TCA carry-over. To avoid this, the pH of the solution can be checked at this point and, if needed, adjusted. However, if the supernatant after TCA precipitation is removed completely by two steps of centrifugation and aspiration, adjustment should not be necessary. 15. Agarose beads should be centrifuged at low speed to avoid crushing them. All wash solutions should contain some detergent, which prevents the beads from sticking to the sides of the tube. For distributing them with a pipette, cut the tip from the plastic pipette tip. Magnetic Ni-NTA beads are also available and are easier to handle, but, in direct comparisons, we have found that their binding capacity is significantly lower. 16. Addition of low concentrations of imidazole significantly reduces the background signal arising from nonspecific binding to the Ni-NTA beads. However, concentrations higher than 15 mM are not recommended, as they will reduce the pull-down efficiency. 17. As shown in Fig. 6.2B, the amount and distribution of the total cellular HisSUMO conjugates depends on the expression levels of the HisSMT3 allele, and addition of CuSO4 does not automatically result in increased conjugation of the tagged protein, even though the total abundance of SUMO is much higher than in the absence of copper. Omission of CuSO4 may sometimes result in improved detection of some His SUMO conjugates, but this needs to be empirically determined for each candidate substrate. 18. We describe here just one of several strategies to replace an endogenous gene with a His-tagged allele. This method is simple and works with high efficiency for any gene, and mutant alleles can be introduced with the same ease. The disadvantage is the use of two selectable markers: one by the integrative vector and the other one for the deletion construct. However, in this example, the knockout construct for POL30, pBL243, carries the URA3 marker flanked by tandem repeats of a sequence derived from the E. coli hisG gene (pol30::hisG-URA3-hisG), which allows the subsequent removal of URA3 by counterselection on 5-fluoroorotic acid (5FOA). An alternative approach is the integration of the tagged allele on a URA3-based plasmid into the target locus itself and subsequent selection on 5FOA for loss of the
102
Ulrich and Davies
untagged open reading frame by spontaneous recombination between the two alleles. This strategy leaves no marker behind in the genome, but the integration of mutant alleles is less efficient, because recombination may occur anywhere within the open reading frame, thus separating the His-tag from the site of the mutation. A third option would be the insertion of a selectable marker adjacent to the tagged open reading frame on a plasmid carrying the gene with its flanking regions and the use of this construct for a one-step replacement of the endogenous gene. All three options are schematically depicted in Fig. 6.4.
Acknowledgments The authors would like to thank E. Johnson for providing the strain CDC3HA, P. Burgers for plasmid pBL243, and M. Knop for plasmid pYM3. Work in this lab is supported by Cancer Research UK.
References 1. Denison, C., Rudner, A. D., Gerber, S. A., Bakalarski, C. E., Moazed, D., and Gygi, S. P. (2005) A proteomic strategy for gaining insights into protein sumoylation in yeast. Mol. Cell. Proteomics 4, 246–254. 2. Ganesan, A. K., Kho, Y., Kim, S. C., Chen, Y., Zhao, Y., and White, M. A. (2007) Broad spectrum identification of SUMO substrates in melanoma cells. Proteomics 7, 2216–2221. 3. Hannich, J. T., Lewis, A., Kroetz, M. B., Li, S. J., Heide, H., Emili, A., and Hochstrasser, M. (2005) Defining the SUMOmodified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280, 4102–4110. 4. Manza, L. L., Codreanu, S. G., Stamer, S. L., Smith, D. L., Wells, K. S., Roberts, R. L., and Liebler, D. C. (2004) Global shifts in protein sumoylation in response to electrophile and oxidative stress. Chem. Res. Toxicol. 17, 1706–1715. 5. Panse, V. G., Hardeland, U., Werner, T., Kuster, B., and Hurt, E. (2004) A proteomewide approach identifies sumoylated substrate proteins in yeast. J. Biol. Chem. 279, 41346–41351. 6. Rosas-Acosta, G., Russell, W. K., Deyrieux, A., Russell, D. H., and Wilson, V. G. (2005)
7.
8.
9.
10.
11.
12.
A universal strategy for proteomic studies of SUMO and other ubiquitin-like modifiers. Mol. Cell. Proteomics 4, 56–72. Vertegaal, A. C., Ogg, S. C., Jaffray, E., Rodriguez, M. S., Hay, R. T., Andersen, J. S., Mann, M., and Lamond, A. I. (2004) A proteomic study of SUMO-2 target proteins. J. Biol. Chem. 279, 33791–33798. Wohlschlegel, J. A., Johnson, E. S., Reed, S. I., and Yates, J. R. 3rd. (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J. Biol. Chem. 279, 45662–45668. Zhao, Y., Kwon, S. W., Anselmo, A., Kaur, K., and White, M. A. (2004) Broad spectrum identification of cellular small ubiquitin-related modifier (SUMO) substrate proteins. J. Biol. Chem. 279, 20999–21002. Zhou, W., Ryan, J. J., and Zhou, H. (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J. Biol. Chem. 279, 32262–32268. Johnson, E. S. and Blobel, G. (1999) Cell cycle-regulated attachment of the ubiquitinrelated protein SUMO to the yeast septins. J. Cell Biol. 147, 981–994. Johnson, E. S. and Gupta, A. A. (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106, 735–744.
Detection of Sumoylation Targets in Yeast 13. Takahashi, Y., Kahyo, T., Toh-E, A., Yasuda, H., and Kikuchi, Y. (2001) Yeast Ull1/Siz1 is a novel SUMO1/Smt3 ligase for septin components and functions as an adaptor between conjugating enzyme and substrates. J. Biol. Chem. 276, 48973–48977. 14. Jónsson, Z. O. and Hübscher, U. (1997) Proliferating cell nuclear antigen: more than a clamp for DNA polymerases. BioEssays 19, 967–975. 15. Hoege, C., Pfander, B., Moldovan, G. L., Pyrowolakis, G., and Jentsch, S. (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419, 135–141. 16. Stelter, P. and Ulrich, H. D. (2003) Control of spontaneous and damage-induced mutagenesis by SUMO and ubiquitin conjugation. Nature 425, 188–191. 17. Papouli, E., Chen, S., Davies, A. A., Huttner, D., Krejci, L., Sung, P., and Ulrich, H. D. (2005) Crosstalk between SUMO and ubiquitin on PCNA is mediated by recruitment of the helicase Srs2p. Mol. Cell 19, 123–133. 18. Pfander, B., Moldovan, G. L., Sacher, M., Hoege, C., and Jentsch, S. (2005) SUMOmodified PCNA recruits Srs2 to prevent recombination during S phase. Nature 436, 428–433. 19. Robert, T., Dervins, D., Fabre, F., and Gangloff, S. (2006) Mrc1 and Srs2 are major actors in the regulation of spontaneous crossover. EMBO J. 25, 2837–2846.
103
20. Windecker, H. and Ulrich, H. D. (2008) Architecture and assembly of poly-SUMO chains on PCNA in Saccharomyces cerevisiae. J. Mol. Biol. 376, 221–231. 21. Guthrie, C. and Fink, G. R. (1991) Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego, CA. 22. Gietz, R. D. and Sugino, A. (1988) New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527–534. 23. Knop, M., Siegers, K., Pereira, G., Zachariae, W., Winsor, B., Nasmyth, K., and Schiebel, E. (1999) Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines. Yeast 15, 963–972. 24. Ayyagari, R., Impellizzeri, K. J., Yoder, B. L., Gary, S. L., and Burgers, P. M. (1995) A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair. Mol. Cell. Biol. 15, 4420–4429. 25. Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961. 26. Sambrook, J. and Russell, D. W. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Chapter 7 Identification of SUMO-Interacting Proteins by Yeast Two-Hybrid Analysis Mary B. Kroetz and Mark Hochstrasser Abstract This chapter will discuss various adaptations of the yeast two-hybrid method for analyzing protein interactions that can be used to identify small ubiquitin-related modifier (SUMO) interacting proteins and to determine the nature of the SUMO–protein interactions that occur. SUMO binds to a protein in two different ways: covalently and noncovalently. In a covalent interaction an isopeptide bond forms between the glycine residue at the C terminus of the mature SUMO and a lysine side-chain on the substrate protein. Alternatively, SUMO can interact noncovalently with another protein, usually via insertion of a β strand from a substrate SUMO-interacting motif (SIM) into a hydrophobic groove next to the SUMO β2 strand. By mutating either the C-terminal diglycine motif or amino acids within the β2 strand of SUMO, these respective interactions can be abolished. The expression of the two-hybrid SUMO constructs with either of these mutations can help distinguish the type of interaction that occurs between a SUMO and a given protein. Sumoylation can be verified by independent methods, such as a SUMO mobility shift assay. Finally, the chapter will compare the two-hybrid approach with mass spectrometric analysis as a means of identifying SUMO-interacting proteins. Key words: SUMO, two-hybrid analysis, SIM (SUMO-interacting motif), desumoylating enzymes, SUMO proteases.
1. Introduction Mammalian SUMO-1 (small ubiquitin-related modifier-1) was initially identified as an interacting protein with various bait proteins in different yeast two-hybrid screens (1–3). Two independent studies then revealed that SUMO-1 acts as a modifying group that is covalently bound to a substrate protein (4,5). “Sumoylation” of a protein can change its localization, activity, or interaction with other proteins, and SUMO (there are three functional SUMO paralogs in mammals: SUMO-1 and the closely related SUMO-2 and SUMO-3 proteins; here we will use “SUMO”
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
107
108
Kroetz and Hochstrasser
unless the paralogs need to be distinguished) has been implicated in a number of biological pathways including cell cycle progression, DNA repair, cytokinesis, and transcription (6,7). Therefore, a more comprehensive understanding of the proteins that interact with SUMO can shed light on the mechanisms by which SUMO regulates specific cellular regulatory mechanisms. Subsequent to the discovery of SUMO as a post-translational modifier, the yeast two-hybrid method—designed to identify in vivo protein– protein interactions (8)—has been utilized to identify a number of other proteins that interact with SUMO (9,10). One of the great advantages of this technique is that it not only identifies SUMOinteracting proteins but can also be adapted so that covalent and noncovalent interactions with SUMO can be distinguished (9). This chapter will detail how the two-hybrid approach can be used to identify proteins that interact with SUMO and to distinguish whether the association with SUMO is likely to be covalent or noncovalent. We will also compare the two-hybrid approach to mass spectrometry methods as alternatives for the identification of SUMO–protein interactions.
2. Materials 1. Yeast two-hybrid vectors and expression strain, for example: pGAD and pGBD; pGAD-based plasmid library of yeast chromosomal DNA fragments, and yeast two-hybrid expression strain PJ69-4A (11). 2. Restriction enzymes, T4 DNA ligase. 3. SD minimal medium plates lacking various combinations of the following: leucine, uracil, histidine, and adenine; and buffered SD minimal medium plates for yeast containing X-gal, 5-Fluoroorotic acid (5-FOA), or 3-amino-triazole (3-AT) (12). 4. E.Z.N.A. Yeast Plasmid Mini Kit (Omega Bio-Tek, Inc.) or an equivalent system for harvesting plasmids from yeast. 5. E. coli strain carrying a leuB mutation such as the RR1 strain (11) and M9 minimal medium plates lacking leucine. 6. Oligonucleotide primers for DNA sequencing. 7. Quikchange mutagenesis kit (Stratagene) or an equivalent system. 8. ULP1 overexpression plasmid (13). 9. TAP-tagged yeast strains (Open Biosystems). 10. Yeast high-copy SUMO plasmids, expressing either an N-terminally tagged SUMO or an untagged SUMO (9).
Two-Hybrid Analysis of SUMO
109
11. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) reagents, equipment for protein electroblotting, and anti-PAP antibody (Sigma).
3. Methods The methods described below outline (1) the construction of the necessary yeast two-hybrid plasmids and the protocol for screening a “prey” library for SUMO-interacting proteins; (2) the variations used to determine if a SUMO interaction is likely to be covalent, noncovalent, or both; (3) a method used to verify that the identified protein is indeed sumoylated; and (4) a brief comparison of two-hybrid and mass spectrometry approaches. 3.1. Screening a Yeast Genomic Library for Two-Hybrid Interactions with SUMO
The two-hybrid screening methods used to identify SUMO-interacting proteins will be described in Sects. 3.1.1–3.1.3. These include a description of the plasmids and yeast strains used to screen a library of two-hybrid “prey” constructs for their interactions with the “bait” SUMO, as well as methods used to confirm the two-hybrid signal and to identify the interacting peptides or protein domains.
3.1.1. Two-Hybrid Plasmids and Yeast Strains
A number of vector systems and strains are available for yeast two-hybrid analysis. The analysis of SUMO–protein interactions described here uses a set of constructs and yeast strains described previously (11). Fig. 7.1 depicts the plasmids used for screening, the pGBD-SUMO bait plasmid, and pGAD vector into which the target DNA library is inserted. The two-hybrid method exploits the ability of the DNA-binding and activation domains of a transcriptional activator to function on separate polypeptides if those polypeptides are able to associate. In the present case, the yeast Gal4 transcription factor is used. The Gal4 DNA-binding domain (GBD) and the Gal4 activation domain (GAD) must be brought into close proximity to activate reporter genes that are under the control of distinct GAL promoters. These Gal4 domains do not have an affinity for one another but are brought together by the interaction of the proteins to which they are each fused. The yeast two-hybrid reporter strain PJ69-4A was developed with three separate reporter genes: GAL1-HIS3, GAL2-ADE2, and GAL7-lacZ. The use of distinct GAL promoters and reporters helps to minimize false positives. The different reporters vary somewhat in their sensitivity to particular protein–protein interactions. In general, the GAL1-HIS3 is sensitive to even weak interactions, and the stringency of the growth assay can be increased by adding 3-amino-triazole (3-AT), which is an inhibitor of His3 catalytic activity, to the medium.
110
Kroetz and Hochstrasser
Fig. 7.1. Diagram of yeast two-hybrid plasmids. (A) Structure of the pGBD-SUMO and pGAD-C(x) plasmids. Stippled regions indicate the constitutive ADH1 promoter (P) and transcription termination (T) elements. The sequence encoding mature yeast SUMO or its variants, indicated by the black segment, was cloned downstream of and in-frame with the sequence encoding the Gal4 BD (DNA-binding domain). In the pGAD plasmids, the multiple cloning site follows directly after the GAL4 AD (activation domain) sequence. (B) Sequences of the multiple cloning region for the pGAD-C(x) and pGBDU-C(x) plasmids (11). Restriction sites are underlined; stop codons are boxed. The complete sequences of the pGAD plasmids can be found in Genbank under the accession numbers U70024 (pGAD-C1), U70025 (pGAD-C2), and U70026 (pGAD-C3). pGBD-SUMO is a derivative of pGBDU-C1, accession number U70021.
The SUMO-encoding bait gene (yeast SMT3 in the current example) is cloned into the plasmid containing the DNA-binding domain of Gal4, yielding pGBD-SUMO. In the example study, a Saccharomyces cerevisiae genomic library derived from various partial restrict digests of chromosomal DNA was screened (11). Alternatively, cDNA libraries from yeast or other species could be utilized. Three versions of the pGAD plasmids (pGAD-C1, pGAD-C2, and pGAD-C3) allow for in-frame fusion of the Gal4 activation domain and various prey fragments (see Note 1). The pGBD-SUMO plasmid is first transformed into the PJ69-4A yeast cells to create the bait strain and, subsequently, the prey libraries are transformed into this strain. If the prey interacts with SUMO, the various reporter genes will yield a positive signal. 3.1.2. Screening a Library for Two-Hybrid Interactions with SUMO
1. Clone the SUMO-encoding gene into the multiple cloning site of the pGBD plasmid to express an in-frame, full-length GBD-SUMO fusion. SUMO is fused to the C-terminal end of
Two-Hybrid Analysis of SUMO
111
the GBD; hence, the SUMO C terminus can be activated and conjugated to other proteins. SUMO proteins are normally expressed in precursor forms that require processing of C-terminal peptides in order to reach the mature, conjugation-competent state of the protein. To avoid problems with precursor processing, it is advisable to express only the mature portion of SUMO, which terminates with two glycine residues. 2. Obtain or create a library of yeast chromosomal DNA fragments cloned into each reading frame–specific pGAD plasmid, pGAD-C1, pGAD-C2, and pGAD-C3, or an analogous set of two-hybrid screening vectors. 3. Transform the library of pGAD plasmids into the two-hybrid yeast strain PJ69–4A carrying the pGBD-SUMO plasmid using standard techniques (12) (for an alternate approach using mammalian SUMO see Note 2). Cells should be plated at a density that will yield ~300–800 colonies per plate. This needs to be determined empirically. 4. Grow the cells on double dropout plates (SD–ura–leu, which are minimal medium plates lacking uracil and leucine) to select for cells that carry both two-hybrid plasmids. 5. To test for two-hybrid interactions, replica-plate colonies from the double dropout plates onto three different tester plates: (1) SD–ura–leu–his triple dropout plates (his = histidine), which test for the expression of the GAL1-HIS3 reporter gene; (2) SD–ura–leu–ade triple dropout plates (ade = adenine), which test for the expression of the GAL2-ADE2 reporter; and (3) X-gal plates lacking uracil and leucine, which test for the expression of the GAL7-lacZ reporter (colonies turn blue if the lacZ-encoded β-galactosidase enzyme is expressed). Control transformations with empty pGAD vectors are also necessary to verify that any positive signal on the above plates requires the inserted prey sequence. If a high background of growth of cells expressing only GBD-SUMO is observed on plates lacking histidine, plates with different concentrations of 3-AT should be tested to find a minimal 3-AT concentration that prevents this growth. Ideally, a clone should give a positive signal on all three tester plates; however, weaker interactions might not always allow growth on the adenine dropout plates yet might still prove to be biologically relevant in subsequent validation tests. 3.1.3. Confirming the Two-Hybrid Interaction and Identifying the Prey Peptides
Colonies yielding positive yeast two-hybrid signals express proteins that potentially interact with SUMO. 1. To confirm that the two-hybrid signal is dependent on the SUMO fusion protein, evict the pGBD-SUMO plasmid from the yeast cells by streaking the colonies from the master plates onto a medium containing 5-FOA. 5-FOA is toxic
112
Kroetz and Hochstrasser
for strains that synthesize uracil, and therefore a medium containing 5-FOA selects for the cells that have lost the URA3-marked pGBD-SUMO plasmid. 5-FOA-resistant cells are then retested for expression of the three two-hybrid reporters. If the two-hybrid signal is abrogated on eviction of the pGBD-SUMO plasmid, the signal likely depends on the two-hybrid SUMO-prey protein interaction. 2. A second control to verify that a positive two-hybrid signal is due to interaction between the two fusion proteins is to recover the prey plasmid in E. coli, purify the plasmid, transform it into the original bait strain, and retest: i. Isolate plasmid DNA from the two-hybrid yeast strain by a rapid isolation method such as the E.Z.N.A. Yeast Plasmid Mini Kit (Omega Bio-Tek, Inc.). ii. Transform into E. coli RR1 and select for ampicillinresistant colonies. iii. Replica-plate colonies to M9 minimal plates lacking leucine (11,14). RR1 cells have a mutated leuB gene, which is a homolog of the yeast LEU2 gene present on the pGAD plasmids and can be functionally replaced by LEU2. iv. Retransform the isolated plasmids into the two-hybrid bait strain. v. Repeat Step 5 of Sect. 3.1.2 to confirm that the newly transformed plasmids continue to give a positive twohybrid signal. 3. Once a prey clone has been verified to give a positive twohybrid signal, the insert in the pGAD is sequenced. For genomic yeast DNA inserts, it is sufficient to sequence the ends of the insert because the entire genomic sequence of S. cerevisiae is available. The junction of the insert that is fused in-frame with the GAD domain in the pGAD plasmid can be sequenced with the primer 5′-TTCGATGATGAAGATACC-3′ and the distal junction of insert and vector can be sequenced with the primer 5′-TGAAGTGAACTTGCGGGG-3′ (11). 3.2. Modifications of the Yeast Two-Hybrid Method
Similar to ubiquitin, SUMO interacts covalently or noncovalently with other proteins. In covalent interactions, an isopeptide bond is formed between the glycine at the C terminus of the mature SUMO and a lysine side chain of the substrate protein; in noncovalent interactions, the most common interface involves residues in the β2 strand of SUMO that bind to a stretch of aliphatic amino acids (usually followed by a cluster of acidic residues) known as a SUMO-interacting motif (SIM) on the interacting protein (10,15). Mutating SUMO residues involved in either type of interaction can help determine the nature of the interaction responsible for the two-hybrid signal.
Two-Hybrid Analysis of SUMO
113
There are two desumoylating enzymes or SUMO proteases in yeast, Ulp1 and Ulp2, which are responsible for cleaving the isopeptide bond between SUMO and its substrates (16). Ulp1 also processes the SUMO precursor. Altering the expression level of either SUMO protease changes the profile of bulk SUMOprotein conjugates within the cell, which can be visualized by anti-SUMO immunoblotting (16) (Fig. 7.2). Moreover, altering SUMO protease expression levels can modulate the outcome of yeast two-hybrid interaction assays (9). A great advantage of the two-hybrid system compared to other methods of determining SUMO-interacting proteins is that by incorporating a few simple adaptations to the two-hybrid system, the type of interaction that is required between SUMO and the interacting protein can easily be determined. Sections 3.2.1 and 3.2.2 discuss various mutations incorporated in the pGBD-SUMO to determine if the SIM-binding domain or the conjugation site (or both) of the SUMO moiety is essential for a particular two-hybrid interaction. Refer to Fig. 7.3 for a diagram of these potential interactions. In Sect. 3.2.3, the
Fig. 7.2. Comparison of bulk SUMO conjugates in different yeast strains. Anti-SUMO immunoblot of whole cell lysates of the following strains: (lane 1) wild-type strain (WT); (lane 2) WT strain harboring a high-copy (HC) ULP1 plasmid; (lane 3) ulp1ts mutant strain; and (lane 4) ulp2∆ strain. Strains were harvested during logarithmic growth at 30°C. For the lower panel, the membrane was reprobed with anti-Pgk1 to compare protein loading. * indicates high molecular weight poly-SUMO conjugates within the stacking gel.
114
Kroetz and Hochstrasser
Fig. 7.3. Diagram of potential SUMO–protein interactions identified from various permutations of the yeast two-hybrid assay. (A) Four ways by which pGBD-SUMO can interact with a GAD-prey fusion to generate a two-hybrid signal. (I) SUMO is covalently conjugated to the GAD-prey fusion. (II) SUMO is conjugated to a protein that associates noncovalently with the prey. (III) Direct noncovalent SUMO interaction with the prey. (IV) Noncovalent SUMO interaction with a protein that associates noncovalently with the prey. (B) Table listing the type of SUMO–protein interactions that can be identified by variations of the yeast two-hybrid system. See main text for details.
use of high-copy ULP1, which reduces the levels of most SUMO conjugates, is described as an additional way to test possible covalent interactions in the two-hybrid assay system. 3.2.1.Modifications to pGBD-SUMO that Abolish its Ability to Conjugate to Substrates
Once a protein is determined to interact with SUMO, the following modifications can be incorporated into the two-hybrid system. First, instead of using the standard pGBD-SUMO plasmid, a sequence encoding a SUMO mutant that lacks the last two glycine residues is cloned into the pGBD plasmid, creating pGBD-SUMO∆GG (9). SUMO∆GG is not capable of covalently modifying a protein (17). Therefore, if a two-hybrid signal is still present with the expression of pGBD-SUMO∆GG, SUMO must interact noncovalently with the protein (9) (see Note 3). Fig. 7.4 compares two yeast SUMO-interacting proteins: one that interacts noncovalently (Ris1) and the other that is likely to depend on a covalent SUMO–protein interaction for strong interaction (Yen1).
Two-Hybrid Analysis of SUMO
115
Fig. 7.4. Conjugationally competent SUMO is necessary for some SUMO–protein interactions. Two-hybrid fusion protein interactions activate the GAL1-HIS3 reporter gene, allowing for growth on media lacking histidine. Either pGBD-SUMO or pGBD-SUMO∆GG is expressed in the two-hybrid strain with one of the indicated pGAD-yeast gene fusion constructs. GAD-Yen1 can only interact with the conjugationally competent GBD-SUMO, whereas GAD-Ris1 interacts with both GBDSUMO and GBD-SUMO∆GG as determined by growth on medium lacking histidine.
3.2.2. Modifications to pGBD-SUMO that Abolish Noncovalent Interactions
Structural and mutagenesis studies demonstrated that the β2 strand of SUMO and part of the α helix are the chief sites of noncovalent binding to a substrate SIM (18,19,20). When mutations in these two regions were incorporated into a SUMO derivative expressed in the yeast two-hybrid system, interaction with a SIM-containing prey protein was greatly impaired; mutations with strong effects included the following: I34E, V38K, K39A, and K45/46A (20). Quikchange (Stratagene) site-directed mutagenesis can be used to mutate the pGBD-SUMO plasmid with any of the aforementioned mutations. The SIM-binding mutants are then used with the identified GAD-prey fusions to determine if SUMObinding is inhibited. GAD-fusion peptides that produce a twohybrid signal with the mutant GBD-SUMO probably do not need a SIM domain to interact with SUMO. It is noteworthy that noncovalent SIM binding is sometimes a prerequisite for covalent SUMO modification of the same protein (21). The core consensus SIM has been determined as I/V-X-I/V-I/V or the inverted motif but is usually flanked on one side by a cluster of acidic residues; however, the full range of functional sequence variations of SIMs has not been determined (15,22). As a complementary approach, if a putative SIM is identified in a prey
116
Kroetz and Hochstrasser
protein, it can be mutated in the context of the pGAD plasmid to determine if it abolishes the two-hybrid signal. 3.2.3. Overexpression of ULP1
When the highly active and broad-specificity desumoylating enzyme Ulp1 is expressed from a high-copy plasmid, the level of SUMO conjugates is greatly reduced, as determined by Western blot analysis (Fig. 7.2) (13) (see Note 4 and 5). When ULP1 is overexpressed in the yeast two-hybrid system, this decrease in bulk SUMO conjugates will often be paralleled by a loss of twohybrid signal if the prey–protein interaction with SUMO requires covalent SUMO modification (I, II in Fig. 7.3). A previous twohybrid screen showed a close correspondence between interactions that were sensitive to overexpressed ULP1 and those that were sensitive to the deletion of the terminal diglycine motif in SUMO (GBD-SUMO∆GG) (9). However, the concordance was not 100%, presumably because Ulp1 may not be active against some sumoylated proteins or the diglycine motif of SUMO may be necessary for certain noncovalent SUMO interactions.
3.3. Verifying the Sumoylation of a Protein by a SUMO Mobility Shift Assay
After a potential substrate has been identified by yeast twohybrid analysis, the sumoylation of the substrate in vivo should be confirmed by an independent method. One relatively simple method is to look for forms of the substrate that migrate more slowly on an SDS gel than the unmodified protein and determine whether migration of these species is retarded further if cells express an epitope-tagged (larger) SUMO protein. Additions of peptide extensions to the N terminus of SUMO are tolerated, although some are conjugated less efficiently than the untagged SUMO. If antibodies to the target protein are unavailable, epitope-tagged derivatives can be generated. For yeast proteins, a library of genomically tagged ORFs is commercially available (Open Biosystems) in which individual yeast proteins are fused to a tandem-affinity purification (TAP) tag composed of a protein A segment and a calmodulin-binding peptide (23). If the protein is sumoylated to a significant level in vivo, Western blot analysis of whole cell lysates of logarithmically growing yeast should detect a slower migrating band(s), often present at a small fraction of the level of the unmodified protein (see Note 6). In order to determine if the slower migrating species results from sumoylation of the target protein, the strain is transformed with either a plasmid that expresses high levels of untagged SUMO or a peptide-tagged SUMO derivative such as Flag-TEVSUMO (FT-SUMO) (9). The Flag-TEV tag is large enough to cause a detectable supershift of the sumoylated species by Western blotting analysis for most proteins when compared to cells expressing untagged SUMO. Fig. 7.5 provides an example. Note that the endogenous SUMO is still present in these cells and is often conjugated more efficiently than the tagged SUMO,
Two-Hybrid Analysis of SUMO
117
Fig. 7.5. SUMO mobility shift analysis of TAP-tagged Rap1. Immunoblotting of whole lysates from RAP1-TAP strains harboring (lane 1) the pRS426 empty vector; (lane 2) pRS426-SUMO; or (lane 3) pRS426-Flag-TEV-SUMO (FT-SUMO). Anti-PAP antibody, which recognizes the protein A segment within the TAP tag, was used.
so both tagged and untagged SUMO derivatives are usually seen conjugated to the substrate (lane 3 in Fig. 7.5). 3.4. Comparison of Mass Spectrometry and Yeast Two-Hybrid Methods for Identifying SUMOBinding Proteins
Tandem mass spectrometry (MS/MS) is among the most widely used techniques employed to identify sumoylated substrates (24). Purification of epitope-tagged SUMO and its associating proteins followed by mass spectrometric analysis has yielded a far greater number of potentially sumoylated proteins compared to any other method, including the two-hybrid approach. One difficulty with the MS/MS approach, however, is that purified SUMO conjugates will be greatly enriched for substrates that are highly abundant even if they are only sumoylated to a very minor extent. This increases the probability of identifying proteins for which sumoylation occurs at very low frequency but is of little or no physiological consequence. Because expression of all two-hybrid clones in a given prey library is driven by the same regulatory sequences, biases in protein identification due to large differences in protein levels are substantially reduced. It is also generally necessary to purify SUMO-protein conjugates under stringent denaturing conditions for identification by MS/MS because such conditions inactivate SUMO proteases and because the level of copurifying contaminants would otherwise be unacceptably high. The drawback is that noncovalent SUMO– protein interactions are also largely eliminated. Nevertheless, MS/MS and two-hybrid approaches should be regarded as complementary approaches, and substrates identified by either approach can be verified or further studied by the alternative method. For example, sumoylated proteins identified by MS/MS could be verified by the two-hybrid method and further analyzed by the modifications to the two-hybrid technique described above. Acute environmental changes and their effects on SUMO-conjugate profiles are more easily studied by MS/MS,
118
Kroetz and Hochstrasser
but chronic stimuli or stresses, such as growth on different carbon sources, can be profitably studied by either method.
4. Notes 1. Using random genomic fragments rather than full-length cDNAs in the construction of two-hybrid prey libraries can help narrow the specific region(s) of a protein that interacts with SUMO. Also, there may be additional domains of a full-length prey fusion construct that impair the two-hybrid interaction between SUMO and the interacting region of the protein. Therefore, protein fragments may sometimes enhance detection of certain interactions by the yeast two-hybrid method. 2. The SUMO isoforms (SUMO-1, SUMO-2, and SUMO-3) have been shown to sumoylate partially overlapping sets of substrates. A yeast two-hybrid screen comparing SUMO-1 and SUMO-2 has shown that these isoforms have distinct interactions (10). Future screens comparing the various SUMO isoforms might identify interesting subgroups of SUMO-interacting proteins. 3. In a complementary approach, it is possible to determine the site of covalent sumoylation by mutating lysine residues of the substrate in the context of the GAD-protein fusion. Often, sumoylation sites in proteins fit the consensus sequence ΨKxD/E (where Ψ is a hydrophobic residue and x is any residue), providing a rapid means to identify potential SUMO attachment sites. When a lysine residue necessary for sumoylation of the substrate is mutated (usually to an arginine), the two-hybrid signal should be abolished. A limitation here is that a protein may be sumoylated on a number of different lysine residues, so identifying the relevant lysines will require making multiply mutant alleles. 4. Very high levels of Ulp1, such as those generated by expression of ULP1 from a galactose-inducible promoter, are toxic to the cell (13). 5. Deleting ULP2 or mutating ULP1 (which is essential for viability) greatly increases the levels of specific SUMO conjugates and consequently might facilitate identification of certain two-hybrid interactors when such alleles are introduced into the two-hybrid yeast tester strain. 6. Usually only a very small percentage of a substrate protein, often less than 1%, is sumoylated. This makes detection of its sumoylation difficult. Mutating the ULP genes or overexpressing SUMO can enhance detection sensitivity.
Two-Hybrid Analysis of SUMO
119
Acknowledgements We would like to thank Rachael Felberbaum and Dan Su for critical reading of the manuscript. This work was supported by NIH grant GM053756. References 1. Okura, T., Gong, L., Kamitani, T., Wada, T., Okura, I., Wei, C. F., et al. (1996) Protection against Fas/APO-1- and tumor necrosis factor-mediated cell death by a novel protein, sentrin. J. Immunol. 157, 4277–4281. 2. Shen, Z., Pardington-Purtymun, P. E., Comeaux, J. C., Moyzis, R. K., and Chen, D. J. (1996) UBL1, a human ubiquitin-like protein associating with human RAD51/ RAD52 proteins. Genomics 36, 271–279. 3. Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E., and Freemont, P. S. (1996) PIC 1, a novel ubiquitin-like protein which interacts with the PML component of a multiprotein complex that is disrupted in acute promyelocytic leukaemia. Oncogene 13, 971–982. 4. Matunis, M. J., Coutavas, E., and Blobel, G. (1996) A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J. Cell Biol. 135, 1457–1470. 5. Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997) A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88, 97–107. 6. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 7. Schwartz, D. C. and Hochstrasser, M. (2003) A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem. Sci. 28, 321–328. 8. Fields, S. and Song, O. (1989) A novel genetic system to detect protein-protein interactions. Nature 340, 245–246. 9. Hannich, J. T., Lewis, A., Kroetz, M. B., Li, S. J., Heide, H., Emili, A., et al. (2005) Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280, 4102–4110. 10. Hecker, C. M., Rabiller, M., Haglund, K., Bayer, P., and Dikic, I. (2006) Specification of SUMO1- and SUMO2-interacting motifs. J. Biol. Chem. 281, 16117–16127. 11. James, P., Halladay, J., and Craig, E. A. (1996) Genomic libraries and a host strain
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425–1436. Guthrie, C. and Fink G. R. (1991) Guide to Yeast Genetics and Molecular Biology Academic Press, San Diego, CA. Li, S. J. and Hochstrasser, M. (2003) The Ulp1 SUMO isopeptidase: distinct domains required for viability, nuclear envelope localization, and substrate specificity. J. Cell Biol. 160, 1069–1081. Storms, R. K., Holowachuck, E. W., and Friesen, J. D. (1981) Genetic complementation of the Saccharomyces cerevisiae leu2 gene by the Escherichia coli leuB gene. Mol. Cell Biol. 1, 836–842. Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G., and Chen, Y. (2004) Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc. Natl. Acad. Sci. USA 101, 14373–14378. Li, S. J. and Hochstrasser, M. (2000) The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol. Cell Biol. 20, 2367–2377. Johnson, E. S., Schwienhorst, I., Dohmen, R. J., and Blobel, G. (1997) The ubiquitinlike protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16, 5509–5519. Song, J., Zhang, Z., Hu, W., and Chen, Y. (2005) Small ubiquitin-like modifier (SUMO) recognition of a SUMO binding motif: a reversal of the bound orientation. J. Biol. Chem. 280, 40122–40129. Reverter, D. and Lima, C. D. (2005) Insights into E3 ligase activity revealed by a SUMO-RanGAP1-Ubc9-Nup358 complex. Nature 435, 687–692. Lin, D. Y., Huang, Y. S., Jeng, J. C., Kuo, H. Y., Chang, C. C., Chao, T. T., et al. (2006) Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol. Cell 24, 341–354. Takahashi, H., Hatakeyama, S., Saitoh, H., and Nakayama, K. I. (2005) Noncovalent SUMO-1 binding activity of thymine
120
Kroetz and Hochstrasser
DNA glycosylase (TDG) is required for its SUMO-1 modification and colocalization with the promyelocytic leukemia protein. J. Biol. Chem. 280, 5611–5621. 22. Kerscher, O. (2007) SUMO junctionwhat’s your function? New insights through SUMO-interacting motifs. EMBO Rep. 8, 550–555.
23. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Séraphin, B. (1999) A generic protein purification method for protein complex characterization and proteome exploration. Nat Biotechnol. 17, 1030–1032. 24. Xu, P. and Peng, J. (2006) Dissecting the ubiquitin pathway by mass spectrometry. Biochim. Biophys. Acta 1764, 1940–1947.
Chapter 8 Identification of SUMO-Binding Motifs by NMR Candace S. Seu and Yuan Chen Abstract Post-translational modification by the small ubiquitin-like modifier (SUMO) family of proteins is an important cellular regulatory mechanism, and in recent years has been found to be involved in a large and diverse set of signaling pathways. Most of these SUMO-dependent functions appear to be mediated by the interaction between SUMO attached to the modified proteins and a “SUMO-binding motif” (SBM or SIM) on receptor proteins. Nuclear magnetic resonance (NMR) studies were instrumental in the identification of this SUMO-binding motif, and reveal that, depending on the sequence context, this motif can bind to SUMO in two opposing orientations. In this paper, we provide an overview of how NMR methods can be used to identify such short conserved binding motifs and structurally characterize their interaction with target proteins. These experiments are complementary to traditional biochemical methods and are applicable to the identification of other SUMO-binding motifs and to the studies of other ubiquitin-like modification systems. Key words: SUMO, SUMO-binding motif (SBM), SUMO-interacting motif (SIM), NMR, chemical shift perturbation, protein–peptide interaction, protein–protein interaction.
1. Introduction Small ubiquitin-like modifiers (SUMO) are a family of small proteins that are known to be involved in an increasing variety of essential cellular functions, including DNA repair, genetic transcription, and mitotic regulation (1–3). The SUMO family of proteins includes at least three paralogues, SUMO-1, -2, and -3, which have similar structural and chemical characteristics but appear to be involved in different pathways. The rapid and reversible nature of the modification enables SUMO to exert flexible and specific control over protein– protein interactions. Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
121
122
Seu and Chen
Sumoylation, like other post-translational modifications, exerts this control by providing a new binding site for interactions with other proteins. For example, sumoylation of RanGAP1 is necessary for its interaction with the nuclear pore protein RanBP2/Nup358 (4, 5), and the transcription factors p300 and Elk-1 must be sumoylated to recruit histone deacetylase 6 (HDAC6) (6) and HDAC2 (7), respectively. In principle, SUMO modification could regulate the activity of a protein by altering its conformation. However, this is unlikely to be a general phenomenon, because SUMO modification sites are often located in extended loops, such as in RanGAP1 (8), or in unstructured termini, such as in p53 (9). Additionally, the modification sites are not required to be in regular secondary structures (10). By studying the interaction between SUMO and several protein fragments known to bind to sumoylated proteins, our lab has identified and characterized a SUMO-binding motif (SBM) that is crucial to the formation of SUMO-dependent protein–protein interactions (11, 12). This SBM is different from the previously identified ΦKxE substrate motif, which binds the E2 enzyme for covalent modification by SUMO, but does not bind to SUMO noncovalently (10). The SBM first identified in our NMR experiments has since been confirmed by many other studies. For example, the SBM site on PML has been shown to be critical for binding sumoylated proteins and for the formation of PML nuclear bodies (13), and the SBM site on PIASx has been shown to be important for its association with SUMO-modified Elk-1 protein in regulation of its transcriptional activities (14). Notably, the importance of the SBM in transcriptional regulation was demonstrated by a study, in which random mutagenesis was used to identify a small, defined surface on SUMO-1 as the only region important for sumoylation-dependent transcriptional repression, which is a common function of sumoylation (15). This surface of SUMO-1 binds the SBM determined by our studies, which suggests that the SBM is likely to mediate most transcriptional regulatory activities. The widespread significance of the SBM has been further demonstrated by the publication of a variety of papers over the last two and half years (16–29). NMR studies have played and will continue to play a critical role in the identification and characterization of other SUMObinding motifs (11, 12). There are several advantages to the use of NMR methods for such studies. First, NMR studies are carried out in solutions; hence, sample preparation is simple. Second, NMR chemical shift perturbation is sensitive to the formation of molecular complexes with a wide range of affinities (with Kd from pM to mM). Third, the residues at the binding interface can be efficiently identified when an interaction is observed. NMR
NMR Studies of SUMO-Binding Motifs
123
studies have had two important advantages over other methods in SBM identification. First, SBMs in proteins can be as short as four or five amino acid residues. Unlike long ubiquitin-binding motifs, such as UBA and CUE, which were readily identified by sequence alignment of ubiquitin-binding proteins, the consensus sequence of the short SBM was difficult to identify by alignment alone. Therefore, NMR studies were critical in the identification of the core residues in the SBM. Second, the bound orientation of the SBM is sometimes reversed, depending on the sequence context (12) (Fig. 8.1). Thus, proper alignment of the consensus sequence requires some SUMO-binding protein sequences to be reversed, which is difficult to carry out in the absence of threedimensional structural information about the bound orientations of different SUMO-binding sequences. The NMR structures of the two SBM peptides in complexes with SUMO-1 allowed a structure-based sequence alignment to define the consensus sequence (12). SUMO is only one of many ubiquitin-like proteins, and it is likely that similar binding motifs that cannot be identified through purely biochemical means exist in other systems as well. Here, we discuss and attempt to offer a general understanding of the NMR techniques and strategies that have been used to identify and structurally characterize the SBM. These approaches are expected to be applicable to the identification of other SBMs or novel motifs that bind to other ubiquitin-like proteins.
Fig. 8.1. The SBMs of RanBP2 and PIAS-X-P bind SUMO-1 in opposite orientations.
124
Seu and Chen
2. Materials 2.1. Protein Expression and Purification
1. BL21(DE3) E. coli cells or appropriate variants. 2. Expression plasmids for His6-tagged SUMO-1, -2, or 3. 3. Antibiotic stocks: Ampicillin (100 mg/ml), kanamycin (25 mg/ml), or appropriate stock solutions, sterilized by filtration. 4. LB medium: Dissolve 5 g yeast extract, 10 g trypton, and 10 g NaCl in 1 l H2O. Autoclave for 20 min, cool to room temperature. Add 1 ml of the appropriate antibiotic stock solution. 5. M9 medium: Dissolve 6.7 g Na2HPO4, 3.0 g KH2PO4, 1 g NaCl, and 0.5 g Na2SO4 in 1 L H2O. Autoclave for 20 min, cool to room temperature. Filter and add 1 ml of 0.1 M CaCl2, 1 ml of 1.0 M MgCl2, 5 ml of 0.2 g/ml NH4Cl, and 5 ml of 0.4 g/ml glucose (all sterile-filtered solutions in H2O). Add 1 ml antibiotic stock solution, 10 ml of 100x Basal Medium Eagle Vitamin Concentrate (FisherSci), and 1 ml of 1000x Trace Mineral Solution (286 mg H3BO4, 1.5 g CaCl2·H2O, 4 mg CoCl2·6H2O, 20 mg CuSO4·H2O, 28 mg FeSO4·H2O, 20.8 g MgCl2·6H2O, 18 mg MnCl2·4H2O. 0.2 mg MoO3, and 20.8 mg ZnCl2 in 100 ml sterilized H2O). For 15N-, 13C-, or 2H-labeled protein, replace NH4Cl, glucose, or H2O with its isotopically labeled counterpart (15NH4Cl, 13C6-glucose, or D2O, respectively, available from Cambridge Isotope Laboratories or Spectra Stable Isotopes). 6. Isopropyl-β-D-thio-galactopyranoside (IPTG): 1.0 M stock solution in H2O. 7. Bugbuster 10x (Novagen). 8. Benzonase (Novagen). 9. 14x Protease inhibitor tablets (Roche) or phenylmethanesulphonyl fluoride (PMSF). 10. Lysis buffer: 5 mM imidazole, 20 mM phosphate, pH 7.5. Filter-sterilize. 11. Wash buffer: 10 mM imidazole, 20 mM phosphate, pH 7.5. Filter-sterilize. 12. Elution buffer: 200 mM imidazole, 20 mM phosphate, pH 7.5. Filter-sterilize. 13. Ni-NTA agarose beads (Qiagen). 14. 5K MWCO dialysis cassette or centrifuge filtration units.
2.2. Peptide Expression and Purification
1. BLR(DE3)pLysS E. coli cells. 2. pET31b+ plasmid with sequence for ketosteroid isomerase(Met- candidate SBM)n-His6 (see Note 1).
NMR Studies of SUMO-Binding Motifs
125
3. LB medium: see Sect. 2.1, Item 4. 4.
15
N/13C labeled M9 medium: see Sect. 2.1., Item 5.
5. IPTG: see Sect. 2.1., Item 6. 6. Denaturing lysis buffer: 100 mM NaH2PO4, 10 mM TrisHCl, 8 M urea, pH 8.0. 7. Denaturing wash buffer: 100 mM NaH2PO4, 10 mM TrisHCl, 8 M urea, pH 6.3. 8. Denaturing elution buffer: 100 mM NaH2PO4, 10 mM TrisHCl, 8 M urea, pH 4.5. and adjust the pH of the buffer prior to use. 9. 70% formic acid in H2O. 10. Cyanogen bromide solution: 0.2 g cyanogen bromide in 6 ml 70% formic acid. 11. Phosphate buffer, 10–100 mM. 2.3. NMR Experiments
1. NMR spectrometer, equipped with four channels, pulsedfield gradient, pulse-shaping capabilities, and triple resonance probe. 2. NMR tubes are from Shigemi Inc.: advanced microtube, model BMS-005-TB (http://www.geocities.com/∼shigemi/page7. html) (see Note 2). 3. NMR buffer: 10–100 mM phosphate, 5–10% D2O, 0.1% NaN3, pH 6–7.
3. Methods 3.1.General Strategy
The usual strategy for studying protein–peptide complexes requires, such that only one is visible in the NMR spectrum enrichment of one binding partner, but not the other (Fig. 8.2) isotopic. Most NMR-active nuclei, with the exception of 1H, exist in low abundance in natural molecules. Therefore, artificially elevated 13C and 15N levels in the protein sample need to be obtained by expressing it in isotopically enriched media (described in detail below). 13C- or 15N-edited NMR experiments, typically 1H-15N HSQC or TROSY, are used to selectively observe signals from the 13C/15N-enriched partner. Reciprocally, 13C- or 15N-filtered NMR experiments, such as 15N-filtered TOCSY and NOESY, are used to selectively observe signals from the unenriched partner in the complex. In these spectra, resonances of the labeled protein are usually well resolved because of large 15N chemical shift dispersion, while resonances of the peptide are easy to monitor because of the low number of peaks.
126
Seu and Chen
Fig. 8.2. Labeling scheme for protein–peptide interaction studies using NMR methods. The left configuration is usually sufficient for most SBMs; preparation of the complex on the right may be necessary when the peptide contains degenerate residues.
3.2. Expression and Purification of 13C, 15 N-labeled SUMO Proteins
1. Transform expression plasmids of SUMO into BL21(DE3) E. coli cells using standard molecular biology methods. 2. Streak cells onto an LB plate containing appropriate antibiotic, incubate overnight at 37°C. 3. Select a single colony. Inoculate 50–100 ml of antibioticsupplemented LB media with the colony, and grow overnight at 37°C in a shaker (see Note 3). 4. Centrifuge cells (5000g, 5 min), decant the medium, and resuspend the cell pellet in 1 l of 15N- or 15N-, 13C- enriched M9 media containing appropriate isotopes and antibiotics. 15N-labeled medium would be sufficient for titration experiments to detect chemical shift perturbation upon complex formation. However, the 15N, 13C-enriched medium is necessary for structural studies of the SUMO-SBM complex. 5. Shake in a 37°C incubator at 220 rpm, 2–3 h until OD600 = 0.6–0.8. 6. Induce protein expression by adding 0.5 mM IPTG (500 µl of 1 M stock solution). Incubate 3–4 h. Do not overgrow the cells; SUMO expression should be induced at OD600 = 0.6 for maximal protein production in M9 media. When using LB medium, induction of SUMO expression is possible at OD600 =0.8–1. 7. Harvest by centrifuging cells (5000g, 5 min). The pellet can be saved at −80°C indefinitely. 8. Resuspend cells in a solution of 20 ml lysis buffer, 2 ml 10x Bugbuster, 2 µl benzonase, and protease inhibitors (see Note 4). 9. Centrifuge the suspension (16,000g, 15 min) and retain the supernatant. 10. Purify the His6-tagged proteins from the supernatant using standard Ni-NTA affinity chromatography techniques (please refer to the instructions by the manufacturer of the Ni-NTA affinity beads). Buffer exchange into a buffer that does not produce NMR signal by itself, such as phosphate buffer, and concentrate the protein (see Note 5).
NMR Studies of SUMO-Binding Motifs
127
11. Titration experiments require a minimum protein concentration of 0.1 mM. For structural studies, it is desirable to use SUMO at concentrations exceeding 0.4 mM. Since the sample volume can be as small as 250 µl, 1 mg of SUMO is sufficient for most experiments. 12. Check protein purity by Coomassie blue staining of an SDSPAGE gel. Estimate protein concentrations by amino acid analysis. SUMO can be stored at −80°C for several years. All human SUMO paralogs and the yeast homolog are stable in the NMR tube and are soluble to several mM. 3.3. Expression and Purification of Labeled Peptides
1. Clone multiple tandem copies (a larger replication number gives a higher yield) of the peptide-encoding sequence, separated by single methionine codons, into the pET31b+ plasmid. The cloning site is upstream of the His6 tag and downstream of an N-terminal ketosteroid isomerase gene (see Note 1). 2. Transform BLR(DE3)pLysS E. coli cells with the pET31b+ expression construct using standard molecular biology methods. 3. For induction of expression, follow Sect. 3.2, Steps 2–7. 4. Resuspend cells in 5 ml of denaturing lysis buffer per gram of pellet. Mix gently at room temperature until the solution is translucent (15–60 min), signaling complete lysis. 5. Centrifuge the suspension (10,000g, 30 min) and retain the supernatant. 6. Purify the His6-tagged proteins from the supernatant using standard denaturing Ni-NTA affinity chromatography techniques. Precipitate the purified protein by dialysis against water. 7. Redissolve the precipitate in 70% formic acid. Cleave the fusion protein overnight with the cyanogen bromide and formic acid solution in a ventilated hood, protected from light. Dry by rotary evaporation. 8. Resuspend the resulting gelatinous material in PBS. Adjust pH to 7.4 and stir overnight. 9. Purify the peptide-containing supernatant with reversephase HPLC in order to remove a small amount of covalent dimer that will also be produced by this treatment. Verify the sequence identity by mass spectrometry (see Note 6).
3.4. Detection of SUMO-SBM Interactions
Nuclear magnetic resonance (NMR) chemical shift perturbation is probably the most sensitive method for determining whether the candidate SBM binds to SUMO. The exact frequencies, or “chemical shifts” of the nuclei, are modulated by their chemical
128
Seu and Chen
and spatial environments. Each peak in an NMR spectrum can be correlated to a source nucleus and interpreted to reveal and monitor the chemical environment and structure around that particular atom. Chemical shifts are extremely sensitive to changes in the local environments of their source nuclei, which can be caused by introduction of aromatic ring currents, peptide bond anisotropy, electrostatic interactions, and hydrogen bonding upon protein complex formation. Therefore, NMR chemical shift perturbation is frequently used for monitoring protein complex formation. To detect whether a potential SBM binds to SUMO, 15N-labeled SUMO can be titrated with a peptide harboring the potential SBM. Then 1H-15N HSQC or TROSY will be recorded to monitor specific chemical shift changes. Chemical shift perturbation is extremely sensitive for detecting complex formation of a wide range of affinities with dissociation constants ranging from pM to mM. 3.5. Identification of Interacting SUMO Residues and Estimation of Kd
Chemical shift perturbation is highly efficient in identifying the residues involved in the SUMO-SBM interaction. Residues that are located at the binding interface will inevitably experience changes in their chemical shifts, because of changes in the local environments of their nuclei. Residues that have the largest chemical shift changes are usually located within the binding interface, although the surface identified by chemical shift perturbation usually extends slightly beyond the direct contact area, because of small conformational changes induced by complex formation. Superposition of the HSQC spectra of SUMO, free and in complex with the peptides, will reveal the SBM binding sites on the surface of SUMO. In order to correlate a resonance in the spectra to a specific residue in the protein or peptide, chemical shift assignments must be obtained. The chemical shift assignments for SUMO-1 and SUMO-2 are available (deposited in BioMagResBank with entry numbers 6304 for SUMO-1, and 6801 for SUMO-2). HSQC is a very sensitive 2D NMR experiment that correlates amide hydrogens with their nitrogens, yielding one peak for every residue. Within one hour, one can determine whether a putative SBM actually interacts with SUMO, identify the binding site, and obtain information on the Kd of the interaction. Detailed procedures are as follows: 1. Prepare at least 0.2 ml of 15N-labeled SUMO-1 in NMR buffer in a Shigemi tube. A concentration of 0.1 mM is sufficient for a 600 MHz spectrometer with a cryo-probe; 0.3 mM should guarantee signal on a 500 MHz spectrometer with a room temperature probe (see Note 7). 2. Record an initial HSQC spectrum of this unbound SUMO sample. This will serve as your baseline and control.
NMR Studies of SUMO-Binding Motifs
129
3. Add unlabeled peptide to the sample to specific molar equivalences (e.g., 1:4, 1:2, 3:4, 1:1, 2:1), mixing well and taking a new HSQC spectrum after each addition. The titration should be designed such that the final concentration of SUMO should be at least 0.1 mM at the end of the titration. It is usually not a problem, since SUMO is soluble to at least 5 mM. 4. Process and overlay the spectra using programs such as Felix and NMRView. 5. Observe how each peak changes in response to increasing peptide concentration. A lack of change indicates that the residue does not participate in the interaction. The type of changes (such as gradual shifts, intensity changes, and complete disappearances) provides information on the rate of the complex dissociation (see below: Step 8). Since the association rate is likely to be diffusion-limited, the dissociation rate is therefore a good indication of the affinity constant. 6. Mapping the affected residues onto a 3D model of the protein may aid in confirming the binding site and differentiating between local and long-range structural changes. This requires chemical shift assignments of the protein (see Sect. 3.7). 7. When performing these experiments, it is important to ensure that both SUMO and the peptides are in an identical buffer to ensure that chemical shift changes are not caused by slight pH changes in the solution when mixing the peptide and the protein. 8. Note the types of chemical shift changes (Fig. 8.3): ●
●
Fast exchange: Gradual peak shifting indicates that the exchange between the free and bound molecule is fast relative to the chemical shift difference of the two forms. The NMR spectrum is thus a population-weighted average of the free and bound molecule. As the concentration of the bound form increases, the average is increasingly weighted towards the new position. Fast exchange is usually correlated with weak binding, with dissociation constants ranging in the order of 100 µM to 1 mM. In this case, a Kd for the interaction can be accurately extracted by fitting the data to a curve using software such as Origin or Sigma Plot. More detailed reviews on this topic can be found in the literature (30). Slow exchange: In some cases, peaks in the spectrum of unbound protein will gradually decrease in intensity until they disappear, while new peaks appear in new positions and gradually increase in intensity at subsequent titration points. This pattern of change occurs when the dissociation
130
Seu and Chen
Fig. 8.3. NMR peak behavior at different exchange rates between the free and bound states.
rate is slower than the chemical shift difference of the free and bound species. The NMR thus effectively takes a spectrum of a sample containing two distinct compounds (free and bound protein), whose relative intensities are determined by the population of the free and bound portions of the protein. Slow exchange is usually correlated with stronger complex formation, with dissociation constants less than 1 µM. ●
3.6. Identification of the Core SBM Residues
Intermediate exchange: In some cases, peaks will disappear completely due to extreme line broadening. In this case, the dissociation constant is usually between 1 and 10 µM.
Superposition of the TOCSY spectrum of the free peptides and the 15N-filtered TOCSY spectrum of the peptides in complexes with 15N-enriched SUMO-1 will reveal the residues in these peptides that have the most significant chemical shift changes upon complexation, identifying the core SBM sequence (11). Identification of the specific SBM residues that participate in the interaction with SUMO can usually be accomplished with the same sample of 13C, 15N-labeled SUMO, and unlabeled SBM.
NMR Studies of SUMO-Binding Motifs
131
15
N/13C-filtering is used to remove signals from the 15N/13Clabeled SUMO, leaving only the data from the unlabeled peptide. TOCSY experiments are used to identify the amino acid residue types, while nuclear overhauser effect spectroscopy (NOESY) experiments provide information on their sequential connectivity (31). In particular, the latter are used to establish physical proximity between Hα, Hβ, HN of one residue (n−1, Fig. 8.4) and the HN of the next residue (n, Fig. 4). Chemical shift assignments of the peptides, free and in complex with SUMO, can be obtained using a combination of TOCSY and NOESY spectra. If the SBM contains multiple instances of the same amino acid, the residues may give degenerate shifts and be indistinguishable in the 2D spectrum. In this case, it is necessary to produce 13 C, 15N-labeled peptide using the methods described in Sect. 3.3. The amino acid assignment of the peptide’s residues can then be solved using the heteronuclear NMR techniques described in Sect. 3.7. Once this has been achieved, a one-step titration and spectral overlay of labeled peptide with unlabeled SUMO will distinguish the SBM and noninteracting regions of the peptide. A 13C-resolved NOESY spectrum of the sample containing 13C, 15 N-labeled peptide, and unlabeled SUMO contains mostly intermolecular NOEs, because the small peptide does not produce a large number of intramolecular NOEs. Such NOESY spectrum has significantly higher sensitivity than filtered and edited NOESY spectra for the identification of intermolecular NOEs for structural determination of the complex. 3.7. Structural Determination of SUMO-SBM Complexes
Resonance assignments are the basis for structural determination by NMR methods. If the exchange between free and bound SUMO is fast on the chemical shift timescale, SUMO resonances in the complex with an SBM can be readily assigned by following the shift of the peaks during titration. We have developed software
Fig. 8.4. The NOESY experiment transfers signal between protons that are physically close. TOCSY spectral patterns are used to identify amino acid residues, and inter-residue NOESY connections are then used to match the residues to the peptide sequence.
132
Seu and Chen
to automatically accomplish this task (32). If the exchange between free and bound SUMO is slow on the chemical shift time scale, the resonances of SUMO in the complex will need to be assigned. This can be accomplished by acquiring multiple 3D NMR experiments on 0.3–0.5 mM a 13C, 15N-labeled sample of SUMO in complex with the unlabeled SBM peptide. In these experiments, NMR-active side chain carbons are correlated with nearby backbone nitrogens and their protons, functionally adding a third, carbon dimension to a HSQC plane. Inter-residue correlations aid in establishing amino acid connectivity, while intra-residue correlations aid in identifying the amino acids and matching them up to a known sequence. A strategy for establishing connectivity is illustrated in Fig. 8.5. Complete resonance assignments of the protein are achieved when the chemical shifts of H, N, Cα, and Cβ are known for each residue in the protein. The choice and number of experiments needed to achieve this varies. Data acquisition using current methods generally takes 1–3 days per 3D experiment on a 600 MHz NMR instrument. Data interpretation may take up to an additional week to 6 months, though this depends on the size of the protein, the quality of the NMR data, and the extent of signal overlap. While a complete protocol for solving a protein structure by NMR is beyond the scope of this review, procedures can be found in other publications (33–36). A similar strategy can be used to assign the resonances of the SBMcontaining peptide, using a sample containing 13C/15N-enriched peptide and unlabeled SUMO. Assignment of chemical shifts to their originating residues does not in itself yield a three-dimensional structure of a protein. Instead, it is necessary to collect “structural restraints”, which identify short inter-proton distances, backbone torsion angles, hydrogen bonds, and bond orientations. These are compiled and incorporated into iterated structural calculations with programs such as HADDOCK (37). The determination of the structure of a SUMO-SBM complex can provide insights into the recognition mechanism, and the information can be used to design peptidomimetics or small molecular mimics of the SBM. NOESY nuclear overhauser effects (NOE) experiments, which measure NOE between two protons, are the most important way of providing distance restraints. The intensity of an NOE signal is inversely proportional to r6 (where r is the distance between the two nuclei), and can be used to infer inter-atom distances of up to 5 Å. In a real, nonideal environment, this effect can be complicated by phenomena such as “spin diffusion,” in which the signal is transferred to a third nucleus, giving the erroneous impression that there is an NOE signal between nuclei 1 and 3, and local dynamics, which artificially weaken the NOE. Distances derived from NOEs are thus expressed as one of several ranges in order to reflect this uncertainty.
NMR Studies of SUMO-Binding Motifs
133
Fig. 8.5. The HNCA experiment, true to its name, transfers magnetization in the order H-N-Cα and back, and thus correlates the H and N of residue n with the Cα residues of residues n and n−1. Cαn−1 is correlated to two H-N pairs; therefore, there should be two peaks with the same Cα shift but different H-N values. Unambiguous identification of these two peaks establishes that they belong to contiguous residues. Chains of contiguous residues can then be combined to reveal overall connectivity.
The second class of restraints used in our SBM studies was generated by inferring backbone torsion angles from chemical shifts. The chemical shifts of the Hα, Cα, Cβ, and C′ residues are affected by local backbone conformation in a highly predictable manner. The chemical shift index (CSI) method is a simple
134
Seu and Chen
analytical tool that correlates chemical shift patterns with certain secondary structural features (38). More recently, structure prediction programs such as TALOS have been developed to yield more detailed predictions (39). There are three other common methods of generating restraints: 1. Backbone dihedral angle constraints can be provided by chemical shifts of the backbone atoms, as described above. In addition, J coupling constants between HN and Hα atoms are dependent on their dihedral angles, and can be related by the Karplus equation in order to yield Φ backbone angles (40, 41). 2. Residual dipole coupling (RDC) constraints measure the relative orientation of dipoles (usually H-N bonds) to an alignment tensor. In normal solution, the rapid tumbling of the macromolecule causes the average dipolar coupling constants to be zero. However, bacteriophages, bicelles, or other solid supports can be used as “alignment media” to predispose the molecule towards a preferred alignment in the magnetic field, so that RDCs are not zero and thus can be measured (42). RDCs are most often used to improve the accuracy of structures determined from other constraints. 3. NH hydrogens exchange rapidly with water protons, if not protected by hydrogen bonds. Dissolving the protein in D2O allows these residues to become deuterated, and hence NMR inactive. An overlay of the HSQC spectra of the protein in H2O and D2O should thus identify the amide hydrogen atoms that are protected by hydrogen bonds, by virtue of their persistence in the latter spectrum.
4. Notes 1. pET31b+ by Novagen is specific for the expression of small peptides. A ketosteroid isomerase gene in the N-terminus of the construct is used to drive the expressed peptide into inclusion bodies in order to protect it from degradation. Methionine residues separate repeats of the peptide, which allows the peptides to be cleaved with cyanogen bromide. 2. Shigemi tubes allow the use of smaller sample volumes (1/3 of that needed for a regular NMR tube) and are manufactured as an outer tube and an inner plug (Fig. 8.6). To load the sample and inner plug effectively, first pipette the sample into the outer tube and centrifuge to remove any bubbles at the meniscus. Carefully push the inner plug into the tube
NMR Studies of SUMO-Binding Motifs
135
Fig. 8.6. Proper Shigemi tube assembly.
until its bottom contacts the top of the sample. Hold the tube in one hand at a 45° angle to upright and tap the top of the inner tube gently but quickly, such that the inner plug travels a short distance downward, allowing any air bubbles slip past the plug. Avoid forcing the inner plug all the way to the bottom of the outer tube; the inner plug can be slowly and gently pulled upward before this happens. Tap and repeat as necessary until all air bubbles are gone and a small amount of sample solution is present above the plug. Air bubbles in the sample volume cause field inhomogeneity and should be scrupulously eliminated. 3. This initial overnight growth in LB is necessary to ensure that the cells grow in a timely manner, as starting with a single colony in M9 media is too slow to be practical. 4. As an alternative to Bugbuster, cell lysis can be achieved through sonication or with a French press. 5. Buffer exchange filters sometimes contain a wetting agent such as glycerol, which will contaminate samples and produce NMR signals that overlap with the signals of the protein and peptide samples. To avoid this, soak and rinse the filters thoroughly following the manufacture’s recommendations.
136
Seu and Chen
6. Isotopically labeled Fmoc amino acid derivatives are extremely expensive. Thus, in vivo production presents an attractive alternative to solid-phase peptide synthesis. 7. All NMR experiments should be performed at the same temperature (recommended: 17° C for SUMO-1) and at the same pH. Chemical shifts are extremely sensitive to both, but especially the latter.
Acknowledgments This work was supported by NIH grants GM074748 and CA94595. References 1. Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12. 2. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 3. Seeler, J. S., and Dejean, A. (2003) Nuclear and unclear functions of SUMO. Nat. Rev. Mol. Cell. Biol. 4, 690–699. 4. Matunis, M. J., Wu, J., and Blobel, G. (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J. Cell Biol. 140, 499–509. 5. Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997) A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88, 97–107. 6. Girdwood, D., Bumpass, D., Vaughan, O. A., Thain, A., Anderson, L. A., Snowden, A. W., Garcia-Wilson, E., Perkins, N. D., and Hay, R. T. (2003) P300 transcriptional repression is mediated by SUMO modification. Mol. Cell 11, 1043–1054. 7. Yang, S. H., and Sharrocks, A. D. (2004) SUMO promotes HDAC-mediated transcriptional repression. Mol. Cell 13, 611–617. 8. Bernier-Villamor, V., Sampson, D. A., Matunis, M. J., and Lima, C. D. (2002) Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108, 345–356. 9. Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P., and Hay, R. T. (1999) SUMO-1 modification activates the
10.
11.
12.
13.
14.
15.
16.
transcriptional response of p53. EMBO J. 18, 6455–6461. Lin, D., Tatham, M. H., Yu, B., Kim, S., Hay, R. T., and Chen, Y. (2002) Identification of a substrate recognition site on Ubc9. J. Biol. Chem. 277, 21740–21748. Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G., and Chen, Y. (2004) Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc. Natl. Acad. Sci. USA 101, 14373–14378. Song, J., Zhang, Z., Hu, W., and Chen, Y. (2005) Small ubiquitin-like modifier (SUMO) recognition of a SUMO binding motif: a reversal of the bound orientation. J. Biol. Chem. 280, 40122–40129. Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., and Pandolfi, P. P. (2006) The mechanisms of PML-nuclear body formation. Mol. Cell 24, 331–339. Yang, S. H., and Sharrocks, A. D. (2005) PIASx acts as an Elk-1 coactivator by facilitating derepression. EMBO J. 24, 2161–2171. Chupreta, S., Holmstrom, S., Subramanian, L., and Iniguez-Lluhi, J. A. (2005) A small conserved surface in SUMO is the critical structural determinant of its transcriptional inhibitory properties. Mol. Cell. Biol. 25, 4272–4282. Tatham, M. H., Kim, S., Jaffray, E., Song, J., Chen, Y., and Hay, R. T. (2005) Unique binding interactions among Ubc9, SUMO and RanBP2 reveal a mechanism for SUMO paralog selection. Nat. Struct. Mol. Biol. 12, 67–74.
NMR Studies of SUMO-Binding Motifs 17. Baba, D., Maita, N., Jee, J. G., Uchimura, Y., Saitoh, H., Sugasawa, K., Hanaoka, F., Tochio, H., Hiroaki, H., and Shirakawa, M. (2005) Crystal structure of thymine DNA glycosylase conjugated to SUMO-1. Nature 435, 979–982. 18. Izumiya, Y., Ellison, T. J., Yeh, E. T. H., Jung, J. U., Luciw, P. A., and Kung, H. J. (2005) Kaposi’s sarcoma-associated herpesvirus K-bZIP represses gene transcription via SUMO modification. J. Virol. 79, 9912–9925. 19. Takahashi, Y., and Kikuchi, Y. (2005) Yeast PIAS-type Ull1/Siz1 is composed of SUMO ligase and regulatory domains. J. Biol. Chem. 280, 35822–35828. 20. Nguyen, H. V., Chen, J. L., Zhong, J., Kim, K. J., Crandall, E. D., Borok, Z., Chen, Y., and Ann, D. K. (2006) SUMOylation attenuates sensitivity toward hypoxia- or desferroxamine-induced injury by modulating adaptive responses in salivary epithelial cells. Am. J. Path. 168, 1452–1463. 21. Cheng, C. H., Lo, Y. H., Liang, S. S., Ti, S. C., Lin, F. M., Yeh, C. H., Huang, H. Y., and Wang, T. F. (2006) SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae. Genes Dev. 20, 2067–2081. 22. Uchimura, Y., Ichimura, T., Uwada, J., Tachibana, T., Sugahara, S., Nakao, M., and Saitoh, H. (2006) Involvement of SUMO modification in MBD1- and MCAF1-mediated heterochromatin formation. J. Biol. Chem. 281, 23180–23190. 23. Raffa, G. D., Wohlschlegel, J., Yates, J. R., and Boddy, M. N. (2006) UMO-binding motifs mediate the Rad60-dependent response to replicative stress and self-association. J. Biol. Chem. 281, 27973–27981. 24. Mukhopadhyay, D., Ayaydin, F., Kolli, N., Tan, S. H., Anan, T., Kametaka, A., Azuma, Y., Wilkinson, K. D., and Dasso, M. (2006) SUSP1 antagonizes formation of highly SUMO2/3-conjugated species. J. Cell Biol. 174, 939–949. 25. Lin, D. Y., Huang, Y. S., Jeng, J. C., Kuo, H. Y., Chang, C. C., Chao, T. T., Ho, C. C., Chen, Y. C., Lin, T. P., Fang, H. I., Hung, C. C., Suen, C. S., Hwang, M. J., Chang, K. S., Maul, G. G., and Shih, H. M. (2006) Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol. Cell 24, 341–354. 26. Mohan, R. D., Rao, A., Gagliardi, J., and Tini, M. (2007) SUMO-1-dependent allosteric regulation of thymine DNA glycosylase
27.
28.
29.
30.
31. 32.
33.
34.
35.
36.
137
alters subnuclear localization and CBP/p300 recruitment. Mol. Cell. Biol. 27, 229–243. Lee, Y. K., Thomas, S. N., Yang, A. J., and Ann, D. K. (2007) Doxorubicin down-regulates Kruppel-associated box domain-associated protein 1 sumoylation that relieves its transcription repression on p21WAF1/ CIP1 in breast cancer MCF-7 cells. J. Biol. Chem. 282, 1595–1606. Benson, M. D., Li, Q. J., Kieckhafer, K., Dudek, D., Whorton, M. R., Sunahara, R. K., Iniguez-Lluhi, J. A., and Martens, J. R. (2007) SUMO modification regulates inactivation of the voltage-gated potassium channel Kv1.5. Proc. Natl. Acad. Sci. USA 104, 1805–1810. Kumar, A., Srivastava, S., and Hosur, R. V. (2007) NMR characterization of the energy landscape of SUMO-1 in the native-state ensemble. J. Mol. Biol. 367, 1480–1493. Lian, L.-Y. (1993) Effects of chemical exchange on NMR spectro. NMR of Macromolecules: A Practical Approach, Roberts, G., Ed., pp. 164–166, Oxford University Press, New York. Wuthrich, K. (1986) NMR of Proteins and Nucleic Acids John Wiley and Sons. Fukui, L., and Chen, Y. (2007) NvMap: automated analysis of NMR chemical shift perturbation data. Bioinformatics 23, 378–380. Clore, G. M., and Gronenborn, A. M. (1991) Structures of larger proteins in solution: three- and four-dimensional heteronuclear NMR spectroscopy. Science 252, 1390–1399. Driscoll, P. C., Gronenborn, A. M., Wingfield, P. T., and Clore, G. M. (1990) Determination of the secondary structure and molecular topology of interleukin-1 beta by use of two- and three-dimensional heteronuclear 15N-1H NMR spectroscopy. Biochemistry 29, 4668–4682. Marion, D., Driscoll, P. C., Kay, L. E., Wingfield, P. T., Bax, A., Gronenborn, A. M., and Clore, G. M. (1989) Overcoming the overlap problem in the assignment of 1H NMR spectra of larger proteins by use of three-dimensional heteronuclear 1H-15N Hartmann-Hahn-multiple quantum coherence and nuclear Overhauser-multiple quantum coherence spectroscopy: application to interleukin 1 beta. Biochemistry 28, 6150–6156. Oschkinat, H., Griesinger, C., Kraulis, P. J., Sorensen, O. W., Ernst, R. R., Gronenborn, A. M., and Clore, G. M. (1988) Threedimensional NMR spectroscopy of a protein in solution. Nature 332, 374–376.
138
Seu and Chen
37. Dominguez, C., Boelens, R., and Bonvin, A. M. (2003) HADDOCK: a protein-protein docking approach based on biochemical or biophysical information. J. Am. Chem. Soc. 125, 1731–1737. 38. Wishart, D. S., Sykes, B. D., and Richards, F. M. (1991) Relationship between nuclear magnetic resonance chemical shift and protein secondary structure. J. Mol. Biol. 222, 311–333. 39. Cornilescu, G., Delaglio, F., and Bax, A. (1999) Protein backbone angle restraints
from searching a database for chemical shift and sequence homology. J. Biomol. NMR 13, 289–302. 40. Karplus, M. (1959) Contact electron-spin interactions of nuclear magnetic moments. J. Chem. Phys. 30, 11–15. 41. Karplus, M. (1963) Vicinal Proton Coupling in NMR. J. Am. Chem. Soc. 85, 2870–2871. 42. Bax, A., Kontaxis, G., and Tjandra, N. (2001) Dipolar couplings in macromolecular structure determination. Methods Enzymol. 339, 127–174.
Chapter 9 Regulation of Transcription Factor Activity by SUMO Modification Jian Ouyang, Alvaro Valin, and Grace Gill Abstract Post-translational modification by SUMO is an important mechanism to regulate transcription. Sumoylation has diverse effects on substrate activity, but in most cases reported to date sumoylation of transcription factors correlated with transcriptional repression. Here we describe general strategies to address how post-translational modification by SUMO regulates the activity of a DNA-binding transcription factor. Key words: Transcription factor, sumoylation, SUMO fusion, reporter gene assay.
1. Introduction Reversible SUMO modification of proteins that regulate transcription is an important mechanism to achieve dynamic regulation of gene expression (1–3). A large number of transcriptional regulators, including DNA-binding transcription factors, cofactors, and chromatin-modifying enzymes, have been found to be substrates of SUMO modification, using methods such as those described elsewhere in this volume (see Chaps. 2–5). In the majority of cases described to date, post-translational modification of DNA-binding transcription factors leads to inhibition of activation or stimulation of repression (2, 4). However, the effects of sumoylation on transcription factor stability, localization, and activity are substrate-specific and must be determined experimentally in each case. Sumoylation is rapidly reversible and generally a sumoylated transcription factor exists in dynamic distribution between the SUMO-modified and unmodified forms (1–3, 5). Notably, Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
141
142
Ouyang, Valin, and Gill
although the SUMO-modified form may be a minor species as determined by immunoblotting, sumoylation may nonetheless have a major impact on transcription factor function. As shown in this chapter, a general strategy to determine how SUMO modification affects the activity of a particular transcription factor is to compare the activities of two engineered versions of the protein: one that cannot be sumoylated and one that is always covalently attached to SUMO (Fig. 9.1). If these transcription factor derivatives are found to have measurably different activities compared to wild type, this would indicate that SUMO modification regulates the activity of the transcription factor being analyzed.
2. Materials 1. Primer pairs for site-directed mutagenesis and gene fusion. 2. cDNA of transcription factor of interest cloned in a mammalian expression vector such as Invitrogen pcDNA3.1+/−, which has a strong CMV promoter. cDNAs in frame with common epitopes such as FLAG or HA are often used. 3. dNTP set: 2.5 mM each deoxynucleoside triphosphate, dATP, dTTP, dGTP, and dCTP. 4. Pfu DNA polymerase. 5. Thermocycler.
Fig. 9.1. Schematic of assay to determine how SUMO regulates transcription factor activity. A wild-type DNA-binding transcription factor (TF) is present in dynamic equilibrium between the unmodified and sumoylated forms. SUMO modification is regulated by E1, E2, and E3 enzymes and reversed by SUMO-specific proteases (SENPs) (5, 6). As shown on the left, a nonsumoylated form of the TF can be generated by mutating the SUMO acceptor lysine to arginine (K/R). As shown on the right, fusion to SUMO generates a form of the TF that is constitutively attached to SUMO. In the example shown here, the nonsumoylated form activates expression of its target gene, whereas the SUMO-modified TF represses transcription.
Regulation of Transcription by SUMO
143
6. Horizontal DNA electrophoresis system. 7. DpnI restriction endonuclease. 8. Appropriate restriction endonucleases for gene fusion. 9. T4 DNA ligase. 10. Cells suitable for expression and analysis of transcription factor. 11. Media for the cells to be used. 12. Transfection reagent appropriate for the cells to be used. 13. SUMO expression plasmids (see Note 1). 14. Protease inhibitor cocktail (Roche or equivalent). 15. IP lysis buffer: 50 mM Tris-HCl, pH8.0, 150 mM NaCl, 1% NP-40, 50 mM N-ethylmaleimide (NEM)*, 2 mM DTT*, 1X protease inhibitor cocktail* (*add fresh). 16. IP wash buffer: 50 mM Tris-HCl, pH8.0, 100 mM KCl, 5 mM MgCl2, 0.2 mM EDTA, 0.1% Tween-20, 2 mM DTT* (*add fresh). 17. IP elution buffer: 0.2 M glycine-HCl, pH2.5. 18. 1 M Tris-HCl, pH8.0. 19. Vertical protein electrophoresis system. 20. Protein blotting system. 21. PVDF membrane. 22. PBS: 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4. 23. PBS-T: 0.05% Tween-20 in PBS. 24. Blocking solution: 5% nonfat milk in PBS-T. 25. Antibodies that recognize transcription factor and SUMO or epitope tag. 26. HRP-conjugated secondary antibody. 27. Protein A- or Protein G-conjugated beads. 28. Enhanced chemiluminescent (ECL) detection system. 29. X-ray film. 30. QIAGEN QIAquick Gel Extraction kit or equivalent. 31. Dual-Luciferase Reporter Assay System (Promega) or equivalent. 32. Luminometer. 33. Reporter gene consisting of a promoter sequence that can be recognized by the TF to be studied driving expression of firefly Luciferase. 34. Renilla Luciferase expression plasmid as an internal control in the luciferase assay.
144
Ouyang, Valin, and Gill
3. Methods The methods described below outline (1) generation of a mutant transcription factor (TF) that cannot be sumoylated through sitedirected mutagenesis of the SUMO acceptor lysine, (2) generation of a form of the TF that is constitutively attached to SUMO by gene fusion, and (3) luciferase reporter gene assays to compare the activity of these derivatives with the wild-type TF (Fig. 9.1). Alternative approaches to generate nonsumoylated TF are available (see Note 2) and additional assays to compare the activities of the sumoylated and nonsumoylated TF derivatives can be used (see Note 3). 3.1. Generation of a Mutant Transcription Factor (TF) that Cannot Be Sumoylated
SUMO is covalently attached to proteins through an isopeptide linkage at an acceptor lysine (K) in the substrate (5, 6). Mutation of the SUMO acceptor lysine to arginine (R) prevents SUMO conjugation at that site (see Note 4). Some TFs are sumoylated at multiple lysines, and so additional rounds of mutagenesis, using the technique described here, may be necessary to generate a fully nonsumoylated derivative.
3.1.1. Site-Directed Mutagenesis of SUMO Acceptor Lysines
Several commercial kits are available for site-directed mutagenesis. We use a protocol that is similar to QuickChange Site-Directed Mutagenesis kit (Stratagene). In brief, plasmid DNA containing the cDNA encoding the TF of interest is amplified by PCR, using complementary primers that incorporate the desired mutation. Incorporation of the mutation is enriched by digestion with Dpn I restriction endonuclease that digests the methylated template DNA isolated from dam+ bacteria, but not the unmethylated PCR product produced in vitro. 1. Design PCR primer pair to introduce lysine to arginine (K/R) mutation by considering the following: a. Both mutagenic primers must contain the desired mutation and anneal to the same position on the opposite strands of the plasmid. b. Ideally, primers should be between 20 and 30 bases in length, with the desired mutation in the middle of the primer and 10–15 bases of correct sequence on both sides. 2. Set up a PCR reaction in a total volume 50 µl, containing 10 ng template plasmid DNA that contains the TF coding sequence, 0.2 µM of each primer, 0.2 mM dNTP, and 2.5 U Pfu DNA polymerase. The annealing temperature, usually 50–60°C, is determined empirically, and 15 to 20 cycles of amplification are used. Note that longer extension time may be required to amplify the entire plasmid.
Regulation of Transcription by SUMO
145
3. Check the PCR amplification by running 5 µl of the PCR reaction product on an agarose gel containing ethidium bromide. If a single DNA band at the right size is visible under UV light, the desired PCR product has been obtained and is ready to be processed in the next step. 4. Add 10 U of restriction endonuclease DpnI to the remaining 45 µl PCR reaction to digest the parental plasmid DNA. Incubate at 37°C for 1 h. After that, 10 µl of the DpnIdigested PCR reaction is used to transform competent bacteria. 5. After isolation of plasmids from bacteria, clones containing the desired point mutation must be confirmed by DNA sequencing. 3.1.2. Verification of Sumoylation-Deficient Mutations by Immunoprecipitation and Western Blot
Post-translational modification by SUMO generally increases the apparent molecular weight of the substrate by about 15–40 kD. Upon mutation of the SUMO acceptor lysine to arginine, it is anticipated that the higher molecular weight, sumoylated form(s) of the TF will be absent as determined by either Western Blot or immunoprecipitation followed by Western Blot (IP-WB; see Note 5). 1. Plasmids expressing wild-type TF and the sumoylation-deficient mutant (K/R mutant) generated in Sect. 3.1.1 are used to transfect appropriate culture cells together with the HA-SUMO expression plasmid (see Note 1). 2. Twenty-four to forty-eight hours post-transfection (see Note 6), cells are harvested, washed with cold PBS, and total cell lysate is prepared by adding 500 µl IP lysis buffer (see Note 7) per 5 × 106 cells and incubating for 30 min on ice. 3. Cell lysates are clarified by centrifugation at 4°C in a microfuge at maximum speed for 15 min. The supernatant is transferred to a fresh 1.5 ml microfuge tube. Set aside 50 µl total cell lysate as input sample and store it at −20°C. 4. Add antibody specific to the TF and Protein A- or Protein G-conjugated beads (see Note 8) to the total cell lysate and rotate at 4°C for 2 h to overnight. 5. Wash the beads with 0.5 ml cold IP wash buffer by inverting. Wash five times. 6. Remove the wash buffer, add 50 µl IP elution buffer, and incubate at room temperature for 5–10 min with occasional gentle vortexing. 7. Quickly spin down the beads and transfer the eluted protein samples to a new microfuge tube, add 0.25 volumes of 1M Tris-HCl, pH 8.0, to neutralize the elution buffer, and add glycerol to 10%. The eluted IP sample is then subjected
146
Ouyang, Valin, and Gill
to Western Blot analysis or can be maintained at −80°C for long-term storage. 8. For Western blot analysis of eluted IP samples, choose an appropriate concentration of polyacrylamide for the gel to achieve good resolution of the TF and sumoylated TF. Run the gel on an electrophoresis device according to the manufacturer’s instructions. 9. Proteins are blotted onto a PVDF (or nitrocellulose) membrane using a blotting device according to the manufacturer’s protocol. 10. The PVDF membrane is blocked with blocking solution for 1 h at room temperature (or overnight at 4°C) with slow agitation. 11. Incubate the membrane in primary antibody diluted in the blocking solution (the dilution should be determined empirically) for 1 h at room temperature. Wash the membrane three times for 10 min each with PBS-T. 12. Incubate the membrane in HRP-conjugated secondary antibody diluted in the blocking solution (follow the manufacturer’s recommended dilution or determine the dilution empirically). Wash the membrane three times for 10 min each with PBS-T. 13. Detect the bound HRP-conjugated secondary antibody with an enhanced chemiluminescent (ECL) detection system (for example, Pierce Enhanced Chemiluminescent Western Blotting Substrate) according to the manufacturer’s instructions. Usually, the emission of light is detected by blue-light-sensitive x-ray film. An example of IP-WB result is given in Fig. 9.2.
Fig. 9.2. Immunoprecipitation/Western Blot of wild type (WT) and K/R mutant of the transcription factor Sp3. Flag-HA-tagged WT Sp3 (lane 2) and K/R mutated Sp3 (lane 3) expressed in HEK293T cells were immunoprecipitated with anti-FLAG antibody and immunoblotted with anti-FLAG antibody. While a higher molecular weight SUMOylated form of Sp3 WT was observed, no SUMO-modified form was detected with the K/R mutation. Lane 1: Flag-HA vector negative control.
Regulation of Transcription by SUMO
3.2. Generation of a linear SUMO-TF Fusion
147
SUMO modification is highly dynamic and reversible. In order to generate a form of TF that is constitutively attached to SUMO, a SUMO-TF fusion is used. In many cases, covalent attachment of SUMO by linear gene fusion has been found to mimic the activity of the SUMO conjugate (7–11) (see Note 9). The SUMO-TF fusions are generated by in-frame cloning of the SUMO coding region, amplified by PCR (see Note 10), and either the wild type (WT) or the K/R mutant version of the TF coding region (Fig. 9.3). Both N- and C-terminal SUMO fusions have been used successfully and the choice should be determined empirically; here we describe generation of fusions with SUMO at the N terminus. 1. To clone the SUMO-TF fusions into an expression vector (for example, Invitrogen pcDNA3.1+/−, which bears a strong CMV promoter for protein expression in mammalian cells) with restriction sites X and Z, design a PCR primer pair for amplification of the SUMO coding region (see Note 10) to incorporate restriction endonuclease (RE) site X into the SUMO forward primer and RE site Y into the SUMO reverse primer. Design another primer pair for amplification of the TF coding regions (WT and K/R) to incorporate RE site Y into the TF forward primer and RE site Z into the TF reverse primer (Fig. 9.3). 2. Perform a PCR reaction to amplify the SUMO coding region using Pfu DNA polymerase as described in Sect. 3.1.1. After confirming the amplification by analyzing 5 µl of the PCR reaction on an agarose gel, digest the remainder of the PCR product with restriction endonucleases X and Y. 3. Perform a PCR reaction to amplify WT TF or K/R TF using Pfu DNA polymerase as described in Sect. 3.1.1. After confirming the amplification by analyzing 5 µl of the PCR reaction on an agarose gel, digest the remainder of the PCR product with restriction endonucleases Y and Z. 4. Digest the vector with restriction endonucleases X and Z.
Fig. 9.3. Schematic strategy to generate a SUMO-transcription factor (TF) gene fusion. X, Y, Z: DNA restriction endonuclease sites X, Y, and Z. See Sect. 3.2 for details.
148
Ouyang, Valin, and Gill
5. Run agarose gels to separate the digested DNA fragments of SUMO, TF, and vector. Recover the fragments from the gel using the QIAGEN QIAquick Gel Extraction kit or equivalent. 6. Set up a ligation reaction with the SUMO and TF fragments and the vector using T4 DNA ligase according to the manufacturer’s protocol. The ligation product is then used to transform competent bacteria. 7. After isolating plasmids from bacteria, clones containing the desired fusion are screened by restriction digestion and verified by DNA sequencing. 8. The expression of the desired fusion protein can be determined by Western Blot or IP-WB according to Sect. 3.1.2. 3.3. Luciferase Assays for Functional Analysis of Mutant TF
In many cases, SUMO modification has been found to promote repression or inhibit activation by a TF (2, 4). To determine how SUMO affects the activity of your favorite TF, the WT TF, K/R mutant TF, and SUMO-TF fusion are tested for their ability to activate or repress the transcription of a specific reporter gene in a transient transfection assay. We have used the Gal4 reporter gene system, which consists of Gal4 DNA binding domain (Gal4DBD) fused to Sp3 transcription factor and tandem Gal4 binding sites fused to a firefly Luciferase coding sequence (G5-TK-Luciferase), as a reporter (8) (Fig. 9.4). 1. The WT, sumoylation-deficient mutant (K/R) and the SUMO fusion to both WT and the K/R mutant as well as the empty vector (as a negative control) are cotransfected
Fig. 9.4. SUMO-1 fusion represses Sp3 transcriptional activity. SUMO-1(1–96), lacking one of the two glycines at the C terminus of mature SUMO-1, was fused in-frame to the Gal4 DNA binding domain (G4) alone, Gal4-Sp3, or Gal4-Sp3K539R as indicated in the schematic drawing. Cells were cotransfected with the indicated Gal4 fusions and a Gal4dependent luciferase reporter gene. The luciferase activity relative to Gal4-Sp3 WT, which was set at 1, is shown. Error bars represent standard deviation of assays performed in triplicate. Note that the mutation of the major SUMO acceptor lysine in Sp3 leads to a dramatic increase in activity, which is completely suppressed by in-frame fusion to SUMO-1 (Reprinted from ref. (8) with permission from Elsevier).
Regulation of Transcription by SUMO
149
with a specific firefly luciferase reporter plasmid (such as G5-tk-luc) and a Renilla Luciferase construct (as an internal control) into an appropriate cell line. The amount of plasmid DNA used for transfection should be determined empirically (see Note 11). 2. Twenty-four to forty-eight hours post-transfection (see Note 6), cell lysates are prepared by adding adequate Passive Lysis Buffer (provided with the Promega dual luciferase assay kit) directly to the cultured cells according to manufacturer’s protocol. 3. After shaking at room temperature for 15 min, cell lysates are transferred to 1.5 ml microfuge tubes and centrifuged at maximum speed for 5 min. The cell lysates can be processed immediately for luciferase assay or stored at −80°C. If necessary, cell lysates can be analyzed by Western blot to check uniform expression of different versions of TF. 4. Luciferase activity is determined using a Luciferase assay kit and a Luminometer according to the manufacturer’s specifications. Briefly, substrates for both Firefly Luciferase and Renilla Luciferase are added sequentially and both activities are measured. Some Luminometers can be programmed to automatically inject the substrates for both Firefly Luciferase and Renilla Luciferase sequentially and read the activities in a 96-well format. The amount of Firefly Luciferase activity produced from the reporter gene reflects the activity of the TF. Renilla Luciferase activity serves as an internal control. An example of a Luciferase assay is given in Fig. 9.4.
4. Notes 1. In mammals, there are three SUMO paralogs: human SUMO-1 is 45% identical to SUMO-2, which is 96% identical to SUMO-3 (5, 6, 12). If a TF is known to be preferentially modified by SUMO-1 or SUMO-2 or 3, then that SUMO paralog should be used in the coexpression and fusion experiments described here. In general, overexpression of the mature form of SUMO increases sumoylation level and facilitates the detection of SUMO-modified proteins, especially when endogenous sumoylation levels are very low or modification is limited to specific circumstances. 2. There are two additional well-established approaches to generate a nonsumoylated TF: (i) If the SUMO acceptor lysine lies within a consensus site, ΨKXE/D (5, 6), mutation of
150
Ouyang, Valin, and Gill
the acidic residue at +2 is often sufficient to abolish sumoylation at the lysine (13, 14). (ii) Overexpression of a SUMOspecific protease can effectively remove SUMO from a TF substrate. While this approach has the advantage of using an otherwise WT TF, appropriate controls are needed to insure any observed effects are due to direct desumoylation of the TF and not the many other substrates of the protease (8, 15). 3. To regulate transcription, DNA-binding transcription factors must be stably expressed, translocate to the nucleus, bind DNA sequences near the target gene and interact with coactivators or corepressors. Since sumoylation may affect any of these steps, assays in addition to the luciferase assay described here should be considered. Common assays include immunofluorescence to determine subcellular localization and gel mobility shift assays to monitor DNA binding. 4. Please see Chap. 3 of this volume for methods to identify the site of SUMO modification in a substrate. It should be noted that some SUMO acceptor lysines are also sites of other post-translational modifications, such as acetylation or ubiquitylation (16–18). Thus, caution should be used in interpreting the findings of the lysine mutant, as any change in activity associated with this mutant may not be directly attributable to loss of sumoylation. 5. IP-WB is the recommended method to monitor the presence or absence of the sumoylated form of a TF. By confirming that a species is reactive to antibodies specific to both the TF and SUMO, IP-WB allows unambiguous identification of the SUMO-modified form of TF. In those cases in which a TF is known to be sumoylated, and a higher molecular weight species can be attributed with confidence to sumoylation and not any other post-translational modifications, a simple WB may be sufficient to monitor the presence or absence of the sumoylated form. 6. The optimal time point to harvest cells after transfection should be determined empirically to obtain high level of sumoylated TF. 7. It is essential to include N-ethylmaleimide (NEM) in the lysis buffer because high activity of SUMO-specific proteases in cell lysates can remove SUMO from substrate proteins very quickly if these proteases are not inactivated. NEM irreversibly inhibits the SUMO-specific proteases. 8. We generally use 0.5–5 µg antibody and 10–30 µl Protein A- or protein G-conjugated beads. Antibodies from different species and different antibody subtypes have different affinities for Protein A or Protein G. Protein A is generally used for rabbit polyclonal antibodies, whereas Protein G is
Regulation of Transcription by SUMO
151
often more suitable for mouse monoclonal antibodies. The amount of antibodies and Protein A- or Protein G-conjugated beads to optimize signal to noise in the IPs should be determined empirically. 9. Although in most cases SUMO fusions have been reported to mimic the activity of the SUMO-conjugated proteins (7, 8, 19), this must be determined empirically as there are exceptions (see Ref. 20 for an example). 10. It is important that a truncated form of SUMO lacking the diglycine motif at the C terminus of the mature SUMO be used in generating the SUMO-TF fusions. The motif should be deleted or mutated in order to avoid either cleavage of N-terminal SUMO-TF fusions by SUMO-specific proteases or conjugation of C-terminal TF-SUMO fusions to other proteins in the cell. 11. It is important to empirically determine the optimal amount of plasmid DNA used for transfection. For example, our experience suggests that a transcriptional activator can behave like a transcriptional repressor when present in excess (21). References 1. Gill, G. (2004) SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes Dev. 18, 2046–2059. 2. Gill, G. (2005) Something about SUMO inhibits transcription. Curr. Opin. Genet. Dev. 15, 536–541. 3. Girdwood, D. W., Tatham, M. H., and Hay, R. T. (2004) SUMO and transcriptional regulation. Semin. Cell Dev. Biol. 15, 201–210. 4. Gill, G. (2003) Post-translational modification by the small ubiquitin-related modifier SUMO has big effects on transcription factor activity. Curr. Opin. Genet. Dev. 13, 108–113. 5. Melchior, F. (2000) SUMO–nonclassical ubiquitin. Annu. Rev. Cell Dev. Biol. 16, 591–626. 6. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 7. Huang, T. T., Wuerzberger-Davis, S. M., Wu, Z. H., and Miyamoto, S. (2003) Sequential modification of NEMO/IKKgamma by SUMO-1 and ubiquitin mediates NF-kappaB activation by genotoxic stress. Cell 115, 565–576. 8. Ross, S., Best, J. L., Zon, L. I., and Gill, G. (2002) SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization. Mol. Cell 10, 831–842.
9. Holmstrom, S., Van Antwerp, M. E., and Iniguez-Lluhi, J. A. (2003) Direct and distinguishable inhibitory roles for SUMO isoforms in the control of transcriptional synergy. Proc. Natl. Acad. Sci. USA 100, 15758–15763. 10. Muromoto, R., Ishida, M., Sugiyama, K., Sekine, Y., Oritani, K., Shimoda, K., and Matsuda, T. (2006) Sumoylation of Daxx regulates IFN-induced growth suppression of B lymphocytes and the hormone receptor-mediated transactivation. J. Immunol. 177, 1160–1170. 11. Yurchenko, V., Xue, Z., and Sadofsky, M. J. (2006) SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair. Mol. Cell. Biol. 26, 1786–1794. 12. Ayaydin, F., and Dasso, M. (2004) Distinct in vivo dynamics of vertebrate SUMO paralogues. Mol. Biol. Cell 15, 5208–5218. 13. Degerny, C., Monte, D., Beaudoin, C., Jaffray, E., Portois, L., Hay, R. T., de Launoit, Y., and Baert, J. L. (2005) SUMO modification of the Ets-related transcription factor ERM inhibits its transcriptional activity. J. Biol. Chem. 280, 24330–24338. 14. Sapetschnig, A., Rischitor, G., Braun, H., Doll, A., Schergaut, M., Melchior, F., and Suske, G. (2002) Transcription factor Sp3
152
Ouyang, Valin, and Gill
is silenced through SUMO modification by PIAS1. EMBO J. 21, 5206–5215. 15. Cheng, J., Perkins, N. D., and Yeh, E. T. (2005) Differential regulation of c-Jundependent transcription by SUMO-specific proteases. J. Biol. Chem. 280, 14492– 14498. 16. Shalizi, A., Gaudilliere, B., Yuan, Z., Stegmuller, J., Shirogane, T., Ge, Q., Tan, Y., Schulman, B., Harper, J. W., and Bonni, A. (2006) A calcium-regulated MEF2 sumoylation switch controls postsynaptic differentiation. Science 311, 1012–1017. 17. Desterro, J. M., Rodriguez, M. S., and Hay, R. T. (1998) SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2, 233–239.
18. Hoege, C., Pfander, B., Moldovan, G. L., Pyrowolakis, G., and Jentsch, S. (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419, 135–141. 19. Long, J., Wang, G., He, D., and Liu, F. (2004) Repression of Smad4 transcriptional activity by SUMO modification. Biochem. J. 379, 23–29. 20. Ihara, M., Yamamoto, H., and Kikuchi, A. (2005) SUMO-1 modification of PIASy, an E3 ligase, is necessary for PIASy-dependent activation of Tcf-4. Mol. Cell. Biol. 25, 3506–3518. 21. Gill, G., and Ptashne, M. (1988) Negative effect of the transcriptional activator GAL4. Nature 334, 721–724.
Chapter 10 Characterization of the Effects and Functions of Sumoylation Through Rapamycin-Mediated Heterodimerization Shanshan Zhu and Michael J. Matunis Abstract Post-translational modification of proteins, such as phosphorylation, ubiquitination, and SUMO modification, is an important means of regulating a variety of cellular activities. SUMOs (Small Ubiquitin related Modifiers) are covalently conjugated to lysine residues of many proteins by a mechanism that parallels ubiquitination (1). The effects of sumoylation, however, are distinct from ubiquitination. Sumoylation does not directly control protein stability, but regulates proteins through various mechanisms that include modulation of protein–protein interactions, protein–nucleic acid interactions, subcellular protein localization, and enzymatic activity (1–4). There are many examples, however, where the molecular bases for the effects of sumoylation on protein function and on cellular processes remain unclear. Here, we outline the use of an inducible and reversible sumoylation system, based on rapamycin heterodimerization, as a novel tool to characterize the functions of sumoylation in mammalian cells. Key words: SUMO conjugation, RanGAP1, rapamycin, heterodimerization, Ariad.
1. Introduction The rapamycin-mediated heterodimerization system was first described in 1994 (5–7) and has subsequently been used to study a diverse array of cellular processes (8–10). The system utilizes a small, bivalent, cell-permeable compound to mediate protein dimerization, thus allowing for exploration of the biological consequences of induced protein–protein interactions in vivo. Ariad Pharmaceuticals, Inc. has specifically developed a system that uses
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
153
154
Zhu and Matunis
Fig. 10.1. A general schematic depicting heterodimerization-controlled SUMO “modification” and “demodification”. SUMO and potential SUMO-modified proteins are fused to the rapamycin binding domains of the FK506 binding protein (FKBP) and the FKBP–rapamycin-associated protein (FRB). The carboxy-terminal glycine of SUMO is mutated to alanine to prevent its covalent attachment to other proteins. The addition or removal of rapamycin (or related analogs—indicated by a star symbol) is used to associate or disassociate SUMO and target proteins and investigate the effects of SUMO modification and demodification (Reproduced from ref. (11) with permission from Elsevier Limited).
the compound AP21967, which is a nontoxic rapamycin analog able to “heterodimerize” FKBP (FK506 binding protein, 12 KDa) and FRB (10.5 KDa) proteins in vivo. By fusing SUMO with FRB and candidate substrates with FKBP, and expressing these fusion proteins in cells, inducible and reversible “sumoylation” can be mimicked by the addition or removal of AP21967 from the culture medium (11). Treating cells with AP21967 induces a tight association between SUMO and a single SUMO substrate, thereby allowing substrate-specific downstream effects to be analyzed (Fig. 10.1). Expression of SUMO-1, SUMO-2, or SUMO-3 fusion proteins can also be used to analyze potential SUMO paralog-specific effects. Here, we outline the use of human RanGAP1 as a model SUMO-1 substrate to illustrate how heterodimerization in vivo is able to mimic natural covalent sumoylation. A recently described alternative, but somewhat related, approach involves expression of linear fusions of the SUMO E2 conjugating enzyme Ubc9 with target substrates (see Note 1 and Chap. 5).
2. Materials 1. Ariad Pharmaceuticals provides the regulated heterodimerization kits that include AP21967 and expression vectors for FRB and FKBP fusion genes free to noncommercial users. Kits can be requested through the Ariad website (http:// www.ariad.com). 2. Eukaryotic expression vectors for FRB and FKBP fusion proteins (Ariad Pharmaceuticals, Cambridge, MA) (Fig. 10.2) a.
pC4EN-F1 vector
b.
pC4RH-E vector
c.
pC4M-F2E vector
Sumoylation Through Rapamycin-Mediated Heterodimerization
155
3. AP21967 stock solution: prepare by dissolving the compound into ethanol to a concentration of 250 mM. 4. Restriction enzymes and T4 DNA ligase. 5. Oligonucleotide primers. 6. HeLa cells. 7. Digitonin (e.g., #37008 from Sigma-Aldrich, St. Louis, MO, or from other suppliers). 8. Tissue culture grade phosphate-buffered saline (PBS) (see Note 2). 9. Dulbecco’s modified eagle’s medium (DMEM). 10. Penicillin-streptomycin (P/S). 11. HEPES (N-(2-hydroxyethyl)-piperazine-N′-2-ethanesulfonic acid): 1 M, tissue culture grade. 12. Fetal bovine serum (FBS). 13. Complete cell culture medium: DMEM, 10% FBS, 1% (w/v) P/S, 10 mM HEPES. 14. Lipofectamine transfection reagent (Invitrogen, Carlsbad, CA): 15. PLUS transfection reagent (Invitrogen, Carlsbad, CA): 16. OPTI-MEM. 17. Permeabilization buffer (PB): 20 mM HEPES (pH7.4), 2 mM magnesium acetate, 110 mM potassium acetate. 18. Primary antibodies: a.
Mouse anti-Myc antibody 9E10 (ATCC, Manassas, VA).
b.
Rabbit anti-HA antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
19. Fluorescently labeled secondary antibodies (Invitrogen, Carlsbad, CA): a.
Alexa-488 conjugated goat anti-mouse.
b.
Alexa-594 conjugated goat anti-rabbit.
20. Antibody dilution buffer: PBS with 2% BSA. 21. Anti-fade mounting solution: 80% glycerol, 50 mM TrisHC1 (pH 8.0) and 0.1% DABCO (1,4-diazabicyclo[2.2.2] octane). 22. Rapamycin analog AP21967 (Ariad Pharmaceuticals Inc., Cambridge, MA). 23. Zeiss fluorescence microscope and LSM 510 confocal microscope (e.g., Carl Zeiss, Thornwood, NY; alternative equipment for fluorescence and confocal imaging may be available from other suppliers).
156
Zhu and Matunis
Fig. 10.2. Schematic drawing of pC4EN-F1 (A), pC4RH-E (B), and pC4M-F2E (C) expression plasmids acquired from Ariad Pharmaceuticals Inc., Cambridge, MA.
24. Binding buffer for immunoprecipitation: 20 mM Hepes, pH7.9, 125 mM NaCl, 0.25% NP-40, 1 mM EDTA. 25. Complete protease inhibitor (Roche Applied Science, Indianapolis, IN). 26. SDS-PAGE sample buffer, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) equipment and reagents, equipment and reagents for protein electroblotting.
3. Methods 3.1. FKBP and FRB Expression Plasmids
The heterodimerization assay requires the coexpression of FKBP and FRB fusion proteins in living cells. FKBP and FRB expression vectors (Fig. 10.2) are freely available from Ariad Pharmaceuticals Inc. Although SUMO may be fused to either FRB or FKBP, we have found SUMO-FRB fusions to be effective and have therefore focused our studies on the characterization of SUMO-FRB fusion proteins coexpressed with substrate-FKBP
Sumoylation Through Rapamycin-Mediated Heterodimerization
157
fusion proteins. SUMO may be fused to either the amino- or the carboxy terminus of FRB, and optimal heterodimerization with different SUMO substrates may be affected by the specific orientation. We therefore recommend testing both SUMO-FRB and FRB-SUMO fusions with individual substrates. In the example discussed below, fusing SUMO-1 to the amino terminus of FRB was most effective in studies with the RanGAP1 substrate. Sect. 3.1.1 describes the construction of the HA-tagged SUMO-1FRB fusion protein expression vector used in these studies. (For additional instructions, see Notes 3–5.) When using SUMO-FRB fusion proteins, substrates must be fused to FKBP to enable heterodimerization in the presence of AP21967. We have found that the number of FKBP domains fused to the substrate, as well as the specific orientation (fused to the amino- or carboxy terminus of the substrate), can significantly affect the efficiency of productive heterodimerization. Thus, it is important to test multiple fusion constructs for individual substrates. (see Notes 3–5). Sect. 3.1.2 describes the construction of a Myc-tagged RanGAP1–2xFKBP fusion protein expression vector. All vectors described here are available on request. 3.1.1. SUMO-FRB Fusion Protein Construct
Fuse SUMO to the amino terminus or carboxy terminus of FRB. Please note that the carboxy-terminal glycine of SUMO should be mutated to alanine to prevent SUMO-FRB from being cleaved by SUMO isopeptidases and to prevent covalent conjugation of FRB-SUMO to protein substrates. For our RanGAP1 studies, a plasmid for expression of HAtagged human SUMO-1(G97A)-FRB (Fig. 10.3A) was constructed from parent plasmids provided by Ariad Pharmaceuticals Inc. (Fig. 10.2A and B) using standard molecular cloning techniques. The carboxy-terminal glycine 97 of SUMO-1 was mutated to alanine to prevent recognition and cleavage of the fusion protein by SUMO isopeptidases. In addition, the nuclear localization signal (NLS) present in the parent plasmid was mutated to avoid influencing the normal subcellular localization of SUMO-1.
3.1.2. RanGAP1–2xFKBP Fusion Protein Construct
Clone a cDNA encoding your protein of interest to the amino terminus or carboxy terminus of FKBP or 2xFKBP. The lysine residue(s) within known SUMO conjugation site(s) in your protein can be mutated to arginine to avoid covalent conjugation by endogenous SUMOs. In our experiments, a plasmid for expression of Myc-tagged mouse RanGAP1(K526R)-2xFKBP (Fig. 10.3B) was constructed from parent plasmids provided by Ariad Pharmaceuticals Inc. (Fig. 10.2A–C) using standard molecular cloning techniques. Notably, the major sumoylation site at lysine residue 526 was mutated to arginine to prevent covalent conjugation by endogenous SUMOs. In addition, the myristoylation signal (Myr) and
158
Zhu and Matunis
Fig. 10.3. Schematic drawing of plasmids coding for HA-SUMO-FRB (A) and Myc-RanGAP1-2xFKBP (B).
HA tag present in the parent plasmids were eliminated by subcloning and mutagenesis. Preliminary experiments verified that the RanGAP1/K526A fusion protein was not covalently modified by endogenous SUMO-1. 3.2. Transfection and AP21967 Treatment
The following procedures describe conditions for transient transfection and expression of SUMO-FRB and RanGAP1-2xFKBP fusion proteins in human HeLa cells and for their heterodimerization using AP21967. Transfections can be performed on cells culture in 6-well plates as outlined below, or scaled up as necessary. Different transfection conditions, including ratios of plasmids encoding for SUMO fusion gene to substrate fusion gene and ratios of plasmids to transfection reagents, should be tested for your specific purpose.
Sumoylation Through Rapamycin-Mediated Heterodimerization
159
1. HeLa cells are grown in complete cell culture medium containing and grown at 37°C, 5% CO2. Twelve hours before transfection, cells are plated onto glass coverslips and cultured in 6-well tissue culture dishes. 2. For each transfection reaction, 0.8 µg HA-SUMO/G97AFRB plasmid DNA and 1.6 µg Myc-RanGAP1/K526R2xFKBP plasmid DNA are diluted into 200 µl OPTI-MEM and mixed. Subsequently, 6 µl of PLUS reagent is added to the DNA mixture, and tubes are incubated at room temperature (RT) for 15 min. 3. 4 µl of lipofectamine reagent is diluted into 200 µl of OPTIMEM in a separate tube and mixed. 4. The DNA mixture and diluted lipofectamine reagent from Steps 2 and 3 are combined, mixed, and incubated at RT for 20 min. 5. HeLa cells are washed with PBS, and 800 µl DMEM (without serum) are added to each 6-well chamber. The DNAPLUS-Lipofectamine mixture is added to each well, and plates are incubated at 37°C for 4 h. 6. Complete cell culture medium containing 20% FBS and 250 nM AP21967 is added to the transfected cells (see Note 6 and 7). 7. Cells are analyzed 48 h after the start of transfection. 3.3. Immunoblot Analysis and Immunopurification
Following transfection, the integrity and expression levels of the transfected FRB and FKBP fusion proteins should be analyzed by immunoblot analysis. Transfected cells can be lysed in SDS sample buffer, separated by SDS-PAGE, and immunoblot analysis can be carried out with anti-HA and anti-Myc antibodies using standard procedures. Immunopurification of the fusion proteins from lysates prepared from cells treated and not treated with AP21967 is also recommended to demonstrate drug-dependent heterodimerization. Immunopurification and immunoblot analysis can be performed with anti-HA and anti-Myc antibodies as outlined below. 1. Transfections are performed on cells cultured in 10 cm plates. Following incubation with or without AP21967 for 48 h, cells are washed once with cold PBS and lysed in ice-cold binding buffer containing Complete protease inhibitors. 2. After incubation on ice for 30 min (vortex briefly every 10 min) to allow for complete lysis, cell lysates are cleared by centrifugation at 20,800g for 15 min at 4°C. 3. The supernatants are incubated for 4 h at 4°C with 10 µl of protein-G agarose beads containing cross-linked anti-HA antibody.
160
Zhu and Matunis
4. Following incubation, the beads are washed five times with binding buffer, and bound proteins are eluted with 30 µl of SDS-PAGE sample buffer. 5. Eluted proteins are separated by SDS-PAGE, transferred to nitrocellulose membranes, and probed with anti-Myc and anti-HA antibodies. HA-tagged SUMO-1 is expected to be present in immunopurifications from both AP21967 treated and untreated control cells. Myc-RanGAP1-2xFKBP should be detected only in immunopurifications from cells treated with AP21967 (Fig. 10.4). 3.4. Immunofluorescence Microscopy
The effects of sumoylation on proteins are very often substratedependent. Therefore, the specific assays used to assess the effects of “sumoylation” mediated by rapamycin-induced heterodimerization must be defined on an individual basis. Among other effects, sumoylation often alters a protein’s subcellular localization, as exemplified by RanGAP1 (12, 13). As outlined below, immunofluorescence microscopy can be used to analyze the effects of rapamycin-mediated heterodimerization on protein subcellular localization.
Fig. 10.4. AP21967 mediates the heterodimerization of SUMO-1(G97A)-FRB with RanGAP1 (K526R)-2xFKBP fusion proteins. Cells were cotransfected with plasmids encoding for HA-tagged SUMO-1(G97A)-FRB and Myc-tagged RanGAP1(K526R)-2xFKBP fusion proteins. Cells were cultured for 40 h in the absence (−) or presence (+) of 250 nM AP21967. Expression of RanGAP1 (K526R) fusion protein was determined by immunoblot analysis of whole cell lysates with an anti-Myc antibody (lanes 1 & 2, top panel), and expression of the SUMO-1 (G97A) fusion protein was determined by immunoblot analysis with an anti-HA antibody (lanes 1 & 2, bottom panel). To assay for heterodimerization, SUMO-1 (G97A)-FRB was immunopurified from cell lysates using an anti-HA antibody and immunopurified complexes were analyzed by immunoblot analysis. An anti-HA antibody was used to detect the immunopurified SUMO-1(G97A)-FRB protein (lanes 3 & 4, bottom panel) and an anti-Myc antibody was used to detect the presence of copurified RanGAP1 (K526R)-2xFKBP protein (lanes 3 & 4, top panel).
Sumoylation Through Rapamycin-Mediated Heterodimerization
161
1. Cells are cultured on glass coverslips, transfected with plasmid DNAs, and treated with AP21967. 2. Following transfection and drug treatment, cells are washed twice with ice-cold PBS. 3. Cells are permeabilized by incubation in PB buffer containing 50 µg/ml digitonin and 250 nM AP21967 for 7 min at RT. This step is specifically tailored for analysis of RanGAP1 localization, as digitonin permeabilization releases soluble cytoplasmic proteins while leaving the nuclear membrane and nuclear pore complexes intact. Specific permeabilization and fixation conditions will vary depending on the SUMO substrate being characterized. 4. Following permeabilization, cells are washed twice with icecold PBS. 5. Cells are fixed using 2% formaldehyde in PB containing 250 nM AP21967 for 40 min at RT. 6. Cells are washed twice with PBS at RT. 7. Cells are incubated for 1 h at RT with 100 µl primary antibody (either anti-Myc and anti-HA) diluted in PBS containing 2% BSA. 8. Cells are washed three times with PBS at RT. 9. Cells are incubated for 30 min at RT with 100 µl secondary antibody diluted in PBS containing 2% BSA. 10. Cells are washed three times with PBS at RT. 11. Coverslips are mounted onto glass microscope slides using anti-fade mounting solution. 12. Cells are analyzed by fluorescence microscopy. RanGAP1 should be diffusely localized throughout the cytoplasm in the absence of AP21967 and concentrated at nuclear pore complexes in the presence of the heterodimerizer (see Fig. 10.5).
4. Notes 1. An alternative strategy to mediate substrate-specific sumoylation is to induce heterodimerization between Ubc9 (the SUMO-conjugating enzyme) and substrates. In this scenario, the substrates can be expected to be covalently modified by SUMO, potentially at lysine residues corresponding to the natural modification sites (see Chap. 5). In support of this concept, Jakobs et. al. were able to increase the covalent modification of p53 and STAT1 at consensus SUMOylation sites in vivo by expressing linear fusions with Ubc9 (14).
162
Zhu and Matunis
Fig. 10.5. Heterodimerization targets RanGAP1 and SUMO-1 to NPCs. Cells were cotransfected with plasmids encoding for the indicated K526R mutant RanGAP1 and G97A mutant SUMO-1 fusion proteins. Cells were cultured in the absence or presence of a heterodimerizer. Expressed fusion proteins were detected by immunofluorescence microscopy using anti-Myc and anti-HA antibodies. (A) In the absence of the heterodimerizer, neither fusion protein was detected at NPCs; (B) in the presence of the heterodimerizer, mutant RanGAP1 and SUMO-1 were both detected at NPCs, as indicated by the discontinuous rim staining at the nuclear envelope. Scale bar equals 10 µm (Reproduced from ref. (11) with permission from Elsevier Limited).
The rapamycin heterodimerization system has the advantages of being inducible and reversible. 2. All cell culture and transfection products and reagents are from Invitrogen (Carlsbad, CA), but alternative sources are expected to work equally well. 3. When making FKBP and FRB fusion protein constructs, both SUMO and the substrate should be mutated so that they are conjugation deficient. The carboxy-terminal glycine
Sumoylation Through Rapamycin-Mediated Heterodimerization
163
of SUMO can be mutated to alanine, making it incapable of forming a thiol-ester with E1 and E2 enzymes. If the modification sites in the SUMO substrate to be studied are known, the corresponding lysine residues can be mutated to arginine. 4. The orientations of the rapamycin-binding domains with respect to SUMO and the substrate can be very important. For example, although RanGAP1 with 2xFKBP fused to its carboxy terminus was efficiently targeted to NPCs upon heterodimerization with SUMO-FRB, RanGAP1 with 2xFKBP fused to its amino terminus was not. This may be due to geometric constraints that prevent effective protein–protein interactions, either between fusion proteins or with downstream interacting proteins. The most effective heterodimerization pair must be determined empirically. 5. In general, we recommend fusing SUMO with FRB and substrates with 2xFKBP. Both amino- and carboxy-terminal fusions should be constructed and tested in different combinations. 6. The concentration of AP21967 that is needed to induce heterodimerization can vary between 10 nM and 1 µM. The effects of treatment should be tested over a range of times between 12 and 48 h. 7. AP21967 is an effective compound that leads to the formation of very stable heterodimers within hours. When immunopurifying FRB fusion proteins from lysates prepared from cells treated with AP21967, FKBP fusion protein partners are easily detected (Fig. 10.4). The addition of AP21967 to IP and wash buffers is not required to maintain interactions during the purification procedures. Because of the very stable interaction, reversal of heterodimer formation is not easily achieved by simply removing AP21967 from the culture medium. For example, SUMO-FRB and RanGAP12xFKBP could be detected at NPCs 48 h following removal of AP21967. The reversal of heterodimerization, however, can be achieved by adding FK506 to cells. FK506 only binds to FKBP and at high concentrations it is able to antagonize AP21967-mediated heterodimerization (15).
References 1. Muller, S., Hoege, C., Pyrowolakis, G. and Jentsch, S. (1994) SUMO, ubiquitin’s mysterious cousin. Nat. Rev. Mol. Cel. Biol. 2, 202–210. 2. Johnson, E. S. (2005) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382.
3. Matunis, M. J. and Pickart, C. M. (2005) Beginning at the end with SUMO. Nat. Struct. Mol. Biol. 12, 565–566. 4. Kerscher, O. (2007) SUMO junction-what’s your function? New insights through SUMOinteracting motifs. EMBO Rep. 8, 550–555.
164
Zhu and Matunis
5. Brown, E. J., Albers, M. W., Shin, T. B., Ichikawa, K., Keith, C. T., Lane, W. S. and Schreiber, S. L. (1994) A mammalian protein targeted by G1-arresting rapamycinreceptor complex. Nature 369, 756–758. 6. Sabatini, D. M., Erdjument-Bromage, H., Lui, M., Tempst, P. and Snyder, S. H. (1994) RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78, 35–43. 7. Chen, J., Zheng, X. F., Brown, E. J. and Schreiber, S. L. (1995) Identification of an 11-kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycinassociated protein and characterization of a critical serine residue. Proc. Natl. Acad. Sci. 92, 4947–4951. 8. Klemm, J. D., Schreiber, S. L. and Crabtree, G. R. (1998) Dimerization as a regulatory mechanism in signal transduction. Annu. Rev. Immunol. 16, 569–592. 9. Pollock, R., and Clackson, T. (2002) Dimerizer-regulated gene expression. Curr. Opin. Biotechnol. 13, 459–467. 10. Hoogenraad, C. C., Wulf, P., Schiefermeier, N., Stepanova, T., Galjart, N., Small, J. V., Grosveld, F., de Zeeuw, C. I. and Akhmanova, A. (2003) Bicaudal D induces selective dynein-mediated microtubule minus
11.
12.
13.
14.
15.
end-directed transport. EMBO. J. 22, 6004– 6015. Zhu, S., Zhang, H. and Matunis, M. J. (2006) SUMO modification through rapamycin-mediated heterodimerization reveals a dual role for Ubc9 in targeting RanGAP1 to nuclear pore complexes. Exp. Cell Res. 312, 1042–1049. Matunis, M. J., Coutavas, E. and Blobel, G. (1996) A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J. Cell Biol. 135, 1457–1470. Matunis, M. J., Wu, J. and Blobel, G. (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J. Cell Biol. 140, 499–509. Jakobs, A., Koehnke, J., Himstedt, F., Funk, M., Korn, B., Gaestel, M. and Niedenthal, R. (2007) Ubc9 fusion-directed SUMOylation (UFDS): a method to analyze function of protein SUMOylation. Nat. Methods. 4, 245–250. Harding, M. W., Galat, A., Uehling, D. E. and Schreiber, S. L. (1989) A receptor for the immunosuppressant FK506 is a cistrans peptidyl-prolyl isomerase. Nature 341, 758–760.
Chapter 11 Purification of SUMO Conjugating Enzymes and Kinetic Analysis of Substrate Conjugation Ali A. Yunus and Christopher D. Lima Abstract SUMO conjugation to protein substrates requires the concerted action of a dedicated E2 ubiquitin conjugation enzyme (Ubc9) and associated E3 ligases. Although Ubc9 can directly recognize and modify substrate lysine residues that occur within a consensus site for SUMO modification, E3 ligases can redirect specificity and enhance conjugation rates during SUMO conjugation in vitro and in vivo. In this chapter, we will describe methods utilized to purify SUMO conjugating enzymes and model substrates which can be used for analysis of SUMO conjugation in vitro. We will also describe methods to extract kinetic parameters during E3-dependent or E3-independent substrate conjugation. Key words: SUMO, Smt3, E2 conjugating enzyme, Ubc9, E3 ligase, Siz/PIAS, protein purification.
1. Introduction Post-translational covalent modification of substrates by ubiquitin (Ub) and ubiquitin-like (Ubl) proteins can alter the activities of targeted substrates by affecting protein stability, catalytic activity, or by redirecting protein localization within the cell (1–6). Substrate modification by Ub/Ubl modifiers is carried out by sequential action of at least three enzymes or factors termed E1, E2, and E3 (1). The Ub/Ubl is first processed by a protease to reveal a conserved di-glycine motif, which is subsequently adenylated by E1 in an ATP-dependent reaction. The Ub/Ubl is then transferred to a conserved E1 cysteine residue to form E1∼Ub/Ubl adduct (where ∼ indicates a thioester bond). The E1∼Ub/Ubl is then transferred to a conserved E2 active site Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
167
168
Yunus and Lima
cysteine residue to form an E2∼Ub/Ubl adduct. The Ub/Ubl modifier is then transferred from the E2∼Ub/Ubl adduct to substrate lysine residues to form a stable isopeptide bond between the Ub/Ubl C-terminal glycine and the ε-amine atom from the substrate lysine residue. E3 ligases can facilitate this reaction between substrate and E2∼Ub/Ubl either by enhancing the rate of transfer or by redirecting substrate specificity. SUMO is a member of the Ubl family of proteins. Yeast encodes one SUMO ortholog termed Smt3 while human encodes four SUMO orthologs termed SUMO-1, SUMO-2, SUMO-3, and SUMO-4. It remains unclear whether SUMO-4 is capable of conjugation. SUMO activation requires a dedicated heterodimeric E1 (Aos1/Uba2 or SAE1/SAE2), a single E2 enzyme (Ubc9) and at least two distinct families of SUMO E3 ligases. Ubc9 can directly interact with and modify SUMO substrates containing an accessible consensus motif Ψ-K-x-E/D where Ψ is a hydrophobic, K is the lysine attached to SUMO, x is any amino acid, and E or D is an acidic residue (7, 8). Many SUMO substrates can be conjugated in vitro in an E3-independent manner, although SUMO E3 ligases enhance SUMO conjugation in vitro and in vivo. In addition, SUMO E3s can confer additional substrate specificity during modification in vitro and in vivo. There are two known families of SUMO E3 ligases. SP-RING E3 ligases share limited sequence similarity to ubiquitin RING E3s and include members from yeast (Siz1, Siz2, Mms21 and Zip3) and the human PIAS protein family in higher eukaryotes (9–16). The RanBP2/Nup358 protein encompasses the second type of SUMO E3 ligase and is unrelated to either RING or HECT E3 ligase families (17–19). Recent analysis of the enzymes involved in SUMO conjugation has elucidated the biochemical and structural basis for SUMO conjugation in both E2- and E3-dependent reactions. We will describe procedures used to isolate SUMO conjugating enzymes and methods to extract kinetic parameters for SUMO conjugation in both E3-independent and E3-dependent reactions.
2. Materials 2.1. Protein Expression and Purification
1. Luria-Bertani (LB) medium: 10 g bacto-tryptone, 10 g NaCl, 5 g bacto-yeast extract in 1 l water. 2. Super Broth (SB) medium: 32 g tryptone, 20 g yeast extract, 5 g NaCl in 1 l water. 3. Antibiotics: Ampicillin, 200 mg/ml in water, filter-sterilized; Kanamycin, 50 mg/ml in water, filter-sterilized; Chloramphenicol, 34 mg/ml in ethanol.
SUMO Conjugation Assays
169
4. Isopropyl-β-D-thiogalactopyranoside (IPTG): 1 M in water, filter-sterilized. 5. Plasmids: pET-15b, pET-11c, pET-28b, and pET-21b (Novagen). pSMT3 and TOPO-SMT3 (see Note 1). 6. Bacterial strains: Escherichia coli BL21(DE3) RIL Codon Plus (Stratagene) or E. coli BL21(DE3) pLysS (Novagen). 7. Fermentation: Fermentor equipped with a 14 l vessel (BioFlo-3000 from New Brunswick or equivalent). 8. Site-directed mutagenesis: QuikChange Mutagenesis Kit (Stratagene). 9. Fluorescence: Alexa Fluor 488 C5 maleimide dye (Molecular Probes; Invitrogen). 10. Oligonucleotide primers; thermostable polymerase (Pfu turbo; Strategene). 11. Bovine thrombin (Sigma): 1 U/µl (0.33 µg/µl) in 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM or β-mercaptoethanol (BME), water. Store at −20°C. 12. Ulp1 protease catalytic domain (amino acids 403–621): 3 mg/ml in 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, 10% glycerol. Store at −80°C. 13. Suspension buffer: 20% sucrose, 50 mM Tris-HCl pH 8.0. 14. Lysis buffer: 20% sucrose, 50 mM Tris pH 8.0, 1 mM BME, 350 mM NaCl, 20 mM imidazole, 20 µg/ml lysozyme, 100 µg/ml DNAse I, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1% IGEPAL CA-630 (Sigma). 15. Ni-NTA Superflow agarose resin (Qiagen). 16. Buffer A: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, and 20 mM imidazole. 17. Buffer B: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, and 400 mM imidazole. 18. Buffer C: 20 mM Tris-HCl pH 8.0, 50 mM NaCl, and 1 mM BME. 19. Buffer D: 20 mM Tris-HCl pH 8.0, 100 mM NaCl, and 1 mM BME. 20. Buffer E: 20 mM Tris-HCl pH 8.0, 1 M NaCl, and 1 mM BME. 21. Buffer F: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, and 1 mM BME. 22. Buffer G: 20 mM Tris-HCl pH 8.0, 150 mM NaCl, and 1 mM BME. 23. Buffer H: 20 mM Tris-HCl pH 8.0, 75 mM NaCl, and 1 mM BME. 24. AKTA-FPLC (GE Healthcare) equipped with gel filtration columns (Superdex-75 26/60 and Superdex-200 26/60)
170
Yunus and Lima
and ion exchange columns (Mono-Q 10/10 and Mono-S 10/10) (see Note 2). 25. Micro-filtration devices (Centricon or Centriprep from Amicon or equivalent) with appropriate molecular weight cutoffs (10, 30 or 50 kDa). 26. Bradford reagent (Bio-Rad) or BCA Protein Assay Reagent (Pierce). 2.2. SUMO Conjugation Assays
1. Desalting column: e.g., Micro Bio-Spin Bio-gel P-6 (Bio-Rad). 2. Buffer I: 20 mM HEPES pH 7.5, 50 mM NaCl, 5 mM MgCl2, 0.1% (v/v) Tween-20. 3. Buffer II: 50 mM sodium citrate pH 5.5, 50 mM NaCl, and 5% glycerol. 4. Buffer III: 20 mM HEPES pH 7.5, 50 mM NaCl, 0.1% (v/v) Tween-20, 5 mM EDTA. 5. Buffer IV: 50 mM Tris-HCl pH 6.8, 2% SDS, 4 M urea, 10% glycerol, and 0.25% bromophenol blue. 6. Buffer V: 50 mM sodium citrate pH 6.8, 75mM NaCl, 5 mM MgCl2. 7. Buffer VI: 20 mM HEPES pH 7.5, 50 mM NaCl. 8. Buffer VII: 20 mM Bis-Tris propane (pH range from 7.07 to 10.6), 50 mM NaCl, 0.1% (v/v) Tween-20, 5 mM EDTA.
2.3. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) 2.4. Protein Detection and Analysis by Western Blot
1. NuPAGE system (Invitrogen) for SDS-PAGE analysis with either MES or MOPS running buffer (Invitrogen). 2. 4–12% gradient polyacrylamide Bis-Tris gels (Invitrogen). 1. Transfer buffer: 1x Tris glycine (Genemate; ISC Bioexpress) buffer with 20% methanol. 2. Wash buffer: Phosphate buffered saline (PBS) solution (10 mM phosphate buffer pH 7.4, 2.7 mM potassium chloride, 137 mM NaCl; commercially available from Sigma) and 0.1% (v/v) Tween-20. 3. Blocking buffer: 3% (w/v) non-fat dry milk in PBS. 4. PVDF membranes (Immun-Blot from Bio-Rad or equivalent). 5. Primary Antibody: Antibody against human SUMO-1 (Boston Biochem) used at 1:1000 dilution in blocking buffer. 6. Secondary antibody: Anti-rabbit IgG horseradish peroxidase linked whole antibody (donkey; GE Healthcare) used at 1:2500 dilution in blocking buffer. 7. Semi-Dry Electrophoretic Transfer Cell (Trans-Blot from Bio-Rad or equivalent). 8. Enhanced chemiluminescent (ECL) plus reagent (GE Healthcare).
SUMO Conjugation Assays
171
9. Imaging Western blots: Fujifilm LAS3000 chemiluminescence detector. 10. Image processing and data quantification: Multi Gauge v2.02 or Image Gauge v4.0 (Fujifilm). 2.5. Protein Detection and Analysis Using Fluorescence
1. Fujifilm FLA-5000 with a FITC filter.
2.6. Data Processing
1. Raw data are processed in EXCEL (Microsoft).
2. Image processing and data quantification: Multi Gauge v2.02 or Image Gauge v4.0 (Fujifilm).
2. Data and regression analysis: SigmaPlot 9.0 (Systat Software Inc.).
3. Methods 3.1. Cloning and Purification of Human and Yeast E1 (Aos1/Uba2)
1. The E1 enzyme for SUMO is heterodimeric and consists of two individually encoded polypeptides, Aos1 and Uba2 (a.k.a. SAE1 and SAE2 for human E1). Human or yeast genes are amplified by PCR from human cDNA or yeast genomic DNA, respectively. 2. The yeast Aos1 subunit is cloned into pET-15b using 5′ NcoI and 3′ BamHI and the human Aos1 subunit is cloned into pET-11c using 5′ NdeI and 3′ BamHI. In both instances, Aos1 is encoded as a native polypeptide. 3. Full-length human and yeast Uba2 are cloned into pET28b using 5′ NheI and 3′ XhoI or 5′ NdeI and 3′ HindIII, respectively, to encode polypeptides fused to an N-terminal thrombin cleavable His6-tag. 4. Primers are designed to amplify the C-terminally truncated versions of the human and yeast Uba2 (∆C-term; human: amino acids 1–549; yeast: amino acids 1–554) using 5′ BglII and 3′ SalI or 5′ NdeI and 3′ XhoI, respectively. 5. Co-transform the two plasmids encoding respective E1 subunits (Aos1, Uba2, or Uba2∆C-term) into E. coli BL21 (DE3) RIL Codon Plus. 6. Grow a 10 l culture by fermentation at 37°C to an A600 of 3.0, induce protein expression by addition of IPTG to a final concentration of 1 mM, and grow the culture for another 3 h at 30°C. 7. Harvest the cells by centrifugation (7000× g) and suspend cell pellets in suspension buffer to a final volume of 2 ml per gram cell wet weight. The cell suspension can be stored at −80°C for later use after flash-freezing the suspended cells in liquid nitrogen.
172
Yunus and Lima
8. Thaw frozen cell pellets and equilibrate in Lysis buffer prior to sonication. 9. Disrupt cells by sonication and clarify the cell lysate by centrifugation (40000× g) to obtain supernatant free from cell debris (see Note 3). 10. Apply the lysate to a chromatography column packed with Ni-NTA resin and wash using at least 5 column volumes of Buffer A prior to elution with Buffer B. The heterodimeric E1 enzyme is isolated by virtue of the His6-tag on Uba2. Collect fractions and analyze by SDS-PAGE. Protein content is quantified by Bradford analysis. 11. Protein fractions are analyzed by SDS-PAGE and those containing E1 are pooled and applied to a gel filtration column (Superdex-200) in Buffer F. The SUMO E1 heterodimer migrates as a monodisperse peak with an apparent molecular weight of ∼120 kDa. 12. Fractions are analyzed by SDS-PAGE, and those containing E1 are pooled, desalted into Buffer D, and applied to an anion exchange column (Mono-Q). Elute the protein using a gradient from Buffer D to 50% Buffer E over 20 column volumes. SUMO E1 elutes at approximately 200–250 mM NaCl. 13. Fractions are analyzed by SDS-PAGE and those containing E1 are pooled, desalted into Buffer H, concentrated to ∼10 mg/ml, flash-frozen in liquid nitrogen and stored at −80°C (see Note 7). 3.2. Cloning and Purification of Human and Yeast Ubc9
1. The primers used to amplify the open reading frame of human and yeast UBC9 are designed to include NdeI and XhoI restriction sites at the 5′ or 3′ ends, respectively. 2. Amplify human and yeast UBC9 by PCR from human cDNA or yeast genomic DNA, respectively. Yeast UBC9 contains an intron near the 5′ end, so the 5′ primer is designed to include the 5′ exon. 3. PCR products are digested with appropriate restriction endonucleases and ligated into pET-28b plasmid to encode Ubc9 N-terminally fused with a thrombin cleavable hexahistidine tag. 4. Yeast UBC9 containing the point mutation K153R is generated by site-directed mutagenesis. This Ubc9 isoform will be utilized in assays described later. 5. Transform plasmids into E. coli BL21 (DE3) RIL Codon Plus. 6. Grow 2 l LB cultures in baffled shaker flasks at 37°C to an A600 of 1.0. Cool the cultures to 30°C, and add IPTG to a final concentration of 1 mM. Cultures are then incubated for 3 h at 30°C.
SUMO Conjugation Assays
173
7. Harvest the cells and process the cell pellets for sonication as described in Sect. 3.1. 8. Apply the cleared lysate to Ni-NTA resin. The lysate from a 2 l culture contains approximately 100 mg of His6-Ubc9, requiring ∼10 ml of Ni-NTA resin. 9. Pool the fractions from the Ni-NTA column containing Ubc9. The His6-thrombin cleavable polypeptide is removed by incubation with a 1:1000 (w/w) ratio of bovine thrombin to protein. Monitor the extent of proteolysis by SDS-PAGE. 10. When proteolysis is complete (2–4 h at room temperature or overnight at 4°C), apply the sample to a gel filtration column (Superdex-75) equilibrated in Buffer F. Ubc9 migrates as a monodisperse protein with an apparent molecular weight of ∼20 kDa. Fractions are analyzed by SDS-PAGE and those containing Ubc9 are pooled and dialyzed or desalted into Buffer C. This mixture is loaded onto cation-exchange resin (Mono-S) and the protein is eluted using a gradient from Buffer C to 50% Buffer E over 20 column volumes. Ubc9 elutes from MonoS at approximately 150 mM NaCl. Fractions containing the protein peak are exchanged into Buffer C and concentrated to 5–10 mg/ml. 11. Flash-freeze the protein in aliquots in liquid nitrogen and store at −80°C for future use. 3.3. Cloning, Purification and Fluorophore Labeling of Human SUMO-1 and Yeast SUMO (Smt3)
3.3.1. Purification of Processed Human SUMO-1
In this section we discuss the purification protocol of native and mutant isoforms of SUMO-1 and Smt3. We also discuss the procedure for labeling mutant SUMO proteins with Alexa Fluor 488 C5 maleimide dye, which covalently and irreversibly modifies cysteine residues. The mutant isoforms [SUMO-1(K9C) and Smt3(K11C)] are generated to introduce cysteine residues. Wild-type Smt3 contains no cysteine residues, although human SUMO-1 contains a cysteine residue at position 52. This residue is mutated to alanine by altering the respective codon within the SUMO-1(K9C) construct. K9C and K11C are located in the structurally disordered N-terminal domain. We and others have determined that deletion of this region has no detectable deleterious effects during SUMO activation or during SUMO conjugation to substrates. These labeled SUMO proteins will be utilized in subsequent assays described in the text. 1. Full length SUMO-1 with a C-terminal hexahistidine tag is cloned and purified as described in the chapter detailing proteolysis with endogenous substrates (Reverter and Lima). 2. The human SUMO-1 isoform containing the point mutation K9C is obtained by site-directed mutagenesis.
174
Yunus and Lima
3.3.2. Cloning and Purification of Processed Smt3(K11C)
1. Yeast SMT3 is inserted into pET-28b using NcoI and XhoI restriction sites to encode Smt3 with a C-terminal His6-tag. 2. The Smt3 isoform containing the point mutation K11C is obtained by site-directed mutagenesis. 3. Transform plasmids for expression of wild-type and mutant Smt3 proteins into E. coli BL21 (DE3) pLysS. 4. Grow strains in LB medium at 37°C to an O.D of 1.0 prior to addition of IPTG to a final concentration of 1 mM. Grow cultures for an additional 3 h at 30°C. 5. Process cell pellets for sonication as described above (see Sect. 3.1.). 6. Apply the cleared lysate to Ni-NTA resin in Buffer A and elute from the chromatography column in Buffer B. 7. To remove the C-terminal His6-tag, incubate the fractions containing the protein with Ulp1 protease at a 1:1000 (w/w) ratio for 2–4 h at room temperature or overnight at 4°C. 8. Apply this mixture to a gel filtration column (Superdex-75) equilibrated in Buffer F. Smt3 elutes as a monodisperse peak with an apparent molecular weight near 20 kDa. Fractions are analyzed by SDS-PAGE and those containing Smt3 are pooled and desalted into Buffer C and applied to an anion exchange resin (Mono-Q). Elute Smt3 from the column using a gradient from Buffer C to 50% Buffer E over 20 column volumes. Smt3 elutes at ∼150 mM NaCl. 9. Fractions are analyzed by SDS-PAGE and those containing Smt3 are pooled, concentrated to approximately 4 mg/mL, flash-frozen using liquid nitrogen, and stored at −80°C for future use.
3.3.3. Labeling SUMO1(K9C) or Smt3(K11C) with Alexa Fluor 488 C5 Maleimide
1. Incubate 300 µM Smt3(K11C) or SUMO-1(K9C) (∼4 mg/ ml) with a 10-fold molar excess of Alexa Fluor 488 C5 maleimide dye. 2. Add the dye to the protein solution in a drop-wise manner and incubate overnight at 4°C. 3. Quench the reaction and remove excess dye by applying the mixture to a desalting column equilibrated with Buffer D. 4. The resulting mixture is concentrated to at least 1 mg/ml, aliquoted, flash-frozen in liquid nitrogen, and stored at −80°C for future use.
3.4. Cloning and Purification of SUMO Substrates
1. Primers are designed to clone the C-terminal tetramerization domain of human p53 (amino acids 320–393) as a C-terminal fusion to Smt3. The PCR-amplified ORF is cloned using pSMT3 (see Note 1).
3.4.1. Cloning and Purification of the Human p53 C-Terminal Domain
2. Transform the plasmid DNA into E. coli BL21 (DE3) RIL Codon Plus cells.
SUMO Conjugation Assays
175
3. Grow a 10 l culture by fermentation at 37°C to an A600 of 3.0, induce protein expression by addition of IPTG to a final concentration of 1 mM, and grow the culture for an additional 3 h at 30°C. 4. Process the cell pellets as described previously (see Sect. 3.1.). 5. Apply the cleared lysate is applied to Ni-NTA resin pre-equilibrated with Buffer A. Elute the protein using Buffer B. 6. Fractions are analyzed by SDS-PAGE and those containing His6-Smt3-p53 are pooled and equilibrated by dialysis or desalting in Buffer G in the presence of Ulp1 protease (1:1000 w/w) to liberate p53 from the His6-Smt3 tag. Dialysis and cleavage can be carried out simultaneously by overnight incubation at 4°C or after desalting by incubation at room temperature for 3–4 h. The extent of cleavage should be assessed by SDS-PAGE before proceeding to Step 7. 7. Apply the sample to cation exchange resin (Mono-S) and elute the protein using a gradient from Buffer G to 50% Buffer E over 20 column volumes. Human p53 elutes at ∼325 mM NaCl. The His6-Smt3 tag does not interact with MonoS resin. 8. Fractions containing p53 are applied to a gel filtration column (Superdex-75) equilibrated in Buffer F. The C-terminal p53 domain elutes as a tetramer with an apparent molecular weight of ∼32 kDa. Fraction containing p53 are pooled, desalted into Buffer D, concentrated to ∼6 mg/ml, aliquoted, frozen in liquid nitrogen, and stored at −80°C. 3.4.2. Cloning and Purification of Yeast PCNA(K127G)
1. Primers are designed to amplify wild-type PCNA from yeast genomic DNA using Pfu turbo polymerase. Primers include NdeI and XhoI restriction sites at the 5′ or 3′ ends of the gene, respectively. 2. PCR products are digested with appropriate restriction enzymes and ligated into pET-21b to encode yeast PCNA without any affinity tag. 3. A non-consensus lysine residue (K164) is the primary site for Siz1-dependent SUMO modification of PCNA (21, 22). However, in a Ubc9-dependent reaction under some in vitro and in vivo conditions, a minor SUMO-modified product accumulates on a lysine residue within a SUMO consensus site (K127). To simplify kinetic analysis during E3-mediated conjugation to K164, this side chain is mutated to glycine, a residue observed in other PCNA family members. The K127G mutation is introduced into the PCNA open reading frame by site-directed mutagenesis. 4. Transform the plasmid carrying PCNA into E. coli BL21 (DE3) RIL Codon Plus.
176
Yunus and Lima
5. Grow a 10 L culture by fermentation at 37°C to an A600 of 3.0, add IPTG to a final concentration of 1 mM, and grow the culture at 30°C for an additional 3 h. 6. Process the cells as described above (see Sect. 3.1). 7. Cell pellets for protein purification should be processed in batches corresponding to approximately 4 l of bacterial culture. 8. PCNA is purified from the soluble fraction by slow addition of solid ammonium sulfate to the supernatant with stirring to 45% saturation. Remove the precipitated material by centrifugation at 7500× g for 30 min. Retrieve the supernatant and carry out a second ammonium sulfate precipitation to 70% saturation. The precipitated material contains yeast PCNA as a major species (confirm by SDS-PAGE analysis). Resuspend this fraction in Buffer F and dialyze overnight at 4°C against the same buffer. 9. Apply this mixture to a gel filtration column (Superdex-200) equilibrated in Buffer F. Fractions containing yeast PCNA are analyzed by SDS-PAGE, pooled, and dialyzed against Buffer C. 10. Apply this mixture to an anion-exchange resin (Mono-Q) and elute PCNA using a gradient from Buffer C to 50% Buffer E over 20 column volumes. PCNA elutes at ∼300 mM NaCl. Peak fractions containing PCNA are analyzed by SDSPAGE, pooled, concentrated to ∼3 mg/ml as estimated by the BCA protein assay, flash-frozen in liquid nitrogen, and stored at −80°C. 3.5. Cloning and Purification of SUMO E3 Ligases 3.5.1. Cloning and Purification of RanBP2/ Nup358 IR1
1. Nup358/RanBP2 (amino acids 2632–2695) is cloned into the TOPO-SMT3 vector (19). This Nup358/RanBP2 fragment is named IR1*. 2. Transform the plasmid into E. coli strain BL21 (DE3) RIL Codon Plus. 3. Grow a 2 l culture in LB medium at 37°C to an A600 of 1.0 prior to addition of IPTG to a final concentration of 1 mM. The culture is then incubated at 30°C for an additional 3–4 h. 4. His6-Smt3-Nup358 is purified from cell lysate by applying the cleared lysate to Ni-NTA resin in Buffer A. The protein is eluted from the resin in Buffer B. 5. Apply the sample to a gel-filtration column (Superdex-75) equilibrated in Buffer F. Fractions containing His6-Smt3Nup358 are analyzed by SDS-PAGE, pooled, and the His6-Smt3 tag is liberated from IR1* by incubating His6Smt3-Nup358 with Ulp1 at a 1000:1 (w/w) ratio of His6tagged protein to protease.
SUMO Conjugation Assays
177
6. Denature the sample in 6 M guanidine hydrochloride and pass through Ni-NTA resin to remove the His6-Smt3 tag. Nup358 IR1* is collected in the flow-through fractions. 7. Remove the guanidine hydrochloride from the sample by applying the mixture to a desalting column equilibrated with Buffer F, in which BME is substituted with 2 mM DTT. The sample is then applied to gel filtration (Superdex-75) in Buffer F. 8. Fractions containing Nup358 IR1* are analyzed by SDSPAGE, pooled, concentrated to 5–10 mg/ml, flash-frozen in liquid nitrogen, and stored at −80°C. 3.5.2. Cloning and Purification of the Yeast E3 Ligase Siz1
1. A minimal Siz1 fragment encoding E3 ligase activity (amino acids 172–443) is amplified by PCR from yeast genomic DNA and cloned using the directional TOPO-SMT3 vector. 2. Transform plasmids into E. coli BL21 (DE3) RIL Codon Plus. 3. Grow a 10 l culture in LB medium by fermentation at 37°C to an A600 of 3.0 before inducing protein expression at 30°C for 3–4 h with the addition IPTG to a final concentration of 1 mM. 4. Process the cells for storage and sonication as described before (see Sect. 3.1). 5. Apply the lysate to Ni-NTA resin in Buffer A and elute His6Smt3-Siz1 from the column using Buffer B. 6. Fractions are analyzed by SDS-PAGE, and those containing His6-Smt3-Siz1 are pooled and dialyzed against Buffer F. Add Ulp1 protease to the mixture at a 1000:1 (w:w) ratio of protein to Ulp1 and incubate overnight at 4°C. 7. To remove His6-Smt3, the mixture is passed through fresh Ni-NTA resin in Buffer A. Siz1 is recovered in the flowthrough fractions. 8. Fractions containing Siz1 are pooled and applied to a gel filtration column (Superdex-200) equilibrated in Buffer F. Siz1 migrates as a mono-disperse peak with an apparent molecular weight of ∼35 kDa. Fractions are analyzed by SDS-PAGE, and those containing Siz1 are pooled and dialyzed against Buffer C. 9. Fractions containing Siz1 are applied to cation exchange resin (Mono-S) in Buffer C and eluted by applying a gradient from Buffer C to 50% Buffer E. Siz1 elutes at ∼125 mM NaCl. 10. Fractions are analyzed by SDS-PAGE, and those containing Siz1 are pooled, concentrated to 15 mg/ml, aliquoted, flash-frozen in liquid nitrogen, and stored at −80°C.
178
Yunus and Lima
3.6. Assays for Substrate Conjugation Under Single Turnover Conditions
3.6.1. Preparation of Ubc9∼SUMO Thioester and Single Turnover Conjugation Assay for the Human SUMO Conjugation System 3.6.1.1. Assay Utilizing Native SUMO-1
SUMO can be conjugated to many substrates using only E1 and E2 (Ubc9) in the presence of SUMO, the substrate, magnesium, and ATP. These assays contain a complex mixture of reagents, and each reactant must interact with at least one or more of the other reactants. As such, extraction of relevant kinetic parameters during substrate conjugation remains difficult under conditions of multiple turnover. To address this issue, we have single employed turnover assays to facilitate analysis of SUMO conjugation. This is achieved by isolating Ubc9∼SUMO (where ‘∼’ indicates a thioester adduct) in the absence of E3 and substrate, using only E1, E2, SUMO and ATP. In this section we describe the methods to conduct single turnover assays using Ubc9∼SUMO in conjunction with substrate titrations in the presence or absence of an E3 ligase. We will also describe methods to determine pK values during conjugation. In addition, we will describe methodologies to extract kinetic parameters from these assays. 1. Formation of the Ubc9∼SUMO adduct is carried out in a reaction Buffer I with 1 µM E1, 10 µM mature SUMO-1 and 5 µM Ubc9. 2. Initiate the reaction by addition of 10 µM ATP and incubate for 20 min at 37°C. 3. Quench the reaction by removing magnesium and excess ATP by applying the mixture to a desalting column equilibrated with Buffer II. The lower pH of Buffer II increases the stability of Ubc9∼SUMO for long term storage at −80°C. 4. Single turnover reactions are conducted by adding 0.6 µl of Ubc9∼SUMO to reaction Buffer III with substrate (reaction volume: 50 µl). This usually results in a final Ubc9∼SUMO concentration that ranges between 5–20 nM. In this example, we utilize the human p53 C-terminal domain (see above) at concentrations ranging from 2 µM to 94 µM at 37 or 4°C. These assays can also be carried out in the presence of IR1*, a SUMO E3 ligase, at a concentration of 60 nM. Reactions containing E3 ligase are carried out 4°C because reactions are too fast to reproducibly measure rates at higher temperatures. 5. Remove samples at various time points (at least three time points per substrate concentration) and quench by addition of Buffer IV. Flash-freeze in liquid nitrogen and store at −80°C. 6. Separate the reaction products by non-reducing SDS-PAGE in MES buffer at a constant voltage of 180 V for 60 min and subsequently blot the gels to PVDF membranes (see Note 4). The semi-dry transfer is conducted at 20 V for 40 min at room-temperature. 7. Block the PVDF membranes for 1 hour at room temperature or overnight at 4°C in Blocking buffer.
SUMO Conjugation Assays
179
8. Probe the PVDF membranes with a primary antibody against human SUMO-1 in Blocking buffer at room temperature for 1 h or overnight at 4°C. 9. Wash the PVDF membranes for 30 min with three changes of Wash buffer to remove excess unbound primary antibody. 10. Incubate the PVDF membranes with secondary antibody for 1 h at room temperature. Excess secondary antibody is removed by rinsing three times in Wash buffer. 11. Incubate the PVDF membranes with ECL-Plus reagent and capture images using a LAS-3000 chemiluminescence detector (Fig. 11.1A) (see Note 5). 12. Images are processed and data quantified using either MultiGauge v2.02 or ImageGauge v4.0. 13. Raw data is processed with EXCEL to extract the rates of reaction at various substrate concentrations using linear regression analysis (Fig. 11.1B). 14. Initial rate values obtained at different substrate concentrations are subsequently used to derive the maximal rate and apparent dissociation constant by fitting the data nonlinearly to a two parameter rectangular hyperbolic function (Fig. 11.1C) (see Note 6). The hyperbolic function used to fit the data is of the form v = Vmax [S]/(Kd + [S]), where Vmax = k2[E]t, k2 is the rate constant, [E]t is the E2∼SUMO thioester concentration, Kd is the apparent dissociation constant, and [S] is the substrate concentration. The apparent rate constant k2 can be calculated by dividing Vmax by [E]t. 15. The concentration of E2∼SUMO ([E]t) is determined by quantifying the fraction of the E2∼SUMO with respect to known input SUMO-1 concentrations. In conjugation reactions, the final concentration of E2∼SUMO can range between 5–20 nM depending on the assay conditions and date of preparation. 3.6.1.2. pH Titration Analysis of Ubc9∼SUMO with and without E3
1. Reactions are carried out with human p53 as the substrate at 4°C as reactions at higher pH conditions are too fast to be reproducibly measured at 22 or 37°C. 2. Ubc9∼SUMO thioester is generated as described in Sect. 3.6.1.1. 3. Single turnover assays at different pH values are conducted as described in Sect. 3.6.1.1, but in Buffer VII to facilitate analysis across a broad pH range. 4. Use human p53 at 94 µM in the absence of IR1* and at 1 µM in the presence of IR1*. Reactions are analyzed and processed as described in Sect. 3.6.1.1 (Fig. 11.2A and B). 5. The pH titration data are fit to a sigmoidal function of the form LH = (LHA [H+] + LA– K)/(K + [H+]) (where LH is
180
Yunus and Lima
Fig. 11.1. Ubc9 mediated SUMO conjugation to human p53. (A) Time course of a single turnover assay for SUMO-1 transfer from the E2∼SUMO thioester to the C-terminal tetramerization domain of human p53 at various p53 concentrations after separation by SDS-PAGE and detection with an anti-SUMO-1 antibody. (B) Data in A depicted graphically to calculate the reaction rates at various p53 concentrations by linear regression analysis. (C) Reaction rates (Y-axis) plotted against various p53 concentrations (X-axis) and data fit to a rectangular hyperbola of the form y = ax/(b + x). The data points represent the mean of three independent experiments and error bars denote one standard deviation.
SUMO Conjugation Assays
181
Fig. 11.2. Titration of pH and analysis of Ubc9-mediated SUMO conjugation to human p53. (A) Time course for SUMO-1 conjugation to p53 at 94 µM under single turnover conditions at various pH values at 4°C after separation by SDS-PAGE and detection with an anti-SUMO-1 antibody. (B) Data in A depicted graphically to calculate the reaction rates at various pH values. The reaction rates are calculated by linear regression analysis. (C) Initial reaction rates (Y-axis) plotted as a function of pH and data fit to a sigmoidal function (see text for details). The vertical lines mark the pH at half-maximal activity (pK of the titratable group). The data points represent the mean of two independent experimental trials and error bars denote one standard deviation.
182
Yunus and Lima
the rate of the reaction at a particular pH; LHA and LA− are constants that denote the contribution of the acid or base form of the reactive group towards rate of the reaction; K is the equilibrium constant of dissociation of an acid; and LHA = 0 if only the basic form of the species contributes to the reaction rate). The pK of the titratable group is estimated by non-linear curve fitting (8, 23). 3.6.1.3. Assays for Conjugation Using Alexa Fluor 488-labeled SUMO-1
1. Ubc9∼SUMO thioester is generated at 37°C in Buffer V with 0.27 µM E1, 12.5 µM Alexa Fluor 488-labeled SUMO-1 and 33 µM Ubc9. The reactions are initiated by addition of ATP to a final concentration of 5 mM. 2. Quench the reaction by applying the reaction to a desalting column equilibrated with Buffer II to remove excess magnesium and ATP. The mix is diluted 3.3 fold to yield a final SUMO concentration of 3.8 µM and a final Ubc9 concentration of 10 µM, flash-frozen in liquid nitrogen, and stored at −80°C until further use. 3. Single turnover SUMO conjugation to human p53 in the presence or absence of an SUMO E3 ligase IR1* is initiated by adding 0.6 µl of the E2∼SUMO to 50 µl reaction Buffer VI, and human p53 at concentrations ranging from 512 µM to 0.25 µM. E3 ligase reactions contain IR1* at 100 nM. 4. Remove samples at different time points (at least three time points per concentration) and quench by addition of Buffer IV. Samples are flash-frozen in liquid nitrogen and stored at −80°C until analysis. 5. Resolve reactants by non-reducing SDS-PAGE and immediately image to mitigate diffusion in the gel using a FLA-5000. Alexa 488 fluorophore is excited with blue laser (473 nm) and the fluorescent signal detected through a FITC filter. 6. Image and data processing are conducted in a manner similar to that described for analysis of chemiluminescence in Sect. 3.6.1.1.
3.6.2. Preparation of Ubc9∼SUMO and Single Turnover Conjugation Assays for the Yeast SUMO Conjugation System
1. Yeast Ubc9∼Smt3 thioester formation is conducted as described above (see Sect. 3.6.1.3.). 2. The reaction mix includes Buffer V with 0.27 µM yeast E1, 12.5 µM Alexa Fluor 488-labeled Smt3(K11C) and 33 µM yeast Ubc9 containing the K153R point mutation to suppress auto-conjugation of SUMO to the E2 at K153. 3. Initiate the reactions by addition of ATP to a final concentration of 5 mM. 4. Quench the reactions by applying them to a desalting column equilibrated with Buffer II to remove excess magnesium and
SUMO Conjugation Assays
183
Fig. 11.3. Siz1-dependent Smt3-Alexa Fluor 488 conjugation to yeast PCNA. (A) Time course of a single turnover assay for Smt3 transfer from the E2∼Smt3 thioester to the yeast PCNA mutant K127G at various PCNA concentrations after separation by SDS-PAGE and detection of the fluorescent signal. (B) Data in A depicted graphically to calculate the reactions rates at various substrate concentrations using linear regression analysis. (C) Initial reaction rates (Y-axis) plotted against various yeast PCNA concentration and data fit to a rectangular hyperbola of the form y = ax/(b + x). The data points represent the mean of three independent experiments and error bars denote one standard deviation.
184
Yunus and Lima
ATP. The mix is then diluted 3.3-fold to yield a final Smt3 concentration of 3.8 µM and a final Ubc9 concentration of 10 µM, flash-frozen in liquid nitrogen, and stored at −80°C for future use. 5. Single turnover conjugation of PCNA(K127G) in the presence of Siz1(172–443) are initiated by addition of 0.6 µl of the E2-Smt3 thioester reaction to a 50 µl reaction Buffer VI with PCNA at concentrations ranging from 40 to 2.5 µM. 6. Aliquots are removed at time points ranging from seconds to minutes (at least two time points per concentration) and quenched by addition of Buffer IV. Samples are flash-frozen in liquid nitrogen. 7. Reaction products are resolved, imaged, and processed as described in Sect. 3.6.1.3 (Fig. 11.3).
4. Notes 1. The pSMT3 vectors are derived from pET-28b and include an N-terminal hexahistidine fusion to S. cerevisiae Smt3 (20). pSMT3 enables cloning of the gene of interest into the MCS, usually using the BamHI site to fuse the protein of interest (POI) in-frame with the N-terminal His6-Smt3 polypeptide to generate the His6-Smt3-Gly-Gly-Ser-POI fusion polypeptide. The Ulp1 protease can then be used to cleave His6-Smt3 from the protein of interest C-terminal to the Smt3 di-glycine sequence to liberate the POI with a non-native N-terminal serine residue. The TOPO-SMT3 vector is based on pSMT3, but custom TOPO-adapted to facilitate directional flap ligation (TOPO-adapted by Invitrogen). N-terminal Smt3 fusions to proteins can enhance expression and solubility for difficult to express proteins. 2. To ensure reproducibility and to protect the columns from undue wear and tear, all chromatographic steps are performed using filtered buffer solutions prepared from MilliQ (Millipore) water or the equivalent. All buffers should be degassed under vacuum for at least 1 hour prior to use. 3. All protein purification are conducted at 4°C to avoid degradation and/or aggregation. All protein preparations are passed through a 0.2 µm filter prior to application to chromatography media. All proteins are flash-frozen in liquid nitrogen prior to storage at −80°C. 4. While immunoblotting and detection has provided adequate signal to quantify protein bands, uneven transfer of protein
SUMO Conjugation Assays
185
to PVDF membranes can result in substantive artifacts. Duplicate gels and transfer steps are recommended for each experiment to ensure reproducibility. 5. Integration of signal requires proper background selection. 6. For the extraction of the kinetic parameters, it is important to obtain velocities at substrate concentrations that are at least ten-fold higher than the binding constant to ensure that the reaction is approaching saturation. 7. SUMO conjugating enzymes are prone to oxidation and damage. After preparation, enzymes should be aliquoted in small volumes to avoid repeated freeze-thaw cycles.
References 1. Hershko, A., and Ciechanover, A. (1998) The ubiquitin system. Annu Rev Biochem 67, 425–479. 2. Hochstrasser, M. (1996) Ubiquitin-dependent protein degradation. Annu Rev Genet 30, 405–439. 3. Johnson, E. S. (2004) Protein modification by SUMO. Annu Rev Biochem 73, 355–382. 4. Laney, J. D., and Hochstrasser, M. (1999) Substrate targeting in the ubiquitin system. Cell 97, 427–430. 5. Melchior, F. (2000) SUMO–nonclassical ubiquitin. Annu Rev Cell Dev Biol 16, 591–626. 6. Muller, S., Hoege, C., Pyrowolakis, G., and Jentsch, S. (2001) SUMO, ubiquitin’s mysterious cousin. Nat Rev Mol Cell Biol 2, 202–210. 7. Bernier-Villamor, V., Sampson, D. A., Matunis, M. J., and Lima, C. D. (2002) Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108, 345–356. 8. Yunus, A. A., and Lima, C. D. (2006) Lysine activation and functional analysis of E2-mediated conjugation in the SUMO pathway. Nat Struct Mol Biol 13, 491–499. 9. Cheng, C. H., Lo, Y. H., Liang, S. S., Ti, S. C., Lin, F. M., Yeh, C. H., Huang, H. Y., and Wang, T. F. (2006) SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae. Genes Dev 20, 2067–2081. 10. Hochstrasser, M. (2001) SP-RING for SUMO: new functions bloom for a ubiquitin-like protein. Cell 107, 5–8.
11. Johnson, E. S., and Gupta, A. A. (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106, 735–744. 12. Kahyo, T., Nishida, T., and Yasuda, H. (2001) Involvement of PIAS1 in the sumoylation of tumor suppressor p53. Mol Cell 8, 713–718. 13. Potts, P. R., and Yu, H. (2005) Human MMS21/NSE2 is a SUMO ligase required for DNA repair. Mol Cell Biol 25, 7021–7032. 14. Schmidt, D., and Muller, S. (2003) PIAS/ SUMO: new partners in transcriptional regulation. Cell Mol Life Sci 60, 2561–2574. 15. Takahashi, Y., Toh-e, A., and Kikuchi, Y. (2001) A novel factor required for the SUMO1/Smt3 conjugation of yeast septins. Gene 275, 223–231. 16. Zhao, X., and Blobel, G. (2005) A SUMO ligase is part of a nuclear multiprotein complex that affects DNA repair and chromosomal organization. Proc Natl Acad Sci U S A 102, 4777–4782. 17. Pichler, A., Gast, A., Seeler, J. S., Dejean, A., and Melchior, F. (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108, 109–120. 18. Pichler, A., Knipscheer, P., Saitoh, H., Sixma, T. K., and Melchior, F. (2004) The RanBP2 SUMO E3 ligase is neither HECT- nor RINGtype. Nat Struct Mol Biol 11, 984–991. 19. Reverter, D., and Lima, C. D. (2005) Insights into E3 ligase activity revealed by a SUMO-RanGAP1-Ubc9-Nup358 complex. Nature 435, 687–692.
186
Yunus and Lima
20. Mossessova, E., and Lima, C. D. (2000) Ulp1-SUMO crystal structure and genetic analysis reveal conserved interactions and a regulatory element essential for cell growth in yeast. Mol Cell 5, 865–876. 21. Hoege, C., Pfander, B., Moldovan, G. L., Pyrowolakis, G., and Jentsch, S. (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419, 135–141.
22. Pfander, B., Moldovan, G. L., Sacher, M., Hoege, C., and Jentsch, S. (2005) SUMOmodified PCNA recruits Srs2 to prevent recombination during S phase. Nature 436, 428–433. 23. Fersht, A. (2000) The pH dependence of enzyme catalysis. in Structure and Mechanism in Protein Science, W.H Freeman and Company, New York.
Chapter 12 Performing In Vitro Sumoylation Reactions Using Recombinant Enzymes Andreas Werner, Marie-Christine Moutty, Ulrike Möller, and Frauke Melchior Abstract Sumoylation of proteins in vitro has evolved as an indispensable tool for the functional analysis of this post-translational modification. In this article we present detailed protocols for bacterial production of mammalian proteins necessary to perform in vitro sumoylation reactions, namely the E1 activating enzyme Aos1/Uba2 (SAE1/SAE2), the E2 conjugating enzyme Ubc9, SUMO-1 (identical protocols can be used for SUMO-2/3), and the catalytic domain of the E3 ligase RanBP2/Nup358. Two alternative procedures are described for the E1 enzyme, one depending on co-expression of His-Aos1 and untagged Uba2, and a second protocol for separate expression of His-Aos1 and Uba2-His and subsequent reconstitution of the active dimer. Two example conditions for in vitro sumoylation of RanGAP1 and Sp100 in the absence or presence of the SUMO E3 ligase RanBP2, respectively, are provided. Both protocols can be adapted easily to test in vitro conjugation of other target proteins and/or E3 ligases. Key words: SUMO, E2 conjugating enzyme, Ubc9, SUMO E1 activating enzyme, Aos1/Uba2, RanBP2, SUMO E3 ligase, in vitro sumoylation assay.
1. Introduction Sumoylation (1) has been reconstituted in vitro for many known targets using recombinant or purified SUMO enzymes and recombinant or in vitro translated targets. Exclusive use of bacterially expressed targets and enzymes has the obvious advantage that SUMO isopeptidases, E3 ligases and competing substrates present in eukaryotic extracts (including reticulocyte lysates) can be avoided.
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
187
188
Werner et al.
Different protocols for recombinant expression and purification of SUMO-1, Ubc9 and E1 enzyme can be found in the literature (2–4). Most of these make use of His- or GST-tagging to facilitate purification, and some remove the tags prior to use. As tags may impair specific activity of the enzymes or even interfere with the enzymatic reaction, they should be avoided, removed or kept to a minimal size whenever possible - unless proven to be without negative consequence. To give a recent example for problems caused by tags, the enzyme E1-L2 activates ubiquitin and FAT10, but fails to form a thioester with GST-tagged FAT10 (5). In this article we present detailed protocols for purifying recombinant enzymes necessary to perform an in vitro sumoylation, namely the SUMO E1 enzyme, untagged Ubc9, untagged SUMO-1 and a fragment of RanBP2 that was shown to have SUMO E3 ligase activity (6). For the SUMO E1 enzyme we describe two alternative protocols resulting in equally active protein complexes (His-Aos/Uba2 and His-Aos1/Uba2-His, see Fig. 12.1). Furthermore, we provide two example protocols
Fig. 12.1. Comparison of SUMO E1 enzymes purified as His-Aos1/Uba2 dimer or reconstituted from His-Aos1 and Uba2His. (A) Coomassie-stained SDS gel of 0.6 µg SUMO E1 enzyme purified as His-Aos1/Uba2 dimer or reconstituted from His-Aos1 and Uba2-His. (B) Activity of E1 enzyme purified as His-Aos1/Uba2 dimer or reconstituted from monomeric HisAos1 and Uba2-His in an in vitro sumoylation assay for human RanGAP1. RanGAP1 (79 nM) was incubated with 225 nM SUMO-1, 27 nM Ubc9 and 1.6 nM E1 for different periods, stopped by addition of SDS sample buffer, and visualized by immunoblotting using an anti RanGAP1 antibody. (C) Activity of 86 pM (squares), 1.4 nM (triangles) and 22 nM (points) E1 enzyme purified as His-Aos1/Uba2 dimer (black curves) or reconstituted from monomeric His-Aos1 and Uba2-His (grey curves) in an assay measuring SUMO conjugation to RanGAP1 by FRET (see accompanying chapter by Stankovic-Valentin et al.).
In Vitro Sumoylation Reactions
189
for in vitro sumoylation assays in the absence or presence of the SUMO E3 ligase fragment GST-RanBP2∆FG (6). Sumoylation results in a ∼20 kDa mobility shift of the target and can hence be visualized by Coomassie staining or immunoblotting (analysis by FRET is described in the accompanying chapter by StankovicValentin et al.). The protocols described here are suitable for the analysis of target proteins that can be purified in quantities of 10 to 100 µg, and can be adapted easily to include other E3 ligases such as PIAS proteins (see for example Ref. 7).
2. Materials 2.1. Purification of Enzymes
1. LB medium (Luria/Miller; Carl Roth GmbH). 2. MgCl2: 1 M, autoclave before use. 3. 20% glucose: sterilize by filtration and store at −20°C. 4. Ampicillin: 100 mg/ml, sterilize by filtration and store in 1 ml aliquots at −20°C. 5. Kanamycin: 60 mg/ml, sterilize by filtration and store in 1 ml aliquots at −20°C. 6. Isopropyl-β-D-thiogalactoside (IPTG): 1 M, filter-sterilize and store in aliquots at −20°C. 7. DTT (1000X stock solution): 1 M, stored in aliquots at −20°C. 8. Aprotinin (1000X stock solution): 1 mg/ml in 20 mM Hepes pH 7.4, store in aliquots at −20°C. 9. Leupeptin/Pepstatin (1000X stock solution): 1 mg/ml each in DMSO, store in aliquots at −20°C. 10. Transport buffer (TB): 20 mM HEPES, pH 7.3, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, 1 mM DTT, 1 µg/ml each of leupeptin, pepstatin and aprotinin. 11. Chromatography columns: preparative S200 and S75 gel filtration columns, 1 ml Mono Q column. 12. Centrifugal concentrators (30 and 5 kDa cut-off).
2.1.1. Purification of the SUMO E1 Enzyme
1. Nickel beads (e.g., Probond, Invitrogen). 2. E1 lysis buffer: 50 mM Na-phosphate, pH 8.0, 300 mM NaCl, 10 mM imidazole. 3. E1 wash buffer: 50 mM Na-phosphate, pH 8.0, 300 mM NaCl, 20 mM imidazole, 1 mM β-mercaptoethanol, 1 µg/ ml each of aprotinin, leupeptin and pepstatin.
190
Werner et al.
4. E1 elution buffer: 50 mM Na-phosphate pH 8.0, 300 mM NaCl, 250 mM imidazole, 1 mM β-mercaptoethanol, 1 µg/ ml each of aprotinin, leupeptin and pepstatin. 5. S200 buffer: 50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM DTT, 1 µg/ml each of aprotinin, leupeptin and pepstatin. 2.1.2. Purification of the E2 Conjugating Enzyme Ubc9
1. Ubc9 lysis buffer: 50 mM Na-phosphate, pH 6.5, 50 mM NaCl. 2. SP-Sepharose (Fast Flow, Sigma-Aldrich). 3. Ubc9 elution buffer: 50 mM Na-phosphate, pH 6.5, 300 mM NaCl, 1 mM DTT, 1 µg/ml each of aprotinin, leupeptin and pepstatin.
2.1.3. Purification of SUMO
1. SUMO lysis buffer: 50 mM Tris-HCl, pH 8.0, 50 mM NaCl. 2. Q-Sepharose (Fast Flow, Sigma-Aldrich).
2.1.4. Purification of RanBP2∆FG
1. RanBP2 lysis buffer: 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA. 2. RanBP2 wash buffer: 50 mM Tris-HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 µg/ml each of aprotinin, leupeptin and pepstatin. 3. Glutathione: 1 M in 50 mM Tris-HCl, pH 8.0, store at −20°C.
2.1.5. Expression Constructs
All these plasmids are available from the Melchior lab upon request. 1. pET28a-Aos1: the coding region for human Aos1 was obtained by PCR from clone DKFZp434J0913 using the primers GGCTAGCATGGTGGAGAAGGAGGAGGCTGG and GGGATCCCGGGCCAATGACTTCAGTTTTCC and cloned into pET28a via NheI/BamHI. 2. pET11d-Uba2: the coding region was obtained by PCR from clone DKFZp434O1810 using the primers GGCTA GCGCCATGGCACTGTCGCGGGGGCTGCCCC and GAGATCTGGCATTTCTGTTCAATCTAATGC and ligated into the NcoI/BamHI sites of pET11d. 3. pET28b-Uba2: the coding region was obtained by PCR from pET11d-Uba2 using the primers AACCATGGGGA GGCACTGTCGCGGGGGCTG and TGCTAGCTCCAT CTAATGCTATGACATCATCAAG and ligated into the NcoI/NheI sites of pET28b. 4. pET23a-Ubc9: the coding region was obtained by PCR from EST clone No. IMAGp998A061122 using the primers CATATGTCGGGGATCGCCCTCAGCCGC and
In Vitro Sumoylation Reactions
191
GGATCCTTATGAGGGGGCAAACTTCTTCGC and ligated into the NdeI/BamHI sites of pET23a. 5. pET11a-SUMO-1: the coding region was obtained by PCR using the primers CGGCTTAAATGAATCCTAAC CCCCCGTTTG and GGTTCCGCGTGGACATATGTCT GACCAGG and cloned into the NdeI/BamHI sites of pET11a. 6. pGEX-3X-RanBP2∆FG: the coding region was obtained by PCR from the full length RanBP2 cDNA using the primers CCGCGGATCCCGTTGAAAAGTAACAATA GTGAAACTAGTTC and CCGGAATTCCGAACTATCTTGCTTTCCCCTTGG-CTTG and ligated into pGEX-3X via BamHI/EcoRI. 2.2. In vitro Sumoylation Assay
1. Sumoylation assay buffer (SAB): 20 mM HEPES pH 7.3, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, 1 mM DTT, 0.05% Tween 20, 0.2 mg/ ml ovalbumin, 1 µg/ml each of leupeptin, pepstatin and aprotinin. 2. ATP: 100 mM in 20 mM HEPES, pH 7.4, 100 mM magnesium acetate (pH adjusted with NaOH). 3. Enzyme stock solutions in small aliquots (E1, Ubc9, SUMO, RanBP2∆FG, target). 4. SDS sample buffer (5X): 250 mM Tris-HCl, pH 6.8, 500 mM DTT, 10% SDS, 0.5% bromophenol blue, 50% glycerol.
3. Methods 3.1. Purification of Enzymes
Bacterial growth is performed while shaking at 180 rpm. Unless stated otherwise, all buffers are ice cold and procedures are carried out on ice or at 4°C. Protease inhibitors and DTT are added to the buffers directly before use.
3.1.1. Purification of SUMO E1 Enzyme
The protocol in Sect. 3.1.1.1 describes the purification of the dimeric E1 complex after coexpression of His-tagged Aos1 and untagged Uba2 in bacteria. Recently, we developed an alternative protocol, which involves separate expression and purification of N-terminal His-tagged Aos1 and C-terminal His-tagged Uba2 and subsequent reconstitution of the dimeric complex (see Sect. 3.1.1.2). This procedure results in a SUMO E1 enzyme with identical activity to the one purified by co-expression (Fig. 12.1), but has the advantage of higher yields, simplified procedures and the possibility to combine different variants.
192
Werner et al.
3.1.1.1. Purification as Dimeric His-Aos1/Uba2 Complex
1. Transform pET28a-Aos1 and pET11d-Uba2 simultaneously into E. coli strain BL21(DE3) and directly inoculate into 500 ml of LB supplemented with 50 µg/ml ampicillin, 30 µg/ml kanamycin, 1 mM MgCl2 and 0.1% glucose (due to poor growth of the bacteria, we omit selection for single colonies on plates). 2. Harvest bacteria by centrifugation after growth for 18 h at 37°C, resuspend them in 2 l of fresh medium and induce protein expression at an OD600 of 0.6 by adding 1 mM IPTG. Let the cells grow for further 6 h at 25°C. 3. Harvest cells by centrifugation (5,000–6,000g, 10 min), resuspend them in 50 ml E1 lysis buffer and store at −80°C until use. 4. Thaw cells, add protease inhibitors and 1 mM β-mercaptoethanol, lyse cells by two passages over an emulsion flex and centrifuge at 100,000g for 1 h at 4°C. 5. Apply the supernatant to 6 ml nickel beads equilibrated in lysis buffer containing protease inhibitors and 1 mM β-mercaptoethanol and incubate with slow rotation for 1 h at 4°C. 6. Transfer beads into column and wash extensively with cold wash buffer until no more protein is detected in the flowthrough (test using Bradford solution or by spotting on nitrocellulose membrane with subsequent Ponceau staining). 7. Elute protein with at least 3 column volumes of elution buffer. Collect 2 ml fractions. 8. Combine protein-containing fractions (detected as in Step 6) and concentrate to 2–4 ml using a centrifugal device (30 kDa cut-off). 9. Centrifuge the sample (16,000g, 15 min, 4°C, in table top centrifuge) or filter through a 0.2 µm low protein binding non-pyrogenic filter to remove small amounts of precipitated protein. 10. Load onto a preparative S200 gel filtration column equilibrated in S200 buffer. Run overnight, collect 5 ml fractions. 11. Analyze 10 µl of the fractions on Coomassie stained 8% SDS gel and combine fractions that contain both Aos1 (migrates at 40 kDa) and Uba2 (migrates at 90 kDa) (see Note 1). 12. Apply the sample onto a 1 ml Mono Q column equilibrated in S200 buffer and elute using a gradient (20 column volumes) from 50 to 500 mM NaCl in S200 buffer. Collect 0.5 ml fractions. 13. Analyze 3–5 µl of the fractions on a Coomassie-stained 8% SDS gel and pool fractions that contain equimolar amounts of Aos1 and Uba2 (usually 2–3 fractions).
In Vitro Sumoylation Reactions
193
14. Dialyze against TB, flash-freeze in small aliquots (2–10 µl) in liquid nitrogen and store at −80°C. Using this protocol 0.5–1.5 mg SUMO E1 can be purified per liter of E. coli culture. As the enzyme loses some activity upon freeze-thawing, for reproducibility each aliquot should be used only once. Dilutions are routinely done in SAB, which contains 0.05% Tween20 and 0.2 mg/ml ovalbumin. 3.1.1.2. Purification of Monomeric His-Aos1 and Uba2-His and Subsequent Reconstitution
1. Transform pET28a-Aos1 and pET28b-Uba2 separately into E. coli strain BL21(DE3) and directly inoculate overnight cultures in 500 ml LB supplemented with 30 µg/ml kanamycin, 1 mM MgCl2 and 0.1% glucose for each of the two proteins. 2. For further purification of monomeric His-Aos1 and monomeric Uba2-His follow the procedure described in Sect. 3.1.1.1 (Steps 2–10) with the exception that TB is used for the S200 gel filtration step (see Note 2). The monomeric proteins obtained after the S200 run are very pure and do not require further purification on a Mono Q column. 3. Concentrate the proteins in centrifugal devices to 1–3 mg/ ml, flash-freeze them in liquid nitrogen and store them at −80°C. 4. To reconstitute the dimeric SUMO E1, combine His-Aos1 and Uba2-His in equimolar amounts on ice for 1–2 h and run the sample over a S200 gel filtration column in TB as described above (Sect. 3.1.1.1, Step 10) to separate the complex from excess of one subunit or partially unfolded Uba2. 5. Using this protocol 1.5–3 mg Uba2-His and 5–7 mg HisAos1 can be purified per liter of E. coli culture.
3.1.2. Purification of the E2 Conjugating Enzyme Ubc9
1. Transform the plasmid pET23a-Ubc9 in BL21(DE3), inoculate 20 ml LB containing 100 µg/ml ampicillin, 1 mM MgCl2 and 0.1% glucose with a single colony and grow overnight at 37°C. 2. Harvest bacteria by centrifugation at 5,000g, resuspend them in 2 l fresh medium and grow at 37°C. At an OD600 of 0.6 induce protein expression by adding 1 mM IPTG and continue growing at 37°C for 3–4 h. 3. Harvest cells by centrifugation (5,000–6,000g, 10 min), resuspend them in 60 ml Ubc9 lysis buffer and freeze at −80°C (freezing is essential, see Note 3). 4. Thaw the lysate, add protease inhibitors and DTT and centrifuge (100,000g, 1 h, 4°C).
194
Werner et al.
5. Apply the supernatant to a 10 ml SP-Sepharose column equilibrated in Ubc9 lysis buffer containing protease inhibitors and DTT. Wash the column with the same buffer until no protein can be detected in the flow-through (test with Bradford solution or by spotting on nitrocellulose and staining with Ponceau solution). 6. Elute Ubc9 using 30 ml of Ubc9 elution buffer. Collect 2 ml fractions. Analyze 15 µl of each fraction on Coomassiestained 15% SDS gels (Ubc9 runs at a molecular weight of approximately 20 kDa). 7. Pool Ubc9 containing fractions and concentrate to 2–4 ml using a centrifugal concentrator with a 5 kDa cut-off. 8. Centrifuge the sample (16,000g, 15 min, 4°C, in table top centrifuge) or filtrate through a 0.2 µm low protein binding non-pyrogenic filter to remove small amounts of precipitated protein. 9. Load onto preparative S75 or S200 gel filtration column equilibrated in TB buffer. Run overnight, collect 5 ml fractions and analyze them on 15% SDS gels. 10. Pool Ubc9 peak fractions, flash-freeze small aliquots in liquid nitrogen and store at −80°C. 11. This protocol results in about 5 mg untagged Ubc9 per liter E. coli culture. Although Ubc9 can be thawed and frozen several times, for reproducibility we prefer to use aliquots only once. Dilutions of Ubc9 should be done with SAB, which contains 0.05% Tween20 and 0.2 mg/ml ovalbumin. 3.1.3. Purification of SUMO
1. Transform plasmid containing SUMO-1, SUMO-2 or SUMO-3 in pET11a into BL21(DE3) and grow a single colony overnight in 20 ml LB medium containing 100 µg/ml ampicillin, 1 mM MgCl2 and 0.1% glucose. 2. Harvest bacteria by centrifugation, resuspend them in 2 l of fresh medium and grow at 37°C. At an OD600 of 0.6 induce protein expression by adding 1 mM IPTG and keep growing at 37°C for 3–4 h. 3. Harvest cells by centrifugation (5,000–6,000g for 10 min), resuspend the pellet in 40 ml SUMO lysis buffer and store at −80°C until use. 4. Thaw cell suspension, add protease inhibitors and DTT, lyse bacteria by two passages through an emulsion flex (see Note 4) and centrifuge at 100,000g for 1 h at 4°C to remove cellular debris. 5. Incubate the supernatant for 1–2 h at 4°C with 10 ml Q-Sepharose equilibrated in SUMO lysis buffer containing protease inhibitors and DTT.
In Vitro Sumoylation Reactions
195
6. Remove Q-Sepharose by centrifuging at 250g for 15 min in a swing-out rotor. SUMO remains soluble in the supernatant during this preclearing step. 7. Concentrate the supernatant to a final volume of 3–6 ml using a centrifugal concentrator with a 5 kDa cut-off. 8. Centrifuge the sample (16,000g, 15 min, 4°C, in table top centrifuge) or filter through a 0.2 µm low protein binding non-pyrogenic filter to remove small amounts of precipitated protein. 9. Load onto a preparative S75 gel filtration column equilibrated in TB buffer. Run overnight, collect 5 ml fractions and analyze them on 15% SDS gels (SUMO runs in gel with an apparent molecular mass of 20 kDa). 10. Pool fractions containing pure SUMO (see Note 5), flashfreeze small aliquots in liquid nitrogen and store them at −80°C. 11. This protocol can be used to purify untagged SUMO-1 as well as SUMO-2/3. The expected yield is 15–20 mg SUMO per liter of E. coli culture (see Note 6). 3.1.4. Purification of GSTRanBP2∆FG
1. Transform the plasmid RanBP2∆FG-pGEX-3X into BL21 (DE3) and inoculate 200 ml LB containing 100 µg/ml ampicillin, 1 mM MgCl2, 0.1% glucose. Grow overnight at 37°C. 2. Spin down bacteria by centrifugation and resuspend them in 4 l fresh medium. Let bacteria grow at 37°C until OD600 is 0.6, induce protein expression with 1 mM IPTG and continue growing at 30°C for 4–6 h. 3. Harvest cells by centrifugation (5,000–6,000g for 10 min), resuspend the pellet in 100 ml RanBP2 lysis buffer and store at −80°C until use. 4. Thaw the cell suspension, add protease inhibitors and DTT, lyse bacteria by two passages through an emulsion flex and centrifuge at 100,000g for 45 min at 4°C to remove cellular debris. 5. Incubate the supernatant for 1 h at 4°C with 5 ml Glutathion-Sepharose (equilibrated in RanBP2 lysis buffer). 6. Wash the beads four times in 100 ml RanBP2 wash buffer and pour them into a column. 7. Elute proteins with at least 25 ml 20 mM glutathione in RanBP2 wash buffer, collect 2 ml fractions and check complete elution by using Bradford reagent or by spotting on nitrocellulose and subsequent Ponceau staining. 8. Concentrate the eluate to 2–4 ml by using a centrifugal concentrator with a 30 kDa cut-off.
196
Werner et al.
9. Purifiy over preparative S200 gel filtration column in TB, collect 5 ml fractions. 10. Analyze the fractions on Coomassie-stained 12% SDS gels. Although GST-RanBP2∆FG has a theoretical molecular mass of 59 kDa, it runs at 75 kDa in SDS gels. 11. Pool GST-RanBP2∆FG peak fractions, flash-freeze them in small aliquots in liquid nitrogen and store at −80°C. 3.2. In vitro Sumoylation Assay
Modification of a target protein by SUMO usually results in a 20 kDa shift in apparent molecular mass, which can be easily visualized using SDS-PAGE, followed by gel staining or immunoblotting. We describe here two different conditions for performing an in vitro sumoylation assay. The first protocol (Sect. 3.2.1) does not include an E3 ligase in the reaction and therefore usually needs high concentrations of Ubc9. It is the method of choice when the specific E3 ligase for a target is not known or unavailable. An exceptional target is RanGAP1 (6, 8, 9), which is efficiently modified even with low concentrations of Ubc9 (Fig. 12.2A). The second protocol (Sect. 3.2.2) is designed to investigate sumoylation in the presence of the E3 ligase fragment RanBP2∆FG. In this case, limiting amounts of Ubc9 have to be used, which do not result in sumoylation in the absence of RanBP2∆FG. Sumoylation of YFP-SP100 is given as an example (Fig. 12.2B). In this protocol, RanBP2 fragment can be replaced by other E3 ligases such as PIAS proteins, although optimal Ubc9 and E3 concentrations have to be titrated for every single target protein.
Fig. 12.2. In vitro sumoylation assays in the absense or presence of E3 ligase. (A) 20 µl reactions containing 2.2 µg (1.7 µM) hRanGAP1, 2 µg (9 µM) SUMO-1 and the indicated amounts of E1 and E2 enzyme were incubated at 30°C in the presence of ATP for different time points, stopped by addition of SDS sample buffer and analyzed on a Coomassie-stained SDS gel. (B) 20 µl reactions containing 800 ng (550 nM) YFP-SP100, 2 µg (9 µM) SUMO-1 (upper panel) or SUMO-2 (lower panel), 150 ng (65 nM) E1, 10 ng (27 nM) E2 and 25 ng (37 nM) RanBP2∆FG were incubated at 30°C in the presence of ATP for different periods, stopped by addition of SDS sample buffer and analyzed by immunoblotting using anti-YFP antibody.
In Vitro Sumoylation Reactions 3.2.1. E3 ligase-Independent Sumoylation Assay
197
1. Sumoylation assays are done in 20 µl reactions. Calculate the volumes of protein stock solutions needed for the assay. If necessary, dilute enzymes in an appropriate way using SAB (see Note 7). Always include a control reaction without ATP. 2. Pipette the amount of SAB necessary to fill up the reaction to 20 µl into microfuge tubes. 3. Add 0.2 µg (∼1.0 µM) SUMO-1 or SUMO-2/3, 150 ng (65 nM) E1, 200 ng (∼0.5 µM) Ubc9 and 0.2 µg target (equivalent to 150 nM for a 65 kDa protein). All invariant components for a series of assays (except ATP) should be premixed in advance and added as master mix to the reaction to avoid variations in pipetting. 4. Start the reaction by addition of 1 µl ATP solution, mix, spin down and incubate at 30°C for 30–60 min. 5. Stop the reaction by adding 20 µl SDS loading buffer and denaturation for 3 min at 95°C. 6. Load half of the reaction on a SDS gel and analyze by immunoblotting with target specific antibodies. If your protein is sumoylated you should see a typical shift of 20 kDa, which does not occur in the control without ATP.
3.2.2. RanBP2-Dependent Sumoylation Assay
1. Sumoylation assays are done in 20 µl reactions. Calculate the volumes of protein stock solutions necessary for the assay. If necessary, dilute in an appropriate way using SAB. Always include a control reaction without ATP and another control with ATP but without RanBP2. 2. Pipette the amount of SAB necessary to fill up the reaction to 20 µl into microfuge tubes. 3. Add 1 µg (4.5 µM) SUMO-1 or SUMO-2/3, 150 ng (65 nM) E1, 10–30 ng (27–81 nM) Ubc9, 1 µg target (0.7 µM for a 65 kDa protein) and 10–70 ng (8.5–60 nM) GST-RanBP2 (see Note 8). All invariant components for a series of assays (except ATP) should be premixed in advance and added as master mix to the reaction to avoid variations in pipetting. 4. Start the reaction by addition of 1 µl ATP solution, mix, spin down and incubate at 30°C for 30–60 min. 5. Stop the reaction by adding 20 µl SDS loading buffer and denaturation for 3 min at 95°C. 6. Load half of the reaction on a SDS gel and analyze by Western blot using a target specific antibody. If RanBP2 acts as an E3 ligase for the sumoylation of the target you should see a typical shift of 20 kDa, which does not occur in the controls without ATP or without RanBP2.
198
Werner et al.
4. Notes 1. His-Aos1 is expressed in large excess over Uba2 and smears over many fractions. During combining, fractions containing free His-Aos1 have to be avoided. 2. Uba2-His and untagged Uba2 run at about 90 kDa in SDSPAGE, although their theoretical molecular mass is 72 kDa. 3. Ubc9 leaks out from the bacteria after freeze-thawing (neither lysozyme nor sonication is required). Do not use lysozyme, because it cannot be separated from Ubc9 during purification by SP-Sepharose or gel filtration. 4. Alternatively, sonication can be used, although it is slightly less efficient. Do not lyse bacteria by adding lysozyme, because it has a very similar molecular mass to SUMO and can not be removed by gel filtration. 5. If impurities are still present in the SUMO containing fractions (mostly due to overloading of the column), pure SUMO can be obtained by pooling the fractions, concentrating again and rerunning over the S75 column. 6. The most reliable method for determining the protein concentration of SUMO in our hands is the comparison to known BSA concentrations in Coomassie-stained SDS gels. 7. Make all dilutions in SAB to stabilize proteins at low concentrations and prevent protein binding to tube walls. Convenient ready-to-use stocks would be 150 µg/ml E1 and 200 µg/ml Ubc9. 8. RanBP2 uses SUMO for extensive autosumoylation. Therefore, SUMO and the target protein have to be in vast excess over RanBP2. Optimal amount of RanBP2 has to be determined for each target empirically. The protocol can also be used to test sumoylation by other E3 ligases (like PIAS proteins); however, the amount of E3 ligase has to be titrated for every single target.
Acknowledgments The authors gratefully acknowledge Tina Lampe, Annette Flotho and all group members for sharing reagents and Frank Rhode for excellent technical assistance. Funding was obtained from the EU (Rubicon, UbiRegulator) and the DFG (SFB 523, GRK 521).
In Vitro Sumoylation Reactions
199
References 1. Geiss-Friedlander, R. and Melchior, F. (2007) Concepts in sumoylation: a decade on. Nat. Rev. Mol. Cell. Biol. 8, 947–956. 2. Tatham, M. H., Jaffray, E., Vaughan, O. A., Desterro, J. M., Botting, C. H., Naismith, J. H. and Hay, R. T. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J. Biol. Chem. 276, 5368–5374. 3. Schmidt, D. and Muller, S. (2002) Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc. Natl. Acad. Sci. USA 99, 2872–2877. 4. Johnson, E. S. and Gupta, A. A. (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106, 735–744. 5. Chiu, Y. H., Sun, Q. and Chen, Z. J. (2007) E1-L2 activates both ubiquitin and FAT10. Mol. Cell 27, 1014–1023.
6. Pichler, A., Gast, A., Seeler, J. S., Dejean, A. and Melchior, F. (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108, 109–120. 7. Sapetschnig, A., Rischitor, G., Braun, H., Doll, A., Schergaut, M., Melchior, F. and Suske, G. (2002) Transcription factor Sp3 is silenced through SUMO modification by PIAS1. Embo J. 21, 5206–5215. 8. Matunis, M. J., Coutavas, E. and Blobel, G. (1996) A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J. Cell Biol. 135, 1457–1470. 9. Mahajan, R., Delphin, C., Guan, T., Gerace, L. and Melchior, F. (1997) A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88, 97–107.
Chapter 13 Preparation of Sumoylated Substrates for Biochemical Analysis Puck Knipscheer, Helene Klug, Titia K. Sixma, and Andrea Pichler Abstract Covalent modification of proteins with SUMO (small ubiquitin related modifier) affects many cellular processes like transcription, nuclear transport, DNA repair and cell cycle progression. Although hundreds of SUMO targets have been identified, for several of them the function remains obscure. In the majority of cases sumoylation is investigated via “loss of modification” analysis by mutating the relevant target lysine. However, in other cases this approach is not successful since mapping of the modification site is problematic or mutation does not cause an obvious phenotype. These latter cases ask for different approaches to investigate the target modification. One possibility is to choose the opposite approach, a “gain in modification” analysis by producing both SUMO modified and unmodified protein in vitro and comparing them in functional assays. Here, we describe the purification of the ubiquitin conjugating enzyme E2-25K, its in vitro sumoylation with recombinant enzymes and the subsequent separation and purification of the modified and the unmodified forms. Key words: SUMO, E2-25K, in vitro sumoylation assay with recombinant enzymes, protein purification.
1. Introduction Post-translational modification with small proteins like ubiquitin and ubiquitin-like molecules (UBLs) is a powerful means of regulating many cellular pathways (1). SUMO is one of the best characterised UBLs and, similarly to ubiquitin, it is covalently linked to a lysine residue within the target protein. This depends on an enzymatic cascade, involving one E1 activating enzyme, one E2 conjugating enzyme and often one out of a few E3 ligating enzymes (1–4): In the first step of this cascade SUMO is Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
201
202
Knipscheer et al.
activated and forms a thioester bond between its C-terminal glycine and the active-site cysteine of the E1, a heterodimer between Aos1/Uba2 (also known as Sae1/Sae2). From here, SUMO is transferred to the active-site cysteine of the E2 Ubc9, again forming a thioester bond. Finally, SUMO forms an isopeptide bond with the ε-amino group of the substrate lysine, a step that is often facilitated by an E3 ligase. In addition to the covalent attachment of SUMO to its targets, SUMO also interacts non-covalently with proteins via a so called SUMO interaction motif (SIM) or SUMO binding motif (SBM), a hydrophobic stretch which adds a β-strand to the β-sheet of the SUMO molecule (5–9). Among the long list of SUMO substrates the biological consequences are ranging from changes in intracellular localization to enzymatic activity, protein stability and many others (1–3). This poses the question which molecular mechanism can explain such a broad variety of consequences. Over the last years it has become apparent that SUMO attachment often results in providing a new binding interface or interfering with an existing one. This ensures a switch of either protein-protein or protein-nucleic acid interactions and explains the large diversity of biological consequences. One of the best understood examples for creating such a new binding interface was demonstrated for RanGAP1, which via sumoylation binds to the nuclear pore component RanBP2, determining its localization to nuclear pore complexes (NPC) (10–14). Mutagenesis of the sole sumoylation site results in “loss of modification” and prevents its localization to NPCs (11). Another exciting and even more complex model is proposed for promyelocytic leukaemia (PML) body formation. PML itself but also several other nuclear body components like Sp100 or DAXX contain both SUMO attachment sites and SUMO interaction motifs (SIM). A complex network of covalent and non-covalent SUMO interactions seems to be required for PML body assembly (15, 16). Such covalent and non-covalent interactions can also occur intra-molecularly as it was shown for the thymidine DNA glycosylase (TDG). Sumoylation of TDG at its C-terminus triggers a SIM-dependent non-covalent interaction with its N-terminus resulting in a conformational change in TDG (17). We recently demonstrated an opposite mechanism where sumoylation interferes with an existing binding interface. The ubiquitin-conjugating enzyme E2-25K is sumoylated at a site required for interaction with the ubiquitin-specific E1. SUMO modification of this site results in a severe defect in ubiquitin thioester formation, a step depending on E1 interaction (18). The most common way to investigate sumoylation of a particular target is to first map the sumoylation site(s) and subsequently
Preparation of E2-25K*SUMO
203
study “loss of modification” using mutagenesis. This method is the optimal tool for substrates, which have defined SUMO attachment site(s) and where abolishing sumoylation results in an observable biological phenotype. However, for other substrates mapping of the sumoylation site(s) may already cause difficulties, especially if the target lysine is not situated in a SUMO consensus motif (ψKxE, where ψ is a bulky aliphatic and x any residue) (18). One possibility to overcome this problem is to submit the sumoylated protein for analysis by mass spectrometry. Nevertheless, there are substrates where mutation of a mapped sumoylation site does not abolish its modification. In such cases it seems that sumoylation shifts from one lysine to another one after its mutagenesis (our unpublished observations), a well-known phenomenon in the case of ubiquitylation. In other proteins, abolishing sumoylation has no obvious biological consequence since modification is either strictly regulated, requires specific stimuli or other conditions. All these cases require a different method to analyze the function of sumoylation. In this chapter we describe a “gain in modification” approach that we have established for the ubiquitin-conjugating enzyme E2-25K. We present the purification, the large scale in vitro modification of E2-25K and the subsequent separation of the modified from the unmodified form. This method has allowed us to map the site of modification, solve the crystal structure and identify a function for this particular protein modification (18). Such a “gain in modification” approach can be applied as a powerful tool to investigate the function of other SUMO targets. Several alternative approaches addressing this issue are described in Chaps. 9, 10 and 14.
2. Materials 2.1. Purification of E2-25K
1. Competent bacterial strain BL21(DE3). 2. IPTG: 1 M solution in water. 3. E2-25K cloned into pGEX-4T (18) with cleavable TEV tag (see Notes 1 and 2). 4. Glutathione Sepharose TM 4B (GE Healthcare). 5. TEV protease (Invitrogen). 6. Lysis buffer: 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, supplemented with 1 mM PMSF, 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 7. TEV protease buffer: 50 mM Tris-HCl, pH 8.0, 0.5 mM EDTA supplemented with 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT.
204
Knipscheer et al.
8. Transport buffer (TB): 20 mM HEPES, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, pH 7.3, supplemented with 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 9. LB/Amp: LB medium (e.g., Invitrogen) supplemented with ampicillin (100 µg/ml). 10. Lysozyme (Sigma). 11. Concentrator tubes with a 10 K molecular weight cut-off. 12. Micro-Bio-Spin Chromatography Column (Bio-Rad). 13. Standard SDS-PAGE equipment. 14. Coomassie staining solution. 2.2. In Vitro Sumoylation of E2-25K
1. Recombinant proteins: SUMO1, E1 and E2 (19), described in detail in ref. (20) and Chap. 11 (see Notes 3 and 4). 2. Transport buffer (TB): 20 mM HEPES, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, pH 7.3, supplemented with 1 µg/mL each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 3. ATP: 100 mM ATP, 100 mM magnesium acetate, 20 mM HEPES, titrate to pH 7.4 with 10 N NaOH. 4. Heat block. 5. Standard SDS-PAGE equipment. 6. Coomassie staining solution.
2.3. Separation of Modified and Unmodified E2-25K
1. Buffer A: 20 mM Tris-HCl, pH 8.0, 100 mM NaCl supplemented with 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 2. Buffer B: 20 mM Tris-HCl, pH 8.0, 1 M NaCl supplemented with 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 3. Transport buffer (TB): 20 mM HEPES, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, pH 7.3, supplemented with 1 µg/ml each of aprotinin, leupeptin, pepstatin and 1 mM DTT. 4. FPLC system: Pharmacia LKB Pump P-500, Pharmacia LKB Controller LCC-501 Plus, Pharmacia LKB UV-M II, Pharmacia LKB Frac-100 (or equivalent). 5. FPLC columns (HiPrep 16/10 Q FF and Superdex 75 10/300, GE Healthcare) (see Note 7). 6. Concentrator tubes with a 10 K molecular weight cut-off. 7. Standard SDS-PAGE equipment. 8. Coomassie staining solution.
Preparation of E2-25K*SUMO
205
3. Methods 3.1. Purification of E2-25K
1. Transform E2-25K in pGEX-4T into the Escherichia coli strain BL21(DE3). 2. Use a single colony to inoculate a 20 ml overnight culture in LB/Amp. 3. Dilute the overnight culture 1:50 into a final volume of 1 l LB/Amp and let it grow for 2–3 h at 37°C up to OD600 0.4–0.5. 4. Add 1 mM IPTG to induce protein expression and incubate overnight at 15°C. 5. Harvest the cells by centrifugation at 3,000g. 6. Resuspend the cell pellet in 30 ml lysis buffer. 7. Subject sample to one cycle of freeze-thawing in liquid nitrogen. 8. Transfer the sample to ultracentrifuge tubes, add 1 mg/ml lysozyme and incubate sample for 1 h on ice. 9. Centrifuge the sample at 100,000g for 1 h, use the cleared supernatant for the affinity purification step and take a small sample for the control SDS-PAGE (Fig. 13.1, lane 1). 10. During centrifugation equilibrate 4 ml Glutathione beads by washing three times with lysis buffer. 11. Add the equilibrated beads to the cleared supernatant from step 9 and incubate at 4°C for 1 h on a rotating wheel. 12. Collect the beads by centrifugation at 200g. 13. Take a small aliquot from the supernatant for the control SDS-PAGE to analyze depletion of the tagged protein (Fig. 13.1, lane 2). 14. Wash the beads three times with 10 ml TEV protease buffer and take a small sample from the beads for the control SDSPAGE (Fig. 13.1, lane 3). 15. Resuspend the beads in 1 ml TEV protease buffer supplemented with 20 µl TEV protease (100 U/µl) and incubate overnight at 4°C on a rotating wheel. 16. Centrifuge the sample at 200g and collect the supernatant. 17. Wash the beads twice with 4 ml TEV protease buffer and collect supernatants to obtain as much as possible of the cleaved protein. Take another sample of the beads for the control SDS-PAGE to check cleavage (Fig. 13.1, lane 4). 18. Meanwhile, add 200 µl Glutathione beads to a Micro-Bio-Spin Chromatography column.
206
Knipscheer et al.
Fig. 13.1. Purification of E2-25K. GST-tagged E2-25K was first enriched on glutathione beads, followed by cleavage with TEV-protease to obtain untagged E2-25K. Aliquots from the lysate before (lane 1) and after (lane 2) incubation with glutathione beads, glutathione beads before (lane 3) and after (lane 4) TEV cleavage, and the supernatant containing the cleaved E2-25K were separated on a 12.5% SDS gel, and protein was stained with Coomassie Blue.
19. Wash the column three times with TEV protease buffer. 20. Pool the collected supernatants from Steps 15 and 16 and apply the sample to the column to remove residual traces of GST. Collect the flow-through and take a small aliquot for SDS-PAGE (Fig. 13.1, lane 5). 21. Concentrate the flow-through containing purified E2-25K using concentrator tubes to a final concentration of 1–5 mg/ml. 22. Control the different purification steps by separation of all samples on 12.5% SDS-PAGE and subsequent Coomassie staining (Fig. 13.1). 3.2. In Vitro Sumoylation of E2-25K
1. Mix 20 µM E2-25K, 34 µM SUMO-1, 2 µM Ubc9 and 45 nM E1 in a total volume of 4–5 ml transport buffer and take a 10 µl aliquot for the control SDS-PAGE (Fig. 13.2, lane 5) (see Notes 3–6 and 8–10). 2. Start the reaction by adding 0.5 mM ATP and incubate for 4 h at 30°C. 3. Take another 10 µl aliquot for the control SDS-PAGE (Fig. 13.2, lane 6). 4. Concentrate reaction mix to 1 ml and ultracentrifuge at 100,000g for 10 min at 4°C and continue at Sect. 3.3, Step 3. 5. Separate the control samples on a 12.5% SDS-PAGE and analyze the reaction by staining total protein with Coomassie blue (Fig. 13.2).
Preparation of E2-25K*SUMO
207
Fig. 13.2. In vitro sumoylation of E2-25K. (A) Purified components used in the assay (left panel): 500 ng E2-25K (lane 1), 500 ng SUMO1 (lane 2), 500 ng Ubc9 (lane 3), 500 ng E1 (Aos1/Uba2, lane 4). (B) In vitro modification was performed with 20 µM E2-25K, 34 µM SUMO-1, 2 µM Ubc9, 45 nM E1, 0.5 mM ATP and reaction was incubated for 4 h at 30°C (right panel). Aliquots were taken before (lane 5) and after the reaction (lane 6). All samples were resolved on a 12.5% SDS gel and stained with Coomassie Blue.
3.3. Separation of Modified and Unmodified E2-25K
1. Degas buffers A and B. 2. Equilibrate the HiPrep Q column with buffer A. 3. Inject the concentrated reaction mix from Sect. 3.2, Step 4. 4. Apply a gradient from 0–50% buffer B for 85 fractions of 1 ml each, followed by an increase to 100% buffer B for another 15 fractions (proteins elute between 20 and 30% buffer B). 5. Analyze the collected fractions by separation on a 12.5% SDS-PAGE and subsequent Coomassie staining (Fig. 13.3A). 6. Pool fractions containing E2-25K and those enriched in sumoylated E2-25K (E2-25K*SUMO) separately. 7. Concentrate each sample to 1 ml using concentrator tubes. 8. Meanwhile, equilibrate the Superdex 75 gel filtration column in transport buffer. 9. Centrifuge the samples from step 7 at 100,000g for 10 min at 4°C prior applying to the column. 10. Inject the E2-25K sample to the S75 column and collect 0.5 ml fractions. 11. In a subsequent run, inject E2-25K*SUMO sample to the Superdex 75 column and collect 0.5 ml fractions.
208
Knipscheer et al.
Fig. 13.3. Separation of modified and unmodified E2-25K. (A) The in vitro sumoylation mix was first separated on a HiPrep Q column, and fractions were analyzed by SDS-PAGE and Coomassie staining. Fractions 34 to 42 (enriched in E2-25K) and 46 to 52 (enriched in E2-25K*SUMO1 and free SUMO1) were pooled separately, concentrated and subsequently loaded on a Sephadex 75 column, respectively. Fractions collected from these runs were analyzed as above. (B) Fractions from the E2-25K and (C) fractions from the E2-25K*SUMO gel filtration runs, respectively.
12. Analyze fractions from both runs by 12.5% SDS-PAGE and Coomassie staining (Fig. 13.3B and c). 13. Combine fractions containing purified E2-25K and E2-25K*SUMO, respectively, and concentrate both samples using concentrator tubes to about 1 mg/ml. Aliquot all samples, flash-freeze the aliquots in liquid nitrogen and store them at −80°C.
4. Notes 1. E2-25K is sumoylated close to its very N-terminus. Sumoylation thus requires the removal of the N-terminal GST-tag. 2. Any other tag which does not interfere with sumoylation or protein function can be used for the protein of investigation. 3. SUMO E3 ligases can be included in the in vitro modification assay.
Preparation of E2-25K*SUMO
209
4. The catalytic domain of the SUMO E3 ligase RanBP2, IR1 + M can be used to enhance in vitro sumoylation since it has lost substrate specificity (4, 21). 5. Titration series of the enzymes for the in vitro modification assay help to optimize target modification. Especially high concentrations of Ubc9 can sometimes replace the requirement of an unidentified E3 ligase. 6. In some cases, multiple SUMOs are attached to a target because either multiple target lysines are modified with SUMO, or SUMO forms polymeric chains. In case of SUMO chain formation the responsible lysine in SUMO can be mutated to abolish chain formation. If multiple lysines are modified one can mutate all modified lysines except one to study the consequence of sumoylation of specific sites independently. For studying a multi-sumoylated protein an alternative method (see Note 8) is recommended. 7. Instead of the HiPrep FF Q a MonoQ column can be used to separate the modified and the unmodified E2-25K. In general, sumoylation of the target protein changes the isoelectric point (pI) of the protein to some extent. Therefore, ion exchange chromatography is often an ideal method for separation of a sumoylated protein from its unmodified form. Since the charge of a protein depends on its pI and the pH of the buffer, these two factors determine the usage of either anion (low pI of the protein) or cation (high pI of the protein) exchange chromatography. 8. Alternative to the method described here, a tagged version of SUMO can be used. Separation of the modified from the unmodified substrate can then be performed via affinity purification using this SUMO-tag. Free SUMO can be removed by subsequent gel filtration. 9. An additional method to obtain large amounts of sumoylated protein is described in Chap. 14. 10. Two methods to study “gain in modification” in vivo can be found in Chaps. 9 and 10.
Acknowledgements Our special thanks go to Katharina Maderböck and Neha Nigam for critical reading of the manuscript. This work was funded by the Vienna Science and Technology Fund WWTF LS05003 and FWF P18584-B12 to A.P., and EU-Rubicon, NWO-CW pionier and CBG to T.K.S.
210
Knipscheer et al.
References 1. Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006) Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell. Dev. Biol. 22, 159–180. 2. Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12. 3. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 4. Pichler, A., Knipscheer, P., Saitoh, H., Sixma, T. K., and Melchior, F. (2004) The RanBP2 SUMO E3 ligase is neither HECT- nor RINGtype. Nat. Struct. Mol. Biol. 11, 984–991. 5. Hannich, J. T., Lewis, A., Kroetz, M. B., Li, S. J., Heide, H., Emili, A., and Hochstrasser, M. (2005) Defining the SUMOmodified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280, 4102–4110. 6. Hecker, C. M., Rabiller, M., Haglund, K., Bayer, P., and Dikic, I. (2006) Specification of SUMO1- and SUMO2-interacting motifs. J. Biol. Chem. 281, 16117–16127. 7. Minty, A., Dumont, X., Kaghad, M., and Caput, D. (2000) Covalent modification of p73alpha by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO-1-interacting proteins and a SUMO-1 interaction motif. J. Biol. Chem. 275, 36316–36323. 8. Song, J., Durrin, L. K., Wilkinson, T. A., Krontiris, T. G., and Chen, Y. (2004) Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc. Natl. Acad. Sci. U S A 101, 14373–14378. 9. Song, J., Zhang, Z., Hu, W., and Chen, Y. (2005) Small ubiquitin-like modifier (SUMO) recognition of a SUMO binding motif: a reversal of the bound orientation. J. Biol. Chem. 280, 40122–40129. 10. Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997) A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88, 97–107. 11. Mahajan, R., Gerace, L., and Melchior, F. (1998) Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J. Cell. Biol. 140, 259–270. 12. Matunis, M. J., Coutavas, E., and Blobel, G. (1996) A novel ubiquitin-like modifi-
13.
14.
15.
16.
17.
18.
19.
20.
21.
cation modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J. Cell. Biol. 135, 1457–1470. Matunis, M. J., Wu, J., and Blobel, G. (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J. Cell. Biol. 140, 499–509. Reverter, D., and Lima, C. D. (2005) Insights into E3 ligase activity revealed by a SUMO-RanGAP1-Ubc9-Nup358 complex. Nature 435, 687–692. Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., and Pandolfi, P. P. (2006) The mechanisms of PML-nuclear body formation. Mol. Cell 24, 331–339. Lin, D. Y., Huang, Y. S., Jeng, J. C., Kuo, H. Y., Chang, C. C., Chao, T. T., Ho, C. C., Chen, Y. C., Lin, T. P., Fang, H. I., Hung, C. C., Suen, C. S., Hwang, M. J., Chang, K. S., Maul, G. G., and Shih, H. M. (2006) Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol. Cell 24, 341–354. Baba, D., Maita, N., Jee, J. G., Uchimura, Y., Saitoh, H., Sugasawa, K., Hanaoka, F., Tochio, H., Hiroaki, H., and Shirakawa, M. (2005) Crystal structure of thymine DNA glycosylase conjugated to SUMO-1. Nature 435, 979–982. Pichler, A., Knipscheer, P., Oberhofer, E., van Dijk, W. J., Korner, R., Olsen, J. V., Jentsch, S., Melchior, F., and Sixma, T. K. (2005) SUMO modification of the ubiquitin-conjugating enzyme E2–25K. Nat. Struct. Mol. Biol. 12, 264–269. Pichler, A., Gast, A., Seeler, J. S., Dejean, A., and Melchior, F. (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108, 109–120. Bossis, G., Chmielarska, K., Gartner, U., Pichler, A., Stieger, E., and Melchior, F. (2005) A fluorescence resonance energy transfer-based assay to study SUMO modification in solution. Methods Enzymol. 398, 20–32. Pichler A. (2008) Posttranslational modification of proteins - Analysis of Sumoylation. Methods in Molecular Biology. 446, 131–8.
Chapter 14 Strategies for the Expression of SUMO-Modified Target Proteins in Escherichia coli Hisato Saitoh, Junsuke Uwada, and Azusa Kawasaki Abstract We previously described the establishment of a binary vector system that allows co-expression of SUMO conjugation enzymes and a target protein of interest, leading to efficient SUMO modification and the production of a large amount of recombinant SUMO-modified proteins in Escherichia coli. The advantages of this E. coli expression/modification approach include scalability of experiments, low cost, fast growth, and a lack of proteases that cleave the isopeptide linkage between SUMO and the target protein. Thus, this E. coli method provides a useful alternative to authentic SUMO modification assays, such as in vitro SUMO conjugation and in vivo SUMO modification using baculovirus or mammalian cell culture, that are usually complicated, time-consuming and expensive. Key words: SUMO conjugation pathway, plasmid compatibility, protein expression in E. coli, affinity purification, in vivo sumoylation.
1. Introduction We previously generated tri-cistronic plasmids for the overexpression of SUMO-E1 and -E2 enzymes and SUMO-1 or -3, designated as pT-E1E2S1 and pT-E1E2S3 (see Note 1) (1,2). Transformation of E. coli with the pT-E1E2S1/S3 vector along with a plasmid encoding a potential SUMO target protein and containing a compatible replication origin and antibiotic selection marker allows co-expression of SUMO-E1 and -E2 enzymes, SUMO-1/-3 and a protein of interest. This results in the efficient production of a recombinant protein modified with SUMO-1 or SUMO-3 in E. coli. A summary of the strategy is presented in Fig. 14.1. The strategy can easily be adapted to proteins with Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
211
212
Saitoh, Uwada, and Kawasaki
Fig. 14.1. Schematic representation of the E. coli SUMO modification system (1,2 ). It should be mentioned that, in addition to plasmid compatibility, successful expression and purification of SUMO modified proteins is dependent on several other factors, including the E. coli host strain, the choice of tag used for target proteins and, of course, the nature of the target proteins being co-expressed.
various epitope tags, such as glutathione S-transferase (GST), His6 or maltose-binding protein (MBP). Other protein-specific tagging systems can likewise be used by replacing the plasmids pGEX, pMAL and pET plasmids with a relevant expression vector. In our experience, the choice of tag has little effect on the degree of modification. So far, many genuine SUMO substrates have been shown to be modified in this system with a pattern identical to the in vivo situation (1–5). It should be noted, however, that sumoylation in the E. coli system does not prove that a given protein is a genuine SUMO substrate in a eukaryotic system. For instance, a minor population of E. coli proteins appears to be sumoylated when E. coli containing pT-E1E2S1/ S3 alone is cultured under the same expression conditions (our unpublished observations), suggesting the presence of “false positive” proteins that are modified without being genuine substrates in a eukaryotic system. In this chapter, we demonstrate our expression/purification scheme for MBD1, a member of the methyl CpG DNAbinding protein family, as an example protein, using GST, MBP and His6 fusions, respectively. It has been reported that MBD1 is sumoylated in mammalian cells, and sumoylation of this protein plays important roles in cell growth and differentiation via epigenetic gene regulation (6,7). Comparison of the recombinant non-modified form with the sumoylated form of MBD1 therefore provides a useful tool to study the role of functional transfer of MBD1 by sumoylation in cellular regulation.
Expression of SUMO-Modified Proteins in E. coli
213
2. Materials 2.1. Preparation of E. coli BL21(DE3) Competent Cells
1. 50 mM CaCl2: prepare the solution with purified water (Milli-Q or equivalent) and sterilize by autoclaving. 2. 50 mM CaCl2 plus 20% glycerol solution: prepare the solution with purified water (Milli-Q or equivalent) and sterilize by autoclaving. 3. Luria-Bertani (LB) broth: dissolve 10 g of bacto-tryptone, 5 g of yeast extract and 5 g of NaCl in 950 ml of deionized H2O. Adjust the pH to 7.0 with 5 N NaOH (∼0.2 ml). Adjust the volume of the solution to 1 l with deionized H2O and sterilize by autoclaving. 4. LB plates: prepare 1 l of liquid LB medium in a 2 l flask. Just before autoclaving, add 15 g of bacto-agar. Sterilize the solution by autoclaving. After removing the flask, allow the medium to cool to 50°C. Add appropriate antibiotics and mix the medium gently. The appropriate concentrations of working solutions and stock solutions for several antibiotics are shown in Table 14.1. Plates can then be poured directly from the flask. Allow about 25–30 ml of medium per 90-mm plate. We recommend setting up a color code to represent the different antibiotics (for example, red stripes for LBampicillin plates, blue stripes for LB-kanamycin plates, black stripes for LB-chloramphenicol plates, red-blue stripes for LB-plates containing ampicillin and chloramphenicol, and so on) and marking the edges of the plates with the appropriate colors. When the medium has hardened completely, invert the plates and store them at 4°C until needed. 5. 80% (v/v) glycerol: prepare using distilled H2O and sterilize by autoclaving.
2.2. Protein Expression and Affinity Chromatography of the Expressed Proteins
1. Isopropyl-β-D-1-thiogalactopyranoside (IPTG): prepare a 1 M stock solution by dissolving IPTG in sterilized water. Dispense the solution into 1 ml aliquots and store at −20°C. 2. Glutathione Sepharose 4B beads: available from GE Healthcare. 3. Ni-NTA-agarose beads: available from Qiagen. 4. Amylose beads: available from New England BioLabs. 5. Phosphate-buffered saline (PBS): dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, and 0.24 g of KH2PO4 in 800 ml of distilled H2O. Adjust the pH to7.4 with HCl. Add H2O to 1 l. Store at room temperature. 6. Triton X-100: prepare a 20% (v/v) solution in distilled H2O. 7. Washing buffer: PBS containing 0.1% Triton X-100.
214
Saitoh, Uwada, and Kawasaki
8. 3x SDS sample buffer: 150 mM Tris-HCl, pH 6.8, 6% (w/v) SDS, 0.3% (w/v) bromophenol blue, 30% (w/v) glycerol, 300 mM dithiothreitol. Store in aliquots at −20°C.
3. Methods A schematic outline of the method is presented in Fig. 14.2. Before starting the experiments, make sure that your plasmid possesses an origin of replication that is compatible with that of the pT-E1E2S1/S3 vector, but different E. coli antibiotic resistant genes for selection (see Table 14.1). 3.1. Preparation and Storage of Competent E. coli BL21(DE3) Cells Using Calcium Chloride 3.1.1. Preparation of Competent E. coli BL21(DE3) Cells
1. Grow the E. coli strain BL21(DE3) in 5 ml of LB broth for 16–20 h at 37°C (see Note 2). 2. Transfer 1 ml of the culture into 100 ml of LB broth in a 500 ml flask. Incubate the culture for ∼3 h at 37°C with vigorous shaking (200 rpm in a rotary shaker). Monitor the growth by determining the OD600 every 30 min. Stop the incubation when the culture reaches an OD600 of 0.5–0.6. 3. Aseptically transfer the cells to sterile, disposable, ice-cold 50 ml polypropylene test tubes. Cool the culture to 0°C by incubation on ice for 10 min. Note that all subsequent steps in this procedure should be carried out aseptically.
Fig. 14.2. Outline of the experimental protocol for development of the E. coli SUMO modification system for a protein of interest. Note that a suitable expression construct needs to be available before the start of the experiment.
Expression of SUMO-Modified Proteins in E. coli
215
Table 14.1 Features of the vectors described in this chapter (see also Ref. 8) Vector
Antibiotic Promoter resistance
Concentration
Replicon (source) [copy number]
Compatible vectors
pT-E1E2S1
T7
Chloramphenicol
25 µg/mla
P15A(pACYC184) [10–12]
pGEX pETp MAL
pT-E1E2S3
T7
Chloramphenicol
25 µg/mla
P15 (pACYC184) [10–12]
pGEX pET pMAL
pET (all)
T7
Kanamycin
25 µg/mlb
ColE1 (pBR322) [∼40]
pT-E1E2S1
pGEX (all)
tac
Ampicillin or carbenicin
50 µg/mlc
ColE1 (pBR322) [∼40]
pT-E1E2S1 pT-E1E2S3
pMAL (all)
tac
Ampicillin or carbenicin
50 µg/mlc
ColE1 (pBR322) [∼40]
pT-E1E2S1 pT-E1E2S3
pT-E1E2S3
a
Stock solution: 25 mg/ml in ethanol. Sterilization is not needed. Store at −20°C in a light-tight container. Stock solution: 25 mg/ml in autoclaved water. Sterilized by filtration through a 0.22 µm filter. Store at −20°C in a light-tight container. c Stock solution: 50 mg/ml in autoclaved water. Sterilized by filtration through a 0.22 µm filter. Store at −20°C in a light-tight container. b
4. Recover the cells by centrifugation at ∼1,100g for 5 min at 4°C. 5. Decant the medium from the cell pellets. 6. Gently resuspend each pellet on ice in 12.5 ml of ice-cold 50 mM CaCl2. It is important to ensure that any remaining cell clumps are completely disrupted. Leave the resuspended bacteria on ice. This step takes about 10 min. 7. Recover the cells by centrifugation at 1,100g for 10 min at 4°C. 8. Decant the supernatant from the cell pellets, making sure to remove as much as possible of the liquid. 9. Resuspend each pellet on ice in 5 ml of ice-cold 50 mM CaCl2–20% glycerol. This step takes ∼3 min. 10. Using a sterile pipette tip, transfer 100 µl of each suspension of competent cells to a sterile microfuge tube. Immerse the tightly closed tubes in liquid nitrogen. Store the tubes at −80°C until needed.
216
Saitoh, Uwada, and Kawasaki
3.1.2. Transformation of E. coli BL21(DE3) with pT-E1E2S1/S3.
1. Take a tube of competent cells from the −80°C freezer and thaw the cell suspension on ice. 2. Add 1 µl of DNA solution (1 µg/µl) containing the pTE1E2S1/S3 plasmid DNA to 30 µl of the competent cells, and swirl the tube gently several times to mix its contents (see Note 3). 3. Place the tube on ice for 30 min. 4. Transfer the tube to an incubator preheated at 42°C. Incubate for 30 s without shaking. 5. Rapidly transfer the tube to an ice bath. Allow the cells to chill for 1–2 min. 6. Add 200 µl of LB broth to the tube. Warm the culture to 37°C in a water bath, and then transfer the tube to a shaking incubator set at 37°C. Incubate the culture for 60 min to allow the bacteria to recover and express the antibiotic resistance marker encoded by the plasmid. 7. Transfer 200 µl of transformed cells onto an LB-agar plate containing 25 µg/ml chloramphenicol. Using a sterile bent glass rod to gently spread the cell suspension over the surface of the agar plate. 8. Leave the plate at room temperature until the liquid has been absorbed. 9. Invert the plate and incubate at 37°C for 16–20 h.
3.1.3. Preparation of Competent E. coli Containing pT-E1E2S1/S3
1. Pick a single colony (2–3 mm in diameter) obtained from Step 9 of Sect. 3.1.2 and transfer it into 5 ml of LB broth containing 25 µg/ml chloramphenicol.
3.1.4. Transformation of E. coli BL21(DE3) Containing pT-E1E2S1/S3 with a Plasmid of Interest
2. Repeat Steps 1–10 described in Sect. 3.1.1. 1. Take a tube of competent cells containing pT-E1E2S1/S3, prepared as described in Sect. 3.1.3, from the −80°C freezer (see Note 4). 2. Add 1 µl of DNA solution (1 µg/µl) containing the plasmid DNA of interest to the competent cells, and swirl the tube gently several times to mix its contents. 3. Repeat Steps 3–6 of Sect. 3.1.2. 4. Transfer 200–500 µl of transformed cells onto an LB-agar plate containing 25 µg/ml chloramphenicol plus either 50 µg/ml ampicillin or 25 µg/ml kanamycin (depending on the antibiotics marker of the plasmid of interest). Use a sterile bent glass rod to gently spread the cell suspension over the surface of the agar plate. 5. Leave the plate at room temperature until the liquid has been absorbed. 6. Invert the plate and incubate at 37°C for 16–20 h.
Expression of SUMO-Modified Proteins in E. coli
217
3.2. Protein Expression and Affinity Chromatography of Expressed Protein
1. Pick four (or more) transformants obtained from Step 6 of Sect. 3.1.4 (see Note 5).
3.2.1. Growth of Cultures for Protein Expression
3. Grow the cultures for 12–18 h with vigorous shaking at 37°C.
2. Set up a 3 ml culture of each clone in LB broth containing 25 µg/ml chloramphenicol plus the appropriate second antibiotic (50 µg/ml ampicillin or 25 µg/ml kanamycin). 4. Remove 1 ml of culture for the preparation of a glycerol stock by adding 80% glycerol to a final concentration of 20%, and store at −80°C. 5. Use the remaining culture (∼2 ml) to inoculate 50 ml of LB broth supplemented with 25 µg/ml chloramphenicol plus the appropriate second antibiotic (50 µg/ml ampicillin or 25 µg/ml kanamycin) in a 300 ml flask (see Note 6). 6. Grow the culture to an OD600 of 0.5–0.6 with vigorous shaking at 37°C. Then lower the temperature to 25°C (see Note 7). 7. Induce protein expression by adding 1 M IPTG to a final concentration of 0.1 mM and incubating for 12–16 h at 25°C (see Note 7).
3.2.2. Harvesting and Cell Lysis
1. Transfer the induced culture to a 50 ml test tube and collect the cells by centrifugation at 1,600g for 10 min at 4°C. 2. Discard the supernatant and resuspend the pellet in 5 ml of ice-cold PBS. At this point cells can be stored at 4°C for short term or −20°C for longer term. 3. Lyse the cells by sonication (using a TOMY UD201 sonicator or equivalent) at maximum output for 30 s on ice. Repeat sonication until the cloudy suspension becomes translucent. 4. Add 20% Triton X-100 to a final concentration 0.1% and mix gently for 5 min at room temperature. Set aside a 10 µl aliquot for analysis by SDS-PAGE (total lysate). 5. Centrifuge the lysate at 9,100g for 5 min at 4°C. Transfer the supernatant to a 15 ml test tube and retain 10 µl of the supernatant for analysis by SDS-PAGE.
3.2.3. Preparation of the Resin
1. To enrich SUMO-modified recombinant proteins from bacterial lysates, the recombinant GST, His6, or MBP (Maltose-Binding Protein) fusion proteins must be bound to glutathione beads, Ni-NTA beads or amylose beads, respectively. Transfer an aliquot of the appropriate beads to a microcentrifuge tube. We typically use 30 µl of glutathione Sepharose 4B, Ni-NTA agarose or amylose beads. 2. Centrifuge the tube at 400g at room temperature for 1 min. Remove the supernatant carefully by aspiration or with a pipette tip (see Note 8).
218
Saitoh, Uwada, and Kawasaki
3. Wash the beads once with ten bead volumes of PBS-0.1% Triton X-100. To perform the wash, add PBS-Triton X-100, mix gently, centrifuge at 400g for 30 s and aspirate the supernatant. 4. After this wash step, add an equal bead volume of PBS-0.1% Triton X-100 and store on ice. The packed bead volume is most easily estimated by visual comparison of the bead pellet to a series of microcentrifuge tubes containing a known volume of water. 3.2.4. Affinity Chromatography of Expressed Proteins
1. Transfer the p.re-washed beads from Step 4 of Sect. 3.2.3 to the lysate prepared in Step 5 of Sect. 3.2.2. 2. Place the tube into a rotator and mix at 4°C for 1 h. 3. Centrifuge the tube at 400g at room temperature for 1 min. Remove the supernatant by aspiration. 4. Wash the beads three times with 10 ml of ice-cold PBS-0.1% Triton X-100. To perform each wash, add buffer, centrifuge at 400g at room temperature for 1 min and aspirate the supernatant. 5. After the last wash, add an equal bead volume of PBS-0.1% Triton X-100 and store on ice until use.
3.2.5. Detection of SUMO-Modified Proteins
1. Split the resin containing bound protein from Step 5 of Sect. 3.2.4 into two equal aliquots. Take one of the aliquots, centrifuge at 400g at room temperature for 1 min and aspirate the supernatant. 2. Add 50 µl of 3x SDS sample buffer to the beads. 3. Heat the sample at 95°C for 3–5 min and then centrifuge the tubes at 800g at room temperature for 30 s. 4. Load 15 µl of the supernatant from this sample onto an SDSPAGE gel, along with the samples collected from the total lysate and soluble protein (see Note 9). 5. Analyze the proteins resolved by gel electrophoresis, followed by Coomassie or silver staining. 6. Ideally, bacteria expressing a SUMO-conjugated protein of interest will be identified by the presence of novel bands of lower mobility. An example of the result produced is shown in Fig. 14.3 (see Notes 10–13). 7. Once an expression clone has been identified, perform largescale expression and purification by scaling up the above protocol.
Expression of SUMO-Modified Proteins in E. coli
219
Fig. 14.3. Enrichment of SUMO-1- and SUMO-3-conjugated methyl-CpG-DNA binding protein 1 (MBD1) (4,5) fused to GST-, MBP- and (His)6-tags. (A) Total lysates from E. coli harboring pGEX-MBD1 alone or in combination with pT-E1E2S1 or pT-E1E2S3 were incubated with glutathione Sepharose beads, and the bound proteins were analyzed by SDS-PAGE followed by Coomassie blue staining. (B) Total lysates from E. coli harboring pMAL-MBD1 alone or in combination with pT-E1E2S1 or pT-E1E2S3 were incubated with amylose beads, and the bound proteins were analyzed by SDS-PAGE followed by Coomassie blue staining. (C) Total lysates from E. coli harboring pET-MBD1 alone or in combination with pT-E1E2S1 or pT-E1E2S3 were incubated with Ni-NTA beads, and the bound proteins were analyzed by SDS-PAGE followed by Coomassie blue staining. (D) Total lysates from E. coli harboring pGEX vector alone or in combination with pT-E1E2S1 or pT-E1E2S3 were incubated with glutathione Sepharose beads, and the bound proteins were analyzed by SDS-PAGE followed by Coomassie blue staining. Note that GST alone appears to be modified poorly in this system, suggesting that the GST moiety within a fusion protein may not be effectively subjected to the SUMO conjugation reaction either. (e) Total lysates from E. coli harboring pMAL or in combination with pT-E1E2S1 or pT-E1E2S3 were incubated with amylose beads, and the bound proteins were analyzed by SDS-PAGE followed by Coomassie blue staining. Note that MBP alone appears to be modified poorly in this system, suggesting that the MBP moiety within the fusion protein may not be effectively subjected to the SUMO conjugation reaction either.
4. Notes 1. It should be mentioned that the plasmid vector designated as pT-E1E2S3 in this text was referred to as pT-E1E2S2 in the original paper (2). 2. BL21(DE3) is required at this point. The pT-E1E2S1/S3 vector carries a T7 promoter for high-level expression and therefore requires an E. coli strain containing a chromosomal
220
Saitoh, Uwada, and Kawasaki
copy of the RNA polymerase gene (DE3). Another advantage of the BL21(DE3) strain is its deficiency in the OmpT and Lon proteases, which could otherwise cause the proteolysis of overexpressed proteins. Make sure to avoid the use of the strain BL21(DE3)pLysS, since this carries a pLysS plasmid, which is incompatible with the pT-E1E2S1/S3 vector. 3. For optimal results, the volume of the DNA solution should not exceed 5% of the volume of the competent cells. 4. It is possible to perform double transformations with both plasmids in one step. However, transformation of cells with multiple plasmids may result in fewer colonies as compared to those seen in single-plasmid transformations. The efficiency of transformation with multiple plasmids is sensitive to both the post-transformation recovery period and the concentration of antibiotics used for selection. For these experiments, ensure that transformants are allowed to recover for at least 2 h before plating, and that the concentration of antibiotics is reduced to 50% of that recommended in Table 14.1. 5. For comparison, it is advisable to inoculate a control tube with bacteria that do not carry the SUMO-expression vector, pT-E1E2S1/S3, and process this in parallel. 6. To endure adequate aeration, the culture volume should represent less than 25% of the capacity of the flask. 7. Temperature, IPTG concentration and length of induction can all influence protein expression. Lower temperatures and lower concentrations of IPTG may induce protein expression at a slower rate, allowing better folding. Longer induction times, while increasing expression levels, may also induce proteolysis of the target protein. A range of temperatures, IPTG concentrations and inducation times should be tested to empirically determine the conditions that maximize the yield of intact, soluble protein. 8. It is important that the resin does not dry out during washing. A small amount of buffer should be left on the beads after aspiration. It is also important that slurries of beads should not be vortexed because this may fragment the beads. 9. The amount of sample eluted by 3x SDS buffer to use for SDS-PAGE depends on the detection limit of the assay. 10. In some cases, it will not be possible to visualize the bound SUMO-conjugated protein by staining of total protein. In this case, the other half of the sample can be used for Western blotting. 11. It should be noted that a growth of the starter culture at 37°C for extended periods may lead to plasmid silencing,
Expression of SUMO-Modified Proteins in E. coli
221
which will prevent expression of target and SUMO-enzyme proteins. If your protein of interest is toxic, expression at a higher density for a shorter period can help to increase the yield of modified protein. 12. If the protein is insoluble and thus not conjugated to SUMO in the E. coli system, it may be possible to obtain a soluble construct by truncating or deleting sections of the coding sequence. It is also a good idea to test a homolog of the protein from another species that may be more soluble. 13. Co-expression of any E3 protein may increase the degree of SUMO-modification. Given that the Duet vectors (Novagen) allow the simultaneous expression of up to eight proteins, the combination of Duet vectors containing the target protein and an appropriate E3 with pT-E1E2S1/3 vector would allow efficient sumoylation in E. coli. However, we have not attempted such co-expression.
Acknowledgements The authors would like to thank all the members of the Saitoh laboratory. This work was supported by the Naito Foundation and a Grant-in-Aid for Scientific Research from the JSPS to H. S.
References 1. Uchimura, Y., Nakamura, M., Sugasawa, K., Nakao, M., and Saitoh, H. (2004) Overproduction of eukaryotic SUMO-1- and SUMO-2-conjugated proteins in Escherichia coli. Anal. Biochem. 331, 204–206. 2. Uchimura, Y., Nakao, M., and Saitoh, H. (2004) Generation of SUMO-1 modified proteins in E. coli: towards understanding the biochemistry/structural biology of the SUMO-1 pathway. FEBS Lett. 564, 85–90. 3. Baba, D., Maita, N., Jee, J.G., Uchimura, Y., Saitoh, H., Sugasawa, K., Hanaoka, F., Tochio, H., Hiroaki, H., and Shirakawa, M. (2005) Crystal structure of thymine DNA glycosylase conjugated to SUMO-1. Nature 435, 979–982. 4. Dadke,S., Cotteret, S., Yip, S.C., Jaffer, Z.M., Haj, F., Ivanov, A., Rauscher, F. 3rd., Shuai, K., Ng, T., Neel, B.G., and Chernoff, J. (2007) Regulation of protein tyrosine phos-
5.
6.
7.
8.
phatase 1B by sumoylation. Nat. Cell. Biol. 9, 80–85. Martin, S., Nishimune, A., Mellor, J.R., and Henley, J.M. (2007) SUMOylation regulates kainate-receptor-mediated synaptic transmission. (2007) Nature 447, 321–325. Uchimura, Y., Ichimura, T., Uwada, J., Tachibana, T., Sugahara, S., Nakao, M., and Saitoh, H. (2006) Involvement of SUMO modification in MBD1- and MCAF1-mediated heterochromatin formation. J. Biol. Chem. 281, 23180–23190. Lyst, M.J., Nan, X., and Stancheva, I. (2006) Regulation of MBD1-mediated transcriptional repression by SUMO and PIAS proteins. EMBO J. 25, 5317–5328. Held, D., Yaeger, K., and Novy, R. (2003) New coexpression vectors for expanded compatibilities in E. coli. InNovations 15, 4–6.
Chapter 15 Preparation of SUMO Proteases and Kinetic Analysis Using Endogenous Substrates David Reverter and Christopher D. Lima Abstract SUMO proteases catalyze two reactions, deconjugation of SUMO from substrates and processing of precursor SUMO isoforms to prepare SUMO for conjugation. The SUMO protease family includes two members in yeast (Ulp1 and Ulp2) and as many as six members in human (SENP1-3, SENP5-7). SENP/Ulp proteases each contain conserved C-terminal domains that catalyze protease activity. The C-terminal protease domains exhibit unique specificities during SUMO processing and deconjugation in vitro. While there are many available reagents to assess these activities, including fusion proteins and chemically modified SUMO isoforms, our studies have indicated that the composition of substrates C-terminal to the scissile bond can substantively influence the activity of the protease. As such, we have relied extensively on assays that utilize endogenous substrates, namely wild-type SUMO precursors and SUMO conjugated substrates. In this chapter, we will describe methodological details for purification and characterization of SUMO precursors, SUMO conjugated substrates, and SUMO proteases. We will also describe methods for kinetic analysis of SUMO deconjugation and maturation using endogenous substrates. Key words: SUMO, SENP, isopeptidase, deconjugation, SUMO precursor, processing, protein purification.
1. Introduction SUMO is a member of the ubiquitin (Ub) and ubiquitin-like (Ubl) family. Post-translational attachment of SUMO to target proteins occurs through an enzymatic cascade analogous to the ubiquitin conjugation cascade (E1-E2-E3 enzymes), ultimately resulting in formation of an isopeptide bond between the Ub/Ubl C-terminal residue and substrate lysine residue (1, 2). While yeast includes one SUMO ortholog named Smt3, mammals contain Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
225
226
Reverter and Lima
at least four SUMO family members. SUMO-2 and SUMO-3 share greater than 96% sequence identity to each other in their processed forms, although each share only 43% and 42% identity to SUMO-1, respectively. SUMO-4 is more similar to SUMO2/3, but it remains unclear whether SUMO-4 forms SUMO conjugates (3). We utilize UniProtKB/Swiss-Prot nomenclature for human SUMO isoforms 1–4. The steady state level of a particular SUMO conjugated substrate is regulated by maintaining balance between SUMO conjugation and SUMO deconjugation. SUMO deconjugation occurs through the action of SUMO (SENP/Ulp) proteases. These enzymes are composed of at least two domains, an N-terminal domain, which directs subcellular localization, and a conserved C-terminal catalytic domain, which shares similarity to other papain-like cysteine proteases (4). SENP/Ulp proteases catalyze two essential activities. The first involves SUMO precursor maturation in a reaction that entails proteolysis and removal of amino acids C-terminal to the conserved SUMO di-glycine motif. The second proteolytic activity entails SUMO deconjugation from proteins, releasing both the target lysine and SUMO for subsequent rounds of conjugation. These two activities share a common catalytic mechanism, although the substrates differ insomuch as processing involves hydrolysis of an α-linked peptide bond and deconjugation catalyzes hydrolysis of the ε-linked lysine isopeptide bond (Fig. 15.1). The six human Ulp/SENP protease family members identified thus far are termed SENP1-3 and SENP5-7 (4,5). While their individual physiological roles remain somewhat obscure, recent reports support the hypothesis that SENP family members participate in non-redundant cellular functions. For example, mouse SENP1 is required during embryonic development (6), while knockdown of SENP5 inhibited cell proliferation and exhibited defects in nuclear morphology, revealing essential roles during mitosis and/or cytokinesis (7). The diversity of cellular functions for SENP proteases is supported by the observation that SENP proteases exhibit distinct subcellular localization patterns (8). It is believed in most instances that non-conserved N-terminal domains direct subcellular localization, and that subcellular localization contributes in part to SENP function by restricting protease activity to distinct areas within the cell. Recent studies have revealed differences in the ability of some SENP catalytic domains to catalyze maturation of SUMO precursors. While SENP1 and SENP2 can hydrolyze all three SUMO precursors, SENP2 exhibits a preference for SUMO-2 > SUMO-1 > SUMO-3 (9,10) while SENP1 exhibits different specificities during processing (SUMO-1 > SUMO-2 > SUMO-3) (11,12). For SENP2, substrate preferences were correlated to differences in polypeptide composition C-terminal to the scissile peptide bond
SUMO Protease Assays
227
Fig. 15.1. SUMO variants and substrates used in proteolytic assays. (A) SUMO with its C-terminal glycine reduced to aldehyde. (B) SUMO with its C-terminal glycine modified with vinyl sulfone. (C) SUMO with its C-terminal glycine modified with 7-amido-4-methylcoumarin. (D) Fusions in a single polypeptide of the SUMO precursor with the yellow fluorescent protein (YFP) at the N-terminus and the cyan fluorescent protein (CFP) at the C-terminus. (E) Fusion of SUMO with the cyan fluorescent protein (CFP) at the N-terminus forming an isopeptide bond with a lysine of a SUMO substrate fused to yellow fluorescent protein (YFP). (F) Endogenous SUMO precursor substrate. (G) Endogenous SUMO substrate, with its C-terminal glycine forming an isopeptide bond with a lysine of a substrate. Black arrows indicate the sites of nucleophilic attack and cleavage by the catalytic cysteine of the protease.
228
Reverter and Lima
in respective SUMO isoforms while for SENP1 and SENP2, substrate preferences could be explained by differences in affinity between the protease domain and principle interaction surfaces for respective SUMO isoforms (9–12). Recent analysis of SENP6 and SENP5 revealed that each preferred substrates containing isopeptide bonds, and both exhibited a preference for SUMO-2/3, either as a conjugated substrate or as chains (7,8). Kinetic analysis has provided unique insights into substrate specificity for SENP1 and SENP2, albeit with substantive differences in observed Kcat and Km values (10,12). While these differences may be attributable to indirect methodologies used to extract kinetic parameters from the experimental data, it is also possible that utilization of chemical or genetic modifications C-terminal to the SUMO scissile peptide bond might interfere with accurate assessment of protease activity. For instance, ubiquitin or SUMO-AMC (7-amido-4-methylcoumarin) modifications are commonly used substrates in proteolytic assays because they are easily followed by spectrofluorometric analysis (13) (Fig. 15.1). Ubiquitin aldehyde or vinyl sulfone derivatives are also commonly used as these C-terminal modifications trap intermediates of the proteolytic reaction (14). Another useful methodology employs FRET (fluorescence resonance energy transfer), in this case GFP and YFP are linked to both ends of the substrate and changes in fluorescence are monitored during proteolytic cleavage. This method is amenable to applications involving peptide and isopeptide cleavage assays, but is dependent on suitable FRET signal between donor and acceptor positions within the substrate (12). While these reagents have been used to determine Km or Ki values during proteolysis, they do not represent physiological substrates (13,14). In this chapter we describe procedures to express and purify SENP family members and methods to extract kinetic parameters for SENP protease activities under steady-state conditions using full-length SUMO isoforms and substrates that do not contain chemical modifications or fusion to foreign proteins.
2. Materials 2.1. Protein Expression and Purification
1. Luria-Bertani (LB) medium: 10 g bacto-tryptone, 10 g NaCl, 5 g bacto-yeast extract in 1 l water. 2. Super Broth (SB) medium: 32 g bacto-tryptone, 20 g bactoyeast extract, and 5 g NaCl in 1 l water. 3. Antibiotics: Ampicillin: 50 mg/ml in water, filter sterilized. Kanamycin: 50 mg/ml in water, filter sterilized. Chloramphenicol: 34 mg/ml in ethanol.
SUMO Protease Assays
229
4. Plasmids: pET-28b (Novagen). 5. PCR: oligonucleotide primers; Pfu turbo polymerase (Strategene) or Deep Vent polymerase (New England Biolabs); human cDNA (Clontech). 6. Bacterial strains: Escherichia coli BL21(DE3) RIL Codon Plus (Stratagene). 7. Isopropyl-beta-D-thiogalactopyranoside (IPTG): 1 M in water, filter sterilized. 8. Fermentation: fermentor equipped with a 14 l vessel (BioFlo-3000 from New Brunswick or equivalent). 9. Thrombin (SIGMA): 1 U/µl (0.33 µg/µl) in 20 mM TrisHCl pH 8.0, 350 mM NaCl, 1 mM β-mercaptoethanol (BME). 10. Ulp1 protease catalytic domain (amino acids 403–621): 3 mg/ml in 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, 10% glycerol at −80°C. 11. Suspension Buffer: 20% sucrose, 20 mM Tris-HCl pH 8.0, and 1 mM BME. 12. Lysis Buffer: 20% sucrose, 20 mM Tris-HCl pH 8.0, 1 mM BME, 350 mM NaCl, 20 mM imidazole, 10 µg/ml DNase, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1% IGEPAL CA-630, and 20 µg/ml lysozyme. 13. NTA-Ni Superflow resin (Qiagen or equivalent). 14. Buffer A: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, and 20 mM imidazole. 15. Buffer B: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, 1 mM BME, and 400 mM imidazole. 16. Buffer C: 20 mM Tris-HCl pH 8.0, 200 mM NaCl, and 1 mM BME. 17. Buffer D: 20 mM Tris-HCl pH 8.0, 50 mM NaCl, and 1 mM BME. 18. Buffer E: 20 mM Tris-HCl pH 8.0, 1 M NaCl, and 1 mM BME. 19. Buffer F: 20 mM Tris-HCl pH 8.0, 350 mM NaCl, and 1 mM BME. 20. Chromatography system (AKTA-FPLC from GE Healthcare or equivalent), equipped with gel filtration (Superdex-75 26/60 and Superdex-200 26/60) and ion exchange columns (Mono-Q 10/10 and Mono-S 10/10) (see Note 1). 21. Micro-filtration devices (Centricon or Centriprep from Amicon or equivalent) with appropriate molecular weight cut-offs (10 or 30 kDa).
230
Reverter and Lima
2.2. SUMO-Deconjugation Assays and SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
1. Buffer I: 20 mM Hepes pH 7.5, 5 mM MgCl2, 0.1% Tween20, 50 mM NaCl, 1 mM DTT and 2 mM ATP. 2. Buffer II: 25 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% Tween-20 and 2 mM DTT. 3. NuPAGE system for SDS-PAGE analysis with MES or MOPS running buffer (Invitrogen). 4. 4–12% polyacrylamide gradient gels. 5. 12% polyacrylamide gels. 6. SYPRO Ruby (Bio-Rad). 7. SYPRO fixing and destaining solution: 7% acetic acid, 10% methanol.
2.3. Integration and Data Analysis
1. Gel-Doc apparatus (Bio-Rad or equivalent) for gel visualization under UV irradiation. 2. Image processing and data integration: Quantity-One software (Bio-Rad). 3. Raw data processing: EXCEL (Microsoft). 4. Data and regression analysis: SigmaPlot 9.0 software (Systat Software, Inc).
3. Methods The C-terminal SENP/Ulp catalytic protease domains consist of approximately 220 residues and exhibit homology throughout the SENP/Ulp family. The first identified SENP/Ulp family member was Ulp1 (15), and the first structure of a SENP/Ulp catalytic domain was elucidated through x-ray structure determination of the yeast Ulp1 catalytic domain in complex with Smt3-aldehyde (16). We have utilized the structure of the Ulp1 catalytic domain in conjunction with sequence alignments to design PCR primers for respective catalytic domains for each member of the human SENP/Ulp protease family [for alignments, see Ref. (9)]. Details of this process and expression of a representative SENP family member will be addressed below. To analyze processing reactions for human SUMO family members, we have utilized native proteins and SUMO isoforms that exclude the native C-terminal stop codon and include a C-terminal hexahistidine affinity tag (Fig. 15.1). Based on our previous data with SENP2, protease specificity was substantially influenced by only 2–3 amino acids immediately C-terminal to the scissile peptide bond. In this instance, use of SUMO precursors with C-terminal hexahistidine sequences located after
SUMO Protease Assays
231
the endogenous stop codon appeared equivalent in processing reactions using SENP2 when compared to endogenous SUMO isoforms. Use of a C-terminal tag is especially useful during analysis of the SUMO-2 precursor as it includes a very short C-terminal native sequence (GG-VY) that complicates analysis because of the difficulty associated with resolving SUMO-2 substrates from SUMO-2 products by conventional SDS-PAGE electrophoresis. With that said, it remains a distinct possibility that other SUMO proteases may be inhibited or affected by inclusion of C-terminal affinity tags, so it is best to utilize comparative assays with both native and tagged SUMO isoforms during initial characterization (10). Deconjugation reactions utilize SUMO isoforms, which are conjugated to a substrate via a covalent isopeptide bond between the SUMO C-terminal glycine and substrate lysine (Fig. 15.1). For kinetic analysis, we describe the use of the C-terminal domain of human RanGAP1 since it can be readily conjugated to any SUMO isoform in quantities sufficient for further analysis. We also know this substrate to be a monomer in solution, simplifying kinetic analysis. While current structural and functional data suggest that the RanGAP1 substrate does not interact specifically with the protease catalytic domain, it does engage in contacts to the protease surface (10,12). As such, it is important to consider that SUMO substrates can interact with the protease domain and may thus affect kinetic analysis. 3.1. Preparation of SENP Catalytic Domains
1. Expression constructs containing catalytic domains for SENP/Ulp family members are defined by the structures of the catalytic domains from Ulp1, SENP1 and SENP2 (9,10,12,15). Primers are designed for human SENP family members and used to amplify the respective coding regions using PCR and human cDNA. Use of a low error PCR polymerase is recommended. 2. Using SENP2 as an example, design the primers to include NheI and HindIII restriction sites 5′ and 3′ to the coding regions to facilitate ligation into pET-28b. Use the NheI site to incorporate an N-terminal thrombin-cleavable hexahistidine tag fused to the SENP2 catalytic domain (364–489). Obtain stable clones by transforming into E. coli DH5α with the ligation products. Clones containing suitable inserts are then verified by DNA sequencing. This procedure has been repeated for other SENP/Ulp family members. Using this method we have successfully isolated Ulp1 and Ulp2 from yeast genomic DNA and SENP1, SENP2, SENP3, SENP5, SENP6 and SENP7 from human cDNA. 3. Generate bacterial strains suitable for protein expression by transforming respective plasmids into E. coli BL21 DE3
232
Reverter and Lima
codon plus strains. These cells contain the T7 polymerase and a ColE1-compatible plasmid that encodes additional copies of rare tRNA genes to enhance expression of recombinant polypeptides. 4. To induce protein expression, grow bacterial cultures by fermentation at 37°C to OD600 = 0.8 and induce protein expression by addition of IPTG to a final concentration of 0.5–1.0 mM. Incubate the cultures for another 3 to 4 h at 30°C. Harvest the cells by centrifugation (7000 × g) and discard the supernatant. 5. Suspend the cell pellets in Suspension Buffer. Cell pellets can be stored at this stage for later use by snap freezing the suspended pellets in liquid nitrogen. Equilibrate the cell suspensions in Lysis Buffer, and disrupt the cells by sonication. Remove the cell debris by centrifugation (40,000 × g). 6. Apply the supernatant to Ni-NTA resin equilibrated with Buffer A. To elute His6-SENP2 from the Ni-NTA resin, apply a step gradient with Buffer B to the chromatography column. Dialyze the peak fractions containing His6SENP2 against Buffer C overnight at 4°C in the presence of thrombin at a 1:1000 (w:w) thrombin to protein ratio. To ensure that thrombin cleavage is complete, analyze the reaction by SDS-PAGE before proceeding to the next step. 7. To purify SENP2, pass the dialyzed mixture through a 0.2 µm filter and apply to a gel filtration column (Superdex-200) equilibrated with Buffer F (see Notes 1 and 2). Analyze the fractions by SDS-PAGE. Those containing SENP2 are pooled, equilibrated to Buffer D, and applied to a cation exchange matrix (Mono-S). SENP2 Elute from the cation exchange resin by application of a salt gradient from Buffer D to 50% Buffer E. Fractions are again analyzed by SDS-PAGE and those containing SENP2 are pooled, concentrated to 10 mg/mL, snap frozen in liquid nitrogen, and stored at −80°C for future use. Purification protocols for other SENP/Ulp family members employ similar chromatography methods. Expression levels for recombinant Ulp1, SENP1, and SENP2 are high and approach 30 mg of purified material per liter of starting culture. 3.2. Cloning and Preparation of SUMO Precursors Fused to C-terminal Hexahistidine Tags
1. Isolate DNA encoding full-length SUMO-1, SUMO-2, and SUMO-3 precursors by PCR from human cDNA as described above. 2. Plasmids containing suitable SUMO DNA fragments for recombinant protein expression can be obtained by engineering NcoI and XhoI restriction sites into the upstream and downstream primers, respectively, but excluding the native stop codon
SUMO Protease Assays
233
to encode a polypeptide fused to a C-terminal hexahistidine sequence to facilitate purification by metal-affinity chromatography. Prepare these DNA fragments and ligate them into pET28b. Confirm the gene sequences by DNA sequencing. 3. Transform the plasmids into appropriate E.coli expression strains and induce protein expression as described above. 4. Cell pellets are suspended, lysed, and prepared as described in Step 5 (Sect. 3.1) and proteins are purified via Ni-NTA agarose chromatography (see above). 5. Analyze fractions by SDS-PAGE. Those fractions containing SUMO are buffer-exchanged by overnight dialysis into Buffer D, and applied to an anion exchange matrix (MonoQ). SUMO isoforms are eluted by application of a salt gradient from Buffer D to 50% Buffer E. Fractions are again analyzed by SDS-PAGE, and those that contain SUMO are pooled and applied to a gel filtration column (Superdex-75) equilibrated in Buffer F. 6. To prepare SUMO isoforms for large scale conjugation reactions, preSUMO is subjected to proteolysis using Ulp1 (16) at a protease to substrate ratio of 1:1000 (w:w). Remove trace quantities of Ulp1 by applying the reaction to an anion exchange resin (Mono-Q) followed by elution using a salt gradient from Buffer D to 50% Buffer E over 12 column volumes. Analyze the fractions by SDS-PAGE. Those containing SUMO are pooled and applied to a gel filtration column equilibrated in Buffer F (Superdex-75). Fractions are again analyzed by SDS-PAGE, and those that contain SUMO are pooled, concentrated to 10 mg/mL, snap frozen in liquid nitrogen, and stored at −80°C. 3.3. Cloning and Preparation of Native SUMO Precursors Fused to N-terminal Hexahistidine Tags
1. This protocol is similar to that described for purification of C-terminal hexahistidine tagged SUMO isoforms (see Sect. 3.2) but the cloning strategy differs. In this case, fulllength SUMO precursors containing native C-terminal tails and respective stop codons are produced by introducing an N-terminal hexahistidine tag which can be removed by proteolysis using thrombin, leaving behind three non-native N-terminal amino acid residues (Gly–Ser–His–). 2. To produce the desired native SUMO isoform precursors, ligate the coding DNA for respective SUMO isoforms into pET-28b using NheI and XhoI restriction sites engineered in upstream and downstream primers, respectively. 3. Transform plasmids into expression strains as described above. 4. Cell pellets are suspended, lysed, and prepared as described in Step 5 (Sect. 3.1) and proteins are purified via Ni-NTA agarose chromatography (see above).
234
Reverter and Lima
5. Cleave the N-terminal His-tag by overnight treatment of the His6-SUMO fusion with thrombin at a final thrombin to protein ratio of 1:1000 (w:w). The native SUMO isoform is purified by applying this mixture to anion exchange resin (Mono-Q) and eluting with a salt gradient from Buffer D to 50% Buffer E. Fractions containing SUMO are pooled and further purified by gel filtration chromatography (Superdex-75) as described above. 3.4. Preparation of SUMO-Conjugated Substrates
1. SUMO-conjugated substrates are prepared using SUMO conjugation enzymes in conjunction with mature SUMO and respective substrates [see Chapter on SUMO conjugation in this volume (Yunus and Lima) and Ref. (18)]. It is advantageous to purify and isolate SUMO-conjugated substrates by conventional chromatography methods to avoid potential artifacts generated by remnants of the affinity tags used for initial purification. We have developed preparative conjugation reactions for human SUMO substrates that include IκBα, P53, 10-mer P53 peptide, and RanGAP1. For our studies on deconjugation, we have principally utilized SUMO isoforms conjugated to the C-terminal RanGAP1 domain (9,10). 2. Preparative quantities of the RanGAP1 C-terminal domain can be produced in E. coli by conventional protein expression methods (17). RanGAP1 conjugation reactions are performed at 37°C in Buffer I containing 150 nM SUMO E1, 100 nM Ubc9 (E2), 16 µM of the desired SUMO isoform and 8 µM RanGAP1. The reaction typically requires 2–3 h to complete. The extent of conjugation is evaluated by SDSPAGE before proceeding to the next step. 3. The mixture is filtered, concentrated (if necessary), and purified by gel filtration chromatography (Superdex-75) as described above. In this instance, RanGAP1-SUMO can be readily separated from free SUMO and RanGAP1 since it migrates with an apparent molecular weight approximately twice that of its constituents.
3.5. Analysis of Processing and Deconjugation Reactions
1. Processing reactions (carboxyl-terminal hydrolase activity) include 10 µM native SUMO-1, -2 and -3 precursors in Buffer II. 2. Incubate the SUMO precursors with 10 nM SENP proteases (for SENP2), which corresponds to a protease:substrate ratio of 1:1000 (w:w). The reaction is incubated at 23, 30 or 37°C in Buffer II. 3. Remove samples at time points ranging from seconds to hours. Stop the reaction by addition of SDS-PAGE loading buffer, and analyze by SDS-PAGE.
SUMO Protease Assays
235
4. Fix the gels in SYPRO solution and stain them for 3 h using SYPRO-Ruby. Gels are de-stained in SYPRO solution for 30 min prior to visualization (see Note 3). 5. Protein bands are visualized in the gel by UV irradiation. Protein quantities are determined by 2-dimensional integration using a Gel-Doc apparatus and associated software. Fig. 15.2 depicts an example for quantifying SUMO processing reactions. 6. Deconjugation reactions utilize 3 µM SUMO-modified RanGAP1 and 5 nM SENP protease (SENP2) at 23, 30 or 37°C in Buffer II. 7. Remove samples at time points ranging from a few seconds to several minutes, stop the reaction by addition of SDSPAGE loading buffer, and analyze by SDS-PAGE. pSUMO-1
pSUMO-2
kDa M 0 2 4 8 16 30
C
pSUMO-3
0 2 4 8 16
0 2 4
pSUMO-1 Concentrations (µM)
8 16 min
[Processed SUMO] (µM)
A
25 20 15 10
2 4 8 16 24 48
1
0 0
100
Time
2 µM
4 µM
8 µM
16 µM 32 µM 48 µM
0
0
0
0
0
0
0
120
0.016
0.059
0.075
0.146
0.195
0.269
240
0.073
0.101
0.155
0.329
0.513
0.616
480
0.095
0.156
0.348
0.500
1.034
1.169
960
n.d.
n.d.
0.363
0.644
1.496
1.877
300
400
500
Time (sec)
Measure percentage of processed SUMO/Total SUMO to obtain concentration of processed SUMO (µM)
Determine Michaelis-Menten rate constants
D 0.008
0.006 Rate(s−1)
B
200
0.004
Km= 27.9+/−3.7 µM
Kcat= 0.72 +/−1.5 s−1 Kcat /Km= 2.6 x 104M−1s−1
0.002
Determine slopes at each concentration to estimate rates
0.000 0
10
20
30
40
50
pSUMO-1 (µM)
Fig. 15.2. Detection and kinetic analysis for SUMO processing reactions. (A) SDS-PAGE for a processing reaction with preSUMO-1, preSUMO-2 and preSUMO-3 stained with SYPRO. Bands were quantified with Bio-RAD Quantity One software. Boxes indicate integrated areas for estimation of protein levels and representative background levels. (B) Table indicating the concentration of processed SUMO at different times for a range of different SUMO concentrations. (C) Linear representation of the SUMO processing reaction from table in (B). Slopes represent SUMO processing rates at different substrate concentrations. (D) Michaelis-Menten kinetics was applied to SUMO processing rates in (C) to extract kinetic parameters. Data was obtained in triplicate to determine standard deviations and error bars.
236
Reverter and Lima
8. Gels are fixed in SYPRO solution and stained using SYPRORuby for 3 h. Gels are de-stained in SYPRO solution for 30 min prior to visualization. 9. Gels are visualized and analyzed as described in Step 5 above. Fig. 15.3 depicts an example utilized for quantifying SUMO deconjugation reactions. 3.6. Kinetic Analysis Under Multiple Turnover Conditions
1. Catalytic parameters for processing and deconjugation can be determined under steady state multiple turnover conditions using Michaelis-Menten kinetics by establishing conditions that enable rate measurements in the linear range during product formation. For reactions containing the SENP2 catalytic domain, preliminary titration analysis indicated that the respective binding constants were in the low µM range, thus enabling analysis by conventional SDSPAGE electrophoresis and SYPRO-Ruby staining, which is capable of detecting a broad range of protein concentrations (from 1–1000 ng/band) with sensitivity comparable to that obtained using silver stain. Using this method, we have extracted rate constants for deconjugation of RanGAP1SUMO-1 and RanGAP1-SUMO-2/3 and for processing of preSUMO-1, -2, and-3 (10) (Figs. 15.2 and 15.3). 2. During processing and deconjugation, initial reaction velocities are determined by titrating the substrate (from 40 nM to 96 µM) using SENP2 concentrations of 5 or 0.5 nM for processing or deconjugation reactions, respectively. The length for each respective time course has to be determined empirically to obtain initial rate velocities in the linear range. 3. Three to four time points should be measured for each substrate concentration to obtain estimates of reaction velocity in a linear range (Figs. 15.2 and 15.3). The respective bands are quantified by integrating the intensities contained within respective boxed areas (see Note 4). Numerical values are extracted for each band and analyzed to ensure that increasing substrate concentrations result in a commensurate increase in initial rate velocity at each substrate concentration (Figs. 2B, C and 3B, C). 4. The slope of each line represents an initial reaction velocity (see Note 5). These results are plotted against respective substrate concentrations (Figs. 2d and 3d). To obtain rate parameters, these data are fitted to a hyperbolic 2-parameter, single rectangular Michaelis-Menten function (ν = Vmax [S]/Km + [S]) using SigmaPlot to derive rate constants (kcat = Vmax/[E], and Km = Michaelis-Menten constant). Data should be measured in triplicate to obtain standard deviations and respective error bars (indicated at ±1 standard deviation).
SUMO Protease Assays
237
Fig. 15.3. Detection and kinetic analysis for SUMO deconjugating reactions. (A) SDS-PAGE for SUMO deconjugation reactions at RanGAP1-SUMO-1 concentrations of 2, 4, 8 and 16 µM. The gel was stained with SYPRO. Bands were quantified with Bio-RAD Quantity One software. Boxes indicate integrated areas for estimation of protein levels and representative background levels. (B) Table listing concentrations of released SUMO at different times for a range of different RanGAP1SUMO concentrations. (C) Linear representation of the SUMO deconjugation reaction from table in (b). Slopes represent SUMO deconjugation rates at different substrate concentrations. (D) Michaelis-Menten kinetics was applied to SUMO deconjugation rates in (c) to extract kinetic parameters. Data was obtained in triplicate to determine standard deviations and error bars.
4. Notes 1. To ensure reproducibility and to protect chromatography columns from undue wear and tear, all chromatographic steps were performed using filtered buffer solutions prepared from MilliQ (Millipore) water or the equivalent. All buffers should be degassed under vacuum for at least 1 hour prior to use. 2. All protein purifications should be conducted at 4°C to avoid degradation and/or aggregation. All protein preparations should be passed through a 0.2 µm filter prior to application to chromatography media. All proteins are flash-frozen in liquid nitrogen prior to storage at −80°C.
238
Reverter and Lima
3. SYPRO-Ruby staining is a reasonable method to quantify protein bands, but its sensitive detection limits can give rise to slow migrating bands in the gel. Duplicate gels are recommended for each experiment to ensure reproducibility. 4. Integration of signal requires proper background selection. We select individual background boxes adjacent to each band of interest. 5. To obtain kinetic parameters Km and Kcat, it is important to determine velocities at substrate concentrations at least ten-fold higher than Km to ensure that the reaction is nearing saturation. For Km values in the low nM range, SYPRO staining is not recommended due to its sensitivity limits. In this instance, one may utilize immunoblotting and detection with appropriate antibodies raised against SUMO or the desired substrate (18).
References 1. Hershko, A. and Ciechanover, A. (1998) The Ubiquitin System. Annu Rev Biochem. 67, 425–479. 2. Saitoh, H., Pu, R.T. and Dasso, M. (1997) SUMO-1: wrestling with a new ubiquitinrelated modifier. TIBS. 22, 374–376. 3. Towerbach, D., McKay, E.M., Yeh, E.T., Gabbay, K.H. and Bohren, K.M.T (2005) A proline-90 residue unique to SUMO-4 prevents maturation and sumoylation. Biochem Biophys Res Commun 337, 517–520. 4. Melchior, F., Schergaut, M. and Pichler, A. (2003) SUMO: ligases, isopeptidases and nuclear pores. TIBS 28, 612–618. 5. Yeh, E.T., Gong, L. and Kamitani, T. (2000) Ubiquitin-like proteins: new wines in new bottles. Gene 248, 1–14. 6. Yamaguchi, T. et al. (2005) Mutation of SENP1/SuPr-2 reveals an essential role for desumoylation in mouse development. Mol Cell Biol 25, 5171–82. 7. Di Bacco, A. et al. (2006) The SUMOspecific protease SENP5 is required for cell division. Mol Cell Biol 26, 4489–4498. 8. Mukhopadhyay, D., and Dasso, M. (2007) Modification in reverse: the SUMO proteases. Trends Biochem Sci. 32, 286–295. 9. Reverter, D. and Lima, C.D. (2004) A basis for SUMO protease specificity provided by analysis of human SENP2 and a SENP2SUMO complex. Structure 12, 1519–1531.
10. Reverter, D. and Lima, C.D. (2006) Structural basis for SENP2 protease interactions with SUMO precursors and conjugated substrates. Nat Struct Mol Biol. 13, 1060–1068. 11. Shen, L.N., Dong, C., Liu, H., Naismith, J.H. and Hay, R.T.T. (2006) The structure of SENP1-SUMO-2 complex suggests a structural basis for discrimination between SUMO paralogues during processing. Biochem J. 397, 279–288. 12. Shen, L., Tatham, M.H., Dong, C., Zagorska, A., Naismith, J.H. and Hay, R.T. (2006) SUMO protease SENP1 induces isomerization of the scissile peptide bond. Nat Struct Mol Biol. 13, 1069–1077. 13. Dang, L.C., Melandri, F.D. and Stein, R.L. (1998) Kinetic and Mechanistic Studies on the Hydrolysis of Ubiquitin C-Terminal 7-Amido-4-Methylcoumarin by Deubiquitinating Enzymes. Biochemistry 37, 1868–1879. 14. Hemelaar, J., Borodovsky, A., Kessler, B.M., Reverter, D., Cook, J. et al. (2004) Specific and covalent targeting of conjugating and deconjugating enzymes of ubiquitin-like proteins. Mol. Cell Biol 24, 84–95. 15. Li, S.J. and Hochstrasser, M. (1999) A new protease required for cell-cycle progression in yeast. Nature 398, 246–251. 16. Mossessova, E. and Lima, C.D. (2000) Ulp1-SUMO crystal structure and genetic
SUMO Protease Assays analysis reveal conserved interactions and a regulatory element essential for cell growth in yeast. Mol. Cell 5, 865–876. 17. Bernier-Villamor, V., Sampson, D.A., Matunis, M.J., and Lima, C.D. (2002) Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin-
239
conjugating enzyme Ubc9 and RanGAP1. Cell 108, 345–356. 18. Yunus, A.A. and Lima, C.D. (2005) Purification and activity assays for Ubc9, the ubiquitin conjugating enzyme for the small ubiquitin-like modifier SUMO. Methods Enzymol. 398, 74–87.
Chapter 16 An In Vitro FRET-Based Assay for the Analysis of SUMO Conjugation and Isopeptidase Cleavage Nicolas Stankovic-Valentin, Lukasz Kozaczkiewicz, Katja Curth, and Frauke Melchior Abstract To measure rates of sumoylation and isopeptidase cleavage in vitro, we developed an enzyme assay that is based on fluorescence resonance energy transfer (FRET). FRET is a process by which the excited state energy of a fluorescent donor molecule is transferred to an acceptor molecule. Efficient energy transfer requires very close proximity, and can therefore be used as a read-out for covalent and non-covalent protein interactions. The assay described here uses bacterially expressed and purified YFP-SUMO-1 and CFP-RanGAP1 as model substrates that are covalently coupled in the presence of recombinant SUMO E1 and E2 enzymes and ATP. Reactions of 25 µl volume, set up in 384-wells plates, give sufficient signal for analysis. Consequently, this assay requires very low amounts of recombinant proteins and allows measurement of time courses in high-throughput format. Key words: SUMO, E1 activating enzyme, E2 conjugating enzyme, Aos1/Uba2, Ubc9, yellow fluorescent protein, fluorescence resonance energy transfer, FRET, isopeptidase.
1. Introduction Analysis of sumoylation generally involves detection of the modified species by SDS-PAGE, immunoblotting or autoradiography. These techniques are not only time- and material-consuming, they are also not easily applicable for kinetic, quantitative or high-throughput assays. To circumvent these problems, we have developed a fluorescence resonance energy transfer (FRET) based sumoylation assay (1). FRET is a process by which the excited state energy of a fluorescent donor molecule is transferred emissionfree to an acceptor molecule. The consequence is a significant Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
241
242
Stankovic-Valentin et al.
reduction in donor and a concomitant appearance of acceptor emission. Efficient energy transfer not only requires overlapping emission and excitation spectra, it also requires very close proximity (less than 10 nm) of the donor and acceptor molecules. FRET is therefore widely used as a sensor for inter- or intra-molecular protein interactions (reviewed in Ref. (2, 3) ). The basic outline of the in vitro FRET assay described here is shown in Fig. 16.1A. Yellow fluorescent protein (YFP)-tagged mature SUMO and Cyan fluorescent protein (CFP)-tagged RanGAP1 (amino acids 400–589, referred to as CFP-GAPtail) are used as model substrates. RanGAP1 was chosen because it is one of the most efficient SUMO targets known to date (4, 5). Moreover, its in vitro sumoylation does not require addition of an E3 ligase, which simplifies the assay (6). Reactions containing the fluorescent substrates and E1 and E2 enzymes are set up in 384-well microtiter plates in a final volume of 25 µl. Sumoylation of CFP-GAPtail is started upon addition of ATP, and samples are analyzed in time-dependent manner in a fluorescence microtiter plate reader. Isopeptidase activity can be measured upon addition to preformed YFP-SUMO*CFP-GAPtail conjugates. Applications for our assay include characterization of E1 and E2 enzymes (see for example the comparison of two distinct E1 enzyme preparations in the accompanying chapter by Werner et al. on in vitro sumoylation), identification of enzyme inhibitors (7), comparison of wild type and mutant SUMO proteins, characterization of isopeptidases, and comparative analysis of cell extracts for modifying or demodifying activities. The assay is presently not applicable for analysis of E3 ligases, but this could be changed by replacing CFP-RanGAPtail with a CFP-tagged E3 ligase-dependent SUMO target. Here we provide a detailed protocol for bacterial expression and purification of the fluorescent substrates YFP-SUMO and CFP-GAPtail and describe the basic setup for use of the assay in conjugation and cleavage reactions. Recombinant expression and purification of the SUMO E1 enzyme Aos1/Uba2 and the E2 enzyme Ubc9 is described in Chaps. 11 and 12.
Fig. 16.1. (A) Principle of the FRET based sumoylation/desumoylation assay. YFP-SUMO-1 and CFP-GAPtail are conjugated upon addition of ATP and the SUMO E1 enzymes Aos1/Uba2 and Ubc9. This can be followed upon excitation of CFP at 430 nm by measuring emission at 485 and 527 nm. Conjugation allows FRET to take place. As a consequence, emission at 485 nm decreases while emission at 527 nm increases. (B) Upper panel : Titration of the E1 conjugating enzyme. Several dilutions of the E1 enzyme were prepared in SAB buffer and added to a mix containing E2, YFP-SUMO-1 and CFP-GAPtail. The reaction was started by automatic addition of 5 µl ATP. Fluorescence after excitation at 430 nm was measured every minute at 485 and 527 nm. The ratio of emission (527/485 nm) was plotted versus time. Lower panel : Titration of the E2 conjugating enzyme. Several dilutions of the E2 enzymes were prepared in SAB buffer, added to a mix containing E1, YFP-SUMO-1 and CFP-GAPtail, and tested as in (b).
FRET Assay to Study In Vitro Sumoylation
243
244
Stankovic-Valentin et al.
2. Materials 2.1. YFP-SUMO and CFP-GAPtail Purification
1. E. coli Rosetta (DE3) Single strain. 2. LB medium (Carl Roth GmbH): plates and liquid medium, supplemented with 100 µg/ml ampicillin. 3. MgCl2: 1 M, autoclave before use. 4. 20% glucose: sterilize by filtration and store at −20°C. 5. pET11d-YFP-SUMO-1 (see Note 1): briefly, the coding sequence for human mature SUMO-1 (amino acids 1–97) was obtained by PCR amplification from pET11SUMO1∆C4 (7) and cloned into the KpnI and BamHI sites of pEYFP-C1 (Clontech). The YFP-SUMO-1 fragment was extracted by digestion of this plasmid with NcoI and BamHI and was cloned into the NcoI and BamHI sites of pET11d. 6. pET11d-CFP-GAPtail (see Note 1): briefly, the C-terminal domain of mouse RanGAP1 (amino acids 400–589) was obtained by digesting pHHS10B GAPtail (4) with BglII and EcoRI and was cloned into the corresponding sites of pECFP-C1 (Clontech). pECFP-GAPtail was digested with NcoI and BamHI and the CFP-GAPtail fragment was cloned into the NcoI and BamHI sites of pET11d. 7. Stock solution of IPTG (isopropyl-β-D-thiogalactosidase): 1 M in water, sterilized by filtration and stored in aliquots at −20°C. 8. SUMO Lysis buffer: 50 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 8.0. 9. GAP Lysis buffer: 50 mM Tris-HCl, 20 mM NaCl, 1 mM EDTA, pH 8.0. 10. Stock solution of DTT: 1 M in water, stored in aliquots at −20°C. 11. Stock solution of leupeptin + pepstatin: 1 mg/ml of leupeptin and 1 mg/ml of pepstatin in DMSO, stored in aliquots at −20°C. 12. Stock solution of aprotinin: 1 mg/ml in 20 mM HEPES pH 7.4, stored in aliquots at −20°C. 13. Stock solution of lysozyme: 25 mg/ml in water, stored in aliquot at −20°C. 14. Low protein binding filters − 0.2 µm (e.g., Acrodisc LC25, PALL Life Sciences). 15. FPLC system (e.g., ÄKTA purifier, GE Healthcare) equipped with Q Sepharose chromatography column (e.g., HiTrap Q
FRET Assay to Study In Vitro Sumoylation
245
FF 5 ml, GE Healthcare) and S-75 preparative gel filtration column (e.g., HiLoad 26/60 Superdex 75 pg, GE Healthcare). 16. Buffer A: 50 mM Tris-HCl, pH 8.0, 1 mM DTT, 1 µg/ml each of aprotinin, pepstatin and leupeptin. 17. Buffer B: 50 mM Tris-HCl, pH 8.0, 1 M NaCl, 1 mM DTT, 1 µg/ml each of aprotinin, pepstatin and leupeptin. 18. Transport Buffer: 20 mM HEPES, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, pH 7.3, 1 mM DTT, 1 µg/ml each of aprotinin, pepstatin and leupeptin. 19. Protein concentrators with 10 kDa cut-off (e.g., VIVASPIN, Sartorius). 20. 12% SDS polyacrylamide gels. 2.2. FRET-Based SUMO Conjugation Assay
1. SAB buffer: 20 mM HEPES, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, pH 7.3, 0.05% Tween-20, 0.2 mg/ml ovalbumin, 1 mM DTT and 1 µg/ml each of aprotinin, leupeptin and pepstatin. 2. E1 and E2 recombinant enzymes (see accompanying chapter by Werner et al.). 3. CFP-GAPtail and YFP-SUMO-1 recombinant proteins (purified as described below in Sect. 3.1). 4. Black 384-well plates (e.g., Greiner). 5. ATP: 5 mM in SAB buffer (see Item 1). 6. Fluorescence microtiter plate reader (e.g., Fluoroskan Ascent. Labsystems) with 430 nm excitation filter and 485 and 527 nm emission filters. Ideally, the plate reader should be equipped with an automatic sample dispenser.
2.3. FRET-Based SUMO Deconjugation Assay 2.3.1. Conjugate Preparation
1. YFP-SUMO and CFP-GAPtail recombinant proteins (see Sect. 3.1). 2. SAB buffer (see Sect. 2.2 Item 1). 3. Recombinant E1 and E2 enzymes (see the accompanying chapter by Werner et al.). 4. ATP (see Sect. 2.2 Item 5). 5. Apyrase (e.g., from SIGMA) at 1 U/µl.
2.3.2. Deconjugation Reaction
1. SAB buffer (see Sect. 2.2. Item 1). 2. Black 384-well plates (e.g., Greiner). 3. Fluorescence microtiter plate reader (e.g., Fluoroskan Ascent, Labsystems) with 430 nm excitation filter and 485 and 527 nm emission filters.
246
Stankovic-Valentin et al.
3. Methods 3.1. YFP-SUMO and CFP-GAPtail Purification
The protocols for purification of YFP-SUMO-1 and CFP-GAPtail are nearly identical. The only difference is the salt concentration in the lysis buffer and the ion exchange chromatography due to different strength in binding to the anion exchanger. Of note, while the protocols describe purification and use of YFP-SUMO-1, the procedures are valid also for expression, purification and application of YFP-SUMO-2 and YFP-SUMO-3. Unless stated otherwise, all buffers are ice cold and procedures are carried out on ice or at 4°C. Protease inhibitors and DTT are added to the buffers directly before use. 1. Transform the E. coli strain Rosetta (DE3) Single with pET11aYFP-SUMO-1 or pET11aCFP-GAPtail, plate on LB with ampicillin. Incubate overnight at 37°C. 2. Pick a single colony to inoculate 500 ml LB with ampicillin, 1 mM MgCl2, 0.1% glucose, and incubate in a shaker (200 rpm) overnight at 37°C. Pellet bacteria by centrifugation and resuspend the pellet in 2 l of LB with ampicillin, 1 mM MgCl2, 0.1% glucose. Induce immediately with 1 mM IPTG and grow for 6 h at 20°C and 200 rpm. 3. Collect bacteria by centrifugation and resuspend in 50 ml of SUMO or GAP lysis buffer, respectively. Flash-freeze in liquid nitrogen. Quickly thaw the pellet in a water bath at room temperature; add protease inhibitors to final concentration each of 1 µg/ml and DTT to final concentration of 1 mM. 4. Add 50 mg of lysozyme. Incubate for 60 min on ice. Centrifuge the lysate at 100,000g for 60 min. 5. Filter the supernatant through a 0.2 µm low protein-binding filter. 6. Equilibrate a 5 ml Q-Sepharose column with 95% buffer A, 5% buffer B for YPF-SUMO-1 purification, or 98% buffer A, 2% buffer B for CFP-GAPtail purification. Load 25 ml of the filtered supernatant onto the column. Wash the column with 20 ml of SUMO or GAP lysis buffer, respectively. Elute with a linear NaCl gradient up to 500 mM NaCl using buffers A and B, in a total volume of 200 ml, and collect 5 ml fractions. 7. Analyze the yellow fractions by SDS-PAGE (see Note 2). 8. Concentrate the cleanest fractions to a final volume of 5 ml using a protein concentrator with a 10 kDa MW cut-off and load onto an S-75 preparative column, equilibrated with TB buffer. Analyze the yellow fractions by SDS-PAGE (see Note 2). Pool the cleanest fractions and concentrate down to 1 mg/ml.
FRET Assay to Study In Vitro Sumoylation
247
9. Prepare 10 µl aliquots, flash-freeze in liquid nitrogen and store at −80°C. The substrates are stable for years. While aliquots can be refrozen several times, we prefer to use each aliquot only once. 10. The yield is usually 10 mg per liter culture for YFP-SUMO and 2 mg per liter culture for CFP-GAPtail. 3.2. FRET-Based Sumoylation Assay
The FRET-based sumoylation assay is carried out in 384-well plates at a final reaction volume of 25 µl. All invariant components needed for a series of assays (with the exception of ATP) are premixed in a single test tube to avoid variations in pipetting. This premix is placed in the wells, and the variable component is added manually to each well such that the final volume is 20 µl. After preincubation to reach the desired reaction temperature (normally 30°C), the reaction is started by addition of 5 µl ATP. Ideally, an automated sample dispenser is used to inject the ATP, which allows the analysis of large sample numbers even when the reaction takes place within just a few minutes. At desired time intervals (usually every 0.5 to 2 min), CFP is excited at 430 nm, and emissions are recorded at 485 and 527 nm. Upon conjugation of YFP-SUMO-1 to CFP-GAPtail, CFP emission decreases, while YFP emission increases (Fig. 16.1A). The ratio of emissions at 527 and 485 nm is calculated, and data are plotted as a function of time. The following protocol provides an example application for the FRET assay. Here, serial dilutions of the recombinant E2 enzyme Ubc9 were tested for activity. YFP-SUMO-1, CFP-GAPtail and the E1 enzyme Aos1/Uba2 were kept constant in each assay. As a negative control, one sample obtained buffer instead of Ubc9. A second example, comparison of two different preparations of SUMO E1 enzyme, is shown in the accompanying chapter by Werner et al. Other applications can be found in the literature (1, 7). 1. Prepare a master mix (15 µl per reaction) that contains the E1 enzyme and the two fluorescent substrates YFP-SUMO-1 and CFP-GAPtail (see Note 3). Concentrations in the final reaction volume of 25 µl should be 10 nM for the E1 enzyme and 100 nM each for CFP-GAPtail and YFP-SUMO-1. Complete the mix with SAB buffer (see Note 4). 2. Carefully place 15 µl of this master mix into each well (see Note 5). 3. Prepare a serial dilution of the E2 enzyme in SAB buffer, such that 5 µl contain the desired amount per assay (the stock solutions need to be 5-fold more concentrated than the desired concentration in the assay). Here, serial dilutions of Ubc9 had concentrations of 750, 75, 15, 7.5 and 3.75 nM. The final dilution will be 5-fold lower. (Fig. 16.1, lower panel).
248
Stankovic-Valentin et al.
4. Add 5 µl of the different E2 dilutions to their respective wells. To one well add 5 µl SAB buffer as a negative control. 5. Optional: If an automatic dispenser is used, wash and fill (prime) the dispenser with a solution of 5 mM ATP. 6. Preincubate the plate for 10 min at 30°C in the fluorescence microtiter plate reader. 7. Reactions are started either by automated or by manual addition of ATP (5 µl/well). 8. At desired time points, samples are excited at 430 nm and fluorescent emissions at 485 and 527 nm are recorded with an integration time of 100 ms. We usually take measurement every minute over the course of 45 min but reactions can also be followed for longer periods (see Note 6). 9. For each time point determine the ratio of fluorescence emissions at 535 and 485 nm. Plot these values as a function of time (see Notes 7 and 8). 3.3. FRET-Based Isopeptidase Assay
Obviously, the FRET assay can also be used for the analysis of SUMO isopeptidases, as cleavage of preformed YFP-SUMO*CFP-GAPtail conjugate results in loss of the FRET signal. For isopeptidase assays, we prepare large amounts of fluorescent conjugate by an in vitro sumoylation reaction, deplete ATP to prevent continued modification, and store the conjugate in small aliquots at −80°C. Similar to modification reactions, isopeptidase assays are carried out in 384-well plates in a final reaction volume of 25 µl, and reaction kinetics are followed by time-dependent analysis of fluorescence emissions at 485 and 525 nm. Two short protocols are provided below, one for the large scale preparation of conjugate, and one example application, in which a serial dilution of a recombinant isopeptidase fragment was tested for activity (other examples can be found in the literature (1,7). The assay can be used for applications such as the characterization of known isopeptidases, comparisons of activities in cell and tissue samples, or screens for inhibitors. At present the assay allows studies involving different SUMO paralogs, but it is limited to one target, RanGAP1. Other CFP-tagged targets can be included as long as they can be efficiently modified and give rise to a significant FRET signal.
3.3.1. CFP-GAPtail Conjugate Preparation
Usually, we prepare 40 µg of the CFP-GAPtail*YFP-SUMO-1 (or -SUMO-2) conjugate at a concentration of 80 µg/ml (1 µM). This is sufficient for up to 200 standard isopeptidase assays, depending on the specific assay and the sensitivity of the machine. 1. Mix 20 µg YFP-SUMO-1, 20 µg CFP-GAPtail, 400 ng E1 and 500 ng E2 enzymes. Complete with SAB buffer to
FRET Assay to Study In Vitro Sumoylation
249
495 µl. The conjugation reaction is started by addition of 5 µl 100mM ATP. 2. Incubate for 40 min at 37°C. 3. Deplete ATP by incubation with 1 U of apyrase for 20 min at 30°C. Aliquot the conjugate, flash-freeze in liquid nitrogen and store at −80°C. 4. Control successful conjugation by SDS-PAGE or Westernblotting with anti-GFP antibodies. 3.3.2. Deconjugation Assay
In this example (Fig. 16.2), the deconjugation assay was used to study the activity of a recombinant SUMO isopeptidase fragment (GST-SENP1 catalytic domain, amino acid 419–644), which was cloned from a full-length construct kindly provided by Dr. Bailey and Dr. O’Hare (8). 1. Place between 2 and 20 µl of the undiluted conjugate into each of the required wells of a black 384-well plate (see Notes 5 and 9). 2. Prepare dilutions of GST-SENP1 catalytic domain (5 µM, 1 µM, 500 nM, 200 nM) in SAB buffer. The final dilution will be 5-fold lower. 3. Add 5 µl of the isopeptidase dilutions per well (duplicate assays are recommended). One well receives SAB buffer instead of isopeptidase and is used as a negative control. 4. At desired time points (usually every minute), samples are excited at 430 nm and fluorescent emissions at 485 and
Fig. 16.2. SUMO deconjugation assay. 20 µl of isopeptidase substrate (a preformed conjugate of YFP-SUMO-1 and CFP-GAPtail) were placed in several wells of a 384well microtiter plate. Recombinant isopeptidase fragment (GST-SENP1) was added at the indicated concentration, and the reaction was followed upon excitation of CFP at 430 nm by measuring emission at 485 and 527 nm. The ratio of emission (527/485 nm) was plotted versus time.
250
Stankovic-Valentin et al.
527 nm are recorded with an integration time of 100 ms. Follow the reaction for 30–60 min. 5. For each time point determine the ratio of fluorescence emissions at 535 and 485 nm. Plot these values as a function of time (see Note 8).
4. Notes 1. The plasmid is available from our lab upon request. 2. Always check the fractions by SDS-PAGE. The yellow color of the fraction is not sufficient to determine whether it contains the full-length fusion protein, as fluorescent cleavage products can be also present. 3. As E1 and E2 enzymes lose some activity upon freeze-thawing we use each aliquot only once. YFP-SUMO-1 and CFPGAPtail can be frozen several times. 4. Always prepare the dilution in SAB buffer. This buffer contains Tween and ovalbumin to prevent non-specific adsorption of the proteins to plastic. 5. Special care needs to be taken to avoid air bubbles, as these obscure the reading. 6. Depending on the concentration of E1 and E2 enzymes, sumoylation reactions may be completed within a few minutes or could need several hours. With appropriate dilutions, assays can be linear over 60 min, but longer reaction times should be avoided due to inactivation of the enzymes. Measurement intervals should be chosen such that at least 20 time points can be recorded. Short measurement intervals in combination with large sample numbers may be a problem for the plate reader (for sample numbers < 40 we can measure every minute, with sample numbers > 40 we increase time intervals to 2 min). 7. The ratio at time zero is usually around 0.4. This is due to the emission profile of CFP, which has a maximum at 485 nm but still significantly emits light at 527 nm. The read out is influenced by buffer composition and pH, so care should be taken that samples are comparable. Over time, absolute values of emission decrease slowly, likely due to bleaching and protein unfolding or aggregation, but the ratio should remain rather constant over 60 min. 8. A simple control to test whether the read out correlates with bona fide conjugation is to add 25 µl SDS-PAGE sample buffer
FRET Assay to Study In Vitro Sumoylation
251
to the wells immediately after completion of the time course and test for appearance or disappearance of conjugate by immunoblotting with anti GFP antibodies (shown in Ref. (1) ). 9. The stability of the assay increases with increased conjugate concentration.
Acknowledgments We would like to acknowledge previous and current lab members for contributing to the assay development, for sharing reagents and for many stimulating discussions. Funding by the EU (Rubicon and UbiRegulator), and fellowships by the Fondation pour la Recherche Médicale (to NS) and the Niedersachsen Lichtenberg Program (to LK) are gratefully acknowledged.
References 1. Bossis, G., Chmielarska, K., Gartner, U., Pichler, A., Stieger, E., and Melchior, F. (2005) A fluorescence resonance energy transfer-based assay to study SUMO modification in solution. Methods Enzymol 398, 20–32. 2. Piston, D. W., and Kremers, G. J. (2007) Fluorescent protein FRET: the good, the bad and the ugly. Trends Biochem Sci 32, 407–414. 3. Tsien, R. Y. (1998) The green fluorescent protein. Annu Rev Biochem 67, 509–544. 4. Mahajan, R., Gerace, L., and Melchior, F. (1998) Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J Cell Biol 140, 259–270.
5. Matunis, M. J., Wu, J., and Blobel, G. (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J Cell Biol 140, 499–509. 6. Pichler, A., Gast, A., Seeler, J. S., Dejean, A., and Melchior, F. (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108, 109–120. 7. Bossis, G., and Melchior, F. (2006) Regulation of SUMOylation by reversible oxidation of SUMO conjugating enzymes. Mol Cell 21, 349–357. 8. Bailey, D., and O’Hare, P. (2004) Characterization of the localization and proteolytic activity of the SUMO-specific protease, SENP1. J Biol Chem 279, 692–703.
Chapter 17 FRET-Based In Vitro Assays for the Analysis of SUMO Protease Activities Michael H. Tatham and Ronald T. Hay Abstract In humans cells three SUMO paralogues (SUMO-1, SUMO-2 and SUMO-3) and six SUMO specific proteases (SENP1-SENP3 and SENP5-SENP7) are expressed. Together the SUMO proteases perform three distinct functions. They: (1) process the immature pro-SUMO proteins into the active forms, (2) remove SUMO molecules conjugated to protein targets, and (3) depolymerise SUMO conjugated within polymeric chains. By regulating these processes the SENPs play a crucial role in regulating the sumoylation state of target proteins in cells, and therefore are academically and pharmacologically interesting enzymes. Gel-based techniques for SENP analysis are well established and can be used for many applications, but their laborious methodology makes them cumbersome tools for kinetic analysis or inhibitor screening. Therefore in vitro FRET-based assays have been developed to test the three major functions of the SENPs. These use fluorescent protein fusions of the SUMOs, and together facilitate high-throughput, real-time analysis of the three major SUMO protease activities. Key words: SUMO, sentrin eprotease, SENP FRET, inhibitory peptide, sumoylation, isomerisation. •
1. Introduction The post-translational conjugation of ubiquitin-like proteins (Ulps) into specific target proteins represents an important group of regulatory mechanisms in cells. The conjugation of members of one Ulp sub-family, the three small ubiquitin-like modifiers SUMO-1, SUMO-2 and SUMO-3, onto protein targets is no exception, and is known to play a significant role in a variety of cellular functions (1). SUMO-1 has approximately 50% sequence identity with SUMO-2 and SUMO-3, which differ from one another Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
253
254
Tatham and Hay
N-terminally to the diglycine motif only by 3 amino acids, and are thought to be largely functionally redundant (2–4). Dependent on the substrate, sumoylation (the conjugation of SUMO onto proteins) can regulate protein-protein and protein-DNA interactions with a variety of physiological consequences, including transcriptional control, maintenance of genome integrity, protein trafficking and protein stability. Unsurprisingly, with such a diverse range of consequences sumoylation substrates are not restricted to any particular subsection of the proteome, although many are involved in chromatin organization, transcriptional regulation and RNA metabolism (1, 5). Importantly, the SUMO modification state of a particular protein is regulated not only at the level of attachment, but also removal. Thus, the extent to which proteins are conjugated to SUMO is a consequence of the balance of activities of the specific conjugation enzymes E1, E2 and E3, as well as the deconjugating proteases. In eukaryotes a single heterodimeric E1 enzyme (SAE1/SAE2 or Uba2-Aos1) and a single E2 (Ubc9), co-operate with a number of E3 ligases to control SUMO attachment. The reverse reaction is catalyzed by the SUMO-specific proteases, also known as the Sentrin proteases (or SENPs). In the yeast S. cerevisiae two proteases, Ulp1 and Ulp2, are known to act upon the yeast SUMO orthologue Smt3, while in humans the SENP family contains six members, Senp1-3 and Senp5-7 (6). The SUMO proteases perform three major functions in cells (Fig. 17.1). Firstly, as discussed above, they oppose the conjugation enzymes by deconjugating SUMO from target proteins. This deconjugation function is also known as isopeptidase activity, because sumoylation results in the formation of an isopeptide bond between the SUMO C-terminus and the ε-amino group of the target lysine. Secondly, due to the fact that the primary translation products of the three SUMOs are inactive, requiring removal of C-terminal residues to expose the diglycine motif essential for conjugation, the SUMO proteases are also required for the maturation of the SUMO proteins by a function known as C-terminal hydrolase activity, or processing activity. Finally, owing to the fact that SUMO can conjugate onto an internal lysine on other SUMO molecules, thus forming polymeric conjugates, the SUMO proteases are responsible for depolymerizing SUMO back to monomers. Genetic studies in yeast have shown that Ulp1 and Ulp2 are non-redundant, with the ulp1 deletion mutant being lethal (G2 to M progression block) (7, 8). Cells lacking Ulp2, although viable, are defective in sporulation, are temperature-sensitive for growth, have decreased plasmid and chromosome stability, and display unusual cell morphology (9). In vivo Ulp1 and Ulp2 have distinct sets of target substrates, and it is Ulp1 that is responsible for Smt3 C-terminal hydrolase activity (9) although both are
FRET-Based SUMO Protease Assays
255
Fig. 17.1. The three modes of action of SUMO proteases. The SUMO proteases perform three major functions in vivo. Before the newly translated SUMO-1 (S1), SUMO-2 (S2), or SUMO-3 (S3) can be conjugated to protein targets, inhibitory C-terminal peptides (shaded ovals) must be removed. This is known as processing or maturation and is the result of the C-terminal hydrolase activity of the SUMO proteases. SUMO proteases, via their isopeptidase activity, also deconjugate SUMO moieties attached to protein substrates, and remove SUMO from other SUMO molecules when functioning to depolymerize SUMO polymers. Filled arrowheads indicate point of protease action, and bold arrows and text show direction of protease reaction progress (Adapted from Ref. 6).
known to possess hydrolase and isopeptidase activities in vitro. Ulp2 appears to be responsible for depolymerizing poly-Smt3 in vivo (10). In humans four of the SUMO proteases, SENP1, SENP2, SENP3 and SENP5, are most closely related to Ulp1, while SENP6 and SENP7 are closer relatives of Ulp2. These similarities are also reflected in function, with SENP1, SENP2, SENP3 and SENP5 displaying varying degrees of isopeptidase and C-terminal hydrolase activities towards the three SUMOs, while SENP6 and SENP7 function to depolymerize SUMO chains. Importantly, in yeasts and humans, the different SUMO proteases are localized to specific cellular compartments, which likely play a significant part in their function in vivo. For a current summary of the substrate specificity and cellular distribution of the SUMO proteases, see Ref. (6). The SENPs are cysteine proteases and all contain a conserved protease domain of about 200 amino-acids that harbors the CysAsp-His catalytic triad. The remaining regions of the SENPs are largely unrelated and vary in length from around 350 to 900 residues. These domains are thought to be important for directing the SENPs to particular subcellular localizations and to regulate substrate specificity (11). There are a number of methods available for the in vitro analysis of SUMO proteases. The simplest gel-based approaches have the advantage of using the ‘native’ proteins, but are laborious, technically demanding and difficult to quantitate (12, 13).
256
Tatham and Hay
However, recently a number of high-throughput methods have been developed (14–18) that provide a means of real-time, quantitative analysis of the progress of a protease reaction. Of these, the FRET-based assays are the only ones that have been adapted to analyze all thee SUMO protease functions in a SUMO paralogue-specific manner.
2. Materials 2.1. Production of ECFP and YFP Fusion Proteins
1. Luria Broth (Merck): prepared as described by the manufacturer and stored in 10–500 ml volumes at 4°C after autoclaving. 2. Kanamycin: dissolved in distilled water to 50 mg/ml, 0.22 µm filter-sterilized and stored in 100–1000 µl aliquots at −20°C (single use). 3. Isopropyl-β-D-thiogalactopyranoside (IPTG): just before use dissolve in Luria broth to 400 mM and 0.22 µm filter-sterilize. 4. Complete protease inhibitor tablets (Roche): dissolve the desired number of tablets in the lysis buffer just before use. 5. Imidazole: dissolve in distilled water to 1 M and stored at −20°C in 100–1000 µl aliquots. 6. Phosphate-buffered saline (PBS). 7. Lysis buffer: PBS with 0.3 M NaCl, 20 mM imidazole, 5 mM β-mercaptoethanol and complete protease inhibitors. 8. Wash buffer: PBS with 0.3 M NaCl, 30 mM imidazole, 1 mM PMSF, 1 mM benzamidine, 5 mM β-mercaptoethanol. 9. Elution buffer: PBS with 0.3 M NaCl, 250 mM imidazole, 1 mM PMSF, 1 mM benzamidine, 5 mM β-mercaptoethanol. 10. Dialysis buffer: 50 mM Tris-HCl, pH7.5, 10 mM NaCl, 2 mM β-mercaptoethanol. 11. Escherichia coli BL21DE3 transformed with the following plasmid DNAs (16, 19): C-terminal hydrolase assays: - pHis-TEV-30a-YFP-SUMO-1(1-101)-ECFP - pHis-TEV-30a-YFP-SUMO-2(1-103)-ECFP Depolymerisation assays: - pHis-TEV-30a-ECFP-SUMO-1(1-97) - pHis-TEV-30a-YFP-SUMO-1(1-97) - pHis-TEV-30a-ECFP-SUMO-2(1-92) - pHis-TEV-30a-YFP-SUMO-2(1-92) Isopeptidase assasys:
FRET-Based SUMO Protease Assays
257
- pHis-TEV-30a-YFP-SUMO-1(1-97) - pHis-TEV-30a-YFP-SUMO-2(1-92) - pHis-TEV-30a-ECFP-RanGAP1(418-587) Plasmids are available from R. T. Hay lab by request. Bacterial cultures should be stored as 15% glycerol stocks at −80°C. 12. Nickel-NTA agarose resin (Quiagen). 13. Q Sepharose resin (SIGMA). 14. UV/visible spectrophotometer. 2.2. In Vitro SUMO Conjugation Assays Using Fluorescent Proteins
1. Recombinant human SAE2/SAE1 (Uba2/Aos1) and human Ubc9 (Alexis Biochemicals or BIOMOL international). 2. Tris-HCl: 1 M aqueous solution, pH 7.5, stored at room temperature. 3. MgCl2: 100 mM aqueous solution, stored at room temperature. 4. ATP (disodium salt): dissolve in distilled water, titrate to pH 7.0 with NaOH and adjusted to 100 mM. Store in 10–1000 µl aliquots at −20°C. 5. β-mercaptoethanol: Store at room temperature in supplied container.
2.3. In Vitro SUMO Protease FRET Assays
1. Multi-well fluorimeter with an excitation wavelength of 400–410 nm and capable of measuring emission at 480 and 530 nm (for example: BMG Labtech NOVOstar fluorimeter with 405-10, 530-10 and 480-10 filters and NOVOstar software (v1.20) ). 2. Polystyrene multiwell plates with flat-bottom, black sides and clear base (Corning 384 well non-sterile plates or equivalent). 3. A source of SUMO protease, such as cell extract or recombinant protein. As a positive control for these assays, the recombinant SENP1 catalytic domain (available from BIOMOL international) can be used. 4. Assay buffer: 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM β-mercaptoethanol, 0.1 mg/ml bovine serum albumin (BSA).
3. Methods 3.1. Protein Expression and Purification
1. Streak an L-agar plate including 50 µg/ml kanamycin with each of the bacterial stocks to be used for protein induction and incubate at 37°C overnight. 2. Pick a single colony from each plate and grow at 37°C with 200 rpm agitation in a 10 ml culture of L-broth with 50 µg/
258
Tatham and Hay
ml kanamycin for 12–16 h or until the bacterial suspension has reached an OD600 > 1.0. 3. Inoculate a 1 l culture of L-broth with 50 µg/ml kanamycin with each 10 ml mini-culture and incubate at 37°C with 200 rpm until the OD600 is between 0.6 and 1.0. 4. Chill cultures in iced water for 10 min before adding IPTG to 0.4 mM. 5. Incubate at 22°C with 200 rpm for between 4 and 16 h. Cultures expressing fluorescent proteins should become colored. 6. Pellet bacteria from suspension by centrifugation at ∼3,000g for 15 min. 7. Resuspend bacteria fully in ~40 ml PBS and pellet in a 50 ml Falcon tube, ~3,000g for 15 min. At this point the pellets can be stored at −80°C if required. 8. Lyse bacteria by sonication in 25 ml lysis buffer. 9. Centrifuge lysates for 30 min at 20,000g and 4°C. 10. 0.22 µm filter-sterilize the supernatants and load onto a 5 ml Nickel-NTA Sepharose column preequilibrated with lysis buffer without protease inhibitors. 11. Wash each column with 5 column volumes (CV) of wash buffer. 12. Elute bound proteins by addition of elution buffer. Either collect fractions of 0.5 CV each and analyze by SDS-PAGE (see Note 1) before pooling, or collect protein-containing eluate (colored fractions) into one single tube. 13. Dialyze fluorescent proteins with three buffer changes of at least 100-fold dilution against dialysis buffer. 14. Pass protein solutions over individual 3 ml Q Sepharose columns pre-equilibrated with dialysis buffer, and elute with dialysis buffer containing a NaCl gradient from 100 to 500 mM. Analyze colored fractions by SDS-PAGE, and pool the purest fractions. 15. Re-dialyze against dialysis buffer as described in Step 13 and freeze in 10–1000 µl aliquots at −80°C. 3.2. Calculation of Fluorescent Protein Concentration
1. Dilute a sample of each of the YFP-containing proteins 1:20 in dialysis buffer. 2. Set a spectrophotometer to 515 nm, and set the blank to the same buffer. 3. Read the absorbance value A for your diluted protein sample. 4. Use Beer’s law to calculate your protein concentration. Beer’s law: A = e × c × l where: A is the absorbance at 515 nm
FRET-Based SUMO Protease Assays
259
e is the extinction coefficient for YFP (92 200 M−1•cm−1 at 515 nm) l is the length of light path (typically 1 cm) c is the protein concentration (M) 5. Repeat Steps 1–4 using undiluted samples of your ECFP-containing proteins, measuring the absorbance at 435 nm, and use the extinction coefficient for ECFP ε (28 750 M−1 • cm−1 at 435 nm) to calculate the concentration of ECFP in the sample (see Note 2). 6. Yields are in the region of 1 µmol pure protein per liter of culture. 3.3. Conjugation of SUMO to RanGAP1 and SUMO
Of the proteins expressed directly from the plasmids (see Sect. 2.1), only the immature SUMO proteins N- and C-terminally linked to YFP and ECFP are ready to use in protease assays. The substrates used to test isopeptidase and depolymerization activities of SUMO proteases first need to be conjugated to SUMO before they can be deconjugated by the protease (Fig. 17.2). This is done by in vitro SUMO conjugation using recombinant SUMO specific E1 (SAE2/SAE1) and E2 (Ubc9) enzymes. Examples of conjugation assays used to generate these constructs are shown in Table 17.1 (see Notes 3 and 4).
3.4. FRET Analysis of SUMO Protease Activities
How you perform your FRET assays very much depends on your fluorimeter. Obviously, if you have only a single sample unit, you will have to analyze one sample at a time. A multi-well fluorimeter will have the advantage of giving the user the option of running many samples simultaneously, although, unless it can read multiple wells simultaneously (most models can only read one well at a time), you will need to plan your experiment more carefully (see Notes 5–14 for caveats to consider). We use a NOVOstar (BMG labtech), which has the facility to use 384 well plates and contains an integral pipettor for in situ dispensations, and which reads one well at a time. It uses NOVOstar v1.20 software, which allows the user to write individual programs to perform each task required to run an assay. For a SUMO protease FRET assay three programs are written for each experiment: 1. Dispensation of the FRET substrate: The instrument’s internal pipettor is used to transfer the FRET substrate (typically 20 µl of 50–1000 nM per well) into the desired position of the ‘measurement’ plate from either a ‘reagent’ plate or a microcentrifuge tube, followed by single readings at 480 and 530 nm. 2. Protease injection and initial rate monitoring:
260
Tatham and Hay
Fig. 17.2. Overview of the three FRET-based SUMO protease assays. Three FRET SUMO substrates were developed whose cleavage state is detectable by measurement of light emitted at 480 and 530 nm upon irradiation at 400–405 nm. The substrates are a (i) SUMO-target protein conjugate, (ii) the immature forms of SUMO, and (iii) polymerized SUMO, all fused to the fluorescent proteins ECFP and YFP. After cleavage by the protease, the 530 nm FRET signal decreases in intensity while the 480 nm signal (direct emission by ECFP) increases due to reduced quenching (see dashed and solid lines on lower charts). Both signals can be used to determine the amount of uncleaved substrate in a reaction at any given time. The lower charts show emission scans of YFP-SUMO-1(1-101)-ECFP before (left) and after (right) cleavage by SENP1. Similar data are obtained for all substrates described.
The instrument’s internal pipettor is used to transfer the protease sample (typically 5 µl) into the desired position of the ‘measurement’ plate from either a ‘reagent’ plate or a microcentrifuge tube, followed by continuous readings at 480 and 530 nm for between 2 and 5 min.
FRET-Based SUMO Protease Assays
261
Table 17.1 Examples of in vitro conjugation assays used to prepare YFP-SUMO-RanGAP1ECFP conjugate and YFP/ECFP-SUMO polymeric conjugates. Incubation times and enzyme concentration are given, but it is worth monitoring the reaction by sampling at different time-points during incubation and analysing by SDS-PAGE Assay component/feature
Isopeptidase substrate
Depolymerization substrate
Fluorescent protein 1 (0.25 µmol)
YFP-SUMO1(1-97) or YFPSUMO2(1-92)
YFP-SUMO-2
Fluorescent protein 2 (0.25 µmol)
ECFP-RanGAP1(418-587)
ECFP-SUMO-2
Tris-HCl, pH7.5
50 mM
50 mM
NaCl
150 mM
150 mM
MgCl2
5 mM
5 mM
β-mercaptoethanol
5 mM
5 mM
SAE2/SAE1
0.22 µM
0.22 µM
Ubc9
1.66 µM
13.3 µM
Reaction volume
Up to 7.0 ml with dH2O
Up to 7.0 ml with dH2O
Temperature
37°C
37°C
Incubation time
2h
4h
3. Long-term progress monitoring: Emission intensities at 480 and 530 nm are measured for all samples across the entire plate for up to 5 h. Note that both the protease and FRET substrate samples are prepared in assay buffer. The settings used for each program are outlined in Table 17.2. 3.5. Conversion of Fluorimeter Raw Output Data into Concentration of Cleaved Substrate
Data output from NOVOstar are automatically exported into an Excel spread sheet that relates time and temperature to fluorescence emission measurements for each well of the plate monitored. This allows the user to plot charts of the fluorescence intensity at each wavelength monitored with respect to time (Fig. 17.3A). For quantitative comparisons, these data need to be converted into concentrations of cleaved substrate. Since the magnitude of the fluorescence intensity at 480 nm and the inverse of the magnitude of the fluorescence intensity at 530 nm is proportional to the concentration of cleaved substrate, these two figures can be used to directly calculate the unknown. The following section outlines a method for converting 480 and 530 nm fluorescence intensity to concentration of cleaved substrate, although it should be pointed out that this is not the only method to do this.
262
Tatham and Hay
Table 17.2 Summary of the NOVOstar fluorimeter settings generally used for SUMO protease experiments Program 1 (Substrate loading)
Fluorimeter setting
Program 2 (Protease addition & short-term read)
Program 3 (Long-term read)
Mode
Well
Well
Plate
Temperature
~25°C
~25°C
~25°C
Positioning delay (s)
0.2
0.2
0.2
Number of kinetic windows
1
1
1
Measurement start time (s)
~10
~8.5
0
Number of intervals
1
50–100
30–100
Flashes per well per interval
20–50
20–50
20–50
Duration of data collection
Single point
2–5 min
2–5 h
Measuring fluorescence intensity
Yes
Yes
Yes
Excitation wavelength
405 (±10) nm
405 (±10) nm
405 (±10) nm
Emission wavelength(s)
480 (±10) nm
480 (±10) nm
480 (±10) nm
530 (±10) nm
530 (±10) nm
530 (±10) nm
Gain (both wavelengths)
1500–2000
1500–2000
1500–2000
Volume of solution added
15–20 µl
5–10 µl
—
Pump speed
100 µl/s
100 µl/s
—
Shaking
None
None
None
Rinse cycles
1
1
—
Air gap
Yes
Yes
Yes
Number of mix cycles
0
3
0
Mix volume
—
10 µl
—
1. Where: E480 is the measured emission at 480 nm (Fig. 17.3A) E530 is the measured emission at 530 nm (Fig. 17.3A) E480max is the maximum measured emission at 480 nm (see Note 15) E480min is the minimum measured emission at 480 nm E530max is the maximum measured emission at 530 nm
FRET-Based SUMO Protease Assays
263
E530min is the minimum measured emission at 530 nm (see Note 15) First we need to determine the full scale range (FSR) for each wavelength measured for the reaction proceeding from 0 to 100% cleavage. So: FSR 480 = E 480 max − E 480 min (17.1) FSR 530 = E530 max − E530 min
(17.2)
2. Next we need to standardize the measured E480 and E530 data to the ‘zero’ signal at time ‘zero’ and invert the 530 nm data to yield an increase in signal over time rather than a decrease (Fig. 17.3B). This will give us E480stand and E530stand: E 480 stand = E 480 − E 480 min and
E530 stand = −1·(E530 − E530 max )
From this we can calculate the percentage of the substrate cleaved according to data acquired at 480 nm (E480%) and 530 nm (E480%) (Fig. 17.3C) by the following: E 480 % = 100·(E 480 stand /FSR 480 ) E530 % = 100·(E530 stand /FSR 530 ) 3. At this point we can combine both sets of data to give a mean value Emean% for each time point: E mean % = (E 480 % + E530 % ) / 2 This can be standardized back to a scale of 0–100% (Fig. 17.3D): E mean % stand = 100·(E mean % /E mean %max ) Where Emean% max is the average of the Emean% values once the reaction is complete. This is important because the average of the Emean% values will probably not be 100%. 4. This can then be converted to the actual amount of cleaved substrate, Emeansubstrate (Fig. 17.3E), by: E mean substrate = [S] t = 0·(E mean % stand /100) Where [S]t = 0 is the initial concentration of substrate in the assay.
Fig. 17.3. Processing raw data output from the fluorimeter to calculate the concentration of cleaved substrate in the reaction. (A) Example of data output from the NOVOstar fluorimeter for an experiment using 685 nM YFP-SUMO-1(1-101)-ECFP digested by 1 nM SENP1(415–644) in a 25 ml reaction. Fluorescence intensity at 480 and 530 nm was measured using 405 nm incident light. The reaction was monitored at 3 s intervals for 5 min after the addition of protease, then at 2 min intervals for a further 130 min. Note that the gap in the data series is due to the fact that this experiment was one of over 30 assays run simultaneously, and represents the time taken for the fluorimeter to start other reactions, before reading the entire plate every 2 min (see Notes 11 and 14). (B) Data from panel (a) standardized to ‘zero’ emission at time = 0 and to give an increase in r.l.u during the reaction progress. (C) Percentage of cleaved substrate according to 480 and 530 nm outputs calculated from panel (b). (D) Mean percentage of cleaved substrate using 480 and 530 nm data shown in (c). Concentration of YFP-SUMO-1(1-101)-ECFP cleaved by SENP1 calculated from data shown in (d). See text for details of calculations.
FRET-Based SUMO Protease Assays
265
4. Notes 1. The jellyfish fluorescent proteins and their derivatives are extremely stable. This is advantageous when it comes to their analysis by SDS-PAGE, because if protein samples are not boiled before fractionation, the fluorescent proteins remain folded in the gel. They will then fluoresce in the gel under UV irradiation (Fig. 17.4A), which allows the user to see exactly which species are fluorescent and also to verify the identity of each fluorescent protein due to the difference in colors between YFP and ECFP. If quantification is required, such gels can also be scanned using a gel reader with appropriate lasers fitted. Gels can be Coomassie-stained later if required. 2. If necessary for protein preps containing equal amounts of both YFP and ECFP, both methods can be used and compared. They should agree to within about 10%. 3. Monitor your in vitro conjugation assays by sampling at 30 min intervals and analyze by fractionation on SDS-PAGE. If your assays are progressing too slowly more SAE2/SAE1 and Ubc9 can be added. SUMOs, RanGAP1 and fluorescent proteins are very stable, so extended incubations (up to 24 h) at 37°C are not usually a problem. 4. After conjugation the newly-synthesized substrates should be purified away from the SUMO conjugation enzymes by Nickel-NTA Sepharose affinity chromatography as described in Sect. 3.1, Steps 10–15, but including an extra wash step with buffer containing 1 M NaCl. 5. Always run your reactions to completion if you want to quantify them in terms of substrate concentration. You need to know the magnitude of the signals at 480 and 530 nm both before and after complete digestion with the protease to determine the ‘uncleaved’ and ‘cleaved’ values (0 and 100% cleavage) for your particular quantity of substrate, and hence the full scale range (FSR) for your assay. If you know the concentration of the FRET substrate then this can easily be used to calibrate the signal intensities at 480 and 530 nm to a concentration value (see Sect. 2.5. for details). 6. Avoid bubbles in your FRET assays at all costs. Check your plates by eye after dispensation of the FRET substrate to make sure none are present. If they are present, bubbles can usually be removed by centrifugation of the plate (suitable centrifuge and rotor required). It is always worth checking after your assays have finished just to make sure bubbles haven’t been inadvertently introduced and may have interfered with your analysis.
266
Tatham and Hay
Time
A
YFP-SUMO-1GGHSTV-ECFP
YFP-SUMO-1-GG HSTV-ECFP
SUMO-1-GGHSTV SUMO-1-GG
B
Fig. 17.4. Fluorescent protein adducts do not significantly affect SUMO processing rates. Analysis of samples of YFPSUMO-1(1-101)-ECFP, and SUMO-1(1-101) during the progress of a SENP1 digestion show that the rate of cleavage is unaffected by the fusion with fluorescent proteins. (A) (upper panel) Photograph of a UV-irradiated SDS-PAGE gel showing a fractionation of the YFP-SUMO-1(1-101)-ECFP samples from a SENP1 protease assay (labeled YFP-SUMO-1-GGHSTV-ECFP to indicate the amino acid sequence of the linear fusion protein). The image shows the gradual disappearance of a low mobility species (uncleaved substrate) and the concomitant appearance of two higher mobility species (YFPSUMO-1(1-97) and ECFP fused to residues 98-101 of SUMO-1 (HSTV), which can be distinguished by color (not shown). A Coomassie-stained SDS-PAGE gel of an equimolar quantity of the ‘native’ SUMO-1(1-101), cleaved in parallel by SENP1, shows a similar rate of cleavage. (B) Densitometric analysis of the image shown in (a). (Adapted from Ref. 16).
7. Since the plates are uncovered during analysis, evaporation can cause sample concentrations to increase, which affects data collection. To avoid this we have found that it is best to adjust the concentration of protease used in the assays to allow reaction completion in less than 5 h. Where this is not possible, most plate suppliers manufacture clear plastic sealing film for their plates, which can be applied at a suitable point in the experiment. Make sure to recalibrate your data if these affect the signal strength. 8. The magnitude of fluorescence signals is affected by temperature, so it is important to run your assays at a constant temperature. The NOVOstar has an integral heating plate, and the equipment can be used in a cold room. Thus, fixed temperatures below
FRET-Based SUMO Protease Assays
267
room temperature can be achieved if required. We usually run assays at 25°C. 9. Avoid using the wells at the edge of the plate for experiments as their spectral qualities tend to differ slightly from those of the internal wells. 10. Using the buffers described here and water as the wash solution, the NOVOstar integral pipettor appears to have a slight carry-over issue that can interfere with assays. Firstly, it usually takes two dispensations of FRET substrate before it consistently dispenses the same quantity. Secondly, after having just dispensed protease, it takes at least three dispensations (with two washes in between each) of buffer only, before absolutely no protease activity is detectable. To allow for these problems, set up your experiment with a number of wells with ‘trial’ assays where FRET substrate or protease are dispensed just to equilibrate the pipettor. This may be an idiosyncrasy of the NOVOstar machine under the conditions described, but it is more likely to be a feature to some degree of any fluorimeter with an internal pipettor. 11. Unless you have a multi-channel fluorimeter capable of dispensing into and reading multiple wells simultaneously you will need to plan a multiple-sample experiment carefully. For example, if you have intend to analyze 40 assays for 2 min each immediately after protease addition, it will take about 100 min for these to be analyzed before the long-term analysis can begin. In order to get as much curve information as possible, it is important to arrange your assays from slow to fast so that those predicted to finish most quickly are started latest. This limits the time between the short constant analysis and the long-term analysis. 12. If you are interested in the initial rates of your reaction, try to cover at least the first 15% of cleavage of your substrate with at least 20 data points. This should yield enough points to accurately estimate the initial rate. 13. When manually adding liquids to 384 well ‘reagent’ plates, aspirate the liquid as normal with a hand pipette (Gilson or similar). Subsequently, while touching the bottom corner of the well with the pipette tip, dispense the liquid, but only to the first ‘click’ of the pipette. By dispensing to the second ‘click’ you risk adding bubbles to the well. Add a twofold excess of sample to those wells from which the automatic pipettor is set to remove a sample, in order to avoid any further problems with bubbles. 14. When starting program 2 (addition of protease) in your experiment, start a timer. Note the time at which you start program 3 (long-term analysis). You will need this time to
268
Tatham and Hay
relate the timings of the two programs when combining the data later. 15. When determining the ‘maximum’ and ‘minimum’ values for the ECFP and FRET emissions, signal variation needs to be considered. Therefore these values should be the average of the values measured once the reaction has reached completion rather than the highest or lowest single number measured. References 1. Seeler, J. S. and Dejean, A. (2003) Nuclear and unclear functions of SUMO. Nat. Rev. Mol. Cell. Biol. 4, 690–699. 2. Saitoh, H. and Hinchey, J. (2000) Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J. Biol. Chem. 275, 6252–6258. 3. Tatham, M. H., Jaffray, E., Vaughan, O. A., Desterro, J. M., Botting, C. H., Naismith, J. H. and Hay, R. T. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J. Biol. Chem. 276, 35368–35374. 4. Ayaydin, F. and Dasso, M. (2004) Distinct in vivo dynamics of vertebrate SUMO paralogues. Mol. Biol. Cell 15, 5208–5218. 5. Hay, R. T. (2005) SUMO: a history of modification. Mol. Cell 18, 1–12. 6. Hay, R. T. (2007) SUMO-specific proteases: a twist in the tail. Trends Cell Biol. 17, 370– 376. 7. Li, S. J. and Hochstrasser, M. (1999) A new protease required for cell-cycle progression in yeast. Nature 398, 246–251. 8. Takahashi, Y., Mizoi, J., Toh, E. A. and Kikuchi, Y. (2000) Yeast Ulp1, an Smt3Specific Protease, Associates with Nucleoporins. J. Biochem. (Tokyo) 128, 723–725. 9. Li, S. J. and Hochstrasser, M. (2000) The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol. Cell. Biol. 20, 2367–2377. 10. Bylebyl, G. R., Belichenko, I. and Johnson, E. S. (2003) The SUMO isopeptidase Ulp2 prevents accumulation of SUMO chains in yeast. J. Biol. Chem. 278, 44113–44120. 11. Melchior, F., Schergaut, M. and Pichler, A. (2003) SUMO: ligases, isopeptidases and nuclear pores. Trends. Biochem. Sci. 28, 612–618. 12. Reverter, D. and Lima, C. D. (2004) A basis for SUMO protease specificity pro-
13.
14.
15.
16.
17.
18.
19.
vided by analysis of human Senp2 and a Senp2-SUMO complex. Structure (Camb) 12, 1519–1531. Shen, L. N., Dong, C., Liu, H., Naismith, J. H. and Hay, R. T. (2006) The structure of SENP1-SUMO-2 complex suggests a structural basis for discrimination between SUMO paralogues during processing. Biochem. J. 397, 279–288. Arnold, J. J., Bernal, A., Uche, U., Sterner, D. E., Butt, T. R., Cameron, C. E. and Mattern, M. R. (2006) Small ubiquitin-like modifying protein isopeptidase assay based on poliovirus RNA polymerase activity. Anal. Biochem. 350, 214–221. Bossis, G., Chmielarska, K., Gartner, U., Pichler, A., Stieger, E. and Melchior, F. (2005) A fluorescence resonance energy transfer-based assay to study SUMO modification in solution. Methods Enzymol. 398, 20–32. Martin, S. F., Hattersley, N., Samuel, I. D., Hay, R. T. and Tatham, M. H. (2007) A fluorescence-resonance-energy-transferbased protease activity assay and its use to monitor paralog-specific small ubiquitinlike modifier processing. Anal. Biochem. 363, 83–90. Mikolajczyk, J., Drag, M., Bekes, M., Cao, J. T., Ronai, Z. and Salvesen, G. S. (2007) Small ubiquitin-related modifier (SUMO)specific proteases: profiling the specificities and activities of human SENPs. J. Biol. Chem. 282, 26217–26224. Wilkinson, K. D., Gan-Erdene, T. and Kolli, N. (2005) Derivatization of the C-Terminus of Ubiquitin and Ubiquitinlike Proteins Using Intein Chemistry: Methods and Uses. Methods Enzymol. 399, 37–51. Shen, L., Tatham, M. H., Dong, C., Zagorska, A., Naismith, J. H. and Hay, R. T. (2006) SUMO protease SENP1 induces isomerization of the scissile peptide bond. Nat. Struct. Mol. Biol. 13, 1069–1077.
Chapter 18 Detection and Characterization of SUMO Protease Activity Using a Sensitive Enzyme-Based Reporter Assay Craig A. Leach, Xufan Tian, Michael R. Mattern, and Benjamin Nicholson Abstract In this chapter we describe a novel, sensitive, homogenous high throughput reporter-based in vitro assay for SUMO protease activity developed by Progenra, Inc. A reporter construct was created by fusing His6tagged small ubiquitin-like modifier (SUMO) to the amino terminus of the reporter enzyme phospholipase A2 (PLA2). Following cleavage by a member of the sentrin specific proteases (SENPs), free PLA2 is able to turn over its substrate, resulting in the release of a fluorescent product which is readily quantifiable using a fluorimeter or a fluorescence plate reader. The utility of this SUMO-CHOP-Reporter assay platform is demonstrated by its ability to determine Km values and to characterize inhibitors of SUMO proteases. Key words: SUMO, SUMO protease, SENP1, SENP2, Ulp1, Smt3, enzyme-linked assay.
1. Introduction Post-translational modification of proteins allows cells to precisely regulate intracellular processes such as DNA repair, transcription, proteasomal degradation, autophagy and cellular localization (1). One example of these modifications is sumoylation, wherein small ubiquitin-like modifier (SUMO) is covalently linked to the ε-NH2 group of lysine residues by the coordinated action of 2–3 enzymes, E1 activating enzyme, E2 conjugating enzyme and an E3 ligase (2). To date, four paralogs of SUMO have been identified in mammalian systems SUMO-1, -2, -3 and -4. Sumoylation is a dynamic process; a family of enzymes known as the sentrin-specific proteases (SENPs) such as SENP1 and SENP2 function as SUMO
Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
269
270
Leach et al.
isopeptidases, cleaving SUMO from proteins (2, 3). An equivalent system exists in Saccharomyces cerevisiae, where the SUMO ortholog Smt3 is cleaved from proteins by the SENP homologs Ulp1 and Ulp2. Several SUMO protease activity assays have been reported, including SUMO-7-amino-4-methylcoumarin (SUMO-AMC) reporters and a fluorescence resonance energy transfer (FRET)based SUMO processing assay (4, 5). However, detection of AMC requires excitation in the UV range and depending on the composition of the screening library, SUMO-AMC reporters can result in false positive rates as high as 20% (6). Furthermore, FRET-based SUMO processing assays require micromolar concentrations of reporter for a robust signal (4). To address the lack of sensitivity and/or excitation in the UV range, Progenra developed an assay platform based on the fact that certain reporter enzymes require a free amino terminus for catalytic activity. Initially, we reported the first generation of the assay platform, which utilized the RNA polymerase 3Dpol (7). We now describe a second generation CHOP-Reporter platform which takes advantage of the fact that phospholipase A2 (PLA2) requires a free amino terminus for catalytic activity (8, 9). Specifically, SUMO3CHOP-Reporter consists of a linear fusion of SUMO-3 fused to the amino terminus of PLA2. Similarly, Smt3-CHOP-Reporter consists of Smt3 fused to the amino terminus of PLA2. SUMO protease activity precisely cleaves a fusion protein of SUMO-PLA2 at the terminal diglycine of SUMO. Cleavage results in free catalytically active PLA2, which is then able to turn over its substrate 2-(6-(7-nitrobenz2-oxa-1,3-diazol-4-yl)amino)hexanoyl-1-hexadecanoyl-sn-glycero3-phosphocholine (NBD C6-HPC), resulting in an accumulation of free NBD, monitored by an increase in fluorescence intensity. Hence, the activity of the reporter enzyme can be used as a measure of SENP activity. The SUMO-CHOP-Reporter reporter platform is a facile, highly sensitive assay system that has utility for the characterization of SUMO proteases and modulators of their activities in a high-throughput screening (HTS) format. Data presented within this chapter demonstrate multiple practical applications of the SUMO-CHOP-Reporter assay platform, including measurement of dose dependent SUMO protease activity, determination of Km values, and characterization of two inhibitors of Ulp1 in a HTS format.
2. Materials The reporter component of the CHOP reagents consist of SUMO-3 or Smt3 fused to the amino terminus of PLA2 (9). In this chapter, we will refer to SUMO3-CHOP-Reporter and Smt3-CHOP-Reporter as SUMO3-PLA2 and Smt3-PLA2, respectively, in the body of the text. Following generation of these reagents, they were licensed to
Enzyme-Based SUMO Protease Assays
271
LifeSensors Inc, Malvern, PA (www.lifesensors.com) for distribution. Details of kit reagent production are provided in a separate publication (9). Briefly, the reporters consist of a His6-tagged Smt3 or SUMO3 cDNA fused to mouse group X PLA2 cDNA (encoding amino acids 29–151) in a pET plasmid (9, 10). Following expression and affinity purification, the reporter proteins are refolded as described (9). The reporter substrate is NBD C6-HPC. The catalytic cores of Ulp1 (amino acids 403–621), SENP1 (amino acids 491–715) and SENP2 (amino acids 366–590) were expressed as His6-tagged proteins from pET vectors and purified by affinity chromatography (9, 10). In principle, the same experiments could be performed with alternative reporter enzymes that require a free amino terminus for catalytic activity such as the RNA polymerase 3Dpol (7). 2.1. Gel Cleavage Analysis of SUMO Protease Activity
1. Smt3-CHOP-Reporter kit (LifeSensors, Inc), stored at −80°C (9). 2. Ulp1 core (LifeSensorsa Inc), stored at −80°C (10). 3. Assay Buffer: 50 mM Tris-HCl, pH 8.0, 2 mM CaCl2, 2 mM β-mercaptoethanol (see Note 1). 4. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) reagents (11).
2.2. SUMO Protease CHOP-Reporter Plate-Based Assay
1. Assay buffer, Ulp1 and Smt3-CHOP-Reporter kit (see Sect. 2.1). 2. Additional NBD C6-HPC (see Note 2) (Invitrogen, Carlsbad, CA): prepare at a concentration of 5 mM in 95%(v/v) ethanol, store at −20°C. 3. Non-sterile, flat-bottomed, black 96 well polypropylene plates (Greiner Bio One, Monroe, NC).
2.3. Kinetic Analysis of SENP1
1. Black 96 well plate, assay buffer and NBD C6-HPC (see Sects. 2.1 and 2.2 and Note 2). 2. SUMO3-CHOP-Reporter kit and SENP1 core (LifeSensors, Inc), stored at −80°C (9).
2.4. Generation of Free PLA2
1. SUMO3-CHOP-Reporter kit (see Sect. 2.3). 2. Additional SENP2 core (LifeSensors, Inc), stored at −80°C (9). 3. Ni-NTA Agarose (Qiagen, Valencia, CA). 4. Protein Assay Reagent (Bio-Rad, Hercules, CA). 5. Dialysis buffer: 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% (v/v) glycerol.
2.5. Profiling Modulators of Ulp1 Core SUMO Protease Activity
1. Black 96 well plate, assay buffer, Ulp1 core, NBD C6-HPC (see Note 2) and Smt3-CHOP-Reporter kit (see Subheadings 2.1 and 2.2) 2. Non-sterile, round-bottomed, colorless 96 well polypropylene plate (Greiner Bio One).
272
Leach et al.
3. N-ethyl maleimide (NEM) (Fisher Scientific, Pittsburgh, PA): freshly dissolved at a concentration of 1 M in 95%(v/v) ethanol (see Note 3). 4. Iodoacetamide (IA) (Sigma, St Louis, MO): freshly dissolved at a concentration of 1 M in DMSO (see Note 3).
3. Methods 3.1. Gel cleavage analysis of SUMO protease activity
Gel cleavage analysis affords a low-throughput method of measuring SUMO protease activity using the same enzymes as the reporter assay, but visualized by SDS-PAGE. In this method, SUMO protease activity is evidenced by the appearance of free Smt3 (∼18 kDa) and PLA2 (∼14 kDa), both of which migrate faster than the uncleaved Smt3-PLA2 (∼32 kDa). 1. In a total volume of 100 µl in a 1.5 ml microcentrifuge tube, combine 20 µg of Smt3-PLA2 with 100 nM Ulp1 core in assay buffer. A reaction without Ulp1 core serves as a negative control. 2. Incubate for 6 h at room temperature before stopping the reaction by adding 20 µl of 6x SDS loading dye. 3. Denature the samples by incubating at 95°C for 5 min before loading 20 µl onto a 4–20% gradient SDS-PAGE gel. 4. Run the gel at 140 V in SDS running buffer until the dye front is approximately 1 cm from the bottom of the gel. 5. Transfer the gel to a plastic tray and rinse with dH2O. 6. Completely submerge the gel in Coomassie brilliant blue stain and incubate with agitation for ∼1 h. 7. Decant the Coomassie brilliant blue stain and rinse the gel several times in dH2O before transferring to destain. The bands will typically appear after approximately 1 h. Decant destain and rinse the gel with dH2O (Fig. 18.1).
3.2. SUMO Protease CHOP-Reporter Plate-Based Assay
The plate based assay allows for a rapid quantitative readout of SUMO protease activity. In this method, SUMO protease activity is observed following cleavage of Smt3-PLA2 by Ulp1 core. The free PLA2 is able to cleave its substrate NBD C6-HPC, resulting in the liberation of the fluorescent product NBD, which is detected by a fluorescence plate reader. 1. Dilute Ulp1 core to a concentration of 100 pM in a total volume of 400 µl assay buffer in a 1.5 ml microcentrifuge tube. 2. Perform a two-fold dilution by transferring 200 µl of 100 pM Ulp1 core to a new 1.5 ml tube containing 200 µl assay buffer.
Enzyme-Based SUMO Protease Assays
273
Fig. 18.1. Ulp1 completely cleaves Smt3-PLA2. 20 µg of the reporter Smt3-PLA2 was incubated in the presence and absence of 100 nM Ulp1. Uncleaved (inactive) and cleaved (active) PLA2 are indicated.
3. Repeat Step 2 five more times, generating a two-fold dilution series of Ulp1 core ranging from 100 to 1.56 pM. 4. In a new tube, dilute Smt3-PLA2 and NBD C6-HPC with assay buffer to concentrations of 400 nM and 40 µM, respectively, in a total volume of 3 ml (see Note 4). Mix extensively. 5. Dispense 50 µl of each Ulp1 core dilution into three wells of a black 96 well plate. 6. Dispense 50 µl of assay buffer into three wells of a black 96 well plate. 7. Dispense 50 µl of the Smt3-PLA2/NBD C6-HPC into each well. 8. Read the plate every minute for 1 h at room temperature on a fluorescence plate reader using λex = 475 nm and λem = 555 nm (see Note 5). 9. Export the data into Microsoft Excel. 10. Remove all points greater than 70% of the maximum value for the highest dose of Ulp1 core (see Note 6). 11. Plot the relative fluorescence unit (RFU) values on the Y axis versus the time on the X axis in a graph drawing program such as GraphPad Prism 4.0 (Fig. 18.2A) (see Note 7). 12. Analyze the data by non-linear regression using the 4th order polynomial equation to determine the X2 factor for each concentration of Ulp1 (see Note 8). 13. Generate a second graph plotting the X2 factor on the Y axis and Ulp1 concentration on the X axis in GraphPad Prism 4.0 (Fig. 18.2B). 14. Analyze the data by linear regression. The r2 value should be ≥0.95 (Fig. 18.2B) (see Notes 7, 9 and 10).
274
Leach et al.
Fig. 18.2. Ulp1 exhibits dose dependent cleavage of Smt3-PLA2. (A) Raw data from a representative experiment; data are mean ± standard deviation (SD) of triplicate determinations. (B) These data were transformed as described and analyzed by linear regression analysis, r2 value from a representative experiment. Over the concentration range tested, there is a linear correlation between Ulp1 core concentration and liberated NBD fluorescence (see Note 8). Thus the Ulp1 core, Smt3-PLA2 assay can be used for quantitative measurements of Ulp1 core activity.
3.3. Determination of Km
An additional utility of the CHOP-Reporter assay is the ability to derive kinetic data. In this method, a fixed concentration of SENP1 core is incubated with a range of concentrations of SUMO3-PLA2 and a fixed concentration of NBD C6-HPC. The resulting data are transformed and fit to a Michaelis-Menten equation to obtain the Km of SENP1 core for SUMO3-PLA2. 1. Dilute SUMO3-PLA2 to a concentration of 2 µM in a total volume of 80 µl assay buffer in a 1.5 ml microcentrifuge tube. 2. Perform a two-fold dilution by transferring 40 µl of 2 µM SUMO3-PLA2 to a new 1.5 mL tube containing 40 µl assay buffer. 3. Repeat Step 2 five more times, generating a two-fold dilution series ranging from 2 µM to 31.25 nM. 4. Dispense 10 µl of each SUMO3-PLA2 dilution into triplicate wells in a black 96 well plate. 5. Dispense 10 µl of assay buffer into three wells of a black 96 well plate. 6. In a new tube, dilute SENP1 core and NBD C6-HPC to concentrations of 27.8 pM and 22 µM, respectively, in a volume of 3 ml of assay buffer. Mix extensively. 7. Dispense 90 µl of this mixture (27.8 pM SENP1 core/22 µM NBD C6-HPC) into each well. 8. Read the plate as described (see Sect. 3.2.8). 9. Export the data into Microsoft Excel. 10. Remove all points greater than 70% of the maximum value for the highest dose of SUMO3-PLA2 (see Note 6).
Enzyme-Based SUMO Protease Assays
275
Fig. 18.3. Kinetic analysis of cleavage of SUMO3-PLA2 by SENP1. (A) Raw data from a representative experiment, data are mean ± SD of three wells/experimental condition. (B) These data were transformed and fit to the Michaelis-Menten equation as described yielding the affinity of SENP1 core for SUMO3-PLA2 (Km). The Km value is presented as the mean ± SD of triplicate experiments.
11. Plot the RFU values on the Y axis versus the SUMO3-PLA2 concentration on the X axis in a graph drawing program such as GraphPad Prism 4.0 (Fig. 18.3A) (see Note 7). 12. Analyze the data by non-linear regression using the 4th order polynomial equation to determine the X2 factor for each concentration of SUMO3-PLA2 (see Note 8). 13. Generate a second graph plotting the X2 factor on the Y axis and SUMO3-PLA2 concentration on the X axis in GraphPad Prism 4.0 (Fig. 18.3B). 14. Analyze the data by non-linear regression using the Michaelis-Menten equation [Y = (Vmax × X)/(Km + X)] to determine the Km (Fig. 18.3B) (see Notes 10 and 11). 3.4. Generation of Free PLA2
Free mature active PLA2 enables counterscreening to determine the specificity of a potential inhibitor (see Note 12). In this method, His6-SUMO3-PLA2 is cleaved by His6-SENP2 core, resulting in two His6-tagged proteins (His6-SUMO3 and His6SENP2 core) and one un-tagged protein (PLA2). Incubating with Ni-NTA agarose efficiently removes the His6-tagged proteins, leaving free PLA2 in the supernatant. 1. In a total volume of 1 ml in a 1.5 ml microcentrifuge tube, combine SUMO3-PLA2 and SENP2 core to final concentrations of 2 µM and 200 nM, respectively, in assay buffer. Mix extensively. 2. Incubate at room temperature for 6 h. 3. Add 100 µl Ni-NTA agarose and incubate with mixing at 4°C for 1 h. 4. Centrifuge the 1.5 ml tube at 800g for 1 min. 5. Carefully collect the supernatant (containing free PLA2).
276
Leach et al.
6. Measure the protein concentration of the supernatant using Protein Assay Reagent according to the manufacturer’s protocol. 7. Test the supernatant for PLA2 activity by incubating 5 nM of supernatant with 20 µM NBD C6-HPC in 100 µl of assay buffer in a black well plate (see Note 13). Confirm purity by SDS-PAGE analysis (see Sect. 3.1). 8. Dialyze the supernatant into dialysis buffer overnight at 4°C, using 3.5 kDa cutoff dialysis tubing. 9. Determine the protein concentration as before; aliquot free PLA2 and store at −80°C. 3.5. Profiling Modulators of Ulp1 Core SUMO Protease Activity
The CHOP-Reporter assay can be used to discover and characterize modulators of SUMO protease activity (9). In this method, two known cysteine protease inhibitors (NEM and IA) are used as model compounds. In addition to the examples presented in this method any other compound or natural product extract could be tested with this assay platform for its ability to modulate isopeptidase activity (Ref. (9) and our unpublished results). When counterscreening for activity against Ca2+-dependent PLA2, an appropriate control would be the Ca2+ chelator ethylenedinitrilotetraacetic acid (EDTA). It is not necessary to test against EDTA in the coupled enzyme assay. In this method, Ulp1 core is preincubated with dose ranges of NEM or IA for 30 min before the addition of Smt3-PLA2 and NBD C6-HPC. If Ulp1 is inhibited, there will be no cleavage of Smt3-PLA2 and thus no increase in NBD fluorescence. 1. The Ulp1 core/Smt3-PLA2 assay has been optimized for screening for modulators of SUMO protease activity (see Notes 14 and 15). 2. Prepare a 5% (v/v) DMSO solution in H2O and dispense 60 µl aliquots into wells B2-H7 in a 96 well polypropylene plate. 3. In wells A2-A4 of the 96 well plate, mix 30 µl of 1 M NEM with 112.5 µl of H2O and 7.5 µl DMSO making a 200 mM solution of NEM in 5% DMSO. In wells A5-A7, mix 7.5 µl IA and 142.5 µl H2O (generating 50 mM IA in 5% DMSO) (Fig. 18.4A). 4. Serially dilute NEM and IA (see Note 16) by mixing 60 µl of solution from row A with 60 µl of 5% DMSO/H2O in row B, using a multichannel pipette. Repeat the serial dilutions down the plate in a sequential manner (Fig. 18.4A). 5. Using a multichannel pipette, dispense 5 µl (see Note 17) of the diluted NEM and IA solutions in triplicate to a black 96 well plate (Fig. 18.4A). 6. To control for potential variation between plates, add internal controls to each plate. Specifically, for testing modulators
Enzyme-Based SUMO Protease Assays
277
of Ulp1 core, 5 µl of 100 mM NEM in 5% DMSO (see Note 18) is added to wells A1-D1 and E12-H12, and 5% DMSO is added to wells E1-H1 and A12-D12 (Fig. 18.4A). 7. Dilute Ulp1 core in assay buffer to a concentration of 66.7 pM in a 25 mL reservoir (see Note 18). Mix extensively. 8. Using a multichannel pipette, dispense 45 µl aliquots of 66.7 pM Ulp1 core to each well in the black 96 well plate, resulting in a concentration of 60 pM Ulp1 core. Gently tap the plate to ensure thorough mixing of the compound and Ulp1 core. 9. Cover the plate and incubate for 30 min protected from light. 10. In a new 25 ml reservoir, dilute Smt3-PLA2 and NBD C6-HPC to concentrations of 20 nM and 40 µM respectively in assay buffer (see Note 4). Mix extensively. 11. Using a multichannel pipette, dispense 50 µl aliquots of 20 nM Smt3-PLA2/ 40 µM NBD C6-HPC to each well of the black 96 well plate. 12. Read the plate as described (see Sect. 3.2.8 and Note 19). 13. Calculate the mean RFUNEM from wells A1-D1 and E12-H12 and the mean RFU0.5%DMSO from wells E1-H1 and A12-D12. The data are normalized within a plate using the following equation: % inhibition = 100 − ( (RFUwell − RFUNEM)/ (RFU0.5%DMSO − RFUNEM) × 100) using Microsoft Excel. 14. To determine the concentration of NEM or IA required to inhibit Ulp1 core activity by 50% (EC50), plot the normalized data on the Y axis and a logarithmic transformation of the compound concentration on the X axis in a graph drawing program such as GraphPad Prism 4.0. 15. Analyze the data by non-linear regression using the sigmoidal dose response (variable slope) equation (Y = Bottom + (Top-Bottom)/(1 + 10∧( (LogEC50-X) × HillSlope) ) )where top and bottom are the plateaus of the Y axis and the HillSlope is the steepness of the slope) to determine the EC50 value of each compound (Fig. 18.4B) (see Note 10) 16. The PLA2 assay (see Note 12) is performed in an analogous manner to the Ulp1/ Smt3-PLA2 assay with the following three exceptions: 17. As NEM does not inhibit the Ca2+ -dependent enzyme PLA2, an appropriate control would be EDTA (Fig. 18.4C). A serial dilution of EDTA is prepared as described above, starting with a concentration of 160 mM EDTA in 5% DMSO in wells A8-A10, followed by two fold serial dilutions in wells B8-H10 (Fig. 18.4A).
Fig. 18.4. Inhibition of Ulp1 activity by NEM and Iodoacetamide. (a) representative plate layout of an eight point dose response experiment. The concentrations refer to the compound concentrations at the preincubation step with Ulp1. Note for testing free PLA2 activity, 10 mM NEM is replaced with 10 mM EDTA in wells A1-D1 and E12-H12. (b) Representative EC50 curves for the inhibition of Ulp1 by NEM and IA, EC50 values from triplicate experiments are presented (mean ± SD). (c) In parallel, NEM and IA were tested for their ability to inhibit PLA2. Over the concentration range tested, NEM and IA were inactive against free PLA2 and thus within the experiment, the inhibition of Ulp1 by NEM or IA is specific. The mean ± SD of the positive control EDTA was calculated from three independent experiments.
278 Leach et al.
Enzyme-Based SUMO Protease Assays
279
18. The internal plate control for PLA2 assays is as above except 5 µl of 100 mM EDTA in 5% DMSO replaces 5 µl of 100 mM NEM 19. There is no pre-incubation step for the PLA2 assay; 5 µl of compound is mixed with 45 µl of 11.1 nM PLA2 followed immediately by 50 µl of 40 µM NBD C6-HPC. In our hands this assay is typically linear for ∼10 min; we normally use the 8 min timepoint for determining inhibition of PLA2.
4. Notes 1. Prepare fresh assay buffer on a daily basis. 2. NBD C6-HPC is light-sensitive, where possible shield from ambient light. 3. NEM and IA are both toxic substances, take appropriate care when handling and disposing of these compounds. 4. Due to the possibility of increased background activity and thus reduced dynamic range as well as quenching of the NBD fluorophor, it is recommended that the SUMO3/ Smt3-PLA2 and NBD C6-HPC are mixed just before use. 5. The NBD fluorophor can be successfully detected with excitation wavelengths ranging from 460–475 nm and emission wavelengths ranging from 538–555 nm. In our hands the maximal excitation and emission wavelengths were 472 and 552 nm respectively. 6. At high enzyme concentrations it is possible for the liberated PLA2 to cleave all of the available NBD C6-HPC resulting in a plateau in fluorescence. To determine the initial velocity correctly it is necessary to exclude all data points in which the fluorescence is greater than 70% of the maximum value. It may not be necessary to exclude any data points from assays performed in the presence of low concentrations of Ulp1 core or SUMO3-PLA2. 7. The polynomial fit and linear regression analysis can also be performed in Microsoft Excel or a number of other graph drawing programs. 8. The shape of the progress curves such as Fig. 18.2a or 18.3a is due to several factors. First, there will be a lag in appearance of fluorescence due to the coupled nature of the assay, and this is further complicated by the fact that the substrate for PLA2 is largely micellar requiring bulk transport of monomeric substrate before the PLA2 can act. Thus, the use of a
280
Leach et al.
polynomial fit is phenomenological. A 4th order polynomial equation is of the format Y = A + BX + CX2 + DX3 + EX4; where C = the X2 factor. 9. The r2 value quantifies goodness of fit between 0.0 and 1.0; higher values indicate a superior fit to the data. 10. To confirm these data, at least three independent experiments should be performed 11. Alternative models such Lineweaver-Burk and Eadie-Hofstee do not require non-linear regression analysis and may be performed in Microsoft Excel. 12. As in the case of all coupled enzyme assays, there is the potential that a compound will modulate directly the activity of the reporter enzyme (PLA2); these compounds can be rapidly eliminated by a counterscreen against free PLA2. 13. To confirm that there is no uncleaved SUMO3-PLA2 in the supernatant, the supernatant may be tested in the presence and absence of 20 nM SENP2 core. If signal enhancement is observed, the supernatant must be mixed with new NiNTA as described in Sect. 3.4.3. 14. The Ulp1 core/ Smt3-PLA2 assay was optimized by performing dose response experiments and determining the Z’ of the assay, which takes into account the dynamic range and assay variability (12). A Z’ value > 0.5 represents an assay that is useable in a high throughput screen, the Ulp1 core/ Smt3PLA2 assay had a Z’ value of 0.82 ± 0.03 in 96 well plates. Space restrictions preclude the inclusion of these data. 15. The CHOP-Reporter assay platform has also been successfully adapted to 384 and 1536 well plate formats (data not shown). 16. In the current example the compounds are serially diluted by two fold dilutions; alternative dilution strategies would include ½ log and ten fold dilutions. 17. The test compounds are diluted ten-fold following the addition of 45 µl of enzyme to 5 µl of compound, thus the concentrations in the compound plate represent ten times the actual concentration in the presence of enzyme. 18. NEM is dissolved in ethanol; additional experiments have shown, however, that ethanol does not inhibit the Ulp1 core/ Smt3-PLA2 reaction (data not shown). Thus, no control for the presence of ethanol is necessary in these experiments. 19. In our hands this assay typically proceeds in a linear manner for 50–60 min, we normally use the 50 min time point for determining modulation of Ulp1 core. Hence, it is not necessary to read every minute for one hour, a single 50 min time point will suffice.
Enzyme-Based SUMO Protease Assays
281
Acknowledgements The authors thank Keith Wilkinson (Emory University) and current and past employees of Progenra for their contributions to the development of the CHOP-Reporter assay platform. This work was supported in part by grants 1R43 CA115205, 1R43 HL083527, and 1R43 DK071391 from the National Institutes of Health, US Department of Health and Human Services, to Progenra, Inc.
References 1. Kirkin, V., and Dikic, I. (2007) Role of ubiquitin- and Ubl-binding proteins in cell signaling. Curr. Opin. Cell Biol. 19, 199–205. 2. Johnson, E. S. (2004) Protein modification by SUMO. Annu. Rev. Biochem. 73, 355–382. 3. Yeh, E. T., Gong, L., and Kamitani, T. (2000) Ubiquitin-like proteins: new wines in new bottles. Gene 248, 1–14. 4. Martin, S. F., Hattersley, N., Samuel, I. D., Hay, R. T., and Tatham, M. H. (2007) A fluorescence-resonance-energy-transfer-based protease activity assay and its use to monitor paralog-specific small ubiquitin-like modifier processing. Anal. Biochem. 363, 83–90. 5. Wilkinson, K. D., Gan-Erdene, T., and Kolli, N. (2005) Derivitization of the C-terminus of ubiquitin and ubiquitin-like proteins using intein chemistry: methods and uses. Methods Enzymol. 399, 37–51. 6. Tirat, A., Schilb, A., Riou, V., Leder, L., Gerhartz, B., Zimmermann, J., Worpenberg, S., Eidhoff, U., Freuler, F., Stettler, T., Mayr, L., Ottl, J., Leuenberger, B., and Filipuzzi, I. (2005) Synthesis and characterization of fluorescent ubiquitin derivatives as highly sensitive substrates for the deubiquitinating enzymes UCH-L3 and USP-2. Anal. Biochem. 343, 244–255. 7. Arnold, J. J., Bernal, A., Uche, U., Sterner, D. E., Butt, T. R., Cameron, C. E., and Mattern, M. R. (2006) Small ubiquitin-like
8.
9.
10.
11.
12.
modifying protein isopeptidase assay based on poliovirus RNA polymerase activity. Anal. Biochem. 350, 214–221. Dijkstra, B. W., Drenth, J., and Kalk, K. H. (1981) Active site and catalytic mechanism of phospholipase A2. Nature 289, 604–606. Nicholson B., Leach C. A. , Goldenberg S. J., Francis D. M., Kodrasov M. P., Tian X., Shanks J., Sterner D. E., Bernal A., Mattern M. R., Wilkinson K. D., and Butt T. R.(2008) Characterization of ubiquitin and ubiquitin-like-protein isopeptidase activities. Protein Science 17, 1035–1043. Malakhov, M. P., Mattern, M. R., Malakhova, O. A., Drinker, M., Weeks, S. D., and Butt, T. R. (2004) SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. J. Structural and Functional Genomics 5, 75–86 Gallagher, S. R. (1996) Electrophoretic separation of proteins. in Current Protocols in Molecular Biology, Ausubel, F. M., Brent, R., Kingston, R. E. et al., ed., John Wiley and Sons, Hoboken, NJ, pp. 10.12.11– 10.12.35. Zhang, J. H., Chung, T. D., and Oldenburg, K. R. (1999) A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J. Biomol. Screen. 4, 67–73
Chapter 19 Inhibition of the SUMO Pathway by Gam1 Mariaelena Pozzebon, Chiara V. Segré, and Susanna Chiocca Abstract We have previously demonstrated that Gam1, an avian adenoviral protein inhibits sumoylation. By counteracting the SUMO pathway, Gam1 has a significant impact on virus-infected cells, but in isolation the inhibitory effects of the Gam1 protein can be exploited to intentionally manipulate the SUMO system in vivo or in vitro. Here we discuss in detail the techniques we use to inhibit the SUMO pathway using the Gam1 protein. Key words: Gam1, SAE1/SAE2, UBC9, SUMO, SUMO E1, SUMO E2, inhibition, sumoylation, degradation.
1. Introduction A common denominator for most viruses is their ability to subvert cellular biochemical machineries to promote viral replication. We have been studying an unusual avian adenoviral protein, Gam1. Gam1 was first identified in a screen for viral anti-apoptotic functions in primary human cell lines (1). Subsequent studies led to the discovery that Gam1 is essential for viral replication (2), is a global activator of transcription and inhibits the histone deacetylase 1 (HDAC1) protein in vitro (3). Moreover, Gam1 causes disappearance of the PML Nuclear Bodies (NBs) and induces a relocalization of SUMO-1 from the nucleus to the cytoplasm (4, 5). These observations, and the evidence that many other viral proteins can act as substrates for SUMO modification as well as alter the sumoylation status of host cell proteins, prompted us to investigate the connections between Gam1 and the cellular SUMO pathway. Work from our laboratory has demonstrated Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
285
286
Pozzebon, Segré, and Chiocca
that Gam1 inhibits sumoylation through disappearance of the SUMO E1 and E2 enzymes (4). We have recently demonstrated that Gam1 is able to bind the E1 heterodimer and target it to degradation through an elongin/cullin-based E3 ubiquitin ligase complex. Gam1 possesses a SOCS box that interacts with EloC and two different cullins, CUL2 and CUL5, which are components of cullin RING ligases (CRLs) (6). This allows Gam1 to act as a substrate receptor in ubiquitin-E3 CRL complexes and to directly bind and ubiquitinate SAE1 (although this has so far been demonstrated only in an in vitro ubiquitination assay). In fact, Gam1 LL/AA (1), which is mutated in its SOCS-box, is unable to bind EloC and therefore unable to induce degradation of SAE1 (6). Concomitantly with SAE1 degradation, SAE2 is also destabilized, as SAE2 is unstable in the absence of SAE1, an effect that can be phenocopied by shRNA-mediated silencing of SAE1 (6). This leads to the disappearance of SAE1/SAE2 function, with subsequent complete block of sumoylation (4,6). Gam1 also causes the disappearance of UBC9, but the mechanism of UBC9 disappearance has not been clarified yet. In this chapter we will describe in vivo and in vitro methods to inhibit the SUMO pathway using the Gam1 protein.
2. Materials Unless otherwise indicated, all reagents and buffers are dissolved in purified water (ddH2O). 2.1. Plasmids, Transfection and Infection
1. For transient transfections we use the myc-tagged Gam1 gene cloned in the pSG9M expression vector. The transcription is driven by the strong viral promoter T7 (1). 2. For the infection protocol we use the pMSCV-IRES-Gam1GFP retroviral expression vector. Transcription of both Gam1 and GFP is driven by the same promoter in a bicistronic mRNA, and the presence of the IRES (Internal Ribosome Entry Site) element between Gam1 and GFP allows the detachment and reattachment of ribosomes to mRNA to produce two distinct proteins in 1:1 ratio. Other viral vectors, such as Adenoviral-Gam1, have been also successfully utilized (2, 7). 3. 2X HEPES-buffered saline (HBS): 50 mM HEPES, pH 7, 280 mM NaCl, 1.5 mM Na2HPO4. NaOH is used to adjust the pH. 4. Transfection mix: 1 M CaCl2 in HBS (HBS 2X diluted 1:1 with water).
Inhibition of the SUMO Pathway by Gam1
287
5. Chloroquine (Sigma) for transfections. 6. Polybrene (Sigma) for infections. 7. 0.22-µm filters and 5 ml sterile syringes for infections. 2.2. Cell Culture and Lysis
1. Phoenix ecotropic cells are used as retrovirus producer cells. 2. U2OS ecoR (stably transfected with the receptor for the uptake of retroviral particles) are used as target cells for infections. 3. HeLa cells are used in transient transfections. 4. A stable and inducible human HEK 293-derived cell line expressing Gam1 was created in our laboratory through the Flp-In System (Invitrogen). This system allows integration and expression of the gene of interest in mammalian cells at a specific transcriptionally active genomic location. The first step consists in the introduction of Flp Recombination Target (FRT) site into the genome of the mammalian cell line. An expression vector containing the gene of interest is then integrated into the genome via Flp recombinase-mediated recombination at the FRT site. For further and more detailed information about the technique, see the Invitrogen web site (www.invitrogen.com). The Gam1 insert was isolated from the pSG9M plasmid (previously described) (1) and placed under the control of a Tet-On (Clontech) promoter to induce gene expression once inserted in the specific locus (see www.clontech.com). 5. For Phoenix eco, U2OS ecoR and HeLa cells: Dulbecco’s Modified Eagle’s Medium (DMEM, Cambrexx) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% glutamine. 6. For the inducible HEK 293 cell line: Dulbecco’s Modified Eagle’s Medium (DMEM, Cambrexx) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% glutamine, 150 µg/ml hygromycin B. 7. 10X PBS (Phosphate Buffered Saline): 1.36 M NaCl, 270 mM KCl, 8 mM Na2HPO4, 15 mM KH2PO4. Dilute 100 ml with 900 ml of ddH2O for use. 8. Doxycycline: dissolve doxycycline at 1 mg/ml in sterile PBS. Doxycycline is photosensitive. Thus, keep the stock protected from light at 4°C. 9. E1A lysis buffer: 50 mM HEPES, pH 7.5, 250 mM NaCl, 0.1% NP-40, 1 mM PMSF (phenylmethanesulphonylfluoride), 10 µg/ml leupeptin, 10 µg/ml aprotinin. 10. Sonicator (e.g. Sonicator Ultrasonic processor XL). 11. Solution for protein quantification: Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad CatNo 500-0006), diluted 1:4 in PBS or sterile ddH2O.
288
Pozzebon, Segré, and Chiocca
12. Temperature-controlled centrifuge. 13. UV/visible light spectrophotometer. 2.3. SDSPolyacrylamide Gel Electrophoresis (SDS-PAGE)
1. 4X separating buffer: 0.4% SDS, 1.5 M Tris-HCl, pH 8.8. 2. 4X stacking buffer: 0.4% SDS, 500 mM Tris-HCl, pH 6.8. 3. 30% acrylamide/bis acrylamide solution (37.5:1), 10% ammonium persulfate (APS) and N,N,N,N´-tetramethylethylenediamine (TEMED). 4. Isopropanol. 5. 10X SDS buffer: 0.25 M Tris-HCl, pH 8.3, 2 M glycine, 20 mM SDS. 6. 5X loading buffer: 250 mM Tris-HCl, pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, 500 mM 1,4-dithiothreitol (DTT). 7. Ponceau staining: 0.2% Ponceau S (Sigma-Aldrich), 1% acetic acid. 8. Power supply and SDS-PAGE equipment (e.g., Bio-Rad Mini-Protean 3 Apparatus and Bio-Rad Mini Trans-Blot Electrophoretic Transfer Cell).
2.4. Detection of Gam1 Protein by Western Blot
1. 10X transfer buffer: 0.25 M Tris base, 2 M glycine. Dilute with ddH2O and add methanol to 20% for use. 2. Supported nitrocellulose transfer membrane (e.g. Whatman, Protran) and chromatography paper (e.g., Whatman 3MM). 3. Sponges and electrophoretic transfer cassette. 4. 10X Tris-buffered saline with Tween 20 (TBS-T): 250 mM Tris-HCl, pH 7.5, 1.5 M NaCl, 1% (v/v) Tween 20. Dilute 10-fold with ddH2O for use. 5. Blocking buffer: 5% (w/v) nonfat dry milk in TBS-T. 6. Primary antibody: α-myc tag (e.g. Calbiochem Cat. No. OP10), diluted 1:1000 in blocking buffer. 7. Secondary antibody: horseradish peroxidase-conjugated α-mouse IgG, diluted 1:10000 in blocking buffer. 8. Enhanced chemiluminescent (ECL) reagents (GE Healthcare or equivalent). 9. Amersham Hyperfilm ECL films (GE Healthcare or equivalent).
2.5. Bacterial Preparations
1. E. coli BL21 (DE3) F− ompT (Ion) hsdSB (rB−, mB−; E. coli B strain), T7 RNA polymerase plus; proteases minus. 2. Luria-Bertani medium (LB): 10 g Bactotryptone, 5 g yeast extract, 10 g NaCl for 1 l. Adjust to pH 7.
Inhibition of the SUMO Pathway by Gam1
289
3. Selective antibiotic (Ampicillin, Kanamycin), according to the vector used. 4. Incubator Shaker for bacterial cultures. 2.6. Production and Purification of Gam1 Recombinant Protein
1. Isopropyl-beta-D-thiogalactopyranoside (IPTG): 1 M stock solution in ddH2O. 2. Glutathione Sepharose 4B beads (GE Healthcare) or NiNTA agarose beads (Qiagen). 3. GST lysis buffer: 20 mM Tris-HCl, pH 8, 500 mM NaCl, 0.5% NP-40, 10% glycerol, 10 mM DTT, 4 mM EDTA, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin. 4. Glutathione elution buffer: 50 mM Tris-HCl, pH 8, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM reduced glutathione. Glutathione is photosensitive. Store it at 4°C, protected from light. 5. Histidine lysis buffer: 20 mM Tris-HCl, pH 8, 0.5 M NaCl, 0.5% Triton, 0.5% Tween 20, 10% glycerol, 10 mM β-mercaptoethanol, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin. Use PBS as a solvent. 6. Histidine wash buffer: 50 mM NaH2PO4, 300 mM NaCl, 30 mM imidazole. Adjust to pH 8.0 with HCl. 7. Histidine elution buffer: 50 mM NaH2PO4, 300 mM NaCl, 600 mM imidazole, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin. Adjust to pH 8.0 with HCl. 8. Comassie Brilliant Blue staining: 0.25% Comassie Brilliant Blue R-250, 10% acetic acid, 50% methanol. 9. Destaining solution: 7.5% acetic acid, 5% methanol.
2.7. In Vitro Sumoylation Assay with Gam1 Protein
1. 5X ATP buffer: 500 mM Tris-HCl, pH 7.4, 50 mM MgCl2, 20 mM ATP. 2. Purified recombinant E1, E2, SUMO1 and Gam1 proteins (see Sect. 3.2.3 for details). 3. Thermomixer compact (Eppendorf).
3. Methods 3.1. Inhibition of Sumoylation by Gam1 In Vivo
Several aspects must be taken into account when using Gam1 in vivo. First of all, it is a global activator of transcription (3, 8, 9). It is therefore not always possible to normalize the expression of the co-transfected plasmids. Second, it can enhance apoptosis in immortalized cells after 48–72 h, possibly as a consequence of sumoylation inhibition (10), which makes long-lasting analysis a
290
Pozzebon, Segré, and Chiocca
bit cumbersome. Third, it can alter cell morphology, although this may not be a concern for most experiments. Fourth, upon treatment with proteasome inhibitors, Gam1 has the tendency to become “sticky” and to form aggregates, so its function may be impaired. 3.1.1. Transient Expression of Gam1 through Calcium Phosphate Transfection 3.1.1.1. Calcium Phosphate Transfection
Here we describe the calcium phosphate transfection method, but alternative methods are equally suitable. 1. 24 h prior to transfection plate cells in a 10-cm plate in 10 ml of medium and incubate at 37°C in a humidified 5% CO2 incubator until they reach the desired confluence (see Note 1). 2. Cells are transfected using the calcium phosphate technique in a final volume of 10 ml of medium (see Note 2). Prepare the following two solutions (see Note 3). Solution A: ● 10 µg DNA (pSG9M-Gam1 or pSG9M vector as negative control) ●
61 µl of 2 M CaCl2.
●
sterile ddH2O to a final volume of 500 µl.
Solution B: ● 500 µl of 2X HBS. 3. Add solution A dropwise into solution B while bubbling, and leave the transfection mix for 10 min at room temperature (see Note 4). 4. Gently add the transfection mix (1 ml) to the 10-cm plate. Transfection may be performed as described either overnight (16 h) or for 8 h. In the latter case, add chloroquine to the transfection mix to a final concentration of 25 µM (see Note 5). 5. Check under the microscope for the formation of DNA/ Ca3(PO4)2 precipitates; they will appear as small black particles (see Note 6). 6. Gently shake the plates a few times to evenly distribute Ca3(PO4)2 precipitates and incubate the cells at 37°C in a humidified 5% CO2 incubator for the chosen time (see Step 4). 7. Discard the medium. 8. Carefully wash the cells twice with PBS. 9. Add 10 ml of fresh medium. 10. Incubate cells as described above. 3.1.1.2. Preparation of Samples
1. About 48 h after transfection cells are collected and lysed in 400–500 µl of E1A lysis buffer keeping the samples on ice
Inhibition of the SUMO Pathway by Gam1
291
for 30 min. Alternatively, cells can be collected and stored as a pellet at −80°C and lysed afterwards (see Note 7). 2. Sonicate the lysates twice for 20 s each and then centrifuge at 11000×g at 4°C for 30 min (see Note 8). 3. Quantify the lysates using the Bio-Rad protein assay, based on the Bradford method. Add 1–2 ml of assay solution for quantification to a cuvette (see Note 9). Use a single cuvette for each lysate and one for a blank sample. Add 1–2 µl of lysate to the solution in the cuvette and mix them by inverting several times. 4. Calibrate a UV/visible light spectrophotometer using the blank and then measure the absorbance at 595 nm and calculate the protein concentration (see Note 10). 5. Prepare samples to load with the desired amount of protein and adjust the final volume by adding sterile ddH2O or E1A lysis buffer and 5X loading buffer. 3.1.1.3. SDS-PAGE
1. Clean glass plates and spacers with ddH2O. 2. Prepare a 1.5-mm 15% gel by mixing 2.5 ml of 4X separating buffer with 5 ml of acrylamide/bis acrylamide solution, 2.4 ml of ddH2O, 100 µl of APS solution and 10 µl of TEMED (see Note 11). Pour the gel to 314 of the glass and top with isopropanol. The gel polymerizes in about 20 min. 3. Pour off the isopropanol and rinse the top of the gel twice with ddH2O. 4. Prepare the stacking gel by mixing 2.5 ml of 4X stacking buffer with 1.65 ml of acrylamide/bis acrylamide solution, 5.85 ml of ddH2O, 100 µl of APS solution and 40 µl of TEMED (see Note 11). Pour the gel and insert the comb. The stacking gel polymerizes in about 20 min. 5. Prepare the running buffer by diluting 100 ml of 10X SDS buffer with 900 ml of ddH2O in a measuring cylinder. Cover with PARAFILM® (Spi Supplies) and invert to mix. 6. Once the stacking gel has set, carefully remove the comb and use a syringe with a needle to wash the wells with running buffer. 7. Set up the electrophoresis apparatus and pour in the running buffer. 8. Load the samples, including an aliquot of prestained molecular weight marker. 9. Complete the assembly of the gel unit and connect to a power supply. The gel should be run at 70 V through the stacking gel and at 180 V through the separating gel. Stop the current when the dye front runs off the gel.
292
Pozzebon, Segré, and Chiocca
3.1.1.4. Western Blot
1. Electrophoretically transfer the samples separated by SDSPAGE to supported nitrocellulose membranes using a tank blotting apparatus as described as follows. 2. Disassemble the gel from the electrophoresis unit, discard the stacking gel and carefully place the separating gel onto a sheet of nitrocellulose membrane. 3. Wet two sheets of Whatman 3MM paper in transfer buffer and place them on both sides of the gel/membrane assembly (see Note 12). 4. Place two sponges, soaked in transfer buffer, on either side of the stack and place this assembly into the transfer cassette. 5. Place the cassette into the transfer apparatus filled with cold transfer buffer, such that the nitrocellulose membrane faces the anode (see Note 13). 6. Close the apparatus and connect the lid to the power supply. Transfer should be performed either at 30 V overnight or at 80 V for 2 h (see Note 14). 7. Following the transfer, disassemble the apparatus and keep the nitrocellulose membrane (see Note 15). 8. Stain the membrane for 1–2 min with 10 ml of Ponceau. Then wash the membrane with ddH2O to eliminate the excess Ponceau. The staining will indicate whether the transfer was successful and whether samples have been loaded evenly. 9. Incubate the nitrocellulose membrane in 15 ml blocking buffer for 1 h at room temperature on a rocking platform (see Note 16). 10. Discard the blocking buffer and incubate the membrane with primary antibody (α-myc diluted 1:100 in blocking buffer) for 1 h at room temperature or overnight at 4°C on a rocking platform. 11. Remove the primary antibody and wash the membrane three times in blocking buffer for 5 min each (see Note 17). 12. Incubate the membrane with freshly prepared secondary antibody (α-mouse diluted 1:10000 in blocking buffer) for 30 min at room temperature on a rocking platform. 13. Discard the secondary antibody and wash the membrane three times in TBS-T for 5 min each. 14. Following the final wash, drain the membrane, add 1 ml of each ECL reagent solution and rotate it by hand for 1 min to ensure complete coverage. 15. Place the blot into a developing cassette, protect it with a transparent film, and expose an Amersham film for a suitable time, from 10 s to several minutes (see Note 18).
Inhibition of the SUMO Pathway by Gam1
293
16. Develop the film (see Note 19). The myc-Gam1 protein is expected at a molecular weight of 30 KDa. It is not unusual to detect degradation products of Gam1 protein when it is overexpressed, but this will not influence the outcome of the experiment. A loss in global sumoylated substrates is expected and, as a consequence, PML nuclear bodies disaggregate, since sumoylated PML is required for the assembly and maintenance of PML nuclear bodies [see (11) and references therein]. 3.1.2. Transient Expression of Gam1 Through Infection
1. 24 h prior transfection, plate 2 million Phoenix cells per 10 cm plate in 10 ml of medium. Phoenix cells should be 70% confluent at the time of transfection. Calculate two plates of Phoenix producer cells for each plate of target cells to perform two cycles of infection. 2. Transfection with pMSCV-IRES-Gam1-GFP plasmid is performed with the classical calcium phosphate technique (see Sect. 3.1.1.1). 3. Either 8 h (for transfection with chloroquine) or 16 h (for transfection without chloroquine) post-transfection change the medium, wash the cells twice with 5–10 ml PBS, and add 5 ml of fresh medium to concentrate the viral supernatant. 4. Split the target cells. Adherent cells should be 50% confluent (in 10 cm plates for 5 ml of viral supernatant), while suspension cells should be in log phase at the time of infection (see Note 20). 5. Prior to infection, remove the medium from the target cells. 6. Collect and filter (0.45-µm filter) the supernatant from one of the two plates of Phoenix cells for every plate of target cells (see Note 21). 7. Add 5 ml of fresh medium to Phoenix cells and continue incubation at 37°C in a humidified 5% CO2 incubator. They will be used on the following day for the second cycle of infection. 8. Add the filtered viral supernatant to target cells. 9. Add polybrene at a final concentration of 5 µg/ml to the target cells in order to improve the rate of infection, and incubate them for 3–4 h at 37°C in a humidified 5% CO2 incubator. 10. Repeat the procedure with the second plate of Phoenix cells. 11. After 3–4 h, remove the viral supernatant from target cells and replace with proper growth medium (10 ml in 10-cm plates). 12. The following day repeat Steps 5–11, but skipping Step 7 (see Note 22). 13. After 48 h collect the target cells infected with pMSCVIRES-Gam1-GFP plasmid and perform biochemical analysis, such as SDS-PAGE and Western blot (see Sects. 3.1.1.3 and
294
Pozzebon, Segré, and Chiocca
3.1.1.4), immunoprecipitation and immunofluorescence. Reverse transcription and integration take place within 24–36 h, depending on cell growth kinetics. This method usually allows to infect more than 90% of the cell population with very good expression of Gam1 after 24–48 h. Quantification of infected cells overexpressing Gam1 is possible via FACS or immunofluorescence analysis by monitoring the levels of GFP green fluorescence (see Note 23). 3.1.3. Inducible Expression of Gam1 in a Human Cell Line
This approach presents several advantages: (1) a homogenous cell population expressing Gam1 simply by adding the specific drug, (2) fast and total inhibition of sumoylation, (3) the opportunity to carry out extended treatments on cells before induction of Gam1 expression and the inhibition of SUMO system. 1. Plate cells in a 10-cm plate in 10 ml of selective medium. 2. Incubate the cells at 37°C in a humidified 5% CO2 incubator until they reach the desired confluence (see Note 24). 3. Add 1 µg/ml doxycycline to the medium when cells are 70% confluent (see Note 25). 4. Incubate the cells at 37°C in a humidified 5% CO2 incubator. 5. 24–48 h after induction collect the cells and lyse them or store them at −80°C. Confirm the presence and activity of Gam1 by SDS-PAGE and Western blot analysis (see Sect. 3.1.1.3 and 3.1.1.4). The fascinating advantage of using this cell line is that Gam1 is expressed homogenously and simultaneously in every induced cell. Compared to transient transfection or infection, this cell line expresses less Gam1 (see Note 26), but nevertheless there is inhibition of global sumoylation, and SAE1, SAE2 and UBC9 disappear after 48 h (Fig. 19.1).
3.2. Inhibition of Sumoylation by Gam1 In Vitro
3.2.1. Production and Purification of GST-Gam1 Protein
Gam1 can also be easily produced as a recombinant protein to be used in various in vitro experiments such as inhibition of SUMO modification in sumoylation assays of a given substrate (5), in competition assays (4) or, in GST-Gam1 pull-down binding experiments (6). We present here two optimized protocols to produce huge amounts of Gam1 as a GST- or 6HIS-tagged recombinant protein. 1. Inoculate producer bacteria (BL21) transformed with a GSTGam1 expressing vector in 40 ml LB with selective antibiotic overnight. 2. Dilute 40 ml of bacteria in 210 ml LB with selective antibiotic (see Note 27) and incubate them with shaking for 1.5–2 h at 37°C until they reach logarithmic growth phase at OD600 = 0.7–0.8 (see Note 28).
Inhibition of the SUMO Pathway by Gam1
295
Fig. 19.1. Inhibition of the SUMO pathway by inducible Gam1 in the HEK293 cell line. Mock and inducible Gam1-expressing cell lines are treated where indicated with 1 µg/ ml doxycycline for 48 h. Cells are collected, lysed and analyzed by SDS-PAGE and Western blot. The SUMO system in mock cells is not affected by the inducing agent doxycycline (compare lanes 1 and 3), whereas it is completely impaired in Gam1expressing cells once induced by doxycycline (compare lanes 2 and 4). SAE2 protein corresponds to the lower band of the doublet, as indicated by the arrowhead. Vinculin is used as a loading control.
3. Induce production of GST-Gam1 recombinant protein with 0.3 mM IPTG and continue shaking for 2 h at room temperature (see Note 29). 4. Pellet bacteria at 5500 × g for 15 min at 4°C. 5. Lyse bacteria in 20 ml of Glutathione Lysis buffer for 20 min on ice, then sonicate twice for 30 s and place on ice for 10 min (see Note 30). 6. Centrifuge at 23000 × g for 30 min. 7. Filter the supernatant through a 0.22-µm filter. 8. Add 1 ml of a 50% slurry of glutathione Sepharose 4B beads to the lysate and incubate at 4°C overnight on a rotating device.
296
Pozzebon, Segré, and Chiocca
9. Centrifuge the beads at 500 × g for 1 min at 4°C, discard the supernatant and wash the beads with 10 ml of cold glutathione lysis buffer or PBS. Repeat at least three times. 10. After the last wash, remove most of the supernatant, leaving 250 µl of buffer on the beads. 11. Load a small quantity of beaols suspension (i.e. 10 µl, supplemented with 5X loading buffer) on a 15% polyacrylamide gel, along with known amounts of BSA (1, 5, 10, 20 µg), and run the gel at 200 V for 1 h. 12. Stain the gel with Comassie Brilliant Blue for 10 min, then incubate with destaining solution at 4°C overnight on a rocking platform (see Note 31). 13. Verify the presence of purified GST-Gam1 protein and determine its concentration by comparison with the BSA standards. A representative Comassie Brilliant Blue staining is shown (Fig. 19.2). The protein often appears as a doublet at the expected molecular weight of GST-Gam1 (60 KDa), probably due to partial degradation. 14. GST-Gam1 beads can be stored at −80°C with no significant degradation of GST-Gam1, but multiple freeze/thaw cycles should be avoided. Addition of 5–10% glycerol may help to stabilize the suspension. 15. GST-Gam1 can be eluted from beads for enzymatic assays such as sumoylation reactions by incubation with 0.5–1 ml
Fig. 19.2. Purification of GST-Gam1 protein for in vitro analysis. Recombinant GST-Gam1 protein was produced in E.coli BL-21 strain and purified on glutathione Sepharose. Quantification of eluted proteins was performed by the Bio-Rad protein assay, based on the Bradford method, and confirmed by comparison with known amounts of BSA protein on a Comassie Brilliant Blue-stained gel. The arrowhead indicates purified GST-Gam1 protein at the expected molecular weight of about 60 KDa.
Inhibition of the SUMO Pathway by Gam1
297
of glutathione elution buffer for 30 min. In this case, Gam1 can be identified on Western blots by means of its GST-tag (see Sect. 3.1.1.4). 3.2.2. Production and Purification of His6-Gam1 Protein
Gam1 can be alternatively produced as a 6HIS Gam1 protein. The procedure is the same as for GST-Gam1, with the following variations: 1. Induce bacterial expression with 0.37 mM IPTG. 2. Lyse bacteria with 20 ml of histidine lysis buffer. 3. Purify the fusion protein with 500 µl of a 50% slurry of NiNTA agarose beads (at 4°C for 2 h) or on a Ni-Co column. 4. Wash three times with 10 ml of histidine wash buffer. 5. Elute the fusion protein with 2 ml of histidine elution buffer for 30 min.
3.2.3. Sumoylation Assay in the Presence of Purified Gam1 Protein
1. Prepare a reaction mix (final volume: 20–30 µl) containing: ●
●
●
●
●
●
100–500 ng of purified E1 [GST-SAE2/SAE1 (12)]. 200–1000 ng of purified E2 (GST-UBC9). It is recommended to use the E2 at two-fold concentration compared to the E1. 2–5 µg of purified GST-SUMO-1 [1–97aa-C52A (12), see Note 32]. 0.5–5 µg of purified substrate protein. 25 ng of purified Gam1 protein is the suggested starting amount, but it can be adjusted depending on the purpose of the experiments [for example, increasing concentrations in competition assays as described in (4)]. 4–6 µl of 5X ATP buffer.
2. Incubate the mix at 30°C for 2 h in the thermomixer. 3. Stop the reaction with 5X loading buffer and perform SDS-PAGE and Western blot analysis (see Sects. 3.1.1.3 and 3.1.1.4). An example of the outcome for this assay is reported in (4).
4. Notes 1. To optimize Gam1 transfection and its subsequent expression, cell should be 50% confluent at the time of transfection; thus, plate cells accordingly. 2. This is the simplest and quickest method of transfection, but others can be used with equal success. Refer to the cell line
298
Pozzebon, Segré, and Chiocca
datasheet to choose the most efficient method. Alternatively, use the infection method. 3. Solutions must be prepared under a laminar flow hood. CaCl2 is the last reagent to be added to the first solution. It is possible to co-transfect other plasmids with pSG9MGam1, but it is necessary to normalize the total amount of DNA using the pSG9M vector. We also suggest preparing fresh DNA before each transfection in order to improve transfection efficiency. 4. “Bubbling” is performed by blowing air through a pipette in order to create bubbles in the transfection mix. During transfection, this is a critical step in the formation of DNA/ Ca3(PO4)2 complexes and must be performed correctly. It is suggested to continue bubbling for an additional 30–60 s after the first reaction mix has been added. 5. The resulting efficiency of transfection is comparable. 6. If precipitates are very small, it may not be possible to detect them under the microscope, but this will not impinge on transfection efficiency. 7. It is strongly suggested to collect cells at this point because sumoylation has already been inhibited by Gam1, and prolonged incubation time would only enhance apoptosis (10). 8. Keep the samples on ice between sonication cycles. 9. The exact final volume depends on the capacity of the cuvette. Make sure that the emission ray of the spectrophotometer crosses the solution. 10. Before quantification, prepare a standard curve of absorbance versus protein concentration using known concentrations of BSA. 11. These quantities are based on a final volume of 10 ml for a mini gel apparatus. 12. Be careful not to trap any air bubbles that could impair proper transfer. Use a pipette to eliminate the air by rolling it from the centre to the edges of the gel. 13. It is extremely important to ensure this orientation or the proteins will be moving from the gel into the buffer rather than onto the membrane. 14. The efficiency of transfer is comparable. For best results, transfer should be carried out at 4°C or with ice in the apparatus. 15. The molecular weight marker should be clearly visible on the membrane. This is a good indication for successful transfer of the proteins. 16. The Ponceau staining is washed away from the membrane during the blocking step.
Inhibition of the SUMO Pathway by Gam1
299
17. The primary antibody can be saved for subsequent experiments by addition of 0.02% sodium azide and stored at 4°C. This primary antibody can be used for many blots up to several weeks. 18. The last step must be performed in a dark room or under safe light conditions. 19. Manual development is possible without compromising the outcome of the experiment. 20. Retroviruses infect only actively replicating cells. We have noted that correct density of target cells (50% confluence) can be crucial for the efficiency of infection with pMSCVIRES-Gam1-GFP plasmid and thus for expression of the Gam1 protein. 21. It is possible to freeze the filtrated viral supernatant at −80°C and infect target cells later. Viral supernatant must be rapidly thawed at 37°C and immediately used on target cells. Viral titer and efficiency of infection are slightly reduced compared to the standard protocol. 22. Two consecutive days noticeably improve the efficiency of infection on the target cells. 23. Although Gam1 and GFP should theoretically be expressed at a ratio of 1:1, it is possible that GFP is expressed at lower levels compared to the Gam1 protein. In this case, GFP is present and detectable by Western blot, but not sufficient to give a significant green fluorescence signal detectable with an optical microscope or by FACS analysis. The use of pMSCV-IRES-EGFP (enhanced GFP) plasmid may solve this problem. 24. Cell density can vary according to the cell type, as well as the total duration of the experiment (including further possible treatments, as mentioned above), but it is useful to keep in mind that cells must be 70% confluent at the time of Gam1 induction by drug treatment. 25. At the indicated dose, doxycycline is not toxic for cells and induces expression of Gam1. Doxycyline is used in place of tetracycline because it is more stable and therefore more effective at inducing Gam1 gene expression. 26. In some cases the amount of the expressed myc-Gam1 protein may be too low to be easily detected. In this case, FACS analysis and immunofluorence analysis can be performed. Disappearance of SAE1, SAE2 and UBC9 is a good indication that Gam1 is active. 27. If large amounts of GST-Gam1 protein are required, volumes of bacterial culture and LB for logarithmic growth may be scaled up proportionally.
300
Pozzebon, Segré, and Chiocca
28. Bacteria produce significant amount of GST-Gam1 protein only when they are growing in exponential phase. The optical density must not be less than 0.65 or more than 0.85 when cultures are induced with IPTG. 29. GST-Gam1 protein has the tendency to form aggregates. Be careful not to induce bacterial expression for more than 3 h and to use protease inhibitors in the glutathione lysis buffer. 30. If the pellet is derived from a bigger volume of bacteria, adjust the volumes of glutathione lysis buffer accordingly. Bacterial sonication is a critical step. Clarification of supernatant is a good indication of proper lysis, which is essential for obtaining appreciable amounts of GST-Gam1 protein. 31. Successful destaining is obtained when the gel surrounding the protein bands is transparent. 32. The 1-97aa-C52A form is already processed and can be covalently attached. The mutation of cysteine 52 into Alanine improves the efficiency of the enzymatic reaction in vitro.
Acknowledgments We thank all IFOM-IEO campus facilities and all members of our laboratory, past and present. A special thank to Ario de Marco, Marisa Aliprandi and Annunziata Venuto for creating the inducible Gam1 expressing cell line, to Alfonso passafaro for generating the pMSCV-IRES-Gam1-GFP Plasmid and to Ronald T. Hay for kindly providing GST-SAE2/SAE1 and GST-SUMO-1 (1–97aa-C52A plasmids). This work was supported by grants from AIRC (Associazione Italiana per la Ricerca sul Cancro) to S.C., and from the Italian Ministry of Health.
References 1. Chiocca, S., Baker, A., and Cotten, M. (1997) Identification of a novel antiapoptotic protein, GAM-1, encoded by the CELO adenovirus. J. Virol. 71, 3168–3177. 2. Glotzer, J. B., Saltik, M., Chiocca, S., Michou, A. I., Moseley, P., and Cotten, M. (2000) Activation of heat-shock response by an adenovirus is essential for virus replication. Nature 407, 207–211. 3. Chiocca, S., Kurtev, V., Colombo, R., Boggio, R., Sciurpi, M. T., Brosch, G., Seiser, C., Draetta, G. F., and Cotten, M. (2002)
Histone deacetylase 1 inactivation by an adenovirus early gene product. Curr. Biol. 12, 594–598. 4. Boggio, R., Colombo, R., Hay, R. T., Draetta, G. F., and Chiocca, S. (2004) A mechanism for inhibiting the SUMO pathway. Mol. Cell 16, 549–561. 5. Colombo, R., Boggio, R., Seiser, C., Draetta, G. F., and Chiocca, S. (2002) The adenovirus protein Gam1 interferes with sumoylation of histone deacetylase 1. EMBO Rep. 3, 1062–1068.
Inhibition of the SUMO Pathway by Gam1 6. Boggio, R., Passafaro, A., and Chiocca, S. (2007) Targeting SUMO E1 to ubiquitin ligases: a viral strategy to counteract sumoylation. J. Biol. Chem. 282, 15376– 15382. 7. Deyrieux, A. F., Rosas-Acosta, G., Ozbun, M. A., and Wilson, V. G. (2007) Sumoylation dynamics during keratinocyte differentiation. J. Cell Sci. 120, 125–136. 8. Hacker, D. L., Derow, E., and Wurm, F. M. (2005) The CELO adenovirus Gam1 protein enhances transient and stable recombinant protein expression in Chinese hamster ovary cells. J. Biotechnol. 117, 21–29. 9. Colombo, R., Draetta, G. F., and Chiocca, S. (2003) Modulation of p120E4F tran-
301
scriptional activity by the Gam1 adenoviral early protein. Oncogene 22, 2541–2547. 10. Wu, F., Chiocca, S., Beck, W. T., and Mo, Y. Y. (2007) Gam1-associated alterations of drug responsiveness through activation of apoptosis. Mol. Cancer Ther. 6, 1823–1830. 11. Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., and Pandolfi, P. P. (2006) The mechanisms of PML-nuclear body formation. Mol. Cell 24, 331–339. 12. Tatham, M. H., Jaffray, E., Vaughan, O. A., Desterro, J. M., Botting, C. H., Naismith, J. H., and Hay, R. T. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J. Biol. Chem. 276, 35368–35374.
Chapter 20 SUMO Fusion Technology for Enhanced Protein Production in Prokaryotic and Eukaryotic Expression Systems Tadas Panavas, Carsten Sanders, and Tauseef R. Butt Abstract In eukaryotic cells, the reversible attachment of small ubiquitin-like modifier (SUMO) protein is a post-translational modification that has been demonstrated to play an important role in various cellular processes. Moreover, it has been found that SUMO as an N-terminal fusion partner enhances functional protein production in prokaryotic and eukaryotic expression systems, based upon significantly improved protein stability and solubility. Following the expression and purification of the fusion protein, the SUMO-tag can be cleaved by specific (SUMO) proteases via their endopeptidase activity in vitro to generate the desired N-terminus of the released protein partner. In addition to its physiological relevance in eukaryotes, SUMO can, thus, be used as a powerful biotechnological tool for protein expression in prokaryotic and eukaryotic cell systems. In this chapter, we will describe the construction of a fusion protein with the SUMO-tag, its expression in Escherichia coli, and its purification followed by the removal of the SUMO-tag by a SUMOspecific protease in vitro. Key words: SUMO fusion, Ulp1, protein expression, protein stability, solubility.
1. Introduction SUMO proteins are covalently attached to and removed from specific protein substrates in eukaryotic cells. Sumoylation as a reversible post-translational modification process has been shown to be involved in many cellular processes, such as nuclear-cytosolic transport (1), apoptosis (2), protein activation (3) and stability (4), response to stress (5), and progression through the cell cycle (6). In addition, SUMO (Saccharomyces cerevisiae Smt3) has emerged as an effective biotechnological tool, since it is rapidly folded and relatively stable in prokaryotic cell systems even when Helle D. Ulrich (ed.), Methods in Molecular Biology: SUMO Protocols, vol. 497 © 2009 Humana Press, a part of Springer Science + Business Media, New York, NY Book doi: 10.1007/978-1-59745-566-4
303
304
Panavas et al.
Fig. 20.1. Comparison of protein expression and solubility among GDF8 derivatives containing various N-terminal fusions (SUMO, GST, MBP, TRX, NusA and Ub). All genes were expressed in derivatives of the vector pET24. Equal amounts of protein from uninduced culture (UN), induced (IN), soluble fraction (S) and inclusion bodies (IB) were analyzed by 10% SDS-PAGE. Gels were stained with Coomassie blue. Details are given in the text. GDF8 fused with SUMO or NusA consistently showed higher amounts of expression and solubility, whereas the GDF8 derivatives tagged with GST, MBP or TRX were least improved.
expressed at high levels. As an N-terminal tag, SUMO usually promotes correct folding and structural stability of the fusion protein, leading to enhanced functional production of the partner protein compared to its untagged version (Fig. 20.1) (7–13). To facilitate the purification step of the partner protein following its expression in a bacterial host, a 6xHis+SUMO-tag has been established. This tag can be efficiently removed by SUMO protease (S. cerevisiae Ulp1), which recognizes the SUMO-based tag, cleaves it C-terminally of a conserved Gly-Gly motif and, thus, generates a partner protein with a desired N-terminus. This enzymatically detached partner protein can be re-purified and used for many biomedical or biopharmaceutical purposes. The wild-type SUMO-tag is an excellent tool for prokaryotic expression systems like E. coli. However, in eukaryotic organisms, the SUMO-tag is cleaved by naturally occuring SUMO proteases in vivo (14). LifeSensors, Inc. recently engineered a novel SUMO-based tag, called SUMOstar, which is not removed from the fusion partner in eukaryotic cells while maintaining enhanced protein expression, as we have shown in yeast (Saccharomyces cerevisiae and Pichia pastoris, unpublished data), insect (15) and mammalian cells (16). Moreover, a SUMOstar-specific protease has been developed by LifeSensors, Inc. to cleave off the SUMOstar-tag in vitro after affinity purification of the fusion protein making the SUMO fusion technology utilizable for a variety of prokaryotic and eukaryotic cell systems. Here, we will provide detailed protocols how to construct a SUMO-tag fused gene of interest, express this gene fusion in E. coli and purify the gene product from either soluble fraction or inclusion bodies. Furthermore, we will show how to cleave off the SUMO-tag in vitro using a SUMO-specific protease and to re-purify the generated native-like protein of interest.
SUMO Fusion Technology for Protein Expression
305
2. Materials 2.1. Cloning of an Open Reading Frame (Gene of Interest) into the pSUMO Vector
1. pSUMO vector (LifeSensors, Inc.) (Fig. 20.2). 2. DNA containing the gene of interest. 3. PCR kit (High Fidelity DNA polymerase, 10x reaction buffer, dNTP nucleotide mix). 4. Appropriate DNA restriction enzymes and reaction buffers. 5. PCR purification kit. 6. 50°C water bath. 7. DNA gel extraction kit. 8. TAE buffer: 40 mM Tris base, 1 mM EDTA, 20 mM acetic acid; pH adjusted to 8.5. 9. Agarose. 10. T4 DNA ligase and its reaction buffer. 11. Competent E. coli TOP10 cells. 12. LB medium: 1% (w/v) Bacto-Tryptone, 0.5% (w/v) Yeast Extract, 1% (w/v) NaCl; adjusted to pH 7.0 with HCl. 13. LB agar plates with appropriate antibiotics. 14. Plasmid DNA miniprep kit.
2.2. Transformation of the E. coli Expression Strain and Induction of Protein Expression
1. SOC media: 2% (w/v) Bacto-Tryptone, 0.5% (w/v) BactoYeast Extract, 0.05% (w/v) NaCl, 2.5 mM KCl, 20 mM Glucose; adjusted to pH 7.0 with HCl. 2. LB medium: 1% (w/v) Bacto-Tryptone, 0.5% (w/v) Yeast Extract, 1% (w/v) NaCl; adjusted to pH 7.0 with HCl. 3. Kanamycin: 50 mg/ml (1000x concentrate). 4. Bunsen burner and flint striker. 5. Ice bucket. 6. Shaking 37°C incubator. 7. Sterile 2.5 l flasks. 8. Water bath heated to 42°C. 9. Sterile spreader. 10. Automatic pipettor. 11. Centrifuge with a rotor holding 250 and 500 ml bottles.
2.3. E. coli Cell Lysis for the Preparation of Soluble Protein and Inclusion Body (IB) Fractions
1. Sterile 35 ml centrifugation tubes. 2. PBS: 2 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl; adjusted to pH 8.0 with Na2HPO4. 3. Lysis buffer: PBS containing additional 150 mM NaCl, 10 mM imidazole and 1% (v/v) Triton X-100.
306
Panavas et al.
Fig. 20.2. The cloning vector pSUMO. (A) A feature map of the vector. Expression of the SUMO fusion protein is driven from the inducible T7 promoter. The pSUMO vector is a low copy plasmid with a kanamycin selectable marker. (B) The DNA sequence encoding the SUMO-tag and the polylinker. The cleavage pattern by the restriction enzyme BsaI is illustrated. Digestion with BsaI results in two unique overhangs for the directional cloning of the predigested PCR insert.
SUMO Fusion Technology for Protein Expression
307
4. IB Wash buffer: Lysis buffer containing 0.5% (v/v) Trition X-100, 1 mM EDTA and 1 M urea. 5. IB Solubilization buffer: 50 mM CAPS-KOH, pH 11, 0.3 M NaCl, 0.3% (w/v) N-Laurylsarcosine, 1 mM DTT. 6. DNase: 50 mg/ml stock of Deoxyribonuclease I from bovine pancreas (frozen at −20°C). 7. RNase: 50 mg/ml stock of Ribonuclease A from bovine pancreas. 8. PMSF (Phenylmethylsulfonyl fluoride): 1 M stock. 9. IPTG: 1 M stock. 10. Triton X-100. 11. Dialysis buffer: 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% glycerol. 2.4. Affinity Purification of a SUMO-Tagged Protein from E. coli Soluble Extract and Solubilized Inclusion Bodies
1. Ni-NTA resin for IMAC (Immobilized affinity chromatography). 2. Lysis buffer: PBS containing additional 150 mM NaCl, 10 mM imidazole and 1% (v/v) Triton X-100. 3. Wash buffer 1: PBS containing additional 150 mM NaCl, 5 mM imidazole, and 1% (v/v) Triton X-100. 4. Wash buffer 2: PBS containing additional 150 mM NaCl and 15 mM imidazole. 5. Elution buffer: PBS containing additional 150 mM NaCl and 300 mM imidazole. 6. Strip buffer: 20 mM Tris-HCl, pH 7.9, 100 mM EDTA, 0.5 M NaCl. 7. IB solubilization buffer: 50 mM CAPS-KOH, pH 11, 300 mM NaCl, 0.3% (w/v) N-Laurylsarcosine, 1 mM DTT. 8. Charge buffer: 50 mM NiCl2. 9. 20% (v/v) ethanol. 10. Dialysis buffer: 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% glycerol.
2.5. Cleavage of the SUMO-Tag by SUMO Protease
1. SUMO protease (recombinant 6xHis-tagged catalytic core of S. cerevisiae Ulp1; 10 unit/µl, available from LifeSensors, Inc.). 2. PBS: 2 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl; adjusted to pH 8.0 with Na2HPO4. 3. Refolding buffer: 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% (w/v) CHAPS, 10% (v/v) glycerol. 4. 1 M DTT. 5. 3.5 kDa MWCO (Molecular weight cut-off) dialysis tubing.
308
Panavas et al.
3. Methods 3.1. Directional Cloning into pSUMO Vector Using BsaI
In this sub-section, we will describe how to generate a SUMOtag fused gene of interest by using the pSUMO vector and a single restriction enzyme for cloning in frame (see Notes 1 and 2). 1. Design PCR primers for the gene of interest. For the forward and reverse primers, use the sequences 5′-NNN GGT CTC NA GGT XXX XXX XXX XXX XXX-3′ and 5′-NNN GGT CTC TCT AGA TCA YYY YYY YYY YYY YYY-3′ as templates, respectively. Within these PCR templates, “X” corresponds to any nucleotide at the 5′ end of the gene of interest and “Y” to any nucleotide reverse complementary to its 3′ end. “N” is any nucleotide, the BsaI site is in bold, and the XbaI site in bold and italics (see Note 3). 2. Amplify the gene of interest with the designed primers in a PCR reaction using a thermostable high fidelity DNA polymerase. 3. Clean up the PCR reaction using a PCR purification kit. 4. Digest the pSUMO vector and the generated PCR product separately in reaction tubes with BsaI restriction endonuclease (10 U) for 1 h at 50°C (see Notes 4 and 5), and separate the reaction samples on a 1% (w/v) TAE agarose gel by running for 30 min at 10 V/cm. 5. Isolate (excise) both restricted DNAs, the pSUMO vector and the PCR fragment from the agarose gel using a DNA gel extraction kit. 6. Mix the vector and the PCR fragment at a ratio 1:3 and set up a 20 µl ligation reaction. 7. Incubate the reaction mix at room temperature for 2 h. 8. Use 5 µl of the ligation reaction to transform 50 µl of competent E. coli TOP10, DH5α, or other strains suitable for cloning according to the transformation protocol (see Sect. 3.2). 9. Inoculate 3 ml cultures with positive colonies on LB-based selection plates and grow with shaking at 37°C overnight. 10. Spin down bacteria at 4000g for 5 min and discard the medium. 11. Isolate the plasmid using a Plasmid DNA miniprep kit. After sequence confirmation proceed to the transformation of the E. coli expression strain.
3.2. Transformation and Culturing of the E. coli Strain BL21(DE3) for Induced Protein Expression
The next step is the expression of the SUMO fusion construct from the newly generated vector in the E. coli strain BL21(DE3). This strain is commonly used for inducible, T7 RNA polymerasedriven high-level gene expression. To decrease cellular degradation of rapidly produced proteins of interest, the genes of two
SUMO Fusion Technology for Protein Expression
309
major proteases, OmpT and Lon, are deleted from the genome of this strain. 1. Thaw chemically competent cells on ice, keeping the cells as cold as possible at all times. Manipulate the cells as gently as possible at all times. Always work aseptically when transforming and culturing E. coli cells. 2. Add 1 µl of DNA solution (approximately 0.1 µg) to 50 µl of a suspension of chemically competent cells in a sterile 1.5 ml microfuge tube on ice. 3. Mix with a pipette tip and incubate on ice for 15–30 min. 4. Following incubation on ice, heat-shock the cells by removing the tube from the ice and immediately immersing in a 42°C water bath for 40 s. Place the tube back on ice after this heat shock period. 5. After two minutes on ice, add 200 µl of pre-warmed SOC (37°C). 6. Incubate the cells for recovery in the 37°C shaker for 1 h. 7. Aseptically transfer 0.1 ml of transformation culture to an LB plate containing 50 mg/l kanamycin. 8. Spread the transformation culture evenly under a lit Bunsen burner with a sterile spreader. 9. Incubate the plate overnight in a 37°C incubator. 10. Pipette 5 ml LB media into a sterile 15 ml snap cap tube. Add 5 µl of 1000x kanamycin solution (final concentration: 50 µg/ml). 11. Inoculate this culture with a single colony of E. coli BL21 (DE3) strain transformed with the expression plasmid, using an inoculation loop (see Note 6). 12. Incubate the culture with shaking (250 rpm) at 37°C overnight. 13. Measure 1 l of LB using sterile graduated cylinder and transfer to sterile 2.5 l flask by pouring. Add kanamycin to a final concentration of 50 µg/ml. 14. Inoculate the 2.5 l flask with the 5 ml starter culture 15. Incubate with shaking (rpm = 250) at 37°C for approximately 3 h until the cell density reaches an OD600nm of 0.5. 16. When the OD600nm of 0.5 is reached, remove 1 ml of culture serving as an negative induction control. Harvest the cells by centrifugation at 4000g for 15 min and store the pellet at −80°C. 17. Add IPTG to a final concentration of 1 mM. Incubate either at 37°C with shaking for 3 h or at 20°C for 16 h (see Note 7). Harvest cells by centrifugation at 4000g for 15 min.
310
Panavas et al.
3.3. Cell Lysis and Preparation of Soluble Protein and Bacterial Inclusion Body (IB) Fractions
3.3.1. Preparation of Soluble Fraction from E. coli Cells
When overexpressed in E. coli, proteins that are naturally not inserted into membranes can either accumulate in the soluble fraction or form insoluble aggregates called inclusion bodies. Since the SUMO fusion technology usually promotes increased protein solubility, SUMO-tagged proteins of interest are likely to be found in the soluble fraction. In some cases, however, even SUMO-tagged fusion proteins are misfolded in E. coli and form inclusion bodies. In this section, we will describe the procedures how to prepare a soluble fraction and how to isolate and solubilize inclusion bodies from bacterial cells. 1. Harvest E. coli cells from LB medium by centrifugation (4000g, 15 min at 4°C), yielding a typical wet weight of cultured cells of approximately 10–12 g per liter culture. 2. Decant the medium and resuspend the cell pellets in Lysis buffer (3 ml Lysis buffer per 1 g cells). 3. Lyse cells in Lysis buffer by sonication (50% output for 5 × 30 s, with 1 min intervals between the pulse cycles) on ice water (see Note 8). 4. Add DNase and RNase (20 µg/ml) to the lysates and incubate for 20 min on ice (see Note 9). 5. Add Triton X-100 to the sample to the final concentration of 1% (v/v) and incubate at 4°C for 1 h. 6. Centrifuge the sample (20,000g, 30 min at 4°C); save the supernatant as the soluble protein fraction and keep the pellet for preparation of insoluble proteins (see Sect. 3.3.2.).
3.3.2. Solubilization of Proteins from Inclusion Bodies (IB) of E. coli Cells
1. Wash the pellet prepared above from a 1 l culture with 30 ml IB Wash buffer by resuspension and centrifugation at 10,000g for 10 min at 4°C. 2. Discard the supernatant and repeat the wash steps twice as described above. 3. Add 30 ml IB Solubilization buffer to the pellet and incubate with shaking for 1 h at room temperature to extract insoluble proteins. 4. Centrifuge the sample at 15,000g for 30 min at 4°C and collect the supernatant as the insoluble protein fraction. 5. Analyze the soluble and insoluble fractions prepared above using SDS-polyacrylamide gel electrophoresis (PAGE) according to the molecular weight of the gene product. 6. Use the protein samples for purification immediately or store them at 4°C for a short period of time (less than 10 days). Long-term storage should be at −80°C; avoid repeated freeze-thaw cycles.
SUMO Fusion Technology for Protein Expression
311
3.4. Affinity Purification of SUMO-Tagged Protein Using Ni-NTA Resin
The 6xHis affinity tag at the N-terminus of SUMO allows affinity purification of SUMO fusion proteins on a Ni-NTA resin (Fig. 20.3). This is a very efficient and relatively inexpensive way of purifying proteins from bacterial lysates. The purification protocols for soluble proteins and those solubilized from inclusion bodies are distinct with respect the buffer compositions and hence differentiated here (Sects. 3.4.1 and 3.4.2).
3.4.1. Purification from the Soluble Fraction
1. Pipette 25 ml Ni-NTA resin into a column and allow to drain by gravity (here and in all subsequent purification steps allow the column to drain by gravity). 2. Wash the column with 5 column volumes (CV) of water. 3. Charge the column with 5 CV Charge buffer. If using new Ni-NTA resin, the resin is pre-charged and this step may be omitted.
Fig. 20.3. Flow chart for purification and cleavage of 6xHis-SUMO-tagged proteins.
312
Panavas et al.
4. Equilibrate column with 10 CV of Wash buffer 1. 5. Load sample onto Ni-NTA resin. Make sure that the protein extract contains 5 mM imidazole. If not, add 1.7% (v/v) Elution buffer to the protein sample and mix gently (see Note 10). 6. Wash the column with 10 CV of Wash buffer 1. 7. Wash with 10 CV of Wash buffer 2. 8. Elute the bound SUMO fusion protein with 4 CV of Elution buffer. 9. Strip the column by adding 5 CV of Strip buffer. 10. Wash the column with 5 CV water. 11. Apply 5 CV 20% (v/v) ethanol to the column, allow ½ the volume to drain by gravity, and store the column at 4vC. 3.4.2. Purification from the Insoluble Fraction
1. Equilibrate a pre-charged column with 10 CV of IB Solubilization buffer containing 5 mM imidazole. 2. Load the sample onto Ni-NTA resin. Make sure the protein extract contains 5 mM imidazole as mentioned in Step 5 of Sect. 3.4.1. 3. Wash the column with 10 CV IB Solubilization buffer containing 5 mM imidazole. 4. Wash with 10 CV IB Solubilization buffer containing 15 mM imidazole. 5. Elute with 4 CV IB Solubilization buffer containing 300 mM imidazole. 6. Strip the column by adding 5 CV Strip buffer. 7. Wash the column with 5 CV water. 8. Prepare the column for storage in ethanol as described in Step 11 of Sect. 3.4.1.
3.5. Cleavage of the SUMO-Tag with SUMO Protease and Re-Purification of the Released Protein of Interest
This is the final step in obtaining purified tagless native-like protein of interest. The SUMO protease Ulp1 is very robust (see Fig. 20.4 and Table 20.1) and recognizes defined structural features of SUMO rather than primary amino acid sequences like other commonly used proteases such as enterokinase, Factor Xa, or TEV protease. After the cleavage of the SUMO fusion protein with Ulp1, the mixture is passed again through a Ni-NTA column. The cleaved SUMO-tag along with the SUMO protease bind to the column since they both contain 6xHis affinity tags, while the tagless protein of interest can be recovered in the flow-through. 1. Dialyze a purified SUMO-fused protein using 3.5 kDa MWCO dialysis tubing against either 500 ml PBS (for soluble fusions) or 500 ml Refolding buffer (for insoluble SUMO-fused proteins). Dialyze for 24 h at 4°C with at least four buffer exchanges.
SUMO Fusion Technology for Protein Expression
313
Fig. 20.4. Effect of temperature and various chemicals on Ulp1 activity. Purified SUMOM-GFP fusion (15 µg) and one unit of SUMO protease were combined in PBS buffer with indicated additives, and the reactions were stopped after 20 min. Reaction products were resolved by SDS-PAGE and stained with Coomassie blue.
Table 20.1. Influence of various chemicals on the activity of SUMO protease Ulp1 Chemical
Concentration
% of cleavage
Phosphate-buffered saline (PBS)
1X
100
DTT or β-mercaptoethanol
20 mM
100
NaCl
150 mM
100
500 mM
60
1M
30
1M
100
2M
95
3M
5
Guanidine-hydrochloride
500 mM
60
1M
0
Triton X-100
1%
100
Imidazole
300 mM
100
GSH (reduced Glutathione)
20 mM
100
Maltose
20 mM
100
Glycerol
20% (v/v)
100
Ethylene glycol
20% (v/v)
100
Sucrose
20% (w/v)
100
Ethanol
10% (v/v)
100
Urea
314
Panavas et al.
2. Add SUMO protease (Ulp1) to the SUMO-fusion protein sample in appropriate buffer (conditions are listed in Table 20.1) at a ratio of 1 unit enzyme per 100 µg substrate (see Note 11). One arbitrary unit of the SUMO protease is defined as the ability to cleave 100 µg of SUMO-tag fused GFP in 1 h at 30°C. 3. Add DTT to the enzyme-substrate mixture to a final concentration of 2.0 mM. Do not exceed 2 mM if Nickel affinity resin (Ni-NTA) will be used for subtracting SUMO in the downstream purification, because high concentrations of DTT can disassociate the metal from the resin. 4. Incubate the mixture at 30°C for 1 h with slight shaking. Typically, >95% of SUMO-fusions can be cleaved under these conditions (to maximize cleavage, continue to incubate the mixture at 4°C overnight). 5. Check the cleavage using SDS-PAGE. If the SUMO-fusion is not approx. 95% cleaved, add more Ulp1 and incubate for a longer time. 6. Dialyze the cleaved SUMO fusion with proper buffer for the next purification step, subtraction of SUMO and Ulp1 for pure target proteins (see Note 12). 7. For the subtraction step, re-apply the digestion mixture to the 5 ml column of Ni-NTA resin. Add two column volumes of PBS to the column. While the gene product of interest, which does not harbor a 6xHis-tag, flows through the column, both the SUMO fusion and SUMO protease contain a 6xHis-tag and thus bind to the Ni-NTA resin and are removed from the mixture. 8. Analyze the protein samples on SDS-PAGE gel (see a sample purification and cleavage analysis in Fig. 20.5).
4. Notes 1. To take full advantage of SUMO fusion technology, including the removal of SUMO tag by SUMO protease, it is critical to generate a fusion construct without any additional sequence between SUMO and the desired gene. SUMO protease recognizes the secondary structure of SUMO moiety and cleaves at the C-terminal end of a conservedGly-Gly sequence (17). Therefore, SUMO protease never cleaves within the partner protein.
SUMO Fusion Technology for Protein Expression
315
Fig. 20.5. Expression and purification of 6xHis-SUMO-3CL and untagged protein. E. coli grown in LB medium was induced at 20°C for 6 h. Proteins were purified on Ni-NTA resin and eluted (lanes as described in Sect. 3.4.). Cleavage and dialysis of 2 mg of each fusion were performed overnight at 4°C with 10 units of SUMO protease Ulp1. Following dialysis, 6xHis-SUMO and Ulp1 were removed by passing the proteins through a miniature Ni-NTA column. Protein fractions were resolved by SDS-PAGE and stained with Coomassie blue.
2. SUMO protease can cleave the SUMO moiety in any amino acid context except where the C-terminal glycine residues of SUMO are followed immediately by a proline residue. 3. In designing DNA primers for the amplification of the open reading frame, make sure to add at least two extra nucleotides at the 5′ end of the primer. Otherwise the restriction enzymes will not cleave the PCR product efficiently. 4. If the gene of interest contains an inherent BsaI site, one can use alternative type II-S restriction endonuclease. Below are recommended ways to incorporate these enzymes into the DNA primers. AarI 5′-CACCTGCNNNNAGGTXXXXXXXXXXXXXXX–3′ BbsI: 5′-GAAGACNNAGGTXXXXXXXXXXXXXXX-3′ BbvI: 5′-GCAGCNNNNNNNNAGGTXXXXXXXXXXXXXXX-3′ BfuAI: 5′-ACCTGCNNNNAGGTXXXXXXXXXXXXXXX-3′ BsaI: 5′-GGTCTCNAGGTXXXXXXXXXXXXXXX-3′ BsmAI: 5′-GTCTCNAGGTXXXXXXXXXXXXXXX-3′ BsmBI: 5′-CGTCTCNAGGTXXXXXXXXXXXXXXX-3′
316
Panavas et al.
BsmFI: 5′-GGGACNNNNNNNNNNAGGTXXXXXXXXXXXXXXX-3′ BtgZI: 5′-GCGATGNNNNNNNNNNAGGTXXXXXXXXXXXXXXX-3′ FokI: 5′-GGATGNNNNNNNNNAGGTXXXXXXXXXXXXXXX-3′ SfaNI: 5′GCATCNNNNNAGGTXXXXXXXXXXXXXXX-3′ Where N = any nucleotide and X = represents the sequence of the gene of interest; and underlined bold = the enzyme recognition sequence. 5. When performing the restriction digest, make sure not to use too much enzyme for an extended period of time. Overdigestion of the vector could result in inefficient cloning. 6. For the protein expression, use an E. coli expression strain freshly transformed with the expression plasmid (less than 2 weeks old). Using older cells entails the risk of significant reduction in protein expression as compared with expression using freshly transformed cells. 7. When inducing the culture for protein expression it is important to know that even with the SUMO fusion tag, some proteins are insoluble when expressed at 37°C. Lowering the temperature during the induction ensures a higher yield of soluble protein. Induction can be performed at 15°C overnight, in which case the cell density before induction must be 0.8 OD instead of 0.5. 8. When sonicating, it is critical not to overheat the lysate. If a large bacterial pellet is being sonicated, it is wise to use a metal container for the best heat transfer from the lysate to the ice water. 9. DNase I solution must be prepared freshly since freezing and thawing significantly decreases DNase I enzymatic activity, and the cell lysate might appear too viscous after centrifugation. 10. During column purification it is critical to have imidazole in the Lysis and Wash buffers to ensure a clean protein preparation. However, if the protein starts to elute during the second wash, replace the Wash buffer II with Wash buffer I. 11. SUMO protease is a very robust enzyme and it can cleave in a variety of buffers and additives. Fig. 20.4 and Table 20.1 summarize some tested conditions for the cleavage efficiency. 12. It is noteworthy that some proteins that remain soluble as fusions to SUMO may precipitate after cleavage with SUMO protease.
SUMO Fusion Technology for Protein Expression
317
References 1. Seeler, J. S., Bischof, O., Nacerddine, K., and Dejean, A. (2007) SUMO, the three Rs and cancer. Curr. Top. Microbiol. Immunol. 313, 49–71. 2. Meinecke, I., Cinski, A., Baier, A., Peters, M. A., Dankbar, B., Wille, A., Drynda, A., Mendoza, H., Gay, R. E., Hay, R. T., Ink, B., Gay, S., and Pap, T. (2007) Modification of nuclear PML protein by SUMO-1 regulates Fas-induced apoptosis in rheumatoid arthritis synovial fibroblasts. Proc. Natl. Acad. Sci. USA 104, 5073–5078. 3. Rajan, S., Plant, L. D., Rabin, M. L., Butler, M. H., and Goldstein, S. A. (2005) Sumoylation silences the plasma membrane leak K+ channel K2P1. Cell 121, 37–47. 4. Martin, S., Nishimune, A., Mellor, J. R., and Henley, J. M. (2007) SUMOylation regulates kainate-receptor-mediated synaptic transmission. Nature 447, 321–325. 5. Mabb, A. M., Wuerzberger-Davis, S. M., and Miyamoto, S. (2006) PIASy mediates NEMO sumoylation and NF-kappaB activation in response to genotoxic stress. Nat. Cell Biol. 8, 986–993. 6. Li, S. J. and Hochstrasser, M. (1999) A new protease required for cell-cycle progression in yeast. Nature 398, 246–251. 7. Malakhov, M. P., Mattern, M. R., Malakhova, O. A., Drinker, M., Weeks, S. D., and Butt, T. R. (2004) SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. J. Struct. Funct. Genomics 5, 75–86. 8. Marblestone, J. G., Edavettal, S. C., Lim, Y., Lim, P., Zuo, X., and Butt, T. R. (2006) Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO. Protein Sci. 15, 182–189. 9. Butt, T. R., Edavettal, S. C., Hall, J. P., and Mattern, M. R. (2005) SUMO fusion technology for difficult-to-express proteins. Protein Expr. Purif. 43, 1–9. 10. Zuo, X., Mattern, M. R., Tan, R., Li, S., Hall, J., Sterner, D. E., Shoo, J., Tran, H., Lim, P., Sarafianos, S. G., Kazi, L., NavasMartin, S., Weiss, S. R., and Butt, T. R. (2005) Enhanced expression and purifica-
11.
12.
13.
14.
15.
16.
17.
tion of membrane proteins by SUMO fusion in Escherichia coli. J. Struct. Funct. Genomics 6, 103–111. Zuo, X., Mattern, M. R., Tan, R., Li, S., Hall, J., Sterner, D. E., Shoo, J., Tran, H., Lim, P., Sarafianos, S. G., Kazi, L., NavasMartin, S., Weiss, S. R., and Butt, T. R. (2005) Expression and purification of SARS coronavirus proteins using SUMO-fusions. Protein Expr. Purif. 42, 100–110. Guzzo, C. M. and Yang, D. C. (2007) Systematic analysis of fusion and affinity tags using human aspartyl-tRNA synthetase expressed in E. coli. Protein Expr. Purif. 54, 166–175. Dominy, J. E., Jr., Simmons, C. R., Hirschberger, L. L., Hwang, J., Coloso, R. M., and Stipanuk, M. H. (2007) Discovery and characterization of a second mammalian thiol dioxygenase, cysteamine dioxygenase. J. Biol. Chem. 282, 25189–25198. Hughes, R. S., Dowd, P. F., Hector, R. E., Riedmuller, S. B., Bartolett, S., Mertens, J. A., Qureshi, N., Liu, S., Bischoff, K. M., Li, X., Jackson Jr., J. S., Sterner, D., Panavas, T., Rich, J. O., Farrelly, P. J., Butt, T., and Cotta, M. A. (2007) Cost-Effective HighThroughput Fully Automated Construction of a Multiplex Library of Mutagenized Open Reading Frames for an Insecticidal Peptide Using a Plasmid-Based Functional Proteomic Robotic Workcell with Improved Vacuum System. J. Assoc. Lab. Autom. 12, 202–212. Peroutka, R., Elshourbagy, J., N., Piech, T., and Butt, T.R. (2008) Enhanced protein expression in mammalian cells using engineered SUMO fusion: Secreted Phospholipase A2. Protein Sci. 17, 1586–1595. Liu, L., Spurrier, J., Butt, T. R., Strickler, J.E. (2008) Enhanced protein expression in the baculovirus/insect cell system using engineered SUMO fusions. Protein Expr. Purif. Epub ahead of print 5 Aug 2008. Mossessova, E., and Lima, C. D. (2000) Ulp1-SUMO crystal structure and genetic analysis reveal conserved interactions and a regulatory element essential for cell growth in yeast. Mol. Cell 5, 865–876.
INDEX A Acetylation................. .................................................29 Adenovirus............................................................... 13, 285 Affinity tags biotinylation peptide ................................................. 36 FLAG -SUMO............ ................................................. 116 GST, -E2-25K............ ...............................................206f -Gam1................. .................................... 295f, 296f -MBD1................................................................ 212 -RanBP2............................................................ 189 -SENP1......................... .................................... 249 -SUMO................... ............................................ 76 -Ulp1................... ...............................................52f His, -Aos1................... ............................... 52f, 188, 193 -Gam1................... ............................................ 297 -MBD1.............................................................212f -PCNA................... ............................................. 93 -SENP2................... .................................. 231, 275 -SIM................... .......................... 107, 113, 115, 121 -SUMO................... ................. 20f, 34, 57, 89, 126, 173f, 233 C-terminal tag................... ...............................227f expression levels in yeast................... .............101 fusions to YFP and ECFP................... .........260f stable transfection in cell lines........................20f use for recombinant protein expression................... ...................... 306f -SUMO-PLA2................... ..................................277 -SUMO-RanBP2................... .........................176f -SUMO-Ulp1................... ................................. 177f -Uba2 ................................... 52f, 171, 188, 192, 193 -Ubc9.............................................................52f, 172 use under denaturing conditions................... 20f, 34, 81f MBP, -MBD1............................................................... 212f problems using tags................... .................................188 3-Amino-triazole (3-AT)................... .............108, 109, 111 Apoptosis................... ....................................... 289, 298, 303 Aprotinin, see Protease inhibitors Apyrase................... ..................................................245, 249
Arginine conversion to proline................... .................................29 isotope-labeled................... ..................................20f, 25f stock solution................................................................22 Aos1................... ...............................................................5, 6 purification, see SUMO activating enzyme AP21967, see Rapamycin analog AXAM2, see SENP2
B Biotinylation peptide, see Affinity tags Benzamidine, see Protease inhibitors Bradford reagent, see Protein concentration measurements BsaI............................ .................................................... 315 Budding yeast, see Saccharomyces cerevisiae
C C-terminal hydrolase, see SUMO proteases C18 resin.........................................................23, 27, 37, 41 cDNA library.............................................53, 110, 118, 229 CFP............................ ............................................ 250, 265 excitation and emission ....................................242, 245, 249, 257, 262, 270 properties.......................................................... 250, 265 -RanGAP1....................................................... 257, 259 -SUMO...................................................................242f Chemical shift, see NMR experiments CMV promoter............................ .................................... 24 Complete™, see Protease inhibitors Contaminants................................................................... 29 Contrast2, see Mass spectrometry software Coomassie blue staining solution ............................ 53, 204 CtBP................................................................................... 8 Cyan fluorescent protein, see CFP Cyanogen bromide cleavage .......................................... 127 Cytokinesis................................................................. 12, 83
D Daxx............................ ............................................... 10, 12 Denaturing conditions, see Lysis Desalting columns.................................................... 53, 170 Directional cloning......................................................... 308 DNase I...................................................169, 229, 307, 316
319
PROTOCOLS 320 SUMO Index Doxycycline............................ .........................287, 294, 299 DTASelect2, see Mass spectrometry software
E E1, see SUMO activating enzyme E2, see SUMO conjugating enzyme E2-25K............................ .............................................. 202 purification............................ ..................................205f purification of the sumoylated form........................207f in vitro sumoylation.................................................206f E3, see SUMO ligases ECFP, see CFP Endopeptidase, see Lys-C endoprotease Escherichia coli, lysis, native, BugBuster™................................................... 126 emulsion flex..................................192, 194, 195 freeze-thaw............................ ...... 193, 205, 246 lysozyme............................ ............................. 56 sonication............................ . 135, 172, 217, 258, 298, 300, 310 sonication/lysozyme............................ ......... 232 denaturing, urea............................ ................................... 125 preparation of competent cells.................................213f transformation......................................... 216, 220, 308f use for production of SUMO-modified target proteins, see Sumoylation in E. coli
F Felix, see NMR software FK506............................ ................................................ 163 FKBP, see Rapamycin binding proteins Fluorescence resonance energy transfer, see FRET 5-Fluoroorotic acid (5-FOA)............................ .....101, 108, 111f FPLC............................ ..........................169, 204, 229, 244 FRB, see Rapamycin binding proteins FRET............................ ....................................... 241f, 253f use for desumoylation assays, see SUMO protease assays use for sumoylation assays, see Sumoylation assays Fub2............................ ....................................................... 5
G Gam1............................ .......................................... 13, 285f stable inducible expression............................ ... 287, 294 transient expression ................................................293f purification, as GST-tagged protein ............................ 294f, 299f as His-tagged protein ........................................ 297 Gel filtration.............. ............... 53, 169, 189, 207, 229, 245 Genome Stability................................................................ 10f
Glu-C protease...................................................................47 Glutathione......................... .........................57, 190, 195, 289 effect on Ulp1 activity............................................... 313 Glutathione S Transferase, see Affinity tags Glutathione Sepharose............................ ... 53, 56, 195, 203, 213, 289 GST, see Affinity tags Gradient gels............................ ........................................ 30
H HADDOCK, see NMR experiments HDACs.............................................................5, 8, 10, 285 Heat shock............................ ........................................... 13 Heterodimerization by rapamycin, see Rapamycin High-throughput analysis, FRET assays............................ .........241, 253, 256, 267 reporter-based assays............................ ........... 269f, 280 His-tag, see Affinity tags Histone deacetylases, see HDACs HPLC............................ ......................... 23, 37, 41, 46, 127 HSF1............................ ................................................... 12 HSQC, see NMR experiments Hus5............................ ...................................................... 5 Hydrolase, see SUMO proteases
I IA, see Protease inhibitors ICAT............................ .................................................... 28 IκBα................................................................................. 12 IMAC, see Ni-NTA affinity chromatography Imidazole, stock solution............................ ......................... 86, 256 use............................ 22, 38, 57, 89, 101, 124, 169, 189f, 229, 256, 289, 305, 307, 312, 316 effect on Ulp1 activity............................................... 315 Immobilized metal affinity chromatography, see Ni-NTA affinity chromatography Immunofluorescence microscopy.................................... 160 In vitro expression cloning, see IVEC Inclusion bodies............................ ......................... 310, 312 Insolubility of proteins............................ ........221, 310, 316 International Protein Index (IPI)............................ ......... 28 Iodoacetamide, see Protease inhibitors Ion trap, see Mass spectrometry instruments IPTG, influence on protein expression............................ .... 220 stock solution.. ...........................................52, 124, 169, 189, 203, 213, 229, 244, 256, 289, 307 use.............................................. 54, 126, 171, 192, 205, 217, 232, 246, 258, 297, 309 Isoelectric point, influence of sumoylation........................................... 209 Isopropyl β-D-1-thiogalactopyranoside, see IPTG Isotope labeling, see SILAC
SUMO PROTOCOLS 321 Index iTRAQ............................................................................. 28 IVEC..............................................................................52f
K Keratin............................................................................. 29 Kinetic assays, SUMO conjugation, see Sumoylation SUMO deconjugation, see SUMO Proteases Kinetic parameters, calculation............................ ....................178, 185, 235, 238, 275
L Leupeptin, see Protease inhibitors Luciferase assay............................ ......................... 143, 148f Lys-C endoprotease........................................23, 27, 37, 40 Lysine, isotope-labeled.................................................... 22, 30f stock solution.......................... ................................... 22 Lysis, of bacterial cells, see Escherichia coli of mammalian cells, denaturing, guanidine........................................................... 26f SDS buffer.......................... ........................... 72 native................................................... 145, 159, 292f of yeast cells, see Saccharomyces cerevisiae Lysozyme, stock solution.......................... ........................... 52, 244 use...................................................... 56, 169, 198, 205, 229, 246
M Mascot, see Mass spectrometry software Mass spectrometry.......................... ......................... 20f, 33f comparison to the two-hybrid system.......................117 instruments.......................... ................................ 37, 45 software and algorithms, Contrast2.......................... ............................. 37, 43 DTASelect2.......................... ......................... 37, 43 Mascot.......................... ............................23, 28, 45 MSQuant....................................................... 23, 28 Pep_probe.......................... .................................. 45 RawXtract............................................................ 37 SEQUEST .......................... ......................... 37, 43 SpectrumMill....................................................... 23 MBD1.......................... ................................................. 212 purification of the sumoylated form........................ 212f sumoylation in E. coli.......................... ..................... 212 Meiosis.......................... ............................................ 6, 11 Methylation.......................... ........................................... 29 Mms21.......................... ........................................ 5, 8, 11 Mobility shift by sumoylation, see Sumoylation MSQuant, see Mass spectrometry software
MudPIT..........................................................................35f Multidimensional protein identification technology, see MudPIT
N N-ethylmaleimide, see Protease inhibitors NEM, see Protease inhibitors Nfi1, see Siz2 NFκB............................................................................... 12 Nib1, see Ulp1 Ni-NTA affinity chromatography........................... 34f, 45f, 86f, 126f, 213f, 233f, 265f, 273f, 291f, 307f Ni-NTA resin, capacity.................................................................45f, 101 NMR.......................... ..................................................122f assignment.......................... ..................................... 132 chemical shift, index (CSI).......................... .............................133f sensitivity.................................................... 131, 136 connectivity.......................... .................................... 132 exchange rates.......................... ...............................130f experiments, HADDOCK.......................... ........................... 132 HSQC.......................... ......................125, 128, 134 NOESY.......................... ......................125, 131, 132 TALOS.............................................................. 134 TOCSY.......................... .......................... 125, 130f TROSY...................................................... 125, 128 software, Felix.......................... ......................................... 129 NMRView.......................... ............................... 129 spectrometer............................................................. 125 tubes.......................... ...................................... 125, 134 NMRView, see NMR software NOESY, see NMR experiments Nse2, see Mms21 Nuclear Magnetic Resonance, see NMR Nup358, see RanBP2
O Orbitrap, see Mass spectrometry instruments Oxidation of proteins..................................................... 185 Oxidative stress................................................................ 13
P p53..................................................................................65f SUMO fusion to the C-terminal domain................174f Pc2........................................................................... 5, 8, 12 PCNA.......................... .......................................... 11, 83f purification.......................... ..................................... 175f Pep_probe, see Mass spectrometry software Pepstatin, see Protease inhibitors Phenylmethylsulfonyl fluoride, see Protease inhibitors
PROTOCOLS 322 SUMO Index Phosphorylation................................................... 7, 12, 29 PIAS proteins.......................... .........................5, 8, 10, 12 PLA2.............................................................................270f substrate....................................................270, 272, 279 Pli1..................................................................................5 PML.......................... .................................10, 12, 202, 285 PMSF, see Protease inhibitors Pmt3, see SUMO Poly-SUMO chains, see SUMO chains Ponceau staining.......................... ..........................192, 195, 288, 292, 298 Protease inhibitors, aprotinin.......................... ......189f, 203f, 244f, 287, 289 benzamidine............................................................. 256 Complete™.......................... ............................. 156, 256 iodoacetamide (IA).......................... .. 23, 27, 37, 40, 46, 272, 278f, 279 leupeptin.......................... ............................. 189f, 203f, 244f, 287, 289 N-ethylmaleimide (NEM).................................45, 143, 150, 272, 276f, 279f pepstatin.......................... ..................... 189f, 203f, 244f phenylmethylsulfonyl fluoride (PMSF)...........124, 169, 203, 229, 256, 287, 289, 307 Protein assay reagent, see Protein concentration measurements Protein concentration measurements comparison to a standard.......................... 179, 198, 298 Bradford reagent.......................... ................53, 57, 170, 172, 192, 194f, 276, 291, 296 fluorescent proteins.................................................258f SYPRO-Ruby staining.......................... .................. 236 Protein assay reagent see Bradford reagent Proteomics.......................... ..................................... 19f, 33f
Q Quantification of Western blot signals ............. 75, 98, 197f Quantitative proteomics, see Proteomics
R Rapamycin, analog AP21967.......................... ................... 154f, 163 binding proteins, FK506 binding protein (FKBP)........................ 154f FKBP-rapamycin-associated protein (FRB) ........154f induced heterodimerization.......................... ..........153f Rabbit reticulocyte lysate.......................... ....................... 52 Rad31.......................... ....................................................5 Rad52.......................... ..................................................11 RanBP2.......................... .......................5, 8, 168, 202, 209 purification................................................... 176f, 195f autosumoylation....................................................... 198 RanGAP1.............................................................. 154, 202 in vitro sumoylation........................................ 234, 259 use in desumoylation assays.......................... .........259f
RawXtract, see Mass spectrometry Reprosil............................................................................ 23 Retroviral infection.......................... ......286, 287, 293f, 299 Rfp1................................................................................. 12 RNF4............................................................................... 12 RSUME.......................... ............................................ 5, 8
S Saccharomyces cerevisiae.......................... ..................5, 47, 81 gene replacement.......................... ..........................101 lysis methods.................................................38, 45, 88 transformation.......................... .......................... 86f, 99 Saccharomyces genome database, see SGD Sae1, see Aos1 Sae2, see Uba2 SBM, see SUMO interaction motif Schizosaccharomyces pombe................................................... 5 SCX resin.......................... ................................. 34, 37, 41f SENPs, see SUMO proteases SENP1.......................... ...................... 5, 9, 226f, 255, 271 purification, see SUMO proteases SENP2.......................... ...................... 5, 9, 226f, 255, 271 purification, see SUMO proteases SENP3.......................... ...................................... 5, 9, 255 SENP5.......................... .............................. 5, 9, 226f, 255 SENP6.......................... ............................... 5, 9, 228, 255 SENP7.......................... ...................................... 5, 9, 255 Septins.......................... ............................................ 12, 82f SGD..............................................................................43 Sgs1...............................................................................11 Shigemi tube, see NMR tubes SILAC.......................... ..................................................19f Silica capillary.......................... ....................23, 28, 37, 40f SIM, see SUMO interaction motif Siz1.....................................................................5, 8, 12, 82 purification.......................... ...............................177f Siz2................................................................................ 5, 8 Size shift by sumoylation, see Sumoylation Slx5.................................................................................. 12 Slx8.................................................................................. 12 Smt3, see SUMO SMT3IP1, see SENP3 SMT3IP2, see SENP2 Smt4, see Ulp2 SP-RING.......................... ........................................ 8, 168 SpectrumMill, see Mass spectrometry software Srs2.................................................................................. 83 SSP1, see SENP6 SSP3, see SENP3 Stable isotope labeling, see SILAC STAT1.......................... ..................................................65f Streptavidin resin............................................36, 38, 43, 46 SUMO, acceptor sites.......................... .. 29, 35f, 47, 83, 118, 144 mapping by mass spectrometry...........................43f
SUMO PROTOCOLS 323 Index activating enzyme.......................... .......................... 5, 6 purification.......................... ............. 54f, 171f, 191f AMC fusions.......................... ................................. 270 attachment sites, see acceptor sites chains.............................................. 6, 7, 9, 93, 209, 255 preparation......................................................... 259 conjugating enzyme, see Ubc9 folding.....................................................................303f fusion technology, see SUMO linear fusions interaction motif (SIM).......................... .. 11f, 107, 202 identification by NMR.......................... ...........122f mutants.......................... .................................... 115 orientation.......................... ..............................123 purification............................................... 124, 126 isoforms.......................... ................... 4, 5, 21, 118, 149, 168, 226, 271 isopeptidases, see SUMO proteases labeling with fluorescent dyes.......................... .......174 ligases....................................................................... 5, 8 linear fusions.......................... ......................... 147f, 151 use for enhanced protein production.................303f maturation, see SUMO proteases orthologs, see isoforms paralogs, see isoforms precursor, purification.......................... ............................232f processing enzymes, see SUMO proteases proteases.......................... ........ 5, 9, 28, 226, 253f, 272 activity in extracts.......................... ............. 69, 150 in vitro assays, gel-based C-terminal hydrolase assays.......................... ............. 234f, 256 Effects of NEM and iodoacetamide.......................... .......278f FRET-based assays, isopeptidase assay..........................249f, 259f depolymerization assay.......................... 259f quantification of substrate cleavage.......................... ......... 260f, 265 steady-state kinetics, .............................. 236 reporter-based C-terminal hydrolase assays.......................... ...................... 256 model substrates................................................227f overexpression.......................... ...........116, 118, 150 purification of catalytic domains................................... 231f, 271 purification............................ 54f, 126, 173f, 194f, 233f stability..................................................................... 303 substrates, identification............................................... 19f, 34f, 51f, 63f, 81f target proteins, see SUMO substrates thioester.......................... ......................................... 6, 7 preparation........................................................178f truncated, see SUMOΔGG
SUMO-4.......................... ........................................ 4f, 226 SUMOΔGG.......................................................... 114–116 SUMOstar.......................... ........................................... 304 Sumoylation, consensus motif..........................................7, 54, 82, 83, 118, 149, 168, 203 in E. coli.......................... ....................................211f in vitro assays, single turnover...................................................178f pH titration.......................................................179f E3-dependent.......................... .......................... 197 E3-independent.......................... ....................... 197 effect of Gam1.......................... ......................... 299 FRET-based conjugation assay..........................245f mobility shift.......................... .................... 75, 97f, 116 preparative.......................... ........................... 203f, 242f SuPr-2, see SENP1 SUSP1, see SENP6 Synaptonemal complex.......................... .......................... 11
T TALOS, see NMR experiments Tags, see Affinity tags TEV protease................................................ 203, 205f, 312 Thrombin.......................... ....................................169, 173, 229, 232, 234 TOCSY, see NMR experiments Topoisomerase II.......................... ................................... 11 Transcription, activation.......................... ............................. 13, 289 regulation by SUMO.......................... .............. 10, 141f reporter system......................................................... 148 repression.......................... ......................................... 10 Transfection, calcium phosphate method.......................... ............ 290 efficiency.......................... ................................. 69, 298f Lipofectamine/PLUS method..........................71f, 159f polyethyleneimine (PEI) method ..............................................70f Transformation, of E. coli, see Escherichia coli of yeast cells, see Saccharomyces cerevisiae TROSY, see NMR experiments Trypsin.......................... ..............................21, 23f, 27f, 34, 37, 40, 44, 46f Two hybrid system, see Yeast two hybrid system
U Uba2.......................... ................................................... 5, 6 purification, see SUMO activating enzyme Ubc9.......................... ............................................... 5, 6f, 9 fusion-dependent sumoylation, see UFDS mutant K153R, ....................................................... 172 purification, .. . . . ..................................... 54f, 172f, 193f ubc9ts, ......................................................................... 11
PROTOCOLS 324 SUMO Index Ubiquitin, ........... ....................................................... 3, 12 UFDS, ................ ..........................................................63f Ull1, see Siz1 Ulp1.................................................................5, 9, 59, 254f catalytic domain............................................... 169, 271 enzymatic properties.......................... .........60, 313, 315 purification.......................... .....................................54f ulp1ts................................................................. 113, 118 use for cleavage of fusion proteins ..........175f, 184, 233, 304f, 314f Ulp2................................................. 5, 9, 11, 113, 118, 254f
W Western blotting, discontinuous buffer system..................................... 100 of free SUMO............................................................ 30 of large SUMO conjugates.......................... ........ 77, 98 quantification of blot signals ..................... 75, 100, 184f semi-dry.......................... .................................... 73f, 87
stripping and reprobing of blots................................. 75 tank.......................................................................... 292
Y Yellow fluorescent protein, see YFP Yeast, see Saccharomyces cerevisiae or Schizosaccharomyces pombe Yeast two-hybrid system.......................... .....................107f comparison to mass spectrometry.......................... .. 117 vectors.......................... ............................................ 109 YFP, concentration measurement by UV absorption........258f emission.......................... ..........................247, 262, 268 properties.......................... ....................................... 265 -RanGAP1.......................... ...................................242f -SUMO.......................... ......................................... 256
Z Zip3.......................... ............................................... 5, 8, 11